U.S. patent application number 10/371099 was filed with the patent office on 2003-12-18 for metapneumovirus strains and their use in vaccine formulations and as vectors for expression of antigenic sequences.
Invention is credited to Fouchier, Ronaldus Adrianus Maria, Haller, Aurelia, Osterhaus, Albertus Dominicus Marcellinus Erasmus, Tang, Roderick, Van Den Hoogen, Bernadetta Gerarda.
Application Number | 20030232326 10/371099 |
Document ID | / |
Family ID | 27766025 |
Filed Date | 2003-12-18 |
United States Patent
Application |
20030232326 |
Kind Code |
A1 |
Fouchier, Ronaldus Adrianus Maria ;
et al. |
December 18, 2003 |
Metapneumovirus strains and their use in vaccine formulations and
as vectors for expression of antigenic sequences
Abstract
The present invention provides an isolated mammalian negative
strand RNA virus, metapneumovirus (MPV), within the sub-family
Pneumoviridae, of the family Paramyxoviridae. The invention also
provides isolated mammalian negative strand RNA viruses
identifiable as phylogenetically corresponding or relating to the
genus Metapneumovirus and components thereof. In particular the
invention provides a mammalian MPV, subgroups and variants thereof.
The invention relates to genomic nucleotide sequences of different
isolates of mammalian metapneumoviruses, in particular human
metapneumoviruses. The invention relates to the use of the sequence
information of different isolates of mammalian metapneumoviruses
for diagnostic and therapeutic methods. The present invention
relates to nucleotide sequences encoding the genome of a
metapneumovirus or a portion thereof, including both mammalian and
avian metapneumovirus. The invention further encompasses chimeric
or recombinant viruses encoded by said nucleotide sequences. The
invention also relates to chimeric and recombinant mammalian MPV
that comprise one or more non-native or heterologous sequences. The
invention further relates to vaccine formulations comprising
mammalian or avian metapneumovirus, including recombinant and
chimeric forms of said viruses. The vaccine preparations of the
invention encompass multivalent vaccines, including bivalent and
trivalent vaccine preparations.
Inventors: |
Fouchier, Ronaldus Adrianus
Maria; (Rotterdam, NL) ; Van Den Hoogen, Bernadetta
Gerarda; (Rotterdam, NL) ; Osterhaus, Albertus
Dominicus Marcellinus Erasmus; (Bunnik, NL) ; Haller,
Aurelia; (Redwood City, CA) ; Tang, Roderick;
(San Carlos, CA) |
Correspondence
Address: |
PENNIE AND EDMONDS
1155 AVENUE OF THE AMERICAS
NEW YORK
NY
100362711
|
Family ID: |
27766025 |
Appl. No.: |
10/371099 |
Filed: |
February 21, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60358934 |
Feb 21, 2002 |
|
|
|
Current U.S.
Class: |
435/5 ;
435/235.1; 435/325; 435/456; 435/69.3; 530/350; 530/388.3;
536/23.72; 702/20 |
Current CPC
Class: |
A61K 2039/58 20130101;
C12N 2760/18322 20130101; C12N 2710/22034 20130101; C12N 2760/18622
20130101; C12N 2840/203 20130101; A61K 39/12 20130101; A61P 11/06
20180101; C12N 2760/18534 20130101; C12Q 2600/158 20130101; A61P
7/00 20180101; A61P 19/00 20180101; A61K 2039/552 20130101; C12N
2760/18334 20130101; A61K 2039/70 20130101; C12N 2760/18522
20130101; A61P 31/12 20180101; A61P 35/00 20180101; A61P 37/00
20180101; C07K 14/005 20130101; G01N 33/5011 20130101; G01N 33/502
20130101; A61P 35/02 20180101; G01N 33/5008 20130101; A61P 13/12
20180101; C07K 16/1027 20130101; G01N 33/56983 20130101; A61P 37/04
20180101; C12N 2760/18621 20130101; A61K 2039/545 20130101; C12N
2760/18634 20130101; C12N 2760/18321 20130101; C12N 2760/18643
20130101; A61K 2123/00 20130101; Y02A 90/10 20180101; G01N 2333/08
20130101; A61P 37/02 20180101; C12N 7/00 20130101; C12Q 1/701
20130101; A61P 11/00 20180101; C12N 15/86 20130101; A61K 39/155
20130101; G01N 33/5088 20130101; C12N 2760/18343 20130101; A61K
2039/5256 20130101; A61K 2039/5254 20130101; A61P 31/16 20180101;
A61P 31/14 20180101 |
Class at
Publication: |
435/5 ;
435/235.1; 702/20; 536/23.72; 530/350; 435/69.3; 435/456; 435/325;
530/388.3 |
International
Class: |
C12Q 001/70; G06F
019/00; G01N 033/48; G01N 033/50; C07H 021/04; C12N 007/00; C07K
014/005; C07H 021/02 |
Claims
We claim:
1. An isolated negative-sense single stranded RNA virus MPV
belonging to the sub-family Pneumovirinae of the family
Paramyxoviridae and identifiable as phylogenetically corresponding
to the genus Metapneumovirus, wherein the virus is phylogenetically
more closely related to a virus isolate comprising the nucleotide
sequence of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID
NO:21 than it is related to turkey rhinotracheitis virus, the
etiological agent of avian rhinotracheitis.
2. The isolated negative-sense single stranded RNA of claim 1,
wherein the phylogenetic analysis uses 100 bootstraps and 3
jumbles.
3. An isolated negative-sense single stranded RNA metapneumovirus,
wherein the genome of the virus comprises a nucleotide sequence of
SEQ ID NO:18.
4. An isolated negative-sense single stranded RNA metapneumovirus,
wherein the genome of the virus comprises a nucleotide sequence of
SEQ ID NO:19.
5. An isolated negative-sense single stranded RNA metapneumovirus,
wherein the genome of the virus comprises a nucleotide sequence of
SEQ ID NO:20.
6. An isolated negative-sense single stranded RNA metapneumovirus,
wherein the genome of the virus comprises a nucleotide sequence of
SEQ ID NO:21.
7. An isolated nucleic acid, wherein the nucleic acid has a
nucleotide sequence that is at least 70% identical to SEQ ID NO:18,
SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:21, wherein sequence
identity is determined over the entire length of SEQ ID NO:19, SEQ
ID NO:20, SEQ ID NO:21 or SEQ ID NO:22.
8. An isolated nucleic acid, wherein the nucleic acid encodes a
protein comprising (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant B1 (SEQ ID
NO:324); (ii) an amino acid sequence that is at least 98.5%
identical to the N protein of a mammalian MPV variant Bi (SEQ ID
NO:368); (iii) an amino acid sequence that is at least 96%
identical the P protein of a mammalian MPV variant B1 (SEQ ID
NO:376); (iv) an amino acid sequence that is identical the M
protein of a mammalian MPV variant B1 (SEQ ID NO:360); (v) an amino
acid sequence that is at least 99% identical the F protein of a
mammalian MPV variant B1 (SEQ ID NO:316); (vi) an amino acid
sequence that is at least 98% identical the M2-1 protein of a
mammalian MPV variant B1 (SEQ ID NO:340); (vii) an amino acid
sequence that is at least 99% identical the M2-2 protein of a
mammalian MPV variant B1 (SEQ ID NO:348); (viii) an amino acid
sequence that is at least 83% identical the SH protein of a
mammalian MPV variant B1 (SEQ ID NO:384); or (ix) an amino acid
sequence that is at least 99% identical the L protein a mammalian
MPV variant B1 (SEQ i) NO:332).
9. An isolated nucleic acid, wherein the nucleic acid encodes a
protein comprising (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant A1 (SEQ ID
NO:322); (ii) an amino acid sequence that is at least 99.5%
identical to the N protein of a mammalian MPV variant A1 (SEQ ID
NO:366); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant A1 (SEQ ID
NO:374); (iv) an amino acid sequence that is at least 99% identical
to the M protein of a mammalian MPV variant A1 (SEQ ID NO:358); (v)
an amino acid sequence that is at least 98% identical to the F
protein of a mammalian MPV variant A1 (SEQ ID NO:314); (vi) an
amino acid sequence that is at least 99% identical to the M2-1
protein of a mammalian MPV variant A1 (SEQ ID NO:338); (vii) an
amino acid sequence that is at least 96% identical to the M2-2
protein of a mammalian MPV variant A1 (SEQ ID NO:346); (viii) an
amino acid sequence that is at least 84% identical to the SH
protein of a mammalian MPV variant A1 (SEQ ID NO:382); or (ix) an
amino acid sequence that is at least 99% identical to the L protein
of a virus of a mammalian MPV variant A1 (SEQ ID NO:330).
10. An isolated nucleic acid, wherein the nucleic acid encodes a
protein comprising (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant A2 (SEQ ID
NO:332); (ii) an amino acid sequence that is at least 99.5%
identical to the N protein of a mammalian MPV variant A2 (SEQ ID
NO:367); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant A2 (SEQ ID
NO:375); (iv) an amino acid sequence that is at least 99% identical
to the M protein of a mammalian MPV variant A2 (SEQ ID NO:359); (v)
an amino acid sequence that is at least 98% identical to the F
protein of a mammalian MPV variant A2 (SEQ ID NO:315); (vi) an
amino acid sequence that is at least 99% identical to the M2-1
protein of a mammalian MPV variant A2 (SEQ ID NO: 339); (vii) an
amino acid sequence that is at least 96% identical to the M2-2
protein of a mammalian MPV variant A2 (SEQ ID NO:347); (viii) an
amino acid sequence that is at least 84% identical to the SH
protein of a mammalian MPV variant A2 (SEQ ID NO:383); or (ix) an
amino acid sequence that is at least 99% identical to the L protein
of a mammalian MPV variant A2 (SEQ ID NO:331).
11. An isolated nucleic acid, wherein the nucleic acid encodes a
protein comprising (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant B2 (SEQ ID
NO:325); (ii) an amino acid sequence that is at least 97% identical
to the N protein of a mammalian MPV variant B2 (SEQ ID NO:369);
(iii) an amino acid sequence that is at least 96% identical to the
P protein of a mammalian MPV variant B2 (SEQ ID NO:377); (iv) an
amino acid sequence that is identical to the M protein of a
mammalian MPV variant B2 (SEQ ID NO:361); (v) an amino acid
sequence that is at least 99% identical to the F protein of a
mammalian MPV variant B2 (SEQ ID NO:317); (vi) an amino acid
sequence that is at least 98% identical to the M2-1 protein of a
mammalian MPV variant B2 (SEQ ID NO:341); (vii) an amino acid
sequence that is at least 99% identical to the M2-2 protein of a
mammalian MPV variant B2 (SEQ ID NO:349); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant B2 (SEQ ID NO:385); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant B2 (SEQ ID NO:333).
12. An isolated nucleic acid, wherein the nucleic acid hybridizes
specifically under high stringency conditions to the nucleic acid
of claim 8, 9, 10 or 11.
13. An isolated nucleic acid, wherein the nucleic acid hybridizes
under low stringency conditions to the nucleic acid of claim 8, 9,
10 or 11.
14. The isolated nucleic acid of claim 12, wherein said high
stringency conditions comprise hybridization in a buffer consisting
of 6.times.SSC, 50 mM Tris-HCl (pH=7.5), 1 mM EDTA, 0.02% PVP,
0.02% Ficoll, 0.02% BSA and 100 .mu.g/ml denatured salmon sperm
DNA, for 48 hours at 65.degree. C., washing in a buffer consisting
of 2.times.SSC, 0.01% PVP, 0.01% Ficoll and 0.01% BSA, for 45
minutes at 37.degree. C., and washing in a buffer consisting of
0.1.times.SSC, for 45 minutes at 50.degree. C.
15. An isolated infectious virus, wherein the virus comprises the
nucleic acid of claim 8, 9, 10 or 11.
16. A method for detecting a variant BI mammalian MPV in a sample,
wherein the method comprises contacting the sample with the nucleic
acid of claim 8.
17. A method for detecting a variant Al mammalian MPV in a sample,
wherein the method comprises contacting the sample with the nucleic
acid of claim 9.
18. A method for detecting a variant A2 mammalian MPV in a sample,
wherein the method comprises contacting the sample with the nucleic
acid of claim 10.
19. A method for detecting a variant B2 mammalian MPV in a sample,
wherein the method comprises contacting the sample with the nucleic
acid of claim 11.
20. An isolated protein, wherein the protein comprises: (i) an
amino acid sequence that is at least 66% identical to the G protein
of a mammalian MPV variant B1 (SEQ ID NO:324); (ii) an amino acid
sequence that is at least 98.5% identical to the N protein of a
mammalian MPV variant B1 (SEQ ID NO:368); (iii) an amino acid
sequence that is at least 96% identical the P protein of a
mammalian MPV variant B1 (SEQ ID NO:376); (iv) an amino acid
sequence that is identical the M protein of a mammalian MPV variant
B1 (SEQ ID NO:360); (v) an amino acid sequence that is at least 99%
identical the F protein of a mammalian MPV variant B1 (SEQ ID
NO:316); (vi) an amino acid sequence that is at least 98% identical
the M2-1 protein of a mammalian MPV variant B1 (SEQ ID NO:340);
(vii) an amino acid sequence that is at least 99% identical the
M2-2 protein of a mammalian MPV variant B1 (SEQ ID NO:348); (viii)
an amino acid sequence that is at least 83% identical the SH
protein of a mammalian MPV variant B1 (SEQ ID NO:384); or (ix) an
amino acid sequence that is at least 99% identical the L protein a
mammalian MPV variant B1 (SEQ ID NO:332).
21. An isolated protein, wherein the protein comprises: (i) an
amino acid sequence that is at least 66% identical to the G protein
of a mammalian MPV variant A1 (SEQ ID NO:322); (ii) an amino acid
sequence that is at least 99.5% identical to the N protein of a
mammalian MPV variant A1 (SEQ ID NO:366); (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant A1 (SEQ ID NO:374); (iv) an amino acid
sequence that is at least 99% identical to the M protein of a
mammalian MPV variant A1 (SEQ ID NO:358); (v) an amino acid
sequence that is at least 98% identical to the F protein of a
mammalian MPV variant A1 (SEQ ID NO:314); (vi) an amino acid
sequence that is at least 99% identical to the M2-1 protein of a
mammalian MPV variant A1 (SEQ ID NO:338); (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A1 (SEQ ID NO:346); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A1 (SEQ ID NO:382); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a virus
of a mammalian MPV variant A1 (SEQ ID NO:330).
22. An isolated protein, wherein the protein comprises: (i) an
amino acid sequence that is at least 66% identical to the G protein
of a mammalian MPV variant A2 (SEQ ID NO:332); (ii) an amino acid
sequence that is at least 99.5% identical to the N protein of a
mammalian MPV variant A2 (SEQ ID NO:367); (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant A2 (SEQ ID NO:375); (iv) an amino acid
sequence that is at least 99% identical to the M protein of a
mammalian MPV variant A2 (SEQ ID NO:359); (v) an amino acid
sequence that is at least 98% identical to the F protein of a
mammalian MPV variant A2 (SEQ ID NO:315); (vi) an amino acid
sequence that is at least 99% identical to the M2-1 protein of a
mammalian MPV variant A2 (SEQ ID NO: 339); (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A2 (SEQ ID NO:347); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A2 (SEQ ID NO:383); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant A2 (SEQ ID NO:331).
23. An isolated protein, wherein the protein comprises: (i) an
amino acid sequence that is at least 66% identical to the G protein
of a mammalian MPV variant B2 (SEQ ID NO:325); (ii) an amino acid
sequence that is at least 97% identical to the N protein of a
mammalian MPV variant B2 (SEQ ID NO:369); (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant B2 (SEQ ifD NO:377); (iv) an amino acid
sequence that is identical to the M protein of a mammalian MPV
variant B2 (SEQ ID NO:361); (v) an amino acid sequence that is at
least 99% identical to the F protein of a mammalian MPV variant B2
(SEQ ID NO:317); (vi) an amino acid sequence that is at least 98%
identical to the M2-1 protein of a mammalian MPV variant B2 (SEQ ID
NO:341); (vii) an amino acid sequence that is at least 99%
identical to the M2-2 protein of a mammalian MPV variant B2 (SEQ ID
NO:349); (viii) an amino acid sequence that is at least 84%
identical to the SH protein of a mammalian MPV variant B2 (SEQ ID
NO:385); or (ix) an amino acid sequence that is at least 99%
identical to the L protein of a mammalian MPV variant B2 (SEQ ID
NO:333).
24. An antibody, wherein the antibody binds specifically to a
protein consisting of: (i) an amino acid sequence that is at least
66% identical to the G protein of a mammalian MPV variant B1 (SEQ
ID NO:324); (ii) an amino acid sequence that is at least 98.5%
identical to the N protein of a mammalian MPV variant Bi (SEQ ID
NO:368); (iii) an amino acid sequence that is at least 96%
identical the P protein of a mammalian MPV variant B1 (SEQ ID
NO:376); (iv) an amino acid sequence that is identical the M
protein of a mammalian MPV variant B1 (SEQ ID NO:360); (v) an amino
acid sequence that is at least 99% identical the F protein of a
mammalian MPV variant B1 (SEQ ID NO:316); (vi) an amino acid
sequence that is at least 98% identical the M2-1 protein of a
mammalian MPV variant B1 (SEQ ID NO:340); (vii) an amino acid
sequence that is at least 99% identical the M2-2 protein of a
mammalian MPV variant B1 (SEQ ID NO:348); (viii) an amino acid
sequence that is at least 83% identical the SH protein of a
mammalian MPV variant B1 (SEQ ID NO:384); or (ix) an amino acid
sequence that is at least 99% identical the L protein a mammalian
MPV variant B1 (SEQ ID NO:332).
25. An antibody, wherein the antibody binds specifically to a
protein consisting of: (i) an amino acid sequence that is at least
66% identical to the G protein of a mammalian MPV variant A1 (SEQ
ID NO:322); (ii) an amino acid sequence that is at least 99.5%
identical to the N protein of a mammalian MPV variant A1 (SEQ ID
NO:366); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant A1 (SEQ ID
NO:374); (iv) an amino acid sequence that is at least 99% identical
to the M protein of a mammalian MPV variant A1 (SEQ ID NO:358); (v)
an amino acid sequence that is at least 98% identical to the F
protein of a mammalian MPV variant A1 (SEQ ID NO:314); (vi) an
amino acid sequence that is at least 99% identical to the M2-1
protein of a mammalian MPV variant A1 (SEQ ID NO:338); (vii) an
amino acid sequence that is at least 96% identical to the M2-2
protein of a mammalian MPV variant A1 (SEQ ID NO:346); (viii) an
amino acid sequence that is at least 84% identical to the SH
protein of a mammalian MPV variant A1 (SEQ ID NO:382); or (ix) an
amino acid sequence that is at least 99% identical to the L protein
of a virus of a mammalian MPV variant A1 (SEQ ID NO:330).
26. An antibody, wherein the antibody binds specifically to a
protein consisting of: (i) an amino acid sequence that is at least
66% identical to the G protein of a mammalian MPV variant A2 (SEQ
ID NO:332); (ii) an amino acid sequence that is at least 96%
identical to the N protein of a mammalian MPV variant A2 (SEQ ID
NO:367); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant A2 (SEQ ID
NO:375); (iv) an amino acid sequence that is at least 99% identical
to the M protein of a mammalian MPV variant A2 (SEQ ID NO:359); (v)
an amino acid sequence that is at least 98% identical to the F
protein of a mammalian MPV variant A2 (SEQ ID NO:315); (vi) an
amino acid sequence that is at least 99% identical to the M2-1
protein of a mammalian MPV variant A2 (SEQ ID NO: 339); (vii) an
amino acid sequence that is at least 96% identical to the M2-2
protein of a mammalian MPV variant A2 (SEQ ID NO:347); (viii) an
amino acid sequence that is at least 84% identical to the SH
protein of a mammalian MPV variant A2 (SEQ ID NO:383); or (ix) an
amino acid sequence that is at least 99% identical to the L protein
of a mammalian MPV variant A2 (SEQ ID NO:331).
27. An antibody, wherein the antibody binds specifically to a
protein consisting of: (i) an amino acid sequence that is at least
66% identical to the G protein of a mammalian MPV variant B2 (SEQ
ID NO:325); (ii) an amino acid sequence that is at least 97%
identical to the N protein of a mammalian MPV variant B2 (SEQ ID
NO:369); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant B2 (SEQ ID
NO:377); (iv) an amino acid sequence that is identical to the M
protein of a mammalian MPV variant B2 (SEQ ID NO:361); (v) an amino
acid sequence that is at least 99% identical to the F protein of a
mammalian MPV variant B2 (SEQ ID NO:317); (vi) an amino acid
sequence that is at least 98% identical to the M2-1 protein of a
mammalian MPV variant B2 (SEQ ID NO:341); (vii) an amino acid
sequence that is at least 99% identical to the M2-2 protein of a
mammalian MPV variant B2 (SEQ ID NO:349); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant B2 (SEQ ID NO:385); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant B2 (SEQ ID NO:333).
28. A method for detecting a variant B1 mammalian MPV in a sample,
wherein said method comprises contacting the sample with the
antibody of claim 24.
29. A method for detecting a variant Al mammalian MPV in a sample,
wherein said method comprises contacting the sample with the
antibody of claim 25.
30. A method for detecting a variant A2 mammalian MPV in a sample,
wherein said method comprises contacting the sample with the
antibody of claim 26.
31. A method for detecting a variant B2 mammalian MPV in a sample,
wherein said method comprises contacting the sample with the
antibody of claim 27.
32. A method for identifying a viral isolate as a mammalian MPV,
wherein said method comprises contacting said isolate or a
component thereof with the antibody of claim 24, 25, 26 or 27.
33. A method for virologically diagnosing a MPV infection of a
mammal comprising determining in a sample of said mammal the
presence of a viral isolate or component thereof by contacting the
sample with the antibody of claim 24, 25, 26 or 27.
34. A method for virologically diagnosing a mammalian MPV infection
of a subject, wherein said method comprises: (a) obtaining a sample
from the subject; (b) contacting the sample with the antibody of
claim 24, 25, 26 or 27, wherein if the antibody binds to the sample
the subject is infected with mammalian MPV.
35. An infectious recombinant virus, wherein the recombinant virus
comprises the genome of a mammalian MPV and further comprises a
non-native MPV sequence.
36. A recombinant nucleic acid, wherein the recombinant nucleic
acid comprises (i) a nucleic acid encoding a G polypeptide of an
MPV Al variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide.
37. A recombinant nucleic acid, wherein the recombinant nucleic
acid comprises (i) a nucleic acid encoding a G polypeptide of an
MPV A2 variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide.
38. A recombinant nucleic acid, wherein the recombinant nucleic
acid comprises (i) a nucleic acid encoding a G polypeptide of an
MPV B I variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide.
39. A recombinant nucleic acid, wherein the recombinant nucleic
acid comprises (i) a nucleic acid encoding a G polypeptide of an
MPV B2 variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide.
40. An isolated infectious recombinant virus, wherein the
recombinant virus is encoded by the nucleic acid of claim 36, 37,
38 or 39.
41. The isolated infectious recombinant virus of claim 40, wherein
the nucleic acid of claim 36, 37, 38 or 39 further comprises a
heterologous sequence.
42. An infectious chimeric virus, wherein the chimeric virus
comprises the genome of a mammalian MPV of a first variant, wherein
one or more of the open reading frames in the genome of the
mammalian MPV of the first variant have been replaced by the
analogous open reading frame from a mammalian MPV of a second
variant.
43. An infectious chimeric virus, wherein the chimeric virus
comprises the genome of a mammalian MPV of a first variant, wherein
one or more of open reading frames of a mammalian MPV of a second
variant are inserted into the genome of the mammalian MPV of the
first variant.
44. The infectious chimeric virus of claim 42 or 43, wherein (i) if
the first variant is A1, the second variant is A2, B1 or B2; (ii)
if the first variant is A2, the second variant is A1, B1 or B2;
(iii) if the first variant is B1, the second variant is A1, A2 or
B2; (iv) if the first variant is B2, the second variant is A1, A2,
or B I.
45. The infectious chimeric virus of claim 42 or 43, wherein the
analogous open reading frame encodes a F protein or a G
protein.
46. An infectious chimeric virus, wherein the chimeric virus
comprises the genome of a mammalian MPV, wherein one or more of the
open reading frames in the genome of the mammalian MPV have been
replaced by an ORF which encodes one or more of (i) an avian MPV F
protein; (ii) an avian MPV G protein; (iii) an avian MPV SH
protein; (iv) an avian MPV N protein; (v) an avian MPV P protein;
(vi) an avian MPV M2 protein; (vii) an avian MPV M2-1 protein;
(viii) an avian MPV M2-2 protein; or (ix) an avian MPV L
protein.
47. An infectious chimeric virus, wherein the chimeric virus
comprises the genome of an avian MPV, wherein one or more of the
open reading frames in the genome of the avian MPV have been
replaced by an ORF which encodes one or more of (i) a mammalian MPV
F protein; (ii) a mammalian MPV G protein; (iii) a mammalian MPV SH
protein; (iv) a mammalian MPV N protein; (v) a mammalian MPV P
protein; (vi) a mammalian MPV M2 protein; (vii) a mammalian MPV
M2-1 protein; (viii) a mammalian MPV M2-2 protein; or (ix) a
mammalian MPV L protein.
48. The infectious chimeric virus of claim 35, 42, 43, 46 or 47,
wherein the avian MPV is APV type A, APV type B, APV type C or APV
type D.
49. The infectious chimeric virus of claim 35, 42, 43, 46 or 47,
wherein the mammalian MPV is variant A1, variant A2, variant BI or
variant B2.
50. The infectious virus of claim 35, 42, 43, 46 or 47, wherein the
virus further comprises a heterologous nucleotide sequence.
51. The infectious virus of claim 50, wherein the heterologous
nucleotide sequence is inserted at position 1, 2, 3, 4, 5, or 6 of
the metapneumovirus genome.
52. The infectious virus of claim 50, wherein a nucleotide sequence
of the genome of the virus is substituted with the heterologous
nucleotide sequence.
53. The virus of claim 50, wherein the heterologous sequence is
derived from a negative stand RNA virus.
54. The virus of claim 50, wherein the heterologous sequence is
derived from a RSV, PIV, APV, or from a mammalian MPV.
55. The virus of claim 54, wherein the RSV is a respiratory
syncytial virus type A, a respiratory syncytial virus type B, a
bovine respiratory syncytial virus or an ovine respiratory
syncytial virus.
56. The virus of claim 54, wherein said parainfluenza virus is a
parainfluenza virus type 1, a parainfluenza virus type 2, a
parainfluenza virus type 3, a parainfluenza virus type 4 or a
bovine parainfluenza virus.
57. The virus of anyone of claims 50-56, wherein the heterologous
sequence encodes a F protein or a G protein.
58. The virus of claim 50, wherein said heterologous sequence is
derived from a virus that causes Acquired Immune Deficiency
Syndrome.
59. The virus of claim 35, 40, 42, 43, 46, or 47, wherein the virus
is an attenuated virus.
60. The virus of claim 35, 40, 42, 43, 46, or 47, wherein the
genome of said virus contains mutations or modifications, in
addition to said heterologous nucleotide sequences, that result in
a chimeric virus having a phenotype more suitable for use in
vaccine formulations such an attenuated phenotype or a phenotype
with enhanced antigenicity or enhanced immunogenicity.
61. The virus of claim 35, 40, 42, 43, 46, or 47, wherein the
genome of the mammalian MPV is a mammalian MPV comprising the
nucleotide sequence of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or
SEQ ID NO:21.
62. An immunogenic composition, wherein the immunogenic composition
comprises the infectious recombinant virus of claim 35, 40, 42, 43,
46, or 47.
63. A pharmaceutical composition, wherein the pharmaceutical
composition comprises the infectious recombinant virus of claim 35,
40, 42, 43, 46, or 47.
64. A method for treating or preventing a respiratory tract
infection in a mammal, said method comprising administering a
vaccine comprising a mammalian metapneumovirus.
65. A method for treating or preventing a respiratory tract
infection in a mammal, said method comprising administering a
vaccine comprising the recombinant mammalian metapneumovirus of
claim 35, 40, 42, 43, 46, or 47.
66. A method for treating or preventing a respiratory tract
infection in a mammal, said method comprising administering a
vaccine comprising avian metapneumovirus.
67. A method for treating or preventing a respiratory tract
infection in a human, said method comprising administering a
vaccine comprising avian metapneumovirus.
68. A method for treating or preventing a respiratory tract
infection in a subject, said method comprising administering to the
subject the composition of claim 62 or 63.
69. The method of claim 64, 65, 66, 67 or 68, wherein the
respiratory tract infection is a MPV infection.
70. The method of claim 64, 65, 66, 67 or 68, wherein the
respiratory tract infection is an infection with MPV and RSV.
71. The method of claim 64, 65, 66, 67 or 68, wherein the subject
is a human.
72. The method of claim 71, wherein the human subject is less than
5 years of age.
73. The method of claim 71, wherein the human subject is less than
2 years of age.
74. The method of claim 71, wherein the human subject suffers from
a disease or a condition in addition to the respiratory tract
infection.
75. The method of claim 71, wherein the disease or condition is
selected from a group consisting of cystic fibrosis, leukaemia,
non-Hodgkin lymphoma, Asthma, and bone marrow transplantation and
kidney transplantation.
76. The method of claim 71, wherein the human subject is an
immunocompromised individual.
77. The method of claim 71, wherein the human subject is an
elderly.
78. A method for identifying a compound useful for the treatment of
infections with mammalian MPV, wherein the method comprises: (a)
infecting an animal with a mammalian MPV; (b) administering to the
animal a test compound; and (c) determining the effect of the test
compound on the infection of the animal, wherein a test compound
that reduces the extent of the infection or that ameliorates the
symptoms associated with the infection is identified as a compound
useful for the treatment of infections with mammalian MPV.
79. A method for identifying a compound useful for the treatment of
infections with mammalian MPV, wherein the method comprises: (a)
infecting a cell culture with a mammalian MPV; (b) incubating the
cell culture with a test compound; and (c) determining the effect
of the test compound on the infection of the cell culture, wherein
a test compound that reduces the extent of the infection is
identified as a compound useful for the treatment of infections
with mammalian MPV.
80. A method for diagnosing a mammalian MPV infection of an animal,
wherein the method comprises determining in a sample of said animal
the presence of a viral isolate or component thereof by reacting
said sample with a nucleic acid or an antibody reactive with a
component of an aviant pneumovirus, said nucleic acid or antibody
being cross-reactive with a component of MPV.
81. A method for serologically diagnosing a mammalian MPV infection
of an animal, wherein the method comprises contacting a sample from
the animal with the protein of claim 20, 21, 22 or 23.
82. A method for serologically diagnosing a mammalian MPV infection
of an animal, wherein the method comprises contacting a sample from
the animal with a protein of an APV.
83. A method for diagnosing an APV infection of a bird comprising
contacting a sample from the animal with the protein of claim 20,
21, 22 or 23.
84. The method of claim 83, wherein said APV is APV-C.
Description
[0001] This application claims priority to U.S. Provisional Patent
Application No. 60/358,934, filed Feb. 21, 2002, which is
incorporated by reference herein in its entirety.
[0002] Copending and co-assigned U.S. Patent Application ______,
filed on even date herewith, listing Ronaldus Fouchier, Bemadetta
van den Hoogen, Albertus Osterhaus, Aurelia Haller, and Roderick
Tang as Inventors, entitled "Recombinant Parainfluenza Virus
Expression Systems and Vaccines Comprising Heterologous Antigens
Derived from Metapneumovirus", is incorporated herein by reference
in its entirety.
1. INTRODUCTION
[0003] The invention relates to an isolated mammalian negative
strand RNA virus, metapneumovirus (MPV), within the sub-family
Pneumoviridae, of the family Paramyxoviridae. The present invention
also relates to isolated mammalian negative strand RNA viruses
identifiable as phylogenetically corresponding or relating to the
genus Metapneumovirus and components thereof. The invention relates
to genomic nucleotide sequences of different isolates of mammalian
metapneumoviruses, in particular human metapneumoviruses. The
invention relates to the use of the sequence information of
different isolates of mammalian metapneumoviruses for diagnostic
and therapeutic methods. The present invention relates to
nucleotide sequences encoding the genome of a metapneumovirus or a
portion thereof, including both mammalian and avian
metapneumovirus. The invention further encompasses chimeric or
recombinant viruses encoded by said nucleotide sequences. The
invention also relates to chimeric and recombinant mammalian MPV
that comprise one or more non-native or heterologous sequences. The
invention further relates to vaccine formulations comprising
mammalian or avian metapneumovirus, including recombinant and
chimeric forms of said viruses. The vaccine preparations of the
invention encompass multivalent vaccines, including bivalent and
trivalent vaccine preparations.
2. BACKGROUND OF THE INVENTION
[0004] Classically, as devastating agents of disease,
paramyxoviruses account for many animal and human deaths worldwide
each year. The Paramyxoviridae form a family within the order of
Mononegavirales (negative-sense single stranded RNA viruses),
consisting of the sub-families Paramyxovirinae and Pneumovirinae.
The latter sub-family is at present taxonomically divided in the
genera Pneumovirus and Metapneumovirus (Pringle, 1999, Arch. Virol.
144/2, 2065-2070). Human respiratory syncytial virus (hRSV), a
species of the Pneumovirus genus, is the single most important
cause of lower respiratory tract infections during infancy and
early childhood worldwide (Domachowske, & Rosenberg, 1999,
Clin. Microbio. Rev. 12(2): 298-309). Other members of the
Pneumovirus genus include the bovine and ovine respiratory
syncytial viruses and pneumonia virus of mice (PVM).
[0005] In the past decades several etiological agents of mammalian
disease, in particular of respiratory tract illnesses (RTI), in
particular of humans, have been identified (Evans, In: Viral
Infections of Humans, Epidemiology and Control. 3th edn. (ed.
Evans, A.S) 22-28 (Plenum Publishing Corporation, New York, 1989)).
Classical etiological agents of RTI with mammals are respiratory
syncytial viruses belonging to the genus Pneumovirus found with
humans (hRSV) and ruminants such as cattle or sheep (bRSV and/or
ORSV). In human RSV differences in reciprocal cross neutralization
assays, reactivity of the G proteins in immunological assays and
nucleotide sequences of the G gene are used to define two hRSV
antigenic subgroups. Within the subgroups the amino acid sequences
show 94% (subgroup A) or 98% (subgroup B) identity, while only 53%
amino acid sequence identity is found between the subgroups.
Additional variability is observed within subgroups based on
monoclonal antibodies, RT-PCR assays and RNAse protection assays.
Viruses from both subgroups have a worldwide distribution and may
occur during a single season. Infection may occur in the presence
of pre-existing immunity and the antigenic variation is not
strictly required to allow re-infection. See, for example
Sullender, 2000, Clinical Microbiology Reviews 13(1): 1-15; Collins
et al. Fields Virology, ed. B. N. Knipe, Howley, P. M. 1996,
Philadelphia: Lippencott-Raven. 1313-1351; Johnson et al., 1987,
(Proc Natl Acad Sci USA, 84(16): 5625-9; Collins, in The
Paramyxoviruses, D.W. Kingsbury, Editor. 1991, Plenum Press: New
York. p. 103-153.
[0006] Another classical Pneumovirus is the pneumonia virus of mice
(PVM), in general only found with laboratory mice. However, a
proportion of the illnesses observed among mammals can still not be
attributed to known pathogens.
[0007] 2.1 Avian Metapneumovirus
[0008] Respiratory disease caused by an avian pneumovirus (APV) was
first described in South Africa in the late 1970s (Buys et al.,
1980, Turkey 28:36-46) where it had a devastating effect on the
turkey industry. The disease in turkeys was characterized by
sinusitis and rhinitis and was called turkey rhinotracheitis (TRT).
The European isolates of APV have also been strongly implicated as
factors in swollen head syndrome (SHS) in chickens (O'Brien, 1985,
Vet. Rec. 117:619-620). Originally, the disease appeared in broiler
chicken flocks infected with Newcastle disease virus (NDV) and was
assumed to be a secondary problem associated with Newcastle disease
(ND). Antibody against European APV was detected in affected
chickens after the onset of SHS (Cook et al., 1988, Avian Pathol.
17:403-410), thus implicating APV as the cause.
[0009] Avian pneumovirus (APV) also known as turkey rhinotracheitis
virus (TRTV), the aetiological agent of avian rhinotracheitis, an
upper respiratory tract infection of turkeys (Giraud et al., 1986,
Vet. Res. 119:606-607), is the sole member of the recently assigned
Metapneumovirus genus, which, as said was until now not associated
with infections, or what is more, with disease of mammals.
Serological subgroups of APV can be differentiated on the basis of
nucleotide or amino acid sequences of the G glycoprotein and
neutralization tests using monoclonal antibodies that also
recognize the G glycoprotein. However, other differences in the
nucleotide and amino acid sequences can be used to distinguish
serological subgroups of APV. Within subgroups A, B and D, the G
protein shows 98.5 to 99.7% aa sequence identity within subgroups
while between the subgroups only 31.2-38% aa identity is observed.
See for example Collins et al., 1993, Avian Pathology, 22: p.
469-479; Cook et al., 1993, Avian Pathology, 22: 257-273;
Bayon-Auboyer et al., J Gen Virol, 81(Pt 11): 2723-33; Seal, 1998,
Virus Res, 58(1-2): 45-52; Bayon-Auboyer et al., 1999, Arch Virol,
144(6): 91-109; Juhasz, et al., 1994, J Gen Virol, 75(Pt 11):
2873-80.
[0010] A further serotype of APV is provided in WO00/20600,
incorporated by reference herein, which describes the Colorado
isolate of APV and compared it to known APV or TRT strains with in
vitro serum neutralization tests. First, the Colorado isolate was
tested against monospecific polyclonal antisera to recognized TRT
isolates. The Colorado isolate was not neutralized by monospecific
antisera to any of the TRT strains. It was, however, neutralized by
a hyperimmune antiserum raised against a subgroup A strain. This
antiserum neutralized the homologous virus to a titre of 1:400 and
the Colorado isolate to a titer of 1: 80. Using the above method,
the Colorado isolate was then tested against TRT monoclonal
antibodies. In each case, the reciprocal neutralization titer was
<10. Monospecific antiserum raised to the Colorado isolate was
also tested against TRT strains of both subgroups. None of the TRT
strains tested were neutralized by the antiserum to the Colorado
isolate.
[0011] The Colorado strain of APV does not protect SPF chicks
against challenge with either a subgroup A or a subgroup B strain
of TRT virus. These results suggest that the Colorado isolate may
be the first example of a further serotype of avian pneumovirus
(See, Bayon-Auboyer et al., 2000, J. Gen. Vir. 81:2723-2733).
[0012] The avian pneumovirus is a single stranded, non-segmented
RNA virus that belongs to the sub-family Pneumovirinae of the
family Paramyxoviridae, genus metapneumovirus (Cavanagh and
Barrett, 1988, Virus Res. 11:241-256; Ling et al., 1992, J. Gen.
Virol. 73:1709-1715; Yu et al., 1992, J. Gen. Virol. 73:1355-1363).
The Paramyxoviridae family is divided into two sub-families: the
Paramyxovirinae and Pneumovirinae. The subfamily Paramyxovirinae
includes, but is not limited to, the genera: Paramyxovirus,
Rubulavirus, and Morbillivirus. Recently, the sub-family
Pneumovirinae was divided into two genera based on gene order, and
sequence homology, i.e. pneumovirus and metapneumovirus (Naylor et
al., 1998, J. Gen. Virol., 79:1393-1398; Pringle, 1998, Arch.
Virol. 143:1449-1159). The pneumovirus genus includes, but is not
limited to, human respiratory syncytial virus (hRSV), bovine
respiratory syncytial virus (bRSV), ovine respiratory syncytial
virus, and mouse pneumovirus. The metapneumovirus genus includes,
but is not limited to, European avian pneumovirus (subgroups A and
B), which is distinguished from hRSV, the type species for the
genus pneumovirus (Naylor et al., 1998, J. Gen. Virol.,
79:1393-1398; Pringle, 1998, Arch. Virol. 143:1449-1159). The US
isolate of APV represents a third subgroup (subgroup C) within
metapneumovirus genus because it has been found to be antigenically
and genetically different from European isolates (Seal, 1998, Virus
Res. 58:45-52; Senne et al., 1998, In: Proc. 47th WPDC, California,
pp. 67-68).
[0013] Electron microscopic examination of negatively stained APV
reveals pleomorphic, sometimes spherical, virions ranging from 80
to 200 nm in diameter with long filaments ranging from 1000 to 2000
nm in length (Collins and Gough, 1988, J. Gen. Virol. 69:909-916).
The envelope is made of a membrane studded with spikes 13 to 15 nm
in length. The nucleocapsid is helical, 14 nm in diameter and has 7
nm pitch. The nucleocapsid diameter is smaller than that of the
genera Paramyxovirus and Morbillivirus, which usually have
diameters of about 18 nm.
[0014] Avian pneumovirus infection is an emerging disease in the
USA despite its presence elsewhere in the world in poultry for many
years. In May 1996, a highly contagious respiratory disease of
turkeys appeared in Colorado, and an APV was subsequently isolated
at the National Veterinary Services Laboratory (NVSL) in Ames, Iowa
(Senne et al., 1997, Proc. 134th Ann. Mtg., AVMA, pp. 190). Prior
to this time, the United States and Canada were considered free of
avian pneumovirus (Pearson et al., 1993, In: Newly Emerging and
Re-emerging Avian Diseases: Applied Research and Practical
Applications for Diagnosis and Control, pp. 78-83; Hecker and
Myers, 1993, Vet. Rec. 132:172). Early in 1997, the presence of APV
was detected serologically in turkeys in Minnesota. By the time the
first confirmed diagnosis was made, APV infections had already
spread to many farms. The disease is associated with clinical signs
in the upper respiratory tract: foamy eyes, nasal discharge and
swelling of the sinuses. It is exacerbated by secondary infections.
Morbidity in infected birds can be as high as 100%. The mortality
can range from 1 to 90% and is highest in six to twelve week old
poults.
[0015] Avian pneumovirus is transmitted by contact. Nasal
discharge, movement of affected birds, contaminated water,
contaminated equipment; contaminated feed trucks and load-out
activities can contribute to the transmission of the virus.
Recovered turkeys are thought to be carriers. Because the virus is
shown to infect the epithelium of the oviduct of laying turkeys and
because APV has been detected in young poults, egg transmission is
considered a possibility.
[0016] 2.2 PIV Infections
[0017] Parainfluenza viral infection results in serious respiratory
tract disease in infants and children. (Tao et al., 1999, Vaccine
17: 1100-08). Infectious parainfluenza viral infections account for
approximately 20% of all hospitalizations of pediatric patients
suffering from respiratory tract infections worldwide. Id.
[0018] PIV is a member of the genus respirovirus (PIV1, PIV3) or
rubulavirus (PIV2, PIV4) of the paramyxoviridae family. PIV is made
up of two structural modules: (1) an internal ribonucleoprotein
core, or nucleocapsid, containing the viral genome, and (2) an
outer, roughly spherical lipoprotein envelope. Its genome is a
single strand of negative sense RNA, approximately 15,456
nucleotides in length, encoding at least eight polypeptides. These
proteins include, but are not limited to, the nucleocapsid
structural protein (NP, NC, or N depending on the genera), the
phosphoprotein (P), the matrix protein (M), the fusion glycoprotein
(F), the hemagglutinin-neuraminidase glycoprotein (HN), the large
polymerase protein (L), and the C and D proteins of unknown
function. Id.
[0019] The parainfluenza nucleocapsid protein (NP, NC, or N)
consists of two domains within each protein unit including an
amino-terminal domain, comprising about two-thirds of the molecule,
which interacts directly with the RNA, and a carboxyl-terminal
domain, which lies on the surface of the assembled nucleocapsid. A
hinge is thought to exist at the junction of these two domains
thereby imparting some flexibility to this protein (see Fields et
al. (ed.), 1991, Fundamental Virology, Second Edition, Raven Press,
New York, incorporated by reference herein in its entirety). The
matrix protein (M), is apparently involved with viral assembly and
interacts with both the viral membrane as well as the nucleocapsid
proteins. The phosphoprotein (P), which is subject to
phosphorylation, is thought to play a regulatory role in
transcription, and may also be involved in methylation,
phosphorylation and polyadenylation. The fusion glycoprotein (F)
interacts with the viral membrane and is first produced as an
inactive precursor, then cleaved post-translationally to produce
two disulfide linked polypeptides. The active F protein is also
involved in penetration of the parainfluenza virion into host cells
by facilitating fusion of the viral envelope with the host cell
plasma membrane. Id. The glycoprotein, hemagglutinin-neuraminidase
(HN), protrudes from the envelope allowing the virus to contain
both hemagglutinin and neuraminidase activities. HN is strongly
hydrophobic at its amino terminal which functions to anchor the HN
protein into the lipid bilayer. Id. Finally, the large polymerase
protein (L) plays an important role in both transcription and
replication. Id.
[0020] 2.3 RSV Infections
[0021] Respiratory syncytial virus (RSV) is the leading cause of
serious lower respiratory tract disease in infants and children
(Feigen et al., eds., 1987, In: Textbook of Pediatric Infectious
Diseases, W B Saunders, Philadelphia at pages 1653-1675; New
Vaccine Development, Establishing Priorities, Vol. 1, 1985,
National Academy Press, Washington D.C. at pages 397-409; and
Ruuskanen et al., 1993, Curr. Probl. Pediatr. 23:50-79). The yearly
epidemic nature of RSV infection is evident worldwide, but the
incidence and severity of RSV disease in a given season vary by
region (Hall, 1993, Contemp. Pediatr. 10:92-110). In temperate
regions of the northern hemisphere, it usually begins in late fall
and ends in late spring. Primary RSV infection occurs most often in
children from 6 weeks to 2 years of age and uncommonly in the first
4 weeks of life during nosocomial epidemics (Hall et al., 1979, New
Engl. J. Med. 300:393-396). Children at increased risk for RSV
infection include, but are not limited to, preterm infants (Hall et
al., 1979, New Engl. J. Med. 300:393-396) and children with
bronchopulmonary dysplasia (Groothuis et al., 1988, Pediatrics
82:199-203), congenital heart disease (MacDonald et al., New Engi.
J. Med. 307:397-400), congenital or acquired immunodeficiency (Ogra
et al., 1988, Pediatr. Infect. Dis. J. 7:246-249; and Pohl et al.,
1992, J. Infect. Dis. 165:166-169), and cystic fibrosis (Abman et
al., 1988, J. Pediatr. 113:826-830). The fatality rate in infants
with heart or lung disease who are hospitalized with RSV infection
is 3%-4% (Navas et al., 1992, J. Pediatr. 121:348-354).
[0022] RSV infects adults as well as infants and children. In
healthy adults, RSV causes predominantly upper respiratory tract
disease. It has recently become evident that some adults,
especially the elderly, have symptomatic RSV infections more
frequently than had been previously reported (Evans, A. S., eds.,
1989, Viral Infections of Humans. Epidemiology and Control, 3rd
ed., Plenum Medical Book, New York at pages 525-544). Several
epidemics also have been reported among nursing home patients and
institutionalized young adults (Falsey, A. R., 1991, Infect.
Control Hosp. Epidemiol. 12:602-608; and Garvie et al., 1980, Br.
Med. J. 281:1253-1254). Finally, RSV may cause serious disease in
immunosuppressed persons, particularly bone marrow transplant
patients (Hertz et al., 1989, Medicine 68:269-281).
[0023] Treatment options for established RSV disease are limited.
Severe RSV disease of the lower respiratory tract often requires
considerable supportive care, including administration of
humidified oxygen and respiratory assistance (Fields et al., eds,
1990, Fields Virology, 2nd ed., Vol. 1, Raven Press, New York at
pages 1045-1072).
[0024] While a vaccine might prevent RSV infection, and/or
RSV-related disease, no vaccine is yet licensed for this
indication. A major obstacle to vaccine development is safety. A
formalin-inactivated vaccine, though immunogenic, unexpectedly
caused a higher and more severe incidence of lower respiratory
tract disease due to RSV in immunized infants than in infants
immunized with a similarly prepared trivalent parainfluenza vaccine
(Kim et al., 1969, Am. J. Epidemiol. 89:422-434; and Kapikian et
al., 1969, Am. J. Epidemiol. 89:405-421). Several candidate RSV
vaccines have been abandoned and others are under development
(Murphy et al., 1994, Virus Res. 32:13-36), but even if safety
issues are resolved, vaccine efficacy must also be improved. A
number of problems remain to be solved. Immunization would be
required in the immediate neonatal period since the peak incidence
of lower respiratory tract disease occurs at 2-5 months of age. The
immaturity of the neonatal immune response together with high
titers of maternally acquired RSV antibody may be expected to
reduce vaccine immunogenicity in the neonatal period (Murphy et
al., 1988, J. Virol. 62:3907-3910; and Murphy et al., 1991, Vaccine
9:185-189). Finally, primary RSV infection and disease do not
protect well against subsequent RSV disease (Henderson et al.,
1979, New Engl. J. Med. 300:530-534).
[0025] Currently, the only approved approach to prophylaxis of RSV
disease is passive immunization. Initial evidence suggesting a
protective role for IgG was obtained from observations involving
maternal antibody in ferrets (Prince, G. A., Ph.D. diss.,
University of California, Los Angeles, 1975) and humans (Lambrecht
et al, 1976, J. Infect. Dis. 134:211-217; and Glezen et al., 1981,
J. Pediatr. 98:708-715). Hemming et al. (Morell et al., eds., 1986,
Clinical Use of Intravenous Immunoglobulins, Academic Press, London
at pages 285-294) recognized the possible utility of RSV antibody
in treatment or prevention of RSV infection during studies
involving the pharmacokinetics of an intravenous immune globulin
(IVIG) in newborns suspected of having neonatal sepsis. In this
study, it was noted that one infant, whose respiratory secretions
yielded RSV, recovered rapidly after IVIG infusion. Subsequent
analysis of the IVIG lot revealed an unusually high titer of RSV
neutralizing antibody. This same group of investigators then
examined the ability of hyperimmune serum or immune globulin,
enriched for RSV neutralizing antibody, to protect cotton rats and
primates against RSV infection (Prince et al., 1985, Virus Res.
3:193-206; Prince et al., 1990, J. Virol. 64:3091-3092; Hemming et
al., 1985, J. Infect. Dis. 152:1083-1087; Prince et al., 1983,
Infect. Immun. 42:81-87; and Prince et al., 1985, J. Virol.
55:517-520). Results of these studies indicate that IVIG may be
used to prevent RSV infection, in addition to treating or
preventing RSV-related disorders.
[0026] Recent clinical studies have demonstrated the ability of
this passively administered RSV hyperimmune globulin (RSV IVIG) to
protect at-risk children from severe lower respiratory infection by
RSV (Groothius et al., 1993, New Engl. J. Med. 329:1524-1530; and
The PREVENT Study Group, 1997, Pediatrics 99:93-99). While this is
a major advance in preventing RSV infection, this treatment poses
certain limitations in its widespread use. First, RSV IVIG must be
infused intravenously over several hours to achieve an effective
dose. Second, the concentrations of active material in hyperimmune
globulins are insufficient to treat adults at risk or most children
with comprised cardiopulmonary function. Third, intravenous
infusion necessitates monthly hospital visits during the RSV
season. Finally, it may prove difficult to select sufficient donors
to produce a hyperimmune globulin for RSV to meet the demand for
this product. Currently, only approximately 8% of normal donors
have RSV neutralizing antibody titers high enough to qualify for
the production of hyperimmune globulin.
[0027] One way to improve the specific activity of the
immunoglobulin would be to develop one or more highly potent RSV
neutralizing monoclonal antibodies (MAbs). Such MAbs should be
human or humanized in order to retain favorable pharmacokinetics
and to avoid generating a human anti-mouse antibody response, as
repeat dosing would be required throughout the RSV season. Two
glycoproteins, F and G, on the surface of RSV have been shown to be
targets of neutralizing antibodies (Fields et al., 1990, supra; and
Murphy et al., 1994, supra).
[0028] A humanized antibody directed to an epitope in the A
antigenic site of the F protein of RSV, SYNAGIS.RTM., is approved
for intramuscular administration to pediatric patients for
prevention of serious lower respiratory tract disease caused by RSV
at recommended monthly doses of 15 mg/kg of body weight throughout
the RSV season (November through April in the northern hemisphere).
SYNAGIS.RTM. is a composite of human (95%) and murine (5%) antibody
sequences. See, Johnson et al., 1997, J. Infect. Diseases
176:1215-1224 and U.S. Pat. No. 5,824,307, the entire contents of
which are incorporated herein by reference. The human heavy chain
sequence was derived from the constant domains of human IgG1 and
the variable framework regions of the VH genes of Cor (Press et
al., 1970, Biochem. J. 117:641-660) and Cess (Takashi et al., 1984,
Proc. Natl Acad. Sci. USA 81:194-198). The human light chain
sequence was derived from the constant domain of CK and the
variable framework regions of the VL gene K104 with J.sub..kappa.-4
(Bentley et al., 1980, Nature 288:5194-5198). The murine sequences
derived from a murine monoclonal antibody, Mab 1129 (Beeler et al.,
1989, J. Virology 63:2941-2950), in a process which involved the
grafting of the murine complementarity determining regions into the
human antibody frameworks.
[0029] A significant portion of human respiratory disease is caused
by members of the viral sub-families Paramyxovirinae and
Pneumovirinae. The identification of another mammalian
Pneumovirinae that infects humans, hMPV, is described for the first
time herein. There still remains a need for an effective vaccine to
confer protection against a variety of viruses that result in
respiratory tract infection.
[0030] Citation or discussion of a reference herein shall not be
construed as an admission that such is prior art to the present
invention.
3. SUMMARY OF THE INVENTION
[0031] The invention relates to an isolated mammalian negative
strand RNA virus, metapneumovirus (MPV), within the sub-family
Pneumovirinae, of the family Paramyxoviridae. The present invention
also relates to isolated mammalian negative strand RNA viruses
identifiable as phylogenitically corresponding or relating to the
genus Metapneumovirus and components thereof. In particular, the
invention relates to a mammalian MPV that is phylogenetically more
closely related to a virus isolate deposited as I-2614 with CNCM,
Paris than it is related to APV type C. In more specific
embodiments, the mammalian MPV can be a variant A1, A2, B1 or B2
mammalian MPV. However, the mammalian MPVs of the present invention
may encompass additional variants yet to be identified, and are not
limited to variants A1, A2, B1 or B2.
[0032] The invention relates to genomic nucleotide sequences of
different isolates of mammalian metapneumoviruses, in particular
human metapneumoviruses. The invention relates to the use of the
sequence information of different isolates of mammalian
metapneumoviruses for diagnostic and therapeutic methods. The
present invention relates to the differences of the genomic
nucleotide sequences among the different metapneumovirus-isolates,
and their use in the diagnostic and therapeutic methods of the
invention. In specific embodiments, the nucleotide sequence of a
mammalian MPV that encodes for the N, M, F, L, P, M2-1, M2-2, SH or
G ORFs may be used to identify a virus of the invention. In other
specific embodiments, the nucleotide sequence of mammalian MPV that
encodes for the N, M, F, L, P, M2-1, M2-2, SH or G ORFs used to
classify a mammalian MPV into variant A1, A2, B1 or B2. In a
specific embodiment; the invention relates to the use of the single
nucleotide polymorphisms (SNPs) among different metapneumovirus
isolates for diagnostic purposes.
[0033] The invention relates to recombinant and chimeric viruses
that are derived from a mammalian MPV or avian pneumovirus (APV).
In accordance with the present invention, a recombinant virus is
one derived from a mammalian MPV or an APV that is encoded by
endogenous or native genomic sequences or non-native genomic
sequences. In accordance with the invention, a non-native sequence
is one that is different from the native or endogenous genomic
sequence due to one or more mutations, including, but not limited
to, point mutations, rearrangements, insertions, deletions etc., to
the genomic sequence that may or may not result in a phenotypic
change. In accordance with the invention, a chimeric virus of the
invention is a recombinant MPV or APV which further comprises a
heterologous nucleotide sequence. In accordance with the invention,
a chimeric virus may be encoded by a nucleotide sequence in which
heterologous nucleotide sequences have been added to the genome or
in which endogenous or native nucleotide sequences have been
replaced with heterologous nucleotide sequences. In certain
embodiments, a chimeric virus of the invention is derived from a
MPV or APV in which one or more of the ORFs or a portion thereof is
replaced by a homologous ORF or a portion thereof from another
strain of metapneumovirus. In an exemplary embodiment, the ORF of
the F gene of a mammalian MPV is replaced by the ORF of the F gene
of an APV. In certain other embodiments, a chimeric virus of the
invention is derived from an APV in which one or more of the ORFs
is replaced by a homologous ORF of a mammalian MPV.
[0034] The present invention relates to nucleotide sequences
encoding the genome of a metapneumovirus (including mammalian and
avian strains) or a portion thereof. The present invention relates
to nucleotide sequences encoding gene products of a
metapneumovirus. In particular, the invention relates to, but is
not limited to, nucleotide sequences encoding an F protein, a G
protein, an M protein, an SH protein, an N protein, a P protein, an
M2 protein, or an L protein of a MPV. In particular the invention
relates to nucleotide sequences encoding an F protein, a G protein,
an M protein, an SH protein, an N protein, a P protein, an M2
protein, or an L protein of a variant of mammalian MPV, such as but
not limited to variant A1, A2, B1 or B2 of a MPV. The present
invention further relates to a cDNA or RNA that encodes the genome
or a portion thereof of a metapneumovirus, including both mammalian
and avian, in addition to a nucleotide sequence which is
heterologous or non-native to the viral genome. The invention
further encompasses chimeric or recombinant viruses encoded by said
cDNAs or RNAs.
[0035] The invention further relates to polypeptides and amino acid
sequences of an F protein, a G protein, an M protein, an SH
protein, an N protein, a P protein, an M2 protein, or an L protein
of a mammalian MPV and different variants of mammalian MPV. The
invention further relates to antibodies against an F protein, a G
protein, an M protein, an SH protein, an N protein, a P protein, an
M2 protein, or an L protein of a mammalian MPV and different
variants of mammalian MPV. The antibodies can be used for
diagnostic and therapeutic methods. In certain more specific
embodiments, the antibodies are specific to mammalian MPV. In
certain embodiments, the antibodies are specific to a variant of
mammalian MPV. The invention further relates to vaccine
formulations and immunogenic compositions comprising one or more of
the following: an F protein, a G protein, an M protein, an SH
protein, an N protein, a P protein, an M2 protein, and/or an L
protein of a mammalian MPV.
[0036] The invention further relates to vaccine formulations and
immunogenic compositions comprising mammalian or avian
metapneumovirus, including recombinant and chimeric forms of said
viruses. In particular, the present invention encompasses vaccine
preparations comprising recombinant or chimeric forms of MPV and/or
APV. The invention further relates to vaccines comprising chimeric
MPV wherein the chimeric MPV encodes one or more APV proteins and
wherein the chimeric MPV optionally additionally expresses one or
more heterologous or non-native sequences. The invention also
relates to vaccines comprising chimeric APV wherein the chimeric
APV encodes one or more hMPV proteins and wherein the chimeric APV
optionally additionally expresses one or more heterologous or
non-native sequences. The present invention also relates to
multivalent vaccines, including bivalent and trivalent vaccines. In
particular, multivalent vaccines of the invention encompass two or
more antigenic polypeptides expressed by the same or different
pneumoviral vectors. The antigenic polypeptides of the multivalent
vaccines include but are not limited to, antigenic polypeptides of
MPV, APV, PIV, RSV, influenza or another negative strand RNA virus,
or another virus, such as morbillivirus.
[0037] The invention further relates to methods for treating a
respiratory tract infection in a subject. In certain embodiments,
the invention relates to treating a respiratory tract infection in
a subject by administering to the subject a vaccine formulation
comprising a mammalian MPV. In specific embodiments, the methods
for treating a respiratory tract infection in a subject comprise
administering to the subject a vaccine formulation or an
immunogenic composition comprising a recombinant or a chimeric
mammalian MPV or APV. In more specific embodiments, the recombinant
or chimeric mammalian MPV is attenuated. In a specific embodiment,
the invention relates to treating a respiratory tract infection in
a human patient comprising administering to the human patient a
vaccine formulation comprising a recombinant or chimeric APV, or a
nucleotide sequence encoding an F protein, a G protein, an M
protein, an SH protein, an N protein, a P protein, an M2 protein,
or an L protein of APV.
[0038] The invention provides an isolated negative-sense single
stranded RNA virus MPV belonging to the sub-family Pneumovirinae of
the family Paramyxoviridae and identifiable as phylogenetically
corresponding to the genus Metapneumovirus, wherein the virus is
phylogenetically more closely related to a virus isolate comprising
the nucleotide sequence of SEQ ID NO:18, SEQ ID NO:19, SEQ ID
NO:20, or SEQ ID NO:21 than it is related to turkey rhinotracheitis
virus, the etiological agent of avian rhinotracheitis. In certain
embodiments, the invention provides an isolated negative-sense
single stranded RNA metapneumovirus, wherein the genome of the
virus comprises a nucleotide sequence of SEQ ID NO:18. In certain
embodiments, the invention providesa n isolated negative-sense
single stranded RNA metapneumovirus, wherein the genome of the
virus comprises a nucleotide sequence of SEQ ID NO:19. In certain
embodiments, the invention provides an isolated negative-sense
single stranded RNA metapneumovirus, wherein the genome of the
virus comprises a nucleotide sequence of SEQ ID NO:20. In certain
embodiments, the invention provides an isolated negative-sense
single stranded RNA metapneumovirus, wherein the genome of the
virus comprises a nucleotide sequence of SEQ ID NO:21. In certain
embodiments, the invention provides an isolated nucleic acid,
wherein the nucleic acid has a nucleotide sequence that is at least
70% identical to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID
NO:21, wherein sequence identity is determined over the entire
length of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 or SEQ ID NO:22.
