U.S. patent application number 10/422523 was filed with the patent office on 2004-01-01 for synthetic ligation reassembly in directed evolution.
Invention is credited to Short, Jay M..
Application Number | 20040002103 10/422523 |
Document ID | / |
Family ID | 23300064 |
Filed Date | 2004-01-01 |
United States Patent
Application |
20040002103 |
Kind Code |
A1 |
Short, Jay M. |
January 1, 2004 |
Synthetic ligation reassembly in directed evolution
Abstract
Harvesting the full richness of biodiversity is instantly
recognized by Diversa Corporation as a powerful means to access
both novel molecules having direct commercial utility as well as
molecular templates that could be retooled to acquire commercial
utility. A directed evolution process for rapid and facilitated
production from a progenitor polynucleotide template, of a library
of mutagenized progeny polynucleotides wherein each of the 20
naturally encoded amino acids is encoded at each original codon
position. This method, termed site-saturation mutagenesis, or
simply saturation mutagenesis, is preferably based on the use of
the degenerate N,N,G/T sequence. Also, a method of
non-stochastically producing a library of chimeric nucleic acid
molecules having an overall assembly order that is chosen by
design. Accordingly, a set of progenitor templates, such as genes
(e.g. a family of esterase genes) or genes pathways (e.g. encoding
antibiotics) can be shuffled to generate a sizable library of
distinct progeny polynucleotide molecules (e.g. 10.sup.100) and
correspondingly encoded polypeptides. Screening of these
polynucleotide libraries enables the identification of a desirable
molecular species that has a desirable property, such as a specific
enzymatic activity serviceable for a commercial application, or a
novel antibiotic. Also, a method of retooling genes and gene
pathways by the introduction of regulatory sequences, such as
promoters, that are operable in an intended host, thus conferring
operability to a novel gene pathway when it is introduced into an
intended host. For example a novel man-made gene pathway, generated
based on microbially-derived progenitor templates, that is operable
in a plant cell.
Inventors: |
Short, Jay M.; (Rancho Santa
Fe, CA) |
Correspondence
Address: |
HALE AND DORR LLP
300 PARK AVENUE
NEW YORK
NY
10022
US
|
Family ID: |
23300064 |
Appl. No.: |
10/422523 |
Filed: |
April 24, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10422523 |
Apr 24, 2003 |
|
|
|
09594459 |
Jun 14, 2000 |
|
|
|
6605449 |
|
|
|
|
09594459 |
Jun 14, 2000 |
|
|
|
09332835 |
Jun 14, 1999 |
|
|
|
6537776 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/6.1; 435/6.16; 435/91.2; 536/23.1 |
Current CPC
Class: |
A61K 2039/53 20130101;
C12N 15/1027 20130101; C12N 15/102 20130101; C12Y 308/01002
20130101; C07K 14/445 20130101; C12N 9/14 20130101; C12N 15/1034
20130101; C12N 15/1058 20130101; A61P 33/06 20180101; A61K 39/00
20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/23.1 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34 |
Claims
What is claimed is:
1. A method of non-stochastically producing a library of chimeric
nucleic acid molecules having an overall assembly order that is
non-random comprising: (a) non-randomly generating a plurality of
nucleic acid building blocks having mutually compatible ligatable
ends; and (b) assembling the nucleic acid building blocks, such
that a designed overall assembly order is achieved; whereby a set
of progenitor templates can be shuffled to generate a library of
progeny polynucleotide molecules and correspondingly encoded
polypeptides, and whereby screening of the progeny polynucleotide
library provides a means to identify a desirable species that have
a desirable property.
2. A method of non-stochastically producing a library comprised of
a defined number of groupings comprised of one or more groupings of
chimeric nucleic acid molecules having an overall assembly order
that is chosen by design, said method comprised of: (a) generating
by design for each grouping a set of specific nucleic acid building
blocks having serviceable mutually compatible ligatable ends, and
(b) assembling these nucleic acid building blocks according to said
groupings, such that a designed overall assembly order is achieved;
whereby a set of progenitor templates can be shuffled to generate a
library of progeny polynucleotide molecules and correspondingly
encoded polypeptides, and whereby the expression screening of the
progeny polynucleotide library provides a means to identify a
desirable species that has a desirable property.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of U.S.
application Ser. No. 09/332,835, filed on Jun. 14, 1999, which is
hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention relates to the field of protein engineering.
Specifically, this invention relates to a directed evolution method
for preparing a polynucleotide encoding a polypeptide. More
specifically, this invention relates to a method of using
mutagenesis to generate a novel polynucleotide encoding a novel
polypeptide, which novel polypeptide is itself an improved
biological molecule &/or contributes to the generation of
another improved biological molecule. More specifically still, this
invention relates to a method of performing both non-stochastic
polynucleotide chimerization and non-stochastic site-directed point
mutagenesis.
[0003] Thus, in one aspect, this invention relates to a method of
generating a progeny set of chimeric polynucleotide(s) by means
that are synthetic and non-stochastic, and where the design of the
progeny polynucleotide(s) is derived by analysis of a parental set
of polynucleotides &/or of the polypeptides correspondingly
encoded by the parental polynucleotides. In another aspect this
invention relates to a method of performing site-directed
mutagenesis using means that are exhaustive, systematic, and
non-stochastic.
[0004] Furthermore this invention relates to a step of selecting
from among a generated set of progeny molecules a subset comprised
of particularly desirable species, including by a process termed
end-selection, which subset may then be screened further. This
invention also relates to the step of screening a set of
polynucleotides for the production of a polypeptide &/or of
another expressed biological molecule having a useful property.
[0005] Novel biological molecules whose manufacture is taught by
this invention include genes, gene pathways, and any molecules
whose expression is affected thereby, including directly encoded
polypetides &/or any molecules affected by such polypeptides.
Said novel biological molecules include those that contain a
carbohydrate, a lipid, a nucleic acid, &/or a protein
component, and specific but non-limiting examples of these include
antibiotics, antibodies, enzymes, and steroidal and non-steroidal
hormones.
[0006] In a particular non-limiting aspect, the present invention
relates to enzymes, particularly to thermostable enzymes, and to
their generation by directed evolution. More particularly, the
present invention relates to thermostable enzymes which are stable
at high temperatures and which have improved activity at lower
temperatures.
BACKGROUND OF THE INVENTION
General Overview of the Problem to Be Solved
[0007] Brief Summary: It is instantly appreciated that harvesting
the full potential of nature's diversity can include both the step
of discovery and the step of optimizing what is discovered. For
example, the step of discovery allows one to mine biological
molecules that have commercial utility. It is instantly appreciated
that the ability to harvest the full richness of biodiversity, i.e.
to mine biological molecules from a wide range of environmental
conditions, is critical to the ability to discover novel molecules
adapted to funtion under a wide variety of conditions, including
extremes of conditions, such as may be found in a commercial
application.
[0008] However, it is also instantly appreciated that only
occassionally are there criteria for selection &/or survival in
nature that point in the exact direction of particular commercial
needs. Instead, it is often the case that a naturally occurring
molecule will require a certain amount of change--from fine tuning
to sweeping modification--in order to fulfill a particular unmet
commercial need. Thus, to meet certain commercial needs (e.g., a
need for a molecule that is fucntional under a specific set of
commercial processing conditions) it is sometimes advantageous to
experimentally modify a naturally expresed molecule to achieve
properties beyond what natural evolution has provided &/or is
likely to provide in the near future.
[0009] The approach, termed directed evolution, of experimentally
modifying a biological molecule towards a desirable property, can
be achieved by mutagenizing one or more parental molecular
templates and by identifying any desirable molecules among the
progeny molecules. Currently available technologies in directed
evolution include methods for achieving stochastic (i.e. random)
mutagenesis and methods for achieving non-stochastic (non-random)
mutagenesis. However, critical shortfalls in both types of methods
are identified in the instant disclosure.
[0010] In prelude, it is noteworthy that it may be argued
philosophically by some that all mutagenesis--if considered from an
objective point of view--is non-stochastic; and furthermore that
the entire universe is undergoing a process that--if considered
from an objective point of view--is non-stochastic. Whether this is
true is outside of the scope of the instant consideration.
Accordingly, as used herein, the terms "randomness", "uncertainty",
and "unpredictability" have subjective meanings, and the knowledge,
particularly the predictive knowledge, of the designer of an
experimental process is a determinant of whether the process is
stochastic or non-stochastic.
[0011] By way of illustration, stochastic or random mutagenesis is
exemplified by a situation in which a progenitor molecular template
is mutated (modified or changed) to yield a set of progeny
molecules having mutation(s) that are not predetermined. Thus, in
an in vitro stochastic mutagenesis reaction, for example, there is
not a particular predetermined product whose production is
intended; rather there is an uncertainty--hence
randomness--regarding the exact nature of the mutations achieved,
and thus also regarding the products generated. In contrast,
non-stochastic or non-random mutagenesis is exemplified by a
situation in which a progenitor molecular template is mutated
(modified or changed) to yield a progeny molecule having one or
more predetermined mutations. It is appreciated that the presence
of background products in some quantity is a reality in many
reactions where molecular processing occurs, and the presence of
these background products does not detract from the non-stochastic
nature of a mutagenesis process having a predetermined product.
[0012] Thus, as used herein, stochastic mutagenesis is manifested
in processes such as error-prone PCR and stochastic shuffling,
where the mutation(s) achieved are random or not predetermined. In
contrast, as used herein, non-stochastic mutagenesis is manifested
in instantly disclosed processes such as gene site-saturation
mutagenesis and synthetic ligation reassembly, where the exact
chemical structure(s) of the intended product(s) are
predetermined.
[0013] In brief, existing mutagenesis methods that are
non-stochastic have been serviceable in generating from one to only
a very small number of predetermined mutations per method
application, and thus produce per method application from one to
only a few progeny molecules that have predetermined molecular
structures. Moreover, the types of mutations currently available by
the application of these non-stochastic methods are also limited,
and thus so are the types of progeny mutant molecules.
[0014] In contrast, existing methods for mutagenesis that are
stochastic in nature have been serviceable for generating somewhat
larger numbers of mutations per method application--though in a
random fashion & usually with a large but unavoidable
contingency of undesirable background products. Thus, these
existing stochastic methods can produce per method application
larger numbers of progeny molecules, but that have undetermined
molecular structures. The types of mutations that can be achieved
by application of these current stochastic methods are also
limited, and thus so are the types of progeny mutant molecules.
[0015] It is instantly appreciated that there is a need for the
development of non-stochastic mutagenesis methods that:
[0016] 1) Can be used to generate large numbers of progeny
molecules that have predetermined molecular structures;
[0017] 2) Can be used to readily generate more types of
mutations;
[0018] 3) Can produce a correspondingly larger variety of progeny
mutant molecules;
[0019] 4) Produce decreased unwanted background products;
[0020] 5) Can be used in a manner that is exhaustive of all
possibilities; and
[0021] 6) Can produce progeny molecules in a systematic &
non-repetitive way.
[0022] The instant invention satisfies all of these needs.
[0023] Directed Evolution Supplements Natural Evolution: Natural
evolution has been a springboard for directed or experimental
evolution, serving both as a reservoir of methods to be mimicked
and of molecular templates to be mutagenized. It is appreciated
that, despite its intrinsic process-related limitations (in the
types of favored &/or allowed mutagenesis processes) and in its
speed, natural evolution has had the advantage of having been in
process for millions of years and throughout a wide diversity of
environments. Accordingly, natural evolution (molecular mutagenesis
and selection in nature) has resulted in the generation of a wealth
of biological compounds that have shown usefulness in certain
commercial applications.
[0024] However, it is instantly appreciated that many unmet
commercial needs are discordant with any evolutionary pressure
&/or direction that can be found in nature. Moreover, it is
often the case that when commercially useful mutations would
otherwise be favored at the molecular level in nature, natural
evolution often overrides the positive selection of such mutations,
e.g. when there is a concurrent detriment to an organism as a whole
(such as when a favorable mutation is accompanied by a detrimental
mutation). Additionally, natural evolution is often slow, and
favors fidelity in many types of replication. Additionally still,
natural evolution often favors a path paved mainly by consecutive
beneficial mutations while tending to avoid a plurality of
successive negative mutations, even though such negative mutations
may prove beneficial when combined, or may lead--through a
circuitous route--to final state that is beneficial.
[0025] Moreover, natural evolution advances through specific steps
(e.g. specific mutagenesis and selection processes), with avoidance
of less favored steps. For example, many nucleic acids do not reach
close enough proximity to each other in a operative environment to
undergo chimerization or incorporation or other types of transfers
from one species to another. Thus, e.g., when sexual intercourse
between 2 particular species is avoided in nature, the
chimerization of nucleic acids from these 2 species is likewise
unlikely, with parasites common to the two species serving as an
example of a very slow passageway for inter-molecular encounters
and exchanges of DNA. For another example, the generation of a
molecule causing self-toxicity or self-lethality or sexual
sterility is avoided in nature. For yet another example, the
propagation of a molecule having no particular immediate benefit to
an organism is prone to vanish in subsequent generations of the
organism. Furthermore, e.g., there is no selection pressure for
improving the performance of molecule under conditions other than
those to which it is exposed in its endogenous environment; e.g. a
cytoplasmic molecule is not likely to acquire functional features
extending beyond what is required of it in the cytoplasm.
Furthermore still, the propagation of a biological molecule is
susceptible to any global detrimental effects--whether caused by
itself or not--on its ecosystem. These and other characteristics
greatly limit the types of mutations that can be propagated in
nature.
[0026] On the other hand, directed (or experimental)
evolution--particularly as provided herein--can be performed much
more rapidly and can be directed in a more streamlined manner at
evolving a predetermined molecular property that is commercially
desirable where nature does not provide one &/or is not likely
to provide. Moreover, the directed evolution invention provided
herein can provide more wide-ranging possibilities in the types of
steps that can be used in mutagenesis and selection processes.
Accordingly, using templates harvested from nature, the instant
directed evolution invention provides more wide-ranging
possibilities in the types of progeny molecules that can be
generated and in the speed at which they can be generated than
often nature itself might be expected to in the same length of
time.
[0027] In a particular exemplification, the instantly disclosed
directed evolution methods can be applied iteratively to produce a
lineage of progeny molecules (e.g. comprising successive sets of
progeny molecules) that would not likely be propagated (i.e.,
generated &/or selected for) in nature, but that could lead to
the generation of a desirable downstream mutagenesis product that
is not achievable by natural evolution.
[0028] Previous Directed Evolution Methods are Suboptimal:
[0029] Mutagenesis has been attempted in the past on many
occasions, but by methods that are inadequate for the purpose of
this invention. For example, previously described non-stochastic
methods have been serviceable in the generation of only very small
sets of progeny molecules (comprised often of merely a solitary
progeny molecule). By way of illustration, a chimeric gene has been
made by joining 2 polynucleotide fragments using compatible sticky
ends generated by restriction enzyme(s), where each fragment is
derived from a separate progenitor (or parental) molecule. Another
example might be the mutagenesis of a single codon position (i.e.
to achieve a codon substitution, addition, or deletion) in a
parental polynucleotide to generate a single progeny polynucleotide
encoding for a single site-mutagenized polypeptide.
[0030] Previous non-stochastic approaches have only been
serviceable in the generation of but one to a few mutations per
method application. Thus, these previously described non-stochastic
methods thus fail to address one of the central goals of this
invention, namely the exhaustive and non-stochastic chimerization
of nucleic acids. Accordingly previous non-stochastic methods leave
untapped the vast majority of the possible point mutations,
chimerizations, and combinations thereof, which may lead to the
generation of highly desirable progeny molecules.
[0031] In contrast, stochastic methods have been used to achieve
larger numbers of point mutations and/or chimerizations than
non-stochastic methods; for this reason, stochastic methods have
comprised the predominant approach for generating a set of progeny
molecules that can be subjected to screening, and amongst which a
desirable molecular species might hopefully be found. However, a
major drawback of these approaches is that--because of their
stochastic nature--there is a randomness to the exact components in
each set of progeny molecules that is produced. Accordingly, the
experimentalist typically has little or no idea what exact progeny
molecular species are represented in a particular reaction vessel
prior to their generation. Thus, when a stochastic procedure is
repeated (e.g. in a continuation of a search for a desirable
progeny molecule), the re-generation and re-screening of previously
discarded undesirable molecular species becomes a labor-intensive
obstruction to progress, causing a circuitous--if not
circular--path to be taken. The drawbacks of such a highly
suboptimal path can be addressed by subjecting a stochastically
generated set of progeny molecules to a labor-incurring process,
such as sequencing, in order to identify their molecular
structures, but even this is an incomplete remedy.
[0032] Moreover, current stochastic approaches are highly
unsuitable for comprehensively or exhaustively generating all the
molecular species within a particular grouping of mutations, for
attributing functionality to specific structural groups in a
template molecule (e.g. a specific single amino acid position or a
sequence comprised of two or more amino acids positions), and for
categorizing and comparing specific grouping of mutations.
Accordingly, current stochastic approaches do not inherently enable
the systematic elimination of unwanted mutagenesis results, and
are, in sum, burdened by too many inherently shortcomings to be
optimal for directed evolution.
[0033] In a non-limiting aspect, the instant invention addresses
these problems by providing non-stochastic means for
comprehensively and exhaustively generating all possible point
mutations in a parental template. In another non-limiting aspect,
the instant invention further provides means for exhaustively
generating all possible chimerizations within a group of
chimerizations. Thus, the aforementioned problems are solved by the
instant invention.
[0034] Specific shortfalls in the technological landscape addressed
by this invention include:
[0035] 1) Site-directed mutagenesis technologies, such as sloppy or
low-fidelity PCR, are ineffective for systematically achieving at
each position (site) along a polypeptide sequence the full
(saturated) range of possible mutations (i.e. all possible amino
acid substitutions).
[0036] 2) There is no relatively easy systematic means for rapidly
analyzing the large amount of information that can be contained in
a molecular sequence and in the potentially colossal number or
progeny molecules that could be conceivably obtained by the
directed evolution of one or more molecular templates.
[0037] 3) There is no relatively easy systematic means for
providing comprehensive empirical information relating structure to
function for molecular positions.
[0038] 4) There is no easy systematic means for incorporating
internal controls, such as positive controls, for key steps in
certain mutagenesis (e.g. chimerization) procedures.
[0039] 5) There is no easy systematic means to select for a
specific group of progeny molecules, such as full-length chimeras,
from among smaller partial sequences.
[0040] An exceedingly large number of possibilities exist for the
purposeful and random combination of amino acids within a protein
to produce useful hybrid proteins and their corresponding
biological molecules encoding for these hybrid proteins, i.e., DNA,
RNA. Accordingly, there is a need to produce and screen a wide
variety of such hybrid proteins for a desirable utility,
particularly widely varying random proteins.
[0041] The complexity of an active sequence of a biological
macromolecule (e.g., polynucleotides, polypeptides, and molecules
that are comprised of both polynucleotide and polypeptide
sequences) has been called its information content ("IC"), which
has been defined as the resistance of the active protein to amino
acid sequence variation (calculated from the minimum number of
invariable amino acids (bits) required to describe a family of
related sequences with the same function). Proteins that are more
sensitive to random mutagenesis have a high information
content.
[0042] Molecular biology developments, such as molecular libraries,
have allowed the identification of quite a large number of variable
bases, and even provide ways to select functional sequences from
random libraries. In such libraries, most residues can be varied
(although typically not all at the same time) depending on
compensating changes in the context. Thus, while a 100 amino acid
protein can contain only 2,000 different mutations, 20.sup.100
sequence combinations are possible. Information density is the IC
per unit length of a sequence. Active sites of enzymes tend to have
a high information density. By contrast, flexible linkers of
information in enzymes have a low information density.
[0043] Current methods in widespread use for creating alternative
proteins in a library format are error-prone polymerase chain
reactions and cassette mutagenesis, in which the specific region to
be optimized is replaced with a synthetically mutagenized
oligonucleotide. In both cases, a substantial number of mutant
sites are generated around certain sites in the original
sequence.
[0044] Error-prone PCR uses low-fidelity polymerization conditions
to introduce a low level of point mutations randomly over a long
sequence. In a mixture of fragments of unknown sequence,
error-prone PCR can be used to mutagenize the mixture. The
published error-prone PCR protocols suffer from a low processivity
of the polymerase. Therefore, the protocol is unable to result in
the random mutagenesis of an average-sized gene. This inability
limits the practical application of error-prone PCR. Some computer
simulations have suggested that point mutagenesis alone may often
be too gradual to allow the large-scale block changes that are
required for continued and dramatic sequence evolution. Further,
the published error-prone PCR protocols do not allow for
amplification of DNA fragments greater than 0.5 to 1.0 kb, limiting
their practical application. In addition, repeated cycles of
error-prone PCR can lead to an accumulation of neutral mutations
with undesired results, such as affecting a protein's
immunogenicity but not its binding affinity.
[0045] In oligonucleotide-directed mutagenesis, a short sequence is
replaced with a synthetically mutagenized oligonucleotide. This
approach does not generate combinations of distant mutations and is
thus not combinatorial. The limited library size relative to the
vast sequence length means that many rounds of selection are
unavoidable for protein optimization. Mutagenesis with synthetic
oligonucleotides requires sequencing of individual clones after
each selection round followed by grouping them into families,
arbitrarily choosing a single family, and reducing it to a
consensus motif. Such motif is re-synthesized and reinserted into a
single gene followed by additional selection. This step process
constitutes a statistical bottleneck, is labor intensive, and is
not practical for many rounds of mutagenesis.
[0046] Error-prone PCR and oligonucleotide-directed mutagenesis are
thus useful for single cycles of sequence fine tuning, but rapidly
become too limiting when they are applied for multiple cycles.
[0047] Another limitation of error-prone PCR is that the rate of
down-mutations grows with the information content of the sequence.
As the information content, library size, and mutagenesis rate
increase, the balance of down-mutations to up-mutations will
statistically prevent the selection of further improvements
(statistical ceiling).
[0048] In cassette mutagenesis, a sequence block of a single
template is typically replaced by a (partially) randomized
sequence. Therefore, the maximum information content that can be
obtained is statistically limited by the number of random sequences
(i.e., library size). This eliminates other sequence families which
are not currently best, but which may have greater long term
potential.
[0049] Also, mutagenesis with synthetic oligonucleotides requires
sequencing of individual clones after each selection round. Thus,
such an approach is tedious and impractical for many rounds of
mutagenesis.
[0050] Thus, error-prone PCR and cassette mutagenesis are best
suited, and have been widely used, for fine-tuning areas of
comparatively low information content. One apparent exception is
the selection of an RNA ligase ribozyme from a random library using
many rounds of amplification by error-prone PCR and selection.
[0051] In nature, the evolution of most organisms occurs by natural
selection and sexual reproduction. Sexual reproduction ensures
mixing and combining of the genes in the offspring of the selected
individuals. During meiosis, homologous chromosomes from the
parents line up with one another and cross-over part way along
their length, thus randomly swapping genetic material. Such
swapping or shuffling of the DNA allows organisms to evolve more
rapidly.
[0052] In recombination, because the inserted sequences were of
proven utility in a homologous environment, the inserted sequences
are likely to still have substantial information content once they
are inserted into the new sequence.
[0053] Theoretically there are 2,000 different single mutants of a
100 amino acid protein. However, a protein of 100 amino acids has
20.sup.100 possible sequence combinations, a number which is too
large to exhaustively explore by conventional methods. It would be
advantageous to develop a system which would allow generation and
screening of all of these possible combination mutations.
[0054] Some workers in the art have utilized an in vivo site
specific recombination system to generate hybrids of combine light
chain antibody genes with heavy chain antibody genes for expression
in a phage system. However, their system relies on specific sites
of recombination and is limited accordingly. Simultaneous
mutagenesis of antibody CDR regions in single chain antibodies
(scFv) by overlapping extension and PCR have been reported.
[0055] Others have described a method for generating a large
population of multiple hybrids using random in vivo recombination.
This method requires the recombination of two different libraries
of plasmids, each library having a different selectable marker. The
method is limited to a finite number of recombinations equal to the
number of selectable markers existing, and produces a concomitant
linear increase in the number of marker genes linked to the
selected sequence(s).
[0056] In vivo recombination between two homologous, but truncated,
insect-toxin genes on a plasmid has been reported as a method of
producing a hybrid gene. The in vivo recombination of substantially
mismatched DNA sequences in a host cell having defective mismatch
repair enzymes, resulting in hybrid molecule formation has been
reported.
SUMMARY OF THE INVENTION
[0057] This invention relates generally to the field of nucleic
acid engineering and correspondingly encoded recombinant protein
engineering. More particularly, the invention relates to the
directed evolution of nucleic acids and screening of clones
containing the evolved nucleic acids for resultant activity(ies) of
interest, such nucleic acid activity(ies) &/or specified
protein, particularly enzyme, activity(ies) of interest.
[0058] Mutagenized molecules provided by this invention may have
chimeric molecules and molecules with point mutations, including
biological molecules that contain a carbohydrate, a lipid, a
nucleic acid, &/or a protein component, and specific but
non-limiting examples of these include antibiotics, antibodies,
enzymes, and steroidal and non-steroidal hormones.
[0059] This invention relates generally to a method of: 1)
preparing a progeny generation of molecule(s) (including a molecule
that is comprised of a polynucleotide sequence, a molecule that is
comprised of a polypeptide sequence, and a molecule that is
comprised in part of a polynucleotide sequence and in part of a
polypeptide sequence), that is mutagenized to achieve at least one
point mutation, addition, deletion, &/or chimerization, from
one or more ancestral or parental generation template(s); 2)
screening the progeny generation molecule(s)--preferably using a
high throughput method--for at least one property of interest (such
as an improvement in an enzyme activity or an increase in stability
or a novel chemotherapeutic effect); 3) optionally obtaining
&/or cataloguing structural &/or and functional information
regarding the parental &/or progeny generation molecules; and
4) optionally repeating any of steps 1) to 3).
[0060] In a preferred embodiment, there is generated (e.g. from a
parent polynucleotide template)--in what is termed "codon
site-saturation mutagenesis"--a progeny generation of
polynucleotides, each having at least one set of up to three
contiguous point mutations (i.e. different bases comprising a new
codon), such that every codon (or every family of degenerate codons
encoding the same amino acid) is represented at each codon
position. Corresponding to--and encoded by--this progeny generation
of polynucleotides, there is also generated a set of progeny
polypeptides, each having at least one single amino acid point
mutation. In a preferred aspect, there is generated--in what is
termed "amino acid site-saturation mutagenesis"--one such mutant
polypeptide for each of the 19 naturally encoded
polypeptide-forming alpha-amino acid substitutions at each and
every amino acid position along the polypeptide. This yields--for
each and every amino acid position along the parental
polypeptide--a total of 20 distinct progeny polypeptides including
the original amino acid, or potentially more than 21 distinct
progeny polypeptides if additional amino acids are used either
instead of or in addition to the 20 naturally encoded amino acids
Thus, in another aspect, this approach is also serviceable for
generating mutants containing--in addition to &/or in
combination with the 20 naturally encoded polypeptide-forming
alpha-amino acids--other rare &/or not naturally-encoded amino
acids and amino acid derivatives. In yet another aspect, this
approach is also serviceable for generating mutants by the use
of--in addition to &/or in combination with natural or
unaltered codon recognition systems of suitable hosts--altered,
mutagenized, &/or designer codon recognition systems (such as
in a host cell with one or more altered tRNA molecules).
[0061] In yet another aspect, this invention relates to
recombination and more specifically to a method for preparing
polynucleotides encoding a polypeptide by a method of in vivo
re-assortment of polynucleotide sequences containing regions of
partial homology, assembling the polynucleotides to form at least
one polynucleotide and screening the polynucleotides for the
production of polypeptide(s) having a useful property.
[0062] In yet another preferred embodiment, this invention is
serviceable for analyzing and cataloguing--with respect to any
molecular property (e.g. an enzymatic activity) or combination of
properties allowed by current technology--the effects of any
mutational change achieved (including particularly saturation
mutagenesis). Thus, a comprehensive method is provided for
determining the effect of changing each amino acid in a parental
polypeptide into each of at least 19 possible substitutions. This
allows each amino acid in a parental polypeptide to be
characterized and catalogued according to its spectrum of potential
effects on a measurable property of the polypeptide.
[0063] In another aspect, the method of the present invention
utilizes the natural property of cells to recombine molecules
and/or to mediate reductive processes that reduce the complexity of
sequences and extent of repeated or consecutive sequences
possessing regions of homology.
[0064] It is an object of the present invention to provide a method
for generating hybrid polynucleotides encoding biologically active
hybrid polypeptides with enhanced activities. In accomplishing
these and other objects, there has been provided, in accordance
with one aspect of the invention, a method for introducing
polynucleotides into a suitable host cell and growing the host cell
under conditions that produce a hybrid polynucleotide.
[0065] In another aspect of the invention, the invention provides a
method for screening for biologically active hybrid polypeptides
encoded by hybrid polynucleotides. The present method allows for
the identification of biologically active hybrid polypeptides with
enhanced biological activities.
[0066] According to another aspect of this invention is provided
that an important advantage of the synthetic ligation reassembly
methods provided herein is that the starting templates that can be
aligned and subjected to ligation reassembly are not limited to
full length genes. In fact when working with genomic sequences it
is often the case that partial gene sequences are obtained, and
these can be subjected to ligation reassembly according to this
invention.
[0067] In an important aspect of this invention, it is appreciated
herein that nucleic acid building blocks that are serviceable for
this invention can be generated by synthetic means or alternatively
by polymerase-based methods either in vivo or in vitro or
alternatively by a combination of synthetic means and
polymerase-based means. The likelihood of nucleotide incorporation
errors is different for each method. Among such errors some may be
undesirable at times. For example the presence of a single
nucleotide mistake in the generation of up a nucleic acid building
block can lead to the undesirable introduction of a stop codon. It
is appreciated that several prescreening methods can be used to
filter out to undesirable nucleotide incorporation errors. For
example the finalized construct can be a fusion product that
includes a reporter sequence, such as GFP or a 6xHis tag, that is
only generated in the absence of unwanted internal stop codons. It
is also appreciated that the selection all of the method by which
nucleic acid building blocks are generated can be based upon
consideration of the error rates of each method considered.
[0068] Furthermore, it is provided that, according to this
invention, nucleic acid building blocks may be single-stranded or
double-stranded polynucleotides. Thus, ligation reassembly
according to this invention may be performed using synthetic as
well as non-synthetic nucleic acid building blocks up, or a
combination thereof. Moreover both single-stranded and
double-stranded polynucleotides may be used in ligation reassembly,
either mutually exclusively or in combination.
[0069] In another aspect of this invention of, it is provided that
blunt ended acid building blocks may be used without alteration of
the blunt ends or alternatively may be subjected to treatment with
an exonuclease, such as Exonuclease III, to create serviceable
overhangs up for synthetic ligation couplings of. Such a treatment
may be brief and controlled, e.g., by subjecting the working sample
of to a temperature at which the Exonuclease III is operable, and
then quickly chilling. In all aspects of ligation reassembly,
treatment with a ligase such as T4 DNA Ligase is an optional
step.
[0070] In specific embodiments, the invention provides a method of
non-stochastically producing a library of chimeric nucleic acid
molecules having an overall assembly order that is chosen by
design, which method is comprised of (a) generating by design a
plurality of specific synthetic nucleic acid building blocks having
serviceable mutually compatible ligatable ends, and (b) assembling
these nucleic acid building blocks, such that a designed overall
assembly order is achieved; whereby a set of progenitor templates,
such as genes (e.g. a family of esterase genes) or genes pathways
(e.g. encoding antibiotics) can be shuffled to generate a sizable
library of progeny polynucleotide molecules (e.g. 10.sup.100) and
correspondingly encoded polypeptides, and whereby the expression
screening of the progeny polynucleotide library provides a means to
identify a desirable species that has a desirable property, such as
a specific enzymatic activity serviceable for a commercial
application.
[0071] Also included is a method of non-stochastically producing a
library comprised of a defined number of groupings comprised of one
or more groupings of chimeric nucleic acid molecules having an
overall assembly order that is chosen by design, which method is
comprised of (a) generating by design for each grouping a set of
specific nucleic acid building blocks having serviceable mutually
compatible ligatable ends, and (b) assembling these nucleic acid
building blocks according to said groupings, such that a designed
overall assembly order is achieved; whereby a set of progenitor
templates, such as genes (e.g. a family of esterase genes) or genes
pathways (e.g. encoding antibiotics) can be shuffled to generate a
sizable library of progeny polynucleotide molecules (e.g.
10.sup.100) and correspondingly encoded polypeptides, and whereby
the expression screening of the progeny polynucleotide library
provides a means to identify a desirable species that has a
desirable property, such as a specific enzymatic activity
serviceable for a commercial application.
[0072] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0073] FIG. 1. Exonuclease Activity. FIG. 1 shows the activity of
the enzyme exonuclease III. This is an exemplary enzyme that can be
used to shuffle, assemble, reassemble, recombine, and/or
concatenate polynucleotide building blocks. The asterisk indicates
that the enzyme acts from the 3' direction towards the 5' direction
of the polynucleotide substrate.
[0074] FIG. 2. Generation of A Nucleic Acid Building Block by
Polymerase-Based Amplification. FIG. 2 illustrates a method of
generating a double-stranded nucleic acid building block with two
overhangs using a polymerase-based amplification reaction (e.g.,
PCR). As illustrated, a first polymerase-based amplification
reaction using a first set of primers, F.sub.2 and R.sub.1, is used
to generate a blunt-ended product (labeled Reaction 1, Product 1),
which is essentially identical to Product A. A second
polymerase-based amplification reaction using a second set of
primers, F.sub.1 and R.sub.2, is used to generate a blunt-ended
product (labeled Reaction 2, Product 2), which is essentially
identical to Product B. These two products are then mixed and
allowed to melt and anneal, generating a potentially useful
double-stranded nucleic acid building block with two overhangs. In
the example of FIG. 1, the product with the 3' overhangs (Product
C) is selected for by nuclease-based degradation of the other 3
products using a 3' acting exonuclease, such as exonuclease III.
Alternate primers are shown in parenthesis to illustrate
serviceable primers may overlap, and additionally that serviceable
primers may be of different lengths, as shown.
[0075] FIG. 3. Unique Overhangs And Unique Couplings. FIG. 3
illustrates the point that the number of unique overhangs of each
size (e.g. the total number of unique overhangs composed of 1 or 2
or 3, etc. nucleotides) exceeds the number of unique couplings that
can result from the use of all the unique overhangs of that size.
For example, there are 4 unique 3' overhangs composed of a single
nucleotide, and 4 unique 5' overhangs composed of a single
nucleotide. Yet the total number of unique couplings that can be
made using all the 8 unique single-nucleotide 3' overhangs and
single-nucleotide 5' overhangs is 4, as presented in Panel A. Panel
B shows that the number of unique single-nucleotide 3' overhangs is
greater than the number of unique couplings. Thus, only 2
intrinsically unique couplings exist using single-nucleotide 3'
overhangs as shown. Panel C shows 4 unique-single nucleotide 5'
overhangs are possible (i.e., A, C, G, & T). For each of these
there is a complementary 5' overhang with which it can pair (i.e.,
T, G, C, & A, respectively), as shown. Panel D shows that the
number of unique single-nucleotide 5' overhangs is greater than the
number of unique couplings. Thus, only 2 intrinsically unique
couplings exist using single-nucleotide 5' overhangs as shown.
[0076] FIG. 4. Unique Overall Assembly Order Achieved by
Sequentially Coupling the Building Blocks. Awareness of the
degeneracy (between the number of unique overhangs and the number
of unique couplings) is important in order to avoid the production
of degeneracy in the overall assembly order of the finalized
nucleic acid. However, a unique overall assembly order can also be
achieved--despite the use of non-unique couplings--by using
building blocks having distinct combinations of couplings, and/or
by stepping the assembly of the building blocks in a deliberately
chosen sequence.
[0077] In FIG. 4A, Panel A, for example, one could attempt to
assemble the following nucleic acid product using the 5 nucleic
acid building blocks as shown. FIG. 4 illustrates the fact that in
order to assemble a total of "n" nucleic acid building blocks,
"n-1" couplings are needed. Yet it is sometimes the case that the
number of unique couplings available for use is fewer that the
"n-1" value. In FIG. 4A, Panel B, degeneracy in the overall
assembly order of the 5 nucleic acid building blocks would be
present if the assembly process were carried out in one step. For
example, building block #2 and building block #3 could both couple
to building block #1 as shown. Under these, and other,
circumstances a stringent non-stochastic overall assembly order can
still be achieved by performing the assembly process in sequential
steps.
[0078] For example, FIG. 4B illustrates a unique overall assembly
order could be achieved by sequentially coupling the building
blocks in 2 steps (rather than all at once) as shown. In this
example, 2 sequential steps are used to achieve a designed overall
assembly order for five nucleic acid building blocks. In this
illustration the designed overall assembly order for the five
nucleic acid building blocks is: 5'-(#1-#2-#3-#4-#5)-3', where #1
represents building block number 1, etc.
[0079] FIG. 5. Unique Couplings Available Using a Two-Nucleotide 3'
Overhang. FIG. 5 further illustrates the point that the number of
unique overhangs of each size (here, e.g. the total number of
unique overhangs composed of 2 nucleotides) exceeds the number of
unique couplings that can result from the use of all the unique
overhangs of that size. For example, there are 16 unique 3'
overhangs composed of two nucleotides, and another 16 unique 5'
overhangs composed of two nucleotides, for a total of 32 as shown.
Yet the total number of couplings that are unique and not
self-binding that can be made using all the 32 unique
double-nucleotide 3' overhangs and double-nucleotide 5' overhangs
is 12. Some apparently unique couplings have "identical twins"
(marked in the same shading), which are visually obvious in this
illustration. Still other overhangs contain nucleotide sequences
that can self-bind in a palindromic fashion, as shown and labeled
in this figure; thus they do not contribute the high stringency to
the overall assembly order.
[0080] FIG. 6. Generation of an Exhaustive Set of Chimeric
Combinations by Synthetic Ligation Reassembly. FIG. 6 showcases the
power of this invention in its ability to generate exhaustively and
systematically all possible combinations of the nucleic acid
building blocks designed in this example. Particularly large sets
(or libraries) of progeny chimeric molecules can be generated.
Because this method can be performed exhaustively and
systematically, the method application can be repeated by choosing
new demarcation points and with correspondingly newly designed
nucleic acid building blocks, bypassing the burden of re-generating
and re-screening previously examined and rejected molecular
species. It is appreciated that, codon wobble can be used to
advantage to increase the frequency of a demarcation point. In
other words, a particular base can often be substituted into a
nucleic acid building block without altering the amino acid encoded
by progenitor codon (that is now altered codon) because of codon
degeneracy. As illustrated, demarcation points are chosen upon
alignment of 8 progenitor templates. Nucleic acid building blocks
including their overhangs (which are serviceable for the formation
of ordered couplings) are then designed and synthesized. In this
instance, 18 nucleic acid building blocks are generated based on
the sequence of each of the 8 progenitor templates, for a total of
144 nucleic acid building blocks (or double-stranded oligos).
Performing the ligation synthesis procedure will then produce a
library of progeny molecules comprised of yield of 8.sup.18 (or
over 1.8.times.10.sup.16) chimeras.
[0081] FIG. 7. Synthetic genes from oligos. According to one
embodiment of this invention, double-stranded nucleic acid building
blocks are designed by aligning a plurality of progenitor nucleic
acid templates. Preferably these templates contain some homology
and some heterology. The nucleic acids may encode related proteins,
such as related enzymes, which relationship may be based on
function or structure or both. FIG. 7 shows the alignment of three
polynucleotide progenitor templates and the selection of
demarcation points (boxed) shared by all the progenitor molecules.
In this particular example, the nucleic acid building blocks
derived from each of the progenitor templates were chosen to be
approximately 30 to 50 nucleotides in length.
[0082] FIG. 8. Nucleic acid building blocks for synthetic ligation
gene reassembly. FIG. 8 shows the nucleic acid building blocks from
the example in FIG. 7. The nucleic acid building blocks are shown
here in generic cartoon form, with their compatible overhangs,
including both 5' and 3' overhangs. There are 22 total nucleic acid
building blocks derived from each of the 3 progenitor templates.
Thus, the ligation synthesis procedure can produce a library of
progeny molecules comprised of yield of 322 (or over
3.1.times.10.sup.10) chimeras.
[0083] FIG. 9. Addition of Introns by Synthetic Ligation
Reassembly. FIG. 9 shows in generic cartoon form that an intron may
be introduced into a chimeric progeny molecule by way of a nucleic
acid building block. It is appreciated that introns often have
consensus sequences at both termini in order to render them
operational. It is also appreciated that, in addition to enabling
gene splicing, introns may serve an additional purpose by providing
sites of homology to other nucleic acids to enable homologous
recombination. For this purpose, and potentially others, it may be
sometimes desirable to generate a large nucleic acid building block
for introducing an intron. If the size is overly large easily
generated by direct chemical synthesis of two single stranded
oligos, such a specialized nucleic acid building block may also be
generated by direct chemical synthesis of more than two single
stranded oligos or by using a polymerase-based amplification
reaction as shown in FIG. 2.
