U.S. patent application number 10/413041 was filed with the patent office on 2003-12-25 for unimolecular segment amplification and sequencing.
Invention is credited to Caplan, Michael, Lizardi, Paul M..
Application Number | 20030235849 10/413041 |
Document ID | / |
Family ID | 26688937 |
Filed Date | 2003-12-25 |
United States Patent
Application |
20030235849 |
Kind Code |
A1 |
Lizardi, Paul M. ; et
al. |
December 25, 2003 |
Unimolecular segment amplification and sequencing
Abstract
Disclosed are compositions and a method for amplification of and
multiplex detection of molecules of interest involving rolling
circle replication. The method is useful for simultaneously
detecting multiple specific nucleic acids in a sample with high
specificity and sensitivity. The method also has an inherently low
level of background signal. A preferred form of the method consists
of an association operation, an amplification operation, and a
detection operation. The association operation involves association
of one or more specially designed probe molecules, either wholly or
partly nucleic acid, to target molecules of interest. This
operation associates the probe molecules to a target molecules
present in a sample. The amplification operation is rolling circle
replication of circular nucleic acid molecules, termed
amplification target circles, that are either a part of, or
hybridized to, the probe molecules. A single round of amplification
using rolling circle replication results in a large amplification
of the amplification target circles. Following rolling circle
replication, the amplified sequences are detected using
combinatorial multicolor coding probes that allow separate,
simultaneous, and quantitative detection of multiple different
amplified target circles representing multiple different target
molecules. Since the amplified product is directly proportional to
the amount of target sequence present in a sample, quantitative
measurements reliably represent the amount of a target sequence in
a sample. Major advantages of this method are that a large number
of distinct target molecules can be detected simultaneously, and
that differences in the amounts of the various target molecules in
a sample can be accurately quantified. It is also advantageous that
the DNA replication step is isothermal, and that signals are
strictly quantitative because the amplification reaction is linear
and is catalyzed by a highly processive enzyme.
Inventors: |
Lizardi, Paul M.;
(Cuernavaca, MX) ; Caplan, Michael; (Woodbridge,
CT) |
Correspondence
Address: |
NEEDLE & ROSENBERG, P.C.
SUITE 1000
999 PEACHTREE STREET
ATLANTA
GA
30309-3915
US
|
Family ID: |
26688937 |
Appl. No.: |
10/413041 |
Filed: |
April 10, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10413041 |
Apr 10, 2003 |
|
|
|
09841513 |
Apr 24, 2001 |
|
|
|
6632609 |
|
|
|
|
09841513 |
Apr 24, 2001 |
|
|
|
09602428 |
Jun 23, 2000 |
|
|
|
6329150 |
|
|
|
|
09602428 |
Jun 23, 2000 |
|
|
|
08754681 |
Nov 21, 1996 |
|
|
|
6143495 |
|
|
|
|
08754681 |
Nov 21, 1996 |
|
|
|
08563912 |
Nov 21, 1995 |
|
|
|
5854033 |
|
|
|
|
60016677 |
May 1, 1996 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6853 20130101; C12Q 1/6862 20130101; C12Q 1/6844 20130101;
C12Q 2563/131 20130101; C12Q 2531/125 20130101; C12Q 2563/131
20130101; C12Q 2525/307 20130101; C12Q 2531/125 20130101; C12Q
2565/102 20130101; C12Q 2525/307 20130101; C12Q 2537/125 20130101;
C12Q 2563/179 20130101; C12Q 2525/161 20130101; C12Q 2531/119
20130101; C12Q 2537/143 20130101; C12Q 2537/143 20130101; C12Q
2525/307 20130101; C12Q 2525/161 20130101; C12Q 2531/125 20130101;
C12Q 2537/143 20130101; C12Q 2565/102 20130101; C12Q 2525/307
20130101; C12Q 2563/131 20130101; C12Q 2525/161 20130101; C12Q
2531/125 20130101; C12Q 2531/125 20130101; C12Q 2531/125 20130101;
C12Q 2565/102 20130101; C12Q 2537/143 20130101; C12Q 2531/143
20130101; C12Q 2531/125 20130101; C12Q 2525/161 20130101; C12Q
2531/125 20130101; C12Q 2537/143 20130101; C12Q 1/6844 20130101;
C12Q 1/6804 20130101; C12Q 2563/131 20130101; C12Q 1/6809 20130101;
C12Q 1/6816 20130101; C12Q 1/6853 20130101; C12Q 1/6862 20130101;
C12Q 1/6809 20130101; C12Q 1/6804 20130101; C12Q 1/6844 20130101;
C12Q 1/6853 20130101; C12Q 1/6844 20130101; C12Q 2539/113 20130101;
C12Q 2565/102 20130101; C12Q 1/6809 20130101; C12Q 1/6816 20130101;
C12Q 1/6862 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim:
1. A method of amplifying nucleic acid sequences, the method
comprising, (a) mixing one or more rolling circle replication
primers with one or more amplification target circles, to produce a
primer-ATC mixture, and incubating the primer-ATC mixture under
conditions that promote hybridization between the amplification
target circles and the rolling circle replication primers in the
primer-ATC mixture, wherein the amplification target circles each
comprise a single-stranded, circular DNA molecule comprising a
primer complement portion, wherein the primer complement portion is
complementary to at least one of the rolling circle replication
primers, and (b) mixing DNA polymerase with the primer-ATC mixture,
to produce a polymerase-ATC mixture, and incubating the
polymerase-ATC mixture under conditions that promote replication of
the amplification target circles, wherein replication of the
amplification target circles results in the formation of tandem
sequence DNA; wherein the method further comprises at least one of
the following: (1) an amplification operation, (2) the use of at
least one rolling circle replication primer coupled to a specific
binding molecule, (3) the use of at least one amplification target
circle tethered to a specific binding molecule, (4) a nucleic acid
collapse operation, (5) a combinatorial multicolor coding detection
operation, (6) differential amplification of at least two of the
amplification target circles, and (7) primer-extension sequencing,
wherein the amplification operation (i) is performed simultaneous
with, or following step (b), (ii) is selected from the group
consisting of nested ligation mediated rolling circle
amplification, secondary DNA strand displacement, and
transcription, and (iii) results in the formation of secondary
tandem sequence DNA or tandem sequence RNA.
2. The method of claim 1 wherein at least one of the rolling circle
replication primers is coupled to a specific binding molecule,
wherein the specific binding molecule interacts with a target
molecule, or at least one of the amplification target circles is
tethered to a specific binding molecule, wherein the specific
binding molecule interacts with a target molecule.
3. The method of claim 2 wherein the method includes at least one
of the following: (1) the amplification operation, (2) the use of a
solid-state sample wherein the solid-state sample comprises the
target molecule, (3) a step of bringing the specific binding
molecule into contact with the target molecule, (4) the nucleic
acid collapse operation, (5) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (6)
differential amplification of at least two of the amplification
target circles, and (7) primer-extension sequencing.
4. The method of claim 2 wherein the target molecule is a primary
amplification target circle, wherein the primary amplification
target circle is formed by (i) mixing an open circle probe with a
primary target sample, to produce an OCP-target sample mixture, and
incubating the OCP-target sample mixture under conditions that
promote hybridization between the open circle probe and a primary
target sequence in the OCP-target sample mixture, wherein the
primary target sequence comprises a 5' region and a 3' region, and
wherein the open circle probe comprises a single-stranded, linear
DNA molecule comprising, from 5' end to 3' end, a 5' phosphate
group, a right target probe portion, a spacer portion, a left
target probe portion, and a 3' hydroxyl group, wherein the left
target probe portion is complementary to the 3' region of the
primary target sequence and the right target probe portion is
complementary to the 5' region of the primary target sequence, (ii)
mixing ligase with the OCP-target sample mixture, to produce a
ligation mixture, and incubating the ligation mixture under
conditions that promote ligation of the open circle probe resulting
in the formation of the primary amplification target circle.
5. The method of claim 1 wherein the method includes the
amplification operation and wherein the amplification operation
comprises, simultaneous with, or following, step (b), (c) mixing
RNA polymerase with the polymerase-ATC mixture, and incubating the
polymerase-ATC mixture under conditions that promote transcription
of the tandem sequence DNA, wherein transcription of the tandem
sequence DNA results in the formation of tandem sequence RNA, or
(c) mixing a secondary DNA strand displacement primer with the
polymerase-ATC mixture, and incubating the polymerase-ATC mixture
under conditions that promote (i) hybridization between the tandem
sequence DNA and the secondary DNA strand displacement primer, and
(ii) replication of the tandem sequence DNA in the polymerase-ATC
mixture, wherein replication of the tandem sequence DNA results in
the formation of secondary tandem sequence DNA.
6. The method of claim 5 wherein the amplification operation
comprises, (c) mixing a secondary DNA strand displacement primer
with the polymerase-ATC mixture, and incubating the polymerase-ATC
mixture under conditions that promote (i) hybridization between the
tandem sequence DNA and the secondary DNA strand displacement
primer, and (ii) replication of the tandem sequence DNA in the
polymerase-ATC mixture, wherein replication of the tandem sequence
DNA results in the formation of secondary tandem sequence DNA, and
(d) mixing RNA polymerase with the polymerase-ATC mixture, and
incubating the polymerase-ATC mixture under conditions that promote
transcription of the secondary tandem sequence DNA, wherein
transcription of the secondary tandem sequence DNA results in the
formation of tandem sequence RNA.
7. The method of claim 6 wherein the method includes at least one
of the following: (1) the nucleic acid collapse operation, (2) a
multiplex detection operation comprising separately and
simultaneously detecting a plurality of different sequences present
in the tandem sequence DNA, (3) differential amplification of at
least two of the amplification target circles, and (4)
primer-extension sequencing.
8. The method of claim 1 wherein the method includes at least one
of the following: (1) the nucleic acid collapse operation, (2) a
multiplex detection operation comprising separately and
simultaneously detecting a plurality of different sequences present
in the tandem sequence DNA, (3) differential amplification of at
least two of the amplification target circles, and (4)
primer-extension sequencing.
9. The method of claim 8 wherein the method includes, following the
formation of tandem sequence DNA, secondary tandem sequence DNA, or
tandem sequence RNA, primer extension sequencing, wherein primer
extension sequencing comprises (i) forming an interrogation
mixture, wherein one or more interrogation primers are hybridized
to the tandem sequence DNA, secondary tandem sequence DNA, or
tandem sequence RNA, (ii) simultaneous with, or following, step
(i), mixing at least two different tagged chain terminating
nucleotides and DNA polymerase with the interrogation mixture,
wherein each different tagged chain terminating nucleotide
comprises a different chain terminating nucleotide triphosphate
coupled to a different tag molecule, (iii) incubating the
interrogation mixture under conditions that promote template-based
addition of the tagged chain terminating nucleotides to the
interrogation primers, wherein addition of the tagged chain
terminating nucleotides to the interrogation primers results in
association of the tagged chain terminating nucleotides with the
tandem sequence DNA, secondary tandem sequence DNA, or tandem
sequence RNA, and (iv) detecting the association of the tagged
chain terminating nucleotides with the tandem sequence DNA,
secondary tandem sequence DNA, or tandem sequence RNA.
10. The method of claim 9 wherein formation of the interrogation
mixture comprises (i)(a) mixing an interrogation probe and a
plurality of degenerate probes with the tandem sequence DNA,
secondary tandem sequence DNA, or tandem sequence RNA, to produce a
probe mixture, under conditions that promote hybridization between
(1) the tandem sequence DNA, secondary tandem sequence DNA, or
tandem sequence RNA, and (2) the interrogation probe and degenerate
probes, wherein each degenerate probe has a 3' blocking group,
(i)(b) mixing ligase with the probe mixture, to produce a
degenerate ligation mixture, and incubating the degenerate ligation
mixture under conditions that promote ligation of the interrogation
probe to one of the degenerate probes hybridized to the tandem
sequence DNA, secondary tandem sequence DNA, or tandem sequence
RNA, wherein the degenerate probe that is ligated to the
interrogation probe is a ligated degenerate probe, (i)(c) removing
the 3' blocking group of the ligated degenerate probe, wherein
ligation of the interrogation probe to one or more degenerate
probes results in the formation of the interrogation primer,
wherein the formation of the interrogation primer results in
formation of the interrogation mixture.
11. The method of claim 10 wherein formation of the interrogation
mixture further comprises, following step (i)(c), (i)(d) mixing the
plurality of degenerate probes with the ligation mixture, to
produce a secondary probe mixture, under conditions that promote
hybridization between (1) the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA, and (2) the degenerate
probes, (i)(e) mixing ligase with the secondary probe mixture, to
produce a secondary degenerate ligation mixture, and incubating the
secondary degenerate ligation mixture under conditions that promote
ligation of the ligated degenerate probe to one of the degenerate
probes hybridized to the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA, wherein the degenerate probe
that is ligated to the ligated degenerate probe is a secondary
ligated degenerate probe, (i)(f) removing the 3' blocking group of
the secondary degenerate probe, wherein steps (i)(d), (i)(e), and
(i)(f) are performed, in order, one or more times.
12. The method of claim 9 wherein formation of the interrogation
mixture comprises mixing an interrogation primer with the tandem
sequence DNA, secondary tandem sequence DNA, or tandem sequence
RNA, under conditions that promote hybridization between (1) the
tandem sequence DNA, secondary tandem sequence DNA, or tandem
sequence RNA, and (2) the interrogation primer.
13. The method of claim 8 wherein the method includes the
combinatorial multicolor coding detection operation, and wherein
the combinatorial multicolor coding detection operation comprises
separately and simultaneously detecting a plurality of different
sequences present in the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA by mixing a set of detection
probes with the tandem sequence DNA, secondary tandem sequence DNA,
or tandem sequence RNA, under conditions that promote hybridization
between (i) the tandem sequence DNA, secondary tandem sequence DNA,
or tandem sequence RNA, and (ii) the detection probes, wherein the
set of detection probes is labeled using combinatorial multicolor
coding.
14. A method of amplifying nucleic acid sequences, the method
comprising, (a) mixing one or more different open circle probes
with a target sample comprising one or more target sequences, to
produce an OCP-target sample mixture, and incubating the OCP-target
sample mixture under conditions that promote hybridization between
the open circle probes and the target sequences in the OCP-target
sample mixture, (b) mixing ligase with the OCP-target sample
mixture, to produce a ligation mixture, and incubating the ligation
mixture under conditions that promote ligation of the open circle
probes to form amplification target circles, (c) mixing a rolling
circle replication primer with the ligation mixture, to produce a
primer-ATC mixture, and incubating the primer-ATC mixture under
conditions that promote hybridization between the amplification
target circles and the rolling circle replication primer in the
primer-ATC mixture, and (d) mixing DNA polymerase with the
primer-ATC mixture, to produce a polymerase-ATC mixture, and
incubating the polymerase-ATC mixture under conditions that promote
replication of the amplification target circles, wherein
replication of the amplification target circle results in the
formation of tandem sequence DNA; wherein the method further
comprises at least one of the following: (1) an amplification
operation, (2) the use of at least one rolling circle replication
primer that is coupled to a specific binding molecule, (3) the use
of a reporter binding agent as at least one of the target
sequences, (4) a nucleic acid collapse operation, (5) a
combinatorial multicolor coding detection operation, (6)
differential amplification, and (7) primer-extension sequencing,
(8) the use of one or more gap oligonucleotides, (9) the use of a
primary amplification target circle as at least one of the target
sequences, wherein the amplification operation (i) is performed
simultaneous with, or following step (d), (ii) is selected from the
group consisting of nested ligation mediated rolling circle
amplification, secondary DNA strand displacement, and
transcription, and (iii) results in the formation of secondary
tandem sequence DNA or tandem sequence RNA, and wherein the primary
amplification target circle is formed by (i) mixing a primary open
circle probe with a primary target sample, to produce a primary
OCP-target sample mixture, and incubating the primary OCP-target
sample mixture under conditions that promote hybridization between
the primary open circle probe and a primary target sequence in the
primary OCP-target sample mixture, wherein the primary target
sequence comprises a 5' region and a 3' region, and wherein the
primary open circle probe comprises a single-stranded, linear DNA
molecule comprising, from 5' end to 3' end, a 5' phosphate group, a
right target probe portion, a spacer portion, a left target probe
portion, and a 3' hydroxyl group, wherein the left target probe
portion is complementary to the 3' region of the primary target
sequence and the right target probe portion is complementary to the
5' region of the primary target sequence, (ii) mixing ligase with
the primary OCP-target sample mixture, to produce a primary
ligation mixture, and incubating the primary ligation mixture under
conditions that promote ligation of the primary open circle probe
resulting in the formation of the primary amplification target
circle.
15. The method of claim 14 wherein the target sequences each
comprise a 5' region and a 3' region, wherein the open circle
probes each comprise a single-stranded, linear DNA molecule
comprising, from 5' end to 3' end, a 5' phosphate group, a right
target probe portion, a spacer portion, a left target probe
portion, and a 3' hydroxyl group, wherein the spacer portion
comprises a primer complement portion, and wherein the left target
probe portion and the right target probe portion of the same open
circle probe are each complementary to the 3' region and the 5'
region, respectively, of the same target sequence, wherein at least
one of the target sequences further comprises a central region
located between the 5' region and the 3' region, wherein neither
the left target probe portion of the open circle probe nor the
right target probe portion of any of the open circle probes is
complementary to the central region of the target sequences, and
wherein step (a) further comprises, prior to incubating, mixing one
or more gap oligonucleotides with the target sample, such that the
OCP-target sample mixture comprises the one or more open circle
probes, the one or more gap oligonucleotides, and the target
sample, wherein each gap oligonucleotide comprises a
single-stranded, linear DNA molecule comprising a 5' phosphate
group and a 3' hydroxyl group, wherein each gap oligonucleotide is
complementary all or a portion of the central region of at least
one of the target sequences.
16. The method of claim 15 wherein the method includes the
amplification operation and wherein the amplification operation
comprises, simultaneous with, or following, step (d), (e) mixing
RNA polymerase with the polymerase-ATC mixture, and incubating the
polymerase-ATC mixture under conditions that promote transcription
of the tandem sequence DNA, wherein transcription of the tandem
sequence DNA results in the formation of tandem sequence RNA, or
(e) mixing a secondary DNA strand displacement primer with the
polymerase-ATC mixture, and incubating the polymerase-ATC mixture
under conditions that promote (i) hybridization between the tandem
sequence DNA and the secondary DNA strand displacement primer, and
(ii) replication of the tandem sequence DNA in the polymerase-ATC
mixture, wherein replication of the tandem sequence DNA results in
the formation of secondary tandem sequence DNA.
17. The method of claim 16 wherein the method includes at least one
of the following: (1) the use of a solid-state sample wherein the
solid-state sample comprises the target molecule, (2) the nucleic
acid collapse operation, (3) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (4)
differential amplification of at least two of the amplification
target circles, and (5) primer-extension sequencing.
18. The method of claim 15 wherein at least one of the target
sequences is coupled to a specific binding molecule, wherein the
specific binding molecule interacts with a target molecule.
19. The method of claim 18 wherein the method includes at least one
of the following: (1) the amplification operation, (2) the use of a
solid-state sample wherein the solid-state sample comprises the
target molecule, (3) a step of bringing the specific binding
molecule into contact with the target molecule, (4) the nucleic
acid collapse operation, (5) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (6)
differential amplification of at least two of the amplification
target circles, and (7) primer-extension sequencing.
20. The method of claim 15 wherein at least one of the rolling
circle replication primers is coupled to a specific binding
molecule, wherein the specific binding molecule interacts with a
target molecule.
21. The method of claim 20 wherein the method includes at least one
of the following: (1) the amplification operation, (2) the use of a
solid-state sample wherein the solid-state sample comprises the
target molecule, (3) a step of bringing the specific binding
molecule into contact with the target molecule, (4) the nucleic
acid collapse operation, (5) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (6)
differential amplification of at least two of the amplification
target circles, and (7) primer-extension sequencing.
22. The method of claim 15 wherein the method further comprises at
least one of the following: (1) the nucleic acid collapse
operation, (2) a multiplex detection operation comprising
separately and simultaneously detecting a plurality of different
sequences present in the tandem sequence DNA, (3) differential
amplification of at least two of the amplification target circles,
and (4) primer-extension sequencing.
23. The method of claim 22 wherein the method includes the
combinatorial multicolor coding detection operation, and wherein
the combinatorial multicolor coding detection operation comprises
separately and simultaneously detecting a plurality of different
sequences present in the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA by mixing a set of detection
probes with the tandem sequence DNA, secondary tandem sequence DNA,
or tandem sequence RNA, under conditions that promote hybridization
between (i) the tandem sequence DNA, secondary tandem sequence DNA,
or tandem sequence RNA, and (ii) the detection probes, wherein the
set of detection probes is labeled using combinatorial multicolor
coding.
24. The method of claim 15 wherein the target molecule is part of a
solid-state sample.
25. The method of claim 24 wherein the method includes at least one
of the following: (1) the nucleic acid collapse operation, (2) a
multiplex detection operation comprising separately and
simultaneously detecting a plurality of different sequences present
in the tandem sequence DNA, (3) differential amplification of at
least two of the amplification target circles, and (4)
primer-extension sequencing.
26. The method of claim 14 wherein the method includes the
amplification operation and wherein the amplification operation
comprises, simultaneous with, or following, step (d), (e) mixing
RNA polymerase with the polymerase-ATC mixture, and incubating the
polymerase-ATC mixture under conditions that promote transcription
of the tandem sequence DNA, wherein transcription of the tandem
sequence DNA results in the formation of tandem sequence RNA, or
(e) mixing a secondary DNA strand displacement primer with the
polymerase-ATC mixture, and incubating the polymerase-ATC mixture
under conditions that promote (i) hybridization between the tandem
sequence DNA and the secondary DNA strand displacement primer, and
(ii) replication of the tandem sequence DNA in the polymerase-ATC
mixture, wherein replication of the tandem sequence DNA results in
the formation of secondary tandem sequence DNA.
27. The method of claim 26 wherein the method includes at least one
of the following: (1) the use of a solid-state sample wherein the
solid-state sample comprises the target molecule, (2) the nucleic
acid collapse operation, (3) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (4)
differential amplification of at least two of the amplification
target circles, and (5) primer-extension sequencing.
28. The method of claim 14 wherein at least one of the target
sequences is coupled to a specific binding molecule, wherein the
specific binding molecule interacts with a target molecule.
29. The method of claim 28 wherein the method includes at least one
of the following: (1) the amplification operation, (2) the use of a
solid-state sample wherein the solid-state sample comprises the
target molecule, (3) a step of bringing the specific binding
molecule into contact with the target molecule, (4) the nucleic
acid collapse operation, (5) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (6)
differential amplification of at least two of the amplification
target circles, and (7) primer-extension sequencing.
30. The method of claim 14 wherein at least one of the rolling
circle replication primers is coupled to a specific binding
molecule, wherein the specific binding molecule interacts with a
target molecule.
31. The method of claim 30 wherein the method includes at least one
of the following: (1) the amplification operation, (2) the use of a
solid-state sample wherein the solid-state sample comprises the
target molecule, (3) a step of bringing the specific binding
molecule into contact with the target molecule, (4) the nucleic
acid collapse operation, (5) a multiplex detection operation
comprising separately and simultaneously detecting a plurality of
different sequences present in the tandem sequence DNA, (6)
differential amplification of at least two of the amplification
target circles, and (7) primer-extension sequencing.
32. The method of claim 14 wherein the method includes at least one
of the following: (1) the nucleic acid collapse operation, (2) a
multiplex detection operation comprising separately and
simultaneously detecting a plurality of different sequences present
in the tandem sequence DNA, (3) differential amplification of at
least two of the amplification target circles, and (4)
primer-extension sequencing.
33. The method of claim 32 wherein the method includes, following
the formation of tandem sequence DNA, secondary tandem sequence
DNA, or tandem sequence RNA, primer extension sequencing, wherein
primer extension sequencing comprises (i) forming an interrogation
mixture, wherein one or more interrogation primers are hybridized
to the tandem sequence DNA, secondary tandem sequence DNA, or
tandem sequence RNA, (ii) simultaneous with, or following, step
(i), mixing at least two different tagged chain terminating
nucleotides and DNA polymerase with the interrogation mixture,
wherein each different tagged chain terminating nucleotide
comprises a different chain terminating nucleotide triphosphate
coupled to a different tag molecule, (iii) incubating the
interrogation mixture under conditions that promote template-based
addition of the tagged chain terminating nucleotides to the
interrogation primers, wherein addition of the tagged chain
terminating nucleotides to the interrogation primers results in
association of the tagged chain terminating nucleotides with the
tandem sequence DNA, secondary tandem sequence DNA, or tandem
sequence RNA, and (iv) detecting the association of the tagged
chain terminating nucleotides with the tandem sequence DNA,
secondary tandem sequence DNA, or tandem sequence RNA.
34. The method of claim 33 wherein formation of the interrogation
mixture comprises (i)(a) mixing an interrogation probe and a
plurality of degenerate probes with the tandem sequence DNA,
secondary tandem sequence DNA, or tandem sequence RNA, to produce a
probe mixture, under conditions that promote hybridization between
(1) the tandem sequence DNA, secondary tandem sequence DNA, or
tandem sequence RNA, and (2) the interrogation probe and degenerate
probes, wherein each degenerate probe has a 3' blocking group,
(i)(b) mixing ligase with the probe mixture, to produce a
degenerate ligation mixture, and incubating the degenerate ligation
mixture under conditions that promote ligation of the interrogation
probe to one of the degenerate probes hybridized to the tandem
sequence DNA, secondary tandem sequence DNA, or tandem sequence
RNA, wherein the degenerate probe that is ligated to the
interrogation probe is a ligated degenerate probe, (i)(c) removing
the 3' blocking group of the ligated degenerate probe, wherein
ligation of the interrogation probe to one or more degenerate
probes results in the formation of the interrogation primer,
wherein the formation of the interrogation primer results in
formation of the interrogation mixture.
35. The method of claim 34 wherein formation of the interrogation
mixture further comprises, following step (i)(c), (i)(d) mixing the
plurality of degenerate probes with the ligation mixture, to
produce a secondary probe mixture, under conditions that promote
hybridization between (1) the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA, and (2) the degenerate
probes, (i)(e) mixing ligase with the secondary probe mixture, to
produce a secondary degenerate ligation mixture, and incubating the
secondary degenerate ligation mixture under conditions that promote
ligation of the ligated degenerate probe to one of the degenerate
probes hybridized to the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA, wherein the degenerate probe
that is ligated to the ligated degenerate probe is a secondary
ligated degenerate probe, (i)(f) removing the 3' blocking group of
the secondary degenerate probe, wherein steps (i)(d), (i)(e), and
(i)(f) are performed, in order, one or more times.
36. The method of claim 33 wherein formation of the interrogation
mixture comprises mixing an interrogation primer with the tandem
sequence DNA, secondary tandem sequence DNA, or tandem sequence
RNA, under conditions that promote hybridization between (1) the
tandem sequence DNA, secondary tandem sequence DNA, or tandem
sequence RNA, and (2) the interrogation primer.
37. The method of claim 32 wherein the method includes the
combinatorial multicolor coding detection operation, and wherein
the combinatorial multicolor coding detection operation comprises
separately and simultaneously detecting a plurality of different
sequences present in the tandem sequence DNA, secondary tandem
sequence DNA, or tandem sequence RNA by mixing a set of detection
probes with the tandem sequence DNA, secondary tandem sequence DNA,
or tandem sequence RNA, under conditions that promote hybridization
between (i) the tandem sequence DNA, secondary tandem sequence DNA,
or tandem sequence RNA, and (ii) the detection probes, wherein the
set of detection probes is labeled using combinatorial multicolor
coding.
38. The method of claim 14 wherein the target molecule is part of a
solid-state sample.
39. The method of claim 38 wherein the method further comprises at
least one of the following: (1) the nucleic acid collapse
operation, (2) a multiplex detection operation comprising
separately and simultaneously detecting a plurality of different
sequences present in the tandem sequence DNA, (3) differential
amplification of at least two of the amplification target circles,
and (4) primer-extension sequencing.
40. A kit for selectively detecting one or more target molecules,
the kit comprising, (a) one or more amplification target circles,
wherein the amplification target circles each comprise a
single-stranded, circular DNA molecule comprising a primer
complement portion, and (b) a rolling circle replication primer
comprising a single-stranded, linear nucleic acid molecule
comprising a complementary portion that is complementary to the
primer complement portion of one or more of the amplification
target circles, wherein either (1) each amplification target circle
is tethered to a specific binding molecule, or (2) the rolling
circle replication primer is coupled to a specific binding
molecule, wherein the specific binding molecule interacts with at
least one of the target molecules.
41. The kit of claim 40 further comprising a secondary DNA strand
displacement primer comprising a single-stranded, linear nucleic
acid molecule comprising a matching portion that matches a portion
of one or more of the amplification target circles.
42. The kit of claim 40 further comprising an interrogation probe
and a plurality of degenerate probes.
43. The kit of claim 40 further comprising an interrogation
primer.
44. A kit for selectively amplifying nucleic acid sequences related
to one or more target sequences, each comprising a 5' region and a
3' region, the kit comprising, (a) one or more open circle probes
each comprising a single-stranded, linear DNA molecule comprising,
from 5' end to 3' end, a 5' phosphate group, a right target probe
portion, a spacer portion, a left target probe portion, and a 3'
hydroxyl group, wherein the spacer portion comprises a primer
complement portion, and wherein the left target probe portion is
complementary to the 3' region of at least one of the target
sequences and the right target probe portion is complementary to
the 5' region of the same target sequence, (b) a rolling circle
replication primer comprising a single-stranded, linear nucleic
acid molecule comprising a complementary portion that is
complementary to the primer complement portion of one or more of
the open circle probes, and (c) one or both of (1) a secondary DNA
strand displacement primer comprising a single-stranded, linear
nucleic acid molecule comprising a matching portion that matches a
portion of one or more of the open circle probes, and (2) one or
more reporter binding agents each comprising an affinity portion
and an oligonucleotide portion, wherein the oligonucleotide portion
comprises one of the target sequences.
45. The kit of claim 44 further comprising one or more gap
oligonucleotides, wherein at least one of the target sequences
further comprises a central region located between the 5' region
and the 3' region, wherein neither the left target probe portion of
the open circle probe nor the right target probe portion of the
open circle probe is complementary to the central region, and
wherein each gap oligonucleotide comprises a single-stranded,
linear DNA molecule comprising a 5' phosphate group and a 3'
hydroxyl group, wherein each gap oligonucleotide is complementary
all or a portion of the central region of at least one of the
target sequences.
46. The kit of claim 44 further comprising an interrogation probe
and a plurality of degenerate probes.
47. The kit of claim 44 further comprising an interrogation primer.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 08/563,912, filed Nov. 21, 1995. This
application also claims benefit of U.S. Provisional Application No.
60/016,677, filed May 1, 1996.
BACKGROUND OF THE INVENTION
[0002] The disclosed invention is generally in the field of assays
for detection of nucleic acids, and specifically in the field of
nucleic acid amplification and sequencing.
[0003] A number of methods have been developed which permit the
implementation of extremely sensitive diagnostic assays based on
nucleic acid detection. Most of these methods employ exponential
amplification of targets or probes. These include the polymerase
chain reaction (PCR), ligase chain reaction (LCR), self-sustained
sequence replication (3SR), nucleic acid sequence based
amplification (NASBA), strand displacement amplification (SDA), and
amplification with Q.beta. replicase (Birkenmeyer and Mushahwar, J.
Virological Methods, 35:117-126 (1991); Landegren, Trends Genetics,
9:199-202 (1993)).
[0004] While all of these methods offer good sensitivity, with a
practical limit of detection of about 100 target molecules, all of
them suffer from relatively low precision in quantitative
measurements. This lack of precision manifests itself most
dramatically when the diagnostic assay is implemented in multiplex
format, that is, in a format designed for the simultaneous
detection of several different target sequences.
[0005] In practical diagnostic applications it is desirable to
assay for many targets simultaneously. Such multiplex assays are
typically used to detect five or more targets. It is also desirable
to obtain accurate quantitative data for the targets in these
assays. For example, it has been demonstrated that viremia can be
correlated with disease status for viruses such as HIV-1 and
hepatitis C (Lefrere et al., Br. J. Haematol., 82(2):467-471
(1992), Gunji et al., Int. J. Cancer, 52(5):726-730 (1992),
Hagiwara et al., Hepatology, 17(4):545-550 (1993), Lu et al., J.
Infect. Dis., 168(5):1165-8116 (1993), Piatak et al., Science,
259(5102):1749-1754 (1993), Gupta et al., Ninth International
Conference on AIDS/Fourth STD World Congress, Jun. 7-11, 1993,
Berlin, Germany, Saksela et al., Proc. Natl. Acad. Sci. USA,
91(3):1104-1108 (1994)). A method for accurately quantitating viral
load would be useful.
[0006] In a multiplex assay, it is especially desirable that
quantitative measurements of different targets accurately reflect
the true ratio of the target sequences. However, the data obtained
using multiplexed, exponential nucleic acid amplification methods
is at best semi-quantitative. A number of factors are involved:
[0007] 1. When a multiplex assay involves different priming events
for different target sequences, the relative efficiency of these
events may vary for different targets. This is due to the stability
and structural differences between the various primers used.
[0008] 2. If the rates of product strand renaturation differ for
different targets, the extent of competition with priming events
will not be the same for all targets.
[0009] 3. For reactions involving multiple ligation events, such as
LCR, there may be small but significant differences in the relative
efficiency of ligation events for each target sequence. Since the
ligation events are repeated many times, this effect is
magnified.
[0010] 4. For reactions involving reverse transcription (3SR,
NASBA) or klenow strand displacement (SDA), the extent of
polymerization processivity may differ among different target
sequences.
[0011] 5. For assays involving different replicatable RNA probes,
the replication efficiency of each probe is usually not the same,
and hence the probes compete unequally in replication reactions
catalyzed by Q.beta. replicase.
[0012] 6. A relatively small difference in yield in one cycle of
amplification results in a large difference in amplification yield
after several cycles. For example, in a PCR reaction with 25
amplification cycles and a 10% difference in yield per cycle, that
is, 2-fold versus 1.8-fold amplification per cycle, the yield would
be 2.0.sup.25=33,554,000 versus 1.8.sup.25=2,408,800. The
difference in overall yield after 25 cycles is 14-fold. After 30
cycles of amplification, the yield difference would be more than
20-fold.
[0013] Accordingly, there is a need for amplification methods that
are less likely to produce variable and possibly erroneous signal
yields in multiplex assays.
[0014] It is therefore an object of the disclosed invention to
provide a method of amplifying diagnostic nucleic acids with
amplification yields proportional to the amount of a target
sequence in a sample.
[0015] It is another object of the disclosed invention to provide a
method of detecting specific target nucleic acid sequences present
in a sample where detection efficiency is not dependent on the
structure of the target sequences.
[0016] It is another object of the disclosed invention to provide a
method of determining the amount of specific target nucleic acid
sequences present in a sample where the signal level measured is
proportional to the amount of a target sequence in a sample and
where the ratio of signal levels measured for different target
sequences substantially matches the ratio of the amount of the
different target sequences present in the sample.
[0017] It is another object of the disclosed invention to provide a
method of detecting and determining the amount of multiple specific
target nucleic acid sequences in a single sample where the ratio of
signal levels measured for different target nucleic acid sequences
substantially matches the ratio of the amount of the different
target nucleic acid sequences present in the sample.
[0018] It is another object of the disclosed invention to provide a
method of detecting the presence of single copies of target nucleic
acid sequences in situ.
[0019] It is another object of the disclosed invention to provide a
method of detecting the presence of target nucleic acid sequences
representing individual alleles of a target genetic element.
[0020] It is another object of the disclosed invention to provide a
method for detecting, and determining the relative amounts of,
multiple molecules of interest in a sample.
[0021] It is another object of the disclosed invention to provide a
method for determining the sequence of a target nucleic acid
sequence.
[0022] It is another object of the present invention to provide a
method of determining the range of sequences present in a mixture
of target nucleic acid sequences.
SUMMARY OF THE INVENTION
[0023] Disclosed are compositions and a method for amplifying
nucleic acid sequences based on the presence of a specific target
sequence or analyte. The method is useful for detecting specific
nucleic acids or analytes in a sample with high specificity and
sensitivity. The method also has an inherently low level of
background signal. Preferred embodiments of the method consist of a
DNA ligation operation, an amplification operation, and,
optionally, a detection operation. The DNA ligation operation
circularizes a specially designed nucleic acid probe molecule. This
step is dependent on hybridization of the probe to a target
sequence and forms circular probe molecules in proportion to the
amount of target sequence present in a sample. The amplification
operation is rolling circle replication of the circularized probe.