In certain embodiments, the invention providesa n isolated nucleic
acid, wherein the nucleic acid encodes a protein comprising (i) an
amino acid sequence that is at least 66% identical to the G protein
of a mammalian MPV variant B1 (SEQ ID NO:324); (ii) an amino acid
sequence that is at least 98.5% identical to the N protein of a
mammalian MPV variant B1 (SEQ ID NO:368); (iii) an amino acid
sequence that is at least 96% identical the P protein of a
mammalian MPV variant B1 (SEQ ID NO:376); (iv) an amino acid
sequence that is identical the M protein of a mammalian MPV variant
B1 (SEQ ID NO:360); (v) an amino acid sequence that is at least 99%
identical the F protein of a mammalian MPV variant B1 (SEQ ID
NO:316); (vi) an amino acid sequence that is at least 98% identical
the M2-1 protein of a mammalian MPV variant B1 (SEQ ID NO:340);
(vii) an amino acid sequence that is at least 99% identical the
M2-2 protein of a mammalian MPV variant B1 (SEQ ID NO:348); (viii)
an amino acid sequence that is at least 83% identical the SH
protein of a mammalian MPV variant B1 (SEQ ID NO:384); or (ix) an
amino acid sequence that is at least 99% identical the L protein a
mammalian MPV variant B1 (SEQ ID NO:332). In certain embodiments,
the invention provides an isolated nucleic acid, wherein the
nucleic acid encodes a protein comprising (i) an amino acid
sequence that is at least 66% identical to the G protein of a
mammalian MPV variant A1 (SEQ ID NO:322); (ii) an amino acid
sequence that is at least 99.5% identical to the N protein of a
mammalian MPV variant A1 (SEQ ID NO:366); (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant A1 (SEQ ID NO:374); (iv) an amino acid
sequence that is at least 99% identical to the M protein of a
mammalian MPV variant A1 (SEQ ID NO:358); (v) an amino acid
sequence that is at least 98% identical to the F protein of a
mammalian MPV variant A1 (SEQ ID NO:314); (vi) an amino acid
sequence that is at least 99% identical to the M2-1 protein of a
mammalian MPV variant A1 (SEQ ID NO:338) (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A1 (SEQ ID NO:346) (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A1 (SEQ ID NO:382); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a virus
of a mammalian MPV variant A1 (SEQ ID NO:330). In certain
embodiments, the invention provides n isolated nucleic acid,
wherein the nucleic acid encodes a protein comprising (i) an amino
acid sequence that is at least 66% identical to the G protein of a
mammalian MPV variant A2 (SEQ ID NO:332); (ii) an amino acid
sequence that is at least 99.5% identical to the N protein of a
mammalian MPV variant A2 (SEQ ID NO:367); (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant A2 (SEQ ID NO:375); (iv) an amino acid
sequence that is at least 99% identical to the M protein of a
mammalian MPV variant A2 (SEQ ID NO:359); (v) an amino acid
sequence that is at least 98% identical to the F protein of a
mammalian MPV variant A2 (SEQ ID NO:315); (vi) an amino acid
sequence that is at least 99% identical to the M2-1 protein of a
mammalian MPV variant A2 (SEQ ID NO: 339); (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A2 (SEQ ID NO:347); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A2 (SEQ ID NO:383); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant A2 (SEQ ID NO:331). In certain embodiments,
the invention provides an isolated nucleic acid, wherein the
nucleic acid encodes a protein comprising (i) an amino acid
sequence that is at least 66% identical to the G protein of a
mammalian MPV variant B2 (SEQ ID NO:325); (ii) an amino acid
sequence that is at least 97% identical to the N protein of a
mammalian MPV variant B2 (SEQ ID NO:369); (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant B2 (SEQ ID NO:377); (iv) an amino acid
sequence that is identical to the M protein of a mammalian MPV
variant B2 (SEQ ID NO:361) (v) an amino acid sequence that is at
least 99% identical to the F protein of a mammalian MPV variant B2
(SEQ ID NO:317); (vi) an amino acid sequence that is at least 98%
identical to the M2-1 protein of a mammalian MPV variant B2 (SEQ ID
NO:341); (vii) an amino acid sequence that is at least 99%
identical to the M2-2 protein of a mammalian MPV variant B2 (SEQ ID
NO:349); (viii) an amino acid sequence that is at least 84%
identical to the SH protein of a mammalian MPV variant B2 (SEQ ID
NO:385); or (ix) an amino acid sequence that is at least 99%
identical to the L protein of a mammalian MPV variant B2 (SEQ ID
NO:333). In certain embodiments, the invention provides an isolated
nucleic acid, wherein the nucleic acid hybridizes specifically
under high stringency, medium stringency, or low stringency
conditions to a nucleic acid of a mammalian MPV.
[0039] In certain embodiments, the invention provides a virus
comprising the nucleotide sequence of SEQ ID NO:18-21 or a fragment
thereof.
[0040] In certain embodiments, the invention provides an isolated
protein, wherein the protein comprises (i) an amino acid sequence
that is at least 66% identical to the G protein of a mammalian MPV
variant B1 (SEQ ID NO:324); (ii) an amino acid sequence that is at
least 98.5% identical to the N protein of a mammalian MPV variant
B1 (SEQ ID NO:368); (iii) an amino acid sequence that is at least
96% identical the P protein of a mammalian MPV variant B1 (SEQ ID
NO:376); (iv) an amino acid sequence that is identical the M
protein of a mammalian MPV variant B1 (SEQ ID NO:360); (v) an amino
acid sequence that is at least 99% identical the F protein of a
mammalian MPV variant B1 (SEQ ID NO:316) (vi) an amino acid
sequence that is at least 98% identical the M2-1 protein of a
mammalian MPV variant B1 (SEQ ID NO:340); (vii) an amino acid
sequence that is at least 99% identical the M2-2 protein of a
mammalian MPV variant B1 (SEQ ID NO:348); (viii) an amino acid
sequence that is at least 83% identical the SH protein of a
mammalian MPV variant B1 (SEQ ID NO:384); or (ix) an amino acid
sequence that is at least 99% identical the L protein a mammalian
MPV variant B1 (SEQ ID NO:332). In certain embodiments, the
invention provides an isolated protein, wherein the protein
comprises: (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant A1 (SEQ ID
NO:322); (ii) an amino acid sequence that is at least 99.5%
identical to the N protein of a mammalian MPV variant A1 (SEQ ID
NO:366) (iii) an amino acid sequence that is at least 96% identical
to the P protein of a mammalian MPV variant A1 (SEQ ID NO:374);
(iv) an amino acid sequence that is at least 99% identical to the M
protein of a mammalian MPV variant A1 (SEQ ID NO:358); (v) an amino
acid sequence that is at least 98% identical to the F protein of a
mammalian MPV variant A1 (SEQ ID NO:314); (vi) an amino acid
sequence that is at least 99% identical to the M2-1 protein of a
mammalian MPV variant A1 (SEQ ID NO:338) (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A1 (SEQ ID NO:346) (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A1 (SEQ ID NO:382); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a virus
of a mammalian MPV variant A1 (SEQ ID NO:330) In certain
embodiments, the invention provides isolated protein, wherein the
protein comprises (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant A2 (SEQ ID
NO:332); (ii) an amino acid sequence that is at least 99.5%
identical to the N protein of a mammalian MPV variant A2 (SEQ ID
NO:367); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant A2 (SEQ ID
NO:375) (iv) an amino acid sequence that is at least 99% identical
to the M protein of a mammalian MPV variant A2 (SEQ ID NO:359); (v)
an amino acid sequence that is at least 98% identical to the F
protein of a mammalian MPV variant A2 (SEQ ID NO:315) (vi) an amino
acid sequence that is at least 99% identical to the M2-1 protein of
a mammalian MPV variant A2 (SEQ ID NO: 339); (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A2 (SEQ ID NO:347) (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A2 (SEQ ID NO:383); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant A2 (SEQ ID NO:331). In certain embodiments,
the invention provides an isolated protein, wherein the protein
comprises: (i) an amino acid sequence that is at least 66%
identical to the G protein of a mammalian MPV variant B2 (SEQ ID
NO:325); (ii) an amino acid sequence that is at least 97% identical
to the N protein of a mammalian MPV variant B2 (SEQ ID NO:369)
(iii) an amino acid sequence that is at least 96% identical to the
P protein of a mammalian MPV variant B2 (SEQ ID NO:377) (iv) an
amino acid sequence that is identical to the M protein of a
mammalian MPV variant B2 (SEQ ID NO:361); (v) an amino acid
sequence that is at least 99% identical to the F protein of a
mammalian MPV variant B2 (SEQ ID NO:317); (vi) an amino acid
sequence that is at least 98% identical to the M2-1 protein of a
mammalian MPV variant B2 (SEQ ID NO:341); (vii) an amino acid
sequence that is at least 99% identical to the M2-2 protein of a
mammalian MPV variant B2 (SEQ ID NO:349); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant B2 (SEQ ID NO:385); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant B2 (SEQ ID NO:333). In certain embodiments,
the invention provides an antibody, wherein the antibody binds
specifically to a protein consisting of (i) an amino acid sequence
that is at least 66% identical to the G protein of a mammalian MPV
variant B1 (SEQ ID NO:324); (ii) an amino acid sequence that is at
least 98.5% identical to the N protein of a mammalian MPV variant
B1 (SEQ ID NO:368); (iii) an amino acid sequence that is at least
96% identical the P protein of a mammalian MPV variant B1 (SEQ ID
NO:376) (iv an amino acid sequence that is identical the M protein
of a mammalian MPV variant B1 (SEQ ID NO:360); (v) an amino acid
sequence that is at least 99% identical the F protein of a
mammalian MPV variant BI (SEQ ID NO:316); (vi) an amino acid
sequence that is at least 98% identical the M2-1 protein of a
mammalian MPV variant B1 (SEQ ID NO:340) (vii) an amino acid
sequence that is at least 99% identical the M2-2 protein of a
mammalian MPV variant B1 (SEQ ID NO:348); (viii) an amino acid
sequence that is at least 83% identical the SH protein of a
mammalian MPV variant B1 (SEQ ID NO:384); (ix) an amino acid
sequence that is at least 99% identical the L protein a mammalian
MPV variant B1 (SEQ ID NO:332). In certain embodiments, the
invention provides an antibody, wherein the antibody binds
specifically to a protein consisting of: (i) an amino acid sequence
that is at least 66% identical to the G protein of a mammalian MPV
variant A1 (SEQ ID NO:322); (ii) an amino acid sequence that is at
least 99.5% identical to the N protein of a mammalian MPV variant
A1 (SEQ ID NO:366); (iii an amino acid sequence that is at least
96% identical to the P protein of a mammalian MPV variant A1 (SEQ
ID NO:374); (iv) an amino acid sequence that is at least 99%
identical to the M protein of a mammalian MPV variant A1 (SEQ ID
NO:358); (v) an amino acid sequence that is at least 98% identical
to the F protein of a mammalian MPV variant A1 (SEQ ID NO:314);
(vi) an amino acid sequence that is at least 99% identical to the
M2-1 protein of a mammalian MPV variant A1 (SEQ If) NO:338); (vii)
an amino acid sequence that is at least 96% identical to the M2-2
protein of a mammalian MPV variant A1 (SEQ ID NO:346); (viii) an
amino acid sequence that is at least 84% identical to the SH
protein of a mammalian MPV variant A1 (SEQ ID NO:382); (ix) an
amino acid sequence that is at least 99% identical to the L protein
of a virus of a mammalian MPV variant A1 (SEQ ID NO:330). In
certain embodiments, the invention provides an antibody, wherein
the antibody binds specifically to a protein consisting of: (i) an
amino acid sequence that is at least 66% identical to the G protein
of a mammalian MPV variant A2 (SEQ ID NO:332); (ii) an amino acid
sequence that is at least 96% identical to the N protein of a
mammalian MPV variant A2 (SEQ ID NO:367) (iii) an amino acid
sequence that is at least 96% identical to the P protein of a
mammalian MPV variant A2 (SEQ ID NO:375); (iv) an amino acid
sequence that is at least 99% identical to the M protein of a
mammalian MPV variant A2 (SEQ ID NO:359); (v) an amino acid
sequence that is at least 98% identical to the F protein of a
mammalian MPV variant A2 (SEQ ID NO:315) (vi) an amino acid
sequence that is at least 99% identical to the M2-1 protein of a
mammalian MPV variant A2 (SEQ ID NO: 339); (vii) an amino acid
sequence that is at least 96% identical to the M2-2 protein of a
mammalian MPV variant A2 (SEQ ID NO:347); (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant A2 (SEQ ID NO:383); (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant A2 (SEQ ID NO:331) In certain embodiments,
the invention provides an antibody, wherein the antibody binds
specifically to a protein consisting of: (i) an amino acid sequence
that is at least 66% identical to the G protein of a mammalian MPV
variant B2 (SEQ ID NO:325); (ii) an amino acid sequence that is at
least 97% identical to the N protein of a mammalian MPV variant B2
(SEQ ID NO:369); (iii) an amino acid sequence that is at least 96%
identical to the P protein of a mammalian MPV variant B2 (SEQ ID
NO:377) (iv) an amino acid sequence that is identical to the M
protein of a mammalian MPV variant B2 (SEQ ID NO:361); (v) an amino
acid sequence that is at least 99% identical to the F protein of a
mammalian MPV variant B2 (SEQ ID NO:317); (vi) an amino acid
sequence that is at least 98% identical to the M2-1 protein of a
mammalian MPV variant B2 (SEQ ID NO:341); (vii) an amino acid
sequence that is at least 99% identical to the M2-2 protein of a
mammalian MPV variant B2 (SEQ ID NO:349) (viii) an amino acid
sequence that is at least 84% identical to the SH protein of a
mammalian MPV variant B2 (SEQ ID NO:385); or (ix) an amino acid
sequence that is at least 99% identical to the L protein of a
mammalian MPV variant B2 (SEQ ID NO:333). In certain embodiments,
the invention provides a method for detecting a variant B1
mammalian MPV in a sample, wherein said method comprises contacting
the sample with the antibody of specific to a variant B1. In
certain embodiments, the invention provides method for detecting a
variant Al mammalian MPV in a sample, wherein said method comprises
contacting the sample with the antibody specific to variant A1. In
certain embodiments, the invention provides a method for detecting
a variant A2 mammalian MPV in a sample, wherein said method
comprises contacting the sample with the antibody specific to
variant A2. In certain embodiments, the invention provides a method
for detecting a variant B2 mammalian MPV in a sample, wherein said
method comprises contacting the sample with the antibody specific
to B2.
[0041] In certain embodiments, the invention provides a method for
identifying a viral isolate as a mammalian MPV, wherein said method
comprises contacting said isolate or a component thereof with the
antibody specific to a mammalian MPV. In certain embodiments, the
invention provides method for virologically diagnosing a MPV
infection of a mammal comprising determining in a sample of said
mammal the presence of a viral isolate or component thereof by
contacting the sample with the antibody specific to a MPV. In
certain embodiments, the invention provides method for
virologically diagnosing a mammalian MPV infection of a subject,
wherein said method comprises obtaining a sample from the subject
and contacting the sample with an antibody specific to MPV wherein
if the antibody binds to the sample the subject is infected with
mammalian MPV.
[0042] In certain embodiments, the invention provides an infectious
recombinant virus, wherein the recombinant virus comprises the
genome of a mammalian MPV and further comprises a non-native MPV
sequence. In certain embodiments, the invention provides a
recombinant nucleic acid, wherein the recombinant nucleic acid
comprises (i) a nucleic acid encoding a G polypeptide of an MPV Al
variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide. In certain embodiments, the invention provides
recombinant nucleic acid, wherein the recombinant nucleic acid
comprises (i) a nucleic acid encoding a G polypeptide of an MPV A2
variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide. In certain embodiments, the invention provides s
recombinant nucleic acid, wherein the recombinant nucleic acid
comprises (i) a nucleic acid encoding a G polypeptide of an MPV B1
variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide. In certain embodiments, the invention provides a
recombinant nucleic acid, wherein the recombinant nucleic acid
comprises (i) a nucleic acid encoding a G polypeptide of an MPV B2
variant; and (ii) a nucleic acid encoding a non-native MPV
polypeptide.
[0043] In certain embodiments, the invention provides an infectious
chimeric virus, wherein the chimeric virus comprises the genome of
a mammalian MPV of a first variant, wherein one or more of the open
reading frames in the genome of the mammalian MPV of the first
variant have been replaced by the analogous open reading frame from
a mammalian MPV of a second variant. In certain embodiments, the
invention provides an infectious chimeric virus, wherein the
chimeric virus comprises the genome of a mammalian MPV of a first
variant, wherein one or more of open reading frames of a mammalian
MPV of a second variant are inserted into the genome of the
mammalian MPV of the first variant.
[0044] In certain embodiments, the invention provides an infectious
chimeric virus, wherein the chimeric virus comprises the genome of
a mammalian MPV, wherein one or more of the open reading frames in
the genome of the mammalian MPV have been replaced by an ORF which
encodes one or more of an avian MPV F protein; an avian MPV G
protein (iii) an avian MPV SH protein; (iv) an avian MPV N protein
(v) an avian MPV P protein; (vi) an avian MPV M2 protein;(vii) an
avian MPV M2-1 protein; (viii) an avian MPV M2-2 protein; or (ix)
an avian MPV L protein. In certain embodiments, the invention
provides an infectious chimeric virus, wherein the chimeric virus
comprises the genome of an avian MPV, wherein one or more of the
open reading frames in the genome of the avian MPV have been
replaced by an ORF which encodes one or more of (i) a mammalian MPV
F protein (ii) a mammalian MPV G protein; (iii) a mammalian MPV SH
protein; (iv) a mammalian MPV N protein; (v) a mammalian MPV P
protein; (vi) a mammalian MPV M2 protein; (vii) a mammalian MPV
M2-1 protein; (viii) a mammalian MPV M2-2 protein; or (ix) a
mammalian MPV L protein.
[0045] In certain embodiments, the invention provides an
immunogenic composition, wherein the immunogenic composition
comprises the infectious recombinant virus of the invention.
[0046] In certain embodiments, the invention provides a method for
detecting a mammalian MPV in a sample, wherein the method comprises
contacting the sample with a nucleic acid sequence of the
invention. In certain embodiments, the invention provides a
pharmaceutical composition, wherein the pharmaceutical composition
comprises the infectious recombinant virus of the invention.
[0047] In certain embodiments, the invention provides a method for
treating or preventing a respiratory tract infection in a mammal,
said method comprising administering a vaccine comprising a
mammalian metapneumovirus. In certain embodiments, the invention
provides an method for treating or preventing a respiratory tract
infection in a mammal, said method comprising administering a
vaccine comprising the recombinant mammalian metapneumovirus of the
invention.
[0048] In certain embodiments, the invention provides an method for
treating or preventing a respiratory tract infection in a mammal,
said method comprising administering a vaccine comprising avian
metapneumovirus. In certain embodiments, the invention provides a
method for treating or preventing a respiratory tract infection in
a human, said method comprising administering a vaccine comprising
avian metapneumovirus. In certain embodiments, the invention
provides a method for treating or preventing a respiratory tract
infection in a subject, said method comprising administering to the
subject the composition of the invention.
[0049] In certain embodiments, the invention provides a method for
identifying a compound useful for the treatment of infections with
mammalian MPV, wherein the method comprises: (a) infecting an
animal with a mammalian MPV; (b) Administering to the animal a test
compound; and (c) determining the effect of the test compound on
the infection of the animal, wherein a test compound that reduces
the extent of the infection or that ameliorates the symptoms
associated with the infection is identified as a compound useful
for the treatment of infections with mammalian MPV. In certain
embodiments, the invention provides a method for identifying a
compound useful for the treatment of infections with mammalian MPV,
wherein the method comprises (a) infecting a cell culture with a
mammalian MPV (b) incubating the cell culture with a test compound;
and (c) determining the effect of the test compound on the
infection of the cell culture, wherein a test compound that reduces
the extent of the infection is identified as a compound useful for
the treatment of infections with mammalian MPV. In certain
embodiments, the invention provides a method for diagnosing a
mammalian MPV infection of an animal, wherein the method comprises
determining in a sample of said animal the presence of a viral
isolate or component thereof by reacting said sample with a nucleic
acid or an antibody reactive with a component of an avian
pneumovirus, said nucleic acid or antibody being cross-reactive
with a component of MPV.
[0050] In certain embodiments, the invention provides a method for
serologically diagnosing a mammalian MPV infection of an animal,
wherein the method comprises contacting a sample from the animal
with the protein of the invention. In certain embodiments, the
invention provides a method for serologically diagnosing a
mammalian MPV infection of an animal, wherein the method comprises
contacting a sample from the animal with a protein of an APV. In
certain embodiments, the invention provides an method for
diagnosing an APV infection of a bird comprising contacting a
sample from the animal with the protein of the invention.
[0051] In certain embodiments, the invention provides an isolated
negative-sense single stranded RNA virus MPV belonging to the
sub-family Pneumovirinae of the family Paramyxoviridae and
identifiable as phylogenetically corresponding to the genus
Metapneumovirus, wherein the virus is phylogenetically more closely
related to a virus isolate deposited as I-2614 with CNCM, Paris
than to turkey rhinotracheitis virus, the etiological agent of
avian rhinotracheitis.
[0052] 3.1 Conventions and Abbreviations
1 cDNA complementary DNA L large protein M matrix protein (lines
inside of envelope) F fusion glycoprotein HN
hemagglutinin-neuraminidase glycoprotein N, NP or NC nucleoprotein
(associated with RNA and required for polymerase activity) P
phosphoprotein MOI multiplicity of infection NA neuraminidase
(envelope glycoprotein) PIV parainfluenza virus hPIV human
parainfluenza virus hPIV3 human parainfluenza virus type 3 APV/hMPV
recombinant APV with hMPV sequences hMPV/APV recombinant hMPV with
APV sequences Mammalian MPV mammalian metapneumovirus nt nucleotide
RNP ribonucleoprotein rRNP recombinant RNP vRNA genomic virus RNA
cRNA antigenomic virus RNA hMPV human metapneumovirus APV avian
pneumovirus MVA modified vaccinia virus Ankara FACS Fluorescence
Activated Cell Sorter CPE cytopathic effects Position 1 Position of
the first gene of the viral genome to be transcribed Position 2
Position between the first and the second open reading frame of the
native viral genome, or alternatively, the position of the second
gene of the viral genome to be transcribed Position 3 Position
between the second and the third open reading frame of the native
viral genome, or alternatively, the position of the third gene of
the viral genome to be transcribed. Position 4 Position between the
third and the fourth open reading frame of the native viral genome,
or alternatively, the position of the fourth gene of the viral
genome to be transcribed. Position 5 Position between the fourth
and the fifth open reading frame of the native viral genome, or
alternatively, the position of the fifth gene of the viral genome
to be transcribed. Position 6 Position between the fifth and the
sixth open reading frame of the native viral genome, or
alternatively, the position of the sixth gene of the viral genome
to be transcribed.
4. DESCRIPTION OF THE FIGURES
[0053] FIG. 1: Percentage homology found between the amino acid
sequence of isolate 00-1 and other members of the Pneumovirinae.
Percentages (x100) are given for the amino acid sequences of N, P,
M, F and two RAP-PCR fragments in L (8 and 9/10).
[0054] FIG. 2: Seroprevalence of MPV in humans categorized by age
group, using immunofluorescence and virus neutralisation
assays.
[0055] FIG. 3: Schematic representation of the genome of APV with
the location and size of the fragments obtained with RAP-PCR and
RT-PCR on virus isolate 00-1 (A1). Fragments 1 to 10 were obtained
using RAP-PCR. Fragment A was obtained with a primer in RAP-PCR
fragment 1 and 2 and a primer that was designed based on alignment
of leader and trailer sequences of APV and RSV (Randhawa et al.,
1997, J. Virol. 71:9849-9854). Fragment B was obtained using
primers designed in RAP-PCR fragment 1 and 2 and RAP-PCR fragment
3. Fragment C was obtained with primers designed in RAP-PCR
fragment 3 and RAP-PCR fragments 4, 5, 6, and 7.
[0056] FIG. 4: Comparison of the N, P, M and F ORFs of members of
the subfamily Pneumovirinae and virus isolate 00-1 (A1). The
alignment shows the amino acid sequence of the complete N, F, M and
P proteins and partial L proteins of virus isolate 00-1 (A1). Amino
acids that differ between isolate 00-1 (A1) and the other viruses
are shown, identical amino acids are represented by periods. Gaps
are represented as dashes. Numbers correspond to amino acid
positions in the proteins. Abbreviations are as follows: APV-A, B
or C: Avian Pneumovirus type A, B or C; hRSV: bovine or human
respiratory syncytial virus; PVM: pneumonia virus of mice. L8:
fragment 8 obtained with RAP-PCR located in L, L 9/10: consensus of
fragment 9 and 10 obtained with RAP-PCR, located in L. For the L
alignment only bRSV, hRSV and APV-A sequences were available.
[0057] FIG. 5: Alignment of the predicted amino acid sequence of
the nucleoprotein of MPV with those of other pneumoviruses. The
conserved regions are represented by boxes and labeled A, B, and C.
The conserved region among pneumoviruses is shown in gray and
shaded. Gaps are represented by dashes, periods indicate the
positions of identical amino acid residues compared to MPV.
[0058] FIG. 6: Amino acid sequence comparison of the phosphoprotein
of MPV with those of other pneumoviruses. The region of high
similarity is boxed, and the glutamate rich region is in grey and
shaded. Gaps are represented by dashes. Periods indicate the
position of identical amino acid residues compared to MPV.
[0059] FIG. 7: Comparison of the deduced amino acid sequence of the
matrix protein of MPV with those of other pneumoviruses. The
conserved hexapeptide sequence is in grey and shaded. Gaps are
represented by dashes. Periods indicate the position of identical
amino acid residues relative to MPV.
[0060] FIG. 8: Genomic map of MPV isolate 00-1 (A1). The nucleotide
positions of the start and stop codons are indicated under each
ORF. The double lines which cross the L ORF indicate the shortened
representation of the L gene. The three reading frames below the
map indicate the primary G ORF (nt 6262-6972) and overlapping
potential secondary ORFs.
[0061] FIG. 9: Alignment of the predicted amino acid sequence of
the fusion protein of MPV with those of other pneumoviruses. The
conserved cysteine residues are boxed. N-linked glycosylation sites
are underlined. The cleavage site of F0 is double underlined; the
fusion peptide, signal peptide, and membrane anchor domain are
shown in grey and shaded. Gaps are represented by dashes, and
periods indicate the position of identical amino acids relative to
MPV.
[0062] FIG. 10: Comparison of amino acid sequences of the M2 ORFs
of MPV with those of other pneumoviruses. The alignment of M2-1
ORFs is shown in panel A, with the conserved amino terminus shown
in grey and shaded. The three conserved cysteine residues are
printed bold face and indicated by #. The alignment of the M2-2
ORFs is shown in panel B. Gaps are represented by dashes and
periods indicate the position of identical amino acids relative to
MPV.
[0063] FIG. 11: Amino acid sequence analyses of the SH ORF of MPV.
(A) Amino acid sequence of the SH ORF of MPV, with the serine and
threonine residues in grey and shaded, cysteine residues in bold
face, and the hydrophobic region doubly underlined. Potential
N-linked glycosylation sites are single underlined. Arrows indicate
the positions of the basic amino acids flanking the hydrophobic
domain. (B) Alignment of the hydrophobicity plots of the SH
proteins of MPV, APV-A and hRSV-B. A window of 17 amino acids was
used. Arrows indicate a strong hydrophobic domain. Positions within
the ORF are given on the X-axis.
[0064] FIG. 12: Amino acid sequence analyses of the G ORF of MPV.
(A) Amino acid sequence of the G ORF of MPV, with serine,
threonine, and proline residues in grey and shaded. The cysteine
residue is in bold face, and the hydrophobic region is doubly
underlined. The potential N-linked glycosylation sites are singly
underlined. (B) Alignment of the hydrophobicity plots of the G
proteins of MPV, APV-A and hRSV-B. A window of 17 amino acids was
used. Arrows indicate the hydrophobic region, and positions within
the ORF are given at the X-axis.
[0065] FIG. 13: Comparison of the amino acid sequences of a
conserved domain of the polymerase gene of MPV and other
paramyxoviruses. Domain III is shown with the four conserved
polymerase motifs (A, B, C, D) in domain III (Poch et al., 1989
EMBO J 8:3867-74; Poch et al., 1990, J. Gen. Virol 71:1153-62)
boxed. Gaps are represented by dashes and periods indicate the
position of identical amino acid residues relative to MPV.
Abbreviations used are as follows: hPIV-3: human parainfluenza
virus type 3; SV: sendai virus; hPIV-2: human parainfluenza virus
type 2; NDV: New castle disease virus; MV: measles virus; nipah:
Nipah virus.
[0066] FIG. 14: Phylogenetic analyses of the N, F, M, and F ORF s
of members of the genus Pneumovirinae and virus isolate 00-1 (A1).
Phylogenetic analysis was performed on viral sequences from the
following genes: F (panel A), N (panel B), M (panel C), and P
(panel D). The phylogenetic trees are based on maximum likelihood
analyses using 100 bootstraps and 3 jumbles. The scale representing
the number of nucleotide changes is shown for each tree.
[0067] FIG. 15: Phylogenetic analyses of the M2-1 and L ORFs of MPV
and selected paramyxoviruses. The M2-1 ORF was aligned with the
M2-1 ORFs of other members of the genus Pneumovirinae (A) and the L
ORF was aligned with L ORFs members of the genus pneumovirinae and
selected other paramyxoviruses as described in the legend of FIG.
13. Phylogenetic trees were generated by maximum likelihood
analyses using 100 bootstraps and 3 jumbles. The scale representing
the number of nucleotide changes is shown for each tree. Numbers in
the trees represent bootstrap values based on the consensus
trees.
[0068] FIG. 16: Phylogenetic relationship for parts of the F (panel
A), N (panel B), M (panel C) 20 and L (panel D) ORFs of nine of the
primary MPV isolates with APV-C, its closest relative genetically.
The phylogenetic trees are based on maximum likelihood analyses.
The scale representing the number of nucleotide changes is shown
for each tree. Accession numbers for APV-C: panel A: D00850; panel
B: U39295; panel C: X58639; and panel D: U65312.
[0069] FIG. 17: Alignment of the F genes of different isolates of
hMPV of all four variants, variant A1, A2, B1, or B2.
[0070] FIG. 18: Alignment of the F proteins of different isolates
of hMPV of all four variants, variant A1, A2, B1, or B2.
[0071] FIG. 19: Alignment of the G genes of different isolates of
hMPV of all four variants, variant A1, A2, B1, or B2.
[0072] FIG. 20: Alignment of the G proteins of different isolates
of hMPV of all four variants, variant A1, A2, B1, or B2.
[0073] FIG. 21: Phylogenetic tree based on the F gene sequences
showing the phylogenetic relationship of the different hMPV
isolates with the respective variants of hMPV.
[0074] FIG. 22: Phylogenetic tree based on the G gene sequences
showing the phylogenetic relationship of the different hMPV
isolates with the respective variants of hMPV is shown in FIG.
13.
[0075] FIG. 23: Growth curve of hMPV isolate 00-1 (A1) in Vero
cells. The Vero cells were infected at a MOI of 0.1.
[0076] FIG. 24: Sequence of CAT-hMPV minireplicon construct. The
function encoded by a segment of sequence is indicated underneath
the sequence.
[0077] FIG. 25: Expression of CAT from the CAT-hMPV minireplicon.
The different constructs used for transfection are indicated on the
x-axis; the amount of CAT expression is indicated on the y-axis.
The Figure shows CAT expression 24 hours after transfection and CAT
expression 48 hours after transfection. Standards were dilutions of
CAT protein.
[0078] FIG. 26: Leader and Trailer Sequence Comparison: Alignments
of the leader and trailer sequences of different viruses as
indicated are shown.
[0079] FIG. 27: hMPV genome analysis: PCR fragments of hMPV genomic
sequence relative to the hMPV genomic organization are shown. The
position of mutations are shown underneath the vertical bars
indicating the PCR fragments.
[0080] FIG. 28: Restriction maps of hMPV isolate 00-1 (A1) and hMPV
isolate 99-1 (B1). Restriction sites in the respective isolates are
indicated underneath the diagram showing the genomic organization
of hMPV. The scale on top of the diagram indicates the position in
the HMPV genome in kb.
[0081] FIGS. 29A and 29B: hMPV cDNA assembly. The diagram on top
shows the genomic organization of hMPV, the bars underneath
indicate the PCR fragments (see FIG. 27) that are assembled to
result in a full length cDNA encoding the virus. The numbers on top
of the bars representing the PCR fragments indicate the position in
the viral genome in basepairs.
[0082] FIG. 30: Nucleotide and amino acid sequence information from
the 3'end of the genome of MPV isolate 00-1 (A1). ORFs are given.
N: ORF for nucleoprotein; P: ORF for phosphoprotein; M: ORF for
matrix protein; F: ORF for fusion protein; GE: gene end; GS: gene
start.
[0083] FIGS. 31A and B: Nucleotide and amino acid sequence
information from obtained fragments in the polymerase gene (L) of
MPV isolates 00-1 (A1). Positioning of the fragments in L is based
on protein homologies with APV-A (accession number U65312). The
translated fragment 8 (FIG. 31A) is located at amino acid number 8
to 243, and the consensus of fragments 9 and 10 (FIG. 31B) is
located at amino acid number 1358 to 1464 of the APV-A L ORF.
[0084] FIG. 32: Results of RT-PCR assays on throat and nose swabs
of 12 guinea pigs 15 inoculated with ned/00/01 (A1) and/or
ned/99/01 (B1).
[0085] FIG. 33A: IgG response against ned/00/01 (A1) and ned/99/01
(B1) for guinea pigs infected with ned/00/01 (A1) and re-infected
with ned/00/01 (A1) (GP 4, 5 and 6) or ned/99/01 (B1) (GP 1 and
3).
[0086] FIG. 33B: IgG response against ned/00/01 (A1) and ned/99/01
(B1) for guinea pigs infected with ned/99/01 and re-infected with
either ned/00/01 (A1) (GP's 8 and 9) or with ned/99/01 (B1) (GP's
10, 11, 12).
[0087] FIG. 34: Specificity of the ned/00/01 (A1) and ned/99/01
(B1) ELISA on sera taken from guinea pigs infected with either
ned/00/01 (A1) or ned/99/01 (B1).
[0088] FIG. 35: Mean IgG response against ned/00/01 (A1) and
ned/99/01 (B1) ELISA of 3 homologous (00-1/00-1), 2 homologous
(99-1/99-1), 2 heterologous (99-1/00-1) and 2 heterologous
(00-1/99-1) infected guinea pigs.
[0089] FIG. 36: Mean percentage of APV inhibition of hMPV infected
guinea pigs.
[0090] FIG. 37: Virus neutralization titers of ned/00/01 (A1) and
ned/99/01 (BI) infected guinea pigs against ned/00/01 (A1),
ned/99/01 (B1) and APV-C.
[0091] FIG. 38: Results of RT-PCR assays on throat swabs of
cynomolgous macaques inoculated (twice) with ned/00/01 (A1).
[0092] FIG. 39A (top two panels): IgA, IgM and IgG response against
ned/00/01 (A1) of 2 cynomologous macaques (re)infected with
ned/00/01 (A1).
[0093] FIG. 39B (bottom panels): IgG response against APV of 2
Cynomologous macaques infected with ned/00/01 (A1).
[0094] FIG. 40: Comparison of the use of the hMPV ELISA and the APV
inhibition ELISA for the detection of IgG antibodies in human
sera.
[0095] FIG. 41: Comparison of two prototypic hMPV isolates with
APV-A and APV-C; DNA similarity matrices for nucleic acids encoding
the various viral proteins.
[0096] FIG. 42: Comparison of two prototypic hMPV isolates with
APV-A and APV-C; protein similarity matrices for the various viral
proteins.
[0097] FIG. 42b: Comparison of the coding sequences of four
prototypes of mammalian MPV. The left column shows nucleic acid
sequence comparisons and the right column shows amino acid sequence
comparisons. NL/1/00 is the prototype of variant A1 (SEQ ID NO:19).
NL/17/00 is the prototype of variant A2 (SEQ ID NO:20). NL/1/99 the
prototype of variant BI (SEQ ID NO:18). NL/1/94 is the prototype of
variant B2 (SEQ ID NO:21).
[0098] FIG. 43: Amino acid alignment of the nucleoprotein of two
prototype hMPV isolates.
[0099] FIG. 44: Amino acid alignment of the phosphoprotein of two
prototype hMPV isolates.
[0100] FIG. 45: Amino acid alignment of the matrix protein of two
prototype hMPV isolates.
[0101] FIG. 46: Amino acid alignment of the fusion protein of two
prototype hMPV isolates.
[0102] FIG. 47: Amino acid alignment of the M2-1 protein of two
prototype hMPV isolates.
[0103] FIG. 48: Amino acid alignment of the M2-2 protein of two
prototype hMPV isolates.
[0104] FIG. 49: Amino acid alignment of the short hydrophobic
protein of two prototype hMPV isolates.
[0105] FIG. 50: Amino acid alignment of the attachment glycoprotein
of two prototype hMPV isolates.
[0106] FIG. 51: Amino acid alignment of the N-terminus of the
polymerase protein of two prototype hMPV isolates.
[0107] FIG. 52: Noncoding sequences of hMPV isolate 00-1 (A1). (A)
The noncoding sequences between the ORFs and at the genomic termini
are shown in the positive sense. From left to right, stop codons of
indicated ORFs are shown, followed by the noncoding sequences, the
gene start signals and start codons of the indicated subsequent
ORFs. Numbers indicate the first position of start and stop codons
in the hMPV map. Sequences that display similarity to published
gene end signals are underlined and sequences that display
similarity to UAAAAAU/A/C are represented with a line above the
sequence. (B) Nucleotide sequences of the genomic termini of hMPV.
The genomic termini of hMPV are aligned with each other and with
those of APV. Underlined regions represent the primer sequences
used in RT-PCR assays which are based on the 3' and 5' end
sequences of APV and RSV. Bold italicized nucleotides are part of
the gene start signal of the N gene. Le: leader, Tr: trailer.
[0108] FIG. 53: Sequence comparison of the genomic sequence of hMPV
isolate 00-1 (A1) with hMPV isolate 99-1 (B1).
[0109] FIG. 54: Leader sequences of human metapneumovirus (hMPV)
NL/1/00 (A1) genomic RNA was determined using a combination of
polyadenylation and 3' RACE methods.
[0110] FIG. 55: Sequencing analyses on PCR products directly and on
PCR clones both indicated that the leader region of hMPV consisted
of 5' ACG CGA AAA AAA CGC GTA TA (expressed as positive sense cDNA
orientation) at the 3' most proximal 20 nucleotides in the leader
sequence. The two newly identified nucleotides are underlined.
5. DETAILED DESCRIPTION OF THE INVENTION
[0111] The invention relates to an isolated mammalian negative
strand RNA virus, metapneumovirus (MPV) and variants thereof,
within the sub-family Pneumovirinae, of the family Paramyxoviridae.
The present invention also relates to isolated mammalian negative
strand RNA viruses identifiable as phylogenetically corresponding
or relating to the genus metapneumovirus and components thereof.
The mammalian MPVs of the invention can be a variant A1, A2, B1 or
B2 mammalian MPV. However, the mammalian MPVs of the present
invention may encompass additional variants of MPV yet to be
identified, and are not limited to variants A1, A2, B1 or B2.
[0112] The invention relates to genomic nucleotide sequences of
different variants of isolates of mammalian metapneumoviruses
(MPV), in particular human metapneumoviruses including isolates of
variants A1, A2, B1 and B2. The invention relates to the use of the
sequence information of different isolates of mammalian
metapneumoviruses for diagnostic and therapeutic methods. The
present invention relates to the differences of the genomic
nucleotide sequences among the different metapneumovirus-isolates,
and their use in the diagnostic and therapeutic methods of the
invention. In particular, the invention relates to the use of the
single nucleotide polymorphisms (SNPs) among different
metapneumovirus isolates for diagnostic and therapeutic methods.
The present invention also relates to the use serological
characterization of the different isolates of mammalian
metapneumoviruses, alone or in combination with the sequence
information of the different isolates, for diagnostic and
therapeutic methods.
[0113] The present invention relates to nucleotide sequences
encoding the genome of a metapneumovirus or a portion thereof,
including both mammalian and avian metapneumovirus (APV). The
present invention relates to nucleotide sequences encoding gene
products of a metapneumovirus, including both mammalian and avian
metapneumoviruses. The present invention further relates to nucleic
acids, including DNA and RNA, that encodes the genome or a portion
thereof of a metapneumovirus, including both mammalian and avian,
in addition to a nucleotide sequence which is heterologous or
non-native to the viral genome. The invention further encompasses
recombinant or chimeric viruses encoded by said nucleotide
sequences.
[0114] In accordance with the present invention, a recombinant
virus is one derived from a mammalian MPV or an APV that is encoded
by endogenous or native genomic sequences or non-native genomic
sequences. In accordance with the invention, a non-native sequence
is one that is different from the native or endogenous genomic
sequence due to one or more mutations, including, but not limited
to, point mutations, rearrangements, insertions, deletions etc.,
the genomic sequence that may or may not result in a phenotypic
change. In accordance with the invention, a chimeric virus is a
recombinant MPV or APV which further comprises a heterologous
nucleotide sequence. In accordance with the invention, a chimeric
virus may be encoded by a nucleotide sequence in which heterologous
nucleotide sequences have been added to the genome or in which
endogenous or native nucleotide sequences have been replaced with
heterologous nucleotide sequences.
[0115] The invention further relates to vaccine formulations
comprising mammalian or avian metapneumovirus, including
recombinant forms of said viruses. In particular, the present
invention encompasses vaccine preparations comprising recombinant
or chimeric forms of MPV or APV that express antigenic
glycoproteins, including glycoproteins of MPV, or APV and/or
non-native MPV or APV glycoproteins. The invention also encompasses
vaccine preparations comprising recombinant forms of MPV or APV
that encode antigenic sequences of another negative strand RNA
virus, including PIV or RSV, or a heterologous glycoprotein of
another species or strain of metapneumovirus. The invention further
relates to vaccines comprising chimeric hMPV wherein the chimeric
hMPV encodes one or more APV proteins and wherein the chimeric hMPV
optionally additionally expresses one or more heterologous or
non-native sequences. The invention also relates to vaccines
comprising chimeric APV wherein the chimeric APV encodes one or
more hMPV proteins and wherein the chimeric APV optionally
additionally expresses one or more heterologous or non-native
sequences. The present invention also relates to multivalent
vaccines, including bivalent and trivalent vaccines. In particular,
the bivalent and trivalent vaccines of the invention encompass two
or more antigenic polypeptides expressed by the same or different
pneumoviral vectors encoding antigenic proteins of MPV, APV, PIV,
RSV, influenza or another negative strand RNA virus, or
morbillivirus.
[0116] 5.1 Mammalian Metapneumovirus Structural Characteristics of
a Mammalian Metapneumovirus
[0117] The invention provides a mammalian MPV. The mammalian MPV is
a negative-sense single stranded RNA virus belonging to the
sub-family Pneumovirinae of the family Paramyxoviridae. Moreover,
the mammalian MPV is identifiable as phylogenetically corresponding
to the genus Metapneumovirus, wherein the mammalian MPV is
phylogenetically more closely related to a virus isolate deposited
as 1-2614 with CNCM, Paris (SEQ ID NO:19) than to turkey
rhinotracheitis virus, the etiological agent of avian
rhinotracheitis. A virus is identifiable as phylogenetically
corresponding to the genus Metapneumovirus by, e.g., obtaining
nucleic acid sequence information of the virus and testing it in
phylogenetic analyses. Any technique known to the skilled artisan
can be used to determine phylogenetic relationships between strains
of viruses. For exemplary methods see section 5.9. Other techniques
are disclosed in International Patent Application PCT/NL02/00040,
published as WO 02/057302, which is incorporated by reference in
its entirety herein. In particular, PCT/NL02/00040 discloses
nucleic acid sequences that are suitable for phylogenetic analysis
at page 12, line 27 to page 19, line 29, which are incorporated by
reference herein. A virus can further be identified as a mammalian
MPV on the basis of sequence similarity as described in more detail
below.
[0118] In addition to phylogenetic relatedness and sequence
similarity of a virus to a mammalian MPV as disclosed herein, the
similarity of the genomic organization of a virus to the genomic
organization of a mammalian MPV disclosed herein can also be used
to identify the virus as a mammalian MPV. For a representative
genomic organization of a mammalian MPV see FIG. 27. In certain
embodiments, the genomic organization of a mammalian MPV is
different from the genomic organization of pneumoviruses within the
sub-family Pneumovirinae of the family Paramyxoviridae. The
classification of the two genera, metapneumovirus and pneumovirus,
is based primarily on their gene constellation; metapneumoviruses
generally lack non-structural proteins such as NS1 or NS2 (see also
Randhawa et al., 1997, J. Virol. 71:9849-9854) and the gene order
is different from that of pneumoviruses (RSV:
'3-NS1-NS2-N-P-M-SH-G-F-M2-L-5', APV: '3-N-P-M-F-M2-SH-G-L-5')
(Lung, et al., 1992, J. Gen. Virol. 73:1709-1715; Yu, et al., 1992,
Virology 186:426-434; Randhawa, et al., 1997, J. Virol.
71:9849-9854).
[0119] Further, a mammalian MPV of the invention can be identified
by its immunological properties. In certain embodiments, specific
anti-sera can be raised against mammalian MPV that can neutralize
mammalian MPV. Monoclonal and polyclonal antibodies can be raised
against MPV that can also neutralize mammalian MPV. (See, PCT WO
02/057302 at pages ______ to ______, which is incorporated by
reference herein.
[0120] The mammalian MPV of the invention is further characterized
by its ability to infect a mammalian host, i.e., a mammalian
cultured cell or a mammal. Unlike APV, mammalian MPV does not
replicate or replicates only at low levels in chickens and turkeys.
Mammalian MPV replicates, however, in mammalian hosts, such as
cynomolgous macaques. In certain, more specific, embodiments, a
mammalian MPV is further characterized by its ability to replicate
in a mammalian host. In certain, more specific embodiments, a
mammalian MPV is further characterized by its ability to cause the
mammalian host to express proteins encoded by the genome of the
mammalian MPV. In even more specific embodiments, the viral
proteins expressed by the mammalian MPV are inserted into the
cytoplasmic membranes of the mammalian host. In certain
embodiments, the mammalian MPV of the invention can infect a
mammalian host and cause the mammalian host to produce new
infectious viral particles of the mammalian MPV. For a more
detailed description of the functional characteristics of the
mammalian MPV of the invention, see section 5.1.2.
[0121] In certain embodiments, the appearance of a virus in an
electron microscope or its sensitivity to chloroform can be used to
identify the virus as a mammalian MPV. The mammalian MPV of the
invention appears in an electron microscope as paramyxovirus-like
particle. Consistently, a mammalian MPV is sensitive to treatment
with chloroform; a mammalian MPV is cultured optimally on tMK cells
or cells functionally equivalent thereto and it is essentially
trypsine dependent in most cell cultures. Furthermore, a mammalian
MPV has a typical cytopathic effects (CPE) and lacks
haemagglutinating activity against species of red blood cells. The
CPE induced by MPV isolates are similar to the CPE induced by hRSV,
with characteristic syncytia formation followed by rapid internal
disruption of the cells and subsequent detachment from the culture
plates. Although most paramyxoviruses have haemagglutinating
activity, most of the pneumoviruses do not (Pringle, C. R. In: The
Paramyxoviruses; (ed. D. W. Kingsbury) 1-39 (Plenum Press, New
York, 1991)). A mammalian MPV contains a second overlapping ORF
(M2-2) in the nucleic acid fragment encoding the M2 protein. The
occurrence of this second overlapping ORF occurs in other
pneumoviruses as shown in Ahmadian et al., 1999, J Gen. Vir.
80:2011-2016.
[0122] In certain embodiments, the invention provides methods to
identify a viral isolate as a mammalian MPV. A test sample can,
e.g., be obtained from an animal or human. The sample is then
tested for the presence of a virus of the sub-family Pneumovirinae.
If a virus of the sub-family Pneumovirinae is present, the virus
can be tested for any of the characteristics of a mammalian MPV as
discussed herein, such as, but not limited to, phylogenetic
relatedness to a mammalian MPV, nucleotide sequence identity to a
nucleotide sequence of a mammalian MPV, amino acid sequence
identity/homology to a amino acid sequence of a mammalian MPV, and
genomic organization. Furthermore, the virus can be identified as a
mammalian MPV by cross-hybridization experiments using nucleic acid
sequences from a MPV isolate, RT-PCR using primers specific to
mammalian MPV, or in classical cross-serology experiments using
antibodies directed against a mammalian MPV isolate. In certain
other embodiments, a mammalian MPV can be identified on the basis
of its immunological distinctiveness, as determined by quantitative
neutralization with animal antisera. The antisera can be obtained
from, e.g., ferrets, pigs or macaques that are infected with a
mammalian MPV (see, e.g., Example 8).
[0123] In certain embodiments, the serotype does not cross-react
with viruses other than mammalian MPV. In other embodiments, the
serotype shows a homologous-to-heterologous titer ratio >16 in
both directions If neutralization shows a certain degree of
cross-reaction between two viruses in either or both directions
(homologous-to-heterologous titer ration of eight or sixteen),
distinctiveness of serotype is assumed if substantial
biophysical/biochemical differences of DNA sequences exist. If
neutralization shows a distinct degree of cross-reaction between
two viruses in either or both directions
(homologous-to-heterologous titer ratio of smaller than eight),
identity of serotype of the isolates under study is assumed.
Isolate I-2614, herein also known as MPV isolate 00-1, can be used
as prototype.
[0124] In certain embodiments, a virus can be identified as a
mammalian MPV by means of sequence homology/identity of the viral
proteins or nucleic acids in comparison with the amino acid
sequence and nucleotide sequences of the viral isolates disclosed
herein by sequence or deposit. In particular, a virus is identified
as a mammalian MPV when the genome of the virus contains a nucleic
acid sequence that has a percentage nucleic acid identity to a
virus isolate deposited as I-2614 with CNCM, Paris which is higher
than the percentages identified herein for the nucleic acids
encoding the L protein, the M protein, the N protein, the P
protein, or the F protein as identified herein below in comparison
with APV-C (see Table 1). (See, PCT WO 02/05302, at pp. 12 to 19,
which is incorporated by reference herein. Without being bound by
theory, it is generally known that viral species, especially RNA
virus species, often constitute a quasi species wherein the members
of a cluster of the viruses display sequence heterogeneity. Thus,
it is expected that each individual isolate may have a somewhat
different percentage of sequence identity when compared to
APV-C.
[0125] The highest amino sequence identity between the proteins of
MPV and any of the known other viruses of the same family to date
is the identity between APV-C and human MPV. Between human MPV and
APV-C, the amino acid sequence identity for the matrix protein is
87%, 88% for the nucleoprotein, 68% for the phosphoprotein, 81% for
the fusion protein and 56-64% for parts of the polymerase protein,
as can be deduced when comparing the sequences given in FIG. 30,
see also Table 1. Viral isolates that contain ORFs that encode
proteins with higher homology compared to these maximum values are
considered mammalian MPVs. It should be noted that, similar to
other viruses, a certain degree of variation is found between
different isolated of mammalian MPVs.
2TABLE 1 Amino acid sequence identity between the ORFs of MPV and
those of other paramyxoviruses. N P M F M2-1 M2-2 L APV A 69 55 78
67 72 26 64 APV B 69 51 76 67 71 27 --.sup.2 APV C 88 68 87 81 84
56 --.sup.2 hRSV 42 24 38 34 36 18 42 A hRSV B 41 23 37 33 35 19 44
bRSV 42 22 38 34 35 13 44 PVM 45 26 37 39 33 12 --.sup.2
others.sup.3 7-11 4-9 7-10 10-18 --.sup.4 --.sup.4 13-14 Footnotes:
.sup.1No sequence homologies were found with known G and SH
proteins and were thus excluded .sup.2Sequences not available.
.sup.3others: human parainfluenza virus type 2 and 3, Sendai virus,
measles virus, nipah virus, phocine distemper virus, and New Castle
Disease virus. .sup.4ORF absent in viral genome.
[0126] In certain embodiments, the inventio provides a mammalian
MPV, wherein the amino acid sequence of the SH protein of the
mammalian MPV is at least 30%, at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, at least 98%, at least 99%, or at least 99.5%
identical to the amino acid sequence of SEQ ID NO:382 (SH protein
of isolate NL/1/00; see Table 14). The isolated negative-sense
single stranded RNA metapneumovirus that comprises the SH protein
that is at least 30% identical to SEQ ID NO:382 (SH protein of
isolate NL/1/00; see Table 14) is capable of infecting a mammalian
host. In certain embodiments, the isolated negative-sense single
stranded RNA metapneumovirus that comprises the SH protein that is
at least 30% identical to SEQ ID NO:382 (SH protein of isolate
NL/1/00; see Table 14) is capable of replicating in a mammalian
host. In certain embodiments, a mammalian MPV contains a nucleotide
sequence that encodes a SH protein that is at least 30% identical
to SEQ ID NO:382 (SH protein of isolate NL/1/00; see Table 14).
[0127] In certain embodiments, the invention provides a mammalian
MPV, wherein the amino acid sequence of the G protein of the
mammalian MPV is at least 20%, at least 25%, at least 30%, at least
35%, at least 40%, at least 45%, at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, at least
99%, or at least 99.5% identical to the amino acid sequence of SEQ
ID NO:322 (G protein of isolate NL/1/00; see Table 14). The
isolated negative-sense single stranded RNA metapneumovirus that
comprises the G protein that is at least 20% identical to SEQ ID
NO:322 (G protein of isolate NL/1/00; see Table 14) is capable of
infecting a mammalian host. In certain embodiments, the isolated
negative-sense single stranded RNA metapneumovirus that comprises
the G protein that is at least 20% identical to SEQ ID NO:322 (G
protein of isolate NL/1/00; see Table 14) is capable of replicating
in a mammalian host. In certain embodiments, a mammalian MPV
contains a nucleotide sequence that encodes a G protein that is at
least 20% identical to SEQ ID NO:322 (G protein of isolate NL/1/00;
see Table 14).
[0128] In certain embodiments, the invention provides a mammalian
MPV, wherein the amino acid sequence of the L protein of the
mammalian MPV is at least 85%, at least 90%, at least 95%, at least
98%, at least 99%, or at least 99.5% identical to the amino acid
sequence of SEQ ID NO:330 (L protein of isolate NL/1/00; see Table
14). The isolated negative-sense single stranded RNA
metapneumovirus that comprises the L protein that is at least 85%
identical to SEQ ID NO:330 (L protein of isolate NL/1/00; see Table
14) is capable of infecting a mammalian host. In certain
embodiments, the isolated negative-sense single stranded RNA
metapneumovirus that comprises the L protein that is at least 85%
identical to SEQ ID NO:330 (L protein of isolate NL/1/00; see Table
14) is capable of replicating in a mammalian host. In certain
embodiments, a mammalian MPV contains a nucleotide sequence that
encodes a L protein that is at least 20% identical to SEQ ID NO:330
(L protein of isolate NL/1/00; see Table 14).
[0129] In certain embodiments, the invention provides a mammalian
MPV, wherein the amino acid sequence of the N protein of the
mammalian MPV is at least 90%, at least 95%, or at least 98%
identical to the amino acid sequence of SEQ ID NO:366. The isolated
negative-sense single stranded RNA metapneumovirus that comprises
the N protein that is at least 90% identical in amino acid sequence
to SEQ ID NO:366 is capable of infecting mammalian host. In certain
embodiments, the isolated negative-sense single stranded RNA
metapneumovirus that comprises the N protein that is 90% identical
in amino acid sequence to SEQ ID NO:366 is capable of replicating
in a mammalian host. The amino acid identity is calculated over the
entire length of the N protein. In certain embodiments, a mammalian
MPV contains a nucleotide sequence that encodes a N protein that is
at least 90%, at least 95%, or at least 98% identical to the amino
acid sequence of SEQ ID NO:366.
[0130] The invention further provides mammalian MPV, wherein the
amino acid sequence of the P protein of the mammalian MPV is at
least 70%, at least 80%, at least 90%, at least 95% or at least 98%
identical to the amino acid sequence of SEQ ID NO:374. The
mammalian MPV that comprises the P protein that is at least 70%
identical in amino acid sequence to SEQ ID NO:374 is capable of
infecting a mammalian host. In certain embodiments, the mammalian
MPV that comprises the P protein that is at least 70% identical in
amino acid sequence to SEQ ID NO:374 is capable of replicating in a
mammalian host. The amino acid identity is calculated over the
entire length of the P protein. In certain embodiments, a mammalian
MPV contains a nucleotide sequence that encodes a P protein that is
at least 70%, at least 80%, at least 90%, at least 95% or at least
98% identical to the amino acid sequence of SEQ ID NO:374.
[0131] The invention further provides, mammalian MPV, wherein the
amino acid sequence of the M protein of the mammalian MPV is at
least 90%, at least 95% or at least 98% identical to the amino acid
sequence of SEQ ID NO:358. The mammalian MPV that comprises the M
protein that is at least 90% identical in amino acid sequence to
SEQ ID NO:358 is capable of infecting mammalian host. In certain
embodiments, the isolated negative-sense single stranded RNA
metapneumovirus that comprises the M protein that is 90% identical
in amino acid sequence to SEQ ID NO:358 is capable of replicating
in a mammalian host. The amino acid identity is calculated over the
entire length of the M protein. In certain embodiments, a mammalian
MPV contains a nucleotide sequence that encodes a M protein that is
at least 90%, at least 95% or at least 98% identical to the amino
acid sequence of SEQ ID NO:358.
[0132] The invention further provides mammalian MPV, wherein the
amino acid sequence of the F protein of the mammalian MPV is at
least 85%, at least 90%, at least 95% or at least 98% identical to
the amino acid sequence of SEQ ID NO:314. The mammalian MPV that
comprises the F protein that is at least 85% identical in amino
acid sequence to SEQ ID NO:314 is capable of infecting a mammalian
host. In certain embodiments, the isolated negative-sense single
stranded RNA metapneumovirus that comprises the F protein that is
85% identical in amino acid sequence to SEQ If) NO:314 is capable
of replicating in mammalian host. The amino acid identity is
calculated over the entire length of the F protein. In certain
embodiments, a mammalian MPV contains a nucleotide sequence that
encodes a F protein that is at least 85%, at least 90%, at least
95% or at least 98% identical to the amino acid sequence of SEQ ID
NO:314.
[0133] The invention further provides mammalian MPV, wherein the
amino acid sequence of the M2-1 protein of the mammalian MPV is at
least 85%, at least 90%, at least 95% or at least 98% identical to
the amino acid sequence of SEQ ID NO:338. The mammalian MPV that
comprises the M2-1 protein that is at least 85% identical in amino
acid sequence to SEQ ID NO:338 is capable of infecting a mammalian
host. In certain embodiments, the isolated negative-sense single
stranded RNA metapneumovirus that comprises the M2-1 protein that
is 85% identical in amino acid sequence to SEQ ID NO:338 is capable
of replicating in a mammalian host. The amino acid identity is
calculated over the entire length of the M2-1 protein. In certain
embodiments, a mammalian MPV contains a nucleotide sequence that
encodes a M2-1 protein that is at least 85%, at least 90%, at least
95% or at least 98% identical to the amino acid sequence of SEQ ID
NO:338.
[0134] The invention further provides mammalian MPV, wherein the
amino acid sequence of the M2-2 protein of the mammalian MPV is at
least 60%, at least 70%, at least 80%, at least 90%, at least 95%
or at least 98% identical to the amino acid sequence of SEQ ID
NO:346 The isolated mammalian MPV that comprises the M2-2 protein
that is at least 60% identical in amino acid sequence to SEQ ID
NO:346 is capable of infecting mammalian host. In certain
embodiments, the isolated negative-sense single stranded RNA
metapneumovirus that comprises the M2-2 protein that is 60%
identical in amino acid sequence to SEQ ID NO:346 is capable of
replicating in a mammalian host. The amino acid identity is
calculated over the entire length of the M2-2 protein. In certain
embodiments, a mammalian MPV contains a nucleotide sequence that
encodes a M2-1 protein that is is at least 60%, at least 70%, at
least 80%, at least 90%, at least 95% or at least 98% identical to
the amino acid sequence of SEQ ID NO:346.
[0135] In certain embodiments, the invention provides mammalian
MPV, wherein the negative-sense single stranded RNA metapneumovirus
encodes at least two proteins, at least three proteins, at least
four proteins, at least five proteins, or six proteins selected
from the group consisting of (i) a N protein with at least 90%
amino acid sequence identity to SEQ ID NO:366; (ii) a P protein
with at least 70% amino acid sequence identity to SEQ ID NO:374
(iii) a M protein with at least 90% amino acid sequence identity to
SEQ ID NO:358 (iv) a F protein with at least 85% amino acid
sequence identity to SEQ ID NO:314 (v) a M2-1 protein with at least
85% amino acid sequence identity to SEQ ID NO:338; and (vi) a M2-2
protein with at least 60% amino acid sequence identity to SEQ ID
NO:346.
[0136] The invention provides two subgroups of mammalian MPV,
subgroup A and subgroup B. The invention also provides four
variants A1, A2, B1 and B2. A mammalian MPV can be identified as a
member of subgroup A if it is phylogenetically closer related to
the isolate 00-1 (SEQ ID NO:19) than to the isolate 99-1 (SEQ ID
NO:18). A mammalian MPV can be identified as a member of subgroup B
if it is phylogenetically closer related to the isolate 99-1 (SEQ
ID NO:18) than to the isolate 00-1 (SEQ ID NO:19). In other
embodiments, nucleotide or amino acid sequence homologies of
individual ORFs can be used to classify a mammalian MPV as
belonging to subgroup A or B.
[0137] The different isolates of mammalian MPV can be divided into
four different variants, variant A1, variant A2, variant B1 and
variant B2 (see FIGS. 21 and 22). The isolate 00-1 (SEQ ID NO:19)
is an example of the variant A1 of mammalian MPV. The isolate 99-1
(SEQ ID NO:18) is an example of the variant B1 of mammalian MPV. A
mammalian MPV can be grouped into one of the four variants using a
phylogenetic analysis. Thus, a mammalian MPV belongs to a specific
variant if it is phylogenetically closer related to a known member
of that variant than it is phylogenetically related to a member of
another variant of mammalian MPV. The sequence of any ORF and the
encoded polypeptide may be used to type a MPV isolate as belonging
to a particular subgroup or variant, including N, P, L, M, SH, G,
M2 or F polypeptides. In a specific embodiment, the classification
of a mammalian MPV into a variant is based on the sequence of the G
protein. Without being bound by theory, the G protein sequence is
well suited for phylogenetic analysis because of the high degree of
variation among G proteins of the different variants of mammalian
MPV.
[0138] In certain embodiments of the invention, sequence homology
may be determined by the ability of two sequences to hybridize
under certain conditions, as set forth below. A nucleic acid which
is hybridizable to a nucleic acid of a mammalian MPV, or to its
reverse complement, or to its complement can be used in the methods
of the invention to determine their sequence homology and
identities to each other. In certain embodiments, the nucleic acids
are hybridized under conditions of high stringency.
[0139] It is well-known to the skilled artisan that hybridization
conditions, such as, but not limited to, temperature, salt
concentration, pH, formamide concentration (see, e.g., Sambrook et
al., 1989, Chapters 9 to 11, Molecular Cloning, A Laboratory
Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., incorporated herein by reference in its entirety). In
certain embodiments, hybridization is performed in aqueous solution
and the ionic strength of the solution is kept constant while the
hybridization temperature is varied dependent on the degree of
sequence homology between the sequences that are to be hybridized.
For DNA sequences that 100% identical to each other and are longer
than 200 basebairs, hybridization is carried out at approximately
15-25.degree. C. below the melting temperature (Tm) of the perfect
hybrid. The melting temperature (Tm) can be calculated using the
following equation (Bolton and McCarthy, 1962, Proc. Natl. Acad.
Sci. USA 84:1390):
Tm=81.5.degree.
C.-16.6(log10[Na+])+(%G+C)-0.63(%formamide)-(600/1)
[0140] Wherein (Tm) is the melting temperature, [Na+] is the sodium
concentration, G+C is the Guanine and Cytosine content, and I is
the length of the hybrid in basepairs. The effect of mismatches
between the sequences can be calculated using the formula by Bonner
et al. (Bonner et al., 1973, J. Mol. Biol. 81:123-135): for every
1% of mismatching of bases in the hybrid, the melting temperature
is reduced by 1-1.5.degree. C.
[0141] Thus, by determining the temperature at which two sequences
hybridize, one of skill in the art can estimate how similar a
sequence is to a known sequence. This can be done, e.g., by
comparison of the empirically determined hybridization temperature
with the hybridization temperature calculated for the know sequence
to hybridize with its perfect match. Through the use of the formula
by Bonner et al., the relationship between hybridization
temperature and percent mismatch can be exploited to provide
information about sequence similarity.
[0142] By way of example and not limitation, procedures using such
conditions of high stringency are as follows. Prehybridization of
filters containing DNA is carried out for 8 h to overnight at 65 C
in buffer composed of 6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM
EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 .mu.g/ml
denatured salmon sperm DNA. Filters are hybridized for 48 h at 65 C
in prehybridization mixture containing 100 .mu.g/ml denatured
salmon sperm DNA and 5-20.times.10.sup.6 cpm of 32P-labeled probe.
Washing of filters is done at 37 C for 1 h in a solution containing
2.times.SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is
followed by a wash in 0.1.times.SSC at 50 C for 45 min before
autoradiography. Other conditions of high stringency which may be
used are well known in the art. In other embodiments of the
invention, hybridization is performed under moderate of low
stringency conditions, such conditions are well-known to the
skilled artisan (see e.g., Sambrook et al., 1989, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.; see also, Ausubel et al., eds., in
the Current Protocols in Molecular Biology series of laboratory
technique manuals, 1987-1997 Current Protocols,.COPYRGT. 1994-1997
John Wiley and Sons, Inc., each of which is incorporated by
reference herein in their entirety). An illustrative low stringency
condition is provided by the following system of buffers:
hybridization in a buffer comprising 35% formamide, 5.times.SSC, 50
mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA,
100 .mu.g/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran
sulfate for 18-20 hours at 40.degree. C., washing in a buffer
consisting of 2.times.SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and
0.1% SDS for 1.5 hours at 55.degree. C., and washing in a buffer
consisting of 2.times.SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and
0.1% SDS for 1.5 hours at 60.degree. C.
