U.S. patent application number 10/369121 was filed with the patent office on 2003-12-11 for vaccines comprising synthetic genes.
Invention is credited to Davies, Mary Ellen, Freed, Daniel C., Liu, Margaret A., Perry, Helen C., Shiver, John W..
Application Number | 20030229214 10/369121 |
Document ID | / |
Family ID | 27555717 |
Filed Date | 2003-12-11 |
United States Patent
Application |
20030229214 |
Kind Code |
A1 |
Shiver, John W. ; et
al. |
December 11, 2003 |
Vaccines comprising synthetic genes
Abstract
Synthetic polynucleotides comprising a DNA sequence encoding a
peptide or protein are provided. The DNA sequence of the synthetic
polynucleotides comprise codons optimized for expression in a
nonhomologous host. The invention is exemplified by synthetic DNA
molecules encoding HIV env as well as modifications of HIV env. The
codons of the synthetic molecules include the projected host cell's
preferred codons. The synthetic molecules provide preferred forms
of foreign genetic material. The synthetic molecules may be used as
a polynucleotide vaccine which provides immunoprophylaxis against
HIV infection through neutralizing antibody and cell-mediated
immunity. This invention provides polynucleotides which, when
directly introduced into a vertebrate in vivo, including mammals
such as primates and humans, induces the expression of encoded
proteins within the animal.
Inventors: |
Shiver, John W.;
(Doylestown, PA) ; Davies, Mary Ellen;
(Norristown, PA) ; Freed, Daniel C.; (King of
Prussia, PA) ; Liu, Margaret A.; (Rosemont, PA)
; Perry, Helen C.; (Lansdale, PA) |
Correspondence
Address: |
VAN DYKE & ASSOCIATES, P.A.
7200 LAKE ELLENOR DRIVE, SUITE 252
ORLANDO
FL
32809
US
|
Family ID: |
27555717 |
Appl. No.: |
10/369121 |
Filed: |
February 17, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10369121 |
Feb 17, 2003 |
|
|
|
09340798 |
Jun 28, 1999 |
|
|
|
6534312 |
|
|
|
|
09340798 |
Jun 28, 1999 |
|
|
|
08877418 |
Jun 17, 1997 |
|
|
|
10369121 |
Feb 17, 2003 |
|
|
|
09342404 |
Jun 28, 1999 |
|
|
|
09342404 |
Jun 28, 1999 |
|
|
|
08802368 |
Feb 19, 1997 |
|
|
|
60020166 |
Jun 21, 1996 |
|
|
|
60020165 |
Jun 21, 1996 |
|
|
|
60012082 |
Feb 22, 1996 |
|
|
|
Current U.S.
Class: |
536/23.1 |
Current CPC
Class: |
C07K 2319/00 20130101;
C12N 15/67 20130101; C07K 14/005 20130101; A61K 2039/51 20130101;
C12N 2740/16122 20130101 |
Class at
Publication: |
536/23.1 |
International
Class: |
C07H 021/04 |
Claims
What is claimed is:
1. A synthetic polynucleotide comprising a DNA sequence encoding a
peptide or protein, the DNA sequence comprising codons optimized
for expression in a nonhomologous host.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of co-pending U.S.
application Ser. No. 09/340,798, filed Jun. 28, 1999, granted,
which is a continuation of U.S. application Ser. No. 08/877,418,
filed Jun. 17, 1997, now abandoned, which claims the benefit of
priority of U.S. Provisional Applications, Serial Nos. 60/020,166
and 60,020,165, both filed Jun. 21, 1996. This application also is
a continuation in part of co-pending U.S. application Ser. No.
09/342,404 filed Jun. 28, 1999, now abandoned, which is a
continuation of co-pending U.S. application Ser. No. 08/802,368,
filed Feb. 19, 1997, now abandoned, which claims the benefit of
priority of U.S. Provisional Application, Serial No. 60/012,082,
filed Feb.22, 1996. The benefit of priority is claimed to all of
the foregoing applications under 35 U.S.C. Sections 119 and 120,
and the disclosures of each application are incorporated herein by
reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] 1. HIV Infection:
[0003] Human Immunodeficiency Virus-1 (HIV-1) is the etiological
agent of acquired human immune deficiency syndrome (AIDS) and
related disorders. HIV-1 is an RNA virus of the Retroviridae family
and exhibits the 5'LTR-gag-pol-env-LTR3' organization of all
retroviruses. In addition, HIV-1 comprises a handful of genes with
regulatory or unknown functions, including the tat and rev genes.
The env gene encodes the viral envelope glycoprotein that is
translated as a 160-kilodalton (kDa) precursor (gp160) and then
cleaved by a cellular protease to yield the external 120-kDa
envelope glycoprotein (gp120) and the transmembrane 41-kDa envelope
glycoprotein (gp41). Gp120 and gp41 remain associated and are
displayed on the viral particles and the surface of HIV-infected
cells. Gp120 binds to the CD4 receptor present on the surface of
helper T-lymphocytes, macrophages and other target cells. After
gp120 binds to CD4, gp41 mediates the fusion event responsible for
virus entry.
[0004] Infection begins when gp120 on the viral particle binds to
the CD4 receptor on the surface of T4 lymphocytes or other target
cells. The bound virus merges with the target cell and reverse
transcribes its RNA genome into the double-stranded DNA of the
cell. The viral DNA is incorporated into the genetic material in
the cell's nucleus, where the viral DNA directs the production of
new viral RNA, viral proteins, and new virus particles. The new
particles bud from the target cell membrane and infect other
cells.
[0005] Destruction of T4 lymphocytes, which are critical to immune
defense, is a major cause of the progressive immune dysfunction
that is the hallmark of HIV infection. The loss of target cells
seriously impairs the body's ability to fight most invaders, but it
has a particularly severe impact on the defenses against viruses,
fungi, parasites and certain bacteria, including mycobacteria.
[0006] HIV-1 kills the cells it infects by replicating, budding
from them and damaging the cell membrane. HIV-1 may kill target
cells indirectly by means of the viral gp120 that is displayed on
an infected cell's surface. Since the CD4 receptor on T cells has a
strong affinity for gp120, healthy cells expressing CD4 receptor
can bind to gp120 and fuse with infected cells to form a syncytium.
A syncytium cannot survive.
[0007] HIV-1 can also elicit normal cellular immune defenses
against infected cells. With or without the help of antibodies,
cytotoxic defensive cells can destroy an infected cell that
displays viral proteins on its surface. Finally, free gp120 may
circulate in the blood of individuals infected with HIV-1. The free
protein may bind to the CD4 receptor of uninfected cells, making
them appear to be infected and evoking an immune response.
[0008] Infection with HIV-1 is almost always fatal, and at present
there are no cures for HIV-1 infection. Effective vaccines for
prevention of HIV-1 infection are not yet available. Because of the
danger of reversion or infection, live attenuated virus probably
cannot be used as a vaccine. Most subunit vaccine approaches have
not been successful at preventing HIV infection. Treatments for
HIV-1 infection, while prolonging the lives of some infected
persons, have serious side effects. There is thus a great need for
effective treatments and vaccines to combat this lethal
infection.
[0009] 2. Vaccines
[0010] Vaccination is an effective form of disease prevention and
has proven successful against several types of viral infection.
Determining ways to present HIV-1 antigens to the human immune
system in order to evoke protective humoral and cellular immunity,
is a difficult task. To date, attempts to generate an effective HIV
vaccine have not been successful. In AIDS patients, free virus is
present in low levels only. Transmission of HIV-1 is enhanced by
cell-to-cell interaction via fusion and syncytia formation. Hence,
antibodies generated against free virus or viral subunits are
generally ineffective in eliminating virus-infected cells.
[0011] Vaccines exploit the body's ability to "remember" an
antigen. After first encounters with a given antigen the immune
system generates cells that retain an immunological memory of the
antigen for an individual's lifetime. Subsequent exposure to the
antigen stimulates the immune response and results in elimination
or inactivation of the pathogen.
[0012] The immune system deals with pathogens in two ways: by
humoral and by cell-mediated responses. In the humoral response
lymphocytes generate specific antibodies that bind to the antigen
thus inactivating the pathogen. The cell-mediated response involves
cytotoxic and helper T lymphocytes that specifically attack and
destroy infected cells.
[0013] Vaccine development with HIV-1 virus presents problems
because HIV-1 infects some of the same cells the vaccine needs to
activate in the immune system (i.e., T4 lymphocytes). It would be
advantageous to develop a vaccine which inactivates HIV before
impairment of the immune system occurs. A particularly suitable
type of HIV vaccine would generate an anti-HIV immune response
which recognizes HIV variants and which works in HIV-positive
individuals who are at the beginning of their infection.
[0014] A major challenge to the development of vaccines against
viruses, particularly those with a high rate of mutation such as
the human immunodeficiency virus, against which elicitation of
neutralizing and protective immune responses is desirable, is the
diversity of the viral envelope proteins among different viral
isolates or strains. Because cytotoxic T-lymphocytes (CTLs) in both
mice and humans are capable of recognizing epitopes derived from
conserved internal viral proteins, and are thought to be important
in the immune response against viruses, efforts have been directed
towards the development of CTL vaccines capable of providing
heterologous protection against different viral strains.
[0015] It is known that CD8.sup.+ CTLs kill virally-infected cells
when their T cell receptors recognize viral peptides associated
with MHC class I molecules. The viral peptides are derived from
endogenously synthesized viral proteins, regardless of the
protein's location or function within the virus. Thus, by
recognition of epitopes from conserved viral proteins, CTLs may
provide cross-strain protection. Peptides capable of associating
with MHC class I for CTL recognition originate from proteins that
are present in or pass through the cytoplasm or endoplasmic
reticulum. In general, exogenous proteins, which enter the
endosomal processing pathway (as in the case of antigens presented
by MHC class II molecules), are not effective at generating
CD8.sup.+ CTL responses.
[0016] Most efforts to generate CTL responses have used replicating
vectors to produce the protein antigen within the cell or they have
focused upon the introduction of peptides into the cytosol. These
approaches have limitations that may reduce their utility as
vaccines. Retroviral vectors have restrictions on the size and
structure of polypeptides that can be expressed as fusion proteins
while maintaining the ability of the recombinant virus to
replicate, and the effectiveness of vectors such as vaccinia for
subsequent immunizations may be compromised by immune responses
against the vectors themselves. Also, viral vectors and modified
pathogens have inherent risks that may hinder their use in humans.
Furthermore, the selection of peptide epitopes to be presented is
dependent upon the structure of an individual's MHC antigens and,
therefore, peptide vaccines may have limited effectiveness due to
the diversity of MHC haplotypes in outbred populations.
[0017] 3. DNA Vaccines
[0018] Benvenisty, N., and Reshef, L. [PNAS 83, 9551-9555, (1986)]
showed that CaPO.sub.4-precipitated DNA introduced into mice
intraperitoneally (i.p.), intravenously (i.v.) or intramuscularly
(i.m.) could be expressed. The i.m. injection of DNA expression
vectors without CaCl.sub.2 treatment in mice resulted in the uptake
of DNA by the muscle cells and expression of the protein encoded by
the DNA. The plasmids were maintained episomally and did not
replicate. Subsequently, persistent expression has been observed
after i.m. injection in skeletal muscle of rats, fish and primates,
and cardiac muscle of rats. The technique of using nucleic acids as
therapeutic agents was reported in WO90/11092 (Oct. 4, 1990), in
which naked polynucleotides were used to vaccinate vertebrates.
[0019] It is not necessary for the success of the method that
immunization be intramuscular. The introduction of gold
microprojectiles coated with DNA encoding bovine growth hormone
(BGH) into the skin of mice resulted in production of anti-BGH
antibodies in the mice. A jet injector has been used to transfect
skin, muscle, fat, and mammary tissues of living animals. Various
methods for introducing nucleic have been reviewed. Intravenous
injection of a DNA:cationic liposome complex in mice was shown by
Zhu et al., [Science 261:209-211 (Jul. 9, 1993) to result in
systemic expression of a cloned transgene. Ulmer et al., [Science
259:1745-1749, (1993)] reported on the heterologous protection
against influenza virus infection by intramuscular injection of DNA
encoding influenza virus proteins.
[0020] The need for specific therapeutic and prophylactic agents
capable of eliciting desired immune responses against pathogens and
tumor antigens is met by the instant invention. Of particular
importance in this therapeutic approach is the ability to induce
T-cell immune responses which can prevent infections or disease
caused even by virus strains which are heterologous to the strain
from which the antigen gene was obtained. This is of particular
concern when dealing with HIV as this virus has been recognized to
mutate rapidly and many virulent isolates have been identified
[see, for example, LaRosa et al., Science 249:932-935 (1990),
identifying 245 separate HIV isolates]. In response to this
recognized diversity, researchers have attempted to generate CTLs
based on peptide immunization. Thus, Takahashi et al., [Science
255:333-336 (1992)] reported on the induction of broadly
cross-reactive cytotoxic T cells recognizing an HIV envelope
(gp160) determinant. However, those workers recognized the
difficulty in achieving a truly cross-reactive CTL response and
suggested that there is a dichotomy between the priming or
restimulation of T 10 cells, which is very stringent, and the
elicitation of effector function, including cytotoxicity, from
already stimulated CTLs.
[0021] Wang et al. reported on elicitation of immune responses in
mice against HIV by intramuscular inoculation with a cloned,
genomic (unspliced) HIV gene. However, the level of immune
responses achieved in these studies was very low. In addition, the
Wang et al., DNA construct utilized an essentially genomic piece of
HIV encoding contiguous Tat/rev-gp160-Tat/rev coding sequences. As
is described in detail below, this is a suboptimal system for
obtaining high-level expression of the gp160. It also is
potentially dangerous because expression of Tat contributes to the
progression of Kaposi's Sarcoma.
[0022] WO 93/17706 describes a method for vaccinating an animal
against a virus, wherein carrier particles were coated with a gene
construct and the coated particles are accelerated into cells of an
animal. In regard to HIV, essentially the entire genome, minus the
long terminal repeats, was proposed to be used. That method
represents substantial risks for recipients. It is generally
believed that constructs of HIV should contain less than about 50%
of the HIV genome to ensure safety of the vaccine; this ensures
that enzymatic moieties and viral regulatory proteins, many of
which have unknown or poorly understood functions have been
eliminated. Thus, a number of problems remain if a useful human HIV
vaccine is to emerge from the gene-delivery technology.
[0023] The instant invention contemplates any of the known methods
for introducing polynucleotides into living tissue to induce
expression of proteins. However, this invention provides a novel
immunogen for introducing HIV and other proteins into the antigen
processing pathway to efficiently generate HIV-specific CTLs and
antibodies. The pharmaceutical is effective as a vaccine to induce
both cellular and humoral anti-HIV and HIV neutralizing immune
responses. In the instant invention, the problems noted above are
addressed and solved by the provision of polynucleotide immunogens
which, when introduced into an animal, direct the efficient
expression of HIV proteins and epitopes without the attendant risks
associated with those methods. The immune responses thus generated
are effective at recognizing HIV, at inhibiting replication of HIV,
at identifying and killing cells infected with HIV, and are
cross-reactive against many HIV strains.
[0024] 4. Codon Usage and Codon Context
[0025] The codon pairings of organisms are highly nonrandom, and
differ from organism to organism. This information is used to
construct and express altered or synthetic genes having desired
levels of translational efficiency, to determine which regions in a
genome are protein coding regions, to introduce translational pause
sites into heterologous genes, and to ascertain relationship or
ancestral origin of nucleotide sequences.
[0026] The expression of foreign heterologous genes in transformed
organisms is now commonplace. A large number of mammalian genes,
including, for example, murine and human genes, have been
successfully inserted into single celled organisms. Standard
techniques in this regard include introduction of the foreign gene
to be expressed into a vector such as a plasmid or a phage and
utilizing that vector to insert the gene into an organism. The
native promoters for such genes are commonly replaced with strong
promoters compatible with the host into which the gene is inserted.
Protein sequencing machinery permits elucidation of the amino acid
sequences of even minute quantities of native protein. From these
amino acid sequences, DNA sequences coding for those proteins can
be inferred. DNA synthesis is also a rapidly developing art, and
synthetic genes corresponding to those inferred DNA sequences can
be readily constructed.
[0027] Despite the burgeoning knowledge of expression systems and
recombinant DNA, significant obstacles remain when one attempts to
express a foreign or synthetic gene in an organism. Many native,
active proteins, for example, are glycosylated in a manner
different from that which occurs when they are expressed in a
foreign host. For this reason, eukaryotic hosts such as yeast may
be preferred to bacterial hosts for expressing many mammalian
genes. The glycosylation problem is the subject of continuing
research.
[0028] Another problem is more poorly understood. Often translation
of a synthetic gene, even when coupled with a strong promoter,
proceeds much less efficiently than would be expected. The same is
frequently true of exogenous genes foreign to the expression
organism. Even when the gene is transcribed in a sufficiently
efficient manner that recoverable quantities of the translation
product are produced, the protein is often inactive or otherwise
different in properties from the native protein.
