U.S. patent application number 10/379614 was filed with the patent office on 2003-12-11 for gene silencing materials and methods.
Invention is credited to Baulcombe, David Charles, Lederer, Carsten Werner, Voinnet, Olivier.
Application Number | 20030229920 10/379614 |
Document ID | / |
Family ID | 10819470 |
Filed Date | 2003-12-11 |
United States Patent
Application |
20030229920 |
Kind Code |
A1 |
Baulcombe, David Charles ;
et al. |
December 11, 2003 |
Gene silencing materials and methods
Abstract
Disclosed are methods for silencing a target nucleotide sequence
(preferably representing one or more endogenous genes, preferably
in a systemic fashion) which is present in a first part of the
plant, which method comprises transiently introducing into the
cytoplasm of a cell in a second part of the plant, which cell
comprises a nucleic acid encoding the target sequence and which is
remote from said first part of the plant, a nucleic acid
construct.
Inventors: |
Baulcombe, David Charles;
(Norwich, GB) ; Voinnet, Olivier; (Stras Bourg,
FR) ; Lederer, Carsten Werner; (Nicosia, CY) |
Correspondence
Address: |
DANN, DORFMAN, HERRELL & SKILLMAN
1601 MARKET STREET
SUITE 2400
PHILADELPHIA
PA
19103-2307
US
|
Family ID: |
10819470 |
Appl. No.: |
10/379614 |
Filed: |
March 5, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10379614 |
Mar 5, 2003 |
|
|
|
09509138 |
Mar 22, 2000 |
|
|
|
6531647 |
|
|
|
|
09509138 |
Mar 22, 2000 |
|
|
|
PCT/GB98/02862 |
Sep 22, 1998 |
|
|
|
Current U.S.
Class: |
800/280 |
Current CPC
Class: |
C12N 15/8216 20130101;
C12N 15/8203 20130101; C12N 15/8218 20130101; C12N 15/63
20130101 |
Class at
Publication: |
800/280 |
International
Class: |
A01H 001/00; C12N
015/82 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 22, 1997 |
GB |
9720148.7 |
Claims
1. A method for silencing a target nucleotide sequence present in a
first part of a plant, which method comprises transiently
introducing into the cytoplasm of a cell in a second part of the
plant, which cell comprises a nucleic acid encoding the target
sequence and which is remote from said first part of the plant, a
nucleic acid construct, wherein said construct: (i) encodes a
sequence which shares sequence identity with the target nucleotide
sequence or the complement thereof, and (ii) does not encode
proteins which are capable of blocking systemic movement of a gene
silencing signal, such that a silencing signal not comprising the
construct is initiated in the first part of the plant and
propagated to the second part of the plant such as to cause the
silencing of said target nucleotide sequence.
2. A method as claimed in claim 1 wherein the proteins which are
capable of blocking systemic movement of a gene silencing signal
are those which are capable of mediating intercellular viral
movement.
3. A method as claimed in claim 1 or claim 2 wherein the part of
the plant into which the nucleic acid is introduced corresponds to
a region in which photosynthetic products are concentrated and the
target nucleotide sequence is present in a remote region in which
such products are used.
4. A method as claimed in any one of the preceding claims wherein
the target nucleotide sequence, or a nucleotide sequence sharing
homology with the target nucleotide sequence, is transcribed in the
cells of the tissues connecting the first and second parts of the
plant through which the gene silencing signal is propagated.
5. A method as claimed in any one of the preceding claims wherein
the target nucleotide sequence is silenced systemically in the
plant.
6. A method as claimed in any one of the preceding claims wherein
the construct is not capable of autonomous replication.
7. A method as claimed in any one of the preceding claims wherein
the construct introduced into the plant cell does not encode a
viral coat protein
8. A method as claimed in any one of the preceding claims wherein
the sequence sharing sequence identity with the target gene does
not include translation-recognition signals such that said sequence
is not translated to a protein product.
9. A method as claimed in any one of the preceding claims wherein
the nucleic acid construct is DNA.
10. A method as claimed in any one of the preceding claims wherein
the construct comprises a promoter operably linked to a nucleotide
sequence, wherein said nucleotide sequence: (i) encodes a viral
replicase, (ii) encodes a replicable sequence which shares sequence
identity with the target nucleotide sequence or its complement, and
which is operably linked to one or more cis acting elements
recognised by said replicase, such that the replicable sequence is
replicated in the cytoplasm of the cell into which it is
introduced, (iii) does not encode proteins which are capable of
mediating intercellular viral movement.
11. A method as claimed in claim 11 wherein the viral replicase is
a PVX replicase.
12. A method as claimed in claim 10 or 11 wherein the promoter is
an inducible promoter.
13. A method as claimed in any one of claims 10 to 12 wherein the
construct comprises Ti-derived sequences which permit integration
of the construct into the plant genome.
14. A method as claimed in any one of claims 1 to 9 wherein the
construct does not comprise any of the following: (i) promoter or
terminator sequences, (ii) Ti-derived sequences which permit
integration of the construct into the plant genome.
15. A method as claimed in claim 13 wherein the construct is
introduced into the plant using Agrobacteriun tumafaciens.
16. A method as claimed in any one of claims 1 to 14 wherein the
construct is introduced into the plant cell by microprojectile
bombardment.
17. A method as claimed in any one of the preceding claims wherein
the target nucleotide sequence encodes a heterologous gene.
18. A method as claimed in any one of claims 1 to 16 wherein the
target nucleotide sequence encodes a gene which is endogenous to
the plant.
19. A method as claimed in claim 18 wherein the plant is not a
transgenic plant.
20. A method as claimed in any one of the preceding claims wherein
the target nucleotide sequence encodes all or part of a viral
genome of a virus in the plant.
21. A method as claimed in any one of the preceding claims wherein
two or more target genes which share sequence identity are
silenced.
22. A method of assessing a phenotypic characteristic associated
with a target nucleotide sequence in a plant, the method
comprising: (a) silencing the nucleotide sequence in a plant in
accordance with a method as claimed in any one of the preceding
claims, (b) observing the phenotype of the plant, and optionally
(c) comparing the result of the observation with the phenotype of a
control plant.
23. A method for regulating the expression of a target nucleotide
sequence in a plant comprising use of a method as claimed in any
one of claims 1 to 21.
24. A method of systemically altering the phenotype of a plant
comprising use of a method as claimed in any one of claims 1 to
21.
25. A nucleic acid construct comprising a promoter operably linked
to a nucleotide sequence, wherein said nucleotide sequence: (i)
encodes a viral replicase, (ii) encodes a replicable sequence which
shares sequence identity with the target nucleotide sequence or its
complement, and which is operably linked to one or more cis acting
elements recognised by said replicase, such that the replicable
sequence is replicated in the cytoplasm of the cell into which it
is introduced, (iii) does not encode proteins which are capable of
mediating intercellular viral movement.
26. A construct as claimed in claim 25 which is a DNA plasmid.
27. A construct as claimed in claim 26 which is a Ti plasmid
vector.
28. A method for producing a systemic gene silencing signal in a
plant, said method comprising the steps of introducing a construct
as claimed in any one of claims 25 to 27 into a cell of that
plant.
29. A method as claimed in claim 28 wherein the signal produced by
the construct is subsequently stably maintained in the absence of
the construct.
30. A plant cell comprising a construct as claimed in any one of
claims 25 to 27.
31. A plant comprising a plant cell as claimed in claim 30.
32. A plant comprising a target nucleotide sequence which has been
silenced in accordance with the method of any one of claims 1 to
21.
Description
TECHNICAL FIELD
[0001] The present invention relates to methods and materials for
controlling gene silencing in plants, and various processes and
products employing these methods and materials.
PRIOR ART
[0002] Co-Suppression and Anti-Sense Suppression of Endogenous
Genes
[0003] It is known that stably-integrated transgenes (referred to
as `STgenes` or `intGENES` below) which may be constitutively
expressed may be used to suppress homologous endogenous (`HEgenes`)
plant genes. This was discovered originally when chalcone synthase
transgenes in petunia caused suppression of the endogenous chalcone
synthase genes. Subsequently it has been described how many, if not
all plant genes can be "silenced" by transgenes. Gene silencing
requires sequence homology between the transgene and the gene that
becomes silenced (Matzke, M. A. and Matzke, A. J. M. (1995), Trends
in Genetics, 11: 1-3). This sequence homology may involve promoter
regions or coding regions of the silenced gene (Matzke, M. A. and
Matzke, A. J. M. (1993) Annu. Rev. Plant Physiol. Plant Mol. Biol.,
44: 53-76, Vaucheret, H. (1993) C. R. Acad. Sci. Paris, 316:
1471-1483, Vaucheret, H. (1994), C. R. Acad. Sci. Paris, 317:
310-323, Baulcombe, D. C. and English, J. J. (1996), Current
Opinion In Biotechnology, 7: 173-180, Park, Y-D., et al (1996),
Plant J., 9: 183-194).
[0004] When coding regions are involved, the transgene able to
cause gene silencing may have been constructed with a promoter that
would transcribe either the sense or the antisense orientation of
the coding sequence RNA. In at least one example the coding
sequence transgene was constructed without a promoter (Van
Blokland, R., et al (1994), Plant J., 6: 861-877).
[0005] Co-Suppression of Transgenes
[0006] It has also become clear that gs can account for some
characteristics of transgenic plants that are not easily reconciled
with conventional understanding of genetics. For example the wide
variation in STgene expression between sibling lines with a STgene
construct is due in part to gene silencing: low expressers are
those with a high level of gene silencing whereas high expressers
are those in which gene silencing is absent or induced late in
plant development. In this case there is no requirement for there
to be an HEgene corresponding to the STgene (see e.g. Elmayan &
Vaucheret (1996) Plant J., 9: 787-797.
[0007] Viral Resistance
[0008] In addition to observations of STgenes, gs has also been
implicated in virus resistance. In these cases various factors
including ectopic DNA interactions.sup.6, DNA methylation.sup.7,
transgene expression level.sup.8 and double stranded RNA.sup.9 have
been proposed as initiators of gene silencing.
[0009] Additionally in non-transgenic plants, it has been
demonstrated that leaves which develop subsequently to systematic
spread of a virus in a plant contain lower levels of virus than do
symptomatic leaves. This resistance may be similar in nature to
transgene-induced gene silencing (see e.g. Ratcliff et al (1997)
Science, 276: 1558-1560).
[0010] Cytoplasmically Replicating Viral Constructs
[0011] Biosource Technologies, in WO 95/34668, have suggested the
use of genetic constructions based on RNA viruses which replicate
in the cytoplasm of cells to provide inhibitory RNA, either
anti-sense or sense ("co-suppressor") RNA. The constructs were used
to inhibit a particular HEgene (phytoene desaturase). Cells were
transfected with the cytoplasmically-replicating genetic
constructions in which the RNA encoding region is specific for the
gene of interest. The hybrid viruses spread throughout the plant,
including the non-inoculated upper leaves (as verified by
transmission electron microscopy). System-wide gene silencing was
reported following transfection.
[0012] GB patent application 9703146.2, and PCT/GB98/00442, both
filed in the name of John Innes Centre Innovations Limited, are
hereby incorporated by reference. These applications, which were
not published prior to the claimed priority date of the present
application, discuss various constructs (`amplicons`) which are
intended to be stably integrated into the plant genome, and to
generate cytoplasmically replicating constructs which are capable
of eliciting gene silencing.
[0013] Silencing in Animals
[0014] Fire et al (1998) Nature 391: 806-811 (not published prior
to the claimed priority date of the present application) discusses
the use of RNA, particularly double-stranded RNA, to achieve
silencing of endogenous genes and GFP-transgenes in nematodes. The
demonstrated interference effect was apparently able to cross
cell-boundaries.
[0015] Applications for Gene-Silencing
[0016] In principle there is an enormous practical potential of gs
for crop improvement. It is possible to silence genes conferring
unwanted traits in the plant by transformation with transgene
constructs containing elements of these genes. Examples of this
type of application include gs of ripening specific genes in tomato
to improve processing and handling characteristics of the harvested
fruit; gs of genes involved in pollen formation so that breeders
can reproducibly generate male sterile plants for the production of
F1 hybrids; gs of genes involved in lignin biosynthesis to improve
the quality of paper pulp made from vegetative tissue of the plant;
gene silencing of genes involved in flower pigment production to
produce novel flower colours; gene silencing of genes involved in
regulatory pathways controlling development or environmental
responses to produce plants with novel growth habit or (for
example) disease resistance; elimination of toxic secondary
metabolites by gene silencing of genes required for toxin
production.
[0017] Gene silencing is also useful for investigating gene
function in that it can be used to impose an intermediate or a null
phenotype for a particular gene, which can provide information
about the function of that gene in vivo.
[0018] A major complication in the practical exploitation of this
phenomenon to date is the unpredictable and low occurrence of gene
silencing. Therefore, it has not been realistic to attempt gene
silencing in plants that are difficult to transform and for which
it is difficult to produce many transformants. Similarly, it would
be difficult to activate (and deactivate) gene silencing against
several different traits or against several viruses in the same
plant. Even with plants that are easy to transform the need to
generate multiple lines limits the ease of exploitation of gene
silencing.
INVENTION
[0019] The present inventors have now demonstrated a novel means of
providing consistent, controlled, systemic gene silencing within a
system, particularly a mature plant, which may (but is preferably
not) a transgenic plant. This novel approach is clearly distinct
from previously described approaches to gene silencing, for
example, transwitch and antisense technologies, in that it
describes a multicomponent system in which there is the potential
to regulate the gene silencing spatially and optionally
temporally.
[0020] The current invention is also distinct from the
virus-induced gene silencing described previously by Biosource
Technologies. In the current invention there is no absolute
requirement that the transgenes conferring the gene silencing or
their transcripts are able to replicate using viral components or
through mechanisms that resemble virus replication, although in
certain advantageous embodiments they may do so. Importantly, the
systemic silencing of the invention does not require that the
transgenes or their transcripts use virus-derived mechanisms to
move between cells (e.g. `movement proteins` as they are termed in
the art).
[0021] These movement proteins are encoded by most (probably nearly
all) plant viruses. Movement proteins are normally recognised by
mutation analysis of a viral genome. Mutation of a movement protein
gene affects the ability of a virus to spread in the infected plant
but does not affect the ability of the virus to replicate. Examples
of viral movement proteins identified in this way include the 30
kDa protein of tobacco mosaic virus (Deom et al., 1987), the 25
kDa, 12 kDa and 8 kDa triple gene block proteins of potato virus X
(FIG. 1C) (Angell and Baulcombe, 1995; Angell et al., 1996; Verchot
et al., 1998) and the tubule-forming protein of cowpea mosaic virus
(van Lent et al., 1991). Some viruses also encode movement proteins
specifically for translocation of the virus through the phloem of
the plant. Examples of these long distance movement proteins
include the 2b protein encoded in cucumber mosaic virus (Ding et
al., 1995) and the 19 kDa protein of tomato bushy stunt virus
(Scholthof et al., 1995).
[0022] Until recently it has been considered that movement proteins
open channels between plant cells and thereby mediate virus
movement (Wolf et al., 1989). However it is now apparent that at
least some of these proteins may also promote movement by
suppression of a defence mechanism in the plant that blocks virus
movement, which may itself be related to the gene silencing
referred to hereinbefore. From these new findings, which are
consistent with observations by Anandalakshmi et al. (1998) and
Brigneti et al. (1998) [both in press] it is clear that movement
proteins may be suppressors of gene silencing. Similarly the work
of the present inventors suggests that certain proteins previously
described only as pathogenicity proteins may also have a role in
suppressing a gene silencing signal.
[0023] Thus it can be appreciated that stronger, systemic, gene
silencing is obtained if transgene constructs for gene silencing do
not also lead to expression of gene silencing by viral movement
proteins or pathogenicity proteins, which are a fundamental part of
the prior art systems which rely on the activity of vectors based
on RNA-viruses. Such systems may be incapable of mediating a TIGS
effect (see e.g. Dougherty, W. G, et al Molecular Plant-Microbe
Interactions, 1994: 7, 544-552).
[0024] The novel gene silencing system of this invention was first
demonstrated using transgenic N. benthamiana stably transformed
with stably transformed with the gene for green fluorescent protein
(designated stGFP).
[0025] The workers demonstrated that the expression of stGFP could
be silenced by the transient presence of a GFP reporter gene (which
was designated trGFP to distinguish it from the stGFP) using
strains of Agrobacterium tumefaciens carrying binary Ti plasmid
vectors or using direct infiltration. The silencing was systemic in
nature, occurring remotely from the sites of infection or
infiltration.
[0026] This approach has suggested the existence of a previously
unknown signalling mechanism in plants that mediates systemic gene
silencing. The signal of silencing is gene-specific and likely to
be a nucleic acid that moves between cells.
[0027] A systemic, sequence-specific signal of gene silencing which
is initiated by the transient presence (not stable integration) in
part of a plant of foreign initiator nucleic acid or nucleic acid
complex (termed hereinafter `fiNA`) which need not be capable of
autonomous replication in the cytoplasm of a plant cell or movement
from cell to cell, but which generates a signal which may be
propagated systemically is an entirely novel and unexpected concept
in plant biology. The observation has a number of important
(industrially applicable) properties. These properties, and the
characteristics of the fiNA required achieve them, will be
discussed in more detail hereinafter.
[0028] The work of the present inventors, with hindsight, is
consistent with data from other published experimental systems and
could be a general feature of gene silencing in plants.
[0029] Thus transgenic petunia exhibiting transgene-induced
silencing of the genes required for flower pigment biosynthesis
were shown to exhibit unusual and irregular patterns of
pigmentation. These can perhaps be explained by an extracellular
signal rather than by cell lineage-dependent cues of gene silencing
(see Jorgensen (1995) Science 268, 686-691). It should be stressed
that in that work the gene silencing of an HEgene (CHS) was induced
in the test plants using a chimeric STgene. Although the paper
speculates about a 2 state system of gene silencing, no information
is given about how to switch gene silencing on.
