U.S. patent application number 10/379996 was filed with the patent office on 2003-12-11 for product.
Invention is credited to Brekke, Ole Henrik, Kausmally, Louise, Stacy, John.
Application Number | 20030228626 10/379996 |
Document ID | / |
Family ID | 29713384 |
Filed Date | 2003-12-11 |
United States Patent
Application |
20030228626 |
Kind Code |
A1 |
Brekke, Ole Henrik ; et
al. |
December 11, 2003 |
Product
Abstract
The present invention relates to an antibody expression library
derived from a patient which has been immunochallenged with one or
more foreign antigens associated with a particular disease or
foreign agent, wherein said patients have been immunochallenged
with the foreign antigens at a time point such that they still
contain a repertoire of antibody producing cells which are enriched
with cells producing antibodies directed to said foreign antigens
associated with said disease or foreign agent, or at a time point
such that they are still in an active phase of immune response to
said foreign antigens associated with said disease or foreign
agent. Methods of producing such expression libraries are also
disclosed.
Inventors: |
Brekke, Ole Henrik; (Oslo,
NO) ; Stacy, John; (Oslo, NO) ; Kausmally,
Louise; (Oslo, NO) |
Correspondence
Address: |
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
1425 K STREET, N.W.
SUITE 800
WASHINGTON
DC
20005
US
|
Family ID: |
29713384 |
Appl. No.: |
10/379996 |
Filed: |
March 6, 2003 |
Current U.S.
Class: |
435/7.1 ;
435/320.1; 435/339; 435/340; 435/6.1; 435/69.1; 506/9; 530/388.3;
530/388.4; 536/23.53 |
Current CPC
Class: |
G01N 33/6854 20130101;
C12Q 1/6809 20130101; C07K 16/1217 20130101; C07K 16/088 20130101;
C07K 2317/622 20130101; C07K 16/00 20130101 |
Class at
Publication: |
435/7.1 ;
530/388.3; 530/388.4; 435/69.1; 435/320.1; 435/6; 435/339; 435/340;
536/23.53 |
International
Class: |
C12Q 001/68; G01N
033/53; C07H 021/04; C12P 021/02; C12N 005/06; C07K 016/08; C07K
016/12 |
Foreign Application Data
Date |
Code |
Application Number |
May 14, 2002 |
GB |
0211015.3 |
Nov 29, 2002 |
GB |
0227977.6 |
Claims
1. An antibody expression library derived from a patient which has
been immunochallenged with one or more foreign antigens associated
with a particular disease or foreign agent.
2. The antibody expression library of claim 1 wherein said patients
have been immunochallenged with said foreign antigens at a time
point such that they still contain a repertoire of antibody
producing cells which are enriched with cells producing antibodies
directed to said foreign antigens associated with said disease or
foreign agent, or at a time point such that they are still in an
active phase of immune response to said foreign antigens associated
with said disease or foreign agent.
3. The antibody expression library of claim 1 wherein said
libraries are derived from material from a patient obtained up to
40 days after a first or subsequent exposure to said foreign
antigens or the outbreak of disease.
4. The antibody expression library of claim 3 wherein said
libraries are derived from material from a patient obtained up to
30 days, 20 days, 15 days, 10 days or 7 days after a first or
subsequent exposure to said foreign antigens or the outbreak of
disease.
5. The antibody expression library of claim 4 wherein said
libraries are derived from material from a patient obtained 4 to 10
days or 6 to 7 days after a first or subsequent exposure to said
foreign antigens or the outbreak of disease.
6. The antibody expression library of claim 1 wherein said
libraries are derived from material from a patient obtained 1 to 10
days before the patient shows the highest serum levels of
antibodies directed to said foreign antigens associated with said
disease or foreign agent.
7. The antibody expression library of claim 6 wherein said
libraries are derived from material from a patient obtained 6 to 7
days before the patient shows the highest serum levels of
antibodies directed to said foreign antigens associated with said
disease or foreign agent.
8. The antibody expression library of claim 1 wherein said
immunochallenge involves a first exposure of the patient to said
foreign antigens.
9. The antibody expression library of claim 1 wherein said
immunochallenge involves a second or subsequent exposure of the
patient to said foreign antigens.
10. The antibody expression library of claim 1 wherein said
immunochallenge involves the administration of a vaccine.
11. The antibody expression library of claim 1 wherein said
immunochallenge involves exposure of said patient to an infectious
agent.
12. The antibody expression library of claim 11 wherein said
infectious agent is Varicella Zoster Virus (VZV), HIV, CMV,
Hepatitis, Herpes, Meningococcus or group A Streptococcus.
13. The antibody expression library of claim 12 wherein said
immunochallenge is stimulated by meningococcus B Outer membrane
vesicles (OMV) or VZV infection.
14. The antibody expression library of claim 13 wherein said
immunochallenge by meningococcus B OMV is stimulated by the
administration of a vaccine.
15. The antibody expression library of claim 1 wherein said
immunochallenge is a cancer, autoimmune disease or an allergic
disease.
16. The antibody expression library of claim 1 wherein said library
is derived from antibody producing cells obtained from a tissue
source or other cellular source which is effected by said disease
or foreign agent.
17. A method for producing an in vitro antibody expression library
from a patient which has been immunochallenged with one or more
foreign antigens associated with a particular disease or foreign
agent, said method comprising the steps of: a) isolating one or
more populations of antibody producing cells from said patient, or
otherwise obtaining said populations of antibody producing cells,
and b) cloning nucleic acid fragments comprising sequences encoding
antibody variable domains, or fragments thereof, from said antibody
producing cells into an appropriate expression vector to form a
library of said expression vectors capable of expressing a library
of antibody molecules.
18. The method of claim 17, further comprising the steps of: c)
expressing the library of expression vectors in an appropriate
expression system and optionally d) screening the expressed library
for antibodies with desired properties.
19. The method of claim 18 wherein said library is screened against
more than one target antigen.
20. The method of claim 19 wherein said target antigens are
related.
21. The method of claim 20 wherein cross-reactive antibodies are
identified.
22. The method of claim 17 wherein said patients are as defined in
claim 2, claim 3 or claim 6.
23. The method of claim 17, wherein step a) of the method is
followed by one or more steps wherein the isolated or obtained
population of antibody producing cells is enriched for antibody
producing cells which produce the desired antibody molecules.
24. Antibody expression libraries obtainable by the method of claim
17.
25. Libraries of cloned nucleic acid fragments comprising the
variable heavy chain regions, or fragments thereof, and/or variable
light chain regions, or fragments thereof, of antibody genes
derived from the antibody producing cells of immunochallenged
patients as defined in claim 1.
26. The library of claim 25 wherein said cloned fragments further
comprise part of the constant regions of heavy and/or light
antibody chains.
27. A method of identifying and/or isolating from an antibody
expression library as defined in claim 1 or claim 17 one or more
antibody molecules which is a specific binding partner for a target
antigen, said method comprising the steps of a) screening an
expression library as defined in claim 1 or claim 17 for antibody
molecules which bind to a particular target antigen and b)
identifying and/or isolating the relevant library member.
28. A method of manufacturing a specific antibody molecule
comprising the steps of identifying a specific antibody molecule
which is a binding partner for a target antigen according to the
method of claim 27, manufacturing said identified antibody
molecule, or a component, fragment, variant, or derivative thereof,
and optionally formulating said manufactured antibody molecule with
at least one pharmaceutically acceptable carrier or excipient.
29. An antibody molecule identified, manufactured or formulated in
accordance with the method of claim 27 or claim 28.
30. A method of treatment of a patient comprising the
administration of an appropriate dose of an antibody molecule as
defined in claim 29.
31. A method of diagnosis or imaging of a patient comprising the
administration of an appropriate dose of an antibody molecule as
defined in claim 29 to the patient and detecting the presence,
location, and/or amount of the antibody molecule in the
patient.
32. Use of the expression library of claim 1 for differential
screening with different target antigens to identify cross-reactive
antibodies.
33. Use of the expression library of claim 1 in the development of
vaccines or to identify the immunogens of a vaccine which stimulate
the most effective and protective antibodies.
34. Use of the expression library of claim 1 to isolate, detect,
identify, select or manufacture one or more antibody molecules
which bind specifically to one or more target antigens.
35. A method to develop and/or produce a recombinant vaccine
comprising the steps of: a) screening an antibody expression
library of claim 1 derived from a vaccinee, against one or more
vaccines; b) identifying the immunogen(s) of the vaccine to which
the antibodies recognising the vaccine become bound; c) deducing
the nucleic acid sequence encoding one or more of the identified
immunogens; d) optionally isolating the native gene(s) encoding the
immunogen(s); e) using said nucleic acid sequence or native gene to
produce a recombinant vaccine.
36. The method of claim 35 wherein the screening step (a) is
carried out against the vaccine used to vaccinate the patient from
which the antibody library is derived.
37. The method of claim 36 wherein the screening step (a) is also
carried out against one or more related vaccines.
38. A recombinant vaccine produced by the method of claim 35.
39. An expression vector comprising one or more dummy nucleic acid
fragments located in the parts of the vector into which the nucleic
acid inserts encoding a desired polypeptide will be cloned, wherein
said dummy fragments are positioned such that they are not in
reading frame with the other parts of the expression vector and
wherein said expression vectors, when expressed, do not give rise
to detectable polypeptide products.
40. The use of an expression vector of claim 39 in the production
of an expression library.
41. The use of claim 40 wherein the expression library is an
antibody expression library.
42. The use of claim 41 wherein the antibody expression library is
as defined in claim 1.
Description
[0001] This invention relates to antibody expression libraries
derived from immunochallenged patients and methods of preparing
such libraries. The invention further relates to the use of these
expression libraries to screen and isolate high affinity and highly
diverse recombinant human antibodies exhibiting desired properties
and which may be suitable for use as therapeutic antibodies or for
in vivo diagnosis. Novel expression vectors for use in the
production of expression libraries are also described.
[0002] Molecular libraries are important tools in many areas of
molecular and cellular biology and in the identification and
development of new drugs and therapeutic and diagnostic agents.
Such libraries generally contain genetic material, for example
fragments of genes or nucleic acid sequences which may in turn be
associated with a suitable vehicle which allows the fragments to be
amplified and manipulated, e.g. a plasmid. Such libraries may be
screened at the nucleic acid level, i.e. by screening for the
desired sequence or sequences using a nucleotide probe.
Alternatively such libraries can be designed so that the
polypeptides encoded by the nucleic acid fragments or genes are
expressed and screening can be carried out using an appropriate
"target" molecule to which it is desired that the selected
polypeptide should bind. The latter type of libraries where the
encoded peptides are capable of being expressed are known as
"expression libraries".
[0003] In the development of therapeutic antibodies (and to a large
extent diagnostic antibodies) several success criteria must be met.
The antibodies must show high specificity, the antibodies should
have high affinity for the relevant target molecule and the
antibodies should express well in different expression systems.
Another important aspect is that one should be able to isolate a
pool of antibodies showing specificity against different epitopes
on the same antigen, i.e the repertoire of isolated human
antibodies should be as broad as possible so as to be able to
identify antibodies against the most effective, neutralising
epitope(s).
[0004] All in vitro antibody selection systems, e.g. phage or
ribosomal display technologies, demand the selection of antibody
fragments within an unnatural context. Either the antibody
fragments are fused to a phage protein (in phage display) or as a
fusion to ribosomes (in ribosomal display). In addition, these
selection systems demand several rounds of selection to reduce the
number of antibody candidates to be screened. This may drive the
selection pressure towards only a few antibody candidates that
behave well in their unnatural context and which are reactive
against one or only a few epitopes.
[0005] Although improved in vitro selection methods have been
developed which increase the throughput in such selection assays,
thereby decreasing the number of rounds of selection required, the
inherent problems associated with the selection of antibody
fragments in an unnatural context and the biased repertoire
associated with this selection remain.
[0006] There is therefore a need for alternative improved in vitro
selection systems wherein the number of rounds of selection can be
reduced or even eliminated, wherein the antibodies can be selected
in a more natural context and wherein the repertoire from which the
antibodies are selected is as broad or diverse as possible so as to
identify antibodies reactive against the most effective
epitopes.
[0007] Surprisingly, it has now been found that these needs can be
met by deriving and screening in vitro antibody expression
libraries from post-disease or immunochallenged patients. These
expression libraries contain high affinity and highly diverse human
antibodies which can be directly generated and screened as
expression libraries and do not need to be subjected to many rounds
of selection in an unnatural context. Advantageously, libraries can
be generated and be ready for screening very quickly, e.g. in up to
4 weeks. In addition, a throughput of 10000 to 40000 screened
clones a month is feasible from such patient libraries.
[0008] The present invention is based on the idea that individuals
that have been exposed to a particular disease or foreign antigen
or agent and especially an infectious disease, hold the genetic
information for the expression of extremely good antibodies against
the particular disease antigen(s) or foreign antigen(s) in
question. Advantageously it has been found that populations of
antibody producing cells from such patients are enriched for cells
which make antibodies directed to the disease antigen or foreign
antigen in question. Such antibodies are highly diverse in their
nature and reactive to a large number of epitopes displayed on the
particular foreign antigen(s) associated with the disease or
foreign agent.
