U.S. patent application number 10/271602 was filed with the patent office on 2004-01-01 for multiplexed analysis of polymorphic loci by concurrent interrogation and enzyme-mediated detection.
Invention is credited to Hashmi, Ghazala, Li, Alice Xiang, Seul, Michael.
Application Number | 20040002073 10/271602 |
Document ID | / |
Family ID | 27541093 |
Filed Date | 2004-01-01 |
United States Patent
Application |
20040002073 |
Kind Code |
A1 |
Li, Alice Xiang ; et
al. |
January 1, 2004 |
Multiplexed analysis of polymorphic loci by concurrent
interrogation and enzyme-mediated detection
Abstract
The invention provides methods and processes for the
identification of polymorphisms at one or more designated sites,
without interference from non-designated sites located within
proximity of such designated sites. Probes are provided capable of
interrogation of such designated sites in order to determine the
composition of each such designated site. By the methods of this
invention, one or more mutations within the CFTR gene and the HLA
gene complex can be can be identified.
Inventors: |
Li, Alice Xiang; (Ithaca,
NY) ; Hashmi, Ghazala; (Holmdel, NJ) ; Seul,
Michael; (Fanwood, NJ) |
Correspondence
Address: |
Eric P. Mirabel
Bioarray Solutions
35 Technology Drive
Warren
NJ
07059
US
|
Family ID: |
27541093 |
Appl. No.: |
10/271602 |
Filed: |
October 15, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60329427 |
Oct 15, 2001 |
|
|
|
60329428 |
Oct 15, 2001 |
|
|
|
60329619 |
Oct 15, 2001 |
|
|
|
60329620 |
Oct 15, 2001 |
|
|
|
60364416 |
Mar 14, 2002 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 2527/107 20130101;
C12Q 2565/537 20130101; C12Q 2535/125 20130101; C12Q 2535/125
20130101; C12Q 2527/107 20130101; C12Q 1/6837 20130101; C12Q 1/6827
20130101; C12Q 2600/156 20130101; C12Q 1/6827 20130101; C12Q
2600/16 20130101; C12Q 1/6858 20130101; A61P 9/00 20180101; C12Q
1/6837 20130101; C12Q 1/6883 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim
1. A method of concurrent determination of nucleotide composition
at designated polymorphic sites located within one or more target
nucleotide sequences, said method comprising the following steps:
(a) providing one or more sets of probes, each probe capable of
annealing to a subsequence of said one or more target nucleotide
sequences located within a range of proximity to a designated
polymorphic site; (b) contacting the set of probes with said one or
more target nucleotide sequences so as to permit formation of
hybridization complexes by placing an interrogation site within a
probe sequence in direct alignment with the designated polymorphic
site; (c) for each hybridization complex, determining the presence
of a match or a mismatch between the interrogation site and a
designated polymorphic site; and (d) determining the composition of
the designated polymorphic site.
2. The method of claim 1 wherein said one or more target nucleotide
sequences are produced in a multiplex PCR reaction using one or
more primer sets.
3. The method of claim 2 wherein said primers sets are degenerate
primer sets.
4. The method of claim 1 wherein said targets are fragments of
genomic DNA.
5. The method of claim 1 wherein said targets are fragments of
cDNA.
6. The method of claim 1 wherein one or more sets of probes are
spatially encoded on a substrate.
7. The method of claim 1 wherein one or more sets of probes are
immobilized on encoded microparticles.
8. The method of claim 7 wherein the encoded microparticles are
assembled into a random encoded array.
9. The method of claim 1 wherein each probe contains a terminal
elongation initiation region capable of initiating an elongation or
extension reaction.
10. The method of claim 9 wherein the reaction is catalyzed by a
polymerase lacking 3'.fwdarw.5' exonuclease activity.
11. The method of claim 1 wherein step (c) comprises adding one or
more deoxynucleotide triphosphates.
12. The method of claim 11 further comprising using a polymerase
capable of extending or elongating probes.
13. The method of claim 12 wherein the polymerase lacks
3'.fwdarw.5' exonuclease activity.
14. The method of claim 11 wherein at least one of the deoxy
nucleotide triphosphates is labeled so as to generate an optically
detectable signature associated with the elongation product.
15. The method of claim 1 wherein an optical label is attached to
one or more probes by annealing to the probes a fluorescently
labeled target to form a fluorescent hybridization complex.
16. The method of claim 15 further comprising using a polymerase
capable of extending or elongating probes displaying a match by
addition of one or more deoxynucleotide triphosphates to form an
elongated hybridization complex.
17. The method of claim 16 further comprising identifying
elongation products by detecting the stability of optical
signatures under conditions in which temperature is set to a value
above the melting temperature of any hybridization complex formed
by target and non-matched probe but below the melting temperature
of any extended hybridization complex formed by target and
elongated probe.
18. The method of claim 15 wherein one or more probes from the set
of probes are immobilized on encoded microparticles and a change in
optical signature is detected.
19. The method of claim 15 wherein one or more probes from the set
of probes are immobilized on encoded microparticles which are
arranged in random encoded arrays.
20. The method of claim 19 wherein the arrays are arranged in a
spatially encoded manner.
21. The method of claim 15 wherein the change in optical signature
is detected and particle identity is determined.
22. A method of sequence-specific amplification of assay signals
produced in the analysis of a nucleic acid sequence of interest in
a biological sample, comprising the following steps: (a) providing
a set of immobilized probes capable of forming a hybridization
complex with the sequence of interest; (b) contacting said set of
immobilized probes with said biological sample containing said
sequence of interest under conditions which permit the sequence of
interest to anneal to at least one of the immobilized probes to
form a hybridization complex; (c) contacting said hybridization
complex with a polymerase to allow elongation or extension of the
probes contained within said hybridization complex; (d) converting
elongation or extension of the probes into an optical signal; and
(e) recording said optical signal from the set of immobilized
probes in real time.
23. The method of claim 22 further comprising performing one or
more cycles, each cycle comprising
"annealing-extending/elongating-detecting-d- enaturing" steps,
wherein each cycle results in the increase of the number of
extended or elongated probes in arithmetic progression.
24. The method of claim 23 comprising the steps of: (a) setting a
first temperature favoring the formation of a hybridization
complex; (b) setting a second temperature favorable to
polymerase-catalyzed extension; (c) converting extension or
elongation into optical signal; (d) recording/imaging optical
signals/signatures from all immobilized probes; and (e) setting a
third temperature so as to ensure denaturation of all hybridization
complexes.
25. A method of forming a covering probe set for the concurrent
interrogation of a designated polymorphic site located in one or
more target nucleic acid sequences comprising the steps of: (a)
determining the sequence of an elongation probe capable of
alignment of the interrogation site of the probe with a designated
polymorphic site; (b) further determining a complete set of
degenerate probes to accommodate all non-designated as well as
non-selected designated polymorphic sites while maintaining
alignment of the interrogation site of the probe with the
designated polymorphic site; and (c) reducing the degree of
degeneracy by removing all tolerated polymorphisms.
26. The method of claim 25 wherein the covering set contains at
least two probes with different interrogation site composition per
designated site.
27. The method of claim 25 wherein the reduction of complexity in
step (c) is accomplished by probe pooling.
28. A method of identifying polymorphisms at one or more designated
sites on one or more target nucleotides, the method comprising (a)
providing one or more probes capable of interrogating said
designated sites; (b) forming an elongation product by elongating
one or more probes designed to interrogate a designated site; and
(c) determining the compositions at said two or more sites.
29. The method of claim 28 further comprising forming a
hybridization complex by annealing to the elongation product a
second probe designed to interrogate a second designated site.
30. A method for identifying polymorphisms at one or more
designated sites within a target polynucleotide sequence, the
method comprising (a) providing one or more probes capable of
interrogating said designated sites; (b) assigning a value to each
such designated site while accommodating non-designated polymorphic
sites located within a range of proximity to each such
polymorphism.
31. The method of claim 30 wherein the homology between the probes
and the target sequence is analyzed by multiplexing.
32. A method for determining polymorphism at one or more designated
sites of a target nucleotide sequence, the method comprising the
steps of providing one or more pairs of probes capable of detecting
deletions wherein the deletions are placed either at the 3'
terminus of the probe or within 3-5 bases of the 3' terminus.
33. A method of identifying polymorphisms at two or more designated
sites of a target nucleotide sequence, the method comprising (a)
selecting a multiplicity of designated polymorphic sites to permit
allele assignment; (b) providing two or more probes capable of
concurrent interrogation of the multiplicity of designated sites;
(c) assigning a value to each such designated site; and (d)
combining said values to determine the identity of an allele or
group of alleles while accommodating non-designated sites near said
designated polymorphisms.
34. A method for determining a polymorphism at one or more
designated sites in a target polynucleotide sequence, the method
comprising providing a probe set for such designated sites and
grouping said probe set in different probe subsets according to the
terminal elongation initiation of each probe.
35. The method of claim 34 further comprising the step of
multiplexing said probe set, measuring each probe in the probe set
without interference from the other probes in the probe set and
changing the allele matching pattern of a target polynucleotide
sequence to include alleles that are tolerated by a probe set.
36. The method of claim 35 wherein the step of changing the allele
matching pattern of a target polynucleotide sequence comprises
pooling one or more probe sets to include matched alleles.
37. The method of claim 36 wherein the step of changing the allele
matching pattern of a target polynucleotide sequence comprises the
step of comparing the signal intensities produced by the probe
set.
38. The method of claim 37 further comprising the step of
separating the terminal elongation initiation region and duplex
anchoring region on the probe set.
39. A method for the concurrent interrogation of a multiplicity of
polymorphic sites comprising the step of conducting a multiplexed
elongation assay by applying one or more temperature cycles to
achieve linear amplification of such target.
40. A method for the concurrent interrogation of a multiplicity of
polymorphic sites comprising the step of conducting a multiplexed
elongation assay by applying a combination of annealing and
elongation steps under temperature-controlled conditions.
41. A method of concurrent interrogation of nucleotide composition
at S polymorphic sites, P sub S:={c sub P (s); 1<=s<=S}
located within one or more contiguous target sequences, said method
assigning to each c sub P one of a limited set of possible values
by performing the following steps: (a) providing a set of
designated immobilized oligonucleotide probes, also known as
elongation probes, each probe capable of annealing in a preferred
alignment to a subsequence of the target located proximal to a
designated polymorphic site, the preferred alignment placing an
interrogation site within the probe sequence in direct
juxtaposition to the designated polymorphic site, the probes
further containing a terminal elongation initiation (TEI) region
capable of initiating an elongation or extension reaction; (b)
permitting the one or more target sequences to anneal to the set of
immobilized oligonucleotide probes so as form probe-target
hyrbdization complexes; and (c) for each probe-target hybridization
complex, calling a match or a mismatch in composition between
interrogation site and corresponding designated polymorphic
site.
42. The method of claim 41, wherein probes are immobilized in a
spatially encoded fashion on a substrate.
43. The method of 41, wherein probes are immobilized on encoded
microparticles which are in turn assembled in a random encoded
array on a substrate.
44. The method of 41, in which the calling step involves the use of
a polymerase capable of extending or elongating probes whose
interrogation site composition matches that of the designated
polymorphic site in the target, and only those probes, by addition
of one or more nucleoside triphosphates, one of which is labeled so
as to generate an optically deectable signature
45. The method of claim 41, wherein an optical signature is
attached to all available immobilized probes in the first step by
annealing to these primers a fluorescently labeled target to form a
fluorescent hybridization complex, and wherein the second step
involves the use of a polymerase capable of extending or elongating
probes displaying a terminal match, and only those probes, by
addition of one or more nucleotide triphosphates to form an
extended hybridization complex, and wherein extension products are
identified by the stability of optical signatures under an increase
in temperature to a value selected to exceed the melting
temperature of any hybridization complex but not to exceed the
melting temperature of any extended hybridization complex.
46. The method of claim 45, wherein probes are immobilized on
encoded microparticles and the change in optical signature is
detected, and particle identity determined, by flow cytometry.
47. The method of claim 45, wherein probes are immobilized on
encoded microparticles which are arranged in random encoded arrays,
said arrays optionally arranged in a spatially encoded manner, and
the change in optical signature is detected, and particle identity
is determined, by direct imaging.
48. A method of sequence-specific amplification of assay signals
produced in the analysis of a nucleic acid sequence of interest in
a biological sample, the method permitting real-time monitoring of
amplified signal, and comprising the following steps: (a) providing
a temperature-controlled sample containment device with associated
temperature control apparatus permitting real-time recording of
optical assay signal produced within said device; (b) providing
within said sample containment device a set of distinguishable,
immobilized oligonucleotide probes capable forming a hybridization
complex with the sequence of interest; (c) permitting the sequence
to anneal to the set of immobilized oligonucleotide probes to form
a hybridization complex; (d) contacting said hybridization complex
with a polymerase to allow elongation of extension of the matched
probes contained within a hybridization complex; (e) providing
means to convert elongation or extension of matching probes into an
optical assay signal; (f) providing an optical recording/imaging
device capable of recording optical assay signals from the set of
immobilized probes in real time; (g) performing one or more
"annealing-extending-detecting-denaturing" cycles, each cycle
increasing the number of extended or elongated probes in arithmetic
progression and involving the following steps: (i) set a first
temperature favoring the formation of a hybridization complex; (ii)
set a second temperature favorable to polymerase-catalyzed
extension; (iii) convert extension into optical signal; (iv)
record/image optical signals/signatures from all immobilized
probes; and (v) set a third temperature so as to ensure
denaturation of all hybridization complexes.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional
Application Serial No. 60/329,427 filed Oct. 14, 2001, U.S.
Provisional Application Serial No. 60/329,620, filed Oct. 15, 2001,
U.S. Provisional Application Serial No. 60/329,428, filed Oct. 14,
2001 and U.S. Provisional Application Serial No. 60/329,619 filed
Oct. 15, 2001. This application is related to PCT application
Serial Number PCT/US02/xxxx of the same title filed concurrently
herewith. All the above-referenced applications are expressly
incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention generally relates to molecular
diagnostics and genetic typing or profiling. The invention relates
to methods, processes and probes for the multiplexed analysis of
highly polymorphic genes. The invention also relates to the
molecular typing and profiling of the Human Leukocyte Antigen (HLA)
gene complex and the Cystic Fibrosis Conductance Trans-membrane
Regulator gene (CFTR) and to compositions, methods and designs
relating thereto.
BACKGROUND OF THE INVENTION
[0003] The ability to efficiently, rapidly and unambiguously
analyze polymorphisms in the nucleic acid sequences of a gene of
interest plays an important role in the development of molecular
diagnostic assays, the applications of which includes genetic
testing, carrier screening, genotyping or genetic profiling, and
identity testing. For example, it is the objective of genetic
testing and carrier screening to determine whether mutations
associated with a particular disease are present in a gene of
interest. The analysis of polymorphic loci, whether or not these
comprise mutations known to cause disease, generally provides
clinical benefit, as for example in the context of pharmacogenomic
genotyping or in the context of HLA molecular typing, in which the
degree of allele matching in the HLA loci of transplant donor and
prospective recipient is determined in context of allogeneic tissue
and bone marrow transplantation.
[0004] The multiplexed analysis of polymorphisms while desirable in
facilitating the analysis of a high volume of patient samples,
faces a considerable level of complexity which will likely increase
as new polymorphisms, genetic markers and mutations are identified
and must be included in the analysis. The limitations of current
methods to handle this complexity in a multiplexed format of
analysis so as to ensure reliable assay performance while
accommodating high sample volume, and the consequent need for novel
methods of multiplexed analysis of polymorphisms and mutations is
the subject of the present invention. By way of example, the
genetic loci encoding Cystic Fibrosis Transmembrane Conductance
(CFTR) channel and Human Leukocyte Antigens (HLA) are analyzed by
the methods of the invention. Cystic fibrosis (CF) is one of the
most common recessive disorders in Caucasians with a rate of
occurrence in the US of 1 in 2000 live births. About 4% of the
population carry one of the CF mutations. The CFTR gene is highly
variable: more than 900 mutations have been identified to date (see
http://www.genet.sickkids.on.ca/cftr, which is incorporated herein
by reference). The characterization of the CFTR gene provides the
key to the molecular diagnosis of CF by facilitating the
development of sequence-specific probes (Rommens et al., 1989;
Riordan, et al., 1989; Kerem et al., 1989, each of which is
incorporated herein by reference). The National Institutes of
Health (NIH)--sponsored consensus development conference
recommended carrier screening for CFTR mutations for adults with a
positive family history of CF (NIH 1997). The committee on carrier
screening of the American College of Medical Genetics (ACMG) has
recommended for use in general population carrier screening a
pan-ethnic mutation panel that includes a set of 25 disease-causing
CF mutations with an allele frequency of >0.1% in the general
population of United States (see
http://www.faseb.org/genetics/acmg, which is incorporated herein by
reference). The mutations in the ACMG panel also include the most
common mutations in Ashkenazi Jewish and African-American
populations.
[0005] Several methods have been described for the detection of
CFTR mutations including the following: : denaturing gradient gel
electrophoresis (Devoto et al., 1991); single strand conformation
polymorphism analysis (Plieth et al., 1992); RFLP (Friedman et al.,
1991); amplification with allele-specific primers (ASPs) (Gremonesi
et al., 1992), and probing with allele specific oligonucleotides
(ASO) (Saiki et al., 1986). A widely used method involves PCR
amplification followed by blotting of amplified target strands onto
a membrane and probing of strands with oligonucleotides designed to
match either the normal ("wild type") or mutant configuration.
Specifically, multiplex PCR has been used in conjunction with ASO
hybridization in this dot blot format to screen 12 CF mutations
(Shuber et al., 1993). In several instances, arrays of
substrate-immobilized oligonucleotide probes were used to
facilitate the detection of known genomic DNA sequence variations
(Saiki, R K et al., 1989) in a "reverse dot blot" format An array
of short oligonucleotides synthesized in-situ by photolithographic
processes was used to detect known mutations in the coding region
of the CFTR gene (Cronin, M T., et al., 1996). Primer extension
using reverse transcriptase has been reported as a method for
detecting the .DELTA.508 mutation in CFTR (Pastinen, T., 2000).
This approach was described as early as 1989 (Wu, D. Y. et al,
Proc. Natl. Acad. Sci. USA. 86:2757-2760 (1989), Newton, C. R. et
al, Nucleic Acids Res. 17:2503-2506 (1989)). As further discussed
herein below, while providing reasonable detection in a research
laboratory setting, these methods require significant labor,
provide only slow turnaround, offer only low sample throughput, and
hence require a high cost per sample.
[0006] In connection with the spotted microarrays, several methods
of spotting have been described, along with many substrate
materials and methods of probe immobilization. However, the spotted
arrays of current methods exhibit not only significant
array-to-array variability but also significant spot-to-spot
variability, an aspect that leads to limitations in assay
reliability and sensitivity. In addition, spotted arrays are
difficult to miniaturize beyond their current spot dimensions of
typically 100 .mu.m diameter on 500 .mu.m centers, thereby
increasing total sample volumes and contributing to slow assay
kinetics limiting the performance of hybridization assays whose
completion on spotted arrays may require as much as 18 hours.
