U.S. patent application number 10/078113 was filed with the patent office on 2003-11-27 for interleukin-3 (il-3) multiple mutation polypeptides.
Invention is credited to Abrams, Mark Allen, Bauer, S. Christopher, Braford-Goldberg, Sarah Ruth, Caparon, Maire Helena, Easton, Alan Michael, Klein, Barbara Kure, McKearn, John Patrick, Olins, Peter, Paik, Kumnan, Thomas, John Warren.
Application Number | 20030220472 10/078113 |
Document ID | / |
Family ID | 25528061 |
Filed Date | 2003-11-27 |
United States Patent
Application |
20030220472 |
Kind Code |
A1 |
Bauer, S. Christopher ; et
al. |
November 27, 2003 |
Interleukin-3 (IL-3) multiple mutation polypeptides
Abstract
The present invention relates to recombinant human interleukin-3
(hIL-3) variant or mutant proteins (muteins). These hIL-3 muteins
contain amino acid substitutions and may also have amino acid
deletions at both the N- and C- termini. The invention also relates
to pharmaceutical compositions containing the hIL-3 muteins and
methods for using them. Additionally, the present invention relates
to recombinant expression vectors comprising nucleotide sequences
encoding the hIL-3 muteins, related microbial expression systems,
and processes for making the hIL-3 muteins using the microbial
expression systems. Included in the present invention are deletion
mutants of hIL-3 in which from 1 to 14 amino acids have been
deleted from the N-terminus, and from 1 to 15 amino acids 119 to
133 have been deleted from the C-terminus, and which also contain
amino acid substitutions in the polypeptide. These hIL-3 multiple
mutation polypeptides may have biological activities similar to or
better than hIL-3 and, in some cases, may also have an improved
side effect profile.
Inventors: |
Bauer, S. Christopher; (New
Haven, MO) ; Abrams, Mark Allen; (St. Louis, MO)
; Braford-Goldberg, Sarah Ruth; (St. Louis, MO) ;
Caparon, Maire Helena; (Chesterfield, MO) ; Easton,
Alan Michael; (Maryland Heights, MO) ; Klein, Barbara
Kure; (Town ?amp; Country, MO) ; McKearn, John
Patrick; (Glencoe, MO) ; Olins, Peter;
(Glencoe, MO) ; Paik, Kumnan; (Ballwin, MO)
; Thomas, John Warren; (Town ?amp; Country, MO) |
Correspondence
Address: |
Carol M. Nielsen
GARDERE WYNNE SEWELL LLP
Suite 3000
1601 Elm Street
Dallas
TX
75201-4761
US
|
Family ID: |
25528061 |
Appl. No.: |
10/078113 |
Filed: |
February 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10078113 |
Feb 19, 2002 |
|
|
|
08469419 |
Jun 6, 1995 |
|
|
|
08469419 |
Jun 6, 1995 |
|
|
|
08411795 |
Apr 6, 1995 |
|
|
|
5604116 |
|
|
|
|
08411795 |
Apr 6, 1995 |
|
|
|
PCT/US93/11197 |
Nov 22, 1993 |
|
|
|
PCT/US93/11197 |
Nov 22, 1993 |
|
|
|
07981044 |
Nov 24, 1992 |
|
|
|
Current U.S.
Class: |
530/350 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 2319/02 20130101; C07K 14/5403 20130101; A61P 7/00 20180101;
C07K 2319/00 20130101; Y10S 930/141 20130101; A61P 43/00
20180101 |
Class at
Publication: |
530/350 |
International
Class: |
C07K 001/00; C07K
014/00; C07K 017/00 |
Claims
What is claimed is:
1. A human interleukin-3 mutant polypeptide Formula I:
79 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:15] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at
position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys; Xaa at
position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at
position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr,
Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His,
Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val,
Ala, Leu, Gly, Trp, Lys, Phe, Leu, Ser, or Arg; Xaa at position 24
is Ile, Gly, Val, Arg, Ser, Phe, or Leu; Xaa at position 25 is Thr,
His, Gly, Gln, Arg, Pro, or Ala; Xaa at position 26 is His, Thr,
Phe, Gly, Arg, Ala, or Trp; Xaa at position 27 is Leu, Gly, Arg,
Thr, Ser, or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly,
Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or
Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu,
or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu; Xaa at
position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala,
Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro,
Gln, or Val; Xaa at position 36 is Asp, Leu, or Val; Xaa at
position 37 is Phe, Ser, Pro, Trp, or Ile; Xaa at position 38 is
Asn, or Ala; Xaa at position 40 is Leu, Trp, or Arg; Xaa at
position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro; Xaa at
position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu,
Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr,
Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position
44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or
Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys,
Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46
is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile,
Val or Gly; Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or
His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu,
Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg,
Ala, Gly, Pro, Asn, His, or Asp; Xaa at position 50 is Glu, Leu,
Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at
position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met; Xaa
at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His,
Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr,
Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys; Xaa at
position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa at position 60
is Ala, Ser, Pro, Tyr, Asn, or Thr; Xaa at position 61 is Phe, Asn,
Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is Asn His, Val,
Arg, Pro, Thr, Asp, or Ile; Xaa at position 63 is Arg, Tyr, Trp,
Lys, Ser, His, Pro, or Val; Xaa at position 64 is Ala, Asn, Pro,
Ser, or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or
Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or
His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or
His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly,
or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala; Xaa
at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or
Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or
Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or
Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa
at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or
Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly,
or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu; Xaa at
position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg; Xaa at
position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp; Xaa at
position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg; Xaa at
position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys; Xaa at
position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr,
Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro,
Ala, Thr, Trp, Arg, or Met; Xaa at position 84 is Cys, Glu, Gly,
Arg, Met, or Val; Xaa at position 85 is Leu, Asn, Val, or Gln; Xaa
at position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa at position 87 is
Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala, Lys, Arg, Val, or
Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn,
or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or
Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or
His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly,
Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala,
Leu, or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val,
Gln, Lys, His, Ala, or Pro; Xaa at position 95 is His, Gln, Pro,
Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at
position 97 is Ile, Val, Lys, Ala, or Asn; Xaa at position 98 is
His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val,
Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp,
Val, Pro, Gln, Gly, Ser, Phe, or His; Xaa at position 100 is Lys,
Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro; Xaa at position 101 is
Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly,
Ile, Leu, or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Ser,
Tyr, or Pro; Xaa at position 103 is Asp, or Ser; Xaa at position
104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe,
or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 106 is Glu, Ser,
Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at position 108 is Arg, Lys,
Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109
is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly; Xaa at position 110
is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, Ala, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met; Xaa at position
112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe; Xaa at position
113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val
or Asn; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or
Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr,
Trp, or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp,
Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile; Xaa
at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro; Xaa at
position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr; Xaa at
position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg; Xaa at
position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln; Xaa at
position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at
position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr,
or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr,
or Leu; and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3.
2. A human interleukin-3 mutant polypeptide of the Formula II:
80 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:16] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Leu
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa
Xaa Glu Xaa Xaa 35 40 45 Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Asn Leu Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa
Cys Xaa Pro Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein Xaa at position 17 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at
position 19 is Met, Phe, Ile, Arg, or Ala; Xaa at position 20 is
Ile or Pro; Xaa at position 21 is Asp or Glu; Xaa at position 23 is
Ile, Val, Ala, Leu, or Gly; Xaa at position 24 is Ile, Val, Phe, or
Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Phe, Gly, Arg, or Ala; Xaa at position
28 is Lys, Leu, Gln, Gly, Pro, or Val; Xaa at position 29 is Gln,
Asn, Leu, Arg, or Val; Xaa at position 30 is Pro, His, Thr, Gly, or
Gln; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 33 is Pro, Leu, Gln, Ala, or Glu; Xaa at position 34 is
Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at
position 36 is Asp or Leu; Xaa at position 37 is Phe, Ser, Pro,
Trp, or Ile; Xaa at position 38 is Asn or Ala; Xaa at position 41
is Asn, Cys, Arg, His, Met, or Pro; Xaa at position 42 is Gly, Asp,
Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr, Val or Arg; Xaa at position
44 is Asp or Glu; Xaa at position 45 is Gln, Val, Met, Leu, Thr,
Lys, Ala, Asn, Glu, Ser, or Trp; Xaa at position 46 is Asp, Phe,
Ser, Thr, Cys, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Gly;
Xaa at position 47 is Ile, Val, or His; Xaa at position 49 is Met,
Asn, or Asp; Xaa at position 50 is Glu, Thr, Ala, Asn, Ser or Asp;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 52 is Asn or Gly; Xaa at position 53 is Leu, Met, or Phe;
Xaa at position 54 is Arg, Ala, or Ser; Xaa at position 55 is Arg,
Thr, Val, Leu, or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser,
Gln, Ala, Arg, Asn, Glu, His, Leu, Thr, Val or Lys; Xaa at position
59 is Glu, Tyr, His, Leu, or Arg; Xaa at position 60 is Ala, Ser,
Asn, or Thr; Xaa at position 61 is Phe or Ser; Xaa at position 62
is Asn, Val, Pro, Thr, or Ile; Xaa at position 63 is Arg, Tyr, Lys,
Ser, His, or Val; Xaa at position 64 is Ala or Asn; Xaa at position
65 is Val, Thr, Leu, or Ser; Xaa at position 66 is Lys, Ile, Arg,
Val, Asn, Glu, or Ser; Xaa at position 67 is Ser, Phe, Val, Gly,
Asn, Ile, or His; Xaa at position 68 is Leu, Val, Ile, Phe, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at
position 70 is Asn or Pro; Xaa at position 71 is Ala, Met, Pro,
Arg, Glu, Thr, or Gln; Xaa at position 72 is Ser, Glu, Met, Ala,
His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu,
Ser, Gly, Thr, Arg, or Pro; Xaa at position 74 is Ile or Met; Xaa
at position 75 is Glu, Gly, Asp, Ser, or Gln; Xaa at position 76 is
Ser, Val, Ala, Asn, Glu, Pro, Gly, or Asp; Xaa at position 77 is
Ile, Ser, or Leu; Xaa at position 79 is Lys, Thr, Gly, Asn, Met,
Arg, Ile, Gly, or Asp; Xaa at position 80 is Asn, Val, Gly, Thr,
Leu, Glu, or Arg; Xaa at position 81 is Leu, or Val; Xaa at
position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Met,
Phe, Ser, Thr, Tyr or Val; Xaa at position 83 is Pro, Ala, Thr,
Trp, or Met; Xaa at position 85 is Leu or Val; Xaa at position 87
is Leu or Ser; Xaa at position 88 is Ala, Arg, or Trp; Xaa at
position 89 is Thr, Asp, Glu, His, Asn, or Ser; Xaa at position 90
is Ala, Asp, or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe,
Leu, or Asp; Xaa at position 92 is Pro or Ser; Xaa at position 93
is Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 95 is His,
Pro, Arg, Val, Leu, Gly, Asn, Ile, Phe, Ser or Thr; Xaa at position
96 is Pro or Tyr; Xaa at position 97 is Ile, Val, or Ala; Xaa at
position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Leu, Arg, Gln,
Glu, Lys, Met, Ser, Tyr, Val or Pro; Xaa at position 99 is Ile,
Leu, Val, or Phe; Xaa at position 100 is Lys, Leu, His, Arg, Ile,
Gln, Pro, or Ser; Xaa at position 101 is Asp, Pro, Met, Lys, His,
Thr, Val, Asn, Ile, Leu or Tyr; Xaa at position 102 is Gly, Glu,
Lys, or Ser; Xaa at position 104 is Trp, Val, Tyr, Met, or Leu; Xaa
at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu,
Lys, Ile, Asp, or His; Xaa at position 106 is Glu, Ser, Ala, or
Gly; Xaa at position 108 is Arg, Ala, Gln, Ser or Lys; Xaa at
position 109 is Arg, Thr, Glu, Leu, Ser, or Gly; Xaa at position
112 is Thr, Val, Gln, Glu, His, or Ser; Xaa at position 114 is Tyr
or Trp; Xaa at position 115 is Leu or Ala; Xaa at position 116 is
Lys, Thr, Met, Val, Trp, Ser, Leu, Ala, Asn, Gln, His, Met, Phe,
Tyr or Ile; Xaa at position 117 is Thr, Ser, or Asn; Xaa at
position 119 is Glu, Ser, Pro, Leu, Thr, or Tyr; Xaa at position
120 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position 121 is Ala,
Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln,
Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys; Xaa at
position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu; and
which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 44 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133) human interleukin-3.
3. A human interleukin-3 mutant polypeptide according to claim 2 of
the Formula III:
81 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:17] 1 5 10 15 Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu Xaa 50 55 60 Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein Xaa at position 17 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 18 is Asn, His, or Ile; Xaa at position 19 is Met or Ile;
Xaa at position 21 is Asp or Glu; Xaa at position 23 is Ile, Ala,
Leu, or Gly; Xaa at position 24 is Ile, Val, or Leu; Xaa at
position 25 is Thr, His, Gln, or Ala; Xaa at position 26 is His or
Ala; Xaa at position 29 is Gln, Asn, or Val; Xaa at position 30 is
Pro, Gly, or Gln; Xaa at position 31 is Pro, Asp, Gly, or Gln; Xaa
at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 33 is Pro or Glu; Xaa at position 34 is Leu, Val, Gly,
Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met; Xaa at position
35 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at position 37 is Phe,
Ser, Pro, or Trp; Xaa at position 38 is Asn or Ala; Xaa at position
42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg; Xaa
at position 44 is Asp or Glu; Xaa at position 45 is Gln, Val, Met,
Leu, Thr, Ala, Asn, Glu, Ser or Lys; Xaa at position 46 is Asp,
Phe, Ser, Thr, Ala, Asn Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp; Xaa at position 51
is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at position 54 is Arg
or Ala; Xaa at position 55 is Arg, Thr, Val, Leu, or Gly; Xaa at
position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr,
Val or Lys; Xaa at position 60 is Ala or Ser; Xaa at position 62 is
Asn, Pro, Thr, or Ile; Xaa at position 63 is Arg or Lys; Xaa at
position 64 is Ala or Asn; Xaa at position 65 is Val or Thr; Xaa at
position 66 is Lys or Arg; Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His; Xaa at position 69 is
Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at position 71 is Ala,
Pro, or Arg; Xaa at position 72 is Ser, Glu, Arg, or Asp; Xaa at
position 73 is Ala or Leu; Xaa at position 76 is Ser, Val, Ala,
Asn, Glu, Pro, or Gly; Xaa at position 77 is Ile or Leu; Xaa at
position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa
at position 80 is Asn, Gly, Glu, or Arg; Xaa at position 82 is Leu,
Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 83 is Pro or Thr; Xaa at position 85 is
Leu or Val; Xaa at position 87 is Leu or Ser; Xaa at position 88 is
Ala or Trp; Xaa at position 91 is Ala or Pro; Xaa at position 93 is
Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 95 is His,
Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 96
is Pro or Tyr; Xaa at position 97 is Ile or Val; Xaa at position 98
is His, Ile, Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 99 is Ile, Leu, or Val; Xaa at
position 100 is Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position
101 is Asp, Pro, Met, Lys, His, Thr, Pro, Asn, Ile, Leu or Tyr; Xaa
at position 104 is Trp or Leu; Xaa at position 105 is Asn, Pro,
Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at
position 106 is Glu or Gly; Xaa at position 108 is Arg, Ala, or
Ser; Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser; Xaa at
position 112 is Thr, Val, or Gln; Xaa at position 114 is Tyr or
Trp; Xaa at position 115 is Leu or Ala; Xaa at position 116 is Lys,
Thr, Val, Trp, Ser, Ala, His, Met, Phe, Tyr or Ile; Xaa at position
117 is Thr or Ser; Xaa at position 120 is Asn, Pro, Leu, His, Val,
or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or
Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His,
Ile, Tyr, or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser,
Pro, Tyr, or Leu; and which can additionally have Met- preceding
the amino acid in position 1; and wherein from 1 to 14 amino acids
can be deleted from the N-terminus and/or from 1 to 15 amino acids
can be deleted from the C-terminus; and wherein from 4 to 35 of the
amino acids designated by Xaa are different from the corresponding
amino acids of native (1-133) human interleukin-3.
4. A human interieukin-3 mutant polypeptide according to claim 3 of
the Formula IV:
82 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:18] 1 5 10 15 Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu Ala 50 55 60 Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp Xaa 95 100 105 Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
wherein Xaa at position 17 is Ser, Gly, Asp, or Gln; Xaa at
position 18 is Asn, His, or Ile; Xaa at position 23 is Ile, Ala,
Leu, or Gly; Xaa at position 25 is Thr, His, or Gln; Xaa at
position 26 is His or Ala; Xaa at position 29 is Gln or Asn; Xaa at
position 30 is Pro or Gly; Xaa at position 32 is Leu, Arg, Asn, or
Ala; Xaa at position 34 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile,
Phe, Thr, or Met; Xaa at position 35 is Leu, Ala, Asn, or Pro; Xaa
at position 38 is Asn or Ala; Xaa at position 42 is Gly, Asp, Ser,
Ala, Asn, Ile, Leu, Met, Tyr or Arg; Xaa at position 45 is Gln,
Val, Met, Leu, Ala, Asn, Glu, or Lys; Xaa at position 46 is Asp,
Phe, Ser, Gln, Glu, His, Val or Thr; Xaa at position 50 is Glu Asn,
Ser or Asp; Xaa at position 51 is Asn, Arg, Pro, Thr, or His; Xaa
at position 55 is Arg, Leu, or Gly; Xaa at position 56 is Pro, Gly,
Ser, Ala, Asn, Val, Leu or Gln; Xaa at position 62 is Asn, Pro, or
Thr; Xaa at position 64 is Ala or Asn; Xaa at position 65 is Val or
Thr; Xaa at position 67 is Ser or Phe; Xaa at position 68 is Leu or
Phe; Xaa at position 69 is Gln, Ala, Glu, or Arg; Xaa at position
76 is Ser, Val, Asn, Pro, or Gly; Xaa at position 77 is Ile or Leu;
Xaa at position 79 is Lys, Gly, Asn, Met, Arg, Ile, or Gly; Xaa at
position 80 is Asn, Gly, Glu, or Arg; Xaa at position 82 is Leu,
Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 87 is Leu or Ser; Xaa at position 88 is Ala or Trp;
Xaa at position 91 is Ala or Pro; Xaa at position 93 is Thr, Asp,
or Ala; Xaa at position 95 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr; Xaa at position 98 is His, Ile, Asn, Ala, Thr, Gln, Glu, Lys,
Met, Ser, Tyr, Val or Leu; Xaa at position 99 is Ile or Leu; Xaa at
position 100 is Lys or Arg; Xaa at position 101 is Asp, Pro, Met,
Lys, Thr, His, Pro, Asn, Ile, Leu or Tyr; Xaa at position 105 is
Asn, Pro, Ser, Ile or Asp; Xaa at position 108 is Arg, Ala, or Ser;
Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser; Xaa at position
112 is Thr or Gln; Xaa at position 116 is Lys, Val, Trp, Ala, His,
Phe, Tyr or Ile; Xaa at position 117 is Thr or Ser; Xaa at position
120 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position 121 is Ala,
Ser, Ile, Pro, or Asp; Xaa at position 122 is Gln, Met, Trp, Phe,
Pro, His, Ile, or Tyr; Xaa at position 123 is Ala, Met, Glu, Ser,
or Leu; and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3.
5. The human interleukin-3 mutant polypeptide of claim 1 wherein
1-15 amino acids are deleted from the C-terminus and/or 1-14 amino
acids are deleted from the N-terminus.
6. The human interleukin-3 mutant polypeptide of claim 1 wherein;
Xaa at position 42 is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
Xaa at position 45 is Gln, Val, Met or Asn; Xaa at position 46 is
Asp, Ser, Gln, His or Val; Xaa at position 50 is Glu or Asp; Xaa at
position 51 is Asn, Pro or Thr; Xaa at position 62 is Asn or Pro;
Xaa at position 76 is Ser, or Pro; Xaa at position 82 is Leu, Trp,
Asp, Asn Glu, His, Phe, Ser or Tyr; Xaa at position 95 is His, Arg,
Thr, Asn or Ser; Xaa at position 98 is His, Ile, Leu, Ala, Gln,
Lys, Met, Ser, Tyr or Val; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, His, Asn, Ile or Leu; Xaa at position
105 is Asn, or Pro; Xaa at position 108 is Arg, Ala, or Ser; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, or Tyr; Xaa at
position 121 is Ala, or Ile; Xaa at position 122 is Gln, or Ile;
and Xaa at position 123 is Ala, Met or Glu.
7. A (15-125) human interleukin-3 mutant polypeptide of the Formula
V:
83 Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa [SEQ
ID NO:19] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
wherein Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at
position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys; Xaa at position
6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position 7 is
Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa
at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu,
Val, or Gly; Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp,
Lys, Phe, Leu, Ser, or Arg; Xaa at position 10 is Ile, Gly, Val,
Arg, Ser, Phe, or Leu; Xaa at position 11 is Thr, His, Gly, Gln,
Arg, Pro, or Ala; Xaa at position 12 is His, Thr, Phe, Gly, Arg,
Ala, or Trp; Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa
at position 15 is Gln, Asn, Leu, Pro, Arg, or Val; Xaa at position
16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa at
position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at
position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro, Leu, Gln, Ala, Thr, or Glu; Xaa at position 20
is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or
Met; Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val; Xaa at position 23 is Phe,
Ser, Pro, Trp, or Ile; Xaa at position 24 is Asn, or Ala; Xaa at
position 26 is Leu, Trp, or Arg; Xaa at position 27 is Asn, Cys,
Arg, Leu, His, Met, Pro; Xaa at position 28 is Gly, Asp, Ser, Cys,
Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met; Xaa at
position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg,
Thr, Gly or Ser; Xaa at position 30 is Asp, Ser, Leu, Arg, Lys,
Thr,Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 31 is Gln,
Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile,
Glu, His or Trp; Xaa at position 32 is Asp, Phe, Ser, Thr, Cys,
Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position
33 is Ile, Gly, Val, Ser, Arg, Pro, or His; Xaa at position 34 is
Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or
Asn; Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or
Asp; Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser,
Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 37 is Asn,
Arg, Met, Pro, Ser, Thr, or His; Xaa at position 38 is Asn, His,
Arg, Leu, Gly, Ser, or Thr; Xaa at position 39 is Leu, Thr, Ala,
Gly, Glu, Pro, Lys, Ser, Met, or; Xaa at position 40 is Arg, Asp,
Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position
41 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 42 is Pro,
Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or
Lys; Xaa at position 43 is Asn or Gly; Xaa at position 44 is Leu,
Ser, Asp, Arg, Gln, Val, or Cys; Xaa at position 45 is Glu Tyr,
His, Leu, Pro, or Arg; Xaa at position 46 is Ala, Ser, Pro, Tyr,
Asn, or Thr; Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or
Ser; Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or
Ile; Xaa at position 49 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or
Val; Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys; Xaa at
position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser; Xaa at
position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa
at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His; Xaa at
position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu; Xaa
at position 56 is Asn, Leu, Val, Trp, Pro, or Ala; Xaa at position
57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at
position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp; Xaa at
position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at
position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position
61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu; Xaa at
position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp; Xaa
at position 63 is Ile, Ser, Arg, Thr, or Leu; Xaa at position 64 is
Leu, Ala, Ser, Glu, Phe, Gly, or Arg; Xaa at position 65 is Lys,
Thr, Gly, Asn, Met, Arg, Ile, or Asp; Xaa at position 66 is Asn,
Trp, Val, Gly, Thr, Leu, Glu, or Arg; Xaa at position 67 is Leu,
Gln, Gly, Ala, Trp, Arg, Val, or Lys; Xaa at position 68 is Leu,
Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe,
Ile, Met or Val; Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or
Met; Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val; Xaa at
position 71 is Leu, Asn, Val, or Gln; Xaa at position 72 is Pro,
Cys, Arg, Ala, or Lys; Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp; Xaa at position
75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser; Xaa at
position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met; Xaa at
position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His,
Ala or Pro; Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu,
Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position
82 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 83 is Ile,
Val, Lys, Ala, or Asn; Xaa at position 84 is His, Ile, Asn, Leu,
Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser,
Phe, or His; Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile,
Ser, Gln, Pro; Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr,
Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position
88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 89 is
Asp, or Ser; Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met,
Pro, Leu, Gln, Lys, Ala, Phe, or Gly; Xaa at position 91 is Asn,
Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa
at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or
Pro; Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu,
Ser, Ala or Trp; Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys,
Leu, Ile, Val or Asn; Xaa at position 100 is Tyr, Cys, His, Ser,
Trp, Arg, or Leu; Xaa at position 101 is Leu, Asn, Val, Pro, Arg,
Ala, His, Thr, Trp, or Met; Xaa at position 102 is Lys, Leu, Pro,
Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe,
Gln, or Ile; Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys,
or Pro; Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp,
or Tyr; Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr,
or Arg; Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or
Gln; Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly; Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His,
Ile, Tyr, or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser,
Pro, Tyr, or Leu; and which can additionally have Met- or Met-Ala-
preceding the amino acid in position 1; and wherein from 4 to 44 of
the amino acids designated by Xaa are different from the
corresponding native amino acids of (1-133) human interleukin-3; or
a polypeptide having substantially the same structure and
substantially the same biological activity.
8. A (15-125) human interleukin-3 mutant polypeptide of the Formula
VI:
84 Asn Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Leu Xaa Xaa [SEQ
ID NO:20] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa
Xaa Glu Xaa 20 25 30 Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Asn Leu Xaa 35 40 45 Xaa Xaa Xea Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa
Cys Xaa Pro Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
wherein Xaa at position 3 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at position
5 is Met, Phe, Ile, Arg, or Ala; Xaa at position 6 is Ile or Pro;
Xaa at position 7 is Asp, or Glu; Xaa at position 9 is Ile, Val,
Ala, Leu, or Gly; Xaa at position 10 is Ile, Val, Phe, or Leu; Xaa
at position 11 is Thr, His, Gly, Gln, Arg, Pro, or Ala; Xaa at
position 12 is His, Phe, Gly, Arg, or Ala; Xaa at position 14 is
Lys, Leu, Gln, Gly, Pro, or Val; Xaa at position 15 is Gln, Asn,
Leu, Arg, or Val; Xaa at position 16 is Pro, His, Thr, Gly, or Gln;
Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at
position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro, Leu, Gln, Ala, or Glu; Xaa at position 20 is
Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met;
Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at
position 22 is Asp or Leu; Xaa at position 23 is Phe, Ser, Pro,
Trp, or Ile; Xaa at position 24 is Asn or Ala; Xaa at position 27
is Asn, Cys, Arg, His, Met, or Pro; Xaa at position 28 is Gly, Asp,
Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr, or Arg; Xaa at position 30
is Asp, or Glu; Xaa at position 31 is Gln, Val, Met, Leu, Thr, Lys,
Ala, Asn Glu, Ser or Trp; Xaa at position 32 is Asp, Phe, Ser, Thr,
Cys, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Gly; Xaa at
position 33 is Ile, Val, or His; Xaa at position 35 is Met, Asn, or
Asp; Xaa at position 36 is Glu, Thr, Ala, Asn, Ser or Asp; Xaa at
position 37 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 38 is Asn or Gly; Xaa at position 39 is Leu, Met, or Phe;
Xaa at position 40 is Arg, Ala or Ser; Xaa at position 41 is Arg,
Thr, Val, Leu, or Gly; Xaa at position 42 is Pro, Gly, Cys, Ser,
Gln, Ala, Arg, Asn, Glu, His, Leu, Thr, Val or Lys; Xaa at position
45 is Glu, Tyr, His, Leu, or Arg; Xaa at position 46 is Ala, Ser,
Asn, or Thr; Xaa at position 47 is Phe or Ser; Xaa at position 48
is Asn, Val, Pro, Thr, or Ile; Xaa at position 49 is Arg, Tyr, Lys,
Ser, His, or Val; Xaa at position 50 is Ala or Asn; Xaa at position
51 is Val, Thr, Leu, or Ser; Xaa at position 52 is Lys, Ile, Arg,
Val, Asn, Glu, or Ser; Xaa at position 53 is Ser, Phe, Val, Gly,
Asn, Ile, or His; Xaa at position 54 is Leu, Val, Ile, Phe, or His;
Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at
position 56 is Asn or Pro; Xaa at position 57 is Ala, Met, Pro,
Arg, Glu, Thr, or Gln; Xaa at position 58 is Ser, Glu, Met, Ala,
His, Asn, Arg, or Asp; Xaa at position 59 is Ala, Glu, Asp, Leu,
Ser, Gly, Thr, Arg, or Pro; Xaa at position 60 is Ile or Met; Xaa
at position 61 is Glu, Gly, Asp, Ser, or Gln; Xaa at position 62 is
Ser, Val, Ala, Asn, Glu, Pro, Gly, or Asp; Xaa at position 63 is
Ile, Ser, or Leu; Xaa at position 65 is Lys, Thr, Gly, Asn, Met,
Arg, Ile, or Asp; Xaa at position 66 is Asn, Val, Gly, Thr, Leu,
Glu, or Arg; Xaa at position 67 is Leu, or Val; Xaa at position 68
is Leu, Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 69 is Pro, Ala, Thr, Trp, or Met; Xaa
at position 71 is Leu or Val; Xaa at position 73 is Leu or Ser; Xaa
at position 74 is Ala, Arg, or Trp; Xaa at position 75 is Thr, Asp,
Glu, His, Asn, or Ser; Xaa at position 76 is Ala, Asp, or Met; Xaa
at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, or Asp; Xaa at
position 78 is Pro or Ser; Xaa at position 79 is Thr, Asp, Ser,
Pro, Ala, Leu, or Arg; Xaa at position 81 is His, Pro, Arg, Val,
Leu, Gly, Asn, Ile, Phe, Ser or Thr; Xaa at position 82 is Pro or
Tyr; Xaa at position 83 is Ile, Val, or Ala; Xaa at position 84 is
His, Ile, Asn, Leu, Asp, Ala, Thr, Arg, Gln, Glu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 85 is Ile, Leu, Val, or Phe; Xaa
at position 86 is Lys, Leu, His, Arg, Ile, Gln, Pro or Ser; Xaa at
position 87 is Asp, Pro, Met, Lys, His, Thr, Val, Asn, Ile, Leu or
Tyr; Xaa at position 88 is Gly, Glu, Lys, or Ser; Xaa at position
90 is Trp, Val, Tyr, Met, or Leu; Xaa at position 91 is Asn, Pro,
Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at
position 92 is Glu, Ser, Ala, or Gly; Xaa at position 94 is Arg,
Ala, Gln, Ser or Lys; Xaa at position 95 is Arg, Thr, Glu, Leu,
Ser, or Gly; Xaa at position 98 is Thr, Val, Gln, Glu, His, or Ser;
Xaa at position 100 is Tyr or Trp; Xaa at position 101 is Leu or
Ala; Xaa at position 102 is Lys, Thr, Met, Val, Trp, Ser, Leu, Ala,
Asn, Gln, His, Met, Phe, Tyr or Ile; Xaa at position 103 is Thr,
Ser, or Asn; Xaa at position 105 is Glu, Ser, Pro, Leu, Thr, or
Tyr; Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln; Xaa at
position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at
position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr,
or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr,
or Leu; and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3; or a polypeptide
having substantially the same structure and substantially the same
biological activity.
9. A (15-125) human interleukin-3 mutant polypeptide according to
claim 7 of the Formula VII:
85 Asn Cys Xaa Xaa Xaa Ile Xaa Gln Xaa Xaa Xaa Xaa Leu Lys Xaa [SEQ
ID NO:21] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Gln 35 40 45 Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile 50 55 60 Gln Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
wherein Xaa at position 3 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu; Xaa at position 9 is Ile, Ala,
Leu, or Gly; Xaa at position 10 is Ile, Val, or Leu; Xaa at
position 11 is Thr, His, Gln, or Ala; Xaa at position 12 is His or
Ala; Xaa at position 15 is Gln, Asn, or Val; Xaa at position 16 is
Pro, Gly, or Gln; Xaa at position 17 is Pro, Asp, Gly, or Gln; Xaa
at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro or Glu; Xaa at position 20 is Leu, Val, Gly,
Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met; Xaa at position
21 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at position 23 is Phe,
Ser, Pro, or Trp; Xaa at position 24 is Asn or Ala; Xaa at position
28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg; Xaa
at position 30 is Asp or Glu; Xaa at position 31 is Gln, Val, Met,
Leu, Thr, Ala, Asn, Glu, Ser or Lys; Xaa at position 32 is Asp,
Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp; Xaa at position 37
is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at position 40 is Arg
or Ala; Xaa at position 41 is Arg, Thr, Val, Leu, or Gly; Xaa at
position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr,
Val or Lys; Xaa at position 46 is Ala or Ser; Xaa at position 48 is
Asn, Pro, Thr, or Ile; Xaa at position 49 is Arg or Lys; Xaa at
position 50 is Ala or Asn; Xaa at position 51 is Val or Thr; Xaa at
position 52 is Lys or Arg; Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His; Xaa at position 55 is
Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at position 57 is Ala,
Pro, or Arg; Xaa at position 58 is Ser, Glu, Arg, or Asp; Xaa at
position 59 is Ala or Leu; Xaa at position 62 is Ser, Val, Ala,
Asn, Glu, Pro, or Gly; Xaa at position 63 is Ile or Leu; Xaa at
position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa
at position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 69 is Pro or Thr; Xaa at position 71 is
Leu or Val; Xaa at position 73 is Leu or Ser; Xaa at position 74 is
Ala or Trp; Xaa at position 77 is Ala or Pro; Xaa at position 79 is
Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 81 is His,
Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 82
is Pro or Tyr; Xaa at position 83 is Ile or Val; Xaa at position 84
is His, Ile, Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 85 is Ile, Leu, or Val; Xaa at
position 86 is Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position 87
is Asp, Pro, Met, Lys, His, Thr, Asn, Ile, Leu or Tyr; Xaa at
position 90 is Trp or Leu; Xaa at position 91 is Asn, Pro, Ala,
Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 92
is Glu, or Gly; Xaa at position 94 is Arg, Ala, or Ser; Xaa at
position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position 98 is
Thr, Val, or Gln; Xaa at position 100 is Tyr or Trp; Xaa at
position 101 is Leu or Ala; Xaa at position 102 is Lys, Thr, Val,
Trp, Ser, Ala, His, Met, Phe, Tyr or Ile; Xaa at position 103 is
Thr or Ser; Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly; Xaa at
position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr,
or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr,
or Leu; which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 35 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native human interleukin-3.
10. A (15-125) human interieukin-3 mutant polypeptide according to
claim 7 of the Formula VIII:
86 Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa [SEQ
ID NO:22] 1 5 10 15 Xaa Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Gln Asp 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Gln 35 40 45 Ala Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp 80 85 90 Xaa Gln Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Gln 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
wherein Xaa at position 3 is Ser, Gly, Asp, or Gln; Xaa at position
4 is Asn, His, or Ile; Xaa at position 9 is Ile, Ala, Leu, or Gly;
Xaa at position 11 is Thr, His, or Gln; Xaa at position 12 is His
or Ala; Xaa at position 15 is Gln or Asn; Xaa at position 16 is Pro
or Gly; Xaa at position 18 is Leu, Arg, Asn, or Ala; Xaa at
position 20 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile, Phe, Thr or
Met; Xaa at position 21 is Leu, Ala, Asn, or Pro; Xaa at position
24 is Asn or Ala; Xaa at position 28 is Gly, Asp, Ser, Ala, Asn,
Ile, Leu, Met, Tyr or Arg; Xaa at position 31 is Gln, Val, Met,
Leu, Ala, Asn, Glu or Lys; Xaa at position 32 is Asp, Phe, Ser,
Ala, Gln, Glu, His, Val or Thr; Xaa at position 36 is Gln, Asn, Ser
or Asp; Xaa at position 37 is Asn, Arg, Pro, Thr, or His; Xaa at
position 41 is Arg, Leu, or Gly; Xaa at position 42 is Pro, Gly,
Ser, Ala, Asn, Val, Leu or Gln; Xaa at position 48 is Asn, Pro, or
Thr; Xaa at position 50 is Ala or Asn; Xaa at position 51 is Val or
Thr; Xaa at position 53 is Ser or Phe; Xaa at position 54 is Leu or
Phe; Xaa at position 55 is Gln, Ala, Glu, or Arg; Xaa at position
62 is Ser, Val, Asn, Pro, or Gly; Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Asn, Met, Arg, Ile, or Gly; Xaa at
position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 73 is Leu or Ser; Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro; Xaa at position 79 is Thr, Asp,
or Ala; Xaa at position 81 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr; Xaa at position 84 is His, Ile, Asn, Ala, Thr, Arg, Gln, Glu,
Lys, Met, Ser, Tyr, Val or Leu; Xaa at position 85 is Ile or Leu;
Xaa at position 86 is Lys or Arg; Xaa at position 87 is Asp, Pro,
Met, Lys, His, Pro, Asn, Ile, Leu or Tyr; Xaa at position 91 is
Asn, Pro, Ser, Ile or Asp; Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position
98 is Thr or Gln; Xaa at position 102 is Lys, Val, Trp, or Ile; Xaa
at position 103 is Thr, Ala, His, Phe, Tyr or Ser; Xaa at position
106 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position 107 is Ala,
Ser, Ile, Pro, or Asp; Xaa at position 108 is Gln, Met, Trp, Phe,
Pro, His, Ile, or Tyr; Xaa at position 109 is Ala, Met, Glu, Ser,
or Leu; and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 26 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3; or a polypeptide
having substantially the same structure and substantially the same
biological activity.
11. A (15-125) human interleukin-3 mutant polypeptide of claim 7
wherein: Xaa at position 17 is Ser, Lys, Asp, Met, Gln, or Arg; Xaa
at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at
position 19 is Met, Arg, Gly, Ala, or Cys; Xaa at position 20 is
Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp,
Phe, Lys, Arg, Ala, Gly, or Val; Xaa at position 22 is Glu, Trp,
Pro, Ser, Ala, His, or Gly; Xaa at position 23 is Ile, Ala, Gly,
Trp, Lys, Leu, Ser, or Arg; Xaa at position 24 is Ile, Gly, Arg, or
Ser; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln,
Asn, Loh, Pro, Arg, or Val; Xaa at position 30 is Pro, His, Thr,
Gly, Asp, Gln, Ser, Leu, or Lys; Xaa at position 31 is Pro, Asp,
Gly, Arg, Leu, or Gln; Xaa at position 32 is Leu, Arg, Gln, Asn,
Gly, Ala, or Glu; Xaa at position 33 is Pro, Leu, Gln, Thr, or Glu;
Xaa at position 34 is Leu, Gly, Ser, or Lys; Xaa at position 35 is
Leu, Ala, Gly, Asn, Pro, or Gln; Xaa at position 36 is Asp, Leu, or
Val; Xaa at position 37 is Phe, Ser, or Pro; Xaa at position 38 is
Asn, or Ala; Xaa at position 40 is Leu, Trp, or Arg; Xaa at
position 41 is Asn, Cys, Arg, Leu, His, Met, Pro; Xaa at position
42 is Gly, Asp, Ser, Cys, or Ala; Xaa at position 42 is Glu, Asn,
Tyr, Leu, Phe, Asp, Ala, Cys, or Ser; Xaa at position 44 is Asp,
Ser, Leu, Arg, Lys, Thr, Met, Trp, or Pro; Xaa at position 45 is
Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, or Trp; Xaa at position 46
is Asp, Phe, Ser, Thr, Cys, or Gly; Xaa at position 47 is Ile, Gly,
Ser, Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg,
His, Phe, or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro,
Asn, His, or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, or Tyr;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at
position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or; Xaa at
position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, or Leu; Xaa at
position 55 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 56
is Pro, Gly, Cys, Ser, Gln, or Lys; Xaa at position 57 is Asn or
Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa at
position 60 is Ala, Ser, Tyr, Asn, or Thr; Xaa at position 61 is
Phe, Asn, Gln, Pro, Lys, Arg, or Ser; Xaa at position 62 is Asn
His, Val, Arg, Pro, Thr, or Ile; Xaa at position 63 is Arg, Tyr,
Trp, Ser, Pro, or Val; Xaa at position 64 is Ala, Asn, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 66 is Lys, Ile, Val, Asn, Gln, or Ser; Xaa at position 67
is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa at position
68 is Leu, Val, Trp, Ser, Thr, or His; Xaa at position 69 is Gln,
Ala, Pro, Thr, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn,
Leu, Val, Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu,
Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu,
Met, Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Gln,
Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, or Leu; Xaa at position 76 is Ser, Val, Ala, Asn,
Trp, Gln, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser, Arg, or
Thr; Xaa at position 78 is Leu, Ala, Ser, Glu, Gly, or Arg; Xaa at
position 79 is Lys, Thr, Gly, Asn, Met, Ile, or Asp; Xaa at
position 80 is Asn, Trp, Val, Gly, Thr, Leu, or Arg; Xaa at
position 81 is Leu, Gln, Gly, Ala, Trp, Arg, or Lys; Xaa at
position 82 is Leu, Gln, Lys, Trp, Arg, or Asp; Xaa at position 83
is Pro, Thr, Trp, Arg, or Met; Xaa at position 84 is Cys, Gln, Gly,
Arg, Met, or Val; Xaa at position 85 is Leu, Asn, or Gln; Xaa at
position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa at position 87 is
Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala, Lys, Arg, Val, or
Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, or
Asn; Xaa at position 90 is Ala, Ser, Asp, Ile, or Met; Xaa at
position 91 is Ala, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 92 is Pro, Phe, Arg, Ser, Lys, His, or Leu; Xaa at
position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at
position 94 is Arg, Ile, Ser, Glu, Leu, Val, or Pro; Xaa at
position 95 is His, Gln, Pro, Val, Leu, Thr or Tyr; Xaa at position
96 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile,
Lys, Ala, or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp,
Ala, Thr, or Pro; Xaa at position 99 is Ile, Arg, Asp, Pro, Gln,
Gly, Phe, or His; Xaa at position 100 is Lys, Tyr, Leu, His, Ile,
Ser, Gln, or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His,
Thr, Val, Tyr, or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys,
Ser, Tyr, or Pro; Xaa at position 103 is Asp, or Ser; Xaa at
position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys,
Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser,
Trp, Gln, Tyr, Leu, Lys, Ile, or His; Xaa at position 106 is Glu,
Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at position 108 is Arg,
Asp, Leu, Thr, Ile, or Pro; Xaa at position 109 is Arg, Thr, Pro,
Glu, Tyr, Leu, Ser, or Gly.
12. The human interleukin-3 mutant polypetide of claim 7: wherein;
Xaa at position 28 is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
Xaa at position 31 is Gln, Val, Met or Asn; Xaa at position 32 is
Asp, Ser, Ala, Gln, His or Val; Xaa at position 36 is Glu or Asp;
Xaa at position 37 is Asn, Pro or Thr; Xaa at position 48 is Asn or
Pro; Xaa at position 62 is Ser, or Pro; Xaa at position 68 is Leu,
Trp, Asp, Asn Glu, His, Phe, Ser or Tyr; Xaa at position 81 is His,
Arg, Thr, Asn or Ser; Xaa at position 84 is His, Ile, Leu, Ala,
Arg, Gln, Lys, Met, Ser, Tyr or Val; Xaa at position 86 is Lys or
Arg; Xaa at position 87 is Asp, Pro, His, Asn, Ile or Leu; Xaa at
position 91 is Asn, or Pro; Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 102 is Lys, Val, Trp, Ala, His, Phe, or Tyr; Xaa at
position 107 is Ala, or Ile; Xaa at position 108 is Gln, or Ile;
and Xaa at position 109 is Ala, Met or Glu.
13. A polypeptide of the formula
87 1 5 10 (Met).sub.m-Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr
[SEQ ID NO:29] 15 20 Ser Trp Val Asn Cys Ser Xaa Xaa Xaa Asp Gln
Ile Ile 25 30 35 Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa Leu Asp
Xaa 40 45 50 Xaa Asn Leu Asn Xaa Gln Asp Xaa Asp Ile Leu Xaa Glu 55
60 Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa Xaa 65 70 75 Ala
Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Gln Xaa 80 85 Ile Leu Xaa
Asn Leu Xaa Pro Cys Xaa Pro Xaa Xaa Thr 90 95 100 Ala Xaa Pro Xaa
Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 105 110 115 Asp Trp Xaa Glu Phe
Arg Xaa Lys Leu Xaa Phe Tyr Leu 120 125 Xaa Xaa Leu Glu Xaa Ala Gln
Xaa Gln Gln Thr Thr Leu 130 Ser Leu Ala Ile Phe
wherein m is 0 or 1; Xaa at position 18 is Asn or Ile; Xaa at
position 19 is Met, Ala or Ile; Xaa at position 20 is Ile, Pro or
Ile; Xaa at position 23 is Ile, Ala or Leu; Xaa at position 25 is
Thr or His; Xaa at position 29 is Gln, Arg, Val or Ile; Xaa at
position 32 is Leu, Ala, Asn or Arg; Xaa at position 34 is Leu or
Ser; Xaa at position 37 is Phe, Pro, or Ser; Xaa at position 38 is
Asn or Ala; Xaa at position 42 is Gly, Ala, Ser, Asp or Asn; Xaa at
position 45 is Gln, Val, or Met; Xaa at position 46 is Asp or Ser;
Xaa at position 49 is Met, Ile, Leu or Asp; Xaa at position 50 is
Glu or Asp; Xaa at position 51 is Asn Arg or Ser; Xaa at position
55 is Arg, Leu, or Thr; Xaa at position 56 is Pro or Ser; Xaa at
position 59 is Glu or Leu; Xaa at position 60 is Ala or Ser; Xaa at
position 62 is Asn, Val or Pro; Xaa at position 63 is Arg or His;
Xaa at position 65 is Val or Ser; Xaa at position 67 is Ser, Asn,
His or Gln; Xaa at position 69 is Gln or Glu; Xaa at position 73 is
Ala or Gly; Xaa at position 76 is Ser, Ala or Pro; Xaa at position
79 is Lys, Arg or Ser; Xaa at position 82 is Leu, Glu, Val or Trp;
Xaa at position 85 is Leu or Val; Xaa at position 87 is Leu, Ser,
Tyr; Xaa at position 88 is Ala or Trp; Xaa at position 91 is Ala or
Pro; Xaa at position 93 is Pro or Ser; Xaa at position 95 is His or
Thr; Xaa at position 98 is His, Ile, or Thr; Xaa at position 100 is
Lys or Arg; Xaa at position 101 is Asp, Ala or Met; Xaa at position
105 is Asn or Glu; Xaa at position 109 is Arg, Glu or Leu; Xaa at
position 112 is Thr or Gln; Xaa at position 116 is Lys, Val, Trp or
Ser; Xaa at position 117 is Thr or Ser; Xaa at position 120 is Asn,
Gln, or His; Xaa at position 123 is Ala or Glu; with the proviso
that from four to forty-four of the amino acids designated by Xaa
are different from the corresponding amino acids of native human
interleukin-3; or a polypeptide having substantially the same
structure and substantially the same biological activity.
14. A polypeptide according to claim 13 wherein Xaa at position 18
is Ile; Xaa at position 19 is Ala, or Ile; Xaa at position 20 is
Pro, or Leu; Xaa at position 23 is Ala, or Leu; Xaa at position 25
is His; Xaa at position 29 is Arg, Val, or Ile; Xaa at position 32
is Ala, Asn or Arg; Xaa at position 34 is Ser; Xaa at position 37
is Pro or Ser; Xaa at position 38 is Ala; Xaa at position 42 is
Ala, Ser, Asp, or Asn; and Xaa at position 45 is Val or Met; Xaa at
position 46 is Ser.
15. A polypeptide according to claim 13 wherein Xaa at position 49
is Ile, or Leu, or Asp; Xaa at position 50 is Asp; Xaa at position
51 is Arg or Ser; Xaa at position 55 is Leu or Thr; Xaa at position
56 is Ser; Xaa at position 59 is Glu or Leu; Xaa at position 60 is
Ala or Ser; Xaa at position 62 is Val, or Pro; Xaa at position 63
is His; Xaa at position 65 is Ser; Xaa at position 67 is Asn, or
His, or Gln; and Xaa at position 69 is Glu.
16. A polypeptide according to claim 13 wherein Xaa at position 73
is Gly; Xaa at position 76 is Ala, or Pro; Xaa at position 79 is
Arg, or Ser; Xaa at position 82 is Gln or Val, or Trp; Xaa at
position 85 is Val; Xaa at position 87 is Ser, or Tyr; Xaa at
position 88 is Trp; Xaa at position 91 is Pro; Xaa at position 93
is Ser; Xaa at position 95 is Thr; Xaa at position 98 is Ile or
Thr; Xaa at position 100 is Arg; Xaa at position 101 is Ala, or
Met; and Xaa at position 105 is Glu.
17. A polypeptide according to claim 13 wherein Xaa at position 109
is Glu, or Leu; Xaa at position 112 is Gln; Xaa at position 116 is
Val, or Trp, or Ser; Xaa at position 117 is Ser; Xaa at position
120 is Glu or His; and Xaa at position 123 is Glu.
18. A polypeptide according to claim 13 wherein Xaa at position 18
is Ile; Xaa at position 19 is Ala, or Ile; Xaa at position 20 is
Pro, or Leu; Xaa at position 23 is Ala, or Leu; Xaa at position 25
is His; Xaa at position 29 is Arg or Val, or Ile; Xaa at position
32 is Ala or Asn, or Arg; Xaa at position 34 is Ser; Xaa at
position 37 is Pro or Ser; Xaa at position 38 is Ala; Xaa at
position 42 is Ala or Ser, Asp or Asn; Xaa at position 45 is Val or
Met; Xaa at position 46 is Ser; Xaa at position 49 is Ile, or Leu,
or Asp; Xaa at position 50 is Asp; Xaa at position 51 is Arg, or
Ser; Xaa at position 55 is Leu or Thr; Xaa at position 56 is Ser;
Xaa at position 59 is Glu or Leu; Xaa at position 60 is Ala or Ser;
Xaa at position 62 is Val, or Pro; Xaa at position 63 is His; Xaa
at position 65 is Ser; Xaa at position 67 is Asn, or His, or Gln;
and Xaa at position 69 is Glu.
19. A polypeptide according to claim 13 wherein Xaa at position 73
is Gly; Xaa at position 76 is Ala, or Pro; Xaa at position 79 is
Arg, or Ser; Xaa at position 82 is Gln or Val, or Trp; Xaa at
position 85 is Val; Xaa at position 87 is Ser, or Tyr; Xaa at
position 88 is Trp; Xaa at position 91 is Pro; Xaa at position 93
is Ser; Xaa at position 95 is Thr; Xaa at position 98 is Ile or
Thr; Xaa at position 100 is Arg; Xaa at position 101 is Ala, or
Met; Xaa at position 105 is Glu; Xaa at position 109 is Glu, or
Leu; Xaa at position 112 is Gln; Xaa at position 116 is Val, or
Trp, or Ser; Xaa at position 117 is Ser; Xaa at position 120 is Glu
or His; and Xaa at position 123 is Glu.
20. A polypeptide of the formula
88 1 5 10 (Met.sub.m-Ala.sub.n).sub.pAsn Cys Ser Xaa Xaa Xaa Asp
Glu Xaa Ile [SEQ ID NO: 130] 15 20 Xaa His Leu Lys Xaa Pro Pro Xaa
Pro Xaa Leu Asp Xaa 25 30 35 Xaa Asn Leu Asn Xaa Gln Asp Xaa Xaa
Ile Leu Xaa Gln 40 45 Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe
Xaa Xaa 50 55 60 Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu
Xaa 65 70 75 Ile Leu Xaa Asn Xaa Xaa Pro Cys Xaa Pro Xaa Ala Thr 80
85 Ala Xaa Pro Xaa Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 90 95 100
Asp Trp Xaa Glu Phe Arg Xaa Lys Leu Xaa Phe Tyr Leu 105 110 Xaa Xaa
Leu Glu Xaa Ala Gln Xaa Gln Gln
wherein m is 0 or 1; n is 0 or 1; p is 0 or 1; Xaa at position 4 is
Asn or Ile; Xaa at position 5 is Met, Ala or Ile: Xaa at position 6
is Ile, Pro or Leu; Xaa at position 9 is Ile, Ala or Leu; Xaa at
position 11 is Thr or His; Xaa at position 15 is Gln, Arg, Val or
Ile; Xaa at position 18 is Leu, Ala, Asn or Arg; Xaa at position 20
is Leu or Ser; Xaa at position 23 is Phe, Pro, or Ser; Xaa at
position 24 is Asn or Ala; Xaa at position 28 is Gly, Ala, Ser, Asp
or Asn; Xaa at position 31 is Gln, Val, or Met; Xaa at position 32
is Asp or Ser; Xaa at position 35 is Met, Ile or Asp; Xaa at
position 36 is Glu or Asp; Xaa at position 37 is Asn, Arg or Ser;
Xaa at position 41 is Arg, Leu, or Thr; Xaa at position 42 is Pro
or Ser; Xaa at position 45 is Glu or Leu; Xaa at position 46 is Ala
or Ser; Xaa at position 48 is Asn, Val or Pro; Xaa at position 49
is Arg or His; Xaa at position 51 is Val or Ser; Xaa at position 53
is Ser, Asn, His or Gln; Xaa at position 55 is Gln or Glu; Xaa at
position 59 is Ala or Gly; Xaa at position 62 is Ser, Ala or Pro;
Xaa at position 65 is Lys, Arg or Ser; Xaa at position 67 is Leu,
Glu, or Val; Xaa at position 68 is Leu, Glu, Val or Trp; Xaa at
position 71 is Leu or Val; Xaa at position 73 is Leu, Ser or Tyr;
Xaa at position 74 is Ala or Trp; Xaa at position 77 is Ala or Pro;
Xaa at position 79 is Pro or Ser; Xaa at position 81 is His or Thr;
Xaa at position 84 is His, Ile, or Thr; Xaa at position 86 is Lys
or Arg; Xaa at position 87 is Asp, Ala or Met; Xaa at position 91
is Asn or Glu; Xaa at position 95 is Arg, Glu, Leu; Xaa at position
98 Thr or Gln; Xaa at position 102 is Lys, Val, Trp or Ser; Xaa at
position 103 is Thr or Ser; Xaa at position 106 is Asn, Gln, or
His; Xaa at position 109 is Ala or Glu; with the proviso that from
four to forty-four of the amino acids designated by Xaa are
different from the corresponding amino acids of native (15-125)
human interleukin-3; or a polypeptide having substantially the same
structure and substantially the same biological activity.
21. A polypeptide according to claim 20 wherein Xaa at position 4
is Ile; Xaa at position 5 is Ala, or Ile; Xaa at position 6 is Pro,
or Leu; Xaa at position 9 is Ala, or Leu; Xaa at position 11 is
His; Xaa at position 15 is Arg or Val, or Ile; Xaa at position 18
is Ala or Asn, or Arg; Xaa at position 20 is Ser; Xaa at position
23 is Pro or Ser; Xaa at position 24 is Ala; Xaa at position 28 is
Ala or Ser, or Asp, or Asn; Xaa at position 31 is Val or Met; and
Xaa at position 32 is Ser.
22. A polypeptide according to claim 20 wherein Xaa at position 35
is Ile, or Leu, or Asp; Xaa at position 36 is Asp; Xaa at position
37 is Arg, or Ser; Xaa at position 41 is Leu or Thr; Xaa at
position 42 is Ser; Xaa at position 45 is Glu or Leu; Xaa at
position 46 is Ala or Ser; Xaa at position 48 is Val, or Pro; Xaa
at position 49 is His; Xaa at position 51 is Ser; Xaa at position
53 is Asn, or His, or Gln; and Xaa at position 55 is Glu.
