U.S. patent application number 10/310734 was filed with the patent office on 2003-12-18 for chimeric alphavirus replicon particles.
This patent application is currently assigned to Chiron Corporation. Invention is credited to Perri, Silvia, Polo, John M., Tang, Zequn, Thudium, Kent.
Application Number | 20030232324 10/310734 |
Document ID | / |
Family ID | 46150242 |
Filed Date | 2003-12-18 |
United States Patent
Application |
20030232324 |
Kind Code |
A1 |
Polo, John M. ; et
al. |
December 18, 2003 |
Chimeric alphavirus replicon particles
Abstract
Chimeric alphaviruses and alphavirus replicon particles are
provided including methods of making and using same. Specifically,
alphavirus particles are provided having nucleic acid molecules
derived from one or more alphaviruses and structural proteins
(capsid and/or envelope) from at least two or more alphaviruses.
Methods of making, using, and therapeutic preparations containing
the chimeric alphavirus particle, are disclosed.
Inventors: |
Polo, John M.; (Hayward,
CA) ; Perri, Silvia; (Castro Valley, CA) ;
Thudium, Kent; (Oakland, CA) ; Tang, Zequn;
(San Ramon, CA) |
Correspondence
Address: |
Chiron Corporation
Intellectual Property
P.O. Box 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
Chiron Corporation
|
Family ID: |
46150242 |
Appl. No.: |
10/310734 |
Filed: |
December 4, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10310734 |
Dec 4, 2002 |
|
|
|
10123101 |
Apr 11, 2002 |
|
|
|
60295451 |
May 31, 2001 |
|
|
|
Current U.S.
Class: |
435/5 ;
435/235.1; 435/325; 435/456; 435/69.3; 536/23.72 |
Current CPC
Class: |
C12N 2770/36162
20130101; C12Q 1/70 20130101; C07K 2319/00 20130101; C07K 14/005
20130101; C12N 15/86 20130101; A61P 31/14 20180101; C12N 7/00
20130101; C12N 2740/16222 20130101; C12N 2770/36145 20130101; C12N
2770/36122 20130101; C12N 2770/36143 20130101; C12N 2770/36134
20130101; A61K 2039/5258 20130101; C12N 2810/10 20130101; A61K
39/12 20130101; C12P 21/02 20130101; A61K 2039/5256 20130101 |
Class at
Publication: |
435/5 ; 435/69.3;
435/235.1; 435/456; 435/325; 536/23.72 |
International
Class: |
C12Q 001/70; C12N
007/00; C07H 021/04; C12P 021/02; C12N 015/86; C07H 021/02 |
Claims
What is claimed is:
1. An alphavirus replicon RNA encoding nonstructural proteins from
at least one alphavirus and one or more heterologous sequence(s),
wherein said replicon encodes a modified nsP4 polypeptide and
wherein said replicon does not comprise sequences encoding
alphavirus structural proteins.
2. The alphavirus replicon RNA of claim 1, wherein one or more
amino acids in a region corresponding to amino acid residues 363 to
404 of nsP4, numbered relative to a wild-type SIN, are
modified.
3. The alphavirus replicon RNA of claim 2, wherein one or more
amino acid residues in a region corresponding to amino acid
residues 387 to 396, numbered relative to SIN, are modified.
4. The alphavirus replicon of claim 2, wherein the modification
comprises replacing one or more wild-type amino residues with a
different amino acid.
5. The alphavirus replicon of claim 3, wherein the modification
comprises replacing one or more wild-type amino residues with a
different amino acid.
6. An alphavirus particle comprising the replicon of claim 1.
7. An alphavirus particle comprising the replicon of claim 2.
8. An alphavirus particle comprising the replicon of claim 3.
9. The replicon particle according to claim 1, wherein said
particle is a replicon particle and further wherein said RNA
comprises, in 5' to 3' order (i) a 5' sequence required for
nonstructural protein-mediated amplification, (ii) a nucleotide
sequence encoding alphavirus nonstructural proteins, (iii) a means
for expressing a heterologous nucleic acid, (iv) the heterologous
nucleic acid sequence, (v) a 3' sequence required for nonstructural
protein-mediated amplification, and (vi) a polyadenylate tract,
wherein said heterologous nucleic acid sequence replaces an
alphavirus structural protein gene.
10. The alphavirus replicon RNA of claim 1, wherein said replicon
sequences are derived from Sindbis virus (SIN).
11. The alphavirus replicon RNA of claim 1, wherein said replicon
sequences are derived from Venezuelan equine encephalitis virus
(VEE).
12. The alphavirus replicon RNA of claim 1, wherein said replicon
sequences are derived from Semliki Forest virus (SFV).
13. The alphavirus replicon particle according to claim 1, wherein
heterologous nucleic acid sequence encodes for a therapeutic agent
or an immunogen.
14. A method for producing alphavirus replicon particles,
comprising introducing into a host cell: a) an alphavirus replicon
RNA encoding nonstructural proteins from at least one alphavirus
and one or more heterologous sequence(s), wherein said replicon
encodes a modified nsP4 polypeptide and wherein said replicon does
not comprise sequences encoding alphavirus structural proteins; and
b) at least one separate defective helper RNA(s) encoding
alphavirus structural protein(s) absent from the replicon RNA;
wherein alphavirus replicon particles are produced.
15. A method of generating an immune response in a mammal, the
method comprising administering an alphavirus replicon according to
claim 13 to said mammal, thereby generating an immune response.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
10/123,101, filed Apr. 11, 2002 which in turn claims the benefit of
U.S. Serial No. 60/295,451 filed May 31, 2001, which applications
are hereby incorporated by reference in its entirety.
TECHNICAL FIELD
[0002] The present invention relates generally to chimeric
alphavirus particles. More specifically, the present invention
relates to the preparation of chimeric alphaviruses having RNA
derived from at least one alphavirus and one or more structural
elements (capsid and/or envelope) derived from at least two
different alphaviruses. The chimeric alphaviruses of the present
invention are useful in the ex vivo and in vivo administration of
heterologous genes and also have therapeutic or prophylactic
applications.
BACKGROUND
[0003] Alphaviruses comprise a set of genetically, structurally,
and serologically related arthropod-borne viruses of the
Togaviridae family. Twenty-six known viruses and virus subtypes
have been classified within the alphavirus genus, including,
Sindbis virus, Semliki Forest virus, Ross River virus, and
Venezuelan equine encephalitis virus.
[0004] Sindbis virus is the prototype member of the Alphavirus
genus of the Togaviridae family. Its replication strategy has been
well characterized in a variety of cultured cells and serves as a
model for other alphaviruses. Briefly, the genome of Sindbis (like
other alphaviruses) is an approximately 12 kb single-stranded
positive-sense RNA molecule that is capped, polyadenylated, and
contained within a virus-encoded capsid protein shell. The
nucleocapsid is further surrounded by a host-derived lipid
envelope, into which two viral-specific glycoproteins, E1 and E2,
are inserted and anchored by a cytoplasmic tail to the
nucleocapsid. Certain alphaviruses (e.g., SFV) also maintain an
additional protein, E3, which is a cleavage product of the E2
precursor protein, PE2.
[0005] After virus particle adsorption to target cells,
penetration, and uncoating of the nucleocapsid to release viral
genomic RNA into the cytoplasm, the replicative process occurs via
four alphaviral nonstructural proteins (nsPs), translated from the
5' two-thirds of the viral genome. Synthesis of a full-length
negative strand RNA, in turn, provides template for the synthesis
of additional positive strand genomic RNA and an abundantly
expressed 26S subgenomic RNA, initiated internally at the junction
region promoter. The alphavirus structural proteins are translated
from the subgenomic 26S RNA, which represents the 3' one-third of
the genome, and like the nsPs, are processed post-translationally
into the individual proteins.
[0006] Several members of the alphavirus genus are being developed
as "replicon" expression vectors for use as vaccines and
therapeutics. Replicon vectors may be utilized in several formats,
including DNA, RNA, and recombinant replicon particles. Such
replicon vectors have been derived from alphaviruses that include,
for example, SIN (Xiong et al. (1989) Science 243:1188-1191;
Dubensky et al., (1996) J. Virol. 70:508-519; Hariharan et al.
(1998) J. Virol. 72:950-958; Polo et al. (1999) PNAS 96:4598-4603),
Semliki Forest virus (Liljestrom (1991) Bio/Technology 9:1356-1361;
Berglund et al. (1998) Nat. Biotech. 16:562-565), and VEE (Pushko
et al. (1997) Virology 239:389-401). A wide body of literature has
now demonstrated efficacy of alphavirus replicon vectors for
applications such as vaccines (see for example, Dubensky et al.,
ibid; Berglund et al., ibid; Hariharan et al., ibid, Pushko et al.,
ibid; Polo et al., ibid; Davis et al. (2000) J Virol. 74:371-378;
Schlesinger & Dubensky (1999) Curr Opin. Biotechnol.
10:434-439; Berglund et al. (1999) Vaccine 17:497-507). Generally,
speaking, a "replicon" particle refers to a virus particle
containing a self-replicating nucleic acid. The replicon particle
itself is generally considered replication incompetent or
"defective," that is no progeny replicon particles will result when
a cell is infected with a replicon particle. Through the years,
several synonymous terms including recombinant viral particle,
recombinant alphavirus particle, alphavirus replicon particle and
replicon particle have emerged that are used to describe replicon
particles. However, as used herein, these terms all refer to a
virion-like unit containing a virus-derived RNA vector replicon,
specifically, an alphavirus RNA vector replicon. Moreover, these
terms may be referred to collectively as vectors, vector constructs
or gene delivery vectors.
[0007] Currently, several alphaviruses are being developed as gene
delivery systems for vaccine and other therapeutic applications.
Although generally quite similar in overall characteristics (e.g.,
structure, replication), individual alphaviruses may exhibit some
particular property (e.g., receptor binding, interferon
sensitivity, and disease profile) that is unique. To exploit the
most desirable properties from each virus a chimeric replicon
particle approach has been developed. Specifically, a chimeric
alphavirus replicon particle may have RNA derived from one virus
and one or more structural components derived from a different
virus. The viral components are generally derived from closely
related viruses; however, chimeric virus particles made from
divergent virus families are possible.
[0008] It was previously demonstrated that chimeric alphavirus
replicon particles can be generated, wherein the RNA vector is
derived from a first alphavirus and the structural "coat" proteins
(e.g., envelope glycoproteins) are derived from a second alphavirus
(see, for example U.S. patent application Ser. No. 09/236,140; see
also, U.S. Pat. Nos. 5,789,245, 5,842,723, 5,789,245, 5,842,723,
and 6,015,694; as well as WO 95/07994, WO 97/38087 and WO
99/18226). However, although previously-described strategies were
successful for making several alphavirus chimeras, such chimeric
particles are not always produced in commercially viable yields,
perhaps due to less efficient interactions between the viral RNA
and structural proteins, resulting in decreased productivity.
[0009] Thus, there remains a need for compositions comprising and
methods of making and using chimeric replicon particles and
replicons, for example for use as gene delivery vehicles having
altered cell and tissue tropism and/or structural protein surface
antigenicity.
SUMMARY
[0010] The present invention includes compositions comprising
chimeric alphaviruses and alphavirus replicon particles and methods
of making and using these particles.
[0011] In one aspect, the present invention provides chimeric
alphavirus particles, comprising RNA derived from one or more
alphaviruses; and structural proteins wherein at least one of said
structural proteins is derived from two or more alphaviruses. In
certain embodiments, the RNA is derived from a first alphavirus and
the structural proteins comprise (a) a hybrid capsid protein having
(i) an RNA binding domain derived from said first alphavirus and
(ii) an envelope glycoprotein interaction domain derived from a
second alphavirus; and (b) an envelope glycoprotein from said
second alphavirus. In other embodiments, the RNA is derived from a
first alphavirus and the structural proteins comprise (a) a capsid
protein derived from first alphavirus; and (b) an envelope
glycoprotein having (i) a cytoplasmic tail portion and (ii) a
remaining portion, wherein the cytoplasmic tail portion is derived
from said first alphavirus and the remaining portion derived from a
second alphavirus. The nucleic acid can be derived from a first
virus that is contained within a viral capsid derived from the same
virus but having envelope glycoprotein components from a second
virus. In still further embodiments, the chimeric particles
comprise hybrid capsid proteins and hybrid envelope proteins.
Furthermore, the hybrid proteins typically contain at least one
functional domain derived from a first alphavirus while the
remaining portion of the protein is derived from one or more
additional alphaviruses (e.g., envelope glycoprotein components
derived from the first virus, the second virus or a combination of
two or more viruses). The remaining portion can include 25% to 100%
(or any value therebetween) of sequences derived from different
alphaviruses. The RNA contained within a chimeric alphavirus
particle of the present invention may include one or more of the
following: an RNA comprising an alphavirus replicon vector for
expression of heterologous sequences and/or an RNA comprising the
genome of one or more alphaviruses (e.g., for use as an attenuated
live virus vaccine).
[0012] Thus, the modified (or chimeric) alphavirus particles (e.g.,
replicon particles) of the present invention include, but are not
limited to, particles comprising a nucleic acid derived from one or
more alphaviruses that is contained within at least one structural
element (capsid and/or envelope protein) derived from two or more
alphaviruses (e.g., provided by defective helpers or other
structural protein gene expression cassettes). For example, the
chimeric particles comprise RNA from a first alphavirus, a hybrid
capsid protein with an RNA binding domain from the first alphavirus
and an envelope glycoprotein interaction domain from a second
alphavirus, and an envelope glycoprotein from the second
alphavirus. In other embodiments, the particles of the present
invention comprise RNA from a first alphavirus, a capsid protein
the first alphavirus and an envelope glycoprotein that has a
cytoplasmic tail from the first alphavirus with the remaining
portion of the envelope glycoprotein derived from a second
alphavirus. In still another embodiment, the chimeric alphavirus
particles comprise RNA from a first alphavirus, the RNA having a
packaging signal derived from a second alphavirus inserted, for
example, in a nonstructural protein gene region that is deleted,
and a capsid protein and envelope glycoprotein from the second
alphavirus.
[0013] In another aspect, the invention includes chimeric
alphavirus particles comprising (a) RNA encoding one or more
nonstructural proteins derived from a first alphavirus and a
packaging signal derived from a second alphavirus different from
said first alphavirus (e.g., a packaging signal inserted into a
site selected from the group consisting of the junction of nsP3
with nsP4, following the open reading frame of nsP4, and a deletion
in a nonstructural protein gene); (b) a capsid protein derived from
said second alphavirus; and (c) an envelope protein derived from an
alphavirus different from said first alphavirus. In certain
embodiments, the envelope protein is derived from the second
alphavirus.
[0014] In any of the chimeric replicon particles described herein,
the RNA can comprises, in 5' to 3' order (i) a 5' sequence required
for nonstructural protein-mediated amplification, (ii) a nucleotide
sequence encoding alphavirus nonstructural proteins, (iii) a means
for expressing a heterologous nucleic acid (e.g., a viral junction
region promoter), (iv) the heterologous nucleic acid sequence
(e.g., an immunogen), (v) a 3' sequence required for nonstructural
protein-mediated amplification, and (vi) a polyadenylate tract. In
certain embodiments, the heterologous nucleic acid sequence
replaces an alphavirus structural protein gene. Further, in any of
the embodiments described herein, the chimeras are comprised of
sequences derived from Sindbis virus (SIN) and Venezuelan equine
encephalitis virus (VEE), for example where the first alphavirus is
VEE and the second alphavirus is SIN or where the first alphavirus
is VEE and second is SIN.
[0015] In other aspects, the invention includes an alphavirus
replicon RNA comprising a 5' sequence required for nonstructural
protein-mediated amplification, sequences encoding biologically
active alphavirus nonstructural proteins, an alphavirus subgenomic
promoter, a non-alphavirus heterologous sequence, and a 3' sequence
required for nonstructural protein-mediated amplification, wherein
the sequence encoding at least one of said nonstructural proteins
is derived from a Biosafety Level 3 (BSL-3) alphavirus and wherein
the sequences of said replicon RNA exhibit sequence identity to at
least one third but no more than two-thirds of a genome of a BSL-3
alphavirus. In certain embodiments, cDNA copies of these replicons
are included as nucleic acid vector sequences in a Eukaryotic
Layered Vector Initiation System (ELVIS) vector, for example an
ELVIS vector comprising a 5' promoter which is capable of
initiating within a eukaryotic cell the synthesis of RNA from cDNA,
and the nucleic acid vector sequence which is capable of directing
its own replication and of expressing a heterologous sequence. The
BSL-3 alphavirus can be, for example, Venezuelan equine
encephalitis virus (VEE).
[0016] In any of the chimeric particles and replicons described
herein, the RNA can further comprise a heterologous nucleic acid
sequences, for example, a therapeutic agent or an immunogen
(antigen). The heterologous nucleic acid sequence can replace one,
more than one, or all of the structural protein coding sequences.
Further the heterologous nucleotide sequence can encode, for
example, a polypeptide antigen derived from a pathogen (e.g., an
infectious agent such as a virus, bacteria, fungus or parasite). In
preferred embodiments, the antigen is derived from a virus such as
human immunodeficiency virus (HIV) (e.g. gag, gp120, gp140, gp160
pol, rev, tat, and nef), a hepatitis C virus (HCV) (e.g., C, E1,
E2, NS3, NS4 and NS5), an influenza virus (e.g., HA, NA, NP, M), a
paramyxovirus such as parainfluenza virus or respiratory syncytial
virus or measles virus (e.g., NP, M, F, HN, H), a herpes virus
(e.g., glycoprotein B, glycoprotein D), a Filovirus such as Marburg
or Ebola virus (e.g., NP, GP), a bunyavirus such as Hantaan virus
or Rift Valley fever virus (e.g., G1, G2, N), or a flavivirus such
as tick-borne encephalitis virus or West Nile virus (e.g., C, prM,
E, NS1, NS3, NS5). In any of compositions or methods described
herein, the RNA can further comprise a packaging signal from a
second alphavirus inserted within a deleted non-essential region of
a nonstructural protein 3 gene (nsP3 gene).
[0017] In another aspect, methods of preparing (producing)
alphaviral replicon particles are provided. In certain embodiments,
the particles are prepared by introducing any of the replicon and
defective helper RNAs described herein into a suitable host cell
under conditions that permit formation of the particles. In any of
the methods described herein, the defective helper RNAs can include
chimeric and/or hybrid structural proteins (or sequences encoding
these chimeric/hybrid proteins) as described herein. For example,
in certain embodiments, the method comprises introducing into a
host cell: (a) an alphavirus replicon RNA derived from one or more
alphaviruses, further containing one or more heterologous
sequence(s); and (b) at least one separate defective helper RNA(s)
encoding structural protein(s) absent from the replicon RNA,
wherein at least one of said structural proteins is derived from
two or more alphaviruses, wherein alphavirus replicon particles are
produced. The replicon RNA can be derived from one or more
alphaviruses and the structural proteins can include one or more
hybrid proteins, for example, a hybrid capsid protein having an RNA
binding domain derived from a first alphavirus and an envelope
glycoprotein interaction domain derived from a second alphavirus;
and/or a hybrid envelope protein having a cytoplasmic tail portion
and a remaining portion, wherein the cytoplasmic tail portion is
derived from a first alphavirus and the remaining portion of said
envelope glycoprotein derived from one or more alphaviruses
different than the first.
[0018] In yet another aspect, the invention provides a method for
producing alphavirus replicon particles, comprising introducing
into a host cell (a) an alphavirus replicon RNA encoding one or
more nonstructural proteins from a first alphavirus, a packaging
signal derived from a second alphavirus, (e.g., inserted into a
site selected from the group consisting of the junction of nsP3
with nsP4, following the nsP4 open reading frame and and a deleted
region of a nonstructural protein gene) and one or more
heterologous sequence(s); and (b) at least one separate defective
helper RNA(s) encoding structural protein(s) absent from the
replicon RNA, wherein at least one of said structural proteins is a
capsid protein derived from said second alphavirus, and at least
one of said structural proteins is an envelope protein derived from
an alphavirus different from said first alphavirus.
[0019] In yet another aspect, the invention includes alphavirus
packaging cell lines comprising one or more structural protein
expression cassettes comprising sequences encoding one or more
structural proteins, wherein at least one of said structural
proteins is derived from two or more alphaviruses. In certain
embodiments, one or more structural protein expression cassettes
comprise cDNA copies of a defective helper RNA and, optionally, an
alphavirus subgenomic promoter. Further, in any of these
embodiments, the defective helper RNA can direct expression of the
structural protein(s).
[0020] In yet another aspect, methods of producing viral replicon
particles using packaging cell lines are provided. Typically, the
methods comprise introducing, into any of the alphavirus packaging
cell lines described herein, any of the alphavirus replicon RNAs
described herein, wherein an alphavirus particle comprising one or
more heterologous RNA sequence(s) is produced. Thus, in certain
embodiments, the RNA will include a packaging signal insertion
derived from a different alphavirus, inserted for example into a
region of nonstructural protein gene deletion. In other
embodiments, the packaging cell comprises three separate RNA
molecules, for example, a first defective helper RNA molecule
encodes for viral capsid structural protein(s), a second defective
helper RNA molecule encodes for one or more viral envelope
structural glycoprotein(s) and a third replicon RNA vector which
comprises genes encoding for required nonstructural replicase
proteins and a heterologous gene of interest substituted for viral
structural proteins, wherein at least one of the RNA molecules
includes sequences derived from two or more alphaviruses.
Modifications can be made to any one or more of the separate
nucleic acid molecules introduced into the cell (e.g., packaging
cell) for the purpose of generating chimeric alphavirus replicon
particles. For example, a first defective helper RNA can be
prepared having a gene that encodes for a hybrid capsid protein as
described herein. In one embodiment, the hybrid capsid protein has
an RNA binding domain derived from a first alphavirus and a
glycoprotein interaction domain from a second alphavirus. A second
defective helper RNA may have a gene or genes that encodes for an
envelope glycoprotein(s) from a second alphavirus, while the
replicon vector RNA is derived from a first alphavirus. In other
embodiments, an RNA replicon vector construct is derived from a
first alphavirus having a packaging signal from a second
alphavirus, inserted for example, in a nonstructural protein gene
region that is deleted. The first and second defective helper RNAs
have genes that encode for capsid protein or envelope proteins from
the second alphavirus. In other embodiments, a chimeric alphavirus
replicon particle is made using a first defective helper RNA
encoding a capsid protein (derived from a first alphavirus that is
the same as the replicon vector source virus) and a second
defective helper RNA having a gene that encodes for a hybrid
envelope glycoprotein having a cytoplasmic tail fragment from the
same alphavirus as the capsid protein of the first helper RNA and a
surface-exposed "ectodomain" of the glycoprotein derived from a
second alphavirus. The tail fragment interacts with the capsid
protein and a chimeric replicon particle having RNA and a capsid
derived from a first virus, and an envelope derived primarily from
a second virus results.
[0021] In another aspect, the invention provides a method for
producing alphavirus replicon particles, comprising introducing
into a permissible cell, (a) any of the alphavirus replicon RNAs
described herein comprising control elements and
polypeptide-encoding sequences encoding (i) biologically active
alphavirus nonstructural proteins and (ii) a heterologous protein,
and (b) one or more defective helper RNA(s) comprising control
elements and polypeptide-encoding sequences encoding at least one
alphavirus structural protein, wherein the control elements can
comprise, in 5' to 3' order, a 5' sequence required for
nonstructural protein-mediated amplification, a means for
expressing the polypeptide-encoding sequences, and a 3' sequence
required for nonstructural protein-mediated amplification, and
further wherein one or more of said RNA replicon control elements
are different than said defective helper RNA control elements; and
incubating said cell under suitable conditions for a time
sufficient to permit production of replicon particles. In certain
embodiments, the replicon RNA and said defective helper RNA(s)
further comprise a subgenomic 5'-NTR. In other embodiments, the
subgenomic 5'-NTR of the replicon RNA is different that the
subgenomic 5'-NTR of the defective helper RNA; the 5' sequence
required for nonstructural protein-mediated amplification of the
replicon RNA is different than the 5' sequence required for
nonstructural protein-mediated amplification of the defective
helper RNA; the 3' sequence required for nonstructural
protein-mediated amplification of the replicon RNA is different
than the 3' sequence required for nonstructural protein-mediated
amplification of the defective helper RNA; and/or the means for
expressing said polypeptide-encoding sequences of the replicon RNA
is different than the means for expressing said
polypeptide-encoding sequences of the defective helper RNA.
[0022] In still further aspects, methods are provided for
stimulating an immune response within a warm-blooded animal,
comprising the step of administering to a warm-blooded animal a
preparation of alphavirus replicon particles according to the
present invention expressing one or more antigens derived from at
least one pathogenic agent. In certain embodiments, the antigen is
derived from a tumor cell. In other embodiments, the antigen is
derived from an infectious agent (e.g., virus, bacteria, fungus or
parasite). In preferred embodiments, the antigen is derived from a
human immunodeficiency virus (HIV) (e.g. gag, gp120, gp140, gp160
pol, rev, tat, and nef), a hepatitis C virus (HCV) (e.g., C, E1,
E2, NS3, NS4 and NS5), an influenza virus (e.g., HA, NA, NP, M), a
paramyxovirus such as parainfluenza virus or respiratory syncytial
virus or measles virus (e.g., NP, M, F, HN, H), a herpes virus
(e.g., glycoprotein B, glycoprotein D), a Filovirus such as Marburg
or Ebola virus (e.g., NP, GP), a bunyavirus such as Hantaan virus
or Rift Valley fever virus (e.g., G1, G2, N), or a flavivirus such
as tick-borne encephalitis virus or West Nile virus (e.g., C, prM,
E, NS1, NS3, NS5). Any of the methods described herein can further
comprise the step of administering a lymphokine, chemokine and/or
cytokine (e.g., IL-2, IL-10, IL-12, gamma interferon, GM-CSF,
M-CSF, SLC, MIP3.alpha., and MIP3 p). The lymphokine, chemokine
and/or cytokine can be administered as a polypeptide or can be
encoded by a polynucleotide (e.g., on the same or a different
replicon that encodes the antigen(s)). Alternatively, a replicon
particle of the present invention encoding a lymphokine, chemokine
and/or cytokine may be used as a to stimulate an immune
response.