A single round of amplification using rolling circle replication
results in a large amplification of the circularized probe
sequences, orders of magnitude greater than a single cycle of PCR
replication and other amplification techniques in which each cycle
is limited to a doubling of the number of copies of a target
sequence. Rolling circle amplification can also be performed
independently of a ligation operation. By coupling a nucleic acid
tag to a specific binding molecule, such as an antibody,
amplification of the nucleic acid tag can be used to detect
analytes in a sample. This is preferred for detection of analytes
where an amplification target circle serves as an amplifiable tag
on a reporter binding molecule, or where an amplification target
circle is amplified using a rolling circle replication primer that
is part of a reporter binding molecule. Optionally, an additional
amplification operation can be performed on the DNA produced by
rolling circle replication.
[0024] Following amplification, the amplified sequences can be
detected and quantified using any of the conventional detection
systems for nucleic acids such as detection of fluorescent labels,
enzyme-linked detection systems, antibody-mediated label detection,
and detection of radioactive labels. Since the amplified product is
directly proportional to the amount of target sequence present in a
sample, quantitative measurements reliably represent the amount of
a target sequence in a sample. Major advantages of this method are
that the ligation operation can be manipulated to obtain allelic
discrimination, the amplification operation is isothermal, and
signals are strictly quantitative because the amplification
reaction is linear and is catalyzed by a highly processive enzyme.
In multiplex assays, the primer oligonucleotide used for DNA
replication can be the same for all probes.
[0025] Following amplification, the nucleotide sequence of the
amplified sequences can be determined either by conventional means
or by primer extension sequencing of amplified target sequence. Two
preferred modes of primer extension sequencing are disclosed.
Unimolecular Segment Amplification and Sequencing (USA-SEQ), a form
of single nucleotide primer extension sequencing, involves
interrogation of a single nucleotide in an amplified target
sequence by incorporation of a specific and identifiable nucleotide
based on the identity of the interrogated nucleotide. Unimolecular
Segment Amplification and CAGE Sequencing (USA-CAGESEQ), a form of
degenerate probe primer extension sequencing, involves sequential
addition of degenerate probes to an interrogation primer hybridized
to amplified target sequences. Addition of multiple probes is
prevented by the presence of a removable cage at the 3' end. After
addition of the degenerate probes, the cage is removed and further
degenerate probes can be added or, as the final operation, the
nucleotide next to the end of the interrogation primer or the last
added degenerate probe is interrogated as in USA-SEQ to determine
its identity. The disclosed primer extension sequencing methods are
useful for identifying the presence of multiple distinct sequences
in a mixture of target sequences.
[0026] The disclosed method has two features that provide simple,
quantitative, and consistent amplification and detection of a
target nucleic acid sequence. First, target sequences are amplified
via a small diagnostic probe with an arbitrary primer binding
sequence. This allows consistency in the priming and replication
reactions, even between probes having very different target
sequences. Second, amplification takes place not in cycles, but in
a continuous, isothermal replication: rolling circle replication.
This makes amplification less complicated and much more consistent
in output.
[0027] Also disclosed are compositions and a method for of
multiplex detection of molecules of interest involving rolling
circle replication. The method is useful for simultaneously
detecting multiple specific nucleic acids in a sample with high
specificity and sensitivity. The method also has an inherently low
level of background signal. A preferred form of the method consists
of an association operation, an amplification operation, and a
detection operation. The association operation involves association
of one or more specially designed probe molecules, either wholly or
partly nucleic acid, to target molecules of interest. This
operation associates the probe molecules to a target molecules
present in a sample. The amplification operation is rolling circle
replication of circular nucleic acid molecules, termed
amplification target circles, that are either a part of, or
hybridized to, the probe molecules. A single round of amplification
using rolling circle replication results in a large amplification
of the amplification target circles, orders of magnitude greater
than a single cycle of PCR replication and other amplification
techniques in which each cycle is limited to a doubling of the
number of copies of a target sequence. By coupling a nucleic acid
tag to a specific binding molecule, such as an antibody,
amplification of the nucleic acid tag can be used to detect
analytes in a sample.
[0028] Following rolling circle replication, the amplified
sequences can be detected using combinatorial multicolor coding
probes that allow separate, simultaneous, and quantitative
detection of multiple different amplified target sequences
representing multiple different target molecules. Since the
amplified product is directly proportional to the amount of target
sequence present in a sample, quantitative measurements reliably
represent the amount of a target sequence in a sample. Major
advantages of this method are that a large number of distinct
target molecules can be detected simultaneously, and that
differences in the amounts of the various target molecules in a
sample can be accurately quantified. It is also advantageous that
the DNA replication step is isothermal, and that signals are
strictly quantitative because the amplification reaction is linear
and is catalyzed by a highly processive enzyme.
[0029] The disclosed method has two features that provide simple,
quantitative, and consistent detection of multiple target
molecules. First, amplification takes place not in cycles, but in a
continuous, isothermal replication: rolling circle replication.
This makes amplification less complicated and much more consistent
in output. Second, combinatorial multicolor coding allows sensitive
simultaneous detection of a large number different target
molecules.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 is a diagram of an example of an open circle probe
hybridized to a target sequence. The diagram shows the relationship
between the target sequence and the right and left target
probes.
[0031] FIG. 2 is a diagram of an example of a gap oligonucleotide
and an open circle probe hybridized to a target sequence. The
diagram shows the relationship between the target sequence, the gap
oligonucleotide, and the right and left target probes.
[0032] FIG. 3 is a diagram of an open circle probe hybridized and
ligated to a target sequence. The diagram shows how the open circle
probe becomes topologically locked to the target sequence.
[0033] FIG. 4 is a diagram of rolling circle amplification of an
open circle probe topologically locked to the nucleic acid
containing the target sequence.
[0034] FIG. 5 is a diagram of an example of an open circle probe.
Various portions of the open circle probe are indicated by
different fills.
[0035] FIG. 6 is a diagram of tandem sequence DNA (TS-DNA) and an
address probe designed to hybridize to the portion of the TS-DNA
corresponding to part of the right and left target probes of the
open circle probe and the gap oligonucleotide. The TS-DNA is SEQ ID
NO: 2 and the address probe is SEQ ID NO: 3.
[0036] FIG. 7 is a diagram of the capture and detection of TS-DNA.
Capture is effected by hybridization of the TS-DNA to address
probes attached to a solid-state detector. Detection is effected by
hybridization of secondary detection probes to the captured TS-DNA.
Portions of the TS-DNA corresponding to various portions of the
open circle probe are indicated by different fills.
[0037] FIG. 8 is a diagram of an example of ligation-mediated
rolling circle replication followed by transcription (LM-RCT).
Diagramed at the top is a gap oligonucleotide and an open circle
probe, having a primer complement portion and a promoter portion
next to the right and left target probe portions, respectively,
hybridized to a target sequence. Diagramed at the bottom is the
rolling circle replication product hybridized to unligated copies
of the open circle probe and gap oligonucleotide. This
hybridization forms the double-stranded substrate for
transcription.
[0038] FIG. 9 is a diagram of an example of a multiplex antibody
assay employing open circle probes and LM-RCT for generation of an
amplified signal. Diagramed are three reporter antibodies, each
with a different oligonucleotide as a DNA tag. Diagramed at the
bottom is amplification of only that DNA tag coupled to a reporter
antibody that bound.
[0039] FIG. 10 is a diagram of two schemes for multiplex detection
of specific amplified nucleic acids. Diagramed at the top is
hybridization of detection probes with different labels to
amplified nucleic acids. Diagramed at the bottom is hybridization
of amplified nucleic acid to a solid-state detector with address
probes for the different possible amplification products attached
in a pattern.
[0040] FIGS. 11A and 11B are diagrams of an example of secondary
DNA strand displacement. Diagramed at the top of FIG. 11A is a gap
oligonucleotide and an open circle probe hybridized to a target
sequence. Diagramed at the bottom of FIG. 11A is the rolling circle
replication product hybridized to secondary DNA strand displacement
primers. Diagramed in FIG. 11B is secondary DNA strand displacement
initiated from multiple primers. FIG. 11B illustrates secondary DNA
strand displacement carried out simultaneously with rolling circle
replication.
[0041] FIG. 12 is a diagram of an example of nested RCA using an
unamplified first open circle probe as the target sequence.
Diagramed at the top is a gap oligonucleotide and a first open
circle probe hybridized to a target sequence, and a secondary open
circle probe hybridized to the first open circle probe. Diagramed
at the bottom is the rolling circle replication product of the
secondary open circle probe.
[0042] FIG. 13 is a diagram of an example of strand displacement
cascade amplification. Diagramed is the synthesis and template
relationships of four generations of TS-DNA. TS-DNA-1 is generated
by rolling circle replication primed by the rolling circle
replication primer. TS-DNA-2 and TS-DNA-4 are generated by
secondary DNA strand displacement primed by a secondary DNA strand
displacement primer (P2). TS-DNA-3 is generated by
strand-displacing secondary DNA strand displacement primed by a
tertiary DNA strand displacement primer (P1).
[0043] FIG. 14 is a diagram of an example of opposite strand
amplification. Diagramed are five different stages of the reaction
as DNA synthesis proceeds. TS-DNA-2 is generated by secondary DNA
strand displacement of TS-DNA primed by the secondary DNA strand
displacement primer. As rolling circle replication creates new
TS-DNA sequence, the secondary DNA strand displacement primer
hybridizes to the newly synthesized DNA and primes synthesis of
another copy of TS-DNA-2.
[0044] FIG. 15 is a diagram of an open circle probe including a gap
sequence. The lower half of the diagram illustrates a preferred
relationship between sequences in the open circle probe and
interrogation primers.
[0045] FIGS. 16A, 16B, and 16C are diagrams showing the results of
unimolecular segment amplification and sequencing (USA-SEQ)
performed on three different nucleic acid samples. The large
circles represent a target sample dot on a solid-state support. The
small circles represent individual TS-DNA molecules, amplified in
situ at the location of target nucleic acids in the sample, which
have been subjected to primer extension sequencing. FIG. 16A is
representative of a sample that is homozygous for the wild type
sequence (indicated by incorporation of cystine). FIG. 16B is
representative of a sample that is heterozygous for the wild type
and a mutant (indicated by an equal number of TS-DNA molecules
resulting in incorporation of cystine and adenine). FIG. 16C is
representative of a sample that is homozygous but includes a few
cells with a somatic mutation.
[0046] FIGS. 17A and 17B are diagrams of an example of the
relationship of an open circle probe to two target sequences having
a different amount of a repeating sequence. The hybridization of
the left target probe and the right target probe of the open circle
probe to the two different target sequences is shown (with
.linevert split. indicating hydrogen bonding). The fill sequences
are the nucleotides, complementary to the sequence in the target
sequence opposite the gap space, which will fill the gap space
between the left and right target probes to join the open circle
probe into an amplification target circle. The sequences depicted
in the diagrams relate to the assay described in Example 10. In
FIG. 17A, the target sequence is SEQ ID NO: 24, the left target
sequence is nucleotides 76 to 96 of SEQ ID NO: 25, the right target
sequence is nucleotides 1 to 24 of SEQ ID NO: 25, and the fill
sequence is nucleotides 97 to 128 of SEQ ID NO: 25. In FIG. 17B,
the target sequence is SEQ ID NO: 23, the left target sequence is
nucleotides 2 to 21 of SEQ ID NO: 18, the right target sequence is
nucleotides 1 to 24 of SEQ ID NO: 25, and the fill sequence is
nucleotides 22 to 51 of SEQ ID NO: 18.
[0047] FIGS. 18A, 18B, 18C, 18D, and 18E are diagrams showing a
slide containing an array of nucleic acid samples and coverage of
rows of samples with a mask during unimolecular segment
amplification and cage sequencing (USA-CAGESEQ).
[0048] FIG. 19 is a diagram showing the nucleotide incorporated in
the first column of samples on a slide subjected to USA-CAGESEQ.
The samples correspond to the target sequence shown in FIG.
17A.
[0049] FIG. 20 is a diagram showing the nucleotide incorporated in
the first column of samples on a slide subjected to USA-CAGESEQ.
The samples correspond to the target sequence shown in FIG.
17B.
[0050] FIGS. 21A, 21B, 22A, 22B, 23A, 23B, 24A, and 24B depict
interrogation primers, formed from interrogation probes and
degenerate probes, hybridized to TS-DNA. The figures depict five
slides and TS-DNA representing a single column of five sample dots
from each slide. In each row, the top (shorter) sequence is the
interrogation primer and the bottom (longer) sequence is a portion
of the TS-DNA. The non-underlined portions of the interrogation
primers represent the interrogation probe. The underlined portions
of the interrogation primers were formed by sequential ligation of
one or more degenerate probes to the end of the interrogation
probe. The nucleotide in boldface is the nucleotide added to the
interrogation primer during primer extension. The TS-DNA sequences
shown in FIGS. 21A, 21B, 22A, and 22B are related to the target
sequence shown in FIG. 17A and correspond to nucleotides 1 to 60 of
SEQ ID NO: 19. The interrogation primer sequences in FIGS. 21A,
21B, 22A, and 22B correspond to various portions of nucleotides 76
to 125 of SEQ ID NO: 25. The sequences shown in FIGS. 23A, 23B,
24A, and 24B are related to the target sequence shown in FIG. 17B
and correspond to nucleotides 1 to 58 of SEQ ID NO: 26. The
interrogation primer sequences in FIGS. 23A, 23B, 24A, and 24B
correspond to various portions of nucleotides 1 to 50 of SEQ ID NO:
18.
[0051] FIGS. 25A and 25B are diagrams of a reporter binding
molecule made up of a peptide nucleic acid(as the affinity portion)
and a rolling circle replication primer (as the oligonucleotide
portion). The affinity portion is shown hybridized to a target DNA.
In FIG. 25B, an amplification target circle is shown hybridized to
the oligonucleotide portion (that is, the rolling circle
replication primer).
[0052] FIGS. 26A and 26B are diagrams of a reporter binding
molecule hybridized to a ligated open circle probe that is
topologically locked to target DNA. The reporter binding molecule
made up of a peptide nucleic acid (as the affinity portion) and a
rolling circle replication primer (as the oligonucleotide portion).
In FIG. 26B, an amplification target circle is shown hybridized to
the oligonucleotide portion (that is, the rolling circle
replication primer).
[0053] FIGS. 27A and 27B are diagrams of a reporter binding
molecule made up of a chemically-linked triple helix-forming
oligonucleotide (as the affinity portion) and a rolling circle
replication primer as the oligonucleotide portion. The affinity
portion is shown hybridized to a target DNA. PS indicates a
psoralen derivative creating a chemical link between the affinity
portion and the target DNA. In FIG. 27B, an amplification target
circle is shown hybridized to the oligonucleotide portion (that is,
the rolling circle replication primer).
[0054] FIGS. 28A and 28B are diagrams of a reporter binding
molecule hybridized to a ligated open circle probe that is
topologically locked to target DNA. The reporter binding molecule
made up of a chemically-linked triple helix-forming oligonucleotide
(as the affinity portion) and a rolling circle replication primer
as the oligonucleotide portion. PS indicates a psoralen derivative
creating a chemical link between the affinity portion and the
target DNA. In FIG. 28B, an amplification target circle is shown
hybridized to the oligonucleotide portion (that is, the rolling
circle replication primer).
[0055] FIGS. 29A and 29B are diagrams of a reporter binding
molecule made up of an antibody (as the affinity portion) and a
rolling circle replication primer (as the oligonucleotide portion).
The affinity portion is shown bound to a target antigen. In FIG.
29B, an amplification target circle is shown hybridized to the
oligonucleotide portion (that is, the rolling circle replication
primer).
DETAILED DESCRIPTION OF THE INVENTION
[0056] The disclosed composition and method make use of certain
materials and procedures which allow consistent and quantitative
amplification and detection of target nucleic acid sequences. These
materials and procedures are described in detail below.
[0057] Some major features of the disclosed method are:
[0058] 1. The ligation operation can be manipulated to obtain
allelic discrimination, especially with the use of a gap-filling
step.
[0059] 2. The amplification operation is isothermal.
[0060] 3. Signals can be strictly quantitative because in certain
embodiments of the amplification operation amplification is linear
and is catalyzed by a highly processive enzyme. In multiplex
assays, the primer used for DNA replication is the same for all
probes.
[0061] 4. Modified nucleotides or other moieties may be
incorporated during DNA replication or transcription.
[0062] 5. The amplification product is a repetitive DNA molecule,
and may contain arbitrarily chosen tag sequences that are useful
for detection.
I. Materials
[0063] A. Open Circle Probes
[0064] An open circle probe (OCP) is a linear single-stranded DNA
molecule, generally containing between 50 to 1000 nucleotides,
preferably between about 60 to 150 nucleotides, and most preferably
between about 70 to 100 nucleotides. The OCP has a 5' phosphate
group and a 3' hydroxyl group. This allows the ends to be ligated
using a DNA ligase, or extended in a gap-filling operation.
Portions of the OCP have specific functions making the OCP useful
for RCA and LM-RCA. These portions are referred to as the target
probe portions, the primer complement portion, the spacer region,
the detection tag portions, the secondary target sequence portions,
the address tag portions, and the promoter portion (FIG. 5). The
target probe portions and the primer complement portion are
required elements of an open circle probe. The primer complement
portion is part of the spacer region. Detection tag portions,
secondary target sequence portions, and promoter portions are
optional and, when present, are part of the spacer region. Address
tag portions are optional and, when present, may be part of the
spacer region. Generally, an open circle probe is a
single-stranded, linear DNA molecule comprising, from 5' end to 3'
end, a 5' phosphate group, a right target probe portion, a spacer
region, a left target probe portion, and a 3' hydroxyl group, with
a primer complement portion present as part of the spacer region.
Those segments of the spacer region that do not correspond to a
specific portion of the OCP can be arbitrarily chosen sequences. It
is preferred that OCPs do not have any sequences that are
self-complementary. It is considered that this condition is met if
there are no complementary regions greater than six nucleotides
long without a mismatch or gap. It is also preferred that OCPs
containing a promoter portion do not have any sequences that
resemble a transcription terminator, such as a run of eight or more
thymidine nucleotides.
[0065] The open circle probe, when ligated and replicated, gives
rise to a long DNA molecule containing multiple repeats of
sequences complementary to the open circle probe. This long DNA
molecule is referred to herein as tandem sequences DNA (TS-DNA).
TS-DNA contains sequences complementary to the target probe
portions, the primer complement portion, the spacer region, and, if
present on the open circle probe, the detection tag portions, the
secondary target sequence portions, the address tag portions, and
the promoter portion. These sequences in the TS-DNA are referred to
as target sequences (which match the original target sequence),
primer sequences (which match the sequence of the rolling circle
replication primer), spacer sequences (complementary to the spacer
region), detection tags, secondary target sequences, address tags,
and promoter sequences.
[0066] A particularly preferred embodiment is an open circle probe
of 70 to 100 nucleotides including a left target probe of 20
nucleotides and a right target probe of 20 nucleotides. The left
target probe and right target probe hybridize to a target sequence
leaving a gap of five nucleotides, which is filled by a single
pentanucleotide gap oligonucleotide.
[0067] 1. Target Probe Portions
[0068] There are two target probe portions on each OCP, one at each
end of the OCP. The target probe portions can each be any length
that supports specific and stable hybridization between the target
probes and the target sequence. For this purpose, a length of 10 to
35 nucleotides for each target probe portion is preferred, with
target probe portions 15 to 20 nucleotides long being most
preferred. The target probe portion at the 3' end of the OCP is
referred to as the left target probe, and the target probe portion
at the 5' end of the OCP is referred to as the right target probe.
These target probe portions are also referred to herein as left and
right target probes or left and right probes. The target probe
portions are complementary to a target nucleic acid sequence.
[0069] The target probe portions are complementary to the target
sequence, such that upon hybridization the 5' end of the right
target probe portion and the 3' end of the left target probe
portion are base-paired to adjacent nucleotides in the target
sequence, with the objective that they serve as a substrate for
ligation (FIG. 1). Optionally, the 5' end and the 3' end of the
target probe portions may hybridize in such a way that they are
separated by a gap space. In this case the 5' end and the 3' end of
the OCP may only be ligated if one or more additional
oligonucleotides, referred to as gap oligonucleotides, are used, or
if the gap space is filled during the ligation operation. The gap
oligonucleotides hybridize to the target sequence in the gap space
to a form continuous probe/target hybrid (FIG. 2). The gap space
may be any length desired but is generally ten nucleotides or less.
It is preferred that the gap space is between about three to ten
nucleotides in length, with a gap space of four to eight
nucleotides in length being most preferred. Alternatively, a gap
space could be filled using a DNA polymerase during the ligation
operation (see Example 3). When using such a gap-filling operation,
a gap space of three to five nucleotides in length is most
preferred. As another alternative, the gap space can be partially
bridged by one or more gap oligonucleotides, with the remainder of
the gap filled using DNA polymerase.
[0070] 2. Primer Complement Portion
[0071] The primer complement portion is part of the spacer region
of an open circle probe. The primer complement portion is
complementary to the rolling circle replication primer (RCRP). Each
OCP should have a single primer complement portion. This allows
rolling circle replication to initiate at a single site on ligated
OCPs. The primer complement portion and the cognate primer can have
any desired sequence so long as they are complementary to each
other. In general, the sequence of the primer complement can be
chosen such that it is not significantly similar to any other
portion of the OCP. The primer complement portion can be any length
that supports specific and stable hybridization between the primer
complement portion and the primer. For this purpose, a length of 10
to 35 nucleotides is preferred, with a primer complement portion 16
to 20 nucleotides long being most preferred. The primer complement
portion can be located anywhere within the spacer region of an OCP.
It is preferred that the primer complement portion is adjacent to
the right target probe, with the right target probe portion and the
primer complement portion preferably separated by three to ten
nucleotides, and most preferably separated by six nucleotides. This
location prevents the generation of any other spacer sequences,
such as detection tags and secondary target sequences, from
unligated open circle probes during DNA replication.
[0072] 3. Detection Tag Portions
[0073] Detection tag portions are part of the spacer region of an
open circle probe. Detection tag portions have sequences matching
the sequence of the complementary portion of detection probes.
These detection tag portions, when amplified during rolling circle
replication, result in TS-DNA having detection tag sequences that
are complementary to the complementary portion of detection probes.
If present, there may be one, two, three, or more than three
detection tag portions on an OCP. It is preferred that an OCP have
two, three or four detection tag portions. Most preferably, an OCP
will have three detection tag portions. Generally, it is preferred
that an OCP have 60 detection tag portions or less. There is no
fundamental limit to the number of detection tag portions that can
be present on an OCP except the size of the OCP. When there are
multiple detection tag portions, they may have the same sequence or
they may have different sequences, with each different sequence
complementary to a different detection probe. It is preferred that
an OCP contain detection tag portions that have the same sequence
such that they are all complementary to a single detection probe.
For some multiplex detection methods, it is preferable that OCPs
contain up to six detection tag portions and that the detection tag
portions have different sequences such that each of the detection
tag portions is complementary to a different detection probe. The
detection tag portions can each be any length that supports
specific and stable hybridization between the detection tags and
the detection probe. For this purpose, a length of 10 to 35
nucleotides is preferred, with a detection tag portion 15 to 20
nucleotides long being most preferred.
[0074] 4. Secondary Target Sequence Portions
[0075] Secondary target sequence portions are part of the spacer
region of an open circle probe. Secondary target sequence portions
have sequences matching the sequence of target probes of a
secondary open circle probe. These secondary target sequence
portions, when amplified during rolling circle replication, result
in TS-DNA having secondary target sequences that are complementary
to target probes of a secondary open circle probe. If present,
there may be one, two, or more than two secondary target sequence
portions on an OCP. It is preferred that an OCP have one or two
secondary target sequence portions. Most preferably, an OCP will
have one secondary target sequence portion. Generally, it is
preferred that an OCP have 50 secondary target sequence portions or
less. There is no fundamental limit to the number of secondary
target sequence portions that can be present on an OCP except the
size of the OCP. When there are multiple secondary target sequence
portions, they may have the same sequence or they may have
different sequences, with each different sequence complementary to
a different secondary OCP. It is preferred that an OCP contain
secondary target sequence portions that have the same sequence such
that they are all complementary to a single target probe portion of
a secondary OCP. The secondary target sequence portions can each be
any length that supports specific and stable hybridization between
the secondary target sequence and the target sequence probes of its
cognate OCP. For this purpose, a length of 20 to 70 nucleotides is
preferred, with a secondary target sequence portion 30 to 40
nucleotides long being most preferred. As used herein, a secondary
open circle probe is an open circle probe where the target probe
portions match or are complementary to secondary target sequences
in another open circle probe or an amplification target circle. It
is contemplated that a secondary open circle probe can itself
contain secondary target sequences that match or are complementary
to the target probe portions of another secondary open circle
probe. Secondary open circle probes related to each other in this
manner are referred to herein as nested open circle probes.
[0076] 5. Address Tag Portion
[0077] The address tag portion is part of either the target probe
portions or the spacer region of an open circle probe. The address
tag portion has a sequence matching the sequence of the
complementary portion of an address probe. This address tag
portion, when amplified during rolling circle replication, results
in TS-DNA having address tag sequences that are complementary to
the complementary portion of address probes. If present, there may
be one, or more than one, address tag portions on an OCP. It is
preferred that an OCP have one or two address tag portions. Most
preferably, an OCP will have one address tag portion. Generally, it
is preferred that an OCP have 50 address tag portions or less.
There is no fundamental limit to the number of address tag portions
that can be present on an OCP except the size of the OCP. When
there are multiple address tag portions, they may have the same
sequence or they may have different sequences, with each different
sequence complementary to a different address probe. It is
preferred that an OCP contain address tag portions that have the
same sequence such that they are all complementary to a single
address probe. Preferably, the address tag portion overlaps all or
a portion of the target probe portions, and all of any intervening
gap space (FIG. 6). Most preferably, the address tag portion
overlaps all or a portion of both the left and right target probe
portions. The address tag portion can be any length that supports
specific and stable hybridization between the address tag and the
address probe. For this purpose, a length between 10 and 35
nucleotides long is preferred, with an address tag portion 15 to 20
nucleotides long being most preferred.
[0078] 6. Promoter Portion
[0079] The promoter portion corresponds to the sequence of an RNA
polymerase promoter. A promoter portion can be included in an open
circle probe so that transcripts can be generated from TS-DNA. The
sequence of any promoter may be used, but simple promoters for RNA
polymerases without complex requirements are preferred. It is also
preferred that the promoter is not recognized by any RNA polymerase
that may be present in the sample containing the target nucleic
acid sequence. Preferably, the promoter portion corresponds to the
sequence of a T7 or SP6 RNA polymerase promoter. The T7 and SP6 RNA
polymerases are highly specific for particular promoter sequences.
Other promoter sequences specific for RNA polymerases with this
characteristic would also be preferred. Because promoter sequences
are generally recognized by specific RNA polymerases, the cognate
polymerase for the promoter portion of the OCP should be used for
transcriptional amplification. Numerous promoter sequences are
known and any promoter specific for a suitable RNA polymerase can
be used. The promoter portion can be located anywhere within the
spacer region of an OCP and can be in either orientation.
Preferably, the promoter portion is immediately adjacent to the
left target probe and is oriented to promote transcription toward
the 3' end of the open circle probe. This orientation results in
transcripts that are complementary to TS-DNA, allowing independent
detection of TS-DNA and the transcripts, and prevents transcription
from interfering with rolling circle replication.
[0080] B. Gap Oligonucleotides
[0081] Gap oligonucleotides are oligonucleotides that are
complementary to all or a part of that portion of a target sequence
which covers a gap space between the ends of a hybridized open
circle probe. An example of a gap oligonucleotide and its
relationship to a target sequence and open circle probe is shown in
FIG. 2. Gap oligonucleotides have a phosphate group at their 5'
ends and a hydroxyl group at their 3' ends. This facilitates
ligation of gap oligonucleotides to open circle probes, or to other
gap oligonucleotides. The gap space between the ends of a
hybridized open circle probe can be filled with a single gap
oligonucleotide, or it can be filled with multiple gap
oligonucleotides. For example, two 3 nucleotide gap
oligonucleotides can be used to fill a six nucleotide gap space, or
a three nucleotide gap oligonucleotide and a four nucleotide gap
oligonucleotide can be used to fill a seven nucleotide gap space.
Gap oligonucleotides are particularly useful for distinguishing
between closely related target sequences. For example, multiple gap
oligonucleotides can be used to amplify different allelic variants
of a target sequence. By placing the region of the target sequence
in which the variation occurs in the gap space formed by an open
circle probe, a single open circle probe can be used to amplify
each of the individual variants by using an appropriate set of gap
oligonucleotides.
[0082] C. Amplification Target Circles
[0083] An amplification target circle (ATC) is a circular
single-stranded DNA molecule, generally containing between 40 to
1000 nucleotides, preferably between about 50 to 150 nucleotides,
and most preferably between about 50 to 100 nucleotides. Portions
of ATCs have specific functions making the ATC useful for rolling
circle amplification (RCA). These portions are referred to as the
primer complement portion, the detection tag portions, the
secondary target sequence portions, the address tag portions, and
the promoter portion. The primer complement portion is a required
element of an amplification target circle. Detection tag portions,
secondary target sequence portions, address tag portions, and
promoter portions are optional. Generally, an amplification target
circle is a single-stranded, circular DNA molecule comprising a
primer complement portion. Those segments of the ATC that do not
correspond to a specific portion of the ATC can be arbitrarily
chosen sequences. It is preferred that ATCs do not have any
sequences that are self-complementary. It is considered that this
condition is met if there are no complementary regions greater than
six nucleotides long without a mismatch or gap. It is also
preferred that ATCs containing a promoter portion do not have any
sequences that resemble a transcription terminator, such as a run
of eight or more thymidine nucleotides. Ligated open circle probes
are a type of ATC, and as used herein the term amplification target
circle includes ligated open circle probes. An ATC can be used in
the same manner as described herein for OCPs that have been
ligated.
[0084] An amplification target circle, when replicated, gives rise
to a long DNA molecule containing multiple repeats of sequences
complementary to the amplification target circle. This long DNA
molecule is referred to herein as tandem sequences DNA (TS-DNA).
TS-DNA contains sequences complementary to the primer complement
portion and, if present on the amplification target circle, the
detection tag portions, the secondary target sequence portions, the
address tag portions, and the promoter portion. These sequences in
the TS-DNA are referred to as primer sequences (which match the
sequence of the rolling circle replication primer), spacer
sequences (complementary to the spacer region), detection tags,
secondary target sequences, address tags, and promoter sequences.
Amplification target circles are useful as tags for specific
binding molecules.
[0085] D. Rolling Circle Replication Primer
[0086] A rolling circle replication primer (RCRP) is an
oligonucleotide having sequence complementary to the primer
complement portion of an OCP or ATC. This sequence is referred to
as the complementary portion of the RCRP. The complementary portion
of a RCRP and the cognate primer complement portion can have any
desired sequence so long as they are complementary to each other.
In general, the sequence of the RCRP can be chosen such that it is
not significantly complementary to any other portion of the OCP or
ATC. The complementary portion of a rolling circle replication
primer can be any length that supports specific and stable
hybridization between the primer and the primer complement portion.
Generally this is 10 to 35 nucleotides long, but is preferably 16
to 20 nucleotides long.
[0087] It is preferred that rolling circle replication primers also
contain additional sequence at the 5' end of the RCRP that is not
complementary to any part of the OCP or ATC. This sequence is
referred to as the non-complementary portion of the RCRP. The
non-complementary portion of the RCRP, if present, serves to
facilitate strand displacement during DNA replication. The
non-complementary portion of a RCRP may be any length, but is
generally 1 to 100 nucleotides long, and preferably 4 to 8
nucleotides long. The rolling circle replication primer may also
include modified nucleotides to make it resistant to exonuclease
digestion. For example, the primer can have three or four
phosphorothioate linkages between nucleotides at the 5' end of the
primer. Such nuclease resistant primers allow selective degradation
of excess unligated OCP and gap oligonucleotides that might
otherwise interfere with hybridization of detection probes, address
probes, and secondary OCPs to the amplified nucleic acid. A rolling
circle replication primer can be used as the tertiary DNA strand
displacement primer in strand displacement cascade
amplification.
[0088] E. Detection Labels
[0089] To aid in detection and quantitation of nucleic acids
amplified using RCA and RCT, detection labels can be directly
incorporated into amplified nucleic acids or can be coupled to
detection molecules. As used herein, a detection label is any
molecule that can be associated with amplified nucleic acid,
directly or indirectly, and which results in a measurable,
detectable signal, either directly or indirectly. Many such labels
for incorporation into nucleic acids or coupling to nucleic acid or
antibody probes are known to those of skill in the art. Examples of
detection labels suitable for use in RCA and RCT are radioactive
isotopes, fluorescent molecules, phosphorescent molecules, enzymes,
antibodies, and ligands.
[0090] Examples of suitable fluorescent labels include fluorescein
(FITC), 5,6-carboxymethyl fluorescein, Texas red,
nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride,
rhodamine, 4'-6-diamidino-2-phenylinodo- le (DAPI), and the cyanine
dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Preferred fluorescent labels
are fluorescein (5-carboxyfluorescein-N-hydroxysuccini- mide ester)
and rhodamine (5,6-tetramethyl rhodamine). Preferred fluorescent
labels for combinatorial multicolor coding are FITC and the cyanine
dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. The absorption and emission
maxima, respectively, for these fluors are: FITC (490 nm; 520 nm),
Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm),
Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing
their simultaneous detection. The fluorescent labels can be
obtained from a variety of commercial sources, including Molecular
Probes, Eugene, OR and Research Organics, Cleveland, Ohio.
[0091] Labeled nucleotides are preferred form of detection label
since they can be directly incorporated into the products of RCA
and RCT during synthesis. Examples of detection labels that can be
incorporated into amplified DNA or RNA include nucleotide analogs
such as BrdUrd (Hoy and Schimke, Mutation Research 290:217-230
(1993)), BrUTP (Wansick et al., J. Cell Biology 122:283-293 (1993))
and nucleotides modified with biotin (Langer et al., Proc. Natl.
Acad. Sci. USA 78:6633 (1981)) or with suitable haptens such as
digoxygenin (Kerkhof, Anal. Biochem. 205:359-364 (1992)). Suitable
fluorescence-labeled nucleotides are
Fluorescein-isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP
(Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)). A preferred
nucleotide analog detection label for DNA is BrdUrd (BUDR
triphosphate, Sigma), and a preferred nucleotide analog detection
label for RNA is Biotin-16-uridine-5'-triphosphate (Biotin-16-dUTP,
Boehringher Mannheim). Fluorescein, Cy3, and Cy5 can be linked to
dUTP for direct labelling. Cy3.5 and Cy7 are available as avidin or
anti-digoxygenin conjugates for secondary detection of biotin- or
digoxygenin-labelled probes.
[0092] Detection labels that are incorporated into amplified
nucleic acid, such as biotin, can be subsequently detected using
sensitive methods well-known in the art. For example, biotin can be
detected using streptavidin-alkaline phosphatase conjugate (Tropix,
Inc.), which is bound to the biotin and subsequently detected by
chemiluminescence of suitable substrates (for example,
chemiluminescent substrate CSPD: disodium,
3-(4-methoxyspiro-[1,2,-dioxetane-3-2'-(5'-chloro)tricyclo
[3.3.1.1.sup.3.7]decane]-4-yl) phenyl phosphate; Tropix, Inc.).
[0093] A preferred detection label for use in detection of
amplified RNA is acridinium-ester-labeled DNA probe (GenProbe,
Inc., as described by Arnold et al., Clinical Chemistry
35:1588-1594 (1989)). An acridinium-ester-labeled detection probe
permits the detection of amplified RNA without washing because
unhybridized probe can be destroyed with alkali (Arnold et al.
(1989)).
[0094] Molecules that combine two or more of these detection labels
are also considered detection labels. Any of the known detection
labels can be used with the disclosed probes, tags, and method to
label and detect nucleic acid amplified using the disclosed method.
