U.S. patent application number 10/447515 was filed with the patent office on 2003-12-18 for modification of fatty acid metabolism in plants.
This patent application is currently assigned to Metabolix, Inc.. Invention is credited to Moloney, Maurice, Patterson, Nii, Peoples, Oliver P., Snell, Kristi D..
Application Number | 20030233677 10/447515 |
Document ID | / |
Family ID | 26758892 |
Filed Date | 2003-12-18 |
United States Patent
Application |
20030233677 |
Kind Code |
A1 |
Peoples, Oliver P. ; et
al. |
December 18, 2003 |
Modification of fatty acid metabolism in plants
Abstract
Methods and systems to modify fatty acid biosynthesis and
oxidation in plants to make new polymers are provided. Two enzymes
are essential: a hydratase such as D-specific enoyl-CoA hydratase,
for example, the hydratase obtained from Aeromonas caviae, and a
.beta.-oxidation enzyme system. Some plants have a .beta.-oxidation
enzyme system which is sufficient to modify polymer synthesis when
the plants are engineered to express the hydratase. Examples
demonstrate production of polymer by expression of these enzymes in
transgenic plants. Examples also demonstrate that modifications in
fatty acid biosynthesis can be used to alter plant phenotypes,
decreasing or eliminating seed production and increasing green
plant biomass, as well as producing polyhydroxyalkanoates.
Inventors: |
Peoples, Oliver P.;
(Arlington, MA) ; Moloney, Maurice; (Calgary,
CA) ; Patterson, Nii; (Calgary, CA) ; Snell,
Kristi D.; (Belmont, MA) |
Correspondence
Address: |
PATREA L. PABST
HOLLAND & KNIGHT LLP
SUITE 2000, ONE ATLANTIC CENTER
1201 WEST PEACHTREE STREET, N.E.
ATLANTA
GA
30309-3400
US
|
Assignee: |
Metabolix, Inc.
|
Family ID: |
26758892 |
Appl. No.: |
10/447515 |
Filed: |
May 28, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10447515 |
May 28, 2003 |
|
|
|
09389395 |
Sep 3, 1999 |
|
|
|
6586658 |
|
|
|
|
09389395 |
Sep 3, 1999 |
|
|
|
09263406 |
Mar 5, 1999 |
|
|
|
60077107 |
Mar 6, 1998 |
|
|
|
Current U.S.
Class: |
800/281 ;
435/134; 435/189; 435/320.1; 435/419; 435/468; 435/69.1;
536/23.2 |
Current CPC
Class: |
C12N 15/8289 20130101;
C12N 15/8247 20130101; C12N 15/52 20130101; C12N 15/8243
20130101 |
Class at
Publication: |
800/281 ;
435/189; 435/468; 435/320.1; 435/419; 435/69.1; 435/134;
536/23.2 |
International
Class: |
A01H 001/00; C12N
015/82; C07H 021/04; C12P 007/64; C12N 009/02; C12P 021/02; C12N
005/04 |
Claims
We claim:
1. A method for manipulating the metabolism of a plant, comprising
expressing heterologous genes encoding fatty acid oxidation enzymes
in the cytosol or plastids other than the peroxisomes, glyoxisomes
or mitochondria, of the plant.
2. The method of claim 1 wherein the fatty acid .beta.-oxidation
enzymes are expressed from genes from selected from the group
consisting of bacterial, yeast, fungal, plant, and mammalian
genes.
3. The method of claim 2 wherein the fatty acid oxidation enzymes
are expressed from genes from bacteria selected from the group
consisting of Escherichia, Pseudomonas, Alcaligenes, and
Coryneform.
4. The method claim 3 wherein the genes are Pseudomonas putida
faoAB.
5. The method of claim 1 further comprising expressing genes
encoding enzymes selected from the group consisting of
polyhydroxyalkanoate synthases, acetoacetyl-CoA reductases,
.beta.-ketoacyl-CoA thiolases, and enoyl-CoA hydratases.
6. A DNA construct for use in a method of manipulating the
metabolism of a plant cell comprising, in phase, (a) a promoter
region functional in a plant; (b) a structural DNA sequence
encoding at least one fatty acid oxidation enzyme activity; and (c)
a 3' nontranslated region of a gene naturally expressed in a plant,
wherein the nontranslated region encodes a signal sequence for
polyadenylation of mRNA.
7. The DNA construct of claim 6 wherein the promoter is a seed
specific promoter.
8. The DNA construct of claim 7 wherein the seed specific promoter
is selected from the group consisting of napin promoter, phaseolin
promoter, oleosin promoter, 2S albumin promoter, zein promoter,
.beta.-conglycinin promoter, acyl-carrier protein promoter, and
fatty acid desaturase promoter.
9. The DNA construct of claim 6 wherein the promoter is a
constitutive promoter.
10. The DNA construct of claim 6 wherein the promoter is selected
from the group consisting of CaMV 35S promoter, enhanced CaMV 35S
promoter, and ubiquitin promoter.
11. A method for enhancing the biological production of
polyhydroxyalkanoates in a transgenic plant, comprising expressing
genes encoding heterologous fatty acid oxidation enzymes in cytosol
or plastids other than the peroxisomes, glyoxisomes or
mitochondria, of the plant.
12. The method of claim 11 wherein the transgenic plant is selected
from the group consisting of Brassica, maize, soybean, cottonseed,
sunflower, palm, coconut, safflower, peanut, mustards, flax,
tobacco, and alfalfa.
13. A transgenic plant or part thereof comprising heterologous
genes encoding fatty acid oxidation enzymes in cytosol or plastids
other than the peroxisomes, glyoxisomes or mitochondria of the
plant.
14. The plant or part thereof of claim 13 wherein the fatty acid
.beta.-oxidation enzymes are expressed from genes selected from the
group consisting of bacterial, yeast, fungal, plant, and
mammalian.
15. The plant or part thereof of claim 14 wherein the fatty acid
oxidation enzymes are expressed from genes from bacteria selected
from the group consisting of Escherichia, Pseudomonas, Alcaligenes,
and Coryneform.
16. The plant or part thereof of claim 15 wherein the genes are
Pseudomonas putida faoAB.
17. The plant or part thereof of claim 13 further comprising genes
encoding enzymes selected from the group consisting of
polyhydroxyalkanoate synthases, acetoacetyl-CoA reductases,
.beta.-ketoacyl-CoA thiolases, and enoyl-CoA hydratases.
18. The plant or part thereof of claim 13 wherein the plant is
selected from the group consisting of Brassica, maize, soybean,
cottonseed, sunflower, palm, coconut, safflower, peanut, mustards,
flax, tobacco, and alfalfa.
19. The plant or part thereof of claim 13 comprising a DNA
construct comprising, in phase, (a) a promoter region functional in
a plant; (b) a structural DNA sequence encoding at least one fatty
acid oxidation enzyme activity; and (c) a 3' nontranslated region
of a gene naturally expressed in a plant, wherein the nontranslated
region encodes a signal sequence for polyadenylation of mRNA.
20. The plant or part thereof of claim 19 wherein the promoter is a
seed specific promoter.
21. The plant or part thereof of claim 20 wherein the seed specific
promoter is selected from the group consisting of napin promoter,
phaseolin promoter, oleosin promoter, 2S albumin promoter, zein
promoter, .beta.-conglycinin promoter, acyl-carrier protein
promoter, and fatty acid desaturase promoter.
22. The plant or part thereof of claim 19 wherein the promoter is a
constitutive promoter.
23. The plant or part thereof of claim 19 wherein the promoter is
selected from the group consisting of CaMV 35S promoter, enhanced
CaMV 35S promoter, and ubiquitin promoter.
24. A method of preventing or suppressing seed production in a
plant, comprising expressing heterologous genes encoding fatty acid
oxidation enzymes in cytosol or plastids other than the
peroxisomes, glyoxisomes or mitochondria, of the plant.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] Priority is claimed to U.S. application Ser. No. 09/263,406,
filed Mar. 5, 1999, which claims priority to U.S. Provisional
application Serial No. 60/077,107, filed Mar. 6, 1998.
BACKGROUND OF THE INVENTION
[0002] The present invention is generally in the field of
transgenic plant systems for the production of polyhydroxyalkanoate
materials, modification of triglycerides and fatty acids, and
methods for altering seed production in plants.
[0003] Methods for producing stable transgenic plants for agronomic
crops have been developed over the last 15 years. Crops have been
genetically modified for improvements in both input and output
traits. In the former traits, tolerance to specific agrochemicals
has been engineered into crops, and specific natural pesticides,
such as the Bacillus thuringenesis toxin, have been expressed
directly in the plant. There also has been significant progress in
developing male sterility systems for the production of hybrid
plants. With respect to output traits, crops are being modified to
increase the value of the product, generally the seed, grain, or
fiber of the plant. Critical metabolic targets include the
modification of starch, fatty acid, and oil biosynthetic
pathways.
[0004] There is considerable commercial interest in producing
microbial polyhydroxyalkanoate (PHA) biopolymers in plant crops.
See, for example, U.S. Pat. Nos. 5,245,023 and 5,250,430 to Peoples
and Sinskey; U.S. Pat. No. 5,502,273 to Bright et al.; U.S. Pat.
No. 5,534,432 to Peoples and Sinskey; U.S. Pat. No. 5,602,321 to
John; U.S. Pat. No. 5,610,041 to Somerville et al.; PCT WO
91/00917; PCT WO 92/19747; PCT WO 93/02187; PCT WO 93/02194; PCT WO
94/12014; Poirier et al., Science 256:520-23 (1992); van der Leij
& Witholt, Can. J. Microbiol. 41(supplement):222-38 (1995);
Nawrath & Poirier, The International Symposium on Bacterial
Polyhydroxyalkanoates, (Eggink et al., eds.) Davos Switzerland
(Aug. 18-23, 1996); Williams and Peoples, CHEMTECH 26: 38-44
(1996), and the recent excellent review by Madison, L. and G.
Husiman, Microbiol. Mol. Biol. 21-53 (March 1999). PHAs are
natural, thermoplastic polyesters and can be processed by
traditional polymer techniques for use in an enormous variety of
applications, including consumer packaging, disposable diaper
linings and garbage bags, food and medical products.
[0005] Early studies on the production of polyhydroxybutyrate in
the chloroplasts of the experimental plant system Arabidopsis
thaliana resulted in the accumulation of up to 14% of the leaf dry
weight as PHB (Nawrath et al., 1993). Arabidopsis, however, has no
agronomic value. Moreover, in order to economically produce PHAs in
agronomic crops, it is desirable to produce the PHAs in the seeds,
so that the current infrastructure for harvesting and processing
seeds can be utilized. The options for recovery of the PHAs from
plant seeds (PCT WO 97/15681) and the end use applications
(Williams & Peoples, CHEMTECH 26:38-44 (1996)) are
significantly affected by the polymer composition. Therefore, it
would be advantageous to develop transgenic plant systems that
produce PHA polymers having a well-defined composition, as well as
produce PHA polymer in specific locations within the plants and/or
seeds.
[0006] Careful selection of the PHA biosynthetic enzymes on the
basis of their substrate specificity allows for the production of
PHA polymers of defined composition in transgenic systems (U.S.
Pat. Nos. 5,229,279; 5,245,023; 5,250,430; 5,480,794; 5,512,669;
5,534,432; 5,661,026; and 5,663,063).
[0007] In bacteria, each PHA group is produced by a specific
pathway. In the case of the short pendant group PHAs, three enzymes
are involved: .beta.-ketothiolase, acetoacetyl-CoA reductase, and
PHA synthase. The homopolymer PHB, for example, is produced by the
condensation of two molecules of acetyl-coenzyme A to give
acetoacetyl-coenzyme A. The latter then is reduced to the chiral
intermediate R-3-hydroxybutyryl-coenzyme A by the reductase, and
subsequently polymerized by the PHA synthase enzyme. The PHA
synthase notably has a relatively wide substrate specificity which
allows it to polymerize C3-C5 hydroxy acid monomers including both
4-hydroxy and 5-hydroxy acid units. This biosynthetic pathway is
found in a number of bacteria such as Alcaligenes eutrophus, A.
latus, Azotobacter vinlandii, and Zoogloea ramigera. Long pendant
group PHAs are produced for example by many different Pseudomonas
bacteria. Their biosynthesis involves the .beta.-oxidation of fatty
acids and fatty acid synthesis as routes to the
hydroxyacyl-coenzyme A monomeric units. The latter then are
converted by PHA synthases which have substrate specificities
favoring the larger C6-C14 monomeric units (Peoples & Sinskey,
1990).
[0008] In the case of the PHB-co-HX copolymers which usually are
produced from cells grown on fatty acids, a combination of these
routes can be responsible for the formation of the different
monomeric units. Indeed, analysis of the DNA locus encoding the PHA
synthase gene in Aeromonas caviae, which produces the copolymer
PHB-co-3-hydroxyhexanoate, was used to identify a gene encoding a
D-specific enoyl-CoA hydratase responsible for the production of
the D-.beta.-hydroxybutyryl-CoA and D-.beta.-hydroxyhexanoyl-CoA
units (Fukui & Doi, J. Bacteriol. 179:4821-30 (1997); Fukui et.
al., J. Bacteriol. 180:667-73 (1998)). Other sources of such
hydratase genes and enzymes include Alcaligenes, Pseudomonas, and
Rhodospirillum.
[0009] The enzymes PHA synthase, acetoacetyl-CoA reductase, and
.beta.-ketothiolase, which produce the short pendant group PHAs in
A. eutrophus, are coded by an operon comprising the phbC-phbA-phbB
genes; Peoples et al., 1987; Peoples & Sinskey, 1989). In the
Pseudomonas organisms, the PHA synthases responsible for production
of the long pendant group PHAs have been found to be encoded on the
pha locus, specifically by thephaA and phaC genes (U.S. Pat. Nos.
5,245,023 and 5,250,430; Huisman et. al., J. Biol. Chem.
266:2191-98 (1991)). Since these earlier studies, a range of PHA
biosynthetic genes have been isolated and characterized or
identified from genome sequencing projects. Known PHA biosynthetic
genes include: Aeronomas caviae (Fukui & Doi, 1997, J.