[0023] In yet other aspects, methods are provided for stimulating
an immune response within a warm-blooded animal (e.g., an
alphavirus-specific immune response), comprising the step of
administering to a warm-blooded animal a composition comprising
chimeric alphavirus particles described herein, for example
alphavirus particles containing an alphavirus genome RNA that is
either unmodified (e.g., naturally occurring) or modified (e.g.,
insertion of a heterologous packaging signal into a region of
nonstructural protein deletion).
[0024] Thus, in any of the compositions and methods described
herein, sequences and/or structural proteins are derived from at
least two alphaviruses, for example Venezuelan equine encephalitis
virus (VEE) and Sindbis virus (SIN).
[0025] In other aspects, methods are provided to produce alphavirus
replicon particles and reduce the probability of generating
replication-competent virus (e.g., wild-type virus) during
production of said particles, comprising introducing into a
permissible cell an alphavirus replicon RNA and one or more
defective helper RNA(s) encoding at least one alphavirus structural
protein, and incubating said cell under suitable conditions for a
time sufficient to permit production of replicon particles, wherein
said replicon RNA comprises a 5' sequence required for
nonstructural protein-mediated amplification, sequences which, when
expressed, code for biologically active alphavirus nonstructural
proteins, a means to express one or more heterologous sequences, a
heterologous sequence that is a protein-encoding gene, said gene
being the 3' proximal gene within the replicon, a 3' sequence
required for nonstructural protein-mediated amplification, a
polyadenylate tract, and optionally a subgenomic 5'-NTR; and
wherein said defective helper RNA comprises a 5' sequence required
for nonstructural protein-mediated amplification, a means to
express one or more alphavirus structural proteins, a sequence
encoding one or more alphavirus structural proteins, the sequence
encoding the 3' proximal gene within the defective helper, a 3'
sequence required for nonstructural protein-mediated amplification,
a polyadenylate tract, and optionally a subgenomic 5'-NTR; and
wherein said replicon RNA differs from at least one defective
helper RNA in at least one element selected from the group
consisting of a 5' sequence required for nonstructural
protein-mediated amplification, a means for expressing a 3'
proximal gene, a subgenomic 5' NTR, and a 3' sequence required for
nonstructural protein-mediated amplification.
[0026] In another aspect, provided herein is an alphavirus replicon
RNA encoding nonstructural proteins from at least one alphavirus
and one or more heterologous sequence(s) (e.g., a sequence encoding
a therapeutic agent, an immunogen, etc.), wherein said replicon
encodes a modified nsP4 polypeptide and wherein said replicon does
not comprise sequences encoding alphavirus structural proteins. One
or more amino acids may be modified (e.g., deleted, added and/or
replaced) at one or more residues of the nsP4 polypeptide. In
certain embodiments, the modification(s) is(are) in a conserved
region of nsP4, for example in the region corresponding to amino
acid residues 363 to 404, numbered relative to SIN (or any region
or amino acids therein including but not limited to one or more of
the amino acids in the region corresponding to amino acid residues
387 to 394, numbered relative to SIN). Any of the particles
described herein may comprise, in 5' to 3' order (i) a 5' sequence
required for nonstructural protein-mediated amplification, (ii) a
nucleotide sequence encoding alphavirus nonstructural proteins,
(iii) a means for expressing a heterologous nucleic acid, (iv) the
heterologous nucleic acid sequence, (v) a 3' sequence required for
nonstructural protein-mediated amplification, and (vi) a
polyadenylate tract, wherein said heterologous nucleic acid
sequence replaces an alphavirus structural protein gene.
[0027] In yet another aspect, the invention includes an alphavirus
particle comprising any of the alphavirus replicon RNAs described
herein. In any of the alphavirus replicons and/or particles
containing these replicons, some or all of the sequences can be
derived from Venezuelan equine encephalitis virus (VEE), Sindbis
(SIN), Semliki Forest virus (SFV) or combinations of these and
other alphaviruses.
[0028] In yet another aspect, provided herein is a method for
producing alphavirus replicon particles, comprising introducing
into a host cell (a) an alphavirus replicon RNA as described herein
(e.g., an alphavirus replicon RNA encoding nonstructural proteins
from at least one alphavirus and one or more heterologous
sequence(s), wherein said replicon encodes a modified nsP4
polypeptide and wherein said replicon does not comprise sequences
encoding alphavirus structural proteins); and (b) at least one
separate defective helper RNA(s) encoding alphavirus structural
protein(s) absent from the replicon RNA, wherein alphavirus
replicon particles are produced.
[0029] In yet another aspect, described herein is a method of
generating an immune response in a mammal by administering an
alphavirus replicon as described herein to the mammal, thereby
generating an immune response.
[0030] These and other aspects and embodiments of the invention
will become evident upon reference to the following detailed
description, attached figures and various references set forth
herein that describe in more detail certain procedures or
compositions (e.g., plasmids, sequences, etc.).
BRIEF DESCRIPTION OF THE FIGURES
[0031] FIG. 1 depicts Venezuelan equine encephalitis virus (VEE)
gene synthesis fragments and restriction sites used for assembly of
a VEE replicon.
[0032] FIG. 2 depicts the oligonucleotide-based synthesis of VEE
nsP fragment 2. (SEQ ID NO 51 and SEQ ID NO 52).
[0033] FIG. 3 depicts VEE gene synthesis fragments and restriction
sites used for assembly of structural protein genes.
[0034] FIG. 4 depicts hybrid capsid protein for the efficient
production of chimeric Sindbis virus (SIN)/VEE alphavirus
particles.
[0035] FIG. 5 depicts hybrid E2 glycoprotein for the efficient
production of chimeric SIN/VEE alphavirus particles.
[0036] FIG. 6 depicts VEE replicons with heterologous SIN packaging
signal for efficient packaging using SIN structural proteins.
[0037] FIG. 7 depicts SIN packaging signal insertion at
nsP4/truncated junction region promoter (as used in Chimera 1A made
in accordance with the teachings of the present invention).
[0038] FIG. 8 depicts SIN packaging signal insertion at
nsP4/non-truncated junction region promoter (as used in Chimera 1B
made in accordance with the teachings of the present
invention).
[0039] FIG. 9 depicts SIN/VFE packaging Chimera number 2 insertion
of SIN packaging signal into a VEE nonstructural protein gene
(nsP3) deletion.
[0040] FIG. 10 depicts SIN/VEE packaging chimera number 3 insertion
of SIN packaging signal at carboxy-terminus of VEE nsP3.
[0041] FIG. 11 depicts modification of nsP3/nsP4 termini for SIN
packaging signal
[0042] FIG. 12 is a graph depicting immunogenicity of alphavirus
replicon particle chimeras expressing an HIV antigen. In
particular, the graph depicts HIV p55gag-specific CD8+ T cell
responses in mice primed with alphavirus replicon encoding HIV gag
sequences.
[0043] FIG. 13 is a graph depicting immunogenicity of alphavirus
replicon particle chimeras expressing an HIV antigen. In
particular, the graph depicts HIV p55gag-specific CD8+ T cell
responses in mice primed with alphavirus replicon encoding HIV gag
sequences and boosted with alphavirus replicon particles.
[0044] FIG. 14 depicts an alignment of the amino acid sequences of
a portion of polymerases of several viruses, including alphaviruses
(SIN, VEE and SFV) and a plant virus (BMV). The amino acid number
shown in parentheses refers to the first amino acid shown in FIG.
14, numbered relative to the wild-type amino acid sequence of the
virus shown.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, molecular biology, immunology and pharmacology,
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Remington's Pharmaceutical Sciences,
18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Methods
In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press,
Inc.); and Handbook of Experimental Immunology, Vols. I-UV (D. M.
Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific
Publications); Sambrook, et al., Molecular Cloning: A Laboratory
Manual (2nd Edition, 1989); Handbook of Surface and Colloidal
Chemistry (Birdi, K. S. ed., CRC Press, 1997); Short Protocols in
Molecular Biology, 4th ed. (Ausubel et al. eds., 1999, John Wiley
& Sons); Molecular Biology Techniques: An Intensive Laboratory
Course, (Ream et al., eds., 1998, Academic Press); PCR
(Introduction to Biotechniques Series), 2nd ed. (Newton &
Graham eds., 1997, Springer Verlag); Peters and Dalrymple, Fields
Virology (2d ed), Fields et al. (eds.), B. N. Raven Press, New
York, N.Y.
[0046] All publications, patents and patent applications cited
herein, whether supra or infra, are hereby incorporated by
reference in their entirety.
[0047] As used in this specification and the appended claims, the
singular forms "a," "an" and "the" include plural references unless
the content clearly dictates otherwise. Thus, for example,
reference to "a particle" includes a mixture of two or more such
particles.
[0048] Prior to setting forth the invention definitions of certain
terms that will be used hereinafter are set forth.
[0049] A "nucleic acid" molecule can include, but is not limited
to, prokaryotic sequences, eukaryotic mRNA or other RNA, cDNA from
eukaryotic mRNA or other RNA, genomic DNA sequences from eukaryotic
(e.g., mammalian) DNA, and even synthetic DNA sequences. The term
also captures sequences that include any of the known base analogs
of DNA and RNA and includes modifications such as deletions,
additions and substitutions (generally conservative in nature), to
the native sequence. These modifications may be deliberate, as
through site-directed mutagenesis, or may be accidental.
Modifications of polynucleotides may have any number of effects
including, for example, facilitating expression of the polypeptide
product in a host cell.
[0050] The terms "polypeptide" and "protein" refer to a polymer of
amino acid residues and are not limited to a minimum length of the
product. Thus, peptides, oligopeptides, dimers, multimers, and the
like, are included within the definition. Both full-length proteins
and fragments thereof are encompassed by the definition. The terms
also include postexpression modifications of the polypeptide, for
example, glycosylation, acetylation, phosphorylation and the like.
Furthermore, for purposes of the present invention, a "polypeptide"
refers to a protein that includes modifications, such as deletions,
additions and substitutions (generally conservative in nature), to
the native sequence, so long as the protein maintains the desired
activity. These modifications may be deliberate, as through
site-directed mutagenesis, or may be accidental, such as through
mutations of hosts that produce the proteins or errors due to PCR
amplification. Furthermore, modifications may be made that have one
or more of the following effects: reducing toxicity; facilitating
cell processing (e.g., secretion, antigen presentation, etc.); and
facilitating presentation to B-cells and/or T-cells. The terms
"polypeptide," and "protein" are used interchangeably herein to
denote any polymer of amino acid residues. The terms encompass
peptides, oligopeptides, dimers, multimers, and the like. Such
polypeptides can be derived from natural sources or can be
synthesized or recombinantly produced. The terms also include
postexpression modifications of the polypeptide, for example,
glycosylation, acetylation, phosphorylation, etc.
[0051] A polypeptide as defined herein is generally made up of the
20 natural amino acids Ala (A), Arg (R), Asn (N), Asp (D), Cys (C),
Gln (O), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met
(M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y) and Val
(V) and may also include any of the several known amino acid
analogs, both naturally occurring and synthesized analogs, such as
but not limited to homoisoleucine, asaleucine,
2-(methylenecyclopropyl)glycine, S-methylcysteine,
S-(prop-1-enyl)cysteine, homoserine, ornithine, norleucine,
norvaline, homoarginine, 3-(3-carboxyphenyl)alanine,
cyclohexylalanine, mimosine, pipecolic acid, 4-methylglutamic acid,
canavanine, 2,3-diaminopropionic acid, and the like. Further
examples of polypeptide agents that will find use in the present
invention are set forth below.
[0052] By "wild type" polypeptide, polypeptide agent or polypeptide
drug, is meant a naturally occurring polypeptide sequence (and,
optionally, its corresponding secondary structure). An "isolated"
or "purified" protein or polypeptide is a protein that is separate
and discrete from a whole organism with which the protein is
normally associated in nature. It is apparent that the term denotes
proteins of various levels of purity. Typically, a composition
containing a purified protein will be one in which at least about
35%, preferably at least about 40-50%, more preferably, at least
about 75-85%, and most preferably at least about 90% or more, of
the total protein in the composition will be the protein in
question.
[0053] By "nsP4 polypeptide" is meant a molecule derived from a
non-structural protein 4 region of a virus polyprotein. nsP4
polypeptides are generally expressed as part of an alphavirus
nonstructural polyprotein that is subsequently cleaved
post-translationally. Alphaviral nsP4 polypeptides typically
exhibit polymerase activity within an alphavirus replicase complex.
The nsP4 sequence has been published for a variety of alphaviruses
(e.g., Strauss et al., 1984, Virology 133:92-110; Takkinen 1986,
Nucleic Acids Res. 14:5667-5682; Kinney et al., 1989, Virology,
170:19-30). The polypeptide sequence of nsP4 is generally of
similar length among alphaviruses (e.g., 607 amino acids for VEE,
610 amino acids for SIN, 614 amino acids for SFV) and the overall
sequence is generally well conserved among the alphaviruses, based
on alignment of published sequences (Kinney, ibid). Specific amino
acids sequences contemplated for modification according to the
present invention can be found for example in any region,
particularly regions exhibiting high sequence homology.
Non-limiting examples of such regions correspond to SIN nsP4 amino
acids 1-17, 59-76, 101-111, 120-153, 157-177, 180-240, 255-360,
362-412, 414-417, 419-454, 459-510, 512-535, and 539-549, numbered
relative to a wild-type SIN (e.g., Strauss et al. (1984) Virology
133:92-110). FIG. 14 depicts an alignment of regions of nsP4 from
SIN, VEE, and SFV, as well as BMV2a, encompassing SIN amino acids
361-405. Furthermore, an "nsP4 polypeptide" as defined herein is
not limited to a polypeptide having the exact sequence described
herein. Indeed, alphaviral genomes are often in flux and contain
several variable domains that exhibit relatively high degrees of
variability between species and isolated. It is readily apparent
that the terms encompass nsP4 polypeptides from any of the
identified alphaviruses, as well as newly identified isolates, and
subtypes of these isolates. Descriptions of structural features are
typically given herein with reference to a Sindbis virus, for
example the SIN sequence described in Strauss et al. (1984)
Virology 133:92-110. One of ordinary skill in the art in view of
the teachings of the present disclosure and the art can determine
corresponding regions in other alphaviruses (e.g., VEE, SFV, WEE,
etc) (see, e.g., Virology, 3rd Edition (W. K. Joklik ed. 1988);
Fundamental Virology, 2nd Edition (B. N. Fields and D. M. Knipe,
eds. 1991); Virology, 3rd Edition (Fields, BN, DM Knipe, PM Howley,
Editors, 1996, Lippincott-Raven, Philadelphia, Pa.; for a
description of these and other related viruses and Weaver et al.
(1993) 197:375-390 and 202:1083 for a comparison of various
alphavirus nucleotide sequences), using for example, sequence
comparison programs (e.g., BLAST and others described herein) or
identification and alignment of structural features (e.g., a
program such as the "ALB" program described herein that can
identify polymerase regions). The actual amino acid sequences of
the modified nsP4 sequences can be based on any alphavirus.
[0054] Additionally, the term "nsP4 polypeptide" encompasses
proteins or sequences encoding these proteins that include
additional modifications to the native sequence, such as additional
internal deletions, additions and substitutions. These
modifications may be deliberate, as through site-directed
mutagenesis, or may be accidental, such as through naturally
occurring mutational events. Thus, a "modified nsP4 polypeptide" is
an nsP4 polypeptide that has been manipulated to delete or replace
one, more than one or all of the amino acid residues in the
polymerase region of the polypeptide. Similarly, the term "modified
nsP4-encoding sequence" refers to a polynucleotide sequence that
encodes a modified nsP4 polypeptide. Generally, modified nsP4
polypeptides as described herein, typically result in the reduction
or elimination of inter-strand transfer. Further, it is to be
understood that other modifications of nsP4 are also encompassed by
the present invention.
[0055] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, a given promoter operably linked to a
coding sequence is capable of effecting the expression of the
coding sequence when the proper enzymes are present. The promoter
need not be contiguous with the coding sequence, so long as it
functions to direct the expression thereof. Thus, for example,
intervening untranslated yet transcribed sequences can be present
between the promoter sequence and the coding sequence and the
promoter sequence can still be considered "operably linked" to the
coding sequence.
[0056] Techniques for determining amino acid sequence "similarity"
are well known in the art. In general, "similarity" means the exact
amino acid to amino acid comparison of two or more polypeptides at
the appropriate place, where amino acids are identical or possess
similar chemical and/or physical properties such as charge or
hydrophobicity. A so-termed "percent similarity" then can be
determined between the compared polypeptide sequences. Techniques
for determining nucleic acid and amino acid sequence identity also
are well known in the art and include determining the nucleotide
sequence of the mRNA for that gene (usually via a cDNA
intermediate) and determining the amino acid sequence encoded
thereby, and comparing this to a second amino acid sequence. In
general, "identity" refers to an exact nucleotide to nucleotide or
amino acid to amino acid correspondence of two polynucleotides or
polypeptide sequences, respectively.
[0057] Two or more polynucleotide sequences can be compared by
determining their "percent identity." Two or more amino acid
sequences likewise can be compared by determining their "percent
identity." The percent identity of two sequences, whether nucleic
acid or peptide sequences, is generally described as the number of
exact matches between two aligned sequences divided by the length
of the shorter sequence and multiplied by 100. An approximate
alignment for nucleic acid sequences is provided by the local
homology algorithm of Smith and Waterman, Advances in Applied
Mathematics 2:482-489 (1981). This algorithm can be extended to use
with peptide sequences using the scoring matrix developed by
Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff
ed., 5 suppl. 3:353-358, National Biomedical Research Foundation,
Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res.
14(6):6745-6763 (1986). An implementation of this algorithm for
nucleic acid and peptide sequences is provided by the Genetics
Computer Group (Madison, Wis.) in their BestFit utility
application. The default parameters for this method are described
in the Wisconsin Sequence Analysis Package Program Manual, Version
8 (1995) (available from Genetics Computer Group, Madison, Wis.).
Other equally suitable programs for calculating the percent
identity or similarity between sequences are generally known in the
art.
[0058] For example, percent identity of a particular nucleotide
sequence to a reference sequence can be determined using the
homology algorithm of Smith and Waterman with a default scoring
table and a gap penalty of six nucleotide positions. Another method
of establishing percent identity in the context of the present
invention is to use the MPSRCH package of programs copyrighted by
the University of Edinburgh, developed by John F. Collins and Shane
S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain
View, Calif.). From this suite of packages, the Smith-Waterman
algorithm can be employed where default parameters are used for the
scoring table (for example, gap open penalty of 12, gap extension
penalty of one, and a gap of six). From the data generated, the
"Match" value reflects "sequence identity." Other suitable programs
for calculating the percent identity or similarity between
sequences are generally known in the art, such as the aligmnent
program BLAST, which can also be used with default parameters. For
example, BLASTN and BLASTP can be used with the following default
parameters: genetic code=standard; filter=none; strand=both;
cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences;
sort by=HIGH SCORE; Databases=non-redundant,
GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss
protein+Spupdate+PIR. Details of these programs can be found at the
following internet address:
http://www.ncbi.nlm.gov/cgi-bin/BLAST.
[0059] One of skill in the art can readily determine the proper
search parameters to use for a given sequence in the above
programs. For example, the search parameters may vary based on the
size of the sequence in question. Thus, for example, a
representative embodiment of the present invention would include an
isolated polynucleotide having X contiguous nucleotides, wherein
(i) the X contiguous nucleotides have at least about 50% identity
to Y contiguous nucleotides derived from any of the sequences
described herein, (ii) X equals Y, and (iii) X is greater than or
equal to 6 nucleotides and up to 5000 nucleotides, preferably
greater than or equal to 8 nucleotides and up to 5000 nucleotides,
more preferably 10-12 nucleotides and up to 5000 nucleotides, and
even more preferably 15-20 nucleotides, up to the number of
nucleotides present in the full-length sequences described herein
(e.g., see the Sequence Listing and claims), including all integer
values falling within the above-described ranges.
[0060] Two nucleic acid fragments are considered to "selectively
hybridize" as described herein. The degree of sequence identity
between two nucleic acid molecules affects the efficiency and
strength of hybridization events between such molecules. A
partially identical nucleic acid sequence will at least partially
inhibit a completely identical sequence from hybridizing to a
target molecule. Inhibition of hybridization of the completely
identical sequence can be assessed using hybridization assays that
are well known in the art (e.g., Southern blot, Northern blot,
solution hybridization, or the like, see Sambrook, et al.,
Molecular Cloning. A Laboratory Manual, Second Edition, (1989) Cold
Spring Harbor, N.Y.). Such assays can be conducted using varying
degrees of selectivity, for example, using conditions varying from
low to high stringency. If conditions of low stringency are
employed, the absence of non-specific binding can be assessed using
a secondary probe that lacks even a partial degree of sequence
identity (for example, a probe having less than about 30% sequence
identity with the target molecule), such that, in the absence of
non-specific binding events, the secondary probe will not hybridize
to the target.
[0061] When utilizing a hybridization-based detection system, a
nucleic acid probe is chosen that is complementary to a target
nucleic acid sequence, and then by selection of appropriate
conditions the probe and the target sequence "selectively
hybridize," or bind, to each other to form a hybrid molecule. A
nucleic acid molecule that is capable of hybridizing selectively to
a target sequence under "moderately stringent" typically hybridizes
under conditions that allow detection of a target nucleic acid
sequence of at least about 10-14 nucleotides in length having at
least approximately 70% sequence identity with the sequence of the
selected nucleic acid probe. Stringent hybridization conditions
typically allow detection of target nucleic acid sequences of at
least about 10-14 nucleotides in length having a sequence identity
of greater than about 90-95% with the sequence of the selected
nucleic acid probe. Hybridization conditions useful for
probe/target hybridization where the probe and target have a
specific degree of sequence identity, can be determined as is known
in the art (see, for example, Nucleic Acid Hybridization: A
Practical Approach, editors B. D. Hames and S. J. Higgins, (1985)
Oxford; Washington, D.C.; IRL Press).
[0062] With respect to stringency conditions for hybridization, it
is well known in the art that numerous equivalent conditions can be
employed to establish a particular stringency by varying, for
example, the following factors: the length and nature of probe and
target sequences, base composition of the various sequences,
concentrations of salts and other hybridization solution
components, the presence or absence of blocking agents in the
hybridization solutions (e.g., formamide, dextran sulfate, and
polyethylene glycol), hybridization reaction temperature and time
parameters, as well as, varying wash conditions. The selection of a
particular set of hybridization conditions is selected following
standard methods in the art (see, for example, Sambrook, et al.,
Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold
Spring Harbor, N.Y.).
[0063] The term "derived from" is used to identify the alphaviral
source of molecule (e.g., polynucleotide, polypeptide). A first
polynucleotide is "derived from" second polynucleotide if it has
the same or substantially the same basepair sequence as a region of
the second polynucleotide, its cDNA, complements thereof, or if it
displays sequence identity as described above. Thus, an alphavirus
sequence or polynucleotide is "derived from" a particular
alphavirus (e.g., species) if it has (i) the same or substantially
the same sequence as the alphavirus sequence or (ii) displays
sequence identity to polypeptides of that alphavirus as described
above.
[0064] A first polypeptide is "derived from" a second polypeptide
if it is (i) encoded by a first polynucleotide derived from a
second polynucleotide, or (ii) displays sequence identity to the
second polypeptides as described above. Thus, an alphavirus
polypeptide (protein) is "derived from" a particular alphavirus if
it is (i) encoded by an open reading frame of a polynucleotide of
that alphavirus (alphaviral polynucleotide), or (ii) displays
sequence identity, as described above, to polypeptides of that
alphavirus.
[0065] Both polynucleotide and polypeptide molecules can be
physically derived from the alphavirus or produced recombinantly or
synthetically, for example, based on known sequences.
[0066] Typical "control elements", include, but are not limited to,
transcription promoters, transcription enhancer elements,
transcription termination signals, polyadenylation sequences
(located 3' to the translation stop codon), sequences for
optimization of initiation of translation (located 5' to the coding
sequence), translation termination sequences, 5' sequence required
for nonstructural protein-mediated amplification, 3' sequence
required for nonstructural protein-mediated amplification, and
means to express one or more heterologous sequences (e.g.,
subgenomic junction region promoter), see e.g., McCaughan et al.
(1995) PNAS USA 92:5431-5435; Kochetov et al (1998) FEBS Letts.
440:351-355.
[0067] "Alphavirus RNA replicon vector", "RNA replicon vector",
"replicon vector" or "replicon" refers to an RNA molecule that is
capable of directing its own amplification or self-replication in
vivo, within a target cell. To direct its own amplification, the
RNA molecule should encode the polymerase(s) necessary to catalyze
RNA amplification (e.g., alphavirus nonstructural proteins nsP1,
nsP2, nsP3, nsP4) and also contain cis RNA sequences required for
replication which are recognized and utilized by the encoded
polymerase(s). An alphavirus RNA vector replicon should contain the
following ordered elements: 5' viral or cellular sequences required
for nonstructural protein-mediated amplification (may also be
referred to as 5'CSE, or 5' cis replication sequence, or 5' viral
sequences required in cis for replication, or 5' sequence which is
capable of initiating transcription of an alphavirus), sequences
which, when expressed, code for biologically active alphavirus
nonstructural proteins (e.g., nsP1, nsP2, nsP3, nsP4), and 3' viral
or cellular sequences required for nonstructural protein-mediated
amplification (may also be referred as 3' CSE, or 3' viral
sequences required in cis for replication, or an alphavirus RNA
polymerase recognition sequence). The alphavirus RNA vector
replicon also should contain a means to express one or more
heterologous sequence(s), such as for example, an IRES or a viral
(e.g., alphaviral) subgenomic promoter (e.g., junction region
promoter) which may, in certain embodiments, be modified in order
to increase or reduce viral transcription of the subgenomic
fragment, or to decrease homology with defective helper or
structural protein expression cassettes, and one or more
heterologous sequence(s) to be expressed. A replicon can also
contain additional sequences, for example, one or more heterologous
sequence(s) encoding one or more polypeptides (e.g., a
protein-encoding gene or a 3' proximal gene) and/or a polyadenylate
tract.