[0030] Work by a different group demonstrated chitinase gene
silencing in non-clonal sectors of transgenic tobacco (see Kunz et
al (1996) Plant J. 10, 4337-450.). This work demonstrated both the
`self` inactivation of the expression of STgenes alone, plus
inactivation of HEgenes by STgenes. The work also suggested that
gene silencing was a post-transcriptional event. It was
demonstrated that gene silencing occurred stochastically in progeny
of transgenic plants but that `resetting` to the non-silenced state
occurred non-stochastically in developing seeds. These
observations, plus the variegated pattern of silencing shown by
some plants, demonstrated that the gene silencing phenotype was not
merely a lineage event, but also highlighted the unpredictability
of gene silencing. There is no suggestion in the paper of the use
of fiNA to control gene silencing in non-silenced or `reset`
genes.
[0031] Palaqui et al, in The EMBO Journal (1997) V 16 No 15: pg
4738, demonstrated that grafting non-silenced scions onto gs-stock
(co-suppressed ST and HE nitrate reductase genes,) imposes
silencing on the scion. The scion had to contain the STgene, and
the silencing was unidirectional and could occur through a
wild-type stem `barrier` in which HE nitrate reductase genes are
present and function as signal transducing resident genes. Although
a diffusible messenger is postulated, there is no mention of
generating or employing this messenger other than by the use of
grafts of already-silenced homozygous plant stock.
[0032] The systemic signal demonstrated by the present inventors is
also consistent with recent findings that gene silencing is
associated with induced natural defence against viruses. The signal
could move in the plant ahead of the inducing virus so that
anti-viral gene silencing could delay spread of the infection front
(Ratcliff et al (1997) Science, 276: 1558-1560). The data below
also suggests that in certain situations, viral proteins may act to
inhibit this signal propagation.
[0033] The provision of the signalling mechanism and the novel
means by which it can be activated (transient presence of fiNA)
opens up a number of possibilities which will be discussed in more
detail hereinafter; essentially the ability to conveniently control
gene silencing systemically will be useful both in the
investigation of gene function, and the production of gene
silencing plants, as well as in the investigation of the mechanisms
of gene silencing.
[0034] Particularly useful is the ability to rapidly and
consistently impose, at will, gene silencing on HE or STgenes of
known or unknown function in order to investigate their
phenotype.
[0035] Although the systemic signal is not yet structurally
characterised, a number of points about it can be made in the light
of the present work. It is produced when fiNA is introduced in to a
plant cell, particularly directly or indirectly into the cytoplasm,
where the target gene or possibly a resident gene (as defined
below) which is to be silenced is being transcribed, in the same
plant cell, and there is sequence similarity between the coding
regions of fiNA and target gene.
[0036] These findings suggest that a protein product, or the
corresponding DNA or RNA, is a component of the signal. of these,
the protein product is the least plausible candidate because there
is no mechanism known that explains how it could move systemically
and specifically target the RNAs of the target. However, a nucleic
acid-based signal could mediate sequence-specific gene silencing
via a base-paired or triple helical structure with the target gene
RNA (or the transcription product of homologous resident gene) as
it moved between cells and tissues expressing that gene. Moreover,
a nucleic acid could move in the plant, perhaps using the channels
involved in virus or viroid movement. The demonstrated systemic
spread of ST-GFP silencing (FIG. 2c) is consistent with this
suggestion because it follows a course (FIGS. 2c, 2g) that is
similar to the pattern of virus spread in an infected plant.
[0037] Thus in a first aspect of the invention there is disclosed a
method for silencing a target nucleotide sequence (e.g. a gene) in
a plant comprising transiently introducing (i.e. not via a stably
integrated transgene) into the cytoplasm of cells of that plant in
which the target sequence is present (and preferably being
transcribed) a foreign initiator nucleic acid (fiNA) which is:
[0038] (i) incapable of movement from cell to cell, and
[0039] (ii) optionally incapable of autonomous replication, and
[0040] (iii) has sequence homology with the gene to be
silenced.
[0041] This method is used for silencing a target gene in a first
part of a plant comprising the steps of:
[0042] (a) transiently exposing a second part of the plant, remote
from said first part, to a foreign initiator nucleic acid (fiNA) as
described above such as to generate a gene silencing signal,
[0043] (b) causing or allowing the signal to be propagated to the
second part of the plant such as to silence said target gene.
[0044] "Causing or allowing" in this sense implies, in particular,
that the construct giving rise to the fiNA (and hence signal) does
not encode proteins which would block the signal e.g. movement
proteins such as those which permit viral movment from cell to
cell.
[0045] Thus the present inventors have demonstrated for the first
time Transiently Induced Gene Silencing (or `TIGS`). They have
further demonstrated that a signal capable of propagating gene
silencing can be initiated in a second part of the plant to induce
silencing of a gene in the first.
[0046] Generally speaking, TIGS can be considered as having three
phases:
[0047] (i) initiation of a gene silencing signal by the transient
presence of fiNA in the cytoplasm of plant cells, which is
described in more detail below,
[0048] (ii) translocation of a gene silencing signal (though not
the fiNA itself) through tissues of the plant, which is facilitated
by the expression of a HE gene or a ST gene with homology to the
target gene in those tissues,
[0049] (iii) maintenance of the gene silencing signal within the
cells of the plant, which may be remote from those which were
initially, transiently, exposed to the fiNA.
[0050] The various different features of TIGS will now be discussed
in more detail:
[0051] "Silencing" in this context is used to refer to suppression
of expression of the (target) gene. It does not necessarily imply
reduction of transcription, because gene silencing is believed to
operate in at least some cases post-transcriptionally. The degree
of reduction may be so as to totally abolish production of the
encoded gene product (yielding a null phenotype), but more
generally the abolition of expression may be partial, with some
degree of expression remaining (yielding an intermediate
phenotype). The term should not therefore be taken to require
complete "silencing" of expression. It is used herein where
convenient because those skilled in the art well understand
this.
[0052] The "systemic" silencing means that the target gene is
silenced via a signal which is translocated substantially
throughout the tissues of a plant (though certain tissues may not
be silenced e.g. meristematic tissues, as discussed in more detail
below).
[0053] The "target" gene (ie the gene to be silenced or the
silenced gene) in the present invention may be any gene of
interest. As discussed below it will share homology with the fiNA.
In particular it may be a homologous endogenous gene (HEgene) or a
stably transformed homologous transgene (STgene, as with the stGFP
used above).
[0054] More than one target gene (e.g. a gene family) may be
targeted simultaneously provided that they all share homology with
the fiNA.
[0055] As will be discussed in more detail hereinafter, in certain
aspects of the invention the identity or phenotype of the gene may
be unknown--and indeed TIGS may be used to identify it.
[0056] The "fiNA", which may be either DNA or RNA, may be synthetic
(ie man made) or naturally occurring nucleic acid sequence which is
a homolog of the target gene or it may be a copy of all or part of
the target gene in sense or antisense orientation. It may be double
or single stranded, for instance it may consist of antisense
(double stranded) RNAs.
[0057] It should be stressed that, unlike RNA viral-based vectors
used to effect gene silencing in the art (e.g Biosource
Technologies, in WO 95/34668) the fiNA itself lacks sequences which
permit movement from plant cell to plant cell, and optionally allow
replication in the cytoplasm of plant cells (i.e. fiNA need not be
capable of autonomous replication in the cell).
[0058] Unlike the amplicons of PCT/GB98/00442 (which may optionally
lack such movement sequences) fiNA is not generated by a stably
integrated transgene in the plant.
[0059] Thus the crucial elements of the fiNA which give the
potential for signal initiation are that:
[0060] (i) it is foreign to the plant, or is at least recognised as
being foreign, possibly after interacting with existing nucleic
acids in the plant,
[0061] (ii) it shares homology with all or part of the target gene
(coding or non-coding strand),
[0062] (iii) it cannot move from plant cell to plant cell (more
particularly, does not comprise sequence encoding movement proteins
or other pathogenicity proteins which would interfere with the
signal), and optionally it cannot replicate autonomously in plant
cell cytoplasm.
[0063] The term "foreign" is used broadly to indicate that the fiNA
has been introduced into the cells of the plant or an ancestor
thereof, possibly using recombinant DNA technology, but in any case
by human intervention. Put another way fiNA will be non-naturally
occurring in cells in to which it is introduced. For instance the
fiNA may comprise a coding sequence of or derived from a particular
type of plant cell or species or variety of plant, or virus, placed
within the context of a plant cell of a different type or species
or variety of plant. Alternatively the fiNA may be derived from the
plant genome but is present in "unnatural" cellular or chromosomal
locations, or lacks certain features of the authentic endogenous
sequence (gene or transcript). A further possibility is for the
fiNA to be placed within a cell in which it or a homolog is found
naturally, but wherein the fiNA is linked and/or adjacent to
nucleic acid which does not occur naturally within the cell, or
cells of that type or species or variety of plant, such as operably
linked to one or more regulatory sequences, such as a promoter
sequence, for control of expression.
[0064] Regarding the "homology" of the fiNA, the complete sequence
corresponding to the transcribed sequence need not be used to
effect gene silencing, as is clear from the prior art studies
(which albeit did not use fiNA as described herein or provide
TIGS). For example fragments of sufficient length may be used. It
is a routine matter for the person skilled in the art to screen
fragments of various sizes and from various parts of the coding or
non-coding sequence of the target gene to optimise the level of
gene silencing, for instance using systems based on the GFP system
described later. It may be advantageous to include the initiating
methionine ATG codon of the target gene, and perhaps one or more
nucleotides upstream of the initiating codon. A further possibility
is to target a conserved sequence within a target gene, e.g. a
sequence that is characteristic of one or more target genes in
order to silence several genes which comprise the same or similar
conserved sequence.
[0065] A fiNA may be 300 nucleotides or less, possibly about 200
nucleotides, or about 100 nucleotides. It may be possible to use
oligonucleotides of much shorter lengths, 14-23 nucleotides. Longer
fragments, and generally even longer than 300 nucleotides are
preferable where possible if the fiNA is produced by transcription
or if the short fragments are not protected from cytoplasmic
nuclease activity.
[0066] It may be preferable that there is complete sequence
identity between the fiNA and a relevant portion of the target
sequence, although total complementarity or similarity of sequence
is not essential. One or more nucleotides may differ in the
targeting sequence from the target gene. Thus the fiNA of the
present invention may correspond to the wild-type sequence of the
target gene, or may be a mutant, derivative, variant or allele, by
way of insertion, addition, deletion or substitution of one or more
nucleotides, of such a sequence.
[0067] The fiNA need not include an open reading frame or specify
an RNA that would be translatable. There may be a TIGS signal even
where there is about 5%, 10%, 15%, 20% or 30% or more mismatch
between the fiNA and the corresponding homologous target sequence.
Sequence homology (or `identity` or `similarity`--the terms are
used synonymously herein) may be assessed by any convenient method
e.g. it may determined by the TBLASTN program, of Altschul et al.
(1990) J. Mol. Biol. 215: 403-10, which is in standard use in the
art.
[0068] Regarding translocation of the TIGS signal, as described
above this is generated when the cells of the plant are transiently
exposed to the fiNA, and the translocating tissues comprise, and
preferably transcribe (though not necessarily express) the target
gene or another `resident gene` sharing homology with the target
gene and the fiNA for the gene silencing signal to be transmitted
through such tissues. However it may not be necessary for all of
the translocating tissues to transcribe the gene--as shown in the
Examples below, the signal may be `relayed` between expressing
cells.
[0069] The resident gene, which is discussed in more detail below,
may be either endogenous or exogenous to the plant. The term
`homology` in relation to the resident gene is used in the same way
as it is used in relation to the fiNA/target gene above. In this
case the crucial element is that the homology be sufficient to
allow signal generation and/or propagation. As described above the
homology will preferably be at least 70%, more preferably at least
75%, more preferably at least 80%, more preferably at least 85%,
more preferably at least 90% or most preferably more than 95%.
[0070] The advantage of using an STgene as a resident gene is that
its transcription may be more readily controlled (if desired) than
a target gene which is an HEgene, as is discussed in more detail in
relation to facilitating signal propagation below.
[0071] The "transient exposure" of the second part of the plant to
the fiNA may be achieved by any convenient method. Essentially the
fiNA should be introduced directly or indirectly (e.g. exposure of
a fiNA produced in the nucleus from locally present foreign nucleic
acid) into the cytoplasm of cells of the second part of the
plant.
[0072] Known methods of introducing nucleic acid into plant cells
include use of a disarmed Ti-plasmid vector carried by
Agrobacterium exploiting its natural gene transfer ability
(EP-A-270355, EP-A-0116718, NAR 12 (22) 8711-8721 (1984), particle
or microprojectile bombardment (U.S. Pat. No. 5,100,792,
EP-A-444882, EP-A-434616) microinjection (WO 92/09696, WO 94/00583,
EP 331083, EP 175966, Green et al. (1987) Plant Tissue and Cell
Culture, Academic Press), electroporation (EP 290395, WO 8706614)
other forms of direct DNA uptake (DE 4005152, WO 9012096, U.S. Pat.
No. 4,684,611), liposome mediated DNA uptake (e.g. Freeman et al.
Plant Cell Physiol. 29: 1353 (1984)), or the vortexing method (e.g.
Kindle, PNAS U.S.A. 87: 1228 (1990d) Physical methods for the
transformation of plant cells are reviewed in Oard, 1991, Biotech.
Adv. 9: 1-11.
[0073] Preferably fiNA is introduced by microprojectile bombardment
with gold particles. Vacuum infiltration or injection of
agrobacterium or direct uptake mediated by carborundum powder,
whiskers (see Frame et al, Plant J 1994, 6: 941-948) or
electroporation.
[0074] Various embodiments will now be exemplified:
[0075] Introduction of fiNA-Initiation of the Signal
[0076] As described above fiNA may be introduced directly as naked
DNA, or it may be transcribed from nucleic acid introduced into
(but not stably integrated throughout) a plant. It should be
stressed that although the fiNA must be located in the cytoplasm of
the cell, there is no requirement that the fiNA be transcribed in
the cell; thus there is no need for the fiNA to incorporate a
promoter region in order to initiate the gene silencing signal or
for it to be introduced into the cytoplasm via the nucleus.
[0077] In a further embodiment it may be possible to use a viral or
other extrachromosomal expression vector (which may or may not
include translation signals) e.g a viral-based vector, encoding the
fiNA, and a replicase, but lacking transmissive elements (e.g.
movement proteins or other pathenogenicity proteins) which could
inhibit the generation of a signal which can move beyond the
infected parts of the plant, or be sustained within the plant after
initial introduction. However viruses, particularly those which are
transmissible, may be undesirable for other reasons e.g. safety,
resistance etc.
[0078] In a further embodiment it may be achieved by transiently
(e.g. locally) initiating the transcription of a fiNA-encoding
sequence which is present in the cells, possibly the nucleus or the
genome, of the second part of the plant.
[0079] This may be achieved by the use of Ti-based binary vectors
(cf. use of the trGFP described below). Generally speaking, those
skilled in the art are well able to construct vectors and design
protocols for transient recombinant gene transcription. For further
details see, for example, Molecular Cloning: a Laboratory Manual:
2nd edition, Sambrook et al, 1989, Cold Spring Harbor Laboratory
Press.
[0080] Optionally transcription of the fiNA may be placed under the
control of an activating agent, for instance using an inducible
promoter.
[0081] The term "inducible" as applied to a promoter is well
understood by those skilled in the art. In essence, transcription
under the control of an inducible promoter is "switched on" or
increased in response to an applied stimulus. The nature of the
stimulus varies between promoters. Some inducible promoters cause
little or undetectable levels of transcription (or no
transcription) in the absence of the appropriate stimulus. Other
inducible promoters cause detectable constitutive expression in the
absence of the stimulus. Whatever the level of expression is in the
absence of the stimulus, expression from any inducible promoter is
increased in the presence of the correct stimulus.
[0082] One example of an inducible promoter is the GST-II-27 gene
promoter which has been shown to be induced by certain chemical
compounds which can be applied to growing plants. The promoter is
functional in both monocotyledons and dicotyledons. It can
therefore be used to control gene expression in a variety of
genetically modified plants, including field crops such as canola,
sunflower, tobacco, sugarbeet, cotton; cereals such as wheat,
barley, rice, maize, sorghum; fruit such as tomatoes, mangoes,
peaches, apples, pears, strawberries, bananas, and melons; and
vegetables such as carrot, lettuce, cabbage and onion. The
GST-II-27 promoter is also suitable for use in a variety of
tissues, including roots, leaves, stems and reproductive tissues.
Other example inducible promoters are well known to those skilled
in the art, the choice of which will be determined by the
convenience of using the inducing agent in the particular
application being carried out.
[0083] Another suitable promoter may be the DEX promoter (Plant
Journal (1997) 11: 605-612).
[0084] In this embodiment the activating agent can be applied
locally to one or more regions of the plant in which the
fiNA-encoding construct has been introduced (the `second part`) in
order to achieve the remote silencing of other (`first part`).
[0085] In a most preferred aspect, the fiNA may be introduced as a
construct corresponding to a truncated `amplicon` of GB 98/00442.
This will generally comprise:
[0086] (i) a plant promoter
[0087] (ii) a nucleic acid sequence operably linked to that
promoter, said sequence encoding an RNA-dependent replicase, and
further encoding fiNA, which is itself operably linked to a
sub-genomic promoter capable of being recognised by said replicase,
such that the fiNA is capable of autonomous cytoplasmic
replication, with the proviso that the nucleic acid sequence does
not encode active viral movement proteins (plus optionally
pathogenicity proteins) which would otherwise inhibit the TIGS
signal from spreading systemically in the plant into which the
construct is introduced.
[0088] By "replicase" is meant, where appropriate, all the required
components to give replicase function. The construct does not
encode "active movement proteins" in the sense that, although a
movement proteins may be encoded, they are not functional e.g.
because one or more has been deleted or modified.