[0009] In contrast to expression libraries generated from a healthy
naive donor which has not been exposed to a particular disease or
foreign agent or antigen, or even from a healthy donor which has
been exposed to a particular disease or foreign agent or antigen in
the past but recovered from that disease, foreign agent or antigen
some time ago, e.g. at least a few months ago, e.g. at least two or
three months ago, or more than a year ago, expression libraries
generated from the antibody producing cells from patients which
have more recently been or are being immunochallenged with a
particular disease or foreign antigen or foreign agent, have a
repertoire of antibodies which is smaller in terms of the number of
antigens recognised but which is enriched and more diverse for the
antibodies of interest. The repertoires of antibodies generated
from healthy naive donors which have not been exposed to a
particular disease, foreign agent or antigen, or from healthy
donors which had recovered from a particular disease, foreign agent
or antigen some time ago, e.g. in the time frames discussed above,
would be so large that it would not be possible to directly screen
such repertoires as an expression library.
[0010] Disadvantageously, such repertoires would therefore have to
undergo some form of selection before screening. Thus, it can be
seen that the selection of an appropriate population of antibody
producing cells from appropriate patients which have come into
contact with particular foreign antigens, agents or diseases in
accordance with the present invention gives rise to significant
advantages in terms of the repertoire of antibodies contained in
the expression libraries and the fact that direct screening without
prior selection steps can be carried out.
[0011] Thus, the repertoire of antibodies contained in an
expression library generated in accordance with the present
invention from patients which have been exposed to a particular
disease, foreign antigen or foreign agent, will be different from
the repertoire produced in expression libraries derived from a
naive donor or from healthy donors which had recovered from a
particular disease, foreign agent or antigen some time ago, e.g. in
the time frames discussed above.
[0012] Moreover, the antibody producing cells from such non-naive
patients or non-healthy patients selected in accordance with the
present invention, will generally produce the high affinity
antibodies (e.g. IgG antibodies) associated with an immune response
as opposed to the lower affinity antibodies (IgM antibodies) which
are associated with non-stimulated antibody producing cells, or the
primary immune response. Thus, the antibodies identified and
isolated from these non-naive or non-healthy donor expression
libraries in accordance with the present invention by screening are
generally of high affinity and more appropriate for use as
therapeutic antibodies or antibodies for in vivo diagnosis.
[0013] Thus, the present invention provides an antibody expression
library derived or obtainable from a patient which has been
immunochallenged with one or more foreign antigens associated with
a particular disease or foreign agent.
[0014] The term "high affinity" as used herein in connection with
antibodies, generally refers to antibodies or antibody fragments
with affinities for antigen in the range of 10.sup.-8M to
10.sup.-10M or higher. "patient" as used herein, for example a
"non-naive patient" or a "non-healthy patient", refers to an
individual which is undergoing some kind of immunochallenge with
one or more foreign antigens associated with a particular disease
or foreign agent. Such patients are for example in an active phase
of an immune response or for example contain a repertoire of
antibody producing cells which are enriched with cells producing
antibodies directed to the foreign antigen or antigens associated
with the particular disease or foreign agent in question. Such
patients will generally show the symptoms of such an
immunochallenge, e.g. show the symptoms of disease or will have
been deliberately immunochallenged, e.g. in the case of
administration of a vaccine. Thus, naive donors, i.e. donors which
have not been exposed to the foreign antigen in question or healthy
donors which have been exposed to a particular disease or foreign
agent or antigen in the past but recovered from that disease,
foreign agent or antigen some time ago, e.g. at least a few months
ago, e.g. at least two or three months ago, or more than a year
ago, are excluded, as they will not be undergoing such an
immunochallenge. Thus, the patients from which the expression
libraries of the present invention are derived have been exposed to
or immunochallenged with the foreign antigen or agent relatively
recently, e.g. not more than two months ago.
[0015] "immunochallenged" as used herein in connection with
patients refers to patients which have been exposed in some way to
one or more foreign antigens which are associated with a particular
disease or foreign agent. The exposure to foreign antigen can occur
in any appropriate way and includes exposure to foreign antigens
associated with a particular disease or foreign agent by way of the
patient contracting the disease, by for example the patient being
infected with particular disease associated bacteria, virus, fungi,
etc., or by the patient in some other way coming into contact with
a foreign agent, e.g. by the patient coming into contact with an
allergen. This exposure also includes deliberate exposure of a
patient to one or more particular foreign antigens associated with
a particular disease or foreign agent, e.g. by vaccination
protocols.
[0016] The exposure may be a first exposure to the foreign
antigen(s) in question or may be a second or subsequent exposure to
the antigen(s), e.g. may be a re-infection with a particular
disease or infectious agent, may be a re-exposure to a particular
foreign agent, e.g. an allergen, or may be a second or further
"booster" exposure to a particular vaccine. The exposure may also
be a first and continued exposure to a foreign antigen e.g. in the
case of exposure to an autoimmune disease.
[0017] In preferred embodiments of the invention, the
immunochallenge will be a second or subsequent exposure to
particular foreign antigen(s).
[0018] Patients which have recovered from an exposure to a
particular foreign antigen (e.g. have recovered from a particular
disease or infectious agent or have dealt with or eliminated a
foreign agent such as an allergen) and have been
re-exposed/re-immunochallenged with the foreign antigen in question
are particularly preferred as sources for the expression libraries
of the invention, as their repertoire of antibody producing cells
will include cells which produce antibodies which are effective in
combatting the foreign antigen/disease/agent in question, i.e.
their repertoire of antibodies will contain particularly
efficacious antibodies. The antibodies which have combatted the
disease or foreign agent should be the best candidates for
neutralisation of the foreign antigen(s) in question. Such
antibodies should show at least the correct specificity and
probably also a broad range of binding properties to a given
antigen, e.g. have the ability to bind different epitopes.
[0019] The main requirement for the patients from which the
antibody expression libraries of the present invention are derived
is that they have been immunochallenged/exposed to the disease,
foreign agent or foreign antigen(s) at a time point such that they
still contain a repertoire of antibody producing cells which are
enriched with cells producing antibodies directed to the foreign
antigen or antigens associated with the particular disease or
foreign agent in question.
[0020] Appropriate time points may vary depending on the type of
immunochallenge in question. For example, in the case of an
immunochallenge by a foreign antigen which is eventually
significantly reduced or eliminated from a patient by the immune
system, e.g. the type of immunochallenge presented by most
diseases, infectious agents or foreign agents such as allergens,
such patients will have been immunochallenged/exposed at a time
point sufficiently recently such that they still contain a
repertoire of antibody producing cells which are enriched with
cells producing antibodies directed to the foreign antigen or
antigens associated with the particular infectious or foreign agent
in question. In the case of an immunochallenge by a foreign antigen
which is not significantly reduced or eliminated from a patient,
e.g. by a "self" antigen associated with an autoimmune disease, the
expression libraries can be derived from patients at any time point
such that they still contain a repertoire of antibody producing
cells which are enriched with cells producing antibodies directed
to the foreign antigen or antigens (or "self" antigens if
applicable) associated with the particular disease or foreign agent
in question. In the latter case it can be seen that the time window
in which the antibody producing cells can be isolated in order to
derive the expression libraries of the invention is increased.
[0021] "enriched" as used herein in connection with populations or
repertoires of antibody producing cells in a patient refers to a
population of antibody producing cells which contains a
significantly increased number of antibody producing cells which
produce antibodies specifically reactive with the foreign
antigen(s) in question compared to the number of antibody producing
cells producing antibodies specifically reactive with the foreign
antigen(s) in question in a population of antibody producing cells
obtained from a naive donor which has not been exposed to the
foreign antigen(s) in question, or a healthy donor which has been
exposed to a particular disease or foreign agent or antigen in the
past but recovered from that disease, foreign agent or antigen some
time ago, e.g. at least a few months ago, e.g. at least two or
three months ago, or more than a year ago. A preferred comparison
will be with a naive donor. Such enriched populations may for
example contain at least 0.1 specific B cells (antibody producing
cells) per thousand non-specific B cells (antibody producing
cells).
[0022] Methods of determining the statistical significance of
differences in parameters such as the number of antibody producing
cells between two or more samples are well known and documented in
the art and any such method can be used. Generally, whichever test
is chosen to determine significance levels, a probability value of
<0.05 is desired in order for the difference to be regarded as
significant.
[0023] Such an enrichment of antibody producing cells will occur as
part of the natural immune response to foreign antigen, as antibody
producing cells (B cells/B lymphocytes) which are capable of making
antibodies directed to the foreign antigen in question will be
stimulated to proliferate and will therefore increase in number.
Such an enrichment will occur over time and reach a maximum.
However, generally the enrichment will naturally tail off once the
amount of antigen in question is reduced or eliminated as there
will be no further antigen induced stimulation of B cell
proliferation and the existing B cells will be removed by naturally
occurring biological mechanisms, e.g. by cell death. The enrichment
will however sometimes be maintained, for example in cases where
the foreign antigen is not significantly eliminated, e.g. in
immunochallenges with autoimmune diseases. In such cases, the time
window in which the antibody producing cells can be isolated in
order to derive the expression libraries of the invention is
increased.
[0024] Put another way, the patients from which the antibody
expression libraries of the present invention are derived have been
immunochallenged/exposed to the disease, foreign agent or foreign
antigen(s) at a time point such that they are still in an active
phase of immune response to the foreign antigen, etc., in question.
Patients in an active phase of immune response can readily be
identified by a person skilled in the art. For example, such
patients will be actively producing specific antibodies in response
to foreign antigen. Thus, for example the presence of a high serum
titre of specific antibodies to the foreign antigen in question is
indicative of such appropriate patients. Preferably this high serum
titre of specific antibodies will be combined with a relatively low
serum titre of non-specific antibodies, thereby evidencing the
enrichment of the antibody producing cells. Again the serum titres
of candidate patients can be compared to the serum titres of naive
donors or healthy donors as described above in order to assess
whether or not the serum titre of antibodies to a particular
foreign antigen is significantly higher in the candidate
patients.
[0025] Thus, there is a finite time window after exposure to
antigen in which the B cells from the patient which are used to
provide the genetic material for the antibody expression libraries
of the invention need to be isolated in order to obtain the
benefits of the enriched B-cell population.
[0026] The length of time after exposure to antigen to meet this
requirement may vary from patient to patient, may depend on the
disease, foreign agent or foreign antigen in question (e.g. whether
or not the disease, etc., is an infectious disease or is otherwise
associated with a foreign antigen which is eventually significantly
reduced or eliminated by the patient, or is associated with a
foreign antigen which is not significantly eliminated, e.g. an
autoimmune disease, as discussed above), the source of the B cells
in the patient (e.g. circulating B cells as opposed to e.g. B cells
in the lymphoid tissues) and also on whether or not a primary,
secondary or further response to the foreign antigen is being
mounted. However, the suitability of a patient can readily be
determined if desired, by taking a sample of antibody producing
cells (B-cells) from the patient, e.g. by taking a blood sample,
and carrying out a standard in vitro assay (e.g. an ELISA assay or
ELISPOT assay., Czerkinsky et al., 1983, J. Immunol. Methods, vol
65:109-121) using the relevant foreign antigen as a target antigen
and measuring the degree of immunoreaction. Preferably the degree
of immunoreaction with a control antigen is also assessed in order
to provide an indication of the level of enrichment of the sample
for the desired antibodies. A low or relatively low degree of
immunoreaction with a control antigen is evidence that the
expression libraries derived from these patients will contain fewer
irrelevant antibodies, i.e. will be enriched and diverse for
antibodies against the antigen in question.
[0027] This immunoreaction measurement can be done one or more
times to monitor the progress and degree of a patient's immune
response to an antigen and assess (by for example an appropriate
comparison with a naive donor) whether or not a suitably enriched
population of B cells is present. In this way the optimum time to
harvest antibody producing cells (which contain the genetic
material from which the expression library will be derived) from a
patient can be identified. In addition, patients which are not
appropriate or are no longer appropriate to provide material for
expression library generation can readily be identified.
[0028] A preferred assay in this regard is the ELISPOT assay
mentioned above. Such an assay is especially suitable for testing
circulating B cells and is based on the coating of a surface with
the particular foreign antigen to which it is desired to obtain
antibodies (and by which the patient is being immunochallenged) and
adding a defined number of B cells. B cells secreting antibodies
that bind to the antigen can be detected by conventional ELISA
detection. This assay only detects B cells which are secreting
specific antibodies and not B cells with specific membrane bound
antibodies, so the actual number of B cells with specific
antibodies may actually be higher than the test suggests.
[0029] Preferably however the immunochallenged patients will have
been exposed to the foreign antigen(s) relatively recently before
the isolation of the antibody producing cells from which the
expression libraries are derived, e.g. the patients will have
received a first or subsequent exposure to a particular foreign
antigen(s) or foreign agent, or the disease will have broken out up
to 40 or 30 days before isolation, more preferably up to 20 or 10
days before isolation, most preferably 4 to 10 or 15, or 6 to 7
days before isolation of the antibody producing cells. In other
words, the antibody expression libraries are preferably derived
from material from a patient obtained up to 40 days (e.g. 30 to 40
days), more preferably up to 30 days, 20 days or 15 days (e.g. 20
to 30 days or 10 to 15 or 20 days), most preferably up to 10 days
or 7 days (e.g. 4 to 10 days or 6 to 7 days), or approximately one
week after a first or subsequent exposure to a particular foreign
antigen(s) or foreign agent or the outbreak of disease.
[0030] "Outbreak of disease" as used herein generally refers to the
first visible sign or symptom of the disease in question, for
example the appearance of spots or lesions. Such signs and symptoms
will vary from disease to disease depending on the foreign antigen
in question, but will be well known and easily recognised for a
particular disease by a person skilled in the art.