[0068] "Recombinant Alphavirus Particle", "Alphavirus replicon
particle" and "Replicon particle" refers to a virion-like unit
containing an alphavirus RNA vector replicon. Generally, the
recombinant alphavirus particle comprises one or more alphavirus
structural proteins, a lipid envelope and an RNA vector replicon.
Preferably, the recombinant alphavirus particle contains a
nucleocapsid structure that is contained within a host cell-derived
lipid bilayer, such as a plasma membrane, in which one or more
alphaviral envelope glycoproteins (e.g., E2, E1) are embedded. The
particle may also contain other components (e.g., targeting
elements such as biotin, other viral structural proteins or
portions thereof, hybrid envelopes, or other receptor binding
ligands), which direct the tropism of the particle from which the
alphavirus was derived. Generally, the interaction between
alphavirus RNA and structural protein(s) necessary to efficiently
form a replicon particle or nucleocapsid may be an RNA-protein
interaction between a capsid protein and a packaging signal (or
packaging sequence) contained within the RNA.
[0069] "Alphavirus packaging cell line" refers to a cell which
contains one or more alphavirus structural protein expression
cassettes and which produces recombinant alphavirus particles
(replicon particles) after introduction of an alphavirus RNA vector
replicon, eukaryotic layered vector initiation system, or
recombinant alphavirus particle. The parental cell may be of
mammalian or non-mammalian origin. Within preferred embodiments,
the packaging cell line is stably transformed with the structural
protein expression cassette(s).
[0070] "Defective helper RNA" refers to an RNA molecule that is
capable of being amplified and expressing one or more alphavirus
structural proteins within a eukaryotic cell, when that cell also
contains functional alphavirus nonstructural "replicase" proteins.
The alphavirus nonstructural proteins may be expressed within the
cell by an alphavirus RNA replicon vector or other means. To permit
amplification and structural protein expression, mediated by
alphavirus nonstructural proteins, the defective helper RNA
molecule should contain 5'-end and 3'-end RNA sequences required
for amplification, which are recognized and utilized by the
nonstructural proteins, as well as a means to express one or more
alphavirus structural proteins. Thus, an alphavirus defective
helper RNA should contain the following ordered elements: 5' viral
or cellular sequences required for RNA amplification by alphavirus
nonstructural proteins (also referred to elsewhere as 5' CSE, or 5'
cis replication sequence, or 5' viral sequences required in cis for
replication, or 5' sequence which is capable of initiating
transcription of an alphavirus), a means to express one or more
alphavirus structural proteins, gene sequence(s) which, when
expressed, codes for one or more alphavirus structural proteins
(e.g., C, E2, E1), 3' viral or cellular sequences required for
amplification by alphavirus nonstructural proteins (also referred
to as 3' CSE, or 3' viral sequences required in cis for
replication, or an alphavirus RNA polymerase recognition sequence),
and a preferably a polyadenylate tract. Generally, the defective
helper RNA should not itself encode or express in their entirety
all four alphavirus nonstructural proteins (nsP1, nsP2, nsP3,
nsP4), but may encode or express a subset of these proteins or
portions thereof, or contain sequence(s) derived from one or more
nonstructural protein genes, but which by the nature of their
inclusion in the defective helper do not express nonstructural
protein(s) or portions thereof. As a means to express alphavirus
structural protein(s), the defective helper RNA may contain a viral
(e.g., alphaviral) subgenomic promoter which may, in certain
embodiments, be modified to modulate transcription of the
subgenomic fragment, or to decrease homology with replicon RNA, or
alternatively some other means to effect expression of the
alphavirus structural protein (e.g., internal ribosome entry site,
ribosomal readthrough element). Preferably an alphavirus structural
protein gene is the 3' proximal gene within the defective helper.
In addition, it is also preferable that the defective helper RNA
does not contain sequences that facilitate RNA-protein interactions
with alphavirus structural protein(s) and packaging into
nucleocapsids, virion-like particles or alphavirus replicon
particles. A defective helper RNA is one specific embodiment of an
alphavirus structural protein expression cassette.
[0071] "Eukaryotic Layered Vector Initiation System" refers to an
assembly that is capable of directing the expression of a sequence
or gene of interest. The eukaryotic layered vector initiation
system should contain a 5' promoter that is capable of initiating
in vivo (i.e. within a eukaryotic cell) the synthesis of RNA from
cDNA, and a nucleic acid vector sequence (e.g., viral vector) that
is capable of directing its own replication in a eukaryotic cell
and also expressing a heterologous sequence. Preferably, the
nucleic acid vector sequence is an alphavirus-derived sequence and
is comprised of 5' viral or cellular sequences required for
nonstructural protein-mediated amplification (also referred to as
5' CSE, or 5' cis replication sequence, or 5' viral sequences
required in cis for replication, or 5' sequence which is capable of
initiating transcription of an alphavirus), as well as sequences
which, when expressed, code for biologically active alphavirus
nonstructural proteins (e.g., nsP1, nsP2, nsP3, nsP4), and 3' viral
or cellular sequences required for nonstructural protein-mediated
amplification (also referred to as 3' CSE, or 3' viral sequences
required in cis for replication, or an alphavirus RNA polymerase
recognition sequence). In addition, the vector sequence may include
a means to express heterologous sequence(s), such as for example, a
viral (e.g., alphaviral) subgenomic promoter (e.g., junction region
promoter) which may, in certain embodiments, be modified in order
to prevent, increase, or reduce viral transcription of the
subgenomic fragment, or to decrease homology with defective helper
or structural protein expression cassettes, and one or more
heterologous sequence(s) to be expressed. Preferably the
heterologous sequence(s) comprises a protein-encoding gene and said
gene is the 3' proximal gene within the vector sequence. The
eukaryotic layered vector initiation system may also contain a
polyadenylation sequence, splice recognition sequences, a catalytic
ribozyme processing sequence, a nuclear export signal, and a
transcription termination sequence. In certain embodiments, in vivo
synthesis of the vector nucleic acid sequence from cDNA may be
regulated by the use of an inducible promoter or subgenomic
expression may be inducible through the use of translational
regulators or modified nonstructural proteins.
[0072] As used herein, the terms "chimeric alphavirus particle" and
"chimeric alphavirus replicon particle" refer to a chimera or
chimeric particle such as a virus, or virus-like particle,
specifically modified or engineered to contain a nucleic acid
derived from a alphavirus other than the alphavirus from which
either the capsid and/or envelope glycoprotein was derived (e.g.,
from a different virus). In such a particle, the nucleic acid
derived from an alphavirus is an RNA molecule comprising one of any
number of different lengths, including, but not limited to
genome-length (encoding nonstructural and structural proteins) and
replicon-length (deleted of one or more structural proteins). For
example, and not intended as a limitation, chimeric replicon
particles made in accordance with the teachings of the present
invention include Sindbis virus (SIN) replicon RNA within a capsid
having a Sindbis virus RNA binding domain and a Venezuelan equine
encephalitis virus (VEE) envelope glycoprotein interaction domain,
surrounded by a VEE glycoprotein envelope and a VEE replicon RNA
having a deletion in nsP3, a SIN packaging signal inserted into the
deletion in nsP3 and capsid and envelope proteins derived from
SIN.
[0073] The term "3' Proximal Gene" refers to a nucleotide sequence
encoding a protein, which is contained within a replicon vector,
Eukaryotic Layered Vector Initiation System, defective helper RNA
or structural protein expression cassette, and located within a
specific position relative to another element. The position of this
3' proximal gene should be determined with respect to the 3'
sequence required for nonstructural protein-mediated amplification
(defined above), wherein the 3' proximal gene is the
protein-encoding sequence 5' (upstream) of, and immediately
preceding this element. The 3' proximal gene generally is a
heterologous sequence (e.g., antigen-encoding gene) when referring
to a replicon vector or Eukaryotic Layered Vector Initiation
System, or alternatively, generally is a structural protein gene
(e.g., alphavirus C, E2, E1) when referring to a defective helper
RNA or structural protein expression cassette.
[0074] The term "5' viral or cellular sequences required for
nonstructural protein-mediated amplification" or "5' sequences
required for nonstructural protein-mediated amplification" refers
to a functional element that provides a recognition site at which
the virus or virus-derived vector synthesizes positive strand RNA.
Thus, it is the complement of the actual sequence contained within
the virus or vector, which corresponds to the 3' end of the of the
minus-strand RNA copy, which is bound by the nonstructural protein
replicase complex, and possibly additional host cell factors, from
which transcription of the positive-strand RNA is initiated. A wide
variety of sequences may be utilized for this function. For
example, the sequence may include the alphavirus 5'-end
nontranslated region (NTR) and other adjacent sequences, such as
for example sequences through nucleotides 210, 250, 300, 350, 400,
or 450. Alternatively, non-alphavirus or other sequences may be
utilized as this element, while maintaining similar functional
capacity, for example, in the case of SIN, nucleotides 10-75 for
tRNA Asparagine (Schlesinger et al., U.S. Pat. No. 5,091,309). The
term is used interchangeably with the terms 5' CSE, or 5' viral
sequences required in cis for replication, or 5' sequence that is
capable of initiating transcription of an alphavirus.
[0075] The term "viral subgenomic promoter" refers to a sequence of
virus origin that, together with required viral and cellular
polymerase(s) and other factors, permits transcription of an RNA
molecule of less than genome length. For an alphavirus (alphaviral)
subgenomic promoter or alphavirus (alphaviral) subgenomic junction
region promoter, this sequence is derived generally from the region
between the nonstructural and structural protein open reading
frames (ORFs) and normally controls transcription of the subgenomic
mRNA. Typically, the alphavirus subgenomic promoter consists of a
core sequence that provides most promoter-associated activity, as
well as flanking regions (e.g., extended or native promoter) that
further enhance the promoter-associated activity. For example, in
the case of the alphavirus prototype, Sindbis virus, the normal
subgenomic junction region promoter typically begins at
approximately nucleotide number 7579 and continues through at least
nucleotide number 7612 (and possibly beyond). At a minimum,
nucleotides 7579 to 7602 are believed to serve as the core sequence
necessary for transcription of the subgenomic fragment.
[0076] The terms "3' viral or cellular sequences required for
nonstructural protein-mediated amplification" or "3' sequences
required for nonstructural protein-mediated amplification" are used
interchangeably with the terms 3' CSE, or 3' cis replication
sequences, or 3' viral sequences required in cis for replication,
or an alphavirus RNA polymerase recognition sequence. This sequence
is a functional element that provides a recognition site at which
the virus or virus-derived vector begins replication
(amplification) by synthesis of the negative RNA strand. A wide
variety of sequences may be utilized for this function. For
example, the sequence may include a complete alphavirus 3'-end
non-translated region (NTR), such as for example, with SIN, which
would include nucleotides 11,647 to 11,703, or a truncated region
of the 3' NTR, which still maintains function as a recognition
sequence (e.g., nucleotides 11,684 to 11,703). Other examples of
sequences that may be utilized in this context include, but are not
limited to, non-alphavirus or other sequences that maintain a
similar functional capacity to permit initiation of negative strand
RNA synthesis (e.g., sequences described in George et al., (2000)
J. Virol. 74:9776-9785).
[0077] An "antigen" refers to a molecule containing one or more
epitopes (either linear, conformational or both) that will
stimulate a host's immune system to make a humoral and/or cellular
antigen-specific response. The term is used interchangeably with
the term "immunogen." Normally, an epitope will include between
about 3-15, generally about 5-15 amino acids. A B-cell epitope is
normally about 5 amino acids but can be as small as 3-4 amino
acids. A T-cell epitope, such as a CTL epitope, will include at
least about 7-9 amino acids, and a helper T-cell epitope at least
about 12-20 amino acids. Normally, an epitope will include between
about 7 and 15 amino acids, such as, 9, 10, 12 or 15 amino acids.
The term "antigen" denotes both subunit antigens, (i.e., antigens
which are separate and discrete from a whole organism with which
the antigen is associated in nature), as well as, killed,
attenuated or inactivated bacteria, viruses, fungi, parasites or
other microbes as well as tumor antigens, including extracellular
domains of cell surface receptors and intracellular portions that
may contain T-cell epitopes. Antibodies such as anti-idiotype
antibodies, or fragments thereof, and synthetic peptide mimotopes,
which can mimic an antigen or antigenic determinant, are also
captured under the definition of antigen as used herein. Similarly,
an oligonucleotide or polynucleotide that expresses an antigen or
antigenic determinant in vivo, such as in gene therapy and DNA
immunization applications, is also included in the definition of
antigen herein.
[0078] Epitopes of a given protein can be identified using any
number of epitope mapping techniques, well known in the art. See,
e.g., Epitope Mapping Protocols in Methods in Molecular Biology,
Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, N.J. For
example, linear epitopes may be determined by e.g., concurrently
synthesizing large numbers of peptides on solid supports, the
peptides corresponding to portions of the protein molecule, and
reacting the peptides with antibodies while the peptides are still
attached to the supports. Such techniques are known in the art and
described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al. (1984)
Proc. Nat'l Acad Sci. USA 81:3998-4002; Geysen et al. (1986) Molec.
Immunol 23:709-715, all incorporated herein by reference in their
entireties.
[0079] Similarly, conformational epitopes are readily identified by
determining spatial conformation of amino acids such as by, e.g.,
x-ray crystallography and nuclear magnetic resonance. See, e.g.,
Epitope Mapping Protocols, supra.
[0080] For purposes of the present invention, antigens can be
derived from tumors and/or any of several known viruses, bacteria,
parasites and fungi, as described more fully below. The term also
intends any of the various tumor antigens or any other antigen to
which an immune response is desired. Furthermore, for purposes of
the present invention, an "antigen" refers to a protein that
includes modifications, such as deletions, additions and
substitutions (generally conservative in nature), to the native
sequence, so long as the protein maintains the ability to elicit an
immunological response, as defined herein. These modifications may
be deliberate, as through site-directed mutagenesis, or may be
accidental, such as through mutations of hosts that produce the
antigens.
[0081] An "immunological response" to an antigen or composition is
the development in a subject of a humoral and/or a cellular immune
response to an antigen present in the composition of interest. For
purposes of the present invention, a "humoral immune response"
refers to an immune response mediated by antibody molecules,
including secretory (IgA) or IgG molecules, while a "cellular
immune response" is one mediated by T-lymphocytes and/or other
white blood cells. One important aspect of cellular immunity
involves an antigen-specific response by cytolytic T-cells
("CTL"s). CTLs have specificity for peptide antigens that are
presented in association with proteins encoded by the major
histocompatibility complex (MHC) and expressed on the surfaces of
cells. CTLs help induce and promote the destruction of
intracellular microbes, or the lysis of cells infected with such
microbes. Another aspect of cellular immunity involves an
antigen-specific response by helper T-cells. Helper T-cells act to
help stimulate the function, and focus the activity of, nonspecific
effector cells against cells displaying peptide antigens in
association with MHC molecules on their surface. A "cellular immune
response" also refers to the production of cytokines, chemokines
and other such molecules produced by activated T-cells and/or other
white blood cells, including those derived from CD4+ and
CD8+T-cells. In addition, a chemokine response may be induced by
various white blood or endothelial cells in response to an
administered antigen.
[0082] A composition or vaccine that elicits a cellular immune
response may serve to sensitize a vertebrate subject by the
presentation of antigen in association with MHC molecules at the
cell surface. The cell-mediated immune response is directed at, or
near, cells presenting antigen at their surface. In addition,
antigen-specific T-lymphocytes can be generated to allow for the
future protection of an immunized host.
[0083] The ability of a particular antigen to stimulate a
cell-mediated immunological response may be determined by a number
of assays, such as by lymphoproliferation (lymphocyte activation)
assays, CTL cytotoxic cell assays, or by assaying for T-lymphocytes
specific for the antigen in a sensitized subject. Such assays are
well known in the art. See, e.g., Erickson et al., J. Immunol.
(1993) 151:4189-4199; Doe et al., Eur. J. Immunol. (1994)
24:2369-2376. Recent methods of measuring cell-mediated immune
response include measurement of intracellular cytokines or cytokine
secretion by T-cell populations (e.g., by ELISPOT technique), or by
measurement of epitope specific T-cells (e.g., by the tetramer
technique)(reviewed by McMichael, A. J., and O'Callaghan, C. A., J
Exp. Med. 187(9):1367-1371, 1998; Mcheyzer-Williams, M. G., et al,
Immunol. Rev. 150:5-21, 1996; Lalvani, A., et al, J. Exp. Med.
186:859-865, 1997).
[0084] Thus, an immunological response as used herein may be one
that stimulates CTLs, and/or the production or activation of helper
T-cells. The production of chemokines and/or cytokines may also be
stimulated. The antigen of interest may also elicit an
antibody-mediated immune response. Hence, an immunological response
may include one or more of the following effects: the production of
antibodies (e.g., IgA or IgG) by B-cells; and/or the activation of
suppressor, cytotoxic, or helper T-cells and/or y.delta. T-cells
directed specifically to an antigen or antigens present in the
composition or vaccine of interest. These responses may serve to
neutralize infectivity, and/or mediate antibody-complement, or
antibody dependent cell cytotoxicity (ADCC) to provide protection
to an immunized host. Such responses can be determined using
standard immunoassays and neutralization assays, well known in the
art.
[0085] An "immunogenic composition" is a composition that comprises
an antigenic molecule (or nucleotide sequence encoding an antigenic
molecule) where administration of the composition to a subject
results in the development in the subject of a humoral and/or a
cellular and/or mucosal immune response to the antigenic molecule
of interest. The immunogenic composition can be introduced directly
into a recipient subject, such as by injection, inhalation, oral,
intranasal or any other parenteral or mucosal (e.g., intra-rectally
or intra-vaginally) route of administration.
[0086] By "subunit vaccine" is meant a vaccine composition that
includes one or more selected antigens but not all antigens,
derived from or homologous to, an antigen from a pathogen of
interest such as from a virus, bacterium, parasite or fungus. Such
a composition is substantially free of intact pathogen cells or
pathogenic particles, or the lysate of such cells or particles.
Thus, a "subunit vaccine" can be prepared from at least partially
purified (preferably substantially purified) immunogenic
polypeptides from the pathogen, or analogs thereof The method of
obtaining an antigen included in the subunit vaccine can thus
include standard purification techniques, recombinant production,
or synthetic production.
[0087] 1.0. Introduction
[0088] Several members of the alphavirus genus are being developed
as gene delivery systems for vaccine and other therapeutic
applications (Schlesinger and Dubensky, Curr. Opin. Biotechnol.,
10:434-9 1999). The typical "replicon" configuration of alphavirus
vector constructs, as described in more detail above and in U.S.
Pat. Nos. 5,789,245, 5,843,723, 5,814,482, and 6,015,694, and WO
00/61772, comprises a 5' sequence which initiates transcription of
alphavirus RNA, a nucleotide sequence encoding alphavirus
nonstructural proteins, a viral subgenomic junction region promoter
which directs the expression of an adjacent heterologous nucleic
acid sequence, an RNA polymerase recognition sequence and
preferably a polyadenylate tract. Other terminology to define the
same elements is also known in the art.
[0089] Often, for in vivo vaccine and therapeutic applications, the
alphavirus RNA replicon vector or replicon RNA is first packaged
into a virus-like particle, comprising the alphavirus structural
proteins (e.g., capsid protein and envelope glycoproteins). Because
of their configuration, vector replicons do not express these
alphavirus structural proteins necessary for packaging into
recombinant alphavirus replicon particles. Thus, to generate
replicon particles, the structural proteins must be provided in
trans. Packaging may be accomplished by a variety of methods,
including transient approaches such as co-transfection of in vitro
transcribed replicon and defective helper RNA(s) (Liljestrom,
Bio/Technology 9:1356-1361, 1991; Bredenbeek et al., J. Virol.
67:6439-6446, 1993; Frolov et al., J. Virol. 71:2819-2829, 1997;
Pushko et al., Virology 239:389-401, 1997; U.S. Pat. Nos. 5,789,245
and 5,842,723) or plasmid DNA-based replicon and defective helper
constructs (Dubensky et al., J. Virol. 70:508-519, 1996), as well
as introduction of alphavirus replicons into stable packaging cell
lines (PCL) (Polo et al., PNAS 96:4598-4603, 1999; U.S. Pat. Nos.
5,789,245, 5,842,723, 6,015,694; WO 9738087 and WO 9918226).
[0090] The trans packaging methodologies permit the modification of
one or more structural protein genes (for example, to incorporate
sequences of alphavirus variants such as attenuated mutants U.S.
Pat. Nos. 5,789,245, 5,842,723, 6,015,694), followed by the
subsequent incorporation of the modified structural protein into
the final replicon particles. In addition, such packaging permits
the overall modification of alphavirus replicon particles by
packaging of a vector construct or RNA replicon from a first
alphavirus using structural proteins from a second alphavirus
different from that of the vector construct (WO 95/07994; Polo et
al., 1999, ibid; Gardner et al., J Virol., 74:11849-11857, 2000).
This approach provides a mechanism to exploit desirable properties
from multiple alphaviruses in a single replicon particle. For
example, while all alphaviruses are generally quite similar in
their overall mechanisms of replication and virion structure, the
various members of the alphavirus genus can exhibit some unique
differences in their biological properties in vivo (e.g., tropism
for lymphoid cells, interferon sensitivity, disease profile).
Furthermore, a number of alphaviruses are classified as Biosafety
Level 3 (BSL-3) organisms, which is an issue for particle
production (e.g., manufacturing) facilities and possible human use,
while others are classified as Biosafety Level 2 (BL-2). Alphavirus
replicon particle chimeras provide a mechanism to include
particular properties of a BSL-3 level alphavirus in a replicon
particle derived from a BL-2 level virus. For example, elements
from the BSL-3 lymphotropic Venezuelan equine encephalitis virus
(VEE) may be incorporated into a non-naturally lymphotropic BL-2
virus (e.g., Sindbis virus).
[0091] However, to date, there has been limited success in
efficiently and routinely produce commercially acceptable high
titer preparations of chimeric alphavirus particles. Such chimeric
alphavirus particles are desirable for several reasons including
specified tropisms or tissue specificity, altered surface
antigenicity and altered recognition by the host. In this regard,
an animal's immune system generally recognizes viral surface
antigens, such as the envelope glycoproteins, and directs specific
cellular and humoral responses against them long before internal
viral antigens such as capsid proteins are exposed to the immune
system. Consequently, if a replicon particle recipient has
pre-existing antibodies directed against the vector's surface
antigens (a sensitized host) the replicon particle may be attacked
and destroyed before it could deliver its therapeutic payload to
the target tissue. Given that many of the most successful replicon
particles are derived from naturally occurring, infectious viruses,
it is likely that at least some potential replicon particle
recipients have been previously exposed to, and developed immune
responses against, surface antigens that are common between the
replicon particle and the natural infectious virus. The likelihood
of an adverse immune response is also increased upon multiple
administrations. Therefore, in order reduce or eliminate this
possibility, subsequent gene delivery replicon particles can be
made using chimeric replicon particles so the recipient is not
required to see the same structural proteins multiple times.
[0092] Described herein are chimeric alphavirus particles that
exhibit efficient structural interactions. Thus, the present
invention provides compositions and methods for constructing and
obtaining recombinant chimeric alphavirus particles with
significantly increased efficiencies of packaging/production, for
example using SIN/VEE chimeras.
[0093] Advantages of the present invention include, but are not
limited to, (i) providing chimeric alphavirus particles at
commercially viable levels; (ii) the ability to reduce the
likelihood of undesirable events occurring, for example,
recombination and/or structural gene packaging; (iii) providing
gene delivery vehicles with specific tissue and cell tropisms
(e.g., antigen delivery to an antigen-presenting cell such as a
dendritic cell).
[0094] The teachings provided herein allow one of skill in the art
to construct chimeric alphavirus particles derived from a wide
variety of different alphaviruses, particularly when sequences of
such alphaviruses have already been published. Eukaryotic Layered
Vector Initiation Systems (ELVIS) can also be designed using these
chimeric compositions. By optimizing the levels of packaging as
disclosed herein, chimeric alphavirus particles (e.g., replicon
particles) may be produced for use in various applications
including in vaccine and therapeutic applications.
[0095] 2.0.0. Alphavirus Replicons and Particles
[0096] As noted above, chimeric particles as described herein
typically include one or more polynucleotide sequences (e.g., RNA).
When found in particles, these polynucleotides are surrounded by
(and interact with) one or more structural proteins. Non-limiting
examples of polynucleotide sequences and structural proteins that
can be used in the practice of the invention are described
herein.
[0097] 2.1.0. Nucleotide Components
[0098] The particles, vectors and replicons described herein
typically include a variety of nucleic acid sequences, both coding
and non-coding sequences. It will be apparent that the chimeric
compositions described herein generally comprise less than a
complete alphavirus genome (e.g., contain less than all of the
coding and/or non-coding sequences contained in a genome of an
alphavirus).
[0099] Further, it should be noted that, for the illustration
herein of various elements useful in the present invention,
alphavirus sequences from a heterologous virus are considered as
being derived from an alphavirus different from the alphavirus that
is the source of nonstructural proteins used in the replicon to be
packaged, regardless of whether the element being utilized is in
the replicon or defective helper RNA (e.g., during particle
production, when both are present).