[0143] In certain embodiments, a mammalian MPV can be classified
into one of the variant using probes that are specific for a
specific variant of mammalian MPV. Such probes include primers for
RT-PCR and antibodies. Illustrative methods for identifying a
mammalian MPV as a member of a specific variant are described in
section 5.9 below.
[0144] In certain embodiments of the invention, the different
variants of mammalian MPV can be distinguished from each other by
way of the amino acid sequences of the different viral proteins
(see, e.g., FIG. 42b). In other embodiments, the different variants
of mammalian MPV can be distinguished from each other by way of the
nucleotide sequences of the different ORFs encoded by the viral
genome (see, e.g., FIG. 42b). A variant of mammalian MPV can be,
but is not limited to, A1, A2, B1 or B2. The invention, however,
also contemplates isolates of mammalian MPV that are members of
another variant yet to be identified. The invention also
contemplates that a virus may have one or more ORF that are closer
related to one variant and one or more ORFs that are closer
phylogenetically related to another variant. Such a virus would be
classified into the variant to which the majority of its ORFs are
closer phylogenetically related. Non-coding sequences may also be
used to determine phylogenetic relatedness.
[0145] An isolate of mammalian MPV is classified as a variant B1 if
it is phylogenetically closer related to the viral isolate NL/1/99
(SEQ ID NO:18) than it is related to any of the following other
viral isolates: NL/1/00 (SEQ ID NO:19), NL/17/00 (SEQ ID NO:20) and
NL/1/94 (SEQ ID NO:21). One or more of the ORFs of a mammalian MPV
can be used to classify the mammalian MPV into a variant. A
mammalian MPV can be classified as an MPV variant B1, if the amino
acid sequence of its G protein is at least 66%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant B1 as represented by the
prototype NL/1/99 (SEQ ID NO:324); if the amino acid sequence of
its N proteint is at least 98.5% or at least 99% or at least 99.5%
identical to the N protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:368); if the amino
acid sequence of its P protein is at least 96%, at least 98%, or at
least 99% or at least 99.5% identical to the P protein of a
mammalian MPV variant B1 as represented by the prototype NL/1/99
(SEQ ID NO:376); if the amino acid sequence of its M protein is
identical to the M protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:360); if the amino
acid sequence of its F protein is at least 99% identical to the F
protein of a mammalian MPV variant B1 as represented by the
prototype NL/1/99 (SEQ ID NO:316); if the amino acid sequence of
its M2-1 protein is at least 98% or at least 99% or at least 99.5%
identical to the M2-1 protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/99 (SEQ ID NO:340); if the amino
acid sequence of its M2-2 protein is at least 99%or at least 99.5%
identical to the M2-2 protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:348); if the amino
acid sequence of its SH protein is at least 83%, at least 85%, at
least 90%, at least 95%, at least 98%, or at least 99% or at least
99.5% identical to the SH protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:384); and/or if the
amino acid sequence of its L protein is at least 99% or at least
99.5% identical to the L protein a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:332).
[0146] An isolate of mammalian MPV is classified as a variant Al if
it is phylogenctically closer related to the viral isolate NL/1/00
(SEQ ID NO:19) than it is related to any of the following other
viral isolates: NL/1/99 (SEQ ID NO:18), NL/17/00 (SEQ ID NO:20) and
NL/1/94 (SEQ ID NO:21). One or more of the ORFs of a mammalian MPV
can be used to classify the mammalian MPV into a variant. A
mammalian MPV can be classified as an MPV variant A1, if the amino
acid sequence of its G protein is at least 66%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant A1 as represented by the
prototype NL/1/00 (SEQ ID NO:322); if the amino acid sequence of
its N protein is at least 99.5% identical to the N protein of a
mammalian MPV variant A1 as represented by the prototype NL/1/00
(SEQ ID NO:366); if the amino acid sequence of its P protein is at
least 96%, at least 98%, or at least 99% or at least 99.5%
identical to the P protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/00 (SEQ ID NO:374); if the amino
acid sequence of its M protein is at least 99% or at least 99.5%
identical to the M protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/00 (SEQ ID NO:358); if the amino
acid sequence of its F protein is at least 98% or at least 99% or
at least 99.5% identical to the F protein of a mammalian MPV
variant A1 as represented by the prototype NL/1/00 (SEQ ID NO:314);
if the amino acid sequence of its M2-1 protein is at least 99% or
at least 99.5% identical to the M2-1 protein of a mammalian MPV
variant A1 as represented by the prototype NL/1/00 (SEQ ID NO:338);
if the amino acid sequence of its M2-2 protein is at least 96% or
at least 99% or at least 99.5% identical to the M2-2 protein of a
mammalian MPV variant A1 as represented by the prototype NL/1/00
(SEQ ID NO:346); if the amino acid sequence of its SH protein is at
least 84%, at least 90%, at least 95%, at least 98%, or at least
99% or at least 99.5% identical to the SH protein of a mammalian
MPV variant A1 as represented by the prototype NL/1/00 (SEQ ID
NO:382); and/or if the amino acid sequence of its L protein is at
least 99% or at least 99.5% identical to the L protein of a virus
of a mammalian MPV variant A1 as represented by the prototype
NL/1/00 (SEQ ID NO:330).
[0147] An isolate of mammalian MPV is classified as a variant A2 if
it is phylogenetically closer related to the viral isolate NL/17/00
(SEQ ID NO:20) than it is related to any of the following other
viral isolates: NL/1/99 (SEQ ID NO:18), NL/1/00 (SEQ ID NO:19) and
NL/1/94 (SEQID NO:21). One or more of the ORFs of a mammalian MPV
can be used to classify the mammalian MPV into a variant. A
mammalian MPV can be classified as an MPV variant A2, if the amino
acid sequence of its G protein is at least 66%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 98%, at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO:332); if the amino acid sequence of
its N protein is at least 99.5% identical to the N protein of a
mammalian MPV variant A2 as represented by the prototype NL/17/00
(SEQ ID NO:367); if the amino acid sequence of its P protein is at
least 96%, at least 98%, at least 99% or at least 99.5% identical
to the P protein of a mammalian MPV variant A2 as represented by
the prototype NL/17/00 (SEQ ID NO:375); if the amino acid sequence
of its M protein is at least 99%, or at least 99.5% identical to
the M protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO:359); if the amino acid sequence of
its F protein is at least 98%, at least 99% or at least 99.5%
identical to the F protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:315); if the amino
acid sequence of its M2-1 protein is at least 99%, or at least
99.5% identical to the M2-1 protein of a mammalian MPV variant A2
as represented by the prototype NL/17/00 (SEQ ID NO: 339); if the
amino acid sequence of its M2-2 protein is at least 96%, at least
98%, at least 99% or at least 99.5% identical to the M2-2 protein
of a mammalian MPV variant A2 as represented by the prototype
NL/17/00 (SEQ ID NO:347); if the amino acid sequence of its SH
protein is at least 84%, at least 85%, at least 90%, at least 95%,
at least 98%, at least 99% or at least 99.5% identical to the SH
protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO:383); if the amino acid sequence of
its L protein is at least 99% or at least 99.5% identical to the L
protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO:331).
[0148] An isolate of mammalian MPV is classified as a variant B2 if
it is phylogenetically closer related to the viral isolate NL/1/94
(SEQ ID NO:21) than it is related to any of the following other
viral isolates: NL/1/99 (SEQ OD NO:18), NL/1/00 (SEQ ID NO:19) and
NL/17/00(SEQ f NO:20). One or more of the ORFs of a mammalian MPV
can be used to classify the mammalian MPV into a variant. A
mammalian MPV can be classified as an MPV variant B2, if the amino
acid sequence of its G protein is at least 66%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant B2 as represented by the
prototype NL/1/94 (SEQ ID NO:325); if the amino acid sequence of
its N protein is at least 99% or at least 99.5% identical to the N
protein of a mammalian MPV variant B2 as represented by the
prototype NL/1/94 (SEQ ID NO:369); if the amino acid sequence of
its P protein is at least 96%, at least 98%, or at least 99% or at
least 99.5% identical to the P protein of a mammalian MPV variant
B2 as represented by the prototype NL/1/94 (SEQ ID NO:377); if the
amino acid sequence of its M protein is identical to the M protein
of a mammalian MPV variant B2 as represented by the prototype
NL/1/94 (SEQ ID NO:361); if the amino acid sequence of its F
protein is at least 99% or at least 99.5% identical to the F
protein of a mammalian MPV variant B2 as represented by the
prototype NL/1/94 (SEQ ID NO:317); if the amino acid sequence of
the M2-1 protein is at least 98% or at least 99% or at least 99.5%
identical to the M2-1 protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:341); if the amino
acid sequence that is at least 99% or at least 99.5% identical to
the M2-2 protein of a mammalian MPV variant B2 as represented by
the prototype NL/1/94 (SEQ ID NO:349); if the amino acid sequence
of its SH protein is at least 84%, at least 85%, at least 90%, at
least 95%, at least 98%, or at least 99% or at least 99.5%
identical to the SH protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:385); and/or if the
amino acid sequence of its L protein is at least 99% or at least
99.5% identical to the L protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:333).
[0149] In certain embodiments, the percentage of sequence identity
is based on an alignment of the full length proteins. In other
embodiments, the percentage of sequence identity is based on an
alignment of contiguous amino acid sequences of the proteins,
wherein the amino acid sequences can be 25 amino acids, 50 amino
acids, 75 amino acids, 100 amino acids, 125 amino acids, 150 amino
acids, 175 amino acids, 200 amino acids, 225 amino acids, 250 amino
acids, 275 amino acids, 300 amino acids, 325 amino acids, 350 amino
acids, 375 amino acids, 400 amino acids, 425 amino acids, 450 amino
acids, 475 amino acids, 500 amino acids, 750 amino acids, 1000
amino acids, 1250 amino acids, 1500 amino acids, 1750 amino acids,
2000 amino acids or 2250 amino acids in length.
[0150] 5.2 Functional Characteristics of a Mammalian MPV
[0151] In addition to the structural definitions of the mammalian
MPV, a mammalian MPV can also be defined by its functional
characteristics. In certain embodiments, the mammalian MPV of the
invention is capable of infecting a mammalian host. The mammalian
host can be a mammalian cell, tissue, organ or a mammal. In a
specific embodiment, the mammalian host is a human or a human cell,
tissue or organ. Any method known to the skilled artisan can be
used to test whether the mammalian host has been infected with the
mammalian MPV. In certain embodiments, the virus is tested for its
ability to attach to a mammalian cell. In certain other
embodiments, the virus is tested for its ability to transfer its
genome into the mammalian cell. In an illustrative embodiment, the
genome of the virus is detectably labeled, e.g., radioactively
labeled. The virus is then incubated with a mammalian cell for at
least 1 minute, at least 5 minutes at least 15 minutes, at least 30
minutes, at least 1 hour, at least 2 hours, at least 5 hours, at
least 12 hours, or at least 1 day. The cells are subsequently
washed to remove any viral particles from the cells and the cells
are then tested for the presence of the viral genome by virtue of
the detectable label. In another embodiment, the presence of the
viral genome in the cells is detected using RT-PCR using mammalian
MPV specific primers. (See, PCT WO 02/057302 at pp. 37 to 44, which
is incorporated by reference herein).
[0152] In certain embodiments, the mammalian virus is capable to
infect a mammalian host and to cause proteins of the mammalian MPV
to be inserted into the cytoplasmic membrane of the mammalian host.
The mammalian host can be a cultured mammalian cell, organ, tissue
or mammal. In an illustrative embodiment, a mammalian cell is
incubated with the mammalian virus. The cells are subsequently
washed under conditions that remove the virus from the surface of
the cell. Any technique known to the skilled artisan can be used to
detect the newly expressed viral protein inserted in the
cytoplasmic membrane of the mammalian cell. For example, after
infection of the cell with the virus, the cells are maintained in
medium comprising a detectably labeled amino acid. The cells are
subsequently harvested, lysed, and the cytoplasmic fraction is
separated from the membrane fraction. The proteins of the membrane
fraction are then solubilized and then subjected to an
immunoprecipitation using antibodies specific to a protein of the
mammalian MPV, such as, but not limited to, the F protein or the G
protein. The immunoprecipitated proteins are then subjected to SDS
PAGE. The presence of viral protein can then be detected by
autoradiography. In another embodiment, the presence of viral
proteins in the cytoplasmic membrane of the host cell can be
detected by immunocytochemistry using one or more antibodies
specific to proteins of the mammalian MPV.
[0153] In even other embodiments, the mammalian MPV of the
invention is capable of infecting a mammalian host and of
replicating in the mammalian host. The mammalian host can be a
cultured mammalian cell, organ, tissue or mammal. Any technique
known to the skilled artisan can be used to determine whether a
virus is capable of infecting a mammalian cell and of replicating
within the mammalian host. In a specific embodiment, mammalian
cells are infected with the virus. The cells are subsequently
maintained for at least 30 minutes, at least 1 hour, at least 2
hours, at least 5 hours, at least 12 hours, at least 1 day, or at
least 2 days. The level of viral genomic RNA in the cells can be
monitored using Northern blot analysis, RT-PCR or in situ
hybridization using probes that are specific to the viral genome.
An increase in viral genomic RNA demonstrates that the virus can
infect a mammalian cell and can replicate within a mammalian
cell.
[0154] In even other embodiments, the mammalian MPV of the
invention is capable of infecting a mammalian host, wherein the
infection causes the mammalian host to produce new infectious
mammalian MPV. The mammalian host can be a cultured mammalian cell
or a mammal. Any technique known to the skilled artisan can be used
to determine whether a virus is capable of infecting a mammalian
host and cause the mammalian host to produce new infectious viral
particles. In an illustrative example, mammalian cells are infected
with a mammalian virus. The cells are subsequently washed and
incubated for at least 30 minutes, at least 1 hour, at least 2
hours, at least 5 hours, at least 12 hours, at least 1 day, at
least 2 days, at least one week, or at least twelve days. The titer
of virus can be monitored by any method known to the skilled
artisan. For exemplary methods see section 5.8.
[0155] In certain, specific embodiments, the mammalian MPV is a
human MPV. The tests described in this section can also be
performed with a human MPV. In certain embodiments, the human MPV
is capable of infecting a mammalian host, such as a mammal or a
mammalian cultured cell.
[0156] In certain embodiments, the human MPV is capable to infect a
mammalian host and to cause proteins of the human MPV to be
inserted into the cytoplasmic membrane of the mammalian host.
[0157] In even other embodiments, the human MPV of the invention is
capable of infecting a mammalian host and of replicating in the
mammalian host.
[0158] In even other embodiments, the human MPV of the invention is
capable of infecting a mammalian host and of replicating in the
mammalian host, wherein the infection and replication causes the
mammalian host to produce and package new infectious human MPV.
[0159] In certain embodiments, the mammalian MPV, even though it is
capable of infecting a mammalian host, is also capable of infecting
an avian host, such as a bird or an avian cultured cell. In certain
embodiments, the mammalian MPV is capable to infect an avian host
and to cause proteins of the mammalian MPV to be inserted into the
cytoplasmic membrane of the avian host. In even other embodiments,
the mammalian MPV of the invention is capable of infecting an avian
host and of replicating in the avian host. In even other
embodiments, the mammalian MPV of the invention is capable of
infecting an avian host and of replicating in the avian host,
wherein the infection and replication causes the avian host to
produce and package new infectious mammalian MPV.
[0160] 5.3 Recombinant and Chimeric Metapneumovirus
[0161] The present invention encompasses recombinant or chimeric
viruses encoded by viral vectors derived from the genomes of
metapneumovirus, including both mammalian and avian variants. In
accordance with the present invention a recombinant virus is one
derived from a mammalian MPV or an APV that is encoded by
endogenous or native genomic sequences or non-native genomic
sequences. In accordance with the invention, a non-native sequence
is one that is different from the native or endogenous genomic
sequence due to one or more mutations, including, but not limited
to, point mutations, rearrangements, insertions, deletions etc., to
the genomic sequence that may or may not result in a phenotypic
change. The recombinant viruses of the invention encompass those
viruses encoded by viral vectors derived from the genomes of
metapneumovirus, including both mammalian and avian variants, and
may or may not, include nucleic acids that are non-native to the
viral genome. In accordance with the present invention, a viral
vector which is derived from the genome of a metapneumovirus is one
that contains a nucleic acid sequence that encodes at least a part
of one ORF of a mammalian metapneumovirus, wherein the polypeptides
encoded by the ORF have amino acid sequence identity as set forth
in Section 5.1. supra, and Table 1.
[0162] In accordance with the present invention, the recombinant
viruses of the invention encompass those viruses encoded by viral
vectors derived from the genome of a mammalian metapneumovirus
(MPV), in particular a human metapneumovirus. In particular
embodiments of the invention, the viral vector is derived from the
genome of a metapneumovirus A1, A2, B1 or B2 variant. In accordance
with the present invention, these viral vectors may or may not
include nucleic acids that are non-native to the viral genome In
accordance with the present invention, the recombinant viruses of
the invention encompass those viruses encoded by viral vectors
derived from the genome of an avian pneumovirus (APV), also known
as turkey rhinotracheitis virus (TRTV). In particular embodiments
of the invention, the viral vector is derived from the genome of an
APV subgroup A, B, C or D. In a preferred embodiment, a viral
vector derived from the genome of an APV subgroup C. In accordance
with the present invention these viral vectors may or may not
include nucleic acids that are non-native to the viral genome.
[0163] In another preferred embodiment of the invention, the
recombinant viruses of the invention encompass those viruses
encoded by a viral vector derived from the genome of an APV that
contains a nucleic acid sequence that encodes a F-ORF of APV
subgroup C. In certain embodiments, a viral vector derived from the
genome of an APV is one that contains a nucleic acid sequence that
encodes at least a N-ORF, a P-ORF, a M-ORF, a F-ORF, a M2-1-ORF, a
M2-2-ORF or a L-ORF of APV.
[0164] In accordance with the invention, a chimeric virus is a
recombinant MPV or APV which further comprises a heterologous
nucleotide sequence. In accordance with the invention, a chimeric
virus may be encoded by a nucleotide sequence in which heterologous
nucleotide sequences have been added to the genome or in which
endogenous or native nucleotide sequences have been replaced with
heterologous nucleotide sequences.
[0165] In accordance with the invention, the chimeric viruses are
encoded by the viral vectors of the invention which further
comprise a heterologous nucleotide sequence. In accordance with the
present invention a chimeric virus is encoded by a viral vector
that may or may not include nucleic acids that are non-native to
the viral genome. In accordance with the invention a chimeric virus
is encoded by a viral vector to which heterologous nucleotide
sequences have been added, inserted or substituted for native or
non-native sequences. In accordance with the present invention, the
chimeric virus may be encoded by nucleotide sequences derived from
different strains of mammalian MPV. In particular, the chimeric
virus is encoded by nucleotide sequences that encode antigenic
polypeptides derived from different strains of MPV.
[0166] In accordance with the present invention, the chimeric virus
may be encoded by a viral vector derived from the genome of an APV,
in particular subgroup C, that additionally encodes a heterologous
sequence that encodes antigenic polypeptides derived from one or
more strains of MPV.
[0167] A chimeric virus may be of particular use for the generation
of recombinant vaccines protecting against two or more viruses (Tao
et al., J. Virol. 72, 2955-2961; Durbin et al., 2000, J.Virol. 74,
6821-6831; Skiadopoulos et al., 1998, J. Virol. 72, 1762-1768; Teng
et al., 2000, J.Virol. 74, 9317-9321). For example, it can be
envisaged that a MPV or APV virus vector expressing one or more
proteins of another negative strand RNA virus, e.g., RSV or a RSV
vector expressing one or more proteins of MPV will protect
individuals vaccinated with such vector against both virus
infections. A similar approach can be envisaged for PIV or other
paramyxoviruses. Attenuated and replication-defective viruses may
be of use for vaccination purposes with live vaccines as has been
suggested for other viruses. (See, PCT WO 02/057302, at pp. 6 and
23, incorporated by reference herein).
[0168] In accordance with the present invention the heterologous
sequence to be incorporated into the viral vectors encoding the
recombinant or chimeric viruses of the invention include sequences
obtained or derived from different strains of metapneumovirus,
strains of avian pneumovirus, and other negative strand RNA
viruses, including, but not limited to, RSV, PIV and influenza
virus, and other viruses, including morbillivirus.
[0169] In certain embodiments of the invention, the chimeric or
recombinant viruses of the invention are encoded by viral vectors
derived from viral genomes wherein one or more sequences,
intergenic regions, termini sequences, or portions or entire ORF
have been substituted with a heterologous or non-native sequence.
In certain embodiments of the invention, the chimeric viruses of
the invention are encoded by viral vectors derived from viral
genomes wherein one or more heterologous sequences have been added
to the vector.
[0170] In certain embodiments, the virus of the invention contains
heterologous nucleic acids. In a preferred embodiment, the
heterologous nucleotide sequence is inserted or added at Position 1
of the viral genome. In another preferred embodiment, the
heterologous nucleotide sequence is inserted or added at Position 2
of the viral genome. In even another preferred embodiment, the
heterologous nucleotide sequence is inserted or added at Position 3
of the viral genome. Insertion or addition of nucleic acid
sequences at the lower-numbered positions of the viral genome
results in stronger or higher levels of expression of the
heterologous nucleotide sequence compared to insertion at
higher-numbered positions due to a transcriptional gradient across
the genome of the virus. Thus, inserting or adding heterologous
nucleotide sequences at lower-numbered positions is the preferred
embodiment of the invention if high levels of expression of the
heterologous nucleotide sequence is desired.
[0171] Without being bound by theory, the position of insertion or
addition of the heterologous sequence affects the replication rate
of the recombinant or chimeric virus. The higher rates of
replication can be achieved if the heterologous sequence is
inserted or added at Position 2 or Position 1 of the viral genome.
The rate of replication is reduced if the heterologous sequence is
inserted or added at Position 3, Position 4, Position 5, or
Position 6.
[0172] Without being bound by theory, the size of the intergenic
region between the viral gene and the heterologous sequence further
determines rate of replication of the virus and expression levels
of the heterologous sequence.
[0173] In certain embodiments, the viral vector of the invention
contains two or more different heterologous nucleotide sequences.
In a preferred embodiment, one heterologous nucleotide sequence is
at Position 1 and a second heterologous nucleotide sequence is at
Position 2 of the viral genome. In another preferred embodiment,
one heterologous nucleotide sequence is at Position 1 and a second
heterologous nucleotide sequence is at Position 3 of the viral
genome. In even another preferred embodiment, one heterologous
nucleotide sequence is at Position 2 and a second heterologous
nucleotide sequence is at Position 3 of the viral genome. In
certain other embodiments, a heterologous nucleotide sequence is
inserted at other, higher-numbered positions of the viral genome.
In accordance with the present invention, the position of the
heterologous sequence refers to the order in which the sequences
are transcribed from the viral genome, e.g., a heterologous
sequence at Position 1 is the first gene sequence to be transcribed
from the genome.
[0174] The selection of the viral vector may depend on the species
of the subject that is to be treated or protected from a viral
infection. If the subject is human, then an attenuated mammalian
metapneumovirus or an avian pneumovirus can be used to provide the
antigenic sequences.
[0175] In accordance with the present invention, the viral vectors
can be engineered to provide antigenic sequences which confer
protection against infection by a metapneumovirus, including
sequences derived from mammalian metapneumovirus, human
metapneumovirus, MPV variants A1, A2, B1 or B2, sequences derived
from avian pneumovirus, including APV subgroups A, B, C or D,
although C is preferred. The viral vectors can be engineered to
provide antigenic sequences which confer protection against
infection or disease by another virus, including negative strand
RNA virus, including influenza, RSV or PIV, including PIV3. The
viral vectors may be engineered to provide one, two, three or more
antigenic sequences. In accordance with the present invention the
antigenic sequences may be derived from the same virus, from
different strains or variants of the same type of virus, or from
different viruses, including morbillivirus.
[0176] In certain embodiments of the invention, the heterologous
nucleotide sequence to be inserted into the genome of the virus of
the invention is derived from a metapneumovirus. In certain
specific embodiments of the invention, the heterologous nucleotide
sequence is derived from a human metapneumovirus. In another
specific embodiment, the heterologous nucleotide sequence is
derived from an avian pneumovirus. More specifically, the
heterologous nucleotide sequence of the invention encodes a F gene
of a human metapneumovirus. More specifically, the heterologous
nucleotide sequence of the invention encodes an G gene of a human
metapneumovirus. More specifically, the heterologous nucleotide
sequence of the invention encodes a F gene of an avian pneumovirus.
More specifically, the heterologous nucleotide sequence of the
invention encodes a G gene of an avian pneumovirus. In specific
embodiments, a heterologous nucleotide sequences can be any one of
SEQ ID NO:1 through SEQ ID NO:5, SEQ ID NO:14, and SEQ ID NO:15. In
certain specific embodiments, the nucleotide sequence encodes a
protein of any one of SEQ ID NO:6 through SEQ ID NO:13, SEQ ID
NO:16, and SEQ ID NO:17.
[0177] In a specific embodiment of the invention, the heterologous
nucleotide sequence encodes a chimeric F protein. In an
illustrative embodiment, the ectodomain of the chimeric F-protein
is the ectodomain of a human MPV and the transmembrane domain and
the luminal domain are derived from the F-protein of an avian
metapneumovirus. Without being bound by theory, a chimeric human
MPV that encodes the chimeric F-protein consisting of the human
ectodomain and the avian luminol/transmembrane domain is attenuated
because of the avian part of the F-protein, yet highly immunogenic
against hMPV because of the human ectodomain.
[0178] In certain embodiments, two different heterologous
nucleotide sequences are inserted or added to the viral vectors of
the invention, derived from metapneumoviral genomes, including
mammalian and avian. For example, the heterologous nucleotide
sequence is derived from a human metapneumovirus, an avian
pneumovirus, RSV, PIV, or influenza. In a preferred embodiment, the
heterologous sequence encodes the F-protein of human
metapneumovirus, avian pneumovirus, RSV or PIV respectively. In
another embodiment, the heterologous sequence encodes the HA
protein of influenza.
[0179] In certain embodiments, the viral vector of the invention
contains two different heterologous nucleotide sequences wherein a
first heterologous nucleotide sequence is derived from a
metapneumovirus, such as a human metapneumovirus or an avian
pneumovirus, and a second nucleotide sequence is derived from a
respiratory syncytial virus (see Table 2). In specific embodiments,
the heterologous nucleotide sequence derived from respiratory
syncytial virus is a F gene of a respiratory syncytial virus. In
other specific embodiments, the heterologous nucleotide sequence
derived from respiratory syncytial virus is a G gene of a
respiratory syncytial virus. In a specific embodiment, the
heterologous nucleotide sequence derived from a metapneumovirus is
inserted at a lower-numbered position than the heterologous
nucleotide sequence derived from a respiratory syncytial virus. In
another specific embodiment, the heterologous nucleotide sequence
derived from a metapneumovirus is inserted at a higher-numbered
position than the heterologous nucleotide sequence derived from a
respiratory syncytial virus.
[0180] In certain embodiments, the virus of the invention contains
two different heterologous nucleotide sequences wherein a first
heterologous nucleotide sequence is derived from a metapneumovirus,
such as a human metapneumovirus or an avian pneumovirus, and a
second nucleotide sequence is derived from a parainfluenza virus,
such as, but not limited to PIV3 (see Table 2). In specific
embodiments, the heterologous nucleotide sequence derived from PIV
is a F gene of PIV. In other specific embodiments, the heterologous
nucleotide sequence derived from PIV is a G gene of a PIV. In a
specific embodiment, the heterologous nucleotide sequence derived
from a metapneumovirus is inserted at a lower-numbered position
than the heterologous nucleotide sequence derived from a PIV. In
another specific embodiment, the heterologous nucleotide sequence
derived from a metapneumovirus is inserted at a higher-numbered
position than the heterologous nucleotide sequence derived from a
PIV.
[0181] The expression products and/or recombinant or chimeric
virions obtained in accordance with the invention may
advantageously be utilized in vaccine formulations. The expression
products and chimeric virions of the present invention may be
engineered to create vaccines against a broad range of pathogens,
including viral and bacterial antigens, tumor antigens, allergen
antigens, and auto antigens involved in autoimmune disorders. In
particular, the chimeric virions of the present invention may be
engineered to create vaccines for the protection of a subject from
infections with PIV, RSV, and/or metapneumovirus.
[0182] In another embodiment, the chimeric virions of the present
invention may be engineered to create anti-HIV vaccines, wherein an
immunogenic polypeptide from gp160, and/or from internal proteins
of HIV is engineered into the glycoprotein HN protein to construct
a vaccine that is able to elicit both vertebrate humoral and
cell-mediated immune responses. In yet another embodiment, the
invention relates to recombinant metapneumoviral vectors and
viruses which are engineered to encode mutant antigens. A mutant
antigen has at least one amino acid substitution, deletion or
addition relative to the wild-type viral protein from which it is
derived.
[0183] In certain embodiments, the invention relates to trivalent
vaccines comprising a recombinant or chimeric virus of the
invention. In specific embodiments, the virus used as backbone for
a trivalent vaccine is a chimeric avian-human metapneumovirus or a
chimeric human-avian metapneumovirus containing a first
heterologous nucleotide sequence derived from a RSV and a second
heterologous nucleotide sequence derived from PIV. In an exemplary
embodiment, such a trivalent vaccine will be specific to (a) the
gene products of the F gene and/or the G gene of the human
metapneumovirus or avian pneumovirus, respectively, dependent on
whether chimeric avian-human or chimeric human-avian
metapneumovirus is used; (b) the protein encoded by the
heterologous nucleotide sequence derived from a RSV; and (c) the
protein encoded by the heterologous nucleotide sequence derived
from PIV. In a specific embodiment, the first heterologous
nucleotide sequence is the F gene of the respiratory syncytial
virus and is inserted in Position 1, and the second heterologous
nucleotide sequence is the F gene of the PIV and is inserted in
Position 3. Many more combinations are encompassed by the present
invention and some are shown by way of example in Table 2. Further,
nucleotide sequences encoding chimeric F proteins could be used
(seesupra). In some less preferred embodiments, the heterologous
nucleotide sequence can be inserted at higher-numbered positions of
the viral genome.
3TABLE 2 Exemplary arrangements of heterologous nucleotide
sequences in the viruses used for trivalent vaccines. Combination
Position 1 Position 2 Position 3 1 F-gene of PIV F-gene of RSV -- 2
F-gene of RSV F-gene of PIV -- 3 -- F-gene of PIV F-gene of RSV 4
-- F-gene of RSV F-gene of PIV 5 F-gene of PIV -- F-gene of RSV 6
F-gene of RSV -- F-gene of PIV 7 HN-gene of PIV G-gene of RSV -- 8
G-gene of RSV HN-gene of PIV -- 9 -- HN-gene of PIV G-gene of RSV
10 -- G-gene of RSV HN-gene of PIV 11 HN-gene of PIV -- G-gene of
RSV 12 G-gene of RSV -- HN-gene of PIV 13 F-gene of PIV G-gene of
RSV -- 14 G-gene of RSV F-gene of PIV -- 15 -- F-gene of PIV G-gene
of RSV 16 -- G-gene of RSV F-gene of PIV 17 F-gene of PIV -- G-gene
of RSV 18 G-gene of RSV -- F-gene of PIV 19 HN-gene of PIV F-gene
of RSV -- 20 F-gene of RSV HN-gene of PIV -- 21 -- HN-gene of PIV
F-gene of RSV 22 -- F-gene of RSV HN-gene of PIV 23 HN-gene of PIV
-- F-gene of RSV 24 F-gene of RSV -- HN-gene of PIV
[0184] In certain embodiments, the expression products and
recombinant or chimeric virions of the present invention may be
engineered to create vaccines against a broad range of pathogens,
including viral antigens, tumor antigens and auto antigens involved
in autoimmune disorders. One way to achieve this goal involves
modifying existing metapneumoviral genes to contain foreign
sequences in their respective external domains. Where the
heterologous sequences are epitopes or antigens of pathogens, these
chimeric viruses may be used to induce a protective immune response
against the disease agent from which these determinants are
derived.
[0185] Thus, the present invention relates to the use of viral
vectors and recombinant or chimeric viruses to formulate vaccines
against a broad range of viruses and/or antigens. The viral vectors
and chimeric viruses of the present invention may be used to
modulate a subject's immune system by stimulating a humoral immune
response, a cellular immune response or by stimulating tolerance to
an antigen. As used herein, a subject means: humans, primates,
horses, cows, sheep, pigs, goats, dogs, cats, avian species and
rodents.
[0186] The invention may be divided into the following stages
solely for the purpose of description and not by way of limitation:
(a) construction of recombinant cDNA and RNA templates; (b)
expression of heterologous gene products using recombinant cDNA and
RNA templates; (c) rescue of the heterologous gene in recombinant
virus particles; and (d) generation and use of vaccines comprising
the recombinant virus particles of the invention.
[0187] 5.4 Construction of the Recombinant cDNA and RNA
[0188] In certain embodiments, the viral vectors are derived from
the genomes of human or mammalian metapneumovirus of the invention.
In other embodiments, the viral vectors are derived from the genome
of avian pneumovirus. In certain embodiments, viral vectors contain
sequences derived from mammalian MPV and APV, such that a chimeric
human MPV/APV virus is encoded by the viral vector. In an exemplary
embodiment, the F-gene and/or the G-gene of human metapneumovirus
have been replaced with the F-gene and/or the G-gene of avian
pneumovirus to construct chimeric hMPV/APV virus. In other
embodiments, viral vectors contain sequences derived from APV and
mammalian MPV, such that a chimeric APV/hMPV virus is encoded by
the viral vector. In more exemplary embodiments, the F-gene and/or
the G-gene of avian pneumovirus have been replaced with the F-gene
and/or the G-gene of human metapneumovirus to construct the
chimeric APV/hMPV virus.
[0189] The present invention also encompasses recombinant viruses
comprising a viral vector derived from a mammalian MPV or APV
genome containing sequences endogenous or native to the viral
genome, and may or may not contain sequences non-native to the
viral genome. Non-native sequences include those that are different
from native or endogenous sequences which may or may not result in
a phenotypic change. The recombinant viruses of the invention may
contain sequences which result in a virus having a phenotype more
suitable for use in vaccine formulations, e.g., attenuated
phenotype or enhanced antigenicity. The mutations and modifications
can be in coding regions, in intergenic regions and in the leader
and trailer sequences of the virus.
[0190] In certain embodiments the viral vectors of the invention
comprise nucleotide sequences derived from hMPV, APV, hMPV/APV or
APV/hMPV, in which native nucleotide sequences have been
substituted with heterologous sequences or in which heterologous
sequences have been added to the native metapneumoviral
sequences.
[0191] In a more specific embodiment, a chimeric virus comprises a
viral vector derived from MPV, APV, APV/hMPV, or hMPV/APV in which
heterologous sequences derived from PIV have been added. In a more
specific embodiment, a recombinant virus comprises a viral vector
derived from MPV, APV, APV/hMPV, or hMPV/APV in which sequences
have been replaced by heterologous sequences derived from PUV. In
other specific embodiments, a chimeric virus comprises a viral
vector derived from MPV, APV, APV/hMPV, or hMPV/APV in which
heterologous sequences derived from RSV have been added. In a more
specific embodiment, a chimeric virus comprises a viral vector
derived from MPV, APV, APV/hMPV, or hMPV/APV in which sequences
have been replaced by heterologous sequences derived from RSV.
[0192] Heterologous gene coding sequences flanked by the complement
of the viral polymerase binding site/promoter, e.g., the complement
of 3'-hMPV virus terminus of the present invention, or the
complements of both the 3'- and 5'-hMPV virus termini may be
constructed using techniques known in the art. In more specific
embodiments, a recombinant virus of the invention contains the
leader and trailer sequence of hMPV or APV. In certain embodiments,
the intergenic regions are obtained from hMPV or APV. The resulting
RNA templates may be of the negative-polarity and contain
appropriate terminal sequences which enable the viral
RNA-synthesizing apparatus to recognize the template.
Alternatively, positive-polarity RNA templates which contain
appropriate terminal sequences which enable the viral
RNA-synthesizing apparatus to recognize the template, may also be
used. Recombinant DNA molecules containing these hybrid sequences
can be cloned and transcribed by a DNA-directed RNA polymerase,
such as bacteriophage T7, T3, the SP6 polymerase or eukaryotic
polymerase such as polymerase I and the like, to produce in vitro
or in vivo the recombinant RNA templates which possess the
appropriate viral sequences that allow for viral polymerase
recognition and activity. In a more specific embodiment, the RNA
polymerase is fowlpox virus T7 RNA polymerase or a MVA T7 RNA
polymerase.
[0193] An illustrative approach for constructing these hybrid
molecules is to insert the heterologous nucleotide sequence into a
DNA complement of a hMPV, APV, APV/hMPV or hMPV/APV genome, so that
the heterologous sequence is flanked by the viral sequences
required for viral polymerase activity; i.e., the viral polymerase
binding site/promoter, hereinafter referred to as the viral
polymerase binding site, and a polyadenylation site. In a preferred
embodiment, the heterologous coding sequence is flanked by the
viral sequences that comprise the replication promoters of the 5'
and 3' termini, the gene start and gene end sequences, and the
packaging signals that are found in the 5' and/or the 3' termini.
In an alternative approach, oligonucleotides encoding the viral
polymerase binding site, e.g., the complement of the 3'-terminus or
both termini of the virus genomic segment can be ligated to the
heterologous coding sequence to construct the hybrid molecule. The
placement of a foreign gene or segment of a foreign gene within a
target sequence was formerly dictated by the presence of
appropriate restriction enzyme sites within the target sequence.
However, recent advances in molecular biology have lessened this
problem greatly. Restriction enzyme sites can readily be placed
anywhere within a target sequence through the use of site-directed
mutagenesis (e.g., see, for example, the techniques described by
Kunkel, 1985, Proc. Natl. Acad. Sci. U.S.A. 82;488). Variations in
polymerase chain reaction (PCR) technology, described infra, also
allow for the specific insertion of sequences (i.e., restriction
enzyme sites) and allow for the facile construction of hybrid
molecules. Alternatively, PCR reactions could be used to prepare
recombinant templates without the need of cloning. For example, PCR
reactions could be used to prepare double-stranded DNA molecules
containing a DNA-directed RNA polymerase promoter (e.g.,
bacteriophage T3, T7 or SP6) and the hybrid sequence containing the
heterologous gene and the PIV polymerase binding site. RNA
templates could then be transcribed directly from this recombinant
DNA. In yet another embodiment, the recombinant RNA templates may
be prepared by ligating RNAs specifying the negative polarity of
the heterologous gene and the viral polymerase binding site using
an RNA ligase.
[0194] In addition, one or more nucleotides can be added in the
untranslated region to adhere to the "Rule of Six" which may be
important in obtaining virus rescue. The "Rule of Six" applies to
many paramyxoviruses and states that the RNA nucleotide genome must
be divisible by six to be functional. The addition of nucleotides
can be accomplished by techniques known in the art such as using a
commercial mutagenesis kits such as the QuikChange mutagenesis kit
(Stratagene). After addition of the appropriate number of
nucleotides, the correct DNA fragment can then be isolated by
digestion with appropriate restriction enzyme and gel purification.
Sequence requirements for viral polymerase activity and constructs
which may be used in accordance with the invention are described in
the subsections below.
[0195] Without being bound by theory, several parameters affect the
rate of replication of the recombinant virus and the level of
expression of the heterologous sequence. In particular, the
position of the heterologous sequence in hMPV, APV, hMPV/APV or
APV/hMPV and the length of the intergenic region that flanks the
heterologous sequence determine rate of replication and expression
level of the heterologous sequence.
[0196] In certain embodiments, the leader and or trailer sequence
of the virus are modified relative to the wild type virus. In
certain more specific embodiments, the lengths of the leader and/or
trailer are altered. In other embodiments, the sequence(s) of the
leader and/or trailer are mutated relative to the wild type virus.
For more detail, see section 5.7.
[0197] The production of a recombinant virus of the invention
relies on the replication of a partial or full-length copy of the
negative sense viral RNA (vRNA) genome or a complementary copy
thereof (cRNA). This vRNA or CRNA can be isolated from infectious
virus, produced upon in-vitro transcription, or produced in cells
upon transfection of nucleic acids. Second, the production of
recombinant negative strand virus relies on a functional polymerase
complex. Typically, the polymerase complex of pneumoviruses
consists of N, P, L and possibly M2 proteins, but is not
necessarily limited thereto.
[0198] Polymerase complexes or components thereof can be isolated
from virus particles, isolated from cells expressing one or more of
the components, or produced upon transfection of specific
expression vectors.
[0199] Infectious copies of MPV can be obtained when the above
mentioned vRNA, CRNA, or vectors expressing these RNAs are
replicated by the above mentioned polymerase complex 16 (Schnell et
al., 1994, EMBO J 13: 4195-4203; Collins, et al., 1995, PNAS 92:
11563-11567; Hoffmann, et al., 2000, PNAS 97: 6108-6113; Bridgen,
et al., 1996, PNAS 93: 15400-15404; Palese, et al., 1996, PNAS 93:
11354-11358; Peeters, et al., 1999, J.Virol. 73: 5001-5009; Durbin,
et al., 1997, Virology 235: 323-332).
[0200] The invention provides a host cell comprising a nucleic acid
or a vector according to the invention. Plasmid or viral vectors
containing the polymerase components of MPV (presumably N, P, L and
M2, but not necessarily limited thereto) are generated in
prokaryotic cells for the expression of the components in relevant
cell types (bacteria, insect cells, eukaryotic cells). Plasmid or
viral vectors containing full-length or partial copies of the MPV
genome will be generated in prokaryotic cells for the expression of
viral nucleic acids in-vitro or in-vivo. The latter vectors may
contain other viral sequences for the generation of chimeric
viruses or chimeric virus proteins, may lack parts of the viral
genome for the generation of replication defective virus, and may
contain mutations, deletions or insertions for the generation of
attenuated viruses.
[0201] Infectious copies of MPV (being wild type, attenuated,
replication-defective or chimeric) can be produced upon
co-expression of the polymerase components according to the
state-of-the-art technologies described above.
[0202] In addition, eukaryotic cells, transiently or stably
expressing one or more full-length or partial MPV proteins can be
used. Such cells can be made by transfection (proteins or nucleic
acid vectors), infection (viral vectors) or transduction (viral
vectors) and may be useful for complementation of mentioned wild
type, attenuated, replication-defective or chimeric viruses.
[0203] 5.4.1 Heterologous Gene Sequences to be Inserted
[0204] In accordance with the present invention the viral vectors
of the invention may be further engineered to express a
heterologous sequence. In an embodiment of the invention, the
heterologous sequence is derived from a source other than the viral
vector. By way of example, and not by limitation, the heterologous
sequence encodes an antigenic protein, polypeptide or peptide of a
virus belonging to a different species, subgroup or variant of
metapneumovirus than the species, subgroup or variant from which
the viral vector is derived. By way of example, and not by
limitation, the heterologous sequence encodes an antigenic protein,
polypeptide or peptide of a virus other than a metapneumovirus. By
way of example, and not by limitation, the heterologous sequence is
not viral in origin. In accordance with this embodiment, the
heterologous sequence may encode a moiety, peptide, polypeptide or
protein possessing a desired biological property or activity. Such
a heterologous sequence may encode a tag or marker. Such a
heterologous sequence may encode a biological response modifier,
examples of which include, lymphokines, interleukines, granulocyte
macrophage colony stimulating factor and granulocyte colony
stimulating factor.
[0205] In certain embodiments, the heterologous nucleotide sequence
to be inserted is derived from a metapneumovirus. More
specifically, the heterologous nucleotide sequence to be inserted
is derived from a human metapneumovirus and/or an avian
pneumovirus.
[0206] In certain embodiments, the heterologous sequence encodes
PIV nucleocapsid phosphoprotein, PIV L protein, PIV matrix protein,
PIV HN glycoprotein, PIV RNA-dependent RNA polymerase, PIV Y1
protein, PIV D protein, PIV C protein, PIV F protein or PIV P
protein. In certain embodiments, the heterologous nucleotide
sequence encodes a protein that is at least 90%, at least 95%, at
least 98%, or at least 99% homologous to PIV nucleocapsid
phosphoprotein, PIV L protein, PIV matrix protein, PIV HN
glycoprotein, PIV RNA-dependent RNA polymerase, PIV Y1 protein, PIV
D protein, PIV C protein, PIV F protein or PIV P protein. The
heterologous sequence can be obtained from PIV type 1, PIV type 2,
or PIV type 3. In more specific embodiments, the heterologouse
sequence is obtained from human PIV type 1, PIV type 2, or PUV type
3. In other embodiments, the heterologous sequence encodes RSV
nucleoprotein, RSV phosphoprotein, RSV matrix protein, RSV small
hydrophobic protein, RSV RNA-dependent RNA polymerase, RSV F
protein, RSV G protein, or RSV M2-1 or M2-2 protein. In certain
embodiments, the heterologous sequence encodes a protein that is at
least 90%, at least 95%, at least 98%, or at least 99% homologous
to RSV nucleoprotein, RSV phosphoprotein, RSV matrix protein, RSV
small hydrophobic protein, RSV RNA-dependent RNA polymerase, RSV F
protein, or RSV G protein. The heterologous sequence can be
obtained from RSV subtype A and RSV subtype B. In more specific
embodiments, the heterologouse sequence is obtained from human RSV
subtype A and RSV subtype B. In other embodiments, the heterologous
sequence encodes APV nucleoprotein, APV phosphoprotein, APV matrix
protein, APV small hydrophobic protein, APV RNA-dependent RNA
polymerase, APV F protein, APV G protein or APV M2-1 or M2-2
protein. In certain embodiments, the heterologous sequence encodes
a protein that is at least 90%, at least 95%, at least 98%, or at
least 99% homologous to APV nucleoprotein, APV phosphoprotein, APV
matrix protein, APV small hydrophobic protein, APV RNA-dependent
RNA polymerase, APV F protein, or APV G protein. The avian
pneumovirus can be APV subgroup A, APV subgroup B, or APV subgroup
C. In other embodiments, the heterologous sequence encodes hMPV
nucleoprotein, hMPV phosphoprotein, hMPV matrix protein, hMPV small
hydrophobic protein, hMPV RNA-dependent RNA polymerase, hMPV F
protein, hMPV G protein or hMPV M2-1 or M2-2. In certain
embodiments, the heterologous sequence encodes a protein that is at
least 90%, at least 95%, at least 98%, or at least 99% homologous
to hMPV nucleoprotein, hMPV phosphoprotein, hMPV matrix protein,
hMPV small hydrophobic protein, hMPV RNA-dependent RNA polymerase,
hMPV F protein, or hMPV G protein. The human metapneumovirus can be
HMPV variant A1, hMPV variant A2, HMPV variant B1, or hMPV variant
B2.
[0207] In certain embodiments, any combination of different
heterologous sequence from PUV, RSV, human metapneumovirus, or
avian pneumovirus can be inserted into the virus of the
invention.
[0208] In certain preferred embodiments of the invention, the
heterologous nucleotide sequence to be inserted is derived from a F
gene from RSV, PIV, APV or hMPV.
[0209] In certain embodiments, the heterologous nucleotide sequence
encodes a chimeric protein. In more specific embodiments, the
heterologous nucleotide sequence encodes a chimeric F protein of
RSV, PIV, APV or hMPV. A chimeric F protein can comprise parts of F
proteins from different viruses, such as a human metapneumovirus,
avian pneumovirus, respiratory syncytial virus, and parainfluenza
virus. In certain other embodiments, the heterologous sequence
encodes a chimeric G protein. A chimeric G protein comprises parts
of G proteins from different viruses, such as a human
metapneumovirus, avian pneumovirus, respiratory syncytial virus,
and parainfluenza virus. In a specific embodiment, the F protein
comprises an ectodomain of a F protein of a metapneumovirus, a
transmembrane domain of a F protein of a parainfluenza virus, and
luminal domain of a F protein of a parainfluenza virus.
[0210] In certain specific embodiments, the heterologous nucleotide
sequence of the invention is any one of SEQ ID NO:1 through SEQ ID
NO:5, SEQ ID NO:14, and SEQ ID NO:15. In certain specific
embodiments, the nucleotide sequence encodes a protein of any one
of SEQ ID NO:6 through SEQ ID NO:13, SEQ ID NO:16, and SEQ ID
NO:17.
[0211] For heterologous nucleotide sequences derived from
respiratory syncytial virus see, e.g., PCT/US98/20230, which is
hereby incorporated by reference in its entirety.
[0212] In a preferred embodiment, heterologous gene sequences that
can be expressed into the recombinant viruses of the invention
include but are not limited to antigenic epitopes and glycoproteins
of viruses which result in respiratory disease, such as influenza
glycoproteins, in particular hemagglutinin H5, H7, respiratory
syncytial virus epitopes, New Castle Disease virus epitopes, Sendai
virus and infectious Laryngotracheitis virus (ILV). In a preferred
embodiment, the heterologous nucleotide sequences are derived from
a RSV or PIV. In yet another embodiment of the invention,
heterologous gene sequences that can be engineered into the
chimeric viruses of the invention include, but are not limited to,
viral epitopes and glycoproteins of viruses, such as hepatitis B
virus surface antigen, hepatitis A or C virus surface glycoproteins
of Epstein Barr virus, glycoproteins of human papilloma virus,
simian virus 5 or mumps virus, West Nile virus, Dengue virus,
glycoproteins of herpes viruses, VPI of poliovirus, and sequences
derived from a lentivirus, preferably, but not limited to human
immunodeficiency virus (HIV) type 1 or type 2. In yet another
embodiment, heterologous gene sequences that can be engineered into
chimeric viruses of the invention include, but are not limited to,
Marek's Disease virus (MDV) epitopes, epitopes of infectious Bursal
Disease virus (IBDV), epitopes of Chicken Anemia virus, infectious
laryngotracheitis virus (ILV), Avian Influenza virus (AIV), rabies,
feline leukemia virus, canine distemper virus, vesicular stomatitis
virus, and swinepox virus (seeFields et al., (ed.), 1991,
Fundamental Virology, Second Edition, Raven Press, New York,
incorporated by reference herein in its entirety).
[0213] Other heterologous sequences of the present invention
include antigens that are characteristic of autoimmune disease.
These antigens will typically be derived from the cell surface,
cytoplasm, nucleus, mitochondria and the like of mammalian tissues,
including antigens characteristic of diabetes mellitus, multiple
sclerosis, systemic lupus erythematosus, rheumatoid arthritis,
pernicious anemia, Addison's disease, scleroderna, autoimmune
atrophic gastritis, juvenile diabetes, and discold lupus
erythromatosus.
[0214] Antigens that are allergens generally include proteins or
glycoproteins, including antigens derived from pollens, dust,
molds, spores, dander, insects and foods. In addition, antigens
that are characteristic of tumor antigens typically will be derived
from the cell surface, cytoplasm, nucleus, organelles and the like
of cells of tumor tissue. Examples include antigens characteristic
of tumor proteins, including proteins encoded by mutated oncogenes;
viral proteins associated with tumors; and glycoproteins. Tumors
include, but are not limited to, those derived from the types of
cancer: lip, nasopharynx, pharynx and oral cavity, esophagus,
stomach, colon, rectum, liver, gall bladder, pancreas, larynx, lung
and bronchus, melanoma of skin, breast, cervix, uterine, ovary,
bladder, kidney, uterus, brain and other parts of the nervous
system, thyroid, prostate, testes, Hodgkin's disease, non-Hodgkin's
lymphoma, multiple myeloma and leukemia.
[0215] In one specific embodiment of the invention, the
heterologous sequences are derived from the genome of human
immunodeficiency virus (HIV), preferably human immunodeficiency
virus-I or human immunodeficiency virus-2. In another embodiment of
the invention, the heterologous coding sequences may be inserted
within a gene coding sequence of the viral backbone such that a
chimeric gene product is expressed which contains the heterologous
peptide sequence within the metapneumoviral protein. In such an
embodiment of the invention, the heterologous sequences may also be
derived from the genome of a human immunodeficiency virus,
preferably of human immunodeficiency virus-1 or human
immunodeficiency virus-2.
[0216] In instances whereby the heterologous sequences are
HIV-derived, such sequences may include, but are not limited to
sequences derived from the env gene (i.e., sequences encoding all
or part of gp160, gp120, and/or gp41), the pol gene (i.e.,
sequences encoding all or part of reverse transcriptase,
endonuclease, protease, and/or integrase), the gag gene (i.e.,
sequences encoding all or part of p7, p6, p55, p17/18, p24/25) tat,
rev, nef, vif, vpu, vpr, and/or vpx.
[0217] In yet another embodiment, heterologous gene sequences that
can be engineered into the chimeric viruses include those that
encode proteins with immunopotentiating activities. Examples of
immunopotentiating proteins include, but are not limited to,
cytokines, interferon type 1, gamma interferon, colony stimulating
factors, and interleukin-1, -2, -4, -5, -6, -12.
[0218] In addition, other heterologous gene sequences that may be
engineered into the chimeric viruses include antigens derived from
bacteria such as bacterial surface glycoproteins, antigens derived
from fungi, and antigens derived from a variety of other pathogens
and parasites. Examples of heterologous gene sequences derived from
bacterial pathogens include, but are not limited to, antigens
derived from species of the following genera: Salmonella, Shigella,
Chlamydia, Helicobacter, Yersinia, Bordatella, Pseudomonas,
Neisseria, Vibrio, Haemophilus, Mycoplasma, Streptomyces,
Treponema, Coxiella, Ehrlichia, Brucella, Streptobacillus,
Fusospirocheta, Spirillum, Ureaplasma, Spirochaeta, Mycoplasma,
Actinomycetes, Borrelia, Bacteroides, Trichomoras, Branhamella,
Pasteurella, Clostridium, Corynebacterium, Listeria, Bacillus,
Erysipelothrix, Rhodococcus, Escherichia, Klebsiella, Pseudomanas,
Enterobacter, Serratia, Staphylococcus, Streptococcus, Legionella,
Mycobacterium, Proteus, Campylobacter, Enterococcus, Acinetobacter,
Morganella, Moraxella, Citrobacter, Rickettsia, Rochlimeae, as well
as bacterial species such as: P. aeruginosa; E. coli, P. cepacia,
S. epidermis, E. faecalis, S. pneumonias, S. aureus, N.
meningitidis, S. pyogenes, Pasteurella niultocida, Treponema
pallidum, and P. mirabilis.
[0219] Examples of heterologous gene sequences derived from
pathogenic fungi, include, but are not limited to, antigens derived
from fungi such as Cryptococcus neoformans; Blastomyces
dermatitidis; Aiellomyces derinatitidis; Histoplasma capsulatum;
Coccidioides immitis; Candida species, including C. albicans, C.
tropicalis, C. parapsilosis, C. guilliermondii and C. krusei,
Aspergillus species, including A. fumigatus, A. flavus and A.
niger, Rhizopus species; Rhizoniucor species; Cunninghammella
species; Apophysomyces species, including A. saksenaea, A. mucor
and A. absidia; Sporothrix schenckii, Paracoccidioides
brasiliensis; Pseudallescheria boydii, Torulopsis glabrata,
Trichophyton species, Microsporum species and Dermatophyres
species, as well as any other yeast or fungus now known or later
identified to be pathogenic.
[0220] Finally, examples of heterologous gene sequences derived
from parasites include, but are not limited to, antigens derived
from members of the Apicomplexa phylum such as, for example,
Babesia, Toxoplasma, Plasinodiuni, Eineria, Isospora, Atoxoplasma,
Cystoisospora, Hamniondia, Besniotia, Sarcocystis, Frenkelia,
Haemoproteus, Leucocytozoon, Theileria, Perkinsus and Gregarina
spp.; Pneumocystis carinii; members of the Microspora phylum such
as, for example, Nosenia, Enterocytozoon, Encephalitozoon, Septata,
Mrazekia, Aniblyospora, Ameson, Glugea, Pleistophora and
Microsporidium spp.; and members of the Ascetospora phylum such as,
for example, Haplosporidium spp., as well as species including
Plasmodium falciparum, P. vivax, P. ovale, P. malaria; Toxoplasma
gondii; Leishmania mexicana, L. tropica, L. major, L. aethiopica,
L. donovani, Trypanosoma cruzi, T brucei, Schistosoma mansoni, S.
haematobium, S. japonium; Trichinella spiralis; Wuchereria
bancrofti; Brugia malayli; Entaroeba histolytica; Enterobius
vermiculoarus; Taenia solium, T. saginata, Trichomonas vaginatis,
T. hominis, T. tenax; Giardia lamblia; Cryptosporidium parvum;
Pneumocytis carinii, Babesia bovis, B. divergens, B. microti,
Isospora belli, L. hominis; Dientamoeba fragilis; Onchocerca
volvulus; Ascaris lumbricoides; Necator americanis; Ancylostoma
duodenale; Strongyloides stercoralis; Capillaria philippinensis;
Angiostrongylus cantonensis; Hymenolepis nana; Diphyllobothrium
latum; Echinococcus granulosus, E. multilocularis; Paragonimus
westermani, P. caliensis; Chlonorchis sinensis;
Opisthorchisfelineas, G. Viverini, Fasciola hepatica, Sarcoptes
scabiei, Pediculus humanus; Phthirlus pubis; and Dermatobia
hominis, as well as any other parasite now known or later
identified to be pathogenic.
[0221] 5.4.2 Insertion of the Heterologous Gene Sequence
[0222] Insertion of a foreign gene sequence into a viral vector of
the invention can be accomplished by either a complete replacement
of a viral coding region with a heterologous sequence or by a
partial replacement or by adding the heterologous nucleotide
sequence to the viral genome. Complete replacement would probably
best be accomplished through the use of PCR-directed mutagenesis.
Briefly, PCR-primer A would contain, from the 5' to 3'end: a unique
restriction enzyme site, such as a class IIS restriction enzyme
site (i.e., a "shifter" enzyme; that recognizes a specific sequence
but cleaves the DNA either upstream or downstream of that
sequence); a stretch of nucleotides complementary to a region of
the gene that is to be replaced; and a stretch of nucleotides
complementary to the carboxy-terminus coding portion of the
heterologous sequence. PCR-primer B would contain from the 5' to 3'
end: a unique restriction enzyme site; a stretch of nucleotides
complementary to the gene that is to be replaced; and a stretch of
nucleotides corresponding to the 5' coding portion of the
heterologous or non-native gene. After a PCR reaction using these
primers with a cloned copy of the heterologous or non-native gene,
the product may be excised and cloned using the unique restriction
sites. Digestion with the class IIS enzyme and transcription with
the purified phage polymerase would generate a RNA molecule
containing the exact untranslated ends of the viral gene that
carries now a heterologous or non-native gene insertion. In an
alternate embodiment, PCR-primed reactions could be used to prepare
double-stranded DNA containing the bacteriophage promoter sequence,
and the hybrid gene sequence so that RNA templates can be
transcribed directly without cloning.
[0223] A heterologous nucleotide sequence can be added or inserted
at various positions of the virus of the invention. In one
embodiment, the heterologous nucleotide sequence is added or
inserted at position 1. In another embodiment, the heterologous
nucleotide sequence is added or inserted at position 2. In another
embodiment, the heterologous nucleotide sequence is added or
inserted at position 3. In another embodiment, the heterologous
nucleotide sequence is added or inserted at position 4. In another
embodiment, the heterologous nucleotide sequence is added or
inserted at position 5. In yet another embodiment, the heterologous
nucleotide sequence is added or inserted at position 6. As used
herein, the term "position" refers to the position of the
heterologous nucleotide sequence on the viral genome to be
transcribed, e.g., position 1 means that it is the first gene to be
transcribed, and position 2 means that it is the second gene to be
transcribed. Inserting heterologous nucleotide sequences at the
lower-numbered positions of the virus generally results in stronger
expression of the heterologous nucleotide sequence compared to
insertion at higher-numbered positions due to a transcriptional
gradient that occurs across the genome of the virus. However, the
transcriptional gradient also yields specific ratios of viral
mRNAs. Insertion of foreign genes will perturb these ratios and
result in the synthesis of different amounts of viral proteins that
may influence virus replication. Thus, both the transcriptional
gradient and the replication kinetics must be considered when
choosing an insertion site. Inserting heterologous nucleotide
sequences at lower-numbered positions is the preferred embodiment
of the invention if strong expression of the heterologous
nucleotide sequence is desired. In a preferred embodiment, the
heterologous sequence is added or inserted at position 1, 2 or
3.
[0224] When inserting a heterologous nucleotide sequence into the
virus of the invention, the intergenic region between the end of
the coding sequence of the heterologous gene and the start of the
coding sequence of the downstream gene can be altered to achieve a
desired effect. As used herein, the term "intergenic region" refers
to nucleotide sequence between the stop signal of one gene and the
start codon (e.g., AUG) of the coding sequence of the next
downstream open reading frame. An intergenic region may comprise a
non-coding region of a gene, i.e., between the transcription start
site and the start of the coding sequence (AUG) of the gene. This
non-coding region occurs naturally in some viral genes.
[0225] In various embodiments, the intergenic region between the
heterologous nucleotide sequence and the downstream gene can be
engineered, independently from each other, to be at least 10 nt in
length, at least 20 nt in length, at least 30 nt in length, at
least 50 nt in length, at least 75 nt in length, at least 100 nt in
length, at least 125 nt in length, at least 150 nt in length, at
least 175 nt in length or at least 200 nt in length. In certain
embodiments, the intergenic region between the heterologous
nucleotide sequence and the downstream gene can be engineered,
independently from each other, to be at most 10 nt in length, at
most 20 nt in length, at most 30 nt in length, at most 50 nt in
length, at most 75 nt in length, at most 100 nt in length, at most
125 nt in length, at most 150 nt in length, at most 175 nt in
length or at most 200 nt in length. In various embodiments, the
non-coding region of a desired gene in a virus genome can also be
engineered, independently from each other, to be at least 10 nt in
length, at least 20 nt in length, at least 30 nt in length, at
least 50 nt in length, at least 75 nt in length, at least 100 nt in
length, at least 125 nt in length, at least 150 nt in length, at
least 175 nt in length or at least 200 nt in length. In certain
embodiments, the non-coding region of a desired gene in a virus
genome can also be engineered, independently from each other, to be
at most 10 nt in length, at most 20 nt in length, at most 30 nt in
length, at most 50 nt in length, at most 75 nt in length, at most
100 nt in length, at most 125 nt in length, at most 150 nt in
length, at most 175 nt in length or at most 200 nt in length.
[0226] When inserting a heterologous nucleotide sequence, the
positional effect and the intergenic region manipulation can be
used in combination to achieve a desirable effect. For example, the
heterologous nucleotide sequence can be added or inserted at a
position selected from the group consisting of position 1, 2, 3, 4,
5, and 6, and the intergenic region between the heterologous
nucleotide sequence and the next downstream gene can be altered
(see Table 3). Some of the combinations encompassed by the present
invention are shown by way of example in Table 3.
4TABLE 3 Examples of mode of insertion of heterologous nucleotide
sequences Position 1 Position 2 Position 3 Position 4 Position 5
Position 6 IGR.sup.a 10-20 10-20 10-20 10-20 10-20 10-20 IGR 21-40
21-40 21-40 21-40 21-40 21-40 IGR 41-60 41-60 41-60 41-60 41-60
41-60 IGR 61-80 61-80 61-80 61-80 61-80 61-80 IGR 81-100 81-100
81-100 81-100 81-100 81-100 IGR 101-120 101-120 101-120 101-120
101-120 101-120 IGR 121-140 121-140 121-140 121-140 121-140 121-140
IGR 141-160 141-160 141-160 141-160 141-160 141-160 IGR 161-180
161-180 161-180 161-180 161-180 161-180 IGR 181-200 181-200 181-200
181-200 181-200 181-200 IGR 201-220 201-220 201-220 201-220 201-220
201-220 IGR 221-240 221-240 221-240 221-240 221-240 221-240 IGR
241-260 241-260 241-260 241-260 241-260 241-260 IGR 261-280 261-280
261-280 261-280 261-280 261-280 IGR 281-300 281-300 281-300 281-300
281-300 281-300 .sup.aIntergenic Region, measured in
nucleotide.
