U.S. patent application number 09/754106 was filed with the patent office on 2003-12-04 for mutations in the diabetes susceptibility genes hepatocyte nuclear factor (hnf) 1 alpha (alpha), hnf-1beta and hnf-4alpha.
This patent application is currently assigned to ARCH Development Corporation. Invention is credited to Bell, Graeme I., Furuta, Hiroto, Horikawa, Yukio, Kaisaki, Pamela J., Menzel, Stephan, Oda, Naohisha, Yamagata, Kazuya.
Application Number | 20030224355 09/754106 |
Document ID | / |
Family ID | 27362613 |
Filed Date | 2003-12-04 |
United States Patent
Application |
20030224355 |
Kind Code |
A1 |
Bell, Graeme I. ; et
al. |
December 4, 2003 |
Mutations in the diabetes susceptibility genes hepatocyte nuclear
factor (HNF) 1 alpha (alpha), HNF-1beta and HNF-4alpha
Abstract
The present invention relates generally to the fields diabetes.
More particularly, it concerns the identification of genes
responsible for NIDDM for use in diagnostics and therapeutics. The
present invention demonstrates that the MODY3 locus is, in fact,
the HNF1.alpha. gene, MODY4 locus is the HNF1.beta. and the MODY1
locus is the HNF4.alpha. gene. The invention further relates to the
discovery that analysis of mutations in the HNF1.alpha., HNF1.beta.
and HNF4.alpha. genes can be diagnostic for diabetes. The invention
also contemplates methods of treating diabetes in view of the fact
that HNF1.alpha., HNF1.beta. and HNF4.alpha. mutations can cause
diabetes.
Inventors: |
Bell, Graeme I.; (Chicago,
IL) ; Yamagata, Kazuya; (Kaizuka-city, JP) ;
Oda, Naohisha; (Chicago, IL) ; Kaisaki, Pamela
J.; (Headington, GB) ; Furuta, Hiroto;
(Wakayama, JP) ; Horikawa, Yukio; (Chicago,
IL) ; Menzel, Stephan; (Headington, GB) |
Correspondence
Address: |
David L. Parker
FULBRIGHT & JAWORSKI L.L.P.
600 Congress Avenue, Suite 2400
Austin
TX
78701
US
|
Assignee: |
ARCH Development
Corporation
|
Family ID: |
27362613 |
Appl. No.: |
09/754106 |
Filed: |
January 3, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09754106 |
Jan 3, 2001 |
|
|
|
08927219 |
Sep 9, 1997 |
|
|
|
6187533 |
|
|
|
|
60029679 |
Oct 30, 1996 |
|
|
|
60028056 |
Oct 2, 1996 |
|
|
|
60025719 |
Sep 10, 1996 |
|
|
|
Current U.S.
Class: |
435/6.18 |
Current CPC
Class: |
C07K 14/4702 20130101;
C12Q 1/6883 20130101; C12Q 2600/172 20130101; C12Q 2600/156
20130101; C12Q 2600/158 20130101; C12Q 2600/136 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 001/68 |
Claims
What is claimed is:
1. A method for screening for diabetes comprising: a) obtaining
sample nucleic acid from an animal; and b) analyzing the nucleic
acids to detect a mutation in an HNF-encoding nucleic segment;
wherein a mutation in the HNF-encoding nucleic acid is indicative
of a propensity for non-insulin dependent diabetes.
2. The method of claim 1, wherein the HNF-encoding nucleic acid is
an HNF1.alpha.-encoding nucleic acid.
3. The method of claim 1, wherein the HNF-encoding nucleic acid is
an HNF4.alpha.-encoding nucleic acid.
4. The method of claim 1, wherein the HNF-encoding nucleic acid is
an HNF1.beta.-encoding nucleic acid.
5. The method of claim 1, wherein the nucleic acid is DNA.
6. The method of claim 1, wherein the step of analyzing the
HNF-encoding nucleic acid comprises sequencing the HNF-encoding
nucleic acid to obtain a sequence.
7. The method of claim 6, wherein the obtained sequence of the HNF
encoding nucleic acid is compared to a native nucleic acid sequence
of an HNF gene.
8. The method of claim 7, wherein the sequence of the HNF encoding
nucleic acid is compared to a native nucleic acid sequence of
HNF1.alpha..
9. The method of claim 8, wherein the native nucleic acid sequence
of HNF1.alpha. has a sequence set forth in SEQ ID NO:2.
10. The method of claim 7, wherein the sequence of the HNF encoding
nucleic acid is compared to a native nucleic acid sequence of
HNF4.beta..
11. The method of claim 10, wherein the native nucleic acid
sequence of HNF4.alpha. has a sequence set forth in SEQ ID
NO:78.
12. The method of claim 7, wherein the sequence of the HNF encoding
nucleic acid is compared to a native nucleic acid sequence of
HNF1.beta..
13. The method of claim 12, wherein the native nucleic acid
sequence of HNF1.beta., has a sequence set forth in SEQ ID:90.
14. The method of claim 1, wherein the HNF-encoding nucleic acid
comprises at least one point mutation.
15. The method of claim 1, wherein the step of analyzing the
HNF-encoding nucleic acid comprises PCR, an Rnase protection assay,
or an RFLP procedure.
16. A method of regulating diabetes in an animal comprising the
step of modulating HNF function in the animal.
17. The method of claim 16, further comprising the step of
diagnosing an animal with diabetes via analysis of an HNF-encoding
nucleic acid sequence for a mutation.
18. The method of claim 17, wherein the HNF-encoding sequence is an
HNF1.alpha.-encoding sequence.
19. The method of claim 17, wherein the HNF-encoding sequence is an
HNF4.alpha.-encoding sequence.
20. The method of claim 17, wherein the HNF-encoding sequence is an
HNF1.beta.-encoding sequence.
21. The method of claim 16, wherein the step of modulating HNF
function comprises providing an HNF polypeptide to the animal.
22. The method of claim 21, wherein the HNF polypeptide is a native
HNF polypeptide.
23. The method of claim 22, wherein the native HNF polypeptide is
an HNF1.alpha. polypeptide that has the sequence of SEQ ID
NO:2.
24. The method of claim 22, wherein the native HNF polypeptide is
an HNF4.alpha. polypeptide that has the sequence of SEQ ID NO:
79.
25. The method of claim 22, wherein the native HNF polypeptide is
an HNF1.beta. polypeptide that has the sequence of SEQ ID
NO:91.
26. The method of claim 21, wherein the provision of an HNF
polypeptide is accomplished by inducing expression of an HNF
polypeptide.
27. The method of claim 26, wherein the expression of an HNF
polypeptide encoded in the animal's genome is induced.
28. The method of claim 26, wherein the expression of an HNF
polypeptide encoded by a nucleic acid provided to the animal is
induced.
29. The method of claim 21, wherein the provision of an HNF
polypeptide is accomplished by a method comprising introduction of
an HNF-encoding nucleic acid to the animal.
30. The method of claim 21, wherein the provision of an HNF
polypeptide is accomplished by injecting the HNF polypeptide into
the animal.
31. The method of claim 16, wherein the step of modulating HNF
function in the animal comprises providing a modulator of HNF
function to the animal.
32. The method of claim 31, wherein the modulator of HNF function
is an agonist of HNF1.alpha..
33. The method of claim 31, wherein the modulator of HNF function
modulates transcription of an HNF1.alpha.-encoding nucleic
acid.
34. The method of claim 31, wherein the modulator of HNF function
modulates translation of an HNF1.alpha.-encoding nucleic acid.
35. The method of claim 31, wherein the modulator of HNF function
is an agonist of HNF4.alpha..
36. The method of claim 31, wherein the modulator of HNF function
modulates transcription of an HNF4.alpha.-encoding nucleic
acid.
37. The method of claim 31, wherein the modulator of HNF function
modulates translation of an HNF4.alpha.-encoding nucleic acid.
38. The method of claim 31, wherein the modulator of HNF function
is an agonist of HNF1.beta..
39. The method of claim 31, wherein the modulator of HNF function
modulates transcription of an HNF1.beta.-encoding nucleic acid.
40. The method of claim 31, wherein the modulator of HNF function
modulates translation of an HNF1.beta.-encoding nucleic acid.
41. The method of claim 16, further comprising the step of
diagnosing an animal with diabetes via analysis of an HNF-encoding
nucleic acid sequence for a mutation.
42. A method of screening for modulators of HNF function comprising
the steps of: a) obtaining an HNF polypeptide; b) determining a
standard activity profile of the HNF polypeptide; c) contacting the
HNF polypeptide with a putative modulator; and d) assaying for a
change in the standard activity profile.
43. The method of claim 42, wherein the HNF polypeptide is an
HNF1.alpha. polypeptide.
44. The method of claim 43, wherein the standard activity profile
of the HNF1.alpha. polypeptide is determined by measuring the
binding of the HNF1.alpha. polypeptide to a nucleic acid segment
comprising the sequence of SEQ ID NO: 9.
45. The method of claim 43, wherein the standard activity profile
of the HNF1.alpha. polypeptide is determined by determining the
ability of the HNF1.alpha. polypeptide to stimulate transcription
of a reporter gene, the reporter gene operatively positioned under
control of a nucleic acid segment comprising the sequence of SEQ ID
NO: 1.
46. The method of claim 42, wherein the HNF polypeptide is an
HNF4.alpha. polypeptide.
47. The method of claim 46, wherein the standard activity profile
of the HNF4.alpha. polypeptide is determined by measuring the
binding of the HNF4.alpha. polypeptide to an amino acid segment
comprising the sequence of SEQ ID NO:85.
48. The method of claim 46, wherein the standard activity profile
of the HNF4.alpha. polypeptide is determined by determining the
ability of the HNF4.alpha. polypeptide to stimulate transcription
of a reporter gene, the reporter gene operatively positioned under
control of a nucleic acid segment comprising the sequence of SEQ ID
NO:78.
49. The method of claim 42, wherein the HNF polypeptide is an
HNF1.beta. polypeptide.
50. The method of claim 49, wherein the standard activity profile
of the HNF1.beta. polypeptide is determined by determining the
ability of the HNF1.beta. polypeptide to stimulate transcription of
a reporter gene, the reporter gene operatively positioned under
control of a nucleic acid segment comprising the sequence of SEQ ID
NO:126.
51. A method of screening for modulators of HNF function comprising
the steps of: a) obtaining an HNF-encoding nucleic acid segment; b)
determining a standard transcription and translation activity of
the HNF nucleic acid sequence; c) contacting the HNF-encoding
nucleic acid segment with a putative modulator; d) maintaining the
nucleic acid segment and putative modulator under conditions that
normally allow for HNF transcription and translation; and e)
assaying for a change in the transcription and translation
activity.
52. An HNF modulator prepared by a process comprising screening for
modulators of HNF function comprising: a) obtaining an HNF
polypeptide; b) determining a standard activity profile of the HNF
polypeptide; c) contacting the HNF polypeptide with a putative
modulator; and d) assaying for a change in the standard activity
profile.
53. An HNF modulator prepared by a process comprising screening for
modulators of HNF function comprising: a) obtaining an HNF-encoding
nucleic acid segment; b) determining a standard transcription and
translation activity of the HNF nucleic acid sequence; c)
contacting the HNF-encoding nucleic acid segment with a putative
modulator; d) maintaining the nucleic acid segment and putative
modulator under conditions that normally allow for HNF
transcription and translation; and e) assaying for a change in the
transcription and translation activity.
54. An isolated and purified polynucleotide having an
HNF1.alpha.-encoding nucleic acid sequence.
55. The polynucleotide of claim 54, wherein the HNF1.alpha. encoded
has an amino acid sequence as set forth in SEQ ID NO:127.
56. The polynucleotide of claim 54, wherein the
HNF1.alpha.-encoding nucleic acid sequence has a sequence of SEQ ID
NO:126.
57. An isolated and purified polynucleotide having an
HNF1.beta.-encoding nucleic acid sequence.
58. The polynucleotide of claim 57, wherein the HNF1.beta. encoded
has an amino acid sequence as set forth in SEQ ID NO:139.
59. The polynucleotide of claim 57, wherein the HNF1.beta.-encoding
nucleic acid sequence has a sequence of SEQ ID NO: 128.
60. An isolated and purified nucleic acid segment comprising 15
contiguous nucleic acids identical to the sequence of SEQ ID NO:128
or SEQ ID NO: 126.
61. The isolated and purified nucleic acid segment of claim 60,
wherein said segment encodes a full-length HNF polypeptide.
62. The isolated and purified nucleic acid segment of claim 60,
wherein said segment encodes a promoter for the expression of an
HNF polypeptide.
Description
[0001] The present application is a continuation-in-part of
co-pending U.S. Patent Application Serial No. 60/029,679 filed 30
Oct. 1996, which was a continuation-in-part of U.S. Patent
Application Serial No. 60/028,056 filed 02 Oct. 1996, which was a
continuation-in-part of U.S. Patent Application Serial No.
60/025,719 filed 10 Sep. 1996. The entire text of each of the
above-referenced disclosures is specifically incorporated by
reference herein without disclaimer. The government owns rights in
the present invention pursuant to grant number DK-20595 and
DK-44840 from the National Institutes of Health.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the fields
diabetes. More particularly, it concerns the identification of
genes responsible for diabetes for use in diagnostics and
therapeutics.
[0004] 2. Description of Related Art
[0005] Diabetes is a major cause of health difficulties in the
United States. Non-insulin-dependent diabetes mellitus (NIDDM also
referred to as Type 2 diabetes) is a major public health disorder
of glucose homeostasis affecting about 5% of the general population
in the United States. The causes of the fasting hyperglycemia
and/or glucose intolerance associated with this form of diabetes
are not well understood.
[0006] Clinically, NIDDM is a heterogeneous disorder characterized
by chronic hyperglycemia leading to progressive micro- and
macrovascular lesions in the cardiovascular, renal and visual
systems as well as diabetic neuropathy. For these reasons, the
disease may be associated with early morbidity and mortality.
[0007] Subtypes of the NIDDM can be identified based at least to
some degree on the time of onset of the symptoms. The principal
type of NIDDM has on-set in mid-life or later. Early-onset NIDDM or
maturity-onset diabetes of the young (MODY) shares many features
with the more common form(s) of NIDDM whose onset occurs in
mid-life. Maturity-onset diabetes of the young (MODY) is a form of
non-insulin dependent (Type 2) diabetes mellitus (NIDDM) that is
characterized by an early age at onset, usually before 25 years of
age, and an autosomal dominant mode of inheritance (Fajans 1989).
Except for these features, the clinical characteristics of patients
with MODY are similar to those with the more common late-onset
form(s) of NIDDM.
[0008] Although most forms of NIDDM do not exhibit simple Mendelian
inheritance, the contribution of heredity to the development of
NIDDM has been recognized for many years (Cammidge 1928) and the
high degree of concordance of NIDDM in monozygotic twin pairs
(Barnett et al. 1981) indicates that genetic factors play an
important role in its development.
[0009] MODY is characterized by its early age of onset which is
during childhood, adolescence or young adulthood and usually before
the age of 25 years. It has a clear mode of inheritance being
autosomal dominant. Further characteristics include high penetrance
(of the symptomology), and availability of multigenerational
pedigrees for genetic studies of NIDDM. MODY occurs worldwide and
has been found to be a phenotypically and genetically heterogeneous
disorder.
[0010] A number of genetically distinct forms of MODY have been
identified. Genetic studies have shown tight linkage between MODY
and DNA markers on chromosome 20, this being the location of the
MODY1 gene (Bell et al., 1991; Cox et al., 1992). MODY2 is
associated with mutations in the glucokinase gene (GCK) located on
chromosome 7 (Froguel et al. 1992 and 1993). Recent linkage studies
have shown the existence of a further form of MODY which has been
termed MODY3 (Vaxillaire et al.,1995). MODY3 has been shown to be
linked to chromosome 12 and is localized to a 5 cM region between
markers D12S86 and D12S807/D12S820 of the chromosome (Menzel et
al., 1995).
[0011] Although it is well established that MODY2 is associated
with mutations in GCK there is still no information as to the
identity of other MODY genes. There is a clear need to identify
these genes and the mutations that result in diseased states. The
identification of these genes and their products will facilitate a
better understanding of the diseased states associated with
mutations in these genes and has important implications in the
diagnosis and therapy of MODY.
[0012] Since an understanding of the molecular basis of diabetes in
general and MODY specifically may facilitate the development of new
therapeutic strategies for the treatment of these disorders,
studies are needed to identify diabetes-susceptibility genes
associated with MODY. Moreover, methods of detecting individuals
with a propensity to develop such diseases are needed. Where
possible, the molecular mechanism underpinning the genetic lesion
should be determined in order to allow diagnosis and
specifically-directed therapy
SUMMARY OF THE INVENTION
[0013] The present invention relates to the inventors discovery
that the MODY3 locus the HNF1.beta. gene, the MODY1 locus is the
HNF4.alpha. gene and the MODY4 locus is HNF1.beta.. The invention
further relates to the discovery that analysis of mutations in the
HNF1.alpha., HNF1.alpha. and HNF4.alpha. genes can be diagnostic
for diabetes. The invention also contemplates methods of treating
diabetes in view of the fact that mutations in HNF1.alpha.,
HNF1.beta. and HNF4.alpha. can cause diabetes.
[0014] In one embodiment, the invention contemplates methods for
screening for diabetes mellitus. These methods comprise: obtaining
sample nucleic acid from an animal; and analyzing the nucleic acids
to detect a mutation in an HNF-encoding nucleic segment; wherein a
mutation in the HNF-encoding nucleic acid is indicative of a
propensity for non-insulin dependent diabetes.
[0015] In certain embodiments the HNF-encoding nucleic acid is an
HNF1.alpha.-encoding nucleic acid. In view of the inventor's
discovery that the MODY3 locus is HNF1.alpha., a mutation in the
HNF1.alpha.-encoding nucleic acid is indicative of a propensity for
diabetes. In some presently preferred embodiments, the
HNF1.alpha.-encoding nucleic acid is located on human chromosome
12q, which is the location site of the MODY3 locus. In other
embodiments, the HNF-encoding nucleic acid is an
HNF4.alpha.-encoding nucleic acid. In view of the inventor's
discovery that the MODY1 locus is HNF4.alpha., a mutation in the
HNF4.alpha.-encoding nucleic acid is indicative of a propensity for
diabetes. In some presently preferred embodiments, the
HNF4.alpha.-encoding nucleic acid is located on human chromosome
20, which is the location of the MODY1 locus.
[0016] It is important to note that the terms NIDDM, MODY, MODY1,
MODY3, and MODY4 are used to designate diabetes disease states, and
the use of a particular such name may not always represent the same
causation of that disease state. The inventors have discovered that
mutations in HNF4.alpha. can lead to a MODY1 disease state;
however, not all mutations in HNF4.alpha. that lead to diabetes
might cause a "MODY1" disease state. Conversely, not all diabetes
disease states brought about by a mutation in HNF4.alpha. might be
considered a MODY1 disease state. Therefore, Applicants prefer to
use, in some cases, "HNF4.alpha.-diabetes" to note any diabetic
disease state brought on by a mutation or malfunction of
HNF4.alpha., even those that do not exhibit all, or any, MODY1
disease states. Likewise, Applicants may use "HNF4.alpha.-diabetes"
and "HNF4.beta.-diabetes" rather than "MODY3" and "MODY4",
respectively.
[0017] The nucleic acid to be analyzed can be either RNA or DNA.
The nucleic acid can be analyzed in a whole tissue mount, a
homogenate, or, preferably, isolated from tissue to be analyzed. In
some preferred embodiments, the step of analyzing the HNF-encoding
nucleic acid comprises sequencing of the HNF-encoding nucleic acid
to obtain a sequence, the sequence may then be compared to a native
nucleic acid sequence of HNF to determine a mutation. Such a native
nucleic acid sequence of HNF1.alpha. may have the sequence set
forth in SEQ ID NO: 1. Such a native nucleic acid sequence of
HNF4.alpha. has a sequence set forth in SEQ ID NO:78.
[0018] The method allows for the diagnosis of almost any mutation,
including, for example, point mutations, translocation mutations,
deletion mutations, and insertion mutations. The method of analysis
may comprise PCR, an RNase protection assay, an RFLP procedure,
etc. Using this method, the inventors have diagnosed a variety of
HNF1.alpha. mutations, including those set forth in Table 8. In
preferred embodiments mutations occur at codons 17, 7, 27, 55/56,
98, 131, 122, 142, 129, 131, 159, 171, 229, 241, 272, 288, 289,
291, 292, 273, 379, 401, 443, 447, 459, 487, 515, 519, 547, 548 or
620 of an HNF1.alpha.-encoding nucleic acid nucleic acid, for
example, having the sequence of SEQ ID NO:1. In other preferred
embodiments a mutation occurs at the splice acceptor region of
intron 5 and exon 6 of an HNF1.alpha.-encoding nucleic acid. In
other embodiments a mutation occurs at the splice acceptor region
of intron 9 of an HNF1.alpha.-encoding nucleic acid. In other
embodiments, the mutation occurs independently, in intron 1, intron
2, intron 5, intron 7 or intron 9 of HNF1.alpha. gene. The
inventors have also found a variety of HNF4.alpha. mutations,
including those found in Table 10. In some preferred embodiments,
the HNF-encoding nucleic acid is an HNF4.alpha.-encoding nucleic
acid and a mutation occurs in exon 7 of the HNF4.alpha.-encoding
nucleic acid. In other preferred embodiments, a mutation occurs at
codon 268, 127, 130 or 154 of an HNF4.alpha.-encoding nucleic acid
having the sequence of SEQ ID NO:78.
[0019] The invention also contemplates methods of treating diabetes
in an animal comprising: diagnosing an animal that has diabetes and
modulating HNF function in the animal.
[0020] The step of diagnosing an animal with diabetes frequently
comprises analysis of an HNF1.alpha.-encoding nucleic acid sequence
or an HNF4.alpha.-encoding nucleic acid sequence for a
mutation.
[0021] The step of modulating HNF function may comprise providing
an HNF1.alpha. or HNF4.alpha. polypeptide to the animal. In cases
where normal HNF1.alpha. or HNF4.alpha. function is sought to be
revived, the HNF1.alpha. or HNF4.alpha. polypeptide may be a native
HNF1.alpha. or HNF4.alpha. polypeptide. For example, a native
HNF1.alpha. polypeptide may the sequence of SEQ ID NO: 2. A native
HNF4.alpha. polypeptide may the sequence of SEQ ID NO: 79. The
provision of an HNF1.alpha. or HNF4.alpha. polypeptide is
accomplished by any of a number of ways. For example, expression of
an HNF1.alpha. or HNF4.alpha. polypeptide may be induced, with the
expression being of an HNF1.alpha. or HNF4.alpha. polypeptide
encoded in the animal's genome or of an HNF1.alpha. or HNF4.alpha.
polypeptide encoded by a nucleic acid provided to the animal. The
provision of an HNF1.alpha. or HNF4.alpha. polypeptide may be
accomplished by a method comprising introduction of an HNF1.alpha.
or HNF4.alpha.-encoding nucleic acid to the animal, for example, by
injecting the HNF1.alpha. or HNF4.alpha.-encoding nucleic acid into
the animal.
[0022] Modulating HNF function in the animal can comprise providing
a modulator of HNF1.alpha. or HNF4.alpha. function to the animal.
Such modulators are in the nature of drugs and can be, for example
HNF4, HNF6, HNF3 or any other peptide or molecule that regulates
HNF1.alpha.. These modulators may be formulated into a
pharmaceutical compound for delivery to the animal. The modulator
of HNF1.alpha., HNF.beta. or HNF4.alpha. function may be an agonist
or antagonist of HNF1.alpha., HNF.beta. or HNF4.alpha.. The
modulator may modulate transcription of an HNF1.alpha., HNF.beta.
or HNF4.alpha.-encoding nucleic acid, translation of an
HNF1.alpha., HNF.beta. or HNF4.alpha.-encoding nucleic acid, or the
functioning of the HNF1.alpha., HNF.beta. or HNF4.alpha.
polypeptide.
[0023] The invention also contemplates methods of screening for
modulators of HNF function comprising: obtaining an HNF
polypeptide, for example an HNF1.alpha., HNF.beta. or HNF4.alpha.
polypeptide; determining a standard activity of the HNF; contacting
the polypeptide with a putative modulator; and assaying for a
change in the standard activity of the polypeptide. In some
preferred methods, the standard activity profile of a HNF1.alpha.
polypeptide is determined by measuring the binding of the
HNF1.alpha. polypeptide to a nucleic acid segment comprising the
sequence of SEQ ID NO: 9. To facilitate measuring the HNF1.alpha.
activity, the nucleic acid segment comprising the sequence of SEQ
ID NO: 9 or the HNF1.alpha. polypeptide may comprise a detectable
label. In some preferred methods, the standard activity profile of
a HNF4.alpha. polypeptide is determined by measuring the binding of
the HNF4.alpha. polypeptide to a nucleic acid segment comprising
the sequence of SEQ ID NO: 85. To facilitate measuring the
HNF4.alpha. activity, the nucleic acid segment comprising the
sequence of SEQ ID NO: 85 or the HNF4.alpha. polypeptide may
comprise a detectable label. In other embodiments, the standard
activity profile of an HNF polypeptide is determined by determining
the ability of an HNF1.alpha. polypeptide to stimulate
transcription of a reporter gene, the reporter gene operatively
positioned under control of a nucleic acid segment comprising the
sequence of SEQ ID NO: 1. In other embodiments, the standard
activity profile of an HNF polypeptide is determined by determining
the ability of an HNF4.alpha. polypeptide to stimulate
transcription of a reporter gene, the reporter gene operatively
positioned under control of a nucleic acid segment comprising the
sequence of SEQ ID NO: 78. Similar assays are contemplated for
HNF1.beta. polypeptide.
[0024] The invention also contemplates methods of screening for
modulators of HNF polypeptide function comprising: obtaining an
HNF1.alpha., HNF1.beta. or HNF4.alpha.-encoding nucleic acid
segment; determining a standard transcription and translation
activity of the HNF1.alpha., HNF1.beta. or HNF4.alpha.-encoding
nucleic acid sequence; contacting the HNF1.alpha. or
HNF4.alpha.-encoding nucleic acid segment with a putative
modulator; maintaining the nucleic acid segment and putative
modulator under conditions that normally allow for HNF1.alpha. or
HNF4.alpha. transcription and translation; and assaying for a
change in the transcription and translation activity.
[0025] The inventors discovery allows for the preparation of a host
of HNF modulators such as MODY3/HNF1.alpha.-modulators,
MODY4/HNF1.beta.-modulat- ors and MODY1/HNF4.alpha. modulators.
Such modulators themselves are within the scope of the invention.
Such an HNF modulator may be prepared or preparable by a process
comprising screening for modulators of HNF function comprising:
obtaining an HNF polypeptide; determining a standard activity
profile of the HNF polypeptide; contacting the HNF polypeptide with
a putative modulator; and assaying for a change in the standard
activity profile. An HNF modulator prepared by a process comprising
screening for modulators of HNF function comprising: obtaining an
HNF-encoding nucleic acid segment; determining a standard
transcription and translation activity of the HNF-nucleic acid
sequence; contacting the HNF-encoding nucleic acid segment with a
putative modulator; maintaining the nucleic acid segment and
putative modulator under conditions that normally allow for HNF
transcription and translation; and assaying for a change in the
transcription and translation activity.
[0026] Some aspects of the invention relate to isolated and
purified polynucleotides encoding an HNF polypeptide. Such
polynucleotides can be: an HNF1.alpha.-encoding nucleic acid,
HNF1.beta.-encoding nucleic acid sequence, or an
HNF4.alpha.-encoding nucleic acid. In some particular embodiments,
the polynucleotide encodes an HNF1.alpha. having an amino acid
sequence as set forth in SEQ ID NO: 127. In preferred embodiments,
the polynucleotide may be an HNF1.alpha.-encoding nucleic acid
sequence has a sequence of SEQ ID NO:126. In additional particular
embodiments, the polynucleotide encodes an HNF1.beta. having an
amino acid sequence as set forth in SEQ ID NO:139. In preferred
embodiments, the polynucleotide may be an HNF1.beta.-encoding
nucleic acid sequence having a sequence of SEQ ID NO:128. The
polynucleotide may encode an HNF4.alpha. having an amino acid
sequence as set forth in SEQ ID NO: 140. In preferred embodiments,
the polynucleotide may be an HNF4.alpha.-encoding nucleic acid
sequence has a sequence of SEQ ID NO: 130.
[0027] Other embodiments comprise isolated and purified nucleic
acid segments comprising 10, 14, 15, 25, 30, 35, 40, 45, 50, 55,
60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450,
or 500 contiguous nucleic acids identical to the sequence of SEQ ID
NO: 128 or SEQ ID NO: 126 or the complement of these sequences.
These nucleic acid segments can be used by those of skill in the
art as hybridization probes, PCR primers, for the expression of HNF
polypeptides, for the expression of other polypeptides, etc. In
some embodiments, the segment encodes a full-length HNF
polypeptide. Of particular interest are the promoters for
HNF1.alpha. and HNF1.beta., which are disclosed in SEQ ID NOS: 126
and 128 respectively and in FIGS. 26 and 27, respectively and
discussed elsewhere in this application. These promoters may be
used by those of skill in the art in many varying applications.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0029] FIG. 1. Pedigrees of MODY3 families. The individuals studied
in the Clinical Research Center at the University of Chicago are
indicated by MD-1-5 and 8-13 and those with NIDDM, IGT and NGT are
shown by black symbols, shaded symbols and open symbols,
respectively. The asterisks indicate that these individuals have
inherited the at-risk haplotype associated with MODY3 in that
family. The genotypes and haplotypes for the P family have been
described (Menzel et al., 1995) and the pairwise lod score between
MODY and the D12S76/D12S321 haplotype in this family is 2.06 at a
recombination fraction of 0.00. The pairwise lod score between MODY
and D12S76 in pedigree F549 is 0.65 at a recombination fraction of
0.00 (Vaxillaire et aL.,1995). The pedigrees BDA1 and BDA12 have
not been previously described. MODY co-segregates with markers
tightly linked to MODY3 in these families with pairwise lod scores
between MODY and D12S86 of 1.94 and 0.60, respectively, at a
recombination fraction of 0.00.
[0030] FIG. 2. Average glucose (A), insulin (B) and insulin
secretion rate (ISR) (C) profiles in 7 diabetic MODY3 subjects
(.quadrature.), 6 nondiabetic MODY3 subjects (.tangle-solidup.) and
6 control subjects (o), during the stepped glucose infusion
studies. After a 30 min period of baseline sampling, glucose was
infused at rates of 1, 2, 3, 4, 6, and 8 mg-kg.sup.-1-min.sup.-1.
Each infusion rate was administered for a period of 40 min and
glucose, insulin and C-peptide were measured at 10, 20, 30 and 40
min into each period.
[0031] FIG. 3. Relationship between average plasma glucose
concentrations and ISR's during the stepped glucose infusion
studies in 7 diabetic MODY3 subjects (.quadrature.), 6 nondiabetic
MODY3 subjects (.tangle-solidup.) and 6 control subjects (o). The
lowest glucose levels and ISR's were measured under basal
conditions, and subsequent levels were obtained during glucose
infusion rates of 1, 2, 3, 4, 6 and 8 mg kg.sup.-1-min.sup.-1,
respectively.
[0032] FIG. 4. Graded intravenous glucose infusions were
administered to 6 controls (A), 6 nondiabetic MODY3 subjects (B)
and 7 diabetic MODY3 subjects (C) after an overnight fast (baseline
(.tangle-solidup.)) and after a 42-h intravenous infusion of
glucose (postglucose (.quadrature.)) at a rate of 4-6 mg
kg.sup.-1-min.sup.-1.
[0033] FIG. 5A, FIG. 5B, FIG. 5C, FIG. 5D, FIG. 5E, FIG. 5F and FIG
5G. MODY3 pedigrees showing co-segregation of mutant HNF Ice allele
with diabetes mellitus. Males are noted by square symbols and
females by circles. Individuals with NIDDM are noted by black
symbols and those with gestational-onset diabetes or impaired
glucose tolerance by shaded symbols. A diagonal line through the
symbol indicates that the individual is deceased.
[0034] The individual ID is noted at the top right corner of each
symbol and the HNF1.alpha. genotype, if determined, noted below: N,
normal allele; M, mutant allele. The arrow indicates the individual
from each pedigree who was screened for mutations. Note that some
individuals have inherited the mutant allele but do not yet have
NIDDM, usually because of their young age (e.g. P pedigree,
individual IV-6; and Ber pedigree, individual V-2. Also, some
individuals have NIDDM even though they did not inherit the mutant
HNF1.alpha. allele segregating in that family (e.g. Ber pedigree,
individual II-2). Such heterogeneity has been noted previously
(Bell et al, 1991) and is a reflection of the high prevalence of
NIDDM.
[0035] FIG. 6. The involvement of hepatocyte nuclear factors in
diabetes.
[0036] FIG. 7. An alignment of the HNF4.alpha. protein sequence
from humans (h) with sequences from human, mouse (m), Xenopus (x)
and Drosophila (d) species. The putative DNA binding sites are
underlined and the putative ligand binding sites are in bold.
[0037] FIG. 8A, FIG. 8B, FIG. 8C, FIG. 8D FIG. 8E, FIG. 8F, FIG.
8G, FIG. 8I, FIG. 8H, FIG. 8I. The DNA sequences for exon 1, exon
2, exon 3, exon 4, exon 5 exon 6 exon 7 exon 8 exon 9 and exon 10
of HNF4.alpha..
[0038] FIG. 9. Physical map of the MODY3 region of chromosome 12.
YAC, BAC (b) and PAC (p) clones are represented as lines, the
length of which reflects the number of included STSs and not the
actual size. The physical distance between adjacent STSs has not
been determined directly and STSs for which the order has not been
unambiguously determined are indicated in brackets. A circle
indicates that the clone was positive for the indicated STS and a
square indicates a STS derived from the end of that specific clone.
Several YACs contain large internal deletions which are noted by
brackets. The STSs are from GDB.TM. and the GenBank STS
databases.
[0039] FIG. 10. Partial sequence of exon 4 of the HNF-1.alpha. gene
of individual EAI (Edinburgh pedigree). The sequences of the normal
and mutant alleles are shown. There is an insertion of a C in codon
291 (noted by the arrowhead) in the mutant allele resulting in a
frameshift and premature termination.
[0040] FIG. 11. The cDNA sequence of HNF1.alpha. denoting position
of the exons.
[0041] FIG. 12. Model of the human HNF-4.alpha. showing the
different patterns of alternative splicing and structures of the
different forms of HNF-4.alpha. that can be generated by
alternative splicing. The amino acids that define the boundaries of
some of the regions of the protein are shown. DBD and LBD
correspond to the DNA and ligand-binding domains of HNF-4.alpha.,
respectively.
[0042] FIG. 13. Comparison of the sequences of the promoter regions
of the human and mouse HNF-4.alpha. genes (SEQ ID NO: 135 and SEQ
ID NO: 137, respectively). Identical residues are shown in boxes.
The binding sites for transcription factors that may regulate the
expression of HNF-40.alpha. are overlined. The asterisk notes the
predicted transcriptional start site based on the study of the
mouse HNF-4.alpha. gene (Zhong et al., 1994). The minimal promoter
region required for high-level expression of the mouse gene in
hepatoma cells is shown by shading. The ATG codon which defines the
start of translation is noted. The arrowhead shows the DNA
polymorphism found in the promoter region of the proband of family
J2-96. The GenBank accession nos. for the mouse promoter sequence
are S74519 and S77762.
[0043] FIG. 14A and FIG. 14B. Partial sequence of exon 4 of
HNF4.alpha. gene of patient J2-21. The sequences of the normal
(FIG. 14A SEQ ID NO: 141 and corresponding amino acids SEQ ID NO:
142) and mutant (FIG. 14B; SEQ ID NO: 143) alleles are shown and
the arrow indicates the C.fwdarw.T substitution at codon 127.
[0044] FIG. 15. Pedigrees of Japanese families with
mutations/polymorphisms in the HNF-4.alpha. gene. Individuals with
diabetes are noted by filled symbols and nondiabetic (or not
tested) individuals are indicated by open symbols. The arrow
indicates the proband. The clinical features of each subject are
shown including age at diagnosis, present age and present
treatment. The HNF4.alpha. genotype of tested individuals is noted:
N-normal and M-mutation/polymorphism.
[0045] FIG. 16. Identification of a nonsense mutation in the
HNF4.alpha. gene in a german family, the Dresden-11 pedigree. The
members of this family with MODY and impaired glucose tolerance are
indicated with black and shaded symbols, respectively. The age at
diagnosis of diabetes mellitus, present age and therapy (OHA, oral
hypoglycemic agents), and nature of complications (M, macrovascular
disease; R, retinopathy; and N, peripheral polyneuropathy) are
indicated. The haplotype associated with MODY in this family is
shown.
[0046] FIG. 17. Partial sequence of exon 4 of the HNF4.alpha. gene
of subject II-4 of the Dresden-11 pedigree. The R154X mutation is
indicated (SEQ ID NO:144 and SEQ ID NO: 145). Intron 4 follows the
Gln codon, CAG.
[0047] FIG. 18A, FIG. 18B, FIG. 18C and FIG. 18D. Oral glucose
tolerance testing in the Dresden-11 family. The blood glucose (FIG.
18A), insulin (FIG. 18B), C-peptide (FIG. 18C) and proinsulin (FIG.
18D) levels during the course of the glucose tolerance test are
shown. The open symbols are the means.+-.SEM for subjects with the
R154X mutation, including those with diabetes and impaired glucose
tolerance, and the filled symbols are the means for the two normal
subjects.
[0048] FIG. 19A, FIG. 19B, FIG. 19C and FIG. 19D. Effect of bolus
and infusion of arginine, of glucose, and of arginine during
hyperglycernic clamp on plasma concentration of glucose (FIG. 19A),
insulin (FIG. 19B), C-peptide (FIG. 19C), and glucagon (FIG. 19D)
in 3 groups of subjects of the RW pedigree.
[0049] FIG. 20A and FIG. 20B. Acute insulin (FIG. 20A) and
C-peptide (FIG. 20B) response to bolus administration of arginine
in 3 groups of subjects of the RW pedigree at baseline and during
the hyperglycemic clamp procedure. The slope of the line connecting
these insulin responses (slope of potentiation) was lower in ND[+]
vs. ND[-], p <0.001. The slope for D[+] was lowest.
[0050] FIG. 21. MODY pedigree, Italy-1. Subjects with MODY and
impaired glucose tolerance are indicated by filled and
cross-hatched symbols, respectively. Nondiabetic subjects (by
testing or history) are indicated by open symbols. The clinical
features of the subjects are noted below the symbol including
current treatment: insulin or oral hypoglycemic agent (OHA). The
haplotype at the markers D12S321-D12S76-UC-39 is shown and the
at-risk haplotype is noted by shading. The HNF-1.alpha. genotype is
shown: N, normal; M, mutant (A.fwdarw.C substitution at nucleotide
-58). Although treated insulin, subject III-9 fasting C-peptide
value of 1.2 ng/ml indicating that she has MODY rather than
insulin-dependent diabetes mellitus.
[0051] FIG. 22. Comparison of the sequence of the promoter region
of the human, rat, mouse, chicken and frog HNF-1.alpha. a genes
(SEQ ID NO:134; SEQ ID NO:138; SEQ ID NO:136; SEQ ID NO:132; SEQ ID
NO:133 respectively). The A.fwdarw.C substitution at nucleotide -58
and HNF-4.alpha. binding site are shown. Residues identical to the
human sequence are boxed. Nucleotides are numbered relative to the
transcriptional start site of the human gene (indicated by an
asterisk). The boxed ATG triplet is the initiating methionine. The
dashes indicate gaps introduced in the sequences to generate this
alignment.
[0052] FIG. 23. Summary of mutations in the human HNF-1.alpha.
gene. This cartoon shows the exons and promoter region as boxes.
The mutations and amino acid polymorphisms are from Yamagata et
al., 1996; Lehto M, et al., 1997; Kaisaki P J, et al., 1997;
Vaxillaire et al., 1997; Frayling et al., 1997; Hansen T, et al.,
1997; Urhammer et al., 1997; Glucksmann et al., 1997. The amino
acid polymorphisms are I/L27, A/V98 and S/N487. The single-letter
abbreviations for the amino acids are used.
[0053] FIG. 24 Partial sequence of exon 2 of HNF-1.beta. gene of
subject J2-20 (SEQ ID NO: 146 and SEQ ID NO: 147). The C.fwdarw.T
mutation in codon 177 is indicated.
[0054] FIG. 25. J2-20 pedigree. Individuals with diabetes mellitus
are noted by filled symbols. The arrow indicates the proband. The
present age, age at diagnosis, current treatment and complications
are shown. The HNF-1.beta. genotype is noted: N, normal; M, mutant.
OHA, oral hypoglycemic agent; PDR, proliferative diabetic
retinopathy; CRF, chronic renal failure; and DKA, diabetic
ketoacidosis.
[0055] FIG. 26A-FIG. 26M Partial sequence of human HNF1.alpha.
gene. These figures depict a contiguous sequence and have been
split into panels due to the size of the sequence. The nucleotide
and predicted amino acid sequences are shown. Exon and intron
sequences are in uppercase and lower cases respectively. The
approximate size of the gaps in the introns, the complete sequence
of which was not determined are noted. In the promoter region,
potential binding sites for transcription factors that may regulate
expression of this gene are indicated, with sites identified by
Dnase footprinting in italics, those identified by sequence
homology in normal type. The minimal promoters region is shown in
boldface type. The polymorphisms and mutations in the HNF1.alpha.
gene identified to date are shown in boldface type with the
designation of the mutation noted. The asterisk notes the predicted
transcriptional start site based on studies of rat HNF1.alpha.
gene. The letter n indicates that the sequence was ambiguous at
this site
[0056] FIG. 27A-FIG. 27I Partial sequence of human HNF1.beta. gene.
These figures depict a contiguous sequence and have been split into
panels due to the size of the sequence. The nucleotide and
predicted amino acid sequences are shown. Exon and intron sequences
are in uppercase and lower cases respectively. The approximate size
of the gaps in the introns, the complete sequence of which was not
determined are noted. In the promoter region, potential binding
sites for transcription factors that may regulate expression of
this gene are indicated, with sites identified by Dnase
footprinting in italics, those identified by sequence homology in
normal type.
[0057] FIG. 28A-FIG. 28V Partial sequence of human HNF4.alpha.
gene. These depict a contiguous sequence and have been split into
panels due to the size of the sequence. The nucleotide and
predicted amino acid sequences are shown. Exon and intron sequences
are in uppercase and lower cases respectively.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0058] The present invention concerns the early detection,
diagnosis, prognosis and treatment of diabetes. The present
invention describes for the first time mutations responsible for
HNF1.alpha., HNF1.beta. and HNF4.alpha.-related diabetes. The
specific mutation and identity of the corresponding wild-type genes
from diabetic subjects, are disclosed. These mutations are
indicators of HNF1.alpha., HNF1.beta. and HNF4.alpha. related
diabetes and are diagnostic of the potential for the development of
diabetes. It is envisioned that the techniques disclosed herein
will also be used to identify other gene mutations responsible for
other forms of diabetes.
[0059] Those skilled in the art will realize that the nucleic acid
sequences disclosed will find utility in a variety of applications
in diabetes detection, diagnosis, prognosis and treatment. Examples
of such applications within the scope of the present invention
include amplification of markers of MODY using specific primers;
detection of markers of HNF1.alpha., HNF1.beta. and HNF4.alpha. by
hybridization with oligonucleotide probes; incorporation of
isolated nucleic acids into vectors and expression of
vector-incorporated nucleic acids as RNA and protein; development
of immunologic reagents corresponding to gene encoded products; and
therapeutic treatment for the identified MODY using these reagents
as well as, anti-sense nucleic acids, or other inhibitors specific
for the identified MODY. The present invention further discloses
screening assays for compounds to upregulate gene expression or to
combat the effects of the mutant HNF1.alpha., HNF1.beta. and
HNF4.alpha. genes.
A. Diabetes and Mody
[0060] Diabetes mellitus affects approximately 5% of the population
of the United States and over 100 million people worldwide (King et
al., 1988, Harris et al., 1992). A better way of identifying the
populace who are at risk of developing diabetes is needed as a
subject may have normal plasma glucose compositions but may be at
risk of developing overt diabetes. These issues could be resolved
if it were possible to diagnose susceptible people before the onset
of overt diabetes. This is presently not possible with subjects
having classical diabetes due to its multifactorial nature.
[0061] MODY is a monogenic form of diabetes and thus the genes
responsible can be more easily studied than those whose mutation
contributes to the development of polygenic form(s) of this
disorder such as type 1 and type 2 diabetes mellitus. Recent
studies have shown that subjects with maturity onset diabetes of
the young (MODY), a subset of diabetes characterized by diabetes in
the first or second decade of life and autosomal dominant
inheritance have shown that MODY may result from mutations in genes
on chromosome 20 (HNF4.alpha./MODY1), chromosome 7
(glucokinase/MODY2) chromosome 12 (HNF1.alpha./MODY3) and
chromosoem 17 (HNF1.beta./MODY4).
[0062] The clinical characteristics that manifest in HNF4.alpha.,
HNF1.alpha. and HNF1.beta. type diabetes resemble those seen in
patients with type 2 diabetes. These characteristics include
frequent severe fasting hyperglycemia, the need for oral
hypoglycemic agents, eventual insulin requirements, and vascular
and neuropathic complications (Fajans et al., 1994; Menzel et al.,
1995).
[0063] The inventors have shown that prediabetic subjects with
mutations in the HNF1.alpha. and HNF4.alpha. genes have subtle but
important alterations in the normal pattern of glucose-stimulated
insulin secretion. Compared to control subjects with no family
history of diabetes, they had normal insulin secretion rates at
lower glucose concentrations. However the increase in insulin
secretion rate resulting from an increase in the plasma glucose
concentration above 8 mM was less in prediabetic
HNF1.alpha.-mutation subjects than controls (see FIG. 2-FIG.
4).
[0064] Exposure of the normal .beta.-cell to increased plasma
glucose concentrations for 42-hours results in an increase in
.beta.-cell responsiveness to a subsequent glucose stimulus.