Bacteriol. 179:4821-30); Alcaligenes eutrophus (U.S. Pat. Nos.
5,245,023; 5,250,430; 5,512,669; and 5,661,026; Peoples &
Sinskey, J. Biol. Chem. 264:15298-03 (1989)); Acinetobacter
(Schembri et. al., FEMS Microbiol. Lett. 118:145-52 (1994));
Chromatium vinosum (Liebergesell & Steinbuchel, Eur. J.
Biochem. 209:135-50 (1992)); Methylobacterium extorquens (Valentin
& Steinbuchel, Appl. Microbiol. Biotechnol. 39:309-17 (1993));
Nocardia corallina (GENBANK Accession No. AF019964; Hall et. al.,
1998, Can. J. Microbiol. 44:687-69); Paracoccus denitrificans (Ueda
et al., J. Bacteriol. 178:774-79 (1996); Yabutani et. al., FEMS
Microbiol. Lett. 133:85-90 (1995)); Pseudomonas acidophila (Umeda
et. al., 1998, Applied Biochemistry and Biotechnology,
70-72:341-52); Pseudomonas sp. 61-3 (Matsusaki et al., 1998, J.
Bacteriol. 180:6459-67); Nocardia corallina; Pseudomonas aeruginosa
(Timm & Steinbuchel, Eur. J. Biochem. 209:15-30 (1992)); P.
oleovorans (U.S. Pat. Nos. 5,245,023 and 5,250,430; Huisman et.
al., J. Biol. Chem. 266(4):2191-98 (1991); Rhizobium etli (Cevallos
et. al., J. Bacteriol. 178:1646-54 (1996)); R. meliloti (Tombolini
et. al., Microbiology 141:2553-59 (1995)); Rhodococcus ruber
(Pieper-Furst & Steinbuchel, FEMS Microbiol. Lett. 75:73-79
(1992)); Rhodospirillum rubrum (Hustede et. al., FEMS Microbiol.
Lett 93:285-90 (1992)); Rhodobacter sphaeroides (Hustede et. al.,
FEMS Microbiol. Rev. 9:217-30 (1992); Biotechnol. Lett. 15:709-14
(1993); Synechocystis sp. (DNA Res. 3:109-36 (1996)); Thiocapsiae
violacea (Appl. Microbiol. Biotechnol. 38:493-501 (1993)) and
Zoogloea ramigera (Peoples et. al., J. Biol. Chem. 262:97-102
(1987); Peoples & Sinskey, Molecular Microbiology 3:349-57
(1989)). The availability of these genes or their published DNA
sequences should provide a range of options for producing PHAs.
[0010] PHA synthases suitable for producing PHB-co-HH copolymers
comprising from 1-99% HH monomers are encoded by the Rhodococcus
ruber, Rhodospirillum rubrum, Thiocapsiae violacea, and Aeromonas
caviae PHA synthase genes. PHA synthases useful for incorporating
3-hydroxyacids of 6-12 carbon atoms in addition to
R-3-hydroxybutyrate i.e. for producing biological polymers
equivalent to the chemically synthesized copolymers described in
PCT WO 95/20614, PCT WO 95/20615, and PCT WO 95/20621 have been
identified in a number of Pseudomonas and other bacteria
(Steinbuchel & Wiese, Appl. Microbiol Biotechnol. 37:691-97
(1992); Valentin et al., Appl. Microbiol. Biotechnol. 36:507-14
(1992); Valentin et al., Appl. Microbiol. Biotechnol. 40:710-16
(1994); Lee et al., AppL Microbiol. Biotechnol. 42:901-09 (1995);
Kato et al., Appl. Microbiol. Biotechnol. 45:363-70 (1996); Abe et
al., Int. J. Biol. Macromol. 16:115-19 (1994); Valentin et al.,
Appl. Microbiol. Biotechnol. 46:261-67 (1996)) and can readily be
isolated as described in U.S. Pat. Nos. 5,245,023 and 5,250,430.
The PHA synthase from P. oleovorans (U.S. Pat. Nos. 5,245,023 and
5,250,430; Huisman et. al., J. Biol. Chem. 266(4): 2191-98 (1991))
is suitable for producing the long pendant group PHAs. Plant genes
encoding .beta.-ketothiolase also have been identified (Vollack
& Bach, Plant Physiol. 111:1097-107 (1996)).
[0011] Despite this ability to modify monomer composition by
selection of the syntheses and substrates, it is desirable to
modify other features of polymer biosynthesis, such as fatty acid
metabolism.
[0012] It is therefore an object of the present invention to
provide a method and DNA constructs to introduce fatty acid
oxidation enzyme systems for manipulating the cellular metabolism
of plants.
[0013] It is another object of the present invention to provide
methods for enhancing the production of PHAs in plants, preferably
in the oilseeds thereof.
SUMMARY OF THE INVENTION
[0014] Methods and systems to modify fatty acid biosynthesis and
oxidation in plants to make new polymers are described. Two enzymes
are essential: a hydratase such as D-specific enoyl-CoA hydratase,
for example, the hydratase obtained from Aeromonas caviae, and a
.beta.-oxidation enzyme system. Some plants have a .beta.-oxidation
enzyme system which is sufficient to modify polymer synthesis when
the plants are engineered to express the hydratase. Tissue specific
and constitutive promoters were used to regulate and direct polymer
production. Fusion constructs enhance polymer production.
[0015] Examples demonstrate production of polymer by expression of
these enzymes in transgenic plants. Examples also demonstrate that
modifications in fatty acid biosynthesis can be used to alter plant
phenotypes, decreasing or eliminating seed production and
increasing green plant biomass, as well as producing PHAs. Use of
the phaseolin promoter can be used to induce male sterility. Tissue
specific promoters in fusion constructs were used to modify
production within regions of the seeds.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a schematic of fatty acid .beta.-oxidation routes
to produce polyhydroxyalkanoate monomers.
[0017] FIG. 2 is a schematic showing plasmid constructs pSBS2024
and pSBS2025.
[0018] FIGS. 3A and 3B are schematics showing plasmid constructs
pCGmf124 and pCGmf125.
[0019] FIGS. 4A and 4B are schematics showing plasmid constructs
pmf1249 and pmf1254.
[0020] FIGS. 5A and 5B are schematics showing plasmid constructs
pCGmf224 and pCGmf225.
[0021] FIGS. 6A and 6B are schematics showing plasmid constructs
pCGmf1P2S and pCGmf2P1S.
[0022] FIG. 7 is a schematic showing plasmid constructs pCGm1124,
pCGmf125,pCGMI5028, pCGmf224, pCGmf225, pCGMI5038, pCGmf1P2S,
pCGmf2P1S, pCGMI5006, pCGmf138, pCGmf1A2P, and pCGmf5034.
DETAILED DESCRIPTION OF THE INVENTION
[0023] Methods and DNA constructs for manipulating the cellular
metabolism of plants by introducing fatty acid oxidation enzyme
systems into the cytoplasm or plastids of developing oilseeds or
green tissue through the use of tissue specific and/or constitutive
promoters, are provided. Fatty acid oxidation systems typically
comprise several enzyme activities including a .beta.-ketothiolase
enzyme activity which utilizes a broad range of .beta.-ketoacyl-CoA
substrates.
[0024] It surprisingly was found that expression of at least one of
these transgenes from the bean phaseolin promoter results in male
sterility. Interestingly, these plants did not set seed, but
instead produced higher than normal levels of biomass (e.g., leafs,
stems, stalks). Therefore the methods and constructs described
herein also can be used to create male sterile plants, for example,
for hybrid production or to increase the production of biomass of
forage, such as alfalfa or tobacco. Plants generated using these
methods and DNA constructs are useful for producing
polyhydroxyalkanoate biopolymers or for producing novel oil
compositions.
[0025] The methods described herein include the subsequent
incorporation of additional transgenes, in particular encoding
additional enzymes involved in fatty acid oxidation or
polyhydroxyalkanoate biosynthesis. For polyhydroxyalkanoate
biosynthesis, the methods include the incorporation of transgenes
encoding enzymes, such as NADH and/or NADPH acetoacetyl-CoenzymeA
reductases, PHB synthases, PHA synthases, acetoacetyl-CoA thiolase,
hydroxyacyl-CoA epimerases, delta3-cis-delta2-trans enoyl-CoA
isomerases, acyl-CoA dehydrogenase, acyl-CoA oxidase and enoyl-CoA
hydratases by subsequent transformation of the transgenic plants
produced using the methods and DNA constructs described herein or
by traditional plant breeding methods.
[0026] I. Plant Expression Systems
[0027] In a preferred embodiment, the fatty acid oxidation
transgenes are expressed from a seed specific promoter, and the
proteins are expressed in the cytoplasm of the developing oilseed.
In an alternate preferred embodiment, fatty acid oxidation
transgenes are expressed from a seed specific promoter and the
expressed proteins are directed to the plastids using plastid
targeting signals. In another preferred embodiment, the fatty acid
oxidation transgenes are expressed directly from the plastid
chromosome where they have been integrated by homologous
recombination. The fatty acid oxidation transgenes may also be
expressed throughout the entire plant tissue from a constitutive
promoter. Combinations of tissue specific and constitutive
promoters with the individual genes encoding the enzymes can also
be varied to alter the amount and/or location of polymer
production. It is also useful to be able to control the expression
of these transgenes by using promoters that can be activated
following the application of an agrochemical or other active
ingredient to the crop in the field. Additional control of the
expression of these genes encompassed by the methods described
herein include the use of recombinase technologies for targeted
insertion of the transgenes into specific chromosomal sites in the
plant chromosome or to regulate the expression of the
transgenes.
[0028] The methods described herein involve a plant seed having a
genome including (a) a promoter operably linked to a first DNA
sequence and a 3'-untranslated region, wherein the first DNA
sequence encodes a fatty acid oxidation polypeptide and optionally
(b) a promoter operably linked to a second DNA sequence and a
3'-untranslated region, wherein the second DNA sequence encodes a
fatty acid oxidation polypeptide. Expression of the two transgenes
provides the plant with a functional fatty acid .beta.-oxidation
system having at least .beta.-ketothiolase, dehydrogenase and
hydratase activities in the cytoplasm or plastids other than
peroxisomes or glyoxisomes. The first and/or second DNA sequence
may be isolated from bacteria, yeast, fungi, algae, plants, or
animals. It is preferable that at least one of the DNA sequences
encodes a polypeptide with at least two, and preferably three,
enzyme activities.
[0029] Transformation Vectors
[0030] DNA constructs useful in the methods described herein
include transformation vectors capable of introducing transgenes
into plants. Several plant transformation vector options are
available, including those described in "Gene Transfer to Plants"
(Potrykus, et al., eds.) Springer-Verlag Berlin Heidelberg New York
(1995); "Transgenic Plants: A Production System for Industrial and
Pharmaceutical Proteins" (Owen, et al., eds.) John Wiley & Sons
Ltd. England (1996); and "Methods in Plant Molecular Biology: A
Laboratory Course Manual" (Maliga, et al. eds.) Cold Spring
Laboratory Press, New York (1995), which are incorporated herein by
reference. Plant transformation vectors generally include one or
more coding sequences of interest under the transcriptional control
of 5' and 3' regulatory sequences, including a promoter, a
transcription termination and/or polyadenylation signal, and a
selectable or screenable marker gene. The usual requirements for 5'
regulatory sequences include a promoter, a transcription
termination and/or a polyadenylation signal. For the expression of
two or more polypeptides from a single transcript, additional RNA
processing signals and ribozyme sequences can be engineered into
the construct (U.S. Pat. No. 5,519,164). This approach has the
advantage of locating multiple transgenes in a single locus, which
is advantageous in subsequent plant breeding efforts. An additional
approach is to use a vector to specifically transform the plant
plastid chromosome by homologous recombination (U.S. Pat. No.
5,545,818), in which case it is possible to take advantage of the
prokaryotic nature of the plastid genome and insert a number of
transgenes as an operon.
[0031] Promoters
[0032] A large number of plant promoters are known and result in
either constitutive, or environmentally or developmentally
regulated expression of the gene of interest. Plant promoters can
be selected to control the expression of the transgene in different
plant tissues or organelles for all of which methods are known to
those skilled in the art (Gasser & Fraley, Science 244:1293-99
(1989)). The 5' end of the transgene may be engineered to include
sequences encoding plastid or other subcellular organelle targeting
peptides linked in-frame with the transgene. Suitable constitutive
plant promoters include the cauliflower mosaic virus 35S promoter
(CaMV) and enhanced CaMV promoters (Odell et. al., Nature, 313: 810
(1985)), actin promoter (McElroy et al., Plant Cell 2:163-71
(1990)), AdhI promoter (Fromm et. al., Bio/Technology 8:833-39
(1990); Kyozuka et al., Mol. Gen. Genet. 228:40-48 (1991)),
ubiquitin promoters, the Figwort mosaic virus promoter, mannopine
synthase promoter, nopaline synthase promoter and octopine synthase
promoter. Useful regulatable promoter systems include spinach
nitrate-inducible promoter, heat shock promoters, small subunit of
ribulose biphosphate carboxylase promoters and chemically inducible
promoters (U.S. Pat. No. 5,364,780 to Hershey et al.).
[0033] In a preferred embodiment of the methods described herein,
the transgenes are expressed only in the developing seeds.
Promoters suitable for this purpose include the napin gene promoter
(U.S. Pat. Nos. 5,420,034 and 5,608,152), the acetyl-CoA
carboxylase promoter (U.S. Pat. Nos. 5,420,034 and 5,608,152), 2S
albumin promoter, seed storage protein promoter, phaseolin promoter
(Slightom et. al., Proc. Natl. Acad. Sci. USA 80:1897-1901 (1983)),
oleosin promoter (Plant et. al., Plant Mol. Biol. 25:193-205
(1994); Rowley et al., Biochim. Biophys. Acta. 1345:1-4 (1997);
U.S. Pat. No. 5,650,554; and PCT WO 93/20216), zein promoter,
glutelin promoter, starch synthase promoter, and starch branching
enzyme promoter.
