U.S. patent application number 10/366123 was filed with the patent office on 2003-11-27 for gene transfer for treating a connective tissue of a mammalian host.
This patent application is currently assigned to University of Pittsburgh of the Commonwealth System of Higher Education. Invention is credited to Evans, Christopher H., Ghivizzani, Steven C., Glorioso, Joseph C., Robbins, Paul D..
Application Number | 20030220283 10/366123 |
Document ID | / |
Family ID | 27363092 |
Filed Date | 2003-11-27 |
United States Patent
Application |
20030220283 |
Kind Code |
A1 |
Glorioso, Joseph C. ; et
al. |
November 27, 2003 |
Gene transfer for treating a connective tissue of a mammalian
host
Abstract
Methods for treating a connective tissue disorder by introducing
at least one gene encoding a product into at least one target cell
of a mammalian host for use in treating the mammalian host are
disclosed. These methods include employing recombinant techniques
to produce a vector molecule containing the DNA sequence encoding
for the product and infecting the target cell of the mammalian host
using the vector. The injection can be done in vivo, by directly
injecting the vector into the host, or can be done in vitro by
transfecting a population of cultured target cells with the vector
and transplanting them each into the host. Nonviral means can also
be used to introduce the DNA sequence to the host. Administration
of more than one gene of interest results in an enhanced
therapeutic benefit. Also disclosed is a method for treating a
connective tissue disorder by introducing at least one gene
encoding a product into at least one target cell of a joint of a
host for use in treating multiple joints of the host. Injection of
a vector molecule containing the DNA sequence encoding for a
product of interest, or non-viral introduction of such a DNA
sequence, to one joint of a mammalian host results in a therapeutic
benefit in that joint as well as other joints in the host.
Inventors: |
Glorioso, Joseph C.;
(Cheswick, PA) ; Evans, Christopher H.;
(Pittsburgh, PA) ; Robbins, Paul D.; (Pittsburgh,
PA) ; Ghivizzani, Steven C.; (Allison Park,
PA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
University of Pittsburgh of the
Commonwealth System of Higher Education
911 William Pitt Union
Pittsburgh
PA
15260
|
Family ID: |
27363092 |
Appl. No.: |
10/366123 |
Filed: |
February 12, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10366123 |
Feb 12, 2003 |
|
|
|
09626597 |
Jul 27, 2000 |
|
|
|
09626597 |
Jul 27, 2000 |
|
|
|
08924376 |
Sep 5, 1997 |
|
|
|
6159464 |
|
|
|
|
08924376 |
Sep 5, 1997 |
|
|
|
08685212 |
Jul 23, 1996 |
|
|
|
6228356 |
|
|
|
|
08685212 |
Jul 23, 1996 |
|
|
|
08027750 |
Mar 8, 1993 |
|
|
|
08027750 |
Mar 8, 1993 |
|
|
|
07630981 |
Dec 20, 1990 |
|
|
|
Current U.S.
Class: |
514/44R ;
424/93.21; 536/23.5 |
Current CPC
Class: |
C07K 14/715 20130101;
C12N 2740/13043 20130101; A61K 48/005 20130101; A61K 48/00
20130101; A01K 2267/03 20130101; A01K 67/0271 20130101; C12N
15/8509 20130101; C12N 15/86 20130101; A01K 2267/01 20130101; Y10S
514/825 20130101; A01K 2227/107 20130101; C07K 14/545 20130101;
A01K 2207/15 20130101; A01K 2217/00 20130101; A61K 38/00 20130101;
C12N 2740/13045 20130101; A01K 2217/05 20130101 |
Class at
Publication: |
514/44 ;
424/93.21; 536/23.5 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
What is claimed is:
1. A method for treating a connective tissue disorder comprising:
a) generating a recombinant vector that comprises at least one DNA
sequence encoding one or more genes of interest; and b) infecting a
population of target cells in vivo in a host with said recombinant
vector, such that subsequent expression of said gene or genes
within said host reduces at least one deleterious joint pathology
or indicia of inflammation normally associated with a connective
tissue disorder; wherein said gene of interest is one or more
therapeutic genes selected from the group consisting of:
interleukin-1 receptor antagonist protein; a LacZ marker gene;
soluble IL-1 receptor; soluble TNF-.alpha. receptor; a proteinase
inhibitor; a cytokine; CTLA4; FasL; and biologically active
derivatives or fragments of these genes.
2. The method of claim 1, wherein said target cell is selected from
the group consisting of connective tissue cells and non-connective
tissue cells.
3. The method of claim 2, wherein said connective tissue cells are
selected from the group consisting of synovium, cartilage, tendon,
ligament, skin, meniscus, bone, and intervertebral disc cells, and
said non-connective tissue cells are selected from the group
consisting of hematopoietic progenitor cells, stromal cells, bone
marrow cells, myoblasts, leukocytes, lymphoid cells and myeloid
cells.
4. The method of claim 3, wherein said cytokine is one or more
members selected from the group consisting of IL-4, IL-10, IL-13,
growth factor, and BMP.
5. The method of claim 4, wherein said BMP is selected from the
group consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6,
BMP-7, BMP-8 and BMP-9.
6. The method of claim 5, wherein said BMP is selected from the
group consisting of BMP-2 and BMP-7.