Following a 42-hr glucose infusion which raised the plasma glucose
concentration to an average value of 7.1.+-.1.4 mM, the insulin
secretion rate of prediabetic HNF1.alpha.-mutation subjects
increased by 35% between 5-9 mM glucose with a resultant shift in
the dose-response curve to the left. Five out of six prediabetic
HNF1.alpha.-mutation subjects showed this increase in insulin
secretion rate, and only one subject MD13 failed to demonstrate
this effect. The magnitude of this priming effect of glucose was
similar to that seen in the controls.
[0065] Diabetic HNF1.alpha.-mutation subjects demonstrated
diminished insulin secretion across the entire range of glucose
concentrations studied. Thus, over the concentration range between
5 and 9 mM glucose, the diabetic subjects secreted 50% less insulin
than the controls and 51% less than the prediabetic
HNF1.alpha.-mutation subjects. Furthermore, the priming effect of
glucose was lost in the subjects with overt diabetes.
[0066] Evaluation of insulin resistance indicated that
HNF1.alpha.-mutation subjects were no more resistant than the
controls. In fact, there was a tendency towards a lesser degree of
insulin resistance in the HNF1.alpha.-mutation subjects, making it
highly unlikely that insulin resistance plays a primary role in the
pathophysiology of diabetes in these subjects.
[0067] The inventors have recently characterized insulin secretory
responses in prediabetic HNF4.alpha. and HNF1.alpha.-mutation
subjects. Prediabetic HNF4.alpha. and HNF1.alpha.-mutation subjects
both have reduced insulin secretory responses to glucose which are
evident only as the plasma glucose rises above a threshold of 7 or
8 mM, respectively. Whereas in HNF1.alpha.-mutation subjects the
priming effect of glucose on insulin secretion is retained, a
low-dose glucose infusion did not have any significant effects on
insulin secretion in prediabetic HNF4.alpha.-mutation subjects
(Byrne et al., 1995b). In subjects with mutations in the
glucokinase gene, the dose-response curve is shifted to the right
and ISR is markedly decreased at glucose concentrations below 7 mM,
but insulin secretion continues to increase with increasing plasma
glucose concentrations even above levels of 8 mM. The priming
effect of glucose on insulin secretion also is preserved (Byrne et
al., 1994). The inventors have recently performed similar studies
in subjects with classical Type 2 and impaired glucose tolerance.
In subjects with IGT, although the dose-response curve relating
glucose and insulin secretion was shifted to the right, the priming
effect of glucose on insulin secretion was retained. In subjects
with overt Type 2 diabetes, the increase in insulin secretion in
response to an increase in glucose was markedly reduced and the
priming effect of glucose on insulin secretion was lost.
[0068] It thus appears that .beta.-cell dysfunction plays an
important, pathophysiologic role in the development of the three
forms of MODY which have been characterized to date. A clear
prediabetic phase has not been identified in subjects with
glucokinase mutations. However, profound defects in the ability of
the .beta.-cell to respond to a glucose stimulus is present even in
the face of the mild elevations in glucose which characterizes the
majority of these subjects. By contrast, a prediabetic phase is a
feature of the HNF4.alpha. and HNF1.alpha. forms of diabetes. These
prediabetic subjects have reduced insulin secretory responses to
elevated concentrations of glucose induced by the step-wise glucose
infusion prior to onset of diabetes. Prediabetic HNF4.alpha. and
HNF1.alpha. subjects can be distinguished based on the effects of a
low dose glucose infusion on insulin secretion. The priming effect
of glucose on insulin secretion is retained in HNF1.alpha. subjects
in the prediabetic phase but is lost after the onset of overt
hyperglycemia whereas this priming effect is absent in HNF4.alpha.
diabetes even in the prediabetic phase of the disease. The severe
reductions in insulin secretory responses to glucose seen in the
overtly diabetic HNF1.alpha. subjects are likely to be due in part
to the effects of high glucose, in view of the well documented
adverse effects of hyperglycemia on insulin secretion. A full
understanding of the reasons for these changes in the dose-response
relationships between glucose and insulin secretion requires a
better understanding of the roles of HNF4.alpha. and HNF1.alpha. in
regulating normal pancreatic b-cell function.
[0069] Further studies by the inventors have shown that elevations
in the 2-hr post-challenge blood glucose levels predict alterations
in insulin secretory responses to glucose. However, in that case,
subjects with impaired glucose tolerance demonstrated reduced
insulin secretory responses over a range of glucose concentrations
and not just in response to increases in glucose above 8 mM as was
seen in the prediabetic HNF1.alpha.-mutation subjects. Thus, the
inventors do not believe that the alterations in insulin secretion
seen in the prediabetic HNF1.alpha. subjects resulted from the
modest elevations in glucose. Rather, the inventors' results
suggest that the percent priming and overall insulin secretion
rates deteriorate as glucose tolerance deteriorates, and the lack
of ability to increase insulin secretion at high glucose levels is
a feature of the mutation in the HNF1.alpha. gene.
[0070] From the studies described above and in the Examples that
follow it is clear that the identification and characterization of
the gene(s) associated with MODY diabetes is important. Mutations
in such genes lead to diabetes and it would be diagnostically and
therapeutically advantageous to identify the mutations in subjects
predisposed to such mutations.
[0071] Studies attempting to find the location of the MODY3 gene
showed that the putative gene linked to MODY3 type diabetes was
localized to a 5 cM interval between the markers D12S86 and
D12S807/D12S820 (Menzel et al., 1995). However the identity of the
gene has not been elucidated. The present invention for the first
time shows that the gene linked to MODY3 expresses a factor
previously identified from-hepatocyte known as hepatocyte nuclear
factor 1.alpha. herein referred to as HNF1.alpha..
[0072] Similarly studies attempting to find the location of the
MODY1 gene showed that the putative gene linked to MODY1 type
diabetes was localized to a 13 cM interval between the markers
D20S169 and D20S176 (Stoffel et al., 1996). Likewise, as with
MODY3, the identity of the gene in MODY1 has not been elucidated.
The present invention for the first time shows that the gene linked
to MODY1 expresses a factor previously identified from hepatocytes
known as hepatocyte nuclear factor 4 .alpha. herein referred to as
HNF4.alpha..
[0073] Subsequently, the inventors performed studies to elucidate
the genetic defects responsible for other forms of MODY. The
present invention for the first time shows that MODY is likely a
consequence of mutations in hepatocyte nuclear factor 1.beta.
herein referred to as HNF1.beta..
[0074] The association of mutation in HNF1.alpha., HNF1.beta. and
HNF4.alpha. with diabetes indicates the importance of the HNF
network in controlling pancreatic .beta.-cell function and glucose
homeostasis. Hence the studies presented here have categorized
exemplary mutations in the HNF1.alpha., HNF1.beta. and HNF4.alpha.
genes as identified by PCR techniques. These landmark results form
the basis of many therapeutic and diagnostic techniques as measures
to alleviate diabetes, particularly HNF 1.alpha.-diabetes, HNF
1.alpha.-diabetes and HNF 4.alpha.-diabetes.
B. Hepatocyte Nuclear Factors are the Genes Linked to Mody Type
Diabetes
[0075] Hepatocyte Nuclear Factor 1.alpha.
[0076] Hepatic nuclear factor 1.alpha. (also known as APF, LFB1 or
HP1) has been described as a sequence specific DNA binding protein
from rat liver. It is thought to interact with promoter elements
present in many genes including albumin, .alpha.- and
.beta.-fibrinogen, .alpha.-1-antitrypsin, .alpha.-fetoprotein
pyruvate kinase, transthyretin and aldose B among others.
HNF1.alpha. has been purified from rat liver extracts by DNA
affinity chromatography using fibrinogen promoter element
(Courtoise, 1987) and was characterized as a single 88 kDa protein.
It is now known that HNF1.alpha. is a transcription factor.
[0077] Mendel and Crabtree (1993) suggested that HNF1.alpha.
interacted with "hepatocyte-specific" genes in which it plays a
prominent role in regulation of both in vitro and in vivo
transcription. However, it was later shown that HNF1.alpha. mRNA
can also be found in several non-hepatocyte tissues including the
kidney stomach, intestines, thymus and spleen and pancreas
(Baumhueter et al., 1990; Kuo et al., 1990). This suggests that
HNF1.alpha. expression may participate in the differentiation of
non-hepatic organs as well as hepatogenesis.
[0078] Transcription factors are proteins that control
transcription by binding to cis-acting regulatory DNA sequences in
a gene. As such, these factors play a crucial role in development
and differentiation by dictating the pattern of expression of genes
within specific cells and tissues.
[0079] The homeodomain proteins are a class of transcription
factors. These proteins all possess the unusual characteristic of
having very similar DNA-binding domains even though they mediate
diverse effects. HNF1.alpha. is an example of a homeodomain
protein. HNF1.alpha. has been shown to dimerize with itself in
solution. It appears that maximal transcriptional activation by
HNF1.alpha. requires a novel dimerization cofactor. This cofactor,
known as the dimerization cofactor of HNF1.alpha. (DCoH), does not
in itself bind DNA, rather, it binds HNF1.alpha..
[0080] HNF1.alpha. binds to DNA as a dimer; this was confirmed from
studies on the purification and cloning of HNF1.alpha.. Other
studies showed that there was a DNA binding protein that binds to
the HNF1.alpha. binding site in cells that lacks the HNF1.alpha.
mRNA. This second protein HNF1.beta. is a homolog of HNF1.alpha.
but is the product of a separate gene.
[0081] Regulation studies of the HNF1.alpha. promoter showed that
binding sites for transcription factors HNF3, AP1 and HNF4.alpha.
are essential for the expression of HNF1.alpha. (Hansen and
Crabtree, 1993). It has been demonstrated that HNF4.alpha. is
located on chromosome 20 of the human genome. The present inventors
suggest that MODY1, which is known to be linked to chromosome 20,
may act as a regulator of MODY3 gene expression as such mutations
in HNF4.alpha. may be responsible for MODY 1 form of diabetes.
[0082] HNF1.alpha. proteins possess three functional regions,
namely, the dimerization, activation and DNA-binding domains. The
dimerization domain is localized to the first 32 amino acids of the
HNF1.alpha. proteins. The DNA-binding domain is a POU-like
homeodomain which binds to a 13 bp palindromic DNA sequence in the
promoters of HNF1.alpha. binding proteins (Courtois et al., 1988;
Frain et al., 1989). The consensus sequence for this HNF1.alpha.
binding site on these genes is:
[0083] GTTAATNATTACC (SEQ ID NO:9)
[0084] Diabetes mellitus alters the transcription of numerous genes
in many different tissues. The mechanisms underlying these
alterations in transcription are largely unknown. One example of
altered transcription is seen in the reduced transcription of the
albumin gene in diabetes (Wanke et al., 1991). Recently, it has
been demonstrated that HNF1.alpha. protein levels are reduced in
diabetes, leading to the theory that decreased gene transcription
in diabetes is due to decreased levels of HNF1.alpha. a factor
critical for the regulation of hepatic albumin gene expression.
This is thought to be the case in other genes that posses an
HNF1.alpha. binding site and are affected by diabetes. Therefore
changes in the abundance of HNF1.alpha. in diabetes appears to
affect the expression of genes whose expression is predominantly
regulated by this factor.
[0085] The expression of the insulin gene in adult mammals is
localized to the .beta. cells in the pancreatic islets. Studies of
this gene have defined a small region in the promoter, the
FF-minienhancer, capable of conferring tissue-specific and glucose
responsive transcriptional activity on a heterologous promoter
(German et al., 1990). This minienhancer region is composed of two
primary regulatory elements the Far box and the FLAT element which
interact to upregulate transcription.
[0086] Further analysis of the FLAT element showed it to be a
cluster of several cis loci that mediate discrete positive and
negative effects. The positive locus is characterized as FLAT-F and
its activity is only revealed when there is a mutation in the
negative locus FLAT-E. This FLAT-F region is able to specifically
bind a number of DNA-binding proteins. The sequence of FLAT-F has
significant similarity to the consensus sequence of HNF1.alpha..
This led to studies to determine whether HNF1.alpha. itself may
play a role in the transcriptional regulation of the rat insulin
gene. Subsequently, it was shown that HNF1.alpha. expression is
present in the pancreatic .beta.-cell derived insulinoma cell line
HIT. HNF1.alpha. has been shown to bind with and transactivate rat
insulin gene enhancers that contain an HNF1.alpha. site.
[0087] Hepatocyte Nuclear Factor 4.alpha.
[0088] Hepatocyte nuclear factor 4.alpha. (HNF4.alpha.) is another
transcription factor first associated with the liver and having
limited tissue distribution (Xanthopoulos et al., 1991; Zhong et
al., 1994). HNF4.alpha. can activate transcription in several
non-hepatic cell lines, indicating that no liver-specific
modification is required for its function (Sladek et al.,
1990).
[0089] It has been observed that there is an apparent contradiction
between the molecular mass of HNF4.alpha. predicted from the
primary sequence (50.6 kDa) (Sladek et al., 1990) and that
determined by gel electrophoresis (54 kDa) suggesting that this
difference may be due to post-translational modification(s). Of the
many types of post-translational modifications that might regulate
gene expression, most attention has been focused on
phosphorylation, which can influence transcription factor activity
in many ways (Hunter and Karin, 1992).
[0090] Three main levels of regulation have been described:
phosphorylation can affect the DNA-binding activity (Boyle et al.,
1991; Segil et al., 1991; Shuai et al., 1994), the transcriptional
activation potential (Yamamoto et al., 1988; Trautwein et al.,
1993), or the translocation of a transcription factor from the
cytoplasm into the nucleus (Metz and Ziff, 1991; Kerr et al., 1991;
Schindler et al., 1992; Shuai et al., 1992). These possibilities
are by no means mutually exclusive, and in principle
phosphorylation can be responsible for simultaneous regulation at
several distinct levels. With the exception of certain signal
transduction proteins (Darnell et al., 1994), all examples of this
type of regulation have involved phosphorylation at serine or
threonine residues.
[0091] It has been demonstrated that the activity of HNF4.alpha. is
post-translationally regulated by tyrosine phosphorylation,
providing an example of a non-signal-transduction factor modulated
by this modification. The HNF4.alpha. polypeptide (SEQ ID NO:79)
contains 12 tyrosine residues scattered throughout the DNA-binding,
dimerization, and putative ligand-binding domains (Sladek et al.,
1990) which could be potential phosphorylation sites. It seems that
the tyrosine phosphorylation of HNF4.alpha. is required for its
DNA-binding activity. It has been shown that the transcriptionally
active form of HNF4.alpha. is localized in specific subnuclear
domains. This intranuclear distribution depends directly or
indirectly on tyrosine phosphorylation, suggesting the existence of
an additional control mechanism at the level of subnuclear
targeting playing a role in transcription regulation.
[0092] Hepatocyte nuclear factor 4.alpha. (HNF-4.alpha.) is a
positive-acting transcription factor which is expressed very early
in embryo development and is essential to liver development and
function (reviewed in Sladek, 1993 and Sladek, 1994). Mouse
HNF4.alpha. mRNA appears in the primary endoderm of implanting
blastocysts at embryonic day 4.5 and in the liver and gut primordia
at day 8.5 (Duncan et al., 1994), while mice deficient in
HNF4.alpha. do not survive past day 9 postcoitus (Chen et al.,
1994).
[0093] HNF4.alpha. has also been proposed to be responsible for the
final commitment for cells to differentiate into hepatocytes (Nagy
et al., 1994). In adult rodents, HNF4.alpha. is located primarily
in the liver, kidney. and intestine, and in insects HNF4.alpha. is
found in the equivalent tissues (Sladek et al., 1990; Zhong et al.,
1993). HNF4.alpha. is known to activate a wide variety of essential
genes, including those involved in cholesterol, fatty acid, and
glucose metabolism; blood coagulation; detoxification mechanisms;
hepatitis B virus infections; and liver differentiation (reviewed
in Sladek, 1993 and Sladek, 1994).
[0094] HNF4.alpha. is a member of the superfamily of
ligand-dependent transcription factors, which includes the steroid
hormone receptors, thyroid hormone receptor (TR), vitamin A
receptor, and vitamin D receptor (VDR), as well as a large number
of receptors for which ligands have not yet been identified, the
so-called orphan receptors (reviewed in Landers and Spelsberg,
1992; O'Malley and Conneely, 1992; Parker, 1993; and Tsai and
O'Malley, 1994). All receptors are characterized by two conserved
domains: the zinc finger region, which mediates DNA binding, and a
large hydrophobic domain which mediates protein dimerization,
transactivation, and ligand binding.
[0095] Whether HNF4.alpha. responds to a ligand is not known, but
it has been shown to activate transcription in the absence of an
exogenously added ligand (Hall et al., 1994;
[0096] Kuo et al., 1992; Metzger et al., 1993; Mietus et al., 1992;
Reijnen et al., 1992; Sladek et al., 1990). HNF4.alpha. is also
highly conserved with the Drosophila HNF4, containing 91% amino
acid sequence identity to the rat HNF4.alpha. in the DNA binding
domain and 68% identity in the large hydrophobic domain (Zhong et
al., 1993).
[0097] The members of the receptor superfamily have been classified
in a variety of ways, one of which is by their ability to dimerize
with themselves and with other members of the superfamily. For
example, the steroid hormone receptors, glucocorticoid,
mineralocorticoid, and progesterone receptors (GR, MR, and PR,
respectively), all bind DNA and activate transcription as
homodimers. They are present in the cytoplasm complexed with heat
shock proteins (HSP) until the presence of the appropriate ligand
disrupts the complex, allowing the receptors to translocate to the
nucleus (reviewed in Freedman and Luisi, 1993; O'Malley and Tsai,
1993; and Tsai and O'Malley, 1994). On the other hand, the retinoid
acid receptor (RAR) and retinoid X receptor (RXR) as well as the
VDR, peroxisome proliferator-activated receptor (PPAR), and TR,
which do not bind HSP and reside primarily in the nucleus, all bind
DNA and activate transcription not only as homodimers but also as
heterodimers (reviewed in Gigure, 1994; Parker, 1993; and
Stunnenberg, 1993). Several of the nuclear receptors bind DNA very
inefficiently, if at all, as homodimers (RXR.alpha., RAR, VDR, TR,
and PPAR) but bind DNA well as heterodimers (reviewed in Gigure,
1994 and Stunnenberg, 1993). At least two of the receptors (RAR and
TR) form heterodimers in solution with RXR.alpha. (Hermann et al.,
1992; Kurokawa et al., 1993; Zhang et al., 1992).
[0098] The most common dimerization partner for all of these
receptors is RXR.alpha.. The third class of receptors identified to
date reside in both the nucleus and the cytoplasm and bind DNA
preferentially as monomers (NGFI-B, FTZ-F1, steroidogenic factor 1
[SF-1], and ROR.alpha.1) (Gigure et al., 1995; Kurachi et al.,
1994; Ohno et al., 1994).
[0099] HNF4.alpha. is very similar to the retinoid receptors, in
particular to RXR.alpha., in both amino acid sequence and DNA
binding specificity. Mouse RXR.alpha. is 60% identical to rat
HNF4.alpha. in the DNA binding domain and 44% identical in the
large hydrophobic domain. In comparison, RAR.alpha., which readily
heterodimerizes with RXR.alpha., is 61% identical to RXR.alpha. in
the DNA binding domain and only 27% identical in the large
hydrophobic domain (Mangelsdorf et al., 1992). HNF4.alpha. and
RXR.alpha. have also been shown to share response elements from at
least six different genes as well as a consensus site of a direct
repeat of AGGTCA separated by one nucleotide (referred to as DR+1)
(Carter et al., 1994; Carter et al., 1993; Garcia et al., 1993; Ge
et al., 1994; Hall et al., 1994; Hall et al., 1992; Kekule et al.,
1993; Ladias, 1994; Lucas et al., 1991; Nakshatri and Chambon,
1994; Widom et al., 1992). The structural and functional
similarities of HNF4.alpha. and RXR.alpha. suggest that HNF4.alpha.
might heterodimerize with RXR.alpha. and/or other receptors.
[0100] Electrophoretic mobility shift analyses (EMSA) of
HNF4.alpha. and RXR.alpha. proteins expressed in vivo and in vitro
showed that HNF4.alpha. in fact does not heterodimerize with
RXR.alpha. on any one of a number of response elements and that
while HNF4.alpha. forms homodimers in solution in the absence the
DNA, it does not form heterodimers with RXR.alpha.. It has also
been shown that HNF4.alpha. does not heterodimerize with a number
of other receptors on DNA, suggesting that the lack of
heterodimerization is a general property of HNF4.alpha..
[0101] These studies led to the proposal that HNF4.alpha., defines
a new subfamily of nuclear receptors which are presently
exclusively in the nucleus, exist in solution, bind DNA as
homodimers, and do not form heterodimers with RXR.alpha. or other
receptors.
[0102] HNF4.alpha. is a member of the steroid hormone receptor
family. The members of this family have been classified according
to the amino acid sequence in the knuckle of the first zinc finger
(referred to as the P box) a region important for recognizing the
sequence of the half site of the palindrome in hormone response
elements (Forman and Samuels, 1990). For examples members of the
thyroid hormone receptor subfamily contain amino acid sequence
EGCKG (SEQ ID NO:83) and bind to the thyroid response element
(TRE). Members of the estrogen receptor subfamily contain the amino
acids EGCKA (SEQ ID NO:84) and bind to estrogen response elements
(ERE). The sequence of HNF4.alpha. is DGCKG (SEQ ID NO:85) and is
most similar to that of the thyroid response element. Despite this
similarity it appears that HNF4.alpha. does not bind TRE nor does
it bind ERE, and the true ligand for HNF4.alpha. is as yet
undetermined. The screening methods of the present invention will
lead one of ordinary skill in the art to elucidate such a ligand or
ligands.
[0103] The present invention describes the exon-intron organization
and partial sequence of the human HNF4.alpha. gene. In addition,
the inventors have screened the exons, flanking introns and minimal
promoter region for mutations in a group of 57 unrelated Japanese
subjects with early-onset diabetes/MODY of unknown cause. The
results of these screens suggest that mutations in the HNF4.alpha.
gene may cause early-onset diabetes/MODY in Japanese but they are
less common than mutations in the HNF1.alpha./MODY3 gene. The
information presented herein on the sequence of the HNF4.alpha.
gene and its promoter region will facilitate the search for
mutations in other populations and studies of the role of this gene
in determining normal pancreatic .beta.-cell function.
[0104] Furthermore, current understanding of the MODY1 form of
diabetes is based on studies of only a single family, the R-W
pedigree. Here the inventors report the identification of a second
family with MODY1 and the first in which there has been a detailed
characterization of hepatic function. The present inventors
demonstrate that MODY1 is primarily a disorder of .beta.-cell
function, however, the inventors have ascertained that mutations in
HNF4.alpha. may lead to .alpha.-cell as well as .beta.-cell
secretory defects or to a reduction in pancreatic islet mass.
[0105] Hepatic Nuclear Factor 1.beta. and DCoH
[0106] Human HNF1.beta. is a homeodomain-containing transcription
factor of 557 amino acids (type A) with alternative splicing
generating two other forms of 531 (type B) and 399 amino acids
(type C) (Mendel et al., 1991a; De Simone et al., 1991; Rey-Campos
et al., 1991; Bach and Yaniv, 1993). The nucleic and amino acid
sequences for human HNF1.beta. are given in SEQ ID NO:128 and SEQ
ID NO:129, respectively. HNF1.beta. is structurally related to
HNF1.alpha. and functions as a homodimer or a heterodimer with
HNF1.alpha.. These dimers are stabilized by the bifunctional
protein, DCoH/PCBD (Mendel et al., 1991b; Citron et al., 1992),
which binds to the dimerization domain of HNF1 forming a
heterotetrameric complex and enhancing transcriptional activity. As
a homotetramer, PCBD is involved in the regeneration of
tetrahydrobiopterin, an essential cofactor of phenylalanine
hydroxylase and other mono-oxygenases, catalyzing the conversion of
4-hydroxytetrahydrobiopterin to quinonoid-dihydrobiopterin (Citron
et al., 1993; Johnen et al., 1995). Loss of function mutations in
PCBD are associated with a rare autosomal recessive form of mild
hyperphenylalaninemia. HNF1.beta. and DCoH mRNA are expressed in
mouse pancreatic islets implying that they may function together
with HNF-1.alpha. to regulate gene expression in this tissue. Human
DCoH is a protein of 104 amino acids (including the initiating
methionine) (Thony et al., 1995) and functions as described herein
below.
[0107] MODY-Type Diabetes is a Manifestation of Defects in
Hepatocyte Nuclear Factors
[0108] It is established that all forms of Type 2 diabetes are
associated with profound insulin secretory defects which include
loss of the first phase response to intravenous glucose, delayed
and blunted responses to ingestion of a mixed meal, loss of the
normal oscillatory patterns of insulin secretion, and increased
secretion of proinsulin and proinsulin-like products. The molecular
basis of these secretory defects in humans is unknown, although in
rats it has been shown that there are global changes in gene
expression in the islets of diabetic and prediabetic animals. One
such global alteration is the reduction in the levels of mRNAs
encoding many pancreatic islet specific proteins. This defect in
gene expression would be compatible with decreased levels of a
master transcription factor whose levels affect the expression of a
whole array of downstream genes.
[0109] The present invention predicts that the .beta.-cell
dysfunction and insulin secretory defects associated with MODY3 are
as a result of mutations in HNF1.alpha., furthermore it
demonstrates that .beta.-cell dysfunction associated with MODY1 are
a result of mutations in HNF4.alpha..
[0110] The features of MODY-type diabetes are very similar to those
of late onset Type 2 diabetes. Hence, acquired defects in the
expression of HNF1.alpha., HNF4.alpha., and HNF1.beta.,
respectively, may well occur in late onset diabetes and lead to
.beta.-cell dysfunction and insulin secretory defects in this form
of diabetes. The identification of agents that activate
transcription of HNF1.alpha., HNF1.beta. and HNF4.alpha. will be
therapeutic for the treatment of MODY, as well as late onset Type 2
diabetes. The present invention details methods for the
identification of such agents which will then be used to increase
the expression of HNF1.alpha., HNF1.beta. and HNF4.alpha. which in
turn will lead to the increased transcription/expression or
activation of .beta.-cell genes such as insulin.
[0111] It is clear from the present invention that hepatocyte
nuclear factors, their expression, regulation and modification have
far reaching implications in diabetes. To date three of the four
types of MODY diabetes identified, are predicted to affect gene
expression. Other forms of MODY can not be ruled out, for example
genetic linkage studies predict the presence of additional MODY
genes, the chromosomal localization of which are presently
unknown.
[0112] The absolute HNF4.alpha. dependence of the HNF1.alpha.
promoter coupled with evidence of the ability of HNF4.alpha. to
rescue endogenous HNF1.alpha. expression is indicative of
HNF4.alpha. being an essential regulator of HNF1.alpha. (FIG. 6).
Thus activation or repression of HNF4.alpha. will result in an
indirect activation or repression of HNF1.alpha.. The present
invention elucidates methods for identifying factors responsible
for modulating HNF4.alpha. expression and/or activity.
[0113] HNF1.beta., also known as vHNF1, is closely related to
HNF1.alpha. and is able to form heterodimers with HNF1.alpha..
Dimerization between members of classes of transcription factors
appears to solve the problem of controlling expression of a very
large number genes. An obvious advantage of the dimerization
ability of a transcription factor is that it provides an
opportunity to diversify the number of regulatory mechanisms that
can be associated with a single regulatory DNA binding site.
Another advantage lies in the possibility of translating subtle
alterations in the relative levels of expression of members of a
dimerization pair into a substantial quantitative effect on
transcription.
[0114] FIG. 6 summarizes the different factors involved in the
regulation of expression and activity of the HNF transcription
factors described above. From the inventors investigations it is
conceivable that aberrations at any points along this pathway or
any factors affecting this pathway directly or indirectly will
result in .beta.-cell dysfunction and diabetes mellitus, either as
MODY or late-onset diabetes.
[0115] The present invention has shown that mutations in
HNF1.alpha. are clearly responsible for MODY3 type diabetes. As
discussed earlier HNF1.alpha. binds to DNA as a dimer. this can
either be a homodimer or a heterodimer with HNF1.beta. (SEQ ID NO:
80). The two forms of HNF1 are expressed in comparable amounts in
the liver but there is a three-fold higher expression of HNF1.beta.
in the kidney as compared to HNF1.alpha..
[0116] HNF1.alpha. lacks the transcriptional activity attributable
to HNF1.alpha.. One potential consequence of this observation in
combination with its ability to dimerize with HNF1.alpha. is that
HNF1.beta. is likely to be a negative regulator of HNF1.alpha.
transcriptional activity. This observation is suggested by the
presence of vHNF1 in systems that do not express the majority of
hepatocyte-specific gene products (Baumhueter et al., 1988).
However, studies by Mendel et al., (1991) were unable to confirm
this observation.
[0117] Studies by Mendel et al., (1991) indicated that a
dimerization cofactor of HNF1 (DCoH) may increase the stability of
HNF1.alpha. dimers. Thus, it is suggested that DCoH has the
potential to restrict the activity of HNF1.alpha. and/or
HNF1.beta.. There are a number of hypothesis as to how DCoH affects
HNF1 activation of transcription. HNF1.alpha. is a monomer in
solution and can only bind DNA as a dimer, the presence of DCoH
favors the formation of the dimeric HNF1.alpha.. Alternatively it
is plausible that DCoH induces a conformational change in
HNF1.alpha. to create a more potent transcriptional activator
either directly or by allowing interaction with other proteins, for
example HNF1.beta.. Yet another alternative is that DCoH decreases
the rate of HNF1.alpha. degradation thereby stabilizing HNF1.alpha.
and potentiating the effects of HNF1.alpha..
[0118] The present invention demonstrates that MODY4, which was
previously uncharacterized, is a manifestation of defects in
HNF1.beta.. The present invention describes specific mutations in
HNF1.beta. that have led to MODY4 in certain individuals. In light
of these observations, there are decribed herein methods for the
identification and isolation of factors involved in the activity of
HNF1.beta. and DCoH with a view to obtaining insights into
therapeutic intervention in diabetes.
C. In Vitro Screening Assays for Candidate Substances
[0119] Certain aspects of this invention concern methods for
conveniently evaluating candidate substances to identify compounds
capable of stimulating HNF1.alpha.-, HNF1.beta.- or
HNF4.alpha.-mediated transcription. Such compounds will be capable
of promoting gene expression, and thus can be said to have
up-regulating activity. In as much as increased gene expression of,
for example, the insulin gene in the body functions to alleviate
the symptoms of diabetes, any positive substances identified by the
assays of the present invention will be anti-diabetic drugs. Before
human administration, such compounds would be rigorously tested
using conventional animal models known to those of skill in the
art.
[0120] Successful candidate substances may function in the absence
of mutations in HNF1.alpha., HNF1.beta. or HNF4.alpha. in which
case the candidate compound may be termed a "positive stimulator"
of HNF1.alpha., HNF1.beta. or HNF4.alpha., respectively.
Alternatively, such compounds may stimulate transcription in the
presence of mutated HNF1.alpha., HNF1.beta. or HNF4.alpha.
overcoming the effects of the mutations, i.e., function to oppose
HNF1.alpha.-mutant, and/or HNF1.beta., and/or HNF4.alpha.-mediated
diabetes, and thus may be termed "an HNF1.alpha. mutant agonist"
"HNF1.beta. mutant agonist" or "HNF4.alpha. mutant agonist"
respectively. Compounds may even be discovered which combine all
three of these actions. Although the agonist class of compounds may
ultimately seem to be the most desirable, compounds of either class
will likely be useful therapeutic agents for use in stimulating
gene expression and combating MODY1, MODY3, MODY4, and late-onset
Type 2 diabetes in human subjects.
[0121] Candidates for HNF1.alpha.
[0122] As HNF1.alpha. is herein shown to be linked to MODY3 type,
one method by which to identify a candidate substance capable of
stimulating HNF1.alpha.-mediated transcription in diabetes is based
upon specific protein:DNA binding. Accordingly, to conduct such an
assay, one may prepare an HNF1.alpha. binding protein composition,
such as recombinant HNF1.alpha. and determine the ability of a
candidate substance to increase HNF1.alpha. protein binding to a
DNA segment including a complementary HNF1.alpha. binding sequence,
i.e., to increase the amount or the binding affinity of a
protein:DNA complex.
[0123] This generally would be achieved using two parallel assays,
one of which contains HNF1.alpha. and the specific DNA alone and
one of which contains HNF1.alpha., DNA and the candidate substance
composition. One would perform each assay under conditions, and for
a period of time, effective to allow the formation of protein:DNA
complexes, and one would then separate the bound protein:DNA
complexes from any unbound protein or DNA and measure the amount of
the protein:DNA complexes. An increase in the amount of the bound
protein:DNA complex formed in the presence of the candidate
substance would be indicative of a candidate substance capable of
promoting HNF1.alpha. binding, and thus, capable of stimulating
HNF1.alpha.-mediated transcription.
[0124] In such binding assays, the amount of the protein:DNA
complex may be measured, after the removal of unbound species, by
detecting a label, such as a radioactive or enzymatic label, which
has been incorporated into the original HNF1.alpha. protein
composition or recombinant protein or HNF1.alpha.-containing DNA
segment. Alternatively, one could detect the protein portion of the
complex by means of an antibody directed against the protein, such
as those disclosed herein.
[0125] Preferred binding assays are those in which either the
HNF1.alpha. protein, recombinant protein or purified composition or
the HNF1.alpha.-containing DNA segment is bound to a solid support
and contacted with the other component to allow complex formation.
Unbound protein or DNA components are then separated from the
protein:DNA complexes by washing and the amount of the remaining
bound complex quantitated by detecting the label or with
antibodies. Such DNA binding assays form the basis of
filter-binding and microtiter plate-type assays and can be
performed in a semi-automated manner to enable analysis of a large
number of candidate substances in a short period of time.
Electrophoretic methods, such as the gel-shift assay disclosed
herein, could also be employed to separate unbound protein or DNA
from bound protein:DNA complexes, but such labor-intensive methods
are not preferred.
[0126] Assays such as those described above are initially directed
to identifying positive stimulator candidate substances and do not,
by themselves, address the activity of the substance in the
presence of HNF1.alpha. mutants. However, such positive regulators
may also prove to act as HNF1.alpha. mutant agonists, and in any
event, would likely have utility in transcriptional promotion,
either in vitro or in vivo. Positive regulators would likely be
further evaluated to assess the effects of HNF1.alpha. mutants on
their action, for example, by employing a cellular reporter gene
assay such as those described herein below.
[0127] Virtually any candidate substance may be analyzed by these
methods, including compounds which may interact with HNF1.alpha.
binding protein(s), HNF1.alpha. or protein:DNA complexes, and also
substances such as enzymes which may act by physically altering one
of the structures present. Of course, any compound isolated from
natural sources such as plants, animals or even marine, forest or
soil samples, may be assayed, as may any synthetic chemical or
recombinant protein.
[0128] Another potential method for stimulating
HNF1.alpha.-mediated transcription is to prepare a HNF1.alpha.
protein composition and to modify the protein composition in a
manner effective to increase HNF1.alpha. protein binding to a DNA
segment including the HNF1.alpha. protein binding sequence. The
binding assays would be performed in parallel, similar to those
described above, allowing the native and modified HNF1.alpha.
binding protein to be compared. In addition to phosphatases and
kinases, other agents, including proteases and chemical agents,
could be employed to modify HNF1.alpha. binding protein. The
present invention, with the cloning of mutant HNF1.alpha. cDNA,
also opens the way for genetically engineering HNF1.alpha. protein
to promote gene transcription in diabetes. In this regard, the
mutation of potential phosphorylation sites and/or the modification
or deletion of other domains is contemplated.
[0129] Candidates for HNF4.alpha. Binding
[0130] The criteria shown above for screening of modulators of
HNF1.alpha. are also true of HNF4.alpha.. HNF4.alpha. is a member
of the steroid hormone receptor superfamily however, the ligand for
HNF4.alpha. is unknown. The identification of the endogenous ligand
for HNF4.alpha. binding would be an important step towards
elucidating the mechanisms of eukaryotic gene control, and would
also provide biomedical science with a powerful tool by which to
regulate specific gene expression. Such a development would lead to
numerous useful applications in the pharmaceutical and
biotechnological industries. Although many applications are
envisioned; one particularly useful application would be as the
central component in screening assays to identify new classes of
pharmacologically active substances which may be employed to
manipulate, and particularly, to promote, the transcription of
genes whose expression is altered in diabetes.
[0131] Hence HNF4.alpha. would be of great use in identifying
agents to combat MODY and Type 2 diabetes. An anti-diabetic agent
isolated by the screening methods of the present invention would
act to promote the cellular transcription or function of
HNF4.alpha., which would in turn serve to increase transcription of
genes whose activity is regulated by HNF4.alpha. (for example
HNF1.alpha.) thereby increasing the transcription of genes involved
in diabetes and alleviating the symptoms of diabetes.
[0132] Candidates for HNF1.beta. Binding
[0133] The criteria shown above for screening of modulators of
HNF1.alpha. and HNF4.alpha. are also true of HNF1.beta.. HNF1.beta.
is a 557 amino acid that is structurally related to HNF1.alpha. and
functions as a homodimer and heterodimer with HNF1.alpha.. These
dimers are stabilized by DCoH. The identification of factors that
affect this dimerization, or any of the factors involved in the
heterotetrameric complex, will provide useful compounds for the
modulation of transcriptional activity. Such a development would
lead to numerous useful applications in the pharmaceutical and
biotechnological industries. Although many applications are
envisioned, one particularly useful application would be as the
central component in screening assays to identify new classes of
pharmacologically active substances which may be employed to
manipulate, and particularly, to promote, the transcription of
genes whose expression is altered in diabetes.
[0134] Hence HNF1.beta. would be of great use in identifying agents
to combat MODY and Type 2 diabetes. An anti-diabetic agent isolated
by the screening methods of the present invention would act to
promote the cellular transcription or function of HNF1.beta., which
would in turn serve to increase transcription of genes whose
activity is regulated by HNF1.beta. (for example HNF1.alpha.)
thereby increasing the transcription of genes involved in diabetes
and alleviating the symptoms of diabetes.
[0135] D. Reporter Genes and Cell-Based Screening Assays
[0136] Cellular assays also are available for screening candidate
substances to identify those capable of stimulating HNF1.alpha.-
HNF1.beta.- and HNF4.alpha.-mediated transcription and gene
expression. In these assays, the increased expression of any
natural or heterologous gene under the control of a functional
HNF1.alpha., HNF1.beta. or HNF4.alpha. protein may be employed as a
measure of stimulatory activity, although the use of reporter genes
is preferred. A reporter gene is a gene that confers on its
recombinant host cell a readily detectable phenotype that emerges
only under specific conditions. In the present case, the reporter
gene, being under the control of a functional HNF1.alpha.,
HNF1.beta. or HNF4.alpha. protein, will generally be repressed
under conditions of MODY3, MODY4 or MODY1 diabetes respectively and
will generally be expressed in the MODY3, MODY4 or MODY1 non
diabetic conditions respectively.
[0137] Reporter genes are genes which encode a polypeptide not
otherwise produced by the host cell which is detectable by analysis
of the cell culture, e.g., by fluorometric, radioisotopic or
spectrophotometric analysis of the cell culture. Exemplary enzymes
include luciferases, transferases, esterases, phosphatases,
proteases (tissue plasminogen activator or urokinase), and other
enzymes capable of being detected by their physical presence or
functional activity. A reporter gene often used is chloramphenicol
acetyltransferase (CAT) which may be employed with a radiolabeled
substrate, or luciferase, which is measured fluorometrically.
[0138] Another class of reporter genes which confer detectable
characteristics on a host cell are those which encode polypeptides,
generally enzymes, which render their transformants resistant
against toxins, e.g., the neo gene which protects host cells
against toxic levels of the antibiotic G418, and genes encoding
dihydrofolate reductase, which confers resistance to methotrexate.
Genes of this class are not generally preferred since the phenotype
(resistance) does not provide a convenient or rapid quantitative
output. Resistance to antibiotic or toxin requires days of culture
to confirm, or complex assay procedures if other than a biological
determination is to be made.
[0139] Other genes of potential for use in screening assays are
those capable of transforming hosts to express unique cell surface
antigens, e.g., viral env proteins such as HIV gp120 or herpes gD,
which are readily detectable by immunoassays. However, antigenic
reporters are not preferred because, unlike enzymes, they are not
catalytic and thus do not amplify their signals. The polypeptide
products of the reporter gene are secreted, intracellular or, as
noted above, membrane bound polypeptides. If the polypeptide is not
ordinarily secreted it is fused to a heterologous signal sequence
for processing and secretion. In other circumstances the signal is
modified in order to remove sequences that interdict secretion. For
example, the herpes gD coat protein has been modified by site
directed deletion of its transmembrane binding domain, thereby
facilitating its secretion (EP 139,417A). This truncated form of
the herpes gD protein is detectable in the culture medium by
conventional immunoassays. Preferably, however, the products of the
reporter gene are lodged in the intracellular or membrane
compartments. Then they can be fixed to the culture container,
e.g., microtiter wells, in which they are grown, followed by
addition of a detectable signal generating substance such as a
chromogenic substrate for reporter enzymes.
[0140] The transcriptional promotion process which, in its
entirety, leads to enhanced transcription is termed "activation."
The mechanism by which a successful candidate substance acts is not
material since the objective is to promote HNF1.alpha., HNF1.beta.
or HNF4.alpha. mediated gene expression, or even, to promote gene
expression in the presence of mutant HNF1.alpha., HNF1.beta., or
HNF4.alpha. gene products, by whatever means.
[0141] To create an appropriate vector or plasmid for use in such
assays one would ligate the HNF1.alpha.-containing promoter,
whether a hybrid or the native HNF1.alpha. promoter, to a DNA
segment encoding the reporter gene by conventional methods. Similar
assays are also contemplated using HNF1.beta. and HNF4.alpha.
promoters. The HNF1.alpha., HNF1.beta. or HNF4.alpha. promoter
sequences may be obtained by in vitro synthesis or recovered from
genomic DNA and should be ligated upstream of the start codon of
the reporter gene. The present invention provides the promoter
region for human HNF1.alpha., a comparison of the sequence of the
promoter region of the human, rat, mouse, chicken and frog
HNF1.alpha. genes is given in FIG. 22. There is also provided
herein aomparison of the sequences of the promoter regions of the
human and mouse HNF4.alpha. genes (FIG. 13). The partial sequence
of the human HNF1.beta. gene including promoter has also been
identified by the present inventors and deposited in the GenBank
database under accession numbers U90279-90287 and U96079. Any of
these promoters may be particularly preferred in the present
invention. An AT-rich TATA box region should also be employed and
should be located between the HNF sequence and the reporter gene
start codon. The region 3' to the coding sequence for the reporter
gene will ideally contain a transcription termination and
polyadenylation site. The promoter and reporter gene may be
inserted into a replicable vector and transfected into a cloning
host such as E. coli, the host cultured and the replicated vector
recovered in order to prepare sufficient quantities of the
construction for later transfection into a suitable eukaryotic
host.
[0142] Host cells for use in the screening assays of tne present
invention will generally be mammalian cells, and are preferably
cell lines which may be used in connection with transient
transfection studies. Cell lines should be relatively easy to grow
in large scale culture. Also, they should contain as little native
background as possible considering the nature of the reporter
polypeptide. Examples include the Hep G2, VERO, HeLa, human
embryonic kidney (HEK)-293, CHO, WI38, BHK, COS-7, and MDCK cell
lines, with monkey CV-1 cells being particularly preferred.
[0143] The screening assay typically is conducted by growing
recombinant host cells in the presence and absence of candidate
substances and determining the ampunt or the activity of the
reporter gene. To assay for candidate substances capable of
exerting their effects in the presence of mutated HNF1.alpha.,
HNF1.beta. and/or HNF4.alpha. gene products, one would make serial
molar proportions of such gene products that alter HNF1.alpha.-,
HNF1.beta.- and HNF4.alpha.-mediated expression. One would ideally
measure the reporter signal level after an incubation period that
is sufficient to demonstrate mutant-mediated repression of signal
expression in controls incubated solely with mutants. Cells
containing varying proportions of candidate substances would then
be evaluated for signal activation in comparison to the suppressed
levels.
[0144] Candidates that demonstrate dose related enhancement of
reporter gene transcription or expression are then selected for
further evaluation as clinical therapeutic agents. The stimulation
of transcription may be observed in the absence of mutant
HNF1.alpha., HNF1.beta. or HNF4.alpha., in which case the candidate
compound might be a positive stimulator of HNF1.alpha. HNF1.beta.
or HNF4.alpha. transcription, respectively. Alternatively, the
candidate compound might only give a stimulation in the presence
mutated HNF1.alpha., mutated HNF1.beta. or mutated HNF4.alpha.
protein, which would indicate that it functions to oppose the
mutation-mediated suppression of the gene expression. Candidate
compounds of either class might be useful therapeutic agents that
would stimulate gene expression and thereby combating MODY and Type
2 diabetes.
E. Nucleic Acids
[0145] As described the Examples, the present invention discloses
the gene at the MODY3 locus of chromosome 12, MODY4 locus as being
associated with HNF1.beta. and the gene at the MODY1 locus of
chromosome 20. Mutations in these genes are responsible for
diabetes. The present invention discloses mutations in the
HNF1.alpha., HNF1.beta., and HNF4.alpha. genes identified by PCR
techniques. The gene for the MODY3 locus has for the first time
been identified as hepatocyte nuclear factor 1.alpha., herein
referred to as HNF1.alpha.. The gene for the MODY1 locus has been
identified as hepatocyte nuclear factor 4.alpha.(HNF4.alpha.). The
gene for the MODY4 locus has been identified as hepatocyte nuclear
factor 1.beta.(HNF1.beta.).
[0146] In one embodiment of the present invention, the nucleic acid
sequences disclosed herein find utility as hybridization probes or
amplification primers. In certain embodiments, these probes and
primers consist of oligonucleotide fragments. Such fragments should
be of sufficient length to provide specific hybridization to an RNA
or DNA sample extracted from tissue. The sequences typically will
be 10-20 nucleotides, but may be longer. Longer sequences, e.g.,
40, 50, 100, 500 and even up to full length, are preferred for
certain embodiments.