[0029] It is recognized that the latter problem is commonly due to
differences in protein folding in various organisms. The solution
to this problem has been elusive, and the mechanisms controlling
protein folding are poorly understood.
[0030] The problems related to translational efficiency are
believed to be related to codon context effects. The protein coding
regions of genes in all organisms are subject to a wide variety of
functional constraints, some of which depend on the requirement for
encoding a properly functioning protein, as well as appropriate
translational start and stop signals. However, several features of
protein coding regions have been discerned which are not readily
understood in terms of these constraints. Two important classes of
such features are those involving codon usage and codon
context.
[0031] It is known that codon utilization is highly biased and
varies considerably between different organisms. Codon usage
patterns have been shown to be related to the relative abundance of
tRNA isoacceptors. Genes encoding proteins of high versus low
abundance show differences in their codon preferences. The
possibility that biases in codon usage alter peptide elongation
rates has been widely discussed. While differences in codon use are
associated with differences in translation rates, direct effects of
codon choice on translation have been difficult to demonstrate.
Other proposed constraints on codon usage patterns include
maximizing the fidelity of translation and optimizing the kinetic
efficiency of protein synthesis.
[0032] Apart from the non-random use of codons, considerable
evidence has accumulated that codon/anticodon recognition is
influenced by sequences outside the codon itself, a phenomenon
termed "codon context." There exists a strong influence of nearby
nucleotides on the efficiency of suppression of nonsense codons as
well as missense codons. Clearly, the abundance of suppressor
activity in natural bacterial populations, as well as the use of
"termination" codons to encode selenocysteine and phosphoserine
require that termination be context-dependent. Similar context
effects have been shown to influence the fidelity of translation,
as well as the efficiency of translation initiation.
[0033] Statistical analyses of protein coding regions of E. coli
have demonstrate another manifestation of "codon context." The
presence of a particular codon at one position strongly influences
the frequency of occurrence of certain nucleotides in neighboring
codons, and these context constraints differ markedly for genes
expressed at high versus low levels. Although the context effect
has been recognized, the predictive value of the statistical rules
relating to preferred nucleotides adjacent to codons is relatively
low. This has limited the utility of such nucleotide preference
data for selecting codons to effect desired levels of translational
efficiency.
[0034] The advent of automated nucleotide sequencing equipment has
made available large quantities of sequence data for a wide variety
of organisms. Understanding those data presents substantial
difficulties. For example, it is important to identify the coding
regions of the genome in order to relate the genetic sequence data
to protein sequences. In addition, the ancestry of the genome of
certain organisms is of substantial interest. It is known that
genomes of some organisms are of mixed ancestry. Some sequences
that are viral in origin are now stably incorporated into the
genome of eukaryotic organisms. The viral sequences themselves may
have originated in another substantially unrelated species. An
understanding of the ancestry of a gene can be important in drawing
proper analogies between related genes and their translation
products in other organisms.
[0035] There is a need for a better understanding of codon context
effects on translation, and for a method for determining the
appropriate codons for any desired translational effect. There is
also a need for a method for identifying coding regions of the
genome from nucleotide sequence data. There is also a need for a
method for controlling protein folding and for insuring that a
foreign gene will fold appropriately when expressed in a host.
Genes altered or constructed in accordance with desired
translational efficiencies would be of significant worth.
[0036] Another aspect of the practice of recombinant DNA techniques
for the expression by microorganisms of proteins of industrial and
pharmaceutical interest is the phenomenon of "codon preference".
While it was earlier noted that the existing machinery for gene
expression is genetically transformed host cells will "operate" to
construct a given desired product, levels of expression attained in
a microorganism can be subject to wide variation, depending in part
on specific alternative forms of the amino acid-specifying genetic
code present in an inserted exogenous gene. A "triplet" codon of
four possible nucleotide bases can exist in 64 variant forms. That
these forms provide the message for only 20 different amino acids
(as well as transcription initiation and termination) means that
some amino acids can be coded for by more than one codon. Indeed,
some amino acids have as many as six "redundant", alternative
codons while some others have a single, required codon. For reasons
not completely understood, alternative codons are not at all
uniformly present in the endogenous DNA of differing types of cells
and there appears to exist a variable natural hierarchy or
"preference" for certain codons in certain types of cells.
[0037] As one example, the amino acid leucine is specified by any
of six DNA codons including CTA, CTC, CTG, CTT, TTA, and TTG (which
correspond, respectively, to the mRNA codons, CUA, CUC, CUG, CUU,
UUA and UUG). Exhaustive analysis of genome codon frequencies for
microorganisms has revealed endogenous DNA of E. coli most commonly
contains the CTG leucine-specifying codon, while the DNA of yeasts
and slime molds most commonly includes a TTA leucine-specifying
codon. In view of this hierarchy, it is generally held that the
likelihood of obtaining high levels of expression of a leucine-rich
polypeptide by an E. coli host will depend to some extent on the
frequency of codon use. For example, a gene rich in TTA codons will
in all probability be poorly expressed in E. coli, whereas a CTG
rich gene will probably highly express the polypeptide. Similarly,
when yeast cells are the projected transformation host cells for
expression of a leucine-rich polypeptide, a preferred codon for use
in an inserted DNA would be TTA.
[0038] The implications of codon preference phenomena on
recombinant DNA techniques are manifest, and the phenomenon may
serve to explain many prior failures to achieve high expression
levels of exogenous genes in successfully transformed host
organisms--a less "preferred" codon may be repeatedly present in
the inserted gene and the host cell machinery for expression may
not operate as efficiently. This phenomenon suggests that synthetic
genes which have been designed to include a projected host cell's
preferred codons provide a preferred form of foreign genetic
material for practice of recombinant DNA techniques.
[0039] 5. Protein Trafficking
[0040] The diversity of function that typifies eukaryote cells
depends upon the structural differentiation of their membrane
boundaries. To generate and maintain these structures, proteins
must be transported from their site of synthesis in the endoplasmic
reticulum to predetermined destinations throughout the cell. This
requires that the trafficking proteins display sorting signals that
are recognized by the molecular machinery responsible for route
selection located at the access points to the main trafficking
pathways. Sorting decisions for most proteins need to be made only
once as they traverse their biosynthetic pathways since their final
destination, the cellular location at which they perform their
function, becomes their permanent residence.
[0041] Maintenance of intracellular integrity depends in part on
the selective sorting and accurate transport of proteins to their
correct destinations. Over the past few years the dissection of the
molecular machinery for targeting and localization of proteins has
been studied vigorously. Defined sequence motifs have been
identified on proteins which can act as `address labels`. A number
of sorting signals have been found associated with the cytoplasmic
domains of membrane proteins.
SUMMARY OF THE INVENTION
[0042] Synthetic polynucleotides comprising a DNA sequence encoding
a peptide or protein are provided. The DNA sequence of the
synthetic polynucleotides comprise codons optimized for expression
in a nonhomologous host. The invention is exemplified by synthetic
DNA molecules encoding HIV env as well as modifications of HIV env.
The codons of the synthetic molecules include the projected host
cell's preferred codons. The synthetic molecules provide preferred
forms of foreign genetic material. The synthetic molecules may be
used as a polynucleotide vaccine which provides effective
immunoprophylaxis against HIV infection through neutralizing
antibody and cell-mediated immunity. This invention provides
polynucleotides which, when directly introduced into a vertebrate
in vivo, including mammals such as primates and humans, induces the
expression of encoded proteins within the animal.
BRIEF DESCRIPTION OF THE DRAWINGS
[0043] FIG. 1 shows HIV env cassette-based expression
strategies.
[0044] FIG. 2 shows DNA vaccine mediated anti-gp120 responses.
[0045] FIG. 3 shows anti-gp120 ELISA titers of murine DNA vaccinee
sera.
[0046] FIG. 4 shows the relative expression of gp 120 after HIV env
PNV cell culture transfection.
[0047] FIG. 5 shows the mean anti-gp120 ELISA responses following
tPA-gp143/optA vs. optB DNA vaccination.
[0048] FIG. 6 shows the neutralization of HIV by murine DNA
vaccinee sera.
[0049] FIG. 7 shows HIV neutralization by sera from murine HIV env
DNA vaccinees.
[0050] FIG. 8 is an immunoblot analysis of optimized HIV env DNA
constructs.
[0051] FIG. 9 shows anti-gp120 ELISA responses in rhesus monkeys
following final vaccination with gp140 DNA and o-gp160 protein.
[0052] FIG. 10 shows SHIV neutralizing antibody responses of rhesus
monkeys following final vaccination.
DETAILED DESCRIPTION OF THE INVENTION
[0053] Synthetic polynucleotides comprising a DNA sequence encoding
a peptide or protein are provided. The DNA sequence of the
synthetic polynucleotides comprise codons optimized for expression
in a nonhomologous host. The invention is exemplified by synthetic
DNA molecules encoding HIV env as well as modifications of HIV env
are provided. The codons of the synthetic molecules include the
projected host cell's preferred codons. The synthetic molecules
provide preferred forms of foreign genetic material. The synthetic
molecules may be used as a polynucleotide vaccine which provides
immunoprophylaxis against HIV infection through neutralizing
antibody and cell-mediated immunity. This invention provides
polynucleotides which, when directly introduced into a vertebrate
in vivo, including mammals such as primates and humans, induces the
expression of encoded proteins within the animal.
[0054] Therefore, synthetic DNA molecules encoding HIV env and
synthetic DNA molecules encoding modified forms of HIV env are
provided. The codons of the synthetic molecules are designed so as
to use the codons preferred by the projected host cell. As noted
above, the synthetic molecules of this portion of the invention may
be used as a polynucleotide vaccine which provides effective
immunoprophylaxis against HIV infection through neutralizing
antibody and cell-mediated immunity. The synthetic molecules may be
used as an immunogenic composition. This portion of the invention
also provides polynucleotides which, when directly introduced into
a vertebrate in vivo, including mammals such as primates and
humans, induces the expression of encoded proteins within the
animal.
[0055] As used herein, a polynucleotide is a nucleic acid which
contains essential regulatory elements such that upon introduction
into a living, vertebrate cell, it is able to direct the cellular
machinery to produce translation products encoded by the genes
comprising the polynucleotide. In one embodiment of the invention,
the polynucleotide is a polydeoxyribonucleic acid comprising at
least one HIV gene operatively linked to a transcriptional
promoter. In another embodiment of the invention, the
polynucleotide vaccine (PNV) comprises polyribonucleic acid
encoding at least one HIV gene which is amenable to translation by
the eukaryotic cellular machinery (ribosomes, tRNAs, and other
translation factors). Where the protein encoded by the
polynucleotide is one which does not normally occur in that animal
except in pathological conditions, (i.e., a heterologous protein)
such as proteins associated with human immunodeficiency virus,
(HIV), the etiologic agent of acquired immune deficiency syndrome,
(AIDS), the animals' immune system is activated to launch a
protective immune response. Because these exogenous proteins are
produced by the animals' tissues, the expressed proteins are
processed by the major histocompatibility system, MHC, in a fashion
analogous to when an actual infection with the related organism
(HIV) occurs. The result, as shown in this disclosure, is induction
of immune responses against the cognate pathogen.
[0056] Accordingly, the instant inventors have prepared nucleic
acids which, when introduced into the biological system induce the
expression of HIV proteins and epitopes. The induced antibody
response is both specific for the expressed HIV protein, and
neutralizes HIV. In addition, cytotoxic T-lymphocytes which
specifically recognize and destroy HIV infected cells are
induced.
[0057] The instant invention provides a method for using a
polynucleotide which, upon introduction into mammalian tissue,
induces the expression in a single cell, in vivo, of discrete gene
products. The instant invention provides a different solution which
does not require multiple manipulations of rev dependent HIV genes
to obtain rev-independent genes. The rev-independent expression
system described herein is useful in its own right and is a system
for demonstrating the expression in a single cell in vivo of a
single desired gene-product.
[0058] Because many of the applications of the instant invention
apply to anti-viral vaccination, the polynucleotides are frequently
referred to as a polynucleotide vaccine, or PNV. This is not to say
that additional utilities of these polynucleotides, in immune
stimulation and in anti-tumor therapeutics, are considered to be
outside the scope of the invention.
[0059] In one embodiment of this invention, a gene encoding an HIV
gene product is incorporated in an expression vector. The vector
contains a transcriptional promoter recognized by an eukaryotic RNA
polymerase, and a transcriptional terminator at the end of the HIV
gene coding sequence. In a preferred embodiment, the promoter is
the cytomegalovirus promoter with the intron A sequence (CMV-intA),
although those skilled in the art will recognize that any of a
number of other known promoters such as the strong immunoglobulin,
or other eukaryotic gene promoters may be used. A preferred
transcriptional terminator is the bovine growth hormone terminator.
The combination of CMVintA-BGH terminator is particularly
preferred.
[0060] To assist in preparation of the polynucleotides in
prokaryotic cells, an antibiotic resistance marker is also
preferably included in the expression vector under transcriptional
control of a prokaryotic promoter so that expression of the
antibiotic does not occur in eukaryotic cells. Ampicillin
resistance genes, neomycin resistance genes and other
pharmaceutically acceptable antibiotic resistance markers may be
used. To aid in the high level production of the polynucleotide by
fermentation in prokaryotic organisms, it is advantageous for the
vector to contain a prokaryotic origin of replication and be of
high copy number. A number of commercially available prokaryotic
cloning vectors provide these benefits. It is desirable to remove
non-essential DNA sequences. It is also desirable that the vectors
not be able to replicate in eukaryotic cells. This minimizes the
risk of integration of polynucleotide vaccine sequences into the
recipients' genome. Tissue-specific promoters or enhancers may be
used whenever it is desirable to limit expression of the
polynucleotide to a particular tissue type.
[0061] In one embodiment, the expression vector pnRSV is used,
wherein the Rous Sarcoma Virus (RSV) long terminal repeat (LTR) is
used as the promoter. In another embodiment, V1, a mutated pBR322
vector into which the CMV promoter and the BGH transcriptional
terminator were cloned is used. In another embodiment, the elements
of V1 and pUC19 have been combined to produce an expression vector
named V1J. Into V1J or another desirable expression vector is
cloned an HIV gene, such as gp 120, gp41, gp160, gag, pol, env, or
any other HIV gene which can induce anti-HIV immune responses. In
another embodiment, the ampicillin resistance gene is removed from
V1J and replaced with a neomycin resistance gene, to generate
V1J-neo into different HIV genes have been cloned for use according
to this invention. In another embodiment, the vector is V1Jns,
which is the same as V1Jneo except that a unique Sfi1 restriction
site has been engineered into the single Kpn1 site at position 2114
of V1J-neo. The incidence of Sfi1 sites in human genomic DNA is
very low (approximately 1 site per 100,000 bases). Thus, this
vector allows careful monitoring for expression vector integration
into host DNA, simply by Sfi1 digestion of extracted genomic DNA.
In a further refinement, the vector is V1R. In this vector, as much
non-essential DNA as possible was "trimmed" from the vector to
produce a highly compact vector. This vector is a derivative of
V1Jns. This vector allows larger inserts to be used, with less
concern that undesirable sequences are encoded and optimizes uptake
by cells.
[0062] One embodiment of this invention incorporates genes encoding
HIV gp160, gp120, gag and other gene products from laboratory
adapted strains of HIV such as SF2, IIIB or MN. Those skilled in
the art will recognize that the use of genes from HIV-2 strains
having analogous function to the genes from HIV-1 would be expected
to generate immune responses analogous to those described herein
for HIV-1 constructs. The cloning and manipulation methods for
obtaining these genes are known to those skilled in the art.
[0063] It is recognized that elicitation of immune responses
against laboratory adapted strains of HIV may not be adequate to
provide neutralization of primary field isolates of HIV. Thus, in
another embodiment of this invention, genes from virulent, primary
field isolates of HIV are incorporated in the polynucleotide
immunogen. This is accomplished by preparing cDNA copies of the
viral genes and then subcloning the individual genes into the
polynucleotide immunogen. Sequences for many genes of many HIV
strains are now publicly available on GENBANK and such primary,
field isolates of HIV are available from the National Institute of
Allergy and Infectious Diseases (NIAID) which has contracted with
Quality Biological, Inc., [7581 Lindbergh Drive, Gaithersburg, Md.
20879] to make these strains available.
[0064] Such strains are also available from the World Health
Organization (WHO) [Network for HIV Isolation and Characterization,
Vaccine Development Unit, Office of Research, Global Programme on
AIDS, CH-1211 Geneva 27, Switzerland]. From this work those skilled
in the art will recognize that one of the utilities of the instant
invention is to provide a system for in vivo as well as in vitro
testing and analysis so that a correlation of HIV sequence
diversity with serology of HIV neutralization, as well as other
parameters can be made. Incorporation of genes from primary
isolates of HIV strains provides an immunogen which induces immune
responses against clinical isolates of the virus and thus meets a
need as yet unmet in the field. Furthermore, as the virulent
isolates change, the immunogen may be modified to reflect new
sequences as necessary.