Further, use of spotted arrays involve readout via highly
specialized confocal laser scanning apparatus. In an alternative
approach, oligonucleotide arrays synthesized in-situ by a
photolithographic process have been described. The complexity of
array fabrication, however, limits routine customization and
combines considerable expense with lack of flexibility for
diagnostic applications.
[0007] The major histocompatibility complex (MHC) includes the
human leukocyte antigen (HLA) gene complex, located on the short
arm of human chromosome six. This region encodes cell-surface
proteins which regulate the cell-cell interactions underlying
immune response. The various HLA Class I loci encode 44,000 dalton
polypeptides which associate with .beta.-2 microglobulin at the
cell surface and mediate the recognition of target cells by
cytotoxic T lymphocytes. HLA Class II loci encode cell surface
heterodimers, composed of a 29,000 dalton and a 34,000 dalton
polypeptide which mediate the recognition of target cells by helper
T lymphocytes. HLA antigens, by presenting foreign pathogenic
peptides to T-cells in the context of a "self" protein, mediate the
initiation of an immune response. Consequently, a large repertoire
of peptides is desirable because it increases the immune response
potential of the host. On the other hand, the correspondingly high
degree of immunogenetic polymorphism represents significant
difficulties in allotransplantation, with a mismatch in HLA loci
representing one of the main causes of allograft rejection. The
degree of allele matching in the HLA loci of a donor and
prospective recipient is a major factor in the success of
allogeneic tissue and bone marrow transplantation.
[0008] The HLA-A, HLA-B, and HLA-C loci of the HLA Class I region
as well as the HLA-DRB, HLA-DQB, HLA-DQA, HLA-DPB and HLA-DPA loci
of the HLA Class II region exhibit an extremely high degree of
polymorphism. To date, the WHO nomenclature committee for factors
of the HLA system has designated 225 alleles of HLA A (HLA A*0101,
A*0201, etc.), 444 alleles of HLA-B, and 111 alleles of HLA-C, 358
HLA-DRB alleles, 22 HLA-DQA alleles, 47 HLA-DQB alleles, 20 HLA-DPA
alleles and 96 HLA-DPB alleles (See IMGT/HLA Sequence Database,
http://www3.ebi.ac.uk:80/imgt/hla/index.- html) and Schreuder, G.
M. Th. et al, Tissue Antigens. 54:409-437 (1999)), both of which
are hereby incorporated by reference.
[0009] HLA typing is a routine procedure that is used to determine
the immunogenetic profile of transplant donors. The objective of
HLA typing is the determination of the patient's allele
configuration at the requisite level of resolution, based on the
analysis of a set of designated polymorphisms within the genetic
locus of interest. Increasingly, molecular typing of HLA is the
method of choice over traditional serological typing, because it
eliminates the requirement for viable cells, offers higher allelic
resolution, and extends HLA typing to Class II for which serology
has not been adequate (Erlich, H. A. et al, Immunity. 14:347-356
(2001)).
[0010] One method currently applied to clinical HLA typing uses the
polymerase chain reaction (PCR) in conjunction with
sequence-specific oligonucleotide probes (SSO or SSOP), which are
allowed to hybridize to amplified target sequences to produce a
pattern as a basis for HLA typing.
[0011] The availability of sequence information for all available
HLA alleles has permitted the design of sequence-specific
oligonucleotides (SSO) and allele-specific oligonucleotides (ASO)
for the characterization of known HLA polymorphisms as well as for
sequencing by hybridization (Saiki, R. K. Nature 324:163-166
(1986), Cao, K. et al, Rev Immunogenetics, 1999: 1: 177-208).
[0012] In one embodiment of SSO analysis, also referred to as a
"dot blot format", DNA samples are extracted from patients,
amplified and blotted onto a set of nylon membranes in an
8.times.12 grid format. One radio-labeled oligonucleotide probe is
added to each spot on each such membrane; following hybridization,
spots are inspected by autoradiography and scored either positive
(1) or negative (0). For each patient sample, the string of l's and
0's constructed from the analysis of all membranes defines the
allele configuration. A multiplexed format of SSO analysis in the
"reverse dot blot format" employs sets of oligonucleotide probes
immobilized on planar supports (Saiki, R. et al, Immunological Rev.
167: 193-199 (1989), Erlich, H. A. Eur. J. Immunogenet. 18: 33-55
(1991)).
[0013] Another method of HLA typing uses the polymerase-catalyzed
elongation of sequence-specific primers (SSPs) to discriminate
between alleles. The high specificity of DNA polymerase generally
endows this method with superior specificity. In the SSP method,
PCR amplification is performed with a specific primer pair for each
polymorphic sequence motif or pair of motifs and a DNA polymerase
lacking 3'->5' exonuclease activity so that elongation (and
hence amplification) occurs only for that primer whose 3' terminus
is perfectly complementary ("matched") to the template. The
presence of the corresponding PCR product is ascertained by gel
electrophoretic analysis. An example of a highly polymorphic locus
is the 280 nt DNA fragment of the HLA class II DR gene which
features a high incidence of polymorphisms
[0014] HLA typing based on the use of sequence-specific probes
(SSP), also referred to as phototyping (Dupont, B. Tissue Antigen.
46: 353-354 (1995)), has been developed as a commercial technology
that is in routine use for class I and class II typing (Bunce, M.
et al, Tissue Antigens. 46:355-367 (1995), Krausa, P and Browning,
M. J., Tissue Antigens. 47: 237-244 (1996), Bunce, M. et al, Tissue
Antigens. 45:81-90 (1995)). However, the requirement of the SSP
methods of the prior art for extensive gel electrophoretic analysis
for individual detection of amplicons represents a significant
impediment to the implementation of multiplexed assay formats that
can achieve high throughput. This disadvantage is overcome by the
methods of the present invention.
[0015] In the context of elongation reactions, highly polymorphic
loci and the effect of non-designated polymorphic sites as
interfering polymorphisms were not considered in previous
applications, especially in multiplexed format. Thus, there is a
need to provide for methods, compositions and processes for the
multiplexed analysis of polymorphic loci that would enable the
detection of designated while accommodating the presence of
no-designated sites and without interference from such
non-designated sites.
SUMMARY OF THE INVENTION
[0016] The present invention provides methods and processes for the
concurrent interrogation of multiple designated polymorphic sites
in the presence of non-designated polymorphic sites and without
interference from such non-designated sites. Sets of probes are
provided which facilitate such concurrent interrogation. The
present invention also provides methods, processes, and probes for
the identification of polymorphisms of the HLA gene complex and the
CFTR gene.
[0017] The specificity of methods of detection using probe
extension or elongation is intrinsically superior to that of
methods using hybridization, particularly in a multiplexed format,
because the discrimination of sequence configurations no longer
depends on differential hybridization but on the fidelity of
enzymatic recognition. To date, the overwhelming majority of
applications of enzyme-mediated analysis use single base probe
extension. However, probe elongation, in analogy to that used in
the SSP method of HLA typing, offers several advantages for the
multiplexed analysis of polymorphisms, as disclosed herein. Thus,
single nucleotide as well as multi-nucleotide polymorphisms are
readily accommodated. The method, as described herein, is generally
practiced with only single label detection, accommodates concurrent
as well as consecutive interrogation of polymorphic loci and
incorporates complexity in the probe design.
[0018] One aspect of this invention provides a method of concurrent
determination of nucleotide composition at designated polymorphic
sites located within one or more target nucleotide sequences. This
method comprises the following steps: (a) providing one or more
sets of probes, each probe capable of annealing to a subsequence of
the one or more target nucleotide sequences located within a range
of proximity to a designated polymorphic site; (b) contacting the
set of probes with the one or more target nucleotide sequences so
as to permit formation of hybridization complexes by placing an
interrogation site within a probe sequence in direct alignment with
the designated polymorphic site; (c) for each hybridization
complex, determining the presence of a match or a mismatch between
the interrogation site and a designated polymorphic site; and (d)
determining the composition of the designated polymorphic site.
[0019] Another aspect of this invention is to provide a method of
sequence-specific amplification of assay signals produced in the
analysis of a nucleic acid sequence of interest in a biological
sample. This method comprises the following steps: (a) providing a
set of immobilized probes capable of forming a hybridization
complex with the sequence of interest; (b) contacting said set of
immobilized probes with the biological sample containing the
sequence of interest under conditions which permit the sequence of
interest to anneal to at least one of the immobilized probes to
form a hybridization complex; (c) contacting the hybridization
complex with a polymerase to allow elongation or extension of the
probes contained within the hybridization complex; (d) converting
elongation or extension of the probes into an optical signal; and
(e) recording the optical signal from the set of immobilized probes
in real time.
[0020] Yet another aspect of this invention is to provide a method
of forming a covering probe set for the concurrent interrogation of
a designated polymorphic site located in one or more target nucleic
acid sequences. This method comprises the steps of: (a) determining
the sequence of an elongation probe capable of alignment of the
interrogation site of the probe with a designated polymorphic site;
(b) further determining a complete set of degenerate probes to
accommodate all non-designated as well as non-selected designated
polymorphic sites while maintaining alignment of the interrogation
site of the probe with the designated polymorphic site; and (c)
reducing the degree of degeneracy by removing all tolerated
polymorphisms.
[0021] One aspect of this invention is to provide a method for
identifying polymorphisms at one or more designated sites within a
target polynucleotide sequence. This the method comprise the
following steps: (a) providing one or more probes capable of
interrogating said designated sites; (b) assigning a value to each
such designated site while accommodating non-designated polymorphic
sites located within a range of proximity to each such
polymorphism.
[0022] Another aspect of this invention is to provide a method for
determining a polymorphism at one or more designated sites in a
target polynucleotide sequence. This method comprises providing a
probe set for the designated sites and grouping the probe set in
different probe subsets according to the terminal elongation
initiation of each probe.
[0023] Another aspect of this invention is to provide a method for
the concurrent interrogation of a multiplicity of polymorphic sites
comprising the step of conducting a multiplexed elongation assay by
applying one or more temperature cycles to achieve linear
amplification of such target.
[0024] Yet another aspect of this invention is to provide a method
for the concurrent interrogation of a multiplicity of polymorphic
sites. This method comprises the step of conducting a multiplexed
elongation assay by applying a combination of annealing and
elongation steps under temperature-controlled conditions.
[0025] Another aspect of this invention is to provide a method of
concurrent interrogation of nucleotide composition at S polymorphic
sites, P.sub.S:={c.sub.P(s); 1.ltoreq.s.ltoreq.S} located within
one or more contiguous target sequences, said method assigning to
each c.sub.P one of a limited set of possible values by performing
the following steps: (a) providing a set of designated immobilized
oligonucleotide probes, also known as elongation probes, each probe
capable of annealing in a preferred alignment to a subsequence of
the target located proximal to a designated polymorphic site, the
preferred alignment placing an interrogation site within the probe
sequence in direct juxtaposition to the designated polymorphic
site, the probes further containing a terminal elongation
initiation (TEI) region capable of initiating an elongation or
extension reaction ;(b) permitting the one or more target sequences
to anneal to the set of immobilized oligonucleotide probes so as
form probe-target hyrbdization complexes; and (c) for each
probe-target hybridization complex, calling a match or a mismatch
in composition between interrogation site and corresponding
designated polymorphic site.
[0026] Other objects, features and advantages of the invention will
be more clearly understood when taken together with the following
detailed description of an embodiment which will be understood as
being illustrative only.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1a is an illustration of probe sets designed to
interrogate designated sites in HLA-DR and an internal control.
[0028] FIG. 1b is an illustration of a staggered primer design.
[0029] FIG. 2 is an illustration of a modification of allele
binding pattern based on tolerance effect.
[0030] FIG. 3 is an illustration of the use of linked primer
structure to separate the anchoring sequence and polymorphism
detection sequence.
[0031] FIG. 4 shows simulated ambiguity in allele identification
due to allele combination.
[0032] FIG. 5 shows one method for decreasing the ambiguity in
allele identification that arises from allele combination.
[0033] FIG. 6 is an illustration of a combination of hybridization
and elongation.
[0034] FIG. 7 shows a model reaction using synthetic
oligonucleotides as targets.
[0035] FIG. 8 shows results obtained using testing real patient
sample in an eMAP format.
[0036] FIG. 9 shows results obtained from eMAP primer extension for
DR locus.
[0037] FIG. 10 shows results obtained from eMAP for DR locus.
[0038] FIG. 11 shows results obtained from eMAP for A locus Exon
3.
[0039] FIG. 12 shows results obtained from eMAP SSP for A locus
Exon 3 and is an example of tolerance for the non-designated
polymorphism.
[0040] FIG. 13 is an illustration of bead immobilized probe
elongation of variable mutant sites.
[0041] FIG. 14 is an illustration of PCR using primers immobilized
on the surface of beads.
[0042] FIG. 15 is an illustration of elongation of multiple probes
using combined PCR products.
[0043] FIG. 16 is an illustration of results for probe elongation
of a multiplexed CF mutation.
[0044] FIG. 16a is an illustration of probe elongation using a
synthetic target.
[0045] FIG. 16b is an illustration of probe elongation using beads
in a PCR reaction.
[0046] FIG. 17 is an illustration of one-step elongation with
temperature-controlled cycling results.
[0047] FIG. 18 is an illustration of primer elongation with labeled
dNTP and three other unlabeled dNTPs.
[0048] FIG. 19 is an illustration of primer elongation with labeled
ddNTP and three other unlabeled dNTPs.
[0049] FIG. 20 is an illustration of primer elongation, where four
unlabeled dNTPs are used for elongation and the product is detected
by a labeled oligonucleotide probe which hybridizes to the extended
unlabeled product.
[0050] FIG. 21 is an illustration of a primer extension in which a
labeled target and four unlabeled dNTPs are added. This
illustration which shows that only with the extended product can
the labeled target be retained with the beads when high temperature
is applied to the chip.
[0051] FIG. 22 is an illustration of linear amplification where
sequence specific probes are immobilized.
[0052] FIG. 23 is an illustration of the utilization of hairpin
probes.
[0053] FIG. 24 is an illustration of applying this invention to the
analysis of cystic fibrosis and Ashkenazi Jewish disease
mutations.
DETAILED DESCRIPTION OF THE INVENTION
[0054] This invention provides compositions, methods and designs
for the multiplexed analysis of highly polymorphic loci; that is,
loci featuring a high density of specific ("designated")
polymorphic sites, as well as interfering non-designated
polymorphic sites. The multiplexed analysis of such sites thus
generally involves significant overlap in the sequences of probes
directed to adjacent sites on the same target, such that probes
designed for any specific or designated site generally also will
cover neighboring polymorphic sites. The interference in the
analysis of important genes including CFTR and HLA has not been
addressed in the prior art. To exemplify the methods of the methods
of the invention, the HLA gene complex and the CFTR gene are
analyzed.
[0055] The present invention provides compositions and methods for
the parallel or multiplexed analysis of polymorphisms ("MAP") in
nucleic acid sequences displaying a high density of polymorphic
sites. In a given nucleic acid sequence, each polymorphic site
comprises a difference comprising one or more nucleotides.
[0056] This invention provides methods and compositions for the
concurrent interrogation of an entire set of designated
polymorphisms within a nucleic acid sequence. This invention
provides compositions, methods and designs to determine the
composition at each such site and thereby provide the requisite
information to select, from the set of possible configurations for
the sequence of interest, the actual configuration in a given
specific sample. The invention also serves to narrow the set of
possible sequences in that sample. Accordingly, in certain
embodiments, it will be useful or necessary to determine sequence
composition by assigning to a designated site one of the possible
values corresponding to nucleotide identity. In other embodiments,
it will be sufficient to determine the site composition to be
either matching or non-matching with respect to a known reference
sequence, as in the assignment of "wild-type" or "mutation" in the
context mutation analysis. The capability of sequence determination
thereby afforded is referred to herein as confirmatory sequencing
or resequencing. In a preferred embodiment, the present invention
provides elongation-mediated multiplexed analysis of polymorphisms
(eMAP) of the Cystic Fibrosis Transmembrane Conductance Regulator
(CFTR) gene and for the Human Leukocyte Antigen (HLA) gene
complex.
[0057] The methods and compositions of this invention are useful
for improving the reliability and accuracy of polymorphism analysis
of target regions which contain polymorphic sites in addition to
the polymorphic sites designated for interrogation. These
non-designated sites represent a source of interference in the
analysis. Depending on the specific assay applications, one or more
probes of differing composition may be designated for the same
polymorphic site, as elaborated in several Examples provided
herein. It is a specific objective of the present invention to
provide compositions and methods for efficient, rapid and
unambiguous analysis of polymorphisms in genes of interest. This
analysis is useful in molecular diagnostic assays, such as those
designed, for example, for genetic testing, carrier screening,
genotyping or genetic profiling, identity testing, paternity
testing and forensics.
[0058] Preparation of target sequences may be carried out using
methods known in the art. In a non-limiting example, a sample of
cells or tissue is obtained from a patient. The nucleic acid
regions containing target sequences (e.g., Exons 2 and 3 of HLA)
are then amplified using standard techniques such as PCR (e.g.,
asymmetric PCR).
[0059] Probes for detecting polymorphic sites function as the point
of initiation of a polymerase-catalyzed elongation reaction when
the composition of a polymorphic site being analyzed is
complementary ("matched") to that of the aligned site in the probe.
Generally, the probes of the invention should be sufficiently long
to avoid annealing to unrelated DNA target sequences. In certain
embodiments, the length of the probe may be about 10 to 50 bases,
more preferably about 15 to 25, and more preferably 18 to 20 bases.
Probes may be immobilized on the solid supports via linker moieties
using methods and compositions well known in the art.
[0060] As used herein, the term "nucleic acid" or "oligonucleotide"
refers to deoxyribonucleic acid or ribonucleic acid in a single or
double-stranded form. The term also covers nucleic-acid like
structures with synthetic backbones. DNA backbone analogues include
phosphodiester, phosphorothioate, phosphorodithioate,
methylphosphonate, phosphoramidate, alkyl phosphotriester,
sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate,
morpholino carbamate, and peptide nucleic acids (PNAs). See
Oligonucleotides and Analogues, A Practical Approach (Editor: F.
Eckstein), IRL Press at Oxford University Press (1991); Antisense
Strategies, Annals of the New York Academy of Sciences, vol. 600,
Eds.; Baserga and Denhardt (NYAS 1992); Milligan, J. Med. Chem.,
vol. 36, pp. 1923-1937; Antisense Research and Applications (1993,
CRC Press). PNAs contain non-ionic backbones, such as
N-2(2-aminoethyl) glycine units. Phosphorothioate linkages are
described in WO 97/0321 1;WO 96/39159; and Mata, Toxicol. Appl.
Pharmacol. 144: 189-197 (1997). Other synthetic backbones
encompassed by the term include methyl-phosphonate linkages or
alternating methylphosphonate and phosphodiester linkages
(Strauss-Soukup, Biochemistry, 36: 8692-8698 (1997), and
benzylphosphonate linkages (Samstag, Antisense Nucleic Acid Drug
Dev., 6: 153-156 (1996)). The term nucleic acid includes genes,
cDNAs, and mRNAs.