[0147] Nucleic acid molecules having contiguous stretches of about
10, 15, 17, 20, 30, 40, 50, 60, 75 or 100 or 500 nucleotides from a
sequence selected from the group comprising SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:5, SEQ ID NO:7, HNF1.alpha. and its mutants are
contemplated. In other embodiments nucleotides from a sequence
selected from the group comprising SEQ ID NO:78, SEQ ID NO:34, SEQ
ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44,
SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID
NO:54, HNF4.alpha. and its mutants are contemplated. In still other
embodiments nucleotides from a sequence selected from the group
comprising SEQ ID NO:---, SEQ ID NO:---, SEQ ID NO:---, SEQ ID
NO:---, SEQ ID NO:---, SEQ ID NO:---, SEQ ID NO:---, SEQ ID NO:---,
SEQ ID NO:---, SEQ ID NO:---, SEQ ID NO:---, SEQ ID NO:---,
HNF1.beta. and its mutants are contemplated. Molecules that are
complementary to the above mentioned sequences and that bind to
these sequences under high stringency conditions also are
contemplated. These probes will be useful in a variety of
hybridization embodiments, such as Southern and northern blotting.
In some cases, it is contemplated that probes may be used that
hybridize to multiple target sequences without compromising their
ability to effectively diagnose diabetes (MODY1, MODY3, and MODY4).
In certain embodiments, it is contemplated that multiple probes may
be used for hybridization to a single sample.
[0148] Various probes and primers can be designed around the
disclosed nucleotide sequences. Primers may be of any length but,
typically, are 10-20 bases in length. By assigning numeric values
to a sequence, for example, the first residue is 1, the second
residue is 2, etc., an algorithm defining all primers can be
proposed:
n to n+y
[0149] where n is an integer from 1 to the last number of the
sequence and y is the length of the primer minus one, where n+y
does not exceed the last number of the sequence. Thus, for a
10-mer, the probes correspond to bases 1 to 10, 2 to 11, 3 to 12 .
. . and so on. For a 15-mer, the probes correspond to bases 1 to
15, 2 to 16, 3 to 17 . . . and so on. For a 20-mer, the probes
correspond to bases 1 to 20, 2 to 21, 3 to 22 . . . and so on.
[0150] The values of n in the algorithm above for the nucleic acid
sequences is: SEQ ID NO:1, n=3238 for HNF1.alpha., SEQ ID NO:78
n=1441 for HNF4.alpha., SEQ ID NO:128.
[0151] The use of a hybridization probe of between 17 and 100
nucleotides in length allows the formation of a duplex molecule
that is both stable and selective. Molecules having complementary
sequences over stretches greater than 20 bases in length are
generally preferred, in order to increase stability and selectivity
of the hybrid, and thereby improve the quality and degree of
particular hybrid molecules obtained. One will generally prefer to
design nucleic acid molecules having stretches of 20 to 30
nucleotides, or even longer where desired. Such fragments may be
readily prepared by, for example, directly synthesizing the
fragment by chemical means or by introducing selected sequences
into recombinant vectors for recombinant production.
[0152] Accordingly, the nucleotide sequences of the invention may
be used for their ability to selectively form duplex molecules with
complementary stretches of genes or RNAs or to provide primers for
amplification of DNA or RNA from tissues. Depending on the
application envisioned, one will desire to employ varying
conditions of hybridization to achieve varying degrees of
selectivity of probe towards target sequence.
[0153] For applications requiring high selectivity, one will
typically desire to employ relatively stringent conditions to form
the hybrids, e.g., one will select relatively low salt and/or high
temperature conditions, such as provided by about 0.02 M to about
0.10 M NaCl at temperatures of about 50.degree. C. to about
70.degree. C. Such high stringency conditions tolerate little, if
any, mismatch between the probe and the template or target strand,
and would be particularly suitable for isolating specific genes or
detecting specific mRNA transcripts. It is generally appreciated
that conditions can be rendered more stringent by the addition of
increasing amounts of formamide.
[0154] For certain applications, for example, substitution of
nucleotides by site-directed mutagenesis, it is appreciated that
lower stringency conditions are required. Under these conditions,
hybridization may occur even though the sequences of probe and
target strand are not perfectly complementary, but are mismatched
at one or more positions. Conditions may be rendered less stringent
by increasing salt concentration and decreasing temperature. For
example, a medium stringency condition could be provided by about
0.1 to 0.25 M NaCl at temperatures of about 37.degree. C. to about
55.degree. C., while a low stringency condition could be provided
by about 0.15 M to about 0.9 M salt, at temperatures rangoing from
about 20.degree. C. to about 55.degree. C. Thus, hybridization
conditions can be readily manipulated depending on the desired
results.
[0155] In other embodiments, hybridization may be achieved under
conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3
mM MgCl.sub.2, 1.0 mM dithiothreitol, at temperatures between
approximately 20.degree. C. to about 37.degree. C. Other
hybridization conditions utilized could include approximately 10 mM
Tris-HCl (pH 8.3), 50 mM KCI, 1.5 mM MgCI.sub.2, at temperatures
ranging from approximately 40.degree. C. to about 72.degree. C.
[0156] In certain embodiments, it will be advantageous to employ
nucleic acid sequences of the present invention in combination with
an appropriate means, such as a label, for determining
hybridization. A wide variety of appropriate indicator means are
known in the art, including fluorescent, radioactive, enzymatic or
other ligands, such as avidin/biotin, which are capable of being
detected. In preferred embodiments, one may desire to employ a
fluorescent label or an enzyme tag such as urease, alkaline
phosphatase or peroxidase, instead of radioactive or other
environmentally undesirable reagents. In the case of enzyme tags,
colorimetric indicator substrates are known that can be employed to
provide a detection means visible to the human eye or
spectrophotometrically, to identify specific hybridization with
complementary nucleic acid-containing samples.
[0157] In general, it is envisioned that the hybridization probes
described herein will be useful both as reagents in solution
hybridization, as in PCR, for detection of expression of
corresponding genes, as well as in embodiments employing a solid
phase. In embodiments involving a solid phase, the test DNA (or
RNA) is adsorbed or otherwise affixed to a selected matrix or
surface. This fixed, single-stranded nucleic acid is then subjected
to hybridization with selected probes under desired conditions. The
selected conditions will depend on the particular circumstances
based on the particular criteria required (depending, for example,
on the G+C content, type of target nucleic acid, source of nucleic
acid, size of hybridization probe, etc.). Following washing of the
hybridized surface to remove non-specifically bound probe
molecules, hybridization is detected, or even quantified, by means
of the label.
[0158] It will be understood that this invention is not limited to
the particular probes disclosed herein and particularly is intended
to encompass at least nucleic acid sequences that are hybridizable
to the disclosed sequences or are functional analogs of these
sequences.
[0159] For applications in which the nucleic acid segments of the
present invention are incorporated into vectors, such as plasmids,
cosmids or viruses, these segments may be combined with other DNA
sequences, such as promoters, polyadenylation signals, restriction
enzyme sites, multiple cloning sites, other coding segments, and
the like, such that their overall length may vary considerably. It
is contemplated that a nucleic acid fragment of almost any length
may be employed, with the total length preferably being limited by
the ease of preparation and use in the intended recombinant DNA
protocol.
[0160] DNA segments encoding a specific gene may be introduced into
recombinant host cells and employed for expressing a specific
structural or regulatory protein. Alternatively, through the
application of genetic engineering techniques, subportions or
derivatives of selected genes may be employed. Upstream regions
containing regulatory regions such as promoter regions may be
isolated and subsequently employed for expression of the selected
gene.
[0161] In an alternative embodiment, the HNF1.alpha., HNF1.beta. or
HNF4.alpha. nucleic acids employed may actually encode antisense
constructs that hybridize, under intracellular conditions, to an
HNF1.alpha. or HNF.alpha. nucleic acid, respectively. The term
"antisense construct" is intended to refer to nucleic acids,
preferably oligonucleotides, that are complementary to the base
sequences of a target DNA or RNA. Antisense oligonucleotides, when
introduced into a target cell, specifically bind to their target
nucleic acid and interfere with transcription, RNA processing,
transport, translation and/or stability.
[0162] Antisense constructs may be designed to bind to the promoter
and other control regions, exons, introns or even exon-intron
boundaries of a gene. Antisense RNA constructs, or DNA encoding
such antisense RNA's, may be employed to inhibit gene transcription
or translation or both within a host cell, either in vitro or in
vivo, such as within a host animal, including a human subject.
Nucleic acid sequences which comprise "complementary nucleotides"
are those which are capable of base-pairing according to the
standard Watson-Crick complementarity rules. That is, the larger
purines will base pair with the smaller pyrimidines to form
combinations of guanine paired with cytosine (G:C) and adenine
paired with either thymine (A:T), in the case of DNA, or adenine
paired with uracil (A:U) in the case of RNA. Inclusion of less
common bases such as inosine, 5-methylcytosine, 6-methyladenine,
hypoxanthine and others in hybridizing sequences does not interfere
with pairing.
[0163] As used herein, the terms "complementary" means nucleic acid
sequences that are substantially complementary over their entire
length and have very few base mismatches. For example, nucleic acid
sequences of fifteen bases in length may be termed complementary
when they have a complementary nucleotide at thirteen or fourteen
positions with only a single mismatch. Naturally, nucleic acid
sequences which are "completely complementary" will be nucleic acid
sequences which are entirely complementary throughout their entire
length and have no base mismatches.
[0164] Other sequences with lower degrees of homology also are
contemplated. For example, an antisense construct which has limited
regions of high homology, but also contains a non-homologous region
(e.g., a ribozyme) could be designed. These molecules, though
having less than 50% homology, would bind to target sequences under
appropriate conditions.
[0165] While all or part of the HNF1.alpha., HNF1.beta.,
HNF4.alpha. gene sequence may be employed in the context of
antisense construction, short oligonucleotides are easier to make
and increase in vivo accessibility. However, both binding affinity
and sequence specificity of an antisense oligonucleotide to its
complementary target increases with increasing length. It is
contemplated that antisense oligonucleotides of 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80,
90, 100 or more base pairs will be used. One can readily determine
whether a given antisense nucleic acid is effective at targeting of
the corresponding host cell gene simply by testing the constructs
in vitro to determine whether the endogenous gene's function is
affected or whether the expression of related genes having
complementary sequences is affected.
[0166] In certain embodiments, one may wish to employ antisense
constriucts which include other elements, for example, those which
include C-5 propyne pyrimidines. Oligonucleotides which contain C-5
propyne analogues of uridine and cytidine have been shown to bind
RNA with high affinity and to be potent antisense inhibitors of
gene expression (Wagner et al., 1993).
[0167] Throughout this application, the term "expression construct"
is meant to include any type of genetic construct containing a
nucleic acid coding for a gene product in which part or all of the
nucleic acid encoding sequence is capable of being transcribed. The
transcript may be translated into a protein, but it need not be.
Thus, in certain embodiments, expression includes both
transcription of a gene and translation of a RNA into a gene
product. In other embodiments, expression only includes
transcription of the nucleic acid, for example, to generate
antisense constructs.
[0168] In preferred embodiments, the nucleic acid is under
transcriptional control of a promoter. A "promoter" refers to a DNA
sequence recognized by the synthetic machinery of the cell, or
introduced synthetic machinery, required to initiate the specific
transcription of a gene. The phrase "under transcriptional control"
means that the promoter is in the correct location and orientation
in relation to the nucleic acid to control RNA polymerase
initiation and expression of the gene.
[0169] The term promoter will be used here to refer to a group of
transcriptional control modules that are clustered around the
initiation site for RNA polymerase II. Much of the thinking about
how promoters are organized derives from analyses of several viral
promoters, including those for the HSV thymidine kinase (tk) and
SV40 early transcription units. These studies, augmented by more
recent work, have shown that promoters are composed of discrete
functional modules, each consisting of approximately 7-20 bp of
DNA, and containing one or more recognition sites for
transcriptional activator or repressor proteins.
[0170] At least one module in each promoter functions to position
the start site for RNA synthesis. The best known example of this is
the TATA box, but in some promoters lacking a TATA box, such as the
promoter for the mammalian terminal deoxynucleotidyl transferase
gene and the promoter for the SV40 late genes, a discrete element
overlying the start site itself helps to fix the place of
initiation.
[0171] Additional promoter elements regulate the frequency of
transcriptional initiation. Typically, these are located in the
region 30-110 bp upstream of the start site, although a number of
promoters have recently been shown to contain functional elements
downstream of the start site as well. The spacing between promoter
elements frequently is flexible, so that promoter function is
preserved when elements are inverted or moved relative to one
another. In the tk promoter, the spacing between promoter elements
can be increased to 50 bp apart before activity begins to decline.
Depending on the promoter, it appears that individual elements can
function either co-operatively or independently to activate
transcription.
[0172] The particular promoter that is employed to control the
expression of a nucleic acid is not believed to be critical, so
long as it is capable of expressing the nucleic acid in the
targeted cell. Thus, where a human cell is targeted, it is
preferable to position the nucleic acid coding region adjacent to
and under the control of a promoter that is capable of being
expressed in a human cell. Generally speaking, such a promoter
might include either a human or viral promoter. Preferred promoters
include those derived from HSV, and HNF1.alpha. (see for example,
FIG. 22), HNF1.beta. or HNF4.alpha. promoter (see for example, FIG.
13). The partial sequence of the human HNF1.beta. gene including
promoter has also been identified by the present inventors and
deposited in the GenBank database under accession numbers
U90279-90287 and U96079 (SEQ ID NO:128). Another preferred
embodiment is the tetracycline controlled promoter.
[0173] In various other embodiments, the human cytomegalovirus
(CMV) immediate early gene promoter, the SV40 early promoter and
the Rous sarcoma virus long terminal repeat can be used to obtain
high-level expression of transgenes. The use of other viral or
mammalian cellular or bacterial phage promoters which are
well-known in the art to achieve expression of a transgene is
contemplated as well, provided that the levels of expression are
sufficient for a given purpose. Tables 1 and 2 list several
elements/promoters which may be employed, in the context of the
present invention, to regulate the expression of a transgene. This
list is not intended to be exhaustive of all the possible elements
involved in the promotion of transgene expression but, merely, to
be exemplary thereof.
[0174] Enhancers were originally detected as genetic elements that
increased transcription from a promoter located at a distant
position on the same molecule of DNA. This ability to act over a
large distance had little precedent in classic studies of
prokaryotic transcriptional regulation. Subsequent work showed that
regions of DNA with enhancer activity are organized much like
promoters. That is, they are composed of many individual elements,
each of which binds to one or more transcriptional proteins.
[0175] The basic distinction between enhancers and promoters is
operational. An enhancer region as a whole must be able to
stimulate transcription at a distance; this need not be true of a
promoter region or its component elements. On the other hand, a
promoter must have one or more elements that direct initiation of
RNA synthesis at a particular site and in a particular orientation,
whereas enhancers lack these specificities. Promoters and enhancers
are often overlapping and contiguous, often seeming to have a very
similar modular organization.
[0176] Additionally any promoter/enhancer combination (as per the
Eukaryotic Promoter Data Base EPDB) could also be used to drive
expression of a transgene. Use of a T3, T7 or SP6 cytoplasmic
expression system is another possible embodiment. Eukaryotic cells
can support cytoplasmic transcription from certain bacterial
promoters if the appropriate bacterial polymerase is provided,
either as part of the delivery complex or as an additional genetic
expression construct.
1TABLE 1 PROMOTER Immunoglobulin Heavy Chain Immunoglobulin Light
Chain T-Cell Receptor HLA DQ .alpha. and DQ .beta.
.beta.-Interferon Interleukin-2 Interleukin-2 Receptor MHC Class II
5 MHC Class II HLA-DR.alpha. .beta.-Actin Muscle Creatine Kinase
Prealbumin (Transthyretin) Elastase I Metallothionein Collagenase
Albumin Gene .alpha.-Fetoprotein .alpha.-Globin .beta.-Globin c-fos
c-HA-ras Insulin Neural Cell Adhesion Molecule (NCAM)
.alpha..sub.1-Anti-trypsin H2B (TH2B) Histone Mouse or Type I
Collagen Glucose-Regulated Proteins (GRP94 and GRP78) Rat Growth
Hormone Human Serum Amyloid A (SAA) Troponin I (TN I)
Platelet-Derived Growth Factor Duchenne Muscular Dystrophy SV40
Polyoma Retroviruses Papilloma Virus Hepatitis B Virus Human
Immunodeficiency Virus Cytomegalovirus Gibbon Ape Leukemia
Virus
[0177]
2TABLE 2 Element Inducer MT II Phorbol Ester (TPA) Heavy metals
MMTV (mouse mammary Glucocorticoids tumor virus) .beta.-Interferon
poly(rI)X poly(rc) Adenovirus 5 E2 Ela c-jun Phorbol Ester (TPA),
H.sub.2O.sub.2 Collagenase Phorbol Ester (TPA) Stromelysin Phorbol
Ester (TPA), IL-1 SV40 Phorbol Ester (TPA) Murine MX Gene
Interferon, Newcastle Disease Virus GRP78 Gene A23187
.alpha.-2-Macroglobulin IL-6 Vimentin Serum MHC Class I Gene H-2kB
Interferon HSP70 Ela, SV40 Large T Antigen Proliferin Phorbol
Ester-TPA Tumor Necrosis Factor FMA Thyroid Stimulating Thyroid
Hormone Hormone .alpha. Gene
[0178] Use of the baculovirus system will involve high level
expression from the powerful polyhedron promoter.
[0179] One will typically include a polyadenylation signal to
effect proper polyadenylation of the transcript. The nature of the
polyadenylation signal is not believed to be crucial to the
successful practice of the invention, and any such sequence may be
employed. Preferred embodiments include the SV40 polyadenylation
signal and the bovine growth hormone polyadenylation signal,
convenient and known to function well in various target cells. Also
contemplated as an element of the expression cassette is a
terminator. These elements can serve to enhance message levels and
to minimize read through from the cassette into other
sequences.
[0180] A specific initiation signal also may be required for
efficient translation of coding sequences. These signals include
the ATG initiation codon and adjacent sequences. Exogenous
translational control signals, including the ATG initiation codon,
may need to be provided. One of ordinary skill in the art would
readily be capable of determining this and providing the necessary
signals. It is well known that the initiation codon must be
"in-frame" with the reading frame of the desired coding sequence to
ensure translation of the entire insert. The exogenous
translational control signals and initiation codons can be either
natural or synthetic. The efficiency of expression may be enhanced
by the inclusion of appropriate transcription enhancer elements
(Bittner et al., 1987).
[0181] In various embodiments of the invention, the expression
construct may comprise a virus or engineered construct derived from
a viral genome. The ability of certain viruses to enter cells via
receptor-mediated endocytosis and to integrate into the host cell
genome and express viral genes stably and efficiently have made
them attractive candidates for the transfer of foreign genes into
mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988;
Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as
vectors were DNA viruses including the papovaviruses (simian virus
40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal
and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and
Sugden, 1986) and adeno-associated viruses. Retroviruses also are
attractive gene transfer vehicles (Nicolas and Rubenstein, 1988;
Temin, 1986) as are vaccina virus (Ridgeway, 1988) and
adeno-associated virus (Ridgeway, 1988). Such vectors may be used
to (i) transform cell lines in vitro for the purpose of expressing
proteins of interest or (ii) to transform cells in vitro or in vivo
to provide therapeutic polypeptides in a gene therapy scenario.
[0182] In some embodiments, the vector is HSV. Because HSV is
neurotropic, it has generated considerable interest in treating
nervous system disorders. Since insulin-secreting pancreatic
.beta.-cells share many features with neurons, HSV may be useful
for delivering genes to .beta.-cells and for gene therapy of
diabetes. Moreover, the ability of HSV to establish latent
infections in non-dividing neuronal cells without integrating into
the host cell chromosome or otherwise altering the host cell's
metabolism, along with the existence of a promoter that is active
during latency. And though much attention has focused on the
neurotropic applications of HSV, this vector also can be exploited
for other tissues.
[0183] Another factor that makes HSV an attractive vector is the
size and organization of the genome. Because HSV is large,
incorporation of multiple genes or expression cassettes is less
problematic than in other smaller viral systems. In addition, the
availability of different viral control sequences with varying
performance (temporal, strength, etc.) makes it possible to control
expression to a greater extent than in other systems. It also is an
advantage that the virus has relatively few spliced messages,
further easing genetic manipulations.
[0184] HSV also is relatively easy to manipulate and can be grown
to high titers. Thus, delivery is less of a problem, both in terms
of volumes needed to attain sufficient MOI and in a lessened need
for repeat dosings.
F. Encoded Proteins
[0185] Once the entire coding sequence of a marker-associated gene
has been determined, the gene can be inserted into an appropriate
expression system. The gene can be expressed in any number of
different recombinant DNA expression systems to generate large
amounts of the polypeptide product, which can then be purified and
used to vaccinate animals to generate antisera with which further
studies may be conducted.
[0186] Examples of expression systems known to the skilled
practitioner in the art include bacteria such as E. coli, yeast
such as Saccharomyces cerevisia and Pichia pastoris, baculovirus,
and mammalian expression systems such as in COS or CHO cells. In
one embodiment, polypeptides are expressed in E. coli and in
baculovirus expression systems. A complete gene can be expressed
or, alternatively, fragments of the gene encoding portions of
polypeptide can be produced.
[0187] In one embodiment, the gene sequence encoding the
polypeptide is analyzed to detect putative transmembrane sequences.
Such sequences are typically very hydrophobic and are readily
detected by the use of standard sequence analysis software, such as
MacVector (IBI, New Haven, Conn.). The presence of transmembrane
sequences is often deleterious when a recombinant protein is
synthesized in many expression systems, especially E. coli, as it
leads to the production of insoluble aggregates that are difficult
to renature into the native conformation of the protein. Deletion
of transmembrane sequences typically does not significantly alter
the conformation of the remaining protein structure.
[0188] Moreover, transmembrane sequences, being by definition
embedded within a membrane, are inaccessible. Therefore, antibodies
to these sequences will not prove useful for in vivo or in situ
studies. Deletion of transmembrane-encoding sequences from the
genes used for expression can be achieved by standard techniques.
For example, fortuitously-placed restriction enzyme sites can be
used to excise the desired gene fragment, or PCR-type amplification
can be used to arnplify, only the desired part of the gene. The
skilled practitioner will realize that such changes must be
designed so as not to change the translational reading frame for
downstream portions of the protein-encoding sequence.
[0189] In one embodiment, computer sequence analysis is used to
determine the location of the predicted major antigenic determinant
epitopes of the polypeptide. Software capable of carrying out this
analysis is readily available commercially, for example MacVector
(IBI, New Haven, Conn.). The software typically uses standard
algorithms such as the Kyte/Doolittle or Hopp/Woods methods for
locating hydrophilic sequences which are characteristically found
on the surface of proteins and are, therefore, likely to act as
antigenic determinants.
[0190] Once this analysis is made, polypeptides can be prepared
that contain at least the essential features of the antigenic
determinant and that can be employed in the generation of antisera
against the polypeptide. Minigenes or gene fusions encoding these
determinants can be constructed and inserted into expression
vectors by standard methods, for example, using PCR
methodology.
[0191] The gene or gene fragment encoding a polypeptide can be
inserted into an expression vector by standard subcloning
techniques. In one embodiment, an E. coli expression vector is used
that produces the recombinant polypeptide as a fusion protein,
allowing rapid affinity purification of the protein. Examples of
such fusion protein expression systems are the glutathione
S-transferase system (Pharmacia, Piscataway, N.J.), the maltose
binding protein system (NEB, Beverley, Mass.), the FLAG system
(IBI, New Haven, Conn.), and the 6.times.His system (Qiagen,
Chatsworth, Calif.).
[0192] Some of these systems produce recombinant polypeptides
bearing only a small number of additional amino acids, which are
unlikely to affect the antigenic ability of the recombinant
polypeptide. For example, both the FLAG system and the 6.times.His
system add only short sequences, both of that are known to be
poorly antigenic and which do not adversely affect folding of the
polypeptide to its native conformation. Other fusion systems
produce polypeptide where it is desirable to excise the fusion
partner from the desired polypeptide. In one embodiment, the fusion
partner is linked to the recombinant polypeptide by a peptide
sequence containing a specific recognition sequence for a protease.
Examples of suitable sequences are those recognized by the Tobacco
Etch Virus protease (Life Technologies, Gaithersburg, Md.) or
Factor Xa (New England Biolabs, Beverley, Mass.).
[0193] Recombinant bacterial cells, for example E. coli, are grown
in any of a number of suitable media, for example LB, and the
expression of the recombinant polypeptide induced by adding IPTG to
the media or switching incubation to a higher temperature. After
culturing the bacteria for a further period of between 2 and 24
hours, the cells are collected by centrifugation and washed to
remove residual media. The bacterial cells are then lysed, for
example, by disruption in a cell homogenizer and centrifuged to
separate the dense inclusion bodies and cell membranes from the
soluble cell components. This centrifugation can be performed under
conditions whereby the dense inclusion bodies are selectively
enriched by incorporation of sugars such as sucrose into the buffer
and centrifugation at a selective speed.
[0194] In another embodiment, the expression system used is one
driven by the baculovirus polyhedron promoter. The gene encoding
the polypeptide can be manipulated by standard techniques in order
to facilitate cloning into the baculovirus vector. One baculovirus
vector is the pBlueBac vector (Invitrogen, Sorrento, Calif.). The
vector carrying the gene for the polypeptide is transfected into
Spodoptera frugiperda (Sf9) cells by standard protocols, and the
cells are cultured and processed to produce the recombinant
antigen. See Summers et al., A MANUAL OF METHODS FOR BACULOVIRUS
ECTORS AND INSECT CELL CULTURE PROCEDURES, Texas Agricultural
Experimental Station.
[0195] As an alternative to recombinant polypeptides, synthetic
peptides corresponding to the antigenic determinants can be
prepared. Such peptides are at least six amino acid residues long,
and may contain up to approximately 35 residues, which is the
approximate upper length limit of automated peptide synthesis
machines, such as those available from Applied Biosystems (Foster
City, Calif.). Use of such small peptides for vaccination typically
requires conjugation of the peptide to an immunogenic carrier
protein such as hepatitis B surface antigen, keyhole limpet
hemocyanin or bovine serum albumin. Methods for performing this
conjugation are well known in the art.
[0196] In one embodiment, amino acid sequence variants of the
polypeptide can be prepared. These may, for instance, be minor
sequence variants of the polypeptide that arise due to natural
variation within the population or they may be homologues found in
other species. They also may be sequences that do not occur
naturally but that are sufficiently similar that they function
similarly and/or elicit an immune response that cross-reacts with
natural forms of the polypeptide. Sequence variants can be prepared
by standard methods of site-directed mutagenesis such as those
described below in the following section.
[0197] Amino acid sequence variants of the polypeptide can be
substitutional, insertional or deletion variants. Deletion variants
lack one or more residues of the native protein which are not
essential for function or immunogenic activity, and are exemplified
by the variants lacking a transmembrane sequence described above.
Another common type of deletion variant is one lacking secretory
signal sequences or signal sequences directing a protein to bind to
a particular part of a cell. An example of the latter sequence is
the SH2 domain, which induces protein binding to phosphotyrosine
residues.
[0198] Substitutional variants typically contain the exchange of
one amino acid for another at one or more sites within the protein,
and may be designed to modulate one or more properties of the
polypeptide such as stability against proteolytic cleavage.
Substitutions preferably are conservative, that is, one amino acid
is replaced with one of similar shape and charge. Conservative
substitutions are well known in the art and include, for example,
the changes of: alanine to serine; arginine to lysine; asparagine
to glutamine or histidine; aspartate to glutamate; cysteine to
serine; glutarnine to asparagine; glutamate to aspartate; glycine
to proline; histidine to asparagine or glutamine; isoleucine to
leucine or valine; leucine to valine or isoleucine; lysine to
arginine; methionine to leucine or isoleucine; phenylalanine to
tyrosine, leucine or methionine; serine to threonine; threonine to
serine; tryptophan to tyrosine; tyrosine to tryptophan or
phenylalanine; and valine to isoleucine or leucine.
[0199] Insertional variants include fusion proteins such as those
used to allow rapid purification of the polypeptide and also can
include hybrid proteins containing sequences from other proteins
and polypeptides which are homologues of the polypeptide. For
example, an insertional variant could include portions of the amino
acid sequence of the polypeptide from one species, together with
portions of the homologous polypeptide from another species. Other
insertional variants can include those in which additional amino
acids are introduced within the coding sequence of the polypeptide.
These typically are smaller insertions than the fusion proteins
described above and are introduced, for example, into a protease
cleavage site.
[0200] In one embodiment, major antigenic determinants of the
polypeptide are identified by an empirical approach in which
portions of the gene encoding the polypeptide are expressed in a
recombinant host, and the resulting proteins tested for their
ability to elicit an immune response. For example, PCR can be used
to prepare a range of cDNAs encoding peptides lacking successively
longer fragments of the C-terminus of the protein. The
immunoprotective activity of each of these peptides then identifies
those fragments or domains of the polypeptide that are essential
for this activity. Further experiments in which only a small number
of amino acids are removed at each iteration then allows the
location of the antigenic determinants of the polypeptide.
[0201] Another embodiment for the preparation of the polypeptides
according to the invention is the use of peptide mimetics. Mimetics
are peptide-containing molecules that mimic elements of protein
secondary structure. See, for example, Johnson et al., "Peptide
Turn Mimetics" in BIOTECHNOLOGY AND PHARMACY, Pezzuto et al., Eds.,
Chapman and Hall, New York (1993). The underlying rationale behind
the use of peptide mimetics is that the peptide backbone of
proteins exists chiefly to orient amino acid side chains in such a
way as to facilitate molecular interactions, such as those of
antibody and antigen. A peptide mimetic is expected to permit
molecular interactions similar to the natural molecule.
[0202] Successful applications of the peptide mimetic concept have
thus far focused on mimetics of .beta.-turns within proteins, which
are known to be highly antigenic. Likely .beta.-turn structure
within an polypeptide can be predicted by computer-based algorithms
as discussed above. Once the component amino acids of the turn are
determined, peptide mimetics can be constructed to achieve a
similar spatial orientation of the essential elements of the amino
acid side chains.
[0203] Modification and changes may be made in the structure of a
gene and still obtain a functional molecule that encodes a protein
or polypeptide with desirable characteristics. The following is a
discussion based upon changing the amino acids of a protein to
create an equivalent, or even an improved, second-generation
molecule. The amino acid changes may be achieved by changing the
codons of the DNA sequence, according to the following data.
[0204] For example, certain amino acids may be substituted for
other amino acids in a protein structure without appreciable loss
of interactive binding capacity with structures such as, for
example, antigen-binding regions of antibodies or binding sites on
substrate molecules. Since it is the interactive capacity and
nature of a protein that defines that protein's biological
functional activity, certain amino acid substitutions can be made
in a protein sequence, and its underlying DNA coding sequence, and
nevertheless obtain a protein with like properties. It is thus
contemplated by the inventors that various changes may be made in
the DNA sequences of genes without appreciable loss of their
biological utility or activity.
[0205] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte & Doolittle, 1982).
3TABLE 3 Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine
Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA
GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K
AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG
Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine
Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S
AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val
V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU
[0206] It is accepted that the relative hydropathic character of
the amino acid contributes to the secondary structure of the
resultant protein, which in turn defines the interaction of the
protein with other molecules, for example, enzymes, substrates,
receptors, DNA, antibodies, antigens, and the like.
[0207] Each amino acid has been assigned a hydropathic index on the
basis of their hydrophobicity and charge characteristics (Kyte
& Doolittle, 1982), these are: Isoleucine (+4.5); valine
(+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine
(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4);
threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine
(-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5);
glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine
(-3.9); and arginine (-4.5).
[0208] It is known in the art that certain amino acids may be
substituted by other amino acids having a similar hydropathic index
or score and still result in a protein with similar biological
activity, i.e., still obtain a biological functionally equivalent
protein. In making such changes, the substitution of amino acids
whose hydropathic indices are within .+-.2 is preferred, those
which are within +1 are particularly preferred, and those within
.+-.0.5 are even more particularly preferred.
[0209] It is also understood in the art that the substitution of
like amino aeids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by
reference, states that the greatest local average hydrophilicity of
a protein, as governed by the hydrophilicity of its adjacent amino
acids, correlates with a biological property of the protein.
[0210] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (0.5.+-.1); alanine (-0.5);
histidine -0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5);
leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine
(-2.5); tryptophan (-3.4).
[0211] It is understood that an amino acid can be substituted for
another having a similar hydrophilicity value and still obtain a
biologically equivalent and immunologically equivalent protein. In
such changes, the substitution of amino acids whose hydrophilicity
values are within .+-.2 is preferred, those that are within .+-.1
are particularly preferred, and those within .+-.0.5 are even more
particularly preferred.
[0212] As outlined above, amino acid substitutions are generally
based on the relative similarity of the amino acid side-chain
substituents, for example, their hydrophobicity, hydrophilicity,
charge, size, and the like. Exemplary substitutions that take
various of the foregoing characteristics into consideration are
well known to those of skill in the art and include: arginine and
lysine; glutamate and aspartate; serine and threonine; glutamine
and asparagine; and valine, leucine and isoleucine.
G. Site-Specific Mutagenesis
[0213] Site-specific mutagenesis is a technique useful in the
preparation of individual peptides, or biologically functional
equivalent proteins or peptides, through specific mutagenesis of
the underlying DNA. The technique further provides a ready ability
to prepare and test sequence variants, incorporating one or more of
tho foregoing considerations, by introducing one or more nucleotide
sequence changes into the DNA. Site-specific mutagenesis allows the
production of mutants through the use of specific oligonucleotide
sequences which encode the DNA sequence of the desired mutation, as
well as a sufficient number of adjacent nucleotides, to provide a
primer sequence of sufficient size and sequence complexity to form
a stable duplex on both sides of the deletion junction being
traversed. Typically, a primer of about 17 to 25 nucleotides in
length is preferred, with about 5 to 10 residues on both sides of
the junction of the sequence being altered.
[0214] In general, the technique of site-specific mutagenesis is
well known in the art. As will be appreciated, the technique
typically employs a bacteriophage vector that exists in both a
single stranded and double stranded form. Typical vectors useful in
site-directed mutagenesis include vectors such as the M13 phage.
These phage vectors are commercially available and their use is
generally well known to those skilled in the art. Double stranded
plasmids are also routinely employed in site directed mutagenesis,
which eliminates the step of transferring the gene of interest from
a phage to a plasmid.
[0215] In general, site-directed mutagenesis is performed by first
obtaining a single-stranded vector, or melting of two strands of a
double stranded vector which includes within its sequence a DNA
sequence encoding the desired protein. An oligonucleotide primer
bearing the desired mutated sequence is synthetically prepared.
This primer is then annealed with the single-stranded DNA
preparation, and subjected to DNA polymerizing enzymes such as E.
coli polymerase I Klenow fragment, in order to complete the
synthesis of the mutation-bearing strand. Thus, a heteroduplex is
formed wherein one strand encodes the original non-mutated sequence
and the second strand bears the desired mutation. This heteroduplex
vector is then used to transform appropriate cells, such as E. coli
cells, and clones are selected that include recombinant vectors
bearing the mutated sequence arrangement.
[0216] The preparation of sequence variants of the selected gene
using site-directed mutagenesis is provided as a means of producing
potentially useful species and is not meant to be limiting, as
there are other ways in which sequence variants of genes may be
obtained. For example, recombinant vectors encoding the desired
gene may be treated with mutagenic agents, such as hydroxylamine,
to obtain sequence variants.
H. Expression and Purification of Encoded Proteins
[0217] 1. Expression of Proteinsfrom Cloned cDNAs
[0218] The cDNA species specified in SEQ ID NO: 1, SEQ ID NO:3, SEQ
ID NO:5, SEQ ID NO:7, and HNF1.alpha. can be expressed as encoded
peptides or proteins. In other embodiments cDNA species specified
in SEQ ID NO:78, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID
NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ
ID NO:50, SEQ ID NO:52, SEQ ID NO:54, and HNF4.alpha. can be
expressed as encoded peptides or proteins. The DNA species
specified in SEQ ID NO: 128 and HNF1.beta. can be expressed as
encoded peptides or proteins. The engineering of DNA segment(s) for
expression in a prokaryotic or eukaryotic system may be performed
by techniques generally known to those of skill in recombinant
expression. It is believed that virtually any expression system may
be employed in the expression of the claimed nucleic acid
sequences.
[0219] Both cDNA and genomic sequences are suitable for eukaryotic
expression, as the host cell will generally process the genomic
transcripts to yield functional mRNA for translation into protein.
Generally speaking, it may be more convenient to employ as the
recombinant gene a cDNA version of the gene. It is believed that
the use of a cDNA version will provide advantages in that the size
of the gene will generally be much smaller and more readily
employed to transfect the targeted cell than will a genomic gene,
which will typically be up to an order of magnitude larger than the
cDNA gene. However, the inventor does not exclude the possibility
of employing a genomic version of a particular gene where
desired.
[0220] As used herein, the terms "engineered" and "recombinant"
cells are intended to refer to a cell into which an exogenous DNA
segment or gene, such as a cDNA or gene has been introduced.
Therefore, engineered cells are distinguishable from naturally
occurring cells which do not contain a recombinantly introduced
exogenous DNA segment or gene. Engineered cells are thus cells
having a gene or genes introduced through the hand of man.
Recombinant cells include those having an introduced cDNA or
genomic DNA, and also include genes positioned adjacent to a
promoter not naturally associated with the particular introduced
gene.
[0221] To express a recombinant encoded protein or peptide, whether
mutant or wild-type, in accordance with the present invention one
would prepare an expression vector that comprises one of the
claimed isolated nucleic acids under the control of one or more
promoters. To bring a coding sequence "under the control of" a
promoter, one positions the 5' end of the translational initiation
site of the reading frame generally between about 1 and 50
nucleotides "downstream" of (ie., 3' of) the chosen promoter. The
"upstream" promoter stimulates transcription of the inserted DNA
and promotes expression of the encoded recombinant protein. This is
the meaning of "recombinant expression" in the context used
here.
[0222] Many standard techniques are available to construct
expression vectors containing the appropriate nucleic acids and
transcriptionalutranslational control sequences in order to achieve
protein or peptide expression in a variety of host-expression
systems. Cell types available for expression include, but are not
limited to, bacteria, such as E. coli and B. subtilis transformed
with recombinant phage DNA, plasmid DNA or cosmid DNA expression
vectors.
[0223] Certain examples of prokaryotic hosts are E. coli strain
RR1, E. coli LE392, E. coli B, E. coli .chi.1776 (ATCC No. 31537)
as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No.
273325); bacilli such as Bacillus subtilis; and other
enterobacteriaceae such as Salmonella typhimurium, Serratia
marcescens, and various Pseudomonas species.
[0224] In general, plasmid vectors containing replicon and control
sequences that are derived from species compatible with the host
cell are used in connection with these hosts. The vector ordinarily
carries a replication site, as well as marking sequences that are
capable of providing phenotypic selection in transformed cells. For
example, E. coli is often transformed using pBR322, a plasmid
derived from an E. coli species. Plasmid pBR322 contains genes for
ampicillin and tetracycline resistance and thus provides easy means
for identifying transformed cells. The pBR322 plasmid, or other
microbial plasmid or phage must also contain, or be modified to
contain, promoters that can be used by the microbial organism for
expression of its own proteins.
[0225] In addition, phage vectors containing replicon and control
sequences that are compatible with the host microorganism can be
used as transforming vectors in connection with these hosts. For
example, the phage lambda GEM.TM.-11 may be utilized in making a
recombinant phage vector that can be used to transform host cells,
such as E. coli LE392.
[0226] Further useful vectors include pIN vectors (Inouye et al.,
1985); and pGEX vectors, for use in generating glutathione
S-transferase (GST) soluble fusion proteins for later purification
and separation or cleavage. Other suitable fusion proteins are
those with .beta.-galactosidase, ubiquitin, or the like.
[0227] Promoters that are most commonly used in recombinant DNA
construction include the .beta.-lactamase (penicillinase), lactose
and tryptophan (trp) promoter systems. While these are the most
commonly used, other microbial promoters have been discovered and
utilized, and details concerning their nucleotide sequences have
been published, enabling those of skill in the art to ligate them
functionally with plasmid vectors.
[0228] For expression in Saccharomyces, the plasmid YRp7, for
example, is commonly used (Stinchcomb et al., 1979; Kingsman et
al., 1979; Tschemper et al., 1980). This plasmid contains the trpl
gene, which provides a selection marker for a mutant strain of
yeast lacking the ability to grow in tryptophan, for example ATCC
No. 44076 or PEP4-1 (Jones, 1977). The presence of the trpl lesion
as a characteristic of the yeast host cell genome then provides an
effective environment for detecting transformation by growth in the
absence of tryptophan.
[0229] Suitable promoting sequences in yeast vectors include the
promoters for 3-phosphoglycerate kinase (Hitzeman et al., 1980) or
other glycolytic enzymes (Hess et al., 1968; Holland et al., 1978),
such as enolase, glyceraldehyde-3-phosphate dehydrogenase,
hexokinase, pyruvate decarboxylase, phosphofructokinase,
glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate
kinase, triosephosphate isomerase, phosphoglucose isomerase, and
glucokinase. In constructing suitable expression plasmids, the
termination sequences associated with these genes are also ligated
into the expression vector 3' of the sequence desired to be
expressed to provide polyadenylation of the MRNA and
termination.
[0230] Other suitable promoters, which have the additional
advantage of transcription controlled by growth conditions, include
the promoter region for alcohol dehydrogenase 2, isocytochrome C,
acid phosphatase, degradative enzymes associated with nitrogen
metabolism, and the aforementioned glyceraldehyde-3-phosphate
dehydrogenase, and enzymes responsible for maltose and galactose
utilization.
[0231] In addition to micro-organisms, cultures of cells derived
from multicellular organisms may also be used as hosts. In
principle, any such cell culture is workable, whether from
vertebrate or invertebrate culture. In addition to mammalian cells,
these include insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus); and plant cell systems
infected with recombinant virus expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with recombinant plasmid expression vectors (e.g., Ti
plasmid) containing one or more coding sequences.
[0232] In a useful insect system, Autograph californica nuclear
polyhidrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The isolated
nucleic acid coding sequences are cloned into non-essential regions
(for example the polyhedron gene) of the virus and placed under
control of an AcNPV promoter (for example, the polyhedron
promoter). Successful insertion of the coding sequences results in
the inactivation of the polyhedron gene and production of
non-occluded recombinant virus (i.e., virus lacking the
proteinaceous coat coded for by the polyhedron gene). These
recombinant viruses are then used to infect Spodoptera frugiperda
cells in which the inserted gene is expressed (e.g., U.S. Pat. No.
4,215,051).
[0233] Examples of useful mammalian host cell lines are VERO and
HeLa cells, Chinese hamster ovary (CHO) cell lines, WI38, BHK,
COS-7, 293, HepG2, NIH3T3, RIN and MDCK cell lines. In addition, a
host cell may be chosen that modulates the expression of the
inserted sequences, or modifies and processes the gene product in
the specific fashion desired. Such modifications (e.g.,
glycosylation) and processing (e.g., cleavage) of protein products
may be important for the function of the encoded protein.
[0234] Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins. Appropriate cell lines or host systems can be chosen
to ensure the correct modification and processing of the foreign
protein expressed. Expression vectors for use in mammalian cells
ordinarily include an origin of replication (as necessary), a
promoter located in front of the gene to be expressed, along with
any necessary ribosome binding sites, RNA splice sites,
polyadenylation site, and transcriptional terminator sequences. The
origin of replication may be provided either by construction of the
vector to include an exogenous origin, such as may be derived from
SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may
be provided by the host cell chromosomal replication mechanism. If
the vector is integrated into the host cell chromosome, the latter
is often sufficient.
[0235] The promoters may be derived from the genome of mammalian
cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the adenovirus late promoter; the vaccinia virus 7.5K
promoter). Further, it is also possible, and may be desirable, to
utilize promoter or control sequences normally associated with the
desired gene sequence, provided such control sequences are
compatible with the host cell systems.
[0236] A number of viral based expression systems may be utilized,
for example, commonly used promoters are derived from polyoma,
Adenovirus 2, cytomegalovirus and Simian Virus 40 (SV40). The early
and late promoters of SV40 virus are useful because both are
obtained easily from the virus as a fragment which also contains
the SV40 viral origin of replication. Smaller or larger SV40
fragments may also be used, provided there is included the
approximately 250 bp sequence extending from the HinDIII site
toward the BglI site located in the viral origin of
replication.
[0237] In cases where an adenovirus is used as an expression
vector, the coding sequences may be ligated to an adenovirus
transcription/translatio- n control complex, e.g., the late
promoter and tripartite leader sequence. This chimeric gene may
then be inserted in the adenovirus genome by in vitro or in vivo
recombination. Insertion in a non-essential region of the viral
genome (e.g., region E1 or E3) will result in a recombinant virus
that is viable and capable of expressing proteins in infected
hosts.
[0238] Specific initiation signals may also be required for
efficient translation of the claimed isolated nucleic acid coding
sequences. These signals include the ATG initiation codon and
adjacent sequences. Exogenous translational control signals,
including the ATG initiation codon, may additionally need to be
provided. One of ordinary skill in the art would readily be capable
of determining this need and providing the necessary signals. It is
well known that the initiation codon must be in-frame (or in-phase)
with the reading frame of the desired coding sequence to ensure
translation of the entire insert. These exogenous translational
control signals and initiation codons can be of a variety of
origins, both natural and synthetic. The efficiency of expression
may be enhanced by the inclusion of appropriate transcription
enhancer elements or transcription terminators (Bittner et al.,
1987).
[0239] In eukaryotic expression, one will also typically desire to
incorporate into the transcriptional unit an appropriate
polyadenylation site (e.g., 5'-AATAAA-3') if one was not contained
within the original cloned segment. Typically, the poly A addition
site is placed about 30 to 2000 nucleotides "downstream" of the
termination site of the protein at a position prior to
transcription termination.
[0240] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
that stably express constructs encoding proteins may be engineered.