[0100] 2.1.1. Non-Coding Polynucleotide Components
[0101] The chimeric particles and replicons described herein
typically contain sequences that code for polypeptides (e.g.,
structural or non-structural) as well as non-coding sequences, such
as control elements. Non-limiting examples of non-coding sequences
include 5' sequences required for nonstructural protein-mediated
amplification, a means for expressing a 3' proximal gene,
subgenomic mRNA 5'-end nontranslated region (subgenomic 5' NTR),
and 3' sequences required for nonstructural protein-mediated
amplification (U.S. Pat. Nos. 5,843,723; 6,015,694; 5,814,482; PCT
publications WO 97/38087; WO 00/61772). It will be apparent from
the teachings herein that one, more than one or all of the
sequences described herein can be included in the particles,
vectors and/or replicons described herein and, in addition, that
one or more of these sequences can be modified or otherwise
manipulated according to the teachings herein.
[0102] Thus, the polynucleotides described herein typically include
a 5' sequence required for nonstructural protein-mediated
amplification. Non-limiting examples of suitable 5' sequences
include control elements such as native alphavirus 5'-end from
homologous virus, native alphavirus 5'-end from heterologous virus,
non-native DI alphavirus 5'-end from homologous virus, non-native
DI alphavirus 5'-end from heterologous virus, non-alphavirus
derived viral sequence (e.g., togavirus, plant virus), cellular RNA
derived sequence (e.g., tRNA element) (e.g., Monroe et al., PNAS
80:3279-3283, 1983), mutations/deletions of any of the above
sequences to reduce homology (See, e.g., Niesters et al., J. Virol.
64:4162-4168, 1990; Niesters et al., J. Virol. 64:1639-1647, 1990),
and/or minimal 5' sequence in helpers (to approx. 200, 250, 300,
350, 400 nucleotides).
[0103] The polynucleotide sequences also generally include a means
for expressing a 3' proximal gene (e.g., a heterologous sequence,
polypeptide encoding sequence). Non-limiting examples of such means
include control elements such as promoters and the like, for
example, a native alphavirus subgenomic promoter from homologous
virus, a native alphavirus subgenomic promoter from heterologous
virus, a core alphavirus subgenomic promoter (homologous or
heterologous), minimal sequences upstream or downstream from core
subgenomic promoter, mutations/deletions/additions of core or
native subgenomic promoter, a non-alphavirus derived compatible
subgenomic promoter (e.g. plant virus), an internal ribosome entry
site (IRES), and/or a ribosomal readthrough element (e.g.,
BiP).
[0104] Suitable subgenomic mRNA 5'-end nontranslated regions
(subgenomic 5' NTR) include, but are not limited to, a native
alphavirus subgenomic 5'NTR from homologous virus, a native
alphavirus subgenomic 5'NTR from heterologous virus, a
non-alphavirus derived viral 5'NTR (e.g., plant virus), a cellular
gene derived 5'NTR (e.g., .beta.-globin), and/or sequences
containing mutations, deletions, and/or additions to native
alphavirus subgenomic 5'NTR.
[0105] Non-limiting examples of suitable 3' sequences required for
nonstructural protein-mediated amplification include control
elements such as a native alphavirus 3'-end from homologous virus,
a native alphavirus 3'-end from heterologous virus, a non-native DI
alphavirus 3'-end from homologous virus, a non-native DI alphavirus
3'-end from heterologous virus, a non-alphavirus derived viral
sequence (e.g., togavirus, plant virus), a cellular RNA derived
sequence, sequences containing mutations, deletions, or additions
of above sequences to reduce homology (See, e.g., Kuhn et al.
(1990) J. Virol. 64:1465-1476), minimal sequence in helpers to
approx. (20, 30, 50, 100, 200 nucleotides) and/or sequences from
cell-repaired 3' alphavirus CSE. A polyadenylation sequence can
also be incorporated, for example, within 3'-end sequences. (See,
e.g., George et al. (2000) J. Virol. 74:9776-9785).
[0106] 2.1.2. Coding Sequences
[0107] The compositions described herein may also include one or
more sequences coding for various alphavirus polypeptides, for
example one or more of the non-structural (nsP1, nsP2, nsP3, nsP4)
or structural (e.g., caspid, envelope) alphavirus polypeptides.
[0108] As described in Strauss et al. (1984), supra, a wild-type
SIN genome is 11,703 nucleotides in length, exclusive of the 5' cap
and the 3'-terminal poly(A) tract. After the 5'-terminal cap there
are 59 nucleotides of 5' nontranslated nucleic acid followed by a
reading frame of 7539 nucleotides that encodes the nonstructural
polypeptides and which is open except for a single opal termination
codon. Following 48 untranslated bases located in the junction
region that separates the nonstructural and structural protein
coding sequences, there is an open reading frame 3735 nucleotides
long that encodes the structural proteins. Finally, the 3'
untranslated region is 322 nucleotides long. The nonstructural
proteins are translated from the genomic RNA as two polyprotein
precursors. The first includes nsP 1, nsP2 and nsP3 is 1896 amino
acids in length and terminates at an opal codon at position 1897.
The fourth nonstructural protein, nsP4, is produced when
readthrough of the opal codon produces a second polyprotein
precursor of length 2513 amino acids, which is then cleaved
post-translationally.
[0109] The approximately boundaries that define the nonstructural
protein genes from the genomes of three representative and commonly
used alphaviruses, SIN, SFV and VEE as follows.
1 SIN.sup.1 SFV.sup.2 VEE.sup.3 nsP1 (approx. 60-1679 86-1696
45-1649 nucleotide boundaries) nsP1 (approx. 1-540 1-537 1-535
amino acid boundaries) nsP2 (approx. 1680-4100 1697-4090 1650-4031
nucleotide boundaries) nsP2 (approx. 541-1347 538-1335 536-1329
amino acid boundaries) nsP3 (approx. 4101-5747 4191-5536 4032-5681
nucleotide boundaries) nsP3 (approx. 1348-1896 1336-1817 1330-1879
amino acid boundaries) nsP4 (approx. 5769-7598 5537-7378 5703-7523
nucleotide boundaries) .sup.1Strauss et al. (1984) Virology
133:92-110 .sup.2Takkinen (1986) Nucleic Acids Res. 14:5667-5682
.sup.3Kinney et al. (1989) Virology 170:19
[0110] A wild-type alphavirus genome also includes sequences
encoding structural proteins. In SIN, the structural proteins are
translated from a subgenomic message which begins at nucleotide
7598, is 4106 nucleotides in length (exclusive of the poly(A)
tract), and is coterminal with the 3' end of the genomic RNA. Like
the non-structural proteins, the structural proteins are also
translated as a polyprotein precursor that is cleaved to produce a
nucleocapsid protein and two integral membrane glycoproteins as
well as two small peptides not present in the mature virion. Thus,
the replicons, particles and vectors of the present invention can
include sequences derived from one or more coding sequences of one
or more alphaviruses.
[0111] In addition to providing for sequences derived from coding
regions of alphaviruses, the present invention also provides for
alphavirus replicon vectors containing sequences encoding modified
alphavirus proteins, for example modified non-structural proteins
to reduce or eliminate their propensity for inter-strand transfer
(e.g., recombination) between replicon and defective helper RNA, or
between two defective helper RNAs, during positive-strand RNA
synthesis, negative-strand RNA synthesis, or both. In the context
of the production of alphavirus replicon particles, inter-strand
transfer or recombination may lead to undesirable contamination
with replication-competent virus in the preparation. Thus, it is
desirable to limit or eliminate inter-strand transfer, for example
using molecules described herein.
[0112] Modifications to alphavirus coding sequences may include,
but are not limited to nucleotide mutations, deletions, additions,
or sequence substitutions, in whole or in part, such as for example
using a hybrid nonstructural protein comprising sequences from one
alphavirus and another virus (e.g., alphavirus, togavirus, plant
virus).
[0113] Thus, a variety of sequence modifications are contemplated
within the present invention. For example, in certain embodiments,
there are one or more deletions in sequences encoding nonstructural
protein gene(s). Such deletions may be in nonstructural protein
(nsP) 1, 2, 3, or 4, as well as combinations of deletions from more
than one nsP gene. For example, and not intended by way of
limitation, a deletion may encompass at least the nucleotide
sequences encoding VEE nsP1 amino acid residues 101-120, 450-470,
460-480, 470-490, or 480-500, numbered relative to the sequence in
Kinney et al., (1989) Virology 170:19-30, as well as smaller
regions included within any of the above.
[0114] In another embodiment, a deletion may encompass at least the
sequences encoding VEE nsP2 amino acid residues 9-29, 613-633,
650-670, or 740-760, as well as smaller regions included within any
of the above. In another embodiment, a deletion may encompass at
least the sequences encoding VEE nsP3 amino acid residues 340-370,
350-380, 360-390, 370-400, 380-410, 390-420, 400-430, 410-440,
420-450, 430-460, 440-470, 450-480, 460-490, 470-500, 480-510,
490-520, 500-530, or 488-522, as well as smaller regions included
within any of the above. In another embodiment, the deletion may
encompass at least the sequences encoding VEE nsP4 amino acid
residues 8-28, or 552-570, as well as smaller regions included
within any of the above. It should be noted that although the above
amino acid ranges are illustrated using VEE as an example, similar
types of deletions may be utilized in other alphaviruses. For
example, in other embodiments, the modified non-structural proteins
include a modification (e.g., deletion(s), addition(s) and/or
substitution(s)) at a highly conserved location within an nsP4 of
an alphavirus replicon. By way of non-limiting example and as shown
in FIG. 13, the polymerase regions comprising nsP4 amino acids
368-400 of Sindbis virus (SIN), 375-407 of Semliki Forest virus
(SFV), and 383-415 of Venezuelan equine encephalitis virus (VEE),
as well as amino acids 462-494 of the 2a protein of the plant brome
mosaic virus (BMV), have a high degree of sequence conservation and
may serve as the target region for modification according to the
present invention. (See, FIG. 14). Further, modifications to the
adjacent amino acid sequence 1, 2 or 3 amino acids upstream or
downstream from this region also are contemplated for alphavirus
replicons.
[0115] Generally, while amino acid numbering is somewhat different
between alphaviruses, primarily due to slight differences in
polyprotein lengths, alignments amongst or between sequences from
different alphaviruses provides a means to identify similar regions
in other alphaviruses (see representative alignment in Kinney et
al. (1989) Virology 170:19-30). Preferably, the nonstructural
protein gene deletions of the present invention are confined to a
region or stretch of amino acids considered as non-conserved among
multiple alphaviruses. In addition, conserved regions also may be
subject to deletion.
[0116] 2.2. Alphavirus Structural Proteins
[0117] The structural proteins surrounding (and in some cases,
interacting with) the alphavirus replicon or vector polynucleotide
component(s) can include both capsid and envelope proteins. In most
instances, the polynucleotide component(s) are surrounded by the
capsid protein(s), which form nucleocapsids. In turn, the
nucleocapsid protein is surrounded by a lipid envelope containing
the envelope protein(s). It should be understood although it is
preferred to have both capsid and envelope proteins, both are not
required.
[0118] Alphavirus capsid proteins and envelope proteins are
described generally in Strauss et al. (1994) Microbiol. Rev.,
58:491-562. The capsid protein is the N-terminal protein of the
alphavirus structural polyprotein, and following processing from
the polyprotein, interacts with alphavirus RNA and other capsid
protein monomers to form nucleocapsid structures.
[0119] Alphavirus envelope glycoproteins (e.g., E2, E1) protrude
from the enveloped particle as surface "spikes", which are
functionally involved in receptor binding and entry into the target
cell.
[0120] One or both of these structural proteins (or regions
thereof) may include one or more modifications as compared to
wild-type. "Hybrid" structural proteins (e.g., proteins containing
sequences derived from two or more alphaviruses) also find use in
the practice of the present invention. Hybrid proteins can include
one or more regions derived from different alphaviruses. These
regions can be contiguous or non-contiguous. Preferably, a
particular region of the structural protein (e.g., a functional
regions such as the cytoplasmic tail portion of the envelope
protein or the RNA binding domain of the capsid protein) is derived
from a first alphavirus. Any amount of the "remaining" sequences of
the protein (e.g., any sequences outside the designated region) can
be derived from one or more alphaviruses that are different than
the first. It is preferred that between about 25% to 100% (or any
percentage value therebetween) of the "remaining" portion be
derived from a different alphavirus, more preferably between about
35% and 100% (or any percentage value therebetween), even more
preferably between about 50% and 100% (or any percentage value
therebetween). The sequences derived from the one or more different
alphaviruses in the hybrid can be contiguous or non-contiguous, in
other words, sequences derived from one alphavirus can be separated
by sequences derived from one or more different alphaviruses.
[0121] 2.3. Modified Biosafety Level-3 Alphavirus Replicon
[0122] The compositions and methods described herein also allow for
the modification of replicon vectors or Eukaryotic Layered Vector
Initiation Systems derived from a BSL-3 alphavirus (e.g., VEE),
such that they may be utilized at a lower classification level
(e.g., BSL-2 or BSL-1) by reducing the nucleotide sequence derived
from the parental BSL-3 alphavirus to more than one-third but less
than two-thirds genome-length.
[0123] Thus, chimeric replicon vectors, particles or ELVIS can be
used that include an alphavirus replicon RNA (or cDNA) sequence
comprising a 5' sequence required for nonstructural
protein-mediated amplification, sequences encoding biologically
active alphavirus nonstructural proteins, an alphavirus subgenomic
promoter, a non-alphavirus heterologous sequence, a 3' sequence
required for nonstructural protein-mediated amplification, and
optionally a polyadenylate tract, wherein the sequence encoding at
least one of said nonstructural proteins is derived from a BSL-3
virus, but wherein the replicon RNA contains sequences derived from
said Biosafety Level 3 alphavirus that in total comprise less than
two-thirds genome-length of the parental Biosafety Level 3
alphavirus from which the sequence(s) is(are) derived.
[0124] Thus, the replicon sequences as described herein exhibit no
more than 66.67% sequence identity to a BSL-3 alphavirus across the
entire sequence. In other words, there may be many individual
regions of sequence identity as compared to a BSL-3 genome, but the
overall homology or percent identity to the entire genome-length of
a BSL-3 is no more than 66.67% and nor less than 33.33%.
Preferably, the replicon sequences derived from said Biosafety
Level 3 alphavirus comprise between 40% and two-thirds
genome-length of the parental Biosafety Level 3 alphavirus. More
preferably, the replicon sequences derived from said Biosafety
Level 3 alphavirus comprise between 50% and two-thirds
genome-length of the parental Biosafety Level 3 alphavirus. Even
more preferably, the replicon sequences derived from said Biosafety
Level 3 alphavirus comprise between 55% and two-thirds
genome-length of the parental Biosafety Level 3 alphavirus. Most
preferably, the replicon sequences derived from said Biosafety
Level 3 alphavirus comprise between 60% and two-thirds
genome-length of the parental Biosafety Level 3 alphavirus.
[0125] As used herein, the definitions of Biosafety Level (e.g.,
Biosafety Level 2, 3, 4) are considered to be those of HHS
Publication "Biosafety in Microbiological and Biomedical
Laboratories", from the U.S. Department of Health and Human
Services (Public Health Service, Centers for Disease Control and
Prevention, National Institutes of Health), excerpts of which
pertain to such classifications are incorporated below.
[0126] Biosafety Level I practices, safety equipment, and facility
design and construction are appropriate for undergraduate and
secondary educational training and teaching laboratories, and for
other laboratories in which work is done with defined and
characterized strains of viable microorganisms not known to
consistently cause disease in healthy adult humans. Bacillus
subtilis, Naegleria grubri, infectious canine hepatitis virus, and
exempt organisms under the NIH Recombinant DNA Guidelines are
representative of microorganisms meeting these criteria. Many
agents not ordinarily associated with disease processes in humans
are, however, opportunistic pathogens and may cause infection in
the young, the aged, and immunodeficient or immunosuppressed
individuals. Vaccine strains that have undergone multiple in vivo
passages should not be considered avirulent simply because they are
vaccine strains. Biosafety Level 1 represents a basic level of
containment that relies on standard microbiological practices with
no special primary or secondary barriers recommended, other than a
sink for handwashing.
[0127] Biosafety Level 2 practices, equipment, and facility design
and construction are applicable to clinical, diagnostic, teaching,
and other laboratories in which work is done with the broad
spectrum of indigenous moderate-risk agents that are present in the
community and associated with human disease of varying severity.
With good microbiological techniques, these agents can be used
safely in activities conducted on the open bench, provided the
potential for producing splashes or aerosols is low. Hepatitis B
virus, HIV, the salmonellae, and Toxoplasma spp. are representative
of microorganisms assigned to this containment level. Biosafety
Level 2 is appropriate when work is done with any human-derived
blood, body fluids, tissues, or primary human cell lines where the
presence of an infectious agent may be unknown. (Laboratory
personnel working with human-derived materials should refer to the
OSHA Bloodborne PathogenStandard 2, for specific required
precautions). Primary hazards to personnel working with these
agents relate to accidental percutaneous or mucous membrane
exposures, or ingestion of infectious materials. Extreme caution
should be taken with contaminated needles or sharp instruments.
Even though organisms routinely manipulated at Biosafety Level 2
are not known to be transmissible by the aerosol route, procedures
with aerosol or high splash potential that may increase the risk of
such personnel exposure must be conducted in primary containment
equipment, or in devices such as a BSC or safety centrifuge cups.
Other primary barriers should be used as appropriate, such as
splash shields, face protection, gowns, and gloves. Secondary
barriers such as handwashing sinks and waste decontamination
facilities must be available to reduce potential environmental
contamination.
[0128] Biosafety Level 3 practices, safety equipment, and facility
design and construction are applicable to clinical, diagnostic,
teaching, research, or production facilities in which work is done
with indigenous or exotic agents with a potential for respiratory
transmission, and which may cause serious and potentially lethal
infection. Mycobacterium tuberculosis, St. Louis encephalitis
virus, and Coxiella burnetii are representative of the
microorganisms assigned to this level. Primary hazards to personnel
working with these agents relate to autoinoculation, ingestion, and
exposure to infectious aerosols. At Biosafety Level 3, more
emphasis is placed on primary and secondary barriers to protect
personnel in contiguous areas, the community, and the environment
from exposure to potentially infectious aerosols. For example, all
laboratory manipulations should be performed in a BSC or other
enclosed equipment, such as a gas-tight aerosol generation chamber.
Secondary barriers for this level include controlled access to the
laboratory and ventilation requirements that minimize the release
of infectious aerosols from the laboratory.
[0129] Non-limiting examples of BSL-3 alphaviruses that may be used
in the practice of the present invention include Cabassou virus,
Kyzylagach virus, Tonate virus, Babanki virus, Venezuelan equine
encephalitis virus (excluding TC-83 vaccine strain), Getah virus,
Chikungunya virus, Middelburg virus, Sagiyama virus, Everglades
virus, Mayaro virus, and Mucambo virus.
[0130] Biosafety Level 4 practices, safety equipment, and facility
design and construction are applicable for work with dangerous and
exotic agents that pose a high individual risk of life-threatening
disease, which may be transmitted via the aerosol route and for
which there is no available vaccine or therapy. Agents with a close
or identical antigenic relationship to Biosafety Level 4 agents
also should be handled at this level. When sufficient data are
obtained, work with these agents may continue at this level or at a
lower level. Viruses such as Marburg or Congo-Crimean hemorrhagic
fever are manipulated at Biosafety Level 4. The primary hazards to
personnel working with Biosafety Level 4 agents are respiratory
exposure to infectious aerosols, mucous membrane or broken skin
exposure to infectious droplets, and autoinoculation. All
manipulations of potentially infectious diagnostic materials,
isolates, and naturally or experimentally infected animals, pose a
high risk of exposure and infection to laboratory personnel, the
community, and the environment. The laboratory worker's complete
isolation from aerosolized infectious materials is accomplished
primarily by working in a Class III BSC or in a full-body,
air-supplied positive-pressure personnel suit. The Biosafety Level
4 facility itself is generally a separate building or completely
isolated zone with complex, specialized ventilation requirements
and waste management systems to prevent release of viable agents to
the environment.
[0131] As utilized within the scope of the present invention,
creating a replicon that contains more than one-third but less than
two-thirds the original genome-length of sequence from any BSL-3
virus (referred to as the parental virus) may be accomplished in a
variety of ways. For example, contiguous or non-contiguous regions
of the parental virus can be deleted. Alternatively, contiguous or
non-contiguous regions of the parental virus may be utilized.
Alternatively, regions of the parental virus can be excised and
ligated into a BSL-2 or BSL-1 backbone.
[0132] In certain embodiments, the alphavirus 5' and/or 3' ends
(sequences required for nonstructural protein-mediated
amplification) are reduced to the minimal nucleotide sequence
required to maintain sufficient function in the context of a
replicon for expression of heterologous sequences, or alternatively
replaced by a non-alphavirus sequence capable of performing the
same function. In other embodiments, one or more alphavirus
nonstructural protein genes may be deleted within specific regions,
for example regions that are not well conserved among alphaviruses
(e.g., nsP3 non-conserved region) or elsewhere. Alternatively, the
alphavirus subgenomic promoter region or subgenomic 5' NTR region
may contain deletions. In still further embodiments, one or more
structural protein genes may be deleted, as well as combinations of
any of the above.
[0133] 3.0. Methods of Producing Chimeric Replicon Particles
[0134] The chimeric alphavirus replicon particles according to the
present invention may be produced using a variety of published
methods. Such methods include, for example, transient packaging
approaches, such as the co-transfection of in vitro transcribed
replicon and defective helper RNA(s) (Liljestrom, Bio/Technology
9:1356-1361, 1991; Bredenbeek et al., J. Virol. 67:6439-6446, 1993;
Frolov et al., J. Virol. 71:2819-2829, 1997; Pushko et al.,
Virology 239:389-401, 1997; U.S. Pat. Nos. 5,789,245 and 5,842,723)
or plasmid DNA-based replicon and defective helper constructs
(Dubensky et al., J. Virol. 70:508-519, 1996), as well as
introduction of alphavirus replicons into stable packaging cell
lines (PCL) (Polo et al., PNAS 96:4598-4603, 1999; U.S. Pat. Nos.
5,789,245, 5,842,723, 6,015,694; WO 97/38087, WO 99/18226, WO
00/61772, and WO 00/39318).
[0135] In preferred embodiments, stable alphavirus packaging cell
lines are utilized for replicon particle production. The PCL may be
transfected with in vitro transcribed replicon RNA, transfected
with plasmid DNA-based replicon (e.g., ELVIS vector), or infected
with a seed stock of replicon particles, and then incubated under
conditions and for a time sufficient to produce high titer packaged
replicon particles in the culture supernatant. In particularly
preferred embodiments, PCL are utilized in a two-step process,
wherein as a first step, a seed stock of replicon particles is
produced by transfecting the PCL with a plasmid DNA-based replicon.
A much larger stock of replicon particles is then produced in the
second step, by infecting a fresh culture of the PCL with the seed
stock. This infection may be performed using various multiplicities
of infection (MOI), including a MOI=0.01, 0.05, 0.1, 0.5, 1.0, 3,
5, or 10. Preferably infection is performed at a low MOI (e.g.,
less than 1). Replicon particles at titers even >10.sup.8
infectious units (IU)/ml can be harvested over time from PCL
infected with the seed stock. In addition, the replicon particles
can subsequently be passaged in yet larger cultures of nave PCL by
repeated low multiplicity infection, resulting in commercial scale
preparations with the same high titer. Importantly, by using PCL of
the "split" structural gene configuration, these replicon particle
stocks may be produced free from detectable contaminating RCV.
[0136] As described above, large-scale production of alphavirus
replicon particles may be performed using a bioreactor. Preferably,
the bioreactor is an external component bioreactor, which is an
integrated modular bioreactor system for the mass culture, growth,
and process control of substrate attached cells. The attachment and
propagation of cells (e.g., alphavirus packaging cells) occurs in a
vessel or chamber with tissue culture treated surfaces, and the
cells are with fresh media for increased cell productivity.
Monitoring and adjustments are performed for such parameters as
gases, temperature, pH, glucose, etc., and crude vector is
harvested using a perfusion pump. Typically, the individual
components of an External Bioreactor separate external modules that
are connected (i.e., via tubing). The external components can be
pumps, reservoirs, oxygenators, culture modules, and other
non-standard parts. A representative example of an External
Component Bioreactor is the CellCube.TM. system (Corning, Inc).
[0137] In addition to using the external component bioreactor
described herein, a more traditional Stir Tank Bioreactor may also
be used, in certain instances, for alphavirus replicon particle
production. In a Stir Tank Bioreactor, the alphavirus packaging
cells may be unattached to any matrix (i.e., floating in
suspension) or attached to a matrix (e.g., poly disks, micro- or
macro carriers, beads). Alternatively, a Hollow Fiber Culture
System may be used.
[0138] Following harvest, crude culture supernatants containing the
chimeric alphavirus replicon particles may be clarified by passing
the harvest through a filter (e.g., 0.2 uM, 0.45 uM, 0.65 uM, 0.8
uM pore size). Optionally, the crude supernatants may be subjected
to low speed centrifugation prior to filtration to remove large
cell debris. Within one embodiment, an endonuclease (e.g.,
Benzonase, Sigma #E8263) is added to the preparation of alphavirus
replicon particles before or after a chromatographic purification
step to digest exogenous nucleic acid. Further, the preparation may
be concentrated prior to purification using one of any widely known
methods (e.g., tangential flow filtration).