[0061] As used herein, the term "hybridization" refers to the
binding, duplexing, or hybridizing of a nucleic acid molecule
preferentially to a particular nucleotide sequence under stringent
conditions. The term "stringent conditions" refers to conditions
under which a probe will hybridize preferentially to the
corresponding target sequence, and to a lesser extent or not at all
to other sequences. A "stringent hybridization" is sequence
dependent, and is different under different conditions. An
extensive guide to the hybridization of nucleic acids may be found
in, e.g. Tijssen, Laboratory Techniques in Biochemistry and
Molecular Biology, Elsevier, N.Y. (1993). Generally, highly
stringent hybridization and wash conditions are selected to about
5.degree. C. lower than the thermal melting point (T.sub.m) for the
specific sequence at a defined ionic strength and pH. The T.sub.m
is the temperature (under defined ionic strength and pH) at which
50% of the target sequence hybridizes to a perfectly matched probe.
Very stringent conditions are selected by conducting the assay at a
temperature set to be equal to the T.sub.m for a particular probe.
An example of highly stringent wash condition is 0.15 M NaCl at
72.degree. C. for about 15 minutes. An example of stringent wash
conditions is a 0.2.times.SSC wash at 65.degree. C. for 15 minutes.
See Sambrook, Molecular Cloning: A Laboratory Manual (2.sup.nd Ed),
vol. 1-3 (1989).
[0062] As used herein, the term "designated site" is defined as a
polymorphic site of interest (i.e., a polymorphic site that one
intends to identify) on a given nucleic acid. The term
"non-designated site" refers to any polymorphic site that co-exists
with a designated site or sites on a given nucleic acid but is not
of interest.
[0063] As used herein, the term "correlated designated sites"
refers to polymorphic sites with correlated occurrences. Typically,
each member of such a set of polymorphic sites must be identified
in order to identify the allele to which the set belongs.
[0064] As used herein, the term "selected designated site" refers
to a polymorphic site of interest on a given nucleic acid that also
overlaps with the 3' end of a probe sequence of this invention. A
"non-selected designated site" refers to a polymorphic site of
interest that does not overlap with a 3' end of a probe sequence of
this invention.
[0065] As used herein, an "interfering non-designated site" refers
to a non-designated polymorphic site that is within 1-5 bases from
the 3' end of a probe sequence of this invention. A
"non-interfering non-designated site" refers to a non-designated
site that is greater than 5 bases from the 3' end of a probe
sequence of this invention. The non-interfering non-designated site
may be closer to the 5' end of the probe sequence than to the 3'
end.
[0066] In certain embodiments, the probes of this invention
comprise a "terminal elongation initiation" region (also referred
to as a "TEI" region) and a Duplex Anchoring ("DA") region. The TEI
region refers a section of the probe sequence, typically the three
or four 3' terminal positions of the probe. The TEI region is
designed to align with a portion of the target nucleic acid
sequence at a designated polymorphic site so as to initiate the
polymerase-catalyzed elongation of the probe. The DA region,
typically comprises the remaining positions within the probe
sequence and is preferably designed to align with a portion of the
target sequence in a region located close (within 3-5 bases) to the
designated polymorphism.
[0067] As used herein, the term a "close range of proximity" refers
to a distance of between 1-5 bases along a given nucleic acid
strand. A "range of proximity" refers to a distance within 1-10
bases along a given nucleic acid strand. The term "range of
tolerance" refers to the total number of mismatches in the TEI
region of a probe hybridized to a target sequence that still
permits annealing and elongation of the probe. Typically, more than
2 mismatches in the TEI region of a hybridized probe is beyond the
range of tolerance.
[0068] The terms "microspheres", "microparticles", "beads", and
"particles" are herein used interchangeably. The composition of the
beads includes, but is not limited to, plastics, ceramics, glass,
polystyrene, methylstyrene, acrylic polymers, paramagnetic
materials, thoria sol, carbon graphite, titanium dioxide, latex or
cross-linked dextrans such as sepharose, cellulose, nylon,
cross-linked micelles and Teflon. See "Microsphere Detection Guide"
from Bangs Laboratories, Fishers IN. The particles need not be
spherical and may be porous. The bead sizes may range from
nanometers (e.g., 100 nm) to millimeters (e.g., 1 mm), with beads
from about 0.2 micron to about 200 microns being preferred, more
preferably from about 0.5 to about 5 micron being particularly
preferred.
[0069] This invention provides for the concurrent interrogation of
a set of designated polymorphic sites within one or more target
strands by first annealing a set of immobilized sequence specific
oligonucleotide probes to target nucleic acid strands and by
probing the configuration of designated polymorphic sites by way of
polymerase-catalyzed elongation of the annealed set of immobilized
sequence-specific oligonucleotide probes. An elongation probe is
designed to interrogate a designated site by annealing to a
sequence in a given target, thereby forming a hybridization complex
("duplex"). The probe's 3' terminus is placed at or near the
designated site within the target and polymerase-catalyzed probe
elongation is initiated if the 3' terminal probe composition
matches (i.e., is complementary to) that of the target at the
interrogation site. As described herein, the probe may be designed
to anneal in a manner such that the designated site is within a
range of proximity of the 3' terminus.
[0070] In one embodiment of the invention, two or more probes may
be provided for interrogation of a specific designated site. The
probes are designed to take into account the possibility of
polymorphisms or mutations at the interrogation site and
non-designated polymorphic sites within a certain range of
proximity of the designated polymorphic site. In this context, the
term "polymorphism" refers to any variation in a nucleic acid
sequence, while the term "mutation" refers to a sequence variation
in a gene that is associated or believed to be associated with a
phenotype. In a preferred embodiment, this multiplicity of probe
sequences contains at least one probe that matches the specific
target sequence in all positions within the range of proximity to
ensure elongation.
[0071] In certain embodiments, the invention discloses compositions
and methods for the parallel interrogation of S polymorphic sites
selected from a target sequence of length N by a set of L.gtoreq.S
oligonucleotide primers.
[0072] In accordance with the requirements of specific assay
applications, one or more probes of differing composition may be
designated for the same polymorphic site, as elaborated in several
Examples provided herein.
[0073] Each designated probe is composed of a nucleotide sequence
of length M which contains an interrogation site (one that, upon
hybridization, aligns with the polymorphic site being analyzed) at
or near the 3' terminus. Although 3' end is preferred, those within
3-4 bases from the 3' end may be used. The primer is immobilized on
a solid phase carrier (may be linked via a linker sequence or other
linker moiety) and is identified by its association with that
carrier. The probe sequence is designed to permit annealing of the
primer with the target so as to form a hybridization complex
between probe and target and to ensure the alignment of the
interrogation site with the designated polymorphic site, the
preferred configuration providing an interrogation site at the
probe's 3' terminus and alignment of the 3' terminus with the
designated polymorphic site. The step of interrogating the
nucleotide composition of the designated polymorphic site with a
designated probe of given interrogation site composition assigns to
that site one of two values, namely matched, numerically
represented by 1, or non-matched, numerically represented by 0. In
HLA molecular typing, the resulting binary string of length L
identifies an allele to a desired typing resolution.
[0074] In a preferred embodiment, the interrogation step uses the
extension of the designated probe. This reaction, catalyzed by a
polymerase, produces an extended hybridization complex by adding to
the probe sequence one or more nucleoside triphosphates in the
order reflecting the sequence of the target sequence in the
existing hybridization complex. In order for this extension
reaction to proceed, a designated primer of length M must contain a
terminal extension initiation region of length M*.ltoreq.M, herein
also referred to as terminal extension initiation sequence (or TEI
sequence), which contains the interrogation site. Extension
proceeds if the composition of the designated interrogation site
matches that of the designated polymorphic site.
[0075] Methods of the prior art of detecting successful extension
have been described which involve the use labeled deoxy nucleoside
triphosphates (dNTPs) or dideoxy nucleoside triphosphates (ddNTPs).
The present invention also discloses novel methods of providing
optical signatures for detection of successful extension
eliminating the need for labeled dNTPs or ddNTPs, an advantage
arising from the reduction in the efficiency of available
polymerases in accommodating labeled dNTPs or ddNTPs.
[0076] However, the density of polymorphic sites in highly
polymorphic loci considered in connection with the present
invention makes it likely that designated primers directed to
selected polymorphic sites, when annealing to the target
subsequence proximal to the designated polymorphic site, will
overlap adjacent polymorphic sites.
[0077] That is, an oligonucleotide probe, designed to interrogate
the configuration of the target at one of the selected polymorphic
sites, and constructed with sufficient length to ensure specificity
and thermal stability in annealing to the correct target
subsequence, will align with other nearby polymorphic sites. These
interfering polymorphic sites may include the non-designated sites
as well as non-selected designated sites in the target
sequence.
[0078] In a multiplexed SSP reaction carried out in solution, the
partial overlap between designated probes directed to nearby
selected polymorphisms may lead to mutual competition between
probes for the same target. The present invention significantly
reduces this complication by way of probe immobilization.
[0079] As with multiplexed differential hybridization generally,
the mismatch in one or more positions between a designated probe
and target may affect the thermal stability of the hybridization
complex. That is, any set of annealing conditions applied to the
entire reaction mixture may produce varying degrees of annealing
between probe and target and may affect the outcome of the
subsequent probe extension reaction, thereby introducing
ambiguities in the assay which may require subsequent
resequencing.
[0080] Non-designated polymorphic sites located in immediate
proximity to the interrogation site near or at the 3' terminus of
the designated probe are particularly deleterious to the
effectiveness of the probe's TEI sequence in initiating the
extension reaction.
[0081] The power of currently available polymerase enzymes
catalyzing the extension reaction to discriminate between a match
and a mismatch in composition between the interrogation site within
the designated primer and the polymorphic site depends on the
displacement of the interrogation site from the primer's 3'
terminus, considering single nucleotide as well as multiple
nucleotide polymorphisms.
[0082] In a preferred embodiment yielding optimal discriminating
power, the interrogation site is provided at the probe's 3'
terminus. Given a probe sequence of length M designated for a
selected site s* in the representation P.sub.M(s*):={c.sub.P(m);
1.ltoreq.m.ltoreq.M}, the index m increasing in the primer's 5' to
3' direction, this configuration provides for alignment of the
designated site s* with position M in the probe sequence; in the
case of multiple nucleotide polymorphisms, positions M-1 (for a
dinucleotide polymorphism) and M-2 (for a trinucleotide
polymorphism), etc. also are implicated.
[0083] Under these circumstances as they are anticipated in the
multiplexed analysis of highly polymorphic loci, the advantage of
enhanced specificity afforded by the application of a
polymerase-catalyzed extension reaction is greatly diminished or
lost as a result of complications arising from "sub-optimal"
annealing conditions closely related to those limiting the
performance of SSO analysis.
[0084] In connection with the optimization of the design of
multiple probe sequences sharing the same interrogation site
composition for any given designated polymorphic site, it will be
useful to consider the concept of tolerance of interfering
polymorphisms. Considering without limitation of generality the
example of the single nucleotide polymorphism, a shift in alignment
of s* away from the 3' terminus to positions M-1, M-2, . . . , M-m*
leads to a gradually diminished discriminatory power. That is, when
the designated polymorphic site is aligned with an interior probe
position, m*, the extension reaction no longer discriminates
between match and mismatch. Conversely, in the preferred embodiment
of placing the interrogation site at the probe's 3' terminus, the
deleterious effect of nearby non-designated polymorphisms on the
effectiveness of the extension reaction likewise decreases with
distance from the 3' terminus. That is, non-designated
polymorphisms aligned with position between 1 and m* will not
affect the extension reaction.
[0085] The terminal sequence of length M-m*+1 within the probe is
herein referred to as the TEI sequence of a given primer. In
general, 1<m*<M, and the TEI sequence may comprise only small
number of terminal probe positions; in certain cases, m*=1, so that
the probe sequence encompasses the entire probe sequence.
[0086] The present invention accommodates the presence of
interfering polymorphic sites within the length of a designated
probe sequence by taking into account these known sequence
variations in the design of multiple probes. In particular, the
number of alternate probe sequence configurations to be provided
for given probe length M is significantly reduced as a result of
the existence of a TEI sequence of length M-m*+1. That is, in order
to ensure effective discriminatory power of the extension reaction,
it is sufficient to restrict the anticipatory alternate probe
sequence configurations to the length of the TEI sequence. In a
preferred embodiment, all possible alternative sequences are
anticipated so that one of these alternate probe sequences will
match the target in all of the positions m*, m*+1, . . . M-1,
M.
[0087] Providing, for each selected polymorphic site, a
multiplicity of designated probes with anticipatory sequences
increases the complexity of coding if all of these probes are
separately encoded by the unique association with coded solid phase
carriers. However, this complexity is reduced by placing this set
of probes on a common solid phase carrier. That is, only the
interrogation site composition of any designated probes is encoded,
a concept herein referred to as TEI sequence pooling or probe
pooling. Complete probe sequence pooling reduces the coding
complexity to that of the original design in which no anticipatory
probe sequences were provided. Partial pooling also is
possible.
[0088] In certain preferred embodiments, the polymerase used in
probe elongation is a DNA polymerase that lacks 3' to 5'
exonuclease activity. Examples of such polymerases include T7 DNA
polymerase, T4 DNA polymerase, ThermoSequenase and Taq polymerase.
When the target nucleic acid sequence is RNA, reverse transcriptase
may be used. In addition to polymerase, nucleoside triphosphates
are added, preferably all four bases. For example dNTPs, or
analogues, may be added. In certain other embodiments, ddNTPs may
be added. Labeled nucleotide analogues, such as Cye3-dUTP may also
be used to facilitate detection.
[0089] Prior art methods for detecting successful elongation have
been described which use labeled deoxy nucleoside triphosphates
(dNTPs) or dideoxy nucleoside triphosphates (ddNTPs). This
invention discloses novel methods of providing optical signatures
for detecting successful elongation, thus eliminating the need for
labeled dNTPs or ddNTPs. This is advantageous because currently
available polymerases are less efficient in accommodating labeled
dNTPs or ddNTPs.
[0090] This invention provides methods and compositions for
accurate polymorphism analysis of highly polymorphic target
regions. As used herein, highly polymorphic sequences are those
containing, within a portion of the sequence contacted by the
probe, not only the designated or interrogated polymorphic site,
but also non-designated polymorphic sites which represent a
potential source of error in the analysis. Analogous considerations
pertain to designs, compositions and methods of multiplexing PCR
reactions. In a preferred embodiment, covering sets of PCR probes
composed of priming and annealing subsequences are displayed on
encoded microparticles to produce bead-displayed amplicons by probe
elongation. Assemblies of beads may be formed on planar substrates,
prior to or subsequent to amplification to facilitate decoding and
imaging of probes.
[0091] In one embodiment, this invention provides probes that are
designed to contain a 3' terminal "priming" subsequence, also
referred to herein as a Terminal Elongation Initiation (TEI)
region, and an annealing subsequence, also referred to herein as a
Duplex Anchoring (DA) region. The TEI region typically comprises
the three or four 3' terminal positions of a probe sequence. The
TEI region is designed to align with a portion of the target
sequence at a designated polymorphic site so as to initiate the
polymerase-catalyzed elongation of the probe. Probe elongation
indicates a perfect match in composition of the entire TEI region
and the corresponding portion of the target sequence. The DA
region, comprising remaining positions within the probe sequence,
is preferably designed to align with a portion of the target
sequence in a region located close (within 3-5 bases) to the
designated polymorphism. The duplex anchoring region is designed to
ensure specific and strong annealing, and is not designed for
polymorphism analysis. As described herein, the DA and TEI regions
may be located immediately adjacent to one another within the probe
or may be linked by a molecular tether. The latter approach permits
flexibility in the placement of DA region so as to avoid
non-designated polymorphisms located immediately adjacent to the
designated site. The composition and length of the DA region are
chosen to facilitate the formation of a stable sequence-specific
hybridization complex ("duplex"), while accommodating (i.e., taking
into account) the presence of one or more non-designated
polymorphisms located in that region of the target. The length of
the annealing subsequence is chosen to minimize cross-hybridization
by minimizing sequence homologies between probe and non-selected
subsequences of the target. The length of the annealing subsequence
generally exceeds that of the priming subsequence so that failure
to form a duplex generally implies failure to produce an elongation
product.
[0092] The elongation reaction provides high specificity in
detecting polymorphisms located within the TEI region. For
non-designated polymorphisms in the DA region, the elongation
reaction will proceed at a level either comparable to, or lower
than that of the perfect match under certain conditions. This is
referred to as the tolerance effect of the elongation reaction.
Tolerance is utilized in the design of probes to analyze designated
and non-designated polymorphisms as described in examples
herein.
[0093] The density of polymorphic sites in the highly polymorphic
loci considered in certain embodiments of this invention makes it
likely that probes directed to designated polymorphic sites will
overlap adjacent polymorphic sites, when annealing to a target
subsequence proximal to the designated polymorphic site. That is,
an oligonucleotide probe designed to interrogate the configuration
of the target at a selected designated polymorphic site, and
constructed with sufficient length to ensure specificity and
thermal stability in annealing to the correct target subsequence
will align with nearby polymorphic sites. These interfering
polymorphic sites may include non-designated sites in the target
sequence as well as designated but not selected polymorphic
sites
[0094] Specifically, non-designated polymorphisms as contemplated
in the present invention may interfere with duplex formation,
thereby interfering with or completely inhibiting probe elongation.
In one embodiment, the present invention provides designs of
covering probe sets to accommodate such non-designated
polymorphisms. A covering probe set contains probes for
concurrently interrogating a given multiplicity of designated
polymorphic sites within a nucleic acid sequence. A covering probe
set comprises, for each site, at least one probe capable of
annealing to the target so as to permit, on the basis of a
subsequent elongation reaction, assignment of one of two possible
values to that site: "matched" (elongation) or "unmatched", (no
elongation).
[0095] The covering probe set associated with each designated site
may contain two or more probes differing in one or more positions,
also referred to herein as a degenerate set. In certain
embodiments, the probe sequence may contain universal nucleotides
capable of forming a base-pair with any of the nucleotides
encountered in DNA. In certain embodiments, probes may be attached
to encoded microparticles, and specifically, two or more of the
probes in a covering set or degenerate set may be attached to the
same type of microparticle. The process of attaching two or more
probes to a microparticle or bead is referred to as "probe
pooling".
[0096] The design of covering probe sets is described herein in
connection with elongation-mediated multiplexed analysis of
polymorphisms in two representative areas of genetic analysis: (1):
the scoring of multiple uncorrelated designated polymorphisms and
mutations, as in the case of mutation analysis for CF and Ashkenazi
Jewish (AJ) disease carrier screening, and (2) the scoring of a
correlated set of polymorphisms as in the case of HLA molecular
typing. In the first instance, the covering set for the entire
multiplicity of mutations contains multiple subsets, each subset
being associated with one designated site. In such a case, two or
more probes are provided to ascertain heterozygosity. For the
purpose of general SNP identification and confirmatory sequencing,
degenerate probe sets can be provided to contain up to four labeled
(e.g., bead-displayed) probes per polymorphic site. In the second
instance, the covering set contains subsets constructed to minimize
the number of probes in the set, as elaborated herein. The set of
designated probes is designed to identify allele-specific sequence
configurations on the basis of the elongation pattern.