[0031] Viewed alternatively, a further preferred time point at
which to isolate the antibody producing cells from an
immunochallenged patient is a short time prior to the maximum serum
levels of the specific antibodies to the foreign antigen(s) in
question being reached, e.g. a time point up to approximately one
week before, e.g. 1 to 10 days before the patient shows the highest
serum levels of antibodies (antibody producing cells) against the
particular foreign antigen(s) in question. This time point
generally occurs about one week, e.g. 4 to 10 or 15, or 6 to 7 days
after immunochallenge, e.g. approximately one week or two weeks
after a first or subsequent exposure to a particular foreign
antigen(s) or foreign agent or the outbreak of disease. Thus, a
most preferred time point at which to isolate the antibody
producing cells from an immunochallenged patient is 6 to 7 days
before the patient shows the highest serum levels of antibodies
(antibody producing cells) against the particular foreign
antigen(s) in question.
[0032] Again this time point can readily be identified/assessed for
a patient by standard assays, e.g. ELISA or ELISPOT assays as
described above. In general, samples of antibody producing cells
will be obtained from patients at regular and appropriate time
points and the appropriate sample from which the expression library
should be derived determined by way of the ELISPOT or ELISA assays
as mentioned above. As discussed in more detail below, cell samples
can readily be stored until the appropriate sample from which the
expression library should be derived is determined.
[0033] The selection of an appropriate patient as a source of
antibody producing cells from which to derive the expression
libraries of the invention may also depend on the type of
antibodies it is desired to have in the repertoire. For example, if
it is desired to generate a library comprising an enriched IgM
repertoire, then the B cells will preferably be isolated after a
first exposure of a patient to the foreign antigen, agent, disease,
etc. On the other hand, if it is desired that the repertoire
reflects an enriched pool of antibodies in the IgG format, which is
the preferred format, or another format such as IgA, IgD or IgE,
the B cells may be isolated after a first exposure to the foreign
antigen, etc., but more preferably are isolated after a second or
subsequent exposure.
[0034] In the case of IgE antibodies, it would be particularly
desirable to isolate a hypersensitive IgE repertoire from patients
which are mounting a response to a particular allergen. Antibodies
identified from such expression libraries in accordance with the
present invention could be used as anti-allergenic antibody
fragments, competing with the IgE response and thus inhibiting an
allergic reaction.
[0035] Where the exposure to foreign antigen occurs via the
contraction of a naturally occurring disease, these patients may
also be referred to herein as "post-disease" patients.
[0036] A further aspect of the invention provides a method for
producing an in vitro antibody expression library from a patient
which has been immunochallenged with one or more foreign antigens
associated with a particular disease or foreign agent, said method
comprising the steps of:
[0037] a) isolating one or more populations of antibody producing
cells from said patient, or otherwise obtaining said populations,
and
[0038] b) cloning nucleic acid fragments comprising sequences
encoding antibody variable domains, or fragments thereof, from said
antibody producing cells into an appropriate expression vector to
form a library of said expression vectors capable of expressing a
library of antibody molecules.
[0039] Appropriate immunochallenged patients from which the
antibody producing cells are isolated in step a) are as defined
above.
[0040] Once the library of expression vectors has been generated,
the encoded antibody molecules can then be expressed in an
appropriate expression system and screened using appropriate
techniques which are well known and documented in the art. Thus the
above defined method of the invention may comprise the further
steps of c) expressing the library of expression vectors in an
appropriate expression system and optionally d) screening the
expressed library for antibodies with desired properties.
[0041] Antibody expression libraries produced by the methods of the
invention and antibodies selected or identified therefrom form yet
further aspects of the invention. Thus, the present invention
further provides antibody expression libraries obtainable by the
methods of the invention and antibodies selected or identified
therefrom.
[0042] "Antibody expression library" as used herein can refer to a
collection of molecules (i.e. two or more molecules) at either the
nucleic acid or protein level. Thus, this term can refer to a
collection of expression vectors which encode a plurality of
antibody molecules (i.e. at the nucleic acid level) or can refer to
a collection of antibody molecules after they have been expressed
in an appropriate expression system (i.e. at the protein level).
Alternatively the expression vectors/expression library may be
contained in suitable host cells in which they can be expressed.
The antibody molecules which are encoded or expressed in the
expression libraries of the invention can be in any appropriate
format, e.g. may be whole antibody molecules or may be antibody
fragments, e.g. single chain antibodies (e.g. scFv antibodies), Fv
antibodies, Fab antibodies, Fab'2 fragments, diabodies, etc.
[0043] Antibody molecules identified by, derived from, selected
from or obtainable from the antibody expression libraries of the
invention form a yet further aspect of the invention. Again these
antibody molecules may be proteins or nucleic acids encoding
antibody molecules, which nucleic acids may in turn be incorporated
into an appropriate expression vector and/or be contained in a
suitable host cell.
[0044] Indeed where the term "antibody molecule" is used herein,
this should be taken to include the antibody molecule per se, but
also includes nucleic acid molecules encoding said antibody
molecules, or expression vectors containing said nucleic acid
molecules.
[0045] The patients from which the antibody expression libraries
are derived or produced may have been immunochallenged/exposed to
any disease which is associated with one or more foreign antigens.
Preferred diseases are infectious diseases caused by infectious
agents such as Varicella Zoster Virus (VZV), HIV, CMV, Hepatitis
(and in particular Hepatitis B or C), Herpes, Meningococcus (and in
particular Meningococcus A, B or C) and group A Streptococcus.
Particularly preferred diseases/immunochallenges are those caused
by Meningococcus B and especially preferably the immunochallenge is
stimulated by meningococcus B Outer membrane vesicles (OMV), e.g.
from Neisseria meningitidis, e.g. by the vaccine 44/76 developed at
the Norwegian Institute of Public Health (Fredriksen et al., 1991,
NIPH Ann., vol 14:67-80) or the vaccine NZ98/254 developed from the
New Zealand strain NZ98/254. Other particularly preferred
diseases/immunochallenges are those caused by VZV infection.
[0046] Other preferred diseases/immunochallenges are cancers (for
example pancreatic cancers, lymphomas, sarcomas or melanomas),
autoimmune diseases (for example Coeliac disease, Lupus or
Rheumatoid arthritis) or allergic diseases. Thus, it can be seen
that "foreign antigens" as used herein in accordance with the
present invention includes antigens which are normally self
antigens but which are recognised as foreign antigens by the
particular patient in question from which the antibody expression
library is derived.
[0047] The population(s) of antibody producing cells (B cells)
isolated from a patient in accordance with the present invention
can be derived from one or more appropriate sources, for example
from one or more of peripheral blood, cells from bone marrow,
spleen cells, tonsils or any other secondary lymphoid tissue,
tumour infiltrating lymphocytes, tissues or organs affected by an
autoimmune disease, or from any other tissues or fluids or other
samples known to harbour antibody producing B cells. In some cases,
the appropriate sources of B cells will depend on the disease or
immunochallenge to which antibodies are sought. For example, in a
preferred embodiment of the invention where antibodies to
particular cancers are sought, a preferred source of B cells would
be the tumour infiltrating lymphocytes which are targeting the
tumour in question. In a further preferred embodiment of the
invention where antibodies effective against particular autoimmune
diseases are sought, a preferred source of B cells would be
antibody producing cells which are associated with or which are
targeting the tissue or organ which is effected by the autoimmune
disease in question. The appropriate tissues in this regard would
be readily determined from the literature. For example, it is known
that Rheumatoid arthritis effects the joints and that Coeliac
disease effects the gut. Thus, these tissues may be preferred
sources of B cells where these autoimmune diseases were
concerned.
[0048] The derivation of B cells from a tissue source or other
cellular source which is effected by the disease in question and to
which an immune response is being directed is particularly
advantageous as the repertoire of antibodies produced by this
population should be further enriched for B cells which produce the
desired antibodies. Examples of this is deriving the B-cell
population from the tumour infiltrating lymphocytes associated with
a particular cancer or deriving the B-cell population from the
tissue or organ affected by a particular autoimmune disease as
described above.
[0049] The total B-lymphocyte pool from one or more of the selected
sources can be isolated from the patient and used to generate
antibody expression libraries in accordance with the invention. As
explained above, because of the selection criteria used for the
immunochallenged patients from which the B cells are isolated,
these B cell populations are already enriched for B cells making
antibodies to the foreign antigen or antigens in question. However,
in further preferred embodiments of the invention the lymphocyte
pool may be further enriched for the desired lymphocytes before the
expression library is made. Thus, in a yet further embodiment of
the invention, step a) of the method is followed by one or more
steps wherein the isolated or obtained population of antibody
producing cells is enriched for antibody producing cells which
produce the desired antibody molecules. Antibody expression
libraries produced or obtainable by such methods and antibodies
selected or identified therefrom form yet further aspects of the
invention.
[0050] The use of methods wherein the isolated population of
antibody producing cells is further enriched for antibody producing
cells which produce the desired antibody molecules are particularly
advantageous if it is desired to isolate antibodies from the
expression library which maintain the original variable heavy and
variable light chain pairing from the patient. This is sometimes
desirable as clearly it is likely that the very presence of a
particular original pairing of light and heavy chains in the B cell
population derived from an immunochallenged patient means that this
particular combination of heavy and light chains is likely to be
functional in recognising antigen. When antibody expression
libraries are created (as will be described in more detail below)
the heavy chain genes and light chain genes, or portions thereof,
are generally cloned separately and brought back together by
inserting them into the appropriate position in an appropriately
designed expression vector. In such systems the heavy and light
chains are thus partnered together in an essentially random manner
meaning that the original combination will be a relatively rare
occurrence. Thus, methods whereby the original pairing can be
retained are sometimes desirable. Where the isolated population of
B cells is further enriched, the enriched population will contain
only a few subsets of B cells expressing different antibodies.
These sub-populations therefore contain only a few naturally
occurring combinations of variable heavy (VH) and variable light
(VL) genes. Thus, when the light and heavy chains are cloned from
the enriched subpopulation into expression vectors in the normal
way, the probability that the VL and VH pairing will correspond to
a naturally occurring combination is significantly increased.
[0051] Any appropriate method of further enrichment may be used. A
preferred method however involves stimulating the initial isolated
population of B cells in vitro with the specific antigen or
antigens to which it is desired that the antibodies be directed.
Contacting the B cells with such antigens will activate and
stimulate the selective proliferation of the B cells in the
population which recognise the antigen, thereby further enriching
the population of B cells with B cells which recognise the antigen
and therefore contain genes encoding potential candidate antibodies
against the particular antigen. Methods of stimulation of B cells
with antigen in vitro in this way would be well known to the person
skilled in the art.
[0052] A further method of enrichment is to use a solid support,
e.g. magnetic beads, coated with specific antigen, to isolate B
cells with antigen specific membrane bound antibodies from the
initial population of B cells obtained from the patient.
[0053] Alternatively the population of B cells can be enriched by
dilution and cultivation to reduce the size of the repertoire.
Thus, in the expression libraries of the present invention one of
the ways of retaining the original combination of heavy and light
chains is by diluting the original isolated B-cell repertoire from
the patient so as to generate several small sub-populations of B
cells which contain only a few subsets of B cells expressing
different antibodies. Preferably such sub-populations contain B
cells expressing only one or two different antibody molecules.
These sub-populations (which will generally need to be expanded
after dilution in order to obtain sufficient B cells to work with
by for example inducing the cells to proliferate) therefore contain
only a few naturally occurring combinations of variable heavy (VH)
and variable light (VL) genes. Thus, when the light and heavy
chains are cloned from the diluted subpopulation into expression
vectors in the normal way, the probability that the VL and VH
pairing will correspond to a naturally occurring combination is
significantly increased.
[0054] Once the enriched B lymphocyte pool has been generated using
one or more of the above described methods or any other appropriate
method, the nucleic acids encoding variable heavy and variable
light chains, or fragments thereof, contained within the various B
lymphocytes are cloned into appropriate expression vectors by
standard techniques.
[0055] It should be noted that in the methods and expression
libraries of the invention, once appropriate patients from which a
population of antibody producing cells can be isolated has been
identified and the appropriate population of said cells have been
isolated at an appropriate time and optionally further enriched as
described above, the antibody expression libraries need not be
generated immediately, providing the genetic material contained in
the cells can be kept intact thereby enabling the library to be
made at a later date. Thus, for example the cells, a cell lysate,
or nucleic acid, e.g. RNA or DNA derived therefrom, can be stored
until a later date by appropriate methods, e.g. by freezing, and
the expression libraries generated at a later date when
desired.
[0056] Any appropriate expression system can be used to express the
antibody libraries of the invention and the expression vectors into
which the antibody variable domains are cloned are selected
accordingly. Preferred expression systems are bacterial or other
prokaryotic expression systems and most preferably E. coli
expression systems. Such bacterial expression systems are
especially preferred because these allow the members of the
antibody expression library to be expressed in a more natural
context. Other expression systems, e.g. phage display, covalent
display (WO98/37186, Fitzgerald, K., 2000, Drug Discovery Today,
vol 5:253-258) or ribosomal display systems can also be used to
express the antibody libraries (and again appropriate expression
vectors can be selected accordingly). One of the advantages with
expressing the antibody expression libraries of the present
invention in any system, is the fact that direct expression can
take place (i.e. without the many rounds of panning and selection
usually required to reduce the number of candidate antibodies) due
to the reduction in size of the total repertoire of candidate
antibodies contained in the libraries and the enrichment of the
repertoire for the antibodies of interest by the appropriate
selection of patients to be used as the source of antibody
molecules. However, as mentioned above, systems such as phage,
covalent or ribosomal display do suffer the disadvantage that the
antibodies are expressed and selected in an unnatural context.
[0057] The cloning of the various nucleic acid fragments comprising
sequences encoding antibody variable domains or fragments thereof
from the heavy and light chain antibody genes into appropriate
expression vectors can be carried out using conventional genetic
engineering techniques which are well known to a person in the art
and described in the literature.