Rather than using expression vectors that contain viral origins of
replication, host cells can be transformed with vectors controlled
by appropriate expression control elements (e.g., promoter,
enhancer, sequences, transcription terminators, polyadenylation
sites, etc.), and a selectable marker. Following the introduction
of foreign DNA, engineered cells may be allowed to grow for 1-2
days in an enriched medium, and then are switched to a selective
medium. The selectable marker in the recombinant plasmid confers
resistance to the selection and allows cells to stably integrate
the plasmid into their chromosomes and grow to form foci, which in
turn can be cloned and expanded into cell lines.
[0241] A number of selection systems may be used, including, but
not limited, to the herpes simplex virus thymidine kinase (Wigler
et al., 1977), hypoxanthine-guanine phosphoribosyltransferase
(Szybalska et al., 1962) and adenine phosphoribosyltransferase
genes (Lowy et al., 1980), in tk.sup.-, hgprt.sup.- or aprt.sup.-
cells, respectively. Also, antimetabolite resistance can be used as
the basis of selection for dhfr, which confers resistance to
methotrexate (Wigler et al., 1980; O'Hare et al., 1981); gpt, which
confers resistance to mycophenolic acid (Mulligan et al., 1981);
neo, which confers resistance to the aminoglycoside G-418
(Colberre-Garapin et al., 1981); and hygro, which confers
resistance to hygromycin.
[0242] It is contemplated that the isolated nucleic acids of the
invention may be "overexpressed", i.e., expressed in increased
levels relative to its natural expression in human cells, or even
relative to the expression of other proteins in the recombinant
host cell. Such overexpression may be assessed by a variety of
methods, including radio-labeling and/or protein purification.
However, simple and direct methods are preferred, for example,
those involving SDS/PAGE and protein staining or western blotting,
followed by quantitative analyses, such as densitometric scanning
of the resultant gel or blot. A specific increase in the level of
the recombinant protein or peptide in comparison to the level in
natural human cells is indicative of overexpression, as is a
relative abundance of the specific protein in relation to the other
proteins produced by the host cell and, e.g., visible on a gel.
[0243] 2. Purification of Expressed Proteins
[0244] Further aspects of the present invention concern the
purification, and in particular embodiments, the substantial
purification, of an encoded protein or peptide. The term "purified
protein or peptide" as used herein, is intended to refer to a
composition, isolatable from other components, wherein the protein
or peptide is purified to any degree relative to its
naturally-obtainable state, i.e., in this case, relative to its
purity within a hepatocyte or .beta.-cell extract. A purified
protein or peptide therefore also refers to a protein or peptide,
free from the environment in which it may naturally occur.
[0245] Generally, "purified" will refer to a protein or peptide
composition that has been subjected to fractionation to remove
various other components, and which composition substantially
retains its expressed biological activity. Where the term
"substantially purified" is used, this designation will refer to a
composition in which the protein or peptide forms the major
component of the composition, such as constituting about 50% or
more of the proteins in the composition.
[0246] Various methods for quantifying the degree of purification
of the protein or peptide will be known to those of skill in the
art in light of the present disclosure. These include, for example,
determining the specific activity of an active fraction, or
assessing the number of polypeptides within a fraction by SDS/PAGE
analysis. A preferred method for assessing the purity of a fraction
is to calculate the specific activity of the fraction, to compare
it to the specific activity of the initial extract, and to thus
calculate the degree of purity, herein assessed by a "-fold
purification number". The actual units used to represent the amount
of activity will, of course, be dependent upon the particular assay
technique chosen to follow the purification and whether or not the
expressed protein or peptide exhibits a detectable activity.
[0247] Various techniques suitable for use in protein purification
will be well known to those of skill in the art. These include, for
example, precipitation with ammonium sulphate, polyethylene glycol,
antibodies and the like or by heat denaturation, followed by
centrifugation; chromatography steps such as ion exchange, gel
filtration, reverse phase, hydroxylapatite and affinity
chromatography; isoelectric focusing; gel electrophoresis; and
combinations of such and other techniques. As is generally known in
the art, it is believed that the order of conducting the various
purification steps may be changed, or that certain steps may be
omitted, and still result in a suitable method for the preparation
of a substantially purified protein or peptide.
[0248] There is no general requirement that the protein or peptide
always be provided in their most purified state. Indeed, it is
contemplated that less substantially purified products will have
utility in certain embodiments. Partial purification may be
accomplished by using fewer purification steps in combination, or
by utilizing different forms of the same general purification
scheme. For example, it is appreciated that a cation-exchange
column chromatography performed utilizing an HPLC apparatus will
generally result in a greater-fold purification than the same
technique utilizing a low pressure chromatography system. Methods
exhibiting a lower degree of relative purification may have
advantages in total recovery of protein product, or in maintaining
the activity of an expressed protein.
[0249] It is known that the migration of a polypeptide can vary,
sometimes significantly, with different conditions of SDS/PAGE
(Capaldi et al., Biochem. Biophys. Res. Comm., 76:425, 1977). It
will therefore be appreciated that under differing electrophoresis
conditions, the apparent molecular weights of purified or partially
purified expression products may vary.
I. Preparation of Antibodies Specific for Encoded Proteins
[0250] Antibody Generation
[0251] For some embodiments, it will be desired to produce
antibodies that bind with high specificity to the protein
product(s) of an isolated nucleic acid selected from the group
comprising SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or
any other mutant of HNF1.alpha., SEQ ID NO:78, SEQ ID NO:34, SEQ ID
NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ
ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54,
or any other mutant of HNF4.alpha., SEQ ID NO:128 (HNF1.beta.) or
any mutant of HNF1.beta.. Means for preparing and characterizing
antibodies are well known in the art (See, e.g., Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory, 1988;
incorporated herein by reference).
[0252] Methods for generating polyclonal antibodies are well known
in the art. Briefly, a polyclonal antibody is prepared by
immunizing an animal with an antigenic composition and collecting
antisera from that immunized animal. A wide range of animal species
can be used for the production of antisera. Typically the animal
used for production of antisera is a rabbit, a mouse, a rat, a
hamster, a guinea pig or a goat. Because of the relatively large
blood volume of rabbits, a rabbit is a preferred choice for
production of polyclonal antibodies.
[0253] As is well known in the art, a given composition may vary in
its immunogenicity. It is often necessary therefore to boost the
host immune system, as may be achieved by coupling a peptide or
polypeptide immunogen to a carrier. Exemplary and preferred
carriers are keyhole limpet hemocyanin (KLH) and bovine serum
albumin (BSA). Other albumins such as ovalbumin, mouse serum
albumin or rabbit serum albumin can also be used as carriers. Means
for conjugating a polypeptide to a carrier protein are well known
in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hy-
droxysuccinimide ester, carbodiimide and bis-biazotized
benzidine.
[0254] As is also well known in the art, the immunogenicity of a
particular immunogen composition can be enhanced by the use of
non-specific stimulators of the immune response, known as
adjuvants. Exemplary and preferred adjuvants include complete
Freund's adjuvant (a non-specific stimulator of the immune response
containing killed Mycobacterium tuberculosis), incomplete Freund's
adjuvants and aluminum hydroxide adjuvant.
[0255] The amount of immunogen composition used in the production
of polyclonal antibodies varies upon the nature of the immunogen as
well as the animal used for immunization. A variety of routes can
be used to administer the immunogen (subcutaneous, intramuscular,
intradermal, intravenous and intraperitoneal). The production of
polyclonal antibodies may be monitored by sampling blood of the
immunized animal at various points following immunization. A
second, booster injection, may also be given. The process of
boosting and titering is repeated until a suitable titer is
achieved. When a desired level of immunogenicity is obtained, the
immunized animal can be bled and the serum isolated and stored,
and/or in some cases the animal can be used to generate MAbs. For
production of rabbit polyclonal antibodies, the animal can be bled
through an ear vein or alternatively by cardiac puncture. The
removed blood is allowed to coagulate and then centrifuged to
separate serum components from whole cells and blood clots. The
serum may be used as is for various applications or the desired
antibody fraction may be purified by well-known methods, such as
affinity chromatography using another antibody or a peptide bound
to a solid matrix.
[0256] Monoclonal antibodies (MAbs) may be readily prepared through
use of well-known techniques, such as those exemplified in U.S.
Pat. No. 4,196,265, incorporated herein by reference. Typically,
this technique involves immunizing a suitable animal with a
selected immunogen composition, e.g., a purified or partially
purified expressed protein, polypeptide or peptide. The immunizing
composition is administered in a manner that effectively stimulates
antibody producing cells.
[0257] The methods for generating monoclonal antibodies (MAbs)
generally begin along the same lines as those for preparing
polyclonal antibodies. Rodents such as mice and rats are preferred
animals, however, the use of rabbit, sheep or frog cells is also
possible. The use of rats may provide certain advantages (Goding,
1986, pp. 60-61), but mice are preferred, with the BALBIc mouse
being most preferred as this is most routinely used and generally
gives a higher percentage of stable fusions.
[0258] The animals are injected with antigen as described above.
The antigen may be coupled to carrier molecules such as keyhole
limpet hemocyanin if necessary. The antigen would typically be
mixed with adjuvant, such as Freund's complete or incomplete
adjuvant. Booster injections with the same antigen would occur at
approximately two-week intervals.
[0259] Following immunization, somatic cells with the potential for
producing antibodies, specifically B lymphocytes (B cells), are
selected for use in the MAb generating protocol. These cells may be
obtained from biopsied spleens, tonsils or lymph nodes, or from a
peripheral blood sample. Spleen cells and peripheral blood cells
are preferred, the former because they are a rich source of
antibody-producing cells that are in the dividing plasmablast
stage, and the latter because peripheral blood is easily
accessible. Often, a panel of animals will have been immunized and
the spleen of animal with the highest antibody titer will be
removed and the spleen lymphocytes obtained by homogenizing the
spleen with a syringe. Typically, a spleen from an immunized mouse
contains approximately 5.times.10.sup.7 to 2.times.10.sup.8
lymphocytes.
[0260] The antibody-producing B lymphocytes from the immunized
animal are then fused with cells of an immortal myeloma cell,
generally one of the same species as the animal that was immunized.
Myeloma cell lines suited for use in hybridoma-producing fusion
procedures preferably are non-antibody-producing, have high fusion
efficiency, and have enzyme deficiencies that render them incapable
of growing in certain selective media that support the growth of
only the desired fused cells (hybridomas).
[0261] Any one of a number of myeloma cells may be used, as are
known to those of skill in the art (Goding, pp. 65-66, 1986;
Campbell, pp. 75-83, 1984). For example, where the immunized animal
is a mouse, one may use P3-X63/Ag8, X63-Ag8.653, NS1/1.Ag 4 1,
Sp210-Ag14, FO, NSO/U, MPC-11, MPC11-X45-GTG 1.7 and S 194/5XX0
Bul; for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and
4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all
useful in connection with human cell fusions.
[0262] One preferred murine myeloma cell is the NS-1 myeloma cell
line (also termed P3-NS-1-Ag4-1), which is readily available from
the NIGMS Human Genetic Mutant Cell Repository by requesting cell
line repository number GM3573. Another mouse myeloma cell line that
may be used is the 8-azaguanine-resistant mouse murine myeloma
SP2/0 non-producer cell line.
[0263] Methods for generating hybrids of antibody-producing spleen
or lymph node cells and myeloma cells usually comprise mixing
somatic cells with myeloma cells in a 2:1 proportion, though the
proportion may vary from about 20:1 to about 1:1, respectively, in
the presence of an agent or agents (chemical or electrical) that
promote the fusion of cell membranes. Fusion methods using Sendai
virus have been described by Kohler and Milstein (1975; 1976), and
those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by
Gefter et al. (1977). The use of electrically induced fusion
methods is also appropriate (Goding pp. 71-74, 1986).
[0264] Fusion procedures usually produce viable hybrids at low
frequencies, about 1.times.10.sup.-6 to 1.times.10.sup.-8. However,
this low frequency does not pose a problem, as the viable, fused
hybrids are differentiated from the parental, unfused cells
(particularly the unfused myeloma cells that would normally
continue to divide indefinitely) by culturing in a selective
medium. The selective medium is generally one that contains an
agent that blocks the de novo synthesis of nucleotides in the
tissue culture media. Exemplary and preferred agents are
aminopterin, methotrexate, and azaserine. Aminopterin and
methotrexate block de novo synthesis of both purines and
pyrimidines, whereas azaserine blocks only purine synthesis. Where
aminopterin or methotrexate is used, the media is supplemented with
hypoxanthine and thymidine as a source of nucleotides (HAT medium).
Where azaserine is used, the media is supplemented with
hypoxanthine.
[0265] The preferred selection medium is HAT. Only cells capable of
operating nucleotide salvage pathways are able to survive in HAT
medium. The myeloma cells are defective in key enzymes of the
salvage pathway, e.g., hypoxanthine phosphoribosyl transferase
(HPRT), and thus they cannot survive. The B cells can operate this
pathway, but they have a limited life span in culture and generally
die within about two weeks. Therefore, the only cells that can
survive in the selective media are those hybrids formed from
myeloma and B cells.
[0266] This culturing provides a population of hybridomas from
which specific hybridomas are selected. Typically, selection of
hybridomas is performed by culturing the cells by single-clone
dilution in microtiter plates, followed by testing the individual
clonal supernatants (after about two to three weeks) for the
desired reactivity. The assay should be sensitive, simple and
rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity
assays, plaque assays, dot immunobinding assays, and the like.
[0267] The selected hybridomas would then be serially diluted and
cloned into individual antibody-producing cell lines, which can
then be propagated indefinitely to provide MAbs. The cell lines may
be exploited for MAb production in two basic ways. A sample of the
hybridoma can be injected (often into the peritoneal cavity) into a
histocompatible animal of the type that was used to provide the
somatic and myeloma cells for the original fusion. The injected
animal develops tumors secreting the specific monoclonal antibody
produced by the fused cell hybrid. The body fluids of the animal,
such as serum or ascites fluid, can then be tapped to provide MAbs
in high concentration. The individual cell lines could also be
cultured in vitro, where the MAbs are naturally secreted into the
culture medium from which they can be readily obtained in high
concentrations. MAbs produced by either means may be further
purified, if desired, using filtration, centrifugation and various
chromatographic methods such as HPLC or affinity
chromatography.
[0268] Large amounts of the monoclonal antibodies of the present
invention may also be obtained by multiplying hybridoma cells in
vivo. Cell clones are injected into mammals that are
histocompatible with the parent cells, e.g., syngeneic mice, to
cause growth of antibody-producing tumors. Optionally, the animals
are primed with a hydrocarbon, especially oils such as pristane
(tetramethylpentadecane) prior to injection.
[0269] In accordance with the present invention, fragments of the
monoclonal antibody of the invention can be obtained from the
monoclonal antibody produced as described above, by methods which
include digestion with enzymes such as pepsin or papain and/or
cleavage of disulfide bonds by chemical reduction. Alternatively,
monoclonal antibody fragments encompassed by the present invention
can be synthesized using an automated peptide synthesizer, or by
expression of full-length gene or of gene fragments in E. coli.
[0270] The monoclonal conjugates of the present invention are
prepared by methods known in the art, e.g., by reacting a
monoclonal antibody prepared as described above with, for instance,
an enzyme in the presence of a coupling agent such as
glutaraldehyde or periodate. Conjugates with fluorescein markers
are prepared in the presence of these coupling agents or by
reaction with an isothiocyanate. Conjugates with metal chelates are
similarly produced. Other moieties to which antibodies may be
conjugated include radionuclides such as .sup.3H, 125I,
.sup.131.sup.32P, .sup.35S, .sup.14C, .sup.51Cr, .sup.36Cl,
.sup.57Co, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152Eu, and
.sup.99mTc, are other useful labels that can be conjugated to
antibodies. Radioactively labeled monoclonal antibodies of the
present invention are produced according to well-known methods in
the art. For instance, monoclonal antibodies can be iodinated by
contact with sodium or potassium iodide and a chemical oxidizing
agent such as sodium hypochlorite, or an enzymatic oxidizing agent,
such as lactoperoxidase. Monoclonal antibodies according to the
invention may be labeled with technetium-.sup.99 by ligand exchange
process, for example, by reducing pertechnate with stannous
solution, chelating the reduced technetium onto a Sephadex column
and applying the antibody to this column or by direct labelling
techniques, e.g., by incubating pertechnate, a reducing agent such
as SNCl.sub.2, a buffer solution such as sodium-potassium phthalate
solution, and the antibody.
[0271] It will be appreciated by those of skill in the art that
monoclonal or polyclonal antibodies specific for HNF1.alpha.,
HNF1.beta. or HNF4.alpha. (for proteins that are mutated in MODY3,
MODY4, and MODY1) will have utilities in several types of
applications. These can include the production of diagnostic kits
for use in detecting or diagnosing MODY3, MODY4, and MODY1 type
diabetes. The skilled practitioner will realize that such uses are
within the scope of the present invention.
J. Immunodetection Assays
[0272] The immunodetection methods of the present invention have
evident utility in the diagnosis of conditions such as MODY3,
MODY4, and MODY1 related NIDDM. Here, a biological or clinical
sample suspected of containing either the encoded protein or
peptide or corresponding antibody is used. However, these
embodiments also have applications to non-clinical samples, such as
in the titering of antigen or antibody samples, in the selection of
hybridomas, and the like.
[0273] In the clinical diagnosis or monitoring of patients with
MODY3, MODY4 or MODY1, the detection of an antigen encoded by an
HNF1.alpha. nucleic acid, HNF4.alpha. nucleic acid, HNF1.beta.
nucleic acid, or an decrease in the levels of such an antigen, in
comparison to the levels in a corresponding biological sample from
a normal subject is indicative of a patient with MODY3, MODY4, or
MODY1. The basis for such diagnostic methods lies, in part, with
the finding that the nucleic acid HNF1.alpha., HNF1.beta. and
HNF4.alpha. mutants identified in the present invention are
responsible for MODY3, MODY4, and MODY1 related diabetes,
respectively. Hence, it can be inferred that at least some of these
mutations produce elevated levels of encoded proteins, that may
also be used as markers for MODY3, MODY4 or MODY1.
[0274] Those of skill in the art are very familiar with
differentiating between significant expression of a biomarker,
which represents a positive identification, and low level or
background expression of a biomarker. Indeed, background expression
levels are often used to form a "cut-off" above which increased
staining will be scored as significant or positive. Significant
expression may be represented by high levels of antigens in tissues
or within body fluids, or alternatively, by a high proportion of
cells from within a tissue that each give a positive signal.
[0275] 1. Immunodetection Methods
[0276] In still further embodiments, the present invention concerns
immunodetection methods for binding, purifying, removing,
quantifying or otherwise generally detecting biological components.
The encoded proteins or peptides of the present invention may be
employed to detect antibodies having reactivity therewith, or,
alternatively, antibodies prepared in accordance with the present
invention, may be employed to detect the encoded proteins or
peptides. The steps of various useful immunodetection methods have
been described in the scientific literature, such as, e.g.,
Nakamura et al. (1987).
[0277] In general, the immunobinding methods include obtaining a
sample suspected of containing a protein, peptide or antibody, and
contacting the sample with an antibody or protein or peptide in
accordance with the present invention, as the case may be, under
conditions effective to allow the formation of immunocomplexes.
[0278] The immunobinding methods include methods for detecting or
quantifying the amount of a reactive component in a sample, which
methods require the detection or quantitation of any immune
complexes formed during the binding process. Here, one would obtain
a sample suspected of containing a HNF1.alpha. or HNF4.alpha.
mutant encoded protein, peptide or a corresponding antibody, and
contact the sample with an antibody or encoded protein or peptide,
as the case may be, and then detect or quantify the amount of
immune complexes formed under the specific conditions.
[0279] In terms of antigen detection, the biological sample
analyzed may be any sample that is suspected of containing a
HNF1.alpha., HNF1.beta. or HNF4.alpha. antigen, such as a
pancreatic .beta.-cell, a homogenized tissue extract, an isolated
cell, a cell membrane preparation, separated or purified forms of
any of the above protein-containing compositions, or even any
biological fluid that comes into contact with diabetic tissue,
including blood.
[0280] Contacting the chosen biological sample with the protein,
peptide or antibody under conditions effective and for a period of
time sufficient to allow the formation of immune complexes (primary
immune complexes) is generally a matter of simply adding the
composition to the sample and incubating the mixture for a period
of time long enough for the antibodies to form immune complexes
with, i.e., to bind to, any antigens present. After this time, the
sample-antibody composition, such as a tissue section, ELISA plate,
dot blot or western blot, will generally be washed to remove any
non-specifically bound antibody species, allowing only those
antibodies specifically bound within the primary immune complexes
to be detected.
[0281] In general, the detection of immunocomplex formation is well
known in the art and may be achieved through the application of
numerous approaches. These methods are generally based upon the
detection of a label or marker, such as any radioactive,
fluorescent, biological or enzymatic tags or labels of standard use
in the art. U.S. patents concerning the use of such labels include
U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149 and 4,366,241, each incorporated herein by
reference. Of course, one may find additional advantages through
the use of a secondary binding ligand such as a second antibody or
a biotin/avidin ligand binding arrangement, as is known in the
art.
[0282] The encoded protein, peptide or corresponding antibody
employed in the detection may itself be linked to a detectable
label, wherein one would then simply detect this label, thereby
allowing the amount of the primary immune complexes in the
composition to be determined.
[0283] Alternatively, the first added component that becomes bound
within the primary immune complexes may be detected by means of a
second binding ligand that has binding affinity for the encoded
protein, peptide or corresponding antibody. In these cases, the
second binding ligand may be linked to a detectable label. The
second binding ligand is itself often an antibody, which may thus
be termed a "secondary" antibody. The primary aimmune complexes are
contacted with the labeled, secondary binding ligand, or antibody,
under conditions effective and for a period of time sufficient to
allow the formation of secondary immune complexes. The secondary
immune complexes are then generally washed to remove any
non-specifically bound labeled secondary antibodies or ligands, and
the remaining label in the secondary immune complexes is then
detected.
[0284] Further methods include the detection of primary immune
complexes by a two step approach. A second binding ligand, such as
an antibody, that has binding affinity for the encoded protein,
peptide or corresponding antibody is used to form secondary immune
complexes, as described above. After washing, the secondary immune
complexes are contacted with a third binding ligand or antibody
that has binding affinity for the second antibody, again under
conditions effective and for a period of time sufficient to allow
the formation of immune complexes (tertiary immune complexes). The
third ligand or antibody is linked to a detectable label, allowing
detection of the tertiary immune complexes thus formed. This system
may provide for signal amplification if desired.
[0285] 2. Immunohistochemistry
[0286] The antibodies of the present invention may also be used in
conjunction with both fresh-frozen and formalin-fixed,
paraffin-embedded tissue blocks prepared for study by
immnunohistochemistry (IHC). For example, each tissue block
consists of 50 mg of residual "pulverized" diabetic tissue. The
method of preparing tissue blocks from these particulate specimens
has been successfully used in previous IHC studies of various
prognostic factors, and is well known to those of skill in the art
(Brown et al., 1990; Abbondanzo et al., 1990; Allred et al.,
1990).
[0287] Briefly, frozen-sections may be prepared by rehydrating 50
ng of frozen "pulverized" diabetic tissue at room temperature in
phosphate buffered saline (PBS) in small plastic capsules;
pelleting the particles by centrifugation; resuspending them in a
viscous embedding medium (OCT); inverting the capsule and pelleting
again by centrifugation; snap-freezing in -70.degree. C.
isopentane; cutting the plastic capsule and removing the frozen
cylinder of tissue; securing the tissue cylinder on a cryostat
microtome chuck; and cutting 25-50 serial sections.
[0288] Permanent-sections may be prepared by a similar method
involving rehydration of the 50 mg sample in a plastic microfuge
tube; pelleting; resuspending in 10% formalin for 4 hours fixation;
washing/pelleting; resuspending in warm 2.5% agar; pelleting;
cooling in ice water to harden the agar; removing the tissue/agar
block from the tube; infiltrating and embedding the block in
paraffin; and cutting up to 50 serial permanent sections.
[0289] 3. Elisa
[0290] As noted, it is contemplated that the encoded proteins or
peptides of the invention will find utility as immunogens, e.g., in
connection with vaccine development, in immunohistochemistry and in
ELISA assays. One evident utility of the encoded antigens and
corresponding antibodies is in immunoassays for the detection of
HNF1.alpha., HNF1.beta. and HNF4.alpha., mutant protiens, as needed
in diagnosis and prognostic monitoring of MODY.
[0291] Immunoassays, in their most simple and direct sense, are
binding assays. Certain preferred immunoassays are the various
types of enzyme linked immunosorbent assays (ELISA) and
radioimmunoassays (RIA) known in the art. Immunohistochemical
detection using tissue sections is also particularly useful.
However, it will be readily appreciated that detection is not
limited to such techniques, and western blotting, dot blotting,
FACS analyses, and the like may also be used.
[0292] In one exemplary ELISA, antibodies binding to the encoded
proteins of the invention are immobilized onto a selected surface
exhibiting protein affinity, such as a well in a polystyrene
microtiter plate. Then, a test composition suspected of containing
the HNF1.alpha., HNF1.beta. or HNF4.alpha. mutant, such as a
clinical sample, is added to the wells. After binding and washing
to remove non-specifically bound immune complexes, the bound
antibody may be detected. Detection is generally achieved by the
addition of a second antibody specific for the target protein, that
is linked to a detectable label. This type of ELISA is a simple
"sandwich ELISA". Detection may also be achieved by the addition of
a second antibody, followed by the addition of a third antibody
that has binding affinity for the second antibody, with the third
antibody being linked to a detectable label.
[0293] In another exemplary ELISA, the samples suspected of
containing the mutant HNF1.alpha., HNF1.beta. or HNF4.alpha.
antigen are immobilized onto the well surface and then contacted
with the antibodies of the invention. After binding and washing to
remove non-specifically bound immune complexes, the bound antigen
is detected. Where the initial antibodies are linked to a
detectable label, the immune complexes may be detected directly.
Again, the immune complexes may be detected using a second antibody
that has binding affinity for the first antibody, with the second
antibody being linked to a detectable label.
[0294] Another ELISA in which the proteins or peptides are
immobilized, involves the use of antibody competition in the
detection. In this ELISA, labeled antibodies are added to the
wells, allowed to bind to the mutant HNF1.alpha. protein, mutant
HNF1.beta. protein or mutant HNF4.alpha. protein, and detected by
means of their label. The amount of marker antigen in an unknown
sample is then determined by mixing the sample with the labeled
antibodies before or during incubation with coated wells. The
presence of marker antigen in the sample acts to reduce the amount
of antibody available for binding to the well and thus reduces the
ultimate signal. This is appropriate for detecting antibodies in an
unknown sample, where the unlabeled antibodies bind to the
antigen-coated wells and also reduces the amount of antigen
available to bind the labeled antibodies.
[0295] Irrespective of the format employed, ELISAs have certain
features in common, such as coating, incubating or binding, washing
to remove non-specifically bound species, and detecting the bound
immune complexes. These are described as follows:
[0296] In coating a plate with either antigen or antibody, one will
generally incubate the wells of the plate with a solution of the
antigen or antibody, either overnight or for a specified period of
hours. The wells of the plate will then be washed to remove
incompletely adsorbed material. Any remaining available surfaces of
the wells are then "coated" with a nonspecific protein that is
antigenically neutral with regard to the test antisera. These
include bovine serum albumin (BSA), casein and solutions of milk
powder. The coating of nonspecific adsorption sites on the
immobilizing surface reduces the background caused by nonspecific
binding of antisera to the surface.
[0297] In ELISAs, it is probably more customary to use a secondary
or tertiary detection means rather than a direct procedure. Thus,
after binding of a protein or antibody to the well, coating with a
non-reactive material to reduce background, and washing to remove
unbound material, the immobilizing surface is contacted with the
control MODY3, MODY4 or MODY1 and/or clinical or biological sample
to be tested under conditions effective to allow immune complex
(antigen/antibody) formation. Detection of the immune complex then
requires a labeled secondary binding ligand or antibody, or a
secondary binding ligand or antibody in conjunction with a labeled
tertiary antibody or third binding ligand. "Under conditions
effective to allow immune complex (antigen/antibody) formation"
means that the conditions preferably include diluting the antigens
and antibodies with solutions such as BSA, bovine gamma globulin
(BGG) and phosphate buffered saline (PBS)/Tween.TM.. These added
agents also tend to assist in the reduction of nonspecific
background.
[0298] The "suitable" conditions also mean that the incubation is
at a temperature and for a period of time sufficient to allow
effective binding. Incubation steps are typically from about 1 to 2
to 4 hours, at temperatures preferably on the order of 25.degree.
to 27.degree. C., or may be overnight at about 4.degree. C. or
so.
[0299] Following all incubation steps in an ELISA, the contacted
surface is washed so as to remove non-complexed material. A
preferred washing procedure includes washing with a solution such
as PBS/Tween.TM., or borate buffer. Following the formation of
specific immune complexes between the test sample and the
originally bound material, and subsequent washing, the occurrence
of even minute amounts of immune complexes may be determined.
[0300] To provide a detecting means, the second or third antibody
will have an associated label to allow detection. Preferably, this
label will be an enzyme that will generate color development upon
incubating with an appropriate chromogenic substrate. Thus, for
example, one will desire to contact and incubate the first or
second immune complex with a urease, glucose oxidase, alkaline
phosphatase or hydrogen peroxidase-conjugated antibody for a period
of time and under conditions that favor the development of further
immune complex formation (e.g., incubation for 2 hours at room
temperature in a PBS-containing solution such as
PBS-Tween.TM.).
[0301] After incubation with the labeled antibody, and subsequent
to washing to remove unbound material, the amount of label is
quantified, e.g., by incubation with a chromogenic substrate such
as urea and bromocresol purple or
2,2'-azido-di-(3-ethyl-benzthiazoline-6-sulfonic acid [ABTS] and
H.sub.2O.sub.2, in the case of peroxidase as the enzyme label.
Quantitation is then achieved by measuring the degree of color
generation. e.g., using a visible spectra spectrophotometer.
[0302] 4. Use of Antibodies for Radioimaging
[0303] The antibodies of this invention will be used to quantify
and localize the expression of the encoded marker proteins. The
antibody, for example, will be labeled by any one of a variety of
methods and used to visualize the localized concentration of the
cells producing the encoded protein. Such an assay also will reveal
the subcellular localization of the protein, which can have
diagnostic and therapeutic applications.
[0304] In accordance with this invention, the monoclonal antibody
or fragment thereof may be labeled by any of several techniques
known to the art. The methods of the present invention may also use
paramagnetic isotopes for purposes of in vivo detection. Elements
particularly useful in Magnetic Resonance Imaging ("MRI") include
.sup.157Gd, ssMn, .sup.62Dy, .sup.52Cr, and .sup.56Fe.
[0305] Administration of the labeled antibody may be local or
systemic and accomplished intravenously, intraarterially, via the
spinal fluid or the like. Administration may also be intradermal or
intracavitary, depending upon the body site under examination.
After a sufficient time has lapsed for the monoclonal antibody or
fragment thereof to bind with the diseased tissue, for example, 30
minutes to 48 hours, the area of the subject under investigation is
examined by routine imaging techniques such as MRI, SPECT, planar
scintillation imaging or newly emerging imaging techniques. The
exact protocol will necessarily vary depending upon factors
specific to the patient, as noted above, and depending upon the
body site under examination, method of administration and type of
label used; the determination of specific procedures would be
routine to the skilled artisan. The distribution of the bound
radioactive isotope and its increase or decrease with time is then
monitored and recorded. By comparing the results with data obtained
from studies of clinically normal individuals, the presence and
extent of the diseased tissue can be determined.
[0306] It will be apparent to those of skill in the art that a
similar approach may be used to radio-image the production of the
encoded HNF1.alpha., HNF1.beta. or HNF4.alpha. mutant proteins in
human patients. The present invention provides methods for the in
vivo diagnosis of MODY3, MODY4 or MODY1 in a patient. Such methods
generally comprise administering to a patient an effective amount
of an HNF1.alpha., HNF1.beta. or HNF4.alpha. mutant specific
antibody, to which antibody is conjugated a marker, such as a
radioactive isotope or a spin-labeled molecule, that is detectable
by non-invasive methods. The antibody-marker conjugate is allowed
sufficient time to come into contact with reactive antigens that
are present within the tissues of the patient, and the patient is
then exposed to a detection device to identify the detectable
marker.
[0307] 5. Kits
[0308] In still further embodiments, the present invention concerns
immunodetection kits for use with the immunodetection methods
described above. As the encoded proteins or peptides may be
employed to detect antibodies and the corresponding antibodies may
be employed to detect encoded proteins or peptides, either or both
of such components may be provided in the kit. The immunodetection
kits will thus comprise, in suitable container means, an encoded
protein or peptide, or a first antibody that binds to an encoded
protein or peptide, and an immunodetection reagent.
[0309] In certain embodiments, the encoded protein or peptide, or
the first antibody that binds to the encoded protein or peptide,
may be bound to a solid support, such as a column matrix or well of
a microtiter plate.
[0310] The immunodetection reagents of the kit may take any one of
a variety of forms, including those detectable labels that are
associated with or linked to the given antibody or antigen, and
detectable labels that are associated with or attached to a
secondary binding ligand. Exemplary secondary ligands are those
secondary antibodies that have binding affinity for the first
antibody or antigen, and secondary antibodies that have binding
affinity for a human antibody.
[0311] Further suitable immunodetection reagents for use in the
present kits include the two-component reagent that comprises a
secondary antibody that has binding affinity for the first antibody
or antigen, along with a third antibody that has binding affinity
for the second antibody, the third antibody being linked to a
detectable label.
[0312] The kits may further comprise a suitably aliquoted
composition of the encoded protein or polypeptide antigen, whether
labeled or unlabeled, as may be used to prepare a standard curve
for a detection assay.
[0313] The kits may contain antibody-label conjugates either in
fully conjugated form, in the form of intermediates, or as separate
moieties to be conjugated by the user of the kit. The components of
the kits may be packaged either in aqueous media or in lyophilized
form.
[0314] The container means of the kits will generally include at
least one vial, test tube, flask, bottle, syringe or other
container means, into which the antibody or antigen may be placed,
and preferably, suitably aliquoted. Where a second or third binding
ligand or additional component is provided, the kit will also
generally contain a second, third or other additional container
into which this ligand or component may be placed. The kits of the
present invention will also typically include a means for
containing the antibody, antigen, and any other reagent containers
in close confinement for commercial sale. Such containers may
include injection or blow-molded plastic containers into which the
desired vials are retained.
K. Detection and Quantitation of Nucleic Acid Species
[0315] One embodiment of the instant invention comprises a method
for identification of HNF1.alpha., HNF1.beta. or HNF4.alpha.
mutants in a biological sample by amplifying and detecting nucleic
acids corresponding to HNF1.alpha., HNF1.beta. or HNF4.alpha.
mutants. The biological sample can be any tissue or fluid in which
these mutants might be present. Various embodiments include .beta.
and .alpha.-cells of pancreatic islets, bone marrow aspirate, bone
marrow biopsy, lymph node aspirate, lymph node biopsy, spleen
tissue, fine needle aspirate, skin biopsy or organ tissue biopsy.
Other embodiments include samples where the body fluid is
peripheral blood, lymph fluid, ascites, serous fluid, pleural
effusion, sputum, cerebrospinal fluid, lacrimal fluid, stool or
urine.
[0316] Nucleic acid used as a template for amplification is
isolated from cells contained in the biological sample, according
to standard methodologies (Sambrook et al., 1989). The nucleic acid
may be genomic DNA or fractionated or whole cell RNA. Where RNA is
used, it may be desired to convert the RNA to a complementary DNA.
In one embodiment, the RNA is whole cell RNA and is used directly
as the template for amplification.
[0317] Pairs of primers that selectively hybridize to nucleic acids
corresponding to HNF1.alpha., HNF1.beta. or HNF4.alpha. mutants are
contacted with the isolated nucleic acid under conditions that
permit selective hybridization. Once hybridized, the nucleic
acid:primer complex is contacted with one or more enzymes that
facilitate template-dependent nucleic acid synthesis. Multiple
rounds of amplification, also referred to as "cycles," are
conducted until a sufficient amount of amplification product is
produced.
[0318] Next, the amplification product is detected. In certain
applications, the detection may be performed by visual means.
Alternatively, the detection may involve indirect identification of
the product via chemiluminescence, radioactive scintigraphy of
incorporated radiolabel or fluorescent label or even via a system
using electrical or thermal impulse signals (Affymax technology;
Bellus, 1994).
[0319] Following detection, one may compare the results seen in a
given patient with a statistically significant reference group of
normal patients and MODY or indeed MODY dependent diabetics and non
MODY dependent diabetics. In this way, it is possible to correlate
the amount of HNF1.alpha., HNF1.beta. or HNF4.alpha. mutants
detected with various clinical states.
[0320] 1. Primers
[0321] The term primer, as defined herein, is meant to encompass
any nucleic acid that is capable of priming the synthesis of a
nascent nucleic acid in a template-dependent process. Typically,
primers are oligonucleotides from ten to twenty base pairs in
length, but longer sequences can be employed. Primers may be
provided in double-stranded or single-stranded form, although the
single-stranded form is preferred.
[0322] 2. Template Dependent Amplification Methods
[0323] A number of template dependent processes are available to
amplify the marker sequences present in a given template sample.
One of the best known amplification methods is the polymerase chain
reaction (referred to as PCR) which is described in detail in U.S.
Pat. Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al.,
1990, each of which is incorporated herein by reference in its
entirety.
[0324] Briefly, in PCR, two primer sequences are prepared that are
complementary to regions on opposite complementary strands of the
marker sequence. An excess of deoxynucleoside triphosphates are
added to a reaction mixture along with a DNA polymerase, e.g., Taq
polymerase. If the marker sequence is present in a sample, the
primers will bind to the marker and the polymerase will cause the
primers to be extended along the marker sequence by adding on
nucleotides. By raising and lowering the temperature of the
reaction mixture, the extended primers will dissociate from the
marker to form reaction products, excess primers will bind to the
marker and to the reaction products and the process is
repeated.
[0325] A reverse transcriptase PCR amplification procedure may be
performed in order to quantify the amount of mRNA amplified.
Methods of reverse transcribing RNA into cDNA are well known and
described in Sambrook et al., 1989. Alternative methods for reverse
transcription utilize thermostable, RNA-dependent DNA polymerases.
These methods are described in WO 90/07641 filed Dec. 21, 1990.
Polymerase chain reaction methodologies are well known in the
art.
[0326] Another method for amplification is the ligase chain
reaction ("LCR"), disclosed in EPA No. 320 308, incorporated herein
by reference in its entirety. In LCR, two complementary probe pairs
are prepared, and in the presence of the target sequence, each pair
will bind to opposite complementary strands of the target such that
they abut. In the presence of a ligase, the two probe pairs will
link to form a single unit. By temperature cycling, as in PCR,
bound ligated units dissociate from the target and then serve as
"target sequences" for ligation of excess probe pairs. U.S. Pat.
No. 4,883,750 describes a method similar to LCR for binding probe
pairs to a target sequence.
[0327] Qbeta Replicase, described in PCT Application No.
PCT/US87/00880, may also be used as still another amplification
method in the present invention. In this method, a replicative
sequence of RNA that has a region complementary to that of a target
is added to a sample in the presence of an RNA polymerase. The
polymerase will copy the replicative sequence that can then be
detected.
[0328] An isothermal amplification method, in which restriction
endonucleases and ligases are used to achieve the amplification of
target molecules that contain nucleotide
5'-[alpha-thio]-triphosphates in one strand of a restriction site
may also be useful in the amplification of nucleic acids in the
present invention, Walker et al., (1992), incorporated herein by
reference in its entirety.
[0329] Strand Displacement Amplification (SDA) is another method of
carrying out isothermal amplification of nucleic acids which
involves multiple rounds of strand displacement and synthesis,
i.e., nick translation. A similar method, called Repair Chain
Reaction (RCR), involves annealing several probes throughout a
region targeted for amplification, followed by a repair reaction in
which only two of the four bases are present. The other two bases
can be added as biotinylated derivatives for easy detection. A
similar approach is used in SDA. Target specific sequences can also
be detected using a cyclic probe reaction (CPR). In CPR, a probe
having 3' and 5' sequences of non-specific DNA and a middle
sequence of specific RNA is hybridized to DNA that is present in a
sample. Upon hybridization, the reaction is treated with RNase H,
and the products of the probe identified as distinctive products
that are released after digestion. The original template is
annealed to another cycling probe and the reaction is repeated.
[0330] Still another amplification methods described in GB
Application No. 2 202 328, and in PCT Application No.
PCT/US89/01025, each of which is incorporated herein by reference
in its entirety, may be used in accordance with the present
invention. In the former application, "modified" primers are used
in a PCR-like, template- and enzyme-dependent synthesis. The
primers may be modified by labelling with a capture moiety (e.g.,
biotin) and/or a detector moiety (e.g., enzyme). In the latter
application, an excess of labeled probes are added to a sample. In
the presence of the target sequence, the probe binds and is cleaved
catalytically. After cleavage, the target sequence is released
intact to be bound by excess probe. Cleavage of the labeled probe
signals the presence of the target sequence.
[0331] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR (Kwoh et al.,
1989); Gingeras et al., PCT Application WO 88110315, incorporated
herein by reference in their entirety). In NASBA, the nucleic acids
can be prepared for amplification by standard phenol/chloroform
extraction, heat denaturation of a clinical sample, treatment with
lysis buffer and minispin columns for isolation of DNA and RNA or
guanidinium chloride extraction of RNA. These amplification
techniques involve annealing a primer which has target specific
sequences. Following polymerization, DNA/RNA hybrids are digested
with RNase H while double stranded DNA molecules are heat denatured
again. In either case the single stranded DNA is made fully double
stranded by addition of second target specific primer, followed by
polymerization. The double-stranded DNA molecules are then multiply
transcribed by an RNA polymerase such as T7 or SP6. In an
isothermal cyclic reaction, the RNA's are reverse transcribed into
single stranded DNA, which is then converted to double stranded
DNA, and then transcribed once again with an RNA polymerase such as
T7 or SP6. The resulting products, whether truncated or complete,
indicate target specific sequences.
[0332] Davey et al., EPA No. 329 822 (incorporated herein by
reference in its entirety) disclose a nucleic acid amplification
process involving cyclically synthesizing single-stranded RNA
("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be
used in accordance with the present invention. The ssRNA is a
template for a first primer oligonucleotide, which is elongated by
reverse transcriptase (RNA-dependent DNA polymerase). The RNA is
then removed from the resulting DNA:RNA duplex by the action of
ribonuclease H (RNase H, an RNase specific for RNA in duplex with
either DNA or RNA). The resultant ssDNA is a template for a second
primer, which also includes the sequences of an RNA polymerase
promoter (exemplified by T7 RNA polymerase) 5' to its homology to
the template. This primer is then extended by DNA polymerase
(exemplified by the large "Klenow" fragment of E. coli DNA
polymerase 1), resulting in a double-stranded DNA ("dsDNA")
molecule, having a sequence identical to that of the original RNA
between the primers and having additionally, at one end, a promoter
sequence. This promoter sequence can be used by the appropriate RNA
polymerase to make many RNA copies of the DNA. These copies can
then re-enter the cycle leading to very swift amplification. With
proper choice of enzymes, this amplification can be done
isothermally without addition of enzymes at each cycle. Because of
the cyclical nature of this process, the starting sequence can be
chosen to be in the form of either DNA or RNA.
[0333] Miller et al., PCT Application WO 89/06700 (incorporated
herein by reference in its entirety) disclose a nucleic acid
sequence amplification scheme based on the hybridization of a
promoter/primer sequence to a target single-stranded DNA ("ssDNA")
followed by transcription of many RNA copies of the sequence. This
scheme is not cyclic, i.e., new templates are not produced from the
resultant RNA transcripts. Other amplification methods include
"RACE" and "one-sided PCR" (Frohman, M. A., In: PCR PROTOCOLS: A
GUIDE TO METHODS AND APPLICATIONS, Academic Press, N.Y., 1990;
Ohara et al., 1989; each herein incorporated by reference in their
entirety).
[0334] Methods based on ligation of two (or more) oligonucleotides
in the presence of nucleic acid having the sequence of the
resulting "di-oligonucleotide", thereby amplifying the
di-oligonucleotide, may also be used in the amplification step of
the present invention. Wu et al., 1989), incorporated herein by
reference in its entirety.
[0335] 3. RNase Protection Assay
[0336] Methods for genetic screening by identifying mutations
associated with most genetic diseases such as diabetes must be able
to assess large regions of the genome. Once a relevant mutation has
been identified in a given patient, other family members and
affected individuals can be screened using methods which are
targeted to that site. The ability to detect dispersed point
mutations is critical for genetic counseling, diagnosis, and early
clinical intervention as well as for research into the etiology of
cancer and other genetic disorders. The ideal method for genetic
screening would quickly, inexpensively, and accurately detect all
types of widely dispersed mutations in genomic DNA, cDNA, and RNA
samples, depending on the specific situation.
[0337] Historically, a number of different methods have been used
to detect point mutations, including denaturing gradient gel
electrophoresis ("DGGE"), restriction enzyme polymorphism analysis,
chemical and enzymatic cleavage methods, and others (Cotton, 1989).
The more common procedures currently in use include direct
sequencing of target regions amplified by PCR and single-strand
conformation polymorphism analysis ("SSCP").
[0338] Another method of screening for point mutations is based on
RNase cleavage of base pair mismatches in RNA/DNA and RNA/RNA
heteroduplexes. As used herein, the term "mismatch" is defined as a
region of one or more unpaired or mispaired nucleotides in a
double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This
definition thus includes mismatches due to insertion/deletion
mutations, as well as single and multiple base point mutations.
U.S. Pat. No. 4,946,773 describes an RNase A mismatch cleavage
assay that involves annealing single-stranded DNA or RNA test
samples to an RNA probe, and subsequent treatment of the nucleic
acid duplexes with RNase A. After the RNase cleavage reaction, the
RNase is inactivated by proteolytic digestion and organic
extraction, and the cleavage products are denatured by heating and
analyzed by electrophoresis on denaturing polyacrylamide gels. For
the detection of mismatches, the single-stranded products of the
RNase A treatment, electrophoretically separated according to size,
are compared to similarly treated control duplexes. Samples
containing smaller fragments (cleavage products) not seen in the
control duplex are scored as +.