[0065] To keep the terminology consistent, the following convention
is followed herein for describing polynucleotide immunogen
constructs: "Vector name--HIV strain-gene-additional elements".
Thus, a construct wherein the gp160 gene of the MN strain is cloned
into the expression vector V1Jneo, the name it is given herein is:
"V1Jneo-MN-gp160". The additional elements that are added to the
construct are described in further detail below. As the etiologic
strain of the virus changes, the precise gene which is optimal for
incorporation in the pharmaceutical may be changed. However, as is
demonstrated below, because CTL responses are induced which are
capable of protecting against heterologous strains, the strain
variability is less critical in the immunogen and vaccines of this
invention, as compared with the whole virus or subunit polypeptide
based vaccines. In addition, because the pharmaceutical is easily
manipulated to insert a new gene, this is an adjustment which is
easily made by the standard techniques of molecular biology.
[0066] The term "promoter" as used herein refers to a recognition
site on a DNA strand to which the RNA polymerase binds. The
promoter forms an initiation complex with RNA polymerase to
initiate and drive transcriptional activity. The complex can be
modified by activating sequences termed "enhancers" or inhibiting
sequences termed "silencers."
[0067] The term "leader" as used herein refers to a DNA sequence at
the 5' end of a structural gene which is transcribed along with the
gene. The leader usually results in the protein having an
N-terminal peptide extension sometimes called a pro-sequence. For
proteins destined for either secretion to the extracellular medium
or a membrane, this signal sequence, which is generally
hydrophobic, directs the protein into endoplasmic reticulum from
which it is discharged to the appropriate destination.
[0068] The term "intron" as used herein refers to a section of DNA
occurring in the middle of a gene which does not code for an amino
acid in the gene product. The precursor RNA of the intron is
excised and is therefore not transcribed into mRNA nor translated
into protein.
[0069] The term "cassette" refers to the sequence of the present
invention which contains the nucleic acid sequence which is to be
expressed. The cassette is similar in concept to a cassette tape.
Each cassette will have its own sequence. Thus by interchanging the
cassette the vector will express a different sequence. Because of
the restrictions sites at the 5' and 3' ends, the cassette can be
easily inserted, removed or replaced with another cassette.
[0070] The term "3' untranslated region" or "3' UTR" refers to the
sequence at the 3' end of a structural gene which is usually
transcribed with the gene. This 3' UTR region usually contains the
poly A sequence. Although the 3' UTR is transcribed from the DNA it
is excised before translation into the protein.
[0071] The term "Non-Coding Region" or "NCR" refers to the region
which is contiguous to the 3' UTR region of the structural gene.
The NCR region contains a transcriptional termination signal.
[0072] The term "restriction site" refers to a sequence specific
cleavage site of restriction endonucleases.
[0073] The term "vector" refers to some means by which DNA
fragments can be introduced into a host organism or host tissue.
There are various types of vectors including plasmid,
bacteriophages and cosmids.
[0074] The term "effective amount" means sufficient PNV is injected
to produce the adequate levels of the polypeptide. One skilled in
the art recognizes that this level may vary.
[0075] To provide a description of the instant invention, the
following background on HIV is provided. The human immunodeficiency
virus has a ribonucleic acid (RNA) genome. This RNA genome must be
reverse transcribed according to methods known in the art in order
to produce a cDNA copy for cloning and manipulation according to
the methods taught herein. At each end of the genome is a long
terminal repeat which acts as a promoter. Between these termini,
the genome encodes, in various reading frames, gag-pol-env as the
major gene products: gag is the group specific antigen; pol is the
reverse transcriptase, or polymerase; also encoded by this region,
in an alternate reading frame, is the viral protease which is
responsible for post-translational processing, for example, of
gp160 into gp120 and gp41; env is the envelope protein; vif is the
virion infectivity factor; rev is the regulator of virion protein
expression; neg is the negative regulatory factor; vpu is the
virion productivity factor "u"; tat is the trans-activator of
transcription; vpr is the viral protein r. The function of each of
these elements has been described.
[0076] In one embodiment of this invention, a gene encoding an HIV
or SIV protein is directly linked to a transcriptional promoter.
The env gene encodes a large, membrane bound protein, gp160, which
is post-translationally modified to gp41 and gp120. The gp120 gene
may be placed under the control of the cytomegalovirus promoter for
expression. However, gp120 is not membrane bound and therefore,
upon expression, it may be secreted from the cell. As HIV tends to
remain dormant in infected cells, it is desirable that immune
responses directed at cell-bound HIV epitopes also be generated.
Additionally, it is desirable that a vaccine produce membrane
bound, oligomeric ENV antigen similar in structure to that produced
by viral infection in order to generate the most efficacious
antibody responses for viral neutralization. This goal is
accomplished herein by expression in vivo of a secreted gp140
epitope (gp140>gp120+ectodomain of gp41) or the cell-membrane
associated epitope, gp160, to prime the immune system. However,
expression of gp160 is repressed in the absence of rev due to
non-export from the nucleus of non-spliced genes. For an
understanding of this system, the life cycle of HIV must be
described in further detail.
[0077] In the life cycle of HIV, upon infection of a host cell, HIV
RNA genome is reverse-transcribed into a proviral DNA which
integrates into host genomic DNA as a single transcriptional unit.
The LTR provides the promoter which transcribes HIV genes from the
5' to 3' direction (gag, pol, env), to form an unspliced transcript
of the entire genome. The unspliced transcript functions as the
mRNA from which gag and pol are translated, while limited splicing
must occur for translation of env encoded genes. For the regulatory
gene product rev to be expressed, more than one splicing event must
occur because in the genomic setting, rev and env overlap. In order
for transcription of env to occur, rev transcription must stop, and
vice versa. In addition, the presence of rev is required for export
of unspliced RNA from the nucleus. For rev to function in this
manner, however, a rev responsive element (RRE) must be present on
the transcript [Malim et al., Nature 338:254-257 (1989)].
[0078] In the polynucleotide vaccine of this invention, the
obligatory splicing of certain HIV genes is eliminated by providing
fully spliced genes (i.e.: the provision of a complete open reading
frame for the desired gene product without the need for switches in
the reading frame or elimination of noncoding regions; those of
ordinary skill in the art would recognize that when splicing a
particular gene, there is some latitude in the precise sequence
that results; however so long as a functional coding sequence is
obtained, this is acceptable). Thus, in one embodiment, the entire
coding sequence for gp160 is spliced such that no intermittent
expression of each gene product is required.
[0079] The dual humoral and cellular immune responses generated
according to this invention are particularly significant to
inhibiting HIV infection, given the propensity of HIV to mutate
within the population, as well as in infected individuals. In order
to formulate an effective protective vaccine for HIV it is
desirable to generate both a multivalent antibody response for
example to gp160 (env is approximately 80% conserved across various
HIV-1, clade B strains, which are the prevalent strains in US human
populations), the principal neutralization target on HIV, as well
as cytotoxic T cells reactive to the conserved portions of gp160
and, internal viral proteins encoded by gag. We have made an HIV
vaccine comprising gp160 genes selected from common laboratory
strains; from predominant, primary viral isolates found within the
infected population; from mutated gp160s designed to unmask
cross-strain, neutralizing antibody epitopes; and from other
representative HIV genes such as the gag and pol genes (.about.95%
conserved across HIV isolates.
[0080] Virtually all HIV seropositive patients who have not
advanced towards an immunodeficient state harbor anti-gag CTLs
while about 60% of these patients show cross-strain, gp160-specific
CTLs. The amount of HIV specific CTLs found in infected individuals
that have progressed on to the disease state known as AIDS,
however, is much lower, demonstrating the significance of our
findings that we can induce cross-strain CTL responses.
[0081] Immune responses induced by our env and gag polynucleotide
vaccine constructs are demonstrated in mice and primates.
Monitoring antibody production to env in mice allows confirmation
that a given construct is suitably immunogenic, i.e., a high
proportion of vaccinated animals show an antibody response. Mice
also provide the most facile animal model suitable for testing CTL
induction by our constructs and are therefore used to evaluate
whether a particular construct is able to generate such activity.
Monkeys (African green, rhesus, chimpanzees) provide additional
species including primates for antibody evaluation in larger,
non-rodent animals. These species are also preferred to mice for
antisera neutralization assays due to high levels of endogenous
neutralizing activities against retroviruses observed in mouse
sera. These data demonstrate that sufficient immunogenicity is
engendered by our vaccines to achieve protection in experiments in
a chimpanzee/HIV.sub.IIIB challenge model based upon known
protective levels of neutralizing antibodies for this system.
However, the currently emerging and increasingly accepted
definition of protection in the scientific community is moving away
from so-called "sterilizing immunity", which indicates complete
protection from HIV infection, to prevention of disease. A number
of correlates of this goal include reduced blood viral titer, as
measured either by HIV reverse transcriptase activity, by
infectivity of samples of serum, by ELISA assay of p24 or other HIV
antigen concentration in blood, increased CD4.sup.+T-cell
concentration, and by extended survival rates [see, for example,
Cohen, J., Science 262:1820-1821, 1993, for a discussion of the
evolving definition of anti-HIV vaccine efficacy]. The immunogens
of the instant invention also generate neutralizing immune
responses against infectious (clinical, primary field) isolates of
HIV.
[0082] Immunology
[0083] A. Antibody Responses to env.
[0084] 1. gp160 and gp120. An ELISA assay is used to determine
whether vaccine vectors expressing either secreted gp120 or
membrane-bound gp160 are efficacious for production of env-specific
antibodies. Initial in vitro characterization of env expression by
our vaccination vectors is provided by immunoblot analysis of gp160
transfected cell lysates. These data confirm and quantitate gp160
expression using anti-gp4l and anti-gp120 monoclonal antibodies to
visualize transfectant cell gp160 expression. In one embodiment of
this invention, gp160 is preferred to gp120 for the following
reasons: (1) an initial gp120 vector gave inconsistent
immunogenicity in mice and was very poorly or non-responsive in
African green Monkeys; (2) gp160 contributes additional
neutralizing antibody as well as CTL epitopes by providing the
addition of approximately 190 amino acid residues due to the
inclusion of gp41; (3) gp160 expression is more similar to viral
env with respect to tetramer assembly and overall conformation,
which may provide oligomer-dependent neutralization epitopes; and
(4) we find that, like the success of membrane-bound, influenza HA
constructs for producing neutralizing antibody responses in mice,
ferrets, and nonhuman primates [see Ulmer et al., Science
259:1745-1749, 1993; Montgomery, D., et al., DNA and Cell Biol.
12:777-783, 1993] anti-gp160 antibody generation is superior to
anti-gp120 antibody generation.
[0085] Selection of which type of env, or whether a cocktail of env
subfragments, is preferred is determined by the experiments
outlined below.
[0086] 2. Presence and Breadth of Neutralizing Activity. ELISA
positive antisera from monkeys is tested and shown to neutralize
both homologous and heterologous HIV strains.
[0087] 3. V3 vs. non-V3 Neutralizing Antibodies. A major goal for
env PNVs is to generate broadly neutralizing antibodies. It has now
been shown that antibodies directed against V3 loops are very
strain specific, and the serology of this response has been used to
define strains.
[0088] a. Non-V3 neutralizing antibodies appear to primarily
recognize discontinuous, structural epitopes within gp120 which are
responsible for CD4 binding. Antibodies to this domain are
polyclonal and more broadly cross-neutralizing probably due to
restraints on mutations imposed by the need for the virus to bind
its cellular ligand. An in vitro assay is used to test for blocking
gp120 binding to CD4 immobilized on 96 well plates by sera from
immunized animals. A second in vitro assay detects direct antibody
binding to synthetic peptides representing selected V3 domains
immobilized on plastic. These assays are compatible for antisera
from any of the animal types used in our studies and define the
types of neutralizing antibodies our vaccines have generated as
well as provide an in vitro correlate to virus neutralization.
[0089] b. gp41 harbors at least one major neutralization
determinant, corresponding to the highly conserved linear epitope
recognized by the broadly neutralizing 2F5 monoclonal antibody
(commercially available from Viral Testing Systems Corp., Texas
Commerce Tower, 600 Travis Street, Suite 4750, Houston, Tex.
77002-3005(USA), or Waldheim Pharmazeutika GmbH, Boltzmangasse 11,
A-1091 Wien, Austria), as well as other potential sites including
the well-conserved "fusion peptide" domain located at the
N-terminus of gp41. Besides the detection of antibodies directed
against gp41 by immunoblot as described above, an in vitro assay
test is used for antibodies which bind to synthetic peptides
representing these domains immobilized on plastic.
[0090] 4. Maturation of the Antibody Response. In HIV seropositive
patients, the neutralizing antibody responses progress from chiefly
anti-V3 to include more broadly neutralizing antibodies comprising
the structural gp120 domain epitopes described above (#3),
including gp41 epitopes. These types of antibody responses are
monitored over the course of both time and subsequent
vaccinations.
[0091] B. T Cell Reactivities Against env and gag.
[0092] 1. Generation of CTL Responses. Viral proteins which are
synthesized within cells give rise to MHC I-restricted CTL
responses. Each of these proteins elicits CTL in seropositive
patients. Our vaccines also are able to elicit CTL in mice. The
immunogenetics of mouse strains are conducive to such studies, as
demonstrated with influenza NP, [see Ulmer et al., Science
259:1745-1749, 1993]. Several epitopes have been defined for the
HIV proteins env, rev, nef and gag in Balb/c mice, thus
facilitating in vitro CTL culture and cytotoxicity assays. It is
advantageous to use syngeneic tumor lines, such as the murine
mastocytoma P815, transfected with these genes to provide targets
for CTL as well as for in vitro antigen specific restimulation.
Methods for defining immunogens capable of eliciting MHC class
I-restricted cytotoxic T lymphocytes are known [see Calin-Laurens,
et al., Vaccine 11(9):974-978, 1993; see particularly Eriksson, et
al., Vaccine 11(8):859-865, 1993, wherein T-cell activating
epitopes on the HIV gp120 were mapped in primates and several
regions, including gp120 amino acids 142-192, 296-343, 367-400, and
410-453 were each found to induce lymphoproliferation; furthermore,
discrete regions 248-269 and 270-295 were lymphoproliferative. A
peptide encompassing amino acids 152-176 was also found to induce
HIV neutralizing antibodies], and these methods may be used to
identify immunogenic epitopes for inclusion in the PNV of this
invention. Alternatively, the entire gene encoding gp160, gp120,
protease, or gag could be used. For additional review on this
subject, see for example, Shirai et al., J. Immunol 148:1657-1667,
1992; Choppin et al., J. Immunol 147:569-574, 1991; Choppin et al.,
J. Immunol 147:575-583, 1991; Berzofsky et al., J. Clin. Invest.
88:876-884, 1991. As used herein, T-cell effector function is
associated with mature T-cell phenotype, for example, cytotoxicity,
cytokine secretion for B-cell activation, and/or recruitment or
stimulation of macrophages and neutrophils.
[0093] 2. Measurement of T.sub.H Activities. Spleen cell cultures
derived from vaccinated animals are tested for recall to specific
antigens by addition of either recombinant protein or peptide
epitopes. Activation of T cells by such antigens, presented by
accompanying splenic antigen presenting cells, APCs, is monitored
by proliferation of these cultures or by cytokine production. The
pattern of cytokine production also allows classification of
T.sub.H response as type 1 or type 2. Because dominant T.sub.H2
responses appear to correlate with the exclusion of cellular
immunity in immunocompromised seropositive patients, it is possible
to define the type of response engendered by a given PNV in
patients, permitting manipulation of the resulting immune
responses.
[0094] 3. Delayed Type Hypersensitivity (DTH). DTH to viral antigen
after i.d. injection is indicative of cellular, primarily MHC
II-restricted, immunity. Because of the commercial availability of
recombinant HIV proteins and synthetic peptides for known epitopes,
DTH responses are easily determined in vaccinated vertebrates using
these reagents, thus providing an additional in vivo correlate for
inducing cellular immunity.
[0095] Protection
[0096] Based upon the above immunologic studies, it is predictable
that our vaccines are effective in vertebrates against challenge by
virulent HIV. These studies are accomplished in an
HIV.sub.IIIB/chimpanzee challenge model after sufficient
vaccination of these animals with a PNV construct, or a cocktail of
PNV constructs comprised of gp160.sub.IIIB, gag.sub.IIIB,
nef.sub.IIIB and REV.sub.IIIB. The IIIB strain is useful in this
regard as the chimpanzee titer of lethal doses of this strain has
been established. However, the same studies are envisioned using
any strain of HIV and the epitopes specific to or heterologous to
the given strain. A second vaccination/challenge model, in addition
to chimpanzees, is the scid-hu PBL mouse. This model allows testing
of the human lymphocyte immune system and our vaccine with
subsequent HIV challenge in a mouse host. This system is
advantageous as it is easily adapted to use with any HIV strain and
it provides evidence of protection against multiple strains of
primary field isolates of HIV. A third challenge model utilizes
hybrid HIV/SIV viruses (SHIV), some of which have been shown to
infect rhesus monkeys and lead to immunodeficiency disease
resulting in death [see Li, J., et al., J. AIDS 5:639-646, 1992].