[0058] An exemplary general method is described below, although it
will be appreciated that steps of this method may be varied or
omitted as appropriate.
[0059] Total RNA from the isolated B-lymphocyte population (or the
further enriched population) is extracted by appropriate methods
which are standard and conventional in the art. cDNA is then
synthesised from the RNA by appropriate methods, e.g. using random
hexamer oligonucleotides. Again these are processes known to
persons skilled in the art.
[0060] As indicated above, the populations of B-lymphocytes
isolated from immunochallenged patients as defined herein will be
distinct from populations isolated from a
non-immunochallenged/naive patient. Thus, such isolated B
lymphocyte populations (or the further enriched populations)
provide a yet further aspect of the invention. Further aspects
provided are libraries of isolated nucleic acid molecules derived
from such populations of B-lymphocytes (or the further enriched
populations), e.g. a library of RNA or cDNA molecules derived from
such B-lymphocytes. These libraries of isolated nucleic acid
molecules may optionally be cloned into expression vectors to form
expression libraries.
[0061] The cDNA pool is then subjected to a primary PCR reaction
with oligonucleotides that hybridise to the IgG constant region of
the heavy chain of antibody genes and oligonucleotides that
hybridise to the 5' end of the variable heavy chain region of
antibody genes. A PCR reaction is also set up for the amplification
of the variable light (VL) chain pool of kappa and lambda classes.
Such oligonucleotides may be designed based on known and publicly
available immunoglobulin gene sequence database information.
[0062] It is important to note that the above described PCR
reactions are set up to clone only the antibodies in the IgG form.
These are preferred as they are generally associated with a more
mature immune response and generally exhibit higher affinity than
IgM antibodies, thereby making them more desirable for certain
therapeutic and diagnostic applications. Clearly however
oligonucleotides can be designed which will allow the cloning of
one or more of the other forms of immunoglobulin molecules, e.g.
IgM, IgA, IgE and IgD if desired or appropriate.
[0063] The primary PCR products are then subjected to a secondary
PCR reaction with new oligonucleotide sets that hybridise to the 5'
and 3' ends of the antibody variable domains V-Heavy, V-light kappa
and V-light lambda (as appropriate depending on whether the primary
PCR reaction with which the new oligonucleotide sets are used was
designed to amplify portions of the heavy or light chain antibody
genes). These oligonucleotides advantageously include DNA sequences
specific for a defined set of restriction enzymes (i.e. restriction
enzyme sites) for subsequent cloning. The selected restriction
enzymes must be selected so as not to cut within human antibody
V-gene segments. Such oligonucleotides may be designed based on
known and publicly available immunoglobulin gene sequence and
restriction enzyme database information. However, preferred
restriction enzyme sites to be included are NcoI, Hind III, MluI
and NotI. The products of such secondary PCR reactions are
repertoires of various V-heavy, V-light kappa and V-light lambda
antibody fragments/domains. This type of secondary PCR reaction is
therefore generally carried out when the expression library format
of interest is a scFv or Fv format, wherein only the VH and VL
domains of an antibody are present.
[0064] Libraries of such repertoires of cloned fragments comprising
the variable heavy chain regions, or fragments thereof, and/or
variable light chain regions, or fragments thereof, of antibody
genes derived from the B lymphocytes of immunochallenged patients
as defined herein form further aspects of the invention. These
libraries comprising cloned variable regions may optionally be
inserted into expression vectors to form expression libraries.
[0065] Alternatively, if desired, the primary and secondary PCR
reactions can be set up so as to retain all or part of the constant
regions of the various heavy and/or light antibody chains contained
in the isolated B cell population. This is desirable when the
expression library format is a Fab format, wherein the heavy chain
component comprises VH and CH domains and the light chain component
comprises VL and CL domains. Again libraries of such cloned
fragments comprising all or part of the constant regions of heavy
and/or light antibody chains form further aspects of the
invention.
[0066] Once they have been cloned, the nucleic acid molecules
encoding the various portions of antibody molecules, e.g. the heavy
chains or light chains of antibodies or portions thereof, e.g. VH
and/or VL chains, may be further diversified using standard
techniques, for example by mutation involving the addition,
deletion and/or substitution of one or more nucleotides in a
controlled (e.g. site directed mutagenesis) or random manner, or by
domain swapping, cassette mutagenesis, chain shuffling etc.
Synthetic nucleotides may be used in the generation of the diverse
nucleic acid sequences. Thus, all or part of the nucleic acids
encoding the antibody domains can be synthesised chemically.
[0067] Preferably however the isolated nucleic acid molecules
encoding the various antibody domains for making up the expression
library are not subject to further diversification at this stage
and correspond to the sequences as found in vivo and which are
likely to be functional in antigen binding due to the fact that
they are expressed by B lymphocytes in a patient in response to a
specific immunochallenge.
[0068] The appropriate variable gene fragments may then be cloned
into an expression vector so as to generate an expression library
of scFv fragments. The structure and organisation of vectors to
produce scFv antibody fragments are known in the art. In general,
to generate such scFv fragments nucleic acid fragments encoding
variable light chain and variable heavy chain domains are cloned
into an expression vector in a single reading frame where the
variable heavy and variable light chains are linked by a nucleic
acid encoding a peptide linker. The expression vector is preferably
an E coli expression vector and is advantageously also designed so
that the expressed antibody fragments contain a detection tag such
as a MYC tag.
[0069] It will be appreciated however from the discussion above
that the methods and expression libraries of the invention are not
limited to antibodies in the single chain format and other formats
can equally be generated, for example Fab fragments, Fab'2
fragments, Fv fragments, diabodies, etc., in accordance with
methods which are well known in the art. In addition other types of
expression vector can be used. In particular other forms of
prokaryotic expression vectors can be used, as well as different
types of display vectors such as phage, covalent or ribosomal
display vectors. E. coli vectors are however preferred for the
various reasons outlined herein.
[0070] The main requirement of an expression vector is that it
contains all the necessary components required for obtaining
expression of the appropriate nucleic acid molecule encoding the
polypeptide of interest in the particular expression system chosen.
Thus, the expression vectors, as well as the nucleic acid fragments
encoding the antibody molecules, may optionally additionally
contain other appropriate components, for example origins of
replication, inducible promoters for initiating transcription and
protein expression, antibiotic resistance genes and markers,
general tags, detection tags such as myc tags or reporter
molecules, primer binding sites to enable amplification of the
constructs by e.g. PCR, or any other desirable sequence elements.
Appropriate sources and positioning of such additional components
within the library constructs so that they perform their desired
function would be well within the normal practice of a skilled
person in the art.
[0071] Preferred expression vectors for use in the invention are
the pHOG vector and the pSEX vector, the general structures of
which are shown in FIG. 2. The pHOG vector is suitable for
expression of soluble scFv fragments in bacterial systems such as
E. Coli. The structure of the pHOG vector shown in FIG. 2 can
readily be adapted for the expression of a different format of
antibody, e.g. a Fab antibody. The pSEX vector is a phagemid vector
which is suitable for expressing scFv antibody fragments in phage
display systems. In such vectors the scFv fragments are expressed
as a fusion protein with gpIII, a filamentous bacteriophage coat
protein or a fusion with some other appropriate bacteriophage coat
protein or fragment thereof. Again such vectors can readily be
adapted to express other formats of antibody, e.g. Fab
fragments.
[0072] After cloning into appropriate expression vectors, the
antibody expression library is transformed into E. coli cells (or
other appropriate host cells depending on the vector system used)
such as XL-1 blue.
[0073] Transformation can be carried out by electroporation or any
other appropriate method, after which the library is plated onto
nutrient (e.g. agar) plates. Generally the transformed E. coli (or
other host) are also plated with relevant antibiotics, e.g.
ampicillin, so that only the host cells containing the expression
vector with a resistance gene can grow. Generally the host cells
are also plated with transcription inhibitors to inhibit protein
expression.
[0074] The particular plating technique will differ depending on
the technique chosen for screening the colonies. The aim here is
generally to choose a technique with the ability to screen as many
candidates as possible in order to isolate and detect the colonies
in the library that produce the best antibody candidates. There are
several techniques which achieve this aim and which are well known
and described in the art. Any of these techniques may be used.
However, a preferred method is the filter screening method
summarised below (and also described in Example 1) which can be
used to screen approximately 40,000 different colonies a week.
[0075] This method can of course be readily adapted depending on
the expression system chosen. However, for an E. coli expression
system, the bacterial colonies containing plasmids encoding scFv
fragments (or other format of antibody) are picked by a colony
picking robot and are inoculated to generate master plates of
single colony bacterial stocks.
[0076] The picked colonies are gridded on a nitrocellulose membrane
and grown overnight on non-inducing medium (i.e. a medium which
does not allow protein expression).
[0077] The nitrocellulose membrane with bacterial colonies are
induced to express scFv fragments by adding an appropriate inducer
and are brought into contact with a secondary nitrocellulose
membrane coated with the specific antigen to which it is desired to
identify reactive antibodies. The appropriate inducer used will
depend on the design of the expression vector. However a preferred
inducer is IPTG which induces expression from the LAC promoter.
[0078] The antigen coated membranes are subjected to washing steps
and specific detection of bound scFv antibodies is carried out by
incubating with appropriate reagents. The appropriate reagents will
again depend on the design of the expression system. However, if
for example the scFv fragments also contain a myc tag then
incubation with anti-MYC specific antibodies followed by detection
of such antibodies, for example with HRP-conjugated anti mouse
antibodies is appropriate. The membrane is developed by ECL (or any
other appropriate method).
[0079] By comparing developed membranes with or without specific
antigens, specific spots can be identified which correspond to a
location in the stock master plate which express a potential
antibody candidate. These candidates can then be further analysed
by returning to the stock master plate.
[0080] Thus, the antibody expression library is generally screened
for antibody molecules which interact with a particular target
antigen, e.g. a foreign antigen associated with a particular
disease or foreign agent. Once one or more antibody molecules have
been identified using the methods of the invention these molecules
(or the nucleic acid encoding them) can be isolated and
purified.
[0081] Thus, a further aspect of the present invention provides a
method of identifying and/or isolating one or more antibody
molecules exhibiting desired properties from an antibody expression
library as defined herein, said method comprising the step of
screening an antibody expression library of the invention for
molecules which display certain properties.
[0082] A preferred aspect of the invention thus provides a method
of identifying and/or isolating from an antibody expression library
as defined herein one or more antibody molecules which is a
specific binding partner for a target antigen, said method
comprising the steps of a) screening an expression library of the
invention for antibody molecules which bind to a particular target
antigen and b) identifying and/or isolating the relevant library
member.
[0083] Once appropriate nucleic acid fragments encoding candidate
antibody molecules with particular properties have been identified,
the gene pool encoding candidate polypeptides can, if desired, be
subjected to affinity maturation, for example to try and identify
candidate antibodies with further improved properties. Such
affinity maturation can be performed by carrying out any
conventional form of mutagenesis, including but not limited to the
addition, deletion and/or substitution of one or more nucleotides
in a controlled (e.g. site directed mutagenesis) or random manner,
error-prone PCR, domain swapping, cassette mutagenesis and chain
shuffling, etc., prior to repetition of the screening cycle.
[0084] When one or more antibody molecule candidates have been
selected, identified and/or purified using the methods and
expression libraries of the invention, these candidates, or a
component, fragment, variant, or derivative thereof may be
manufactured and if desired formulated with at least one
pharmaceutically acceptable carrier or excipient. Such manufactured
antibody molecules, or components, fragments, variants, or
derivatives thereof, are also encompassed by the present invention.
Alternatively, these antibody molecules may take the form of
nucleic acids encoding antibody molecules, which nucleic acids may
in turn be incorporated into an appropriate expression vector
and/or be contained in a suitable host cell. Thus, nucleic acid
molecules encoding said antibody molecules, or expression vectors
containing said nucleic acid molecules form further aspects of the
invention.
[0085] Once a particular antibody molecule, or a component,
fragment, variant, or derivative thereof, has been selected,
identified, etc., in accordance with the present invention, the
expression vector encoding the selected antibody can readily be
used (or adapted for use) to produce sufficient quantities of the
antibody molecule by expression in appropriate host cells or
systems and isolating the antibody molecules from the host cell or
system or from the growth medium or supernatant thereof, as
appropriate. Alternatively, said antibody molecules may be produced
by other appropriate methods, e.g. by chemical synthesis of the
nucleic acid encoding the antibody and expression in a suitable
host or in an in vitro transcription system.
[0086] Thus, a yet further aspect of the invention provides a
method of manufacturing a specific antibody molecule comprising the
steps of identifying a specific antibody molecule which is a
binding partner for a target antigen according to the methods of
the invention as described above, manufacturing said identified
antibody molecule, or a component, fragment, variant, or derivative
thereof and optionally formulating said manufactured antibody
molecule with at least one pharmaceutically acceptable carrier or
excipient. Antibody molecules (or components, fragments, variants,
or derivatives thereof), identified, manufactured or formulated in
this way form yet further aspects of the invention.
[0087] Said variants or derivatives of an antibody molecule include
peptoid equivalents, molecules with a non-peptidic synthetic
backbone and polypeptides related to or derived from the original
identified antibody molecule polypeptide wherein the amino acid
sequence has been modified by single or multiple amino acid
substitutions, additions and/or deletions which may alternatively
or additionally include the substitution with or addition of amino
acids which have been chemically modified, e.g. by deglycosylation
or glycosylation. Conveniently, such derivatives or variants may
have at least 60, 70, 80, 90, 95 or 99% sequence identity to the
original polypeptide from which they are derived.