[0034] The transformation of suitable agronomic plant hosts using
these vectors can be accomplished with a variety of methods and
plant tissues. Representative plants useful in the methods
disclosed herein include the Brassica family including napus,
rappa, sp. carinata andjuncea; maize; soybean; cottonseed;
sunflower; palm; coconut; safflower; peanut; mustards including
Sinapis alba; and flax. Crops harvested as biomass, such as silage
corn, alfalfa, or tobacco, also are useful with the methods
disclosed herein. Representative tissues for transformation using
these vectors include protoplasts, cells, callus tissue, leaf
discs, pollen, and meristems. Representative transformation
procedures include Agrobacterium-mediated transformation,
biolistics, microinjection, electroporation, polyethylene
glycol-mediated protoplast transformation, liposome-mediated
transformation, and silicon fiber-mediated transformation (U.S.
Pat. No. 5,464,765; "Gene Transfer to Plants" (Potrykus, et al.,
eds.) Springer-Verlag Berlin Heidelberg New York (1995);
"Transgenic Plants: A Production System for Industrial and
Pharmaceutical Proteins" (Owen, et al., eds.) John Wiley & Sons
Ltd. England (1996); and "Methods in Plant Molecular Biology: A
Laboratory Course Manual" (Maliga, et al. eds.) Cold Spring
Laboratory Press, New York (1995)).
[0035] II. Methods for Making and Screening for Transgenic
Plants
[0036] In order to generate transgenic plants using the constructs
described herein, the following procedures can be used to obtain a
transformed plant expressing the transgenes subsequent to
transformation: select the plant cells that have been transformed
on a selective medium; regenerate the plant cells that have been
transformed to produce differentiated plants; select transformed
plants expressing the transgene at such that the level of desired
polypeptide is obtained in the desired tissue and cellular
location.
[0037] For the specific crops useful for practicing the described
methods, transformation procedures have been established, as
described for example, in "Gene Transfer to Plants" (Potrykus, et
al., eds.) Springer-Verlag Berlin Heidelberg New York (1995);
"Transgenic Plants: A Production System for Industrial and
Pharmaceutical Proteins" (Owen, et al., eds.) John Wiley & Sons
Ltd. England (1996); and "Methods in Plant Molecular Biology: A
Laboratory Course Manual" (Maliga, et al. eds.) Cold Spring
Laboratory Press, New York (1995).
[0038] Brassica napus can be transformed as described, for example,
in U.S. Pat. Nos. 5,188,958 and 5,463,174. Other Brassica such as
rappa, carinata and juncea as well as Sinapis alba can be
transformed as described by Moloney et. al., Plant Cell Reports
8:238-42 (1989). Soybean can be transformed by a number of reported
procedures (U.S. Pat. Nos. 5,015,580; 5,015,944; 5,024,944;
5,322,783; 5,416,011; and 5,169,770). Several transformation
procedures have been reported for the production of transgenic
maize plants including pollen transformation (U.S. Pat. No.
5,629,183), silicon fiber-mediated transformation (U.S. Pat. No.
5,464,765), electroporation of protoplasts (U.S. Pat. Nos.
5,231,019; 5,472,869; and 5,384,253) gene gun (U.S. Pat. Nos.
5,538,877 and 5,538,880 and Agrobacterium-mediated transformation
(EP 0 604 662 Al; PCT WO 94/00977). The Agrobacterium-mediated
procedure is particularly preferred, since single integration
events of the transgene constructs are more readily obtained using
this procedure, which greatly facilitates subsequent plant
breeding. Cotton can be transformed by particle bombardment (U.S.
Pat. Nos. 5,004,863 and 5,159,135). Sunflower can be transformed
using a combination of particle bombardment and Agrobacterium
infection (EP 0 486 233 A2; U.S. Pat. No. 5,030,572). Flax can be
transformed by either particle bombardment or
Agrobacterium-mediated transformation. Recombinase technologies
include the cre-lox, FLP/FRT, and Gin systems. Methods for
utilizing these technologies are described for example in U.S. Pat.
No. 5,527,695 to Hodges et al.; Dale & Ow, Proc. Natl. Acad.
Sci. USA 88:10558-62 (1991); Medberry et. al., Nucleic Acids Res.
23:485-90 (1995).
[0039] Selectable Marker Genes
[0040] Selectable marker genes useful in practicing the methods
described herein include the neomycin phosphotransferase gene nptll
(U.S. Pat. Nos. 5,034,322 and 5,530,196), hygromycin resistance
gene (U.S. Pat. No. 5,668,298), bar gene encoding resistance to
phosphinothricin (U.S. Pat. No. 5,276,268). EP 0 530 129 Al
describes a positive selection system which enables the transformed
plants to outgrow the non-transformed lines by expressing a
transgene encoding an enzyme that activates an inactive compound
added to the growth media. Screenable marker genes useful in the
methods herein include the .beta.-glucuronidase gene (Jefferson et.
al., EMBO J. 6:3901-07 (1987); U.S. Pat. No. 5,268,463) and native
or modified green fluorescent protein gene (Cubitt et. al., Trends
Biochem Sci. 20:448-55 (1995); Pang et. al., Plant Physiol.
112:893-900 (1996)). Some of these markers have the added advantage
of introducing a trait, such as herbicide resistance, into the
plant of interest, thereby providing an additional agronomic value
on the input side.
[0041] In a preferred embodiment of the methods described herein,
more than one gene product is expressed in the plant. This
expression can be achieved via a number of different methods,
including (1) introducing the encoding DNAs in a single
transformation event where all necessary DNAs are on a single
vector; (2) introducing the encoding DNAs in a co-transfonnation
event where all necessary DNAs are on separate vectors but
introduced into plant cells simultaneously; (3) introducing the
encoding DNAs by independent transformation events successively
into the plant cells i.e. transformation of transgenic plant cells
expressing one or more of the encoding DNAs with additional DNA
constructs; and (4) transformation of each of the required DNA
constructs by separate transformation events, obtaining transgenic
plants expressing the individual proteins and using traditional
plant breeding methods to incorporate the entire pathway into a
single plant.
[0042] III. .beta.-Oxidation Enzyme Pathways
[0043] Production of PHAs in the cytosol of plants requires the
cytosolic localization of enzymes that are able to produce
R-3-hydroxyacyl CoA thioesters as substrates for PHA synthases.
Both eukaryotes and prokaryotes possess a .beta.-oxidation pathway
for fatty acid degradation that consists of a series of enzymes
that convert fatty acyl CoA thioesters to acetyl CoA. While these
pathways proceed via intermediate 3-hydroxyacyl CoA, the
stereochemistry of this intermediate varies among organisms. For
example, the .beta.-oxidation pathways of bacteria and the
peroxisomal pathway of higher eukaryotes degrade fatty acids to
acetyl CoA via S-3-hydroxyacyl CoA (Schultz, "Oxidation of Fatty
Acids" in Biochemistry ofLipids, Lipoproteins and Membranes (Vance
et al., eds.) pp. 101-06 (Elsevier, Amsterdam 1991)). In
Escherichia coli, an epimerase activity encoded by the
.beta.-oxidation multifunctional enzyme complex is capable of
converting S-3-hydroxyacyl CoA to R-3-hydroxyacyl CoA. Yeast
possesses a peroxisomal localized fatty acid degradation pathway
that proceeds via intermediate R-3-hydroxyacyl CoA (Hiltunen, et
al. J. Biol. Chem. 267: 6646-53 (1992); Filppula, et al. J Biol.
Chem. 270:27453-57 (1995)), such that no epimerase activity is
required to produce PHAs.
[0044] Plants, like other higher eukaryotes, possesses a
.beta.-oxidation pathway for fatty acid degradation localized
subcellularly in the peroxisomes (Gerhardt, "Catabolism of Fatty
Acids [.alpha. and .beta. Oxidation]" in Lipid Metabolism in Plants
(Moore, Jr., ed.) pp. 527-65 (CRC Press, Boca Raton, Fla. 1993)).
Production of PHAs in the cytosol of plants therefore necessitates
the cytosolic expression of a .beta.-oxidation pathway, for
conversion of fatty acids to R-3-hydroxyacyl CoA thioesters of the
correct chain length, as well as cytosolic expression of an
appropriate PHA synthase, to polymerize R-3-hydroxyacyl CoA to
polymer.
[0045] Fatty acids are synthesized as saturated acyl-ACP thioesters
in the plastids of plants (Hartwood, "Plant Lipid Metabolism" in
Plant Biochemistry (Dey et al., eds.) pp. 237-72 (Academic Press,
San Diego 1997)). Prior to export from the plastid into the
cytosol, the majority of fatty acids are desaturated via a .DELTA.9
desaturase. The pool of newly synthesized fatty acids in most
oilseed crops consists predominantly of oleic acid (cis
9-octadecenoic acid), stearic acid (octadecanoic acid), and
palmitic acid (hexadecanoic acid). However, some plants, such as
coconut and palm kernel, synthesize shorter chain fatty acids
(C8-14). The fatty acid is released from ACP via a thioesterase and
subsequently converted to an acyl-CoA thioester via an acyl CoA
synthetase located in the plastid membrane (Andrews, et al., "Fatty
acid and lipid biosynthesis and degradation" in Plant Physiology,
Biochemistry, and Molecular Biology (Dennis et al., eds.) pp.
345-46 (Longman Scientific & Technical, Essex, England 1990);
Harwood, "Plant Lipid Metabolism" in Plant Biochemistry (Dey et
al., eds) p. 246 (Academic Press, San Diego 1997)).
[0046] The cytosolic conversion of the pool of newly synthesized
acyl CoA thioesters via fatty acid degradation pathways and the
conversion of intermediates from these series of reactions to
R-3-hydroxyacyl-CoA substrates for PHA synthases can be achieved
via the enzyme reactions outlined in FIG. 1. The PHA synthase
substrates are C4-C16 R-3-hydroxyacyl CoAs. For saturated fatty
acyl CoAs, conversion to R-3-hydroxyacyl CoA thioesters using fatty
acids degradation pathways necessitates the following sequence of
reactions: conversion of the acyl CoA thioester to
trans-2-enoyl-CoA (reaction 1), hydration of trans-2-enoyl-CoA to
R-3-hyddroxy acyl CoA (reaction 2a, e.g. yeast system operates
through this route and the Aeromonas caviae D-specific hydratase
yields C4-C7 R-3-hydroxyacyl-CoAs), hydration of trans-2-enoyl-CoA
to S-3-hydroxy acyl CoA (reaction 2b), and epimerization of
S-3-hydroxyacyl CoA to R-3-hydroxyacyl CoA (reaction 5, e.g.
cucumber tetrafunctional protein, bacterial systems). If
3-hydroxyacyl CoA is not polymerized by PHA synthase forming PHA,
it can proceed through the remainder of the .beta.-oxidation
pathway as follows: oxidation of 3-hydroxyacyl CoA to form
.beta.-keto acyl CoA (reaction 3) followed by thiolysis in the
presence of CoA to yield acetyl CoA and a saturated acyl CoA
thioester shorter by two carbon units (reaction 4). The acyl CoA
thioester produced in reaction 4 is free to re-enter the
.beta.-oxidation pathway at reaction 1 and the acetyl-CoA produced
can be converted to R-3-hydroxyacyl CoA by the action of
.beta.-ketothiolase (reaction 7) and NADH or NADPH acetoacetyl-CoA
reductase (reaction 6). This latter route is useful for producing
R-3-hydroxybutyryl-CoA, R-3-hydroxyvaleryl-CoA and
R-3-hydroxyhexanoyl-CoA. The R-3-hydroxyacids of four to sixteen
carbon atoms produced by this series of enzymatic reactions can be
polymerized by PHA synthases expressed from a transgene, or
transgenes in the case of the two subunit synthase enzymes, into
PHA polymers.
[0047] For .DELTA.9 unsaturated fatty acyl CoAs, a variation of the
reaction sequences described is required. Three cycles of
.beta.-oxidation, as detailed in FIG. 1, will remove six carbon
units yielding an unsaturated acyl CoA thioester with a cis double
bond at position 3. Conversion of the cis double bond at position 3
to a trans double bond at position 2, catalyzed by
.DELTA..sup.3-cis-.DELTA..sup.2-t- rans-enoyl CoA isomerase will
allow the .beta.-oxidation reaction sequences outlined in FIG. 1 to
proceed. This enzyme activity is present on the microbial
.beta.-oxidation complexes and the plant tetrafunctional protein,
but not on the yeastfoxl.
[0048] Acyl CoA thioesters also can be degraded to a .beta.-keto
acyl CoA and converted to R-3-hydroxyacyl CoA via a NADH or NADPH
dependent reductase (reaction 6).
[0049] Multifunctional enzymes that encode S-specific hydratase,
S-specific dehydrogenase, .beta.-ketothiolase, epimerase and
.DELTA..sup.3-cis-.DELTA..sup.2-trans-enoyl CoA isomerase
activities have been found in bacteria such as Escherichia coli
(Spratt, et al., J Bacteriol. 158:535-42 (1984)) and Pseudomonas
fragi (Immure, et al., J. Biochem. 107:184-89 (1990)). The
multifunctional enzyme complexes consist of two copies of each of
two subunits such that catalytically active protein forms a
heterotetramer. The hydratase, dehydrogenase, epimerase, and
.DELTA..sup.3-cis-.DELTA..sup.2-trans-enoyl CoA isomerase
activities are located on one subunit, whereas the thiolase is
located on another subunit. The genes encoding the enzymes from
organisms such as E. coli (Spratt, et al., J. Bacteriol. 158:535-42
(1984); DiRusso, J. Bacteriol. 172:6459-68 (1990)) and P. fragi
(Sato, et al., J. Biochem. 111:8-15 (1992)) have been isolated and
sequenced and are suitable for practicing the methods described
herein. Furthermore, the E. coli enzyme system has been subjected
to site-directed mutagenesis analysis to identify amino acid
residues critical to the individual enzyme activities (He &
Yang, Biochemistry 35:9625-30 (1996); Yang et. al., Biochemistry
34:6641-47 (1995); He & Yang, Biochemistry 36:11044-49 (1997);
He et. al., Biochemistry 36:261-68 (1997); Yang & Elzinga, J.
Biol. Chem. 268:6588-92 (1993)). These mutant genes also could be
used in some embodiments of the methods described herein.