Vaccination of rhesus with our polynucleotide vaccine constructs is
protective against subsequent challenge with lethal doses of
SHIV.
[0097] PNV Construct Summary
[0098] HIV and other genes are ligated into an expression vector
which has been optimized for polynucleotide vaccinations.
Essentially all extraneous DNA is removed, leaving the essential
elements of transcriptional promoter, immunogenic epitopes,
transcriptional terminator, bacterial origin of replication and
antibiotic resistance gene.
[0099] Expression of HIV late genes such as env and gag is
rev-dependent and requires that the rev response element (RRE) be
present on the viral gene transcript. A secreted form of gp120 can
be generated in the absence of rev by substitution of the gp120
leader peptide with a heterologous leader such as from tPA
(tissue-type plasminogen activator), and preferably by a leader
peptide such as is found in highly expressed mammalian proteins
such as immunoglobulin leader peptides. We have inserted a
tPA-gp120 chimeric gene into V1Jns which efficiently expresses
secreted gp120 in transfected cells (RD, a human rhabdomyosarcoma
line). Monocistronic gp160 does not produce any protein upon
transfection without the addition of a rev expression vector.
[0100] Representative Construct Components Include (But Are Not
Restricted To):
[0101] 1. tPA-gp120.sup.MN;
[0102] 2. gp160.sup.IIIB;
[0103] 3. gag.sup.IIIB: for anti-gag CTL;
[0104] 4. tPA-gp120.sub.IIIB;
[0105] 5. tPA-gp140
[0106] 6. tPA-gp160 with structural mutations: V1, V2, and/or V3
loop deletions or substitutions
[0107] 7. Genes encoding antigens expressed by pathogens other than
HIV, such as, but not limited to, influenza virus nucleoprotein,
hemagglutinin, matrix, neuraminidase, and other antigenic proteins;
herpes simplex virus genes; human papillomavirus genes;
tuberculosis antigens; hepatitis A, B, or C virus antigens.
[0108] The protective efficacy of polynucleotide HIV immunogens
against subsequent viral challenge is demonstrated by immunization
with the non-replicating plasmid DNA of this invention. This is
advantageous since no infectious agent is involved, assembly of
virus particles is not required, and determinant selection is
permitted. Furthermore, because the sequence of gag and protease
and several of the other viral gene products is conserved among
various strains of HIV, protection against subsequent challenge by
a virulent strain of HIV that is homologous to, as well as strains
heterologous to the strain from which the cloned gene is obtained,
is enabled.
[0109] The i.m. injection of a DNA expression vector encoding gp160
results in the generation of significant protective immunity
against subsequent viral challenge. In particular, gp160-specific
antibodies and primary CTLs are produced. Immune responses directed
against conserved proteins can be effective despite the antigenic
shift and drift of the variable envelope proteins. Because each of
the HIV gene products exhibit some degree of conservation, and
because CTL are generated in response to intracellular expression
and MHC processing, it is predictable that many virus genes give
rise to responses analogous to that achieved for gp160. Thus, many
of these genes have been cloned, as shown by the cloned and
sequenced junctions in the expression vector (see below) such that
these constructs are immunogenic agents in available form.
[0110] The invention offers a means to induce cross-strain
protective immunity without the need for self-replicating agents or
adjuvants. In addition, immunization with the instant
polynucleotides offers a number of other advantages. This approach
to vaccination should be applicable to tumors as well as infectious
agents, since the CD8.sup.+ CTL response is important for both
pathophysiological processes [K. Tanaka et al., Annu. Rev. Immunol.
6, 359 (1988)]. Therefore, eliciting an immune response against a
protein crucial to the transformation process may be an effective
means of cancer protection or immunotherapy. The generation of high
titer antibodies against expressed proteins after injection of
viral protein and human growth hormone DNA suggests that this is a
facile and highly effective means of making antibody-based
vaccines, either separately or in combination with cytotoxic
T-lymphocyte vaccines targeted towards conserved antigens.
[0111] The ease of producing and purifying DNA constructs compares
favorably with traditional methods of protein purification, thus
facilitating the generation of combination vaccines. Accordingly,
multiple constructs, for example encoding gp160, gp120, gp41, or
any other HIV gene may be prepared, mixed and co-administered.
Because protein expression is maintained following DNA injection,
the persistence of B- and T-cell memory may be enhanced, thereby
engendering long-lived humoral and cell-mediated immunity.
[0112] Standard techniques of molecular biology for preparing and
purifying DNA constructs enable the preparation of the DNA
immunogens of this invention. While standard techniques of
molecular biology are therefore sufficient for the production of
the products of this invention, the specific constructs disclosed
herein provide novel polynucleotide immunogens which surprisingly
produce cross-strain and primary HIV isolate neutralization, a
result heretofore unattainable with standard inactivated whole
virus or subunit protein vaccines.
[0113] The amount of expressible DNA or transcribed RNA to be
introduced into a vaccine recipient will depend on the strength of
the transcriptional and translational promoters used and on the
immunogenicity of the expressed gene product. In general, an
immunologically or prophylactically effective dose of about 1 ng to
100 mg, and preferably about 10 .mu.g to 300 .mu.g is administered
directly into muscle tissue. Subcutaneous injection, intradermal
introduction, impression through the skin, and other modes of
administration such as intraperitoneal, intravenous, or inhalation
delivery are also contemplated. It is also contemplated that
booster vaccinations are to be provided. Following vaccination with
HIV polynucleotide immunogen, boosting with HIV protein immunogens
such as gp160, gp120, and gag gene products is also contemplated.
Parenteral administration, such as intravenous, intramuscular,
subcutaneous or other means of administration of interleukin-12
protein or GM-CSF or similar proteins alone or in combination,
concurrently with or subsequent to parenteral introduction of the
PNV of this invention is also advantageous.
[0114] The polynucleotide may be naked, that is, unassociated with
any proteins, adjuvants or other agents which impact on the
recipients' immune system. In this case, it is desirable for the
polynucleotide to be in a physiologically acceptable solution, such
as, but not limited to, sterile saline or sterile buffered saline.
Alternatively, the DNA may be associated with liposomes, such as
lecithin liposomes or other liposomes known in the art, as a
DNA-liposome mixture, or the DNA may be associated with an adjuvant
known in the art to boost immune responses, such as a protein or
other carrier. Agents which assist in the cellular uptake of DNA,
such as, but not limited to, calcium ions, may also be used to
advantage. These agents are generally referred to herein as
transfection facilitating reagents and pharmaceutically acceptable
carriers. Techniques for coating microprojectiles coated with
polynucleotide are known in the art and are also useful in
connection with this invention.
[0115] The following examples are offered by way of illustration
and are not intended to limit the invention in any manner.
EXAMPLE 1
[0116] Materials Descriptions
[0117] Vectors pF411 and pF412: These vectors were subcloned from
vector pSP62 which was constructed in R. Gallo's lab. pSP62 is an
available reagent from Biotech Research Laboratories, Inc. pSP62
has a 12.5 kb XbaI fragment of the HXB2 genome subcloned from
lambda HXB2. SalI and Xba I digestion of pSP62 yields to HXB2
fragments: 5'-XbaI/SalI, 6.5 kb and 3'-SalI/XbaI, 6 kb. These
inserts were subcloned into pUC 18 at SmaI and SalI sites yielding
pF411 (5'-XbaI/SalI) and pF412 (3'-XbaI/SalI). pF411 contains
gag/pol and pF412 contains tat/rev/env/nef.
[0118] Repligen Reagents:
[0119] recombinant rev (IIIB), #RP1024-10
[0120] rec. gp120 (IIIB), #RP1001-10
[0121] anti-rev monoclonal antibody, #RP 1029-10
[0122] anti-gp120 mAB, #1C1, #RP1010-10
[0123] AIDS Research and Reference Reagent Program:
[0124] Anti-gp41 mAB Hybridoma, Chessie 8, #526
[0125] The strategies are designed to induce both cytotoxic T
lymphocyte (CTL) and neutralizing antibody responses to HIV,
principally directed at the HIV gag (.about.95% conserved) and env
(gp160 or gp120; 70-80% conserved) gene products. gp160 contains
the only known neutralizing antibody epitopes on the HIV particle
while the importance of anti-env and anti-gag CTL responses are
highlighted by the known association of the onset of these cellular
immunities with clearance of primary viremia following infection,
which occurs prior to the appearance of neutralizing antibodies, as
well as a role for CTL in maintaining disease-free status. Because
HIV is notorious for its genetic diversity, we hope to obtain
greater breadth of neutralizing antibodies by including several
representative env genes derived from clinical isolates and gp41
(.about.90% conserved), while the highly conserved gag gene should
generate broad cross-strain CTL responses.
EXAMPLE 2
[0126] Heterologous Expression of HIV Late Gene Products
[0127] HIV structural genes such as env and gag require expression
of the HIV regulatory gene, rev, in order to efficiently produce
full-length proteins. We have found that rev-dependent expression
of gag yielded low levels of protein and that rev itself may be
toxic to cells. Although we achieved relatively high levels of
rev-dependent expression of gp160 in vitro this vaccine elicited
low levels of antibodies to gp160 following in vivo immunization
with rev/gp160 DNA. This may result from known cytotoxic effects of
rev as well as increased difficulty in obtaining rev function in
myotubules containing hundreds of nuclei (rev protein needs to be
in the same nucleus as a rev-dependent transcript for gag or env
protein expression to occur). However, it has been possible to
obtain rev-independent expression using selected modifications of
the env gene. Evaluation of these plasmids for vaccine purposes is
underway.
[0128] In general, our vaccines have utilized primarily HIV (IIIB)
env and gag genes for optimization of expression within our
generalized vaccination vector, V1Jns, which is comprised of a CMV
immediate-early (IE) promoter, BGH polyadenylation site, and a pUC
backbone. Varying efficiencies, depending upon how large a gene
segment is used (e.g., gp120 vs. gp160), of rev-independent
expression may be achieved for env by replacing its native
secretory leader peptide with that from the tissue-specific
plasminogen activator (tPA) gene and expressing the resulting
chimeric gene behind the CMVIE promoter with the CMV intron A.
tPA-gp120 is an example of a secreted gp120 vector constructed in
this fashion which functions well enough to elicit anti-gp120
immune responses in vaccinated mice and monkeys.
[0129] Because of reports that membrane-anchored proteins may
induce much more substantial (and perhaps more specific for HIV
neutralization) antibody responses compared to secreted proteins as
well as to gain additional immune epitopes, we prepared
V1Jns-tPA-gp160 and V1Jns-rev/gp160. The tPA-gp160 vector produced
detectable quantities of gp160 and gp120, without the addition of
rev, as shown by immunoblot analysis of transfected cells, although
levels of expression were much lower than that obtained for
rev/gp160, a rev-dependent gp160-expressing plasmid. This is
probably because inhibitory regions (designated INS), which confer
rev dependence upon the gp160 transcript, occur at multiple sites
within gp160 including at the COOH-terminus of gp41 (see FIG. 1 for
schematic view of gp143 construct strategies). A vector was
prepared for a COOH-terminally truncated form of tPA-gp160,
tPA-gp143, which was designed to increase the overall expression
levels of env by elimination of these inhibitory sequences. The
gp143 vector also eliminates intracellular gp41 regions containing
peptide motifs (such as leu-leu) known to cause diversion of
membrane proteins to the lysosomes rather than the cell surface.
Thus, gp143 may be expected to increase both expression of the env
protein (by decreasing rev-dependence) and the efficiency of
transport of protein to the cell surface compared to full-length
gp160 where these proteins may be better able to elicit anti-gp160
antibodies following DNA vaccination. tPA-gp143 was further
modified by extensive silent mutagenesis of the rev response
element (RRE) sequence (350 bp) to eliminate additional inhibitory
sequences for expression. This construct, gp143/mutRRE, was
prepared in two forms: either eliminating (form A) or retaining
(form B) proteolytic cleavage sites for gp120/41'. Both forms were
prepared because of literature reports that vaccination of mice
using uncleavable gp160 expressed in vaccinia elicited much higher
levels of antibodies to gp160 than did cleavable forms.
[0130] A quantitative ELISA for gp160/gp120 expression in cell
transfectants was developed to determine the relative expression
capabilities for these vectors. In vitro transfection of 293 cells
followed by quantification of cell-associated vs. secreted/released
gp120 yielded the following results: (1) tPA-gp160 expressed
5-10.times. less gp120 than rev/gp160 with similar proportions
retained intracellularly vs. trafficked to the cell surface; (2)
tPA-gp143 gave 3-6.times. greater secretion of gp120 than rev/gp160
with only low levels of cell-associated gp143, confirming that the
cytoplasmic tail of gp160 causes intracellular retention of gp160
which can be overcome by partial deletion of this sequence; and,
(3) tPA-gp143/mutRRE A and B gave .about.10.times. greater
expression levels of protein than did parental tPA-gp143 while
elimination of proteolytic processing was confirmed for form A.
FIG. 4 presents representative data supporting points (1)-(3).
[0131] Thus, our strategy to increase rev-independent expression
has yielded stepwise increases in overall expression as well as
redirecting membrane-anchored gp143 to the cell surface away from
lysosomes. It is important to note that it should be possible to
insert gp120 sequences derived from various viral isolates within a
vector cassette containing these modifications which reside either
at the NH.sub.2-terminus (tPA leader) or COOH-terminus (gp41),
where few antigenic differences exist between different viral
strains. In other words, this is a generic construct which can
easily be modified by inserting gp120 derived from various primary
viral isolates to obtain clinically relevant vaccines.
[0132] To apply these expression strategies to viruses that are
relevant for vaccine purposes and confirm the generality of our
approaches, we also prepared a tPA-gp120 vector derived from a
primary HIV isolate (containing the North American consensus V3
peptide loop; macrophage-tropic and nonsyncytia-inducing
phenotypes). This vector gave high expression/secretion of gp120
with transfected 293 cells and elicited anti-gp120 antibodies in
mice demonstrating that it was cloned in a functional form. Primary
isolate gp160 genes will also be used for expression in the same
way as for gp160 derived from laboratory strains.
EXAMPLE 3
[0133] Immune Responses to HIV-1 env Polynucleotide Vaccines:
[0134] African green (AGM) and Rhesus (RHM) monkeys which received
gp120 DNA vaccines showed low levels of neutralizing antibodies
following 2-3 vaccinations, which could not be increased by
additional vaccination. These results, as well as increasing
awareness within the HIV vaccine field that oligomeric gp160 is
probably a more relevant target antigen for eliciting neutralizing
antibodies than gp120 monomers (Moore and Ho, J. Virol. 67: 863
(1993)), have led us to focus upon obtaining effective expression
of gp160-based vectors (see above). Mice and AGM were also
vaccinated with the primary isolate derived tPA-gp120 vaccine.
These animals exhibited anti-V3 peptide (using homologous sequence)
reciprocal endpoint antibody titers ranging from 500-5000,
demonstrating that this vaccine design is functional for clinically
relevant viral isolates.
[0135] The gp160-based vaccines, rev-gp160 and tPA-gp160, failed to
consistently elicit antibody responses in mice and nonhuman
primates or yielded low antibody titers. Our initial results with
the tPA-gp143 plasmid yielded geometric mean titers>10.sup.3 in
mice and AGM following two vaccinations. These data indicate that
we have significantly improved the immunogenicity of gp160-like
vaccines by increasing expression levels. This construct, as well
as the tPA-gp143/mutRRE A and B vectors, will continue to be
characterized for antibody responses, especially for virus
neutralization.
[0136] Significantly, gp120 DNA vaccination produced potent helper
T cell responses in all lymphatic compartments tested (spleen,
blood, inguinal, mesenteric, and iliac nodes) with T.sub.H1-like
cytokine secretion profiles (i.e., g-interferon and IL-2 production
with little or no IL-4). These cytokines generally promote strong
cellular immunity and have been associated with maintenance of a
disease-free state for HIV-seropositive patients. Lymph nodes have
been shown to be primary sites for HIV replication, harboring large
reservoirs of virus even when virus cannot be readily detected in
the blood. A vaccine which can elicit anti-HIV immune responses at
a variety of lymph sites, such as we have shown with our DNA
vaccine, may help prevent successful colonization of the lymphatics
following initial infection.
[0137] As stated previously, we consider realization of the
following objectives to be essential to maximize our chances for
success with this program: (1) env-based vectors capable of
generating stronger neutralizing antibody responses in primates;
(2) gag and env vectors which elicit strong T-lymphocyte responses
as characterized by CTL and helper effector functions in primates;
(3) use of env and gag genes from clinically relevant HIV-1 strains
in our vaccines and characterization of the immunologic responses,
especially neutralization of primary isolates, they elicit; (4)
demonstration of protection in an animal challenge model such as
chimpanzee/HIV (IIIB) or rhesus/SHIV using appropriate optimized
vaccines; and, (5) determination of the duration of immune
responses appropriate to clinical use. Significant progress has
been made on the first three of these objectives and experiments
are in progress to determine whether our recent vaccination
constructs for gp160 and gag will improve upon these initial
results.