[0088] Said variants or derivatives further include the conversion
of one format of antibody molecule into another format (e.g.
conversion from Fab to scFv or vice versa), or the conversion of an
antibody molecule to a particular class of antibody molecule (e.g.
the conversion of an antibody molecule to IgG or a subclass
thereof, e.g. IgG1 or IgG3, which are particularly suitable for
therapeutic antibodies). Said variants or derivatives further
include the association of antibody molecules with further
functional components which may for example be useful in the
downstream applications of said antibodies. For example the
antibody molecules may be associated with components which target
the antibodies to a particular site in the body, detectable
moieties useful for example in imaging or other diagnostic
applications, or peptides which mimic the Fc effector functions of
the constant regions of antibody molecules (e.g. by activating
complement or binding to Fc receptors), by for example making
pepbody molecules such as those described by Affitech AS (see
PCT/GB01/05301).
[0089] Clearly, the main requirement for such components,
fragments, variants, or derivative antibody molecules is that they
retain their original functional activity in terms of ability to
bind a specific antigen or have improved functional activity.
[0090] The antibody expression libraries of the invention can be
screened against more than one target antigen. For example, the
libraries of the invention can be screened against similar targets
either to avoid or to obtain cross-reactive antibodies. For example
in the course of generating human antibodies against infectious
diseases the libraries can be screened against different strains of
the disease causing agent. Antibodies specific for one strain must
recognise a disease specific antigen. Conversely, antibodies
binding different strains must recognise common antigens among the
strains. At least the antibodies must recognise common or
structurally similar epitopes on antigens. Such antibodies,
identified by screening the libraries of the invention with two or
more different but related target antigens, e.g. target antigens
from different strains of a particular infectious agent (i.e.
antibodies identified by differential screening) are particularly
good candidates for use as therapeutic or prophylactic antibodies
against a specific strain or different strains of a disease causing
agent and form a preferred embodiment of the invention.
[0091] Antibodies which have the ability to recognise more than one
strain of an infectious agent clearly have advantages in terms of
more widespread use. The expression libraries of the invention can
readily be used to identify such antibodies as they can be used for
differential screening against a number of targets. Indeed,
experiments show that the libraries of the present invention are
useful to detect a significant number of cross-reactive antibodies.
For example, Example 2 describes how an expression library derived
from patients challenged with a vaccine derived from a particular
strain of Neisseria meningitidis B (Norwegian strain 44/76) and
screened with the OMV target antigen from such a strain can also be
screened for antibodies which recognise the OMV target antigen from
a second strain of Neisseria meningitidis B (New Zealand strain
NZ-98/254), and cross-reactive antibodies (i.e. antibodies which
recognise both target antigens) identified. In this example
approximately 10% cross-reactive clones were detected.
[0092] Thus, the use of the expression libraries of the invention
for differential screening with different target antigens to
identify cross-reactive antibodies forms a yet further aspect of
the invention.
[0093] The libraries of the present invention can also be used in
the development of new and improved vaccines. Usually vaccines are
composed of attenuated virus or bacteria or composite fractions of
bacteria such as capsules or membrane vesicles. Common for most
vaccines are that the detailed compositions and the parts of the
vaccine that are most immunogenic with respect to inducing a
protective immune response are often not known, so efforts to
discover good immunogens are important for the development of safe
and effective vaccines.
[0094] The tapping of the antibody repertoire from vaccinated
individuals as described herein can be used to provide information
on which immunogens foster the most effective and protective
antibodies. The utilisation of a vaccinee's antibody repertoire as
a tool to discover or isolate such immunogens has been proposed and
termed "Reverse vaccinology" (Burton D R, Nature Reviews in
Immunology 2, 706-713(2002)). The patient antibody libraries and in
particular the vaccinee antibody libraries produced in accordance
with the present invention can readily be used for such reverse
vaccinology, which generally involves the identification of
antibodies which can interact with a particular vaccine and then
identifying the antigen/epitope of the vaccine with which these
antibodies are interacting (i.e. identifying the immunogen). Once
the immunogen has been identified at the protein level, this can be
used to deduce the nucleic acid sequence encoding the immunogen
and, if desired, the native gene encoding the immunogen can be
isolated by standard methods. This will then allow the production
of pure recombinant vaccines using an appropriate expression
system. Such vaccines are likely to be more safe and effective than
conventional vaccines and may comprise one or more different
immunogens.
[0095] Thus, a yet further embodiment of the invention provides the
use of the libraries of the invention to develop vaccines or in
reverse vaccinology to identify the immunogens of a vaccine which
stimulate the most effective and protective antibodies.
[0096] The invention further provides a method to develop and/or
produce a recombinant vaccine comprising the steps of:
[0097] a) screening an antibody library of the invention derived
from a vaccinee, against one or more vaccines;
[0098] b) identifying the immunogen(s) of the vaccine to which the
antibodies recognising the vaccine become bound;
[0099] c) deducing the nucleic acid sequence encoding one or more
of the identified immunogens;
[0100] d) optionally isolating the native gene(s) encoding the
immunogen(s);
[0101] e) using said nucleic acid sequence or native gene to
produce a recombinant vaccine.
[0102] The screening step (a) is generally carried out against the
vaccine used to vaccinate the patient from which the antibody
library is derived, but is preferably also carried out against one
or more related vaccines in order that the immunogens identified in
step (b) are more likely to be common to more than one vaccine and
therefore have a wider ranging use as a recombinant vaccine. For
example the libraries are preferably not only screened against the
particular strain of infectious agent with which the patient was
vaccinated but are also screened against one or more related
strains. Thus the screening step (a) preferably involves
differential screening as described above.
[0103] The step (b) of identifying the immunogens can be carried
out by any appropriate methods which would be well known to those
skilled in the art of protein characterisation. Generally the
positive antibodies binding the vaccine are isolated and the
immunogen of the vaccine identified using for example methods such
as western blot, immuno-histochemistry, native gel electrophoresis,
detection of protein spots on two-dimensional gel electrophoresis,
isolation of protein followed by N-terminal sequencing, or affinity
purification of the immunogen from the vaccine. The amino acid
sequence can be used to deduce the nucleic acid sequence and the
native gene encoding the immunogen can be isolated by for example
sequence homology search and PCR amplification of the deduced gene.
The nucleic acid sequence or isolate of the gene encoding the
immunogen can be expressed in a suitable expression system so as to
generate a pure recombinant vaccine.
[0104] Once the recombinant vaccines have been developed these can
be formulated in an appropriate way for administration to patients.
Such formulation and appropriate modes and regimens of
administration would be well known to a person skilled in the art.
Such recombinant vaccines form a yet further embodiment of the
invention.
[0105] Successful use of the methods and expression libraries of
the invention is dependent on high levels of expression of the
correct antibody polypeptide by a particular clone. The inventors
have developed a novel type of expression vector which helps to
improve this by virtue of only allowing in frame antibody fragments
to be detectably expressed. Such expression vectors form a yet
further preferred aspect of the invention.
[0106] Thus, a yet further aspect of the invention provides
expression vectors comprising one or more dummy nucleic acid
fragments located in the parts of the vector into which the
polypeptide encoding nucleic acid inserts will be cloned, wherein
said dummy fragments are positioned such that they are not in
reading frame with the other parts of the expression vector and
wherein said expression vectors, when expressed, do not give rise
to detectable polypeptide products.
[0107] Such expression vectors are also referred to herein as dummy
vectors.
[0108] Often when large expression libraries are to be generated,
as in the methods of the present invention, large amounts of
expression vector need to be used in the ligation reaction in which
the nucleic acid fragments encoding the polypeptide fragments of
interest (the inserts) are cloned into the relevant positions in
the expression vectors for expression. When the vectors are
prepared for ligation, usually by digesting with the appropriate
restriction enzymes, there will always be some vectors which are
cleaved at only one site and thus religate without gaining a new
insert. This is the background of a ligation reaction and, when
colonies arising from these religated vectors are screened, they
may well give rise to false positive results. Where the dummy
vectors of the invention are used however, the colonies arising
from religated dummy vectors will not produce any detectable
protein (because the dummy fragments are out of frame and the
polypeptides produced will for example not contain an in frame
sequence which can be detected by a detection reagent such as a tag
specific antibody or another tag specific reagent) and will thus
not give rise to false positives. Advantageously, this means that
any polypeptides expressed and detected in the expression libraries
of the invention where such vectors are used, is due to the
insertion of a new and desired insert, e.g. an antibody
fragment.
[0109] The dummy nucleic acid fragments are "stuffer" fragments and
can be any DNA fragments providing they are positioned in the
vector such that they are out of reading frame with the expression
vector as a whole. Preferred dummy fragments are Green Fluorescent
protein (GFP) fragments and in particular GFP fragments of
approximately 600 bp or 700 bp derived from the sequence as
disclosed in Genbank Accession number U55762. ID CV55762. A
particularly preferred fragment of approximately 600 bp is found at
positions 2-597 of the above mentioned Genbank sequence. A
particularly preferred fragment of approximately 700 bp is found at
positions 6-690 of the above mentioned Genbank sequence.
[0110] Preferably the dummy vectors of the invention will be used
to clone antibody fragments and manufacture antibody expression
libraries in accordance with the present invention as discussed
above. However, it will be seen that such vectors have a wide
application in the manufacture of any expression libraries where it
is desired to reduce the number of false positive clones. The
present invention thus further provides the use of such dummy
expression vectors in the production of an expression library, e.g.
an antibody expression library, and in particular the antibody
expression libraries of the invention.
[0111] Preferred dummy vectors are pHOG dummy and PSEX dummy (see
FIG. 2) which are designed for the production of antibody
expression libraries in the scFv format. In these dummy vectors,
dummy fragments of approximately 700 bp and 600 bp from GFP are
inserted out of frame in the VH and VL sites, respectively, of the
relevant antibody expression vectors. As shown in FIG. 2 however,
dummy vectors for use in the production of antibody expression
libraries in the Fab format can readily be designed and the PFAB
dummy vectors as shown in FIG. 2 are also preferred.
[0112] The antibody molecules isolated, detected, selected,
identified or manufactured from the expression libraries of the
present invention may be used in any methods where antibodies
specific to a particular antigen are required. Thus, such antibody
molecules can be used as molecular tools and a further aspect of
the invention provides a reagent which comprises such an antibody
molecule as defined herein.
[0113] As discussed above however the antibody molecules selected
or identified, etc., from the antibody expression libraries of the
invention are particularly useful as therapeutic antibodies or as
antibodies for in vivo diagnosis, e.g. by imaging. Other preferred
uses include theranostic uses (i.e. antibodies used in both
diagnosis and therapy), imaging, and as prophylactic antibodies,
e.g. to confer passive immunity to particularly susceptible
individuals (immunocompromised patients, small children, the fetus
of pregnant women, people in endemic areas for disease, etc).
Suitable and appropriate adaptations of the antibody molecules, if
necessary for such uses, e.g. the conversion to IgG1 or IgG3
classes for therapy, the incorporation or addition of an
appropriate label for imaging, etc., would be well known to a
person skilled in the art.
[0114] The most suitable antibodies for the various uses described
above can be readily identified using appropriate tests which can
be designed by a person skilled in the art. For example, in
applications where high affinity or avidity of an antibody is
important these criteria can readily be tested in candidate
antibodies using standard assay techniques (e.g. Biacore assays).
In addition, where antibodies against a particular infectious
agent, e.g. a bacteria, virus or fungus, have been identified,
appropriate tests can be carried out to assess which antibodies are
most effective to neutralise the infectious agent. For example, in
the case of bacteria, bactericidal and opsonophagocytic activity
against the bacteria in question can be assessed. Similarly, in the
case of viruses, viral neutralisation studies can be carried out to
identify the best candidates.
[0115] A yet further aspect of the invention thus provides the use
of an antibody expression library as described herein to isolate,
detect, identify, select or manufacture one or more antibody
molecules which bind specifically to one or more target antigens,
for example one or more target antigens which are associated with
particular diseases or tissues or foreign agents. This could for
example be carried out by screening the antibody expression
libraries with the target antigens.
[0116] Yet further aspects of the invention provide such isolated,
detected, identified, selected or manufactured antibody molecules
for use in therapy or in vivo diagnosis or for use in any of the
other applications mentioned above. Also covered is the use of such
antibody molecules in the manufacture of a medicament or
composition for use in therapy or in vivo diagnosis or for use in
any of the other applications mentioned above. Methods of treatment
of a patient comprising the administration of an appropriate dose
of such an antibody molecule are also provided.
[0117] When said antibody molecules are used in the above described
uses and methods then these may be administered in any appropriate
way. For example such antibody molecules may be administered
locally at the site where action is required or may be attached or
otherwise associated with entities which will facilitate the
targeting of the antibody molecules to an appropriate location in
the body.
[0118] Pharmaceutical compositions comprising the antibody
molecules as defined herein, together with one or more
pharmaceutically acceptable carriers or excipients form a yet
further aspect of the invention.
[0119] Yet further aspects are methods of diagnosis or imaging of a
patient comprising the administration of an appropriate amount of
an antibody molecule as defined herein to the patient and detecting
the presence, location and/or amount of the antibody molecule in
the patient.
[0120] The antibody molecules identified, selected, etc., from the
expression libraries of the invention may equally be used in
methods of diagnosis which are carried out in vitro, if
appropriate, e.g. carried out on a tissue sample or some other kind
of sample, e.g. blood, obtained or derived from a patient.
[0121] Preferred diseases to be treated or diagnosed, etc., are
infectious diseases caused by infectious agents such as Varicella
Zoster Virus, HIV, CMV, Hepatitis (and in particular Hepatitis B or
C), Herpes, Meningococcus (and in particular Meningococcus A, B or
C) and Streptococcus A. Particularly preferred diseases are those
caused by Meningococcus B and especially preferably diseases which
are stimulated by meningococcus B Outer membrane vesicles (OMV).