23. A polypeptide according to claim 20 wherein Xaa at position 59
is Gly; Xaa at position 62 is Ala, or Pro; Xaa at position 65 is
Arg, or Ser; Xaa at position 67 is Gln or Val; Xaa at position 68
is Glu, or Val, or Trp; Xaa at position 71 is Val; Xaa at position
73 is Ser, or Tyr; Xaa at position 74 is Trp; Xaa at position 77 is
Pro; Xaa at position 79 is Ser; Xaa at position 81 is Thr; Xaa at
position 84 is Ile or Thr; Xaa at position 86 is Arg; Xaa at
position 87 is Ala, or Met; and Xaa at position 91 is Glu.
24. A polypeptide according to claim 20 wherein Xaa at position 95
is Glu, or Leu; Xaa at position 98 ia Gln; Xaa at position 102 is
Val, or Trp, or Ser; Xaa at position 103 is Ser; Xaa at position
106 is Glu or His; and Xaa at position 109 is Glu.
25. A polypeptide according to claim 20 wherein Xaa at position 4
is Ile; Xaa at position 5 is Ala, or Ile; Xaa at position 6 is Pro,
or Leu; Xaa at position 9 is Ala, or Leu; Xaa at position 11 is
His; Xaa at position 15 is Arg or Val, or Ile; Xaa at position 18
is Ala or Asn, or Arg; Xaa at position 20 is Ser; Xaa at position
23 is Pro or Ser; Xaa at position 24 is Ala; Xaa at position 28 is
Ala or Ser, or Asp, or Asn; Xaa at position 31 is Val or Met; Xaa
at position 32 is Ser; Xaa at position 35 is Ile, or Leu, or Asp;
Xaa at position 36 is Asp; Xaa at position 37 is Arg, or Ser; Xaa
at position 41 is Leu or Thr; Xaa at position 42 is Ser; Xaa at
position 45 is Glu or Leu; Xaa at position 46 is Ala or Ser; Xaa at
position 48 is Val, or Pro; Xaa at position 49 is His; Xaa at
position 51 is Ser; Xaa at position 53 is Asn, or His, or Gln; and
Xaa at position 55 is Glu.
26. A polypeptide according to claim 20 wherein Xaa at position 59
is Gly; Xaa at position 62 is Ala, or Pro; Xaa at position 65 is
Arg, or Ser; Xaa at position 67 is Gln or Val; Xaa at position 68
is Glu, or Val, or Trp; Xaa at position 71 is Val; Xaa at position
73 is Ser, or Tyr; Xaa at position 74 is Trp; Xaa at position 77 is
Pro; Xaa at position 79 is Ser; Xaa at position 81 is Thr; Xaa at
position 84 is Ile or Thr; Xaa at position 86 is Arg; Xaa at
position 87 is Ala, or Met; Xaa at position 91 is Glu; Xaa at
position 95 is Glu, or Lue; Xaa at position 98 is Gln; Xaa at
position 102 is Val, or Trp, or Ser; Xaa at position 103 is Ser;
Xaa at position 106 is Glu or His; and Xaa at position 109 is
Glu.
27. A polypeptide according to claim 20 which is selected from
89 Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu [SEQ ID
NO:66] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala
Gln Asp Val Asp Ile Leu Met Gln Asn Asn Leu Arg Arg Pro Asn Leu Gln
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Gln Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln ; Asn
Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu Lys [SEQ ID NO:67]
Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Gln Asp Met
Asp Ile Leu Met Gln Asn Asn Leu Arg Arg Pro Asn Leu Gln Ala Phe Asn
Arg Ala Vai Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Gln Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Gln Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile
Met Ile Asp Gln Ile Ile His His Leu Lys [SEQ ID NO:68] Val Pro Pro
Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Gln Asp Met Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Alu Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Gb Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu Lys [SEQ ID NO:69] Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu
Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu Lys [SEQ ID NO:70] Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Glu Ser Phe Val Arq Ala Val Lys Asn Leu Glu Asn Ala
Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala
Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn
Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gln Asn Ala Gln
Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
Lys [SEQ ID NO:71] Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Aso Ala Gln Ala Gln
Gln; Asn Cys Ser Asn Met Ile Asp Gln Ile Ile Thr His Leu Lys [SEQ
ID NO:72] Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Gln Asp Gln Asp Ile Leu Met Gln Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn
Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys [SEQ ID NO:73]
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln
Asp Ile Leu Met Gln Asn Asn Leu Arg Arg Pro Aso Leu Gln Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg
Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro
Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Gln Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn
Met Ile Asp Gln Ile Ile Thr His Leu Lys [SEQ ID NO:74] Gln Pro Pro
Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Gln Asp Gln Asp Ile Leu
Met Gln Asn Asn Leu Arg Arg Pro Asn Leu Gln Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Gln Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Gln Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val
Thr Leu Gln Gln Ala Gln Gln Gln Gln; Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu Lys [SEQ ID NO:75] Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Gly Gln Asp Gln Asp Ile Leu Met Glu Asn
Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu
Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Ser Leu Gln
His Ala Gln Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu Lys [SEQ ID NO:76] Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Gln Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Gln Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala Gln
Gln Gln Gln; Asn Cys Ser Asn Met Ile Asp Gln Ile Ile Thr His Leu
Lys [SEQ ID NO:77] Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Gln Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys [SEQ
ID NO:78] Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln; Asn
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys [SEQ ID NO:79]
Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val
Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Gln Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile
Met Ile Asp Gln Ile Ile His His Leu Lys [SEQ ID NO:80] Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Gln Asp Met Asp Ile Leu
Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val
Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Gln Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Gln Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile Met Ile Asp
Gln Ile Ile His His Leu Lys [SEQ ID NO:81] Val Pro Pro Ala Pro Leu
Leu Asp Ser Asn Asn Leu Asn Ser Gln Asp Met Asp Ile Leu Met Gln Arg
Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu
Gln Asn Ala Ser Ala Ile Gln Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu
Asn Ala Gln Ala Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu
Ile Ile Thr His Leu [SEQ ID NO:82] Lys Gln Pro Pro Leu Pro Leu Leu
Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn
Leu Arg Arg Pro Asn Leu Gln Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp
Trp Gln Gln Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln
Ala Gln Glu Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Gln Ile
Ile Thr His Leu [SEQ ID NO:83] Lys Gln Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly Gln Asp Gln Asp Ile Leu Met Gln Asn Asn Leu
Arg Arg Pro Asn Leu Gln Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn
Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp
Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala
Gln Gln Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Gln Ile Ile
Thr His Leu [SEQ ID NO:84] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Gln Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Gln Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln
Gln Gln Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:85] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Gln Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Gln Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Ala Ile Gln Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Gln
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Gln Asn Ala Gln Ala
Gln Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His
Leu [SEQ ID NO:86] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro
Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala
Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe
Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:87] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:88] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu
[SEQ ID NO:89] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Gln Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Gln Phe Arg
Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala Gln Gln Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu
[SEQ ID NO:90] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser Gly Ile
Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu
[SEQ ID NO:91] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Gln Asp Val Asp Ile Leu Met Gln Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser Gly Ile
Gln Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Gln Phe Arg
Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Gys Ser Ile Met Ile Asp Gln Ile Ile His His Leu
[SEQ ID NO:92] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser Gly Ile
Gln Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Gln Phe Arg
Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Gln Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:93] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:94] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp
Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn [SEQ ID NO:95]
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Gln Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala Gln Gln Gln
Gln; and Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His
Leu [SEQ ID NO:96] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ala Gln Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro
Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser Gly
Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Gln His Ala Gln
Gln Gln Gln. Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO.: 296] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro
Asn Asn Leu Asn Ala Gln Asp Val Asp Ile Leu Met Asp Arg Asn Leu Arg
Leu Ser Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Gly Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Gln Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln
Glu Gln Gln. Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His
His Leu [SEQ ID NO.: 300] Lys Arg Pro Pro Ala Pro Ser Leu Asp Pro
Aso Asn Leu Asn Asp Glu Asp Met Ser Ile Leu Met Gln ArgAsn Leu Arg
Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala Gln
Gln Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His
Leu [SEQ ID NO.: 301] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Asp Gln Asp Met Ser Ile Leu Met Gln Arg Asn Leu Arg Leu
Pro Asn Leu Gln Ser Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser
Gly Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Gln
Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Gln
Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO.: 308] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ala Glu Asp Val Asp Ile Leu Met Asp Arg Asn Leu Arg Leu Pro
Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly
Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala
Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln Met Ala Asn Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu
[SEQ ID NO.: 309] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Asp Gln Asp Val Ser Ile Leu Met Gln Arg Asn Leu Arg Leu Pro
Asn Leu Gln Ser Phe Val Arg Ala Val Lys Aso Leu Gln Asn Ala Ser Gly
Ile Gln Ala Ile Leu Arg Aso Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala
Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Gln Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln Met Ala Asa Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO.: 310] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Asp Glu Asp Met Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro
Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asa Ala Ser Gly
Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala
Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Gln Gln
Gln Met Ala Tyr Pro Gln Thr Asp Tyr Lys Asp Asp Asp Asp Lys Asn
[SEQ ID NO. 315] Cys Ser Ile Met Ile Asp Gln Ile Ile His His Leu
Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Gln Asp
Val Asp Ile Leu Met Gln Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe
Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Gln Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Gln Phe Arg Gln Lys Leu Thr
Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Gln Gln Gln Met Ala Tyr Pro
Gln Thr Asp Tyr Lys Asp Asp Asp Asp Lys Asn [SEQ ID NO.: 316] Cys
Ser Ile Met Ile Asp Gln Ile Ile His His Leu Lys Arg Pro Pro Asn Pro
Leu Leu Asp Pro Asn Asn Leu Asn Ser Gln Asp Met Asp Ile Leu Met Gln
Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His
Leu Gln Asn Ala Ser Gly Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys
Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala
Gly Asp Trp Gln Gln Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu
Gln Gln Ala Gln Gln Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Gln
Leu Ile His His Leu [SEQ ID NO.: 318] Lys Ile Pro Pro Asn Pro Ser
Leu Asp Ser Ala Asn Leu Asn Ser Gln Asp Val Ser Ile Leu Met Gln Arg
Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu
Gln Asn Ala Ser Gly Ile Gln Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu
Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly
Asp Trp Gln Glu Phe Arg Gln Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln
Gln Ala Gln Gln Gln Gln.
28. A pharmaceutical composition for the treatment of hematopoietic
cell deficiencies comprising a therapeutically effective amount of
a mutant human interleukin-3 polypeptide selected from the group
consisting of a polypeptide of claim 1, a polypeptide of claim 2, a
polypeptide of claim 3, a polypeptide of claim 4, a polypeptide of
claim 5, a polypeptide of claim 6, a polypeptide of claim 7, a
polypeptide of claim 8, a polypeptide of claim 9, a polypeptide of
claim 10, a polypeptide of claim 11, a polypeptide of claim 12, a
polypeptide of claim 13, a polypeptide of claim 14, a polypeptide
of claim 15, a polypeptide of claim 16, a polypeptide of claim 17;
a polypeptide of claim 18, a polypeptide of claim 19, a polypeptide
of claim 20, a polypeptide of claim 21, a polypeptide of claim 22,
a polypeptide of claim 23, a polypeptide of claim 24, a polypeptide
of claim 25, a polypeptide of claim 26 and a polypeptide of claim
27, and a pharmaceutically acceptable carrier.
29. A pharmaceutical composition according to claim 28 for the
treatment of hematopoietic cell deficiencies comprising a
therapeutically effective amount of a polypeptide having an amino
acid sequence corresponding to SEQ ID NO:88 and a pharmaceutically
acceptable carrier.
30. A pharmaceutical composition according to claim 28 for the
treatment of hematopoietic cell deficiencies comprising a
therapeutically effective amount of a polypeptide having an amino
acid sequence corresponding to SEQ ID NO:89 and a pharmaceutically
acceptable carrier.
31. A pharmaceutical composition according to claim 28 for the
treatment of hematopoietic cell deficiencies comprising a
therapeutically effective amount of a polypeptide having an amino
acid sequence corresponding to SEQ ID NO:90 and a pharmaceutically
acceptable carrier.
32. A pharmaceutical composition according to claim 28 for the
treatment of hematopoietic cell deficiencies comprising a
therapeutically effective amount of a polypeptide selected from the
group consisting of a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:66; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:67; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:68; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:69; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:70; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:71; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:72; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:73; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:74; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:75; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:76; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:77; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:78; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:79; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:80; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:81; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:82; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:83; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:84; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:85; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:86; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:87; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:91; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:92; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:93; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:94; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:95; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:96; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:258; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:259; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:260; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:261; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:262; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:263; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:278; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:279; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:314; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:315; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:316; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:264; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:265; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:266; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:267; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:268; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:269; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:270; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:271; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:272; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:273; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:274; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:275; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:276; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:277; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:280; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:281; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:282; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:283; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:284; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:285; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:286; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:287; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:288; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:289; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:299; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:300; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:301; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:302; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:303; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:304; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:305; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:306; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:307; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:308; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:309; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:310; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:311; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:312; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:313; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:314; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:317; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:318; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:319; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:320; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:321; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:322; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:323; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:324; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:325; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:326; and a pharmaceutically acceptable carrier.
33. A method of stimulating the production of hematopoietic cells
which comprises administering a therapeutically effective amount of
a mutant human interleukin-3 polypeptide selected from the group
consisting of a polypeptide of claim 1, a polypeptide of claim 2, a
polypeptide of claim 3, a polypeptide of claim 4, a polypeptide of
claim 5, a polypeptide of claim 6, a polypeptide of claim 7, a
polypeptide of claim 8, a polypeptide of claim 9, a polypeptide of
claim 10, a polypeptide of claim 11, a polypeptide of claim 12, a
polypeptide of claim 13, a polypeptide of claim 14, a polypeptide
of claim 15, a polypeptide of claim 16, a polypeptide of claim 17;
a polypeptide of claim 18, a polypeptide of claim 19, a polypeptide
of claim 20, a polypeptide of claim 21, a polypeptide of claim 22,
a polypeptide of claim 23, a polypeptide of claim 24, a polypeptide
of claim 25, a polypeptide of claim 26, a polypeptide of claim 27,
to a patient in need of such treatment.
34. A method according to claim 33 of stimulating the production of
hematopoietic cells which comprises administering a therapeutically
effective amount of a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:88.
35. A method according to claim 33 of stimulating the production of
hematopoietic cells which comprises administering a therapeutically
effective amount of a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:89.
36. A method according to claim 33 of stimulating the production of
hematopoietic cells which comprises administering a therapeutically
effective amount of a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:90.
37. A method according to claim 33 of stimulating the production of
hematopoietic cells which comprises administering a therapeutically
effective amount of a polypeptide selected from the group
consisting of a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:66; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:67; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:68; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:69; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:70; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:71; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:72; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:73; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:74; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:75; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:76; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:77; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:78; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:79; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:80; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:81; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:82; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:83; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:84; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:85; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:86; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:87; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:91; a polypeptide having an amino acid sequence corresponding to
SEQ ID NO:92; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:93; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:94; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:95; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:96; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:258; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:259; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:260; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:261; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:262; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:263; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:278; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:279; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:314; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:315; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:316; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:264; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:265; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:266; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:267; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:268; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:269; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:270; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:271; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:272; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:273; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:274; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:275; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:276; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:277; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:280; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:281; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:282; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:283; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:284; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:285; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:286; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:287; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:288; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:289; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:299; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:300; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:301; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:302; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:303; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:304; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:305; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:306; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:307; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:308; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:309; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:310; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:311; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:312; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:313; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:314; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:317; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:318; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:319; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:320; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:321; a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:322; a polypeptide having an amino acid
sequence corresponding to SEQ ID NO:323; a polypeptide having an
amino acid sequence corresponding to SEQ ID NO:324; a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:325; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:326; to a patient in need of such treatment.
38. A recombinant DNA sequence comprising vector DNA and a DNA that
encodes a polypeptide selected from the group consisting of a
polypeptide of claim 1, a polypeptide of claim 2, a polypeptide of
claim 3, a polypeptide of claim 4, a polypeptide of claim 5, a
polypeptide of claim 6, a polypeptide of claim 7, a polypeptide of
claim 8, a polypeptide of claim 9, a polypeptide of claim 10, a
polypeptide of claim 11, a polypeptide of claim 12, a polypeptide
of claim 13, a polypeptide of claim 14, a polypeptide of claim 15,
a polypeptide of claim 16, a polypeptide of claim 17; a polypeptide
of claim 18, a polypeptide of claim 19, a polypeptide of claim 20,
a polypeptide of claim 21, a polypeptide of claim 22, a polypeptide
of claim 23, a polypeptide of claim 24, a polypeptide of claim 25,
a polypeptide of claim 26, or a polypeptide of claim 27.
39. A recombinant DNA sequence according to claim 38 comprising
vector DNA and a DNA having a nucleotide sequence corresponding to
SEQ ID NO:97.
40. A recombinant DNA sequence according to claim 38 comprising
vector DNA and a DNA having a nucleotide sequence corresponding to
SEQ ID NO:100 or 103.
41. A recombinant DNA sequence according to claim 38 comprising
vector DNA and a DNA having a nucleotide sequence corresponding to
SEQ ID NO:161.
42. A recombinant DNA sequence according to claim 38 comprising
vector DNA and a DNA selected from a DNA having a nucleotide
sequence corresponding to SEQ ID NO:98; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:99; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:101; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:102; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:104; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:105; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:106; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:107; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:108; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:109; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:110; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:111; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:112; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:113; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:114; a DNA having a nucleotide
sequence corresponding to SEQ ID NO: 115; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:116; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:117; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:118; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:119; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:120; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:121; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:122; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:123; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:124; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:125; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:126; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:127; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:160; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:161; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:398; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:399; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:346; a DNA having a nucleotide
sequence corresponding to SEQ ID NO:347 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:303 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:404 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:405 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:332 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:333 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:334 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:335 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:336 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:337 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:338 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:339 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:340 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:341 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:342 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:343 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:344 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:345 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:348 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:349 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:350 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:352 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:353 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:354 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:355 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:356 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:357 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:358 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:359 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:360 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:361 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:362 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:363 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:364 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:365 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:366 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:367 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:368 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:369 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:370 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:371 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:372 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:373 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:374 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:375 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:376 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:377 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:378 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:379 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:380 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:381 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:382 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:384 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:385 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:386 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:387 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:388 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:389 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:390 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:391 a DNA having a nucleotide
sequence corresponding to SEQ ID NO:392
43. A host cell containing a recombinant DNA sequence of claim 38
and capable of expressing the encoded polypeptide.
44. A host cell of claim 43 containing a recombinant DNA vector
comprising vector DNA and a DNA having a nucleotide sequence
corresponding to SEQ ID NO:97 and capable of expressing the encoded
polypeptide.
45. A host cell of claim 43 containing a recombinant DNA vector
comprising vector DNA and a DNA having a nucleotide sequence
corresponding to SEQ ID NO:100 or 103 and capable of expressing the
encoded polypeptide.
46. A host cell of claim 43 containing a recombinant DNA vector
comprising vector DNA and a DNA having a nucleotide sequence
corresponding to SEQ ID NO:161 and capable of expressing the
encoded polypeptide.
47. A method of producing a mutant human interleukin-3 polypeptide
comprising the steps of: (a) culturing a host cell containing a
recombinant DNA sequence comprising vector DNA and a DNA sequence
of claim 38 and capable of expressing the encoded polypeptide under
conditions permitting expression of the recombinant DNA; and (b)
harvesting the polypeptide from the culture.
48. A method according to claim 47 of producing a mutant human
interleukin-3 polypeptide comprising the steps of: (a) culturing a
host cell containing a recombinant DNA sequence comprising vector
DNA and a DNA having a nucleotide sequence corresponding to SEQ ID
NO:97 and capable of expressing the encoded polypeptide under
conditions permitting expression of the recombinant DNA; and (b)
harvesting the polypeptide from the culture.
49. A method according to claim 47 of producing a mutant human
interleukin-3 polypeptide comprising the steps of: (a) culturing a
host cell containing a recombinant DNA sequence comprising vector
DNA and a DNA having a nucleotide sequence corresponding to SEQ ID
NO:100 or 103 and capable of expressing the encoded polypeptide
under conditions permitting expression of the recombinant DNA; and
(b) harvesting the polypeptide from the culture.
50. A method according to claim 47 of producing a mutant human
interleukin-3 polypeptide comprising the steps of: (a) culturing a
host cell containing a recombinant DNA sequence comprising vector
DNA and a DNA having a nucleotide sequence corresponding to SEQ ID
NO:161 and capable of expressing the encoded polypeptide under
conditions permitting expression of the recombinant DNA; and (b)
harvesting the polypeptide from the culture.
51. A vector containing a gene having a DNA sequence selected from
the group consisting of: a DNA having a nucleotide sequence
corresponding to SEQ ID NO:97; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:100; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:103; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:160; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:161; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:404; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:405; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:364; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:368; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:369; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:376; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:377; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:378; a DNA having a nucleotide sequence
corresponding to SEQ ID NO:385;
52. A recombinant DNA vector comprising a promoter, a ribosome
binding site, and a signal peptide directly linked to a DNA
sequence encoding a polypeptide selected from the group consisting
of a polypeptide having an amino acid sequence corresponding to SEQ
ID NO:88; a polypeptide having an amino acid sequence corresponding
to SEQ ID NO:89; and a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:90; said vector being capable of
directing expression of said mutant human interleukin-3
polypeptide.
53. A recombinant DNA vector according to claim 51 wherein the
promoter is AraBAD.
54. A recombinant DNA vector according to claim 51 wherein the
ribosome binding site is g10-L.
55. A recombinant DNA vector according to claim 51 wherein the
signal peptide is a lamB signal peptide.
56. A recombinant DNA vector according to claim 51 wherein the
signal peptide is the lamB signal peptide depicted in FIG. 8.
57. A recombinant DNA vector according to claim 51 wherein the
promoter is AraBAD and the ribosome binding site is g10-L.
58. A recombinant DNA vector according to claim 51 wherein the
promoter is AraBAD, the ribosome binding site is g10-L, and the
signal peptide is a lamB signal peptide.
59. A recombinant DNA vector according to claim 51 wherein the
promoter is AraBAD, the ribosome binding site is g10-L, and the
signal peptide is the lamB signal peptide depicted in FIG. 8.
60. A recombinant bacterial host which comprises the vector of
claim 51 wherein said host secretes a mutant human interleukin-3
polypeptide selected from the group consisting of a polypeptide
having an amino acid sequence corresponding to SEQ ID NO:88; a
polypeptide having an amino acid sequence corresponding to SEQ ID
NO:89; and a polypeptide having an amino acid sequence
corresponding to SEQ ID NO:90.
61. A polypeptide of the formula
90 1 5 10 [SEQ ID NO:129] (Met).sub.m-Ala Pro Met Thr Gln Thr Thr
Ser Leu Lys Thr 15 20 Ser Trp Val Asn Cys Ser Xaa Met Ile Asp Glu
Ile Ile 25 30 35 Xaa His Leu Lys Xaa Pro Pro Xaa Pro Leu Leu Asp
Xaa 40 45 50 Asn Asn Leu Asn Xaa Glu Asp Xaa Asp Ile Leu Met Glu 55
60 Xaa Asn Leu Arg Xaa Pro Asn Leu Xaa Xaa Phe Xaa Arg 65 70 75 Ala
Val Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 80 85 Ile Leu Xaa
Asn Leu Xaa Pro Cys Leu Pro Xaa Ala Thr 90 95 100 Ala Ala Pro Xaa
Arg His Pro Ile Xaa Ile Lys Xaa Gly 105 110 115 Asp Trp Xaa Glu Phe
Arg Xaa Lys Leu Thr Phe Tyr Leu 120 125 Xaa Thr Leu Glu Xaa Ala Gln
Xaa Gln Gln Thr Thr Leu 130 Ser Leu Ala Ile Phe
wherein m is 0 or 1; Xaa at position 18 is Asn or Ile; Xaa at
position 25 is Thr or His; Xaa at position 29 is Gln, Arg, or Val;
Xaa at position 32 is Leu, Ala, or Asn; Xaa at position 37 is Phe,
Pro, or Ser; Xaa at position 42 is Glu, Ala, or Ser; Xaa at
position 45 is Gln, Val, or Met; Xaa at position 51 is Asn or Arg;
Xaa at position 55 is Arg, Leu, or Thr; Xaa at position 59 is Glu
or Leu; Xaa at position 60 is Ala or Ser; Xaa at position 62 is Asn
or Val; Xaa at position 67 is Ser, Asn, or His; Xaa at position 69
is Gln or Glu; Xaa at position 73 is Ala or Gly; Xaa at position 76
is Ser or Ala; Xaa at position 79 is Lys or Arg; Xaa at position 82
is Leu, Glu, or Val; Xaa at position 87 is Leu or Ser; Xaa at
position 93 is Pro or Ser; Xaa at position 98 is His, Ile, or Thr;
Xaa at position 101 is Asp or Ala; Xaa at position 105 is Asn or
Glu; Xaa at position 109 is Arg or Glu; Xaa at position 116 is Lys
or Val; Xaa at position 120 is Asn, Gln, or His; Xaa at position
123 is Ala or Glu; with the proviso that from four to twenty-seven
of the amino acids designated by Xaa are different from the
corresponding amino acids of native human interleukin-3 and wherein
from 1 to 14 of amino acids 1 to 14 has been deleted from the
N-terminus and/or from 1 to 15 of amino acids 119 to 133 has been
deleted from the C-terminus of the polypeptide; or a polypeptide
having substantially the same structure and substantially the same
biological activity.
62. A method according to claim 47 of producing a mutant human
interleukin-3 polypeptide comprising the steps of: (a) culturing a
host cell containing a recombinant DNA sequence comprising vector
DNA and a DNA having a nucleotide sequence corresponding to SEQ ID
NO:160 and capable of expressing the encoded polypeptide under
conditions permitting expression of the recombinant DNA; and (b)
harvesting the polypeptide from the culture.
63. A method according to claim 47 of producing a mutant human
interleukin-3 polypeptide comprising the steps of: (a) culturing a
host cell containing a recombinant DNA sequence comprising vector
DNA and a DNA having a nucleotide sequence corresponding to SEQ ID
NO:161 and capable of expressing the encoded polypeptide under
conditions permitting expression of the recombinant DNA; and (b)
harvesting the polypeptide from the culture.
64. A host cell containing a recombinant DNA vector comprising
vector DNA and a DNA sequence selected from the group consisting
of: a DNA having a nucleotide sequence corresponding to SEQ ID
NO:160; and a DNA having a nucleotide sequence corresponding to SEQ
ID NO:161; and capable of expressing the encoded polypeptide.
65. A polypeptide according to claim 27 which is:
91 [SEQ ID NO:89] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu
Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu
Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln.
INTERLEUKIN-3 (IL-3) MULTIPLE MUTATION POLYPEPTIDES
Description
[0001] This is a continuation-in-part of U.S. application Ser. No.
07/981,044 filed Nov. 24, 1992 which is incorporated herein by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates to mutants or variants of
human interleukin-3 (hIL-3) which contain multiple amino acid
substitutions and which may have portions of the native hIL-3
molecule deleted. These hIL-3 multiple mutation polypeptides retain
one or more activities of native hIL-3 and may also show improved
hematopoietic cell-stimulating activity and/or an improved activity
profile which may include reduction of undesirable biological
activities associated with native hIL-3.
BACKGROUND OF THE INVENTION
[0003] Colony stimulating factors (CSFs) which stimulate the
differentiation and/or proliferation of bone marrow cells have
generated much interest because of their therapeutic potential for
restoring depressed levels of hematopoietic stem cell-derived
cells. CSFs in both human and murine systems have been identified
and distinguished according to their activities. For example,
granulocyte-CSF (G-CSF) and macrophage-CSF (M-CSF) stimulate the in
vitro formation of neutrophilic granulocyte and macrophage
colonies, respectively while GM-CSF and interleukin-3 (IL-3) have
broader activities and stimulate the formation of both macrophage,
neutrophilic and eosinophilic granulocyte colonies. IL-3 also
stimulates the formation of mast, megakaryocyte and pure and mixed
erythroid colonies.
[0004] Because of its ability to stimulate the proliferation of a
number of different cell types and to support the growth and
proliferation of progenitor cells, IL-3 has potential for
therapeutic use in restoring hematopoietic cells to normal amounts
in those cases where the number of cells has been reduced due to
diseases or to therapeutic treatments such as radiation and
chemotherapy.
[0005] Interleukin-3 (IL-3) is a hematopoietic growth factor which
has the property of being able to promote the survival, growth and
differentiation of hematopoietic cells. Among the biological
properties of IL-3 are the ability (a) to support the growth and
differentiation of progenitor cells committed to all, or virtually
all, blood cell lineages; (b) to interact with early multipotential
stem cells; (c) to sustain the growth of pluripotent precursor
cells; (d) to stimulate proliferation of chronic myelogenous
leukemia (CML) cells; (e) to stimulate proliferation of mast cells,
eosinophils and basophils; (f) to stimulate DNA synthesis by human
acute myelogenous leukemia (AML) cells; (g) to prime cells for
production of leukotrienes and histamines; (h) to induce leukocyte
chemotaxis; and (i) to induce cell surface molecules needed for
leukocyte adhesion.
[0006] Mature human interleukin-3 (hIL-3) consists of 133 amino
acids. It has one disulfide bridge and two potential glycosylation
sites (Yang, et al., CELL 47:3 (1986)).
[0007] Murine IL-3 (mIL-3) was first identified by Ihle, et al., J.
IMMUNOL. 126:2184 (1981) as a factor which induced expression of a
T cell associated enzyme, 20_-hydroxysteroid dehydrogenase. The
factor was purified to homogeneity and shown to regulate the growth
and differentiation of numerous subclasses of early hematopoietic
and lymphoid progenitor cells.
[0008] In 1984, cDNA clones coding for murine IL-3 were isolated
(Fung, et al., NATURE 307:233 (1984) and Yokota, et al., PROC.
NATL. ACAD. SCI. USA 81:1070 (1984)). The murine DNA sequence coded
for a polypeptide of 166 amino acids including a putative signal
peptide.
[0009] The gibbon IL-3 sequence was obtained using a gibbon cDNA
expression library. The gibbon IL-3 sequence was then used as a
probe against a human genomic library to obtain a human IL-3
sequence.
[0010] Gibbon and human genomic DNA homologues of the murine IL-3
sequence were disclosed by Yang, et al., CELL 47:3 (1986). The
human sequence reported by Yang, et al. included a serine residue
at position 8 of the mature protein sequence. Following this
finding, others reported isolation of Pro.sup.8 hIL-3 cDNAs having
proline at position 8 of the protein sequence. Thus it appears that
there may be two allelic forms of hIL-3.
[0011] Dorssers, et al., GENE 55:115 (1987), found a clone from a
human cDNA library which hybridized with mIL-3. This hybridization
was the result of the high degree of homology between the 3'
noncoding regions of mIL-3 and hIL-3. This cDNA coded for an hIL-3
(Pro.sup.8) sequence.
[0012] U.S. Pat. No. 4,877,729 and U.S. Pat. No. 4,959,454 disclose
human IL-3 and gibbon IL-3 cDNAs and the protein sequences for
which they code. The hIL-3 disclosed has serine rather than proline
at position 8 in the protein sequence.
[0013] Clark-Lewis, et al., SCIENCE 231:134 (1986) performed a
functional analysis of murine IL-3 analogues synthesized with an
automated peptide synthesizer. The authors concluded that the
stable tertiary structure of the complete molecule was required for
full activity. A study on the role of the disulfide bridges showed
that replacement of all four cysteines by alanine gave a molecule
with {fraction (1/500)}th the activity as the native molecule.
Replacement of two of the four Cys residues by Ala(Cys.sup.79,
Cys.sup.140->Ala.sup.79, Ala.sup.140) resulted in an increased
activity. The authors concluded that in murine IL-3 a single
disulfide bridge is required between cysteines 17 and 80 to get
biological activity that approximates physiological levels and that
this structure probably stabilizes the tertiary structure of the
protein to give a conformation that is optimal for function.
(Clark-Lewis, et al., PROC. NATL. ACAD. SCI. USA 85:7897
(1988)).
[0014] International Patent Application (PCT) WO 88/00598 discloses
gibbon- and human-like IL-3. The hIL-3 contains a
Ser.sup.8->Pro.sup.8 replacement. Suggestions are made to
replace Cys by Ser, thereby breaking the disulfide bridge, and to
replace one or more amino acids at the glycosylation sites.
[0015] EP-A-0275598 (WO 88/04691) illustrates that Ala.sup.1 can be
deleted while retaining biological activity. Some mutant hIL-3
sequences are provided, e.g., two double mutants,
Ala.sup.1->Asp.sup.1, Trpl.sup.3->Arg.sup.13 (pGB/IL-302) and
Ala.sup.1->Asp.sup.1, Met.sup.3->Thr.sup.3 (pGB/IL-304) and
one triple mutant Ala.sup.1->Asp.sup.1, Leu.sup.9->Pro.sup.9,
Trp.sup.13->Arg.sup.- 13 (pGB/IL-303).
[0016] WO 88/05469 describes how deglycosylation mutants can be
obtained and suggests mutants of Arg.sup.54Arg.sup.55 and
Arg.sup.108Arg.sup.109Ly- s.sup.110 might avoid proteolysis upon
expression in Saccharomyces cerevisiae by KEX2 protease. No mutated
proteins are disclosed. Glycosylation and the KEX2 protease
activity are only important, in this context, upon expression in
yeast.
[0017] WO 88/06161 mentions various mutants which theoretically may
be conformationally and antigenically neutral. The only actually
performed mutations are Met.sup.2->Ile.sup.2 and
Ile.sup.131->Leu.sup.131. It is not disclosed whether the
contemplated neutralities were obtained for these two
mutations.
[0018] WO 91/00350 discloses nonglycosylated hIL-3 analog proteins,
for example, hIL-3 (Pro.sup.8Asp.sup.15Asp.sup.70), Met.sup.3
rhul-3 (Pro.sup.8Asp.sup.15Asp.sup.70); Thr.sup.4 rhuL-3
(Pro.sup.8Asp.sup.15Asp- .sup.70)and Thr.sup.6 rhuIL-3
(Pro.sup.8Asp.sup.15Asp.sup.70). It is said that these protein
compositions do not exhibit certain adverse side effects associated
with native hIL-3 such as urticaria resulting from infiltration of
mast cells and lymphocytes into the dermis. The disclosed analog
hIL-3 proteins may have N termini at Met.sup.3, Thr.sup.4, or
Thr.sup.6.
[0019] WO 91/12874 discloses cysteine added variants (CAVs) of IL-3
which have at least one Cys residue substituted for a naturally
occurring amino acid residue.
SUMMARY OF THE INVENTION
[0020] The present invention relates to recombinant human
interleukin-3 (hIL-3) variant or mutant proteins (muteins). These
hIL-3 muteins contain amino acid substitutions and may also have
amino acid deletions at either/or both the N- and C- termini.
Preferably, these mutant polypeptides of the present invention
contain four or more amino acids which differ from the amino acids
found at the corresponding positions in the native hIL-3
polypeptide. The invention also relates to pharmaceutical
compositions containing the hIL-3 muteins, DNA coding for the
muteins, and methods for using the muteins. Additionally, the
present invention relates to recombinant expression vectors
comprising nucleotide sequences encoding the hIL-3 muteins, related
microbial expression systems, and processes for making the hIL-3
muteins using the microbial expression systems.
[0021] The present invention includes mutants of hIL-3 in which
from 1 to 14 amino acids have been deleted from the N-terminus
and/or from 1 to 15 amino acids have been deleted from the
C-terminus, and in which multiple amino acid substitutions have
been made. Preferred muteins of the present invention are those in
which amino acids 1 to 14 have been deleted from the N-terminus,
amino acids 126 to 133 have been deleted from the C-terminus, and
which also contain from about four to about twenty-six amino acid
substitutions in the polypeptide sequence. These hIL-3 multiple
mutation polypeptides may have biological activities similar to or
better than hIL-3 and, in some cases, may also have an improved
side effect profile, i.e., some muteins may have a better
therapeutic index than native hIL-3. The present invention also
provides muteins which may function as IL-3 antagonists or as
discrete antigenic fragments for the production of antibodies
useful in immunoassay and immunotherapy protocols. In addition to
the use of the hIL-3 multiple mutation polypeptides of the present
invention in vivo, it is envisioned that in vitro uses would
include the ability to stimulate bone marrow and blood cell
activation and growth before infusion into patients.
[0022] Antagonists of hIL-3 would be particularly useful in
blocking the growth of certain cancer cells like AML, CML and
certain types of B lymphoid cancers. Other conditions where
antagonists would be useful include those in which certain blood
cells are produced at abnormally high numbers or are being
activated by endogenous ligands. Antagonists would effectively
compete for ligands, presumably naturally occurring hemopoietins
including and not limited to IL-3, GM-CSF and IL-5, which might
trigger or augment the growth of cancer cells by virtue of their
ability to bind to the IL-3 receptor complex while intrinsic
activation properties of the ligand are diminished. IL-3, GM-CSF
and/or IL-5 also play a role in certain asthmatic responses. An
antagonist of the IL-3 receptor may have the utility in this
disease by blocking receptor-mediated activation and recruitment of
inflammatory cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 is the human IL-3 gene for E. coli expression
(pMON5873), encoding the polypeptide sequence of natural (wild
type) human IL-3 [SEQ ID NO:128], plus an initiator methionine, as
expressed in E. coli, with the amino acids numbered from the
N-terminus of the natural hIL-3.
[0024] FIG. 2: ClaI to NsiI Replacement Fragment. FIG. 2 shows the
nucleotide sequence of the replacement fragment used between the
ClaT and NsiI sites of the hIL-3 gene. The codon choice used in the
fragment corresponds to that found in highly expressed E. coli
genes (Gouy and Gautier, 1982). Three new unique restriction sites,
EcoRV, XhoI and PstI were introduced for the purpose of inserting
synthetic gene fragments. The portion of the coding sequence shown
encodes hIL-3 amino acids 20-70.
[0025] FIG. 3 shows the nucleotide and amino acid sequence of the
gene in pMON5873 with the sequence extending from NcoI through
HindIII. The codon choices used to encode amino acids 1-14 and
107-133 correspond to that found in highly expressed E. coli
genes.
[0026] FIG. 4 shows the construction of the plasmid vector pMON5846
which encodes [Met-(1-133) hIL-3 (Arg.sup.129)].
[0027] FIG. 5 shows the construction of the plasmid vector pMON5847
(ATCC 68912) which encodes [Met-(1-133) hIL-3 (Arg.sup.129)].
[0028] FIG. 6 shows the construction of plasmid vector pMON5853
which encodes [Met-(15-133) hIL-3 (Arg.sup.129)].
[0029] FIG. 7 shows the construction of the plasmid vector pMON5854
which encodes [Met-(1-133) hIL-3 (Arg.sup.129)].
[0030] FIG. 8 shows the DNA sequence and resulting amino acid
sequence of the LamB signal peptide.
[0031] FIG. 9 shows the construction of the plasmid vector pMON5978
which encodes Met-Ala-(15-125)hIL-3.
[0032] FIG. 10 shows the construction of the plasmid vector
pMON5988 which encodes Met-Ala(15-125)hIL-3.
[0033] FIG. 11 shows the construction of the plasmid vector
pMON5887 which encodes Met-(1-125)hIL-3.
[0034] FIG. 12 shows the construction of pMON6457 which encodes
(15-125)hIL-3; it contains the araBAD promoter and the LamB signal
peptide fused to the variant hIL-3 amino acids 15-125.
[0035] FIG. 13 shows the construction of pMON6458; it contains the
araBAD promoter and the LamB signal peptide fused to the variant
hIL-3 amino acids 15-125.
[0036] FIG. 14 shows the construction of pMON13359.
[0037] FIG. 15 shows the construction of pMON13352.
[0038] FIG. 16 shows the construction of pMON13360.
[0039] FIG. 17 shows the construction of pMON13363.
[0040] FIG. 18 shows the construction of pMON13364.
[0041] FIG. 19 shows the construction of pMON13365.
[0042] FIG. 20 shows the construction of pMON13287.
[0043] FIG. 21 shows the construction of pMON13288.
[0044] FIG. 22 shows the construction of pMON13289.
[0045] FIG. 23 shows the construction of pMON5723.
[0046] FIG. 24 shows the construction of pMON13438.
DETAILED DESCRIPTION OF THE INVENTION
[0047] The present invention relates to muteins of human
interleukin-3 (hIL-3) in which amino acid substitutions have been
made at four or more positions in amino acid sequence of the
polypeptide and to muteins which have substantially the same
structure and substantially the same biological activity. Preferred
muteins of the present invention are (15-125)hIL-3 deletion mutants
which have deletions of amino acids 1 to 14 at the N-terminus and
126 to 133 at the C-terminus and which also have four or more amino
acid substitutions in the polypeptide and muteins having
substantially the same structure and substantially the same
biological activity. Among the preferred muteins are those having
twenty-six amino acid substitutions. As used herein human
interleukin-3 corresponds to the amino acid sequence (1-133) as
depicted in FIG. 1 and (15-125) hIL-3 corresponds to the 15 to 125
amino acid sequence of the hIL-3 polypeptide. Naturally occurring
variants of hIL-3 polypeptide amino acids are also included in the
present invention (for example, the allele in which proline rather
than serine is at position 8 in the hIL-3 polypeptide sequence) as
are variant hIL-3 molecules which are modified post-translationally
(e.g. glycosylation).
[0048] The present invention also includes the DNA sequences which
code for the mutant polypeptides, DNA sequences which are
substantially similar and perform substantially the same function,
and DNA sequences which differ from the DNAs encoding the muteins
of the invention only due to the degeneracy of the genetic
code.
[0049] Included in the present invention are novel mutant human
interleukin-3 polypeptides comprising a polypeptide having the
amino acid sequence of native human interleukin-3 wherein amino
acids 126 to 133 have been deleted from the C-terminus of the
native human interleukin-3 polypeptide and amino acids 1 to 14 have
been deleted from the N-terminus of the native human interleukin-3
polypeptide and, in addition, polypeptides also have four or more
amino acid substitutions in the polypeptide sequence.
[0050] Also included in the present invention are the DNA sequences
coding for the muteins of the present invention; the
oligonucleotide intermediates used to construct the mutant DNAs;
and the polypeptides coded for by these oligonucleotides. These
polypeptides may be useful as antagonists or as antigenic fragments
for the production of antibodies useful in immunoassay and
immunotherapy protocols.
[0051] The mutant hIL-3 polypeptides of the present invention may
also have methionine, alanine, or methionine-alanine residues
inserted at the N-terminus.
[0052] The present invention includes human interleukin-3 mutant
polypeptide Formula I:
1 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:15] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
[0053] wherein
[0054] Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or
Arg;
[0055] Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or
Gln;
[0056] Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or
Cys;
[0057] Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or
Ala;
[0058] Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu,
Gln, Asn, Thr, Ser or Val;
[0059] Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp,
Asn, Gln, Leu, Val or Gly;
[0060] Xaa at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys,
Phe, Leu, Ser, or Arg;
[0061] Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or
Leu;
[0062] Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or
Ala;
[0063] Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or
Trp;
[0064] Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
[0065] Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or
Trp;
[0066] Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
[0067] Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser,
Leu, or Lys;
[0068] Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or
Gln;
[0069] Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or
Glu;
[0070] Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
[0071] Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln,
Thr, Arg, Ala, Phe, Ile or Met;
[0072] Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or
Val;
[0073] Xaa at position 36 is Asp, Leu, or Val;
[0074] Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
[0075] Xaa at position 38 is Asn, or Ala;
[0076] Xaa at position 40 is Leu, Trp, or Arg;
[0077] Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or
Pro;
[0078] Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr,
Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
[0079] Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala,
Cys, Gln, Arg, Thr, Gly or Ser;
[0080] Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met,
Trp, Glu, Asn, Gln, Ala or Pro;
[0081] Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr,
Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
[0082] Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Gln, Asn,
Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
[0083] Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or
His;
[0084] Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe,
Glu, Lys, Thr, Ala, Met, Val or Asn;
[0085] Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or
Asp;
[0086] Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn,
Ser, Ala, Ile, Val, His, Phe, Met or Gln;
[0087] Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or
His;
[0088] Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or
Thr;
[0089] Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys,
Ser, or Met;
[0090] Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln,
Asn, Lys, His, Ala or Leu;
[0091] Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
[0092] Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg,
His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
[0093] Xaa at position 57 is Asn or Gly;
[0094] Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or
Cys;
[0095] Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg;
[0096] Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
[0097] Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or
Ser;
[0098] Xaa at position 62 is Asn His, Val, Arg, Pro, Thr, Asp, or
Ile;
[0099] Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or
Val;
[0100] Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
[0101] Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or
Ser;
[0102] Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or
Ser;
[0103] Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile,
Pro, or His;
[0104] Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or
His;
[0105] Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp,
Gly, or Leu;
[0106] Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
[0107] Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr,
Gln, Trp, or Asn;
[0108] Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or
Asp;
[0109] Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or
Arg;
[0110] Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
[0111] Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg,
Ser, Gln, or Leu;
[0112] Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro,
Gly, or Asp;
[0113] Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
[0114] Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or
Arg;
[0115] Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or
Asp;
[0116] Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or
Arg;
[0117] Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or
Lys;
[0118] Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu,
Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
[0119] Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
[0120] Xaa at position 84 is Cys, Gln, Gly, Arg, Met, or Val;
[0121] Xaa at position 85 is Leu, Asn, Val, or Gln;
[0122] Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
[0123] Xaa at position 87 is Leu, Ser, Trp, or Gly;
[0124] Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
[0125] Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His,
Asn, or Ser;
[0126] Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or
Met;
[0127] Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or
His;
[0128] Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala,
Gly, Ile or Leu;
[0129] Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or
Arg;
[0130] Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln,
Lys, His, Ala, or Pro;
[0131] Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly,
Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
[0132] Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
[0133] Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
[0134] Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr,
Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
[0135] Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln,
Gly, Ser, Phe, or His;
[0136] Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser,
Gln, or Pro;
[0137] Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val,
Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;
[0138] Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or
Pro;
[0139] Xaa at position 103 is Asp, or Ser;
[0140] Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro,
Leu, Gln, Lys, Ala, Phe, or Gly;
[0141] Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His;
[0142] Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or
Pro;
[0143] Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln,
His, Ser, Ala or Pro;
[0144] Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly;
[0145] Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln,
His, Glu, Ser, Ala, or Trp;
[0146] Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
[0147] Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or
Phe;
[0148] Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr,
Asp, Lys, Leu, Ile, Val or Asn;
[0149] Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or
Leu;
[0150] Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His,
Thr, Trp, or Met;
[0151] Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val,
Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;
[0152] Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or
Pro;
[0153] Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or
Tyr;
[0154] Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or
Arg;
[0155] Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or
Gln;
[0156] Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly;
[0157] Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro,
His, Ile, Tyr, or Cys;
[0158] Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or
Leu;
[0159] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3.
[0160] Included in the present invention are human interleukin-3
mutant polypeptide of the Formula II:
2 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:16] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Leu
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa
Xaa Glu Xaa Xaa 35 40 45 Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Asn Leu Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa
Cys Xaa Pro Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
[0161] wherein
[0162] Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
[0163] Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or
Gln;
[0164] Xaa at position 19 is Met, Phe, Ile, Arg, or Ala;
[0165] Xaa at position 20 is Ile or Pro;
[0166] Xaa at position 21 is Asp or Glu;
[0167] Xaa at position 23 is Ile, Val, Ala, Leu, or Gly;
[0168] Xaa at position 24 is Ile, Val, Phe, or Leu;
[0169] Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or
Ala;
[0170] Xaa at position 26 is His, Phe, Gly, Arg, or Ala;
[0171] Xaa at position 28 is Lys, Leu, Gln, Gly, Pro, or Val;
[0172] Xaa at position 29 is Gln, Asn, Leu, Arg, or Val;
[0173] Xaa at position 30 is Pro, His, Thr, Gly, or Gln;
[0174] Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or
Gln;
[0175] Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or
Glu;
[0176] Xaa at position 33 is Pro, Leu, Gln, Ala, or Glu;
[0177] Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg,
Gln, Glu, Ile, Phe, Thr or Met;
[0178] Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
[0179] Xaa at position 36 is Asp or Leu;
[0180] Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
[0181] Xaa at position 38 is Asn or Ala;
[0182] Xaa at position 41 is Asn, Cys, Arg, His, Met, or Pro;
[0183] Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile,
Leu, Met, Tyr, Val or Arg;
[0184] Xaa at position 44 is Asp or Glu;
[0185] Xaa at position 45 is Gln, Val, Met, Leu, Thr, Lys, Ala,
Asn, Glu, Ser, or Trp;
[0186] Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Ala, Asn,
Gln, Glu, His, Ile, Lys, Tyr, Val or Gly;
[0187] Xaa at position 47 is Ile, Val, or His;
[0188] Xaa at position 49 is Met, Asn, or Asp;
[0189] Xaa at position 50 is Glu, Thr, Ala, Asn, Ser or Asp;
[0190] Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or
His;
[0191] Xaa at position 52 is Asn or Gly;
[0192] Xaa at position 53 is Leu, Met, or Phe;
[0193] Xaa at position 54 is Arg, Ala, or Ser;
[0194] Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
[0195] Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Ala, Arg,
Asn, Glu, His, Leu, Thr, Val or Lys;
[0196] Xaa at position 59 is Glu, Tyr, His, Leu, or Arg;
[0197] Xaa at position 60 is Ala, Ser, Asn, or Thr;
[0198] Xaa at position 61 is Phe or Ser;
[0199] Xaa at position 62 is Asn, Val, Pro, Thr, or Ile;
[0200] Xaa at position 63 is Arg, Tyr, Lys, Ser, His, or Val;
[0201] Xaa at position 64 is Ala or Asn;
[0202] Xaa at position 65 is Val, Thr, Leu, or Ser;
[0203] Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or
Ser;
[0204] Xaa at position 67 is Ser, Phe, Val, Gly, Asn, Ile, or
His;
[0205] Xaa at position 68 is Leu, Val, Ile, Phe, or His;
[0206] Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, or
Gly;
[0207] Xaa at position 70 is Asn or Pro;
[0208] Xaa at position 71 is Ala, Met, Pro, Arg, Glu, Thr, or
Gln;
[0209] Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or
Asp;
[0210] Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr,
Arg, or Pro;
[0211] Xaa at position 74 is Ile or Met;
[0212] Xaa at position 75 is Glu, Gly, Asp, Ser, or Gln;
[0213] Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, Gly, or
Asp;
[0214] Xaa at position 77 is Ile, Ser, or Leu;
[0215] Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile,
Gly, or Asp;
[0216] Xaa at position 80 is Asn, Val, Gly, Thr, Leu, Glu, or
Arg;
[0217] Xaa at position 81 is Leu, or Val;
[0218] Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn,
Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
[0219] Xaa at position 83 is Pro, Ala, Thr, Trp, or Met;
[0220] Xaa at position 85 is Leu or Val;
[0221] Xaa at position 87 is Leu or Ser;
[0222] Xaa at position 88 is Ala, Arg, or Trp;
[0223] Xaa at position 89 is Thr, Asp, Glu, His, Asn, or Ser;
[0224] Xaa at position 90 is Ala, Asp, or Met;
[0225] Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, or
Asp;
[0226] Xaa at position 92 is Pro or Ser;
[0227] Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or
Arg;
[0228] Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn,
Ile, Phe, Ser or Thr;
[0229] Xaa at position 96 is Pro or Tyr;
[0230] Xaa at position 97 is Ile, Val, or Ala;
[0231] Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr,
Leu, Arg, Gln, Glu, lys, Met, Ser, Tyr, Val or Pro;
[0232] Xaa at position 99 is Ile, Leu, Val, or Phe;
[0233] Xaa at position 100 is Lys, Leu, His, Arg, Ile, Gln, Pro, or
Ser;
[0234] Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val,
Asn, Ile, Leu or Tyr;
[0235] Xaa at position 102 is Gly, Glu, Lys, or Ser;
[0236] Xaa at position 104 is Trp, Val, Tyr, Met, or Leu;
[0237] Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His;
[0238] Xaa at position 106 is Glu, Ser, Ala, or Gly;
[0239] Xaa at position 108 is Arg, Ala, Gln, Ser or Lys;
[0240] Xaa at position 109 is Arg, Thr, Glu, Leu, Ser, or Gly;
[0241] Xaa at position 112 is Thr, Val, Gln, Glu, His, or Ser;
[0242] Xaa at position 114 is Tyr or Trp;
[0243] Xaa at position 115 is Leu or Ala;
[0244] Xaa at position 116 is Lys, Thr, Met, Val, Trp, Ser, Leu,
Ala, Asn, Gln, His, Met, Phe, Tyr or Ile;
[0245] Xaa at position 117 is Thr, Ser, or Asn;
[0246] Xaa at position 119 is Glu, Ser, Pro, Leu, Thr, or Tyr;
[0247] Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
[0248] Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly;
[0249] Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro,
His, Ile, Tyr, or Cys;
[0250] Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or
Leu;
[0251] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin 3.
[0252] Included in the present invention are human interleukin-3
mutant polypeptide of the Formula III:
3 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:17] 1 5 10 15 Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu Xaa 50 55 60 Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
[0253] wherein
[0254] Xaa at position 17 is Ser, Gly, Asp, Met, or Gln;
[0255] Xaa at position 18 is Asn, His, or Ile;
[0256] Xaa at position 19 is Met or Ile;
[0257] Xaa at position 21 is Asp or Glu;
[0258] Xaa at position 23 is Ile, Ala, Leu, or Gly;
[0259] Xaa at position 24 is Ile, Val, or Leu;
[0260] Xaa at position 25 is Thr, His, Gln, or Ala;
[0261] Xaa at position 26 is His or Ala;
[0262] Xaa at position 29 is Gln, Asn, or Val;
[0263] Xaa at position 30 is Pro, Gly, or Gln;
[0264] Xaa at position 31 is Pro, Asp, Gly, or Gln;
[0265] Xaa at position 32 is Leu, Arg, Gln, Asn, Gly, Ala, or
Glu;
[0266] Xaa at position 33 is Pro or Glu;
[0267] Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg,
Gln, Glu, Ile, Phe, Thr or Met;
[0268] Xaa at position 35 is Leu, Ala, Asn, Pro, Gln, or Val;
[0269] Xaa at position 37 is Phe, Ser, Pro, or Trp;
[0270] Xaa at position 38 is Asn or Ala;
[0271] Xaa at position 42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile,
Leu, Met, Tyr or Arg;
[0272] Xaa at position 44 is Asp or Glu;
[0273] Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn,
Glu, Ser or Lys;
[0274] Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn Gln, Glu,
His, Ile, Lys, Tyr, Val or Cys;
[0275] Xaa at position 50 is Glu, Ala, Asn, Ser or Asp;
[0276] Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or
His;
[0277] Xaa at position 54 is Arg or Ala;
[0278] Xaa at position 54 is Arg or Ala;
[0279] Xaa at position 55 is Arg, Thr, Val, Leu, or Gly;
[0280] Xaa at position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn,
Glu, Leu, Thr, Val or Lys;
[0281] Xaa at position 60 is Ala or Ser;
[0282] Xaa at position 62 is Asn, Pro, Thr, or Ile;
[0283] Xaa at position 63 is Arg or Lys;
[0284] Xaa at position 64 is Ala or Asn;
[0285] Xaa at position 65 is Val or Thr;
[0286] Xaa at position 66 is Lys or Arg;
[0287] Xaa at position 67 is Ser, Phe, or His;
[0288] Xaa at position 68 is Leu, Ile, Phe, or His;
[0289] Xaa at position 69 is Gln, Ala, Pro, Thr, Gln, Arg, or
Gly;
[0290] Xaa at position 71 is Ala, Pro, or Arg;
[0291] Xaa at position 72 is Ser, Glu, Arg, or Asp;
[0292] Xaa at position 73 is Ala or Leu;
[0293] Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or
Gly;
[0294] Xaa at position 77 is Ile or Leu;
[0295] Xaa at position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile,
Gly, or Asp;
[0296] Xaa at position 80 is Asn, Gly, Glu, or Arg;
[0297] Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Ala, Asn,
Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
[0298] Xaa at position 83 is Pro or Thr;
[0299] Xaa at position 85 is Leu or Val;
[0300] Xaa at position 87 is Leu or Ser;
[0301] Xaa at position 88 is Ala or Trp;
[0302] Xaa at position 91 is Ala or Pro;
[0303] Xaa at position 93 is Thr, Asp, Ser, Pro, Ala, Leu, or
Arg;
[0304] Xaa at position 95 is His, Pro, Arg, Val, Leu, Gly, Asn,
Phe, Ser or Thr;
[0305] Xaa at position 96 is Pro or Tyr;
[0306] Xaa at position 97 is Ile or Val;
[0307] Xaa at position 98 is His, Ile, Asn, Leu, Ala, Thr, Leu,
Arg, Gln, Leu, Lys, Met, Ser, Tyr, Val or Pro;
[0308] Xaa at position 99 is Ile, Leu, or Val;
[0309] Xaa at position 100 is Lys, Arg, Ile, Gln, Pro, or Ser;
[0310] Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Pro,
Asn, Ile, Leu or Tyr;
[0311] Xaa at position 104 is Trp or Leu;
[0312] Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr,
Leu, Lys, Ile, Asp, or His;
[0313] Xaa at position 106 is Glu or Gly;
[0314] Xaa at position 108 is Arg, Ala, or Ser;
[0315] Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
[0316] Xaa at position 112 is Thr, Val, or Gln;
[0317] Xaa at position 114 is Tyr or Trp;
[0318] Xaa at position 115 is Leu or Ala;
[0319] Xaa at position 116 is Lys, Thr, Val, Trp, Ser, Ala, His,
Met, Phe, Tyr or Ile;
[0320] Xaa at position 117 is Thr or Ser;
[0321] Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
[0322] Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or
Gly;
[0323] Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro,
His, Ile, Tyr, or Cys;
[0324] Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or
Leu;
[0325] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 35 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3.