EXAMPLE 4
[0138] Vectors for Vaccine Production
[0139] A. V1Jneo Expression Vector, SEQ. ID 1:
[0140] It was necessary to remove the amp.sup.r gene used for
antibiotic selection of bacteria harboring V1J because ampicillin
may not be used in large-scale fermenters. The amp.sup.r gene from
the pUC backbone of V1J was removed by digestion with SspI and
Eam11051 restriction enzymes. The remaining plasmid was purified by
agarose gel electrophoresis, blunt-ended with T4 DNA polymerase,
and then treated with calf intestinal alkaline phosphatase. The
commercially available kan.sup.r gene, derived from transposon 903
and contained within the pUC4K plasmid, was excised using the PstI
restriction enzyme, purified by agarose gel electrophoresis, and
blunt-ended with T4 DNA polymerase. This fragment was ligated with
the V1J backbone and plasmids with the kan.sup.r gene in either
orientation were derived which were designated as V1Jneo #'s 1 and
3. Each of these plasmids was confirmed by restriction enzyme
digestion analysis, DNA sequencing of the junction regions, and was
shown to produce similar quantities of plasmid as V1J. Expression
of heterologous gene products was also comparable to V1J for these
V1Jneo vectors. We arbitrarily selected V1Jneo#3, referred to as
V1Jneo hereafter (SEQ ID: 1), which contains the kan.sup.r gene in
the same orientation as the amp.sup.r gene in V1J as the expression
construct.
[0141] B. V1Jns Expression Vector:
[0142] An Sfi I site was added to V1Jneo to facilitate integration
studies. A commercially available 13 base pair Sfi I linker (New
England BioLabs) was added at the Kpn I site within the BGH
sequence of the vector. V1Jneo was linearized with Kpn I, gel
purified, blunted by T4 DNA polymerase, and ligated to the blunt
Sfi I linker. Clonal isolates were chosen by restriction mapping
and verified by sequencing through the linker. The new vector was
designated V1Jns. Expression of heterologous genes in V1Jns (with
Sfi I) was comparable to expression of the same genes in V1Jneo
(with Kpn I).
[0143] C. V1Jns-tPA:
[0144] In order to provide an heterologous leader peptide sequence
to secreted and/or membrane proteins, V1Jn was modified to include
the human tissue-specific plasminogen activator (tPA) leader. Two
synthetic complementary oligomers were annealed and then ligated
into V1Jn which had been BglII digested. The sense and antisense
oligomers were 5'-GATC ACC ATG GAT GCA ATG AAG AGA GGG CTC TGC TGT
GTG CTG CTG CTG TGT GGA GCA GTC TTC GTT TCG CCC AGC GA-3' (SEQ. ID:
2), and 5'-GAT CTC GCT GGG CGA AAC GAA GAC TGC TCC ACA CAG CAG CAG
CAC ACA GCA GAG CCC TCT CTT CAT TGC ATC CAT GGT-3' (SEQ. ID: 3).
The Kozak sequence is underlined in the sense oligomer. These
oligomers have overhanging bases compatible for ligation to
BglII-cleaved sequences. After ligation the upstream BglII site is
destroyed while the downstream BglII is retained for subsequent
ligations. Both the junction sites as well as the entire tPA leader
sequence were verified by DNA sequencing. Additionally, in order to
conform with our consensus optimized vector V1Jns (=V1Jneo with an
SfiI site), an SfiI restriction site was placed at the KpnI site
within the BGH terminator region of V1Jn-tPA by blunting the KpnI
site with T4 DNA polymerase followed by ligation with an SfiI
linker (catalogue #1138, New England Biolabs). This modification
was verified by restriction digestion and agarose gel
electrophoresis.
EXAMPLE 5
[0145] I. HIV env Vaccine Constructs:
[0146] Vaccines Producing Secreted env-Derived Antigen (gp120 and
gp140):
[0147] Expression of the rev-dependent env gene as gp120 was
conducted as follows: gp120 was PCR-cloned from the MN strain of
HIV with either the native leader peptide sequence (V1Jns-gp120),
or as a fusion with the tissue-plasminogen activator (tPA) leader
peptide replacing the native leader peptide (V1Jns-tPA-gp120).
tPA-gp120 expression has been shown to be rev-independent [B. S.
Chapman et al., Nuc. Acids Res. 19, 3979 (1991); it should be noted
that other leader sequences would provide a similar function in
rendering the gp120 gene rev independent]. This was accomplished by
preparing the following gp120 constructs utilizing the above
described vectors.
EXAMPLE 6
[0148] gp120 Vaccine Constructs:
[0149] A. V1Jns-tPA-HTV.sub.MN gp120:
[0150] HIV.sub.MN gp120 gene (Medimmune) was PCR amplified using
oligomers designed to remove the first 30 amino acids of the
peptide leader sequence and to facilitate cloning into V1Jns-tPA
creating a chimeric protein consisting of the tPA leader peptide
followed by the remaining gp120 sequence following amino acid
residue 30. This design allows for rev -independent gp120
expression and secretion of soluble gp120 from cells harboring this
plasmid. The sense and antisense PCR oligomers used were 5'-CCC CGG
ATC CTG ATC ACA GAA AAA TTG TGGGTC ACA GTC-3' (SEQ. ID:4), and 5'-C
CCC AGG AATC CAC CTG TTA GCG CTT TTC TCT CTG CAC CAC TCT TCT C-3'
(SEQ. ID: 5). The translation stop codon is underlined. These
oligomers contain BamHI restriction enzyme sites at either end of
the translation open reading frame with a BclI site located 3' to
the BamHI of the sense oligomer. The PCR product was sequentially
digested with Bell followed by BamHI and ligated into V1Jns-tPA
which had been BglII digested followed by calf intestinal alkaline
phosphatase treatment. The resulting vector was sequenced to
confirm in-frame fusion between the tPA leader and gp120 coding
sequence, and gp120 expression and secretion was verified by
immunoblot analysis of transfected RB cells.
[0151] B. V1Jns-tPA-HIV.sub.IIIB gp120:
[0152] This vector is analogous to I.A. except that the HIV IIIB
strain was used for gp120 sequence. The sense and antisense PCR
oligomers used were: 5'-GGT ACA TGA TCA CA GAA AAA TTG TGG GTC ACA
GTC-3' (SEQ. ID: 6), and 5'-CCA CAT TGA TCA GAT ATC TTA TCT TTT TTC
TCT CTG CAC CAC TCT TC-3' (SEQ. ID: 7), respectively. These
oligomers provide BclI sites at either end of the insert as well as
an EcoRV just upstream of the BclI site at the 3'-end. The
5'-terminal BclI site allows ligation into the BglII site of
V1Jns-tPA to create a chimeric tPA-gp120 gene encoding the tPA
leader sequence and gp120 without its native leader sequence.
Ligation products were verified by restriction digestion and DNA
sequencing.
EXAMPLE 7
[0153] gp140 Vaccine Constructs:
[0154] These constructs was prepared by PCR similarly as tPA-gp120
with the tPA leader in place of the native leader, but designed to
produce secreted antigen by terminating the gene immediately
NH2-terminal of the transmembrane peptide (projected
carboxyterminal amino acid sequence=NH.sub.2- . . . TNWLWYIK-COOH)
[SEQ. ID: 8]. Unlike the gp120-producing constructs, gp140
constructs should produce oligomeric antigen and retain known
gp41-contained antibody neutralization epitopes such as ELDKWA
(SEQ. ID: 53) defined by the 2F5 monoclonal antibody.
[0155] Constructs were prepared in two forms (A or B) depending
upon whether the gp160 proteolytic cleavage sites at the junction
of gp.sup.120 and gp41 were retained (B) or eliminated (A) by
appropriate amino acid substitutions as described by Kieny et al.,
(Prot. Eng. 2: 219-255 (1988)) (wild type sequence=NH2- . . .
KAKRRVVQREKR . . . COOH (SEQ. ID: 9) and the mutated
sequence=NH.sub.2- . . . KAQNHVVQNEHQ . . . COOH (SEQ. ID: 10) with
mutated amino acids underlined).
[0156] A. V1Jns-tPA-gp140/mutRRE-A/SRV-1 3'-UTR (Based on HIV-b
1.sub.IIIB):
[0157] This construct was obtained by PCR using the following sense
and antisense PCR oligomers: 5'-CT GAA AGA CCA GCA ACT CCT AGG GAAT
TTG GGG TTG CTC TGG-3' (SEQ. ID: 11):, and 5'-CGC AGG GGA GGT GGT
CTA GAT ATC TTA TTA TTT TAT ATA CCA CAG CCA ATT TGT TAT G-3' (SEQ
ID: 12) to obtain an AvrII/EcoRV segment from vector IVB
(containing the optimized RRE-A segment). The 3'-UTR, prepared as a
synthetic gene segment, that is derived from the Simian
Retrovirus-1 (SRV-1, see below) was inserted into an SrfI
restriction enzyme site introduced immediately 3'- of the gp140
open reading frame. This UTR sequence has been described previously
as facilitating rev-independent expression of HIV env and gag.
[0158] B. V1Jns-tPA-gp140/mutRRE-B/SRV-1 3'-UTR (Based on
HIV-1.sub.IIIB):
[0159] This construct is similar to IIA except that the env
proteolytic cleavage sites have been retained by using construct
IVC as starting material.
[0160] C. V1Jns-tPA-gp140/Opt30-A (Based on HIV-1.sub.IIIB):
[0161] This construct was derived from IVB by AvrII and SrfI
restriction enzyme digestion followed by ligation of a synthetic
DNA segment corresponding to gp30 but comprised of optimal codons
for translation (see gp32-opt below). The gp30-opt DNA was obtained
from gp32-opt by PCR amplification using the following sense and
anti-sense oligomers: 5'-GGT ACA CCT AGG CAT CTG GGG CTG CTC
TGG-3', (SEQ ID: 13) and, 5'-CCA CAT GAT ATC G CCC GGG C TTA TTA
TTT GAT GTA CCA CAG CCA GTT GGT GAT G-3', (SEQ ID: 14),
respectively. This DNA segment was digested with AvrII and EcoRV
restriction enzymes and ligated into V1Jns-tPA-gp143/opt32-A (IVD)
that had been digested with AvrII and SrfI to remove the
corresponding DNA segment. The resulting products were verified by
DNA sequencing of ligation junctions and immunoblot analysis.
[0162] D. V1Jns-tPA-gp140/Opt30-B (Based on HIV-1.sub.IIIB):
[0163] This construct is similar to IIC except that the env
proteolytic cleavage sites have been retained.
[0164] E. V1Jns-tPA-gp140/Opt All-A:
[0165] The env gene of this construct is comprised completely of
optimal codons. The constant regions (C1, C5, gp32) are those
described in IVB,D,H with an additional synthetic DNA segment
corresponding to variable regions 1-5 is inserted using a synthetic
DNA segment comprised of optimal codons for translation (see
example below based on HIV-1 MN V1-V5).
[0166] F. V1Jns-tPA-gp140/Opt All-B:
[0167] This construct is similar to IIE except that the env
proteolytic cleavage sites have been retained.
[0168] G. V1Jns-tPA-gp140/Opt All-A (Non-IIIB Strains):
[0169] This construct is similar to IIE above except that env amino
acid sequences from strains other than IIIB are used to determine
optimum codon usage throughout the variable (V1-V5) regions.
[0170] H. V1Jns-tPA-gp140/opt All-B (Non-IIIB Strains):
[0171] This construct is similar to IIG except that the env
proteolytic cleavage sites have been retained.
EXAMPLE 8
[0172] gp160 Vaccine Constructs:
[0173] Constructs were prepared in two forms (A or B) depending
upon whether the gp160 proteolytic cleavage sites as described
above.
[0174] A. V1Jns-rev/env:
[0175] This vector is a variation of the one described in section D
above except that the entire tat coding region in exon 1 is deleted
up to the beginning of the rev open reading frame.
V1Jns-gp160.sub.IIIB (see section A. above) was digested with PstI
and KpnI restriction enzymes to remove the 5'-region of the gp160
gene. PCR amplification was used to obtain a DNA segment encoding
the first REV exon up to the KpnI site in gp160 from the HXB2
genomic clone. The sense and antisense PCR oligomers were 5'-GGT
ACA CTG CAG TCA CCG TCC T ATG GCA GGA AGA AGC GGA GAC-3' (SEQ. ID:
15) and 5'-CCA CAT CA GGT ACC CCA TAA TAG ACT GTG ACC-3' (SEQ. ID:
16) respectively. These oligomers provide PstI and KpnI restriction
enzyme sites at the 5'- and 3'-termini of the DNA fragment,
respectively. The resulting DNA was digested with PstI and KpnI,
purified from an agarose electrophoretic gel, and ligated with
V1Jns-gp160(PstI/KpnI). The resulting plasmid was verified by
restriction enzyme digestion.
[0176] B. V1Jns-gp160:
[0177] HIV.sub.IIIb gp160 was cloned by PCR amplification from
plasmid pF412 which contains the 3'-terminal half of the
HIV.sub.IIIb genome derived from HIV.sub.IIIb clone HXB2. The PCR
sense and antisense oligomers were 5'-GGT ACA TGA TCA ACC ATG AGA
GTG AAG GAG AAA TAT CAG C-3' (SEQ. ID: 17), and 5'-CCA CAT TGA TCA
GAT ATC CCC ATC TTA TAG CAA AAT CCT TTC C-3' (SEQ. ID: 18),
respectively. The Kozak sequence and translation stop codon are
underlined. These oligomers provide BclI restriction enzyme sites
outside of the translation open reading frame at both ends of the
env gene. (BclI-digested sites are compatible for ligation with
BglII-digested sites with subsequent loss of sensitivity to both
restriction enzymes. BclI was chosen for PCR-cloning gp160 because
this gene contains internal BglII and as well as BamHI sites). The
antisense oligomer also inserts an EcoRV site just prior to the
BclI site as described above for other PCR-derived genes. The
amplified gp160 gene was agarose gel-purified, digested with BclI,
and ligated to V1Jns which had been digested with BglII and treated
with calf intestinal alkaline phosphatase. The cloned gene was
about 2.6 kb in size and each junction of gp160 with V1Jns was
confirmed by DNA sequencing.
[0178] C. V1Jns-tPA-gp160 (Based on HIV-1.sub.IIIB):
[0179] This vector is similar to Example 1 (C) above, except that
the full-length gp160, without the native leader sequence, was
obtained by PCR. The sense oligomer was the same as used in I.C.
and the antisense oligomer was 5'-CCA CAT TGA TCA GAT ATC CCC ATC
TTA TAG CAA AAT CCT TTC C-3' (SEQ. ID: 19). These oligomers provide
Bell sites at either end of the insert as well as an EcoRV just
upstream of the BclI site at the 3'-end. The 5'-terminal BclI site
allows ligation into the BglII site of V1Jns-tPA to create a
chimeric tPA-gp160 gene encoding the tPA leader sequence and gp160
without its native leader sequence. Ligation products were verified
by restriction digestion and DNA sequencing.
[0180] D. V1Jns-tPA-gp160/Opt C1/Opt41-A (Based on
HIV-1.sub.IIIB):
[0181] This construct was based on IVH, having a complete optimized
codon segment for C5 and gp41, rather than gp32, with an additional
optimized codon segment (see below) replacing C1 at the amino
terminus of gp120 following the tPA leader. The new C1 segment was
joined to the remaining gp143 segment via SOE PCR using the
following oligomers for PCR to synthesize the joined C1/143
segment: 5'-CCT GTG TGT GAG TTT AAA C TGC ACT GAT TTG AAG AAT GAT
ACT AAT AC-3' (SEQ ID: 20). The resulting gp143 gene contains
optimal codon usage except for V1-V5 regions and has a unique PmeI
restriction enzyme site placed at the junction of C1 and V1 for
insertion of variable regions from other HIV genes.
[0182] E. V1Jns-tPA-gp160/Opt C1/Opt41-B (Based on
HIV-1.sub.IIIB):
[0183] This construct is similar to IIID except that the env
proteolytic cleavage sites have been retained.
[0184] F V1Jns-tPA-gp160/Opt all-A (Based on HIV-1.sub.IIIB):
[0185] The env gene of this construct is comprised completely of
optimal codons as described above. The constant regions (C1, C5,
gp32) are those described in IIID,E which is used as a cassette
(employed for all completely optimized gp160s) while the variable
regions, V1-V5, are derived from a synthetic DNA segment comprised
of optimal codons.
[0186] G. V1Jns-tPA-gp160/Opt All-B:
[0187] This construct is similar to IIIF except that the env
proteolytic cleavage sites have been retained.
[0188] H. V1Jns-tPA-gp160/Opt All-A (Non-IIIB Strains):
[0189] This construct is similar to IIIF above except that env
amino acid sequences from strains other than IIIB were used to
determine optimum codon useage throughout the variable (V1-V5)
regions.