Methods for detecting and measuring signals generated by detection
labels are also known to those of skill in the art. For example,
radioactive isotopes can be detected by scintillation counting or
direct visualization; fluorescent molecules can be detected with
fluorescent spectrophotometers; phosphorescent molecules can be
detected with a spectrophotometer or directly visualized with a
camera; enzymes can be detected by detection or visualization of
the product of a reaction catalyzed by the enzyme; antibodies can
be detected by detecting a secondary detection label coupled to the
antibody. Such methods can be used directly in the disclosed method
of amplification and detection. As used herein, detection molecules
are molecules which interact with amplified nucleic acid and to
which one or more detection labels are coupled.
[0095] F. Detection Probes
[0096] Detection probes are labeled oligonucleotides having
sequence complementary to detection tags on TS-DNA or transcripts
of TS-DNA. The complementary portion of a detection probe can be
any length that supports specific and stable hybridization between
the detection probe and the detection tag. For this purpose, a
length of 10 to 35 nucleotides is preferred, with a complementary
portion of a detection probe 16 to 20 nucleotides long being most
preferred. Detection probes can contain any of the detection labels
described above. Preferred labels are biotin and fluorescent
molecules. A particularly preferred detection probe is a molecular
beacon. Molecular beacons are detection probes labeled with
fluorescent moieties where the fluorescent moieties fluoresce only
when the detection probe is hybridized (Tyagi and Kramer, Nature
Biotechnology 14:303-308 (1996)). The use of such probes eliminates
the need for removal of unhybridized probes prior to label
detection because the unhybridized detection probes will not
produce a signal. This is especially useful in multiplex
assays.
[0097] A preferred form of detection probe, referred to herein as a
collapsing detection probe, contains two separate complementary
portions. This allows each detection probe to hybridize to two
detection tags in TS-DNA. In this way, the detection probe forms a
bridge between different parts of the TS-DNA. The combined action
of numerous collapsing detection probes hybridizing to TS-DNA will
be to form a collapsed network of cross-linked TS-DNA. Collapsed
TS-DNA occupies a much smaller volume than free, extended TS-DNA,
and includes whatever detection label present on the detection
probe. This result is a compact and discrete detectable signal for
each TS-DNA. Collapsing TS-DNA is useful both for in situ
hybridization applications and for multiplex detection because it
allows detectable signals to be spatially separate even when
closely packed. Collapsing TS-DNA is especially preferred for use
with combinatorial multicolor coding.
[0098] TS-DNA collapse can also be accomplished through the use of
ligand/ligand binding pairs (such as biotin and avidin) or
hapten/antibody pairs. As described in Example 6, a nucleotide
analog, BUDR, can be incorporated into TS-DNA during rolling circle
replication. When biotinylated antibodies specific for BUDR and
avidin are added, a cross-linked network of TS-DNA forms, bridged
by avidin-biotin-antibody conjugates, and the TS-DNA collapses into
a compact structure. Collapsing detection probes and
biotin-mediated collapse can also be used together to collapse
TS-DNA.
[0099] G. Address Probes
[0100] An address probe is an oligonucleotide having a sequence
complementary to address tags on TS-DNA or transcripts of TS-DNA.
The complementary portion of an address probe can be any length
that supports specific and stable hybridization between the address
probe and the address tag. For this purpose, a length of 10 to 35
nucleotides is preferred, with a complementary portion of an
address probe 12 to 18 nucleotides long being most preferred.
Preferably, the complementary portion of an address probe is
complementary to all or a portion of the target probe portions of
an OCP. Most preferably, the complementary portion of an address
probe is complementary to a portion of either or both of the left
and right target probe portions of an OCP and all or a part of any
gap oligonucleotides or gap sequence created in a gap-filling
operation (see FIG. 6). Address probe can contain a single
complementary portion or multiple complementary portions.
Preferably, address probes are coupled, either directly or via a
spacer molecule, to a solid-state support. Such a combination of
address probe and solid-state support are a preferred form of
solid-state detector.
[0101] H. DNA Strand Displacement Primers
[0102] Primers used for secondary DNA strand displacement are
referred to herein as DNA strand displacement primers. One form of
DNA strand displacement primer, referred to herein as a secondary
DNA strand displacement primer, is an oligonucleotide having
sequence matching part of the sequence of an OCP or ATC. This
sequence is referred to as the matching portion of the secondary
DNA strand displacement primer. This matching portion of a
secondary DNA strand displacement primer is complementary to
sequences in TS-DNA. The matching portion of a secondary DNA strand
displacement primer may be complementary to any sequence in TS-DNA.
However, it is preferred that it not be complementary TS-DNA
sequence matching either the rolling circle replication primer or a
tertiary DNA strand displacement primer, if one is being used. This
prevents hybridization of the primers to each other. The matching
portion of a secondary DNA strand displacement primer may be
complementary to all or a portion of the target sequence. In this
case, it is preferred that the 3' end nucleotides of the secondary
DNA strand displacement primer are complementary to the gap
sequence in the target sequence. It is most preferred that
nucleotide at the 3' end of the secondary DNA strand displacement
primer falls complementary to the last nucleotide in the gap
sequence of the target sequence, that is, the 5' nucleotide in the
gap sequence of the target sequence. The matching portion of a
secondary DNA strand displacement primer can be any length that
supports specific and stable hybridization between the primer and
its complement. Generally this is 12 to 35 nucleotides long, but is
preferably 18 to 25 nucleotides long.
[0103] It is preferred that secondary DNA strand displacement
primers also contain additional sequence at their 5' end that does
not match any part of the OCP or ATC. This sequence is referred to
as the non-matching portion of the secondary DNA strand
displacement primer. The non-matching portion of the secondary DNA
strand displacement primer, if present, serves to facilitate strand
displacement during DNA replication. The non-matching portion of a
secondary DNA strand displacement primer may be any length, but is
generally 1 to 100 nucleotides long, and preferably 4 to 8
nucleotides long.
[0104] Another form of DNA strand displacement primer, referred to
herein as a tertiary DNA strand displacement primer, is an
oligonucleotide having sequence complementary to part of the
sequence of an OCP or ATC. This sequence is referred to as the
complementary portion of the tertiary DNA strand displacement
primer. This complementary portion of the tertiary DNA strand
displacement primer matches sequences in TS-DNA. The complementary
portion of a tertiary DNA strand displacement primer may be
complementary to any sequence in the OCP or ATC. However, it is
preferred that it not be complementary OCP or ATC sequence matching
the secondary DNA strand displacement primer. This prevents
hybridization of the primers to each other. Preferably, the
complementary portion of the tertiary DNA strand displacement
primer has sequence complementary to a portion of the spacer
portion of an OCP. The complementary portion of a tertiary DNA
strand displacement primer can be any length that supports specific
and stable hybridization between the primer and its complement.
Generally this is 12 to 35 nucleotides long, but is preferably 18
to 25 nucleotides long. It is preferred that tertiary DNA strand
displacement primers also contain additional sequence at their 5'
end that is not complementary to any part of the OCP or ATC. This
sequence is referred to as the non-complementary portion of the
tertiary DNA strand displacement primer. The non-complementary
portion of the tertiary DNA strand displacement primer, if present,
serves to facilitate strand displacement during DNA replication.
The non-complementary portion of a tertiary DNA strand displacement
primer may be any length, but is generally 1 to 100 nucleotides
long, and preferably 4 to 8 nucleotides long. A rolling circle
replication primer is a preferred form of tertiary DNA strand
displacement primer.
[0105] DNA strand displacement primers may also include modified
nucleotides to make them resistant to exonuclease digestion. For
example, the primer can have three or four phosphorothioate
linkages between nucleotides at the 5' end of the primer. Such
nuclease resistant primers allow selective degradation of excess
unligated OCP and gap oligonucleotides that might otherwise
interfere with hybridization of detection probes, address probes,
and secondary OCPs to the amplified nucleic acid. DNA strand
displacement primers can be used for secondary DNA strand
displacement and strand displacement cascade amplification, both
described below.
[0106] I. Interrogation Probes
[0107] An interrogation probe is an oligonucleotide having a
sequence complementary to portions of TS-DNA or transcripts of
TS-DNA. Interrogation probes are intended for use in primer
extension sequencing operations following rolling circle
amplification of an OCP or amplification target circle (for
example, USA-SEQ and USA-CAGESEQ). Interrogation probes can be used
directly as interrogation primers in a primer extension sequencing
operation, or they can be combined with other interrogation probes
or with degenerate probes to form interrogation primers. As use
herein, interrogation primers are oligonucleotides serving as
primers for primer extension sequencing. The relationship of
interrogation probes to sequences in OCPs or ATCs (and, therefore,
in amplified target sequences) is preferably determined by the
relationship of the interrogation primer (which is formed from the
interrogation probe) to sequences in OCPs or ATCs.
[0108] The complementary portion of an interrogation probe can be
any length that supports hybridization between the interrogation
probe and TS-DNA. For this purpose, a length of 10 to 40
nucleotides is preferred, with a complementary portion of an
interrogation probe 15 to 30 nucleotides long being most preferred.
The preferred use of interrogation probes is to form interrogation
primers for primer extension sequencing of an amplified target
sequence. For this purpose, interrogation probes should hybridize
to TS-DNA 5' of the portion of the amplified target sequences that
are to be sequenced.
[0109] For primer extension sequencing operations (for example,
USA-CAGESEQ), it is preferred that a nested set of interrogation
probes are designed to hybridize just 5' to a region of amplified
target sequence for which the sequence is to be determined. Thus,
for example, a set of interrogation probes can be designed where
each probe is complementary to a 20 nucleotide region of the target
sequence with each 20 nucleotide region offset from the previous
region by one nucleotide. This preferred relationship can be
illustrated as follows:
1 Probe 1 TCTCGACATCTAACGATCGA Probe 2 CTCGACATCTAACGATCGAT Probe 3
TCGACATCTAACGATCGATC Probe 4 CGACATCTAACGATCGATCC Probe 5
GACATCTAACGATCGATCCT .linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split. Target TAGAGCTGTAGATTGCTAGCTAGGATCACACACACA-
CACACA
[0110] Probe 1 is nucleotides 76 to 95 of SEQ ID NO: 25, probe 2 is
nucleotides 77 to 96 of SEQ ID NO: 25, probe 3 is nucleotides 78 to
97 of SEQ ID NO: 25, probe 4 is nucleotides 79 to 98 of SEQ ID NO:
25, probe 5 is nucleotides 80 to 99 of SEQ ID NO: 25, and the
target (shown 3' to 5') is nucleotides 19 to 60 of SEQ ID NO: 19.
It is preferred that the number of interrogation probes in such a
nested set be equal to the length of the degenerate probes used in
the primer extension sequencing operation.
[0111] It is also preferred that the 3' hydroxyl of interrogation
probes be reversibly blocked in order to prevent unwanted ligation
to other oligonucleotides. Such blocked probes allow controlled
ligation of additional probes, such as degenerate probes, to an
interrogation probe. For example, USA-CAGESEQ, a form of degenerate
probe primer extension sequencing, makes use of reversibly blocked
interrogation probes to allow sequential, and controlled, addition
of degenerate probes to interrogation probes. Any of the known
means of reversibly blocking 3'-hydroxyls in oligonucleotides can
be used to produce blocked interrogation probes. Preferred forms of
reversible blocking elements are the cage structures described
below. Caged oligonucleotides useful as blocked interrogation
probes are described below.
[0112] J. Degenerate Probes
[0113] Degenerate probes are oligonucleotides intended for use in
primer extension sequencing operations following rolling circle
amplification of an OCP or amplification target circle (for
example, USA-SEQ and USA-CAGESEQ). Degenerate probes are combined
with interrogation probes to form interrogation primers. This is
accomplished by hybridizing an interrogation probe and degenerate
primers to TS-DNA and ligating together the interrogation probe and
whichever degenerate probe that is hybridized adjacent to the
interrogation probe. For this purpose, it is preferred that a full
set of degenerate probes be used together. This ensures that at
least one of the degenerate probes will be complementary to the
portion of TS-DNA immediately adjacent to a hybridized
interrogation probe. This preferred relationship can be illustrated
as follows:
2 Interrogation probe Degenerate probe GACATCTAACGATCGATCCTAGTGT
.linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split. TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
Target
[0114] The interrogation probe and degenerate probe together
represent nucleotides 80 to 104 of SEQ ID NO: 25, and the target
(shown 3' to 5') is nucleotides 19 to 60 of SEQ ID NO: 19. The
underlined sequence represents the degenerate probe which is
ligated to the interrogation probe (non-underlined portion of the
top sequence).
[0115] It is preferred that a full set of degenerate probes be used
in primer extension sequencing operations involving degenerate
probes. As used herein, a full set of degenerate probes refers to a
set of oligonucleotides, all of the same length, where every
possible nucleotide sequence is represented. The number of such
probes is described by the formula 4.sup.N where 4 represents the
four types of nucleotides found in DNA (or in RNA) and N is the
length of the oligonucleotides in the set. Thus, a full set of
degenerate probes three nucleotides in length would include 64
different oligonucleotides, a full set of degenerate probes four
nucleotides in length would include 256 different oligonucleotides,
and a full set of degenerate probes five nucleotides in length
would include 1024 different oligonucleotides. It is preferred that
the number of interrogation probes in such a nested set be equal to
the length of the degenerate probes used in degenerate probe primer
extension sequencing. Sets of degenerate probes can be used with a
single interrogation probe or with sets of interrogation probes. It
is preferred that such sets of interrogation probes represent a
nested set as described above.
[0116] In a primer extension operation, only one of the degenerate
probes in a set of degenerate probes will hybridize adjacent to a
given interrogation probe hybridized to an amplified target
sequence. The nucleotide sequence adjacent to (that is, 3' of) the
region of the target sequence hybridized to the interrogation probe
determines which degenerate probe will hybridize. Only degenerate
probes hybridized immediately adjacent to the interrogation probe
should be ligated to the interrogation probe. For this reason, it
is preferred that the region of the target sequence to be sequenced
is adjacent to the region hybridized to the interrogation probe.
Preferably, this region is a gap sequence in TS-DNA (representing
all or a portion of a filled gap space). The use of gap-filling
ligation allows the presence of gap sequences in TS-DNA
representing a potential, expected, or known region of sequence
variability in the target nucleic aid which is amplified in
RCA.
[0117] Degenerate probes can be combined with interrogation probes
or with other degenerate probes to form interrogation primers. As
used herein, interrogation primers are oligonucleotides serving as
primers for primer extension sequencing.
[0118] It is also preferred that the 3' hydroxyl of degenerate
probes be reversibly blocked in order to prevent unwanted ligation
to other oligonucleotides. Such blocked probes allow controlled
ligation of additional degenerate probes to a degenerate probe. For
example, USA-CAGESEQ makes use of reversibly blocked degenerate
probes to allow sequential, and controlled, addition of the
degenerate probes to interrogation probes. Any of the known means
of reversibly blocking 3'-hydroxyls in oligonucleotides can be used
to produce blocked degenerate probes. Preferred forms of reversible
blocking elements are the cage structures described below. Caged
oligonucleotides useful as blocked degenerate probes are described
below.
[0119] Where a nested set of interrogation probes are used, they
can be used in a set of primer extension sequencing operations to
determine the identity of adjacent nucleotides. Using the set of
interrogation probes illustrated above, and a full set of pentamer
degenerate probes, the highlighted nucleotides in the target
sequence can be identified where a single degenerate probe is
ligated to each of the interrogation probes:
3 Probe 1 TCTCGACATCTAACGATCGA Probe 2 CTCGACATCTAACGATCGAT Probe 3
TCGACATCTAACGATCGATC Probe 4 CGACATCTAACGATCGATCC Probe 5
GACATCTAACGATCGATCCT .vertline..vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline. Target TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
[0120] Probe 1 is nucleotides 76 to 95 of SEQ ID NO: 25, probe 2 is
nucleotides 77 to 96 of SEQ ID NO: 25, probe 3 is nucleotides 78 to
97 of SEQ ID NO: 25, probe 4 is nucleotides 79 to 98 of SEQ ID NO:
25, probe 5 is nucleotides 80 to 99 of SEQ ID NO: 25, and the
target (shown 3' to 5') is nucleotides 19 to 60 of SEQ ID NO: 19.
The highlighted nucleotides represent the nucleotides adjacent to
(that is, 3' of) the interrogation primers formed by the ligation
of the interrogation probes and the degenerate primers. The
identity of additional nucleotides can be determined by ligating
additional degenerate probes to the degenerate probes already
ligated to the interrogation probes. This process is illustrated
Example 10. It is preferred that the length of the degenerate
probes be equal to the number of interrogation probes in a nested
set.
[0121] K. Interrogation Primers
[0122] An interrogation primer is an oligonucleotide having a
sequence complementary to portions of TS-DNA or transcripts of
TS-DNA. Interrogation primers are intended for use in primer
extension sequencing operations following rolling circle
amplification of an amplification target circle (for example,
USA-SEQ and USA-CAGESEQ). Preferably, an interrogation primer is
complementary to a portion of the target sequences in TS-DNA
representing all or a portion of the left target probe portion of
an OCP. For use with secondary TS-DNA, it is preferred that
interrogation primers are complementary to a portion of the target
sequences in secondary TS-DNA representing the right target probe
portion of an OCP. Such interrogation primers are also preferably
complementary to a portion of the spacer region adjacent to the
left target probe portion. Thus, preferred interrogation primers
are complementary to a contiguous segment of TS-DNA representing
the 5' end of the OCP. This preferred relationship allows primer
extension sequencing of gap sequences in TS-DNA. An example of this
preferred relationship between interrogation primers and an OCP is
shown in FIG. 15. An interrogation probe can, however, be
complementary to any desired sequence in amplified nucleic
acid.
[0123] In general, interrogation primers can be an unligated
interrogation probe, a combination of two or more interrogation
probes (that is, interrogation probes ligated together), or a
combination of one or more interrogation probes and one or more
degenerate probes (that is, interrogation probes and degenerate
probes ligated together). Thus, interrogation probes can be used
directly as interrogation primers in a primer extension sequencing
operation, or they can be combined with other interrogation probes
or with degenerate probes to form interrogation primers. As use
herein, interrogation primers are oligonucleotides serving as
primers for primer extension sequencing. Where an interrogation
primer is made from probes with blocked 3'-hydroxyls, and the
resulting interrogation primer is blocked, the block must be
removed prior to the primer extension operation.
[0124] The complementary portion of an interrogation primer can be
any length that supports specific and stable hybridization between
the interrogation primer and TS-DNA. For this purpose, a length of
10 to 40 nucleotides is preferred, with a complementary portion of
an interrogation primer 15 to 30 nucleotides long being most
preferred. The preferred use of interrogation primers as primers in
primer extension sequencing of an amplified target sequence. For
this purpose, interrogation primers should hybridize to TS-DNA 5'
of the portion of the amplified target sequences that are to be
sequenced. It is preferred that the portion of the amplified target
sequences that are to be sequenced represent gap sequences. Such
gap sequences preferably collectively represent known, expected, or
potential sequence variants present in the portion of the target
nucleic acid opposite the gap space formed when an OCP hybridizes
to the target nucleic acid. For this purpose, it is preferred that
the gap space is filled by DNA polymerase in a gap-filling ligation
operation.
[0125] L. Caged Oligonucleotides
[0126] Caged oligonucleotides are oligonucleotides having a caged
nucleotide at their 3' end. The cage structure is a removable
blocking group which prevents the 3' hydroxyl from participating in
nucleotide addition and ligation reactions. Caged oligonucleotides
are useful as primers and probes as described above for use in the
amplification, detection, and sequencing operations disclosed
herein. Many cage structures are known. A preferred form of cage
structure are photolabile structures which allow their removal by
exposure to light. Examples of cage structures useful for
reversibly blocking the 3' end of oligonucleotides are described by
Metzker et al., Nucleic Acids Research 22:4259-4267 (1994), Burgess
and Jacutin, Am. Chem Soc. Abstracts volume 221, abstract 281
(1996), Zehavi et al., J. Organic Chem. 37:2281-2288 (1972), Kaplan
et al., Biochem. 17:1929-1935 (1978), and McCray et al., Proc.
Natl. Acad. Sci. USA 77:7237-7241 (1980). Preferred forms of caged
nucleotides for use in caged oligonucleotides are described by
Metzker et al. A most preferred cage structures is a
3'-O-(2-nitrobenzyl) group, which is labile upon exposure to
ultraviolet light (Pillai, Synthesis 1-26 (1980)). Removal of this
cage structure is preferably accomplished by illuminating the
material containing the caged nucleotide with long wavelength
ultraviolet light (preferably 354 nm) using a transilluminator for
3 to 10 minutes.
[0127] Disclosed and known cage structures can be incorporated into
oligonucleotides by adapting known and established oligonucleotide
synthesis methodology (described below) to use protected caged
nucleotides or by adding the cage structure following
oligonucleotide synthesis.
[0128] As described above, caged oligonucleotides can be used as
interrogation probes or degenerate probes. Caged oligonucleotides
can also be used as replication primers, such as rolling circle
replication primers, either for the entire population of, or a
portion of, the primers in an amplification reaction. This allows
the pool of functional (that is, extendable) primers to be
increased at a specified point in the reaction or amplification
operation. For example, when using different rolling circle
replication primers to produce different lengths of TS-DNA (see
Section II B below), one of the rolling circle replication primers
can be a caged oligonucleotide.
[0129] M. Peptide Nucleic Acid Clamps
[0130] Peptide nucleic acids (PNA) are a modified form of nucleic
acid having a peptide backbone. Peptide nucleic acids form
extremely stable hybrids with DNA (Hanvey et al., Science
258:1481-1485 (1992); Nielsen et al., Anticancer Drug Des. 8:53-63
(1993)), and have been used as specific blockers of PCR reactions
(Orum et al., Nucleic Acids Res., 21:5332-5336 (1993)). PNA clamps
are peptide nucleic acids complementary to sequences in both the
left target probe portion and right target probe portion of an OCP,
but not to the sequence of any gap oligonucleotides or filled gap
space in the ligated OCP. Thus, a PNA clamp can hybridize only to
the ligated junction of OCPs that have been illegitimately ligated,
that is, ligated in a non-target-directed manner. The PNA clamp can
be any length that supports specific and stable hybridization
between the clamp and its complement. Generally this is 7 to 12
nucleotides long, but is preferably 8 to 10 nucleotides long. PNA
clamps can be used to reduce background signals in rolling circle
amplifications by preventing replication of illegitimately ligated
OCPs.
[0131] N. Oligonucleotide Synthesis
[0132] Open circle probes, gap oligonucleotides, rolling circle
replication primers, detection probes, address probes,
amplification target circles, DNA strand displacement primers, and
any other oligonucleotides can be synthesized using established
oligonucleotide synthesis methods. Methods to produce or synthesize
oligonucleotides are well known in the art. Such methods can range
from standard enzymatic digestion followed by nucleotide fragment
isolation (see for example, Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989) Chapters 5, 6) to purely
synthetic methods, for example, by the cyanoethyl phosphoramidite
method using a Milligen or Beckman System 1Plus DNA synthesizer
(for example, Model 8700 automated synthesizer of
Milligen-Biosearch, Burlington, Mass. or ABI Model 380B). Synthetic
methods useful for making oligonucleotides are also described by
Ikuta et al., Ann. Rev. Biochem. 53:323-356 (1984),
(phosphotriester and phosphite-triester methods), and Narang et
al., Methods Enzymol., 65:610-620 (1980), (phosphotriester method).
Protein nucleic acid molecules can be made using known methods such
as those described by Nielsen et al., Bioconjug. Chem. 5:3-7
(1994).
[0133] Many of the oligonucleotides described herein are designed
to be complementary to certain portions of other oligonucleotides
or nucleic acids such that stable hybrids can be formed between
them. The stability of these hybrids can be calculated using known
methods such as those described in Lesnick and Freier, Biochemistry
34:10807-10815 (1995), McGraw et al., Biotechniques 8:674-678
(1990), and Rychlik et al., Nucleic Acids Res. 18:6409-6412
(1990).
[0134] O. Solid-State Detectors
[0135] Solid-state detectors are solid-state substrates or supports
to which address probes or detection molecules have been coupled. A
preferred form of solid-state detector is an array detector. An
array detector is a solid-state detector to which multiple
different address probes or detection molecules have been coupled
in an array, grid, or other organized pattern.
[0136] Solid-state substrates for use in solid-state detectors can
include any solid material to which oligonucleotides can be
coupled. This includes materials such as acrylamide, cellulose,
nitrocellulose, glass, polystyrene, polyethylene vinyl acetate,
polypropylene, polymethacrylate, polyethylene, polyethylene oxide,
glass, polysilicates, polycarbonates, teflon, fluorocarbons, nylon,
silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid,
polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans,
and polyamino acids. Solid-state substrates can have any useful
form including thin films or membranes, beads, bottles, dishes,
fibers, woven fibers, shaped polymers, particles and
microparticles. A preferred form for a solid-state substrate is a
microtiter dish. The most preferred form of microtiter dish is the
standard 96-well type.
[0137] Address probes immobilized on a solid-state substrate allow
capture of the products of RCA and RCT on a solid-state detector.
Such capture provides a convenient means of washing away reaction
components that might interfere with subsequent detection steps. By
attaching different address probes to different regions of a
solid-state detector, different RCA or RCT products can be captured
at different, and therefore diagnostic, locations on the
solid-state detector. For example, in a microtiter plate multiplex
assay, address probes specific for up to 96 different TS-DNAs (each
amplified via a different target sequence) can be immobilized on a
microtiter plate, each in a different well. Capture and detection
will occur only in those wells corresponding to TS-DNAs for which
the corresponding target sequences were present in a sample.
[0138] Methods for immobilization of oligonucleotides to
solid-state substrates are well established. Oligonucleotides,
including address probes and detection probes, can be coupled to
substrates using established coupling methods. For example,
suitable attachment methods are described by Pease et al., Proc.
Natl. Acad. Sci. USA 91(11):5022-5026 (1994), and Khrapko et al.,
Mol Biol (Mosk) (USSR) 25:718-730 (1991). A method for
immobilization of 3'-amine oligonucleotides on casein-coated slides
is described by Stimpson et al., Proc. Natl. Acad. Sci. USA
92:6379-6383 (1995). A preferred method of attaching
oligonucleotides to solid-state substrates is described by Guo et
al., Nucleic Acids Res. 22:5456-5465 (1994).
[0139] Some solid-state detectors useful in RCA and RCT assays have
detection antibodies attached to a solid-state substrate. Such
antibodies can be specific for a molecule of interest. Captured
molecules of interest can then be detected by binding of a second,
reporter antibody, followed by RCA or RCT. Such a use of antibodies
in a solid-state detector allows RCA assays to be developed for the
detection of any molecule for which antibodies can be generated.
Methods for immobilizing antibodies to solid-state substrates are
well established. Immobilization can be accomplished by attachment,
for example, to aminated surfaces, carboxylated surfaces or
hydroxylated surfaces using standard immobilization chemistries.
Examples of attachment agents are cyanogen bromide, succinimide,
aldehydes, tosyl chloride, avidin-biotin, photocrosslinkable
agents, epoxides and maleimides. A preferred attachment agent is
glutaraldehyde. These and other attachment agents, as well as
methods for their use in attachment, are described in Protein
immobilization: fundamentals and applications, Richard F. Taylor,
ed. (M. Dekker, New York, 1991), Johnstone and Thorpe,
Immunochemistry In Practice (Blackwell Scientific Publications,
Oxford, England, 1987) pages 209-216 and 241-242, and Immobilized
Affinity Ligands, Craig T. Hermanson et al., eds. (Academic Press,
New York, 1992). Antibodies can be attached to a substrate by
chemically cross-linking a free amino group on the antibody to
reactive side groups present within the solid-state substrate. For
example, antibodies may be chemically cross-linked to a substrate
that contains free amino or carboxyl groups using glutaraldehyde or
carbodiimides as cross-linker agents. In this method, aqueous
solutions containing free antibodies are incubated with the
solid-state substrate in the presence of glutaraldehyde or
carbodiimide. For crosslinking with glutaraldehyde the reactants
can be incubated with 2% glutaraldehyde by volume in a buffered
solution such as 0.1 M sodium cacodylate at pH 7.4. Other standard
immobilization chemistries are known by those of skill in the
art.
[0140] P. Solid-State Samples
[0141] Solid-state samples are solid-state substrates or supports
to which target molecules or target sequences have been coupled or
adhered. Target molecules or target sequences are preferably
delivered in a target sample or assay sample. A preferred form of
solid-state sample is an array sample. An array sample is a
solid-state sample to which multiple different target samples or
assay samples have been coupled or adhered in an array, grid, or
other organized pattern.
[0142] Solid-state substrates for use in solid-state samples can
include any solid material to which target molecules or target
sequences can be coupled or adhered. This includes materials such
as acrylamide, cellulose, nitrocellulose, glass, polystyrene,
polyethylene vinyl acetate, polypropylene, polymethacrylate,
polyethylene, polyethylene oxide, glass, polysilicates,
polycarbonates, teflon, fluorocarbons, nylon, silicon rubber,
polyanhydrides, polyglycolic acid, polylactic acid,
polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans,
and polyamino acids. Solid-state substrates can have any useful
form including thin films or membranes, beads, bottles, dishes,
slides, fibers, woven fibers, shaped polymers, particles and
microparticles. Preferred forms for a solid-state substrate are
microtiter dishes and glass slides. The most preferred form of
microtiter dish is the standard 96-well type.
[0143] Target molecules and target sequences immobilized on a
solid-state substrate allow formation of target-specific TS-DNA
localized on the solid-state substrate. Such localization provides
a convenient means of washing away reaction components that might
interfere with subsequent detection steps, and a convenient way of
assaying multiple different samples simultaneously. Diagnostic
TS-DNA can be independently formed at each site where a different
sample is adhered. For immobilization of target sequences or other
oligonucleotide molecules to form a solid-state sample, the methods
described above for can be used. Where the target molecule is a
protein, the protein can be immobilized on a solid-state substrate
generally as described above for the immobilization of
antibodies.
[0144] A preferred form of solid-state substrate is a glass slide
to which up to 256 separate target or assay samples have been
adhered as an array of small dots. Each dot is preferably from 0.1
to 2.5 mm in diameter, and most preferably around 2.5 mm in
diameter. Such microarrays can be fabricated, for example, using
the method described by Schena et al., Science 270:487-470 (1995).
Briefly, microarrays can be fabricated on poly-L-lysine-coated
microscope slides (Sigma) with an arraying machine fitted with one
printing tip. The tip is loaded with 1 .mu.l of a DNA sample (0.5
mg/ml) from, for example, 96-well microtiter plates and deposited
.about.0.005 .mu.l per slide on multiple slides at the desired
spacing. The printed slides can then be rehydrated for 2 hours in a
humid chamber, snap-dried at 100.degree. C. for 1 minute, rinsed in
0.1% SDS, and treated with 0.05% succinic anhydride prepared in
buffer consisting of 50% 1-methyl-2-pyrrolidinone and 50% boric
acid. The DNA on the slides can then be denatured in, for example,
distilled water for 2 minutes at 90.degree. C. immediately before
use. Microarray solid-state samples can scanned with, for example,
a laser fluorescent scanner with a computer-controlled XY stage and
a microscope objective. A mixed gas, multiline laser allows
sequential excitation of multiple fluorophores.
[0145] Q. Reporter Binding Agents
[0146] A reporter binding agent is a specific binding molecule
coupled or tethered to an oligonucleotide. The specific binding
molecule is referred to as the affinity portion of the reporter
binding agent and the oligonucleotide is referred to as the
oligonucleotide portion of the reporter binding agent. As used
herein, a specific binding molecule is a molecule that interacts
specifically with a particular molecule or moiety. The molecule or
moiety that interacts specifically with a specific binding molecule
is referred to herein as a target molecule. It is to be understood
that the term target molecule refers to both separate molecules and
to portions of molecules, such as an epitope of a protein, that
interacts specifically with a specific binding molecule.
Antibodies, either member of a receptor/ligand pair, and other
molecules with specific binding affinities are examples of specific
binding molecules, useful as the affinity portion of a reporter
binding molecule. A reporter binding molecule with an affinity
portion which is an antibody is referred to herein as a reporter
antibody. By tethering an amplification target circle or coupling a
target sequence to such specific binding molecules, binding of a
specific binding molecule to its specific target can be detected by
amplifying the ATC or target sequence with rolling circle
amplification. This amplification allows sensitive detection of a
very small number of bound specific binding molecules. A reporter
binding molecule that interacts specifically with a particular
target molecule is said to be specific for that target molecule.
For example, a reporter binding molecule with an affinity portion
which is an antibody that binds to a particular antigen is said to
be specific for that antigen. The antigen is the target molecule.
Reporter binding agents are also referred to herein as reporter
binding molecules. FIGS. 25, 26, 27, 28, and 29 illustrate examples
of several preferred types of reporter binding molecules and their
use. FIG. 29 illustrates a reporter binding molecule using an
antibody as the affinity portion.
[0147] A special form of reporter binding molecule, referred to
herein as a reporter binding probe, has an oligonucleotide or
oligonucleotide derivative as the specific binding molecule.
Reporter binding probes are designed for and used to detect
specific nucleic acid sequences. Thus, the target molecule for
reporter binding probes are nucleic acid sequences. The target
molecule for a reporter binding probe can be a nucleotide sequence
within a larger nucleic acid molecule. It is to be understood that
the term reporter binding molecule encompasses reporter binding
probes. The specific binding molecule of a reporter binding probe
can be any length that supports specific and stable hybridization
between the reporter binding probe and the target molecule. For
this purpose, a length of 10 to 40 nucleotides is preferred, with a
specific binding molecule of a reporter binding probe 16 to 25
nucleotides long being most preferred. It is preferred that the
specific binding molecule of a reporter binding probe is peptide
nucleic acid. As described above, peptide nucleic acid forms a
stable hybrid with DNA. This allows a reporter binding probe with a
peptide nucleic acid specific binding molecule to remain firmly
adhered to the target sequence during subsequent amplification and
detection operations. This useful effect can also be obtained with
reporter binding probes with oligonucleotide specific binding
molecules by making use of the triple helix chemical bonding
technology described by Gasparro et al., Nucleic Acids Res. 1994
22(14):2845-2852 (1994). Briefly, the affinity portion of a
reporter binding probe is designed to form a triple helix when
hybridized to a target sequence. This is accomplished generally as
known, preferably by selecting either a primarily homopurine or
primarily homopyrimidine target sequence. The matching
oligonucleotide sequence which constitutes the affinity portion of
the reporter binding probe will be complementary to the selected
target sequence and thus be primarily homopyrimidine or primarily
homopurine, respectively. The reporter binding probe (corresponding
to the triple helix probe described by Gasparro et al.) contains a
chemically linked psoralen derivative. Upon hybridization of the
reporter binding probe to a target sequence, a triple helix forms.
By exposing the triple helix to low wavelength ultraviolet
radiation, the psoralen derivative mediates cross-linking of the
probe to the target sequence. FIGS. 25, 26, 27, and 28 illustrate
examples of reporter binding molecules that are reporter binding
probes.
[0148] The specific binding molecule in a reporter binding probe
can also be a bipartite DNA molecule, such as ligatable DNA probes
adapted from those described by Landegren et al., Science
241:1077-1080 (1988). When using such a probe, the affinity portion
of the probe is assembled by target-mediated ligation of two
oligonticleotide portions which hybridize to adjacent regions of a
target nucleic acid. Thus, the components used to form the affinity
portion of such reporter binding probes are a truncated reporter
binding probe (with a truncated affinity portion which hybridizes
to part of the target sequence) and a ligation probe which
hybridizes to an adjacent part of the target sequence such that it
can be ligated to the truncated reporter binding probe. The
ligation probe can also be separated from (that is, not adjacent
to) the truncated reporter binding probe when both are hybridized
to the target sequence. The resulting space between them can then
be filled by a second ligation probe or by gap-filling synthesis.
For use in the disclosed methods, it is preferred that the
truncated affinity portion be long enough to allow target-mediated
ligation but short enough to, in the absence of ligation to the
ligation probe, prevent stable hybridization of the truncated
reporter binding probe to the target sequence during the subsequent
amplification operation. For this purpose, a specific step designed
to eliminate hybrids between the target sequence and unligated
truncated reporter binding probes can be used following the
ligation operation.
[0149] In one embodiment, the oligonucleotide portion of a reporter
binding agent includes a sequence, referred to as a target
sequence, that serves as a target sequence for an OCP. The sequence
of the target sequence can be arbitrarily chosen. In a multiplex
assay using multiple reporter binding agents, it is preferred that
the target sequence for each reporter binding agent be
substantially different to limit the possibility of non-specific
target detection. Alternatively, it may be desirable in some
multiplex assays, to use target sequences with related sequences.