Other preferred diseases are cancers (for example pancreatic
cancers, lymphomas, sarcomas or melanomas), autoimmune diseases
(for example Coeliac disease, Lupus or Rheumatoid arthritis), or
allergic diseases.
[0122] The terms "therapy" or "treatment" as used herein include
prophylactic therapy. The terms "therapy" and "treatment" also
include combatting or cure of disease or infections or allergic
reactions but also include the controlling or alleviation of
disease or infection or allergic reactions or the symptoms
associated therewith.
[0123] The antibodies from the expression libraries for the uses as
described above are preferably IgG antibodies with a high affinity
for antigen.
[0124] Yet further aspects of the present invention provide kits
comprising the antibody expression libraries as defined herein or
antibodies derived, selected or identified from said expression
libraries. Kits comprising the dummy expression vectors of the
invention are also include in the scope.
[0125] The invention will now be described in more detail in the
following non-limiting Examples with reference to the following
drawings in which:
[0126] FIG. 1 shows a schematic overview of the steps of an
exemplary array based screening technique which can be used to
screen the expression libraries of the invention.
[0127] FIG. 2 shows schematic diagrams of the three preferred dummy
expression vectors of the present invention, pHOG dummy, pSEX dummy
and pFAB dummy.
[0128] FIG. 3 shows in more detail the step of the screening
technique where antibody (scFv) expression is induced and expressed
proteins are captured on a capture membrane permeated with a target
antigen for screening.
[0129] FIG. 4 shows the results of screening antibody expression
libraries from four patients (patients/libraries B to E) for
antibodies which interact with OMV target antigen. Positive
colonies can be seen as dark spots on the OMV membranes (left hand
side) compared with the BSA (background membranes). The colonies
picked for further analysis are marked with white squares. FIG. 4a
shows the results for patient E, FIG. 4b shows the results for
patient B, FIG. 4c shows the results for patient D and FIG. 4d
shows the results for patient C.
[0130] FIG. 5 shows the results of an ELISA assay to confirm that
the positive and negative clones picked from patient libraries B to
D were truly positive and negative for antibodies reactive with the
OMV target antigen. FIG. 5a shows the results for the ten positive
clones selected from patient E, FIG. 5b shows the results for the
ten positive clones selected from patient D, FIG. 5c shows the
results for the ten positive clones selected from patient C and
FIG. 5d shows the results for the four negative clones selected
from patient B.
[0131] FIG. 6 shows the diversity analysis carried out on the 34
clones picked from the four patients B, C, D and E. DNA was
extracted from each of the 34 clones and subjected to restriction
digest with the enzyme MvaI. The digested fragments were separated
on an acrylamide gel. The results show different restriction
lengths for each of the isolated plasmids indicating unique DNA
sequences for each clone.
[0132] FIG. 7 shows a composite image based on films exposed to
filters treated with OMV from N. meningitidis B strain 44/76
(orange), strain NZ 98/254 (purple/blue) and BSA (green). Red
squares (A2, B9, C1, D3, D7, H1 and H3 from Library C, B6 and E12
from Library D and D5 from Library E) indicate signals whose
associated clones were chosen for further study. Black squares (A4,
B7, D2, D10, F10, F12, G10, H6 and H8 from Library C, A2, A3, A8,
B2, B12, C3, C8, D3, D7 and E5 from Library D and B8, B9, C4, D1,
D2, D11, D12, E1 and F5 from Library E) indicate clones that were
already under investigation at the time of this screening based on
their interaction with 44/76 alone.
[0133] FIG. 8 shows the amino acid sequence of recombinant VZV
glycoprotein E. Boxed peptides at the amino terminal in the
sequence indicate 3.times. FLAG tag.
[0134] FIG. 9 shows ELISA analysis of serum from a person with no
visible signs of ever having had a VZV infection (negative serum),
a person who had a Varicella infection many years ago (low
positive) and the serum from a patient recently infected with VZV
taken 5 days (RN5) or 11 days (RN11) after detection of the first
vesicular lesion.
[0135] FIG. 10 shows a composite image based on films exposed to
filters treated with FLAG-gE (red/purple) and BSA (green).
[0136] FIG. 11 shows Biacore data from selected OMV binding
scFvs.
EXAMPLE 1
[0137] Array Based Screening
[0138] Screening many thousand clones enables us to isolate
antibodies directly from immunochallenged donor libraries. With the
array based method (Skerra A, Dreher M L, Winter G. "Filter
screening of antibody Fab fragments secreted from individual
bacterial colonies: Specific detection of antigen binfind with a
two-membrane system" Anal. Biochemistry 1991; 196:151-155. and de
Wildt R M T, Mundy C R, Gorick B D, Tomlinson I M, "Antibody arrays
for high-throughput screening of antibody-antigen interactions"
Nature Biotechnology 2000; 18: 989-933) more than 104 clones can be
screened in one working week by one person. This method has been
selected for use in the array based expression library screening
carried out in the present invention, although of course other
techniques could also be used.
[0139] The method is described schematically by FIG. 1. Monday: a
library (of appropriate diversity) is plated on bioassay trays and
incubated overnight. Tuesday: colonies grown from the plating of
the library are picked to 384 well microtiter plates using a colony
picking robot. Wednesday: an array is stamped from the microtiter
plates to a membrane overlying nutrient agar in a bioassay tray
using an arraying robot. Thursday: a second "capture" membrane is
treated with the target antigen and blocked for unspecific binding.
The capture membrane is then placed on agar containing IPTG.
Thereafter, the first membrane with its arrays of colonies are then
transferred to overlie the capture membrane. The colonies are
incubated overnight and induced to express recombinant antibodies.
Friday: antibodies retained on the capture membrane are detected
using a secondary antibody as might be done in a Western blot. The
signals produced on the filter are analysed to identify cultures
containing candidate clones, which are then "cherry-picked" from
the source microtiter plates.
EXAMPLE 2
[0140] Generation and Screening of Meningococcal B Vaccine
Libraries
[0141] Generation of 4 Meningococcal B Donor Libraries:
[0142] Peripheral Blood Lymphocytes (PBL) from 4 different
Meningococcus B OMV (outer membrane vesicles) vaccines were
isolated.
[0143] Donor B: (Aase et al., 1998, Scand. J. Immunology, vol
47:388-396). The patient was vaccinated 26/8/87 and 6/10/87 (50
.mu.g dosages). The last dose (25 .mu.g) was given 11/1/95. The
cells were isolated 13/2/95, i.e 26 days after the last
injection.
[0144] Donor C, D and E (Naess et al., 1999, Vaccine, vol
17:754-764). Patients were vaccinated with doses of 25 kg each
time. Second vaccination was given 6 weeks after the first dose and
the last dose was given 40 weeks after the second dose. Cells were
isolated 6-7 days after the last dose.
[0145] Each patient was vaccinated with the Norwegian meningococcal
B OMV vaccine 44/76 developed at the Norwegian Institute of Public
Health (Fredriksen et al., supra).
[0146] RNA Isolation:
[0147] 2.times.10.sup.7 cells from each donor were washed once in
ice-cold PBS. The cell pellet was lysed. Between 5 to 25 .mu.g
total RNA was isolated according to the protocol from Stratagene:
Strataprep.RTM. Total RNA miniprep kit.
[0148] cDNA Synthesis:
[0149] 5 .mu.g of each donor RNA was used for 1.sup.st strand cDNA
synthesis by the use of random hexamer oligonucleotides according
to the Protocol from Gibco BRL: SuperScript Rnase H.sup.- Reverse
transcriptase.
1 Random hexamer 500 ng Promega oligonucleotide Total RNA 5 .mu.g
-- dNTP, 10 mM 0.5 mM Fermentas RNasin 2 U/.mu.l Promega
SUPERSCRIPT II RT 200 U Gibco BRL 5.times. Reaction buffer 1.times.
Gibco BRL DTT, 0.1 M 10 mM Gibco BRL
[0150] RNA, dNTPs and random hexamers were incubated at 65.degree.
C. for 5 minutes followed by rapid cooling to 4.degree. C. Reaction
buffer, DTT and RNasin were added and incubated at 25.degree. C.
for 2 mins. During incubation Superscript II reverse transcriptase
was added. After 10 mins the reaction was incubated at 42.degree.
C. for one hour. The Reverse transcriptase was inactivated at
70.degree. C.
[0151] Primary Variable Gene PCR Amplification:
[0152] 125 ng cDNA was used as template for the amplification of
V-genes. A total of 9 IgG variable heavy chain, 20 Variable light
chain kappa and 9 variable light chain lambda reactions were set up
with V-gene specific oligonucleotide sets. The Reactions were run
at annealing temperatures at 55, 58 or 61.degree. C. for 30 cycles.
The primer sequences used for the primary PCR-V gene amplification
are shown in Table 1.
[0153] Secondary Variable Gene PCR Amplification:
[0154] 2 .mu.l of each primary PCR reaction (approximately 100 ng)
was used as template for the secondary PCR reactions. A total of 45
V-Heavy, 9 V-lambda and 20 V-kappa PCR reactions were run for 30
cycles at an annealing temperature at 58.degree. C. All the
oligonucleotides introduce restriction enzyme sites, NcoI and
HindIII for all V-heavy genes and MluI and NotI for all V-kappa and
V-lambda genes. The primer sequences used for the secondary PCR-V
gene amplification are shown in Table 2.
[0155] Digestion and Purification of Amplified Variable Genes:
[0156] All the PCR products were purified by PCR cleanup kit
(Qiagen) and digested with appropriate restriction enzymes (i.e
NcoI and HindIII, for V-heavy and MluI and NotI for V-kappa and
lambda) overnight at 37.degree. C. The digested fragments were run
on an agarose gel and correct sized fragments were isolated and
purified by Gel extraction kit (Qiagen).
[0157] Design of the pHOG, pSEX and pFAB Dummy Vectors:
[0158] pSEX and pHOG-dummy vectors were made by insertion of a 700
bp Green Fluorescent protein (GFP)-DNA fragment in the VH-site and
a 600 bp GFP DNA fragment in the VL site. Both DNA fragments are
cloned such that they are out of reading frame, rendering
re-ligated vectors, i.e. the background in a ligation reaction,
non-functional with respect to protein production. The GFP
fragments of approximately 600 bp or 700 bp are derived from the
sequence as disclosed in Genbank Accession number U55762. ID
CV55762. The fragment of approximately 600 bp is found at positions
2-597 of the above mentioned Genbank sequence. The fragment of
approximately 700 bp is found at positions 6-690 of the above
mentioned Genbank sequence.
[0159] Two vector constructs were made, pHOG dummy for the
expression of soluble scFv fragments and pSEX dummy for the
expression of scFv fused to gpIII, a filamentous bacteriophage coat
protein for the use in phagemid display of antibody fragments.
Schematics showing the general structure of these dummy vectors are
shown in FIG. 2. The system may also be used for the expression of
Fab fragments by exchanging the VH and VL coding parts of PFAB
expression vectors with GFP dummy fragments (see the schematic of
the pFab dummy vector in FIG. 2).
[0160] The pHOG dummy vector is 4.3 kb and the pSEX dummy vector is
5.5 kb. These vectors also contain MYC and HIS tags located 3' to
the VL gene segment. The promoter used is the inducible LAC
promoter.
[0161] Cloning of the Variable Genes into pHOG-Dummy:
[0162] The pHOG dummy vector was digested with MluI and NotI and
ligated with variable light chain pools of Kappa and lambda
isotypes and electroporated into XL-1 blue cells. Two light chain
libraries (kappa and lambda) from each donor, total of 8 libraries,
showed each between 3 to 5.times.10.sup.6 clones. The bacterial
colonies were scraped from agar plates and a total plasmid pool
from each library was isolated by 10 DNA miniprep (Qiagen)
isolations of each.
[0163] The light chain plasmid libraries (pHOG VL) were digested
with NcoI overnight at 37.degree. C., linearised plasmid was
isolated from agarose gels and purified by gel extraction kit
(Qiagen) followed by secondary digestion with HinDIII overnight.
The digestion reaction was incubated with calf intestinal phosphate
(CIP, New England Biolabs) before the double NcoI/HinDIII digested
plasmid was isolated from agarose gel and purified by gel
extraction kit (Qiagen).
[0164] The NcoI and HindIII digested pHOG VL plasmids were ligated
with 7 Variable heavy pools from each donor and electroporated into
XL-1 blue cells. Colonies were grown on agar plates with Ampicillin
(100 .mu.l/ml) and 2 mM glucose.
[0165] Screening of 4 Meningococcal B Donor Libraries:
[0166] 10 000 colonies of each library B, C, D and E were picked by
the Qpix II colony picking and arraying robot (see also Example 1),
i.e. a total of 40 000 colonies, and inoculated into 384-well trays
with LB medium with 200 mM glucose, ampicillin (100 .mu.g/ml),
tetracycline (30 .mu.g/ml) and 8% Glycerol. The cultures were
incubated at 37.degree. C. over night to generate master stock
liquid cultures of all 40 000 clones.
[0167] The clones were gridded in an array onto a nitrocellulose
membrane pre-incubated in LB/ampicillin put on top of a large
LB-agar plate. The gridding was performed by the QpixII colony
picker robot. The colonies were arrayed in duplicates and on three
separate membranes. The colonies were allowed to grow on the
nitrocellulose membrane/agar plate overnight at 30.degree. C.
[0168] The membranes with colony arrays were put on top of a
secondary nitrocellulose membrane (see FIG. 3) coated with either
450 .mu.g OMV-target (menigococcal B Outer Membrane Vesicle) or BSA
and blocked with 3% sterile filtered BSA per membrane. A third
untreated membrane was included for the subsequent detection of
total secreted scFv's, not shown. The colonies were induced to
protein expression by IPTG (100 .mu.M) overnight at 30.degree.