[0227] Depending on the purpose (e.g., to have strong
immunogenicity) of the inserted heterologous nucleotide sequence,
the position of the insertion and the length of the intergenic
region of the inserted heterologous nucleotide sequence can be
determined by various indexes including, but not limited to,
replication kinetics and protein or mRNA expression levels,
measured by following non-limiting examples of assays: plaque
assay, fluorescent-focus assay, infectious center assay,
transformation assay, endpoint dilution assay, efficiency of
plating, electron microscopy, hemagglutination, measurement of
viral enzyme activity, viral neutralization, hemagglutination
inhibition, complement fixation, immunostaining,
immunoprecipitation and immunoblotting, enzyme-linked immunosorbent
assay, nucleic acid detection (e.g., Southern blot analysis,
Northern blot analysis, Western blot analysis), growth curve,
employment of a reporter gene (e.g., using a reporter gene, such as
Green Fluorescence Protein (GFP) or enhanced Green Fluorescence
Protein (eGFP), integrated to the viral genome the same fashion as
the interested heterologous gene to observe the protein
expression), or a combination thereof. Procedures of performing
these assays are well known in the art (see, e.g., Flint et al.,
PRINCIPLES OF VIROLOGY, MOLECULAR BIOLOGY, PATHOGENESIS, AND
CONTROL, 2000, ASM Press pp 25-56, the entire text is incorporated
herein by reference), and non-limiting examples are given in the
Example sections, infra.
[0228] For example, expression levels can be determined by
infecting cells in culture with a virus of the invention and
subsequently measuring the level of protein expression by, e.g.,
Western blot analysis or ELISA using antibodies specific to the
gene product of the heterologous sequence, or measuring the level
of RNA expression by, e.g., Northern blot analysis using probes
specific to the heterologous sequence. Similarly, expression levels
of the heterologous sequence can be determined by infecting an
animal model and measuring the level of protein expressed from the
heterologous sequence of the recombinant virus of the invention in
the animal model. The protein level can be measured by obtaining a
tissue sample from the infected animal and then subjecting the
tissue sample to Western blot analysis or ELISA, using antibodies
specific to the gene product of the heterologous sequence. Further,
if an animal model is used, the titer of antibodies produced by the
animal against the gene product of the heterologous sequence can be
determined by any technique known to the skilled artisan, including
but not limited to, ELISA.
[0229] As the heterologous sequences can be homologous to a
nucleotide sequence in the genome of the virus, care should be
taken that the probes and the antibodies are indeed specific to the
heterologous sequence or its gene product.
[0230] In certain specific embodiments, expression levels of
F-protein of hMPV from chimeric avian-human metapneumovirus can be
determined by any technique known to the skilled artisan.
Expression levels of the F-protein can be determined by infecting
cells in a culture with the chimeric virus of the invention and
measuring the level of protein expression by, e.g., Western blot
analysis or ELISA using antibodies specific to the F-protein and/or
the G-protein of HMPV, or measuring the level of RNA expression by,
e.g., Northern blot analysis using probes specific to the F-gene
and/or the G-gene of human metapneumovirus. Similarly, expression
levels of the heterologous sequence can be determined using an
animal model by infecting an animal and measuring the level of
F-protein and/or G-protein in the animal model. The protein level
can be measured by obtaining a tissue sample from the infected
animal and then subjecting the tissue sample to Western blot
analysis or ELISA using antibodies specific to F-protein and/or
G-protein of the heterologous sequence. Further, if an animal model
is used, the titer of antibodies produced by the animal against
F-protein and/or G-protein can be detenmined by any technique known
to the skilled artisan, including but not limited to, ELISA.
[0231] The rate of replication of a recombinant virus of the
invention can be determined by any technique known to the skilled
artisan.
[0232] In certain embodiments, to facilitate the identification of
the optimal position of the heterologous sequence in the viral
genome and the optimal length of the intergenic region, the
heterologous sequence encodes a reporter gene. Once the optimal
parameters are detenmined, the reporter gene is replaced by a
heterologous nucleotide sequence encoding an antigen of choice. Any
reporter gene known to the skilled artisan can be used with the
methods of the invention. For more detail, see section 5.8.
[0233] The rate of replication of the recombinant virus can be
determined by any standard technique known to the skilled artisan.
The rate of replication is represented by the growth rate of the
virus and can be determined by plotting the viral titer over the
time post infection. The viral titer can be measured by any
technique known to the skilled artisan. In certain embodiments, a
suspension containing the virus is incubated with cells that are
susceptible to infection by the virus. Cell types that can be used
with the methods of the invention include, but are not limited to,
Vero cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, MRC-5
cells, WI-38 cells, tMK cells, 293 T cells, QT 6 cells, QT 35
cells, or chicken embryo fibroblasts (CEF). Subsequent to the
incubation of the virus with the cells, the number of infected
cells is detenmined. In certain specific embodiments, the virus
comprises a reporter gene. Thus, the number of cells expressing the
reporter gene is representative of the number of infected cells. In
a specific embodiment, the virus comprises a heterologous
nucleotide sequence encoding for eGFP, and the number of cells
expressing eGFP, i.e., the number of cells infected with the virus,
is determined using FACS.
[0234] In certain embodiments, the replication rate of the
recombinant virus of the invention is at most 20% of the
replication rate of the wild type virus from which the recombinant
virus is derived under the same conditions. The same conditions
refer to the same initial titer of virus, the same strain of cells,
the same incubation temperature, growth medium, number of cells and
other test conditions that may affect the replication rate. For
example, the replication rate of APV/hMPV with PIV's F gene in
position 1 is at most 20% of the replication rate of APV.
[0235] In certain embodiments, the replication rate of the
recombinant virus of the invention is at most 5%, at most 10%, at
most 20%, at most 30%, at most 40%, at most 50%, at most 75%, at
most 80%, at most 90% of the replication rate of the wild type
virus from which the recombinant virus is derived under the same
conditions. In certain embodiments, the replication rate of the
recombinant virus of the invention is at least 5%, at least 10%, at
least 20%, at least 30%, at least 40%, at least 50%, at least 75%,
at least 80%, at least 90% of the replication rate of the wild type
virus from which the recombinant virus is derived under the same
conditions. In certain embodiments, the replication rate of the
recombinant virus of the invention is between 5% and 20%, between
10% and 40%, between 25% and 50%, between 40% and 75%, between 50%
and 80%, or between 75% and 90% of the replication rate of the wild
type virus from which the recombinant virus is derived under the
same conditions.
[0236] In certain embodiments, the expression level of the
heterologous sequence in the recombinant virus of the invention is
at most 20% of the expression level of the F-protein of the wild
type virus from which the recombinant virus is derived under the
same conditions. The same conditions refer to the same initial
titer of virus, the same strain of cells, the same incubation
temperature, growth medium, number of cells and other test
conditions that may affect the replication rate. For example, the
expression level of the heterologous sequence of the F-protein of
PIV3 in position 1 of hMPV is at most 20% of the expression level
of the F-protein of hMPV.
[0237] In certain embodiments, the expression level of the
heterologous sequence in the recombinant virus of the invention is
at most 5%, at most 10%, at most 20%, at most 30%, at most 40%, at
most 50%, at most 75%, at most 80%, at most 90% of the expression
level of the F-protein of the wild type virus from which the
recombinant virus is derived under the same conditions. In certain
embodiments, the expression level of the heterologous sequence in
the recombinant virus of the invention is at least 5%, at least
10%, at least 20%, at least 30%, at least 40%, at least 50%, at
least 75%, at least 80%, at least 90% of the expression level of
the F-protein of the wild type virus from which the recombinant
virus is derived under the same conditions. In certain embodiments,
the expression level of the heterologous sequence in the
recombinant virus of the invention is between 5% and 20%, between
10% and 40%, between 25% and 50%, between 40% and 75%, between 50%
and 80%, or between 75% and 90% of the expression level of the
F-protein of the wild type virus from which the recombinant virus
is derived under the same conditions.
[0238] 5.4.3 Insertion of the Heterologous Gene Sequence into the G
Gene
[0239] The G protein is a transmembrane protein of
metapneumoviruses. In a specific embodiment, the heterologous
sequence is inserted into the region of the G-ORF that encodes for
the ectodomain, such that it is expressed on the surface of the
viral envelope. In one approach, the heterologous sequence may be
inserted within the antigenic site without deleting any viral
sequences. In another approach, the heterologous sequences replaces
sequences of the G-ORF. Expression products of such constructs may
be useful in vaccines against the foreign antigen, and may indeed
circumvent problems associated with propagation of the recombinant
virus in the vaccinated host. An intact G molecule with a
substitution only in antigenic sites may allow for G function and
thus allow for the construction of a viable virus. Therefore, this
virus can be grown without the need for additional helper
functions. The virus may also be attenuated in other ways to avoid
any danger of accidental escape.
[0240] Other hybrid constructions may be made to express proteins
on the cell surface or enable them to be released from the
cell.
[0241] 5.4.4 Construction of Bicistronic RNA
[0242] Bicistronic mRNA could be constructed to permit internal
initiation of translation of viral sequences and allow for the
expression of foreign protein coding sequences from the regular
terminal initiation site. Alternatively, a bicistronic mRNA
sequence may be constructed wherein the viral sequence is
translated from the regular terminal open reading frame, while the
foreign sequence is initiated from an internal site. Certain
internal ribosome entry site (IRES) sequences may be utilized. The
IRES sequences which are chosen should be short enough to not
interfere with MPV packaging limitations. Thus, it is preferable
that the IRES chosen for such a bicistronic approach be no more
than 500 nucleotides in length. In a specific embodiment, the IRES
is derived from a picomavirus and does not include any additional
picornaviral sequences. Specific IRES elements include, but are not
limited to the mammalian BiP IRES and the hepatitis C virus
IRES.
[0243] Alternatively, a foreign protein may be expressed from a new
internal transcriptional unit in which the transcriptional unit has
an initiation site and polyadenylation site. In another embodiment,
the foreign gene is inserted into a MPV gene such that the
resulting expressed protein is a fusion protein.
[0244] 5.5 Expression of Heterologous Gene Products Using
Recombinant cDNA and RNA Templates
[0245] The viral vectors and recombinant templates prepared as
described above can be used in a variety of ways to express the
heterologous gene products in appropriate host cells or to create
chimeric viruses that express the heterologous gene products. In
one embodiment, the recombinant cDNA can be used to transfect
appropriate host cells and the resulting RNA may direct the
expression of the heterologous gene product at high levels. Host
cell systems which provide for high levels of expression include
continuous cell lines that supply viral functions such as cell
lines superinfected with APV or MPV, respectively, cell lines
engineered to complement APV or MPV functions, etc.
[0246] In an alternate embodiment of the invention, the recombinant
templates may be used to transfect cell lines that express a viral
polymerase protein in order to achieve expression of the
heterologous gene product. To this end, transformed cell lines that
express a polymerase protein such as the L protein may be utilized
as appropriate host cells. Host cells may be similarly engineered
to provide other viral functions or additional functions such as G
or N.
[0247] In another embodiment, a helper virus may provide the RNA
polymerase protein utilized by the cells in order to achieve
expression of the heterologous gene product. In yet another
embodiment, cells may be transfected with vectors encoding viral
proteins such as the N, P, L, and M2-1 proteins.
[0248] 5.6 Rescue of Recombinant Virus Particles
[0249] In order to prepare the chimeric and recombinant viruses of
the invention, a cDNA encoding the genome of a recombinant or
chimeric virus of the invention in the plus or minus sense may be
used to transfect cells which provide viral proteins and functions
required for replication and rescue. Alternatively, cells may be
transfected with helper virus before, during, or after transfection
by the DNA or RNA molecule coding for the recombinant virus of the
invention. The synthetic recombinant plasmid DNAs and RNAs of the
invention can be replicated and rescued into infectious virus
particles by any number of techniques known in the art, as
described, e.g., in U.S. Pat. No. 5,166,057 issued Nov. 24, 1992;
in U.S. Pat. No. 5,854,037 issued Dec. 29, 1998; in European Patent
Publication EP 0702085A1, published Feb. 20, 1996; in U.S. patent
application Ser. No. 09/152,845; in International Patent
Publications PCT WO97/12032 published Apr. 3, 1997; WO96/34625
published Nov. 7, 1996; in European Patent Publication EP-A780475;
WO 99/02657 published Jan. 21, 1999; WO 98/53078 published Nov. 26,
1998; WO 98/02530 published Jan. 22, 1998; WO 99/15672 published
Apr. 1, 1999; WO 98/13501 published Apr. 2, 1998; WO 97/06270
published Feb. 20, 1997; and EPO 78047SA1 published Jun. 25, 1997,
each of which is incorporated by reference herein in its
entirety.
[0250] In one embodiment, of the present invention, synthetic
recombinant viral RNAs may be prepared that contain the non-coding
regions of the negative strand virus RNA which are essential for
the recognition by viral polymerases and for packaging signals
necessary to generate a mature virion. There are a number of
different approaches which may be used to apply the reverse
genetics approach to rescue negative strand RNA viruses. First, the
recombinant RNAs are synthesized from a recombinant DNA template
and reconstituted in vitro with purified viral polymerase complex
to form recombinant ribonucleoproteins (RNPs) which can be used to
transfect cells. In another approach, a more efficient transfection
is achieved if the viral polymerase proteins are present during
transcription of the synthetic RNAs either in vitro or in vivo.
With this approach the synthetic RNAs may be transcribed from cDNA
plasmids which are either co-transcribed in vitro with cDNA
plasmids encoding the polymerase proteins, or transcribed in vivo
in the presence of polymerase proteins, i.e., in cells which
transiently or constitutively express the polymerase proteins.
[0251] In additional approaches described herein, the production of
infectious chimeric or recombinant virus may be replicated in host
cell systems that express a metapneumoviral polymerase protein
(e.g., in virus/host cell expression systems; transformed cell
lines engineered to express a polymerase protein, etc.), so that
infectious chimeric or recombinant virus are rescued. In this
instance, helper virus need not be utilized since this function is
provided by the viral polymerase proteins expressed.
[0252] In accordance with the present invention, any technique
known to those of skill in the art may be used to achieve
replication and rescue of recombinant and chimeric viruses. One
approach involves supplying viral proteins and functions required
for replication in vitro prior to transfecting host cells. In such
an embodiment, viral proteins may be supplied in the form of
wildtype virus, helper virus, purified viral proteins or
recombinantly expressed viral proteins. The viral proteins may be
supplied prior to, during or post transcription of the synthetic
cDNAs or RNAs encoding the chimeric virus. The entire mixture may
be used to transfect host cells. In another approach, viral
proteins and functions required for replication may be supplied
prior to or during transcription of the synthetic cDNAs or RNAs
encoding the chimeric virus. In such an embodiment, viral proteins
and functions required for replication are supplied in the form of
wildtype virus, helper virus, viral extracts, synthetic cDNAs or
RNAs which express the viral proteins are introduced into the host
cell via infection or transfection. This infection/transfection
takes place prior to or simultaneous to the introduction of the
synthetic cDNAs or RNAs encoding the chimeric virus.
[0253] In a particularly desirable approach, cells engineered to
express all viral genes or chimeric or recombinant virus of the
invention, i.e., APV, MPV, MPV/APV or APV/MPV, may result in the
production of infectious virus which contain the desired genotype;
thus eliminating the need for a selection system. Theoretically,
one can replace any one of the ORFs or part of any one of the ORFs
encoding structural proteins of MPV with a foreign sequence.
However, a necessary part of this equation is the ability to
propagate the defective virus (defective because a normal viral
gene product is missing or altered). A number of possible
approaches exist to circumvent this problem. In one approach a
virus having a mutant protein can be grown in cell lines which are
constructed to constitutively express the wild type version of the
same protein. By this way, the cell line complements the mutation
in the virus. Similar techniques may be used to construct
transformed cell lines that constitutively express any of the MPV
genes. These cell lines which are made to express the viral protein
may be used to complement the defect in the chimeric or recombinant
virus and thereby propagate it. Alternatively, certain natural host
range systems may be available to propagate chimeric or recombinant
virus.
[0254] In yet another embodiment, viral proteins and functions
required for replication may be supplied as genetic material in the
form of synthetic cDNAs or RNAs so that they are co-transcribed
with the synthetic cDNAs or RNAs encoding the chimeric virus. In a
particularly desirable approach, plasmids which express the
chimeric virus and the viral polymerase and/or other viral
functions are co-transfected into host cells. For example, plasmids
encoding the genomic or antigenomic APV, MPV, MPV/APV or APV/MPV
RNA, with or without one or more heterologous sequences, may be
co-transfected into host cells with plasmids encoding the
metapneumoviral polymerase proteins N, P, L, or M2-1.
Alternatively, rescue of the recombinant viruses of the invention
may be accomplished by the use of Modified Vaccinia Virus Ankara
(MVA) encoding T7 RNA polymerase, or a combination of MVA and
plasmids encoding the polymerase proteins (N, P, and L). For
example, MVA-T7 or Fowl Pox-T7 can be infected into Vero cells,
LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, tMK cells,
LLC-MK2, HUT 292, FRHL-2 (rhesus), FCL-1 (green monkey), WI-38
(human), MRC-5 (human) cells, 293 T cells, QT 6 cells, QT 35 cells
and CEF cells. After infection with MVA-T7 or Fowl Pox-T7, a full
length antigenomic cDNA encoding the recombinant virus of the
invention may be transfected into the cells together with the N, P,
L, and M2-1 encoding expression plasmids. Alternatively, the
polymerase may be provided by plasmid transfection. The cells and
cell supernatant can subsequently be harvested and subjected to a
single freeze-thaw cycle. The resulting cell lysate may then be
used to infect a fresh HeLa or Vero cell monolayer in the presence
of 1-beta-D-arabinofuranosylcytosine (ara C), a replication
inhibitor of vaccinia virus, to generate a virus stock. The
supernatant and cells from these plates can then be harvested,
freeze-thawed once and the presence of recombinant virus particles
of the invention can be assayed by immunostaining of virus plaques
using antiserum specific to the particular virus.
[0255] Another approach to propagating the chimeric or recombinant
virus may involve co-cultivation with wild-type virus. This could
be done by simply taking recombinant virus and co-infecting cells
with this and another wild-type virus. The wild-type virus should
complement for the defective virus gene product and allow growth of
both the wild-type and recombinant virus. Alternatively, a helper
virus may be used to support propagation of the recombinant
virus.
[0256] In another approach, synthetic templates may be replicated
in cells co-infected with recombinant viruses that express the
metapneumovirus polymerase protein. In fact, this method may be
used to rescue recombinant infectious virus in accordance with the
invention. To this end, the metapneumovirus polymerase protein may
be expressed in any expression vector/host cell system, including
but not limited to viral expression vectors (e.g., vaccinia virus,
adenovirus, baculovirus, etc.) or cell lines that express a
polymerase protein (e.g., see Krystal et al, 1986, Proc. Natl.
Acad. Sci. USA 83: 2709-2713). Moreover, infection of host cells
expressing all metapneumovirus proteins may result in the
production of infectious chimeric virus particles. It should be
noted that it may be possible to construct a recombinant virus
without altering virus viability. These altered viruses would then
be growth competent and would not need helper functions to
replicate.
[0257] Transfection procedures are well-known to the skill artisan
and include, but are not limited to, DEAE-dextran-mediated, Calcium
phosphate-mediated, Electroporation, and Liposome-mediated
transfection.
[0258] A full-length viral genome can be assembled from several
smaller PCR fragments. Restriction maps of different isolates of
hMPV are shown in FIG. 28. The restriction sites can be used to
assemble the full-length construct. In certain embodiments, PCR
primers are designed such that the fragment resulting from the PCR
reaction has a restriction site close to its 5' end and a
restriction site close to it 3' end. The PCR product can then be
digested with the respective restriction enzymes and subsequently
ligated to the neighboring PCR fragments.
[0259] 5.7 Attenuation of Recombinant Viruses
[0260] The recombinant viruses of the invention can be further
genetically engineered to exhibit an attenuated phenotype. In
particular, the recombinant viruses of the invention exhibit an
attenuated phenotype in a subject to which the virus is
administered as a vaccine. Attenuation can be achieved by any
method known to a skilled artisan. Without being bound by theory,
the attenuated phenotype of the recombinant virus can be caused,
e.g., by using a virus that naturally does not replicate well in an
intended host (e.g., using an APV in human), by reduced replication
of the viral genome, by reduced ability of the virus to infect a
host cell, or by reduced ability of the viral proteins to assemble
to an infectious viral particle relative to the wild type strain of
the virus. The viability of certain sequences of the virus, such as
the leader and the trailer sequence can be tested using a
minigenome assay (see section 5.8).
[0261] The attenuated phenotypes of a recombinant virus of the
invention can be tested by any method known to the artisan (see,
e.g., section 5.8). A candidate virus can, for example, be tested
for its ability to infect a host or for the rate of replication in
a cell culture system. In certain embodiments, a mimi-genome system
is used to test the attenuated virus when the gene that is altered
is N, P, L, M2, F, G, M2-1, M2-2 or a combination thereof. In
certain embodiments, growth curves at different temperatures are
used to test the attenuated phenotype of the virus. For example, an
attenuated virus is able to grow at 35.degree. C., but not at
39.degree. C. or 40.degree. C. In certain embodiments, different
cell lines can be used to evaluate the attenuated phenotype of the
virus. For example, an attenuated virus may only be able to grow in
monkey cell lines but not the human cell lines, or the achievable
virus titers in different cell lines are different for the
attenuated virus. In certain embodiments, viral replication in the
respiratory tract of a small animal model, including but not
limited to, hamsters, cotton rats, mice and guinea pigs, is used to
evaluate the attenuated phenotypes of the virus. In other
embodiments, the immune response induced by the virus, including
but not limited to, the antibody titers (e.g., assayed by plaque
reduction neutralization assay or ELISA) is used to evaluate the
attenuated phenotypes of the virus. In a specific embodiment, the
plaque reduction neutralization assay or ELISA is carried out at a
low dose. In certain embodiments, the ability of the recombinant
virus to elicit pathological symptoms in an animal model can be
tested. A reduced ability of the virus to elicit pathological
symptoms in an animal model system is indicative of its attenuated
phenotype. In a specific embodiment, the candidate viruses are
tested in a monkey model for nasal infection, indicated by mucous
production.
[0262] The viruses of the invention can be attenuated such that one
or more of the functional characteristics of the virus are
impaired. In certain embodiments, attenuation is measured in
comparison to the wild type strain of the virus from which the
attenuated virus is derived. In other embodiments, attenuation is
determined by comparing the growth of an attenuated virus in
different host systems. Thus, for a non-limiting example, an APV is
said to be attenuated when grown in a human host if the growth of
the APV in the human host is reduced compared to the growth of the
APV in an avian host.
[0263] In certain embodiments, the attenuated virus of the
invention is capable of infecting a host, is capable of replicating
in a host such that infectious viral particles are produced. In
comparison to the wild type strain, however, the attenuated strain
grows to lower titers or grows more slowly. Any technique known to
the skilled artisan can be used to determine the growth curve of
the attenuated virus and compare it to the growth curve of the wild
type virus. For exemplary methods see Example section, infra. In a
specific embodiment, the attenuated virus grows to a titer of less
than 10.sup.5 pfu/ml, of less than 10.sup.4 pfu/ml, of less than
10.sup.3 pfu/ml, or of less than 10.sup.2 pfu/ml in Vero cells
under conditions as described in, e.g., Example 22.
[0264] In certain embodiments, the attenuated virus of the
invention (e.g., a chimeric mammalian MPV) cannot replicate in
human cells as well as the wild type virus (e.g., wild type
mammalian MPV) does. However, the attenuated virus can replicate
well in a cell line that lack interferon functions, such as Vero
cells.
[0265] In other embodiments, the attenuated virus of the invention
is capable of infecting a host, of replicating in the host, and of
causing proteins of the virus of the invention to be inserted into
the cytoplasmic membrane, but the attenuated virus does not cause
the host to produce new infectious viral particles. In certain
embodiments, the attenuated virus infects the host, replicates in
the host, and causes viral proteins to be inserted in the
cytoplasmic membrane of the host with the same efficiency as the
wild type mammalian virus. In other embodiments, the ability of the
attenuated virus to cause viral proteins to be inserted into the
cytoplasmic membrane into the host cell is reduced compared to the
wild type virus. In certain embodiments, the ability of the
attenuated mammalian virus to replicate in the host is reduced
compared to the wild type virus. Any technique known to the skilled
artisan can be used to determine whether a virus is capable of
infecting a mammalian cell, of replicating within the host, and of
causing viral proteins to be inserted into the cytoplasmic membrane
of the host. For illustrative methods see section 5.8.
[0266] In certain embodiments, the attenuated virus of the
invention is capable of infecting a host. In contrast to the wild
type mammalian MPV, however, the attenuated mammalian MPV cannot be
replicated in the host. In a specific embodiment, the attenuated
mammalian virus can infect a host and can cause the host to insert
viral proteins in its cytoplasmic membranes, but the attenuated
virus is incapable of being replicated in the host. Any method
known to the skilled artisan can be used to test whether the
attenuated mammalian MPV has infected the host and has caused the
host to insert viral proteins in its cytoplasmic membranes.
[0267] In certain embodiments, the ability of the attenuated
mammalian virus to infect a host is reduced compared to the ability
of the wild type virus to infect the same host. Any technique known
to the skilled artisan can be used to determine whether a virus is
capable of infecting a host. For illustrative methods see section
5.8.
[0268] In certain embodiments, mutations (e.g., missense mutations)
are introduced into the genome of the virus to generated a virus
with an attenuated phenotype. Mutations (e.g., missense mutations)
can be introduced into the N-gene, the P-gene, the M-gene, the
F-gene, the M2-gene, the SH-gene, the G-gene or the L-gene of the
recombinant virus. Mutations can be additions, substitutions,
deletions, or combinations thereof. In specific embodiments, a
single amino acid deletion mutation for the N, P, L, F, G, M2-1,
M2-2 or M2 proteins is introduced, which can be screened for
functionality in the mini-genome assay system and be evaluated for
predicted functionality in the virus. In more specific embodiments,
the missense mutation is a cold-sensitive mutation. In other
embodiments, the missense mutation is a heat-sensitive mutation. In
one embodiment, major phosphorylation sites of P protein of the
virus is removed. In another embodiment, a mutation or mutations
are introduced into the L gene of the virus to generate a
temperature sensitive strain. In yet another embodiment, the
cleavage site of the F gene is mutated in such a way that cleavage
does not occur or occurs at very low efficiency.
[0269] In other embodiments, deletions are introduced into the
genome of the recombinant virus. In more specific embodiments, a
deletion can be introduced into the N-gene, the P-gene, the M-gene,
the F-gene, the M2-gene, the SH-gene, the G-gene or the L-gene of
the recombinant virus. In specific embodiments, the deletion is in
the M2-gene of the recombinant virus of the present invention. In
other specific embodiments, the deletion is in the SH-gene of the
recombinant virus of the present invention. In yet another specific
embodiment, both the M2-gene and the SH-gene are deleted.
[0270] In certain embodiments, the intergenic region of the
recombinant virus is altered. In one embodiment, the length of the
intergenic region is altered. In another embodiment, the intergenic
regions are shuffled from 5' to 3' end of the viral genome.
[0271] In other embodiments, the genome position of a gene or genes
of the recombinant virus is changed. In one embodiment, the F or G
gene is moved to the 3' end of the genome. In another embodiment,
the N gene is moved to the 5' end of the genome.
[0272] In certain embodiments, attenuation of the virus is achieved
by replacing a gene of the wild type virus with a gene of a virus
of a different species, of a different subgroup, or of a different
variant. In illustrative embodiments, the N-gene, the P-gene, the
M-gene, the F-gene, the M2-gene, the SH-gene, the G-gene or the
L-gene of a mammalian MPV is replaced with the N-gene, the P-gene,
the M-gene, the F-gene, the M2-gene, the SH-gene, the G-gene or the
L-gene, respectively, of an APV. In other illustrative embodiments,
the N-gene, the P-gene, the M-gene, the F-gene, the M2-gene, the
SH-gene, the G-gene or the L-gene of APV is replaced with the
N-gene, the P-gene, the M-gene, the F-gene, the M2-gene, the
SH-gene, the G-gene or the L-gene, respectively, of a mammalian
MPV. In a preferred embodiment, attenuation of the virus is
achieved by replacing one or more polymerase associated genes
(e.g., N, P, L or M2) with genes of a virus of a different
species.
[0273] In certain embodiments, attenuation of the virus is achieved
by replacing one or more specific domains of a protein of the wild
type virus with domains derived from the corresponding protein of a
virus of a different species. In an illustrative embodiment, the
ectodomain of a F protein of APV is replaced with an ectodomain of
a F protein of a mammalian MPV. In a preferred embodiment, one or
more specific domains of L, N, or P protein are replaced with
domains derived from corresponding proteins of a virus of a
different species. In certain other embodiments, attenuation of the
virus is achieved by deleting one or more specific domains of a
protein of the wild type virus. In a specific embodiment, the
transmembrane domain of the F-protein is deleted.
[0274] In certain embodiments of the invention, the leader and/or
trailer sequence of the recombinant virus of the invention can be
modified to achieve an attenuated phenotype. In certain, more
specific embodiments, the leader and/or trailer sequence is reduced
in length relative to the wild type virus by at least 1 nucleotide,
at least 2 nucleotides, at least 3 nucleotides, at least 4
nucleotides, at least 5 nucleotides or at least 6 nucleotides. In
certain other, more specific embodiments, the sequence of the
leader and/or trailer of the recombinant virus is mutated. In a
specific embodiment, the leader and the trailer sequence are 100%
complementary to each other. In other embodiments, 1 nucleotide, 2
nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6
nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10
nucleotides are not complementary to each other where the remaining
nucleotides of the leader and the trailer sequences are
complementary to each other. In certain embodiments, the
non-complementary nucleotides are identical to each other. In
certain other embodiments, the non-complementary nucleotides are
different from each other. In other embodiments, if the
non-complementary nucleotide in the trailer is purine, the
corresponding nucleotide in the leader sequence is also a purine.
In other embodiments, if the non-complementary nucleotide in the
trailer is pyrimidine, the corresponding nucleotide in the leader
sequence is also a purine.
[0275] When a live attenuated vaccine is used, its safety must also
be considered. The vaccine must not cause disease. Any techniques
known in the art that can make a vaccine safe may be used in the
present invention. In addition to attenuation techniques, other
techniques may be used. One non-limiting example is to use a
soluble heterologous gene that cannot be incorporated into the
virion membrane. For example, a single copy of the soluble RSV F
gene, a version of the RSV gene lacking the transmembrane and
cytosolic domains, can be used. Since it cannot be incorporated
into the virion membrane, the virus tropism is not expected to
change.
[0276] Various assays can be used to test the safety of a vaccine.
See section 5.8, infra. Particularly, sucrose gradients and
neutralization assays can be used to test the safety. A sucrose
gradient assay can be used to determine whether a heterologous
protein is inserted in a virion. If the heterologous protein is
inserted in the virion, the virion should be tested for its ability
to cause symptoms even if the parental strain does not cause
symptoms. Without being bound by theory, if the heterologous
protein is incorporated in the virion, the virus may have acquired
new, possibly pathological, properties.
[0277] 5.8 Assays for Use with the Invention
[0278] A number of assays may be employed in accordance with the
present invention in order to determine the rate of growth of a
chimeric or recombinant virus in a cell culture system, an animal
model system or in a subject. A number of assays may also be
employed in accordance with the present invention in order to
determine the requirements of the chimeric and recombinant viruses
to achieve infection, replication and packaging of virions.
[0279] The assays described herein may be used to assay viral titre
over time to determine the growth characteristics of the virus. In
a specific embodiment, the viral titre is determined by obtaining a
sample from the infected cells or the infected subject, preparing a
serial dilution of the sample and infecting a monolayer of cells
that are susceptible to infection with the virus at a dilution of
the virus that allows for the emergence of single plaques. The
plaques can then be counted and the viral titre express as plaque
forming units per milliliter of sample. In a specific embodiment of
the invention, the growth rate of a virus of the invention in a
subject is estimated by the titer of antibodies against the virus
in the subject. Without being bound by theory, the antibody titer
in the subject reflects not only the viral titer in the subject but
also the antigenicity. If the antigenicity of the virus is
constant, the increase of the antibody titer in the subject can be
used to determine the growth curve of the virus in the subject. In
a preferred embodiment, the growth rate of the virus in animals or
humans is best tested by sampling biological fluids of a host at
multiple time points post-infection and measuring viral titer.
[0280] The expression of heterologous gene sequence in a cell
culture system or in a subject can be determined by any technique
known to the skilled artisan. In certain embodiments, the
expression of the heterologous gene is measured by quantifying the
level of the transcript. The level of the transcript can be
measured by Northern blot analysis or by RT-PCR using probes or
primers, respectively, that are specific for the transcript. The
transcript can be distinguished from the genome of the virus
because the virus is in the antisense orientation whereas the
transcript is in the sense orientation. In certain embodiments, the
expression of the heterologous gene is measured by quantifying the
level of the protein product of the heterologous gene. The level of
the protein can be measured by Western blot analysis using
antibodies that are specific to the protein.
[0281] In a specific embodiment, the heterologous gene is tagged
with a peptide tag. The peptide tag can be detected using
antibodies against the peptide tag. The level of peptide tag
detected is representative for the level of protein expressed from
the heterologous gene. Alternatively, the protein expressed from
the heterologous gene can be isolated by virtue of the peptide tag.
The amount of the purified protein correlates with the expression
level of the heterologous gene. Such peptide tags and methods for
the isolation of proteins fused to such a peptide tag are well
known in the art. A variety of peptide tags known in the art may be
used in the modification of the heterologous gene, such as, but not
limited to, the immunoglobulin constant regions, polyhistidine
sequence (Petty, 1996, Metal-chelate affinity chromatography, in
Current Protocols in Molecular Biology, volume 1-3 (1994-1998). Ed.
by Ausubel, F. M., Brent, R., Kunston, R. E., Moore, D. D.,
Seidman, J. G., Smith, J. A. and Struhl, K. Published by John Wiley
and sons, Inc., USA, Greene Publish. Assoc. & Wiley
Interscience), glutathione S-transferase (GST; Smith, 1993, Methods
Mol. Cell Bio. 4:220-229), the E. coli maltose binding protein
(Guan et al., 1987, Gene 67:21-30), various cellulose binding
domains (U.S. Pat. No. 5,496,934; 5,202,247; 5,137,819; Tomme et
al., 1994, Protein Eng. 7:117-123), and the FLAG epitope (Short
Protocols in Molecular Biology, 1999, Ed. Ausubel et al., John
Wiley & Sons, Inc., Unit 10.11) etc. Other peptide tags are
recognized by specific binding partners and thus facilitate
isolation by affinity binding to the binding partner, which is
preferably immobilized and/or on a solid support. As will be
appreciated by those skilled in the art, many methods can be used
to obtain the coding region of the above-mentioned peptide tags,
including but not limited to, DNA cloning, DNA amplification, and
synthetic methods. Some of the peptide tags and reagents for their
detection and isolation are available commercially.
[0282] Samples from a subject can be obtained by any method known
to the skilled artisan. In certain embodiments, the sample consists
of nasal aspirate, throat swab, sputum or broncho-alveolar
lavage.
[0283] 5.8.1 Minireplicon Constructs
[0284] Minireplicon constructs can be generated to contain an
antisense reporter gene. Any reporter gene known to the skilled
artisan can be used with the invention (see section 5.8.2). In a
specific embodiment, the reporter gene is CAT. In certain
embodiments, the reporter gene can be flanked by the negative-sense
hMPV or APV leader linked to the hepatitis delta ribozyme (Hep-d
Ribo) and T7 polymerase termination (T-T7) signals, and the hMPV or
APV trailer sequence preceded by the T7 RNA polymerase
promoter.
[0285] In certain embodiments, the plasmid encoding the
minireplicon is transfected into a host cell. The host cell
expresses T7 RNA polymerase, the N gene, the P gene, the L gene,
and the M2.1 gene. In certain embodiments, the host cell is
transfected with plasmids encoding T7 RNA polymerase, the N gene,
the P gene, the L gene, and the M2.1 gene. In other embodiments,
the plasmid encoding the minireplicon is transfected into a host
cell and the host cell is infected with a helper virus.
[0286] The expression level of the reporter gene and/or its
activity can be assayed by any method known to the skilled artisan,
such as, but not limited to, the methods described in section
5.8.2.
[0287] In certain, more specific, embodiments, the minireplicon
comprises the following elements, in the order listed: T7 RNA
Polymerase or RNA polymerase 1, leader sequence, gene start, GFP,
trailer sequence, Hepatitis delta ribozyme sequence or RNA
polymerase I termination sequence. If T7 is used as RNA polymerase,
Hepatitis delta ribozyme sequence should be used as termination
sequence. If RNA polymerase I is used, RNA polymerase I termination
sequence may be used as a termination signal. Dependent on the
rescue system, the sequence of the minireplicon can be in the sense
or antisense orientation. In certain embodiments, the leader
sequence can be modified relative to the wild type leader sequence
of hMPV. The leader sequence can optionally be preceded by an AC.
The T7 promoter sequence can be with or without a G-doublet or
triplet, where the G-doublet or triplet provides for increased
transcription.
[0288] In a specific embodiment, a cell is infected with hMPV at
TO. 24 hours later, at T24, the cell is transfected with a
minireplicon construct. 48 hours after T0 and 72 hours after T0,
the cells are tested for the expression of the reporter gene. If a
fluorescent reporter gene product is used (e.g., GFP), the
expression of the reporter gene can be tested using FACS.
[0289] In another embodiment, a cell is transfected with six
plasmids at T=0 hours. Cells are then harvested at T=40 hours and
T=60 hours and analyzed for CAT or GFP expression. (See FIG.
25.)
[0290] In another specific embodiment, a cell is infected with
MVA-T7 at T0.1 hour later, at T1, the cell is transfected with a
minireplicon construct. 24 hours after T0, the cell is infected
with hMPV. 72 hours after T0, the cells are tested for the
expression of the reporter gene. If a fluorescent reporter gene
product is used (e.g., GFP), the expression of the reporter gene
can be tested using FACS.
[0291] 5.8.2 Reporter Genes
[0292] In certain embodiments, assays for measurement of reporter
gene expression in tissue culture or in animal models can be used
with the methods of the invention. The nucleotide sequence of the
reporter gene is cloned into the virus, such as APV, hMPV, hMPV/APV
or APV/hMPV, wherein (i) the position of the reporter gene is
changed and (ii) the length of the intergenic regions flanking the
reporter gene are varied. Different combinations are tested to
determine the optimal rate of expression of the reporter gene and
the optimal replication rate of the virus comprising the reporter
gene.
[0293] In certain embodiments, minireplicon constructs are
generated to include a reporter gene. The construction of
minireplicon constructs is described herein.
[0294] The abundance of the reporter gene product can be determined
by any technique known to the skilled artisan. Such techniques
include, but are not limited to, Northern blot analysis or Western
blot analysis using probes or antibodies, respectively, that are
specific to the reporter gene.
[0295] In certain embodiments, the repoirter gene emits a
fluorescent signal that can be detected in a FACS. FACS can be used
to detect cells in which the reporter gene is expressed.
[0296] Techniques for practicing the specific aspect of this
invention will employ, unless otherwise indicated, conventional
techniques of molecular biology, microbiology, and recombinant DNA
manipulation and production, which are routinely practiced by one
of skill in the art. See, e.g., Sambrook et al., Molecular cloning,
a laboratory manual, second ed., vol. 1-3. (Cold Spring Harbor
Laboratory, 1989), A Laboratory Manual, Second Edition; DNA
Cloning, Volumes I and II (Glover, Ed. 1985); and Transcription and
Translation (Hames & Higgins, Eds. 1984).
[0297] The biochemical activity of the reporter gene product
represents the expression level of the reporter gene. The total
level of reporter gene activity depends also on the replication
rate of the recombinant virus of the invention. Thus, to determine
the true expression level of the reporter gene from the recombinant
virus, the total expression level should be divided by the titer of
the recombinant virus in the cell culture or the animal model.
[0298] Reporter genes that can be used with the methods of
invention include, but are not limited to, the genes listed in the
Table 4 below:
5TABLE 4 Reporter genes and the biochemical properties of the
respective reporter gene products Reporter Gene Protein Activity
& Measurement CAT (chloramphenicol Transfers radioactive acetyl
groups to acetyltransferase) chloramphenicol or detection by thin
layer chromatography and autoradiography GAL (.beta.-galactosidase)
Hydrolyzes colorless galactosides to yield colored products. GUS
(.beta.-glucuronidase) Hydrolyzes colorless glucuronides to yield
colored products. LUC (luciferase) Oxidizes luciferin, emitting
photons GFP (green fluorescent fluorescent protein without
substrate protein) SEAP (secreted alkaline luminescence reaction
with suitable phosphatase) substrates or with substrates that
generate chromophores HRP (horseradish peroxidase) in the presence
of hydrogen oxide, oxidation of 3,3',5,5'-tetramethylbenzidine to
form a colored complex AP (alkaline phosphatase) luminescence
reaction with suitable substrates or with substrates that generate
chromophores
[0299] The abundance of the reporter gene can be measured by, inter
alia, Western blot analysis or Northern blot analysis or any other
technique used for the quantification of transcription of a
nucleotide sequence, the abundance of its mRNA its protein
(seeShort Protocols in Molecular Biology, Ausubel et al.,
(editors), John Wiley & Sons, Inc., 4.sup.th edition, 1999). In
certain embodiments, the activity of the reporter gene product is
measured as a readout of reporter gene expression from the
recombinant virus. For the quantification of the activity of the
reporter gene product, biochemical characteristics of the reporter
gene product can be employed (see Table 4). The methods for
measuring the biochemical activity of the reporter gene products
are well-known to the skilled artisan. A more detailed description
of illustrative reporter genes that can be used with the methods of
the invention is set forth below.
[0300] 5.8.3 Measurement of Incidence of Infection Rate
[0301] The incidence of infection can be determined by any method
well-known in the art, for example, but not limited to, clinical
samples (e.g., nasal swabs) can be tested for the presence of a
virus of the invention by immunofluorescence assay (IFA) using an
anti-APV-antigen antibody, an anti-hMPV-antigen antibody, an
anti-APV-antigen antibody, and/or an antibody that is specific to
the gene product of the heterologous nucleotide sequence,
respectively.
[0302] In certain embodiments, samples containing intact cells can
be directly processed, whereas isolates without intact cells should
first be cultured on a permissive cell line (e.g. HEp-2 cells). In
an illustrative embodiments, cultured cell suspensions should be
cleared by centrifugation at, e.g., 300.times.g for 5 minutes at
room temperature, followed by a PBS, pH 7.4 (Ca++ and Mg++ free)
wash under the same conditions. Cell pellets are resuspended in a
small volume of PBS for analysis. Primary clinical isolates
containing intact cells are mixed with PBS and centrifuged at
300.times.g for 5 minutes at room temperature. Mucus is removed
from the interface with a sterile pipette tip and cell pellets are
washed once more with PBS under the same conditions. Pellets are
then resuspended in a small volume of PBS for analysis. Five to ten
microliters of each cell suspension are spotted per 5 mm well on
acetone washed 12-well HTC supercured glass slides and allowed to
air dry. Slides are fixed in cold (-20.degree. C.) acetone for 10
minutes. Reactions are blocked by adding PBS-1% BSA to each well
followed by a 10 minute incubation at room temperature. Slides are
washed three times in PBS-0.1% Tween-20 and air dried. Ten
microliters of each primary antibody reagent diluted to 250 ng/ml
in blocking buffer is spotted per well and reactions are incubated
in a humidified 37.degree. C. environment for 30 minutes. Slides
are then washed extensively in three changes of PBS-0.1% Tween-20
and air dried. Ten microliters of appropriate secondary conjugated
antibody reagent diluted to 250 ng/ml in blocking buffer are
spotted per respective well and reactions are incubated in a
humidified 37.degree. C. environment for an additional 30 minutes.
Slides are then washed in three changes of PBS-0.1% Tween-20. Five
microliters of PBS-50% glycerol-10 mM Tris pH 8.0-1 mM EDTA are
spotted per reaction well, and slides are mounted with cover slips.
Each reaction well is subsequently analyzed by fluorescence
microscopy at 200.times.power using a B-2A filter (EX 450-490 nm).
Positive reactions are scored against an autofluorescent background
obtained from unstained cells or cells stained with secondary
reagent alone. Positive reactions are characterized by bright
fluorescence punctuated with small inclusions in the cytoplasm of
infected cells.
[0303] 5.8.4 Measurement of Serum Titer
[0304] Antibody serum titer can be determined by any method
well-known in the art, for example, but not limited to, the amount
of antibody or antibody fragment in serum samples can be
quantitated by a sandwich ELISA. Briefly, the ELISA consists of
coating microtiter plates overnight at 4.degree. C. with an
antibody that recognizes the antibody or antibody fragment in the
serum. The plates are then blocked for approximately 30 minutes at
room temperature with PBS-Tween-0.5% BSA. Standard curves are
constructed using purified antibody or antibody fragment diluted in
PBS-TWEEN-BSA, and samples are diluted in PBS-BSA. The samples and
standards are added to duplicate wells of the assay plate and are
incubated for approximately 1 hour at room temperature. Next, the
non-bound antibody is washed away with PBS-TWEEN and the bound
antibody is treated with a labeled secondary antibody (e.g.,
horseradish peroxidase conjugated goat-anti-human IgG) for
approximately 1 hour at room temperature. Binding of the labeled
antibody is detected by adding a chromogenic substrate specific for
the label and measuring the rate of substrate turnover, e.g., by a
spectrophotometer. The concentration of antibody or antibody
fragment levels in the serum is determined by comparison of the
rate of substrate turnover for the samples to the rate of substrate
turnover for the standard curve at a certain dilution.
[0305] 5.8.5 Serological Tests
[0306] In certain embodiments of the invention, the presence of
antibodies that bind to a component of a mammalian MPV is detected.
In particular the presence of antibodies directed to a protein of a
mammalian MPV can be detected in a subject to diagnose the presence
of a mammalian MPV in the subject. Any method known to the skilled
artisan can be used to detect the presence of antibodies directed
to a component of a mammalian MPV.
[0307] In an illustrative embodiment, components of mammalian MPV
are linked to a solid support. In a specific embodiment, the
component of the mammalian MPV can be, but is not limited to, the F
protein or the G protein. Subsequently, the material that is to be
tested for the presence of antibodies directed to mammalian MPV is
incubated with the solid support under conditions conducive to the
binding of the antibodies to the mammalian MPV components.
Subsequently, the solid support is washed under conditions that
remove any unspecifically bound antibodies. Following the washing
step, the presence of bound antibodies can be detected using any
technique known to the skilled artisan. In a specific embodiment,
the mammalian MPV protein-antibody complex is incubated with
detectably labeled antibody that recognizes antibodies that were
generated by the species of the subject, e.g., if the subject is a
cotton rat, the detectably labeled antibody is directed to rat
antibodies, under conditions conducive to the binding of the
detectably labeled antibody to the antibody that is bound to the
component of mammalian MPV. In a specific embodiment, the
detectably labeled antibody is conjugated to an enzymatic activity.
In another embodiment, the detectably labeled antibody is
radioactively labeled. The complex of mammalian MPV
protein-antibody-detectably labeled antibody is then washed, and
subsequently the presence of the detectably labeled antibody is
quantified by any technique known to the skilled artisan, wherein
the technique used is dependent on the type of label of the
detectably labeled antibody.
[0308] 5.8.6 Biacore Assay
[0309] Determination of the kinetic parameters of antibody binding
can be determined for example by the injection of 250 .mu.L of
monoclonal antibody ("mAb") at varying concentration in HBS buffer
containing 0.05% Tween-20 over a sensor chip surface, onto which
has been immobilized the antigen. The antigen can be any component
of a mammalian MPV. In a specific embodiment, the antigen can be,
but is not limited to, the F protein or the G protein of a
mammalian MPV. The flow rate is maintained constant at 75 uL/min.
Dissociation data is collected for 15 min, or longer as necessary.
Following each injection/dissociation cycle, the bound mAb is
removed from the antigen surface using brief, 1 min pulses of
dilute acid, typically 10-100 mM HCl, though other regenerants are
employed as the circumstances warrant.
[0310] More specifically, for measurement of the rates of
association, k.sub.on, and dissociation, k.sub.off, the antigen is
directly immobilized onto the sensor chip surface through the use
of standard amine coupling chemistries, namely the EDC/NHS method
(EDC=N-diethylaminopropyl)-carbodiimide). Briefly, a 5-100 nM
solution of the antigen in 10 mM NaOAc, pH 4 or pH 5 is prepared
and passed over the EDC/NHS-activated surface until approximately
30-50 RU's (Biacore Resonance Unit) worth of antigen are
immobilized. Following this, the unreacted active esters are
"capped" off with an injection of 1M Et-NH2. A blank surface,
containing no antigen, is prepared under identical immobilization
conditions for reference purposes. Once a suitable surface has been
prepared, an appropriate dilution series of each one of the
antibody reagents is prepared in HBS/Tween-20, and passed over both
the antigen and reference cell surfaces, which are connected in
series. The range of antibody concentrations that are prepared
varies depending on what the equilibrium binding constant, K.sub.D,
is estimated to be. As described above, the bound antibody is
removed after each injection/dissociation cycle using an
appropriate regenerant.
[0311] Once an entire data set is collected, the resulting binding
curves are globally fitted using algorithms supplied by the
instrument manufacturer, BIAcore, Inc. (Piscataway, N.J.). All data
are fitted to a 1:1 Langmuir binding model. These algorithm
calculate both the k.sub.in and the k.sub.off, from which the
apparent equilibrium binding constant, K.sub.D, is deduced as the
ratio of the two rate constants (i.e. k.sub.off/k.sub.on). More
detailed treatments of how the individual rate constants are
derived can be found in the BIAevaluation Software Handbook
(BIAcore, Inc., Piscataway, N.J.).
[0312] 5.8.7 Microneutralization Assay
[0313] The ability of antibodies or antigen-binding fragments
thereof to neutralize virus infectivity is determined by a
microneutralization assay. This microneutralization assay is a
modification of the procedures described by Anderson et al., (1985,
J. Clin. Microbiol. 22:1050-1052, the disclosure of which is hereby
incorporated by reference in its entirety). The procedure is also
described in Johnson et al., 1999, J. Infectious Diseases
180:35-40, the disclosure of which is hereby incorporated by
reference in its entirety.
[0314] Antibody dilutions are made in triplicate using a 96-well
plate. 106 TCID.sub.50 of a mammalian MPV are incubated with serial
dilutions of the antibody or antigen-binding fragments thereof to
be tested for 2 hours at 37.degree. C. in the wells of a 96-well
plate. Cells susceptible to infection with a mammalian MPV, such
as, but not limited to Vero cells (2.5.times.10.sup.4) are then
added to each well and cultured for 5 days at 37.degree. C. in 5%
CO.sub.2. After 5 days, the medium is aspirated and cells are
washed and fixed to the plates with 80% methanol and 20% PBS. Virus
replication is then determined by viral antigen, such as F protein
expression. Fixed cells are incubated with a biotin-conjugated
anti-viral antigen, such as anti-F protein monoclonal antibody
(e.g., pan F protein, C-site-specific MAb 133-1H) washed and
horseradish peroxidase conjugated avidin is added to the wells. The
wells are washed again and turnover of substrate TMB (thionitr6
benzoic acid) is measured at 450 nm. The neutralizing titer is
expressed as the antibody concentration that causes at least 50%
reduction in absorbency at 450 nm (the OD.sub.450) from virus-only
control cells.
[0315] The microneutralization assay described here is only one
example. Alternatively, standard neutralization assays can be used
to determine how significantly the virus is affected by an
antibody.
[0316] 5.8.8 Viral Fusion Inhibition Assay
[0317] This assay is in principle identical to the
microneutralization assay, except that the cells are infected with
the respective virus for four hours prior to addition of antibody
and the read-out is in terms of presence of absence of fusion of
cells (Taylor et al., 1992, J. Gen. Virol. 73:2217-2223).
[0318] 5.8.9 Isothermal Titration Calorimetry
[0319] Thermodynamic binding affinities and enthalpies are
determined from isothermal titration calorimetry (ITC) measurements
on the interaction of antibodies with their respective antigen.
[0320] Antibodies are diluted in dialysate and the concentrations
were determined by UV spectroscopic absorption measurements with a
Perkin-Elmer Lambda 4B Spectrophotometer using an extinction
coefficient of 217,000 M.sup.-1 cm.sup.-1 at the peak maximum at
280 nm. The diluted mammalian MPV-antigen concentrations are
calculated from the ratio of the mass of the original sample to
that of the diluted sample since its extinction coefficient is too
low to determine an accurate concentration without employing and
losing a large amount of sample.
[0321] ITC Measurements
[0322] The binding thermodynamics of the antibodies are determined
from ITC measurements using a Microcal, Inc. VP Titration
Calorimeter. The VP titration calorimeter consists of a matched
pair of sample and reference vessels (1.409 ml) enclosed in an
adiabatic enclosure and a rotating stirrer-syringe for titrating
ligand solutions into the sample vessel. The ITC measurements are
performed at 25.degree. C. and 35.degree. C. The sample vessel
contained the antibody in the phosphate buffer while the reference
vessel contains just the buffer solution. The phosphate buffer
solution is saline 67 mM PO.sub.4 at pH 7.4 from HyClone, Inc. Five
or ten .mu.l aliquots of the 0.05 to 0.1 mM RSV-antigen,
PIV-antigen, and/or hMPV-antigen solution are titrated 3 to 4
minutes apart into the antibody sample solution until the binding
is saturated as evident by the lack of a heat exchange signal.
[0323] A non-linear, least square minimization software program
from Microcal, Inc., Origin 5.0, is used to fit the incremental
heat of the i-th titration (.DELTA.Q (i)) of the total heat,
Q.sub.t, to the total titrant concentration, X.sub.t, according to
the following equations (I),
Q.sub.t=nC.sub.t.DELTA.H.sub.b.degree.V{1+X.sub.t/nC.sub.t+1/nK.sub.bC.su-
b.t-[(1+X.sub.t/nC.sub.t+1/nK.sub.bC.sub.t).sup.2-4X.sub.t/nC.sub.t].sup.1-
/2}/2 (1a)
.DELTA.Q(i)=Q(i)+dVi/2V{Q(i)+Q(i-1)}-Q(i-1) (1b)
[0324] where C.sub.t is the initial antibody concentration in the
sample vessel, V is the volume of the sample vessel, and n is the
stoichiometry of the binding reaction, to yield values of K.sub.b,
.DELTA.H.sub.b.degree., and n. The optimum range of sample
concentrations for the determination of K.sub.b depends on the
value of K.sub.b and is defined by the following relationship.
C.sub.tK.sub.bn.ltoreq.500 (2)
[0325] so that at 1 .mu.M the maximum K.sub.b that can be
determined is less than 2.5.times.10.sup.8 M.sup.-1. If the first
titrant addition does not fit the binding isotherm, it was
neglected in the final analysis since it may reflect release of an
air bubble at the syringe opening-solution interface.
[0326] 5.8.10 Immunoassays
[0327] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
159 aprotinin, sodium vanadate), adding the antibody of interest to
the cell lysate, incubating for a period of time (e.g., to 4 hours)
at 4 degrees C., adding protein A and/or protein G sepharose beads
to the cell lysate, incubating for about an hour or more at 4
degrees C., washing the beads in lysis buffer and re-suspending the
beads in SDS/sample buffer. The ability of the antibody of interest
to immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al., eds., 1994, Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York
at pages 10, 16, 1.
[0328] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
get to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane, in blocking solution (e.g., PBS with 3% BSA or
non-fat milk), washing the membrane in washing buffer (e.g.,
PBSTween20), incubating the membrane with primary antibody (the
antibody of interest) diluted in blocking buffer, washing the
membrane in washing buffer, incubating the membrane with a
secondary antibody (which recognizes the primary antibody, e.g., an
anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive
molecule (e.g., .sup.12P or .sup.121I) diluted in blocking buffer,
washing the membrane in wash buffer, and detecting the presence of
the antigen. One of skill in the art would be knowledgeable as to
the parameters that can be modified to increase the signal detected
and to reduce the background noise. For further discussion
regarding western blot protocols see, e.g., Ausubel et al., eds,
1994, GinTent Protocols in Molecular Biology, Vol. 1, John Wiley
& Sons, Inc., New York at 10.8.1.
[0329] ELISAs comprise preparing antigen, coating the well of a
96-well microtiter plate with the antigen, washing away antigen
that did not bind the wells, adding the antibody of interest
conjugated to a detectable compound such as an enzymatic substrate
(e.g., horseradish peroxidase or alkaline phosphatase) to the wells
and incubating for a period of time, washing away unbound
antibodies or non-specifically bound antibodies, and detecting the
presence of the antibodies specifically bound to the antigen
coating the well. In ELISAs the antibody of interest does not have
to be conjugated to a detectable compound; instead, a second
antibody (which recognizes the antibody of interest) conjugated to
a detectable compound may be added to the well. Further, instead of
coating the well with the antigen, the antibody may be coated to
the well. In this case, the detectable molecule could be the
antigen conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase).
The parameters that can be modified to increase signal detection
and other variations of ELISAs are well known to one of skill in
the art. For further discussion regarding ELISAs see, e.g., Ausubel
et al., eds, 1994, Current Protocols in Molecular Biology, Vol. I,
John Wiley & Sons, Inc., New York at 11.2.1.
[0330] The binding affinity of an antibody (including a scFv or
other molecule comprising, or alternatively consisting of, antibody
fragments or variants thereof) to an antigen and the off-rate of an
antibody-antigen interaction can be determined by competitive
binding assays. One example of a competitive binding assay is a
radioimmunoassay comprising the incubation of labeled antigen
(e.g., .sup.3H or .sup.121I) with the antibody of interest in the
presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen.
[0331] 5.8.11 Sucrose Gradient Assay
[0332] The question of whether the heterologous proteins are
incorporated into the virion can be further investigated by use of
any biochemical assay known to the skilled artisan. In a specific
embodiment, a sucrose gradient assay is used to determine whether a
heterologous protein is incorporated into the virion.
[0333] Infected cell lysates can be fractionated in 20-60% sucrose
gradients, various fractions are collected and analyzed for the
presence and distribution of heterologous proteins and the vector
proteins by, e.g., Western blot analysis. The fractions and the
virus proteins can also be assayed for peak virus titers by plaque
assay. If the heterologous protein co-migrates with the virion the
heterologous protein is associated with the virion.
[0334] 5.9 Methods to Identify New Isolates of MPV
[0335] The present invention relates to mammalian MPV, in
particular hMPV. While the present invention provides the
characterization of two serological subgroups of MPV, A and B, and
the characterization of four variants of MPV A1, A2, B1 and B2, the
invention is not limited to these subgroups and variants. The
invention encompasses any yet to be identified isolates of MPV,
including those which are characterized as belonging to the
subgroups and variants described herein, or belonging to a yet to
be characterized subgroup or variant.
[0336] Immunoassays can be used in order to characterize the
protein components that are present in a given sample. Immunoassays
are an effective way to compare viral isolates using peptides
components of the viruses for identification. For example, the
invention provides herein a method to identify further isolates of
MPV as provided herein, the method comprising inoculating an
essentially MPV-uninfected or specific-pathogen-free guinea pig or
ferret (in the detailed description the animal is inoculated
intranasally but other was of inoculation such as intramuscular or
intradermal inoculation, and using an other experimental animal, is
also feasible) with the prototype isolate I-2614 or related
isolates. Sera are collected from the animal at day zero, two weeks
and three weeks post inoculation. The animal specifically
seroconverted as measured in virus neutralization (VN) assay (For
an example of a VN assay, see Example 16) and indirect IFA (For an
example of IFA, see Example 11 or 14) against the respective
isolate I-2614 and the sera from the seroconverted animal are used
in the immunological detection of said further isolates. As an
example, the invention provides the characterization of a new
member in the family of Paramyxoviridae, a human metapneumovirus or
metapneumovirus-like virus (since its final taxonomy awaits
discussion by a viral taxonomy committee the MPV is herein for
example described as taxonomically corresponding to APV) (MPV)
which may cause severe RTI in humans. The clinical signs of the
disease caused by MPV are essentially similar to those caused by
hRSV, such as cough, myalgia, vomiting, fever broncheolitis or
pneumonia, possible conjunctivitis, or combinations thereof. As is
seen with hRSV infected children, specifically very young children
may require hospitalization. As an example an MPV which was
deposited Jan. 19, 2001 as 1-2614 with CNCM, Institute Pasteur,
Paris or a virus isolate phylogenetically corresponding therewith
is herewith provided. Therewith, the invention provides a virus
comprising a nucleic acid or functional fragment phylogenetically
corresponding to a nucleic acid sequence of SEQ. ID NO:19, or
structurally corresponding therewith. In particular the invention
provides a virus characterized in that after testing it in
phylogenetic tree analysis wherein maximum likelihood trees are
generated using 100 bootstraps and 3 jumbles it is found to be more
closely phylogenetically corresponding to a virus isolate deposited
as I-2614 with CNCM, Paris than it is related to a virus isolate of
avian pnuemovirus (APV) also known as turkey rhinotracheitis virus
(TRTV), the aetiological agent of avian rhinotracheitis. It is
particularly useful to use an AVP-C virus isolate as outgroup in
said phylogenetic tree analysis, it being the closest relative,
albeit being an essentially non-mammalian virus.
[0337] 5.9.1 Bioinformatics Alignment of Sequences
[0338] Two or more amino acid sequences can be compared by BLAST
(Altschul, S. F. et al., 1990, J. Mol. Biol. 215:403-410) to
determine their sequence homology and sequence identities to each
other. Two or more nucleotide sequences can be compared by BLAST
(Altschul, S. F. et al., 1990, J. Mol. Biol. 215:403-410) to
determine their sequence homology and sequence identities to each
other. BLAST comparisons can be performed using the Clustal W
method (MacVector(tm)). In certain specific embodiments, the
alignment of two or more sequences by a computer program can be
followed by manual re-adjustment.
[0339] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
non-limiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and
Altschul, 1990, Proc. Natl. Acad. Sci. USA 87:2264-2268, modified
as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA
90:5873-5877. Such an algorithm is incorporated into the NBLAST and
XBLAST programs of Altschul et al., 1990, J. Mol. Biol.
215:403-410. BLAST nucleotide comparisons can be performed with the
NBLAST program. BLAST amino acid sequence comparisons can be
performed with the XBLAST program. To obtain gapped alignments for
comparison purposes, Gapped BLAST can be utilized as described in
Altschul et al., 1997, Nucleic Acids Res.25:3389-3402.
Alternatively, PSI-Blast can be used to perform an iterated search
which detects distant relationships between molecules (Altschul et
al., 1997, supra). When utilizing BLAST, Gapped BLAST, and
PSI-Blast programs, the default parameters of the respective
programs (e.g., XBLAST and NBLAST) can be used
(seehttp://www.ncbi.nlm.nih.gov). Another preferred, non-limiting
example of a mathematical algorithm utilized for the comparison of
sequences is the algorithm of Myers and Miller, 1988, CABIOS
4:11-17. Such an algorithm is incorporated into the ALIGN program
(version 2.0) which is part of the GCG sequence alignment software
package. When utilizing the ALIGN program for comparing amino acid
sequences, a PAM120 weight residue table can be used. The gap
length penalty can be set by the skilled artisan. The percent
identity between two sequences can be determined using techniques
similar to those described above, with or without allowing gaps. In
calculating percent identity, typically only exact matches are
counted.
[0340] 5.9.2 Hybridization Conditions
[0341] A nucleic acid which is hybridizable to a nucleic acid of a
mammalian MPV, or to its reverse complement, or to its complement
can be used in the methods of the invention to determine their
sequence homology and identities to each other. In certain
embodiments, the nucleic acids are hybridized under conditions of
high stringency. By way of example and not limitation, procedures
using such conditions of high stringency are as follows.