[0089] Propagation and Maintenance of the Signal through the
Plant
[0090] The advantage of achieving systemic gene silencing using
transient activation or introduction of fiNA in a localised area
(e.g. by application of a specific agent) is that there is no
requirement for the inducing agent of fiNA to be translocated
within the tissues of the plant or be applied to all parts of the
plant. Once initiated the signal can induce gene silencing in
remote parts of the plant. This gene silencing is stable and
persists even after the fiNA ahs been removed.
[0091] By "remote" is meant the first and second parts of the plant
are spatially separated, although obviously connected via the plant
tissues. It may be advantageous if the first part of the plant is
above the level of the second, or if the route corresponds to the
`source-sink` movement of photosynthetic products from regions in
which they are concentrated to regions of use. The observations
described in the Examples suggest that signal movement mimics in
some respects viral or viral-vector movement. It should be
stressed, however, that neither the signal of the present
invention, nor the fiNA used to initiate it, are viruses, for
instance mobile, cytoplasmatically replicable vectors.
[0092] It should also be stressed that the part of the plant in
which the target gene is to be silenced may encompass all, or
almost all, of that part of the plant which is not directly exposed
to the fiNA i.e. systemic silencing.
[0093] Thus in one embodiment of this aspect, the target gene is
silenced systemically in the plant tissues i.e. in the first and
second parts of the plant and the tissues between them, (cf. the
stGFP described below).
[0094] It may not be necessary for all the cells in these tissues
to transcribe the target gene, as detailed in the Examples.
[0095] Alternatively, some or all of the cells of the connecting
plant tissues will comprise a resident gene, the transcription
(though not necessarily expression) facilitates the propagation of
the signal.
[0096] By "resident gene" is meant a gene (endogenous or exogenous)
which is homologous to the target gene and homologous to the fiNA
such as to facilitate transduction of the TIGS signal.
[0097] Thus in a second embodiment of this aspect, the target gene
is transcribed only in a second, remote, part of the plant (e.g. it
is expressed in a tissue specific manner), but a resident gene
which is homologous to the target gene is present and preferably
transcribed in the plant tissues in the second part of the plant
and/or the tissues between the first and second parts of the plant.
Presence or preferably transcription of this resident gene may thus
serve to cause or allow signal propagation.
[0098] This embodiment permits control of tissue specific target
genes. The resident gene serves to assist systemic spread of the
signal. The systemic spread of the signal can thus be controlled at
an additional level to the direct control of the fiNA exposure,
providing further temporal and spatial control over gene
silencing:
[0099] By regulating the transcription of the resident gene in the
cells carrying the TIGs signal, it will be possible to determine
whether gene silencing in the first part of the plant is activated
effectively, or to affect the tissue specificity of gene
silencing.
[0100] Transcription of a resident (STgene) may be altered by use
of an inducible promoter, such as is described above in relation to
the fiNA.
[0101] It will be apparent from the foregoing that the invention
embraces methods of controlling gene silencing in plants by
manipulating the presence or transcription of the fiNA or the
propagation of the signal. e.g. by controlling the presence or
absence of an activating agent which induces transcription of a
resident gene. Physical methods for manipulating the resident gene
expression are also envisaged. For instance grafts of tissue
between the different parts of the plant which are either
permissive (i.e. contain cells having the resident gene) or
non-permissive (cells don't have the resident gene) can be used to
control translocation of the signal.
[0102] Selected Applications for TIGS
[0103] In embodiments of the present invention which have been
experimentally exemplified as described below for illustrative and
non-limiting purposes only, the transiently introduced gene
encoding the fiNA that determined the target of gene silencing was
the gene encoding the jellyfish green fluorescent protein GFP
(Chalfie et al. (1994) Science 263: 802-805). This was used to
silence a stably integrated GFP transgene.
[0104] Any other ST- or HEgene of a plant, or STgene of animal,
fungal, bacterial or viral origin may be a target gene provided
that the fiNA contains a corresponding homologous sequence.
[0105] In one aspect of the present invention, the target gene may
be of unknown phenotype, in which case the TIGS system may be
employed to analyse the phenotype by generating a systemic (or
widespread) null (or nearly null) phenotype.
[0106] Thus a further aspect of the invention comprises a method of
characterising a target gene comprising the steps of:
[0107] (a) silencing the target gene in a part or at a certain
development stage of the plant using the TIGS system described
above,
[0108] (b) observing the phenotype of the part of the plant in
which or when the target gene has been silenced.
[0109] Preferably the gene is silenced systemically. Generally the
observation will be contrasted with a plant wherein the target gene
is being expressed in order to characterise (i.e. establish one or
more phenotypic characteristics of) the gene.
[0110] There are several advantages of the current method over
alternative methods in which the targeted gene is inactivated by
insertional or other mutagenic procedures or in which gene
silencing is uncontrolled. The advantage over mutagenic procedures
applies when there is more than one homologous gene carrying out
the role of the target gene. Mutagenic procedures will not normally
reveal a phenotype in that situation. A second situation where the
current invention has advantage over both mutagenic and unregulated
gene silencing procedures applies when the target gene has a lethal
phenotype. The controllable attribute of the gene silencing will
allow the phenotype of such genes to be investigated and exploited
more efficiently than using the alternative methods available prior
to the disclosure of the current invention.
[0111] This aspect is particularly useful given the significant
amount of sequence data currently being generated in genomics
projects which is unassigned in terms of function or phenotype.
Thus even if the gene exerts its effects only in particular
tissues, this may be detectable without having to ensure that a
virus has permeated the entire plant (as in Biosource Technologies,
WO 95/34668).
[0112] Nor, for the identification of HE genes, would it be
necessary to try and generate a transgenic plant in which gene
silencing is already activated to observe the effect.
[0113] In a further aspect there is disclosed a method of altering
the phenotype of a plant comprising use of the TIGS method.
[0114] Traits for which it may be desirable to change the phenotype
include the following: colour; disease or pest resistance; ripening
potential; male sterility.
[0115] For instance male sterile plants are required for production
of hybrid seed. To propagate the male sterile lines it is necessary
to restore male fertility. In the examples in which male sterility
is induced by a transgene it would be possible to restore male
fertility by controlled silencing of the transgene using the
approach described above.
[0116] Many genes have multiple roles in development. They may be
required, for example, in embryo development and in the development
of organs or tissues in the mature plant. Obviously it would not be
possible to silence these genes unless the silencing system could
be controlled so that it is not active in embryo development. The
system described here could be used to provide that control.
[0117] Other traits will occur to those skilled in the art. In each
case the only necessity is that sufficient is known about the
target gene(s) to devise suitable fiNA, which may of course be
optimised without burden to achieve the desired effect. If the
target gene is not expressed systemically, then it may be necessary
to produce a transgenic plant wherein a resident STgene is
transcribed systemically in order to allow signal propagation. The
fiNA can then be used to initiate the signal.
[0118] The production of transgenic plants is now very well known
to those skilled in the art, as evidenced by the various reported
methods some of which are recorded in non-prior published GB patent
application 9703146.2 in the name of John Innes Centre Innovations
Limited, the content of which is incorporated herein by
reference.
[0119] In a further aspect of the present invention there is
disclosed a method for producing a systemic gene silencing
signaling agent in a plant, which is capable of silencing a target
gene comprising causing or allowing the transient exposure of a
part of the plant expressing said target gene or a homolog thereof
to a fiNA.
[0120] The systemic gene silencing signaling agent is characterised
in that it
[0121] (a) comprises nucleic acid,
[0122] (b) is capable of mediating sequence-specific gene silencing
of a target gene,
[0123] (c) it is obtainable by transient exposure of a plant cell
transcribing said target gene or a homolog thereof to a fiNA,
[0124] (d) is capable of moving between a first and second part of
the plant, said parts being connected by cells comprising, and
preferably transcribing said target gene or a homolog thereof,
which movement is inhibited my movement or pathogenicity proteins
as discussed above.
[0125] The various nucleic acids of the present invention may be
provided isolated and/or purified (i.e. from their natural
environment), in substantially pure or homogeneous form, or free or
substantially free of other nucleic acid. Nucleic acid according to
the present invention may be wholly or partially synthetic. The
term "isolate" encompasses all these possibilities.
[0126] Also embraced by the present invention is a transgenic plant
comprising a target gene which has been systemically silenced using
TIGS.
[0127] The present invention may be used in plants such as crop
plants, including cereals and pulses, maize, wheat, potatoes,
tapioca, rice, sorgum, millet, cassava, barley, pea and other root,
tuber or seed crops. Important seed crops are oil seed rape, sugar
beet, maize, sunflower, soybean and sorghum. Horticultural plants
to which the present invention may be applied may include lettuce,
endive and vegetable brassicas including cabbage, broccoli and
cauliflower, and carnations and geraniums. The present invention
may be applied to tobacco, cucurbits, carrot, strawberry,
sunflower, tomato, pepper, chrysanthemum, poplar, eucalyptus and
pine.
[0128] The present invention will now be illustrated and
exemplified with reference to experimental results and the
accompanying Figures. Further aspects and embodiments of the
present invention, and modifications of those disclosed herein,
will be apparent to those skilled in the art. All documents
mentioned anywhere herein are incorporated by reference.
FIGURES
[0129] FIG. 1. Transgene and Viral Constructs
[0130] a T-DNA from pBin-35S-mGFP5 used for Nicotiana benthamiana
stable transformation (pnos: nos promoter, tnos: nos terminator,
35S: CaMV-35S promoter, RB: right border, LB: left border). This is
the STgene construct.
[0131] b T-DNAs from various binary vectors carried by
Agrobacterium tumefaciens strain LBA4404 used for leaf
infiltrations (OCS: octopine synthase terminator, BaR: BASTA
resistance gene). These are TRgene constructs. lacZ: multiple
cloning site, inserted for cloning facilities.
[0132] c Structures of PVX-GUS.sup.17 and PVX-GFP.sup.16.
Expression of the inserted marker genes is controlled by a
duplicated coat protein (CP) promoter (shaded boxes). Other
abbreviations are RdRp: RNA dependent RNA polymerase, and 25K, 12K,
8K: cell-to-cell movement proteins. These constructs were used,
inter alia, in determining whether gene silencing was pre- or
post-transcriptional.
[0133] FIG. 2. Expression of GUS and GFP reporter genes in N.
benthamiana
[0134] These images were all produced under UV illumination except
for the bottom panels of E and F and panels I-L that show leaves
stained for GUS activity.sup.24. The method and abbreviations are
described in more detail in Example 1. Depending on the exposure
time and the source of UV, GFP appears green or yellow. In the
absence of GFP the chlorophyllous plant tissue appears red.
[0135] (a) A leaf of a stably integrated GFP homogene (stGFP)
plant
[0136] (b) A leaf of a non-transgenic (not) nt plant.
[0137] (c-d) stGFP plants infiltrated 18 d previously with a
culture of the NPT:GUS:GFP strain of A. tumefaciens, prepared in
the presence (c) or in the absence (d) of acetosyringone; the
arrows indicate the infiltrated leaves.
[0138] (e-f) Expression of trGFP (top panel) and GUS (bottom panel)
in leaves of an nt plant (e) or an stGFP plant (f) that had been
infiltrated with the NPT:GUS:GFP strain of A. tumefaciens 2 days
previously. The arrow in (e) indicates the zone of stGFP
suppression at the edge of the infiltrated zone where A line of red
fluorescent tissue is observed.
[0139] (g) Close-up view of an axillary shoot emerging from one of
the three fully expanded leaves of the plant presented in (c).
Leaves on these axillary shoots always show very strong stGFP
suppression. The diffuse patches of residual expression of stGFP
fade when these leaves expand. Some of the smaller leaflets on the
axillary shoots as shown in this panel (arrow) are uniformly
red.
[0140] (h) UV illumination of upper leaves emerging from the main
stem of A stGFP plant infiltrated 18 days previously with water
(left), or with the NPT:GUS:GFP strain of A. tumefaciens. (middle
and right).
[0141] (i) Leaves shown in (h) were stained for GUS activity.
[0142] (j) A leaf infiltrated with an NPT:GUS:GFP strain of A.
tumefaciens as an internal control for the histochemical GUS
staining shown in (i).
[0143] (k-l). PVX-GUS foci observed on A systemic leaf of an stGFP
plant infiltrated with either the NPT:GUS:GFP strain of A.
tumefaciens (k) or with water (l). Leaves were inoculated with
PVX-GUS and collected after 5 days for GUS staining. When leaves
were collected later than 5 days post-inoculation, the GUS foci had
spread to the veins, indicating a potential for systemic spread of
PVX-GUS independently of stGFP silencing.
[0144] FIG. 3. Northern analysis of stGFP and PVX-GFP RNA. stGFP
plants (GFP) or nt plants (NT) were infiltrated with either water
(Mock), or the NPT:GUS:GFP strain of A. tumefaciens previously
induced with acetosyringone (N:G:G)-X(N:G:G-) indicates that the
culture was not previously induced. After 20 d, two upper leaves
were inoculated with water (Mock) or PVX-GFP. 5 d after virus
inoculation, total RNA was extracted from one of the two inoculated
leaves and northern analysis on 10 .mu.g of RNA was carried out to
detect accumulation of the stGFP RNA and PVX-GFP RNA (indicated on
the left side of the upper panel). The heterodisperse RNA species
in tracks 9-14 represent sub-genomic and degraded RNA species and
are typical of PVX RNA samples of inoculated leaves. The lower
panel shows probing of the northern blot with an rRNA probe to
confirm equal loadings of RNA.
[0145] In Figure legends 4 to 7, the intGFP refers to stably
integrated GFP, while epiGFP refers to infiltrated sequence.
[0146] FIG. 4. Constructs used in Example 13
[0147] The T-DNA constructs used for Agrobacterium infiltrations
are derived from the N:G:G construct. The 35S promoter controlling
the GFP gene has been replaced by the nos promoter in the N:Gnos
construct, and has been deleted in the N:G.DELTA. construct.
[0148] FIG. 5. Kinetics of translocation of the TIGS signal
[0149] The top diagram illustrates the order of events described
below. One leaf of intGFP plant was infiltrated with the N:G:G
strain of A. tumefaciens (previously induced with acetosyringone),
and subsequently removed 1, 2, 3, 4 or 5 days after infiltration.
The percentage of plants undergoing TIGS after removal of the
infiltrated leaf was then assessed under UV illumination. Each dot
on the diagram represents the average percentage obtained from 30
individual plants infiltrated at the same time (see Example
14).
[0150] FIG. 6. Biolistic activation of TIGS
[0151] (A) DNA constructs tested for biolistic activation of TIGS.
The pUC35S-GFP plasmid contains the 35S-GFP expression cassette
from pBin35S-GFP (FIG. 1). The GFP plasmid contains only the
full-length GFP open reading frame from pBin35S-GFP cloned as a
BamHI-SalI restriction fragment in pUC19. The ..P and G.. DNA
constructs are linear, PCR-amplified fragments of the GFP open
reading frame and are respectively 348 and 453 bp long. Equal
amounts of each construct were bombarded (see Experimental
Procedures and Example 16).
[0152] (B) Effect of the length of homology between epiGFP and
intGFP on biolistic activation of TIGS. The intGFP seedlings were
bombarded with a series of PCR-amplified fragments sharing a
similar physical length but harbouring 3' terminal fragments of GFP
cDNA of varying length. These fragments were amplified from a
pBluescript vector containing the full-length GFP open reading
frame by using one vector-specific primer and one GFP-specific
primer. The white dot on the diagram represents the 5' end of the
GFP open reading frame. Equal amounts of each construct were
bombarded (see Experimental Procedures, and Example 16).
[0153] FIG. 7. TIGS Requires an Interaction of epiGFP and
intGFP
[0154] See Example 17.
[0155] (A) Bombarded epiGFP and inoculated viral constructs. The
..P and GF. DNA constructs are derivatives of the GFP construct
described in FIG. 5A. PVX-GF and PVX-P are PVX vectors carrying the
GF. and ..P restriction fragments of the GFP open reading frame,
respectively.
[0156] (B) Northern analysis of intGFP and PVX-GF/GFP RNAs. The top
diagram illustrates the order of events described below. First
intGFP seedlings or non-transformed plants (NT) were bombarded with
either uncoated gold particles (-) or gold particles coated with
either the GFP or the ..P construct. After 21 days, two upper
leaves were inoculated with either water (Mock), PVX-GFP or PVX-GF.
The plants bombarded with GFP or derivatives exhibiting TIGS were
selected for the virus inoculation. Five days after virus
inoculation, total RNA was extracted from one of the two inoculated
upper leaves and Northern analysis of 10 (g of RNA was carried out
to detect accumulation of the intGFP and PVX-GF/GFP RNA (indicated
on the left side of the upper panel).
[0157] FIG. 8: pPVX209 and pPVX210A
[0158] As described in Example 19, the CP was deleted from pPVX209
[FIG. 8(a)] to create pPVX210A [FIG. 8(b)]. The sequence is
numbered from the 35S promoter, with the SacI site immediately
upstream of the promoter being numbered as nucleotide 4.
[0159] FIG. 9: pCL-vectors and progenitor construct
[0160] After eliminating the TGB (triple gene block) tagged PCR
fragments amplified from pPVX210A were re-inserted to restore
replicase function. Shown are (a) pCL100; (b) pCL101; (c) pCL102;
(d) pCL105 (includes a 1729 bp deletion in the replicase); (e)
pCL106 (includes a PCR fragment from pPVX210A to restore GFP
function and enhance the production of sub genomic RNA); (f)
progenitor construct pA500 [see Table 2; Example 19; (g) pCL103;
(h) pCL104. See FIG. 8 for explanation of terms.
[0161] FIG. 10: Insertion of pUC19 constructs into plasmid
pSLJ755/5.
[0162] Numbers in pSLJ755/5 are relative to the SacI cloning
site.
[0163] FIG. 11: Positive strand sequences of constructs
[0164] Restriction sites used in cloning are underlined and
labelled in grey. `Xxxx` indicates the ligated SalI/XhoI hlaf
sites. Abridged parts of the sequences are labelled in tildes
(`.about.`). The 144 underlined bases represent the duplicated CP
promoter region which together with the downstream GFP 5' end was
inserted into pCL100 to create pCL106. Bases in lower case indicate
non-viral sequence introduced by PCR primers used in cloning.