[0084] FIG. 10. Ligation Reassembly Using Fewer Than All The
Nucleotides Of An Overhang. FIG. 10 shows that coupling can occur
in a manner that does not make use of every nucleotide in a
participating overhang. The coupling is particularly likely to
survive (e.g. in a transformed host) if the coupling reinforced by
treatment with a ligase enzyme to form what may be referred to as a
"gap ligation" or a "gapped ligation". It is appreciated that, as
shown, this type of coupling can contribute to generation of
unwanted background product(s), but it can also be used
advantageously to increase the diversity of the progeny library
generated by the designed ligation reassembly. The example in FIG.
10 shows ligation of one strand only; the gap in the second strand
can be repaired in vivo.
[0085] FIG. 11. Avoidance of unwanted self-ligation in palindromic
couplings. As mentioned before and shown in FIG. 5, certain
overhangs are able to undergo self-coupling to form a palindromic
coupling. A coupling is strengthened substantially if it is
reinforced by treatment with a ligase enzyme. Accordingly, it is
appreciated that the lack of 5' phosphates on these overhangs, as
shown, can be used advantageously to prevent this type of
palindromic self-ligation. Accordingly, this invention provides
that nucleic acid building blocks can be chemically made (or
ordered) that lack a 5' phosphate group (or alternatively they can
be removed--e.g. by treatment with a phosphatase enzyme such as a
calf intestinal alkaline phosphatase (CIAP)--in order to prevent
palindromic self-ligations in ligation reassembly processes. This
figure shows that there is no self-ligation of end primers with
palindromic overhangs.
[0086] FIG. 12. Pathway Engineering. It is a goal of this invention
to provide ways of making new gene pathways using ligation
reassembly, optionally with other directed evolution methods such
as saturation mutagenesis. FIG. 12 illustrates a preferred approach
that may be taken to achieve this goal. It is appreciated that
naturally-occurring microbial gene pathways are linked more often
than naturally-occurring eukaryotic (e.g. plant) gene pathways,
which are sometime only partially linked. In a particular
embodiment, this invention provides that regulatory gene sequences
(including promoters) can be introduced in the form of nucleic acid
building blocks into progeny gene pathways generated by ligation
reassembly processes. Thus, originally linked microbial gene
pathways, as well as originally unlinked genes and gene pathways,
can be thus converted to acquire operability in plants and other
eukaryotes.
[0087] FIG. 13. Avoidance of unwanted self-ligation in palindromic
couplings. FIG. 13 illustrates that another goal of this invention,
in addition to the generation of novel gene pathways, is the
subjection of gene pathways--both naturally occurring and
man-made--to mutagenesis and selection in order to achieve improved
progeny molecules using the instantly disclosed methods of directed
evolution (including saturation mutagenesis and synthetic ligation
reassembly). In a particular embodiment, as provided by the instant
invention, both microbial and plant pathways can be improved by
directed evolution, and as shown, the directed evolution process
can be performed both on genes prior to linking them into pathways,
and on gene pathways themselves.
[0088] FIG. 14. Conversion of Microbial Pathways to Eukaryotic
Pathways. In a particular embodiment, this invention provides that
microbial pathways can be converted to pathways operable in plants
and other eukaryotic species by the introduction of regulatory
sequences that function in those species. Preferred regulatory
sequences include promoters, operators, and activator binding
sites. As shown, a preferred method of achieving the introduction
of such serviceable regulatory sequences is in the form of nucleic
acid building blocks, particularly through the use of couplings in
ligation reassembly processes. These couplings in FIG. 14 are
marked with the letters A, B, C, D and F.
[0089] FIG. 15. Evolution of polypeptides by synthesizing (in vivo
or in vitro) corresponding deduced polynucleotides and subjecting
the deduced polynucleotides to directed evolution and expression
screening subsequently expressed polypeptides. This invention
provides that ligation reassembly and site saturation mutagenesis
are each serviceable for introducing nucleotide substitutions as
well as nucleotide deletions and nucleotide additions and
combinations thereof. Furthermore synthetic ligation reassembly can
be performed on a plurality of starting templates as well as on a
single template to rearrange the order of the nucleotide cassettes
in a non-stochastic predetermined manner. Additionally, when
subjecting a plurality of starting templates to ligation
reassembly, it is not necessary that the same number of nucleic
acid building blocks be generated from each template (e.g. to
participate to in each coupling). Thus for example if three
templates are used, then a different number of nucleic acid
building blocks may be generated corresponding to each
template.
[0090] FIG. 16: In Silico Triage. This figure illustrates the
grouping of potential products and the ranking of the groupings
according to "structure-function" predictions, which steps are
aspects of what is referred to herein as "triaging", and
specifically "in silico triage" if performed using the aid of a
computer.
[0091] FIG. 17: Solid Phase Ligation Reassembly. The outline of the
procedure used is the following: (1) Annealing of complementary
oligos. (Couplings are shown underlined and in bold. Dashes " - - -
" indicate internal sequences not involved in couplings.) (2)
Immobilization of 5' pre-annealed biotinylated fragment to
conjugated beads. (3) Wash to remove free fragments. (4) Enzymatic
ligation of consecutive pre-annealed fragments including washes
between each addition to remove free fragments. (5) BsaI-mediated
elution of reassembled gene (cuts inside of TOPO sequence). (6)
Ligation to 5'--and 3' end PCR generated fragments (if necessary).
(7) Cloning into appropriate vector.
[0092] FIG. 18. Polynucleotide reassembly. Shown is an example of
directed evolution. N different strains of a virus are used in this
illustration, but the technique is applicable to any single nucleic
acid as well as to any nucleic acid for which different strains,
species, or gene families have homologous nucleic acids that have
one or more nucleotide changes compared to other homologous nucleic
acids. The different variant nucleic acids are experimentally
generated, preferably non-stochastically, as described herein, and
screened or selected to identify those variants that exhibit the
desired property. The directed evolution method(s) and screening
can be repeated one or more times to obtain further improvement.
Panel B shows that successive rounds of directed evolution can
produce progressively enhanced properties, and that the combination
of individual beneficial mutations can lead to an enhance
improvement compared to the improvement achieved by an individual
beneficial mutation. This figure illustrates the non-stochastic
polynucleotide reassembly in combination with non-stochastic
polynucleotide site-saturation mutagenesis.
[0093] FIGS. 19A-F. An alignment of two CMV-derived nucleotide
sequences from human and primate species. Shown here is an
alignment of two CMV-derived nucleotide sequences of human and
primate strains. This alignment is serviceable for performing
non-stochastic polynucleotide reassembly. Nucleotide sequences
shared by two sequences are boxed to illustrate preferred but
non-limiting examples of reassembly points.
[0094] FIGS. 20A-B: An alignment of the IFN-gamma nucleotide
sequences from human, cat, rodent species. Shown here is an
alignment of the IFN-gamma nucleotide sequences from human, cat,
and rodent species. This alignment is serviceable for performing
non-stochastic polynucleotide reassembly. Nucleotide sequences
shared by two sequences are boxed to illustrate preferred but
non-limiting examples of reassembly points.
DEFINITIONS OF TERMS
[0095] In order to facilitate understanding of the examples
provided herein, certain frequently occurring methods and/or terms
will be described.
[0096] The term "agent" is used herein to denote a chemical
compound, a mixture of chemical compounds, an array of spatially
localized compounds (e.g., a VLSIPS peptide array, polynucleotide
array, and/or combinatorial small molecule array), biological
macromolecule, a bacteriophage peptide display library, a
bacteriophage antibody (e.g., scFv) display library, a polysome
peptide display library, or an extract made from biological
materials such as bacteria, plants, fungi, or animal (particular
mammalian) cells or tissues. Agents are evaluated for potential
activity as anti-neoplastics, anti-inflammatories or apoptosis
modulators by inclusion in screening assays described herein below.
Agents are evaluated for potential activity as specific protein
interaction inhibitors (i.e., an agent which selectively inhibits a
binding interaction between two predetermined polypeptides but
which does not substantially interfere with cell viability) by
inclusion in screening assays described herein below.
[0097] An "ambiguous base requirement" in a restriction site refers
to a nucleotide base requirement that is not specified to the
fullest extent, i.e. that is not a specific base (such as, in a
non-limiting exemplification, a specific base selected from A, C, G
and T), but rather may be any one of at least two or more bases.
Commonly accepted abbreviations that are used in the art as well as
herein to represent ambiguity in bases include the following: R=G
or A; Y=C or T; M=A or C; K=G or T; S=G or C; W=A or T; H=A or C or
T; B=G or T or C; V=G or C or A; D=G or A or T; N=A or C or G or
T.
[0098] The term "amino acid" as used herein refers to any organic
compound that contains an amino group (--NH.sub.2) and a carboxyl
group (--COOH); preferably either as free groups or alternatively
after condensation as part of peptide bonds. The "twenty naturally
encoded polypeptide-forming alpha-amino acids" are understood in
the art and refer to: alanine (ala or A), arginine (arg or R),
asparagine (asn or N), aspartic acid (asp or D), cysteine (cys or
C), gluatamic acid (glu or E), glutamine (gln or Q), glycine (gly
or G), histidine (his or H), isoleucine (ile or I), leucine (leu or
L), lysine (lys or K), methionine (met or M), phenylalanine (phe or
F), proline (pro or P), serine (ser or S), threonine (thr or T),
tryptophan (trp or W), tyrosine (tyr or Y), and valine (val or
V).
[0099] The term "amplification" means that the number of copies of
a polynucleotide is increased.
[0100] The term "antibody", as used herein, refers to intact
immunoglobulin molecules, as well as fragments of immunoglobulin
molecules, such as Fab, Fab', (Fab').sub.2, Fv, and SCA fragments,
that are capable of binding to an epitope of an antigen. These
antibody fragments, which retain some ability to selectively bind
to an antigen (e.g., a polypeptide antigen) of the antibody from
which they are derived, can be made using well known methods in the
art (see, e.g., Harlow and Lane, supra), and are described further,
as follows.
[0101] (1) An Fab fragment consists of a monovalent antigen-binding
fragment of an antibody molecule, and can be produced by digestion
of a whole antibody molecule with the enzyme papain, to yield a
fragment consisting of an intact light chain and a portion of a
heavy chain.
[0102] (2) An Fab' fragment of an antibody molecule can be obtained
by treating a whole antibody molecule with pepsin, followed by
reduction, to yield a molecule consisting of an intact light chain
and a portion of a heavy chain. Two Fab' fragments are obtained per
antibody molecule treated in this manner.
[0103] (3) An (Fab').sub.2 fragment of an antibody can be obtained
by treating a whole antibody molecule with the enzyme pepsin,
without subsequent reduction. A (Fab').sub.2 fragment is a dimer of
two Fab' fragments, held together by two disulfide bonds.
[0104] (4) An Fv fragment is defined as a genetically engineered
fragment containing the variable region of a light chain and the
variable region of a heavy chain expressed as two chains.
[0105] (5) An single chain antibody ("SCA") is a genetically
engineered single chain molecule containing the variable region of
a light chain and the variable region of a heavy chain, linked by a
suitable, flexible polypeptide linker.
[0106] The term "Applied Molecular Evolution" ("AME") means the
application of an evolutionary design algorithm to a specific,
useful goal. While many different library formats for AME have been
reported for polynucleotides, peptides and proteins (phage, lacI
and polysomes), none of these formats have provided for
recombination by random cross-overs to deliberately create a
combinatorial library.
[0107] A molecule that has a "chimeric property" is a molecule that
is: 1) in part homologous and in part heterologous to a first
reference molecule; while 2) at the same time being in part
homologous and in part heterologous to a second reference molecule;
without 3) precluding the possibility of being at the same time in
part homologous and in part heterologous to still one or more
additional reference molecules. In a non-limiting embodiment, a
chimeric molecule may be prepared by assemblying a reassortment of
partial molecular sequences. In a non-limiting aspect, a chimeric
polynucleotide molecule may be prepared by synthesizing the
chimeric polynucleotide using plurality of molecular templates,
such that the resultant chimeric polynucleotide has properties of a
plurality of templates.
[0108] The term "cognate" as used herein refers to a gene sequence
that is evolutionarily and functionally related between species.
For example, but not limitation, in the human genome the human CD4
gene is the cognate gene to the mouse 3d4 gene, since the sequences
and structures of these two genes indicate that they are highly
homologous and both genes encode a protein which functions in
signaling T cell activation through MHC class 11-restricted antigen
recognition.
[0109] A "comparison window," as used herein, refers to a
conceptual segment of at least 20 contiguous nucleotide positions
wherein a polynucleotide sequence may be compared to a reference
sequence of at least 20 contiguous nucleotides and wherein the
portion of the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) of 20 percent or less
as compared to the reference sequence (which does not comprise
additions or deletions) for optimal alignment of the two sequences.
Optimal alignment of sequences for aligning a comparison window may
be conducted by the local homology algorithm of Smith (Smith and
Waterman, Adv Appl Math, 1981; Smith and Waterman, J Teor Biol,
1981; Smith and Waterman, J Mol Biol, 1981; Smith et al, J Mol
Evol, 1981), by the homology alignment algorithm of Needleman
(Needleman and Wuncsch, 1970), by the search of similarity method
of Pearson (Pearson and Lipman, 1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package Release 7.0,
Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by
inspection, and the best alignment (i.e., resulting in the highest
percentage of homology over the comparison window) generated by the
various methods is selected.
[0110] As used herein, the term "complementarity-determining
region" and "CDR" refer to the art-recognized term as exemplified
by the Kabat and Chothia CDR definitions also generally known as
supervariable regions or hypervariable loops (Chothia and Lesk,
1987; Clothia et al, 1989; Kabat et al, 1987; and Tramontano et al,
1990). Variable region domains typically comprise the
amino-terminal approximately 105-115 amino acids of a
naturally-occurring immunoglobulin chain (e.g., amino acids 1-110),
although variable domains somewhat shorter or longer are also
suitable for forming single-chain antibodies.
[0111] "Conservative amino acid substitutions" refer to the
interchangeability of residues having similar side chains. For
example, a group of amino acids having aliphatic side chains is
glycine, alanine, valine, leucine, and isoleucine; a group of amino
acids having aliphatic-hydroxyl side chains is serine and
threonine; a group of amino acids having amide-containing side
chains is asparagine and glutamine; a group of amino acids having
aromatic side chains is phenylalanine, tyrosine, and tryptophan; a
group of amino acids having basic side chains is lysine, arginine,
and histidine; and a group of amino acids having sulfur-containing
side chains is cysteine and methionine. Preferred conservative
amino acids substitution groups are: valine-leucine-isoleuci- ne,
phenylalanine-tyrosine, lysine-arginine, alanine-valine, and
asparagine-glutamine.
[0112] The term "corresponds to" is used herein to mean that a
polynucleotide sequence is homologous (i.e., is identical, not
strictly evolutionarily related) to all or a portion of a reference
polynucleotide sequence, or that a polypeptide sequence is
identical to a reference polypeptide sequence. In
contradistinction, the term "complementary to" is used herein to
mean that the complementary sequence is homologous to all or a
portion of a reference polynucleotide sequence. For illustration,
the nucleotide sequence "TATAC" corresponds to a reference "TATAC"
and is complementary to a reference sequence "GTATA."
[0113] The term "degrading effective" amount refers to the amount
of enzyme which is required to process at least 50% of the
substrate, as compared to substrate not contacted with the enzyme.
Preferably, at least 80% of the substrate is degraded.
[0114] As used herein, the term "defined sequence framework" refers
to a set of defined sequences that are selected on a non-random
basis, generally on the basis of experimental data or structural
data; for example, a defined sequence framework may comprise a set
of amino acid sequences that are predicted to form a 13-sheet
structure or may comprise a leucine zipper heptad repeat motif, a
zinc-finger domain, among other variations. A "defined sequence
kernal" is a set of sequences which encompass a limited scope of
variability. Whereas (1) a completely random 10-mer sequence of the
20 conventional amino acids can be any of (20)10 sequences, and (2)
a pseudorandom 10-mer sequence of the 20 conventional amino acids
can be any of (20)10 sequences but will exhibit a bias for certain
residues at certain positions and/or overall, (3) a defined
sequence kernal is a subset of sequences if each residue position
was allowed to be any of the allowable 20 conventional amino acids
(and/or allowable unconventional amino/imino acids). A defined
sequence kernal generally comprises variant and invariant residue
positions and/or comprises variant residue positions which can
comprise a residue selected from a defined subset of amino acid
residues), and the like, either segmentally or over the entire
length of the individual selected library member sequence. Defined
sequence kernels can refer to either amino acid sequences or
polynucleotide sequences. Of illustration and not limitation, the
sequences (NNK).sub.10 and (NNM).sub.10, wherein N represents A, T,
G, or C; K represents G or T; and M represents A or C, are defined
sequence kernels.
[0115] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a gel to
isolate the desired fragment.
[0116] "Directional ligation" refers to a ligation in which a 5'
end and a 3' end of a polynuclotide are different enough to specify
a preferred ligation orientation. For example, an otherwise
untreated and undigested PCR product that has two blunt ends will
typically not have a preferred ligation orientation when ligated
into a cloning vector digested to produce blunt ends in its
multiple cloning site; thus, directional ligation will typically
not be displayed under these circumstances. In contrast,
directional ligation will typically displayed when a digested PCR
product having a 5' EcoR I-treated end and a 3' BamH I- is ligated
into a cloning vector that has a multiple cloning site digested
with EcoR I and BamH I.
[0117] The term "DNA shuffling" is used herein to indicate
recombination between substantially homologous but non-identical
sequences, in some embodiments DNA shuffling may involve crossover
via non-homologous recombination, such as via cer/lox and/or
flp/frt systems and the like.
[0118] As used in this invention, the term "epitope" refers to an
antigenic determinant on an antigen, such as a phytase polypeptide,
to which the paratope of an antibody, such as an phytase-specific
antibody, binds. Antigenic determinants usually consist of
chemically active surface groupings of molecules, such as amino
acids or sugar side chains, and can have specific three-dimensional
structural characteristics, as well as specific charge
characteristics. As used herein "epitope" refers to that portion of
an antigen or other macromolecule capable of forming a binding
interaction that interacts with the variable region binding body of
an antibody. Typically, such binding interaction is manifested as
an intermolecular contact with one or more amino acid residues of a
CDR.
[0119] The terms "fragment", "derivative" and "analog" when
referring to a reference polypeptide comprise a polypeptide which
retains at least one biological function or activity that is at
least essentially same as that of the reference polypeptide.
Furthermore, the terms "fragment", "derivative" or "analog" are
exemplified by a "pro-form" molecule, such as a low activity
proprotein that can be modified by cleavage to produce a mature
enzyme with significantly higher activity.
[0120] A method is provided herein for producing from a template
polypeptide a set of progeny polypeptides in which a "full range of
single amino acid substitutions" is represented at each amino acid
position. As used herein, "full range of single amino acid
substitutions" is in reference to the 20 naturally encoded
polypeptide-forming alpha-amino acids, as described herein.
[0121] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0122] "Genetic instability", as used herein, refers to the natural
tendency of highly repetitive sequences to be lost through a
process of reductive events generally involving sequence
simplification through the loss of repeated sequences. Deletions
tend to involve the loss of one copy of a repeat and everything
between the repeats.
[0123] The term "heterologous" means that one single-stranded
nucleic acid sequence is unable to hybridize to another
single-stranded nucleic acid sequence or its complement. Thus areas
of heterology means that areas of polynucleotides or
polynucleotides have areas or regions within their sequence which
are unable to hybridize to another nucleic acid or polynucleotide.
Such regions or areas are for example areas of mutations.
[0124] The term "homologous" or "homeologous" means that one
single-stranded nucleic acid sequence may hybridize to a
complementary single-stranded nucleic acid sequence. The degree of
hybridization may depend on a number of factors including the
amount of identity between the sequences and the hybridization
conditions such as temperature and salt concentrations as discussed
later. Preferably the region of identity is greater than about 5
bp, more preferably the region of identity is greater than 10
bp.
[0125] An immunoglobulin light or heavy chain variable region
consists of a "framework" region interrupted by three hypervariable
regions, also called CDR's. The extent of the framework region and
CDR's have been precisely defined; see "Sequences of Proteins of
Immunological Interest" (Kabat et al, 1987). The sequences of the
framework regions of different light or heavy chains are relatively
conserved within a specie. As used herein, a "human framework
region" is a framework region that is substantially identical
(about 85 or more, usually 90-95 or more) to the framework region
of a naturally occurring human immunoglobulin. the framework region
of an antibody, that is the combined framework regions of the
constituent light and heavy chains, serves to position and align
the CDR's. The CDR's are primarily responsible for binding to an
epitope of an antigen.
[0126] The benefits of this invention extend to "commercial
applications" (or commercial processes), which term is used to
include applications in commercial industry proper (or simply
industry) as well as non-commercial commercial applications (e.g.
biomedical research at a non-profit institution). Relevant
applications include those in areas of diagnosis, medicine,
agriculture, manufacturing, and academia.
[0127] The term "identical" or "identity" means that two nucleic
acid sequences have the same sequence or a complementary sequence.
Thus, "areas of identity" means that regions or areas of a
polynucleotide or the overall polynucleotide are identical or
complementary to areas of another polynucleotide or the
polynucleotide.
[0128] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or enzyme present in a living animal is not
isolated, but the same polynucleotide or enzyme, separated from
some or all of the coexisting materials in the natural system, is
isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or enzymes could be part of a composition, and
still be isolated in that such vector or composition is not part of
its natural environment.
[0129] By "isolated nucleic acid" is meant a nucleic acid, e.g., a
DNA or RNA molecule, that is not immediately contiguous with the 5'
and 3' flanking sequences with which it normally is immediately
contiguous when present in the naturally occurring genome of the
organism from which it is derived. The term thus describes, for
example, a nucleic acid that is incorporated into a vector, such as
a plasmid or viral vector; a nucleic acid that is incorporated into
the genome of a heterologous cell (or the genome of a homologous
cell, but at a site different from that at which it naturally
occurs); and a nucleic acid that exists as a separate molecule,
e.g., a DNA fragment produced by PCR amplification or restriction
enzyme digestion, or an RNA molecule produced by in vitro
transcription. The term also describes a recombinant nucleic acid
that forms part of a hybrid gene encoding additional polypeptide
sequences that can be used, for example, in the production of a
fusion protein.
[0130] As used herein "ligand" refers to a molecule, such as a
random peptide or variable segment sequence, that is recognized by
a particular receptor. As one of skill in the art will recognize, a
molecule (or macromolecular complex) can be both a receptor and a
ligand. In general, the binding partner having a smaller molecular
weight is referred to as the ligand and the binding partner having
a greater molecular weight is referred to as a receptor.
[0131] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Sambrook
et al, 1982, p. 146; Sambrook, 1989). Unless otherwise provided,
ligation may be accomplished using known buffers and conditions
with 10 units of T4 DNA ligase ("ligase") per 0.5 .mu.g of
approximately equimolar amounts of the DNA fragments to be
ligated.
[0132] As used herein, "linker" or "spacer" refers to a molecule or
group of molecules that connects two molecules, such as a DNA
binding protein and a random peptide, and serves to place the two
molecules in a preferred configuration, e.g., so that the random
peptide can bind to a receptor with minimal steric hindrance from
the DNA binding protein.
[0133] As used herein, a "molecular property to be evolved"
includes reference to molecules comprised of a polynucleotide
sequence, molecules comprised of a polypeptide sequence, and
molecules comprised in part of a polynucleotide sequence and in
part of a polypeptide sequence. Particularly relevant--but by no
means limiting--examples of molecular properties to be evolved
include enzymatic activities at specified conditions, such as
related to temperature; salinity; pressure; pH; and concentration
of glycerol, DMSO, detergent, &/or any other molecular species
with which contact is made in a reaction environment. Additional
particularly relevant--but by no means limiting--examples of
molecular properties to be evolved include stabilities--e.g. the
amount of a residual molecular property that is present after a
specified exposure time to a specified environment, such as may be
encountered during storage.
[0134] The term "mutations" includes changes in the sequence of a
wild-type or parental nucleic acid sequence or changes in the
sequence of a peptide. Such mutations may be point mutations such
as transitions or transversions. The mutations may be deletions,
insertions or duplications. A mutation can also be a
"chimerization", which is exemplified in a progeny molecule that is
generated to contain part or all of a sequence of one parental
molecule as well as part or all of a sequence of at least one other
parental molecule. This invention provides for both chimeric
polynucleotides and chimeric polypeptides.
[0135] As used herein, the degenerate "N,N,G/T" nucleotide sequence
represents 32 possible triplets, where "N" can be A, C, G or T.
[0136] The term "naturally-occurring" as used herein as applied to
the object refers to the fact that an object can be found in
nature. For example, a polypeptide or polynucleotide sequence that
is present in an organism (including viruses) that can be isolated
from a source in nature and which has not been intentionally
modified by man in the laboratory is naturally occurring.
Generally, the term naturally occurring refers to an object as
present in a non-pathological (un-diseased) individual, such as
would be typical for the species.
[0137] As used herein, a "nucleic acid molecule" is comprised of at
least one base or one base pair, depending on whether it is
single-stranded or double-stranded, respectively. Furthermore, a
nucleic acid molecule may belong exclusively or chimerically to any
group of nucleotide-containing molecules, as exemplified by, but
not limited to, the following groups of nucleic acid molecules:
RNA, DNA, genomic nucleic acids, non-genomic nucleic acids,
naturally occurring and not naturally occurring nucleic acids, and
synthetic nucleic acids. This includes, by way of non-limiting
example, nucleic acids associated with any organelle, such as the
mitochondria, ribosomal RNA, and nucleic acid molecules comprised
chimerically of one or more components that are not naturally
occurring along with naturally occurring components.
[0138] Additionally, a "nucleic acid molecule" may contain in part
one or more non-nucleotide-based components as exemplified by, but
not limited to, amino acids and sugars. Thus, by way of example,
but not limitation, a ribozyme that is in part nucleotide-based and
in part protein-based is considered a "nucleic acid molecule".
[0139] In addition, by way of example, but not limitation, a
nucleic acid molecule that is labeled with a detectable moiety,
such as a radioactive or alternatively a non-radioactive label, is
likewise considered a "nucleic acid molecule".
[0140] The terms "nucleic acid sequence coding for" or a "DNA
coding sequence of" or a "nucleotide sequence encoding" a
particular enzyme--as well as other synonymous terms--refer to a
DNA sequence which is transcribed and translated into an enzyme
when placed under the control of appropriate regulatory sequences.
A "promotor sequence" is a DNA regulatory region capable of binding
RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. The promoter is part of
the DNA sequence. This sequence region has a start codon at its 3'
terminus. The promoter sequence does include the minimum number of
bases where elements necessary to initiate transcription at levels
detectable above background. However, after the RNA polymerase
binds the sequence and transcription is initiated at the start
codon (3' terminus with a promoter), transcription proceeds
downstream in the 3' direction. Within the promotor sequence will
be found a transcription initiation site (conveniently defined by
mapping with nuclease S1) as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase.
[0141] The terms "nucleic acid encoding an enzyme (protein)" or
"DNA encoding an enzyme (protein)" or "polynucleotide encoding an
enzyme (protein)" and other synonymous terms encompasses a
polynucleotide which includes only coding sequence for the enzyme
as well as a polynucleotide which includes additional coding and/or
non-coding sequence.
[0142] In one preferred embodiment, a "specific nucleic acid
molecule species" is defined by its chemical structure, as
exemplified by, but not limited to, its primary sequence. In
another preferred embodiment, a specific "nucleic acid molecule
species" is defined by a function of the nucleic acid species or by
a function of a product derived from the nucleic acid species.
Thus, by way of non-limiting example, a "specific nucleic acid
molecule species" may be defined by one or more activities or
properties attributable to it, including activities or properties
attributable its expressed product.
[0143] The instant definition of "assembling a working nucleic acid
sample into a nucleic acid library" includes the process of
incorporating a nucleic acid sample into a vector-based collection,
such as by ligation into a vector and transformation of a host. A
description of relevant vectors, hosts, and other reagents as well
as specific non-limiting examples thereof are provided hereinafter.
The instant definition of "assembling a working nucleic acid sample
into a nucleic acid library" also includes the process of
incorporating a nucleic acid sample into a non-vector-based
collection, such as by ligation to adaptors. Preferably the
adaptors can anneal to PCR primers to facilitate amplification by
PCR.
[0144] Accordingly, in a non-limiting embodiment, a "nucleic acid
library" is comprised of a vector-based collection of one or more
nucleic acid molecules. In another preferred embodiment a "nucleic
acid library" is comprised of a non-vector-based collection of
nucleic acid molecules. In yet another preferred embodiment a
"nucleic acid library" is comprised of a combined collection of
nucleic acid molecules that is in part vector-based and in part
non-vector-based. Preferably, the collection of molecules
comprising a library is searchable and separable according to
individual nucleic acid molecule species.
[0145] The present invention provides a "nucleic acid construct" or
alternatively a "nucleotide construct" or alternatively a "DNA
construct". The term "construct" is used herein to describe a
molecule, such as a polynucleotide (e.g., a phytase polynucleotide)
may optionally be chemically bonded to one or more additional
molecular moieties, such as a vector, or parts of a vector. In a
specific--but by no means limiting--aspect, a nucleotide construct
is exemplified by a DNA expression constructs suitable for the
transformation of a host cell.
[0146] An "oligonucleotide" (or synonymously an "oligo") refers to
either a single stranded polydeoxynucleotide or two complementary
polydeoxynucleotide strands which may be chemically synthesized.
Such synthetic oligonucleotides may or may not have a 5' phosphate.
Those that do not will not ligate to another oligonucleotide
without adding a phosphate with an ATP in the presence of a kinase.
A synthetic oligonucleotide will ligate to a fragment that has not
been dephosphorylated. To achieve polymerase-based amplification
(such as with PCR), a "32-fold degenerate oligonucleotide that is
comprised of, in series, at least a first homologous sequence, a
degenerate N,N,G/T sequence, and a second homologous sequence" is
mentioned. As used in this context, "homologous" is in reference to
homology between the oligo and the parental polynucleotide that is
subjected to the polymerase-based amplification.
[0147] As used herein, the term "operably linked" refers to a
linkage of polynucleotide elements in a functional relationship. A
nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
instance, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the coding sequence.
Operably linked means that the DNA sequences being linked are
typically contiguous and, where necessary to join two protein
coding regions, contiguous and in reading frame.
[0148] A coding sequence is "operably linked to" another coding
sequence when RNA polymerase will transcribe the two coding
sequences into a single mRNA, which is then translated into a
single polypeptide having amino acids derived from both coding
sequences. The coding sequences need not be contiguous to one
another so long as the expressed sequences are ultimately processed
to produce the desired protein.
[0149] As used herein the term "parental polynucleotide set" is a
set comprised of one or more distinct polynucleotide species.
Usually this term is used in reference to a progeny polynucleotide
set which is preferably obtained by mutagenization of the parental
set, in which case the terms "parental", "starting" and "template"
are used interchangeably.
[0150] As used herein the term "physiological conditions" refers to
temperature, pH, ionic strength, viscosity, and like biochemical
parameters which are compatible with a viable organism, and/or
which typically exist intracellularly in a viable cultured yeast
cell or mammalian cell. For example, the intracellular conditions
in a yeast cell grown under typical laboratory culture conditions
are physiological conditions. Suitable in vitro reaction conditions
for in vitro transcription cocktails are generally physiological
conditions. In general, in vitro physiological conditions comprise
50-200 mM NaCl or KCl, pH 6.5-8.5, 20-45.degree. C. and 0.001-10 mM
divalent cation (e.g., Mg.sup.++, Ca.sup.++); preferably about 150
mM NaCl or KCl, pH 7.2-7.6, 5 mM divalent cation, and often include
0.01-1.0 percent nonspecific protein (e.g., BSA). A non-ionic
detergent (Tween, NP-40, Triton X-100) can often be present,
usually at about 0.001 to 2%, typically 0.05-0.2% (v/v). Particular
aqueous conditions may be selected by the practitioner according to
conventional methods. For general guidance, the following buffered
aqueous conditions may be applicable: 10-250 mM NaCl, 5-50 mM Tris
HCl, pH 5-8, with optional addition of divalent cation(s) and/or
metal chelators and/or non-ionic detergents and/or membrane
fractions and/or anti-foam agents and/or scintillants.
[0151] Standard convention (5' to 3') is used herein to describe
the sequence of double standed polynucleotides.
[0152] The term "population" as used herein means a collection of
components such as polynucleotides, portions or polynucleotides or
proteins. A "mixed population: means a collection of components
which belong to the same family of nucleic acids or proteins (i.e.,
are related) but which differ in their sequence (i.e., are not
identical) and hence in their biological activity.
[0153] A molecule having a "pro-form" refers to a molecule that
undergoes any combination of one or more covalent and noncovalent
chemical modifications (e.g. glycosylation, proteolytic cleavage,
dimerization or oligomerization, temperature-induced or pH-induced
conformational change, association with a co-factor, etc.) en route
to attain a more mature molecular form having a property difference
(e.g. an increase in activity) in comparison with the reference
pro-form molecule. When two or more chemical modification (e.g. two
proteolytic cleavages, or a proteolytic cleavage and a
deglycosylation) can be distinguished en route to the production of
a mature molecule, the referemce precursor molecule may be termed a
"pre-pro-form" molecule.
[0154] As used herein, the term "pseudorandom" refers to a set of
sequences that have limited variability, such that, for example,
the degree of residue variability at another position, but any
pseudorandom position is allowed some degree of residue variation,
however circumscribed.
[0155] "Quasi-repeated units", as used herein, refers to the
repeats to be re-assorted and are by definition not identical.
Indeed the method is proposed not only for practically identical
encoding units produced by mutagenesis of the identical starting
sequence, but also the reassortment of similar or related sequences
which may diverge significantly in some regions. Nevertheless, if
the sequences contain sufficient homologies to be reasserted by
this approach, they can be referred to as "quasi-repeated"
units.
[0156] As used herein "random peptide library" refers to a set of
polynucleotide sequences that encodes a set of random peptides, and
to the set of random peptides encoded by those polynucleotide
sequences, as well as the fusion proteins contain those random
peptides.
[0157] As used herein, "random peptide sequence" refers to an amino
acid sequence composed of two or more amino acid monomers and
constructed by a stochastic or random process. A random peptide can
include framework or scaffolding motifs, which may comprise
invariant sequences.
[0158] As used herein, "receptor" refers to a molecule that has an
affinity for a given ligand. Receptors can be naturally occurring
or synthetic molecules. Receptors can be employed in an unaltered
state or as aggregates with other species. Receptors can be
attached, covalently or non-covalently, to a binding member, either
directly or via a specific binding substance. Examples of receptors
include, but are not limited to, antibodies, including monoclonal
antibodies and antisera reactive with specific antigenic
determinants (such as on viruses, cells, or other materials), cell
membrane receptors, complex carbohydrates and glycoproteins,
enzymes, and hormone receptors.
[0159] "Recombinant" enzymes refer to enzymes produced by
recombinant DNA techniques, i.e., produced from cells transformed
by an exogenous DNA construct encoding the desired enzyme.
"Synthetic" enzymes are those prepared by chemical synthesis.
[0160] The term "related polynucleotides" means that regions or
areas of the polynucleotides are identical and regions or areas of
the polynucleotides are heterologous.
[0161] "Reductive reassortment", as used herein, refers to the
increase in molecular diversity that is accrued through deletion
(and/or insertion) events that are mediated by repeated
sequences.
[0162] The following terms are used to describe the sequence
relationships between two or more polynucleotides: "reference
sequence," "comparison window," "sequence identity," "percentage of
sequence identity," and "substantial identity."
[0163] A "reference sequence" is a defined sequence used as a basis
for a sequence comparison; a reference sequence may be a subset of
a larger sequence, for example, as a segment of a full-length cDNA
or gene sequence given in a sequence listing, or may comprise a
complete cDNA or gene sequence. Generally, a reference sequence is
at least 20 nucleotides in length, frequently at least 25
nucleotides in length, and often at least 50 nucleotides in length.
Since two polynucleotides may each (1) comprise a sequence (i.e., a
portion of the complete polynucleotide sequence) that is similar
between the two polynucleotides and (2) may further comprise a
sequence that is divergent between the two polynucleotides,
sequence comparisons between two (or more) polynucleotides are
typically performed by comparing sequences of the two
polynucleotides over a "comparison window" to identify and compare
local regions of sequence similarity.
[0164] "Repetitive Index (RI)", as used herein, is the average
number of copies of the quasi-repeated units contained in the
cloning vector.
[0165] The term "restriction site" refers to a recognition sequence
that is necessary for the manifestation of the action of a
restriction enzyme, and includes a site of catalytic cleavage. It
is appreciated that a site of cleavage may or may not be contained
within a portion of a restriction site that comprises a low
ambiguity sequence (i.e. a sequence containing the principal
determinant of the frequency of occurrence of the restriction
site). Thus, in many cases, relevant restriction sites contain only
a low ambiguity sequence with an internal cleavage site (e.g.
G/AATTC in the EcoR I site) or an immediately adjacent cleavage
site (e.g. /CCWGG in the EcoR II site). In other cases, relevant
restriction enzymes [e.g. the Eco57 I site or CTGAAG(16/14)]
contain a low ambiguity sequence (e.g. the CTGAAG sequence in the
Eco57 I site) with an external cleavage site (e.g. in the N.sub.16
portion of the Eco57 I site). When an enzyme (e.g. a restriction
enzyme) is said to "cleave" a polynucleotide, it is understood to
mean that the restriction enzyme catalyzes or facilitates a
cleavage of a polynucleotide.
[0166] In a non-limiting aspect, a "selectable polynucleotide" is
comprised of a 5' terminal region (or end region), an intermediate
region (i.e. an internal or central region), and a 3' terminal
region (or end region). As used in this aspect, a 5' terminal
region is a region that is located towards a 5' polynucleotide
terminus (or a 5' polynucleotide end); thus it is either partially
or entirely in a 5' half of a polynucleotide. Likewise, a 3'
terminal region is a region that is located towards a 3'
polynucleotide terminus (or a 3' polynucleotide end); thus it is
either partially or entirely in a 3' half of a polynucleotide. As
used in this non-limiting exemplification, there may be sequence
overlap between any two regions or even among all three
regions.
[0167] The term "sequence identity" means that two polynucleotide
sequences are identical (i.e., on a nucleotide-by-nucleotide basis)
over the window of comparison. The term "percentage of sequence
identity" is calculated by comparing two optimally aligned
sequences over the window of comparison, determining the number of
positions at which the identical nucleic acid base (e.g., A, T, C,
G, U, or I) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity. This "substantial identity", as used herein,
denotes a characteristic of a polynucleotide sequence, wherein the
polynucleotide comprises a sequence having at least 80 percent
sequence identity, preferably at least 85 percent identity, often
90 to 95 percent sequence identity, and most commonly at least 99
percent sequence identity as compared to a reference sequence of a
comparison window of at least 25-50 nucleotides, wherein the
percentage of sequence identity is calculated by comparing the
reference sequence to the polynucleotide sequence which may include
deletions or additions which total 20 percent or less of the
reference sequence over the window of comparison.
[0168] As known in the art "similarity" between two enzymes is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one enzyme to the sequence of a second
enzyme. Similarity may be determined by procedures which are
well-known in the art, for example, a BLAST program (Basic Local
Alignment Search Tool at the National Center for Biological
Information).
[0169] As used herein, the term "single-chain antibody" refers to a
polypeptide comprising a V.sub.H domain and a V.sub.L domain in
polypeptide linkage, generally linked via a spacer peptide (e.g.,
[Gly-Gly-Gly-Gly-Ser].sub.x), and which may comprise additional
amino acid sequences at the amino- and/or carboxy-termini. For
example, a single-chain antibody may comprise a tether segment for
linking to the encoding polynucleotide. As an example, a scFv is a
single-chain antibody. Single-chain antibodies are generally
proteins consisting of one or more polypeptide segments of at least
10 contiguous amino substantially encoded by genes of the
immunoglobulin superfamily (e.g., see Williams and Barclay, 1989,
pp. 361-368, which is incorporated herein by reference), most
frequently encoded by a rodent, non-human primate, avian, porcine
bovine, ovine, goat, or human heavy chain or light chain gene
sequence. A functional single-chain antibody generally contains a
sufficient portion of an immunoglobulin superfamily gene product so
as to retain the property of binding to a specific target molecule,
typically a receptor or antigen (epitope).
[0170] The members of a pair of molecules (e.g., an
antibody-antigen pair or a nucleic acid pair) are said to
"specifically bind" to each other if they bind to each other with
greater affinity than to other, non-specific molecules. For
example, an antibody raised against an antigen to which it binds
more efficiently than to a non-specific protein can be described as
specifically binding to the antigen. (Similarly, a nucleic acid
probe can be described as specifically binding to a nucleic acid
target if it forms a specific duplex with the target by base
pairing interactions (see above).)