[0050] Mammals, such as rat, possess a trifunctional
.beta.-oxidation enzyme in their peroxisomes that contains
hydratase, dehydrogenase, and
.DELTA..sup.3-cis-.DELTA..sup.2-trans-enoyl CoA isomerase
activities. The trifunctional enzyme from rat liver has been
isolated and has been found to be monomeric with a molecular weight
of 78 kDa (Palosaari, et al., J Biol. Chem. 265:2446-49 (1990)).
Unlike the bacterial system, thiolase activity is not part of the
multienzyme protein (Schultz, "Oxidation of Fatty Acids" in
Biochemistry of Lipids, Lipoproteins and Membranes (Vance et al.,
eds) p. 95 (Elsevier, Amsterdam (1991)). Epimerization in rat
occurs by the combined activities of two distinct hydratases, one
which converts R-3-hydroxyacyl CoA to trans-2-enoyl CoA, and
another which converts trans-2-enoyl CoA to S-3-hydroxyacyl CoA
(Smeland, et al., Biochemical and Biophysical Research
Communications 160:988-92 (1989)). Mammals also possess
.beta.-oxidation pathways in their mitochondria that degrade fatty
acids to acetyl CoA via intermediate S-3-hydroxyacyl CoA (Schultz,
"Oxidation of Fatty Acids" in Biochemistry of Lipids, Lipoproteins
and Membranes (Vance et al., eds) p. 96 (Elsevier, Amsterdam
(1991)). Genes encoding mitochondrial .beta.-oxidation activities
have been isolated from several animals including a Rat
mitochondrial long chain acyl CoA hydratase/3-hydroxy acyl CoA
dehydrogenase (GENBANK Accession # D16478) and a Rat mitochondrial
thiolase (GENBANK Accession #s DI 3921, D005 11).
[0051] Yeast possesses a multifunctional enzyme, Fox2, that differs
from the .beta.-oxidation complexes of bacteria and higher
eukaryotes in that it proceeds via a R-3-hydroxyacyl CoA
intermediate instead of S-3-hydroxyacyl CoA (Hiltunen, et al., J
Biol. Chem. 267:6646-53 (1992)). Fox2 possesses R-specific
hydratase and R-specific dehydrogenase enzyme activities. This
enzyme does not possess the .DELTA..sup.3-cis-.DELTA..su-
p.2-trans-enoyl CoA isomerase activity needed for degradation of
.DELTA.9-cis-hydroxyacyl CoAs to form R-3-hydroxyacyl CoAs. The
gene encoding fox2 from yeast has been isolated and sequenced and
encodes a 900 amino acid protein. The DNA sequence of the
structural gene and amino acid sequence of the encoded polypeptide
is shown in SEQ ID NO:1 and SEQ ID NO:2.
[0052] Plants have a tetrafunctional protein similar to the yeast
Fox2, but also encoding a
.DELTA..sup.3-cis-.DELTA..sup.2-trans-enoyl CoA isomerase activity
(Muller et., al., J. Biol. Chem. 269:20475-81 (1994)). The DNA
sequence of the cDNA and amino acid sequence of the encoded
polypeptide is shown in SEQ ID NO:3 and SEQ ID NO:4.
[0053] IV. Targeting of Enzymes to the Cytoplasm of Oil Seed
Crops
[0054] Engineering PHA production in the cytoplasm of plants
requires directing the expression of .beta.-oxidation to the
cytosol of the plant. No targeting signals are present in the
bacterial systems, such as faoAB. In fungi, yeast, plants, and
mammals, .beta.-oxidation occurs in subcellular organelles.
Typically, the genes are expressed from the nuclear chromosome, and
the polypeptides synthesized in the cytoplasm are directed to these
organelles by the presence of specific amino acid sequences. To
practice the methods described herein using genes isolated from
eukaryotic sources, e.g., fatty acid oxidation enzymes from
eukaryotic sources, such as yeast, fungi, plants, and mammals, the
removal or modification of subcellular targeting signals is
required to direct the enzymes to the cytosol. It may be useful to
add signals for directing proteins to the endoplasmic reticulum.
Peptides useful in this process are well known in the art. The
general approach is to modify the transgene by inserting a DNA
sequence specifying an ER targeting peptide sequence to form a
chimeric gene.
[0055] Eukaryotic acyl CoA dehydrogenases, as well as other
mitrochondrial proteins, are targeted to the mitochondria via
leader peptides on the N-terminus of the protein that are usually
20-60 amino acids long (Horwich, Current Opinion in Cell Biology,
2:625-33 (1990)). Despite the lack of an obvious consensus sequence
for mitochondrial import leader peptides, mutagenesis of key
residues in the leader sequence have been demonstrated to prevent
the import of the mitochrondrial protein. For example, the import
of Saccharomyces cerevisiae F1 -ATPase was prevented by mutagenesis
of its leader sequence, resulting in the accumulation of the
modified precursor protein in the cytoplasm (Bedwell, et al., Mol.
Cell Biol. 9:1014-25 (1989))
[0056] Three eukaryotic peroxisomal targeting signals have been
reported (Gould, et al., J Cell Biol. 108:1657-64 (1989); Brickner,
et al., J. Plant Physiol. 113:1213-21 (1997)). The tripeptide
targeting signal S/A/C-K/H/1R-L occurs at the C-terminal end of
many peroxisomal proteins (Gould, et al., J. Cell Biol. 108:1657-64
(1989)). Mutagenesis of this sequence has been shown to prevent
import of proteins into peroxisomes. Some peroxisomal proteins do
not contain the tripeptide at the C-terminal end of the protein.
For these proteins, it has been suggested that targeting occurs via
the tripeptide in an internal position within the protein sequence
(Gould, et al., J Cell Biol. 108:1657-64 (1989)) or via an unknown,
unrelated sequence (Brickner, et al., J. Plant Physiol. 113:1213-21
(1997)). The results of in vitro peroxisomal targeting experiments
with fragments of acyl CoA oxidase from Candida tropicalis appear
to support the latter theory and suggest that there are two
separate targeting signals within the internal amino acid sequence
of the polypeptide (Small, et al., The EMBO Journal 7:1167-73
(1988)). In the aforementioned study, the targeting signals were
localized to two regions of 118 amino acids in length, and neither
of regions was found to contain the targeting signal S/A/C-K/H/R-L.
A small number of peroxisomal proteins appear to contain an amino
terminal leader sequence for import into peroxisomes (Brickner, et
al., J Plant Physiol. 113:1213-21 (1997)). These targeting signals
can be deleted or altered by site directed mutagenesis.
[0057] V. Cultivation and Harvesting of Transgenic Plant
[0058] The transgenic plants can be grown using standard
cultivation techniques. The plant or plant part also can be
harvested using standard equipment and methods. The PHAs can be
recovered from the plant or plant part using known techniques such
as solvent extraction in conjunction with traditional seed
processing technologies, as described in PCT WO 97/15681, or can be
used directly, for example, as animal feed, where it is unnecessary
to extract the PHA from the plant biomass.
[0059] Several lines which did not produce seed, produced much
higher levels of biomass. This phenotype therefore may be useful as
a means to increase the amount of green biomass produced per acre
for silage, forage, or other biomass crops. End uses include the
more cost effective production of forage crops for animal feed or
as energy crops for electric power generation. Other uses include
increasing biomass levels in crops, such as alfalfa or tobacco, for
subsequent recovery of industrial products, such as PHAs by
extraction.
[0060] The compositions and methods of preparation and use thereof
described herein are further described by the following
non-limiting examples.
EXAMPLE 1
[0061] Isolation and Characterization of the Pseudomonas putida
faoAB Genes and Fao Enzyme
[0062] All DNA manipulations, including PCR, DNA sequencing E. coli
transformation, and plasmids purification, were performed using
standard procedures, as described, for example, by Sambrook et.
al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, New York (1989)). The genes encoding faoAB from
Pseudomonas putida were isolated using a probe generated from P.
putida genomic DNA by PCR (polymerase chain reaction) using primers
1 and 2 possessing homology to faoB from Pseudomonas fragi (Sato,
et al., J. Biochem. 111:8-15 (1992)).
[0063] Primer 1:
1 Primer 1: 5' gat ggg ccg ctc caa ggg tgg 3' (SEQ ID NO:5) Primer
2: 5' caa ccc gaa ggt gcc gcc att 3' (SEQ ID NO:6)
[0064] A 1.1 kb DNA fragment was purified from the PCR reaction and
used as a probe to screen a P. putida genomic library constructed
in plasmid pBKCMV using the lambda ZAP expression system
(Stratagene). Plasmid pMFX1 was selected from the positive clones
and the DNA sequence of the insert containing thefaoAB genes and
flanking sequences determined. This is shown in SEQ ID NO:7. A
fragment containingfaoAB was subcloned with the native P. putida
ribosome binding site intact into the expression vector pTRCN
forming plasmid pMFX3 as follows. Plasmid pMFX1 was digested with
BsrG I. The resulting protruding ends were filled in with Klenow.
Digestion with Hind III yielded a 3.39 kb blunt ended/Hind III
fragment encoding FaoAB. The expression vector pTRCN was digested
with Sma I/Hind III and ligated with thefaoAB fragment forming the
7.57 kb plasmid pMFX3.
[0065] Enzymes in the FaoAB multienzyme complex were assayed as
follows. Hydratase activity was assayed by monitoring the
conversion of NAD to NADH using the coupling enzyme L-p-hydroxyacyl
CoA dehydrogenase as previously described, except that assays were
run in the presence of CoA (Filppula, et al., J. Biol. Chem.
270:27453-57 (1995)). Severe product inhibitation of the coupling
enzyme was observed in the absence of CoA. The assay contained (1
mL final volume) 60 .mu.M crotonyl CoA, 50 .mu.M Tris-CI, pH 9, 50
.mu.g bovine serum albumin per mL, 50 mM KCl, 1 mM NAD, 7 .mu.g
L-specific .beta.-hydroxyacyl CoA dehydrogenase from porcine heart
per mL, and 0.25 mM CoA. The assay was initiated with the addition
of FaoAB to the assay mixture. A control assay was perfonned
without substrate to determine the rate of consumption of NAD in
the absence of -the hydratase generated product, S-hydroxybutyryl
CoA. One unit of activity is defined as the consumption of one
.mu.Mol of NAD per min (.epsilon..sub.340=6220
M.sup.-1cm.sup.-1).
[0066] Hydroxyacyl CoA dehydrogenase was assayed in the reverse
direction with acetoacetyl CoA as the substrate by monitoring the
conversion of NADH to NAD at 340 nm (Binstock, et al., Methods in
Enzymology, 71:403 (1981)). The assay contained (1 mL final volume)
0.1 M KH.sub.2PO.sub.4, pH 7, 0.2 mg bovine serum albumin per mL,
0.1 mM NADH, and 33 .mu.M acetoacetyl CoA. The assay was initiated
with the addition of FaoAB to the assay mixture. When necessary,
enzyme samples were diluted in 0.1 M KH.sub.2PO.sub.4, pH 7,
containing 1 mg bovine serum albumin per mL. A control assay was
performed without substrate acetoacetyl CoA to detect the rate of
consumption of NADH in the crude due to enzymes other than
hydroxyacyl CoA dehydrogenase. One unit of activity is defined as
the consumption of one .mu.Mol of NADH per minute
(.epsilon..sub.340=6220 M.sup.-1cm.sup.-1).
[0067] HydroxyacylCoA dehydrogenase was assayed in the forward
direction with crotonyl CoA as a substrate by monitoring the
conversion of NAD to NADH at 340 nm (Binstock, et al., Methods in
Enzymology, 71:403 (1981)). The assay mixture contained (1 mL final
volume) 0.1 M KH.sub.2PO.sub.4, pH 8, 0.3 mg bovine serum albumin
per mL, 2 mM .beta.-mercaptoethanol, 0.25 mM CoA, 30 .mu.M crotonyl
CoA, and an aliquot of FaoAB. The reaction was preincubated for a
couple of minutes to allow in situ formation of S-hydroxybutyryl
CoA. The assay then was initiated by the addition of NAD (0.45 mM).
A control assay was performed without substrate to detect the rate
of consumption of NAD due to enzymes other than hydroxyacyl CoA
dehydrogenase. One unit of activity is defined as the consumption
of one .mu.Mol of NAD per minute (.epsilon..sub.340=6220
M.sup.-1cm.sup.-1).
[0068] Thiolase activity was determined by monitoring the decrease
in absorption at 304 nm due to consumption of substrate acetoacetyl
CoA as previously described with some modifications (Palmer, et
al., J. Biol. Chem. 266:1-7 (1991)). The assay contained (final
volume 1 mL) 62.4 mM Tris-Cl, pH 8.1, 4.8 mM MgCl.sub.2, 62.5 .mu.M
CoA, and 62.5 .mu.M acetoacetyl CoA. The assay was initiated with
the addition of FaoAB to the assay mixture. A control sample
without enzyme was performed for each assay to detect the rate of
substrate degradation of pH 8.1 in the absence of enzyme. One unit
of activity is defined as the consumption of one .mu.Mol of
substrate acetoacetyl CoA per minute (.epsilon..sub.340=16900
M.sup.-1cm.sup.-1).
[0069] Epimerase activity was assayed as previously described
(Binstock, et al., Methods in Enzymology, 71:403 (1981)) except
that R-3-hydroxyacyl CoA thioesters were utilized instead of
D,L-3-hydroxyacyl CoA mixtures. The assay contained (final volume 1
mL) 30 .mu.M R-3-hydroxyacyl CoA, 150 mM KH.sub.2PO.sub.4 (pH 8),
0.3 mg/mL BSA, 0.5 mM NAD, 0.1 mM CoA, and 7 .mu.g/mL L-specific
.beta.-hydroxyacyl CoA dehydrogenase from porcine heart. The assay
was initiated with the addition of FaoAB.