Sequences confirmed after the respective cloning step are double
underlinded, single bp exchanges or deviations not unambiguously
falsified by examining the sequencing raw data are in minor case
italics. Spacing for the CP deletion is condensed in TGB deletion
contructs.
[0165] (a) pPVX209 (10762 nt)
[0166] (b) pPVX210A (10024 nt)
[0167] (c) pCL100 (8753 nt)
[0168] (d) pCL102 (8918 nt)
[0169] (e) pCL101 (8780 nt)
[0170] (f) pCL106 (8901 nt)
EXAMPLES
General Methods--Examples 1 to 12
[0171] Plant Transformation.
[0172] Four independent lines of Nicotiana benthamiana plants
carrying the GFP transgene (stGFP plants) were generated by the A.
tumefaciens-mediated leaf disk transformation method.sup.22. For
transformation, we used the disarmed Agrobacterium strain GV-3101
containing the binary vector pBin-35S-mGFP5.sup.23. Restriction
digestion and Southern analysis showed that each line harbours a
single T-DNA integration site, consistent with the observed 3:1
segregation of the expression of GFP in the R1 generation. In all
cases, this single locus is associated with one intact copy of the
GFP transgene. Northern analysis showed comparable high levels of
GFP mRNA in these four independent lines. All stGFP plants used in
this work were homozygous, selfed F1 progeny of the primary
transformants.
[0173] Infiltration of Agrobacteriun and the Selective Enrichment
Assay
[0174] Infiltration of Agrobacterium cultures for transient
expression was based on a previously-described method.sup.13.
First, the constructs shown in FIG. 1b were transferred to A.
tumefaciens GV3101 by triparental mating and the strains were
plated on minA medium. A single colony was inoculated into 5 ml LB
medium supplemented with the appropriate antibiotics, and grown at
280.degree.C. for 48 hours One ml of the culture was transferred to
100 ml LB with 10 mM MES pH 5.6 and 20 .mu.M acetosyringone, and
grown at 28.degree. C. for 16 hours. The bacteria (OD600=1) were
spun down, suspended in 50 ml 10 mM MgCl.sub.2 and kept at room
temperature for 3 hours. The infiltration, performed with a 2 ml
syringe, was to one or two expanded leaves of 3 week-old seedlings.
The infiltrated leaves were then sealed in a small plastic bag for
two days. Seedlings were maintained in A glasshouse- between
20.degree. C. and 25.degree. C. Artificial illumination was used,
if necessary, to provide A day length of 16 hours or more.
[0175] The selective enrichment assay for Agrobacterium was as
described.sup.19. Using this procedure a single isolated
Agrobacterium cell mixed with 0.1 g of tobacco tissue could be
enriched to the late exponential phase after 3 days of
incubation.
[0176] General Procedures.
[0177] PVX-GFP and PVX-GUS inocula were sap extracts of plants
(Nicotiana clevelandii) infected with in vitro transcripts of the
corresponding cDNA clones.sup.16,17. RNA isolation and Northern
analysis were done as described.sup.17. The probe used for
hybridization was a .sup.32P-labelled cDNA corresponding to the
entire GFP open reading frame. Histochemical staining of plant
material for GUS activity was performed according to the method of
Jefferson.sup.24.
General Methods--Examples 13-19
[0178] These were as above except:
[0179] Infiltration of Agrobacterium.
[0180] Infiltration of A. tumefaciens was based on a
previously-described method (English et al., 1997). The constructs
shown in FIG. 4 were transferred to A. tumefaciens (strain GV3101,
unless otherwise stated) by triparental mating or electroporation
and the strains were plated on minA medium. Procedure was as
described above.
[0181] Grafting Procedure
[0182] Non-transformed and transgenic N. benthamiana plants were
grown about 1 month before grafting. The stocks were beheaded 10-15
cm from the soil and wedge-grafting was performed with scions of
similar age. The graft junction was then fastened and protected
from desiccation by Parafilm. During the first week after grafting,
plants were covered with a plastic bag to maintain high humidity
conditions.
[0183] Seedling Bombardment
[0184] N. benthamiana seeds were sterilised with 0.25% sodium
hypochlorite for 15 min and rinsed 3 times with sterile water.
Seeds were germinated for 7-10 days on MSR6 medium. One day before
bombardment the seedlings in groups of 10-12 were transferred onto
fresh MSR6 medium distributed over a 3.2 cm2 target area. DNA
coating and particle bombardment were carried out as described
previously (Christou et al., 1991). Each group of 10 seedlings was
bombarded twice with 163 ml of gold particles coated with 326 ng of
DNA and accelerated at 12 Kv. Two weeks after bombardment seedlings
were transferred to a glasshouse between 20.degree. C. and
25.degree. C. Artificial illumination was used, if necessary, to
provide a day length of 16 hours or more.
[0185] In Vitro Propagation
[0186] N. benthamiana leaves were harvested from greenhouse-grown
plants. Leaves were sterilised with 0.25% (w/v) sodium hypochlorite
for five minutes and rinsed three times with sterile distilled
water. Leaf disks were aseptically plated onto MSR6 medium (Vain et
al., 1998) complemented with 1 mg/l 6-Benzylaminopurine and 0.1
mg/l (-Naphthaleneacetic acid. Culture was conducted in 2 cm deep
Petri dish sealed with Micropore (tape, at 23 (C. and under a 16
hours photoperiod. Leaves were subsequently transferred at 15 day
intervals onto fresh medium. After 4 to 6 weeks the regenerated
shoots were dissected and rooted onto MSR6 medium.
[0187] GFP Imaging
[0188] Visual detection of GFP fluorescence in whole plant was
performed using a 100 W hand-held long-wave ultraviolet lamp (UV
products, Upland Calif. 91786, Black Ray model B 100AP). Plants
were photographed with a Kodak Ektachrome Panther (400 ASA) film
through a Wratten 8 filter. Exposure times varied up to 70 sec
depending on the intensity of the fluorescence and the distance of
the camera and lamp from the plant. Observation of explants
cultured in vitro was carried out using a MZ12 Leica dissecting
microscope coupled to an epifluorescent module. Photographs were
taken using Kodak Ektachrome Panther (400 ASA) film. Confocal
microscopy was performed under a Leica DMR module coupled to a
Leica TCS-NT system. A 100 mW Argon ion laser was used to produce
blue excitation light at 488 nm (emission filter 522 nm). Using
these filter combinations, background autofluorescence from the
samples was removed. Individual images were stored on optical
disc.
[0189] Construction of PVX Derivatives and In Vitro
Transcription
[0190] PVX-GFP has been described previously (Baulcombe et al.,
1995). PVX-GF was made by replacing the original GFP insert in the
PVX vector pTXS-GFP (Baulcombe et al., 1995) by the mGFP5 insert
from pBin-35S-mGFP5 (Haseloff et al., 1997) and by removing the 354
bp fragment between a ClaI site (position 465 within the GFP5
coding sequence) and a SalI site at the 3' end of GFP5 (position
818). PVX-P was made by inserting a ClaI-SalI restriction fragment
from GFP5 into the PVX vector pP2C2S (Baulcombe et al., 1995).
Viral inocula were sap extracts of plants (N. clevelandii) infected
with in vitro transcripts (Chapman et al., 1992) of the
corresponding cDNA clones.
[0191] Agroinfiltrated and Bombarded epiGFP Constructs
[0192] The N:G:G binary vector (FIG. 1) is based on pBIN 35S:GFP4
(Haseloff et al., 1997) in which the LacZ polylinker from pUC19 has
been inserted in the HindIII blunted restriction site located
upstream the 35S promoter of GFP4. A 35S-GUS expression cassette
from pSLJ4D4 (Jones et al., 1992) was then inserted in the LacZ
polylinker as a HindIII-EcoRI restriction fragment. The N:Gnos and
N:G.DELTA. constructs (FIG. 4) are derived from pBin 35S:GFP4.
N:G.DELTA. was obtained by removal of the 35S promoter of GFP4 by a
BamHI-HindIII restriction, followed by blunt ending (Klenow) and
relegation. N:Gnos was obtained by removal of the 35S promoter by a
BamHI-HindIII restriction, followed by Klenow DNA filling and
insertion of the nos promoter. The pUC35S-GFP construct (FIG. 6)
was obtained by inserting the 35S:GFP4 expression cassette from
pBIN 35S:GFP4 (HindIII-EcoRI restriction fragment) in pUC19. The
GFP construct was obtained by inserting the full-length GFP open
reading frame from pBIN 35S:GFP4 (BamHI-SacI restriction fragment)
in pUC19 (Yanisch-Perron et al., 1985). The "G.." fragment (FIG. 6)
was PCR-amplified from pBIN 35S:GFP5 (Haseloff et al., 1997) using
primers GGATCCAAGGAGATATAACAA and AAATCGATTCCCTTAAGCTCG (pos1 and
pos453 in the GFP5 cDNA, respectively). The "..P" fragment (FIG. 6)
was PCR-amplified from pBIN 35S:GFP5 using primers
AGCTTAAGGGAATCGAT and CTTAGAGTTCGTCATGTTTGT (pos454 and pos813 in
the GFP5 cDNA, respectively). The series of PCR-amplified fragments
used for the study of the effect of the length of homology between
epiGFP and intGFP (FIG. 6B) was obtained from pBluescript in which
the complete GFP5 cDNA was inserted as a BamHI-SacI restriction
fragment. Primer combinations used for each amplification are:
1 (AGCTTAAGGGAATCGAT-TTGTGGCCGAGGATGTTT);
(AAATCGATCCCTTAAGCTCG-GGGTAACGCCAGGGTTTTCC);
(AGTAGTGACAAGTGTTGGCC-AGCGGGCGCTAGGGCGCT);
(TGACAGAAAATTTGTGCCCATT-GTAAAGCACTAAATCGGAACC);
(TTGGGACAACTCCAGTGAAAA-CCACTACGTGAACCATCAC).
[0193] The ...P and GF. constructs are respectively linear
ClaI-SalI and BamHI-ClaI restriction fragments from the GFP
construct described above.
[0194] General Procedures
[0195] RNA isolation and Northern analysis were done as described
(Mueller et al., 1995). The probe used for hybridisation was a
32P-labelled cDNA corresponding to the entire GFP open reading
frame. Histochemical staining of plant material for GUS activity
was performed using standard procedures (Jefferson, 1987).
Example 1
[0196] The Gene Silencing Signal Imposes Remote Silencing
[0197] To develop a reproducible system for activation of gene
silencing we have used transient expression of silencer transgenes
in Nicotiana benthamiana. The target of gene silencing (FIG. 1a) in
these experiments encodes the jellyfish green fluorescent protein
(GFP).sup.11 that can be monitored non-invasively: leaves of
transgenic GFP plants appear green under UV light (FIG. 2a) whereas
non transgenic (nt) leaves appear red due to chlorophyll
fluorescence (FIG. 2b). To deliver silencer transgenes, we
infiltrated leaves.sup.12,13 of N. benthamiana with strains of
Agrobacterium tumefaciens carrying various binary Ti plasmid
vectors (FIG. 1b), including one with a GFP reporter gene. We refer
to the stably integrated and transiently expressed GFP transgenes
as stGFP and trGFP, respectively.
[0198] At 2 days post-infiltration with the NPT:GUS:GFP strain of
A. tumefaciens (FIG. 1B) there was expression of both the GUS and
the trGFP reporter genes in the infiltrated tissues (FIGS. 2e, 2f).
In the stGFP transgenic lines (FIG. 2f) the strong green
fluorescence due to the trGFP was superimposed over a weaker
background fluorescence from the stGFP. However, at the edge of the
infiltrated zone there was a thin line of red fluorescent tissue
(FIG. 2f) indicating that stGFP expression had been suppressed.
[0199] Although the zone of stGFP suppression did not spread
further within the infiltrated leaf, by 18 days post-infiltration
there was suppression of stGFP in the upper leaves (FIG. 2c) of the
NPT:GUS:GFP infiltrated plant. This effect was most pronounced in
the stem and leaves that were directly above the infiltrated leaf
and in the tissues surrounding the veins (FIGS. 2c, 2h). In leaves
of the axillary shoots (FIG. 2g) and in some uppermost leaves (FIG.
2h) there was complete suppression of green fluorescence due to
stGFP. The time-course of stGFP suppression and its pattern of
spread through the vegetative parts of the infiltrated plants were
consistently observed in 5 independent experiments involving 20
plants of each of 4 independent stGFP lines.
Example 2
[0200] The Gene Silencing Signal is Sequence Specific
[0201] There was no suppression of stGFP when the plants were
infiltrated with the NPT:GUS, GUS:BAR or empty vector strains of A.
tumefaciens (FIG. 1b). If the suppression had been caused by the
infiltration process these control strains would have caused
suppression of stGFP. Similarly, if the 35S promoter or nos
terminator components of the trGFP are involved, there would have
been suppression of stGFP following infiltration with the NPT:GUS
and GUS:BAR strains (FIG. 1b): these constructs have both 35S
promoters and nos terminators. Therefore, the systemic suppression
of stGFP is a sequence-specific effect based on the common presence
of GFP coding sequences in stGFP and trGFP.
Example 3
[0202] The Gene Silencing Signal Requires Uptake of the Transgene
Coding for the fiNA
[0203] The A. tumefaciens cultures used in these experiments
contained acetosyringone as an inducer of virulence (Vir)
functions.sup.14. In the absence of Vir gene expression there is no
transfer of T-DNA (between the right and left borders; FIG. 1b)
from the Ti plasmid into the plant cell. Consequently, when leaves
of nt N. benthamiana were infiltrated with the NPT:GUS:GFP strain
of A. tumefaciens incubated without acetosyringone, there was no
expression of GUS or trGFP at 2 days post-infiltration. In
addition, there was no systemic suppression of stGFP by 18 days
post-infiltration (FIG. 2b, 2 days). From this result we conclude
that the systemic suppression of stGFP requires T-DNA-mediated
transfer of trGFP nucleic acid into plant cells.
Example 4
[0204] The Gene Silencing Signal Effects Post-Transcriptional
Silencing
[0205] In the tissue exhibiting the systemic suppression of stGFP,
the steady state levels of stGFP RNA were reduced below the level
of northern blot detection (FIG. 3 lanes 1-4) indicating that there
is gene silencing. To determine whether the mechanism of stGFP
silencing is transcriptional or post-transcriptional, we exploited
previous demonstrations that post-transcriptionally silenced
transgenes confer resistance against modified potato virus X (PVX)
constructs in which there is sequence similarity to the silencer
transgene.sup.15. A transgene exhibiting transcriptional gene
silencing did not affect the corresponding viral construct.sup.15.
The modified PVX in the present analyses (FIG. 1c) carried either a
GFP or a GUS reporter gene (PVX-GFP.sup.16 and PVX-GUS.sup.17
respectively). The viral inocula were applied to the upper leaves
of N. benthamiana at 18 d post-infiltration with either water or
cultures of A. tumefaciens.
[0206] Northern analysis (FIG. 3) revealed that at 5 days
post-inoculation there was abundant PVX-GFP RNA in leaves of nt and
stGFP N. benthamiana that had been previously infiltrated with
water (FIG. 3, lanes 11-13). The PVX-GFP RNA was also abundant if
the plants had been previously infiltrated with the NPT:GUS:GFP
strain prepared in the presence (nt line) or absence (stGFP line)
of acetosyringone (FIG. 3, lanes 9, 10, 14). However, in the
stGFP-silenced leaves of plants that had been previously
infiltrated with the acetosyringone-treated NPT:GUS:GFP strain of
A. tumefaciens, the accumulation of PVX-GFP RNA was reduced to
levels that were at or below the limit of detection (FIG. 3, lanes
5-8). When PVX-GUS was inoculated to these leaves there were as
many GUS foci as on the corresponding control leaves in which there
was no suppression of stGFP (FIGS. 2k, l). From these differential
effects on PVX-GFP and PVX-GUS we conclude that trGFP elicited
sequence-specific gene silencing at the post-transcriptional
level.
Example 5
[0207] The Gene Silencing Signal is not the Construct Vector or
Host Comprising the Transgene Coding for the fiNA
[0208] We can rule out that the systemic suppression of stGFP is
associated with systemic spread of the NPT:GUS:GFP strain of A.
tumefaciens because there was no detectable GUS.sup.18 in tissues
that exhibited systemic suppression of stGFP (FIGS. 2h-j).
Furthermore, using A selective enrichment procedure.sup.19, we
could not detect A. tumefaciens in sap extracts of tissue showing
suppression of stGFP. In ten samples the selective enrichment
procedure detected A. tumefaciens in 10.sup.-12-fold dilutions of
infiltrated leaf extracts. However, in forty-five samples from
systemic tissue (including stems and apexes) exhibiting full or
partial silencing of stGFP, the infiltrated A. tumefaciens was not
detected, even in undiluted samples. These sensitive assay methods
therefore confirm that A. tumefaciens cells were absent from the
systemic tissue in which stGFP was suppressed. We can also rule
out, based on negative results of a PCR test for GUS DNA, that
there is systemic movement of the NPT:GUS:GFP binary vector
independently of its A. tumefaciens host.
Example 6
[0209] Effect of Reduced Levels of fiNA
[0210] In embodiments in which the fiNA is introduced into the
cytoplasm by means of transcription of a nucleic acid in the
nucleus, the efficient introduction of fiNA in the cytoplasm may
determine the efficiency of the silencing. To verify this the
systemic silencing of GFP was only partial if the GFP constructs
were modified so that the 35S promoter was either deleted or
replaced with the weaker nopaline synthase promoter. The resulting
partial silencing was manifest as small spots on the systemic
leaves of the infiltrated plants in which there was no GFP due to
stGFP. The reduced gene silencing may reflect reduced levels of the
GFP mRNA fiNA in the cytoplasm, owing to reduced transcription
under a weaker promoter.
