U.S. patent application number 10/421011 was filed with the patent office on 2003-12-11 for generation of xenogeneic antibodies.
This patent application is currently assigned to Abqenix, Inc.. Invention is credited to Brenner, Daniel G., Capon, Daniel J., Jakobovits, Aya, Klapholz, Sue, Kucherlapati, Raju.
Application Number | 20030229905 10/421011 |
Document ID | / |
Family ID | 29740869 |
Filed Date | 2003-12-11 |
United States Patent
Application |
20030229905 |
Kind Code |
A1 |
Kucherlapati, Raju ; et
al. |
December 11, 2003 |
Generation of xenogeneic antibodies
Abstract
The subject invention provides non-human mammalian hosts
characterized by inactivated endogenous Ig loci and functional
human Ig loci for response to an immunogen to produce human
antibodies or analogs thereof. The hosts are produced by multiple
genetic modifications of embryonic cells in conjunction with
breeding. Different strategies are employed for recombination of
the human loci randomly or at analogous host loci. Chimeric and
transgenic mammals, particularly mice, are provided, having stably
integrated large, xenogeneic DNA segments. The segments are
introduced by fusion with yeast spheroplasts comprising yeast
artificial chromosomes (YACs) which include the xenogeneic DNA
segments and a selective marker such as HPRT, and embryonic stem
cells.
Inventors: |
Kucherlapati, Raju; (Darien,
CT) ; Jakobovits, Aya; (Menlo Park, CA) ;
Klapholz, Sue; (Stanford, CA) ; Brenner, Daniel
G.; (Redwood City, CA) ; Capon, Daniel J.;
(Hillsborough, CA) |
Correspondence
Address: |
FISH & NEAVE
1251 AVENUE OF THE AMERICAS
50TH FLOOR
NEW YORK
NY
10020-1105
US
|
Assignee: |
Abqenix, Inc.
|
Family ID: |
29740869 |
Appl. No.: |
10/421011 |
Filed: |
April 21, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10421011 |
Apr 21, 2003 |
|
|
|
09653722 |
Sep 1, 2000 |
|
|
|
09653722 |
Sep 1, 2000 |
|
|
|
08464582 |
Jun 5, 1995 |
|
|
|
6114598 |
|
|
|
|
08464582 |
Jun 5, 1995 |
|
|
|
08031801 |
Mar 15, 1993 |
|
|
|
08031801 |
Mar 15, 1993 |
|
|
|
07919297 |
Jul 24, 1992 |
|
|
|
07919297 |
Jul 24, 1992 |
|
|
|
07610515 |
Nov 8, 1990 |
|
|
|
07610515 |
Nov 8, 1990 |
|
|
|
07466008 |
Jan 12, 1990 |
|
|
|
Current U.S.
Class: |
800/6 ;
435/70.21 |
Current CPC
Class: |
C12N 15/90 20130101;
A01K 67/0276 20130101; A01K 2217/20 20130101; C07K 16/1282
20130101; A01K 67/0271 20130101; A01K 2217/075 20130101; A01K
2227/105 20130101; A01K 2217/00 20130101; A61K 38/00 20130101; C07K
16/244 20130101; A01K 67/0278 20130101; A01K 2207/15 20130101; A01K
2217/05 20130101; C07K 16/00 20130101; C07K 16/248 20130101; C12N
15/87 20130101; C07K 2317/24 20130101; C07K 16/2812 20130101; C07K
2317/21 20130101; C12N 15/8509 20130101; C07K 16/2875 20130101;
A01K 2217/072 20130101; A01K 2267/01 20130101; A01K 2267/03
20130101; C07K 16/2854 20130101; C07K 16/462 20130101; C07K 16/241
20130101 |
Class at
Publication: |
800/6 ;
435/70.21 |
International
Class: |
C12P 021/04 |
Claims
What is claimed is:
1. A method for producing a xenogeneic immunoglobulin or analog
thereof in a non-human animal host, said method comprising:
immunizing said host with an immunogen under conditions to
stimulate an immune response to said immunogen, whereby said host
mounts an immune response to said immunogen and produces B-cells
producing immunoglobulin specific for said immunogen, and isolating
xenogeneic immunoglobulin produced bys aid host, wherein said host
is characterized by 1) being substantially incapable of producing
endogenous immunoglobulin heavy chain; (2) being substantially
incapable of producing endogenous immunoglobulin light chains; and
3) being capable of producing a xenogeneic immunoglobulin or analog
thereof.
2. A method according to claim 1, wherein said host is rendered
substantially incapable of producing endogenous immunoglobulin
heavy and light chains by inactivation of at least a portion of
said endogenous immunoglobulin heavy and light chain loci by
homologous recombination.
3. A method according to claim 2, wherein said inactivation is a
result of introduction of a lesion into the endogenous
immunoglobulin loci.
4. A method according to claim 1, wherein said analog comprises a
variable region joined by a peptide bond to a peptide other than
solely the immunoglobulin constant region.
5. A method according to claim 1, wherein said xenogeneic
immunoglobulin is human immunoglobulin.
6. A method according to claim 1, including the additional step of
immortalizing said B-cells.
7. A method according to claim 1, wherein said host comprises
B-cells comprising a functional immunoglobulin locus comprising a
xenogeneic variable region and at least one human constant
region.
8. A method according to claim 1, wherein said non-human host is a
rodent.
9. A method according to claim 1, wherein said xenogeneic
immunoglobulin is chimeric immunoglobulin.
10. A method according to claim 9, wherein said chimeric
immunoglobulin is mouse/human immmunoglobulin.
11. An immortalized non-human cell line genetically modified so as
to lack the ability to produce immunoglobulin endogenous to the
cell line and comprising xenogeneic immunoglobulin loci encoding at
least one xenogeneic immunoglobulin heavy chain and a light chain;
wherein said xenogeneic immunoglobulin heavy and light chain loci
are expressed.
12. An immortalized cell line according to claim 11, wherein said
cell line is a B cell hybridoma.
13. An immortalized cell line according to claim 11, wherein said
non-human cell line is a murine cell line, and said xenogeneic
immunoglobulin loci are human immunoglobulin loci.
14. A method of making a xenogeneic immunoglobulin comprising
culturing the immortalized cell line of claim 11 under suitable
culture conditions and recovering the xenogeneic
immunoglobulin.
15. A xenogeneic immunoglobulin produced by the method according to
claim 1 or 14.
16. A genetically modified non-human animal comprising a modified
genome selected from the group consisting of: a genome heterozygous
or homozygous for a modification that results in the inability of
at least one locus to produce endogenous immunoglobulin heavy or
light chains; a genome heterozygous or homozygous for a
modification that results in the inability of at least one locus to
produce endogenous immunoglobulin heavy and light chains; a genome
heterozygous for a modification that results in the inability of at
least one locus to produce endogenous immunoglobulin heavy and
light chains and hemizygous for the ability to produce xenogeneic
immunoglobulin heavy chains; a genome heterozygous for a
modification that results in the inability of at least one locus to
produce endogenous immunoglobulin heavy and light chains and
hemizygyous for the ability to produce xenogeneic immunoglobulin
light chains; a genome homozygous for a modification that results
in the inability to produce endogenous immunoglobulin heavy and
light chains and homozygous for the ability to produce xenogeneic
immunoglobulin heavy or light chains; a genome homozygyous for a
modification that results in the inability to produce endogenous
immunoglobulin heavy and light chains and hemizygous for the
ability to produce xenogeneic immunoglobulin heavy or light chains;
a genome homozygous or heterozygous for a modification that results
in the inability of at least one locus to produce endogenous
immunoglobulin heavy and light chains and hemizygous for the
ability to produce xenogeneic immunoglobulin heavy and light
chains; a genome heterozygous for a modification that results in
the inability of at least one locus to produce endogenous
immunoglobulin heavy or light chain and hemizygous for a
modification that results in the ability to produce xenogeneic
immunoglobulin heavy and light chains; a genome homozygous for a
modification that results in the inability to produce endogenous
immunoglobulin heavy or light chain and homozygous for a
modification that results in the ability to produce xenogeneic
immunoglobulin heavy and light chains; and a genome homozygous for
a modificatio that results in the inability to produce endogenous
immunoglobulin heavy or light chain and hemizygous for a
modification that results in the ability to produce xenogeneic
immunoglobulin heavy and light chains.
17. A non-human animal according to claim 16, wherein the animal is
murine.
18. A non-human animal according to claim 16, wherein the
xenogeneic immunoglobulin is human.
19. A non-human animal according to claim 16, wherein the inability
to produce endogenous immunoglobulin is a result of inactivation of
at least a portion of the endogenous immunoglobulin loci by
homologous recombination.
20. A non-human animal according to claim 19, wherein at least a
portion of the endogenous immunoglobulin light and heavy chain loci
are replaced with at least one locus capable of producing
xenogeneic immunoglobulin.
21. A non-human animal according to claim 16, wherein said
inactivation comprises introduction of a lesion in the loci
encoding said heavy and/or light immunoglobulin chains.
22. A non-human animal according to claim 21, wherein said lesion
is in the constant and/or J region.
23. A non-human animal according to claim 21, wherein said light
chain loci are kappa immunoglobulin chain loci.
24. A non-human animal according to claim 21, wherein said light
chain loci are lambda immunoglobulin chain loci.
25. A transgenic murine animal comprising a genome lacking the
ability to produce endogenous immunoglobulin, said genome
comprising a lesion in the J region of the heavy chain
immunoglobulin loci, and a lesion in the constant and/or J regions
of the light chain immunoglobulin loci.
26. A murine animal according to claim 25, wherein said genome
further comprises xenogeneic heavy and light chain immunoglobulin
loci and said murine animal has the ability to produce xenogeneic
immunoglobulin.
27. A method for producing a modified non-human animal, said animal
having a xenogeneic DNA segment of at least 100 kb stably
integrated into the genome of said animal, said method comprising:
combining under fusing conditions yeast spheroplasts, said
spheroplasts comprising a YAC having said xenogeneic DNA segment
and a marker for selection, with embryonic stem cells of said
animal, whereby said xenogeneic DNA segment becomes integrated into
the genome of said embryonic stem cells; selecting for embryonic
stem cells carrying said xenogeneic DNA segment by means of the
marker; transferring said embryonic cells into a host blastocyst
and implanting said blastocyst in a pseudopregnant animal
recipient, and allowing said blastocyst to develope to term to
produce a chimeric animal carrying said xenogeneic DNA segment; and
mating said chimeric animal with an animal of the same species to
produce said modified animal carrying said xenogeneic DNA
segment.
28. A method according to claim 27, wherein said marker is the HPRT
gene and said embryonic stem cell is HPRT deficient.
29. A method according to claim 27, wherein said step of mating
produces heterozygous progeny and the heterozygous progeny are
mated to produce homozygous progeny.
30. A method according to claim 27, wherein said animal is a
rodent.
31. A method according to claim 30, wherein said animal is a murine
animal.
32. A method according to claim 27, wherein said xenogeneic DNA is
human DNA.
33. A method according to claim 32, wherein said xenogeneic DNA is
human immunoglobulin DNA in substantially intact form.
34. The modified animal produced by the method according to claim
27.
35. A non-human animal heterozygous or homozygous for a xenogeneic
genomic mammalian DNA segment of at least 100 kb, stably integrated
in substantially intact form into the genome of said animal.
36. A non-human animal according to claim 35, comprising a HPRT
gene and wherein said xenogeneic DNA is human DNA.
37. A non-human animal according to claim 36, wherein said human
DNA is human immunoglobulin DNA in substantially intact form.
38. A non-human animal according to claim 35, wherein said animal
is a rodent.
39. A non-human animal according to claim 38, wherein said animal
is a murine animal.
40. An embryonic stem cell comprising a genome having endogenous
immunoglobulin heavy chain loci, and immunoglobulin light chain
loci, said genome comprising a lesion in said endogenous
immunoglobulin heavy chain and/or light loci, resulting in the
incapacity of the immunoglobulin locus comprising said lesion to
rearrange.
41. An embryonic stem cell according to claim 40, wherein said
lesion is in the J and/or constant regions of said endogenous
immunoglobulin loci.
42. An embryonic stem cell according to claim 40, wherein said
lesion is insertion of a xenogeneic sequence.
43. An embryonic stem cell according to claim 42 wherein said
xenogeneic sequence is immunoglobulin DNA or a selectable
marker.
44. An embryonic stem cell according to claim 43, wherein said
marker is neomycin.
45. An embryonic stem cell according to claim 42, wherein said
lesion further comprises deletion of endogenous immunoglobulin
DNA.
46. An embryonic stem cell according to claim 40 wherein said stem
cell is homozygous for the lesion.
47. An embryonic stem cell according to claim 40 wherein the lesion
is in the heavy chain immunoglobulin J region loci.
48. An embryonic stem cell according to claim 40 wherein the lesion
is in the light chain immunoglobulin J region loci.
49. An embryonic stem cell according to claim 40 wherein said
lesion comprises replacement of at least a portion of the
immunoglobulin light and heavy chain loci comprising said
endogenous immunoglobulin loci with loci capable of producing
xenogeneic immunoglobulin by homologous recombination.
50. A murine embryonic stem cell comprising homozygotic alleles of
immunoglobulin heavy chain loci, said loci comprising a lesion
resulting in the incapacity of the immunoglobulin loci comprising
said lesion to rearrange.
51. A murine embryonic stem cell according to claim 50, wherein
said lesion is in the J region of said immunoglobulin heavy chain
loci.
52. A murine embryonic stem cell comprising homozygotic alleles of
immunoglobulin light chain loci, said loci comprising a lesion
resulting in the incapacity of the immunoglobulin loci comprising
said lesion to rearrange.
53. A murine embryonic stem cell according to claim 52, wherein
said lesion is in the constant and/or J regions of said
immunoglobulin light chain loci.
54. A murine embryonic stem cell of a murine host said stem cell
comprising a genome having immunoglobulin loci comprising J
regions, said stem cell comprising a lesion in at least one of the
J regions of the immunoglobulin locus resulting in the incapacity
of said immunoglobulin locus to rearrange, said embryonic stem cell
produced by the method comprising introducing homologous DNA into a
murine stem cell in culture, wherein said homologous DNA comprises
a region homologous with the J region of an immunoglobulin locus
and a marker gene for insertion into said locus; and selecting for
embryonic stem cells having undergone homologous recombination with
said homologous DNA.
55. A murine embryonic stem cell according to claim 54 wherein said
marker is the neomycin gene.
56. A murine embryonic stem cell according to claim 54 wherein said
lesion is in at least one of the J regions of an endogenous heavy
chain immunoglobulin locus.
57. A murine embryonic stem cell comprising at least 100 kb of
xenogeneic DNA.
58. A murine embryonic stem cell according to claim 57, wherein
said xenogeneic DNA is immunoglobulin heavy and/or light chain
immunoglobulin DNA.
59. A murine embryonic stem cell according to claim 58, wherein
said xenogeneic DNA is human immunoglobulin DNA in substantially
intact form.
60. A method for modifying a genome of a recipient murine embryonic
stem cell by homologous recombination with a large xenogeneic DNA
genomic fragment previously manipulated in a yeast artificial
chromosome (YAC), the improvement which comprises: introducing at
least one YAC into said murinie embryonic stem cell by spheroplast
fusion, and selecting recipient cells comprising said genomic
fraqment, wherein said YAC comprises a mammalian selectable or
screenable gene, wherein said YAC is faithfully transmitted through
the host germline, and said xenogeneic DNA fragment is transmitted
in substantially intact form.
61. A method according to claim 60, wherein said selectable or
screenable gene is HPRT and the recipient cells are selected with
HAT medium and are negative for HPRT.
62. A method according to claim 60, wherein said selectable or
screenable gene is a HPRT minigene.
63. A method according to claim 60 wherein said selectable or
screenable gene is cDNA encoding a gene selected from the group
consisting of neomycin, hygromycin, HPRT, GPT and .beta.gal.
64. A method according to claim 60, wherein said YAC comprises at
least 100 kb of a human immunoglobulin DNA locus in substantially
intact form.
65. A modified YAC according to claim 64, further comprising a
mammalian selectable or screenable marker.
66. A modified YAC according to claim 65, wherein the selectable
marker is HPRT.
67. A murine embryonic stem cell comprising a genome modified
according to the method of claim 60.
68. A murine animal heterozygous for a xenogeneic unrearranged
mammalian DNA segment of at least 100 kb stably integrated into the
genome of said murine animal.
69. A murine animal according to claim 68 comprising a xenogeneic
HPRT gene and wherein said DNA segment is human immunoglobulin.
70. A human antibody molecule characterized by; comprising the
protein sequences of the human immunoglobulin heavy and light
chains; specificity for an immunogen; and having other than human
glycosylation.
71. A human antibody molecule according to claim 70, wherein said
antibody is monoclonal.
72. A method for producing a genetically modified non-human animal,
comprising interbreeding a first parent and a second parent, and
recovering the progeny thereof, wherein the parents and progeny are
selected from the group consisting of: first and second parents
heterozygous for a genome modified to be incapable of producing
endogenous immunoglobulin light chain, and progeny homozygous for
said modified genome; first and second parents heterozygous for a
genome modified to be incapable of producing an endogenous
immunoglobulin heavy chain, and progeny homozygous for said
modified genome; a first parent heterozygous for a genome modified
to be incapable of producing an endogenous immunoglobulin light
chain, a second parent heterozygous for a genome modified to be
incapable of producing an endogenous immunoglobulin heavy chain and
progeny heterozygous for said modified genome so as to be incapable
of producing endogenous immunoglobulin heavy and light chains;
first and second parents heterozygous for a genome modified to be
incapable of producing endogenous immunoglobuin light and heavy
chains, and progeny homozygous for said modified genome; a first
parent hemizgyous for a genome modified to be capable of producing
xenogeneic immunoglobulin heavy chain, a second parent heterozygous
for a genome modified to be incapable of producing endogenous
immunoglobulin light and heavy chains, and progeny heterozygous for
said modified genome so as to be incapable of producing endogenous
immunoglobulin light and heavy chains and hemizygous for a modified
genome so as to be capable of producing xenogeneic immunoglobulin
heavy chain; first and second parents heterozygous for a genome
modified to be incapable of producing endogenous immunoglobulin
light and heavy chains and hemizygous for a genome modified to be
capable of producing xenogeneic immunoglobulin heavy chain, and
progeny 1) homozygous for said modified genome and 2) homozygous
for said modification of being incapable of producing endogenous
immunoglobulin light and heavy chains and also hemizygous for the
modification of being capable of producing xenogeneic
immunoglobulin heavy chain; a first parent hemizygous for a genome
modified to be capable of producing xenogeneic immunoglobulin light
chain, a second parent heterozygous for a genome modified to be
incapable of producing immunoglobulin heavy and light chains, and
progeny heterozygous for said genome modified to be incapable of
producing endogenous immunoglobulin light and heavy chains and
hemizygous for said genome modified to be capable of producing
xenogeneic immunoglobulin light chain; first and second parents
heterozygous for a genome modified to be incapable of producing
endogenous immunoglobulin light and heavy chains and hemizygous for
a genome modified to be capable of producing xenogeneic
immunoglobulin light chain, and progeny 1) homozygous for said
modified genome and 2) homozygous for said modification of being
incapable of producing endogenous immunoglobulin light and heavy
chains and also hemizygous for the modification of being capable of
producing xenogeneic immunoglobulin light chain; a first parent
heterozygous for a genome modified to be incapable of producing
endogenous immunoglobulin light and heavy chains and hemizygous for
xenogeneic immunoglobulin heavy chain, a second parent heterozygous
for a genome modified to be incapable of producing endogenous
immunoglobulin light and heavy chains and hemizygous for the
modification of being capable of producing xenogeneic immunogobulin
light chain, and progeny homozygous and heterozygous for said
genome modified to be incapable of producing endogenous
immunoglobulin light and heavy chains and hemizygous for the
modification of being capable of producing xenogeneic
immunoglobulin light and heavy chains, first and second parents
heterozygous for a genome modified to be incapable of producing
endogenous immunoglobulin light and heavy chains and hemizgyous for
a genome modified to be capable of producing xenogeneic
immunoglobulin light and heavy chains, and progeny 1) homozygous
for said modified genome, and 2) homozygous for a genome modified
to be incapable of producing endogenous immunoglobulin heavy and
light chains and hemizygyous for a genome modified to be capable of
producing xenogeneic immunoglobulin light and heavy chains; first
and second parents homozygous for a genome modified to be incapable
of producing endogenous immunoglobulin light and heavy chains and
hemizygous for a genome modified to be capable of producing
xenogeneic immunoglobulin light and heavy chains, and progeny
homozygous for said modified genome; a first parent heterozygous
for a genome modified to be incapable of producing endogenous
immunoglobulin heavy chain, a second parent hemizygyous for a
genome modified to be capable of producing xenogeneic
immunoglobulin light and heavy chains, and progeny heterozygous for
a genome modified to be incapable of producing endogenous
immunoglobulin heavy chain and hemizygyous for a genome modified to
be capable of producing xenogeneic immunoglobulin light and heavy
chains; first and second parents heterozygous for a genome modified
to be incapable of producing endogenous immunoglobulin heavy chain
and hemizygous for a genome modified to be capable of producing
xenogeneic immunglobulin light and heavy chains, and progeny 1)
homozygous for said modified genome and 2) homozygous for a genome
modified to be incapable of producing endogenous immunoglobulin
heavy chain and hemizygous for a genome modified to be capable of
producing xenogeneic immunoglobulin light and heavy chains; a first
parent heterozygous for a genome modified to be incapable of
producing endogenous immunoglobulin light chain, a second parent
hemizygyous for a genome modified to be capable of producing
xenogeneic immunoglobulin light and heavy chains, and progeny
heterozygous for a genome modified to be incapable of producing
endogenous immunoglobulin light chain and hemizygyous for a genome
modified to be capable of producing xenogeneic immunoglboulin light
and heavy chain; and first and second parents heterozygous for a
genome modified to be incapable of producing endogenous
immunoglobulin light chain and hemizgyous for a genome modified to
be capable of producing xenogeneic immunoglobulin light and heavy
chains, and progeny 1) homozygous for said modified genome, and 2)
homozygous for a genome modified to be incapable of producing
endogenous immunoglobulin light chain and hemizygous for a genome
modified to be capable of producing xenogeneic immunoglobulin light
and heavy chains.