[0097] While this method of accommodating or identifying
non-designated polymorphic sites is especially useful in connection
with the multiplexed elongation of sequence specific probes, it
also may be used in conjunction with single base extension of
probes, also known as mini-sequencing (see e.g., Pastinen, et al.
Genome Res. 7: 606-614 (1997), incorporated herein by
reference).
[0098] The elongation-mediated method of analysis of the present
invention, unlike the single-base probe extension method, may be
used to detect not only SNPs, but also to detect other types of
polymorphisms such as multiple (e.g., double, triple, etc.)
nucleotide polymorphisms, as well as insertions and deletions
commonly observed in the typing of highly polymorphic genetic loci
such as HLA. In these complex systems, sequence-specific probe
elongation in accordance with the methods of this invention,
simplifies the detection step because two or more probes are
provided for each polymorphic target location of interest and the
detection step is performed only to determine which of the two or
more probes was elongated, rather than to distinguish between two
extended probes, as in the case of single-base probe extension
Thus, although the methods of this invention accommodate the use of
multiple fluorophore or chromophore labels in the detection step, a
single universal label generally will suffice for the sequence
specific probe elongation. This is in contrast to single-base
extension methods whose application in a multiplexed format
requires at least two fluorophore or chromophore labels.
[0099] DNA methylation:
[0100] In certain embodiments, methods and compositions for
determining the methylation status of DNA are provided. Cytosine
methylation has long been recognized as an important factor in the
silencing of genes in mammalian cells. Cytosine methylation at
single CpG dinucleotides within the recognition sites of a number
of transcription factors is enough to block binding and related to
several diseases. eMAP can be used to determine the methylation
status of genomic DNA for diagnostic and other purposes. The DNA is
modified by sodium bisulfite treatment converting unmethylated
Cytosines to Uracil. Following removal of bisulfite and completion
of the chemical conversion, this modified DNA is used as a template
for PCR. A pair of probes is designed, one specific for DNA that
was originally methylated for the gene of interest, and one
specific for unmethylated DNA. eMAP is performed with DNA
polymerase and one labeled dNTP and unlabeled mixture of 3 dNTPs or
ddNTPs. The elongated product on the specific bead surface can
indicate the methylation status.
[0101] Selective Sequencing:
[0102] In certain other embodiments of this invention, selective
sequencing (also referred to as "sequencing") is used for
concurrent interrogation of an entire set of designated
polymorphisms within a nucleic acid sequence in order to determine
the composition at each such site. Selective sequencing can be used
to provide the requisite information to select, from the set of
possible configurations for the sequence of interest, the actual
configuration in a given specific sample or to narrow the set of
possible sequences in that sample. In selective sequencing, the
length of probes used in an extension reaction determine the length
of the sequences that can be determined. For longer DNA sequences,
staggered probe designs can be used to link the sequences together.
Thus, known sequence combinations can be confirmed, while unknown
sequence combinations can be identified as new alleles.
[0103] Cystic Fibrosis Carrier Screening--
[0104] One practical application of this invention involves the
analysis of a set of designated mutations within the context of a
large set of non-designated mutations and polymorphisms in the
Cystic Fibrosis Transmembrane Conductance (CFTR) gene. Each of the
designated mutations in the set is associated with the disease and
must be independently scored. In the simplest case of a point
mutation, two encoded probes are provided to ensure alignment of
their respective 3' termini with the designated site, with one
probe anticipating the wild-type, and the other anticipating the
altered ("mutated") target sequence.
[0105] However, to ensure elongation regardless of the specific
target sequence configuration encountered near the designated site,
additional probes are provided to match any of the possible or
likely configurations, as described in several Example herein. In a
preferred embodiment, the covering probe set is constructed to
contain probes displaying TEI sequences corresponding to all known
or likely variations of the corresponding target subsequence. This
ensures elongation in the presence of otherwise
elongation-inhibiting non-designated polymorphisms located within a
range of proximity of the designated site.
[0106] In certain embodiments, the identification of the specific
target configuration encountered in the non-designated sites is not
necessary so long as one of the sequences provided in the covering
probe set matches the target sequence sufficiently closely to
ensure elongation,and thus matches the target sequence exactly
within the TEI region. In this case, all or some of the covering
probes sharing the same 3' terminus may be assigned the same code
In a preferred embodiment, such probes may be associated with the
same solid support ("probe pooling"). Probe pooling reduces the
number of distinguishable solid supports required to represent the
requisite number of TEI sequences. In one particularly preferred
embodiment, solid supports are provided in the form of a set or
array of distinguishable microparticles which may be decoded
in-situ. Inclusion of additional probes in the covering probe set
to identify additional polymorphisms in the target region is a
useful method to elucidate haplotypes for various populations.
[0107] HLA--
[0108] Another application of this invention involves the genetic
analysis of the Human Leukocyte Antigen (HLA) complex, allowing the
identification of one or more alleles within regions of HLA
encoding class I HLA antigens (preferably HLA-A, HLA-B, HLA-C or
any combination thereof) and class II HLA antigens (preferably
including HLA-DR, HLA-DQ, HLA-DP or any combination thereof). Class
I and II gene loci also may be analyzed simultaneously.
[0109] In contrast to the independent scoring of multiple
uncorrelated designated mutations, identification of alleles (or
groups of alleles) relies on the scoring of an entire set of
elongation reactions. Each of these reactions involves one or more
probes directed to a member of a selected set of designated
polymorphic sites. The set of these elongation reactions produces a
characteristic elongation signal pattern. In a preferred
embodiment, a binary pattern is produced, assigning a value of "1"
to matching (and hence elongated) probes, and a value of "0" to
non-elongated probes. The binary pattern ("string") of given length
uniquely identifies an allele or a group of alleles.
[0110] The total number of probes required for HLA typing depends
on the desired resolution. The term "resolution" is used here to
indicate the degree of allelic discrimination. Preferably, the
method of this invention allows typing of an HLA allele that is
sufficient to distinguish different antigen groups. For example,
A*01 and A*03 are different antigen groups that have to be
distinguished in clinical applications. The National Marrow Donor
Program (NMDP) recommended a panel for molecular typing of the
donors. The low-to-medium resolution required by the NMDP panel
means that different antigen groups should be distinguished at all
times. Further, at least some of the alleles within one group
should be distinguished, though not necessarily all alleles. In
certain embodiments, the present invention allows typing of the HLA
allele to a low to medium resolution, as defined by the NMDP
standard (www.NMDPresearch.org), incorporated herein by
reference.
[0111] With such resolution, A*01, A*03 etc., will always be
identified. A*0101 and A*0102 may not be necessarily
distinguishable. For the SSO method, the current NMDP panel
contains 30 probes for HLA-A; 48 for HLA-B and 31 for HLA-DR-B.
High resolution HLA typing refers to the situation when most of the
alleles will be identified within each group. In this case, A*0101
and A*0102 will be distinguished. To reach such resolution,
approximately 500 to 1000 probes will be required for both class I
and class II typing. In certain embodiments, the method of the
present invention provides high resolution HLA typing, at least to
the degree described in Cao, et al., Rev. Immunogentics, 1: 177-208
(1999), incorporated herein by reference.
[0112] This invention also provides strategies for designating
sites and for designing probe sets for such designated sites in
order to produce unique allele assignments based on the elongation
reaction signal patterns. The design of covering probes explicitly
takes into account the distinct respective functions of TEI and DA
regions of each probe.
[0113] A covering set of probes associated with a given designated
site is constructed to contain subsets. Each subset in turn
contains probes displaying identical TEI regions. A mismatch in a
single position within the TEI region, or a mismatch in three or
more positions within the DA region precludes elongation.
Accordingly, the elongation of two probes displaying such
differences in composition generally will produce distinct
elongation patterns. All such probes can be multiplexed in a
parallel elongation reaction as long as they are individually
encoded. In a preferred embodiment, encoding is accomplished by
attaching probes to color-encoded beads.
[0114] Probes displaying identical TEI subsequences and displaying
DA subsequences differing in not more than two positions generally
will produce elongation reactions at a yield (and hence signal
intensity) either comparable to, or lower than that of a perfect
match. In the first case which indicates tolerance of the mismatch,
the set of alleles matched by the probe in question will be
expanded to include alleles that display the tolerated mismatched
sequence configurations within the DA region. In the second case,
indicating only partial tolerance, three approaches are described
herein to further elucidate the allele matching pattern. In the
first approach, probes displaying one or two nucleotide
polymorphisms in their respective DA regions are included in the
covering set. Information regarding the target sequence is obtained
by quantitatively comparing the signal intensities produced by the
different probes within the covering set. In the second approach,
probes comprising separate TEI and DA regions joined by a tether
are used to place the DA region farther away from the TEI region in
order to avoid target polymorphisms. In the third approach, probes
are optionally pooled in such cases offering only a modest
expansion of the set of matched alleles.
[0115] In certain embodiments of this invention probes preferably
are designed to be complementary to certain target sequences that
are known to correlate with allele combinations within the HLA gene
locus. Known polymorphisms are those that have appeared in the
literature or are available from a searchable database of sequences
(e.g., www.NMDProcessing.org). In certain embodiments, the HLA gene
of interest belongs to HLA class I group, (e.g., HLA-A, HLA-B or
HLA-C or combination thereof). In certain other embodiments, the
HLA gene of interest belongs to the HLA class II group, (e.g., DR,
DQ, DP or combination thereof). The HLA class I and class II loci
may be examined in combination and by way of concurrent
interrogation.
[0116] Probes previously employed in the SSP/gel method also may be
used in this invention. Preferably, the probes set forth in Bunce
et al., Tissue Antigen, 46: 355-367 (1995) and/or Bunce et al.,
Tissue Antigen, 45:81-90 (1995), (each of which are hereby
incorporated by reference) are used in preparing the probes for
this invention. The probe sequences or HLA sequence information
provided in WO 00/65088; European Application No. 98111696.5; WO
00/70006; and Erlich et al., Immunity, 14: 347-356 (2001), (each of
which are hereby incorporated by reference) may be used in
designing the probes for this invention.
[0117] The complexity of an encoded bead array is readily adjusted
to accommodate the requisite typing resolution. For example, when
32 types of beads are used for each of four distinct subarrays, a
total of 128 probes will be available to attain a medium level of
resolution for HLA class I and class II typing in a multiplexed
elongation reaction. Analogously, with 128 types of beads and four
subarrays, or 64 types of beads and 8 subarrays, a total of 512
probes will be available to attain a high resolution of HLA class I
and class II typing in a multiplexed elongation reaction.
[0118] The encoded bead array format is compatible with high
throughput analysis. For example, certain embodiments of this
invention provide a carrier that accommodates multiple samples in a
format that is compatible with the dimensions of 96-well
microplates, so that sample distribution may be handled by a
standard robotic fluid handling apparatus. This format can
accommodate multiple encoded bead arrays mounted on chips and
permits the simultaneous completion of multiple typing reactions
for each of multiple patient samples on a single multi-chip carrier
in a 96-well carrier testing 128 types per patient, more than
10,000 genotypes can be determined at a rate of throughput that is
not attainable by current SSP or SSO methodology.
[0119] In certain embodiments of this invention, the elongation
reaction can be combined with a subsequent hybridization reaction
to correlate subsequences on the same DNA target strand, a
capability referred to herein as "phasing". Phasing resolves
ambiguities in allele assignment arising from the possibility that
a given elongation pattern is generated by different combinations
of alleles. Similarly, phasing is useful in the context of
haplotying to assign polymorphisms to the same DNA strand or
chromosome.
[0120] In certain embodiments of this invention, the annealing and
elongation steps of the elongation reaction can be combined as a
one-step reaction. Furthermore, means to create continuous or
discrete temperature variations can be incorporated into the system
to accommodate multiple optimal conditions for probes with
different melting temperatures in a multiplexed reaction.
[0121] In certain embodiments of this invention, encoded bead
arrays are formed on solid substrates. These solid substrates may
comprise any suitable solid material, such as glass or
semiconductor, that has sufficient mechanical strength and can be
subjected to fabrication steps, if desired. In some embodiments,
the solid substrates are divided into discrete units known as
"chips". Chips comprising encoded bead arrays may be processed
individually or in groups, if they are loaded into a multichip
carrier. For example, standard methods of temperature control are
readily applied to set the operating temperature of, or to apply a
preprogramed sequence of temperature changes to, single chips or to
multichip carriers. Further, chips may be analyzed with the direct
imaging capability of Random Encoded Array Detection ("READ"), as
disclosed in PCT/US01/20179, the contents of which are incorporated
herein by reference. Using READ, the multiplexed analysis of entire
arrays of encoded beads on chips is possible. Furthermore, in the
READ format, the application of preprogrammed temperature cycles
provides real-time on-chip amplification of elongation products.
Given genomic, mitochondrial or other DNA, linear on-chip
amplification may obviate the need for pre-assay DNA amplification
such as PCR, thereby dramatically shortening the time required to
complete the entire typing assay. Time-sensitive applications such
as cadaver typing are therefore possible. More importantly, this
approach eliminates the complexities of PCR multiplexing, which is
a limiting step in many genetic screening and polymorphism
analyses. In a preferred embodiment, a fluidic cartridge provides
for sample and reagent injection as well as temperature
control.
[0122] In one embodiment, the invention provides a method for
polymorphism analysis in which each target nucleic acid sequence is
used as a template in multiple elongation reactions by applying one
or more "annealing-extending-detecting-denaturing" temperature
cycles. This method achieves linear amplification with in-situ
detection of the elongation products. This additional capability
obviates the need for a first step of sequence-specific
amplification of a polynucleotide sample Integration of assay
procedure and signal amplification by way of cycling not only
simplifies and accelerates the completion of genetic analysis, but
also eliminates the need to develop, test and implement multiplexed
PCR procedures. The methods of this invention also provide a
high-throughput format for the simultaneous genetic analysis of
multiple patient samples.
[0123] Several embodiments of this invention are provided for the
multiplexed elongation of sequence-specific probes to permit
simultaneous evaluation of a number of different targets. In
certain embodiments, oligonucleotide probes are immobilized on a
solid support to create dense patterns of probes on a single
surface, e.g., silicon or glass surface. In certain embodiments,
presynthesized oligonucleotide probes are immobilized on a solid
support, examples of which include silicon, chemically modified
silicon, glass, chemically modified glass or plastic. These solid
supports may be in the form of microscopic beads. The resolution of
the oligonucleotide array is determined by both spatial resolution
of the delivery system and the physical space requirements of the
delivered nucleotide solution volume. [See Guo, et al., Nucleic
Acids Res. 22: 5456-5465 (1994); Fahy, et al., Nucleic Acid Res.
21: 1819-1826 (1993); Wolf, et al., Nuc. Acids Res. 15: 2911-2926
(1987); and Ghosh, et al., Nuc. Acids Res. 15: 5353-5372
(1987).]
[0124] This invention provides methods for multiplexed assays. In
certain embodiments, sets of elongation probes are immobilized on a
solid phase in a way that preserves their identity, e.g., by
spatially separating different probes and/or by chemically encoding
the probe identities. One or more solution-borne targets are then
allowed to contact a multiplicity of immobilized probes in the
annealing and elongation reactions. This spatial separation of
probes from one another by immobilization reduces ambiguities in
identifying elongation products. Thus, this invention offers
advantages over the existing PCR-SSP method, which is not adaptable
to a high throughput format because of (i) its requirement for two
probes for each PCR amplification; (ii) the competition between
overlapping probes for the highly polymorphic genes, such as HLA,
in a multiplexed homogeneous reaction; and (iii) the difficulty in
distinguishing between specific products in such a multiplexed
reaction.
[0125] In a preferred embodiment, probes are attached, via their
respective 5' termini, to encoded microparticles ("beads") having a
chemically or physically distinguishable characteristic that
uniquely identifies the attached probe. Probes capture target
sequences of interest contained in a solution that contacts the
beads. Elongation of the probe displayed on a particular bead
produces an optically detectable signature or a chemical signature
that may be converted into an optically detectable signature. In a
multiplexed elongation reaction, the optical signature of each
participating bead uniquely corresponds to the probe displayed on
that bead. Subsequent to the probe elongation step, one may
determine the identity of the probes by way of particle
identification and detection, e.g., by flow cytometry.
[0126] In certain embodiments, beads may be arranged in a planar
array on a substrate before the elongation step. Beads also may be
assembled on a planar substrate to facilitate imaging after the
elongation step. The process and system described herein provide a
high throughput assay format permitting the instant imaging of an
entire array of beads and the simultaneous genetic analysis of
multiple patient samples.
[0127] The array of beads may be a random encoded array, in which a
chemically or physically distinguishable characteristic of the
beads within the array indicates the identity of oligonucleotide
probes attached to the beads. The array may be formed according to
the READ format The bead array may be prepared by employing
separate batch processes to produce application-specific substrates
(e.g., a chip at the wafer scale). Beads that are encoded and
attached to oligonucleotide probes (e.g., at the scale of about
10.sup.8 beads/100 .mu.l suspension) are combined with a substrate
(e.g., silicon chip) and assembled to form dense arrays on a
designated area of the substrate. In certain embodiments, the bead
array contains 4000 beads of 3.2 .mu.m diameter and has a dimension
of 300 .mu.m by 300 .mu.m. With beads of different size, the
density will vary. Multiple bead arrays also can be formed
simultaneously in discrete fluid compartments maintained on the
same chip. Such methods are disclosed in U.S. application Ser. No.
10/192,351, filed Jul. 9, 2002, which is incorporated herein by
reference in its entirety.
[0128] Bead arrays may be formed by the methods collectively
referred to as "LEAPS", as described in U.S. Pat. No. 6,251,691 and
PCT International Application No. PCT/US00/25466),both of which are
incorporated herein by reference.
[0129] The substrate (e.g., a chip) used in this invention may be
in the form of a planar electrode patterned in accordance with the
interfacial patterning methods of LEAPS. For example, the substrate
may be patterned with oxide or other dielectric materials to create
a desired configuration of impedance gradients in the presence of
an applied AC electric field. Patterns may be designed so as to
produce a desired configuration of AC field-induced fluid flow and
corresponding particle transport. Substrates may be patterned on a
wafer scale by using semiconductor processing technology. In
addition, substrates may be compartmentalized by depositing a thin
film of a UV-patternable, optically transparent polymer to affix to
the substrate a desired layout of fluidic conduits and
compartments. These conduits and compartments confine fluid in one
or several discrete compartments, thereby accommodating multiple
samples on a given substrate.