Example 7
[0211] The Gene Silencing Signal does not Require fiNA
Transcription
[0212] In the second series of experiments the same stGFP plants
were bombarded as young seedlings with gold particles carrying DNA
fragments. When the gold particles carried sequences homologous to
stGFP there was silencing of GFP as described above in the
infiltrated plants after 10 d or more. These experiments revealed
that the foreign nucleic acid need not be transcribed in order to
elicit the systemic gene silencing.
[0213] Constructs/Nucleic Acids Used for Bombardment:
[0214] All experiments described here involve GFP as a target gene
in plants. Each bombardment is performed on 10 plants at the same
time. Plants are small seedlings (usually 1 cm long) grown on AGAR.
The indicated nucleic acids are coated onto gold particles and the
bombardment of the DNA coated gold uses electrostatic acceleration
such as is well known to those skilled in the art.
[0215] Each of the following constructs/nucleic acid has been
tested at least 3 times (30 plants). The ability of the construct
to promote silencing is expressed in term of YIELD. The yield is
calculated on the 10 bombarded plants and corresponds to number of
plants showing clear systemic silencing. Silencing for these
purposes was taken to mean initiation within the plant of the gene
silencing signal, leading to persistent silencing of the adult
plant which was essentially systemic (except in meristematic
tissues and in the pollen and eggs). The systemic silencing
normally becomes apparent within 10 days. post bombardment and is
complete after 28 days.
[0216] 1. {CamV 35S promoter-GFPcDNA-Nos terminator} in PUC19
[0217] This construct gave the most elevated yield of those tested.
Out of 7 independent bombardment experiments (70 plants) the
average yield of silencing is 75%.
[0218] 2. {GFP cDNA} in PUC19/pBluescript (GFP cDNA is 800 bp).
[0219] This construct gives silencing, but with an attenuated
yield. It shows that transcription of the input homologous sequence
(fiNA) is not required for setting the signal and the silencing
throughout the plant.
[0220] Average yield calculated on 4 independent experiments (40
plants): 40%.
[0221] 3. PCR-amplified fragment corresponding to the 5' part of
the GFP cDNA, 400 bp long, no vector.
[0222] This gives silencing, with an average yield of 30%
calculated on the basis on 3 experiments. This shows that even a
portion of the target gene (here approximately the half) is able to
generate silencing. Also, it shows that there is no need of a
plasmid vector to carry the input sequence.
[0223] 4. {3' part of the GFP cDNA, 300 bp long} in PUC19
[0224] This gives silencing with an average yield of 20% calculated
on the basis on 2 experiments only. This shows that (i) potentially
any part of the target sequence can elicit silencing and (ii) the
length and/or homology between the target and the input sequence
may affect the yield of silencing, but that gene silencing can be
achieved with only partial sequences.
[0225] 5. Control experiments
[0226] None of the following constructs led to GFP silencing:
[0227] a. {CamV 35S promoter-GUS cDNA-Nos terminator} in PUC19
tested on 60 plants
[0228] b. {Ubiquitin promoter-GUS cDNA-Nos terminator} in PUC19
tested on 60 plants
[0229] c. {400 bp of PDS cDNA} in PUC19 tested on 40 plants
[0230] d. PUC19 tested on 30 plants
Example 8
[0231] Translocation of the Gene Silencing Signal is Facilitated by
the Expression of a Resident Gene that is Homologous to the
fiNA
[0232] A three-way graft was produced in which the bottom stock
part was an stGFP N.benthamiana plant that had been previously
infiltrated with an NPT:GUS:GFP strain of Agrobacterium as
described in Example 1 and in which there was systemic silencing of
GFP. The upper scion was also from an stGFP transgenic N.
benthamiana but that had not been infiltrated and in which stGFP
was not silenced. The intermediate scion was from a non-transgenic
N.benthamiana i.e. a plant which did not comprise the GFP gene or a
sequence homolog thereof. The upper part of this grafted plant
remained green fluorescent over several weeks indicating that the
signal did not move through the non transgenic segment that lacked
a gene with homology to the fiNA. However, in Example 14 below, it
was shown that after 6 weeks the signal did spread accross the
graft junction in a number of cases, indicating that transcription
of a homologous gene is not an absolute requirement for
transmission.
[0233] In separate experiments it was confirmed that the signal of
gene silencing did move efficiently though the graft union between
the stock and scion of two stGFP plants.
Example 9
[0234] TIGS is Stably Maintained whereas VIGS is not
[0235] stGFP N. benthamiana plants were infected with PVX-GFP to
elicit `viral induced gene silencing` (`VIGS`) of GFP or were
infiltrated with an NPT:GUS:GFP strain of Agrobacterium to induce
TIGS. The VIGS had extended through most of the upper part of the
plant by 21 days post inoculation and associated with this there
was suppression of PVX-GFP below the levels detectable northern
blotting. By 35 days the uppermost regions of the plants regained
green fluorescence indicating that VIGS had diminished although
there was no reappearance of the PVX-GFP. This suggests that VIGS
requires continued presence of the initiator virus.
[0236] In the plants exhibiting TIGS of GFP the initial spread of
gene silencing was at the same rate as in the plants showing VIGS.
However, in these plants the silenced condition was permanent for
42 days or longer after the initial infiltration. All upper parts
of the plant except the meristems, pollen and eggs exhibited
silencing of GFP. The silenced condition remained even if the
infiltrated leaf was detached. Thus TIGS does not require continued
presence of the fiNA.
Example 10
[0237] The TICS can be Maintained in Regenerated Plants
[0238] It was even possible to regenerate stGFP silenced plants by
tissue culture of leaf disc explants from the upper parts of the
TIGS plants. These regenerated plants showed silencing of stGFP in
the same way as the original infiltrated plants.
[0239] The regeneration of gene silencing plants may be carried out
by methods analogous to those used by those skilled in the art for
regeneration of plants. Briefly, the regeneration was carried out
as follows:
[0240] 1) take a leave from a silenced plant (silenced by TIGS)
[0241] 2) sterilize it for 30 minutes in 7.5% domestos
[0242] 3) cut the leaf into small squares
[0243] 4) put this square into "MS media plus vitamins" (Sigma)
supplemented with 1.0 mg/ml of 6-BAP, 0.1 mg/ml of NAA, 3%
sucrose.
[0244] 5) after 2-3 weeks the squares start to produce shoots that
are completely silenced (except on meristems).
[0245] 6) transfer these shoots to unsupplemented "MS media plus
vitamins"
[0246] 7) allow the plants to grow
[0247] The post transcriptional silencing was evidenced by a
continued resistance to viral constructs sharing homology with the
silenced gene, but no resistance to other viral constructs which
did not include a GFP sequence or homolog thereof.
Example 11
[0248] The TIGS Signal has the Characteristics of Nucleic Acid
[0249] GFP transgenic N.benthamiana were harvested at 10-20 d post
infiltration with the NPT:GUS:GFP strain of agrobacterium and the
leaves in which GFP expression was silenced were homogenised in
phosphate buffer (50 mM pH7.0). The homogenate was then applied to
the leaves of GFP N.benthamiana that had not previously been
infiltrated and in which GFP expression was not silenced. The
procedure for application of the sap was the same as standard
procedures used to inoculate plants with virus-infected sap: the
leaves were first dusted with carborundum. A drop of sap (20 uL)
was applied to the leaves and the leaves were rubbed gently by hand
to generate abrasions through which the sap components could enter
the cells. After five minutes the leaves were drenched with water
so that residual sap would not have a toxic effect.
[0250] By 20 days post treatment the GFP expression was largely
unaffected. However there were several (5-20) small regions on each
plant in which GFP expression (diagnosed by absence of green
fluorescence under UV light) was absent. These regions varied in
size between 1 and 10 mm diameter. There were no regions of GFP
suppression if the extracts were taken from GFP N.benthamiana that
had not previously been infiltrated with the NPT:GUS:GFP strain of
agrobacterium or from non transgenic plants.
[0251] The presence of the regions suppressed GFP expression
indicates that the signal of silencing had been isolated in the sap
extracts. We conclude that this signal is a nucleic acid because it
was heat labile (100.degree. C. 5 min) and was not destroyed when
the sap was extracted with phenol/chloroform. The signal was also
not destroyed by DNAase treatment of the sap indicating that it may
be RNA.
Example 12
[0252] TIGS is not the Same as VIGS
[0253] stGFP N.benthamiana were inoculated with a mutant
derivatives of PVX-GFP in which the CP gene had been deleted.
Because of this mutation the virus was disabled for cell to cell
movement. Whereas the intact PVX-GFP elicited systemic silencing of
the GFP transgene in a manner consistent with the systemic spread
of the virus throughout the plants, these mutant constructs failed
to do so. This failure was not because the inocula were inactive:
the same inocula applied to transgenic plants expressing the PVX CP
produced croning infection loci due to complementation of the CP
mutation in the virus.
[0254] This result shows that VIGS did not produce a signal that
moved long distances beyond the infected cells: the systemic effect
of VIGS must be because the virus can move between cells. In
contrast, TIGS, despite the involvement of a fiNA that is not
endowed with cell to cell movement properties, does produce a long
distance signal as described in the above examples.
[0255] In Examples 13 to 19 below, the stably integrated GFP
transgene (trGFP) is referred to as "intGFP", while the transient
FINA GFP (trGFP) is referred to as "epiGFP".
Example 13
[0256] The Gene Silencing Signal Requires Uptake of the Transgene
Coding for the fiNA: The Role of T-DNA Transfer and
Transcription
[0257] As discussed in Example 3 above, transfer of the T-DNA from
A. tumefaciens to the plant cell nucleus is a process that requires
expression of the bacterial virulence (Vir) genes. To determine
whether TIGS requires transfer of epiGFP into plant cells, the
previously described experiments were repeated under conditions in
which the A. tumefaciens Vir gene activity was either up-or
down-regulated. To down-regulate the Vir genes, the A. tumefaciens
culture was incubated prior to infiltration in the absence of
acetosyringone, which is an inducer of Vir genes (Ream, 1989).
Up-regulation of Vir genes was achieved by use of a hypervirulent
strain of A. tumefaciens (cor308) carrying duplicate copies of
VirG, VirE1 and VirE2 (Hamilton et al., 1996). VirG is the
transcription activator of all Vir functions; VirE1 and VirE2 are
involved in T-DNA transfer and stabilisation in the cytoplasm.
VirE2 is also required for nuclear targeting of the T-DNA (Zupan
and Zambryski, 1997).
[0258] Both approaches indicated that TIGS requires Vir gene
function. Thus, with N:G:G, A. tumefaciens cultures produced in the
absence of acetosyringone, the onset of TIGS was inconsistent from
plant to plant and was much slower (40 d post infiltration) than
with cultures prepared in the presence of acetosyringone (around 20
d post infiltration) as shown in Table I:
2TABLE 1 Effect of A. tumefaciens Vir genes and epiGFP promoters on
TIGS. No. No. hyper- silenced silenced aceto- virulent No. plants
plants Binary syringone strain of by by vector induction cor308
plants 7 dpi 20 dpi N:G:G + + 30 26 30 N:G:G + - 100 0 100 N:G:G -
- 30 0 0 N:G + - 30 0 30 N:Gnos + - 30 0 30 N:G .DELTA. + - 30 0 30
"dpi" is an abbreviation for d post infiltration. A plant was
considered as silenced if there was loss of GFP fluorescence
surrounding the veins of systemic leaves.
[0259] Furthermore, when cultures were produced without
acetosyringone, TIGS was restricted to small discrete zones in the
upper parts of the infiltrated plants and was much less extensive
than in plants infiltrated with acetosyringone-treated cultures.
Conversely, the use of a hypervirulent A. tumefaciens (cor308) host
of the N:G:G construct accelerated the development of TIGS by
several days: TIGS initiated with this strain started at 7 d post
infiltration and was complete by 10 d (Table I).
[0260] The influence of Vir gene expression indicates that TIGS
requires transfer of T-DNA into plant cells. However, these
experiments do not show whether epiGFP transcription is required.
To address this issue, the infiltration experiments were repeated
with derivatives of the pBin35S:GFP construct (FIG. 1) in which the
35S promoter of epiGFP was either replaced with the nos promoter
(N:Gnos, FIG. 4). The nos promoter is much weaker than the 35S
promoter of CaMV (Harpster et al., 1988). We also agroinfiltrated
with a construct without a GFP promoter (N:G.DELTA., FIG. 4). In
several experiments (Table I) there was TIGS of intGFP when the
constructs were infiltrated into transgenic N. benthamiana plants.
With both of these constructs, TIGS developed as quickly as with
the original N:G:G construct (Table I), indicating that the
presence of a promoter upstream. epiGFP is not required for
initiation of TIGS.
Example 14
[0261] Propagation of the TIGS Signal
[0262] Symplastic movement of molecules in plants can occur from
cell-to-cell through plasmodesmata and/or through the phloem (Lucas
et al., 1989). To investigate which of these routes is used to
propagate TIGS, we monitored intGFP silencing after infiltration of
plants with the N:G:G strain of A. tumefaciens. At 20 d
post-infiltration of lower leaves, the silencing was manifest in
systemic, young developing leaves and was very pronounced in the
shoot tips. There was also silencing in upper leaves that were
already expanded at the time of infiltration but it was fainter and
less extensive than in the young developing leaves. In contrast,
the leaves immediately above and below the infiltrated leaves
remained fully green fluorescent. At 30 d post-infiltration the
stem and roots below the infiltrated leaves also showed intGFP
silencing, thus indicating that the movement of the TIGS signal was
bi-directional in the plant. In terms of speed and spatial
distribution, this pattern of spread is similar to the movement of
viruses in the phloem, from source to sink leaves (Leisner and
Turgeon, 1993).
[0263] Additional support for phloem transport of the signal comes
from experiments in which intGFP plants were infiltrated with the
N:G:G strain of A. tumefaciens in just a single leaf. These
experiments differ from those described previously in which the
plants were infiltrated in two or three leaves on opposite sides of
the plant. At 1 month post-infiltration, intGFP silencing in the
stem was restricted to the side of the original infiltrated leaf.
Shoots that had emerged from the silenced portion of the stem were
silenced, while those emerging from the non-silenced half were not.
This pattern of signal movement was strikingly similar to the
spread of a phloem-translocated dye and of a systemic virus in N.
benthamiana (Roberts et al., 1997).
[0264] The development of silencing in leaves was also similar to
the translocation of a phloem-transported dye through class I, II
and III veins of N. benthamiana leaves (Roberts et al., 1997). In
systemic leaves that had already expanded at the time of
infiltration, intGFP silencing was initially (20 d post
infiltration) in regions surrounding the main veins and later (27 d
post-infiltration) in regions around the minor veins. At 34 d
post-infiltration, intGFP silencing spread across the whole lamina
of the leaf thus indicating that there was cell-to-cell movement of
the silencing signal as well as translocation through the phloem.
This cell-to-cell movement is likely to occur through plasmodesmata
because there was no intGFP silencing in the stomatal guard cells
which would have been symplastically isolated before the signal
moved into the leaf (Ding et al., 1997; McLean et al., 1997).
However, in leaves that developed after the signal had spread to
the apical growing point, intGFP was uniformly silenced, even in
the stomatal guard cells. From this observation, we conclude that
guard cells are competent for gene silencing provided that the
signal invades leaves early in their development, before symplastic
isolation of the guard cells.
[0265] To further investigate the movement of the TIGS signal, we
carried out grafting experiments similar to those described
previously to characterise systemic spread of transgene-induced
gene silencing (Palauqui et al., 1997; see also Example 8 above).
Specifically, we wished to determine whether the signal could move
through cells in which there were no genes with sequence similarity
to the target of TIGS. First, to confirm that the signal is graft
transmissible, we wedge-grafted non-silenced intGFP scions onto
intGFP rootstocks exhibiting TIGS. TIGS spread into the scions
about four weeks after the graft union in 10 out of 16 graftings
tested. As with the intact N:G:G infiltrated. plants, intGFP
suppression in the scions was first manifest around the veins of
newly emerging leaves and later became widespread on all vegetative
parts of the scions.
[0266] Having thus established that the signal in this system is
graft transmissible, we produced three-way grafts comprising a
silenced intGFP rootstocks, an intermediate section of nt stem and
a top scion of a non silenced intGFP plant. Using this procedure,
we observed silencing occurring in the intGFP top scions about six
weeks after the graft junctions in 5 out of 11 graftings tested.
This result demonstrates that the TIGS signal could move long
distances and through cells in which there is no corresponding
nuclear gene, as the intermediate section had no GFP sequence.
[0267] In a separate series of experiments, the speed of signal
movement was assessed by removal of the infiltrated leaf 1, 2, 3, 4
or 5 days after infiltration with the N:G:G strain of A.
tumefaciens. In these experiments, there was systemic loss of
intGFP fluorescence (i.e. TIGS) in 10% of the plants if the
infiltrated leaf was removed 2 d post-infiltration. A progressively
higher proportion of plants exhibited TIGS when the infiltrated
leaf was removed 3 d or later (FIG. 5). From these data, we
conclude that production and translocation of the signal occurs
within 2 or 3 d post-infiltration.
[0268] In plants that exhibited TIGS after removal of the
infiltrated leaf, loss of intGFP developed as quickly and persisted
for as long as in the intact plants. Furthermore, in all of the
N:G:G-infiltrated plants, TIGS of intGFP persisted for more than
100 d post infiltration. Even in these old plants, TIGS continued
to be induced in the newly emerging leaves, despite the loss of the
infiltrated leaf due to senescence. Considering these observations,
we propose that propagation of the TIGS signal occurs via a relay
process. The cells receiving the signal from the infiltrated leaf
would become a secondary source of the signal so that maintenance
of PTGS in the plant would become independent of the infiltrated
leaf.
Example 15
[0269] TIGS in Meristematic Cells
[0270] Although there was extensive and persistent silencing of
intGFP in the N:G:G-infiltrated N. benthamiana plants the floral,
vegetative and root apexes always remained non silenced i.e. green
fluorescent (see below). Either the signal of gene silencing cannot
enter dividing cells or dividing cells lack the potential to
silence intGFP. To address these alternatives, we cultured leaf
explants from plants exhibiting TIGS of GFP. The explants were
cultured on media promoting shoot regeneration. It was expected
that intGFP silencing would be lost if dividing cells lack the
potential to silence intGFP.