[0190] I. V1Jns-tPA-gp160/Opt All-B (Non-IIIB Strains):
[0191] This construct is similar to IIIH except that the env
proteolytic cleavage sites have been retained.
EXAMPLE 9
[0192] gp143 Vaccine Constructs:
[0193] These constructs were prepared by PCR similarly as other
tPA-containing constructs described above (tPA-gp120, tPA-gp140,
and tPA-gp160), with the tPA leader in place of the native leader,
but designed to produce COOH-terminated, membrane-bound env
(projected intracellular amino acid sequence=NH2-NRVRQGYSP-COOH).
This construct was designed with the purpose of combining the
increased expression of env accompanying tPA introduction and
minimizing the possibility that a transcript or peptide region
corresponding to the intracellular portion of env might negatively
impact expression or protein stability/transport to the cell
surface. Constructs were prepared in two forms (A or B) depending
upon whether the gp160 proteolytic cleavage sites were removed or
retained as described above. The residual gp41 fragment resulting
from truncation to gp143 is referred to as gp32.
[0194] A. V1Jns-tPA-gp143:
[0195] This construct was prepared by PCR using plasmid pF412 with
the following sense and antisense PCR oligomers: 5'-GGT ACA TGA TCA
CA GAA AAA TTG TGG GTC ACA GTC-3' (SEQ. ID: 21):, and 5'-CCA CAT
TGA TCA G CCC GGG C TTA GGG TGA ATA GCC CTG CCT CAC TCT GTT CAC-3'
(SEQ. ID: 22). The resulting DNA segment contains BelI restriction
sites at either end for cloning into V1Jns-tPA/BglII-digested with
an SrfI site located immediately 3'- to the env open reading frame.
Constructs were verified by DNA sequencing of ligation junctions
and immunoblot analysis of transfected cells (FIG. 8).
[0196] B. V1Jns-tPA-gp143/mutRRE-A:
[0197] This construct was based on IVA by excising the DNA segment
using the unique MunI restriction enzyme site and the downstream
SrfI site described above. This segment corresponds to a portion of
the gp120 C5 domain and the entirety of gp32. A synthetic DNA
segment corresponding to .about.350 bp of the rev response element
(RRE A) of gp160, comprised of optimal codons for translation, was
joined to the remaining gp32 segment by splice overlap extension
(SOE) PCR creating an AvrII restriction enzyme site at the junction
of the two segments (but no changes in amino acid sequence). These
PCR reactions were performed using the following sense and
antisense PCR oligomers for generating the gp32-containing domain:
5'-CT GAA AGA CCA GCA ACT CCT AGG GAT TTG GGG TTG CTG TGG-3' (SEQ
ID: 23) and 5'-CCA CAT TGA TCA G CCC GGG C TTA GGG TGA ATA GCC CTG
CCT CAC TCT GTT CAC-3' [SEQ ID: 24] (which was used as the
antisense oligomer for IVA), respectively. The mutated RRE
(mutRRE-A) segment was joined to the wild type sequence of gp32 by
SOE PCR using the following sense oligomer, 5'-GGT ACA CAA TTG GAG
GAG CGA GTT ATA TAA ATA TAA G-3' (SEQ ID: 25), and the antisense
oligomer used to make the gp32 segment. The resulting joined DNA
segment was digested with MunI and SrfI restriction enzymes and
ligated into the parent gp143/MunI/SrfI digested plasmid. The
resulting construct was verified by DNA sequencing of ligation and
SOE PCR junctions and immunoblot analysis of transfected cells
(FIG. 8).
[0198] C. V1Jns-tPA-gp143/mutRRE-B:
[0199] This construct is similar to IVB except that the env
proteolytic cleavage sites have been retained by using the mutRRE-B
synthetic gene segment in place of mutRRE-A.
[0200] D. V1Jns-tPA-gp143/Opt32-A:
[0201] This construct was derived from IVB by AvrII and SrfI
restriction enzyme digestion followed by ligation of a synthetic
DNA segment corresponding to gp32 but comprised of optimal codons
for translation (see gp32 opt below). The resulting products were
verified by DNA sequencing of ligation junctions and immunoblot
analysis.
[0202] E. V1Jns-tPA-gp143/Opt32-B:
[0203] This construct is similar to IVD except that the env
proteolytic cleavage sites have been retained by using IVC as the
initial plasmid.
[0204] F. V1Jns-tPA-gp143/SRV-1 3'-UTR:
[0205] This construct is similar to IVA except that the 3'-UTR
derived from the Simian Retrovirus-1 (SRV-1, see below) was
inserted into the SrfI restriction enzyme site introduced
immediately 3'- of the gp143 open reading frame. This UTR sequence
has been described previously as facilitating rev-independent
expression of HIV env and gag.
[0206] G. V1Jns-tPA-gp143/Opt C1/Opt32A:
[0207] This construct was based on IVD, having a complete optimized
codon segment for C5 and gp32 with an additional optimized codon
segment (see below) replacing C1 at the amino terminus of gp120
following the tPA leader. The new C1 segment was joined to the
remaining gp143 segment via SOE PCR using the following oligomers
for PCR to synthesize the joined C1/143 segment: 5'-CCT GTG TGT GAG
TTT AAA C TGC ACT GAT TTG AAG AAT GAT ACT AAT AC-3' (SEQ ID: 26).
The resulting gp143 gene contains optimal codon useage except for
V1-V5 regions and has a unique PmeI restriction enzyme site placed
at the junction of C1 and V1 for insertion of variable regions from
other HIV genes.
[0208] H. V1Jns-tPA-gp143/Opt C1/Opt32B:
[0209] This construct is similar to IVH except that the env
proteolytic cleavage sites have been retained.
[0210] I. V1Jns-tPA-gp143/Opt All-A:
[0211] The env gene of this construct is comprised completely of
optimal codons. The constant regions (C1, C5, gp32) are those
described in 4B,D,H with an additional synthetic DNA segment
corresponding to variable regions V1-V5 is inserted using a
synthetic DNA segment comprised of optimal codons for
translation.
[0212] J. V1Jns-tPA-gp143/Opt All-B:
[0213] This construct is similar to IVJ except that the env
proteolytic cleavage sites have been retained.
[0214] K. V1Jns-tPA-gp143/Opt All-A (Non-IIIB Strains):
[0215] This construct is similar to IIIG above except that env
amino acid sequences from strains other than IIIB were used to
determine optimum codon useage throughout the variable (V1-V5)
regions.
[0216] L. V1Jns-tPA-gp143/Opt All-B (Non-IIIB Strains):
[0217] This construct is similar to IIIG above except that env
amino acid sequences from strains other than IIIB were used to
determine optimum codon useage throughout the variable (V1-V5)
regions.
EXAMPLE 10
[0218] gp143/glyB Vaccine Constructs:
[0219] These constructs were prepared by PCR similarly as other
tPA-containing constructs described above (tPA-gp120, tPA-gp140,
tPA-gp143 and tPA-gp160), with the tPA leader in place of the
native leader, but designed to produce COOH-terminated,
membrane-bound env as with gp143. However, gp143/glyB constructs
differ from gp143 in that of the six amino acids projected to
comprise the intracellular peptide domain, the last 4 are the same
those at the carboxyl terminus of human glycophorin B (glyB)
protein (projected intracellular amino acid
sequence=NH2-NRLIKA-COOH (SEQ. ID: 27) with the underlined residues
corresponding to glyB and "R" common to both env and glyB). This
construct was designed with the purpose gaining additional env
expression and directed targeting to the cell surface by completely
eliminating any transcript or peptide region corresponding to the
intracellular portion of env that might negatively impact
expression or protein stability/transport to the cell surface by
replacing this region with a peptide sequence from an abundantly
expressed protein (glyB) having a short cytoplasmic domain
(intracellular amino acid sequence=NH.sub.2-RRLIKA-COOH).
Constructs were prepared in two forms (A or B) depending upon
whether the gp160 proteolytic cleavage sites were removed or
retained as described above.
[0220] A. V1Jns-tPA-gp143/opt32-A/glyB:
[0221] This construct is the same as IVD except that the following
antisense PCR oligomer was used to replace the intracellular
peptide domain of gp143 with that of glycophorin B as described
above: 5'-CCA CAT GAT ATC G CCC GGG C TTA TTA GGC CTT GAT CAG CCG
GTT CAC AAT GGA CAG CAC AGC-3' (SEQ ID: 28).
[0222] B. V1Jns-tPA-gp143/Opt32-B/glyB:
[0223] This construct is similar to VA except that the env
proteolytic cleavage sites have been retained.
[0224] C. V1Jns-tPA-gp143/Opt C1/Opt32-A/glyB:
[0225] This construct is the same as VA except that the first
constant region (C1) of gp120 is replaced by optimal codons for
translation as with IVH.
[0226] D. V1Jns-tPA-gp143/Opt C1/Opt32-B/glyB:
[0227] This construct is similar to VC except that the env
proteolytic cleavage sites have been retained.
[0228] E. V1Jns-tPA-gp143/Opt All-A/glyB:
[0229] The env gene of this construct is comprised completely of
optimal codons as described above.
[0230] F. V1Jns-tPA-gp143/Opt All-B/glyB:
[0231] This construct is similar to VE except that the env
proteolytic cleavage sites have been retained.
[0232] G. V1Jns-tPA-gp143/Opt All-A/glyB (Non-IIIB Strains):
[0233] This construct is similar to IIIG above except that env
amino acid sequences from strains other than IIIB were used to
determine optimum codon useage throughout the variable (V1-V5)
regions.
[0234] H. V1Jns-tPA-gp143/opt all-B/glyB (Non-IIIB Strains):
[0235] This construct is similar to VG except that the env
proteolytic cleavage sites have been retained.
[0236] HIV env Vaccine Constructs with Variable Loop Deletions:
[0237] These constructs may include all env forms listed above
(gp120, gp140, gp143, gp160, gp143/glyB) but have had variable
loops within the gp120 region deleted during preparation (e.g., V1,
V2, and/or V3). The purpose of these modifications is to eliminate
peptide segments which may occlude exposure of conserved
neutralization epitopes such as the CD4 binding site. For example,
the following oligomer was used in a PCR reaction to create a V1/V2
deletion resulting in adjoining THE C1 and C2 segments: 5'-CTG ACC
CCC CTG TGT GTG GGG GCT GGC AGT TGT AAC ACC TCA GTC ATT ACA CAG-3'
(SEQ ID: 29).
EXAMPLE 11A
[0238] Design of Synthetic Gene Segments for Increased env Gene
Expression: Gene segments were converted to sequences having
identical translated sequences (except where noted) but with
alternative codon usage as defined by R. Lathe in a research
article from J. Molec. Biol. Vol. 183, pp. 1-12 (1985) entitled
"Synthetic Oligonucleotide Probes Deduced from Amino Acid Sequence
Data: Theoretical and Practical Considerations". The methodology
described below to increase rev-independent expression of HIV env
gene segments was based on our hypothesis that the known inability
to express this gene efficiently in mammalian cells is a
consequence of the overall transcript composition. Thus, using
alternative codons encoding the same protein sequence may remove
the constraints on env expression in the absence of rev. Inspection
of the codon usage within env revealed that a high percentage of
codons were among those infrequently used by highly expressed human
genes. The specific codon replacement method employed may be
described as follows employing data from Lathe et al.:
[0239] 1. Identify placement of codons for proper open reading
frame.
[0240] 2. Compare wild type codon for observed frequency of use by
human genes (refer to Table 3 in Lathe et al.).
[0241] 3. If codon is not the most commonly employed, replace it
with an optimal codon for high expression based on data in Table
5.
[0242] 4. Inspect the third nucleotide of the new codon and the
first nucleotide of the adjacent codon immediately 3'- of the
first. If a 5'-CG-3' pairing has been created by the new codon
selection, replace it with the choice indicated in Table 5.
[0243] 5. Repeat this procedure until the entire gene segment has
been replaced.
[0244] 6. Inspect new gene sequence for undesired sequences
generated by these codon replacements (e.g., "ATTTA" sequences,
inadvertent creation of intron splice recognition sites, unwanted
restriction enzyme sites, etc.) and substitute codons that
eliminate these sequences.
[0245] 7. Assemble synthetic gene segments and test for improved
expression.
[0246] These methods were used to create the following synthetic
gene segments for HIV env creating a gene comprised entirely of
optimal codon usage for expression: (i) gp120-C1 (opt); (ii) V1-V5
(opt); (iii) RRE-A/B (mut or opt); and (iv) gp30 (opt) with
percentages of codon replacements/nucleotide substitutions of
56/19, 73/26, 78/28, and 61/25 obtained for each segment,
respectively. Each of these segments has been described in detail
above with actual sequences listed below.
[0247] gp120-C1 (Opt)
[0248] This is a gp120 constant region 1 (C1) gene segment from the
mature N-terminus to the beginning of V1 designed to have optimal
codon usage for expression.
1 1 TGATCACAGA GAAGCTGTGG GTGACAGTGT ATTATGGCGT GCCAGTCTGG (SEQ
ID:30) 51 AAGGAGGCCA CCACCACCCT GTTCTGTGCC TCTGATGCCA AGGCCTATGA
101 CACAGAGGTG CACAATGTGT GGGCCACCCA TGCCTGTGTG CCCACAGACC 151
CCAACCCCCA GGAGGTGGTG CTGGTGAATG TGACTGAGAA CTTCAACATG 201
TGGAAGAACA ACATGGTGGA GCAGATGCAT GAGGACATCA TCAGCCTGTG 251
GGACCAGAGC CTGAAGCCCT GTGTGAAGCT GACCCCCCTG TGTGTGAGTT 301
TAAAC
[0249] MN V1-V5 (Opt)
[0250] This is a gene segment corresponding to the derived protein
sequence for HIV MN V1-V5 (1066BP) having optimal codon usage for
expression.
2 1 AGTTTAAACT GCACAGACCT GAGGAACACC ACCAACACCA ACAACTCCAC (SEQ
ID:31) 51 AGCCAACAAC AACTCCAACT CCGAGGGCAC CATCAAGGGG GGGGAGATGA
101 AGAACTGCTC CTTCAACATC ACCACCTCCA TCAGGGACAA GATGCAGAAG 151
GAGTATGCCC TGCTGTACAA GCTGGACATT GTGTCCATTG ACAATGACTC 201
CACCTCCTAC AGGCTGATCT CCTGCAACAC CTCTGTCATC ACCCAGGCCT 251
GCCCCAAAAT CTCCTTTGAG CCCATCCCCA TCCACTACTG TGCCCCTGCT 301
GGCTTTGCCA TCCTGAAGTG CAATGACAAG AAGTTCTCTG GCAAGGGCTC 351
CTGCAAGAAT GTGTCCACAG TGCAGTGCAC ACATGGCATC AGGCCTGTGG 401
TGTCCACCCA GCTGCTGCTG AATGGCTCCC TGGCTGAGGA GGAGGTGGTC 451
ATCAGGTCTG AGAACTTCAC AGACAATGCC AAGACCATCA TCGTGCACCT 501
GAATGAGTCT GTGCAGATCA ACTGCACCAG GCCCAACTAC AACAAGAGGA 551
AGAGGATGCA CATTGGCCCT GGCAGGGCCT TCTACACCAC CAAGAACATC 601
ATTGGCACCA TCAGGCAGGC CCACTGCAAC ATCTCCAGGG CCAAGTGGAA 651
TGACACCCTG AGGCAGATTG TGTCCAAGCT GAAGGAGCAG TTCAAGAACA 701
AGACCATTGT GTTCAACCAG TCCTCTGGGG GGGACCCTGA GATTGTGATG 751
CACTCCTTCA ACTGTGGGGG GGAGTTCTTC TACTGCAACA CCTCCCCCCT 801
GTTCAACTCC ACCTGGAATG GCAACAACAC CTGGAACAAC ACCACAGGCT 851
CCAACAACAA CATCACCCTC CAGTGCAAGA TCAAGCAGAT CATCAACATG 901
TGGCAGGAGG TGGGCAAGGC CATGTATGCC CCCCCCATTG AGGGCCAGAT 951
CAGGTGCTCC TCCAACATCA CAGGCCTGCT GCTGACCAGG GATGGGGGGA 1001
AGGACACAGA CACCAACGAC ACCGAAATCT TCAGGCCTGG GGGGGGGGAC 1051
ATGAGGGACA ATTGG
[0251] RRE.Mut (A)
[0252] This is a DNA segment corresponding to the rev response
element (RRE) of HIV-1 comprised of optimal codon usage for
expression. The "A" form also has removed the known proteolytic
cleavage sites at the gp120/gp41 junction by using the nucleotides
indicated in boldface.