[0171] "Specific hybridization" is defined herein as the formation
of hybrids between a first polynucleotide and a second
polynucleotide (e.g., a polynucleotide having a distinct but
substantially identical sequence to the first polynucleotide),
wherein substantially unrelated polynucleotide sequences do not
form hybrids in the mixture.
[0172] The term "specific polynucleotide" means a polynucleotide
having certain end points and having a certain nucleic acid
sequence. Two polynucleotides wherein one polynucleotide has the
identical sequence as a portion of the second polynucleotide but
different ends comprises two different specific
polynucleotides.
[0173] "Stringent hybridization conditions" means hybridization
will occur only if there is at least 90% identity, preferably at
least 95% identity and most preferably at least 97% identity
between the sequences. See Sambrook et al, 1989, which is hereby
incorporated by reference in its entirety.
[0174] Also included in the invention are polypeptides having
sequences that are "substantially identical" to the sequence of a
phytase polypeptide, such as one of SEQ ID 1. A "substantially
identical" amino acid sequence is a sequence that differs from a
reference sequence only by conservative amino acid substitutions,
for example, substitutions of one amino acid for another of the
same class (e.g., substitution of one hydrophobic amino acid, such
as isoleucine, valine, leucine, or methionine, for another, or
substitution of one polar amino acid for another, such as
substitution of arginine for lysine, glutamic acid for aspartic
acid, or glutamine for asparagine).
[0175] Additionally a "substantially identical" amino acid sequence
is a sequence that differs from a reference sequence or by one or
more non-conservative substitutions, deletions, or insertions,
particularly when such a substitution occurs at a site that is not
the active site the molecule, and provided that the polypeptide
essentially retains its behavioural properties. For example, one or
more amino acids can be deleted from a phytase polypeptide,
resulting in modification of the structure of the polypeptide,
without significantly altering its biological activity. For
example, amino- or carboxyl-terminal amino acids that are not
required for phytase biological activity can be removed. Such
modifications can result in the development of smaller active
phytase polypeptides.
[0176] The present invention provides a "substantially pure
enzyme". The term "substantially pure enzyme" is used herein to
describe a molecule, such as a polypeptide (e.g., a phytase
polypeptide, or a fragment thereof) that is substantially free of
other proteins, lipids, carbohydrates, nucleic acids, and other
biological materials with which it is naturally associated. For
example, a substantially pure molecule, such as a polypeptide, can
be at least 60%, by dry weight, the molecule of interest. The
purity of the polypeptides can be determined using standard methods
including, e.g., polyacrylamide gel electrophoresis (e.g.,
SDS-PAGE), column chromatography (e.g., high performance liquid
chromatography (HPLC)), and amino-terminal amino acid sequence
analysis.
[0177] As used herein, "substantially pure" means an object species
is the predominant species present (i.e., on a molar basis it is
more abundant than any other individual macromolecular species in
the composition), and preferably substantially purified fraction is
a composition wherein the object species comprises at least about
50 percent (on a molar basis) of all macromolecular species
present. Generally, a substantially pure composition will comprise
more than about 80 to 90 percent of all macromolecular species
present in the composition. Most preferably, the object species is
purified to essential homogeneity (contaminant species cannot be
detected in the composition by conventional detection methods)
wherein the composition consists essentially of a single
macromolecular species. Solvent species, small molecules (<500
Daltons), and elemental ion species are not considered
macromolecular species.
[0178] As used herein, the term "variable segment" refers to a
portion of a nascent peptide which comprises a random,
pseudorandom, or defined kernal sequence. A variable segment"
refers to a portion of a nascent peptide which comprises a random
pseudorandom, or defined kernal sequence. A variable segment can
comprise both variant and invariant residue positions, and the
degree of residue variation at a variant residue position may be
limited: both options are selected at the discretion of the
practitioner. Typically, variable segments are about 5 to 20 amino
acid residues in length (e.g., 8 to 10), although variable segments
may be longer and may comprise antibody portions or receptor
proteins, such as an antibody fragment, a nucleic acid binding
protein, a receptor protein, and the like.
[0179] The term "wild-type" means that the polynucleotide does not
comprise any mutations. A "wild type" protein means that the
protein will be active at a level of activity found in nature and
will comprise the amino acid sequence found in nature.
[0180] The term "working", as in "working sample", for example, is
simply a sample with which one is working. Likewise, a "working
molecule", for example is a molecule with which one is working.
DETAILED DESCRIPTION OF THE INVENTION
[0181] The invention described herein is directed to the use of
repeated cycles of reductive reassortment, recombination and
selection which allow for the directed molecular evolution of
highly complex linear sequences, such as DNA, RNA or proteins
thorough recombination.
[0182] In vivo shuffling of molecules can be performed utilizing
the natural property of cells to recombine multimers. While
recombination in vivo has provided the major natural route to
molecular diversity, genetic recombination remains a relatively
complex process that involves 1) the recognition of homologies; 2)
strand cleavage, strand invasion, and metabolic steps leading to
the production of recombinant chiasma; and finally 3) the
resolution of chiasma into discrete recombined molecules. The
formation of the chiasma requires the recognition of homologous
sequences.
[0183] In a preferred embodiment, the invention relates to a method
for producing a hybrid polynucleotide from at least a first
polynucleotide and a second polynucleotide. The present invention
can be used to produce a hybrid polynucleotide by introducing at
least a first polynucleotide and a second polynucleotide which
share at least one region of partial sequence homology into a
suitable host cell. The regions of partial sequence homology
promote processes which result in sequence reorganization producing
a hybrid polynucleotide. The term "hybrid polynucleotide", as used
herein, is any nucleotide sequence which results from the method of
the present invention and contains sequence from at least two
original polynucleotide sequences. Such hybrid polynucleotides can
result from intermolecular recombination events which promote
sequence integration between DNA molecules. In addition, such
hybrid polynucleotides can result from intramolecular reductive
reassortment processes which utilize repeated sequences to alter a
nucleotide sequence within a DNA molecule.
[0184] The invention provides a means for generating hybrid
polynucleotides which may encode biologically active hybrid
polypeptides. In one aspect, the original polynucleotides encode
biologically active polypeptides. The method of the invention
produces new hybrid polypeptides by utilizing cellular processes
which integrate the sequence of the original polynucleotides such
that the resulting hybrid polynucleotide encodes a polypeptide
demonstrating activities derived from the original biologically
active polypeptides. For example, the original polynucleotides may
encode a particular enzyme from different microorganisms. An enzyme
encoded by a first polynucleotide from one organism may, for
example, function effectively under a particular environmental
condition, e.g. high salinity. An enzyme encoded by a second
polynucleotide from a different organism may function effectively
under a different environmental condition, such as extremely high
temperatures. A hybrid polynucleotide containing sequences from the
first and second original polynucleotides may encode an enzyme
which exhibits characteristics of both enzymes encoded by the
original polynucleotides. Thus, the enzyme encoded by the hybrid
polynucleotide may function effectively under environmental
conditions shared by each of the enzymes encoded by the first and
second polynucleotides, e.g., high salinity and extreme
temperatures.
[0185] Enzymes encoded by the original polynucleotides of the
invention include, but are not limited to; oxidoreductases,
transferases, hydrolases, lyases, isomerases and ligases. A hybrid
polypeptide resulting from the method of the invention may exhibit
specialized enzyme activity not displayed in the original enzymes.
For example, following recombination and/or reductive reassortment
of polynucleotides encoding hydrolase activities, the resulting
hybrid polypeptide encoded by a hybrid polynucleotide can be
screened for specialized hydrolase activities obtained from each of
the original enzymes, i.e. the type of bond on which the hydrolase
acts and the temperature at which the hydrolase functions. Thus,
for example, the hydrolase may be screened to ascertain those
chemical functionalities which distinguish the hybrid hydrolase
from the original hydrolyases, such as: (a) amide (peptide bonds),
i.e. proteases; (b) ester bonds, i.e. esterases and lipases; (c)
acetals, i.e., glycosidases and, for example, the temperature, pH
or salt concentration at which the hybrid polypeptide
functions.
[0186] Sources of the original polynucleotides may be isolated from
individual organisms ("isolates"), collections of organisms that
have been grown in defined media ("enrichment cultures"), or, most
preferably, uncultivated organisms ("environmental samples"). The
use of a culture-independent approach to derive polynucleotides
encoding novel bioactivities from environmental samples is most
preferable since it allows one to access untapped resources of
biodiversity.
[0187] "Environmental libraries" are generated from environmental
samples and represent the collective genomes of naturally occurring
organisms archived in cloning vectors that can be propagated in
suitable prokaryotic hosts. Because the cloned DNA is initially
extracted directly from environmental samples, the libraries are
not limited to the small fraction of prokaryotes that can be grown
in pure culture. Additionally, a normalization of the environmental
DNA present in these samples could allow more equal representation
of the DNA from all of the species present in the original sample.
This can dramatically increase the efficiency of finding
interesting genes from minor constituents of the sample which may
be under-represented by several orders of magnitude compared to the
dominant species.
[0188] For example, gene libraries generated from one or more
uncultivated microorganisms are screened for an activity of
interest. Potential pathways encoding bioactive molecules of
interest are first captured in prokaryotic cells in the form of
gene expression libraries. Polynucleotides encoding activities of
interest are isolated from such libraries and introduced into a
host cell. The host cell is grown under conditions which promote
recombination and/or reductive reassortment creating potentially
active biomolecules with novel or enhanced activities.
[0189] The microorganisms from which the polynucleotide may be
prepared include prokaryotic microorganisms, such as Eubacteria and
Archaebacteria, and lower eukaryotic microorganisms such as fungi,
some algae and protozoa. Polynucleotides may be isolated from
environmental samples in which case the nucleic acid may be
recovered without culturing of an organism or recovered from one or
more cultured organisms. In one aspect, such microorganisms may be
extremophiles, such as hyperthermophiles, psychrophiles,
psychrotrophs, halophiles, barophiles and acidophiles.
Polynucleotides encoding enzymes isolated from extremophilic
microorganisms are particularly preferred. Such enzymes may
function at temperatures above 100.degree. C. in terrestrial hot
springs and deep sea thermal vents, at temperatures below 0.degree.
C. in arctic waters, in the saturated salt environment of the Dead
Sea, at pH values around 0 in coal deposits and geothermal
sulfur-rich springs, or at pH values greater than 11 in sewage
sludge. For example, several esterases and lipases cloned and
expressed from extremophilic organisms show high activity
throughout a wide range of temperatures and pHs.
[0190] Polynucleotides selected and isolated as hereinabove
described are introduced into a suitable host cell. A suitable host
cell is any cell which is capable of promoting recombination and/or
reductive reassortment. The selected polynucleotides are preferably
already in a vector which includes appropriate control sequences.
The host cell can be a higher eukaryotic cell, such as a mammalian
cell, or a lower eukaryotic cell, such as a yeast cell, or
preferably, the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host cell
can be effected by calcium phosphate transfection, DEAE-Dextran
mediated transfection, or electroporation (Davis et al, 1986).
[0191] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; and plant cells. The selection
of an appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
[0192] With particular references to various mammalian cell culture
systems that can be employed to express recombinant protein,
examples of mammalian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described in "SV40-transformed simian
cells support the replication of early SV40 mutants" (Gluzman,
1981), and other cell lines capable of expressing a compatible
vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
Mammalian expression vectors will comprise an origin of
replication, a suitable promoter and enhancer, and also any
necessary ribosome binding sites, polyadenylation site, splice
donor and acceptor sites, transcriptional termination sequences,
and 5' flanking nontranscribed sequences. DNA sequences derived
from the SV40 splice, and polyadenylation sites may be used to
provide the required nontranscribed genetic elements.
[0193] Host cells containing the polynucleotides of interest can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying genes.
The culture conditions, such as temperature, pH and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan. The clones
which are identified as having the specified enzyme activity may
then be sequenced to identify the polynucleotide sequence encoding
an enzyme having the enhanced activity. In another aspect, it is
envisioned the method of the present invention can be used to
generate novel polynucleotides encoding biochemical pathways from
one or more operons or gene clusters or portions thereof. For
example, bacteria and many eukaryotes have a coordinated mechanism
for regulating genes whose products are involved in related
processes. The genes are clustered, in structures referred to as
"gene clusters," on a single chromosome and are transcribed
together under the control of a single regulatory sequence,
including a single promoter which initiates transcription of the
entire cluster. Thus, a gene cluster is a group of adjacent genes
that are either identical or related, usually as to their function.
An example of a biochemical pathway encoded by gene clusters are
polyketides. Polyketides are molecules which are an extremely rich
source of bioactivities, including antibiotics (such as
tetracyclines and erythromycin), anti-cancer agents (daunomycin),
immunosuppressants (FK506 and rapamycin), and veterinary products
(monensin). Many polyketides (produced by polyketide synthases) are
valuable as therapeutic agents. Polyketide synthases are
multifunctional enzymes that catalyze the biosynthesis of an
enormous variety of carbon chains differing in length and patterns
of functionality and cyclization. Polyketide synthase genes fall
into gene clusters and at least one type (designated type I) of
polyketide synthases have large size genes and enzymes,
complicating genetic manipulation and in vitro studies of these
genes/proteins.
[0194] The ability to select and combine desired components from a
library of polyketides, or fragments thereof, and postpolyketide
biosynthesis genes for generation of novel polyketides for study is
appealing. The method of the present invention makes it possible to
facilitate the production of novel polyketide synthases through
intermolecular recombination.
[0195] Preferably, gene cluster DNA can be isolated from different
organisms and ligated into vectors, particularly vectors containing
expression regulatory sequences which can control and regulate the
production of a detectable protein or protein-related array
activity from the ligated gene clusters. Use of vectors which have
an exceptionally large capacity for exogenous DNA introduction are
particularly appropriate for use with such gene clusters and are
described by way of example herein to include the f-factor (or
fertility factor) of E. coli. This f-factor of E. coli is a plasmid
which affect high-frequency transfer of itself during conjugation
and is ideal to achieve and stably propagate large DNA fragments,
such as gene clusters from mixed microbial samples. Once ligated
into an appropriate vector, two or more vectors containing
different polyketide synthase gene clusters can be introduced into
a suitable host cell. Regions of partial sequence homology shared
by the gene clusters will promote processes which result in
sequence reorganization resulting in a hybrid gene cluster. The
novel hybrid gene cluster can then be screened for enhanced
activities not found in the original gene clusters.
[0196] Therefore, in a preferred embodiment, the present invention
relates to a method for producing a biologically active hybrid
polypeptide and screening such a polypeptide for enhanced activity
by:
[0197] 1) introducing at least a first polynucleotide in operable
linkage and a second polynucleotide in operable linkage, said at
least first polynucleotide and second polynucleotide sharing at
least one region of partial sequence homology, into a suitable host
cell;
[0198] 2) growing the host cell under conditions which promote
sequence reorganization resulting in a hybrid polynucleotide in
operable linkage;
[0199] 3) expressing a hybrid polypeptide encoded by the hybrid
polynucleotide;
[0200] 4) screening the hybrid polypeptide under conditions which
promote identification of enhanced biological activity; and
[0201] 5) isolating the a polynucleotide encoding the hybrid
polypeptide.
[0202] Methods for screening for various enzyme activities are
known to those of skill in the art and discussed throughout the
present specification. Such methods may be employed when isolating
the polypeptides and polynucleotides of the present invention.
[0203] As representative examples of expression vectors which may
be used there may be mentioned viral particles, baculovirus, phage,
plasmids, phagemids, cosmids, fosmids, bacterial artificial
chromosomes, viral DNA (e.g. vaccinia, adenovirus, foul pox virus,
pseudorabies and derivatives of SV40), P1-based artificial
chromosomes, yeast plasmids, yeast artificial chromosomes, and any
other vectors specific for specific hosts of interest (such as
bacillus, aspergillus and yeast). Thus, for example, the DNA may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences. Large numbers of
suitable vectors are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids,
pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3,
pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene),
pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid
or other vector may be used as long as they are replicable and
viable in the host. Low copy number or high copy number vectors may
be employed with the present invention.
[0204] A preferred type of vector for use in the present invention
contains an f-factor origin replication. The f-factor (or fertility
factor) in E. coli is a plasmid which effects high frequency
transfer of itself during conjugation and less frequent transfer of
the bacterial chromosome itself. A particularly preferred
embodiment is to use cloning vectors, referred to as "fosmids" or
bacterial artificial chromosome (BAC) vectors. These are derived
from E. coli f-factor which is able to stably integrate large
segments of genomic DNA. When integrated with DNA from a mixed
uncultured environmental sample, this makes it possible to achieve
large genomic fragments in the form of a stable "environmental DNA
library."
[0205] Another preferred type of vector for use in the present
invention is a cosmid vector. Cosmid vectors were originally
designed to clone and propagate large segments of genomic DNA.
Cloning into cosmid vectors is described in detail in "Molecular
Cloning: A laboratory Manual" (Sambrook et al, 1989).
[0206] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct RNA synthesis. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda P.sub.R, P.sub.L and trp.
Eukaryotic promoters include CMV immediate early, HSV thymidine
kinase, early and late SV40, LTRs from retrovirus, and mouse
metallothionein-I. Selection of the appropriate vector and promoter
is well within the level of ordinary skill in the art. The
expression vector also contains a ribosome binding site for
translation initiation and a transcription terminator. The vector
may also include appropriate sequences for amplifying expression.
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol transferase) vectors or other vectors with
selectable markers.
[0207] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0208] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP 1 gene, and a promoter
derived from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium.
[0209] The cloning strategy permits expression via both vector
driven and endogenous promoters; vector promotion may be important
with expression of genes whose endogenous promoter will not
function in E. coli.
[0210] The DNA isolated or derived from microorganisms can
preferably be inserted into a vector or a plasmid prior to probing
for selected DNA. Such vectors or plasmids are preferably those
containing expression regulatory sequences, including promoters,
enhancers and the like. Such polynucleotides can be part of a
vector and/or a composition and still be isolated, in that such
vector or composition is not part of its natural environment.
Particularly preferred phage or plasmid and methods for
introduction and packaging into them are described in detail in the
protocol set forth herein.
[0211] The selection of the cloning vector depends upon the
approach taken, for example, the vector can be any cloning vector
with an adequate capacity to multiply repeated copies of a
sequence, or multiple sequences that can be successfully
transformed and selected in a host cell. One example of such a
vector is described in "Polycos vectors: a system for packaging
filamentous phage and phagemid vectors using lambda phage packaging
extracts" (Alting-Mecs and Short, 1993). Propagation/maintenance
can be by an antibiotic resistance carried by the cloning vector.
After a period of growth, the naturally abbreviated molecules are
recovered and identified by size fractionation on a gel or column,
or amplified directly. The cloning vector utilized may contain a
selectable gene that is disrupted by the insertion of the lengthy
construct. As reductive reassortment progresses, the number of
repeated units is reduced and the interrupted gene is again
expressed and hence selection for the processed construct can be
applied. The vector may be an expression/selection vector which
will allow for the selection of an expressed product possessing
desirable biologically properties. The insert may be positioned
downstream of a functional promotor and the desirable property
screened by appropriate means.
[0212] In vivo reassortment is focused on "inter-molecular"
processes collectively referred to as "recombination" which in
bacteria, is generally viewed as a "RecA-dependent" phenomenon. The
present invention can rely on recombination processes of a host
cell to recombine and re-assort sequences, or the cells' ability to
mediate reductive processes to decrease the complexity of
quasi-repeated sequences in the cell by deletion. This process of
"reductive reassortment" occurs by an "intra-molecular",
RecA-independent process.
[0213] Therefore, in another aspect of the present invention, novel
polynucleotides can be generated by the process of reductive
reassortment. The method involves the generation of constructs
containing consecutive sequences (original encoding sequences),
their insertion into an appropriate vector, and their subsequent
introduction into an appropriate host cell. The reassortment of the
individual molecular identities occurs by combinatorial processes
between the consecutive sequences in the construct possessing
regions of homology, or between quasi-repeated units. The
reassortment process recombines and/or reduces the complexity and
extent of the repeated sequences, and results in the production of
novel molecular species. Various treatments may be applied to
enhance the rate of reassortment. These could include treatment
with ultra-violet light, or DNA damaging chemicals, and/or the use
of host cell lines displaying enhanced levels of "genetic
instability". Thus the reassortment process may involve homologous
recombination or the natural property of quasi-repeated sequences
to direct their own evolution.
[0214] Repeated or "quasi-repeated" sequences play a role in
genetic instability. In the present invention, "quasi-repeats" are
repeats that are not restricted to their original unit structure.
Quasi-repeated units can be presented as an array of sequences in a
construct; consecutive units of similar sequences. Once ligated,
the junctions between the consecutive sequences become essentially
invisible and the quasi-repetitive nature of the resulting
construct is now continuous at the molecular level. The deletion
process the cell performs to reduce the complexity of the resulting
construct operates between the quasi-repeated sequences. The
quasi-repeated units provide a practically limitless repertoire of
templates upon which slippage events can occur. The constructs
containing the quasi-repeats thus effectively provide sufficient
molecular elasticity that deletion (and potentially insertion)
events can occur virtually anywhere within the quasi-repetitive
units.
[0215] When the quasi-repeated sequences are all ligated in the
same orientation, for instance head to tail or vice versa, the cell
cannot distinguish individual units. Consequently, the reductive
process can occur throughout the sequences. In contrast, when for
example, the units are presented head to head, rather than head to
tail, the inversion delineates the endpoints of the adjacent unit
so that deletion formation will favor the loss of discrete units.
Thus, it is preferable with the present method that the sequences
are in the same orientation. Random orientation of quasi-repeated
sequences will result in the loss of reassortment efficiency, while
consistent orientation of the sequences will offer the highest
efficiency. However, while having fewer of the contiguous sequences
in the same orientation decreases the efficiency, it may still
provide sufficient elasticity for the effective recovery of novel
molecules. Constructs can be made with the quasi-repeated sequences
in the same orientation to allow higher efficiency.
[0216] Sequences can be assembled in a head to tail orientation
using any of a variety of methods, including the following:
[0217] a) Primers that include a poly-A head and poly-T tail which
when made single-stranded would provide orientation can be
utilized. This is accomplished by having the first few bases of the
primers made from RNA and hence easily removed RNAseH.
[0218] b) Primers that include unique restriction cleavage sites
can be utilized. Multiple sites, a battery of unique sequences, and
repeated synthesis and ligation steps would be required.
[0219] c) The inner few bases of the primer could be thiolated and
an exonuclease used to produce properly tailed molecules.
[0220] The recovery of the re-assorted sequences relies on the
identification of cloning vectors with a reduced RI. The
re-assorted encoding sequences can then be recovered by
amplification. The products are re-cloned and expressed. The
recovery of cloning vectors with reduced RI can be effected by:
[0221] 1) The use of vectors only stably maintained when the
construct is reduced in complexity.
[0222] 2) The physical recovery of shortened vectors by physical
procedures. In this case, the cloning vector would be recovered
using standard plasmid isolation procedures and size fractionated
on either an agarose gel, or column with a low molecular weight cut
off utilizing standard procedures.
[0223] 3) The recovery of vectors containing interrupted genes
which can be selected when insert size decreases.
[0224] 4) The use of direct selection techniques with an expression
vector and the appropriate selection.
[0225] Encoding sequences (for example, genes) from related
organisms may demonstrate a high degree of homology and encode
quite diverse protein products. These types of sequences are
particularly useful in the present invention as quasi-repeats.
However, while the examples illustrated below demonstrate the
reassortment of nearly identical original encoding sequences
(quasi-repeats), this process is not limited to such nearly
identical repeats.
[0226] The following example demonstrates the method of the
invention. Encoding nucleic acid sequences (quasi-repeats) derived
from three (3) unique species are depicted. Each sequence encodes a
protein with a distinct set of properties. Each of the sequences
differs by a single or a few base pairs at a unique position in the
sequence which are designated "A", "B" and "C". The quasi-repeated
sequences are separately or collectively amplified and ligated into
random assemblies such that all possible permutations and
combinations are available in the population of ligated molecules.
The number of quasi-repeat units can be controlled by the assembly
conditions. The average number of quasi-repeated units in a
construct is defined as the repetitive index (RI).
[0227] Once formed, the constructs may, or may not be size
fractionated on an agarose gel according to published protocols,
inserted into a cloning vector, and transfected into an appropriate
host cell. The cells are then propagated and "reductive
reassortment" is effected. The rate of the reductive reassortment
process may be stimulated by the introduction of DNA damage if
desired. Whether the reduction in RI is mediated by deletion
formation between repeated sequences by an "intra-molecular"
mechanism, or mediated by recombination-like events through
"inter-molecular" mechanisms is immaterial. The end result is a
reassortment of the molecules into all possible combinations.
[0228] Optionally, the method comprises the additional step of
screening the library members of the shuffled pool to identify
individual shuffled library members having the ability to bind or
otherwise interact (e.g., such as catalytic antibodies) with a
predetermined macromolecule, such as for example a proteinaceous
receptor, peptide oligosaccharide, viron, or other predetermined
compound or structure.
[0229] The displayed polypeptides, antibodies, peptidomimetic
antibodies, and variable region sequences that are identified from
such libraries can be used for therapeutic, diagnostic, research
and related purposes (e.g., catalysts, solutes for increasing
osmolarity of an aqueous solution, and the like), and/or can be
subjected to one or more additional cycles of shuffling and/or
affinity selection. The method can be modified such that the step
of selecting for a phenotypic characteristic can be other than of
binding affinity for a predetermined molecule (e.g., for catalytic
activity, stability oxidation resistance, drug resistance, or
detectable phenotype conferred upon a host cell).
[0230] The present invention provides a method for generating
libraries of displayed antibodies suitable for affinity
interactions screening. The method comprises (1) obtaining first a
plurality of selected library members comprising a displayed
antibody and an associated polynucleotide encoding said displayed
antibody, and obtaining said associated polynucleotide encoding for
said displayed antibody and obtaining said associated
polynucleotides or copies thereof, wherein said associated
polynucleotides comprise a region of substantially identical
variable region framework sequence, and (2) introducing said
polynucleotides into a suitable host cell and growing the cells
under conditions which promote recombination and reductive
reassortment resulting in shuffled polynucleotides. CDR
combinations comprised by the shuffled pool are not present in the
first plurality of selected library members, said shuffled pool
composing a library of displayed antibodies comprising CDR
permutations and suitable for affinity interaction screening.
Optionally, the shuffled pool is subjected to affinity screening to
select shuffled library members which bind to a predetermined
epitope (antigen) and thereby selecting a plurality of selected
shuffled library members. Further, the plurality of selectively
shuffled library members can be shuffled and screened iteratively,
from 1 to about 1000 cycles or as desired until library members
having a desired binding affinity are obtained.
[0231] In another aspect of the invention, it is envisioned that
prior to or during recombination or reassortment, polynucleotides
generated by the method of the present invention can be subjected
to agents or processes which promote the introduction of mutations
into the original polynucleotides. The introduction of such
mutations would increase the diversity of resulting hybrid
polynucleotides and polypeptides encoded therefrom. The agents or
processes which promote mutagenesis can include, but are not
limited to: (+)-CC-1065, or a synthetic analog such as
(+)-CC-1065-(N3-Adenine, see Sun and Hurley, 1992); an N-acelylated
or deacetylated 4'-fluro-4-aminobiphenyl adduct capable of
inhibiting DNA synthesis (see, for example, van de Poll et al,
1992); or a N-acetylated or deacetylated 4-aminobiphenyl adduct
capable of inhibiting DNA synthesis (see also, van de Poll et al,
1992, pp. 751-758); trivalent chromium, a trivalent chromium salt,
a polycyclic aromatic hydrocarbon ("PAH") DNA adduct capable of
inhibiting DNA replication, such as
7-bromomethyl-benz[.alpha.]anthracene ("BMA"),
tris(2,3-dibromopropyl)pho- sphate ("Tris-BP"),
1,2-dibromo-3-chloropropane ("DBCP"), 2-bromoacrolein (2BA),
benzo[.alpha.]pyrene-7,8-dihydrodiol-9-10-epoxide ("BPDE"), a
platinum(II) halogen salt,
N-hydroxy-2-amino-3-methylimidazo[4,5f]-quinol- ine
("N-hydroxy-IQ"), and
N-hydroxy-2-amino-1-methyl-6-phenylimidazo[4,5f]- -pyridine
("N-hydroxy-PhIP"). Especially preferred "means for slowing or
halting PCR amplification consist of UV light (+)-CC-1065 and
(+)-CC-1065-(N3-Adenine). Particularly encompassed means are DNA
adducts or polynucleotides comprising the DNA adducts from the
polynucleotides or polynucleotides pool, which can be released or
removed by a process including heating the solution comprising the
polynucleotides prior to further processing.
[0232] In another aspect the present invention is directed to a
method of producing recombinant proteins having biological activity
by treating a sample comprising double-stranded template
polynucleotides encoding a wild-type protein under conditions
according to the present invention which provide for the production
of hybrid or re-assorted polynucleotides.
[0233] The invention also provides the use of polynucleotide
shuffling to shuffle a population of viral genes (e.g., capsid
proteins, spike glycoproteins, polymerases, and proteases) or viral
genomes (e.g., paramyxoviridae, orthomyxoviridae, herpesviruses,
retroviruses, reoviruses and rhinoviruses). In an embodiment, the
invention provides a method for shuffling sequences encoding all or
portions of immunogenic viral proteins to generate novel
combinations of epitopes as well as novel epitopes created by
recombination; such shuffled viral proteins may comprise epitopes
or combinations of epitopes as well as novel epitopes created by
recombination; such shuffled viral proteins may comprise epitopes
or combinations of epitopes which are likely to arise in the
natural environment as a consequence of viral evolution; (e.g.,
such as recombination of influenza virus strains).
[0234] The invention also provides a method suitable for shuffling
polynucleotide sequences for generating gene therapy vectors and
replication-defective gene therapy constructs, such as may be used
for human gene therapy, including but not limited to vaccination
vectors for DNA-based vaccination, as well as anti-neoplastic gene
therapy and other general therapy formats.
[0235] In the polypeptide notation used herein, the left-hand
direction is the amino terminal direction and the right-hand
direction is the carboxy-terminal direction, in accordance with
standard usage and convention. Similarly, unless specified
otherwise, the left-hand end of single-stranded polynucleotide
sequences is the 5' end; the left-hand direction of double-stranded
polynucleotide sequences is referred to as the 5' direction. The
direction of 5' to 3' addition of nascent RNA transcripts is
referred to as the transcription direction; sequence regions on the
DNA strand having the same sequence as the RNA and which are 5' to
the 5' end of the RNA transcript are referred to as "upstream
sequences"; sequence regions on the DNA strand having the same
sequence as the RNA and which are 3' to the 3' end of the coding
RNA transcript are referred to as "downstream sequences".
[0236] Methodology
[0237] Nucleic acid shuffling is a method for in vitro or in vivo
homologous recombination of pools of shorter or smaller
polynucleotides to produce a polynucleotide or polynucleotides.
Mixtures of related nucleic acid sequences or polynucleotides are
subjected to sexual PCR to provide random polynucleotides, and
reassembled to yield a library or mixed population of recombinant
hybrid nucleic acid molecules or polynucleotides.
[0238] In contrast to cassette mutagenesis, only shuffling and
error-prone PCR allow one to mutate a pool of sequences blindly
(without sequence information other than primers).
[0239] The advantage of the mutagenic shuffling of this invention
over error-prone PCR alone for repeated selection can best be
explained with an example from antibody engineering. Consider DNA
shuffling as compared with error-prone PCR (not sexual PCR). The
initial library of selected pooled sequences can consist of related
sequences of diverse origin (i.e. antibodies from naive mRNA) or
can be derived by any type of mutagenesis (including shuffling) of
a single antibody gene. A collection of selected complementarity
determining regions ("CDRs") is obtained after the first round of
affinity selection. In the diagram the thick CDRs confer onto the
antibody molecule increased affinity for the antigen. Shuffling
allows the free combinatorial association of all of the CDR1s with
all of the CDR2s with all of the CDR3s, for example.
[0240] This method differs from error-prone PCR, in that it is an
inverse chain reaction. In error-prone PCR, the number of
polymerase start sites and the number of molecules grows
exponentially. However, the sequence of the polymerase start sites
and the sequence of the molecules remains essentially the same. In
contrast, in nucleic acid reassembly or shuffling of random
polynucleotides the number of start sites and the number (but not
size) of the random polynucleotides decreases over time. For
polynucleotides derived from whole plasmids the theoretical
endpoint is a single, large concatemeric molecule.
[0241] Since cross-overs occur at regions of homology,
recombination will primarily occur between members of the same
sequence family. This discourages combinations of CDRs that are
grossly incompatible (e.g., directed against different epitopes of
the same antigen). It is contemplated that multiple families of
sequences can be shuffled in the same reaction. Further, shuffling
generally conserves the relative order, such that, for example,
CDR1 will not be found in the position of CDR2.
[0242] Rare shufflants will contain a large number of the best (eg.
highest affinity) CDRs and these rare shufflants may be selected
based on their superior affinity.
[0243] CDRs from a pool of 100 different selected antibody
sequences can be permutated in up to 1006 different ways. This
large number of permutations cannot be represented in a single
library of DNA sequences. Accordingly, it is contemplated that
multiple cycles of DNA shuffling and selection may be required
depending on the length of the sequence and the sequence diversity
desired.
[0244] Error-prone PCR, in contrast, keeps all the selected CDRs in
the same relative sequence, generating a much smaller mutant
cloud.
[0245] The template polynucleotide which may be used in the methods
of this invention may be DNA or RNA. It may be of various lengths
depending on the size of the gene or shorter or smaller
polynucleotide to be recombined or reassembled. Preferably, the
template polynucleotide is from 50 bp to 50 kb. It is contemplated
that entire vectors containing the nucleic acid encoding the
protein of interest can be used in the methods of this invention,
and in fact have been successfully used.
[0246] The template polynucleotide may be obtained by amplification
using the PCR reaction (U.S. Pat. No. 4,683,202 and U.S. Pat. No.
4,683,195) or other amplification or cloning methods. However, the
removal of free primers from the PCR products before subjecting
them to pooling of the PCR products and sexual PCR may provide more
efficient results. Failure to adequately remove the primers from
the original pool before sexual PCR can lead to a low frequency of
crossover clones.
[0247] The template polynucleotide often should be double-stranded.
A double-stranded nucleic acid molecule is recommended to ensure
that regions of the resulting single-stranded polynucleotides are
complementary to each other and thus can hybridize to form a
double-stranded molecule.
[0248] It is contemplated that single-stranded or double-stranded
nucleic acid polynucleotides having regions of identity to the
template polynucleotide and regions of heterology to the template
polynucleotide may be added to the template polynucleotide, at this
step. It is also contemplated that two different but related
polynucleotide templates can be mixed at this step.
[0249] The double-stranded polynucleotide template and any added
double-or single-stranded polynucleotides are subjected to sexual
PCR which includes slowing or halting to provide a mixture of from
about 5 bp to 5 kb or more. Preferably the size of the random
polynucleotides is from about 10 bp to 1000 bp, more preferably the
size of the polynucleotides is from about 20 bp to 500 bp.
[0250] Alternatively, it is also contemplated that double-stranded
nucleic acid having multiple nicks may be used in the methods of
this invention. A nick is a break in one strand of the
double-stranded nucleic acid. The distance between such nicks is
preferably 5 bp to 5 kb, more preferably between 10 bp to 1000 bp.
This can provide areas of self-priming to produce shorter or
smaller polynucleotides to be included with the polynucleotides
resulting from random primers, for example.
[0251] The concentration of any one specific polynucleotide will
not be greater than 1% by weight of the total polynucleotides, more
preferably the concentration of any one specific nucleic acid
sequence will not be greater than 0.1% by weight of the total
nucleic acid.
[0252] The number of different specific polynucleotides in the
mixture will be at least about 100, preferably at least about 500,
and more preferably at least about 1000.
[0253] At this step single-stranded or double-stranded
polynucleotides, either synthetic or natural, may be added to the
random double-stranded shorter or smaller polynucleotides in order
to increase the heterogeneity of the mixture of
polynucleotides.
[0254] It is also contemplated that populations of double-stranded
randomly broken polynucleotides may be mixed or combined at this
step with the polynucleotides from the sexual PCR process and
optionally subjected to one or more additional sexual PCR
cycles.
[0255] Where insertion of mutations into the template
polynucleotide is desired, single-stranded or double-stranded
polynucleotides having a region of identity to the template
polynucleotide and a region of heterology to the template
polynucleotide may be added in a 20 fold excess by weight as
compared to the total nucleic acid, more preferably the
single-stranded polynucleotides may be added in a 10 fold excess by
weight as compared to the total nucleic acid.
[0256] Where a mixture of different but related template
polynucleotides is desired, populations of polynucleotides from
each of the templates may be combined at a ratio of less than about
1:100, more preferably the ratio is less than about 1:40. For
example, a backcross of the wild-type polynucleotide with a
population of mutated polynucleotide may be desired to eliminate
neutral mutations (e.g., mutations yielding an insubstantial
alteration in the phenotypic property being selected for). In such
an example, the ratio of randomly provided wild-type
polynucleotides which may be added to the randomly provided sexual
PCR cycle hybrid polynucleotides is approximately 1:1 to about
100:1, and more preferably from 1:1 to 40:1.
[0257] The mixed population of random polynucleotides are denatured
to form single-stranded polynucleotides and then re-annealed. Only
those single-stranded polynucleotides having regions of homology
with other single-stranded polynucleotides will re-anneal.
[0258] The random polynucleotides may be denatured by heating. One
skilled in the art could determine the conditions necessary to
completely denature the double-stranded nucleic acid. Preferably
the temperature is from 80.degree. C. to 100.degree. C., more
preferably the temperature is from 90.degree. C. to 96.degree. C.
other methods which may be used to denature the polynucleotides
include pressure (36) and pH.
[0259] The polynucleotides may be re-annealed by cooling.
Preferably the temperature is from 20.degree. C. to 75.degree. C.,
more preferably the temperature is from 40.degree. C. to 65.degree.
C. If a high frequency of crossovers is needed based on an average
of only 4 consecutive bases of homology, recombination can be
forced by using a low annealing temperature, although the process
becomes more difficult. The degree of renaturation which occurs
will depend on the degree of homology between the population of
single-stranded polynucleotides.
[0260] Renaturation can be accelerated by the addition of
polyethylene glycol ("PEG") or salt. The salt concentration is
preferably from 0 mM to 200 mM, more preferably the salt
concentration is from 10 mM to 100 mm. The salt may be KCl or NaCl.
The concentration of PEG is preferably from 0% to 20%, more
preferably from 5% to 10%.
[0261] The annealed polynucleotides are next incubated in the
presence of a nucleic acid polymerase and dNTP's (i.e. dATP, dCTP,
DGTP and dTTP). The nucleic acid polymerase may be the Klenow
fragment, the Taq polymerase or any other DNA polymerase known in
the art.
[0262] The approach to be used for the assembly depends on the
minimum degree of homology that should still yield crossovers. If
the areas of identity are large, Taq polymerase can be used with an
annealing temperature of between 45-65.degree. C. If the areas of
identity are small, Klenow polymerase can be used with an annealing
temperature of between 20-30.degree. C. One skilled in the art
could vary the temperature of annealing to increase the number of
cross-overs achieved.
[0263] The polymerase may be added to the random polynucleotides
prior to annealing, simultaneously with annealing or after
annealing.
[0264] The cycle of denaturation, renaturation and incubation in
the presence of polymerase is referred to herein as shuffling or
reassembly of the nucleic acid. This cycle is repeated for a
desired number of times. Preferably the cycle is repeated from 2 to
50 times, more preferably the sequence is repeated from 10 to 40
times.
[0265] The resulting nucleic acid is a larger double-stranded
polynucleotide of from about 50 bp to about 100 kb, preferably the
larger polynucleotide is from 500 bp to 50 kb.
[0266] This larger polynucleotide may contain a number of copies of
a polynucleotide having the same size as the template
polynucleotide in tandem. This concatemeric polynucleotide is then
denatured into single copies of the template polynucleotide. The
result will be a population of polynucleotides of approximately the
same size as the template polynucleotide. The population will be a
mixed population where single or double-stranded polynucleotides
having an area of identity and an area of heterology have been
added to the template polynucleotide prior to shuffling.
[0267] These polynucleotides are then cloned into the appropriate
vector and the ligation mixture used to transform bacteria.
[0268] It is contemplated that the single polynucleotides may be
obtained from the larger concatemeric polynucleotide by
amplification of the single polynucleotide prior to cloning by a
variety of methods including PCR (U.S. Pat. No. 4,683,195 and U.S.
Pat. No. 4,683,202), rather than by digestion of the
concatemer.