[0070] For expression of FaoAB in DH5.alpha./pMFX3, cultures were
grown in 2.times.TY medium at 30.degree. C. 2.times.TY medium
contains (per L) 16 g tryptone, 10 g yeast, and 5 g NaCl. A starter
culture was grown overnight and used to inoculate (1% inoculum)
fresh medium (100 mL in a 250 mL Erlenmeyer flask for small scale
growths; 1.5 L in a 2.8 L flask for large scale growths). Cells
were induced with 0.4 mM IPTG when the absorbance at 600 nm was in
the range of 0.4 to 0.6. Cells were cultured an additional 4 h
prior to harvest. Cells were lysed by sonication, and the insoluble
matter was removed from the soluble proteins by centrifugation.
Acyl CoA dehydrogenase activity was monitored in the reverse
direction to ensure activity of the FaoA subunit (SEQ ID NO:31) and
thiolase activity was assayed to determine activity of the Fao
subunit. FaoAB in DH5.alpha./pMFX3 contained dehydrogenase and
thiolase activity values of 4.3 and 0.99 U/mg, respectively, which
is significantly more than the 0.0074 and 0.0033 U/mg observed for
dehydrogenase and thiolase, respectively, in control strain
DH5.alpha./pTRCN.
[0071] FaoAB was purified from DH5.alpha./pMFX3 using a modified
procedure previously described for the purification of FaoAB from
Pseudoinonas fragi (Imamura, et al., J. Biochem. 107:184-89
(1990)). Thiolase activity (assayed in the forward direction) and
dehydrogenase activities (assayed in the reverse direction) were
monitored throughout the purification. Three liters of
DH5.alpha./pMFX3 cells (2.times.1.5 L aliquots in 2.8 L Erlenmeyer
flasks) were grown in 2.times.TY medium using the cell growth
procedure previously described for preparing cells for enzyme
activity analysis. Cells (15.8 g) were resuspended in 32 mL of 10
mM KH.sub.2PO.sub.4, pH 7, and lysed by sonication. Soluble
proteins were removed from insoluble cells debris by centrifugation
(18,000 RPM, 30 min., 4.degree. C.). The soluble extract was made
50% in acetone and the precipitated protein was isolated by
centrifugation and redissolved in 10 mM KH.sub.2PO4, pH 7. The
sample was adjusted to 33% saturation with (NH.sub.4).sub.2SO.sub.4
and the soluble and insoluble proteins were separated by
centrifugation. The resulting supernatant was adjusted to 56%
saturation with (NH.sub.4).sub.2SO.sub.4 and the insoluble pellet
was isolated by centrifugation and dissolved in 10 mM
KH.sub.2PO.sub.4, pH 7. The sample was heated at 50.degree. C. for
30 min. and the soluble proteins were isolated by centrifugation
and dialyzed in a 6,000 to 8,000 molecular weight cut off membrane
in 10 mM KH.sub.2PO.sub.4, pH 7 (2.times.3 L; 20 h). The sample was
loaded on a Toyo Jozo DEAE FPLC column (3 cm x 14 cm) that
previously had been equilibrated in 10 mM KH.sub.2PO.sub.4, pH 7.
The protein was eluted with a linear gradient (100 mL by 100 mL; 0
to 500 mM NaCl in 10 KH.sub.2PO.sub.4, pH 7) at a flow of 3 mL/min.
FaoAB eluted between 300 and 325 mM NaCl. The sample was dialyzed
in a 50,000 molecular weight cut off membrane in 10 mM
KH.sub.2PO.sub.4, pH 7 (1.times.2 L; 15h) prior to loading on a
macro-prep hydroxylapatite 18/30 (Biorad) FPLC column (2
cm.times.15 cm) that previously had been equilibrated in 10 mM
KH.sub.2PO.sub.4, pH 7. The protein was eluted with a linear
gradient (250 mL by 250 mL; 10 to 500 mM KH.sub.2PO.sub.4, pH 7) at
a flow rate of 3 mL/min. FaoAB eluted between 70 and 130 mM
KH.sub.2PO.sub.4. The fractions containing activity were
concentrated to 9 mL using a MILLIPORE.TM. 100,000 molecular weight
cutoff concentrator. The buffer was exchanged 3 times with 10 mM
KH.sub.2PO.sub.4, pH 7 containing 20% sucrose and frozen at
-70.degree. C. Enzyme activities of the hydroxylapatite purified
fraction were assayed with a range of substrates. The results are
shown in Table 1 below.
2TABLE 1 Enzyme Substrates and Activities Enzyme Substrate Activity
(U/mg) hydratase crotonyl CoA 8.8 dehydrogenase (forward) crotonyl
CoA 0.46 dehydrogenase (reverse) acetoacetyl CoA 29 thiolase
acetoacetyl CoA 9.9 epimerase R-3-hydroxyoctanyl CoA 0.022
epimerase R-3-hydroxyhexanyl CoA 0.0029 epimerase
R-3-hydroxybutyryl CoA 0.000022
EXAMPLE 2
[0072] Production of Antibodies to the FaoAB and FaoAB
Polypeptides
[0073] Following purification of the FaoAB protein as described in
Example 1, a sample was separated by SDS-PAGE. The protein band
corresponding to the FaoA (SEQ ID NO:31) and FaoB (SEQ ID NO:26)
was excised and used to immunize New Zealand white rabbits with
complete Freunds adjuvant. Boosts were performed using incomplete
Freunds at three week intervals. Antibodies were recovered from
serum by affinity chromatography on Protein A columns (Pharmacia)
and tested against the antigen by Western blotting procedures.
Control extracts of Brassica seeds were used to test for cross
reactivity to plant proteins. No cross reactivity was detected.
EXAMPLE 3
[0074] Construction of Plasmids for Expression of the Pseudomonas
putido fao AB Genes in Transgenic Oilseeds
[0075] Construction of pSBS2024
[0076] Oligonucleotide primers GVR471
3 GVR471 5'-CGGTACCCATTGTACTCCCAGTATCAT-3' and (SEQ ID NO:8) GVR472
5'-CATTTAAATAGTAGAGTATTGAATATG-3' (SEQ ID NO:9)
[0077] homologous to sequences flanking the 5' and 3' ends
(underlined), respectively, of the bean phaseolin promoter (SEQ ID
NO:10; Slightom et al., 1983) were designed with the addition of
Kpizl (in italics, nucleotides 1-7 in SEQ ID NO:8) and SwaI (in
italics, nucleotides 1-9 in SEQ ID NO:9) at the 5' ends of GVR471
and GVR472, respectively. These restriction sites were incorporated
to facilitate cloning. The primers were used to amplify a 1.4 kb
phaseolin promoter, which was cloned at the SmaI site in pUC19 by
blunt ended ligation. The designated plasmid, pCPPI (see FIG. 2)
was cut with SalI and SwaI and ligated to a SalI/SwaI phaseolin
terminator (SEQ ID NO:27). The bean phaseolin terminator sequence
encompassing the polyadenylation signals was amplified using the
following PCR primers: GVR396:
4 GVR396: (SEQ ID NO:22) 5'-GATTTAAATGCAAGCTTAAATAAGTATGAA-
CTAAAATGC-3' and GVR397: (SEQ ID NO.23)
5'-CGGTACCTTAGTTGGTAGGGTGCTA-3'
[0078] and the 1.2Kb fragment (SEQ ID NO:27) cloned into Sall-Sal
site of pCCP1 to obtain pSBS2024 (FIG. 2). The resulting plasmid
which contains a unique HindIII site for cloning was called
pSBS2024 (FIG. 2).
[0079] Construction of pSBS2025
[0080] A soybean oleosin promoter fragment (SEQ ID NO:11; Rowley et
al., 1997) was simplified with primers that flank the DNA
sequence.
[0081] Primer JA408
5 (SEQ ID NO:12) 5'-TCTAGATACATCCATTTCTTAATATAATCCTCTTATT- C-3'
[0082] contains sequences that are complementary to the 5' end
(underlined).
[0083] Primer np1
6 5'-CATTTAATCGTTAAGGTGAAGGTAGGGCT-3' (SEQ ID NO:13)
[0084] contains sequences homologous to the 3' end (underlined) of
the promoter fragment. The restriction sites Xbal (in italics) and
Swal (in italics) were incorporated at the 5' end of JA408 and np1,
respectively, to facilitate cloning. The primers were used to
amplify a 975 bp promoter fragment, which then was cloned into
Sniall site ofpUC19 (see FIG. 2). The resulting plasmid, pCSPI, was
cut with SalI and SwaI and ligated to the soybean terminator (SEQ
ID NO:28). The soybean oleosin terminator was amplified by PCR
using the following primers:
[0085] JA410:
7 (SEQ ID NO:29) 5'-AAGCTTACGTGATGAGTATTAATGTGTTGTTATG-3'
[0086] and
[0087] JA411:
8 (SEQ ID NO:30) 5'-TCTAGACAATTCATCAAATACAAATCACATTGCC-3'
[0088] and the 225 bp fragment cloned into the SalI-SwaI site of
pCSP1 to obtain plasmid pSBS2025 (FIG. 6). The designated plasmid,
pSBS2025, carried a unique HindIII site for cloning (FIG. 2).
[0089] Construction of Promoter-coding Sequence Fusions
[0090] Two oligonucleotide primers were synthesized:
[0091] np2
9 5'AAGCTTAAAATGATTTACGAAGGTAAAGCC-3' (SEQ ID NO:14)
[0092] homologous to nucleotides 553 to 573 of the 5' flanking
sequences, and
[0093] np3
10 5'ATTGCTTTCAGTTGAAGCGCTG-3' (SEQ ID NO:15)
[0094] complementary to nucleotides 2700 to 2683 flanking the 3'
end of mf1 (faoA, SEQ ID NO:24) of plasmid pmfx3. A HindIII (in
italics) site was introduced at the 5' end of primers np2 and np3
to facilitate cloning. In addition, a 3 bp AAA sequence (bold) was
incorporated to obtain a more favorable sequence surrounding the
plant translational initiation codon. Primers np2 and np3 were used
to amplify the fragment and cloned into SmaI site of pUC19. The
resulting plasmid was called pCmf1 (FIGS. 3A and 3B). Plasmid pBmf2
was constructed in a similar process (FIGS. 5A and 5B). In order to
generate a HindIII (in italics) at 5' and 3' ends of the mf2 (faoB)
gene (SEQ ID NO:25) for cloning, a second set of synthetic primers
were designed.
[0095] Primers np4
11 5'-AAGCTTAAAATGAGCCTGAATCCAAGAGAC-3' (SEQ ID NO:16)
[0096] complementary to 5' (nucleotides 2732-2752 bp) and np5
12 5'-AAGCTTTCAGACGCGTTCGAAGACAGTG-3' (SEQ ID NO:17)
[0097] homologous to 3' (nucleotides 3907-3886 bp) sequences of mf2
(faoB, SEQ ID NO:25) of plasmid pmfx3 were used in a PCR reaction
to amplify the 1.17 kb DNA fragment. The resulting PCR product was
cloned into the EcoR V site of pBluescript. The plasmid was
referred to as pBmf2.
[0098] Both plasmids were individually cut with HindIII and their
inserts cloned in plasmids pSBS2024 and pSBS2025, which had
previously been linearized with the same restriction enzyme. As a
result, the following plasmids were generated: pmf124 and pmf125
(FIGS. 3A and 3B) and pmf224 and pmf225 (FIGS. 5A and 5B)
containing the Fao genes (mf1 and mf2) fused to either the
phaseolin or soybean promoters. DNA sequence analysis confirmed the
correct promoter-coding sequence-termination sequence fusions for
pmf124, pmf125, pmf224, and pmf225.
EXAMPLE 4
[0099] Assembly of Promoter-coding Sequence Fusions into Plant
Transformation Vectors
[0100] After obtaining plasmids pmf124, pmf125, pmf224, and pmf225,
promoter-coding sequence fusions were independently cloned into the
binary vectors, pCGN1559 (McBride and Summerfelt, 1990) containing
the CaMV 35S promoter driving the expression of NPTII gene
(conferring resistance to the antibiotic kanamycin) and pSBS2004
containing a parsley ubiquitin promoter driving the PPT gene, which
confers resistance to the herbicide phosphinothricine. Binary
vectors suitable for this purpose with a variety of selectable
markers can be obtained from several sources.
[0101] The phaseolin-mf21 fusion cassette was released from the
parent plasmid with XbaI and ligated with pCGN1559, which had been
linearized with the same restriction enzyme. The resulting plasmid
was designated pCGmf124 (FIGS. 3A and 3B). Plasmid pCGmf125
containing the soybean-mf1 fusion was constructed in a similar way
(FIGS. 3A and 3B), except that both pmf125 and pCGN1559 were cut
with BamHI before ligation.
[0102] Construction of pmf1249 an pmf1254
[0103] The plasmid pSBS.sup.2004 was linearized with BamHI fragment
containing the soybean-mf1 fusion. This plasmid was designated
pmf1254 (FIGS. 4A and 4B). Similarly, the XbaI phaseolin-mfl fusion
fragment was ligated to pSBS2004 which had been linearized with the
same restriction enzyme. The resulting plasmid was designated
pmf1249 (FIGS. 4A and 4B).
[0104] Construction of pCGmf224 and pCGmf225
[0105] The phaseolin-mf2 and soybean-mf2 fusions were constructed
by excising the fusions from the vector by cutting with either
BamHI or XbaI, and cloned into pCGN1559 which had been linearized
with either restriction enzyme (FIGS. 5A and 5B).
[0106] Construction of pCGmf1P2S and pCGmf2P1S
[0107] The two expression cassettes containing the promoter-coding
sequence fusions were assembled on the same binary vector as
follows: Plasmid pmf124 containing the phaseolin-mf1 fusion was cut
with BamHI and cloned into the BamHI site ofpCGN1559 to create
pCGmfB124. This plasmid then was linearized with XbaI and ligated
to the XbaI fragment of pmf225 containing the soybean-mf2 fusion.
The final plasmid was designated pCGmf1P2S (FIGS. 6A and 6B).
Plasmid pCGmf2P1S was assembled in similar manner. The
phaseolin-mf2 fusion was released from pmf224 by cutting with BamHI
and cloned at the BamHI site ofpCGN1559. The resulting plasmid,
pCGmfB224, was linearized with XbaI and ligated to the XbaI
fragment of pmf125 containing the soybean-mf1 fusion (FIGS. 6A and
6B).