C.
[0169] The target-coated membranes (capture membranes) were washed
in PBS/0.05% TWEEN (P/T). The membranes were incubated with
mouse-anti-MYC antibody, Invitrogen, (1:8000 in P/T) for 1 hour at
room temperature in roller-bottles. The membranes were washed in
P/T for 10 mins followed by incubation with anti mouse HRP
antibody, Dako, (1:10 000 in P/T) for 1 hour at room temperature in
roller-bottles. The membranes were washed prior to signal
development by ECL (Amersham). Positive signals were detected as
spots on a light sensitive film (Amersham Hyperfilm).
[0170] Results:
[0171] From each of the donors C, D and E approximately 50 out of
10 000 clones showed positive to binding membranes coated with OMV
targets and not the background membrane coated with BSA. For donor
B no positives were found. From each of the donors B, C, D and E a
total of 34 clones were picked, 30 positive (C1-10, D1-10 and
E1-10) and 4 negative (B1-4). Picked colonies are marked with white
squares on FIGS. 4a to d.
[0172] Re-Expression of Positive Anti-OMV ScFv's as Soluble
Antibody Fragments
[0173] Positive colonies were picked from the master stock plates
and grown overnight at 37.degree. C. in
LB/Tetracyclin/Ampicillin/Glucose. Plasmids from each clone were
isolated and transformed into new CaCl.sub.2 competent XL1-blue
cells. A new overnight culture from each positive clone was further
inoculated into LB/TAG medium to OD 640 at 0.1. The cultures were
grown to OD 640 0.6 before being induced to protein expression by
changing medium to LB, ampicillin, 100 .mu.M IPTG and incubated
overnight at 30.degree. C.
[0174] Confirmation of Positive Anti OMV ScFv's in an ELISA
Format.
[0175] 96 well microtiter plates (NUNC, Maxisorp) were coated with
45 .mu.g/ml OMV target overnight at 4.degree. C. The wells were
blocked with 4% skimmed milk before dilutions (undiluted, 1:3 and
1:81) of supernatant from re-expressed scFvs were added and
incubated for 1 hour at room temperature. The plates were washed
with P/T followed by incubation of anti-myc antibody (1:6000) for 1
hour at room temperature, after washing in P/T, anti-mouse HRP
(1:10 000) was added and incubated for 1 hour at room temperature.
The plates were washed in P/T and the signal was developed by
adding ABTS. The signal was read at 405 nm after 20 minutes.
[0176] Of the total of 30 clones shown positive on the membrane
screening, 25 were confirmed true positives in the ELISA assay (see
FIGS. 5a-c). It can be seen from FIG. 5d that the four clones
picked from donor B were true negatives.
[0177] DNA analysis of anti-OMV ScFvs:
[0178] All 34 picked clones were shown by Restriction enzyme digest
analysis to be unique. Plasmids derived from the 34 picked colonies
were digested with restriction enzyme MvaI at 37.degree. C.
overnight. The samples were run on a 10% TBE Criterion Precast
acrylamide gel (Bio-Rad). The DNA fragments are visualized by
staining the gel in 0.5 mg/ml Ethidium Bromide. The results show
different restriction fragment lengths among the isolated plasmids,
indicating unique DNA sequences for each clone (see FIG. 6).
[0179] This means that the 25 confirmed positive anti OMV scFv's
are all different and thus probably bind the same antigen at
different epitopes. In other words the isolated repertoire is
broad, thereby increasing the probability of isolating antibodies
directed to the most effective neutralising epitope.
[0180] Affinity Analysis of Selected Positive Anti OMV ScFvs:
[0181] The affinity of the positive antibodies E7, D3, D9 and EB as
shown in FIGS. 5a and 5b for target antigen were analysed by a
Biacore machine. The Biacore data for these antibodies is shown in
FIG. 11. The affinities (dissociation constant, K.sub.D) of the
scFv fragments binding to the OMV 44/76 antigen were calculated to
be:
E7=4.times.10.sup.-9 M
D3=6.times.10.sup.-9 M
D9=2.times.10.sup.-9 M
E8=1.5.times.10.sup.-8 M
[0182] These antibodies thus all show high affinity for the target
antigen.
[0183] Summary:
[0184] Antibody expression libraries from 4 patients vaccinated
with OMV (meningococcal B outer membrane vesicles) vaccines were
generated. By the process of direct screening of antibody
expression libraries from three donors, many antibodies binding OMV
were successfully isolated. From one donor (B) no binders were
found. The main difference lies in the fact that donor B had
received the vaccine for the first time 8 year prior to the third
boost and that the cells were harvested 26 days after the last
vaccine boost. The successful three libraries were generated from
donors which had received the vaccine within one year and the cells
were isolated 6-7 days after the third dose.
[0185] This indicates that the harvesting of cells from different
patients especially with infectious diseases should take place
within a week after outbreak or after a secondary encounter of an
infectious agent. If this is done then the correct antibody
producing circulating B-cells can be isolated.
[0186] Discussion:
[0187] The antibody repertoire can be screened against similar
targets either to avoid or to obtain cross-reactive antibodies. For
example in the course of generating human antibodies against
infectious diseases the libraries can be screened against different
strains of the disease causing agent. Antibodies specific for one
strain must recognise a disease specific antigen. Conversely,
antibodies binding different strains must recognise common antigens
among the strains. At least the antibodies must recognise common or
structurally similar epitopes on antigens. Such antibodies can be
used as prophylactic or therapeutic antibodies against a specific
strain or different strains of the disease-causing agent.
[0188] Usually vaccines are composed of attenuated virus or
bacteria or composite fractions of bacteria such as capsules or
membrane vesicles. Common for most vaccines are that the detailed
compositions and the parts of the vaccine that are most immunogenic
with respect to protective immune response are often not known, so
effort's to discover good immunogens are important for the
development of safe and effective vaccines. The tapping of the
antibody repertoire from vaccinated individuals as described herein
provides information on which immunogens foster the most effective
and protective antibodies. The utilisation of a vaccinee's antibody
repertoire as a tool to discover or isolate such immunogens has
been proposed and termed "Reverse vaccinology" (Burton D R, Nature
Reviews in Immunology 2, 706-713 (2002)). The patient antibody
libraries and in particular the vaccinee antibody libraries
produced in accordance with the present invention can readily be
used for such reverse vaccinology for example by carrying out the
following steps:
[0189] A. The vaccinee antibody repertoire is screened against the
vaccine.
[0190] B. Positive antibodies binding the vaccine are isolated and
used for the immunogen discovery by methods known to those skilled
in the art of protein characterisation. These methods can be such
as western blot, immuno-histochemistry, native gel electrophoresis,
detection of protein spots on two-dimensional gel electrophoresis,
isolation of protein followed by N-terminal sequencing, affinity
purification of the immunogen from the vaccine. The amino acid
sequence can be used to deduce the nucleic acid sequence and the
native gene encoding the immunogen can be isolated by sequence
homology search and PCR amplification of the gene.
[0191] C. The isolate of the gene encoding the immunogen can be
produced in a suitable expression system so as to generate a pure
recombinant vaccine.
[0192] An example of differential screening of OMV antibody
libraries to obtain cross-reactive antibodies against two Neisseria
meningitidis B strains is shown below:
[0193] Screening for Antibodies to Neisseria meningitidis NZ-98/254
(New Zealand Strain) from Candidates Binding 44/76 (Norwegian
Strain).
[0194] Selection of Candidate Clones:
[0195] Films from the initial screening against strain 44/76
(Norway) were analyzed to produce a list of candidates for
screening against NZ-98/254. The films that formed the basis of the
analysis were those from 10 second exposure to target filters and
those from 5 minute exposure to the background filters for each of
the relevant libraries (C, D and E). The criterion used in
selecting candidate clones was that the clone showed clear signal
on a 10 sec exposure to the target filter coated in 10 mls of 45
.mu.g/ml (450 .mu.g total) OMV in PBS from strain 44/76, but little
or no signal on the 5 minute exposure against the background filter
(coated in 10 mls 3% BSA)*. Clones that met this criterion were
chosen as candidates for cross screening against NZ-98/254. From
the 3 libraries, 94, 61 and 70 clones were thus chosen from
libraries C, D and E respectively.
[0196] [*To facilitate the evaluation of presence versus absence of
signal, images were subjected to an image analysis process. The
process can be described as follows. Films were scanned and stored
as "TIF" files. The files were then opened in Corel Photo Paint 9
and the "find edges" function used to define areas of signal above
an arbitrary cut-off level and simultaneously define signal
circumference. The images were then given color using the "replace
colors" function: target images colored purple and background
images green. Finally the files were exported as "GIF" files with
transparent background, imported into Corel Draw 9 and superimposed
and aligned such that the background (green) image was over the
target (image). The superimposition of a long exposure to the
background filter over a short exposure to the target filter
provided a clear method for choosing candidates].
[0197] Picking of Positive Candidates, "Cherry-Picking":
[0198] Deep well plates were filled with 400 .mu.l HMFM (Hogness
Modified Freezing Medium, 1.times.HMFM=3.6 mM K.sub.2HPO.sub.4, 1.3
mM KH.sub.2PO.sub.4, 2 mM Na citrate, 1 MM
MgSO.sub.4.times.7H.sub.2O, 47% glycerol) per well. The Q-pix2
instrument, which employs a standard picking head, was used to
"cherry-pick" from the relevant source plates to the deep well
destination plates. The operation was performed in triplicate, such
that each source culture was inoculated to corresponding wells in
three separate destination plates. Cultures were grown 20 hours at
37.degree. C. with shaking. Once 384 well plates were prepared from
the 96 well deep well plates (see next section) the cultures were
frozen at -80.degree. C.
[0199] Preparing 384 Well Plates for Arraying of Candidate
Clones:
[0200] To array the cherry-picked clones with our equipment it was
necessary to transfer an aliquot of each culture in the 96
deep-well plates to a well in a 384 well plate. Therefore, a 384
well plate was prepared for each of the 3 replicate picks mentioned
above (resulting in 9 plates: library C rep1, rep2 rep3, library D
rep1 rep2 rep3, library E rep1, rep2 rep3).
[0201] Arraying:
[0202] The arraying strategy was chosen in a way to "cluster"
replicate clones. This was achieved by choosing the appropriate
plate placement and 3.times.3 pattern. The pattern chosen included
duplicate printing of each spot within its subgrid. Each clone was
thus represented as duplicate printings of triplicate
cherry-pickings (see Table 3). Arrays were printed from the 384
well plates described above on to blocked filters placed on growth
medium in 22.times.22 cm bioassay trays. The filters employed were
22.times.22 cm Schleiser and Schuell "Protan" cellulose nitrate
filters, pore size 0.45 .mu.m, and these were blocked in 50 ml 2%
BSA (lg total) for 1 hr. The growth medium employed was 200 ml LB
agar containing 100 .mu.g/ml ampicillin 30 .mu.g/ml tetracycline.
Colonies were allowed to grow at 37.degree. C. for 16 hrs.
2TABLE 3 Correspondence between well A1 in the deep-well plates
inoculated from the cherry- pick, the 384 well plates used to
create the array and the position of colonies on the array* 1 [*The
cells at the bottom right of the table show 3 by 3 pattern of
duplicates used in the arraying procedure. Those positions marked
in gray font are those printed from empty wells, whereas those in
bold indicate wells containing cultures from the cherry-picking
procedure. Subgrid row A, column 1 was thereby occupied only by two
colonies, each from replicate 1. Similarly, subgrid A2, and B1 #
were occupied only by duplicate colonies of replicates 2 and 3
respectively. Also, the constitutive positive control clone ("c")
was printed to subgrid B2.]
[0203] Also, the constitutive positive control clone ("c") was
printed to subgrid B2.]
[0204] Capture Filter Coating:
[0205] Two "target" filters were prepared. The primary target
filter was prepared from the New Zealand strain NZ-98/254 of N.
meningitidis OMV (outer membrane vesicles). The secondary filter
was that prepared from OMV of the Norwegian strain 44/76. One
"background" filter was also prepared by coating only with block
agent (3% BSA). The coating procedure was performed as follows.
Schleiser and Schuell "Protan" cellulose nitrate filters, pore size
0.45 .mu.m, were cut to three 11 by 22 cm strips and treated as
follow. Filters were first wet in PBS, rolled into nylon mesh and
inserted into large (1.5 liter) hybridization tubes. The target
filters were then incubated with 25 ml of 45 .mu.g/ml OMV (1.125 mg
total) in PBS for 1 hr, while the background filter was incubated
with PBS. The filters were then drained and incubated with 25 ml 3%
BSA (750 mg total) in PBS for 1 hr to block. Filters were then
drained and rinsed in 50 ml LB before application to the induction
plate.
[0206] Induction-Capture and Detection Conditions:
[0207] Induction-capture and detection was performed for each of
four capture filters (2 "target" filters coated either with NZ
98/254 or 44/76, 1 background filter coated with BSA and 1
untreated filter used to monitor scFv expression).
Induction-capture were achieved by superimposing the filter bearing
the colonies grown in the arraying process onto the capture filter
on an induction plate. Induction plates were comprised of 200 mls
LB agar containing 100 .mu.g/ml ampicillin, 30 .mu.g/ml
tetracycline and 100 mM IPTG in 22 X 22 cm bioassay trays. The
induction-capture "sandwich" was incubated 18 hrs at 30.degree. C.,
allowing secreted antibody fragments (scFv) to be expressed and
secreted from the colonies and to diffuse to the capture filter.