3 1 GACAATTGGA GGAGCGAGTT ATATAAATAT AAGGTGGTGA AGATTGAGCC (SEQ
ID:32) 51 CCTGGGGGTG GCCCCAACAA AAGCTCAGAACCACGTGGTG CAGAACGAGC 101
ACCAGGCCGT GGGCATTGGG GCCCTGTTTC TGGGCTTTCT GGGGGCTGCT 151
GGCTCCACAA TGGGCGCCGC TAGCATGACC CTCACCGTGC AAGCTCGCCA 201
GCTGCTGAGT GGCATCGTCC AGCAGCAGAA CAACCTGCTC CGCGCCATCG 251
AAGCCCAGCA GCACCTCCTC CAGCTGACTG TGTGGGGGAT CAAACAGCTT 301
CAGGCCCGGG TGCTGGCCGT CGAGCGCTAT CTGAAAGACC AGCAACTCCT 351 AGGC
[0253] RRE.Mut (B)
[0254] This is a DNA segment corresponding to the rev response
element (RRE) of HIV-1 comprised of optimal codon usage for
expression. The "B" form retains the known proteolytic cleavage
sites at the gp120/gp41 junction.
4 1 GACAATTGGA GGAGCGAGTT ATATAAATAT AAGGTGGTGA AGATTGAGCC (SEQ
ID:33) 51 CCTGGGGGTG GCCCCAACAA AAGCTAAGAGAAGAGTGGTG CAGAGAGAGA 101
AGAGAGCCGT GGGCATTGGG GCCCTGTTTC TGGGCTTTCT GGGGGCTGCT 151
GGCTCCACAA TGGGCGCCGC TAGCATGACC CTCACCGTGC AAGCTCGCCA 201
GCTGCTGAGT GGCATCGTCC AGCAGCAGAA CAACCTGCTC CGCGCCATCG 251
AAGCCCAGCA GCACCTCCTC CAGCTGACTG TGTGGGGGAT CAAACAGCTT 301
CAGGCCCGGG TGCTGGCCGT CGAGCGCTAT CTGAAAGACC AGCAACTCCT 351 AGGC
[0255] gp32 (Opt)
[0256] This is a gp32 gene segment from the AvrII site (starting
immediately at the end of the RRE) to the end of gp143 comprised of
optimal codons for expression.
5 1 CCTAGGCA TCTGGGGCTG CTCTGGCAAG CTGATCTGCA CCACAGCTGT (SEQ
ID:34) 51 GCCCTGGAAT GCCTCCTGGT CCAACAAGAG CCTGGAGCAA ATCTGGAACA
101 ACATGACCTG GATGGAGTGG GACAGAGAGA TCAACAACTA CACCTCCCTG 151
ATCCACTCCC TGATTGAGGA GTCCCAGAAC CAGGAGGAGA AGAATGAGCA 201
GGAGCTGCTG GAGCTGGACA AGTGGGCCTC CCTGTGGAAC TGGTTCAACA 251
TCACCAACTG GCTGTGGTAC ATCAAAATCT TCATCATGAT TGTGGGGGGC 301
CTGGTGGGGC TGCGGATTGT CTTTGCTGTG CTGTCCATTG TGAACCGGGT 351
GAGACAGGGC TACTCCCCCT AATAAGCCCG GGCGATATC
[0257] SRV-1 CTE (A)
[0258] This is a synthetic gene segment corresponding to a 3'-UTR
from the Simian Retrovirus-1 genome. This DNA is placed in the
following orientation at the 3'-terminus of HIV genes to increase
rev-independent expression.
6 SrfI EcoRV 5'-GCCC GGGC GATATC TA GACCACCTCC CCTGCGAGCT
AAGCTGGACA (SEQ ID:35) GCCAATGACG GGTAAGAGAG TGACATTTTT CACTAACCTA
AGACAGGAGG GCCGTCAGAG CTACTGCCTA ATCCAAAGAC GGGTAAAAGT GATAAAAATG
TATCACTCCA ACCTAAGACA GGCGCAGCTT CCGAGGGATT TGTCGTCTGT TTTATATATA
TTTAAAAGGG TGACCTGTCC GGAGCCGTGC TGCCCGGATG ATGTCTTGG GATATC GCCC
GGGC-3' EcoRV SrfI
[0259] SRV-1 CTE (B)
[0260] This synthetic gene segment is identical to SRV-1 CTE (A)
shown above except that a single nucleotide mutation was used
(indicated by boldface) to eliminate an ATTTA sequence. This
sequence has been associated with increased mRNA turnover.
7 SrfI EcoRV 5'-GCCC GGGC GATATC TA GACCACCTCC CCTGCGAGCT
AAGCTGGACA (SEQ ID:36) GCCAATGACG GGTAAGAGAG TGACATTTTT CACTAACCTA
AGACAGGAGG GCCGTCAGAG CTACTGCCTA ATCCAAAGAC GGGTAAAAGT GATAAAAATG
TATCACTCCA ACCTAAGACA GGCGCAGCTT CCGAGGGATT TGTCGTCTGT TTTATATATA
TTAAAAAGGG TGACCTGTCC GGAGCCGTGC TGCCCGGATG ATGTCTTGG GATATC GCCC
GGGC-3' EcoRV SrfI
EXAMPLE 11B
[0261] In Vitro gp120 Vaccine Expression:
[0262] In vitro expression was tested in transfected human
rhabdomyosarcoma (RD) cells for these constructs. Quantitation of
secreted tPA-gp120 from transfected RD cells showed that
V1Jns-tPA-gp120 vector produced secreted gp120.
[0263] In Vivo gp120 Vaccination:
[0264] V1Jns-tPA-gp120.sub.MNPNV-induced Class II MHC-restricted T
lymphocyte gp120 specific antigen reactivities. Balb/c mice which
had been vaccinated two times with 200 .mu.g V1Jns-tPA-gp120.sub.MN
were sacrificed and their spleens extracted for in vitro
determinations of helper T lymphocyte reactivities to recombinant
gp120. T cell proliferation assays were performed with PBMC
(peripheral blood mononuclear cells) using recombinant
gp120.sub.IIIB (Repligen, catalogue #RP1016-20) at 5 .mu.g/ml with
4.times.10.sup.5 cells/ml. Basal levels of .sup.3H-thymidine uptake
by these cells were obtained by culturing the cells in media alone,
while maximum proliferation was induced using ConA stimulation at 2
.mu.g/ml. ConA-induced reactivities peak at .about.3 days and were
harvested at that time point with media control samples while
antigen-treated samples were harvested at 5 days with an additional
media control. Vaccinated mice responses were compared with naive,
age-matched syngeneic mice. ConA positive controls gave very high
proliferation for both naive and immunized mice as expected. Very
strong helper T cell memory responses were obtained by gp120
treatment in vaccinated mice while the naive mice did not respond
(the threshold for specific reactivity is an stimulation index (SI)
of >3-4; SI is calculated as the ratio of sample cpm/media cpm).
SI's of 65 and 14 were obtained for the vaccinated mice which
compares with anti-gp120 ELISA titers of 5643 and 11,900,
respectively, for these mice. Interestingly, for these two mice the
higher responder for antibody gave significantly lower T cell
reactivity than the mouse having the lower antibody titer. This
experiment demonstrates that the secreted gp120 vector efficiently
activates helper T cells in vivo as well as generates strong
antibody responses. In addition, each of these immune responses was
determined using antigen which was heterologous compared to that
encoded by the inoculation PNV (IIIB vs. MN):
EXAMPLE 12
[0265] gp160 Vaccines
[0266] In addition to secreted gp120 constructs, we have prepared
expression constructs for full-length, membrane-bound gp160. The
rationales for a gp160 construct, in addition to gp120, are (1)
more epitopes are available both for both CTL stimulation as well
as neutralizing antibody production including gp41, against which a
potent HIV neutralizing monoclonal antibody (2F5, see above) is
directed; (2) a more native protein structure may be obtained
relative to virus-produced gp160; and, (3) the success of
membrane-bound influenza HA constructs for immunogenicity [Ulmer et
al., Science 259:1745-1749, 1993; Montgomery, D., et al., DNA and
Cell Biol. 12:777-783, 1993].
[0267] gp160 retains substantial rev dependence even with a
heterologous leader peptide sequence so that further constructs
were made to increase expression in the absence of rev.
EXAMPLE 13
[0268] Assay For HIV Cytotoxic T-Lymphocytes:
[0269] The methods described in this section illustrate the assay
as used for vaccinated mice. An essentially similar assay can be
used with primates except that autologous B cell lines must be
established for use as target cells for each animal. This can be
accomplished for humans using the Epstein-Barr virus and for rhesus
monkey using the herpes B virus.
[0270] Peripheral blood mononuclear cells (PBMC) are derived from
either freshly drawn blood or spleen using Ficoll-Hypaque
centrifugation to separate erythrocytes from white blood cells. For
mice, lymph nodes may be used as well. Effecter CTLs may be
prepared from the PBMC either by in vitro culture in IL-2 (20 U/ml)
and concanavalin A (2 .mu.g/ml) for 6-12 days or by using specific
antigen using an equal number of irradiated antigen presenting
cells. Specific antigen can consist of either synthetic peptides
(9-15 amino acids usually) that are known epitopes for CTL
recognition for the MHC haplotype of the animals used, or vaccinia
virus constructs engineered to express appropriate antigen. Target
cells may be either syngeneic or MHC haplotype-matched cell lines
which have been treated to present appropriate antigen as described
for in vitro stimulation of the CTLs. For Balb/c mice the P18
peptide (ArgIleHisIleGlyProGlyArgAlaPheTyrThrThrLysAsn [SEQ. ID:
37], for HIV MN strain) can be used at 10 .mu.M concentration to
restimulate CTL in vitro using irradiated syngeneic splenocytes and
can be used to sensitize target cells during the cytotoxicity assay
at 1-10 .mu.M by incubation at 37.degree. C. for about two hours
prior to the assay. For these H-2.sup.d MHC haplotype mice, the
murine mastocytoma cell line, P815, provides good target cells.
Antigen-sensitized target cells are loaded with Na.sup.51CrO.sub.4,
which is released from the interior of the target cells upon
killing by CTL, by incubation of targets for 1-2 hours at
37.degree. C. (0.2 mCi for .about.5.times.10.sup.6 cells) followed
by several washings of the target cells. CTL populations are mixed
with target cells at varying ratios of effectors to targets such as
100:1, 50:1, 25:1, etc., pelleted together, and incubated 4-6 hours
at 37.degree. C. before harvest of the supernatants which are then
assayed for release of radioactivity using a gamma counter.
Cytotoxicity is calculated as a percentage of total releasable
counts from the target cells (obtained using 0.2% Triton X-100
treatment) from which spontaneous release from target cells has
been subtracted.
EXAMPLE 14
[0271] Assay For HIV Specific Antibodies:
[0272] ELISA were designed to detect antibodies generated against
HIV using either specific recombinant protein or synthetic peptides
as substrate antigens. 96 well microtiter plates were coated at
4.degree. C. overnight with recombinant antigen at 2 .mu.g/ml in
PBS (phosphate buffered saline) solution using 50 .mu.l/well on a
rocking platform. Antigens consisted of either recombinant protein
(gp120, rev: Repligen Corp.; gp160, gp41: American
Bio-Technologies, Inc.) or synthetic peptide (V3 peptide
corresponding to virus isolate sequences from IIIB, etc.: American
Bio-Technologies, Inc.; gp41 epitope for monoclonal antibody 2F5).
Plates were rinsed four times using wash buffer (PBS/0.05% Tween
20) followed by addition of 200 .mu.l/well of blocking buffer (1%
Carnation milk solution in PBS/0.05% Tween-20) for 1 hr at room
temperature with rocking. Pre-sera and immune sera were diluted in
blocking buffer at the desired range of dilutions and 100 .mu.l
added per well. Plates were incubated for 1 hr at room temperature
with rocking and then washed four times with wash buffer. Secondary
antibodies conjugated with horse radish peroxidase, (anti-rhesus
Ig, Southern Biotechnology Associates; anti-mouse and anti-rabbit
Igs, Jackson Immuno Research) diluted 1:2000 in blocking buffer,
were then added to each sample at 100 .mu.l/well and incubated 1 hr
at room temperature with rocking. Plates were washed 4 times with
wash buffer and then developed by addition of 100 .mu.l/well of an
o-phenylenediamine (o-PD, Calbiochem) solution at 1 mg/ml in 100 mM
citrate buffer at pH 4.5. Plates were read for absorbance at 450 nm
both kinetically (first ten minutes of reaction) and at 10 and 30
minute endpoints (Thermo-max microplate reader, Molecular
Devices).
EXAMPLE 15
[0273] Assay for HIV Neutralizing Antibodies:
[0274] In vitro neutralization of HIV isolates assays using sera
derived from vaccinated animals was performed as follows. Test sera
and pre-immune sera were heat inactivated at 56.degree. C. for 60
min before use. A titrated amount of HIV-1 was added in 1:2 serial
dilutions of test sera and incubated 60 min at room temperature
before addition to 10.sup.5 MT-4 human lymphoid cells in 96 well
microtiter plates. The virus/cell mixtures were incubated for 7
days at 37.degree. C. and assayed for virus-mediated killing of
cells by staining cultures with tetrazolium dye. Neutralization of
virus is observed by prevention of virus-mediated cell death.
EXAMPLE 16
[0275] Isolation of Genes from Clinical HIV Isolates:
[0276] HIV viral genes were cloned from infected PBMC's which had
been activated by ConA treatment. The preferred method for
obtaining the viral genes was by PCR amplification from infected
cellular genome using specific oligomers flanking the desired
genes. A second method for obtaining viral genes was by
purification of viral RNA from the supernatants of infected cells
and preparing cDNA from this material with subsequent PCR. This
method was very analogous to that described above for cloning of
the murine B7 gene except for the PCR oligomers used and random
hexamers used to make cDNA rather than specific priming
oligomers.
[0277] Genomic DNA was purified from infected cell pellets by lysis
in STE solution (10 mM NaCl, 10 mM EDTA, 10 mM Tris-HCl, pH 8.0) to
which Proteinase K and SDS were added to 0.1 mg/ml and 0.5% final
concentrations, respectively. This mixture was incubated overnight
at 56.degree. C. and extracted with 0.5 volumes of
phenol:chloroform:isoamyl alcohol (25:24:1). The aqueous phase was
then precipitated by addition of sodium acetate to 0.3 M final
concentration and two volumes of cold ethanol. After pelleting the
DNA from solution the DNA was resuspended in 0.1.times. TE solution
(1.times. TE=10 mM Tris-HCl, pH 8.0, 1 mM EDTA). At this point SDS
was added to 0.1 % with 2 U of RNAse A with incubation for 30
minutes at 37.degree. C. This solution was extracted with
phenol/chloroform/isoamyl alcohol and then precipitated with
ethanol as before. DNA was suspended in 0.1.times. TE and
quantitated by measuring its ultraviolet absorbance at 260 nm.
Samples were stored at -20.degree. C. until used for PCR.
[0278] 20 PCR was performed using the Perkin-Elmer Cetus kit and
procedure using the following sense and antisense oligomers for
gp160: 5'-GA AAG AGC AGA AGA CAG TGG CAA TGA-3' (SEQ. ID: 38) and
5'-GGG CTT TGC TAA ATG GGT GGC AAG TGG CCC GGG C ATG TGG-3' (SEQ.
ID: 39), respectively. These oligomers add an SrfI site at the
3'-terminus of the resulting DNA fragment. PCR-derived segments are
cloned into either the V1Jns or V1R vaccination vectors and V3
regions as well as ligation junction sites confirmed by DNA
sequencing.
EXAMPLE 17
[0279] T Cell Proliferation Assays:
[0280] PBMCs are obtained and tested for recall responses to
specific antigen as determined by proliferation within the PBMC
population. Proliferation is monitored using .sup.3H-thymidine
which is added to the cell cultures for the last 18-24 hours of
incubation before harvest. Cell harvesters retain
isotope-containing DNA on filters if proliferation has occurred
while quiescent cells do not incorporate the isotope which is not
retained on the filter in free form. For either rodent or primate
species 4.times.10.sup.5 cells are plated in 96 well microtiter
plates in a total of 200 .mu.l of complete media (RPMI/10% fetal
calf serum). Background proliferation responses are determined
using PBMCs and media alone while nonspecific responses are
generated by using lectins such as phytohaemagglutin (PHA) or
concanavalin A (ConA) at 1-5 .mu.g/ml concentrations to serve as a
positive control. Specific antigen consists of either known peptide
epitopes, purified protein, or inactivated virus. Antigen
concentrations range from 1-10 .mu.M for peptides and 1-10 .mu.g/ml
for protein. Lectin-induced proliferation peaks at 3-5 days of cell
culture incubation while antigen-specific responses peak at 5-7
days. Specific proliferation occurs when radiation counts are
obtained which are at least three-fold over the media background
and is often given as a ratio to background, or Stimulation Index
(SI). HIV gp160 is known to contain several peptides known to cause
T cell proliferation of gp160/gp120 immunized or HIV-infected
individuals. The most commonly used of these are: T1
(LysGlnIleIleAsnMetTrpGlnGluValGlyLysAlaMetTyrAla [SEQ. ID: 40]);
T2 (HisGluAspIleIleSerLeuTrpAspGlnSerLeuLys [SEQ. ID: 41]; and, TH4
(AspArgValIleGluValValGlnGlyAlaTyrArgAla IleArg [SEQ. ID: 42]).