[0326] Included in the present invention arehuman interleukin-3
mutant polypeptide of the Formula IV:
4 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:18] 15 10 15 Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu Ala 50 55 60 Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp Xaa 95 100 105 Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130
[0327] wherein
[0328] Xaa at position 17 is Ser, Gly, Asp, or Gln;
[0329] Xaa at position 18 is Asn, His, or Ile;
[0330] Xaa at position 23 is Ile, Ala, Leu, or Gly;
[0331] Xaa at position 25 is Thr, His, or Gln;
[0332] Xaa at position 26 is His or Ala;
[0333] Xaa at position 29 is Gln or Asn;
[0334] Xaa at position 30 is Pro or Gly;
[0335] Xaa at position 32 is Leu, Arg, Asn, or Ala;
[0336] Xaa at position 34 is Leu, Val, Ser, Ala, Arg, Gln, Glu,
Ile, Phe, Thr, or Met;
[0337] Xaa at position 35 is Leu, Ala, Asn, or Pro;
[0338] Xaa at position 38 is Asn or Ala;
[0339] Xaa at position 42 is Gly, Asp, Ser, Ala, Asn, Ile, Leu,
Met, Tyr or Arg;
[0340] Xaa at position 45 is Gln, Val, Met, Leu, Ala, Asn, Glu, or
Lys;
[0341] Xaa at position 46 is Asp, Phe, Ser, Gln, Glu, His, Val or
Thr;
[0342] Xaa at position 50 is Glu Asn, Ser or Asp;
[0343] Xaa at position 51 is Asn, Arg, Pro, Thr, or His;
[0344] Xaa at position 55 is Arg, Leu, or Gly;
[0345] Xaa at position 56 is Pro, Gly, Ser, Ala, Asn, Val, Leu or
Gln;
[0346] Xaa at position 62 is Asn, Pro, or Thr;
[0347] Xaa at position 64 is Ala or Asn;
[0348] Xaa at position 65 is Val or Thr;
[0349] Xaa at position 67 is Ser or Phe;
[0350] Xaa at position 68 is Leu or Phe;
[0351] Xaa at position 69 is Gln, Ala, Glu, or Arg;
[0352] Xaa at position 76 is Ser, Val, Asn, Pro, or Gly;
[0353] Xaa at position 77 is Ile or Leu;
[0354] Xaa at position 79 is Lys, Gly, Asn, Met, Arg, Ile, or
Gly;
[0355] Xaa at position 80 is Asn, Gly, Glu, or Arg;
[0356] Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Asn, Glu,
His, Met, Phe, Ser, Thr, Tyr or Val;
[0357] Xaa at position 87 is Leu or Ser;
[0358] Xaa at position 88 is Ala or Trp;
[0359] Xaa at position 91 is Ala or Pro;
[0360] Xaa at position 93 is Thr, Asp, or Ala;
[0361] Xaa at position 95 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr;
[0362] Xaa at position 98 is His, Ile, Asn, Ala, Thr, Gln, Glu,
Lys, Met, Ser, Tyr, Val or Leu;
[0363] Xaa at position 99 is Ile or Leu;
[0364] Xaa at position 100 is Lys or Arg;
[0365] Xaa at position 101 is Asp, Pro, Met, Lys, Thr, His, Pro,
Asn, Ile, Leu or Tyr;
[0366] Xaa at position 105 is Asn, Pro, Ser, Ile or Asp;
[0367] Xaa at position 108 is Arg, Ala, or Ser;
[0368] Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser;
[0369] Xaa at position 112 is Thr or Gln;
[0370] Xaa at position 116 is Lys, Val, Trp, Ala, His, Phe, Tyr or
Ile;
[0371] Xaa at position 117 is Thr or Ser;
[0372] Xaa at position 120 is Asn, Pro, Leu, His, Val, or Gln;
[0373] Xaa at position 121 is Ala, Ser, Ile, Pro, or Asp;
[0374] Xaa at position 122 is Gln, Met, Trp, Phe, Pro, His, Ile, or
Tyr;
[0375] Xaa at position 123 is Ala, Met, Glu, Ser, or Leu;
[0376] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3.
[0377] Included in the present invention are (15-125)human
interleukin-3 mutant polypeptides of the Formula V:
5 Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa [SEQ
ID NO:19] 15 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
[0378] wherein
[0379] Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or
Arg;
[0380] Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or
Gln;
[0381] Xaa at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or
Cys;
[0382] Xaa at position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or
Ala;
[0383] Xaa at position 7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln,
Asn, Thr, Ser or Val;
[0384] Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn,
Gln, Leu, Val, or Gly;
[0385] Xaa at position 9 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe,
Leu, Ser, or Arg;
[0386] Xaa at position 10 is Ile, Gly, Val, Arg, Ser, Phe, or
Leu;
[0387] Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or
Ala;
[0388] Xaa at position 12 is His, Thr, Phe, Gly, Arg, Ala, or
Trp;
[0389] Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or Ala;
[0390] Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or
Trp;
[0391] Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val;
[0392] Xaa at position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser,
Leu, or Lys;
[0393] Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or
Gln;
[0394] Xaa at position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or
Glu;
[0395] Xaa at position 19 is Pro, Leu, Gln, Ala, Thr, or Glu;
[0396] Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Glu, Gln,
Thr, Arg, Ala, Phe, Ile or Met;
[0397] Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or
Val;
[0398] Xaa at position 22 is Asp, Leu, or Val;
[0399] Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
[0400] Xaa at position 24 is Asn, or Ala;
[0401] Xaa at position 26 is Leu, Trp, or Arg;
[0402] Xaa at position 27 is Asn, Cys, Arg, Leu, His, Met, Pro;
[0403] Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Lys, Asn,
Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met;
[0404] Xaa at position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala,
Cys, Gln, Arg, Thr, Gly or Ser;
[0405] Xaa at position 30 is Asp, Ser, Leu, Arg, Lys, Thr, Met,
Trp, Glu, Asn, Gln, Ala or Pro;
[0406] Xaa at position 31 is Gln, Pro, Phe, Val, Met, Leu, Thr,
Lys, Asp, Asn, Arg, Ser, Ala, Ile, Glu, His or Trp;
[0407] Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Glu, Asn,
Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
[0408] Xaa at position 33 is Ile, Gly, Val, Ser, Arg, Pro, or
His;
[0409] Xaa at position 34 is Leu, Ser, Cys, Arg, Ile, His, Phe,
Glu, Lys, Thr, Ala, Met, Val or Asn;
[0410] Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or
Asp;
[0411] Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn,
Ser, Ala, Ile, Val, His, Phe, Met or Gln;
[0412] Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or
His;
[0413] Xaa at position 38 is Asn, His, Arg, Leu, Gly, Ser, or
Thr;
[0414] Xaa at position 39 is Leu, Thr, Ala, Gly, Glu, Pro, Lys,
Ser, Met, or;
[0415] Xaa at position 40 is Arg, Asp, Ile, Ser, Val, Thr, Gln,
Asn, Lys, His, Ala or Leu;
[0416] Xaa at position 41 is Arg, Thr, Val, Ser, Leu, or Gly;
[0417] Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Glu, Arg,
His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
[0418] Xaa at position 43 is Asn or Gly;
[0419] Xaa at position 44 is Leu, Ser, Asp, Arg, Gln, Val, or
Cys;
[0420] Xaa at position 45 is Glu Tyr, His, Leu, Pro, or Arg;
[0421] Xaa at position 46 is Ala, Ser, Pro, Tyr, Asn, or Thr;
[0422] Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or
Ser;
[0423] Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or
Ile;
[0424] Xaa at position 49 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or
Val;
[0425] Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys;
[0426] Xaa at position 51 is Val, Thr, Pro, His, Leu, Phe, or
Ser;
[0427] Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or
Ser;
[0428] Xaa at position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile,
Pro, or His;
[0429] Xaa at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or
His;
[0430] Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp,
Gly, or Leu;
[0431] Xaa at position 56 is Asn, Leu, Val, Trp, Pro, or Ala;
[0432] Xaa at position 57 is Ala, Met, Leu, Pro, Arg, Glu, Thr,
Gln, Trp, or Asn;
[0433] Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or
Asp;
[0434] Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or
Arg;
[0435] Xaa at position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
[0436] Xaa at position 61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg,
Ser, Gln, or Leu;
[0437] Xaa at position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro,
Gly, or Asp;
[0438] Xaa at position 63 is Ile, Ser, Arg, Thr, or Leu;
[0439] Xaa at position 64 is Leu, Ala, Ser, Glu, Phe, Gly, or
Arg;
[0440] Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or
Asp;
[0441] Xaa at position 66 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or
Arg;
[0442] Xaa at position 67 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or
Lys;
[0443] Xaa at position 68 is Leu, Gln, Lys, Trp, Arg, Asp, Glu,
Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
[0444] Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or Met;
[0445] Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val;
[0446] Xaa at position 71 is Leu, Asn, Val, or Gln;
[0447] Xaa at position 72 is Pro, Cys, Arg, Ala, or Lys;
[0448] Xaa at position 73 is Leu, Ser, Trp, or Gly;
[0449] Xaa at position 74 is Ala, Lys, Arg, Val, or Trp;
[0450] Xaa at position 75 is Thr, Asp, Cys, Leu, Val, Glu, His,
Asn, or Ser;
[0451] Xaa at position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or
Met;
[0452] Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or
His;
[0453] Xaa at position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala,
Gly, Ile or Leu;
[0454] Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or
Arg;
[0455] Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln,
Lys, His, Ala or Pro;
[0456] Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu, Gly,
Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;
[0457] Xaa at position 82 is Pro, Lys, Tyr, Gly, Ile, or Thr;
[0458] Xaa at position 83 is Ile, Val, Lys, Ala, or Asn;
[0459] Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr,
Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
[0460] Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln,
Gly, Ser, Phe, or His;
[0461] Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile, Ser,
Gln, Pro;
[0462] Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr, Val,
Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln;
[0463] Xaa at position 88 is Gly, Leu, Glu, Lys, Ser, Tyr, or
Pro;
[0464] Xaa at position 89 is Asp, or Ser;
[0465] Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met, Pro,
Leu, Gln, Lys, Ala, Phe, or Gly;
[0466] Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His;
[0467] Xaa at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or
Pro;
[0468] Xaa at position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln,
His, Ser, Ala, or Pro;
[0469] Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly;
[0470] Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His,
Glu, Ser, Ala or Trp;
[0471] Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
[0472] Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or
Phe;
[0473] Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr,
Asp, Lys, Leu, Ile, Val or Asn;
[0474] Xaa at position 100 is Tyr, Cys, His, Ser, Trp, Arg, or
Leu;
[0475] Xaa at position 101 is Leu, Asn, Val, Pro, Arg, Ala, His,
Thr, Trp, or Met;
[0476] Xaa at position 102 is Lys, Leu, Pro, Thr, Met, Asp, Val,
Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;
[0477] Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys, or
Pro;
[0478] Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or
Tyr;
[0479] Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or
Arg;
[0480] Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or
Gln;
[0481] Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly;
[0482] Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro,
His, Ile, Tyr, or Cys;
[0483] Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or
Leu;
[0484] and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding native
amino acids of (1-133) human interleukin-3; or a polypeptide having
substantially the same structure and substantially the same
biological activity.
[0485] Included in the present invention are (15-125)human
interleukin-3 mutant polypeptides of the Formula VI:
6 Asn Cys Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Leu Xaa Xaa [SEQ
ID NO:20] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Leu Xaa
Xaa Glu Xaa 20 25 30 Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Asn Leu Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa
Cys Xaa Pro Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
[0486] wherein
[0487] Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
[0488] Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or
Gln;
[0489] Xaa at position 5 is Met, Phe, Ile, Arg, or Ala;
[0490] Xaa at position 6 is Ile or Pro;
[0491] Xaa at position 7 is Asp, or Glu;
[0492] Xaa at position 9 is Ile, Val, Ala, Leu, or Gly;
[0493] Xaa at position 10 is Ile, Val, Phe, or Leu;
[0494] Xaa at position 11 is Thr, His, Gly, Gln, Arg, Pro, or
Ala;
[0495] Xaa at position 12 is His, Phe, Gly, Arg, or Ala;
[0496] Xaa at position 14 is Lys, Leu, Gln, Gly, Pro, or Val;
[0497] Xaa at position 15 is Gln, Asn, Leu, Arg, or Val;
[0498] Xaa at position 16 is Pro, His, Thr, Gly, or Gln;
[0499] Xaa at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or
Gln;
[0500] Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or
Glu;
[0501] Xaa at position 19 is Pro, Leu, Gln, Ala, or Glu;
[0502] Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg,
Gln, Glu, Ile, Phe, Thr or Met;
[0503] Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
[0504] Xaa at position 22 is Asp or Leu;
[0505] Xaa at position 23 is Phe, Ser, Pro, Trp, or Ile;
[0506] Xaa at position 24 is Asn or Ala;
[0507] Xaa at position 27 is Asn, Cys, Arg, His, Met, or Pro;
[0508] Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile,
Leu, Met, Tyr, or Arg;
[0509] Xaa at position 30 is Asp, or Glu;
[0510] Xaa at position 31 is Gln, Val, Met, Leu, Thr, Lys, Ala, Asn
Glu, Ser or Trp;
[0511] Xaa at position 32 is Asp, Phe, Ser, Thr, Cys, Ala, Asn,
Gln, Glu, His, Ile, Lys, Tyr, Val or Gly;
[0512] Xaa at position 33 is Ile, Val, or His;
[0513] Xaa at position 35 is Met, Asn, or Asp;
[0514] Xaa at position 36 is Glu, Thr, Ala, Asn, Ser or Asp;
[0515] Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or
His;
[0516] Xaa at position 38 is Asn or Gly;
[0517] Xaa at position 39 is Leu, Met, or Phe;
[0518] Xaa at position 40 is Arg, Ala or Ser;
[0519] Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
[0520] Xaa at position 42 is Pro, Gly, Cys, Ser, Gln, Ala, Arg,
Asn, Glu, His, Leu, Thr, Val or Lys;
[0521] Xaa at position 45 is Glu, Tyr, His, Leu, or Arg;
[0522] Xaa at position 46 is Ala, Ser, Asn, or Thr;
[0523] Xaa at position 47 is Phe or Ser;
[0524] Xaa at position 48 is Asn, Val, Pro, Thr, or Ile;
[0525] Xaa at position 49 is Arg, Tyr, Lys, Ser, His, or Val;
[0526] Xaa at position 50 is Ala or Asn;
[0527] Xaa at position 51 is Val, Thr, Leu, or Ser;
[0528] Xaa at position 52 is Lys, Ile, Arg, Val, Asn, Glu, or
Ser;
[0529] Xaa at position 53 is Ser, Phe, Val, Gly, Asn, Ile, or
His;
[0530] Xaa at position 54 is Leu, Val, Ile, Phe, or His;
[0531] Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or
Gly;
[0532] Xaa at position 56 is Asn or Pro;
[0533] Xaa at position 57 is Ala, Met, Pro, Arg, Glu, Thr, or
Gln;
[0534] Xaa at position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or
Asp;
[0535] Xaa at position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr,
Arg, or Pro;
[0536] Xaa at position 60 is Ile or Met;
[0537] Xaa at position 61 is Glu, Gly, Asp, Ser, or Gln;
[0538] Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, Gly, or
Asp;
[0539] Xaa at position 63 is Ile, Ser, or Leu;
[0540] Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, or
Asp;
[0541] Xaa at position 66 is Asn, Val, Gly, Thr, Leu, Glu, or
Arg;
[0542] Xaa at position 67 is Leu, or Val;
[0543] Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn,
Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
[0544] Xaa at position 69 is Pro, Ala, Thr, Trp, or Met;
[0545] Xaa at position 71 is Leu or Val;
[0546] Xaa at position 73 is Leu or Ser;
[0547] Xaa at position 74 is Ala, Arg, or Trp;
[0548] Xaa at position 75 is Thr, Asp, Glu, His, Asn, or Ser;
[0549] Xaa at position 76 is Ala, Asp, or Met;
[0550] Xaa at position 77 is Ala, Pro, Ser, Thr, Phe, Leu, or
Asp;
[0551] Xaa at position 78 is Pro or Ser;
[0552] Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or
Arg;
[0553] Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn,
Ile, Phe, Ser or Thr;
[0554] Xaa at position 82 is Pro or Tyr;
[0555] Xaa at position 83 is Ile, Val, or Ala;
[0556] Xaa at position 84 is His, Ile, Asn, Leu, Asp, Ala, Thr,
Arg, Gln, Glu, Lys, Met, Ser, Tyr, Val or Pro;
[0557] Xaa at position 85 is Ile, Leu, Val, or Phe;
[0558] Xaa at position 86 is Lys, Leu, His, Arg, Ile, Gln, Pro or
Ser;
[0559] Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr, Val,
Asn, Ile, Leu or Tyr;
[0560] Xaa at position 88 is Gly, Glu, Lys, or Ser;
[0561] Xaa at position 90 is Trp, Val, Tyr, Met, or Leu;
[0562] Xaa at position 91 is Asn, Pro, Ala, Phe, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His;
[0563] Xaa at position 92 is Glu, Ser, Ala, or Gly;
[0564] Xaa at position 94 is Arg, Ala, Gln, Ser or Lys;
[0565] Xaa at position 95 is Arg, Thr, Glu, Leu, Ser, or Gly;
[0566] Xaa at position 98 is Thr, Val, Gln, Glu, His, or Ser;
[0567] Xaa at position 100 is Tyr or Trp;
[0568] Xaa at position 101 is Leu or Ala;
[0569] Xaa at position 102 is Lys, Thr, Met, Val, Trp, Ser, Leu,
Ala, Asn, Gln, His, Met, Phe, Tyr or Ile;
[0570] Xaa at position 103 is Thr, Ser, or Asn;
[0571] Xaa at position 105 is Glu, Ser, Pro, Leu, Thr, or Tyr;
[0572] Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
[0573] Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly;
[0574] Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro,
His, Ile, Tyr, or Cys;
[0575] Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or
Leu;
[0576] and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3; or a polypeptide
having substantially the same structure and substantially the same
biological activity.
[0577] Included in the present invention are (15-125)human
interleukin-3 mutant polypeptides of the Formula VII:
7 Asn Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu Lys Xaa [SEQ
ID NO:21] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu 35 40 45 Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
[0578] wherein
[0579] Xaa at position 3 is Ser, Gly, Asp, Met, or Gln;
[0580] Xaa at position 4 is Asn, His, or Ile;
[0581] Xaa at position 5 is Met or Ile;
[0582] Xaa at position 7 is Asp or Glu;
[0583] Xaa at position 9 is Ile, Ala, Leu, or Gly;
[0584] Xaa at position 10 is Ile, Val, or Leu;
[0585] Xaa at position 11 is Thr, His, Gln, or Ala;
[0586] Xaa at position 12 is His or Ala;
[0587] Xaa at position 15 is Gln, Asn, or Val;
[0588] Xaa at position 16 is Pro, Gly, or Gln;
[0589] Xaa at position 17 is Pro, Asp, Gly, or Gln;
[0590] Xaa at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or
Glu;
[0591] Xaa at position 19 is Pro or Glu;
[0592] Xaa at position 20 is Leu, Val, Gly, Ser, Lys, Ala, Arg,
Gln, Glu, Ile, Phe, Thr or Met;
[0593] Xaa at position 21 is Leu, Ala, Asn, Pro, Gln, or Val;
[0594] Xaa at position 23 is Phe, Ser, Pro, or Trp;
[0595] Xaa at position 24 is Asn or Ala;
[0596] Xaa at position 28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile,
Leu, Met Tyr or Arg;
[0597] Xaa at position 30 is Asp or Glu;
[0598] Xaa at position 31 is Gln, Val, Met, Leu, Thr, Ala, Asn,
Glu, Ser or Lys;
[0599] Xaa at position 32 is Asp, Phe, Ser, Thr, Ala, Asn, Gln,
Glu, His, Ile, Lys, Tyr, Val or Cys;
[0600] Xaa at position 36 is Glu, Ala, Asn, Ser or Asp;
[0601] Xaa at position 37 is Asn, Arg, Met, Pro, Ser, Thr, or
His;
[0602] Xaa at position 40 is Arg or Ala;
[0603] Xaa at position 41 is Arg, Thr, Val, Leu, or Gly;
[0604] Xaa at position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn,
Glu, Leu, Thr, Val or Lys;
[0605] Xaa at position 46 is Ala or Ser;
[0606] Xaa at position 48 is Asn, Pro, Thr, or Ile;
[0607] Xaa at position 49 is Arg or Lys;
[0608] Xaa at position 50 is Ala or Asn;
[0609] Xaa at position 51 is Val or Thr;
[0610] Xaa at position 52 is Lys or Arg;
[0611] Xaa at position 53 is Ser, Phe, or His;
[0612] Xaa at position 54 is Leu, Ile, Phe, or His;
[0613] Xaa at position 55 is Gln, Ala, Pro, Thr, Glu, Arg, or
Gly;
[0614] Xaa at position 57 is Ala, Pro, or Arg;
[0615] Xaa at position 58 is Ser, Gln, Arg, or Asp;
[0616] Xaa at position 59 is Ala or Leu;
[0617] Xaa at position 62 is Ser, Val, Ala, Asn, Glu, Pro, or
Gly;
[0618] Xaa at position 63 is Ile or Leu;
[0619] Xaa at position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile,
Gly, or Asp;
[0620] Xaa at position 66 is Asn, Gly, Glu, or Arg;
[0621] Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Ala, Asn,
Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val;
[0622] Xaa at position 69 is Pro or Thr;
[0623] Xaa at position 71 is Leu or Val;
[0624] Xaa at position 73 is Leu or Ser;
[0625] Xaa at position 74 is Ala or Trp;
[0626] Xaa at position 77 is Ala or Pro;
[0627] Xaa at position 79 is Thr, Asp, Ser, Pro, Ala, Leu, or
Arg;
[0628] Xaa at position 81 is His, Pro, Arg, Val, Leu, Gly, Asn,
Phe, Ser or Thr;
[0629] Xaa at position 82 is Pro or Tyr;
[0630] Xaa at position 83 is Ile or Val;
[0631] Xaa at position 84 is His, Ile, Asn, Leu, Ala, Thr, Leu,
Arg, Gln, Leu, Lys, Met, Ser, Tyr, Val or Pro;
[0632] Xaa at position 85 is Ile, Leu, or Val;
[0633] Xaa at position 86 is Lys, Arg, Ile, Gln, Pro, or Ser;
[0634] Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr, Asn,
Ile, Leu or Tyr;
[0635] Xaa at position 90 is Trp or Leu;
[0636] Xaa at position 91 is Asn, Pro, Ala, Ser, Trp, Gln, Tyr,
Leu, Lys, Ile, Asp, or His;
[0637] Xaa at position 92 is Glu, or Gly;
[0638] Xaa at position 94 is Arg, Ala, or Ser;
[0639] Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
[0640] Xaa at position 98 is Thr, Val, or Gln;
[0641] Xaa at position 100 is Tyr or Trp;
[0642] Xaa at position 101 is Leu or Ala;
[0643] Xaa at position 102 is Lys, Thr, Val, Trp, Ser, Ala, His,
Met, Phe, Tyr or Ile;
[0644] Xaa at position 103 is Thr or Ser;
[0645] Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
[0646] Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or
Gly;
[0647] Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro,
His, Ile, Tyr, or Cys;
[0648] Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr, or
Leu;
[0649] which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 35 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native human interleukin-3.
[0650] Included in the present invention are (15-125)human
interleukin-3 mutant polypeptides of the Formula VIII:
8 Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa [SEQ
ID NO:22] 1 5 10 15 Xaa Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu 35 40 45 Ala Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp 80 85 90 Xaa Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110
[0651] wherein
[0652] Xaa at position 3 is Ser, Gly, Asp, or Gln;
[0653] Xaa at position 4 is Asn, His, or Ile;
[0654] Xaa at position 9 is Ile, Ala, Leu, or Gly;
[0655] Xaa at position 11 is Thr, His, or Gln;
[0656] Xaa at position 12 is His or Ala;
[0657] Xaa at position 15 is Gln or Asn;
[0658] Xaa at position 16 is Pro or Gly;
[0659] Xaa at position 18 is Leu, Arg, Asn, or Ala;
[0660] Xaa at position 20 is Leu, Val, Ser, Ala, Arg, Gln, Glu,
Ile, Phe, Thr or Met;
[0661] Xaa at position 21 is Leu, Ala, Asn, or Pro;
[0662] Xaa at position 24 is Asn or Ala;
[0663] Xaa at position 28 is Gly, Asp, Ser, Ala, Asn, Ile, Leu,
Met, Tyr or Arg;
[0664] Xaa at position 31 is Gln, Val, Met, Leu, Ala, Asn, Glu or
Lys;
[0665] Xaa at position 32 is Asp, Phe, Ser, Ala, Gln, Glu, His, Val
or Thr;
[0666] Xaa at position 36 is Glu, Asn, Ser or Asp;
[0667] Xaa at position 37 is Asn, Arg, Pro, Thr, or His;
[0668] Xaa at position 41 is Arg, Leu, or Gly;
[0669] Xaa at position 42 is Pro, Gly, Ser, Ala, Asn, Val, Leu or
Gln;
[0670] Xaa at position 48 is Asn, Pro, or Thr;
[0671] Xaa at position 50 is Ala or Asn;
[0672] Xaa at position 51 is Val or Thr;
[0673] Xaa at position 53 is Ser or Phe;
[0674] Xaa at position 54 is Leu or Phe;
[0675] Xaa at position 55 is Gln, Ala, Glu, or Arg;
[0676] Xaa at position 62 is Ser, Val, Asn, Pro, or Gly;
[0677] Xaa at position 63 is Ile or Leu;
[0678] Xaa at position 65 is Lys, Asn, Met, Arg, Ile, or Gly;
[0679] Xaa at position 66 is Asn, Gly, Glu, or Arg;
[0680] Xaa at position 68 is Leu, Gln, Trp, Arg, Asp, Asn, Glu,
His, Met, Phe, Ser, Thr, Tyr or Val;
[0681] Xaa at position 73 is Leu or Ser;
[0682] Xaa at position 74 is Ala or Trp;
[0683] Xaa at position 77 is Ala or Pro;
[0684] Xaa at position 79 is Thr, Asp, or Ala;
[0685] Xaa at position 81 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr;
[0686] Xaa at position 84 is His, Ile, Asn, Ala, Thr, Arg, Gln,
Glu, Lys, Met, Ser, Tyr, Val or Leu;
[0687] Xaa at position 85 is Ile or Leu;
[0688] Xaa at position 86 is Lys or Arg;
[0689] Xaa at position 87 is Asp, Pro, Met, Lys, His, Pro, Asn,
Ile, Leu or Tyr;
[0690] Xaa at position 91 is Asn, Pro, Ser, Ile or Asp;
[0691] Xaa at position 94 is Arg, Ala, or Ser;
[0692] Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser;
[0693] Xaa at position 98 is Thr or Gln;
[0694] Xaa at position 102 is Lys, Val, Trp, or Ile;
[0695] Xaa at position 103 is Thr, Ala, His, Phe, Tyr or Ser;
[0696] Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
[0697] Xaa at position 107 is Ala, Ser, Ile, Pro, or Asp;
[0698] Xaa at position 108 is Gln, Met, Trp, Phe, Pro, His, Ile, or
Tyr;
[0699] Xaa at position 109 is Ala, Met, Glu, Ser, or Leu;
[0700] and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 26 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3; or a polypeptide having
substantially the same structure and substantially the same
biological activity.
[0701] The present invention includes polypeptides of the
formula
9 [SEQ ID NO:129] 1 5 10 (Met).sub.m-Ala Pro Met Thr Gln Thr Thr
Ser Leu Lys 15 20 Thr Ser Trp Val Asn Cys Ser Xaa Xaa Xaa Asp Glu
25 30 Ile Ile Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa 35 40 45 Leu
Asp Xaa Xaa Asn Leu Asn Xaa Glu Asp Xaa Asp 50 55 Ile Leu Xaa Glu
Xaa Asn Leu Arg Xaa Xaa Asn Leu 60 65 70 Xaa Xaa Phe Xaa XaaAla Xaa
Lys Xaa Leu Xaa Asn Ala 75 80 Ser Xaa Ile Glu Xaa Ile Leu Xaa Asn
Leu Xaa Pro 85 90 95 Cys Xaa Pro Xaa Xaa Thr Ala Xaa Pro Xaa Arg
Xaa 100 105 Pro Ile Xaa Ile Xaa Xaa Gly Asp Trp Xaa Glu Phe 110 115
Arg Xaa Lys Leu Xaa Phe Tyr Leu Xaa Xaa Leu Glu 120 125 130 Xaa Ala
Gln Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile Phe
[0702] wherein m is 0 or 1; Xaa at position 18 is Asn or Ile; Xaa
at position 19 is Met, Ala or Ile; Xaa at position 20 is Ile, Pro
or Ile; Xaa at position 23 is Ile, Ala or Leu; Xaa at position 25
is Thr or His; Xaa at position 29 is Gln, Arg, Val or Ile; Xaa at
position 32 is Leu, Ala, Asn or Arg; Xaa at position 34 is Leu or
Ser; Xaa at position 37 is Phe, Pro, or Ser; Xaa at position 38 is
Asn or Ala; Xaa at position 42 is Gly, Ala, Ser, Asp or Asn; Xaa at
position 45 is Gln, Val, or Met; Xaa at position 46 is Asp or Ser;
Xaa at position 49 is Met, Ile, Leu or Asp; Xaa at position 50 is
Glu or Asp; Xaa at position 51 is Asn Arg or Ser; Xaa at position
55 is Arg, Leu, or Thr; Xaa at position 56 is Pro or Ser; Xaa at
position 59 is Glu or Leu; Xaa at position 60 is Ala or Ser; Xaa at
position 62 is Asn, Val or Pro; Xaa at position 63 is Arg or His;
Xaa at position 65 is Val or Ser; Xaa at position 67 is Ser, Asn,
His or Gln; Xaa at position 69 is Gln or Glu; Xaa at position 73 is
Ala or Gly; Xaa at position 76 is Ser, Ala or Pro; Xaa at position
79 is Lys, Arg or Ser; Xaa at position 82 is Leu, Glu, Val or Trp;
Xaa at position 85 is Leu or Val; Xaa at position 87 is Leu, Ser,
Tyr; Xaa at position 88 is Ala or Trp; Xaa at position 91 is Ala or
Pro; Xaa at position 93 is Pro or Ser; Xaa at position 95 is His or
Thr; Xaa at position 98 is His, Ile, or Thr; Xaa at position 100 is
Lys or Arg; Xaa at position 101 is Asp, Ala or Met; Xaa at position
105 is Asn or Glu; Xaa at position 109 is Arg, Glu or Leu; Xaa at
position 112 is Thr or Gln; Xaa at position 116 is Lys, Val, Trp or
Ser; Xaa at position 117 is Thr or Ser; Xaa at position 120 is Asn,
Gln, or His; Xaa at position 123 is Ala or Glu; with the proviso
that from four to twenty-six of the amino acids designated by Xaa
are different from the corresponding amino acids of native human
interleukin-3; or a polypeptide having substantially the same
structure and substantially the same biological activity.
[0703] Preferred polypeptides of the present invention are those of
the formula
10 [SEQ ID NO:130] 1 .5 (Met.sub.m-Ala.sub.n)p-Asn Cys Ser Xaa Xaa
Xaa Asp Glu Xaa 10 15 20 Ile Xaa His Leu Lys Xaa Pro Pro Xaa Pro
Xaa Leu 25 30 Asp Xaa Xaa Asn Leu Asn Xaa Glu Asp Xaa Xaa Ile 35 40
45 Leu Xaa Glu Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa 50 55 Xaa Phe
Xaa Xaa Ala Xaa Lys Xaa Leu Xaa Asn Ala 60 65 Ser Xaa Ile Glu Xaa
Ile Leu Xaa Asn Xaa Xaa Pro 70 75 80 Cys Xaa Pro Xaa Ala Thr Ala
Xaa Pro Xaa Arg Xaa 85 90 Pro Ile Xaa Ile Xaa Xaa Gly Asp Trp Xaa
Glu Phe 95 100 105 Arg Xaa Lys Leu Xaa Phe Tyr Leu Xaa Xaa Leu Glu
110 Xaa Ala Gln Xaa Gln Gln
[0704] wherein m is 0 or 1; n is 0 or 1; p is 0 or 1; Xaa at
position 4 is Asn or Ile; Xaa at position 5 is Met, Ala or Ile: Xaa
at position 6 is Ile, Pro or Leu; Xaa at position 9 is Ile, Ala or
Leu; Xaa at position 11 is Thr or His; Xaa at position 15 is Gln,
Arg, Val or Ile; Xaa at position 18 is Leu, Ala, Asn or Arg; Xaa at
position 20 is Leu or Ser; Xaa at position 23 is Phe, Pro, or Ser;
Xaa at position 24 is Asn or Ala; Xaa at position 28 is Gly, Ala,
Ser, Asp or Asn; Xaa at position 31 is Gln, Val, or Met; Xaa at
position 32 is Asp or Ser; Xaa at position 35 is Met, Ile or Asp;
Xaa at position 36 is Glu or Asp; Xaa at position 37 is Asn, Arg or
Ser; Xaa at position 41 is Arg, Leu, or Thr; Xaa at position 42 is
Pro or Ser; Xaa at position 45 is Glu or Leu; Xaa at position 46 is
Ala or Ser; Xaa at position 48 is Asn, Val or Pro; Xaa at position
49 is Arg or His; Xaa at position 51 is Val or Ser; Xaa at position
53 is Ser, Asn, His or Gln; Xaa at position 55 is Gln or Glu; Xaa
at position 59 is Ala or Gly; Xaa at position 62 is Ser, Ala or
Pro; Xaa at position 65 is Lys, Arg or Ser; Xaa at position 67 is
Leu, Glu, or Val; Xaa at position 68 is Leu, Glu, Val or Trp; Xaa
at position 71 is Leu or Val; Xaa at position 73 is Leu, Ser or
Tyr; Xaa at position 74 is Ala or Trp; Xaa at position 77 is Ala or
Pro; Xaa at position 79 is Pro or Ser; Xaa at position 81 is His or
Thr; Xaa at position 84 is His, Ile, or Thr; Xaa at position 86 is
Lys or Arg; Xaa at position 87 is Asp, Ala or Met; Xaa at position
91 is Asn or Glu; Xaa at position 95 is Arg, Glu, Leu; Xaa at
position 98 Thr or Gln; Xaa at position 102 is Lys, Val, Trp or
Ser; Xaa at position 103 is Thr or Ser; Xaa at position 106 is Asn,
Gln, or His; Xaa at position 109 is Ala or Glu; with the proviso
that from four to twenty-six of the amino acids designated by Xaa
are different from the corresponding amino acids of native
(15-125)human interleukin-3; or a polypeptide having substantially
the same structure and substantially the same biological
activity.
[0705] "Mutant amino acid sequence," "mutant protein" or "mutant
polypeptide" refers to a polypeptide having an amino acid sequence
which varies from a native sequence or is encoded by a nucleotide
sequence intentionally made variant from a native sequence. "Mutant
protein," "variant protein" or "mutein" means a protein comprising
a mutant amino acid sequence and includes polypeptides which differ
from the amino acid sequence of native hIL-3 due to amino acid
deletions, substitutions, or both. "Native sequence" refers to an
amino acid or nucleic acid sequence which is identical to a
wild-type or native form of a gene or protein.
[0706] Human IL-3 can be characterized by its ability to stimulate
colony formation by human hematopoietic progenitor cells. The
colonies formed include erythroid, granulocyte, megakaryocyte,
granulocytic macrophages and mixtures thereof. Human IL-3 has
demonstrated an ability to restore bone marrow function and
peripheral blood cell populations to therapeutically beneficial
levels in studies performed initially in primates and subsequently
in humans (Gillio, A. P., et al. (1990); Ganser, A, et al. (1990);
Falk, S., et al. (1991). Additional activities of hIL-3 include the
ability to stimulate leukocyte migration and chemotaxis; the
ability to prime human leukocytes to produce high levels of
inflammatory mediators like leukotrienes and histamine; the ability
to induce cell surface expression of molecules needed for leukocyte
adhesion; and the ability to trigger dermal inflammatory responses
and fever. Many or all of these biological activities of hIL-3
involve signal transduction and high affinity receptor binding.
Mutant polypeptides of the present invention may exhibit useful
properties such as having similar or greater biological activity
when compared to native hIL-3 or by having improved half-life or
decreased adverse side effects, or a combination of these
properties. They may also be useful as antagonists. hIL-3 mutant
polypeptides which have little or no activity when compared to
native hIL-3 may still be useful as antagonists, as antigens for
the production of antibodies for use in immunology or
immunotherapy, as genetic probes or as intermediates used to
construct other useful hIL-3 muteins. Since hIL-3 functions by
binding to its receptor(s) and triggering second messages resulting
in competent signal transduction, hIL-3 muteins of this invention
may be useful in helping to determine which specific amino acid
sequences are responsible for these activities.
[0707] The novel hIL-3 mutant polypeptides of the present invention
will preferably have at least one biological property of human IL-3
or of an IL-3-like growth factor and may have more than one
IL-3-like biological property, or an improved property, or a
reduction in an undesirable biological property of human IL-3. Some
mutant polypeptides of the present invention may also exhibit an
improved side effect profile. For example, they may exhibit a
decrease in leukotriene release or histamine release when compared
to native hIL-3 or (15-125) hIL-3. Such hIL-3 or hIL-3-like
biological properties may include one or more of the following
biological characteristics and in vivo and in vitro activities.
[0708] One such property is the support of the growth and
differentiation of progenitor cells committed to erythroid,
lymphoid, and myeloid lineages. For example, in a standard human
bone marrow assay, an IL-3-like biological property is the
stimulation of granulocytic type colonies, megakaryocytic type
colonies, monocyte/macrophage type colonies, and erythroid bursts.
Other IL-3-like properties are the interaction with early
multipotential stem cells, the sustaining of the growth of
pluripotent precursor cells, the ability to stimulate chronic
myelogenous leukemia (CML) cell proliferation, the stimulation of
proliferation of mast cells, the ability to support the growth of
various factor-dependent cell lines, and the ability to trigger
immature bone marrow cell progenitors. Other biological properties
of IL-3 have been disclosed in the art. Human IL-3 also has some
biological activities which may in some cases be undesirable, for
example the ability to stimulate leukotriene release and the
ability to stimulate increased histamine synthesis in spleen and
bone marrow cultures and in vivo.
[0709] Biological activity of hIL-3 and hIL-3 mutant proteins of
the present invention is determined by DNA synthesis by human acute
myelogenous leukemia cells (AML). The factor-dependent cell line
AML 193 was adapted for use in testing biological activity.
[0710] One object of the present invention is to provide hIL-3
muteins and hIL-3 deletion muteins with four or more amino acid
substitutions in the polypeptide sequence which have similar or
improved biological activity in relation to native hIL-3 or native
(15-125)hIL-3.
[0711] The present invention includes mutant polypeptides
comprising minimally amino acids residues 15 to 118 of hIL-3 with
or without additional amino acid extensions to the N-terminus
and/or C-terminus which further contain four or more amino acid
substitutions in the amino acid sequence of the polypeptide. It has
been found that the (15-125)hIL-3 mutant is more soluble than is
hIL-3 when expressed in the cytoplasm of E. coli, and the protein
is secreted to the periplasm in E. coli at higher levels compared
to native hIL-3.
[0712] When expressed in the E. coli cytoplasm, the above-mentioned
mutant hIL-3 polypeptides of the present invention may also be
constructed with Met-Ala- at the N-terminus so that upon expression
the Met is cleaved off leaving Ala at the N-terminus. These mutant
hIL-3 polypeptides may also be expressed in E. coli by fusing a
signal peptide to the N-terminus. This signal peptide is cleaved
from the polypeptide as part of the secretion process. Secretion in
E. coli can be used to obtain the correct amino acid at the
N-terminus (e.g., Asn.sup.15 in the (15-125) hIL-3 polypeptide) due
to the precise nature of the signal peptidase. This is in contrast
to the heterogeneity often observed at the N-terminus of proteins
expressed in the cytoplasm in E. coli.
[0713] The hIL-3 mutant polypeptides of the present invention may
have hIL-3 or hIL-3-like activity. For example, they may possess
one or more of the biological activities of native hIL-3 and may be
useful in stimulating the production of hematopoietic cells by
human or primate progenitor cells. The hIL-3 muteins of the present
invention and pharmaceutical compositions containing them may be
useful in the treatment of conditions in which hematopoietic cell
populations have been reduced or destroyed due to disease or to
treatments such as radiation or chemotherapy.
[0714] hIL-3 muteins of the present invention may also be useful as
antagonists which block the hIL-3 receptor by binding specifically
to it and preventing binding of the agonist.
[0715] One potential advantage of the (15-125) hIL-3 muteins of the
present invention, particularly those which retain activity similar
to or better than that of native hIL-3, is that it may be possible
to use a smaller amount of the biologically active mutein to
produce the desired therapeutic effect. This may make it possible
to reduce the number of treatments necessary to produce the desired
therapeutic effect. The use of smaller amounts may also reduce the
possibility of any potential antigenic effects or other possible
undesirable side effects. For example, if a desired therapeutic
effect can be achieved with a smaller amount of polypeptide it may
be possible to reduce or eliminate side effects associated with the
administration of native IL-3 such as the stimulation of
leukotriene and/or histamine release. The hIL-3 muteins of the
present invention may also be useful in the activation of stem
cells or progenitors which have low receptor numbers.
Pharmaceutical compositions containing (15-125) hIL-3 muteins of
the present invention can be administered parenterally,
intravenously, or subcutaneously.
[0716] As another aspect of the present invention, there is
provided a novel method for producing the novel family of human
IL-3 muteins. The method of the present invention involves
culturing a suitable cell or cell line, which has been transformed
with a vector containing a DNA sequence coding for expression of a
novel hIL-3 mutant polypeptide. Suitable cells or cell lines may be
bacterial cells. For example, the various strains of E. coli are
well-known as host cells in the field of biotechnology. Examples of
such strains include E. coli strains JM101 [Yanish-Perron, et al.
(1985)] and MON105 [Obukowicz, et al. (1992)]. Various strains of
B. subtilis may also be employed in this method. Many strains of
yeast cells known to those skilled in the art are also available as
host cells for expression of the polypeptides of the present
invention.
[0717] Also suitable for use in the present invention are mammalian
cells, such as Chinese hamster ovary cells (CHO). General methods
for expression of foreign genes in mammalian cells are reviewed in:
Kaufman, R. J. (1987) High level production of proteins in
mammalian cells, in Genetic Engineering, Principles and Methods,
Vol. 9, J. K. Setlow, editor, Plenum Press, New York. An expression
vector is constructed in which a strong promoter capable of
functioning in mammalian cells drives transcription of a eukaryotic
secretion signal peptide coding region, which is translationally
fused to the coding region for the hIL-3 variant. For example,
plasmids such as pcDNA I/Neo, pRc/RSV, and pRc/CMV (obtained from
Invitrogen Corp., San Diego, Calif.) can be used. The eukaryotic
secretion signal peptide coding region can be from the hIL-3 gene
itself or it can be from another secreted mammalian protein (Bayne,
M. L. et al. (1987) Proc. Natl. Acad. Sci. USA 84, 2638-2642).
After construction of the vector containing the hIL-3 variant gene,
the vector DNA is transfected into mammalian cells. Such cells can
be, for example, the COS7, HeLa, BHK, CHO, or mouse L lines. The
cells can be cultured, for example, in DMEM media (JRH Scientific).
The hIL-3 variant secreted into the media can be recovered by
standard biochemical approaches following transient expression
24-72 hours after transfection of the cells or after establishment
of stable cell lines following selection for neomycin resistance.
The selection of suitable mammalian host cells and methods for
transformation, culture, amplification, screening and product
production and purification are known in the art. See, e.g.,
Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively,
Kaufman et al, Mol. Cell. Biol., 5(7):1750-1759 (1985) or Howley et
al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line
is the monkey COS-1 cell line. A similarly useful mammalian cell
line is the CV-1 cell line.
[0718] Where desired, insect cells may be utilized as host cells in
the method of the present invention. See, e.g. Miller et al,
Genetic Engineering, 8:277-298 (Plenum Press 1986) and references
cited therein. In addition, general methods for expression of
foreign genes in insect cells using Baculovirus vectors are
described in: Summers, M. D. and Smith, G. E. (1987)--A manual of
methods for Baculovirus vectors and insect cell culture procedures,
Texas Agricultural Experiment Station Bulletin No. 1555. An
expression vector is constructed comprising a Baculovirus transfer
vector, in which a strong Baculovirus promoter (such as the
polyhedron promoter) drives transcription of a eukaryotic secretion
signal peptide coding region, which is translationally fused to the
coding region for the hIL-3 variant polypeptide. For example, the
plasmid pVL1392 (obtained from Invitrogen Corp., San Diego, Calif.)
can be used. After construction of the vector carrying the hIL-3
variant gene, two micrograms of this DNA is cotransfected with one
microgram of Baculovirus DNA (see Summers & Smith, 1987) into
insect cells, strain SF9. Pure recombinant Baculovirus carrying the
hIL-3 variant is used to infect cells cultured, for example, in
Excell 401 serum-free medium (JRH Biosciences, Lenexa, Kans.). The
hIL-3 variant secreted into the medium can be recovered by standard
biochemical approaches.
[0719] Another aspect of the present invention provides plasmid DNA
vectors for use in the method of expression of these novel hIL-3
muteins. These vectors contain the novel DNA sequences described
above which code for the novel polypeptides of the invention.
Appropriate vectors which can transform microorganisms capable of
expressing the hIL-3 muteins include expression vectors comprising
nucleotide sequences coding for the hIL-3 muteins joined to
transcriptional and translational regulatory sequences which are
selected according to the host cells used.
[0720] Vectors incorporating modified sequences as described above
are included in the present invention and are useful in the
production of the hIL-3 mutant polypeptides. The vector employed in
the method also contains selected regulatory sequences in operative
association with the DNA coding sequences of the invention and
capable of directing the replication and expression thereof in
selected host cells.
[0721] Additional details may be found in co-filed U.S. Patent
Application Attorney docket No. 2713/1, which is hereby
incorporated by reference in its entirety.
[0722] All references, patents or applications cited herein are
incorporated by reference in their entirety.
[0723] The present invention also includes the construction and
expression of (15-125) human interleukin-3 muteins having four or
more amino acid substitutions in secretion vectors that optimize
accumulation of correctly folded, active polypeptide. While many
heterologous proteins have been secreted in E. coli there is still
a great deal of unpredictability and limited success (Stader and
Silhavy 1990). Full-length hIL-3 is such a protein, where attempts
to secrete the protein in E. coli resulted in low secretion levels.
Secretion of the variant (15-125) hIL-3 mutant polypeptides of the
present invention as a fusion with a signal peptide such as LamB
results in correctly folded protein that can be removed from the
periplasm of E. coli by osmotic shock fractionation. This property
of the variant (15-125) hIL-3 muteins allows for the direct and
rapid screening for bioactivity of the secreted material in the
crude osmotic shock fraction, which is a significant advantage.
Furthermore, it provides a means of using the (15-125) hIL-3
muteins to conduct structure activity relationship (SAR) studies of
the hIL-3 molecule. A further advantage of secretion of (15-125)
hIL-3 muteins fused to the LamB signal peptide is that the secreted
polypeptide has the correct N-terminal amino acid (Asn) due to the
precise nature of the cleavage of the signal peptide by signal
peptidase, as part of the secretion process.
[0724] The (15-125) hIL-3 muteins of the present invention may
include hIL-3 polypeptides having Met-, Ala- or Met-Ala- attached
to the N-terminus. When the muteins are expressed in the cytoplasm
of E. coli, polypeptides with and without Met attached to the
N-terminus are obtained. The methionine can in some cases be
removed by methionine aminopeptidase.
[0725] Amino terminal sequences of hIL-3 muteins made in E. coli
were determined using the method described by Hunkapillar et al.,
(1983). It was found that hIL-3 proteins made in E. coli from genes
encoding Met-(15-125) hIL-3 were isolated as Met-(15-125) hIL-3.
Proteins produced from genes encoding Met-Ala-(15-125) hIL-3 were
produced as Ala-(15-125) hIL-3. The N-termini of proteins made in
the cytoplasm of E. coli are affected by posttranslational
processing by methionine aminopeptidase (Ben-Bassat et al., 1987)
and possibly by other peptidases.
[0726] One method of creating the preferred hIL-3 (15-125) mutant
genes is cassette mutagenesis [Wells, et al. (1985)] in which a
portion of the coding sequence of hIL-3 in a plasmid is replaced
with synthetic oligonucleotides that encode the desired amino acid
substitutions in a portion of the gene between two restriction
sites. In a similar manner amino acid substitutions could be made
in the full-length hIL-3 gene, or genes encoding variants of hIL-3
in which from 1 to 14 amino acids have been deleted from the
N-terminus and/or from 1 to 15 amino acids have been deleted from
the C-terminus. When properly assembled these oligonucleotides
would encode hIL-3 variants with the desired amino acid
substitutions and/or deletions from the N-terminus and/or
C-terminus. These and other mutations could be created by those
skilled in the art by other mutagenesis methods including;
oligonucleotide-directed mutagenesis [Zoller and Smith (1982, 1983,
1984), Smith (1985), Kunkel (1985), Taylor, et al. (1985), Deng and
Nickoloff (1992)] or polymerase chain reaction (PCR) techniques
[Saiki, (1985)].
[0727] Pairs of complementary synthetic oligonucleotides encoding
portions of the amino terminus of the hIL-3 gene can be made and
annealed to each other. Such pairs would have protruding ends
compatible with ligation to NcoI at one end. The NcoI site would
include the codon for the initiator methionine. At the other end of
oligonucleotide pairs, the protruding (or blunt) ends would be
compatible with a restriction site that occurs within the coding
sequence of the hIL-3 gene. The DNA sequence of the oligonucleotide
would encode sequence for amino acids of hIL-3 with the exception
of those substituted and/or deleted from the sequence.
[0728] The NcoI enzyme and the other restriction enzymes chosen
should have recognition sites that occur only once in the DNA of
the plasmid chosen. Plasmid DNA can be treated with the chosen
restriction endonucleases then ligated to the annealed
oligonucleotides. The ligated mixtures can be used to transform
competent JM101 cells to resistance to an appropriate antibiotic.
Single colonies can be picked and the plasmid DNA examined by
restriction analysis and/or DNA sequencing to identify plasmids
with mutant hIL-3 genes.
[0729] One example of a restriction enzyme which cleaves within the
coding sequence of the hIL-3 gene is ClaI whose recognition site is
at codons 20 and 21. The use of ClaI to cleave the sequence of
hIL-3 requires that the plasmid DNA be isolated from an E. coli
strain that fails to methylate adenines in the DNA at GATC
recognition sites. This is because the recognition site for ClaI,
ATCGAT, occurs within the sequence GATCGAT which occurs at codons
19, 20 and 21 in the hIL-3 gene. The A in the GATC sequence is
methylated in most E. coli host cells. This methylation prevents
ClaI from cleaving at that particular sequence. An example of a
strain that does not methylate adenines is GM48.
[0730] Interpretation of Activity of Single Amino Acid Mutants in
IL-3 (15-125)
[0731] As illustrated in Tables 6 and 9, there are certain
positions in the IL-3 (15-125) molecule which are intolerant of
substitutions, in that most or all substitutions at these positions
resulted in a considerable decrease in bioactivity. There are two
likely classes of such "down-mutations": mutations that affect
overall protein structure, and mutations that interfere directly
with the interaction between the IL-3 molecule and its receptor.
Mutations affecting the three-dimensional structure of the protein
will generally lie in the interior of the protein, while mutations
affecting receptor binding will generally lie on the surface of the
protein. Although the three-dimensional structure of IL-3 is
unknown, there are simple algorithms which can aid in the
prediction of the structure. One such algorithm is the use of
"helical wheels" (Kaiser, E. T. & Kezdy, F. J., Science,
223:249-255 (1984)). In this method, the presence of alpha helical
protein structures can be predicted by virtue of their amphipathic
nature. Helices in globular proteins commonly have an exposed
hydrophilic side and a buried hydrophobic side. As a broad
generalization, in globular proteins, hydrophobic residues are
present in the interior of the protein, and hydrophilic residues
are present on the surface. By displaying the amino acid sequence
of a protein on such a "helical wheel" it is possible to derive a
model for which amino acids in alpha helices are exposed and which
are buried in the core of the protein. Such an analysis of the IL-3
(15-125) molecule predicts that the following helical residues are
buried in the core:
[0732] M19, I20, I23, I24, L27, L58, F61, A64, L68, A71, I74, I77,
L78, L81, W104, F107, L111, Y114, L115, L118.
[0733] In addition, cysteine residues at positions 16 and 84 are
linked by a disulfide bond, which is important for the overall
structure or "folding" of the protein. Finally, mutations which
result in a major disruption of the protein structure may be
expressed at low level in the secretion system used in our study,
for a variety of reasons: either because the mis-folded protein is
poorly recognized by the secretion machinery of the cell; because
mis-folding of the protein results in aggregation, and hence the
protein cannot be readily extracted from the cells; or because the
mis-folded protein is more susceptible to degradation by cellular
proteases. Hence, a block in secretion may indicate which positions
in the IL-3 molecule which are important for maintenance of correct
protein structure.
[0734] In order to retain the activity of a variant of IL-3, it is
necessary to retain both the structural integrity of the protein,
and retain the specific residues important for receptor contact.
Hence it is possible to define specific amino acid residues in IL-3
(15-125) which must be retained in order to preserve biological
activity.
[0735] Residues predicted to be important for interaction with the
receptor: D21, E22, E43, D44, L48, R54, R94, D103, K110, F113.
[0736] Residues predicted to be structurally important: C16, L58,
F61, A64, I74, L78, L81, C84, P86, P92, P96, F107, L111, L115,
L118.
[0737] The hIL-3 muteins of the present invention may be useful in
the treatment of diseases characterized by a decreased levels of
either myeloid, erythroid, lymphoid, or megakaryocyte cells of the
hematopoietic system or combinations thereof. In addition, they may
be used to activate mature myeloid and/or lymphoid cells. Among
conditions susceptible to treatment with the polypeptides of the
present invention is leukopenia, a reduction in the number of
circulating leukocytes (white cells) in the peripheral blood.
Leukopenia may be induced by exposure to certain viruses or to
radiation. It is often a side effect of various forms of cancer
therapy, e.g., exposure to chemotherapeutic drugs and of infection
or hemorrhage. Therapeutic treatment of leukopenia with these hIL-3
mutant polypeptides of the present invention may avoid undesirable
side effects caused by treatment with presently available
drugs.