[0339] Currently available RNase mismatch cleavage assays,
including those performed according to U.S. Pat. No. 4,946,773,
require the use of radiolabeled RNA probes. Myers and Maniatis in
U.S. Pat. No. 4,946,773 describe the detection of base pair
mismatches using RNase A Other invenstigators have described the
use of E.coli enzyme, RNase I, in mismatch assays. Because it has
broader cleavage specificity than RNase A, RNase I would be a
desirable enzyme to employ in the detection of base pair mismatches
if components can be found to decrease the extent of non-specific
cleavage and increase the frequency of cleavage of mismatches. The
use of RNase I for mismatch detection is described in literature
from Promega Biotech. Promega markets a kit containing RNase I that
is shown in their literature to cleave three out of four known
mismatches, provided the enzyme level is sufficiently high.
[0340] The RNase protection assay as first described by Melton et
al. (1984) was used to detect and map the ends of specific mRNA
targets in solution. The assay relies on being able to easily
generate high specific activity radiolabeled RNA probes
complementary to the mRNA of interest by in vitro transcription.
Originally, the templates for in vitro transcription were
recombinant plasmids containing bacteriophage promoters. The probes
are mixed with total cellular RNA samples to permit hybridization
to their complementary targets, then the mixture is treated with
RNase to degrade excess unhybridized probe. Also, as originally
intended, the RNase used is specific for single-stranded RNA, so
that hybridized double-stranded probe is protected from
degradation. After inactivation and removal of the RNase, the
protected probe (which is proportional in amount to the amount of
target mRNA that was present) is recovered and analyzed on a
polyacrylamide gel.
[0341] The RNase Protection assay was adapted for detection of
single base mutations by Myers and Maniatis (1985) and by Winter
and Perucho (1985). In this type of RNase A mismatch cleavage
assay, radiolabeled RNA probes transcribed in vitro from wild type
sequences, are hybridized to complementary target regions derived
from test samples. The test target generally comprises DNA (either
genomic DNA or DNA amplified by cloning in plasmids or by PCR.TM.),
although RNA targets (endogenous mRNA) have occasionally been, used
(Gibbs and Caskey, 1987; Winter et al., 1985). If single nucleotide
(or greater) sequence differences occur between the hybridized
probe and target, the resulting disruption in Watson-Crick hydrogen
bonding at that position ("mismatch") can be recognized and cleaved
in some cases by single-strand specific ribonuclease. To date,
RNase A has been used almost exclusively for cleavage of
single-base mismatches, although RNase I has recently been shown as
useful also for mismatch cleavage. There are recent descriptions of
using the MutS protein and other DNA-repair enzymes for detection
of single-base mismatches (Ellis et al., 1994; Lishanski et al.,
1994).
[0342] By hybridizing each strand of the wild type probe in RNase
cleavage mismatch assays separately to the complementary Sense and
Antisense strands of the test target, two different complementary
mismatches (for example, A-C and G-U or G-T) and therefore two
chances for detecting each mutation by separate cleavage events,
was provided. Myers et al. (1985) used the RNase A cleavage assay
to screen 615 bp regions of the human .beta.-globin gene contained
in recombinant plasmid targets. By probing with both strands, they
were able to detect most, but not all, of the .beta.-globin
mutations in their model system. The collection of mutants included
examples of all the 12 possible types of mismatches between RNA and
DNA: rA/dA, rC/dC, rU/dC, rC/dA, rC/dT, rU/dG, rG/dA, rG/dG, rU/dG,
rA/dC, rG/dT, and rA/dG.
[0343] Myers et. al. (1985) showed that certain types of mismatch
were more frequently and more completely cleaved by RNase A than
others. For example, the rC/dA, rC/dC, and rC/dT mismatches were
cleaved in all cases, while the rG/dA mismatch was only cleaved in
13% of the cases tested and the rG/dT mismatch was almost
completely resistant to cleavage. In general, the complement of a
difficult-to-detect mismatch was much easier to detect. For
example, the refractory rG/dT mismatch generated by probing a G to
A mutant target with a wild type sense-strand probe, is
complemented by the easily cleaved rC/dA mismatch generated by
probing the mutant target with the wild type antisense strand. By
probing both target strands, Myers and Maniatis (1986) estimated
that at least 50% of all single-base mutations would be detected by
the RNase A cleavage assay. These authors stated that approximately
one-third of all possible types of single-base substitutions would
be detected by using a single probe for just one strand of the
target DNA (Myers et al., 1985).
[0344] In the typical RNase cleavage assays, the separating gels
are run under denaturing conditions for analysis of the cleavage
products. This requires the RNase to be inactivated by treating the
reaction with protease (usually Proteinase K, often in the presence
of SDS) to degrade the RNase. This reaction is generally followed
by an organic extraction with a phenol/chloroform solution to
remove proteins and residual RNase activity. The organic extraction
is then followed by concentration and recovery of the cleavage
products by alcohol precipitation (Myers et al., 1985; Winter et
al., 1985; Theophilus et al., 1989).
[0345] 4. Separation Methods
[0346] Following amplification, it may be desirable to separate the
amplification product from the template and the excess primer for
the purpose of determining whether specific amplification has
occurred. In one embodiment, amplification products are separated
by agarose, agarose-acrylamide or polyacrylamide gel
electrophoresis using standard methods. See Sambrook et al.,
1989.
[0347] Alternatively, chromatographic techniques may be employed to
effect separation. There are many kinds of chromatography which may
be used in the present invention: adsorption, partition,
ion-exchange and molecular sieve, and many specialized techniques
for using them including column, paper, thin-layer and gas
chromatography (Freifelder, 1982).
[0348] 5. Identification Methods
[0349] Amplification products must be visualized in order to
confirm amplification of the marker sequences. One typical
visualization method involves staining of a gel with ethidium
bromide and visualization under UV light. Alternatively, if the
amplification products are integrally labeled with radio- or
fluorometrically-labeled nucleotides, the amplification products
can then be exposed to x-ray film or visualized under the
appropriate stimulating spectra, following separation.
[0350] In one embodiment, visualization is achieved indirectly.
Following separation of amplification products, a labeled, nucleic
acid probe is brought into contact with the amplified marker
sequence. The probe preferably is conjugated to a chromophore but
may be radiolabeled. In another embodiment, the probe is conjugated
to a binding partner, such as an antibody or biotin, and the other
member of the binding pair carries a detectable moiety.
[0351] In one embodiment, detection is by Southern blotting and
hybridization with a labeled probe. The techniques involved in
Southern blotting are well known to those of skill in the art and
can be found in many standard books on molecular protocols. See
Sambrook et al., 1989. Briefly, amplification products are
separated by gel electrophoresis. The gel is then contacted with a
membrane, such as nitrocellulose, permitting transfer of the
nucleic acid and non-covalent binding. Subsequently, the membrane
is incubated with a chromophore-conjugated probe that is capable of
hybridizing with a target amplification product. Detection is by
exposure of the membrane to x-ray film or ion-emitting detection
devices.
[0352] One example of the foregoing is described in U.S. Pat. No.
5,279,721, incorporated by reference herein, which discloses an
apparatus and method for the automated electrophoresis and transfer
of nucleic acids. The apparatus permits electrophoresis and
blotting without external manipulation of the gel and is ideally
suited to carrying out methods according to the present
invention.
[0353] 6. Kit Components
[0354] All the essential materials and reagents required for
detecting MODY markers in a biological sample may be assembled
together in a kit. This generally will comprise pre-selected
primers for specific markers. Also included may be enzymes suitable
for amplifying nucleic acids including various polymerases (RT,
Taq, etc.), deoxynucleotides and buffers to provide the necessary
reaction mixture for amplification.
[0355] Such kits generally will comprise, in suitable means,
distinct containers for each individual reagent and enzyme as well
as for each marker primer pair. Preferred pairs of primers for
amplifying nucleic acids are selected to amplify the sequences
specified in SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:5, along with
the cDNAs for HNF1.alpha. (SEQ ID NO:1) HNF1.beta. (SEQ ID NO:128)
and HNF4.alpha. (SEQ ID NO:78). In other embodiments preferred
pairs of primers for amplification are selected to amplify
sequences specified in SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38,
SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID
NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54.
[0356] In another embodiment, such kits will comprise hybridization
probes specific for MODY3, chosen from a group including nucleic
acids corresponding to the sequences specified in SEQ ID NO:1, SEQ
ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, along with the cDNAs for
HNF1.alpha. (SEQ ID NO:1). In yet another embodiment such kits will
comprise probes specific for MODY 1 chosen from a group including
nucleic acids corresponding to the sequences specified in SEQ ID
NO:78, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ
ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50,
SEQ ID NO:52, SEQ ID NO:54, HNF4.alpha. In still another embodiment
such kits will comprise probes specific for MODY4 chosen from a
group including nucleic acids corresponding to the sequences
specified in SEQ ID NO: 128, HNF1.beta. or any of the exons shown
in FIG. 27A-FIG. 27I, or Genbank accession numbers U90279-90287 and
U96079, incorporated herein by reference.
[0357] Such kits generally will comprise, in suitable means,
distinct containers for each individual reagent and enzyme as well
as for each marker hybridization probe.
L. Use of RNA Fingerprinting to Identify MODY3, MODY4, and MODY1
Markers
[0358] RNA fingerprinting is a means by which RNAs isolated from
many different tissues, cell types or treatment groups can be
sampled simultaneously to identify RNAs whose relative abundances
vary. Two forms of this technology were developed simultaneously
and reported in 1992 as RNA fingerprinting by differential display
(Liang and Pardee, 1992; Welsh et al., 1992). (See also Liang and
Pardee, U.S. Pat. No. 5,262,311, incorporated herein by reference
in its entirety.) Some of the experiments described herein were
performed similarly to Donahue et al., J. Biol. Chem. 269:
8604-8609, 1994.
[0359] All forms of RNA fingerprinting by PCR are theoretically
similar but differ in their primer design and application. The most
striking difference between differential display and other methods
of RNA fingerprinting is that differential display utilizes
anchoring primers that hybridize to the poly A tails of mnRNAs. As
a consequence, the PCR products amplified in differential display
are biased towards the 3' untranslated regions of mRNAs.
[0360] The basic technique of differential display has been
described in detail (Liang and Pardee, 1992). Total cell RNA is
primed for first strand reverse transcription with an anchoring
primer composed of oligo dT and any two of the four
deoxynucleosides. The oligo dT primer is extended using a reverse
transcriptase, for example, Moloney Murine Leukemia Virus (MMLV)
reverse transcriptase. The synthesis of the second strand is primed
with an arbitrarily chosen oligonucleotide, using reduced
stringency conditions. Once the double-stranded cDNA has been
synthesized, amplification proceeds by standard PCR techniques,
utilizing the same primers. The resulting DNA fingerprint is
analyzed by gel electrophoresis and ethidium bromide staining or
autoradiography. A side by side comparison of fingerprints obtained
from for example tumor versus normal tissue samples using the same
oligonucleotide primers identifies mRNAs that are differentially
expressed.
[0361] RNA fingerprinting technology has been demonstrated as being
effective in identifying genes that are differentially expressed in
cancer (Liang et al., 1992; Wong et al., 1993; Sager et al., 1993;
Mok et al., 1994; Watson et al., 1994; Chen et al., 1995; An et
al., 1995). The present invention utilizes the RNA fingerprinting
technique to identify genes that are differentially expressed in
diabetes.
[0362] Design and Theoretical Considerations for Relative
Quantitative RT-PCR
[0363] Reverse transcription (RT) of RNA to cDNA followed by
relative quantitative PCR (RT-PCR) can be used to determine the
relative concentrations of specific mRNA species isolated from
MODY3, MODY4, and MODY1 patients. By determining that the
concentration of a specific mRNA species varies, it is shown that
the gene encoding the specific mRNA species is differentially
expressed. This technique can be used to confirm that mRNA
transcripts shown to be differentially regulated by RNA
fingerprinting are differentially expressed in MODY related
diabetes.
[0364] In PCR, the number of molecules of the amplified target DNA
increase by a factor approaching two with every cycle of the
reaction until some reagent becomes limiting. Thereafter, the rate
of amplification becomes increasingly diminished until there is no
increase in the amplified target between cycles. If a graph is
plotted in which the cycle number is on the X axis and the log of
the concentration of the amplified target DNA is on the Y axis, a
curved line of characteristic shape is formed by connecting the
plotted points. Beginning with the first cycle, the slope of the
line is positive and constant. This is said to be the linear
portion of the curve. After a reagent becomes limiting, the slope
of the line begins to decrease and eventually becomes zero. At this
point the concentration of the amplified target DNA becomes
asymptotic to some fixed value. This is said to be the plateau
portion of the curve.
[0365] The concentration of the target DNA in the linear portion of
the PCR amplification is directly proportional to the starting
concentration of the target before the reaction began. By
determining the concentration of the amplified products of the
target DNA in PCR reactions that have completed the same number of
cycles and are in their linear ranges, it is possible to determine
the relative concentrations of the specific target sequence in the
original DNA mixture. If the DNA mixtures are cDNAs synthesized
from RNAs isolated from different tissues or cells, the relative
abundances of the specific mRNA from which the target sequence was
derived can be determined for the respective tissues or cells. This
direct proportionality between the concentration of the PCR
products and the relative mRNA abundances is only true in the
linear range of the PCR reaction.
[0366] The final concentration of the target DNA in the plateau
portion of the curve is determined by the availability of reagents
in the reaction mix and is independent of the original
concentration of target DNA. Therefore, the first condition that
must be met before the relative abundances of a mRNA species can be
determined by RT-PCR for a collection of RNA populations is that
the concentrations of the amplified PCR products must be sampled
when the PCR reactions are in the linear portion of their
curves.
[0367] The second condition that must be met for an RT-PCR
experiment to successfully determine the relative abundances of a
particular mRNA species is that relative concentrations of the
amplifiable cDNAs must be normalized to some independent standard.
The goal of an RT-PCR experiment is to determine the abundance of a
particular mRNA species relative to the average abundance of all
mRNA species in the sample. In the experiments described below,
mRNAs for .beta.-actin, asparagine synthetase and lipocortin II
were used as external and internal standards to which the relative
abundance of other mRNAs are compared.
[0368] Most protocols for competitive PCR utilize internal PCR
standards that are approximately as abundant as the target. These
strategies are effective if the products of the PCR amplifications
are sampled during their linear phases. If the products are sampled
when the reactions are approaching the plateau phase, then the less
abundant product becomes relatively over represented. Comparisons
of relative abundances made for many different RNA samples, such as
is the case when examining RNA samples for differential expression,
become distorted in such a way as to make differences in relative
abundances of RNAs appear less than they actually are. This is not
a significant problem if the internal standard is much more
abundant than the target. If the internal standard is more abundant
than the target, then direct linear comparisons can be made between
RNA samples.
[0369] The above discussion describes theoretical considerations
for an RT-PCR assay for clinically derived materials. The problems
inherent in clinical samples are that they are of variable quantity
(making normalization problematic), and that they are of variable
quality (necessitating the co-amplification of a reliable internal
control, preferably of larger size than the target). Both of these
problems are overcome if the RT-PCR is performed as a relative
quantitative RT-PCR with an internal standard in which the internal
standard is an amplifiable cDNA fragment that is larger than the
target cDNA fragment and in which the abundance of the mRNA
encoding the internal standard is roughly 5-100 fold higher than
the mRNA encoding the target. This assay measures relative
abundance, not absolute abundance of the respective mRNA
species.
[0370] Other studies may be performed using a more conventional
relative quantitative RT-PCR assay with an external standard
protocol. These assays sample the PCR products in the linear
portion of their amplification curves. The number of PCR cycles
that are optimal for sampling must be empirically determined for
each target cDNA fragment. In addition, the reverse transcriptase
products of each RNA population isolated from the various tissue
samples must be carefully normalized for equal concentrations of
amplifiable cDNAs. This consideration is very important since the
assay measures absolute mRNA abundance. Absolute mRNA abundance can
be used as a measure of differential gene expression only in
normalized samples. While empirical determination of the linear
range of the amplification curve and normalization of cDNA
preparations are tedious and time consuming processes, the
resulting RT-PCR assays can be superior to those derived from the
relative quantitative RT-PCR assay with an internal standard.
[0371] One reason for this advantage is that without the internal
standard/competitor, all of the reagents can be converted into a
single PCR product in the linear range of the amplification curve,
thus increasing the sensitivity of the assay. Another reason is
that with only one PCR product, display of the product on an
electrophoretic gel or another display method becomes less complex,
has less background and is easier to interpret.
M. Methods for Activation of Gene Expression
[0372] In one embodiment of the present invention, there are
provided methods for the increased gene expression or activation in
a cell. This is particularly useful where there is an aberration in
the gene product or gene expression is not sufficient for normal
function. This will allow for the alleviation of symptoms of MODY3
type diabetes experienced as a result of mutation in HNF1.alpha.,
MODY4 type diabetes experienced as a result of mutation in
HNF1.beta. and MODY1 type diabetes experienced as a result of
mutation in HNF4.alpha..
[0373] The general approach to increasing gene expression as
mediated by HNF1.alpha., HNF1.beta. or HNF4.alpha. according to the
present invention, will be to provide a cell with an HNF1.alpha.,
HNF1.beta. or HNF4.alpha. polypeptide, thereby permitting the
transcription promotional activity of HNF1.alpha., HNF1.beta. or
HNF4.alpha. to take effect. While it is conceivable that the
protein may be delivered directly, a preferred embodiment involves
providing a nucleic acid encoding an HNF1.alpha., HNF1.beta. or
HNF4.alpha. polypeptide, i.e., an HNF1.alpha., HNF1.beta. or
HNF4.alpha. gene, to the cell. Following this provision, the
HNF1.alpha. HNF1.beta. or HNF4.alpha. polypeptide is synthesized by
the host cell's transcriptional and translational machinery, as
well as any that may be provided by the expression construct.
Cis-acting regulatory elements necessary to support the expression
of the HNF1.alpha. HNF1.beta. or HNF4.alpha. gene will be provided,
in the form of an expression construct. It also is possible that,
expression of the virally-encoded HNF1.alpha., HNF1.beta. or
HNF4.alpha. could be stimulated or enhanced, or the expressed
polypeptide stabilized, thereby achieving the same or similar
effect.
[0374] In order to effect expression of constructs encoding
HNF1.alpha., HNF1.beta. or HNF4.alpha. genes, the expression
construct must be delivered into a cell. One mechanism for delivery
is via viral infection, where the expression construct is
encapsidated in a viral particle which will deliver either a
replicating or non-replicating nucleic acid. In certain embodiments
an HSV vector is used, although virtually any vector would
suffice.
[0375] Several non-viral methods for the transfer of expression
constructs into cultured mammalian cells also are contemplated by
the present invention. These include calcium phosphate
precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987;
Rippe et al., 1990) DEAE-dextran (Gopal, 1985), electroporation
(Tur-Kaspa et al., 1986; Potter et al., 1984), direct
microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes
(Nicolau and Sene, 1982; Fraley et al., 1979) and
lipofectarnine-DNA complexes, cell sonication (Fechheimer et al.,
1987), gene bombardment using high velocity microprojectiles (Yang
et. al., 1990), and receptor-mediated transfection (Wu and Wu,
1987; Wu and Wu, 1988). Some of these techniques may be
successfully adapted for in vivo or ex vivo use, as discussed
below.
[0376] In another embodiment of the invention, the expression
construct may simply consist of naked recombinant DNA or plasmids.
Transfer of the construct may be performed by any of the methods
mentioned above which physically or chemically permeabilize the
cell membrane. This is particularly applicable for transfer in
vitro, but it may be applied to in vivo use as well. Another
embodiment of the invention for transferring a naked DNA expression
construct into cells may involve particle bombardment. This method
depends on the ability to accelerate DNA coated microprojectiles to
a high velocity allowing them to pierce cell membranes and enter
cells without killing them (Klein et al., 1987). Several devices
for accelerating small particles have been developed. One such
device relies on a high voltage discharge to generate an electrical
current, which in turn provides the motive force (Yang et al.,
1990). The microprojectiles used have consisted of biologically
inert substances such as tungsten or gold beads.
[0377] In a further embodiment of the invention, the expression
construct may be entrapped in a liposome. Liposomes are vesicular
structures characterized by a phospholipid bilayer membrane and an
inner aqueous medium. Multilamellar liposomes have multiple lipid
layers separated by aqueous medium. They form spontaneously when
phospholipids are suspended in an excess of aqueous solution. The
lipid components undergo self-rearrangement before the formation of
closed structures and entrap water and dissolved solutes between
the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated
are lipofectamine-DNA complexes.
[0378] Liposome-mediated nucleic acid delivery and expression of
foreign DNA in vitro has been very successful. Wong et al. (1980)
demonstrated the feasibility of liposome-mediated delivery and
expression of foreign DNA in cultured chick embryo, HeLa and
hepatoma cells. In certain embodiments of the invention, the
liposome may be complexed with a hemagglutinating virus (HVJ). This
has been shown to facilitate fusion with the cell membrane and
promote cell entry of liposome-encapsulated DNA (Kaneda et al.,
1989). In other embodiments, the liposome may be complexed or
employed in conjunction with nuclear non-histone chromosomal
proteins (HMG-1) (Kato et al., 1991). In yet further embodiments,
the liposome may be complexed or employed in conjunction with both
HVJ and HMG-1. In other embodiments, the delivery vehicle may
comprise a ligand and a liposome. Where a bacterial promoter is
employed in the DNA construct, it also will be desirable to include
within the liposome an appropriate bacterial polymerase.
[0379] Other expression constructs which can be employed to deliver
a nucleic acid encoding an HNF1.alpha., HNF1.beta., or HNF4.alpha.
transgene into cells are receptor-mediated delivery vehicles. These
take advantage of the selective uptake of macromolecules by
receptor-mediated endocytosis in almost all eukaryotic cells.
Because of the cell type-specific distribution of various
receptors, the delivery can be highly specific (Wu and Wu,
1993).
[0380] Receptor-mediated gene targeting vehicles generally consist
of two components: a cell receptor-specific ligand and a
DNA-binding agent. Several ligands have been used for
receptor-mediated gene transfer. The most extensively characterized
ligands are asialoorosomucoid (ASOR) (Wu and Wu, 1987) and
transferrin (Wagner et al., 1990). Recently, a synthetic
neoglycoprotein, which recognizes the same receptor as ASOR, has
been used as a gene delivery vehicle (Ferkol et al., 1993; Perales
et al., 1994). Mannose can be used to target the mannose receptor
on liver cells. Also, antibodies to CD5 (CLL), CD22 (lymphoma),
CD25 (T-cell leukemia) and MAA (melanoma) can similarly be used as
targeting moieties. In other embodiments, the delivery vehicle may
comprise a ligand and a liposome.
[0381] Primary mammalian cell cultures may be prepared in various
ways. In order for the cells to be kept viable while in vitro and
in contact with the expression construct, it is necessary to ensure
that the cells maintain contact with the correct ratio of oxygen
and carbon dioxide and nutrients but are protected from microbial
contamination. Cell culture techniques are well documented and are
disclosed herein by reference (Freshner, 1992).
[0382] One embodiment of the foregoing involves the use of gene
transfer to immortalize cells for the production of proteins. The
gene for the protein of interest may be transferred as described
above into appropriate host cells followed by culture of cells
under the appropriate conditions. The gene for virtually any
polypeptide may be employed in this manner. The generation of
recombinant expression vectors, and the elements included therein,
are discussed above. Alternatively, the protein to be produced may
be an endogenous protein normally synthesized by the cell in
question.
[0383] Examples of useful mammalian host cell lines are Vero and
HeLa cells and cell lines of Chinese hamster ovary, W138, BHK,
COS-7, 293, HepG2, NIH3T3, RIN and MDCK cells. In addition, a host
cell strain may be chosen that modulates the expression of the
inserted sequences, or modifies and process the gene product in the
manner desired. Such modifications (e.g., glycosylation) and
processing (e.g., cleavage) of protein products may be important
for the function of the protein. Different host cells have
characteristic and specific mechanisms for the post-translational
processing and modification of proteins. Appropriate cell lines or
host systems can be chosen to insure the correct modification and
processing of the foreign protein expressed.
[0384] A number of selection systems may be used including, but not
limited to, HSV thymidine kinase, hypoxanthine-guanine
phosphoribosyltransferase and adenine phosphoribosyltransferase
genes, in tk-, hgprt- or aprt-cells, respectively. Also,
anti-metabolite resistance can be used as the basis of selection
for dhfr, that confers resistance to; gpt, that confers resistance
to mycophenolic acid; neo, that confers resistance to the
aminoglycoside G418; and hygro, that confers resistance to
hygromycin.
[0385] Animal cells can be propagated in vitro in two modes: as
non-anchorage dependent cells growing in suspension throughout the
bulk of the culture or as anchorage-dependent cells requiring
attachment to a solid substrate for their propagation (i.e., a
monolayer type of cell growth).
[0386] Non-anchorage dependent or suspension cultures from
continuous established cell lines are the most widely used means of
large scale production of cells and cell products. However,
suspension cultured cells have limitations, such as tumorigenic
potential and lower protein production than adherent cells.
[0387] Large scale suspension culture of mammalian cells in stirred
tanks is a common method for production of recombinant proteins.
Two suspension culture reactor designs are in wide use--the stirred
reactor and the airlift reactor. The stirred design has
successfully been used on an 8000 liter capacity for the production
of interferon. Cells are grown in a stainless steel tank with a
height-to-diameter ratio of 1:1 to 3:1. The culture is usually
mixed with one or more agitators, based on bladed disks or marine
propeller patterns. Agitator systems offering less shear forces
than blades have been described. Agitation may be driven either
directly or indirectly by magnetically coupled drives. Indirect
drives reduce the risk of microbial contamination through seals on
stirrer shafts.
[0388] The airlift reactor, also initially described for microbial
fermentation and later adapted for mammalian culture, relies on a
gas stream to both mix and oxygenate the culture. The gas stream
enters a riser section of the reactor and drives circulation. Gas
disengages at the culture surface, causing denser liquid free of
gas bubbles to travel downward in the downcomer section of the
reactor. The main advantage of this design is the simplicity and
lack of need for mechanical mixing. Typically, the
height-to-diameter ratio is 10:1. The airlift reactor scales up
relatively easily, has good mass transfer of gases and generates
relatively low shear forces.
N. Methods for Blocking Mutant HNF1.alpha., HNF1.beta. and
HNF4.alpha. Action
[0389] In another embodiment of the present invention, there is
contemplated the method of blocking the function of mutated
HNF1.alpha. in MODY3, HNF1.beta. in MODY4, and HNF4.alpha. in
MODY1. In this way, it may be possible to curtail the effects of
the mutation in diabetes. In addition, it may prove effective to
use this sort of therapeutic intervention in combination with more
traditional diabetes therapies, such as the administration of
insulin.
[0390] The general form that this aspect of the invention will take
is the provision, to a cell, of an agent that will inhibit mutated
HNF1.alpha., HNF1.beta. or HNF4.alpha. function. Four such agents
are contemplated. First, one may employ an antisense nucleic acid
that will hybridize either to the mutated HNF1.alpha., HNF1.beta.
or HNF4.alpha. gene or the mutated HNF1.alpha. HNF1.beta. or
HNF4.alpha. gene transcript, thereby preventing transcription or
translation, respectively. The considerations relevant to the
design of antisense constructs have been presented above. Second,
one may utilize a mutated HNF1.alpha.-, HNF1.beta.- or
HNF4.alpha.-binding protein or peptide, for example, a
peptidomimetic or an antibody that binds immunologically to a
mutated HNF1.alpha., HNF1.beta. or HNF4.beta. respectively, the
binding of either will block or reduce the activity of the mutated
HNF1.alpha., HNF1.alpha. and HNF4.alpha. respectively. The methods
of making and selecting peptide binding partners and antibodies are
well known to those of skill in the art. Third, one may provide to
the cell an antagonist of mutated HNF1.alpha., HNF1.beta. or
HNF4.alpha., for example, the transactivation target sequence,
alone or coupled to another agent. And fourth, one may provide an
agent that binds to the mutated HNF1.alpha., HNF1.beta. or
HNF4.alpha. target without the same functional result as would
arise with mutated HNF1.alpha., HNF1.beta. or HNF4.alpha.
binding.
[0391] Provision of an HNF1.alpha., HNF1.beta. or HNF4.alpha. gene,
a mutated HNF1.alpha., HNF1.beta. or HNF4.alpha. protein, or a
mutated HNF1.alpha., HNF1.beta. or HNF4.alpha. antagonist, would be
according to any appropriate pharmaceutical route. The formulation
of such compositions and their delivery to tissues is discussed
below. The method by which the nucleic acid, protein or chemical is
transferred, along with the preferred delivery route, will be
selected based on the particular site to be treated. Those of skill
in the art are capable of determining the most appropriate methods
based on the relevant clinical considerations.
[0392] Many of the gene transfer techniques that generally are
applied in vitro can be adapted for ex vivo or in vivo use. For
example, selected organs including the liver, skin, and muscle
tissue of rats and mice have been bombarded in vivo (Yang et al.,
1990; Zelenin et al., 1991). Naked DNA also has been used in
clinical settings to effect gene therapy. These approaches may
require surgical exposure of the target tissue or direct target
tissue injection. Nicolau et al. (1987) accomplished successful
liposome-mediated gene transfer in rats after intravenous
injection.
[0393] Dubensky et al. (1984) successfully injected polyomavirus
DNA in the form of CaPO.sub.4 precipitates into liver and spleen of
adult and newborn mice demonstrating active viral replication and
acute infection. Benvenisty and Neshif (1986) also demonstrated
that direct intraperitoneal injection of CaPO.sub.4 precipitated
plasmids results in expression of the transfected genes. Thus, it
is envisioned that DNA encoding an antisense construct also may be
transferred in a similar manner in vivo.
[0394] Where the embodiment involves the use of an antibody that
recognizes a mutated HNF1.alpha., HNF1.beta. or HNF4.alpha.
polypeptide, consideration must be given to the mechanism by which
the antibody is introduced into the cell cytoplasm. This can be
accomplished, for example, by providing an expression construct
that encodes a single-chain antibody version of the antibody to be
provided. Most of the discussion above relating to expression
constructs for antisense versions of HNF1.alpha., HNF1.beta. or
HNF4.alpha. genes will be relevant to this aspect of the invention.
Alternatively, it is possible to present a bifunctional antibody,
where one antigen binding arm of the antibody recognizes an
HNF1.alpha., HNF1.beta. or HNF4.alpha. polypeptide and the other
antigen binding arm recognizes a receptor on the surface of the
cell to be targeted. Examples of suitable receptors would be an HSV
glycoprotein such as gB, gC, gD, or gH. In addition, it may be
possible to exploit the Fc-binding function associated with HSV gE,
thereby obviating the need to sacrifice one arm of the antibody for
purposes of cell targeting.
[0395] Advantageously, one may combine this approach with more
conventional diabetes therapy options.
O. Pharmaceuticals and in Vivo Methods for the Treatment of
Disease
[0396] Aqueous pharmaceutical compositions of the present invention
will have an effective amount of an HNF1.alpha., HNF1.beta. or
HNF4.alpha. expression construct, an antisense HNF1.alpha.,
HNF1.beta. or HNF4.alpha. expression construct, an expression
construct that encodes a therapeutic gene along with HNF1.alpha.,
HNF1.beta. or HNF4.alpha., a protein or compound that inhibits
mutated HNF1.alpha., HNF1.beta. or HNF4.alpha. function
respectively, such as an anti-mutant HNF1.alpha. antibody, an
anti-mutant HNF1.beta. antibody or an anti-mutant HNF4.alpha.
antibody, or a mutated HNF1.alpha. polypeptide, mutated HNF1.beta.
polypeptide or a mutated HNF4.alpha. polypeptide. Such compositions
generally will be dissolved or dispersed in a pharmaceutically
acceptable carrier or aqueous medium. An "effective amount," for
the purposes of therapy, is defined at that amount that causes a
clinically measurable difference in the condition of the subject.
This amount will vary depending on the substance, the condition of
the patient, the type of treatment, the location of the lesion,
etc.
[0397] The phrases "pharmaceutically or pharmacologically
acceptable" refer to molecular entities and compositions that do
not produce an adverse, allergic or other untoward reaction when
administered to an animal, or human, as appropriate. As used
herein, "pharmaceutically acceptable carrier" includes any and all
solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic and absorption delaying agents and the like. The
use of such media and agents for pharmaceutically active substances
is well known in the art. Except insofar as any conventional media
or agent is incompatible with the active ingredients, its use in
the therapeutic compositions is contemplated. Supplementary active
ingredients, such as other anti-diabetic agents, can also be
incorporated into the compositions.
[0398] In addition to the compounds formulated for parenteral
administration, such as those for intravenous or intramuscular
injection, other pharmaceutically acceptable forms include, e.g.,
tablets or other solids for oral administration; time release
capsules; and any other form currently used, including cremes,
lotions, mouthwashes, inhalants and the like.
[0399] The active compounds of the present invention will often be
formulated for parenteral administration, e.g., formulated for
injection via the intravenous, intramuscular, subcutaneous, or even
intraperitoneal routes. The preparation of an aqueous composition
that contains mutated HNF1.alpha., HNF1.beta. or HNF4.alpha.
inhibitory compounds alone or in combination with a conventional
diabetes therapy agents as active ingredients will be known to
those of skill in the art in light of the present disclosure.
Typically, such compositions can be prepared as injectables, either
as liquid solutions or suspensions; solid forms suitable for using
to prepare solutions or suspensions upon the addition of a liquid
prior to injection can also be prepared; and the preparations can
also be emulsified.
[0400] Solutions of the active compounds as free base or
pharmacologically acceptable salts can be prepared in water
suitably mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions can also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms.
[0401] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions; formulations including
sesame oil, peanut oil or aqueous propylene glycol; and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersions. In many cases, the form must be sterile
and must be fluid to the extent that easy syringability exists. It
must be stable under the conditions of manufacture and storage and
must be preserved against the contaminating action of
microorganisms, such as bacteria and fungi.
[0402] The active compounds may be formulated into a composition in
a neutral or salt form. Pharmaceutically acceptable salts, include
the acid addition salts (formed with the free amino groups of the
protein) and which are formed with inorganic acids such as, for
example, hydrochloric or phosphoric acids, or such organic acids as
acetic, oxalic, tartaric, mandelic, and the like. Salts formed with
the free carboxyl groups can also be derived from inorganic bases
such as, for example, sodium, potassium, ammonium, calcium, or
ferric hydroxides, and such organic bases as isopropylamine,
trimethylamine, histidine, procaine and the like.
[0403] The carrier also can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (for example,
glycerol, propylene glycol, and liquid polyethylene glycol, and the
like), suitable mixtures thereof, and vegetable oils. The proper
fluidity can be maintained, for example, by the use of a coating,
such as lecithin, by the maintenance of the required particle size
in the case of dispersion and by the use of surfactants. The
prevention of the action of microorganisms can be brought about by
various antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In
many cases, it will be preferable to include isotonic agents, for
example, sugars or sodium chloride. Prolonged absorption of the
injectable compositions can be brought about by the use in the
compositions of agents delaying absorption, for example, aluminum
monostearate and gelatin.
[0404] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof.
[0405] Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms, such as the type of injectable
solutions described above, with even drug release capsules and the
like being employable.
[0406] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered if necessary and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous and
intraperitoneal administration. In this connection, sterile aqueous
media which can be employed will be known to those of skill in the
art in light of the present disclosure. For exarnple, one dosage
could be dissolved in 1 mL of isotonic NaCl solution and either
added to 1000 mL of hypodermoclysis fluid or injected at the
proposed site of infusion, (see for example, "Remington's
Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and
1570-1580). Some variation in dosage will necessarily occur
depending on the condition of the subject being treated. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject.
P. EXAMPLES
[0407] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Altered Insulin Secretory Responses to Glucose in Diabetic and
Nondiabetic Subjects with Mutations in the Diabetes Mellitus
Susceptibility Gene MODY3 on Chromosome 12
[0408] The present Example determines whether alterations in the
dose-response relationships between plasma glucose concentration
and insulin secretion rate (ISR) can be identified in subjects who
have inherited an at-risk MODY3 allele but who have not yet
developed overt diabetes.
[0409] 1. Methods
[0410] Subjects from MODY3 Pedigrees
[0411] Thirteen Caucasian subjects who were positive for MODY3
markers on chromosome 12q were studied. Two subjects were members
of a French pedigree F549 (Vaxillaire et al.,1995), three were from
the P pedigree from Michigan (Menzel et al., 1995), two from a New
York pedigree the H pedigree depicted in FIG. 1, two were from a
Liverpool pedigree, the BDA1 pedigree and four from a Nottingham
pedigree, the BDA12 pedigree (FIG. 1). Each subject was typed with
a series of DNA markers in the region of MODY3 to determine whether
or not they had inherited the at-risk haplotype segregating with
MODY in that farnily. The diabetes status of each subject except
for MD13, had been determined by oral glucose tolerance testing
(OGTT) according to the World Health Organization (WHO) criteria
(WHO Study Group on Diabetes Mellitus, 1985) and confirmed at the
time of the studies by the measurement of glycosylated hemoglobin.
Based on the results of the OGTT and glycosylated hemoglobin values
within or above the normal range for the inventors' laboratory
(<7.4%) subjects were divided into diabetic and nondiabetic
groups.
[0412] Nondiabetic MODY3 Subjects (n=6).
[0413] The clinical profiles of these subjects are described in
Table 4. All had normal fasting glucose and glycosylated hemoglobin
(<7.4%) levels at the time of this study. At the time of study 4
subjects had IGT (MD1, MD4, MD9, MD13) and 2 subjects had normal
glucose tolerance (NGT) (MD3, MD5). Based on previous glucose
tolerance testing MD1 had IGT, MD3 consistently demonstrated NGT on
serial OGTTs, MD4 was diagnosed with IGT in 6/93 and has persistent
IGT with a 2-h postprandial blood glucose level of 147 mg/dl, MD5
was initially diagnosed with IGT and subsequently had 2 normal
OGTTs, with 2-h blood glucose values of 130 mg/dl and 105 mg/dl,
respectively, MD9 had IGT, with a 2-h post-challenge blood glucose
level was 167 mg/dl with no other blood glucose level above 200
mg/dl and MD13 had IGT with elevated postprandial blood glucose
levels in the past up to 160 mg/dl. Age of diagnosis refers to the
age at which abnormal glucose tolerance was diagnosed. None of
these subjects were ever diagnosed with NIDDM.
[0414] Diabetic MODY3 Subjects (n=7).
[0415] Clinical profiles are shown in Table 4. All subjects had
been treated with oral hypoglycemic agents except for MD8 who was
taking insulin which was discontinued two days prior to the study
and MD12 who was treated with diet alone. All subjects had
discontinued treatment with oral hypoglycemic agents at least three
weeks prior to being studied. As shown in Table 4, fasting plasma
glucose and total glycosylated hemoglobin levels were higher in the
diabetic group and fasting insulin levels were lower. The diabetic
group was also significantly older than the other two groups.
[0416] Nondiabetic Controls.
[0417] The control subjects consisted of 5 males and one female (5
Caucasians and 1 African American) who did not have a personal or
family history of NIDDM. They were all within 20% of ideal body
weight, had no medical illnesses and were not receiving any
medications. Data from four of the control subjects have previously
been published (Byrne et al., 1994; Byrne et al., 1995a). BMI was
not significantly different between the control and diabetic or
nondiabetic MODY3 groups.
[0418] Female volunteers had regular menstrual cycles and were
studied only in the early follicular phase. The study was approved
by the Institutional Review Board of the University of Chicago
Medical Center and all subjects and/or parents provided written
informed consent.
[0419] Experimental Protocol
[0420] Studies began at 0800 h with subjects in the recumbent
position after a 12-h overnight fast. An intravenous catheter was
placed in each forearm, one for blood sampling and one for glucose
administration. In all experiments, the arm containing the sampling
catheter was maintained in a heating blanket or hot hand box to
ensure arterialization of the venous sample.
[0421] Graded Glucose Infusion Studies.
[0422] These studies were designed to characterize the
dose-response relationships between glucose and insulin secretion
rate (ISR). In order to eliminate potentially confounding effects
of differences in the basal glucose concentration, each study began
with the administration of a small bolus of insulin intravenously
(0.007 U/kg) followed by a low dose continuous infusion of insulin
to lower the fasting plasma glucose to similar levels in all groups
(target plasma glucose=5 mM). After a period of 20 min during which
time the exogenously administered insulin was allowed to decay,
samples were drawn at 10 min intervals for 30 min to define
baseline insulin, glucose and C-peptide levels. An intravenous
infusion of 20% dextrose was then started at a rate of 1 mg/kg/min,
followed by infusions of 2 mg/kg/min, 3 mg/kg/min, 4 mg/kg/min, 6
mg/kg/min and 8 mg/kg/min. Each infusion rate was administered for
a period of 40 min. Insulin, C-peptide and glucose concentrations
were measured at 10, 20, 30 and 40 min into each infusion
period.
[0423] Effects of Prolonged Intravenous Glucose Administration on
Insulin Secretory Responses to Graded Glucose Infusions.
[0424] At the completion of the graded glucose infusion study
described above, glucose was infused intravenously for a 42-h
period at a rate of 4-6 mg/kg/min in order to determine if the
insulin secretory responses to glucose could be primed by exposure
to mild hyperglycemia. Subjects also consumed three carbohydrate
enriched meals during the second day of this glucose infusion. At
the conclusion of the 42-h infusion period, the infusion rate was
reduced over a 60 min period and then stopped. Thirty minutes
later, the graded glucose infusion study was repeated. Plasma
glucose levels were obtained every four hours during the 42-h
glucose infusion.
[0425] Assays.
[0426] Plasma glucose was measured by the glucose oxidase technique
(YSI analyzer, Yellow Springs, Ohio). The coefficient of variation
of this method is <2%. Serum insulin was assayed by a double
antibody technique (Morgan and Lazarow, 1963). The average
intra-assay coefficient of variation was 6%. Plasma C-peptide was
measured as previously described (Faber et al., 1978). The lower
limit of sensitivity of the assay was 0.02 pmol/ml and the
intra-assay coefficient of variation averaged 6%. All samples were
measured in duplicate. Assays were performed at the University of
Chicago.
[0427] Data Analysis
[0428] Estimation of ISRs. ISRs were derived by deconvolution of
plasma C-peptide concentrations assuming a two-compartmental model
of C-peptide clearance kinetics (Van Cauter et al., 1992; Eaton et
al., 1980; Polonsky et al., 1986).
[0429] Relationship Between Glucose and ISRs.
[0430] The relationship between plasma glucose and ISR was explored
in each individual by analyzing the data from the graded glucose
infusion studies. Baseline glucose, insulin, C-peptide and ISRs
were calculated as the man of the values in the -30, -20, -10 and 0
min samples. During each glucose infusion period, average glucose
and ISRs were calculated. Mean ISRs for each period were then
plotted against the corresponding mean glucose level, thereby
establishing a dose-response relationship between glucose and ISR.
Mean ISRs were determined for 1 mM glucose concentration intervals
by calculating the area under the curve for each interval using the
trapezoidal rule. This area was divided by 1 mM to obtain the
correct units (pmol/min).
[0431] Statistical Analyses
[0432] All results are expressed as mean.+-.SEM. Data analysis was
performed using the Statistical Analysis System (SAS Version 6
Edition for Personal Computers, SAS Institute, Inc., Cary, N.C.).
The significance of differences between the groups was determined
using paired or unpaired t-tests or analysis of variance where
appropriate. Tukey's studentized range test was used for post hoc
comparisons. Pearson's correlation coefficient was used to evaluate
correlations between pairs of parameters.
[0433] 2. Results
[0434] Glucose, Insulin and ISR During Graded Intravenous Glucose
Infusion
[0435] Fasting plasma glucose levels were higher in the MODY3
diabetic group compared to the nondiabetic group or controls
(7.5.+-.0.7 mM vs. 4.5.+-.0.2 mM and 4.7.+-.0.2, respectively;
P>0.0008). The corresponding fasting plasma insulin levels were
lower in the diabetic MODY3 group compared to nondiabetics and
controls (Table 4). Glucose, insulin and ISR responses to the
glucose infusions are shown in FIG. 2A, FIG. 2B and FIG. 2C,
respectively. Average glucose concentrations over the duration of
the study were higher in the diabetic MODY3 subjects compared to
the nondiabetic MODY3 and control subjects (8.5.+-.0.4 mM vs.
6.3.+-.0.3 mM and 64.+-.0.2; P<0.0002) (FIG. 2A). Average
insulin levels were lower in the diabetic and nondiabetic MODY3
groups than in the controls (57.4.+-.8.2 pmol/L and 79.8.+-.11.0
vs. 139.3.+-.14.7 pmol/L; P<0.0006) (FIG. 2B). Average ISR's
were significantly lower in diabetic compared to the nondiabetic
MODY3 subjects and the controls (116.+-.18.8 pmol/min vs.
179.7.+-.19.9 pmol/min and 1995.+-.18.7; P<0.02) (FIG. 2C).
4TABLE 4 Kindred/Generation/ Glucose Age of Fasting Fasting ID
Subject Tolerance Sex Age BMI Diagnosis Glucose mM Insulin pmol/l
Glycohemoglobin Non-Diabetic MODY 3 MD1 F549 IV-1 IGT F 17.0 24.0
12 4.69 43.0 6.0 MD3 P IV-6 NGT F 19.0 17.9 3.86 23.1 5.1 MD4 P
IV-7 IGT F 14.0 17.1 12 4.47 33.8 5.1 MD5 P IV-5 NGT F 15.0 18.8 13
4.22 63.6 5.1 MD9 BDA1 V-12 IGT M 14.0 20.0 12 4.77 69.9 6.4 MD13
BDA12 IV-2 IGT F 14.0 23.7 12 5.17 60.9 6.4 Mean .+-. SEM 15.5 .+-.