By using different, unique gap oligonucleotides to fill different
gap spaces, such assays can use one or a few OCPs to amplify and
detect a larger number of target sequences. The oligonucleotide
portion can be coupled to the affinity portion by any of several
established coupling reactions. For example, Hendrickson et al.,
Nucleic Acids Res., 23(3):522-529 (1995) describes a suitable
method for coupling oligonucleotides to antibodies.
[0150] In another embodiment, the oligonucleotide portion of a
reporter binding agent includes a sequence, referred to as a
rolling circle replication primer sequence, that serves as a
rolling circle replication primer for an ATC. This allows rolling
circle replication of an added ATC where the resulting TS-DNA is
coupled to the reporter binding agent. Because of this, the TS-DNA
will be effectively immobilized at the site of the target molecule.
Preferably, the immobilized TS-DNA can then be collapsed in situ
prior to detection. The sequence of the rolling circle replication
primer sequence can be arbitrarily chosen. In a multiplex assay
using multiple reporter binding agents, it is preferred that the
rolling circle replication primer sequence for each reporter
binding agent be substantially different to limit the possibility
of non-specific target detection. Alternatively, it may be
desirable in some multiplex assays, to use rolling circle
replication primer sequences with related sequences. Such assays
can use one or a few ATCs to detect a larger number of target
molecules. When the oligonucleotide portion of a reporter binding
agent is used as a rolling circle replication primer, the
oligonucleotide portion can be any length that supports specific
and stable hybridization between the oligonucleotide portion and
the primer complement portion of an amplification target circle.
Generally this is 10 to 35 nucleotides long, but is preferably 16
to 20 nucleotides long. FIGS. 25, 26, 27, 28, and 29 illustrate
examples of reporter binding molecules in which the oligonucleotide
portion is a rolling circle replication primer.
[0151] In another embodiment, the oligonucleotide portion of a
reporter binding agent can include an amplification target circle
which serves as a template for rolling circle replication. In a
multiplex assay using multiple reporter binding agents, it is
preferred that address tag portions and detection tag portions of
the ATC comprising the oligonucleotide portion of each reporter
binding agent be substantially different to unique detection of
each reporter binding agent. It is desirable, however, to use the
same primer complement portion in all of the ATCs used in a
multiplex assay. The ATC is tethered to the specific binding
molecule by looping the ATC around a tether loop. This allows the
ATC to rotate freely during rolling circle replication while
remaining coupled to the affinity portion. The tether loop can be
any material that can form a loop and be coupled to a specific
binding molecule. Linear polymers are a preferred material for
tether loops.
[0152] A preferred method of producing a reporter binding agent
with a tethered ATC is to form the tether loop by ligating the ends
of oligonucleotides coupled to a specific binding molecule around
an ATC. Oligonucleotides can be coupled to specific binding
molecules using known techniques. For example, Hendrickson et al.
(1995), describes a suitable method for coupling oligonucleotides
to antibodies. This method is generally useful for coupling
oligonucleotides to any protein. To allow ligation,
oligonucleotides comprising the two halves of the tether loop
should be coupled to the specific binding molecule in opposite
orientations such that the free end of one is the 5' end and the
free end of the other is the 3' end. Ligation of the ends of the
tether oligonucleotides can be mediated by hybridization of the
ends of the tether oligonucleotides to adjacent sequences in the
ATC to be tethered. In this way, the ends of the tether
oligonucleotides are analogous to the target probe portions of an
open circle probe, with the ATC containing the target sequence.
[0153] Another preferred method of producing a reporter binding
agent with a tethered ATC is to ligate an open circle probe while
hybridized to an oligonucleotide tether loop on a specific binding
molecule. This is analogous to the ligation operation of LM-RCA. In
this case, the target sequence is part of an oligonucleotide with
both ends coupled to a specific binding molecule. In this method,
both ends of a single tether oligonucleotide are coupled to a
specific binding molecule. This can be accomplished using known
coupling techniques as described above.
[0154] The ends of tether loops can be coupled to any specific
binding molecule with functional groups that can be derivatized
with suitable activating groups. When the specific binding molecule
is a protein, or a molecule with similar functional groups,
coupling of tether ends can be accomplished using known methods of
protein attachment. Many such methods are described in Protein
immobilization: fundamentals and applications Richard F. Taylor,
ed. (M. Dekker, New York, 1991).
[0155] Antibodies useful as the affinity portion of reporter
binding agents, can be obtained commercially or produced using well
established methods. For example, Johnstone and Thorpe, on pages
30-85, describe general methods useful for producing both
polyclonal and monoclonal antibodies. The entire book describes
many general techniques and principles for the use of antibodies in
assay systems.
[0156] R. DNA Ligases
[0157] Any DNA ligase is suitable for use in the disclosed
amplification method. Preferred ligases are those that
preferentially form phosphodiester bonds at nicks in
double-stranded DNA. That is, ligases that fail to ligate the free
ends of single-stranded DNA at a significant rate are preferred.
Thermostable ligases are especially preferred. Many suitable
ligases are known, such as T4 DNA ligase (Davis et al., Advanced
Bacterial Genetics--A Manual for Genetic Engineering (Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., 1980)), E. coli DNA
ligase (Panasnko et al., J. Biol. Chem. 253:4590-4592 (1978)),
AMPLIGASE.RTM. (Kalin et al., Mutat. Res., 283(2):119-123 (1992);
Winn-Deen et al., Mol Cell Probes (England) 7(3):179-186 (1993)),
Taq DNA ligase (Barany, Proc. Natl. Acad. Sci. USA 88:189-193
(1991), Thermus thermophilus DNA ligase (Abbott Laboratories),
Thermus scotoductus DNA ligase and Rhodothermus marinus DNA ligase
(Thorbjarnardottir et al., Gene 151:177-180 (1995)). T4 DNA ligase
is preferred for ligations involving RNA target sequences due to
its ability to ligate DNA ends involved in DNA:RNA hybrids (Hsuih
et al., Quantitative detection of HCV RNA using novel
ligation-dependent polymerase chain reaction, American Association
for the Study of Liver Diseases (Chicago, Ill., Nov. 3-7,
1995)).
[0158] The frequency of non-target-directed ligation catalyzed by a
ligase can be determined as follows. LM-RCA is performed with an
open circle probe and a gap oligonucleotide in the presence of a
target sequence. Non-targeted-directed ligation products can then
be detected by using an address probe specific for the open circle
probe ligated without the gap oligonucleotide to capture TS-DNA
from such ligated probes. Target directed ligation products can be
detected by using an address probe specific for the open circle
probe ligated with the gap oligonucleotide. By using a solid-state
detector with regions containing each of these address probes, both
target directed and non-target-directed ligation products can be
detected and quantitated. The ratio of target-directed and
non-target-directed TS-DNA produced provides a measure of the
specificity of the ligation operation. Target-directed ligation can
also be assessed as discussed in Barany (1991).
[0159] S. DNA Polymerases
[0160] DNA polymerases useful in the rolling circle replication
step of RCA must perform rolling circle replication of primed
single-stranded circles. Such polymerases are referred to herein as
rolling circle DNA polymerases. For rolling circle replication, it
is preferred that a DNA polymerase be capable of displacing the
strand complementary to the template strand, termed strand
displacement, and lack a 5' to 3' exonuclease activity. Strand
displacement is necessary to result in synthesis of multiple tandem
copies of the ligated OCP. A 5' to 3' exonuclease activity, if
present, might result in the destruction of the synthesized strand.
It is also preferred that DNA polymerases for use in the disclosed
method are highly processive. The suitability of a DNA polymerase
for use in the disclosed method can be readily determined by
assessing its ability to carry out rolling circle replication.
Preferred rolling circle DNA polymerases are bacteriophage .phi.29
DNA polymerase (U.S. Pat. Nos. 5,198,543 and 5,001,050 to Blanco et
al.), phage M2 DNA polymerase (Matsumoto et al., Gene 84:247
(1989)), phage .phi.PRD1 DNA polymerase (Jung et al., Proc. Natl.
Acad. Sci. USA 84:8287 (1987)), VENT.RTM. DNA polymerase (Kong et
al., J. Biol. Chem. 268:1965-1975 (1993)), Klenow fragment of DNA
polymerase I (Jacobsen et al., Eur. J. Biochem. 45:623-627 (1974)),
T5 DNA polymerase (Chatterjee et al., Gene 97:13-19 (1991)), PRD1
DNA polymerase (Zhu and Ito, Biochim. Biophys. Acta. 1219:267-276
(1994)), modified T7 DNA polymerase (Tabor and Richardson, J. Biol.
Chem. 262:15330-15333 (1987); Tabor and Richardson, J. Biol. Chem.
264:6447-6458 (1989); Sequenase.TM. (U.S. Biochemicals)), and T4
DNA polymerase holoenzyme (Kaboord and Benkovic, Curr. Biol.
5:149-157 (1995)). .phi.29 DNA polymerase is most preferred.
[0161] Strand displacement can be facilitated through the use of a
strand displacement factor, such as helicase. It is considered that
any DNA polymerase that can perform rolling circle replication in
the presence of a strand displacement factor is suitable for use in
the disclosed method, even if the DNA polymerase does not perform
rolling circle replication in the absence of such a factor. Strand
displacement factors useful in RCA include BMRF1 polymerase
accessory subunit (Tsurumi et al., J. Virology 67(12):7648-7653
(1993)), adenovirus DNA-binding protein (Zijderveld and van der
Vliet, J. Virology 68(2):1158-11-64 (1994)), herpes simplex viral
protein ICP8 (Boehmer and Lehman, J. Virology 67(2):711-715 (1993);
Skaliter and Lehman, Proc. Natl. Acad. Sci. USA 91(22):10665-10669
(1994)), single-stranded DNA binding proteins (SSB; Rigler and
Romano, J. Biol. Chem. 270:8910-8919 (1995)), and calf thymus
helicase (Siegel et al., J. Biol. Chem. 267:13629-13635
(1992)).
[0162] The ability of a polymerase to carry out rolling circle
replication can be determined by using the polymerase in a rolling
circle replication assay such as those described in Fire and Xu,
Proc. Natl. Acad. Sci. USA 92:4641-4645 (1995) and in Example
1.
[0163] Another type of DNA polymerase can be used if a gap-filling
synthesis step is used, such as in gap-filling LM-RCA (see Example
3). When using a DNA polymerase to fill gaps, strand displacement
by the DNA polymerase is undesirable. Such DNA polymerases are
referred to herein as gap-filling DNA polymerases. Unless otherwise
indicated, a DNA polymerase referred to herein without specifying
it as a rolling circle DNA polymerase or a gap-filling DNA
polymerase, is understood to be a rolling circle DNA polymerase and
not a gap-filling DNA polymerase. Preferred gap-filling DNA
polymerases are T7 DNA polymerase (Studier et al., Methods Enzymol.
185:60-89 (1990)), DEEP VENT.RTM. DNA polymerase (New England
Biolabs, Beverly, Mass.), modified T7 DNA polymerase (Tabor and
Richardson, J. Biol. Chem. 262:15330-15333 (1987); Tabor and
Richardson, J. Biol. Chem. 264:6447-6458 (1989); Sequenase.TM.
(U.S. Biochemicals)), and T4 DNA polymerase (Kunkel et al., Methods
Enzymol. 154:367-382 (1987)). An especially preferred type of
gap-filling DNA polymerase is the Thermus flavus DNA polymerase
(MBR, Milwaukee, Wis.). The most preferred gap-filling DNA
polymerase is the Stoffel fragment of Taq DNA polymerase (Lawyer et
al., PCR Methods Appl. 2(4):275-287 (1993), King et al., J. Biol.
Chem. 269(18):13061-13064 (1994)).
[0164] The ability of a polymerase to fill gaps can be determined
by performing gap-filling LM-RCA. Gap-filling LM-RCA is performed
with an open circle probe that forms a gap space when hybridized to
the target sequence. Ligation can only occur when the gap space is
filled by the DNA polymerase. If gap-filling occurs, TS-DNA can be
detected, otherwise it can be concluded that the DNA polymerase, or
the reaction conditions, is not useful as a gap-filling DNA
polymerase.
[0165] T. RNA Polymerases
[0166] Any RNA polymerase which can carry out transcription in
vitro and for which promoter sequences have been identified can be
used in the disclosed rolling circle transcription method. Stable
RNA polymerases without complex requirements are preferred. Most
preferred are T7 RNA polymerase (Davanloo et al., Proc. Natl. Acad.
Sci. USA 81:2035-2039 (1984)) and SP6 RNA polymerase (Butler and
Chamberlin, J. Biol. Chem. 257:5772-5778 (1982)) which are highly
specific for particular promoter sequences (Schenbom and
Meirendorf, Nucleic Acids Research 13:6223-6236 (1985)). Other RNA
polymerases with this characteristic are also preferred. Because
promoter sequences are generally recognized by specific RNA
polymerases, the OCP or ATC should contain a promoter sequence
recognized by the RNA polymerase that is used. Numerous promoter
sequences are known and any suitable RNA polymerase having an
identified promoter sequence can be used. Promoter sequences for
RNA polymerases can be identified using established techniques.
[0167] The materials described above can be packaged together in
any suitable combination as a kit useful for performing the
disclosed method.
II. Method
[0168] The disclosed rolling circle amplification (RCA) method
involves replication of circular single-stranded DNA molecules. In
RCA, a rolling circle replication primer hybridizes to circular OCP
or ATC molecules followed by rolling circle replication of the OCP
or ATC molecules using a strand-displacing DNA polymerase.
Amplification takes place during rolling circle replication in a
single reaction cycle. Rolling circle replication results in large
DNA molecules containing tandem repeats of the OCP or ATC sequence.
This DNA molecule is referred to as a tandem sequence DNA (TS-DNA).
Rolling circle amplification is also referred to herein as
unimolecular segment amplification (USA). The term unimolecular
segment amplification is generally used herein to emphasis the
amplification of individual segments of nucleic acid, such as a
target sequence, that are of interest.
[0169] A preferred embodiment, ligation-mediated rolling circle
amplification (LM-RCA) method involves a ligation operation prior
to replication. In the ligation operation, an OCP hybridizes to its
cognate target nucleic acid sequence, if present, followed by
ligation of the ends of the hybridized OCP to form a covalently
closed, single-stranded OCP. After ligation, a rolling circle
replication primer hybridizes to OCP molecules followed by rolling
circle replication of the circular OCP molecules using a
strand-displacing DNA polymerase. Generally, LM-RCA comprises
[0170] (a) mixing an open circle probe (OCP) with a target sample,
resulting in an OCP-target sample mixture, and incubating the
OCP-target sample mixture under conditions promoting hybridization
between the open circle probe and a target sequence,
[0171] (b) mixing ligase with the OCP-target sample mixture,
resulting in a ligation mixture, and incubating the ligation
mixture under conditions promoting ligation of the open circle
probe to form an amplification target circle (ATC),
[0172] (c) mixing a rolling circle replication primer (RCRP) with
the ligation mixture, resulting in a primer-ATC mixture, and
incubating the primer-ATC mixture under conditions that promote
hybridization between the amplification target circle and the
rolling circle replication primer,
[0173] (d) mixing DNA polymerase with the primer-ATC mixture,
resulting in a polymerase-ATC mixture, and incubating the
polymerase-ATC mixture under conditions promoting replication of
the amplification target circle, where replication of the
amplification target circle results in formation of tandem sequence
DNA (TS-DNA).
[0174] The open circle probe is a single-stranded, linear DNA
molecule comprising, from 5' end to 3' end, a 5' phosphate group, a
right target probe portion, a primer complement portion, a spacer
region, a left target probe portion, and a 3' hydroxyl group,
wherein the left target probe portion is complementary to the 5'
region of a target sequence and the right target probe portion is
complementary to the 3' region of the target sequence.
[0175] The left and right target probe portions hybridize to the
two ends of the target nucleic acid sequence, with or without a
central gap to be filled by one or more gap oligonucleotides.
Generally, LM-RCA using gap oligonucleotides can be performed by,
in an LM-RCA reaction, (1) using a target sequence with a central
region located between a 5' region and a 3' region, and an OCP
where neither the left target probe portion of the open circle
probe nor the right target probe portion of the open circle probe
is complementary to the central region of the target sequence, and
(2) mixing one or more gap oligonucleotides with the target sample,
such that the OCP-target sample mixture contains the open circle
probe, the one or more gap oligonucleotides, and the target sample,
where each gap oligonucleotide consists of a single-stranded,
linear DNA molecule comprising a 5' phosphate group and a 3'
hydroxyl group, where each gap oligonucleotide is complementary all
or a portion of the central region of the target sequence.
[0176] A. The Ligation Operation
[0177] An open circle probe, optionally in the presence of one or
more gap oligonucleotides, is incubated with a sample containing
DNA, RNA, or both, under suitable hybridization conditions, and
then ligated to form a covalently closed circle. The ligated open
circle probe is a form of amplification target circle. This
operation is similar to ligation of padlock probes described by
Nilsson et al., Science, 265:2085-2088 (1994). The ligation
operation allows subsequent amplification to be dependent on the
presence of a target sequence. Suitable ligases for the ligation
operation are described above. Ligation conditions are generally
known. Most ligases require Mg.sup.++. There are two main types of
ligases, those that are ATP-dependent and those that are
NAD-dependent. ATP or NAD, depending on the type of ligase, should
be present during ligation.
[0178] The ligase and ligation conditions can be optimized to limit
the frequency of ligation of single-stranded termini. Such ligation
events do not depend on the presence of a target sequence. In the
case of AMPLIGASE.RTM.-catalyzed ligation, which takes place at
60.degree. C., it is estimated that no more than 1 in 1,000,000
molecules with single-stranded DNA termini will be ligated. This is
based on the level of non-specific amplification seen with this
ligase in the ligase chain reaction. Any higher nonspecific
ligation frequency would cause enormously high background
amplification in the ligase chain reaction. Using this estimate, an
approximate frequency for the generation of non-specifically
ligated open circles with a correctly placed gap oligonucleotide in
at the ligation junction can be calculated. Since two ligation
events are involved, the frequency of such events using
AMPLIGASE.RTM. should be the square of 1 in 1,000,000, or 1 in
1.times.10.sup.12. The number of probes used in a typical ligation
reaction of 50 .mu.l is 2.times.10.sup.12. Thus, the number of
non-specifically ligated circles containing a correct gap
oligonucleotide would be expected to be about 2 per reaction.
[0179] When RNA is to be detected, it is preferred that a reverse
transcription operation be performed to make a DNA target sequence.
An example of the use of such an operation is described in Example
4. Alternatively, an RNA target sequence can be detected directly
by using a ligase that can perform ligation on a DNA:RNA hybrid
substrate. A preferred ligase for this is T4 DNA ligase.
[0180] B. The Replication Operation
[0181] The circular open circle probes formed by specific ligation
and amplification target circles serve as substrates for a rolling
circle replication. This reaction requires the addition of two
reagents: (a) a rolling circle replication primer, which is
complementary to the primer complement portion of the OCP or ATC,
and (b) a rolling circle DNA polymerase. The DNA polymerase
catalyzes primer extension and strand displacement in a processive
rolling circle polymerization reaction that proceeds as long as
desired, generating a molecule of up to 100,000 nucleotides or
larger that contains up to approximately 1000 tandem copies of a
sequence complementary to the amplification target circle or open
circle probe (FIG. 4). This tandem sequence DNA (TS-DNA) consists
of, in the case of OCPs, alternating target sequence and spacer
sequence. Note that the spacer sequence of the TS-DNA is the
complement of the sequence between the left target probe and the
right target probe in the original open circle probe. A preferred
rolling circle DNA polymerase is the DNA polymerase of the
bacteriophage .phi.29.
[0182] During rolling circle replication one may additionally
include radioactive, or modified nucleotides such as
bromodeoxyuridine triphosphate, in order to label the DNA generated
in the reaction. Alternatively, one may include suitable precursors
that provide a binding moiety such as biotinylated nucleotides
(Langer et al. (1981)).
[0183] Rolling circle amplification can be engineered to produce
TS-DNA of different lengths in an assay involving multiple ligated
OCPs or ATCs. This can be useful for extending the number of
different targets that can be detected in a single assay. TS-DNA of
different lengths can be produced in several ways. In one
embodiment, the base composition of the spacer region of different
classes of OCP or ATC can be designed to be rich in a particular
nucleotide. Then a small amount of the dideoxy nucleotide
complementary to the enriched nucleotide can be included in the
rolling circle amplification reaction. After some amplification,
the dideoxy nucleotides will terminate extension of the TS-DNA
product of the class of OCP or ATC enriched for the complementary
nucleotide. Other OCPs or ATCs will be less likely to be
terminated, since they are not enriched for the complementary
nucleotide, and will produce longer TS-DNA products, on
average.
[0184] In another embodiment, two different classes of OCP or ATC
can be designed with different primer complement portions. These
different primer complement portions are designed to be
complementary to a different rolling circle replication primer.
Then the two different rolling circle replication primers are used
together in a single rolling circle amplification reaction, but at
significantly different concentrations. The primer at high
concentration immediately primes rolling circle replication due to
favorable kinetics, while the primer at lower concentration is
delayed in priming due to unfavorable kinetics. Thus, the TS-DNA
product of the class of OCP or ATC designed for the primer at high
concentration will be longer than the TS-DNA product of the class
of OCP or ATC designed for the primer at lower concentration since
it will have been replicated for a longer period of time. As
another option, one of the rolling circle replication primers can
be a caged oligonucleotide. In this case, the two rolling circle
replication primers can be at similar concentrations. The caged
rolling circle replication primer will not support rolling circle
replication until the cage structure is removed. Thus, the first,
uncaged rolling circle replication primer begins amplification of
its cognate amplification target circle(s) when the replication
operation begins, the second, caged rolling circle replication
primer begins amplification of its cognate amplification target
circle(s) only after removal of the cage. The amount of TS-DNA
produced from each rolling circle replication primer will differ
proportionate to the different effective times of replication.
Thus, the amount of TS-DNA made using each type of rolling circle
replication primer can be controlled using a caged primer. The use
of such a caged primer has the advantage that the caged primer can
be provided at a sufficient concentration to efficiently initiate
rolling circle replication as soon as it is uncaged (rather than at
a lower concentration).
[0185] C. Modifications and Additional Operations
[0186] 1. Detection of Amplification Products
[0187] Current detection technology makes a second cycle of RCA
unnecessary in many cases. Thus, one may proceed to detect the
products of the first cycle of RCA directly. Detection may be
accomplished by primary labeling or by secondary labeling, as
described below.
[0188] (a) Primary Labeling
[0189] Primary labeling consists of incorporating labeled moieties,
such as fluorescent nucleotides, biotinylated nucleotides,
digoxygenin-containing nucleotides, or bromodeoxyuridine, during
rolling circle replication in RCA, or during transcription in RCT.
For example, one may incorporate cyanine dye UTP analogs (Yu et al.
(1994)) at a frequency of 4 analogs for every 100 nucleotides. A
preferred method for detecting nucleic acid amplified in situ is to
label the DNA during amplification with BrdUrd, followed by binding
of the incorporated BUDR with a biotinylated anti-BUDR antibody
(Zymed Labs, San Francisco, Calif.), followed by binding of the
biotin moieties with Streptavidin-Peroxidase (Life Sciences, Inc.),
and finally development of fluorescence with Fluorescein-tyramide
(DuPont de Nemours & Co., Medical Products Dept.).
[0190] (b) Secondary Labeling with Detection Probes
[0191] Secondary labeling consists of using suitable molecular
probes, referred to as detection probes, to detect the amplified
DNA or RNA. For example, an open circle may be designed to contain
several repeats of a known arbitrary sequence, referred to as
detection tags. A secondary hybridization step can be used to bind
detection probes to these detection tags (FIG. 7). The detection
probes may be labeled as described above with, for example, an
enzyme, fluorescent moieties, or radioactive isotopes. By using
three detection tags per open circle probe, and four fluorescent
moieties per each detection probe, one may obtain a total of twelve
fluorescent signals for every open circle probe repeat in the
TS-DNA, yielding a total of 12,000 fluorescent moieties for every
ligated open circle probe that is amplified by RCA.
[0192] (c) Multiplexing and Hybridization Array Detection
[0193] RCA is easily multiplexed by using sets of different open
circle probes, each set carrying different target probe sequences
designed for binding to unique targets. Note that although the
target probe sequences designed for each target are different, the
primer complement portion may remain unchanged, and thus the primer
for rolling circle replication can remain the same for all targets.
Only those open circle probes that are able to find their targets
will give rise to TS-DNA. The TS-DNA molecules generated by RCA are
of high molecular weight and low complexity; the complexity being
the length of the open circle probe. There are two alternatives for
capturing a given TS-DNA to a fixed position in a solid-state
detector. One is to include within the spacer region of the open
circle probes a unique address tag sequence for each unique open
circle probe. TS-DNA generated from a given open circle probe will
then contain sequences corresponding to a specific address tag
sequence. A second and preferred alternative is to use the target
sequence present on the TS-DNA as the address tag.
[0194] (d) Combinatorial Multicolor Coding
[0195] A preferred form of multiplex detection involves the use of
a combination of labels that either fluoresce at different
wavelengths or are colored differently. One of the advantages of
fluorescence for the detection of hybridization probes is that
several targets can be visualized simultaneously in the same
sample. Using a combinatorial strategy, many more targets can be
discriminated than the number of spectrally resolvable
fluorophores. Combinatorial labeling provides the simplest way to
label probes in a multiplex fashion since a probe fluor is either
completely absent (-) or present in unit amounts (+); image
analysis is thus more amenable to automaton, and a number of
experimental artifacts, such as differential photobleaching of the
fluors and the effects of changing excitation source power
spectrum, are avoided.
[0196] The combinations of labels establish a code for identifying
different detection probes and, by extension, different target
molecules to which those detection probes are associated with. This
labeling scheme is referred to as Combinatorial Multicolor Coding
(CMC). Such coding is described by Speicher et al., Nature Genetics
12:368-375 (1996). Any number of labels, which when combined can be
separately detected, can be used for combinatorial multicolor
coding. It is preferred that 2, 3, 4, 5, or 6 labels be used in
combination. It is most preferred that 6 labels be used. The number
of labels used establishes the number of unique label combinations
that can be formed according to the formula 2.sup.N-1, where N is
the number of labels. According to this formula, 2 labels forms
three label combinations, 3 labels forms seven label combinations,
4 labels forms 15 label combinations, 5 labels form 31 label
combinations, and 6 labels forms 63 label combinations.
[0197] For combinatorial multicolor coding, a group of different
detection probes are used as a set. Each type of detection probe in
the set is labeled with a specific and unique combination of
fluorescent labels. For those detection probes assigned multiple
labels, the labeling can be accomplished by labeling each detection
probe molecule with all of the required labels. Alternatively,
pools of detection probes of a given type can each be labeled with
one of the required labels. By combining the pools, the detection
probes will, as a group, contain the combination of labels required
for that type of detection probe. This can be illustrated with a
simple example. Starting with seven different types of detection
probe, each complementary to a different detection tag and
designated 1 through 7, unique identification requires three
different labels used in seven combinations. Assigning the
combinations arbitrarily, one coding scheme is:
4 Detection probe 1 2 3 4 5 6 7 label A + + + + label B + + + label
C + + + +
[0198] As can be seen, detection probe 7 must be labeled with three
different labels, A, B, and C. This can be accomplished by labels
A, B, and C to each individual detection probe 7 molecule. This is
the first option described above. Alternatively, three pools of
detection probe 7 can be separately labeled, one pool with label A,
one pool with label B, and one pool with label C. In each pool,
individual detection molecules are labeled with a single type of
label. Mixing the pools results in a solution of detection probe 7
that collectively contains all three labels as required. Labeling
of detection probes requiring different numbers of probes can be
accomplished in a similar fashion.
[0199] Of course, the two types of labeling schemes described above
can be combined, resulting in detection probe molecules with
multiple labels combined with detection probe molecules of the same
type multiply labeled with different labels. This can be
illustrated using the example above. Two pools of detection probe
type 7 can be separately labeled, one pool with both labels A and
B, and one pool with only label C. Mixing the pools results in a
solution of detection probe 7 that collectively contains all three
labels as required. Combinatorial multicolor coding is further
illustrated in Examples 7 and 8.
[0200] Where each detection probe is labeled with a single label,
label combinations can also be generated by using OCPs or ATCs with
coded combinations of detection tags complementary to the different
detection probes. In this scheme, the OCPs or ATCs will contain a
combination of detection tags representing the combination of
labels required for a specific label code. Using the example above,
a set of seven OCPs or ATCs, designated 1 though 7, would contain
one, two, or three detection tags, chosen from a set of three
detection tag sequences designated dtA, dtB, and dtC. Each
detection tag sequence corresponds to one of the labels, A, B, or
C, with each label coupled to one of three detection probes,
designated dpA, dpB, or dpC, respectively. An example of the
resulting coding scheme would be:
5 OCP or ATC 1 2 3 4 5 6 7 dtA + + + + dtB + + + + dtC + + + +
[0201] Hybridization could be performed with a pool of all the
different labeled detection probes, dpA, dpB, and dpC. The result
would be that TS-DNA generated from OCP 7 would hybridize to all
three detection probes, thus labeling the TS-DNA with all three
labels. In contrast, TS-DNA generated from OCP 4, for example,
would hybridize only to detection probes dpA and dpB, thus labeling
the OCP 4-derived TS-DNA with only labels A and B. This method of
coding and detection is preferred. Use of this coding scheme is
illustrated in Examples 7 and 8.
[0202] As described above, rolling circle amplification can be
engineered to produce TS-DNA of different lengths in an assay
involving multiple ligated OCPs or ATCs. The resulting TS-DNA of
different length can be distinguished simply on the basis of the
size of the detection signal they generate. Thus, the same set of
detection probes could be used to distinguish two different sets of
generated TS-DNA. In this scheme, two different TS-DNAs, each of a
different size but assigned the same color code, would be
distinguished by the size of the signal produced by the hybridized
detection probes. In this way, a total of 126 different targets can
be distinguished on a single solid-state sample using a code with
63 combinations, since the signals will come in two flavors, low
amplitude and high amplitude. Thus one could, for example, use the
low amplitude signal set of 63 probes for detection of an oncogene
mutations, and the high amplitude signal set of 63 probes for the
detection of a tumor suppressor p53 mutations.
[0203] Speicher et al. describes a set of fluors and corresponding
optical filters spaced across the spectral interval 350-770 nm that
give a high degree of discrimination between all possible fluor
pairs. This fluor set, which is preferred for combinatorial
multicolor coding, consists of 4'-6-diamidino-2-phenylinodole
(DAPI), fluorescein (FITC), and the cyanine dyes Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. Any subset of this preferred set can also be used
where fewer combinations are required. The absorption and emission
maxima, respectively, for these fluors are: DAPI (350 nm; 456 nm),
FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588
nm), Cy5 (652 nm; 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm;
778 nm). The excitation and emission spectra, extinction
coefficients and quantum yield of these fluors are described by
Ernst et al., Cytometry 10:3-10 (1989), Mujumdar et al., Cytometry
10:11-19 (1989), Yu, Nucleic Acids Res. 22:3226-3232 (1994), and
Waggoner, Meth. Enzymology 246:362-373 (1995). These fluors can all
be excited with a 75W Xenon arc.
[0204] To attain selectivity, filters with bandwidths in the range
of 5 to 16 nm are preferred. To increase signal discrimination, the
fluors can be both excited and detected at wavelengths far from
their spectral maxima. Emission bandwidths can be made as wide as
possible. For low-noise detectors, such as cooled CCD cameras,
restricting the excitation bandwidth has little effect on
attainable signal to noise ratios. A list of preferred filters for
use with the preferred fluor set is listed in Table 1 of Speicher
et al. It is important to prevent infra-red light emitted by the
arc lamp from reaching the detector; CCD chips are extremely
sensitive in this region. For this purpose, appropriate IR blocking
filters can be inserted in the image path immediately in front of
the CCD window to minimize loss of image quality. Image analysis
software can then be used to count and analyze the spectral
signatures of fluorescent dots.
[0205] Discrimination of individual signals in combinatorial
multicolor coding can be enhanced by collapsing TS-DNA generated
during amplification. As described above, this is preferably
accomplished using collapsing detection probes, biotin-antibody
conjugates, or a combination of both. A collapsed TS-DNA can occupy
a space of no more than 0.3 microns in diameter. Based on this, it
is expected that up to a million discrete signals can be detected
in a 2.5 mm sample dot. Such discrimination also results in a large
dynamic range for quantitative signal detection. For example, where
two separate signals are detected in the same sample dot, a ratio
of the two signals up to 1:500,000 can be detected. Thus, the
relative numbers of different types of signals (such as multicolor
codes) can be determined over a wide range. This is expected to
allow determination of, for example, whether a particular target
sequence is homozygous or heterozygous in a genomic DNA sample,
whether a target sequence was inherited or represents a somatic
mutation, and the genetic heterogeneity of a genomic DNA sample,
such as a tumor sample. In the first case, a homozygous target
sequence would produce twice the number of signals of a
heterozygous target sequence. In the second case, an inherited
target sequence would produce a number of signals equivalent to a
homozygous or heterozygous signal (that is, a large number of
signals), while a somatic mutation would produce a smaller number
of signals depending on the source of the sample. In the third
case, the relative number of cells, from which a sample is derived,
that have particular target sequences can be determined. The more
cells in the sample with a particular target sequence, the larger
the signal.
[0206] (e) Detecting Groups of Target Sequences
[0207] Multiplex RCA assays are particularly useful for detecting
mutations in genes where numerous distinct mutations are associated
with certain diseases or where mutations in multiple genes are
involved. For example, although the gene responsible for
Huntington's chorea has been identified, a wide range of mutations
in different parts of the gene occur among affected individuals.
The result is that no single test has been devised to detect
whether an individual has one or more of the many Huntington's
mutations. A single LM-RCA assay can be used to detect the presence
of one or more members of a group of any number of target
sequences. This can be accomplished, for example, by designing an
open circle probe (and associated gap oligonucleotides, if desired)
for each target sequence in the group, where the target probe
portions of each open circle probe are different but the sequence
of the primer portions and the sequence of the detection tag
portions of all the open circle probes are the same. All of the
open circle probes are placed in the same OCP-target sample
mixture, and the same primer and detection probe are used to
amplify and detect TS-DNA. If any of the target sequences are
present in the target sample, the OCP for that target will be
ligated into a circle and the circle will be amplified to form
TS-DNA. Since the detection tags on TS-DNA resulting from
amplification of any of the OCPs are the same, TS-DNA resulting
from ligation of any of the OCPs will be detected in that assay.
Detection indicates that at least one member of the target sequence
group is present in the target sample. This allows detection of a
trait associated with multiple target sequences in a single tube or
well.
[0208] If a positive result is found, the specific target sequence
involved can be identified by using a multiplex assay. This can be
facilitated by including an additional, different detection tag in
each of the OCPs of the group. In this way, TS-DNA generated from
each different OCP, representing each different target sequence,
can be individually detected. It is convenient that such multiple
assays need be performed only when an initial positive result is
found.
[0209] The above scheme can also be used with arbitrarily chosen
groups of target sequences in order to screen for a large number of
target sequences without having to perform an equally large number
of assays. Initial assays can be performed as described above, each
using a different group of OCPs designed to hybridize to a
different group of target sequences. Additional assays to determine
which target sequence is present can then be performed on only
those groups that produce TS-DNA. Such group assays can be further
nested if desired.
[0210] (f) In Situ Detection Using RCA
[0211] In situ hybridization, and its most powerful implementation,
known as fluorescent in situ hybridization (FISH), is of
fundamental importance in cytogenetics. RCA can be adapted for use
in FISH, as follows.
[0212] Open circle probes are ligated on targets on microscope
slides, and incubated in situ with fluorescent precursors during
rolling circle replication. The rolling circle DNA polymerase
displaces the ligated open circle probe from the position where it
was originally hybridized. However, the circle will remain
topologically trapped on the chromosome unless the DNA is nicked
(Nilsson et al. (1994)). The presence of residual chromatin may
slow diffusion of the circle along the chromosome. Alternatively,
fixation methods may be modified to minimize this diffusional
effect. This diffusion has an equal probability of occurring in
either of two directions along the chromosome, and hence net
diffusional displacement may be relatively small during a 10 minute
incubation. During this time rolling circle replication should
generate a linear molecule of approximately 25,000 nucleotides
containing approximately 2,500 bromodeoxyuridine moieties, which
can be detected with a biotinylated anti-BUDR IgG (Zymed Labs,
Inc.) and fluorescein-labeled avidin. This level of incorporation
should facilitate recording of the image using a microscope-based
CCD system. Diffusion may also be limited because the TS-DNA should
be able to hybridize with the complement of the target strand.