[0738] The hIL-3 muteins of the present invention may be useful in
the treatment of neutropenia and, for example, in the treatment of
such conditions as aplastic anemia, cyclic neutropenia, idiopathic
neutropenia, Chediak-Higashi syndrome, systemic lupus erythematosus
(SLE), leukemia, myelodysplastic syndrome and myelofibrosis.
[0739] Many drugs may cause bone marrow suppression or
hematopoietic deficiencies. Examples of such drugs are AZT, DDI,
alkylating agents and anti-metabolites used in chemotherapy,
antibiotics such as chloramphenicol, penicillin and sulfa drugs,
phenothiazones, tranquilizers such as meprobamate, and diuretics.
The hIL-3 muteins of the present invention may be useful in
preventing or treating the bone marrow suppression or hematopoietic
deficiencies which often occur in patients treated with these
drugs.
[0740] Hematopoietic deficiencies may also occur as a result of
viral, microbial or parasitic infections and as a result of
treatment for renal disease or renal failure, e.g., dialysis. The
hIL-3 muteins of the present invention may be useful in treating
such hematopoietic deficiency.
[0741] The treatment of hematopoietic deficiency may include
administration of the hIL-3 mutein of a pharmaceutical composition
containing the hIL-3 mutein to a patient. The hIL-3 muteins of the
present invention may also be useful for the activation and
amplification of hematopoietic precursor cells by treating these
cells in vitro with the muteins of the present invention prior to
injecting the cells into a patient.
[0742] Various immunodeficiencies e.g., in T and/or B lymphocytes,
or immune disorders, e.g., rheumatoid arthritis, may also be
beneficially affected by treatment with the hIL-3 mutant
polypeptides of the present invention. Immunodeficiencies may be
the result of viral infections e.g. HTLVI, HTLVII, HTLVIII, severe
exposure to radiation, cancer therapy or the result of other
medical treatment. The hIL-3 mutant polypeptides of the present
invention may also be employed, alone or in combination with other
hematopoietins, in the treatment of other blood cell deficiencies,
including thrombocytopenia (platelet deficiency), or anemia. Other
uses for these novel polypeptides are in the treatment of patients
recovering from bone marrow transplants in vivo and ex vivo, and in
the development of monoclonal and polyclonal antibodies generated
by standard methods for diagnostic or therapeutic use.
[0743] Other aspects of the present invention are methods and
therapeutic compositions for treating the conditions referred to
above. Such compositions comprise a therapeutically effective
amount of one or more of the hIL-3 muteins of the present invention
in a mixture with a pharmaceutically acceptable carrier. This
composition can be administered either parenterally, intravenously
or subcutaneously. When administered, the therapeutic composition
for use in this invention is preferably in the form of a
pyrogen-free, parenterally acceptable aqueous solution. The
preparation of such a parenterally acceptable protein solution,
having due regard to pH, isotonicity, stability and the like, is
within the skill of the art.
[0744] The dosage regimen involved in a method for treating the
above-described conditions will be determined by the attending
physician considering various factors which modify the action of
drugs, e.g. the condition, body weight, sex and diet of the
patient, the severity of any infection, time of administration and
other clinical factors. Generally, a daily regimen may be in the
range of 0.2-150 .mu.g/kg of non-glycosylated IL-3 protein per
kilogram of body weight. This dosage regimen is referenced to a
standard level of biological activity which recognizes that native
IL-3 generally possesses an EC.sub.50 at or about 10 picoMolar to
100 picoMolar in the AML proliferation assay described herein.
Therefore, dosages would be adjusted relative to the activity of a
given mutein vs. the activity of native (reference) IL-3 and it
would not be unreasonable to note that dosage regimens may include
doses as low as 0.1 microgram and as high as 1 milligram per
kilogram of body weight per day. In addition, there may exist
specific circumstances where dosages of TL-3 mutein would be
adjusted higher or lower than the range of 10-200 micrograms per
kilogram of body weight. These include co-administration with other
CSF or growth factors; co-administration with chemotherapeutic
drugs and/or radiation; the use of glycosylated IL-3 mutein; and
various patient-related issues mentioned earlier in this section.
As indicated above, the therapeutic method and compositions may
also include co-administration with other human factors. A
non-exclusive list of other appropriate hematopoietins, CSFs and
interleukins for simultaneous or serial co-administration with the
polypeptides of the present invention includes GM-CSF, CSF-1,
G-CSF, Meg-CSF, M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, LIF, B-cell growth
factor, B-cell differentiation factor and eosinophil
differentiation factor, stem cell factor (SCF) also known as steel
factor or c-kit ligand, or combinations thereof. The dosage recited
above would be adjusted to compensate for such additional
components in the therapeutic composition. Progress of the treated
patient can be monitored by periodic assessment of the
hematological profile, e.g., differential cell count and the
like.
[0745] Materials and Methods for hIL-3 Mutein Expression in E.
coli
[0746] Unless noted otherwise, all specialty chemicals were
obtained from Sigma Co., (St. Louis, Mo.). Restriction
endonucleases, T4 poly-nucleotides kinase, E. coli DNA polymerase T
large fragment (Klenow) and T4 DNA ligase were obtained from New
England Biolabs (Beverly, Mass.).
[0747] Escherichia coli Strains
[0748] Strain JM101: delta (pro lac), supE, thi, F'(traD36, rpoAB,
lacI-Q, lacZdeltaM15) (Messing, 1979). This strain can be obtained
from the American Type Culture Collection (ATCC), 12301 Parklawn
Drive, Rockville, Md. 20852, accession number 33876. MON 105 (W3110
rpoH358) is a derivative of W3110 (Bachmann, 1972) and has been
assigned ATCC accession number 55204. Strain GM48: dam-3, dcm-6,
gal, ara, lac, thr, leu, tonA, tsx (Marinus, 1973) was used to make
plasmid DNA that is not methylated at the sequence GATC.
[0749] Genes and Plasmids
[0750] The gene used for hIL-3 production in E. coli was obtained
from British Biotechnology Incorporated, Cambridge, England,
catalogue number BBG14. This gene is carried on a pUC based plasmid
designated pP0518.
[0751] The plasmids used for production of hIL-3 in E. coli contain
genetic elements whose use has been described (Olins et al., 1988;
Olins and Rangwala, 1990). The replicon used is that of pBR327
(Covarrubias, et al., 1981) which is maintained at a copy number of
about 100 in the cell (Soberon et al., 1980). A gene encoding the
beta-lactamase protein is present on the plasmids. This protein
confers ampicillin resistance on the cell. This resistance serves
as a selectable phenotype for the presence of the plasmid in the
cell.
[0752] For cytoplasmic expression vectors the transcription
promoter was derived from the recA gene of E. coli (Sancar et al.,
1980). This promoter, designated precA, includes the RNA polymerase
binding site and the lexA repressor binding site (the operator).
This segment of DNA provides high level transcription that is
regulated even when the recA promoter is on a plasmid with the
pBR327 origin of replication (Olins et al., 1988) incorporated
herein by reference.
[0753] In secretion expression plasmids the transcription promoter
was derived from the ara B, A, and D genes of E. coli (Greenfield
et al., 1978). This promoter is designated pAraBAD and is contained
on a 323 base pair SacII, BglII restriction fragment. The LamB
secretion leader (Wong et al., 1988, Clement et al., 1981) was
fused to the N-terminus of the hIL-3 gene at the recognition
sequence for the enzyme NcoI (5'CCATGG3'). The hIL-3 genes used
were engineered to have a HindIII recognition site (5'AAGCTT3')
following the coding sequence of the gene.
[0754] These hIL-3 variants were expressed as a fusion with the
LamB signal peptide shown in FIG. 8, operatively joined to the
araBAD promoter (Greenfield, 1978) and the g10-L ribosome binding
site (Olins et al. 1988). The processed form was selectively
released from the periplasm by osmotic shock as a correctly folded
and fully active molecule. Secretion of (15-125) hIL-3 was further
optimized by using low inducer (arabinose) concentration and by
growth at 30.degree. C. These conditions resulted in lower
accumulation levels of unprocessed LamB signal peptide (15-125)
hIL-3 fusion, maximal accumulation levels of processed (15-125)
hIL-3 and selective release of (15-125) hIL-3 by osmotic shock
fractionation. The use of a tightly regulated promoter such as
araBAD from which the transcription level and hence the expression
level can be modulated allowed for the optimization of secretion of
(15-125) hIL-3.
[0755] The ribosome binding site used is that from gene 10 of phage
T7 (Olins et al., 1988). This is encoded in a 100 base pair (bp)
fragment placed adjacent to precA. In the plasmids used herein, the
recognition sequence for the enzyme NcoI (CCATGG) follows the
g10-L. It is at this NcoI site that the hIL-3 genes are joined to
the plasmid. It is expected that the nucleotide sequence at this
junction will be recognized in mRNA as a functional start site for
translation (Olins et al., 1988). The hIL-3 genes used were
engineered to have a HindIII recognition site (AAGCTT) downstream
from the coding sequence of the gene. At this HindIII site is a 514
base pair RsaI fragment containing the origin of replication of the
single stranded phage f1 (Dente et al., 1983; Olins, et al., 1990)
both incorporated herein by reference. A plasmid containing these
elements is pMON2341. Another plasmid containing these elements is
pMON5847 which has been deposited at the American Type Culture
Collection, 12301 Parklawn Drive, Rockville, Md. 20852 under the
accession number ATCC 68912.
[0756] Synthesis of Oligonucleotides
[0757] Oligonucleotides were synthesized on Nucleotide Synthesizer
model 380A or 380B from Applied Biosystems, Inc. (Foster City,
Calif.). Oligonucleotides were purified by polyacrylamide gel
electrophoresis at concentrations from 12-20% (19:1 crosslinked) in
0.5.times.Tris borate buffer (0.045 M Tris, 0.045 M boric acid,
1.25 mM EDTA) followed by passage through a Nensorb column obtained
from New England Nuclear (Boston, Mass.) using a PREP Automated
Sample Processor obtained from DuPont, Co. (Wilmington, Del.).
[0758] Quantitation of Synthetic Oligonucleotides
[0759] Synthetic oligonucleotides were resuspended in water and
quantitated by reading the absorbance at 260 nm on a Beckman DU40
Spectrophotometer (Irvine, Calif.) using a one centimeter by one
millimeter quartz cuvette (Maniatis, 1982). The concentration was
determined using an extinction coefficient of 1.times.10.sup.4
(Voet et al., 1963; Mahler and Cordes, 1966). The oligonucleotides
were then diluted to a desired concentration.
[0760] Quantitation of synthetic DNA fragments can also be achieved
by adding 10 to 100 picomoles of DNA to a solution containing
kinase buffer (25 mM Tris pH 8.0, 10 mM MgCl.sub.2, 10 mM DTT and 2
mM spermidine). To the reaction mix is added ATP to 20 micromolar,
ATP radiolabeled at the gamma phosphate (5000-10,0000 dpm/pmol) and
5 units of T4 polynucleotide kinase. Radiolabelled material is
obtained from New England Nuclear (Boston, Mass.). The 10
microliter mixture is incubated at 37.degree. C. for one hour. A 1
microliter aliquot of the mixture was chromatographed on DEAE paper
(Whatman) in 0.3 M ammonium bicarbonate. The counts that remained
at the origin were used to determine the concentration of the
synthetic DNA.
[0761] Recombinant DNA Methods
[0762] Isolation of plasmid DNA from E. coli cultures was performed
as described (Birnboim and Doly, 1979). Some DNAs were purified by
Magic.TM. columns, available from Promega (Madison, Wis.).
[0763] Purified plasmid DNA was treated with restriction
endonucleases according to manufacturer's instructions. Analysis of
the DNA fragments produced by treatment with restriction enzymes
was done by agarose or polyacrylamide gel electrophoresis. Agarose
(DNA grade from Fisher, Pittsburgh Pa.) was used at a concentration
of 1.0% in a Tris-acetate running buffer (0.04 M Tris-acetate,
0.001M EDTA). Polyacrylamide (BioRad, Richmond Calif.) was used at
a concentration of 6% (19:1 crosslinked) in 0.5.times.Tris-borate
buffer (0.045 M Tris, 0.045 M boric acid, 1.25 mM EDTA), hereafter
referred to as PAGE.
[0764] DNA polymerase I, large fragment, Klenow enzyme was used
according to manufacturers instructions to catalyze the addition of
mononucleotides from 5' to 3' of DNA fragments which had been
treated with restriction enzymes that leave protruding ends. The
reactions were incubated at 65.degree. C. for 10 minutes to heat
inactivate the Klenow enzyme.
[0765] The synthetic oligonucleotides were made without 5' or 3'
terminal phosphates. In cases where such oligonucleotides were
ligated end to end, the oligonucleotides were treated at a
concentration of 10 picomoles per microliter with T4 polynucleotide
kinase in the following buffer: 25 mM Tris, pH 8.0, 10 mM
MgCl.sub.2, 10 mM dithiothreitol, 2 mM spermidine, 1 mM rATP. After
incubation for 30 minutes at 37.degree. C., the samples were
incubated at 65.degree. C. for five minutes to heat inactivate the
kinase.
[0766] Synthetic Gene Assembly
[0767] The (15-125) hIL-3 gene was divided into four regions
separated by five convenient restriction sites. In each of the four
regions synthetic oligonucleotides were designed so that they would
anneal in complementary pairs, with protruding single stranded
ends, and when the pairs were properly assembled would result in a
DNA sequence that encoded a portion of the hIL-3 gene. Amino acid
substitutions in the hIL-3 gene were made by designing the
oligonucleotides to encode the desired substitutions. The
complementary oligonucleotides were annealed at concentration of 1
picomole per microliter in ligation buffer plus 50 mM NaCl. The
samples were heated in a 100 ml beaker of boiling water and
permitted to cool slowly to room temperature. One picomole of each
of the annealed pairs of oligonucleotides were ligated with
approximately 0.2 picomoles of plasmid DNA, digested with the
appropriate restriction enzymes, in ligation buffer (25 mM Tris pH
8.0, 10 mM MgCl.sub.2, 10 mM dithiothreitol, 1 mM ATP, 2 mM
spermidine) with T4 DNA ligase obtained from New England Biolabs
(Beverly, Mass.) in a total volume of 20 .mu.l at room temperature
overnight.
[0768] DNA fragments were isolated from agarose gels by
intercepting the restriction fragments on DEAE membranes from
Schleicher and Schuell (Keene, N.H.) and eluting the DNA in 10 mM
Tris, 1 mM EDTA, 1 M NaCl at 55.degree. C. for 1 hour, according to
manufacturer's directions. The solutions containing the DNA
fragment were concentrated and desalted by using Centricon 30
concentrators from Amicon (W. R. Grace, Beverly Mass.) according to
the manufacturer's directions. Ligations were performed at
15.degree. C. overnight, except as noted, in ligation buffer.
[0769] Polymerase Chain Reaction
[0770] Polymerase Chain Reaction (hereafter referred to as PCR)
techniques (Saiki, 1985) used the reagent kit and thermal cycler
from Perkin-Elmer Cetus (Norwalk, Conn.). PCR is based on a
thermostable DNA polymerase from Thermus aquaticus. The PCR
technique is a DNA amplification method that mimics the natural DNA
replication process in that the number of DNA molecules doubles
after each cycle, in a way similar to in vivo replication. The DNA
polymerase mediated extension is in a 5' to 3' direction. The term
"primer" as used herein refers to an oligonucleotide sequence that
provides an end to which the DNA polymerase can add nucleotides
that are complementary to a nucleotide sequence. The latter
nucleotide sequence is referred to as the "template", to which the
primers are annealed. The amplified PCR product is defined as the
region comprised between the 5' ends of the extension primers.
Since the primers have defined sequences, the product will have
discrete ends, corresponding to the primer sequences. The primer
extension reaction was carried out using 20 picomoles (pmoles) of
each of the oligonucleotides and 1 picogram of template plasmid DNA
for 35 cycles (1 cycle is defined as 94 degrees C. for one minute,
50 degrees C. for two minutes and 72 degrees for three minutes.).
The reaction mixture was extracted with an equal volume of
phenol/chloroform (50% phenol and 50% chloroform, volume to volume)
to remove proteins. The aqueous phase, containing the amplified
DNA, and solvent phase were separated by centrifugation for 5
minutes in a microcentrifuge (Model 5414 Eppendorf Inc, Fremont
Calif.). To precipitate the amplified DNA the aqueous phase was
removed and transferred to a fresh tube to which was added
{fraction (1/10)} volume of 3M NaOAc (pH 5.2) and 2.5 volumes of
ethanol (100% stored at minus 20 degrees C.). The solution was
mixed and placed on dry ice for 20 minutes. The DNA was pelleted by
centrifugation for 10 minutes in a microcentrifuge and the solution
was removed from the pellet. The DNA pellet was washed with 70%
ethanol, ethanol removed and dried in a speedvac concentrator
(Savant, Farmingdale, N.Y.). The pellet was resuspended in 25
microliters of TE (20 mM Tris-HCl pH 7.9, 1 mM EDTA). Alternatively
the DNA was precipitated by adding equal volume of 4M NH.sub.4OAc
and one volume of isopropanol [Treco et al., (1988)]. The solution
was mixed and incubated at room temperature for 10 minutes and
centrifuged. These conditions selectively precipitate DNA fragments
larger than 20 bases and were used to remove oligonucleotide
primers. One quarter of the reaction was digested with restriction
enzymes [Higuchi, (1989)] an on completion heated to 70 degrees C.
to inactivate the enzymes.
[0771] Recovery of Recombinant Plasmids from Ligation Mixes
[0772] E. coli JM101 cells were made competent to take up DNA.
Typically, 20 to 100 ml of cells were grown in LB medium to a
density of approximately 150 Klett units and then collected by
centrifugation. The cells were resuspended in one half culture
volume of 50 mM CaCl.sub.2 and held at 4.degree. C. for one hour.
The cells were again collected by centrifugation and resuspended in
one tenth culture volume of 50 mM CaCl.sub.2. DNA was added to a
150 microliter volume of these cells, and the samples were held at
4.degree. C. for 30 minutes. The samples were shifted to 42.degree.
C. for one minute, one milliliter of LB was added, and the samples
were shaken at 37.degree. C. for one hour. Cells from these samples
were spread on plates containing ampicillin to select for
transformants. The plates were incubated overnight at 37.degree. C.
Single colonies were picked, grown in LB supplemented with
ampicillin overnight at 37.degree. C. with shaking. From these
cultures DNA was isolated for restriction analysis.
[0773] Culture Medium
[0774] LB medium (Maniatis et al., 1982) was used for growth of
cells for DNA isolation. M9 minimal medium supplemented with 1.0%
casamino acids, acid hydrolyzed casein, Difco (Detroit, Mich.) was
used for cultures in which recombinant hIL-3 was produced. The
ingredients in the M9 medium were as follows: 3 g/liter
KH.sub.2PO.sub.4, 6 g/l Na.sub.2HPO.sub.4, 0.5 g/l NaCl, 1 g/l
NH.sub.4Cl, 1.2 mM MgSO.sub.4, 0.025 mM CaCl.sub.2, 0.2% glucose
(0.2% glycerol with the AraBAD promoter), 1% casamino acids, 0.1
ml/l trace minerals (per liter 108 g FeCl.sub.3.6H.sub.2O, 4.0 g
ZnSO.sub.4.7H.sub.2O, 7.0 CoCl.sub.2.2H.sub.2O, 7.0 g
Na.sub.2MoO.sub.4.2H.sub.2O, 8.0 g CuSO.sub.4.5H.sub.2O, 2.0 g
H.sub.3BO.sub.3, 5.0 g MnSO.sub.4.H.sub.2O, 100 ml concentrated
HCl). Bacto agar was used for solid media and ampicillin was added
to both liquid and solid LB media at 200 micrograms per
milliliter.
[0775] DNA Sequence Analysis
[0776] The nucleotide sequencing of plasmid DNA was determined
using a Genesis 2000 sequencer obtained from DuPont (Wilmington,
Del.) according to the methods of Prober et al. (1987) and Sanger
et al. (1977). Some DNA sequences were performed using
Sequenase.TM. polymerase (U.S. Biochemicals, Cleveland, Ohio)
according to manufacturer's directions.
[0777] Production of Recombinant hIL-3 Muteins in E. coli with
Vectors Employing the recA Promoter
[0778] E. coli strains harboring the plasmids of interest were
grown at 37.degree. C. in M9 plus casamino acids medium with
shaking in a Gyrotory water bath Model G76 from New Brunswick
Scientific (Edison, N.J.). Growth was monitored with a Klett
Summerson meter (green 54 filter), Klett Mfg. Co. (New York, N.Y.).
At a Klett value of approximately 150, an aliquot of the culture
(usually one milliliter) was removed for protein analysis. To the
remaining culture, nalidixic acid (10 mg/ml) in 0.1 N NaOH was
added to a final concentration of 50 .mu.g/ml. The cultures were
shaken at 37.degree. C. for three to four hours after addition of
nalidixic acid. A high degree of aeration was maintained throughout
the bacterial growth in order to achieve maximal production of the
desired gene product. The cells were examined under a light
microscope for the presence of refractile bodies (RBs). One
milliliter aliquots of the culture were removed for analysis of
protein content.
[0779] Production of Recombinant hIL-3 Proteins from the pAraBAD
Promoter in E. coli
[0780] E. coli strains harboring the plasmids of interest were
grown at 30.degree. C. with shaking in M9 medium plus casamino
acids and glycerol. Growth was monitored with a Klett Summerson
calorimeter, using a green 54 filter. At a Klett value of about
150, an aliquot of the culture (usually one milliliter) was removed
for protein analysis. To the remaining culture, 20% arabinose was
added to a final concentration of 0.05%. The cultures were shaken
at 30.degree. C. for three to four hours after addition of
arabinose. A high degree of aeration was maintained throughout the
bacterial growth in order to achieve maximal production of the
desired gene product. One milliliter aliquots of the culture were
removed for analysis of protein content.
[0781] Secretion and Osmotic Shock
[0782] Three hour post induction samples were fractionated by
osmotic shock [Neu and Heppel (1965)]. The optical density (Klett
value) of the cultures was determined and 1 ml of cells were
centrifuged in a Sigma microcentrifuge (West Germany) model 202MK
in 1.5 mls snap top microcentrifuge tubes for 5 minutes at 10,000
rpm. The cell pellet was resuspended very gently by pipeting in a
room temperature sucrose solution (20% sucrose w/v, 30 mM Tris-Hcl
pH7.5, 1 mM EDTA), using 1 .mu.l/1 Klett unit. Following a 10
minute incubation at room temperature, the cells were centrifuged
for 5 minutes at 10,000 rpm. The sucrose fraction was carefully
removed from the cell pellet. The cell pellet was then resuspended
very gently by pipeting in ice cold distilled water, using 1
.mu.l/l Klett unit. Following a 10 minute incubation on ice, the
cells were centrifuged for 5 minutes at 12,000 rpm. The water
fraction was carefully removed. Equal volumes of the sucrose and
water fractions were pooled and aliquoted to provide samples for
activity screening.
[0783] Analysis of Protein Content of E. coli Cultures Producing
hIL-3 Mutant Polypeptides
[0784] Bacterial cells from cultures treated as described above
were collected from the medium by centrifugation. Aliquots of these
cells were resuspended in SDS loading buffer (4.times.: 6 g SDS, 10
ml beta-mercaptoethanol, 25 ml upper Tris gel stock (0.5 M Tris HCl
pH 6.8, 0.4% SDS) brought to 50 ml with glycerol, 0.2% bromophenol
blue was added) at a concentration of one microliter per Klett
unit. These samples were incubated at 85.degree. C. for five
minutes and vortexed. Five or ten microliter aliquots of these
samples were loaded on 15% polyacrylamide gels prepared according
to the method of Laemmli (1970). Protein bands were visualized by
staining the gels with a solution of acetic acid, methanol and
water at 5:1:5 ratio (volume to volume) to which Coomassie blue had
been added to a final concentration of 1%. After staining, the gels
were washed in the same solution without the Coomassie blue and
then washed with a solution of 7% acetic acid, 5% methanol. Gels
were dried on a gel drier Model SE1160 obtained from Hoeffer (San
Francisco, Calif.). The amount of stained protein was measured
using a densitometer obtained from Joyce-Loebl (Gateshead,
England). The values obtained were a measure of the amount of the
stained hIL-3 protein compared to the total of the stained protein
of the bacterial cells.
[0785] Western Blot Analysis of hIL-3 Muteins made in E. coli
[0786] In some E. coli cultures producing hIL-3, the level of
accumulation of the hIL-3 protein is lower than 5% of total
bacterial protein. To detect hIL-3 produced at this level, Western
blot analysis was used. Proteins from cultures induced with
nalidixic acid or arabinose were run on polyacrylamide gels as
described above except that volumes of sample loaded were adjusted
to produce appropriate signals. After electrophoresis, the proteins
were electroblotted to APT paper, Transa-bind, Schleicher and
Schuell (Keene, N.H.) according to the method of Renart et al.
(1979). Antisera used to probe these blots had been raised in
rabbits, using peptides of the sequence of amino acids 20 to 41 and
94 to 118 of hIL-3 as the immunogens. The presence of bound
antibody was detected with Staphylococcal protein A radiolabeled
with .sup.125I, obtained from New England Nuclear (Boston,
Mass.).
[0787] Fractionation of E. coli Cells Producing hIL-3 Proteins in
the Cytoplasm
[0788] Cells from E. coli cultures harboring plasmids that produce
hIL-3 muteins were induced with nalidixic acid. After three hours,
the hIL-3 muteins accumulated in retractile bodies. The first step
in purification of the hIL-3 muteins was to sonicate cells.
Aliquots of the culture were resuspended from cell pellets in
sonication buffer: 10 mM Tris, pH 8.0, 1 mM EDTA, 50 mM NaCl and
0.1 mM PMSF. These resuspended cells were subjected to several
repeated sonication bursts using the microtip from a Sonicator cell
disrupter, Model W-375 obtained from Heat Systems-Ultrasonics Inc.
(Farmingdale, N.Y.). The extent of sonication was monitored by
examining the homogenates under a light microscope. When nearly all
of the cells had been broken, the homogenates were fractionated by
centrifugation. The pellets, which contain most of the refractile
bodies, are highly enriched for hIL-3 muteins.
[0789] Methods: Extraction, Refolding and Purification of
Interleukin-3 (IL-3) Muteins Expressed as Refractile Bodies in E.
coli.
[0790] Extraction of refractile bodies (RB's):
[0791] For each gram of RB's (and typically one gram is obtained
from a 300 ml E. coli culture), 5 ml of a solution containing 6M
guanidine hydrochloride (GnHCl), 50 mM
2-N-cyclohexylaminoethanesulfonic acid (CHES) pH 9.5 and 20 mM
dithiothreitol (DTT) was added. The RB's were extracted with a
Bio-Homogenizer for 15-30 seconds and gently rocked for 2 hours at
5 degrees centigrade (5.degree. C.) to allow the protein to
completely reduce and denature.
[0792] Refolding of the IL-3 Muteins
[0793] The protein solution was transferred to dialysis tubing
(1000 molecular weight cut-off) and dialyzed against at least 100
volumes of 4M GnHCl-50 mM CHES pH 8.0. The dialysis was continued
overnight at 5.degree. C. while gently stirring. Subsequently
dialysis was continued against at least 100 volumes of 2M GnHCl-50
mM CHES pH 8.0 and dialyzed overnight at 5.degree. C. while gently
stirring.
[0794] Purification of the IL-3 Muteins
[0795] The protein solution was removed from the dialysis tubing
and acidified by the addition of 40% acetonitrile (CH.sub.3CN)-0.2%
trifluoroacetic acid (TFA) to a final concentration of 20%
CH.sub.3CN-0.1% TFA. This was centrifuged (16,000.times.g for 5
minutes) to clarify and the supernatant was loaded onto a Vydac
C-18 reversed phase column (10.times.250 mm) available from Vydac
(Hesperia, Calif.) previously equilibrated in 20% CH.sub.3CN-0.1%
TFA. The column was eluted with a linear gradient (0.2%
CH.sub.3CN/minute) between 40-50% CH.sub.3CN-0.1% TFA at a flow
rate of 3 ml/minute while collecting 1.5 ml fractions. The
fractions were analyzed by polyacrylamide gel electrophoresis
(SDS-PAGE) and the appropriate fractions pooled. The pooled
material was dried by lyophilization or in a Speed Vac
concentrator. The dry powder was reconstituted with 10 mM ammonium
bicarbonate pH 7.5, centrifuged (16,000.times.g for 5 minutes) to
clarify and assayed for protein concentration by the method of
Bradford (1976) with bovine serum albumin as the standard. Such
protein can be further analyzed by additional techniques such as,
SDS-PAGE, electrospray mass spectrometry, reverse phase HPLC,
capillary zone electrophoresis, amino acid composition analysis,
and ELISA (enzyme-linked immunosorbent assay).
[0796] hIL-3 SANDWICH ELISA
[0797] IL-3 protein concentrations can be determined using a
sandwich ELISA based on an affinity purified polyclonal goat
anti-rhIL-3. Microtiter plates (Dynatech Immulon II) were coated
with 150 .mu.l goat-anti-rhIL-3 at a concentration of approximately
1 .mu.g/ml in 100 mM NaHCO3, pH 8.2. Plates were incubated
overnight at room temperature in a chamber maintaining 100%
humidity. Wells were emptied and the remaining reactive sites on
the plate were blocked with 200 .mu.l of solution containing 10 mM
PBS, 3% BSA and 0.05% Tween 20, pH 7.4 for 1 hour at 37.degree. C.
and 100% humidity. Wells were emptied and washed 4.times. with 150
mM NaCl containing 0.05% Tween 20 (wash buffer). Each well then
received 150 .mu.l of dilution buffer (10 mM PBS containing 0.1%
BSA, 0.01% Tween 20, pH 7.4), containing rhIL-3 standard, control,
sample or dilution buffer alone. A standard curve was prepared with
concentrations ranging from 0.125 ng/ml to 5 ng/ml using a stock
solution of rhIL-3 (concentration determined by amino acid
composition analysis). Plates were incubated 2.5 hours at
37.degree. C. and 100% humidity. Wells were emptied and each plate
was washed 4.times. with wash buffer. Each well then received 150
.mu.l of an optimal dilution (as determined in a checkerboard assay
format) of goat anti-rhIL-3 conjugated to horseradish peroxidase.
Plates were incubated 1.5 hours at 37.degree. C. and 100% humidity.
Wells were emptied and each plate was washed 4.times. with wash
buffer. Each well then received 150 ul of ABTS substrate solution
(Kirkegaard and Perry). Plates were incubated at room temperature
until the color of the standard wells containing 5 ng/ml rhIL-3 had
developed enough to yield an absorbance between 0.5-1.0 when read
at a test wavelength of 410 nm and a reference wavelength of 570 nm
on a Dynatech microtiter plate reader. Concentrations of
immunoreactive rhIL-3 in unknown samples were calculated from the
standard curve using software supplied with the plate reader.
[0798] AML Proliferation Assay for Bioactive Human
Interleukin-3
[0799] The factor-dependent cell line AML 193 was obtained from the
American Type Culture Collection (ATCC, Rockville, Md.). This cell
line, established from a patient with acute myelogenous leukemia,
is a growth factor dependent cell line which displayed enhanced
growth in GM/CSF supplemented medium (Lange, B., et al., (1987);
Valtieri, M., et al., (1987). The ability of AML 193 cells to
proliferate in the presence of human IL-3 has also been documented.
(Santoli, D., et al., (1987)). A cell line variant was used, AML
193 1.3, which was adapted for long term growth in IL-3 by washing
out the growth factors and starving the cytokine dependent AML 193
cells for growth factors for 24 hours. The cells were then replated
at 1.times.10.sup.5 cells/well in a 24 well plate in media
containing 100 U/ml IL-3. It took approximately 2 months for the
cells to grow rapidly in IL-3. These cells were maintained as AML
193 1.3 thereafter by supplementing tissue culture medium (see
below) with human IL-3.
[0800] AML 193 1.3 cells were washed 6 times in cold Hanks balanced
salt solution (HBSS, Gibco, Grand Island, N.Y.) by centrifuging
cell suspensions at 250.times.g for 10 minutes followed by
decantation of supernatant. Pelleted cells were resuspended in HBSS
and the procedure was repeated until six wash cycles were
completed. Cells washed six times by this procedure were
resuspended in tissue culture medium at a density ranging from
2.times.10.sup.5 to 5.times.10.sup.5 viable cells/ml. This medium
was prepared by supplementing Iscove's modified Dulbecco's Medium
(TMDM, Hazleton, Lenexa, Kans.) with albumin, transferrin, lipids
and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim,
Indianapolis, Ind.) was added at 500 .mu.g/ml; human transferrin
(Boehringer-Mannheim, Indianapolis, Ind.) was added at 100
.mu.g/ml; soybean lipid (Boehringer-Mannheim, Indianapolis, Ind.)
was added at 50 .mu.g/ml; and 2-mercaptoethanol (Sigma, St. Louis,
Mo.) was added at 5.times.10.sup.-5 M.
[0801] Serial dilutions of human interleukin-3 or human
interleukin-3 variant protein (hIL-3 mutein) were made in
triplicate series in tissue culture medium supplemented as stated
above in 96 well Costar 3596 tissue culture plates. Each well
contained 50 .mu.l of medium containing interleukin-3 or
interleukin-3 variant protein once serial dilutions were completed.
Control wells contained tissue culture medium alone (negative
control). AML 193 1.3 cell suspensions prepared as above were added
to each well by pipetting 50 .mu.l (2.5.times.10.sup.4 cells) into
each well. Tissue culture plates were incubated at 37.degree. C.
with 5% CO.sub.2 in humidified air for 3 days. On day 3, 0.5 .mu.Ci
.sup.3H-thymidine (2 Ci/mM, New England Nuclear, Boston, Mass.) was
added in 50 .mu.l of tissue culture medium. Cultures were incubated
at 37.degree. C. with 5% CO.sub.2 in humidified air for 18-24
hours. Cellular DNA was harvested onto glass filter mats (Pharmacia
LKB, Gaithersburg, Md.) using a TOMTEC cell harvester (TOMTEC,
Orange, Conn.) which utilized a water wash cycle followed by a 70%
ethanol wash cycle. Filter mats were allowed to air dry and then
placed into sample bags to which scintillation fluid (Scintiverse
II, Fisher Scientific, St. Louis, Mo. or BetaPlate Scintillation
Fluid, Pharmacia LKB, Gaithersburg, Md.) was added. Beta emissions
of samples from individual tissue culture wells were counted in a
LKB Betaplate model 1205 scintillation counter (Pharmacia LKB,
Gaithersburg, Md.) and data was expressed as counts per minute of
.sup.3H-thymidine incorporated into cells from each tissue culture
well. Activity of each human interleukin-3 preparation or human
interleukin-3 variant preparation was quantitated by measuring cell
proliferation (.sup.3H-thymidine incorporation) induced by graded
concentrations of interleukin-3 or interleukin-3 variant.
Typically, concentration ranges from 0.05 pM-10.sup.5 pM are
quantitated in these assays. Activity is determined by measuring
the dose of interleukin-3 or interleukin-3 variant which provides
50% of maximal proliferation [EC.sub.50-0.5.times.(maximum average
counts per minute of .sup.3H-thymidine incorporated per well among
triplicate cultures of all concentrations of interleukin-3
tested-background proliferation measured by .sup.3H-thymidine
incorporation observed in triplicate cultures lacking
interleukin-3]. This EC.sub.50 value is also equivalent to 1 unit
of bioactivity. Every assay was performed with native interleukin-3
as a reference standard so that relative activity levels could be
assigned.
[0802] Relative biological activities of IL-3 muteins of the
present invention are shown in Table 1. The Relative Biological
Activity of IL-3 mutants is calculated by dividing the EC.sub.50 of
(1-133) hIL-3 by the EC.sub.50 of the mutant. The Relative
Biological Activity may be the average of replicate assays.
11TABLE 1 BIOLOGICAL ACTIVITY OF IL-3 MUTEINS Relative* Plasmid
Biological Polypeptide Code Structure Activity Reference (1-133)
hIL-3 1 pMON13298 SEQ ID NO. 82 3 pMON13299 SEQ ID NO. 83 2
pMON13300 SEQ ID NO. 84 3 pMON13301 SEQ ID NO. 85 2 pMON13302 SEQ
ID NO. 86 1.2 pMON13303 SEQ ID NO. 87 0.6 pMON13287 SEQ ID NO. 88
26 pMON13288 SEQ ID NO. 89 24 pMON13289 SEQ ID NO. 90 13 pMON13290
SEQ ID NO. 91 20 pMON13292 SEQ ID NO. 92 6 pMON13294 SEQ ID NO. 93
3 pMON13295 SEQ ID NO. 94 3 pMON13312 SEQ ID NO. 95 4 pMON13313 SEQ
ID NO. 96 8 pMON13285 SEQ ID NO. 259 32 pMON13286 SEQ ID NO. 260 8
pMON13325 SEQ ID NO. 261 8 pMON13326 SEQ ID NO. 262 25 pMON13330
SEQ ID NO. 263 19 pMON13329 SEQ ID NO. 406 10 pMON13364 SEQ ID NO.
117 13 pMON13475 SEQ ID NO. 280 7 pMON13366 SEQ ID NO. 281 38
pMON13367 SEQ ID NO. 282 36 pMON13368 SEQ ID NO. 278 1.6 pMON13369
SEQ ID NO. 283 10 pMON13370 SEQ ID NO. 284 6 pMON13373 SEQ ID NO.
285 12 pMON13374 SEQ ID NO. 286 6 pMON13375 SEQ ID NO. 287 14
pMON13376 SEQ ID NO. 288 0.4 pMON13377 SEQ ID NO. 289 0.4 pMON13379
SEQ ID NO. 291 0.9 pMON13380 SEQ ID NO. 279 0.05 pMON13381 SEQ ID
NO. 293 10 pMON13382 SEQ ID NO. 313 38 pMON13383 SEQ ID NO. 294 0.5
pMON13384 SEQ ID NO. 295 0.25 pMON13385 SEQ ID NO. 292 1 pMON13387
SEQ ID NO. 308 32 pMON13388 SEQ ID NO. 296 23 pMON13389 SEQ ID NO.
297 10 pMON13391 SEQ ID NO. 298 30 pMON13392 SEQ ID NO. 299 17
pMON13393 SEQ ID NO. 300 32 pMON13394 SEQ ID NO. 301 20 pMON13395
SEQ ID NO. 302 11 pMON13396 SEQ ID NO. 303 20 pMON13397 SEQ ID NO.
304 16 pMON13398 SEQ ID NO. 305 36 pMON13399 SEQ ID NO. 306 18
pMON13404 SEQ ID NO. 307 1.3 pMON13417 SEQ ID NO. 310 24 pMON13420
SEQ ID NO. 311 19 pMON13421 SEQ ID NO. 312 0.5 pMON13432 SEQ ID NO.
313 10 pMON13400 SEQ ID NO. 317 0.09 pMON13402 SEQ ID NO. 318 20
pMON13403 SEQ ID NO. 321 0.03 pMON13405 SEQ ID NO. 267 9 pMON13406
SEQ ID NO. 264 5 pMON13407 SEQ ID NO. 266 16 pMON13408 SEQ ID NO.
269 7 pMON13409 SEQ ID NO. 270 15 pMON13410 SEQ ID NO. 271 0.4
pMON13411 SEQ ID NO. 322 1.2 pMON13412 SEQ ID NO. 323 0.5 pMON13413
SEQ ID NO. 324 0.6 pMON13414 SEQ ID NO. 265 4 pMON13415 SEQ ID NO.
268 4 pMON13418 SEQ ID NO. 326 0.5 pMON13419 SEQ ID NO. 325 0.015
pMON13422 SEQ ID NO. 272 0.4 pMON13423 SEQ ID NO. 273 0.4 pMON13424
SEQ ID NO. 274 3 pMON13425 SEQ ID NO. 275 6 pMON13426 SEQ ID NO.
276 >0.0003 pMON13429 SEQ ID NO. 277 >0.0002 pMON13440 SEQ ID
NO. 319 9 pMON13451 SEQ ID NO. 320 0.1 pMON13459 SEQ ID NO. 328
0.003 pMON13416 SEQ ID NO. 309 19.9 pMON13428 SEQ ID NO. 327 0.008
pMON13467 SEQ ID NO. 329 0.16 pMON13446 SEQ ID NO. 315 21.5
pMON13390 SEQ ID NO. 316 20 *The Relative Biological Activity of
IL-3 mutants is calculated by dividing the EC.sub.50 of (1-133)
hIL-3 by the EC.sub.50 of the mutant.
[0803] The following assay is used to measure IL-3 mediated
sulfidoleukotriene release from human mononuclear cells.
[0804] IL-3 Mediated Sulfidoleukotriene Release from Human
Mononuclear Cells
[0805] Heparin-containing human blood was collected and layered
onto an equal volume of Ficoll-Paque (Pharmacia #17-0840-02) ready
to use medium (density 1.077 g/ml.). The Ficoll was warmed to room
temperature prior to use and clear 50 ml polystyrene tubes were
utilized. The Ficoll gradient was spun at 300.times.g for 30
minutes at room temperature using a H1000B rotor in a Sorvall
RT6000B refrigerated centrifuge. The band containing the
mononuclear cells was carefully removed, the volume adjusted to 50
mls with Dulbecco's phosphate-buffered saline (Gibco Laboratories
cat. #310-4040PK), spun at 400.times.g for 10 minutes at 4.degree.
C. and the supernatant was carefully removed. The cell pellet was
washed twice with HA Buffer [20 mM Hepes (Sigma #H-3375), 125 mM
NaCl (Fisher #S271-500), 5 mM KCl (Sigma #P-9541), 0.5 mM glucose
(Sigma #G-5000), 0.025% Human Serum Albumin (Calbiochem #126654)
and spun at 300.times.g, 10 min., 4.degree. C. The cells were
resuspended in HACM Buffer (HA buffer supplemented with 1 mM
CaCl.sub.2 (Fisher #C79-500) and 1 mM MgCl.sub.2 (Fisher #M-33) at
a concentration of 1.times.106 cells/ml and 180 .mu.l were
transferred into each well of 96 well tissue culture plates. The
cells were allowed to acclimate at 37.degree. C. for 15 minutes.
The cells were primed by adding 10 .mu.ls of a 20.times. stock of
various concentrations of cytokine to each well (typically 100000,
20000, 4000, 800, 160, 32, 6.4, 1.28, 0 fM IL3). The cells were
incubated for 15 minutes at 37.degree. C. Sulfidoleukotriene
release was activated by the addition of 10 .mu.ls of
20.times.(1000 nM) fmet-leu-phe (Calbiochem #344252) final
concentration 50 nM FMLP and incubated for 10 minutes at 37.degree.
C. The plates were spun at 350.times.g at 4.degree. C. for 20
minutes. The supernatants were removed and assayed for
sulfidoleukotrienes using Cayman's Leukotriene C4 EIA kit (Cat.
#420211) according to manufacturers' directions. Native (15-125)
hIL-3 was run as a standard control in each assay.
[0806] Native hIL-3 possesses considerable inflammatory activity
and has been shown to stimulate synthesis of the arachidonic acid
metabolites LTC.sub.4, LTD.sub.4, and LTE.sub.4; histamine
synthesis and histamine release. Human clinical trials with native
hIL-3 have documented inflammatory responses (Biesma, et al.,
BLOOD, 80:1141-1148 (1992) and Postmus, et al., J. CLIN. ONCOL.,
10:1131-1140 (1992)). A recent study indicates that leukotrienes
are involved in IL-3 actions in vivo and may contribute
significantly to the biological effects of IL-3 treatment
(Denzlinger, C., et al., BLOOD, 81:2466-2470 (1993))
[0807] Some muteins of the present invention may have an improved
therapeutic profile as compared to native hIL-3 or (15-125) hIL-3.
For example, some muteins of the present invention may have a
similar or more potent growth factor activity relative to native
hIL-3 or (15-125) hIL-3 without having a similar or corresponding
increase in the stimulation of leukotriene or histamine. These
muteins would be expected to have a more favorable therapeutic
profile since the amount of polypeptide which needs to be given to
achieve the desired growth factor activity (e. g. cell
proliferation) would have a lesser leukotriene or histamine
stimulating effect. In studies with native hIL-3, the stimulation
of inflammatory factors has been an undesirable side effect of the
treatment. Reduction or elimination of the stimulation of mediators
of inflammation would provide an advantage over the use of native
hIL-3.
[0808] The pMON13288 polypeptide has demonstrated a more potent
growth factor activity relative to native hIL-3 in the AML 193 cell
proliferation assay (EC.sub.50=0.8-3.8 pM for pMON13288 and
EC.sub.50=30.2 pM for native hIL-3) without demonstrating a
corresponding increase in the stimulation of leukotriene C.sub.4
(LTC.sub.4) production and histamine release, i. e., it stimulated
LTC.sub.4 production and histamine release with a potency similar
to that of native hIL-3 while having an improved ability to
stimulate cell proliferation compared to native hIL-3. Thus with
the pMON13288 polypeptide it would be expected that one would be
able to produce a desired therapeutic response, e. g., cell
proliferation, with less stimulation of the undesirable
inflammatory mediators.
[0809] Some muteins of the present invention have antigenic
profiles which differ from that of native hIL-3. For example, in a
competition ELISA with an affinity purified polyclonal goat
anti-hIL-3 antibody, native hIL-3 significantly blocked the binding
of labeled hIL-3 to polyclonal anti-hIL-3 antibody whereas the
pMON13288 polypeptide failed to block the binding of hIL-3 to
anti-hIL-3 antibody.
[0810] Table 2 lists the sequences of some oligonucleotides used in
making the muteins of the present invention.
[0811] Table 3 lists the amino acid sequence of native (15-125)
hIL-3 (Peptide #1) and the amino acid sequences of some mutant
polypeptides of the present invention. The sequences are shown with
the amino acid numbering corresponding to that of native hIL-3
[FIG. 1].
[0812] Table 4 lists the nucleotide sequences of some DNA sequences
which encode mutant polypeptides of the present invention.