0.9 20.4 .+-. 1.2 4.5 .+-. 0.2 49.1 .+-. 7.6 5.7 .+-. 0.3 Diabetic
MODY3 MD2 F549 III-2 NIDDM F 41 23.2 30 8.89 35.0 7.5 MD6 H IV-1
NIDDM F 17 23.6 16 7.39 24.7 10.6 MD7 HIV-2 NIDDM F 15 19.4 14 7.11
48.8 8.9 MD8 BDA1 V-11 NIDDM F 17 20.9 12 4.22 7.6 M10 BDA12 II-1
NIDDM F 67 26.1 27 8.67 29.8 8.4 M11 BDA12 IV-1 NIDDM M 17 17.8 14
10.1 16.6 10.1 M12 BDA12 III-2 NIDDM F 46 21.4 14 6.19 43.0 7.6
Mean .+-. SEM 31.4 .+-. 7.7 21.4 .+-. .9 7.51 .+-. 0.7* 33 .+-.
4.8* 8.7 .+-. 0.5* Controls Mean .+-. SEM 17.7 .+-. .2 21.1 .+-.
0.7 4.7 .+-. 0.2 69.9 .+-. 8 <6.2 P value p > 0.08 p > 0.8
P < 0.0008 P < 0.007 P < 0.0004
[0436] Demographic data on the study subjects. Age of diagnosis
refers to the age at which diabetes or IGT was diagnosed. MD3 is
the only MODY3 subject who had demonstrated consistently normal
glucose tolerance. p values refer to the results of analysis of
variance corhparing the three groups. The asterisks denote
statistically significant differences between the diabetic subjects
and the other two groups using Tukey's studentized range test for
post-hoc comparisons.
5 TABLE 5 Insulin Secreted between 5 and 9 mM glucose ID Baseline
Post-glucose Priming effect % Non-diabetic MODY3 MD1 188.1 221.6
17.9 MD3 164.5 255 55 MD4 136.6 208.3 52.5 MD5 297.5 342.5 15.1 MD9
249.1 292.1 34.5 MD13 248.1 234.2 -5.9 MEAN 214.3 .+-. 24.8 259
.+-. 20.6 35 .+-. 8 Diabetic MODY3 MD2 67.4 68.9 2.2 MD6 131.5
109.1 -17 MD7 144.6 85.2 -41 MD8 156.6 189.3 20.9 M10 63.7 34.9 -45
M11 38.2 28.4 -26 M12 102.6 115.1 12.2 MEAN 100.8 .+-. 17.3* 90.0
.+-. 20.8* -13.4 .+-. 9.8* Controls C05 318.1 356.8 12.2 C07 209.5
272.1 29.2 C09 166.9 223.1 33.7 C12 235.6 381.6 62.0 C13 215.6
306.5 42.2 C18 120.1 180.5 50.3 MEAN 211 .+-. 27 287 .+-. 32 38
.+-. 7 p value p < 0.004 P < 0.002 p < 0.009
[0437] The amount of insulin secreted as glucose was raised from 5
to 9 mM in study subjects before and after a priming intravenous
infusion of glucose. Asterisks refer to statistically significant
differences between the diabetic subjects and those in the other
two groups using Tukey's studentized range test for post-hoc
comparisons.
[0438] Changes in Insulin Sensitivity
[0439] Insulin resistance estimated by the Homeostasis Model
Assessment Method (HOMA) (Matthews et al., 1985) failed to
demonstrate significant differences between the groups (diabetic
MODY3: 1.9.+-.0.2; nondiabetic MODY3: 1.7.+-.0.3; controls:
2.4.+-.0.2; P=0.11).
[0440] Dose-Response Relationship Between Glucose and ISR
[0441] The ISR in the three groups was compared at the same plasma
glucose level by plotting the mean ISR at each glucose infusion
rate against the corresponding mean glucose level. The resulting
glucose-ISR dose-response relationships are shown in FIG. 3. Over
the 5-9 mM glucose concentration interval the diabetic MODY3 group
secreted significantly less insulin than subjects in the
nondiabetic MODY3 and control groups (101.+-.17 pmol/min vs.
214.+-.25 pmol/min and 211.+-.27 pmol/min, respectively;
P<0.004). The mean insulin secretion rate did not differ between
these latter two groups.
[0442] The dose response curves (FIG. 3) indicate that the insulin
secretion rates were similar in nondiabetic MODY subjects and
controls at lower glucose concentrations. The amount of insulin
secreted as the glucose concentration was increased from 5-7 mM was
similar in these two groups (180.+-.19 vs. 160.+-.17 pmol/min;
P=0.45). Over the 7-8 mM glucose interval the nondiabetic MODY3
subjects secreted 243.5.+-.31.5 pmol/min compared to 284.7.+-.30.5
pmol/min in controls P=0.37. From 8-9 mM glucose they secreted
257.1.+-.35.0 pmol/min compared to 354.0.+-.43.4 pmol/min in
controls P=012 (FIG. 3). As the glucose concentration was increased
from 7-8 mM to 8-9 mM the increase in insulin secretion rate in the
nondiabetic MODY3 subjects was significantly less than in the
controls (37.3.+-.13.5 vs. 75.7.+-.9.5 pmol/min; P<0.05).
[0443] Effect of Low-Dose Glucose Infusion on Relationships Between
Glucose and ISR
[0444] Mean glucose levels achieved during the 42-h constant
glucose infusion were significantly higher in the diabetic compared
to the nondiabetic MODY3 group and controls (14.9.+-.0.6 mM vs.
10.0.+-.1.4 mM vs. 6.6.+-.0.3 mM; P<0.0001). The glucose
infusion was discontinued after 42-h and low dose insulin was
administered resulting in a fall in the plasma glucose
concentration to similar levels in the two groups. The graded
intravenous glucose infusion study was then repeated in each
subject.
[0445] In order to quantify the priming effect of glucose on
insulin secretion, the average ISR measured during each glucose
infusion rate was plotted against the average plasma glucose
concentration and compared with values obtained before glucose
infusion. Over the glucose concentration range between 5 and 9 mM
glucose, control subjects secreted 211.+-.27 pmol/min before and
287.+-.32 pmol/min (P<0.005) insulin after glucose infusion
(FIG. 4A). There was a shift in the glucose-ISR does-response
curves upwards and to the left, with ISR increasing by 38.+-.7%.
The nondiabetic MODY3 group increased their ISR from 214.+-.25
pmol/min to 259.+-.21 pmol/min (P<0.03) (FIG. 4B). The diabetic
MODY3 group had a small and non significant 13.+-.10% decrease in
ISR after glucose administration (101.+-.17 pmol/min to 90.+-.21
pmol/min; P>0.9) (FIG. 4C). Individual values for ISR from 5-9
mM glucose before and after low-dose glucose infusion are given in
Table 5.
[0446] Relationship Between Glycosylated Hemoglobin Levels and
Parameters of the Insulin Secretory Response to Glucose
[0447] There was a significant negative correlation between
glycosylated hemoglobin and percent priming (r=-0.78; P<0.002)
and between glycosylated hemoglobin and ISR from 5-9 mM glucose
(r=-0.61; P<0.03). By contrast there was no significant decrease
in ISR as glucose concentrations rose from 7-8 to 8-9 mM with
increasing glycosylated hemoglobin levels (r=-0.07; P=0.82).
[0448] 3. Discussion
[0449] Basal glucose levels were higher and insulin levels were
lower in MODY3 subjects with diabetes compared to nondiabetic
subjects or normal healthy controls. In response to the graded
glucose infusion, insulin secretion rates were significantly lower
in the diabetic subjects over a broad range of glucose
concentrations. Insulin secretion rates in the nondiabetic MODY3
subjects were not significantly different from the controls at
plasma levels <8 mM. As glucose rose above this level, however,
the increase in insulin secretion is these subjects was
significantly reduced. Administration of glucose by intravenous
infusion for 42-h resulted in a significant increase in the amount
of insulin secreted over the 5-9 mM glucose concentration range in
the controls and nondiabetic MODY3 subjects (by 38% and 35%,
respectively) but no significant change was observed in the
diabetic MODY3 subjects. In conclusion, in nondiabetic MODY3
subjects insulin secretion demonstrates a diminished ability to
respond when blood glucose exceeds 8 mM. The priming effect of
glucose on insulin secretion is preserved. Thus, .beta.-cell
dysfunction is present prior to the onset of overt hyperglycemia in
this form of MODY. The defect in insulin secretion in the
nondiabetic MODY3 subjects differ from than reported previously in
nondiabetic MODY1 or mildly diabetic MODY2 subjects.
Example 2
[0450] Mutations in HNF1.alpha. Relating to MODY3 Type Diabetes
[0451] 1. Materials and Methods
[0452] Isolation of Partial Sequence of the Human HNF1.alpha.
Gene.
[0453] The PAC clone, 254A7, containing the human HNF1.alpha. gene
was isolated from a library (Genome Systems, St. Louis, Mo.) by
screening PAC DNA pools with PCR and the primers HNF1P1
(5'-TACACCACTCTGGCAGCCACACT-3' SEQ ID NO:10) and HNF1P2
(5'-CGGTGGGTACATTGGTGACAGAAC-3' SEQ ID NO:11). The sequences of the
exons and flanking introns were determined after subcloning
fragments of the 254A7 into pGEM-4Z (Promega Biotec, Madison, Wis.)
or pBluescript SK+ (Stratagene, La Jolla, Calif.) and sequencing
using primers based on the sequence of the human HNF1.alpha. cDNA
(Bach et al., 1990; and Bach and Yaniv, 1993) and selected using
the conserved exon-intron organization of the mouse and rat genes
(Bach et al., 1992) as a guide. Sequencing was carried using a
AmpliTaq FS Dye Terminator Cycle Sequening Kit (ABI, Foster City,
Calif.) on an ABI Prism.TM. 377 DNA Sequencer (ABI). The sequences
of the exon 2/intron 2, exon 3/intron 3, intron 6/exon 7, and
intron 8/exon 9/intron 9 junctions were determined by directly
sequencing PCR products generated by amplification of PAC 254A7 or
human genomic DNA. FIG. 11 shows the cDNA sequence of
HNF1.alpha..
[0454] Screening of HNF1.alpha. Gene for Mutations.
[0455] The ten exons and flanking introns of the HNF1.alpha. gene
of an affected subject from families in which of MODY cosegregated
with markers spanning the MODY3 region of chromsome 12 subjects
with the MODY3-form of NIDDM were amplified using PCR and specific
primers (Table 6). PCR conditions were denaturation at 94.degree.
C. for 5 min following by 35 cycles of denaturation at 94.degree.
C. for 30 sec, annealing at 62.degree. C. for 30 sec (except for
exon 9--annealing temperature was 60.degree. C.) and extension at
72.degree. C. for 45 sec, and final extension at 72.degree. C. for
10 min. The PCR products were purified using a Centricon-100
membrane (Amicon, Beverly, Mass.) and sequenced from both ends
using the primers shown in Table 6, a AmpliTaq FS Dye Terminator
Cycle Sequencing Kit and ABI Prism.TM. 377 DNA Sequencer. The
presence of the specific mutation in other family members was
assessed by amplifying and directly sequencing the appropriate
exon. At least 40 normal unrelated healthy non-diabetic
non-Hispanic white subjects (80 chromosomes) were also similarly
screened. DNA polymorphisms identified during the course of
screening patients for mutations were characterized by PCR and
direct sequencing, or digestion with an appropriate restriction
endonuclease and gel electrophoresis.
6TABLE 6 Sequences of primers used to amplify and directly sequence
exons and flanking introns of the human HNFl.alpha. gene Exon
Forward primer (5'-3') Reverse primer (5'-3') Product size (bp) 1
GGCAGGCAAACGCAACCCACG GAAGGGGGGCTCGTTAGGAGC 483 (SEQ ID NO:12) (SEQ
ID NO:13) 2 CATGCACAGTCCCCACCCTCA CTTCCAGCCCCCACCTATGAG 384 (SEQ ID
NO:14) (SEQ ID NO:15) 3 GGGCAAGGTCAGGGGAATGGA CAGCCCAGACCAAACCAGCAC
306 (SEQ ID NO:16) (SEQ ID NO:17) 4 CAGAACCCTCCCCTTCATGCC
GGTGACTGCTGTCAATGGGAC 404 (SEQ ID NO:18) (SEQ ID NO:19) 5
GCCTCCCTAGGGACTGCTCCA GGCAGACAGGCAGATGGCCTA 347 (SEQ ID NO:20) (SEQ
ID NO:21) 6 TGGAGCAGTCCCTAGGGAGGC GTTGCCCCATGAGCCTCCCAC 320 (SEQ ID
NO:22) (SEQ ID NO:23) 7 GGTCTTGGGCAGGGGTGGGAT CTGCAATGCCTGCCAGGCACC
345 (SEQ ID NO:24) (SEQ ID NO:25) CCCCTGCATCCATTGACAGCC* (SEQ ID
NO:26) 8 GAGGCCTGGGACTAGGGCTGT CTCTGTCACAGGCCGAGGGAG 228 (SEQ ID
NO:27) (SEQ ID NO:28) 9 CCTGTGACAGAGCCCCTCACC CGGACAGCAACAGAAGGGGTG
286 (SEQ ID NO:29) (SEQ ID NO:31) CAGAGCCCCTCACCCCCACAT* (SEQ ID
NO:30) 10 GTACCCCTAGGGACAGGCAGG ACCCCCCAAGCAGGCAGTACA 247 (SEQ ID
NO:32) (SEQ ID NO:33) *= primer used only for sequencing
[0456] 2. Results
[0457] Table 7 identifies the DNA polymorphisms identified in the
coding region of HNF1.alpha. gene. Of course these are exemplary
polymorphisms and those of skill in the art will easily be able to
employ the methods and descriptions set forth in the present
invention to identify other polymorphisms.
7TABLE 7 DNA polymorphisms identified in coding region of human
HNF1.alpha. gene Exon Codon Nucleotide change Frequency 1 17
CTC(Leu).fwdarw.CTG (Leu) C, 0.57; G, 0.43 1 27 ATC(Ile).fwdarw.CTC
(Leu) A, 0.63; C, 0.37 1 98 CCC(Ala).fwdarw.GTC (Val) C, 0.98; T,
0.02 4 279 GGG(Gly).fwdarw.GGC (Gly) G, 0.69; C, 0.31 7 459
CTG(Leu).fwdarw.TTG (Leu) C, 0.63; T, 0.37 7 487
AGC(Ser).fwdarw.AAC (Asn) G, 0.68; C, 0.32 8 515
ACG(Thr).fwdarw.ACA (Thr) G, 0.79; A, 0.21 Intron 1 nt-91
A.fwdarw.G A, 0.88; G, 0.12 Intron 1 nt-42 G.fwdarw.A G, 0.66; A,
0.34 Intron 2 nt-51 T.fwdarw.A T, 0.85; A, 0.15 Intron 2 nt-23
C.fwdarw.T C, 0.88; T, 0.12 Intron 5 nt-47 C.fwdarw.T C, 0.99; T,
0.01 Intron 7 nt-7 G.fwdarw.A G, 0.57; A, 0.43 Intron 9 nt-44
C.fwdarw.T C, 0.96; T, 0.04 Intron 9 nt-24 T.fwdarw.C T, 0.59; C,
0.41
[0458] Table 8 shows a summary of mutations identified in human
HNF1.alpha. in patients with MODY3. Sixteen exemplary mutations are
identified in the HNF-1.alpha. gene in MODY3 patients but were not
present in unaffected individuals, these mutations include
frameshifts in exons 1, 4, 6, and 9, nissense coding in exons 2,
and 7 as well as abnromal splicing in introns 5 and 9. The results
described herein demonstrate that mutations in this transcription
factor can cause diabetes mellitus and focuses attention on the
role of HNF-1.alpha. in determining normal pancreatic .beta.-cell
function.
8TABLE 8 Summary Of Mutations In Human HNF1.alpha. In Patients With
MODY1 Location Mutation/Location Effect Family Exon 1
R55G56fsde1GAGGG Frameshift F593 Exon 2 codon 122 Y.fwdarw.C R213
codon 131 R.fwdarw.Q H, GL codon 142 S.fwdarw.F F515 codon 159
R.fwdarw.Q F384 codon 171 R.fwdarw.X F Pierre Exon 4 P291fsinsC
Frameshift EA, SW, G17, G18, M13 P291fsdelC Frameshift FS4
G292fsdelG Frameshift F159 Intron 5 IVS5nt-2A.fwdarw.G abnormal P
splice Exon 6 P379fsdelCT Frameshift R, F632 P379fsinsC Frameshift
F549 Q401fsdelC Frameshift G19 Exon 7 codon 447 P.fwdarw.L A,
Danish-1 Exon 9 T547E548fsdelTG Frameshift ber Intron 9 IVS9nt +
1G.fwdarw.A abnormal GK splice
[0459] 3. Discussion
[0460] Linkage analysis localized MODY3 to a 10 cM interval of
chromosome 12 between the markers D12S86 and D12S342 (Vaxillaire et
al., 1995) and then to a 5 cM interval between the markers D12S86
and D12S807/D12S820 (Menzel, S. et al. 1995). A combined YAC, BAC
and PAC contig spanning D12S86 and D12S807 (FIG. 9) was generated
using information in public databases (Chumakov et al. 1995; Hudson
et al. 1995) and screening appropriate libraries (YAC and BAC,
Research Genetics, Huntsville, Ala.; and PAC, Genome Systems, St.
Louis, Mo.) with STSs from the MODY3 region. The physical map
allowed localization of new polymorphisms as they were reported as
well as to generate new markers to further localize recombination
events in key individuals. Such studies refined the localization of
MODY3 to the 3 cM interval between D12S 1666 and the polymorphic
STS UC-39. Fluorescence in situ chromosomal hybridization using the
BAC 162B15 mapped the contig to chromosome band 12q24.2.
[0461] This combination of genetic and physical mapping information
was used to begin a systematic search for MODY3. Using a
combination of approaches including testing genes known to be on
the long arm of chromosome 12 to see if they mapped into the
contig, exon-trapping (Church, et al. 1994), and cDNA selection
(Kaplan et al., 1992) using human pancreatic islet cDNA (clinical
studies had shown that insulin secretion was abnormal in MODY3
patients, and thus islets were a likely site of expression of MODY3
mRNA and protein), the inventors identified 14 genes encoding known
proteins (.gamma.-subunit of AMP-activated protein kinase, citron,
the GTP-binding protein H-ray, paxillin, acidic ribosomal
phosphoprotein P0, pancreatic phospholipase A2, splicing factor
SRp30, cyctochrome C oxidase subunit VIa, short chain acyl CoA
dehydrogenase, HNF-1.alpha., thyroid receptor interactor (TRIP14)
protein, Ca.sup.2+/calmodulin-dependent protein kinase,
P.sub.2.times.4 purinoceptor and restin), 5 pseudogenes
(metallopanstimulin-like, cell surface heparin binding
protein-like, ribosomal protein L12-like, nucleoside diphosphate
kinase-like and ADP ribosylation factor-like), 12 ESTs (yq81d09,
yd50d03, IB383, hbc3028, yu36h05, yn75d09, yz51b06, yd88g07,
ym03h09, ym30e05, WI-6178/c-01h06, WI-6239/c-04b12) and 9 unknown
genes (FIG. 9).
[0462] These genes were being systematically sequenced in affected
and unaffected subjects using nested PCR and illegitimate
transcription of lymphoblastoid RNA (Kaplan et al., 1992), as well
as PCR of individual exons of the gene. Comparison of the sequences
of the pancreatic phospholipase A2, .gamma.-subunit of
AMP-activated protein kinase, H-ray, cytochrome C oxidase subunit
VIA, acidic ribosomal phosphoprotein P0, paxillin, splicing factor
SRp30, short chain acyl CoA dehydrogenase, and P2.times.4
purinoceptor genes from patients and controls revealed a number of
polymorphisms but no MODY3-associated mutations.
[0463] The HNF-1.alpha. gene was localized in the interval
containing MODY3 using PCR and HNF-1.alpha. gene-specific primers
(FIG. 9). HNF-1.alpha. cDNAs were also isolated at high frequency
by cDNA selection from human pancreatic islet cDNA using PAC 254A7,
a result consistent with the report of Emens et al. (1992) showing
that HNF-1.alpha. was expressed in hamster insulinoma cells and
functioned as a weak transactivator of the rat insulin I gene. The
human HNF-1.alpha. gene was isolated and partially sequenced to
provide the exon-intron organization and the sequences of introns
from which primers could be selected for PCR. The human gene
consists of 10 exons with introns 1-8 located in the same positions
as in the rat and mouse genes (Bach et al., 1992). Intron 9
interrupts codon 590 (phase 1) and is not present in the rat and
mouse genes but does occur in the chicken gene (Horlein et al.,
1993) consistent with loss of this intron during the period when
humans and rodents shared their last common ancestor. Amplification
and direct sequencing of exon 4 of subject EA1 (Edinburgh pedigree,
FIG. 5A) showed an insertion of a C in codon 289 (Pro) resulting in
a frameshift and premature termination (designated P289fsinsC)
(FIG. 10). This mutation was present in all affected members and no
unaffected members of this family. It was also not found on
screening 55 healthy non-diabetic white subjects (110 chromosomes).
Hence it was concluded that the HNF-1.alpha. gene is MODY3 and led
the inventors to sequence the HNF-1.alpha. gene in other families
in which NIDDM cosegregated with markers from the MODY3 region.
[0464] Fifteen additional mutations were found (Table 8), all of
which co-segregated with NIDDM, and did not occur in any of at
least 50 healthy non-diabetic white subjects. However, there were
individuals in several pedigrees (GK pedigree, III-3; Ber pedigree,
V-2; and P pedigree, IV-5 and IV-6) who had inherited the mutant
chromosome (and at-risk chromosome 12 haplotype) but who were
non-diabetic or showed only evidence of impaired glucose
intolerance or diabetes during pregnancy. These individuals will
likely develop NIDDM in the future. In addition, one subject with
NIDDM did not have the mutant allele (Ber pedigree, II-2). He was
diagnosed with NIDDM at 65 years of age at which time he was mildly
obese with a body mass index of 27 kg/m.sup.2 suggesting a
diagnosis of late-onset NIDDM rather than MODY. Such heterogeneity
within MODY families has been noted previously (Bell et al. 1991;
Vionnet 1992) and is due to the high frequency of late-onset NIDDM
which affects 10% or more of individuals over age 65 years (Kenny
et al., 1995). In addition to the mutations listed in Table 8,
three amino acid polymorphisms (I/L27, A/V98 and S/N487), four
silent polymorphisms (in codons for L17, G288, I459 and T515) and
seven polymorphisms in introns were found in the HNF-1.alpha. gene
(Tables 7 and 8).
[0465] Sixteen different mutations in the HNF-1.alpha. gene were
identified in patients with the MODY3-form of diabetes. The
splicing and frameshift mutations would be predicted to result in
the expression of a truncated protein having at least amino acids
1-290 of the native protein. The missense mutations, R131Q and
P447L, are of residues that are conserved in human, rat, mouse,
hamster, chicken, Xenopus and salmon HNF-1.alpha. and the
structurally-related transcription factor human HNF-1.beta.
suggesting that these residues are functionally important.
[0466] HNF-1.alpha. is one of a group of transcription factors
expressed in liver that act together to confer tissue-specific
expression of genes in this tissue (Tronche et al., 1992; Bach et
al., 1990). It is also found in kidney, intestine, stomach and
pancreas, including islets of Langerhans, and at low levels in
spleen and testis suggesting that it plays a role in
transcriptional regulation in these tissues as well. HNF-1.alpha.
is composed of three functional domains: an NH.sub.2-terminal
dimerization domain (amino acids 1-32), a DNA binding domain with
POU-like and homeodomain-like motifs (amino acids 150-280) and a
COOH-terminal transactivation domain (amino acids 281-631). The
functional form of HNF-1.alpha. is a dimer and HNF-1.alpha. may
form homodimers or heterodimers with the structurally-related
protein HNF-1.beta. (Mendel et al., 1991)
[0467] Pontoglio et al. (1996) have generated mice that lack
HNF-1.alpha.. Homozygous HNF-1.alpha.-deficient animals failed to
thrive and usually died around the time of weaning. They also
suffered from phenylketonuria and renal tubular dysfunction.
However, the homozygous HNF-1.alpha.-deficient mice did not appear
to be diabetic as they had normal blood glucose levels and a normal
response to an intravenous bolus injection of glucose. The massive
glucosuria in these animals though may have masked the presence of
diabetes mellitus. The insulin secretory responses of heterozygous
HNF-1.alpha.-deficient mice, animals that may be most similar to
human subjects with HNF-1.alpha. mutations and MODY, were not
reported. In view of the present findings that mutations in the
HNF-1.alpha. gene causes early-onset NIDDM, more detailed
evaluation of .beta.-cell and liver function in
HNF-1.alpha.-deficient mice is indicated.
[0468] The mechanism by which mutations in the HNF-1.alpha. gene
when present on a single allele can cause diabetes is unclear
however, it is possible that a partial deficiency of HNF-1.alpha.
could lead to .beta.-cell dysfunction and diabetes. Alternatively,
mutations in HNF-1.alpha. may cause diabetes by a dominant-negative
mechanism (Herskowitz, 1987) by interfering with the function of
wild-type HNF-1.alpha. and other proteins which act in concert with
HNF-1.alpha. to regulate transcription in the .beta.-cell and/or
liver. All of the HNF-1.alpha. gene mutations identified to date
would result in the synthesis of a mutant protein impaired in DNA
binding or transactivation but not dimerization. These mutant
proteins could form non-productive dimers with the product of the
normal HNF-1.alpha. allele or other proteins such as HNF-1.beta.
and thereby impair the normal function of HNF-1.alpha..
[0469] The inventors have previously shown that diabetes mellitus
in the Zucker diabetic fatty rat, a rodent model of obesity and
NIDDM, is associated with decreased expression of a large number of
.beta.-cell genes including genes such as insulin whose expression
is restricted to the .beta.-cell as well as others with a much
broader tissue distribution (Tokuyama, et al. 1995). Thus, it is
believed that NIDDM is likely to be a disorder of transcription
with genetic or acquired defects affecting key proteins that
regulate transcription leading to .beta.-cell dysfunction and
diabetes.
Example 3
Mutations in HNF4.alpha. Relating to MODY1 Type Diabetes
[0470] The PAC clone, 114E13, 130B8, 207N8, containing the human
HNF4.alpha. gene was isolated from a library (Genome Systems, St.
Louis, Mo.) by screening PAC DNA pools with PCR and the primers
HNF4P1 (5'-CACCTGGTGATCACGTGGTC-3' SEQ ID NO:81) and HNF4P2
(5'-GTAAGGCTCAAGTCATCTCC-3' SEQ ID NO:82). The sequences of the
exons and flanking introns were determined by directly sequencing
using primers based on the sequence of the human HNF4.alpha. cDNA
(Chartier et al., 1994; Drewes et al., 1996) and selected using the
conserved exon-intron organization of the mouse (Taraviras et al,
1994) as a guide. Sequencing was carried using a AmpliTaq FS Dye
Terminator Cycle Sequening Kit (ABI, Foster City, Calif.) on an ABI
Prism.TM. 377 DNA Sequencer (ABI).
[0471] Screening of HNF4.alpha. Gene for Mutations.
[0472] The eleven exons and flanking introns of the HNF4.alpha.
gene of an affected subject from families in which of MODY
cosegregated with markers spanning the MODY1 region of chromsome 20
subjects with the MODY1-form of NIDDM were amplified using PCR and
specific primers (Table 9). PCR conditions were denaturation at
94.degree. C. for 5 min following by 35 cycles of denaturation at
94.degree. C. for 30 sec, annealing at 60.degree. C. for 30 sec and
extension at 72.degree. C. for 30 sec, and final extension at
72.degree. C. for 10 min. The PCR products were purified using a
Centricon-100 membrane (Amicon, Beverly, Mass.) and sequenced from
both ends using the primers shown in Table 9, a AmpliTaq FS Dye
Terminator Cycle Sequencing Kit and ABI Prism.TM. 377 DNA
Sequencer. The presence of the specific mutation in other family
members was assessed by digestion with Bta3 restriction
endonuclease that resulted from mutation and gel electrophoresis.
At least 100 normal unrelated healthy non-diabetic non-Hispanic
white subjects (200 normal chromosomes) were also similarly
screened. DNA polymorphisms identified during the course of
screening patients for mutations were characterized by PCR and
direct sequencing, or digestion with an appropriate restriction
endonuclease and gel electrophoresis.
9TABLE 9 DNA Sequences of PCR Primers for MODY1 Exon Forward primer
(5'-3') Reverse primer (5'-3') Product size (bp) 1
GGGCACTGGGAGGAGGCAGT (SEQ ID NO:56) GCCTGTAGGACCAACCTACC (SEQ ID
NO:57) 340 1b TCTGGTGTGCACGACTGCAC (SEQ ID NO:58)
CTGGAGCTGCAGCCTCATAC (SEQ ID NO:59) 356 2 AAGGCTCCCTTAGATGCCTG (SEQ
ID NO:60) CCACTCAGGGAGAAGACAGACCT (SEQ ID NO:61) 321 3
CCTAGTTCTGTCCTAAGAGG (SEQ ID NO:62) GTCATAAAGTGTGGCTACAG (SEQ ID
NO:63) 253 4 CCACCCCCTACTCCATCCCTGT (SEQ ID NO:64)
CCCTCCCGTCAGCTGCTCCA (SEQ ID NO:65) 272 5 GTGCAGGGGACAGAGAATGC (SEQ
ID NO:66) AATCAAGCCAGTCCACGGCTAT (SEQ ID NO:67) 322 6
GCCCAGCGTCACTGAGTTGGCTA (SEQ ID NO:68) TTGCCTGGGTGAGTGCCATG (SEQ ID
NO:69) 234 7 GCACCAGCTATCTTGCCAAC (SEQ ID NO:70)
AGGAGAAGTCTGGCAGAGCG (SEQ ID NO:71) 315 8 CTCCTTGTGTGACACAAGTC (SEQ
ID NO:72) CTCACTGTGTGAGGCCTGTC (SEQ ID NO:73) 407 9
TGGTTGATTGGCCACGCCTG (SEQ ID NO:74) ATCCTGGTTCTACCTTCTAG (SEQ ID
NO:75) 341 10 CATTTACTCCCACAAAGGCT (SEQ ID NO:76)
GACCACGTGATCACCAGGTG (SEQ ID NO:77) 277
[0473] Table 10 identifies the DNA polymorphisms and mutations
identified in the coding region of the HNF4.alpha. gene. Of course,
these are exemplary polymorphisms and those of skill in the art
will easily be able to employ the methods and descriptions set
forth in the present invention to identify other polymorphisms.
FIG. 7 shows an alignment of the HNF4.alpha. protein sequence from
humans with sequences from human mouse, X. Laves and Drosophila.
The putative DNA binding sites are underlined and the putative
ligand binding sites are in bold. The DNA sequences for exon 1,
exon 1b, exon 2, exon 3, exon 4, exon 5 exon 6 exon 7 exon 8 exon 9
and exon 10 of HNF4.alpha. are show in FIG. 8A, FIG. 8B, FIG. 8C,
FIG. 8D FIG. 8E, FIG. 8F, FIG. 8G, FIG. 8I, FIG. 8H, FIG. 8I and
SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID
NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ
ID NO:52, and SEQ ID NO:54, respectively. It is contemplated that
mutations in any of these exons, or the related intron regions
therebetween, of HNF4.alpha. will result in MODY1 type
diabetes.
10TABLE 10 Polymorphisms and Mutations in the Human HNF4.alpha.
Gene Location Nucleotide change Exon Codon Frequency 4 130 ACT
(Thr)-ATT(Ile) C:T = 105:5 C-0.95, T-0.05 7 273 GAT(Asp)-GAC(Asp)
T:C = 169:1 T-0.004, C-0.006 7 268 GAG(Gln)-TAG(stop) 0/216 control
chromosomes
[0474] The R-W pedigree, which includes more than 360 members
spanning 6 generations and 74 members with diabetes including those
with MODY, has been studied prospectively since 1958 (Fajans,
1989). The members of this family are descendants of a man who was
born in East Prussia in 1809 and emigrated to Detroit, Mich. in
1861 with his four sons, three of whom were diabetic, and five
daughters, one of whom was diabetic (Fajans, 1989; Fajans et
al.,1994). Linkage studies have shown that the gene responsible for
MODY in this family, MODY1, is tightly linked to markers in
chromosome band 20q12-q13.1 with a multipoint lod score >14 in
those branches of the family in which MODY is segregating (Bell, et
al. 1991; Bowden, et al., 1992; Irwin, et al., 1994). The analysis
of key recombinants in the R-W pedigree localized MODY1 to a 13-cM
interval (.about.7 Mb) between D20S 169 and D20S 176, an interval
which also includes the gene encoding HNF-4 (Stoffel, M. et al.,
1996). The demonstration in the previous examples that mutations in
the HNF1.alpha. gene are the cause of the MODY3-form of NIDDM
prompted the inventors to screen the HNF4.alpha. gene for mutations
in the R-W pedigree.
[0475] The human HNF-4.alpha. gene consists of 11 exons with the
introns being located in the same positions as in the mouse gene
(Tavaviras, et al., 1994). Alternative splicing generates a family
of HNF-4.alpha. mRNAs, HNF-4 1, 2 and 4, the latter two of which
contain inserts of 30 and 90 nucleotides, respectively (Tavaviras
et al., 1994; Laine et al., 1994; Drewes, 1996). Of these, HNF4 2
mRNA appears to be the most abundant transcript in many tissues. In
contrast to a previous report (Drewes et al., 1996), the inventors
studies show that HNF-4.alpha. mRNA encodes a truncated and
presumably nonfunctional form of HNF-4.alpha.. The sequence of exon
1B, the exon encoding the insertion in HNF4.alpha. mRNA revealed an
additional T between nucleotides 219 and 220 in both alleles of
five unrelated individuals (10 chromosomes) not present in the cDNA
sequence (Drewes et al., 1996) which causes a frameshift and the
generation of a protein of 98 amino acids whose function, if any,
is unknown. The 11 exons of the HNF4.alpha. gene of two affected,
V-20 and 22, and one unaffected, VI-9, subject from the R-W
pedigree were amplified and the PCR products sequenced directly.
The sequences were identical to one another and to the cDNA (Drewes
et al., 1996; Laine et al., 1994)) except for a C.fwdarw.T
substitutions in exon 4, codon 130 and exon 7, codon 268. The
C.fwdarw.T substitution in codon 130 results in a Thr
(ACT).fwdarw.Ile (ATT) substitution and is a polymorphism (T/I130)
with a frequency of the Ile allele in a group of 55 unrelated
nondiabetic non-Hispanic white subjects of 5%. The C.fwdarw.T
substitution in codon 268 results in a nonsense mutation CAG
(Gln).fwdarw.TAG (AM) (Q268X). The nonsense mutation was confirmed
by cloning and sequencing PCR products derived from both alleles.
The Q268X mutation created a site for the enzyme Bfa I with
digestion of the normal allele generating fragments of 281 and 34
bp, and the mutant allele, 152, 129 and 34 bp and facilitating
testing for this mutation in other members of the R-W pedigree. In
the R-W pedigree, Ile130 and the amber mutation at codon 268 were
present in the same allele.
[0476] The Q268X mutation cosegregated with the at-risk haplotype
and NIDDM in the R-W pedigree and was not observed on screening 108
healthy nondiabetic non-Hispanic white subjects (216 normal
chromosomes). Seven subjects in the R-W pedigree who have inherited
the mutant allele (V-18, 37 and 48; and VI-6, 11, 15 and 20) have
normal glucose tolerance. The ages of five of these subjects (V-48,
and VI-6, 11, 15 and 20) are less than 25 years and thus, they are
still within the age range when diabetes usually develops in
at-risk individuals in this family. Of the others, subject V-18 is
44 years of age and has shown normal glucose on all oral glucose
tolerance tests, and subject V-37 who is 36 years of age had one
glucose tolerance test characteristic of impaired glucose tolerance
and one of diabetes at ages 16-17 years but for the past 19 years
each glucose tolerance test has been normal even though she has a
low insulin response to orally administered glucose. She is very
lean and active, and has increased sensitivity to insulin during
the frequently sampled intravenous glucose tolerance test. During a
prolonged low dose glucose infusion, she became markedly
hyperglycemic (Herman, et al. 1994; Byrne, et al. 1995). Two
subjects (V-1 and 4) who have the mutation were considered
nondiabetic based on medical history and their affection status
needs to be evaluated by oral glucose tolerance testing. The
results indicate that the nonsense mutation in the HNF-4 gene in
the R-W pedigree is highly but not completely penetrant although
the age of diabetes onset is variable.
[0477] In addition to subjects who inherited the Q268X mutation but
are presently nondiabetic, there are subjects in the R-W pedigree
who have NIDDM but did not inherit the Q268X mutation or at-risk
haplotype. Subject IV-9 was diagnosed with NIDDM at 48 years of age
and was hyperinsulinemic, a diagnosis consistent with late-onset
NIDDM rather than MODY. The inventors also tested her six children,
one of whom had NIDDM and another impaired glucose tolerance, and
all had two normal alleles. Similarly, 10 children of subject
III-7, five of whom had NIDDM were also tested, and none had
inherited the Q268X mutation, suggesting that the NIDDM in this
branch of the R-W family is of a different etiology. Finally, the
five nondiabetic children of III-11 were also tested and all were
normal. The presence of both MODY and late-onset NIDDM in the R-W
family has been noted previously (Bell, et al. 1991; Bowden, et al,
1992). The MODY phenotype results from a mutation in the HNF-4
gene. The cause(s) of the late-onset NIDDM is unknown.
[0478] HNF-4 is a member of the steroid/thyroid hormone receptor
superfamily and is expressed at highest levels in liver, kidney and
intestine (Xanthopoulos et al., 1991; Sladek et al., 1990). It is
also expressed in pancreatic islets and insulinoma cells (Miquerol,
et al 1994). In liver, HNF-4.alpha. is a key regulator of hepatic
gene expression and is a major activator of HNF-1.alpha. which in
turn activates expression of a large number of liver-specific genes
including those involved in glucose, cholesterol and fatty acid
metabolism (Sladek et al., 1990; Kuo et al., 1992). Its expression
in kidney, intestine and pancreatic islets implies that it plays a
central role in tissue-specific regulation of gene expression in
these tissues as well, although its specific function in nonhepatic
tissues has not been addressed. Homozygous loss of functional
HNF-4.alpha. protein causes embryonic lethality characterized by
defects in gastrulation underscoring the key role played by this
transcription factor in development and differentiation (Chen et
al., 1994). The phenotype of the heterozygous animals was not
described and further studies are necessary to determine if they
represent a mouse model of MODY.
[0479] HNF-4.alpha. defines a subclass of nuclear receptors which
reside primarily in the nucleus and bind to their recognition site
and regulate transcription as homodimers (Sladek et al., 1994; Kuo
et al., 1992). The key role played by HNF-4.alpha. in the
regulation of hepatic gene expression is well established (Sladek
et al., 1994; Kuo et al., 1992). However, its role as well as that
of HNF-1.alpha., the MODY3 product and a downstream target of
HNF-4.alpha. action, in regulating gene expression in the
insulin-secreting pancreatic .beta.-cell is largely unknown,
although Emens et al. (1992) have shown that HNF-1.alpha. is a weak
transactivator of the insulin gene. Thus, the mechanism by which
mutations in HNF-4.alpha. result in an autosomal dominant form of
NIDDM characterized by pancreatic--cell dysfunction is unclear. The
nonsense mutation in HNF-4.alpha. found in the R-W family is
predicted to result in the synthesis of a protein of 267 amino
acids with an intact DNA binding domain. However, it is missing the
regions involved in dimerization and transcriptional activation in
other members of the steroid/thyroid hormone superfamily Zhang, et
al., 1994; Bourguet, et al., 1995; Renaud, et al. 1995; Wagner, R.
L. et al. 1995) and as a consequence is predicted to be unable to
dimerize, bind to its recognition site and activate transcription.
Thus, the dominant inheritance is due to a reduction in the amount
of HNF-4.alpha. per se rather than a dominant negative mechanism.
The decreased levels of functional HNF-4.alpha. appear to have a
critical effect on .beta.-cell function perhaps as a consequence of
decreased HNF-1.alpha. gene expression, mutations in this gene also
leading to MODY as described in the examples above. Prediabetic
subjects with mutations in either the HNF-4.alpha. or HNF-1.alpha.
genes exhibit similar abnormalities in glucose-stimulated insulin
secretion with normal insulin secretion rates at lower glucose
concentrations but lower than normal rates as the glucose
concentration increases (Byrne et al., 1995), a result consistent
with HNF-4.alpha. and HNF-1.alpha. affecting a common pathway in
the pancreatic .beta.-cell. The absence of overt hepatic, renal or
gastrointestinal dysfunction in affected members of the R-W
pedigree suggests that the levels of HNF-4.alpha. in these tissues,
although possibly lower than normal, are sufficient to ensure
normal function or that alternative pathways are sufficient for
expression of key genes. However, detailed studies of hepatic
glucose production and metabolism have not performed in subjects
from the R-W pedigree and it is possible that subtle alterations in
these processes may be present.
[0480] The demonstration that MODY can result from mutations in the
HNF-1.alpha. and HNF-4.alpha. genes suggests that this form of
NIDDM is primarily a disorder of abnormal gene expression. In this
regard, genes encoding other proteins in the
HNF-1.alpha./HNF-4.alpha. regulatory cascade such as other members
of the HNF-1 (Mendel et al., 1994) and HNF-4 families (Drewes et
al., 1996) as well as HNF-3 (Lai et al., 1993), HNF-6 (Lemaigre, et
al. 1996).), and perhaps dimerization cofactor of HNF-1 (Mendel et
al., 1991) should be considered as candidates for other forms of
MODY and/or late-onset NIDDM. The role of HNF-4.alpha. in the
development of the more common late-onset NIDDM is unknown. There
is no evidence for linkage of markers flanking the HNF-4.alpha.
gene with late-onset NIDDM in Mexican Americans or Japanese
implying that mutations in the HNF-4.alpha. gene are unlikely to a
significant genetic factor contributing to the development of
late-onset NIDDM. However, acquired defects in HNF-4.alpha.
expression may contribute, at least in part, to the .beta.-cell
dysfunction which characterizes late-onset NIDDM (Polonsky et al.,
1996) especially if it plays a central role in regulating gene
expression in the pancreatic .beta.-cell as suggested by its
association with MODY. Furthermore, the similarity between
HNF-4.alpha. and ligand dependent transcription factors raises the
possibility that HNF-4.alpha. and the genes it regulates respond to
an unidentified ligand. The identification of such a ligand by the
methods of the present invention will lead to new approaches for
treating diabetes.
Example 4
Organization and Partial Sequence of the HNF 4.alpha./MODY1 Gene
and Identification of Missense Mutation, R127W, in a Japanese
Family with MODY
[0481] HNF-4.alpha. is a member of the nuclear receptor
superfamily, a class of ligand-activated transcription factors. A
nonsense mutation in the gene encoding this transcription factor
has been recently found in a white family with one form of
maturity-onset diabetes of the young, MODY1. In the present
example, the inventors report the exon-intron organization and
partial sequence of the human HNF4.alpha. gene. In addition, the
inventors have screened the twelve exons, flanking introns and
minimal promoter region for mutations in a group of 57 unrelated
Japanese subjects with early-onset NIDDM/MODY of unknown cause.
Eight nucleotide substitutions were noted, of which one resulted in
the mutation of a conserved arginine residue, Arg127
(CGG).fwdarw.Trp (TGG) (designated R127W), located in the T-box, a
region of the protein that may play a role in HNF-4.alpha.
dimerization and DNA binding. This mutation was not found in 214
unrelated nondiabetic subjects (53 Japanese, 53 Chinese, 51 white
and 57 African-American). The R127W mutation was only present in
three of five diabetic members in this family indicating that it is
not the only cause of diabetes in this family. The remaining seven
nucleotide substitutions were located in the proximal promoter
region and introns. They are not predicted to affect the
transcription of the gene or mRNA processing and represent
polymorphisms and rare variants. The results suggest that mutations
in the HNF-4.alpha. gene may cause early-onset NIDDM/MODY in
Japanese but they are less common than mutations in the
HNF-1.alpha./MODY3 gene. The information on the sequence of the
HNF-4.alpha. gene and its promoter region will facilitate the
search for mutations in other populations and studies of the role
of this gene in determining normal pancreatic .beta.-cell
function.
[0482] 1. Methods
[0483] Isolation and Partial Sequence of the Human HNF-4.alpha.
Gene
[0484] Three P1-derived artificial chromosome (PAC) clones, 114E13,
130B8 and 207N8, containing the human HNF-4.alpha. gene were
isolated by screening PAC DNA pools (Genome System, St. Louis, Mo.)
by PCR.TM. with HNF-4.alpha. specific primers (Yamagata et al.,
1996a). The partial sequence of the HNF-4.alpha. gene was
determined using DNA from PAC's 114E13 and 207N8 and
sequence-specific primers with an AmpliTaq FS Dye Terminator Cycle
Sequencing Kit and ABI Prism.TM. 377 DNA sequencer (ABI, Foster
City, Calif.). The promoter sequence was examined for transcription
factor binding sites using Matlnspector (Quandt et al., 1995) and
TFSEARCH (Version 1.3 http//www.genome.ad.gp/kit/tfsearch.html)- .
The sequences of alternatively-spliced mRNAs were confirmed by
sequencing PCR.TM. products generated by amplification of human
liver cDNA using specific primers.
[0485] Screening of the HNF-4.alpha. Gene for Mutations
[0486] The 12 exons, flanking introns and minimal promoter region
were screened for mutations by amplifying and directly sequencing
both strands of the PCR.TM. product using specific primers (the
sequences of the primers are available at
www.diabetes.org/diabetes). The sequence of the missense mutation
(R127W) was confirmed by cloning the PCR.TM. product into pGEM-T
(Promega, Madison, Wis.) and sequencing clones representing both
alleles. The R127W mutation leads to loss of a Msp I site and
subjects were tested for the presence of this mutation by digestion
of the PCR.TM. product of exon 4 with Msp I, separation of the
fragments by electrophoresis on a 3% NuSieve.RTM. 3:1 agarose gel
(FMC BioProducts, Rockland, Me.) and visualization by ethidium
bromide staining. The sequences of the DNA polymorphisms are based
on sequencing both strands of the PCR.TM. product and were not
confirmed directly by cloning and sequencing the PCR.TM.
product.