73. A method according to claim 72, wherein said modification of a
genome so as to be incapable of producing endogenous immunoglobulin
light and/or heavy chain is inactivation of the endogenous
immunoglobulin loci as a result of homologous recombination.
74. A method according to claim 73 wherein said inactivation is a
result of introduction of a lesion into the endogenous
immunoglobulin loci.
75. The genetically modified non-human animal produced by the
method according to claim 72.
76. The animal according to claim 75, wherein the animal is a
rodent.
77. The animal according to claim 76 wherein the animal is a murine
animal.
78. The animal according to claim 75, wherein the xenogeneic
immunoglobulin is human immunoglobulin.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of application
Ser. No. 07/919,297 filed Jul 24, 1992 which was a
continuation-in-part of application Ser. No. 07/610,515 filed Nov
8, 1990 which was a continuation-in-part of application Ser. No.
07/466,008 filed Jan 12, 1990, the entire disclosures of which are
all incorporated herein by reference.
INTRODUCTION
[0002] 1. Technical Field
[0003] The field of this invention is the production of xenogeneic
specific binding proteins in a viable mammalian host.
[0004] 2. Background
[0005] The ability to produce transgenic animals has been
revolutionized with the advent of the ability to culture murine
embryonic stem cells, and to introduce genetic modifications in
these cells for subsequent transmission to the mouse germline. Thus
one has the opportunity to modify endogenous genes to produce
animal strains capable of producing novel products by introduction
of foreign genes into the host, particularly human genes to produce
xenogeneic binding proteins. The expression of such genes in vivo
in an animal model may provide for investigation of the function of
the gene, the regulation of gene expression, its processing,
response to various agents and the like. In addition, animals with
new phenotypes, including those that mimic a variety of diseases,
may be produced. For example, there is interest in introducing a
dominant mutation or complementing a recessive mutation. Depending
on the particular gene, the difficulty of achieving the desired
mutation will vary greatly. While some gene targets have proven to
be relatively amenable to modification, other targets have proven
to be extremely resistant to modification.
[0006] Because of the opportunity for generating transgenic
animals, there is substantial interest in providing new procedures
that increase the success of production of transgenic animals.
Particularly, where one wishes to introduce large DNA fragments,
encompassing hundreds of kilobases, there is substantial concern
about the ability to introduce the large fragments in intact form
into mammalian cells, the efficiency of integration, the functional
capability of the gene(s) present on the fragment and transmission
in the germline to the progeny. In addition, such procedures for
introduction of large DNA fragments provide for determination of
the function of large DNA fragments identified in the ongoing human
genome project.
[0007] In particular, there is interest in producing xenogeneic
specific binding proteins, for example human monoclonal antibodies,
in small laboratory animals such as mice. Monoclonal antibodies
find use in both diagnosis and therapy. Because of their ability to
bind to a specific epitope, they can be uniquely used to identify
molecules carrying that epitope or may be directed, by themselves
or in conjunction with another moiety, to a specific site for
diagnosis or therapy.
[0008] Monoclonal antibodies comprise heavy and light chains which
join together to define a binding region for the epitope. Each of
the chains is comprised of a variable region and a constant region.
The constant region amino acid sequence is specific for a
particular isotype of the antibody, as well as the host which
produces the antibody.
[0009] Because of the relationship between the sequence of the
constant region and the species from which the antibody is
produced, the introduction of a xenogeneic antibody into the
vascular system of the host can produce an immune response. Where
the xenogeneic antibody is introduced repetitively, in the case of
chronic diseases, it becomes impractical to administer the
antibody, since it will be rapidly destroyed and may have an
adverse effect. There have been, therefore, many efforts to provide
a source of syngeneic or allogeneic antibodies. One technique has
involved the use of recombinant DNA technology where the genes for
the heavy and light chains from a host were identified and the
regions encoding the constant region isolated. These regions were
then joined to the variable region encoding portion of other
immunoglobulin genes from another species directed to a specific
epitope.
[0010] While the resulting chimeric partly xenogeneic antibody is
substantially more useful than using a fully xenogeneic antibody,
it still has a number of disadvantages. The identification,
isolation and joining of the variable and constant regions requires
substantial work. In addition, the joining of a constant region
from one species to a variable region from another species may
change the specificity and affinity of the variable regions, so as
to lose the desired properties of the variable region. Also, there
are framework and hypervariable sequences specific for a species in
the variable region. These framework and hypervariable sequences
may result in undesirable antigenic responses.
[0011] It would therefore be more desirable to produce allogeneic
antibodies for administration to a host by immunizing the host with
an immunogen of interest. For primates, particularly humans, this
approach is not practical. The human antibodies which have been
produced have been based on the adventitious presence of an
available spleen, from a host which had been previously immunized
to the epitope of interest. While human peripheral blood
lymphocytes may be employed for the production of monoclonal
antibodies, these have not been particularly successful in fusions
and have usually led only to IgM. Moreover, it is particularly
difficult to generate a human antibody response against a human
protein, a desired target in many therapeutic and diagnostic
applications. There is, therefore, substantial interest in finding
alternative routes to the production of allogeneic antibodies for
humans.
[0012] Relevant Literature
[0013] Thomas and Capecchi (1987), Cell, 51:503-512 and Koller and
Smithies (1989), Proc. Natl. Acad. Sci. USA, 86:8932-8935 describe
inactivating the .beta.2-microglobulin locus by homologous
recombination in embryonic stem cells. Berman et al. (1988), EMBO
J. 7:727-738 describe the human Ig VH locus. Burke, et al. (1987) ,
Science, 236:806-812 describe yeast artificial chromosome vectors.
See also, Garza et al. (1989), Science, 246:641-646 and Brownstein
et al. (1989), Science, 244:1348-1351. Sakano, et al., describe a
diversity segment of the immunoglobulin heavy chain genes in Sakano
et al. (1981), Nature, 290:562-565. Tucker et al. (1981), Proc.
Natl. Acad. Sci. USA, 78:7684-7688 describe the mouse IgA heavy
chain gene sequence. Blankenstein and Kruwinkel (1987), Eur. J.
Immunol., 17:1351-1357 describe the mouse variable heavy chain
region. See also, Joyner et al. (1989), Nature, 338:153-155, Traver
et al. (1989), Proc. Nat. Acad. Sci. USA 86:5898-5902, Pachnis et
al. (1990), Proc. Nat. Acad. Sci. USA , 87:5109-5113 and PCT
application PCT/US91/00245. Bruggemann et al., Proc. Nat. Acad.
Sci. USA; 86:6709-6713 (1989); Behring Inst. Mitt. 87:21-24 (1990);
Eur. J. Immunol. 21:1323-1326 (1991), describe monoclonal
antibodies with human heavy chains. Albertsen et al., Proc. Nat.
Acad. Sci. USA 87:4256-4260 (1990), describe the construction of a
library of yeast artificial chromosomes containing human DNA
fragments. Yeast artificial chromosome vectors are described by
Burke et al., Science 236:806-812 (1987). Pavan et al. , Mol. and
Cell. Biol. 10(8):4163-4169 (1990) describe the introduction of a
neomycin resistance cassette into the human-derived insert of a
yeast artificial chromosomes using homologous recombination and
transfer into an embryonal carcinoma cell line using polyethylene
glycol-mediated spheroplast fusion. Pachnis et al., Proc. Nat.
Acad. Sci. USA 87:5109-5113 (1990), and Gnirke et al., EMBO Journal
10(7):1629-1634 (1991), describe the transfer of a yeast artificial
chromosome carrying human DNA into mammalian cells. Eliceiri et
al., Proc. Nat. Acad. USA 88:2179-2183 (1991), describe the
expression in mouse cells of yeast artificial chromosomes
containing human genes. Huxley et al., Genomics 9:742-750 (1991)
describe the expression in mouse cells of yeast artificial
chromosomes containing the human HPRT gene. Mortensen et al., Mol.
and Cell. Biol. 12(5):2391-2395 (1992) describe the use of high
concentrations of G418 to grow heterozygous embryonic stem cells
for selection of homozygous mutationally altered cells. Yeast
protoplast fusion with mouse fibroblasts is described by Traver et
al., Proc. Nat. Acad. Sci. USA 86:5898-5902 (1989) and Pachnis et
al., Proc. Nat. Acad. Sci. USA 87:5109-5113 (1990). Davies et al.,
Nucl. Acids Res. 20:2693-2698 (1992) describe targeted alterations
in YACs. Zachau, Biol. Chem. 371:1-6 (1990) describes the human
immunoglobulin light (kappa) (IgK) locus; Matsuda et al., Nature
Genetics 3:88-94 (1993) and Shin et al., EMBO 10:3641-3645 (1991)
describe the cloning of the human immunoglobulin heavy (IgH) locus
in YACs.
SUMMARY OF THE INVENTION
[0014] Xenogeneic specific binding proteins are produced in a
non-human viable host by immunization of the host with an
appropriate immunogen.
[0015] A preferred non-human host is characterized by: (1) being
incapable of producing endogenous immunoglobulin heavy chain; (2)
being substantially incapable of producing endogenous
immunoglobulin light chains; and (3) capable of producing
xenogeneic immunoglobulin light and heavy chains to produce a
xenogeneic immunoglobulin or immunoglobulin analog. Thus, the host
may have an entire endogenous immunoglobulin locus substituted by a
portion of, or an entire, xenogeneic immunoglobulin locus, or may
have a xenogeneic immunoglobulin locus inserted into a chromosome
of the host cell and an inactivated endogenous immunoglobulin
region. These various alternatives will be achieved, at least in
part, by employing homologous recombination for inactivation or
replacement at the immunoglobulin loci for the heavy and light
chains.
[0016] Additionally, novel methods are provided for introducing
large segments of xenogeneic DNA of at least 100 kb, particularly
human DNA, into host animals, particularly mice, by introducing a
yeast artificial chromosome (YAC) containing a xenogeneic DNA
segment of at least 100 kb, into an embryonic stem cell for
integration into the genome of the stem cell, selection of stem
cells comprising the integrated YAC by means of a marker present in
the YAC, introduction of the YAC-containing ES cells into embryos
and generation of chimeric mice from the embryos. The chimeric
animals may be mated to provide animals that are heterozygous for
the YAC. The heterozygous animals may be mated to generate progeny
homozygous for the integrated YAC.
DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 is a diagram of the inactivation vector for the mouse
heavy chain J region, as described in Example I, infra.
[0018] FIG. 2 is a diagram of the DNA restriction map for the
plasmid pmH.delta.J and the targeted mouse heavy chain J genes, as
described in Example II, infra.
[0019] FIG. 3 is a flow cytometry plot of antibody staining for IgM
allotypes in mouse strains, as described in Example II, infra.
[0020] FIG. 4 is a flow cytometry histogram of antibody staining
for IgM allotypes in mouse strains, as described in Example II,
infra.
[0021] FIG. 5 is a diagram of the inactivation vector for the mouse
immunoglobulin kappa constant region genes, as described in Example
III, infra.
[0022] FIG. 6 is a diagram of the derivation of the plasmid
pK.TK/Neo, as described in Example III, infra.
[0023] FIG. 7 is a diagram of the restriction map of the light
chain targeted locus, as described in Example III, infra.
[0024] FIG. 8 is a diagram of the targeting vector for inactivation
of the kappa light chain J and constant regions and design of the
targeting experiment as described in Example IV, infra.
[0025] FIG. 9 is a diagram of the construction of vectors for
inactivating the kappa light chain J and constant regions as
described in Example IV, infra.
[0026] FIG. 10 is a diagram of the final deletion vectors for
inactivation of the kappa light chain J and constant regions as
described in Example IV, infra.
[0027] FIG. 11 is an illustration of the Southern analysis of light
chain J and constant region deleted cells as described in Example
IV, infra.
[0028] FIGS. 12 A-E are photographs of the results of Southern blot
analysis to characterize yHPRT and yeast genomic DNA integrated in
ES clones as described in Example VI, infra (A=human repetitive Alu
sequence; B,C=pBR322-specific sequences for the right (B) and left
(C) YAC arms; D=yeast Ty repetitive sequence; E=yeast single copy
gene LYS2. Shorter exposure times (12 hrs for II as compared to 48
hrs for I) of yHPRT probed with Alu and Ty sequences also are also
shown. Positions of molecular weight markers are indicated. Schemes
of right (a) and left (b) vector arms and the locations of
pBR322-derived YAC vector fragments are shown (=telomere;
=yeast-derived sequences; 0=yeast centromere; =pBR322-derived
sequences; =human insert; =EcoRI cloning site; H=HindIII
sites).
[0029] FIGS. 13 A-D are photomicrographs of the results of in situ
hybridization to detect integration of yHPRT and yeast genomic
sequences in ES cell chromosomes as described in Example VI, infra
(A, B=metaphase spreads from ESY 8-7 cells hybridized to
biotinylated human genomic sequences and C=metaphase spreads or
D=interphase nuclei from ESY 8-6 cells hybridized to biotinylated
yeast repeated DNA sequences).
[0030] FIGS. 14 A, B, C demonstrates the stable retention of yHPRT
during in vitro ES cell differentiation and transmission through
the mouse germline, as described in Example VI, infra (A: a,
b=embryoid bodies; and differentiated cell types: c=blood islands;
d=contracting muscle; e=neuronal cells; f=neural tubules formed by
ESY clones; B: Southern blot analysis of DNA extracted from
differentiated ESY 5-2, 3-6, 8-5 and 8-6 (20 .mu.g) and yHPRT in
AB1380 (40 ng) using a=human Alu probe; b=yeast Ty sequences; C:
Southern blot analysis of tail DNA (20 .mu.g) from 2 agouti
offspring (4-2 and 4-3) derived from ESY chimeric male 394/95-2
using a=human Alu and b=Ty sequences; shorter exposures (12 hr) of
8-6 and yHPRT probed with Ty are shown (II).
[0031] FIG. 15 A and B are a photograph of an electrophoresis gel
showing the expression of the human HPRT gene in various mouse
tissues, as described in Example VI, infra (15 A=detection of human
HPRT mRNA using reverse transcription-PCR in ES, ESY 3-1 and Hut 78
cells, spleen and liver from control mice or ESY 4-3 agouti
offspring; 15 B=detection of mouse .gamma.-interferon receptor mRNA
by RT-PCR in samples from 15 A; M=size marker).
[0032] FIG. 16 is a diagram of the human immunoglobulin heavy chain
locus, and a human heavy chain replacement YAC vector, as described
in Example VII, infra.
[0033] FIG. 17 is a diagram of a mouse breeding scheme, as
described in Example VIII, infra.
[0034] FIG. 18 depicts the genotypes of some of the host animals
produced by the methods of the invention.
DESCRIPTION OF SPECIFIC EMBODIMENTS
[0035] Novel transgenic non-human hosts, particularly mammalian
hosts, usually murine, are provided, where the host is capable of
mounting an immune response to an immunogen, where the response
produces antibodies having xenogeneic, particularly primate, and
more particularly human, constant and/or variable regions or such
other effector peptide sequences of interest. By "transgenic" is
meant an animal that contains a genetically engineered
modification, particularly, as to this invention, the introduction
of a human immunoglobulin gene, in all of its cells. The hosts are
characterized by being capable of producing xenogeneic
immunoglobulins or analogs thereof as a result of inactivation of
the endogenous immunoglobulin subunit encoding loci and
introduction of xenogeneic DNA, for example DNA encoding human
immunoglobulin. The modifications may retain at least a portion of
the xenogeneic constant regions which provide for assembly of the
variable region binding site bonded at the C-terminus to a
functional peptide. The functional peptide may take many forms or
conformations and may serve as an enzyme, growth factor, binding
protein, ligand, cytokine, effector protein, chelating proteins,
etc. The antibodies may be of any isotype, e.g., IgA, D, E, G or M
or subtypes within the isotype.
[0036] In a first strategy, as individual steps, the xenogeneic,
e.g. human, heavy and light chain immunoglobulin genes are
introduced into the host germ line (e.g. sperm or oocytes) and in
separate steps the corresponding host genes are rendered
non-functional by inactivation using homologous recombination.
Human heavy and light chain immunoglobulin genes are reconstructed
in an appropriate eukaryotic or prokaryotic microorganism and the
resulting DNA fragments can be introduced into the appropriate
host, for example into the pronuclei of fertilized mouse occytes or
embryonic stem cells. Inactivation of the endogenous host
immunoglobulin loci is achieved by targeted disruption of the
appropriate loci by homologous recombination in the host cells,
particularly embryonic stem cells or pronuclei of fertilized mouse
oocytes. The targeted disruption can involve introduction of a
lesion or deletion in the target locus, or deletion within the
target locus accompanied by insertion into the locus, for example,
insertion of a selectable marker. In the case of embryonic stem
cells, chimeric animals are generated which are derived in part
from the modified embryonic stem cells and are capable of
transmitting the genetic modifications through the germ line. The
mating of hosts with introduced human immunoglobulin loci to
strains with inactivated endogenous loci will yield animals whose
antibody production is purely xenogeneic, e.g. human.
[0037] In a second, alternative strategy, at least portions of the
human heavy and light chain immunoglobulin loci are used to
directly replace the corresponding endogenous immunoglobulin loci
by homologous recombination in embryonic stem cells. This results
in simultaneous inactivation and replacement of the endogenous
immunoglobulin. This is followed by the generation of chimeric
animals in which the embryonic stem cell-derived cells can
contribute to the germ line.
[0038] These strategies are based on the known organization of the
immunoglobulin chain loci in a number of animals, since the
organization, relative location of exons encoding individual
domains, and location of splice sites and transcriptional elements
is understood to varying degrees. In the human, the immunoglobulin
heavy chain (IgH.sub.hu) locus is located on chromosome 14. In the
5'-3' direction of transcription, the locus comprises a large
cluster of variable region genes (V.sub.H), the diversity (D)
region genes, followed by the joining (J.sub.H) region genes and
the constant (C.sub.H) gene cluster. The size of the locus is
estimated to be about from 1,500 to about 2,500 kilobases (kb).