[0130] Bead arrays may be prepared using LEAPS by providing a first
planar electrode that is in substantially parallel to a second
planar electrode ("sandwich" configuration) with the two electrodes
being separated by a gap and containing a polarizable liquid
medium, such as an electrolyte solution. The surface or the
interior of the second planar electrode may be patterned with the
interfacial patterning method. The beads are introduced into the
gap. When an AC voltage is applied to the gap, the beads form a
random encoded array on the second electrode (e.g., a "chip").
[0131] In another embodiment of LEAPS, an array of beads may be
formed on a light-sensitive electrode (e.g., a "chip"). Preferably,
the sandwich configuration described above is also used with a
planar light sensitive electrode and another planar electrode. Once
again, the two electrodes are separated by the a gap and contain an
electrolyte solution. The functionalized and encoded beads are
introduced into the gap. Upon application of an AC voltage in
combination with light, the beads form an array on the
light-sensitive electrode.
[0132] In certain embodiments of the present invention, beads may
be associated with a chemically or physically distinguishable
characteristic. This may be provided, for example, by staining
beads with sets of optically distinguishable tags, such as those
containing one or more fluorophore or chromophore dyes spectrally
distinguishable by excitation wavelength, emission wavelength,
excited-state lifetime or emission intensity. The optically
distinguishable tags may be used to stain beads in specified
ratios, as disclosed, for example, in Fulwyler, U.S. Pat. No.
4,717,655 (Jan. 5, 1988). Staining may also be accomplished by
swelling of particles in accordance with methods known to those
skilled in the art, (Molday, Dreyer, Rembaum & Yen, J. Mol Biol
64, 75-88 (1975); L. Bangs, "Uniform latex Particles, Seragen
Diagnostics, 1984). For example, up to twelve types of beads were
encoded by swelling and bulk staining with two colors, each
individually in four intensity levels, and mixed in four nominal
molar ratios. Alternatively, the methods of combinatorial color
encoding described in International Application No. PCT/US 98/10719
(incorporated by reference in its entirety) can be used to endow
the bead arrays with optically distinguishable tags. In addition to
chemical encoding, beads may also be rendered magnetic by the
processes described in PCT/US0/20179.
[0133] In addition to chemical encoding with dyes, beads having
certain oligonucleotide primers may be spatially separated
("spatial encoding"), such that the location of the beads provides
information as to the identity of the beads. Spatial encoding, for
example, can be accomplished within a single fluid phase in the
course of array assembly by using Light-controlled Electro kinetic
Assembly of Particles near Surfaces (LEAPS). LEAPS can be used to
assemble planar bead arrays in any desired configuration in
response to alternating electric fields and/or in accordance with
patterns of light projected onto the substrate.
[0134] LEAPS can be used to create lateral gradients in the
impedance at the interface between a silicon chip and a solution to
modulate the electrohydrodynamic forces that mediate array
assembly. Electrical requirements are modest: low AC voltages of
typically less than 10V.sub.pp are applied across a fluid gap
between two planar electrodes that is typically 100 .mu.m. This
assembly process is rapid and it is optically programmable: arrays
containing thousands of beads are formed within seconds under an
applied electric field. The formation of multiple subarrays can
also occur in multiple fluid phases maintained on a
compartmentalized chip surface.
[0135] Subsequent to the formation of an array, the array may be
immobilized. For example, the bead arrays may be immobilized, for
example, by application of a DC voltage to produce random encoded
arrays. The DC voltage, set to typically 5-7 V (for beads in the
range of 2-6 .mu.m and for a gap size of 100-150 .mu.m) and applied
for <30 s in "reverse bias" configuration so that an n-doped
silicon substrate would form the anode, causes the array to be
compressed to an extent facilitating contact between adjacent beads
within the array and simultaneously causes beads to be moved toward
the region of high electric field in immediate proximity of the
electrode surface. Once in sufficiently close proximity, beads are
anchored by van der Waals forces mediating physical adsorption.
This adsorption process is facilitated by providing on the bead
surface a population of "tethers" extending from the bead surface;
polylysine and streptavidin have been used for this purpose.
[0136] In certain embodiments, the particle arrays may be
immobilized by chemical means, e.g, by forming a composite
gel-particle film. In one exemplary method for forming such
gel-composite particle films, a suspension of microparticles is
provided which also contains monomer, crosslinker and initiator for
in-situ gel formation. The particles are assembled into a planar
assembly on a substrate by using LEAPS. AC voltages of 1-20
V.sub.p-p in a frequency range from 100's of hertz to several
kilohertz are applied between the electrodes across the fluid gap.
In the presence of the applied AC voltage, polymerization of the
fluid phase is triggered after array assembly by thermally heating
the cell to .about.40-45.degree. C. using an infra-red (IR) lamp or
photoinitiating the reaction using a mercury lamp source. The
resultant gel effectively entraps the particle array. Gels may be
composed of a mixture of acrylamide and bisacrylamide of varying
monomer concentrations from 20% to 5%
(acrylamide:bisacrylamide=37.5:1, molar ratio), but any other low
viscosity water soluble monomer or monomer mixture may be used as
well. Chemically immobilized functionalized microparticle arrays
prepared by this process may be used for a variety of bioassays,
e.g., ligand receptor binding assays.
[0137] In one example, thermal hydrogels are formed using
azodiisobutyramidine dihydrochloride as a thermal initiator at a
low concentration to ensure that the overall ionic strength of the
polymerization mixture falls in the range of .about.0.1 mM to 1.0
mM. The initiator used for the UV polymerization is Irgacure
2959.RTM. (2-Hydroxy-4'-hydroxyethoxy-2-methylpropiophenone, Ciba
Geigy, Tarrytown, N.Y.). The initiator is added to the monomer to
give a 1.5% by weight solution.
[0138] In certain embodiments, the particle arrays may be
immobilized by mechanical means. For example, an array of
microwells may be produced by standard semiconductor processing
methods in the low impedance regions of a silicon substrate.
Particle arrays may be formed using such structures. In certain
embodiments LEAPS mediated hydrodynamic and ponderomotive forces
are utilized to transport and to accumulate particles on the hole
arrays. The AC field is then switched off and particles are trapped
into microwells and thus mechanically confined. Excess beads are
removed leaving behind a spatially ordered random bead array on the
substrate surface.
[0139] Substrates (e.g., chips) can be placed in one or more
enclosed compartments that permit samples and reagents to be
transported in and out of the compartments through fluidic
interconnection. Reactions can also be performed in an open
compartment format such as a microtiter plate. Reagents may be
pipetted on top of the chip by robotic liquid handling equipment,
and multiple samples may be processed simultaneously. Such a format
accommodates standard sample processing and liquid handling for the
existing microtiter plate format and integrates sample processing
and array detection.
[0140] In certain embodiments of this invention, encoded beads are
assembled on the substrate surface, but not in an array. For
example, by spotting bead suspensions into multiple regions of the
substrate and allowing beads to settle under gravity, assemblies of
beads can be formed on the substrate. In contrast to the bead
arrays formed by LEAPS, these assemblies generally assume
disordered configurations of low-density or non-planar
configurations involving stacking or clumping of beads, thereby
preventing imaging of affected beads. However, the combination of
spatial and color encoding attained by spotting mixtures of
chemically encoded beads into a multiplicity of discrete positions
on the substrate still allows multiplexing.
[0141] In certain embodiments, a comparison of an image of an array
after the assay with a decoded image of the array can be used to
reveal chemically or physically distinguishable characteristics, as
well as the elongation of probes. This comparison can be achieved
by using, for example, an optical microscope with an imaging
detector and computerized image capture and analysis equipment. The
assay image of the array is taken to detect the optical signature
that indicates the probe elongation. The decoded image is taken to
determine the chemically and/or physically distinguishable
characteristics that uniquely identify the probe displayed on the
bead surface. In this way, the identity of the probe on each
particle in the array may be identified by a distinguishable
characteristic.
[0142] Image analysis algorithms may be used in analyzing the data
obtained from the decoding and the assay images. These algorithms
may be used to obtain quantitative data for each bead within an
array. The analysis software automatically locates bead centers
using a bright-field image of the array as a template, groups beads
according to type, assigns quantitative intensities to individual
beads, rejects "blemishes" such as those produced by "matrix"
materials of irregular shape in serum samples, analyzes background
intensity statistics and evaluates the background-corrected mean
intensities for all bead types along with the corresponding
variances. Examples of such algorithms are set forth in
PCT/US01/20179.
[0143] Probe elongation may be indicated by a change in the optical
signature, or a change in chemical signature which may be converted
to a change in optical signature, originating from the beads
displaying elongated probes, for example. Direct and indirect
labeling methods well known in the art are available for this
purpose. Direct labeling refers to a change in optical signature
resulting from the elongation; indirect labeling refers to a change
introduced by elongation which requires one or more additional
steps to produce a detectable optical signature. In certain
embodiments, fluorophore or chromophore dyes may be attached to one
of the nucleotides added as an ingredient of probe elongation, such
that probe elongation changes the optical signature of beads by
changing, for example, fluorescence intensities or by providing
other changes in the optical signatures of beads displaying
elongation products.
EXAMPLES
[0144] The present invention will be better understood from the
Examples which follow. It should be understood that these examples
are for illustrative purposes and are not to be construed as
limiting this invention in any manner.
Example 1
Staggered Probe Design for Multiplexed SSP Analysis
[0145] Probes for each polymorphism are immobilized on a solid
phase carrier to provide a format in which multiple concurrent
annealing and extension reactions can proceed with minimal mutual
interference. Specifically, this method provides a design which
accommodates overlapping probes, as illustrated in FIG. 1. In this
example, we consider three alleles: allele A, allele B and allele
C. Probes 1 and 2 detect SNPs that are aligned with their
respective 3' termini while probes 3 and 4 detect two-nucleotide
polymorphisms that are aligned with their respective 3' termini.
The polymorphic sites targeted by probes 1 and 2 are located five
nucleotides upstream of those targeted by probes 3 and 4. This
design permits each probe to bind its corresponding target and
permits elongation to proceed when there is a perfect match at the
designated polymorphic site. Thus, probes 1 and 3 match allele A,
probe 2 and possibly probe 3 match allele B, and probes 1 and 4
match allele C
Example 2
Probe Design for HLA Typing
[0146] To design probes for the analysis of the polymorphic region
ranging from base 106 to base 125 of the DRB gene, twenty-two
different types of sequences for the 20 base long fragment were
located in the DRB database. These are listed in the table
below:
1 7 DRB1*0101 TTCTTGTGGCAGCTTAAGTT 104 DRB1*03011
TTCTTGGAGTACTCTACGTC 26 DRB1*04011 TTCTTGGAGCAGGTTAAACA 1 DRB1*0434
TTCTTGGAGCAGGTTAAACC 3 DRB1*07011 TTCCTGTGGCAGGGTAAGTA 1 DRB1*07012
TTCCTGTGGCAGGGTAAATA 28 DRB1*0801 TTCTTGGAGTACTCTACGGG 1 DRB1*0814
TTCTTGGAGTACTCTAGGGG 1 DRB1*0820 TTCTTGGAGTACTCTACGGC 1 DRB1*0821
TTCTTGGAGTACTCTATGGG 1 DRB1*09012 TTCTTGAAGCAGGATAAGTT 2 DRB1*10011
TTCTTGGAGGAGGTTAAGTT 1 DRB1*1122 TTCTTGGAGCAGGCTACACA 1 DRB1*1130
TTCTTGGAGTTCCTTAAGTC 18 DRB1*15011 TTCCTGTGGCAGCCTAAGAG 9
DRB3*01011 TTCTTGGAGCTGCGTAAGTC 1 DRB3*0102 TTCTTGGAGCTGTGTAAGTC 1
DRB3*0104 TTCTCGGAGCTGCGTAAGTC 16 DRB3*0201 TTCTTGGAGCTGCTTAAGTC 1
DRB3*0212 TTCTTGCAGCTGCTTAAGTC 6 DRB4*01011 TTCTTGGAGCAGGCTAAGTG 14
DRB5*01011 TTCTTGCAGCAGGATAAGTA
[0147] The first column contains the number of alleles sharing the
sequence listed in third column, the second column contains one of
the allele names. We selected the last three bases of the 20-base
fragment as the TEI region and sorted the set of sequences
according to their TEI region to obtain the following groups:
2 1 104 DRB1*03011 TTCTTGGAGTACTCTACGTC e1 1 DRB1*1130
TTCTTGGAGTgCctTAaGTC 9 DRB3*01011 TTCTTGGAGctgcgTAaGTC 1 DRB3*0102
TTCTTGGAGctgTgTAaGTC 1 DRB3*0104 TTCTcGGAGctgcgTAaGTC 16 DRB3*0201
TTCTTGGAGctgctTAaGTC e2 1 DRB3*0212 TTCTTGcAGctgctTAaGTC 2 7
DRB1*0101 TTCTTGTGGCAGCTTAAGTT 1 DRB1*09012 TTCTTGaaGCAGgaTAAGTT 2
DRB1*10011 TTCTTGgaGGAGgTTAAGTT 3 26 DRB1*04011
TTCTTGGAGCAGGTTAAACA 1 DRB1*1122 TTCTTGGAGCAGGcTAcACA 4 1 DRB1*0434
TTCTTGGAGCAGGTTAAACC 5 3 DRB1*07011 TTCCTGTGGCAGGGTAAGTA 14
DRB5*01011 TTCtTGcaGCAGGaTAAGTA 6 1 DRB1*07012 TTCCTGTGGCAGGGTAAATA
7 28 DRB1*0801 TTCTTGGAGTACTCTACGGG e3 1 DRB1*0814
TTCTTGGAGTACTCTAgGGG 1 DRB1*0821 TTCTTGGAGTACTCTAtGGG 8 1 DRB1*0820
TTCTTGGAGTACTCTACGGC 9 18 DRB1*15011 TTCCTGTGGCAGCCTAAGAG 10 6
DRB4*01011 TTCTTGGAGCAGGCTAAGTG
[0148] For sequences in the same group, variations between the
first sequence of the group and the rest are indicated in lower
case. Three probe sequences are used to illustrate the application
of our probe design rules. The first sequence in the first group is
selected as probe e1; the 6th sequence in the first group is
selected as probe e2; and the first group in the 7th sequence is
selected as probe e3.
[0149] Due to requirement for perfect complementarity of the target
and the probe's TEI region, sequences in group to group 10 do not
produce elongation products for e1 and e2. Similarly, sequences in
groups other than the 7th group do not produce elongation products
for e3. Each group is distinctive from the others with respect to
elongation reaction patterns.
[0150] For sequences in the same group, there are two types of
situations. For example, e1 and e2 differ by one nucleotide in 6
positions within the annealing region. Thus, targets matching e1
and e2 will not produce elongation products for the other
sequences, and e1 and e2 are also distinct probes.
[0151] Similarly, targets for the second to the 7th sequences in
group 1 will not produce elongation products for probe e1.
[0152] Except for the target matching e1, the remaining 5 sequences
only differ from e2 by one or two nucleotides as indicated
below:
3 1,2................M 16 DRB3*0201 TTCTTGGAGCTGCTTAAGTC e2 1
DRB1*1130 TTCTTGGAGtTcCTTAAGTC a 9 DRB3*01011 TTCTTGGAGCTGCgTAAGTC
b 1 DRB3*0102 TTCTTGGAGCTGtgTAAGTC c 1 DRB3*0104
TTCTcGGAGCTGCgTAAGTC d 1 DRB3*0212 TTCTTGcAGCTGCTTAAGTC e
[0153] These sequences are cross-reactive. When targets for
sequences b and e, which differ from e2 by one base at respective
positions M-7 and M-14 anneal to probe e2, the non-designated
poylmorphism(s) in the annealing region will be tolerated and the
elongation reaction will proceed to substantially the same degree
as for perfectly matched sequences. When targets for sequences a,
c, and d, which differ from e2 by two nucleotides anneal to probe
e2, the elongation reaction will exhibit only partial tolerance of
the non-designated polymoprhism(s). One approach to improve on this
situation is to provide separate probes for a, c, and d, then
quantitatively analyze the yield of elongation products by
analyzing signals intensitities to identify the correct sequences.
An alternative would be to bridge the non-designated polymorphisms
in the annealing region altogether by adding a physical linker
(e.g., a tether) to the e2 probe to be able to separate annealing
and TEI regions
[0154] For the sequences in the 7th group, the other two sequences
will be partially tolerated by the e3 probe. These three sequences
may be pooled. The e2 probe will yield elongation products for 30
alleles instead of 28 alleles.
Example 3
Utilizing Mismatch Tolerance to Modify Allele Binding Patterns
[0155] Probe DR-13e, GGACATCCTGGAAGACGA, was used to target the
bases 281-299 of the DRB gene. Thirty-four alleles, including
allele DRB1*0103, are perfectly matched to this sequence. Thus, in
the binding pattern, 13e is positive for theses 34 alleles (that
is, 13e will yield elongation products with these 34 alleles).
Several additional alleles display the same TEI region but display
non-designated polymorphisms in their respective annealing regions.
For example, five alleles, such as DRB1*0415, contain T in instead
of A in position 4 while four alleles, such as DRB1*1136,contain C
in the that position. Due to mismatch tolerance in the annealing
region, target sequences complementary to these nine alleles will
produce elongation reaction patterns similar to that of the
perfectly matched sequence. The result is shown in FIG. 2. TO-3 and
TO-4 are completely complementary sequences to allele *0415 and
*1136, respectively.
4 DRB1*0103 GACATCCTGGAAGACGA 34 alleles DRB1*0415
GACTTCCTGGAAGACGA 5 alleles DRB1*1136 GACCTCCTGGAAGACGA 4
alleles
Example 4
Design of Linker Structure in the Probes to Bridge Non-Designated
Polymorphisms
[0156] As illustrated in FIG. 3, an anchor sequence is derived from
conserved sequence regions to ensure specific and strong annealing.
It is not designed for polymorphism detection. For that purpose, a
shorter sequence for polymorphism detection is attached to the
anchoring sequence by way of a neutral chemical linker. The shorter
length of the sequence designed for polymorphism detection will
limit potential interference to non-designated polymorphisms in the
immediate vicinity of the designated site and thus decreases the
number of possible sequence combinations required to accommodate
such interfering polymorphisms This approach avoids highly dense
polymorphic sites in certain situations. For example, it would be
possible to distinguish between the sequences listed in Example 3
using a probe which takes into account the additional
polymorphism(s). Illustrative designs of the linker and the
sequences are listed below:
5 linker AGCCAGAAGGAC/Spacer 18/spacer 18/GGAAGACGA 13-5 linker
AGCCAGAAGGAC/Spacer 18/spacer 18/AGACGA 13-8 linker
AGCCAGAAGGAC/Spacer 18/spacer 18/CGA 13-11
Example 5
Phasing
[0157] The present invention also is useful in reducing ambiguities
that arise when two or more allele combinations can produce the
same reaction pattern. In a simulated situation shown in FIGS. 4
and 5, allele A which matches--and hence produces an elongation
product with--Probe 1 and Probe 3, and allele B, which matches
Probe 2 and Probe 4 when present in the same multiplexed reaction,
generate the same total reaction pattern as does the combination of
allele C which matches Probe 1 and 2, and allele D which matches
Probe 3 and and Probe 4. Such ambiguity can be reduced or
eliminiated by using the detection methods provided in this
invention to analyze the elongation product of Probe 1 by
hybridization using a labeled detection probe that is designed to
target the same polymorphic site as Probe 3. If the result of the
analysis is positive, only one allele combination, namely
combination 1, is possible because Probe 1 and Probe 3 are
associated with the same allele. The detection probe can be labeled
by using any of the methods disclosed in this invention or methods
known in the art. If this identification detection step is
performed together with the multiplexed elongation reaction
detection, different labels are used for the elongation detection
and probe hybridization detection as shown in the FIG. 5.