[0487] Subjects
[0488] The study population consisted of 57 unrelated Japanese
subjects attending the Diabetes Clinic, Tokyo Women's Medical
College who were diagnosed with NIDDM before 25 years of age and/or
who were members of families in which NIDDM was present in three or
more generations: age at diagnosis, 20.1.+-.7.5 years (mean.+-.SE);
male/female, 31/26; and treatment, insulin-36, oral hypoglycemic
agents-10, and diet-11. Thirty-two of the subjects met strict
criteria for a diagnosis of MODY (i.e., NIDDM in at least three
generations with autosomal dominant transmission and diagnosis
before 25 years of age in at least one affected subject). NIDDM was
diagnosed using the criteria of the World Health Organization
(Bennett et al., 1994). At the time of recruitment, informed
consent was obtained from each subject and a blood sample was taken
for DNA isolation. Fifty-three unrelated nondiabetic Japanese
subjects were tested for each nucleotide substitution and mutation
to determine if the sequence change was a polymorphism or
disease-associated mutation. In addition, 53 Chinese (15), 51 white
(16), and 57 African-American unrelated nondiabetic subjects (16)
were tested for the R127W mutation
[0489] 2. Results
[0490] Organization and partial sequence of human HNF-4.alpha.
gene. The human HNF-4.alpha. gene (gene symbol, TCF14) consists of
12 exons spanning approximately 30 kb, of which about 10 kb were
sequenced including 1 kb of the promoter region (the gene sequence
is available at www.diabetes.org/diabetes). Human HNF-4.alpha. mRNA
is alternatively spliced (Hata et al., 1992; Chartier et al., 1994;
Drewes et al., 1996; Kritis et al., 1996) which may generate as
many as six different forms of HNF-4.alpha. (FIG. 12).
HNF-4.alpha.2 is the predominant form present in many adult tissues
including liver, kidney and intestine. The inventors have used
RT-PCR.TM. to determine which HNF-4.alpha. transcripts are
expressed in human pancreatic islets. This analysis showed that
islets express mRNAs for HNF-4.alpha.1, 2 and 3. The inventors
could not detect islet transcripts that included exons 1C and 1B
although transcripts containing these two exons could be detected
in human liver by RT-PCR.TM..
[0491] The sequence of 1 kb of the promoter region of the human
HNF-4.alpha. gene was determined (FIG. 13). The comparison of the
sequences of the human and mouse genes showed regions of sequence
conservation that included the predicted start of transcription and
the binding sites for several transcription factors including
HNF-6, AP-1, HNF-3, HNF-1.alpha. and NF-1. The transcription start
site for the human gene has not been determined directly but has
been inferred from studies of the mouse gene which showed multiple
start sites spread over a 10 bp interval (Zhong et al., 1994;
Tavaviras et al., 1994) of which one was defined as nucleotide +1
(Zhong et al., 1994). The sequence homology in the promoter of the
human and mouse genes suggests that transcription of the
HNF-4.alpha. gene may be regulated in a similar manner. In this
regard, Zhong et al. (Zhong et al., 1994) have shown that the major
promoter activity in a hepatoma cell line was associated with a 126
bp fragment of the mouse promoter (nucleotides 289-414 in FIG. 13).
There is 83% identity between the human and mouse sequences in this
minimal promoter region.
[0492] Mutations and polymorphisms in the HNF-4.alpha. gene. The
twelve exons, flanking introns and minimal promoter region were
screened for mutations in 57 unrelated Japanese subjects with
early-onset NIDDM/MODY. This analysis revealed one putative
mutation (FIG. 14) and seven DNA polymorphisms/variants (Table 11).
The putative mutation in exon 4 at codon 127, CGG (Arg).fwdarw.TGG
(Trp) (R127W) alters a conserved amino acid that is located in the
T-box, a region implicated in receptor dimerization and DNA binding
(Lee et al., 1993; Rastinejad et al., 1995; Gronemeyer and Moras,
1995; Jiang and Sladek et al., 1997). The C.fwdarw.T substitution
in codon 127 results in the loss of a site for the enzyme Msp I and
digestion of the normal allele generates fragments of 104, 91, and
76 bp, whereas the mutant allele generates fragments of 104 and 167
bp. PCR.TM.-RFLP analysis showed that the R127W mutation was not
present in any of 214 unrelated nondiabetic subjects of different
ethnic groups (53 Japanese, 53 Chinese, 51 white and 57
African-American).
11TABLE 11 DNA Polymorphisms/Variants in the Human HNF-4.alpha.
Gene in Japanese Subjects Allele frequency Early-onset Location
Nucleotide Substitution NIDDM/MODY Nondiabetic Promoter nt 922
G.fwdarw.A G-0.99, A-0.01 G-1.00, A-0.00 Intron 1A nt 1364
T.fwdarw.C T-0.99, A-0.01 T-1.00, C-0.00 (+109) nt 1486 G.fwdarw.A
G-0.99, A-0.01 G-0.99, A-0.01 (-21) Intron 1C nt 2218 G.fwdarw.A
G-0.99, A-0.01 G-1.00, A-0.00 (-105) Intron 1B nt 2420 A.fwdarw.G
G-0.99, A-0.01 G-0.99, A-0.01 (+8) nt 3142 T.fwdarw.C T-0.28,
C-0.72 T-0.24, C-0.76 (-38) nt 3175 C.fwdarw.T C-0.84, T-0.16
C-0.86, T-0.14 (-5)
[0493] The R127W mutation was present in three of five diabetic
members of the J2-21 family, a MODY family characterized by severe
microvascular complications (Iwasaki et al., 1988) (FIG. 15). In
addition, subject II-2 must be a carrier since she has children
with both normal homozygous and heterozygous genotypes. The age at
diagnosis of diabetes in two of the four subjects with the R127W
mutation was <25 years (subject II-2, 16 years; and subject
III-4, 17 years). One of the subjects with the R127W mutation was
diagnosed with diabetes at 90 years of age indicating the variable
penetrance of the mutant allele. Another subject, the 12 year-old
son of subject III-4, has inherited the mutant allele but is
nondiabetic. However, he is not yet beyond the age at risk and may
develop diabetes in the future. There are two subjects with
diabetes in the J2-21 family who did not inherit the at-risk allele
(subjects III-3 and -6). Such etiological heterogeneity has been
noted previously (Bell et al., 1991).
[0494] The seven DNA polymorphisms/variants were located in the
promoter region and the introns (Table 11, FIG. 13). In subject
J2-96 (FIG. 15), there was a G.fwdarw.A substitution at nucleotide
922 in the proximal promoter region which changes the human
sequence so that it more closely resembles the sequence of the
mouse gene (FIG. 13). This substitution was not found on screening
53 nondiabetic subjects. Since this substitution does not alter a
conserved residue or disrupt the binding site for one of the
factors predicted to regulate transcription of the HNF-4.alpha.
gene, the inventors believe that it is a rare variant rather than a
diabetes-associated mutation. However, further studies are
necessary to distinguish between these two possibilities.
[0495] The six substitutions found in introns (Table 11) do not
disrupt the conserved GT and AG dinucleotides of the splice donor
and acceptor sites, respectively, and are thus unlikely to affect
splicing. The substitutions at nucleotides 1486, 2420, 3142 and
3175 were found in both diabetic and nondiabetic Japanese subjects
indicating that they are polymorphisms rather than
diabetes-associated mutations. The substitutions at nucleotides
1364 and 2218 were found only in two different unrelated subjects
with early-onset NIDDM/MODY. The inventors believe that these are
rare variants rather than diabetes-associated mutations as they are
not near the splice donor and acceptor sites but are rather in the
central portion of the intron.
Example 5
Hepatic Function in a Family with a Nonsense Mutation (R154X) in
HNF 4.alpha./MODY1 Gene
[0496] MODY is a genetically heterogeneous monogenic disorder
characterized by autosomal dominant inheritance, onset usually
before 25 years of age and abnormal pancreatic .beta.-cell
function. Mutations in the hepatocyte nuclear factor
(HNF)-4.alpha./MODY1, glucokinase/MODY2 and HNF-1.alpha./MODY3
genes can cause this form of diabetes. In contrast to the
glucokinase and HNF-1.alpha. genes, mutations in the HNF-4.alpha.
gene are a relatively uncommon cause of MODY and the inventors'
understanding of the MODY1 form of diabetes is based on studies of
only a single family, the R-W pedigree. Here the inventors report
the identification of another family with MODY1 and the first in
which there has been a detailed characterization of hepatic
function. The affected members of this family, Dresden-11 have
inherited a nonsense mutation, R154X in the HNF-4.alpha. gene and
are predicted to have reduced levels of this transcription factor
in the tissues in which it is expressed including pancreatic
islets, liver, kidney and intestine. Subjects with the R 154X
mutation exhibited a diminished insulin secretory response to oral
glucose. HNF4.alpha. plays a central role in tissue-specific
regulation of gene expression in the liver. including the control
of synthesis of proteins involved in cholesterol and lipoprotein
metabolism and the coagulation cascade. However, subjects with the
R154X mutation showed no abnormalities in lipid metabolism or
coagulation except for a paradoxical 3.3-fold increase in serum
lipoprotein(a) levels. Nor was there any evidence of renal
dysfunction in these subjects. The results suggest that MODY 1 is
primarily a disorder of .beta.-cell function.
[0497] 1. Methods
[0498] Subjects.
[0499] The study population consisted of members of twelve
unrelated families with early-onset NIDDM ascertained through the
Department of Internal Medicine III, University Clinic Carl Gustav
Carus of the Technical University, Dresden, Germany. Families were
selected based on the presence of non-insulin-dependent (type 2)
diabetes mellitus (NIDDM) in two or more generations with diagnosis
before 35 years of age in at least one subject. Sufficient family
data were available to suggest a diagnosis of MODY in nine of these
families (i.e., NIDDM in three generations with autosomal dominant
inheritance and onset before 25 years of age in at least one
affected subject) (Fajans et al., 1994). The remaining three
families were classified as having early-onset NIDDM. The average
age at diagnosis of diabetes in affected members of these twelve
families was 29.9.+-.2.8 years (range, 14-60 years) (mean.+-.SEM)
and included 18 men and 13 women of whom 12, 12 and 7 were being
treated with insulin, oral hypoglycemic agents and diet,
respectively. At the time of recruitment, informed consent was
obtained from each subject and blood and urine samples were
obtained for DNA isolation and clinical testing.
[0500] Screening HNF-4.alpha. Gene for Mutations.
[0501] The minimal promoter region (nucleotides -21 to -459) (Zhong
et al., 1994) and 10 exons encoding the HNF-4.alpha. form (Drewes
et al., 1996) of HNF4.alpha. were screened for mutations by
polymerase chain reaction (PCR.TM.) amplification and direct
sequencing of both strands of the amplified PCR.TM. product as
described previously (Yamagata et al., 1996). Sequence changes were
confirmed by cloning the PCR.TM. product into, pGEM-4Z (Promega,
Madison, Wis.) and sequencing clones derived from both alleles. The
sequences of the primers for the amplification and sequencing of
the minimal promoter region are P 1,5'-CAAGGATCCAGAAGATTGGC- -3'
(SEQ ID NO:120), and P2, 5'-CGTCCTCTGGGAAGATCTGC-3' (SEQ ID
NO:121); the size of the PCR.TM. product is 479 bp. The sequence of
the promoter of the human HNF4.alpha. gene has been deposited in
the GenBank database with accession number U72959.
[0502] Linkage Analysis.
[0503] Family members were typed with the markers D20S43, D20S89,
D20S96, D20S 119, D20S 169 and D20S424, all of which are tightly
linked to the HNF-4.alpha. gene (Stoffel et al., 1996). Tests for
linkage were carried out using the haplotype formed from these
markers and assuming a recombination frequency between adjacent
markers of 0.001 with the computer program ILINK (Lathrop et al.,
1984; Lathrop and Lalouel, 1984). The frequencies of the haplotypes
were estimated from the data. The analysis assumed a disease allele
frequency of 0.001 and two liability classes. Liability class 1
included individuals who were 25 years of age with penetrances of
0.00, 0.95 and 0.95 for the normal homozygote, heterozygote and
susceptible homozygote, respectively. Liability class 2 included
individuals who were <25 years of age with penetrances of 0.00,
0.60 and 0.95 for the normal homozygote, heterozygote and
susceptible homozygote, respectively. The affection status of the
one subject with impaired glucose tolerance was coded as affected.
The maximum expected lod score (ELOD) was determined using the
computer program SLINK (Ott, 1989; Weeks et al., 1990).
[0504] Clinical Studies.
[0505] A standard 75 g oral glucose tolerance test was given to
subjects after a 12 h overnight fast. Treatment with insulin and
oral hypoglycemic agents was discontinued 12 h and 24 h,
respectively, before testing. Blood samples for glucose, insulin,
C-peptide and proinsulin were drawn at 0, 30, 60, 90 and 120 min.
Fasting blood samples were also drawn for the measurement of
insulin, islet cell and glutamic acid decarboxyjase (GAD)
antibodies, glycosylated hemoglobin (HbA.sub.1c), lipoprotein(a),
apolipoproteins AI, AII, B, CII, CIII and E, cholesterol (total and
in VLDL, LDL, HDL, HDL2 and HDL3), triglycerides (total and in VLDL
and LDL+HDL), coagulation time (QUICK test) and partial
thromboplastin time (PTT), fibrinogen, von Willebrand factor
antigen (vWFr:Ag), plasminogen activator inhibitor-1 (PAI-1),
tissue-type plasminogen activator (tPA), alanine aminotransferase,
.gamma.-glutamyl transferase, bilirubin, albumin, total protein,
hemoglobin, creatinine, urea, amylase, lipase and uric acid. A
urine sample (from a 24-hour collection of urine) was taken for
measurements of creatinine and microalbumin.
[0506] Assays.
[0507] Blood glucose was measured with a hexokinase method
(Boehringer-Mannheim, Mannheim, Germany), plasma insulin and
C-peptide by radioimmunoassay (DPC Biermann GmbH, Bad Nauheim,
Germany; and C peptide RIA Diagnostic Systems Laboratories,
Sinsheim, Germany, respectively), plasma proinsulin by ELISA (DRG
Instruments, Marburg, Germany), HbA.sub.1c, by HPLC (DIAMAT
Analyzer, Bio-Rad, Munich, Germany), fibrinogen by the Clauss
method (Fibrinogen A Kit, Boehringer-Mannheim), PAI-1 by
bioimmunoassay and ELISA (TC.RTM. Actibind PAI-1 and TC.RTM. PAI-1
ELISA, Technoclone/Immuno GmbH Deutschland, Heidelberg, Germany),
tPA by ELISA (TintElize.RTM. tPA, Biopool AB, Umea, Sweden),
vWFr:Ag enzymatically (ELISA Asserachrom.RTM. vWF,
Boehringer-Mannheim), insulin- and GAD-Ab by ELISA and
radioimmunoassay (Elias, Freiburg, Germany), islet cell-Ab by an
immunofluorescence assay (using a positive sample from EUROIMMUN
Immunologie GmbH, Gro.beta. Gronau, Germany), coagulation and
partial thromboplastin time by the AMAX Analyzer (Munich, Germany).
Total cholesterol, cholesterol in VLDL, HDL, LDL+HDL, and HDL3 were
measured by the CHOD-PAP, total triglycerides and triglycerides in
VLDL and LDL+HDL by the GPO-PAP method using the Ciba Corning 550
Express Clinical Chemistry Analyzer (Boehringer-Mannheim).
HDL2-cholesterol was calculated using the formula HDL2=HDL-HDL3.
Samples for the measurement of cholesterol, triglycerides in VLDL,
HDL, LDL+HDL were prepared by preparative ultracentrifugation using
a Beckman Optima tabletop TLX ultracentrifuge with a TLA-120.2
rotor. Serum creatinine, urea, uric acid, total protein, alanine
aminotransferase, .gamma.-glutamyl transferase, bilirubin, amylase
and urine creatinine were measured using the BM Hitachi 717
Chemistry Analyzer (Boehringer Mannheim). Lipase was measured using
the Monarch System (Sigma Germany, Munich, Germany).
Apolipoproteins AI, AII and B and urine microalbumin were measured
using the Behring-Nephelometer BN II (Behringwerke, Marburg,
Germany). Apolipoproteins CIII and E were measured using the Sebia
System (Fulda, Germany), apolipoprotein CII using the RID System
(WAK, Bad Homburg, Germany).
[0508] 2. Results
[0509] Identification of a Nonsense Mutation in the HNF-4.alpha.
Gene.
[0510] Twelve families with early-onset NIDDM/MODY were ascertained
for genetic studies of MODY in subjects of German ancestry.
Mutations in the HNF-1.alpha./MODY3 gene (Yamagata et al., 1996)
were found in three of these families (Kaisaki et al., 1997). The
HNF-4.alpha. gene was screened for mutations in one affected
subject from the remaining nine families. There was a C.fwdarw.T
substitution in codon 154 of exon 4 in the proband (II-4) of family
Dresden-11 (FIG. 16) which generated a nonsense mutation CGA
(Arg).fwdarw.TGA (OP) (R154X, FIG. 17). The R154X mutation would
result in the synthesis of a truncated protein of 153 amino acids
with an intact DNA binding domain but lacking the ligand binding
and transactivation domain (Sladek et al., 1990). In addition to
this mutation, there was a silent C.fwdarw.T substitution in the
codon for Ala58 (GCC/GCT) in one subject which did not cosegregate
with MODY/early-onset NIDDM.
[0511] The presence of the R154X mutation in other members of the
Dresden-11 family was determined by PCR.TM. amplification and
direct sequencing of exon 4. The R154X mutation cosegregated with
MODY in the Dresden-11 family (FIG. 16). All diabetic subjects had
the R154X mutation as did a 14-year old male (III-2) with impaired
glucose tolerance. The at-risk haplotype showed some evidence for
linkage with MODY with a lod score of 1.20 at a recombination of
0.00 (the maximum expected lod score in this pedigree is 1.20).
[0512] Age at Diagnosis.
[0513] Three subjects were diagnosed with NIDDM between 15-25 years
of age and two others at 28 and 44 years (FIG. 16). The subject,
I-1, diagnosed with diabetes at 44 years of age had proliferative
retinopathy at the time of diagnosis suggesting that the onset of
diabetes had been many years earlier.
[0514] Clinical Severity of Diabetes.
[0515] The diabetes in the Dresden-11 family was severe and all the
diabetic subjects were treated with either insulin or oral
hypoglycemic agents. Subjects with diabetes of long duration (e.g.,
I-1, 1I-4) had diabetic complications including proliferative
retinopathy, macrovascular disease (coronary heart disease) and
peripheral polyneuropathy. Surprisingly, none of the subjects with
the R154X mutation had evidence of nephropathy. Thus, the diabetic
phenotype of the Dresden-11 family is very similar to that seen in
the R-W pedigree (Fajans et al., 1994). None of the subjects in the
Dresden-11 family were positive for islet, insulin or GAD
antibodies.
[0516] Insulin-Secretory Response.
[0517] Previous studies have shown that prediabetic subjects with a
mutation in HNF-4.alpha. exhibit a characteristic defect in the
normal pattern of glucose-stimulated insulin secretion as well as
abnormalities in other measures of normal .beta.-cell function
(Herman et al., 1994; Byrne et al., 1995). The OGTT studies showed
a profound reduction in insulin secretion accompanied by diminished
C-peptide and proinsulin levels in subjects with the R154X mutation
(FIG. 18).
[0518] Lipid Levels.
[0519] None of the subjects with the R154X mutation showed evidence
of secondary hypertriglyceridemia, even though several (I-1, II-4,
III-1) had poor metabolic control with HbA.sub.1c levels of 10.6,
8.8 and 10.1, respectively (Table 12).
12TABLE 12 Clinical Parameters of the Dresden-11 family Genotype
Normal/Normal Reference Parameter Normal/Mutant (female/male)
values Age at diagnosis (years) 26.40 .+-. 3.47 -- -- Current age
(years) 35.50 .+-. 7.58 62/41 -- n (females/males) 2/4 1/1 -- BMI
(kg/m.sup.2) 25.21 .+-. 1.15 41.08/22.86 <25.00 HbA.sub.1c (%)
8.13 .+-. 0.78 5.60/5.30 <6.50 Basal insulin (nM) 0.067 .+-.
0.005 0.080/0.040 0.059-0.253 Basal C-peptide (nM) 0.60 .+-. 0.08
0.68/0.45 <1.06 Cholesterol (mM), total 4.72 .+-. 0.41 5.03/5.01
<5.20 in VLDL (mM) 0.79 .+-. 0.31 0.21/0.70 0.10-1.40 in LDL
(mM) 2.86 .+-. 0.25 3.62/3.34 1.80-5.10 in HDL (mM) 1.17 .+-. 0.18
1.32/1.26 0.80-2.50 in HDL2 (mM) 0.31 .+-. 0.06 0.44/0.27 0.10-0.60
in HDL3 (mM) 0.86 .+-. 0.12 0.88/0.99 0.80-1.90 Triglycerides (mM),
total 0.70 .+-. 0.13 0.65/1.45 0.40-2.80 in VLDL (mM) 0.43 .+-.
0.13 0.34/1.06 0.10-2.10 in LDL + HDL (mM) 0.28 .+-. 0.02 0.33/0.47
0.20-0.80 Lipoprotein (a) (mg/l) 816.0 .+-. 90.4 3.0/6.0 <250.0
ApoB (g/l) 1.38 .+-. 0.22 1.33/1.38 0.72-1.50 ApoAI (g/l) 1.66 .+-.
0.16 1.89/2.00 1.12-1.75 ApoAII (g/l) 0.32 .+-. 0.02 0.290.53
0.30-0.70 ApoE (mg/l) 61.2 .+-. 12.2 65.0/55.0 13.0-76.0 ApoCII
(mg/l) 36.0 .+-. 5.3 36.0/61.0 7.0-63.0 ApoCIII (mg/l) 26.7 .+-.
3.7 23.0/36.0 16.0-45.0 General liver and kidney function
Hemoglobin (mM) 9.7 .+-. 0.4 9.2/10.8 8.6-12.1 Creatinine (.mu.M)
91.5 .+-. 5.6 73.0/80.0 <124.0 Urea (mM) 5.6 .+-. 0.8 6.6/1.0
3.6-8.9 Total protein (g/l) 72.7 .+-. 1.7 77.2/84.0 65.0-85.0
Albumin (g/l) 38.6 .+-. 1.0 38.5/43.5 37.0-53.0 Alanine
aminotranferase 0.39 .+-. 0.06 0.39/0.91 0.10-0.67 (.mu.mol/l
.multidot. s)) .gamma.-glutamyl transferase 0.54 .+-. 0.12
0.55/1.11 0.18-0.83 (.mu.mol/l .multidot. s)) Bilirubin (.mu.M),
total 16.7 .+-. 5.2 13.7/24.3 1.0-16.0 Uric acid (.mu.M) 249 .+-.
28 317/359 208-416 Exocrine pancreatic function Amylase (U/l) 56.8
.+-. 6.7 30.0/58.0 17.0-115.0 Lipase (.mu.mole/(l .multidot. s))
1.22 .+-. 0.40 0.20/3.00 0.38-3.40 Coagulation parameters
Coagulation time (%) 117 .+-. 6 108/125 70-120 Partial
thromboplastin 33 .+-. 1 29/35 30-40 time (s) Fibrinogen (g/l) 3.54
.+-. 0.23 2.89/3.69 1.50-4.00 Von Willebrand Factor 103 .+-. 11
145/115 70-200 Antigen (%) PAI-1 (ng/ml), total 36 .+-. 8 102/40
30-80 tPA (ng/ml) 10.6 .+-. 1.5 17.2/16.0 2.0-10.0 Urine analysis
Creatinine (mM) 8.36 .+-. 0.88 7.96/2.86 4.66-18.00 Microalbumin
(mg/24 h) <2.2 13.5/<2.2 2.2-18.0
[0520] Values are means.+-.SEM (standard error of means). The two
normal subjects are shown with the single values. Reference values
are those from the Institute of Clinical Laboratory Diagnostics,
University Clinic Carl Gustav Carus, Dresden.
[0521] Hepatic and Renal Function.
[0522] HNF-4.alpha. is expressed in the liver and kidney and as
such mutations in HNF-4.alpha. might be expected to affect the
normal function of these tissues (Sladek et al., 1990; Cereghini,
1996). In this regard, HNF-4.alpha. regulates the expression of a
number of apolipoproteins including AI, AIV, B and CIII (Cereghini,
1996). The serum apolipoprotein levels and lipoprotein fractions
were normal in the subjects with the R154X mutation except for
lipoprotein(a) levels, which were elevated 3.3-fold (Table 12).
Lipoprotein(a) levels have been reported to be elevated in subjects
with NIDDM in some studies (Nakagawa et al., 1996; Hirata et al.,
1995) but not others (Durlach et al., 1996; Chico et al., 1996).
However, an elevation in lipoprotein(a) levels in subjects with
HNF-4.alpha. deficiency appears paradoxical as expression of
lipoprotein(a) is controlled by HNF-1.alpha. (Wade et al., 1994)
which is in turn regulated by HNF-4.alpha. (Cereghini, 1996). Thus,
lower lipoprotein(a) levels not higher would be expected in
subjects with the R154X mutation. Further studies will be necessary
to determine the relationship between lipoprotein(a) levels and
mutations in HNF-4.alpha..
[0523] HNF-4.alpha. also regulates the expression of albumin,
fibrinogen and the coagulation factors VII, VIII, IX and X
(Cereghini, 1996; Erdmann and Heim, 1995; Figueiredo and Brownlee,
1995; Naka and Brownlee, 1996; Hung and High, 1996). The serum
levels of albumin and fibrinogen and measurements of coagulation
time were normal in subjects with the R154X mutation (Table 12).
HNF-4.alpha. is also expressed in the kidney although the identity
of the target genes in this organ are unknown (Sladek et al., 1990;
Cereghini, 1996). The urinary creatinine and microalbumin levels
were normal in subjects with the R154X mutation (Table 12)
suggesting that renal function was not impaired in subjects with
mutations in the HNF-4.alpha. gene.
Example 6
[0524] Diminished Insulin and Glucagon Secretory Responses to
Arginine in Nondiabetic Subject with a Mutation in
HNF4.alpha./MODY1 Gene
[0525] Nondiabetic subjects with the Q268X mutation in the
hepatocyte nuclear factor (HNF)-4.alpha./MODY1 gene have impaired
glucose-induced insulin secretion. To ascertain the effects of the
nonglucose secretagogue arginine on insulin and glucagon secretion
in these subjects, we studied 18 members of the RW pedigree: 7
nondiabetic mutation negative (ND[-]), 7 nondiabetic mutation
positive (ND[+]), and 4 diabetic mutation positive (D[+]). We gave
arginine as a 5 g bolus followed by a 25 minute infusion at basal
glucose concentrations and after glucose infusion to clamp plasma
glucose at .about.200 mg/dl. The acute insulin response (AIR), the
10-60 minute insulin area under the curve (AUC), and the insulin
secretion rate (ISR) were compared as were acute glucagon response
(AGR) and glucagon AUC. The ND[+] and D[+] groups had decreased
insulin AUC and ISR and decreased glucose potentiation of AIR,
insulin AUC. and ISR to arginine administration when compared to
the ND[-] group. At basal glucose concentrations, glucagon AUC was
greatest for ND[-], intermediate for ND[+], and lowest for D[+]
group. During the hyperglycemic clamp there was decreased
suppression of glucagon AUC for both ND[+] and D[+] groups compared
to the ND[-] group. The decreased ISR to arginine in the ND[+]
group compared to the ND[-] group, magnified by glucose
potentiation, indicates that HNF-4.alpha. affects the signaling
pathway for arginine-induced insulin secretion. The decrease in
glucagon AUC and decreased suppression of glucagon AUC with
hyperglycemia suggest that mutations in HNF-4.alpha. may lead to
.alpha.-cell as well as .beta.-cell secretory defects or to a
reduction in pancreatic islet mass.
[0526] 1. Methods
[0527] Subjects
[0528] Eighteen members of the RW pedigree from branches II-2 and
II-5, generations III, IV, and V, were studied (Fajans, 1990;
Fajans et al., 1994). The study was reviewed and approved by the
Institutional Review Board of the University of Michigan Medical
Center, and all subjects and/or parents provided written informed
consent. The glycemic status of each subject was determined by oral
glucose tolerance test (OGTT) as defined by the National Diabetes
Data Group (NDDG) (1979). Each subject was originally typed with a
series of DNA markers on chromosome 20q to determine whether he or
she has inherited the extended at-risk haplotype (defined by
alleles at the loci ADA, D20S17, D20S79, and D20S4) associated with
MODY1 (Bell et al., 1991; Bowden et al., 1992; Cox et al., 1992;
Rothschild et al., 1993). When the Q268X mutation in the
HNF-4.alpha. gene was shown to be the cause of MODY1 in the RW
pedigree (Yamagata et al., 1996a), subjects were tested directly
for this mutation. All the subjects included in this study, except
nondiabetic individual GM11626, have been tested for the presence
of the Q268X mutation. However, his nondiabetic father, IV-16, was
tested and he does not have the Q268X mutation. Based on the OGTT
results and the presence or absence of the Q268X mutation or
at-risk haplotype, the family members were subdivided into three
groups:
[0529] Nondiabetic Q268X Mutation-Negative Group (ND[-])
[0530] Seven nondiabetic mutation-negative subjects were studied.
GM identification numbers (Human Genetic Mutant Cell Repository) as
given by Bell et al. (1991), RW pedigree generation and person
numbers as given by Fajans et al. (1994), and age at the time of
study were: GM10085, IV-22, 45 fears; GM11429, IV-41, 32 years;
GM11626, offspring of IV-16, 17 years; GM10153, offspring of IV-17,
18 years; GM11579, offspring of IV-19, 16 years; GM11331, offspring
of IV-21, 21 years; and GM11333, offspring of IV-21, 22 years. Four
of these subjects were offspring of diabetic parents (GM10085,
GM11429, GM10153, and GM11579).
[0531] Nondiabetic 0268X Mutation-Positive Group (ND[+])
[0532] This group included seven subjects. Two subjects never had
diabetes or impaired glucose tolerance on OGTT: GM11090, offspring
of IV-143, 16 years; and GM10668, offspring of IV-141, 16 years.
Five subjects has previous abnormalities of glucose tolerance but
none had ever had an abnormal fasting plasma glucose or
glycosylated hemoglobin concentration. Two had single diabetic
OGTTs 4 and 22 years, respectively, before the study but had
numerous normal glucose tolerance tests subsequently: GM10018,
IV-168, 25 years; and GM8072, IV-143, 39 years. Three subjects had
fulfilled NDDG diagnostic criteria for diabetes by OGTT in the
past. Prior to the study they had normal OGTTs on 2, 4 and 5
occasions, over 2, 4 and 4 years, respectively. They were: GM11600,
offspring of IV-143, 14 years; GM8759, IV-166, 31 years; and
GM8073, offspring of 143, 19 years.
[0533] Diabetic Q268X Mutation-Positive Group (D[+])
[0534] The four subjects in this group ad consistently diabetic
OGTTs for 6 or more years or ad mild fasting hyperglycemia (<200
mg/dl) when untreated. They were GM8106, III-35, 59 years; GM7974,
IV-141, 43 years; GM8107, IV-165, 26 years; and GM10724, offspring
of IV-142, 17 years. Subject GM8106 was treated with tolbutamide
between 1958 and 1968 and with chlorpropamide since May, 1995. When
untreated, his highest fasting plasma glucose was 160 mg/dl and his
highest total glycosylated hemoglobin 9.1% (normal <6.3%). On
100 mg of chlorpropamide per day, his fasting plasma glucose was 91
mg/dl and glycosylated hemoglobin was 5.3%. Chlorpropamide was
discontinued for 26 days before the study and fasting plasma
glucose was 99 mg/dl and total glycosylated hemoglobin
concentration was 5.8% on the day of the study. Subject GM7974 was
treated with diet alone. She had diabetic OGTTs intermittently
since 1969; OGTTs were consistently diabetic since 1990. Her
fasting plasma glucose was 84 mg/dl and her total glycosylated
hemoglobin was 6.9% at the time of the study. Subject GM8107's
highest fasting plasma glucose was 192 mg/dl and highest total
glycosylated hemoglobin was 9.5% when untreated. When treated with
glyburide 1,25 mg daily, she had normal fasting and postprandial
plasma glucose concentrations and a total glycosylated hemoglobin
of 6.7%. Glyburide was discontinue 11 days before the study. Her
fasting plasma glucose concentration was 106 mg/dl and her total
glycosylated hemoglobin was 6.9% on the day of the study. Subject
GM10725 had been treated with glyburide 2.5 mg twice daily since
1989. Her highest total glycosylated hemoglobin concentration was
9.0%. She discontinued medication 5 days before the study and her
fasting plasma glucose was 158 mg/dl and her total glycosylated
hemoglobin was 7.7% at the time of the study.
[0535] Protocol
[0536] Subjects were studied in the University of Michigan General
Clinical Research Center (CRC). Subjects were admitted to the CRC
in the evening and studied in the recumbent position after a 10-12
hour overnight fast. An intravenous sampling catheter was inserted
in a retrograde direction in a dorsal vein of the hand and the hand
was kept in a wooden box thermostatically heated to 60.degree. C.
to achieve arterialization of venous blood. A second catheter for
insulin, arginine and glucose administration was inserted into the
contralateral antecubital vein. In subjects with fasting
hyperglycemia, a small intravenous bolus of human regular insulin
(0.007 U/kg or approximately 0.5 U) was given at -50 minutes to
lower the plasma glucose to approximately 75 mg/dl.
[0537] Blood samples for measurement of basal glucose, insulin,
C-peptide, and glucagon concentrations were obtained at -30, -20,
-10, and 0 minutes. At 0 minutes, arginine was administered. The
total arginine dose was calculated as 0.41 gm/kg body weight to a
maximum of 30 grams. At time 0, 5 grams of arginine was
administered as an IV bolus over 30 seconds and at time 5 minutes,
the remaining arginine was infused with a pump at a constant rate
over 25 minutes. Samples were drawn at 2, 3, 5, 7, 10, 20, and
30-minutes for measurement of glucose, insulin, C-peptide, and
glucagon. Following the first arginine bolus and infusion, there
was a 60 minute washout period. Blood samples for measurement of
the same constituents were obtained at 40, 50, 60, 70, 80, and 90
minutes. At 90 minutes, glucose (150 mg/kg) was administered over
30 seconds and a variable rate infusion of 20% dextrose with 10 mEq
KCl/1 was begun to clamp the plasma glucose level at 200 mg/dl for
the remainder of the study, as determined by frequent bedside blood
glucose measurements. Blood samples for the above constituents were
obtained at 92, 93, 95, 97, 100, 110, 120, 130, 140, and 150
minutes. At 150 minutes, arginine (0.41 gm/kg, maximum 30 grams)
was again administered as a 5 gram bolus followed after 5 minutes
by an infusion over 25 minutes, as previously, and samples were
drawn at 152, 153, 155, 157, 160, 170, 180, 190, 200, 210. 220,
230, and 240 minutes for measurement of glucose, insulin,
C-peptide, and glucagon.
[0538] Assay Procedures
[0539] All blood samples were collected on ice and stored at
-70.degree. C. until assayed. Plasma glucose was measured on a
Kodak Ektachem 700 Analyzer using a hexokinase method (intra-assay
coefficient of variation [CV] 1.7% at 5.0 mmol and 1.2% at 16.1
mmol). Immunoreactive insulin was measured by double-antibody
radioimmunoassay (RIA) (intra-assay CV 6.4%) (Hayashi et al.,
1977). C-peptide was measured by a specific RIA (intra-assay CV
3.9%) (Faber et al., 1978). Glucagon was measured by
double-antibody radioimmunoassay (intra-assay CV 3.2%) (Hayashi et
al., 1977). All samples were measured in duplicate and their means
were used. Samples from individual subjects were measured in a
single assay. All assays were performed in the Michigan Diabetes
Research and Training Center Chemistry Core laboratory.
[0540] Data Analysis
[0541] Acute insulin responses (AIR), acute C-peptide responses
(ACR), and acute glucagon responses (AGR) were calculated as the
mean of the 2, 3, 4, and 5 minute hormone levels minus the mean of
the -10, -5, and 0 minute hormone levels. Glucose, insulin,
C-peptide, and glucagon areas under the curve were calculated with
the trapezoidal rule for the time interval 10 to 60 minute when the
arginine bolus was administered at time 0 and the arginine infusion
began at time 5 minutes. Baseline values, calculated as the mean
hormone levels measured at -10, -5, and 0 minutes immediately
preceding the arginine bolus, were subtracted from the areas under
the curve. Insulin secretion rates were calculated by deconvolution
of C-peptide values (Polonsky et al, 1986). All of these indices of
insulin secretion were assessed during arginine administration at
baseline glucose levels, during glucose administration, and during
arginine administration during the hyperglycemic clamp. Slope of
potentiation was calculated as the difference between the AIR or
ACR to arginine obtained during the hyperglycemic clamp and at
baseline glucose levels divided by the difference between these two
glucose levels (Halter et al., 1979). Results are expressed as
means.+-.standard error of the mean. Statistical significance of
differences among groups was assessed with chi-square and unpaired
t-tests. The primary comparisons of interest were between the ND[-]
and ND[+] group. P <0.05 was defined as the limit of statistical
significance.
[0542] 2. Results
[0543] Eighteen members of the RW Pedigree were studied: Seven
non-diabetic mutation negative (ND[-]), seven non-diabetic mutation
positive (ND[+]), and four diabetic mutation positive (D[+]) (Table
13). There were no significant differences among groups with regard
to gender or age, although D[+] subjects tended to be older. All
subjects were non-obese. Fasting glucose and insulin levels did not
differ significantly among groups although D[+] subjects tended to
have higher glucose levels and lower insulin levels. Fasting
C-peptide levels were lower in D[+] subjects compared to ND[-]
subjects. Fasting glucagon levels did not differ among groups.
Glycosylated hemoglobin concentration did not differ between the
two nondiabetic groups, but was higher in the D[+] group.
13TABLE 13 Characteristics of Subjects from RW Pedigree by Glucose
Tolerance and Mutation Status Glucose Tolerance Nondiabetic
Nondiabetic Diabetic Genotype* [-] [+] [+] Number and gender 5/2
3/4 1/3 (M/F) Age (years) 24 .+-. 4 23 .+-. 4 36 .+-. 9 Body Mass
Index 25.2 .+-. 1.5 23.1 .+-. 1.0 22.5 .+-. 0.4 (kg/m.sup.2)
Fasting glucose (mg/dl) 91 .+-. 2 87 .+-. 2 112 .+-. 16 Fasting
insulin (.mu.U/ml) 10 .+-. 1 11 .+-. 2 7 .+-. 1 Fasting C-peptide
1.8 .+-. 0.1** 1.6 .+-. 0.2 1.3 .+-. 0.2 (ng/ml) Fasting glucagon
(pg/ml) 73 .+-. 6 64 .+-. 9 77 .+-. 12 Glycosylated hemoglobin 5.5
.+-. 0.1** 5.7 .+-. 0.2** 7.8 .+-. 0.4 [-] = Normal/Normal [+] =
Normal/Q268X Mutation **p < 0.05 vs. diabetic [+] All values are
mean .+-. SEM
[0544] FIG. 19 demonstrates the protocol and illustrates
concentrations of glucose (FIG. 19A), insulin (FIG. 19B), C-peptide
(FIG. 19C), and glucagon (FIG. 19D) during the three phases of the
study. These were: A) administration of arginine (bolus and
infusion) at basal glucose concentrations, B) administration of
glucose (bolus and variable rate infusion) to clamp the glucose
level at 200 mg/dl, and C) administration of arginine (bolus and
infusion) during the hyperglycemic clamp.
[0545] Table 14 summarizes average glucose levels; acute insulin
responses (AIR) and C-peptide responses (ACR) to arginine; and
hormone areas under the curve (AUC) and insulin secretion rate
(ISR) measured 10 to 60 minutes following commencement of the three
study phases. These are A) administration of arginine at basal
glucose concentrations, B) administration of glucose, and C)
administration of arginine during the hyperglycemic clamp.
14TABLE 14 Plasma Concentrations of Glucose, Acute Insulin and
C-peptide Responses (AIR and ACR), Areas Under the Curve (AUC 10-60
minutes) for Insulin and C-peptide and Insulin Secretion Rate (ISR)
during administration of A) Arginine at basal glucose
concentrations (Bolus and Infusion), B) Glucose (Bolus and
Infusion) and C) Arginine (Bolus and Infusion) during hyperglycemic
clamp. Period Group Nondiabetic (-) Nondiabetic (+) Diabetic (+)
Number n = 7 n = 7 n = 4 A. Arginine administration at basal
glucose concentration Glucose (mg/dl)* 107 .+-. 3 102 .+-. 2 115
.+-. 15 AIR (.mu.U/ml) 48 .+-. 10 70 .+-. 19 27 .+-. 7 ACR (ng/ml)
3.05 .+-. 0.61 3.25 .+-. 0.44 2.19 .+-. 0.55 AUC.sub.1 (ng/ml) 78.5
.+-. 7.7 25.6 .+-. 5.5.sup..dagger. 3.5 .+-.
0.8.sup..dagger-dbl..sctn. AUC.sub.c (ng/ml) 205 .+-. 12 71 .+-.
9.sup..dagger. 38 .+-. 6.sup..dagger-dbl..sctn. ISR (.mu.g) 76 .+-.
6 31 .+-. 3.sup.II 16 .+-. 3.sup..paragraph..sctn. B. Glucose
administration Glucose (mg/dl)* 207 .+-. 2 207 .+-. 5 203 .+-. 7
AIR (.mu.U/ml) 72 .+-. 10 63 .+-. 15 16 .+-. 6.sup..paragraph. ACR
(ng/ml) 4.03 .+-. 0.61 2.83 .+-. 0.54 1.25 .+-. 0.58.sup.#
AUC.sub.1 (ng/ml) 43.9 .+-. 6.3 47.1 .+-. 11.4 16.1 .+-.
4.1.sup..paragraph. AUC.sub.c (ng/ml) 131 .+-. 12 103 .+-. 16 61
.+-. 2.sup.# ISR (.mu.g) 63 .+-. 4 51 .+-. 6 33 .+-.
2.sup..paragraph. C. Arginine administration during hyperglycemic
clamp Glucose (mg/dl)* 198 .+-. 2 209 .+-. 7 201 .+-. 6 AIR
(.mu.U/ml) 271 .+-. 33 162 .+-. 36** 50 .+-.
10.sup..dagger-dbl..sctn. ACR (ng/ml) 10.33 .+-. 1.31 5.87 .+-.
0.72.sup.II 3.21 .+-. 0.91.sup..paragraph..sctn. AUC.sub.1 (ng/ml)
628 .+-. 69 149 .+-. 40.sup..dagger. 25 .+-.
7.sup..dagger-dbl..sctn. AUC.sub.c (ng/ml) 739 .+-. 52 209 .+-.
40.sup..dagger. 109 .+-. 42.sup..dagger-dbl. ISR (.mu.g) 276 .+-.
18 101 .+-. 19.sup.554 54 .+-. 16.sup..dagger-dbl. *mean for period
10-60 minutes All values are mean .+-. SEM **p .ltoreq. 0.05
.sup.IIp .ltoreq. 0.01 .sup..dagger.p .ltoreq. 0.001, ND[+] vs
ND[-] .sup.#p < 0.05 .sup..paragraph.p < 0.01
.sup..dagger-dbl.p < 0.001, D[+] vs ND[-] .sup..sctn.p < 0.05
D[+] vs ND[+]
[0546] Effects of Arginine and Glucose on Insulin Secretion
[0547] Administration of Arginine at Basal Glucose
Concentrations
[0548] At baseline, glucose levels did not differ among the groups
(Table 13) After the 5 g arginine bolus, AIR and ACR did not differ
among groups but tended to be lower for the D[+] group (Table 14).
During and after the subsequent arginine infusion, glucose levels
were slightly higher at 10, 20, and 30 minute intervals in the
ND[-] as compared to the ND[+] group (FIG. 19) but the average
glucose levels during the 10-60 minute time interval (Table 14) and
the glucose area under the curve (1171.+-.99 vs. 1012.+-.141 mg/dl,
respectively, p=0.37) did not differ. Insulin and C-peptide levels
rose to a peak at 30 minutes in the ND[-] group but were markedly
decreased in both the ND[+] and D[+] groups (FIG. 19). The insulin
area under the curve (AUC.sub.l) and C-peptide area under the curve
(AUC.sub.c) were significantly reduced in ND[+] group compare to
ND[-] group (Table 14). They were further reduced in D[+] group
compared to the ND[+] group (Table 14). ISR was significantly
reduced in ND[+] compared to ND[-] subjects and further reduced in
D[+] compared to ND[+] subjects (Table 14).
[0549] Administration of Glucose
[0550] Glucose levels did not differ among the groups during the
bolus and the variable rate glucose infusion (Table 14). AIR and
ACR to glucose did not differ between the ND[+] and ND[-] groups
but were significantly reduced in the D[+] group compared to the
ND[-] group (FIG. 19, Table 14). AUC.sub.l, AUC.sub.c, and ISR
during the glucose infusion did not differ between the ND[-] and
ND[+] groups (Table 14). They were reduced in the D[+] group
compared to the ND[-] group (Table 14).
[0551] Administration of Arginine During the Hyperglycemic
Clamp
[0552] Glucose levels did not differ among the groups during the
variable rate glucose infusion and second arginine bolus and
infusion (Table 14). At hyperglycemic plasma glucose levels, as
compared to euglycemic levels, AIR and ACR to arginine, and
AUC.sub.l, AUC.sub.c and ISR were enhanced and differences among
groups were greatly magnified (FIG. 19, Table 14). All indices of
insulin secretion were significantly reduced in the ND[+] group
compare to the ND[-] group and there was a further reduction in the
D[+] group (Table 14).
[0553] FIG. 20A and FIG. 20B demonstrates the slopes of
potentiation for insulin and C-peptide, respectively. Glucose
potentiation of arginine-stimulated insulin secretion was reduced
in both the ND[+] (0.80.+-.0.18) and D[+] (0.24.+-.0.04) groups
compared to the ND[-] group (2.12.+-.0.25, p <0.001). The
insulin slope of potentiation was also reduced in D[+] group
compared to ND[+] group (p<0.05). Glucose potentiation of
arginine-stimulated C-peptide secretion was also reduced in the
ND[+] (0.02.+-.0.00) and D[+] (0.01.+-.0.00) groups compared to the
ND[-] group (0.07.+-.0.01, p<0.01).