12TABLE 2 OLIGONUCLEOTIDES Oligo #1 Length: 000040 CATGGCTAAC
TGCTCTATAA TGATCGATGA AATTATACAT [SEQ ID NO:15] Oligo #2 Length:
000045 CTTTAAGTGA TGTATAATTT CATCGATCAT TATAGAGCAG TTAGC [SEQ ID
NO:16] Oligo #3 Length: 000036 CACTTAAAGA GACCACCTGC ACCTTTGCTG
GACCCG [SEQ ID NO:17] Oligo #4 Length: 000036 GAGGTTGTTC GGGTCCAGCA
AAGGTGCAGG TGGTCT [SEQ ID NO:18] Oligo #5 Length: 000036 CACTTAAAGA
GACCACCTAA CCCTTTGCTG GACCCG [SEQ ID NO:19] Oligo #6 Length: 000036
GAGGTTGTTC GGGTCCAGCA AAGGGTTAGG TGGTCT [SEQ ID NO:20] Oligo #7
Length: 000036 CACTTAAAGG TTCCACCTGC ACCTTTGCTG GACAGT [SEQ ID
NO:21] Oligo #8 Length: 000036 GAGGTTGTTA CTGTCCAGCA AAGGTGCAGG
TGGAAC [SEQ ID NO:22] Oligo #9 Length: 000027 AACAACCTCA ATGCTGAAGA
CGTTGAT [SEQ ID NO:23] Oligo #10 Length: 000018 ATCAACGTCT TGAGCATT
[SEQ ID NO:24] Oligo #11 Length: 000027 AACAACCTCA ATTCTGAAGA
CATGGAT [SEQ ID NO:25] Oligo #12 Length: 000018 ATCCATGTCT TCAGAATT
[SEQ ID NO:26] Oligo #13 Length: 000022 CATGGGAACC ATATGTCAGG AT
[SEQ ID NO:27] Oligo #14 Length: 000018 ATCCTGACAT ATGGTTCC [SEQ ID
NO:28] Oligo #15 Length: 000016 TGAACCATAT GTCAGG [SEQ ID NO:29]
Oligo #16 Length: 000024 AATTCCTGAC ATATGGTTCA TGCA [SEQ ID NO:30]
Oligo #17 Length: 000020 AATTCGAACC ATATGTCAGA [SEQ ID NO:31] Oligo
#18 Length: 000020 AGCTTCTGAC ATATGGTTCG [SEQ ID NO:32] Oligo #19
Length: 000022 ATCGAACCAT ATGTCAGATG CA [SEQ ID NO:33] Oligo #20
Length: 000018 TCTGACATAT GGTTCGAT [SEQ ID NO:34] Oligo #21 Length:
000036 ATCCTGATGG AACGAAACCT TCGACTTCCA AACCTG [SEQ ID NO:35] Oligo
#22 Length: 000027 AAGTCGAAGG TTTCGTTCCA TCAGGAT [SEQ ID NO:36]
Oligo #23 Length: 000036 ATCCTGATGG AACGAAACCT TCGAACTCCA AACCTG
[SEQ ID NO:37] Oligo #24 Length: 000027 AGTTCGAAGG TTTCGTTCCA
TCAGGAT [SEQ ID NO:39] Oligo #25 Length: 000024 CTCGGATTCG
TAAGGSCTGT CAAG [SEQ ID NO:39] Oligo #26 Length: 000024 CCTTACGAAT
GCGAGCAGGT TTGG [SEQ ID NO:40] Oligo #27 Length: 000024 GAGAGCTTCG
TAAGGGCTGT CAAG [SEQ ID NO:41] Oligo #28 Length: 000024 CCTTACGAAG
CTCTCCAGGT TTGG [SEQ ID ND:42] Oligo #29 Length: 000015 CACTTAGAAA
ATGCA [SEQ ID NO:43] Oligo #30 Length: 000020 TTTTCTAAGT GCTTGACAGC
[SEQ ID NO:44] Oligo #31 Length: 000015 AACTTAGAAA ATGCA [SEQ ID
NO:45] Oligo #32 Length: 000020 TTTTCTAAGT TCTTGACAGC [SEQ ID
NO:46] Oligo #33 Length: 000048 GGTGATTGGA TGTCGAGAGG GTGCGGCCGT
GGCAGAGGGC AGACATGG [SEQ ID NO:47] Oligo #34 Length: 000048
CTGCCCTCTG CCACGGCCGC ACCCTCTCGA CATCCAATCA CCATCAAG [SEQ ID NO:48]
Oligo #35 Length: 000048 GATGATTGGA TGTCGAGAGG GTGCGGCCGT
GGGAGAGGGC AGACATGG [SEQ ID NO:49] Oligo #36 Length: 000048
CTGCCCTCTG CCACGGCCGC ACCCTCTCGA CATCCAATCA TCATCAAG [SEQ ID NO:50]
Oligo #37 Length: 000018 TACGAGATTA CGAAGAAT [SEQ ID NO:51] Oligo
#38 Length: 000018 CGTAATCTCG TACCATGT [SEQ ID NO:52] Oligo #39
Length: 000018 TTGGAGATTA CGAAGAAT [SEQ ID NO:53] Oligo #40 Length:
000018 CGTAATCTCC AACCATGT [SEQ ID NO:54] Oligo #41 Length: 000019
TGCCTCAATA CCTGATGCA [SEQ ID NO:55] Oligo #42 Length: 000021
TCAGGTATTG AGGCAATTCT T [SEQ ID NO:56] Oligo #43 Length: 000026
AATTCTTGCC AGTCACCTGC CTTGAT [SEQ ID NO:57] Oligo #44 Length:
000016 GCAGGTGACT GGCAAG [SEQ ID NO:58] Oligo #45 Length: 000032
AATTCCGGGA AAAACTGACG TTCTATCTGG TT [SEQ ID NO:59] Oligo #46
Length: 000037 CTCAAGGGAA ACCAGATAGA ACGTCAGTTT TTCCCGG [SEQ ID
NO:60] Oligo #47 Length: 000032 ACCCTTGAGC ACGCGCAGGA ACAACAGTAA TA
[SEQ ID NO:61] Oligo #48 Length: 000027 AGCTTATTAC TGTTGTTCCT
GCGCGTG [SEQ ID NO:62] Oligo #49 Length: 000032 ACCCTTGAGC
AAGCGCAGGA ACAACAGTAA TA [SEQ ID NO:63] Oligo #50 Length: 000027
AGCTTATTAC TGTTGTTCCT GCGCTTG [SEQ ID NO:64] Oligo #51 Length:
000034 GCCGATACCGCGGCATACTCCCACCATTCAGAGA [SEQ ID NO:155] Oligo #52
Length: 000033 GCCGATAAGATCTAAAACGGGTATG- GAGAAACA [SEQ ID NO:156]
Oligo #53 ATAGTCTTCCCCAGATATCTAACGCTTGAG [SEQ ID NO:157] Oligo #54
Length: 24 CAATACCTGATGCGTTTTCTAAGT [SEQ ID NO:158] Oligo #55
Length: 33 GGTTTCGTTCCATCAGAATGTCCATGTCTTCAG [SEQ ID NO:159] Oligo
#165 NCOECRV1.REQ Length: 000040 CATGGCTAAC TGCTCTAACA TGATCGATGA
AATTATAACA [SEQ ID NO: 162] Oligo #166 NCOECRV4.REQ Length: 000045
CTTTAAGTGT GTTATAATTT CATCGATCAT GTTAGAGCAG TTAGC [SEQ ID NO:163]
Oligo #167 NCOECRV2.REQ Length: 000036 CACTTAAAGC AGCCACCTTT
GCCTTTGCTG GACTTC [SEQ ID NO:164] Oligo #168 NCOECRV5.REQ Length:
000036 GAGGTTGTTG AAGTCCAGCA AAGGCAAAGC TGGCTG [SEQ ID NO:165]
Oligo #169 2D5M6SUP.:REQ Length: 000027 AACAACCTCA ATGACGAAGA
CATGTCT [SEQ ID NO:166] Oligo #170 2D5M6SLO.REQ Length: 000018
AGACATGTCT TCGTCATT [SEQ ID NO:167] Oligo #15(A) Length: 000016
TGAACCATAT GTCAGG [SEQ ID NO:168] Oligo #16(A) Length: 000024
AATTCCTGAC ATATGGTTCA TGCA [SEQ ID NO:169] Oligo #B1 19ALA1.REQ
Length: 000040 CATGGCAAAC TGCTCTATAG CTATCGATGA AATTATACAT [SEQ ID
NO:170] Oligo #B2 19ALA4.REQ Length: 000045 CTTTAAGTGA TGTATAATTT
CATCGATAGC TATAGAGGAG TTTGC [SEQ ID NO:171] Oligo #B3 19ILE1.REQ
Length: 000040 CATGGCAAAC TGCTCTATAA TCATCGATGA AATTATACAT [SEQ ID
NO:172] Oligo #B 19ILE4.REQ Length: 000045 CTTTAAGTGA TGTATAATTT
CATCGATGAT TATAGAGCAG TTTGC [SEQ ID NO:173] Oligo #B5 49ASP1.REQ
Length: 000036 ATCCTGGACG AACGAAAGCT TCGAACTCCA AACCTG [SEQ ID
NO:174] Oligo #B6 49ASP4.REQ Length: 000027 AGTTCGAAGG TTTCGTTCGT
CCAGGAT [SEQ ID NO:175] Oligo #B7 491LE1.REQ Length: 000036
ATCCTGATCG AACGAAACCT TCGAACTCCA AACCTG [SEQ ID NO:176] Oligo #B8
491LE4.REQ Length: 000027 AGTTCGAAGG TTTCGTTCGA TCAGGAT [SEQ ID
NO:177] Oligo #B9 49LEU1.REQ Length: 000036 ATCCTGGTGG AACGAAACCT
TCGAACTCCA AACCTG [SEQ ID NO:178] Oligo #B10 49LEU4.REQ Length:
000027 AGTTCGAAGG TTTCGTTCCA GCAGGAT [SEQ ID NO:179] Oligo #B11
42S45V3.REQ Length: 000027 AACAACCTCA ATTCTGAAGA CGTTGAT [SEQ ID
NO:180] Oligo #B12 42S45V6.REQ Length: 000018 ATCAACGTCT TCAGAATT
[SEQ ID NO:181] Oligo #B13 18I23A5H.REQ Length: 000051 CGCGCCATGG
CTAAGTGCTC TATAATGATC GATGAAGCAA TACATCACTTA [SEQ ID NO:182] Oligo
#B14 2341HIN3.REQ Length: 000018 CGCGTCGATA AGCTTATT [SEQ ID
NO:183] Oligo #B15 2341NCO.REQ Length: 000018 GGAGATATAT CCATGGCT
[SEQ ID NO:184] Oligo #B16 2A5M6S0D.REQ Length: 000042 TCGGTCCATC
AGAATAGACA TGTCTTCAGC ATTGAGGTTG TT [SEQ ID NO:185] Oligo #B17
2A5V6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGAAA CGTCTTCAGC
ATTGAGGTTG TT [SEQ ID NO:186] Oligo #B18 2D5M6S0D.REQ Length:
000042 TCGGTCCATC AGAATAGACA TGTCTTCGTC ATTGAGGTTG TT [SEQ ID
NO:187] Oligo #B19 2D5V6S0D.REQ Length: 000042 TCGGTCCATC
AGAATAGAAA CGTCTTCGTC ATTGAGGTTG TT [SEQ ID NO:188] Oligo #B20
2S5M6S0D.REQ Length: 000042 TCGGTCCATC AGAATAGACA TGTCTTCAGA
ATTGAGGTTG TT [SEQ ID NO:189] Oligo #B21 2S5V6S0D.REQ Length:
000042 TCGGTCCATC AGAATAGAAA CGTCTTCAGA ATTGAGGTTG TT [SEQ ID
NO:190 ] Oligo #B22 100ARG3.REQ Length: 000048 CTGCCCTCTG
CCACGGCCGC ACCCTCTCGA CATCCAATCA TCATCCGT [SEQ ID NO:191] Oligo
#B23 100ARG8.REQ Length: 000026 AATTCTTGCC AGTCACCTGC ACGGAT [SEQ
ID NO:192] Oligo #B24 101MET4.REQ Length: 000016 ATGGGTGACT GGCAAG
[SEQ ID NO:193] Oligo #B25 10R01M8.REQ Length: 000026 AATTCTTGCC
AGTCACCCAT ACGGAT [SEQ ID NO:194] Oligo #B26 23ALA1.REQ Length:
000040 CATGGCTAAC TGCTCTATTA TGATCGATGA AGCAATACAT [SEQ ID NO:195]
Oligo #B27 23ALA4.REQ Length: 000045 CTTTAAGTGA TGTATTGCTT
CATCGATCAT AATAGAGCAG TTAGC [SEQ ID NO:196] Oligo #B28 29V2R4S2.REQ
Length: 000036 CACTTAAAGG TACCACCTCG CCCTTCCCTG GACCCG [SEQ ID
NO:197] Oligo #B29 29V2R4S5.REQ Length: 000036 GAGGTTGTTC
GGGTCCAGGG AAGGGCGAGG TGGTAC [SEQ ID NO:198] Oligo #B30 34SER2.REQ
Length: 000036 CACTTAAAGA GACCACCTGC ACCTTCCCTG GACCCG [SEQ ID
NO:199] Oligo #B31 34SER5.REQ Length: 000036 GAGGTTGTTC GGGTCCAGGG
AAGGTGCAGG TGGTCT [SEQ ID NO:200] Oligo #B32 42D45M3.REQ Length:
000027 AACAACCTCA ATGACGAAGA CATGGAT [SEQ ID NO:201] Oligo #B33
42D45M6.REQ Length: 000018 ATCCATGTCT TCGTCATT [SEQ ID NO:202]
Oligo #B34 42D45V3.REQ Length: 000027 AACAACCTCA ATGACGAAGA CGTCGAT
[SEQ ID NO:203] Oligo #B35 42D45V6.REQ Length: 000018 ATCGACGTCT
TCGTCATT [SEQ ID NO:204] Oligo #B36 42D5M6S3.REQ Length: 000027
AACAACCTCA ATGACGAAGA CATGTCT [SEQ ID NO:205] Oligo #B37
42D5M6S6.REQ Length: 000018 AGACATGTCT TCGTCATT [SEQ ID NO:206]
Oligo #B38 42D5V6S3.REQ Length: 000027 AACAACCTCA ATGACGAAGA
CGTCTCT [SEQ ID NO:207] Oligo #B39 42D5V6S6.REQ Length: 000018
AGAGACGTCT TCGTCATT [SEQ ID NO:208] Oligo #B40 50ASP1.REQ Length:
000036 ATCCTGATGG ACCGAAACCT TCGACTTCCA AACCTG [SEQ ID NO:209]
Oligo #B41 50ASP4.REQ Length: 000027 AAGTCGAAGG TTTCGGTCCA TCAGGAT
[SEQ ID NO:210] Oligo #B42 50D56S1.REQ Length: 000036 ATCCTGATGG
ACCGAAACCT TCGACTTAGC AACCTG [SEQ ID NO:211] Oligo #B43 56SER5.REQ
Length: 000024 CCTTACGAAG CTCTCCAGGT TGCT [SEQ ID NO:212] Oligo
#B44 82TRP2.REQ Length: 000018 CGTAATCTCT GGCCATGT [SEQ ID NO:213]
Oligo #B45 82TRP6.REQ Length: 000018 CCAGAGATTA CGAAGAAT [SEQ ID
NO:214] Oligo #B46 9E12Q6W1.REQ Length: 000032 AATTCCGGGA
AAAACTGCAA TTCTATCTGT GG [SEQ ID NO:215] Oligo #B47 9E12Q6W3.REQ
Length: 000037 CTCAAGGGTC CACACATACA ATTGCAGTTT TTCCCGG [SEQ ID
NO:216] Oligo #B48 9E12Q6V1.REQ Length: 000032 AATTCCGGGA
AAAACTGCAA TTCTATCTGG TT [SEQ ID NO:217] Oligo #B49 9E12Q6V3.REQ
Length: 000037 CTCAAGGGTA ACCAGATAGA ATTGCAGTTT TTCCCGG [SEQ ID
NO:218] Oligo #B50 S09E16V1.REQ Length: 000023 AATTCCGGGA
AAAACTGACG TTC [SEQ ID NO:219] Oligo #B51 S09E16V3.REQ Length:
000028 AACCAGATAG AACGTCAGTT TTTCCCGG [SEQ ID NO:220] Oligo #B52
S116VD31.REQ Length: 000023 TATCTGGTTA CCCTTGAGTA ATA [SEQ ID
NO:221] Oligo #B53 SECR1D33.REQ Length: 000018 AGCTTATTAC TTCAAGGGT
[SEQ ID NO:222] Oligo #B54 S9E2Q6V1.REQ Length: 000023 AATTCCGGGA
AAAACTGCAA TTC [SEQ ID NO:223] Oligo #B55 S9E2Q6V3.REQ Length:
000028 AACCAGATAG AATTGCAGTT TTTCCCGG [SEQ ID NO:224] Oligo #B56
Ent338.Lo Length: 61 CGATCATTAT AGAGCAGTTA GCCTTGTCAT CGTCGTCCTT
GTAATCAGTT [SEQ ID NO:225] TCTGGATATG C Oligo #B57 Ent338.UP
Length: 63 CATGGCATAT CCAGAAACTG ATTACAAGGA CCACGATGAC AAGGCTAACT
[SEQ ID NO:226] GCTCTATAAT GAT 09L2Q8S1.REQ Length: 000032
AATTCCGGCT TAAACTGCAA TTCTATCTGT CT [SEQ ID NO:227] 09L2Q6S3.REQ
Length: 000037 CTCAAGGGTA GACAGATAGA ATTGCAGTTT AAGCCGG [SEQ ID
NO:228] 117S2.REQ Length: 000032 TCTCTTGAGC AAGCGCAGGA ACAACAGTAA
TA [SEQ ID NO:229] 19I0L3A1.REQ Length: 000040 CATGGCAAAC
TGCTCTATAA TACTCGATGA AGCAATACAT [SEQ ID NO:230] 19I0L3A4.REQ
Length: 000045 CTTTAAGTGA TGTATTGCTT CATCGAGTAT TATAGAGGAG TTTGC
[SEQ. ID NO.:231] 20P23A1.REQ Length: 000040 CATGGCAAAC TGCTCTATAA
TGCCAGATGA AGCAATACAT [SEQ. ID NO.:232] 20P23A4.REQ Length: 000045
CTTTAAGTGA TGTATTGCTT CATCTGGCAT TATAGAGCAG TTTGC [SEQ. ID NO.:233]
23L1.REQ Length: 000040 CATGGCaAAC TGCTCTATAA TGATCGATGA
AactgATACAT [SEQ. ID NO.:234] 23L4.REQ Length: 000045 CTTTAAGTGA
TGTATcagTT CATCGATCAT TATAGAGCAG TTtGC [SEQ. ID NO.:235]
29I45752.REQ Length: 000036 CACTTAAAGA TACCACCTAA CCCTAGCCTG GACAGT
[SEQ. ID NO.:236] 29I4S7S5.REQ Length: 000036 GAGGTTAGCA CTGTCCAGGC
TAGGGTTAGG TGGTAT [SEQ. ID NO.:237] 38A5V6S3.REQ Length: 000027
GCTAACCTCA ATTCCGAAGA CGTCTCT [SEQ. ID NO.:238] 38A5V6S6.REQ
Length: 000018 AGAGACGTCT TCGGAATT [SEQ. ID NO.:239] 50D51S1.REQ
Length: 000036 ATCCTGATGG ACTCCAACCT TCGAACTCCA AACCTG [SEQ. ID
NO.:240] 50D51S4.REQ Length: 000027 AGTTCGAAGG TTGGAGTCCA TCAGGAT
[SEQ. ID NO.:241] 5VYWPTT3.REQ Length: 000048 GTTCCCTATT GGACGGCCCC
TCCCTCTCGA ACACCAATCA CGATCAAG [SEQ. ID NO.:242] 5VYWPTT7.REQ
Length: 000048 CGTGATTGGT GTTCGAGAGG GAGGGGCCGT CCAATAGGGA ACACATGG
[SEQ. ID NO.:243] 62P3H5S2.REQ Length: 000024 CTCGCATTCC CACATGCTTC
TAAG [SEQ. ID NO.:244] 62P63H2.REQ Length: 000024 CTCGCATTCC
CACATGCTGT CAAG [SEQ. ID NO.:245] 62P63H5.REQ Length: 000024
ATGTGGGAAT GCGAGCAGGT TTGG [SEQ. ID NO.:246] 65S67Q6.REQ Length:
000020 TTTTCTAATT GCTTAGAAGC [SEQ. ID NO.:247] 67Q3.REQ Length:
000015 CAATTAGAAA ATGCA [SEQ. ID NO.:248] 67Q6.REQ Length: 00002]
TTTTCTAATT GCTTGACAGC [SEQ. ID NO.:249 76P1.REQ Length: 000021
TCAGGTATTG AGCCAATTCT T [SEQ. ID NO.:250] 76P5.REQ Length: 000019
TGGCTCAATA CCTGATGCA [SEQ. ID NO.:251] 79S2.REQ Length: 000018
TCTAATCTCC AACCATGT [SEQ. ID NO.:252] 79S6.REQ Length: 000018
TTGGAGATTA GAAAGAAT [SEQ. ID NO.:253] 9L2Q67S3.REQ Length: 000037
CTCAAGAGAA GACAGATAGA ATTGCAGTTT AAGCGG [SEQ. ID NO.:254]
9LQS1181.REQ Length: 000043 AATTCCGGCT TAAACTGCAA TTCTATCTGT
CTACCCTTTA ATA [SEQ. ID NO.:256] 9LQS1183.REQ Length: 000043
AGCTTATTAA AGGGTAGACA GATAGAATTG CAGTTTAAGC CGG [SEQ. ID NO.:257]
S9L2Q6S1.REQ Length: 000043 AATTCCGGCT TAAACTGCAA TTCTATCTGT
CTACCCTTTA ATA [SEQ. ID NO.:258]
[0813]
13TABLE 3 POLYPEPTIDES PEPTIDE #1; pMON5988 (Example 43);
(15-125)hIL-3 Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
[SEQ ID NO:65 ] 15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly 30 35 40 Gln Asp Gln Asp Ile Leu Met Glu Asn
Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala Val
Lys Asn Leu Gln Asn Ala Ser 60 65 70 Ala Ile Gln Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp Trp Asn Glu Phe
Arg Arg Lys Len Thr Phe Tyr Leu Lys Thr 105 110 115 Leu Glu Asn Ala
Gln Ala Gln Gln 120 125 Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr
His Leu [SEQ ID NO:65] Lys Gln Pro Pro Leu pro Leu Leu Asp Phe Asn
Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala
Gln Gln PEPTIDE #2; pMON13344 (Example 8); (15-125)hIL-3 (18I, 25H,
29R, 32A, 37P, 42A and 45V); Asn Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu [SEQ ID NO:66] 15 20 25 Lys Arg Pro Pro Ala Pro Leu
Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Gln Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp Trp
Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115 Leu
Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #3; pMON13345 (Example
9); (15-125)hIL-3 (18I, 25H, 29R, 32N, 37P, 42S and 45M); Asn Cys
Ser Ile Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:67] 15 20 25
Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35
40 Glu Asp Met Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45
50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro
Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys
Asp Gly 90 95 100 Asp Trp Asn Glu Phe Srg Arg Lys Leu Thr Phe Tyr
Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125
PEPTIDE #4; pMON13346 (Example 10); (15-125)hIL-3 (18I, 25H, 29V,
32A, 37S, 42A and 45M); Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:68] 15 20 25 Lys Val Pro Pro Ala pro Leu Leu Asp
Ser Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu
Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala
Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu
Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro
Thr Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115 Leu Glu Asn
Ala Gln Ala Gln Gln 120 125 PEPTIDE #5; pMON13347 (Example 12);
(15-125)hIL-3 (51R, 55L, 59L, 62V, 67N and 69E); Asn Cys Ser Asn
Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:69] 15 20 25 Lys Gln
Pro Pro Leu pro Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35 40 Glu
Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65
70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75
80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Ala Gly
90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #6;
pMON13348 (Example 13); (15-125)hIL-3 (51R, 55L, 60S, 62V, 67N and
69E); Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID
NO:704] 15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn
Leu Asn Gly 30 35 40 Glu Asp Gln Asp Ile Lou Met Glu Arg Asn Leu
Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn
Leu Glu Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu
Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His
Pro Ile His Ile Lys Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg
Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Asn Ala Gln Ala
Gln Gln 120 125 PEPTIDE #7; pMON13349 (Example 14); (15-125)hiL-3
(51R, 55T, 59L, 62V, 67H and 69E); Asn Cys Ser Asn Met Ile Asp Glu
Ile Ile Thr His Leu [SEQ ID NO:71] 15 20 25 Lys Gln Pro Pro Leu Pro
Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35 40 Glu Asp Gln Asp Ile
Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe
Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp
Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115
Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #8; pMON13350
(Example 16); (15-125)hIL-3 (73G, 76A, 79R, 82Q, 87S, 93S, 98I,
101A, 105Q); Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
[SEQ ID NO:72] 15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn
Asn Leu Asn Gly 30 35 40 Glu Asp Gln Asp Ile Leu Met Glu Asn Asn
Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys
Ser Leu Gln Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Lee Arg Asn
Leu Gln Pro Gys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg
His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln
Ala Gln Gln 120 125 PEPTIDE #9: pMON13355 (Example 17);
(15-125)hIL-3 (73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q);
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:73]
15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn
Gly 30 35 40 Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro
Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile
Thr Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Arg Lys Leu
Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln
120 125 PEPTIDE #10; pMON13352 (Example 19); (15-125)hIL-3 (109E,
116V, 120Q and 123E) Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr
His Leu [SEQ ID NO:74] 15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly 30 35 40 Glu Asp Gln Asp Ile Leu Met Glu
Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala
Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu
Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro
Thr Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp Trp Asn Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #11; pMON13354 (Example 20);
(15-125)hIL-3 (109E, 116V, 117S, 120H and 123E); Asn Cys Ser Asn
Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:75] 15 20 25 Lys Gln
Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35 40 Glu
Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50 55
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65
70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75
80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
90 95 100 Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Ser 105 110 115 Leu Glu His Ala Gln Glu Gln Gln 120 125 PEPTIDE
#12; pMON13360 (Example 21); (15-125)hIL-3 (73G, 76A, 79R, 82Q,
87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E); Asn Cys Ser
Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:76] 15 20 25 Lys
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35 40
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50
55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60
65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser
75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Asp
Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu
Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#13; pMON13361 (Example 22); (15-125)hIL-3 (73G, 76A, 79R, 82V,
87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E); Asn Cys Ser
Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:77] 15 20 25 Lys
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35 40
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50
55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60
65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser
75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Asp
Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu
Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#14; pMON13362 (Example 22); (15-125)hIL-3 (73G, 76A, 79R, 82V,
87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E); Asn
Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:78] 15
20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
30 35 40 Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro
Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn
Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys
Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr
Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Ser 105 110 115 Leu Glu His Ala Gln Glu Gln Gln 120
125 PEPTIDE #15; pMON13363 (Example 24); (15-125)hIL-3 (18I, 25H,
29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E); Asn Cys
Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:79] 15 20 25
Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35
40 Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Arg Leu Pro Asn
45 50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125
PEPTIDE #16; pMON13364 (Example 25); (15-125)hIL-3 (18I, 25H, 29R,
32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E); Asn Cys Ser
Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:80] 15 20 25 Lys
Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30
35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala
Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Ala Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125
PEPTIDE #17; pMON13365 (Example 26 ); (15-125)hIL-3 (18I, 25H, 29V,
32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E); Asn Cys Ser
Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:81] 15 20 25 Lys
Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser 30 35 40
Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50
55 Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60
65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu
75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp
Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu
Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE
#18; pMON13298 (Example 27); Met-Ala-(15-125)hIL-3 (73G, 76A, 79R,
80Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E); Met Ala
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:82]
15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn
Gly 30 35 40 Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro
Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile
Ile Ile Lys Asp Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu
Thr Phe Tyr Leu Lys Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln
120 125 PEPTIDE #19; pMON13299 (Example 28); Met-Ala-(15-125)hIL-3
(73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q
and 123E123E;) Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr
His Leu [SEQ ID NO:83] 15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly 30 35 40 Glu Asp Gln Asp Ile Leu Met Glu
Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala
Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Val Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Thr Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #20; pMON13300 (Example 29);
Met-Ala-(15-125)hIL-3 (73G, 76A, 79R, 82V, 87S, 93S. 98T, 101A,
105Q, 109E, 116V, 117S, 120H and 123E); Met Ala Asn Cys Ser Asn Met
Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:84] 15 20 25 Lys Gln Pro
Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35 40 Glu Asp
Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu
Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65 70
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser 75 80
85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly 90
95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser
105 110 115 Leu Glu His Ala Gln Ala Gln Gln 120 125 PEPTIDE #21;
pMON13301 (Example 30); Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A,
37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, and 69E); Met Ala Asn Cys
Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:85] 15 20 25
Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35
40 Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45
50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser
60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro
Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys
Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr
Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125
PEPTIDE #22; pMON13302 (Example 31); Met-Ala-(15-125)hIL-3 (18I,
25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, and 69E):
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO:86] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg
Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His Leu
Glu Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln
Gln 120 125 PEPTIDE #23; pMON13303 (Example 32);
Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L,
59L, 62V, 67N and 69E); Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu [SEQ ID NO:87] 15 20 25 Lys Val Pro Pro Ala Pro Leu
Leu Asp Ser Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu
Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Leu Ala Phe Val
Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Ala Ile Glu Ser
Ile Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Ala Gly 90 95 100 Asp
Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115
Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #24; pMON13287
(Example 33); Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A,
45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82Q, 87S, 93S,
98I, 101A, 105Q, 109E, 116V, 120Q and 123E); Met Ala Asn Cys Ser
Ile Met Ile Asp Gln Ile Ile His His Leu [SEQ ID NO:88] 15 20 25 Lys
Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40
Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50
55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60
65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser
75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala
Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu
Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#25; pMON13288 (Example 34); Met-Ala-(15-125)hIL-3 (18I, 25H, 29R,
32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R,
82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and Met Ala Asn
Cys Ser Ile Met Ile Asp Giu Ile Ile His His Leu [SEQ ID NO:89] 15
20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser
30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro
Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn
Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys
Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile
Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120
125 PEPTIDE #26; pMON13289 (Example 35); Met-Ala-(15-125)hIL-3
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E,
73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q,
and 123E); Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO:90] 15 20 25 Lys Val Pro Pro Ala Pro Leu Leu Asp Ser
Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val
Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg
Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln Ala
Gln Glu Gln Gln 120 125 PEPTIDE #27; pMON13290 (Example 36);
Met-Ala-(15-125)hIL-3 (18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L,
60S, 62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q,
109E, 116V, 120Q and 123E); Met Ala Asn Cys Ser Ile Met Ile Asp Glu
Ile Ile His His Leu [SEQ ID NO:91] 15 20 25 Lys Arg Pro Pro Ala Pro
Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Asp Ile
Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe
Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu
Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser 75 80 85 Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly 90 95 100 Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115
Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #28; pMON13292
(Example 37); Met-Ala-(15-125)hIL-3 (18I, 25H, 29V, 32A, 37S, 42S,
45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A, 79R, 82V, 87S, 93S,
98T, 101A, 105Q, 109E, 116V, 120Q and 123E); Met Ala Asn Cys Ser
Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:92] 15 20 25 Lys
Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser 30 35 40
Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50
55 Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60
65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser
75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala
Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu
Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#29; pMON13294 Met-Ala-(15-125)hIL-3; (18I, 25H, 29R, 32N, 37P,
42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82V, 87S,
93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and 123E); Met Ala Asn
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:93 ] 15
20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser
30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro
Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn
Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys
Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr
Ile Lys Asp Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Ser 105 110 115 Leu Glu His Ala Gln Glu Gln Gln 120
125 PEPTIDE #30; pMON13295 (Example 39); Met-Ala-(15-125)hIL-3;
(18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E,
73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S,
120H and 123E); Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:94] 15 20 25 Lys Val Pro Pro Ala Pro Leu Leu Asp
Ser Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Val Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Thr Ile Lys Asp Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser 105 110 115 Leu Glu His
Ala Gln Glu Gln Gln 120 125 PEPTIDE #31; pMON13312 (Example 40);
Met-Ala-(15-125)hIL-3; (18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R,
55T, 59L, 62V, 67H, 69E, 73G, 76A, 79R, 82V, 87S, 93S, 98T,
101A,
105Q, 109E, 116V, 120Q and 123E); Met Ala Asn Cys Ser Ile Met Ile
Asp Glu Ile Ile His His Leu [SEQ ID ND:95] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Asp Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #32;
pMGN13313 (Example 41); Met-Ala-(15-125)hIL-3; (18I, 25H, 29R, 32A,
37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A, 79R, 82V,
87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120G and 123E); Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO:96] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala 30 35 40 Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Val
Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro
Ile Thr Ile Lys Asp Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Ser 105 110 115 Leu Glu His Ala Gln Glu Gln
Gln 120 125 PEPTIDE #A3; pMON13285 Met-Ala-(15-125)hIL-3; (42D,
45M, 465, 46S, 50D); Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile
Ile Thr His Leu ]SEQ ID NO:259] 15 20 25 Lys Gln Pro Pro Leu Pro
Leu Leu Asp Phe Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile
Leu Met Asp Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe
Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly 90 95 100 Asp
Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr 105 110 115
Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #A4; pMON13286
Met-Ala-(15-125)hIL-3; (42D, 45M, 46S, Met Ala Asn Cys Ser Asn Met
Ile Asp Gli Ile Ile Thr His Leu [SEQ ID NO:260] 15 20 25 Lys Gln
Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Asp 30 35 40 Glu
Asp Met Ser Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50 55
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65
70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75
80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE
#A5: pMON13325 Met-Ala-(15-125)hIL-3 (42D, 45M, 46S, 116W); Met Ala
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:261]
15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn
Asp 30 35 40 Glu Asp Met Ser Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn 45 50 55 Leu Leu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro
Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile
His Ile Lys Ala Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu
Thr Phe Tyr Leu Trp Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln
120 125 PEPTIDE #A6; pMON13326 Met-Ala-(15-125)hIL-3 (42D, 45M,
46S, 50D, 116W); Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:262] 15 20 25 Lys Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile Leu
Met Asp Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Ala Gly 90 95 100 Asp Trp
Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Trp Thr 105 110 115 Leu
Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #A7; pMON13330
Met-Ala-Il-3; (42D, 45M, 46S, 50D, 95R, 98I, 100R, 116W); Met Ala
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:263]
15 20 25 Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn
Asp 30 35 40 Glu Asp Met Ser Ile Leu Met Asp Asn Asn Leu Arg Arg
Pro Asn 45 50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser 60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro
Cys Leu Pro Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg Arg Pro Ile
Ile Ile Arg Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu
Thr Phe Tyr Leu Trp Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln
120 125 PEPTIDE #A8; pMON13329 Met-Ala-(15-125)hIL-3 (42D, 45M,
46S, 98I, 100R, 116W); Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile
Ile Thr His Leu [SEQ ID NO:406] 15 20 25 Lys Gln Pro Pro Leu Pro
Leu Leu Asp Phe Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile
Leu Met Glu Asn Asn Leu Arg Arg Pro Asn 45 50 55 Leu Glu Ala Phe
Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser 60 65 70 Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu 75 80 85 Ala Thr
Ala Ala Pro Thr Arg His Pro Ile Ile Ile Arg Asp Gly 90 95 100 Asp
Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Trp Thr 105 110 115
Leu Glu Asn Ala Gln Ala Gln Gln 120 125 PEPTIDE #B1
Met-Ala-(15-125)hIL-3 pMON13406 Met Ala Asn Cys Ser Ile Ala Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 264] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B2
Met-Ala-(15-125)hIL-3 pMON13414 Met Ala Asn Cys Ser Ile Ile Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 265] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B3
Met-Ala-(15-125)hIL-3 pMON13407 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu ]SEQ ID NO.: 266] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B4
Met-Ala-(15-125)hIL-3 pMON13405 Met Ala Asn Cys Ser Ile Ala Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 267] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B
Met-Ala-(15-125)hIL-3 pMON13415 Met Ala Asn Cys Ser Ile Ile Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 268] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B6
Met-Ala-(15-125)hIL-3 pMON13408 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 269] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Ile Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B7
Met-Ala-(15-125)hIL3 pMON13409 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 270] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Leu Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE 190 B8
Met-Ala-(15-125)hIL-3 pMON13410 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 271] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Asp Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Gln Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B9
Met-Ala-(15-125)hIL-3 pMON13422 Met Ala Asn Cys Ser Ile Ala Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 272] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val
Asp Ile Leu Ile Glu
Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His ProIle Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Gln
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B10 Met-Ala-(15-125)hIL-3
pMON13423 Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 273] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val Asp Ile Leu Ile Glu
Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B11 Met-Ala-(15-125)hIL-3
pMON13424 Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO: 274] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val Asp Ile Leu Leu Glu
Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Lru Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B12 Met-Ala-(15-125)hIL-3
pMON13425 Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 275] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val Asp Ile Leu Leu Glu
Arg Asn Leu Arg Thr Pro Aso 45 50 55 Leu Leo Ala Phe Val Arg Ala
Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B13 Met-Ala-(15-125)hIL-3
pMON13426 Met Ala Asn Cys Ser Ile Ala Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 276] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val Asp Ile Leu Asp Glu
Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B14 Met-Ala-(15-125)hIL-3
pMON13429 Met Ala Asn Cys Ser Ile Ile Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 277] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Val Asp Ile Leu Asp Glu
Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B15 Met-Ala-(15-125)hIL-3
pMON13368 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.: 278] 15 20 25 Lys Val Pro Pro Ala Pro Leu Leu Asp
Ser Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B16 Met-Ala-(15-125)hIL-3
pMON13380 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.: 279] 15 20 25 Lys Val Pro Pro Ala Pro Leu Leu Asp
Ser Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Gln Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B17 Met-Ala-(15-125)hIL-3
pMON13475 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.: 280] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B18 Met-Ala-(15-125)hIL-3
pMON13366 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 281] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Asn 30 35 40 Glu Asp Val Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Gln
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B19 Met-Ala-(15-125)hIL-3
pMON13367 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 282] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B20 Met-Ala-(15-125)hIL-3
pMON13369 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 283] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B21 Met-Ala-(15-125)hIL-3
pMON13370 Met Asp Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 284] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Met Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B22 Met-Ala-(15-125)hIL-3
pMON13378 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 285] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B23 Met-Ala-(15-125)hIL-3
pMON13374 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 286] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B24 Met-Ala-(15-125)hIL-3
pMON13375 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 287] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Ser Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu 119
PEPTIDE #B25 Met-Ala-(15-125)hIL-3 pMON13376 Met Asp Asn Cys Ser
Ile Met Ile Asp Glu Ala Ile His His Leu [SEQ ID NO.: 288] 15 20 25
Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35
40 Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45
50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Gln Asn Ala Ser
60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro
Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys
Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Gln Phe Tyr
Leu Val Thr 105 110 115 Leu Glu 119 PEPTIDE #B26
Met-Ala-(15-125)hIL-3 pMON13377 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ala Ile His His Leu [SEQ ID NO.: 289] 15
20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp
30 35 40 Glu Asp Val Ser Ile Leu Met Asp Arg Asn Leu Arg Leu Pro
Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn
Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Trp Pro Cys
Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile
Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Gln
Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120
125 PEPTIDE #B27 Met-Ala-(15-125)hIL-3 pMON13378 Met Ala Asn Cys
Ser Ile Met Ile Asp Glu Ala Ile His His Leu [SEQ ID NO.: 290] 15 20
25 Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30
35 40 Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
45 50 55 Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu
Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile
Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe
Tyr Leu Val Thr 105 110 115 Leu Glu 119 PEPTIDE #B28
Met-Ala-(15-125)hIL-3 pMON13379 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 291] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Ser Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Gln Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B29
Met-Ala-(15-125)hIL-3 pMON13385 Met Ala Ann Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 292] 15 20 25 Lys Val Pro Pro
Arg Pro Ser Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 95
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B30
Met-Ala-(15-125)hIL-3 pMON13381 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 293] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Aso 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Trp Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B31
Met-Ala-(15-125)hIL-3 pMON13383 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ala Ile His His Leu [SEQ ID ND.: 294] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val
Ser Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B32
Met-Ala-(15-125)hIL-3 pMON13384 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 295] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Gln Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B33
Met-Ala-(15-125)hIL-3 pMON13388 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 296] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Asp Ile Leu Met Asp Arg Asn Leu Arg Leu Ser Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B34
Met-Ala-(15-125)hIL-3 pMON13389 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 297] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B35
Met-Ala-(15-125)hIL-3 pMON13391 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 298] 15 20 25 Lys Arg Pro Pro
Ala Pro Ser Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B36
Met-Ala-(15-125)hIL-3 pMON13392 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 299] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B37
Met-Ala-(15-125)hIL-3 pMON13393 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ala Ile His His Leu [SEQ ID NO.: 300] 15 20 25 Lys Arg Pro Pro
Ala Pro Ser Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met
Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B38
Met-Ala-(15-125)hIL-3 pMON13394 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 301] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met
Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B39
Met-Ala-(15-125)hIL-3 pMON13395 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ala Ile His His Leu [SEQ ID NO.: 302] 15 20 25 Lys Val Pro Pro
Arg Pro Ser Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val
Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B40
Met-Ala-(15-125)hIL-3 pMON13396 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 303] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Arg Met Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B41
Met-Ala-(15-125)hIL-3 pMON13397 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 304] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Trp Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Arg Met Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B42
Met-Ala-(15-125)hIL-3 pMON13398 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 305] 15 20 25 Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val
Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115
Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B43
Met-Ala-(15-125)hIL-3 pMON13399 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ala Ile His His Leu [SEQ ID NO.: 306] 15 20 25 Lys Val Pro Pro
Arg Pro Ser Leu Asp Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val
Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Gys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #B44
Met-Ala-(15-125)hIL-3 pMON13404 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ala Ile Ile His His Leu [SEQ ID NO.: 307] 15 20 25 Lys Arg Pro
Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp
Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu
Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser 60 65 70
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80
85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90
95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Gln Phe Tyr Leu Val Thr
105 110 115 Leu Glu 119 PEPTIDE #B45 Met-Ala-(15-125)hIL-3
pMON13387 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO. :308] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Asp Ile Leu Met Asp
Arg Asn Leu Arg Leu Ser Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B46 Met-Ala-(15-125)hIL-3
pMON13416 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 309] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val Ser Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B47 Met-Ala-(15-125)hIL-3
pMON13417 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 310] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B48 Met-Ala-(15-125)hIL-3
pMON13420 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.: 311] 15 20 25 Lys Arg Pro Pro Ala Pro Ser Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Val Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Ser Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B49 Met-Ala-(15-125)hIL-3
pMON13421 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.:331] 15 20 25 Lys Arg Pto Pro Ala Pro Ser Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Ser Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln Gln 120 125 PEPTIDE #B50 Met-Ala-(15-125)hiL-3
pMON13432 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.: 312] 15 20 25 Lys Arg Pro Pro Ala Pro Ser Leu Asp
Pro Asn Asn Leu Asn Asp 30 35 40 Glu Asp Met Ser Ile Leu Met Asp
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B51 Met-Ala-(15-125)hIL-3
pMON13382 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO.: 313] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Asp Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
Phe Arg Glu Lys Leu Gln Phe Tyr Leu Trp Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B52 Met-Asp-(15-125)hIL-3
pMON13476 Met Asp Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His
Leu [SEQ ID NO.: 314] 15 20 25 Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala 30 35 40 Glu Asp Val Asp Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn 45 50 55 Leu Glu Ser Phe Val Arg Ala
Val Lys Asn Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu
phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln
Ala Gln Glu Gln Gln 120 125 PEPTIDE #B53 Met-Ala-(15-125)hIL-3
pMON13446 Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys
Asp [SEQ ID NO.: 315] -14 -10 -5 15 Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu Lys Arg Pro 20 25 30 Pro Ala Pro Leu Leu Asp Pro
Asn Asn Leu Asn Ala Glu Asp Val 35 40 45 Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Glu Ser 50 55 60 Phe Val Arg Ala Val
Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu 65 70 75 Ala Ile Leu Arg
Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala 80 85 90 Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln 95 100 105 Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln 110 115 120 Ala
Gln Glu Gln Gln 125 PEPTIDE #54 Met-Ala-(15-125)hIL-3 pMON13390 Met
Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys Asn -14 -10 -5
15 Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro 20
25 30 Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met
35 40 45 Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu
Ala 50 55 60 Phe VAl Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly
Ile Glu 65 70 75 Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser
Ala Thr Ala 80 85 90 Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala
Gly Asp Trp Gln 95 100 105 Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu
Val Thr Leu Glu Gln 110 115 120 Ala Gln Glu Gln Gln 125 PEPTIDE
#C-2 Met-Ala-(15-125_hIL-3 pMON13400 Met Ala Asn Cys Ser Ile Met
Pro Asp Glu Ala Ile His His Leu [SEQ ID NO.: 317] 15 20 25 Lys Ile
Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn Ser 30 35 40 Glu
Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65
70 Gly Ile Glu Pro Ile L3u Arg Asn Leu Gln Pro Cys Leu Pro Ser 75
80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly
90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#C-3 Met-Ala-(15-125)hIL-3 pMON13402 Met Ala Asn Cys Ser Ile Met
Ile Asp Glu Leu Ile His His Leu [SEQ ID NO.: 318] 15 20 25 Lys Ile
Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn Ser 30 35 40 Glu
Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65
70 Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75
80 85 Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly
90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#C-10 Met-Ala-(15-125)hIL-3 pMON13440 Met Ala Asn Cys Ser Ile Met
Ile Asp Glu Ala Ile His His Leu [SEQ ID NO.: 319] 15 20 25 Lys Ile
Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn Ser 30 35 40 Glu
Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65
70 Gly Ile Glu Pro Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75
80 85 Ala Thr Ala Ala Pro Ser Arg Thr Pro Ile Ile Ile Lys Ala Gly
90 95 100 Asp Trp Gln Glu Phe Arg Leu Lys Leu Thr Phe Tyr Leu Val
Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#C-11 Met-Ala-(15-125)hIL-3 pMON13451 Met Ala Asn Cys Ser Ile Ile
Leu Asp Glu Ala Ile His His Leu [SEQ ID NO.: 320] 15 20 25 Lys Ile
Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn Ser 30 35 40 Glu
Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65
70 Gly Ile Glu Pro Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75
80 85 Ala Thr Ala Ala Pro Ser Arg Thr Pro Ile Ile Ile Lys Ala Gly
90 95 100 Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Thr 105 110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE
#C-4 Met-Ala-(15-125)hIL-3 pMON13403 Met Ala Asn Cys Ser Ile Met
Ile Asp Glu Ile Ile His His Leu [SEQ ID NO.: 321] 15 20 25 Lys Arg
Pro Pro Ase Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu
Asp Met Asp Ile
Leu Met Asp Ser Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe
Pro His Ala Ser Lys Gln Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu
Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115
Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #C-5
Met-Ala-(15-125)hIL-3 pMON13411 Met Ala Asn Cys Ser Ile Met Ile Asp
Gln Ile Ile His His Leu [SEQ ID NO.: 322] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Leu Lys Leu Gln Phe Tyr Leu Ser Thr 105
110 115 Leu Glu Gln Ala Gln Glu Gln Gln 120 125 PEPTIDE #C-6
Met-Ala-(15-125)hIL-3 pMON13412 Met Ala Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO.: 323] 15 20 25 Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser 30 35 40 Glu Asp Met
Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn 45 50 55 Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser 60 65 70 Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser 75 80 85
Ala Thr Ala Pro Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly 90 95
100 Asp Trp Gln Glu Phe Arg Leu Lys Leu Gln Phe Tyr Leu Ser Thr Leu
105 110 115 118 PEPTIDE #C-7 Met-Ala-(15-125)hIL-3 pMON13413 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO.: 324] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu
Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu
Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Leu
Lys Leu Gln Phe Tyr Leu Ser Ser 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125 PEPTIDE #C-8 Met-Ala-(15-125)hIL-3 pMON13419 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO.: 325] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Asp Ser Asn Leu
Leu Thr Pro Asn 45 50 55 Leu Leu Ala Phe Pro His Ala Ser Lys Gln
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu
Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Leu
Lys Leu Gln Phe Tyr Leu Ser Ser 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125 PEPTIDE #C-1 Met-Ala-(15-125)hIL-3 pMON13418 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO.: 326] 15 20 25 Lys Ala Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu
Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe VAl Arg Ala Val Lys His
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Pro Ile Leu Ser Asn Leu
Gln Pro Cys Val Pro Tyr 75 80 85 Trp Thr Ala Pro Pro Ser Arg Thr
Pro Ile Thr Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125 PEPTIDE #C-9 Met-Ala-(15-125)hIL-3 pMON13428 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO.: 327] 15 20 25 Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser 30 35 40 Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu
Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Pro Ile Leu Ser Asn LEu
Gln Pro Cys Val Pro Tyr 75 80 85 Trp Thr Ala Pro Pro Ser Arg Thr
Pro Ile Thr Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Leu
Lys Leu Gln Phe Tyr Leu Ser Thr 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125 PEPTIDE #C-12 Met-Ala-(15-125)hIl-3 pMON13459 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Leu Ile His His Leu [SEQ ID
NO.: 328] 15 20 25 Lys Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn
Leu Asn Ser 30 35 40 Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu
Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Pro Ile Leu Ser Asn Leu
Gln Pro Cys Val Pro Tyr 75 80 85 Trp Thr Ala Pro Pro Ser Arg Thr
Pro Ile Thr Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Leu
Lys Leu Gln Phe Tyr Leu Ser Thr 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125 PEPTIDE #C-13 Met-Ala-(15-125)hIL-3 pMON13467 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Leu Ile His His Leu [SEQ ID
NO.: 329] 15 20 25 Lys Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn
Leu Asn Ser 30 35 40 Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu
Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Ala Ile Leu Arg Asn Leu
Gln Pro Cys Leu Pro Ser 75 80 85 Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Leu
Lys Leu Gln Phe Tyr Leu Ser Ser 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125 PEPTIDE #C-14 Met-Ala-(15-125)hIL-3 pMON13492 Met
Ala Asn Cys Ser Ile Met Ile Asp Glu Leu Ile His His Leu [SEQ ID
NO.: 330] 15 20 25 Lys Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn
Leu Asn Ser 30 35 40 Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu
Arg Thr Pro Asn 45 50 55 Leu Leu Ala Phe Val Arg Ala Val Lys His
Leu Glu Asn Ala Ser 60 65 70 Gly Ile Glu Pro Ile Leu Ser Asn Leu
Gln Pro Cys Val Pro Tyr 75 80 85 Trp Thr Ala Pro Pro Ser Arg Thr
Pro Ile Thr Ile Lys Ala Gly 90 95 100 Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr 105 110 115 Leu Glu Gln Ala Gln Glu
Gln Gln 120 125
[0814]
14TABLE 4 DNA SEQUENCES pMON13287 Met-Ala-(15-125) IL-3 DNA
sequence #1
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO:97] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGA-
ACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGA-
AAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTGC-
CACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13290 Met-Ala-(15-125) IL-3 DNA sequence #2
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACT-
TAAAGAGACCACCTGCACCTTTG [SEQ ID NO:98]
CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGAACGAAACCTTCCACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGACGCAATTC-
TT CCTAATCTCGTACCATCTCTGCCCTCTCCCACGCCCGCACCCTCTCGACATCCAA-
TCACCATCAAG CCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAC GAACAACAG pMON13313 Met-Ala-(15-125) IL-3 DNA
sequence #3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO:99] CTGGACCCGAACAACCTCAATGCTGAAGACCTCGATATCCTGATCGA-
ACGAAACCTTCCACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGA-
AAATGCATCAGCTATTGAGCCAATTCTT CGTAATCTCGTACCATGTCTGCCCTCTGC-
CACGGCCGCACCCTCTCGACATCCAATCACCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTTCCCTTGAGCACGCGCAG
GAACAACAG pMON13288 Met-Ala-(15-125) IL-3 DNA sequence #4
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACT-
TAAAGAGACCACCTAACCCTTTG [SEQ ID NO:100]
CTGGACCCGAACAACCTCAATTCTGAAGACATGGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTSGCAAGAATTCCGGGAAAAACTGAGGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13312 Met-Ala-(15-125) IL-3 DNA
sequence #5
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO:101] CTGGACCCGAACAACCTCAATTCTGAAGACATGGATATCCTGATGG-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCGTACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCACCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13294 Met-Ala-(15-125) IL-3 DNA sequence #6
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACT-
TAAAGAGACGACCTAACCCTTTG [SEQ ID NO:102]
CTGGACCCGAACAACCTCAATTCTGAAGACATGGATATCCTCATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCGTACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCACCATCAAG GCAGGTGACTCCCAACAATTCCGGGAAAAACTGACGTTCTATCTCG-
TTTCCCTTGAGCACGCCCAG GAACAACAG pMONM13289 Met-Ala-(15-125) IL-3 DNA
sequence #7
ATGGCTAACTGCTCTATAATCATCGATCAAATTATACATCACTTAAACCTTCCACCTGCACCTTTG
[SEQ ID NO:103] CTGGACAGTAACAACCTCAATTCCGAACACATGCATATCCTCATGC-
AACGAAACCTTCCACTTCCA AACCTCCTCGCATTCCTAAGCCCTCTCAACAACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTCCCCTCTG-
CCACCCCCCCACCCTCTCCACATCCAATCATCATCAAG
GCACGTGACTGGCAAGAATTCCGGCAAAAACTCACGTTCTATCTGCTTACCCTTCACCAAGCCCAG
GAACAACAG pMON13292 Met-Ala-(15-125) IL-3 DNA sequence #8
ATGGCTAACTCCTCTATAATCATCCATGAAATTATACATCACT-
TAAACGTTCCACCTGCACCTTTG [SEQ ID NO:104]
CTGGACAGTAACAACCTCAATTCCGAAGACATGGATATCCTGATGGAACGAAACCTTCCACTTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCTACCATCTCTCCCCTCTGCCACGCCCGCACCCTCTCCACATCCAA-
TCACCATCAAC GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTCG-
TTACCCTTGACCAAGCCCAG GAACAACAG pMON13295 Met-Ala-(15-125) IL-3 DNA
sequence #9
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGGTTCCACCTGCACCTTTG
[SEQ ID NO:105] CTGGACAGTAACAACCTCAATTCCGAAGACATGGATATCCTGATGG-
AACGAAACCTTCGACTTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGAACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCGTACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCACCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTTCCCTTGAGCACGCGCAG
GAACAACAG pMON13344 (15-125) IL-3 DNA sequence #10
AACTGCTCTATAATGATCGATGAAATTATACATGACTTAAAGAGACCAC- CTGGACCTTTG [SEQ
ID NO:106] CTGGACCCGAACAACCTCAATGCTGAAGAC-
GTCGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGCAATTGAGAGCATTCTT
AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAATCCATATCA-
AG CACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGG-
AGAACGCGCAG GCTCAACAG pMON13345 (15-125) IL-3 DNA sequence #11
AACTGCTCTATAATGATCGATGAAATTA- TACATCACTTAAAGAGACCACCTAACCCTTTG [SEQ
ID NO:107]
CTGGACCCGAACAACCTCAATTCTGAAGACATGGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCGCAG GCTCAACAG pMON13346 (15-125) IL-3 DNA sequence
#12 AACTGCTCTATAATGATCGATGA- AATTATACATCACTTAAAGGTTCCACCTGCACCTTTG
[SEQ ID NO:108]
CTGGACAGTAACAACCTCAATTCCGAAGACATGGATATCCTGATGCAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCCCAG GCTCAACAG pMON13347 (15-125) IL-3 DNA sequence
#13 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCACCCACCGCTGCCGCTG
[SEQ ID NO:109]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAACGAAACCTTCGACTTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCGCAG GCTCAACAG pMON13348 (15-125) IL-3 DNA sequence
#14 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:110]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCGCAG GCTCAACAG pMON13349 (15-125) IL-3 DNA sequence
#15 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:111]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCGCAG GCTCAACAG pMON13350 (15-125) IL-3 DNA sequence
#16 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:112]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGACAACGCGCAG GCTCAACAG pMON13355 (15-125) IL-3 DNA sequence