These peptides have been demonstrated to stimulate proliferation of
PBMC from antigen-sensitized mice, nonhuman primates, and
humans.
EXAMPLE 18
[0281] Vector V1R Preparation:
[0282] In an effort to continue to optimize our basic vaccination
vector, we prepared a derivative of V1Jns which was designated as
V1R. The purpose for this vector construction was to obtain a
minimum-sized vaccine vector, i.e., without unnecessary DNA
sequences, which still retained the overall optimized heterologous
gene expression characteristics and high plasmid yields that V1J
and V1Jns afford. We determined from the literature as well as by
experiment that (1) regions within the pUC backbone comprising the
E. coli origin of replication could be removed without affecting
plasmid yield from bacteria; (2) the 3'-region of the kan.sup.r
gene following the kanamycin open reading frame could be removed if
a bacterial terminator was inserted in its stead; and, (3)
.about.300 bp from the 3'-half of the BGH terminator could be
removed without affecting its regulatory function (following the
original KpnI restriction enzyme site within the BGH element).
[0283] V1R was constructed by using PCR to synthesize three
segments of DNA from V1Jns representing the CMVintA promoter/BGH
terminator, origin of replication, and kanamycin resistance
elements, respectively. Restriction enzymes unique for each segment
were added to each segment end using the PCR oligomers: SspI and
XhoI for CMVintA/BGH; EcoRV and BamHI for the kan.sup.r gene; and,
BclI and SalI for the ori.sup.r. These enzyme sites were chosen
because they allow directional ligation of each of the PCR-derived
DNA segments with subsequent loss of each site:
[0284] EcoRV and SspI leave blunt-ended DNAs which are compatible
for ligation while BamHI and BclI leave complementary overhangs as
do SalI and XhoI. After obtaining these segments by PCR each
segment was digested with the appropriate restriction enzymes
indicated above and then ligated together in a single reaction
mixture containing all three DNA segments. The 5'-end of the ori r
was designed to include the T2 rho independent terminator sequence
that is normally found in this region so that it could provide
termination information for the kanamycin resistance gene. The
ligated product was confirmed by restriction enzyme digestion
(>8 enzymes) as well as by DNA sequencing of the ligation
junctions. DNA plasmid yields and heterologous expression using
viral genes within V1R appear similar to V1Jns. The net reduction
in vector size achieved was 1346 bp (V1Jns=4.86 kb; V1R=3.52 kb),
[SEQ. ID: 43 of this specification; also see FIG. 11 and SEQ ID:
100 of WO95/24485; PCT International Application No.
PCT/US95/02633].
[0285] PCR oligomer sequences used to synthesize V1R (restriction
enzyme sites are underlined and identified in brackets following
sequence):
8 (1) 5'-GGT ACA AAT ATT GG CTA TTG GCC ATT GCA TAC G-3':, [SspI],
(SEQ.ID:44) (2) 5'-CCA CAT CTC GAG GAA CCG GGT CAA TTC TTC AGC
ACC-3': [XhoI], (SEQ.ID:45) (for CMVintA/BGH segment) (3) 5'-GGT
ACA GAT ATC GGA AAG CCA CGT TGT GTC TCA AAA TC- [EcoRV],
(SEQ.ID:46) 3': (4) 5'-CCA CAT GGA TCC G TAA TGC TCT GCC AGT GTT
ACA ACC-3': [BamHI], (SEQ.ID:47) (for kanamycin resistance gene
segment) (5) 5'-GGT ACA TGA TCA CGT AGA AAA GAT CAA AGG ATC TTC
TTG- [BclI], (SEQ.ID:48) 3':, (6) 5'-CCA CAT GTC GAC CC GTA AAA AGG
CCG CGT TGC TGG-3': [SalI], (SEQ.ID:49) (for E. coli origin of
replication)
[0286] Ligation junctions were sequenced for V1R using the
following
9 5'-GAG CCA ATA TAA ATG TAC-3': [CMVintA/kan.sup.rjunction]
(SEQ.ID:50) 5'-CAA TAG CAG GCA TGC-3': [BGH/ori junction]
(SEQ.ID:51) 5'-G CAA GCA GCA GAT TAC-3': [ori/kan.sup.r junction]
(SEQ.ID:52)
EXAMPLE 19
[0287] Heterologous Expression of HIV Late Gene Products
[0288] HIV structural genes such as env and gag require expression
of the HIV regulatory gene, rev, in order to efficiently produce
full-length proteins. We have found that rev-dependent expression
of gag yielded low levels of protein and that rev itself may be
toxic to cells. Although we achieved relatively high levels of
rev-dependent expression of gp160 in vitro this vaccine elicited
low levels of antibodies to gp160 following in vivo immunization
with rev/gp160 DNA. This may result from known cytotoxic effects of
rev as well as increased difficulty in obtaining rev function in
myotubules containing hundreds of nuclei (rev protein needs to be
in the same nucleus as a rev-dependent transcript in order for gag
or env protein expression to occur). However, it has been possible
to obtain rev-independent expression using selected modifications
of the env gene.
[0289] 1. rev-Independent Expression of env:
[0290] In general, our vaccines have utilized primarily HIV (IIIB)
env and gag genes for optimization of expression within our
generalized vaccination vector, V1Jns, which is comprised of a CMV
immediate-early (IE) promoter, a BGH-derived polyadenylation and
transcriptional termination sequence, and a pUC backbone. Varying
efficiencies, depending upon how large a gene segment is used
(e.g., gp120 vs. gp160), of rev-independent expression may be
achieved for env by replacing its native secretory leader peptide
with that from the tissue-specific plasminogen activator (tPA) gene
and expressing the resulting chimeric gene behind the CMVIE
promoter with the CMV intron A. tPA-gp120 is an example of a
secreted gp120 vector constructed in this fashion which functions
well enough to elicit anti-gp120 immune responses in vaccinated
mice and monkeys.
[0291] Because of reports that membrane-anchored proteins may
induce much more substantial (and perhaps more specific for HIV
neutralization) antibody responses compared to secreted proteins as
well as to gain additional epitopes, we prepared V1Jns-tPA-gp160
and V1Jns-rev/gp160. The tPA-gp160 vector produced detectable
quantities of gp160 and gp120, without the addition of rev, as
shown by immunoblot analysis of transfected cells, although levels
of expression were much lower than that obtained for rev/gp160, a
rev-dependent gp160-expressing plasmid. This is probably because
inhibitory regions, which confer rev dependence upon the gp160
transcript, occur at multiple sites within gp160 including at the
COOH-terminus of gp41. A vector was prepared for a COOH-terminally
truncated form of tPA-gp160 (tPA-gp143) which was designed to
increase the overall expression levels of env by elimination of
these inhibitory sequences. The gp143 vector also eliminates
intracellular gp41 regions containing peptide motifs (such as
Leu-Leu) known to cause diversion of membrane proteins to the
lysosomes rather than the cell surface. Thus, gp143 may be expected
to have increased levels of expression of the env protein (by
decreasing rev-dependence) and greater efficiency of transport of
protein to the cell surface compared to full-length gp160 where
these proteins may be better able to elicit anti-gp160 antibodies
following DNA vaccination. tPA-gp143 was further modified by
extensive silent mutagenesis of the rev response element (RRE)
sequence (350 bp) to eliminate additional inhibitory sequences for
expression. This construct, gp143/mutRRE, was prepared in two
forms: either eliminating (form A) or retaining (form B)
proteolytic cleavage sites for gp120/41. Both forms were prepared
because of literature reports that vaccination of mice using
uncleavable gp160 expressed in vaccinia elicited much higher levels
of antibodies to gp160 than did cleavable forms.
[0292] A quantitative ELISA for gp160/gp120 expression in cell
transfectants was developed to determine the relative expression
capabilities for these vectors. In vitro transfection of 293 cells
followed by quantification of cell-associated vs. secreted/released
gp120 yielded the following results: (1) tPA-gp160 expressed
5-10.times. less gp120 than rev/gp160 with similar proportions
retained intracellularly vs. released from the cell surface; (2)
tPA-gp143 gave 3-6.times. greater secretion of gp120 than rev/gp160
with only low levels of cell-associated gp143, confirming that the
cytoplasmic tail of gp160 causes intracellular retention of gp160
which can be overcome by partial deletion of this sequence; and,
(3) tPA-gp143/mutRRE A and B gave .about.10.times. greater
expression levels of protein than did parental tPA-gp143 while
elimination of proteolytic processing was confirmed for form A.
[0293] Thus, our strategy to increase rev-independent expression
has yielded stepwise increases in overall expression levels as well
as redirecting membrane-anchored gp.sup.143 to the cell surface
away from lysosomes. It is important to note that this is a generic
construct into which it should be possible to insert gp120
sequences derived from various primary viral isolates within a
vector cassette containing these modifications which reside either
at the NH.sub.2-terminus (tPA leader) or COOH-terminus (gp41),
where few antigenic differences exist between different viral
strains.
[0294] FIGS. 2-7 present data supporting the use of various
constructs, including but not limited to a gp143-based construct,
and preferably a tPA-gp143 based construct, as a DNA vaccine
against HIV infection. FIG. 2 shows that tPA-143 (opt41) elicits an
anti-gp120 antibody response in the in the range of GMT=10.sup.3.
FIG. 3 measures and compares anti-gp120 antibody titers for several
DNA vaccines, including gp143-based constructs. FIG. 4 shows the
relative expression of tPA-gp143 and tPA-143/mutRRE in comparison
to the tPA-gp160 construct. FIG. 5 measures generation of
anti-gp120 antibodies for both the optA and optB forms of tPA-gp143
constructs. FIG. 6 shows the ability of several DNA vaccines,
including tPA-gp143-optA and tPA-gp143-optB, to promote generation
of neutralizing antibodies against HIV strains subsequent to murine
DNA vaccination. FIG. 7 also shows HIV neutralization data for
various DNA vaccine constructions, including tPA-gp143-optA,
tPA-gp143-optB, tPA-gp143-optA-glyB and tPA-gp143-optB-glyB.
[0295] 2. Expression of gp120 Derived From a Clinical Isolate:
[0296] To apply these expression strategies to viruses that are
relevant for vaccine purposes and confirm the generality of our
approaches, we also prepared a tPA-gp120 vector derived from a
primary HIV isolate (containing the North American concensus V3
peptide loop; macrophage-tropic and nonsyncytia-inducing
phenotypes). This vector gave high expression/secretion of gp120
with transfected 293 cells and elicited anti-gp120 antibodies in
mice thus demonstrating that it was cloned in a functional form.
Primary isolate gp160 genes will also be used for expression in the
same way as for gp160 derived from laboratory strains.
[0297] 3. Immune Responses to HIV-1 env Polynucleotide Vaccines
[0298] Effect of vaccination route on immune responses in mice:
While efforts to improve expression of gp160 are ongoing, we have
utilized the tPA-gp120 DNA construct to assess immune responses and
ways to augment them. Intramuscular (i.m.) and intradermal (i.d.)
vaccination routes were compared for this vector at 100, 10, and 1
.mu.g doses in mice. Vaccination by either route elicited antibody
responses (GMTs=10.sup.3-10.sup.4) in all recipients following 2-3
vaccinations at all three dosage levels. Each route elicited
similar anti-gp120 antibody titers with clear dose-dependent
responses. However, we observed greater variability of responses
for i.d. vaccination, particularly at the lower doses following the
initial inoculation. Moreover, helper T-cell responses, as
determined by antigen-specific in vitro proliferation and cytokine
secretion, were higher following i.m. vaccination than i.d. We
concluded that i.d. vaccination did not offer any advantages
compared to i.m. for this vaccine.
[0299] 4. gp120 DNA Vaccine-Mediated Helper T Cell Immunity in
Mice:
[0300] gp120 DNA vaccination produced potent helper T-cell
responses in all lymphatic compartments tested (spleen, blood,
inguinal, mesenteric, and iliac nodes) with T.sub.H1-like cytokine
secretion profiles (i.e., g-interferon and IL-2 production with
little or no IL-4). These cytokines generally promote strong
cellular immunity and have been associated with maintenance of a
disease-free state for HIV-seropositive patients. Lymph nodes have
been shown to be primary sites for HIV replication, harboring large
reservoirs of virus even when virus cannot be readily detected in
the blood. A vaccine which can elicit anti-HIV immune responses at
a variety of lymph sites, such as we have shown with our DNA
vaccine, may help prevent successful colonization of the lymphatics
following initial infection.
[0301] 5. env DNA Vaccine-Mediated Antibody Responses:
[0302] African green (AGM) and Rhesus (RHM) monkeys which received
gp120 DNA vaccines showed low levels of neutralizing antibodies
following 2-3 vaccinations, which could not be increased by
additional vaccination. These results, as well as increasing
awareness within the HIV vaccine field that oligomeric gp160 is
probably a more relevant target antigen for eliciting neutralizing
antibodies than gp120 monomers, have led us to focus upon obtaining
effective expression of gp160-based vectors (see above). Mice and
AGM were also vaccinated with the primary isolate derived tPA-gp120
vaccine. These animals exhibited anti-V3 peptide (using homologous
sequence) reciprocal endpoint antibody titers ranging 500-5000,
demonstrating that this vaccine design is functional for clinically
relevant viral isolates.
[0303] The gp160-based vaccines, rev-gp160 and tPA-gp160, failed to
consistently elicit antibody responses in mice and nonhuman
primates or yielded low antibody titers. Our initial results with
the tPA-gp143 plasmid yielded geometric mean titers
(GMT)>10.sup.3 in mice and AGM following two vaccinations. These
data indicate that we have signficantly improved the immunogenicity
of gp160-like vaccines by increasing expression levels and more
efficient intracellular trafficking of env to the cell surface.
This construct, as well as the tPA-gp143/mutRRE A and B vectors,
will continue to be characterized for antibody responses,
especially for virus neutralization.
[0304] 6. env DNA Vaccine-Mediated CTL Responses in Monkeys:
[0305] We continued to characterize CTL responses of RHM that had
been vaccinated with gp120 and gp160/IRES/rev DNA. All four monkeys
that received this vaccine showed significant MHC Class
I-restricted CTL activities (20-35% specific killing at an
effector/target=20) following two vaccinations. Following a fourth
vaccination these activities increased to 50-60% killing under
similar test conditions, indicating that additional vaccination
boosted responses significantly. The CTL activities have persisted
for at least seven months subsequent to the final vaccination at
about 50% of their peak levels indicating that long-term memory had
been established.
EXAMPLE 20
[0306] SIV/HIV (SHIV) Chimeras:
[0307] A major obstacle for testing the protective efficacy of
candidate HIV-1 vaccines has been the lack of a suitable animal
challenge model for this virus. Although the simian
immunodeficiency virus (SIV), which is closely related to HIV, is
infectious and causes AIDS in rhesus monkeys, the only animal
species which can be infected with HIV-1 viral isolates is the
chimpanzee. However, the resulting viremia from this infection is
low-level, transient, and no pathogenic effects (e.g., lymphopenia,
immunodeficiency-related opportunistic infections, etc.) develop.
Recently, hybrid viruses comprised of SIV and HIV genomes have been
developed which are also infectious to rhesus monkeys and which can
cause infection-related AIDS. An example of this type of virus is
SHIV-4 (IIIB) (Li et al., J. of Acquired Immune Deficiency
Syndrome, Vol. 5, 639-646 (1992)). This virus contains the SIV
(MAC239) genome except for the regulatory genes, tat and rev, and
the structural gene, env. Because the principle component of
candidate HIV vaccines is based upon env this virus allows testing
vaccines developed for human clinical purposes for protective
efficacy against infection in an animal model.
EXAMPLE 21
[0308] Plasmid DNA and Recombinant Protein Combination
Vaccines:
[0309] Vaccines having both a plasmid DNA HIV env component and a
recombinant HIV env protein component were tested for their
abilities to induce antibody responses in rhesus monkeys. FIG. 9
and FIG. 10 show the resulting anti-gp120 ELISA antibody and SHIV-4
(IIIB) virus neutralizing antibody titers, respectively, following
vaccination of rhesus with HIV env gene-containing DNA vaccines and
recombinant protein (formulated in an appropriate adjuvant). These
monkeys developed high titers of env-specific antibodies and
neutralizing antibodies. Control monkeys, vaccinated with "blank"
DNA that did not contain a gene and ovalbumin did not develop any
detectable env-specific responses while monkeys vaccinated only
with the protein component of this vaccine showed low levels of
antigen-specific antibodies detected by ELISA and no neutralizing
antibodies. When these monkeys were challenged with SHIV-4 (IIIB)
virus all control and protein only monkeys became infected while
those receiving both env DNA and protein did not develop a
detectable SHIV viremia. These monkeys are currently being tested
periodically for possible delayed onset of infection.
* * * * *