[0554] Effects Of Arginine on Plasma Glucagon Concentrations
[0555] At baseline, glucagon levels did not differ among groups
(Table 13). Acute glucagon responses to the 5 g bolus of arginine
administered at basal glucose concentrations did not differ
significantly among ND[-], ND[+], and D[+] groups (104.+-.19,
92.+-.16, and 82 .+-.23 pg/ml, respectively). On the other hand,
the glucagon area under the curve (10-60 minutes) during and
following the arginine infusion at basal glucose concentrations was
reduced in D[+] compared to ND[-] subjects (4,778.+-.1,087 vs.
7,549.+-.639 pg/ml, p<0.05). ND[+] subjects showed intermediated
volumes (5,772.+-.734 pg/ml; p=0.09 vs. ND[-] group). During the
hyperglycemic clamp there were no significant differences among
glucagon areas under the curve for any of the groups (4,237.+-.406,
3.963.+-.508, and 2,941.+-.568 pg/ml, for ND[-], ND[+] and D[+],
respectively). To assess the impact of glucose infusion on the
glucagon response to arginine in the three study groups, the
inventors assessed the differences in glucagon area under the curve
between the euglycemic and hyperglycemic periods. Decreases in
glucagon areas induced by the hyperglycemic clamp between the first
and the second arginine infusion were 3312.+-.404, 1809.+-.387, and
1836.+-.535 pg/ml for the ND[-], ND[+] and D[+] groups,
respectively (p<0.02 ND[-] vs. ND[+].
Example 7
[0556] MODY Due to Mutations in the HNF-4.alpha. Binding Site in
the HNF-1.alpha. Gene Promoter
[0557] Recent studies have shown that mutations in the
transcription factor hepatocyte nuclear factor (HNF)-1.alpha. are
the cause of one form of maturity-onset diabetes of the young,
MODY3. These studies have identified mutations in the mRNA and
protein coding regions of this gene that result in the synthesis of
an abnormal mRNA or protein. Here, the inventors report an Italian
family in which an A.fwdarw.C substitution at nucleotide-58 of the
promoter region of the HNF-1.alpha. gene cosegregates with MODY.
This mutation is located in a highly conserved region of the
promoter and disrupts the binding site for the transcription factor
HNF-4.alpha., mutations in the gene encoding HNF-4.alpha. being
another cause of MODY (MODY1). This result demonstrates that
decreased levels of HNF-1.alpha. per se can cause MODY. Moreover,
it indicates that both the promoter and coding regions of the
HNF-1.alpha. gene should be screened for mutations in subjects
thought to have MODY because of mutations in this gene.
[0558] 1. Method
[0559] Subjects
[0560] The MODY family Italy-1 was ascertained through the diabetes
clinic of Santo Spirito's Hospital. Affection status was determined
using criteria of the National Diabetes Data Group. The affection
status of unaffected family members was defined as normal or
impaired based on the results of a standard 75 g OGTT. This study
had institutional approval and all subjects gave informed
consent.
[0561] Linkage Analysis
[0562] Family members were genotyped with the markers D12S321,
D12S76 and UC-39 all of which are tightly linked to the
HNF-1.alpha. gene (MODY3) (Yamagata et al., 1996). The forward and
reverse primers for the polymorphic sequence tagged site (STS)
UC-39 are 5'-GCAACAGAGCAAGACTCCATC- TCA-3' (SEQ ID NO: 122) and
5'-GAGTTTAATGGAAGAACTAACC-3' (SEQ ID NO:123) respectively, and the
PCR included initial denaturation at 94.degree. C. for 5 min and 35
cycles of denaturation at 94.degree. C. for 1 min, annealing at
63.degree. C. for 1 min and extension at 72.degree. C. for 1 min
with a final extension at 72.degree. C. for 10 min. The forward
primer was labeled with .sup.32P and the MgCl.sub.2 concentration
in the reaction was 1.0 mM. The PCR was carried out in a GeneAmp
9600 PCR System (Perkin Elmer, Norwalk, Conn.). The PCR products
were separated by electrophoresis on a 5% polyacrylamide sequencing
gel and visualized by autoradiography. Tests for linkage were
carried out using the haplotype formed from D12S321, D12S76 and
UC-39 and assuming a recombination frequency between adjacent
markers of 0.001 with the computer program MLINK from the LINKAGE
package (version 5.1) (Lathrop et al., 1985). The frequencies of
the haplotypes were estimated from the data. The analysis assumed a
disease allele frequency of 0.001 and two liability classes.
Liability class 1 included individuals whose age was .gtoreq.25
years of age with penetrances of 0.00, 0.95 and 0.95 for the normal
homozygote, heterozygote and susceptible homozygote, respectively.
Liability class 2 included individuals <25 years of age with
penetrances of 0.00, 0.50 and 0.95 for the normal homozygote,
heterozygote and susceptible homozygote, respectively. The
affection status of the one subject with impaired glucose tolerance
was coded as unknown.
[0563] Identification of Mutations
[0564] Each exon and minimal promoter region of the HNF-1.alpha. :
gene of subjects II-5 and III-1 were screened for mutations as
described previously (Yamagata et al., 1996; Kaisaki et al., 1997).
The mutation was confirmed by cloning the PCR product into pGEM-4Z
and sequencing clones derived from both alleles. The presence of
the mutation in other family members and unrelated nondiabetic
subjects was tested by PCR amplification of the proximal promoter
region and direct sequencing.
[0565] 2. Results
[0566] Linkage Studies
[0567] The NIDDM in the pedigree Italy-1 has the clinical features
of MODY including autosomal dominant inheritance and age at
diagnosis <25 years in multiple family members (FIG. 21). The
six affected members are treated with either insulin (individuals
II-1, II-5 and III-9) or oral hypoglycemic agents (II-7, III-1 and
III-2). The three subjects on insulin therapy showed evidence of
diabetic complications including retinopathy (II-1 and II-5) and
nephropathy (III-9). One member of this pedigree, III-6, has
impaired glucose tolerance.
[0568] The polymorphic markers D12S321, D12S76 and UC-39 which are
closely linked to the HNF-1.alpha. gene (order:
cen--D12S321--D12S76--HNF-1.alpha- .--UC-39--qter) were typed in
this family. The haplotype 3-3-7 co-segregated with MODY with no
obligate recombinants (FIG. 21). One subject with IGT (age, 18
years) also inherited this haplotype as did two unaffected young
women, individuals III-5 and III-13, of 21 and 14 years of age,
respectively. These three subjects may be at risk of developing
diabetes in the future. The LOD score in this family was 1.28 at a
recombination fraction of 0.00. Although this LOD score does not
meet formal criteria for establishing linkage (ie. the LOD score is
<3.0), the p-value associated with the evidence for linkage is
0.008 which is sufficient to justify a search for mutations in the
HNF-1.alpha. gene.
[0569] Mutation Screening.
[0570] Two diabetic subjects, II-5 and III-1, were screened for
mutations in the HNF-1.alpha. gene. No mutations were found on
screening the mRNA/protein coding regions, exons 1-10, although the
subjects were heterozygous for several previously described
polymorphisms (Yamagata et al., 1996). Since no mutations were
found in the coding region of the HNF-1.alpha. gene, the proximal
promoter region was screened. This analysis revealed that both
affected subjects were heterozygous for an A--C substitution at
nucleotide-58 which is located in a highly conserved region of the
promoter of the HNF-1.alpha. gene that includes the binding site
for HNF-4.alpha. (FIG. 22) (Tian and Schibler et al., 1991; Kuo et
al., 1992). Since this mutation does not lead to gain or loss of a
site for a restriction endonuclease, it was tested for by PCR
amplification and direct sequencing. The A.fwdarw.C substitution at
nucleotide-58 co-segregated with the at-risk haplotype in the
Italy-1 pedigree (FIG. 21) and was not present in a sample of 50
unrelated white subjects implying that it is the mutation
responsible for MODY in this family.
Example 8
Mutation in HNF-1.beta. Associated with MODY
[0571] HNF-1.alpha. and HNF-4.alpha. are members of a complex
transcriptional regulatory network which includes other homeodomain
proteins and nuclear receptors as well as members of the
forkhead/winged helix and leucine zipper CCAAT/enhancer binding
protein families (Cereghini, 1996). The inventors have screened two
other members of this network, HNF-1.beta. (Mendel et al., 1991a;
De Simone et al., 1991; Rey-Campos et al., 1991; Bach and Yaniv,
1993) and the bifunctional protein dimerization cofactor of HNF-1
(DCoH)/pterin-4-carbinolamine dehydratase (PCBD) (Mendel et al.,
1991b; Citron et al., 1992) for mutations in Japanese subjects with
MODY. No diabetes-associated mutations were found in DCoH. However,
the inventors found one subject with a nonsense mutation, R177X, in
HNF-1.beta. which co-segregated with early-onset diabetes. The
identification of mutations in three members of the HNF-family of
transcription factors indicates the importance of this regulatory
network in the maintenance of glucose homeostasis.
[0572] 1. Methods
[0573] Study Population.
[0574] The study population consisted of 57 unrelated Japanese
subjects attending the Diabetes Clinic of Tokyo Women's Medical
College who were diagnosed with NIDDM before 25 years of age and/or
who were members of families in which NIDDM was present in three or
more generations: age at diagnosis, 20.1.+-.7.5 years (mean.+-.SE);
male/female, 31/26; and treatment, insulin--36, oral hypoglycemic
agents--10, and diet--11. These subjects had been screened for
mutations in the HNF-1/MODY3 gene and all were negative for
mutations in this gene (Lazzaro et al., 1992). Thirty-two of the
subjects met strict criteria for a diagnosis of MODY (i.e., NIDDM
in at least three generations with autosomal dominant transmission
and diagnosis before 25 years of age in at least one affected
subject). NIDDM was diagnosed using the criteria of the World
Health Organization (Bennett, 1994). At the time of recruitment,
informed consent was obtained from each subject and a blood sample
was taken for DNA isolation. Fifty-three unrelated nondiabetic
Japanese subjects were tested for each nucleotide substitution and
mutation to determine if the sequence change was a polymorphism or
disease-associated mutation.
[0575] Pedigree J2-20.
[0576] The proband (subject III-2, FIG. 25) presented with
glucosuria at 10 years of age and was hospitalized. She was
diagnosed with diabetes and treated with insulin for two days and
then with diet only for two years. At 12 years of age, she resumed
insulin therapy (28 U/day). She came to clinical attention again at
21 years because of a pyelonephritis and poorly controlled
diabetes. At 23 years of age, she was admitted to the hospital of
Tokyo Women's Medical College because of blurred vision. Her urine
C-peptide levels at this time were 3.2 g/day (normal, 50.+-.25
g/day) indicating low insulin secretory capacity. Despite
persistent high blood glucose levels, she had no history of
ketosis. The subject was diagnosed with NIDDM based on her clinical
course. Subject III-3 presented with general fatigue at 15 years of
age. He had gained 15 kg during the previous three months and his
weight at the time of presentation was 75 kg. He was diagnosed with
diabetes and was treated first with insulin and then diet and
exercise. He was well controlled when he maintained his weight at
60 kg. At 18 years of age, he had gained weight again and insulin
treatment was initiated His urinary C-peptide at this time was 57.5
g/day with fasting C-peptide and glucose levels of 2.4 ng/ml and
106 mg/dl, respectively. There was no history of ketosis and he was
diagnosed with NIDDM. He presently shows diminished pancreatic-cell
function with no increase in C-peptide levels following
administration of glucagon. All individuals shown in FIG. 25 were
invited to participate in this study but many declined to do
so.
[0577] Isolation and Partial Sequence of Human HNF-1.beta.
Gene.
[0578] The PAC clone 319P12 containing the human HNF-1.beta. gene
was isolated from a library (Genome Systems, St. Louis, Mo.) by
screening PAC DNA pools using polymerase chain reaction (PCR.TM.)
and the primers vHNFP 1 (5'-CCTCATGGAGAAACATCCTAAGT-3') (SEQ ID
NO:124) and vHNFP2 (5'-AGGGAGTGCACGGCTGAGCTCCTG-3') (SEQ ID NO:
125). The sequences of the exons, flanking introns and promoter
region were determined by sequencing PCR.TM. products and
appropriate restriction fragments cloned into pGEM.RTM.-4Z
(Promega, Madison, Wis.) with an AmpliTaq FS Dye Terminator cycle
sequencing kit (Perkin-Elmer, Norwalk, Conn.) and ABI Prism.TM. 377
DNA sequencer. Primers for PCR.TM. and sequencing were selected
using the exon-intron organization of the human HNF-1.alpha. gene
(Yamagata et al., 1996a) as a guide since related genes often have
similar exon-intron organizations. The partial sequence of the
human HNF-1.alpha. gene including promoter has been deposited in
the GenBank database under accession numbers U90279-90287 and
U96079.
[0579] Mutation Screening.
[0580] The nine exons, flanking introns and minimal promoter region
of the HNF-1.beta. gene were amplified using PCR.TM. and specific
primers (Table 17) and the PCR.TM. products were sequenced from
both ends as described above. PCR.TM. for exon 1 was carried out
using ELONGASE Enzyme.TM. Mix (Life Technologies, Grand Island,
N.Y.) with denaturation at 94.degree. C. for 1 min followed by 35
cycles of denaturation at 94.degree. C. for 30 s, annealing at
55.degree. C. for 30 s and extension at 68.degree. C. for 1 min,
and final extension at 68.degree. C. for 10 min. PCR.TM. for exons
2-9 was carried out using Taq DNA polymerase and 1.5 mM MgCl.sub.2
with denaturation at 94.degree. C. for 5 min followed by 35 cycles
of denaturation at 94.degree. C. for 30 s, annealing at 60.degree.
C. for 30 s and extension at 72.degree. C. for 30 s, and final
extension at 72.degree. C. for 10 min. The sequence of each
mutation was confirmed by cloning the PCR.TM. product into
pGEM.RTM.-T Easy (Promega, Madison, Wis.) and sequencing clones
representing both alleles. Exons 2-4 of the DCoH gene were
amplified using Taq DNA polymerase/1.5 mM MgCl.sub.2 and specific
primers (Table 16) and sequenced as described above. Exon 1 of the
DCoH gene encoding the 5'-untranslated region and the initiating
Met was refractory to PCR.TM. amplification and therefore was not
screened for mutations. The presence of a specific mutation or
polymorphism in other individuals was determined by PCR-RFLP
analysis if it resulted in the gain/loss of a site for a
restriction endonuclease, or PCRT and direct sequencing if there
was no change in a site.
[0581] Linkage Studies.
[0582] The human HNF-1.beta. (STS WI-7310) and DCoH genes were
mapped and confirmed to YACs 969C9 (chromosome 17) (Schuler et al.,
1996) and 849H3 (chromosome 10), respectively. The adjacent
polymorphic STSs D 17S1788 and D10S1688 were tested for linkage
with NIDDM in Japanese affected sib pairs (258 and 268 possible
pairs, respectively). In the genome-wide screen of Mexican American
affected sib pairs 23, the HNF-1.beta. and DCoH genes are in the
intervals D17S1293-D17S1299 and D10S589-D10S535, respectively
(Schuler et al., 1996).
[0583] Transactivation Studies of Normal and Mutant Human
HNF-1.beta..
[0584] The construct pcDNA3.1-HNF-1.beta. was prepared by cloning
the type A human HNF-1.beta. cDNA (nucleotides 195-2783 inclusive,
GenBank Accession No. X58840; SEQ ID NO:128) into
pcDNA3.1+(Invitrogen, Carlsbad, Calif.). The R177X mutation was
introduced by site-directed mutagenesis (QuikChange.TM. mutagenesis
kit; Stratagene, La Jolla, Calif.) to generate
pcDNA3.1-HNF-1.beta.-R177X. The reporter gene construct pGL3-RA was
prepared by cloning the promoter of the rat albumin gene,
nucleotides -170 to +5 (Ringeisen et al., 1993), into the firefly
luciferase reporter vector pGL3-Basic (Promega, Madison, Wis.). The
sequences of all constructs were confirmed. HeLa cells were
transfected for 5 hr using lipofectAMINE.TM. (GIBCO BRL,
Gaithersburg, Md.) with 500 ng of pGL3-RA, 250 ng of
pcDNA3.1-HNF-1.beta. or pcDNA3.1-HNF-1.beta.-R177X, and 25 ng of
pRL-SV40 to control for efficiency of transfection. pcDNA3.1+ DNA
was added to each transfection so that the final amount of DNA
added was 2 g. After 24 h, the transactivation activity of the
normal and mutant HNF-1.beta. proteins was measured using the
Dual-Luciferase.TM. Reporter Assay System (Promega, Madison,
Wis.).
[0585] 2. Results
[0586] The nine exons, flanking introns and minimal promoter region
of the human HNF-1.beta. gene (TCF2) which encode all forms of
HNF-1.beta. were screened for mutations in 57 unrelated Japanese
subjects with MODY. This analysis revealed four nucleotide
substitutions, a C T substitution in codon 177 (exon 2) in the
proband from family J2-20 which generated a nonsense mutation CGA
(Arg) TGA (OP) (R177X) (FIG. 24), an uncommon silent mutation in
codon 463 (exon 7) for which one subject was homozygous, and two
polymorphisms in intron 8 (Table 15), neither of which is predicted
to affect RNA splicing. The nonsense mutation R177X was not found
on screening 53 unrelated non-diabetic Japanese subjects. One
nondiabetic subject was heterozygous for the silent mutation in
codon 463 (Table 15).
15TABLE 15 Mutations and DNA polymorphisms in human HNF-1.beta. and
DCoH genes Location Frequency Patients Con- Site Codon Nucleotide
Change (n = 57) trols A.HNF-1.beta. Exon 2 177
CGA(Arg).fwdarw.TGA(OP) C-0.99; T-0.01 C-1.00; T-0.00 Exon 7 463
GCC(Ala).fwdarw.GCT(Ala) C-0.98; T-0.02 C-0.99; T-0.01 Intron 8 nt
48 Insertion C C-0.12 C-0.17 Intron 8 nt -22 C.fwdarw.T C-0.71;
T0.29 C-0.68; T-0.32 B.DCoH Exon 4 nt 9306 A.fwdarw.G A-0.82
A-0.80; G-0.20
[0587] DNA polymorphisms found in introns are noted relative to the
splice donor or acceptor site. nt, nucleotide. In the HNF1-.beta.
gene the C.fwdarw.T substitution in codon 463 and the C-insertion
polymorphism in intorn 8 nt 48, result in the gain of a Dde I site
and loss of a Nae I, respectively. In the human DCoH gene (Genbank
accession no. LA1560, incorporated herein by reference), the nt
9306 is in the region encoding the 3'-untranslated region of DcoH
mRNA and is 36 nucleotides after the translation termination
codon.
[0588] Family J2-20 shows bilineal inheritance of diabetes (FIG.
25). The R177X mutation, which was maternally inherited, is
associated with early-onset NIDDM, progression to insulin treatment
and severe complications. The earlier age at diagnosis in the
proband and her brother may be due to the inheritance of
diabetes-susceptibility genes from both parents. The paternal
diabetes gene which may potentiate the effect of the HNF-1.beta.
mutation is unknown but is not another known MODY gene as mutations
were not found in the HNF-1.alpha. and HNF4.alpha. and glucokinase
genes of the proband (Iwasaki, et al., 1997; Furuta et al., 1997;
Iwasaki et al., 1995). The proband's older brother had been healthy
until developing a common cold and died one week later of diabetic
ketoacidosis. The proband's maternal grandparents, both of whom are
deceased, were not known to have diabetes. However, she has a
maternal uncle with mild diet-controlled NIDDM diagnosed at 60
years of age. The difference in phenotype between the proband's
mother and maternal uncle and the absence of diabetes in the
maternal grandparents suggest that the R177X mutation may represent
a new mutation in the proband's mother. The father and two paternal
uncles have late-onset NIDDM treated with oral hypoglycemic agents.
The proband's paternal grandmother was reported to have had
diabetes. The presence of MODY and late-onset NIDDM within the same
family is not unusual and has been reported previously (Bell et
al., 1991). With respect to the presence of nephropathy in the
subjects with the R177X mutation in HNF-1.beta., it is interesting
to note that HNF-1.beta. is expressed at highest levels in kidney
(Mendel et al., 1991a; De Simone et al., 1991; Rey-Campos et al.,
1991; Bach and Yaniv, 1993; Lazzaro et al., 1992) and perhaps
decreased levels of this transcription factor contribute to renal
dysfunction.
[0589] HNF-2.beta. contains a bipartite DNA binding region
consisting of a POU-like element and a homeodomain (Mendel et al.,
1991a; De Simone et al., 1991; Rey-Campos et al., 1991; Bach and
Yaniv, 1993). The R177X mutation is located at the end of the
POU-like domain and generates a protein of 176 amino acids having
the NH.sub.2-dimerization and POU domains (Cereghini, 1996; Mendel
et al., 1991a; De Simone et al., 1991; Rey-Campos et al., 1991;
Bach and Yaniv, 1993). This truncated protein cannot stimulate
transcription of a rat albumin promoter-linked reporter gene and
does not inhibit the activity of wild-type HNF-1.beta. (Table 16).
This suggests that the R177X mutation represents a loss of function
mutation which results in decreased HNF-1.beta. levels and a
corresponding reduction in expression of HNF-1.beta. target
genes.
16TABLE 16 Transactiviation activity of human HNF-1.beta. and R177X
mutation. Normalized Activity (Firefly Luciferase/ Construct
Renilla luciferase) pcDNA 3.1 3.5 .+-. 0.5 pc DNA 3.1-HNF-1.beta.
25.1 .+-. 3.2 pc DNA 3.1-R177X 3.8 .+-. 1.0 pcDNA 3.1-HNF-1.beta. +
pcDNA 3.1-R177X 32.2 .+-. 2.8
[0590] The activity of each construct was meassured in triplicate
and the mean.+-.SD is shown. These results are representative of at
least two independent experiments.
17TABLE 17 Seqences of PCR primers used for amplification and
sequencing of human HNF-1 (TCF2) and DCoH (PCBD) genes Product size
Region Forward primer (5'-3') Reverse primer (5'-3') (bp) A. HNF-1
(TCF2) Promoter CATGAACCCCGAAGAGTGGTG (SEQ ID NO:90)
GCCTCCAGACACCTGTTACT SEQ ID NO:91 423 Exon 1-1
GGCGATCATGGCAAGTTAGAAG SEQ ID NO:92 TTGGTGAGAGTATGGAAGACC (SEQ ID
NO:93 392 Exon 1-2 GGGGTTTGCTTGTGAAACTCC SEQ ID NO:94
TTGGTGGGAAACGGGCTTGG SEQ ID NO:95 536 Exon 2 CTCCCACTAGTACCCTAACC
SEQ ID NO:96 GAGAGGGCAAAGGTCACTTCAG SEQ ID NO:97 291 Exon 3
AGTGAAGGCTACAGACCCTATC SEQ ID NO:98 TTCCTGGGTCTGTGTACTTGC SEQ ID
NO:99 365 Exon 4-1 TGTGTTTTGGGCCAAGCACCA SEQ ID NO:100
AACCAGATAAGATCCGTGGC SEQ ID NO:101 381 Exon 4-2
AACCAGACTCACAGCCTGAACC SEQ ID NO:102 TCACAGGGCAATGGCTGAAC SEQ ID
NO:103 293 Exon 5 TGCCGAGTCATTGTTCCAGG SEQ ID NO:104
CCTCTTATCTTATCAGCTCCAG SEQ ID NO:105 276 Exon 6
CTGCTCTTTGTGGTCCAAGTCC SEQ ID NO:106 GAGTTTGAAGGAGACCTACAG SEQ ID
NO:107 288 Exon 7 ATCCACCTCTCCTTATCCCAG SEQ ID NO:108
ACTTCCGAGAAAGTTCAGACC SEQ ID NO:109 340 Exon 8
TTTGCCTGTGTATGCACCTTG SEQ ID NO:110 GCCGAGTCCATGCTTGCCAC SEQ ID
NO:111 257 Exon 9 CTTTGCTGGTTGAGTTGGGC SEQ ID NO:112
TTCCATGACAGCTGCCCAGAG SEQ ID NO:113 208 B. DCoH (PCBD) Exon2
TAAAGGTTGGAGCCCCTCTG SEQ ID NO:114 TTGTAAGGTGACCCCATCAG SEQ ID
NO:115 264 Exon 3 TTGGTGATGTCCAGAAGTCC SEQ ID NO:116
CAGAATGTGTCAGAGTTCGC SEQ ID NO:117 213 Exon 4 CTCCCTCCTGTTCTTAAGTG
SEQ ID NO:118 CTGGACTCCCAGTTCAGTCA SEQ ID NO:119 205
[0591] Human DCoH is a protein of 104 amino acids (including the
initiating methionine) (Thony et al., 1995). Exons 2-4 which encode
amino acids 2-104 were screened for mutations in the 57 unrelated
Japanese subjects with MODY described above. The sequences were
identical to one another except for an A G polymorphism located in
the 3'-untranslated region (Table 15), the frequency of which was
not different between MODY and nondiabetic subjects. Thus,
mutations in DCoH do not appear to contribute to the development of
MODY in Japanese.
[0592] The frequency of HNF-1.beta. mutations in the inventors'
study population of Japanese subjects with MODY is 2% (1/57) which
is the same as for mutations in HNF-4.alpha. (Furuta et al., 1997)
whereas the frequency of HNF-1.alpha. mutations is about 8%
(Iwasaki, et al., 1997) (the frequency of glucokinase mutations in
this sample is unknown). However, genetic variation in HNF-1.beta.
or DCoH is unlikely to be a major factor contributing to the more
common late-onset NIDDM as there is no evidence for linkage of
markers adjacent to these genes with diabetes in Japanese or
Mexican American affected sib pairs (Hanis et al., 1996).
[0593] The association of a mutation in HNF-1.beta. with diabetes
indicates the importance of the HNF-regulatory network in
determining pancreatic-cell function. Moreover, HNF-1.alpha. is not
able to compensate for the reduction in HNF-1.beta. activity
implying that the primary target genes for these transcription
factors in pancreatic .beta.-cells are different. The
identification of these target genes will provide a better
understanding of the molecular mechanisms that determine
normal-cell function and may lead to new approaches for treating
diabetes.
Example 9
Elucidation of the Genes Responsible for Additional MODY Disease
States
[0594] The inventors have identified that various MODY-type
diabetes disease states are caused by mutations in various HNF
proteins in the diseased individuals. However, the inventors are
also aware of families that exhibit classic "MODY" disease states
that are not caused by mutations in HNF1.alpha., HNF1.beta., or
HNF4.alpha.. Therefore, one aspect of this invention is to continue
to screen the genetic complement of these families to determine the
genes that cause these additional MODY disease states. Such
screening can be done in the manner successfully used by the
inventors to screen for the causes of MODY1, MODY2, and MODY 3. One
of ordinary skill will be able and motivated in view of the
teachings of this application, to work towards elucidating genes
that, when mutated, cause additional MODY disease states. Once such
genes are elucidated, all aspects diagnostic, treatment, and other
aspects of the invention will be realizable by those of skill in
the art for those additional MODY causations. In order to achieve
these aspects of the invention, one will simply have to modify
procedures and protocols taught in this specification to be
appropriate to the specific gene determined to cause a MODY disease
state.
[0595] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
REFERENCES
[0596] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0597] Abbondanzo et al., Breast Cancer Res. Treat., 16: 182(#151),
1990.
[0598] Allred et al., Breast Cancer Res. Treat., 16: 182(#149),
1990.
[0599] An et al., Proc. Amer. Assn. Canc. Res., 36: 82, 1995.
[0600] Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.,
1988.
[0601] Bach, and Yaniv, EMBO J., 12:4229-4242, 1993.
[0602] Baichwal and Sugden, In: Kucherlapati R, ed. Gene transfer.
New York: Plenum Press, pp. 117-148, 1986.
[0603] Barnett et al., Diabetologia 20:87-93 (1981).
[0604] Baumheuter et al., Genes and Development, 4:372-379 1990
[0605] Bell, et al., Proc. Natl. Acad. Sci. USA, 88:1484-1488,
1991.
[0606] Bellus, J. Macromol. Sci. Pure Appl. Chem, A31(1):
1355-1376, 1994.
[0607] Bennett, et al., "In: Joslin's Diabetes Mellitus, 13.sup.th
ed., Kahn CR, Weir GC Eds., Philadelphia, Lea & Febiger, p.
193-200, 1994.
[0608] Benvenisty and Neshif, Proc. Natl Acad. Sci. USA,
83:9551-9555, 1986.
[0609] Bittner et al., Methods in Enzymol, 153:516-544, 1987.
[0610] Bourguet, et al., Nature, 375:377-382 (1995).
[0611] Bowden, et al., Am. J. Hum. Genet. 50:607-618 (1992).
[0612] Bowden, et al., Diabetes, 41:88-92 (1992).
[0613] Brown et al., Breast Cancer Res. Treat., 16: 192(#191),
1990.
[0614] Byrne, et al., Am. J. Physiol., 268:E21-27, 1995a.
[0615] Byrne, et al., Diabetes, 44(6):699-704, 1995b.
[0616] Byrne, et al., J. Clin. Invest., 93:1120-1130, 1994.
[0617] Cammidge, P. J., Br. Med. J., 2:738-741 (1928).
[0618] Capaldi et al., Biochem. Biophys. Res. Comm., 76:425,
1977
[0619] Cereghini, et al., FASEB J., 10:267-282, 1996.
[0620] Chartier, et al., Gene, 147:269-272, 1994.
[0621] Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987.
[0622] Chen et al., Proc. Am. Urol. Assn., 153: 267A, 1995.
[0623] Chen, et al. Genes & Dev., 8:2466-2477 (1994).
[0624] Chico, et al., Diabetes Res. Clin. Pr., 33: 105-110,
1996.
[0625] Citron, et al., Proc. Natl. Acad. Sci. USA, 89:11891-11894,
1992.
[0626] Colberre-Garapin et al., J. Mol. Biol., 150: 1, 1981.
[0627] Cotton, R. G. H., Biochem J., 263:1-10 (1989).
[0628] Courtois et al., Proc. Nat'l. Acad. Sci. USA, 85:7937-7941
(1988).
[0629] Courtois et al; Science 238:688-692 (1987).
[0630] Cox, et al., Diabetes, 41:401-407, 1992.
[0631] Davey et al., EPO No. 329 822.
[0632] De Simone, et al., EMBO J., 10:1435-1443 1991.
[0633] Donahue et al., J. Biol. Chem., 269: 8604-8609, 1994
[0634] Drewes, et al., G. U. Molec. Cell. Biol., 16:925-931
(1996).
[0635] Dubensky et al., Proc. Nat'l Acad. Sci. USA, 81:7529-7533,
1984.
[0636] Durlach, et al., Diabetes & Metabolism, 22:319-323,
1996.
[0637] Eaton, et al., J. Clin. Endocrinol. Metab., 51:520-528,
1980.
[0638] Ellis, L. A. et al., Nucleic Acids Res., 22:2710-2711
(1994).
[0639] Emens, et al., Proc. Natl. Acad. Sci. U.S.A., 89:7300-7304
(1992).
[0640] Erdmann and Heim, J. Biol. Chem., 270:22988-22996, 1995.
[0641] European Patent Application No. 139,417A
[0642] European Patent Application No. 320 308
[0643] Faber, et al., Diabetes, 27(Suppl. 1):170-177, 1978.
[0644] Fajans, et al., Life Sci., 55:413-422, 1994.
[0645] Fajans, Diabetes Care, 13:49-64, 1990 (Erratum 13:910,
1990).
[0646] Fajans, S. S., Diab./Metab. Rev. 5, 579-606 (1989).
[0647] Fechheimer et al., Proc. Nat'l Acad. Sci. USA, 84:8463-8467,
1987.
[0648] Ferkol et al, FASEB J., 7:1081-1091, 1993.
[0649] Figueiredo and Brownlee, J. Biol. Chem., 270:11828-11838,
1995.
[0650] Frain et al.Cell, 59:145-157 (1989).
[0651] Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352,
1979.
[0652] Freifelder, Physical Biochemistry Applications to
Biochemistry and Molecular Biology, 2.sup.nd ed. Wm. Freeman and
Co., New York, N.Y., 1982.
[0653] Freshner, Second Edition, Oxford/New York, IRL Press, Oxford
University Press, 1992.
[0654] Froguel, et al., N. Engl. J. Med., 328:697-702, 1993.
[0655] Froguel, et al., Nature (Lond.), 356:162-164, 1992 (Erratum
357:607, 1992).
[0656] Frohman, PCR PROTOCOLS. A GUIDE TO METHODS AND APPLICATIONS,
Academic Press, N.Y., 1990.
[0657] Furuta, et al., " Diabetes, 46:IN PRESS, 1997.
[0658] Gefter et al., Somatic Cell Genet., 3: 231-236, 1977.
[0659] German et al., 1990 JBC 265, 22063-22066
[0660] Ghosh and Bachhawat, In: Wu G. and C. Wu ed. Liver diseases,
targeted diagnosis and therapy using specific receptors and
ligands. New York: Marcel Dekker, pp. 87-104, 1991.
[0661] Gibbs, and Caskey, Science 236: 303-305 (1987).
[0662] Gingeras et al., PCT Application WO 88/10315.
[0663] Goding, 1986, In Monoclonal Antibodies: Principles and
Practice, 2d ed., Orlando, Fla., Academic Press, 1986, pp. 60-61,
and 71-74.
[0664] Gopal, Mol. Cell Biol., 5:1188-1190, 1985.
[0665] Graham and van der Eb, Virology, 52:456-467, 1973.
[0666] Great Britain Patent Application No. 2 202 328
[0667] Gronemeyer and Moras, Nature, 375:190-191, 1995.
[0668] Halter, et al., J. Clin. Endocrinol. Metab., 48:946-954,
1979.
[0669] Hanis, et al., Nature Genet., 13:161-166 (1996).
[0670] Hansen et al., Current Opinion in Genetics and Development,
3:246-253, 1993.
[0671] Harland and Weintraub, J. Cell Biol., 101:1094-1099,
1985.
[0672] Hayashi, et al., J. Clin. Endocrinol. Metab., 44:681-94,
1977.
[0673] Herman, et al. Diabetes 43, 40-46 (1994) [Errata, Diabetes
43:1171 (1994)].
[0674] Hess et al., J. Adv. Enzyme Reg., 7:149, 1968.
[0675] Hirata, et al., Diabetologia, 38:1434-1442, 1995.
[0676] Hitzeman et al., J. Biol. Chem., 255:2073, 1980.
[0677] Holland et al., Biochemistry, 17:4900, 1978.
[0678] Hung and High, J. Biol. Chem., 271:2323-2331, 1996.
[0679] Innis et al., PCR Protocols, Academic Press, Inc., San Diego
Calif., 1990.
[0680] Inouye et al., Nucleic Acids Res., 13: 3101-3109, 1985.
[0681] Irwin, et al., Proc. Natl. Acad. Sci. U.S.A.,
91:11684-11688(1994).
[0682] Iwasaki, et al., Diab. Res. & Clin. Pract., 4:237-240,
1988.
[0683] Iwasaki, et al., Diabetes, 46:IN PRESS, 1997.
[0684] Iwasaki, et al. J. Japan Diab. Soc., 39:409-416 (1996).
[0685] Iwaski, et al., Acta Diabetol 32:17-22, 1995.
[0686] Jiang and Sladek, J. Biol. Chem., 272:1218-1225, 1997.
[0687] Jiang, et al., Molec. Cell. Biol. 15:5131-5143 (1995).
[0688] Johnson et al., In BIOTECHNOLOGY AND PHARMACY, Pezzuto et
al., Eds., Chapman and Hall, New York (1993)
[0689] Jones, Genetics, 85: 12, 1977.
[0690] Kaisaki, et al., Diabetes, 46:528-535, 1997.
[0691] Kaneda et al., Science, 243:375-378, 1989.
[0692] Kato et al., J. Biol. Chem., 266:3361-3364, 1991.
[0693] Kingsman et al., Gene, 7: 141, 1979.
[0694] Klein et al., Nature, 327:70-73, 1987.
[0695] Kohler and Milstein, Eur. J. Inmunol., 6:511-519, 1976.
[0696] Kohler and Milstein, Nature, 256:495497, 1975.
[0697] Kritis, et al., Gene, 173:275-280, 1996.
[0698] Kuo et al., Nature 355:457461, 1992.
[0699] Kuo, et al., Nature, 355:457-461, 1990.
[0700] Kwoh et al., Proc. Nat. Acad. Sci. USA, 86: 1173, 1989.
[0701] Kyte and Doolittle, J. Mol. Biol., 157(1):105-132, 1982.
[0702] Lai, et al., Proc. Natl. Acad. Sci U.S.A., 90:10421-10423
(1993).
[0703] Laine, et al., , Gene 147:269-272 (1994).
[0704] Lathrop and Lalouel, Am. J. Humn. Genet., 36:460-465,
1984.
[0705] Lathrop, et al., Am J Hum Genet 37:482-498, 1985
[0706] Lathrop, et al., Proc. Natl. Acad. Sci. USA, 81:3443-3446,
1984.
[0707] Lazzaro, et al., Development, 114:469-479, 1992.
[0708] Leahy, et al., Diabetologia, 36:1238-1244, 1993.
[0709] Lederman et al., Lancet 345, 648, 1995.
[0710] Lee, et al., Science, 260:1117-1121, 1993.
[0711] Lemaigre, et al. Proc. natl. Acad. Sci. U.S.A. 93, 9460-9464
(1996).
[0712] Liang and Pardee, Science, 257: 967-971, 1992.
[0713] Lishanski et al., Proc. Nat'l. Acad. Sci USA., 91:2674-2678
(1994).
[0714] Lowry et al., Cell, 22: 817, 1980.
[0715] Mangelsdorf, et al. Cell, 83:835-839 (1995).
[0716] Matthews, et al., Diabetologia, 28:412-419, 1985.
[0717] Melton, et al, Nucleic Acids Res., 12:7035-7056, (1984).
[0718] Mendel and Crabtree, 1991, JBC 266:677-680
[0719] Mendel, et al. Science 254, 1762-1767 (1991b).
[0720] Mendel, et al., Genes & Dev. 5, 1042-1056 (1991a).
[0721] Menzel, et al., Diabetes, 44:1408-1413, 1995.
[0722] Miller et al., PCT Application WO 89/06700
[0723] Miquerol, L. et al. J. Biol. Chem., 269:8944-8951
(1994).
[0724] Mok et al., Gynecol. Oncol., 52: 247-252, 1994.
[0725] Morgan and Lazarow, Diabetes, 12:115-126, 1963.
[0726] Mulligan et al., Proc. Nat'l Acad. Sci. USA, 78: 2072,
1981.
[0727] Myers and Maniatis in U.S. Pat. No. 4,946,733
[0728] Myers and Maniatis, Cold Spring Harbor Symposium on
Quantitative Biology, Vo. LI, pp. 18275-18284 (1986)
[0729] Myers and Maniatis, Science, 230:1242-1246 (1985).
[0730] Naka and Brownlee, Brit. J. Haematol., 92:231-240, 1996.
[0731] Nakagawa, et al., Jap. J. Nephrol., 38:513-518, 1996.
[0732] Nakamura et al., In: Handbook of Experimental Immunology
(4.sup.th Ed.), Weir, E., Herzenberg, L. A., Blackwell, C.,
Herzenberg, L. (eds). Vol. 1, Chapter 27, Blackwell Scientific
Publ., Oxford, 1987.
[0733] Nicolas & Rubenstein, "Retroviral vectors," In: Vectors:
A survey of molecular cloning vectors and their uses, Rodriguez
& Denhardt (eds.), Stoneham: Butterworth, pp. 493-513,
1988.
[0734] Nicolau and Sene, "Liposome-mediated DNA transfer in
eukaryotic cells," Biochem. Biophys. Acta, 721:185-190, 1982.
[0735] O'Hare et al., Proc. Nat'l Acad. Sci. USA, 78: 1527,
1981.
[0736] Ohara et al., Proc. Nat'l Acad. Sci. USA, 86: 5673-5677,
1989.
[0737] Ott, Proc. Natl. Acad. Sci. USA, 86:4175-4178, 1989.
[0738] PCT Application No. PCT/US87/00880
[0739] PCT Application No. PCT/US89/01025
[0740] PCT Application No. WO 88/10315
[0741] Perales et al., Proc. Natl. Acad. Sci. USA, 91:4086-4090,
1994.
[0742] Polonsky, et al., J. Clin. Invest., 77:98-105, 1986.
[0743] Polonsky, et al., N. Engl. J. Med. 334, 777-783 (1996).
[0744] Potter et al., Proc. Nat'l Acad. Sci. USA, 81:7161-7165,
1984.
[0745] Quandt, et al., Nucl. Acids Res., 23:4878-4884, 1995.
[0746] Rastinejad, et al., Nature, 375:203-211, 1995.
[0747] Remington's Pharmaceutical Sciences 15.sup.th Edition, pages
1035-1038 and 1570-1580
[0748] Renaud, et al. Nature 378, 681-689 (1995).
[0749] Rey-Campos, et al., EMBO J., 10: 1445-1457, 1991.
[0750] Ridgeway, In: Rodriguez R L, Denhardt D T, ed. Vectors: A
survey of molecular cloning vectors and their uses. Stoneham:
Butterworth, pp. 467-492, 1988.
[0751] Ringeisen, et al., J. Biol. Chem., 268:25706-25711,
1993.
[0752] Rippe et al., Mol. Cell Biol., 10:689-695, 1990.
[0753] Rothschild, et al., Am. J. Hum. Genet., 52:110-23, 1993.
[0754] Sager et al., FASEB J., 7: 964-970, 1993.
[0755] Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d
Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989.
[0756] Santerre et al. 1984
[0757] Schuler, et al., Science, 274:540-546, 1996.
[0758] Sladek, et al., Genes & Dev. 4, 2353-2365 (1990).
[0759] Stinchcomb et al., Nature, 282: 39, 1979.
[0760] Stoffel, M. et al. Proc. natl. Acad. Sci. U.S.A.,
93:3937-3941 (1996).
[0761] Summers et al. A MANUAL OF METHODS FOR BACULOVIRUS VECTORS
AND INSECT CELL CULTURE PROCEDURES, Texas Agriculture Experimental
Station.
[0762] Szybalska et al., Proc. Nat'l Acad. Sci. USA, 48:2026,
1962.
[0763] Tavaviras, et al., Mech. Dev., 48:67-79, 1994.
[0764] Temin, In: Gene Transfer, Kucherlapati (ed.), New York:
Plenum Press, pp. 149-188, 1986.
[0765] Theophilus, et al., Nucleic Acids Research,
17:(19):7707-7722. 1989
[0766] Thony, et al., Biochem. Biophys. Res. Commun., 210:966-973,
1995
[0767] Tian and Schibler, Genes Dev 5:2225-2234, 1991.
[0768] Tschemper et al., Gene, 10: 157, 1980.
[0769] Tur-Kaspa et al., Mol. Cell Biol., 6:716-718, 1986.
[0770] U.S. Pat. No. 3,817,837
[0771] U.S. Pat. No. 3,850,752
[0772] U.S. Pat. No. 3,939,350
[0773] U.S. Pat. No. 3,996,345
[0774] U.S. Pat. No. 4,215,051
[0775] U.S. Pat. No. 4,275,149
[0776] U.S. Pat. No. 4,277,437
[0777] U.S. Pat. No. 4,366,241
[0778] U.S. Pat. No. 4,554,101
[0779] U.S. Pat. No. 4,683,195
[0780] U.S. Pat. No. 4,683,202
[0781] U.S. Pat. No. 4,800,159
[0782] U.S. Pat. No. 4,883,750
[0783] U.S. Pat. No. 5,262,311
[0784] U.S. Pat. No. 5,279,721
[0785] Van Cauter, et al., Diabetes, 41:368-377, 1992.
[0786] Vaxillaire, et al., Nature Genetics, 9:418-423, 1995
[0787] Wade, et al., J. Biol. Chem., 269:19757-19765, 1994.
[0788] Wagner et al., Science, 260:1510-1513, 1993.
[0789] Wagner et al., Science, 260:1510-1513, 1990.
[0790] Wagner, et al. Nature 378, 690-697 (1995)
[0791] Walker et al., Proc. Nat'l Acad. Sci. USA 89:392-396
1992.
[0792] Wanke et al., JBC 1991, 6068-6072
[0793] Ward, et al., Diabetes, 37:723-729, 1988.
[0794] Watson et al., Cancer Res., 54: 4598-4602, 1994.
[0795] Weeks, et al., Am. J. Hum. Genet., 47:A204, 1990.
[0796] Welsh et al., Nucleic Acids Res., 20: 4965-4970, 1992.
[0797] WHO Study Group on Diabetes Mellitus, Technical Report
Series 727, World Health Organization, Geneva, 1985.
[0798] Wigler et al., Cell, 11: 223, 1977.
[0799] Wigler et al., Proc. Nat'l Acad. Sci. USA, 77: 3567,
1980.
[0800] Winter and Perucho, Proc. Nat'l Acad. Sci USA, 82:7575-7579
(1985).
[0801] WO 90/07641 filed Dec. 21, 1990
[0802] Wong et al., Gene, 10:87-94, 1980.
[0803] Wong et al., Int. J. Oncol., 3: 13-17, 1993.
[0804] Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993.
[0805] Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993.
[0806] Wu and Wu, Biochemistry, 27:887-892, 1988.
[0807] Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987.
[0808] Wu et al., Genomics, 4: 560, 1989.
[0809] Xanthopoulos, et al., Proc. Natl. Acad. Sci. U.S.A. 88,
3807-3811 (1991).
[0810] Yamagata, et al., Nature, 384:458-460, 1996a.
[0811] Yamagata, et al., Nature, 384:455-458, 1996b.
[0812] Yang et al., Proc. Nat'l Acad. Sci. USA, 87:9568-9572,
1990.
[0813] Zhang, et al., Molec. Cell. Biol. 14, 4311-4323 (1994).
[0814] Zhong, et al., Mol. Cell. Biol., 14:7276-7284, 1994.
Sequence CWU 1
1
* * * * *
References