[0213] A preferred method of in situ detection is Reporter Binding
Agent Unimolecular Rolling Amplification (RBAURA), which is
described below. In RBAURA, a reporter binding agent is used where
the oligonucleotide portion serves as a rolling circle replication
primer. Once the reporter binding agent is associated with a target
molecule, an amplification target circle is hybridized to the
rolling circle replication primer sequence of the reporter binding
agent followed by amplification of the ATC by RCA. The resulting
TS-DNA has the rolling circle replication primer sequence of the
reporter binding agent at one end, thus anchoring the TS-DNA to the
site of the target molecule. Peptide Nucleic Acid Probe
Unimolecular Rolling Amplification (PNAPURA) and Locked Antibody
Unimolecular Rolling Amplification (LAURA), described below, are
preferred forms of RBAURA.
[0214] Localization of the TS-DNA for in situ detection can also be
enhanced by collapsing the TS-DNA using collapsing detection
probes, biotin-antibody conjugates, or both, as described above.
Multiplexed in situ detection can be carried out as follows:
Rolling circle replication is carried out using unlabeled
nucleotides. The different TS-DNAs are then detected using standard
multi-color FISH with detection probes specific for each unique
target sequence or each unique detection tag in the TS-DNA.
Alternatively, and preferably, combinatorial multicolor coding, as
described above, can be used for multiplex in situ detection.
[0215] (g) Enzyme-Linked Detection
[0216] Amplified nucleic acid labeled by incorporation of labeled
nucleotides can be detected with established enzyme-linked
detection systems. For example, amplified nucleic acid labeled by
incorporation of biotin-16-UTP (Boehringher Mannheim) can be
detected as follows. The nucleic acid is immobilized on a solid
glass surface by hybridization with a complementary DNA
oligonucleotide (address probe) complementary to the target
sequence (or its complement) present in the amplified nucleic acid.
After hybridization, the glass slide is washed and contacted with
alkaline phosphatase-streptavidin conjugate (Tropix, Inc., Bedford,
Mass.). This enzyme-streptavidin conjugate binds to the biotin
moieties on the amplified nucleic acid. The slide is again washed
to remove excess enzyme conjugate and the chemiluminescent
substrate CSPD (Tropix, Inc.) is added and covered with a glass
cover slip. The slide can then be imaged in a Biorad
Fluorimager.
[0217] (h) Collapse of Nucleic Acids
[0218] As described above, TS-DNA or TS-RNA, which are produced as
extended nucleic acid molecules, can be collapsed into a compact
structure. It should also be understood that the same collapsing
procedure can be performed on any extended nucleic acid molecule.
For example, genomic DNA, PCR products, viral RNA or DNA, and cDNA
samples can all be collapsed into compact structures using the
disclosed collapsing procedure. It is preferred that the nucleic
acid to be collapsed is immobilized on a substrate. A preferred
means of collapsing nucleic acids is by hybridizing one or more
collapsing probes with the nucleic acid to be collapsed. Collapsing
probes are oligonucleotides having a plurality of portions each
complementary to sequences in the nucleic acid to be collapsed.
These portions are referred to as complementary portions of the
collapsing probe, where each complementary portion is complementary
to a sequence in the nucleic acid to be collapsed. The sequences in
the nucleic acid to be collapsed are referred to as collapsing
target sequences. The complementary portion of a collapsing probe
can be any length that supports specific and stable hybridization
between the collapsing probe and the collapsing target sequence.
For this purpose, a length of 10 to 35 nucleotides is preferred,
with a complementary portion of a collapsing probe 16 to 20
nucleotides long being most preferred. It is preferred that at
least two of the complementary portions of a collapsing probe be
complementary to collapsing target sequences which are separated on
the nucleic acid to be collapsed or to collapsing target sequences
present in separate nucleic acid molecules. This allows each
detection probe to hybridize to at least two separate collapsing
target sequences in the nucleic acid sample. In this way, the
collapsing probe forms a bridge between different parts of the
nucleic acid to be collapsed. The combined action of numerous
collapsing probes hybridizing to the nucleic acid will be to form a
collapsed network of cross-linked nucleic acid. Collapsed nucleic
acid occupies a much smaller volume than free, extended nucleic
acid, and includes whatever detection probe or detection label
hybridized to the nucleic acid. This result is a compact and
discrete nucleic acid structure which can be more easily detected
than extended nucleic acid. Collapsing nucleic acids is useful both
for in situ hybridization applications and for multiplex detection
because it allows detectable signals to be spatially separate even
when closely packed. Collapsing nucleic acids is especially
preferred for use with combinatorial multicolor coding.
[0219] Collapsing probes can also contain any of the detection
labels described above. This allows detection of the collapsed
nucleic acid in cases where separate detection probes or other
means of detecting the nucleic acid are not employed. Preferred
labels are biotin:and fluorescent molecules. A particularly
preferred detection probe is a molecular beacon. Molecular beacons
are detection probes labeled with fluorescent moieties where the
fluorescent moieties fluoresce only when the detection probe is
hybridized. The use of such probes eliminates the need for removal
of unhybridized probes prior to label detection because the
unhybridized detection probes will not produce a signal. This is
especially useful in multiplex assays.
[0220] TS-DNA collapse can also be accomplished through the use of
ligand/ligand binding pairs (such as biotin and avidin) or
hapten/antibody pairs. As described in Example 6, a nucleotide
analog, BUDR, can be incorporated into TS-DNA during rolling circle
replication. When biotinylated antibodies specific for BUDR and
avidin are added, a cross-linked network of TS-DNA forms, bridged
by avidin-biotin-antibody conjugates, and the TS-DNA collapses into
a compact structure. Biotin-derivatized nucleic acid can be formed
in many of the common nucleic acid replication operations such as
cDNA synthesis, PCR, and other nucleic acid amplification
techniques. In most cases, biotin can be incorporated into the
synthesized nucleic acid by either incorporation of
biotin-derivatized nucleotides or through the use of
biotin-derivatized primers. Collapsing probes and biotin-mediated
collapse can also be used together to collapse nucleic acids.
[0221] 2. Nested LM-RCA
[0222] After RCA, a round of LM-RCA can be performed on the TS-DNA
produced in the first RCA. This new round of LM-RCA is performed
with a new open circle probe, referred to as a secondary open
circle probe, having target probe portions complementary to a
target sequence in the TS-DNA produced in the first round. When
such new rounds of LM-RCA are performed, the amplification is
referred to herein as nested LM-RCA. Nested LM-RCA is particularly
useful for in situ hybridization applications of LM-RCA.
Preferably, the target probe portions of the secondary OCP are
complementary to a secondary target sequence in the spacer
sequences of the TS-DNA produced in the first RCA. The complement
of this secondary target sequence is present in the spacer portion
of the OCP or ATC used in the first RCA. After mixing the secondary
OCP with the TS-DNA, ligation and rolling circle amplification
proceed as in LM-RCA. Each ligated secondary OCP generates a new
TS-DNA. By having, for example, two secondary target sequence
portions in the first round OCP, the new round of LM-RCA will yield
two secondary TS-DNA molecules for every OCP or ATC repeat in the
TS-DNA produced in the first RCA. Thus, the amplification yield of
nested LM-RCA is about 2000-fold. The overall amplification using
two cycles of RCA is thus 1000.times.2000=2,000,000. Nested LM-RCA
can follow any DNA replication or transcription operation described
herein, such as RCA, LM-RCA, secondary DNA strand displacement,
strand displacement cascade amplification, or transcription.
[0223] Generally, nested LM-RCA involves, following a first
RCA,
[0224] (a) mixing a secondary open circle probe with the polymerase
mixture, resulting in an OCP-TS mixture, and incubating the OCP-TS
mixture under conditions promoting hybridization between the
secondary open circle probe and the tandem sequence DNA,
[0225] (b) mixing ligase with the OCP-TS mixture, resulting in a
secondary ligation mixture, and incubating the secondary ligation
mixture under conditions promoting ligation of the secondary open
circle probe to form a secondary amplification target circle,
[0226] (c) mixing a rolling circle replication primer with the
secondary ligation mixture, resulting in a secondary primer-ATC
mixture, and incubating the secondary primer-ATC mixture under
conditions that promote hybridization between the secondary
amplification target circle and rolling circle replication
primer,
[0227] (d) mixing DNA polymerase with the secondary primer-ATC
mixture, resulting in a secondary polymerase-ATC mixture, and
incubating the secondary polymerase-ATC mixture under conditions
promoting replication of the secondary amplification target circle,
where replication of the secondary amplification target circle
results in formation of nested tandem sequence DNA.
[0228] An exonuclease digestion step can be added prior to
performing the nested LM-RCA. This is especially useful when the
target probe portions of the secondary open circle probe are the
same as those in the first open circle probe. Any OCP which has
been ligated will not be digested since ligated OCPs have no free
end. A preferred way to digest OCPs that have hybridized to TS-DNA
during the first round of LM-RCA is to use a special rolling circle
replication primer containing at least about four phosphorothioate
linkages between the nucleotides at the 5' end. Then, following
rolling circle replication, the reaction mixture is subjected to
exonuclease digestion. By using a 5' exonuclease unable to cleave
these phosphorothioate linkages, only the OCPs hybridized to TS-DNA
will be digested, not the TS-DNA. The TS-DNA generated during the
first cycle of amplification will not be digested by the
exonuclease because it is protected by the phosphorothioate
linkages at the 5' end. A preferred exonuclease for this purpose is
the T7 gene 6 exonuclease. The T7 gene 6 exonuclease can be
inactivated prior to adding the secondary open circle probe by
heating to 90.degree. C. for 10 minutes.
[0229] By using an exonuclease digestion, nested LM-RCA can be
performed using the same target sequence used in a first round of
LM-RCA. This can be done, for example, generally as follows. After
the first round of LM-RCA, the unligated open circle probes and gap
oligonucleotides hybridized to TS-DNA are digested with T7 gene 6
exonuclease. The exonuclease is inactivated by heating for 10
minutes at 90.degree. C. Then a second open circle probe is added.
In this scheme, the second open circle probe has target probe
portions complementary to the same original target sequence, but
which contain a different (arbitrary) spacer region sequence. A
second round of LM-RCA is then performed. In this second round, the
target of the second open circle probes comprises the repeated
target sequences contained in the TS-DNA generated by the first
cycle. This procedure has the advantage of preserving the original
target sequence in the amplified DNA obtained after nested
LM-RCA.
[0230] Nested LM-RCA can also be performed on ligated OCPs or ATCs
that have not been amplified. In this case, LM-RCA can be carried
out using either ATCs or target-dependent ligated OCPs. This is
especially useful for in situ detection. For in situ detection, the
first, unamplified OCP, which is topologically locked to its target
sequence, can be subjected to nested LM-RCA. By not amplifying the
first OCP, it can remain hybridized to the target sequence while
LM-RCA amplifies a secondary OCP topologically locked to the first
OCP. This is illustrated in FIG. 12.
[0231] 3. Secondary DNA Strand Displacement and Strand Displacement
Cascade Amplification
[0232] Secondary DNA strand displacement is another way to amplify
TS-DNA. Secondary DNA strand displacement is accomplished by
hybridizing secondary DNA strand displacement primers to TS-DNA and
allowing a DNA polymerase to synthesize DNA from these primed sites
(FIG. 11). Since a complement of the secondary DNA strand
displacement primer occurs in each repeat of the TS-DNA, secondary
DNA strand displacement can result in a level of amplification
similar to or larger than that obtained in RCT. The product of
secondary DNA strand displacement is referred to as secondary
tandem sequence DNA or TS-DNA-2.
[0233] Secondary DNA strand displacement can be accomplished by
performing RCA to produce TS-DNA in a polymerase-ATC mixture, and
then mixing secondary DNA strand displacement primer with the
polymerase-ATC mixture, resulting in a secondary DNA strand
displacement mixture, and incubating the secondary DNA strand
displacement mixture under conditions promoting replication of the
tandem sequence DNA. The secondary DNA strand displacement primer
is complementary to a part of the OCP or ATC used to generated
TS-DNA as described earlier. It is preferred that the secondary DNA
strand displacement primer is not complementary to the rolling
circle replication primer, or to a tertiary DNA strand displacement
primer, if used.
[0234] Secondary DNA strand displacement can also be carried out
simultaneously with rolling circle replication. This is
accomplished by mixing secondary DNA strand displacement primer
with the polymerase-ATC mixture prior to incubating the mixture for
rolling circle replication. For simultaneous rolling circle
replication and secondary DNA strand displacement, it is preferred
that the rolling circle DNA polymerase be used for both
replications. This allows optimum conditions to be used and results
in displacement of other strands being synthesized downstream as
shown in FIG. 11B. Secondary DNA strand displacement can follow any
DNA replication operation disclosed herein, such as RCA, LM-RCA or
nested LM-RCA.
[0235] To optimize the efficiency of secondary DNA strand
displacement, it is preferred that a sufficient concentration of
secondary DNA strand displacement primer be used to obtain
sufficiently rapid priming of the growing TS-DNA strand to
outcompete any remaining unligated OCPs and gap oligonucleotides
that might be present for binding to TS-DNA. In general, this is
accomplished when the secondary DNA strand displacement primer is
in very large excess compared to the concentration of
single-stranded sites for hybridization of the secondary DNA strand
displacement primer on TS-DNA. Optimization of the concentration of
secondary DNA strand displacement primer can be aided by analysis
of hybridization kinetics using methods such as those described by
Young and Anderson, "Quantitative analysis of solution
hybridization" in Nucleic Acid Hybridization: A Practical Approach
(IRL-Press, 1985) pages 47-71. For example, assuming that .phi.29
DNA polymerase is used as the rolling circle DNA polymerase, TS-DNA
is generated at a rate of about 53 nucleotides per second, and the
rolling circle DNA polymerase generates approximately 10 copies of
the amplification target circle in 19 seconds. Analysis of the
theoretical solution hybridization kinetics for an OCP driver DNA
(unligated OCP) present at a concentration of 80 nM (a typical
concentration used for a LM-RCA ligation operation), and the
theoretical solution hybridization kinetics for a secondary DNA
strand displacement primer driver DNA present at a concentration of
800 nM, indicates that the secondary DNA strand displacement primer
will bind to those 10 copies within 30 seconds, while unligated OCP
will hybridize to less than one site in 30 seconds (8% of sites
filled). If the concentration of DNA polymerase is relatively high
(for this example, in the range of 100 to 1000 nM), the polymerase
will initiate DNA synthesis at each available 3' terminus on the
hybridized secondary DNA strand displacement primers, and these
elongating TS-DNA-2 molecules will block any hybridization by the
unligated OCP molecules. Alternatively, the efficiency of secondary
DNA strand displacement can be improved by the removal of unligated
open circle probes and gap oligonucleotides prior to amplification
of the TS-DNA. In secondary DNA strand displacement, it is
preferred that the concentration of secondary DNA strand
displacement primer generally be from 500 nM to 5000 nM, and most
preferably from 700 nM to 1000 nM.
[0236] As a secondary DNA strand displacement primer is elongated,
the DNA polymerase will run into the 5' end of the next hybridized
secondary DNA strand displacement molecule and will displace its 5'
end. In this fashion a tandem queue of elongating DNA polymerases
is formed on the TS-DNA template. As long as the rolling circle
reaction continues, new secondary DNA strand displacement primers
and new DNA polymerases are added to TS-DNA at the growing end of
the rolling circle. The generation of TS-DNA-2 and its release into
solution by strand displacement is shown diagrammatically in FIG.
11.
[0237] Generally, secondary DNA strand displacement can be
performed by, simultaneous with or following RCA, mixing a
secondary DNA strand displacement primer with the polymerase-ATC
mixture, and incubating the polymerase-ATC mixture under conditions
that promote both hybridization between the tandem sequence DNA and
the secondary DNA strand displacement primer, and replication of
the tandem sequence DNA, where replication of the tandem sequence
DNA results in the formation of secondary tandem sequence DNA.
[0238] When secondary DNA strand displacement is carried out in the
presence of a tertiary DNA strand displacement primer, an
exponential amplification of TS-DNA sequences takes place. This
special and preferred mode of secondary DNA strand displacement is
referred to as strand displacement cascade amplification (SDCA). In
SDCA, illustrated in FIG. 13, a secondary DNA strand displacement
primer primes replication of TS-DNA to form TS-DNA-2, as described
above. The tertiary DNA strand displacement primer strand can then
hybridize to, and prime replication of, TS-DNA-2 to form TS-DNA-3.
Strand displacement of TS-DNA-3 by the adjacent, growing TS-DNA-3
strands makes TS-DNA-3 available for hybridization with secondary
DNA strand displacement primer. This results in another round of
replication resulting in TS-DNA4 (which is equivalent to TS-DNA-2).
TS-DNA4, in turn, becomes a template for DNA replication primed by
tertiary DNA strand displacement primer. The cascade continues this
manner until the reaction stops or reagents become limiting. This
reaction amplifies DNA at an almost exponential rate, although
kinetics are not truly exponential because there are stochastically
distributed priming failures, as well as steric hindrance events
related to the large size of the DNA network produced during the
reaction. In a preferred mode of SDCA, the rolling circle
replication primer serves as the tertiary DNA strand displacement
primer, thus eliminating the need for a separate primer. For this
mode, the rolling circle replication primer should be used at a
concentration sufficiently high to obtain rapid priming on the
growing TS-DNA-2 strands. To optimize the efficiency of SDCA, it is
preferred that a sufficient concentration of secondary DNA strand
displacement primer and tertiary DNA strand displacement primer be
used to obtain sufficiently rapid priming of the growing TS-DNA
strand to outcompete TS-DNA for binding to its complementary
TS-DNA, and, in the case of secondary DNA strand displacement
primer, to outcompete any remaining unligated OCPs and gap
oligonucleotides that might be present for binding to TS-DNA. In
general, this is accomplished when the secondary DNA strand
displacement primer and tertiary DNA strand displacement primer are
both in very large excess compared to the concentration of
single-stranded sites for hybridization of the DNA strand
displacement primers on TS-DNA. For example, it is preferred that
the secondary DNA strand displacement primer is in excess compared
to the concentration of single-stranded secondary DNA strand
displacement primer complement sites on TS-DNA, TS-DNA-3, TS-DNA-5,
and so on. In the case of tertiary DNA strand displacement primer,
it is preferred that the tertiary DNA strand displacement primer is
in excess compared to the concentration of single-stranded tertiary
DNA strand displacement primer complement sites on TS-DNA-2,
TS-DNA-4, TS-DNA-6, and so on. Such an excess generally results in
a primer hybridizing to its complement in TS-DNA before amplified
complementary TS-DNA can hybridize. Optimization of primer
concentrations can be aided by analysis of hybridization kinetics
(Young and Anderson). In a strand displacement cascade
amplification, it is preferred that the concentration of both
secondary and tertiary DNA strand displacement primers generally be
from 500 nM to 5000 nM, and most preferably from 700 nM to 1000
nM.
[0239] As in the case of secondary DNA strand displacement primers,
if the concentration of DNA polymerase is sufficiently high, the
polymerase will initiate DNA synthesis at each available 3'
terminus on the hybridized tertiary DNA strand displacement
primers, and these elongating TS-DNA-3 molecules will block any
hybridization by TS-DNA-2. As a tertiary DNA strand displacement
primer is elongated to form TS-DNA-3, the DNA polymerase will run
into the 5' end of the next hybridized tertiary DNA strand
displacement primer molecule and will displace its 5' end. In this
fashion a tandem queue of elongating DNA polymerases is formed on
the TS-DNA-2 template. As long as the reaction continues, new
rolling circle replication primers and new DNA polymerases are
added to TS-DNA-2 at the growing ends of TS-DNA-2. This
hybridization/replication/strand displacement cycle is repeated
with hybridization of secondary DNA strand displacement primers on
the growing TS-DNA-3. The cascade of TS-DNA generation, and their
release into solution by strand displacement is shown
diagrammatically in FIG. 13.
[0240] Generally, strand displacement cascade amplification can be
performed by, simultaneous with, or following, RCA, mixing a
secondary DNA strand displacement primer and a tertiary DNA strand
displacement primer with the polymerase-ATC mixture, and incubating
the polymerase-ATC mixture under conditions that promote
hybridization between the tandem sequence DNA and the secondary DNA
strand displacement primer, replication of the tandem sequence
DNA--where replication of the tandem sequence DNA results in the
formation of secondary tandem sequence DNA--hybridization between
the secondary tandem sequence DNA and the tertiary DNA strand
displacement primer, and replication of secondary tandem sequence
DNA--where replication of the secondary tandem sequence DNA results
in formation of tertiary tandem sequence DNA (TS-DNA-3).
[0241] An example of the amplification yield generated by a strand
displacement cascade amplification can be roughly estimated as
follows. A rolling circle reaction that proceeds for 35 minutes at
53 nucleotides per second will generate 1236 copies of a 90
nucleotide amplification target circle. Thus, TS-DNA-1 contains
1236 tandem repeats. As these 1236 tandem repeats grow, priming and
synthesis with secondary DNA strand displacement primers can
generate at least 800 TS-DNA-2 molecules, taking into account
delays and missed priming events. These new molecules will have
lengths linearly distributed in the range of 1 to 799 repeats.
Next, priming events on TS-DNA-2 by tertiary DNA strand
displacement primers can generate at least 500 TS-DNA-3 molecules,
taking into account delays and missed priming events, and these new
molecules will have lengths linearly distributed in the range of 1
to 499 repeats. Then, priming events on TS-DNA-3 by secondary DNA
strand displacement primers can generate at least 300 TS-DNA-4
molecules, taking into account delays and missed priming events,
and these new molecules will have lengths linearly distributed in
the range of 1 to 299 repeats. A conservative overall amplification
yield, calculated as the product of only these four amplification
levels, is estimated to be 1.86.times.10.sup.10 repeats of the
original OCP or ATC. Thus, SDCA is capable of extremely high
amplification yields in an isothermal 35-minute reaction.
[0242] Secondary DNA strand displacement can also be carried out
sequentially. Following a first round of secondary DNA strand
displacement, a tertiary DNA strand displacement primer can be
mixed with the polymerase-ATC mixture, and the polymerase-ATC
mixture can be incubated under conditions that promote
hybridization between the secondary tandem sequence DNA and the
tertiary DNA strand displacement primer, and replication of
secondary tandem sequence DNA, where replication of the secondary
tandem sequence DNA results in formation of tertiary tandem
sequence DNA (TS-DNA-3). This round of strand displacement
replication can be referred to as tertiary DNA strand displacement.
However, all rounds of strand displacement replication following
rolling circle replication can also be referred to collectively as
secondary DNA strand displacement.
[0243] A modified form of secondary DNA strand displacement results
in amplification of TS-DNA and is referred to as opposite strand
amplification (OSA). OSA is the same as secondary DNA strand
displacement except that a special form of rolling circle
replication primer is used that prevents it from hybridizing to
TS-DNA-2. This can be accomplished in a number of ways. For
example, the rolling circle replication primer can have an affinity
tag coupled to its non-complementary portion allowing the rolling
circle replication primer to be removed prior to secondary DNA
strand displacement. Alternatively, remaining rolling circle
replication primer can be crippled following initiation of rolling
circle replication. One preferred form of rolling circle
replication primer for use in OSA is designed to form a hairpin
that contains a stem of perfectly base-paired nucleotides. The stem
can contain 5 to 12 base pairs, most preferably 6 to 9 base pairs.
Such a hairpin-forming rolling circle replication primer is a poor
primer at lower temperature (less than 40.degree. C.) because the
hairpin structure prevents it from hybridizing to complementary
sequences. The stem should involve a sufficient number of
nucleotides in the complementary portion of the rolling circle
replication primer to interfere with hybridization of the primer to
the OCP or ATC. Generally, it is preferred that a stem involve 5 to
24 nucleotides, and most preferably 6 to 18 nucleotides, of the
complementary portion of a rolling circle replication primer. A
rolling circle replication primer where half of the stem involves
nucleotides in the complementary portion of the rolling circle
replication primer and the other half of the stem involves
nucleotides in the non-complementary portion of the rolling circle
replication primer is most preferred. Such an arrangement
eliminates the need for self-complementary regions in the OCP or
ATC when using a hairpin-forming rolling circle replication
primer.
[0244] When starting the rolling circle replication reaction,
secondary DNA strand displacement primer and rolling circle
replication primer are added to the reaction mixture, and the
solution is incubated briefly at a temperature sufficient to
disrupt the hairpin structure of the rolling circle replication
primer but to still allow hybridization to the primer complement
portion of the amplification target circle (typically greater than
50.degree. C.). This incubation permits the rolling circle
replication primer to hybridize to the primer complement portion of
the amplification target circle. The solution is then brought to
the proper temperature for rolling circle replication, and the
rolling circle DNA polymerase is added. As the rolling circle
reaction proceeds, TS-DNA is generated, and as the TS-DNA grows in
length, the secondary DNA strand displacement primer rapidly
initiates DNA synthesis with multiple strand displacement reactions
on TS-DNA. These reactions generate TS-DNA-2, which is
complementary to the TS-DNA. While TS-DNA-2 contains sequences
complementary to the rolling circle replication primer, the primer
is not able to hybridize nor prime efficiently at the reaction
temperature due to its hairpin structure at this temperature. Thus,
there is no further priming by the rolling circle replication
primer and the only products generated are TS-DNA and TS-DNA-2. The
reaction comes to a halt as rolling circle amplification stops and
TS-DNA becomes completely double-stranded. In the course of the
reaction, an excess of single-stranded TS-DNA-2 is generated.
[0245] Another form of rolling circle replication primer useful in
OSA is a chimera of DNA and RNA. In this embodiment, the rolling
circle primer has deoxyribonucleotides at its 3' end and
ribonucleotides in the remainder of the primer. It is preferred
that the rolling circle replication primer have five or six
deoxyribonucleotides at its 3' end. By making part of the rolling
circle replication primer with ribonucleotide, the primer can be
selectively degraded by RNAse H when it is hybridized to DNA. Such
hybrids form during OSA as TS-DNA-2 is synthesized. The
deoxyribonucleotides at the 3' end allow the rolling circle DNA
polymerase to initiate rolling circle replication. RNAse H can then
be added to the OSA reaction to prevent priming of TS-DNA-2
replication.
[0246] An example of the amplification yield generated by OSA can
be roughly estimated as follows. A rolling circle reaction that
proceeds for 45 minutes at 53 nucleotides per second will generate
tandem 1590 copies of a 90 nucleotide amplification target circle.
Thus, TS-DNA-1 contains 1590 tandem repeats. As these 1590 tandem
repeats grow, priming and displacement reactions with secondary DNA
strand displacement primers will generate and release up to 1400
TS-DNA-2 molecules, and those new molecules will have lengths
linearly distributed in the range of 1 to 1399 repeats.
Calculations indicate that after 45 minutes, single-stranded
TS-DNA-2 exceeds the amount of TS-DNA by a factor of about 700. OSA
is useful for generating single-stranded DNA that contains the
reverse complement of the target sequence. Overall amplification
can be of the order of one million fold.
[0247] If secondary DNA strand displacement is used with a ligated
OCP, unligated OCPs and gap oligonucleotides may be removed prior
to rolling circle replication to eliminate competition between
unligated OCPs and gap oligonucleotides and the secondary DNA
strand displacement primer for hybridization to TS-DNA. An
exception would be when secondary DNA strand displacement is used
in conjunction with gap-filling LM-RCA, as described below.
Alternatively, the concentration of the secondary DNA strand
displacement primer can be made sufficiently high so that it
outcompetes unligated OCP for hybridization to TS-DNA. This allows
secondary DNA strand displacement to be performed without removal
of unligated OCPs.
[0248] The DNA generated by secondary DNA strand displacement can
be labeled and/or detected using the same labels, labeling methods,
and detection methods described for use with TS-DNA. Most of these
labels and methods are adaptable for use with nucleic acids in
general. A preferred method of labeling the DNA is by incorporation
of labeled nucleotides during synthesis.
[0249] 4. Multiple Ligation Cycles
[0250] Using a thermostable DNA ligase, such as AMPLIGASE.RTM.
(Epicentre Technologies, Inc.), the open circle probe ligation
reaction may be cycled a number of times between a annealing
temperature (55.degree. C.) and a melting temperature (96.degree.
C.). This cycling will produce multiple ligations for every target
sequence present in the sample. For example, 8 cycles of ligation
would provide and approximate 6-fold increase in the number of
ligated circles. A preferred cycling protocol is 96.degree. C. for
2 seconds, 55.degree. C. for 2 seconds, and 60.degree. C. for 70
seconds in a Perkin Elmer 9600 thermal cycler. If the number of
cycles is kept small, the linearity of the amplification response
should not be compromised.
[0251] The expected net amplification yield using eight ligation
cycles, secondary fluorescent tags, and array hybridization can be
calculated as shown below.
6 Ligation cycling yield: 6 OSA yield 1,000,000 number of
fluorescent tags/circle 5 20% array hybridization yield 0.2 Net
yield = 6 .times. 1,000,000 .times. 5 .times. 0.2 = 6,000,000
[0252] 100 target molecules.times.6,000,000=6.times.10.sup.8 fluors
bound on the surface
[0253] 5. Transcription Following RCA (RCT)
[0254] Once TS-DNA is generated using RCA, further amplification
can be accomplished by transcribing the TS-DNA from promoters
embedded in the TS-DNA. This combined process, referred to as
rolling circle replication with transcription (RCT), or ligation
mediated rolling circle replication with transcription (LM-RCT),
requires that the OCP or ATC from which the TS-DNA is made have a
promoter portion in its spacer region. The promoter portion is then
amplified along with the rest of the OCP or ATC resulting in a
promoter embedded in each tandem repeat of the TS-DNA (FIG. 8).
Since transcription, like rolling circle amplification, is a
process that can go on continuously (with re-initiation), multiple
transcripts can be produced from each of the multiple promoters
present in the TS-DNA. RCT effectively adds another level of
amplification of ligated OCP sequences.
[0255] Generally, RCT can be accomplished by performing RCA to
produce TS-DNA in a polymerase-OCP mixture or polymerase-ATC
mixture, and then mixing RNA polymerase with the polymerase-OCP
mixture or polymerase-ATC mixture, resulting in a transcription
mixture, and incubating the transcription mixture under conditions
promoting transcription of the tandem sequence DNA. The OCP or ATC
must include the sequence of a promoter for the RNA polymerase (a
promoter portion) in its spacer region for RCT to work. The
transcription step in RCT generally can be performed using
established conditions for in vitro transcription of the particular
RNA polymerase used. Preferred conditions are described in the
Examples. Alternatively, transcription can be carried out
simultaneously with rolling circle replication. This is
accomplished by mixing RNA polymerase with the polymerase-OCP
mixture or polymerase-ATC mixture prior to incubating the mixture
for rolling circle replication. For simultaneous rolling circle
replication and transcription the rolling circle DNA polymerase and
RNA polymerase must be active in the same conditions. Such
conditions can be optimized in order to balance and/or maximize the
activity of both polymerases. It is not necessary that the
polymerase achieve their maximum activity, a balance between the
activities is preferred. Transcription can follow any DNA
replication operation described herein, such as RCA, LM-RCA, nested
LM-RCA, secondary DNA strand displacement, or strand displacement
cascade amplification.
[0256] The transcripts generated in RCT can be labeled and/or
detected using the same labels, labeling methods, and detection
methods described for use with TS-DNA. Most of these labels and
methods are adaptable for use with nucleic acids in general. A
preferred method of labeling RCT transcripts is by direct labeling
of the transcripts by incorporation of labeled nucleotides, most
preferably biotinylated nucleotides, during transcription.
[0257] 6. Gap-Filling Ligation
[0258] The gap space formed by an OCP hybridized to a target
sequence is normally occupied by one or more gap oligonucleotides
as described above. Such a gap space may also be filled in by a
gap-filling DNA polymerase during the ligation operation. As an
alternative, the gap space can be partially bridged by one or more
gap oligonucleotides, with the remainder of the gap filled using
DNA polymerase. This modified ligation operation is referred to
herein as gap-filling ligation and is the preferred form of the
ligation operation. The principles and procedure for gap-filling
ligation are generally analogous to the filling and ligation
performed in gap LCR (Wiedmann et al., PCR Methods and Applications
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor
Laboratory, N.Y., 1994) pages S51-S64; Abravaya et al., Nucleic
Acids Res., 23(4):675-682 (1995); European Patent Application
EP0439182 (1991)). In the case of LM-RCA, the gap-filling ligation
operation is substituted for the normal ligation operation.
Gap-filling ligation provides a means for discriminating between
closely related target sequences. An example of this is described
in Example 3. Gap-filling ligation can be accomplished by using a
different DNA polymerase, referred to herein as a gap-filling DNA
polymerase. Suitable gap-filling DNA polymerases are described
above. Alternatively, DNA polymerases in general can be used to
fill the gap when a stop base is used. The use of stop bases in the
gap-filling operation of LCR is described in European Patent
Application EP0439182. The principles of the design of gaps and the
ends of flanking probes to be joined, as described in EP0439182, is
generally applicable to the design of the gap spaces and the ends
of target probe portions described herein.
[0259] To prevent interference of the gap-filling DNA polymerase
with rolling circle replication, the gap-filling DNA polymerase can
be removed by extraction or inactivated with a neutralizing
antibody prior to performing rolling circle replication. Such
inactivation is analogous to the use of antibodies for blocking Taq
DNA polymerase prior to PCR (Kellogg et al., Biotechniques
16(6):1134-1137 (1994)).
[0260] Gap-filling ligation is also preferred because it is highly
compatible with exponential amplification of OCP sequences similar
to the strand displacement cascade amplification (SDCA) as
described above. As TS-DNA is formed during rolling circle
replication, unligated OCP molecules present in the reaction
hybridize to TS-DNA, leaving gap spaces between every OCP repeat.
The hybridized OCP molecules serve as primers for secondary DNA
synthesis.
[0261] Generally, gap-filling LM-RCA can be performed by, in an
LM-RCA reaction, (1) using a target sequence with a central region
located between a 5' region and a 3' region, and an OCP where
neither the left target probe portion of the open circle probe nor
the right target probe portion of the open circle probe is
complementary to the central region of the target sequence, and (2)
mixing gap-filling DNA polymerase with the OCP-target sample
mixture.
[0262] 7. Ligation Mediated Rolling Circle Amplification with
Combinatorial Multicolor Coding
[0263] A preferred form of rolling circle amplification involving
multiplex detection is Ligation Mediated Rolling Circle
Amplification with Combinatorial Multicolor Coding (LM-RCA-CMC),
which is a combination of LM-RCA and CMC, both as described above.
In LM-RCA-CMC, open circle probes and corresponding gap
oligonucleotides are designed for the detection of a number of
distinct target sequences. DNA samples to be tested are
incorporated into a solid-state sample, as described above. The
solid-state substrate is preferably a glass slide and the
solid-state sample preferably incorporates up to 256 individual
target or assay samples arranged in dots. Multiple solid-state
samples can be used to either test more individual samples, or to
increase the number of distinct target sequences to be detected. In
the later case, each solid-state sample has an identical set of
sample dots, and LM-RCA will be carried out using a different set
of open circle probes and gap oligonucleotides, collectively
referred to as a probe set, for each solid-state sample. This
allows a large number of individuals and target sequences to be
assayed in a single assay. By using up to six different labels,
combinatorial multicolor coding allows up to 63 distinct targets to
be detected on a single solid-state sample. When using multiple
solid-state substrates and performing LM-RCA with a different set
of OCPs and gap oligonucleotides for each solid-state substrate,
the same labels can be used with each solid-state sample (although
differences between OCPs in each set may require the use of
different detection probes). For example, 10 replica slides, each
with 256 target sample dots, can be subjected to LM-RCA using 10
different sets of OCPs and gap oligonucleotides, where each set is
designed for combinatorial multicolor coding of 63 targets. This
result in an assay for detection of 630 different target sequences.
Where two or more different target sequences are closely spaced in
the DNA of the target or assay sample (for example, when multiple
closely spaced mutations of the same gene are targets), it is
preferred that the OCPs and gap oligonucleotides for each of the
closely spaced target sequences be placed in a different probe set.