#17 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:113]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCGTACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCACCATCAAG GCAGGTGACTGGCAAGAATTCCGTCGTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCGCAG GCTCAACAG pMON13352 (15-125) IL-3 DNA sequence
#18 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:114]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13354 (15-125) IL-3 DNA sequence
#19 AACTGCTCTAACATGATCGATGA- AATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:115]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTTCCCTTGAGCACGCGCAG GAACAACAG pMON13363 (15-125) IL-3 SECRETED DNA
sequence #20
AACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG [SEQ
ID NO:116] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGAAC-
GAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAA-
ATGCATCAGCAATTGAGAGCATTCTT AAAAATCTCCTGCCATGTCTGCCCCTGGCCA-
CGGCCGCACCCACGCGACATCCAATCCATATCAAG
GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAG
GCTCAACAG pMON13364 (15-125) IL-3 SECRETED DNA sequence #21
AACTGCTCTATAATGATCGATGAAATTATACAT- CACTTAAAGAGACCACCTAACCCTTTG [SEQ
ID NO:117]
CTGGACCCGAACAACCTCAATTCTGAAGACATGGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAA-
TCCATATCAAG GACGGTGACTGGAATGAATTCCGTCCTAAACTGACCTTCTATCTGA-
AAACCTTGGAGAACGCGCAG GCTCAACAG pMON13365 (15-125) IL-3 SECRETED DNA
sequence #22
AACTGCTCTATAATGATCGATGAAATTATAGATCACTTAAAGGTTCCACCTGCACCTTTG [SEQ
ID NO:118] CTGGACAGTAACAACCTCAATTCCGAAGACATGGATATCCTGATGGAAC-
GAAACCTTCGACTTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGAACTTAGAAA-
ATGCATCAGCAATTGAGAGCATTCTT AAAAATCTCCTGCCATGTCTGCCCCTGGCCA-
CGGCCGCACCCACGCGACATCCAATCCATATCAAG
GACGGTGACTGGAATGAATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAG
GCTCAACAG pMON13360 (15-125) IL-3 SECRETED DNA sequence #23
AACTGCTCTAACATGATCGATGAAATCATCACC- CACCTGAAGCAGCCACCGCTGCCGCTG [SEQ
ID NO:119]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13361 (15-125) IL-3 SECRETED DNA
sequence #24
AACTGCTCTAACATGATCGATGAAATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG [SEQ
ID NO:120] CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAA-
ATAACCTTCGTCGTCCA AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGA-
ATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCGTACCATGTCTGCCCTCTGCCA-
CGGCCGCACCCTCTCGACATCCAATCACCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13362 (15-125) IL-3 SECRETED DNA sequence #25
AACTGCTCTAACATGATCGATGAAATCATCACC- CACCTGAAGCAGCCACCGCTGCCGCTG [SEQ
ID NO:121]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCGTACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCACCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTTCCCTTGAGCACGCGCAG GAACAACAG pMON13301 (15-125) IL-3
INTRACELLULAR DNA sequence #26
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO:122] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGG-
AACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGCCTGTCAAGAACTTAG-
AAAATGCATCAGCAATTGAGAGCATTCTT AAAAATCTCCTGCCATGTCTGCCCCTGG-
CCACGGCCGCACCCACGCGACATCCAATCCATATCAAG
GACGGTGACTGGAATCAATTCCGTCGTAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAG
GCTCAACAG pMON13302 (15-125) IL-3 INTRACELLULAR DNA sequence #27
ATGGCTAACTGCTCTATAATGATCGATG-
AAATTATACATCACTTAAAGAGACCACCTAACCCTTTG [SEQ ID NO:123]
CTGGACCGCGAACAACCTCAATTCTGAAGACATGGATATCCTGATGGAACGAAACCTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTACAAAATGCATCAGCAATTGAGAGCATTC-
TT AAAAATCTCCTGCCATGTCT CCCCTGGCCACGGC
GCACCCACGCGACATCCAATCCATATCAAG GACGGTGACTGGAATGAATTCCGTCG-
TAAACTGACCTTCTATCTGAAAACCTTGGAGAACGCGCAG GCTCAACAG pMON13303
(15-125) IL-3 INTRACELLULAR DNA sequence #28
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGGTTCCACCTGCACC-
TTTG [SEQ ID NO:124] CTGGACAGTAACAACCTCAATTCCGAAGACATGGATA-
TCCTCATGGAACGAAACCTTCGACTTCCA AACCTGCTCGCATTCGTAAGGGCTGTCA-
AGAACTTAGAAAATGCATCAGCAATTGAGAGCATTCTT
AAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAC
GACCGTGACTGGAATGAATTCCGTCCTAAACTCACCTTCTATCTGAAAACCTTGCAGAACCCCC-
AG GCTCAACAG pMON13298 (15-125) IL-3 INTRACELLULAR DNA sequence #29
ATGGCTAACTGCTCTAACATGAT-
CCATGAAATCATCACCCACCTGAAGCAGCCACCCCTCCCGCTG [SEQ ID NO:125]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCCTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAACTCTCTGCAGAATGCATCAGGTATTGAGGCAATT-
CTT CGTAATCTCCAACCATCTCTCCCCTCTCCCACCGCCCCACCCTCTCCACATCCA-
ATCATCATCAAG GCAGGTGACTGCCAAGAATTCCGGGAAAAACTGACGTTCTATCTG-
CTTACCCTTGACCAAGCGCAG GAACAACAG pMON13299 (15-125) IL-3
INTRACELLULAR DNA sequence #30
ATGGCTAACTGCTCTAACATGATCGATGAAATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG
[SEQ ID NO:126] CTGGACTTCAACAACCTCAATGGTCAAGACCAAGATATCCTGATGG-
AAAATAACCTTCGTCGTCCA AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGC-
AGAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCGTACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCACCATCAAC
GCAGGTGACTGGCAAGAATTCCCGGAAAAACTGACGTTCTATCTGGTTACCCTTGACCAAGCGCAC
GAACAACAG pMON13300 Met-Ala-(15-125) IL-3 INTRACELLULAR DNA
sequence #31 ATGGCTAACTGCTCTAACATGATCGATG-
AAATCATCACCCACCTGAAGCAGCCACCGCTGCCGCTG [SEQ ID NO:127]
CTGGACTTCAACAACCTCAATGGTGAAGACCAAGATATCCTGATGGAAAATAACCTTCGTCGTCCA
AACCTCGAGGCATTCAACCGTGCTGTCAAGTCTCTGCAGAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCGTACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCACCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTTCCCTTGAGCACGCGCAG GAACAACAG DNA sequence #32
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC-
ACCTAACCCTTTG [SEQ ID NO:160] CTGGACCCGAACAACCTCAATTCTGAAG-
ACATGGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAACGGCTCTCAAGCACTTAGAAAACGCATCAGCTATTGAGGCAATTCTT
CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAATCATCATCA-
AG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTG-
AGCAAGCGCAG GAACAACAG DNA sequence #33
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO:161] CTGGACCCGAACAACCTCAATTCTGAAGACATGGACATTTG-
ATGGAACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCAC-
TTAGAAAACGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCC-
TCTGCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCOGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B1 pMON13406 Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAGCTATCGATGAAATTATACATCACT-
TAAAGAGACCACCTAACCCTTTG [SEQ ID NO.:332]
CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAACGGCTGTCAAGCACTTAGAAAATGCATCACGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTCCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGCGAAAAACTGACGTTCTATCTGC-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B2 pMON13414
Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAATCATCCATGAAATTATACATCACTTAAACAGACCACCTAACCCTTTC
[SEQ ID NO.:333] CTGGACCCGAACAACCTCAATTCCCAACACATCGATATCCTGATG-
GAACCAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTCTCAAGCACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
CCCACCGCCCCACCCTCTCGACATCCAATCATCATCAAG
GCAGCTGACTGCCAAGAATTCCCCGAAAAACTCACGTTCTATCTCGTTACCCTTGACCAACCCCAG
GAACAACAG DNA sequence #B3 pMON13407 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACT-
TAAAGAGACCACCTAACCCTTTG [SEQ ID NO.:334]
CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATGCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B4 pMON13405
Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAGCTATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO.:335] CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATCCTGATG-
GAACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTCCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B5 pMON13415 Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAATGATCCATGAAATTATACATCACT-
TAAAGAGACCACCTAACCCTTTG [SEQ ID NO.:336]
CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCCCAG GAACAACAG DNA sequence #B6 pMON13408
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO.:337] CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATC-
GAACGAACCTTCGAACTCCA AACCTGCTCCCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACCCCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGCTTACCCTTGAGCAACCGCAG
GAACAACAG DNA sequence #B7 pMON13409 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACT-
TAAAGAGACCACCTAACCCTTTG [SEQ ID NO.:338]
CTGGACCCGAACAACCTCAATTCCGAACACATCGATATCCTGCTGCAACCAAACCTTCGAACTCCA
AACCTCCTCCCATTCCTAAGGCCTCTCAACCACTTAGAAAATGCATCACGTATTCAGCCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTCCCACCGCCCCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAACAATTCCGGCAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAACCCCAG GAACAACAG DNA sequence #B8 pMON13410
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCCATGAAATTATACATCACTTAAACAGACCACCTAACCCTTTG
[SEQ ID NO.:339] CTGGACCCGAACAACCTCAATTCCCAACACATGGATATCCTCCAC-
GAACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTA-
CAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATCTCTCCCCTCT-
CCCACGCCCGCACCCTCTCCACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACCTTCTATCTCCTTACCCTTGACCAACCGCAG
GAACAACAG DNA sequence #B9 pMON13422 Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAGCTATCGATGAAATTATACATCACT-
TAAAGACACCACCTAACCCTTTG [SEQ ID NO.:340]
CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATCCTGATCGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACCTTCTATCTGG-
TTACCCTTGAGCAACCGCAG GAACAACAG DNA sequence #B10 pMON13423
Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAATCATCCATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO.:341] CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATCCTGCTG-
GAACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAACCGCTCTCAACCACTTA-
CAAAATGCATCAGGTATTCAGGCAATTCTT CGTAATCTCCAACCATCTCTGCCCTCT-
GCCACCGCCGCACCCTCTCCACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B11 pMON13424 Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAGCTATCGATGAAATTATACATCAC-
TTAAAGAGACCACCTAACCCTTTG [SEQ ID NO.:342]
CTGGACCCCAACAACCTCAATTCTCAACACGTTGATATCCTGCTCCAACGAAACCTTCCAACTCCA
AACCTGCTCGCATTCGTAACCGCTGTCAACCACTTAGAAAATCCATCAGGTATTGACCCAATTC-
TT CGTAATCTCCAACCATCTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGCCAAAAACTGACGTTCTATCTCG-
TTACCCTTGACCAACCCCAG GAACAACAG DNA sequence #B12 pMON13425
Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAATCATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO.:343] CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATCCTGCTG-
GAACGAAACCTTCGAACTCCA AACCTGCTCGCATTCCTAAGGGCTGTCAAGCACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATCTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGAGTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B13 pMON13426 Met-Ala-(15-125)IL-3
ATGGCAAACTGCTCTATAGCTATCGATGAAATTATACATGAG-
TTAAAGAGACCACCTAACCCTTTG [SEQ ID NO.:344]
CTGGACCCGAACAACCTCAATTCTGAAGACGTTGATATCCTGGACGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATCTCTGCCCTCTCCCACCGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTCGCAAGAATTCCGCGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B14 pMON13429
Met-Ala-(15-125)IL-3
ATGGCAAACTCCTCTATAATCATCGATGAAATTATACATCACTTAAACAGACCACCTAACCCTTTG
[SEQ ID NO.:345] CTGGACCCGAACAACCTCAATTCTGAAGACGTTATATCCTGGACG-
AACGAAACCTTCGAACTCCA AACCTCCTCGCATTCGTAACCGCTGTCAACCACTTAG-
AAAATGCATCAGCTATTGACGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACCGCCCCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAACCGCAG
GAACAACAG DNA sequence #B15 pMONM13368 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATTATGATCCATGAACCAATACATCA-
CTTAAACCTTCCACCTCCACCTTTG [SEQ ID NO.:346]
CTGGACAGTAACAACCTCAATTCCCAAGACATGGATATCCTCATCCAACGAAACCTTCCACTTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCCCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCCGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCCCAG GAACAACAG DNA sequence #B16 pMONM13380
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCACTTAAAGGTTCCACCTGCACCTTTG
[SEQ ID NO.:347] CTGGACAGTAACAACCTCAATTCCGAAGACATCGATATCCTCATG-
GAACGAAACCTTCGACTTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGCAATTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B17 pMON13475 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCAC-
TTAAAGAGACCACCTGCACCTTTG [SEQ ID NO.:348]
CTGGACCCGAACAACCTCAATGACGAAGACGTTTCTATTCTGATGGACCGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGCCAACAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAACCGCAG GAACAACAG DNA sequence #B18 pMON13366
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:349] CTGGACCCGAACAACCTCAATAACGAAGACGTTTCTATTCTGATG-
CACCCAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B19 pMON13367 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAAGAGACCACCTGCACCTTTG [SEQ ID NO. :350]
CTGGACCCGAACAACCTCAATGCTGAAGACGTTTCTATTCTGATGGACCGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATCCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGCAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B20 pMON13369
Met-Ala-(15-425)IL-3 42D, 46S, 50D
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGACACCACCTGCACCTTTG
[SEQ ID NO.:351] CTGGACCCGAACAACCTCAATGACGAAGACGTTTCTATTC-
TGATGGACCGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGA-
ACTTAGAAAATGCATCAGGTATTGAGGCAATTCTT
CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGC-
AG GAACAACAG DNA sequence #B21 pMON13370 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATG-
AAATTATACATCACTTAAAGAGACCACCTGCACCTTTG [SEQ ID NO.:352]
CTGGACCCGAACAACCTCAATGCTGAAGACATGTCTATTCTGATGGACCGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATCTCTGCCCTCTCCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGCGAAAAACTCACCTTCTATCTCC-
TTACCCTTGACCAAGCCCAG GAACAACAG DNA sequence #B22 pMON13373
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATCAAATTATACATCACTTAAAGACACGAGCTGCACCTTTG
[SEQ ID NO.:353] CTGGACCCGAACAACCTCAATCACCAACACATGTCTATTCTCATC-
GACCCAAACCTTCGAGTTCCA AACCTGGAGACCTTCGTAAGCCCTGTCAACAACTTA-
GAAAATCCATCAGCTATTGACGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCCGGAAAAACTGACGTTCTATCTCCTTACCCTTGAGCAACCCCAG
GAACAACAG DNA sequence #B23 pMON13374 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCA-
CTTAAAGACACCACCTCCACCTTTG [SEQ ID NO.:354]
CTGGACCCGAACAACCTCAATGCTGAAGACGTCCATATCCTCATGGAACGAAACCTTCCACTTCCA
AACCTGGACAGCTTCGTAAGCGCTGTCAAGAACTTACAAAATCCATCACCTATTCACCCAATTC-
TT CGTAATCTCCAACCATCTCTGCCCTCTGCCACCCCCCCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B24 pMON13375
Met-Ala-(15-119)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAACACACCACCTCCACCTTTG
[SEQ ID NO. 355] CTGGACCCGAACAACCTCAATGCTGAACACGTCGATATCCTGATG-
GAACGAAACCTTCCACTTCCA AACCTCCACACCTTCCTAACCCCTCTCAACAACTTA-
CAAAATCCATCACCTATTCACCCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAG DNA
sequence #B25 pMON13376 Met-Asp-(15-119)IL-3
ATGGATAACTGCTCTATAATGATCGATGAAGCAATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO. :356] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGAT-
GGAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTT-
AGAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTC-
TGCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGCAATTCTATCTGGTTACCCTTGAG DNA
sequence #B26 pMON13377 Met-Ala-(15-119)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO. 357] CTGGACCCGAACAACCTCAATGACGAAGACGTCTCTATTCTGATG-
CACCGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAACAATTCCGGGAAAAACTGCAATTCTATCTGGTTACCCTTGAC DNA
sequence #B27 pMON13378 Met-Asp-(15-119)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGACACCACCTGCACCTTTG
[SEQ ID NO.:358] CTCGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
CCAGGTGACTGGCAAGAATTCCGGCAAAAACTGACGTTCTATCTGGTTACCCTTGAG DNA
sequence #B28 pMON13379 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATGGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:359] CTGGACCCGAACAACCTCAATGCTGAAGACGTTTCTATCCTGATG-
GACCGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGCAATTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B29 pMON13385 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAAGGTACCACCTCGCCCTTCC [SEQ ID NO.:360]
CTGGACCCCAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B30 pMON13381
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:361] CTGGACCCGAACAACCTCAATCCTGAAGACGTCGATATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCTGGCCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B31 pMON13383 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATAGATGAC-
TTAAAGAGACCACCTGCACCTTTG [SEQ ID NO.:362]
CTGGACCCGAACAACCTCAATGAGGAAGACGTTTCTATTCTGATGGACCGAAACCTTCGAGTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATGCAA-
TCATCATCAAG GCAGGTGAGTGGCAAGAATTCCGGGAAAAACTGCAATTGTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B32 pMON13384
Net-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCCATGAAATTATACATCACTTAAACACACCACCTGCACCTTTG
[SEQ ID NO.:363] CTGGACCCCAACAACCTCAATGCTCAAGACGTCCATATCCTCATG-
CAACCAAACCTTCGACTTCCA AACCTGGAGAGCTTCCTAAGGCCTGTCAACAACTTA-
GAAAATCCATCAGGTATTGACCCAATTCTT CGTAATCTCCAACCATCTCTGCCCTCT-
CCCACGGCCGCACCCTCTCCACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGCAATTCTATCTGGTTACCCTTGACCAAGCCCAG
GAACAACAG DNA sequence #B33 pMON13388 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAACACACCACCTCCACCTTTG [SEQ ID NO.:364]
CTGGACCCGAACAACCTCAATGCTGAAGACGTCCATATCCTCATGGACCCAAACCTTCGACTTAGC
AACCTGGAGACCTTCCTAACCCCTCTCAAGAACTTAGAAAATGCATCACGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACCCCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGCTGACTGCCAAGAATTCCGGGAAAAACTCACGTTCTATCTCC-
TTACCCTTCACCAACCGCAG GAACAACAG DNA sequence #B34 pMON13389
Net-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:365] CTGGACCCGAACAACCTCAATGAGGAAGACATGGATATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B35 pMON13391 Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAAGAGACCACCTGGACCTTCC [SEQ ID NO.:366]
CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B36 pMON13392
Met-Ala-(15-125)IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:367] CTGGACCCGAACAACCTCAATGACGAAGACGTCGATATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B37 pMON13393 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCCATGAAGCAATACATC-
ACTTAAAGAGACCACCTGCACCTTCC [SEQ ID NO.:368]
CTGGACCCGAACAACCTCAATGACGAAGACATGTCTATCCTGATGGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGCCAATTC-
TT CGTAATCTCCAACCATCTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAC GCACGTGACTGCCAACAATTCCGCGAAAAACTGACCTTCTATCTCG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B38 pMON13394
Met-Ala-(15-125) IL-3
ATCCCTAACTGCTCTATAATCATCGATGAAATTATACATCACTTAAAGACACCACCTCCACCTTTG
[SEQ ID NO.:369] CTGGACCCGAACAACCTCAATGACCAAGACATGTCTATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTCCACACCTTCCTAACCCCTGTCAACAACTTA-
GAAAATGCATCACCTATTGAGCCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
CCCACGGCCCCACCCTCTCCACATCCAATCATCATCAAG
GCAGGTGACTCGCAAGAATTCCCCGAAAAACTGACCTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B39 pMON13395 Met-Ala-(15-125) IL-3
ATGGCTAACTCCTCTATAATCATCGATGAAGCAATACATCA-
CTTAAACGTACCACCTCGCCCTTCC [SEQ ID NO.:370]
CTGGACCCGAACAACCTCAATGACCAAGACGTCTCTATCCTGATGCAACCAAACCTTCGACTTCCA
AACCTCCAGAGCTTCGTAACGCCTGTCAACAACTTAGAAAATGCATCAGGTATTGACCCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACCCCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGCCAACAATTCCGGCAAAAACTGACCTTCTATCTGG-
TTACCCTTCAGCAAGCGCAG GAACAACAG DNA sequence #B40 pMON13396
Met-Ala-(15-125)IL-3
ATGGCTAACTCCTCTATAATCATCGATGAAATTATACATCACTTAAACAGACCACCTGCACCTTTG
[SEQ ID NO.:371] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTCATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCCGT
ATGGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAACCGCAG
GAACAACAG DNA sequence #B41 pMON13397 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCA-
CTTAAAGAGACCACCTGCACCTTTG [SEQ ID NO.:372]
CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGAACGAAACCTTCGAGTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCTGGCCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCCGT ATGGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B42 pMON13398
Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:373] CTGGACCCGAACAACCTCAATGACGAAGACGTCTCTATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B43 pMON13399 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCA-
CTTAAAGGTACCACCTCGCCCTTCC [SEQ ID NO.:374]
CTGGACCCGAACAACCTCAATGACGAAGACGTCTCTATCCTGATGGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGCCCGCACCCTCTCGACATCCAA-
TCATCATCAAG CCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAACCGCAG GAACAACAG DNA sequence #B44 pMON13404
Met-Ala-(15-119) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:375] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGCAATTCTATCTGGTTACCCTTGAG DNA
sequence #B45 pMON13387 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATGGACCGAAACCTTCGACTTC-
CA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTG-
AGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTC-
GACATCCAATCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGT-
TCTATCTGGTTACCCTTGAGCAACCGCAG GAACAACAG DNA sequence #B46 pMON13416
Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:377] CTGGACCCGAACAACCTCAATGACGAAGACGTCGATTCTCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B47 pMON13287 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCA-
CTTAAAGAGACCACCTGCACCTTTG [SEQ ID NO.:378]
CTGGACCGGAACAACCTCAATGACGAAGACGTCATGTCTCTGATGGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTGGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B48 pMON13420
Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCACTTAAAGAGACCACCTGACCTTCC
[SEQ ID NO.:379] CTGGACCCGAACAACCTCAATGACGAACACGTCTCTATCCTGATGGAC-
CGAAACCTTCACTTAGC AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAA-
ATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTGCCA-
CGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGCGAAAAACTGACGTTCTATCTGGTTACCCTTGACCAAGCGCAG
GAACAACAG DNA sequence #B49 pMON13421 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCA-
CTTAAAGAGACCACCTGCACCTTCC [SEQ ID NO.:380]
CTCGACCCGAACAACCTCAATGACGAAGACATGTCTATCCTGATGGACCGAAACCTTCCACTTAGC
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B50 pMON13432
Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAGCAATACATCACTTAAAGAGACCACCTGCACCTTCC
[SEQ ID NO.:381] CTGGACCCGAACAACCTCAATGACGAAGACATGTCTATCCTGATG-
GACCGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
CCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGCTTACCCTTGAGCAAGCGCAG
GAACAACAG DNA sequence #B51 pMON13382 Met-Ala-(15-125) IL-3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCA-
CTTAAAGACACCACCTGCACCTTTG [SEQ ID NO.:382]
CTGGACCCGAACAACCTCAATCCTGAAGACGTCGATATCCTGATCGAACGAAACCTTCGACTTCCA
AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCACGTGACTGGCAACAATTCCGGGAAAAACTGCAATTCTATCTGT-
GGACCCTTGAGCAAGCGCAG GAACAACAG DNA sequence #B52 pMON13476
Met-Asp-(15-125) IL-3
ATGGATAACTGCTCTATTATGATCGATGAAGCAATACATCACTTAAAGAGACCACCTGCACCTTTG
[SEQ ID NO.:383] CTGGACCCGAACAACCTCAATGCTGAAGACGTCGATATCCTGATG-
GAACGAAACCTTCGACTTCCA AACCTGGAGAGCTTCGTAAGGGCTGTCAAGAACTTA-
GAAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCT-
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGAGGTTGTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13400 Met-Ala-(15-125) IL-3 DNA sequence #C2
ATGGCTAACTGCTCTATAATGCCAGATGAAGCAATACATCAC-
TTAAAGATACCACCTAACCCTAGC [SEQ ID NO:384]
CTGGACAGTGCTAACCTCAATTCCGAAGACGTCTCTATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGAGGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13402 Met-Ala-(15-125) IL-3 DNA
sequence #C3
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGATACCACCTAACCCTAGC
[SEQ ID NO:385] CTGGACAGTGCTAACCTCAATTCCGAAGACGTCTCTATCCTGATGG-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13440 Met-Ala-(15-125) IL-3 DNA sequence #C10
ATGGCTAACTGCTCTATTATGATCGATGAAGCAATACATCA-
CTTAAAGATACCACCTAACCCTAGC [SEQ ID NO:386]
CTGGACAGTGCTAACCTCAATTCCGAAGACGTCTCTATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGAGGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13451 Met-Ala-(15-125) IL-3 DNA
sequence #C11
ATGGCTAACTGCTCTATAATACTCGATGAAGCAATACATCACTTAAAGATACCACCTAACCCTAGC
[SEQ ID NO:387] CTGGACAGTGCTAACCTCAATTCCGAAGACGTCTCTATCCTGATGG-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13403 Met-Ala-(15-125) IL-3 DNA sequence #C4
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAAGAGACCACCTAACCCTTTG [SEQ ID NO:388]
CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGGACTCCAACCTTCGAACTCCA
AACCTGCTCGCATTCCCACATGCTGTCAAGCAATTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13419 Met-Ala-(15-125) IL-3 DNA
sequence #C8
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO:389] CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGG-
ACTCCAACCTTCGAACTCCA AACCTGCTCGCATTCCCACATCCTTCTAAGCAATTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACGCCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13411 Met-Ala-(15-125) IL-3 DNA sequence #C5
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAAGAGACCACCTAACCCTTTG [SEQ ID NO:390]
CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTC-
TT CGTAATCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA-
TCATCATCAAG GCAGGTGACTGGCAAGAATTCCGGCTTAAACTGCAATTCTATCTGT-
CTACCCTTGAGCAAGCGCAG GAACAACAG pMON13412 Met-Ala-(15-118) IL-3 DNA
sequence #C6
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO:391] CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGG-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGCTTAAACTGCAATTCTATCTGTCTACCCTTTAATA
pMON13413 Met-Ala-(15-125) IL-3 DNA sequence #C7
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO:392] CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGG-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGGCTTAAACTGCAATTCTATCTGTCTTCTCTTGAGCAAGCGCAG
GAACAACAG pMON13418 Met-Ala-(15-125) IL-3 DNA sequence #C1
ATGGCTAACTGCTCTATAATGATCGATGAAATTATACATCAC-
TTAAAGAGACCACCTAACCCTTTG [SEQ ID NO:393]
CTGGACCCGAACAACCTCAATTCCCAACACATGGATATCCTCATCGAACCAAACCTTCGAACTCCA
AACCTGCTCCCATTCCTAAGGCCTGTCAAGCACTTAGAAAATGCATCACGTATTGACCCAATTC-
TT TCTAATCTCCAACCATGTGTTCCCTATTCGACCGCCCCTCCCTCTYGAACACCAA-
TCACGATCAAG CCAGCTGACTCGCAAGAATTCCGGCAAAAACTCACCTTCTATCTCG-
TTACCCTTGACCAACCCCAG GAACAACAC pMON13428 Met-Ala-(15-125) IL-3 DNA
sequence #C9
ATGGCTAACTGCTGTATAATGATCGATGAAATTATACATCACTTAAAGAGACCACCTAACCCTTTG
[SEQ ID NO:394] CTGGACCCGAACAACCTCAATTCCGAAGACATGGATATCCTGATGG-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGCCAATTCTT TCTAATCTCCAACCATGTGTTCCCTATT-
GGACGGCCCCTCCCTCTCGAACACCAATCACGATCAAG
GCAGGTGACTGGCAAGAATTCCGGCTTAAACTGGAATTCTATCTGTCTACCCTTGAGCAAGCGCAG
GAACAACAG pMON13459 Met-Ala-(15-125) IL-3 DNA sequence #C12
ATGGCTAACTGCTCTATAATGATCCATGAAATTATACATCA-
CTTAAAGATACCACCTAACCCTAGC [SEQ ID NO:395]
CTGGACAGTGCTAACCTCAATTCCGAAGACGTCTCTATCCTGATGGAACGAAACCTTCGAACTCCA
AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGGTATTGAGCCAATTC-
TT TCTAATCTCCAACCATGTGTTCCCTATTGGACGGCCCCTCCCTCTCGAACACCAA-
TCACCATCAAG GCAGGTGACTGGCAAGAATTCCGGCTTAAACTGCAATTCTATCTGT-
CTACCCTTGAGCAAGCGCAG GAACAACAG pMON13467 Met-Ala-(15-125) IL-3 DNA
sequence #C13
ATGGCTAACTGCTCTATAATCATCCATGAAATTATACATCACTTAAAGATACCACCTAACCCTACC
[SEQ ID NO:396] CTGGACAGTCCTAACCTCAATTCCCAACACCTCTCTATCCTGATCC-
AACGAAACCTTCGAACTCCA AACCTGCTCGCATTCGTAAGGGCTGTCAAGCACTTAG-
AAAATGCATCAGGTATTGAGGCAATTCTT CGTAATCTCCAACCATGTCTGCCCTCTG-
CCACGGCCGCACCCTCTCGACATCCAATCATCATCAAG
GCAGGTGACTGGCAAGAATTCCGCCTTAAACTGCAATTCTATCTCTCTTCTCTTGAGCAAGCGGAG
GAACAACAG pMON13492 Met-Ala-(15-125) IL-3 DNA sequence #C14
ATCGCTAACTGCTCTATAATGATCGATGAAATTATACATCA-
CTTAAAGATACCACCTAACCCTAGC [SEQ ID NO:397]
CTGGACAGTGCTAACCTCAATTCCGAAGACGTCTCTATCCTGATCGAACGAAACCTTCGAACTCCA
AACCTCCTCGCATTCGTAAGGGCTGTCAAGCACTTAGAAAATGCATCAGCTATTGAGCCAATTC-
TT TCTAATCTCCAACCATGTGTTCCCTATTGGACGGCCCCTCCCTCTCGAACACCAA-
TCACGATCAAG GCAGGTSACTGGCAAGAATTCCGGGAAAAACTGACGTTCTATCTGG-
TTACCCTTGAGCAAGCGCAG GAACAACAG pMON13446
Met-Ala-Tyr-Pro-Glu-Thr-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-Ala
(15-125) IL-3 DNA sequence #B53 ATGGCATATCCAGAAACTGATTACAAG-
GACCACGATGACAAGGCTAACTGCTCTATAATGATCGAT [SEQ ID NO:404]
GAAATTATACATCACTTAAAGAGACCACCTGCACCTTTGCTGGACCCGAACAACCTCAATGCTGAA
GACGTCGATATCCTGATCGAACGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGGGCTG-
TC AAGAACTTACAAAATGCATCAGGTATTCAGGCAATTCTTCGTAATCTCCAACCAT-
GTCTGCCCTCT GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAGCCAGGTG-
ACTGCCAAGAATTCCGGGAA AAACTGACGTTCTATCTGGTTACCCTTGAGCAAGCGC-
AGGAACAACAG pMON133990 Met-Ala-Tyr-Pro-Glu-Thr-Asp--
Tyr-Lys-Asp-Asp-Asp-Asp-Lys-Ala (15-125) IL-3 DNA sequence #B54
ATGGCATATCCAGAAACTGATTACAAGGACGACGATGACAAGGCTAACTGCTCTATAATGA-
TCGAT [SEQ ID NO:405] GAAATTATACATCACTTAAAGAGACCACCTAACCCT-
TTGCTGGACCCCAACAACCTCAATTCCGAA GACATGGATATCCTGATGGAACCAAAC-
CTTCGAACTCCAAACCTGCTCGCATTCGTAAGGGCTGTC
AAGCACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAATCTCCAACCATGTCTGCCCTCT
GCCACGGCCGCACCCTCTCGACATCCAATCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGG-
AA AAACTGACCTTCTATCTCGTTACCCTTGAGCAAGCGCAGGAACAACAG
[0815] Polypeptides corresponding to [SEQ ID NO. 129] comprising
(1-133) hIL-3 containing four or more amino acid substitutions can
be made using the procedures described above and in the following
examples by starting with the appropriate oligonuctiotides and then
constructing the DNA encoding the polypeptide and expressing it in
an appropriate host cell. In a similar manner polypeptides which
correspond to [SEQ ID NO. 130] and contain four or more amino acid
substitutions and wherein from 1 to 14 amino acids have been
sequentially deleted from the N-terminus, or from 1 to 15 amino
acids have been deleted from the C-terminus or deletions of amino
acids have been made from both the N-terminus and the C-terminus
can also be made by following the procedures described above and in
the following examples, beginning with the appropriate starting
materials.
[0816] Further details known to those skilled in the art may be
found in T. Maniatis, et al., Molecular Cloning, A Laboratory
Manual, Cold Spring Harbor Laboratory (1982) and references cited
therein, incorporated herein by reference; and in J. Sambrook, et
al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold
Spring Harbor Laboratory (1989) and references cited therein,
incorporated herein by reference.
[0817] The following examples will illustrate the invention in
greater detail although it will be understood that the invention is
not limited to these specific examples.
[0818] Amino acids are shown herein by standard one letter or three
letter abbreviations as follows:
15 Abbreviated Designation Amino Acid A Ala Alanine C Cys Cysteine
D Asp Aspartic acid E Glu Glutamic acid F Phe Phenylalanine G Gly
Glycine H His Histidine I Ile Isoleucine K Lys Lysine L Leu Leucine
M Met Methionine N Asn Asparagine P Pro Proline Q Gln Glutamine R
Arg Arginine S Ser Serine T Thr Threonine V Val Valine W Trp
Tryptophan Y Tyr Tyrosine
[0819] Various other examples will be apparent to the person
skilled in the art after reading the present disclosure without
departing from the spirit and scope of the invention. It is
intended that all such other examples be included within the scope
of the appended claims.
[0820] References
[0821] Adams, S. P., Kavka, K. S., Wykes, E. J., Holder, S. B. and
Galluppi, G. R. Hindered Dialkyamino Nucleoside Phosphate reagents
in the synthesis of two DNA 51-mers. J. Am. Chem. Soc., 105,
661-663 (1983).
[0822] Atkinson, T. and Smith, M., in Gait, M. J., Oligonucleotide
Sythesis (1984) (IRL Press, Oxford England).
[0823] Bachmann, B., Pedigrees of some mutant strains of
Escherichia coli K-12, Bacteriological Reviews, 36:525-557
(1972).
[0824] Bayne, M. L., Expression of a synthetic gene encoding human
insulin-like growth factor I in cultured mouse fibroblasts. Proc.
Natl. Acad. Sci. USA 84, 2638-2642 (1987).
[0825] Ben-Bassat, A., K. Bauer, S-Y. Chang, K. Myambo, A. Boosman
and S. Ching. Processing of the initiating methionine from
proteins: properties of the Escherichia coli methionine
aminopeptidase and its gene structure. J. Bacteriol., 169: 751-757
(1987).
[0826] Biesma, B. et al., Effects of interleukin-3 after
chemotherapy for advanced ovarian cancer. Blood, 80:1141-1148
(1992).
[0827] Birnboim, H. C. and J. Doly. A rapid alkaline extraction
method for screening recombinant plasmid DNA. Nucleic Acids
Research, 7(6): 1513-1523 (1979).
[0828] Bradford, M. M., A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding, Analytical Biochemistry, 72:
248-254 (1976).
[0829] Clark-Lewis, I., L. E. Hood and S. B. H. Kent. Role of
disulfide bridges in determining the biological activity of
interleukin 3, Proc. Natl. Acad. Sci., 85: 7897-7901 (1988).
[0830] Clement, J. M. and Hofnung, M. Gene sequence of the
receptor, an outer membrane protein of E. coli K12. Cell, 27:
507-514 (1981).
[0831] Covarrubias, L., L. Cervantes, A. Covarrubias, X. Soberon,
I. Vichido, A. Blanco, Y. M. Kupersztoch-Portnoy and F. Bolivar.
Construction and characterization of new cloning vehicles. V.
Mobilization and coding properties of pBR322 and several deletion
derivates including pBR327 and pBR328. Gene 13: 25-35 (1981).
[0832] Deng, W. P. & Nickoloff, J. A. Site-directed mutagenesis
of virtually any plasmid by eliminating a unique site Anal.
Biochem. 200:81 (1992).
[0833] Dente, L., G. Cesareni and R. Cortese, pEMBL: a new family
of single stranded plasmids, Nucleic Acids Research, 11: 1645-1655
(1983).
[0834] Dunn, J. J. and Studier, F. W., Complete nucleotide sequence
of bacteriophage T7 DNA and the locations of T7 genetic elements.
J. Mol. Biol. 166:477-535 (1983).
[0835] Falk, S., G. Seipelt, A. Ganser, O. G. Ottmann, D. Hoelzer,
H. J. Stutte and K. Hubner. Hematopathology 95: 355 (1991).
[0836] Fling, M. E., et al. Nucleotide sequence of the transposon
Tn7 gene encoding an aminoglycoside-modifying enzyme,
3"(9)-O-nucleotidyltransfera- se. Nucl. Acids Res. 13:7095-7106
(1985).
[0837] Ganser, A., A. Lindemann, G. Seipelt, O. G. Ottmann, F.
Herrmann, M. Eder, J. Frisch, G. Schulz, R. Mertelsmann and D.
Hoelzer. Effects of Recombinant Human Interleukin-3 in Patients
With Normal Hematopoiesis and in Patients with Bone Marrow Failure,
Blood 76: 666 (1990).
[0838] Gething and Sambrook, Cell-surface expression of influenza
haemagglutinin from a cloned DNA copy of the RNA gene, Nature, 293:
620-625 (1981).
[0839] Gillio, A. P., C. Gasparetto, J. Laver, M. Abboud, M. A.
Bonilla, M. B. Garnick and R. J. O'Reilly. J. Clin. Invest. 85:
1560 (1990).
[0840] Gouy, M. and G. Gautier, Codon usage in bacteria:
Correlation with gene expressivity, Nucleic Acids Research, 10:
7055-7074 (1982).
[0841] Greenfield, L., T. Boone, and G. Wilcox. DNA sequence of the
araBAD promoter in Escherichia coli B/r. Proc. Natl. Acad. Sci.
USA, 75: 4724-4728 (1978).
[0842] Higuchi, R, (1989) in PCR Technology, H. A. Erlich ed.,
Stockton Press, N.Y. chapter 2-6.
[0843] Hunkapiller, M. W., R. W. Hewick, R. J. Dreyer and L. E.
Hood. High sensitivity sequencing with a gas-phase sequenator.
Methods in Enzymology 153: 399-413 (1983).
[0844] Kaufman, et al., Coamplification and Coexpression of Human
Tissue-Type Plasminogen Activator and Murine Dihydrofolate
Reductase Sequences in Chinese Hamster Ovary Cells, Mol. Cell.
Biol., 5(7): 1750-1759 (1985).
[0845] Kaufman, R. J. High level production of proteins in
mammalian cells, in Genetic Engineering, Principles and Methods,
Vol. 9, J. K. Setlow, editor, Plenum Press, New York (1987).
[0846] Kunkel, T. A. Rapid and efficient site-specific mutagenesis
without phenotypic selection. Proc. Natl. Acad. Sci. USA, 82:
488-492 (1985).
[0847] Laemmli, U. K., Cleavage of structural proteins during
assembly of the head of bacteriophage T4, Nature, 227:680-685
(1970).
[0848] Lange, B., M. Valtieri, D. Santoli, D. Caracciolo, F.
Mavilio, I. Gemperlein, C. Griffin, B. Emanuel, J. Finan, P.
Nowell, and G. Rovera. Growth factor requirements of childhood
acute leukemia: establishment of GM-CSF-defendent cell lines. Blood
70:192 (1987).
[0849] Mahler, H. R. and E. H. Cordes, in Biological Chemistry, p.
128, New York, Harper and Row (1966).
[0850] Maniatis, T., E. F. Fritsch and J. Sambrook, Molecular
Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory
(1982).
[0851] Marinus, M. G. Location of DNA methylation genes on the
Escherichia coli K-12 genetic map. Molec. Gen. Genet. 127: 47-55
(1973).
[0852] McBride, L. J. and Caruthers, M. H. An investigation of
several deoxynucleoside phosphoramidites. Tetrahedron Lett., 24,
245-248 (1983).
[0853] Messing, J., A multipurpose cloning system based on the
single-stranded DNA bacteriophage M13. Recombinant DNA Technical
Bulletin, NIH Publication No. 79-99, Vol. 2, No. 2, pp. 43-48
(1979).
[0854] Neu, H. C. and L. A. Heppel. The release of enzymes from
Escherichia coli by osmotic shock and during the formation of
spheroplasts. J. Biol. Chem., 240: 3685-3692 (1965).
[0855] Obukowicz, M. G., Staten, N. R. and Krivi, G. G., Enhanced
Heterologous Gene Expression in Novel rpoH Mutants of Escherichia
coli. Applied and Environmental Microbiology 58, No. 5, p.
1511-1523 (1992).
[0856] Olins, P. O., C. S. Devine, S. H. Rangwala and K. S. Kavka,
The T7 phage gene 10 leader RNA, a ribosome-binding site that
dramatically enhances the expression of foreign genes in
Escherichia coli, Gene, 73:227-235 (1988).
[0857] Olins, P. O. and S. H. Rangwala, Vector for enhanced
translation of foreign genes in Escherichia coli, Methods in
Enzymology, 185: 115-119 (1990).
[0858] Postmus, et al., Effects of recombinant human interleukin-3
in patients with relapsed small-cell lung cancer treated with
chemotherapy: a dose-finding study. J. Clin. Oncol., 10:1131-1140
(1992).
[0859] Prober, J. M., G. L. Trainor, R. J. Dam, F. W. Hobbs, C. W.
Robertson, R. J. Zagursky, A. J. Cocuzza, M. A. Jensen and K.
Baumeister. A system for rapid DNA sequencing with fluorescent
chain-terminating dideoxynucleotides. Science 238: 336-341
(1987).
[0860] Renart J., J. Reiser and G. R. Stark, Transfer of proteins
from gels to diazobenzyloxymethyl-paper and detection with
anti-sera: a method for studying antibody specificity and antigen
structure, Proc. Natl. Acad. Sci. USA, 76:3116-3120 (1979).
[0861] Saiki, R. K., Schorf, S., Faloona, F., Mullis, K. B., Horn,
G. T., Erlich, H. A. and Arnheim, N., Enzymatic Amplification of
.beta.-Globin Genomic Sequences and Restriction Site Analysis for
Diagnosis of Sickle Cell Anemia, Science, 230: 1350-1354
(1985).
[0862] Sambrook, J., et al., Molecular Cloning, A Laboratory
Manual, 2nd edition, Cold Spring Harbor Laboratory (1989).
[0863] Sancar, A., C. Stachelek, W. Konigsberg and W. D. Rupp,
Sequences of the recA gene and protein, Proc. Natl. Acad. Sci., 77:
2611-2615 (1980).
[0864] Sanger, F., S. Nicklen and A. R. Coulson. DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A.
74: 5463-5467 (1977).
[0865] Santoli, D., Y. Yang, S. C. Clark, B. L. Kreider, D.
Caracciolo, and G. Rovera. Synergistic and antagonistic effects of
recombinant human interleukin (IL-3), IL-1_, granulocyte and
macrophage colony-stimulating factors (G-CSF and M-CSF) on the
growth of GM-CSF-dependent leukemic cell lines. J. Immunol. 139:348
(1987).
[0866] Smith, M. In vitro mutagenesis. Ann. Rev. Genet., 19:423-462
(1985).
[0867] Soberon, X., L. Covarrubias and F. Bolivar, Construction and
characterization of new cloning vehicles. IV. Deletion derivatives
of pBR322 and pBR325, Gene, 9: 211-223 (1980).
[0868] Stader, J. A. and T. J. Silhavy. Engineering Escherichia
coli to secrete heterologous gene products, Methods in Enzymology,
185: 166-87 (1990).
[0869] Summers, M. D. and G. E. Smith. A manual of methods for
Baculovirus vectors and insect cell culture procedures. Texas
Agricultural Experiment Station Bulletin No. 1555 (1987).
[0870] Taylor, J. W., Ott, J. and Eckstein, F. The rapid generation
of oligonucleotide-directed mutants at high frequency using
phosphorothioate modified DNA. Nucl. Acids Res., 13:8764-8785
(1985).
[0871] Treco, D. A., (1989) in Current protocols in Molecular
Biology, Seidman et al., eds. J Wiley N.Y., unit 2.1.
[0872] Valtieri, M., D. Santoli, D. Caracciolo, B. L. Kreider, S.
W. Altmann, D. J. Tweardy, I. Gemperlein, F. Mavilio, B. J. Lange
and G. Rovera. Establishment and characterization of an
undifferentiated human T leukemia cell line which requires
granulocyte-macrophage colony stimulating factor for growth. J.
Immunol. 138:4042 (1987).
[0873] Voet, D., W. B. Gatzer, R. A. Cox, P. Doty. Absorption
spectra of the common bases. Biopolymers 1: 193 (1963).
[0874] Wells, J. A., Vasser, M., and Powers, D. B. Cassette
mutagenesis: an effective method for generation of multiple mutants
at defined sites. Gene, 34:315-323 (1985).
[0875] Wong, Y. Y., R. Seetharam, C. Kotts, R. A. Heeren, B. K.
Klein, S. B. Braford, K. J. Mathis, B. F. Bishop, N. R. Siegel, C.
E. Smith and W. C. Tacon. Expression of secreted IGF-1 in
Escherichia coli. Gene, 68: 193-203 (1988).
[0876] Yanisch-Perron, C., J. Viera and J. Messing. Improved M13
phage cloning vectors and host strains: nucleotide sequences of the
M13mp18 and pUC19 vectors. Gene 33: 103-119 (1985).
[0877] Zoller, M. J. and Smith, M. Oligonucleotide-directed
mutagenesis using M13-derived vectors: an efficient and general
procedure for the production of point mutations in any fragment of
DNA. Nucleic Acid Research, 10: 6487-6500 (1982).
[0878] Zoller, M. J. and Smith, M. Oligonucleotide-directed
mutagenesis of DNA fragments cloned into M13 vectors. Methods in
Enzymology, 100:468-500 (1983).
[0879] Zoller, M. J. and Smith, M. Oligonucleotide-directed
Mutagenesis: A simple method using two oligonucleotide primers and
a single-stranded DNA template. DNA, 3: 479 (1984).
EXAMPLE 1
[0880] Construction of pMON 5846 (FIG. 4) which encodes
[Met-(1-133) hIL-3 (Arg.sup.129)]
[0881] A plasmid containing the gene for the cDNA of hIL-3 cloned
into pUC18 on an EcoRI to HindIII fragment was obtained from
British Biotechnology Limited (Cambridge, England). This plasmid
was designated pPO518. The purified plasmid DNA was cleaved by the
restriction endonucleases NheI and BamHI. Approximately 0.5
micrograms of cleaved plasmid DNA was ligated to 1.0 picomoles of a
pair of annealed oligonucleotides with the following sequence:
16 5'-CTAGCGATCTTTTAATAAGCTTG-3' [SEQ ID NO:1]
3'-GCTAGAAAATTATTCGAACCTAG-5' [SEQ ID NO:2]
[0882] The ligation mixture was used to transform competent JM101
cells to ampicillin resistance. Colonies were picked, and plasmid
DNA was purified and subjected to restriction enzyme analysis. An
isolate was identified in which the above oligonucleotide sequence
had replaced the portion of the gene that encodes the extreme C
terminus. Within the new sequence was a new stop codon, TAA, and a
recognition site for the enzyme HindIII. The new plasmid was
designated pMON5846.
EXAMPLE 2
[0883] (a) Construction of Expression Vector Plasmid pMON2341
[0884] The plasmid pMON2341 was used to supply the particular
replicon and expression elements used for construction of many of
the plasmids used to produce hIL-3 and hIL-3 muteins in E. coli.
These expression elements are described in the materials and
methods section. pMON2341 is derived from pMON5515 (Olins et al.,
1988) and from pMON2429. pMON2429 consists of the phage mp18
(Yanisch-Perron et al., 1985) with a BclI fragment carrying the
chloramphenicol acetyl transferase (cat) gene from pBR328
(Covarrubias et al., 1981) inserted into the BamHI site. The cat
gene in pMON2429 has been altered from that in pBR328 by site
directed mutagenesis (Kunkel, 1985). The recognition sites for NcoI
and EcoRI which occur in the native gene were altered so that these
two restriction enzymes no longer recognize these sites. The
changes did not alter the protein specified by the gene. Also, an
NcoI site was introduced at the N-terminus of the coding sequence
so that it overlaps the codon for initiator methionine.
[0885] The steps involved in construction of pMON2341 are listed
below:
[0886] (1) The DNAs of pMON5515 and pMON2429 were treated with NcoI
and HindIII. The fragments were ligated and used to transform
competent E. coli to ampicillin resistance. From these colonies,
some were identified that were chloramphenicol resistant. From one
of these colonies, plasmid DNA was isolated in which the rat
atriopeptigen gene of pMON5515 had been replaced by the NcoI to
HindIII fragment containing the cat gene from pMON2429. This
fragment contains the recognition sites for several restriction
enzymes in the portion derived from the multilinker region of mp18.
The new plasmid was designated pMON2412.
[0887] (2) pMON2412 was treated with the enzyme ClaI which cleaves
at one location in the pBR327 derived portion of the DNA. The
protruding ends were rendered blunt by treatment with Klenow in the
presence of nucleotide precursors. This DNA was mixed with an
isolated 514 bp RsaI fragment derived from pEMBL8 (Dente et al.,
1983). This RsaI fragment contains the origin of replication of
phage f1. This ligation mixture was used to transform competent E.
coli cells to ampicillin resistance. Among the plasmid DNAs
isolated from these cells was pMON5578. This plasmid has the
structure of pMON2412 with the f1 origin region inserted into the
ClaI site. This is illustrated in the Figures and in Olins and
Rangwala (1990).
[0888] (3) The DNA of pMON5578 was treated with restriction enzymes
HindIII and MstII. The DNA was then treated with Klenow enzyme in
the presence of nucleotide precursors to render the ends blunt.
This treated DNA was ligated and used to transform competent E.
coli to ampicillin resistance. From the ampicillin resistant
colonies, one plasmid was recovered from which the portion between
HindIII and MstII was absent. This deletion resulted in the removal
of sequences from the plasmid which are recognized by a number of
restriction endonuclease sites. The new plasmid was designated
pMON5582.
[0889] (4) The DNA of pMON5582 was treated with SstII and BclII and
ligated in the presence of annealed oligonucleotides with the
sequences shown below.
17 5'-GGCAACAATTTCTACAAAACACTTGATACTGTAT [SEQ ID NO:3] GAGCAT-
3'-CGCCGTTGTTAAAGATGTTTTGTGAACTATGACA [SEQ ID NO:4] TACTCGTA-
ACAGTATAATTGCTTCAACAGAACAGATC-3' TGTCATATTAACGAAGTTGTCTTGT-5'
[0890] This sequence encodes the essential elements of the recA
promoter of E. coli including the transcription start site and the
lexA repressor binding site (the operator) (Sancar et al., 1980).
The plasmid recovered from the ligation mixes contained this recA
promoter in place of the one in pMON5582 (and in pMON5515). The
functionality of the recA promoter was illustrated by Olins and
Rangwala (1990). The new plasmid was designated pMON5594.
[0891] (5) To eliminate the single EcoRI site in pMON5594, the DNA
was treated with EcoRI, then with Klenow in the presence of
nucleotide precursors to render the ends blunt and then the DNA was
ligated. From this ligation mix a plasmid was recovered whose DNA
was not cleaved with EcoRI. This plasmid was designated
pMON5630.
[0892] (6) To alter the single recognition site for PstI, plasmid
pMON5630 was subjected to site directed mutagensis (Kunkel, 1985).
The oligonucleotide used in this procedure has the sequence shown
below.
[0893] 5'-CCATTGCTGCCGGCATCGTGGTC-3' [SEQ ID NO:5]
[0894] The result of the procedure was to construct pMON2341 which
differs from pMON5630 in that the PstI site in the beta-lactamase
gene was altered so that PstI no longer recognizes the site. The
single nucleotide change does not alter the amino acid sequence of
the beta-lactamase protein.
[0895] (b) Construction of pMON5847 (FIG. 5) which encodes
[Met-(1-133) hIL-3(Arg.sup.129)]
[0896] Plasmid pMON2341 was used to supply the replicon, promotor,
ribosome binding site, transcription terminator and antibiotic
resistance marker for the plasmids used to produce hIL-3 in E. coli
from cDNA derived hIL-3 genes.
[0897] Plasmid pMON2341 was treated with restriction enzymes NcoI
and HindIII. The restriction fragment containing the replication
origin was purified. The DNA of plasmid pMON5846 was treated with
NcoI and HindIII. The restriction fragment containing the hIL-3
gene was gel purified. These purified restriction fragments were
mixed and ligated. The ligation mixture was used to transform
competent JM101 cells to ampicillin resistance. Colonies were
picked, and plasmid DNA was purified and analyzed using restriction
enzymes. pMON5847 was identified as a plasmid with the replicon of
pMON2341 and the hIL-3 gene in place of the chloramphenicol acetyl
transferase gene. JM101 cells harboring this plasmid were cultured
in M9 medium and treated with nalidixic acid as described above.
Samples of the culture were examined for protein content. It was
found that this hIL-3 mutein was produced at about 6% of total cell
protein as measured on Coomassie stained polyacrylamide gels.
EXAMPLE 3
[0898] Construction of pMON5854 (FIG. 7) which Encodes [Met-(1-133)
hIL-3(Arg.sup.129)]
[0899] To increase the accumulation of hIL-3 in E. coli, the coding
sequence of the amino terminal portion of the protein was altered
to more closely reflect the codon bias found in E. coli genes that
produce high levels of proteins (Gouy and Gautier, 1982). To change
the coding sequence for the amino terminal portion of the gene, a
pair of synthetic oligonucleotides were inserted between the NcoI
and HpaI sites within the coding sequence. About 0.5 micrograms of
DNA of the plasmid pMON5847 (Example 2) was treated with NcoI and
HpaI. This DNA was mixed with an annealed pair of oligonucleotides
with the following sequence:
18 5'-CATGGCTCCAATGACTCAGACTACTTCTCTTAAG [SEQ ID NO:6] ACT-
3'-CGAGGTTACTGAGTCTGATGAAGAGAATTC [SEQ ID NO:7] TGA- TCTTGGGTT-3'
AGAACCCAA-5'
[0900] The fragments were ligated. The ligation mixture was used to
transform competent JM101 to ampicillin resistance. Colonies were
picked into broth. From the cultures plasmid DNA was made and
examined for the presence of a DdeI site (CTNAG) which occurs in
the synthetic sequence but not between the NcoI and HpaI sites in
the sequence of pMON5847. The new recombinant plasmid was
designated pMON5854. The nucleotide sequence of the DNA in the
coding sequence of the amino terminal portion of the hIL-3 gene in
pMON5854 was determined by DNA sequencing and found to be the same
as that of the synthetic oligonucleotide used in ligation. Cultures
of JM101 cells harboring this plasmid were grown and treated with
nalidixic acid to induce production of the hIL-3 mutant protein.
Analysis of the proteins on Coomassie gels showed that the
accumulation of hIL-3 mutein was about 25% of total cell protein in
cultures harboring pMON5854, significantly higher than it was in
cultures harboring pMON5847.
EXAMPLE 4
Construction of pMON5887 (FIG. 12) which encodes [Met-(1-125)
hIL-3]
[0901] The plasmid DNA of pMON5854 (Example 3) was treated with
EcoRI and HindIII and the larger fragment gel was purified. About
0.5 microgram of this DNA was ligated to 1 picomole of an annealed
pair of oligonucleotides which encode amino acids 107 through 125
of hIL-3. The sequences of these oligonucleotides are shown
below.
19 EcoRI to HindIII 5'-AATTCCGTCGTAAACTGACCTTCTATCTGAAAA- [SEQ ID
NO:8] 3'-GGCAGCATTTGACTGGAAGATAGACTTTT- [SEQ ID NO:9]
CCTTGGAGAACGCGCAGGCTCAACAGTAATA-3'
GGAACCTCTTGCGCGTCCGAGTTGTCATTATTCGA- 5'
[0902] After ligation, the DNA was used to transform competent
JM101 cells to ampicillin resistance. Colonies were picked into
broth and plasmid DNA was isolated from each culture. Restriction
analysis of the plasmid DNA showed the presence of an EcoRI to
HindIII fragment smaller than that of pMON5854. The nucleotide
sequence of the portion of the coding sequence between the EcoRI
and HindIII sites was determined to confirm the accuracy of the
replaced sequence. The new plasmid was designated pMON5887 encoding
Met-(1-125) hIL-3 which has the following amino acid sequence:
20 [SEQ ID NO:10] Met Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr
Ser Trp Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Gln Asp Gln
Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln
EXAMPLE 5
[0903] Construction of pMON5967 which encodes [Met-Ala-(15-125)
hIL-3]
[0904] Plasmid DNA of pMON5887 isolated from E. coli GM48 (dam-)
was cleaved with NcoI and ClaI and ligated to 1 picomole of an
annealed pair of oligonucleotides, encoding amino acids [Met Ala
(15-20) hIL-3]. The sequence of these oligonucleotides is shown
below.
21 5'-CATGGCTAACTGCTCTAACATGAT-3' [SEQ ID NO:11]
3'-CGATTGACGAGATTGTACTAGC-5' [SEQ ID NO:12]
[0905] The resulting ligation mix was used to transform competent
E. coli JM101 cells to ampicillin resistant colonies. Plasmid DNA
was isolated from these cells and the size of the inserted fragment
was determined to be smaller than that of pMON5887 by restriction
analysis using NcoI and NsiI. The nucleotide sequence of the region
between NcoI and ClaI was determined and found to be that of the
synthetic oligonucleotides. The new plasmid was designated pMON5967
and cells containing it were induced for protein production.
Sonicated cell pellets and supernatants were used for protein
purification and bio-assay.
EXAMPLE 6
[0906] Construction of pMON5978 which Encodes [Met-Ala-(15-125)
hIL-3]
[0907] Plasmid DNA of pMON5967 isolated from E. coli GM48(dam-) was
cleaved with ClaI and NsiI and ligated to 1 picomole of an annealed
assembly of six oligonucleotides encoding hIL-3 amino acids 20-70
(FIG. 2). This synthetic fragment encodes three unique restriction
sites, EcoRV, XhoI and PstI. The sequence of these oligonucleotides
is shown in FIG. 2.
[0908] The resulting ligation mix was used to transform competent
E. coli JM101 cells to ampicillin resistant colonies. Plasmid DNA
was isolated and screened with XbaI and EcoRV for the presence of
the new restriction site EcoRV. The DNA sequence of the region
between ClaI and NsiI was determined and found to be the same as
that of the synthetic oligonucleotides. The new plasmid was
designated pMON5978, and cells containing it were induced for
protein production. Sonicated cell pellets and supernatants were
used for protein purification and bio-assay.
[0909] Plasmid pMON5978 encodes [Met-Ala-(15-125) hIL-3] which has
the following amino acid sequence:
22 [SEQ ID NO:13] Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn
Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu
Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro
Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg
Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln
EXAMPLE 7
[0910] Construction of pMON13356
[0911] Plasmid pMON5988 DNA was digested with restriction enzymes
NcoI and EcoRV, and the resulting 4190 base pair NcoI,EcoRV
fragment contains the following genetic elements: beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 47-125 of (15-125) hIL-3. The 4190 base pair NcoI,EcoRV
restriction fragment from pMON5988 was ligated to the following
annealed complementary oligonucleotides from Table (2).
[0912] Oligo #13 [SEQ ID NO:27]
[0913] Oligo #14 [SEQ ID NO:28]
[0914] The ligation reaction mixture was used to transform E. coli
K-12 strain JM101 and transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated from a
colony grown in LB broth and the size of the inserted fragment was
determined by restriction analysis employing restriction enzymes
NcoI and HindIII in double digest. In the resulting plasmid the 99
bases between the NcoI and EcoRV restriction sites in the (15-125)
hIL-3 gene are replaced with 22 bases from the above mentioned
oligonucleotides. This linker also contains a NdeI recognition
sequence.
EXAMPLE 8
[0915] Construction of pMON13344
[0916] Plasmid pMON13356 DNA was digested with restriction enzymes
NcoI and EcoRV, and the resulting 4190 base pair NcoI,EcoRV
fragment contains the following genetic elements: beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 47-125 of (15-125) hIL-3. The second DNA fragment was
generated by synthetic gene assembly using the following
complementary oligonucleotide pairs that have overlapping ends:
[0917] Oligo #1 [SEQ ID NO:15]
[0918] Oligo #2 [SEQ ID NO:16]
[0919] Oligo #3 [SEQ ID NO:17]
[0920] Oligo #4 [SEQ ID NO:18]
[0921] Oligo #9 [SEQ ID NO:23]
[0922] Oligo #10 [SEQ ID NO:24]
[0923] The assembled oligonucleotides create NcoI and EcoRV
restriction ends and the DNA sequence that encodes amino acids
15-46 of (15-125) hIL-3 with the following amino acid
substitutions: 18I, 25H, 29R, 32A, 37P, 42A and 45V. The codons
encoding amino acids 15-46 of (15-125) hIL-3 are those found in the
hIL-3 cDNA sequence except at those positions where amino acid
substitutions were made. The 4190 base pair NcoI, EcoRV restriction
fragment from pMON13356 was ligated with the pairs of annealed
oligonucleotides. The ligation reaction was digested with NdeI and
subsequently used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated from a colony grown in LB broth.
The DNA sequence was determined to be that of the oligonucleotides.
The plasmid, pMON13344, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
23 Peptide #2 [SEQ ID NO:66] Asn Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leo Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leo Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0924] DNA sequence #10 [SEQ ID NO:106] codes for the foregoing
pMON13344 polypeptide.
EXAMPLE 9
[0925] Construction of pMON13345
[0926] The 4190 base pair NcoI, EcoRV restriction fragment from
pMON13356 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0927] Oligo #1 [SEQ ID NO:15]
[0928] Oligo #2 [SEQ ID NO:16]
[0929] Oligo #5 [SEQ ID NO:19]
[0930] Oligo #6 [SEQ ID NO:20]
[0931] Oligo #11 [SEQ ID NO:25]
[0932] Oligo #12 [SEQ ID NO:26]
[0933] The assembled oligonucleotides create NcoI and EcoRV
restriction ends and the DNA sequence that encodes amino acids
15-46 of (15-125) hIL-3 with the following amino acid
substitutions: 18I, 25H, 29R, 32N, 37P, 42S and 45M. The codons
encoding amino acids 15-46 of (15-125) hIL-3 are those found in the
hIL-3 cDNA sequence except at those positions where amino acid
substitutions were made. The ligation reaction was digested with
NdeI and used to transform E. coli K-12 strain JM101. Transformant
bacteria were selected on ampicillin-containing plates. Plasmid DNA
was isolated from a colony grown in LB broth. The DNA was sequenced
to determine that the sequence was that of the oligonucleotides.
The plasmid, pMON13345, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
24 Peptide #3 [SEQ ID NO:67] Asn Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0934] DNA sequence #11 [SEQ ID NO:107] codes for the foregoing
pMON13345 polypeptide.
EXAMPLE 10
[0935] Construction of pMON13346
[0936] The 4190 base pair NcoI,EcoRV restriction fragment from
pMON13356 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0937] Oligo #1 [SEQ ID NO:15]
[0938] Oligo #2 [SEQ ID NO:16]
[0939] Oligo #7 [SEQ ID NO:21]
[0940] Oligo #8 [SEQ ID NO:22]
[0941] Oligo #11 [SEQ ID NO:25]
[0942] Oligo #12 [SEQ ID NO:26]
[0943] The assembled oligonucleotides create NcoI and EcoRV
restriction ends and the DNA sequence that encodes amino acids
15-46 of (15-125) hIL-3 with the following amino acid
substitutions: 18I, 25H, 29V, 32A, 37S, 42S and 45M. The codons
encoding amino acids 15-46 of (15-125) hIL-3 are those found in the
hIL-3 cDNA sequence except at those positions where amino acid
substitutions were made. The ligation reaction was digested with
NdeI and used to transform E. coli K-12 strain JM101. Transformant
bacteria were selected on ampicillin-containing plates. Plasmid DNA
was isolated from a colony grown in LB broth and DNA sequenced to
determine that the sequence was that of the oligonucleotides. The
plasmid, pMON13346, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
25 Peptide #4 [SEQ ID NO:68] Asn Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0944] DNA sequence #12[SEQ ID NO:108] codes for the foregoing
pMON13346 polypeptide.