[0271] In shoots and leaves regenerating from these explants there
was no intGFP fluorescence in most parts of the organs, whereas
shoots regenerated from non-silenced plants remained fully green
fluorescent. From these observations we conclude that silencing was
not induced by the culture procedures but that it could persist
through in vitro organogenesis. However the extreme apical regions
of the silenced shoots were green fluorescent, as in the progenitor
plants. When the shoots developed into plants with roots, the root
tips and apical zones of vegetative and floral shoots were also
green fluorescent. This apical fluorescence was not present in
nontransformed plants and is therefore bona fide GFP rather than an
artefact due to the presence of fluorescent compounds. These
results indicate that TIGS can be maintained in, or can pass
through dividing cells but that the gene silencing mechanism is not
effective in meristematic tissues of the plant, presumably because
the signal of TIGS cannot reach those regions. These findings
reinforce the striking similarities between the movement of the
TIGS signal and the movement of plant viruses, which are generally
excluded from meristems (Matthews, 1991).
Example 16
[0272] Biolistic Activation of TIGS
[0273] In the experiments described above, epiGFP was delivered by
infiltration of A. tumefaciens into leaves of intGFP transgenic
plants. To evaluate an alternative means of epiGFP delivery, we
bombarded small seedlings (5-7 mm long) with gold particles coated
with the pUC 35S-GFP plasmid (FIG. 6A). This plasmid is based on
pUC19 and has the complete 35S-GFP cassette from pBin35S-GFP (FIG.
6A). Three weeks after bombardment, 75% of the plants showed TIGS
of intGFP. As in the agroinfiltrated plants, there was TIGS of
intGFP throughout the plant except in the growing points of the
shoots and roots. This result was consistent and reproducible in
seven independent experiments, involving a total of 70 plants (FIG.
6A). TIGS of intGFP was never observed when intGFP plants were
bombarded with uncoated gold particles or plasmid that did not
carry the GFP ORF (data not shown). In order to estimate the number
of cells that receive the delivered DNA, we also bombarded
seedlings with a pUC 35S-GUS plasmid and stained the whole plants
for GUS activity three days later. We found that, on average, less
than 8 randomly distributed individual cells exhibited blue
staining in whole seedlings. These results indicate that TIGS does
not depend on the delivery method of epiGFP and that very localised
events can initiate production and spread of the sequence-specific
signal of gene silencing.
[0274] Bombardment of linear fragments of GFP cDNA without a
promoter, either intact or as 5' or 3' fragments, also led to TIGS.
The two fragments of GFP (..P and G..; FIG. 6A) were both less
efficient initiators of TIGS than the intact cDNA (GFP, FIG. 6A)
thus indicating that initiation of TIGS is affected by the length
of epiGFP. To further investigate importance of epiGFP length, a
series of PCR-amplified fragments were produced. These fragments
were all of the same physical length (500 bp) but had 3'
co-terminal fragments of GFP cDNA of varying length. The non-GFP
DNA in these fragments was from pBluescript. Equal amounts of each
fragment were bombarded into 50 plants in 5 independent
experiments. The results, summarised in FIG. 6B, clearly show that
the efficiency of TIGS initiation is determined by the length of
homology between the epiGFP and the intGFP.
Example 17
[0275] TIGS Requires an Interaction of epiGFP and intGFP
[0276] In principle, TIGS could be initiated by epiGFP alone.
Alternatively it could be initiated following an interaction
between epiGFP and intGFP DNA or intGFP RNA. To distinguish between
these possibilities, we have further characterised the targets of
TIGS following bombardments with 5' or 3' linear fragments of GFP
cDNA (GF. and ..P, FIG. 7A). If TIGS was initiated only by the
bombarded DNA, the target would be confined to the region (i.e.
sequence) of the bombarded DNA. However, a target that was
determined following an interaction with intGFP could extend beyond
the regions of the bombarded DNA. The assay for TIGS target sites
involved inoculation of PVX-GF and PVX-P (FIG. 7A) to intGFP plants
that had been bombarded 21 d previously with GFP, ..P or GF. (FIG.
7A, diagram). Virus inoculations were made to leaves exhibiting
TIGS of intGFP and accumulation of the viral RNA was assessed by
northern analysis of RNA samples taken from the inoculated leaves
at 8 d post inoculation (FIG. 7A, diagram).
[0277] Northern analyses of inoculated leaves showed that
accumulation of PVX-GFP and PVX-GF (FIG. 7B, lanes 8-10 and 12-14)
was lower (by at least ten fold) in leaves exhibiting TIGS of
intGFP than in the leaves of non transformed plants (FIG. 7B lanes
6) or in the leaves of intGFP plants that had been previously
bombarded with uncoated gold particles (FIG. 7B, lanes 6, 7 and
11). It was particularly striking that silencing induced by epi..P
could target PVX-GF (FIG. 7B, lanes 13 and 14) and, conversely,
silencing induced by epiGF. could target PVX-P (FIG. 7A, data not
shown). As there is no sequence overlap between the GF. and ..P
fragments involved in these experiments, we conclude that the
target site of TIGS is determined following an interaction of
epiGFP and intGFP DNA or intGFP RNA.
[0278] Moreover, the influence of the bombarded DNA can extend both
in the 3' (from GF to P) or in the 5' (from P to GF) direction.
Example 18
[0279] Spontaneous TIGS
[0280] Among our transgenic N. benthamiana lines, we identified one
line (15a) in which intGFP systemic silencing occurs spontaneously.
As with many examples of PTGS in plants, the silencing phenotype of
line 15a is influenced by transgene dosage (Hobbs et al.,
1993)(Mueller et al., 1995). Progeny of 15a with a hemizygous GFP
transgene remained green fluorescent (data not shown) whereas those
with a homozygous transgene exhibited intGFP silencing. The
development of silencing in these plants followed the same pattern
as in infiltrated and bombarded plants. Initially, the plants were
uniformly green fluorescent but, at the four leaf stage, spots of
red fluorescence developed around the veins of the upper leaves.
Eventually, these regions spread along the length of the veins and
throughout the plant as for TIGS induced by bombardment or
infiltration of A. tumefaciens. We confirmed by grafting
experiments the involvement of a systemic signal of silencing in
line 15a. In addition, intGFP silencing was not observed in 15a
meristems, as in plants exhibiting TIGS. From these observations we
conclude that the bombardment or A. tumefaciens infiltration mimic
processes that can take place spontaneously in transgenic
plants.
Example 19
[0281] TIGS from Viral Constructs-Effect of Viral Proteins
[0282] A number of constucts were prepared based on the PVX-GFP
amplicon constructs of PCT/GB98/00442, but included various
deletions in the PVX or transgene regions. GFP was monitored under
UV light.
[0283] Construction of plasmids
[0284] Referring to FIGS. 8 to 10.
[0285] The constructs were based upon pPVX209 (in which PVX-GFP is
inserted into a pUC19 plasmid under a 35S promoter) which in turn
was based on pPVX204 (see Baulcombe et al, 1995) but including an
additional SacI site at the 5' side of the promoter.
[0286] Plasmid pPVX210A, which included a coat protein (CP)
deletion, was generated from pPVX209.
[0287] Plasmids pCL100, pCL101 and pCL102, which included further
deletions in the `triple block` of cell-to-cell movement proteins
(25K, 12K and 8K), were generated from pPVX210A.
[0288] Plasmid pCL105, which included further deletions in the
replicase (Rep) region, was generated from pCL100.
[0289] Plasmid pCL106 included a PCR fragment from pPVX210A to
restore GFP function.
[0290] FIG. 10 shows how the pUC19 constructs were inserted into
the Agrobacterium binary vector plasmid pSLJ755/5. These constructs
are numbered as per Table 2:
3TABLE 2 List and description of minimal constructs created (in
bold type), and progenitor constructs. Description of Construct in
Construct in construct pUC19 pSLJ755/5 PVX-GFP-CP pPVX209 pPVX211
PVX-GFP pPVX210A pPVX212A PVX-.DELTA.B-FP pCL102 pCL112
PVX-.DELTA.GV-FP pCL101 pCL111 PVX-.DELTA.TGB-FP pCL100 pCL110
PVX-.DELTA.Rep.DELTA.TGB-FP pCL105 pCL115 PVX-.DELTA.TGB-GFP pCL106
pCL116 PVX-GUS pA500 -- PVX-.DELTA.B-GUS pCL104 pCL114
PVX-.DELTA.TGB-GUS pCL103 pCL113 .DELTA.B:TGB deletion retaining 5'
UTR of TGB and 5' end of 25-kDa protein gene .DELTA.GB:TGB deletion
retaining the 5' UTR of TGB .DELTA.TGB:TGB deletion retaining only
the first 3 nt. of the UTR of TGB
[0291] The positive strand sequences for some of the constructs are
given in FIG. 11.
[0292] Production and Replication of Viral RNA in Infected
Cells
[0293] This was confirmed in wild-type plants. Owing to the fact
that movement proteins were disabled in most constructs, a standard
infection assay could not be used. However, Agrobacterium strains
could be infiltrated into the leaves of N. benthamiana to infect a
high density of cells in a region of the infiltrated leaf. Northern
analysis of RNA isolated from the infiltrated zone of the leaf
showed that there was replication of the transcripts from
constructs 212A, 110, 112 and 116 as would be predicted from their
structure. The 116 construct, which included the strong CP
sub-genomic promoter, produced more subgenomic RNA than other
constructs. Similarly, under UV light the 212A and 116 gave bright
green fluorescence--brighter than a 35S-GFP construct (pA1036--not
shown) which is again consistent with replication of the
constructs.
[0294] Use of Constructs to Generate TIGS
[0295] Silencing of a GFP-transgenic plant was assessed as
described in earlier examples in relation to non-replicating
35S-GFP constructs. The constructs described above were introduced
into Agrobacterium tumefaciens (strain GV3101) and cultures were
allowed to grow in the presence of acetosyringone. The leaves of a
GFP transgenic plant were then infiltrated with the agrobacterium,
as described in Example 1, and gene silencing was monitored over a
four week period by UV illumination of the plants. The PVX-GFP
construct in pPVX212A (see Table 2) was a less efficient silencer
sequence than the PVX-Drep-DTGB-FP construct whereas the
PVX-DTGB-FP (pCL110) and PVX-DTGB-GFP (PCL116) were more efficient
than PVX-Drep-DTGB-FP. From these data we conclude that the ability
to produce a replicating RNA, although not necessary to perform the
invention, greatly enhances the efficiency of silencing but that
the viral movement proteins (encoded in pPVK212A but not in
PVX-DTGB-FP (pCL110) and PVX-DTGB-GFP (PCL116)) are antagonists of
gene silencing. We conclude that constructs for gene silencing
should be constructed so as to avoid expression of movement
proteins that may antagonise the gene silencing mechanism.
[0296] Discussion of Examples 13-19
[0297] These Examples employ TIGS to further dissect PTGS into
separate initiation, spread and maintenance stages. In this
discussion we assess the likely molecular mechanisms of these
different stages and the natural role of gene silencing in plants
and other organisms. We consider the spread stage first, because
the inferences about the likely nature of the signal of gene
silencing influence the subsequent discussion about the initiation
and maintenance stages of gene silencing.
[0298] Systemic Spread of TIGS
[0299] Systemic spread of TIGS is remarkable in that it involves a
sequence specific signal: TIGS initiated against GFP was specific
for intGFP or viral GFP RNAs whereas TIGS against GUS was specific
for GUS RNAs. This pattern of sequence specificity rules out the
possibility that TIGS is a non specific wounding signal or that the
specificity is related to the 35S promoter. Therefore it is likely
that the signal of TIGS is specific for the transcribed regions of
the target gene and that the specificity determinant includes a
nucleic acid component. Thus, the signal for TIGS of GFP is likely
to contain GFP RNA or DNA, whereas the signal for TIGS of GUS or
other genes would contain the corresponding alternative nucleic
acid species. From its pattern and speed of systemic spread, we
confirm that this putative nucleic acid is able to move not only
from cell to cell through plasmodesmata but also systemically
through the phloem, as proposed in a recent review article
(Jorgensen et al., 1998).
[0300] There are precedents in plants for endogenous nucleic acids
that move between cells. For example, there are mobile nucleic
acids encoded by nuclear genes including the mRNA for a
transcription factor (Lucas et al., 1995) and a sucrose transporter
mRNA (Kuhn et al., 1997). However in both of these examples the
movement is only between cells: there is no evidence for long
distance movement, as with the signal of TIGS. The mobile nucleic
acids that are most obviously comparable to the putative signal of
gene silencing are viroids. Like the signal of silencing (FIG. 5),
these small non-coding RNA species move systemically within a
period of a few days after inoculation (Palukaitis, 1987). For both
viroids and TIGS, the route of movement involves cell-to-cell
through plasmodesmata and long distance spread through the phloem
(Palukaitis, 1987; Ding et al., 1997).
[0301] From the leaf detachment experiment (FIG. 5), we infer that
movement of the signal involves a relay. Some cells receiving the
epiGFP were the primary source of initial signal production.
However, once the signal moved out of the bombarded or infiltrated
leaves this primary source was no longer required and there must
have been cells elsewhere in the plant that were a secondary source
of the signal molecule. We do not know the maximum distance between
primary and secondary relay points in signal production but, from
the three-way grafting experiments, we can infer that distances of
several centimetres or more could be involved.
[0302] Also of interest is the deduced effect of the viral movement
proteins on the spread (or possibly the initiation) of the signal
(Example 19). This suggests that, while it may be desirable to have
replicating constructs as a source of the fiNA, it may also be
desirable to limit these to only a replicase, plus associated cis
acting elements and targeting sequence, all under the control of a
suitable plant promoter.
[0303] Initiation and Maintenance of Signal Production
[0304] TIGS was initiated in the bombarded or infiltrated cells
that received epiGFP. It is unlikely, although it cannot formally
be ruled out, that TIGS required transcription of the introduced
DNA because the presence of a promoter had little or no effect on
the initiation of TIGS (Table I above, plus also FIGS. 6 and 7). It
is also unlikely that the signal was derived directly from the
introduced DNA because TIGS induced by ..P resulted in targeting of
the GF. component of GFP RNA. Similarly, bombardment of GF.
produced silencing targeted against ..P (FIG. 7). Our
interpretation of these data is that TIGS was initiated by an
interaction between intGFP and epiGFP and that the target of TIGS
was determined by intGFP. The influence of epiGFP length on TIGS is
also consistent with an homology-dependent interaction between
epiGFP and intGFP (FIG. 6B).
[0305] We recognise that this proposed interaction of epiGFP could
involve intGFP DNA or RNA and that our data do not provide
conclusive evidence for either. However, we consider that an
interaction with DNA is more likely than with RNA because in N:G:G
and N:G.sub..DELTA. the GFP transgene was orientated 5' to 3'
towards the left border of the T-DNA (FIG. 4B). The orientation of
this gene is relevant because the T-DNA of A. tumefaciens is
transferred into plant cells as single-stranded DNA with the right
border of the T-DNA at the 5' end (Zupan and Zambryski, 1997). This
strand-specific transfer mechanism would not allow the single
stranded epiGFP DNA to interact with intGFP RNA because both
molecules have the same polarity. However, the single-stranded
epiGFP T-DNA would have the potential to interact with homologous
DNA in the genome, irrespective of the orientation of the insert.
Consistent with a DNA-level interaction we have also shown that
single stranded GFP DNA with the polarity of intGFP RNA can
initiate TIGS after bombardment (data not shown).
[0306] How could a DNA-level interaction of epiGFP and intGFP
result in TIGS ? We propose here a mechanism similar to an earlier
ectopic pairing model of PTGS in transgenic plants. According to
this model, the ectopic interactions of epiGFP and intGFP would
perturb transcription of the intGFP and lead ultimately to
formation of anti-sense RNA (Baulcombe and English, 1996). This
antisense RNA would target GFP RNAs for degradation and would be a
component of the signal molecule. If the DNA-level interaction led
to aberrant transcription of the non-coding strand of the genomic
DNA, this antisense RNA could be a product of direct transcription
from the genome. Alternatively the anti-sense RNA could be produced
indirectly by a host-encoded RNA-dependent RNA polymerase, as
suggested originally to explain transgene mediated PTGS (Lindbo et
al., 1993). In this scenario the RNA-dependent RNA polymerase would
produce anti-sense RNA using aberrant sense RNA as template.
[0307] The proposal that there could be ectopic interactions of
homologous DNA leading to aberrant transcription is based on
precedents from plants, animals and fungi. In one example, with
.beta.-globin genes in mammalian cells, an ectopic DNA interaction
was demonstrated directly by the co-localisation of a transfected
plasmid with the homologous sequence in the genome (Ashe et al.,
1997). In plant and fungal cells, the ectopic interaction could
only be inferred indirectly from the modified methylation pattern
of the homologous DNAs (Hobbs et al., 1990; Barry et al., 1993). We
envisage that these ectopic interactions may lead to aberrant RNA
either by arrest of transcription leading to prematurely truncated
RNA species, as shown in Ascobolus immersus (Barry et al., 1993).
Alternatively the ectopic interactions could cause aberrant
extension of transcription, as in the example with .beta.-globin
genes (Ashe et al., 1997).
[0308] A DNA-level interaction leading to aberrant transcription
provides a convenient explanation for the persistence and
uniformity of TIGS in the plant. For example, it would explain why
the silenced state was stable during the lifetime of the silenced
plant. The interaction of the introduced DNA or the signalling
molecule at the DNA level could lead to an epigenetic change
involving DNA methylation or chromatin modification that could
persist even if the silenced cell was no longer receiving
signal.