[0269] The vector used for cloning is not critical provided that it
will accept a polynucleotide of the desired size. If expression of
the particular polynucleotide is desired, the cloning vehicle
should further comprise transcription and translation signals next
to the site of insertion of the polynucleotide to allow expression
of the polynucleotide in the host cell. Preferred vectors include
the pUC series and the pBR series of plasmids.
[0270] The resulting bacterial population will include a number of
recombinant polynucleotides having random mutations. This mixed
population may be tested to identify the desired recombinant
polynucleotides. The method of selection will depend on the
polynucleotide desired.
[0271] For example, if a polynucleotide which encodes a protein
with increased binding efficiency to a ligand is desired, the
proteins expressed by each of the portions of the polynucleotides
in the population or library may be tested for their ability to
bind to the ligand by methods known in the art (i.e. panning,
affinity chromatography). If a polynucleotide which encodes for a
protein with increased drug resistance is desired, the proteins
expressed by each of the polynucleotides in the population or
library may be tested for their ability to confer drug resistance
to the host organism. One skilled in the art, given knowledge of
the desired protein, could readily test the population to identify
polynucleotides which confer the desired properties onto the
protein.
[0272] It is contemplated that one skilled in the art could use a
phage display system in which fragments of the protein are
expressed as fusion proteins on the phage surface (Pharmacia,
Milwaukee Wis.). The recombinant DNA molecules are cloned into the
phage DNA at a site which results in the transcription of a fusion
protein a portion of which is encoded by the recombinant DNA
molecule. The phage containing the recombinant nucleic acid
molecule undergoes replication and transcription in the cell. The
leader sequence of the fusion protein directs the transport of the
fusion protein to the tip of the phage particle. Thus the fusion
protein which is partially encoded by the recombinant DNA molecule
is displayed on the phage particle for detection and selection by
the methods described above. It is further contemplated that a
number of cycles of nucleic acid shuffling may be conducted with
polynucleotides from a sub-population of the first population,
which sub-population contains DNA encoding the desired recombinant
protein. In this manner, proteins with even higher binding
affinities or enzymatic activity could be achieved.
[0273] It is also contemplated that a number of cycles of nucleic
acid shuffling may be conducted with a mixture of wild-type
polynucleotides and a sub-population of nucleic acid from the first
or subsequent rounds of nucleic acid shuffling in order to remove
any silent mutations from the sub-population.
[0274] Any source of nucleic acid, in purified form can be utilized
as the starting nucleic acid. Thus the process may employ DNA or
RNA including messenger RNA, which DNA or RNA may be single or
double stranded. In addition, a DNA-RNA hybrid which contains one
strand of each may be utilized. The nucleic acid sequence may be of
various lengths depending on the size of the nucleic acid sequence
to be mutated. Preferably the specific nucleic acid sequence is
from 50 to 50000 base pairs. It is contemplated that entire vectors
containing the nucleic acid encoding the protein of interest may be
used in the methods of this invention.
[0275] The nucleic acid may be obtained from any source, for
example, from plasmids such a pBR322, from cloned DNA or RNA or
from natural DNA or RNA from any source including bacteria, yeast,
viruses and higher organisms such as plants or animals. DNA or RNA
may be extracted from blood or tissue material. The template
polynucleotide may be obtained by amplification using the
polynucleotide chain reaction (PCR, see U.S. Pat. No. 4,683,202 and
U.S. Pat. No. 4,683,195). Alternatively, the polynucleotide may be
present in a vector present in a cell and sufficient nucleic acid
may be obtained by culturing the cell and extracting the nucleic
acid from the cell by methods known in the art.
[0276] Any specific nucleic acid sequence can be used to produce
the population of hybrids by the present process. It is only
necessary that a small population of hybrid sequences of the
specific nucleic acid sequence exist or be created prior to the
present process.
[0277] The initial small population of the specific nucleic acid
sequences having mutations may be created by a number of different
methods. Mutations may be created by error-prone PCR. Error-prone
PCR uses low-fidelity polymerization conditions to introduce a low
level of point mutations randomly over a long sequence.
Alternatively, mutations can be introduced into the template
polynucleotide by oligonucleotide-directed mutagenesis. In
oligonucleotide-directed mutagenesis, a short sequence of the
polynucleotide is removed from the polynucleotide using restriction
enzyme digestion and is replaced with a synthetic polynucleotide in
which various bases have been altered from the original sequence.
The polynucleotide sequence can also be altered by chemical
mutagenesis. Chemical mutagens include, for example, sodium
bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid.
other agents which are analogues of nucleotide precursors include
nitrosoguanidine, 5-bromouracil, 2-aminopurine, or acridine.
Generally, these agents are added to the PCR reaction in place of
the nucleotide precursor thereby mutating the sequence.
Intercalating agents such as proflavine, acriflavine, quinacrine
and the like can also be used. Random mutagenesis of the
polynucleotide sequence can also be achieved by irradiation with
X-rays or ultraviolet light. Generally, plasmid polynucleotides so
mutagenized are introduced into E. coli and propagated as a pool or
library of hybrid plasmids.
[0278] Alternatively the small mixed population of specific nucleic
acids may be found in nature in that they may consist of different
alleles of the same gene or the same gene from different related
species (i.e., cognate genes). Alternatively, they may be related
DNA sequences found within one species, for example, the
immunoglobulin genes.
[0279] Once the mixed population of the specific nucleic acid
sequences is generated, the polynucleotides can be used directly or
inserted into an appropriate cloning vector, using techniques
well-known in,the art.
[0280] The choice of vector depends on the size of the
polynucleotide sequence and the host cell to be employed in the
methods of this invention. The templates of this invention may be
plasmids, phages, cosmids, phagemids, viruses (e.g., retroviruses,
parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and
the like), or selected portions thereof (e.g., coat protein, spike
glycoprotein, capsid protein). For example, cosmids and phagemids
are preferred where the specific nucleic acid sequence to be
mutated is larger because these vectors are able to stably
propagate large polynucleotides.
[0281] If the mixed population of the specific nucleic acid
sequence is cloned into a vector it can be clonally amplified by
inserting each vector into a host cell and allowing the host cell
to amplify the vector. This is referred to as clonal amplification
because while the absolute number of nucleic acid sequences
increases, the number of hybrids does not increase. Utility can be
readily determined by screening expressed polypeptides.
[0282] The DNA shuffling method of this invention can be performed
blindly on a pool of unknown sequences. By adding to the reassembly
mixture oligonucleotides (with ends that are homologous to the
sequences being reassembled) any sequence mixture can be
incorporated at any specific position into another sequence
mixture. Thus, it is contemplated that mixtures of synthetic
oligonucleotides, PCR polynucleotides or even whole genes can be
mixed into another sequence library at defined positions. The
insertion of one sequence (mixture) is independent from the
insertion of a sequence in another part of the template. Thus, the
degree of recombination, the homology required, and the diversity
of the library can be independently and simultaneously varied along
the length of the reassembled DNA.
[0283] This approach of mixing two genes may be useful for the
humanization of antibodies from murine hybridomas. The approach of
mixing two genes or inserting alternative sequences into genes may
be useful for any therapeutically used protein, for example,
interleukin I, antibodies, tPA and growth hormone. The approach may
also be useful in any nucleic acid for example, promoters or
introns or 31 untranslated region or 51 untranslated regions of
genes to increase expression or alter specificity of expression of
proteins. The approach may also be used to mutate ribozymes or
aptamers.
[0284] Shuffling requires the presence of homologous regions
separating regions of diversity. Scaffold-like protein structures
may be particularly suitable for shuffling. The conserved scaffold
determines the overall folding by self-association, while
displaying relatively unrestricted loops that mediate the specific
binding. Examples of such scaffolds are the immunoglobulin
beta-barrel, and the four-helix bundle which are well-known in the
art. This shuffling can be used to create scaffold-like proteins
with various combinations of mutated sequences for binding.
Saturation mutagenesis
[0285] In one aspect, this invention provides for the use of
proprietary codon primers (containing a degenerate N,N,G/T
sequence) to introduce point mutations into a polynucleotide, so as
to generate a set of progeny polypeptides in which a full range of
single amino acid substitutions is represented at each amino acid
position. The oligos used are comprised contiguously of a first
homologous sequence, a degenerate N,N,G/T sequence, and preferably
but not necessarily a second homologous sequence. The downstream
progeny translational products from the use of such oligos include
all possible amino acid changes at each amino acid site along the
polypeptide, because the degeneracy of the N,N,G/T sequence
includes codons for all 20 amino acids.
[0286] In one aspect, one such degenerate oligo (comprised of one
degenerate N,N,G/T cassette) is used for subjecting each original
codon in a parental polynucleotide template to a full range of
codon substitutions. In another aspect, at least two degenerate
N,N,G/T cassettes are used--either in the same oligo or not, for
subjecting at least two original codons in a parental
polynucleotide template to a full range of codon substitutions.
Thus, more than one N,N,G/T sequence can be contained in one oligo
to introduce amino acid mutations at more than one site. This
plurality of N,N,G/T sequences can be directly contiguous, or
separated by one or more additional nucleotide sequence(s). In
another aspect, oligos serviceable for introducing additions and
deletions can be used either alone or in combination with the
codons containing an N,N,G/T sequence, to introduce any combination
or permutation of amino acid additions, deletions, and/or
substitutions.
[0287] In a particular exemplification, it is possible to
simultaneously mutagenize two or more contiguous amino acid
positions using an oligo that contains contiguous N,N,G/T triplets,
i.e. a degenerate (N,N,G/T).sub.n sequence.
[0288] In another aspect, the present invention provides for the
use of degenerate cassettes having less degeneracy than the N,N,G/T
sequence. For example, it may be desirable in some instances to use
(e.g. in an oligo) a degenerate triplet sequence comprised of only
one N, where said N can be in the first second or third position of
the triplet. Any other bases including any combinations and
permutations thereof can be used in the remaining two positions of
the triplet. Alternatively, it may be desirable in some instances
to use (e.g. in an oligo) a degenerate N,N,N triplet sequence, or
an N,N, G/C triplet sequence.
[0289] It is appreciated, however, that the use of a degenerate
triplet (such as N,N,G/T or an N,N, G/C triplet sequence) as
disclosed in the instant invention is advantageous for several
reasons. In one aspect, this invention provides a means to
systematically and fairly easily generate the substitution of the
full range of possible amino acids (for a total of 20 amino acids)
into each and every amino acid position in a polypeptide. Thus, for
a 100 amino acid polypeptide, the instant invention provides a way
to systematically and fairly easily generate 2000 distinct species
(i.e. 20 possible amino acids per position X 100 amino acid
positions). It is appreciated that there is provided, through the
use of an oligo containing a degenerate N,N,G/T or an N,N, G/C
triplet sequence, 32 individual sequences that code for 20 possible
amino acids. Thus, in a reaction vessel in which a parental
polynucleotide sequence is subjected to saturation mutagenesis
using one such oligo, there are generated 32 distinct progeny
polynucleotides encoding 20 distinct polypeptides. In contrast, the
use of a non-degenerate oligo in site-directed mutagenesis leads to
only one progeny polypeptide product per reaction vessel.
[0290] This invention also provides for the use of nondegenerate
oligos, which can optionally be used in combination with degenerate
primers disclosed. It is appreciated that in some situations, it is
advantageous to use nondegenerate oligos to generate specific point
mutations in a working polynucleotide. This provides a means to
generate specific silent point mutations, point mutations leading
to corresponding amino acid changes, and point mutations that cause
the generation of stop codons and the corresponding expression of
polypeptide fragments.
[0291] Thus, in a preferred embodiment of this invention, each
saturation mutagenesis reaction vessel contains polynucleotides
encoding at least 20 progeny polypeptide molecules such that all 20
amino acids are represented at the one specific amino acid position
corresponding to the codon position mutagenized in the parental
polynucleotide. The 32-fold degenerate progeny polypeptides
generated from each saturation mutagenesis reaction vessel can be
subjected to clonal amplification (e.g. cloned into a suitable E.
coli host using an expression vector) and subjected to expression
screening. When an individual progeny polypeptide is identified by
screening to display a favorable change in property (when compared
to the parental polypeptide), it can be sequenced to identify the
correspondingly favorable amino acid substitution contained
therein.
[0292] It is appreciated that upon mutagenizing each and every
amino acid position in a parental polypeptide using saturation
mutagenesis as disclosed herein, favorable amino acid changes may
be identified at more than one amino acid position. One or more new
progeny molecules can be generated that contain a combination of
all or part of these favorable amino acid substitutions. For
example, if 2 specific favorable amino acid changes are identified
in each of 3 amino acid positions in a polypeptide, the
permutations include 3 possibilities at each position (no change
from the original amino acid, and each of two favorable changes)
and 3 positions. Thus, there are 3.times.3.times.3 or 27 total
possibilities, including 7 that were previously examined--6 single
point mutations (i.e. 2 at each of three positions) and no change
at any position. In yet another aspect, site-saturation mutagenesis
can be used together with shuffling, chimerization, recombination
and other mutagenizing processes, along with screening. This
invention provides for the use of any mutagenizing process(es),
including saturation mutagenesis, in an iterative manner. In one
exemplification, the iterative use of any mutagenizing process(es)
is used in combination with screening.
[0293] Thus, in a non-limiting exemplification, this invention
provides for the use of a saturation mutagenesis in combination
with additional mutagenization processes, such as process where two
or more related polynucleotides are introduced into a suitable host
cell such that a hybrid polynucleotide is generated by
recombination and reductive reassortment.
[0294] In addition to performing mutagenesis along the entire
sequence of a gene, the instant invention provides that mutagenesis
can be use to replace each of any number of bases in a
polynucleotide sequence, wherein the number of bases to be
mutagenized is preferably every integer from 15 to 100,000. Thus,
instead of mutagenizing every position along a molecule, one can
subject every a discrete number of bases (preferably a subset
totaling from 15 to 100,000) to mutagenesis. Preferably, a separate
nucleotide is used for mutagenizing each position or group of
positions along a polynucleotide sequence. A group of 3 positions
to be mutagenized may be a codon. The mutations are preferably
introduced using a mutagenic primer, containing a heterologous
cassette, also referred to as a mutagenic cassette. Preferred
cassettes can have from 1 to 500 bases. Each nucleotide position in
such heterologous cassettes be N, A, C, G, T, A/C, A/G, A/T, C/G,
C/T, G/T, C/G/T, A/G/T, A/C/T, A/C/G, or E, where E is any base
that is not A, C, G, or T (E can be referred to as a designer
oligo). The tables below show exemplary tri-nucleotide cassettes
(there are over 3000 possibilities in addition to N,N,G/T and N,N,N
and N,N,A/C).
[0295] In a general sense, saturation mutagenesis is comprised of
mutagenizing a complete set of mutagenic cassettes (wherein each
cassette is preferably 1-500 bases in length) in defined
polynucleotide sequence to be mutagenized (wherein the sequence to
be mutagenized is preferably from 15 to 100,000 bases in length).
Thusly, a group of mutations (ranging from 1 to 100 mutations) is
introduced into each cassette to be mutagenized. A grouping of
mutations to be introduced into one cassette can be different or
the same from a second grouping of mutations to be introduced into
a second cassette during the application of one round of saturation
mutagenesis. Such groupings are exemplified by deletions,
additions, groupings of particular codons, and groupings of
particular nucleotide cassettes.
[0296] Defined sequences to be mutagenized (see FIG. 20) include
preferably a whole gene, pathway, cDNA, an entire open reading
frame (ORF), and intire promoter, enhancer,
repressor/transactivator, origin of replication, intron, operator,
or any polynucleotide functional group. Generally, a preferred
"defined sequences" for this purpose may be any polynucleotide that
a 15 base-polynucleotide sequence, and polynucleotide sequences of
lengths between 15 bases and 15,000 bases (this invention
specifically names every integer in between). Considerations in
choosing groupings of codons include types of amino acids encoded
by a degenerate mutagenic cassette.
[0297] In a particularly preferred exemplification a grouping of
mutations that can be introduced into a mutagenic cassette, this
invention specifically provides for degenerate codon substitutions
(using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids at each
position, and a library of polypeptides encoded thereby.
Chimerizations
[0298] In vitro Shuffling
[0299] The equivalents of some standard genetic matings may also be
performed by shuffling in vitro. For example, a "molecular
backcross" can be performed by repeatedly mixing the hybrid's
nucleic acid with the wild-type nucleic acid while selecting for
the mutations of interest. As in traditional breeding, this
approach can be used to combine phenotypes from different sources
into a background of choice. It is useful, for example, for the
removal of neutral mutations that affect unselected characteristics
(i.e. immunogenicity). Thus it can be useful to determine which
mutations in a protein are involved in the enhanced biological
activity and which are not, an advantage which cannot be achieved
by error-prone mutagenesis or cassette mutagenesis methods.
[0300] Large, functional genes can be assembled correctly from a
mixture of small random polynucleotides. This reaction may be of
use for the reassembly of genes from the highly fragmented DNA of
fossils. In addition random nucleic acid fragments from fossils may
be combined with polynucleotides from similar genes from related
species.
[0301] It is also contemplated that the method of this invention
can be used for the in vitro amplification of a whole genome from a
single cell as is needed for a variety of research and diagnostic
applications. DNA amplification by PCR is in practice limited to a
length of about 40 kb. Amplification of a whole genome such as that
of E. coli (5, 000 kb) by PCR would require about 250 primers
yielding 125 forty kb polynucleotides. This approach is not
practical due to the unavailability of sufficient sequence data. On
the other hand, random production of polynucleotides of the genome
with sexual PCR cycles, followed by gel purification of small
polynucleotides will provide a multitude of possible primers. Use
of this mix of random small polynucleotides as primers in a PCR
reaction alone or with the whole genome as the template should
result in an inverse chain reaction with the theoretical endpoint
of a single concatamer containing many copies of the genome.
[0302] 100 fold amplification in the copy number and an average
polynucleotide size of greater than 50 kb may be obtained when only
random polynucleotides are used. It is thought that the larger
concatamer is generated by overlap of many smaller polynucleotides.
The quality of specific PCR products obtained using synthetic
primers will be indistinguishable from the product obtained from
unamplified DNA. It is expected that this approach will be useful
for the mapping of genomes.
[0303] The polynucleotide to be shuffled can be produced as random
or non-random polynucleotides, at the discretion of the
practitioner. Moreover, this invention provides a method of
shuffling that is applicable to a wide range of polynucleotide
sizes and types, including the step of generating polynucleotide
monomers to be used as building blocks in the reassembly of a
larger polynucleotide. For example, the building blocks can be
fragments of genes or they can be comprised of entire genes or gene
pathways, or any combination thereof.
[0304] Exonuclease-mediated shuffling
[0305] In a particular embodiment, this invention provides for a
method for shuffling, assembling, reassembling, recombining,
&/or concatenating at least two polynucleotides to form a
progeny polynucleotide (e.g. a chimeric progeny polynucleotide that
can be expressed to produce a polypeptide or a gene pathway). In a
particular embodiment, a double stranded polynucleotide end (e.g.
two single stranded sequences hybridized to each other as
hybridization partners) is treated with an exonuclease to liberate
nucleotides from one of the two strands, leaving the remaining
strand free of its original partner so that, if desired, the
remaining strand may be used to achieve hybridization to another
partner.
[0306] In a particular aspect, a double stranded polynucleotide end
(that may be part of--or connected to--a polynucleotide or a
nonpolynucleotide sequence) is subjected to a source of exonuclease
activity. Serviceable sources of exonuclease activity may be an
enzyme with 3' exonuclease activity, an enzyme with 5' exonuclease
activity, an enzyme with both 3' exonuclease activity and 5'
exonuclease activity, and any combination thereof. An exonuclease
can be used to liberate nucleotides from one or both ends of a
linear double stranded polynucleotide, and from one to all ends of
a branched polynucleotide having more than two ends. The mechanism
of action of this liberation is believed to be comprised of an
enzymatically-catalyzed hydrolysis of terminal nucleotides, and can
be allowed to proceed in a time-dependent fashion, allowing
experimental control of the progression of the enzymatic
process.
[0307] By contrast, a non-enzymatic step may be used to shuffle,
assemble, reassemble, recombine, and/or concatenate polynucleotide
building blocks that is comprised of subjecting a working sample to
denaturing (or "melting") conditions (for example, by changing
temperature, pH, and/or salinity conditions) so as to melt a
working set of double stranded polynucleotides into single
polynucleotide strands. For shuffling, it is desirable that the
single polynucleotide strands participate to some extent in
annealment with different hybridization partners (i.e. and not
merely revert to exclusive reannealment between what were former
partners before the denaturation step). The presence of the former
hybridization partners in the reaction vessel, however, does not
preclude, and may sometimes even favor, reannealment of a single
stranded polynucleotide with its former partner, to recreate an
original double stranded polynucleotide.
[0308] In contrast to this non-enzymatic shuffling step comprised
of subjecting double stranded polynucleotide building blocks to
denaturation, followed by annealment, the instant invention further
provides an exonuclease-based approach requiring no
denaturation--rather, the avoidance of denaturing conditions and
the maintenance of double stranded polynucleotide substrates in
annealed (i.e. non-denatured) state are necessary conditions for
the action of exonucleases (e.g., exonuclease III and red alpha
gene product). Additionally in contrast, the generation of single
stranded polynucleotide sequences capable of hybridizing to other
single stranded polynucleotide sequences is the result of covalent
cleavage--and hence sequence destruction--in one of the
hybridization partners. For example, an exonuclease III enzyme may
be used to enzymatically liberate 3' terminal nucleotides in one
hybridization strand (to achieve covalent hydrolysis in that
polynucleotide strand); and this favors hybridization of the
remaining single strand to a new partner (since its former partner
was subjected to covalent cleavage).
[0309] By way of further illustration, a specific exonuclease,
namely exonuclease III is provided herein as an example of a 3'
exonuclease; however, other exonucleases may also be used,
including enzymes with 5' exonuclease activity and enzymes with 3'
exonuclease activity, and including enzymes not yet discovered and
enzymes not yet developed. It is particularly appreciated that
enzymes can be discovered, optimized (e.g. engineered by directed
evolution), or both discovered and optimized specifically for the
instantly disclosed approach that have more optimal rates &/or
more highly specific activities &/or greater lack of unwanted
activities. In fact it is expected that the instant invention may
encourage the discovery &/or development of such designer
enzymes. In sum, this invention may be practiced with a variety of
currently available exonuclease enzymes, as well as enzymes not yet
discovered and enzymes not yet developed.
[0310] The exonuclease action of exonuclease III requires a working
double stranded polynucleotide end that is either blunt or has a 5'
overhang, and the exonuclease action is comprised of enzymatically
liberating 3' terminal nucleotides, leaving a single stranded 5'
end that becomes longer and longer as the exonuclease action
proceeds (see FIG. 1). Any 5' overhangs produced by this approach
may be used to hybridize to another single stranded polynucleotide
sequence (which may also be a single stranded polynucleotide or a
terminal overhang of a partially double stranded polynucleotide)
that shares enough homology to allow hybridization. The ability of
these exonuclease III-generated single stranded sequences (e.g. in
5' overhangs) to hybridize to other single stranded sequences
allows two or more polynucleotides to be shuffled, assembled,
reassembled, &/or concatenated.
[0311] Furthermore, it is appreciated that one can protect the end
of a double stranded polynucleotide or render it susceptible to a
desired enzymatic action of a serviceable exonuclease as necessary.
For example, a double stranded polynucleotide end having a 3'
overhang is not susceptible to the exonuclease action of
exonuclease III. However, it may be rendered susceptible to the
exonuclease action of exonuclease III by a variety of means; for
example, it may be blunted by treatment with a polymerase, cleaved
to provide a blunt end or a 5' overhang, joined (ligated or
hybridized) to another double stranded polynucleotide to provide a
blunt end or a 5' overhang, hybridized to a single stranded
polynucleotide to provide a blunt end or a 5' overhang, or modified
by any of a variety of means).
[0312] According to one aspect, an exonuclease may be allowed to
act on one or on both ends of a linear double stranded
polynucleotide and proceed to completion, to near completion, or to
partial completion. When the exonuclease action is allowed to go to
completion, the result will be that the length of each 5' overhang
will be extended far towards the middle region of the
polynucleotide in the direction of what might be considered a
"rendezvous point" (which may be somewhere near the polynucleotide
midpoint). Ultimately, this results in the production of single
stranded polynucleotides (that can become dissociated) that are
each about half the length of the original double stranded
polynucleotide (see FIG. 1). Alternatively, an exonuclease-mediated
reaction can be terminated before proceeding to completion.
[0313] Thus this exonuclease-mediated approach is serviceable for
shuffling, assembling &/or reassembling, recombining, and
concatenating polynucleotide building blocks, which polynucleotide
building blocks can be up to ten bases long or tens of bases long
or hundreds of bases long or thousands of bases long or tens of
thousands of bases long or hundreds of thousands of bases long or
millions of bases long or even longer.
[0314] This exonuclease-mediated approach is based on the action of
double stranded DNA specific exodeoxyribonuclease activity of E.
coli exonuclease III. Substrates for exonuclease III may be
generated by subjecting a double stranded polynucleotide to
fragmentation. Fragmentation may be achieved by mechanical means
(e.g., shearing, sonication, etc.), by enzymatic means (e.g. using
restriction enzymes), and by any combination thereof. Fragments of
a larger polynucleotide may also be generated by
polymerase-mediated synthesis.
[0315] Exonuclease III is a 28K monomeric enzyme, product of the
xthA gene of E. coli with four known activities:
exodeoxyribonuclease (alternatively referred to as exonuclease
herein), RNaseH, DNA-3'-phosphatase, and AP endonuclease. The
exodeoxyribonuclease activity is specific for double stranded DNA.
The mechanism of action is thought to involve enzymatic hydrolysis
of DNA from a 3' end progressively towards a 5' direction, with
formation of nucleoside 5'-phosphates and a residual single strand.
The enzyme does not display efficient hydrolysis of single stranded
DNA, single-stranded RNA, or double-stranded RNA; however it
degrades RNA in an DNA-RNA hybrid releasing nucleoside
5'-phosphates. The enzyme also releases inorganic phosphate
specifically from 3'phosphomonoester groups on DNA, but not from
RNA or short oligonucleotides. Removal of these groups converts the
terminus into a primer for DNA polymerase action.
[0316] Additional examples of enzymes with exonuclease activity
include red-alpha and venom phosphodiesterases. Red alpha
(red.alpha.) gene product (also referred to as lambda exonuclease)
is of bacteriophage .lambda. origin. The red.alpha. gene is
transcribed from the leftward promoter and its product is involved
(24 kD) in recombination. Red alpha gene product acts processively
from 5'-phosphorylated termini to liberate mononucleotides from
duplex DNA (Takahashi & Kobayashi, 1990). Venom
phosphodiesterases (Laskowski, 1980) is capable of rapidly opening
supercoiled DNA.
[0317] Synthetic Ligation Reassembly
[0318] In one aspect, the present invention provides a
non-stochastic method termed synthetic ligation reassembly (SLR),
that is somewhat related to stochastic shuffling, save that the
nucleic acid building blocks are not shuffled or concatenated or
chimerized randomly, but rather are assembled
non-stochastically.
[0319] A particularly glaring difference is that the instant SLR
method does not depend on the presence of a high level of homology
between polynucleotides to be shuffled. In contrast, prior methods,
particularly prior stochastic shuffling methods require that
presence of a high level of homology, particularly at coupling
sites, between polynucleotides to be shuffled. Accordingly these
prior methods favor the regeneration of the original progenitor
molecules, and are suboptimal for generating large numbers of novel
progeny chimeras, particularly full-length progenies. The instant
invention, on the other hand, can be used to non-stochastically
generate libraries (or sets) of progeny molecules comprised of over
10.sup.100 different chimeras. Conceivably, SLR can even be used to
generate libraries comprised of over 10.sup.1000 different progeny
chimeras with (no upper limit in sight).
[0320] Thus, in one aspect, the present invention provides a
method, which method is non-stochastic, of producing a set of
finalized chimeric nucleic acid molecules having an overall
assembly order that is chosen by design, which method is comprised
of the steps of generating by design a plurality of specific
nucleic acid building blocks having serviceable mutually compatible
ligatable ends, and assembling these nucleic acid building blocks,
such that a designed overall assembly order is achieved.
[0321] The mutually compatible ligatable ends of the nucleic acid
building blocks to be assembled are considered to be "serviceable"
for this type of ordered assembly if they enable the building
blocks to be coupled in predetermined orders. Thus, in one aspect,
the overall assembly order in which the nucleic acid building
blocks can be coupled is specified by the design of the ligatable
ends and, if more than one assembly step is to be used, then the
overall assembly order in which the nucleic acid building blocks
can be coupled is also specified by the sequential order of the
assembly step(s). FIG. 4, Panel C illustrates an exemplary assembly
process comprised of 2 sequential steps to achieve a designed
(non-stochastic) overall assembly order for five nucleic acid
building blocks. In a preferred embodiment of this invention, the
annealed building pieces are treated with an enzyme, such as a
ligase (e.g. T4 DNA ligase), achieve covalent bonding of the
building pieces.
[0322] In a preferred embodiment, the design of nucleic acid
building blocks is obtained upon analysis of the sequences of a set
of progenitor nucleic acid templates that serve as a basis for
producing a progeny set of finalized chimeric nucleic acid
molecules. These progenitor nucleic acid templates thus serve as a
source of sequence information that aids in the design of the
nucleic acid building blocks that are to be mutagenized, i.e.
chimerized or shuffled.
[0323] In one exemplification, this invention provides for the
chimerization of a family of related genes and their encoded family
of related products. In a particular exemplification, the encoded
products are enzymes. As a representative list of families of
enzymes which may be mutagenized in accordance with the aspects of
the present invention, there may be mentioned, the following
enzymes and their functions:
[0324] 1 Lipase/Esterase
[0325] a. Enantioselective hydrolysis of esters (lipids)/
thioesters
[0326] 1) Resolution of racemic mixtures
[0327] 2) Synthesis of optically active acids or alcohols from
meso-diesters
[0328] b. Selective syntheses
[0329] 1) Regiospecific hydrolysis of carbohydrate esters
[0330] 2) Selective hydrolysis of cyclic secondary alcohols
[0331] c. Synthesis of optically active esters, lactones, acids,
alcohols
[0332] 1) Transesterification of activated/nonactivated esters
[0333] 2) Interesterification
[0334] 3) Optically active lactones from hydroxyesters
[0335] 4) Regio- and enantioselective ring opening of
anhydrides
[0336] d. Detergents
[0337] e. Fat/Oil conversion
[0338] f. Cheese ripening
[0339] 2 Protease
[0340] a. Ester/amide synthesis
[0341] b. Peptide synthesis
[0342] c. Resolution of racemic mixtures of amino acid esters
[0343] d. Synthesis of non-natural amino acids
[0344] e. Detergents/protein hydrolysis
[0345] 3 Glycosidase/Glycosyl transferase
[0346] a. Sugar/polymer synthesis
[0347] b. Cleavage of glycosidic linkages to form mono, di-and
oligosaccharides
[0348] c. Synthesis of complex oligosaccharides
[0349] d. Glycoside synthesis using UDP-galactosyl transferase
[0350] e. Transglycosylation of disaccharides, glycosyl fluorides,
aryl galactosides
[0351] f. Glycosyl transfer in oligosaccharide synthesis
[0352] g. Diastereoselective cleavage of
.beta.-glucosylsulfoxides
[0353] h. Asymmetric glycosylations
[0354] i. Food processing
[0355] j. Paper processing
[0356] 4 Phosphatase/Kinase
[0357] a. Synthesis/hydrolysis of phosphate esters
[0358] 1) Regio-, enantioselective phosphorylation
[0359] 2) Introduction of phosphate esters
[0360] 3) Synthesize phospholipid precursors
[0361] 4) Controlled polynucleotide synthesis
[0362] b. Activate biological molecule
[0363] c. Selective phosphate bond formation without protecting
groups
[0364] 5 Mono/Dioxygenase
[0365] a. Direct oxyfunctionalization of unactivated organic
substrates
[0366] b. Hydroxylation of alkane, aromatics, steroids
[0367] c. Epoxidation of alkenes
[0368] d. Enantioselective sulphoxidation
[0369] e. Regio- and stereoselective Bayer-Villiger oxidations
[0370] 6 Haloperoxidase
[0371] a. Oxidative addition of halide ion to nucleophilic
sites
[0372] b. Addition of hypohalous acids to olefinic bonds
[0373] c. Ring cleavage of cyclopropanes
[0374] d. Activated aromatic substrates converted to ortho and para
derivatives
[0375] e. 1.3 diketones converted to 2-halo-derivatives
[0376] f. Heteroatom oxidation of sulfur and nitrogen containing
substrates
[0377] g. Oxidation of enol acetates, alkynes and activated
aromatic rings
[0378] 7 Lignin peroxidase/Diarylpropane peroxidase
[0379] a. Oxidative cleavage of C--C bonds
[0380] b. Oxidation of benzylic alcohols to aldehydes
[0381] c. Hydroxylation of benzylic carbons
[0382] d. Phenol dimerization
[0383] e. Hydroxylation of double bonds to form diols
[0384] f. Cleavage of lignin aldehydes
[0385] 8 Epoxide hydrolase
[0386] a. Synthesis of enantiomerically pure bioactive
compounds
[0387] b. Regio- and enantioselective hydrolysis of epoxide
[0388] c. Aromatic and olefinic epoxidation by monooxygenases to
form epoxides
[0389] d. Resolution of racemic epoxides
[0390] e. Hydrolysis of steroid epoxides
[0391] 9 Nitrile hydratase/nitrilase
[0392] a. Hydrolysis of aliphatic nitrites to carboxamides
[0393] b. Hydrolysis of aromatic, heterocyclic, unsaturated
aliphatic nitrites to corresponding acids
[0394] c. Hydrolysis of acrylonitrile
[0395] d. Production of aromatic and carboxamides, carboxylic acids
(nicotinamide, picolinamide, isonicotinamide)
[0396] e. Regioselective hydrolysis of acrylic dinitrile
[0397] f. i-amino acids from .alpha.-hydroxynitriles
[0398] 10 Transaminase
[0399] a. Transfer of amino groups into oxo-acids
[0400] 11 Amidase/Acylase
[0401] a. Hydrolysis of amides, amidines, and other C--N bonds
[0402] b. Non-natural amino acid resolution and synthesis
[0403] These exemplifications, while illustrating certain specific
aspects of the invention, do not portray the limitations or
circumscribe the scope of the disclosed invention.
[0404] Thus according to one aspect of this invention, the
sequences of a plurality of progenitor nucleic acid templates are
aligned in order to select one or more demarcation points, which
demarcation points can be located at an area of homology, and are
comprised of one or more nucleotides, and which demarcation points
are shared by at least two of the progenitor templates. The
demarcation points can be used to delineate the boundaries of
nucleic acid building blocks to be generated. Thus, the demarcation
points identified and selected in the progenitor molecules serve as
potential chimerization points in the assembly of the progeny
molecules.
[0405] Preferably a serviceable demarcation point is an area of
homology (comprised of at least one homologous nucleotide base)
shared by at least two progenitor templates. More preferably a
serviceable demarcation point is an area of homology that is shared
by at least half of the progenitor templates. More preferably still
a serviceable demarcation point is an area of homology that is
shared by at least two thirds of the progenitor templates. Even
more preferably a serviceable demarcation points is an area of
homology that is shared by at least three fourths of the progenitor
templates. Even more preferably still a serviceable demarcation
points is an area of homology that is shared by at almost all of
the progenitor templates. Even more preferably still a serviceable
demarcation point is an area of homology that is shared by all of
the progenitor templates.
[0406] The process of designing nucleic acid building blocks and of
designing the mutually compatible ligatable ends of the nucleic
acid building blocks to be assembled is illustrated in FIGS. 6 and
7. As shown, the alignment of a set of progenitor templates reveals
several naturally occurring demarcation points, and the
identification of demarcation points shared by these templates
helps to non-stochastically determine the building blocks to be
generated and used for the generation of the progeny chimeric
molecules.
[0407] In a preferred embodiment, this invention provides that the
ligation reassembly process is performed exhaustively in order to
generate an exhaustive library. In other words, all possible
ordered combinations of the nucleic acid building blocks are
represented in the set of finalized chimeric nucleic acid
molecules. At the same time, in a particularly preferred
embodiment, the assembly order (i.e. the order of assembly of each
building block in the 5' to 3' sequence of each finalized chimeric
nucleic acid) in each combination is by design (or non-stochastic).
Because of the non-stochastic nature of this invention, the
possibility of unwanted side products is greatly reduced.
[0408] In another preferred embodiment, this invention provides
that, the ligation reassembly process is performed systematically,
for example in order to generate a systematically compartmentalized
library, with compartments that can be screened systematically,
e.g. one by one. In other words this invention provides that,
through the selective and judicious use of specific nucleic acid
building blocks, coupled with the selective and judicious use of
sequentially stepped assembly reactions, an experimental design can
be achieved where specific sets of progeny products are made in
each of several reaction vessels. This allows a systematic
examination and screening procedure to be performed. Thus, it
allows a potentially very large number of progeny molecules to be
examined systematically in smaller groups.
[0409] Because of its ability to perform chimerizations in a manner
that is highly flexible yet exhaustive and systematic as well,
particularly when there is a low level of homology among the
progenitor molecules, the instant invention provides for the
generation of a library (or set) comprised of a large number of
progeny molecules. Because of the non-stochastic nature of the
instant ligation reassembly invention, the progeny molecules
generated preferably comprise a library of finalized chimeric
nucleic acid molecules having an overall assembly order that is
chosen by design. In a particularly preferred embodiment of this
invention, such a generated library is comprised of preferably
greater than 10.sup.3 different progeny molecular species, more
preferably greater than 10.sup.5 different progeny molecular
species, more preferably still greater than 10.sup.10 different
progeny molecular species, more preferably still greater than
10.sup.15 different progeny molecular species, more preferably
still greater than 10.sup.20 different progeny molecular species,
more preferably still greater than 10.sup.30 different progeny
molecular species, more preferably still greater than 10.sup.40
different progeny molecular species, more preferably still greater
than 10.sup.50 different progeny molecular species, more preferably
still greater than 10.sup.60 different progeny molecular species,
more preferably still greater than 10.sup.70 different progeny
molecular species, more preferably still greater than 10.sup.80
different progeny molecular species, more preferably still greater
than 10.sup.100 different progeny molecular preferably still
greater than 10.sup.110 different progeny molecular species, more
preferably still greater than 10.sup.120 different progeny
molecular species, more preferably still greater than 10.sup.130
different progeny molecular species, more preferably still greater
than 10.sup.140 different progeny molecular species, more
preferably still greater than 10.sup.150 different progeny
molecular species, more preferably still greater than 10.sup.175
different progeny molecular species, more preferably still greater
than 10.sup.200 different progeny molecular species, more
preferably still greater than 10.sup.300 different progeny
molecular species, more preferably still greater than 10.sup.400
different progeny molecular species, more preferably still greater
than 10.sup.500 different progeny molecular species, and even more
preferably still greater than 10.sup.1000 different progeny
molecular species.
[0410] In one aspect, a set of finalized chimeric nucleic acid
molecules, produced as described is comprised of a polynucleotide
encoding a polypeptide. According to one preferred embodiment, this
polynucleotide is a gene, which may be a man-made gene. According
to another preferred embodiment, this polynucleotide is a gene
pathway, which may be a man-made gene pathway. This invention
provides that one or more man-made genes generated by this
invention may be incorporated into a man-made gene pathway, such as
pathway operable in a eukaryotic organism (including a plant).
[0411] It is appreciated that the power of this invention is
exceptional, as there is much freedom of choice and control
regarding the selection of demarcation points, the size and number
of the nucleic acid building blocks, and the size and design of the
couplings. It is appreciated, furthermore, that the requirement for
intermolecular homology is highly relaxed for the operability of
this invention. In fact, demarcation points can even be chosen in
areas of little or no intermolecular homology. For example, because
of codon wobble, i.e. the degeneracy of codons, nucleotide
substitutions can be introduced into nucleic acid building blocks
without altering the amino acid originally encoded in the
corresponding progenitor template. Alternatively, a codon can be
altered such that the coding for an originally amino acid is
altered. This inventiop provides that such substitutions can be
introduced into the nucleic acid building block in order to
increase the incidence of intermolecularly homologous demarcation
points and thus to allow an increased number of couplings to be
achieved among the building blocks, which in turn allows a greater
number of progeny chimeric molecules to be generated.
[0412] In another exemplifaction, the synthetic nature of the step
in which the building blocks are generated allows the design and
introduction of nucleotides (e.g. one or more nucleotides, which
may be, for example, codons or introns or regulatory sequences)
that can later be optionally removed in an in vitro process (e.g.
by mutageneis) or in an in vivo process (e.g. by utilizing the gene
splicing ability of a host organism). It is appreciated that in
many instances the introduction of these nucleotides may also be
desirable for many other reasons in addition to the potential
benefit of creating a serviceable demarcation point.