During B-cell development, discontinuous gene segments from the
germ line IgH locus are juxtaposed by means of a physical
rearrangement of the DNA. In order for a functional heavy chain Ig
polypeptide to be produced, three discontinuous DNA segments, from
the V.sub.H, D, and J.sub.H regions must be joined in a specific
sequential fashion; first D to J.sub.H then V.sub.H to DJ.sub.H,
generating the functional unit V.sub.HDJ.sub.H. Once a
V.sub.HDJ.sub.H has been formed, specific heavy chains are produced
following transcription of the Ig locus, utilizing as a template
the specific V.sub.HDJ.sub.HC.sub.H unit comprising exons and
introns.
[0039] There are two loci for immunoglobulin light chains (IgL),
the kappa locus on human chromosome 2 and the lambda locus on human
chromosome 22. The organization of the IgL loci is similar to that
of the IgH locus, except that the D region is not present.
Following IgH rearrangement, rearrangement of a light chain locus
is similarly accomplished by V.sub.L to J.sub.L joining of the
kappa or lambda chain. The sizes of the lambda and kappa loci are
each approximately 1000 kb to 2000 kb. Expression of rearranged IgH
and an Ig.kappa. or Ig.lambda. light chain in a particular B-cell
allows for the generation of antibody molecules.
[0040] In order to isolate, clone and transfer the IgH.sub.hu
locus, a yeast artificial chromosome or "YAC" may be employed. A
YAC carrying the xenogeneic DNA may be introduced into ES cells or
oocytes by a variety of methods, including yeast spheroplast: ES
cell fusion, microinjection and lipofection. The YAC will integrate
randomly (i.e. non-homologously) into the host genome. If yeast
spheroplast: ES cell fusion is employed to introduce a YAC carrying
xenogeneic DNA into ES host cells, then two or more YACs in a
single yeast host cell may be introduced simultaneously into the
same host ES cell. The advantage of this approach is that multiple
YACs each containing xenogeneic DNA, for example human heavy and
light chain immunoglobulin loci, can be introduced into a single
chromosome in a host cell. This eliminates the need for breeding of
animals containing individual human Ig genes in order to generate a
host capable of producing fully human immunoglobulins. For example,
a strain of yeast containing a single YAC is targeted with a vector
such as pLUTO (described infra) to introduce a mammalian selectable
marker such as HPRT, and a yeast selectable marker such as LYS2
into an arm of the YAC. Chromosomal DNA from the targeted strain is
then used to transform a second, usually haploid, lys2 mutant yeast
strain containing a second, different YAC. Lys+ colonies are then
analyzed by pulsed-field gel electrophoresis (PFGE) to identify
clones harboring the two YACs and to confirm that they are
unaltered in size. Additional YACs with different selectable
markers, for example ADE2 (if the host is an ade2 mutant), can
subsequently be added by transformation. Alternatively, a
YAC-containing strain of yeast is targeted with a vector such as
pLUTO to introduce a mammalian selectable marker (e.g. HPRT), as
above, and then mated to a second YAC-containing strain of opposite
mating type. The presence of the two YACs is then confirmed in the
diploid yeast cells as described above. The diploid yeast strain is
used directly for fusion or put through meiosis and
ascosporogenesis (sporulation) using standard procedures. The
meiotic products are then screened to identify a haploid clone
containing the two YACs. With either approach described above, the
second YAC can be targeted with HPRT or another selectable marker
prior to introduction of the first YAC. Also, if each YAC contains
a different yeast selectable marker, maintenance of both YACS
during strain propagation may be genetically selected. Fusion with
ES cells is then carried out in the same manner as with yeast cells
containing a single YAC. Because many yeast chromosomes may
integrate along with the YAC, it is expected that a substantial
portion of ES clones expressing the mammalian selectable marker
present in one YAC (e.g. HAT.sup.R clones if the YAC marker is
HPRT, and the ES cells are HPRT-), will have integrated both YACS.
Methods such as Southern analysis and/or PCR may be used to
identify such clones, and Southern analysis employing pulsed-field
gel electrophoresis used to characterize the extent of YAC
integration.
[0041] The entire IgH.sub.bu locus can be contained within one or a
few YAC clones along with a mammalian marker such as Neo, HPRT,
GPT, .beta.-gal, etc. The same is true for the Ig light chain loci.
Reconstitution of intact germ line Ig loci by homologous
recombination between YACs with overlapping regions of homology can
be achieved in yeast. In this manner, the isolation of DNA
fragments encoding the human Ig chain is obtained. Alternatively,
one can directly clone an intact germline locus in a single
YAC.
[0042] In order to obtain a broad spectrum of high affinity
antibodies, it is not necessary that one include the entire V
region. Various V region gene families are interspersed within the
V region cluster in humans. Thus, by obtaining a subset of the
known V region genes of the human heavy and light chain Ig loci
(Berman et al., EMBO J. (1988) 7:727-738) rather than the entire
complement of V regions, the transgenic host may be immunized and
be capable of mounting a strong immune response and provide high
affinity antibodies. In this manner, relatively small DNA fragments
of the chromosome may be employed. For example., a reported 670 kb
fragment of the Ig.sub.Hu locus is contained on a NotI-NotI
restriction fragment, which would serve to provide a variety of V
regions (Berman et al., supra). Increased diversity is also
provided by recombination with the various D and J regions and
somatic mutation.
[0043] To render the host immunoglobulin loci non-functional,
homologous recombination may be employed, where DNA is introduced
at the endogenous host immunoglobulin heavy chain and light chain
loci which inhibits the production of endogenous immunoglobulin.
Because there are two heavy chain alleles and two light chain loci,
kappa and lambda, each with two alleles, although one may choose to
ignore the lambda loci, there will have to be multiple
transformations which result in inactivation of each of the
alleles. Homologous recombination may be employed to functionally
inactivate each of the loci, by introduction of the homologous DNA
via a construct that can disrupt or delete the target locus into
embryonic stem cells, followed by introduction of the modified
cells into recipient blastocysts. Subsequent breeding allows for
germ-line transmission of the inactivated locus. One can therefore
choose to breed heterozygous offspring and select for homozygous
offspring from the heterozygous parents.
[0044] In the second, alternative strategy described above, the
number of steps may be reduced by providing at least a fragment of
the human immunoglobulin locus within the construct used for
homologous recombination with the analogous endogenous
immunoglobulin, so that the human locus is substituted for at least
a part of the host immunoglobulin locus, with resulting
inactivation of the host immunoglobulin subunit locus. Of
particular interest is the use of transformation for a single
inactivation, followed by breeding of the heterozygous offspring to
produce a homozygous offspring. Where the human locus is employed
for substitution or insertion into the host locus for inactivation,
the number of transformations may be limited to three
transformations and as already indicated, one may choose to ignore
the less used locus and limit the transformations to two
transformations. Alternatively, one may choose to provide for
inactivation as a separate step for each locus, employing embryonic
stem cells from offspring which have previously had one or more
loci inactivated. In the event that only transformation is used and
the human locus is integrated into the host genome in random
fashion, a total of eight or more transformations may be
required.
[0045] For inactivation, any lesion in the target locus resulting
in the prevention of expression of an immunoglobulin subunit of
that locus may be employed. Thus, the lesion may be in a region
comprising enhancers, e.g., a 5' or 3' enhancer, or intron, in the
V, J or C regions, and with the heavy chain, the opportunity exists
in the D region, or combinations thereof. The important factor is
that Ig germ line gene rearrangement is inhibited, or a functional
message encoding the enodgenous immunoglobulin cannot be produced,
either due to failure of transcription, failure of processing of
the message, or the like. Such a lesion may take the form of a
deletion in the target gene, an insertion of a foreign gene, a
combination of an insertion and deletion, or a replacement using
xenogeneic sequences with or without introduction of a deletion in
the endogenous gene.
[0046] Preferably, when one is interested in inactivating the
immunoglobulin subunit locus, the lesion will be introduced into
one or more of the exons contained in the immunoglobulin subunit
locus, for example in the constant or J region of the locus. Thus,
one produces a targeting construct which lacks functional exons in
this region and may comprise the sequences adjacent to and upstream
and/or downstream from the J and/or C region or comprises all or
part of the region with an inactivating insertion in the J or C
exons. The insertion may be 50 bp or more, where such an insertion
results in disruption of formation of a functional mRNA. Desirably,
usually at least about 75% of the exon sequence, preferably at
least about 90% of the exon sequence, is deleted.
[0047] Desirably, a marker gene is used in the targeting construct
to replace the deleted sequences. Various markers may be employed,
particularly those which allow for positive selection. Of
particular interest is the use of G418 resistance, resulting from
expression of the gene for neomycin phosphotransferase ("neo").
[0048] In the targeting construct, upstream and/or downstream from
the target gene, may be a gene which provides for identification of
whether a homologous double crossover has occurred (negative
selection). For this purpose, the Herpes simplex virus thymidine
kinase gene may be employed, since cells expressing the thymidine
kinase gene may be killed by the use of nucleoside analogs such as
acyclovir or gancyclovir, by their cytotoxic effects on cells that
contain a functional HSV-tk (Mansour et al., Nature 336:348-352
(1988)). The absence of sensitivity to these nucleoside analogs
indicates the absence of the HSV-thymidine kinase gene and,
therefore, where homologous recombination has occurred, that a
double crossover has also occurred.
[0049] While the presence of the marker gene in the genome will
indicate that integration has occurred, it will still be necessary
to determine whether homologous integration has occurred. This can
be achieved in a number of ways. For the most part, DNA analysis by
Southern blot hybridization will be employed to establish the
location of the integration. By employing probes for the insert and
the sequences at the 5' and 3' regions flanking the region where
homologous integration would occur, one can demonstrate that
homologous targeting has occurred.
[0050] PCR may also be used with advantage in detecting the
presence of homologous recombination. PCR primers may be used which
are complementary to a sequence within the targeting construct and
complementary to a sequence outside the construct and at the target
locus. In this way, one can only obtain DNA molecules having both
the primers present in the complementary strands if homologous
recombination has occurred. By demonstrating the expected size
fragments, e.g. using Southern blot analysis, the occurrence of
homologous recombination is supported.
[0051] The targeting construct may further include a replication
system which is functional in the host cell. For the most part,
these replication systems will involve viral replication systems,
such as Simian virus 40, Epstein-Barr virus, polyoma virus,
papilloma virus, and the like. Various transcriptional initiation
systems may be employed, either from viruses or from mammalian
genes, such as SV40, metallathionein-I and II genes, .beta.-actin
gene, adenovirus early and late genes, phosphoglycerate kinase
gene, RNA polymerase II gene, or the like. In addition to
promoters, wild-type enhancers may be employed to further enhance
the expression of the marker gene.
[0052] In preparing the targeting constructs for homologous
recombination, a replication system for procaryotes, particularly
E. coli, may be included for preparing the targeting construct,
subcloning after each manipulation, analysis such as restriction
mapping or sequencing, expansion and isolation of the desired
sequence. In the case of the replacement strategy, where the
xenogeneic DNA insert is large, generally exceeding about 50 kbp,
usually exceeding 100 kbp, and usually not more than about 1000
kbp, a yeast artificial chromosome (YAC) may be used for cloning of
the targeting construct.
[0053] Once a targeting construct has been prepared and any
undesirable sequences removed, e.g., procaryotic sequences, the
construct may now be introduced into the target cell, for example
an ES cell. Any convenient technique for introducing the DNA into
the target cells may be employed. Techniques include protoplast
fusion, e.g. yeast spheroplast: cell fusion, lipofection,
electroporation, calcium phosphate-mediated DNA transfer or direct
microinjection.
[0054] After transformation or transfection of the target cells,
target cells may be selected by means of positive and/or negative
markers, as previously indicated, neomycin resistance and acyclovir
or gancyclovir resistance. Those cells which show the desired
phenotype may then be further analyzed by restriction analysis,
electrophoresis, Southern analysis, PCR, or the like. By
identifying fragments which show the presence of the lesion(s) at
the target locus, one can identify cells in which homologous
recombination has occurred to inactivate a copy of the target
locus.
[0055] The above described process may be performed first to
inactivate a heavy chain locus in an embryonic stem cell whereby
the cells are microinjected into host blastocysts which develop
into a chimeric animal. The chimeric animals are bred to obtain
heterozygous hosts. Then, by breeding of the heterozygous hosts, a
homozygous host may be obtained or embryonic stem cells may be
isolated and transformed to inactivate the second IgH locus, and
the process repeated until all the desired loci have been
inactivated. Alternatively, the light chain locus may be the first
to be inactivated. For complete elimination of the ability to
produce light chain immunoglobulin, it is desirable to inactivate
both the lambda and the kappa light chain immunoglobulin loci. At
any stage, the xenogeneic loci may be introduced.
[0056] As already indicated, the target locus may be substituted
with the analogous xenogeneic locus. In this way, the xenogeneic
locus will be placed substantially in the same region as the
analogous host locus, so that any regulation associated with the
position of the locus will be substantially the same for the
xenogeneic immunoglobulin locus. For example, by isolating the
variable region of the human IgH locus (including V, D, and J
sequences), or portion thereof, and flanking the human locus with
sequences from the murine locus, preferably sequences separated by
at least about 5 kbp, in the host locus, preferably at least about
10 kbp in the host locus, one may insert the human fragment into
this region in a recombinational event(s), substituting the human
immunoglobulin locus for the endogenous variable region of the host
immunoglobulin locus. In this manner, one may disrupt the ability
of the host to produce an endogenous immunoglobulin subunit, while
allowing for the promoter of the human immunoglobulin locus to be
activated by the host enhancer and regulated by the regulatory
system of the host.
[0057] In order to provide for the production of xenogeneic binding
proteins in a host, it is necessary that the host be competent to
provide the necessary enzymes and other factors involved with the
production of antibodies, while lacking competent endogenous genes
for the expression of heavy and light subunits of immunoglobulins.
Thus, those enzymes and other factors associated with germ line
rearrangement, splicing, somatic mutation, and the like will be
functional in the host. What will be lacking is a functional
natural region comprising the various exons associated with the
production of endogenous immunoglobulin.
[0058] The integration of introduced xenogeneic DNA may be random
or homologous depending on the particular strategy to be employed.
Thus, by using transformation, using repetitive steps or in
combination with breeding, transgenic animals may be obtained which
are able to produce xenogeneic binding proteins in the substantial
absence of light or heavy endogenous immunoglobulin. By
transformation is intended any technique for introducing DNA into a
viable cell, such as conjugation, PEG-mediated cell fusion,
transformation, transfection, transduction, electroporation,
lipofection, biolistics, or the like.
[0059] Once the xenogeneic loci, have been introduced into the host
genome, either by homologous recombination or random integration,
and host animals have been produced with the endogenous
immunoglobulin loci inactivated by appropriate breeding of the
various transgenic animals or animals derived from chimeric
animals, one can produce a host which lacks the native capability
to produce endogenous immunoglobulin, but has the capacity to
produce xenogeneic immunoglobulins with at least a significant
portion of the repertoire of the xenogeneic source.
[0060] The functional inactivation of the two copies of each of the
three host Ig loci (heavy, kappa and lambda), where the host then
contains the human IgH and the human Ig kappa and/or lambda loci
would allow for the production of purely human antibody molecules
without the production of host or host/human chimeric antibodies.
Such a host strain, by immunization with specific antigens, would
respond by the production of murine B-cells producing specific
human antibodies, which B-cells could be fused with murine myeloma
cells or be immortalized in any other manner for the continuous
stable production of human monoclonal antibodies. Methods are well
known in the art for obtaining continuous stable production of
monoclonal antibodies.
[0061] The subject methodology and strategies need not be limited
to producing complete immunoglobulins, but provides the opportunity
to provide for regions joined to a portion of the constant region,
e.g., C.sub.H1, C.sub.H2, H.sub.H3, or C.sub.H4, or combination
thereof. Alternatively, one or more of the exons of the C.sub.H and
C.sub..kappa. or C.sub..lambda. regions may be replaced or joined
to a sequence encoding a different protein, such as an enzyme,
e.g., plasminogen activator, superoxide dismutase, etc.; toxin,
e.g., ricin, abrin, diphtheria toxin, etc.; growth factor;
cytotoxic agent, e.g., TNF; receptor ligand, or the like. See, for
example, WO 89/07142; WO 89/09344; and WO 88/03559. By inserting
the protein of interest into a constant region exon and providing
for splicing of the variable region to the modified constant region
exon, the resulting binding protein may have a different C-terminal
region from the immunoglobulin. By providing for a stop sequence
with the inserted gene, the protein product will have the inserted
protein as the C-terminal region. If desired, the constant region
may be entirely substituted by the other protein, by providing for
a construct with the appropriate splice sites for joining the
variable region to the other protein.
[0062] The B-cells from the transgenic host producing
immunoglobulin or immunoglobulin analog may be used for fusion to a
murine myeloid cell to produce hybridomas or immortalized by other
conventional process, e.g., transfection with oncogenes. These
immortalized cells may then be grown in continuous culture or
introduced into the peritoneum of a compatible host for production
of ascites.
[0063] The subject invention provides for the production of
polyclonal human anti-serum or human monoclonal antibodies or
antibody analogs. Where the mammalian host has been immunized with
an immunogen, the resulting human antibodies may be isolated from
other proteins by using an affinity column, having an Fc binding
moiety, such as protein A, or the like.
[0064] The invention includes the following embodiments of
non-human hosts (see also FIG. 18):
[0065] I. Animals heterozygous for an inactive endogenous light
chain immunoglobulin gene (homozygous animals are obtained by
interbreeding);
[0066] II. Animals heterozygous for an inactive endogenous heavy
chain immunoglobulin gene (homozygous animals are obtained by
interbreeding);
[0067] III. Animals homozygous for functional endogenous light and
heavy chain immunoglobulin genes and hemizygous for (i.e.
containing one copy of) foreign, preferably human, heavy chain
immunoglobulin genes (homozygous animals are obtained by
interbreeding);
[0068] IV. Animals homozygous for functional endogenous light and
heavy chain immunoglobulin genes and hemizygous for foreign,
preferably human, light chain immunoglobulin genes (homozygous
animals are obtained by interbreeding);
[0069] V. Animals heterozygous for inactive endogenous heavy and
light chain immunoglobulin genes obtained by crossbreeding animals
of category I with animals from category II (homozygous animals are
obtained by interbreeding);
[0070] VI. Animals heterozygous for inactive endogenous heavy and
light chain immunoglobulin genes and hemizygous for foreign,
preferably human, heavy chain immunoglobulin genes obtained by
crossbreeding animals of category III with animals from category V
(animals homozygous for the inactive endogenous loci and homo- or
hemizygous for the foreign gene are obtained by interbreeding);
[0071] VII. Animals heterozygous for inactive endogenous heavy and
light chain immunoglobulin genes and hemizygous for foreign,
preferably human, light chain immunoglobulin genes obtained by
crossbreeding animals of category IV with animals from category V
(animals homozygous for the inactive endogenous loci and homo- or
hemizygous for the foreign gene are obtained by interbreeding);
[0072] VIII. Animals homozygous or heterozygous for inactive
endogenous heavy and light chain immunoglobulin genes and
hemizygous for foreign, preferably human, light and heavy chain
immunoglobulin genes, obtained by crossbreeding animals of category
VI and VII (animals homozygous for the inactive endogenous loci and
homo- or hemizygous for the foreign gene are obtained by
interbreeding);
[0073] In a preferred embodiment, the homozygous animals of
category VIII are used to produce human antibodies.
[0074] IX. Animals homozygous for functional endogenous heavy and
light chain immunoglobulin genes and hemizygous for foreign,
preferably human, heavy and light chain immunoglobulin genes,
obtained by crossbreeding animals of category III and IV
(homozygous animals are obtained by interbreeding);
[0075] X. Animals heterozygous for an inactive endogenous heavy
chain immunoglobulin gene and hemizygous for foreign, preferably
human, heavy and light chain immunoglobulin genes, obtained by
crossbreeding animals of category II and IX (animals homozygous for
the inactive endogenous loci and homo- or hemizygous for the
foreign gene are obtained by interbreeding).