[0139] Crude or clarified alphavirus replicon particles may be
concentrated and purified by chromatographic techniques (e.g., ion
exchange chromatography, size exclusion chromatography, hydrophobic
interaction chromatography, affinity chromatography). Two or more
such purification methods may be performed sequentially. In
preferred embodiments, at least one step of ion exchange
chromatography is performed and utilizes a ion exchange resin, such
as a tentacle ion exchange resin, and at least one step of size
exclusion chromatography is performed. Briefly, clarified
alphavirus replicon particle filtrates may be loaded onto a column
containing a charged ion exchange matrix or resin (e.g., cation or
anion exchange). The matrix or resin may consist of a variety of
substances, including but not limited to cross-linked agarose,
cross linked polystyrene, cross linked styrene, hydrophilic
polyether resin, acrylic resin, and methacrylate based resin. The
ion exchanger component may comprise, but is not limited to, a
cationic exchanger selected from the list consisting of
sulphopropyl cation exchanger, a carboxymethyl cation exchanger, a
sulfonic acid exchanger, a methyl sulfonate cation exchanger, and
an SO.sub.3-exchanger. In other embodiments, the ion exchanger
component may comprise, but is not limited to, an anionic exchanger
selected from the list consisting of DEAE, TMAE, and DMAE. Most
preferably, ion exchange chromatography is performed using a
tentacle cationic exchanger, wherein the ion exchange resin is a
methacrylate-based resin with an SO.sub.3-cation exchanger (e.g.,
Fractogel.RTM. EDM SO.sub.3-).
[0140] The chimeric replicon particles may be bound to the ion
exchange resin followed by one or more washes with buffer
containing a salt (e.g., 250 mM or less NaCl). Replicon particles
then may be eluted from the column in purified form using a buffer
with increased salt concentration. In preferred embodiments, the
salt concentration is a least 300 mM, 350 mM, 400 mM, 450 mM or 500
mM. Elution may be monitored preferably by a spectrophotometer at
280 nm, but also by replicon titer assay, transfer of expression
(TOE) assay, or protein gel analysis with subsequent Coomassie
staining or Western blotting.
[0141] The higher salt elution buffer subsequently may be exchanged
for a more desirable buffer, for example, by dilution in the
appropriate aqueous solution or by passing the particle-containing
eluate over a molecular exclusion column. Additionally, the use of
a molecular size exclusion column may also provide, in certain
instances, further purification. For example, in one embodiment
Sephacryl S-500 or S-400 (Pharmacia) chromatography may be used as
both a buffer exchange as well as to further purify the fractions
containing the replicon particles eluted from an ion exchange
column. Using this particular resin, the replicon particles
generally are eluted in the late void volume and show improvement
in the level of purity as some of the contaminants are smaller in
molecular weight and are retained on the column longer. However,
alternative resins of different compositions as well as size
exclusion could also be used that might yield similar or improved
results. In these strategies, larger-sized resins such as Sephacryl
S-1000 could be incorporated that would allow the replicon
particles to enter into the matrix and thus be retained longer,
allowing fractionation.
[0142] The methods described herein are unlike widely practiced
methods in which the defective helper RNAs and the replicon vector
contain genes derived from the same virus, thereby allowing the
process of replicon particle assembly to proceed naturally and
resulting in a replicon particle having a replicon packaged within
a viral capsid and envelope protein(s) derived from the same virus
that contributed the nonstructural protein genes. Consequently, in
such methods, the packaging signal (also known as packaging
sequences), the RNA binding domain, the glycoprotein interaction
domain and envelope glycoproteins are all from the same virus.
[0143] In contrast, the methods described herein involve the
successful and efficient production of alphavirus replicon
particles from sequences derived from two or more alphaviruses. As
described herein, the particles are produced more efficiently and,
additionally, have other advantages as well.
[0144] Methods are also provided to package alphavirus replicon RNA
into replicon particles (produce replicon particles) and reduce the
probability of generating replication-competent virus (e.g.,
wild-type virus) during packaging, comprising introducing into a
permissible cell an alphavirus replicon RNA encoding biologically
active alphavirus nonstructural proteins and a heterologous
polypeptide, together with one or more defective helper RNA(s)
encoding at least one alphavirus structural protein, and incubating
said cell under suitable conditions for a time sufficient to permit
production of replicon particles. In these embodiments, both the
replicon RNA and defective helper RNA include control elements,
particularly a 5' sequence required for nonstructural
protein-mediated amplification, a means to express the
polypeptide-encoding sequences (the polypeptide-encoding
sequence(s) are also referred to as the 3' proximal gene), for
example a promoter that drives expression of (1) the heterologous
protein in the replicon and (2) the structural proteins in the
defective helper RNA, a 3' sequence required for nonstructural
protein-mediated amplification, a polyadenylate tract, and,
optionally, a subgenomic 5'-NTR. Further, unlike known methods, one
or more of these control elements are different (e.g., the sequence
is different) as between the RNA in the replicon and the RNA in the
defective helper. For example, in certain embodiments, the 5'
sequence required for nonstructural protein-mediated amplification
is different as between the replicon and the helper RNA. In other
embodiments, the means to express the polypeptide-encoding
sequences and/or the 3' sequence required for nonstructural
protein-mediated amplification is different as between the replicon
and the helper RNA.
[0145] One of skill in the art will readily understand that
introduction of replicon RNA into permissive cells may be performed
by a variety of means, such as for example, transfection or
electroporation of RNA (e.g., in vitro transcribed RNA),
transcription of RNA within the cell from DNA (e.g., eukaryotic
layered vector initiation system), or delivery by viral or
virus-like particles (e.g., replicon particles) and introduction of
defective helper RNA into permissive cells may also be performed by
a variety of means, such as for example, transfection or
electroporation of RNA (e.g., in vitro transcribed RNA) or
transcription of RNA within the cell from DNA (e.g., structural
protein expression cassette).
[0146] In addition, modifications to reduce homologous sequences
may also be made at the DNA backbone level, such as for example, in
a Eukaryotic Layered Vector Initiation System or structural protein
expression cassette used for the derivation of packaging cells.
Such modifications include, but are not limited to, alternative
eukaryotic promoters, polyadenylation sequences, antibiotic
resistance markers, bacterial origins of replication, and other
non-functional backbone sequences.
[0147] 4.0 Pharmaceutical Compositions
[0148] The present invention also provides pharmaceutical
compositions comprising any of the alphavirus replicon particles,
vectors and/or replicons described herein in combination with a
pharmaceutically acceptable carrier, diluent, or recipient. Within
certain preferred embodiments, a sufficient amount of formulation
buffer is added to the purified replicon particles to form an
aqueous suspension. In preferred embodiments, the formulation
buffer comprises a saccharide and a buffering component in water,
and may also contain one or more amino acids or a high molecular
weight structural additive. The formulation buffer is added in
sufficient amount to reach a desired final concentration of the
constituents and to minimally dilute the replicon particles. The
aqueous suspension may then be stored, preferably at -70.degree.
C., or immediately dried.
[0149] The aqueous suspension can be dried by lyophilization or
evaporation at ambient temperature. Briefly, lyophilization
involves the steps of cooling the aqueous suspension below the gas
transition temperature or below the eutectic point temperature of
the aqueous suspension, and removing water from the cooled
suspension by sublimation to form a lyophilized replicon particle.
Within one embodiment, aliquots of the formulated recombinant virus
are placed into an Edwards Refrigerated Chamber (3 shelf RC3S unit)
attached to a freeze dryer (Supermodulyo 12K). A multistep freeze
drying procedure as described by Phillips et al. (Cryobiology
18:414, 1981) is used to lyophilize the formulated replicon
particles, preferably from a temperature of -40.degree. C. to
-45.degree. C. The resulting composition contains less than 10%
water by weight of the lyophilized replicon particles. Once
lyophilized, the replicon particles are stable and may be stored at
-20.degree. C. to 25.degree. C., as discussed in more detail below.
In the evaporative method, water is removed from the aqueous
suspension at ambient temperature by evaporation. Within one
embodiment, water is removed by a spray-drying process, wherein the
aqueous suspension is delivered into a flow of preheated gas,
usually which results in the water rapidly evaporating from
droplets of the suspension. Once dehydrated, the recombinant virus
is stable and may be stored at -20.degree. C. to 25.degree. C.
[0150] The aqueous solutions used for formulation preferably
comprise a saccharide, a buffering component, and water. The
solution may also include one or more amino acids and a high
molecular weight structural additive. This combination of
components acts to preserve the activity of the replicon particles
upon freezing and also lyophilization or drying through
evaporation. Although a preferred saccharide is lactose, other
saccharides may be used, such as sucrose, mannitol, glucose,
trehalose, inositol, fructose, maltose or galactose. A particularly
preferred concentration of lactose is 3%-4% by weight.
[0151] The high molecular weight structural additive aids in
preventing particle aggregation during freezing and provides
structural support in the lyophilized or dried state. Within the
context of the present invention, structural additives are
considered to be of "high molecular weight" if they are greater
than 5000 M.W. A preferred high molecular weight structural
additive is human serum albumin. However, other substances may also
be used, such as hydroxyethyl-cellulose, hydroxymethyl-cellulose,
dextran, cellulose, gelatin, or povidone. A particularly preferred
concentration of human serum albumin is 0.1% by weight.
[0152] The buffering component acts to buffer the solution by
maintaining a relatively constant pH. A variety of buffers may be
used, depending on the pH range desired, preferably between 7.0 and
7.8. Suitable buffers include phosphate buffer and citrate buffer.
In addition, it is preferable that the aqueous solution contains a
neutral salt that is used to adjust the final formulated replicon
particles to an appropriate iso-osmotic salt concentration.
Suitable neutral salts include sodium chloride, potassium chloride
or magnesium chloride. A preferred salt is sodium chloride. The
lyophilized or dehydrated replicon particles of the present
invention may be reconstituted using a variety of substances, but
are preferably reconstituted using water. In certain instances,
dilute salt solutions that bring the final formulation to
isotonicity may also be used.
[0153] 5.0 Applications
[0154] The chimeric alphavirus particles can be used to deliver a
wide variety of nucleotide sequences including, for example,
sequences which encode lymphokines or cytokines (e.g., IL-2, IL-12,
GM-CSF), prodrug converting enzymes (e.g., HSV-TK, VZV-TK),
antigens which stimulate an immune response (e.g., HIV, HCV, tumor
antigens), therapeutic molecules such as growth or regulatory
factors (e.g., VEGF, FGF, PDGF, BMP), proteins which assist or
inhibit an immune response, as well as ribozymes and antisense
sequences. The above nucleotide sequences include those referenced
previously (e.g., U.S. Pat. No. 6,015,686, WO 9738087 and WO
9918226), and may be obtained from repositories, readily cloned
from cellular or other RNA using published sequences, or
synthesized, for example, on an Applied Biosystems Inc. DNA
synthesizer (e.g., APB DNA synthesizer model 392 (Foster City,
Calif.)).
[0155] For purposes of the present invention, virtually any
polypeptide or polynucleotide can be used. Antigens can be derived
from any of several known viruses, bacteria, parasites and fungi,
as well as any of the various tumor antigens or any other antigen
to which an immune response is desired. Furthermore, for purposes
of the present invention, an "antigen" refers to a protein that
includes modifications, such as deletions, additions and
substitutions (generally conservative in nature), to the native
sequence, so long as the protein maintains the ability to elicit an
immunological response. These modifications may be deliberate, as
through site-directed mutagenesis, or may be accidental, such as
through mutations of hosts that produce the antigens.
[0156] Antigens may be used alone or in any combination. (See,
e.g., WO 02/00249 describing the use of combinations of bacterial
antigens). The combinations may include multiple antigens from the
same pathogen, multiple antigens from different pathogens or
multiple antigens from the same and from different pathogens. Thus,
bacterial, viral, tumor and/or other antigens may be included in
the same composition or may be administered to the same subject
separately. It is generally preferred that combinations of antigens
be used to raise an immune response be used in combinations.
[0157] Non-limiting examples of bacterial pathogens include
diphtheria (See, e.g., Chapter 3 of Vaccines, 1998, eds. Plotkin
& Mortimer (ISBN 0-7216-1946-0), staphylococcus (e.g.,
Staphylococcus aureus as described in Kuroda et al. (2001) Lancet
357:1225-1240), cholera, tuberculosis, C. tetani, also known as
tetanus (See, e.g., Chapter 4 of Vaccines, 1998, eds. Plotkin &
Mortimer (ISBN 0-7216-1946-0), Group A and Group B streptococcus
(including Streptococcus pneumoniae, Streptococcus agalactiae and
Streptococcus pyogenes as described, for example, in Watson et al.
(2000) Pediatr. Infect. Dis. J 19:331-332; Rubin et al. (2000)
Pediatr Clin. North Am. 47:269-284; Jedrzejas et al. (2001)
Microbiol Mol Biol Rev 65: 187-207; Schuchat (1999) Lancet
353:51-56; GB patent applications 0026333.5; 0028727.6; 015640.7;
Dale et al. (1999) Infect Dis Clin North Am 13:227-1243; Ferretti
et al. (2001) PNAS USA 98:4658-4663), pertussis (See, e.g.,
Gusttafsson et al. (1996) N. Engl. J Med. 334:349-355; Rappuoli et
al. (1991) TIBTECH 9:232-238), meningitis, Moraxella catarrhalis
(See, e.g., McMichael (2000) Vaccine 19 Suppl. 1:S101-107) and
other pathogenic states, including, without limitation, Neisseria
meningitides (A, B, C, Y), Neisseria gonorrhoeae (See, e.g., WO
99/24578; WO 99/36544; and WO 99/57280), Helicobacter pylori (e.g.,
CagA, VacA, NAP, HopX, HopY and/or urease as described, for
example, WO 93/18150; WO 99/53310; WO 98/04702) and Haemophilus
influenza. Hemophilus influenza type B (HIB) (See, e.g., Costantino
et al. (1999) Vaccine 17:1251-1263), Porphyromonas gingivalis (Ross
et al. (2001) Vaccine 19:4135-4132) and combinations thereof.
[0158] Non-limiting examples of viral pathogens include meningitis,
rhinovirus, influenza (Kawaoka et al., Virology (1990) 179:759-767;
Webster et al., "Antigenic variation among type A influenza
viruses," p. 127-168. In: P. Palese and D. W. Kingsbury (ed.),
Genetics of influenza viruses. Springer-Verlag, New York),
respiratory syncytial virus (RSV), parainfluenza virus (PIV), and
the like. Antigens derived from other viruses will also find use in
the present invention, such as without limitation, proteins from
members of the families Picomaviridae (e.g., polioviruses, etc. as
described, for example, in Sutter et al. (2000) Pediatr Clin North
Am 47:287-308; Zimmerman & Spann (1999) Am Fam Physician
59:113-118; 125-126); Caliciviridae; Togaviridae (e.g., rubella
virus, dengue virus, etc.); the family Flaviviridae, including the
genera flavivirus (e.g., yellow fever virus, Japanese encephalitis
virus, serotypes of Dengue virus, tick borne encephalitis virus,
West Nile virus); pestivirus (e.g., classical porcine fever virus,
bovine viral diarrhea virus, border disease virus); and hepacivirus
(e.g., hepatitis A, B and C as described, for example, in U.S. Pat.
Nos. 4,702,909; 5,011,915; 5,698,390; 6,027,729; and 6,297,048);
Parvovirsus (e.g., parvovirus B19); Coronaviridae; Reoviridae;
Bimaviridae; Rhabodoviridae (e.g., rabies virus, etc. as described
for example in Dressen et al. (1997) Vaccine 15 Suppl:s2-6; MMWR
Morb Mortal Wkly Rep. 1998 Jan 16:47(1):12, 19); Filoviridae;
Paramyxoviridae (e.g., mumps virus, measles virus, rubella,
respiratory syncytial virus, etc. as described in Chapters 9 to 11
of Vaccines, 1998, eds. Plotkin & Mortimer (ISBN
0-7216-1946-0); Orthomyxoviridae (e.g., influenza virus types A, B
and C, etc. as described in Chapter 19 of Vaccines, 1998, eds.
Plotkin & Mortimer (ISBN 0-7216-1946-0),.); Bunyaviridae;
Arenaviridae; Retroviradae (e.g., HTLV-1; HTLV-11; HIV-1 (also
known as HTLV-III, LAV, ARV, HTI,R, etc.)), including but not
limited to antigens from the isolates HIVI11b, HIVSF2, HIVLAV,
HIVI-AL, I-IIVMN); HIV-I CM235, HIV-I IJS4; HW-2; simian
immunodeficiency virus (SIV) among others. Additionally, antigens
may also be derived from human papilloma virus (HPV) and the
tick-borne encephalitis viruses. See, e.g. Virology, 3rd Edition
(W. K. Joklik ed. 1988); Fundamental Virology, 2nd Edition (B. N.
Fields and D. M. Knipe, eds, 1991), for a description of these and
other viruses.
[0159] Antigens from the hepatitis family of viruses, including
hepatitis A virus (HAV) (See, e.g., Bell et al. (2000) Pediatr
Infect Dis. J. 19:1187-1188; Iwarson (1995) APMIS 103:321-326),
hepatitis B virus (HBV) (See, e.g., Gerlich et al. (1990) Vaccine 8
Suppl:S63-68 & 79-80), hepatitis C virus (HCV), the delta
hepatitis virus (HDV), hepatitis E virus (HEV) and hepatitis G
virus (HGV), can also be conveniently used in the techniques
described herein. By way of example, the viral genomic sequence of
HCV is known, as are methods for obtaining the sequence. See, e.g.,
International Publication Nos. WO 89/04669; WO 90/11089; and WO
90/14436. Also included in the invention are molecular variants of
such polypeptides, for example as described in PCT/US99/31245;
PCT/US99/31273 and PCT/US99/31272.
[0160] Non-limiting examples of tumor antigens include antigens
recognized by CD8+ lymphocytes (e.g., melanoma-melanocyte
differentiation antigens such as MART-1, gp100, tyrosinase,
tyrosinase related protein-1, tyrosinase related protein-2,
melanocyte-stimulating hormone receptor; mutated antigens such as
beta-catenin, MUM-1, CDK-4, caspase-8, KIA 0205, HLA-A2-R1701;
cancer-testes antigens such as MAGE-1, MAGE-2, MAGE-3, MAGE-12,
BAGE, GAGE and NY-ESO-1; and non-mutated shared antigens over
expressed on cancer such as alpha-fetoprotein, telomerase catalytic
protein, G-250, MUC-1, carcinoembryonic antigen, p53, Her-2-neu) as
well as antigens recognized by CD4+lymphocytes (e.g., gp100,
MAGE-1, MAGE-3, tyrosinase, NY-ESO-1, triosephosphate isomerase,
CDC-27, and LDLR-FUT). See, also, WO 91/02062, U.S. Pat. No.
6,015,567, WO 01/08636, WO 96/30514, U.S. Pat. No. 5,846,538 and
U.S. Pat. No. 5,869,445.
[0161] In certain embodiments, the tumor antigen(s) may be used.
Tumor antigens are derived from mutated or altered cellular
components. After alteration, the cellular components no longer
perform their regulatory functions, and hence the cell may
experience uncontrolled growth. Representative examples of altered
cellular components include ras, p53, Rb, altered protein encoded
by the Wilms' tumor gene, ubiquitin, mucin, protein encoded by the
DCC, APC, and MCC genes, as well as receptors or receptor-like
structures such as neu, thyroid hormone receptor, platelet derived
growth factor (PDGF) receptor, insulin receptor, epidermal growth
factor (EGF) receptor, and the colony stimulating factor (CSF)
receptor. These as well as other cellular components are described
for example in U.S. Pat. No. 5,693,522 and references cited
therein.
[0162] The present invention also provides methods for delivering
these selected heterologous sequences to a warm-blooded mammal
(e.g., a mammal such as a human or other warm-blooded animal such
as a horse, cow, pig, sheep, dog, cat, rat or mouse) for use as a
vaccine or therapeutic, comprising the step of administering to the
mammal replicon particles or eukaryotic layered vector initiation
systems as described herein, which are capable of expressing the
selected heterologous sequence. Delivery may be by a variety of
routes (e.g., intravenously, intramuscularly, intradermally,
intraperitoneally, subcutaneously, orally, intraocularly,
intranasally, rectally, intratumorally). In addition, the replicon
particles may either be administered directly (i.e., in vivo), or
to cells that have been removed (ex vivo), and subsequently
returned to the warm-blooded mammal.
[0163] It should be noted that the selected method for production
of chimeric alphavirus replicon particles of the present invention
should use techniques known in the art to minimize the possibility
of generating contaminating replication-competent virus (RCV). One
such strategy is the use of defective helpers or PCL that contain
"split" structural protein expression cassettes (see U.S. Pat. Nos.
5,789,245; 6,242,259; 6,329,201). In this context, the alphavirus
structural protein genes are segregated into separate expression
constructs (e.g., capsid separate from glycoproteins) such that
recombination to regenerate a complete complement of structural
proteins is highly unlikely. The present invention also provides
compositions and methods to further reduce the probability of
recombination events during production of alphavirus replicon
particles, beyond those conventional methods known in the art. For
example, any of the several functional elements (e.g., control
elements) commonly shared by replicon and defective helper RNA, or
shared between multiple defective helper RNAs (also eukaryotic
layered vector initiation systems and structural protein expression
cassettes) may be substituted with alternative elements that
perform the same function. In this instance, homology between RNA
molecules is decreased or eliminated. Alternatively, the likelihood
of polymerase template switching between RNA molecules also may be
reduced. Representative functional elements commonly shared by
replicon and defective helper RNA, or shared between multiple
defective helper RNAs, as well as some alternatives for each as
contemplated within the present invention are included, but not
limited to those described above in Section B above.
[0164] The following examples are included to more fully illustrate
the present invention. Additionally, these examples provide
preferred embodiments of the invention and are not meant to limit
the scope thereof.
EXAMPLES
Example 1
Construction of a VEE Derived Replicon Vector
[0165] In order to construct VEE derived replicon vectors and
defective helper packaging cassettes for use in producing chimeric
particles, it was necessary to first synthesize complementary DNA
corresponding to the entire VEE genome. Based on previously
published sequence from the wild-type Trinidad Donkey strain of VEE
(GENBANK, L01442), (hereinafter VEE-TRD) the entire 11,447 genome
was synthesized and cloned in multiple fragments using overlapping
oligonucleotides. Nonstructural protein gene clones were used for
assembly of a replicon vector, while the structural protein gene
clones were used for assembly of defective helper packaging
cassettes.
[0166] The sequences encoding VEE-TRD nonstructural protein genes
were analyzed for suitable unique restriction cleavage sites that
would subdivide the region into fragments of practical length and
which could be conveniently used for final assembly of the complete
replicon vector construct. As shown in FIG. 1, a total of 13
intermediate fragments were identified, ranging in length from 334
to 723 nucleotides. This series of fragments was synthesized using
overlapping oligonucleotides and techniques commonly employed by
those of skill in the art of molecular biology (see below, for
example). To the terminal fragments #1 and #13 were appended
additional sequences necessary to for final construction of the
plasmid that could be used for transcription of RNA replicon
expression vectors in vitro and in vivo. Upstream, as part of
fragment 1, was placed either a bacteriophage SP6 promoter or
eukaryotic CMV promoter to allow for transcription of replicon RNA.
Downstream, as part of fragment 13, was replicated the viral 3'
UTR, a synthetic A40 polyadenylation tract, and the hepatitis delta
virusr antigenomic ribozyme for generation of authentically
terminated RNAs (Dubensky et al., J Virol. 70:508-519, 1996; Polo,
1999, ibid).
[0167] As a detailed example of gene synthesis for one of the
fragments, full duplex DNA strands for replicon fragment #2 were
generated from overlapping synthetic oligonucleotides as described
below and shown in FIG. 2 (adjacent oligonucleotides are shown with
or without shading to highlight junctions). First, the full duplex
strand was appended with the recognition sequence of convenient
restriction enzyme sites suitable for insertion into intermediate
cloning vectors. Each fragment was then subdivided into a series of
oligonucleotides with an average length of 60 nucleotides each, and
overlapping those oligonucleotides from the opposite strand by an
average of 20 nucleotides at either end. Synthesis of the initial
oligonucleotides was performed by commercial vendors (e.g.,
Integrated DNA Technologies, Coralville, Iowa; Operon Technologies,
Alameda, Calif.). Oligonucleotides for each fragment were
re-constituted as per the supplier's recommendation to yield 100 nM
solutions of each individual oligo. To assemble the fragment, 100
pmoles of each oligo was mixed in a single reaction tube containing
T4 polynucleotide kinase buffer (New England Biolabs, Beverly,
Mass.), 1 mM rATP, water, and 10 units of T4 polynucleotide kinase
enzyme (New England Biolabs, Beverly, Mass.) in a final reaction
volume of 500 ul. The phosphorylation reaction was allowed to
proceed for 30 minutes at 37.degree. C., at which time the reaction
was supplemented with an additional 10 units of T4 polynucleotide
kinase and allowed to continue for an additional 30 minutes. At the
conclusion of the reaction, the tube containing the mixture was
heated to 95.degree. C. for 5' in a beaker containing a large
volume of water to denature the enzyme and any DNA strands that may
have already annealed. The beaker was then removed from the heat
source and allowed to slowly cool to ambient temperature, in order
for the complementary oligonucleotides to anneal into full duplex
DNA strands.
[0168] Once cooled, 0.2 pmoles of the reacted material was ligated
with 100 pmoles of previously prepared shuttle vector DNA and
transformed into competent bacteria according to standard methods.
Transformants arising from this ligation were analyzed first for
the presence of the appropriate terminal replicon enzyme sites, for
insert size, and evidence of insert duplication. Several positive
transformants were randomly chosen and submitted for sequence
confirmation. Any detected sequence errors were corrected by
fragment swap between two or more sequenced samples, or by
site-directed mutagenesis, and re-confirmed for authenticity.
[0169] After all fragments were obtained, final assembly of a
replicon vector, similar to those published previously with a
variety of alphaviruses (Xiong et al., Science 243:1188-1191, 1989;
Dubensky et al., 1996, ibid; Liljestrom et al., Bio/Technol.
9:1356-1361, 1991; Pushko et al., Virology 239:389-401), was
performed by piecing each sub-fragment together with its adjoining
fragment through ligation at the previously selected terminal
fragment cleavage sites. Once assembled, the sequence of the entire
synthetic VEE replicon was re-confirmed. The resulting VEE-based
alphavirus vector construct from which replicon RNA can be
transcribed in vitro was designated pVCR.