For this purpose, it is considered that target sequences within 20
nucleotides of each other on a DNA molecule in a target or assay
sample are closely spaced. It is not required that multiple targets
within the same gene be detected with a different probe set. It is
merely preferred that closely spaced target sequences, as defined
above, be separately probed.
[0264] After rolling circle amplification, a cocktail of detection
probes is added, where the cocktail contains color combinations
that are specific for each OCP. The design and combination of such
detection probes for use in combinatorial multicolor coding is
described above. It is preferred that the OCPs be designed with
combinatorially coded detection tags to allow use of a single set
of singly labeled detection probes. It is also preferred that
collapsing detection probes be used. As described above, collapsing
probes contain two complementary portions. This allows each
detection probe to hybridize to two detection tags in TS-DNA. In
this way, the detection probe forms a bridge between different
parts of the TS-DNA. The combined action of numerous collapsing
detection probes hybridizing to TS-DNA will be to form a collapsed
network of cross-linked TS-DNA. Collapsed TS-DNA occupies a much
smaller volume than free, extended TS-DNA, and includes whatever
detection label present on the detection probe. This result is a
compact and discrete detectable signal for each TS-DNA. Probe
binding will, upon collapse, trap a unique combination of colors
that was designed a priory on the basis of each probe sequence.
[0265] As discussed above, rolling circle amplification can be
engineered to produce TS-DNA of different lengths for different
OCPs. Such products can be distinguish simply on the basis of the
size of the detection signal they generate. Thus, the same set of
detection probes could be used to distinguish two different sets of
generated TS-DNA. In this scheme, two different TS-DNAs, each of a
different size class but assigned the same color code, would be
distinguished by the size of the signal produced by the hybridized
detection probes. In this way, a total of 126 different targets can
be distinguished on a single solid-state sample using a code with
63 combinations, since the signals will come in two flavors, low
amplitude and high amplitude. Thus one could, for example, use the
low amplitude signal set of 63 probes for detection of an oncogene
mutations, and the high amplitude signal set of 63 probes for the
detection of a tumor suppressor p53 mutations.
[0266] 8. Reporter Binding Agent Unimolecular Rolling
Amplification
[0267] Reporter Binding Agent Unimolecular Rolling Amplification
(RBAURA) is a form of RCA where a reporter binding agent provides
the rolling circle replication primer for amplification of an
amplification target circle. In RBAURA, the oligonucleotide portion
of the reporter binding agent serves as a rolling circle
replication primer. RBAURA allows RCA to produce an amplified
signal (that is, TS-DNA) based on association of the reporter
binding agent to a target molecule The specific primer sequence
that is a part of the reporter binding agent provides the link
between the specific interaction of the reporter binding agent to a
target molecule (via the affinity portion of the reporter binding
agent) and RCA. In RBAURA, once the reporter binding agent is
associated with a target molecule, an amplification target circle
is hybridized to the rolling circle replication primer sequence of
the reporter binding agent, followed by amplification of the ATC by
RCA. The resulting TS-DNA incorporates the rolling circle
replication primer sequence of the reporter binding agent at one
end, thus anchoring the TS-DNA to the site of the target molecule.
RBAURA is a preferred RCA method for in situ detections. For this
purpose, it is preferred that the TS-DNA is collapsed using
collapsing detection probes, biotin-antibody conjugates, or both,
as described above. RBAURA can be performed using any target
molecule. Preferred target molecules are nucleic acids, including
amplified nucleic acids such as TS-DNA and amplification target
circles, antigens and ligands. Examples of the use of such target
molecules are illustrated in FIGS. 25A to 29B. Peptide Nucleic Acid
Probe Unimolecular Rolling Amplification (PNAPURA) and Locked
Antibody Unimolecular Rolling Amplification (LAURA), described
below, are preferred forms of RBAURA.
[0268] (a) Peptide Nucleic Acid Probe Unimolecular Rolling
Amplification
[0269] In PNAPURA, chimeric PNA:DNA molecules are used as reporter
binding probes, referred to as PNA reporter binding probes. The
oligonucleotide portion of the PNA reporter binding agent serves as
a rolling circle replication primer. The affinity portion of the
PNA reporter binding probe is a peptide nucleic acid, preferably 12
to 20 nucleotide bases in length and more preferably 15 to 18 bases
in length, designed to hybridize to a target nucleic acid sequence
of interest. In PNAPURA, the PNA reporter binding probe is first
allowed to hybridize to a target sequence (illustrated in FIG.
25A). Once the PNA reporter binding probe is hybridized to a target
sequence, an amplification target circle is hybridized to the
rolling circle replication primer sequence of the PNA reporter
binding probe (illustrated in FIG. 25B), followed by amplification
of the ATC by RCA. The resulting TS-DNA incorporates the rolling
circle replication primer sequence of the PNA reporter binding
probe at one end, thus anchoring the TS-DNA to the site of the
target molecule. Reporter binding agents having any form of
affinity portion can be used in a similar manner.
[0270] PNAPURA is preferably performed with a solid-state substrate
and in combination with CMC. For this purpose, DNA samples to be
tested are incorporated into a solid-state sample, as described
above. The solid-state substrate is preferably a glass slide and
the solid-state sample preferably incorporates up to 256 individual
target or assay samples arranged in dots. Multiple solid-state
samples can be used to either test more individual samples, or to
increase the number of distinct target sequences to be detected. In
the later case, each solid-state sample has an identical set of
samples dots, and PNAPURA will be carried out using a different set
of PNA reporter binding probes and amplification target circles,
collectively referred to as a probe set, for each solid-state
sample. This allows a large number of individuals and target
sequences to be assayed in a single assay. By using up to six
different labels, combinatorial multicolor coding allows up to 63
distinct targets to be detected on a single solid-state sample.
When using multiple solid-state substrates and performing PNAPURA
with a different set of PNA reporter binding probes and
amplification target circles for each solid-state substrate, the
same labels can be used with each solid-state sample (although
differences between ATCs in each set may require the use of
different detection probes). For example, 10 replica slides, each
with 256 target sample dots, can be subjected to PNAPURA using 10
different sets of PNA reporter binding probes and amplification
target circles, where each set is designed for combinatorial
multicolor coding of 63 targets. This results in an assay for
detection of 630 different target sequences. Where two or more
different target sequences are closely spaced in the DNA of the
target or assay sample (for example, when multiple closely spaced
mutations of the same gene are targets), it is preferred that the
PNA reporter binding probe for each of the closely spaced target
sequences be placed in a different probe set. For this purpose, it
is considered that target sequences within 20 nucleotides of each
other on a DNA molecule in a target or assay sample are closely
spaced. It is not required that multiple targets within the same
gene be detected with a different probe set. It is merely preferred
that closely spaced target sequences, as defined above, be
separately probed.
[0271] After rolling circle amplification, a cocktail of detection
probes is added, where the cocktail contains color combinations
that are specific for each ATC. The design and combination of such
detection probes for use in combinatorial multicolor coding is
described above. It is preferred that the ATCs be designed with
combinatorially coded detection tags to allow use of a single set
of singly labeled detection probes. It is also preferred that
collapsing detection probes be used. As described above, collapsing
probes contain two complementary portions. This allows each
detection probe to hybridize to two detection tags in TS-DNA. In
this way, the detection probe forms a bridge between different
parts of the TS-DNA. The combined action of numerous collapsing
detection probes hybridizing to TS-DNA will be to form a collapsed
network of cross-linked TS-DNA. Collapsed TS-DNA occupies a much
smaller volume than free, extended TS-DNA, and includes whatever
detection label present on the detection probe. This result is a
compact and discrete detectable signal for each TS-DNA. Probe
binding will, upon collapse, trap a unique combination of colors
that was designed a priory on the basis of each probe sequence.
[0272] (b) Locked Antibody Unimolecular Rolling Amplification
[0273] In LAURA, a covalently coupled antibody and oligonucleotide
is used as a reporter binding agent. The oligonucleotide portion of
the reporter binding agent serves as a rolling circle replication
primer. The affinity portion of the reporter binding agent is an
antibody specific for a target molecule of interest. The reporter
binding agent is conjugated to the target molecule as in a
conventional immunoassay (illustrated in FIG. 29A). Unlike
conventional immunoassays, detection of this interaction is
mediated by rolling circle amplification. After conjugation and
washing, the immune complexes are fixed in place with a suitable
fixation reaction (for example, methanol-acetic acid) to immobilize
the antibody. As in conventional immunoassays, unconjugated
antibodies (in this case, in the form of reporter binding agents)
are removed by washing. Once the reporter binding agent is
conjugated to a target molecule, an amplification target circle is
hybridized to the rolling circle replication primer sequence of the
reporter binding agent (illustrated in FIG. 29B), followed by
amplification of the ATC by RCA. The resulting TS-DNA incorporates
the rolling circle replication primer sequence of the reporter
binding agent at one end, thus anchoring the TS-DNA to the site of
the target molecule.
[0274] In a variant of this method, the oligonucleotide portion of
the reporter binding agent can be a peptide nucleic acid, instead
of DNA. After fixation of the reporter binding agent to the target
molecule, the PNA can be hybridized an oligonucleotide that
contains a portion complementary to the PNA, referred to as the
complementary portion, and a portion that remains single stranded,
referred to as the primer portion. The primer portion can then be
used as a rolling circle primer in LAURA as described above.
[0275] LAURA is preferably performed with a solid-state substrate
and in combination with CMC. For this purpose, DNA samples to be
tested are incorporated into a solid-state sample, as described
above. The solid-state substrate is preferably a glass slide and
the solid-state sample preferably incorporates up to 256 individual
target or assay samples arranged in dots. Multiple solid-state
samples can be used to either test more individual samples, or to
increase the number of distinct target sequences to be detected. In
the later case, each solid-state sample has an identical set of
samples dots, and LAURA will be carried out using a different set
of reporter binding agents and amplification target circles,
collectively referred to as a probe set, for each solid-state
sample. This allows a large number of individuals and target
sequences to be assayed in a single assay. By using up to six
different labels, combinatorial multicolor coding allows up to 63
distinct targets to be detected on a single solid-state sample.
When using multiple solid-state substrates and performing LAURA
with a different set of reporter binding agents and amplification
target circles for each solid-state substrate, the same labels can
be used with each solid-state sample (although differences between
ATCs in each set may require the use of different detection
probes). For example, 10 replica slides, each with 256 target
sample dots, can be subjected to LAURA using 10 different sets of
reporter binding agents and amplification target circles, where
each set is designed for combinatorial multicolor coding of 63
targets. This results in an assay for detection of 630 different
target sequences. Where two or more different target sequences are
closely spaced in the DNA of the target or assay sample, it is
preferred that the PNA reporter binding probe for each of the
closely spaced target sequences be placed in a different probe set,
as discussed above.
[0276] After rolling circle amplification, a cocktail of detection
probes is added, where the cocktail contains color combinations
that are specific for each ATC. The design and combination of such
detection probes for use in combinatorial multicolor coding is
described above. It is preferred that the ATCs be designed with
combinatorially coded detection tags to allow use of a single set
of singly labeled detection probes. It is also preferred that
collapsing detection probes be used. As described above, collapsing
probes contain two complementary portions. This allows each
detection probe to hybridize to two detection tags in TS-DNA. In
this way, the detection probe forms a bridge between different
parts of the TS-DNA. The combined action of numerous collapsing
detection probes hybridizing to TS-DNA will be to form a collapsed
network of cross-linked TS-DNA. Collapsed TS-DNA occupies a much
smaller volume than free, extended TS-DNA, and includes whatever
detection label present on the detection probe. This result is a
compact and discrete detectable signal for each TS-DNA. Probe
binding will, upon collapse, trap a unique combination of colors
that was designed a priory on the basis of each probe sequence.
[0277] 9. Primer Extension Sequencing
[0278] Following amplification, the nucleotide sequence of the
amplified sequences can be determined either by conventional means
or by primer extension sequencing of amplified target sequence.
Primer extension sequencing is also referred herein as chain
terminating primer extension sequencing. A preferred form of chain
terminating primer extension sequencing, referred to herein as
single nucleotide primer extension sequencing, involves the
addition of a single chain-terminating nucleotide to a primer (no
other nucleotides are added). This form of primer extension
sequencing allows interrogation (and identification) of the
nucleotide immediately adjacent to the region to which the primer
is hybridized. Two preferred modes of single nucleotide primer
extension sequencing are disclosed.
[0279] (a) Unimolecular Segment Amplification and Sequencing
[0280] Unimolecular Segment Amplification and Sequencing (USA-SEQ)
involves interrogation of a single nucleotide in an amplified
target sequence by incorporation of a specific and identifiable
nucleotide based on the identity of the interrogated nucleotide. In
Unimolecular Segment Amplification and Sequencing (USA-SEQ)
individual target molecules are amplified by rolling circle
amplification. Following amplification, an interrogation primer is
hybridized immediately 5' of the base in the target sequence to be
interrogated, and a single chain-terminating nucleotide is added to
the end of the primer. The identity of the interrogated base
determines which nucleotide is added. By using nucleotides with
unique detection signatures (e.g. different fluorescent labels),
the identity of the interrogated base can be determined. The
interrogation primer can be a pre-formed single molecule or it can
be formed by hybridizing one or more interrogation probes to the
amplified target sequences and ligating them together to form an
interrogation primer.
[0281] USA-SEQ is useful for identifying the presence of multiple
distinct sequences in a mixture of target sequences. In particular,
if the sample from which the target sequences are amplified
contains different forms of the target sequence (that is, different
alleles of the target sequence), then USA-SEQ can identify not only
their presence but also provide information on the relative
abundance of the different forms. This is possible because each
TS-DNA molecule is amplified from a single target sequence molecule
and each TS-DNA molecule can be individually detected.
[0282] Primer extension sequencing can be performed generally as
follows. After amplification of a target nucleic acid sequence
using any of the rolling circle amplification techniques disclosed
herein, an interrogation primer is hybridized to the amplified
nucleic acid (for example, to TS-DNA). The mixture of amplified
nucleic acid and interrogation primer is referred to as an
interrogation mixture. The interrogation primer is designed to
hybridize adjacent to (that is 3' of) the nucleotide in the TS-DNA
that is to be interrogated (that is, sequenced). Of course, since
the target sequence is repeated numerous times in a TS-DNA
molecule, numerous interrogation probes will hybridize to a single
TS-DNA molecule. Next, at least two differently labeled chain
terminating nucleotides and DNA polymerase are added to the
interrogation mixture. This results in addition of a single
nucleotide to the end of the interrogation primer, the identity of
which is based on the identity of the interrogated nucleotide (that
is, the first template nucleotide after the end of the
interrogation primer). Finally, the identity of the nucleotide
incorporated for each TS-DNA molecule is determined by fluorescence
microscopy. For this purpose, it is preferred that the TS-DNA be
collapsed prior to detection of the incorporated nucleotide.
Example 9 describes an example of the use of USA-SEQ to detect of
homo- or heterozygosity at a particular nucleotide in a genetic
sample. It is specifically contemplated that primer extension
sequencing can be used to determine the identity of one or more
specific nucleotides in any amplified nucleic acid, including
nucleotides derived from a target nucleic acid, and nucleotides
present as arbitrarily chosen sequences in the spacer region of an
OCP or ATC. In the later case, primer extension sequencing can be
used to distinguish or identify a specific OCP or ATC which has
been amplified. As described elsewhere, the detection of specific
OCPs and ATCs, from among an original pool of OCPs or ATCs,
amplified based on the presence of a specific target molecule or
nucleic acid is a preferred use for the disclosed amplification and
detection methods.
[0283] Preferred chain terminating nucleotides are
dideoxynucleotides. Other known chain terminating nucleotides (for
example, nucleotides having substituents at the 3' position) can
also be used. Fluorescent forms of dideoxynucleotides are known for
use in conventional chain terminating sequencing, any of which are
suitable for the disclosed primer extension sequencing. Preferred
forms of fluorescent or haptenated chain-terminating nucleotides
include fluorescein-N6-ddATP, biotin-N6-ddATP,
fluorescein-12-ddATP, fluorescein-12-ddCTP, fluorescein-12-ddGTP,
fluorescein-12-ddUTP, lissamine-5-ddGTP, eosin-6-ddCTP,
coumarin-ddUTP, tetramethylmodamine-6-ddUTP, Texas Red-5-ddATP (all
available from NEN Life Sciences).
[0284] (b) Degenerate Probe Primer Extension Sequencing
[0285] Degenerate probe primer extension sequencing involves
sequential addition of degenerate probes to an interrogation primer
hybridized to amplified target sequences. Addition of multiple
probes is prevented by the presence of a removable blocking group
at the 3' end. After addition of the degenerate probes, the
blocking group is removed and further degenerate probes can be
added or, as the final operation, the nucleotide next to the end of
the interrogation probe, or the last added degenerate probe, is
interrogated as described for single nucleotide primer extension
sequencing to determine its identity. It is contemplated that
degenerate probes having any form of removable 3' end block can be
used in a primer extension sequencing procedure. A preferred form
of removable blocking group is the cage structure, as described
herein. In each case, conditions specific for removal of the
particular blocking structure are used as appropriate. A preferred
form of amplification and degenerate probe primer extension
sequencing is Unimolecular Segment Amplification and CAGE
Sequencing (USA-CAGESEQ).
[0286] Primer extension sequencing using blocked degenerate probes
(that is, degenerate probe primer extension sequencing, of which
CAGESEQ is a preferred form) can be performed generally as follows.
One or more interrogation probes and a plurality of degenerate
probes are mixed with an DNA sample to be sequenced to form an
interrogation mixture. It is preferred that the nucleic acid to be
sequenced is a nucleic acid amplified using any of the rolling
circle amplification techniques disclosed herein. In this case it
is further preferred that the nucleic acid to be sequenced is
amplified form an amplification target circle formed by gap-filling
ligation of an open circle probe. For degenerate probe primer
extension sequencing it is also preferred that a full set of
degenerate probes, as described above, be used. The interrogation
probes are designed to hybridize to the target nucleic acid such
that the region of the target nucleic acid to be sequenced lies
past the 3' end of the interrogation probe. The interrogation
mixture is incubated under conditions that promotes hybridization
of the interrogation probe and the degenerate primers to the
nucleic acid to be sequenced. Only one of the degenerate probes
will form a perfect hybrid with the nucleic acid sequence adjacent
to the interrogation probe. It is preferred that incubation
conditions be chosen which will favor the formation of perfect
hybrids. Once the interrogation and degenerate probes are
hybridized, the interrogation mixture is subjected to ligation.
This joins the interrogation probe and the degenerate primer.
Finally, the blocking group present at the 3' end of the ligated
degenerate probe is removed. When using photolabile caged
oligonucleotides, the cage structure is removed by exposure to
appropriate light. This makes the end of the ligated degenerate
probe available for either ligation of another degenerate probe or
primer extension. These hybridization, ligation, and block removal
steps are referred to herein as a round of degenerate probe
ligation. Additional rounds of degenerate probe ligation can be
performed following removal of the blocking structure. It is
preferred that a set of primer extension sequencing assays be
performed, using identical samples, in which a different number of
rounds of degenerate probe ligation are performed prior to primer
extension. It is also preferred that a nested set of interrogation
probes be used in a set of such a set of primer extension
sequencing assays. The use of such a set of assays is illustrated
in Example 10. Once all the rounds of degenerate probe ligation are
performed (thus forming an interrogation primer), the interrogation
mixture is subjected to primer extension. For this, at least two
differently labeled chain terminating nucleotides and DNA
polymerase are added to the interrogation mixture. This results in
addition of a single nucleotide to the end of the interrogation
primers, the identity of which is based on the identity of the
interrogated nucleotide (that is, the first template nucleotide
after the end of the interrogation primer). Finally, the identity
of the nucleotide incorporated for each interrogation primer for
each target nucleic acid is determined by fluorescence microscopy.
For this purpose, it is preferred that the nucleic acid be
collapsed prior to detection of the incorporated nucleotide.
[0287] Example 10 describes an example of USA-CAGESEQ where a
nested set of interrogation primers are extended by sequential
addition of degenerate primers in an array of amplified nucleic
acids. The principles of the primer extension sequencing operation
illustrated in this example can be analogously applied to the use
of different numbers of sample and interrogation probes, different
arrangements of samples and different forms of blocking structures.
It is contemplated that sets of assays can be performed on arrays
of sample dots (as shown in Example 10), in arrays of samples (such
as in microtiter dishes), or in individual reaction vessels. In
particular, the use of a multiwell dish, such as a microtiter dish,
allows multiple separate reactions on the same dish to be easily
automated. The use of multiple wells also allows complete freedom
in the selection of the sample and interrogation probe in each
well. For example, rather than performing primer extension
sequencing using five separately treated slides (as in example 10),
primer extension sequencing samples and components could be
arranged in any convenient order in the wells. Using the components
of Example 10, for example, a five well by five well array of
identical nucleic acid samples could be used where each of the
wells in a given column has the same interrogation probe. The first
column of wells would have the first interrogation probe, the
second column of wells would have the second interrogation probe,
and so on. As in example 10, the mask would be moved down to cover
one additional row prior to each cage removal step. The resulting
sequence obtained using this arrangement would be read across and
then down.
[0288] As described above, specific portions of TS-DNA or TS-RNA
can be sequenced using a primer extension sequencing operation. It
should also be understood that the same primer extension sequencing
procedure can be performed on any nucleic acid molecule. For
example, genomic DNA, PCR products, viral RNA or DNA, and cDNA
samples can all be sequenced using the disclosed primer extension
sequencing procedure. A preferred primer extension sequencing
procedure for this purpose is CAGE sequencing. For this purpose,
interrogation probes and degenerate probes are hybridized to a
nucleic acid sample of interest (rather than TS-DNA or TS-RNA),
ligated, and subjected to chain-terminating primer extension, all
as described above in connection with USA-CAGESEQ.
[0289] D. Discrimination Between Closely Related Target
Sequences
[0290] Open circle probes, gap oligonucleotides, and gap spaces can
be designed to discriminate closely related target sequences, such
as genetic alleles. Where closely related target sequences differ
at a single nucleotide, it is preferred that open circle probes be
designed with the complement of this nucleotide occurring at one
end of the open circle probe, or at one of the ends of the gap
oligonucleotide(s). Where gap-filling ligation is used, it is
preferred that the distinguishing nucleotide appear opposite the
gap space. This allows incorporation of alternative (that is,
allelic) sequence into the ligated OCP without the need for
alternative gap oligonucleotides. Where gap-filling ligation is
used with a gap oligonucleotide(s) that partially fills the gap, it
is preferred that the distinguishing nucleotide appear opposite the
portion of gap space not filled by a gap oligonucleotide. Ligation
of gap oligonucleotides with a mismatch at either terminus is
extremely unlikely because of the combined effects of hybrid
instability and enzyme discrimination. When the TS-DNA is
generated, it will carry a copy of the gap oligonucleotide sequence
that led to a correct ligation. Gap oligonucleotides may give even
greater discrimination between related target sequences in certain
circumstances, such as those involving wobble base pairing of
alleles. Features of open circle probes and gap oligonucleotides
that increase the target-dependency of the ligation operation are
generally analogous to such features developed for use with the
ligation chain reaction. These features can be incorporated into
open circle probes and gap oligonucleotides for use in LM-RCA. In
particular, European Patent Application EP0439182 describes several
features for enhancing target-dependency in LCR that can be adapted
for use in LM-RCA. The use of stop bases in the gap space, as
described in European Patent Application EP0439182, is a preferred
mode of enhancing the target discrimination of a gap-filling
ligation operation.
[0291] A preferred form of target sequence discrimination can be
accomplished by employing two types of open circle probes. These
two OCPs would be designed essentially as shown in FIG. 2, with
small modifications. In one embodiment, a single gap
oligonucleotide is used which is the same for both target
sequences, that is, the gap oligonucleotide is complementary to
both target sequences. In a preferred embodiment, a gap-filling
ligation operation can be used (Example 3). Target sequence
discrimination would occur by virtue of mutually exclusive ligation
events, or extension-ligation events, for which only one of the two
open-circle probes is competent. Preferably, the discriminator
nucleotide would be located at the penultimate nucleotide from the
3' end of each of the open circle probes. The two open circle
probes would also contain two different detection tags designed to
bind alternative detection probes and/or address probes. Each of
the two detection probes would have a different detection label.
Both open circle probes would have the same primer complement
portion. Thus, both ligated open circle probes can be amplified
using a single primer. Upon array hybridization, each detection
probe would produce a unique signal, for example, two alternative
fluorescence colors, corresponding to the alternative target
sequences.
[0292] E. Optimization of RCA
[0293] 1. Assay Background
[0294] A potential source of background signals is the formation of
circular molecules by non-target-directed ligation events. The
contribution of such events to background signals can be minimized
using five strategies, alone or in combination, as follows:
[0295] (a) The use of a thermostable DNA ligase such as
AMPLIGASE.RTM. (Kalin et al. (1992)) or the T. thermophilus DNA
ligase (Barany (1991)) will minimize the frequency of
non-target-directed ligation events because ligation takes place at
high temperature (50 to 75.degree. C.).
[0296] (b) In the case of in situ hybridization, ligation of the
open circle probe to the target sequence permits extensive washing.
This washing will remove any circles that may have been formed by
non-target-directed ligation, while circles ligated on-target are
impossible to remove because they are topologically trapped
(Nilsson et al. (1994)).
[0297] (c) The use of one or more gap oligonucleotides, or a
combination of gap oligonucleotides and gap-filling DNA synthesis,
provides additional specificity in the ligation event. Using a gap
oligonucleotide greatly reduces the probability of
non-target-directed ligation. Particularly favored is the use of a
gap oligonucleotide, or a gap-filling ligation operation, coupled
to a capture hybridization step where the complementary portion of
an address probe spans the ligation junction in a highly
discriminatory fashion, as shown below and in FIG. 6.
7 complement of gap oligonucleotide (11 nucleotides) .backslash. /
...NNNTA{GTCAGATCAGA}TANNNNN... TS-DNA .vertline..vertline.
.vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine. .vertline..vertline. AT CAGTCTAGTCT ATNNNNN... address probe /
.backslash.
[0298] complementary portion of address probe (15 nucleotides
hybridized) Brackets ({}) mark sequence complementary to the gap
oligonucleotide (or the gap space when filled in). The TS-DNA shown
is SEQ ID NO: 10 and the address probe sequence shown is SEQ ID NO:
4. This system can be used with gap oligonucleotides of any length.
Where the gap between the ends of an open circle probe hybridized
to a target sequence is larger than the desired address probe
length, an address probe can be designed to overlap just one of the
junctions between the gap sequence and the open circle probe
sequence. By designing open circle probes to place discriminating
nucleotides opposite the gap space, a single OCP can be used in
gap-filling LM-RCA to generate ligated open circle probes having
different sequences, which depend on the target sequence.
[0299] The capture step involves hybridization of the amplified DNA
to an address probe via a specific sequence interaction at the
ligation junction, involving the complement of the gap
oligonucleotide, as shown above. Guo et al. (1994), have shown that
15-mer oligonucleotides bound covalently on glass slides using
suitable spacers, can be used to capture amplified DNA with
reasonably high efficiency. This system can be adapted to detection
of amplified nucleic acid (TS-DNA or TS-RNA) by using address
probes to capture the amplified nucleic acid. In the example shown
above, only LM-RCA amplified DNA generated from correct ligation
events will be captured on the solid-state detector.
[0300] Optionally one may use additional immobilizing reagents,
known in the art as capture probes (Syvanen et al., Nucleic Acids
Res., 14:5037 (1986)) in order to bind nucleic acids containing the
target sequence to a solid surface. Suitable capture probes contain
biotinylated oligonucleotides (Langer et al. (1981)) or terminal
biotin groups. Immobilization may take place before or after the
ligation reaction. Immobilization serves to allow removal of
unligated open circle probes as well as non-specifically ligated
circles.
[0301] (d) Using ligation conditions that favor intramolecular
ligation. Conditions are easily found where circular ligation of
OCPs occurs much more frequently than tandem linear ligation of two
OCPs. For example, circular ligation is favored when the
temperature at which the ligation operation is performed is near
the melting temperature (T.sub.m) of the least stable of the left
target probe portion and the right target probe portion when
hybridized to the target sequence. When ligation is carried out
near the T.sub.m of the target probe portion with the lowest
T.sub.m, the target probe portion is at association/dissociation
equilibrium. At equilibrium, the probability of association in cis
(that is, with the other target probe portion of the same OCP) is
much higher than the probability of association in trans (that is,
with a different OCP). When possible, it is preferred that the
target probe portions be designed with melting temperatures near
suitable temperatures for the ligation operation. The use of a
thermostable ligase, however, allows a wide range of ligation
temperatures to be used, allowing greater freedom in the selection
of target sequences.
[0302] (e) Peptide nucleic acids form extremely stable hybrids with
DNA, and have been used as specific blockers of PCR reactions (Orum
et al., Nucleic Acids Res., 21:5332-5336 (1993)). A special PNA
probe, referred to herein as a PNA clamp, can be used to block
rolling circle amplification of OCPs that have been ligated
illegitimately (that is, ligated in the absence of target). By
using one or more gap oligonucleotides during ligation, by using
gap-filling ligation, or by using a combination of gap
oligonucleotides and gap-filling ligation, illegitimately ligated
circles will lack the gap sequence and they can be blocked with a
PNA clamp that is complementary to the sequence resulting from the
illegitimate ligation of the 3' end and the 5' end of the OCP. This
is illustrated in the diagram below, where the PNA clamp llllrrrr
is positioned exactly over the junction: 1
[0303] In this diagram, "L" and "l" represent a nucleotide in the
left target probe portion of the OCP and its complement in the PNA
clamp, and "R" and "r" represent a nucleotide in the right target
probe portion of the OCP and its complement in the PNA clamp. The
most preferred length for a PNA clamp is 8 to 10 nucleotides. The
PNA clamp is incapable of hybridizing to unligated OCP because it
can only form four to five base pairs with either target probe
portion, and it is also incapable of hybridizing with correctly
ligated OCP because a gap sequence is present. However, the PNA
clamp will hybridize strongly with illegitimately ligated OCP, and
it will block the progress of the rolling circle reaction because
the DNA polymerase is incapable of displacing a hybridized PNA
molecule. This prevents amplification of illegitimately ligated
OCPs.
[0304] 2. Removing Excess Unligated OCPs
[0305] The gene 6 exonuclease of phage T7 provides a useful tool
for the elimination of excess open circle probes and excess gap
oligonucleotides that will bind to the TS-DNA or LM-RCT transcripts
and interfere with its hybridization to detection probes. This
exonuclease digests DNA starting from the 5'-end of a
double-stranded structure. It has been used successfully for the
generation of single-stranded DNA after PCR amplification (Holloway
et al., Nucleic Acids Res. 21:3905-3906 (1993); Nikiforov et al.,
PCR Methods and Applications 3:285-291(1994)). In an LM-RCA assay
this enzyme can be added after ligation, together with the rolling
circle DNA polymerase. To protect TS-DNA from degradation, the
rolling circle replication primer can contain 3 or 4
phosphorothioate linkages at the 5' end, to make this molecule
resistant to the exonuclease (Nikiforov et al. (1994)). The
exonuclease will degrade excess open circle probe molecules as they
become associated with the rolling circle DNA product. The use of
this nuclease eliminates the need for capture probes as well as the
need for washing to remove excess probes. In general, such a
nuclease digestion should not be used when performing LM-RCT, since
unligated OCPs and gap oligonucleotides are needed to form a
double-stranded transcription template with the TS-DNA. This
nuclease digestion is a preferred method of eliminating unligated
OCPs and gap oligonucleotides when nested LM-RCA is to be
performed.
EXAMPLES
Example 1
[0306] Target-Mediated Ligation of Open Circle Probes and Rolling
Circle Replication of Ligated Open Circle Probes
[0307] 1. Ligation of Open Circle Probes
[0308] Linear oligonucleotides with 5'-phosphates are efficiently
ligated by ligase in the presence of a complementary target
sequence. In particular, open circle probes hybridized to a target
sequence as shown in FIG. 1, and open circle probes with gap
oligonucleotides hybridized to a target sequence as shown in as
shown in FIG. 2, are readily ligated. The efficiency of such
ligation can be measured by LM-RCA.
[0309] The following is an example of target-dependent ligation of
an open circle probe:
[0310] A DNA sample (target sample) is heat-denatured for 3 minutes
at 95.degree. C., and incubated under ligation conditions (45
minutes at 60.degree. C.) in a buffer consisting of 20 mM Tris-HCl
(pH 8.2), 25 mM KCl, 10 MM MgCl.sub.2, 0.5 mM NAD, 0.05% Triton
X-100, in the presence of (a) DNA ligase (AMPLIGASE.RTM., Epicentre
Technologies) at a concentration of 1 unit per 50 .mu.l, and (b)
the following 5'-phosphorylated oligonucleotides:
[0311] Open circle probe (111 nucleotides):
8 (SEQ ID NO:1) 5'-GCCTGTCCAGGGATCTGCTCAAGACTCGTCATGTCTCAG- TAGCTT
CTAACGGTCACAAGCTTCTAACGGTCACAAGCTTCTAACGGTCACAT
GTCTGCTGCCCTCTGTATT-3'
[0312] Gap oligonucleotide: 5'-CCTT-3'
[0313] This results in hybridization of the open circle probe and
gap oligonucleotide to the target sequence, if present in the
target sample, and ligation of the hybridized open circle probe and
gap oligonucleotide.
[0314] 2. Measuring the Rate of Rolling Circle Replication
[0315] (a) On large template: 7 kb single-stranded phage M13 circle
The rate of oligonucleotide-primed rolling circle replication on
single-stranded M13 circles mediated by any DNA polymerase can be
measured by using the assay described by Blanco et al., J. Biol.
Chem. 264:8935-8940 (1989). The efficiency of primed synthesis by
the .phi.29 DNA polymerase is stimulated about 3-fold in the
presence of Gene-32 protein, a single-stranded DNA binding
protein.
[0316] (b) On small templates: 110-nucleotide ligated open circle
probes The rate of oligonucleotide-primed rolling circle
replication on single-stranded small circles of 110 bases was
measured using the .phi.29 DNA polymerase generally as described in
Example 2. After five minutes of incubation, the size of the DNA
product is approximately 16 kilobases. This size corresponds to a
polymerization rate of 53 nucleotides per second. The rate of
synthesis with other DNA polymerases can be measured and optimized
using a similar assay, as described by Fire and Xu, Proc. Natl.
Acad. Sci. USA 92:4641-4645 (1995). It is preferred that
single-stranded circles of 110 nucleotides be substituted for the
34 nucleotide circles of Fire and Xu.
[0317] The .phi.29 DNA polymerase provides a rapid rate of
polymerization of the .phi.29 rolling circle reaction on 110
nucleotide circular templates. At the observed rate of 50
nucleotides per second, a 35 minute polymerization reaction will
produce a DNA product of approximately 105,000 bases. This would
yield an amplification of 954-fold over the original 110-base
template. Fire and Xu (1995) shows that rolling circle reactions
catalyzed by bacterial DNA polymerases may take place on very small
circular templates of only 34 nucleotides. On the basis of the
results of Fire and Yu, rolling circle replication can be carried
out using circles of less than 90 nucleotides.
Example 2
[0318] Detection of a Mutant Ornithine Transcarbamylase (OTC) Gene
Using LM-RCA Followed by Transcription (LM-RCT)
[0319] This example describes detection of human DNA containing a
mutant form (G to C) at position 114 of exon 9 of the ornithine
transcarbamylase gene (Hata et al., J. Biochem. 103:302-308
(1988)). Human DNA for the assay is prepared by extraction from
buffy coat using a standard phenol procedure.
[0320] 1. Two DNA samples (400 ng each) are heat-denatured for 4
minutes at 97.degree. C., and incubated under ligation conditions
in the presence of two 5'-phosphorylated oligonucleotides, an open
circle probe and one gap oligonucleotide:
[0321] Open circle probe (95 nucleotides):
9 (SEQ ID NO:5) 5'-GAGGAGAATAAAAGTTTCTCATAAGACTCGTCATGTCTC- AGCAGC
TTCTAACGGTCACTAATACGACTCACTATAGGTTCTGCCTCTGGGAA CAC-3'
[0322] Gap oligonucleotide for mutant gene (8 nucleotides)
[0323] 5'-TAGTGATG-3'
[0324] Gap oligonucleotide for wild type gene (8 nucleotides)
[0325] 5'-TAGTGATC-3'
[0326] T4 DNA ligase (New England Biolabs) is present at a
concentration of 5 units per .mu.l, in a buffer consisting of 10 mM
Tris-HCl (pH 7.5), 0.20 M NaCl, 10 mM MgCl.sub.2, 2 mM ATP. The
concentration of open circle probe is 80 nM, and the concentration
of gap oligonucleotide is 100 nM. The total volume is 40 .mu.l.