[0076] XI. Animals heterozygous for an inactive endogenous light
chain immunoglobulin gene and hemizygous for foreign, preferably
human, heavy and light chain immunoglobulin genes, obtained by
crossbreeding animals of category I and IX (animals homozygous for
the inactive endogenous loci and homo- or hemizygous for the
foreign gene are obtained by interbreeding).
[0077] The invention also provides a method for introducing large
continuous, xenogeneic DNA sequences into a non-human, e.g.
mammalian, host. Usually, the sequences will be at least 100 kb,
more usually at least about 200 kb, generally ranging from about
200 to 1000 kb. Thus, one may wish to transfer a locus of interest,
such as the immunoglobulin locus, T-cell receptor locus, major
histocompatibility locus; regions of an xenogeneic chromosome,
which may include one or more genes of interest, which may or may
not have been characterized, such as the Low Density Lipoprotein
(LDL) receptor, Apolipoprotein (Apo) B, Apo E, cystic fibrosis
transmembrane conductor regulator, dystrophin, or regions of
xenogeneic chromosomes that may be involved in partial chromosome
trisomy (e.g. chromosomes 21, 7 and 10); and viruses. The DNA may
comprise wild type or defective genes for studying a variety of
diseases by creating dominant mutations or complementing recessive
mutations, for example the LDL receptor and Apo B genes can be
introduced for the study of hypercholesterolemia,
hyperlipoproteinemia and atherosclerosis, Factor VIII or IX can be
introduced for hemophilia, cystic fibrosis transmembrane
conductance regulator can be introduced for cystic fibrosis and the
dystrophin gene for muscular dystrophy. The xenogeneic DNA to be
introduced using a YAC is from a mammalian source, particularly
primates, more particularly human, other vertebrates or
invertebrates and the like. One can thus impart numerous novel
capabilities to the host, create genetic responses related to the
xenogeneic source of the DNA, provide for the production of
antibodies, provide for specific combinations of transcription
factors, provide for metabolic systems, introduce dominant
mutations or complement recessive mutations. The xenogeneic DNA may
be modified when present in a YAC. Because homologous recombination
is efficient in yeast, giving a high ratio of site-specific
integration of homologous DNA, where the homologous DNA flanks
other DNA of interest, one is able to modify the xenogeneic DNA
before introduction into an ES cell. In this way, one can introduce
defective genes into the host which express defective proteins to
mimic diseased states of the xenogeneic host, to study various
mechanisms of the interaction of defective proteins with other
xenogeneic proteins or endogenous proteins, or to study genes or
gene systems.
[0078] In general, to transfer large DNA segments, as described in
detail herein, YACs are employed which comprise a yeast centromere,
an origin of replication and telomeres bounding the DNA of
interest. Various centromeres or telomeres may be used,
particularly the centromeres from yeast chromosomes 4 and 5. The
YAC has a marker which allows for selection or screening of cells
into which the YAC becomes integrated. Not all markers allow for
efficient selection. Particularly, the HPRT gene, more particularly
human HPRT, is found to permit efficient selection of
HPRT-deficient ES cells carrying the YAC. Other known selectable or
screenable markers include hygromycin, neomycin, .beta.-gal, and
GPT. The ES cell may be derived from any non-human host, from which
ES cells are available, and can be expanded in culture, which
remain viable and functional, for which a marker for selection
exists, and where the ES cell can be introduced into an embryo and
can repopulate the host, including the germline. For the most part
this capability has been established with rodents, e.g. mice and
rats, and to a lesser extent with guinea pigs. Mice have been used
for the production of antibodies or B-lymphocytes for
immortalization for the production of antibodies. Because mice are
easy to handle, can be produced in large quantities, and are known
to have an extensive immune repertoire, mice will usually be the
animal of choice. As other species of ES cells become available,
these may also be employed in accordance with the subject
invention. Of particular interest will be small laboratory animals,
or domestic animals particularly rodents, including mice, rats,
rabbits, cows, pigs, hamsters, horses, dogs, sheep and guinea pigs,
or birds such as chickens, turkeys, etc. The ES cells may have one
or more mutations, for example lacking a particular activity. of
particular interest in this invention are ES cells that are
deficient in HPRT. In addition, fertilized eggs of certain species
may find use in accordance with the invention.
[0079] The YAC may be obtained by screening existing human YAC
libraries such as those available from the Centre d'Etude du
Polymorphisme Human (C.E.P.H.) , Paris, France, and Washington
University, St. Louis, Mo., using standard procedures.
Alternatively, the YAC is readily prepared as described in detail
herein, by joining the yeast flanking segments comprising one arm
with a centromere and telomere and another with a telomere together
with the DNA of interest. Usually there will also be one or more
markers present that allow for selection in the yeast host cells.
For yeast selection, of particular interest are markers which
complement mutations of the yeast host, such as genes involved in
the production of amino acids, purines or pyrimidines, URA3, TRP1,
LYS2, ADE2 on the YAC to complement ura3, trp1, lys2 and Ade2
mutations in the host. By providing for complementation, for the
most part only yeast cells carrying the entire- YAC will be able to
survive in a selective medium. In addition to genetic verification
that both YAC arms have been retained, it is desirable to confirm
the integrity of the YAC using a method such as pulsed-field gel
electrophoresis.
[0080] Those yeast hosts carrying the YAC may then be used as a
source of the YAC for introduction into the ES cell. Transfer of
the YAC is efficiently achieved by preparing yeast spheroplasts in
accordance with conventional ways. By degrading the outer wall,
under mild conditions, in an isotonic medium, spheroplasts are
produced in high yield. Exponentially growing ES cells are
protease-treated, e.g. trypsinized, and combined with the
spheroplasts. Conveniently, a pellet of yeast spheroplasts can be
prepared and the ES cells are spun with the pellet and exposed to a
fusogenic agent such as PEG for 1-2 minutes. The cells are then
resuspended and incubated in appropriate serrum-free medium. The
cells are then plated onto feeder cells, followed by selection in
accordance with the selective marker. For the HPRT gene, HAT medium
may be employed for selection. Surviving fusion colonies are then,
picked, expanded and analyzed. Analysis may be performed by
restriction enzyme analysis, combined with Southern blotting or
pulsed-field gel electrophoresis, or by the polymerase chain
reaction (PCR), employing appropriate primers, at least one of
which is complementary to the DNA insert, and probing with
repetitive sequences present in the xenogeneic DNA, such as Alu,
for detection of human DNA sequences. Ty, Y', rDNA, delta sequences
are used to probe for for yeast sequences. Probes for YAC ends are
used to confirm integrity of the YAC. Those cells that demonstrate
the intact or substantially intact YAC DNA integrated into the host
genome are then used in the next steps. In some clones, only a
portion or little or none of the yeast DNA becomes integrated into
the mouse genome. The integrated yeast DNA ranges from more than
about 90% of the original yeast genome to less than about 10%.
[0081] In a preferred embodiment, efficient production of
transgenic non-human hosts is provided using a process which
integrates large, at least 100 kb, xenogeneic DNA fragments, in
substantially intact form, into a host embryonic stem (ES) cell or
fertilized egg (zygote). The introduction of the xenogeneic DNA is
efficiently achieved by fusion of the ES cell with yeast
spheroplasts that contain YACs carrying the 100 kb DNA and a
selectable marker, under conditions allowing for integration of the
YAC DNA containing the marker into the ES cell genome, or by
transfection of a purified YAC into ES cells. ES cells comprising
the YAC integrated into the genome are then selected by means of
the marker, which is functional in the ES cell. For example, the
hypoxanthine phosphoribosyl transferase (HPRT) gene may be used as
a marker in HPRT deficient (HPRT-) ES cells. For producing animals
from embryonic stem cells, after transformation, the cells may be
plated onto a feeder layer in an appropriate medium, e.g. fetal
bovine serum enhanced DMEM. The ES cell may have a single targeted
locus (heterozygous), or may be manipulated by the process of
homogenotization to have both loci targeted (homozygous). The
process of homogenotization (formation of homozygotes) uses
selective pressure to grow out those cells which have the gene
targeting event on both chromosomes. Cells containing the two
targeted alleles may be detected by employing a selective medium
and after sufficient time for colonies to grow, colonies may be
picked and analyzed for the occurrence of integration or homologous
recombination. As described previously, the PCR may be used, with
primers within or outside of the construct sequence, but at the
target locus.
[0082] Those colonies which show homologous recombination may then
be used for embryo manipulation and blastocyst injection. The
selected ES cells are then introduced into embryos, by
microinjection or other means, into the appropriate host. For
example, murine blastocyts may be obtained from female animals by
flushing the uterus 3.5 days after ovulation. The modified ES cells
are then trypsinized and at least 1 and up to 15 cells may be
injected into the blastocoel of the blastocyst. After injection, at
least 1 and no more than about 10 of the blastocysts are returned
to each uterine horn of pseudo-pregnant females. The females
proceed to term and the resulting chimeric animals can be analyzed
for the presence of the YAC in their somatic cells. By "chimeric"
is meant an animal that carries cells derived from more than one
source, e.g. from the host and another animal. For example, in the
present invention a chimeric murine animal contains a genetically
engineered modification, particularly a human gene, in some of its
cells, e.g. in cells that develop from the modified embryonic stem
cells. The presence of the integrated YAC in chimeric hosts that
are generated is then analyzed. The chimeric hosts are evaluated
for germline transmission of the ES cell genome by mating, for
example chimeric mice are mated with C57BL/6J mice. Chimeric hosts
may be bred with non-chimeric hosts, either syngeneic or
allogeneic, to screen for chimeras that carry the YAC in their germ
cells. Offspring that are heterozygous for the genetic modification
are then interbred to produce progeny that are homozygous for the
modification, stably transmitting the functioning YAC construct to
their progeny.
[0083] The method of the invention for introduction of large
xenogeneic DNA segments into a non-human host, particularly a
rodent and usually a murine animal, provides for stable integration
of the DNA. Genes in the inserted DNA are found to be functional
and the resulting chimeric hosts are able to provide for germline
transmission of the integrated DNA. After breeding of the chimeric
host, transgenic heterozygous hosts are produced and are mated to
produce a homozygous animal that may be used for a wide variety of
purposes, including production of products, such as binding
proteins, for example immunoglobulins, for screening of various
drugs, for gene therapy, for example to complement for recessive
genetic disorders, to study various diseases, to study the function
and regulation of poorly mapped large DNA fragments.
[0084] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTAL
EXAMPLE I
I. Inactivation of the Mouse Heavy Chain J (J.sub.H) Genes
[0085] A. Construction of the Targeting Inactivation Vector
[0086] A 6.4 kb EcoRI fragment, containing the mouse heavy chain J
genes and flanking sequences, is cloned from a Balb/c mouse embryo
genomic library using the probes described in Sakano et al. (1981),
Nature 290:562-565. This fragment (mDJ) is inserted into
EcoRI-digested pUC19 plasmid (pmDJ). A 2.9 Kb fragment, containing
the 4 J genes, is deleted by XhoI-ScaI digestion (pmD.delta.JNeo,
see FIG. 1). An 1150 bp Xhol-BamHI fragment, containing a
neomycin-resistance gene driven by the Herpes simplex virus
thymidine kinase gene (HSV-tk) promoter and a polyoma enhancer is
isolated from pMClNeo (Thomas and Capecchi (1987) , Cell, 51,
503-512). A synthetic adaptor is added onto this fragment to
convert the BamHI end into a ScaI end and the resulting fragment is
joined to the XhoI-ScaI pmD.delta.J to form the inactivation vector
(pmD.delta.J.Neo) in which the 5' to 3' orientation of the neomycin
and the heavy chain promoters is identical. This plasmid is
linearized by NdeI digestion before transfection to ES cells. The
sequences driving the homologous recombination event are 3 kb and
0.5 kb fragments, located 5' and 3' to the neomycin gene,
respectively.
[0087] B. Culturing, Electroporation and Selection of ES Cells
[0088] The ES cell line E14TG2a (Hooper et al. (1987), Nature,
326:292-295) is cultured on mitomycin treated primary embryonic
fibroblast-feeder layers essentially as described (Doetschman et
al. (1985), J. Embryol. Exp. Morphol. 87:27-45). The embryonic
fibroblasts are prepared from embryos from C57BL/6 females that are
mated 14 to 17 days earlier with a male homozygous for a neomycin
transgene (Gossler et al. (1986) , PNAS 83:9065-9069). These cells
are capable of growth in media containing G418. Electroporation
conditions are described by (Boggs et al. (1986), Ex. Hematol. (NY)
149:988-994). ES cells are trypsinized, resuspended in culture
media at a concentration of 4.times.10.sup.7/ml and electroporated
in the presence of the targeting DNA construct at a concentration
of 12 nM in the first experiment and 5 nM DNA in the second. A
voltage of 300 V with a capacitance of 150-250 .mu.F is found
optimal with an electroporation cell of 5 mm length and 100
mm.sup.2 cross-section. 5.times.10.sup.6 electroporated cells are
plated onto mitomycin-treated fibroblasts in 100 mm dishes in the
presence of Dulbecco's modified Eagle's media (DMEM) supplemented
with 15% fetal bovine serum (FBS) and 0.1 mM 2-mercaptoethanol. The
media is replaced 24 hrs after electroporation with media
containing 200 .mu.g/ml G418.
[0089] ES colonies resulting 10-14 days after electroporation are
picked with drawn out capillary pipettes for analysis using PCR.
Half of each picked colony is saved in 24-well plates already
seeded with mitomycin-treated feeder cells. The other halves,
combined in pools of 3-4, are transferred to Eppendorf tubes
containing approximately 0.5 ml of PBS and analyzed for homologous
recombination by PCR. Conditions for PCR reactions are essentially
as described (Kim and Smithies (1988), Nucleic Acids Res.
16:8887-8893). After pelleting, the ES cells are resuspended in 5
.mu.l of PBS and are lysed by the addition of 55 .mu.l of H.sub.2O
to each tube. DNAses are inactivated by heating each tube at
95.degree. C. for 10 min. After treatment with proteinase K at
55.degree. C. for 30 min, 30 .mu.l of each lysate is transferred to
a tube containing 20 .mu.l of a reaction mixture including PCR
buffer: 1.5 .mu.g of each primer, 3U of Taq polymerase, 10% DMSO,
and dNTPs, each at 0.2 mM. The PCR expansion employs 55 cycles
using a thermocycler with 65 seconds melt at 92.degree. C. and a 10
min annealing and extension time at 65.degree. C. The two priming
oligonucleotides are TGGCGGACCGCTATCCCCCAGGAC and
TAGCCTGGGTCCCTCCTTAC, which correspond respectively to a region 650
bases 3' of the start codon of the neomycin gene and sequences
located in the mouse heavy chain gene, 1100 bases 3' of the
insertion site. 20 .mu.l of the reaction mix is electrophoresed on
agarose gels and transferred to nylon membranes (Zeta Bind).
Filters are probed with a .sup.32P-labelled fragment of the 991 bp
XbaI fragment of the J-C region.
EXAMPLE II
II. Deletion of the Mouse Ig Heavy Chain J (J.sub.H) Genes in ES
Cells
[0090] A. Construction of the Replacement Targeting Vector
[0091] A 6.1-Kb EcoRI fragment, containing the mouse immunoglobulin
heavy chain J region genes and flanking sequences, cloned from a
BALB/c mouse embryo genomic library and inserted into pUC18
(pJ.sub.H), was digested with XhoI and NaeI to delete an about 2.3
kb fragment containing the four J genes (see FIG. 2A). An about 1.1
kb XhoI-BamHI fragment, blunted at the BamHI site, containing a
neomycin resistance gene driven by the Herpes simplex virus
thymidine kinase gene (HSV-tk) promoter and polyoma enhancer was
isolated from pMC1Neo (Thomas and Capecchi (1987), Cell, 51,
503-512). This fragment was inserted into the XhoI-NaeI deleted pJH
to form the deletion vector (pmH.delta.J, see FIG. 2B), in which
the transcriptional orientation of the neomycin and the heavy chain
genes is the same. This plasmid was linearized by NdeI digestion
before transfection to ES cells. The sequences driving the
homologous recombination event are about 2.8 kb and about 1.1 kb
fragments, located 5' and 3' to the neomycin gene,
respectively.
[0092] B. Culturing, Electroporation, and Selection of ES Cells
[0093] The ES cell line E14TG2a (Koller and Smithies (1989), PNAS
USA, 86:8932-8935) was cultured on mitomycin C-treated embryonic
fibroblast feeder layers as described (Koller and Smithies (1989),
PNAS USA, 86:8932-8935). ES cells were trypsinized, resuspended in
HBS buffer (pH 7.05; 137 mM NaCl, 5 mM KCl, 2 mM CaCl.sub.2, 0.7 mM
Na.sub.2HPO.sub.4, 21 mM HEPES pH 7.1) at a concentration of
2.times.10.sup.7/ml and electroporated in the presence of 50
.mu.g/ml of the linearized inactivation vector. Electroporation was
carried out with a BioRad Gene Pulser using 240 volts and 500 .mu.F
capacitance. 5.times.10.sup.6 electroporated cells were plated onto
mitomycin C-treated fibroblasts in 100 mm dishes in the presence of
Dulbecco's modified Eagle's media (DMEM) supplemented with 15%
fetal bovine serum and 0.1 mM 2-mercaptoethanol. The media was
replaced 24 hr after electroporation with media containing 200
.mu.g/ml G418. G418-resistant ES colonies resulting from growth
12-14 days after electroporation were picked with drawn out
capillary pipettes for analysis using the polymerase chain reaction
(PCR). Half of each picked colony was transferred to an individual
well of a 24-well plate, already seeded with mitomycin C-treated
feeder cells. The other halves, combined in pools of four, were
transferred to Eppendorf tubes containing 0.3 ml of PBS and cell
lysates were prepared for PCR analysis as described by Joyner et al
(1989) Nature, 338:153-155. The PCR reaction included 5-20 .mu.l of
the cell lysate, 1 .mu.M of each primer, 1.5 U of Taq polymerase
and 200 .mu.M of dNTPs. The PCR amplification employed 45 cycles
using a thermal cycler (Perkin-Elmer Cetus), with 1 min. melt at
94.degree. C., 2 min. annealing at 55.degree. C., and 3 min.
extension at 72.degree. C. The two priming oligonucleotides are
ACGGTATCGCCGCTCCCGAT and AGTCACTGTAAAGACTTCGGGTA, which correspond
respectively to about 120 bases 5' of the BamHI site of the
neomycin gene, and to the sequences located in the mouse heavy
chain gene, about 160 bases 3' of the insertion site. Successful
homologous recombination gives rise to an about 1.4 kb fragment. 20
.mu.l of the reaction mixture is electrophoresed on 1% agarose
gels, stained with ethidium bromide and transferred to nylon
membranes (Gene Screen). Filters were probed with a
.sup.32P-labelled EcoRI-PstI about 1.4 kb fragment located in the
mouse heavy chain, 3' of the insertion site (see FIG. 2). For
further analysis, genomic DNA was prepared from ES cells, digested
with restriction enzymes as recommended by the manufacturers, and
fragments were separated on 1% agarose gels. DNA was transferred to
nylon membranes (Gene Screen) and probed with the .sup.32P-labelled
fragment as described above.
[0094] C. Analysis of G418-resistant ES Colonies
[0095] In the first experiment, PCR analysis of the pooled colonies
detected one positive PCR signal of the expected size (about 1.4
kb) out of 34 pools representing 136 G418-resistant colonies. The
four individual colonies that had contributed to this positive pool
were analyzed individually by PCR, and a positive clone, ES33D5,
was identified. Similar analysis of 540 G418-resistant colonies
obtained in the second experiment yielded 4 additional positive
clones (ES41-1, ES61-1, ES65-1, ES110-1).