[0413] Thus, according to another embodiment, this invention
provides that a nucleic acid building block can be used to
introduce an intron. Thus, this invention provides that functional
introns may be introduced into a man-made gene of this invention.
This invention also provides that functional introns may be
introduced into a man-made gene pathway of this invention.
Accordingly, this invention provides for the generation of a
chimeric polynucleotide that is a man-made gene containing one (or
more) artificially introduced intron(s).
[0414] Accordingly, this invention also provides for the generation
of a chimeric polynucleotide that is a man-made gene pathway
containing one (or more) artificially introduced intron(s).
Preferably, the artificially introduced intron(s) are functional in
one or more host cells for gene splicing much in the way that
naturally-occurring introns serve functionally in gene splicing.
This invention provides a process of producing man-made
intron-containing polynucleotides to be introduced into host
organisms for recombination and/or splicing.
[0415] The ability to achieve chimerizations, using couplings as
described herein, in areas of little or no homology among the
progenitor molecules, is particularly useful, and in fact critical,
for the assembly of novel gene pathways. This invention thus
provides for the generation of novel man-made gene pathways using
synthetic ligation reassembly. In a particular aspect, this is
achieved by the introduction of regulatory sequences, such as
promoters, that are operable in an intended host, to confer
operability to a novel gene pathway when it is introduced into the
intended host. In a particular exemplification, this invention
provides for the generation of novel man-made gene pathways that is
operable in a plurality of intended hosts (e.g. in a microbial
organism as well as in a plant cell). This can be achieve, for
example, by the introduction of a plurality of regulatory
sequences, comprised of a regulatory sequence that is operable in a
first intended host and a regulatory sequence that is operable in a
second intended host. A similar process can be performed to achieve
operability of a gene pathway in a third intended host species,
etc. The number of intended host species can be each integer from 1
to 10 or alternatively over 10. Alternatively, for example,
operability of a gene pathway in a plurality of intended hosts can
be achieved by the introduction of a regulatory sequence having
intrinsic operability in a plurality of intended hosts.
[0416] Thus, according to a particular embodiment, this invention
provides that a nucleic acid building block can be used to
introduce a regulatory sequence, particularly a regulatory sequence
for gene expression. Preferred regulatory sequences include, but
are not limited to, those that are man-made, and those found in
archeal, bacterial, eukaryotic (including mitochondrial), viral,
and prionic or prion-like organisms. Preferred regulatory sequences
include but are not limited to, promoters, operators, and activator
binding sites. Thus, this invention provides that functional
regulatory sequences may be introduced into a man-made gene of this
invention. This invention also provides that functional regulatory
sequences may be introduced into a man-made gene pathway of this
invention.
[0417] Accordingly, this invention provides for the generation of a
chimeric polynucleotide that is a man-made gene containing one (or
more) artificially introduced regulatory sequence(s). Accordingly,
this invention also provides for the generation of a chimeric
polynucleotide that is a man-made gene pathway containing one (or
more) artificially introduced regulatory sequence(s). Preferably,
an artificially introduced regulatory sequence(s) is operatively
linked to one or more genes in the man-made polynucleotide, and are
functional in one or more host cells.
[0418] Preferred bacterial promoters that are serviceable for this
invention include lacI, lacZ, T3, T7, gpt, lambda P.sub.R, P.sub.L
and trp. Serviceable eukaryotic promoters include CMV immediate
early, HSV thymidine kinase, early and late SV40, LTRs from
retrovirus, and mouse metallothionein-I. Particular plant
regulatory sequences include promoters active in directing
transcription in plants, either constitutively or stage and/or
tissue specific, depending on the use of the plant or parts
thereof. These promoters include, but are not limited to promoters
showing constitutive expression, such as the 35S promoter of
Cauliflower Mosaic Virus (CaMV) (Guilley et al., 1982), those for
leaf-specific expression, such as the promoter of the ribulose
bisphosphate carboxylase small subunit gene (Coruzzi et al., 1984),
those for root-specific expression, such as the promoter from the
glutamin synthase gene (Tingey et al., 1987), those for
seed-specific expression, such as the cruciferin A promoter from
Brassica napus (Ryan et al., 1989), those for tuber-specific
expression, such as the class-I patatin promoter from potato
(Rocha-Sasa et al., 1989; Wenzler et al., 1989) or those for
fruit-specific expression, such as the polygalacturonase (PG)
promoter from tomato (Bird et al., 1988).
[0419] Other regulatory sequences that are preferred for this
invention include terminator sequences and polyadenylation signals
and any such sequence functioning as such in plants, the choice of
which is within the level of the skilled artisan. An example of
such sequences is the 3' flanking region of the nopaline synthase
(nos) gene of Agrobacterium tumefaciens (Bevan, 1984). The
regulatory sequences may also include enhancer sequences, such as
found in the 35S promoter of CaMV, and mRNA stabilizing sequences
such as the leader sequence of Alfalfa Mosaic Cirus (AlMV) RNA4
(Brederode et al., 1980) or any other sequences functioning in a
like manner.
[0420] A man-made genes produced using this invention can also
serve as a substrate for recombination with another nucleic acid.
Likewise, a man-made gene pathway produced using this invention can
also serve as a substrate for recombination with another nucleic
acid. In a preferred instance, the recombination is facilitated by,
or occurs at, areas of homology between the man-made
intron-containing gene and a nucleic acid with serves as a
recombination partner. In a particularly preferred instance, the
recombination partner may also be a nucleic acid generated by this
invention, including a man-made gene or a man-made gene pathway.
Recombination may be facilitated by or may occur at areas of
homology that exist at the one (or more) artificially introduced
intron(s) in the man-made gene.
[0421] The synthetic ligation reassembly method of this invention
utilizes a plurality of nucleic acid building blocks, each of which
preferably has two ligatable ends. The two ligatable ends on each
nucleic acid building block may be two blunt ends (i.e. each having
an overhang of zero nucleotides), or preferably one blunt end and
one overhang, or more preferably still two overhangs.
[0422] A serviceable overhang for this purpose may be a 3' overhang
or a 5' overhang. Thus, a nucleic acid building block may have a 3'
overhang or alternatively a 5' overhang or alternatively two 3'
overhangs or alternatively two 5' overhangs. The overall order in
which the nucleic acid building blocks are assembled to form a
finalized chimeric nucleic acid molecule is determined by
purposeful experimental design and is not random.
[0423] According to one preferred embodiment, a nucleic acid
building block is generated by chemical synthesis of two
single-stranded nucleic acids (also referred to as single-stranded
oligos) and contacting them so as to allow them to anneal to form a
double-stranded nucleic acid building block.
[0424] A double-stranded nucleic acid building block can be of
variable size. The sizes of these building blocks can be small or
large depending on the choice of the experimenter. Preferred sizes
for building block range from 1 base pair (not including any
overhangs) to 100,000 base pairs (not including any overhangs).
Other preferred size ranges are also provided, which have lower
limits of from 1 bp to 10,000 bp (including every integer value in
between), and upper limits of from 2 bp to 100, 000 bp (including
every integer value in between).
[0425] It is appreciated that current methods of polymerase-based
amplification can be used to generate double-stranded nucleic acids
of up to thousands of base pairs, if not tens of thousands of base
pairs, in length with high fidelity. Chemical synthesis (e.g.
phosphoramidite-based) can be used to generate nucleic acids of up
to hundreds of nucleotides in length with high fidelity; however,
these can be assembled, e.g. using overhangs or sticky ends, to
form double-stranded nucleic acids of up to thousands of base
pairs, if not tens of thousands of base pairs, in length if so
desired.
[0426] A combination of methods (e.g. phosphoramidite-based
chemical synthesis and PCR) can also be used according to this
invention. Thus, nucleic acid building block made by different
methods can also be used in combination to generate a progeny
molecule of this invention.
[0427] The use of chemical synthesis to generate nucleic acid
building blocks is particularly preferred in this invention &
is advantageous for other reasons as well, including procedural
safety and ease. No cloning or harvesting or actual handling of any
biological samples is required. The design of the nucleic acid
building blocks can be accomplished on paper. Accordingly, this
invention teaches an advance in procedural safety in recombinant
technologies.
[0428] Nonetheless, according to one preferred embodiment, a
double-stranded nucleic acid building block according to this
invention may also be generated by polymerase-based amplification
of a polynucleotide template. In a non-limiting exemplification, as
illustrated in FIG. 2, a first polymerase-based amplification
reaction using a first set of primers, F.sub.2 and R.sub.1, is used
to generate a blunt-ended product (labeled Reaction 1, Product 1),
which is essentially identical to Product A. A second
polymerase-based amplification reaction using a second set of
primers, F.sub.1 and R.sub.2, is used to generate a blunt-ended
product (labeled Reaction 2, Product 2), which is essentially
identical to Product B. These two products are mixed and allowed to
melt and anneal, generating potentially useful double-stranded
nucleic acid building blocks with two overhangs. In the example of
FIG. 2, the product with the 3' overhangs (Product C) is selected
by nuclease-based degradation of the other 3 products using a 3'
acting exonuclease, such as exonuclease III. It is appreciated that
a 5' acting exonuclease (e.g. red alpha) may be also be used, for
example to select Product D instead. It is also appreciated that
other selection means can also be used, including
hybridization-based means, and that these means can incorporate a
further means, such as a magnetic bead-based means, to facilitate
separation of the desired product.
[0429] Many other methods exist by which a double-stranded nucleic
acid building block can be generated that is serviceable for this
invention; and these are known in the art and can be readily
performed by the skilled artisan.
[0430] According to particularly preferred embodiment, a
double-stranded nucleic acid building block that is serviceable for
this invention is generated by first generating two single stranded
nucleic acids and allowing them to anneal to form a double-stranded
nucleic acid building block. The two strands of a double-stranded
nucleic acid building block may be complementary at every
nucleotide apart from any that form an overhang; thus containing no
mismatches, apart from any overhang(s). According to another
embodiment, the two strands of a double-stranded nucleic acid
building block are complementary at fewer than every nucleotide
apart from any that form an overhang. Thus, according to this
embodiment, a double-stranded nucleic acid building block can be
used to introduce codon degeneracy. Preferably the codon degeneracy
is introduced using the site-saturation mutagenesis described
herein, using one or more N,N,G/T cassettes or alternatively using
one or more N,N,N cassettes.
[0431] Contained within an exemplary experimental design for
achieving an ordered assembly according to this invention are:
[0432] 1) The design of specific nucleic acid building blocks.
[0433] 2) The design of specific ligatable ends on each nucleic
acid building block.
[0434] 3) The design of a particular order of assembly of the
nucleic acid building blocks.
[0435] An overhang may be a 3' overhang or a 5' overhang. An
overhang may also have a terminal phosphate group or alternatively
may be devoid of a terminal phosphate group (having, e.g., a
hydroxyl group instead). An overhang may be comprised of any number
of nucleotides. Preferably an overhang is comprised of 0
nucleotides (as in a blunt end) to 10,000 nucleotides. Thus, a wide
range of overhang sizes may be serviceable. Accordingly, the lower
limit may be each integer from 1-200 and the upper limit may be
each integer from 2-10,000. According to a particular
exemplification, an overhang may consist of anywhere from 1
nucleotide to 200 nucleotides (including every integer value in
between).
[0436] The final chimeric nucleic acid molecule may be generated by
sequentially assembling 2 or more building blocks at a time until
all the designated building blocks have been assembled. A working
sample may optionally be subjected to a process for size selection
or purification or other selection or enrichment process between
the performance of two assembly steps. Alternatively, the final
chimeric nucleic acid molecule may be generated by assembling all
the designated building blocks at once in one step.
[0437] The methods of these experiments allow reassembly to occur
among nucleic acids having a little or no homology. Additionally
fusion points or couplings can also occur in regions of low or no
homology. The number of resulting molecules that can be generated
in according to this experiment is very large.
[0438] Rather than to physically generate and screen this large
number of potential products in random order, it is appreciated
that, optionally with the aid of a computer, groupings of these
potential products can be non-stochastically determined and
furthermore ranked according to the predicted the likelihood that
desirable products are contained in each grouping. Accordingly it
is appreciated according to this experiment that computer modeling
("in silico") or mental calculations or considerations ("in
cranio") may be useful to determine groupings all of potential
reassembly products, where each such grouping is delineated by the
potential products that can be generated using one set (or a finite
set) of reagents and/or resulting from a one application (or a
finite number of applications) of a method (or a finite number of
methods) disclosed herein. Additionally the groupings can be ranked
against each other mentally or using computer modeling by
predicting the number of potentially desirable or usable products
in each grouping.
[0439] The grouping of potential products and the ranking of the
groupings are different facets of what is referred to herein as
"triaging", and specifically "in silico triage" if performed using
the aid of a computer.
[0440] Examples of "structure-activity" considerations and
serviceable computer software programs are abundant. The following
examples are provided in a non-limiting fashion and are hereby
incorporated by reference. Molecular Simulations Inc. of San Diego,
Calif. is a subsidiary of Pharmacopeia, Inc. provides the following
software programs that are useful for this invention: Gene
Explorer.TM., ViewerPro.TM., SeqFold, Insight II, Biploymer,
Homology, MODELER, Profiles-3D, Binding Site Analysis, and CFF.
[0441] In Vivo Shuffling
[0442] In an embodiment of in vivo shuffling, the mixed population
of the specific nucleic acid sequence is introduced into bacterial
or eukaryotic cells under conditions such that at least two
different nucleic acid sequences are present in each host cell. The
polynucleotides can be introduced into the host cells by a variety
of different methods. The host cells can be transformed with the
smaller polynucleotides using methods known in the art, for example
treatment with calcium chloride. If the polynucleotides are
inserted into a phage genome, the host cell can be transfected with
the recombinant phage genome having the specific nucleic acid
sequences. Alternatively, the nucleic acid sequences can be
introduced into the host cell using electroporation, transfection,
lipofection, biolistics, conjugation, and the like.
[0443] In general, in this embodiment, the specific nucleic acids
sequences will be present in vectors which are capable of stably
replicating the sequence in the host cell. In addition, it is
contemplated that the vectors will encode a marker gene such that
host cells having the vector can be selected. This ensures that the
mutated specific nucleic acid sequence can be recovered after
introduction into the host cell. However, it is contemplated that
the entire mixed population of the specific nucleic acid sequences
need not be present on a vector sequence. Rather only a sufficient
number of sequences need be cloned into vectors to ensure that
after introduction of the polynucleotides into the host cells each
host cell contains one vector having at least one specific nucleic
acid sequence present therein. It is also contemplated that rather
than having a subset of the population of the specific nucleic
acids sequences cloned into vectors, this subset may be already
stably integrated into the host cell.
[0444] It has been found that when two polynucleotides which have
regions of identity are inserted into the host cells homologous
recombination occurs between the two polynucleotides. Such
recombination between the two mutated specific nucleic acid
sequences will result in the production of double or triple hybrids
in some situations.
[0445] It has also been found that the frequency of recombination
is increased if some of the mutated specific nucleic acid sequences
are present on linear nucleic acid molecules. Therefore, in a
preferred embodiment, some of the specific nucleic acid sequences
are present on linear polynucleotides.
[0446] After transformation, the host cell transformants are placed
under selection to identify those host cell transformants which
contain mutated specific nucleic acid sequences having the
qualities desired. For example, if increased resistance to a
particular drug is desired then the transformed host cells may be
subjected to increased concentrations of the particular drug and
those transformants producing mutated proteins able to confer
increased drug resistance will be selected. If the enhanced ability
of a particular protein to bind to a receptor is desired, then
expression of the protein can be induced from the transformants and
the resulting protein assayed in a ligand binding assay by methods
known in the art to identify that subset of the mutated population
which shows enhanced binding to the ligand. Alternatively, the
protein can be expressed in another system to ensure proper
processing.
[0447] Once a subset of the first recombined specific nucleic acid
sequences (daughter sequences) having the desired characteristics
are identified, they are then subject to a second round of
recombination.
[0448] In the second cycle of recombination, the recombined
specific nucleic acid sequences may be mixed with the original
mutated specific nucleic acid sequences (parent sequences) and the
cycle repeated as described above. In this way a set of second
recombined specific nucleic acids sequences can be identified which
have enhanced characteristics or encode for proteins having
enhanced properties. This cycle can be repeated a number of times
as desired.
[0449] It is also contemplated that in the second or subsequent
recombination cycle, a backcross can be performed. A molecular
backcross can be performed by mixing the desired specific nucleic
acid sequences with a large number of the wild-type sequence, such
that at least one wild-type nucleic acid sequence and a mutated
nucleic acid sequence are present in the same host cell after
transformation. Recombination with the wild-type specific nucleic
acid sequence will eliminate those neutral mutations that may
affect unselected characteristics such as immunogenicity but not
the selected characteristics.
[0450] In another embodiment of this invention, it is contemplated
that during the first round a subset of the specific nucleic acid
sequences can be generated as smaller polynucleotides by slowing or
halting their PCR amplification prior to introduction into the host
cell. The size of the polynucleotides must be large enough to
contain some regions of identity with the other sequences so as to
homologously recombine with the other sequences. The size of the
polynucleotides will range from 0.03 kb to 100 kb more preferably
from 0.2 kb to 10 kb. It is also contemplated that in subsequent
rounds, all of the specific nucleic acid sequences other than the
sequences selected from the previous round may be utilized to
generate PCR polynucleotides prior to introduction into the host
cells.
[0451] The shorter polynucleotide sequences can be single-stranded
or double-stranded. If the sequences were originally
single-stranded and have become double-stranded they can be
denatured with heat, chemicals or enzymes prior to insertion into
the host cell. The reaction conditions suitable for separating the
strands of nucleic acid are well known in the art.
[0452] The steps of this process can be repeated indefinitely,
being limited only by the number of possible hybrids which can be
achieved. After a certain number of cycles, all possible hybrids
will have been achieved and further cycles are redundant.
[0453] In an embodiment the same mutated template nucleic acid is
repeatedly recombined and the resulting recombinants selected for
the desired characteristic.
[0454] Therefore, the initial pool or population of mutated
template nucleic acid is cloned into a vector capable of
replicating in a bacteria such as E. coli. The particular vector is
not essential, so long as it is capable of autonomous replication
in E. coli. In a preferred embodiment, the vector is designed to
allow the expression and production of any protein encoded by the
mutated specific nucleic acid linked to the vector. It is also
preferred that the vector contain a gene encoding for a selectable
marker.
[0455] The population of vectors containing the pool of mutated
nucleic acid sequences is introduced into the E. coli host cells.
The vector nucleic acid sequences may be introduced by
transformation, transfection or infection in the case of phage. The
concentration of vectors used to transform the bacteria is such
that a number of vectors is introduced into each cell. Once present
in the cell, the efficiency of homologous recombination is such
that homologous recombination occurs between the various vectors.
This results in the generation of hybrids (daughters) having a
combination of mutations which differ from the original parent
mutated sequences.
[0456] The host cells are then clonally replicated and selected for
the marker gene present on the vector. Only those cells having a
plasmid will grow under the selection.
[0457] The host cells which contain a vector are then tested for
the presence of favorable mutations. Such testing may consist of
placing the cells under selective pressure, for example, if the
gene to be selected is an improved drug resistance gene. If the
vector allows expression of the protein encoded by the mutated
nucleic acid sequence, then such selection may include allowing
expression of the protein so encoded, isolation of the protein and
testing of the protein to determine whether, for example, it binds
with increased efficiency to the ligand of interest.
[0458] Once a particular daughter mutated nucleic acid sequence has
been identified which confers the desired characteristics, the
nucleic acid is isolated either already linked to the vector or
separated from the vector. This nucleic acid is then mixed with the
first or parent population of nucleic acids and the cycle is
repeated.
[0459] It has been shown that by this method nucleic acid sequences
having enhanced desired properties can be selected.
[0460] In an alternate embodiment, the first generation of hybrids
are retained in the cells and the parental mutated sequences are
added again to the cells. Accordingly, the first cycle of
Embodiment I is conducted as described above. However, after the
daughter nucleic acid sequences are identified, the host cells
containing these sequences are retained.
[0461] The parent mutated specific nucleic acid population, either
as polynucleotides or cloned into the same vector is introduced
into the host cells already containing the daughter nucleic acids.
Recombination is allowed to occur in the cells and the next
generation of recombinants, or granddaughters are selected by the
methods described above.
[0462] This cycle can be repeated a number of times until the
nucleic acid or peptide having the desired characteristics is
obtained. It is contemplated that in subsequent cycles, the
population of mutated sequences which are added to the preferred
hybrids may come from the parental hybrids or any subsequent
generation.
[0463] In an alternative embodiment, the invention provides a
method of conducting a "molecular" backcross of the obtained
recombinant specific nucleic acid in order to eliminate any neutral
mutations. Neutral mutations are those mutations which do not
confer onto the nucleic acid or peptide the desired properties.
Such mutations may however confer on the nucleic acid or peptide
undesirable characteristics. Accordingly, it is desirable to
eliminate such neutral mutations. The method of this invention
provide a means of doing so.
[0464] In this embodiment, after the hybrid nucleic acid, having
the desired characteristics, is obtained by the methods of the
embodiments, the nucleic acid, the vector having the nucleic acid
or the host cell containing the vector and nucleic acid is
isolated.
[0465] The nucleic acid or vector is then introduced into the host
cell with a large excess of the wild-type nucleic acid. The nucleic
acid of the hybrid and the nucleic acid of the wild-type sequence
are allowed to recombine. The resulting recombinants are placed
under the same selection as the hybrid nucleic acid. Only those
recombinants which retained the desired characteristics will be
selected. Any silent mutations which do not provide the desired
characteristics will be lost through recombination with the
wild-type DNA. This cycle can be repeated a number of times until
all of the silent mutations are eliminated.
[0466] Thus the methods of this invention can be used in a
molecular backcross to eliminate unnecessary or silent
mutations.
[0467] Utility
[0468] The in vivo recombination method of this invention can be
performed blindly on a pool of unknown hybrids or alleles of a
specific polynucleotide or sequence. However, it is not necessary
to know the actual DNA or RNA sequence of the specific
polynucleotide.
[0469] The approach of using recombination within a mixed
population of genes can be useful for the generation of any useful
proteins, for example, interleukin I, antibodies, tPA and growth
hormone. This approach may be used to generate proteins having
altered specificity or activity. The approach may also be useful
for the generation of hybrid nucleic acid sequences, for example,
promoter regions, introns, exons, enhancer sequences, 31
untranslated regions or 51 untranslated regions of genes. Thus this
approach may be used to generate genes having increased rates of
expression. This approach may also be useful in the study of
repetitive DNA sequences. Finally, this approach may be useful to
mutate ribozymes or aptamers.
[0470] Scaffold-like regions separating regions of diversity in
proteins may be particularly suitable for the methods of this
invention. The conserved scaffold determines the overall folding by
self-association, while displaying relatively unrestricted loops
that mediate the specific binding. Examples of such scaffolds are
the immunoglobulin beta barrel, and the four-helix bundle. The
methods of this invention can be used to create scaffold-like
proteins with various combinations of mutated sequences for
binding.
[0471] The equivalents of some standard genetic matings may also be
performed by the methods of this invention. For example, a
"molecular" backcross can be performed by repeated mixing of the
hybrid's nucleic acid with the wild-type nucleic acid while
selecting for the mutations of interest. As in traditional
breeding, this approach can be used to combine phenotypes from
different sources into a background of choice. It is useful, for
example, for the removal of neutral mutations that affect
unselected characteristics (i.e. immunogenicity). Thus it can be
useful to determine which mutations in a protein are involved in
the enhanced biological activity and which are not.
[0472] Peptide Display Methods
[0473] The present method can be used to shuffle, by in vitro
and/or in vivo recombination by any of the disclosed methods, and
in any combination, polynucleotide sequences selected by peptide
display methods, wherein an associated polynucleotide encodes a
displayed peptide which is screened for a phenotype (e.g., for
affinity for a predetermined receptor (ligand).
[0474] An increasingly important aspect of bio-pharmaceutical drug
development and molecular biology is the identification of peptide
structures, including the primary amino acid sequences, of peptides
or peptidomimetics that interact with biological macromolecules.
one method of identifying peptides that possess a desired structure
or functional property, such as binding to a predetermined
biological macromolecule (e.g., a receptor), involves the screening
of a large library or peptides for individual library members which
possess the desired structure or functional property conferred by
the amino acid sequence of the peptide.
[0475] In addition to direct chemical synthesis methods for
generating peptide libraries, several recombinant DNA methods also
have been reported. One type involves the display of a peptide
sequence, antibody, or other protein on the surface of a
bacteriophage particle or cell. Generally, in these methods each
bacteriophage particle or cell serves as an individual library
member displaying a single species of displayed peptide in addition
to the natural bacteriophage or cell protein sequences. Each
bacteriophage or cell contains the nucleotide sequence information
encoding the particular displayed peptide sequence; thus, the
displayed peptide sequence can be ascertained by nucleotide
sequence determination of an isolated library member.
[0476] A well-known peptide display method involves the
presentation of a peptide sequence on the surface of a filamentous
bacteriophage, typically as a fusion with a bacteriophage coat
protein. The bacteriophage library can be incubated with an
immobilized, predetermined macromolecule or small molecule (e.g., a
receptor) so that bacteriophage particles which present a peptide
sequence that binds to the immobilized macromolecule can be
differentially partitioned from those that do not present peptide
sequences that bind to the predetermined macromolecule. The
bacteriophage particles (i.e., library members) which are bound to
the immobilized macromolecule are then recovered and replicated to
amplify the selected bacteriophage sub-population for a subsequent
round of affinity enrichment and phage replication. After several
rounds of affinity enrichment and phage replication, the
bacteriophage library members that are thus selected are isolated
and the nucleotide sequence encoding the displayed peptide sequence
is determined, thereby identifying the sequence(s) of peptides that
bind to the predetermined macromolecule (e.g., receptor). Such
methods are further described in PCT patent publications WO
91/17271, WO 91/18980, WO 91/19818 and WO 93/08278.
[0477] The latter PCT publication describes a recombinant DNA
method for the display of peptide ligands that involves the
production of a library of fusion proteins with each fusion protein
composed of a first polypeptide portion, typically comprising a
variable sequence, that is available for potential binding to a
predetermined macromolecule, and a second polypeptide portion that
binds to DNA, such as the DNA vector encoding the individual fusion
protein. When transformed host cells are cultured under conditions
that allow for expression of the fusion protein, the fusion protein
binds to the DNA vector encoding it. Upon lysis of the host cell,
the fusion protein/vector DNA complexes can be screened against a
predetermined macromolecule in much the same way as bacteriophage
particles are screened in the phage-based display system, with the
replication and sequencing of the DNA vectors in the selected
fusion protein/vector DNA complexes serving as the basis for
identification of the selected library peptide sequence(s).
[0478] Other systems for generating libraries of peptides and like
polymers have aspects of both the recombinant and in vitro chemical
synthesis methods. In these hybrid methods, cell-free enzymatic
machinery is employed to accomplish the in vitro synthesis of the
library members (i.e., peptides or polynucleotides). In one type of
method, RNA molecules with the ability to bind a predetermined
protein or a predetermined dye molecule were selected by alternate
rounds of selection and PCR amplification (Tuerk and Gold, 1990;
Ellington and Szostak, 1990). A similar technique was used to
identify DNA sequences which bind a predetermined human
transcription factor (Thiesen and Bach, 1990; Beaudry and Joyce,
1992; PCT patent publications WO 92/05258 and WO 92/14843). In a
similar fashion, the technique of in vitro translation has been
used to synthesize proteins of interest and has been proposed as a
method for generating large libraries of peptides. These methods
which rely upon in vitro translation, generally comprising
stabilized polysome complexes, are described further in PCT patent
publications WO 88/08453, WO 90/05785, WO 90/07003, WO 91/02076, WO
91/05058, and WO 92/02536. Applicants have described methods in
which library members comprise a fusion protein having a first
polypeptide portion with DNA binding activity and a second
polypeptide portion having the library member unique peptide
sequence; such methods are suitable for use in cell-free in vitro
selection formats, among others.
[0479] The displayed peptide sequences can be of varying lengths,
typically from 3-5000 amino acids long or longer, frequently from
5-100 amino acids long, and often from about 8-15 amino acids long.
A library can comprise library members having varying lengths of
displayed peptide sequence, or may comprise library members having
a fixed length of displayed peptide sequence. Portions or all of
the displayed peptide sequence(s) can be random, pseudorandom,
defined set kernal, fixed, or the like. The present display methods
include methods for in vitro and in vivo display of single-chain
antibodies, such as nascent scFv on polysomes or scfv displayed on
phage, which enable large-scale screening of scfv libraries having
broad diversity of variable region sequences and binding
specificities.
[0480] The present invention also provides random, pseudorandom,
and defined sequence framework peptide libraries and methods for
generating and screening those libraries to identify useful
compounds (e.g., peptides, including single-chain antibodies) that
bind to receptor molecules or epitopes of interest or gene products
that modify peptides or RNA in a desired fashion. The random,
pseudorandom, and defined sequence framework peptides are produced
from libraries of peptide library members that comprise displayed
peptides or displayed single-chain antibodies attached to a
polynucleotide template from which the displayed peptide was
synthesized. The mode of attachment may vary according to the
specific embodiment of the invention selected, and can include
encapsulation in a phage particle or incorporation in a cell.
[0481] A method of affinity enrichment allows a very large library
of peptides and single-chain antibodies to be screened and the
polynucleotide sequence encoding the desired peptide(s) or
single-chain antibodies to be selected. The polynucleotide can then
be isolated and shuffled to recombine combinatorially the amino
acid sequence of the selected peptide(s) (or predetermined portions
thereof) or single-chain antibodies (or just VHI, VLI or CDR
portions thereof). Using these methods, one can identify a peptide
or single-chain antibody as having a desired binding affinity for a
molecule and can exploit the process of shuffling to converge
rapidly to a desired high-affinity peptide or scfv. The peptide or
antibody can then be synthesized in bulk by conventional means for
any suitable use (e.g., as a therapeutic or diagnostic agent).
[0482] A significant advantage of the present invention is that no
prior information regarding an expected ligand structure is
required to isolate peptide ligands or antibodies of interest. The
peptide identified can have biological activity, which is meant to
include at least specific binding affinity for a selected receptor
molecule and, in some instances, will further include the ability
to block the binding of other compounds, to stimulate or inhibit
metabolic pathways, to act as a signal or messenger, to stimulate
or inhibit cellular activity, and the like.
[0483] The present invention also provides a method for shuffling a
pool of polynucleotide sequences selected by affinity screening a
library of polysomes displaying nascent peptides (including
single-chain antibodies) for library members which bind to a
predetermined receptor (e.g., a mammalian proteinaceous receptor
such as, for example, a peptidergic hormone receptor, a cell
surface receptor, an intracellular protein which binds to other
protein(s) to form intracellular protein complexes such as
hetero-dimers and the like) or epitope (e.g., an immobilized
protein, glycoprotein, oligosaccharide, and the like).
[0484] Polynucleotide sequences selected in a first selection round
(typically by affinity selection for binding to a receptor (e.g., a
ligand)) by any of these methods are pooled and the pool(s) is/are
shuffled by in vitro and/or in vivo recombination to produce a
shuffled pool comprising a population of recombined selected
polynucleotide sequences. The recombined selected polynucleotide
sequences are subjected to at least one subsequent selection round.
The polynucleotide sequences selected in the subsequent selection
round(s) can be used directly, sequenced, and/or subjected to one
or more additional rounds of shuffling and subsequent selection.
Selected sequences can also be back-crossed with polynucleotide
sequences encoding neutral sequences (i.e., having insubstantial
functional effect on binding), such as for example by back-crossing
with a wild-type or naturally-occurring sequence substantially
identical to a selected sequence to produce native-like functional
peptides, which may be less immunogenic. Generally, during
back-crossing subsequent selection is applied to retain the
property of binding to the predetermined receptor (ligand).
[0485] Prior to or concomitant with the shuffling of selected
sequences, the sequences can be mutagenized. In one embodiment,
selected library members are cloned in a prokaryotic vector (e.g.,
plasmid, phagemid, or bacteriophage) wherein a collection of
individual colonies (or plaques) representing discrete library
members are produced. Individual selected library members can then
be manipulated (e.g., by site-directed mutagenesis, cassette
mutagenesis, chemical mutagenesis, PCR mutagenesis, and the like)
to generate a collection of library members representing a kernal
of sequence diversity based on the sequence of the selected library
member. The sequence of an individual selected library member or
pool can be manipulated to incorporate random mutation,
pseudorandom mutation, defined kernal mutation (i.e., comprising
variant and invariant residue positions and/or comprising variant
residue positions which can comprise a residue selected from a
defined subset of amino acid residues), codon-based mutation, and
the like, either segmentally or over the entire length of the
individual selected library member sequence. The mutagenized
selected library members are then shuffled by in vitro and/or in
vivo recombinatorial shuffling as disclosed herein.
[0486] The invention also provides peptide libraries comprising a
plurality of individual library members of the invention, wherein
(1) each individual library member of said plurality comprises a
sequence produced by shuffling of a pool of selected sequences, and
(2) each individual library member comprises a variable peptide
segment sequence or single-chain antibody segment sequence which is
distinct from the variable peptide segment sequences or
single-chain antibody sequences of other individual library members
in said plurality (although some library members may be present in
more than one copy per library due to uneven amplification,
stochastic probability, or the like).
[0487] The invention also provides a product-by-process, wherein
selected polynucleotide sequences having (or encoding a peptide
having) a predetermined binding specificity are formed by the
process of: (1) screening a displayed peptide or displayed
single-chain antibody library against a predetermined receptor
(e.g., ligand) or epitope (e.g., antigen macromolecule) and
identifying and/or enriching library members which bind to the
predetermined receptor or epitope to produce a pool of selected
library members, (2) shuffling by recombination the selected
library members (or amplified or cloned copies thereof) which binds
the predetermined epitope and has been thereby isolated and/or
enriched from the library to generate a shuffled library, and (3)
screening the shuffled library against the predetermined receptor
(e.g., ligand) or epitope (e.g., antigen macromolecule) and
identifying and/or enriching shuffled library members which bind to
the predetermined receptor or epitope to produce a pool of selected
shuffled library members.
[0488] Antibody Display and Screening Methods
[0489] The present method can be used to shuffle, by in vitro
and/or in vivo recombination by any of the disclosed methods, and
in any combination, polynucleotide sequences selected by antibody
display methods, wherein an associated polynucleotide encodes a
displayed antibody which is screened for a phenotype (e.g., for
affinity for binding a predetermined antigen (ligand).
[0490] Various molecular genetic approaches have been devised to
capture the vast immunological repertoire represented by the
extremely large number of distinct variable regions which can be
present in immunoglobulin chains. The naturally-occurring germ line
immunoglobulin heavy chain locus is composed of separate tandem
arrays of variable segment genes located upstream of a tandem array
of diversity segment genes, which are themselves located upstream
of a tandem array of joining (i) region genes, which are located
upstream of the constant region genes. During B lymphocyte
development, V-D-J rearrangement occurs wherein a heavy chain
variable region gene (VH) is formed by rearrangement to form a
fused D segment followed by rearrangement with a V segment to form
a V-D-J joined product gene which, if productively rearranged,
encodes a functional variable region (VH) of a heavy chain.
Similarly, light chain loci rearrange one of several V segments
with one of several J segments to form a gene encoding the variable
region (VL) of a light chain.
[0491] The vast repertoire of variable regions possible in
immunoglobulins derives in part from the numerous combinatorial
possibilities of joining V and i segments (and, in the case of
heavy chain loci, D segments) during rearrangement in B cell
development. Additional sequence diversity in the heavy chain
variable regions arises from non-uniform rearrangements of the D
segments during V-D-J joining and from N region addition. Further,
antigen-selection of specific B cell clones selects for higher
affinity variants having non-germline mutations in one or both of
the heavy and light chain variable regions; a phenomenon referred
to as "affinity maturation" or "affinity sharpening". Typically,
these "affinity sharpening" mutations cluster in specific areas of
the variable region, most commonly in the
complementarity-determining regions (CDRs).
[0492] In order to overcome many of the limitations in producing
and identifying high-affinity immunoglobulins through
antigen-stimulated 13 cell development (i.e., immunization),
various prokaryotic expression systems have been developed that can
be manipulated to produce combinatorial antibody libraries which
may be screened for high-affinity antibodies to specific antigens.
Recent advances in the expression of antibodies in Escherichia coli
and bacteriophage systems (see "alternative peptide display
methods", infra) have raised the possibility that virtually any
specificity can be obtained by either cloning antibody genes from
characterized hybridomas or by de novo selection using antibody
gene libraries (e.g., from Ig cDNA).
[0493] Combinatorial libraries of antibodies have been generated in
bacteriophage lambda expression systems which may be screened as
bacteriophage plaques or as colonies of lysogens (Huse et al,
1989); Caton and Koprowski, 1990; Mullinax et al, 1990; Persson et
al, 1991). Various embodiments of bacteriophage antibody display
libraries and lambda phage expression libraries have been described
(Kang et al, 1991; Clackson et al, 1991; McCafferty et al, 1990;
Burton et al, 1991; Hoogenboom et al, 1991; Chang et al, 1991;
Breitling et al, 1991; Marks et al, 1991, p. 581; Barbas et al,
1992; Hawkins and Winter, 1992; Marks et al, 1992, p. 779; Marks et
al, 1992, p. 16007; and Lowman et al, 1991; Lerner et al, 1992; all
incorporated herein by reference). Typically, a bacteriophage
antibody display library is screened with a receptor (e.g.,
polypeptide, carbohydrate, glycoprotein, nucleic acid) that is
immobilized (e.g., by covalent linkage to a chromatography resin to
enrich for reactive phage by affinity chromatography) and/or
labeled (e.g., to screen plaque or colony lifts).
[0494] One particularly advantageous approach has been the use of
so-called single-chain fragment variable (scfv) libraries (Marks et
al, 1992, p. 779; Winter and Milstein, 1991; Clackson et al, 1991;
Marks et al, 1991, p. 581; Chaudhary et al, 1990; Chiswell et al,
1992; McCafferty et al, 1990; and Huston et al, 1988). Various
embodiments of scfv libraries displayed on bacteriophage coat
proteins have been described.
[0495] Beginning in 1988, single-chain analogues of Fv fragments
and their fusion proteins have been reliably generated by antibody
engineering methods. The first step generally involves obtaining
the genes encoding VH and VL domains with desired binding
properties; these V genes may be isolated from a specific hybridoma
cell line, selected from a combinatorial V-gene library, or made by
V gene synthesis. The single-chain Fv is formed by connecting the
component V genes with an oligonucleotide that encodes an
appropriately designed linker peptide, such as
(Gly-Gly-Gly-Gly-Ser)3 or equivalent linker peptide(s). The linker
bridges the C-terminus of the first V region and N-terminus of the
second, ordered as either VH-linker-VL or VL-linker-VH' In
principle, the scfv binding site can faithfully replicate both the
affinity and specificity of its parent antibody combining site.
[0496] Thus, scfv fragments are comprised of VH and VL domains
linked into a single polypeptide chain by a flexible linker
peptide. After the scfv genes are assembled, they are cloned into a
phagemid and expressed at the tip of the M13 phage (or similar
filamentous bacteriophage) as fusion proteins with the
bacteriophage PIII (gene 3) coat protein. Enriching for phage
expressing an antibody of interest is accomplished by panning the
recombinant phage displaying a population scfv for binding to a
predetermined epitope (e.g., target antigen, receptor).
[0497] The linked polynucleotide of a library member provides the
basis for replication of the library member after a screening or
selection procedure, and also provides the basis for the
determination, by nucleotide sequencing, of the identity of the
displayed peptide sequence or VH and VL amino acid sequence. The
displayed peptide (s) or single-chain antibody (e.g., scfv) and/or
its VH and VL domains or their CDRs can be cloned and expressed in
a suitable expression system. Often polynucleotides encoding the
isolated VH and VL domains will be ligated to polynucleotides
encoding constant regions (CH and CL) to form polynucleotides
encoding complete antibodies (e.g., chimeric or fully-human),
antibody fragments, and the like. Often polynucleotides encoding
the isolated CDRs will be grafted into polynucleotides encoding a
suitable variable region framework (and optionally constant
regions) to form polynucleotides encoding complete antibodies
(e.g., humanized or fully-human), antibody fragments, and the like.
Antibodies can be used to isolate preparative quantities of the
antigen by immunoaffinity chromatography. Various other uses of
such antibodies are to diagnose and/or stage disease (e.g.,
neoplasia) and for therapeutic application to treat disease, such
as for example: neoplasia, autoimmune disease, AIDS, cardiovascular
disease, infections, and the like.