Prehybridization of filters containing DNA is carried out for 8 h
to overnight at 65 C in buffer composed of 6.times.SSC, 50 mM
Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA,
and 500 .mu.g/ml denatured salmon sperm DNA. Filters are hybridized
for 48 h at 65 C in prehybridization mixture containing 100 pg/ml
denatured salmon sperm DNA and 5-20.times.10.sup.6 cpm of
32P-labeled probe. Washing of filters is done at 37 C for 1 h in a
solution containing 2.times.SSC, 0.01% PVP, 0.01% Ficoll, and 0.01%
BSA. This is followed by a wash in 0.1.times.SSC at 50 C for 45 min
before autoradiography. Other conditions of high stringency which
may be used are well known in the art. In other embodiments of the
invention, hybridization is performed under moderate of low
stringency conditions, such conditions are well-known to the
skilled artisan (see e.g., Sambrook et al., 1989, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.; see also, Ausubel et al., eds., in
the Current Protocols in Molecular Biology series of laboratory
technique manuals, 1987-1997 Current Protocols,.COPYRGT. 1994-1997
John Wiley and Sons, Inc.).
[0342] 5.9.3 Phylogenetic Analysis
[0343] This invention relates to the inference of phylogenetic
relationships between isolates of mammalian MPV. Many methods or
approaches arc available to analyze phylogenetic relationship;
these include distance, maximum likelihood, and maximum parsimony
methods (Swofford, D L., et. al., Phylogenetic Inference. In
Molecular Systematics. Eds. Hillis, DM, Mortiz, C, and Mable, B K.
1996. Sinauer Associates: Massachusetts, USA. pp. 407-514;
Felsenstein, J., 1981, J. Mol. Evol. 17:368-376). In addition,
bootstrapping techniques are an effective means of preparing and
examining confidence intervals of resultant phylogenetic trees
(Felsenstein, J., 1985, Evolution. 29:783-791). Any method or
approach using nucleotide or peptide sequence information to
compare mammalian MPV isolates can be used to establish
phylogenetic relationships, including, but not limited to,
distance, maximum likelihood, and maximum parsimony methods or
approaches. Any method known in the art can be used to analyze the
quality of phylogenetic data, including but not limited to
bootstrapping. Alignment of nucleotide or peptide sequence data for
use in phylogenetic approaches, include but are not limited to,
manual alignment, computer pairwise alignment, and computer
multiple alignment. One skilled in the art would be familiar with
the preferable alignment method or phylogenetic approach to be used
based upon the information required and the time allowed.
[0344] In one embodiment, a DNA maximum likehood method is used to
infer relationships between hMPV isolates. In another embodiment,
bootstrapping techniques are used to determine the certainty of
phylogenetic data created using one of said phylogenetic
approaches. In another embodiment, jumbling techniques are applied
to the phylogenetic approach before the input of data in order to
minimize the effect of sequence order entry on the phylogenetic
analyses. In one specific embodiment, a DNA maximum likelihood
method is used with bootstrapping. In another specific embodiment,
a DNA maximum likelihood method is used with bootstrapping and
jumbling. In another more specific embodiment, a DNA maximum
likelihood method is used with 50 bootstraps. In another specific
embodiment, a DNA maximum likelihood method is used with 50
bootstraps and 3 jumbles. In another specific embodiment, a DNA
maximum likelihood method is used with 100 bootstraps and 3
jumbles.
[0345] In one embodiment, nucleic acid or peptide sequence
information from an isolate of hMPV is compared or aligned with
sequences of other hMPV isolates. The amino acid sequence can be
the amino acid sequence of the L protein, the M protein, the N
protein, the P protein, or the F protein. In another embodiment,
nucleic acid or peptide sequence information from an hMPV isolate
or a number of hMPV isolates is compared or aligned with sequences
of other viruses. In another embodiment, phylogenetic approaches
are applied to sequence alignment data so that phylogenetic
relationships can be inferred and/or phylogenetic trees
constructed. Any method or approach that uses nucleotide or peptide
sequence information to compare hMPV isolates can be used to infer
said phylogenetic relationships, including, but not limited to,
distance, maximum likelihood, and maximum parsimony methods or
approaches.
[0346] Other methods for the phylogenetic analysis are disclosed in
International Patent Application PCT/NL02/00040, published as WO
02/057302, which is incorporated in its entirety herein. In
particular, PCT/NL02/00040 discloses nucleic acid sequences that
are suitable for phylogenetic analysis at page 12, line 27 to page
19, line29, which is incorporated herein by reference.
[0347] For the phylogenetic analyses it is most useful to obtain
the nucleic acid sequence of a non-MPV as outgroup with which the
virus is to be compared, a very useful outgroup isolate can be
obtained from avian pneumovirus serotype C (APV-C), see, e.g., FIG.
16.
[0348] Many methods and programs are known in the art and can be
used in the inference of phylogenetic relationships, including, but
not limited to BioEdit, ClustalW, TreeView, and NJPlot. Methods
that would be used to align sequences and to generate phylogenetic
trees or relationships would require the input of sequence
information to be compared. Many methods or formats are known in
the art and can be used to input sequence information, including,
but not limited to, FASTA, NBRF, EMBL/SWISS, GDE protein, GDE
nucleotide, CLUSTAL, and GCG/MSF. Methods that would be used to
align sequences and to generate phylogenetic trees or relationships
would require the output of results. Many methods or formats can be
used in the output of information or results, including, but not
limited to, CLUSTAL, NBRF/PIR, MSF, PHYLIP, and GDE. In one
embodiment, ClustalW is used in conjunction with DNA maximum
likelihood methods with 100 bootstraps and 3 jumbles in order to
generate phylogenetic relationships.
[0349] 5.10 Generation of Antibodies
[0350] The invention also relates to the generation of antibodies
against a protein encoded by a mammalian MPV. In particular, the
invention relates to the generation of antibodies against all MPV
antigens, including the F protein, N protein, M2-1 protein, M2-2
protein, G protein, or P protein of a mammalian MPV. According to
the invention, any protein encoded by a mammalian MPV, derivatives,
analogs or fragments thereof, may be used as an immunogen to
generate antibodies which immunospecifically bind such an
immunogen. Antibodies of the invention include, but are not limited
to, polyclonal, monoclonal, multispecific, human, humanized or
chimeric antibodies, single chain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id
antibodies to antibodies of the invention), and epitope-binding
fragments. The term "antibody," as used herein, refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that immunospecifically binds an antigen. The
immunoglobulin molecules of the invention can be of any type (e.g.,
IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG.sub.1,
IgG.sub.2, IgG.sub.3, IgG.sub.4, IgA, and IgA.sub.2) or subclass of
immunoglobulin molecule. Examples of immunologically active
portions of immunoglobulin molecules include F(ab) and F(ab').sub.2
fragments which can be generated by treating the antibody with an
enzyme such as pepsin or papain. In a specific embodiment,
antibodies to a protein encoded by human MPV are produced. In
another embodiment, antibodies to a domain a protein encoded by
human MPV are produced.
[0351] Various procedures known in the art may be used for the
production of polyclonal antibodies against a protein encoded by a
mammalian MPV, derivatives, analogs or fragments thereof. For the
production of antibody, various host animals can be immunized by
injection with the native protein, or a synthetic version, or
derivative (e.g., fragment) thereof, including but not limited to
rabbits, mice, rats, etc. Various adjuvants may be used to increase
the immunological response, depending on the host species, and
including but not limited to Freund's (complete and incomplete),
mineral gels such as aluminum hydroxide, surface active substances
such as lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanins, dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and corynebacterium parvum.
[0352] For preparation of monoclonal antibodies directed toward a
protein encoded by a mammalian MPV, derivatives, analogs or
fragments thereof, any technique which provides for the production
of antibody molecules by continuous cell lines in culture may be
used. For example, the hybridoma technique originally developed by
Kohler and Milstein (1975, Nature 256:495-497), as well as the
trioma technique, the human B-cell hybridoma technique (Kozbor et
al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique
to produce human monoclonal antibodies (Cole et al., 1985, in
Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp.
77-96). In an additional embodiment of the invention, monoclonal
antibodies can be produced in germ-free animals utilizing recent
technology (PCT/US90/02545). According to the invention, human
antibodies may be used and can be obtained by using human
hybridomas (Cote et al., 1983, Proc. NatI. Acad. Sci. U.S.A.
80:2026-2030) or by transforming human B cells with EBV virus in
vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, pp. 77-96). In fact, according to the
invention, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. U.S.A.
81:6851-6855; Neuberger et al., 1984, Nature 312:604-608; Takeda et
al., 1985, Nature 314:452-454) by splicing the genes from a mouse
antibody molecule specific for a protein encoded by a mammalian
MPV, derivatives, analogs or fragments thereof together with genes
from a human antibody molecule of appropriate biological activity
can be used; such antibodies are within the scope of this
invention.
[0353] According to the invention, techniques described for the
production of single chain antibodies (U.S. Pat. No. 4,946,778) can
be adapted to produce specific single chain antibodies. An
additional embodiment of the invention utilizes the techniques
described for the construction of Fab expression libraries (Huse et
al., 1989, Science 246:1275-1281) to allow rapid and easy
identification of monoclonal Fab fragments with the desired
specificity for a protein encoded by a mammalian MPV, derivatives,
analogs or fragments thereof.
[0354] Antibody fragments which contain the idiotype of the
molecule can be generated by known techniques. For example, such
fragments include but are not limited to: the F(ab')2 fragment
which can be produced by pepsin digestion of the antibody molecule;
the Fab' fragments which can be generated by reducing the disulfide
bridges of the F(ab')2 fragment, the Fab fragments which can be
generated by treating the antibody molecule with papain and a
reducing agent, and Fv fragments.
[0355] In the production of antibodies, screening for the desired
antibody can be accomplished by techniques known in the art, e.g.
ELISA (enzyme-linked immunosorbent assay). For example, to select
antibodies which recognize a specific domain of a protein encoded
by a mammalian MPV, one may assay generated hybridomas for a
product which binds to a fragment of a protein encoded by a
mammalian MPV containing such domain.
[0356] The antibodies provided by the present invention can be used
for detecting MPV and for therapeutic methods for the treatment of
infections with MPV.
[0357] The specificity and binding affinities of the antibodies
generated by the methods of the invention can be tested by any
technique known to the skilled artisan. In certain embodiments, the
specificity and binding affinities of the antibodies generated by
the methods of the invention can be tested as described in sections
5.8.5, 5.8.6, 5.8.7, 5.8.8 or 5.8.9.
[0358] 5.11 Screening Assays to Identify Antiviral Agents
[0359] The invention provides methods for the identification of a
compound that inhibits the ability of a mammalian MPV to infect a
host or a host cell. In certain embodiments, the invention provides
methods for the identification of a compound that reduces the
ability of a mammalian MPV to replicate in a host or a host cell.
Any technique well-known to the skilled artisan can be used to
screen for a compound that would abolish or reduce the ability of a
mammalian MPV to infect a host and/or to replicate in a host or a
host cell. In a specific embodiment, the mammalian MPV is a human
MPV.
[0360] In certain embodiments, the invention provides methods for
the identification of a compound that inhibits the ability of a
mammalian MPV to replicate in a mammal or a mammalian cell. More
specifically, the invention provides methods for the identification
of a compound that inhibits the ability of a mammalian MPV to
infect a mammal or a mammalian cell. In certain embodiments, the
invention provides methods for the identification of a compound
that inhibits the ability of a mammalian MPV to replicate in a
mammalian cell. In a specific embodiment, the mammalian cell is a
human cell. For a detailed description of assays that can be used
to determine virus titer see section 5.7.
[0361] In certain embodiments, a cell is contacted with a test
compound and infected with a mammalian MPV. In certain embodiments,
a control culture is infected with a mammalian virus in the absence
of a test compound. The cell can be contacted with a test compound
before, concurrently with, or subsequent to the infection with the
mammalian MPV. In a specific embodiment, the cell is a mammalian
cell. In an even more specific embodiment, the cell is a human
cell. In certain embodiments, the cell is incubated with the test
compound for at least 1 minute, at least 5 minutes at least 15
minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at
least 5 hours, at least 12 hours, or at least 1 day. The titer of
the virus can be measured at any time during the assay. In certain
embodiments, a time course of viral growth in the culture is
determined. If the viral growth is inhibited or reduced in the
presence of the test compound, the test compound is identified as
being effective in inhibiting or reducing the growth or infection
of a mammalian MPV. In a specific embodiment, the compound that
inhibits or reduces the growth of a mammalian MPV is tested for its
ability to inhibit or reduce the growth rate of other viruses to
test its specificity for mammalian MPV.
[0362] In certain embodiments, a test compound is administered to a
model animal and the model animal is infected with a mammalian MPV.
In certain embodiments, a control model animal is infected with a
mammalian virus in without the administration of a test compound.
The test compound can be administered before, concurrently with, or
subsequent to the infection with the mammalian MPV. In a specific
embodiment, the model animal is a mammal. In an even more specific
embodiment, the model animal can be, but is not limited to, a
cotton rat, a mouse, or a monkey. The titer of the virus in the
model animal can be measured at any time during the assay. In
certain embodiments, a time course of viral growth in the culture
is determined. If the viral growth is inhibited or reduced in the
presence of the test compound, the test compound is identified as
being effective in inhibiting or reducing the growth or infection
of a mammalian MPV. In a specific embodiment, the compound that
inhibits or reduces the growth of a mammalian MPV in the model
animal is tested for its ability to inhibit or reduce the growth
rate of other viruses to test its specificity for mammalian
MPV.
[0363] 5.12 Formulations of Vaccines, Antibodies and Antivirals
[0364] In a preferred embodiment, the invention provides a
proteinaceous molecule or metapneumovirus-specific viral protein or
functional fragment thereof encoded by a nucleic acid according to
the invention. Useful proteinaceous molecules are for example
derived from any of the genes or genomic fragments derivable from a
virus according to the invention. Such molecules, or antigenic
fragments thereof, as provided herein, are for example useful in
diagnostic methods or kits and in pharmaceutical compositions such
as sub-unit vaccines. Particularly useful are the F, SH and/or G
protein or antigenic fragments thereof for inclusion as antigen or
subunit immunogen, but inactivated whole virus can also be used.
Particularly useful are also those proteinaceous substances that
are encoded by recombinant nucleic acid fragments that are
identified for phylogenetic analyses, of course preferred are those
that are within the preferred bounds and metes of ORFs useful in
phylogenetic analyses, in particular for eliciting MPV specific
antibody or T cell responses, whether in vivo (e.g. for protective
purposes or for providing diagnostic antibodies) or in vitro (e.g.
by phage display technology or another technique useful for
generating synthetic antibodies).
[0365] Also provided herein are antibodies, be it natural
polyclonal or monoclonal, or synthetic (e.g. (phage)
library-derived binding molecules) antibodies that specifically
react with an antigen comprising a proteinaceous molecule or
MPV-specific functional fragment thereof according to the
invention. Such antibodies are useful in a method for identifying a
viral isolate as an MPV comprising reacting said viral isolate or a
component thereof with an antibody as provided herein. This can for
example be achieved by using purified or non-purified MPV or parts
thereof (proteins, peptides) using ELISA, RIA, FACS or different
formats of antigen detection assays (Current Protocols in
Immunology). Alternatively, infected cells or cell cultures may be
used to identify viral antigens using classical immunofluorescence
or immunohistochemical techniques.
[0366] A pharmaceutical composition comprising a virus, a nucleic
acid, a proteinaceous molecule or fragment thereof, an antigen
and/or an antibody according to the invention can for example be
used in a method for the treatment or prevention of a MPV infection
and/or a respiratory illness comprising providing an individual
with a pharmaceutical composition according to the invention. This
is most useful when said individual comprises a human, specifically
when said human is below 5 years of age, since such infants and
young children are most likely to be infected by a human MPV as
provided herein. Generally, in the acute phase patients will suffer
from upper respiratory symptoms predisposing for other respiratory
and other diseases. Also lower respiratory illnesses may occur,
predisposing for more and other serious conditions. The
compositions of the invention can be used for the treatment of
immuno-compromised individuals including cancer patients,
transplant recipients and the elderly.
[0367] The invention also provides methods to obtain an antiviral
agent useful in the treatment of respiratory tract illness
comprising establishing a cell culture or experimental animal
comprising a virus according to the invention, treating said
culture or animal with an candidate antiviral agent, and
determining the effect of said agent on said virus or its infection
of said culture or animal. An example of such an antiviral agent
comprises a MPV-neutralising antibody, or functional component
thereof, as provided herein, but antiviral agents of other nature
are obtained as well. The invention also provides use of an
antiviral agent according to the invention for the preparation of a
pharmaceutical composition, in particular for the preparation of a
pharmaceutical composition for the treatment of respiratory tract
illness, specifically when caused by an MPV infection or related
disease, and provides a pharmaceutical composition comprising an
antiviral agent according to the invention, useful in a method for
the treatment or prevention of an MPV infection or respiratory
illness, said method comprising providing an individual with such a
pharmaceutical composition.
[0368] In certain embodiments of the invention, the vaccine of the
invention comprises mammalian metapneumovirus as defined herein. In
certain, more specific embodiments, the mammalian metapneumovirus
is a human metapneumovirus. In a preferred embodiment, the
mammalian metapneumovirus to be used in a vaccine formulation has
an attenuated phenotype. For methods to achieve an attenuated
phenotype, see section 5.6.
[0369] The invention provides vaccine formulations for the
prevention and treatment of infections with PIV, RSV, APV, and/or
hMPV. In certain embodiments, the vaccine of the invention
comprises recombinant and chimeric viruses of the invention. In
certain embodiments, the virus is attenuated.
[0370] In a specific embodiment, the vaccine comprises APV and the
vaccine is used for the prevention and treatment for hMPV
infections in humans. Without being bound by theory, because of the
high degree of homology of the F protein of APV with the F protein
of hMPV, infection with APV will result in the production of
antibodies in the host that will cross-react with hMPV and protect
the host from infection with hMPV and related diseases.
[0371] In another specific embodiment, the vaccine comprises hMPV
and the vaccine is used for the prevention and treatment for APV
infection in birds, such as, but not limited to, in turkeys.
Without being bound by theory, because of the high degree of
homology of the F protein of APV with the F protein of hMPV,
infection with hMPV will result in the production of antibodies in
the host that will cross-react with APV and protect the host from
infection with APV and related diseases.
[0372] In a specific embodiment, the invention encompasses the use
of recombinant and chimeric APV/hMPV viruses which have been
modified in vaccine formulations to confer protection against APV
and/or hMPV. In certain embodiments, APV/hMPV is used in a vaccine
to be administered to birds, to protect the birds from infection
with APV. Without being bound by theory, the replacement of the APV
gene or nucleotide sequence with a hMPV gene or nucleotide sequence
results in an attenuated phenotype that allows the use of the
chimeric virus as a vaccine. In other embodiments the APV/hMPV
chimeric virus is administered to humans. Without being bound by
theory the APV viral vector provides the attenuated phenotype in
humans and the expression of the hMPV sequence elicits a hMPV
specific immune response.
[0373] In a specific embodiment, the invention encompasses the use
of recombinant and chimeric hMPV/APV viruses which have been
modified in vaccine formulations to confer protection against APV
and/or hMPV. In certain embodiments, hMPV/APV is used in a vaccine
to be administered to humans, to protect the human from infection
with hMPV. Without being bound by theory, the replacement of the
hMPV gene or nucleotide sequence with a APV gene or nucleotide
sequence results in an attenuated phenotype that allows the use of
the chimeric virus as a vaccine. In other embodiments the hMPV/APV
chimeric virus is administered to birds. Without being bound by
theory the hMPV backbone provides the attenuated phenotype in birds
and the expression of the APV sequence elicits an APV specific
immune response.
[0374] In certain preferred embodiments, the vaccine formulation of
the invention is used to protect against infections by a
metapneumovirus and related diseases. More specifically, the
vaccine formulation of the invention is used to protect against
infections by a human metapneumovirus and/or an avian pneumovirus
and related diseases. In certain embodiments, the vaccine
formulation of the invention is used to protect against infections
by (a) a human metapneumovirus and a respiratory syncytial virus;
and/or (b) an avian pneumovirus and a respiratory syncytial
virus.
[0375] In certain embodiments, the vaccine formulation of the
invention is used to protect against infections by (a) a human
metapneumovirus and a human parainfluenza virus; and/or (b) an
avian pneumovirus and a human parainfluenza virus, and related
diseases.
[0376] In certain embodiments, the vaccine formulation of the
invention is used to protect against infections by (a) a human
metapneumovirus, a respiratory syncytial virus, and a human
parainfluenza virus; and/or (b) an avian pneumovirus, a respiratory
syncytial virus, and a human parainfluenza virus, and related
diseases.
[0377] In certain embodiments, the vaccine formulation of the
invention is used to protect against infections by a human
metapneumovirus, a respiratory syncytial virus, and a human
parainfluenza virus and related diseases. In certain other
embodiments, the vaccine formulation of the invention is used to
protect against infections by an avian pneumovirus, a respiratory
syncytial virus, and a human parainfluenza virus and related
diseases.
[0378] Due to the high degree of homology among the F proteins of
different viral species, for exemplary amino acid sequence
comparisons see FIG. 9, the vaccine formulations of the invention
can be used for protection from viruses different from the one from
which the heterologous nucleotide sequence encoding the F protein
was derived. In a specific exemplary embodiment, a vaccine
formulation contains a virus comprising a heterologous nucleotide
sequence derived from an avian pneumovirus type A, and the vaccine
formulation is used to protect from infection by avian pneumovirus
type A and avian pneumovirus type B.
[0379] The invention encompasses vaccine formulations to be
administered to humans and animals which are useful to protect
against APV, including APV-C and APV-D, hMPV, PIV, influenza, RSV,
Sendai virus, mumps, laryngotracheitis virus, simianvirus 5, human
papillomavirus, measles, mumps, as well as other viruses and
pathogens and related diseases. The invention further encompasses
vaccine formulations to be administered to humans and animals which
are useful to protect against human metapneumovirus infections and
avian pneumovirus infections and related diseases.
[0380] In one embodiment, the invention encompasses vaccine
formulations which are useful against domestic animal disease
causing agents including rabies virus, feline leukemia virus (FLV)
and canine distemper virus. In yet another embodiment, the
invention encompasses vaccine formulations which are useful to
protect livestock against vesicular stomatitis virus, rabies virus,
rinderpest virus, swinepox virus, and further, to protect wild
animals against rabies virus.
[0381] Attenuated viruses generated by the reverse genetics
approach can be used in the vaccine and pharmaceutical formulations
described herein. Reverse genetics techniques can also be used to
engineer additional mutations to other viral genes important for
vaccine production--i.e., the epitopes of useful vaccine strain
variants can be engineered into the attenuated virus.
Alternatively, completely foreign epitopes, including antigens
derived from other viral or non-viral pathogens can be engineered
into the attenuated strain. For example, antigens of non-related
viruses such as HIV (gp160, gp120, gp41) parasite antigens (e.g.,
malaria), bacterial or fungal antigens or tumor antigens can be
engineered into the attenuated strain. Alternatively, epitopes
which alter the tropism of the virus in vivo can be engineered into
the chimeric attenuated viruses of the invention.
[0382] Virtually any heterologous gene sequence may be constructed
into the chimeric viruses of the invention for use in vaccines.
Preferably moieties and peptides that act as biological response
modifiers. Preferably, epitopes that induce a protective immune
response to any of a variety of pathogens, or antigens that bind
neutralizing antibodies may be expressed by or as part of the
chimeric viruses. For example, heterologous gene sequences that can
be constructed into the chimeric viruses of the invention include,
but are not limited to influenza and parainfluenza hemagglutinin
neuraminidase and fusion glycoproteins such as the HN and F genes
of human PIV3. In yet another embodiment, heterologous gene
sequences that can be engineered into the chimeric viruses include
those that encode proteins with immuno-modulating activities.
Examples of immuno-modulating proteins include, but are not limited
to, cytokines, interferon type 1, gamma interferon, colony
stimulating factors, interleukin-1, -2, -4, -5, -6, -12, and
antagonists of these agents.
[0383] In addition, heterologous gene sequences that can be
constructed into the chimeric viruses of the invention for use in
vaccines include but are not limited to sequences derived from a
human immunodeficiency virus (HIV), preferably type 1 or type 2. In
a preferred embodiment, an immunogenic HIV-derived peptide which
may be the source of an antigen may be constructed into a chimeric
PIV that may then be used to elicit a vertebrate immune response.
Such HIV-derived peptides may include, but are not limited to
sequences derived from the env gene (i.e., sequences encoding all
or part of gp160, gp120, and/or gp41), the pol gene (i.e.,
sequences encoding all or part of reverse transcriptase,
endonuclease, protease, and/or integrase), the gag gene (i.e.,
sequences encoding all or part of p7, p6, p55, pl7/18, p24/25),
tat, rev, nef, vif, vpu, vpr, and/or vpx.
[0384] Other heterologous sequences may be derived from hepatitis B
virus surface antigen (HBsAg); hepatitis A or C virus surface
antigens, the glycoproteins of Epstein Barr virus; the
glycoproteins of human papillomavirus; the glycoproteins of
respiratory syncytial virus, parainfluenza virus, Sendai virus,
simianvirus 5 or mumps virus; the glycoproteins of influenza virus;
the glycoproteins of herpesviruses; VP1 of poliovirus; antigenic
determinants of non-viral pathogens such as bacteria and parasites,
to name but a few. In another embodiment, all or portions of
immunoglobulin genes may be expressed. For example, variable
regions of anti-idiotypic immunoglobulins that mimic such epitopes
may be constructed into the chimeric viruses of the invention.
[0385] Other heterologous sequences may be derived from tumor
antigens, and the resulting chimeric viruses be used to generate an
immune response against the tumor cells leading to tumor regression
in vivo. These vaccines may be used in combination with other
therapeutic regimens, including but not limited to chemotherapy,
radiation therapy, surgery, bone marrow transplantation, etc. for
the treatment of tumors. In accordance with the present invention,
recombinant viruses may be engineered to express tumor-associated
antigens (TAAs), including but not limited to, human tumor antigens
recognized by T cells (Robbins and Kawakami, 1996, Curr. Opin.
Immunol. 8:628-636, incorporated herein by reference in its
entirety), melanocyte lineage proteins, including gplO0,
MART-1I/MelanA, TRP--I (gp75), tyrosinase; Tumor-specific widely
shared antigens, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-1,
N-acetylglucosaminyltrans- ferase-V, p15; Tumor-specific mutated
antigens, p-catenin, MUM-1, CDK4; Nonmelanoma antigens for breast,
ovarian, cervical and pancreatic carcinoma, HER-2/neu, human
papillomavirus-E6, -E7, MUC-1.
[0386] In even other embodiments, a heterologous nucleotide
sequence is derived from a metapneumovirus, such as human
metapneumovirus and/or avian pneumovirus. In even other
embodiments, the virus of the invention contains two different
heterologous nucleotide sequences wherein one is derived from a
metapneumovirus, such as human metapneumovirus and/or avian
pneumovirus, and the other one is derived from a respiratory
syncytial virus. The heterologous nucleotide sequence encodes a F
protein or a G protein of the respective virus. In a specific
embodiment, a heterologous nucleotide sequences encodes a chimeric
F protein, wherein the chimeric F protein contains the ectodomain
of a F protein of a metapneumovirus and the transmembrane domain as
well as the luminal domain of a F protein of a parainfluenza
virus.
[0387] Either a live recombinant viral vaccine or an inactivated
recombinant viral vaccine can be formulated. A live vaccine may be
preferred because multiplication in the host leads to a prolonged
stimulus of similar kind and magnitude to that occurring in natural
infections, and therefore, confers substantial, long-lasting
immunity. Production of such live recombinant virus vaccine
formulations may be accomplished using conventional methods
involving propagation of the virus in cell culture or in the
allantois of the chick embryo followed by purification.
[0388] In a specific embodiment, the recombinant virus is
non-pathogenic to the subject to which it is administered. In this
regard, the use of genetically engineered viruses for vaccine
purposes may desire the presence of attenuation characteristics in
these strains. The introduction of appropriate mutations (e.g.,
deletions) into the templates used for transfection may provide the
novel viruses with attenuation characteristics. For example,
specific missense mutations which are associated with temperature
sensitivity or cold adaption can be made into deletion mutations.
These mutations should be more stable than the point mutations
associated with cold or temperature sensitive mutants and reversion
frequencies should be extremely low.
[0389] Alternatively, chimeric viruses with "suicide"
characteristics may be constructed. Such viruses would go through
only one or a few rounds of replication within the host. When used
as a vaccine, the recombinant virus would go through limited
replication cycle(s) and induce a sufficient level of immune
response but it would not go further in the human host and cause
disease. Recombinant viruses lacking one or more of the genes of
wild type APV and hMPV, respectively, or possessing mutated genes
as compared to the wild type strains would not be able to undergo
successive rounds of replication. Defective viruses can be produced
in cell lines which permanently express such a gene(s). Viruses
lacking an essential gene(s) will be replicated in these cell lines
but when administered to the human host will not be able to
complete a round of replication. Such preparations may transcribe
and translate--in this abortive cycle--a sufficient number of genes
to induce an immune response. Alternatively, larger quantities of
the strains could be administered, so that these preparations serve
as inactivated (killed) virus vaccines. For inactivated vaccines,
it is preferred that the heterologous gene product be expressed as
a viral component, so that the gene product is associated with the
virion. The advantage of such preparations is that they contain
native proteins and do not undergo inactivation by treatment with
formalin or other agents used in the manufacturing of killed virus
vaccines. Alternatively, recombinant virus of the invention made
from cDNA may be highly attenuated so that it replicates for only a
few rounds.
[0390] In certain embodiments, the vaccine of the invention
comprises an attenuated mammalian MPV. Without being bound by
theory, the attenuated virus can be effective as a vaccine even if
the attenuated virus is incapable of causing a cell to generate new
infectious viral particles because the viral proteins are inserted
in the cytoplasmic membrane of the host thus stimulating an immune
response.
[0391] In another embodiment of this aspect of the invention,
inactivated vaccine formulations may be prepared using conventional
techniques to "kill" the chimeric viruses. Inactivated vaccines are
"dead" in the sense that their infectivity has been destroyed.
Ideally, the infectivity of the virus is destroyed without
affecting its immunogenicity. In order to prepare inactivated
vaccines, the chimeric virus may be grown in cell culture or in the
allantois of the chick embryo, purified by zonal
ultracentrifugation, inactivated by formaldehyde or
.beta.-propiolactone, and pooled. The resulting vaccine is usually
inoculated intramuscularly.
[0392] Inactivated viruses may be formulated with a suitable
adjuvant in order to enhance the immunological response. Such
adjuvants may include but are not limited to mineral gels, e.g.,
aluminum hydroxide; surface active substances such as lysolecithin,
pluronic polyols, polyanions; peptides; oil emulsions; and
potentially useful human adjuvants such as BCG, Corynebacterium
parvum, ISCOMS and virosomes.
[0393] Many methods may be used to introduce the vaccine
formulations described above, these include but are not limited to
oral, intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, percutaneous, and intranasal and inhalation routes.
It may be preferable to introduce the chimeric virus vaccine
formulation via the natural route of infection of the pathogen for
which the vaccine is designed.
[0394] In certain embodiments, the invention relates to immunogenic
compositions. The immunogenic compositions comprise a mammalian
MPV. In a specific embodiment, the immunogenic composition
comprises a human MPV. In certain embodiments, the immunogenic
composition comprises an attenuated mammalian MPV or an attenuated
human MPV. In certain embodiments, the immunogenic composition
further comprises a pharmaceutically acceptable carrier.
[0395] 5.13 Dosage Regimens, Administration and Formulations
[0396] The present invention provides vaccines and immunogenic
preparations comprising MPV and APV, including attenuated forms of
the virus, recombinant forms of MPV and APV, and chimeric MPV and
APV expressing one or more heterologous or non-native antigenic
sequences. The vaccines or immunogenic preparations of the
invention encompass single or multivalent vaccines, including
bivalent and trivalent vaccines. The vaccines or immunogenic
formulations of the invention are useful in providing protections
against various viral infections. Particularly, the vaccines or
immunogenic formulations of the invention provide protection
against respiratory tract infections in a host.
[0397] A recombinant virus and/or a vaccine or immunogenic
formulation of the invention can be administered alone or in
combination with other vaccines. Preferably, a vaccine or
immunogenic formulation of the invention is administered in
combination with other vaccines or immunogenic formulations that
provide protection against respiratory tract diseases, such as but
not limited to, respiratory syncytial virus vaccines, influenza
vaccines, measles vaccines, mumps vaccines, rubella vaccines,
pneumococcal vaccines, rickettsia vaccines, staphylococcus
vaccines, whooping cough vaccines or vaccines against respiratory
tract cancers. In a preferred embodiment, the virus and/or vaccine
of the invention is administered concurrently with pediatric
vaccines recommended at the corresponding ages. For example, at
two, four or six months of age, the virus and/or vaccine of the
invention can be administered concurrently with DtaP (IM), Hib
(IM), Polio (IPV or OPV) and Hepatitis B (IM). At twelve or fifteen
months of age, the virus and/or vaccine of the invention can be
administered concurrently with Hib (IM), Polio (IPV or OPV),
MMRII.RTM. (SubQ); Varivax.RTM. (SubQ), and hepatitis B (IM). The
vaccines that can be used with the methods of invention are
reviewed in various publications, e.g., The Jordan Report 2000,
Division of Microbiology and Infectious Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes
of Health, United States, the content of which is incorporated
herein by reference in its entirety.
[0398] A vaccine or immunogenic formulation of the invention may be
administered to a subject per se or in the form of a pharmaceutical
or therapeutic composition. Pharmaceutical compositions comprising
an adjuvant and an immunogenic antigen of the invention (e.g., a
virus, a chimeric virus, a mutated virus) may be manufactured by
means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping
or lyophilizing processes. Pharmaceutical compositions may be
formulated in conventional manner using one or more physiologically
acceptable carriers, diluents, excipients or auxiliaries which
facilitate processing of the immunogenic antigen of the invention
into preparations which can be used pharmaceutically. Proper
formulation is, amongst others, dependent upon the route of
administration chosen.
[0399] When a vaccine or immunogenic composition of the invention
comprises adjuvants or is administered together with one or more
adjuvants, the adjuvants that can be used include, but are not
limited to, mineral salt adjuvants or mineral salt gel adjuvants,
particulate adjuvants, microparticulate adjuvants, mucosal
adjuvants, and immunostimulatory adjuvants. Examples of adjuvants
include, but are not limited to, aluminum hydroxide, aluminum
phosphate gel, Freund's Complete Adjuvant, Freund's Incomplete
Adjuvant, squalene or squalane oil-in-water adjuvant formulations,
biodegradable and biocompatible polyesters, polymerized liposomes,
triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also
sold under the trademark STIMULON, ISCOPREP),
N-acetyl-muramyl-L-threonyl-D-isoglutamine (Threonyl-MDP, sold
under the trademark TERMURTIDE), LPS, monophosphoryl Lipid A
(3D-MLAsold under the trademark MPL).
[0400] The subject to which the vaccine or an immunogenic
composition of the invention is administered is preferably a
mammal, most preferably a human, but can also be a non-human
animal, including but not limited to, primates, cows, horses,
sheep, pigs, fowl (e.g., chickens, turkeys), goats, cats, dogs,
hamsters, mice and rodents.
[0401] Many methods may be used to introduce the vaccine or the
immunogenic composition of the invention, including but not limited
to, oral, intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, percutaneous, intranasal and inhalation routes, and
via scarification (scratching through the top layers of skin, e.g.,
using a bifurcated needle).
[0402] For topical administration, the vaccine or immunogenic
preparations of the invention may be formulated as solutions, gels,
ointments, creams, suspensions, etc. as are well-known in the
art.
[0403] For administration intranasally or by inhalation, the
preparation for use according to the present invention can be
conveniently delivered in the form of an aerosol spray presentation
from pressurized packs or a nebulizer, with the use of a suitable
propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethan- e, carbon dioxide or other suitable gas.
In the case of a pressurized aerosol the dosage unit may be
determined by providing a valve to deliver a metered amount.
Capsules and cartridges of, e.g., gelatin for use in an inhaler or
insufflator may be formulated containing a powder mix of the
compound and a suitable powder base such as lactose or starch.
[0404] For injection, the vaccine or immunogenic preparations may
be formulated in aqueous solutions, preferably in physiologically
compatible buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. The solution may contain fonmulatory
agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the proteins may be in powder form for constitution
with a suitable vehicle, e.g., sterile pyrogen-free water, before
use.
[0405] Detenmination of an effective amount of the vaccine or
immunogenic formulation for administration is well within the
capabilities of those skilled in the art, especially in light of
the detailed disclosure provided herein.
[0406] An effective dose can be estimated initially from in vitro
assays. For example, a dose can be formulated in animal models to
achieve an induction of an immunity response using techniques that
are well known in the art. One having ordinary skill in the art
could readily optimize administration to all animal species based
on results described herein. Dosage amount and interval may be
adjusted individually. For example, when used as an immunogenic
composition, a suitable dose is an amount of the composition that
when administered as described above, is capable of eliciting an
antibody response. When used as a vaccine, the vaccine or
immunogenic formulations of the invention may be administered in
about 1 to 3 doses for a 1-36 week period. Preferably, 1 or 2 doses
are administered, at intervals of about 2 weeks to about 4 months,
and booster vaccinations may be given periodically thereafter.
Alternate protocols may be appropriate for individual animals. A
suitable dose is an amount of the vaccine formulation that, when
administered as described above, is capable of raising an immunity
response in an immunized animal sufficient to protect the animal
from an infection for at least 4 to 12 months. In general, the
amount of the antigen present in a dose ranges from about 1 pg to
about 100 mg per kg of host, typically from about 10 pg to about 1
mg, and preferably from about 100 pg to about 1 .mu.g. Suitable
dose range will vary with the route of injection and the size of
the patient, but will typically range from about 0.1 mL to about 5
mL.
[0407] In a specific embodiment, the viruses and/or vaccines of the
invention are administered at a starting single dose of at least
10.sup.3 TCID.sub.50, at least 10.sup.4 TCID.sub.50, at least
10.sup.5 TCID.sub.50, at least 10.sup.6 TCID.sub.50. In another
specific embodiment, the virus and/or vaccines of the invention are
administered at multiple doses. In a preferred embodiment, a
primary dosing regimen at 2, 4, and 6 months of age and a booster
dose at the beginning of the second year of life are used. More
preferably, each dose of at least 10.sup.5 TCID.sub.50, or at least
10.sup.6 TCID.sub.50 is given in a multiple dosing regimen.
[0408] 5.13.1 Challenge Studies
[0409] This assay is used to determine the ability of the
recombinant viruses of the invention and of the vaccines of the
invention to prevent lower respiratory tract viral infection in an
animal model system, such as, but not limited to, cotton rats or
hamsters. The recombinant virus and/or the vaccine can be
administered by intravenous (IV) route, by intramuscular (IM) route
or by intranasal route (IN). The recombinant virus and/or the
vaccine can be administered by any technique well-known to the
skilled artisan. This assay is also used to correlate the serum
concentration of antibodies with a reduction in lung titer of the
virus to which the antibodies bind.
[0410] On day 0, groups of animals, such as, but not limited to,
cotton rats (Sigmodon hispidis, average weight 100 g) cynomolgous
macacques (average weight 2.0 kg) are administered the recombinant
or chimeric virus or the vaccine of interest or BSA by
intramuscular injection, by intravenous injection, or by intranasal
route. Prior to, concurrently with, or subsequent to administration
of the recombinant virus or the vaccine of the invention, the
animals are infected with wild type virus wherein the wild type
virus is the virus against which the vaccine was generated. In
certain embodiments, the animals are infected with the wild type
virus at least 1 day, at least 2 days, at least 3 days, at least 4
days, at least 5 days, at least 6 days, 1 week or 1 or more months
subsequent to the administration of the recombinant virus and/or
the vaccine of the invention.
[0411] After the infection, cotton rats are sacrificed, and their
lung tissue is harvested and pulmonary virus titers are determined
by plaque titration. Bovine serum albumin (BSA) 10 mg/kg is used as
a negative control. Antibody concentrations in the serum at the
time of challenge are determined using a sandwich ELISA. Similarly,
in macacques, virus titers in nasal and lung lavages can be
measured.
[0412] 5.13.2 Target Populations
[0413] In certain embodiments of the invention, the target
population for the therapeutic and diagnostic methods of the
invention is defined by age. In certain embodiments, the target
population for the therapeutic and/or diagnostic methods of the
invention is characterized by a disease or disorder in addition to
a respiratory tract infection.
[0414] In a specific embodiment, the target population encompasses
young children, below 2 years of age. In a more specific
embodiment, the children below the age of 2 years do not suffer
from illnesses other than respiratory tract infection.
[0415] In other embodiments, the target population encompasses
patients above 5 years of age. In a more specific embodiment, the
patients above the age of 5 years suffer from an additional disease
or disorder including cystic fibrosis, leukaemia, and non-Hodgkin
lymphoma, or recently received bone marrow or kidney
transplantation.
[0416] In a specific embodiment of the invention, the target
population encompasses subjects in which the hMPV infection is
associated with immunosuppression of the hosts. In a specific
embodiment, the subject is an immunocompromised individual.
[0417] In certain embodiments, the target population for the
methods of the invention encompasses the elderly.
[0418] In a specific embodiment, the subject to be treated or
diagnosed with the methods of the invention was infected with hMPV
in the winter months.
[0419] 5.13.3 Clinical Trials
[0420] Vaccines of the invention or fragments thereof tested in in
vitro assays and animal models may be further evaluated for safety,
tolerance and pharmacokinetics in groups of normal healthy adult
volunteers. The volunteers are administered intramuscularly,
intravenously or by a pulmonary delivery system a single dose of a
recombinant virus of the invention and/or a vaccine of the
invention. Each volunteer is monitored at least 24 hours prior to
receiving the single dose of the recombinant virus of the invention
and/or a vaccine of the invention and each volunteer will be
monitored for at least 48 hours after receiving the dose at a
clinical site. Then volunteers are monitored as outpatients on days
3, 7, 14, 21, 28, 35, 42, 49, and 56 postdose.
[0421] Blood samples are collected via an indwelling catheter or
direct venipuncture using 10 ml red-top Vacutainer tubes at the
following intervals: (1) prior to administering the dose of the
recombinant virus of the invention and/or a vaccine of the
invention; (2) during the administration of the dose of the
recombinant virus of the invention and/or a vaccine of the
invention; (3) 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30
minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, and
48 hours after administering the dose of the recombinant virus of
the invention and/or a vaccine of the invention; and (4) 3 days, 7
days 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, and 56
days after administering the dose of the recombinant virus of the
invention and/or a vaccine of the invention. Samples are allowed to
clot at room temperature and serum will be collected after
centrifugation.
[0422] The amount of antibodies generated against the recombinant
virus of the invention and/or a vaccine of the invention in the
samples from the patients can be quantitated by ELISA. T-cell
immunity (cytotoxic and helper responses) in PBMC and lung and
nasal lavages can also be monitored.
[0423] The concentration of antibody levels in the serum of
volunteers are corrected by subtracting the predose serum level
(background level) from the serum levels at each collection
interval after administration of the dose of recombinant virus of
the invention and/or a vaccine of the invention. For each volunteer
the pharmacokinetic parameters are computed according to the
model-independent approach (Gibaldi et al., eds., 1982,
Pharmacokinetics, 2nd edition, Marcel Dekker, New York) from the
corrected serum antibody or antibody fragment concentrations.
[0424] 5.14 Methods for Detecting and Diagnosing Mammalian MPV
[0425] The invention provides means and methods for the diagnosis
and/or detection of MPV, said means and methods to be employed in
the detection of MPV, its components, and the products of its
transcription, translation, expression, propagation, and metabolic
processes. More specifically, this invention provides means and
methods for the diagnosis of an MPV infection in animals and in
humans, said means and methods including but not limited to the
detection of components of MPV, products of the life cycle of MPV,
and products of a host's response to MPV exposure or infection.
[0426] In one embodiment, the invention provides means and methods
for the diagnosis and detection of MPV, said means and methods
including but not limited to the detection of genomic material and
other nucleic acids that are associated with or complimentary to
MPV, the detection of transcriptional and translational products of
MPV, said products being both processed and unprocessed, and the
detection of components of a host response to MPV exposure or
infection.
[0427] In one embodiment, the invention relates to the detection of
MPV through the preparation and use of oligonucleotides that are
complimentary to nucleic acid sequences and transcriptional
products of nucleic acid sequences that are present within the
genome of MPV. Furthermore, the invention relates to the detection
of nucleic acids, or sequences thereof, that are present in the
genome of MPV and its transcription products, using said
oligonucleotides as primers for copying or amplification of
specific regions of the MPV genome and its transcripts. The regions
of the MPV genome and its transcripts that can be copied or
amplified include but are not limited to complete and incomplete
stretches of one or more of the following: the N-gene, the P-gene,
the M-gene, the F-gene, the M2-gene, the SH-gene, the G-gene, and
the L-gene. In a specific embodiment, oligonucleotides are used as
primers in conjunction with methods to copy or amplify the N-gene
of MPV, or transcripts thereof, for identification purposes. Said
methods include but are not limited to RT-PCR assays, primer
extension or run on assays, and other methods that employ the
genetic material of MPV or transcripts and compliments thereof as
templates for the extension of nucleic acid sequences from said
oligonucleotides.
[0428] In another embodiment, the invention relates to detection of
MPV through the preparation and use of oligonucleotides that are
complimentary to nucleic acid sequences and transcriptional
products of nucleic acid sequences that are present within the
genome of MPV. Furthermore, the invention relates to the detection
of nucleic acids, or sequences thereof, that are present in or
complimentary to the genome of MPV and its transcription products,
using said oligonucleotide sequences as probes for hybridization to
and detection of specific regions within or complimentary to the
MPV genome and its transcripts. The regions of the MPV genome and
its transcripts that can be detected using hybridization probes
include but are not limited to complete and incomplete stretches of
one or more of the following: the N-gene, the P-gene, the M-gene,
the F-gene, the M2-gene, the SH-gene, the G-gene, and the L-gene.
In a specific embodiment, oligonucleotides are used as probes in
conjunction with methods to detect, anneal, or hybridize to the
N-gene of MPV, or transcripts thereof, for identification purposes.
Said methods include but are not limited to, Northern blots,
Southern blots and other methods that employ the genetic material
of MPV or transcripts and compliments thereof as targets for the
hybridization, annealing, or detection of sequences or stretches of
sequences within or complimentary to the MPV genome.
[0429] A nucleic acid which is hybridizable to a nucleic acid of a
mammalian MPV, or to its reverse complement, or to its complement
can be used in the methods of the invention to detect the presence
of a mammalian MPV. In certain embodiments, the nucleic acids are
hybridized under conditions of high stringency. By way of example
and not limitation, procedures using such conditions of high
stringency are as follows. Prehybridization of filters containing
DNA is carried out for 8 h to overnight at 65 C in buffer composed
of 6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP,
0.02% Ficoll, 0.02% BSA, and 500 .mu.g/ml denatured salmon sperm
DNA. Filters are hybridized for 48 h at 65 C in prehybridization
mixture containing 100 .mu.g/ml denatured salmon sperm DNA and
5-20.times.10.sup.6 cpm of 32P-labeled probe. Washing of filters is
done at 37 C for 1 h in a solution containing 2.times.SSC, 0.01%
PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in
0.1.times.SSC at 50 C for 45 min before autoradiography. Other
conditions of high stringency which may be used are well known in
the art. In other embodiments of the invention, hybridization is
performed under moderate of low stringency conditions, such
conditions are well-known to the skilled artisan (see e.g.,
Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d
Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.;
see also, Ausubel et al., eds., in the Current Protocols in
Molecular Biology series of laboratory technique manuals, 1987-1997
Current Protocols,.COPYRGT. 1994-1997 John Wiley and Sons,
Inc.).
[0430] In another embodiment, the invention relates to the
detection of an MPV infection in an animal or human host through
the preparation and use of antibodies, e.g., monoclonal antibodies
(MAbs), that are specific to and can recognize peptides or nucleic
acids that are characteristic of MPV or its gene products. The
epitopes or antigenic determinants recognized by said MAbs include
but are not limited to proteinaceous and nucleic acid products that
are synthesized during the life cycle and metabolic processes
involved in MPV propagation. The proteinaceous or nucleic acid
products that can be used as antigenic determinants for the
generation of suitable antibodies include but are not limited to
complete and incomplete transcription and expression products of
one or more of the following components of MPV: the N-gene, the
P-gene, the M-gene, the F-gene, the M2-gene, the SH-gene, the
G-gene, and the L-gene. In one specific embodiment, MAbs raised
against proteinaccous products of the G-gene or portions thereof
are used in conjunction with other methods to detect or confirm the
presence of the MPV expressed G peptide in a biological sample,
e.g. body fluid. Said methods include but are not limited to ELISA,
Radio-Immuno or Competition Assays, Immuno-precipitation and other
methods that employ the transcribed or expressed gene products of
MPV as targets for detection by MAbs raised against said targets or
portions and relatives thereof.
[0431] In another embodiment, the invention relates to the
detection of factors that are associated with and characteristic of
a host's immunologic response to MPV exposure or infection. Upon
exposure or infection by MPV, a host's immune system illicits a
response to said exposure or infection that involves the generation
by the host of antibodies directed at eliminating or attenuating
the effects and/or propagation of virus. This invention provides
means and methods for the diagnosis of MPV related disease through
the detection of said antibodies that may be produced as a result
of MPV exposure to or infection of the host. The epitopes
recognized by said antibodies include but are not limited to
peptides and their exposed surfaces that are accessible to a host
immune response and that can serve as antigenic determinants in the
generation of an immune response by the host to the virus. Some of
the proteinaceous and nuclear material used by a host immune
response as epitopes for the generation of antibodies include but
are not limited to products of one or more of the following
components of MPV: the N-gene, the P-gene, the M-gene, the F-gene,
the M2-gene, the SH-gene, the G-gene, and the L-gene. In one
embodiment, antibodies to partially or completely accessible
portions of the N-gene encoded peptides of MPV are detected in a
host sample. In a specific embodiment, proteinaceous products of
the G-gene or portions thereof are used in conjunction with other
methods to detect the presence of the host derived antibodies in a
biological sample, e.g. body fluid. Said methods include but are
not limited to ELISA, Radio-Immuno or Competition Assays, and other
methods that employ the transcribed or expressed gene products of
MPV as targets for detection by host antibodies that recognize said
products and that are found in biological samples.
[0432] This invention also provides means and methods for
diagnostic assays or test kits and for methods to detect agents of
an MPV infection from a variety of sources including but not
limited to biological samples, e.g., body fluids. In one
embodiment, this invention relates to assays, kits, protocols, and
procedures that are suitable for identifying an MPV nucleic acid or
a compliment thereof. In another embodiment, this invention relates
to assays, kits, protocols, and procedures that are suitable for
identifying an MPV expressed peptide or a portion thereof. In
another embodiment, this invention relates to assays, kits,
protocols, and procedures that are suitable for identifying
components of a host immunologic response to MPV exposure or
infection.
[0433] In addition to diagnostic confirmation of MPV infection of a
host, the present invention also provides for means and methods to
classify isolates of MPV into distinct phylogenetic groups or
subgroups. In one embodiment, this feature can be used
advantageously to distinguish between the different variant of MPV,
variant A1, A2, B1 and B2, in order to design more effective and
subgroup specific therapies. Variants of MPV can be differentiated
on the basis of nucleotide or amino acid sequences of one or more
of the following: the N-gene, the P-gene, the M-gene, the F-gene,
the M2-gene, the SH-gene, the G-gene, and the L-gene. In a specific
embodiment, MPV can be differentiated into a specific subgroup
using the nucleotide or amino acid sequence of the G gene or
glycoprotein and neutralization tests using monoclonal antibodies
that also recognize the G glycoprotein.
[0434] In one embodiment, the diagnosis of an MPV infection in a
human is made using any technique well known to one skilled in the
art, e.g., immunoassays. Immunoassays which can be used to analyze
immunospecific binding and cross-reactivity include, but are not
limited to, competitive and non-competitive assay systems using
techniques such as westem blots, radioimmunoassays, ELISA (enzyme
linked immunosorbent assay), sandwich immunoassays,
immunoprecipitation assays, precipitin reactions, gel diffusion
precipitation reactions, immunodiffusion assays, agglutination
assays, complement-fixation assays, and fluorescent immunoassays,
to name but a few. Such assays are routine and well known in the
art (see, e.g., Ausubel et al., eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York,
which is incorporated by reference herein in its entirety) and
non-limiting examples of immunoassays are described in section
5.8.
[0435] In one embodiment, the invention relates to the detection of
an MPV infection using oligonucleotides in conjunction with PCR or
primer extension methods to copy or amplify regions of the MPV
genome, said regions including but not limited to genes or parts of
genes, e.g., the N, M, F, G, L, M, P, and M2 genes. In a specific
embodiment, oligonucleotides are used in conjunction with RT-PCR
methods. In a further embodiment, the amplification products and/or
genetic material can be probed with oligonucleotides that are
complimentary to specific sequences that are either conserved
between various hMPV strains or are distinct amongst various hMPV
strains. The latter set of oligonucletides would allow for
identification of the specific strain of hMPV responsible for the
infection of the host.
[0436] The invention provides methods for distinguishing-between
different subgroups and variants of hMPV that are capable of
infecting a host. In one specific embodiment, the hMPV that is
responsible for a host infection is classified into a specific
subgroup, e.g., subgroup A or subgroup B. In another specific
embodiment, the hMPV that is responsible for a host infection is
classified as a specific variant of a subgroup, e.g., variant A1,
A2, B1, or B2. In another embodiment, the invention provides means
and methods for the classification of an hMPV that is responsible
for a host infection into a new subgroup and/or into a new variant
of a new or existing subgroup. The methods that are able to
distinguish hMPV strains into subgroups and/or variant groups would
be known to one skilled in the art. In one embodiment, a polyclonal
antibody is used to identify the etiological agent of an infection
as a strain of hMPV, and a secondary antibody is used to
distinguish said strain as characteristic of a new or known
subgroup and/or new or known variant of hMPV. In one embodiment,
antibodies that are selective for hMPV are used in conjunction with
immunoreactive assays, e.g. ELISA or RIA, to identify the presence
of hMPV exposure or infection in biological samples. In a further
embodiment, secondary antibodies that are selective for specific
epitopes in the peptide sequence of hMPV proteins are used to
further classify the etiological agents of said identified HMPV
infections into subgroups or variants. In one specific embodiment,
an antibody raised against peptide epitopes that are shared between
all subgroups of hMPV is used to identify the etioligical agent of
an infection as an hMPV. In a further specific embodiment,
antibodies raised against peptide epitopes that are unique to the
different subgroups and/or variants of hMPV are used to classify
the hMPV that is responsible for the host infection into a known or
new subgroup and/or variant. In one specific embodiment, the
antibody that is capable of distinguishing between different
subgroups and/or variants of hMPV recognizes segments of hMPV
peptides that are unique to the subgroup or variant, said peptides
including but not limited to those encoded by the N, M, F, G, L, M,
P, and M2 genes. The peptides or segments of peptides that can be
used to generate antibodies capable of distinghishing between
different hMPV sugroups or variants can be selected using
differences in known peptide sequences of various hMPV proteins in
conjunction with hydrophillicity plots to identify suitable peptide
segments that would be expected to be solvent exposed or accessible
in a diagnostic assay. In one embodiment, the antibody that is
capable of distinguishing between the different subgroups of hMPV
recongnizes differences in the F protein that are unique to
different subgroups of hMPV, e.g. the amino acids at positions 286,
296, 312, 348, and 404 of the full length F protein. In another
specific embodiment, the antibody that is capable of distinguishing
between different subgroups and/or variants of hMPV recognizes
segments of the G protein of hMPV that are unique to specific
subgroups or variants, e.g., the G peptide sequence corresponding
to amino acids 50 through 60 of SEQ ID:119 can be used to
distinguish between subgroups A and B as well as between variants
A1, A2, B1, and B2. In another embodiment of the invention, the
nucleotide sequence of hMPV isolates are used to distinguish
between different subgroups and/or different variants of hMPV. In
one embodiment, oligonucleotide sequences, primers, and/or probes
that are complimentary to sequences in the hMPV genome are used to
classify the etiological agents of hMPV infections into distinct
subgroups and/or variants in conjunction with methods known to one
skilled in the art, e.g. RT-PCR, PCR, primer run on assays, and
various blotting techniques. In one specific embodiment, a
biological sample is used to copy or amplify a specific segment of
the hMPV genome, using RT-PCR. In a further embodiment, the
sequence of said segment is obtained and compared with known
sequences of hMPV, and said comparison is used to classify the hMPV
strain into a distinct subgroup or variant or to classify the hMPV
strain into a new subgroup or variant. In another embodiment, the
invention relates to diagnostic kits that can be used to
distinguish between different subgroups and/or variants of
hMPV.
[0437] In a preferred embodiment, diagnosis and/or treatment of a
specific viral infection is performed with reagents that are most
specific for said specific virus causing said infection. In this
case this means that it is preferred that said diagnosis and/or
treatment of an MPV infection is performed with reagents that are
most specific for MPV. This by no means however excludes the
possibility that less specific, but sufficiently crossreactive
reagents are used instead, for example because they are more easily
available and sufficiently address the task at hand. Herein it is
for example provided to perform virological and/or serological
diagnosis of MPV infections in mammals with reagents derived from
APV, in particular with reagents derived from APV-C, in the
detailed description herein it is for example shown that
sufficiently trustworthy serological diagnosis of MPV infections in
mammals can be achieved by using an ELISA specifically designed to
detect APV antibodies in birds. A particular useful test for this
purpose is an ELISA test designed for the detection of APV
antibodies (e.g in serum or egg yolk), one commercially available
version of which is known as APV-Ab SVANOVIR.RTM. which is
manufactured by SVANOVA Biotech AB, Uppsal Science Park Glunten
SE-75 1 83 Uppsala Sweden. The reverse situation is also the case,
herein it is for example provided to perform virological and/or
serological diagnosis of APV infections in mammals with reagents
derived from MPV, in the detailed description herein it is for
example shown that sufficiently trustworthy serological diagnosis
of APV infections in birds can be achieved by using an ELISA
designed to detect MPV antibodies. Considering that antigens and
antibodies have a lock-and-key relationship, detection of the
various antigens can be achieved by selecting the appropriate
antibody having sufficient cross-reactivity. Of course, for relying
on such cross-reactivity, it is best to select the reagents (such
as antigens or antibodies) under guidance of the amino acid
homologies that exist between the various (glyco)proteins of the
various viruses, whereby reagents relating to the most homologous
proteins will be most useful to be used in tests relying on said
cross-reactivity.
[0438] For nucleic acid detection, it is even more straightforward,
instead of designing primers or probes based on heterologous
nucleic acid sequences of the various viruses and thus that detect
differences between the essentially mammalian or avian
Metapneumoviruses, it suffices to design or select primers or
probes based on those stretches of virus-specific nucleic acid
sequences that show high homology. In general, for nucleic acid
sequences, homology percentages of 90% or higher guarantee
sufficient cross-reactivity to be relied upon in diagnostic tests
utilizing stringent conditions of hybridisation.
[0439] The invention for example provides a method for
virologically diagnosing a MPV infection of an animal, in
particular of a mammal, more in particular of a human being,
comprising determining in a sample of said animal the presence of a
viral isolate or component thereof by reacting said sample with a
MPV specific nucleic acid a or antibody according to the invention,
and a method for serologically diagnosing an MPV infection of a
mammal comprising determining in a sample of said mammal the
presence of an antibody specifically directed against an MPV or
component thereof by reacting said sample with a MPV-specific
proteinaceous molecule or fragment thereof or an antigen according
to the invention. The invention also provides a diagnostic kit for
diagnosing an MPV infection comprising an MPV, an MPV-specific
nucleic acid, proteinaceous molecule or fragment thereof, antigen
and/or an antibody according to the invention, and preferably a
means for detecting said MPV, MPV-specific nucleic acid,
proteinaceous molecule or fragment thereof, antigen and/or an
antibody, said means for example comprising an excitable group such
as a fluorophore or enzymatic detection system used in the art
(examples of suitable diagnostic kit format comprise IF, ELISA,
neutralization assay, RT-PCR assay). To determine whether an as yet
unidentified virus component or synthetic analogue thereof such as
nucleic acid, proteinaceous molecule or fragment thereof can be
identified as MPV-specific, it suffices to analyse the nucleic acid
or amino acid sequence of said component, for example for a stretch
of said nucleic acid or amino acid, preferably of at least 10, more
preferably at least 25, more preferably at least 40 nucleotides or
amino acids (respectively), by sequence homology comparison with
known MPV sequences and with known non-MPV sequences APV-C is
preferably used) using for example phylogenetic analyses as
provided herein. Depending on the degree of relationship with said
MPV or non-MPV sequences, the component or synthetic analogue can
be identified.
[0440] The invention also provides method for virologically
diagnosing an MPV infection of a mammal comprising determining in a
sample of said mammal the presence of a viral isolate or component
thereof by reacting said sample with a cross-reactive nucleic acid
derived from APV (preferably serotype C) or a cross-reactive
antibody reactive with said APV, and a method for serologically
diagnosing an MPV infection of a mammal comprising determining in a
sample of said mammal the presence of a cross-reactive antibody
that is also directed against an APV or component thereof by
reacting said sample with a proteinaceous molecule or fragment
thereof or an antigen derived from APV. Furthermore, the invention
provides the use of a diagnostic kit initially designed for AVP or
AVP-antibody detection for diagnosing an MPV infection, in
particular for detecting said MPV infection in humans.
[0441] The invention also provides methods for virologically
diagnosing an APV infection in a bird comprising determining in a
sample of said bird the presence of a viral isolate or component
thereof by reacting said sample with a cross-reactive nucleic acid
derived from MPV or a cross-reactive antibody reactive with said
MPV, and a method for serologically diagnosing an APV infection of
a bird comprising determining in a sample of said bird the presence
of a cross-reactive antibody that is also directed against an MPV
or component thereof by reacting said sample with a proteinaceous
molecule or fragment thereof or an antigen derived from MPV.
Furthermore, the invention provides the use of a diagnostic kit
initially designed for MPV or MPV-antibody detection for diagnosing
an APV infection, in particular for detecting said APV infection in
poultry such as a chicken, duck or turkey.
[0442] For diagnosis as for treatment, use can be made of the high
degree of homology among different mammalian MPVs and between MPV
and other viruses, such as, e.g., APV, in particular when
circumstances at hand make the use of the more homologous approach
less straightforward. Vaccinations that can not wait, such as
emergency vaccinations against MPV infections can for example be
performed with vaccine preparations derived from APV(preferably
type C) isolates when a more homologous MPV vaccine is not
available, and, vice versa, vaccinations against APV infections can
be contemplated with vaccine preparations derived from MPV. Also,
reverse genetic techniques make it possible to generate chimeric
APV-MPV virus constructs that are useful as a vaccine, being
sufficiently dissimilar to field isolates of each of the respective
strains to be attenuated to a desirable level. Similar reverse
genetic techniques will make it also possible to generate chimeric
paramyxovirus-metapneumovirus constructs, such as RSV-MPV or
P13-MPV constructs for us in a vaccine preparation. Such constructs
are particularly useful as a combination vaccine to combat
respiratory tract illnesses.
[0443] Since MPV CPE was virtually indistinguishable from that
caused by hRSV or hPIV-1 in tMK or other cell cultures, the MPV may
have well gone unnoticed until now. tMK (tertiary monkey kidney
cells, i.e. MK cells in a third passage in cell culture) are
preferably used due to their lower costs in comparison to primary
or secondary cultures. The CPE is, as well as with some of the
classical Paraniyxovimidae, characterized by syncytium formation
after which the cells showed rapid internal disruption, followed by
detachment of the cells from the monolayer. The cells usually (but
not always) displayed CPE after three passages of virus from
original material, at day 10 to 14 post inoculation, somewhat later
than CPE caused by other viruses such as HRSV or hPIV-1.