EXAMPLE 5
[0108] Transformation of Brassica
[0109] Brassica seeds were surface sterilized in 10% commercial
bleach (Javex, Colgate-Palmolive) for 30 min. with gentle shaking.
The seeds were washed three times in sterile distilled water. Seeds
were placed in germination medium comprising Murashige-Skoog (MS)
salts and vitamins, 3% (w/v) sucrose and 0.7% (w/v) phytagar, pH
5.8 at a density of 20 per plate and maintained at 24.degree. C.
and a 16 h light/8 h dark photoperiod at a light intensity of 60-80
.mu.m.sup.-2s.sup.-1 for four to five days.
[0110] Each of the constructs, pCGmf124, pCGmf125, pCGmf224,
pCGmf1P2S, and pCGmf2P1S were introduced into Agrobacterium
tumefacians strain EHA101 (Hood et al., J. Bacteriol. 168:1291-1301
(1986)) by electroporation. Prior to transformation of cotyledonary
petioles, single colonies of strain EHA101 harboring each construct
were grown in 5 ml of minimal medium supplemented with 100 mg
kanamycin per liter and 100 mg gentamycin per liter for 48 hr at
28.degree. C. One milliliter of bacterial suspension was pelletized
by centrifugation for 1 min in a microfuge. The pellet was
resuspended in 1 ml minimal medium.
[0111] For transformation, cotyledons were excised from 4 day old,
or in some cases 5 day old, seedlings, so that they included
approximately 2 mm of petiole at the base. Individual cotyledons
with the cut surface of their petioles were immersed in diluted
bacterial suspension for 1 s and immediately embedded to a depth of
approximately 2 mm in co-cultivation medium, MS medium with 3%
(w/v) sucrose and 0.7% phytagar and enriched with 20 .mu.M
benzyladenine. The inoculated cotyledons were plated at a density
of 10 per plate and incubated under the same growth conditions for
48 h. After co-cultivation, the cotyledons then were transferred to
regeneration medium comprising MS medium supplemented with 3%
sucrose, 20 .mu.M benzyladenine, 0.7% (w/v) phytagar, pH 5.8, 300
mg timentinin per liter, and 20 mg kanamycin sulfate per liter.
[0112] After two to three weeks, regenerant shoots obtained were
cut and maintained on "shoot elongation" medium (MS medium
containing, 3% sucrose, 300 mg timentin per liter, 0.7% (w/v)
phytagar, 300 mg timentinin per liter, and 20 mg kanamycin sulfate
per liter, pH 5.8) in Magenta jars. The elongated shoots were
transferred to "rooting" medium comprising MS medium, 3% sucrose, 2
mg indole butyric acid per liter, 0.7% phytagar, and 500 mg
carbenicillin per liter. After roots emerged, plantlets were
transferred to potting mix (Redi Earth, W.R. Grace and Co.). The
plants were maintained in a misting chamber (75% relative humidity)
under the same growth conditions. Two to three weeks after growth,
leaf samples were taken for neomycin phosphotransferase (NPTII)
assays (Moloney et al., Plant Cell Reports 8:238-42 (1989)).
[0113] Seeds from the FaoA and FaoB transgenic lines can be
analyzed for expression of the fatty acid oxidation polypeptides by
western blotting using the anti-FaoA and anti-FaoB antibodies. The
FaoB polypeptide (SEQ ID NO:26) is not functional in the absence of
the FaoA gene product; however, the FaoAB gene product has enzyme
activity.
[0114] Transgenic lines expressing the FaoA and FaoB complex are
obtained by crossing the FaoA and FaoB transgenic lines expressing
the individual polypeptides and seeds analyzed by western blotting
and enzymes assays as described.
EXAMPLE 6
[0115] Transformation of B. napus cv. Westar and Analysis of
Transgenic Lines
[0116] Transformation
[0117] The protocol used was adopted from a procedure described by
Moloney et al. (1989). Seeds of Brassica napus cv. Westar were
surface sterilized in 10% commercial bleach (Javex,
Colgate-Palmolive Canada Inc.) for 30 min with gentle shaking. The
seeds were washed three times in sterile distilled water. Seeds
were placed on germination medium comprising Murashige-Skoog (MS)
salts and vitamins, 3% sucrose and 0.7% phytagar, pH 5.8 at a
density of 20 per plate and maintained at 24.degree. C. in a 16 h
light/8 h dark photoperiod at a light intensity of 60-80
.mu.Em.sup.-2s.sup.-1 for four to five days.
[0118] Each of the constructs, pCGmf124, pCGmf125, pCGmf224,
pCGmf225, pCGmf1P2S, and pCGmf2P1S were introduced into
Agrobacterium tumefaciens strain EHA101 (Hood et al. 1986) by
electroporation. Prior to transformation of cotyledonary petioles,
single colonies of strain EHAIOI harboring each construct were
grown in 5 mL of minimal medium supplemented with 100 mg kanamycin
per liter, and 100 mg gentamycin per liter for 48 h at 28.degree.
C. One milliliter of bacterial suspension was pelletized by
centrifugation for 1 min in a microfuge. The pellet was resuspended
in 1 mL minimal medium.
[0119] For transformation, cotyledons were excised from
four-day-old, or in some cases five-day-old, seedlings so that they
included approximately 2 mm of petiole at the base. Individual
cotyledons with the cut surface of their petioles were immersed in
diluted bacterial suspension for 1 s and immediately embedded to a
depth of approximately 2 mm in co-cultivation medium, MS medium
with 3% sucrose and 0.7% phytagar, enriched with 20 .mu.M
benzyladenine. The inoculated cotyledons were plated at a density
of 10 per plate and incubated under the same growth conditions for
48 h. After co-cultivation, the cotyledons then were transferred to
regeneration medium, which comprised MS medium supplemented with 3%
sucrose, 20 .mu.M benzyladenine, 0.7% phytagar, pH 5.8, 300 mg
timentinin per liter, and 20 mg kanamycin sulfate per liter.
[0120] After two to three weeks, regenerant shoots were obtained,
cut, and maintained on "shoot elongation" medium (MS medium
containing 3% sucrose, 300mg timentin per liter, 0.7% phytagar, and
20 mg kanamycin per liter, pH 5.8) in Magenta jars. The elongated
shoots then were transferred to "rooting" medium, which comprised
MS medium, 3% sucrose, 2 mg indole butyric acid per liter, 0.7%
phytagar and 500 mg carbenicillin per liter. After roots emerged,
the plantlets were transferred to potting mix (Redi Earth, W.R.
Grace and Co. Canada Ltd.). The plants were maintained in a misting
chamber (75% RH) under the same growth conditions. Two to three
weeks after growth, leaf samples were taken for neomycin
phosphotransferase (NPT II) assays (Moloney et al. 1989). The
results are shown in Table 2 below. The data show the number of
plants that were confinned to be transformed.
13TABLE 2 NPT II Activity in Transformed Plants No. of plants No.
of NPTII NPTII confirmed Constructs plants assayed confirmed
transformed .sup.1pCGmf124 47 27 23 33 .sup.2pCGmf125 37 28 18 18
.sup.3pCGmf224 49 40 30 39 .sup.4pCGmf225 52 37 28 34
.sup.5pCGmf1P2S 27 27 21 21 .sup.6pCGmf2P1S .sup.1pCGmf124--bean
phaseolin regulatory sequences driving FaoA gene
.sup.2pCGmf125--soybean oleosin regulatory sequences driving FaoA
gene .sup.3pCGmf224--bean phaseolin regulatory sequences driving
FaoB gene .sup.4pCGmf225--soybean oleosin regulatory sequences
driving FaoB gene .sup.5pCGmf192S--bean phaseolin and soybean
oleosin regulatory sequences driving FaoA & FaoB genes,
respectively .sup.6pCGmf2P1S--bean phaseolin and soybean oleosin
regulatory sequences driving FaoB & FaoA genes,
respectively
[0121] The fate of the transforming DNA was investigated for
sixteen randomly selected transgenic lines. Southern DNA
hybridization analysis showed that the FaoA and/or FaoB were
integrated into the genomes of the transgenic lines tested.
[0122] Approximately 80% of the pmf124 transgenic plants in which
the FaoA gene is expressed from the strong bean phaseolin promoter
were observed to be male sterile. Clearly high level expression of
the FaoA gene from this promoter results in functional expression
of the FaoA gene product which impairs seed and/or pollen
development. This result was very unexpected, since it was not
anticipated that the plant cells would be capable of carrying out
the first step in the .beta.-oxidation pathway in the cytosol. This
result, however, provides additional applications for expressing
.beta.-oxidation genes in plants for male sterility for hybrid
production or to prevent the production of seed. It was also note
that in a side-by-side comparison with normal transgenic lines, the
pmf124 lines produced much higher levels of biomass, presumably due
to the elimination of seed development. This phenotype therefore
may be useful as a means to increase the amount of green biomass
produced per acre for silage, forage, or other biomass crops. Here,
the use of an inducible promoter system or recombinase technology
could be used to produce seed for planting. Seven of the sterile
plants were successfully cross-pollinated with pollen from pmf225
transgenic lines and set seeds.
[0123] Northern analysis on RNA from seeds from pmf224 lines
containing the phaseolin promoter-FaoB constructs showed a signal
indicative of the expected 1.2 kb transcript in all the samples
tested except the control. Northern analysis on RNA from seeds from
pmf125 lines containing the weak soybean oleolsin promoter-FaoA
constructs revealed a transcript of the expected size of 2.1 kb.
Western blotting on 300-500 .mu.g of protein from approximately 80%
of seeds of pmf125 plants where the FaoA gene is expressed from the
relatively weak soybean oleosin promoter were inconclusive,
although a weak signal was detected in one transgenic line.
[0124] Fatty Acid Analysis
[0125] Given the unexpected results indicating a strong metabolic
effect of expressing the FaoA gene from the strong bean phaseolin
promoter in seeds, the fatty acid profile of the seeds from
transgenic lines expressing the FaoA gene from the weak soybean
oleosin promoter was analyzed. Seeds expressing only the FaoA gene
or also expressing the FaoB gene from the bean phaseolin promoter
were examined. The analysis was carried out as described in Millar
et al., The Plant Cell 11:1889-902 (1998). Seed fatty acid methyl
esters (FAMES) were prepared by placing ten seeds of B. napus in 15
x 45-mm screw capped glass tubes and heating at 80.degree. C. in
0.75 mL of IN methanolic HCl reagent (Supelco, PA) and 10 .mu.L of
1 mg 17:0 methyl ester (internal standard) per mL overnight. After
cooling the samples, the FAMES were extracted with 0.3 mL hexane
and 0.5 mL 0.9% NaCl by vortexing vigorously. The samples were
allowed to stand to separate the phases, and 300 .mu.L of the
organic phase was drawn and analyzed on a Hewlett-Packard gas
chromatograph.
[0126] Fatty acid profile analysis indicated the presence of an
additional component or enhanced component in the lipid profile in
all of the transgenic plants expressing the FaoA gene SEQ ID NO:24
which was absent from the control plants. This result again proves
conclusively that the FaoA gene is being transcribed and translated
and that the FaoA polypeptide SEQ ID NO:27 is catalytically active.
This peak also was observed in eleven additional transgenic plants
harboring SoyP-FaoA, PhaP-FaoA-SoyP-FaoB, SoyP-FaoA-PhaP-FaoB genes
and a sterile (PhaP-FaoA) plant cross-pollinated with SoyP-FaoB.
These data clearly demonstrate functional expression of the FaoA
gene and that even the very low levels of expression are sufficient
to change the lipid profile of the seed. Adapting the methods
described herein, one of skill in the art can express these genes
at levels intermediate between that obtained with the phaseolin
promoter and the soybean oleosin promoter using other promoters
such as the Arabidopsis oleosin promoter, napin promoter, or
cruciferin promoter, and can use inducible promoter systems or
recombinase technologies to control when fatty acid oxidation
transgenes are expressed.
EXAMPLE 7
[0127] Yeast .beta.-oxidation Multi-functional Enzyme Complex
[0128] S. cerevisiae contains a .beta.-oxidation pathway that
proceeds via R-hydroxyacyl CoA rather than the S-3-hydroxyacyl CoA
observed in bacteria and higher eukaryotes. The fox2 gene from
yeast encodes a hydratase that produces R-3-hydroxyacyl CoA from
trans-2-enoyl-CoA and a dehydrogenase that utilizes
R-3-hydroxyacyl-CoA to produce .beta.-keto acyl CoAs.
[0129] The fox2 gene (sequence shown in SEQ ID NO:1) was isolated
from S. cerevisiae genomic DNA by PCR in two pieces. Primers
N-fox2b and N-bamfox2b were utilized to PCR a 1.1 kb SmaI/BamHI
fragment encoding the N-terminal region of Fox2, and primers C-fox2
and C-bamfox2 were utilized to PCR a 1.6 kb BamHI/XbaI fragment
encoding the C-terminal Fox2 region. The full fox2 gene was
reconstructed via subcloning in vector pTRCN.
14 N-fox2b fox2 tcc ccc ggg agg agg ttt tta tta tgc ctg gaa att tat
cct tca aag ata gag tt (SEQ ID NO:18) N-bamfox2b fox2
aaggatccttgatgtcatttacaactacc (SEQ ID NO:19) C-fox2 fox2 gct cta
gat agg gaa aga tgt atg taa g (SEQ ID NO:20) C-bamfox2 fox2
tgacatcaaggatcctttt (SEQ ID NO:21)
[0130] The fox1 gene, however, does not possess a
.beta.-ketothiolase activity and this activity must be supplied by
a second transgene. Representative sources of such a gene include
algae, bacteria, yeast, plants, and mammals. The bacterium
Alcaligenes eutrophus possesses a broad specificity
.beta.-ketothiolase gene suitable for use in the methods described
herein. It can be readily isolated using the acetoacetyl-CoA
thiolase gene as a hybridization probe, as described in U.S. Pat.
No. 5,661,026 to Peoples et al. This enzyme also has been purified
(Haywood et al., FEMS Micro. Lett. 52:91 (1988)), and the purified
enzyme is useful for preparing antibodies or determining protein
sequence information as a basis for the isolation of the gene.