[0158] In this method, the ambiguity is resolved by assigning two
or more polymorphisms to the same "phase" using elongation in
conjunction with hybridization. Phasing is rapidly emerging as an
important concern for haplotype analysis in other genetic studies
designed in the art. More probes can be included by reacting them
with the target sequentially, or they can be arranged in the same
reaction with different labels for detection.
[0159] The capability of combining probe elongation and
hybridization reactions is demonstrated in experiments using a
sample sequence from HLA-B exon 3. The result is shown in FIG. 6. A
probe SB3P was elongated in the reaction and the elongated product
was detected using a labeled DNA probe. For the two samples
presented in FIGS. 6A and 6B, SB 127r and SB3P, and SB285r and SB3P
are in the same phase, respectively.
Example 6
Model HLA Typing Reaction Using Random Encoded Probe Arrays
[0160] To illustrate the discrimination of polymorphisms, a model
reaction was performed using a synthetic single strand as the
target. Color encoded, tosyl-functionalized beads of 3.2 .mu.m
diameter were used as solid phase carriers. A set of 32
distinguishable color codes was generated by staining particles
using standard methods known in the art (Bangs. L. B., "Uniform
Latex Particles", Seragen Diagnostics Inc., p.40) and using
different combinations of blue dye (absorption/emission 419/466 nm)
and green dye (absorption/emission 504/511). Stained beads were
functionalized with Neutravidin (Pierce, Rockford, Ill.), a biotin
binding protein, to mediate immobilization of biotinylated probes.
In a typical small-scale coupling reaction, 200 .mu.l of suspension
containing 1% beads were washed three times with 500 .mu.l of 100
mM phosphate buffer/pH 7.4 (buffer A) and resuspended in 500 .mu.l
of that buffer. After applying 20 .mu.l of 5 mg/ml neutravidin to
the bead suspension, the reaction was sealed and allowed to proceed
overnight at 37.degree. C. Coupled beads were then washed once with
500 .mu.l of PBS/pH 7.4 with 10 mg/ml BSA (buffer B), resuspended
in 500 .mu.l of that buffer and reacted for 1 hour at 37.degree. C.
to block unreacted sites on bead surface. After blocking, beads
were washed three times with buffer B and stored in 200 .mu.l of
that buffer.
[0161] In the model reaction system, two pairs of probes were
synthesized to contain SNPs at their respective 3' termini. The
respective sequences were as follows:
6 SSP13: AAGGACATCCTGGAAGACG; SSP24: AAGGACATCCTGGAAGACA; SSP16:
ATAACCAGGAGGAGTTCC SSP36: ATAACCAGGAGGAGTTCG.
[0162] The probes were biotinylated at the 5' end; a 15-carbon
triethylene glycol linker was inserted between biotin and the
oligonucleotide to minimize disruptive effects of the surface
immobilization on the subsequent reactions. For each probe,
coupling to encoded beads was performed using 50 .mu.l of bead
suspension. Beads were washed once with 500 .mu.l of 20 mM Tris/pH
7.4, 0.5M NaCl (buffer C) and resuspended in 300 .mu.l of that
buffer. 2.5 .mu.l of a 100 .mu.M solution of probe were added to
the bead suspension and allowed to react for 30 min at room
temperature. Beads were then washed three times with 20 mM
Tris/pH7.4, 150 mM NaCl, 0.01% triton and stored in 20 mM Tris/pH
7.4, 150 mM NaCl.
[0163] The following synthetic targets of 33 bases in length were
provided:
7 TA16: GTCGAAGCGCAGGAACTCCTCCTGGTTATGGAA TA36:
GTCGAAGCGCACGAACTCCTCCTGGTTATAGAA TA13:
GGCCCGCTCGTCTTCCAGGATGTCCTTCTGGCT TA24:
GGCCCGCTTGTCTTCCAGGATGTCCTTCTGGCT
[0164] Targets were allowed to react with four probes (SSP13,
SSP24, SSP16, SSP36) on the chip. An aliquot of 10 .mu.l of a 100
nM solution of the target in annealing buffer of 0.2 M NaCl, 0.1%
Triton X-100, 10 mM Tris/pH 8.0, 0.1 mM EDTA was applied to the
chip and allowed to react for 15 min at 30 .degree. C. The chip was
then washed once with the same buffer and was then covered with an
extension reaction mixture including: 100 nM of TAMRA-ddCTP
(absorption/emission: 550/580) (Perkin Elmer Bioscience, Boston,
Mass.), 10 .mu.M dATP-dGTP-dTTP, ThermoSequenase (Amersham,
Piscataway, N.J.) in the associated buffer supplied by the
manufacturer. The reaction was allowed to proceed for 5 min at
60.degree. C., and the chip was then washed in H.sub.2O. Decoding
and assay images of the chip were acquired using a Nikon
fluorescence E800 microscope with an automated filter changer
containing hydroxy coumarin, HQ narrow band GFP and HQ Cy3 filters
for blue, green decoding images and for the assay image,
respectively. An Apogee CCD KX85 (Apogee Instruments, Auburn,
Calif.) was used for image acquisition. In each reaction, only the
perfectly matching target was extended producing, in the case of
the SNPs tested here, discrimination between matching and
non-matching targets in the range from 13-fold to 30-fold; this is
illustrated in FIG. 7 for TA13.
Example 7
HLA-DR Typing of Patient Sample
[0165] A DNA sample extracted from a patient was processed using a
standard PCR protocol. The following primers were used for general
DR amplification:
8 forward primer: GATCCTTCGTGTCCCCACAGCACG reverse primer:
GCCGCTGCACTGTGAAGCTCTC.
[0166] The PCR protocol was as follows: one cycle of 95.degree. C.
for 7 min, 35 cycles of 95.degree. C. for 30 sec, 60.degree. C. for
30 sec and 72.degree. C. for 1 min and one cycle of 72.degree. C.
for 7 min.
[0167] The PCR product, 287 bases in length and covering the DR
locus, was denatured at 100.degree. C. for 5 min, chilled on ice
and mixed with annealing buffer as described in Example 6 for the
model reaction. An aliquot of 10 ul was applied to each chip and
reacted at 40.degree. C. for 15 min. The elongation reaction and
subsequent image acquisition proceeded as in the previous Example
6.
[0168] The multiplexed extension of sequence-specific probes using
the PCR product produced from the patient sample produced results
in accordance with the probe design. Of the four probes tested in
parallel (SSP13, SSP16, SSP24, SSP36), SSP13 was elongated while
the SNP probe SSP24 only showed background binding as did the
unrelated SSP16 and SSP36 probes. As illustrated in FIG. 8, the
multiplexed elongation of SSP significantly enhanced the
discrimination between matching and non-matching SNPs from
approximately two-fold for an analysis based on the hybridization
of matching and non-matching sequence-specific oligonucleotide
probes to at least 20-fold.
Example 8
Group-Specific Amplification
[0169] Primers for group-specific amplification (GSA) are most
frequently used when multiplexed hybridization with SSOs yields
ambiguous assignments of heterozygous allele combinations. In such
a situation, GSA primers are selected to amplify selected sets of
specific alleles so as to remove ambiguities, a labor-intensive
additional assay step which delays the analysis. Using the methods
of the present invention, preferably an embodiment of displaying
probes on random encoded bead arrays, GSA primers may be
incorporated as probes into the multiplexed reaction thereby
eliminating an entire second step of analysis.
Example 9
[0170] Analysis of HLA-DR, -A and -B Loci Using Cell Lines
[0171] Probes for the elongation-mediated multiplexed analysis of
HLA-DR, HLA-A and HLA-B were designed and tested using standard
cell lines. The probes were derived from SSP probes previously
reported in the literature (Bunce, M. et al, Tissue Antigens.
46:355-367 (1995), Krausa, P and Browning, M. J., Tissue Antigens.
47: 237-244 (1996), Bunce, M. et al, Tissue Antigens. 45:81-90
(1995)).
[0172] The probes used for DR were:
9 SR2: ACGGAGCGGGTGCGGTTG SR3: GCTGTCGAAGCGCACGG SR11:
CGCTGTCGAAGCGCACGTT SR19: GTTATGGAAGTATCTGTCCAGGT SR23:
ACGTTTCTTGGAGCAGGTTAAAC SR32: CGTTTCCTGTGGCAGGGTAAGTATA SR33:
TCGCTGTCGAAGCGCACGA SR36: CGTTTCTTGGAGTACTCTACGGG SR39:
TCTGCAGTAGGTGTCCACCA SR45: CACGTTTCTTGGAGCTGCG SR46:
GGAGTACCGGGCGGTGAG SR48: GTGTCTGCAGTAATTGTCCACCT SR52:
CTGTTCCAGGACTCGGCGA SR57: CTCTCCACAACCCCGTAGTTGTA SR58:
CGTTTCCTGTGGCAGCCTAAGA SR60: CACCGCGGCCCGCGC SR67:
GCTGTCGAAGCGCAAGTC SR71: GCTGTCGAAGCGCACGTA NEG
AAAAAAAAAAAAAAAAAA
[0173] Some of the probes have a SNP site at their respective 3'
termini, for example: SR3 and SR33 (G and A, respectively); SR11,
SR67 and SR71 (T,C, and A, respectively). In addition, probes SR3
and 33 are staggered at the 3'-end with respect to probes the group
of SR11, 67 and 71 by one base.
10 SR3 GCTGTCGAAGCGCACGG SR33 TCGCTGTCGAAGCGCACGA SR11
CGCTGTCGAAGCGCACGTT SR67 GCTGTCGAAGCGCAAGTC SR71
GCTGTCGAAGCGCACGTA
[0174] Reaction conditions were as described in Example 7 except
that the annealing temperature was 55.degree. C. instead of
40.degree. C., and the extension temperature was 70.degree. C.
instead of 60.degree. C. Double-stranded DNA was used as in Example
7. Single-stranded DNA generated better results under current
conditions. Single-stranded DNA was generated by re-amplifying the
initial PCR product in the same PCR program with only one of the
probes. Results for two cell lines, W51 and SP0010, are shown in
FIG. 9 and FIG. 10. NEG, a negative control, was coupled to a
selected type of bead. Signal intensity for other probes minus NEG
was considered to be real signal for the probe and the values were
plotted in the figures. The Y axis unit was the signal unit from
the camera used in the experiment. The distinction between the
positive and negative probes was unambiguous for each sample. In
particular, and in contrast to the situation typically encountered
in SSO analysis, it was not necessary to make comparisons to other
samples to determine a reliable threshold for each probe.
[0175] The probes used for HLA-A were:
11 SAD CACTCCACGCACGTGCCA SAF GCGCAGGTCCTCGTTCAA SAQ
CTCCAGGTAGGCTCTCAA SAR CTCCAGGTAGGCTCTCTG SAX GCCCGTCCACGCACCG SAZ
GGTATCTGCGGAGCCCG SAAP CATCCAGGTAGGCTCTCAA SA8 GCCGGAGTATTGGGACGA
SA13 TGGATAGAGCAGGAGGGT SA16 GACCAGGAGACACGGAATA
[0176] Results for A locus exon 3, shown in FIG. 11 and FIG. 12,
also were unambiguous. FIG. 12 also shows an example of the
mismatch tolerance for a non-designated polymorphism. That is,
while allele 0201, displaying C instead of A at position M-18, is
not perfectly matched to probe SAAP, the elongation reaction
nonetheless proceeded because the polymerase detected a perfect
match for the designated polymorphism at the probe's 3' end and
tolerated the mismatch at position M-18.
[0177] The probes used for HLA-B were:
12 SB220 CCGCGCGCTCCAGCGTG SB246 CCACTCCATGAGGTATTTCC SB229
CTCCAACTTGCGCTGGGA SB272 CGCCACGAGTCCGAGGAA SB285
GTCGTAGGCGTCCTGGTC SB221 TACCAGCGCGCTCCAGCT SB197 AGCAGGAGGGGCCGGAA
SB127 CGTCGCAGCCATACATCCA SB187 GCGCCGTGGATAGAGCAA SB188
GCCGCGAGTCCGAGGAC SB195 GACCGGAACACACAGATCTT
[0178] Experiments using these probes for typing HLA-B exon 2 were
performed using reference cell lines. As with HLA-A, unambiguous
results (not shown here) were obtained.
Example 10
CF Mutation Analysis--Probe and Array Design for Probe
Elongation
[0179] This Example describes the design and application of a
planar array of probes, displayed on color-encoded particles, these
probes designed to display several--most frequently two selected
base compositions at or near their respective 3' ends and designed
to align with designated regions of interest within the CFTR target
gene.
[0180] The CFTR gene sequence from Genebank (www.ncbi.nlm.nih.gov)
was used to design sixteen-mer probes for the multiplexed analysis
of the 25 CFTR mutations in the ACMG-CF mutation panel. Probe
sequences were designed using PROBE 3.0
(http://www.genome.wi.mit.edu) and aligned with respective exon
sequences (http://searchlauncher.bcm.tmc.edu/seq-search/a-
lignment.html). Oligonucleotides were designed to comprise 15 to 21
nucleotides, with a 30-50% G+C rich.base composition and
synthesized to contain a 5' biotin TEG (Synthegen Tex.); to handle
small deletions, the variable sequence of the TEI region was placed
at or within 3-5 positions of the probe's 3' terminus. Probe
compositions are listed in the table below.
[0181] A combination of 17 either pure blue or blue-green stained
beads were used with CF mutation analysis. The 48 base long Human
.beta.-actin gene (Accession #X00351) was synthesized and used in
each reaction as an internal positive control. Sixteen base long
complementary probes were included on each array. The CFTR gene
sequence from Genebank (www.ncbi.nlm.nih.gov) was used for probe
design for analysis of 25 CFTR mutations in the ACMG-CF mutation
panel. The probe sequences were designed by PROBE 3.0
(http://www.genome.wi.mit.edu). Each probe sequence was aligned
with respective exon sequences (http://searchlauncher.bcm.tmc-
.edu/seq-search/alignment.html). Oligonucleotides were synthesized
with a 5' biotin TEG (Synthegen Tex.) and coupled on the surface of
beads in presence of 0.5 M NaCl. Beads were immobilized on the
surface of a chip by LEAPS.
[0182] Exon Mutations Sequence
13 EXON MUTATIONS SEQUENCE 3 G85E CCC CTA AAT ATA AAA AGA TTC
G85E-X CCC CTA AAT ATA AAA AGA TTT 4 1148 ATT CTC ATC TCC ATT CCA A
1148-X ATT CTC ATC TCC ATT CCA G 621+1G>T TGT GTG CAA GGA AGT
ATT AC 621+1G>T-X TGT GTG CAA GGA AGT ATT AA R117H TAG ATA AAT
CGC GAT AGA GC R117H-X TAG ATA AAT CGC GAT AGA GT 5 711+1G>T TAA
ATC AAT AGG TAC ATA C TAA ATC AAT AGG TAC ATA A 7 R334W ATG GTG GTG
AAT ATT TTC CG R334W-X ATG GTG GTG AAT ATT TTC CA R347P ATT GCC GAG
TGA CCG CCA TGC R347P-X ATT GCC GAG TGA CCG CCA TGG 1078delT CAC
AGA TAA AAA CAC CAC AAA 1078delT-X CAC AGA TAA AAA CAC CAC AA
1078delT-X-2 CAC AGA TAA AAA CAC CAC A 9 A455E TCC AGT GGA TCC AGC
AAC CG A455E-X TCC AGT GGA TCC AGC AAC CT 10 508 CAT AGG AAA CAC
CAA AGA T 1507 CAT AGG AAA CAC CAA A F508 CAT AGG AAA CAC CAA T 11
1717-1G>A CTG CAA ACT TGG AGA TGT CC 1717-1G>A CTG CAA ACT
TGG AGA TGT CT 551D TTC TTG CTC GTT GAC 551D-X TTC TTG CTC GTT GAT
R553 TAAAGAAATTCTTGCTCG R553X TAAAGAAATTCTTGCTCA R560
ACCAATAATTAGTTATTCACC R560X ACCAATAATTAGTTATTCACG G542
GTGTGATTCCACCTTCTC C G542X GTGTGATTCCACCTTCTC A INT-12 1898 AGG TAT
TCA AAG AAC ATA C 1898-X AGG TAT TCA AAG AAC ATA T 2183deLA TGT CTG
TTT AAA AGA TTG T 13 2183deLA-X TGT CTG TTT AAA AGA TTG C INT 14B
2789 CAA TAG GAC ATG GAA TAC 2789-X CAA TAG GAC ATG GAA TAC T INT16
3120 ACT TAT TTT TAC ATA C 3120-X ACT TAT TTT TAC ATA T 18 D1152
ACT TAC CAA GCT ATC CAC ATC D1152 ACT TAC CAA GCT ATC CAC ATG INT
19 3849+10kbC>T-WT1 CCT TTC Agg GTG TCT TAC TCG
3849+10kbC>T-M1 CCT TTC Agg GTG TCT TAC TCA 19 R1162 AAT GAA CTT
AAA GAC TCG R1162-X AAT GAA CTT AAA GAG TCA 3659delC-WT1 GTA TGG
TTT GGT TGA CTT GG 3659delCX-M1 GTA TGG TTT GGT TGA CTT GTA
3659delC-WT2 GTA TGG TTT GGT TGA CTT GGT A 3659delCX-M2 GTA TGG TTT
GGT TGA CTT GT A 20 W1282 ACT CCA AAG GCT TTC CTC W1282-X CT CCA
AAG GCT TTC CTT 21 N1303K TGT TCA TAG GGA TCC AAG N1303K-X TGT TCA
TAG GGA TCC AAG b .beta. Actin AGG ACT CCA TGC CCA G
[0183] Probes were attached, in the presence of 0.5 M NaCl, to
differentially encoded beads, stained either pure blue or
blue-green Beads were immobilized on the surface of a chip using
LEAPS. A synthetic 48 base Human .beta.-actin gene (Accession
#X00351) was included in each reaction as an internal positive
control.
[0184] Array Design--In a preferred embodiment, the 25 CF mutations
were divided into four different groups so as to minimize sequence
homologies between members of each group. That is, mutations were
sorted into separate groups so as to minimize overlap between probe
sequences in any such group and thereby to minimize
cross-hybridization under conditions of multiplexed analysis. Each
group, displayed on color-encoded beads, was assembled into a
separate array. (Results for this 4-chip array design are described
in the following Example). Alternative robust array designs also
are disclosed herein.