Ligation is carried out for 25 minutes at 37.degree. C.
[0327] 2. 25 .mu.l are taken from each of the above reactions and
mixed with an equal volume of a buffer consisting of 50 mM Tris-HCl
(pH 7.5), 10 mM MgCl.sub.2, 1 mM DTT, 400 .mu.M each of dTTP, dATP,
dGTP, dCTP, which contains an 18-base rolling circle replication
primer 5'-GCTGAGACATGACGAGTC-3' (SEQ ID NO: 6), at a concentration
of 0.2 .mu.M. The .phi.29 DNA polymerase (160 ng per 50 .mu.l) is
added and the reaction mixture is incubated for 30 minutes at
30.degree. C.
[0328] 3. To the above solutions a compensating buffer is added to
achieve the following concentrations of reagents: 35 mM Tris-HCl
(pH 8.2), 2 mM spermidine, 18 MM MgCl.sub.2, 5 mM GMP, 1 mM of ATP,
CTP, GTP, 333 .mu.M UTP, 667 .mu.M Biotin-16-UTP
(Boehringher-Mannheim), 0.03% Tween-20, 2 Units per .mu.l of T7 RNA
polymerase. The reaction is incubated for 90 minutes at 37.degree.
C.
[0329] 4. One-tenth volume of 5 M NaCl is added to the above
reactions, and the resulting solution is mixed with an equal volume
of ExpressHyb reagent (Clontech Laboratories, Palo Alto, Calif.).
Hybridization is performed by contacting the amplified RNA
solution, under a cover slip, with the surface of a glass slide
(Guo et al. (1994)) containing a 2.5 mm dot with 2.times.10.sup.11
molecules of a covalently bound 29-mer oligonucleotide with the
sequence 5'-TTTTTTTTTTTCCAACCTCCATCACTAGT-3' (SEQ ID NO: 7). The
last 14 nucleotides of this sequence are complementary to the
amplified mutant gene RNA, and hence the mutant RNA binds
specifically. Another 2.5 mm dot on the slide surface contains
2.times.10.sup.11 molecules of a covalently bound 29-mer
oligonucleotide with the sequence
5'-TTTTTTTTTTTCCAACCTCGATCACTAGT-3' (SEQ ID NO: 8). The last 14
nucleotides of this sequence are complementary to the amplified
wild type gene RNA, and hence the wild type RNA binds specifically.
The glass slide is washed once with 2.times.SSPE as described (Guo
et al. (1994)), then washed twice with 2.times.SSC (0.36 M sodium
saline citrate), and then incubated with fluoresceinated avidin (5
.mu.g/ml) in 2.times.SSC for 20 minutes at 30.degree. C. The slide
is washed 3 times with 2.times.SSC and the slide-bound fluorescence
is imaged at 530 nm using a Molecular Dynamics Fluorimager.
Example 3
[0330] Detection of a Mutant Ornithine Transcarbamylase (OTC) Gene
Using Gap-Filling LM-RCT
[0331] This example describes detection of human DNA containing a
mutant form (G to C) at position 114 of exon 9 of the ornithine
transcarbamylase gene (Hata et al. (1988)) using gap-filling
LM-RCT. Human DNA for the assay is prepared by extraction from
buffy coat using a standard phenol procedure. In this example, two
different open circle probes are used to detect the mutant and wild
type forms of the gene. No gap oligonucleotide is used.
[0332] 1. Two DNA samples (400 ng each) are heat-denatured for 4
minutes at 97.degree. C., and incubated in the presence of one of
the following 5'-phosphorylated open circle probes.
[0333] Open circle probe for mutant gene (96 nucleotides):
[0334] 5'-TAAAAGACTTCATCATCCATCTCATAAGACTCGTCATGTCTCAGC
AGCTTCTAACGGTCACTAATACGACTCACTATAGGGGAACACTAGT GATGG-3' (SEQ ID NO:
11). When this probe hybridizes to the target sequence, there is a
gap space of seven nucleotides between the ends of the open circle
probe.
[0335] Open circle probe for wild type gene (96 nucleotides):
[0336] 5'-TAAAAGACTTCATCATCCATCTCATAAGACTCGTCATGTCTCAGC
AGCTTCTAACGGTCACTAATACGACTCACTATAGGGGAACACTAGT GATCG-3' (SEQ ID NO:
12). When this probe hybridizes to the target sequence, there is a
gap space of seven nucleotides between the ends of the open circle
probe.
[0337] Each of the OCP-target sample mixtures are incubated in an
extension-ligation mixture as described by Abravaya et al. (1995).
The reaction, in a volume of 40 .mu.l, contains 50 mM Tris-HCl (pH
7.8), 25 mM MgCl.sub.2, 20 mM potassium acetate, 10 .mu.M NAD, 80
nM open circle probe, 40 .mu.M dATP, 40 .mu.M dGTP, 1 Unit Thermus
flavus DNA polymerase (lacking 3'-5' exonuclease activity; MBR,
Milwaukee, Wis.), and 4000 Units Thermus thermophilus DNA ligase
(Abbott laboratories). The reaction is incubated for 60 seconds at
85.degree. C., and 50 seconds at 60.degree. C. in a thermal cycler.
No thermal cycling is performed. This results in hybridization of
the open circle probe to the target sequence, if present, filling
in of the gap space by the T. flavus DNA polymerase, and ligation
by the T. thermophilus ligase. The discriminating nucleotide in the
open circle probes above is the penultimate nucleotide. T. flavus
DNA polymerase is used in the reaction to match the thermal
stability of the T. thermophilus ligase.
[0338] 2. 25 .mu.l are taken from each of the above reactions and
mixed with an equal volume of a buffer consisting of 50 mM Tris-HCl
(pH 7.5), 10 mM MgCl.sub.2, 1 mM DTT, 400 .mu.M each of dTTP, dATP,
dGTP, dCTP; and containing the 18-base oligonucleotide primer
5'-GCTGAGACATGACGAGTC-3' (SEQ ID NO: 6), at a concentration of 0.2
.mu.M. The .phi.29 DNA polymerase (160 ng per 50 .mu.l) is added
and the reaction mixture is incubated for 30 minutes at 30.degree.
C. to perform rolling circle amplification catalyzed by .phi.29 DNA
polymerase. The Thermus flavus DNA polymerase does not
significantly interfere with rolling circle replication because it
has little activity at 30.degree. C. If desired, the Thermus flavus
DNA polymerase can be inactivated, prior to rolling circle
replication, by adding a neutralizing antibody analogous to
antibodies for blocking Taq DNA polymerase prior to PCR (Kellogg et
al., Biotechniques 16(6):1134-1137 (1994)).
[0339] 3. To each of the above solutions are added compensating
buffer to achieve the following concentrations of reagents: 35 mM
Tris-HCl (pH 8.2), 2 mM spermidine, 18 mM MgCl.sub.2, 5 mM GMP, 1
mM of ATP, CTP, GTP, 333 .mu.M UTP, 667 .mu.M Biotin-16-UTP
(Boehringher-Mannheim), 0.03% Tween-20, 2 Units per .mu.l of T7 RNA
polymerase. The reactions are incubated for 90 minutes at
37.degree. C.
[0340] 4. One-tenth volume of 5 M NaCl is added to the each
solution containing the biotinylated RNA generated by T7 RNA
polymerase, and the resulting solution is mixed with an equal
volume of ExpressHyb reagent (Clontech laboratories, Palo Alto,
Calif.). Hybridization is performed by contacting the amplified RNA
solution, under a cover slip, with the surface of a glass slide
(Guo et al. (1994)) containing a 2.5 mm dot with 2.times.10.sup.11
molecules of a covalently bound 29-mer address probe with the
sequence 5'-TTTTTTTTTTTCCAAATTCTCCTCCATCA-3' (SEQ ID NO: 13). The
last 14 nucleotides of this sequence are complementary to the
amplified mutant gene RNA, and hence the mutant RNA binds
specifically. Another 2.5 mm dot on the slide surface contains
2.times.10.sup.11 molecules of a covalently bound 29-mer address
probe with the sequence 5'-TTTTTTTTTTTCCAAATTCTCCTCGATCA-3' (SEQ ID
NO: 14). The last 14 nucleotides of this sequence are complementary
to the amplified wild type gene RNA, and hence the wild type RNA
binds specifically. The glass slide is washed once with
2.times.SSPE as described (Guo et al. (1994)), then washed twice
with 2.times.SSC (0.36 M sodium saline citrate), and then incubated
with fluoresceinated avidin (5 .mu.g/ml) in 2.times.SSC for 20
minutes at 30.degree. C. The slide is washed 3 times with
2.times.SSC and the slide-bound fluorescence is imaged at 530 nm
using a Molecular Dynamics Fluorimager.
Example 4
[0341] Reverse Transcription of Ornithine Transcarbamylase (OTC)
mRNA Followed by Mutant cDNA Detection Using Gap-Filling LM-RCT
[0342] This example describes detection of human mRNA containing a
mutant form (G to C) at position 114 of exon 9 of the ornithine
transcarbamylase gene (Hata et al. (1988)) using cDNA generated by
reverse transcription. RNA for the assay is prepared by TRIzol
(Life Technologies, Inc., Gaithersburg, Md.) extraction from liver
biopsy.
[0343] 1. OTC exon 9 cDNA is generated as follows:
[0344] A liver biopsy sample is stored at -80.degree. C. in a 0.5
ml. reaction tube containing 40 Units of RNase inhibitor
(Boehringher Mannheim). Total RNA is extracted from the frozen
sample using TRIzol reagent (Life Technologies, Inc., Gaithersburg,
Md.), and dissolved in 10 .mu.l water. A 19 .mu.l reaction mixture
is prepared containing 4 .mu.l of 25 mM MgCl.sub.2, 2 .mu.l of 400
mM KCl, 100 mM Tris-HCl (pH 8.3), 8 .mu.l of a 2.5 mM mixture of
dNTP's (dATP, dGTP, dTTP, dCTP), 1 .mu.l of MuLV reverse
transcriptase (50 U, Life Technologies, Inc., Gaithersburg, Md.), 1
.mu.l of MuLV reverse transcriptase primer
(5'-TGTCCACTTTCTGTTTTCTGCCTC-3'; SEQ ID NO: 15), 2 .mu.l of water,
and 1 .mu.l of RNase inhibitor (20 U). The reaction mixture is
added to 1 .mu.l of the Trizol-purified RNA solution, and incubated
at 42.degree. C. for 20 minutes to generate cDNA.
[0345] 2. Two 20 .mu.l cDNA samples from step 1 are heat-denatured
for 4 minutes at 98.degree. C., and incubated under ligation
conditions in the presence of two 5'-phosphorylated probes:
[0346] Open circle probe (95 nucleotides):
10 (SEQ ID NO:16) 5'-ATCACTAGTGTTCCTTCTCATAAGACTCGTCATGTCT-
CAGCAGCTT CTAACGGTCACTAATACGACTCACTATAGGGGATGATGAAGTCTTTT AT-3'
[0347] Gap probe for mutant gene (8 nucleotides):
[0348] 5'-TAGTGATG-3'
[0349] Gap probe for wild type gene (8 nucleotides):
[0350] 5'-TAGTGATC-3'
[0351] T4 DNA ligase (New England Biolabs) is added at a
concentration of 5 units per .mu.l, in a buffer consisting of 10 mM
Tris-HCl (pH 7.5), 0.20 M NaCl, 10 mM MgCl.sub.2, 2 mM ATP. The
concentration of open circle probe is 80 nM, and the concentration
of gap oligonucleotide is 100 nM. The total volume is 40
.mu.liters. Ligation is carried out for 25 minutes at 37.degree.
C.
[0352] 3. 25 .mu.l are taken from each of the above reactions and
mixed with an equal volume of a buffer consisting of 50 mM Tris-HCl
(pH 7.5), 10 mM MgCl.sub.2, 1 mM DTT, 200 .mu.M each of dTTP, dATP,
dGTP, dCTP; and containing the 18-base rolling circle replication
primer 5'-GCTGAGACATGACGAGTC-3' (SEQ ID NO: 6), at a concentration
of 0.2 .mu.M. The .phi.29 DNA polymerase (160 ng per 50 .mu.l) is
added and the reaction mixtures are incubated for 30 minutes at
30.degree. C.
[0353] 4. To the above solutions are added compensating buffer to
achieve the following concentrations of reagents: 35 mM Tris-HCl
(pH 8.2), 2 mM spermidine, 18 MM MgCl.sub.2, 5 mM GMP, 1 mM of ATP,
CTP, GTP, 333 .mu.M UTP, 667 .mu.M Biotin-16-UTP
(Boehringher-Mannheim), 0.03% Tween-20, 2 Units per .mu.l of T7 RNA
polymerase. The reaction is incubated for 90 minutes at 37.degree.
C.
[0354] 5. One-tenth volume of 5 M NaCl is added to the each
solution containing the biotinylated RNA generated by T7 RNA
polymerase, and the resulting solution is mixed with an equal
volume of ExpressHyb reagent (Clontech laboratories, Palo Alto,
Calif.). Hybridization is performed by contacting the amplified RNA
solution, under a cover slip, with the surface of a glass slide
(Guo et al. (1994)) containing a 2.5 mm dot with 2.times.10.sup.11
molecules of a covalently bound 29-mer address probe with the
sequence 5'-TTTTTTTTTTTTTTTTGATGGAGGAGAAT-3' (SEQ ID NO: 17). The
last 14 nucleotides of this sequence are complementary to the
amplified mutant gene RNA, and hence the mutant RNA binds
specifically. Another 2.5 mm dot on the slide surface contains
2.times.10.sup.11 molecules of a covalently bound 29-mer address
probe with the sequence 5'-TTTTTTTTTTTTTTTTGATCGAGGAGAAT-3' (SEQ ID
NO: 9). The last 14 nucleotides of this sequence are complementary
to the amplified wild type gene RNA, and hence the wild type RNA
binds specifically. The glass slide is washed once with
2.times.SSPE as described (Guo et al. (1994)), then washed twice
with 2.times.SSC (0.36 M sodium saline citrate), and then incubated
with fluoresceinated avidin (5 .mu.g/ml) in 2.times.SSC for 20
minutes at 30.degree. C. The slide is washed 3 times with
2.times.SSC and the slide-bound fluorescence is imaged at 530 nm
using a Molecular Dynamics Fluorimager.
Example 5
[0355] Multiplex Immunoassay Coupled to Rolling Circle
Amplification
[0356] This example describes an example of multiplex detection of
different target molecules using reporter antibodies. The signal
that is detected is produced by rolling circle amplification of the
target sequence portion of the reporter antibodies.
[0357] 1. Three different monoclonal antibodies, each specific for
a different target molecule, are coupled to three different
arbitrary DNA sequences (A, B, C) that serve as unique
identification tags (target sequences). In this example, the three
antibodies are maleimide-modified and are specific for
.beta.-galactosidase, hTSH, and human chorionic gonadotropin (hCG).
The antibodies are coupled to aminated DNA oligonucleotides, each
oligonucleotide being 50 nucleotides long, using SATA chemistry as
described by Hendrickson et al. (1995). The resulting reporter
antibodies are called reporter antibody A, B, and C,
respectively.
[0358] 2. Antibodies specific for the target molecules (not the
reporter antibodies) are immobilized on microtiter dishes as
follows: A 50 .mu.l mixture containing 6 .mu.g/ml of each of the
three antibodies in sodium bicarbonate (pH 9) is applied to the
wells of a microtiter dish, incubated overnight, and washed with
PBS-BLA (10 mM sodium phosphate (pH 7.4), 150 mM sodium chloride,
2% BSA, 10% .beta.-lactose, 0.02% sodium azide) to block
non-adsorbed sites.
[0359] 3. Serial dilutions of solutions containing one or a
combination of the three target molecules (hTSH, hCG, and
.beta.-galactosidase) are added to the wells. Some wells are
exposed to one target molecule, a mixture of two target molecules,
or a mixture of all three target molecules. After 1 hour of
incubation, the wells are washed three times with TBS/Tween wash
buffer as described by Hendrickson et al. (1995).
[0360] 4. Fifty microliters of an appropriately diluted mixture of
the three reporter antibodies (A+B+C) are added to each well of the
microtiter dish. The plate is incubated at 37.degree. C. for 1
hour, and then washed four times with TBS/Tween buffer.
[0361] 5. To each well is added a mixture of three pairs of open
circle probes and gap oligonucleotides, each pair specific for one
of the three target sequence portions of the reporter antibodies.
In this example, the open circle probes have the same spacer region
of 49 bases including a universal primer complement portion, and
different 18 nucleotide target probe portions at each end. Each
cognate pair of open circle probe and gap oligonucleotide is
designed to hybridize to a specific target sequence (A, B, or C) in
the target sequence portion of the reporter antibodies.
Specifically, Open circle probe A' has left and right target probe
portions complementary to two 18-base sequences in tag sequence A
separated by 8 bases that are complementary to the 8-nucleotide gap
oligonucleotide A'. The same is the case for open circle probe and
gap oligonucleotide pairs B' and C'. The concentration of each open
circle probe is 80 nM, and the concentration of each gap
oligonucleotide is 120 nM.
[0362] 6. T4 DNA ligase (New England Biolabs) is added to each
microtiter well at a concentration of 5 units per .mu.l, in a
reaction buffer consisting (10 mM Tris-HCl (pH 7.5), 40 mM
potassium acetate, 10 mM MgCl.sub.2, 2 mM ATP). The total volume in
each well is 40 .mu.liters. Ligation is carried out for 45 minutes
at 37.degree. C.
[0363] 7. To each microtiter well is added 20 .mu.l of a
compensating solution containing dTTP, dATP, dGTP, dCTP (400 .mu.M
each), the universal 18-base oligonucleotide primer
5'-GCTGAGACATGACGAGTC -3' (SEQ ID NO: 6) (at a final concentration
of 0.2 .mu.M), and .phi.29 DNA polymerase (at 160 ng per 50 .mu.l).
The reaction for 30 minutes at 30.degree. C.
[0364] 8. After incubation, a compensating buffer is added to each
well to achieve the following concentrations of reagents: 35 mM
Tris-HCl (pH 8.2), 2 mM spermidine, 18 mM MgCl.sub.2, 5 mM GMP, 1
mM of ATP, CTP, GTP, 333 .mu.M UTP, 667 .mu.M Biotin-16-UTP
(Boehringher-Mannheim), 0.03% Tween-20, 2 Units per .mu.l of T7 RNA
polymerase. The reaction is incubated for 90 minutes at 37.degree.
C., generating biotinylated RNA.
[0365] 9. One-tenth volume of 5 M NaCl is added to each well, and
the resulting solution is mixed with and equal volume of ExpressHyb
reagent (Clontech laboratories, Palo Alto, Calif.). Hybridization
is performed by contacting the mixture of amplified RNAs, under a
cover slip, with the surface of a glass slide containing three
separate dots of 2.times.10.sup.11 molecules of three different
covalently bound 31-mer oligonucleotides (A, B, C) (Guo et al.
(1994)). The last 16 bases of each oligonucleotide are
complementary to a specific segment (4 bases+8 bases+4 bases),
centered on the 8-base gap sequence, of each of the possible
amplified RNAs generated from tag sequences A, B, or C.
Hybridization is carried out for 90 minutes at 37.degree. C. The
glass slide is washed once with 2.times.SSPE as described (Guo et
al. (1994)), then washed twice with 2.times.SSC (0.36 M sodium
saline citrate), and then incubated with fluoresceinated avidin (5
.mu.g/ml) in 2.times.SSC for 20 minutes at 30.degree. C. The slide
is washed 3 times with 2.times.SSC and the surface-bound
fluorescence is imaged at 530 nm using a Molecular Dynamics
Fluorimager to determine if any of tag sequences A or B or C was
amplified.
Example 6
[0366] In Situ Detection of Ornithine Transcarbamylase (OTC) and
Cystic Fibrosis (CF) Target Sequences Using LM-RCA
[0367] 1. DNA samples were prepared as follows:
[0368] A sample of lymphocytes was washed twice in PBS, with the
cells collected by centrifugation for 5 minutes at 1500 RPM. The
cells were resuspended in 10 mM PIPES, pH 7.6, 100 mM NaCl, 0.3 M
sucrose, 3 mM MgCl.sub.2, and 0.5% Triton X-100. The cells were
then incubated on ice for 15 minutes, centrifuged for 5 minutes at
1700 RPM, and resuspend at 2.times.10.sup.5 nuclei/ml. Samples of
1.0.times.10.sup.5 nuclei (0.5 ml) were centrifuged onto slides (5
minutes at 500 g, setting #85) in Cytospin centrifuge. The slides
were then rinsed twice for 3 minutes with PBS, rinsed once for 6
minutes with agitation in 2 M NaCl, 10 mM PIPES, pH 6.8, 10 mM
EDTA, 0.5% Triton X-100, 0.05 mM Spermine, and 0.125 mM Spermidine.
The slides were then rinsed for one minute in 10.times.PBS, for one
minute in 5.times.PBS, for one minute in 2.times.PBS, for 2 minutes
in 1.times.PBS, for one minute in 10% ethanol, for one minute in
30% ethanol, for one minute in 70% ethanol, and for one minute in
95% ethanol. Finally, the slides were air dried and then fixed by
baking at 70.degree. C. for 2 hours.
[0369] 2. The following DNA molecules were used:
[0370] OTC Open Circle Probe (OTC OCP, for OTC target
sequence):
11 5'-GAGGAGAATAAAAGTTTCTCATAAGACTCGTCATGTCTCAG
CAGCTTCTAACGGTCACTAATACGACTCACTATAGGTTCTGCCT CTGGGAACAC-3'
[0371] OTC Gap oligonucleotide:
[0372] 5'-TAGTGATC-3'
[0373] Cystic fibrosis Open Circle Probe (CF OCP, for CF target
sequence):
12 5'-TATTTTCTTTAATGGTTTCTCTGACTCGTCATGTCTCAGC
TTTAGTTTAATACGACTCACTATAGGATCTATATTCATCAT AGGAAACAC-3'
[0374] Cystic fibrosis Gap oligonucleotide
[0375] 5'-CAAAGATGA-3'
[0376] 3. DNA on the sample slides was denatured by washing the
slides for 5 minutes in 2.times.SSC, incubating in denaturation
buffer (2.times.SSC, 70% formamide, pH 7.2) for 1 minute and 45
seconds in a pre-heated large Coplin jar at 71.degree. C. Heating
was stopped immediately by washing the slides for three minutes in
ice-cold 70% ethanol, for two minutes in 90% ethanol, and for three
minutes in 100% ethanol.
[0377] 4. LM-RCA was performed as follows:
[0378] In three separate reactions, the OCPs and gap
oligonucleotides were hybridized and ligated to target sequences on
the sample slides.
[0379] a. OTC and CF ligation operation: 42 .mu.l of the mixture
below was placed on each of two slides.
13 9 .mu.l 10X ligation buffer (Ampligase) 5 .mu.l BSA, 2 mg/ml
stock 9 .mu.l OTC Gap oligo (15 .mu.M) [final 1500 nM] 9 .mu.l CF
Gap oligo (10 .mu.M) [final 1000 nM] 3 .mu.l OTC OCP, (6 .mu.M
stock) [final = 200 nMolar] 3 .mu.l CF OCP, (6 .mu.M stock) [final
= 200 nMolar] 15 .mu.l Ampligase (5 U/.mu.l) [final = 0.833
U/.mu.l] 38 .mu.l H.sub.2O
[0380] The reaction was incubated for 120 minutes at 50.degree.
C.
[0381] b. OTC ligation operation: 42 .mu.l of the mixture below was
placed on a slide.
14 6 .mu.l 10X ligation buffer (Ampligase) 3.5 .mu.l BSA, 2 mg/ml
stock 6 .mu.l OTC Gap oligo (15 .mu.M) [final 1500 nM] 2 .mu.l OTC
OCP, (6 .mu.M stock) [final = 200 nMolar] 10 .mu.l Ampligase (5
U/.mu.l) [final = 0.833 U/.mu.l] 33 .mu.l H.sub.2O
[0382] The reaction was incubated for 120 minutes at 50.degree.
C.
[0383] c. CF ligation operation: 42 .mu.l of the mixture below was
placed on a slide.
15 6 .mu.l 10X ligation buffer (Ampligase) 3.5 .mu.l BSA, 2 mg/ml
stock 6 .mu.l CF Gap oligo (10 .mu.M) [final 1000 nM] 2 .mu.l CF
OCP, (6 .mu.M stock) [final = 200 nMolar] 10 .mu.l Ampligase (5
U/.mu.l) [final = 0.833 U/.mu.l] 33 .mu.l H.sub.2O
[0384] The reaction was incubated for 120 minutes at 50.degree.
C.
[0385] All of the slides were washed twice for 5 minutes with
2.times.SSC with 20% formamide at 42.degree. C., washed for two
minutes with 20 mM Tris, pH 7.5, 0.075 M NaCl to remove the
formamide, and washed for three minutes with 50 mM Tris, pH 7.5, 40
mM KOAc, 10 mM MgCl.sub.2, 10 mM DTT, 100 .mu.g/ml BSA.
[0386] The amplification operation was performed by placing 24
.mu.l of the following mixture on each slide.
16 18.0 .mu.l H.sub.2O [total volume = 100 .mu.l for 4 slides] 20.0
.mu.l 5X .phi.29 buffer with BSA BSA is 200 .mu.g/ml 16.0 .mu.l
dNTPs (A, G, and C, each 2.5 mM) 5.0 .mu.l dTTP (2.5 mM) 15.0 .mu.l
BUdR (2.5 mM) 7.0 .mu.l rolling circle replication primer (10
.mu.M) 3.0 .mu.l Gene32 Protein (1.37 .mu.g/.mu.l) (final 41
.mu.g/ml) 16.0 .mu.l .phi.29 DNA polymerase (1:6 dilution, 16 .mu.l
= 768 ng)
[0387] The reaction was incubated 20 minutes in 37.degree. C.
oven.
[0388] All slides were then washed twice for four minutes with
2.times.SSC with 20% formamide at 25.degree. C., and then washed
twice for four minutes with 2.times.SSC, 3% BSA, 0.1% Tween-20 at
37.degree. C.
[0389] 5. The TS-DNA generated in the amplification operation was
collapsed and detected as follows:
[0390] 50 .mu.l of a solution of AntiBUDR-Mouse.IgG (7 .mu.g/ml) in
2.times.SSC, 3% BSA, 0.1% Tween-20 was placed on each slide, and
the slides were incubated for 30 minutes at 37.degree. C. Then the
slides were washed three times for five minutes with 2.times.SSC,
3% BSA, 0.1% Tween-20 at 37.degree. C. Next, 50 .mu.l of a solution
of FITC-Avidin (6 .mu.g/ml) was placed on each slide, and the
slides were incubated for 30 minutes at 37.degree. C. Then the
slides were washed three times for five minutes with 2.times.SSC,
3% BSA, 0.1% Tween-20 at 37.degree. C., and then incubated for 2.6
minutes with 2.times.SSC, 0.1 .mu.g/ml DAPI (26 .mu.l in 50 ml) at
room temp. Next, the slides were washed 10 minutes with
1.times.SSC, 0.01% Tween at room temperature and then covered with
24 .mu.l antifade. Finally, the slides were examined in a
microscope with CCD camera for DAPI nuclear fluorescence and
discrete fluorescein signals.
Example 7
[0391] Multiplex Detection of Multiple Target Sequences Using
LM-RCA-CMC
[0392] This example illustrates multiplex detection using 31
different OCPs and gap oligonucleotide pairs, each designed to
generate 31 different color combinations using 5 basic colors.
[0393] 1. Slides containing samples are prepared as follows:
[0394] Poly-L-Lysine coated microscope slides are prepared, and DNA
is spotted using an arraying machine as described above using the
method described by Schena et al. The size of each spot of sample
DNA is 2.5 mm. DNA is denatured as described above using the method
described by Schena et al.
[0395] 2. A mixture of gap oligonucleotides and open circle probes
is designed and prepared, containing 31 different OCPs and 31
different gap oligonucleotides. The OCPs and gap oligonucleotides
are designed as pairs with each OCP and gap probe pair containing
sequences complementary to a specific target sequence of interest.
The spacer regions of each of the 31 OCPs contain unique,
alternative combinations of five possible detection tags,
designated 1t, 2t, 3t, 4t, and 5t. The combinations are coded
according to the scheme shown below. The set of pairs is designated
as follows:
17 Gap oligo OCP 1t 2t 3t 4t 5t g2 ocp1 + g2 ocp2 + g3 ocp3 + g4
ocp4 + g5 ocp5 + g6 ocp6 + + . . . . . . and so on . . . g25 ocp25
+ + + g26 ocp26 + + + + g27 ocp27 + + + + g28 ocp28 + + + + g29
ocp29 + + + + g30 ocp30 + + + + g31 ocp31 + + + + +
[0396] 3. LM-RCA is performed as follows:
[0397] The OCPs and gap oligonucleotides are hybridized and ligated
to target sequences on the sample slides with 50 .mu.l of the
following mixture.
18 1.5 .mu.l 10X ligation buffer (Ampligase) 8.8 .mu.l BSA, 2 mg/ml
stock 15 .mu.l Mixture of 31 Gap oligonucleotides [final 400 nM for
each] 5 .mu.l Mixture of 31 OCPs [final = 100 nMolar for each] 25
.mu.l Ampligase (5 U/.mu.l) 82 .mu.l H.sub.2O
[0398] The reaction is incubated for 60 minutes at 52.degree.
C.
[0399] The slides are washed twice for 5 minutes with 2.times.SSC
with 20% formamide at 42.degree. C., washed for two minutes with 20
mM Tris, pH 7.5, 0.075 M NaCl to remove the formamide, and washed
for three minutes with 50 mM Tris, pH 7.5, 40 mM KOAc, 10 mM
MgCl.sub.2, 10 mM DTT, 100 .mu.g/ml BSA.
[0400] The amplification operation is performed by placing 24 .mu.l
of the following mixture on each slide.
19 18.0 .mu.l H.sub.2O [total volume = 100 .mu.l for 4 slides] 20.0
.mu.l 5X .phi.29 buffer with BSA BSA is 200 .mu.g/ml 16.0 .mu.l
dNTPs (A, G, and C, each 2.5 mM) 5.0 .mu.l dTTP (2.5 mM) 15.0 .mu.l
BUdR (2.5 mM) 7.0 .mu.l rolling circle replication primer (10
.mu.M) 3.0 .mu.l Gene32 Protein (1.37 .mu.g/.mu.l) (final 41
.mu.g/ml) 16.0 .mu.l .phi.29 DNA polymerase (1:6 dilution, 16 .mu.l
= 768 ng)
[0401] The reaction is incubated 15 minutes in 37.degree. C.
oven.
[0402] All slides were then washed twice for four minutes with
2.times.SSC with 20% formamide at 25.degree. C.
[0403] 4. The 5 collapsing detection probes, each with a different
label and each complementary to one of the 5 detection tags, are
hybridized to the TS-DNA on the slides in a solution of
4.times.SSC. The detection probes correspond to the detection tags
as follows:
20 Detection probe Label Detection tag dp1 fluorescein 1t dp2 Cy3
2t dp3 Cy3.5 3t dp4 Cy5 4t dp5 Cy7 5t
[0404] All slides were then washed twice for four minutes with
2.times.SSC with 20% formamide at 25.degree. C., and then washed
twice for four minutes with 2.times.SSC, 3% BSA, 0.1% Tween-20 at
37.degree. C.
[0405] 5. The TS-DNA generated in the amplification operation is
further collapsed and detected as follows:
[0406] 50 .mu.l of a solution of AntiBUDR-Mouse.IgG (7 .mu.g/ml) in
2.times.SSC, 3% BSA, 0.1% Tween-20 is placed on each slide, and the
slides are incubated for 30 minutes at 37.degree. C. Then the
slides are washed three times for five minutes with 2.times.SSC, 3%
BSA, 0.1% Tween-20 at 37.degree. C. Next, 50 .mu.l of a solution of
Avidin DN (6 .mu.g/ml) in 2.times.SSC, 3% BSA, 0.1% Tween-20 is
placed on each slide, and the slides are incubated for 30 minutes
at 37.degree. C. Then the slides are washed three times for five
minutes with 2.times.SSC, 3% BSA, 0.1% Tween-20 at 37.degree. C.,
washed 5 minutes with 2.times.SSC, 0.01% Tween at room temperature,
and then covered with 24 .mu.l antifade. Finally, the slides are
scanned in a fluorescence scanning device with appropriate filters
(for example, those described by Schena et al.). Image analysis
software is used to count and analyze the spectral signatures of
the fluorescent dots.
Example 8
[0407] Multiplex Detection of Multiple Target Sequences Using
LM-RCA-CMC
[0408] This example illustrates multiplex detection using 15
different OCPs and 30 different gap oligonucleotides, where pairs
of gap oligonucleotides are associated with each OCP. The OCPs and
gap oligonucleotides are designed to generate 30 different color
combinations using 6 basic label colors.
[0409] 1. Slides containing samples are prepared as follows:
[0410] Poly-L-Lysine coated microscope slides are prepared, and DNA
is spotted using an arraying machine as described above using the
method described by Schena et al. The size of each spot of sample
DNA is 2.5 mm. DNA is denatured as described above using the method
described by Schena et al.
[0411] 2. A mixture of gap oligonucleotides and open circle probes
is designed and prepared, containing 15 different OCPs and 30
different gap oligonucleotides. The OCPs and gap oligonucleotides
are designed as pairs with each OCP and gap probe pair containing
sequences complementary to a specific target sequence of interest.
The spacer regions of each of the 15 OCPs contain unique,
alternative combinations of four possible detection tags,
designated 1t, 2t, 3t, and 4t. Additional detection tags are
generated by ligation of an OCP to a gap oligonucleotide. These
form two different detection tags depending on which of the pair of
gap oligonucleotides is ligated to a given OCP. The combinations
are coded according to the scheme shown below. The set of pairs is
designated as follows:
21 Gap oligo OCP 1t 2t 3t 4t g1 ocp1 + g2 ocp1 + g3 ocp2 + g4 ocp2
+ g5 ocp3 + g6 ocp3 + . . . . . . and so on . . . g25 ocp13 + + +
g26 ocp13 + + + g27 ocp14 + + + g28 ocp14 + + + g29 ocp15 + + + +
g30 ocp15 + + + +
[0412] 3. LM-RCA is performed as follows:
[0413] The OCPs and gap oligonucleotides are hybridized and ligated
to target sequences on the sample slides with 50 .mu.l of the
following mixture.
22 1.5 .mu.l 10X ligation buffer (Ampligase) 8.8 .mu.l BSA, 2 mg/ml
stock 15 .mu.l Mixture of 30 Gap oligonucleotides [final 400 nM for
each] 5 .mu.l Mixture of 15 OCPs [final 100 nMolar for each] 25
.mu.l Ampligase (5 U/.mu.l) 82 .mu.l H.sub.2O
[0414] The reaction is incubated for 60 minutes at 52.degree.
C.
[0415] The slides are washed twice for 5 minutes with 2.times.SSC
with 20% formamide at 42.degree. C., washed for two minutes with 20
mM Tris, pH 7.5, 0.075 M NaCl to remove the formamide, and washed
for three minutes with 50 mM Tris, pH 7.5, 40 mM KOAc, 10 mM
MgCl.sub.2, 10 mM DTT, 100 .mu.g/ml BSA.
[0416] The amplification operation is performed by placing 24 .mu.l
of the following mixture on each slide.
23 18.0 .mu.l H.sub.2O [total volume = 100 .mu.l for 4 slides] 20.0
.mu.l 5X .phi.29 buffer with BSA BSA is 200 .mu.g/ml 16.0 .mu.l
dNTPs (A, G, and C, each 2.5 mM) 5.0 .mu.l dTTP (2.5 mM) 15.0 .mu.l
BUdR (2.5 mM) 7.0 .mu.l rolling circle replication primer (10
.mu.M) 3.0 .mu.l Gene32 Protein (1.37 .mu.g/.mu.l) (final 41
.mu.g/ml) 16.0 .mu.l .phi.29 DNA polymerase (1:6 dilution, 16 .mu.l
= 768 ng)
[0417] The reaction is incubated 15 minutes in 37.degree. C.
oven.