[0444] As an example, the invention provides a not previously
identified paramyxovirus from nasopharyngeal aspirate samples taken
from 28 children suffering from severe RTI. The clinical symptoms
of these children were largely similar to those caused by hRSV.
Twenty-seven of the patients were children below the age of five
years and half of these were between 1 and 12 months old. The other
patient was 18 years old. All individuals suffered from upper RTI,
with symptoms ranging from cough, myalgia, vomiting and fever to
broncheolitis and severe pneumonia. The majority of these patients
were hospitalised for one to two weeks.
[0445] The virus isolates from these patients had the paramyxovirus
morphology in negative contrast electron microscopy but did not
react with specific antisera against known human and animal
paramyxoviruses. They were all closely related to one another as
determined by indirect immunofluorescence assays (IFA) with sera
raised against two of the isolates. Sequence analyses of nine of
these isolates revealed that the virus is somewhat related to APV.
Based on virological data, sequence homology as well as the genomic
organisation we propose that the virus is a member of
Metapneumovirus genus. Serological surveys showed that this virus
is a relatively common pathogen since the seroprevalence in the
Netherlands approaches 100% of humans by the age of five years.
Moreover, the seroprevalence was found to be equally high in sera
collected from humans in 1958, indicating this virus has been
circulating in the human population for more than 40 years. The
identification of this proposed new member of the Metapneumovirus
genus now also provides for the development of means and methods
for diagnostic assays or test kits and vaccines or serum or
antibody compositions for viral respiratory tract infections, and
for methods to test or screen for antiviral agents useful in the
treatment of MPV infections.
[0446] Methods and means provided herein are particularly useful in
a diagnostic kit for diagnosing a MPV infection, be it by
virological or serological diagnosis. Such kits or assays may for
example comprise a virus, a nucleic acid, a proteinaceous molecule
or fragment thereof, an antigen and/or an antibody according to the
invention. Use of a virus, a nucleic acid, a proteinaceous molecule
or fragment thereof, an antigen and/or an antibody according to the
invention is also provided for the production of a pharmaceutical
composition, for example for the treatment or prevention of MPV
infections and/or for the treatment or prevention of respiratory
tract illnesses, in particular in humans. Attenuation of the virus
can be achieved by established methods developed for this purpose,
including but not limited to the use of related viruses of other
species, serial passages through laboratory animals or/and
tissue/cell cultures, site directed mutagenesis of molecular clones
and exchange of genes or gene fragments between related
viruses.
[0447] 5.15 Compositions of the Invention and Components of
Mammalian Metapneumovirus
[0448] The invention relates to nucleic acid sequences of a
mammalian MPV, proteins of a mammalian MPV, and antibodies against
proteins of a mammalian MPV. The invention further relates to
homologs of nucleic acid sequences of a mammalian MPV and homologs
of proteins of a mammalian MPV. The invention further relates to
nucleic acid sequences encoding fusion proteins, wherein the fusion
protein contains a protein of a mammalian MPV or a fragment thereof
and one or more peptides or proteins that are not derived from
mammalian MPV. In a specific embodiment, a fusion protein of the
invention contains a protein of a mammalian MPV or a fragment
thereof and a peptide tag, such as, but not limited to a
polyhistidine tag. The invention further relates to fusion
proteins, wherein the fusion protein contains a protein of a
mammalian MPV or a fragment thereof and one or more peptides or
proteins that are not derived from mammalian MPV. The invention
also relates to derivatives of nucleic acids encoding a protein of
a mammlian MPV. The invention also relates to derivatives of
proteins of a mammalian MPV. A derivative can be, but is not
limited to, mutant forms of the protein, such as, but not limited
to, additions, deletions, truncations, substitutions, and
inversions. A derivative can further be a chimeric form of the
protein of the mammalian MPV, wherein at least one domain of the
protein is derived from a different protein. A derivative can also
be a form of a protein of a mammalian MPV that is covalently or
non-covalently linked to another molecule, such as, e.g., a
drug.
[0449] The viral isolate termed NL/1/00 (also 00-1) is a mammalian
MPV of variant A1 and its genomic sequence is shown in SEQ ID
NO:19. The viral isolate termed NL/17/00 is a mammalian MPV of
variant A2 and its genomic sequence is shown in SEQ ID NO:20. The
viral isolate termed NL/1/99 (also 99-1) is a mammalian MPV of
variant Bi and its genomic sequence is shown in SEQ ID NO:18. The
viral isolate tenned NL/1/94 is a mammalian MPV of variant B2 and
its genomic sequence is shown in SEQ ID NO:21. A list of sequences
disclosed in the present application and the corresponding SEQ ID
Nos is set forth in Table 14.
[0450] The protein of a mammalian MPV can be a an N protein, a P
protein, a M protein, a F protein, a M2-1 protein or a M2-2 protein
or a fragment thereof. A fragment of a protein of a mammlian MPV
can be can be at least 25 amino acids, at least 50 amino acids, at
least 75 amino acids, at least 100 amino acids, at least 125 amino
acids, at least 150 amino acids, at least 175 amino acids, at least
200 amino acids, at least 225 amino acids, at least 250 amino
acids, at least 275 amino acids, at least 300 amino acids, at least
325 amino acids, at least 350 amino acids, at least 375 amino
acids, at least 400 amino acids, at least 425 amino acids, at least
450 amino acids, at least 475 amino acids, at least 500 amino
acids, at least 750 amino acids, at least 1000 amino acids, at
least 1250 amino acids, at least 1500 amino acids, at least 1750
amino acids, at least 2000 amino acids or at least 2250 amino acids
in length. A fragment of a protein of a mammlian MPV can be can be
at most 25 amino acids, at most 50 amino acids, at most 75 amino
acids, at most 100 amino acids, at most 125 amino acids, at most
150 amino acids, at most 175 amino acids, at most 200 amino acids,
at most 225 amino acids, at most 250 amino acids, at most 275 amino
acids, at most 300 amino acids, at most 325 amino acids, at most
350 amino acids, at most 375 amino acids, at most 400 amino acids,
at most 425 amino acids, at most 450 amino acids, at most 475 amino
acids, at most 500 amino acids, at most 750 amino acids, at most
1000 amino acids, at most 1250 amino acids, at most 1500 amino
acids, at most 1750 amino acids, at most 2000 amino acids or at
most 2250 amino acids in length.
[0451] In certain embodiments of the invention, the protein of a
mammalian MPV is a N protein, wherein the N protein is
phylogenetically closer related to a N protein of a mammalian MPV,
such as the N protein encoded by, e.g., the viral genome of SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, (see also Table
14 for a description of the SEQ ID Nos) than it is related to the N
protein of APV type C. In certain embodiments of the invention, the
protein of a mammalian MPV is a P protein, wherein the P protein is
phylogenetically closer related to a P protein of a mammalian MPV,
such as the P protein encoded by, e.g., the viral genome of SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, than it is
related to the N protein of APV type C. In certain embodiments of
the invention, the protein of a mammalian MPV is a M protein,
wherein the M protein is closer related to a M protein of a
mammalian MPV, such as the M protein encoded by, e.g., the viral
genome of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID
NO:21, than it is related to the M protein of APV type C. In
certain embodiments of the invention, the protein of a mammalian
MPV is a F protein, wherein the F protein is phylogenetically
closer related to a F protein of a mammalian MPV, such as the F
protein encoded by, e.g., the viral genome of SEQ ID NO:18, SEQ ID
NO:19, SEQ ID NO:20, or SEQ ID NO:21, than it is related to the F
protein of APV type C. In certain embodiments of the invention, the
protein of a mammalian MPV is a M2-1 protein, wherein the M2-1
protein is phylogenetically closer related to a M2-1 protein of a
mammalian MPV, such as the M2-1 protein encoded by, e.g., the viral
genome of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID
NO:21, than it is related to the M2-1 protein of APV type C. In
certain embodiments of the invention, the protein of a mammalian
MPV is a M2-2 protein, wherein the M2-2 protein is phylogenetically
closer related to a M2-2 protein of a mammalian MPV, such as the
M2-2 protein encoded by, e.g., the viral genome of SEQ ID NO:18,
SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, than it is related to
the M2-2 protein of APV type C. In certain embodiments of the
invention, the protein of a mammalian MPV is a G protein, wherein
the G protein is phylogenetically closer related to a G protein of
a mammalian MPV, such as the G protein encoded by, e.g., the viral
genome of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID
NO:21, than it is related to any protein of APV type C. In certain
embodiments of the invention, the protein of a mammalian MPV is a
SH protein, wherein the SH protein is phylogenetically closer
related to a SH protein of a mammalian MPV, such as the SH protein
encoded by, e.g., the viral genome of SEQ ID NO:18, SEQ ID NO:19,
SEQ ID NO:20, or SEQ ID NO:21, than it is related to any protein of
APV type C. In certain embodiments of the invention, the protein of
a mammalian MPV is a L protein, wherein the L protein is
phylogenetically closer related to a L protein of a mammalian MPV,
such as the SH protein encoded by, e.g., the viral genome of SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, than it is
related to any protein of APV type C.
[0452] In certain embodiments of the invention, the protein of a
mammalian MPV is a N protein, wherein the N protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a N
protein encoded by the viral genome of SEQ ID NO:18, SEQ ID NO:19,
SEQ ID NO:20, or SEQ ID NO:21 (the amino acid sequences of the
respective N proteins are disclosed in SEQ ID NO:366-369; see also
Table 14). In certain embodiments of the invention, the protein of
a mammalian MPV is a N protein, wherein the P protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a P
protein encoded by the viral genome of SEQ ID NO:18, SEQ ID NO:19,
SEQ ID NO:20, or SEQ ID NO:21 (the amino acid sequences of the
respective P proteins are disclosed in SEQ ID NO:374-377; see also
Table 14). In certain embodiments of the invention, the protein of
a mammalian MPV is a M protein, wherein the M protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a M
protein encoded by the viral genome of SEQ ID NO:18, SEQ ID NO:19,
SEQ ID NO:20, or SEQ ID NO:21 (the amino acid sequences of the
respective M proteins are disclosed in SEQ ID NO:358-361; see also
Table 14). In certain embodiments of the invention, the protein of
a mammalian MPV is a F protein, wherein the F protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a F
protein encoded by the viral genome of SEQ ID NO:18, SEQ ID NO:19,
SEQ ID NO:20, or SEQ ID NO:21 (the amino acid sequences of the
respective F proteins are disclosed in SEQ ID NO:314-317; see also
Table 14). In certain embodiments of the invention, the protein of
a mammalian MPV is a M2-1 protein, wherein the M2-1 protein is at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, at least
99%, or at least 99.5% identical to the amino acid sequence of a
M2-1 protein encoded by the viral genome of SEQ ID NO:18, SEQ ID
NO:19, SEQ ID NO:20, or SEQ ID NO:21 (the amino acid sequences of
the respective M2-1 proteins are disclosed in SEQ ID NO:338-341;
see also Table 14). In certain embodiments of the invention, the
protein of a mammalian MPV is a M2-2 protein, wherein the M2-2
protein is at least 60%, at least 65%, at least 70%, at least 75%,
at least 80%, at least 85%, at least 90%, at least 95%, at least
98%, at least 99%, or at least 99.5% identical to the amino acid
sequence of a M2-2 protein encoded by the viral genome of SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21 (the amino acid
sequences of the respective M2-2 proteins are disclosed in SEQ ID
NO:346-349; see also Table 14). In certain embodiments of the
invention, the protein of a mammalian MPV is a G protein, wherein
the G protein is at least 60%, at least 65%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, at least 99%, or at least 99.5% identical to the amino
acid sequence of a G protein encoded by the viral genome of SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21 (the amino acid
sequences of the respective G proteins are disclosed in SEQ ID
NO:322-325; see also Table 14). In certain embodiments of the
invention, the protein of a mammalian MPV is a SH protein, wherein
the SH protein is at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 98%, at least 99%, or at least 99.5% identical to the
amino acid sequence of a SH protein encoded by the viral genome of
SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21 (the
amino acid sequences of the respective SH proteins are disclosed in
SEQ ID NO:382-385; see also Table 14). In certain embodiments of
the invention, the protein of a mammalian MPV is a L protein,
wherein the L protein is at least 60%, at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95%, at least 98%, at least 99%, or at least 99.5% identical to the
amino acid sequence of a L protein encoded by the viral genome of
SEQ ID NO:18, SEQ ID NO:19, SEQ If) NO:20, or SEQ ID NO:21 (the
amino acid sequences of the respective L proteins are disclosed in
SEQ ID NO:330-333; see also Table 14).
[0453] A fragment of a protein of mammalian MPV is at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 98%, at least 99%, or at least
99.5% identical to the homologous protein encoded by the virus of
SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21 over the
portion of the protein that is homologous to the fragment. In a
specific, illustrative embodiment, the invention provides a
fragment of the F protein of a mammalian MPV that contains the
ectodomain of the F protein and homologs thereof. The homolog of
the fragment of the F protein that contains the ectodomain is at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, at least
99%, or at least 99.5% identical to the corresponding fragment
containing the ectodomain of the F protein encoded by a virus of
SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21 (the
amino acid sequences of the respective F proteins are disclosed in
SEQ ID NO:314-317; see also Table 14).
[0454] In certain embodiments, the invention provides a protein of
a mammalian MPV of subgroup A and fragments thereof. The invention
provides a N protein of a mammalian MPV of subgroup A, wherein the
N protein is phylogenetically closer related to the N protein
encoded by a virus of SEQ ID NO:19 or SEQ ID NO:20 than it is
related to the N protein encoded by a virus encoded by SEQ ID NO:18
or SEQ ID NO:21. The invention provides a G protein of a mammalian
MPV of subgroup A, wherein the G protein is phylogenetically closer
related to the G protein encoded by a virus of SEQ ID NO:19 or SEQ
ID NO:20 than it is related to the G protein encoded by a virus
encoded by SEQ ID NO:18 or SEQ ID NO:21. The invention provides a P
protein of a mammalian MPV of subgroup A, wherein the P protein is
phylogenetically closer related to the P protein encoded by a virus
of SEQ ID NO:19 or SEQ ID NO:20 than it is related to the P protein
encoded by a virus encoded by SEQ ID NO:18 or SEQ ID NO:21. The
invention provides a M protein of a mammalian MPV of subgroup A,
wherein the M protein is phylogenetically closer related to the M
protein encoded by a virus of SEQ ID NO:19 or SEQ ID NO:20 than it
is related to the M protein encoded by a virus encoded by SEQ ID
NO:18 or SEQ ID NO:21. The invention provides a N protein of a
mammalian MPV of subgroup A, wherein the F protein is
phylogenetically closer related to the F protein encoded by a virus
of SEQ ID NO:19 or SEQ ID NO:20 than it is related to the F protein
encoded by a virus encoded by SEQ ID NO:18 or SEQ ID NO:21. The
invention provides a M2-1 protein of a mammalian MPV of subgroup A,
wherein the M2-1 protein is phylogenetically closer related to the
M2-1 protein encoded by a virus of SEQ ID NO:19 or SEQ ID NO:20
than it is related to the M2-1 protein encoded by a virus encoded
by SEQ ID NO:18 or SEQ ID NO:21. The invention provides a M2-2
protein of a mammalian MPV of subgroup A, wherein the M2-2 protein
is phylogenetically closer related to the M2-2 protein encoded by a
virus of SEQ ID NO:19 or SEQ ID NO:20 than it is related to the
M2-2 protein encoded by a virus encoded by SEQ ID NO:18 or SEQ ID
NO:21. The invention provides a SH protein of a mammalian MPV of
subgroup A, wherein the SH protein is phylogenetically closer
related to the SH protein encoded by a virus of SEQ ID NO:19 or SEQ
ID NO:20 than it is related to the SH protein encoded by a virus
encoded by SEQ ID NO:18 or SEQ ID NO:21. The invention provides a L
protein of a mammalian MPV of subgroup A, wherein the L protein is
phylogenetically closer related to the L protein encoded by a virus
of SEQ ID NO: 9 or SEQ ID NO:20 than it is related to the L protein
encoded by a virus encoded by SEQ ID NO:18 or SEQ ID NO:21.
[0455] In other embodiments, the invention provides a protein of a
mammalian MPV of subgroup B or fragments thereof. The invention
provides a N protein of a mammalian MPV of subgroup B, wherein the
N protein is phylogenetically closer related to the N protein
encoded by a virus of SEQ ID NO:18 or SEQ ID NO:21 than it is
related to the N protein encoded by a virus encoded by SEQ ID NO:19
or SEQ ID NO:20. The invention provides a G protein of a mammalian
MPV of subgroup A, wherein the G protein is phylogenetically closer
related to the G protein encoded by a virus of SEQ ID NO:18 or SEQ
ID NO:21 than it is related to the G protein encoded by a virus
encoded by SEQ ID NO:19 or SEQ ID NO:20. The invention provides a P
protein of a mammalian MPV of subgroup A, wherein the P protein is
phylogenetically closer related to the P protein encoded by a virus
of SEQ ID NO:18 or SEQ ID NO:21 than it is related to the P protein
encoded by a virus encoded by SEQ ID NO:19 or SEQ ID NO:20. The
invention provides a M protein of a mammalian MPV of subgroup A,
wherein the M protein is phylogenetically closer related to the M
protein encoded by a virus of SEQ ID NO:18 or SEQ ID NO:21 than it
is related to the M protein encoded by a virus encoded by SEQ ID
NO:19 or SEQ ID NO:20. The invention provides a N protein of a
mammalian MPV of subgroup A, wherein the F protein is
phylogenetically closer related to the F protein encoded by a virus
of SEQ ID NO:18 or SEQ ID NO:21 than it is related to the F protein
encoded by a virus encoded by SEQ ID NO:19 or SEQ ID NO:20. The
invention provides a M2-1 protein of a mammalian MPV of subgroup A,
wherein the M2-1 protein is phylogenetically closer related to the
M2-1 protein encoded by a virus of SEQ ID NO:18 or SEQ ID NO:21
than it is related to the M2-1 protein encoded by a virus encoded
by SEQ ID NO:19 or SEQ ID NO:20. The invention provides a M2-2
protein of a mammalian MPV of subgroup A, wherein the M2-2 protein
is phylogenetically closer related to the M2-2 protein encoded by a
virus of SEQ ID NO:18 or SEQ ID NO:21 than it is related to the
M2-2 protein encoded by a virus encoded by SEQ ID NO:19 or SEQ ID
NO:20. The invention provides a SH protein of a mammalian MPV of
subgroup A, wherein the SH protein is phylogenetically closer
related to the SH protein encoded by a virus of SEQ ID NO:18 or SEQ
ID NO:21 than it is related to the SH protein encoded by a virus
encoded by SEQ ID NO:19 or SEQ ID NO:20. The invention provides a L
protein of a mammalian MPV of subgroup A, wherein the L protein is
phylogenetically closer related to the L protein encoded by a virus
of SEQ ID NO:18 or SEQ ID NO:21 than it is related to the L protein
encoded by a virus encoded by SEQ ID NO:19 or SEQ ID NO:20.
[0456] The invention further provides proteins of a mammalian MPV
of variant A1, A2, B1 or B2. In certain embodiments of the
invention, the proteins of the different variants of mammalian MPV
can be distinguished from each other by way of their amino acid
sequence identities (see, e.g., FIG. 42b). A variant of mammalian
MPV can be, but is not limited to, A1, A2, B1 or B2. The invention,
however, also contemplates isolates of mammalian MPV that are
members of another variant.
[0457] The invention provides a G protein of a mammalian MPV
variant B1, wherein the G protein of a mammalian MPV variant B1 is
phylogenetically closer related to the G protein of the prototype
of variant B1, isolate NL/1/99, than it is related to the G protein
of the prototype of variant A1, isolate NL/1/00, the G protein of
the prototype of A2, isolate NL/17/00, or the G protein of the
prototype of B2, isolate NL/1/94. The invention provides a G
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant Bi as represented by the
prototype NL/1/99 (SEQ ID NO:324). The invention provides a N
protein of a mammalian MPV variant B1, wherein the N protein of a
mammalian MPV variant B1 is phylogenetically closer related to the
N protein of the prototype of variant B1, isolate NL/1/99, than it
is related to the N protein of the prototype of variant A1, isolate
NL/1/00, the N protein of the prototype of A2, isolate NL/17/00, or
the N protein of the prototype of B2, isolate NL/1/94. The
invention provides a N protein of a mammalian MPV variant B1,
wherein the amino acid sequence of the N proteint is at least 98.5%
or at least 99% or at least 99.5% identical to the N protein of a
mammalian MPV variant B1 as represented by the prototype NL/1/99
(SEQ ID NO:368). The invention provides a P protein of a mammalian
MPV variant B1, wherein the P protein of a mammalian MPV variant B1
is phylogenetically closer related to the P protein of the
prototype of variant B1, isolate NL/1/99, than it is related to the
P protein of the prototype of variant A1, isolate NL/1/00, the P
protein of the prototype of A2, isolate NL/17/00, or the P protein
of the prototype of B2, isolate NL/1/94. The invention provides a P
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the P protein is at least 96%, at least 98%, or at
least 99% or at least 99.5% identical the P protein of a mammalian
MPV variant B1 as represented by the prototype NL/1/99 (SEQ ID
NO:376). The invention provides a M protein of a mammalian MPV
variant B1, wherein the M protein of a mammalian MPV variant B1 is
phylogenetically closer related to the M protein of the prototype
of variant B1, isolate NL/1/99, than it is related to the M protein
of the prototype of variant A1, isolate NL/1/00, the M protein of
the prototype of A2, isolate NL/17/00, or the M protein of the
prototype of B2, isolate NL/1/94. The invention provides a M
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the M protein is identical the M protein of a mammalian
MPV variant A1 as represented by the prototype NL/1/99 (SEQ ID
NO:360). The invention provides a F protein of a mammalian MPV
variant B1, wherein the F protein of a mammalian MPV variant B1 is
phylogenetically closer related to the F protein of the prototype
of variant B1, isolate NL/1/99, than it is related to the F protein
of the prototype of variant A1, isolate NL/1/00, the F protein of
the prototype of A2, isolate NL/17/00, or the F protein of the
prototype of B2, isolate NL/1/94. The invention provides a F
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the F protein is at least 99% identical to the F
protein of a mammalian MPV variant Bi as represented by the
prototype NL/1/99 (SEQ ID NO:316). The invention provides a M2-1
protein of a mammalian MPV variant B1, wherein the M2-1 protein of
a mammalian MPV variant B1 is phylogenetically closer related to
the M2-1 protein of the prototype of variant B1, isolate NL/1/99,
than it is related to the M2-1 protein of the prototype of variant
A1, isolate NL/1/00, the M2-1 protein of the prototype of A2,
isolate NL/17/00, or the M2-1 protein of the prototype of B2,
isolate NL/1/94. The invention provides a M2-1 protein of a
mammalian MPV variant B1, wherein the amino acid sequence of the
M2-1 protein is at least 98% or at least 99% or at least 99.5%
identical the M2-1 protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/99 (SEQ ID NO:340). The invention
provides a M2-2 protein of a mammalian MPV variant B1, wherein the
M2-2 protein of a mammalian MPV variant B1 is phylogenetically
closer related to the M2-2 protein of the prototype of variant B1,
isolate NL/1/99, than it is related to the M2-2 protein of the
prototype of variant A1, isolate NL/1/00, the M2-2 protein of the
prototype of A2, isolate NL/17/00, or the M2-2 protein of the
prototype of B2, isolate NL/1/94. The invention provides a M2-2
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the M2-2 protein is at least 99%or at least 99.5%
identical the M2-2 protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:348). The invention
provides a SH protein of a mammalian MPV variant B1, wherein the SH
protein of a mammalian MPV variant B1 is phylogenetically closer
related to the SH protein of the prototype of variant B1, isolate
NL/1/99, than it is related to the SH protein of the prototype of
variant A1, isolate NL/1/00, the SH protein of the prototype of A2,
isolate NL/17/00, or the SH protein of the prototype of B2, isolate
NL/1/94. The invention provides a SH protein of a mammalian MPV
variant B1, wherein the amino acid sequence of the SH protein is at
least 83%, at least 85%, at least 90%, at least 95%, at least 98%,
or at least 99% or at least 99.5% identical the SH protein of a
mammalian MPV variant B1 as represented by the prototype NL/1/99
(SEQ ID NO:384). The invention provides a L protein of a mammalian
MPV variant B1, wherein the L protein of a mammalian MPV variant B1
is phylogenetically closer related to the L protein of the
prototype of variant B1, isolate NL/1/99, than it is related to the
L protein of the prototype of variant A1, isolate NL/1/00, the L
protein of the prototype of A2, isolate NL/17/00, or the L protein
of the prototype of B2, isolate NL/1/94. The invention provides a L
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the L protein is at least 99% or at least 99.5%
identical the L protein a mammalian MPV variant BI as represented
by the prototype NL/1/99 (SEQ ID NO:332).
[0458] The invention provides a G protein of a mammalian MPV
variant A1, wherein the G protein of a mammalian MPV variant A1 is
phylogenetically closer related to the G protein of the prototype
of variant A1, isolate NL/1/00, than it is related to the G protein
of the prototype of variant B1, isolate NL/1/99, the G protein of
the prototype of A2, isolate NL/17/00, or the G protein of the
prototype of B2, isolate NL/1/94. The invention provides a G
protein of a mammalian MPV variant A1, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant A1 as represented by the
prototype NL/1/00 (SEQ ID NO:322). The invention provides a N
protein of a mammalian MPV variant A1, wherein the N protein of a
mammalian MPV variant A1 is phylogenetically closer related to the
N protein of the prototype of variant A1, isolate NL/1/00, than it
is related to the N protein of the prototype of variant B1, isolate
NL/1/99, the N protein of the prototype of A2, isolate NL/17/00, or
the N protein of the prototype of B2, isolate NL/1/94. The
invention provides a N protein of a mammalian MPV variant A1,
wherein the amino acid sequence of the N protein is at least 99.5%
identical to the N protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/00 (SEQ ID NO:366). The invention
provides a P protein of a mammalian MPV variant A1, wherein the P
protein of a mammalian MPV variant A1 is phylogenetically closer
related to the P protein of the prototype of variant A1, isolate
NL/1/00, than it is related to the P protein of the prototype of
variant B1, isolate NL/1/99, the P protein of the prototype of A2,
isolate NL/17/00, or the P protein of the prototype of B2, isolate
NL/1/94. The invention provides a P protein of a mammalian MPV
variant A1, wherein the amino acid sequence of the P protein is at
least 96%, at least 98%, or at least 99% or at least 99.5%
identical to the P protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/00 (SEQ ID NO:374). The invention
provides a M protein of a mammalian MPV variant A1, wherein the M
protein of a mammalian MPV variant A1 is phylogenetically closer
related to the M protein of the prototype of variant A1, isolate
NL/1/00, than it is related to the M protein of the prototype of
variant B1, isolate NL/1/99, the M protein of the prototype of A2,
isolate NL/17/00, or the M protein of the prototype of B2, isolate
NL/1/94. The invention provides a M protein of a mammalian MPV
variant A1, wherein the amino acid sequence of the M protein is at
least 99% or at least 99.5% identical to the M protein of a
mammalian MPV variant A1 as represented by the prototype NL/1/00
(SEQ ID NO:358). The invention provides a F protein of a mammalian
MPV variant A1, wherein the F protein of a mammalian MPV variant A1
is phylogenetically closer related to the F protein of the
prototype of variant A1, isolate NL/1/00, than it is related to the
F protein of the prototype of variant B1, isolate NL/1/99, the F
protein of the prototype of A2, isolate NL/17/00, or the F protein
of the prototype of B2, isolate NL/1/94. The invention provides a F
protein of a mammalian MPV variant A1, wherein the amino acid
sequence of the F protein is at least 98% or at least 99% or at
least 99.5% identical to the F protein of a mammalian MPV variant
A1 as represented by the prototype NL/1/00 (SEQ ID NO:314). The
invention provides a M2-1 protein of a mammalian MPV variant A1,
wherein the M2-1 protein of a mammalian MPV variant A1 is
phylogenetically closer related to the M2-1 protein of the
prototype of variant A1, isolate NL/1/00, than it is related to the
M2-1 protein of the prototype of variant B1, isolate NL/1/99, the
M2-1 protein of the prototype of A2, isolate NL/17/00, or the M2-1
protein of the prototype of B2, isolate NL/1/94. The invention
provides a M2-1 protein of a mammalian MPV variant A1, wherein the
amino acid sequence of the M2-1 protein is at least 99% or at least
99.5% identical to the M2-1 protein of a mammalian MPV variant A1
as represented by the prototype NL/1/00 (SEQ ID NO:338). The
invention provides a M2-2 protein of a mammalian MPV variant A1,
wherein the M2-2 protein of a mammalian MPV variant A1 is
phylogenetically closer related to the M2-2 protein of the
prototype of variant A1, isolate NL/1/00, than it is related to the
M2-2 protein of the prototype of variant B1, isolate NL/1/99, the
M2-2 protein of the prototype of A2, isolate NL/17/00, or the M2-2
protein of the prototype of B2, isolate NL/1/94. The invention
provides a M2-2 protein of a mammalian MPV variant A1, wherein the
amino acid sequence of the M2-2 protein is at least 96% or at least
99% or at least 99.5% identical to the M2-2 protein of a mammalian
MPV variant A1 as represented by the prototype NL/1/00 (SEQ ID
NO:346). The invention provides a SH protein of a mammalian MPV
variant A1, wherein the SH protein of a mammalian MPV variant A1 is
phylogenetically closer related to the SH protein of the prototype
of variant A1, isolate NL/1/00, than it is related to the SH
protein of the prototype of variant B1, isolate NL/1/99, the SH
protein of the prototype of A2, isolate NL/17/00, or the SH protein
of the prototype of B2, isolate NL/1/94. The invention provides a
SH protein of a mammalian MPV variant A1, wherein the amino acid
sequence of the SH protein is at least 84%, at least 90%, at least
95%, at least 98%, or at least 99% or at least 99.5% identical to
the SH protein of a mammalian MPV variant A1 as represented by the
prototype NL//00 (SEQ ID NO:382). The invention provides a L
protein of a mammalian MPV variant A1, wherein the L protein of a
mammalian MPV variant A1 is phylogenetically closer related to the
L protein of the prototype of variant A1, isolate NL/1/00, than it
is related to the L protein of the prototype of variant B1, isolate
NL/1/99, the L protein of the prototype of A2, isolate NL/17/00, or
the L protein of the prototype of B2, isolate NL/1/94. The
invention provides a L protein of a mammalian MPV variant A1,
wherein the amino acid sequence of the L protein is at least 99% or
at least 99.5% identical to the L protein of a virus of a mammalian
MPV variant A1 as represented by the prototype NL/1/00 (SEQ ID
NO:330).
[0459] The invention provides a G protein of a mammalian MPV
variant A2, wherein the G protein of a mammalian MPV variant A2 is
phylogenetically closer related to the G protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the G
protein of the prototype of variant B1, isolate NL/1/99, the G
protein of the prototype of A1, isolate NL/1/00, or the G protein
of the prototype of B2, isolate NL/1/94. The invention provides a G
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant A2 as represented by the
prototype NL/7/00 (SEQ ID NO:332). The invention provides a N
protein of a mammalian MPV variant A2, wherein the N protein of a
mammalian MPV variant A2 is phylogenetically closer related to the
N protein of the prototype of variant A2, isolate NL/17/00, than it
is related to the N protein of the prototype of variant B1, isolate
NL/1/99, the N protein of the prototype of A1, isolate NL/1/00, or
the N protein of the prototype of B2, isolate NL/1/94. The
invention provides a N protein of a mammalian MPV variant A2,
wherein the amino acid sequence of the N protein at least 99.5%
identical to the N protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:367). The
invention provides a P protein of a mammalian MPV variant A2,
wherein the P protein of a mammalian MPV variant A2 is
phylogenetically closer related to the P protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the P
protein of the prototype of variant B1, isolate NL/1/99, the P
protein of the prototype of A1, isolate NL/1/00, or the P protein
of the prototype of B2, isolate NL/1/94. The invention provides a P
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the P protein is at least 96%, at least 98%, at least
99% or at least 99.5% identical to the P protein of a mammalian MPV
variant A2 as represented by the prototype NL/17/00(SEQ ID NO:375).
The invention provides a M protein of a mammalian MPV variant A2,
wherein the M protein of a mammalian MPV variant A2 is
phylogenetically closer related to the M protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the M
protein of the prototype of variant B1, isolate NL/1/99, the M
protein of the prototype of A1, isolate NL/1/00, or the M protein
of the prototype of B2, isolate NL/1/94. The invention provides a M
protein of a mammalian MPV variant A2, wherein the the amino acid
sequence of the M protein is at least 99%, or at least 99.5%
identical to the M protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00(SEQ ID NO:359). The invention
provides a F protein of a mammalian MPV variant A2, wherein the F
protein of a mammalian MPV variant A2 is phylogenetically closer
related to the F protein of the prototype of variant A2, isolate
NL/17/00, than it is related to the F protein of the prototype of
variant B1, isolate NL/1/99, the F protein of the prototype of A1,
isolate NL/1/00, or the F protein of the prototype of B2, isolate
NL/1/94. The invention provides a F protein of a mammalian MPV
variant A2, wherein the amino acid sequence of the F protein is at
least 98%, at least 99% or at least 99.5% identical to the F
protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO:315). The invention provides a M2-1
protein of a mammalian MPV variant A2, wherein the M2-1 protein of
a mammalian MPV variant A2 is phylogenetically closer related to
the M2-1 protein of the prototype of variant A2, isolate NL/17/00,
than it is related to the M2-1 protein of the prototype of variant
B1, isolate NL/1/99, the M2-1 protein of the prototype of A1,
isolate NL/1/00, or the M2-1 protein of the prototype of B2,
isolate NL/1/94. The invention provides a M2-1 protein of a
mammalian MPV variant A2, wherein the amino acid sequence of the
M2-1 protein is at least 99%, or at least 99.5% identical to the
M2-1 protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO: 339). The invention provides a M2-2
protein of a mammalian MPV variant A2, wherein the M2-2 protein of
a mammalian MPV variant A2 is phylogenetically closer related to
the M2-2 protein of the prototype of variant A2, isolate NL/17/00,
than it is related to the M2-2 protein of the prototype of variant
B1, isolate NL/1/99, the M2-2 protein of the prototype of A1,
isolate NL/1/00, or the M2-2 protein of the prototype of B2,
isolate NL/1/94. The invention provides a M2-2 protein of a
mammalian MPV variant A2, wherein the amino acid sequence of the
M2-2 protein is at least 96%, at least 98%, at least 99% or at
least 99.5% identical to the M2-2 protein of a mammalian MPV
variant A2 as represented by the prototype NL/17/00 (SEQ ID
NO:347). The invention provides a SH protein of a mammalian MPV
variant A2, wherein the SH protein of a mammalian MPV variant A2 is
phylogenetically closer related to the SH protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the SH
protein of the prototype of variant B1, isolate NL/1/99, the SH
protein of the prototype of A1, isolate NL/1/00, or the SH protein
of the prototype of B2, isolate NL/1/94. The invention provides a
SH protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the SH protein is at least 84%, at least 85%, at least
90%, at least 95%, at least 98%, at least 99% or at least 99.5%
identical to the SH protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:383). The
invention provides a L protein of a mammalian MPV variant A2,
wherein the L protein of a mammalian MPV variant A2 is
phylogenetically closer related to the L protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the L
protein of the prototype of variant B1, isolate NL/1/99, the L
protein of the prototype of A1, isolate NL/1/00, or the L protein
of the prototype of B2, isolate NL/1/94. The invention provides a L
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the L protein is at least 99% or at least 99.5%
identical to the L protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:331).
[0460] The invention provides a G protein of a mammalian MPV
variant B2, wherein the G protein of a mammalian MPV variant B2 is
phylogenetically closer related to the G protein of the prototype
of variant B2, isolate NL/1/94, than it is related to the G protein
of the prototype of variant B1, isolate NL/1/99, the G protein of
the prototype of A1, isolate NL/1/00, or the G protein of the
prototype of A2, isolate NL/17/00. The invention provides a G
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant B2 as represented by the
prototype NL/1/94 (SEQ ID NO:325). The invention provides a N
protein of a mammalian MPV variant B2, wherein the N protein of a
mammalian MPV variant B2 is phylogenetically closer related to the
N protein of the prototype of variant B2, isolate NL/1/94, than it
is related to the N protein of the prototype of variant B1, isolate
NL/1/99, the N protein of the prototype of A1, isolate NL/1/00, or
the N protein of the prototype of A2, isolate NL/17/00. The
invention provides a N protein of a mammalian MPV variant B2,
wherein the amino acid sequence of the N protein is at least 99% or
at least 99.5% identical to the N protein of a mammalian MPV
variant B2 as represented by the prototype NL/1/94 (SEQ ID NO:369).
The invention provides a P protein of a mammalian MPV variant B2,
wherein the P protein of a mammalian MPV variant B2 is
phylogenetically closer related to the P protein of the prototype
of variant B2, isolate NL/1/94, than it is related to the P protein
of the prototype of variant B1, isolate NL/1/99, the P protein of
the prototype of A1, isolate NL/1/00, or the P protein of the
prototype of A2, isolate NL/17/00. The invention provides a P
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the P protein is at least 96%, at least 98%, or at
least 99% or at least 99.5% identical to the P protein of a
mammalian MPV variant B2 as represented by the prototype NL/1/94
(SEQ ID NO:377). The invention provides a M protein of a mammalian
MPV variant B2, wherein the M protein of a mammalian MPV variant B2
is phylogenetically closer related to the M protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
M protein of the prototype of variant B1, isolate NL/1/99, the M
protein of the prototype of A1, isolate NL/1/00, or the M protein
of the prototype of A2, isolate NL/17/00. The invention provides a
M protein of a mammalian MPV variant B2, wherein the amino acid
sequence of its M protein is identical to the M protein of a
mammalian MPV variant B2 as represented by the prototype NL/1/94
(SEQ ID NO:361). The invention provides a F protein of a mammalian
MPV variant B2, wherein the F protein of a mammalian MPV variant B2
is phylogenetically closer related to the F protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
F protein of the prototype of variant B1, isolate NL/1/99, the F
protein of the prototype of A1, isolate NL/1/00, or the F protein
of the prototype of A2, isolate NL/17/00. The invention provides a
F protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the F protein is at least 99% or at least 99.5%
identical to the F protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:317). The invention
provides a M2-1 protein of a mammalian MPV variant B2, wherein the
M2-1 protein of a mammalian MPV variant B2 is phylogenetically
closer related to the M2-1 protein of the prototype of variant B2,
isolate NL/1/94, than it is related to the M2-1 protein of the
prototype of variant B1, isolate NL/1/99, the M2-1 protein of the
prototype of A1, isolate NL/1/00, or the M2-1 protein of the
prototype of A2, isolate NL/17/00. The invention provides a M2-1
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the M2-1 protein is at least 98% or at least 99% or at
least 99.5% identical to the M2-1 protein of a mammalian MPV
variant B2 as represented by the prototype NL/1/94 (SEQ ID NO:341).
The invention provides a M2-2 protein of a mammalian MPV variant
B2, wherein the M2-2 protein of a mammalian MPV variant B2 is
phylogenetically closer related to the M2-2 protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
M2-2 protein of the prototype of variant B1, isolate NL/1/99, the
M2-2 protein of the prototype of A1, isolate NL/1/00, or the M2-2
protein of the prototype of A2, isolate NL/17/00. The invention
provides a M2-2 protein of a mammalian MPV variant B2, wherein the
amino acid sequence is at least 99% or at least 99.5% identical to
the M2-2 protein of a mammalian MPV variant B2 as represented by
the prototype NL/1/94 (SEQ ID NO:350). The invention provides a SH
protein of a mammalian MPV variant B2, wherein the SH protein of a
mammalian MPV variant B2 is phylogenetically closer related to the
SH protein of the prototype of variant B2, isolate NL/1/94, than it
is related to the SH protein of the prototype of variant B1,
isolate NL/1/99, the SH protein of the prototype of A1, isolate
NL/1/00, or the SH protein of the prototype of A2, isolate
NL/17/00. The invention provides a SH protein of a mammalian MPV
variant B2, wherein the amino acid sequence of the SH protein is at
least 84%, at least 85%, at least 90%, at least 95%, at least 98%,
or at least 99% or at least 99.5% identical to the SH protein of a
mammalian MPV variant B2 as represented by the prototype NL/1/94
(SEQ ID NO:385). The invention provides a L protein of a mammalian
MPV variant B2, wherein the L protein of a mammalian MPV variant B2
is phylogenetically closer related to the L protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
L protein of the prototype of variant B1, isolate NL/1/99, the L
protein of the prototype of A1, isolate NL/1/00, or the L protein
of the prototype of A2, isolate NL/17/00. The invention provides a
L protein of a mammalian MPV variant B2, wherein the and/or if the
amino acid sequence of the L protein is at least 99% or at least
99.5% identical to the L protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:333).
[0461] In certain embodiments, the percentage of sequence identity
is based on an alignment of the full length proteins. In other
embodiments, the percentage of sequence identity is based on an
alignment of contiguous amino acid sequences of the proteins,
wherein the amino acid sequences can be 25 amino acids, 50 amino
acids, 75 amino acids, 100 amino acids, 125 amino acids, 150 amino
acids, 175 amino acids, 200 amino acids, 225 amino acids, 250 amino
acids, 275 amino acids, 300 amino acids, 325 amino acids, 350 amino
acids, 375 amino acids, 400 amino acids, 425 amino acids, 450 amino
acids, 475 amino acids, 500 amino acids, 750 amino acids, 1000
amino acids, 1250 amino acids, 1500 amino acids, 1750 amino acids,
2000 amino acids or 2250 amino acids in length.
[0462] In certain, specific embodiments, the invention provides a G
protein of a mammalian MPV wherein the G protein has one of the
amino acid sequences set forth in SEQ ID NO:119-153; SEQ ID
NO:322-325 or a fragment thereof. In certain, specific embodiments,
the invention provides a F protein of a mammalian MPV wherein the F
protein has one of the amino acid sequences set forth in SEQ ID
NO:234-317. In certain, specific embodiments, the invention
provides a L protein of a mammalian MPV wherein the L protein has
one of the amino acid sequences set forth in SEQ IDNO:330-333 or a
fragment thereof. In certain, specific embodiments, the invention
provides a M2-1 protein of a mammalian MPV wherein the M2-1 protein
has one of the amino acid sequences set forth in SEQ ID NO:338-341
or a fragment thereof In certain, specific embodiments, the
invention provides a M2-2 protein of a mammalian MPV wherein the
M2-2 protein has one of the amino acid sequences set forth in SEQ
ID NO:346-349 or a fragment thereof. In certain, specific
embodiments, the invention provides a M protein of a mammalian MPV
wherein the M protein has one of the amino acid sequences set forth
in SEQ ID NO:358-361 or a fragment thereof. In certain, specific
embodiments, the invention provides a N protein of a mammalian MPV
wherein the N protein has one of the amino acid sequences set forth
in SEQ ID NO:366-369 or a fragment thereof. In certain, specific
embodiments, the invention provides a P protein of a mammalian MPV
wherein the P protein has one of the amino acid sequences set forth
in SEQ ID NO:374-377 or a fragment thereof. In certain, specific
embodiments, the invention provides a SH protein of a mammalian MPV
wherein the SH protein has one of the amino acid sequences set
forth in SEQ ID NO:382-385 or a fragment thereof.
[0463] In certain embodiments of the invention, a fragment is at
least 25 amino acids, 50 amino acids, 75 amino acids, 100 amino
acids, 125 amino acids, 150 amino acids, 175 amino acids, 200 amino
acids, 225 amino acids, 250 amino acids, 275 amino acids, 300 amino
acids, 325 amino acids, 350 amino acids, 375 amino acids, 400 amino
acids, 425 amino acids, 450 amino acids, 475 amino acids, 500 amino
acids, 750 amino acids, 1000 amino acids, 1250 amino acids, 1500
amino acids, 1750 amino acids, 2000 amino acids or 2250 amino acids
in length. In certain embodiments of the invention, a fragment is
at most 25 amino acids, 50 amino acids, 75 amino acids, 100 amino
acids, 125 amino acids, 150 amino acids, 175 amino acids, 200 amino
acids, 225 amino acids, 250 amino acids, 275 amino acids, 300 amino
acids, 325 amino acids, 350 amino acids, 375 amino acids, 400 amino
acids, 425 amino acids, 450 amino acids, 475 amino acids, 500 amino
acids, 750 amino acids, 1000 amino acids, 1250 amino acids, 1500
amino acids, 1750 amino acids, 2000 amino acids or 2250 amino acids
in length.
[0464] The invention further provides nucleic acid sequences
derived from a mammalian MPV. The invention also provides
derivatives of nucleic acid sequences derived from a mammalian MPV.
In certain specific embodiments the nucleic acids are modified.
[0465] In certain embodiments, a nucleic acid of the invention
encodes a G protein, a N protein, a P protein, a M protein, a F
protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L
protein of a mammalian MPV as defined above. In certain
embodiments, a nucleic acid of the invention encodes a G protein, a
N protein, a P protein, a M protein, a F protein, a M2-1 protein, a
M2-2 protein, a SH protein, or a L protein of subgroup A of a
mammalian MPV as defined above. In certain embodiments, a nucleic
acid of the invention encodes a G protein, a N protein, a P
protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein,
a SH protein, or a L protein of subgroup B of a mammalian MPV as
defined above. In certain embodiments, a nucleic acid of the
invention encodes a G protein, a N protein, a P protein, a M
protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein,
or a L protein of variant A1 of a mammalian MPV as defined above.
In certain embodiments, a nucleic acid of the invention encodes a G
protein, a N protein, a P protein, a M protein, a F protein, a M2-1
protein, a M2-2 protein, a SH protein, or a L protein of variant A2
of a mammalian MPV as defined above. In certain embodiments, a
nucleic acid of the invention encodes a G protein, a N protein, a P
protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein,
a SH protein, or a L protein of variant B1 of a mammalian MPV as
defined above. In certain embodiments, a nucleic acid of the
invention encodes a G protein, a N protein, a P protein, a M
protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein,
or a L protein of variant B2 of a mammalian MPV as defined
above.
[0466] In certain embodiments, the invention provides a nucleotide
sequence that is at least 50%, at least 55%, at least 60%, at least
65%, at least 70%, at least 75%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the nucleotide sequence of SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21. In certain
embodiments, the nucleic acid sequence of the invention, is at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at least 98%, at least 99%, or at least 99.5%
identical to a fragment of the nucleotide sequence of SEQ ID NO:18,
SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, wherein the fragment
is at least 25 nucleotides, at least 50 nucleotides, at least 75
nucleotides, at least 100 nucleotides, at least 150 nucleotides, at
least 200 nucleotides, at least 250 nucleotides, at least 300
nucleotides, at least 400 nucleotides, at least 500 nucleotides, at
least 750 nucleotides, at least 1,000 nucleotides, at least 1,250
nucleotides, at least 1,500 nucleotides, at least 1,750
nucleotides, at least 2,000 nucleotides, at least 2,00 nucleotides,
at least 3,000 nucleotides, at least 4,000 nucleotides, at least
5,000 nucleotides, at least 7,500 nucleotides, at least 10,000
nucleotides, at least 12,500 nucleotides, or at least 15,000
nucleotides in length. In a specific embodiment, the nucleic acid
sequence of the invention is at least 50%, at least 55%, at least
60%, at least 65%, at least 70%, at least 75%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, at least 98%,
at least 99%, or at least 99.5% or 100% identical to one of the
nucleotide sequences of SEQ ID NO:84-118; SEQ ID NO:154-233; SEQ ID
NO:318-321; SEQ ID NO:326-329; SEQ ID NO:334-337; SEQ ID
NO:342-345; SEQ ID NO:350-353; SEQ ID NO:354-357; SEQ ID
NO:362-365; SEQ ID NO:370-373; SEQ ID NO:378-381; or SEQ ID
NO:386-389.
[0467] In specific embodiments of the invention, a nucleic acid
sequence of the invention is capable of hybridizing under low
stringency, medium stringency or high stringency conditions to one
of the nucleic acid sequences of SEQ ID NO:18, SEQ ID NO:19, SEQ ID
NO:20, or SEQ ID NO:21. In specific embodiments of the invention, a
nucleic acid sequence of the invention is capable of hybridizing
under low stringency, medium stringency or high stringency
conditions to one of the nucleic acid sequences of SEQ ID
NO:84-118; SEQ ID NO:154-233; SEQ ID NO:318-321; SEQ ID NO:326-329;
SEQ If) NO:334-337; SEQ ID NO:342-345; SEQ ID NO:350-353; SEQ ID
NO:354-357; SEQ ID NO:362-365; SEQ ID NO:370-373; SEQ ID
NO:378-381; or SEQ ID NO:386-389. In certain embodiments, a nucleic
acid hybridizes over a length of at least 25 nucleotides, at least
50 nucleotides, at least 75 nucleotides, at least 100 nucleotides,
at least 150 nucleotides, at least 200 nucleotides, at least 250
nucleotides, at least 300 nucleotides, at least 400 nucleotides, at
least 500 nucleotides, at least 750 nucleotides, at least 1,000
nucleotides, at least 1,250 nucleotides, at least 1,500
nucleotides, at least 1,750 nucleotides, at least 2,000
nucleotides, at least 2,00 nucleotides, at least 3,000 nucleotides,
at least 4,000 nucleotides, at least 5,000 nucleotides, at least
7,500 nucleotides, at least 10,000 nucleotides, at least 12,500
nucleotides, or at least 15,000 nucleotides with the nucleotide
sequence of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID
NO:21.
[0468] The invention further provides antibodies and
antigen-binding fragments that bind specifically to a protein of a
mammalian MPV. An antibody of the invention binds specifically to a
G protein, a N protein, a P protein, a M protein, a F protein, a
M2-l protein, a M2-2 protein, a SH protein, or a L protein of a
mammalian MPV. In specific embodiments, the antibody is a human
antibody or a humanized antibody. In certain embodiments, an
antibody of the invention binds specifically to a G protein, a N
protein, a P protein, a M protein, a F protein, a M2-1 protein, a
M2-2 protein, a SH protein, or a L protein of a virus of subgroup A
of a mammalian MPV. In certain other embodiments, an antibody of
the invention binds specifically to a G protein, a N protein, a P
protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein,
a SH protein, or a L protein of a virus of subgroup B of a
mammalian MPV. In certain, more specific, embodiments, an antibody
of the invention binds specifically to a G protein, a N protein, a
P protein, a M protein, a F protein, a M2-1 protein, a M2-2
protein, a SH protein, or a L protein of a virus of variant Al of a
mammalian MPV. In other embodiments, the antibody of the invention
binds specifically to a G protein, a N protein, a P protein, a M
protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein,
or a L protein of a virus of subgroup A2 of a mammalian MPV. In
certain embodiments, an antibody of the invention binds
specifically to a G protein, a N protein, a P protein, a M protein,
a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L
protein of a virus of subgroup B1 of a mammalian MPV. In certain
other embodiments, an antibody of the invention binds specifically
to a G protein, a N protein, a P protein, a M protein, a F protein,
a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a
virus of subgroup B2 of a mammalian MPV. 6. Virus Isolation and
Characterization
6.1 EXAMPLE 1
Specimen Collection, Virus Isolation, Virus Characterization
[0469] Samples of nasopharyngeal aspirates were obtained from hosts
to assay for the presence of viruses, and also to characterize
those identified. Nasopharyngeal aspirates were collected from
children suffering from respiratory tract infection (RTI). In order
to determine the identity of the cause of illness, all
nasopharyngeal aspirates were tested by direct immmunofluorescence
assays (DIF) (See method in Example 9), using fluorescence labeled
antibodies against influenza virus types A and B, hRSV, and human
parainfluenza virus (hPIV) types 1, 2, and 3. Viruses were also
isolated from nasopharyngeal aspirates using rapid shell vial
techniques, (Rothbarth et. al., 1999, J of Virol. Methods
78:163-169) on various cell lines, including VERO cells, tertiary
cynomolgous monkey kidney (tMK) cells, human endothelial lung (HEL)
cells and marbin dock kidney (MDCK) cells. Samples showing
cytopathic effects (CPE) after two to three passages, that were
negative in DIF assays, were tested by indirect immunofluorescence
assays (IFA) (See method in Example 11), using virus specific
antibodies against influenza virus types A, B and C, hRSV types A
and B, measles virus, mumps virus, human parainfluenza virus (hPIV)
types 1 to 4, sendai virus, simian virus type 5, and New-Castle
disease virus. Although for many cases the aetiological agent could
be identified, some specimens were negative for all of the viruses
tested.
[0470] These 28 unidentified virus isolates grew slowly in tMK
cells, poorly in VERO cells and A549 cells and barely in MDCK or
chicken embryonated fibroblast cells. Most of the virus isolates
induced CPE on tMK cells, between days ten and fourteen. This was
somewhat later than the CPE caused by other viruses such as hRSV or
hPIV. The CPE were virtually indistinguishable from that caused by
hRSV or hPIV in tMK or other cell cultures, and were characterized
by syncytium formation. Some of the effects observed on the cells
included rapid internal disruption, followed by detachment of the
cells from the monolayer.
[0471] The supernatants of infected tMK cells were used for
Electron Microscopy (EM) analysis, and they revealed the presence
of paramyxovirus-like virus particles ranging from 150 to 600
nanometers in diameter, with short envelope projections ranging
from 13 to 17 nanometers. Consistent with the biochemical
properties of enveloped viruses such as the Paramyxoviridae family
of viruses, standard chloroform or ether treatment (Osterhaus et.
al., 1985, Arch. of Virol. 86:239-25) resulted in a greater than
10.sup.4 TCID.sub.50 reduction in infectivity of tMK cells.
Virus-infected tMK cell culture supernatants did not display
heamagglutinating activity with turkey, chicken and guinea pig
erythrocytes. During culture, the virus replication appeared to be
trypsin dependent. These combined virological data demonstrated
that the newly identified virus was a taxonomic member of the
Paramyxoviridae family.
[0472] RNA from tMK cells infected with 15 of the unidentified
virus isolates was extracted for use in reverse transcription and
polymerase chain reaction (RT-PCR) analyses, using primer-sets
specific for Paramyxovirinae (K. B. Chua et al., 2000, Science
288:1432-1435) such as: hPIV 1-4, sendai virus, simian virus type
5, New-Castle disease virus, HRSV, morbilli, mumps, Nipah, Hendra,
Tupaia and Mapuera viruses. RT-PCR assays were performed under
conditions of low stringency in order to detect potentially related
viruses. RNA isolated from homologous virus stocks was used as a
control. Whereas the available controls reacted positive with the
respective virus-specific primers, the newly identified virus
isolates did not react with any primer set, indicating the virus
was not closely related to the viruses tested.
[0473] Two of the virus-infected tMK cell culture supernatants were
used to inoculate guinea pigs and ferrets intranasally. Sera
samples were collected from these animals at day zero, two weeks,
and three weeks post inoculation. The animals displayed no clinical
symptoms, however, the seroconversion of all of the animals was
detected and measured in virus neutralization (VN) (See method in
Example 16) assays and indirect IFA against the homologous viruses.
The sera did not react in indirect IFA with any of the known
paramyxoviruses described above or with pneumovirus of mice (PVM).
The so far unidentified virus isolates were screened, using the
guinea pig and ferret pre-and post-infection sera. Of these, 28
were clearly positive by indirect IFA, with the post-infection sera
suggesting that, the thus far unidentified viral isolates, were
closely related or identical.
[0474] In order further characterize the virus, the phenotypic
effects of virus infection on a cell line was examined. In short,
tMK cells were cultured in 24 well plates containing glass slides
(Costar, Cambridge, UK), with the medium described below
supplemented with 10% fetal bovine serum (BioWhittaker, Vervier,
Belgium). Before inoculation, the plates were washed with PBS and
supplied with Eagle's MEM with Hanks' salt (ICN, Costa mesa,
Calif.), of which 0.5L was supplemented with 0.26 g of NaHCO.sub.3,
0.025 M Hepes (Biowhittaker), 2 mM L-glutamine (Biowhittaker), 100
units penicillin, 100 .mu.g streptomycin (Biowhittaker), 0.5 g
lactalbumin (Sigma-Aldrich, Zwijndrecht, The Netherlands), 1.0 g
D-glucose (Merck, Amsterdam, The Netherlands), 5.0 g peptone
(Oxoid, Haarlem, The Netherlands) and 0.02% trypsin (Life
Technologies, Bethesda, Md.). The plates were inoculated with the
supernatant of the nasopharyngeal aspirate samples (0.2 ml per well
in triplicate), followed by centrifuging at 840.times.g for one
hour. After inoculation, the plates were incubated at 37.degree. C.
for a maximum of 14 days, and the medium was changed once a week
while cultures were checked daily for CPE. After 14 days, the cells
were scraped from the second passage and incubated for 14 days.
This step was repeated for the third passage. The glass slides were
used to demonstrate the presence of the virus by indirect IFA as
described below.
[0475] CPE were generally observed after the third passage, between
days 8 to 14, depending on the isolate. The CPE were virtually
indistinguishable from that caused by hRSV or hPIV in tMK or other
cell cultures, except that hRSV induces CPE at around day 4. CPE
were characterized by syncytia formation, after which the cells
showed rapid internal disruption, followed by detachment of the
cells from the monolayer. For some isolates, CPE were difficult to
observe, and IFA was used to confirm the presence of the virus in
these cultures. The observation that the CPE were
indistinghuishable from those of other viruses indicated that
diagnosis could not be made from a visual examination of clinical
symptoms.
6.2 EXAMPLE 2
Seroprevalence in the Human Population
[0476] To study the seroprevalence of this virus in the human
population, sera from humans in different age categories were
analyzed by indirect IFA using tMK cells infected with one of the
unidentified virus isolates. Studies revealed that antibodies to
the virus could be detected in 25% of the children between six and
twelve months. Furthermore, by the age of five, nearly 100% of the
children were seropositive. In total, 56 sera samples examined by
indirect IFA and by VN assay. For 51 of the samples or 91%, the
results of the VN assay, i.e., a titer greater than 8, coincided
with the results obtained with indirect IFA, i.e., a titer greater
than 32. Four samples that were found to be positive by IFA, were
negative by the VN assay, i.e., titer less than 8, whereas one
serum sample was negative by IFA, i.e., titer less than 32, and was
positive by the VN test, i.e., a titer of 16 (FIG. 2).
[0477] IFA conducted on 72 sera samples taken from humans in 1958,
with ages ranging from 8-99 years, revealed a 100% seroprevalence
rate, indicating the virus has been circulating in the human
population for more than 40 years. In addition, a number of these
sera samples were used in VN assays to confirm the IFA data (FIG.
2). The seroprevalence data indicate that the virus has been a
significant source of infection in the human population for many
years.
[0478] The repeated isolation of this virus from clinical samples
from children with severe RTI indicates that the clinical and
economic impact of MPV may be high. New diagnostic assays based on
virus detection and serology would yield a more detailed analysis
of the incidence rate and also of the clinical and economical
impact of this viral pathogen.
[0479] The slight differences between the IFA and VN results (5
samples) may have been due to the fact that in the IFA, only IgG
serum antibodies were detected, whereas the VN assay detects both
classes and sub-classes of antibodies. Alternatively, differences
may have been due to the differences in sensitivity between both
assays. For IFA, a threshold value of 16 was used, whereas for VN a
value of 8 was used.
[0480] Differences between results in the IFA and VN assays may
also indicate possible differences between serotypes of this newly
identified virus. Since MPV seems to be most closely related to
APV, it was speculated that the human virus may have originated
from birds. Analysis of serum samples taken from humans in 1958
revealed that MPV has been widespread in the human population for
more then 40 years, indicating that a tentative zoonosis event must
have taken place long before 1958.
6.3 EXAMPLE 3
Genomic Sequence of HMPV Isolate 00-1
[0481] In order to obtain sequence information for the unknown
virus isolates, a random PCR amplification strategy known as
RAP-PCR (Welsh et. al., 1992, NAR 20:4965-4970) (See Example 19).
In short, tMK cells were infected with one of the virus isolates
(isolate 00-1) as well as with hPIV-1 that served as a positive
control. After both cultures displayed similar levels of CPE, virus
in the culture supernatants was purified on continuous 20-60%
sucrose gradients. The gradient fractions were inspected for
virus-like particles by EM, and RNA was isolated from the fraction
that contained approximately 50% sucrose, in which nucleocapsids
were observed. Equivalent amounts of RNA isolated from both virus
fractions were used for RAP-PCR, after which samples were run side
by side on a 3% NuSieve agarose gel. Twenty differentially
displayed bands specific for the unidentified virus were
subsequently purified from the gel, cloned in plasmid pCR2.1
(Invitrogen) and sequenced (See Example 20) with vector-specific
primers. A search for homologies against sequences in the Genbank
database, using the BLAST program available through the National
Library of Medicine, found that 10 out of 20 fragments displayed
resemblance to APV/TRTV sequences.
[0482] These 10 fragments were located in the genes coding for the
nucleoprotein (N; fragment 1 and 2), the matrix protein (M;
fragment 3), the fusion protein (F; fragment 4, 5, 6, 7) and the
polymerase protein (L; fragment 8, 9, 10) (FIG. 3). PCR primers
were designed to complete the sequence information for the 3' end
of the viral genome based on our RAP PCR fragments as well as
published leader and trailer sequences for the Pneumovirinae
(Randhawa, et.al., 1997, J Virol. 71:9849-9854). Three fragments
were amplified, of which fragment A spanned the extreme 3' end of
the N open reading frame (ORF), fragment B spanned the
phosphoprotein (F) ORF and fragment C closed the gap between the M
and F ORFs (FIG. 16). Sequence analyses of these three fragments
revealed the absence of NS1 and NS2 ORFs at the extreme 3' end of
the viral genome and positioning of the F ORF immediately adjacent
to the M ORF. This genomic organization resembled that of the
metapneumovirus APV, which was also consistent with the sequence
homology. Relation between different viruses could be deduced by
comparing the amino acid sequence of FIG. 4 with the amino acid
sequence of the respective N proteins of other viruses. Overall the
translated sequences for the N, P, M and F ORFs showed an average
of 30-33% homology with members of the genus Pneumovirus and 66-68%
with members of the genus Metapneumovirus. For the SH and G ORFs,
no discernable homology was found with members of either genera.
The amino acid homologies found for the amino acid sequence of the
N ORF showed about 40% homology with HRSV and 88% with APV-C, its
closest relative genetically. The amino acid sequence for the P ORF
showed about 25% homology with hRSV and about 66-68% with APV-C,
the M ORF showed about 36-39% with hRSV and about 87-89% with
APV-C, the F ORF showed about 40% homology with hRSV and about 81%
with APV-C, the M2-1 ORF showed about 34-36% homology with
pneumoviruses and 84-86% with APV-C, the M2-2 ORF showed 15-17%
homology with pneumoviruses and 56% with APV-C and the fragments
obtained from the L ORF showed an average of 44% with pneumoviruses
and 64% with APV-C.
[0483] Genetic analyses of the N, M, P and F genes revealed that
MPV has higher sequence homology to the recently proposed genus
Metapneumovirinae as compared to the genus Pneumovirinae and thus
demonstrates a genomic organization similar to and resembling that
of APV/TRTV. In contrast to the genomic organization of the RSVs
('3-NS1-NS2-N--P-M-SH-G-F-M2-L-5'), metapneumoviruses lack NS1 and
NS2 genes and also have a different genomic organization,
specifically between the M and L ('3-N-P-M-F-M2-SH-G-L-5') genes.
The lack of ORFs between the M and F genes in the virus isolates of
the invention, the lack of NS1 and NS2 adjacent to N, and the high
amino acid sequence homology found within APV led to the proposed
classification of MPV isolated from humans as the first member of
the Metapneumovirus genus of mammals, and more specifically of
humans.
[0484] Phylogenetic analyses revealed that the nine MPV isolates,
from which sequence information was obtained, are closely related.
Although sequence information was limited, they appeared to be more
closely related to one another than to any of the avian
metapneumoviruses. Of the four serotypes of APV that have been
described, serotype C appeared to be most closely related to MPV.