EXAMPLE 11
[0945] Construction of pMON13357
[0946] Plasmid pMON5988 DNA was digested with restriction enzymes
EcoRV and NsiI, and the resulting 4218 base pair EcoRV,NsiI
fragment contains the following genetic elements: beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-46 and 72-125 of (15-125) hIL-3. The 4218 base pair
EcoRV,NsiI restriction fragment from pMON5988 was ligated to the
following annealed complementary oligonucleotides:
[0947] Oligo #19 [SEQ ID NO:33]
[0948] Oligo #20 [SEQ ID NO:34]
[0949] The ligation reaction mixture was used to transform E. coli
K-12 strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated from a
colony grown in LB broth, and the size of the inserted fragment was
determined by restriction analysis employing restriction enzymes
NcoI and HindIII in double digest. In the resulting plasmid the 71
bases between the EcoRV and NsiI restriction sites in the (15-125)
hIL-3 gene are replaced with 22 bases from the above mentioned
oligonucleotides. This linker also contains a NdeI recognition
sequence.
EXAMPLE 12
[0950] Construction of pMON13347
[0951] The 4218 base pair EcoRV,NsiI restriction fragment from
pMON13357 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0952] Oligo #21 [SEQ ID NO:35]
[0953] Oligo #22 [SEQ ID NO:36]
[0954] Oligo #25 [SEQ ID NO:39]
[0955] Oligo #26 [SEQ ID NO:40]
[0956] Oligo #31 [SEQ ID NO:45]
[0957] Oligo #32 [SEQ ID NO:46]
[0958] The assembled oligonucleotides create EcoRV and NsiI
restriction ends and the DNA sequence that encodes amino acids
47-71 of (15-125) hIL-3 with the following amino acid
substitutions: 51R, 55L, 59L, 62V, 67N and 69E. The codons encoding
amino acids 47-71 of (15-125) hIL-3 are those found in the hIL-3
cDNA sequence except at those positions where amino acid
substitutions were made. The ligation reaction was digested with
NdeI and used to transform E. coli K-12 strain JM101. Transformant
bacteria were selected on ampicillin-containing plates. Plasmid DNA
was isolated from a colony grown in LB broth. The DNA was sequenced
to determine that the sequence was that of the oligonucleotides.
The plasmid, pMON13347, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
26 Peptide #5 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:69]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0959] DNA sequence #13 [SEQ ID NO:109] codes for the foregoing
pMON13347 polypeptide.
EXAMPLE 13
[0960] Construction of pMON13348
[0961] The 4218 base pair EcoRV,NsiI restriction fragment from
pMON13357 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0962] Oligo #21 [SEQ ID NO:35]
[0963] Oligo #22 [SEQ ID NO:36]
[0964] Oligo #27 [SEQ ID NO:41]
[0965] Oligo #28 [SEQ ID NO:42]
[0966] Oligo #31 [SEQ ID NO:45]
[0967] Oligo #32 [SEQ ID NO:46]
[0968] The assembled oligonucleotides create EcoRV and NsiI
restriction ends and the DNA sequence that encodes amino acids
47-71 of (15-125) hIL-3 with the following amino acid
substitutions: 51R, 55L, 60S, 62V, 67N and 69E. The codons encoding
amino acids 47-71 of (15-125) hIL-3 are those found in the hIL-3
cDNA sequence except at those positions where amino acid
substitutions were made. The ligation reaction was digested with
NdeI and used to transform E. coli K-12 strain JM101. Transformant
bacteria were selected on ampicillin-containing plates. Plasmid DNA
was isolated from a colony grown in LB broth. The DNA was sequenced
to determine that the sequence was that of the oligonucleotides.
The plasmid, pMON13348, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
27 Peptide #6 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:70]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0969] DNA sequence #14 [SEQ ID NO:110] encodes the foregoing
pMON13348 polypeptide.
EXAMPLE 14
[0970] Construction of pMON13349
[0971] The 4218 base pair EcoRV,NsiI restriction fragment from
pMON13357 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0972] Oligo #23 [SEQ ID NO:37]
[0973] Oligo #24 [SEQ ID NO:38]
[0974] Oligo #25 [SEQ ID NO:39]
[0975] Oligo #26 [SEQ ID NO:40]
[0976] Oligo #29 [SEQ ID NO:43]
[0977] Oligo #30 [SEQ ID NO:44]
[0978] The assembled oligonucleotides create EcoRV and NsiI
restriction ends and the DNA sequence that encodes amino acids
47-71 of (15-125) hIL-3 with the following amino acid
substitutions: 51R, 55T, 59L, 62V, 67H and 69E. The codons encoding
amino acids 47-71 of (15-125) hIL-3 are those found in the hIL-3
cDNA sequence except at those positions where amino acid
substitutions were made. The ligation reaction was digested with
NdeI and used to transform E. coli K-12 strain JM101. Transformant
bacteria were selected on ampicillin-containing plates. Plasmid DNA
was isolated from a colony grown in LB broth and the DNA was
sequenced to determine that the sequence was that of the
oligonucleotides. The plasmid, pMON13349, encodes the (15-125)
hIL-3 variant with the following amino acid sequence:
28 Peptide #7 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:71]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0979] DNA sequence #15 [SEQ ID NO:111] encodes the foregoing
pMON13349 polypeptide.
EXAMPLE 15
[0980] Construction of pMON13358
[0981] Plasmid pMON5988 DNA was digested with restriction enzymes
NsiI and EcoRI and the resulting 4178 base pair NsiT,EcoRI fragment
contains the following genetic elements: beta-lactamase gene (AMP),
pBR327 origin of replication, phage f1 origin of replication as the
transcription terminator, pAraBAD promoter, g10L ribosome binding
site, lamB secretion leader and the bases encoding amino acids
15-71 and 106-125 of (15-125) hIL-3. The 4178 base pair NsiT,EcoRI
restriction fragment from pMON5988 was ligated to the following
annealed complementary oligonucleotides.
[0982] Oligo #15 [SEQ ID NO:29]
[0983] Oligo #16 [SEQ ID NO:30]
[0984] The ligation reaction mixture was used to transform E. coli
K-12 strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated from a
colony grown in LB broth, and the size of the inserted fragment was
determined by restriction analysis employing restriction enzymes
NcoI and HindIII in double digest. In the resulting plasmid the 111
bases between the NsiI and EcoRI restriction sites in the (15-125)
hIL-3 gene are replaced with 24 bases from the above mentioned
oligonucleotides. This linker also contains a NdeI recognition
sequence.
EXAMPLE 16
[0985] Construction of pMON13350
[0986] The 4178 base pair NsiI,EcoRI restriction fragment from
pMON13358 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0987] Oligo #41 [SEQ ID NO:55]
[0988] Oligo #42 [SEQ ID NO:56]
[0989] Oligo #39 [SEQ ID NO:53]
[0990] Oligo #40 [SEQ ID NO:54]
[0991] Oligo #35 [SEQ ID NO:49]
[0992] Oligo #36 [SEQ ID NO:50]
[0993] Oligo #43 [SEQ ID NO:57]
[0994] Oligo #44 [SEQ ID NO:58]
[0995] The assembled oligonucleotides create NsiI and EcoRI
restriction ends and the DNA sequence that encodes amino acids
72-105 of (15-125) hIL-3 with the following amino acid
substitutions: 73G, 76A, 79R, 82Q, 87S, 93S, 98I, 101A and 105Q.
The codons encoding amino acids 72-105 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The ligation reaction was
digested with NdeI and used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated from a colony grown in LB broth.
The DNA was sequenced to determine that the sequence was that of
the oligonucleotides. The plasmid, pMON13350, encodes the (15-125)
hIL-3 variant with the following amino acid sequence:
29 Peptide #8 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:72]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[0996] DNA sequence #16 [SEQ ID NO:112] codes for the foregoing
pMON13350 polypeptide.
EXAMPLE 17
[0997] Construction of pMON13355
[0998] The 4178 base pair NsiI,EcoRI restriction fragment from
pMON13358 was ligated with the following pairs of annealed
complementary oligonucleotides:
[0999] Oligo #41 [SEQ ID NO:55]
[1000] Oligo #42 [SEQ ID NO:56]
[1001] Oligo #37 [SEQ ID NO:51]
[1002] Oligo #38 [SEQ ID NO:52]
[1003] Oligo #33 [SEQ ID NO:47]
[1004] Oligo #34 [SEQ ID NO:48]
[1005] Oligo #43 [SEQ ID NO:57]
[1006] Oligo #44 [SEQ ID NO:58]
[1007] The assembled oligonucleotides create NsiI and EcoRI
restriction ends and the DNA sequence that encodes amino acids
72-105 of (15-125) hIL-3 with the following amino acid
substitutions: 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A and 105Q.
The codons encoding amino acids 72-105 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The ligation reaction was
digested with NdeI and used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated from a colony grown in LB broth.
The DNA was sequenced to determine that the sequence was that of
the oligonucleotides. The plasmid, pMON13355, encodes the (15-125)
hIL-3 variant with the following amino acid sequence:
30 Peptide #9 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:73]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Per Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[1008] DNA sequence #17 [SEQ ID NO:113] codes for the foregoing
pMON13355 polypeptide.
EXAMPLE 18
[1009] Construction of pMON13359
[1010] Plasmid pMON5988 DNA was digested with restriction enzymes
EcoRI and HindIII, and the resulting 4225 base pair EcoRI,HindIII
fragment contains the following genetic elements: beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-105 of (15-125) hIL-3. The 4225 base pair
EcoRI,HindIII restriction fragment from pMON5988 was ligated to the
following annealed complementary oligonucleotides.
[1011] Oligo #17 [SEQ ID NO:31]
[1012] Oligo #18 [SEQ ID NO:32]
[1013] The ligation reaction was used to transform E. coli K-12
strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated from a
colony grown in LB broth, and the size of the inserted fragment was
determined by restriction analysis employing restriction enzymes
NcoI and HindIII in double digest. In the resulting plasmid the 64
bases between the EcoRI and HindIII restriction sites in the
(15-125) hIL-3 gene are replaced with 20 bases from the above
mentioned oligonucleotides. This linker also contains an NdeI
recognition sequence.
EXAMPLE 19
[1014] Construction of pMON13352
[1015] The 4225 base pair EcoRI,HindIII restriction fragment from
pMON13359 was ligated with the following pairs of annealed
complementary oligonucleotides:
[1016] Oligo #45 [SEQ ID NO:59]
[1017] Oligo #46 [SEQ ID NO:60]
[1018] Oligo #49 [SEQ ID NO:63]
[1019] Oligo #50 [SEQ ID NO:64]
[1020] The assembled oligonucleotides create EcoRI and HindIII
restriction ends and the DNA sequence that encodes amino acids
106-125 of (15-125) hIL-3 with the following amino acid
substitutions: 109E, 116V, 120Q and 123E. The codons encoding amino
acids 106-125 of (15-125) hIL-3 are those found in the hIL-3 cDNA
sequence except at those positions where amino acid substitutions
were made. The ligation reaction was digested with NdeI and used to
transform E. coli K-12 strain JM101. Transformant bacteria were
selected on ampicillin-containing plates. Plasmid DNA was isolated
from a colony grown in LB broth. The DNA was sequenced to determine
that the sequence was that of the oligonucleotides. The plasmid,
pMON13352, encodes the (15-125) hIL-3 variant with the following
amino acid sequence:
31 Peptide #10 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:74]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln
[1021] DNA sequence #18 [SEQ ID NO:114] codes for the foregoing
pMON13352 polypeptide.
EXAMPLE 20
[1022] Construction of pMON13354
[1023] The 4225 base pair EcoRI,HindIII restriction fragment from
pMON13359 was ligated with the following pairs of annealed
complementary oligonucleotides:
[1024] Oligo #45 [SEQ ID NO:59]
[1025] Oligo #46 [SEQ ID NO:60]
[1026] Oligo #47 [SEQ ID NO:61]
[1027] Oligo #48 [SEQ ID NO:62]
[1028] The assembled oligonucleotides create EcoRI and HindIII
restriction ends and the DNA sequence that encodes amino acids
106-125 of (15-125) hIL-3 with the following amino acid
substitutions: 109E, 116V, 117S, 120H and 123E. The codons encoding
amino acids 106-125 of (15-125) hIL-3 are those found in the hIL-3
cDNA sequence except at those positions where amino acid
substitutions were made. The ligation reaction was digested with
NdeI and used to transform E. coli K-12 strain JM101. Transformant
bacteria were selected on ampicillin-containing plates. Plasmid DNA
was isolated from a colony grown in LB broth, and the DNA was
sequenced to determine that the sequence was that of the
oligonucleotides. The plasmid, pMON13354, encodes the (15-125)
hIL-3 variant with the following amino acid sequence:
32 Peptide #11 Asn Cys Ser Asn Met Ile Asp Gln Ile [SEQ ID NO:75]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Gln Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln
[1029] DNA sequence #19 [SEQ ID NO:115] codes for the foregoing
pMON13354 polypeptide.
EXAMPLE 21
[1030] Construction of pMON13360
[1031] Plasmid pMON13352 DNA was digested with restriction enzymes
NsiI and EcoRI, resulting in a 4178 base pair NsiI,EcoRI fragment.
The genetic elements derived from pMON13352 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-71 and 106-125 of (15-125) hIL-3. Plasmid pMON13350
DNA was digested with NsiI and EcoRI. The resulting 111 base pair
NsiI, EcoRI fragment encodes amino acids 72-105 of (15-125) hIL-3.
The eluted restriction fragments were concentrated and desalted
using Centricon 30 concentrators. The restriction fragments were
ligated, and the ligation reaction mixture was used to transform E.
coli K-12 strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated and analyzed
by restriction analysis. Clones containing the correct insert lost
a XmnI site as compared with pMON13352. Positive clones were
identified by the loss of a 615 base pair XmnI fragment. The DNA
was sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 73G, 76A,
79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 72-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13360, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
33 Peptide #12 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:76]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln
[1032] DNA sequence #23 [SEQ ID NO:119] encodes the foregoing
pMON13360 polypeptide.
EXAMPLE 22
[1033] Construction of pMON13361
[1034] Plasmid pMON13352 DNA was digested with restriction enzymes
NsiI and EcoRI, resulting in a 4178 base pair NsiI,EcoRI fragment.
The genetic elements derived from pMON13352 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-71 and 106-125 of (15-125) hIL-3. Plasmid pMON13355
DNA was digested with NsiI and EcoRI. The resulting 111 base pair
NsiI, EcoRI fragment encodes amino acids 72-105 of (15-125) hIL-3.
The restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Clones containing the correct insert contained an
additional RsaI site which results in a 1200 base pairs RsaI
fragment. The DNA was sequenced to confirm the correct insert. The
resulting (15-125) hIL-3 variant has the following amino acid
substitutions: 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,
116V, 120Q and 123E. The codons encoding amino acids 72-125 of
(15-125) hIL-3 are those found in the hIL-3 cDNA sequence except at
those positions where amino acid substitutions were made. The
plasmid, pMON13361, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
34 Peptide #13 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:77]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln
[1035] DNA sequence #24 [SEQ ID NO:120] codes for the foregoing
pMON13361 polypeptide.
EXAMPLE 23
[1036] Construction of pMON13362
[1037] Plasmid pMON13354 DNA was digested with restriction enzymes
NsiI and EcoRI, resulting in a 4178 base pair NsiI,EcoRI fragment.
The genetic elements derived from pMON13354 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-71 and 106-125 of (15-125) hIL-3. Plasmid pMON13355
DNA was digested with NsiI and EcoRI. The resulting 111 base pair
NsiI, EcoRI fragment encodes amino acids 72-105 of (15-125) hIL-3.
The restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Clones containing the correct insert contained an
additional RsaI site which results in a 1200 base pairs RsaI
fragment. The DNA was sequenced to confirm the correct insert. The
resulting (15-125) hIL-3 variant has the following amino acid
substitutions: 73G, 76A, 79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E,
116V, 117S, 120H and 123E. The codons encoding amino acids 72-125
of (15-125) hIL-3 are those found in the hIL-3 cDNA sequence except
at those positions where amino acid substitutions were made. The
plasmid, pMON13362, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
35 Peptide #14 Asn Cys Ser Asn Met Ile Asp Glu Ile [SEQ ID NO:78]
Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln
[1038] DNA sequence #25 [SEQ ID NO:121] codes for the foregoing
pMON13362 polypeptide.
EXAMPLE 24
[1039] Construction of pMON13363
[1040] Plasmid pMON13344 DNA was digested with restriction enzymes
NsiI and EcoRV, resulting in a 4218 base pair NsiI,EcoRV fragment.
The genetic elements derived from pMON13344 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-46 and 72-125 of (15-125) hIL-3. Plasmid pMON13348
DNA was digested with NsiI and EcoRV. The resulting 71 base pair
NsiI, EcoRV fragment encodes amino acids 47-71 of (15-125) hIL-3
The restriction fragments were ligated with T4 ligase, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Clones containing the correct insert contained an
additional DdeI site which results in DdeI restriction fragments of
806 and 167 base pairs compared to 973 base pairs in pMON13344. The
DNA was sequenced to confirm the correct insert. The resulting
(15-125) hIL-3 variant has the following amino acid substitutions:
18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N and 69E.
The codons encoding amino acids 15-71 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13363, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
36 Peptide #15 Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:79] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Len Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[1041] DNA sequence #20 [SEQ ID NO:116] codes for the foregoing
pMON13363 polypeptide.
EXAMPLE 25
[1042] Construction of pMON13364
[1043] Plasmid pMON13345 DNA was digested with restriction enzymes
NsiI and EcoRV, resulting in a 4218 base pair NsiI,EcoRV fragment.
The genetic elements derived from pMON13345 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamb secretion leader and the bases encoding
amino acids 15-46 and 72-125 of (15-125) hIL-3. Plasmid pMON13349
DNA was digested with NsiI and EcoRV. The resulting 71 base pair
NsiI, EcoRV fragment encodes amino acids 47-71 of (15-125) hIL-3.
The restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Clones containing the correct insert contained an
additional DdeT site which results in DdeI restriction fragments of
806 and 167 base pairs compared to 973 base pairs in pMON13344. The
DNA was sequenced to confirm the correct insert. The resulting
(15-125) hIL-3 variant has the following amino acid substitutions:
18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H and 69E.
The codons encoding amino acids 15-71 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13364, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
37 Peptide #16 Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:80] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[1044] DNA sequence #21 [SEQ ID NO:117] codes for the foregoing
pMON13364 polypeptide.
EXAMPLE 26
[1045] Construction of pMON13365
[1046] Plasmid pMON13346 DNA was digested with restriction enzymes
NsiI and EcoRV, resulting in a 4218 base pair NsiI,EcoRV fragment.
The genetic elements derived from pMON13346 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and the bases encoding
amino acids 15-46 and 72-125 of (15-125) hIL-3. Plasmid pMON13347
DNA was digested with NsiI and EcoRV. The resulting 71 base pair
NsiI, EcoRV fragment encodes amino acids 47-71 of (15-125) hIL-3.
The restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Clones containing the correct insert contained an
additional DdeI site which results in DdeI restriction fragments of
806 and 167 base pairs compared to 973 base pairs in pMON13344. The
DNA was sequenced to confirm the correct insert. The resulting
(15-125) hIL-3 variant has the following amino acid substitutions:
18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N and 69E.
The codons encoding amino acids 15-71 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13365, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
38 Peptide #17 Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:81] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln
[1047] DNA sequence #22 [SEQ ID NO:118] codes for the foreging
pMON13365 polypeptide.
EXAMPLE 27
[1048] Construction of pMON13298
[1049] Plasmid pMON5978 DNA was digested with restriction enzymes
NsiI and HindIII, resulting in a 3789 base pair NsiI,HindIII
fragment. The genetic elements derived from pMON5978 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter, g10L ribosome binding site, and the bases encoding amino
acids 15-71 of (15-125) hIL-3. Plasmid pMON13360 DNA was digested
with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII
fragment encodes amino acids 72-125 of (15-125) hIL-3. The
restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 73G, 76A,
79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 72-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13298, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
39 Peptide #18 Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr
His Leu [SEQ ID NO:82] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn
Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1050] DNA sequence #29 [SEQ ID NO:125] codes for the foregoing
pMON13298 polypeptide.
EXAMPLE 28
[1051] Construction of pMON13299
[1052] Plasmid pMON5978 DNA was digested with restriction enzymes
NsiI and HindIII, resulting in a 3789 base pair NsiI,HindIII
fragment. The genetic elements derived from pMON5978 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter, g10L ribosome binding site and the bases encoding amino
acids 15-71 of (15-125) hIL-3. Plasmid pMON13361 DNA was digested
with NsiI and HindIII, the resulting 175 base pair NsiI, HindIII
fragment encodes amino acids 72-125 of (15-125) hIL-3. The
restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 72-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13299, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
40 Peptide #19 Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr
His Leu [SEQ ID NO:83] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn
Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1053] DNA sequence #30 [SEQ ID NO:126] codes for the foregoing
pMON13299 polypeptide.
EXAMPLE 29
[1054] Construction of pMON13300
[1055] Plasmid pMON5978 DNA was digested with restriction enzymes
NsiI and HindIII, resulting in a 3789 base pair NsiI,HindIII
fragment. The genetic elements derived from pMON5978 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter, g10L ribosome binding site, and the bases encoding amino
acids 15-71 of (15-125) hIL-3. Plasmid pMON13362 DNA was digested
with NsiI and HindIII. The resulting 175 base pair NsiI, HindIII
fragment encodes amino acids 72-125 of (15-125) hIL-3. The
restriction fragments were ligated, and the ligation reaction
mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 73G, 76A,
79R, 82V, 87S, 93S, 98T, 10A, 105Q, 109E, 116V, 117S, 120H and
123E. The codons encoding amino acids 72-125 of (15-125) hIL-3 are
those found in the hIL-3 cDNA sequence except at those positions
where amino acid substitutions were made. The plasmid, pMON13300,
encodes the (15-125) hIL-3 variant with the following amino acid
sequence:
41 Peptide #20 Met Ala Asn Cys Ser Asn Met Ile Asp Gln Ile Ile Thr
His Leu [SEQ ID NO:84] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn
Asn Leu Asn Gly Gln Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu
Gln Gln
[1056] DNA sequence #31 [SEQ ID NO:127] codes for the foregoing
pMON13300 polypeptide.
EXAMPLE 30
[1057] Construction of pMON13301
[1058] Plasmid pMON5978 DNA was digested with restriction enzymes
NcoI and NsiI, resulting in a 3794 base pair NcoI,NsiI fragment.
The genetic elements derived from pMON5978 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, precA promoter, g10L
ribosome binding site and the bases encoding amino acids 72-125 of
(15-125) hIL-3. Plasmid pMON13363 DNA was digested with NcoI and
NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino
acids 15-71 of (15-125) hIL-3. The restriction fragments were
ligated, and the ligation reaction mixture was used to transform E.
coli K-12 strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated, analyzed by
restriction analysis, and sequenced to confirm the correct insert.
The resulting (15-125) hIL-3 variant has the following amino acid
substitutions: 18I, 25H, 29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S,
62V, 67N and 69E. The codons encoding amino acids 15-71 of (15-125)
hIL-3 are those found in the hIL-3 cDNA sequence except at those
positions where amino acid substitutions were made. The plasmid,
pMON13301, encodes the (15-125) hIL-3 variant with the following
amino acid sequence:
42 Peptide #21 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:85] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala
Gln Gln
[1059] DNA sequence #26 [SEQ ID NO:122] codes for the foregoing
pMON13301 polypeptide.
EXAMPLE 31
[1060] Construction of pMON13302
[1061] Plasmid pMON5978 DNA was digested with restriction enzymes
NcoI and NsiI, resulting in a 3794 base pair NcoI,NsiI fragment.
The genetic elements derived from pMON5978 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, precA promoter, g10L
ribosome binding site, and the bases encoding amino acids 72-125 of
(15-125) hIL-3. Plasmid pMON13364 DNA was digested with NcoI and
NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino
acids 15-71 of (15-125) hIL-3. The restriction fragments were
ligated, and the ligation reaction mixture was used to transform E.
coli K-12 strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated, analyzed by
restriction analysis, and sequenced to confirm the correct insert.
The resulting (15-125) hIL-3 variant has the following amino acid
substitutions: 18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L,
62V, 67H and 69E. The codons encoding amino acids 15-71 of (15-125)
hIL-3 are those found in the hIL-3 cDNA sequence except at those
positions where amino acid substitutions were made. The plasmid,
pMON13302, encodes the (15-125) hIL-3 variant with the following
amino acid sequence:
43 Peptide #22 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:86] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser
Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala
Gln Gln
[1062] DNA sequence #27 [SEQ ID NO:123] codes for the foregoing
pMON13302 polypeptide.
EXAMPLE 32
[1063] Construction of pMON13303
[1064] Plasmid pMON5978 DNA was digested with restriction enzymes
NcoI and NsiI, resulting in a 3794 base pair NcoI,NsiI fragment.
The genetic elements derived from pMON5978 are the beta-lactamase
gene (AMP), pBR327 origin of replication, phage f1 origin of
replication as the transcription terminator, precA promoter, g10L
ribosome binding site, and the bases encoding amino acids 72-125 of
(15-125) hIL-3. Plasmid pMON13365 DNA was digested with NcoI and
NsiI. The resulting 170 base pair NcoI, NsiI fragment encodes amino
acids 15-71 of (15-125) hIL-3. The restriction fragments were
ligated, and the ligation reaction mixture was used to transform E.
coli K-12 strain JM101. Transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated, analyzed by
restriction analysis, and sequenced to confirm the correct insert.
The resulting (15-125) hIL-3 variant has the following amino acid
substitutions: 18I, 25H, 29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L,
62V, 67N and 69E. The codons encoding amino acids 15-71 of (15-125)
hIL-3 are those found in the hIL-3 cDNA sequence except at those
positions where amino acid substitutions were made. The plasmid,
pMON13303, encodes the (15-125) hIL-3 variant with the following
amino acid sequence:
44 Peptide #23 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:87] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala
Gln Gln
[1065] DNA sequence #28 [SEQ ID NO:124] codes for the foregoing
pMON13303 polypeptide.
EXAMPLE 33
[1066] Construction of pMON13287
[1067] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13363 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13360 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A,
79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 15-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13287, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
45 Peptide #24 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:88] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1068] DNA sequence #1 [SEQ ID NO:97] codes for the foregoing
pMON13287 polypeptide.
EXAMPLE 34
[1069] Construction of pMON13288
[1070] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13364 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoiI,
NsiI fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13360 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A,
79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 15-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13288, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
46 Peptide #25 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:89] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Gln Gln Ala Gln Glu
Gln Gln
[1071] DNA sequence #4 [SEQ ID NO:100] codes for the foregoing
pMON13288 polypeptide.
EXAMPLE 35
[1072] Construction of pMON13289
[1073] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13365 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13360 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A,
79R, 82Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 15-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13289, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
47 Peptide #26 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:90] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1074] DNA sequence #7 [SEQ ID NO:103] codes for the foregoing
pMON13289 polypeptide.
EXAMPLE 36
[1075] Construction of pMON13290
[1076] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13363 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13361 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 15-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13290, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
48 Peptide #27 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:91] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1077] DNA sequence #2 [SEQ ID NO:98] codes for the foregoing
pMON13290 polypeptide.
EXAMPLE 37
[1078] Construction of pMON13292
[1079] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13365 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13361 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 15-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13292, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
49 Peptide #28 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:92] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1080] DNA sequence #8 [SEQ ID NO:104] codes for the foregoing
pMON13292 polypeptide.
EXAMPLE 38
[1081] Construction of pMON13294
[1082] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13364 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13362 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and
123E. The codons encoding amino acids 15-125 of (15-125) hIL-3 are
those found in the hIL-3 cDNA sequence except at those positions
where amino acid substitutions were made. The plasmid, pMON13294,
encodes the (15-125) hIL-3 variant with the following amino acid
sequence:
50 Peptide #29 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:93] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu
Gln Gln
[1083] DNA sequence #6 [SEQ ID NO:102] codes for the foregoing
pMON13294 polypeptide.
EXAMPLE 39
[1084] Construction of pMON13295
[1085] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13365 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13362 DNA was digested with NsiT and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29V, 32A, 37S, 42S, 45M, 51R, 55L, 59L, 62V, 67N, 69E, 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and
123E. The codons encoding amino acids 15-125 of (15-125) hIL-3 are
those found in the hIL-3 cDNA sequence except at those positions
where amino acid substitutions were made. The plasmid, pMON13295,
encodes the (15-125) hIL-3 variant with the following amino acid
sequence:
51 Peptide #30 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:94] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu
Gln Gln
[1086] DNA sequence #9 [SEQ ID NO:105] codes for the foregoing
pMON13295 polypeptide.
EXAMPLE 40
[1087] Construction of pMON13312
[1088] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13364 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiI
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13361 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H, 69E, 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 120Q and 123E. The
codons encoding amino acids 15-125 of (15-125) hIL-3 are those
found in the hIL-3 cDNA sequence except at those positions where
amino acid substitutions were made. The plasmid, pMON13312, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
52 Peptide #31 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:95] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln
[1089] DNA sequence #5 [SEQ ID NO:101] codes for the foregoing
pMON13312 polypeptide.
EXAMPLE 41
[1090] Construction of pMON13313
[1091] Plasmid pMON2341 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3619 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, precA
promoter and g10L ribosome binding site. Plasmid pMON13363 DNA was
digested with NcoI and NsiI. The resulting 170 base pair NcoI, NsiT
fragment encodes amino acids 15-71 of (15-125) hIL-3. Plasmid
pMON13362 DNA was digested with NsiI and HindIII. The resulting 175
base pair NsiI, HindIII fragment encodes amino acids 72-125 of
(15-125) hIL-3. The restriction fragments were ligated, and the
ligation reaction mixture was used to transform E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis,
and sequenced to confirm the correct insert. The resulting (15-125)
hIL-3 variant has the following amino acid substitutions: 18I, 25H,
29R, 32A, 37P, 42A, 45V, 51R, 55L, 60S, 62V, 67N, 69E, 73G, 76A,
79R, 82V, 87S, 93S, 98T, 101A, 105Q, 109E, 116V, 117S, 120H and
123E. The codons encoding amino acids 15-125 of (15-125) hIL-3 are
those found in the hIL-3 cDNA sequence except at those positions
where amino acid substitutions were made. The plasmid, pMON13313,
encodes the (15-125) hIL-3 variant with the following amino acid
sequence:
53 Peptide #32 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:96] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu
Gln Gln
[1092] DNA sequence #3 [SEQ ID NO:99] codes for the foregoing
pMON13313 polypeptide.
EXAMPLE 42
[1093] Construction of pMON5987
[1094] Plasmid pMON6458 DNA was digested with restriction enzymes
NcoI and HindIII, resulting in a 3940 base pair NcoI,HindIII
fragment. The genetic elements derived from pMON6458 are the
beta-lactamase gene (AMP), pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, pAraBAD
promoter, g10L ribosome binding site and lamB secretion leader.
Plasmid pMON5978 DNA was digested with NcoI and NsiI. The resulting
170 base pair NcoI, NsiI fragment encodes amino acids 15-71 of
(15-125) hIL-3. Plasmid pMON5976 DNA was digested with NsiI and
HindIII. The resulting 175 base pair NsiI,HindIII fragment encodes
amino acids 72-125 of (15-125) hIL-3. The restriction fragments
were ligated, and the ligation reaction mixture was used to
transform E. coli K-12 strain JM101. Transformant bacteria were
selected on ampicillin-containing plates. Plasmid DNA was isolated
and screened for the restriction sites EcoRV and NheT and DNA
sequenced to confirm the correct insert.
EXAMPLE 43
[1095] Construction of pMON5988
[1096] The plasmid DNA of pMON5987 was digested with NheI and
EcoRI, resulting in a 3903 base pair NheI, EcoRI fragment. The 3903
base pair NheI, EcoRI fragment was ligated to 1.0 picomoles of the
following annealed oligonucleotides:
54 5'-CTAGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAGGACGGTGACTGGAATG-3'
[SEQ ID NO:131] 3'-GGTGCCGGCGTGGGTGCGCTGTAGGTTAGGTATAGTT-
CCTGCCACTGACCTTACAATT-5' [SEQ ID NO:132]
[1097] The ligation reaction mixture was used to transform E. coli
K-12 strain JM101 and transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated and
sequenced to confirm positive clones. This plasmid was constructed
to change alanine 101 to aspartic acid in the hIL-3 gene (15-125).
This plasmid was designated pMON5988.
EXAMPLE 44
[1098] Construction of pMON5853 (FIG. 6) which encodes
[Met-(15-133) hIL-3(Arg.sup.129)]
[1099] Plasmid DNA of pMON5847 (Example 2) was treated with NcoI.
The restriction enzyme was inactivated by heat treatment
(65.degree. C. for 10 minutes). The DNA was then treated with large
fragment of DNA polymerase I (Klenow) in the presence of all four
nucleotide precursors. This produces DNA termini with
non-overlapping ends. After 5 minutes at 37.degree. C., the
polymerase was inactivated by heat treatment at 65.degree. C. for
10 minutes. The DNA was then treated with HpaI, an enzyme which
produces non-overlapping termini. The DNA was ethanol precipitated
and ligated. The ligation reaction mixture was used to transform
competent JM101 cells to ampicillin resistance. Colonies were
picked and plasmid DNA was analyzed by restriction analysis. A
plasmid designated pMON5853 was identified as one containing a
deletion of the amino terminal 14 codons of the hIL-3 gene. The DNA
sequence for the junction of the ribosome binding site to the
(15-133) hIL-3 gene was determined to be the following:
55 [SEQ ID NO:133] [SEQ ID NO:134]
5'-AAGGAGATATATCCATGAACTGCTCTAAC-3' M N C S N
[1100] The lower line contains the one letter code for the amino
acids specified by the coding sequence of the amino terminus of the
15-133 hIL-3 gene. These are methionine, asparagine, cysteine,
serine and asparagine.
[1101] When cultures of JM101 cells harboring this plasmid were
induced with nalidixic acid, it was found that hIL-3 (15-133)
accumulated at levels higher than hIL-3 (pMON5847).
[1102] The plasmid, pMON5853, encodes Met-(15-133) hIL-3
(Arg.sup.129) which has the following amino acid sequence:
56 Met Asn Cys Ser Asn Met Ile Asp [SEQ ID NO:135] Glu Ile Ile Thr
His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr
Leu Arg Leu Ala Ile Phe
EXAMPLE 45
[1103] Construction of pMON5873 which encodes [Met-(1-133)
hIL-3]
[1104] The gene obtained from British Biotechnology, Ltd. specified
arginine at codon position 129. The amino acid specified in the
native hIL-3 cDNA is serine. To produce a protein with the native
sequence at this position, the portion of the coding sequence
between the EcoRI site at codons 106 and 107 and the NheI site at
codons 129 and 130 was replaced. Plasmid DNA of pMON5854 (Example
3) and pMON5853 (Example 44) were treated with EcoRI and NheI. The
larger fragments of each were gel purified. These were ligated to a
pair of an annealed oligonucleotides with the following
sequences:
57 5'-AATTCCGTCGTAAACTGACCTTCTATCTGAA [SEQ ID NO:136] AACC-
3'-GGCAGCATTTGACTGGAAGATACACTTTTG [SEQ ID NO:137] G-
TTGGAGAACGCGCAGGCTCAACAGACCACTCTGTCG- 3'
AACCTCTTGCGCGTCCGAGTTGTCTGGTGAGACAGCG ATC-5'
[1105] The ligation reaction mixtures were used to transform
competent JM101 cells to ampicillin resistance. Colonies were
picked into broth and grown. Plasmid DNA was isolated and screened
for the presence of a new StyI recognition site present in the
synthetic DNA and not in pMON5854 and pMON5853. The nucleotide
sequence of the gene in the region between EcoRI and NheI was
determined and found to be that of the synthetic oligonucleotides.
The new plasmids were designated pMON5873 encoding [Met-(1-133)
hIL-3] and pMON5872 encoding [Met-(15-133) hIL-3].
[1106] The plasmid, pMON5873, encodes Met-(1-133) hIL-3 which has
the following amino acid sequence:
58 Met Ala Pro Met Thr Gln Thr Thr [SEQ ID NO:128] Ser Leu Lys Thr
Ser Trp Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln
Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr Leu Ser Leu
Ala Ile Phe
EXAMPLE 46
[1107] Construction of pMON6458
[1108] Plasmid pMON6525 was digested with restriction enzymes
HindIII and SalIT and the resulting 3172 base pair fragment was
isolated from a 1% agarose gel by interception onto DEAE membrane.
The genetic elements derived from pMON6525 are the beta-lactamase
gene (AMP), pBR327 origin of replication, and phage f1 origin of
replication as the transcription terminator. (The genetic elements
derived from plasmid pMON6525 are identical to those in plasmid
pMON2341 which could also be used to construct pMON6458.) Plasmid
pMON6457 was digested with restriction enzymes HindIII and SalI and
the resulting 1117 base pair fragment was isolated by PAGE and
crush and soak elution. The genetic elements derived from pMON6457
are the pAraBAD promoter, g10L ribosome binding site, lamB
secretion leader and the (15-125) hIL-3 gene. The restriction
fragments were ligated and the ligation reaction mixture was used
to transform E. coli K-12 strain JM101. Transformant bacteria were
selected on ampicillin-containing plates. Plasmid DNA was isolated
and the size of the inserted fragment was determined by restriction
analysis employing restriction enzymes NcoI and HindIII in double
digest. Clones containing the hIL-3 gene (encoding amino acids
15-125) contained a 345 base pair NcoI, HindIII restriction
fragment. This construct was designated pMON6458. This plasmid was
constructed to eliminate an EcoRI restriction site outside the
hIL-3 gene coding region in plasmid pMON6457.
EXAMPLE 47
[1109] Construction of pMON5976 which encodes [Met-(15-125)
hIL-3(Ala.sup.101)]
[1110] The plasmid DNA of pMON5941 isolated from the dam-E. coli
strain GM48 was cleaved with ClaI and NsiI and ligated to 1
picomole of an annealed assembly of six oligonucleotides encoding
amino acids 20-70 of hIL-3 (FIG. 2). This synthetic fragment
encodes three unique restriction sites, EcoRV, XhoI and PstI. The
sequence of these oligonucleotides is shown in FIG. 2.
[1111] The resulting ligation mix was used to transform competent
E. coli JM101 cells to ampicillin resistant colonies. Plasmid DNA
was isolated and the inserted fragment was determined to have both
an EcoRV and NheI site. The nucleotide sequence of the region
between ClaI and NsiI was determined and found to be that of the
synthetic oligonucleotides. At codons 86-87 of a nucleotide
sequence coding for (15-125) hIL-3, an NheI site was introduced.
The plasmid with this alteration was designated pMON5941. This
plasmid encodes Met-(15-125) hIL-3 which is altered at position 101
by replacement of aspartate by alanine.
[1112] Plasmid pMON5976 encodes Met-(15-125) hIL-3(Ala.sup.101)
which has the following amino acid sequence:
59 Met Asn Cys Ser Asn Met Ile Asp [SEQ ID NO:138] Glu Ile Ile Thr
His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Ala Gly Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln
EXAMPLE 48
[1113] Construction of pMON5917 which encodes [Met-(15-88)
hIL-3]
[1114] The plasmid DNA of pMON5853 was cleaved with NsiI and
HindIII and ligated to an annealed pair of oligonucleotides
encoding (70-88) hIL-3 with a new NheI endonuclease restriction
site at codons 86-87. The sequence of these oligonucleotides is
shown in Example 18.
[1115] The ligation mixture was used to transform competent E. coli
JM101 cells, and ampicillin resistant colonies were picked. Plasmid
DNA isolated from individual colonies was screened for the presence
of the new NheI restriction site. The nucleotide sequence of the
substituted portion was determined and found to be that of the
synthetic oligonucleotides. The new plasmid was designated pMON5917
encoding Met-(15-88) hIL-3 containing a new NheI site at codons
86-87.
[1116] Plasmid pMON5917 encodes Met-(15-88) hIL-3 which has the
following amino acid sequence:
60 Met Asn Cys Ser Asn Met Ile Asp [SEQ ID NO:139] Glu Ile Ile Thr
His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala
EXAMPLE 49
[1117] Construction of pmon5941 which encodes [Met-(15-125) hIL-3
Ala.sup.101]
[1118] The plasmid DNA of pMON5917 was cleaved with NheI and
HindIII and ligated to two annealed pairs of oligonucleotides which
encode amino acids 86-106 and 107-125 of hIL-3. The sequences of
these oligonucleotides is shown below. NheI to EcoRI
61 5'-CTAGCCACGGCCGCACCCACGCGACATCCAA [SEQ ID NO:140]
TCCATATCAAGGCTG- 3'-GGTGCCGGCGTGGGTGCGCTGTAGGTTAGGT [SEQ ID NO:141]
ATAGTTCCGAC- GTGACTGGAATG-3' CACTGACCTTACTTAA-5' EcoRI to HindIII
5'-AATTCCGTCGTAAACTGACCTTCTATCTGAA [SEQ ID NO:142]
AACCTTGGAGAACGCGCA- 3'-CGCAGCATTTGACTGGAACATAGACTTTTGG [SEQ ID
NO:143] AACCTCTTGCGCGT- GGCTCAACACTAATA-3'
CCGAGTTGTCATTATTCGA-5'
[1119] The ligation mixture was used to transform competent E. coli
JM101 cells to ampicillin resistant colonies. Plasmid DNA was
isolated from these cells and the size of the inserted fragment was
determined to be larger by restriction analysis with NcoI and
HindIII. The Asp to Ala 101 change is encoded on the NheI to EcoRI
fragment. The nucleotide sequence of the portion of the coding
region between the NheI and HindIII sites was determined and found
to be that of the synthetic oligonucleotides. The new plasmid was
designated pMON5941.
[1120] The plasmid, pMON5941, encodes Met-(15-125)
hIL-3(Ala.sup.101) and contains a new NheI restriction site.
EXAMPLE 50
[1121] Construction of pMON6455
[1122] Plasmid pMON5905 was digested with restriction enzymes
HindIII and NcoI resulting in a 3936 base pair fragment. The
genetic elements derived from pMON5905 are the beta-lactamase gene
(AMP), pBR327 origin of replication, pAraBAD promoter, g10L
ribosome binding site, lamB secretion leader and phage f1 origin of
replication as the transcription terminator. The following genetic
elements; beta-lactamase gene (AMP), pBR327 origin of replication,
g10L ribosome binding site and phage f1 origin of replication as
the transcription terminator, derived from plasmid pMON5905 are
identical to these in plasmid pMON5594 which could also be used to
construct pMON6455. The AraBAD promoter is identical to that
described in pMON6235. The lamB signal peptide sequence used in
pMON6455 is that shown in FIG. 8 fused to hIL-3 (15-125) at the
NcoI site. Plasmid pMON5887 was digested with restriction enzymes
HindIII and NcoI, resulting in a 384 base pair NcoI, HindIII
fragment. The restriction fragments were ligated, and the ligation
reaction mixture was used to transform into E. coli K-12 strain
JM101. Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated and the size of the inserted
fragment was determined by restriction analysis employing
restriction enzymes NcoI and HindIII in double digest. Positive
clones containing the hIL-3 gene (encoding amino acids 1-125)
contained a 384 base pair NcoI, HindIII restriction fragment. This
construct was designated pMON6455.
EXAMPLE 51
[1123] Construction of pMON6456
[1124] Plasmid pMON5905 was digested with restriction enzymes
HindIII and NcoI resulting in a 3936 base pair fragment. The
genetic elements derived from pMON5905 are the beta-lactamase gene
(AMP), pBR327 origin of replication, phage f1 origin of replication
as the transcription terminator, pAraBAD promoter, g10L ribosome
binding site and the lamB secretion leader. Plasmid pMON5871 was
digested with restriction enzymes HindIII and NcoI, resulting in a
330 base pair NcoI, HindIII fragment. The genetic element derived
from pMON5871 encompassed the bases encoding the (1-107) hIL-3
gene. The restriction fragments were ligated, and the ligation
reaction mixture was used to transform E. coli K-12 strain JM101.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated and the size of the inserted
fragment was determined by restriction analysis employing
restriction enzymes NcoI and HindIII in double digest. Clones
containing the hIL-3 gene (encoding amino acids 1-107) contained a
330 base pair NcoI, HindIII restriction fragment. This construct
was designated pMON6456.
EXAMPLE 52
[1125] Construction of pMON6457
[1126] Plasmid pMON6455 DNA grown in E. coli strain GM48 (dam-) was
digested with restriction enzymes NcoI and ClaI, resulting in a
4263 base pair NcoI, ClaI fragment. The restriction fragment was
ligated to 1.0 picomoles of annealed oligonucleotides with the
following sequence coding for Met Ala 14-20 hIL-3:
62 5'-CATGGCTAACTGCTCTAACATGAT-3' [SEQ ID NO:151]
3'-CGATTGACGAGATTGTACTAGC-5'[SEQ ID NO:152]
[1127] The resulting DNA was transformed into E. coli K-12 strain
JM101 and transformant bacteria were selected on
ampicillin-containing plates. Plasmid DNA was isolated and the size
of the inserted fragment was determined by restriction analysis
employing restriction enzymes XbaI and EcoRI in double digest.
Positive clones containing the hIL-3 gene (encoding aa 15-125 of
hIL-3) contained a 433 base pair XbaI, EcoRI restriction fragment.
This construct was designated pMON6457. This plasmid was
constructed to delete the first 14 amino acids of hIL-3. The coding
sequence of the resulting gene begins as follows:
63 5' ATG GCT AAC TGC . . . 3' [SEQ ID NO:153] Met Ala Asn Cys . .
. [SEQ ID NO:154] 15
[1128] The first two amino acids (Methionine, Alanine) create an
NcoI restriction site and a signal peptidase cleavage site between
the lamB signal peptide and (15-125) hIL-3. Plasmid pMON6457
encodes (15-125) hIL-3 which has the amino acid sequence designated
SEQ ID NO:65.
EXAMPLE 53
[1129] Construction of pMON6235
[1130] One of the DNA fragments used to create this plasmid was
generated by site-directed mutagenesis employing PCR techniques
described previously using the following oligonucleotides, Oligo
#51 [SEQ ID NO:155] and Oligo #52 [SEQ ID NO:156], were used as
primers in this procedure. The template for the PCR reaction was E.
coli strain W3110 chromosomal DNA, prepared as described in
Maniatis (1982). The oligonucleotide primers were designed to
amplify the AraBAD promoter (Greenfield et al., 1978). The
resulting DNA product was digested with the restriction enzymes
SacII and BglII. The reaction mixture was purified as described
previously. Plasmid, pMON5594, DNA was digested with SacII and
BglII, resulting in a 4416 base pair SacII,BglII restriction
fragment which contains the following genetic elements;
beta-lactamase gene (AMP), pBR327 origin of replication, G10L
ribosome binding site, phage f1 origin of replication as the
transcription terminator and the chloramphenicol acetyl transferase
(cat) gene. The 4416 base pair SacII,BglII restriction fragment
from pMON5594 was ligated to the PCR-generated SacII, BglII DNA
fragment. The ligation mixture was used to transform E. coli K-112
strain JM101. Positive clones contained a 323 base pair SacII,BglII
fragment and were DNA sequenced to confirm that the SacII,BglII
fragment was the AraBAD promoter. This construct was designated
pMON6235.
EXAMPLE 54
[1131] Construction of pMON5647
[1132] Plasmid pMON5585 [prepared as disclosed in EP 0241446
incorporated herein by reference in its entirety] DNA was digested
with restriction enzymes NcoI and HindIII resulting in a 3273 base
pair NcoI,HindIII fragment. The genetic elements derived from
pMON5585 are the pBR327 origin of replication, precA promoter, g10L
ribosome binding protein, bovine somatotropin gene (bST),
beta-lactamase gene (AMP) and T7 transcription terminator. Plasmid
pMON3267 [prepared as disclosed in EP 0241446 incorporated herein
by reference in its entirety] DNA was digested with NcoI and
HindIII enzymes resulting in a 580 base pair NcoI,HindIII fragment
which contains the porcine somatotropin (pST) gene. The restriction
fragments were ligated and the ligation reaction mixture was used
to transform E. coli strain JM101. Transformant bacteria were
selected on ampicillin-containing plates. Plasmid DNA was isolated,
analyzed by restriction analysis and sequenced to confirm the
correct insert.
EXAMPLE 55
[1133] Construction of pMON710
[1134] Plasmid pMON709 consists of a 1614 base pair AvaI,EcoRI
fragment of transposon TN7, containing the streptomycin
adenylyltransferase gene (Fling et al., 1985) and a pUC9 linker
(XmaI,HindIII) cloned between the HindIII and EcoRI sites of pUC19.
The streptomycin adenylyltransferase gene COnfers resistance to
streptomycin and spectinomycin. Plasmid pMON709 was mutagenized by
oligonucleotide site-directed mutagenesis (methods described in
Zoller and Smith, 1982) to introduce an EcoRV site at the 3' end of
the streptomycin adenylyltransferase gene. The oligonucleotide,
Oligo # 53 [SEQ ID NO:157], was used in this procedure to introduce
the EcoRV site. The resulting plasmid was designated pMON710.
EXAMPLE 56
[1135] Construction of pMON5723
[1136] Plasmid pMON5647 DNA was digested with restriction enzymes
DraI and SspI resulting in a 2916 base pair DraI, SspI fragment.
The genetic elements derived from pMON5647 are the pBR327 origin of
replication, precA promoter, g10L ribosome binding protein, porcine
somatotropin gene (pST) and T7 transcription terminator (Dunn and
Strudier, 1983). Plasmid pMON710 DNA was digested with restriction
enzymes HincII and EcoRV resulting in 940 base pair HincII,EcoRV
fragment containing the streptomycin adenylyltransferase gene which
infers resistance to streptomycin and spectinomycin. The
restriction fragments were ligated and the ligation reaction
mixture was used to transform E. coli strain JM101. The DraI, SspI,
HincII and EcoRV restriction sites are lost as a result of the
cloning. Transformant bacteria were selected on
spectinomycin-containing plates. Plasmid DNA was isolated, analyzed
by restriction analysis and sequenced to confirm the correct
insert.
EXAMPLE 57
[1137] Construction of pMON13361
[1138] Plasmid pMON13288 was mutagenized by oligonucleotide
site-directed mutagenesis (method described in Kunkel, 1985) to
eliminate a NsiI site in the (15-125) hIL-3 variant coding region.
Codon 70 of (15-125) hIL-3, encoding asparagine, was converted from
AAT to AAC destroying the NsiI recognition site. The
oligonucleotide, Oligo # 54 [SEQ ID NO:158], was used in this
procedure to eliminate the NsiI site. Transformant bacteria were
selected on ampicillin-containing plates. Plasmid DNA was isolated,
analyzed by restriction analysis to confirm the loss of the NsiI
site and sequenced to confirm the sequence of the (15-125) hIL-3
variant gene. The plasmid, pMON13361, encodes the (15-125) hIL-3
variant with the amino acid sequence of PEPTIDE #25 [SEQ ID
NO:89].
[1139] DNA sequence # 32 [SEQ ID NO:160] codes for the foregoing
pMON13361 polypeptide.
EXAMPLE 58
[1140] Construction of pMON14058
[1141] Plasmid pMON13361 was mutagenized by oligonucleotide
site-directed mutagenesis (method described by Taylor et al., 1985
using a kit from Amersham, Arlington Heights, Ill.) to eliminate a
EcoRV site in the (15-125) hIL-3 variant coding region. Codon 46
and 47 of (15-125) hIL-3, encoding asparagine and isoleucine, were
converted from GAT to GAC and ATC to ATT respectively, destroying
the EcoRV recognition site. The oligonucleotide, Oligo # 55 [SEQ ID
NO:159], was used in this procedure to eliminate the EcoRV site.
Transformant bacteria were selected on ampicillin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis
to confirm the loss of the EcoRV site and sequenced to confirm the
sequence of the (15-125) hIL-3 variant gene. The plasmid,
pMON14058, encodes the (15-125) hIL-3 variant with the amino acid
sequence of PEPTIDE #25 [SEQ ID NO:89].
[1142] DNA sequence # 33 [SEQ ID NO:161] codes for the foregoing
pMON14058 polypeptide.
EXAMPLE 59
[1143] Construction of pMON13438
[1144] Plasmid pMON5723 DNA was digested with restriction enzymes
NcoI and HindIII resulting in a 3278 NcoI,HindIII fragment. The
genetic elements derived from pMON5723 are the pBR327 origin of
replication, precA promoter, g10L ribosome binding protein, T7
transcription terminator and streptomycin adenylyltransferase gene.
Plasmid pMON14058 DNA was digested with NcoI and HindIII resulting
in a 345 base pair NcoI,HindIII fragment which contains the
(15-125) hIL-3 gene with the following amino acid substitutions:
18I, 25H, 29R, 32N, 37P, 42S, 45M, 51R, 55T, 59L, 62V, 67H,
69E,73G, 76A, 79R, 83Q, 87S, 93S, 98I, 101A, 105Q, 109E, 116V, 120Q
and 123E. The restriction fragments were ligated and the ligation
reaction mixture was used to transform E. coli strain JM101.
Transformant bacteria were selected on spectinomycin-containing
plates. Plasmid DNA was isolated, analyzed by restriction analysis
and sequenced to confirm the correct insert. The plasmid,
pMON13438, encodes the (15-125) hIL-3 variant with the amino acid
sequence of PEPTIDE #25 [SEQ ID NO:89].
[1145] DNA sequence # 33 [SEQ ID NO:161] codes for the foregoing
pMON13438 polypeptide.
EXAMPLE 60
[1146] Construction of pMON13285
[1147] Plasmid pMON13252 DNA was digested with restriction enzymes
NcoI and EcoRV and the resulting 3669 base pair NcoI,EcoRV fragment
contains the following genetic elements; streptomycin
adenyltransferase gene, pBR327 origin of replication, phage f1
origin of replication as the transcription terminator, recA
promoter, g10L ribosome binding site and the bases encoding amino
acids 47-125 of (15-125) hIL-3 with the following amino acid
substitution, 50D. The 3669 base pair NcoI,EcoRV restriction
fragment from pMON13252 was ligated to the following annealed
complementary oligonucleotides.
[1148] Oligo #165 [SEQ ID NO:162]
[1149] Oligo #166 [SEQ ID NO:163]
[1150] Oligo #167 [SEQ ID NO:164]
[1151] Oligo #168 [SEQ ID NO:165]
[1152] Oligo #169 [SEQ ID NO:166]
[1153] Oligo #170 [SEQ ID NO:167]
[1154] When assembled, the oligonucleotides create NcoI and EcoRV
restriction ends and the DNA sequence that encodes amino acids
15-46 of (15-125) hIL-3 with the following amino acid
substitutions; 42D, 45M and 46S. The codons encoding amino acids
15-46 of (15-125) hIL-3 are those found in the hIL-3 cDNA sequence
except at those positions where amino acid substitutions were made.
The plasmid, pMON13285, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
64 Peptide #A3 [SEQ ID NO:258] DNA sequence #A3 pMON13285 42D, 45M
46S, 50D ATGGCTAACT GCTCTAACAT GATCGATGAA [SEQ ID NO:398]
ATCATCACCC ACCTGAAGCA GCCACCGCTC CCCCTGCTGG ACTTCAACAA CCTCAATGAC
GAAGACATGT CTATCCTGAT GGACAATAAC CTTCGTCGTC CAAACCTCGA GCCATTCAAC
CGTGCTGTCA ACTCTCTCCA GAATGCATCA GCAATTGAGA GCATTCTTAA AAATCTCCTG
CCATGTCTGC CCCTGGCCAC GGCCGCACCC ACCCCACATC CAATCCATAT CAACGACCGT
GACTGGAATG AATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGA GAACGCGCAG
GCTCAACAG
EXAMPLE 61
[1155] Construction of pMON13286
[1156] Plasmid pMON5978 DNA was digested with restriction enzymes
NcoI and EcoRV and the resulting 3865 base pair NcoI,EcoRV fragment
contains the following genetic elements; beta-lactamase gene (AMP),
pBR327 origin of replication, phage f1 origin of replication as the
transcription terminator, precA promoter, g10L ribosome binding
site and the bases encoding amino acids 47-125 of (15-125) hIL-3.