[0170] In addition to the SP6 promoter-based vector replicon
construct, a VEE-based eukaryotic layered vector initiation system
(ELVIS, see U.S. Pat. Nos. 5,814,482 and 6,015,686), which utilized
a CMV promoter for launching functional RNA replicons from within a
eukaryotic cell, also was constructed. Modification of plasmid pVCR
for conversion into an ELVIS vector was accomplished as follows. An
existing Sindbis virus (SIN) based ELVIS vector, pSINCP, was used
as a donor source for the appropriate backbone components including
the CMV promoter, Kanamycin resistance gene, and origin of
replication. This strategy was possible because both pSINCP and
pVCR share identical sequence elements (e.g., synthetic polyA
sequence, HDV ribozyme) downstream of the nonstructural gene and
viral 3' UTR regions. In pVCR, the HDV ribozyme is flanked by a
unique PmeI site, while in pSINCP the ribozyme is flanked by a BclI
site. The PmeI/BclI fusion then served as the 5' joining site
between pSINCP and pVCR. The 3' joining site was a fortuitous BspEI
site present in nsP1 of both SIN and VEE. In order to accomplish
the backbone swap, pSINCP was first transformed into a
Dam/Dcm-minus host bacteria, SCS 110 (Stratagene, La Jolla, Calif.)
to obtain DNA cleavable by BclI. A 1203 base pair fragment
containing the BGHt on the 5' end and Kan R gene on the 3' end was
isolated and blunted by means of T4 DNA polymerase (New England
Biolabs, Beverly, Mass.) following standard methods. This fragment
was subsequently further digested with Pst I to liberate a 999 bp
BclI-PstI fragment that was purified containing the BGHt and the 5'
2/3 of the Kan R gene.
[0171] Plasmid pSINCP contains 4 BspEI sites. To make fragment
identification more precise, the plasmid was co-digested with NotI,
SalI, and Eco471II and the 5173 bp fragment was isolated. This
fragment was then further digested with PstI and BspEI and from
this a 2730 bp PstI-BspEI fragment was purified which contained the
3' 1/3of the Kan R gene, plasmid origin of replication, the CMV pol
II promoter, and 420 bp of the Sindbis nsP1 gene.
[0172] As a source of the 5' and 3' end of the VCR replicon, an
early intermediate, pVCR-DH (see below) was utilized. pVCR-DH
contains fragment 1, fragment 13, and all of the terminal
restriction sites of the intermediate fragments. As such it
contains a portion of the VEE-TRD nsP1 gene including the necessary
BspEI site and all of the 3' features described above that were
necessary for the swap but lacks the core nonstructural region from
the 3' end of nsP1 through the 5' end of nsP4. pVCR-DH was
transformed into SCS110 cells as before and digested with BspEI and
PmeI to release a 1302 bp fragment containing nsP1'-nsP4', 3' UTR,
A40 tract, and HDV ribozyme.
[0173] A three-way ligation of the BclI(blunt)-PstI, and PstI-BspEI
fragments from pSINCP, and the BspEI-PmeI fragment from pVCR-DH was
performed. The resulting intermediate was designated pVCPdhintSP.
Plasmid pVCPdhintSP was digested with SacI (cutting 15 bp before
the 3' end of the CMV promoter) and BspEI at the junction of the
Sindbis and VEE sequences in nsP 1. The vector fragment of this
digest was de-phosphorylated and ligated with a 326 bp PCR product
from pVCR-DH providing the missing 5' terminus of VEE-TRD nsP1. The
5' primer, [AAGCAGAGCTCGTTTAGTGAACCGTATGGGCGGCGCATG], (SEQ ID NO 1)
juxtaposed the 3' terminal 15 nucleotides of the CMV promoter (up
to the transcription start site) to the starting base of the VEE 5'
UTR sequence. The 3' primer had the sequence listed
[gccctgcgtccagctcatctcgaTCTGTCCGGATCTTCCGC- .] (SEQ ID NO 2). This
intermediate was termed, pVCPdhintf. To complete the construct,
pVCPdhintf was digested with NotI and HpaI and the vector fragment
was de-phosphorylated and ligated to the HpaI-NotI fragment of pVCR
providing the missing core VEE nonstructural sequences missing from
the pVCPdhintf intermediate. This final VEE-based ELVIS construct
was designated pVCP.
Example 2
Construction of Alphavirus Defective Helper Constructs
[0174] Prior to construction of defective helpers (DH) of the
present invention for use in generating hybrid structural protein
elements and chimeric alphavirus particles, previous existing SIN
based defective helper packaging cassettes (Polo et al., 1999,
ibid; Gardner et al., 2000 ibid) were first modified. To generate
these new SIN cassettes, plasmid SINBV-neo (Perri et al., J. Virol.
74:9802-9807, 2000) was digested with ApaI, treated with T4 DNA
polymerase to blunt the ApaI generated-ends, and then digested with
BglII and BamHI. The 4.5 kb fragment, which contained the plasmid
backbone, the SIN subgenomic promoter, SIN 3'-end, synthetic polyA
tract, and the HDV antigenomic ribozyme, was gel purified with
QIAquick gel extraction kit and ligated to a 714 bp fragment
containing an SP6 promoter and SIN tRNA 5'-end, obtained from
plasmid 47tRNA BBCrrvdel 13 (Frolov et al., J Virol., 71:2819-2829,
1997) which had been previously digested with SacI, treated with T4
DNA polymerase, digested with BamHI and gel purified. Positive
clones were verified by restriction analysis this construct was
used as the basis for insertion via the XhoI-NotI sites (removes
existing Neo insert), of the alphavirus glycoprotein and capsid
sequences described below. The SIN defective helper cassette
backbone described herein is referred to as tDH.
[0175] VCR-DH construction
[0176] A polylinker region was cloned into the vector backbone of
SINCR-GFP (Gardner et al., 2000, ibid) as a first step. The
polylinker contained the following restriction sites from 5' to 3':
ApaI-MluI-HpaI-BglII-Bsu36I-PstI-BsaBI-AvrII-SwaI-AspI-BbvCI-AscI-NotI-Pm-
el. To generate the polylinker, the following oligonucleotides were
used:
2 PL1F 5'-cacgcgtactactgttaactcatcaagatctactaggcctaaggcacc-
acctgcaggtagtagatacacatcataatacc-3' (SEQ ID NO 3) PL2F
5'-tagggcggcgatttaaatgatttagactacgtcagcagccctcagcggcgcgcccacccagcggccg-
caggatagttt-3' (SEQ ID NO 4) PL1R
5'-tatgatgtgtatctactacctgcaggtggtgccttaggcctagtagatcttgatgagttaacagtagtac-
gcgtgggcc-3' (SEQ ID NO 5) PL2R
5'-aaactatcctgcggccgctgggtgggcgcgccgctgagggctgctgacgtagtctaaatcatttaaatcg-
ccgccctaggtat-3' (SEQ ID NO 6)
[0177] Oligonucleotides PL1F and PL1R, and oligonucleotides PL2F
and PL2R were mixed in two separate reactions, phosphorylated,
denatured, and slowly annealed. The two reactions were then mixed
and ligated to the 2.8 kb fragment generated from plasmid SINCR-GFP
that had been previously digested with ApaI and PmeI, and gel
purified using QIAquick gel extraction kit. Clones were screened
for the correct orientation using AlwNI and NotI restriction
digests. The positive clones were verified by restriction digest
with each single enzyme present in the polylinker. This construct
was named VCR-backbone. Next, the VEE 3'-end, together with a
polyadenylation tract and the HDV ribozyme were inserted into VCR
backbone. This fragment was generated using the following
overlapping synthetic oligonucleotides.
3 (SEQ ID NO 7) VEE3'-1F 5'-ggccgcatacagcagcaattggcaagctgct-
tacatagaactcgcggcgattggcatg-3' (SEQ ID NO 8) VEE3'-1R
5'-ccaatcgccgcgagttctatgtaagcagcttgccaattgctgctgtatgc-3' (SEQ ID NO
9) VEE3'-2F 5'-ccgccttaaaatttttattttattttttct-
tttcttttccgaatcggattttgtttttaat-3' (SEQ ID NO 10) VEE3'-2R
5'-attaaaaacaaaatccgattcggaaaagaaaagaaaaaataaaataaaaattttaaggcgg-
catg-3' (SEQ ID NO 11) VEE3'-3F
5'-atttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagggtcggcatggcatctccacctc-
ctcgcg-3' (SEQ ID NO 12) VEE3'-3R
5'-gaccgcgaggaggtggagatgccatgccgacccttttttttttttttttttttttttttttttttttttt-
tttgaaat-3' (SEQ ID NO 13) VEE3'-4F
5'-gtccgacctgggcatccgaaggaggacgcacgtccactcggatggctaagggagagccacgttt-3'
(SEQ ID NO 14) VEE3'-4R 5'-aaacgtggctctcccttagccatc-
cgagtggacgtgcgtcctccttcggatgcccaggtcg-3'
[0178] Each pair of forward and reverse oligonucleotides (e.g.,
VEE1F with VEE1R, VEE2F with VEE2R, etc) were mixed,
phosphorylated, denatured, and slowly annealed. Then the 4 pairs of
annealed oligonucleotides were mixed together, ligated to each
other, digested with enzymes NotI and PmeI, gel purified using a
QIAquick gel extraction kit, and ligated to the VCR-backbone that
had been previously digested with the same enzymes, gel purified
and treated with shrimp alkaline phosphatase. Positive clones for
the fragment were verified by sequencing. This construct was called
VCR-3'drib.
[0179] Next, the 5' end of VEE genome was inserted. This fragment
was generated using overlapping oligonucleotides to cover the
genome region of VEE strain Trinidad donkey (see GENBANK reference,
above) from nucleotide 1 to the restriction site HpaI. The primers
with VEE nucleotide 1 also contained an upstream MluI site followed
by the SP6 promoter immediately 5' of VEE nucleotide 1. All
oligonucleotides were mixed in one reaction, phosphorylated,
denatured, slowly annealed, and ligated. After inactivating the
ligase, the DNA was digested with the enzymes MluI and HpaI, gel
purified using the QIAquick gel extraction kit and ligated to
VCR-3'drib that had been previously digested with the same
restriction enzymes, gel purified and treated with shrimp alkaline
phosphatase. The positive clones for the insert were verified by
sequencing. This intermediate construct was called
VCR-F1-3'drib.
[0180] Finally, the region of VEE containing the subgenomic
promoter was cloned into VCR-F1-3'drib. This region (fragment 13,
FIG. 1) corresponds to the sequence between restriction site SwaI
and nucleotide 7561 of the VEE Trinidad donkey strain genome. The
fragment was generated using overlapping oligonucleotides
corresponding to the Trinidad Donkey strain sequence, with the
exception of the oligonucleotide corresponding to the 3' end of the
fragment that was modified to carry an additional restriction sites
(BbvCI) to allow later insertion of heterologous sequences under
the control of the subgenomic promoter. All oligonucleotides were
mixed in one reaction, phosphorylated, denatured, slowly annealed,
and ligated. After inactivating the ligase, the DNA was digested
with the enzymes SwaI and BbvCI, gel purified using QIAquick gel
extraction kit and ligated to VCR backbone that had been previously
digested with the same restriction enzymes, gel purified and
treated with shrimp alkaline phosphatase. Clones positive for the
insert were verified by sequencing and one clone, VF 13-14, was
subsequently repaired by deleting a small insertion and
reconfirming by sequencing. The clone was next digested with
SwaI-NotI, the 600 bp fragment was gel purified using the QIAquick
gel extraction kit and ligated to VCR-F1-3'drib that had been
previously digested with the same restriction enzymes, gel purified
and treated with shrimp alkaline phosphatase. The positive clones
for the insert were verified and the construct was called
VCR-DH.
[0181] Construction of tDH-Vgly, tDH-VE2-120, and
tDH-VNTR-glydl160
[0182] The VEE Trinidad donkey strain glycoprotein genes were
generated using overlapping oligonucleotides that were designed
based on the published GENBANK sequence. To allow expression from
the appropriate vector packaging cassettes, an ATG codon, in-frame
with the glycoprotein gene open reading frame, was added
immediately preceding the first amino acid of E3, and a XhoI site
and NotI site were added respectively at the 5' and 3' end of the
glycoprotein gene sequences. Gene synthesis was performed by using
overlapping PCR to generate five separate fragments spanning the
entire glycoprotein sequence (FIG. 3). The fragments were assembled
stepwise into a single fragment in pGEM using the restriction sites
indicated in FIG. 3. A small nucleotide deletion within the KasI
sites was corrected by standard site-directed mutagenesis. The
final clone was verified by sequencing and designated pGEM-Vgly.
Then the glycoprotein gene sequence was transferred from pGEM into
tDH using the XhoI-NotI sites and the final clone was designated
tDH-Vgly.
[0183] A construct similar to tDH-Vgly that also contains the
attenuating mutation at E2 amino acid 120 present in the TC83
vaccine strain of VEE was constructed in an analogous way. Plasmid
pGEM-Vgly was subjected to standard site directed mutagenesis and
the E2-120 mutation confirmed by sequencing. Then, the VEE E2-120
glycoprotein sequence was transferred from pGEM into tDH using the
XhoI-NotI sites and the construct was confirmed by sequencing and
designated tDH-VE2-120.
[0184] Plasmid tDH-VNTR-glydl160 is a tDH defective helper
construct (see above) containing a SIN glycoprotein sequence from
the human dendritic cell tropic strain described previously
(Gardner et al., ibid), in which the SIN derived subgenomic 5' NTR
and the synthetic XhoI site were substituted by the following VEE
subgenomic 5' NTR sequence (5'-ACTACGACATAGTCTAGTCCGCCAAG) (SEQ ID
NO 53). This sequence was inserted such that it immediately
precedes the glycoprotein ATG initiation codon. The construct is
also known as tDH-VUTR-glydl160 to reflect the interchangeable
nomenclature for the subgenomic 5' nontranslated region (NTR), also
referred to as untranslated region (UTR).
[0185] Construction of VCR-DH-Vgly, VCR-DH-VE2-120, and
VCR-DH-Sglydl160
[0186] The VEE glycoprotein gene sequence between the ATG and the
restriction site NcoI was amplified by PCR using the following
oligonucleotides.
4 VGBbvCI 5'-atatatatctcgagcctcagcatgtcactagtgaccaccatgt-3' (SEQ ID
NO 15) VGNcoIR 5'-atatataaattccatggtgatggagtcc-3' (SEQ ID NO
16)
[0187] After PCR amplification, the fragment was digested with
BbvCI and NcoI, and gel purified using QIAquick gel extraction kit.
Separately, the VEE E2-120 glycoprotein region from NcoI to NotI
was prepared by digesting pGEM-VE2-120 with these enzymes followed
by gel purification. The two fragments were mixed and ligated to
VCR-DH that had been previously digested with BbvCI and NotI, gel
purified, and treated with alkaline phosphatase. Positive clones
for the insert were verified by sequencing and designated
VCR-DH-VE2-120. To obtain VCR-DH-Vgly the NcoI-XbaI fragment was
obtained from pGEM-Vgly and used to substitute the same fragment in
VCR-DH-VE2-120.
[0188] A SIN glycoprotein with the human DC+ phenotype was obtained
from a defective helper plasmid E3ndl160/dIRRV, modified from
Gardner et al., (2000, ibid) (PCT WO 01/81609). Plasmid
E3ndl160/dlRRV was digested with XhoI, treated it with Klenow
fragment to blunt the ends, then digested with NotI. The 3 kb
fragment was gel purified using QIAquick gel extraction kit and
ligated to VCR-DH that had been previously digested with BbvCI,
treated with Klenow fragment, digested with NotI, and treated with
alkaline phosphatase. A positive clone for the insert was
designated VCR-DH Sglydl160. Similarly, a defective helper
construct containing the SIN LP strain-derived envelope
glycoproteins (Gardner et al, 2000, ibid) was constructed.
[0189] Construction of VCR-DH-Vcap, VCR-DH-Scap and tDH-Vcap
[0190] The VEE capsid gene was synthesized using overlapping
oligonucleotides, also designed based on the published GENBANK
sequence of the VEE Trinidad donkey strain, with the addition of a
XhoI site and a Kozak consensus sequence adjacent to the capsid
ATG, and a NotI site at the 3'-end. The oligonucleotides were mixed
and used for a 25-cycle PCR amplification reaction. The PCR
generated fragment was digested with the restriction sites XhoI and
NotI, gel purified and cloned into the vector pBS-SK+. Positive
clones for the insert were verified by sequencing. Finally, the
capsid sequence was further modified to insert a termination codon
at it's 3'-end by PCR amplification in a 25-cycle reaction with the
following oligonucleotides.
5 TRDCtR 5'-atatatatgcggccgcttaccattgctcgcagttctccg-3' (SEQ ID NO
17) contains stop codon in frame with the last amino acid of capsid
TRDNtF 5' atatatctcgagccaccatgttcccgttccagccaatg- -3' (SEQ ID NO
18)
[0191] The product was purified with QIAquick PCR purification kit,
digested with XhoI and NotI and ligated to the backbone of tDH
vector that had been previously prepared by digestion with XhoI and
NotI, gel purification, and alkaline phosphatase treatment.
Positive clones for the insert were verified by sequencing and the
construct was designated tDH-Vcap.
[0192] The same PCR product was also digested with XhoI, treated
with T4 DNA polymerase to blunt XhoI site, digested with NotI, gel
purified, and ligated to VCR-DH that had been previously digested
with BbvCI, treated with T4 DNA polymerase to blunt BbvCI site,
digested with NotI, gel purified, and treated with alkaline
phosphatase. Positive clones for the insert were verified by
sequencing and the construct was designated VCR-DH-Vcap.
[0193] The SIN capsid sequence was obtained from a previously
described defective helper and the 800 bp fragment was gel purified
using QIAquick gel extraction kit and ligated to VCR-DH that had
been previously digested with BbvCI, treated with Klenow fragment,
digested with NotI, and treated with alkaline phosphatase. A
positive clone for the insert was designated VCR-DH-Scap.
Example 3
Generation of Alphavirus Replicon Particle Chimeras with Hybrid
Capsid Protein
[0194] In the case of hybrid capsid protein using elements obtained
from both SIN and VEE, a series of hybrid capsid proteins were
constructed containing the amino terminal (RNA binding) portion
from SIN and the carboxy terminal (glycoprotein interaction)
portion from VEE. Additional constructs with the opposite portions
also were derived. The site at which such portions were fused
varied by construct and necessarily factored into account the
differences in overall length of these two capsid proteins, with
SIN capsid being 264 amino acids and VEE capsid being 275 amino
acids. Sites of fusion to generate the capsid hybrids are indicated
in the table below, as well as in FIG. 4.
6 Name of capsid chimera NH2-terminus COOH-terminus S113V
SIN(1-113) VEE(125-275) S129V SIN(1-129) VEE(141-275) S127V
SIN(1-127) VEE(139-275) S116V SIN(1-116) VEE(128-275) S109V
SIN(1-109) VEE(121-275) V141S VEE(1-141).sup. .sup.
SIN(130-264)
[0195] Each of the hybrid capsid constructs was generated by PCR
amplification of two overlapping fragments, one coding for the
amino-terminus of capsid protein from SIN or VEE, and the other
coding for the carboxy-terminus of capsid protein from the opposite
virus (VEE or SIN, respectively).
[0196] Fragments containing SIN capsid sequences were amplified
from a defective helper construct (Gardner et al., 2000, ibid), and
fragments containing VEE capsid sequences were amplified from
construct VCR-DH-Vcap (above). The following oligonucleotides were
used:
7 Fragment 5' oligonucleotide 3' oligonucleotide SIN(1-113) SINNtF
S113R 5'atatatctcgagccaccatgaatag 5'gggaacgtcttgtcggcctccaact
aggattctttaacatg-3' taagtg-3' (SEQ ID NO 20) (SEQ ID NO 19) with
nt. 1-10 containing the restriction complementary to VEE site XhoI
(nt. 7-13), the capsid sequence and Kozak consensus sequence nt.
11-31 to SIN capsid for optimal protein sequence translation (nt.
14-18), and sequence complementary to SIN capsid (nts 19-48)
SIN(1-129) SINNtF SINNtR 5'gaataacttccctccgaccacacat
gcgtgcccgatgacatctc-3' (SEQ ID NO 21) with nt. 1-24 complementary
to VEE capsid sequence and nt. 25-44 to SIN capsid sequence
SIN(1-127) SINNtF S127R 5'ccacacaagcgtacccgatgacat ctccgtcttc-3'
(SEQ ID NO 22) with nt. 1-13 complementary to VEE capsid sequence
and nt. 14-34 to SIN capsid sequence SIN(1-116) SINNtF S116R
5'catgattgggaacaatctgtcggcc tccaac-3' (SEQ ID NO 23) with nt. 1-9
complementary to VEE capsid sequence and nt. 10-31 to SIN capsid
sequence SIN(1-109) SINNtF S109R 5'gtcagactccaacttaagtgccatg cg-3'
(SEQ ID NO 24) with nt. 1-6 complementary to VEE capsid sequence
and nt. 7-27 to SIN capsid sequence. SIN(130-264) SINCtF SINCtR
5'gggaagataaacggctacgctctg 5'atatatatgcggccgctcaccactct
gccatggaaggaaagg-3' (SEQ tctgtcccttc-3' (SEQ ID NO ID NO 25) with
nt. 1-21 26) with the restriction site complementary to VEE NotI
(nt. 9-16) and nt. capsid sequence and nt. 17-39 complementary to
22-40 to SIN capsid SIN capsid sequence. sequence VEE(125-275)
TRD125F TRDCtR 5'gccgacaagacgttcccaatcatgt
5'atatatatgcggccgcttaccattgc tggaag-3' (SEQ ID NO 27)
tcgcagttctccg-3' (SEQ ID with nt. 1-9 complementary NO 28) with the
restriction to SIN capsid sequence and site NotI (nt. 9-16) and nt.
nt. 10-31 to VEE capsid 17-39 complementary to sequence VEE capsid
VEE(141-275) TRDCtF TRDCtR 5'gagatgtcatcgggcacgcatgtgt
ggtcggagggaagttattc-3' (SEQ ID NO 29) with nt. 1-20 complementary
to SIN capsid sequence and nt. 21-44 to VEE capsid sequence
VEE(139-275) TRD139F TRDCtR 5'-tcatcgggtacgcttgtgtggtcg- 3' (SEQ ID
NO 30) with nt. 1-8 complementary to SIN capsid sequence and nt.
9-24 to VEE capsid sequence VEE(128-275) TRD128F TRDCtR
5'gacagattgttcccaatcatgttgga aggg-3' (SEQ ID NO 31) with nt. 1-11
complementary to SIN capsid sequence and nt. 12-30 to VEE capsid
sequence VEE(121-275) TRD121F TRDCtR 5'acttaagttggagtctgacaagacg
ttcccaatc-3' (SEQ ID NO 32) with nt. 1--13 complementary to SIN
capsid sequence and nts. 14-34 to VEE caspid sequence VEE(1-141
TRDNtF TRDNtR 5'atatatctcgagccaccatgttcccg 5'-cctttccttccatggccag
ttccagccaatg-3' (SEQ ID agcgtagccgtttatcttccc-3' NO 33) with the
restriction (SEQ ID NO 34) with nt. site XhoI (nt. 7-13), the 1-19
complementary to Kozak consensus sequence SIN capsid sequence and
for optimal protein nt. 20-40 to VEE capsid translation (nt.
14-18), and sequence nts. 19-48 complementary to VEE capsid
sequence
[0197] The oligonucleotides listed above were used at 2 .mu.M
concentration with 0.1 .mu.g of the appropriate template plasmid
DNA in a 30 cycle PCR reaction, with Pfu polymerase as suggested by
the suppand with the addition of 10% DMSO. The general
amplification protocol illustrated below.
8 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5 60
0.5 10 72 2
[0198] The amplified fragments were purified from agarose gel using
QIAquick gel extraction kit, and then an aliquot ({fraction
(1/15)}th) of each fragment was used as template for a second PCR
amplification. The two fragments were mixed as follows and
amplified with Vent Polymerase as suggested by supplier, with the
addition of 10% DMSO:
[0199] SIN(1-129)+VEE(141-275)
[0200] SIN(1-127)+VEE(139-275)
[0201] SIN(1-116)+VEE(128-275)
[0202] SIN(1-113)+VEE(125-275)
[0203] SIN(1-109)+VEE(121-275)
[0204] VEE(1-141)+SIN(130-264)
[0205] One PCR amplification cycle was performed under the
following conditions:
9 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5 42
1 1 72 3
[0206] For the SIN NH2-terminus/VEE COOH-terminus fusions, the
SINNtF and TRDCtR primers, containing the XhoI and NotI restriction
sites, were added at 2 .mu.M concentration and the complete PCR
amplification was performed as follows:
10 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0207] The PCR product was purified using the QIAquick kit,
digested with XhoI and NotI, gel purified from agarose gel as
described above, and ligated to plasmid tDH that had also been
digested with XhoI and NotI to remove the existing capsid gene
insert. Clones containing the newly generated hybrid inserts were
verified by sequencing and the new defective helper constructs for
use in producing chimeric particles were designated tDHS 129Vcap,
tDHS 127Vcap, tDHS 116Vcap, tDHS 113Vcap, and tDHS 109Vcap.
[0208] Similarly, for the VEE NH2 terminus/SIN COOH terminus
fusions, the TRDNtF and SINCtR primers, containing the XhoI and
NotI restriction sites, were added at 2 .mu.M concentration. The
PCR amplification was performed using the same conditions as above.
This PCR fragment was then digested with XhoI, blunted, digested
with NotI and ligated to plasmid VCR-DH-Vcap that had been digested
with BbvCI, blunted and digested with NotI. Clones containing the
inserts were verified by sequencing and the new defective helper
construct was designated VCR-DH-S 129Vcap.
[0209] The capsid chimeras were then tested for their efficiencies
of replicon packaging with the appropriate alphavirus replicon
vector and glycoprotein defective helper. Specifically, the
chimeras with the SIN-derived NH2-terminus and the VEE-derived
COOH-terminus were tested for their ability to package SIN
replicons with VEE glycoproteins. This was accomplished as follow.