This conclusion was based upon the nucleotide sequence similarities
of the N, P, M and F genes. It should be noted however, that for
serotype D, only partial sequences of the F gene were available
from Genbank, and for serotype B, only M, N, and F sequences were
available. Our MPV isolates formed two clusters in phylogenetic
trees. For both hRSV and APV, different genetic and serological
subtypes have been described. Whether the two genetic clusters of
MPV isolates represent serogical subgroups that are also
functionally different remains unknown at present. Our serological
surveys showed that MPV is a common human pathogen.
6.4 EXAMPLE 4
Further Characterization of Associated Genes
[0485] Sequence analyses of the nucleoprotein (N), phosphoprotein
(P), matrixprotein (M) and fusion protein (F) genes of MPV revealed
the highest degree of sequence homology with APV serotype C, the
avian pneumovirus found primarily in birds in the United States.
These analyses also revealed the absence of non-structural proteins
NS1 and NS2 at the 3'end of the viral genome and positioning of the
fusion protein immediately adjacent to the matrix protein. The
sequences of the 22K (M2) gene, the small hydrophobic (SH) gene,
the attachment (G) gene, the polymerase (L) gene, the intergenic
regions, and the trailer sequences were determined. In combination
with the sequences described previously, the sequences presented
here completed the genomic sequence of MPV with the exception of
the extreme 12-15 nucleotides of the genomic termini and establish
the genomic organization of MPV. Side by side comparisons of the
sequences of the MPV genome with those of APV subtype A, B and C,
RSV subtype A and B, PVM and other paramyxoviruses provides strong
evidence for the classification of MPV in the Metapneuniovirus
genus.
[0486] GENE ENCODING THE NUCLEOPROTEIN (N): As shown above, the
first gene in the genomic map of MPV codes for a 394 amino acid
(aa) protein and shows extensive homology with the N protein of
other pneumoviruses. The length of the N ORF is identical to the
length of the N ORF of APV-C (Table 5) and is smaller than those of
other paramyxoviruses (Barr et al., 1991, J Gen Virol 72:677-85).
Analysis of the amino acid sequence revealed the highest homology
with APV-C (88%), and only 7-11% with other paramyxoviruses (Table
6).
[0487] Three regions of similarity between viruses belonging to the
order Mononegavirales were identified: A, B and C (FIG. 22) (Barr
et al., 1991, J Gen Virol 72: 677-85). Although similarities are
highest within a virus family, these regions are highly conserved
between virus families observed. In all three regions MPV revealed
97% aa sequence identity with APV-C, 89% with APV-B, 92% with
APV-A, and 66-73% with RSV and PYM. The region between aa residues
160 and 340 appears to be highly conserved among metapneumoviruses
and to a somewhat lesser extent the Pneumovirinae (Miyahara et al.,
1991, Arch Viral 124:255-68; Li et al., 1996, Virus Res 41:185-91;
Barr, 1991, J Gen Virol 72:677-85).
[0488] GENE ENCODING THE PHOSPHOPROTEIN (P): The second ORF in the
genome map codes for a 294 aa protein which shares 68% aa sequence
homology with the P protein of APV-C, and only 22-26% with the P
protein of RSV (Table 7). The P gene of MPV contains one
substantial ORF and in that respect is similar to P from many other
paramyxoviruses (Reviewed in Lamb et. al., Fields virology, (B. N.
Knipe, Hawley, P. M., ed., LippencottRaven), Philadelphia, 1996;
Sedlmeier et al., 1998, Adv Virus Res 50:101-39).
[0489] In contrast to APV A and B and PVM and similar to RSV and
APV-C the MPV P ORF lacks cysteine residues. A region of high
similarity between all pneumoviruses (amino acids 185-241) plays a
role in either the RNA synthesis process or in maintaining the
structural integrity of the nucleocapsid complex (Ling et al.,
1995, Virus Res 36:247-57). This region of high similarity is also
found in MPV (FIG. 6) especifically when conservative substitutions
are taken into account, showing 100% similarity with APYC, 93% with
APV-A and B, and approximately 81% with RSV. The C-terminus of the
MPV P protein is rich in glutamate residues as has been described
for APVs (Ling, et al., 1995, Virus Res 36:247-57).
[0490] GENE ENCODING THE MATRIX (M) PROTEIN: The third ORF of the
MPV genome encodes a 254 aa protein, which resembles the M ORFs of
other pneumoviruses. The M ORF of MPV has exactly the same size as
the M ORFs of other metapneumoviruses and shows high aa sequence
homology with the matrix proteins of APV (78-87%), lower homology
with those of iRSV and PVM (37-38%), and 10% or less homology with
those of other paramyxoviruses (Table 6).
[0491] The sequences of matrix proteins of all pneumoviruses were
compared and a conserved heptadpeptide at residue 14 to 19 was
found to also conserved in MPV (FIG. 7) (Easton et al 1997, Virus
Res, 48:27-33). For RSV, PVM and APV, small secondary ORFs within
or overlapping with the major ORF of M have been identified (52 aa
and 51 aa in bRSV, 75 aa in RSV, 46 aa in PVM and 51 aa in APV) (Yu
et al., 1992, Virology 186:426-34; Easton et al., 1997, Virus Res
48:27-33; Samal et al., 1991, J Gen Virol 72:715-20; Satake et al.,
1995, J Virol 50:92-9). One small ORF of 54 aa residues was found
within the major M ORF (fragment 1, FIG. 8), starting at nucleotide
2281 and one small ORF of 33 aa residues was found overlapping with
the major ORF of M starting at nucleotide 2893 (fragment 2, FIG.
8). Similar to the secondary ORFs of RSV and APV there is no
significant homology between these secondary ORFs and secondary
ORFs of the other pneumoviruses, and apparent start or stop signals
are lacking. Furthermore, there have not been any report of protein
synthesis occurring from these secondary ORFs.
[0492] GENE ENCODING THE FUSION PROTEIN: The F ORF of MPV is
located adjacent to the M ORF, a feature that is characteristic of
members of the Metapneuniovirus genus. The F gene of MPV encodes a
539 aa protein, which is two aa residues longer than F of APV-C.
Analysis of the aa sequence revealed 81% homology with APV-C, 67%
with APV-A and B, 33-39% with pneumovirus F proteins and only
10-18% with other paramyxoviruses (Table 6). One of the conserved
features among F proteins of paramyxoviruses, and also seen in MPV
is the distribution of cysteine residues (Morrison et al., 1988,
Virus Res 10:113-35; Yu et al, 1991, J. Gen Virol 72:75-81). The
metapneumoviruses share 12 cysteine residues in El (7 are conserved
among all paramyxoviruses), and two in E2 (1 is conserved among all
paramyxoviruses). Of the 3 potential N-linked glycosylation sites
present in the F ORF of MPV, none are shared with RSV and two
(position 74 and 389) are shared with APV. The third, unique,
potential N-linked glycosylation site for MPV is located at
position 206 (FIG. 9).
[0493] Despite the low sequence homology with other
paramyxoviruses, the F protein of MPV revealed typical fusion
protein characteristics consistent with those described for the F
proteins of other Paramyxoviridae family members (Morrison et. al.,
1988, Virus Res 10:113-35). F proteins of Paramyxoviridae members
are synthesized as inactive precursors (FO) that are cleaved by
host cell proteases which generate amino terminal E2 subunits and
large carboxy terminal Fl subunits. The proposed cleavage site
(Collins et al., Fields virology, (B. N. Knipe, Howley, P. M., ed.,
Lippencott-Raven), Philadelphia, 1996) is conserved among all
members of the Paramyxoviridae family. The cleavage site of MPV
contains the residues RQSR. Both arginine (R) residues are shared
with APV and RSV, but the glutamine (O) and serine (S) residues are
shared with other paramyxoviruses such as human parainfluenza virus
type 1, Sendai virus and morbilliviruses.
[0494] The hydrophobic region at the amino terminus of Fl is
thought to function as the membrane fusion domain and shows high
sequence similarity among paramyxoviruses and morbilliviruses and
to a lesser extent the pneumoviruses (Morrison et al., 1988, Virus
Res 10:113-35). These 26 residues (position 137-163, FIG. 9) are
conserved between MPV and APV-C, which is in agreement with this
region being highly conserved among the metapneumoviruses (Naylor
et al., 1998, J. Gen Virol 79:1393-1398; Seal et al., 2000, Virus
Res 66:139-47).
[0495] As is seen for the F2 subunits of APV and other
paramyxoviruses, MPV revealed a deletion of 22 aa residues compared
with RSV (position 107-128, FIG. 9). Furthermore, for RSV and APV,
the signal peptide and anchor domain were found to be conserved
within subtypes and displayed high variability between subtypes
(Plows et al., 1995, Virus Genes 11:37-45; Naylor et al., 1998, J.
Gen Virol 79:1393-1398). The signal peptide of MPV (aa 10-35, FIG.
9) at the amino terminus of F2 exhibits some sequence similarity
with APV-C (18 out of 26 aa residues are similar), and less
conservation with other APVs or RSV. Much more variability between
subtypes is seen in the membrane anchor domain at the carboxy
terminus of E1, although some homology is still seen with
APV-C.
[0496] GENE ENCODING THE M2 PROTEIN: The M2 gene is unique to the
Pneumovirinae and two overlapping ORFs have been observed in all
pneumoviruses. The first major ORF represents the M2-1 protein
which enhances the processivity of the viral polymerase (Collins et
al., 1995, Proc Natl Acad Sci USA 92:11563-7; Collins et. al.,
Fields virology (B. N. Knipe, Howley, P. M., ed.,
Lippencott-Raven), Philadelphia, 1996) and its readthrough of
intergenic regions (Hardy et al., 1998, J Virol 72:520-6; Feams et
al., 1999, J Virol 73:5852-64). The M2-1 gene for MPV, located
adjacent to the F gene, encodes a 187 aa protein, and reveals the
highest (84%) homology with M2-1 of APV-C. Comparison of all
pneumovirus M2-1 proteins revealed the highest conservation in the
amino-terminal half of the protein (Collins et al., 1990, J. Gen
Virol 71:3015-20; Zamora et al., 1992, J. Gen Virol 73:737-41;
Ahmadian et al., 1999, J. Gen Virol 80:2011-6), which is in
agreement with the observation that MPV displays 100% similarity
with APV-C in the first 80 aa residues of the protein (FIG. 10).
The MPV M2-l protein contains 3 cysteine residues located within
the first 30 aa residues that are conserved among all
pneumoviruses. Such a concentration of cysteines is frequently
found in zinc-binding proteins (Cuesta et al., 2000, Gen Virol:74,
9858-67).
[0497] The secondary ORFs (M2-2) that overlap with the M2-1 ORFs of
pneumoviruses are conserved in location but not in sequence and are
thought to be involved in the control of the switch between virus
RNA replication and transcription (Collins et al., 1985, J Virol
54:65-71; Elango et al., 1985, J Virol 55:101-10; Baybutt et. al.,
1987, J Gen Virol 68:2789-96; Collins et al., 1990, J. Gen Virol
71:3015-20; Ling et al., 1992, J. Gen Virol 73:1709-15; Zamora et
al., 1992, J. Gen Virol 73:737-41; Alansari et al., 1994, J. Gen
Virol:75:401-404; Ahmadian et al., 1999, J. Gen Virol 80: 2011-6).
For MPV, the M2-2 ORF starts at nucleotide 512 in the M2-1 ORF
(FIG. 8), which is exactly the same start position as for APV-C.
The length of the M2-2 ORFs are the same for APV-C and MPV, 71 aa
residues. Sequence comparison of the M2-2 ORF (FIG. 10) revealed
64% aa sequence homology between MPV and APV-C and only 44-48% aa
sequence homology between MPV and APV-A and B.
[0498] SMALL HYROPHOBIC (SH) GENE ORF: The gene located adjacent to
M2 of hMPV probably encodes a 183 aa SH protein (FIG. 8). There is
no discernible sequence identity between this ORF and other RNA
virus genes or gene products. This is not surprising since sequence
similarity between pneumovirus SH proteins is generally low. The aa
composition of the SH ORF is relatively similar to that of APV, RSV
and PVM, with a high percentage of threonine and serune residues
(22%, 18%, 19%, 20.0%, 21% and 28% for hMPV, APV, RSV A, RSV B,
bRSV and PVM respectively). The SH ORF of hMPV contains 10 cysteine
residues, whereas APV SH contains 16 cysteine residues. The SH ORF
of hMPV contains two potential N-linked glycosylation sites (aa 76
and 121), whereas APV has one, RSV has two or three and PVM has
four.
[0499] The hydrophilicity profiles for the putative hMPV SH protein
and SH of APV and RSV revealed similar characteristics (FIG. 11B).
The SH ORFs of APV and hMPV have a hydrophilic N-terminus, a
central hydrophobic domain which can serve as a potential membrane
spanning domain (aa 30-53 for hMPV), a second hydrophobic domain
(aa 155-170) and a hydrophilic C-terminus. In contrast, RSV SH
appears to lack the C-terminal part of the APV and hMPV ORFs. In
all pneumovirus SH proteins the hydrophobic domain is flanked by
basic aa residues, which are also found in the SH ORF for hMPV (aa
29 and 54).
[0500] GENE ENCODING THE ATTACHMENT GLYCOPROTEIN (G): The putative
G ORF of hMPV is located adjacent to the putative SH gene and
encodes a 236 as protein (nt 6262-6972, FIG. 8). A secondary small
ORF is found immediately following this ORF, potentially coding for
68 aa residues (nt 6973-7179) but lacking a start codon. A third
potential ORF in the second reading frame of 194 aa residues is
overlapping with both of these ORFs but also lacks a start codon
(nt 6416-7000). This ORF is followed by a potential fourth ORF of
65 aa residues in the same reading frame (nt 7001-7198), again
lacking a start codon. Finally, a potential ORF of 97 aa residues
(but lacking a start codon) is found in the third reading frame (nt
6444-6737, FIG. 8). Unlike the first ORF, the other ORFs do not
have apparent gene start or gene end sequences (see below).
Although the 236 aa G ORF probably represents at least a part of
the hMPV attachment protein it can not be excluded that the
additional coding sequences are expressed as separate proteins or
as part of the attachment protein through some RNA editing event.
It should be noted that for APV and RSV no secondary ORFs after the
primary G ORF have been identified but that both APV and RSV have
secondary ORFs within the major ORF of G. However, evidence for
expression of these ORFs is lacking and there is no sequence
identity between the predicted aa sequences for different viruses
(Ling et al., 1992, J Gen Virol 73:1709-15). The secondary ORFs in
hMPV G do not reveal characteristics of other G proteins and
whether the additional ORFs are expressed requires further
investigation.
[0501] BLAST analyses with all ORFs revealed no discernible
sequence identity at the nucleotide or aa sequence level with other
known virus genes or gene products. This is in agreement with the
low percentage sequence identity found for other G proteins such as
those of hRSV A and B (53%) (Johnson et al., 1987, J Virol
61:163-6) and APV A and B (38%) (Juhasz and Easton, 1994, J Gen
Virol 75:2873-80).
[0502] Whereas most of the hMPV ORFs resemble those of APV both in
length and sequence, the putative G ORF of 236 aa residues of hMPV
is considerably smaller than the G ORF of APV (Table 4). The aa
sequence revealed a serine and threonine content of 34%, which is
even higher than the 32% for RSV and 24% for APV. The putative G
ORF also contains 8.5% proline residues, which is higher than the
8% for RSV and 7% for APV. The unusual abundance of proline
residues in the G proteins of APV, RSV and hMPV has also been
observed in glycoproteins where it is a major determinant of the
proteins three dimensional structure (Collins and Wertz, 1983, PNAS
80:3208-12; Wertz et al., 1985, PNAS 82:4075-9; Jentoft, 1990,
Trends Biochem Sci 15:291-4.). The G ORF of hMPV contains five
potential N-linked glycosylation sites, whereas hRSV has seven,
bRSV has five and APV has three to five.
[0503] The predicted hydrophilicity profile of hMPV G revealed
characteristics similar to the other pneumoviruses. The N-tenminus
contains a hydrophilic region followed by a short hydrophobic area
(aa 33-53 for hMPV) and a mainly hydrophilic C-tenninus (FIG. 12B).
This overall organization corresponds well with regions in the G
protein of APV and RSV. The putative G ORF of hMPV contains only 1
cysteine residue in contrast to RSV and APV (5 and 20
respectively). Of note, only two of the four secondary ORFs in the
G gene contained one additional cysteine residue and these four
potential ORFs revealed 12-20% serine and threonine residues and
6-11% proline residues.
[0504] POLYMERASE GENE (L): In analogy to other negative strand
viruses, the last ORF of the MPV genome is the RNA-dependent RNA
polymerase component of the replication and transcription
complexes. The L gene of MPV encodes a 2005 aa protein, which is
one residue longer than the APV-A protein (Table 5). The L protein
of MPV shares 64% homology with APV-A, 42-44% with RSV, and
approximately 13% with other paramyxoviruses (Table 6). Six
conserved domains within the L proteins of non-segmented negative
strand RNA viruses were identified; it was found that the domain
three contained the four core polymerase motifs that are thought to
be essential for polymerase function (Poch et al., 1990, J Gen
Virol 71:1153-62; Poch et al., 1989, EMBO J 8:3867-74). These
motifs (A, B, C and D) are well conserved in the MPV L protein: in
motifs A, B and C: MPV shares 100% similarity with all
pneumoviruses and in motif D MPV shares 100% similaritywith APV and
92% with RSVs. For all of domain III (aa 627-903 in the L ORF), MPV
shares 77% identity with APV, 61-62% with RSV and 23-27% with other
pararnyxoviruses (FIG. 13). In addition to the polymerase motifs
the pneumovirus L proteins contain a sequence which conforms to a
consensus ATP binding motif K(X).sub.2,GEGAGN(X).sub.20K (Stec et
al., 1991, Virology 183:273-87). The MPV L ORF contains a similar
motif as APV, in which the spacing of the intermediate residues is
shifted by one residue: K(X).sub.22GEGAGN(X).sub.19K.
6TABLE 5 LENGTHS OF THE ORFs OF MPV AND OTHER PARAMYXOVIRUSES
N.sup.1 P M F M2-1 M2-2 SH G L MPV 394 294 254 539 187 71 183 236
2005 APV A 391 278 254 538 186 73 174 391 2004 APV B 391 279 254
538 186 73 ** 414 ** APV C 394 294 254 537 184 71 ** ** ** APV D **
** ** ** ** ** ** 389 ** hRSV 391 241 256 574 194 90 64 298 2165 A
hRSV B 391 241 249 574 195 93 65 299 2166 bRSV 391 241 256 569 186
93 81 257 2162 PVM 393 295 257 537 176 77 92 396 ** others.sup.3
418-542 225-709 335-393 539-565 **** **** **** **** 2183-2262
Legend for Table 5: * = length in amino acid residues, ** =
sequences not available, *** = others: human parainfluenza virus
type 2 and 3, Sendai virus, measles virus, nipah virus, phocine
distemper virus, and New Castle Disease virus, **** = ORF not
present in viral genome.
[0505]
7TABLE 6 AMINO ACID SEQUENCE IDENTITY BETWEEN THE ORFs OF MPV AND
THOSE OF OTHER PARAMYXOVIRUSES N P M F M2-1 M2-2 L APV A 69 55 78
67 72 26 64 APV B 69 51 76 67 71 27 ** APV C 88 68 87 81 84 56 **
hRSV 42 24 38 34 36 18 42 A hRSV B 41 23 37 33 35 19 44 bRSV 42 22
38 34 35 13 44 PVM 45 26 37 39 33 12 ** others.sup.3 7-11 4-9 7-10
10-18 **** **** 13-14 Legend for Table 6: * = No sequence
homologies were found with known G and SH proteins and were thus
excluded, ** = Sequences not available, *** = See list in table 4,
denoted by same (***), **** = ORF absent in viral genome.
6.5 EXAMPLE 5
Genomic Sequencing of HMPV Isolate 1-99
[0506] Another isolate of hMPV (1-99) was also identified and
sequenced. In order to do so, the hMPV isolate 1-99 was propagated
on tertiary monkey kidney cells exactly as described before (van
den Hoogen et al., 2001, Nature Medicine 7(6):719-724). Viral RNA
was isolated using the MagnaPure LC isolation system (Roche Applied
Science) and the total nucleic acid kit protocol. RNA was converted
into cDNA using standard protocols, with random hexamers (Progema
Inc. Leiden) as primers. This cDNA was kept at -20.degree. C. or
lower until used for sequence analysis. Primers used throughout
this project were based on the sequences available from the
prototype hMPV 1-00 strain, or obtained after sequence analysis
using the hMPV strain 1-99.
[0507] PCR fragments were made ranging in size up to 1600
base-pairs to generate overlapping fragments. Sequence analysis was
performed on the PCR fragments using standard technology and an ABI
3100 capillary sequence instrument (Applied Biosystems, Nieuwerkerk
Issel). The nucleotide sequences generated were compared initially
with the prototype hMPV strain 1-00 for comparison. Blast software
was used for comparison with related sequences in the GenBank
database. For further analysis of the sequences, DNASTAR software
was used (DNASTAR Inc, Madison Wis., U.S.A.) and for phylogenetic
analysis, the ClustalW software program was used.
[0508] Initially, sequences for the 1-99 isolate were obtained
using primers that were designed based on sequence information from
the 1-00 isolate. However, since some parts of the genome could not
be sequenced based on the information from the 1-00 isolate, new
primers based on sequence information from the 1-99 isolate, as
well from information made available through the sequencing of the
3' and 5'end of the 1-00 isolate, were used.
[0509] The prototype sequence of the hMPV isolate 1-99 contained
13,223 base-pairs, sequenced in a total of 227 individual
sequences, with an average length of 404 base-pairs. The sequence
is SEQ ID NO:18.
[0510] The length of the open reading frames of hMPV 1-99 and other
Paramyxoviruses, both in absolute size and percentage amino acid
identity are shown in Table 7. Most identity between the 1-99 and
1-00 strains was observed in the genes coding for N protein
(95.2%), M (97.3%), F (93.7%), L (94.1%) and M2-1 (94.1%) with
percentages homology of over 90%. The homology of the P and M2-2
genes between both strains was found to be 86.1 and 88.9%
respectively. Also, the isolate is mostly related to the subtype C
of the avian Metapneumovirus, with amino acid identities in the N
protein (88.6%), M protein (87.1%) and M2-1 protein (84.3%). The
identity with the P and M2-2 proteins is lower at 67.8% and 56.9%
respectively.
[0511] The genes of the prototype 1-00 and 1-99 strains are
identical on the genomic map, with the same number of amino acids
for N, P, M, F, M21 and M2-2 protein. The putative SH gene is 6
amino acids shorter, the G protein is 12 amino acids shorter, and
the L gene of the 1-00 and 1-99 strain are the same size.
[0512] Finally, the start of the genes on the genomic map and the
non-coding sequences located between the genes, have been
summarized in Table 8.
[0513] In summary, the sequence information of the 1-99 strain of
the human Metapneumovirus clearly demonstrates the genetic relation
of 1-99 with the prototype strain 1-00, sharing identical genomic
map organization. Less phylogenetic relation is observed with the
subtype C of APV.
8TABLE 7 LENGTH OF THE ORFS OF HMPV 1-99 AND OTHER PARAMYXOVIRUSES
(NO. OF AMINO ACID RESIDUES) N P M F M21 M22 SH G L 1-99 394 294
254 539 187 71 177 224 1937 1-00 394 294 254 539 187 71 183 236
2005 APV-A 391 278 254 538 186 73 174 391 2004 APV-B 391 279 254
538 186 73 414 APV-C 394 294 254 537 184 71 hRSV- 391 241 256 574
194 90 64 298 2165 A hRSV- 391 241 256 574 195 90 65 299 2166 B
bRSV 391 241 256 574 186 90 81 257 2162 PVM 393 295 257 537 176 98
92 396 PERCENTAGE OF THE AMINO ACID SEQUENCE IDENTITY BETWEEN HMPV
1-99 AND OTHER PARAMYXOVIRUSES N P M F M21 M22 SH G L 1-00 95.2
86.1 97.3 93.7 94.1 88.9 59 32.4 94.1 APV-A 68.9 58.1 76.1 67.5 69
25 13.1 14.2 63.7 APV-B 69.1 53.9 76.5 66.8 65.8 26.4 APV-C 88.6
67.8 87.1 80.5 84.3 56.9 bRSV 41.1 28.1 36.9 35 32.6 9.7 12.2 15.6
46.5 hRSV- 41.1 26 37.6 32.2 35.6 6.2 16 46.9 A hRSV- 40.6 26 36.9
34.4 34 13.9 21.2 15.6 47 B PVM 43.7 22.4 39.2 38.8 5.4 8
[0514]
9TABLE 8 SUMMARY OF GENE START SEQUENCES ON THE GENOMIC MAP AND THE
NON-CODING SEQUENCES LOCATED BETWEEN THE GENES. Pos. ORF Stop
Non-coding sequence Gene start Start Pos ORF 1 Le
ACGAGAAAAAAACGCGUAUAAAUUAAAU GGGACAAAUAAAA AUG 54 N UCCAAACAAAAC
1238 N UAA UUAAAAAACU GGGACAAGUCAAA AUG 1262 P 2146 P UAG
UUUAAUAAAAAUAAACAAU GGGACAAGUCAAG AUG 2179 M 2943 M UAA
AAAUAACUGUCUUAAUCAAUAAUUGCUU GGGACAAAUAAAA AUG 3065 F AUAUAACUCUAG
AGAUUAAUAAGCUUAUUAUUAUAGUUAU AUAAAAAUAAAU
UAGAAUUAGAAGGGCAUCAAUAGAAAGC 4684 F UAG UUAAUUAAAAAU GGGACAAAUCAUC
AUG 4711 M2 5437 M2 UAG UAAAAAAUAAAAAUAGAAU GGGAUAAAUGACA AUG 5470
SH 6003 SH UAA AAUAACACGGSUUUSAACAUUAAAAUSA GGGACAAGUGGCU AUG 6210
G GAACAACCUCCA CCCAGGUCUAUCAAUACAGUGGUUUAG CCAUUUAAAAACC
GAAUAUUAUCUAGGCUGCACGACACUUU GCAAUAAUAUGC
AAUAGUCAAUAGUUAAACCACUGCUGCA AACUCAUCCAUA
AUAUAAUCACUGAGUAAUACAAAACAAG AAAAU 6884 G UAG
AGAGGUGCAAAACUCAAAUGAGCACAAC GGGAUAAAUGACA AUG 7124 L ACACAAACAUYC
CAUCCAAGUAGUUAACAAAAAACCACAA AAUAACCUUGAA
AACCAAAAAACCAAAACAUAAAGCCAGA CCCAGAAAAACA
UAGACACCAUAUGGAAGGUUCUAGCAUA UGCACCAAUGAG
AUGGCAUCUGUUCAUGUAUCAAUAGCAC CACCAUCAUUCA
AGGAAUAAGAAGAGGGGAAAAUUUAA 13009 L UGA AUUAAACUAUGAUUUCUUUGAAGCAUUA
AUG 13243 Tr GAGAACACAUAC CCCAAUAUGAUCAAGCUUAUAGAUAAUU UGGGAAAUGCAG
AAAUAAAGAAACUAAUCMAGGUCMCUG GGUAUAUGGUUGU
GAGUAAGAAGUAAUAAUAAUGAUAAUGA UUAACCAUAAUC
UCMCMGMACUGAGAAAAUAAUCGUCUA ACAGUUUAGUUGA
UCAUUAGUUAUUUAAAAUUAUAAAAUAG UAACUA
6.6 EXAMPLE 6
Phylogenetic Relationships
[0515] Phylogenetic approaches can be used in order to identify the
relationships among groups of viruses, i.e. between MPV and other
viruses. Additionally, phylogenetic relationships can be determined
for different isolates of the same type of virus. Phylogenetic
trees were determined to determine relationships between MPV and
other viruses, and also to determine relationships between the
different isolates of hMPV. For example, phylogenetic trees can be
generated, using nucleotide or protein sequence data, in order to
illustrate the relationship between MPV and different viruses.
Alternatively, phylogenetic trees can be generated, using
nucleotide or protein sequence data, in order to illustrate the
relationship between various isolates of hMPV.
[0516] PHYLOGENETIC RELATIONSHIPS BETWEEN HMPV AND DIFFERENT
VIRUSES: Although BLAST searches using nucleotide sequences
obtained from the unidentified virus isolates revealed homologies
primarily with members of Pneumovirinae, homologies that were based
on protein sequences revealed some resemblance with other
paramyxoviruses as well. As an indication of the relationship
between the newly identified virus isolates and members of
Pneumovirinae, phylogenetic trees were constructed based on the N,
P, M and F ORFs of these viruses. In all four phylogenetic trees,
the newly identified virus isolate was most closely related to APV
(FIG. 14). From the four serotypes of APV that have been described
(Bayon-Auboyer et al., 2000, J Gen. Virol 81:2723-2733), APV
serotype C, the metapneumovirus found primarily in birds in the
USA, showed the closest resemblance to the newly identified virus.
It should be noted however, that only partial sequence information
for APV serotype D is available.
[0517] For all phylogenetic trees, DNA sequences were aligned using
the ClustalW software package and maximum likelihood trees were
generated using the DNA-ML software package of the Phylip 3.5
program using 50 or 100 bootstraps and 3 jumbles (Brandenburg et
al., 1997, J Med Virol 52:97-104). Previously published sequences
that were used for the generation of phylogenetic trees are
available from Genbank under accessions numbers: For all ORFs:
HRSV: NC001781; bRSV: NC001989; For the F ORF: PYM, D11 128; MV-A,
D00850; MV-B, Y14292; MV-C, AF187152; For the N ORF: PVM, D10331;
MV-A, U39295; MV-B, U39296; MV-C, M176590; For the M ORF:
PMV,U66893; MV-A, X58639; MV-B, U37586; MV-C, AE262571; For the P
ORF: PVM, 09649; MV-A, U22110, MV-C, AF176591.
[0518] As an indicator of the relationship between MPV and members
of the Pneumovirinae, phylogenetic trees based on the N, P, M, and
F ORFs were constructed previously (van den Hoogen et al., 2001,
Nat Med 7(6):19-24) and revealed a close relationship between MPV
and APV-C. Because of the low homology of the MPV SH and G genes
with those genes of other paramyxoviruses, reliable phylogenetic
trees for these genes cannot be constructed. In addition, the
distinct genomic organization between members of the Pneunmovirus
and Metapneumovirus genera make it impossible to generate
phylogenetic trees based on the entire genomic sequence. Trees for
the M2 and L genes were constructed in addition to those previously
published. Both these trees confirmed the close relation between
APV and MPV within the Pneumovirii ae subfamily (FIG. 15).
[0519] To construct phylogenetic trees, DNA sequences were aligned
using the ClustalW software package and maximum likelihood trees
were generated using the DNA-ML software package of the Phylip 3.5
program using 100 bootstraps and 3 jumbles. Bootstrap values were
computed for consensus trees created with the PHYLIP consensus
package.
[0520] Based upon phylogenetic analyses of the different isolates
of hMPV obtained so far, two major genotypes have been identified
with virus isolate 00-1 being the prototype of genotype A and
isolate 99-1 the prototype of genotype B.
[0521] It is hypothesized that the genotypes are related to
subtypes and that re-infection with viruses from both subgroups
occur in the presence of pre-existing immunity and the antigenic
variation may not be strictly required to allow re-infection.
Furthermore, HMPV appears to be closely related to avian
pneumovirus, a virus primarily found in poultry. The nucleotide
sequences of both viruses show high percentages of homology, with
the exception of the SH and G proteins. The viruses appear to
cross-react in tests that are based primarily on the nucleoprotein
and matrixprotein, however, they respond differently in tests that
are based on the attachment proteins. The differences in virus
neutralization titer provide further proof that the two genotypes
of hMPV are two different serotypes of one virus, where APV is a
different virus.
[0522] PHYLOGENETIC RELATIONSHIPS BETWEEN DIFFERENT HMPV ISOLATES:
Phylogenetic approaches can also be used in order to identify the
relationships among different isolates of MPV. For example,
phylogenetic trees can be generated, using nucleotide or protein
sequence data of MPV, in order to illustrate the relationship
between a number of MPV isolates that are obtained from different
subjects. This approach is useful in understanding the differences
that occur within the population of MPV viruses.
[0523] To determine the relationship of our various newly
identified virus isolates, phylogenetic trees were constructed
based on sequence information obtained from eight to nine isolates
(8 for F, 9 for N, M and L). RT-PCR was used with primers designed
to amplify short fragments in the N, M, F, P, SH and L ORFs, that
were subsequently sequenced directly. The nine virus isolates that
were previously found to be related in serological terms (see
above) were also found to be closely related genetically. In fact,
all nine isolates were more closely related to one another than to
APV. Although the sequence information used for these phylogenetic
trees was limited, it appears that the nine isolates can be divided
in two groups, with isolate 94-1, 99-1 and 99-2 clustering in one
group and the other six isolates (94-2; 93-1; 93-2; 93-3; 93-4;
00-1) in the other (FIG. 16).
[0524] An alignment of the F genes of different isolates of hMPV of
all four variants, variant A1, A2, B1, or B2, is shown in FIG.
17.
[0525] An alignment of the F proteins of different isolates of hMPV
of all four variants, variant A1, A2, B1, or B2, is shown in FIG.
18.
[0526] An alignment of the G genes of different isolates of hMPV of
all four variants, variant A1, A2, B1, or B2, is shown in FIG.
19.
[0527] An alignment of the G proteins of different isolates of hMPV
of all four variants, variant A1, A2, B1, or B2, is shown in FIG.
20.
[0528] A phylogenetic tree based on the F gene sequences showing
the phylogenetic relationship of the different hMPV isolates and
their association with the respective variants of hMPV is shown in
FIG. 21. Further, a phylogenetic tree based on the G gene sequences
showing the phylogenic relationship of the different HMPV isolates
and their association with the respective variants of hMPV is shown
in FIG. 22. The phylogenetic trees were calculated using DNA
maximum likelihood with 50 bootstraps and 3 jumbles.
[0529] Sequence identities between different genes of hMPV isolate
00-1 with different genes of hMPV isolate 99-1, APV serotype C, and
APV serotype A are listed in Table 9.
10TABLE 9 ORF SEQUENCE IDENTITY BETWEEN HMPV ISOLATE 00-1 AND OTHER
VIRUSES N P M F M2.1 M2.2 SH G L hMPV isolate 95 86 98 94 95 90 57
33 94 99-1 APV serotype 88 68 87 81 84 56 N.A. N.A. N.A. C APV
serotype 69 55 78 68 72 25 18 9 64 A
[0530] Originally, phylogenetic relationships were inferred for
only nine different isolates. Two potential genetic clusters were
identified by analyses of partial nucleotide sequences in the N, M,
F and L ORFs of virus isolates. Nucleotide identity of 90-100% was
observed within a cluster, and 81-88% identity was observed between
the clusters. Sequence information obtained on more virus isolates
confirmed the existence of two genotypes. Virus isolate 00-1, as a
prototype of cluster A, and virus isolate 99-1 as a prototype of
cluster B, have been used in cross neutralization assays to test
whether the genotypes are related to different serotypes or
subgroups.
[0531] Using RT-PCR assays with primers located in the polymerase
gene, thirty additional virus isolates were identified from
nasopharyngeal aspirate samples. Sequence information of parts of
the matrix and polymerase genes of these new isolates together with
those of the previous nine isolates were used to construct
phylogenetic trees (FIG. 15). Analyses of these trees confirmed the
presence of two genetic clusters, with virus isolate 00-1, as the
prototype virus in group A and virus isolate 99-1 as the prototype
virus in group B. The nucleotide sequence identity within a group
was more than 92%, while between the clusters the identity was
81-85%.
6.7 EXAMPLE 7
Leader Sequences of Human Metapneumovirus (HMPV) NL/1/00 Genomic
RNA
[0532] While the majority of genomic composition was determined,
the authentic terminal sequences at the extreme ends were lacking.
Using ligation of the viral RNA and subsequent PCR amplification of
the ligated junction and a combination of polyadenylation and 3'
RACE methods, the authentic nucleotide sequences were determined
(FIG. 54). The sequence analysis of PCR fragments generated by
ligation of viral RNA ends revealed the Leader and Trailer
sequences displayed in FIG. 26 (See, SEQ IDs 18-21). The trailer
sequences obtained this way were consistent with the sequences
expected from the trailer sequences of other pramyxoviruses,
including APV. However, the leader sequence of only 2 out of 71
clones sequenced, contained AC as the terminal nucleotide residues
that are found in all paramyxoviruses to date. Therefore, the
terminal nucleotide sequences of the hMPV/NL/1/00 leader were
subsequently confirmed using a combination of polyadenylation and
3' RACE methods. Furthermore, two extra nucleotides at the 3'
leader terminus of hMPV NL/1/00 were identified.
[0533] Vero-grown hMPV NL/1/00 virus was used in this study. As a
control, a related negative sense RNA virus, respiratory syncytial
virus (RSV) A2, that has a similar genomic size with identified
terminal sequences, was included. Viral RNA was isolated using the
QIAamp Viral RNA Mini Kit (Qiagen), following the manufacturer's
instructions.
[0534] Viral RNA was polyadenylated by incubating the viral RNA
with poly (A) polymerase (Ambion) at 37.degree. C. for 1 hr,
followed by clean up using a NucAway spin column (Ambion). The
viral RNA was then reverse transcribed using a primer complementary
to the poly (A) tail region and the reverse transcriptase,
Superscript I (Invitrogen). PCR and Nested PCR reactions were
carried out using hMPV specific primers, juxtaposed to the terminal
ends, to amplify the desired products with expected sizes for
sequencing analysis. PCR products were further cloned into pCRII
vector using a TA cloning kit (Invitrogen). To reveal the authentic
nucleotide sequences for the terminus, direct sequencing of PCR DNA
as well as the cloned PCR products were conducted.
[0535] Only hMPV data are shown in FIG. 55. Control experiments,
using RSV-A2 RNA, indicated that the leader sequences of RSV-A2
remained intact and detectible with the same approach. Sequencing
analyses on PCR products directly (FIG. 55) and on PCR clones both
indicated that the leader region of hMPV consisted of 5' ACG CGA
AAA AAA CGC GTA TA (expressed as positive sense cDNA orientation)
at the 3' most proximal 20 nucleotides in the leader sequence. The
two newly identified nucleotides are underlined in FIG. 101.
6.8 EXAMPLE 8
Serotyping and Subgrouping of MPV Isolates
[0536] Virus neutralization assays (See, e.g., Example 16) were
used to determine if the virus isolates of hMPV could be
distingushed by serotype or genotype. Virus isolates 00-1 and 99-1
were used to inoculate ferrets in order to raise virus-specific
antisera. For the 00-1 isolate, ferret and guinea pig specific
antisera for the virus were generated by experimental intranasal
infection of two specific pathogen free ferrets and two guinea
pigs, housed in separate pressurized glove boxes. Two to three
weeks later all the animals were bled by cardiac puncture, and
their sera were used as reference sera. The sera were tested for
all previous described viruses with indirect IFA as described
below. These antisera, along with antisera prepared using the 99-1
isolate, were used in virus neutralization assays with both viruses
(Table 10).
11TABLE 10 VIRUS NEUTRALIZATION TITERS ISOLATE ISOLATE 00-1 99-1
PRESERUM FERRET A 2 2 (00-1) FERRET A 22 DPI (00-1) 64 2 PRESERUM
FERRET B 2 2 (99-1) FERRET B 22 DPI 4 64 (99-1) For isolate 00-1
the titer differs 32 (64/2) fold For isolate 99-1 the titer differs
16 (64/4) fold
[0537] In addition, six guinea pigs were inoculated with either one
of the viruses, i.e., 00-1 and 99-1). RT-PCR assays on
nasopharyngeal aspirate samples showed virus replication from day 2
through day 10 post infection. At day 70 post infection the guinea
pigs were challenged with either the homologous or the heterologous
virus, and in all four cases virus replication was noticed.
[0538] Virus neutralization assays with anti sera after the first
challenge showed essentially the same results as in the VN assays
performed with the ferrets (>16-fold difference in VN
titer).
[0539] The results presented in this example confirm the existence
of two genotypes, that correspond to two serotypes of MPV, and show
the possibility of repeated infection with heterologous and
homologous virus (Table 11).
12 TABLE 11 primary secondary virus infection virus replication
infection replication guinea pig 1-3 00-1 2 out of 3 99-1 1 out of
2 guinea pig 4-6 00-1 3 out of 3 00-1 1 out of 3 guinea pig 7-9
99-1 3 out of 3 00-1 2 out of 2 guinea pig 10-12 99-1 3 out of 3
99-1 1 out of 3 Note: for the secondary infection guinea pig 2 and
9 were not there any more.
[0540] 7. Diagnostic Assays/Detection Methods
7.1 EXAMPLE 9
Direct Immunofluoresence Assay (DIF) Method
[0541] Nasopharyngeal aspirate samples from patients suffering from
RTI were analyzed by DIF as described (Rothbarth et. al., 1999, J.
of Virol. Methods 78:163-169). Samples were stored at -70.degree.
C. In short, nasopharyngeal aspirates were diluted with 5 ml
Dulbecco MEM (BioWhittaker, Walkersville, Md.) and thoroughly mixed
on a vortex mixer for one minute. The suspension was centrifuged
for ten minutes at 840.times.g. The sediment was spread on a
multispot slide (Nutacon, Leimuiden, The Netherlands) and the
supernatant was used for virus isolation. After drying, the cells
were fixed in acetone for one minute at room temperature. After the
slides were washed, they were incubated for 15 minutes at
37.degree. C. with commercially available FITC-labeled anti-sera
specific for viruses such as influenza A and B, hRSV and hPIV 1 to
3 (Dako, Glostrup, Denmark). After three washings in PBS and one in
tap water, the slides were submerged in a glycerol/PBS solution
(Citifluor, UKO, Canterbury, UK) and covered. The slides were then
analyzed using a Axioscop fluorescence microscope.
7.2 EXAMPLE 10
Virus Culture of MPV
[0542] The detection of the virus in a cultivated sample from a
host is a direct indication of the host's current and/or past
exposure or infection with the virus.
[0543] Samples that displayed CPE after the first passage were used
to inoculate sub-confluent mono-layers of tMK cells in media in 24
well plates. Cultures were checked for CPE daily and the media was
changed once a week. Since CPE differed for each isolate, all
cultures were tested at day 12 to 14 with indirect IFA using ferret
antibodies against the new virus isolate. Positive cultures were
freeze-thawed three times, after which the supernatants were
clarified by low-speed centrifugation, aliquoted and stored frozen
at -70.degree. C. The 50% tissue culture infectious doses
(TCID.sub.50) of virus in the culture supernatants were determined
as described (Lennette, D. A. et al. In: DIAGNOSTIC PROCEDURES FOR
VIRAL, RICKETTSIAL, AND CHLAMYDIAL INFECTIONS, 7th ed. (eds.
Lennette, E. H., Lennette, D. A. & Lennette, E. T.) 3-25;
37-138; 431-463; 481-494; 539-563 (American Public Health
Association, Washington, 1995)).
7.3 EXAMPLE 11
Antigen Detection by Indirect Immunofluoresence Assays (IFA)
[0544] Antibodies can be used to visualize viral proteins in
infected cells or tissues. Indirect immunofluorescence assay (IFA)
is a sensitive approach in which a second antibody coupled to a
fluorescence indicator recognizes a general epitope on the
virus-specific antibody. IFA is more advantageous than DIF because
of its higher level of sensitivity.
[0545] In order to perform the indirect IFA, collected specimens
were diluted with 5 ml Dulbecco MEM medium (BioWhittaker,
Walkersville, Md.) and thoroughly mixed on a vortex mixer for one
minute. The suspension was then centrifuged for ten minutes at
840.times.g. The sediment was spread on a multispot slide. After
drying, the cells were fixed in acetone for 1 minute at room
temperature. Alternatively, virus was cultured on tMK cells in 24
well slides containing glass slides. These glass slides were washed
with PBS and fixed in acetone for 1 minute at room temperature.
[0546] Two indirect IFAs were performed. In the first indirect IFA,
slides containing infected tMK cells were washed with PBS, and then
incubated for 30 minutes at 37.degree. C. with virus specific
antisera. Monoclonal antibodies against influenza A, B and C, IIPIV
type 1 to 3, and hRSV were used. For hPIV type 4, mumps virus,
measles virus, sendai virus, simian virus type 5, and New-Castle
Disease virus, polyclonal antibodies (RIVM) and ferret and guinea
pig reference sera were used. After three washings with PBS and one
wash with tap water, the slides were stained with secondary
antibodies directed against the sera used in the first incubation.
Secondary antibodies for the polyclonal antisera were
goat-anti-ferret (KPL, Guilford, UK, 40 fold diluted),
mouse-anti-rabbit (Dako, Glostrup, Denmark, 20 fold diluted),
rabbit-anti-chicken (KPL, 20 fold dilution) and mouse-anti-guinea
pig (Dako, 20 fold diluted).
[0547] In the second IFA, after washing with PBS, the slides were
incubated for 30 minutes at 37.degree. C. with 20 polyclonal
antibodies at a dilution of 1:50 to 1:100 in PBS. Immunized ferrets
and guinea pigs were used to obtain polyclonal antibodies, but
these antibodies can be raised in various animals, and the working
dilution of the polyclonal antibody can vary for each immunization.
After three washes with PBS and one wash with tap water, the slides
were incubated at 37.degree. C. for 30 minutes with FITC labeled
goat-anti-ferret antibodies (KPL, Guilford, UK, 40 fold diluted).
After three washes in PBS and one in tap water, the slides were
included in a glycerol/PBS solution (Citifluor, UKO, Canterbury,
UK) and covered. The slides were analyzed using an Axioscop
fluorescence microscope (Carl Zeiss B. V., Weesp, the
Netherlands).
7.4 EXAMPLE 12
Haemagglutination Assays, Chloroform Sensitivity Tests and Electron
Microscopy
[0548] Different characteristics of a virus can be utilized for the
detection of the virus. For example, many virus contain proteins
that can bind to erythrocytes resulting in a lattice. This property
is called hemagglutination and can be used in hemagglutination
assays for detection of the virus. Virus may also be visualized
under an electron microscope (EM) or detected by PCR
techniques.
[0549] Hemagglutination assays and chloroform sensitivity tests
were performed as described (Osterhaus et al., 1985, Arch.of Virol
86:239-25; Rothbarth et al., J of Virol Methods 78:163-169).
[0550] For EM analyses, virus was concentrated from infected cell
culture supernatants in a micro-centrifuge at 4.degree. C. at
17000.times.g, after which the pellet was resuspended in PBS and
inspected by negative contrast EM.
7.5 EXAMPLE 13
Detection of hMPV/AVP Antibodies of IgG, IgA and IgM Classes
[0551] Specific antibodies to viruses rise during the course of
infection/illness. Thus, detection of virus-specific antibodies in
a host is an indicator of current and/or past infections of the
host with that virus.
[0552] The indirect enzyme immunoassay (EIA) was used to detect the
IgG class of hMPV antibodies. This assay was performed in
microtitre plates essentially as described previously (Rothbarth et
al., 1999, J. of Vir. Methods 78:163-169). Briefly, concentrated
hMPV was solubilized by treatment with 1% Triton X-100. After
determination of the optimal working dilution by checkerboard
titration, it was coated for 16 hr at room temperature into
microtitre plates in PBS. Subsequently, 100 ul volumes of 1:100
diluted human serum samples in EIA buffer were added to the wells
and incubated for 1 hour at 37.degree. C. Binding of human IgG was
detected by adding a goat anti-human IgG peroxidase conjugate
(Biosource, USA), adding TMB as substrate developed plates and
Optical Density (OD) was measured at 450 nm. The results were
expressed as the S(ignal)/N(egative) ratio of the OD. A serum was
considered positive for IgG if the S/N ratio was beyond the
negative control plus three times the standard.
[0553] The hMPV antibodies of the IgM and IgA classes were detected
in sera by capture ELIA essentially as described previously
(Rothbarth et al., 1999, J Vir Methods 78:163-169). For the
detection of IgA and IgM, commercially available microtiter plates
coated with anti human IgM or IgA specific monoclonal antibodies
were used. Sera were diluted 1: 100. After incubation of 1 hour at
37.degree. C., an optimal working dilution of hMPV was added to
each well (100 .mu.l) before incubation for 1 hour at 37.degree. C.
After washing, polyclonal anti-hMPV antibody labeled with
peroxidase was added, and the plate was incubated 1 hour at
37.degree. C. Adding TMB as a substrate the plates were developed,
and OD was measured at 450 rim. The results were expressed as the
S(ignal)/N(egative) ratio of the OD. A positive result was
indicated for IgG when the S/N ratio was beyond the negative
control plus three times the standard.
[0554] AVP antibodies were detected in an AVP inhibition assay. The
protocol for the APV inhibition test is included in the APV-Ab
SVANOVIR.RTM. enzyme immunoassay that is manufactured by SVANOVA
Biotech AB, Uppsala Science Park Glunten SE-751 83 Uppsala Sweden.
The results were expressed as the S(ignal)/N(egative ratio of the
OD. A serum was considered positive for IgG, if the S/N ratio was
beyond the negative control plus three times the standard.
7.6 EXAMPLE 14
Detection of Antibodies in Humans, Mammals, Ruminants or Other
Animals by Indirect IFA
[0555] For the detection of virus specific antibodies, infected tMK
cells with MPV were fixed with acetone on coverslips (as described
above), washed with PBS and incubated 30 minutes at 37.degree. C.
with serum samples at a 1 to 16 dilution. After two washes with PBS
and one with tap water, the slides were incubated for 30 minutes at
37.degree. C. with FITC-labeled secondary antibodies to the species
used (Dako). Slides were processed as described above.
[0556] Antibodies can be labeled directly with a fluorescent dye,
which will result in a direct immunofluorescence assay. FITC can be
replaced with any fluorescent dye.
7.7 EXAMPLE 15
Detection of Antibodies in Humans, Mammals, Ruminants or Other
Animals by Elisa
[0557] In Paramyxoviridae, the N protein is the most abundant
protein, and the immune response to this protein occurs early in
infection. For these reasons, a recombinant source of the N
proteins is preferably used for developing an ELISA assay for
detection of antibodies to MPV. Antigens suitable for antibody
detection include any MPV protein that combines with any
MPV-specific antibody of a patient exposed to or infected with MPV
virus. Preferred antigens of the invention include those that
predominantly engender the immune response in patients exposed to
MPV, thus, typically are recognized most readily by antibodies of a
patient. Particularly preferred antigens include the N, F, M and G
proteins of MPV. Antigens used for immunological techniques can be
native antigens or can be modified versions thereof. Well known
techniques of molecular biology can be used to alter the amino acid
sequence of a MPV antigen to produce modified versions of the
antigen that may be used in immunologic techniques.
[0558] Methods for cloning genes, for manipulating the genes to and
from expression vectors, and for expressing the protein encoded by
the gene in a heterologous host are well-known, and these
techniques can be used to provide the expression vectors, host
cells, and the for expressing cloned genes encoding antigens in a
host to produce recombinant antigens for use in diagnostic assays.
See e.g., MOLECULAR CLONING, A LABORATORY MANUAL AND CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY.
[0559] A variety of expression systems may be used to produce MPV
antigens. For instance, a variety of expression vectors suitable to
produce proteins in E. Coli, B. subtilis, yeast, insect cells, and
mammalian cells have been described, any of which might be used to
produce a MPV antigen suitable to detect anti-MPV antibodies in
exposed patients.
[0560] The baculovirus expression system has the advantage of
providing necessary processing of proteins, and is therefor
preferred. The system utilizes the polyhedrin promoter to direct
expression of MPV antigens. (Matsuura et al., 1987, J. Gen.Virol.
68:1233-1250).
[0561] Antigens produced by recombinant baculo-viruses can be used
in a variety of immunological assays to detect anti-MPV antibodies
in a patient. It is well established that recombinant antigens can
be used instead of natural virus in practically any immunological
assay for detection of virus specific antibodies. The assays
include direct and indirect assays, sandwich assays, solid phase
assays such as those using plates or beads among others, and liquid
phase assays. Assays suitable include those that use primary and
secondary antibodies, and those that use antibody binding reagents
such as protein A. Moreover, a variety of detection methods can be
used in the invention, including calorimetric, fluorescent,
phosphorscent, chemiluminescent, luminescent and radioactive
methods.
[0562] For example, an indirect IgG EIA using a recombinant N
protein (produced with recombinant baculo-vuus in insect (Sf9)
cells) as antigen can be performed. For antigen preparation, Sf9
cells are infected with the recombinant baculovirus and harvested
3-7 days post infection. The cell suspension is washed twice in
PBS, pH 7.2, adjusted to a cell density of 5.0.times.10.sup.6
cells/ml, and freeze-thawed three times. Large cellular debris is
pelleted by low speed centrifugation (500.times.g for 15 minutes)
and the supernatant is collected and stored at -70.degree. C. until
use. Uninfected cells are processed similarly for negative control
antigen.
[0563] Once the antigen is prepared, 100 .mu.l of a freeze-thaw
lysate is used to coat microtiter plates at dilutions ranging from
1:50 to 1:1000. An uninfected cell lysate is run in duplicate wells
and serves as a negative control. After incubation overnight,
plates are washed twice with PBS/0.05% Tween. Test sera are diluted
1:50 to 1:200 in ELISA buffer (PBS, supplemented to 2% with nonmal
goat sera, and with 0.5% bovine serum albumin and 0.1% milk),
followed by incubation wells for 1 hour at 37.degree. C.
[0564] Plates are washed two times with PBS/0.05% Tween.
Horseradish peroxidase labeled goat anti-human (or against other
species) IgG, diluted 1:3000 to 1:5000 in ELISA buffer, is added to
wells, and incubated for 1 hour at 37.degree. C. The plates are
then washed two times with PBS/0.05% Tween and once with tap water,
incubated for 15 minutes at room temperature with the enzyme
substrate TMB, 3,3',5,5' tetramethylbenzidine, such as that
obtained from Sigma, and the reaction is stopped with 100 .mu.l of
2 M phosphoric acid. Colorimetric readings are measured at 450 nm
using an automated microtiter plate reader.
7.8 EXAMPLE 16
Virus Neutralization Assay
[0565] When a subject is infected with a virus, an array of
antibodies against the virus are produced. Some of these antibodies
can bind virus particles and neutralize their infectivity. Virus
neutralization assays (VN) are usually conducted by mixing
dilutions of serum or monoclonal antibody with virus, incubating
them, and assaying for remaining infectivity with cultured cells,
embryonated eggs, or animals. Neutralizing antibodies can be used
to define type-specific antigens on the virus particle, e.g.,
neutralizing antibodies could be used to define serotypes of a
virus. Additionally, broadly neutralizing antibodies may also
exist.
[0566] VN assays were performed with serial two-fold dilutions of
human and animal sera starting at an eight-fold dilution. Diluted
sera were incubated for one hour with 100 TCID.sub.50 of virus
before inoculation of tMK cells grown in 96 well plates, after
which the plates were centrifuged at 840.times.g. The media was
changed after three and six days and IFA was conducted with
FTIC-labeled ferret antibodies against MPV 8 days after
inoculation. The VN titre was defined as the lowest dilution of the
serum sample resulting in negative IFA and inhibition of CPE in
cell cultures.
7.9 EXAMPLE 17
RNA Isolation
[0567] The presence of viruses in a host can also be diagnosed by
detecting the viral nucleic acids in samples taken from the host
(See e.g., RT-PCR in Example 18 and RAP-PCR in Example 19).
[0568] RNA was isolated from the supernatants of infected cell
cultures or sucrose gradient fractions using a High Pure RNA
Isolation kit, according to instructions from the manufacturer
(Roche Diagnostics, Ahnere, The Netherlands). RNA can also be
isolated following other procedures known in the art (see, e.g.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, volume 1-3 (1994-1998). Ed.
by Ausubel, F. M. et al., Published by John Wiley and sons, Inc.,
USA).
7.10 EXAMPLE 18
RT-PCR to Detect/Diagnose MPV
[0569] Detection of the virus in a biological sample can be done
using methods that copy or amplify the genomic material of the
virus. Virus-specific oligonucleotide sequences for RT-PCR assays
on known paramyxoviruses are described below in this Example. A
one-step RT-PCR was performed in 50 .mu.l reactions containing 50
mM Tris.HCl pH 8.5, 50 mM NaCl, 4 mM MgCl.sub.2, 2 mM
dithiotreitol, 200 .mu.M each dNTP, 10 units recombinant RNAsin
(Promega, Leiden, the Netherlands), 10 units AMV RT (Promega,
Leiden, The Netherlands), 5 units Amplitaq Gold DNA polymerase (PE
Biosystems, Nieuwerkerk aan de Ijssel, The Netherlands) and 5 .mu.l
RNA. Cycling conditions were 45 min. at 42.degree. C. and 7 min. at
95.degree. C. once, 1 min at 95.degree. C., 2 min. at 42.degree. C.
and 3 min. at 72.degree. C. repeated 40 times and 10 min. at
72.degree. C. once. Primers sequences are provided in the sequence
listing. More specifically, the primers used for the nucleoprotein
gene were N3 and N4, having nucleotide sequences corresponding to
SEQ ID NOs:28 and 29 respectively, and were used to amplify a 151
nucleotide fragment. The primers used for the matrix protein gene
were M3 and M4, having nucleotide sequences corresponding to SEQ ID
NOs: 30 and 31 respectively, and were used to amplify a 252
nucleotide fragment. The primers used for the polymerase protein
gene were L6 and L7, corresponding to SEQ ID NOs: 34 and 35
respectively, and were used to amplify a 173 nucleotide fragment.
The primers used for the F protein gene were F7 and F8,
corresponding to SEQ IS NOs: 32 and 33 respectively, and were used
to amplify a 221 nucleotide fragment.
[0570] Furthermore, probes were used to confirm the presence of
hMPV genome sequences. The probe used to detect the M gene had a
nucleotide sequence corresponding to SEQ ID NO: 36. The probe used
to detect the N gene had a nucleotide sequence corresponding to SEQ
ID NO: 37. The probe used to detect the L gene had a nucleotide
sequence corresponding to SEQ ID NO:38.
[0571] In another example, primers and probes can be designed based
on MPV sequences that are known or obtained tlrough sequencing.
Likewise, different sequences of primers and difference buffer and
assay conditions to be used for specific purposes would be known to
one skilled in the art.
[0572] RT-PCR was used for the detection of known paramyxoviruses
as well. Primers for hPIV-1 to 4, mumps, measles, Tupsia, Mapuera,
and Hendra were developed in house and based on alignments of
available sequences. Primers for New Castle Disease Virus were
taken from Seal, J., J. et al; Clin. Microb., 2624-2630, 1995.
Primers for Nipah and general paramyxovirus-PCR were taken from
Chua, et al., 2000, Science, 288. The primers used to detect other
known paramyxoviruses were as follows: hPIV-1 was detected with
primers corresponding to the sequences of SEQ ID NO: 58 and 59 for
the forward and reverse primers respectively, hPIV-2 was detected
with primers corresponding to the sequences of SEQ ID NO: 60 and 61
for the forward and reverse primers respectively, hPIV-3 was
detected with primers corresponding to the sequences of SEQ ID NO:
62 and 63 for the forward and reverse primers respectively, hPIV-4
was detected with primers corresponding to the sequences of SEQ ID
NO: 64 and 65 for the forward and reverse primers respectively,
Mumps was detected with primers corresponding to the sequences of
SEQ ID NO: 66 and 67 for the forward and reverser primers
respectively, NDV was detected with primers corresponding to the
sequences of SEQ ID NO: 68 and 69 for the forward and reverse
primers respectively, Tupaia was detected with primers
corresponding to the sequences of SEQ ID NO: 70 and 71 for the
forward and reverse primers respectively, Mapuera was detected with
primers corresponding to the sequences of SEQ ID NO: 72 and 73 for
the forward and reverse primers respectively, Hendra was detected
with primers corresponding to the sequences of SEQ ID NO: 74 and 75
for the forward and reverse primers respectively, Nipah was
detected with primers corresponding to the sequences of SEQ ID NO:
76 and 77 for the forward and reverse primers respectively, HRSV
was detected with primers corresponding to the sequences of SEQ ID
NO: 78 and 79 for the forward and reverse primers respectively,
Measles was detected with primers corresponding to the sequences of
SEQ ID NO: 80 and 81 for the forward and reverse primers
respectively, and general Pararnyxoviridae viruses were detected
with primers corresponding to the sequences of SEQ ID NO: 82 and 83
for the forward and reverse primers respectively.
7.11 EXAMPLE 19
RAP-PCR
[0573] The genetic material of MPV or another virus can be detected
or amplified using primers that hybridize to regions within the
genome and that extend in a particular direction so that the
genetic material is amplified. This type of technique is useful
when specific sequence information is unavailable or when
performing an initial amplification of genetic material in a
sample. One such technique is called RAP-PCR.
[0574] RAP-PCR was performed essentially as described (Welsh et
al., 1992, NAR 20:4965-4970). For the RT reaction, 2 .mu.l of RNA
was used in a 10 .mu.l reaction containing 10 ng/.mu.l
oligonucleotide, 10 mM dithiotreitol, 500 .mu.m each dNTP, 25 mM
Tris-HCl pH 8.3, 75 mM KCl and 3 mM MgCl.sub.2. The reaction
mixture was incubated for 5 minutes at 70.degree. C. and 5 minutes
at 37.degree. C., after which 200 units Superscript RT enzyme
(LifeTechnologies) were added. The incubation at 37.degree. C. was
continued for 55 minutes and the reaction was terminated by a 5
minute incubation at 72.degree. C. The RT mixture was diluted to
give a 50 .mu.l PCR reaction containing 8 ng/.mu.l oligonucleotide,
300 .mu.l each dNTP, 15 mM Tris-HCl pH 8.3,65 mM KCl, 3.0 mM
MgCL.sub.2 and 5 units Taq DNA polymerase (FE Biosystems). Cycling
conditions were 5 minutes at 94.degree. C., 5 minutes at 40.degree.
C., and 1 minute at 72.degree. C. once, followed by 1 minute at
94.degree. C., 2 minutes at 56.degree. C. and 1 minute at
72.degree. C. repeated 40 times, and 5 minutes at 72.degree. C.
once.
[0575] Primers used for RAP-PCR were: primer ZF1 with a nucleotide
sequence corresponding to SEQ ID NO: 46, primer ZF4 with a
nucleotide sequence corresponding to SEQ ID NO: 47, primer ZF7 with
a nucleotide sequence corresponding to SEQ ID NO: 48, primer ZF10
with a nucleotide sequence corresponding to SEQ ID NO: 49, primer
ZF13 with a nucleotide sequence corresponding to SEQ ID NO: 50,
primer ZF16 with a nucleotide sequence corresponding to SEQ ID NO:
51, primer CS1 with a nucleotide sequence corresponding to SEQ ID
NO: 52, CS4 with a nucleotide sequence corresponding to SEQ ID NO:
53, primer CS7 with a nucleotide sequence corresponding to SEQ ID
NO: 54, primer CS10 with a nucleotide sequence corresponding to SEQ
ID NO: 55, primer CS13 with a nucleotide sequence corresponding to
SEQ ID NO: 56, and primer CS16 with a nucleotide sequence
corresponding to SEQ ID NO: 57. Products were run side by side on a
3% NuSieve agarose gel (FMC BioProducts, Heerhugowaard, The
Netherlands). Differentially displayed fragments specific for MPV
were purified from the gel with a Qiaquick Gel Extraction kit
(Qiagen, Leusden, The Netherlands) and cloned in pCR2.1 vector
(Invitrogen, Groningen, The Netherlands), according to instructions
from the manufacturer. Twenty fragments were successfully purified
and sequenced. Sequence homology to APV was found in ten fragments,
i.e. fragment 1 isolated using the ZF7 primer yielded a 335 bp
fragment with homology to the N gene, fragment 2 isolated using the
ZF1O primer yielded a 235 bp fragment with homology to the N gene,
fragment 3 isolated using the ZF1O primer yielded a 800 bp fragment
with homology to the M gene, fragment 4 isolated using the CS1
primer yielded a 1250 bp fragment with homology to the F gene,
fragment 5 isolated using the CS10 primer yielded a 400 bp fragment
with homology to the F gene, fragment 6 isolated using the CS13
primer yielded a 1450 bp fragment with homology to the F gene,
fragment 7 isolated using primer CS13 yielded a 750 bp fragment
with homology to the F gene, fragment 8 isolated using the ZF4
primer yielded a 780 bp fragment with homology to the L gene
(protein level), fragment 9 isolated using the ZF10 primer yielded
a 330.bp fragment with homology to the L gene (protein level), and
fragment 10 isolated using the ZF10 primer yielded a 250 bp
fragment with homology to the L gene (protein level).