[0096] In order to verify the targeted disruption of one copy of
the J genes, (the gene is autosomal and thus present in two copies)
, the PCR positive clones were expanded and genomic DNA was
prepared, digested with HindIII or with SacI and analyzed by
Southern analysis as described using the EcoRI-PstI probe.
[0097] The replacement of the J genes by insertion of the neomycin
gene by an homologous recombination event results in a HindIII
fragment, detectable with the EcoRI-PstI probe, which is about 1.9
kb longer than the equivalent fragment in the native locus, due to
the loss of two HindIII sites located in the deleted J gene region
(see FIG. 2C). Southern analysis of each of the 5 positive clones
by HindIII digestion gave a pattern which indicated that one of the
two copies of the heavy chain J genes had been disrupted. Three
labelled fragments were detected: one fragment (about 760 bp),
identical in size to that present in untreated cells at the same
intensity, one fragment (about 2.3 kb) identical in size to that
present in untreated cells, but of decreased intensity in the PCR
positive clone, and an additional fragment about 4.2 kb, the size
predicted for an homologous recombination event, present only in
the PCR-positive clones. Similarly, the replacement of the J genes
by the neomycin gene by an homologous recombination event results
in a loss of one SacI site and the appearance of a fragment,
detectable with the EcoRI-PstI probe, which is about 570 bp smaller
than the equivalent fragment in the native locus (see FIG. 2C).
Southern analysis of the clones by SacI digestion gave the expected
pattern of one native and one targeted allele: about 4.0 kb
fragment, identical in size to that detected in untreated cells,
but of decreased intensity in the 5 positive clones, and an
additional fragment of about 3.4 kb, the size predicted for a
targeted homologous recombination event, present only in the
identified clones. Rehybridization of the Southern blots with a
probe for the neomycin gene showed that only the 4.2 kb and 3.4 kb
fragments, resulting from the HindIII and the SacI digestion,
respectively, hybridized to the probe as predicted by the targeting
event.
[0098] D. Generation of Chimeric Mice with J.sub.H Deletions
[0099] Three and a half day old C57BL/6J (Jackson Laboratories, Bar
Harbor, Me.) blastocysts were obtained from 4-5 week old
superovulated females as described by Koller, et al. 1989 (supra).
ES cells were trypsinized, washed once with fresh DMEM media, and
diluted to about 1.times.10.sup.6/ml in DMEM medium containing 10%
fetal bovine serum and 20 mM HEPES, pH 7.5. 10 to 15 cells were
injected into the blastocoel of each blastocyst. ES-cell containing
blastocysts were then surgically transferred to one uterine horn of
C57BL/6J.times.DBA/2 or C57BL/6J.times.CBA F1 pseudopregnant
females.
[0100] The contribution of ES cells to the offspring was judged
visually by examination of the coat color of the pups. C57BL/6J
mice are solid black in color. The ES cell parent line E14TG2a was
isolated from 129/Ola embryos, which carry three coat color genes,
the dominant A.sup.W allele at the agouti locus, the recessive
pink-eyes-dilute allele at the p locus, and the recessive C.sup.ch
at the c locus. Chimeric offspring in which the ES cells
participated in the formation of the animal have coats containing
agouti and cream hairs.
[0101] Germline transmission ability of the chimeric mice was
evaluated by mating with a C57BL/6J mouse and scoring for F1
offspring with agouti color. 50% of these agouti mice would be
expected to inherit the mutated heavy chain allele, which can be
identified by Southern blot analysis of DNA isolated from
tails.
[0102] The J.sub.H-targeted ES cell line ES65-1, carrying one
targeted heavy chain allele, was injected into C57BL/6J mouse
blastocysts. About 45% of the surviving pups were chimeras. Two
chimeric females, 238-2 and 244-3, upon mating with C57BL/6J males,
yielded germline transmission at a frequency of 100% and 15%, as
determined by the percent of agouti offspring. Southern blot
analysis of DNA from heterozygous offspring indicated the presence
of the targeted heavy chain in addition to one native allele in 2
out of 5 agouti progeny tested.
[0103] Mice homozygous for the mutation were obtained by
intercrossing male and female mice which were identified as
J.sub.H-deleted (.delta.J.sub.H) heterozygotes. Offspring of these
matings were analyzed for the presence of the two targeted heavy
chain alleles by Southern blot analysis.
[0104] E. Analysis of B Cells from Chimeric Mice
[0105] If deletion of the J.sub.H region is sufficient to
inactivate the heavy chain locus, then it should result in complete
block of development of IgM-expressing B cells and of antibody
production. Mice which are heterozygous at the J.sub.H locus carry
one intact and functional heavy chain allele, derived from the
C57BL/6J parent, and one J.sub.H-deleted heavy chain allele which
is derived from the ES cells (129/Ola strain) . The 129 and B6
strains differ in Ig heavy chain allotypes. The ES-derived B cells
(IgM.sup.a allotype) can be distinguished from B6-derived B cells
(IgM.sup.b allotype) with allotype-specific monoclonal antibodies,
using flow cytometry analysis of antibody expressing B.
[0106] The specificity of these antibodies is shown in FIGS. 3
(A-C). Peripheral blood lymphocytes were stained with antibodies to
the B cell specific marker, B220, and with antibodies to the IgM
allotype. B cells from C57BL/6J mice stained with antibodies
directed against the IgM.sup.b allotype but not the IgM.sup.a
allotype (FIG. 3B). B cells derived from 129/Ola mice stained with
antibody against the IgM.sup.a allotype, but not the IgM.sup.b
allotype (FIG. 3A). In heterozygous (a/b F1) mice carrying one
intact ES-derived heavy chain allele and one intact
C57BL/6J-derived heavy chain allele, both allotypes were present in
equal amounts (FIG. 3C).
[0107] When B cells from mice which were heterozygous for the
J.sub.H deletion were analyzed, where the J.sub.H deleted heavy
chain allele was from the 129/Ola parent, there were no cells
positive for the IgM.sup.a allotype. All B cells were IgM.sup.b
positive, from the intact C57BL/6J heavy chain allele (FIG. 3D).
These results indicated that the J.sub.H-deleted heavy chain locus
is inactivated and cannot encode a functional IgM antibody.
[0108] Mice which were homozygous for the J.sub.H deletion were
also analyzed for the ability to produce functional antibodies.
Peripheral blood lymphocytes from homozygous mutant mice were
analyzed by flow cytometry, using antibodies to the B cell specific
marker B220, and with the allotype specific markers (see FIG. 4).
In contrast to the control mice (FIGS. 4D-F), no B220.sup.+ cells,
or IgM producing cells could be detected in the mutant mice (FIGS.
4A-C). In addition, the mutant mice had no detectable IgM in the
serum. These results indicate that the deletion of the J.sub.H
region from both heavy chain alleles leads to complete inhibition
of B cell development to mature B cells and production of
antibody.
[0109] F. Generation of Homozyqous Mutant ES Cells
[0110] The effect of J.sub.H deletion on B cells can also be
analyzed by generating ES cells with both heavy chain alleles
targeted, which are then used to produce chimeric mice which
contain a population of lymphoid cells homozygous for the
mutation.
[0111] Homozygous .delta.J.sub.H mutant ES cells were generated by
subjecting one of the heterozygous mutant ES clones, ES110-1, to
elevated levels of G418 (1.4 mg/ml) thus selecting for
homogenotization of the targeted allele. Seven of the surviving
colonies were screened by Southern blot analysis using SacI
digestion for the loss of the wild-type heavy chain allele and
acquisition of a second targeted allele. One of these clones,
ESDK207 was shown to have lost the native heavy chain allele, as
evidenced by the inability of probes to detect the wild type 4.0 kb
fragment and by the increased intensity of the 3.4 kb targeted
fragment. Karyotypic analysis of ESDK207 indicated that, like the
parent line ES110-1, about 80% of the cells had 40 chromosomes,
suggesting that two targeted alleles were present. The homozygous
mutant ES cells were microinjected into C57BL/6J blastocysts and
chimeric mice were generated.
[0112] G. Analysis of B Cells from Homozygous Chimeras
[0113] B cells from chimeric mice were analyzed to determine the
effect of J.sub.H deletion on B cell development and antibody
production. Lymphocytes from the ES cell line (129/Ola) can be
distinguished from blastocyst-derived (C57BL/6J) lymphocytes by a
monoclonal antibody to the Ly-9.1 marker, which is found on
lymphocytes of 129 origin, but not those of B6 origin. In addition,
the two strains differ in their IgM allotype, as previously
described.
[0114] The chimeras analyzed had been derived from wild-type
E14TG2a ES cells (WT) , or from ES cells that were heterozygous
(ES110-1, ES65-1) or homozygous (ESDK207) at the targeted J.sub.H
region. Peripheral blood mononuclear cells were stained with
antibodies to the B cell specific marker B220, and with antibodies
to either Ly-9.1 or IgM allotypes, and then analyzed by two-color
flow cytometry. To evaluate chimerism in the T cell lineage, the
cells were stained with antibody for the T cell marker Thy 1.2, and
with anti-Ly-9.1 antibody. Staining of cells from the parental
mouse strains provided controls for the specificity and sensitivity
of the assay.
[0115] Mice with similar degrees of chimerism, as judged by coat
color, were compared. ES-derived B and T cells were detected in the
peripheral blood of chimeric mice generated from the wild-type
E14TG2a ES cells, confirming the ability of this cell line to give
rise to lymphoid cells in vivo. Analysis of chimeras generated from
single J.sub.H-targeted ES65-1 and ES110-1 cells demonstrated the
presence of B220.sup.+/IgM.sup.a+/Ly-9.1.sup.+ B cells containing a
single, intact, ES cell-derived Ig heavy chain locus.
[0116] In contrast to the WT and single deletion chimeras, mice
generated from the homozygous mutant ESDK207 cell line lacked
Ly-9.1.sup.+/B220.sup.+ or IgM.sup.a+/B220+1 B cells in peripheral
blood. The observed lack of ESDK207-derived B cells was not due to
a lack in lymphopoiesis, since ES-derived Ly-9.1.sup.+/B220.sup.-
cells represented 12% of the total pool of peripheral blood
mononuclear cells. Of these, approximately half were Thy-1.2.sup.+
T cells. Thus, deletion of the J.sub.H region from both alleles
blocks development of mature IgM.sup.a producing B cells. Similar
observations were made for chimeric spleen cells.
[0117] Chimeras were also tested for the presence of serum IgM
derived from the ES cells. IgM.sup.a levels were high in chimeras
from wild-type ES cells and cells with a single targeted mutation,
but were undetectable in mice derived from the ESDK207 cell
line.
[0118] Further analysis showed that the bone marrow of ESDK207 mice
contained normal IgM.sup.b+ B cells derived from the blastocyst
host, but lacked ES-derived IgM.sup.a+ B cells. However,
DK207-derived bone marrow did contain a population of cells which
were B220.sup.dull/Ly-9.1.sup.+ derived from the ES cells. The bone
marrow is therefore likely to contain a subpopulation of ES
cell-derived B cell precursors, whose maturation is blocked by the
homozygous deletion of the J.sub.H region.
[0119] The bone marrow cells were also analyzed with three-color
flow cytometry, using antibodies to Ly-9.1, B220 and either CD43 or
Thy-1.2. The results show the majority of ES-derived cells were
CD43 positive, which is consistent with an early block in
maturation. Many of the cells were also positive for Thy-1.2, as
would be expected of very early B cell precursors. These data show
that deleting the J.sub.H region results in the inability of the
heavy chain locus to rearrange and produce functional IgM. Lack of
IgH rearrangement results in a block of B cell maturation,
restricting B cell progenitors to an early stage of
development.
EXAMPLE III
Deletion of the Mouse Ig Kappa Light Chain Constant (C.sub.k)
Region
[0120] A. Construction of the Replacement Targeting Vector
[0121] The kappa region was inactivated with a replacement type
vector, which was designed to delete the constant region of the
kappa locus, and replace it with the G418 drug resistance marker
through homologous recombination. Homologous recombination was
driven by regions of homology which flank the constant region (see
FIG. 5).
[0122] A genomic library from 129/Ola mouse fetal liver DNA
(stratagene) cloned into lambda phage was screened for the presence
of the mouse C.sub.k gene with a 1.6 kb HpaI/BamHI fragment
(Steinmetz and Zachau (1980) Nucleic Acids Research 8:1693-1706)
that spans the mouse kappa constant region. A lambda phage clone
which hybridized to this probe was identified, then purified and
used as a source of C.sub.k DNA. Analysis of the phage DNA showed
that the kappa constant region probe hybridized to a 5.6 kb
SphI/BamHI fragment. This fragment contained the kappa J region
genes, an intronic enhancer element and the kappa constant region.
It was then isolated and subcloned into the SphI and BamHI sites of
the plasmid pUC218 to give the plasmid pUC218/5.6kappa.
[0123] In order to construct the deletion vector, fragments
containing the 5' region of the kappa constant region, a thymidine
kinase gene for negative selection, a neomycin resistance gene and
a 3' region of homology to the kappa constant region were ligated
together (see FIG. 6).
[0124] A 4.0 kb SphI/Bsu361 fragment from the plasmid
pUC218/5.6kappa was subcloned into the SphI and Bsu361 sites of the
vector pSK.A to give the plasmid pSK.A/5'K. The vector pSK.A is a
modification of pBluescript SK-which has a synthetic
polylinker:
1 5' GCATATGCCTGAGGTAAGCATGCGGTACCGAATTCTATAAGCTTGCG
GCCGCAGCTCATGCGTATACGGACTCCATTCGTACGCCATGGCTTAAGAT ATTCGAACGCCGGCG
3'
[0125] inserted between the pBluescript KpnI and SacI sites.
[0126] A 2.7 kb EcoRI/HindIII fragment containing the herpes
thymidine kinase (TK) gene driven by the mouse phosphoglycerate
kinase gene (PGK) promoter from the plasmid pKJtk (Tybulewicz, et
al. (1991) Cell 65:1153-1163) was inserted into the EcoRI and NotI
sites of pSK.A/5'K by using a HindIII/NotI adapter with the
sequence:
[0127] 5' AGCTGGAACCCCTTGCCCTTGGGGAACGCCGG 3'.
[0128] In the resulting plasmid, pSK.A/5'K/TK, the 5' end of the TK
gene and the kappa constant region gene are adjacent to each other,
in opposite transcriptional orientations.
[0129] A 1.1 kb XhoI/BamHI fragment from pMC1Neo, which contains
the mammalian drug selectable marker for resistance to neomycin,
was cloned into the XhoI and BamHI sites of the plasmid pSK.B to
give the plasmid pSK.B/Neo. The vector pSK.B is a modification of
pBluescript SK-which has a synthetic polylinker:
2 5' GAGCTCGGATCCTATCTCGAGGAATTCTATAAGCTTCATATGTAGCT
CATGCTCGAGCCTAGGATAGAGCTCCTTAAGATATTCGAAGTATACA 3'
[0130] inserted between the pBluescript KpnI and SacI sites.
[0131] A 1.1 kb BglII/BamHI fragment from pUC218/5.6kappa, which
contains homology to the 3' end of the kappa region, was cloned
into BamHI digested, alkaline phosphatase treated pSK.C vector. The
vector pSK.C is a modification of pBluescript SK- which has a
synthetic polylinker:
3 5' AAGCTTATAGAATTCGGTACCTGGATCCTGAGCTCATAGCGGCCGCA
GCTCATGTTCGAATATCTTAAGCCATGGACCTAGGACTCGAGTATCGCCG GCG 3'
[0132] inserted between the pBluescript KpnI and SacI sites. The
resulting plasmid, pSK.C/3'K is oriented such that transcription
proceeds from the SacI site in the plasmid polylinker in the
direction of the KpnI site.
[0133] The final targeting plasmid was constructed with a three
part ligation, using (A) 6.1 kb NotI/NdeI fragment from
pSK.A/5'K/TK, (B) 1.2 kb NdeI/SacI fragment from pSK.B/Neo and (C)
4.0 kb SacI/NotI fragment from pSK.C/3'K ligated to make the
plasmid pK.TK/neo.
[0134] B. Electroporation of Kappa Deletion Vector into ES
Cells
[0135] Purified plasmid DNA from pK.TK/Neo was cut with PvuI,
extracted with phenol/chloroform and ethanol precipitated. The DNA
was resuspended after precipitation at a concentration of 1 mg/ml
in 10 mM Tris-HCl, 1 mM EDTA.
[0136] The embryonic stem cell line E14-1, a subclone of E14
(Hooper, et al. (1987) Nature 326:292-295) was cultured in DMEM 4.5
g/l glucose (J.R.H. Biosciences) supplemented with 15% heat
inactivated fetal calf serum, recombinant murine leukemia
inhibitory factor (ESGRO from Gibco BRL, 1000 U/ml), 0.1 mM
.beta.-mercaptoethanol, 2 mM glutamine and 100 U/ml penicillin at
37.degree. C. in 5% CO.sub.2.
[0137] The cells were cultured on mitomycin-treated primary
embryonic fibroblast feeder layers essentially as described (Koller
and Smithies (1989) supra). The embryonic fibroblasts were prepared
from day 14 embryos carrying the homozygous targeted mutation of
.beta.2-microglobulin (Koller and Smithies (1990) Science
248:1227-1230). These feeder cells are capable of growth in media
containing G418.
[0138] At 80% confluency, the ES cells were prepared for
electroporation by trypsinization, concentration by brief
centrifugation and resuspension in HEPES-buffered saline at
2.times.10.sup.7 cells/ml. The cells are equilibrated at room
temperature, and linearized targeting vector DNA (20 .mu.g) added.
The mixture was electroporated at 960 .mu.F and 250 V with a BioRad
Gene Pulser. The cells were left to stand at room temperature for
10 minutes before plating onto 4.times.10 cm dishes of
mitomycin-treated fibroblast feeders (3.times.10.sup.6 feeder
cells/plate). After incubation at 37.degree. C. for 48 hours, the
cells were fed media containing 150 .mu.g/ml G418 to select for
neomycin resistance. After a further 48 hours the cells were fed
media containing 150 .mu.g/ml G418 and 2 .mu.M gancyclovir (Syntex)
to select for loss of the thymidine kinase gene.
[0139] C. Analysis of Targeted ES Cells
[0140] After ten days of drug selection with both G418 and
gancyclovir, the individual surviving colonies were picked and
dissociated with a drop of trypsin in a 96 well plate, then
incubated at 37.degree. for 2 minutes. The cells from each colony
were transferred into a well of a 24-well plate containing
mitomycin C-treated feeder cells and selective media with G418, but
not gancyclovir. After an additional 5-8 days, 20% of the cells in
each well were frozen, and the remainder used to prepare genomic
DNA. The cells were lysed with 0.4 ml of 10 mM Tris-HCl (pH 7.5),
100 mM NaCl, 10 mM EDTA, 1% SDS and proteinase K (1 mg/ml) by
overnight incubation at 50.degree. C. The DNA was purified by
phenol extraction and ethanol precipitation, then washed with 70%
ethanol and resuspended in 20 .mu.l of 10 mM Tris-HCl, 1 mM
EDTA.
[0141] Southern analysis was carried out using BglII digested
genomic DNA from each sample. An about 1.2 kb BamHI/BglII fragment
which contains the region contiguous with the 3' homology fragment
in the targeting vector was used as a probe. The native ES cell
locus gave an about 2.3 kb fragment, while the targeted ES cell
locus gave an about 5.7 kb fragment. The increase in size is due to
the loss of a BglII site during the construction of the deletion
vector.
[0142] A Southern analysis of 166 clones showed two cell lines
which had the intended mutation. These clones were further analyzed
by reprobing the filters with an about 1.1 kb fragment which spans
the neo gene. As expected, the probe only hybridized to the
targeted allele.
[0143] Further analysis of the genomic DNA from the two positive
clones, 1L2-850 and 1L2-972, after being thawed and expanded,
reconfirmed the initial observations. A third probe, an about 1.7
kb HindIII/BglII fragment spanning the kappa J region locus, was
used to check for the correct integration pattern from the 5' end
of the targeting vector. using this probe with EcoRI digested
genomic DNA, an about 15 kb fragment is detected in the native
allele, and an about 5 kb fragment from the targeted locus. The
additional EcoRI site is introduced by the neo gene during
homologous recombination targeting (see FIG. 7).