[0498] Various methods have been reported for increasing the
combinatorial diversity of a scfv library to broaden the repertoire
of binding species (idiotype spectrum) The use of PCR has permitted
the variable regions to be rapidly cloned either from a specific
hybridoma source or as a gene library from non-immunized cells,
affording combinatorial diversity in the assortment of VH and VL
cassettes which can be combined. Furthermore, the VH and VL
cassettes can themselves be diversified, such as by random,
pseudorandom, or directed mutagenesis. Typically, VH and VL
cassettes are diversified in or near the
complementarity-determining regions (CDRs), often the third CDR,
CDR3. Enzymatic inverse PCR mutagenesis has been shown to be a
simple and reliable method for constructing relatively large
libraries of scfv site-directed hybrids (Stemmer et al, 1993), as
has error-prone PCR and chemical mutagenesis (Deng et al, 1994).
Riechmann (Riechmann et al, 1993) showed semi-rational design of an
antibody scfv fragment using site-directed randomization by
degenerate oligonucleotide PCR and subsequent phage display of the
resultant scfv hybrids. Barbas (Barbas et al, 1992) attempted to
circumvent the problem of limited repertoire sizes resulting from
using biased variable region sequences by randomizing the sequence
in a synthetic CDR region of a human tetanus toxoid-binding
Fab.
[0499] CDR randomization has the potential to create approximately
1.times.10 CDRs for the heavy chain CDR3 alone, and a roughly
similar number of variants of the heavy chain CDR1 and CDR2, and
light chain CDR1-3 variants. Taken individually or together, the
combination possibilities of CDR randomization of heavy and/or
light chains requires generating a prohibitive number of
bacteriophage clones to produce a clone library representing all
possible combinations, the vast majority of which will be
non-binding. Generation of such large numbers of primary
transformants is not feasible with current transformation
technology and bacteriophage display systems. For example, Barbas
(Barbas et al, 1992) only generated 5.times.10.sup.7 transformants,
which represents only a tiny fraction of the potential diversity of
a library of thoroughly randomized CDRS.
[0500] Despite these substantial limitations, bacteriophage.
display of scfv have already yielded a variety of useful antibodies
and antibody fusion proteins. A bispecific single chain antibody
has been shown to mediate efficient tumor cell lysis (Gruber et al,
1994). Intracellular expression of an anti-Rev scfv has been shown
to inhibit HIV-1 virus replication in vitro (Duan et al, 1994), and
intracellular expression of an anti-p2lrar, scfv has been shown to
inhibit meiotic maturation of Xenopus oocytes (Biocca et al, 1993).
Recombinant scfv which can be used to diagnose HIV infection have
also been reported, demonstrating the diagnostic utility of scfv
(Lilley et al, 1994). Fusion proteins wherein an scFv is linked to
a second polypeptide, such as a toxin or fibrinolytic activator
protein, have also been reported (Holvost et al, 1992; Nicholls et
al, 1993).
[0501] If it were possible to generate scfv libraries having
broader antibody diversity and overcoming many of the limitations
of conventional CDR mutagenesis and randomization methods which can
cover only a very tiny fraction of the potential sequence
combinations, the number and quality of scfv antibodies suitable
for therapeutic and diagnostic use could be vastly improved. To
address this, the in vitro and in vivo shuffling methods of the
invention are used to recombine CDRs which have been obtained
(typically via PCR amplification or cloning) from nucleic acids
obtained from selected displayed antibodies. Such displayed
antibodies can be displayed on cells, on bacteriophage particles,
on polysomes, or any suitable antibody display system wherein the
antibody is associated with its encoding nucleic acid(s). In a
variation, the CDRs are initially obtained from mRNA (or cDNA) from
antibody-producing cells (e.g., plasma cells/splenocytes from an
immunized wild-type mouse, a human, or a transgenic mouse capable
of making a human antibody as in WO 92/03918, WO 93/12227, and WO
94/25585), including hybridomas derived therefrom.
[0502] Polynucleotide sequences selected in a first selection round
(typically by affinity selection for displayed antibody binding to
an antigen (e.g., a ligand) by any of these methods are pooled and
the pool(s) is/are shuffled by in vitro and/or in vivo
recombination, especially shuffling of CDRs (typically shuffling
heavy chain CDRs with other heavy chain CDRs and light chain CDRs
with other light chain CDRs) to produce a shuffled pool comprising
a population of recombined selected polynucleotide sequences. The
recombined selected polynucleotide sequences are expressed in a
selection format as a displayed antibody and subjected to at least
one subsequent selection round. The polynucleotide sequences
selected in the subsequent selection round(s) can be used directly,
sequenced, and/or subjected to one or more additional rounds of
shuffling and subsequent selection until an antibody of the desired
binding affinity is obtained. Selected sequences can also be
back-crossed with polynucleotide sequences encoding neutral
antibody framework sequences (i.e., having insubstantial functional
effect on antigen binding), such as for example by back-crossing
with a human variable region framework to produce human-like
sequence antibodies. Generally, during back-crossing subsequent
selection is applied to retain the property of binding to the
predetermined antigen.
[0503] Alternatively, or in combination with the noted variations,
the valency of the target epitope may be varied to control the
average binding affinity of selected scfv library members. The
target epitope can be bound to a surface or substrate at varying
densities, such as by including a competitor epitope, by dilution,
or by other method known to those in the art. A high density
(valency) of predetermined epitope can be used to enrich for scfv
library members which have relatively low affinity, whereas a low
density (valency) can preferentially enrich for higher affinity
scfv library members.
[0504] For generating diverse variable segments, a collection of
synthetic oligonucleotides encoding random, pseudorandom, or a
defined sequence kernal set of peptide sequences can be inserted by
ligation into a predetermined site (e.g., a CDR). Similarly, the
sequence diversity of one or more CDRs of the single-chain antibody
cassette(s) can be expanded by mutating the CDR(s) with
site-directed mutagenesis, CDR-replacement, and the like. The
resultant DNA molecules can be propagated in a host for cloning and
amplification prior to shuffling, or can be used directly (i.e.,
may avoid loss of diversity which may occur upon propagation in a
host cell) and the selected library members subsequently
shuffled.
[0505] Displayed peptide/polynucleotide complexes (library members)
which encode a variable segment peptide sequence of interest or a
single-chain antibody of interest are selected from the library by
an affinity enrichment technique. This is accomplished by means of
a immobilized macromolecule or epitope specific for the peptide
sequence of interest, such as a receptor, other macromolecule, or
other epitope species. Repeating the affinity selection procedure
provides an enrichment of library members encoding the desired
sequences, which may then be isolated for pooling and shuffling,
for sequencing, and/or for further propagation and affinity
enrichment.
[0506] The library members without the desired specificity are
removed by washing. The degree and stringency of washing required
will be determined for each peptide sequence or single-chain
antibody of interest and the immobilized predetermined
macromolecule or epitope. A certain degree of control can be
exerted over the binding characteristics of the nascent peptide/DNA
complexes recovered by adjusting the conditions of the binding
incubation and the subsequent washing. The temperature, pH, ionic
strength, divalent cations concentration, and the volume and
duration of the washing will select for nascent peptide/DNA
complexes within particular ranges of affinity for the immobilized
macromolecule. Selection based on slow dissociation rate, which is
usually predictive of high affinity, is often the most practical
route. This may be done either by continued incubation in the
presence of a saturating amount of free predetermined
macromolecule, or by increasing the volume, number, and length of
the washes. In each case, the rebinding of dissociated nascent
peptide/DNA or peptide/RNA complex is prevented, and with
increasing time, nascent peptide/DNA or peptide/RNA complexes of
higher and higher affinity are recovered. Additional modifications
of the binding and washing procedures may be applied to find
peptides with special characteristics. The affinities of some
peptides are dependent on ionic strength or cation concentration.
This is a useful characteristic for peptides that will be used in
affinity purification of various proteins when gentle conditions
for removing the protein from the peptides are required.
[0507] One variation involves the use of multiple binding targets
(multiple epitope species, multiple receptor species), such that a
scfv library can be simultaneously screened for a multiplicity of
scfv which have different binding specificities. Given that the
size of a scfv library often limits the diversity of potential scfv
sequences, it is typically desirable to us scfv libraries of as
large a size as possible. The time and economic considerations of
generating a number of very large polysome scFv-display libraries
can become prohibitive. To avoid this substantial problem, multiple
predetermined epitope species (receptor species) can be
concomitantly screened in a single library, or sequential screening
against a number of epitope species can be used. In one variation,
multiple target epitope species, each encoded on a separate bead
(or subset of beads), can be mixed and incubated with a
polysome-display scfv library under suitable binding conditions.
The collection of beads, comprising multiple epitope species, can
then be used to isolate, by affinity selection, scfv library
members. Generally, subsequent affinity screening rounds can
include the same mixture of beads, subsets thereof, or beads
containing only one or two individual epitope species. This
approach affords efficient screening, and is compatible with
laboratory automation, batch processing, and high throughput
screening methods.
[0508] A variety of techniques can be used in the present invention
to diversify a peptide library or single-chain antibody library, or
to diversify, prior to or concomitant with shuffling, around
variable segment peptides found in early rounds of panning to have
sufficient binding activity to the predetermined macromolecule or
epitope. In one approach, the positive selected
peptide/polynucleotide complexes (those identified in an early
round of affinity enrichment) are sequenced to determine the
identity of the active peptides. Oligonucleotides are then
synthesized based on these active peptide sequences, employing a
low level of all bases incorporated at each step to produce slight
variations of the primary oligonucleotide sequences. This mixture
of (slightly) degenerate oligonucleotides is then cloned into the
variable segment sequences at the appropriate locations. This
method produces systematic, controlled variations of the starting
peptide sequences, which can then be shuffled. It requires,
however, that individual positive nascent peptide/polynucleotide
complexes be sequenced before mutagenesis, and thus is useful for
expanding the diversity of small numbers of recovered complexes and
selecting variants having higher binding affinity and/or higher
binding specificity. In a variation, mutagenic PCR amplification of
positive selected peptide/polynucleotide complexes (especially of
the variable region sequences, the amplification products of which
are shuffled in vitro and/or in vivo and one or more additional
rounds of screening is done prior to sequencing. The same general
approach can be employed with single-chain antibodies in order to
expand the diversity and enhance the binding affinity/specificity,
typically by diversifying CDRs or adjacent framework regions prior
to or concomitant with shuffling. If desired, shuffling reactions
can be spiked with mutagenic oligonucleotides capable of in vitro
recombination with the selected library members can be included.
Thus, mixtures of synthetic oligonucleotides and PCR produced
polynucleotides (synthesized by error-prone or high-fidelity
methods) can be added to the in vitro shuffling mix and be
incorporated into resulting shuffled library members
(shufflants).
[0509] The present invention of shuffling enables the generation of
a vast library of CDR-variant single-chain antibodies. One way to
generate such antibodies is to insert synthetic CDRs into the
single-chain antibody and/or CDR randomization prior to or
concomitant with shuffling. The sequences of the synthetic CDR
cassettes are selected by referring to known sequence data of human
CDR and are selected in the discretion of the practitioner
according to the following guidelines: synthetic CDRs will have at
least 40 percent positional sequence identity to known CDR
sequences, and preferably will have at least 50 to 70 percent
positional sequence identity to known CDR sequences. For example, a
collection of synthetic CDR sequences can be generated by
synthesizing a collection of oligonucleotide sequences on the basis
of naturally-occurring human CDR sequences listed in Kabat (Kabat
et al, 1991); the pool (s) of synthetic CDR sequences are
calculated to encode CDR peptide sequences having at least 40
percent sequence identity to at least one known naturally-occurring
human CDR sequence. Alternatively, a collection of
naturally-occurring CDR sequences may be compared to generate
consensus sequences so that amino acids used at a residue position
frequently (i.e., in at least 5 percent of known CDR sequences) are
incorporated into the synthetic CDRs at the corresponding
position(s). Typically, several (e.g., 3 to about 50) known CDR
sequences are compared and observed natural sequence variations
between the known CDRs are tabulated, and a collection of
oligonucleotides encoding CDR peptide sequences encompassing all or
most permutations of the observed natural sequence variations is
synthesized. For example but not for limitation, if a collection of
human VH CDR sequences have carboxy-terminal amino acids which are
either Tyr, Val, Phe, or Asp, then the pool(s) of synthetic CDR
oligonucleotide sequences are designed to allow the
carboxy-terminal CDR residue to be any of these amino acids. In
some embodiments, residues other than those which naturally-occur
at a residue position in the collection of CDR sequences are
incorporated: conservative amino acid substitutions are frequently
incorporated and up to 5 residue positions may be varied to
incorporate non-conservative amino acid substitutions as compared
to known naturally-occurring CDR sequences. Such CDR sequences can
be used in primary library members (prior to first round screening)
and/or can be used to spike in vitro shuffling reactions of
selected library member sequences. Construction of such pools of
defined and/or degenerate sequences will be readily accomplished by
those of ordinary skill in the art.
[0510] The collection of synthetic CDR sequences comprises at least
one member that is not known to be a naturally-occurring CDR
sequence. It is within the discretion of the practitioner to
include or not include a portion of random or pseudorandom sequence
corresponding to N region addition in the heavy chain CDR; the N
region sequence ranges from 1 nucleotide to about 4 nucleotides
occurring at V-D and D-J junctions. A collection of synthetic heavy
chain CDR sequences comprises at least about 100 unique CDR
sequences, typically at least about 1,000 unique CDR sequences,
preferably at least about 10,000 unique CDR sequences, frequently
more than 50,000 unique CDR sequences; however, usually not more
than about 1.times.10 6 unique CDR sequences are included in the
collection, although occasionally 1.times.10.sup.7 to 1.times.108
unique CDR sequences are present, especially if conservative amino
acid substitutions are permitted at positions where the
conservative amino acid substituent is not present or is rare
(i.e., less than 0.1 percent) in that position in
naturally-occurring human CDRS. In general, the number of unique
CDR sequences included in a library should not exceed the expected
number of primary transformants in the library by more than a
factor of 10. Such single-chain antibodies generally bind of about
at least 1.times.10 m-, preferably with an affinity of about at
least 5.times.10.sup.7 M-1, more preferably with an affinity of at
least 1.times.10.sup.8 M-1 to 1.times.10.sup.9 M-1 or more,
sometimes up to 1.times.1010 M-1 or more. Frequently, the
predetermined antigen is a human protein, such as for example a
human cell surface antigen (e.g., CD4, CD8, IL-2 receptor, EGF
receptor, PDGF receptor), other human biological macromolecule
(e.g., thrombomodulin, protein C, carbohydrate antigen, sialyl
Lewis antigen, Lselectin), or nonhuman disease associated
macromolecule (e.g., bacterial LPS, virion capsid protein or
envelope glycoprotein) and the like.
[0511] High affinity single-chain antibodies of the desired
specificity can be engineered and expressed in a variety of
systems. For example, scfv have been produced in plants (Firek et
al, 1993) and can be readily made in prokaryotic systems (Owens and
Young, 1994; Johnson and Bird, 1991). Furthermore, the single-chain
antibodies can be used as a basis for constructing whole antibodies
or various fragments thereof (Kettleborough et al, 1994). The
variable region encoding sequence may be isolated (e.g., by PCR
amplification or subcloning) and spliced to a sequence encoding a
desired human constant region to encode a human sequence antibody
more suitable for human therapeutic uses where immunogenicity is
preferably minimized. The polynucleotide(s) having the resultant
fully human encoding sequence(s) can be expressed in a host cell
(e.g., from an expression vector in a mammalian cell) and purified
for pharmaceutical formulation.
[0512] The DNA expression constructs will typically include an
expression control DNA sequence operably linked to the coding
sequences, including naturally-associated or heterologous promoter
regions. Preferably, the expression control sequences will be
eukaryotic promoter systems in vectors capable of transforming or
transfecting eukaryotic host cells. Once the vector has been
incorporated into the appropriate host, the host is maintained
under conditions suitable for high level expression of the
nucleotide sequences, and the collection and purification of the
mutant' "engineered" antibodies.
[0513] As stated previously, the DNA sequences will be expressed in
hosts after the sequences have been operably linked to an
expression control sequence (i.e., positioned to ensure the
transcription and translation of the structural gene). These
expression vectors are typically replicable in the host organisms
either as episomes or as an integral part of the host chromosomal
DNA. Commonly, expression vectors will contain selection markers,
e.g., tetracycline or neomycin, to permit detection of those cells
transformed with the desired DNA sequences (see, e.g., U.S. Pat.
No. 4,704,362, which is incorporated herein by reference).
[0514] In addition to eukaryotic microorganisms such as yeast,
mammalian tissue cell culture may also be used to produce the
polypeptides of the present invention (see Winnacker, 1987), which
is incorporated herein by reference). Eukaryotic cells are actually
preferred, because a number of suitable host cell lines capable of
secreting intact immunoglobulins have been developed in the art,
and include the CHO cell lines, various COS cell lines, HeLa cells,
and myeloma cell lines, but preferably transformed Bcells or
hybridomas. Expression vectors for these cells can include
expression control sequences, such as an origin of replication, a
promoter, an enhancer (Queen et al, 1986), and necessary processing
information sites, such as ribosome binding sites, RNA splice
sites, polyadenylation sites, and transcriptional terminator
sequences. Preferred expression control sequences are promoters
derived from immunoglobulin genes, cytomegalovirus, SV40,
Adenovirus, Bovine Papilloma Virus, and the like.
[0515] Eukaryotic DNA transcription can be increased by inserting
an enhancer sequence into the vector. Enhancers are cis-acting
sequences of between 10 to 300 bp that increase transcription by a
promoter. Enhancers can effectively increase transcription when
either 51 or 31 to the transcription unit. They are also effective
if located within an intron or within the coding sequence itself.
Typically, viral enhancers are used, including SV40 enhancers,
cytomegalovirus enhancers, polyoma enhancers, and adenovirus
enhancers. Enhancer sequences from mammalian systems are also
commonly used, such as the mouse immunoglobulin heavy chain
enhancer.
[0516] Mammalian expression vector systems will also typically
include a selectable marker gene. Examples of suitable markers
include, the dihydrofolate reductase gene (DHFR), the thymidine
kinase gene (TK), or prokaryotic genes conferring drug resistance.
The first two marker genes prefer the use of mutant cell lines that
lack the ability to grow without the addition of thymidine to the
growth medium. Transformed cells can then be identified by their
ability to grow on non-supplemented media. Examples of prokaryotic
drug resistance genes useful as markers include genes conferring
resistance to G418, mycophenolic acid and hygromycin.
[0517] The vectors containing the DNA segments of interest can be
transferred into the host cell by well-known methods, depending on
the type of cellular host. For example, calcium chloride
transfection is commonly utilized for prokaryotic cells, whereas
calcium phosphate treatment. lipofection, or electroporation may be
used for other cellular hosts. Other methods used to transform
mammalian cells include the use of Polybrene, protoplast fusion,
liposomes, electroporation, and micro-injection (see, generally,
Sambrook et al, 1982 and 1989).
[0518] Once expressed, the antibodies, individual mutated
immunoglobulin chains, mutated antibody fragments, and other
immunoglobulin polypeptides of the invention can be purified
according to standard procedures of the art, including ammonium
sulfate precipitation, fraction column chromatography, gel
electrophoresis and the like (see, generally, Scopes, 1982). Once
purified, partially or to homogeneity as desired, the polypeptides
may then be used therapeutically or in developing and performing
assay procedures, immunofluorescent stainings, and the like (see,
generally, Lefkovits and Pernis, 1979 and 1981; Lefkovits,
1997).
[0519] The antibodies generated by the method of the present
invention can be used for diagnosis and therapy. By way of
illustration and not limitation, they can be used to treat cancer,
autoimmune diseases, or viral infections. For treatment of cancer,
the antibodies will typically bind to an antigen expressed
preferentially on cancer cells, such as erbB-2, CEA, CD33, and many
other antigens and binding members well known to those skilled in
the art.
[0520] End-Selection
[0521] This invention provides a method for selecting a subset of
polynucleotides from a starting set of polynucleotides, which
method is based on the ability to discriminate one or more
selectable features (or selection markers) present anywhere in a
working polynucleotide, so as to allow one to perform selection for
(positive selection) &/or against (negative selection) each
selectable polynucleotide. In a preferred aspect, a method is
provided termed end-selection, which method is based on the use of
a selection marker located in part or entirely in a terminal region
of a selectable polynucleotide, and such a selection marker may be
termed an "end-selection marker".
[0522] End-selection may be based on detection of naturally
occurring sequences or on detection of sequences introduced
experimentally (including by any mutagenesis procedure mentioned
herein and not mentioned herein) or on both, even within the same
polynucleotide. An end-selection marker can be a structural
selection marker or a functional selection marker or both a
structural and a functional selection marker. An end-selection
marker may be comprised of a polynucleotide sequence or of a
polypeptide sequence or of any chemical structure or of any
biological or biochemical tag, including markers that can be
selected using methods based on the detection of radioactivity, of
enzymatic activity, of fluorescence, of any optical feature, of a
magnetic property (e.g. using magnetic beads), of immunoreactivity,
and of hybridization.
[0523] End-selection may be applied in combination with any method
serviceable for performing mutagenesis. Such mutagenesis methods
include, but are not limited to, methods described herein (supra
and infra). Such methods include, by way of non-limiting
exemplification, any method that may be referred herein or by
others in the art by any of the following terms: "saturation
mutagenesis", "shuffling", "recombination", "re-assembly",
"error-prone PCR", "assembly PCR", "sexual PCR", "crossover PCR",
"oligonucleotide primer-directed mutagenesis", "recursive (&/or
exponential) ensemble mutagenesis (see Arkin and Youvan, 1992)",
"cassette mutagenesis", "in vivo mutagenesis", and "in vitro
mutagenesis". Moreover, end-selection may be performed on molecules
produced by any mutagenesis &/or amplification method (see,
e.g., Arnold, 1993; Caldwell and Joyce, 1992; Stemmer, 1994;
following which method it is desirable to select for (including to
screen for the presence of) desirable progeny molecules.
[0524] In addition, end-selection may be applied to a
polynucleotide apart from any mutagenesis method. In a preferred
embodiment, end-selection, as provided herein, can be used in order
to facilitate a cloning step, such as a step of ligation to another
polynucleotide (including ligation to a vector). This invention
thus provides for end-selection as a serviceable means to
facilitate library construction, selection &/or enrichment for
desirable polynucleotides, and cloning in general.
[0525] In a particularly preferred embodiment, end-selection can be
based on (positive) selection for a polynucleotide; alternatively
end-selection can be based on (negative) selection against a
polynucleotide; and alternatively still, end-selection can be based
on both (positive) selection for, and on (negative) selection
against, a polynucleotide. End-selection, along with other methods
of selection &/or screening, can be performed in an iterative
fashion, with any combination of like or unlike selection &/or
screening methods and serviceable mutagenesis methods, all of which
can be performed in an iterative fashion and in any order,
combination, and permutation.
[0526] It is also appreciated that, according to one embodiment of
this invention, end-selection may also be used to select a
polynucleotide is at least in part: circular (e.g. a plasmid or any
other circular vector or any other polynucleotide that is partly
circular), &/or branched, &/or modified or substituted with
any chemical group or moiety. In accord with this embodiment, a
polynucleotide may be a circular molecule comprised of an
intermediate or central region, which region is flanked on a 5'
side by a 5' flanking region (which, for the purpose of
end-selection, serves in like manner to a 5' terminal region of a
non-circular polynucleotide) and on a 3' side by a 3' terminal
region (which, for the purpose of end-selection, serves in like
manner to a 3' terminal region of a non-circular polynucleotide).
As used in this non-limiting exemplification, there may be sequence
overlap between any two regions or even among all three
regions.
[0527] In one non-limiting aspect of this invention, end-selection
of a linear polynucleotide is performed using a general approach
based on the presence of at least one end-selection marker located
at or near a polynucleotide end or terminus (that can be either a
5' end or a 3' end). In one particular non-limiting
exemplification, end-selection is based on selection for a specific
sequence at or near a terminus such as, but not limited to, a
sequence recognized by an enzyme that recognizes a polynucleotide
sequence. An enzyme that recognizes and catalyzes a chemical
modification of a polynucleotide is referred to herein as a
polynucleotide-acting enzyme. In a preferred embodiment,
serviceable polynucleotide-acting enzymes are exemplified
non-exclusively by enzymes with polynucleotide-cleaving activity,
enzymes with polynucleotide-methylating activity, enzymes with
polynucleotide-ligating activity, and enzymes with a plurality of
distinguishable enzymatic activities (including non-exclusively,
e.g., both polynucleotide-cleaving activity and
polynucleotide-ligating activity).
[0528] Relevant polynucleotide-acting enzymes thus also include any
commercially available or non-commercially available polynucleotide
endonucleases and their companion methylases including those
catalogued at the website http://www.neb.com/rebase, and those
mentioned in the following cited reference (Roberts and Macelis,
1996). Preferred polynucleotide endonucleases include--but are not
limited to--type II restriction enzymes (including type IIS), and
include enzymes that cleave both strands of a double stranded
polynucleotide (e.g. Not I, which cleaves both strands at 5' . . .
GC/GGCCGC . . . 3') and enzymes that cleave only one strand of a
double stranded polynucleotide, i.e. enzymes that have
polynucleotide-nicking activity, (e.g. N. BstNB I, which cleaves
only one strand at 5' . . . GAGTCNNNN/N . . . 3'). Relevant
polynucleotide-acting enzymes also include type III restriction
enzymes.
[0529] It is appreciated that relevant polynucleotide-acting
enzymes also include any enzymes that may be developed in the
future, though currently unavailable, that are serviceable for
generating a ligation compatible end, preferably a sticky end, in a
polynucleotide.
[0530] In one preferred exemplification, a serviceable selection
marker is a restriction site in a polynucleotide that allows a
corresponding type II (or type US) restriction enzyme to cleave an
end of the polynucleotide so as to provide a ligatable end
(including a blunt end or alternatively a sticky end with at least
a one base overhang) that is serviceable for a desirable ligation
reaction without cleaving the polynucleotide internally in a manner
that destroys a desired internal sequence in the polynucleotide.
Thus it is provided that, among relevant restriction sites, those
sites that do not occur internally (i.e. that do not occur apart
from the termini) in a specific working polynucleotide are
preferred when the use of a corresponding restriction enzyme(s) is
not intended to cut the working polynucleotide internally. This
allows one to perform restriction digestion reactions to completion
or to near completion without incurring unwanted internal cleavage
in a working polynucleotide.
[0531] According to a preferred aspect, it is thus preferable to
use restriction sites that are not contained, or alternatively that
are not expected to be contained, or alternatively that unlikely to
be contained (e.g. when sequence information regarding a working
polynucleotide is incomplete) internally in a polynucleotide to be
subjected to end-selection. In accordance with this aspect, it is
appreciated that restriction sites that occur relatively
infrequently are usually preferred over those that occur more
frequently. On the other hand it is also appreciated that there are
occasions where internal cleavage of a polypeptide is desired, e.g.
to achieve recombination or other mutagenic procedures along with
end-selection.
[0532] In accord with this invention, it is also appreciated that
methods (e.g. mutagenesis methods) can be used to remove unwanted
internal restriction sites. It is also appreciated that a partial
digestion reaction (i.e. a digestion reaction that proceeds to
partial completion) can be used to achieve digestion at a
recognition site in a terminal region while sparing a susceptible
restriction site that occurs internally in a polynucleotide and
that is recognized by the same enzyme. In one aspect, partial
digest are useful because it is appreciated that certain enzymes
show preferential cleavage of the same recognition sequence
depending on the location and environment in which the recognition
sequence occurs. For example, it is appreciated that, while lambda
DNA has 5 EcoR I sites, cleavage of the site nearest to the right
terminus has been reported to occur 10 times faster than the sites
in the middle of the molecule. Also, for example, it has been
reported that, while Sac II has four sites on lambda DNA, the three
clustered centrally in lambda are cleaved 50 times faster than the
remaining site near the terminus (at nucleotide 40,386). Summarily,
site preferences have been reported for various enzymes by many
investigators (e.g., Thomas and Davis, 1975; Forsblum et al, 1976;
Nath and Azzolina, 1981; Brown and Smith, 1977; Gingeras and
Brooks, 1983; Kruger et al, 1988; Conrad and Topal, 1989; Oiler et
al, 1991; Topal, 1991; and Pein, 1991; to name but a few). It is
appreciated that any empirical observations as well as any
mechanistic understandings of site preferences by any serviceable
polynucleotide-acting enzymes, whether currently available or to be
procured in the future, may be serviceable in end-selection
according to this invention.
[0533] It is also appreciated that protection methods can be used
to selectively protect specified restriction sites (e.g. internal
sites) against unwanted digestion by enzymes that would otherwise
cut a working polypeptide in response to the presence of those
sites; and that such protection methods include modifications such
as methylations and base substitutions (e.g. U instead of T) that
inhibit an unwanted enzyme activity. It is appreciated that there
are limited numbers of available restriction enzymes that are rare
enough (e.g. having very long recognition sequences) to create
large (e.g. megabase-long) restriction fragments, and that
protection approaches (e.g. by methylation) are serviceable for
increasing the rarity of enzyme cleavage sites. The use of M.Fnu II
(mCGCG) to increase the apparent rarity of Not I approximately
twofold is but one example among many (Qiang et al, 1990; Nelson et
al, 1984; Maxam and Gilbert, 1980; Raleigh and Wilson, 1986).
[0534] According to a preferred aspect of this invention, it is
provided that, in general, the use of rare restriction sites is
preferred. It is appreciated that, in general, the frequency of
occurrence of a restriction site is determined by the number of
nucleotides contained therein, as well as by the ambiguity of the
base requirements contained therein. Thus, in a non-limiting
exemplification, it is appreciated that, in general, a restriction
site composed of, for example, 8 specific nucleotides (e.g. the Not
I site or GC/GGCCGC, with an estimated relative occurrence of 1 in
48, i.e. 1 in 65,536, random 8-mers) is relatively more infrequent
than one composed of, for example, 6 nucleotides (e.g. the Sma I
site or CCC/GGG, having an estimated relative occurrence of 1 in
4.sup.6, i.e. 1 in 4,096, random 6-mers), which in turn is
relatively more infrequent than one composed of, for example, 4
nucleotides (e.g. the Msp I site or C/CGG, having an estimated
relative occurrence of 1 in 4.sup.4, i.e. 1 in 256, random 4-mers).
Moreover, in another non-limiting exemplification, it is
appreciated that, in general, a restriction site having no
ambiguous (but only specific) base requirements (e.g. the Fin I
site or GTCCC, having an estimated relative occurrence of 1 in
4.sup.5, i.e. 1 in 1024, random 5-mers),is relatively more
infrequent than one having an ambiguous W (where W=A or T) base
requirement (e.g. the Ava II site or G/GWCC, having an estimated
relative occurrence of 1 in 4.times.4.times.2.times.4.times.4--i.e.
1 in 512--random 5-mers), which in turn is relatively more
infrequent than one having an ambiguous N (where N=A or C or G or
T) base requirement (e.g. the Asu I site or G/GNCC, having an
estimated relative occurrence of 1 in
4.times.4.times.1.times.4.times.4, i.e. 1 in 256--random 5-mers).
These relative occurrences are considered general estimates for
actual polynucleotides, because it is appreciated that specific
nucleotide bases (not to mention specific nucleotide sequences)
occur with dissimilar frequencies in specific polynucleotides, in
specific species of organisms, and in specific groupings of
organisms. For example, it is appreciated that the % G+C contents
of different species of organisms are often very different and wide
ranging.
[0535] The use of relatively more infrequent restriction sites as a
selection marker include--in a non-limiting fashion--preferably
those sites composed at least a 4 nucleotide sequence, more
preferably those composed at least a 5 nucleotide sequence, more
preferably still those composed at least a 6 nucleotide sequence
(e.g. the BamH I site or G/GATCC, the Bgl II site or A/GATCT, the
Pst I site or CTGCA/G, and the Xba I site or T/CTAGA), more
preferably still those composed at least a 7 nucleotide sequence,
more preferably still those composed of an 8 nucleotide sequence
nucleotide sequence (e.g. the Asc I site or GG/CGCGCC, the Not I
site or GC/GGCCGC, the Pac I site or TTAAT/TAA, the Pme I site or
GTTT/AAAC, the SrfI site or GCCC/GGGC, the Sse838 I site or
CCTGCA/GGG, and the Swa I site or ATTT/AAAT), more preferably still
those composed of a 9 nucleotide sequence, and even more preferably
still those composed of at least a 10 nucleotide sequence (e.g. the
BspG I site or CG/CGCTGGAC). It is further appreciated that some
restriction sites (e.g. for class IIS enzymes) are comprised of a
portion of relatively high specificity (i.e. a portion containing a
principal determinant of the frequency of occurrence of the
restriction site) and a portion of relatively low specificity; and
that a site of cleavage may or may not be contained within a
portion of relatively low specificity. For example, in the Eco57 I
site or CTGAAG(16/14), there is a portion of relatively high
specificity (i.e. the CTGAAG portion) and a portion of relatively
low specificity (i.e. the N16 sequence) that contains a site of
cleavage.
[0536] In another preferred embodiment of this invention, a
serviceable end-selection marker is a terminal sequence that is
recognized by a polynucleotide-acting enzyme that recognizes a
specific polynucleotide sequence. In a preferred aspect of this
invention, serviceable polynucleotide-acting enzymes also include
other enzymes in addition to classic type II restriction enzymes.
According to this preferred aspect of this invention, serviceable
polynucleotide-acting enzymes also include gyrases, helicases,
recombinases, relaxases, and any enzymes related thereto.
[0537] Among preferred examples are topoisomerases (which have been
categorized by some as a subset of the gyrases) and any other
enzymes that have polynucleotide-cleaving activity (including
preferably polynucleotide-nicking activity) &/or
polynucleotide-ligating activity. Among preferred topoisomerase
enzymes are topoisomerase I enzymes, which is available from many
commercial sources (Epicentre Technologies, Madison, Wis.;
Invitrogen, Carlsbad, Calif.; Life Technologies, Gathesburg, Md.)
and conceivably even more private sources. It is appreciated that
similar enzymes may be developed in the future that are serviceable
for end-selection as provided herein. A particularly preferred
topoisomerase I enzyme is a topoisomerase I enzyme of vaccinia
virus origin, that has a specific recognition sequence (e.g. 5' . .
. AAGGG . . . 3') and has both polynucleotide-nicking activity and
polynucleotide-ligating activity. Due to the specific
nicking-activity of this enzyme (cleavage of one strand), internal
recognition sites are not prone to polynucleotide destruction
resulting from the nicking activity (but rather remain annealed) at
a temperature that causes denaturation of a terminal site that has
been nicked. Thus for use in end-selection, it is preferable that a
nicking site for topoisomerase-based end-selection be no more than
100 nucleotides from a terminus, more preferably no more than 50
nucleotides from a terminus, more preferably still no more than 25
nucloetides from a terminus, even more preferably still no more
than 20 nucleotides from a terminus, even more preferably still no
more than 15 nucleotides from a terminus, even more preferably
still no more than 10 nucleotides from a terminus, even more
preferably still no more than 8 nucleotides from a terminus, even
more preferably still no more than 6 nucleotides from a terminus,
and even more preferably still no more than 4 nucleotides from a
terminus.
[0538] In a particularly preferred exemplification that is
non-limiting yet clearly illustrative, it is appreciated that when
a nicking site for topoisomerase-based end-selection is 4
nucleotides from a terminus, nicking produces a single stranded
oligo of 4 bases (in a terminal region) that can be denatured from
its complementary strand in an end-selectable polynucleotide; this
provides a sticky end (comprised of 4 bases) in a polynucleotide
that is serviceable for an ensuing ligation reaction. To accomplish
ligation to a cloning vector (preferably an expression vector),
compatible sticky ends can be generated in a cloning vector by any
means including by restriction enzyme-based means. The terminal
nucleotides (comprised of 4 terminal bases in this specific
example) in an end-selectable polynucleotide terminus are thus
wisely chosen to provide compatibility with a sticky end generated
in a cloning vector to which the polynucleotide is to be
ligated.
[0539] On the other hand, internal nicking of an end-selectable
polynucleotide, e.g. 500 bases from a terminus, produces a single
stranded oligo of 500 bases that is not easily denatured from its
complementary strand, but rather is serviceable for repair (e.g. by
the same topoisomerase enzyme that produced the nick).
[0540] This invention thus provides a method--e.g. that is vaccinia
topoisomerase-based &/or type II (or IIS) restriction
endonuclease-based &/or type III restriction endonuclease-based
&/or nicking enzyme-based (e.g. using N. BstNB I)--for
producing a sticky end in a working polynucleotide, which end is
ligation compatible, and which end can be comprised of at least a 1
base overhang. Preferably such a sticky end is comprised of at
least a 2-base overhang, more preferably such a sticky end is
comprised of at least a 3-base overhang, more preferably still such
a sticky end is comprised of at least a 4-base overhang, even more
preferably still such a sticky end is comprised of at least a
5-base overhang, even more preferably still such a sticky end is
comprised of at least a 6-base overhang. Such a sticky end may also
be comprised of at least a 7-base overhang, or at least an 8-base
overhang, or at least a 9-base overhang, or at least a 10-base
overhang, or at least 15-base overhang, or at least a 20-base
overhang, or at least a 25-base overhang, or at least a 30-base
overhang. These overhangs can be comprised of any bases, including
A, C, G or T.
[0541] It is appreciated that sticky end overhangs introduced using
topoisomerase or a nicking enzyme (e.g. using N. BstNB I) can be
designed to be unique in a ligation environment, so as to prevent
unwanted fragment reassemblies, such as self-dimerizations and
other unwanted concatamerizations.
[0542] According to one aspect of this invention, a plurality of
sequences (which may but do not necessarily overlap) can be
introduced into a terminal region of an end-selectable
polynucleotide by the use of an oligo in a polymerase-based
reaction. In a relevant, but by no means limiting example, such an
oligo can be used to provide a preferred 5' terminal region that is
serviceable for topoisomerase I-based end-selection, which oligo is
comprised of: a 1-10 base sequence that is convertible into a
sticky end (preferably by a vaccinia topoisomerase I), a ribosome
binding site (i.e. and "RBS", that is preferably serviceable for
expression cloning), and optional linker sequence followed by an
ATG start site and a template-specific sequence of 0-100 bases (to
facilitate annealment to the template in a polymerase-based
reaction). Thus, according to this example, a serviceable oligo
(which may be termed a forward primer) can have the sequence: 5'
[terminal sequence=(N).sub.1-10] [topoisomerase I site &
RBS=AAGGGAGGAG] [linker=(N).sub.1-10] [start codon and
template-specific sequence=ATG(N).sub.0-100]3'.
[0543] Analogously, in a relevant, but by no means limiting
example, an oligo can be used to provide a preferred 3' terminal
region that is serviceable for topoisomerase I-based end-selection,
which oligo is comprised of: a 1-10 base sequence that is
convertible into a sticky end (preferably by a vaccinia
topoisomerase I), and optional linker sequence followed by a
template-specific sequence of 0-100 bases (to facilitate annealment
to the template in a polymerase-based reaction). Thus, according to
this example, a serviceable oligo (which may be termed a reverse
primer) can have the sequence: 5' [terminal
sequence=(N).sub.1-10][topoisomerase I site=AAGGG]
[linker=(N).sub.1-100] [template-specific
sequence=(N).sub.0-100]3'.
[0544] It is appreciated that, end-selection can be used to
distinguish and separate parental template molecules (e.g. to be
subjected to mutagenesis) from progeny molecules (e.g. generated by
mutagenesis). For example, a first set of primers, lacking in a
topoisomerase I recognition site, can be used to modify the
terminal regions of the parental molecules (e.g. in
polymerase-based amplification). A different second set of primers
(e.g. having a topoisomerase I recognition site) can then be used
to generate mutated progeny molecules (e.g. using any
polynucleotide chimerization method, such as interrupted synthesis,
template-switching polymerase-based amplification, or interrupted
synthesis; or using saturation mutagenesis; or using any other
method for introducing a topoisomerase I recognition site into a
mutagenized progeny molecule as disclosed herein) from the
amplified template molecules. The use of topoisomerase I-based
end-selection can then facilitate, not only discernment, but
selective topoisomerase I-based ligation of the desired progeny
molecules.
[0545] Annealment of a second set of primers to thusly amplified
parental molecules can be facilitated by including sequences in a
first set of primers (i.e. primers used for amplifying a set
parental molecules) that are similar to a toposiomerase I
recognition site, yet different enough to prevent functional
toposiomerase I enzyme recognition. For example, sequences that
diverge from the AAGGG site by anywhere from 1 base to all 5 bases
can be incorporated into a first set of primers (to be used for
amplifying the parental templates prior to subjection to
mutagenesis). In a specific, but non-limiting aspect, it is thus
provided that a parental molecule can be amplified using the
following exemplary--but by no means limiting--set of forward and
reverse primers:
1 Forward Primer: 5' CTAGAAGAGAGGAGAAAACCATG(N)10100 3', and
Reverse Primer: 5' GATCAAAGGCGCGCCTGCAGG(N)- 10100 3'
[0546] According to this specific example of a first set of
primers, (N).sub.10-100 represents preferably a 10 to 100
nucleotide-long template-specific sequence, more preferably a 10 to
50 nucleotide-long template-specific sequence, more preferably
still a 10 to 30 nucleotide-long template-specific sequence, and
even more preferably still a 15 to 25 nucleotide-long
template-specific sequence.