[0309] Consistent with this hypothesis, it has been shown that
viroid RNAs can direct sequence-specific DNA methylation in
transgenic plants (Wassenegger et al., 1994). Furthermore,
transcription of the epimutated DNA or chromatin could provide an
amplification step in TIGS. This amplification would explain the
relay of TIGS and why the signal does not get diluted as it moves
away from the initially infiltrated or bombarded cells.
[0310] TIGS Compared to other Examples of Gene Silencing in Plants
and Animals.
[0311] Many examples of gene silencing in plants may be similar to
TIGS. For example, in transgenic plants exhibiting
transgene-induced PTGS, it is clear from grafting experiments
(Palauqui et al., 1997) and from the spatial patterns of silencing
that there is an extra-cellular signal of silencing. In addition we
consider it likely that gene silencing with a delayed onset, for
example with GUS transgenes, may also involve systemic spread of a
signal (Elmayan and Vaucheret, 1996). In these instances, we
envisage that the process may be initiated in just one or a few
cells in the plant, as shown here in TIGS, and that the spread of
the signal accounts for the gene silencing throughout the
plant.
[0312] The involvement of a signal molecule means that genetic or
epigenetic variations in single cells could influence the level of
gene silencing throughout the plant. Consequently, the analysis of
transgenes in whole plant DNA may not be an accurate indicator of
factors that influence PTGS. For example, in a previous study based
on analysis of whole plant DNA, it was concluded that single copy,
hemizygous transgenes can activate PTGS (Elmayan and Vaucheret,
1996). This conclusion was difficult to reconcile with the
suggestion that ectopic DNA interactions initiate PTGS (Baulcombe
and English, 1996)
[0313] However, the results presented here show that the PTGS in
the whole plant could have been initiated in individual cells
carrying multiple copies of the transgene due to DNA
endoreduplication or chromosomal rearrangements. Therefore, even in
plants having only one copy of a silencer transgene in the genome,
it cannot be ruled out that PTGS was initiated by ectopic
interactions of homologous DNA.
[0314] Most analyses of PTGS have involved plants and fungi.
However there are now reports of gene silencing phenomena in
animals that appear similar to the plant and fungal systems. For
example, in Drosophila melanogaster there is co-suppression of
transgenes and endogenous genes as in petunia, tobacco and other
plant systems (PalBhadra et al., 1997). However, more striking, are
two recent examples of gene silencing in Caenorhabditis elegans
(Fire et al., 1998) and in Paramecium (Ruiz et al., 1998a). The
"genetic interference" described in C. elegans is initiated by
double stranded RNA (Fire et al., 1998) rather than DNA, as
described here, but otherwise shares many common features with TIGS
including the ability to spread by a relay mechanism through the
affected organism. In Paramecium, microinjection of plasmids
containing sequences of a gene led to homology-dependent silencing
of the corresponding gene in the somatic macronucleus (Ruiz et al.,
1998a). As described here for TIGS, the silencing effect could be
initiated with plasmids containing only the coding region of the
gene and was stably maintained throughout vegetative growth of the
organism. Perhaps the similarity between TIGS, the induced
silencing in Paramecium and the effect of double stranded RNA in C.
elegans reflects the existence of a ubiquitous mechanism in plants
and animals that is able to specifically target aberrant RNA. This
possibility fits well with the suggestion that RNA
double-strandedness is a possible aberrance required for initiation
of PTGS in transgenic plants (Metzlaff et al., 1997).
[0315] A Role for TIGS in Plants?
[0316] In addition to the previously made suggestion that TIGS
reflects a protection mechanism in plants against viruses and
transposons (Voinnet and Baulcombe, 1997--see also above), we
consider it possible that TIGS also represents a natural signalling
mechanism in plant development. These proposals were anticipated in
an insightful review written in 1982 suggesting that viroids
exploit a natural mechanism of RNA signalling (Zimmern, 1982). We
consider it is possible, for example, that TIGS-like signalling may
be implicated in the control of flowering in plants. It is known
from classical experiments that there is a graft transmissible
signal of flowering (florigen) which has many of the predicted
attributes of a natural manifestation of TIGS (Poethig, 1990). Like
the TIGS signal, florigen does not correspond to any of the
conventionally characterised hormones or other signalling molecules
in plants but it does move systemically to produce an epigenetic
switch (Bernier, 1988; Colasanti et al., 1998). With florigen the
epigenetic switch is associated with the transition from the
vegetative to the flowering state of the plants and in TIGS, gene
silencing can be considered as an epigenetic event. In some
instances changes in DNA methylation have been implicated in floral
commitment (Poethig, 1990). Perhaps florigen and the putative
signal of TIGS are similar types of mobile RNA. This RNA might have
the characteristics of viroid RNA that allow it to move
systemically in plants and direct sequence specific DNA methylation
(Wassenegger et al., 1994). In the case of florigen the target DNA
might be sequences controlling the transition from the vegetative
to the flowering state.
REFERENCES
[0317] 1. Covey, S. N., Al-Kaff, N. S., Langara, A. & Turner,
D. S. Plants combat infection by gene silencing. Nature 385,
781-782 (1997).
[0318] 2. Ratcliff, F., Harrison, B. D. & Baulcombe, D. C. A
similarity between viral defense and gene silencing in plants.
Science 276, 1558-1560 (1997).
[0319] 3. Assaad, F. F., Tucker, K. L. & Signer, E. R.
Epigenetic repeat-induced gene silencing (rigs) in arabidopsis.
Plant Molecular Biology 22, 1067-1085 (1993).
[0320] 4. Boerjan, W., Bauw, G., Van Montagu, M. & Inz, D.
Distinct phenotypes generated by overexpression and suppression of
S-Adenosyl-L-Methionine synthetase reveal developmental patterns of
gene silencing in tobacco. Plant Cell 6, 1401-1414 (1994).
[0321] 5. Matzke, M. A. & Matzke, A. J. M. How and why do
plants inactivate homologous (trans)genes? Plant Physiol. 107,
6679-685 (1995).
[0322] 6. Baulcombe, D. C. & English, J. J. Ectopic pairing of
homologous DNA and post-transcriptional gene silencing in
transgenic plants. Current Opinion In Biotechnology 7, 173-180
(1996).
[0323] 7. Ingelbrecht, I., Van Houdt, H., Van Montagu, M. &
Depicker, A. Posttranscriptional silencing of reporter transgenes
in tobacco correlates with DNA methylation. Proc. Natl. Acad. Sci.
USA. 91, 10502-10506 (1994).
[0324] 8. Elmayan, T. & Vaucheret, H. Expression of single
copies of a strongly expressed 35S transgene can be silenced
post-transcriptionally. Plant Journal 9, 787-797 (1996).
[0325] 9. Metzlaff, M., O'Dell, M., Cluster, P. D. & Flavell,
R. B. RNA-mediated RNA degradation and chalcone synthase A
silencing in petunia. Cell 88, 845-854 (1997).
[0326] 10. Mlynarova, L., Jansen, R. C., Conner, A. J., Stiekema,
W. J. & Nap, J. P. The MAR-mediated reduction in position
effect can be uncoupled from copy number-dependent expression in
transgenic plants. Plant Cell 7, 599-609 (1995).
[0327] 11. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. &
Prasher, D. C. Green fluorescent protein as a marker for gene
expression. Science 263, 802-805 (1994).
[0328] 12. English, J. J., Davenport, G. F., Elmayan, T.,
Vaucheret, H. & Baulcombe, D. C. Requirement of sense
transcription for homology-dependent virus resistance and
transactivation. Plant Journal (1997).(in press).
[0329] 13. Vaucheret, H. Promoter-dependent trans-inactivation in
transgenic tobacco plants: kinetic aspects of gene silencing and
gene reactivation. C. R. Acad. Sci. Paris. 317, 310-323 (1994).
[0330] 14. Ream, W. Agrobacterium tumefaciens and interkingdom
genetic exchange. Annu. Rev. Phytopathol. 27, 583-618 (1989).
[0331] 15. English, J. J., Mueller, E. & Baulcombe, D. C.
Suppression of virus accumulation in transgenic plants exhibiting
silencing of nuclear genes. Plant Cell 8, 179-188 (1996).
[0332] 16. Baulcombe, D. C., Chapman, S. N. & Santa Cruz, S.
Jellyfish green fluorescent protein as a reporter for virus
infections. Plant J. 7, 1045-1053 (1995).
[0333] 17. Chapman, S. N., Kavanagh, T. A. & Baulcombe, D. C.
Potato virus X as a vector for gene expression in plants. Plant J.
2, 549-557 (1992).
[0334] 18. Jefferson, R. A., Kavanagh, T. A. & Bevan, M. W. GUS
fusions: b-glucuronidase as a sensitive and versatile gene fusion
marker in higher plants. EMBO J. 6, 3901-3907 (1987).
[0335] 19. Matzk, A, Mantell S., & Schiemann J., Localization
of Persisting agrobacteria in transgenic tobacco plants. Mol.
Plant-Microbe Interact. 9, 373-381 (1996).
[0336] 20. Jorgensen, R. A. Cosuppression, flower color patterns
and metastable gene expression states. Science 268, 686-691
(1995).
[0337] 21. Kunz, C., Schob, H., Stam, M., Kooter, J. M. &
Meins, F., Jr. Developmentally regulated silencing and reactivation
of tobacco chitinase transgene expression. Plant J. 10, 4337-450
(1996).
[0338] 22. Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz,
D., Rogers, S. G. & Fraley, R. T. A simple and general method
of transferring genes into plants. Science 227, 1229-1231
(1985).
[0339] 23. Haseloff, J., Siemering, K. R., Prasher, D. C. &
Hodge, S. Removal of a cryptic intron and subcellular localization
of green fluorescent protein are required to mark transgenic
Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA 94,
2122-2127 (1997).
[0340] 24. Jefferson, R. A. Assaying chimeric genes in plants: The
GUS gene fusion system. Plant Mol. Biol. Rep. 5, 387-405
(1987).
ADDITIONAL REFERENCES
[0341] Anandalakshmi, R., Pruss, G. J., Ge, X., Marathe, R., Smith,
T. H., and Vance, V. B. (1998). A viral suppressor gene silencing
in plant. Proc.Natl.Acad.Sci.USA in press.
[0342] Angell, S. M., and Baulcombe, D. C (1995). Cell to cell
movement of potato virus X related by micro-injection of a viral
vector tagged with the b-glucuronidase gene. Plant J.
7,135-140.
[0343] Angell, S. M., Davies, C., and Baulcombe, D. C (1996).
Cell-to-cell movement of potato virus X is associated with a change
in the size exclusion limit of plasmodesmata in trichome cells of
Nicotiana clevelandii. Virology 215, 197-201.
[0344] Ashe, H. L., Monks, J., Wijgerde, M., Fraser, P., and
Proudfoot, N. J. (1997). Intergenic transcription and
transinduction of the human B-globin locus. Genes and Development
11, 2494-2509.
[0345] Barry, C., Faugeron, G., and Rossignol, J.-L. (1993).
Methylation induced premeiotically in Ascobulus: Coextension with
DNA repeat lengths and effect on transcript elongation.
Proc.Natl.Acad.Sci.USA. 90, 4557-4561.
[0346] Baulcombe, D. C. (1996). Mechanisms of pathogen-derived
resistance to viruses in transgenic plants. Plant Cell 8,
1833-1844.
[0347] Baulcombe, D. C., Chapman, S. N., and Santa Cruz, S. (1995).
Jellyfish green fluorescent protein as a reporter for virus
infections. Plant J. 7, 1045-1053.
[0348] Baulcombe, D. C., and English, J. J. (1996). Ectopic pairing
of homologous DNA and post-transcriptional gene silencing in
transgenic plants. Current Opinion In Biotechnology 7, 173-180.
[0349] Bernier, G. (1988). The control of floral evocation and
morphogenesis. Ann.Rev. Plant Physiol. Plant Mol. Biol. 39,
175-219.
[0350] Brigneti, G., Voinne, O., Wan-Xiang, L., Liang-Hui, J.,
Ding, S.-W., and Baulcombe, D. C. (1998). Viral pathogenicity
determinants are suppressors of transgene silencing in Nicotiana
benthamiana. EMBO J. in press.
[0351] Chapman, S. N., Kavanagh, T. A., and Baulcombe, D. C.
(1992). Potato virus X as a vector for gene expression in plants.
Plant J. 2, 549-557.
[0352] Christou, P., Ford, T. L., and Kofron, M. (1991). Production
of transgenic rice (Oryza sativa L.) plants from agronomically
important indica and japonica varieties via electric discharge
particle acceleration of exogenous DNA into immature zygotic
embryos. Bio/Technology 9, 957-962.
[0353] Colasanti, J., Yuan, Z., and Sundaresan, V. (1998). The
indeterminate Gene Encodes a Zinc Finger Protein and Regulates a
Leaf-Generated Signal Required for the Transition to Flowering in
Maize. Cell 93, 593-603.
[0354] Deom, C. M., Oliver, M. J., and Beachy, R. N (1987). The
30-Kilodalton Gene Produce of Tobacco Mosaic Virus Potentiates
Virus Movement. Science 237, 389-394.
[0355] Depicker, A., and Van Montagu, M. (1997).
Post-transcriptional gene silencing in plants. Curr. Opin. Cell
Biol. 9, 372-382.
[0356] Ding, S. W., Li, W.-X., and Symons, R. H. (1995). A novel
naturally occurring hybrid gene encoded by a plant RNA virus
facilitates a long distance virus movement EMBO J. 14,
5762-5772.
[0357] Ding, B., Kwon, M.-O., Hammond, R., and Owens, R. (1997).
Cell-to-cell movement of potato spindle tuber viroid. Plant J. 12,
931-936.
[0358] Elmayan, T., and Vaucheret, H. (1996). Expression of single
copies of a strongly expressed 35S transgene can be silenced
post-transcriptionally. Plant J. 9, 787-797.
[0359] English, J. J., and Baulcombe, D. C. (1997). The influence
of small changes in transgene transcription on homology-dependent
virus resistance and gene silencing. Plant J. 12, 1311-1318.
[0360] English, J. J., Davenport, G. F., Elmayan, T., Vaucheret,
H., and Baulcombe, D. C. (1997). Requirement of sense transcription
for homology-dependent virus resistance and trans-inactivation.
Plant J. 12, pp.597-603.
[0361] English, J. J., Mueller, E., and Baulcombe, D. C. (1996).
Suppression of virus accumulation in transgenic plants exhibiting
silencing of nuclear genes. Plant Cell 8, 179-188.
[0362] Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver,
S. E., and Mello, C. C. (1998). Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans.
Nature 391, 806-811.
[0363] Hamilton, A. J., Lycett, G. W., and Grierson, D. (1990).
Antisense gene that inhibits synthesis of the hormone ethylene in
transgenic plants. Nature 346, 284-287.
[0364] Hamilton, C. M., Frary, A., Lewis, C., and Tanksley, S. D.
(1996). Stable transfer of intact high molecular weight DNA into
plant chromosomes. Proc.Natl.Acad.Sci.USA. 93, 9975-9979.
[0365] Harpster, M. H., Townsend, J. A., Jones, J. D. G., Bedbrook,
J., and Dunsmuir, P. (1988). Relative strengths of the 35S
cauliflower mosaic virus, 1', 2' and nopaline synthase promoters in
transformed tobacco, sugarbeet and oilseed rape callus tissue.
Mol.Gen.Genet. 212, 182-190.
[0366] Haseloff, J., Siemering, K. R., Prasher, D. C., and Hodge,
S. (1997). Removal of a cryptic intron and subcellular localization
of green fluorescent protein are required to mark transgenic
Arabidopsis plants brightly. Proc.Natl.Acad.Sci.USA 94,
2122-2127.
[0367] Hobbs, S. L. A., Kpodar, P., and DeLong, C. M. O. (1990).
The effect of T-DNA copy number, position and methylation on
reporter gene expression in tobacco transformants. Plant Mol. Biol.
15, 851-864.
[0368] Hobbs, S. L. A., Warkentin, T. D., and DeLong, C. M. O.
(1993). Transgene copy number can be positively or negatively
associated with transgene expression. Plant Mol. Biol. 21,
17-26.
[0369] Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz, D.,
Rogers, S. G., and Fraley, R. T. (1985). A simple and general
method of transferring genes into plants. Science 227,
1229-1231.
[0370] Iglesias, V. A., Moscone, E. A., Papp, I., Neuhuber, F.,
Michalowski, S., Phelan, T., Spiker, S., Matzke, M., and Matzke, A.
J. M. (1997). Molecular and cytogenetic analyses of stably and
unstably expressed transgene loci in tobacco. Plant Cell 9,
1251-1264.
[0371] Jefferson, R. A. (1987). Assaying chimeric genes in plants:
The GUS gene fusion system. Plant Mol.Biol.Rep. 5, 387-405.
[0372] Jones, J. D. G., Shlumukov, L., Carland, F., English, J. J.,
Scofield, S. R., Bishop, G., and Harrison, K. (1992). Effective
vectors for transformation, expression of heterologous genes, and
assaying transposon excision in transgenic plants. Transgenic Res.
1, 285-297.
[0373] Jorgensen, R. A. (1992). Silencing of plant genes by
homologous transgenes. AgBiotech News and Information 4,
265-273.
[0374] Jorgensen, R. A., Atkinson, R. G., Forster, R. L. S., and
Lucas, W. J. (1998). An RNA-Based Information Superhighway in
Plants. Science 279, 1486-1487.
[0375] Jorgensen, R. A., Que, Q. D., English, J. J., Cluster, P.,
and Napoli, C. (1995). Sense-suppression of flower color genes as a
sensitive reporter of epigenetic states of gene-expression in plant
development. Plant Physiol. 108, 14.
[0376] Kjemtrup, S., Sampson, K. S., Peele, C. G., Nguyen, L. V.,
Conkling, M. A., Thompson, W. F., and Robertson, D. (1998). Gene
silencing from plant DNA carried by a geminivirus. Plant J. 14,
91-100.
[0377] Kuhn, C., Franceschi, V. R., Schulz, A., Lemoine, R., and
Frommer, W. B. (1997). Macromolecular Trafficking
[0378] Indicated by Localization and Turnover of Sucrose
Transporters in Enucleate Sieve Elements. Science 275,
1298-1300.