The plasmid DNA encoding for the chimeras (tDHS129Vcap,
tDHS127Vcap, tDHS116Vcap, tDHS113Vcap, and tDHS109Vcap) were
linearized with the unique restriction site PmeI and used for in
vitro transcription as described previously (Polo et al., 1999,
ibid). Each transcript was co-transfected by electroporation into
BHK cells together with helper RNA expressing the VEE glycoproteins
and SIN replicon RNA expressing GFP, as described previously (Polo
et al. 1999, ibid). Transfected cells were incubated at 34.degree.
C. for 24 hr, at which time the culture supernatants were
collected, clarified by centrifugation, serially diluted, and used
to infect nave BHK-21 cells for approximately 14 hr. Enumeration of
GFP positive cells allowed for quantitation of input vector
particles and the vector particle stock. The data below indicate
that the efficiency of packaging for a SIN/VEE chimeric particle
can be increased quite dramatically, particularly with the S 113V
hybrid capsid protein.
11 Capsid Glycoprotein Replicon Particle titer S129V VEE SIN
4e.sup.5 IU/ml S127V VEE SIN 2e.sup.4 IU/ml S116V VEE SIN
1.6e.sup.6 IU/ml S113V VEE SIN 1.1e.sup.7 IU/ml
[0210] Similarly, each chimera transcript was co-transfected by
electroporation into BHK cells together with 1) helper RNA
expressing the VEE glycoproteins with the E2-120 attenuating
mutation tDHVE2-120 and 2) SIN replicon RNA expressing GFP.
Transfected cells were incubated at 34.degree. C. for 24 hr, at
which time the culture supernatants were collected, clarified by
centrifugation, serially diluted, and used to infect nave BHK-21
cells for approximately 14 hr. Enumeration of GFP positive cells
allowed for quantitation of input vector particles and titer
determination for the replicon vector particle stock. The data
below confirm that the hybrid capsid can dramatically increase the
packaging efficiency of the SIN replicon in particles containing
the VEE glycoproteins.
12 Capsid Glycoprotein Replicon Particle titer S129V VE2-120 SIN
1.6e.sup.7 IU/ml S127V VE2-120 SIN 5.1e.sup.5 IU/ml S116V VE2-120
SIN 4.7e.sup.7 IU/ml S113V VE2-120 SIN 9.3e.sup.7 IU/ml S VE2-120
SIN 1e.sup.2 IU/ml
[0211] Similar experiments with the VCR-GFP RNA, cotransfected with
RNA helpers coding for the hybrid capsid S129Vcap and the SIN
glycoproteins, produced particles with average titers of 1.6e7
IU/ml demonstrating that the ability of this hybrid protein to
efficiently package VEE-derived vector RNA.
[0212] To further maximize the capsid-RNA and capsid-glycoprotein
interactions, an additional construct was made, whereby the SI 13V
hybrid capsid protein gene was incorporated into the genome of a
chimeric alphavirus, comprising the 5'-end, 3'-end, subgenomic
promoter and nonstructural protein genes of SIN, and the
glycoprotein genes from VEE.
[0213] To generate such construct, an initial genome-length SIN
cDNA clone from which infectious RNA may be transcribed in vitro
was generated by assembling replicon and structural gene sequences
from the previously described human dendritic cell tropic SIN
variant, SINDCchiron (ATCC#VR-2643, deposited Apr. 13, 1999). DNA
clones used encompassing the entire genome of SINDCchiron virus
(Gardner et al., ibid; WO 00/61772) were assembled using standard
molecular biology techniques and methods widely known to those of
skill in the art (Rice et al., J. Virol., 61:3809-3819, 1987; and
U.S. Pat. No. 6,015,694). The genomic SIN clone was designated
SINDCSP6gen.
[0214] Subsequently, the existing SIN structural proteins were
replaced with the hybrid capsid S129Vcapsid and VEE glycoproteins
in the following manner. A fragment from tDH-S129V containing part
of the hybrid capsid was generated by PCR amplification with the
following oligonucleotides:
13 S/VcVglR atatatatggtcactagtgaccattgctcgcagttctccg (SEQ ID NO 54)
ScAatIIF gccgacagatcgttcgacgtc (SEQ ID NO 55)
[0215] The oligonucleotides were used 2 .mu.M concentration with
0.1 .mu.g of the appropriate template plasmid DNA in a 30 cycle PCR
reaction, with Pfu polymerase as suggested by the supplier and with
the addition of 10% DMSO. The general amplification protocol is
illustrated below.
14 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0216] The PCR fragment was gel purified using QIAquick gel
extraction kit. Another fragment containing the VEE glycoprotein
fragment was obtained from tDHVE2-120 by digestion with SpeI and
PmeI, and gel purification. The two fragments were mixed and
ligated to an 11 kb fragment obtained from the SINDCSP6gen clone by
digestion with SpeI and PmeI, gel purification, and treatment with
shrimp alkaline phosphatase. The positive clones for the inserts
were confirmed by sequencing and this intermediate was called
SrS129VcVg-interm. To restore the authentic 3'-end in the genomic
clone, the PsiI-PsiI fragment was regenerated by PCR with the
following oligonucleotides
15 PsiIFdlN 5'ATATATATTTATAATTGGCTTGGTGCTGGCTACTATTGTGGCCA-
TGTACGTG (SEQ. ID. NO.53)
CTGACCAACCAGAAACATAATTGACCGCTACGCCCCAATGA- TCC-3' PsiR
5'-GGCCGAAATCGGCAAAATCCC-3' (SEQ. ID. NO.54)
[0217] at 2 .mu.M concentration with 0.1 .mu.g of the infectious
clone plasmid DNA in a 30 cycle PCR reaction, with Vent polymerase
as suggested by the supplier and with the addition of 10% DMSO. The
general amplification protocol illustrated below.
16 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0218] The fragment was digested with PsiI, gel purified, and
ligated to SrS 129VcVg-interm that had also been digested with
PsiI, gel purified, and treated with shrimp alkaline phosphatase.
The positive clones for the insert were confirmed by sequencing and
the final construct was designated SrS129VcVg.
[0219] To construct a similar full-length cDNA clone containing the
hybrid SI 13V capsid, a fragment containing part of SIN sequences
upstream of the capsid gene and the capsid gene encoding for -113
was generated using the following oligonucleotides
[0220] Sic7082F
[0221] 5'-CACAGTTTTTGAATGTTCGTTATCGC-3'(SEQ. ID. NO. 55)
[0222] S113R (see above)
[0223] at 2 .mu.M concentration with 0.1 .mu.g of the SINDCSP6gen
construct in a 30 cycle PCR reaction, with Pfu polymerase as
suggested by the supplier and with the addition of 10% DMSO. The
general amplification protocol illustrated below.
17 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0224] The fragment was gel purified using QIAquick gel extraction
kit, and 1/10.sup.th of the reaction was mixed with fragment
VEE(141-275) (see above, construction of all hybrid capsid genes).
One PCR amplification cycle was performed under the following
conditions:
18 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
42 1 1 72 3
[0225] Then oligonucleotides Sic7082F and TRDCtR were added at 2
.mu.M concentration and the complete PCR amplification was
performed as follows:
19 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0226] The PCR product was purified using the QIAquick kit,
digested with BstZ17I and SapI, gel purified from agarose gel as
described above, and ligated to two fragments generated from
plasmid SrS129VcVg that had also been digested with BstZ17I and
SapI to remove the existing capsid gene insert. Clones containing
the newly generated hybrid inserts were verified by sequencing and
the new construct was designated SIN113CVgly.
[0227] In order to generate virus, the SIN113CVgly construct was
linearized with PmeI, transcribed in vitro using SP6 polymerase and
the RNA transfected into BHK cells. Progeny virus was harvested and
passaged in cells, with the infectious titer increasing to levels
approaching 10.sup.9 PFU/mL. A non-plaque purified stock of this
chimeric SIN virus, designated SIN113CVgly virus (deposited with
ATCC May 31, 2001, PTA-3417), was then used as the source of RNA
for cloning and sequencing by standard molecular biology techniques
(e.g., those described above) to identify additional genetic
determinants that provide this high level of chimeric particle
packaging. Individual genetic determinants are readily incorporated
back into the replicon and defective helper packaging constructs of
the present invention using teachings provided herein.
[0228] It is understood that the non-plaque-purified stock of
chimeric SIN virus deposited with ATCC number may contain numerous
genotypes and phenotypes not specifically disclosed herein that are
considered part of the present invention. Persons having ordinary
skill in the art could easily isolate individual phenotypes and or
genotypes using plaque purification techniques and sequence the
isolated chimeric SIN using procedures known to those having
ordinary skill in the art and disclosed herein.
Example 4
[0229] Generation of Alphavirus Replicon Particle Chimeras with
Hybrid Glycoproteins
[0230] In the case of a hybrid envelope glycoprotein using elements
obtained from both SIN and VEE, hybrid E2 glycoproteins were
constructed containing the cytoplasmic tail (e.g., capsid binding
portion) from SIN and the transmembrane and ectodomain portions
from VEE. Additional constructs with the opposite portions can also
be derived. In some embodiments, it may also be desirable to
include hybrids for both the E2 and E1 glycoproteins, and to
include hybrids that encompass the transmembrane domain.
[0231] To demonstrate an increased efficiency of chimeric particle
packaging using such glycoprotein hybrids, a modified VEE-derived
glycoprotein was constructed wherein the E2 tail was substituted
with SIN-derived E2 cytoplasmic tail. The fusion was done at the
conserved cysteine residue (amino acid residue 390, both VEE and
SIN E2) which is at the boundary between the transmembrane domain
and the cytoplasmic tail (FIG. 5). The chimera construct was
generated by PCR amplification of two overlapping fragments one of
which included part of VEE E2 glycoprotein sequence upstream the
cytoplasmic tail and part of the SIN E2 cytoplasmic tail. The
second fragment included part of the SIN E2 cytoplasmic tail and
VEE 6K protein.
[0232] The first fragment was amplified from the construct
VCR-DH-Vgly using the following oligonucleotides:
[0233] VE2F: 5'-atatatcaggggactccatcaccatgg-3' (SEQ ID NO 35)
[0234] (nts 7-27 are complementary to the VEE glycoprotein and
include the NcoI site)
[0235] VSGE2R:
5'-gggattacggcgtttggggccagggcgtatggcgtcaggcactcacggcgcgcttt
gcaaaacagccaggtagacgc-3' (SEQ ID NO 36)
[0236] (nts 1-56 are SIN E2 cytoplasmic tail sequence, and nts.
57-77 are complementary to VEE glycoprotein sequence)
[0237] The second fragment was amplified from the same plasmid
using the following primers:
[0238] VSGE3F:
[0239]
5'-gcccaaacgccgtaatcccaacttcgctggcactcttgtgctgcgttaggtcggccaatgctga-
gaccacctgggagtccttg-3' (SEQ ID NO 37)
[0240] (nts. 1-63 correspond to part of the SIN E2 cytoplasmic tail
sequence, and nts 64-84 are complementary to the VEE
glycoproteins)
[0241] VEE3'-1R:
5'-ccaatcgccgcgagttctatgtaagcagcttgccaattgctgctgtatgc-3' (SEQ ID NO
38) (complementary to VCR-DH Vgly downstream the glycoprotein open
reading frame)
[0242] The oligonucleotides listed above were used at 2 .mu.M
concentration with 0.1 .mu.g of template plasmid DNA VCR-DH-Vgly in
a 30 cycles PCR reaction with Pfu Polymerase as suggested by the
supplier, with the addition of 10% DMSO. The amplification protocol
is shown below.
20 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0243] The two amplified fragments were purified from agarose gel
using QIAquick gel extraction kit, and then an aliquot ({fraction
(1/10)}th) of each fragment was used as templates for a second PCR
amplification. The two fragments were mixed with Pfu Polymerase as
suggested by the supplier with the addition of 10% DMSO. One PCR
amplification cycle was performed:
21 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
42 1 1 72 3
[0244] Then the VE2NtF and VEE3'-1 R primers were added 2 .mu.M
concentration and the PCR amplification was performed as
follows:
22 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 0.5 60
0.5 30 72 2
[0245] The PCR product was purified using the QIAquick kit,
digested with NcoI and NotI, gel purified from agarose gel as
described above, and ligated to plasmid tDH-Vgly that had also been
digested with NcoI and NotI and purified from agarose gel. Clones
containing the inserts were verified by sequencing and the
construct was designated tDH-VglySE2tail.
[0246] To demonstrate increased packaging of particles generated
with such a glycoprotein chimera, plasmid DNA tDH-VglySE2tail was
linearized with the single restriction enzyme PmeI and RNA
transcribed in vitro. The RNA was co-transfected together with
SINCR-GFP replicon RNA and the defective helper RNA encoding SIN
capsid protein. Transfected cells were incubated at 34.degree. C.
for 24 hr, at which time the culture supernatant was collected,
clarified by centrifugation, serially diluted, and used to infect
nave BHK-21 cells for approximately 14 hr. Using flow cytometry
analysis the particles titers were determined and shown to be
2e.sup.3 IU/ml. This result showed that some low efficiency
interaction is occurring between the glycoprotein chimera and SIN
capsid.
[0247] To further increase the efficiency of chimeric particle
packaging with a hybrid glycoprotein, additional constructs were
generated. Alignment of the cytoplasmic tails from VEE and SIN
(FIG. 5) shows the differences at 10 residues, four of which are
conservative changes. Interestingly, the residues at positions 394
and 395 are charged in the SIN glycoprotein, while they are
hydrophobic in VEE. Such difference might affect the E2
functionality. Site directed mutagenesis using a PCR amplification
method was used to change the two residues in the construct
tDH-VglySE2tail as follow:
23 Name Nucleotide change amino acid change Mutagenic oligos tDH-M1
A.sub.2151 to C Glu.sub.395 to Ala M1R (SEQ ID NO 39) 5'GTATGGCGTCA
(SEQ ID NO 39) GGCACGCACGG CGCGCTTTG-3' M1F 5'AGCGCGCCGT (SEQ ID NO
40) GCGTGCCTGACG CCATACGCC-3' tDH-M2 C.sub.2147 to G and G.sub.2148
Arg.sub.394 Val M2R (SEQ ID NO 40) to T 5'ATGGCGTCAG (SEQ ID NO 41)
GCACTCAACGCG CGCTTTGCAAAA C-3' M2F 5'TTTGCAAAGCG (SEQ ID NO 42)
CGCGTTGAGTGC CTGACGCCATAC-3' tDH-M3 A.sub.2151 to C, C.sub.2147 to
Arg.sub.394-Glu.sub.395 to M3R G, and G.sub.2148 to T Val-Ala
5'ATGGCGTCAG (SEQ ID NO 43) GCACGCAACGC GCGCTTTGCAAA AC-3' M3F
5'TTTGCAAAGCG (SEQ ID NO 44) CGCGTTGCGTGC CTGACGCCATAC-3'
[0248] The mutagenized constructs were verified by sequencing. To
quantitate packaging by these new glycoprotein hybrids, the plasmid
DNAs were linearized with the single restriction enzyme PmeI and
transcribed in vitro. Each mutant RNA was then co-transfected
together with the SINCR-GFP replicon RNA and defective helper RNA
encoding SIN capsid. Transfected cells were incubated at 34.degree.
C. for 24 hr, at which time the culture supernatant was collected,
clarified by centrifugation, serially diluted, and used to infect
nave BHK-21 cells for approximately 14 hr for titer analysis. Using
flow cytometry analysis, the particle titers were determined and it
was observed that the packaging efficiency was increased
approximately 7-fold with M1.
[0249] Alternatively, and similarly to the capsid approach, it was
possible to substitute the VEEglyco-E2 SIN tail chimera into a
full-length alphavirus cDNA clone from which infectious virus may
be obtained, and use the chimeric virus genome to select naturally
arising chimeric particle variants with further increased
efficiency of packaging. A large plaque phenotype may be indicative
of high titer virus. This infectious chimera was constructed as
follow. A fragment containing mostly SIN capsid sequence was
generated by PCR in order to have a few nucleotides added to its 3'
end corresponding to the VEE glycoprotein sequence and containing
the SpeI restriction site. This fragment was amplified from a human
DC-tropic SIN infectious clone construct (Gardner et al., ibid)
with the following primers:
24 ScAatIIF: 5'-gccgacagatcgttcgacgtc-3' (SEQ ID NO 45) ScVglR:
5'-atatatatggtcactagtgaccactcttctgtcccttccg-3' (SEQ ID NO 46)
[0250] These oligonucleotides were used at 2 .mu.M concentration
with 0.1 .mu.g of template plasmid DNA in a 30 cycles PCR reaction
with Pfu Polymerase as suggested by the supplier with the addition
of 10% DMSO. The amplification protocol is shown below.
25 Temperature (.degree. C.) Time (Min.) No. Cycles 94 2 1 94 0.5
60 0.5 30 72 2
[0251] The amplified fragment (450 bp) was cleaned using QIAquick
PCR purification kit, digested with AatII and SpeI, gel purified
using QIAquick gel extraction kit. A fragment (3.4 kb) containing
the VEE glycoprotein-SIN E2tail and SIN 3' UTR was generated by
restriction digest from tDH-VE2Stail using the enzymes SpeI-PmeI
and gel purification with QIAquick gel extraction kit. This
fragment and the PCR fragment were mixed and ligated together to
plasmid DNA from the infectious clone that had been also digested
with AatII and PmeI, treated with Shrimp alkaline phosphatase, and
gel purified. Positive clones for the insert were verified by
sequencing. Finally, to restore the authentic full-length clone
3'-end, the PsiI-PsiI fragment was regenerated as described for
SrS129VcVg and the new construct was designated SrcVgSE2t.
[0252] SrcVgSE2t was linearized with the single restriction enzyme
PmeI and transcribed in vitro. The RNA was transfected into BHK
cells. Transfected cells were incubated at 37.degree. C. for 24 hr,
at which time the culture supernatant was collected, clarified by
centrifugation, and used to infect nave BHK-21 cells. Approximately
24 hr post-infection the supernatant was collected, clarified by
centrifugation, and used to infect nave BHK-21 cells again. At 24
hr post-infection a few viral plaques were observed, so the
supernatant was collected, clarified and used for to infect two
flasks of nave BHK. The cells of one flask were collected 16 hr
post-infection and total RNA was extracted using Trizol
(Gibco-BRL). The infection in the other flask was allowed to
continue for another 8 hrs and extensive cytopathic effects were
observed in the cells indicating that large amounts of virus had
been produced.
[0253] Total RNA extracted from the infected cells was used to
amplify and clone capsid and glycoprotein sequences using RT-PCR.
The reverse transcription was primed with either polydT or with the
specific primer
[0254] VglyR: 5'-atatatatgcggccgctcaattatgtttctggttggtcag-3' (SEQ
ID NO 47)
[0255] The cDNA was then used for PCR amplification of the capsid
sequence with the primers SINNtF containing a AlioI site and SINCtR
containing a NotI site, and of the glycoprotein sequence with the
primers VglyR containing a NotI site and
[0256] VglyF: 5'-atatatctcgagccgccagccatgtcactagtgaccac-3' (SEQ ID
NO 48)
[0257] containing a XhoI site. Both fragments were cleaned using
QIAquick PCR purification kit, digested with XhoI and NotI, gel
purified using QIAquick gel extraction kit and separately ligated
to tDH that had been previously digested with XhoI and NotI, gel
purified and treated with shrimp alkaline phosphatase. Ten clones
for the capsid fragment were sequenced to identify the possible
adaptive mutation(s). However, no mutations were found in the
capsid region indicating that either such mutations can only occur
in the glycoprotein sequences or that, since the RNA came from
unpurified plaques, the 10 clones did not completely represent the
entire adapted population.
[0258] Repeating the same analysis on RNA derived from 5 individual
viral plaques still did not lead to identification of capsid
adaptive mutations. The glycoprotein sequence from one plaque (P3)
revealed the presence of two amino acid changes at positions 380 of
E2 (Val to Gly) and 391 (Lys to Arg), also numbered relative to
wild-type E2. Interestingly, the amino acid 380 of E2 is conserved
between Sindbis and at least three VEE strains (TRD, MAC 10 and
6119) and amino acid 390, which is the first residue in of the
cytoplasmic tail, is a Lys in the SIN glycoprotein sequences and
MAC 10 and 6119 but is a Arg in the TRD strain. This might indicate
that the location of these residues play a role in the correct
conformation of the transmembrane-cytoplasmic tail, which might
stabilize the interactions between the glycoproteins and the
capsid, and may be further exploited as part of the present
invention.
[0259] To test if this double mutation could increase packaging
efficiency, a 998 bp fragment (NcoI-MfeI) containing both mutations
was swapped into tDH-VglySE2tail generating tDH-VglySE2tail-P3.
Then, plasmid DNA tDH-VglySE2tail-P3 was linearized with the single
restriction enzyme PmeI and RNA transcribed in vitro. The RNA was
co-transfected together with SINCR-GFP replicon RNA and the
defective helper RNA encoding SIN capsid protein. Transfected cells
were incubated at 34.degree. C. for 24 hr, at which time the
culture supernatant was collected, clarified by centrifugation,
serially diluted, and used to infect nave BHK-21 cells for
approximately 14 hr. Using flow cytometry analysis, the particles
titers were determined and the efficiency of packaging increased 50
fold with respect to VglySE2tail. Also, in the context of a hybrid
VEE glycoprotein containing the SE2tail and the VEE E2-120
attenuating mutation (VE2-120/SE2tail), the P3 mutations increased
the packaging efficiency 200 fold.
Example 5
Generation of Alphavirus Replicon Particle Chimeras with Hybrid
Packaging Signal
[0260] To generate a highly efficient packaging system for a VEE
replicon within Sindbis virus structural proteins, the well-defined
RNA packaging signal from SIN was inserted at various points within
a VEE replicon. For this work the 132 nucleotide (nt.) core
packaging signal from SIN was separately inserted into each of
three different sites (FIG. 6) within the VEE-TRD replicon
constructed in Example 1. Four chimeric replicons were generated.
Chimera-1A and Chimera-1B were the names given to the constructs in
which the SIN packaging signal was inserted at the 3' end of the
VEE-TRD nsP4 gene, just prior to the nsP4 stop codon. The Chimera-2
replicon contains the SIN packaging signal in-frame, at the
C-terminus of nsP3, substituting at the nucleotide level for a 102
bp segment of nsP3. Finally, the Chimera-3 replicon resulted from
the insertion of the SIN packaging signal at the end of nsP3, just
prior to the nsP3 termination codon.
[0261] It is also contemplated by the inventors that the teachings
herein may provide a unique opportunity to modify replicons and
eukaryotic layered vector initiation systems derived from any BSL-3
alphavirus (e.g., VEE), such that they may be treated as BSL-2 or
BSL-1 constructs by reducing the nucleotide sequence derived from
the parental virus to less than two-thirds genome-length.
[0262] A) Chimera 1A, 1B:
[0263] A complicating factor for the construction of these chimeras
lay in the fact that the subgenomic promoter of all alphaviruses
overlaps the last approximately 100 nucleotides of nsP4. In order
to place the SIN packaging signal at the end of nsP4 while
maintaining a functional subgenomic promoter in the replicon vector
for driving expression of the heterologous gene, it was necessary
to alter the codon usage of the last 80 nt. of nsP4 (upstream of
the inserted SIN sequence) to eliminate their ability to bind the
replicase complex. Simultaneously, the VEE subgenomic promoter
region was reconstituted downstream of the nsP4 stop codon by
duplicating the native sequence of a portion of the 3' end of nsP4
thought to be part of the subgenomic promoter recognition sequence.
Chimera 1 A and 1B differ by the length of reconstituted nsP4
sequence that was added back to regenerate a functional subgenomic
promoter: to -80 for CHIMERA-1A (FIG. 7), to -98 for CHIMERA-1B
(FIG. 8).
[0264] Chimera 1A and 1B were prepared by cleaving pVCR-DH, an
intermediate construct from the re-assembly phase of the pVCR
construction described (above), with MscI and AscI. Into this
vector was inserted either of two tripartite synthetic
oligonucleotides coding, as described above, the last 80 bp or so
of nsP4 with non-native codon usage, followed by the SIN packaging
signal (in frame) and nsP4 termination codon, followed by the
duplicated terminal 80 or 98 bp of native nsP4 sequence. The
oligonucleotides were designed to provide synthetic full duplex
strands that were treated in the same manner as was described
earlier for the replicon synthesis. Sequence verified clones from
this ligation were digested with MscI and AscI, and the oligo
fragment bearing the SIN packaging signal was substituted into the
vector fragment of pVCR, digested similarly. The resulting final
constructs for each was called pVCR/CHIMERA-1A and pVCR/CHIMERA-1B.
To evaluate the functionality of these constructs, the GFP gene was
cloned into each using the unique BbvCI and NotI sites downstream
of the subgenomic promoter and the constructs were designated
VCR-Chim1A-GFP and VCR-Chim1B-GFP respectively.
[0265] B) Chimera 2:
[0266] Chimera-2 was prepared by cleavage of the VEE-replicon
assembly intermediate, pCMVkm2-(del XhoI/CelII)-VEE 9/10, from
example 1, coding for a portion of VEE nsP3 and nsP4 bounded by the
MamI and BlnI sites of the replicon. XhoI cleavage of this vector
deletes a 102 bp segment of VEE nsP3. Into this cleaved vector was
inserted a PCR product consisting of the SIN packaging signal
flanked by terminal, in-frame, XhoI sites (FIG. 9). The template
for this amplification was pSINCP and Pfu DNA polymerase was used
with the following oligonucleotide primers.