Colony bearing filters were then removed and capture filters
subjected to the detection procedure. The detection procedure can
be described as follows: wash 3.times.5 min in 50 ml PBS 0.05%
Tween; incubate 1 hr with 25 ml mouse anti c-myc (1:10 000); wash
3.times.5 min in 50 ml PBS 0.05% Tween; incubate 1 hr with 25 ml
goat anti-mouse HRP (1:10 000); wash 5.times.5 min in 50 ml PBS
0.05% Tween; use ECL (Amersham) reagents to produce autoradiograms
to film. For each filter, exposures to film were made at 10, 45 and
120 second durations.
[0208] Evaluation of Images to Identify Cross-Binding Clones:
[0209] As in the initial screening of clones, images were analysed
with the help of functions in Corel Photo Paint 9. Specifically,
films were scanned and files imported into Corel Photo Paint 9
where the "edge detect" function was used to define a radius of
density around the spots produced on film during the detection
procedure. The function uses local differences in density to
establish the presence of "edges", thereby providing an objective
criterion for spot presence: spots under a certain threshold level
are lost from the image. After detection of edges, images were
colored according to their source film: orange=10 sec exposure
44/76 coated filter; purple=10 sec exposure to NZ 98/254 coated
filter; blue=45 sec exposure to NZ 98/254 coated filter; green=120
sec exposure to filter blocked with BSA only. Images were exported
as "transparent" gifs and layered orange, blue, purple, green from
bottom to top (see FIG. 7). Candidate clones were chosen based on
corresponding purple/blue spots (indicating binding to NZ 98/254)
that were clearly larger than the spots originating from the BSA
only (background) filter. Also, one candidate was chosen that
showed strong binding to 44/76, but no detectable interaction with
NZ 98/254 (Clone D5 from library E--see FIG. 7). The 10 clones
chosen in this screening then are those listed in Table 4 below and
indicated by red boxes in FIG. 7. Note that prior to the screening
against strain NZ 98/254, 30 additional clones were chosen based on
their affinity for strain 44/76 alone (see FIGS. 5a, b and c).
About 10% of the tested clones are cross reactive.
3 Library Coordinate Original source C A2 C 1 I10 C B9 C 3 L22 C C1
C 9 D11 C D3 C 9 M6 C D7 C 12 B12 C H1 C 13 N8 C H3 C 23 I3 D B6 D
11 H10 D E12 D 24 C8 E D5 E 16 B21
[0210] The 10 clones chosen in this screening cross react with the
OMV from both the NZ 98/254 and Norwegian 44/76 strains of N.
meningitidis B. The antibodies of these clones are good candidates
for broad range high affinity propylactic or therapeutic antibodies
against N. meningitidis B and in particular the strains NZ 98/254
and Norwegian 44/76. In addition, these antibodies can be used in
reverse vaccinology as described above in order to identify the
particular immunogen in the vaccines which are recognised by these
antibodies and the gene encoding this immunogen.
[0211] Diversity of the Repertoire
[0212] The diversity of the repertoire of antibody molecules which
can be derived from the patient libraries of the invention was
demonstrated by selecting 33 positive clones from libraries C, D
and E and analysing the variable regions of the ScFv fragments from
these clones. These results are shown in Table 5 where it can be
seen that the variable heavy chain (VH) fell into the VH1, 3 and 4
families. The variable light chains (VL) were comprised by VK
(kappa) 1 and 3, V.lambda. (lambda) 1, 2, 3, 6 and 8 families thus
representing a typical level of V-gene usage among humans.
[0213] In carrying out this analysis all variable genes were
sequenced with oligonucleotides annealing to the 5' and the 3' ends
of the Variable Heavy and variable light chain genes respectively.
Sequencing was performed at GATC biotech AG, Constanz, Germany. To
identify the V-gene family all v-gene sequences were analysed by
DNAPLOT at the V-base (http://www.mrc-cpe.cam.ac.uk).
EXAMPLE 3
[0214] Generation and Screening of a Varicella zoster Virus Patient
Antibody Library
[0215] Discussion:
[0216] Whereas Example 2 is based on antibody libraries generated
from individuals vaccinated against a bacterial disease, the
following Example is based on an antibody library from a primary
infected patient with a viral disease, Varicella zoster virus
showing that the process also is valid for viral diseases and that
antibody libraries from real patients can successfully be
screened.
[0217] Generation of Recombinant VZV GlycoproteinE:
[0218] DNA sequence information of gE was obtained from EMBL
HEVZVXX, accession X04370 (ref: Davidson A J and Scott J E The
complete DNA sequence of varicella-zoster virus. J Gen Virol 9,
1759-1816, 1986). Oligonucleotides for the amplification of
glycoprotein E extracellular part were designed:
[0219] 1: 5'AGAGAGCAGCTGCGTATAACGAATCCGGTCAGA
[0220] 2: 5'AGAGAGGCGGCCGCTCGTAGAAGTGGTGACGT.
[0221] The PCR product includes restriction enzyme cleavage sites
for PvuI and NotI in oligonucleotide 1 and 2 respectively
(underlined). The PCR product was digested with PvuI and NotI
enzymes and cloned into a version of PHOG dummy in which the MYC
and HIS tag is removed but with a FLAG tag inserted N-terminally to
the gE protein. The clone was sequenced and verified correct native
gE within the desired sequence (see FIG. 8 gE protein sequence).
Recombinant FLAG-gE was expressed in E.coli. By the denaturation
and renaturation of gE inclusion bodies, soluble, recombinant gE
was produced. The recombinant gE was verified structurally
functional by positive binding of gE specific monoclonal antibodies
(data not shown).
[0222] Generation of VZV Cell Lysate and Control Antigen:
[0223] Low passage virus was used for infection of HE cells (human
embryonic fibroblasts). Cells should not have more than 17
passages. 0.5 to 1.5 ml virus incubated/absorbs the cells at 1-1.5
hours at room temperature (RT). Eagle's minimal essential medium
(EMEM) supplemented with penicillin and Streptomycin, 10% FBS
andlml 5% NaHCO.sub.3/100 ml medium was added and further incubated
at 37.degree. C. overnight (ON). Medium was changed after 24 hours.
The cells were harvested after 52 hours. The cells were sonicated
for 15 seconds and centrifuged at 1000 rpm. Non-infected cells were
treated in an identical way for the generation of control
antigen.
[0224] Generation of VZV Patient Antibody Library:
[0225] PBL was taken at day 5 and day 11 after appearance of the
first vesicular lesion on an adult male with primary varicella
infection.
[0226] 10 ml of PBL was spun 4000 rpm for 15 minutes and the serum
was frozen in -20.degree. C.
[0227] Isolation of Lymphocytes:
[0228] The lymphocytes were isolated using the Lymphoprep.TM. kit
(Axis-Shield). 4.times.10 ml batches of the PBL was mixed with 10
ml PBS and gently layed over 10 ml of lymphoprep. The mixture was
centrifuged for 50 minutes at 800 g, room temperature, before the
sample/medium interface of mononuclear cells was removed, using a
pasteur pipette. The mononuclear cells were washed two times in
PBS. The cells were counted and frozen in batches of
5.times.10.sup.7 cells.
[0229] ELISA Control of Anti-VZV Serum:
[0230] Microtiterplates were coated with 4 .mu.g/ml of both VZV
cell lysate and control antigen. All sera were diluted 1:50 in
water and 100 .mu.l of each diluted sera was added to both the VZV
cell lysate and control antigen coated microtiter wells.
[0231] The negative serum was from a person with no visible signs
of ever having had a VZV infection. The positive control is from a
person who had a Varicella infection many years ago (low positive),
and still displays a certain level of antibodies in the PBL.
Mab7.88 is a mouse monoclonal antibody (National Institute of
Public Health, Norway) diluted 1:1000 before use. The ELISA results
(FIG. 9) show that there are no detectable anti VZV IgG antibodies
in the sera of the patient from day 5 (RN5), but at day 11 (RN11)
we can show an IgG titer against the VZV infected cell-lysate.
Based on these results the library was made from the lymphocytes
isolated on day 11 after detection of the first vesicular
lesion.
[0232] The VZV antibody library was generated as described in
Example 2.
[0233] Plating and Picking:
[0234] Transformation mix was plated on LB agar containing 100
.mu.g/ml ampicillin and 30 .mu.g/ml tetracycline in 22.times.22 cm
bioassay trays (200 ml) and incubated at 37.degree. C. for 16 hrs.
Colonies were then picked to 384 well plates containing 80 .mu.l
per well of LB with 8% glycerol, 100 .mu.g/ml ampicillin and 30
.mu.g/ml tetracycline. Colonies to fill eight 384 well plates were
picked (potentially 3072 cultures). Cultures were incubated 18 hrs
at 37.degree. C.
[0235] Arraying:
[0236] Arrays were printed using the Q-pix 2 in a 4.times.4 pattern
from the 384 well plates produced in the picking procedure
described in Example 2. These were printed on to blocked filters
placed on growth medium in 22.times.22 cm bioassay trays. The
filters employed were 22.times.22 cm Schleiser and Schuell "Protan"
cellulose nitrate filters, pore size 0.45 .mu.m, and these were
blocked in 50 ml 2% BSA (1 g total) for 1 hr. The growth medium
employed was 200 ml LB agar containing 100 .mu.g/ml ampicillin 30
.mu.g/ml tetracycline. Colonies were allowed to grow at 37.degree.
C. for 16 hrs.
[0237] Capture Filter Coating:
[0238] The target filter was coated with the recombinant FLAG
gE-protein. A "background" filter was also prepared by coating only
with block agent (3% BSA). The coating procedure was performed as
follows. Schleiser and Schuell "Protan" cellulose nitrate filters,
pore size 0.45 .mu.m, were cut to three 11 by 7 cm sections and
treated as follows. Filters were first wet in PBS, rolled into
nylon mesh and inserted into large (1.5 liter) hybridization tubes.
The target filter was then incubated with 8 ml of 375 .mu.g/ml
FLAG-gE-protein (3 mg total) in PBS for 1 hr, while the background
filter was incubated with PBS. The filters were then drained and
incubated with 8 ml 3% BSA (240 mg total) in PBS for 1 hr to block.
Filters were then drained and rinsed in 50 ml LB before application
to the induction plate.
[0239] Induction-Capture and Detection Conditions:
[0240] Induction-capture and detection was performed for each of
three capture filters (1 "target" filter coated with FLAG-gE, 1
background filter coated with BSA/and 1 untreated filter used to
monitor scFv expression). Induction-capture was achieved by
superimposing the filter bearing the colonies grown in the arraying
process onto the capture filter on an induction plate. Induction
plates were comprised of 200 mls LB agar containing 100 .mu.g/ml
ampicillin, 30 .mu.g/ml tetracycline and 100 mM IPTG in 22.times.22
cm bioassay trays. The induction-capture "sandwich" was incubated
17.5 hrs at 30.degree. C., allowing secreted antibody fragments
(scFv) to be expressed and secreted from the colonies and to
diffuse to the capture filter. Colony bearing filters were then
removed and capture filters subjected to the detection procedure.
The detection procedure can be described as follows: wash 3.times.5
min in 50 ml PBS 0.05% Tween; incubate 1 hr with 25 ml mouse anti
c-myc (1:10 000); wash 3.times.5 min in 50 ml PBS 0.05% Tween;
incubate 1 hr with 25 ml goat anti mouse HRP (1:10 000); wash
5.times.5 min in 50 ml PBS 0.05% Tween; use ECL (Amersham) reagents
to produce autoradiograms to film. For each filter, exposures to
film were made at 1 and 2 minute durations.
[0241] Evaluation of Images to Identify Clones Binding with
Specific Affinity for gE:
[0242] Images were analysed with the help of functions in Corel
Photo Paint 9 in a way similar to that described in Example 2.
4TABLE 5 The V-gene families and specificity of 33 positive ScFv
fragments from libraries C, D and E. Clone ID VH family VL family
Specificity C1 VH3 nd 44/76 C2 nd V.kappa.1 44/76 C3 VH3 V.lambda.3
44/76 C4 VH3 V.lambda.3 44/76 C5 nd V.lambda.3 44/76 C6 VH3
V.lambda.2 44/76 C10 VH3 V.kappa.1 44/76 C11 VH1 V.kappa.3 44/76
NZ98/254 C12 VH1 V.lambda.3 44/76 NZ98/254 C13 VH1 V.lambda.6 44/76
C14 VH4 nd 44/76 NZ98/254 C15 VH1 V.kappa.3 44/76 NZ98/254 C16 VH3
V.lambda.1 44/76 NZ98/254 D2 VH3 nd 44/76 D3 VH3 V.lambda.3 44/76
D4 VH3 V.lambda.3 44/76 D7 VH4 V.kappa.3 44/76 D8 VH3 V.lambda.1
44/76 D9 nd nd 44/76 D10 VH4 V.lambda.1 44/76 D11 VH4 nd 44/76 D12
VH4 V.kappa.3 44/76 E1 VH4 V.lambda.1 44/76 E2 VH4 V.lambda.6 44/76
E3 VH1 V.kappa.1 44/76 E4 VH1 V.lambda.8 44/76 E5 VH1 V.lambda.8
44/76 NZ98/254 E6 VH1 V.lambda.1 44/76 E7 VH1 V.lambda.1 44/76
NZ98/254 E8 VH1 V.lambda.6 44/76 NZ98/254 E9 VH1 V.lambda.6 44/76
E10 VH1 V.lambda.6 44/76 E11 VH3 V.lambda.2 44/76 nd = no data
44/76 = OMV from strain 44/76 NZ98/254 = OMV from strain
NZ98/254
* * * * *
References