Example 11
Multiplexed CF Mutation Analysis by Probe Elongation Using READ
[0185] Genomic DNA, extracted from several patients, was amplified
with corresponding probes in a multiplex PCR (mPCR) reaction using
the method described in L. McCurdy, Thesis, Mount Sinai School of
Medicine, 2000, which is incorporated by reference. This mPCR
reaction uses chimeric primers tagged with a universal sequence at
the 5' end. Antisense primers were phosphorylated at the 5' end
(Synthegen, Tex.). Twenty eight amplification cycles were performed
using a Perkin Elmer 9600 thermal cycler, each cycle comprising a
10 second denaturation step at 94.degree. C. with a 48 second ramp,
a 10 second annealing step at 60.degree. C. with a 36 second ramp
and a 40 second extension step at 72.degree. C. with a 38 second
ramp, each reaction (50 .mu.l) containing 500 ng genomic DNA,
1.times.PCR buffer (10 mM Tris HCL, 50 mM KCL, 0.1% Triton X-100),
1.5 mM MgCl.sub.2, 200 .mu.M each of PCR grade dNTPs and 5 units
Taq DNA polymerase. Optimal probe concentrations were determined
for each probe pair. Following amplification, products were
purified to remove all reagents using a commercially available kit
(Qiagen). DNA concentration was determined by spectrophotometric
analysis.
[0186] PCR products were amplified with antisense 5'-phosphorylated
primers. To produce single-stranded DNA templates, PCR reaction
products were incubated with 2.5 units of exonuclease in 1.times.
buffer at 37.degree. C. for 20 min, followed by enzyme inactivation
by heating to 75.degree. C. for 10 min. Under these conditions, the
enzyme digests one strand of duplex DNA from the 5'-phosphorylated
end and releases 5'-phosphomononucleotides (J. W. Little, et al.,
1967). Single-stranded targets also can be produced by other
methods known in the art.
[0187] Single or pooled PCR products (20 ng each) were added to an
annealing mixture containing 10 mM Tris-HCL (pH 7.4) 1 mM EDTA, 0.2
M NaCl, 0.1% Triton X-100. The annealing mixture was placed in
contact with the encoded array of bead-displayed CF probes (of
Example 10) and incubated at 37-55.degree. C. for 20 minutes. The
extension mixture--containing 3 U of Thermo Sequenase (Amersham
Pharmacia Biotech N.J.), 1.times. enzyme buffer with either
Fluorescein-labeled or TAMRA-labeled deoxynucleotide (dNTP) analogs
(NEN Life Sciences) and 1 .mu.mole of each type of unlabeled
dNTP--was then added, and the elongation reaction was allowed to
proceed for 3 minutes at 60.degree. C. The bead array was washed
with deionized, sterilized water (dsH.sub.2O) for 5-15 minutes. An
image containing the fluorescence signal from each bead within the
array was recorded using a fluorescence microscope equipped with a
CCD camera. Images were analyzed to determine the identity of each
of the elongated probes. The results are shown in FIG. 15.
Example 12
Use of Covering Probes
[0188] Several SNPs have been identified within exon 10 of the CFTR
gene. The polymorphisms in exon 10 are listed at the end of this
Example. The following nine SNPs have been identified in the
sequence of .DELTA.508, the most common mutation in the CFTR gene
(http://snp.cshl.org):
[0189] dbSNP213450 A/G
[0190] dbSNP180001 C/T
[0191] dbSNP1800093 G/T
[0192] 1648 A/G
[0193] dbSNP100092 C/G
[0194] dbSNP1801178 A/G
[0195] dbSNP1800094 A/G
[0196] dbSNP1800095 G/A
[0197] Probes are designed to accommodate all possible SNPs are
synthesized and coupled to color-encoded beads. The primers for
target amplification (described in Example 11) are also modified to
take into account all possible SNPs. The PCR-amplified target
mediates the elongation of terminally matched probes. The
information collected from the analysis is twofold: identification
of mutations and SNPs.
[0198] Exon 10 Polymorphisms
14 EXON 10 POLYMORPHISMS 1 cactgtagct gtactacctt ccatctcctc
aacctattcc aactatctga atcatgtgcc 61 cttctctgtg aacctctatc
ataatacttg tcacactgta ttgtaattgt ctcttttact 121 ttcccttgta
tcttttgtgc atagcagagt acctgaaaca ggaagtattt taaatatttt 181
gaatcaaatg agttaataga atctttacaa ataagaatat acacttctgc ttaggatgat
241 aattggaggc aagtgaatcc tgagcgtgat ttgataatga cctaataatg
atgggtttta 301 tttccagact tcaCttctaa tgAtgattat gggagaactg
gagccttcag agggtaaaat 361 taagcacagt ggaagaattt cattctgttc
tcagttttcc tggattatgc ctggcaccat 421 taaagaaaat AtCAtctTtg
gtgtttccta tgatgaatat agatacagaa gcgtcatcaa 481 agcatgccaa
ctagaAgagG taagaaacta tgtgaaaact ttttgattat gcatatgaac 541
ccttcacact acccaaatta tatatttggc tccatattca atcggttagt ctacatatat
601 ttatgtttcc tctatgggta agctactgtg aatggatcaa ttaataaaac
acatgaccta 661 tgctttaaga agcttgcaaa cacatgaaat aaatgcaatt
tattttttaa ataatgggtt 721 catttgatca caataaatgc attttatgaa
atggtgagaa ttttgttcac tcattagtga 781 gacaaacgtc tcaatggtta
tttatatggc atgcatatag tgatatgtgg t
Example 13
CF Mutation Analysis--On-Bead Probe Elongation with Model
System
[0199] FIG. 13 provides an overview of detection of CF gene
mutation R117H. The target was amplified by PCR as described in
Example 11. Two 17-base probes variable at their 3' ends were
immobilized on color coded beads. The target nucleic acid sequence
was added along with TAMRA-labeled dCTP, unlabeled dNTPs and
thermostable DNA polymerase.
[0200] Complementary 17-mer oligonucleotide probes variable at the
3' end were were synthesized by a commercial vendor (Synthegen
Tex.) to contain 5' biotin attached by way of a 12-C spacer
(Biotin-TEG) and were purified by reverse phase HPLC. Probes were
immobilized on color encoded beads. Probes were attached to
color-encoded beads. A synthetic 48-mer oligonucleotide also was
provided to contain either A,T,C or G at a designated variable
site, corresponding to a cystic fibrosis gene mutation at exon 4
(R117H).
[0201] 1 .mu.M of synthetic target was added to an annealing
mixture containing 10 mM Tris-HCL (pH 7.4) 1 mM EDTA, 0.2 M NaCl,
0.1% Triton X-100. The annealing mixture was placed in contact with
the encoded bead array and incubated at 37.degree. C. for 20
minutes. An elongation mixture containing 3 U of Thermo Sequenase
(Amersham Pharmacia Biotech N.J.), 1.times. enzyme buffer with
TAMRA-labeled deoxynucleotide (dNTP) analogs (NEN Life Sciences)
and 1 .mu.M of each type of unlabeled dNTP was then added, and the
elongation reaction was allowed to proceed for 3 minutes at
60.degree. C. The bead array was then washed with dsH.sub.2O for
5-15 minutes and an image containing the fluorescence signal from
each bead within the array was recorded using a fluorescence
microscope equipped with a CCD camera. Images were analyzed to
determine the identity of each of the elongated probes. The signal
was analyzed by capturing the image by a CCD camera and comparing
signal intensity between two probes that can be decoded by the bead
color. The wild-type type probe exactly matched the added target
and therefore yielded an elongation product, whereas no elongation
was observed for the mutant probe. The results are shown in FIG.
16a.
Example 14
CF Mutation Analysis--PCR with Bead-Tagged Primers and Integrated
Detection
[0202] This example illustrates probe elongation on the surface of
beads in suspension, followed by assembly of and immobilization of
beads on the surface of a chip for image analysis. Oligonucleotides
corresponding to CFTR gene mutation R117H were designed with
variable 3' ends (FIG. 14) and were synthesized to contain a 5'
biotin-TEG with a 12 C spacer (Synthegen, Tex.). The probes were
attached to blue stained beads as follows: 2 .mu.M of probe were
added to a bead solution in 1.times.TE (100 mM Tris-HCl, 10 mM
EDTA), 500 mM NaCl and reacted for 45 min at room temperature.
Beads were washed with 1.times.TE, 150 mM of NaCl for 3.times., and
suspended in 50 .mu.l of the same solution. One .mu.l of each type
of bead was added to PCR mix containing 1.times. buffer (100 mM
Tris-HCl, pH. 9.0, 1.5 mM MgCl.sub.2, 500 mM KCl), 40 .mu.M
Cy5-labeled dCTP (Amersham Pharmacia Biotech N.J.), and 80 .mu.M of
the other three types of dNTPs, and 3 U of Taq DNA polymerase
(Amersham Pharmacia Biotech N.J.). Wild type complementary target
(40 ng) was added to the PCR mix just before amplification. Eleven
cycles of PCR amplification were performed in a Perkin Elmer 9600
thermal cycler, each cycle consisting of denaturation for 30 s at
90.degree. C., annealing for 30 s at 55.degree. C., and elongation
at 72.degree. C. for 20 s After amplification, beads were washed
four times by centrifugation in 1.times.TE buffer and placed on the
chip surface. Images were recorded as in previous Examples and
analyzed using the software described in WO 01/98765. The results
show specific amplification for beads coupled with the wild-type
probe, but no amplification for beads coupled with the mutant
probe. The results are shown in FIG. 16b.
[0203] This example demonstrates the integration of multiplexed PCR
using bead-tagged probes with subsequent assembly of beads on
planar surfaces for instant imaging analysis. In a preferred
embodiment, a microfluidically connected multicompartment device
may be used for template amplification as described here. For
example, a plurality of compartments capable of permitting
temperature cycling and housing, in each compartment, one mPCR
reaction producing a subset of all desired amplicons may be used as
follows: (1) perform PCR with different probe pairs in each of four
compartments, using encoded bead-tagged primers as described in
this Example; (2) following completion of all PCR reactions, pool
the amplicon-displaying beads; (3) assemble random array; and (4)
record image and analyze the data. Array assembly may be
accomplished by one of several methods of the prior art including
LEAPS.
Example 15
CF Mutation Analysis--One Step Annealing and Elongation in
Temperature-Controlled Reactor
[0204] Genomic DNA, extracted from several patients, was amplified
with corresponding primers in a multiplexed PCR (mPCR) reaction, as
described in Example 11. Following amplification, products were
purified to remove all reagents using a commercially available kit
(Qiagen). DNA concentration was determined by spectrophotometric
analysis. Single or pooled PCR products (20 ng each) were added to
an annealing mixture containing 10 mM Tris-HCL (pH 7.4) 1 mM EDTA,
0.2 M NaCl, 0.1% Triton X-100. The annealing mixture was mixed with
elongation mixture containing 3 U of Thermo Sequenase (Amersham
Pharmacia Biotech, N.J.), 1.times. enzyme buffer with either
fluorescein-labeled or TAMRA-labeled deoxynucleotide (dNTP) analogs
(NEN Life Sciences) and 1-10 .mu.mole of each type of unlabeled
dNTP and placed in contact with an array of oligonucleotide probes
displayed on a color-encoded array. Oligonucleotides were designed
and synthesized as in previous Examples. The annealing and
elongation reactions were allowed to proceed in a temperature
controlled cycler. The temperature steps were as follows: three
minutes each at 65.degree. C., 60.degree. C., 55.degree. C.,
50.degree. C. and 45.degree. C., with a ramp between temperatures
seconds. The bead array was then washed with dsH.sub.2O for 5 to 15
min. and an image containing the fluorescence signal from each bead
within the array was recorded using a fluorescence microscope
equipped with a CCD camera. Images were analyzed to determine the
identity of each of the elongated probes. Typical results are shown
in FIG. 17.
Example 16
Pooling of Covering Probes
[0205] To analyze designated polymorphisms, 20-mer oligonucleotide
elongation probes of 30-50% G+C base composition were designed to
contain a variable site (G/T) at the 3' end, to be aligned with the
designated polymorphic site. Two non-designated polymorphic sites
were anticipated at position 10 (C/A) and at 15 (T/G). A summary of
the design follows:
[0206] Wild-type probe sequence:
[0207] Oligo 1: "G" at position 20, "C" at 10, and "T" at 15.
[0208] Oligo 2: "G" at position 20, "C" at 10, and "G" at 15.
[0209] Oligo 3: "G" at position 20, "A" at 10, and "T" at 15.
[0210] Oligo 4: "G" at position 20, "A" at 10, and "G" at 15.
[0211] Mutant Probe Sequence:
[0212] Oligo 1: "T" at position 20, "C" at 10, and "T" at 15.
[0213] Oligo 2: "T" at position 20, "C" at 10, and "G" at 15.
[0214] Oligo 3: "T" at position 20, "A" at 10, and "T" at 15.
[0215] Oligo 4: "T" at position 20, "A" at 10, and "G" at 15.
[0216] All of the probes were pooled and attached to a single type
of color-coded bead using protocols of previous Examples. When
single-stranded target is added to these beads displaying pooled
probes, one of the probes will yield elongation product as long as
it is perfectly aligned with the designated polymorphism.
Example 17
Designated Polymorphisms in Heterozygous and Homozygous
Configurations
[0217] To distinguish between heterozygous and homozygous
configurations, the design of the previous Example is augmented to
contain a second set of probes to permit the identification of the
C/A designated polymorphism aligned with the probes' 3' ends, and
to permit calling of heterozygous versus homozygous mutations.
[0218] As in the previous example, two non-designated polymorphic
sites are anticipated at positions 10 (C/A) and 15 (T/G). A summary
of the design follows:
[0219] Set #1:
[0220] Oligo 1: "C" at position 20, "C" at 10, and "T" at 15.
[0221] Oligo 2: "C" at position 20, "C" at 10, and "G" at 15.
[0222] Oligo 3: "C" at position 20, "A" at 10, and "T" at 15.
[0223] Oligo 4: "C" at position 20, "A" at 10, and "G" at 15.
[0224] Set #2:
[0225] Oligo 5: "A" at position 20, "C" at 10, and "T" at 15.
[0226] Oligo 6: "A" at position 20, "C" at 10, and "G" at 15.
[0227] Oligo 7: "A" at position 20, "A" at 10, and "T" at 15.
[0228] Oligo 8: "A" at position 20, "A" at 10, and "G" at 15.
[0229] Oligonucleotides from set #1 are pooled and attached to a
single type of color (e.g. green) coded bead using protocols of
previous Examples. Oligonucleotides from set # 2 were pooled and
attached to a scond type of color (e.g. orange) coded bead using
protocols of previous Examples. Beads were pooled and immobilized
on the surface of chip as described earlier. Next, target was
introduced, and on-chip reactions performed as described in
previous Examples. If probes on green beads only are elongated, the
individual has a normal (or wild-type) allele. If probes on orange
beads only are elongated, the individual is homozygous for the
mutation. I If probes on green as well as origan beads are
elongated, the individual is heterozygous for that allele. This
design is useful for the identification of known and unknown
mutations.
Example 18
Confirmatory Sequencing ("Resequencing")
[0230] The design of the present invention can be used for
re-sequencing of a specific area. This test can be used when
on-chip probe elongation reaction requires confirmation, as in the
case of reflex tests for 1506V, 1507V, F508C and 7T in the CF
mutation panel. The sequence in question, here 20 bases to 30 bases
in length, is sequenced on-chip by multiplexed interrogation of all
variable sites. This is accomplished by designing specific probes
for ambiguous locations, and by probe-pooling as described in
Examples 16 and 17.
Example 19
Elongation with One Labeled dNTP and Three Unlabeled dNTPs
[0231] By way of incorporating at least one labeled dNTP, all
elongation products are detected in real-time and identified by
their association with coded solid phase carriers. Using assay
conditions described in connection with Examples 6 and 7,
tetramethylrhodamine-6-dCTP and unlabeled dATP, dTTP and dGTP were
provided in an elongation reaction to produce a fluorescently
labeled elongation product as illustrated FIG. 18. Other dye
labeling of dNTPs (as in BODIPY-labeled dUTP and Cy5-labeled dUTP)
may be used. Similarly, any other labeled dNTP can be used. The
length of the elongation product depends on the amount of labeled
dNTP tolerated by the DNA polymerase. Available enzymes generally
exhibit a higher tolerance for strand-modifying moieties such as
biotin and digoxigenin which may then be reacted in a second step
with labeled avidins or antibodies to accomplish indirect labeling
of elongation procucts. When using these small molecules,
elongation products measuring several hundred bases in length are
produced.
Example 20
Extension with One Labeled ddNTP, Three Unlabeled dNTPs
[0232] TAMRA-labeled ddCTP may be incorporated to terminate the
extension reaction, as illustrated in FIG. 19. On-chip reactions
using TAMRA-labeled ddCTP were performed as described in Examples 6
and 7. In a reaction mixture containing TAMRA-ddCTP and unlabeled
dTTP, dATP and dGTP, following annealing of the target to the
matching probe, the extension reaction terminates when it completes
the incorporation of the first ddCTP. This may occur with the very
first base incorporated, producing a single base extension product,
or it may occur after a number of unlabeled dNTPs have been
incorporated.
Example 21
Elongation with Four Unlabeled dNTPs, Detection by Hybridization of
Labeled Probe
[0233] Probes are elongated using a full set of four types of
unlabeled dNTPs, producing, under these "native" conditions for the
polymerase, elongation products measuring several hundred bases in
length, limited only by the length of the annealed template and
on-chip reaction conditions. The elongation product is detected,
following denaturation at high temperature, in a second step by
hybridization with a labeled oligonucleotide probe whose sequence
is designed to be complementary to a portion of the elongation
product This process is illustrated in FIG. 20.
Example 22
Elongation with Four Unlabeled dNTPs, Detection via Labeled
Template
[0234] As with standard protocols in routine use in multiplexed
hybridization assays, the DNA target to be analyzed can itself be
labeled in the course of PCR by incorporation of labeled probes.
Under conditions such as those described in Examples 6 and 7, a
labeled target is annealed to probes. Matching probes are elongated
using unlabeled dNTPs. Following completion of the elongation
reaction, detection is performed by setting the temperature
(T.sub.det) to a value above the melting temperature
(T.sub.non-match) of the complex formed by target and non-matched
probe, but below the melting temperature (T.sub.match) of the
complex formed by target and matched, and hence elongated, probe.
The latter complex, displaying a long stretch of duplex region,will
be significantly more stable than the former so that
(T.sub.non-match)<T<(T.sub.match). Typical values for T are
in the range of 70.degree. C. to 80.degree. C. Under these
conditions, only the complex formed by target and elongated probe
will stable, while the complex formed by target and non-matching
probe, and hence the fluorescence signal from the corresponding
solid phase carrier, will be lost. That is, in contrast to other
designs, it is the decrease of signal intensity associated with the
non-matching probe which is detected, rather than the increase in
intensity associated the matching probe. FIG. 21 illustrates the
design which eliminates the need for labeled dNTPs or ddNTPs. This
is useful in the preferred embodiments of this invention, where
labeled dNTPs or ddNTPs can absorb non-specifically to encoded
particles, thereby increasing the background of the signal and
decreasing the discriminatory power of the assays. In addition, by
using a labeled target, this protocol is directly compatible with
methods of polymorphism analysis by hybridization of
sequence-specific oligonucleotides.