[0144] D. Generation of Germline Chimeras
[0145] The unmodified E14-1 cells have been found to contribute to
the germline at a high frequency after injection into C57BL/6J
blastocysts. To generate germline chimeras containing the targeted
kappa region, the targeted cell lines 1L2-850 and 1L2-972 were
grown on primary feeder cells, then trypsinized and resuspended in
injection medium, which consists of DMEM supplemented with 15%
fetal calf serum, 20 mM HEPES (pH 7.3), antibiotics and
.beta.mercaptoethanol. The ES cells were injected into each
blastocyst, and the injected blastocysts then transferred to one
uterine horn of a pseudopregnant female mouse. Chimeric pups were
identified by chimeric coat color. Chimeric males were bred to
C57BL/6J females, and germline transmission of the 129/Ola derived
ES cells was detected by agouti coat color of the offspring.
[0146] One chimeric male from cell line 1L2-972 (about 40% ES cell
derived as judged by its coat color), upon mating with C57B1/6J
females yielded germline transmission at a frequency of 25% as
determined by the percent of agouti offspring. Chimeric males,
about 40%, 70% and 90% chimeric, from cell line 1L2-850 yielded
germline transmission at a frequencies of 90%, 63% and 33%,
respectively. Among the agouti offspring generated from the 70%
chimeric male from 1L2-850, eight F1 animals out of 12 tested were
found to be heterozygous at the kappa locus for the targeted
C.sub.K mutation by Southern analysis (a Bgl II digest using the
1.2 kb Bam HI/Bgl II fragment described above as a probe) using
genomic DNA derived from tail samples. Further breeding of a male
and female from this group of 8 F1 animals, both heterozygous for
the C.sub.K mutation, yielded one male offspring found to be
homozygous for this mutation as confirmed by Southern analysis.
[0147] E. Analysis of B Cells Obtained from Mice Targeted at the
Kappa Locus
[0148] If the kappa (.kappa.) light chain locus is inactivated
because of deletion of the light chain constant region (C.kappa.),
the joining region(J.kappa.), or both C.kappa. and J.kappa., then a
complete block in the development of .kappa.-expressing B cells
should result. Mouse embryonic stem cells containing a single copy
of the complete C.kappa. deletion (.DELTA.C.kappa.) were introduced
into mouse blastocysts as described above to produce chimeric mice.
These chimeric mice were then bred with wild-type C57BL/6 (B6)
mice, and the F1 progeny were assayed for the presence of the
.DELTA.C.kappa. mutation by Southern blotting of tail DNA. F1 mice
that carried the .DELTA.CK mutation were bred and F2 offspring were
assayed similarly for .DELTA.C.kappa.. One of 5 F2 offspring was
shown to carry a homozygous C.kappa. deletion, and another was
heterozygous, bearing both .DELTA.C.kappa. and a wild-type C.kappa.
allele. The 3 other offspring were wild-type. The presence or
absence of .kappa.-positive B cells was assayed by flow cytometric
analysis of peripheral blood B cells stained with fluorescent
antibodies that react with a pan-B cell marker (B220) or with the
.kappa. light chain. For the homozygous .DELTA.C.kappa. F2 mouse no
.kappa.-positive B cells were detected, and in the heterozygote,
there was a reduction in the frequency of .kappa. positive B cells,
consistent with the presence of a wild-type allele and a
non-functional .DELTA.C.kappa. allele. These results demonstrate
that deletion of C.kappa. from the chromosome prevents .kappa.
expression by mouse B cells.
EXAMPLE IV
Inactivation of the Mouse Immunoglobulin Kappa Light Chain J and
Constant Region
[0149] A. Design of the Targeting Experiment
[0150] The targeting vector was designed as a replacement type
vector initially to delete the constant region as well as the J
region of the kappa locus and replace it with three elements
through homologous recombination using regions of homology flanking
the constant region (FIG. 8). A diphtheria toxin gene (A chain)
flanking either or both regions of homology was included in some
cases as a negative selectable marker. The three elements consisted
of the G418 resistance drug marker, an additional DNA homology
(ADH) sequence of mouse DNA homologous to a region of the kappa
locus located upstream of the J region, and a thymidine kinase
gene. As a result of the inclusion of the ADH sequence in the
vector, this initial targeting placed a second copy of the ADH in
the locus. This duplication was then used to effect a defined
deletion of the sequences between the segments by applying
selective pressure. In this case the cell deletes the thymidine
kinase gene that lies between the two segments in order to survive
gancyclovir selection.
[0151] B. Construction of the Targeting Vector
[0152] The regions of homology were derived from a 129 mouse fetal
liver genomic library (Stratagene) which was screened using two
probes, as described above in Example III. This subclone contained
the J region, an intronic enhancer element and the constant region
of the kappa light chain locus. The second probe was a 0.8 kb EcoRI
fragment (Van Ness et al. (1981), Cell 27:593-602) that lies 2.8 kb
upstream of the J region. Phage DNA from a lambda clone positive
for this probe showed that the probe hybridized to a 5.5 kb SacI
fragment which was subcloned into the SacI site of pBluescript
SK.sup.- (Stratagene) to give the plasmid pSK.5'kappa (FIG. 8).
[0153] The inactivation vectors which contained a 5' region of
homology, a thymidine kinase gene, a ADH, a neomycin resistance
gene and a 3' region of homology (FIG. 9) flanked in some instances
by diphtheria toxin genes were constructed from three plasmids
(FIG. 8) containing: (a) the 5' fragment of homology with or
without the diphtheria toxin gene (DT) driven by the mouse
phosphoglycerate kinase gene (PGK) promoter as a negative
selectable marker, (b) the herpes thymidine kinase gene (tk) driven
by the mouse phosphoglycerate kinase gene (PGK) promoter as a
negative selectable marker along with the DSH and the G418
selectable neomycin (neo) gene from pMC1Neo (Thomas and Capecchi
(1987), Cell 51:503-12), and (c) the 3' fragment of homology with
or without the PGK driven DT gene. These three plasmids (FIG. 8)
were constructed from pSK.A, PSK.B, and pSK.C, respectively, all
derived from the plasmid pBluescript SK.sup.- by modification of
the polylinker.
[0154] The polylinker of the plasmid pBluescript SK.sup.- was
modified by cloning between the KpnI and SacI sites a synthetic
polylinker defined by the oligonucleotides
5'-GCATATGCCTGAGGGTAAGCATGCGGTACCGAATTCTA TAAGCTTGCGGCCGCAGCT-3'
AND 5'-GCGGCCGCAAGCTTATAGAATTC GGTACCGCATGCTTACCTCAGGCATATGCGTAC-3'
to create the plasmid PSK.A,
5'-GAGCTCGGATCCTATCTCGAGGAATTCTATAAGCTTCATATGT AGCT-3' and
5'-ACATATGAAGCTTATAGAATTCCTCGAGATAGGATCCHA GCTCGTAC-3' to create
plasmid pSK.8, 5'-AAGCTTATAGAATTCGGTACC
TGGATCCTGAGCTCATAGCGGCCGCAGCT-3' to create plasmid psK.B and
5'-GCGGCCGCTATGAGCTCAGGATCCAGGTACCGAATTCTATAAGCT- TG TAC-3' to
create the plasmid pSK.C.
[0155] A diphtheria toxin gene cassette was created in which the
gene was flanked by the PGK promoter and the bovine growth hormone
polyadenylation signal (Woychik et al. (1984), Proc. Natl. Acad.
Sci. U.S.A, 81:3944-3948; Pfarr et al. (1986), DNA 5:115-122). A
2.3 kb XbaI/EcoRI fragment from pTH-1 (Maxwell et al. (1986),
Cancer Res. 46:4660-4664) containing the diphtheria toxin A chain
driven by the human metallothionein (hMTII) promoter was cloned
into pBluescript SK.sup.- cut with XbaI and EcoRI to give the
plasmid pSK.DT. The hMTII promoter of pSK.DT was replaced with the
PGK promoter from pKJ1 (Tybulewicz et al. (1991), Cell
65:1153-1163). A 0.5 kb XbaI/PstI fragment from PKJ1 was joined to
a 3.1 kb XbaI/NcoI fragment from pSK.DT using a PstI/NcoI adapter
formed from the oligonucleotides 5'-GGGAAGCCGCCGC-3' and 5'-CATGGC
GGCGGCTTCCCTGCA-3' to give the plasmid pSK.pgkDT. A 248 bp fragment
containing the bovine growth hormone polyadenylation signal,
obtained by PCR amplification of bovine genomic DNA using the
oligonucleotide primers 5'-CAGGATCCAGCTGTGCCTTCTAGTTG-3' and
5'-CTGAGCTCTAGACCCATA GAGCCCACCGCA-3', was cloned into pCR1000
(Invitron Corp., San Diego, Calif.). The polyadenylation sequence
was then cloned behind the DT gene as a HindIII/PvuII fragment into
pSK.pgkDT cut with HindIII and HpaI to give the plasmid
pSK.pgkDTbovGH. The DT gene cassette from pSK.pgkDTbovGH was moved
as a 2.1 kb EcoRI/HindIII fragment into pSK.A cut with EcoRI and
NotI using a HindIII/NotI adapter formed from the oligonucleotides
5'-AGCTGGAACCCCTTGC-3' and 5'-GGCCGCAAGGGGTTCC-3' to give the
plasmid pSK.A/DT. Between the SphI and Bsu36I sites of both pSK.A
and pSK.A/DT the 5' region of homology for the kappa locus was
cloned. For this purpose a 4.0 kb SphI/Bsu361 fragment resulting
from a partial Bsu36I digest followed by a complete SphI digest of
plasmid subclone pUC218/5.6kappa was ligated to pSK.A or pSK.A/DT
to give the plasmids pSK.A/5'K and pSK.A/DT/5'K, respectively. In
the plasmid, pSK.A/DT/5'K, the 5'-end of the DT gene and kappa
fragment were adjacent to each other running in the opposite
transcriptional orientations.
[0156] The PGKtk gene from the plasmid pKJtk (Tybulewicz et al.
(1991), Cell 65:1153-1163) was cloned as a 2.7 kb EcoRI/HindIII
between the unique EcoRI and HindIII sites of pSK.B to give
pSK.B/TK. A 0.8 kb EcoRI fragment used for the ADH was cloned from
pSK.5'kappa and was ligated into the EcoRI site of pSK.B/TK to give
pSK.B/(TK/0.8K) such that the 5'-end of the tk gene and kappa
fragment were adjacent to each other running in opposite
transcriptional orientations. The 1.1 kb neo gene from pMC1Neo was
cloned as an XhoI/BamHI fragment between the same sites of
pSK.B/(TK/0.8K) to give pSK.B/(TK/0.8K/Neo). The plasmid pSK.C/3'K
containing the 3' fragment of homology was constructed.by ligating
pSK.C digested with BamHI and treated with alkaline phosphatase to
the 1.1 kb Bg1II/BamHI fragment isolated from pUC218/5.6kappa. In
pSK.C/3'K, the kappa fragment was oriented such that transcription
proceeded from the SacI in the plasmid polylinker in the direction
of the KpnI site. The 2.1 kb DT cassette from pSK.pgkDTbovGH was
cloned as an EcoRI/HindIII fragment into the same sites of pSK.C to
give pSK.C/3'K/DT.
[0157] Three-part ligations were carried out to construct the final
targeting plasmids (FIG. 9). The 4.0 kb NotI/NdeI fragment from
pSK.A/5'K, the 4.8 kb NdeI/SacI fragment from pSK.B/(TK/0.8K/Neo)
(obtained by a SacI partial followed by and NdeI digestion of the
plasmid), and the 4.0 kb SacI/NotI fragment from pSK.C/3'K were
isolated and ligated together to create pK. (TK/0.8K/Neo). The 6.1
kb NotI/NdeI fragment from pSk.A/DT/5'K, the 4.8 kb NdeI/SacI
fragment from pSK.B/(TK/0.8K/Neo), and 4.0 kb SacI/NotI fragment
from pSK.C/3'K were isolated and ligated together to create
pK.DT/(TK/0.8K/Neo). The 6.1 kb NotI/NdeI fragment from
pSK.A/DT/5'K, the 4.8 kb NdeI/SacI fragment from
pSK.B/(TK/0.8K/Neo), and 6.1 kb SacI/NotI fragment from
pSK.C/3'K/DT (obtained by a SacI partial followed by a NotI
digestion of the plasmid) were isolated and ligate together to
create pK.DT/(TK/0.8K/Neo)/DT. For electroporation, the purified
plasmid DNAs were first cut with PvuI or ApaLI, then extracted with
phenol/chloroform and precipitated by the addition of ethanol
before centrifugation. The resultant DNA pellets were resuspended
at a concentration of 1 mg/ml in 10 mM Tris-HCl, 1 mM EDTA(TE).
[0158] C. Introduction of DNA into Cells
[0159] The embryonic stem cell line E14-1 was cultured as described
above in Example III. The cells were equilibrated at room
temperature, and DNA (20 .mu.g) linearized with PvuI (as described
above) was added. The mixture was electroporated as described above
in Example III.
[0160] D. Analysis of Constant Region-Targeted ES Cells
[0161] After 7-10 days under drug selection with G418, the
individual surviving colonies were each picked and dissociated in a
drop of trypsin as described above in Example III.
[0162] Southern analysis was carried out using BgIII digested
genomic DNA from each sample. A 2.3 kb fragment was detected from
the native ES cell locus, while a larger 4.9 kb fragment was
detected from a targeted ES cell locus (FIG. 11), using as a probe
the 1.2 kb BamHI/BgIII fragment isolated from the original phage
DNA contiguous with the fragment used for the 3' homology in the
targeting vector. The fragment increased in size because the BgIII
site in the BgIII/BamHI fragment was lost in the targeting plasmid
due to the joining of a BgIII site to a BamHI site in the ligation,
and a new BgIII site located in the thymidine kinase gene is
introduced into the targeted locus.
[0163] From a screen by the Southern analysis described above, of a
total of 103 clones derived from experiments using three different
targeting plasmids, 5 cell lines were identified which carried the
intended mutation (Table 1)
4TABLE 1 C.sub.K Light Chain Targeting Result in E14-1 Number of
Number Screened Confirmed Clone Frequency of Construct by Southern
Targeted Clones Designation Targeting pK.(TK/0.8K/Neo) 44 2 625,691
1/22 pK.DT(TK/0.8/Neo) 42 2 604,611 1/21 pK.DT(TK/0.8K/Neo)DT 17 1
653 1/17
[0164] Further analysis of genomic DNA produced from 4 of the
positive clones (clones 625, 604, 611 and 653) after being thawed
and expanded, re-confirmed the initial observations. Using a second
probe, a 1.7 kb HindIII/BgIII fragment which spanned the J region
of the kappa locus, the correct integration pattern was checked for
homologous targeting at the 5' end of the targeting vector. Thus,
using this probe with an EcoRI digest of the genomic DNA, a 15 kb
fragment was detected from the unmodified allele. In contrast, a
7.8 kb fragment from the targeted allele was observed as a result
of the introduction of a new EcoRI site in the thymidine kinase
gene during the homologous integration (FIG. 11).
[0165] E. In Vitro Excision of J Region DNA from Targeted
Clones
[0166] In order to effect the desired deletion from the
homologously targeted kappa locus, cells from clone 653 were plated
on feeder cells at a density of 0.5-1.times.10.sup.6 cells/10 cm
dish in the presence of both gancyclovir (2 .mu.M) and G418 (150
.mu.g/ml). After growth for 5 days in the presence of both drugs,
clones were picked as described above into 24-well plates and grown
under G418 selection alone. After an additional 5-8 days, 20% of
the cells in each well were frozen and the remainder used to
prepare genomic DNA as previously described.
[0167] F. Analysis of J/Constant Region Deleted ES Cells
[0168] Southern analysis was carried out using BaMHI digested
genomic DNA from each sample. Using as a probe the 0.8 kb EcoRI
fragment used as the ADH in the targeting vectors, as 12.7 kb
fragment was detected from the native ES cell locus, while a larger
15.8 kb fragment was detected from the constant region-targeted ES
cell locus (FIG. 11) using DNA from clone 653. The fragment
increased in size because of the insertion of the tk gene, the ADH,
and the neo gene into the 12.7 kb BamHI fragment. There was also a
new BamHI site introduced at the 3' end of the neo gene. Using DNA
from the J/constant region deleted cells, a 5.5 kb fragment was
detected from the modified locus in addition to the 12.7 kb
fragment from the untargeted allele as predicted from analysis of
the restriction map. From this screen by Southern analysis of 2
clones produced from 1.5.times.10.sup.6 ES cells plated (clone
653), one cell line (clone 653B) was identified which carried the
intended deletion of the J and constant regions.
[0169] Further analysis of genomic DNA produced from clone 653B
after being thawed and expanded re-confirmed the initial
observations. Using the 0.8 kb EcoRI fragment, the deletion was
checked with two other restriction digests which should cut outside
of the excised region on the 5' and 3' ends of the targeting
vector. Thus using this probe with a BgIII digest of the genomic
DNA from the unexcised clone 653, a 2.6 kb fragment was detected
from both the unmodified and modified alleles, whereas an
additional 4.9 kb fragment was observed from the targeted allele
only (FIG. 11). This 4.9 kb fragment was the same as that detected
with the 1.2 kb BamHI/BgIII fragment used previously. Using DNA
from clone 653B, a BgIII digest revealed a 5.8 kb fragment in
addition to the 2.6 kb fragment from the unmodified allele. A SacI
digest of clone 653 DNA probed with the 0.8 kb EcoRI fragment
showed a 5.5 kb fragment from both the unmodified and modified
alleles and a 3.1 kb fragment from the targeted allele only (FIG.
11). The 5.5 kb fragment was also detected in DNA from clone 653B
and an additional 2.0 kb fragment. The 5.8 kb BgIII fragment and
the 2.0 kb ScaI fragment were consistent with an analysis of the
predicted restriction map for a precise excision step in which 10.3
kb of DNA were deleted including the J region, the tk gene, and one
copy of the ADH.
[0170] G. Generation of Germline Chimeras
[0171] The unmodified E14-1 cells contributed to the germline at a
high frequency after injection into C57BL/6J blastocysts. The cells
from the targeted ES cell line 691, in which only the kappa
constant region has been deleted by homologous recombination
without any negative selection, were microinjected and chimeric
animals were produced as described above in Example III. Cells from
the targeted ES cell line 653B in which both the kappa constant and
J regions were deleted are also microinjected and chimeric animals
are produced as described above. Chimeric pups are identified by
chimeric coat color. Germline transmission of the modified ES cell
is detected by the agouti coat color of the F1 offspring.
EXAMPLE V
Cloning of Human Heavy Chain Locus using Yeast Artificial
Chromosomes
[0172] A. Production of Yeast Artificial Chromosome (YAC)
Containing Human Heavy Chain
[0173] An SpeI fragment, spanning the human heavy chain
VH6-D-J-C.mu.-C.delta. region (Berman et al. (1988), EMBO J. 7:
727-738; see FIG. 15) is isolated from a human YAC library (Burke,
et al., Science, 236: 806-812) using DNA probes described by Berman
et al. (1988) EMBO J. 7:727-738. One clone is obtained which is
estimated to be about 100 kb. The isolated YAC clone is
characterized by pulsed-field gel electrophoresis (Burke et al.,
supra; Brownstein et al., Science, 244: 1348-1351), using
radiolabelled probes for the human heavy chain (Berman et al.,
supra).
[0174] B. Introduction of YAC Clones into Embryos or ES Cells
[0175] High molecular weight DNA is prepared in agarose plugs from
yeast cells containing the YAC of interest (i.e., a YAC containing
the aforementioned SpeI fragment from the IgH locus) . The DNA is
size-fractionated on a CHEF gel apparatus and the YAC band is cut
out of the low melting point agarose gel. The gel fragment is
equilibrated with polyamines and then melted and treated with
agarase to digest the agarose. The polyamine-coated DNA is then
injected into the male pronucleus of fertilized mouse embryos which
are then surgically introduced into the uterus of a psueudopregnant
female as described above. The transgenic nature of the newborns is
analyzed by a slot-blot of DNA isolated from tails and the
production of human heavy chain is analyzed by obtaining a small
amount of serum and testing it for the presence of Ig chains with
rabbit anti-human antibodies.