[0418] All slides were then washed twice for four minutes with
2.times.SSC with 20% formamide at 25.degree. C.
[0419] 4. Four collapsing detection probes, each with a different
label and each complementary to one of the 4 detection tags, 1t,
2t, 3t, and 4t, along with 30 collapsing detection probes, each
with one of two labels and each complementary to one of the
detection tags formed by the ligation of an OCP and gap
oligonucleotide, are hybridized to the TS-DNA on the slides in a
solution of 4.times.SSC. The detection probes correspond to the
detection tags as follows:
24 Detection probe Label Detection tag dp1 fluorescein 1t dp2 Cy3
2t dp3 Cy3.5 3t dp4 Cy5.5 4t dp5 Cy5 g1 dp6 Cy7 g2 dp7 Cy5 g3 dp8
Cy7 g4 dp9 Cy5 g5 dp10 Cy7 g6 dp11 Cy5 g7 dp12 Cy7 g8 dp13 Cy5 g9
dp14 Cy7 g10 dp15 Cy5 g11 dp16 Cy7 g12 dp17 Cy5 g13 dp18 Cy7 g14
dp19 Cy5 g15 dp20 Cy7 g16 dp21 Cy5 g17 dp22 Cy7 g18 dp23 Cy5 g19
dp24 Cy7 g20 dp25 Cy5 g21 dp26 Cy7 g22 dp27 Cy5 g23 dp28 Cy7 g24
dp29 Cy5 g25 dp30 Cy7 g26 dp31 Cy5 g27 dp32 Cy7 g28 dp33 Cy5 g29
dp34 Cy7 g30
[0420] All slides were then washed twice for four minutes with
2.times.SSC with 20% formamide at 25.degree. C., and then washed
twice for four minutes with 2.times.SSC, 3% BSA, 0.1% Tween-20 at
37.degree. C.
[0421] 5. The TS-DNA generated in the amplification operation is
further collapsed and detected as follows:
[0422] 50 .mu.l of a solution of AntiBUDR-Mouse.IgG (7 .mu.g/ml) in
2.times.SSC, 3% BSA, 0.1% Tween-20 is placed on each slide, and the
slides are incubated for 30 minutes at 37.degree. C. Then the
slides are washed three times for five minutes with 2.times.SSC, 3%
BSA, 0.1% Tween-20 at 37.degree. C. Next, 50 .mu.l of a solution of
Avidin DN (6 .mu.g/ml) in 2.times.SSC, 3% BSA, 0.1% Tween-20 is
placed on each slide, and the slides are incubated for 30 minutes
at 37.degree. C. Then the slides are washed three times for five
minutes with 2.times.SSC, 3% BSA, 0.1% Tween-20 at 37.degree. C.,
washed 5 minutes with 2.times.SSC, 0.01% Tween at room temperature,
and then covered with 24 .mu.l antifade. Finally, the slides are
scanned in a fluorescence scanning device with appropriate filters
(for example, those described by Schena et al.). Image analysis
software is used to count and analyze the spectral signatures of
the fluorescent dots.
Example 9
[0423] Unimolecular Segment Amplification and Sequencing
[0424] This example illustrates unimolecular segment amplification
(that is, rolling circle amplification) followed by single
nucleotide primer extension sequencing. In this example, an OCP is
hybridized to a target nucleic acid so as to leave a gap in a
region of known sequence variation. After formation of an
amplification target circle using gap-filling ligation, and rolling
circle amplification of the amplification target circle, the
amplified DNA is subjected to chain terminating primer extension
sequencing using uniquely labeled chain-terminating nucleotides.
Detection of the incorporated label identifies the nucleotide of
interest.
[0425] An Open Circle Probe designed to hybridize with the Cystic
Fibrosis Transmembrane Regulator G542X mutant locus is designed so
as to leave a gap of four bases, encompassing the mutant base. The
gap is to be filled by a DNA polymerase in a gap-filling ligation
operation, thereby incorporating whatever sequence is present in
the target Cystic Fibrosis Transmembrane Regulator G542X.
[0426] The sequence of the 5'-phosphorylated OCP (82 bases) is as
follows:
25 (nucleotides 1 to 82 of SEQ ID NO:20)
GAACTATATTGTCTTTCTCTGTTTTCTTGCATGGTCACACGTCGTTCT
AGTACGCTTCTAACTTAGTGTGATTCCACCTTCT
[0427] The underlined ends of this probe hybridize with the target
human DNA as indicated below (target sequence shown in reverse, 3'
to 5'):
26 (mutant) (t) gtgagtcacactaaggtggaagaggttct-
tgatataacagaaagagacgtttga .vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline..vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline. AGTGTGATTCCACCTTCT GAACTATATTGTCTTTCTCTG
Left target probe Right target probe 18 gap 21
[0428] The target DNA is SEQ ID NO: 21. The left target probe is
nucleotides 65 to 82 of SEQ ID NO: 20. The right target probe is
nucleotides 1 to 21 of SEQ ID NO: 20. The region in the target DNA
opposite the gap encompasses a nucleotide which is either g (wild
type) or t (mutant). It is this nucleotide position which is
interrogated (that is, sequenced).
[0429] 1. Microscope slides containing bound DNA samples are
prepared as described by Schena et al.
[0430] 2. Gap-filling ligation in the presence of 150 nMolar Open
Circle Probe, Ampligase DNA ligase, and Thermus flavus DNA
polymerase is carried out as described earlier (generally using the
conditions described by Abravaya et al., Nucleic Acids Research
23:675-682 (1995)), in the presence of dATP and dCTP, so that the
gap is filled and immediately ligated. The reaction is carried out
with the slides covered with a 22 by 40 mm cover slip, in a volume
of 28 .mu.l, and is incubated for 1 hour at 58.degree. C. The
filling reaction adds the base sequence CCAA for the wild type , or
the sequence CAAA for the mutant gene, respectively.
[0431] 3. Wash slides twice in 2.times.SSC with 20% formamide for 5
minutes at 42.degree. C.
[0432] 4. Wash slides for 2 minutes with 20 mM Tris, pH 7.5, 0.075
M NaCl.
[0433] 5. Rolling Circle Amplification is carried out in situ for
15 minutes at 30.degree. C. in a buffer containing the following
components: 50 mM Tris-HCl, pH 7.5, 10 MM MgCl.sub.2, 1 mM DTT, 400
.mu.M each of dCTP, dATP, and dGTP, 95 .mu.M dTTP, 380 .mu.M BUDR
triphosphate (SIGMA), the 18 nucleotide rolling circle replication
primer, ACGACGTGTGACCATGCA (SEQ ID NO: 22), at a concentration of
0.7 .mu.M, Phage T4 Gene-32 protein at a concentration of 1000
nMolar, and .phi.29 DNA polymerase at 200 nM. This reaction
generates approximately 400 copies of TS-DNA containing faithful
copies of the gene sequence.
[0434] 6. Wash twice in 2.times.SSC with 20% formamide for 5
minutes at 25.degree. C.
[0435] 7. Incubate the slides with the 20 nucleotide interrogation
primer, TAGTGTGATTCCACCTTCTC (nucleotides 64 to 83 of SEQ ID NO:
20), designed to hybridize with the TS-DNA adjacent to the
nucleotide being interrogated, shown below as a boldface N:
27 Pri- TAGTGTGATTCCACCTTCTC mer .linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split. TS-
...gaagattgaatcacactaaggtggaagagNttcttgata... DNA
[0436] The TS-DNA is SEQ ID NO: 22. The slides are incubated 10
minutes at 37.degree. C. in the following conditions:
[0437] Four Units Sequenase DNA polymerase (Amersham-USB), in 25
.mu.l of 50 mM Tris-HCl, pH 7.5, 20 mM MgCl.sub.2, 50 mM NaCl, 5 mM
DTT, 50 .mu.g/ml Bovine Serum Albumin (Molecular Biology grade from
Life Sciences, Inc.), 50 .mu.M fluorescent-ddATP,
fluorescent-ddCTP, fluorescent-ddGTP, and fluorescent-ddTTP. The
four fluorescent dideoxynucleoside triphosphates each have
different emission spectra and can be obtained from a standard DNA
sequencing kit (Applied Biosystems, Inc.).
[0438] Sequenase DNA polymerase incorporates only one ddNTP, where
the incorporated ddNTP is complementary to the nucleotide being
interrogated. This is illustrated below where when the interrogated
nucleotide is a T (the mutant form), fluorescent ddATP is
incorporated:
28 Extended primer TAGTGTGATTCCACCTTCTCA* .linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split..linevert split..linevert split..linevert split..linevert
split. TS-DNA ...gaagattgaatcacactaaggtggaagagTttcttgata...
[0439] The extended primer is nucleotides 64 to 84 of SEQ ID NO:
20. If the interrogated nucleotide is G (the wild type),
fluorescent ddCTP is incorporated.
[0440] 8. Wash for 5 minutes in 2.times.SSC at 25.degree. C.
[0441] 9. Wash for 4 minutes in 2.times.SSC, 2.8% BSA, 0.12%
Tween-20 at 37.degree. C.
[0442] 10. Incubate 30 minutes at 37.degree. C. in 50 .mu.l (under
cover slip) using 5 .mu.g/ml Biotinylated AntiBUDR-Mouse.IgG (Zymed
Labs) in 2.times.SSC, 2.8% BSA, and 0.12% Tween-20.
[0443] 11. Wash three times in 2.times.SSC, 2.8% BSA, and 0.12%
Tween-20 for 5 minutes at 37.degree. C.
[0444] 12. Incubate 30 minutes at 37.degree. C. in 50 .mu.l (under
cover slip) using FITC-Avidin, 5 .mu.g/ml, in 2.times.SSC, 2.8%
BSA, and 0.12% Tween-20.
[0445] 13. Wash three times in 2.times.SSC, 2.8% BSA, and 0.12%
Tween-20 for 5 minutes at 37.degree. C.
[0446] 14. Wash 5 minutes with 2.times.SSC, and 0.01% Tween-20 at
room temperature.
[0447] 15. An image of the slide is captured using a microscope-CCD
camera system with appropriate filter sets. Each TS-DNA, each with
multiple extended primers, occupy a small area on the slides. The
incorporated fluorescent nucleotides produce individual fluorescent
dots for each TS-DNA. The fluorescent emission color defines the
nucleotide incorporated at the specific extension position in each
fluorescent dot. Thus, in a sample containing a mixture of wild
type and mutant sequences, the presence of each is indicated by the
presence of fluorescent dots having the fluorescent emission color
of the fluorescent ddATP (indicating the mutant form) and of
fluorescent dots having the fluorescent emission color of the
fluorescent ddCTP (indicating the wild type). The dots will be
distinct and distinguishable due to the small area occupied by each
TS-DNA due to its collapse.
[0448] Expected results for heterozygous and homozygous samples are
depicted in FIG. 16. The large circles represent a target sample
dot on the slide. The small circles represent individual TS-DNA
molecules, amplified in situ at the location of target nucleic
acids in the sample, which have been subjected to primer extension
sequencing. In an actual assay, hundreds or thousands of
individually detectable TS-DNA molecules would be present in a
sample dot, and the area occupied by the collapsed TS-DNA would be
much smaller. Fewer and larger TS-DNA spots are depicted in FIG. 16
for clarity of illustration. The nucleotide incorporated is
identified by its fluorescent spectrum and is based on the
nucleotide present at the interrogated position in the TS-DNA. FIG.
16A is representative of a sample that is homozygous for the wild
type sequence (indicated by incorporation of cystine). All of the
cells in the sample (and thus, all of the target nucleic acids in
the sample) have the same sequence resulting in the same
incorporated nucleotide for all of the TS-DNA molecules in the
sample. FIG. 16B is representative of a sample that is heterozygous
for the wild type and a mutant (indicated by an equal number of
TS-DNA molecules resulting in incorporation of cystine and
adenine). All of the cells in the sample (and thus, all of the
target nucleic acids in the sample) have one copy of both sequences
(that is, wild type and mutant), resulting in the incorporation of
two different nucleotides; each for half of the TS-DNA molecules in
the sample. FIG. 16C is representative of a sample that is
homozygous but includes a few cells with a somatic mutation. Most
of the cells in the sample (and thus, most of the target nucleic
acids in the sample) have the same sequence (that is, wild type),
and only a few have the mutant sequence. This results in the
incorporation of one nucleotide for most of the TS-DNA molecules,
and incorporation of a different nucleotide for a few TS-DNA
molecules. The ratio of the number of TS-DNA molecules for which a
given nucleotide is incorporated is an accurate measure of the
ratio of the corresponding target nucleic acid in the sample. Such
sensitive detection of somatic mutations will be particularly
useful for detecting, for example, a few cancer cells, or a few
virally infected cells, in a sample containing mostly normal or
uninfected cells.
Example 10
[0449] Unimolecular Segment Amplification and CAGE Sequencing
[0450] This example illustrates unimolecular segment amplification
(that is, rolling circle amplification) followed by degenerate
probe primer extension sequencing using caged oligonucleotides. In
this example, an OCP is hybridized to a target nucleic acid so as
to leave a gap in a region of known sequence variation. After
formation of an amplification target circle using gap-filling
ligation, and after rolling circle amplification of the
amplification target circle, interrogation probes are hybridized to
the amplified DNA. Interrogation primers are then formed by
ligating degenerate probe to the interrogation probes. The
interrogation primers are then extended in chain terminating primer
extension sequencing using uniquely labeled chain-terminating
nucleotides. This example illustrates the use of sequential
addition of degenerate probes to hybridized interrogation probes in
an arrayed solid-state sample. Detection of the incorporated label
identifies the nucleotide sequence in the region of interest.
[0451] An Open Circle Probe (OCP.96) of 96 bases with a
5'-phosphate is designed to hybridize with a GT repeat polymorphic
locus. The probe is designed to leave a gap in the GT repeat region
when hybridized to the target DNA. The gap is to be filled by a DNA
polymerase in a gap-filling ligation operation, thereby
incorporating the entire GT repeat region into the ligated OCP.
[0452] The sequences of the OCP (96 bases) is as follows:
29 (nucleotides 1 to 96 of SEQ ID NO:25)
ATCTAGCTATGTACGTACGTGAACTTTTCTTGCATGGTCACACGTCG
TTCTAGTACGCTTCTAACTTTTAACATATCTCGACATCTAACGATCG AT
[0453] The underlined ends of this probe hybridize with the target
DNA as indicated in FIG. 17. In FIG. 17, the gap space is indicated
as "Fill sequence". FIG. 17A shows hybridization of the OCP to
target DNA having 10 repeats of CA. FIG. 17B shows hybridization of
the OCP to target DNA having 9 repeats of CA. As will be shown,
USA-CAGESEQ is a useful and accurate method of determining the
nucleotide sequence in a highly repetitive region of DNA.
[0454] 1. Five microscope slides, each containing at least one
vertically aligned column of five identical bound denatured DNA
samples are prepared as described by Schena et al. Each slide may
contain from one to 100 regularly spaced columns of DNA samples, as
long as the number of sample dots in each column is five. The
slides should be identical (or at least have an identical set of
DNA samples). An example of a slide with an array of bound DNA
samples is shown in FIG. 18A. The five sample dots in each column
are identical (that is, they are from the same DNA sample). Each
column of sample dots is preferably made from different sample
samples.
[0455] 2a. The slides are incubated in 50 mM Tris-HCl, pH 7.5, 0.3
M NaCl, 0.5 mM EDTA, and 150 nM OCP.96 oligo, for 1 hour at
48.degree. C. to achieve hybridization of the OCP. The slides are
then washed for 2 minutes in 50 mM Tris-HCl, pH 7.5, 100 mM M KCl,
and 0.05% Triton X-100.
[0456] 2b. Gap-filling ligation is carried out in the presence of
Ampligase DNA ligase and Thermus flavus DNA polymerase using the
conditions described above (generally using conditions described by
Abravaya et al.) in the presence of dATP, dCTP, dGTP, and dTTP, so
that the gap is filled and immediately ligated. The incubation is
carried out with the slides covered with a 22 by 40 mm cover slip,
in a volume of 28 .mu.l, for 45 minutes at 54.degree. C.
[0457] 3. Wash slides twice in 2.times.SSC with 20% formamide for 5
minutes at 42.degree. C.
[0458] 4. Wash slides for 2 minutes with 20 mM Tris, pH 7.5, and
0.075 M NaCl.
[0459] 5. Rolling Circle Amplification is carried out in situ for
15 minutes at 30.degree. C. in a buffer containing the following
components: 50 mM Tris-HCl pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT, 400
.mu.M each of dCTP, dATP, dGTP, 95 .mu.M dTTP, 360 .mu.M BUDR
triphosphate (SIGMA), the 18 nucleotide rolling circle replication
primer, ACGACGTGTGACCATGCA (SEQ ID NO: 22), at a concentration of
700 nM, Phage T4 Gene-32 protein at a concentration of 1000 nMolar,
and .phi.29 DNA polymerase at 200 nM. This reaction generates
approximately 400 copies of TS-DNA containing faithful copies of
the target DNA.
[0460] 6. Wash twice in 2.times.SSC with 20% formamide for 5
minutes at 25.degree. C.
[0461] 7a. Incubate one slide (slide number 1) in 2.times.SSC and
300 nMolar of a first 20 nucleotide interrogation probe
(interrogation probe 1), TCTCGACATCTAACGATCGA (nucleotides 76 to 95
of SEQ ID NO: 25), which hybridizes with the TS-DNA.
[0462] 7b. Incubate another slide (slide number 2) in 2.times.SSC
and 300 nMolar of a second 20 nucleotide interrogation probe
(interrogation probe 2), CTCGACATCTAACGATCGAT (nucleotides 77 to 96
of SEQ ID NO: 25), which hybridizes with the TS-DNA.
[0463] 7c. Incubate another slide (slide number 3) in 2.times.SSC
and 300 nMolar of a third 20 nucleotide interrogation probe
(interrogation probe 3), TCGACATCTAACGATCGATC (nucleotides 78 to 97
of SEQ ID NO: 25), which hybridizes with the TS-DNA.
[0464] 7d. Incubate another slide (slide number 4) in 2.times.SSC
and 300 nMolar of a fourth 20 nucleotide interrogation probe
(interrogation probe 4), CGACATCTAACGATCGATCC (nucleotides 79 to 98
of SEQ ID NO: 25), which hybridizes with the TS-DNA.
[0465] 7e. Incubate another slide (slide number 5) in 2.times.SSC
and 300 nMolar of a fifth 20 nucleotide interrogation probe
(interrogation probe 5), GACATCTAACGATCGATCCT (nucleotides 80 to 99
of SEQ ID NO: 25), which hybridizes with the TS-DNA.
[0466] The five interrogation probes constitute a nested set as
described earlier. Their relationship to the amplified TS-DNA is
shown below:
30 Probe 1 TCTCGACATCTAACGATCGA Probe 2 CTCGACATCTAACGATCGAT Probe
3 TCGACATCTAACGATCGATC Probe 4 CGACATCTAACGATCGATCC Probe 5
GACATCTAACGATCGATCCT .vertline..vertline..vertline..vertline-
..vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline. TS-DNA TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
[0467] Probe 1 is nucleotides 76 to 95 of SEQ ID NO: 25, probe 2 is
nucleotides 77 to 96 of SEQ ID NO: 25, probe 3 is nucleotides 78 to
97 of SEQ ID NO: 25, probe 4 is nucleotides 79 to 98 of SEQ ID NO:
25, probe 5 is nucleotides 80 to 99 of SEQ ID NO: 25, and the
TS-DNA (shown 3' to 5') is nucleotides 19 to 60 of SEQ ID NO:
19.
[0468] 8. The slides are washed for 2 minutes in 50 mM Tris-Cl pH
7.5, 150 mM KCl, and 0.05% Triton X-100.
[0469] 9. The slides are then subjected to five sequential rounds
of degenerate probe ligation. Each round consists of the following
steps:
[0470] (a) The 5 slides are incubated with a ligation reaction
mixture that contains the following components:
[0471] (i) A full set of pentamer degenerate probes (that is, a
mixture of oligonucleotides representing all 1,024 possible
pentameric sequences), each degenerate probe at a concentration of
40 nMolar, where each degenerate probe has a 5' phosphate and a
modified nucleotide at the 3' end (that is, a block at the 3' end).
In this example, the modified nucleotides are caged nucleotides
which are of the following form:
[0472] 2'-Deoxy-3'-O-(2-nitrobenzyl)adenosine
[0473] 2'-Deoxy-3'-O-(2-nitrobenzyl)guanosine
[0474] 2'-Deoxy-3'-O-(2-nitrobenzyl)thymidine
[0475] 2'-Deoxy-3'-O-(2-nitrobenzyl)cytosine
[0476] These nucleotides are described by Metzker et al., Nucleic
Acids Research 22:4259-4267 (1994). The modified bases protect
(that is, block) the 3'-hydroxyl and render the degenerate probes
incapable of participating in DNA polymerase extension or DNA
ligation.
[0477] (ii) A suitable DNA ligase, preferably Phage T4 DNA ligase.
Ligation is carried out with T4 DNA ligase (New England Biolabs) at
a concentration of 8 units per .mu.l , in a buffer consisting of 10
mM Tris-HCl, pH 7.5, 0.18 M NaCl, 12 mM MgCl.sub.2, 2 mM ATP, and
10% polyethylene glycol. The total volume is 25 .mu.l. Ligation is
carried out for 40 minutes at 32.degree. C.
[0478] (b) A primer extension reaction is carried out for 5 minutes
at 37.degree. C. in 25 .mu.l, under a cover slip, in the presence
of 5 Units Sequenase DNA polymerase (Amersham-USB), 50 mM Tris-HCl,
pH 7.5, 20 mM MgCl.sub.2, 50 mM NaCl, 5 mM DTT, 50 .mu.g/ml Bovine
Serum Albumin (Molecular Biology grade from Life Sciences, Inc.) 50
.mu.M ddATP, ddCTP, ddGTP, ddTTP. This reaction blocks all the
primer 3' ends that failed to participate in a ligation event The
slides are washed for 5 minutes in 2.times.SSC at 25.degree. C. to
remove any unligated degenerate probes.
[0479] After these steps, all of the interrogation probes are
ligated to a degenerate probe. In the first round of degenerate
probe ligation, an opaque "mask" is laid over the first row of DNA
sample dots in all of the slides (see FIG. 18B). This mask thus
covers the first sample dot of each column. The slides are exposed
to UV light for 4 minutes to remove the cage structures from all
the ligated degenerate probes in all the sample rows except row 1,
which is not illuminated.
[0480] For the second round of degenerate probe ligation, steps (a)
and (b) are repeated. Degenerate probes can only be ligated to DNA
sample dots in rows 2 to 5 since the cage structure remains at the
3' end of the degenerate probes ligated to the DNA sample dots in
the first row. After these steps, the interrogation probes in rows
2 to 5 are ligated to two degenerate probes. Then the opaque mask
is laid over the first and second rows of DNA sample dots in all of
the slides (see FIG. 18C). The mask thus covers the first and
second sample dots of each column. The slides are exposed to UV
light for 4 minutes to remove the cage structures from all the
ligated degenerate probes in all the sample rows except rows 1 and
2, which are not illuminated.
[0481] For the third round of degenerate probe ligation, steps (a)
and (b) are repeated. Degenerate probes can only be ligated to DNA
sample dots in rows 3 to 5 since the cage structure remains at the
3' end of the degenerate probes ligated to the DNA sample dots in
rows 1 and 2. After these steps, the interrogation probes in rows 3
to 5 are ligated to three degenerate probes. Then the opaque mask
is laid over rows 1, 2 and 3 of DNA sample dots in all of the
slides (see FIG. 18D). The mask thus covers the first, second and
third sample dots of each column. The slides are exposed to UV
light for 4 minutes to remove the cage structures from all the
ligated degenerate probes in the fourth and fifth sample rows. The
cage structures are not removed from the degenerate probes in
sample rows 1, 2 and 3 since they are not illuminated.
[0482] For the fourth round of degenerate probe ligation, steps (a)
and (b) are repeated. Degenerate probes can only be ligated to DNA
sample dots in the fourth and fifth rows since the cage structure
remains at the 3' end of the degenerate probes ligated to the DNA
sample dots in rows 1, 2 and 3. After these steps, the
interrogation probes in the fourth and fifth rows are ligated to
four degenerate probes. Then the opaque mask is laid over rows 1,
2, 3 and 4 of DNA sample dots in all of the slides (see FIG. 18E).
The mask thus covers the first, second, third and fourth sample
dots of each column. The slides are exposed to UV light for 4
minutes to remove the cage structures from all the ligated
degenerate probes in the fifth sample row. The cage structures are
not removed from the degenerate probes in sample rows 1, 2, 3 and 4
since they are not illuminated.
[0483] For the fifth round of degenerate probe ligation, steps (a)
and (b) are repeated. Degenerate probes can only be ligated to DNA
sample dots in the fifth row since the cage structure remains at
the 3' end of the degenerate probes ligated to the DNA sample dots
in rows 1, 2, 3 and 4. After these steps, the interrogation probes
in the fifth row are ligated to five degenerate probes. The slides
are then exposed to UV light without the mask for 4 minutes to
remove the cage structures from all the ligated degenerate probes
in all the sample rows. This leaves all of the ligated probes
(which can now be considered interrogation primers) ready for chain
terminating primer extension.
[0484] FIGS. 21A, 21B, 23A, and 23B depict the results of the above
degenerate probe ligation. The interrogation primers (the top,
shorter sequences following the row labels) formed by ligation of
degenerate probes to the interrogation probes are shown hybridized
to TS-DNA (the longer sequences below each interrogation primer)
for all of the five sample dots in one column of each of the five
slides. In each slide, one additional degenerate probe has been
added in each succeeding row, which is a consequence of
successively covering one additional row of sample dots during each
round of degenerate probe ligation. The non-underlined portions of
the interrogation primers represent the interrogation probe. The
underlined portions of the interrogation primers represent
degenerate probes ligated to the end of the interrogation probe.
Careful examination of all the interrogation primers in each set of
five slides reveals that each ends adjacent to a different
nucleotide in the TS-DNA. This allows an entire stretch of
nucleotides to be separately interrogated (that is, sequenced).
FIGS. 21A and 21B depict the results with a normal target sequence
(that is, having 10 repeats of CA). FIGS. 23A and 23B depict the
results with a mutant target sequence (that is, having only nine
repeats of CA).
[0485] 10. The slides are then subjected to chain terminating
primer extension carried out for 5 minutes at 37.degree. C. in a
volume of 25 .mu.l, under a cover slip, in the presence of 5 Units
Sequenase DNA polymerase (Amersham-USB), 50 mM Tris-Cl, pH 7.5, 20
mM MgCl.sub.2, 50 mM NaCl, 5 mM DTT, 50 .mu.g/ml Bovine Serum
Albumin (Molecular Biology grade from Life Sciences, Inc.) 50 .mu.M
fluorescent-ddATP, 50 .mu.M fluorescent-ddCTP, 50 .mu.M
fluorescent-ddGTP, 50 .mu.M fluorescent-ddTTP, each fluorescent
dNTP being able to generate- a signal with a different emission
spectrum (Applied Biosystems, Inc. Sequencing kit). In this
reaction, one fluorescent nucleotide is added to the end of each
interrogation primer. The identity of the added nucleotide is based
on the identity of the template nucleotide (the nucleotide adjacent
to the interrogation primer).
[0486] 11. Wash 5 minutes in 2.times.SSC at 25.degree. C.
[0487] 12. Wash 4 minutes in 2.times.SSC, 2.8% BSA, 0.12% Tween-20
at 37.degree. C.
[0488] 13. Incubate 30 minutes at 37.degree. C. in 50 .mu.l (under
cover slip) using 5 .mu.g/ml Biotinylated AntiBUDR-Mouse.IgG (Zymed
Labs) in 2.times.SSC, 2.8% BSA, 0.12% Tween-20. This reaction
collapses the TS-DNA molecules into a compact structures on the
slides.
[0489] 14. Wash three times for 5 minutes in 2.times.SSC, 2.8% BSA,
0.12% Tween-20 at 37.degree. C.
[0490] 15. Incubate 30 minutes at 37.degree. C. in 50 .mu.l (under
cover slip) using FITC-Avidin, 5 .mu.g/ml. in 2.times.SSC, 2.8%
BSA, 0.12% Tween-20. This labels each TS-DNA molecule with
fluorescein.
[0491] 16. Wash three time for 5 minutes in 2.times.SSC, 2.8% BSA,
0.12% Tween-20 at 37.degree. C.
[0492] 17. Wash 5 minutes with 2.times.SSC, 0.01% Tween-20 at room
temperature.
[0493] 18. The image of each slide is captured using a
microscope-CCD camera system with appropriate filter sets. The
fluorescent emission color of each fluorescent nucleotide defines
the nucleotide at the specific extension position in each
fluorescent spot. Each spot corresponds to a single molecule of
TS-DNA. FIGS. 22A, 22B, 24A, and 24B depict the results chain
terminating primer extension. The interrogation primers, now with a
fluorescent nucleotide (in boldface) added to the end, are shown
hybridized to TS-DNA for all of the five sample dots in one column
of each of the five slides. In each slide, a different nucleotide
in a stretch of nucleotides in the TS-DNA has served as the
template for the incorporation of a chain terminating fluorescent
nucleotide. Thus, each of the nucleotides in this stretch has been
separately interrogated (that is, sequenced). FIGS. 22A and 22B
depict the results with a normal target sequence (that is, having
10 repeats of CA). FIGS. 24A and 24B depict the results with a
mutant target sequence (that is, having only nine repeats of
CA).
[0494] 19. The sequence is assembled from the fluorescent spot data
obtained from all five slides, by reading the incorporated
nucleotide in each related sample dot in the order. FIGS. 19 and 21
diagrammatically depict the incorporated nucleotides for each
sample dot in corresponding columns of each of the five slides.
FIG. 19 represents the results with the normal target sequence
(that is, having 10 repeats of CA). FIG. 20 represents the results
with a mutant target sequence (that is, having only nine repeats of
CA). The nucleotides are read first from the first sample dot in a
given column from each slide in order (that is, the sample dot in
row 1 of slide 1, the sample dot in row 1 of slide 2, the sample
dot in row 1 of slide 3, the sample dot in row 1 of slide 4, and
the sample dot in row 1 of slide 5). The next nucleotides are read
from the second sample dot in the column from each slide in order
(that is, the second sample dot in row 2 of slides 1 to 5 in
order). The reading of nucleotides continues in the same manner for
sample dots in rows 3, 4, and 5 in order. The relationship of the
sample dots which leads to this order of reading can be seen by
carefully examining the relationship of the interrogated
nucleotides in FIGS. 22A, 22B, 24A, and 24B. The sequence read from
the slides depicted in FIG. 19 is GTGTGTGTGTGTGTGTGTGTCAATC
(nucleotides 105 to 125 of SEQ ID NO: 25). The sequence read from
the slides depicted in FIG. 20 is GTGTGTGTGTGTGTGTGTCAATCTG
(nucleotides 30 to 50 of SEQ ID NO: 18). The difference in the
number of GT repeats between these two sequences is readily
apparent.
Example 11
[0495] Immunoassay for Human TSH Coupled to Rolling Circle
Amplification
[0496] This example describes single-molecule detection of human
thyroid stimulating hormone (hTSH) using a capture antibody, and a
reporter antibody. The reporter antibody is of the form illustrated
in FIG. 29A where an antibody is coupled to a rolling circle
replication primer. The signal that is detected is produced by
rolling circle amplification primed by the rolling circle
replication primer portion of the reporter antibody.
[0497] 1. A malemide-modified monoclonal antibody specific for hTSH
is coupled to the 5'-end of the 28-base oligonucleotide
5'-[amino]-TTTTTTTTTTGCTGAGACATGACGAGTC-3' (SEQ ID NO: 27) using
SATA chemistry as described by Hendrickson et al. to form a
reporter antibody. The 18 nucleotides at the 3' end of this
oligonucleotide are complementary to the ATC described below. This
oligonucleotide serves as the rolling circle replication primer for
the amplification operation below.
[0498] 2. hTSH capture antibodies, specific for a different epitope
from that recognized by the reporter antibody, are immobilized at
defined positions using droplets of 2 mm diameter on derivatized
glass slides (Guo et al. (1994)) to make a solid-state detector.
Droplets of 1.5 microliters, containing 5 .mu.g/ml of the antibody
in sodium bicarbonate pH 9 are applied at each defined position on
the slides, incubated overnight, and then the entire slide is
washed with PBS-BLA (10 mM sodium phosphate, pH 7.4, 150 mM sodium
chloride, 2% BSA, 10% Beta-lactose, 0.02% sodium azide) to block
non-adsorbed sites.
[0499] 3. Serial dilutions of hTSH are added to each of several
identical slides, under cover slips. After 1 hour of incubation,
the slides are washed three times with TBS/Tween wash buffer
(Hendrickson et al.). The hTSH is now captured on the surface of
the glass slides.
[0500] 4. Thirty microliters of appropriately diluted mixture of
the reporter antibody (antibody coupled to rolling circle
replication primer) is added to each slide, under a cover slip. The
slides are incubated at 37.degree. C. for 1 hour, and then washed
four times, for 5 minutes each wash, with 2.times.SSC, 2.8%
BSA,0.12% Tween-20 at 37.degree. C.
[0501] 5. The ATC is a 94-base closed circular oligonucleotide of
the following sequence 5'-AAATCTCCAACTGGAAACTGTTCTGACTCGTCATGTCTC
AGCTCTAGTACGCTGATCTCAGTCTGATCTCAGTCATTTGGTCTCAA AGTGATTG-3' (SEQ ID
NO: 28). This ATC oligonucleotide is incubated in a volume of 30
microliters on the surface of the glass slide, under a cover slip,
in a buffer consisting of 50 mM Tris-Cl, pH 7.4, 40 mM KOAC, 10 mM
MgCl.sub.2, in order to hybridize the ATC to the rolling circle
replication primer portion of the reporter antibodies. This
hybridization is illustrated in FIG. 29B.
[0502] 6. In situ Rolling Circle Amplification is carried out for
12 minutes at 30.degree. C., under a cover slip, in 30 microliters
of a buffer containing the following components: 50 mM Tris-HCl pH
7.5, 10 mM MgCl.sub.2, 400 .mu.M each of dCTP, dATP, dGTP, 95 .mu.M
dTTP, 380 .mu.M BUDR triphosphate (SIGMA), Phage T4 Gene-32 protein
at a concentration of 1000 nMolar, and .phi.29 DNA polymerase at
200 nM. This reaction generates approximately 350 tandem copies of
the ATC. The copies remain bound to the antibody as a single TS-DNA
molecule since the rolling circle replication primer is
incorporated within the TS-DNA (at the 5' end) and the rolling
circle replication primer remains coupled to the antibody.
[0503] 7. The slide is washed three times for 5 minutes in
2.times.SSC, 2.8% BSA, 0.12% Tween-20 at 37.degree. C.
[0504] 8. The slide is then incubated 30 minutes at 37.degree. C.
in 50 .mu.l (under cover slip) of 2.times.SSC, 2.8% BSA, 0.12%
Tween-20, and 5 .mu.g/ml Biotinylated AntiBUDR-Mouse.IgG (Zymed
Labs).
[0505] 9. The slide is washed three times for 5 minutes in
2.times.SSC, 2.8% BSA, 0.12% Tween-20 at 37.degree. C.
[0506] 10. The slide is then incubated 30 minutes at 37.degree. C.
in 50 .mu.l (under cover slip) of 2.times.SSC, 2.8% BSA, 0.12%
Tween-20, and FITC-Avidin at 5 .mu.g/ml.
[0507] 11. The slide is washed 3.times.5 min. in 2.times.ssc, 2.8%
BSA, 0.12% Tween-20 at 37.degree. C.
[0508] 12. The slide is washed 10 minutes with 1.times.SSC, 0.01%
Tween-20 at room temperature.
[0509] 13. An image of the slide is captured using a microscope-CCD
camera system with appropriate filter sets for fluorescein
detection, and the number of fluorescent dots is counted. This
indicates the presence of, and relative amount of, hTSH present in
the sample since each dot represents a single collapsed TS-DNA
molecule and each TS-DNA molecule represents a single hTSH molecule
captured on the slide.
[0510] All publications cited herein, and the material for which
they are cited, are hereby specifically incorporated by
reference.
[0511] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
* * * * *