EXAMPLE 8
[0131] Plant .beta.-Oxidation Gene
[0132] The DNA sequence of the cDNA encoding .beta.-oxidation
tetrafunctional protein, shown in SEQ ID NO:4, can be isolated as
described in Preisig-Muller et al., J. Biol. Chem. 269:20475-81
(1994). The equivalent gene can be isolated from other plant
species including Arabidopsis, Brassica, soybean, sunflower, and
corn using similar procedures or by screening genomic libraries,
many of which are commercially available, for example from Clontech
Laboratories Inc., Palo Alto, Calif., USA. A peroxisomal targeting
sequence P-R-M was identified at the carboxy terminus of the
protein. Constructs suitable for expressing in the plant cytosol
can be prepared by PCR amplification of this gene using primers
designed to delete this sequence.
EXAMPLE 9
[0133] Expression of PHA Biosynthetic Pathways in Seeds of Brassica
napus.
[0134] Synthesis of PHAs via .beta.-oxidation requires a reductase
for the reduction of acetoacetyl-CoA and a PHA synthase for
subsequent polymerization of the resulting hydroxyacyl-CoA
molecules. To express FaoA, FaoB, reductase and synthase in plants,
the promoters from bean phaseolin (pha), soybean oleosin (soy) and
Arabidopsis oleosin (Ara) were used to express the bacterial genes
in a seed-specific manner. In addition, a constitutive parsley
ubiquitin (ubiq) regulatory sequence was used to express the
synthase gene.
[0135] Seed-Specific-FaoA and FaoB Constructs
[0136] For seed-specific expression of the bacterial FaoA, FaoB,
reductase and synthase genes, and constitutive expression of the
synthase gene, plant promoter-terminator cassettes were
constructed. All the expression cassettes were constructed in
pBluescript before subcloning in Agrobacterium-based plant
transformation vector.
[0137] The Pseudomonas putida FaoA and FaoB genes were amplified
from plasmid pMFX3, cloned into pUC19 and pBluescript respectively,
and sequenced. Functional assays using the amplified FaoA (mf1)
gene performed at Metabolix Inc. found the PCR fragment to contain
coding sequence which specifies biological activities for
hydratase, dehydrogenase and thiolase. The FaoA (mf1) and FaoB
(mf2) PCR fragments were inserted into an expression cassette
containing phaseolin (pSBS2024), soybean oleosin (pSBS2025) or
Arabidopsis oleosin (pSBS2038) regulatory sequences shown. 1
[0138] The seed-specific expression cassettes containing either the
FaoA or FaoB genes were inserted into the plant transformation
vectors pCGN1559 (see FIG. 7) and pSBS2004. pCGN1559 contains CaMV
35S promoter driving expression of the nptll gene (which confers
resistance to the antibiotic, kanamycin) while pSBS2004 contains a
parsley ubiquitin promoter driving the PAT gene which confers
resistance to phosphinothricine. Plasmids, pCGmf1P2S, pCGmf2P1S and
PCGmf1A2P contain both FaoA and FaoB in the same binary vector (see
FIG. 7).
[0139] Seed-Specific Arabidopsis-Reductase Construct
[0140] A plasmid pTRCN c.v. phaB was used as a template in an
amplification reaction to obtain a 790 bp fragment encoding the
acetoacyl CoA reductase from Chromatium vinosum. The PCR fragment
was cloned into pBluescript and sequence analysis confirmed
identity to the original bacterial gene. The consumption of NADH
measured at 340 nm in the presence of acetoacetyl CoA showed that
the activity of the gene product of the amplified fragment
pTRCNRBSH-Rd108 gave similar activity, within the error of the
assay, as the starting construct pTRCN c.v. phaB. The reductase
fragment was cloned into pSBS2038 under the control of the
Arabidopsis oleosin promoter to obtain plasmid pM15006 shown below.
2
[0141] The seed-specific cassette for the expression of the
reductase gene was cloned into the binary vector pCGN1559 to create
plasmid pCGMI5006 for transformation into B. napus (see FIG.
7).
15 Construct name Activity (U/mg) pTRCNRBSH-Rd108 3.79 +/- 0.29
pTRCN C.v. phaB 3.40 +/- 0.46 pTRCNRBSH 0.19 +/- 0.01
[0142] Seed-Specific and Constitutive Synthase Constructs
[0143] Similarly, the plasmid PMSXPB4C5Cat containing a fragment
encoding a hybrid Pseudomonas oleovorans/Zoogloea ramigera synthase
was used as a template to amplify a 1.79 kb fragment. The PCR
fragment was cloned into pUC19 and sequenced. Functional analysis
was performed at Metabolix Inc. by transforming the amplified
fragment into an E. coli strain already expressing reductase and
thiolase genes. This was grown in LB/glucose medium and was shown
to make PHA. GC analysis of the whole E. coli cell pellet showed
the presence of PHA whereas a control strain without the amplified
fragment did not. The amplified fragment was inserted into the
seed-specific promoter-terminator cassette pSBS2038 resulting in
plasmid pMI5038 as shown. 3
[0144] For the expression of the synthase gene in a constitutive
manner, the amplified fragment was cloned into the plasmid pSBS2028
containing the parsley ubiquitin promoter-terninator regulatory
sequences also shown above. The Arabidopsis oleosin
promoter-synthase and ubiquitin promoter-synthase genes were
subsequently cloned into the binary vector pCGN1559 to generate
plasmids pCGM15038 and pCGMI5028 respectively (see FIG. 7) for
transformation. Plasmid pM15034 contains both synthase and
reductase coding sequences under the regulatory control of
ubiquitin and oleosin promoters respectively.
[0145] FaoA Fusion to GUS Reporter Construct
[0146] To demonstrate that the FaoA and FaoB genes are transcribed
and translated in a plant, a translational fusion with the E. coli
betaglucuronidase (GUS) gene was made. The full length amplified
FaoA (mf1) gene was fused in frame to GUS and the resulting
fragment was inserted into the expression cassette pSBS2038 which
contained the Arabidopsis oleosin regulatory sequences. 4
[0147] The final plasmid pGUSmf138 was used in biolistics
experiments. To establish whether the FaoA gene would accumulate as
a fusion protein in plants, the chimaeric Arabidopsis-FaoA fragment
was cloned into the binary vector pCGN1559 and the resulting
plasmid, pCGmfG138 was used to transform Brassica napus.
[0148] Plant Transformation
[0149] Agrobacterium-based binary vectors were used to transform
cotyledons of 4 to 5 day old seedlings of Brassica napus cv.
Westar. Table 3 below shows the various constructs used for
transformation and the number of transformed plants generated. Each
construct comprises a particular plant regulatory sequence and the
bacterial coding sequences within the binary vector pCGN1559. The
number of transforned plants are indicated. Maps of the various
constructs are also indicated in FIG. 7. Surviving transgenic
plants of pha-FaoA were all sterile and unable to set seeds. Six
out of sixteen transgenic plants from the pha-FaoA/soy-FaoB
construct and two of soy-FaoA/pha-FaoB plants were also
sterile.
16TABLE 3 Transformation Constructs & Number of Transformed
Plants Description Number of Construct name (promoter-bacterial
gene) transformed plants pCGmf124 pha-FaoA 33 pCGmf125 soy-FaoA 18
pCGmf138 Ara-FaoA 6 pCGmf224 pha-FaoB 39 pCGmf225 soy-FaoB 34
pCGmf1P2S pha-FaoA-soy-FaoB 16 pCGmf2P1S soy-FaoA-pha-FaoB 9
pCGmf1A2P Ara-FaoA-pha-FaoB 9 PCGmfG138 Ara-FaoA-GUS 5 PCGMI5006
Ara-Red 10 PCGMI5028 ubiq-Syn 10 PCGMI5038 Ara-Syn 6 PCGMI5034
ubiq-Syn-Ara-Red 2 Promoters: Arabidopsis oleosin (Ara); Soybean
oleosin (soy); Phaseolin (pha); and Ubiquitin (ubiq); Genes: FaoA
and FaoB encode bacterial fatty acid .beta.-oxidation
multifunctional complex Red and Syn encode reductase and synthase
respectively
EXAMPLE 10
[0150] Analysis of Transgenic Plants
[0151] All the transgenic plants showed nonnal development except
pha-FaoA plants which were found to exhibit morphological changes.
The plants were sterile and therefore unable to set seed. They
showed vigorous growth and produced more biomass. Characterization
of the transforming DNA by Southern blot showed that the FaoA gene
had stably integrated into plant genome. Transient expression
studies using a GUS reporter gene fused to FaoA demonstrated that
the FaoA gene can be transcribed and translated in plants.
Coexpression of both FaoA and FaoB in embryos also suggests the
formation of a more stable complex. This is supported by transient
expression studies where GUS activity in a GUS-FaoA fusion
increased more than two fold when FaoB is coexpressed. Expression
of FaoB was evident by the presence of the transcript and
polypeptide in transgenic plants. The expression of FaoA in plants
was further demonstrated by the detection of the transcript and
polypeptide in plants transformed with a construct containing the
Arabidopsis oleosin promoter regulating the FaoA gene. Changes in
fatty acid profiles of total seed lipid content in addition to an
alteration in morphology is evidence of functional expression of
FaoA in transgenic plants. Northern and Western blot analysis also
demonstrated transcription and translation of the reductase and
synthase genes in transgenic plants.
[0152] Morphological Changes in FaoA- and FaoB-Expressing
Plants
[0153] Expression of the FaoA transgene under the control of the
phaseolin promoter caused unexpected morphological changes in the
transgenic plants. The plants developed normally until flowering
where the FaoA-expressing plants were found to be male sterile.
This suggests that the phaseolin promoter regulating the FaoA gene
was active during male gametogenesis. It has been demonstrated that
phaseolin promoter is active during microsporogenesis in transgenic
tobacco (van der Geest, et al., Plant Physiol. 109:1151-58 (1995)).
The plants visibly showed vigorous growth with a bushy appearance
and produced more biomass when compared with plants transformed
with either the binary vector alone (pCGN1559 control) or
containing soy-FaoA, pha-FaoB or soy-FaoB constructs. This altered
morphology is presumably caused by reduced fertility as these
plants were unable to set seed. It should be noted that seven of
the male sterile plants were successfully crossed with pollen from
soy-FaoB transgenic plants. It is likely that the functional
over-expression of the FaoA gene product has caused an alteration
in a fundamental process required for the normal development of the
plant. Transgenic plants carrying the pha-FaoA/soy-FaoB and
soy-FaoA/pha-FaoB constructs on the other hand showed normal
growth. It is therefore hypothesized that the accumulation of
detrimental substrates resulting from the overexpression of
functional FaoA may be converted to benign metabolites when active
FaoB protein is present.
[0154] Analysis of the Transgene in the Plant Genome
[0155] Successful gene transfer was confirmed by Southern blot
analysis of total genomic isolated from leaves of the transgenic
plants that had been digested with Pvu II restriction enzyme. The
enzyme cuts once within the FaoA gene, the nptII gene and outside
of the promoter sequence. Hybridization analysis using a
radiolabelled FaoAB gene probe demonstrated the stable integration
of the FaoA gene. In transgenicpha-FaoA plants (No. 15 and 44), the
probe hybridized to the unexpected 2.4 and 2.8 kb fragments. The
DNA containing soy-FaoA fragment in transgenic plants 69, 76, and
85 also appears to have inserted stably, generating 1.4 and 2.2 kb
fragments. The hybridization pattern observed in plant number 82
seems to indicate that in this transformant, the DNA had integrated
into more than one site. In transgenic plant 67, there appears to
have been a rearrangement of the inserting DNA. Hybridization
analysis of transgenic pha-FaoB plants (111 and 121) also showed
stable integration of the sequence. The autoradiogram shows
hybridization of the 32p_ labelled FaoAB gene probe to the expected
2.1 and 2.3 kb fragments. In transgenic plants that harbor both
FaoA and FaoB genes under the control of phaseolin and soybean
regulatory sequences, three hybridizing fragments (0.9, 2.8, and
3.9 kb forpha-FaoA/soy-FaoB, and 2.1, 2.2, and 3.2 kb
forsoy-FaoA/pha-FaoB plants) were expected with the probe. The
hybridizing bands in transgenic plant numbers 202
(pha-FaoA/soy/FaoB) and 252 (soy-FaoA/pha-FaoB) correctly indicated
the expected DNA size fragments. The probe shows some nonspecific
hybridization at the stringency used, as some hybridization is also
seen in the control (plant transformed with pCGN1559).
[0156] Analysis of MRNA and Protein Accumulation
[0157] Developing transgenic seeds were harvested at various stages
and analyzed for the expression of the bacterial FaoA and FaoB
genes using Northern and Western analysis. Northern blot analysis
was performed on 30 .mu.g of total seed RNA using radiolabelled DNA
fragments representing the coding sequence of the bacterial genes.
For immunodetection, extracts of total seed protein were
size-fractionated on 10-12% polyacrylamide-SDS gels and transferred
to PVDF membrane. Antibodies raised in rabbits against the
bacterial FaoA or FaoB protein, and goat anti-rabbit IgG conjugated
to horseradish peroxidase were used to visualize the related
polypeptides using chemiluminescence ECL immunodetection.
[0158] Northern and Western blot analysis were performed on seed
extracts from soy-FaoA transgenic plants which showed normal
growth. A weak signal of the related transcript was detected in one
of four transgenic plants analyzed. The presence of the encoded
polypeptide was tested by Western immunoblot analysis. In the
transgenic plants analyzed, the anti-FaoA antibody did not detect
the polypeptide. The presence of mRNA transcript from seeds of
pha-FaoB (Plant No. 101, 102, 103, 111, and 121) was also analyzed
by Northern hybridization. An oleosin probe was used as an internal
standard to hybridize to the blot before it was partially stripped
and reprobed with the radiolabelled FaoAB gene fragment.