[0379] Kumagai, M. H., Donson, J., Della-Cioppa, G., Harvey, D.,
Hanley, K., and Grill, L. K. (1995). Cytoplasmic inhibition of
carotenoid biosynthesis with virus-derived RNA. Proc.Natl.
Acad.Sci.USA 92, 1679-1683.
[0380] Leisner, S. M., and Turgeon, R. (1993). Movement Of Virus
and Photoassimilate In the Phloem--a Comparative--Analysis.
Bioessays 15, 741-748.
[0381] Lindbo, J. A., Silva-Rosales, L., Proebsting, W. M., and
Dougherty, W. G. (1993). Induction of a highly specific antiviral
state in transgenic plants: implications for regulation of gene
expression and virus resistance. Plant Cell 5, 1749-1759.
[0382] Lucas, W. J., Bouch_-Pillon, S., Jackson, D. P., Nguyen, L.,
Baker, L., Ding, B., and Hake, S. (1995). Selective trafficking of
KNOTTED1 homeodomain proteins and its mRNA through plasmodesmata.
Science 270, 1980-1983.
[0383] Lucas, W. J., Wolf, S., Deom, C. M., Kishore, G. M., and
Beachy, R. N. (1989). Plasmodesmata--Virus infections. unknown.
[0384] Matthews, R. E. F. (1991). Plant Virology, 3rd Edition (San
Diego, Calif.: Academic Press).
[0385] McLean, B., Hempel, F., and Zambryski, P. (1997). Plant
intercellular communication via plasmodesmata. The Plant Cell 9,
1043-1054.
[0386] Meins, F., Jr., and Kunz, C. (1994). Silencing of chitinase
expression in transgenic plants: An autoregulatory model. In
Homologous recombination and gene silencing in plants., J.
Paszowski, ed. (Netherlands: Kluwer Academic Publishers), pp.
335-348.
[0387] Metzlaff, M., O'Dell, M., Cluster, P. D., and Flavell, R. B.
(1997). RNA-mediated RNA degradation and chalcone synthase A
silencing in petunia. Cell 88, 845-854.
[0388] Mueller, E., Gilbert, J. E., Davenport, G., Brigneti, G.,
and Baulcombe, D. C. (1995). Homology-dependent resistance:
transgenic virus resistance in plants related to homology-dependent
gene silencing. Plant J. 7, 1001-1013.
[0389] Napoli, C., Lemieux, C., and Jorgensen, R. A. (1990).
Introduction of a chimeric chalcone synthase gene into Petunia
results in reversible co-suppression of homologous genes in trans.
Plant Cell 2, 279-289.
[0390] Palauqui, J.-C., Elmayan, T., Pollien, J.-M., and Vaucheret,
H. (1997). System acquired silencing: transgene-specific
post-transcriptional silencing is transmitted by grafting from
silenced stocks to non-silenced scions. EMBO J. 16.
[0391] PalBhadra, M., Bhadra, U., and Birchler, J. A. (1997).
Cosuppression in Drosophila: Gene silencing of Alcohol
dehydrogenase by white-Adh transgenes is Polycomb dependent. Cell
90, 479-490.
[0392] Palukaitis, P. (1987). Potato Spindle Tuber Viroid:
Investigation of the Long-Distance, Intra-plant Transport Route.
Virology 158, 239-241.
[0393] Poethig, R. S. (1990). Phase-Change and the Regulation Of
Shoot Morphogenesis In Plants. Science 250, 923-930.
[0394] Que, Q. D., Wang, H. Y., English, J. J., and Jorgensen, R.
A. (1997). The frequency and degree of cosuppression by sense
chalcone synthase transgenes are dependent on transgene promoter
strength and are reduced by premature nonsense codons in the
transgene coding sequence. Plant Cell 9, 1357-1368.
[0395] Ream, W. (1989). Agrobacterium tumefasciens and interkingdom
genetic exchange. Annu.Rev.Phytopathol. 27, 583-618.
[0396] Roberts, A. G., Santa Cruz, S., Roberts, I. M., Prior, D. A.
M., Turgeon, R., and Oparka, K. J. (1997). Phloem unloading in sink
leaves of Nicotiana benthamiana: Comparison of a fluorescent solute
with a fluorescent virus. Plant Cell 9, 1381-1396.
[0397] Ruiz, F., Vassie, L., Klotz, K., Sperling, L., and Madeddu,
L. (1998a). Homology-dependent gene silencing in Paramecium.
Molecular Biology Of The Cell 9, 931-943.
[0398] Ruiz, M. T., Voinnet, O., and Baulcombe, D. C. (1998b).
Initiation and maintenance of virus-induced gene silencing. Plant
Cell, in press.
[0399] Scholthof, H. B., Scholthof, K. B. G., and Jackson, A. O.
(1995). Identification of tomato bushy stunt virus host-specific
symptom determinants by expression of individual genes from a
potato virus X vector. Plant Cell 7, 1157-1172.
[0400] Sijen, T., Wellink, J., Hiriart, J.-B., and van Kammen, A.
(1996). RNA-mediated virus resistance: role of repeated transgenes
and delineation of targeted regions. Plant Cell 8, 2277-2294.
[0401] Smith, C. J. S., Watson, C. F., Ray, J., Bird, C. R.,
Morris, P. C., Schuch, W., and Grierson, D. (1988). Antisense RNA
inhibition of polygalaturonase gene expression in transgenic
tomatoes. Nature 334, 724-726.
[0402] Stam, M., de Bruin, R., Kenter, S., van der Hoorn, R. A. L.,
van Blokland, R., Mol, J. N. M., and Kooter, J. M. (1997).
Post-transcriptional silencing of chalcone synthase in Petunia by
inverted transgene repeats. Plant J. 12, 63-82.
[0403] Vain, P., Worland, B., Kohli, A., Snape, J. W., and
Christou, P. (1998). The green fluorescent protein (GFP) as a vital
screenable marker in rice transformation. Theor. Appl. Genet. 96,
164-169.
[0404] Van Blokland, R., Van der Geest, N., Mol, J. N. M., and
Kooter, J. M. (1994). Transgene-mediated suppression of chalcone
synthase expression in Petunia hybrida results from an increase in
RNA turnover. Plant J. 6, 861-877.
[0405] van der Krol, A. R., Mur, L. A., Beld, M., Mol, J. N. M.,
and Stuitji, A. R. (1990). Flavonoid genes in petunia: Addition of
a limited number of gene copies may lead to a suppression of gene
expression. Plant Cell 2, 291-299.
[0406] van Lent, J. W. M., Storms, M., van der Meer, F., Wellink,
J., and Goldbach, R. W. (1991). Tubular structures involved in
movement of cowpea mosaic virus are also formed in infected cowpea
protoplasts. J.Gen.Virol. 72, 2615-2623.
[0407] Verchot, J., Angell, S. M., and Baulcombe, D. C. (1998). In
Vivo Translation of the Entire Triple Gene Block of Potato Virus X
Requires Two Separate mRNAs. J. Virol., submitted.
[0408] Voinnet, O., and Baulcombe, D. C. (1997). Systemic
signalling in gene silencing. Nature 389, 553.
[0409] Wassenegger, M., Heimes, S., Riedel, L., and Sanger, H. L.
(1994). RNA-directed de novo methylation of genomic sequences in
plants. Cell 76, 567-576.
[0410] Wolf, S., Deom, C. M., Beachy, R. N., and Lucas, W. J
(1989). Movement Protein of Tobacco Mosaic Virus Modifies
Plasmodesmatal Size Exclusion Limit. Science 246, 377-379.
[0411] Yanisch-Perron, C., Vieira, J., and Messing, J. (1985).
Improved M13 phage cloning vectors and host strains: nucleotide
sequences of the M13mpl8 and pUC19 vectors. Gene 33, 103-119.
[0412] Zimmern, D. (1982). Do viroids and RNA viruses derive from a
system that exchanges genetic information between eucaryotic cells
? Trends in Biochemical Sciences, 205-207.
[0413] Zupan, J., and Zambryski, P. (1997). The Agrobacterium DNA
transfer complex. Critical Reviews In Plant Sciences 16, 279-295.
Sequence CWU 1
1
24 1 21 DNA Artificial Sequence Description of Artificial Sequence
Primer 1 ggatccaagg agatataaca a 21 2 21 DNA Artificial Sequence
Description of Artificial Sequence Primer 2 aaatcgattc ccttaagctc g
21 3 17 DNA Artificial Sequence Description of Artificial Sequence
Primer 3 agcttaaggg aatcgat 17 4 21 DNA Artificial Sequence
Description of Artificial Sequence Primer 4 cttagagttc gtcatgtttg t
21 5 18 DNA Artificial Sequence Description of Artificial Sequence
Primer 5 ttgtggccga ggatgttt 18 6 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 6 aaatcgatcc cttaagctcg
20 7 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 7 gggtaacgcc agggttttcc 20 8 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 8 agtagtgaca agtgttggcc
20 9 18 DNA Artificial Sequence Description of Artificial Sequence
Primer 9 agcgggcgct agggcgct 18 10 22 DNA Artificial Sequence
Description of Artificial Sequence Primer 10 tgacagaaaa tttgtgccca
tt 22 11 21 DNA Artificial Sequence Description of Artificial
Sequence Primer 11 gtaaagcact aaatcggaac c 21 12 21 DNA Artificial
Sequence Description of Artificial Sequence Primer 12 ttgggacaac
tccagtgaaa a 21 13 19 DNA Artificial Sequence Description of
Artificial Sequence Primer 13 ccactacgtg aaccatcac 19 14 713 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
sequence 14 gcacagattt tcctaggcac gttatcaatt atgcgcctga ctggtgaagg
tcccactttt 60 gatgcaaaca ctgagtgcaa catagcttac acccatacaa
agtttgacat cccagccgga 120 actgctcaag tttatgcagg agacgactcc
gcactggact gtgttccaga agtgaagcat 180 agtttccaca ggcttgagga
caaattactc ctaaagtcaa agcctgtaat cacgcagcaa 240 aagaagggca
gttggcctga gttttgtggt tggctgatca caccaaaagg ggtgatgaaa 300
gacccaatta agctccatgt tagcttaaaa ttggctgaag ctaagggtga actcaagaaa
360 tgtcaagatt cctatgaaat tgatctgagt tatgcctatg accacaagga
ctctctgcat 420 gacttgttcg atgagaaaca gtgtcaggca cacacactca
cttgcagaac actaatcaag 480 tcagggagag gcactgtctc actttcccgc
ctcagaaact ttctttaacc gttaagttac 540 cttagagatt tgaataagat
ggatattctc atcagtagtt tgaaaagttt aggttattct 600 aggacttcca
aatctttaga ttcaggacct ttggtagtac atgcagtagc cggagccggt 660
aagtccacag ccctaaggaa gttgatcctc agacacccaa cattcaccgt gca 713 15
162 DNA Artificial Sequence Description of Artificial Sequence
Synthetic sequence 15 aaaccataag ggccattgcc gatctcaagc cactctccgt
tgaacggtta agtttccatt 60 gatactcgaa agaggtcagc accagctagc
atcggacatg aagactaatc tttttctctt 120 tctcatcttt tcacttctcc
tatcattatc ctcggccgaa tt 162 16 818 DNA Artificial Sequence
Description of Artificial Sequence Synthetic sequence 16 acatgacgaa
ctctaaatgt cgaccgccga taagcttgat agggccattg ccgatctcaa 60
gccactctcc gttgaacggt taagtttcca ttgatactcg aaagatgtca gcaccagcta
120 gcacaacaca gcccataggg tcaactacct caactaccac aaaaactgca
ggcgcaactc 180 ctgccacagc ttcaggcctg ttcaccatcc cggatgggga
tttctttagt acagcccgtg 240 ccatagtagc cagcaatgct gtcgcaacaa
atgaggacct cagcaagatt gaggctattt 300 ggaaggacat gaaggtgccc
acagacacta tggcacaggc tgcttgggac ttagtcagac 360 actgtgctga
tgtaggatca tccgctcaaa cagaaatgat agatacaggt ccctattcca 420
acggcatcag cagagctaga ctggcagcag caattaaaga ggtgtgcaca cttaggcaat
480 tttgcatgaa gtatgctcca gtggtatgga actggatgtt aactaacaac
agtccacctg 540 ctaactggca agcacaaggt ttcaagcctg agcacaaatt
cgctgcattc gacttcttca 600 atggagtcac caacccagct gccatcatgc
ccaaagaggg gctcatccgg ccaccgtctg 660 aagctgaaat gaatgctgcc
caaactgctg cctttgtgaa gattacaaag gccagggcac 720 aatccaacga
ctttgccagc ctagatgcag ctgtcactcg aggtcgtatc actggaacaa 780
caaccgctga ggctgttgtc actctaccac caccataa 818 17 21 DNA Artificial
Sequence Description of Artificial Sequence Synthetic sequence 17
acatgacgaa ctctaaatgt c 21 18 56 DNA Artificial Sequence
Description of Artificial Sequence Synthetic sequence 18 gtcgtatcac
tggaacaaca accgctgatg ctgttgtcac tctaccacca ccataa 56 19 531 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
sequence 19 gcacagattt tcctaggcac gttatcaatt atgcgcctga ctggtgaagg
tcccactttt 60 gatgcaaaca ctgagtgcaa catagcttac acccatacaa
agtttgacat cccagccgga 120 actgctcaag tttatgcagg agacgactcc
gcactggact gtgttccata agtgaagcat 180 agtttccaca ggcttgagga
caaattactc ctaaagtcaa agcctgtaat cacgcagcaa 240 aagaagggca
gttggcctga gttttgtggt tggctgatca caccaaaagg ggtgatgaaa 300
gacccaatta agctccatgt tagcttaaaa ttggctgaag ctaagggtga actcaagaaa
360 tgtcaagatt cctatgaaat tgatctgagt tatgcctatg accacaagga
ctctctgcat 420 gacttgttcg atgagaaaca gtgtcaggca cacacactca
cttgcataac actaatcaag 480 tcagggagag gcactgtctc actttcccgc
ctcagaaact ttctttaacc g 531 20 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetic sequence 20 cggccgaatt
10 21 80 DNA Artificial Sequence Description of Artificial Sequence
Synthetic sequence 21 acatgacgaa ctctaaatgt cgaggtcgta tcactggaac
aacaaccgct gatgctgttg 60 tcactctacc accaccataa 80 22 696 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
sequence 22 gcacagattt tcctaggcac gttatcaatt atgcgcctga ctggtgaagg
tcccactttt 60 gatgcaaaca ctgagtgcaa catagcttac acccatacaa
agtttgacat cccagccgga 120 actgctcaag tttatgcagg agacgactcc
gcactggact gtgttccata agtgaagcat 180 agtttccaca ggcttgagga
caaattactc ctaaagtcaa agcctgtaat cacgcagcaa 240 aagaagggca
gttggcctga gttttgtggt tggctgatca caccaaaagg ggtgatgaaa 300
gacccaatta agctccatgt tagcttaaaa ttggctgaag ctaagggtga actcaagaaa
360 tgtcaagatt cctatgaaat tgatctgagt tatgcctatg accacaagga
ctctctgcat 420 gacttgttcg atgagaaaca gtgtcaggca cacacactca
cttgcagaac actaatcaag 480 tcagggagag gcactgtctc actttcccgc
ctcagaaact ttctttaacc gttaagttac 540 cttagagatt tgaataagat
ggatattctc atcagtagtt tgaaaagttt aggttattct 600 aggacttcca
aatctttaga ttcaggacct ttggtagtac atgcagtagc cggagccggt 660
aagtccacag ccctaaggaa gttgatcctc agacac 696 23 558 DNA Artificial
Sequence Description of Artificial Sequence Synthetic sequence 23
gcacagattt tcctaggcac gttatcaatt atgcgcctga ctggtgaagg tcccactttt
60 gatgcaaaca ctgagtgcaa catagcttac acccatacaa agtttgacat
cccagccgga 120 actgctcaag tttatgcagg agacgactcc gcactggact
gtgttccata agtgaagcat 180 agtttccaca ggcttgagga caaattactc
ctaaagtcaa agcctgtaat cacgcagcaa 240 aagaagggca gttggcctga
gttttgtggt tggctgatca caccaaaagg ggtgatgaaa 300 gacccaatta
agctccatgt tagcttaaaa ttggctgaag ctaagggtga actcaagaaa 360
tgtcaagatt cctatgaaat tgatctgagt tatgcctatg accacaagga ctctctgcat
420 gacttgttcg atgagaaaca gtgtcaggca cacacactca cttgcagaac
actaatcaag 480 tcagggagag gcactgtctc actttcccgc ctcagaaact
ttctttaacc gttaagttac 540 cttagagatt tgaataag 558 24 679 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
sequence 24 gcacagattt tcctaggcac gttatcaatt atgcgcctga ctggtgaagg
tcccactttt 60 gatgcaaaca ctgagtgcaa catagcttac acccatacaa
agtttgacat cccagccgga 120 actgctcaag tttatgcagg agacgactcc
gcactggact gtgttccaga agtgaagcat 180 agtttccaca ggcttgagga
caaattactc ctaaagtcaa agcctgtaat cacgcagcaa 240 aagaagggca
gttggcctga gttttgtggt tggctgatca caccaaaagg ggtgatgaaa 300
gacccaatta agctccatgt tagcttaaaa ttggctgaag ctaagggtga actcaagaaa
360 tgtcaagatt cctatgaaat tgatctgagt tatgcctatg accacaagga
ctctctgcat 420 gacttgttcg atgagaaaca gtgtcaggca cacacactca
cttgcagaac actaatcaag 480 tcagggagag gcactgtctc actttcccgc
ctcagaaact ttctttaacc gctagcgggc 540 cattgccgat ctcaagccac
tctccgttga acggttaagt ttccattgat actcgaaaga 600 ggtcagcacc
agctagcatc ggacatgaag actaatcttt ttctctttct catcttttca 660
cttctcctat cattatcct 679
* * * * *