Example 23
[0235] Real-Time On-chip Signal Amplification
[0236] A standard temperature control apparatus used with a planar
geometry such as that illustrated in FIG. 22 permits the
application of programmed temperature profiles to a multiplexed
extension of SSPs. Under conditions of Examples 6 and 7, a given
template mediates the elongation of one probe in each of multiple
repeated "denature-anneal-extend" cycles. In the first cycle, a
target molecule binds to a probe and the probe is elongated or
extended. In the next cycle, the target molecule disassociates from
the first probe in the "denature" phase (at a typical temperature
of 95.degree. C.), then anneals with another probe molecule in the
"anneal" phase (at a typical temperature of 55.degree. C.) and
mediates the extension of the probe in the "extend" phase (at a
typical temperature of 72.degree. C.). In N cycles, each template
mediates the extension of N probes, a protocol corresponding to
linear amplification (FIG. 30). In a preferred embodiment of this
invention, in which planar arrays of encoded beads are used to
display probes in a multiplexed extension reaction, a series of
temperature cycles is applied to the reaction mixture contained
between two planar, parallel substrates. One substrate permits
direct optical access and direct imaging of an entire array of
encoded beads. The preferred embodiment provides for real-time
amplification by permitting images of the entire bead array to be
recorded instantly at the completion of each cycle.
[0237] Genomic, mitochondrial or other enriched DNA can be used for
direct detection using on-chip linear amplification without
sequence specific amplification. This is possible when an amount of
DNA sufficient for detection is provided in the sample. In the bead
array format, if 10.sup.4 fluorophores are required for detection
of signal from each bead, 30 cycles of linear amplification will
reduce the requisite number to .about.300. Assuming the use of 100
beads of the requisite type within the array, the requisite total
number of fluorophores would be .about.10.sup.5, a number typically
available in clinical samples. For example, typical PCR reactions
for clinical molecular typing of HLA are performed with 0.1 to 1
.mu.g of genomic DNA. One .mu.g of human genomic DNA corresponds to
approximately 10.sup.-18 moles, thus, 6.times.10.sup.5 copies of
the gene of interest This small amount of sample required by the
miniaturized bead array platform and on-chip amplification makes
the direct use of pre-PCR samples possible. This not only
simplifies sample preparation but, more importantly, eliminates the
complexity of multiplexed PCR, frequently a rate limiting step in
the development of multiplexed genetic analysis.
Example 24
Construction of a Probe Library for Designated and Unselected
Polymorphisms for CF Mutation Analysis
[0238] To increase the specificity of elongation probes and avoid
false positives, elongation probes were designed to accommodate all
known polymorphisms present in a target sequence. In addition, PCR
primers were designed taking into consideration designated and
non-designated polymorphisms.
[0239] The G/C mutation at position 1172. of R347P on Exon 7 within
the CFTR gene, one of 25 mutations within the standard population
carrier screening panel for cystic fibrosis, was selected as a
designated polymorphism. There are 3 CF mutations within Exon 7
included in the mutation panel for general population carrier
screening (http://www.faseb.org/genetics/acmg). A polymorphism
G/T/A at the same site has been reported
(http://www.genet.sickkids.on.ca/cftr), and in addition,
non-designated polymorphisms have been reported at positions 1175,
1178, 1186, 1187 and 1189. All of these polymorphisms can interfere
with desired probe elongation.
[0240] The construction of a set of degenerate probes for eMAP is
illustrated below for R347P (indicated by the bold-faced G) which
is surrounded by numerous non-designated polymorphisms, indicated
by capital letters:
15 5' 3' Normal Target Sequence for Elongation: Gca Tgg Cgg tca ctC
GgC a Degenerate Elongation Probe Set: Ngt Ycc Ycc agt gaY RcY t 3'
5'+TZ,1 41
[0241] where N=a, c, g or t; R (puRines)=a or g and Y
(pYrimidines)=c or t, implying a degeneracy of 128 for the set.
[0242] Primer Pooling for Mutation Analysis--The principal
objective in the construction of a degenerate set is to provide at
least one probe sequence to match the target sequence sufficiently
closely to ensure probe annealing and elongation. While this is
always attainable in principle by providing the entire set of
possible probe sequences associated with the designated
polymorphism, as in the preferred mode of constructing covering
sets, the degree of degeneracy of that set, 128 in the example,
would lead to a corresponding reduction in assay signal intensity
by two orders of magnitude if all probes were to be placed onto a
single bead type for complete probe pooling. Splitting pools would
improve the situation by distributing the probe set over multiple
bead types, but only at the expense of increasing array
complexity.
[0243] First, the probe pool was split into a minimum of two or
more pools, each pool providing the complementary composition, at
probe position M (i.e., the probe's 3' terminus), for each of the
possible compositions of the designated polymorphic site. In the
example, four such pools are required for a positive identification
of the designated target composition. Next, non-designated
polymorphic sites were examined successively in the order of
distance from the designated site. Among these, positions within
the TEI region are of special importance to ensure elongation. That
is, each pool is constructed to contain all possible probe
compositions for those non-designated sites that fall within the
TEI region. Finally, as with the construction of degenerate probes
for cloning and sequencing of variable genes, the degeneracy of the
set is minimized by placing neutral bases such as inosine into
those probe positions which are located outside the TEI region
provided these are known never to be juxtaposed to G in the target.
In the example, non-designated polymorphisms in probe positions
M-16 and M-18 qualify. That is, the minimal degeneracy of each of
the four pools would increase to four, producing a corresponding
reduction in signal intensity. As an empirical guideline, signal
reduction preferably will be limited to a factor of eight.
[0244] In total, four pools, each uniquely assigned to one bead
type and containing eight degenerate probe sequences, will cover
the target sequence. These sequences are analogous to those shown
below for pools variable at M:
[0245] Probe pool for CF mutation R347P
16 Probe pool for CF mutation R347P R347P Cgt Acc Gcc agt gaG GgC
3' 5' POOL 1 Cgt Acc Gcc agt gaG IgI Cgt Acc Gcc agt gaC IgI Cgt
Acc Ccc agt gaG IgI Cgt Acc Ccc agt gaC IgI Cgt Tcc Gcc agt gaG IgI
Cgt Tcc Gcc agt gaC IgI Cgt Tcc Ccc agt gaG IgI Cgt Tcc Ccc agt gaC
IgI POOL 2 Ggt Acc Gcc agt gaG IgI Ggt Acc Gcc agt gaC IgI Ggt Acc
Ccc agt gaG IgI Ggt Acc Ccc agt gaC IgI Ggt Tcc Gcc agt gaG IgI Ggt
Tcc Gcc agt gaG IgI Ggt Tcc Ccc agt gaG IgI Ggt Tcc Ccc agt gaC IgI
POOL 3 Agt Acc Gcc agt gaG IgI Agt Acc Gcc agt gaC IgI Agt Acc Ccc
agt gaG IgI Agt Acc Ccc agt gaC IgI Agt Tcc Gcc agt gaG IgI Agt Tcc
Gcc agt gaC IgI Agt Tcc Ccc agt gaG IgI Agt Tcc Ccc agt gaC IgI
POOL 4 Tgt Acc Gcc agt gaG IgI Tgt Acc Gcc agt gaC IgI Tgt Acc Ccc
agt gaG IgI Tgt Acc Ccc agt gaC IgI Tgt Tcc Gcc agt gaG IgI Tgt Tcc
Gcc agt gaC IgI Tgt Tcc Ccc agt gaG IgI Tgt Tcc Ccc agt gaC IgI
[0246] In general, the type of non-designated polymorphisms on the
antisense strand may differ from that on the sense strand, and it
may then be advantageous to construct degenerate probe sets for the
antisense strand. As with the construction of degenerate elongation
probes, degenerate hybridization probe sets may be constructed by
analogous rules to minimize the degeneracy.
Example 25
"Single Tube" CF Mutation Analysis by eMAP
[0247] This example is concerned with methods and compositions for
performing an eMAP assay, wherein the annealing and elongation
steps occur in the reactor. This embodiment is useful because it
obviates the need for sample transfer between reactors as well as
purification or extraction procedures, thus simplifying the assay
and reducing the possibility of error. A non-limiting exemplary
protocol follows.
[0248] Genomic DNA extracted from several patients was amplified
with corresponding primers in a multiplex PCR (mPCR) reaction. The
PCR conditions and reagent compositions were as follows.
[0249] PRIMER DESIGN: Sense primers were synthesized without any
modification and antisense primers with "Phosphate" at the 5' end.
Multiplex PCR was performed in two groups. Group one amplification
includes exon 5, 7, 9, 12, 13, 14B, 16, 18 and 19. Amplifications
for group 2 includes primers for exon 3, 4, 10, 11, 20, 21 and
intron 19. The 5' phosphate group modification on exon 5, 7, and 11
was included on forward primer to use antisense target for probe
elongation. While sense target was used for all other amplicons by
placing phosphate group on reverse primer.
[0250] PCR Master Mix Composition
17 For 10 ul reaction/sample: Components Volume (.mu.l) 10X PCR
buffer 1.0 25 mM MgCl.sub.2 0.7 dNTPs (2.5 mM) 2.0 Primer mix
(Multiplex 10x) 1.5 Taq DNA polymerase 0.3 ddH2O 1.5 DNA 3.0 Total
10 PCR Cycling 94.degree. C. 5 min, 94.degree. C. 10 sec.,
60.degree. C. 10 sec., 72.degree. C. 40 sec 72.degree. C. 5 min.,
Number of cycles: 28-35
[0251] The reaction volume can be adjusted according to
experimental need. Amplifications are performed using a Perkin
Elmer 9600 thermal cycler. Optimal primer concentrations were
determined for each primer pair. Following amplifications, 5 ul of
the product was removed for gel electrophoresis. Single stranded
DNA targets were generated as follows: Two microliters of
exonuclease was added to 5 .mu.l of PCR product, incubated at
37.degree. C. for 15 minutes and enzyme was denatured at 80.degree.
C. for 15 minutes. After denaturation, 1 .mu.l of 10.times.
exonuclease buffer was added with 1 .mu.l of .lambda. exonuclease
(5 U/.mu.l) and incubated at 37.degree. C. for 20 minutes and the
reaction was stopped by heating at 75.degree. C. for 10
minutes.
[0252] On Chip Elongation
[0253] Wild type and mutant probes for 26 CF mutations were coupled
on the bead surface and assembled on the chip array. The probes
were also divided into two groups. A third group was assembled for
reflex test including 5T/7T/9T polymorphisms.
18 Elongation Group 1, total 31 groups on the chip surface. Bead
cluster # Mutation 1 G85E-WT 2 G85E-M 3 621 + 1G > T-WT 4 621 +
1G > T-M 5 R117H-WT 6 R117H-M 7 .beta. Actin 8 1148T-WT 9
1148T-M 10 508-WT 11 F508 12 I507 13 G542X-WT 14 G542X-M 15
G551D-WT 16 G551D-M 17 R553X-WT 18 R553X-M 19 BIOTIN 20 1717-1G
> A-WT 21 1717-1G > A-M 22 R560T-WT 23 R560T-M 24 3849 +
10kbT-WT 25 3849 + 10kbT-M 26 W1282X-WT 27 W1282X-M 28 N1303K-WT 29
N1303K-M 30 OLIGO-C Cluster # Mutation Elongation Group 2, total 28
groups on the chip surface. 1 711 + IG > T-WT 2 711 + 1G >
T-M 3 R334W-WT 4 R334W-M 5 1078delT-WT 6 1078delT-M 7 .beta. Actin
8 R347P-WT 9 R347P-M 10 A455E-WT 11 A455E-M 12 1898 + 1G > A-WT
13 1898 + 1G > A-WT 14 2184delA-WT 15 2184delA-M 16 2789 + 5G-WT
17 2789 + 5G-M 18 BIOTIN 19 3120 + 1G > A-WT 20 3120 + 1G >
A-WT 21 R1162X-WT 22 R1162X-M 23 3659delC-WT 24 3659delC-M 25
D1152-WT 26 D1152-M 27 OLIGO-C mPCR group 2: Elongation Group 3,
total 6 groups 1 .beta. Actin 1 Oligo C 2 5T 3 7T 4 9T 5 Biotin
[0254] Elongation reaction buffer has been optimized for use in
uniplex and/or multiplex target elongation assays and composed of,
Tris-HCL (pH 8.5) 1.2 mM, EDTA 1 uM, DTT 10 .mu.M, KCl 1 .mu.M,
MgCl.sub.2 13 .mu.M,.sub.--2-Mercaptoethanol 10 .mu.M, Glycerol
0.5%, Tween-20 0.05%, and Nonidet 0.05%. Ten microliters of
elongation reaction mixture was added on each chip containing
1.times. Reaction buffer 0.1 .mu.M of Labeled dNTP, 1.0 .mu.M of
dNTPs mix, 3 U of DNA polymerase and 5 .mu.l (.about.5 ng) of
target DNA (patient sample). The reaction mix was added on the chip
surface and incubated at 53.degree. C. for 15 min and then at
60.degree. C. for 3 min. The chip was washed with wash buffer
containing 0.01% SDS, covered with a clean cover slip and analyzed
using a Bioarray Solutions imaging system. Images are analyzed to
determine the identity of each of the elongated probes.
Example 26
CF Mutation Analysis--Single Tube Single Chip-One Step
Elongation
[0255] Probes for 26 CF mutations and controls were coupled on the
surface of 51 types of beads. Probe coupled beads were assembled on
the surface of a single chip. Genomic DNA was extracted from
several patients and was amplified with corresponding primers in a
multiplexed PCR (mPCR) reaction, as described in the previous
example. Following amplification, single stranded DNA products were
produced using .lambda. exonuclease. Single or pooled PCR products
(.about.5 ng) were added to a reaction mixture containing reaction
buffer, deoxynucleotide (dNTP) analogs (NEN Life Sciences), each
type of unlabeled dNTP, and DNA polymerase (Amersham Pharmacia
Biotech, N.J.). The annealing/elongation reaction was allowed to
proceed in a temperature controlled cycler. The temperature steps
were as follows: 20 minutes at 53.degree. C., and 3 minutes at
60.degree. C. The bead array was then washed with dsH.sub.2O
containing 0.01% SDS for 5 to 15 minutes. An image containing the
fluorescent signal form each bead within the array was recorded
using a fluorescence microscope and a CCD camera. Images were
analyzed to determine the identity of each of the elongated
probes.
[0256] The composition of bead chip containing 26 CF mutations is
provided below.
19 Elongation Group 4, total 51 groups Cluster # Mutation 1 .beta.
Actin 2 G85E-WT 3 G85E-M 4 621 + 1G > T-WT 5 621 + 1G > T-M 6
R117H-WT 7 R117H-M 8 1148T-WT 9 1148T-M 10 711 + 1G > T-WT 11
711 + 1G > T-M 12 A455E-WT 13 A455E-M 14 508-WT 15 F508 16 I507
17 R533-WT 18 R533-M 19 G542-WT 20 G542-M 21 G551D-WT 22 G551D-M 23
R560-WT 24 R560-M 25 1898 + 1G-WT 26 1898 + 1G-M 27 2184de1A-WT 28
2184de1A-M 29 2789 + 5G > A-WT 30 2789 + 5G > A-M 31 3120 +
1G-WT 32 3120 + 1G-WT 33 D1152-WT 34 D1152-M 35 R1162-WT 36 R1162-M
37 OLIGO-C 38 W1282X-WT 39 W1282-M 40 N1303K-WT 41 N1303-M 42
R334-WT 43 R334-M 44 1078delT-WT 45 1078delT-M 46 3849-10kb-WT 47
3849-10kb-M 49 1717-1G > A-WT 50 1717-1G > A-WT 51 Biotin
Example 27
Identification of Three or More Base Deletions and/or Insertions by
eMAP
[0257] Elongation was used to analyze mutations with more than 3
base deletions or insertions. Probes were designed by placing
mutant bases 3-5 base before 3' end. The wild type probes were
designed to either include or exclude mutant bases (terminating
before mutations). The following is an example of mutations caused
by a deletion of ATCTC and/or insertion of AGGTA. The probe designs
are as follows:
[0258] 1. WT1-- - - - ATCTCgca
[0259] 2. WT2-- - - -
[0260] 3. M1-- - - - gca (deletion only)
[0261] 4. M2-- - - - AGGTAgca (deletion and insertion)
[0262] Wild type probes were either coupled on the surface of
differentially encoded beads or pooled as described in this
invention. Probes for mutation 1 (M1: deletion) and 2 (M2:
insertion) were coupled on different beads. Both wild type probes
provide similar information, while the mutant probes can show the
type of mutation identified in a specific sample.
Example 28
Hairpin Probes
[0263] In certain embodiments of this invention, bead-displayed
priming probes form hairpin structures. A hairpin structure may
include a sequence fragment at the 5' end that is complementary to
the TEI region and the DA sequence, as shown in FIG. 23. During a
competitive hybridization reaction, the hairpin structure opens
whenever the DA region preferentially hybridizes with the target
sequence. Under this condition, the TEI region will align with the
designated polymorphic site and the elongation reaction will occur.
The competitive nature of the reaction can be used to control
tolerance level of probes.
Example 29
Analysis of Cystic Fibrosis and Ashkenazi Jewish Disease Mutations
by Multiplexed Elongation of Allele Specific Oligonucleotides
Displayed on Custom Bead Arrays
[0264] A novel assay for the high throughput multiplexed analysis
of mutations has been evaluated for ACMG+ panel of Cystic Fibrosis
mutations. In addition, an Ashkenazi Jewish disease panel also -has
been developed to detect common mutations known to cause Tay-Sachs,
Canavan, Gaucher, Niemann-Pick, Bloom Syndrome, Fancomi Anemia,
Familial Dysautonomia, and mucolipodosis IV.
[0265] In elongated-mediated multiplexed analysis of polymorphisms
(eMAP), allele specific oligonucleotides (ASO) containing variable
3' terminal sequences are attached to color-encoded beads which are
in turn arrayed on silicon chips. Elongation products for normal
and mutant sequences are simultaneously detected by instant imaging
of fluorescence signals from the entire array.
[0266] In this example, several hundred clinical patient samples
were used to evaluate ACMG CF bead chips. As shown in FIG. 24, the
assay correctly scored all of the mutations identified by standard
DNA analysis.
[0267] In summary, a multiplexed elongation assay comprising
customized beads was used to study mutations corresponding to ACMG+
and Ashkenazi disease panels. The customized beads can be used for
DNA and protein analysis. The use of these customized beads are
advantageous for several reasons including (1) instant imaging--the
turnaround time for the assay is within two hours (2) automated
image acquisition and analysis (3) miniaturization, which means low
reagent consumption, and (4) the beadchips are synthesized using
wafer technology, so that millions of chips can be mass-produced,
if desired.
* * * * *
References