[0576] TaqMan assays can be used to measure the level of expression
of a gene. TaqMan assays were adapted to examine the expression of
the L-gene and the N-gene. The primers that were used in these
assays are not required to be specific to any one of the hMPV
groups, however, examples are shown below. Reactions were carried
out with a 500 nM concentration of a forward primer, 250 nM
concentration of a reverse primer, 250 nM concentration of an
oligonucleotide probe, 25 .mu.l of a universal PCR mastermix
(available from ABI), and 5 .mu.l of cDNA in a 50 .mu.l total
reaction volume. Cycling conditions were: a first step of 10
minutes at 95.degree. C., followed by a second step of 45 cycles
consisting of 30 seconds at 95.degree. C. and 60 seconds at
60.degree. C. on an ABI 7000 sequence detection system.
[0577] Other examples of primers for the N gene of hMPV to be used
in TaqMan assays are as follows: For isolates NL/1/00, BI/1/01,
FI/4/01, NL/8/01, and FI/2/01, all of the subgroup A1, primers with
the nucleotide sequence of SEQ ID NO: 39 could be used. For isolate
NL/30/01, of the subgroup A1, a primer with the nucleotide sequence
of SEQ ID NO: 40 could be used. For isolates NL/22/01 and NL/23/01,
of the subgroup A2, a primer with the nucleotide sequence of SEQ ID
NO: 41 could be used. For isolates NL/17/01, of the subgroup A2, a
primer with the nucleotide sequence of SEQ ID NO: 42 could be used.
For isolate NL/17/00, of the subgroup A2, a primer with the
nucleotide sequence of SEQ ID NO: 43 could be used. For isolates
NL/1/99, NL/5/01, NL/21/01, and NL/9/01, of the subgroup B1, a
primer with the nucleotide sequence of SEQ ID NO: 44. For
isolates)F/1/01 and FI/10/01, of subgroup B1, a primer with the
nucleotide sequence of SEQ ID NO: 45 could be used.
[0578] A potential probe that can be used for the A1 subgroup
corresponds to SEQ ID NO:390, a probe that can be used for the B1
subgroup corresponds to SEQ ID NO:391, and a probe that can be used
for the B2 subgroup corresponds to SEQ ID NO:392.
7.12 EXAMPLE 20
Sequence Analysis of RAP-PCR Products
[0579] After segments are amplified using RAP-PCR, sequence
information can be obtained on the amplfied segments. In order to
do so, it is advantageous to clone the generated fragments into
vectors before sequencing.
[0580] RAP-PCR products cloned in vector pCR2.1 (Invitrogen) were
sequenced with M13-specific oligonucleotides. DNA fragments
obtained by RT-PCR were purified from agarose gels using Qiaquick
Gel Extraction kit (Qiagen, Leusden, The Netherlands), and
sequenced directly with the same oligonucleotides used for PCR.
Sequence analyses were performed using a Dyenamic ET terminator
sequencing kit (Amersham Pharmacia Biotech, Roosendaal, The
Netherlands) and an ABI 373 automatic DNA sequencer (PE Biosystem).
All techniques were performed according to the instructions of the
manufacturer.
7.13 EXAMPLE 21
Generating Genomic Fragments by RT-PCR
[0581] The RAP-PCR method can leave gaps in the sequence that have
not be amplified or copied. In order to obtain a complete sequence,
the sequence information of the gaps can be obtained using
RT-PCR.
[0582] To generate PCR fragments spanning gaps A, B and C between
the RAP-PCR fragments (FIG. 3), RT-PCR assays were used as
described previously on RNA samples isolated from virus isolate
00-1.
[0583] The following primers were used to generate fragment A: TR1
designed in the leader, corresponding to the nucleotide sequence of
SEQ ID NO:22 and Ni designed at the 3' end of the RAP-PCR fragments
obtained in N and corresponding to the sequence of SEQ ID NO:23.
The following primers were used to generate fragment B: N2 designed
at the 5' end of the RAP-PCR fragments obtained in N and
corresponding to the nucleotide sequence of SEQ ID NO:24 and M1
designed at the 3' end of the RAP-PCR fragments obtained in M and
corresponding to the nucleotide sequence of SEQ ID NO:25. The
following primers were used to generate fragment C: M2 designed at
the 5' end of the RAP-PCR fragment obtained in M and corresponding
to the nucleotide sequence of SEQ ID NO:26 and Fl designed at the
3' end of the RAP-PCR fragments obtained in F and corresponding to
the nucleotide sequence of SEQ ID NO: 27.
[0584] Fragments were purified after gel electrophoresis and cloned
and sequenced as described previously.
7.14 EXAMPLE 25
Capture Anti-MPV IgM EIA Using a Recombinant Nucleoprotein
[0585] In order to detect the hMPV virus, an immunological assay
that detects the presence of the antibodies in a variety of hosts.
In one example, antibodies to the N protein are used because it is
the most abundant protein that is produced. This feature is due the
transciptional gradient that occurs across the genome of the
virus.
[0586] A capture IgM EIA using the recombinant nucleoprotein or any
other recombinant protein as antigen can be performed by
modification of assays as previously described by Erdman et al.,
1990, J.Clin.Microb. 29: 1466-1471.
[0587] Affinity purified anti-human IgM capture antibody (or
against other species), such as that obtained from Dako, is added
to wells of a microtiter plate in a concentration of 250 ng per
well in 0.1 M carbonate buffer pH 9.6. After overnight incubation
at room temperature, the plates are washed two times with PBS/0.05%
Tween. 100 .mu.l of test serum diluted 1:200 to.1:1000 in ELISA
buffer is added to triplicate wells and incubated for 1 hour at
37.degree. C. The plates are then washed two times with in
PBS/0.05%Tween.
[0588] The freeze-thawed (infected with recombinant virus) Sf21
cell lysate is diluted 1:100 to 1:500 in ELISA buffer is added to
the wells and incubated for 2 hours at 37.degree. C. Uninfected
cell lysate serves as a negative control and is run in duplicate
wells. The plates are then washed three times in PBS/0.05% Tween
and incubated for 1 hour at 37.degree. C. with 100 .mu.l of a
polyclonal antibody against MPV in a optimal dilution in ELISA
buffer. After 2 washes with PBS/0.05% Tween, the plates are
incubated with horseradish peroxide labeled secondary antibody
(such as rabbit anti ferret), and the plates are incubated 20
minutes at 37.degree. C.
[0589] The plates are then washed five times in PBS/0/05% Tween,
incubated for 15 minutes at room temperature with the enzyme
substrate TMB, 3,3,5,5 tetramethylbenzidine, as, for instance
obtained from "Sigma", and the reaction is stopped with 100 .mu.l
of 2M phosphoric acid. Colormetric readings are measured at 450 nm
using automated microtiter plate reader.
[0590] The sensitivities of the capture IgM EIAs using the
recombinant nucleoprotein (or other recombinant protein) and whole
MPV virus are compared using acute-and convalescent-phase serum
pairs form persons with clinical MPV virus infection. The
specificity of the recombinant nucleoprotein capture EIA is
determined by testing serum specimens from healthy persons and
persons with other paramyxovirus infections.
[0591] Potential for EIAs for using recombinant MPV fusion and
glycoprotein proteins produced by the baculovirus expression.
[0592] The glycoproteins G and F are the two transmembraneous
envelope glycoproteins of the MPV virion and represent the major
neutralisation and protective antigens. The expression of these
glycoproteuns in a vector virus system sych as a baculovinus system
provides a source of recombinant antigens for use in assays for
detection of MPV specific antibodies. Moreover, their use in
combination with the nucleoprotein, for instance, further enhances
the sensitivity of enzyme immunoassays in the detection of
antibodies against MPV.
[0593] A variety of other immunological assays (Current Protocols
in Immunology, volume 1-3. Ed. by Coligan, J. E., Kruisbeek, A. M.,
Margulies, D. H., Shevach, E. M. and Strobe, W. Published by John
Wiley and sons, Inc., USA) may be used as alternative methods to
those described here.
[0594] In order to find virus isolates nasopharyngeal aspirates,
throat and nasal swabs, broncheo alveolar lavages and throat swabs
preferable from but not limited to humans, carnivores (dogs, cats,
seals etc.), horses, ruminants (cattle, sheep, goats etc.), pigs,
rabbits, birds (poultry, ostridges, etc) can be examined. From
birds, cloaca and intestinal swabs and droppings can be examined as
well. For all samples, serology (antibody and antigen detection
etc.), virus isolation and nucleic acid detection techniques can be
performed for the detection of virus. Monoclonal antibodies can be
generated by immunizing mice (or other animals) with purified MPV
or parts thereof (proteins, peptides) and subsequently using
established hybridoma technology (Current Protocols in Immnology,
Published by John Wiley and sons, Inc., USA). Alternatively, phage
display technology can be used for this purpose (Current Protocols
in Immunology, Published by John Wiley and sons, Inc., USA).
Similarly, polyclonal antibodies can be obtained from infected
humans or animals, or from immunised humans or animals (Current
Protocols in Immunology, Published by John Wiley and sons, Inc.,
USA).
[0595] The detection of the presence or absence of NS1 and NS2
proteins can be performed using western-blotting, IFA, immuno
precipitation techniques using a variety of antibody preparations.
The detection of the presence or absence of NS1 and NS2 genes or
homologues thereof in virus isolates can be performed using PCR
with primer sets designed on the basis of known NS1 and/or NS2
genes as well as with a variety of nucleic acid hybridisation
techniques.
[0596] To determine whether NS1 and NS2 genes are present at the 3'
end of the viral genome, a PCR can be performed with primers
specific for this 3' end of the genome. In our case, we used a
primer specific for the 3' untranslated region of the viral genome
and a primer in the N ORF. Other primers may be designed for the
same purpose. The absence of the NS1/NS2 genes is revealed by the
length and/or nucleotide sequence of the PCR product. Primers
specific for NS1 and/or NS2 genes may be used in combination with
primers specific for other parts of the 3' end of the viral genome
(such as the untranslated region or N, M or F ORFs) to allow a
positive identification of the presence of NS1 or NS2 genes. In
addition to PCR, a variety of techniques such as molecular cloning,
nucleic acid hybridisation may be used for the same purpose.
[0597] 8. Cell Culture Systems and Animal Models for MPV and
Recombinant Engineering of MPV
8.1 EXAMPLE 22
HMPV Growth in Different Cell Lines
[0598] Virus isolates can be cultured in different cell lines in
order to examine characteristics of each virus. For example, the
infectivity of different virus isolates can be characterized and
distinguished on the basis of titer levels measured in culture.
Alternatively, cells can be used to propagate or amplify strains of
the virus in culture for further analysis.
[0599] In one example, tertiary monkey kidney cells were used to
amplify hMPV. However, tertiary monkey kidney cells are derived
from primary cells which may only be passaged a limited number of
times and have been passaged three times in vivo. It was not known
which kind of immortalized cell line would support hMPV virus
growth to high titers. A number of monkey cell lines such as Vero,
LLC-MK2, HEp-2, and lung fibroblast (LF1043) cells, were tested to
see whether they could support hMPV virus replication (Table 12).
Trypsin used was TPCK-trypsin (Worthington) at a concentration of
0.001 mg/ml. The growth of this virus in fertilized 10 day old
chicken eggs was also tested. The infected eggs were incubated for
2 and 3 days at 37.degree. C. prior to AF harvest. Virus titers
were determined by plaque assay of infected cell lysates on Vero
cells without trypsin, incubated for 10 days at 35.degree. C., and
immunostained using the guinea pig hMPV antiserum. The results
showed that Vero cells and LLC-MK2 cells were the cell substrates
most suitable for hMPV virus replication, resulting in virus stock
titers of 10.sup.6-10.sup.7 pfu/ml. These titers were similar to
those obtained from tMK cells. The addition of trypsin at a
concentration of 0.01 mg/ml did not increase virus titers
appreciably (Table 12).
13TABLE 12 HMPV VIRUS GROWTH IN DIFFERENT CELL LINES Trypsin used
to Cell Substrate grow virus Virus titers on Vero cells (pfu/ml)
Vero yes 2.1 .times. 10.sup.7 no 1.1 .times. 10.sup.7 LLC-MK2 yes
2.3 .times. 10.sup.5 Hep-2 yes cells died LF 1043 (HEL) yes no
virus recovered no no virus recovered tMK yes 1.0 .times. 10.sup.7
eggs (10 days) no no virus recovered
[0600] In order to study the virus kinetics of hMPV viral growth in
Vero cells, a growth curve was performed using an MOI of 0.1 (FIG.
23). Cells and cell supernatants were harvested every 24 hours, and
analyzed by plaque assay for quantification of virus titers. The
results showed that at day 5, near peak titers of hMPV were
observed. The absolute peak titer of 5.4 log.sub.10 pfu/ml was
achieved on Day 8. The virus titer was very stable up to day 10. A
growth curve carried out at the same time with solely the cell
supernatants, showed only very low virus titers. This data
demonstrated that hMPV replication, under the conditions used (MOI
of 0.1) peaked on day 8 post-infection and that hMPV was largely, a
cell-associated RNA virus.
[0601] TRANSFECTION OF 293 CELLS: 293 cells (human kidney
epithelial cells) were passed in DMEM and supplemented with FCS
(10%), L-Glutamine (1: 100) and Pen/Strep (1:100) and split 1:10
every 3-4 days. Care was taken not to let the cells grow to
confluency in order to enhance transfectability. Cells were not
very adherent; a very brief (2 min. or less) incubation in
Trypsin-EDTA was usually sufficient to release them from plastic
surfaces. Cells were diluted in culture media immediately after
trypsin-treatment.
[0602] Cells were split the day before transfection. Cell
confluency approximated 50-75% when transfected. Gelatinized
plasticware was used to prevent cells from detaching throughout the
transfection procedure. Plates or flasks were covered with 0.1%
gelatinin (1:20 dilution of 2% stock) for 10 minuted and rinsed one
time with PBS once. To achieve the correct cell density; cells were
used at a concentration of 1.times.10.sup.7 cells per T75 flask or
100 mm plate (in 10 ml) or 1.times.10.sup.6 cells per well of a
6-well plate (in 2 ml).
[0603] Transfection lasted for a minimum of 7 hours, however, it
was preferable to allow the transfection to occur overnight. The
following were combined in a sterile tube: 30 mg DNA with 62 ml 2 M
CaCl.sub.2 and H.sub.2O to 500 ml (T75) or 3 mg DNA with 6.2 ml 2 M
CaCl.sub.2 and H.sub.2O to 50 ml (6-well plate); with brief mixing.
Addition of 500 or 50 ml 2.times.HBS occurred dropwise and the
solutions were allowed to mix for 5 minutes until a precipitate
formed. Gentle care was used, i.e. no vortexing was applied. The
old media was replaced with fresh prewarmed media (10 ml per T75
flask or 1 ml per well of a 6-well plate. The DNA was mixed
carefully by blowing airbubles through the tube with a Gilson pipet
and the precipitate was added dropwise to the media covering the
cells. The cells were incubated in a 37.degree. C. CO.sub.2
atmosphere.
[0604] The cells appeared to be covered with little specks (the
precipitate). The transfection media was removed from the cells,
and the cells were rinsed carefully with PBS, and then replaced
with fresh media.
[0605] The cells were incubated in a 37.degree. C. CO.sub.2
atmosphere until needed, usually between 8-24 hours.
[0606] A 10.times. stock of HBS was prepared with with 8.18% NaCl,
5.94% Hepes and 0.2% Na.sub.2HPO.sub.4 (all w/v). The solution was
filter sterilized and stored at 4.degree. C. A 2.times. solution
was prepared by diluting the 10.times. stock with H.sub.2O and
adjusting the pH to 7.12 with 1 M NaOH. The solution was stored in
aliquots at -20.degree. C. Care was taken to exactly titrate the pH
of the solution. The pH was adjusted immediately before the
solution was used for the transfection procedure.
8.2 EXAMPLE 23
Minireplicon Construct of MPV
[0607] Minireplicon constructs can be generated to contain an
antisense reporter gene. An example of a minireplicon, CAT-hMPV, is
shown in FIG. 24. The leader and trailer sequences that were used
for the generation of the minireplicon construct are shown in FIG.
26. For comparison, an alignment of APV, RSV and PIV3 leader and
trailer sequences are also shown in FIG. 26.
[0608] Two versions of the minireplicon constructs were tested: one
with terminal AC residues at the leader end (Le+AC), and one
without terminal AC residues at the leader end (Le-AC). The two
constructs were both functional in the assay (FIG. 25). It can be
seen in FIG. 25 that much higher CAT expression occurred after 48
hours than after 24 hours. After 48 hours, around 14 ng CAT per
500,000 cells transfected was observed. This experiment was
entirely plasmid driven: the minireplicon was cotransfected with a
T7 polymerase plasmid, and the N, P, L, M2.1 genes were expressed
from pCITE-2a/3a (the pCite plasmids have a T7 promoter followed by
the IRES element derived from the encephalomyocarditis virus
(EMCV)). The CAT expression was completely abolished when L, P and
N were excluded. A significant reduction in CAT expression was
noted when M2.1 expression was excluded from the vector.
[0609] The specificity (attributes to heterologous viruses) and the
effect of the terminal residues of the leader (attributes to
homologous virus) of the minireplicon system can also be tested by
superinfecting the minireplicon-transfected cells with hMPV
polymerase components (NL/1/00 and NL/1/99) or polymerase
components from APV-A, APV-C, RSV or PIV. The different amount of
each of the six plasmids can also be tested in order to determine
the optimal conditions.
[0610] Other reporter genes can be used instead of CAT. In other
examples, GFP can be inserted into the minireplicon construct
instead of CAT.
8.3 EXAMPLE 24
Generation of Full Length Infectious cDNA
[0611] Full length cDNAs that express the genes of the hMPV virus
can be constructed so that infectious viruses can be produced. For
example, a cDNA encoding all of the genes or all of the essential
genes of hMPV can be constructed; the genome can then be expressed
to produce infectious viruses.
[0612] In order to genetically manipulate hMPV, the genome of this
RNA virus was cloned. For the 00-1 isolate of hMPV, eight PCR
fragments varying in length from 1-3 kb were generated (FIG. 27).
The PCR fragments were sequenced and analyzed for sequence errors
by comparison to the hMPV sequence deposited in Genbank. Two silent
mutations (nucleotide 5780 ile:ile in the SH gene, nucleotide 12219
cys:cys in the L gene) were not corrected. Another change in the L
gene at nucleotide 8352 (trp:leu) was not changed since this
mutation was observed in two independently generated PCR fragments
(C and H), as well as in the HMPV 99-1 sequence. Similarly, a 5
nucleotide insertion at nucleotide 4715 in the F-M2 intergenic
region was not corrected. Both of these changes may be reflected in
the wild type sequence of hMPV. In contrast, at nucleotide 1242, a
single A residue was removed in the N--P intergenic region; at
nucleotide 3367, a ser:pro was corrected in the F gene; at
nucleotide 6296, an asp:val was changed in the G gene; and at
nucleotide 7332 a stop codon was changed to a glu in the L gene.
Restriction maps of different isolates of hMPV are shown in FIG.
28. The restriction sites can be used to assemble the full-length
construct.
[0613] The eight corrected PCR fragments were then assembled in
sequence, taking advantage of unique restriction enzyme sites (FIG.
29). A genetic marker was introduced at nucleotide 75 generating an
AflII restriction enzyme site without altering the amino acid
sequence. A unique restriction enzyme site, XhoI, was added at the
3' end of the hMPV sequence. A phage T7 polymerase promoter
followed by two G residues was also added to the 3' end of the hMPV
sequence. At the 5' end of the hMPV genome, a Hepatitis delta
ribozyme sequence and BssHII restriction enzyme site were
added.
[0614] Helper plasmids encoding the hMPV L, N, P and M2-1 gene in a
pCITE plasmid were also generated. Once the full-length hMPV cDNA
was generated, virus recovery by reverse genetics was performed in
Vero cells using fowl-pox T7 or MVA-T7 as a source of T7
polymerase.
8.4 EXAMPLE 26
Infection of Animal Hosts with Subtypes of hMPV
[0615] Animal hosts can be infected in order to characterize the
virulence of MPV strains. For example, different hosts can be used
in order to determine how infectious each strain is in an
organism.
[0616] A small animal model for hMPV had not been identified.
Balb/c mice, cotton rats, and Syrian Golden hamsters were infected
with hMPV using a dose of 1.3.times.10.sup.6 pfu/animal. The
animals were inoculated intranasally with 1.3.times.10.sup.6 pfu of
hMPV in a 0.1 ml volume. The tissue samples were quantified by
plaque assays that were immunostained on Day 9 with the hMPV guinea
pig antiserum. Four days post-infection, the animals were
sacrificed, and the nasal turbinates and lungs were isolated and
quantified for hMPV titers by plaque assays that were immunostained
(Table 13).
14TABLE 13 HMPV TITERS IN INFECTED ANIMALS Mean virus titer on day
4 post-infection (log.sub.10 PFU/g Number of tissue +/- Standard
Error Animals animals Nasal turbinates Lungs mice (Balb c) 6 2.7
+/- 0.4 2.2 +/- 0.6 cotton rats 5 <1.7 +/- 0.0 <1.8 +/- 0.0
Syrian Golden 6 5.3 +/- 0.2 2.3 +/- 0.6 hamsters
[0617] The results showed that hMPV replicated to high titers in
Syrian Golden hamsters. Titers of 5.3 and 2.3 loglO pfu/g tissue
were obtained in the nasal turbinates and lungs, respectively. hMPV
did not replicate to any appreciable titer levels in the
respiratory tracts of cotton rats. Mice showed titers of 2.7 and
2.2 loglo pfu/g tissue in the upper and lower respiratory tracts,
respectively. These results suggested that Syrian Golden hamsters
would be a suitable small animal model to study hMPV replication
and immunogenicity as well as to evaluate hMPV vaccine
candidates.
[0618] INFECTION OF GUINEA PIGS. Two virus isolates, 00-1 (subtype
A) and 99-1 (subtype B), were used to inoculate six guinea pigs per
subtype (intratracheal, nose and eyes). Six guinea pigs were
infected with hMPV 00-1 (10e6,5 TCID50). Six guinea pigs were
infected with hMPV 99-1 (10e4,1 TCID50). The primary infection was
allowed to progress for fifty-four days when the guinea pigs were
inoculated with the homologous and heterologous subtypes (10e4
TCID50/ml), i.e., two guinea pigs had a primary infection with 00-1
and a secondary infection with 99-1 in order to achieve a
heterologous infection, three guinea pigs had a primary infection
with 00-1 and a secondary infection with 00-1 to achieve a
homologous infection, two guinea pigs had a primary infection with
99-1 and a secondary infection with 00-1 to achieve a heterologous
infection and three guinea pigs had a primary infection with 99-1
and a secondary infection with 99-1 to achieve a homologous
infection.
[0619] Throat and nose swabs were collected for 12 days (primary
infection) or 8 days (secondary infection) post infection, and were
tested for the presence of the virus by RT-PCR assays. The results
(FIG. 32) of the RT-PCR assays showed that guinea pigs inoculated
with virus isolate 00-1 showed infection of the upper respiratory
tract on days 1 through 10 post infection. Guinea pigs inoculated
with 99-1 showed infection of the upper respiratory tract day 1 to
5 post infection. Infection of guinea pigs with 99-1 appeared to be
less severe than infection with 00-1. A second inoculation of the
guinea pigs with the heterologous virus, as commented on above,
resulted in re-infection in 3 out of 4 of the guinea pigs.
Likewise, reinfection in the case of the homologous virus occurred
in 2 out of 6 guinea pigs. Little or no clinical symptoms were
noted in those animals that became re-infected, and no clinical
symptoms were seen in those animals that were protected against the
re-infections, demonstrating that even with the wild-type virus, a
protective effect due to the first infection may have occurred.
This also showed that heterologous and homologous isolates could be
used as a vaccine.
[0620] Both subtypes of hMPV were able to infect guinea pigs,
although infection with subtype B (99-1) seemed less severe, i.e.,
the presence of the virus in nose and throat was for a shorter
period than infection with subtype A (00-1). This may have been due
to the higher dose given for subtype A, or to the lower virulence
of subtype B. Although the presence of pre-existing immunity did
not completely protect against re-infection with both the
homologous and heterologous virus, the infection appeared to be
less prominent, in that a shorter period of presence of virus was
noted and not all animals became virus positive.
[0621] The serology of guinea pigs that were infected with both
subtypes of hMPV was examined. At days 0, 52, 70, 80, 90, 110, 126
and 160, sera were collected from the guinea pigs and tested at a
1:100 dilution in a whole virus ELISA against 00-1 and 99-1
antigens. (See FIG. 33A and B showing the IgG response against 00-1
and 99-1 for each individual guinea pig. See also FIG. 34 showing
the specificity of the 00-1 and 99-1 ELISA but note that only data
from homologous reinfected guinea pigs was used. See also FIG. 35
showing the mean IgG response against 00-1 and 99-1 ELISA of three
homologous, i.e. 00-1 and 00-1, two homologous, i.e., 99-1 and
99-1, two heterologous, i.e., 99-1 and 00-1, and 2 heterologous,
i.e., 00-1 and 99-1 infected guinea pigs).
[0622] Only aminor difference in response to the two different
ELISAs was observed. Whole virus ELISA against 00-1 or 99-1 could
not be used to discriminate between the two subtypes.
[0623] The reactivity of sera raised against hMPV in guinea pigs
with APV antigen was examined. Sera were collected from the
infected guinea pigs and tested with an APV inhibition ELISA. (See
FIG. 36, showing the mean percentage of APV inhibition of hMPV
infected guinea pigs). Sera raised against hMPV in guinea pigs
reacted in the APV inhibition test in a manner similar to their
reaction in the hMPV IgG ELISA's. Sera raised against 99-1 revealed
a lower percentage of inhibition in the APV inhibition ELISA than
sera raised against 00-1. Guinea pigs infected with 99-1 may have
had a lower titer than that seen in the hMVP ELISAs. Alternatively,
the cross-reaction of 99-1 with APV could have been less than that
of 00-1. Nevertheless, the APVAb inhibition ELISA could be used to
detect HMPV antibodies in guinea pigs.
[0624] Virus neutralization assays were performed with sera raised
against hMPV in guinea pigs. Sera were collected at day 0, day 52,
day 70 and day 80 post infection and used in a virus
cross-neutralization assay with 00-1, 99-1, and APV-C. The starting
dilution used was 1 to 10 and 100 TCID50 virus per well. After
neutralization, the virus was exposed to tMK cells (15 mm.) and
centrifuged at 3500 RPM, after which the media was refreshed. The
APV cultures were grown for 4 days and the hMPV cultures were grown
for 7 days. Cells were fixed with 80% acetone, and IFAs were
conducted with labeled monkey-anti hMPV. Wells that were negative
upon staining were defined as the neutralizing titer. For each
virus, a 10-log titration of the virus stock and a 2 fold titration
of the working solution was included. (See FIG. 37 showing the
virus neutralization titers of 00-01 and 99-1 infected guinea pigs
against 00-1, 99-1, and APV-C).
[0625] INFECTION OF CYNOMOLOGOUS MACAGUES. Virus isolates 00-1
(subtype A) and 99-1 (subtype B) (leS TCID50) was used to inoculate
two cynomologous macaques per subtype (intratracheal, nose and
eyes). Six months after the primary infection, the macaques were
inoculated for the second time with 00-1. Throat swabs were
collected for 14 days (primary infection) or 8 days (secondary
infection) post infection, and were tested for presence of the
virus by RT-PCR assays (FIG. 38).
[0626] Cynomologous macaques inoculated with virus isolate 00-1
showed infection of the upper respiratory tract day 1 to 10 post
infection. Clinical symptoms included a suppurative rhinitis. A
second inoculation of the macaques with the homologous virus
results in re-infection, as demonstrated by PCR, however, no
clinical symptoms were seen.
[0627] Sera were collected from the macaques that received 00-1
during six months after the primary infection (re-infection
occurred at day 240 for monkey 3 and day 239 for monkey 6). Sera
were used to test for the presence of IgG (FIG. 39B) antibodies
against either 00-1 or APV, and for the presence of IgA and IgM
antibodies against 00-1 (FIG. 39A).
[0628] Two macaques were succesfully infected with 00-1 and in the
presence of antibodies against 00-1 were reinfected with the
homologous virus. The response to IgA and IgM antibodies showed the
raise in IgM antibodies after the first infection, and the absence
of it after the reinfection. IgA antibodies were only detected
after the re-infection, showing the immediacy of the immune
response after a first infection. Sera raised against hMPV in
macaques that were tested in an APV inhibition ELISA showed a
similar response as to the hMPV IgG ELISA.
[0629] Antibodies to hMPV in cynomologous macaques were detected
with the APV inhibition ELISA using a similar sensitivity as that
with the hMPV ELISA, and therefore the APV inhibition EIA was
suitable for testing human samples for the presence of hMPV
antibodies.
[0630] Virus cross-neutralization assays were preformed on sera
collected from hMPV infected cynomologous macaques. The sera were
taken from day 0 to day 229 post primary infection and showed only
low virus neutralization titers against 00-1 (0-80), the sera taken
after the secondary infection showed high neutralisation titers
against 00-1, i.e., greater than 1280. Only sera taken after the
secondary infection showed neutralization titers against 99-1
(80-640), and none of the sera were able to neutralize the APV C
virus.There was no cross reaction between APV-C and hMPV in virus
cross-neutralization assays, however, there was a cross reaction
between 00-1 and 99-1 after a boost of the antibody response.
[0631] INFECTION OF HUMANS. The sera of patients ranging in ages
under six months or greater than twenty years of age were
previously tested using IFA and virus neutralization assays against
00-1. These sera were tested for the presence of IgG, IgM and IgA
antibodies in an ELISA against 00-1. The samples were also tested
for their ability to in inhibit the APV ELISA. A comparison of the
use of the hMPV ELISA and the APV inhibition ELISA for the
detection of IgG antibodies in human sera was made and a strong
correlation between the IgG hMPV test and the APV-Ab test was
noted, therefore the APV-Ab test was essentially able to detect IgG
antibodies to hMPV in humans (FIG. 40).
[0632] INFECTION OF POULTRY. The APV inhibition ELISA and the 00-1
ELISA were used to test chickens for the presence of IgG antibodies
against APV. Both the hMPV ELISA and the APV inhibition ELISA
detected antibodies against APV.
8.5 EXAMPLE 27
APV as a Vaccine in Humans
[0633] APV can be used as a vaccine in humans to prevent infection
by a human MPV, or to reduce the infectivity of human MPV in human
hosts. The vaccine can be a whole APV or a chimeric or recombinant
version or derivative thereof, that is comprised of heterologous
sequences of another metapneumovirus in addition to sequences of
APV. The genome of APV can be used as a backbone to create a
recombinant virus vaccine. For example, a vaccine can be made where
the F-gene and/or the G-gene of APV is substituted by the F-gene or
the G-gene of human MPV. Alternatively, a vaccine can be made that
includes sequences from PIV substituted for or added to sequences
of an APV backbone. For more on the construction of a
recombinant/chimeric vaccine, see, e.g., Construction of the
Recombinant cDNA and RNA.
[0634] The vaccine can be administered to a candidate by a variety
of methods known to those skilled in the art, (see, Section 5.13,
infra) including but not limited to, subcutaneous injection,
intranasal administration, or inhalation. The viruses and/or
vaccines of the invention are administered at a starting dosage of
at least between 10.sup.3 TCID.sub.50 and 10.sup.6 TCID.sub.50. The
viruses and/or vaccines are administered in either single or
multiple dosages, e.g., a primary dose can be administered with one
or more subsequent or booster doses administered at periodic time
intervals throughout the host life. In a clinical trial, the
replication rate of the virus can be used as an index to adjust the
dosage of the vaccine so that an effective dosage regimen can be
determined. A comparison can be made between the replication rate
of the virus in the study population and a predetermined rate that
is known to be effective.
[0635] The present invention is not to be limited in scope by the
specific described embodiments that are intended as single
illustrations of individual aspects of the invention, and any
constructs, viruses or enzymes that are functionally equivalent are
within the scope of this invention. Indeed, various modifications
of the invention in addition to those shown and described herein
will become apparent to those skilled in the art from the foregoing
description and accompanying drawings. Such modifications are
intended to fall within the scope of the appended claims.
8.6 EXAMPLE 28
MPV as a Vaccine in Birds
[0636] Human MPV can be used as a vaccine in birds to prevent
infection by an APV, or to reduce the infectivity of APV in avian
hosts. The vaccine can be a whole MPV or a chimeric or recombinant
version or derivative thereof, that is comprised of heterologous
sequences of another metapneumovirus in addition to sequences of
MPV. The genome of human MPV can be used as a backbone to create a
recombinant virus vaccine. For example, a vaccine can be made where
the F-gene and/or the G-gene of human MPV is substituted by the
F-gene or the G-gene of APV. For more on the construction of a
recombinant/chimeric vaccine, see, e.g., Construction of the
Recombinant cDNA and RNA.
[0637] The vaccine can be administered to a candidate by a variety
of methods, including but not limited to, subcutaneous injection,
intranasal administration, or inhalation. The viruses and/or
vaccines of the invention are administered at a starting dosage of
at least between 10.sup.3 TCID.sub.50 and 10.sup.6 TCID.sub.50. The
viruses and/or vaccines are administered in either single or
multiple dosages, e.g., a primary dose can be administered with one
or more subsequent or booster doses administered at periodic time
intervals throughout the host life. In a clinical trial, the
replication rate of the virus can be used as an index to adjust the
dosage of the vaccine so that an effective dosage regimen can be
determined. A comparison can be made between the replication rate
of the virus in the study population and a predetermined rate that
is known to be effective.
[0638] Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
15TABLE 14 LEGEND FOR SEQUENCE LISTING SEQ ID NO:1 Human
metapneumovirus isolate 00-1 matrix protein (M) and fusion protein
(F) genes SEQ ID NO:2 Avian pneumovirus fusion protein gene,
partial cds SEQ ID NO:3 Avian pneumovirus isolate 1b fusion protein
mRNA, complete cds SEQ ID NO:4 Turkey rhinotracheitis virus gene
for fusion protein (F1 and F2 subunits), complete cds SEQ ID NO:5
Avian pneumovirus matrix protein (M) gene, partial cds and Avian
pneumovirus fusion glycoprotein (F) gene, complete cds SEQ ID NO:6
paramyxovirus F protein hRSV B SEQ ID NO:7 paramyxovirus F protein
hRSV A2 SEQ ID NO:8 human metapneumovirus01-71 (partial sequence)
SEQ ID NO:9 Human metapneumovirus isolate 00-1 matrix protein (M)
and fusion protein (F) genes SEQ ID NO:10 Avian pneumovirus fusion
protein gene, partial cds SEQ ID NO:11 Avian pneumovirus isolate 1b
fusion protein mRNA, complete cds SEQ ID NO:12 Turkey
rhinotracheitis virus gene for fusion protein (F1 and F2 subunits),
complete cds SEQ ID NO:13 Avian pneumovirus fusion glycoprotein (F)
gene, complete cds SEQ ID NO:14 Turkey rhinotracheitis virus
(strain CVL14/1) attachment protien (G) mRNA, complete cds SEQ ID
NO:15 Turkey rhinotracheitis virus (strain 6574)attachment protein
(G), complete cds SEQ ID NO:16 Turkey rhinotracheitis virus (strain
CVL14/1) attachment protein (G) mRNA, complete cds SEQ ID NO:17
Turkey rhinotracheitis virus (strain 6574)attachment protein (G),
complete cds SEQ ID NO:18 isolate NL/1/99 (99-1) HMPV (Human
Metapneumovirus)cDNA sequence SEQ ID NO:19 isolate NL/1/00 (00-1)
HMPV cDNA sequence SEQ ID NO:20 isolate NL/17/00 HMPV cDNA sequence
SEQ ID NO:21 isolate NL/1/94 HMPV cDNA sequence SEQ ID NO:22 RT-PCR
primer TR1 SEQ ID NO:23 RT-PCR primer N1 SEQ ID NO:24 RT-PCR primer
N2 SEQ ID NO:25 RT-PCR primer M1 SEQ ID NO:26 RT-PCR primer M2 SEQ
ID NO:27 RT-PCR primer F1 SEQ ID NO:28 RT-PCR primer N3 SEQ ID
NO:29 RT-PCR primer N4 SEQ ID NO:30 RT-PCR primer M3 SEQ ID NO:31
RT-PCR primer M4 SEQ ID NO:32 RT-PCR primer F7 SEQ ID NO:33 RT-PCR
primer F8 SEQ ID NO:34 RT-PCR primer L6 SEQ ID NO:35 RT-PCR primer
L7 SEQ ID NO:36 Oligonucleotide probe M SEQ ID NO:37
Oligonucleotide probe N SEQ ID NO:38 Oligonucleotide probe L SEQ ID
NO:39 TaqMan primer and probe sequences for isolates NL/1/00,
BI/1/01, FI/4/01, NL/8/01, FI/2/01 SEQ ID NO:40 TaqMan primer and
probe sequences for isolates NL/30/01 SEQ ID NO:41 TaqMan primer
and probe sequences for isolates NL/22/01 and NL/23/01 SEQ ID NO:42
TaqMan primer and probe sequences for isolate NL/17/01 SEQ ID NO:43
TaqMan primer and probe sequences for isolate NL/17/00 SEQ ID NO:44
TaqMan primer and probe sequences for isolates NL/9/01, NL/21/01,
and NL/5/01 SEQ ID NO:45 TaqMan primer and probe sequences for
isolates FI/1/01 and FI/10/01 SEQ ID NO:46 Primer ZF1 SEQ ID NO:47
Primer ZF4 SEQ ID NO:48 Primer ZF7 SEQ ID NO:49 Primer ZF10 SEQ ID
NO:50 Primer ZF13 SEQ ID NO:51 Primer ZF16 SEQ ID NO:52 Primer CS1
SEQ ID NO:53 Primer CS4 SEQ ID NO:54 Primer CS7 SEQ ID NO:55 Primer
CS10 SEQ ID NO:56 Primer CS13 SEQ ID NO:57 Primer CS16 SEQ ID NO:58
Forward primer for amplification of HPIV-1 SEQ ID NO:59 Reverse
primer for amplification of HPIV-1 SEQ ID NO:60 Forward primer for
amplification of HPIV-2 SEQ ID NO:61 Reverse primer for
amplification of HPIV-2 SEQ ID NO:62 Forward primer for
amplification of HPIV-3 SEQ ID NO:63 Reverse primer for
amplification of HPIV-3 SEQ ID NO:64 Forward primer for
amplification of HPIV-4 SEQ ID NO:65 Reverse primer for
amplification of HPIV-4 SEQ ID NO:66 Forward primer for
amplification of Mumps SEQ ID NO:67 Reverse primer for
amplification of Mumps SEQ ID NO:68 Forward primer for
amplification of NDV SEQ ID NO:69 Reverse primer for amplification
of NDV SEQ ID NO:70 Forward primer for amplification of Tupaia SEQ
ID NO:71 Reverse primer for amplification of Tupaia SEQ ID NO:72
Forward primer for amplification of Mapuera SEQ ID NO:73 Reverse
primer for amplification of Mapuera SEQ ID NO:74 Forward primer for
amplification of Hendra SEQ ID NO:75 Reverse primer for
amplification of Hendra SEQ ID NO:76 Forward primer for
amplification of Nipah SEQ ID NO:77 Reverse primer for
amplification of Nipah SEQ ID NO:78 Forward primer for
amplification of HRSV SEQ ID NO:79 Reverse primer for amplification
of HRSV SEQ ID NO:80 Forward primer for amplification of Measles
SEQ ID NO:81 Reverse primer for amplification of Measles SEQ ID
NO:82 Forward primer to amplify general paramyxoviridae viruses SEQ
ID NO:83 Reverse primer to amplify general paramyxoviridae viruses
SEQ ID NO:84 G-gene coding sequence for isolate NL/1/00 (A1) SEQ ID
NO:85 G-gene coding sequence for isolate BR/2/01 (A1) SEQ ID NO:86
G-gene coding sequence for isolate FL/4/01 (A1) SEQ ID NO:87 G-gene
coding sequence for isolate FL/3/01 (A1) SEQ ID NO:88 G-gene coding
sequence for isolate FL/8/01 (A1) SEQ ID NO:89 G-gene coding
sequence for isolate FL/10/01 (A1) SEQ ID NO:90 G-gene coding
sequence for isolate NL/10/01 (A1) SEQ ID NO:91 G-gene coding
sequence for isolate NL/2/02 (A1) SEQ ID NO:92 G-gene coding
sequence for isolate NL/17/00 (A2) SEQ ID NO:93 G-gene coding
sequence for isolate NL/1/81 (A2) SEQ ID NO:94 G-gene coding
sequence for isolate NL/1/93 (A2) SEQ ID NO:95 G-gene coding
sequence for isolate NL/2/93 (A2) SEQ ID NO:96 G-gene coding
sequence for isolate NL/3/93 (A2) SEQ ID NO:97 G-gene coding
sequence for isolate NL/1/95 (A2) SEQ ID NO:98 G-gene coding
sequence for isolate NL/2/96 (A2) SEQ ID NO:99 G-gene coding
sequence for isolate NL/3/96 (A2) SEQ ID NO:100 G-gene coding
sequence for isolate NL/22/01 (A2) SEQ ID NO:101 G-gene coding
sequence for isolate NL/24/01 (A2) SEQ ID NO:102 G-gene coding
sequence for isolate NL/23/01 (A2) SEQ ID NO:103 G-gene coding
sequence for isolate NL/29/01 (A2) SEQ ID NO:104 G-gene coding
sequence for isolate NL/3/02 (A2) SEQ ID NO:105 G-gene coding
sequence for isolate NL/1/99 (B1) SEQ ID NO:106 G-gene coding
sequence for isolate NL/11/00 (B1) SEQ ID NO:107 G-gene coding
sequence for isolate NL/12/00 (B1) SEQ ID NO:108 G-gene coding
sequence for isolate NL/5/01 (B1) SEQ ID NO:109 G-gene coding
sequence for isolate NL/9/01 (B1) SEQ ID NO:110 G-gene coding
sequence for isolate NL/21/01 (B1) SEQ ID NO:111 G-gene coding
sequence for isolate NL/1/94 (B2) SEQ ID NO:112 G-gene coding
sequence for isolate NL/1/82 (B2) SEQ ID NO:113 G-gene coding
sequence for isolate NL/1/96 (B2) SEQ ID NO:114 G-gene coding
sequence for isolate NL/6/97 (B2) SEQ ID NO:115 G-gene coding
sequence for isolate NL/9/00 (B2) SEQ ID NO:116 G-gene coding
sequence for isolate NL/3/01 (B2) SEQ ID NO:117 G-gene coding
sequence for isolate NL/4/01 (B2) SEQ ID NO:118 G-gene coding
sequence for isolate UK/5/01 (B2) SEQ ID NO:119 G-protein sequence
for isolate NL/1/00 (A1) SEQ ID NO:120 G-protein sequence for
isolate BR/2/01 (A1) SEQ ID NO:121 G-protein sequence for isolate
FL/4/01 (A1) SEQ ID NO:122 G-protein sequence for isolate FL/3/01
(A1) SEQ ID NO:123 G-protein sequence for isolate FL/8/01 (A1) SEQ
ID NO:124 G-protein sequence for isolate FL/10/01 (A1) SEQ ID
NO:125 G-protein sequence for isolate NL/10/01 (A1) SEQ ID NO:126
G-protein sequence for isolate NL/2/02 (A1) SEQ ID NO:127 G-protein
sequence for isolate NL/17/00 (A2) SEQ ID NO:128 G-protein sequence
for isolate NL/1/81 (A2) SEQ ID NO:129 G-protein sequence for
isolate NL/1/93 (A2) SEQ ID NO:130 G-protein sequence for isolate
NL/2/93 (A2) SEQ ID NO:131 G-protein sequence for isolate NL/3/93
(A2) SEQ ID NO:132 G-protein sequence for isolate NL/1/95 (A2) SEQ
ID NO:133 G-protein sequence for isolate NL/2/96 (A2) SEQ ID NO:134
G-protein sequence for isolate NL/3/96 (A2) SEQ ID NO:135 G-protein
sequence for isolate NL/22/01 (A2) SEQ ID NO:136 G-protein sequence
for isolate NL/24/01 (A2) SEQ ID NO:137 G-protein sequence for
isolate NL/23/01 (A2) SEQ ID NO:138 G-protein sequence for isolate
NL/29/01 (A2) SEQ ID NO:139 G-protein sequence for isolate NL/3/02
(A2) SEQ ID NO:140 G-protein sequence for isolate NL/1/99 (B1) SEQ
ID NO:141 G-protein sequence for isolate NL/11/00 (B1) SEQ ID
NO:142 G-protein sequence for isolate NL/12/00 (B1) SEQ ID NO:143
G-protein sequence for isolate NL/5/01 (B1) SEQ ID NO:144 G-protein
sequence for isolate NL/9/01 (B1) SEQ ID NO:145 G-protein sequence
for isolate NL/21/01 (B1) SEQ ID NO:146 G-protein sequence for
isolate NL/1/94 (B2) SEQ ID NO:147 G-protein sequence for isolate
NL/1/82 (B2) SEQ ID NO:148 G-protein sequence for isolate NL/1/96
(B2) SEQ ID NO:149 G-protein sequence for isolate NL/6/97 (B2) SEQ
ID NO:150 G-protein sequence for isolate NL/9/00 (B2) SEQ ID NO:151
G-protein sequence for isolate NL/3/01 (B2) SEQ ID NO:152 G-protein
sequence for isolate NL/4/01 (B2) SEQ ID NO:153 G-protein sequence
for isolate NL/5/01 (B2) SEQ ID NO:154 F-gene coding sequence for
isolate NL/1/00 SEQ ID NO:155 F-gene coding sequence for isolate
UK/1/00 SEQ ID NO:156 F-gene coding sequence for isolate NL/2/00
SEQ ID NO:157 F-gene coding sequence for isolate NL/13/00 SEQ ID
NO:158 F-gene coding sequence for isolate NL/14/00 SEQ ID NO:159
F-gene coding sequence for isolate FL/3/01 SEQ ID NO:160 F-gene
coding sequence for isolate FL/4/01 SEQ ID NO:161 F-gene coding
sequence for isolate FL/8/01 SEQ ID NO:162 F-gene coding sequence
for isolate UK/1/01 SEQ ID NO:163 F-gene coding sequence for
isolate UK/7/01 SEQ ID NO:164 F-gene coding sequence for isolate
FL/10/01 SEQ ID NO:165 F-gene coding sequence for isolate NL/6/01
SEQ ID NO:166 F-gene coding sequence for isolate NL/8/01 SEQ ID
NO:167 F-gene coding sequence for isolate NL/10/01 SEQ ID NO:168
F-gene coding sequence for isolate NL/14/01 SEQ ID NO:169 F-gene
coding sequence for isolate NL/20/01 SEQ ID NO:170 F-gene coding
sequence for isolate NL/25/01 SEQ ID NO:171 F-gene coding sequence
for isolate NL/26/01 SEQ ID NO:172 F-gene coding sequence for
isolate NL/28/01 SEQ ID NO:173 F-gene coding sequence for isolate
NL/30/01 SEQ ID NO:174 F-gene coding sequence for isolate BR/2/01
SEQ ID NO:175 F-gene coding sequence for isolate BR/3/01 SEQ ID
NO:176 F-gene coding sequence for isolate NL/2/02 SEQ ID NO:177
F-gene coding sequence for isolate NL/4/02 SEQ ID NO:178 F-gene
coding sequence for isolate NL/5/02 SEQ ID NO:179 F-gene coding
sequence for isolate NL/6/02 SEQ ID NO:180 F-gene coding sequence
for isolate NL/7/02 SEQ ID NO:181 F-gene coding sequence for
isolate NL/9/02 SEQ ID NO:182 F-gene coding sequence for isolate
FL/1/02 SEQ ID NO:183 F-gene coding sequence for isolate NL/1/81
SEQ ID NO:184 F-gene coding sequence for isolate NL/1/93 SEQ ID
NO:185 F-gene coding sequence for isolate NL/2/93 SEQ ID NO:186
F-gene coding sequence for isolate NL/4/93 SEQ ID NO:187 F-gene
coding sequence for isolate NL/1/95 SEQ ID NO:188 F-gene coding
sequence for isolate NL/2/96 SEQ ID NO:189 F-gene coding sequence
for isolate NL/3/96 SEQ ID NO:190 F-gene coding sequence for
isolate NL/1/98 SEQ ID NO:191 F-gene coding sequence for isolate
NL/17/00 SEQ ID NO:192 F-gene coding sequence for isolate NL/22/01
SEQ ID NO:193 F-gene coding sequence for isolate NL/29/01 SEQ ID
NO:194 F-gene coding sequence for isolate NL/23/01 SEQ ID NO:195
F-gene coding sequence for isolate NL/17/01 SEQ ID NO:196 F-gene
coding sequence for isolate NL/24/01 SEQ ID NO:197 F-gene coding
sequence for isolate NL/3/02 SEQ ID NO:198 F-gene coding sequence
for isolate NL/3/98 SEQ ID NO:199 F-gene coding sequence for
isolate NL/1/99 SEQ ID NO:200 F-gene coding sequence for isolate
NL/2/99 SEQ ID NO:201 F-gene coding sequence for isolate NL/3/99
SEQ ID NO:202 F-gene coding sequence for isolate NL/11/00 SEQ ID
NO:203 F-gene coding sequence for isolate NL/12/00 SEQ ID NO:204
F-gene coding sequence for isolate NL/1/01 SEQ ID NO:205 F-gene
coding sequence for isolate NL/5/01 SEQ ID NO:206 F-gene coding
sequence for isolate NL/9/01 SEQ ID NO:207 F-gene coding sequence
for isolate NL/19/01 SEQ ID NO:208 F-gene coding sequence for
isolate NL/21/01 SEQ ID NO:209 F-gene coding sequence for isolate
UK/11/01 SEQ ID NO:210 F-gene coding sequence for isolate FL/1/01
SEQ ID NO:211 F-gene coding sequence for isolate FL/2/01 SEQ ID
NO:212 F-gene coding sequence for isolate FL/5/01 SEQ ID NO:213
F-gene coding sequence for isolate FL/7/01 SEQ ID NO:214 F-gene
coding sequence for isolate FL/9/01 SEQ ID NO:215 F-gene coding
sequence for isolate UK/10/01 SEQ ID NO:216 F-gene coding sequence
for isolate NL/1/02 SEQ ID NO:217 F-gene coding sequence for
isolate NL/1/94 SEQ ID NO:218 F-gene coding sequence for isolate
NL/1/96 SEQ ID NO:219 F-gene coding sequence for isolate NL/6/97
SEQ ID NO:220 F-gene coding sequence for isolate NL/7/00 SEQ ID
NO:221 F-gene coding sequence for isolate NL/9/00 SEQ ID NO:222
F-gene coding sequence for isolate NL/19/00 SEQ ID NO:223 F-gene
coding sequence for isolate NL/28/00 SEQ ID NO:224 F-gene coding
sequence for isolate NL/3/01 SEQ ID NO:225 F-gene coding sequence
for isolate NL/4/01 SEQ ID NO:226 F-gene coding sequence for
isolate NL/11/01 SEQ ID NO:227 F-gene coding sequence for isolate
NL/15/01 SEQ ID NO:228 F-gene coding sequence for isolate NL/18/01
SEQ ID NO:229 F-gene coding sequence for isolate FL/6/01 SEQ ID
NO:230 F-gene coding sequence for isolate UK/5/01 SEQ ID NO:231
F-gene coding sequence for isolate UK/8/01 SEQ ID NO:232 F-gene
coding sequence for isolate NL/12/02 SEQ ID NO:233 F-gene coding
sequence for isolate HK/1/02 SEQ ID NO:234 F-protein sequence for
isolate NL/1/00 SEQ ID NO:235 F-protein sequence for isolate
UK/1/00 SEQ ID NO:236 F-protein sequence for isolate NL/2/00 SEQ ID
NO:237 F-protein sequence for isolate NL/13/00 SEQ ID NO:238
F-protein sequence for isolate NL/14/00 SEQ ID NO:239 F-protein
sequence for isolate FL/3/01 SEQ ID NO:240 F-protein sequence for
isolate FL/4/01 SEQ ID NO:241 F-protein sequence for isolate
FL/8/01 SEQ ID NO:242 F-protein sequence for isolate UK/1/01 SEQ ID
NO:243 F-protein sequence for isolate UK/7/01 SEQ ID NO:244
F-protein sequence for isolate FL/10/01 SEQ ID NO:245 F-protein
sequence for isolate NL/6/01 SEQ ID NO:246 F-protein sequence for
isolate NL/8/01 SEQ ID NO:247 F-protein sequence for isolate
NL/10/01 SEQ ID NO:248 F-protein sequence for isolate NL/14/01 SEQ
ID NO:249 F-protein sequence for isolate NL/20/01 SEQ ID NO:250
F-protein sequence for isolate NL/25/01 SEQ ID NO:251 F-protein
sequence for isolate NL/26/01 SEQ ID NO:252 F-protein sequence for
isolate NL/28/01 SEQ ID NO:253 F-protein sequence for isolate
NL/30/01 SEQ ID NO:254 F-protein sequence for isolate BR/2/01 SEQ
ID NO:255 F-protein sequence for isolate BR/3/01 SEQ ID NO:256
F-protein sequence for isolate NL/2/02 SEQ ID NO:257 F-protein
sequence for isolate NL/4/02 SEQ ID NO:258 F-protein sequence for
isolate NL/5/02 SEQ ID NO:259 F-protein sequence for isolate
NL/6/02 SEQ ID NO:260 F-protein sequence for isolate NL/7/02 SEQ ID
NO:261 F-protein sequence for isolate NL/9/02 SEQ ID NO:262
F-protein sequence for isolate FL/1/02 SEQ ID NO:263 F-protein
sequence for isolate NL/1/81 SEQ ID NO:264 F-protein sequence for
isolate NL/1/93 SEQ ID NO:265 F-protein sequence for isolate
NL/2/93 SEQ ID NO:266 F-protein sequence for isolate NL/4/93 SEQ ID
NO:267 F-protein sequence for isolate NL/1/95 SEQ ID NO:268
F-protein sequence for isolate NL/2/96 SEQ ID NO:269 F-protein
sequence for isolate NL/3/96 SEQ ID NO:270 F-protein sequence for
isolate NL/1/98 SEQ ID NO:271 F-protein sequence for isolate
NL/17/00 SEQ ID
NO:272 F-protein sequence for isolate NL/22/01 SEQ ID NO:273
F-protein sequence for isolate NL/29/01 SEQ ID NO:274 F-protein
sequence for isolate NL/23/01 SEQ ID NO:275 F-protein sequence for
isolate NL/17/01 SEQ ID NO:276 F-protein sequence for isolate
NL/24/01 SEQ ID NO:277 F-protein sequence for isolate NL/3/02 SEQ
ID NO:278 F-protein sequence for isolate NL/3/98 SEQ ID NO:279
F-protein sequence for isolate NL/1/99 SEQ ID NO:280 F-protein
sequence for isolate NL/2/99 SEQ ID NO:281 F-protein sequence for
isolate NL/3/99 SEQ ID NO:282 F-protein sequence for isolate
NL/11/00 SEQ ID NO:283 F-protein sequence for isolate NL/12/00 SEQ
ID NO:284 F-protein sequence for isolate NL/1/01 SEQ ID NO:285
F-protein sequence for isolate NL/5/01 SEQ ID NO:286 F-protein
sequence for isolate NL/9/01 SEQ ID NO:287 F-protein sequence for
isolate NL/19/01 SEQ ID NO:288 F-protein sequence for isolate
NL/21/01 SEQ ID NO:289 F-protein sequence for isolate UK/11/01 SEQ
ID NO:290 F-protein sequence for isolate FL/1/01 SEQ ID NO:291
F-protein sequence for isolate FL/2/01 SEQ ID NO:292 F-protein
sequence for isolate FL/5/01 SEQ ID NO:293 F-protein sequence for
isolate FL/7/01 SEQ ID NO:294 F-protein sequence for isolate
FL/9/01 SEQ ID NO:295 F-protein sequence for isolate UK/10/01 SEQ
ID NO:296 F-protein sequence for isolate NL/1/02 SEQ ID NO:297
F-protein sequence for isolate NL/1/94 SEQ ID NO:298 F-protein
sequence for isolate NL/1/96 SEQ ID NO:299 F-protein sequence for
isolate NL/6/97 SEQ ID NO:300 F-protein sequence for isolate
NL/7/00 SEQ ID NO:301 F-protein sequence for isolate NL/9/00 SEQ ID
NO:302 F-protein sequence for isolate NL/19/00 SEQ ID NO:303
F-protein sequence for isolate NL/28/00 SEQ ID NO:304 F-protein
sequence for isolate NL/3/01 SEQ ID NO:305 F-protein sequence for
isolate NL/4/01 SEQ ID NO:306 F-protein sequence for isolate
NL/11/01 SEQ ID NO:307 F-protein sequence for isolate NL/15/01 SEQ
ID NO:308 F-protein sequence for isolate NL/18/01 SEQ ID NO:309
F-protein sequence for isolate FL/6/01 SEQ ID NO:310 F-protein
sequence for isolate UK/5/01 SEQ ID NO:311 F-protein sequence for
isolate UK/8/01 SEQ ID NO:312 F-protein sequence for isolate
NL/12/02 SEQ ID NO:313 F-protein sequence for isolate HK/1/02 SEQ
ID NO:314 F protein sequence for HMPV isolate NL/1/00 SEQ ID NO:315
F protein sequence for HMPV isolate NL/17/00 SEQ ID NO:316 F
protein sequence for HMPV isolate NL/1/99 SEQ ID NO:317 F protein
sequence for HMPV isolate NL/1/94 SEQ ID NO:318 F-gene sequence for
HMPV isolate NL/1/00 SEQ ID NO:319 F-gene sequence for HMPV isolate
NL/17/00 SEQ ID NO:320 F-gene sequence for HMPV isolate NL/1/99 SEQ
ID NO:321 F-gene sequence for HMPV isolate NL/1/94 SEQ ID NO:322 G
protein sequence for HMPV isolate NL/1/00 SEQ ID NO:323 G protein
sequence for HMPV isolate NL/17/00 SEQ ID NO:324 G protein sequence
for HMPV isolate NL/1/99 SEQ ID NO:325 G protein sequence for HMPV
isolate NL/1/94 SEQ ID NO:326 G-gene sequence for HMPV isolate
NL/1/00 SEQ ID NO:327 G-gene sequence for HMPV isolate NL/17/00 SEQ
ID NO:328 G-gene sequence for HMPV isolate NL/1/99 SEQ ID NO:329
G-gene sequence for HMPV isolate NL/1/94 SEQ ID NO:330 L protein
sequence for HMPV isolate NL/1/00 SEQ ID NO:331 L protein sequence
for HMPV isolate NL/17/00 SEQ ID NO:332 L protein sequence for HMPV
isolate NL/1/99 SEQ ID NO:333 L protein sequence for HMPV isolate
NL/1/94 SEQ ID NO:334 L-gene sequence for HMPV isolate NL/1/00 SEQ
ID NO:335 L-gene sequence for HMPV isolate NL/17/00 SEQ ID NO:336
L-gene sequence for HMPV isolate NL/1/99 SEQ ID NO:337 L-gene
sequence for HMPV isolate NL/1/94 SEQ ID NO:338 M2-1 protein
sequence for HMPV isolate NL/1/00 SEQ ID NO:339 M2-1 protein
sequence for HMPV isolate NL/17/00 SEQ ID NO:340 M2-1 protein
sequence for HMPV isolate NL/1/99 SEQ ID NO:341 M2-1 protein
sequence for HMPV isolate NL/1/94 SEQ ID NO:342 M2-1 gene sequence
for HMPV isolate NL/1/00 SEQ ID NO:343 M2-1 gene sequence for HMPV
isolate NL/17/00 SEQ ID NO:344 M2-1 gene sequence for HMPV isolate
NL/1/99 SEQ ID NO:345 M2-1 gene sequence for HMPV isolate NL/1/94
SEQ ID NO:346 M2-2 protein sequence for HMPV isolate NL/1/00 SEQ ID
NO:347 M2-2 protein sequence for HMPV isolate NL/17/00 SEQ ID
NO:348 M2-2 protein sequence for HMPV isolate NL/1/99 SEQ ID NO:349
M2-2 protein sequence for HMPV isolate NL/1/94 SEQ ID NO:350 M2-2
gene sequence for HMPV isolate NL/1/00 SEQ ID NO:351 M2-2 gene
sequence for HMPV isolate NL/17/00 SEQ ID NO:352 M2-2 gene sequence
for HMPV isolate NL/1/99 SEQ ID NO:353 M2-2 gene sequence for HMPV
isolate NL/1/94 SEQ ID NO:354 M2 gene sequence for HMPV isolate
NL/1/00 SEQ ID NO:355 M2 gene sequence for HMPV isolate NL/17/00
SEQ ID NO:356 M2 gene sequence for HMPV isolate NL/1/99 SEQ ID
NO:357 M2 gene sequence for HMPV isolate NL/1/94 SEQ ID NO:358 M
protein sequence for HMPV isolate NL/1/00 SEQ ID NO:359 M protein
sequence for HMPV isolate NL/17/00 SEQ ID NO:360 M protein sequence
for HMPV isolate NL/1/99 SEQ ID NO:361 M protein sequence for HMPV
isolate NL/1/94 SEQ ID NO:362 M gene sequence for HMPV isolate
NL/1/00 SEQ ID NO:363 M gene sequence for HMPV isolate NL/17/00 SEQ
ID NO:364 M gene sequence for HMPV isolate NL/1/99 SEQ ID NO:365 M
gene sequence for HMPV isolate NL/1/94 SEQ ID NO:366 N protein
sequence for HMPV isolate NL/1/00 SEQ ID NO:367 N protein sequence
for HMPV isolate NL/17/00 SEQ ID NO:368 N protein sequence for HMPV
isolate NL/1/99 SEQ ID NO:369 N protein sequence for HMPV isolate
NL/1/94 SEQ ID NO:370 N gene sequence for HMPV isolate NL/1/00 SEQ
ID NO:371 N gene sequence for HMPV isolate NL/17/00 SEQ ID NO:372 N
gene sequence for HMPV isolate NL/1/99 SEQ ID NO:373 N gene
sequence for HMPV isolate NL/1/94 SEQ ID NO:374 P protein sequence
for HMPV isolate NL/1/00 SEQ ID NO:375 P protein sequence for HMPV
isolate NL/17/00 SEQ ID NO:376 P protein sequence for HMPV isolate
NL/1/99 SEQ ID NO:377 P protein sequence for HMPV isolate NL/1/94
SEQ ID NO:378 P gene sequence for HMPV isolate NL/1/00 SEQ ID
NO:379 P gene sequence for HMPV isolate NL/17/00 SEQ ID NO:380 P
gene sequence for HMPV isolate NL/1/99 SEQ ID NO:381 P gene
sequence for HMPV isolate NL/1/94 SEQ ID NO:382 SH protein sequence
for HMPV isolate NL/1/00 SEQ ID NO:383 SH protein sequence for HMPV
isolate NL/17/00 SEQ ID NO:384 SH protein sequence for HMPV isolate
NL/1/99 SEQ ID NO:385 SH protein sequence for HMPV isolate NL/1/94
SEQ ID NO:386 SH gene sequence for HMPV isolate NL/1/00 SEQ ID
NO:387 SH gene sequence for HMPV isolate NL/17/00 SEQ ID NO:388 SH
gene sequence for HMPV isolate NL/1/99 SEQ ID NO:389 SH gene
sequence for HMPV isolate NL/1/94
[0639]
Sequence CWU 0
0
* * * * *
References