The 3865 base pair NcoI,EcoRV restriction fragment from pMON5978
was ligated to the following annealed complementary
oligonucleotides.
[1157] Oligo #165 [SEQ ID NO:162]
[1158] Oligo #166 [SEQ ID NO:163]
[1159] Oligo #167 [SEQ ID NO:164]
[1160] Oligo #168 [SEQ ID NO:165]
[1161] Oligo #169 [SEQ ID NO:166]
[1162] Oligo #170 [SEQ ID NO:167]
[1163] When assembled, the oligonucleotides create NcoI and EcoRV
restriction ends and the DNA sequence that encodes amino acids
15-46 of (15-125) hIL-3 with the following amino acid
substitutions; 42D, 45M and 46S. The codons encoding amino acids
15-46 of (15-125) hIL-3 are those found in the hIL-3 cDNA sequence
except at those positions where amino acid substitutions were made.
The plasmid, pMON13286, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
65 Peptide #A4 [SEQ ID NO:259] DNA sequence #A4 pMON13286 42D, 45M,
46S ATGGCTAACT GCTCTAACAT GATCGATGAA [SEQ ID NO:399] ATCATCACCC
ACCTGAAGCA GCCACCGCTG CCGCTGCTGG ACTTCAACAA CCTCAATGAC GAAGACATGT
CTATCCTGAT GGAAAATAAC CTTCGTCGTC CAAACCTCGA GGCATTCAAC CGTGCTGTCA
AGTCTCTGCA GAATGCATCA GCAATTGAGA GCATTCTTAA AAATCTCCTG CCATGTCTGC
CCCTGGCCAC GGCCGCACCC ACGCGACATC CAATCCATAT CAAGGACGGT GACTGGAATG
AATTCCGTCG TAAACTGACC TTCTATCTGA AAACCTTGGA GAACGCGCAG
GCTCAACAG
EXAMPLE 62
[1164] Construction of pMON13325
[1165] The 3704 base pair EcoRI, HindIII DNA fragment from plasmid
pMON13286 is ligated to the 64 base pair EcoRI, HindIII DNA
fragment from plasmid pMON13215. The following genetic elements are
derived from pMON13286; beta-lactamase gene (AMP), pBR327 origin of
replication, phage F1 origin of replication as the transcription
terminator, precA promoter, g10L ribosome binding site and the
bases encoding amino acids 15-105 of the (15-125) hIL-3 gene with
the following changes, 42D, 45M, and 46S. The bases encoding amino
acids 106-125 of the (15-125) gene with the following change, 116W,
are derived from pMON13215. The resulting plasmid, pMON13325,
encodes the (15-125) hIL-3 variant with the following amino acid
sequence:
[1166] Peptide # A5 [SEQ ID NO:261]
EXAMPLE 63
[1167] Construction of pMON13326
[1168] The 3683 base pair NcoI, EcoRI DNA fragment from plasmid
pMON13215 is ligated to the 281 base pair NcoI, EcoRI DNA fragment
from plasmid pMON13285. The following genetic elements are derived
from pMON13215; beta-lactamase gene (AMP), pBR327 origin of
replication, phage F1 origin of replication as the transcription
terminator, precA promoter, g10L ribosome binding site and the
bases encoding amino acids 106-125 of the (15-125) hIL-3 gene with
the following change, 116W. The bases encoding amino acids 15-105
of the (15-125) gene with the following change, 42D, 45M, 46S and
50D derived from pMON13285. The resulting plasmid, pMON13326,
encodes the (15-125) hIL-3 variant with the following amino acid
sequence:
[1169] Peptide # A6 [SEQ ID NO:262]
EXAMPLE 64
[1170] Construction of pMON13332
[1171] Plasmid pMON13326 DNA is digested with restriction enzymes
NsiI and EcoRI and the resulting 3853 base pair NsiI,EcoRI fragment
contains the following genetic elements; beta-lactamase gene (AMP),
pBR327 origin of replication, phage f1 origin of replication as the
transcription terminator, recA promoter, g10L ribosome binding site
and the bases encoding amino acids 15-71 and 106-125 of (15-125)
hIL-3 gene with the following changes 42D, 45M, 46S, 50D and 116W.
The 3853 base pair NsiI,EcoRI restriction fragment from pMON13326
is ligated to the following annealed complementary
oligonucleotides.
[1172] Oligo #15(A) [SEQ ID NO:168]
[1173] Oligo #16(A) [SEQ TD NO:169]
[1174] In the resulting plasmid the 111 bases between the NsiI and
EcoRI restriction sites in the (15-125) hIL-3 gene are replaced
with 24 bases from the above mentioned oligonucleotides. This
linker also creates a NdeI recognition sequence.
EXAMPLE 65
[1175] Construction of pMON13330
[1176] The 3846 base pair PstI, EcoRI DNA fragment from plasmid
pMON13332 is ligated to the 118 base pair PstI, EcoRI DNA fragment
from plasmid pMON13305. The following genetic elements are derived
from pMON13332; beta-lactamase gene (AMP), pBR327 origin of
replication, phage f1 origin of replication as the transcription
terminator, recA promoter, g10L ribosome binding site and the bases
encoding amino acids 15-69 and 106-125 of the (15-125) hIL-3 gene
with the following change, 42D, 45M, 46S, 50D and 116W. The bases
encoding amino acids 70-105 of the (15-125) gene with the following
change, 95R, 98T and 100R are derived from pMON13305. The resulting
plasmid, pMON13330, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
[1177] Peptide # A7 [SEQ ID NO:263]
EXAMPLE 66
[1178] Construction of pMON13329
[1179] The 3846 base pair PstI, EcoRI DNA fragment from plasmid
pMON13332 is ligated to the 118 base pair PstI, EcoRI DNA fragment
from plasmid pMON13304. The following genetic elements are derived
from pMON13332; beta-lactamase gene (AMP), pBR327 origin of
replication, phage f1 origin of replication as the transcription
terminator, recA promoter, g10L ribosome binding site and the bases
encoding amino acids 15-69 and 106-125 of the (15-125) hIL-3 gene
with the following change, 42D, 45M, 46S, and 116W. The bases
encoding amino acids 70-105 of the (15-125) gene with the following
change, 98I and 100R are derived from pMON13304. The resulting
plasmid, pMON13329, encodes the (15-125) hIL-3 variant with the
following amino acid sequence:
[1180] Peptide # A8 [SEQ ID NO:406]
EXAMPLE 67
[1181] Construction of pMON5853 (FIG. 6) which encodes
[Met-(15-133) hIL-3(Arg.sup.129)]
[1182] Plasmid DNA of pMON5847 (Example 2) was treated with NcoI.
The restriction enzyme was inactivated by heat treatment
(65.degree. C. for 10 minutes). The DNA was then treated with large
fragment of DNA polymerase I (Klenow) in the presence of all four
nucleotide precursors. This produces DNA termini with
non-overlapping ends. After 5 minutes at 37.degree. C., the
polymerase was inactivated by heat treatment at 65.degree. C. for
10 minutes. The DNA was then treated with HpaI, an enzyme which
produces non-overlapping termini. The DNA was ethanol precipitated
and ligated. The ligation reaction mixture was used to transform
competent JM101 cells to ampicillin resistance. Colonies were
picked and plasmid DNA was analyzed by restriction analysis. A
plasmid designated pMON5853 was identified as one containing a
deletion of the amino terminal 14 codons of the hIL-3 gene. The DNA
sequence for the junction of the ribosome binding site to the
(15-133) hIL-3 gene was determined to be the following:
66 [SEQ ID NO:400] [SEQ ID NO:401]
5'-AAGGAGATATATCCATGAACTGCTCTAAC-3' M N C S N
[1183] The lower line contains the one-letter code for the amino
acids specified by the coding sequence of the amino terminus of the
15-133 hIL-3 gene. These are methionine, asparagine, cysteine,
serine and asparagine.
[1184] When cultures of JM101 cells harboring this plasmid were
induced with nalidixic acid, it was found that hIL-3 (15-133)
accumulated at levels higher than hIL-3 (pMON5847).
[1185] The plasmid, pMON5853, encodes Met-(15-133) hIL-3
(Arg.sup.129) which has the following amino acid sequence:
67 Met Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr [SEQ ID NO:402]
His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr
Leu Arg Leu Ala Ile Phe
EXAMPLE 68
[1186] Construction of pMON13252
[1187] Plasmid, pMON2341, DNA was digested with restriction enzymes
NcoI and HindIII resulting in a 3619 base pair NcoI/HindIII
fragment. The genetic elements derived from pMON2341 are the
beta-lactamase gene (AMP), pBR327 origin of replication F1 phage
origin of replication as the transcription terminator, precA, g10L
ribosome binding site. The plasmid encoding the hIL-3 (15-125)
Asp.sup.(50) variant, was digested with NcoI and HindIII resulting
in a 345 base pair NcoI/HindIII fragment. This 345 Base pair
NcoI/HindIII fragment was ligated with the 3619 base pair fragment
from pMON2341 and the ligation reaction mixture was used to
transform E. coli K-12 strain JM101. Plasmid DNA was isolated and
screened by restriction analysis using NcoI and HindIII. Positive
clones contained a 345 base pair NcoI/HindIII fragment. This
construct was designated pMON13252. The plasmid, pMON13252, encodes
the (15-125) hIL-3 variant with the following amino acid
sequence:
68 PEPTIDE A10; (15-125)HIL-3 Asp.sup.(50) pMON13252 Asn Cys Ser
Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:407] 15 20 25
Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly 30 35
40 Glu Asp Gln Asp Ile Leu Met Asp Asn Asn Leu Arg Arg Pro Asn 45
50 55 Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
60 65 70 Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro
Leu 75 80 85 Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys
Asp Gly 90 95 100 Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr
Leu Lys Thr 105 110 115 Leu Glu Asn Ala Gln Ala Gln Gln 120 125 DNA
sequence #A10 pMON13252 50D ATGGCTAACT GCTCTAACAT GATCGATGAA
ATCATCACCC ACCTGAAGCA [SEQ ID NO:408] GCCACCGCTG CCGCTGCTGG
ACTTCAACAA CCTCAATGGT GAAGACCAAG ATATCCTGAT GGAACAATAAC CTTCGTCGTC
CAAACCTCGA GGCATTCAAC CGTGCTGTCA ACTCTCTGCA GAATGCATCA GCAATTGAGA
GCATTCTTAA AAATCTCCTG CCATGTCTGC CCCTGGCCAC GGCCGCACCC ACGCGACATC
CAATCCATAT CAAGGACGGT GACTGGAATG AATTCCGTCG TAAACTGACC TTCTATCTGA
AAACCTTGGA GAACGCGCAG GCTCAACAG
EXAMPLES 69-76
[1188] The variants in Table 5 were constructed by cassette
mutagenesis using methods described in the Materials and Methods
and the Examples contained herein, particularly Examples 54-58.
Parental plasmid DNA (Table 5), digested with the appropriate
restriction enzymes (Table 5), was ligated with the indicated
annealed pairs of complementary oligonucleotides (Table 5). The
assembled oligonucleotides create appropriate restriction ends and
a portion of the (15-125) hIL-3 gene sequence (pMON13288 [SEQ ID
NO:100]). Individual isolates were screened by restriction analysis
and DNA sequenced to confirm that the desired changes in the
(15-125) hIL-3 variant gene were made. The oligonucleotides create
change(s) in the (15-125) hIL-3 gene which encode the corresponding
amino acid substitution(s) in the variant polypeptide (Table 5).
The amino acids substitutions in addition to and/or different from
those in polypeptide # 25 [SEQ ID NO:89] are indicated in Table 5.
The table also shows the plasmid designation (pMON number), DNA
sequence identification number for the mutated hIL-3 gene and the
identification number for the the resulting variant polypeptide.
The biological activity (growth promoting activity in AML 193
cells) for some of the variants in Table 5 is shown in Table 1.
EXAMPLES 77-82
[1189] The variants in Table 6 were constructed by methods
described in the Materials and Methods and the Examples contained
herein, particularly in Examples 60 and 61. Parental plasmid DNA
(Table 6), digested with the appropriate restriction enzymes (Table
6), was ligated with the indicated restriction fragment (Table 6).
Individual isolates were screened by restriction analysis and DNA
sequenced to confirm that the desired changes in the (15-125) hIL-3
variant gene were made. The resulting mutated (15-125) hIL-3 genes
encode the corresponding amino acid substitutions in the variant
polypeptides (Table 6). The amino acids substitutions in addition
to and/or different from those in polypeptide # 25 [SEQ ID NO:89]
are indicated in Table 6. The table also shows the plasmid
designation (pMON number), DNA sequence identification number for
the mutated hIL-3 gene and the identification number for the the
resulting variant polypeptide. The biological activity (growth
promoting activity in AML 193 cells) for some of the variants in
Table 6 is shown in Table 1.
EXAMPLE 83
[1190] Construction of pMON13368
[1191] One of the DNA fragments to construct the plasmid,
pMON13368, was generated by site-directed mutagenesis employing PCR
techniques described in the Materials and Methods and the Examples
contained herein, particularly Example 53. The template for the PCR
reaction was plasmid, pMON13289, DNA using the oligonucleotides,
Oligo #B13 18123A25H [SEQ ID NO: 182] and Oligo #B14 2341HIN3 [SEQ
ID NO:183], as primers. The resulting DNA product was digested with
the restriction enzymes NcoI and HindIII. Upon completion, the
digest was heated at 70.quadrature.C for 15 minutes to inactivate
the enzymes. The restriction fragment was purified by
phenol/chloroform extraction and precipitation with equal volume
isopropanol in the presence of 2M NH4OAc. The oligonucleotide,
Oligo #B13 18I23A25H [SEQ ID NO:182], changes the codon at position
23 of (15-125) hIL-3 variant gene pMON13289 [SEQ ID NO:103] from
`ATT` to `GCA` (Ile to Ala). The 3619 base pair NcoI, HindIII
restriction fragment from pMON2341 was ligated to the PCR-generated
NcoI, HindIII restriction fragment. Individual isolates were
screened by restriction analysis and DNA sequenced to confirm that
the desired changes in the (15-125) hIL-3 variant gene were made.
The plasmid, pMON13368, contains the (15-125) hIL-3 variant gene
(DNA sequence #B15 [SEQ ID NO:346]) which encodes the (15-125)
hIL-3 variant polypeptide with the following amino acid
sequence:
[1192] Polypeptide #B15 [SEQ ID NO.:278]
EXAMPLE 84
[1193] Construction of pMON13380
[1194] Plasmid, pMON13368, DNA was digested with restriction
enzymes EcoRI and HindIII. The resulting 3900 base pair
EcoRI,HindIII fragment contains the following genetic elements;
beta-lactamase gene (AMP), pBR327 origin of replication, phage F1
origin of replication as the transcription terminator, precA
promoter, g10L ribosome binding site and the DNA sequence encoding
amino acids 15-105 of the variant pMON13368. The 3900 base pair
EcoRI,HindIII restriction fragment from pMON13368 was ligated to
the following annealed complementary oligonucleotides.
69 Oligo # B48 9E12Q6V1 [SEQ ID NO: 217] Oligo # B49 9E12Q6V3 [SEQ
ID NO: 218] Oligo # 49 120Q123E2 [SEQ ID NO: 63] Oligo # 50
120Q123E4 [SEQ ID NO: 64]
[1195] When assembled, the oligonucleotides create EcoRI and
HindIII restriction ends and the DNA sequence that encodes amino
acids 106-125 of (15-125) hIL-3 with the following amino acid
substitution; 109E, 112Q, 116V, 120Q and 123E. The codons used in
the (15-125) hIL-3 gene are those found in the hIL-3 cDNA sequence
except at those positions where amino acid substitutions were made.
Individual isolates were screened by restriction analysis and DNA
sequenced to confirm that the desired changes in the (15-125) hIL-3
variant gene were made. The plasmid, pMON13380, contains the
(15-125) hIL-3 variant gene (DNA sequence #B16 [SEQ ID NO:347])
which encodes the (15-125) hIL-3 variant polypeptide with the
following amino acid sequence:
[1196] Polypeptide #B16 [SEQ ID NO.:279]
EXAMPLE 85
[1197] Construction of pMON13476
[1198] One of the DNA fragments to construct the plasmid,
pMON13476, was generated by site-directed mutagenesis employing PCR
techniques described in the Materials and Methods and the Examples
contained herein, particularly Example 54. The template for the PCR
reaction was plasmid, pMON13287, DNA using the oligonucleotides,
Oligo #B13 18I23A25H [SEQ ID NO:182] and Oligo #B14 2341HIN3 [SEQ
ID NO.:183] as primers. The resulting DNA product was digested with
the restriction enzymes NcoI and HindIII. Upon completion, the
digest was heated at 70.quadrature.C for 15 minutes to inactivate
the enzymes. The restriction fragment was purified by
phenol/chloroform extraction and precipitation with equal volume
isopropanol in the presence of 2M NH4OAc. The oligonucleotide,
Oligo #B13 18I23A25H [SEQ ID NO.:182], changes the codon at
position 23 of (15-125) hIL-3 variant gene, pMON13287, [SEQ ID
NO:97] from `ATT` to `GCA` (Ile to Ala). The 3619 base pair NcoI,
HindIII restriction fragment from pMON2341 was ligated to the
PCR-generated NcoI, HindIII restriction fragment. Individual
isolates were screened by restriction analysis and DNA sequenced to
confirm that the desired changes in the (15-125) hIL-3 variant gene
were made. The resulting clone also contained a change, that was
not designed in the mutagenic oligonucleotide, which changed the
codon at position -1 from `GCT` to `GAT` which changes the amino
acid from Alanine to Aspartic Acid. The plasmid, pMON13476,
contains the (15-125) hIL-3 variant gene (DNA sequence #B52 [SEQ ID
NO:303]) which encodes the (15-125) hIL-3 variant polypeptide with
the following amino acid sequence:
[1199] Polypeptide #B52 [SEQ ID NO.:314]
EXAMPLES 86-92
[1200] The variants in Table 7 were constructed by PCR techniques
using methods described in the Materials and Methods and the
Example contained herein, particularly Example 51. Two sequential
PCR reactions were used to create the variants. In the first PCR
reaction pMON13287 plasmid DNA served as the template and the two
oligonucleotides indicated in Table 7 served as the primers.
Following the PCR extension reaction, the PCR product was partially
purified to remove primer that was not extended. In the second PCR
reaction pMON13287 plasmid DNA served as the template, the purified
PCR product from the first PCR reaction served as one of the
primers and the Oligo #B14 2341Hin3 [SEQ ID NO:183] as the second
primer. The product from the second PCR reaction was partially
purified and digested with restriction enzymes NcoI and HindIII and
ligated with the 3619 base pair NcoI,HindIII fragment from
pMON2341. Individual isolates were screened by restriction analysis
and DNA sequenced to confirm that the desired changes in the
(15-125) hIL-3 variant gene were made. The amino acids
substitutions in addition to and/or different from those in
polypeptide # 24 [SEQ ID NO:88] are indicated in Table 7. The table
also shows the plasmid designation (pMON number), DNA sequence
identification number for the mutated hIL-3 gene and the
identification number for the the resulting variant polypeptide.
The biological activity (growth promoting activity in AML 193
cells) for some of the variants in Table 7 is shown in Table 1.
EXAMPLES 93-120
[1201] The variants in Table 8 were constructed by cassette
mutagenesis using methods described in the Materials and Methods
and the Examples contained here, particularly Examples 54-58.
Parental plasmid DNA (Table 8), digested with the appropriate
restriction enzymes (Table 8), was ligated with the indicated
annealed pairs of complementary oligonucleotides (Table 8). The
assembled oligonucleotides create the appropriate restriction ends
and a portion of (15-125) hIL-3 gene (pMON13288 [SEQ ID NO:100])
sequence. The oligonucleotides create change(s) in the (15-125)
hIL-3 variant gene which encode the corresponding amino acid
substitution(s); and/or deletions from the C-terminus of the
variant polypeptide (Table 8). Individual isolates were screened by
restriction analysis and DNA sequenced to confirm that the desired
changes in the (15-125) hIL-3 variant gene were made. The amino
acids substitutions in addition to and/or different from those in
polypeptide # 25 [SEQ ID NO:88] are indicated in Table 8. The table
also shows the plasmid designation (pMON number), DNA sequence
identification number for the mutated hIL-3 gene and the
identification number for the the resulting variant polypeptide.
The biological activity (growth promoting activity in AML 193
cells) for some of the variants in Table 5 is shown in Table 1.
EXAMPLE 121
[1202] Construction of pMON13446
[1203] Plasmid, pMON13287, DNA (purified from the E. coli strain
GM48 {dam-}) was digested with restriction enzymes NcoI and ClaI.
The resulting 3942 base pair NcoI,ClaI fragment contains the
following genetic elements; beta-lactamase gene (AMP), pBR327
origin of replication, phage F1 origin of replication as the
transcription terminator, precA promoter, g10L ribosome binding
site and the DNA sequence encoding amino acids 21-125 of the
(15-125) hIL-3 variant pMON13287. The 3942 base pair NcoI,ClaI
restriction fragment from pMON13368 was ligated to the following
annealed complementary oligonucleotides.
70 Oligo # B57 338UP [SEQ ID NO: 226] Oligo # B56 338DOWN [SEQ ID
NO: 225]
[1204] When assembled, the oligonucleotides create NcoI and ClaI
restriction ends and the DNA sequence that encodes the following 14
amino acid sequence; Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp
Asp Asp Lys [SEQ ID NO:403] and the DNA sequence which encodes
amino acids 15-20 of the (15-125) hIL-3 variant gene, pMON13287
[SEQ ID NO:97]. The resulting variant polypeptide has a 14 amino
acid N-terminal extension fused to the (15-125) hIL-3 variant
polypeptide, pMON13288 [SEQ ID NO: 88]. The plasmid, pMON13446,
contains the (15-125) hIL-3 variant gene (DNA sequence #B53 [SEQ ID
NO:404]) which encodes the (15-125) hIL-3 variant polypeptide with
the following amino acid sequence:
[1205] Polypeptide #B53 [SEQ ID NO.:315]
EXAMPLE B54
[1206] Construction of pMON13390
[1207] Plasmid, pMON13288, DNA (purified from the E. coli strain
GM48 {dam-}) was digested with restriction enzymes NcoI and ClaI.
The resulting 3942 base pair NcoI,ClaI fragment contains the
following genetic elements; beta-lactamase gene (AMP), pBR327
origin of replication, phage F1 origin of replication as the
transcription terminator, precA promoter, g10L ribosome binding
site and the DNA sequence encoding amino acids 21-125 of the
(15-125) hIL-3 variant pMON13288. The 3942 base pair NcoI,ClaI
restriction fragment from pMON13288 was ligated to the following
annealed complementary oligonucleotides.
71 Oligo # B57 338UP [SEQ ID NO: 226] Oligo # B56 338DOWN [SEQ ID
NO: 225]
[1208] When assembled, the oligonucleotides create NcoI and ClaI
restriction ends and the DNA sequence which encodes the following
14 amino acid sequence; Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp
Asp Asp Lys [SEQ ID NO:403] and the DNA sequence which encodes
amino acids 15-20 of the (15-125) hIL-3 variant gene pMON13288 [SEQ
ID NO:100]. The resulting variant has a 14 amino acid N-terminal
extension fused to the (15-125) hIL-3 variant polypeptide,
pMON13288 [SEQ ID NO:88]. The plasmid, pMON13390, containes the
(15-125) hIL-3 variant gene (DNA sequence #B54 [SEQ ID NO.:405]
which encodes the (15-125) hIL-3 variant polypeptide with the
following amino acid sequence:
[1209] Polypeptide #B54 [SEQ ID NO:316]
EXAMPLES 133-136
[1210] The variants in Table 10 were constructed by methods
described in Materials and Methods and in Examples contained
herein, particularly Examples 54-58. Parental plasmid DNA (Table
10), digested with the appropriate restriction enzymes (Table 10)
was ligated with the indicated restriction fragment containing the
changes listed (Table 10). The resulting mutated (15-125) IL-3
genes encode the corresponding amino acid substitutions in the
variant polypeptides (Table 10). The amino acid substitutions in
addition to and/or different from those in polypeptide #25 [SEQ ID
NO: 89] are indicated in Table 10. The biological activity (growth
promoting activity in AML 193 cells) for some of the variants in
Table 10 is shown in Table 1.
EXAMPLES 123-132
[1211] The variants in Table 9 were constructed by cassett
mutagenesis using methods described in Materials and Methods and in
Examples 54-58 contained herein. Parental plasmid DNA (Table 9),
digested with the appropriate restriction enzymes (Table 9), was
ligated with the indicated annealed pairs of complementry
oligonucleoties (Table 9). The assembled oligonucleotides create
the appropriate restriction fragment which was inserted into the
(15-125) hIL-3 gene (pMON13288 [SEQ ID NO:100] between these
restriction sites. The deletions or substitutions encoded by the
oligonucleotide in the (15-125) IL-3 gene correspond to the amino
acid deletions or substitutions in the variant polypeptide (Table
9). The amino acid substitutions or deletions, in addition to
and/or different from those in the polypeptide #25 [SEQ ID NO:89]
are indicated in Table 9. The biological activity (growth promoting
activity in AML 193 cells) for some of the variants in Table 9 is
shown in Table 1.
[1212] Formula XI shown below is a representation of a [(15-125)
hIL-3 mutein] with numbers in bold type added above the amino acids
to represent the position at which the amino acid below the bolded
number appears in native (1-133) hIL-3 [e. g. the amino acid at
position 1 of Formula XI corresponds to the Asn which appears at
position 15 in native (1-133) hIL-3]. The number shown in bold
indicates the amino acids that correspond to the native
IL-3(1-133). The non-bold members below the amino acids sequences
are for Seq Id reference numbers. When the muteins are expressed
the initial amino acid may be preceded by Met- or Met-Ala-.
72 15 20 25 Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys
Gln [SEQ ID NO:23] 1 5 10 15 30 35 40 Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly Glu Asp 20 25 30 45 50 55 Gln Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu 35 40 45 60 65 70 Ala
Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile 50 55 60 75
80 85 Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
65 70 75 90 95 100 Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp
Gly Asp Trp 80 85 90 105 110 115 Asn Glu Phe Arg Arg Lys Leu Thr
Phe Tyr Leu Lys Thr Leu Glu 95 100 105 120 125 Asn Ala Gln Ala Gln
Gln 110
[1213]
73TABLE 5 Parental plasmid/ amino acid Example pMON number
restriction digest oligo pair 1, 4 oligo pair 2, 5 oligo pair 3, 6
changes resulting polypeptide Example 69 pMON13406 pMON13288/
19Ala1 29R32N37P2 42S45M3 19Ala polypeptide B1 SEQ ID NO: 332 NcoI,
EcoRV OLIGO# B1 OLIGO# 5 OLIGO# 11 SEQ ID NO: 264 SEQ ID NO: 170
SEQ ID NO: 19 SEQ ID NO: 25 19Ala4 29R32N37P5 42S45M6 OLIGO# B2
OLIGO# 6 OLIGO# 12 SEQ ID NO: 171 SEQ ID NO: 20 SEQ ID NO: 26
Example 70 pMON13414 pMON13288/ 19Ile1 29R32N37P2 42S45M3 19Ile
polypeptide B2 SEQ ID NO: 333 NcoI, EcoRV OLIGO# B3 OLIGO# 5 OLIGO#
11 SEQ ID NO: 265 SEQ ID NO: 172 SEQ ID NO: 19 SEQ ID NO: 25 19Ile4
29R32N37P5 42S45M6 OLIGO# B4 OLIGO# 6 OLIGO# 12 SEQ ID NO: 173 SEQ
ID NO: 20 SEQ ID NO: 26 Example 71 pMON13407 pMON13288/ 18I25H1
29R32N37P2 42S45V3 45Val polypeptide B3 SEQ ID NO: 334 NcoI, EcoRV
OLIGO# 1 OLIGO# 5 OLIGO# B11 SEQ ID NO: 266 SEQ ID NO: 15 SEQ ID
NO: 19 SEQ ID NO: 180 18I25H4 29R32N37P5 42S45V6 OLIGO# 2 OLIGO# 6
OLIGO# B12 SEQ ID NO: 16 SEQ ID NO: 20 SEQ ID NO: 181 Example 72
pMON13405 pMON13288/ 19Ala1 29R32N37P2 42S45V3 19Ala, 45Val
polypeptide B4 SEQ ID NO: 335 NcoI, EcoRV OLIGO# B1 OLIGO# 5 OLIGO#
B11 SEQ ID NO: 267 SEQ ID NO: 170 SEQ ID NO: 19 SEQ ID NO: 180
19Ala4 29R32N37P5 42S45V6 OLIGO# B2 OLIGO# 6 OLIGO# B12 SEQ ID NO:
171 SEQ ID NO: 20 SEQ ID NO: 181 Example 73 pMON13415 pMON13288/
19Ile1 29R32N37P2 42S45V3 19Ile, 45Val polypeptide B5 SEQ ID NO:
336 NcoI, EcoRV OLIGO# B3 OLIGO# 5 OLIGO# B11 SEQ ID NO: 268 SEQ ID
NO: 172 SEQ ID NO: 19 SEQ ID NO: 180 19Ile4 29R32N37P5 42S45V6
OLIGO# B4 OLIGO# 6 OLIGO# B12 SEQ ID NO: 173 SEQ ID NO: 20 SEQ ID
NO: 181 Example 74 pMON13408 pMON13288/ 49Ile1 59L62V2 67H69E3
49Ile polypeptide B6 SEQ ID NO: 337 EcoRV, NsiI OLIGO# B7 OLIGO# 25
OLIGO# 29 SEQ ID NO: 269 SEQ ID NO: 176 SEQ ID NO: 39 SEQ ID NO: 43
49Ile4 59L62V5 67H69E6 OLIGO# B8 OLIGO# 26 OLIGO# 30 SEQ ID NO: 177
SEQ ID NO: 40 SEQ ID NO: 44 Example 75 pMON13409 pMON13288/ 49Leu1
59L62V2 67H69E3 49Leu polypeptide B7 SEQ ID NO: 338 EcoRV, NsiI SEQ
ID NO: 178 OLIGO# 25 OLIGO# 29 SEQ ID NO: 270 OLIGO# B9 SEQ ID NO:
39 SEQ ID NO: 43 49Leu4 59L62V5 67H69E6 OLIGO# B10 OLIGO# 26 OLIGO#
30 SEQ ID NO: 179 SEQ ID NO: 40 SEQ ID NO: 44 Example 76 pMON13410
pMON13288/ 49Asp1 59L62V2 67H69E3 49Asp polypeptide B8 SEQ ID NO:
339 EcoRV, NsiI OLIGO# B5 OLIGO# 25 OLIGO# 29 SEQ ID NO: 271 SEQ ID
NO: 174 SEQ ID NO: 39 SEQ ID NO: 43 49Asp4 59L62V5 67H69E6 OLIGO#
B6 OLIGO# 26 OLIGO# 30 SEQ ID NO: 175 SEQ ID NO: 40 SEQ ID NO:
44
[1214]
74TABLE 6 plasmid pMON Parental plasmid/ restriction amino acid
resulting Example No number restriction digest fragment
substitutions polypeptide Example 77 pMON13422 pMON13408/ 99 base
pair 19 Ala, polypeptide B9 SEQ ID NO: 340 NcoI, EcoRV NcoI, EcoRV
45 Val, SEQ ID NO: 272 fragment from 49 Ile pMON13405 Example 78
pMON13423 pMON13408/ 99 base pair 19 Ile, polypeptide B10 SEQ ID
NO: 341 NcoI, EcoRV NcoI, EcoRV 45 Val, SEQ ID NO: 273 fragment
from 49 Ile pMON13415 Example 79 pMON13424 pMON13409/ 99 base pair
19 Ala, polypeptide B11 SEQ ID NO: 342 NcoI, EcoRV NcoI, EcoRV 45
Val, SEQ ID NO: 274 fragment from 49 Leu pMON13405 Example 80
pMON13425 pMON13409/ 99 base pair 19 Ile, polypeptide B12 SEQ ID
NO: 343 NcoI, EcoRV NcoI, EcoRV 45 Val, SEQ ID NO: 275 fragment
from 49 Leu pMON13415 Example 81 pMON13426 pMON13410/ 99 base pair
19 Ala, polypeptide B13 SEQ ID NO: 344 NcoI, EcoRV NcoI, EcoRV 45
Val, SEQ ID NO: 276 fragment from 49 Asp pMON13405 Example 82
pMON13429 pMON13410/ 99 base pair 19 Ile, polypeptide B14 SEQ ID
NO: 345 NcoI, EcoRV NcoI, EcoRV 45 Val, SEQ ID NO: 277 fragment
from 49 Asp pMON13415
[1215]
75TABLE 7 pMON Step one Step one Step two Step two Amino Acid
Example number template PCR primer1 PCR primer2 PCR primer1 PCR
primer2 Substitutions Polypeptide Example 86 pMON13475 pMON13287
18I23A25H 42D45V46S50D product from 2341HIN3 42D, 46S, 50D
Polypeptide SEQ ID NO: OLIGO# B13 OLIGO# B19 step one OLIGO# B14 #
B17 348 SEQ ID NO: 182 SEQ ID NO: 188 SEQ ID NO: 183 SEQ ID NO: 280
Example 87 pMON13366 pMON13287 2341NCO 42D45V46S50D product from
2341HIN3 42N, 46S, 50D Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B19
step one OLIGO# B14 # B18 349 SEQ ID NO: 184 SEQ ID NO: 188 SEQ ID
NO: 183 SEQ ID NO: 281 Example 88 pMON13367 pMON13287 2341NCO
42A45V46S50D product from 2341HIN3 46S, 50D Polypeptide SEQ ID NO:
OLIGO# B15 OLIGO# B17 step one OLIGO# B14 # B19 350 SEQ ID NO: 184
SEQ ID NO: 186 SEQ ID NO: 183 SEQ ID NO: 282 Example 89 pMON13369
pMON13287 2341NCO 42D45V46S50D product from 2341HIN3 42D, 46S, 50D
Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B21 step one OLIGO# B14 #
B20 351 SEQ ID NO: 184 SEQ ID NO: 190 SEQ ID NO: 183 SEQ ID NO: 283
Example 90 pMON13370 pMON13287 2341NCO 42A45M46S50D product from
2341HIN3 45M, 46S, 50D Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B16
step one OLIGO# B14 # B21 352 SEQ ID NO: 184 SEQ ID NO: 185 SEQ ID
NO: 183 SEQ ID NO: 284 Example 91 pMON13373 pMON13287 2341NCO
42D45M46S50D product from 2341HIN3 42D, 45M, 46S Polypeptide SEQ ID
NO: OLIGO# B15 OLIGO# B18 step one OLIGO# B14 50D # B22 353 SEQ ID
NO: 184 SEQ ID NO: 187 SEQ ID NO: 183 SEQ ID NO: 285 Example 92
pMON13374 pMON13287 2341NCO 42S45M46S50D product from 2341HIN3 42S,
45M, 46S Polypeptide SEQ ID NO: OLIGO# B15 OLIGO# B20 step one
OLIGO# B14 50D # B23 354 SEQ ID NO: 184 SEQ ID NO: 189 SEQ ID NO:
183 SEQ ID NO: 286
[1216]
76TABLE 8 re- sulting amino parental acid Example plasmid plasmid
oligo pair oligo pair oligo pair oligo pair sub (s). polypeptide
Example 93 pMON13375 pMON13287/ SO9E16V1 S116VD31 15-119
polypeptide B24 SEQ ID NO: EcoR1, HindIII OLIGO# B50 OLIGO# B52 SEQ
ID NO: 287 355 SEQ ID NO: 219 SEQ ID NO: 221 SO9E16V3 SECRID33
OLIGO# B51 OLIGO# B53 SEQ ID NO: 220 SEQ ID NO: 222 Example 94
pMON13376 pMON13476/ S9E2Q6V1 S116VD31 15-119, polypeptide B25 SEQ
ID NO: EcoR1,HindIII OLIGO# B54 OLIGO# B52 23A, SEQ ID NO: 288 356
SEQ ID NO: 223 SEQ ID NO: 221 112Q S9E2Q6V3 SECR1D33 OLIGO# B55
OLIGO# B53 SEQ ID NO: 224 SEQ ID NO: 222 Example 95 pMON13377
pMON13475/ S9E2Q6V1 S116VD31 15-119, polypeptide B26 SEQ ID NO:
EcoR1, HindIII OLIGO# B54 OLIGO# B52 23A, SEQ ID NO: 289 357 SEQ ID
NO: 223 SEQ ID NO: 221 42D, S9E2Q6V3 SECR1D33 46S, OLIGO# B55
OLIGO# B53 50D, SEQ ID NO: 224 SEQ ID NO: 222 112Q Example 96
pMON13378 pMON13365/ S09E16V1 S116VD31 15-119, polypeptide B27 SEQ
ID NO: EcoR1, HindIII OLIGO# B50 OLIGO# B52 23A SEQ ID NO: 290 358
SEQ ID NO: 219 SEQ ID NO: 221 S09E16V3 SECR1D33 OLIGO# B51 OLIGO#
B53 SEQ ID NO: 220 SEQ ID NO: 222 Example 97 pMON13379 pMON13367/
9E12Q6V1 120Q123E2 46S, polypeptide B28 SEQ ID NO: EcoR1, HindIII
OLIGO# B48 OLIGO# 49 50D, SEQ ID NO: 291 359 SEQ ID NO: 217 SED ID
NO: 63 112Q 9E12Q6V3 120Q123E4 OLIGO# B49 OLIGO# 50 SEQ ID NO: 218
SED ID NO: 64 Example 98 pMON13385 pMON13287/ 18I25H1 29V32R34S2
42A45V3 29V, polypeptide B29 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO#
B28 OLIGO# 9 32R, SEQ ID NO: 292 360 SEQ ID NO: 15 SED ID NO: 197
SEQ ID NO: 23 34S 18I25H4 29V32R34S5 42A45V6 OLIGO# 2 OLIGO# B29
OLIGO# 10 SEQ ID NO: 16 SED ID NO: 198 SEQ ID NO: 24 Example 99
pMON13381 pMON13287/ 73G76A1 82TRP2 87S93S98I3 101A105Q4 82W
polypeptide B30 SEQ ID NO: NsiI, EcoRI OLIGO# 41 OLIGO# B44 OLIGO#
35 OLIGO# 43 SEQ ID NO: 293 361 SEQ ID NO: 55 SEQ ID NO: 213 SEQ ID
NO: 49 SEQ ID NO: 57 73G76A4 82TRP5 87S93S98I7 101A105Q8 OLIGO# 42
OLIGO# B45 OLIGO# 36 OLIGO# 44 SEQ ID NO: 56 SEQ ID NO: 214 SEQ ID
NO: 50 SEQ ID NO: 58 Example 100 pMON13383 pMON13475/ 9E12Q6V1
120Q123E2 23A, polypeptide B31 SEQ ID NO: EcoR1, HindIII OLIGO# B48
OLIGO# 49 42D, SEQ ID NO: 294 362 SEQ ID NO: 217 SED ID NO: 63 46S,
9E12Q6V5 120Q123E4 50D OLIGO# B49 OLIGO# 50 112Q SEQ ID NO: 218 SED
ID NO: 64 Example 101 pMON13384 pMON13287/ 9E12Q6V1 120Q123E2 112Q
polypeptide B32 SEQ ID NO: EcoR1, HindIII OLIGO# B48 OLIGO# 49 SEQ
ID NO: 295 363 SEQ ID NO: 217 SED ID NO: 63 9E12Q6V5 120Q123E4
OLIGO# B49 OLIGO# 50 SEQ ID NO: 218 SED ID NO: 64 Example 102
pMON13388 pMON13287/ 50D56S1 60S62V2 67N69E3 50D, polypeptide B33
SEQ ID NO: EcoRV, NsiI OLIGO# B42 OLIGO# 27 OLIGO# 31 56S SEQ ID
NO: 296 364 SEQ ID NO: 211 SEQ ID NO: 41 SEQ ID NO: 45 50ASP4
56SER5 67N69E6 OLIGO# B41 OLIGO# B43 OLIGO# 32 SEQ ID NO: 210 SEQ
ID NO: 212 SEQ ID NO: 46 Example 103 pMON13389 pMON13287/ 18I25H1
29R32A37P2 42D45MJ 42D, polypeptide B34 SEQ ID NO: NcoI, EcoRV
OLIGO# 1 OLIGO# 3 OLIGO# B32 45M SEQ ID NO: 297 365 SEQ ID NO: 15
SEQ ID NO: 17 SEQ ID NO: 201 18I25H4 29R32A37P5 42D45M6 OLIGO# 2
OLIGO# 4 OLIGO# B33 SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 202
Example 104 pMON13391 pMON13287/ 18I25H1 34SER1 42A45V3 34S
polypeptide B35 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# B30 OLIGO# 9
SEQ ID NO: 298 366 SEQ ID NO: 15 SEQ ID NO: 199 SEQ ID NO: 23
18I25H4 34SER5 42A45V6 OLIGO# 2 OLIGO# B31 OLIGO# 10 SEQ ID NO: 16
SEQ ID NO: 200 SEQ ID NO: 24 Example 105 pMON13392 pMON13267/
18I25H1 29R32A37P2 42D45V3 42D polypeptide B36 SEQ ID NO: NcoI,
EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B34 SEQ ID NO: 299 367 SEQ ID NO: 15
SEQ ID NO: 17 SEQ ID NO: 203 18I25H4 29R32A37P5 42D45V6 OLIGO# 2
OLIGO# 4 OLIGO# B35 SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 204
Example 106 pMON13393 PMON13287/ 23ALA1 34SER1 42D45M46S3 23A,
polypeptide B37 SEQ ID NO: NcoI, EcoRV OLIGO# B26 OLIGO# B30 OLIGO#
B36 34S, SEQ ID NO: 300 368 SEQ ID NO: 195 SEQ ID NO: 199 SEQ ID
NO: 205 42D, 23ALA4 34SER5 42D45M46S6 45M OLIGO# B27 OLIGO# B31
OLIGO# B37 46S SEQ ID NO: 196 SEQ ID NO: 200 SEQ ID NO: 206 Example
107 pMON13394 pMON13287/ 18I25H1 29R32A37P2 42D45M46S3 42D,
polypeptide B38 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B36
45M, SEQ ID NO: 301 369 SEQ ID NO: 15 SEQ ID NO: 17 SEQ ID NO: 205
46S 18I25H4 29R32A37P5 42D45M46S6 OLIGO# 2 OLIGO# 4 OLIGO# B37 SEQ
ID NO: 16 SEQ ID NO: 16 SEQ ID NO: 206 Example 108 pMON13395
pMON13267/ 23ALA1 29V32R34S2 42D45V46S3 23A, polypeptide B39 SEQ ID
NO: NcoI, EcoRV OLIGO# B26 OLIGO# B28 OLIGO# B38 29V, SEQ ID NO:
302 370 SEQ ID NO: 195 SED ID NO: 197 SEQ ID NO: 207 32R, 23ALA4
29V32R34S5 42D45V4656 34S OLIGO# B27 OLIGO# B29 OLIGO# B39 42D, SEQ
ID NO: 196 SED ID NO: 198 SEQ ID NO: 208 46S Example 109 pMON13396
pMON13287/ 73G76A1 79R82Q2 100ARG3 100MET4 100R, polypeptide B40
SEQ ID NO: NsiI, EcoRI OLIGO# 41 OLIGO# 39 SEQ ID NO: OLIGO# B24
101M SEQ ID NO: 303 371 SEQ ID NO: 55 SEQ ID NO: 53 87S93S98I7 SEQ
ID NO: 193 73G76A4 79R82Q5 OLIGO# 36 10R01M8 OLIGO# 42 OLIGO# 40
SEQ ID NO: 50 OLIGO# B25 SEQ ID NO: 56 SEQ ID NO: 54 SEQ ID NO: 194
Example 110 pMON13397 pMON13267/ 73G76A1 82TRP2 100ARG3 100MET4
82W, polypeptide B41 SEQ ID NO: NsiI, EcoRI OLIGO# 41 OLIGO# B44
OLIGO# B22 OLIGO# B24 100R SEQ ID NO: 304 372 SEQ ID NO: 55 SEQ ID
NO: 213 SEQ ID NO: 191 SEQ ID NO: 193 101M 73G76A4 82TRP5
87S93S98I7 10R01M8 OLIGO# 42 OLIGO# B45 OLIGO# 36 OLIGO# B25 SEQ ID
NO: 56 SEQ ID NO: 214 SEQ ID NO: 50 SEQ ID NO: 194 Example 111
pMON13398 pMON13287/ 18I25H1 29R32A37P2 42D45V46S3 42D, polypeptide
B42 SEQ ID NO: NcoI, EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B38 46S SEQ ID
NO: 305 373 SEQ ID NO: 15 SEQ ID NO: 17 SEQ ID NO: 207 18I25H4
29R32A37P5 42D45V46S6 OLIGO# 2 OLIGO# 4 OLIGO# B39 SEQ ID NO: 16
SEQ ID NO: 18 SEQ ID NO: 208 Example 112 pMON13399 pMON13388/
23ALA1 29V32R34S2 42D45V46S3 23A, polypeptide B43 SEQ ID NO: NcoI,
EcoRV OLIGO# B26 OLIGO# B28 OLIGO# B36 29V SEQ ID NO: 306 374 SEQ
ID NO: 195 SED ID NO: 197 SEQ ID NO: 207 32R 23ALA4 29V32R34S5
42D45V46S6 34S OLIGO# B27 OLIGO# B29 OLIGO# B39 42D SEQ ID NO: 196
SEQ ID NO: 198 SEQ ID NO: 208 46S Example 113 pMON13404 pMON13287/
S9E2Q6V1 S116VD31 15-119 polypeptide B44 SEQ ID NO: EcoRI, HindIII
OLIGO# B54 OLIGO# B52 112Q SEQ ID NO: 307 375 SEQ ID NO: 223 SEQ ID
NO: 221 S9E2Q6V3 SECR1D33 OLIGO# B55 OLIGO# 53 SEQ ID NO: 224 SEQ
ID NO: 222 Example 114 pMON13387 pMON13287/ 50ASP1 60S62V2 67N69E3
50D polypeptide B45 SEQ ID NO: EcoRV, NsiI OLIGO# B40 OLIGO# 27
OLIGO# 31 SEQ ID NO: 308 376 SEQ ID NO: 209 SEQ ID NO: 41 SEQ ID
NO: 45 50ASP4 60S62V5 67N69E6 OLIGO# B41 OLIGO# 28 OLIGO# 32 SEQ ID
NO: 210 SEQ ID NO: 42 SEQ ID NO: 46 Example 115 pMON13416
pMON13387/ 18I25H1 29R32A37P2 42D45V46S3 42D, polypeptide B46 SEQ
ID NO: NcoI/EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B38 46S SEQ ID NO: 309
377 SEQ ID NO: 15 SEQ ID NO: 17 SEQ ID NO: 207 50D 18I25H4
29R32A37P5 42D45V46S6 OLIGO# 2 OLIGO# 4 OLIGO# B39 SEQ ID NO: 16
SEQ ID NO: 18 SEQ ID NO: 208 Example 116 pMON13417 pMON13387/
18I25H1 29R32A37P2 42D45M46S3 42D, polypeptide B47 SEQ ID NO:
NcoI/EcoRV OLIGO# 1 OLIGO# 3 OLIGO# B36 45M SEQ ID NO: 310 378 SEQ
ID NO: 15 SEQ ID NO: 17 SEQ ID NO: 205 46S 18I25H4 29R32A37P5
42D45M4656 50D OLIGO# 2 OLIGO# 4 OLIGO# B37 SEQ ID NO: 16 SEQ ID
NO: 18 SEQ ID NO: 206 Example 117 pMON13420 pMON13388/ 23ALA1
34SER1 42D45V46S3 23A, polypeptide B48 SEQ ID NO: NcoI, EcoRV
OLIGO# B26 OLIGO# B30 OLIGO# B38 34S SEQ ID NO: 311 379 SEQ ID NO:
195 SEQ ID NO: 199 SEQ ID NO: 207 42D 23ALA4 34SERS 42D45V46S6 46S
OLIGO# B27 OLIGO# B31 OLIGO# B39 50D SEQ ID NO: 196 SEQ ID NO: 200
SEQ ID NO: 208 56S Example 118 pMON13421 pMON13388/ 23ALA1 34SER1
42D45M46S3 23A, polypeptide B49 SEQ ID NO: NcoI, EcoRV OLIGO# B26
OLIGO# B30 OLIGO# B36 34S SEQ ID NO: 331 380 SEQ ID NO: 195 SEQ ID
NO: 199 SEQ ID NO: 205 42D 23ALA4 34SER5 42D45M46S6 45M OLIGO# B27
OLIGO# B31 OLIGO# B37 46S SEQ ID NO: 196 SEQ ID NO: 200 SEQ ID NO:
206 50D 56S Example 119 pMON13432 pMON13387/ 23ALA1 34SER1
42D45M46S3 23A, polypeptide B50 SEQ ID NO: NcoI, EcoRV OLIGO# B26
OLIGO# B30 OLIGO# B36 34S SEQ ID NO: 312 381 SEQ ID NO: 195 SEQ ID
NO: 199 SEQ ID NO: 205 42D 23ALA4 34SER5 42D45M46S6 45M OLIGO# B27
OLIGO# B31 OLIGO# B37 46S SEQ ID NO: 196 SEQ ID NO: 200 SEQ ID NO:
206 50D Example 120 pMON13382 pMON13287/ 9E12Q6W1 120Q123E2 112Q,
polypeptide B51 SEQ ID NO: EcoRI, HindIII OLIGO# B46 OLIGO# 49 116W
SEQ ID NO: 313 382 SEQ ID NO: 215 SEQ ID NO: 63 9E12Q16W3 120Q123E4
OLIGO# B47 OLIGO# 50 SEQ ID NO: 216 SEQ ID NO: 64
[1217]
77TABLE 9 Parental Plasmid/ Restriction Amino acid Example No.
Plasmid Digest Oligo pair Oligo pair Oligo pair Oligo pair changes
Polypeptide Example 124 pMON13400 pMON13288 20P23A1 29I4S7S2
38A5V6S3 20P 23A Polypeptide C-2 SEQ ID NO: Restriction SEQ ID NO:
232 SEQ ID NO: 236 SEQ ID NO: 238 29I 34S SEQ ID NO: 317 384
NcoI-EcoRV 20P23A4 29I4S7S5 38A5V6S3 37S 38A SEQ ID NO: 233 SEQ ID
NO: 237 SEQ ID NO: 239 45V 46S Example 125 pMON13402 pMON13288 23L1
29I4S7S2 38A5V6S3 23L 29I Polypeptide C-3 SEQ ID NO: Restriction
SEQ ID NO: 234 SEQ ID NO: 236 SEQ ID NO: 238 34S 37S SEQ ID NO: 318
385 NcoI-EcoRV 23L4 29I4S7S5 38A5V6S3 38A 45V 46S SEQ ID NO: 235
SEQ ID NO: 237 SEQ ID NO: 239 Example 131 pMON13440 pMON13288
18I3A5H1 29I4S7S2 38A5V6S3 18I 23A 25H Polypeptide C-10 SEQ ID NO:
Restriction SEQ ID NO: 195 SEQ ID NO: 236 SEQ ID NO: 238 29I 34S
37S SEQ ID NO: 319 386 NcoI-EcoRV 18I3A5H4 29I4S7S5 38A5V6S3 38A
45V 46S SEQ ID NO: 196 SEQ ID NO: 237 SEQ ID NO: 239 Example 132
pMON13451 pMON13288 19I0L3A1 29I4S7S2 38A5V6S3 19I 20L 23A
Polypeptide C-11 SEQ ID NO: Restriction SEQ ID NO: 230 SEQ ID NO:
236 SEQ ID NO: 238 29I 34S 37S SEQ ID NO: 320 387 NcoI-EcoRV
19I0L3A4 29I4S7S5 38A5V6S3 38A 45V 46S SEQ ID NO: 231 SEQ ID NO:
237 SEQ ID NO: 239 Example 130 pMON13419 pMON13288 50D51S1 62P3H5S2
67Q3 50D 51S 62P Polypeptide C-8 SEQ ID NO: Restriction SEQ ID NO:
240 SEQ ID NO: 244 SEQ ID NO: 248 63H SEQ ID NO: 325 389 EcoRV-NsiI
50D51S4 62P3H5 65S67Q6 65S 67Q SEQ ID NO: 241 SEQ ID NO: 246 SEQ ID
NO: 247 Example 126 pMON13403 pMON13288 50D51S1 62P3H2 67Q3 50D 51S
Polypeptide C-4 SEQ ID NO: Restriction SEQ ID NO: 240 SEQ ID NO:
245 SEQ ID NO: 248 62P 63H SEQ ID NO: 321 388 EcoRV-NsiI 50D51S4
62P3H5 67Q6 67Q SEQ ID NO: 241 SEQ ID NO: 246 SEQ ID NO: 249
Example 123 pMON13418 pMON13288 76P1 79S2 5VYWPTT3 101A105Q4 76P
79S Polypeptide C-1 SEQ ID NO: Restriction SEQ ID NO: 250 SEQ ID
NO: 252 SEQ ID NO: 242 SEQ ID NO: 85V 87Y SEQ ID NO: 326 393
Neil-EcoRI 76P5 79S6 5VYWPTT7 57 88W 91P SEQ ID NO: 251 SEQ ID NO:
253 SEQ ID NO: 243 101A105Q8 95T 98T SEQ ID NO: 58 Example 127
pMON13411 pMON13288 09L2Q6S1 120Q123E2 109L 112Q Polypeptide C-5
SEQ ID NO: Restriction Seq ID NO: 227 SEQ ID NO: 63 116S SEQ ID NO:
322 390 EcoRI- 09L2Q6S3 120Q123E4 HindIII SEQ ID NO: 228 SEQ ID NO:
64 Example 128 pMON13412 pMON13288 9LQS1181 15-118 Polypeptide C-6
SEQ ID NO: Restriction Seq ID NO: 255 109L 112Q SEQ ID NO: 323 391
EcoRI- 9LQS1183 116S HindIII SEQ ID NO: 256 Example 129 pMON13413
pMON13288 09L2Q6S1 117S2 109L 112Q Polypeptide C-7 SEQ ID NO:
Restriction Seq ID NO: 227 SEQ ID NO: 229 116S 117S SEQ ID NO: 324
392 EcoRI- 09L2Q6S3 120Q123E4 HindIII SEQ ID NO: 228 SEQ ID NO:
64
[1218]
78TABLE 10 Parental plasmid/ Restriction Restriction Amino Acid
Example No Plasmid digest fragment changes Polypeptide Example 133
pMON13428 pMON13411 102 bp 76P 79S 85V Polypeptide SEQ ID
NsiI-EcoRI NsiI-EcoRI 87Y 91P 95T C-9 NO: 394 fragment from 98T
109L SEQ ID pMON13418 112Q 116S NO: 327 Example 134 pMON13459
pMON13428 170 bp 23L 29I 34S Polypeptide SEQ ID NcoI-NsiI NcoI-NsiI
37S 38A 45V C-12 NO: 395 fragment from 46S 76P 79S SEQ ID pMON13402
85V 87Y 91P NO: 328 95T 98T 109L 112Q 116S Example 135 pMON13467
pMON13413 170 bp 23L 29I 34S Polypeptide SEQ ID NcoI-NsiI NcoI-NsiI
37S 38A 45V C-13 NO: 396 fragment from 46S 109L SEQ ID pMON13402
112Q 116S NO: 329 109L 112Q 116S 117S Example 136 pMON13492
pMON13418 170 bp 23L 29I 34S Polypeptide SEQ ID NcoI-NsiI NcoI-NsiI
37S 38A 45V C-14 NO: 397 fragment from 46S 76P 79S SEQ ID pMON13402
85V 87Y 91P NO: 330 95T 98T
* * * * *