[0547] According to a specific, but non-limiting aspect, it is thus
provided that, after this amplification (using a disclosed first
set of primers lacking in a true topoisomerase I recognition site),
amplified parental molecules can then be subjected to mutagenesis
using one or more sets of forward and reverse primers that do have
a true topoisomerase I recognition site. In a specific, but
non-limiting aspect, it is thus provided that a parental molecule
can be used as templates for the generation of a mutagenized
progeny molecule using the following exemplary--but by no means
limiting--second set of forward and reverse primers:
2 Forward Primer: 5' CTAGAAGGGAGGAGAAAACCATG 3' Reverse Primer: 5'
GATCAAAGGCGCGCCTGCAGG 3' (contains Asc I recognition sequence)
[0548] It is appreciated that any number of different primers sets
not specifically mentioned can be used as first, second, or
subsequent sets of primers for end-selection consistent with this
invention. Notice that type II restriction enzyme sites can be
incorporated (e.g. an Asc I site in the above example). It is
provided that, in addition to the other sequences mentioned, the
experimentalist can incorporate one or more N,N,G/T triplets into a
serviceable primer in order to subject a working polynucleotide to
saturation mutagenesis. Summarily, use of a second and/or
subsequent set of primers can achieve dual goals of introducing a
topoisomerase I site and of generating mutations in a progeny
polynucleotide.
[0549] Thus, according to one use provided, a serviceable
end-selection marker is an enzyme recognition site that allows an
enzyme to cleave (including nick) a polynucleotide at a specified
site, to produce a ligation-compatible end upon denaturation of a
generated single stranded oligo. Ligation of the produced
polynucleotide end can then be accomplished by the same enzyme
(e.g. in the case of vaccinia virus topoisomerase I), or
alternatively with the use of a different enzyme. According to one
aspect of this invention, any serviceable end-selection markers,
whether like (e.g. two vaccinia virus topoisomerase I recognition
sites) or unlike (e.g. a class II restriction enzyme recognition
site and a vaccinia virus topoisomerase I recognition site) can be
used in combination to select a polynucleotide. Each selectable
polynucleotide can thus have one or more end-selection markers, and
they can be like or unlike end-selection markers. In a particular
aspect, a plurality of end-selection markers can be located on one
end of a polynucleotide and can have overlapping sequences with
each other.
[0550] It is important to emphasize that any number of enzymes,
whether currently in existence or to be developed, can be
serviceable in end-selection according to this invention. For
example, in a particular aspect of this invention, a nicking enzyme
(e.g. N. BstNB I, which cleaves only one strand at 5' . . .
GAGTCNNNN/N . . . 3') can be used in conjunction with a source of
polynucleotide-ligating activity in order to achieve end-selection.
According to this embodiment, a recognition site for N. BstNB
I--instead of a recognition site for topoisomerase I--should be
incorporated into an end-selectable polynucleotide (whether
end-selection is used for selection of a mutagenized progeny
molecule or whether end-selection is used apart from any
mutagenesis procedure).
[0551] It is appreciated that the instantly disclosed end-selection
approach using topoisomerase-based nicking and ligation has several
advantages over previously available selection methods. In sum,
this approach allows one to achieve direction cloning (including
expression cloning). Specifically, this approach can be used for
the achievement of: direct ligation (i.e. without subjection to a
classic restriction-purification-ligation reaction, that is
susceptible to a multitude of potential problems from an initial
restriction reaction to a ligation reaction dependent on the use of
T4 DNA ligase); separation of progeny molecules from original
template molecules (e.g. original template molecules lack
topoisomerase I sites that not introduced until after mutagenesis),
obviation of the need for size separation steps (e.g. by gel
chromatography or by other electrophoretic means or by the use of
size-exclusion membranes), preservation of internal sequences (even
when topoisomerase I sites are present), obviation of concerns
about unsuccessful ligation reactions (e.g. dependent on the use of
T4 DNA ligase, particularly in the presence of unwanted residual
restriction enzyme activity), and facilitated expression cloning
(including obviation of frame shift concerns). Concerns about
unwanted restriction enzyme-based cleavages--especially at internal
restriction sites (or even at often unpredictable sites of unwanted
star activity) in a working polynucleotide--that are potential
sites of destruction of a working polynucleotide can also be
obviated by the instantly disclosed end-selection approach using
topoisomerase-based nicking and ligation.
[0552] Two-Hybrid Based Screening Assays
[0553] Shuffling can also be used to recombinatorially diversify a
pool of selected library members obtained by screening a two-hybrid
screening system to identify library members which bind a
predetermined polypeptide sequence. The selected library members
are pooled and shuffled by in vitro and/or in vivo recombination.
The shuffled pool can then be screened in a yeast two hybrid system
to select library members which bind said predetermined polypeptide
sequence (e.g., and SH2 domain) or which bind an alternate
predetermined polypeptide sequence (e.g., an SH2 domain from
another protein species).
[0554] An approach to identifying polypeptide sequences which bind
to a predetermined polypeptide sequence has been to use a so-called
"two-hybrid" system wherein the predetermined polypeptide sequence
is present in a fusion protein (Chien et al, 1991). This approach
identifies protein-protein interactions in vivo through
reconstitution of a transcriptional activator (Fields and Song,
1989), the yeast Gal4 transcription protein. Typically, the method
is based on the properties of the yeast Gal4 protein, which
consists of separable domains responsible for DNA-binding and
transcriptional activation. Polynucleotides encoding two hybrid
proteins, one consisting of the yeast Gal4 DNA-binding domain fused
to a polypeptide sequence of a known protein and the other
consisting of the Gal4 activation domain fused to a polypeptide
sequence of a second protein, are constructed and introduced into a
yeast host cell. Intermolecular binding between the two fusion
proteins reconstitutes the Gal4 DNA-binding domain with the Gal4
activation domain, which leads to the transcriptional activation of
a reporter gene (e.g., lacz, HIS3) which is operably linked to a
Gal4 binding site. Typically, the two-hybrid method is used to
identify novel polypeptide sequences which interact with a known
protein (Silver and Hunt, 1993; Durfee et al, 1993; Yang et al,
1992; Luban et al, 1993; Hardy et al, 1992; Bartel et al, 1993; and
Vojtek et al, 1993). However, variations of the two-hybrid method
have been used to identify mutations of a known protein that affect
its binding to a second known protein (Li and Fields, 1993; Lalo et
al, 1993; Jackson et al, 1993; and Madura et al, 1993). Two-hybrid
systems have also been used to identify interacting structural
domains of two known proteins (Bardwell et al, 1993; Chakrabarty et
al, 1992; Staudinger et al, 1993; and Milne and Weaver 1993) or
domains responsible for oligomerization of a single protein
(Iwabuchi et al, 1993; Bogerd et al, 1993). Variations of
two-hybrid systems have been used to study the in vivo activity of
a proteolytic enzyme (Dasmahapatra et al, 1992). Alternatively, an
E. coli/BCCP interactive screening system (Germino et al, 1993;
Guarente, 1993) can be used to identify interacting protein
sequences (i.e., protein sequences which heterodimerize or form
higher order heteromultimers). Sequences selected by a two-hybrid
system can be pooled and shuffled and introduced into a two-hybrid
system for one or more subsequent rounds of screening to identify
polypeptide sequences which bind to the hybrid containing the
predetermined binding sequence. The sequences thus identified can
be compared to identify consensus sequence(s) and consensus
sequence kernals.
[0555] In general, standard techniques of recombination DNA
technology are described in various publications (e.g. Sambrook et
al, 1989; Ausubel et al, 1987; and Berger and Kimmel, 1987, each of
which is incorporated herein in its entirety by reference.
Polynucleotide modifying enzymes were used according to the
manufacturer's recommendations. Oligonucleotides were synthesized
on an Applied Biosystems Inc. Model 394 DNA synthesizer using ABI
chemicals. If desired, PCR amplimers for amplifying a predetermined
DNA sequence may be selected at the discretion of the
practitioner.
[0556] One microgram samples of template DNA are obtained and
treated with U.V. light to cause the formation of dimers, including
TT dimers, particularly purine dimers. U.V. exposure is limited so
that only a few photoproducts are generated per gene on the
template DNA sample. Multiple samples are treated with U.V. light
for varying periods of time to obtain template DNA samples with
varying numbers of dimers from U.V. exposure.
[0557] A random priming kit which utilizes a non-proofreading
polymease (for example, Prime-It II Random Primer Labeling kit by
Stratagene Cloning Systems) is utilized to generate different size
polynucleotides by priming at random sites on templates which are
prepared by U.V. light (as described above) and extending along the
templates. The priming protocols such as described in the Prime-It
II Random Primer Labeling kit may be utilized to extend the
primers. The dimers formed by U.V. exposure serve as a roadblock
for the extension by the non-proofreading polymerase. Thus, a pool
of random size polynucleotides is present after extension with the
random primers is finished.
[0558] The present invention is further directed to a method for
generating a selected mutant polynucleotide sequence (or a
population of selected polynucleotide sequences) typically in the
form of amplified and/or cloned polynucleotides, whereby the
selected polynucleotide sequences(s) possess at least one desired
phenotypic characteristic (e.g., encodes a polypeptide, promotes
transcription of linked polynucleotides, binds a protein, and the
like) which can be selected for. One method for identifying hybrid
polypeptides that possess a desired structure or functional
property, such as binding to a predetermined biological
macromolecule (e.g., a receptor), involves the screening of a large
library of polypeptides for individual library members which
possess the desired structure or functional property conferred by
the amino acid sequence of the polypeptide.
[0559] In one embodiment, the present invention provides a method
for generating libraries of displayed polypeptides or displayed
antibodies suitable for affinity interaction screening or
phenotypic screening. The method comprises (1) obtaining a first
plurality of selected library members comprising a displayed
polypeptide or displayed antibody and an associated polynucleotide
encoding said displayed polypeptide or displayed antibody, and
obtaining said associated polynucleotides or copies thereof wherein
said associated polynucleotides comprise a region of substantially
identical sequences, optimally introducing mutations into said
polynucleotides or copies, (2) pooling the polynucleotides or
copies, (3) producing smaller or shorter polynucleotides by
interrupting a random or particularized priming and synthesis
process or an amplification process, and (4) performing
amplification, preferably PCR amplification, and optionally
mutagenesis to homologously recombine the newly synthesized
polynucleotides.
[0560] It is a particularly preferred object of the invention to
provide a process for producing hybrid polynucleotides which
express a useful hybrid polypeptide by a series of steps
comprising:
[0561] (a) producing polynucleotides by interrupting a
polynucleotide amplification or synthesis process with a means for
blocking or interrupting the amplification or synthesis process and
thus providing a plurality of smaller or shorter polynucleotides
due to the replication of the polynucleotide being in various
stages of completion;
[0562] (b) adding to the resultant population of single- or
double-stranded polynucleotides one or more single- or
double-stranded oligonucleotides, wherein said added
oligonucleotides comprise an area of identity in an area of
heterology to one or more of the single- or double-stranded
polynucleotides of the population;
[0563] (c) denaturing the resulting single- or double-stranded
oligonucleotides to produce a mixture of single-stranded
polynucleotides, optionally separating the shorter or smaller
polynucleotides into pools of polynucleotides having various
lengths and further optionally subjecting said polynucleotides to a
PCR procedure to amplify one or more oligonucleotides comprised by
at least one of said polynucleotide pools;
[0564] (d) incubating a plurality of said polynucleotides or at
least one pool of said polynucleotides with a polymerase under
conditions which result in annealing of said single-stranded
polynucleotides at regions of identity between the single-stranded
polynucleotides and thus forming of a mutagenized double-stranded
polynucleotide chain;
[0565] (e) optionally repeating steps (c) and (d);
[0566] (f) expressing at least one hybrid polypeptide from said
polynucleotide chain, or chains; and
[0567] (g) screening said at least one hybrid polypeptide for a
useful activity.
[0568] In a preferred aspect of the invention, the means for
blocking or interrupting the amplification or synthesis process is
by utilization of U.V. light, DNA adducts, DNA binding
proteins.
[0569] In one embodiment of the invention, the DNA adducts, or
polynucleotides comprising the DNA adducts, are removed from the
polynucleotides or polynucleotide pool, such as by a process
including heating the solution comprising the DNA fragments prior
to further processing.
[0570] Having thus disclosed exemplary embodiments of the present
invention, it should be noted by those skilled in the art that the
disclosures are exemplary only and that various other alternatives,
adaptations and modifications may be made within the scope of the
present invention. Accordingly, the present invention is not
limited to the specific embodiments as illustrated herein.
[0571] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, utilize the
present invention to its fullest extent. The following examples are
to be considered illustrative and thus are not limiting of the
remainder of the disclosure in any way whatsoever.
EXAMPLE 1
Generation of Random Size Polynucleotides Using U.V. Induced
Photoproducts
[0572] One microgram samples of template DNA are obtained and
treated with U.V. light to cause the formation of dimers, including
TT dimers, particularly purine dimers. U.V. exposure is limited so
that only a few photoproducts are generated per gene on the
template DNA sample. Multiple samples are treated with U.V. light
for varying periods of time to obtain template DNA samples with
varying numbers of dimers from U.V. exposure.
[0573] A random priming kit which utilizes a non-proofreading
polymerase (for example, Prime-It II Random Primer Labeling kit by
Stratagene Cloning Systems) is utilized to generate different size
polynucleotides by priming at random sites on templates which are
prepared by U.V. light (as described above) and extending along the
templates. The priming protocols such as described in the Prime-It
II Random Primer Labeling kit may be utilized to extend the
primers. The dimers formed by U.V. exposure serve as a roadblock
for the extension by the non-proofreading polymerase. Thus, a pool
of random size polynucleotides is present after extension with the
random primers is finished.
EXAMPLE 2
Isolation of Random Size Polynucleotides
[0574] Polynucleotides of interest which are generated according to
Example 1 are gel isolated on a 1.5% agarose gel. Polynucleotides
in the 100-300 bp range are cut out of the gel and 3 volumes of 6 M
NaI is added to the gel slice. The mixture is incubated at
50.degree. C. for 10 minutes and 10 .mu.l of glass milk (Bio 101)
is added. The mixture is spun for 1 minute and the supernatant is
decanted. The pellet is washed with 500 .mu.l of Column Wash
(Column Wash is 50%, ethanol, 10 mM Tris-HCl pH 7.5, 100 mM NaCl
and 2.5 mM EDTA) and spin for 1 minute, after which the supernatant
is decanted. The washing, spinning and decanting steps are then
repeated. The glass milk pellet is resuspended in 20 .mu.l of
H.sub.2O and spun for 1 minute. DNA remains in the aqueous
phase.
EXAMPLE 3
Shuffling of Isolated Random Size 100-300 bp Polynucleotides
[0575] The 100-300 bp polynucleotides obtained in Example 2 are
recombined in an annealing mixture (0.2 mM each dNTP, 2.2 mM
MgCl.sub.2, 50 mM KCl, 10 mM Tris-HCl ph 8.8, 0.1% Triton X-100,
0.3; Taq DNA polymerase, 50 .mu.l total volume) without adding
primers. A Robocycler by Stratagene was used for the annealing step
with the following program: 95.degree. C. for 30 seconds, 25-50
cycles of [95.degree. C. for 30 seconds, 50-60.degree. C.
(preferably 58.degree. C.) for 30 seconds, and 72.degree. C. for 30
seconds] and 5 minutes at 72.degree. C. Thus, the 100-300 bp
polynucleotides combine to yield double-stranded polynucleotides
having a longer sequence. After separating out the reassembled
double-stranded polynucleotides and denaturing them to form single
stranded polynucleotides, the cycling is optionally again repeated
with some samples utilizing the single strands as template and
primer DNA and other samples utilizing random primers in addition
to the single strands.
EXAMPLE 4
Screening of Polypeptides from Shuffled Polynucleotides
[0576] The polynucleotides of Example 3 are separated and
polypeptides are expressed therefrom. The original template DNA is
utilized as a comparative control by obtaining comparative
polypeptides therefrom. The polypeptides obtained from the shuffled
polynucleotides of Example 3 are screened for the activity of the
polypeptides obtained from the original template and compared with
the activity levels of the control. The shuffled polynucleotides
coding for interesting polypeptides discovered during screening are
compared further for secondary desirable traits. Some shuffled
polynucleotides corresponding to less interesting screened
polypeptides are subjected to reshuffling.
EXAMPLE 5
Directed Evolution an Enzyme by Saturation Mutagenesis
[0577] Site-Saturation Mutagenesis: To accomplish site-saturation
mutagenesis every residue (316) of a dehalogenase enzyme was
converted into all 20 amino acids by site directed mutagenesis
using 32-fold degenerate oligonucleotide primers, as follows:
[0578] 1. A culture of the dehalogenase expression construct was
grown and a preparation of the plasmid was made
[0579] 2. Primers were made to randomize each codon--they have the
common structure X.sub.20NN(G/T)X.sub.20
[0580] 3. A reaction mix of 25 .mu.l was prepared containing
.about.50 ng of plasmid template, 125 ng of each primer, 1.times.
native Pfu buffer, 200 .mu.M each dNTP and 2.5 U native Pfu DNA
polymerase
[0581] 4. The reaction was cycled in a Robo96 Gradient Cycler as
follows:
[0582] Initial denaturation at 95.degree. C. for 1 min
[0583] 20 cycles of 95.degree. C. for 45 sec, 53.degree. C. for 1
min and 72.degree. C. for 11 min
[0584] Final elongation step of 72.degree. C. for 10 min
[0585] 5. The reaction mix was digested with 10 U of DpnI at
37.degree. C. for 1 hour to digest the methylated template DNA
[0586] 6. Two ul of the reaction mix were used to transform 50 ul
of XL1-Blue MRF cells and the entire transformation mix was plated
on a large LB-Amp-Met plate yielding 200-1000 colonies
[0587] 7. Individual colonies were toothpicked into the wells of
96-well microtiter plates containing LB-Amp-IPTG and grown
overnight
[0588] 8. The clones on these plates were assayed the following
day
[0589] Screening: Approximately 200 clones of mutants for each
position were grown in liquid media (384 well microtiter plates)
and screened as follows:
[0590] 1. Overnight cultures in 384-well plates were centrifuged
and the media removed. To each well was added 0.06 mL 1 mM
Tris/SO.sub.4.sup.2-pH 7.8.
[0591] 2. Made 2 assay plates from each parent growth plate
consisting of 0.02 mL cell suspension.
[0592] 3. One assay plate was placed at room temperature and the
other at elevated temperature (initial screen used 55.degree. C.)
for a period of time (initially 30 minutes).
[0593] 4. After the prescribed time 0.08 mL room temperature
substrate (TCP saturated 1 mM Tris/SO.sub.4.sup.2-pH 7.8 with 1.5
mM NaN.sub.3 and 0.1 mM bromothymol blue) was added to each
well.
[0594] 5. Measurements at 620 nm were taken at various time points
to generate a progress curve for each well.
[0595] 6. Data were analyzed and the kinetics of the cells heated
to those not heated were compared. Each plate contained 1-2 columns
(24 wells) of unmutated 20F12 controls.
[0596] 7. Wells that appeared to have improved stability were
re-grown and tested under the same conditions.
[0597] Following this procedure nine single site mutations appeared
to confer increased thermal stability on the enzyme. Sequence
analysis was performed to determine of the exact amino acid changes
at each position that were specifically responsible for the
improvement. In sum, the improvement was conferred at 7 sites by
one amino acid change alone, at an eighth site by each of two amino
acid changes, and at a ninth site by each of three amino acid
changes. Several mutants were then made each having a plurality of
these nine beneficial site mutations in combination; of these two
mutants proved superior to all the other mutants, including those
with single point mutations.
EXAMPLE 6
Direct Expression Cloning Using End-Selection
[0598] An esterase gene was amplified using 5'phosphorylated
primers in a standard PCR reaction (10 ng template; PCR conditions:
3' 94 C; [1' 94 C; 1' 50 C; 1'30" 68 C].times.30; 10'68 C.
[0599] Forward Primer=9511TopF
(CTAGAAGGGAGGAGAATTACATGAAGCGGCTTTTAGCCC)
[0600] Reverse Primer=9511TopR (AGCTAAGGGTCAAGGCCGCACCCGAGG)
[0601] The resulting PCR product (ca. 1000 bp) was gel purified and
quantified.
[0602] A vector for expression cloning, pASK3 (Institut fuer
Bioanalytik, Goettingen, Germany), was cut with Xba I and Bgl II
and dephosphorylated with CIP. 0.5 pmoles Vaccina Topoisomerase I
(Invitrogen, Carlsbad, Calif.) was added to 60 ng (ca. 0.1 pmole)
purified PCR product for 5' 37 C in buffer NEB I (New England
Biolabs, Beverly, Mass.) in 5 .mu.l total volume.
[0603] The topogated PCR product was cloned into the vector pASK3
(5 .mu.l, ca. 200 ng in NEB I) for 5' at room temperature.
[0604] This mixture was dialyzed against H.sub.2O for 30'.
[0605] 2 .mu.l were used for electroporation of DH10B cells (Gibco
BRL, Gaithersburg, Md.).
[0606] Efficiency: Based on the actual clone numbers this method
can produce 2.times.10.sup.6 clones per .mu.g vector. All tested
recombinants showed esterase activity after induction with
anhydrotetracycline.
EXAMPLE 7
Dehalogenase Thermal Stability
[0607] This invention provides that a desirable property to be
generated by directed evolution is exemplified in a limiting
fashion by an improved residual activity (e.g. an enzymatic
activity, an immunoreactivity, an antibiotic acivity, etc.) of a
molecule upon subjection to altered environment, including what may
be considered a harsh enviroment, for a specified time. Such a
harsh environment may comprise any combination of the following
(iteratively or not, and in any order or permutation): an elevated
temperature (including a temperature that may cause denaturation of
a working enzyme), a decreased temperature, an elevated salinity, a
decreased salinity, an elevated pH, a decreased pH, an elevated
pressure, a decreassed pressure, and an change in exposure to a
radiation source (including uv radiation, visible light, as well as
the entire electromagnetic spectrum).
[0608] The following example shows an application of directed
evolution to evolve the ability of an enzyme to regain &/or
retain activity upon exposure to an elevated temperature.
[0609] Every residue (316) of a dehalogenase enzyme was converted
into all 20 amino acids by site directed mutagenesis using 32-fold
degenerate oligonucleotide primers. These mutations were introduced
into the already rate-improved variant Dhla 20F12. Approximately
200 clones of each position were grown in liquid media (384 well
microtiter plates) to be screened. The screening procedure was as
follows:
[0610] 1. Overnight cultures in 384-well plates were centrifuged
and the media removed. To each well was added 0.06 mL 1 mM
Tris/SO.sub.4.sup.2- pH 7.8.
[0611] 2. The robot made 2 assay plates from each parent growth
plate consisting of 0.02 mL cell suspension.
[0612] 3. One assay plate was placed at room temperature and the
other at elevated temperature (initial screen used 55.degree. C.)
for a period of time (initially 30 minutes).
[0613] 4. After the prescribed time 0.08 mL room temperature
substrate (TCP saturated 1 mM Tris/SO.sub.4.sup.2- pH 7.8 with 1.5
mM NaN.sub.3 and 0.1 mM bromothymol blue) was added to each well.
TCP=trichloropropane.
[0614] 5. Measurements at 620 nm were taken at various time points
to generate a progress curve for each well.
[0615] 6. Data were analyzed and the kinetics of the cells heated
to those not heated were compared. Each plate contained 1-2 columns
(24 wells) of un-mutated 20F12 controls.
[0616] 7. Wells that appeared to have improved stability were
regrown and tested under the same conditions.
[0617] Following this procedure nine single site mutations appeared
to confer increased thermal stability on Dhla-20F12. Sequence
analysis showed that the following changes were beneficial:
[0618] D89G
[0619] F91S
[0620] T159L
[0621] G189Q, G189V
[0622] 1220L
[0623] N238T
[0624] W251Y
[0625] P302A, P302L, P302S, P302K
[0626] P302R/S306R
[0627] Only two sites (189 and 302) had more than one substitution.
The first 5 on the list were combined (using G189Q) into a single
gene (this mutant is referred to as "Dhla5"). All changes but S306R
were incorporated into another variant referred to as Dhla8.
[0628] Thermal stability was assessed by incubating the enzyme at
the elevated temperature (55.degree. C. and 80.degree. C.) for some
period of time and activity assay at 30.degree. C. Initial rates
were plotted vs. time at the higher temperature. The enzyme was in
50 mM Tris/SO.sub.4 pH 7.8 for both the incubation and the assay.
Product (Cl.sup.-) was detected by a standard method using
Fe(NO.sub.3).sub.3 and HgSCN. Dhla 20F12 was used as the defacto
wild type. The apparent half-life (T.sub.1/2) was calculated by
fitting the data to an exponential decay function.
[0629] According to another aspect of this invention, ligation
reassembly can be performed using a solid support. The following
example 8 (corresponding to FIG. 17) is illustrative but
non-limiting.
EXAMPLE 8
Solid Phase Gene Family Reassembly Protocol.
[0630] The objective can be, e.g., to reassemble/shuffle molecules
of DNA to generate gene libraries of specific genes, libraries of
gene families, and libraries of unrelated genes. The synthesis of
the full-length molecules is carried out on a solid support. As
solid support we use paramagnetic beads coated with Streptavidin.
The principle is based on the strong interaction between Biotin and
Streptavidin and the ability to stepwise or simulataneously ligate
DNA fragments generated from the annealing of nucleic acid building
blocks (such as ssDNA building blocks). The use of a solid support
facilitates the reassembly of nucleic acid building blocks in a
sequential manner and thus allows one to use not only unique
couplings, but also redundant or repeated couplings throughout the
length of a nucleic acid molecule that is to be generated by
ligation reassembly.
[0631] A "capture oligonucleotide" is biotinylated at the 5'end for
binding to the beads. The "capture oligo" is annealed to a
complementary sequence (no biotinylated). The double stranded
capture fragment contains two restriction sites at the 5'-end which
allows release of the assembled molecules from the solid
support.
[0632] Ligation reassembly is performed by step-wise ligation of
annealed oligonucleotides of 20-100 bases. The first fragment of
the assembly contains a 5'-end compatible with the 3'-end of the
capture biotinylated fragment. Consecutive ligation of double
stranded fragments containing complementary ends allows the
generation of full-length molecules. Half way synthesis (midpoint)
molecules are released from the solid support. A final ligation
step between molecules generated from both ends results in the
generation a full-length reassembled DNA.
[0633] Materials and Methods:
[0634] Streptavidin coated magnetic beads M280 (Dynal corp.)
[0635] Magnetic stand or magnetic particle concentrator (MPC
stand)
[0636] Biotinylated capture oligos containing a 7 or 15 atom-spacer
and two restriction sites not internally found in the sequences
being reassembled. Ensure that the biotinylated capture oligo does
not contain free biotin.
[0637] Design capture oligos to allow reassembly from both ends of
the sequences being reassembled.
[0638] Design internal oligos according to the sequence (s) being
reassembled
[0639] STE buffer
[0640] Washing/Binding buffer (1M NaCl, 10 mM Tris-HCl pH 7.5, 1 mM
EDTA) PBS, pH 7.4 buffer containing 0.1%BSA.
[0641] Annealing/ligation buffer
[0642] Spin columns for DNA purification
[0643] 1) Anneal equimolar amounts of complementary oligos by
heating at 90.degree. C. and slowly cooling down to room
temperature in STE buffer. Dilute annealed oligos to 5
pmole/ul.
[0644] 2) Aliquot 300-ug of 10 mg/ml bead suspension in a 500 ul
Eppendorf tube.
[0645] 3) Wash the beads with 300-ul of PBS buffer using a magnetic
stand. Repeat 3 times.
[0646] 4) Wash the beads with 300-ul of 1.times. Washing/Binding
buffer using a magnetic stand. Repeat once.
[0647] 5) Immobilize the pre-annealed biotinylated capture
fragments to the beads (55 pmole of 500-bp dsDNA binds to 1 mg of
beads). The binding capacity of the beads is fragment length
dependent. Mix beads and capture fragment in binding buffer.
Incubate at room temperature for 12 h in a 360 degree rotator
[0648] 6) Wash the beads with 300-ul of 60.degree. C. pre-heated
1.times. Washing/binding buffer using. Repeat 3 times.
[0649] 7) Wash the beads with 300-ul of freshly thawed 1.times.
ligation buffer.
[0650] 8) For a reassembly of "n" (5' to 3' and 3' to
5')fragments:
3 Mix: Fragment #1 (or "n") (5 pmole) 10 ul 5 .times. ligase buffer
60 ul 1U/ul T4 Ligase 15 ul dH.sub.2O 215 ul 300 ul
[0651] 9) Incubate with rotation at RT for 30 min.
[0652] 10) Wash the beads with 300-ul of 60.degree. C. pre-heated
1.times. Washing/Binding buffer. Repeat 3 times.
[0653] 11) Wash the beads with 300-ul of freshly thawed lx ligation
buffer.
4 Add: Fragment #2 (n-1) (5 pmole) 10 ul 5 .times. ligase buffer 60
ul 1U/ul T4 Ligase 15 ul dH.sub.2O 215 ul 300 ul
[0654] 13) Incubate with rotation at RT for 30 min.
[0655] 14) Wash the beads with 300-ul of 60.degree. C. pre-heated
1.times. Washing/binding buffer. Repeat 3 times.
[0656] 15) Wash the beads with 300-ul of freshly thawed lx ligation
buffer.
[0657] 16) Repeat the procedure until n/2 fragments have been added
from each end of the synthesis
[0658] 17) Elute the partially assembled products from the solid
support by cutting with the corresponding restriction enzyme
5 Beads with immobilized reassembled gene x ul 10 .times. enzyme
buffer 30 ul 1U/ul restriction enzyme 5 ul dH.sub.2O to 300 ul
[0659] 18) Replace restriction buffer of eluted DNA for ligation
buffer using a spin column. Elute from spin column with
H.sub.2O
[0660] 19) Ligate both partially assembled products to generate
reassembled full-length molecules
6 partial synthesis product (5' to 3') 60 ul partial synthesis
product (3' to 5') 60 ul 5x ligase buffer 20 ul 1U/ul T4 ligase 10
ul dH.sub.2O 50 ul 200 ul
[0661] 20) Clone full-length genes in corresponding vector.
[0662] 21) Sequence a few clones and screen for different kinetic
parameters of the expressed enzymes.
LITERATURE CITED
[0663] Unless otherwise indicated, all references cited herein
(supra and infra) are incorporated by reference in their
entirety.
[0664] Barret A J, et al., eds.: Enzyme Nomenclature:
Recommendations of the Nomenclature Committee of the International
Union of Biochemistry and Molecular Biology. San Diego: Academic
Press, Inc., 1992.
[0665] Boyce C O L, ed.: Novo's Handbook of Practical
Biotechnology. 2.sup.nd ed. Bagsvaerd, Denmark, 1986.
[0666] Drauz K, Waldman H, eds.: Enzyme Catalysis in Organic
Synthesis: A Comprehensive Handbook. Vol. 1. New York: VCH
Publishers, 1995.
[0667] Drauz K, Waldman H, eds.: Enzyme Catalysis in Organic
Synthesis: A Comprehensive Handbook. Vol. 2. New York: VCH
Publishers, 1995.
[0668] Foster G D, Taylor S C, eds.: Plant Virology Protocols: From
Virus Isolation to Transgenic Resistance. Methods in Molecular
Biology, Vol. 81. New Jersey: Humana Press Inc., 1998.
[0669] Franks F, ed.: Protein Biotechnology: Isolation,
Characterization, and Stabilization. New Jersey: Humana Press Inc.,
1993.
[0670] Godfrey T, West S, eds.: Industrial Enzymology. 2nd ed.
London: Macmillan Press Ltd, 1996.
[0671] Gottschalk G: Bacterial Metabolism. 2.sup.nd ed. New York:
Springer-Verlag Inc., 1986.
[0672] Gresshoff P M, ed.: Technology Transfer of Plant
Biotechnology. Current Topics in Plant Molecular Biology. Boca
Raton: CRC Press, 1997.
[0673] Griffin H G, Griffin A M, eds.: PCR Technology: Currrent
Innovations. Boca Raton: CRC Press, Inc., 1994.
[0674] Hansen G, Chilton M D: Lessons in gene transfer to plants by
a gifted microbe. Curr Top Microbiol Immunol 240:21-57, 1999.
[0675] Hartmann H T, et al.: Plant Propagation: Principles and
Practices. 6.sup.th ed. New Jersey: Prentice Hall, Inc., 1997.
[0676] Perun T J, Propst C L, eds.: Computer-Aided Drug Design:
Methods and Applications. New York: Marcel Dekker, Inc., 1989.
[0677] Owen M R L, Pen J: Transgenic Plants: A Production System
for Industrial and Pharmaceutical Proteins. Chichester: John Wiley
& Sons, 1996.
[0678] Segel I H: Enzyme Kinetics: Behavior and Analysis of Rapid
Equilibrium and Steady-State Enzyme Systems. New York: John Wiley
& Sons, Inc., 1993.
[0679] White J S, White D C: Source Book of Enzymes. Boca Raton:
CRC Press, 1997.
[0680] Wong C H, Whitesides G M: Enzymes in Synthetic Organic
Chemistry. Vol. 12. New York: Elsevier Science Publications,
1995.
[0681] WO 97/35966; Filed Mar. 20, 1997, Published Oct. 2, 1997.
Minshull J, Stemmer WP: Mehtods and Compositions for Cellular and
Metabolic Engineering.
[0682] WO 98/31837; Filed Jan. 16, 1998, Published Jul. 23, 1998.
Delcardayre S B, Tobin M B, Stemmer W P, Minshull, J: Evolution of
Whole Cells and Organisms by Recursive Sequence Recombination.
[0683] WO 98/37223; Filed Feb. 18, 1998, Published Aug. 27, 1998.
Pang S Z, Gonsalves D, Jan F J: DNA Construct to Confer Multiple
Traits on Plants.
[0684] Alting-Mecs M A and Short J M: Polycos vectors: a system for
packaging filamentous phage and phagemid vectors using lambda phage
packaging extracts. Gene 137:1, 93-100, 1993.
[0685] Arkin A P and Youvan D C: An algorithm for protein
engineering: simulations of recursive ensemble mutagenesis. Proc
Natl Acad Sci USA 89(16):7811-7815, (Aug 15) 1992.
[0686] Arnold F H: Protein engineering for unusual environments.
Current Opinion in Biotechnology 4(4):450-455, 1993.
[0687] Ausubel F M, et al Editors. Current Protocols in Molecular
Biology, Vols. 1 and 2 and supplements. (a.k.a. "The Red Book")
Greene Publishing Assoc., Brooklyn, N.Y., .COPYRGT.1987.
[0688] Ausubel F M, et al Editors. Current Protocols in Molecular
Biology, Vols. 1 and 2 and supplements. (a.k.a. "The Red Book")
Greene Publishing Assoc., Brooklyn, N.Y., .COPYRGT.1989.
[0689] Ausubel F M, et al Editors. Short Protocols in Molecular
Biology: A Compendium of Methods from Current Protocols in
Molecular Biology. Greene Publishing Assoc., Brooklyn, N.Y.,
.COPYRGT.1989.
[0690] Ausubel F M, et al Editors. Short Protocols in Molecular
Biology: A Compendium of Methods from Current Protocols in
Molecular Biology, 2.sup.nd Edition. Greene Publishing Assoc.,
Brooklyn, N.Y., .COPYRGT.1992.
[0691] Barbas C F 3d, Bain J D, Hoekstra D M, Lerner R A:
Semisynthetic combinatorial antibody libraries: a chemical solution
to the diversity problem. Proc Natl Acad Sci USA 89(10):4457-4461,
1992.
[0692] Bardwell A J, Bardwell L, Johnson D K, Friedberg E C: Yeast
DNA recombination and repair proteins Rad1 and Rad10 constitute a
complex in vivo mediated by localized hydrophobic domains. Mol
Microbiol 8(6): 1177-1188, 1993.
[0693] Bartel P, Chien C T, Sternglanz R, Fields S: Elimination of
false positives that arise in using the two-hybrid system.
Biotechniques 14(6):920-924, 1993.
[0694] Beaudry A A and Joyce G F: Directed evolution of an RNA
enzyme. Science 257(5070):635-641, 1992.
[0695] Berger and Kimmel, Methods in Enzymology, Volume 152, Guide
to Molecular Cloning Techniques. Academic Press, Inc., San Diego,
Calif., .COPYRGT.1987. (Cumulative Subject Index: Volumes 135-139,
141-167, 1990, 272 pp.)
[0696] Bevan M: Binary Agrobacterium vectors for plant
transformation. Nucleic Acids Research 12(22):8711-21, 1984.
[0697] Biocca S, Pierandrei-Amaldi P, Cattaneo A: Intracellular
expression of anti-p21ras single chain Fv fragments inhibits
meiotic maturation of xenopus oocytes. Biochem Biophys Res Commun
197(2):422-427, 1993.
[0698] Bird et al. Plant Mol Biol 11:651, 1988..
[0699] Bogerd H P, Fridell R A, Blair W S, Cullen B R: Genetic
evidence that the Tat proteins of human immunodeficiency virus
types 1 and 2 can multimerize in the eukaryotic cell nucleus. J
Virol 67(8):5030-5034, 1993.
[0700] Brederode F T, Koper-Zawrthoff E C, Bol J F: Complete
nucleotide sequence of alfalfa mosaic virus RNA 4. Nucleic Acids
Research 8(10):2213-23, 1980.
[0701] Breitling F, Dubel S, Seehaus T, Klewinghaus I, Little M: A
surface expression vector for antibody screening. Gene
104(2):147-153, 1991.
[0702] Brown N L, Smith M: Cleavage specificity of the restriction
endonuclease isolated from Haemophilus gallinarum (Hga I). Proc
Natl Acad Sci USA 74(8):3213-6, (Aug) 1977.
[0703] Burton D R, Barbas C F 3d, Persson M A, Koenig S, Chanock R
M, Lerner R A: A large array of human monoclonal antibodies to type
1 human immunodeficiency virus from combinatorial libraries of
asymptomatic seropositive individuals. Proc Natl Acad Sci USA
88(22):10134-7, (November 15) 1991.
[0704] Caldwell R C and Joyce G F: Randomization of genes by PCR
mutagenesis. PCR Methods Appl 2(10):28-33, 1992.
[0705] Caton A J and Koprowski H: Influenze virus
hemagglutinin-specific antibodies isolatedf from a combinatorial
expression library are closely related to the immune response of
the donor. Proc Natl Acad Sci USA 87(16):6450-6454, 1990.
[0706] Chakraborty T, Martin J F, Olson E N: Analysis of the
oligomerization of myogenin and E2A products in vivo using a
two-hybrid assay system. J Biol Chem 267(25): 17498-501, 1992.
[0707] Chang C N, Landolfi N F, Queen C: Expression of antibody Fab
domains on bacteriophage surfaces. Potential use for antibody
selection. J Immunol 147(10):3610-4, (Nov 15) 1991.
[0708] Chaudhary V K, Batra J K, Gallo M G, Willingham M C,
FitzGerald D J, Pastan I: A rapid method of cloning functional
variable-region antibody genes in Escherichia coli as single-chain
immunotoxins. Proc Natl Acad Sci USA 87(3): 1066-1070, 1990.
[0709] Chien C T, Bartel P L, Sternglanz R, Fields S: The
two-hybrid system: a method to identify and clone genes for
proteins that interact with a protein of interest. Proc Natl Acad
Sci USA 88(21):9578-9582, 1991.
[0710] Chiswell D J, McCafferty J: Phage antibodies: will new
`coliclonal` antibodies replace monoclonal antibodies? Trends
Biotechnol 10(3):80-84, 1992.
[0711] Chothia C and Lesk A M: Canonical structures for the
hypervariable regions of immunoglobulins. J Mol Biol
196)4):901-917, 1987.
[0712] Chothia C, Lesk AM, Tramontano A, Levitt M, Smith-Gill S J,
Air G, Sheriff S, Padlan E A, Davies D, Tulip W R, et al:
Conformations of immunoglobulin hypervariable regions. Nature
342(6252):877-883, 1989.
[0713] Clackson T, Hoogenboom H R, Griffiths A D, Winter G: Making
antibody fragments using phage display libraries. Nature
352(6336):624-628, 1991.
[0714] Conrad M, Topal M D: DNA and spermidine provide a switch
mechanism to regulate the activity of restriction enzyme Nae I.
Proc Natl Acad Sci USA 86(24):9707-11, (December) 1989.
[0715] Coruzzi G, Broglie R, Edwards C, Chua N H: Tissue-specific
and light-regulated expression of a pea nuclear gene encoding the
small subunit of ribulose-1,5-bisphosphate carboxylase. EMBO J
3(8): 1671-9, 1984.