26 (SEQ ID NO 49) 5'Pr: 5'-ATATCTCGAGAGGGATCACGGGAGAAAC-3- ' (SEQ
ID NO 50) 3'Pr: 5'-AGAGGAGCTCAAATACCACC- GGCCCTAC-3'
[0267] Resulting clones were validated for sequence and
orientation. One positive clone was digested MamI-BlnI to generate
a fragment used to substitute for the native MamI-BlnI segment of
pVCR. The resulting plasmid was called pVCR/CHIMERA-2. The GFP gene
was cloned into this vector as described above for
pVCR/CHIMERA-1A,-1B, generating VCR-Chim2-GFP. It should be
appreciated that the region of deletion in nsP3 was selected based
on convenient restriction endonuclease sites in the plasmid DNA
construct. Additional deletions that remove larger regions of nsP3
are also contemplated by the present invention and can be performed
readily by one of skill in the art.
[0268] C) Chimera-3:
[0269] Chimera-3 was prepared by modification of a replicon
fragment from example 1, pCR2-9057b, which contained a portion of
replicon fragments 9+10, encoding the region of the junction of VEE
nsP3 and nsP4. Insertion of the SIN packaging site was accomplished
by overlapping PCR using Pfu DNA polymerase and two sets of primers
which amplified two products across the junction in pCR2-9057b and
which appended SIN packaging signal sequence tails to the resulting
products. Similarly the SIN packaging signal was amplified from
pSINCP with primers that appended nsP3 and nsP4 sequence tails,
respectively, at the 5' and 3' ends of the product. See FIGS. 10
and 11 for detail of this strategy including primer sequences. The
three PCR products were diluted, mixed, denatured, re-annealed, and
extended with Pfu DNA polymerase to create a chimeric overlap
template for amplification utilizing the external nsP3 and nsP4, 5'
and 3' primers. This product was digested with XbaI and MluI and
cloned into a similarly digested intermediate cloning vector,
pCMVkm2 (zur Megede, J. Virol. 74:2628, 2000). To place the chimera
in the context of pVCR, the pCMVkm2/CHIMERA-3 intermediate was
digested with MamI (5') and SacI (3') and co-ligated with a
SacI-BlnI fragment from pVCR (nt. 5620-6016 of pVCR) into the
MamI/BlnI vector fragment of pVCR. The resulting construct was
called pVCR/CHIMERA-3. The GFP gene was cloned into this vector as
described above for pVCR/CHIMERA-1A,-1B, generating
VCR-Chim3-GFP.
[0270] To test the ability of these constructs to be packaged by
Sindbis structural proteins, the plasmids VCR-Chim1A-GFP,
VCR-Chim1b-GFP, VCR-Chim2-GFP, and VCR-Chim3-GFP were linearized
with the single restriction enzyme PmeI and RNA transcribed in
vitro. The RNA was co-transfected together with defective helper
RNAs encoding SIN capsid and glycoproteins from constructs
VCR-DH-Sglydl160 and VCR-DH-Scap also linearized with PmeI.
Transfected cells were incubated at 34.degree. C. for 24 hr, at
which time the culture supernatants were collected, clarified by
centrifugation, serially diluted, and used to infect nave BHK-21
cells for approximately 14 hr. Using flow cytometry analysis the
particle titers were determined. The results below showed that
three chimeras could be packaged efficiently by the SIN structural
proteins. Chimera 1 A was not expressing GFP and it was not
determined whether this was due to a defect in the subgenomic
transcription or in the RNA replication.
27 Replicon Structural proteins Titers VCR-Chimera1A SIN 0
VCR-Chimera1B SIN 3.8E.sup.7 Iu/ml VCR-Chimera2 SIN 9.6E.sup.7
Iu/ml VCR-Chimera1A SIN 3E.sup.7 Iu/ml
[0271] Construction of Chimera 2.1
[0272] To further reduce the amount of parental VEE virus sequence
present in the pVCR-Chimera2 replicon, the 3' NTR (also known as 3'
sequence required for nonstructural protein-mediated amplification,
or 3' UTR) sequence from VEE was removed in its entirety and
replaced by the 3' NTR from SIN. Plasmid SINCR-GFP (Garner et al.,
2000 ibid.) was digested with NotI and PmeI, the 466 bp fragment
was gel purified using QIAquick gel extraction kit and ligated to
both pVCR-Chimera2 and VCR-Chim2-GFP that had been previously
digested with NotI and PmeI, gel purified and treated with shrimp
alkaline phosphatase. Positive clones were verified and the
constructs designated VCR-Chim2.1 and VCR-Chim2.1-GFP. These
constructs now differ from the parental VEE virus genome by the
deletion of multiple VEE sequences (e.g., region of nsP3,
structural protein genes, 3' NTR).
[0273] To test the functionality of the new chimera replicon vector
configuration, plasmid VCR-Chim2.1-GFP was linearized with the
single restriction enzyme PmeI and RNA transcribed in vitro. The
RNA was co-transfected together with defective helper RNAs encoding
SIN capsid and glycoproteins from constructs VCR-DH-Sglydl160 and
VCR-DH-Scap also linearized with PmeI. Transfected cells were
incubated at 34.degree. C. for 24 hr, at which time the culture
supernatants were collected, clarified by centrifugation, serially
diluted, and used to infect nave BHK-21 cells for approximately 14
hr. Using flow cytometry analysis, the particle titers were
determined to be the same titers as VCR-Chim2-GFP, demonstrating
that deletion of the native 3' NTR and replacement with a
heterologous alphavirus 3' NTR (e.g., SIN 3' NTR) maintains
functionality in the VEE replicon.
[0274] Alternatively, as a means to reduce the overall VEE-derived
sequences in VCR-Chimera2, the 3'NTR was reduced to a minimal
sequence containing the 19 nt conserved CSE. Such a modified 3'NTR
was generated using overlapping oligonucleotides:
28 Vred2F 5'-ggccgcttttcttttccgaatcggattttgtttttaat-3' SEQ ID NO 77
Vred2R 5'-attaaaaacaaaatccgattcggaaaagaaaagc-3' SEQ ID NO 78 VEE3F
see VCR-DH construction for oligonucleotide sequences VEE3R VEE4F
VEE4R
[0275] Each pair of forward and reverse oligonucleotides (e.g.,
Vred2F with Vred2R, VEE2F with VEE2R, etc) were mixed,
phosphorylated, denatured, and slowly annealed. Then the 3 pairs of
annealed oligonucleotides were mixed together, ligated to each
other, digested with enzymes NotI and PmeI, gel purified using a
QIAquick gel extraction kit, and ligated to the VCR-Chim2-GFP that
had been previously digested with the same enzymes to delete the
full length 3'NTR, gel purified and treated with shrimp alkaline
phosphatase. Positive clones for the fragment were verified by
sequencing. This construct was called VCR-Chim2.2-GFP.
[0276] To confirm functionality of this chimera replicon vector
configuration, plasmid VCR-Chim2.2-GFP was linearized with the
single restriction enzyme PmeI and RNA transcribed in vitro. The
RNA was co-transfected together with defective helper RNAs encoding
SIN capsid and glycoproteins from constructs VCR-DH-Sglydl160 and
VCR-DH-Scap also linearized with PmeI. Transfected cells were
incubated at 34.degree. C. for 24 hr, at which time the culture
supernatants were collected, clarified by centrifugation, serially
diluted, and used to infect nave BHK-21 cells for approximately 14
hr. Using flow cytometry analysis, the particle titers were
determined to be the similar to VCR-Chim2-GFP, demonstrating that
reducing the size of the 3' NTR from 117 bp to 37 bp and
replacement maintains functionality of the replicon.
[0277] Similar to the above replicon vectors for use as RNA or
replicon particles, alphavirus DNA-based replicons that function
directly within a eukaryotic cell (e.g., Eukaryotic Layered Vector
Initiation Systems) may be derived by one of skill in the art,
using the teachings provided herein. Such DNA-based replicons may
be deleted of a variety of parental virus sequences for example,
including, but not limited to, sequences from the nsP3 carboxy
terminal region, structural protein gene region, 3' CSE region, and
the like.
Example 6
[0278] Use of Different Structural Proteins for Delivery of
Replicon RNA
[0279] An HIV antigen was expressed from SIN replicon RNA packaged
with either SIN or VEE structural proteins, and from VEE replicon
RNA packaged with either SIN or VEE structural proteins as follows.
Specifically, a fragment containing the heterologous gene sequence
encoding codon-optimized HIV p55gag (zur Megede, J. Virol. 74:2628,
2000) from plasmid pCMVKm2.GagMod.SF2 was inserted into the SINCR
replicon vector (Gardner et al., 2000, ibid) at the XhoI-NotI
sites, into the VCR replicon vector at the BbvCI-NotI sites and
into the VCR-Chim2.1 vector at the BbvCI-MfeI sites. The p55gag
encoding replicon constructs were designated SINCR-p55gag,
VCR-p55gag, and VCR-Chim2.1-p55gag, respectively. To produce SIN,
VEE and chimera replicon particles expressing p55gag, the above
plasmids were linearized with the single restriction enzyme PmeI
and RNA transcribed was in vitro. The RNA was co-transfected
together with defective helper RNA encoding for the appropriate
structural proteins which were transcribed from the PmeI linearized
plasmids as shown below:
29 Particles Replicon Caspid Glycoproteins SIN SINCR-p55gag
SINdl-cap tDH-VUTR-Sglydl160 (Polo et al., 1999, ibid) VEE
VCR-p55gag VCR-DH-Vcap VCR-DH-VE2-120 SINrep/ SINCR-p55gag
tDH-S113Vcap tDH-VUTR-Sglydl160 VEEenv VEErep/ VCR- VCR-DH-Scap
VCR-DH-Vglydl160 SINenv Chim2.1p55gag
[0280] Transfected cells were incubated at 34.degree. C.,
supernatants collected at 20 hr and 36 hr, followed by
clarification by centrifugation, and chromatographic purification
as described previously (PCT WO 01/92552).
[0281] Particle titers were determined by intracellular staining
for gag expression in BHK21 cells infected for 16 hrs with serial
dilution of purified particle preparations. The cells were first
permeabilized and fixed with Cytofix/Cytoperm Kit (Pharmingen),
then stained for intracellular p55gag with FITC conjugated
antibodies to HIV-1 core antigen (Coulter). Using flow cytometry
analysis, the percentage of gag positive cells were determined and
used to calculate the particle titers.
[0282] Immunogenicity in rodent models was determined after
immunization with the different alphavirus replicon particle
preparations expressing HIV p55gag, at doses of 10.sup.6 or
10.sup.7 IU replicon particle doses (FIG. 12). Each was found to be
immunogenic and one chimera, VEErep/SINenv, was found to be a
particularly potent immunogen.
[0283] Additionally, such replicon particles may be used in
combination with another vaccine modality (e.g., DNA,
non-alphavirus viral vector), such as in a prime-boost regime. For
example, mice were first immunized with a plasmid DNA vaccine
encoding HIV p55gag (pCMVKm2.GagMod.SF2), and then boosted with
each of the above alphavirus replicon particles expressing the
p55gag antigen (FIG. 13). Each of the alphavirus replicon particles
was found to be immunogenic, boosting the CD8+ T cell responses,
and one chimera, VEErep/SINenv, was found to be a particularly
potent immunogens.
[0284] Demonstration of sequential immunization of rodents or
primates with alphavirus replicon particles, such as the above
replicon particles, differing in their structural proteins, may be
performed using a variety of routes (e.g., intramuscular,
intradermal, subcutaneous, intranasal) and with dosages ranging
from 10.sup.3 IU up to 10.sup.8 IU, or greater. For example,
primates are immunized first with 10.sup.7 SINCR-p55gag particles
containing VEE structural proteins in 0.5 mL of PBS diluent, by a
subcutaneous route. The same materials are then administered a
second time 30 days later, by the same route of injection.
Approximately 6-12 months later, the animals are then immunized one
or more times with 10.sup.7 SINCR-p55gag particles containing SIN
structural proteins in 0.5 mL of PBS diluent, by an intramuscular
route. Demonstration of immunogenicity is performed using standard
assays and may be compared to parallel animals that received only a
single type of replicon particle at time of administration.
[0285] The preceding examples have described various techniques
suitable for preparing chimeric alphavirus particles using nucleic
acids, nonstructural proteins and structural proteins, as well as
portions thereof, derived from two different alphaviruses. However,
one of ordinary skill in the art, using the teaching provided
herein, could prepare chimeric alphavirus particles from three or
more viruses without undue experimentation. In would be logical to
combine the teachings found herein with the teachings of other
relevant technical disclosures generally available to those skilled
in the art including, but not limited to, patents, patent
applications, scientific journals, scientific treatise and standard
references and textbooks.
[0286] For example, alphavirus chimeric particles are made using
SIN replicon vectors and at least two defective helper RNA
molecules. The replicon RNA encodes for SIN non-structural
proteins, a VEE packaging signal and a heterologous gene of
interest. The first defective helper RNA encodes for a hybrid
capsid protein having a VEE RNA binding domain and a WEE
glycoprotein interaction domain. The second defective helper RNA
encodes for WEE glycoprotein. The resulting chimeric alphavirus
particles have nucleic acid derived from SIN with a VEE/WEE hybrid
capsid and a WEE envelope glycoprotein.
[0287] In another example, a chimeric alphavirus particle is made
in accordance with the teachings of the present invention where a
SIN replicon having SIN non-structural proteins and a heterologous
gene of interest is combined with two defective helper RNA
molecules. The first defective helper RNA encodes for a hybrid
capsid having a SIN RNA binding domain and a SFV glycoprotein
interaction domain. The second defective helper RNA encodes for a
hybrid glycoprotein having a SFV cytoplasmic tail with the
remainder of the glycoprotein envelope provided by VEE. The
resulting chimeric alphavirus particle has SIN nucleic acids with a
heterologous gene of interest encapsidated in a SIN/SFV hybrid
capsid with a SFV/VEE hybrid envelope glycoprotein, the outer
ectodomain portion of the glycoprotein being derived from VEE.
[0288] In yet another example four different alphaviruses are used
to prepare the chimeric alphavirus particle. In this example a SIN
replicon RNA encoding for SIN non-structural proteins, a VEE
packaging signal and a heterologous gene of interest is provided. A
first defective helper RNA encodes for a hybrid capsid having a VEE
RNA binding domain and a WEE glycoprotein interaction domain. The
second defective helper RNA encodes for a hybrid glycoprotein
having a WEE cytoplasmic tail with the remainder of the
glycoprotein being provided by SFV. The resulting chimeric
alphavirus particle has SIN RNA and a heterologous gene of
interest, a VEE/WEE hybrid capsid and a WEE/SFV hybrid
glycoprotein, the outer ectodomain portion of the glycoprotein
being derived from SFV.
[0289] Many other combinations are possible and the preceding
examples serve to illustrate the present invention's tremendous
versatility. Therefore, these non-limiting examples represent only
a few of the numerous chimeric alphavirus particles that can be
made in accordance with the teachings of the present invention.
Example 7
[0290] Use of Alphavirus Replicon Vectors and Defective Helpers
with Different Control Elements
[0291] To produce alphavirus replicon particles using vector (e.g.,
replicon RNA, eukaryotic layered vector initiation system) and
packaging (e.g., defective helper, structural protein expression
cassette) components with different control elements, a wide
variety of combinations may be utilized according to the present
invention. For example, a SIN plasmid DNA-based replicon
(eukaryotic layered vector initiation system) can be constructed to
contain a different 3' sequence required for nonstructural
protein-mediated amplification (3'CSE) than contained in the
structural protein expression cassettes of a SIN packaging cell
line. More specifically, modification of the SIN 3' end to
incorporate a polyadenylation signal derived from the bovine growth
hormone gene is performed as described below. The resulting
sequence:
30 (SEQ ID NO 56) GCGGCCGCCGCTACGCCCCAATGATCCGACCAGCAAAACTC-
GATGTACTT CCGAGGAACTGATGTGCATAATGCATCAGGCTGGTACATTAGATCCCC- GC
TTACCGCGGGCAATATAGCAACACTAAAAACTCGATGTACTTCCGAGGAA
GCGCAGCGCGGGCAATATAGCAACACTAAAAACTCGATGTACTTCCGAGG
AAGCGCAGTGCATAATGCTGCGCAGTGTTGCCACATAACCACTATATTAA
CCATTTATCTAGCGGACGCCAAAAACTCAATGTATTTCTGAGGAAGCGTG
GTGCATAATGCCACGCAGCGTCTGCATAACTTTTATTATTTCTTTTATTA
ATCAAATAAATTTTGTTTTTAACATTTCAAAAAAAAAGTAGGTGTCATTC
TATTCTGGGGGGTGGGGTGGGGGTTTAAAC
[0292] thus is engineered into the SIN plasmid construct. This new
sequence is substituted for the existing 3'-end, synthetic
polyA-tract, ribozyme, and BHGpolyA site of plasmid pSINCP (See, WO
01/81690) as follows. Plasmid pSINCP-bgal (pSINCP expressing bgal)
is deleted of the aforementioned elements by PCR with the following
primers:
[0293] NPSfwd:
[0294] 5'ACAGACAGACCGCGGCCGCACAGACAGACGTTTAAACGTGGGCGAAGAAC
TCCAGCATGAGATCC (SEQ ID NO 57)
[0295] which contains a NotI site (12-19 nts.), a PmeI site (30-37
nt), and 38-65 nts that are complementary to SINCP-bgal sequences
downstream of the aforementioned elements, a NotI site precedes
them.
[0296] NPSrev:
[0297] 5'-TTCGCCAGGCTCAAGGCGCGCATGCCCGAC (SEQ ID NO 58)
[0298] which is complementary to the plasmid backbone region
containing the SphI site. The amplified 492 bp fragment is purified
from agarose gel using QIAquick gel extraction kit, digested with
NotI and SphI and ligated to SINCP-bgal that has also been digested
with NotI and SphI to remove the existing sequence (1106 bp).
Clones containing the newly generated fragment are verified by
sequencing and the intermediate construct is called SINCPt-bgal.
The new 3' end is then generated using overlapping
oligonucleotides:
31 SINpA1F
5'-tcgacccgggcggccgccgctacgccccaatgatccgaccagcaaaactcgat-
gtacttccgaggaactg-3' (SEQ ID NO 59) SINpA1R
5'-ggtcggatcattggggcgtagcggcggccgcccgggtcga-3' (SEQ ID NO 60)
SINpA2F
5'-atgtgcataatgcatcaggctggtacattagatccccgcttaccgcgggcaatatagc-
aacactaaaaac-3' (SEQ ID NO 61) SINpA2R
5'-agcggggatctaatgtaccagcctgatgcattatgcacatcagttcctcggaagtacatcgagttttgct-
-3' (SEQ ID NO 62) SINpA3F 5'-tcgatgtacttccgaggaagcgcagtgc-
ataatgctgcgcagtgttgccacataaccactatattaacca-3' (SEQ ID NO 63)
SINpA3R
5'-gcgcagcattatgcactgcgcttcctcggaagtacatcgagtttttagtgttgctatatt-
gcccgcggta-3' (SEQ ID NO 64) SINpA4F
5'-tttatctagcggacgccaaaaactcaatgtatttctgaggaagcgtggtgcataatgccacgcagcgtct-
-3' (SEQ ID NO 65) SINpA4R 5'-cctcagaaatacattgagtttttggcgt-
ccgctagataaatggttaatatagtggttatgtggcaacact-3' (SEQ ID NO 66)
SINpA5F
5'-gcataacttttattatttcttttattaatcaaataaattttgtttttaacatttcaaaaa-
aaaagtaggtg-3' (SEQ ID NO 67) SINpA5R
5'-aacaaaatttatttgattaataaaagaaataataaaagttatgcagacgctgcgtggcattatgcaccac-
gctt-3' (SEQ ID NO 68) SINpA6F 5'-tcattctattctggggggtggggt-
gggggtttaaacatcatgatcg-3' (SEQ ID NO 69) SINpA6R
5'-cgatcatgatgtttaaacccccaccccacccccagaatagaatgacacctactttttttttgaaatgtta-
aa-3' (SEQ ID NO 70)
[0299] The oligonucleotides are mixed, phosphorylated, denatured,
slowly annealed, and ligated. After inactivating the ligase, the
DNA is digested with the enzymes NotI and PmeI, gel purified using
the QIAquick gel extraction kit and ligated to SINCPt-bgal digested
with the same enzymes and treated with alkaline phosphatase. Clones
containing the newly generated fragment are verified by sequencing
and the final construct is called SINCP-pA-bgal.
[0300] To produce replicon particles this plasmid is transfected
into a SIN packaging cell line that contains structural protein
expression cassettes, which do not have similarly modified 3'-end
sequences (Polo et al., 1999. Proc. Natl. Acad. Sci. USA,
96:4598-603). After appropriate incubation, the replicon particles
are harvested and purified as describe above.
[0301] Alphavirus particles are also produced in which the 3'-ends
(e.g., 3' sequence required for nonstructural protein-mediated
amplification, 3'CSE) of structural protein expression cassettes
(e.g., defective helpers) and reporter gene cassettes (Olivo et
al., 1994, Virology 198:381-384) are modified to incorporate a
polyadenylation signal. The efficiency of RNA transport from the
nucleus for alphavirus DNA molecules modified in this way is
typically increased.
Example 8
Alphavirus Replicons with Modified Nonstructural Protein Genes
[0302] A Sindbis virus-based replicon (SINCR, Gardner et al., ibid)
was modified within a conserved region of nsP4, encompassing SIN
amino acids 363 to 404. For instance, amino acid 390 was modified
by substituting (replacing) the wild-type leucine residue. The
wild-type leucine residue was substituted with a basic amino acid
(e.g., lysine); an acidic amino acid (e.g., glutamic acid); or an
aromatic amino acid (e.g., phenylalanine).
[0303] To make these substitutions, a fragment of the replicon from
plasmid pSINCR-GFP was subcloned into plasmid pCMVKm2 (zur Megede
(2000) J. Virol. 74:2628-2635) for in vitro mutagenesis, by
digestion of pSINCR-GFP with XhoI and HpaI, gel purification of the
small 725 by fragment, and ligation into pCMVKm2 that had also been
digested with XhoI and HpaI, resulting in the construct
pCMVKm2XhoI/HpaI. Mutagenesis was performed using the Stratagene
(La Jolla, Calif.) QuikChange XL site directed mutagenesis kit,
according to the manufacturer's instructions, and the following
pairs of oligonucleotide primers (mutation site indicated with
parenthesis).
32 For Leu => Phe substitution: Oligo A1:
CCGGTCTGATGATC(TTC)GAGGACCTGGGTG (SEQ ID NO 71) Oligo A2:
CACCCAGGTCCTC(GAA)GATCATCAGACCGG (SEQ ID NO 72) For Leu => Lys
substitution: Oligo B1: CCGGTCTGATGATC(AAG)GAGGACCTGGGTG (SEQ ID NO
73) Oligo B2: CACCCAGGTCCTC(CTT)GATCATCAGACCGG (SEQ ID NO 74) For
Leu => Glu substitution: Oligo C1:
CCGGTCTGATGATC(GAG)GAGGACCTGGGTG (SEQ ID NO 75) Oligo C2:
CACCCAGGTCCTC(CTC)GATCATCAGACCGG (SEQ ID NO 76)
[0304] Following PCR amplification, the PCR reaction mixture was
digested with DpnI and transformed into DH5.alpha. cells, according
to the manufacturer's instructions. A positive clone for each of
the three mutations was then used to subclone the modified nsP4
sequence back into the pSINCR-GFP replicon, again using the XhoI
and HpaI sites, to generate the following alphavirus replicons with
modified nsP4 genes: pSINCR390F-GFP, pSINCR390K-GFP, and
pSINCR390E-GFP.
[0305] RNA replicons transcribed in vitro from these plasmids are
introduced into cells containing one or more structural
protein-encoding defective RNA helper cells and the frequency of
recombination with the non-modified parental SINCR-GFP replicon is
measured by enumeration of PFU in the culture supernatant by plaque
assay (either directly or after one or more serial passages in
cells). The modified sequences reduce or eliminate recombination
(inter-strand transfer).
[0306] Additional sequence modifications that result in the same
intended phenotype may be readily obtained by one of skill in the
art using random or site-directed mutagenesis in this or other
(e.g., conserved) regions of nsP4 and analysis based on the
teachings provided herein. For example, any of the alphavirus nsP4
amino acids corresponding to SIN nsP4 amino acids 363 to 404 may be
modified singly or in combination (e.g., nsP4 391/392 E/D changed
to nsP4 391/392 F/A), by using the above detailed protocol with
substitution of any desired oligonucleotides for mutagenesis.
[0307] Recitation of ranges of values herein are merely intended to
serve as a shorthand method of referring individually to each
separate value falling within the range, unless otherwise indicated
herein, each individual value is incorporated into the
specification as if it were individually recited herein. All
methods described herein can be performed in any suitable order
unless otherwise indicated herein or otherwise clearly contradicted
by context. The use of any and all examples, or exemplary language
(e.g. "such as") provided herein is intended merely to better
illuminate the invention and does not pose a limitation on the
scope of the invention otherwise claimed. No language in the
specification should be construed as indicating any non-claimed
element essential to the practice of the invention.
[0308] Groupings of alternative elements or embodiments of the
invention disclosed herein are not to be construed as limitations.
Each group member may be referred to and claimed individually or in
any combination with other members of the group or other elements
found herein. It is anticipated that one or more members of a group
may be included in, or deleted from, a group for reasons of
convenience and/or patentability. When any such inclusion or
deletion occurs, the specification is herein deemed to contain the
group as modified thus fulfilling the written description of all
Markush groups used in the appended claims.
[0309] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Of course, variations on those preferred
embodiments will become apparent to those of ordinary skill in the
art upon reading the foregoing description. The inventors expect
skilled artisans to employ such variations as appropriate, and the
inventors intend for the invention to be practiced otherwise than
specifically described herein. Accordingly, this invention includes
all modifications and equivalents of the subject matter recited in
the claims appended hereto as permitted by applicable law.
Moreover, any combination of the above-described elements in all
possible variations thereof is encompassed by the invention unless
otherwise indicated herein or otherwise clearly contradicted by
context.
* * * * *
References