Hybridizing transcripts of expected size were detected in five
transgenic plants and absent from control plant as well as
FaoA-expressing (No. 22 and 77) plants. Immunoblot analysis of
FaoB-related polypeptide in plants showed that in the crude protein
extract of a mf111 plant, the anti-FaoB antibody cross-reacted with
a polypeptide of approximately 43 kD similar in molecular weight to
the FaoB standard. The extra non-specific hybridizing band in all
samples may represent seed oilbody protein. No polypeptide was
detected in one-fifth of plants analyzed from the same transgenic
line. In addition, the anti-FaoB antibody did not bind to related
polypeptide in samples tested from the soy-FaoB plants. It is
likely that the related-FaoB polypeptide is unable to accumulate as
the protein is normally stabilized in vivo by the presence of the
FaoA protein as demonstrated in bacterial systems. In some
transgenic seeds of soy-FaoA/pha-FaoB analyzed, hybridizing
transcripts were detected for FaoB but not FaoA. However, the
related polypeptide could not be detected by Western blot
analysis.
[0159] GC Analysis
[0160] Although the expression of the soy-FaoA fragment could not
be detected by Northern and Western blot analysis, the
morphological alteration of transgenic plants resulting from
pha-FaoA expression was indirect evidence for the functional
expression of an FaoA gene product. Since FaoA is a key component
in oxidation of fatty acids, a profile of total seed lipid from
soy-FaoA and control transgenic plants was analyzed. Fatty acid
methyl esters were prepared according to Kunst, et al., "Fatty acid
elongation in developing seeds of Arabidopsis thaliana." Plant
Physiol. Biochem. 30:425-34 (1992) and analyzed by gas
chromatography. The chromatogram shows an enhanced peak of a low
molecular weight fatty acid (arrowed) which was absent in the
control transgenic plant. This enhanced peak was also observed in a
plant transformed with the pha-FaoA/soy-FaoB construct. The same
peak was observed in eleven other transgenic plants including a
male-sterile phas-FaoA plant fertilized with pollen from soy-FaoA
plant. The results support the conclusion that the FaoA polypeptide
is functional and perturbs an essential metabolic process. A GC-MS
analysis identified the peak as pentanoic acid which would be an
unusual cleavage product of a functional FaoA.
[0161] Transient Assay of Expression of the FaoA and FaoB Genes in
Embryos
[0162] It is clear from the analysis presented that the pha-FaoB
transcript accumulates and is translated into its polypeptide.
However, in an effort to demonstrate unequivocally that FaoA is
indeed transcribed and translated, a translational fusion with GUS
at the C-terminus was made. The hypothesis was that if the reporter
enzyme GUS accumulates, then the FaoA gene must have been
transcribed and translated. From the literature, it is known that
FaoA and FaoB can interact to form a stable complex in bacterial
systems (Imamura, et al., "Purification of the multienzyme complex
for fatty acid oxidation from Pseudomonas fragi and reconstitution
of the fatty acid oxidation system" J. Biochem. 107:184-89 (1990)).
In order to test this hypothesis in plants, both FaoA and FaoB were
expressed simultaneously in a transient manner. An Ara-FaoA-GUS
construct was used in this study in addition to the pha-FaoB
construct. The oilseed embryos used in this study were from
Brassica napus L. cv Topas and Linum usitatissimum (flax) cv.
MacGregor. Microspore embryos were obtained from B. napus while
zygotic embryos were isolated from flax. Particle bombardment of
embryos was essentially as described in Abenes, et al., "Transient
expression and oil body targeting of an Arabidopsis oleosin-GUS
reporter fusion protein in a range of oilseed embryos" Plant Cell
Reports 17:1-7 (1997). Tables 4 and 5 show GUS fluorimetric
activities in the different fractions of embryo extracts. The GUS
activity of Ara-GUS (pGN1.1) in microspore-derived embryos was at
least eight times the background (pSBS2105) while the activity of
Ara-FaoA-GUS (pmfG138) was more than double the background activity
(Table 4). When embryos were co-bombarded with pmfG138
(Ara-FaoA-GUS) and pmf224 (pha-FaoB) DNA in equal amounts, the
specific activity of GUS was observed to be more than three times
that of background activity. A comparison of the Ara-FaoA-GUS
activity to Ara-FaoA-GUS.pha-FaoB showed that the latter value was
almost double the former value when the background specific
activity was subtracted. It appears that the co-expression of both
FaoA and FaoB contributed to the increase in activity. This result
was further confirmed when zygotic embryos were bombarded with the
set of plasmids described in Table 4 using microspore embryos. The
data describes not only the use of microspore and zygotic embryos
to express FaoA and FaoB genes, but also stresses the importance of
the expression of these genes in different plant species.
17TABLE 4 GUS activity levels in total homogenate of microspore
embryos from Brassica napus L. Cv. Topas. Construct GUS activity
Specific activity name Description (pmol MU/min) (activity/mg prt)
pSBS2105 pBluescript- 30.5 7.78 based plasmid pGN1.1 Ara-GUS 256.5
53.1 pmfG138 Ara-FaoA-GUS 69 17.7 pmfG138: Ara-FaoA-GUS: 85 29.1
pmf224 pha-FaoB The promoter used to regulate the expression of GUS
and FaoA-Gus was from the Arabidopsis (Ara) oleosin gene. The
phaseolin (pha) promoter was used to regulate FaoB expression.
[0163] Table 5 shows the levels of GUS activity in oilbody and
supernatant (OS) and supernatant (SN) fractions. The recorded
activity in the OS fraction was double the activity in SN fraction.
It appears that some amount of GUS is also associated with
oilbodies. This is most likely due to the hydrophobic nature of GUS
and not the FaoA or FaoB protein. In both fractions, there was an
increase in GUS activity when the Ara-FaoA-GUS and pha-FaoB
fragments were co-expressed in a ratio of 1:1 over the
Ara-FaoA-GUS. The activity increases further when the ratio of
plasmid pmfG138:pmf224 DNA used was 1:3 (Table 5). The results
obtained from transient assays of zygotic flax embryos confirmed
the observations noted in Table 4 when Brassica embryos were used.
It is clear that the FaoA gene is transcribed and translated and
that the product of FaoB gene expression increases the activity of
the FaoA-GUS fusion protein. The effect of FaoB most likely occurs
by forming a complex with FaoA and stabilizing the FaoA domain
within the FaoA-Gus fusion protein.
18TABLE 5 GUS activity levels in total homogenate (OS, oilbody
fraction and supernatant) and supernatant (SN) of zygotic embryos
from flax. GUS Specific activity activity Construct (pmol
(activity/mg Fraction name Description MU/min) prt) OS pSBS2105
pBluescript- 7.40 1.36 based pGN1.1 Ara-GUS 656.92 113.20 pmfG138
Ara-FaoA-GUS 265.14 43.30 pmfG138: Ara-FaoA- 386.26 52.84 pmf224
GUS:pha-FaoB (1:1) pmfG138: Ara-FaoA- 440.21 78.98 pmf224
GUS:pha-FaoB (1:3) SN pSBS2105 pBluescript- 2.55 0.47 based pGN1.1
Ara-GUS 373.83 64.47 pmfG138 Ara-FaoA-GUS 132.38 21.62 pmfG138:
Ara-FaoA- 174.54 23.88 pmf224 GUS:pha-FaoB (1:1) pmfG138: Ara-FaoA-
214.07 38.41 pmf224 GUS:pha-FaoB (1:3) The Arabidopsis oleosin
promoter (Ara) was used to regulate the expression of GUS and
FaoA-GUS and a phaseolin (pha) regulatory sequence was used to
drive the expression of FaoB.
EXAMPLE 11
[0164] Comparison of Promoters.
[0165] Using the phaseolin promoter as a regulatory sequence to
express the FaoA gene proved lethal to the normal development of
transgenic B. napus plants, which indicates expression of a
functional FoaA. Furthermore, the soybean oleosin promoter was
comparatively weaker in expressing either the FaoA or FaoB
transgenes. In an effort to express the FaoA transgene in a
seed-specific manner, a relatively strong Arabidopsis oleosin
promoter was used. An Ara-FaoA construct was assembled in plasmid
pCGNI 559 and used to transform B. napus. Plant transformation was
also initiated with the Ara-Red, Ara-Syn, and ubiq-Syn constructs.
The following analyses were conducted on some of the transgenic
plants obtained.
[0166] Analysis of Integration of Chimeric Arabidopsis-FaoA DNA
Fragment
[0167] A Southern blot was prepared from 30 .mu.g of total plant
genomic DNA digested with EcoR V. A radiolabelled coding sequence
of the FaoA gene was used as a probe for hybridization. There was
successful integration of the transgene into the plant genome in
four of the samples analyzed. The number of hybridizing fragments
indicate one or two copies of the insertion within the plant
genome. The probe did not hybridize to DNA from the control
plant.
[0168] Analysis of Expression of the FaoA Transgene in B. napus
[0169] A Northern blot was prepared using 30 .mu.g of total RNA
extracted from transgenic seeds. A .sup.32P-labelled FaoA gene
probe hybridized to the related transcript of expected size in
transgenic plants. No hybridization was observed with RNA from the
control plant. For immunodetection, total seed protein extracts
were size-fractionated on 10-12% polyacrylamide-SDS gels and
transferred to PVDF membrane. Antibodies raised in rabbits against
the bacterial FaoA, and FaoB protein, and goat anti-rabbit IgG
conjugated to alkaline phosphatase (AP), were used to visualize the
related polypeptides by using NBT and BCIP as AP substrates.
Immunoblotting of 300 .mu.g of total seed protein prepared from
Ara-FaoA plants with an anti-FaoAB antibody showed that the FaoA
gene was both transcribed and translated in B. napus. The
cross-reacting polypeptide from the protein extract had the same
molecular mass as the purified FaoA protein standard. No
immunoreaction to a related polypeptide was detected in control
plant extracts. Nonspecific hybridization of the antibody with seed
storage proteins, present in high amounts in the later development
stages of B. napus, account for the signal seen in all plants. The
results clearly demonstrate that the Pseudomonas putida FaoA gene
is expressed in B. napus plants when the Arabidopsis oleosin
promoter is used to regulate expression.
[0170] Analysis of FaoA/FaoB-Expressing Transgenic Plants
[0171] Northern and Western blot analysis were also performed on
transgenic seeds from plants transformed with a construct
containing both FaoA and FaoB genes on the same binary vector. FaoA
and FaoB were under the regulation of Arabidopsis oleosin and
phaseolin promoters respectively. Autoradiography shows the
respective transcripts in both genes from plant number 507;
however, no transcripts were detected in control and three other
plants. In Western blot analysis of total seed protein from plant
number 504 and 507, only the FaoA polypeptide could be detected.
Although, a transcript could be detected with the FaoB probe, the
related polypeptide was not detected in the Western analysis using
the anti-FaoAB antibody.
[0172] Analysis of Expression of the Reductase Transgene in B.
napus
[0173] In order to determine if the reductase gene was expressed in
transgenic plants, the cloned reductase coding sequence was
radiolabelled and used as a probe in Northern blot hybridization.
Autoradiography shows that the probe did not hybridize to RNA from
the control plant. In contrast, mRNA from two of the three
transgenic plants analyzed, hybridized to the reductase gene probe.
To examine the translational product resulting from the
transcription of the reductase gene, a Western blot was prepared
with 300 .mu.g of protein extract in all four samples analyzed and
the polypeptide co-migrated with the purified bacterial reductase
protein standard. There was no immunodetection of a related
polypeptide in the control plants. The extra nonspecific
hybridizing band may represent accumulating oilbody protein in
mature seeds. This result suggests that the bacterial reductase
gene is transcribed and translated in B. napus plant.
[0174] Expression of the Synthase Gene in Transgenic Plants
[0175] To examine the expression of the hybrid synthase in
transgenic plants in a constitutive as well as seed-specific
manner, total RNA was isolated from seeds. Thirty micrograms of RNA
blotted onto nylon membrane was hybridized with a .sup.32P-labelled
synthase gene. Related transcripts from two of the three ubiq-syn
transgenic plants showed cross-hybridization with the complementary
probe while no signal was observed in the control plant. Although
the gene was transcribed as revealed by the Northern analysis, the
related polypeptide could not be detected by Western blot analysis
of protein extracts from leaves as well as seeds using the
anti-synthase antibody. However, a similar transcript was detected
on Northern blot of total RNA isolated from Ara-syn transgenic
plants and the related polypeptide was immunodetected with the
anti-synthase antibody. The related polypeptide co-migrated with
the purified synthase and showed the same degradation products. In
addition, a low molecular weight cleavage product was observed in
the transgenic lines analyzed.
[0176] Synthesis of Polymer in Embryos
[0177] As previously demonstrated in this study, the
.beta.-oxidation enzymes FaoA and FaoB can be transcribed and
translated in embryo cells. In an attempt to synthesize PHA via
.beta.-oxidation of fatty acids in a transient fashion, flax
zygotic embryos were co-bombarded with the Ara-FaoA, pha-FaoB,
Ara-Red, and Ara-Syn constructs. A further biolistic experiment was
performed on another set of embryos with either the Ara-Syn or gold
particles alone. Butanolysis of embryos using PHB as internal
standard in the solvents ethanol, methanol, chloroform ,and hexane
was performed at Metabolix Inc. GC analysis of the chromatograms
from ethanol and methanol soluble fractions did not show any
differences between samples. However, in the chloroform and hexane
soluble fractions, enhanced peaks at about 16.5 min in samples 2
(Ara-Syn) and 3 (Ara-FaoA, pha-FaoB, Ara-Red and Ara-Syn) were
observed. The peaks were not present in sample I which was
bombarded with gold-coated particle alone. The GC analysis could
not detect PHB which is extractable in chloroform in any of the
samples. Some conclusions drawn from this analysis suggest that if
there was PHB in the samples, it would be less than 0.3% of the
total cell dry weight of the samples analyzed, because 0.24 mg of
PHB standard could be detected on the GC. Secondly, the
unidentified peaks are chloroform and hexane extractable and a
medium chain-length polymer would be expected to be extractable in
both solvents. GC-MS analysis can be performed to identify these
compounds. It should be noted that these peaks could not be found
in GC analysis of insoluble fractions or residual cell matter.
[0178] Modifications and variations of the present invention will
be obvious to those of skill in the art from the foregoing detailed
description. Such modifications and variations are intended to come
within the scope of the following claims.
* * * * *