[0716] Dasmahapatra B, DiDomenico B, Dwyer S, Ma J, Sadowski I,
Schwartz J: A genetic system for studying the activity of a
proteolytic enzyme. Proc Natl Acad Sci USA 89(9):4159-4162,
1992.
[0717] Davis L G, Dibner M D, Battey J F. Basic Methods in
Molecular Biology. Elsevier, New York, N.Y., .COPYRGT.1986.
[0718] Delegrave S and Youvan D C. Biotechnology Research 11:
1548-1552, 1993.
[0719] DeLong E F, Wu K Y, Prezelin B B, Jovine R V: High abundance
of Archaea in Antarctic marine picoplankton. Nature
371(6499):695-697, 1994.
[0720] Deng S J, MacKenzie C R, Sadowska J, Michniewicz J, Young N
M, Bundle Dr, Narang S A: Selection of antibody single-chain
variable fragments with improved carbohydrate binding by phage
display. J Biol Chem 269(13):9533-9538, 1994.
[0721] Duan L, Bagasra O, Laughlin M A, Oakes J W, Pomerantz R J:
Potent inhibition of human immunodeficiency virus type 1
replication by an intracellular anti-Rev single-chain antibody.
Proc Natl Acad Sci USA 91(11):5075-5079, 1994.
[0722] Durfee T, Becherer K, Chen P L, Yeb S H, Yang Y, Kilburn A
E, Lee W H, Elledge S J: The retinoblastoma protein associates with
the protein phosphatase type I catalytic subunit. Genes Dev
7(4):555-569, 1993.
[0723] Ellington A D and Szostak J W: In vitro selection of RNA
molecules that bind specific ligands. Nature 346(6287):818-822,
1990.
[0724] Fields S and Song O: A novel genetic system to detect
protein-protein interactions. Nature 340(6230):245-246, 1989.
[0725] Firek S, Draper J, Owen M R, Gandecha A, Cockburn B,
Whitelam G C: Secretion of a functional single-chain Fv protein in
transgenic tobacco plants and cell suspension cultures. Plant Mol
Biol 23(4):861-870, 1993.
[0726] Forsblom S, Rigler R, Ehrenberg M, Philipson L: Kinetic
studies on the cleavage of adenovirus DNA by restriction
endonuclease Eco RI. Nucleic Acids Res 3(12):3255-69, (Dec)
1976.
[0727] Germino F J, Wang Z X, Weissman S M: Screening for in vivo
protein-protein interactions. Proc Natl Acad Sci USA 90(3):933-937,
1993.
[0728] Gingeras T R, Brooks J E: Cloned restriction/modification
system from Pseudomonas aeruginosa. Proc Natl Acad Sci USA
80(2):402-6, 1983 (Jan).
[0729] Gluzman Y: SV40-transformed simian cells support the
replication of early SV40 mutants. Cell 23(1):175-182, 1981.
[0730] Gruber M, Schodin B A, Wilson E R, Kranz D M: Efficient
tumor cell lysis mediated by a bispecific single chain antibody
expressed in Escherichia coli. J Immunol 152(11):5368-5374,
1994.
[0731] Guarente L: Strategies for the identification of interacting
proteins. Proc Natl Acad Sci USA 90(5):1639-1641, 1993.
[0732] Guilley H, Dudley R K, Jonard G, Balazs E, Richards K E:
Transcription of Cauliflower mosaic virus DNA: detection of
promoter sequences, and characterization of transcripts. Cell
30(3):763-73, 1982.
[0733] Hardy C F, Sussel L, Shore D: A RAP 1-interacting protein
involved in transcriptional silencing and telomere length
regulation. Genes Dev 6(5):801-814, 1992.
[0734] Hawkins R E and Winter G: Cell selection strategies for
making antibodies from variable gene libraries: trapping the memory
pool. Eur J Immunol 22(3):867-870, 1992.
[0735] Holvoet P, Laroche Y, Lijnen H R, Van Hoef B, Brouwers E, De
Cock F, Lauwereys M, Gansemans Y, Collen D: Biochemical
characterization of single-chain chimeric plasminogen activators
consisting of a single-chain Fv fragment of a fibrin-specific
antibody and single-chain urokinase. Eur J Biochem 210(3):945-952,
1992.
[0736] Honjo T, Alt F W, Rabbitts T H (eds): Immunoglobulin genes.
Academic Press: San Diego, Calif., pp. 361-368, 01989.
[0737] Hoogenboom H R, Griffiths A D, Johnson K S, Chiswell D J,
Judson P, Winter G: Multi-subunit proteins on the surface of
filamentous phage: methodologies for displaying antibody (Fab)
heavy and light chains. Nucleic Acids Res 19(15):4133-4137,
1991.
[0738] Huse W D, Sastry L, Iverson S A, Kang A S, Alting-Mees M,
Burton D R, Benkovic S J, Lerner R A: Generation of a large
combinatorial library of the immunoglobulin repertoire in phage
lambda. Science 246(4935):1275-1281, 1989.
[0739] Huston J S, Levinson D, Mudgett-Hunter M, Tai M S, Novotney
J, Margolies M N, Ridge R J, Bruccoleri R E, Haber E, Crea R, et
al: Protein engineering of antibody binding sites: recovery of
specific activity in an anti-digoxin single-chain Fv analogue
produced in Escherichia coli. Proc Natl Acad Sci USA
85(16):5879-5883, 1988.
[0740] Iwabuchi K, Li B, Bartel P, Fields S: Use of the two-hybrid
system to identify the domain of p53 involved in oligomerization.
Oncogene 8(6):1693-1696, 1993.
[0741] Jackson A L, Pahl P M, Harrison K, Rosamond J, Sclafani R A:
Cell cycle regulation of the yeast Cdc7 protein kinase by
association with the Dbf4 protein. Mol Cell Biol 13(5):2899-2908,
1993.
[0742] Johnson S and Bird R E: Methods Enzymol 203:88, 1991.
[0743] Kabat et al: Sequences of Proteins of Immunological
Interest, 4th Ed. U.S. Department of Health and Human Services,
Bethesda, Md. (1987)
[0744] Kang A S, Barbas C F, Janda K D, Benkovic S J, Lerner R A:
Linkage of recognition and replication functions by assembling
combinatorial antibody Fab libraries along phage surfaces. Proc
Natl Acad Sci USA 88(10):4363-4366, 1991.
[0745] Kettleborough C A, Ansell K H, Allen R W, Rosell-Vives E,
Gussow D H, Bendig M M: Isolation of tumor cell-specific
single-chain Fv from immunized mice using phage-antibody libraries
and the re-construction of whole antibodies from these antibody
fragments. Eur J Immunol 24(4):952-958, 1994.
[0746] Kruger D H, Barcak G J, Reuter M, Smith H O: EcoRII can be
activated to cleave refractory DNA recognition sites. Nucleic Acids
Res 16(9):3997-4008, (May 11) 1988.
[0747] Lalo D, Carles C, Sentenac A, Thuriaux P: Interactions
between three common subunits of yeast RNA polymerases I and III.
Proc Natl Acad Sci USA 90(12):5524-5528, 1993.
[0748] Laskowski M Sr: Purification and properties of venom
phosphodiesterase. Methods Enzymol 65(1):276-84, 1980.
[0749] Lefkovits I and Pernis B, Editors. Immunological Methods,
Vols. I and II. Academic Press, New York, N.Y. Also Vol. III
published in Orlando and Vol. IV published in San Diego.
.COPYRGT.1979.
[0750] Ivan Lefkovits, Editor. Immunology methods manual: the
comprehensive sourcebook of techniques. Academic Press, San Diego,
.COPYRGT.1997.
[0751] Lerner R A, Kang A S, Bain J D, Burton D R, Barbas C F 3d:
Antibodies without immunization. Science 258(5086):1313-1314,
1992.
[0752] Leung, D. W., et al, Technique, 1:11-15, 1989.
[0753] Li B and Fields S: Identification of mutations in p53 that
affect its binding to SV40 large T antigen by using the yeast
two-hybrid system. FASEB J 7(10):957-963, 1993.
[0754] Lilley G G, Doelzal O, Hillyard C J, Bernard C, Hudson P J:
Recombinant single-chain antibody peptide conjugates expressed in
Escherichia coli for the rapid diagnosis of HIV. J Immunol Methods
171(2):211-226, 1994.
[0755] Lowman H B, Bass S H, Simpson N, Wells J A: Selecting
high-affinity binding proteins by monovalent phage display.
Biochemistry 30(45): 10832-10838, 1991.
[0756] Luban J, Bossolt K L, Franke E K, Kalpana G V, Goff S P:
Human immunodeficiency virus type 1 Gag protein binds to
cyclophilins A and B. Cell 73(6):1067-1078, 1993.
[0757] Madura K, Dohmen R J, Varshavsky A: N-recognin/Ubc2
interactions in the N-end rule pathway. J Biol Chem 268(16):
12046-54, (June 5) 1993.
[0758] Marks J D, Hoogenboom H R, Bonnert T P, McCafferty J,
Griffiths AD, Winter G: By-passing immunization. Human antibodies
from V-gene libraries displayed on phage. J Mol Biol
222(3):581-597, 1991.
[0759] Marks J D, Griffiths Ad, Malmqvist M, Clackson T P, Bye J M,
Winter G: By-passing immunization: building high affinity human
antibodies by chain shuffling. Biotechnology (N Y) 10(7):779-783,
1992.
[0760] Marks J D, Hoogenboom H R, Griffiths A D, Winter G:
Molecular evolution of proteins on filamentous phage. Mimicking the
strategy of the immune system. J Biol Chem 267(23):16007-16010,
1992.
[0761] Maxam A M, Gilbert W: Sequencing end-labeled DNA with
base-specific chemical cleavages. Methods Enzymol 65(1):499-560,
1980.
[0762] McCafferty J, Griffiths A D, Winter G, Chiswell D J: Phage
antibodies: filamentous phage displaying antibody variable domains.
Nature 348(6301):552-554, 1990.
[0763] Miller J H. A Short Course in Bacterial Genetics: A
Laboratory Manual and Handbook for Escherichia coli and Related
Bacteria (see inclusively p. 445). Cold Spring Harbor Laboratory
Press, Plainview, N.Y., .COPYRGT. 1992.
[0764] Milne G T and Weaver D T: Dominant negative alleles of RAD52
reveal a DNA repair/recombination complex including Rad51 and
Rad52. Genes Dev 7(9):1755-1765, 1993.
[0765] Mullinax R L, Gross E A, Amberg J R, Hay B N, Hogrefe H H,
Kubtiz M M, Greener A, Alting-Mees M, Ardourel D, Short J M, et al:
Identification of human antibody fragment clones specific for
tetanus toxoid in a bacteriophage lambda immunoexpression library.
Proc natl Acad Sci USA 87(20):8095-9099, 1990.
[0766] Nath K, Azzolina BA: in Gene Amplification and Analysis (ed.
Chirikjian J G), vol. 1, p. 113, Elsevier North Holland, Inc., New
York, N.Y., .COPYRGT.1981.
[0767] Needleman S B and Wunsch C D: A general method applicable to
the search for similarities in the amino acid sequence of two
proteins. J Mol Biol 48(3):443-453, 1970.
[0768] Nelson M, Christ C, Schildkraut I: Alteration of apparent
restriction endonuclease recognition specificities by DNA
methylases. Nucleic Acids Res 12(13):5165-73, 1984 (July 11).
[0769] Nicholls P J, Johnson V G, Andrew S M, Hoogenboom H R, Raus
J C, Youle R J: Characterization of single-chain antibody
(sFv)-toxin fusion proteins produced in vitro in rabbit
reticulocyte lysate. J Biol Chem 268(7):5302-5308, 1993.
[0770] Oller A R, Vanden Broek W, Conrad M, Topal MD: Ability of
DNA and spermidine to affect the activity of restriction
endonucleases from several bacterial species. Biochemistry
30(9):2543-9, (March 5) 1991.
[0771] Owens R J and Young R J: The genetic engineering of
monoclonal antibodies. J Immunol Methods 168(2):149-165, 1994.
[0772] Pearson W R and Lipman D J: Improved tools for biological
sequence comparison. Proc Natl Acad Sci USA 85(8):2444-2448,
1988.
[0773] Pein C D, Reuter M, Meisel A, Cech D, Kruger D H: Activation
of restriction endonuclease EcoRII does not depend on the cleavage
of stimulator DNA. Nucleic Acids Re s 19(19):5139-42, (Oct 11)
1991.
[0774] Persson M A, Caothien R H, Burton D R: Generation of diverse
high-affinity human monoclonal antibodies by repertoire cloning.
Proc Natl Acad Sci USA 88(6):2432-2436, 1991.
[0775] Queen C, Foster J, Stauber C, Stafford J: Cell-type specific
regulation of a kappa immunoglobulin gene by promoter and enhance
elements. Immunol Rev 89:49-68, 1986.
[0776] Qiang B Q, McClelland M, Poddar S, Spokauskas A, Nelson M:
The apparent specificity of NotI (5'-GCGGCCGC-3') is enhanced by
M.FnuDII or M.BepI methyltransferases (5'-mCGCG-3'): cutting
bacterial chromosomes into a few large pieces. Gene 88(1):101-5,
(March 30) 1990.
[0777] Raleigh E A, Wilson G: Escherichia coli K-12 restricts DNA
containing 5-methylcytosine. Proc Natl Acad Sci USA 83(23):9070-4,
(December) 1986.
[0778] Reidhaar-Olson J F and Sauer R T: Combinatorial cassette
mutagenesis as a probe of the informational content of protein
sequences. Science 241(4861):53-57, 1988.
[0779] Riechmann L and Weill M: Phage display and selection of a
site-directed randomized single-chain antibody Fv fragment for its
affinity improvement. Biochemistry 32(34):8848-8855, 1993.
[0780] Roberts R J, Macelis D: REBASE--restriction enzymes and
methylases. Nucleic Acids Res 24(1):223-35, (January 1) 1996.
[0781] Ryan A J, Royal C L, Hutchinson J, Shaw C H: Genomic
sequence of a 12S seed storage protein from oilseed rape (Brassica
napus c.v. jet neuf). Nucl Acids Res 17(9):3584, 1989.
[0782] Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., .COPYRGT.1982.
[0783] Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A
Laboratory Manual. Second Edition. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., .COPYRGT.1989.
[0784] Scopes R K. Protein Purification: Principles and Practice.
Springer-Verlag, New York, N.Y., .COPYRGT. 1982.
[0785] Silver S C and Hunt S W 3d: Techniques for cloning cDNAs
encoding interactive transcriptional regulatory proteins. Mol Biol
Rep 17(3):155-165, 1993.
[0786] Smith T F, Waterman M S. Adv Appl Math 2: 482-end of
article, 1981.
[0787] Smith T F, Waterman M S: Overlapping genes and information
theory. J Theor Biol 91(2):379-80, (Jul 21) 1981.
[0788] Smith T F, Waterman M S: Identification of common molecular
subsequences. J Mol Biol 147(1):195-7, (March 25) 1981.
[0789] Smith T F, Waterman M S, Fitch W M: Comparative biosequence
metrics. J Mol Evol S18(1):38-46, 1981.
[0790] Staudinger J, Perry M, Elledge S J, Olson E N: Interactions
among vertebrate helix-loop-helix proteins in yeast using the
two-hybrid system. J Biol Chem 268(7):4608-4611, 1993.
[0791] Stemmer W P, Morris S K, Wilson B S: Selection of an active
single chain Fv antibody from a protein linker library prepared by
enzymatic inverse PCR. Biotechniques 14(2):256-265, 1993.
[0792] Stemmer W P: DNA shuffling by random fragmentation and
reassembly: in vitro recombination for molecular evolution. Proc
Natl Acad Sci USA 91(22):10747-10751, 1994.
[0793] Sun D, Hurley L H: Effect of the (+)-CC-1065-(N3-adenine)
DNA adduct on in vitro DNA synthesis mediated by Escherichia coli
DNA polymerase. Biochemistry 31:10, 2822-9, (March 17) 1992, Tague
B W, Dickinson C D, Chrispeels M J: A short domain of the plant
vacuolar protein phytohemagglutinin targets invertase to the yeast
vacuole. Plant Cell 2(6):533-46, (June) 1990.
[0794] Takahashi N, Kobayashi I: Evidence for the double-strand
break repair model of bacteriophage lambda recombination. Proc Natl
Acad Sci USA 87(7):2790-4, (April) 1990.
[0795] Thiesen H J and Bach C: Target Detection Assay (TDA): a
versatile procedure to determine DNA binding sites as demonstrated
on SP1 protein. Nucleic Acids Res 18(11):3203-3209, 1990.
[0796] Thomas M, Davis R W: Studies on the cleavage of
bacteriophage lambda DNA with EcoRI Restriction endonuclease. J Mol
Biol 91(3):315-28, (January 25)1975.
[0797] Tingey S V, Walker E L, Corruzzi G M: Glutamine synthetase
genes of pea encode distinct polypeptides which are differentially
expressed in leaves, roots and nodules. EMBO J 6(1):1-9, 1987.
[0798] Topal M D, Thresher R J, Conrad M, Griffith J: Nael
endonuclease binding to pBR322 DNA induces looping. Biochemistry
30(7):2006-10, (Feb. 19) 1991.
[0799] Tramontano A, Chothia C, Lesk A M: Framework residue 71 is a
major determinant of the position and conformation of the second
hypervariable region in the VH domains of immunoglobulins. J Mol
Biol 215(1):175-182, 1990.
[0800] Tuerk C and Gold L: Systematic evolution of ligands by
exponential enrichment: RNA ligands to bacteriophage T4 DNA
polymerase. Science 249(4968):505-510, 1990.
[0801] van de Poll M L, Lafleur M V, van Gog F, Vrieling H, Meerman
J H: N-acetylated and deacetylated 4'-fluoro-4-aminobiphenyl and
4-aminobiphenyl adducts differ in their ability to inhibit DNA
replication of single-stranded M13 in vitro and of single-stranded
phi X174 in Escherichia coli. Carcinogenesis 13(5):751-8, (May)
1992.
[0802] Vojtek A B, Hollenberg S M, Cooper J A: Mammalian Ras
interacts directly with the serine/threonine kinase Raf. Cell
74(1):205-214, 1993.
[0803] Wenzler H, Mignery G, Fisher L, Park W: Sucrose-regulated
expression of a chimeric potato tuber gene in leaves of transgenic
tobacco plants. Plant Mol Biol 13(4):347-54, 1989.
[0804] Williams and Barclay, in Immunoglobulin Genes, The
Immunoglobulin Gene Superfamily
[0805] Winnacker E L. From Genes to Clones: Introduction to Gene
Technology. VCH Publishers, New York, N.Y., .COPYRGT.1987.
[0806] Winter G and Milstein C: Man-made antibodies. Nature
349(6307):293-299, 1991.
[0807] Yang X, Hubbard E J, Carlson M: A protein kinase substrate
identified by the two-hybrid system. Science 257(5070):680-2, (Jul
31) 1992.
[0808] U.S. Pat. No. 4,683,195; Filed Feb. 7, 1986, Issued Jul 28,
1987. Mullis K B, Erlich H A, Arnheim N, Horn G T, Saiki R K,
Scharf S J: Process for Amplifying, Detecting, and/or Cloning
Nucleic Acid Sequences.
[0809] U.S. Pat. No. 4,683,202; Filed Oct. 25, 1985, Issued Jul.
28, 1987. Mullis K B: Process for Amplifying Nucleic Acid
Sequences.
[0810] U.S. Pat. No. 4,704,362; Filed Nov. 5, 1979, Issued Nov. 3,
1987. Itakura K, Riggs A D: Recombinant Cloning Vehicle Microbial
Polypeptide Expression.
[0811] WO 88/08453; Filed Apr. 14, 1988, Published Nov. 3, 1988.
Alakhov J B, Baranov, V I, Ovodov S J, Ryabova L A, Spirin A S:
Method of Obtaining Polypeptides in Cell-Free Translation
System.
[0812] WO 90/05785; Filed Nov. 15, 1989, Published May 31, 1990.
Schultz P: Method for Site-Specifically Incorporating Unnatural
Amino Acids into Proteins.
[0813] WO 90/07003; Filed Jan. 27, 1989, Published Jun. 28, 1990.
Baranov V I, Morozov U, Spirin A S: Method for Preparative
Expression of Genes in a Cell-free System of Conjugated
Transcription/translation.
[0814] WO 91/02076; Filed Jun. 14, 1990, Published Feb. 21, 1991.
Baranov V I, Ryabova L A, Yarchuk O B, Spirin A S: Method for
Obtaining Polypeptides in a Cell-free System.
[0815] WO 91/05058; Filed Oct. 5, 1989, Published Apr. 18, 1991.
Kawasaki G: Cell-free Synthesis and Isolation of Novel Genes and
Polypeptides.
[0816] WO 91/17271; Filed May 1, 1990, Published Nov. 14, 1991.
Dower W J, Cwirla S E: Recombinant Library Screening Methods.
[0817] WO 91/18980; Filed May 13, 1991, Published Dec. 12, 1991.
Devlin J J: Compositions and Methods for Indentifying Biologically
Active Molecules.
[0818] WO 91/19818; Filed Jun. 20, 1990, Published Dec. 26, 1991.
Dower W J, Cwirla S E, Barrett R W: Peptide Library and Screening
Systems.
[0819] WO 92/02536; Filed Aug. 1, 1991, Published Feb. 20, 1992.
Gold L, Tuerk C: Systematic Polypeptide Evolution by Reverse
Translation.
[0820] WO 92/03918; Filed Aug. 28, 1991, Published Mar. 19, 1992.
Lonberg N, Kay R M: Transgenic Non-human Animals Capable of
Producing Heterologous Antibodies.
[0821] WO 92/03918; Filed Aug. 28, 1991, Published Mar. 19, 1992.
Lonberg N, Kay R M: Transgenic Non-human Animals Capable of
Producing Heterologous Antibodies.
[0822] WO 92/05258; Filed Sep. 17, 1991, Published Apr. 2, 1992.
Fincher G B: Gene Encoding Barley Enzyme.
[0823] WO 92/14843; Filed Feb. 21, 1992, Published Sep. 3, 1992.
Toole J J, Griffin L C, Bock L C, Latham J A, Muenchau D D,
Krawczyk S: Aptamers Specific for Biomolecules and Method of
Making.
[0824] WO 93/08278; Filed Oct. 15, 1992, Published Apr. 29, 1993.
Schatz P J, Cull M G, Miller J F, Stemmer W P: Peptide Library and
Screening Method.
[0825] WO 93/12227; Filed Dec. 17, 1992, Published Jun. 24, 1993.
Lonberg, N; Kay R M: Transgenic Non-human Animals Capable of
Producing Heterologous Antibodies. WO 93/12227; Filed Dec. 17,
1992, Published Jun. 24, 1993. Lonberg N, Kay R M: Transgenic
Non-human Animals Capable of Producing Heterologous Antibodies.
[0826] WO 94/25585; Filed Apr. 25, 1994, Published Nov. 10, 1994.
Lonberg, N, Kay R M: Transgenic Non-human Animals Capable of
Producing Heterologous Antibodies.
[0827] WO 94/25585; Filed Apr. 25, 1994, Published Nov. 10, 1994.
Lonberg N, Kay R M: Transgenic Non-human Animals Capable of
Producing Heterologous Antibodies.
[0828] Arslan T, Abraham A T, Hecht S M: Structurally altered
substrates for DNA topoisomerase I. Effects of inclusion of a
single 3'-deoxynucleotide within the scissile strand. Nucleosides
Nucleotides 1998 January-March; 17(1-3):515-30.
[0829] Aupeix K, Toulme J J: Binding of chemically-modified
oligonucleotides to the double-stranded stem of an RNA hairpin.
Nucleosides Nucleotides 1999 June-July;18(6-7): 1647-50.
[0830] Bazzanini R, Manfredini S, Durini E, Groschel B, Cinatl J,
Balzarini J, De Clercq E, Imbach J L, Perigaud C, Gosselin G:
Prodrugs of Ara-CMP and Ara-AMP with a S-acyl-2-thioethyl (SATE)
biolabile phosphate protecting group: synthesis and biological
evaluation. Nucleosides Nucleotides 1999
April-May;18(4-5):971-2.
[0831] Blackburn G M, Liu X, Rosler A, Brenner C: Two hydrolase
resistant analogues of diadenosine 5',5"'-P1,P3-triphosphate for
studies with Fhit, the human fragile histidine triad protein.
Nucleosides Nucleotides 1998 January-March;17(1-3):301-8.
[0832] Bridson P K, Lin X, Melman N, Ji X D, Jacobson K A:
Synthesis and adenosine receptor affinity of
7-beta-D-ribofuranosylxanthine. Nucleosides Nucleotides 1998 April;
17(4):759-68.
[0833] Brodin P, Gottikh M, Auclair C, Mouscadet J F: Inhibition of
HIV- I integration by mono- & bi-functionalized triple helix
forming oligonucleotides. Nucleosides Nucleotides 1999
June-July;18(6-7):1717-8.
[0834] Creighton T E: Proteins Structures and Molecular Principles.
New York: W. H. Freeman and Co., 1984.
[0835] De Clercq E: Carbocyclic adenosine analogues as
S-adenosylhomocysteine hydrolase inhibitors and antiviral agents:
recent advances. Nucleosides Nucleotides 1998
January-March;17(1-3):625-34.
[0836] de Zwart M, Link R, von Frijtag Drabbe Kunzel J K, Cristalli
G. Jacobson K A, Townsend-Nicholson A, IJzerman A P: A functional
screening of adenosine analogues at the adenosine A2B receptor: a
search for potent agonists. Nucleosides Nucleotides 1998
June;17(6):969-85.
[0837] Egron D, Arzumanov A A, Dyatkina N B, Krayevsky A, Imbach J
L, Aubertin A M, Gosselin G, Perigaud C: Synthesis, anti-HIV
activity and stability studies of 3'-azido-2',3'-dideoxythymidine
5'-fluorophosphate. Nucleosides Nucleotides 1999 April-May;
18(4-5):983-4
[0838] Gianolio D A, McLaughlin L W: Synthesis and triplex forming
properties of pyrimidine derivative containing extended
functionality. Nucleosides Nucleotides 1999 August;
18(8):1751-69.
[0839] Gottikh M B, Volkov E M, Romanova E A, Oretskaya T S,
Shabarova Z A: Synthesis of oligonucleotide-intercalator conjugates
capable to inhibit HIV-I DNA integration. Nucleosides Nucleotides
1999 June-July;18(6-7):1645-6.
[0840] Hotoda H, Koizumi M, Ohmine T, Furukawa H, Nishigaki T, Abe
K, Kosaka T, Tsutsumi S, Sone J, Kaneko M: Biologically active
oligodeoxyribonucleotides. 10: anti-HIV-1 activity and stability of
modified hexanucleotides containing glycerol-skeleton. Nucleosides
Nucleotides 1998 January-March;17(1-3):243-52.
[0841] JP10113194; Filed 19971022, Published 19980506. Donnelly, J
J; Dwarki, V J; Liu, M A; Montgomery, D L; Parker, S; Shiver, J W;
Ulmer J B: Nucleic Acid Preparation.
[0842] Kang S H, Sinhababu A K, Cho M J: Synthesis and biological
activity of bis(pivaloyloxymethyl) ester of
2'-azido-2'-deoxyuridine 5'-monophosphate. Nucleosides Nucleotides
1998 June;17(6): 1089-98.
[0843] Krayevsky A, Arzumanov A, Shirokova E, Dyatkina N, Victorova
L, Jasko M, Alexandrova L: dNTP modified at triphosphate residues:
substrate properties towards DNA polymerases and stability in human
serum. Nucleosides Nucleotides 1998 January-March;
17(1-3):681-93.
[0844] Krayevsky A A, Dyatkina N B, Semizarov D G, Victorova L S,
Shirokova E A, Theil F, Von Janta Lipinski M J, Gosselin G. Imbach
J L: Reasons and limits of substrate activity of modified L-dNTP in
DNA biosynthesis. Nucleosides Nucleotides 1999
April-May;18(4-5):863-4.
[0845] Kvasyuk E I, Mikhailopulo IA, Suhadolnik R J, Henderson E E,
Muto N F, Iacono K T, Homon J, Pfleiderer W: Synthesis and
biological activity of 2',5'-oligoadenylate trimers containing
5'-terminal 5'-amino-5'-deoxy- and 5'-amino-3',5'-dideoxyadenosine
derivatives. Nucleosides Nucleotides 1999
June-July;18(6-7):1483-4.
[0846] Liu J, Skradis A, Kolar C, Kolath J, Anderson J, Lawson T,
Talmadge J, Gmeiner W H: Increased cytotoxicity and decreased in
vivo toxicity of FdUMP[10] relative to 5-FU. Nucleosides
Nucleotides 1999 August;18(8):1789-802.
[0847] Lutz M J, Will D W, Breipohl G, Benner S A, Uhlmann E:
Synthesis of a monocharged peptide nucleic acid (PNA) analog and
its recognition as substrate by DNA polymerases. Nucleosides
Nucleotides 1999 March; 18(3):393-401.
[0848] Monaco V, van de Wetering K I, Meeuwenoord N J, van den Elst
H A, Stuivenberg H R, Visse R, van der Kaaden J C, Moolenaar G F,
Verhoeven E E, Goosen N, van der Marel G A, van Boom J H: Synthesis
and biological evaluation of modified DNA fragments for the study
of nucleotide excision repair in E. coli. Nucleosides Nucleotides
1999 June-July;18(6-7): 1339-41.
[0849] Morozova O V, Kolpashchikov D M, Ivanova T M, Godovikova T
S: Synthesis of new photocross-linking 5-C-base-substituted UTP
analogs and their application in highly selective affinity
labelling of the tick-borne encephalitis virus RNA replicase
proteins. Nucleosides Nucleotides 1999
June-July;18(6-7):1513-4.
[0850] Nguyen-Ba N, Chan L, Quimpere M, Turcotte N, Lee N, Mitchell
H, Bedard J: Design and SAR study of a novel class of nucleotide
analogues as potent anti-HCMV agents. Nucleosides Nucleotides 1999
Apr-May; 18(4-5):821-7.
[0851] Pandolfi D, Rauzi F, Capobianco M L: Evaluation of different
types of end-capping modifications on the stability of
oligonucleotides toward 3'--and 5'-exonucleases. Nucleosides
Nucleotides 1999 September; 18(9):2051-69.
[0852] Pankiewicz K W, Lesiak-Watanabe K: Novel mycophenolic
adenine bis(phosphonate)s as potent anticancer agents and inducers
of cells differentiation. Nucleosides Nucleotides 1999 April-May;
18(4-5):927-32.
[0853] Perrin D M, Garestier T, Helene C: Expanding the catalytic
repertoire of nucleic acid catalysts: simultaneous incorporation of
two modified deoxyribonucleoside triphosphates bearing ammonium and
imidazolyl functionalities. Nucleosides Nucleotides 1999 March;
18(3):377-91.
[0854] Pfundheller H M, Koshkin A A, Olsen C E, Wengel J:
Evaluation of oligonucleotides containing two novel 2'-O-methyl
modified nucleotide monomers: a 3'-C-allyl and a 2'-O,3'-C-linked
bicyclic derivative. Nucleosides Nucleotides 1999 September;
18(9):2017-30.
[0855] Ramasamy K S, Stoisavljevic V: Synthesis and biophysical
studies of modified oligonucleotides containing acyclic amino
alcohol nucleoside analogs. Nucleosides Nucleotides 1999 August;
18(8): 1845-61.
[0856] Schinazi R F, Lesnikowski Z J: Boron containing
oligonucleotides. Nucleosides Nucleotides 1998
January-March;17(1-3):635-47.
[0857] Secrist J A 3rd, Parker W B, Allan P W, Bennett L L Jr, Waud
W R, Truss J W, Fowler A T, Montgomery J A, Ealick S E, Wells A H,
Gillespie G Y, Gadi V K, Sorscher E J: Gene therapy of cancer:
activation of nucleoside prodrugs with E. coli purine nucleoside
phosphorylase. Nucleosides Nucleotides 1999 April-May;
18(4-5):745-57.
[0858] Shirokova E A, Shipitsin A V, Victorova L S, Dyatkina N B,
Goryunova L E, Beabealashvilli R S, Hamilton C J, Roberts S M,
Krayevsky A A: Modified nucleoside 5'-triphosphonates as a new type
of antiviral agents. Nucleosides Nucleotides 1999 April-May;
18(4-5): 1027-8.
[0859] Srivastava T K, Friedhoff P, Pingoud A, Katti S B:
Application of oligonucleoside methylphosphonates in the studies on
phosphodiester hydrolysis by Serratia endonuclease. Nucleosides
Nucleotides 1999 September;18(9):1945-60.
[0860] Stattel J M, Yanachkov I, Wright G E: Synthesis and
biochemical study of N2-(p-n-butylphenyl)-2'-deoxyguanosine
5'-(alpha,beta-imido)trip- hosphate (BuPdGMPNHPP): a non-substrate
inhibitor of B family DNA polymerases. Nucleosides Nucleotides 1998
August; 17(8): 1505-13.
[0861] Terato H, Morita H, Ohyama Y, Ide H: Novel modification of
5-formyluracil by cysteine derivatives in aqueous solution.
Nucleosides Nucleotides 1998 January-March;17(1-3):131-41.
[0862] Tomikawa A, Seno M, Sato-Kiyotaki K, Ohtsuki C, Hirai T,
Yamaguchi T, Kawaguchi T, Yoshida S, Saneyoshi M: Synthetic
nucleosides and nucleotides. 40. Selective inhibition of eukaryotic
DNA polymerase alpha by
9-(beta-D-arabinofuranosyl)-2-(p-n-butylanilino) adenine
5'-triphosphate (BuAaraATP) and its 2'-up azido analog: synthesis
and enzymatic evaluations. Nucleosides Nucleotides 1998
January-March;17(1-3):487-501.
[0863] U.S. Pat. No. 5,580,859; Filed Mar. 3, 1994, Issued Dec. 3,
1996. Felgner, P L.; Wolff, J A.; Rhodes, G H.; Malone, R W.;
Carson, D A.: Delivery of exogenous DNA sequences in a mammal.
[0864] U.S. Pat. No. 5,589,466; Filed Jan. 26, 1995, Issued Dec.
31, 1996. Felgner, P L.; Wolff, J A.; Rhodes, G H.; Malone, R W.;
Carson, DA.: Induction of a protective immune response in a mammal
by injecting a DNA sequence.
[0865] U.S. Pat. No. 5,641,665; Filed Nov. 28, 1994, Issued Jun.
24, 1997. Hobart, P M.; Margalith, M; Parker, S E.; Khatibi, S:
Plasmids suitable for IL-2 expression.
[0866] U.S. Pat. No. 5,693,622; Filed Jun. 07, 1995, Issued Dec. 2,
1997. Wolff, J A.; Duke, D J.; Felgner, P L.: Expression of
exogenous polynucleotide sequences cardiac muscle of a mammal.
[0867] U.S. Pat. No. 5,703,055; Filed Jan. 26, 1994, Issued Dec.
30, 1997. Felgner, P L.; Wolff, J A; Rhodes, G H.; Malone, R W;
Carson, D A.: Generation of antibodies through lipid mediated DNA
delivery.
[0868] U.S. Pat. No. 5,846,946; Filed Jun. 14, 1996, Issued Dec.
08, 1998. Huebner, R C.; Norman, J A.; Liang, X; Carner, K R.;
Barbour, A G.; Luke, CJ.: Compositions and methods for
administering Borrelia DNA.
[0869] U.S. Pat. No. 5,910,488; Filed Dec. 1, 1995, Issued Jun. 08,
1999. Nabel, G J.; Nabel, E G.; Lew, D; Marquet, M: Plasmids
suitable for gene therapy.
[0870] Victorova L S, Semizarov D C, Shirokova E A, Alexandrova L
A, Arzumanov A A, Jasko M V, Krayevsky A A: Human DNA polymerases
and retroviral reverse transcriptases: selectivity in respect to
dNTPs modified at triphosphate residues. Nucleosides Nucleotides
1999 April-May; 18(4-5):1031-2.
[0871] von Janta-Lipinski M, Gaertner K, Lehmann C, Scheer H,
Schildt J, Matthes E: Protein and RNA of human telomerase as
targets for modified oligonucleotides. Nucleosides Nucleotides 1999
June-July; 18(6-7):1719-20
[0872] WO9011092; Filed Mar. 3, 1990, A1 Published Oct. 4, 1990.
Felgner, P L.; Wolff, J A; Rhodes, G H.; Malone, R W; Carson, D A.:
Expression Of Exogenus Polynucleotide Sequences In A
Vertebrate.
[0873] WO9314778; Filed Jan. 21, 1993, A1 Published Aug. 5, 1993.
Rhodes, G H.; Dwarki, V J.; Felgner, P L; Wang-Felgner, J;
Manthorpe, M: Ex Vivo Gene Transfer.
[0874] WO9421797; Filed Mar. 14, 1994, A1 Published Sep. 29, 1994.
Donnelly, J J.; Dwarki, V J.; Liu, M A.; Montgomery, D L.; Parker,
S E.; Shiver, J W.; Ulmer, J B.: Nucleic Acid Pharmaceuticals.
[0875] WO9633736; Filed Apr. 26, 1996, A1 Published Oct. 31, 1996.
Baruch D I; Pasloske B L; Howard, R J: Malaria Peptides and
Vaccines.
[0876] WO9735992; Filed Mar. 17, 1997, A1 Published Oct. 2, 1997.
Hobart, P M.; Liang, X: Tetracycline Inducible/Repressible
Systems.
[0877] WO9926663; Filed Nov. 20, 1998, A2 Published Jun. 3, 1999.
Horton, H; Parker, S; Manthorpe, M; Felgner, P: Treatment Of Cancer
Using Cytokine-Expressing Polynucleotides And Compositions
Therefor.
[0878] WO9941368; Filed Feb. 10, 1999, A2 Published Aug. 19, 1999.
Punnonen J, Stemmer W P, Whalen R G; Howard, R: Optimization of
Immunomodulatory Properties of Genetic Vaccines.
[0879] WO9941369; Filed Feb. 10, 1999, A2 Published Aug. 19, 1999.
Punnonen J, Stemmer W P, Whalen R G; Howard, R: Genetic Vaccine
Vector Engineering.
[0880] WO9941383; Filed Feb. 10, 1999, A1 Published Aug. 19, 1999.
Punnonen J, Bass, S H, Whalen, R G, Howard, R, Stemmer, W P:
Antigen Library Immunization.
[0881] WO9941402; Filed Feb. 10, 1999, A2 Published Aug. 19, 1999.
Punnonen J, Stemmer, W P, Howard R, Patten P A: Targeting of
Genetic Vaccine Vectors.
[0882] Structure-Activity considerations are well-known in the art,
and the following illustrative but non-limiting examples of
references (incorporated by reference in their entirety) are
provided:
[0883] Dunbrack R L Jr, Gerloff D L, Bower M, Chen X, Lichtarge 0,
Cohen F E: Meeting review: the Second meeting on the Critical
Assessment of Techniques for Protein Structure Prediction (CASP2),
Asilomar, California, Dec. 13-16, 1996. Fold Des 2(2): R27-42,
(1997).
[0884] Fischer D, Eisenberg D: Protein fold recognition using
sequence-derived predictions. Protein Sci 5(5): 947-55, (May
1996).
[0885] Havel T F: An evaluation of computational strategies for use
in the determination of protein structure from distance constraints
obtained by nuclear magnetic resonance. Prog Biophys Mol Biol
56(1): 43-78, (1991).
[0886] Lichtarge O, Yamamoto K R, Cohen F E: Identification of
functional surfaces of the zinc binding domains of intracellular
receptors. J Mol Biol 274(3): 325-37, (Dec. 5, 1997).
[0887] Matsumoto R, Sali A, Ghildyal N, Karplus M, Stevens R L:
Packaging of proteases and proteoglycans in the granules of mast
cells and other hematopoietic cells. A cluster of histidines on
mouse mast cell protease 7 regulates its binding to heparin
serglycin proteoglycans. J Biol Chem 270(33): 19524-31, (Aug. 18,
1995).
[0888] Sali A: Comparative protein modeling by satisfaction of
spatial restraints. Mol Med Today 1(6): 270-7, (September
1995).
[0889] Sali A, Matsumoto R, McNeil H P, Karplus M, Stevens: R L
Three-dimensional models of four mouse mast cell chymases.
Identification of proteoglycan binding regions and
protease-specific antigenic epitopes. J Biol Chem 268(12):9023-34,
Apr. 25, 1993.
[0890] Sali A: Modeling mutations and homologous proteins. Curr
Opin Biotechnol 6(4): 437-51, (August 1995).
[0891] Sali A, Potterton L, Yuan F, van Vlijmen H, Karplus M:
Evaluation of comparative protein modeling by MODELLER. Proteins
23(3): 318-26
* * * * *
References