[0176] As an alternative to microinjection, YAC DNA is transferred
into murine ES cells by ES cell: yeast protoplast fusion (Traver et
al., (1989) Proc. Natl. Acad. Sci., USA, 86:5898-5902; Pachnis et
al., (1990), ibid 87:5109-5113). First, the neomycin-resistance
gene from pMC1Neo or HPRT or other mammalian selectable marker and
a yeast selectable marker are inserted into nonessential YAC vector
sequences in a plasmid. This construct is used to transform a yeast
strain containing the IgH YAC, and pMC1Neo (or other selectable
marker) is integrated into vector sequences of the IgH YAC by
homologous recombination. The modified YAC is then transferred into
an ES cell by protoplast fusion (Traver et al. (1989); Pachnis et
al., 1990), and resulting G418-resistant ES cells (or exhibiting
another selectable phenotype) which contain the intact human IgH
sequences are used to generate chimeric mice. Alternatively, a
purified YAC is transfected, for example by lipofection or calcium
phosphate-mediated DNA transfer, into ES cells.
EXAMPLE VI
Introduction of Human Ig Genes into Mice
[0177] A. Cloning of Human Ig Genes in Yeast
[0178] 1. Identification and Characterization of a Human IgH YAC
Clone Containing VH, D. JH, mu and delta sequences:
[0179] PCR primers for the human VH6 gene (V6A=5' GCA GAG CCT GCT
GAA TTC TGG CTG 3' and V6B=5' GTA ATA CAC AGC CGT GTC CTG G 3')
were used to screen DNA pools from the Washington University human
YAC library (Washington University, St. Louis, Mo.). Positive pools
were subsequently screened by colony hybridization and one positive
microtiter plate well, A287-C10, was identified. Two different
sized (205 kb and 215 kb) VH6-containing YACs were isolated from
the microtiter well. In addition to VH6, the smaller of the two IgH
YACs , A287-C10 (205 kb), hybridized to probes for the following
sequences:delta, mu, JH, D, VH1, VH2, and VH4. The larger of the
two IgH YACs, A287-C10 (215 kb), hybridized to the following
probes: delta, JH, D, VH1, VH2, and VH4, but not to mu. The YACs
contained sequences from at least 5 VH genes including two VH1
genes, one VH2, one VH4 and one VH6 gene. Analysis of restriction
digests indicated that the 205 kb YAC contains a deletion (about 20
kb size) that removes some, but not all of the D gene cluster, with
the remainder of the YAC appearing to be intact and in germline
configuration. PCR and detailed restriction digest analysis of the
205 kb YAC demonstrated the presence of several different D gene
family members. The 215 kb YAC appeared to contain the complete
major D gene cluster but had a deletion (about 10 kb) that removed
the mu gene. This deletion does not appear to affect the JH cluster
or the enhancer located between JH and mu genes.
[0180] The putative progenitor of the above two related IgH YACs, a
YAC of about 225-230 kb containing the entire genomic region
between the VH2 gene and the delta gene (Shin et al., 1991, supra)
(see FIG. 15), had not been identified in the A287-C10 microtiter
well. Hence, an earlier aliquot of the A287-C10 microtiter plate
well was examined in order to search for the progenitor YAC under
the assumption that it was lost during passaging of the library.
The A287-C10 microtiter well was streaked out (Washington
University, St. Louis, Mo.), and 2 of 10 clones analyzed contained
a 230 kb IgH YAC with another apparently unrelated YAC. Clone 1
contained in addition the IgH YAC, an approximately 220 kb YAC and
clone 3 in addition contained an approximately 400 kb YAC. The IgH
YAC contained mu, the complete D profile (based on a BamHI digest,
see below) and JH. The IgH YAC from clone 1 was physically
separated from the unrelated YAC by meiotic segregation in a cross
between A287-C10/AB1380 and YPH857 (genotype=MAT.alpha. ade2 lys2
ura3 trp1 HIS5 CAN1 his3 leu2 cyh2, to yield A287-C10 (230 kb)/MP
313 (host genotype=MAT.alpha. ade2 leu2 lys2 his3 ura3 trp1 can1
cyh2).
[0181] 2. Targeting of the A287-C10 kb YAC with a Mammalian
Selectable Marker. HPRT:
[0182] A YAC right arm targeting vector called PLUTO (15.6 kb) was
generated by subcloning a human HPRT minigene contained on a 6.1 kb
BamHI fragment (Reid et al., Proc. Natl. Acad. Sci. USA
87:4299-4303 (1990)) into the BamHI site in the polylinker of pLUS
(Hermanson et al., Nucleic Acids Research 19:4943-4938 (1991)). A
culture of A287-C10/AB1380 containing both the 230 kb IgH YAC and
an unrelated YAC was transformed with linearized pLUTO and Lys+
transformants were selected. The Lys+ clones were screened by
colony hybridization for the presence of mu. One clone was
identified which contained a single YAC of approximately 245 kb
which hybridized to probes for mu, HPRT and LYS2.
[0183] Southern analysis of the 230 kb A287-C10 YAC targeted with
pLUTO was carried out using a variety of probes to demonstrate the
intact, unrearranged nature of the cloned, human IgH sequences. In
most cases, the results of BamHI, HindIII and EcoRI digests were
compared to restriction data for WI38 (a human embryonic fetal
lung-derived cell line), the 205 kb and 215 kb deletion-derivatives
of A287-C10 and to published values. The diversity (D) gene profile
determined by hybridization with a D region probe (0.45 NcoI/PstI
fragment; Berman et al., 1988) demonstrated the expected four D
gene segments (D1-D4 (Siebenlist et al., 1981; Nature 294:631-635).
For example, with BamHI, four restriction fragments, 3.8 kb, 4.5
kb, 6.9 kb and 7.8 kb, were observed in A287-C10 and WI38. WI38 had
one additional larger band, presumed to originate from the
chromosome 16 D5 region (Matsuda et al., 1988, EMBO 7:1047-1051).
PCR and Southern analysis with D family-specific primers and probes
demonstrated in the 215 kb deletion-derivative YAC (which appeared
to have an intact D region with the same restriction pattern as the
230 kb YAC) the presence of 2 to 4 members of each of the following
D gene families: DM, DN, DK, DA, DXP and DLR. The J-mu intronic
enhancer, which was sequenced from cloned PCR products from the
A287-C10 230 kb YAC (primers EnA=5'TTC CGG CCC CGA TGC GGG ACT GC
3' and EnB1=5' CCT CTC CCT AAG ACT 3') and determined to be intact,
also generated single restriction fragments of approximately the
predicted sizes with BamHI, EcoRI and HindIII when probed with the
480 bp PCR product. The JH region was evaluated with an
approximately 6 kb BamHI/HindIII fragment probe spanning DHQ52 and
the entire JH region (Ravetch et al., 1981, Cell 27:583-591).
A287-C10 generated restriction fragments of approximately the
expected sizes. Furthermore, the same-sized restriction fragments
were detected with the enhancer and the JH probes (Ravetch et al.,
supra; Shin et al., 1991, supra). The approximately 18 kb BamHI JH
fragment detected in A287-C10 and WI38 also hybridized to a 0.9 kb
mu probe sequence (Ravetch et al., supra) . Hybridization with the
0.9 kb EcoRI fragment mu probe (Ravetch et al., supra) showed
restriction fragments of approximately the expected sizes (Ravetch
et al., supra; Shin et al., supra): >12 kb BamHI (approximately
17 kb expected); 0.9 kb EcoRI (0.9 kb expected) and approximately
12 kb HindIII (approximately 11 kb expected). WI38 gave the
same-sized BamHI fragment as A287-C10. The JH and DHQ52 regions
were sequenced from both of the deletion derivative YACs and both
were in germline configuration. Delta was analyzed with an exon 1
PCR product (containing the approximately 160 bp region between
primers D1B=5' CAA AGG ATA ACA GCC CTG 3' and D1D=5' AGC TGG CTG
CTT GTC ATG 3'); restriction fragments for A287-C10 were close to
those expected from the literature (Shin et al., supra) and to
those determined for WI38. The 3' cloning site of the YAC may be
the first EcoRI site 3' of delta (Shin et al., supra) or another
EcoRI site further 3'. VH gene probes for VH1, VH4 and VH6 (Berman
et al., supra), and for VH2 (Takahashi et al., 1984, Proc. Nat.
Acad. Sci. USA 81:5194-5198) were used to evaluate the variable
gene content of the YAC. A287-C10 contains two VH1 genes that
approximate the predicted sizes (Shin et al., supra; Matsuda et
al., 1993, supra); restriction analysis with the three enzymes gave
close to the expected fragment sies; e.g. with EcoRI observed bands
are 3.4 and 7.8 kb (expected are 3.4 and 7.2 kb). The predicted
size EcoRI fragments for VH4 (5.3 kb observed, 5.1 kb expected) and
for VH6 (0.8 kb observed, 0.9 kb expected) (Shin et al., supra;
Matsuda et al., supra) were present in A287-C10. The expected size
EcoRI fragment was seen for VH2 (5.5 kb observed, 5.4 kb expected),
but the BamHI and HindIII fragmentswere different from those
predicted. Coincident hybridization of the BamHI and HindIII
fragments with a pBR322 probe suggested that the EcoRI site which
is at the 5' end of the VH2 gene (Shin et al., supra) is the 5'
cloning site, thus eliminating the natural 5' HindIII site and
BamHI sites. The overall size of the YAC insert (estimated to be
approximately 220 kb) fits well with the predicted size for an
intact, unrearranged segment starting at the 5' end of the 3'-most
VH2 gene and extending to an EcoRI site 3' of the delta locus (Shin
et al., supra).
[0184] 3. Identification and Characterization of IqK YACs
Containing CK and VK Sequences:
[0185] Two YACs were identified in a screen of pulsed-field gel
(PFG) pools from the Washington University (St. Louis, Mo.) human
YAC library with a probe from the human kappa constant region (CK)
gene (2.5 kb EcoRI fragment ATCC No. 59173, Parklawn Dr.,
Rockville, Md.). The YACs, designated A80-C7 (170 kb) and A276-F2
(320 kb), contain the kappa deleting element kde, CK, JK and the
C-J intronic enhancer and extend 3' beyond kde. Extending 5' from
JK, the YACs also contain the B1, B2 and B3 VK genes determined by
hybridization and/or PCR, and possibly other VK sequences. The
A80-C7/AB1380 strain housed, in addition to the IgK YAC, an
unrelated YAC of similar size. Therefore, meiotic segregation was
used to separate these YACs; A80-C7 was crossed to YPH857 and a
meiotic product was obtained which contained only the IgK YAC
(MP8-2; host genotype=.alpha. ade2 leu2 his3 his5 lys2 ura3 trp1
can1 cyh2) . The A80-C7 and A276-F2 YACs have been targeted with
pLUTO to incorporate the human HPRT minigene into the YAC right
vector arm.
[0186] Restriction analysis of the IgK YACs A80-C7 and A276-F2
using a number of enzymes supports the conclusion that both YACs
are unrearranged (i.e., in germline configuration). For example,
BamHI digestion followed by hybridization with the CK probe
demonstrates the expected 13 kb restriction fragment (Klobeck et
al., Biol. Chem. Hoppe-Seyler 370:1007-1012 (1989)). The same-sized
band hybridizes to a JK probe (a 1.2 kb PCR product using primer
set to amplify the JK1-5 region), as predicted from the genomic map
(Klobeck et al., supra). The B3 class IV gene (probe is a 123 bp
PCR product from the B3 gene) gives a 4.9 kb BamHI and a 2.2 kb
BglII fragment, close to the published values of 4.6 kb and 2.3 kb,
respectively (Lorenz et al., Molec. Immunol. 25:479-484 (1988)).
PCR analysis of both IgK YACs as well as human genomic DNA for the
following kappa locus sequences revealed the predicted band sizes:
Kde (120 bp), CK (304 bp), C-J intronic enhancer (455 bp), JK1-5
(1204 bp), B3 VK (123 bp) and B1 VK pseudogene (214 bp). Sequences
used to design PCR primers for the CK, JK and C-J enhancer regions
are from Whitehurst et al., Nucl. Acids. Res. 20:4929-4930 (1992);
Kde is from Klobeck and Zachau, Nucl. Acids. Res. 14:4591-4603
(1986); B3 is from Klobeck et al., Nucl. Acids. Res. 13:6515-6529
(1985); and B1 is from Lorenz et al., supra.
[0187] B. Introduction of 680 kb yHPRT YAC into ES Cells
[0188] 1. Culture of yHPRT Yeast Strain and Preparation of Yeast
Spheroplasts
[0189] The 680 kb yHPRT is a YAC containing a functional copy of
the human hypoxanthine phosphoribosyltransferase (HPRT) gene cloned
from a YAC library, as described in Huxley, et al. (1991) Genomics
9:742-750. The yeast strain containing the yHPRT was grown in
uracil and tryptophan deficient liquid media, as described in
Huxley, et al. (1991) supra.
[0190] To prepare the yeast spheroplasts, a 400 ml culture of yeast
containing yHPRT was spun down and the yeast pellet was washed once
with water and once with 1 M sorbitol. The yeast pellet was
resuspended in SPEM (1 M sorbitol, 10 mM sodium phosphate pH 7.5,
10 mM EDTA pH 8.0, 30 mM .beta.-mercaptoethanol) at a concentration
of 5.times.10.sup.8 yeast cells/ml. Zymolase 20T was added at a
concentration of 150 .mu.g/ml of yeast cells, and the culture was
incubated at 30.degree. C. until 90% of the cells were spheroplasts
(usually for 15-20 minutes). The cells were washed twice in STC (1
M sorbitol, 10 mM Tris pH 7.5, 10 mM CaCl.sub.2) and resuspended in
STC at a concentration of 2.5.times.10.sup.8/ml.
[0191] 2. Culture of E14TG2a ES Cells
[0192] HPRT-negative ES cell line E14TG2a was cultured as
previously described.
[0193] 3. Fusion of ES Cells and Yeast Spheroplasts
[0194] Exponentially growing E14TG2a ES cells growing on
gelatin-coated dishes were trypsinized and washed three times with
serum-free DMEM. A pellet of 2.5.times.10.sup.8 yeast spheroplasts
was carefully overlaid with 5.times.10.sup.6 ES cells which were
spun down onto the yeast pellet. The combined pellet was
resuspended in 0.5 ml of either 50% polyethylene glycol (PEG) 1500
or 50% PEG 4000 (Boeringer Mannheim) containing 10 mM CaCl2. After
1.5 minutes incubation at room temperature or at 37.degree. C., 5
ml of serum-free DMEM were added slowly, and the cells were left at
room temperature for 30 minutes. The cells were then pelleted and
resuspended in 10 ml of ES cell complete medium (as previously
described) and were plated onto one 100 mm plate coated with feeder
cells. After 24 hours the medium was replaced with fresh medium.
Forty-eight hours post-fusion, HAT (ES media containing
1.times.10.sup.-4 M hypoxanthine, 4.times.10.sup.-7 M aminopterin,
1.6.times.10 .sup.-5 thymidine) selection was imposed.
HAT-resistant ES colonies were observed 7-10 days post-fusion in
the plates from both the different fusion conditions used. yHPRT-ES
("ESY") fusion colonies were picked and plated onto feeder-coated
wells, and expanded for further analysis.
[0195] 4. Analysis of YAC DNA Integrated into yHPRT-ES Fusion
Clones
[0196] DNA extracted form 23 yHPRT-ES fusion colonies was digested
with HindIII and subjected to Southern blot analysis (FIG. 12)
using the probes: a human repetitive Alu sequence (A) ;
pBR322-specific sequences for the right (B) and left (C) YAC vector
arms; yeast Ty repetitive sequence (D) ; yeast single copy gene
LYS2 (E) . The human HPRT probe, a 1.6 kb full length cDNA (Jolly
et al., Proc. Natl. Acad. Sci. USA 80:477-481 (1983)) was used to
confirm the presence of the human HPRT gene in ESY clones. The Alu
probe was a 300 bp BamHI fragment from the BLUR8 Alu element in
pBP63A (Pavan et al., Proc. Natl. Acad. Sci. USA 78:1300-1304
(1990)). The right and left vector arm probes were pBR322-derived
BamHI-PvuII 1.7 and 2.7 kb fragments, respectively, which
correspond to the vector sequences in pYAC4 (scheme a, b (Burke et
al., in: Guide to Yeast Genetics and Molecular Biology, Methods in
Enzymology, Guthrie and Fink, eds., Academic Press, 194:251-270
(1991)). The 4.5 kb fragment, detected by the right arm probe,
spans the region between the HindIII site at the telomere 5' end
and the first HindIII site within the human insert (scheme a). The
3 kb and 4.1 kb fragments detected by the left end probe correspond
to the region between the HindIII site at the telomere end and the
HindIII site 5' of the yeast sequences, and the region spanning
from the HindIII site 3' of the centromere into the human insert,
respectively (scheme b). The difference in the hybridization
intensity of these two bands relates to the difference in the
amount of homology between these fragments and the probe. The yeast
Ty repetitive probe (Philippsen et al., in Gene Expression in
Yeast, Proceedings of the Alko Yeast Symposium, Helsinki, Korhola
and vaisanen, eds., Foundation for Biotechnical and Industrial
Fermentation Research, 1:189-200 (1983)) was a 5.6 kb XhoI fragment
isolated from Ty1-containing pJEF742 which could also detect the 3'
HindIII fragment of Ty2, due to the homology between the two
elements. The LYS2 gene probe was a 1.7 BamHI fragment from pLUS
(Hermanson et al., Nuc. Acids. Res. 19:4943-4948 (1991)).
[0197] Hybridization with a human HPRT probe (full length 1.6 kb
cDNA probe) demonstrated that all the clones analyzed contained the
same 15, 7 and 5 kb exon-containing fragments of the human HPRT
gene as the yHPRT YAC. Reprobing the same blots with a human
repetitive Alu sequence 300 bp probe indicated that all the clones
analyzed contained most, if not all, the Alu-containing fragments
present in yHPRT (FIG. 12A). These data indicate that in most of
the clones analyzed the 680 kb human insert had not been detectably
rearranged or deleted upon integration into the ES cell genome.
Integration of YAC vector sequences was examined using probes
specific for the vector arms. Rehybridization of the same blots
with a probe for the right YAC vector arm, detecting a 4.5 kb
HindIII fragment, indicated that in 10 out of 23 of the clones
analyzed, the right YAC arm up to the telomere was still intact and
unrearranged and linked to the human insert (FIG. 12B) thus
providing further evidence for the integrity of the YAC in these
clones. The left arm probe detected the 3 kb and 4.1 kb HindIII
yHPRT fragments in 18 out of the 20 clones analyzed (FIG. 12C),
indicating a high frequency of left arm retention.
[0198] The structural integrity of yHPRT in ESY clones was further
evaluated for two clones (ESY 5-2 and 8-7) using pulsed-field gel
restriction analysis. In yeast carrying yHPRT, five Sfi fragments
of the following approximate sizes were defined by different
probes: 315 kb (Alu, left arm), 145 kb (Alu, HPRT); 95 kb (Alu,
right arm), 70 and 50 kb (Alu only). In both ES clones, the
internal HPRT and Alu-specific fragments were similar in size to
the yHPRT fragments. The end fragments detected for both clones
were larger than those in yHPRT, as expected for YACs integrated
within a mouse chromosome: 185 and 200 kb for the right end
fragment, respectively, and over 800 kb for the left end fragment
for both clones. These data, together with the Alu profile, provide
additional evidence for the retention of the structural integrity
of the YAC in these clones. These studies were complemented by
fluorescence in-situ hybridization carried out on ESY 8-7 (FIG. 13
A, B) and ESY 8-6 metaphase chromosome spreads in which a single
integration site was detected for the human sequences.
Photomicrographs of representative metaphase spreads (FIG. 13 A, B,
C) or interphase nuclei (FIG. 13D) from ESY 8-7 cells (FIG. 13 A,
B) hybridized with biotinylated human genomic sequences and ESY 8-6
cells (FIG. 13 C, D) hybridized with biotinylated yeast repeated
DNA sequences. The human probe was generated from human genomic
placental DNA (Clontech, Palo Alto, Calif.). The yeast probe
consisted of a mix of DNA fragments encoding the yeast repeated
elements; delta (a 1.08 kb Sau3A fragment of pdelta6 (Gafner et
al., EMBO J. 2:583-591 (1983)) and Ty (a 1.35 kb EcoRI-SaII
fragment of p29 (Hermanson et al., Nuc. Acids. Res. 19:4943-4948
(1991)), the rDNAs (a 4.6 kb BgIIIk-A L90 and a 4.4 kb BgIII-B L92
fragment (Keil and Roeder, Cell 39:377-386 (1984)), and the Y'
telomere elements (2.0 and 1.5 kb BgIII-HindIII fragments of p198
(Chan and Tye, Cell 33:563-573 (1983)). Hybridization of sequences
on chromosome metaphase spreads with biotinylated probes and
detection by Avidin-FITC followed by biotin-anti-Avidin and
Avidin-FITC amplification was carried as described by Trask and
Pinkel, Methods Cell Biol. 30:383-400 (1990), using a Zeiss
Axiophot microscope. Chromosomes were counterstained with propidium
iodide. The photomicrographs shown are representative of 95% of the
metaphase spreads or interphase nuclei scanned in three independent
experiments carried out with the human or the yeast probes. A
single integration site was detected for the human sequences.
[0199] The same blots were also probed with the yeast Ty repetitive
element sequence to detect the presence of yeast genomic DNA
sequences in the ESY clones (FIG. 12 D) . Whereas some of the
clones were found to contain most of the Ty-containing fragments
present in the parental yeast strain, some of the clones were found
to have a very small fraction, if at all, of the Ty-containing
fragments. These results indicate that in some ES clones, although
the YAC DNA is integrated intact, little or no yeast genomic DNA
was integrated. To determine if the yeast chromosomal DNA was
integrated at single or multiple sites within the ES cell genome,
fluorescent in-situ hybridization was performed on ESY clone 8-6
which had a complete Ty profile. A single integration site was
detected using a combined yeast repetitive probe (FIG. 13 C, D),
indicating that within the limits of resolution, all yeast DNA
fragments integrated in one block.
[0200] Using the ability of ES cells to undergo in vitro orderly
differentiation, YAC stability and the effect of integrated DNA on
the pluripotency of ES cells was investigated. Four ES clones,
containing different amounts of yeast DNA (ESY 5-2, 3-6, 8-6 and
8-7) exhibited a differentiation pattern indistinguishable from
that of unfused ES cells: formation of embryoid bodies giving rise
to a variety of differentiated cell types (FIG. 14 A). Southern
blot analysis was performed on DNA extracted from differentiated
ESY 5-2, 3-6, 8-5 and 8-6 (20 .mu.g) and yHPRT in AB1380 (40 ng)
using (a) a human Alu probe; (b) yeast Ty sequences. ES clones were
induced to form embryoid bodies by culturing them as aggregates in
suspension for 10-14 days as described by Martin and Evans, Cell
6:467-474 (1975). Following their reattachment to tissue culture
substratum, ESY-derived embryoid bodies gave rise to differentiated
cell types. YAC and yeast DNA sequences were stably retained by the
differentiated ES clones during 40 days of culture in non-selective
medium, demonstrating that the stably integrated foreign DNA did
not impair the pluripotency of the ES cells (FIG. 14 B). The
differentiated cultures maintained a functional human HPRT gene as
evidenced by their normal growth and differentiation when
transferred to HAT-selective medium.
[0201] 5. Generation of Chimeric Mice from yHPRT-ES Cell Lines
[0202] The ability of ESY cells to repopulate mice, including the
germline, was demonstrated by microinjection of ES cells into mouse
blastocysts and the generation of chimeric mice. ESY cells were
microinjected into C57BL/6J mouse blastocysts, and chimeric mice
were generated as previously described. Chimeric males were mated
with C57BL/6J females and germline transmission was determined by
the presence of agouti offspring. Genomic DNA prepared from the
tails of the chimeric mice were analyzed for the presence of the
yHPRT DNA in the mouse genome by PCR analysis. The presence of the
YAC left arm was analyzed using the two priming oligonucleotides,
5' TTCTCGGAGCACTGTC CGACC and 5' CTTGCGCCTTAAACCAACTTGGTACCG, which
were derived, respectively, from the pBR322 sequences and the SUP4
gene within the YAC left vector arm. A 259 bp PCR product was
obtained from the analysis of the yeast containing yHPRT and the
ESY cell lines. PCR analysis of tail DNA prepared from 18 chimeric
mice generated from ESY cell lines ESY3-1 ESY3-6 and ESY5-2, gave
rise to the expected PCR product, thus indicating the presence of
the YAC left vector arm in the genome of the chimeric mice.
[0203] 6. Germline Transmission of yHPRT
[0204] Chimeric males, with coat color chimerism of 30-60%, derived
from the ESY cell lines ESY3-1 and ESY5-2 were set up for mating
for germline transmission evaluation, i.e. to determine whether the
genetic modification was passed via the germ cells (sperm or
oocytes) to the progeny of the animals. Three of the chimeric
ESY3-1 derived males, 394/95-1, 394/95-2 and 411-1 transmitted the
ES cell genome to their offspring at a frequency of 20%, 30% and
30%, respectively. Southern blot analysis of tail DNA from the
agouti pups indicated the presence of the yHPRT in the genome of
three mice, 4-2, 4-3 and 5-1, derived from the 394/395-2 chimera.
The Alu profile obtained from such analysis was indistinguishable
from that of the parent ES3-1 cell line (FIG. 14 C), demonstrating
that the 680 kb human insert was transmitted faithfully through the
mouse germline.
[0205] Using a human HPRT-specific PCR assay on mRNA-derived cDNAs
from a yHPRT-containing offspring, the expression of the human HPRT
gene in all the tissues tested was detected (FIG. 15 A and B), thus
demonstrating the transmitted YAC retained its function with
fidelity. In this experiment, human HPRT mRNA was detected by
reverse transcription (RT)-PCR in ES, ESY 3-1 and Hut 78 (human)
cells, spleen and liver from a control mouse (C) or the 4-3 agouti
offspring (derived from the 394/95-2 chimera) and a sample
containing no template DNA (indicated as "-" FIG. 15A). Reverse
transcription of poly (A+) RNA and PCR amplification of specific
cDNA sequences were performed using the cDNA Cycle Kit
(Invitrogen). Specific amplification of a 626 bp fragment from
human HPRT cDNA in the presence of murine HPRT cDNA was performed
as outlined by Huxley et al, supra. Integrity of all RNA samples
was demonstrated by PCR amplification of cDNAs for the mouse
.gamma.-interferon receptor. The primers used to amplify a 359 bp
fragment were: GTATGTGGAGCATAACCGGAG and CAGGTTTTGTCTCTAACGTGG. The
human HPRT and the .gamma.-interferon receptor primers were
designed to eliminate the possibility of obtaining PCR products
from genomic DNA contamination. PCR products were analyzed by
electrophoresis and visualized with ethidium bromide. The size
markers are 1 kb ladder (BRL). The results of detection of mouse
.gamma.-interferon receptor mRNA by RT-PCR in the samples described
above are shown in FIG. 15B. The specific human HPRT mRNA was also
detected in the other tissues tested (brain, kidney and heart)
derived from the 4-3 mouse. Comparable steady-state levels of mouse
and human HPRT mRNA were detected in the liver of yHPRT-containing
progeny. These results indicate that the uptake of as much as 13
megabases of yeast genomic DNA was not detrimental to proper
development, germline transmission or gene expression.
[0206] The above results demonstrate that yeast spheroplasts are an
effective vehicle for the delivery of a single copy large molecular
weight DNA fragment into ES cells and that such molecules are
stably and functionally transmitted through the mouse germline. The
Alu profiles, complemented by PFGE analysis and in situ
hybridization for some of the ES clones, strongly argue that the
majority of the clones contained virtually all the human insert in
unrearranged form (i.e. in "germline configuration"), with a high
frequency of clones (40%) also retaining both YAC arms. The
significant uptake of yeast genomic DNA was not detrimental to
proper differentiation of ES cells in vitro and in vivo and did not
prevent germline transmission or gene expression. kg these methods,
one can transmit large fragments of genomic DNA as inserts into
non-human animal genomes, where the inserts may be transmitted
intact by germline transmission. Therefore, a wide variety of
xenogeneic DNA can be introduced into non-human hosts such as
mammals, particularly small laboratory animals, that may impart
novel phenotypes or novel genotypes. For example, one can provide
in small laboratory animals genes of a mammal, such as a human, to
study the etiology of a disease, the response to human genes to a
wide variety of agents. Alternatively, one can introduce large loci
into a mammalian host to produce products of other species, for
example humans, to provide human protein sequences of proteins such
as immunoglobulins, T-cell receptors, major histocompatibility
complex antigens, etc.
Introduction of Heavy Chain YAC A287-C10 and Kappa Chain YAC A80-C
into ES Cells and Embryos
[0207] Yeast containing the human heavy chain YAC A287-C10 targeted
with pLUTO (yA287-C10) were spheroplasted and fused with the
HPRT-deficient ES cell line E14.1TG3B1 as described above. Ten
HAT-resistant ES (ESY) clones (2B, 2C, 2D, 3A, 3B, 5C, 1125A,
1125E, 100/1500 and 100/4000) were picked and were expanded for DNA
analysis. Evaluation of the integrated YAC was performed by
Southern blot analysis of HindIII-digested DNA from these clones,
using human heavy chain probes for the D, J.sub.H, .mu., and VH2
regions, decribed above. All ESY clones were found to contain the
expected >10 kb J.sub.H and .mu. fragments. All ESY clones
except 2D and 5C clones, were found to contain the 4.8 kb VH2 kb
fragment. All ESY clones, except 2D and 3B were found to contain
the expected 10 and 7.6 kb D gene fragments. Yeast genomic
sequences were detected by hybridization to the yeast repetitive Ty
element in all ESY clones except 2B, 2D, 100/1500 and 5C. ESY
clones 2B, 3A and 5C were microinjected into C57B/6 blastocysts as
described above and chimeric mice (10 from 2B clone, 1 from 3A
clone and 1 from 5C clone) were generated. Southern blot analysis
of tail DNA from 10 of these chimeric animals, indicated the
presence of most, if not all, of the apparent 10 Alu fragments,
detected in yA287-C10 in yeast, as well as the presence of VH.sub.2
and D gene fragments. The generated chimeric mice were bred with
C57BL16J mice for germline transmission evaluation. A chimeric male
78K-3 derived from the 2B clone transmitted the ES cell genome to
its offspring at a frequency of 100%. Southern blot analysis of
tail DNA from 4 out of 6 agouti mice pups indicated the presence of
human heavy chain sequences.
[0208] Fusion experiments with yeast containing the human kappa
chain YAC A80-C7 targeted with pLUTO (yA80-C7) with E14.1TG3B1 ES
cells generated 2 HAT-resistant ESY clones: M4.4.1 and M5.2.1.
Southern blot analysis of HindIII-digested DNAs from these clones
revealed the presence of all the apparent 10 Alu fragments detected
in yA80-C7 in yeast. In both clones yeast genomic sequences were
integrated. ESY clones were microinjected into C57B1/6J blastocysts
and chimeric mice were generated.
EXAMPLE VII
Production of Human Ig by Chimeric Mice by Introduction of Human Ig
using Homologous Recombination
[0209] As an alternative approach to that set forth in Examples
I-VI, human Ig genes are introduced into the mouse Ig locus by
replacing mouse heavy and light chain immunoglobulin loci directly
with fragments of the human heavy and light chain loci using
homologous recombination. This is followed by the generation of
chimeric transgenic animals in which the embryonic stem-cell
derived cells contribute to the germ line.
[0210] A. Construction of Human Heavy Chain Replacement Vector.
[0211] The replacing human sequences include the SpeI 100 kb
fragment of genomic DNA which encompasses the human
VH6-D-J-C.mu.-C.delta. heavy chain region isolated from a human-YAC
library as described before. The flanking mouse heavy chain
sequences, which drive the homologous recombination replacement
event, contain a 10 kb BamHI fragment of the mouse
C.epsilon.-C.alpha. heavy chain and a 5' J558 fragment comprising
the 5' half of the J558 fragment of the mouse heavy chain variable
region, at the 3' and 5' ends of the human sequences, respectively
(FIG. 16). These mouse sequences are isolated from a mouse embryo
genomic library using the probes described in Tucker et al. (1981),
PNAS USA, 78: 7684-7688 and Blankenstein and Krawinkel (1987,
supra) , respectively. The 1150 bp XhoI to BamHI fragment,
containing a neomycin-resistance gene driven by the Herpes simplex
virus thymidine kinase gene (HSV-tk) promoter and a polyoma
enhancer is isolated from pMC1Neo (Koller and Smithies, 1989,
supra). A synthetic adaptor is added onto this fragment to convert
the XhoI end into a BamHI end and the resulting fragment is joined
to the BamHI mouse C.epsilon.-C.alpha. in a plasmid.
[0212] From the YAC clone containing the human heavy chain locus,
DNA sequences from each end of the insert are recovered either by
inverse PCR (Silverman et al. (1989), PNAS, 86:7485-7489), or by
plasmid rescue in E. coli, (Burke et al., (1987); Garza et al.
(1989) Science, 246:641-646; Traver et al., 1989) (see FIG. 8). The
isolated human sequence from the 5'V6 end of the YAC is ligated to
the mouse J558 sequence in a plasmid and likewise, the human
sequence derived from the 3'Cd end of the YAC is ligated to the Neo
gene in the plasmid containing Neo and mouse C.epsilon.-C.alpha.
described above. The human V6-mouse J558 segment is now subcloned
into a half-YAC cloning vector that includes a yeast selectable
marker (HIS3) not present in the original IgH YAC, a centromere
(CEN) and a single telomere (TEL). The human C.delta.-Neo-mouse
C.epsilon.-C.alpha. is likewise subcloned into a separate half-YAC
vector with a different yeast selectable marker (LEU2) and a single
TEL. The half-YAC vector containing the human V6 DNA is linearized
and used to transform a yeast strain that is deleted for the
chromosomal HIS3 and LEU2 loci and which carries the IgH YAC.
Selection for histidine-prototrophy gives rise to yeast colonies
that have undergone homologous recombination between the human V6
DNA sequences and contain a recombinant YAC. The half-YAC vector
containing the human C.delta. DNA is then linearized and used to
transform the yeast strain generated in the previous step.
Selection for leucine-prototrophy results in a yeast strain
containing the complete IgH replacement YAC (see FIG. 16).
Preferably, both targeting events are performed in a single
transformation step, selecting simultaneously for leucine and
histidine prototrophy. This is particularly useful when the
original centric and acentric YAC arms are in opposite orientation
to that shown in FIG. 16. This YAC is isolated and introduced into
ES cells by microinjection as described previously for embryos.
EXAMPLE VIII
Crossbreeding of Transgenic Mice
[0213] A. Generation of Human Monoclonal Antibody Producing
Mice
[0214] Mice containing the human immunoglobulin locus are mated to
mice with inactivated murine immunoglobulin genes to generate mice
that produce only human antibodies. Starting with four heterozygous
strains, three generations of breeding are required to create a
mouse that is homozygous for inactive murine kappa and heavy chain
immunoglobulins, and heterozygous for human heavy and kappa chain
immunoglobulin loci. The breeding scheme is shown in FIG. 17.
EXAMPLE IX
Production of Human Monoclonal Antibodies
[0215] A. Immunization of Mice
[0216] Germline chimeric mice containing integrated human DNA from
the immunoglobulin loci are immunized by injection of an antigen in
adjuvant. The mice are boosted with antigen 14 days after the
primary immunization, repeated after 35 and 56 days. A bleed is
done on the immunized animals to test the titer of serum antibodies
against the immunizing antigen. The mouse with the highest titer is
sacrificed, and the spleen removed.
[0217] B. Fusion of Splenocytes
[0218] Myeloma cells used as the fusion partner for the spleen
cells are thawed 6 days prior to the fusion, and grown in tissue
culture. One day before the fusion, the cells are split into fresh
medium containing 10% fetal calf serum at a concentration of
5.times.10.sup.5 cells/ml. On the morning of the fusion the cells
are diluted with an equal volume of medium supplemented with 20%
fetal calf serum and 2.times. OPI (3 mg/ml oxaloacetate, 0.1 mg/ml
sodium pyruvate and 0.4 IU/ml insulin) solution.
[0219] After sacrificing the mouse, the spleen is aseptically
removed, and placed in a dish with culture medium. The cells are
teased apart until the spleen is torn into fine pieces and most
cells have been removed. The cells are washed in fresh sterile
medium, and the clumps allowed to settle out.
[0220] The splenocytes are further washed twice by centrifugation
in medium without serum. During the second wash, the myeloma cells
are also washed in a separate tube. After the final wash the two
cell pellets are combined, and centrifuged once together.
[0221] A solution of 50% polyethylene glycol (PEG) is slowly added
to the cell pellet while the cells are resuspended, for a total of
two minutes. 10 ml of prewarmed medium is added to the cell
solution, stirring slowly for 3 minutes. The cells are centrifuged
and the supernatant removed. The cells are resuspended in 10 ml of
medium supplemented with 20% fetal calf serum, 1.times. OPI
solution and 1.times. AH solution (58 .mu.M azaserine, 0.1 mM
hypoxanthine). The fused cells are aliquoted into 96-well plates,
and cultured at 37.degree. for one week.
[0222] Supernatant is aseptically taken from each well, and put
into pools. These pools are tested for reactivity against the
immunizing antigen. Positive pools are further tested for
individual wells. When a positive well has been identified, the
cells are transferred from the 96-well plate to 0.5 ml of medium
supplemented with 20% fetal calf serum, 1.times. OPI, and 1.times.
AH in a 24-well plate. When that culture becomes dense, the cells
are expanded into 5 ml, and then into 10 ml. At this stage the
cells are sub-cloned so that a single antibody producing cell is in
the culture.
[0223] In accordance with the above procedures, a chimeric
non-human host, particularly a murine host, may be produced which
can be immunized to produce human antibodies or analogs specific
for an immunogen. In this manner, the problems associated with
obtaining human monoclonal antibodies are avoided, because the
transgenic host can be immunized with immunogens which could not be
used with a human host. Furthermore, one can provide for booster
injections and adjuvants which would not be permitted with a human
host. The resulting B-cells may then be used for immortalization
for the continuous production of the desired antibody. The
immortalized cells may be used for isolation of the genes encoding
the immunoglobulin or analog and be subjected to further molecular
modification by methods such as in-vitro mutagenesis or other
techniques to modify the properties of the antibodies. These
modified genes may then be returned to the immortalized cells by
transfection to provide for a continuous mammalian cellular source
of the desired antibodies. The subject invention provides for a
convenient source of human antibodies, where the human antibodies
are produced in analogous manner to the production of antibodies in
a human host. The animal host cells conveniently provide for the
activation and rearrangement of human DNA in the host cells for
production of human antibodies.
[0224] In accordance with the subject invention, human antibodies
can be produced to human immunogens, eg. proteins, by immunization
of the subject host mammal with human immunogens. The resulting
antisera will be specific for the human immunogen and may be
harvested from the serum of the host. The immunized host B cells
may be used for immortalization, eg. myeloma cell fusion,
transfection, etc. to provide immortal cells, eg. hybridomas, to
produce monoclonal antibodies. The antibodies, antiserum and
monoclonal antibodies will be glycosylated in accordance with the
species of the cell producing the antibodies. Rare variable regions
of the Ig locus may be recruited in producing the antibodies, so
that antibodies having rare variable regions may be obtained.
[0225] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0226] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
* * * * *