7. The method of claim 3, wherein said cytokine is vIL-10.
8. The method of claim 3, wherein said cytokine is growth
hormone.
9. The method of claim 4, wherein said growth factor is selected
from the group consisting of IGF, FGF and TGF.
10. The method of claim 9, wherein said growth factor is selected
from the group consisting of IGF-1 and IGF-2.
11. The method of claim 3, wherein said soluble interleukin-1
receptor is selected from the group consisting of soluble
interleukin-1 receptor Type I and soluble interleukin-1 receptor
Type II.
12. The method of claim 3, wherein said soluble TNF-.alpha.
receptor is selected from the group consisting of soluble
TNF-.alpha. receptor Type I and soluble TNF-.alpha. receptor Type
II.
13. The method of claim 3, wherein said proteinase inhibitor is
selected from the group consisting of TIMP-1, TIMP-2, TIMP-3,
TIMP-4, PAIs and serpins.
14. The method of claim 1, wherein said recombinant vector is
selected from the group consisting of a viral vector and a
non-viral vector.
15. The method of claim 14, wherein said viral vector is selected
from the group consisting of a retroviral vector, an
adeno-associated viral vector, adenovirus and a herpes viral
vector.
16. The method of claim 15, including employing a retrovirus
selected from the group consisting MFG and pLJ.
17. The method of claim 14, wherein said recombinant vector is a
plasmid DNA vector.
18. The method of claim 1, wherein infection is accomplished by
intraarticular injection of the recombinant vector.
19. The method of claim 18, wherein the recombinant vector is an
adenoviral vector and the gene encodes for a member selected from
the group consisting of IRAP; soluble interleukin-1 receptor;
soluble TNF-.alpha. receptor; and a cytokine selected from the
group consisting of IL-10 and vIL-10.
20. The method of claim 18, wherein the recombinant vector is one
or more adenoviral vectors containing genes encoding soluble
TNF-.alpha. receptor and soluble interleukin-1 receptor.
21. The method of claim 1, wherein the target cells are infected in
an area selected from the group consisting of a joint space, bone
marrow and bloodstream of said host.
22. A method for treating a connective tissue disorder comprising:
introducing at least one DNA sequence encoding one or more genes of
interest into at least one target cell of a host by employing
non-viral means selected from the group consisting of at least one
liposome, calcium phosphate, electroporation, DEAE-dextran, and
direct injection of naked DNA, such that subsequent expression of
said gene or genes within said host reduces at least one
deleterious joint pathology or indicia of inflammation normally
associated with a connective tissue disorder; wherein said gene of
interest is one or more therapeutic genes selected from the group
consisting of: interleukin-1 receptor antagonist protein; a LacZ
marker gene; soluble IL-1 receptor; soluble TNF-.alpha. receptor; a
proteinase inhibitor; a cytokine; CTLA4; FasL; and biologically
active derivatives or fragments of these genes.
23. The method of claim 22, including employing a liposome selected
from the group consisting of DC-cholesterol and SF-cholesterol.
24. A method for treating a connective tissue disorder comprising:
a) generating a recombinant vector that comprises at least one DNA
sequence encoding one or more genes of interest; b) infecting a
population of target cells in vivo in a first joint of a host with
said recombinant vector, such that subsequent expression of said
gene or genes in said host reduces at least one deleterious joint
pathology or indicia of inflammation normally associated with a
connective tissue disorder both in said first joint and in one or
more additional joints in the host; wherein said gene of interest
is one or more therapeutic genes selected from the group consisting
of: interleukin-1 receptor antagonist protein; a LacZ marker gene;
soluble IL-1 receptor; soluble TNF-.alpha. receptor; a proteinase
inhibitor; a cytokine; CTLA4; FasL; and biologically active
derivatives or fragments of these genes.
25. The method of claim 24, wherein said target cell is selected
from the group consisting of connective tissue cells and
non-connective tissue cells.
26. The method of claim 25, wherein said connective tissue cells
are selected from the group consisting of synovium, cartilage,
tendon, ligament, skin, meniscus, bone, and intervertebral disc
cells, and said non-connective tissue cells are selected from the
group consisting of hematopoietic progenitor cells, stromal cells,
bone marrow cells, myoblasts, leukocytes, lymphoid cells and
myeloid cells.
27. The method of claim 26, wherein said cytokine is one or more
members selected from the group consisting of IL-4, IL-10, IL-13,
growth factor, and BMP.
28. The method of claim 27, wherein said BMP is selected from the
group consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6,
BMP-7, BMP-8 and BMP-9.
29. The method of claim 28, wherein said BMP is selected from the
group consisting of BMP-2 and BMP-7.
30. The method of claim 26, wherein cytokine is vIL-10.
31. The method of claim 26, wherein said cytokine is growth
hormone.
32. The method of claim 27, wherein said growth factor is selected
from the group consisting of IGF, FGF and TGF.
33. The method of claim 32, wherein said growth factor is selected
from the group consisting of IGF-1 and IGF-2.
34. The method of claim 26, wherein said soluble interleukin-1
receptor is selected from the group consisting of soluble
interleukin-1 receptor Type I and soluble interleukin-1 receptor
Type II.
35. The method of claim 26, wherein said soluble TNF-.alpha.
receptor is selected from the group consisting of soluble
TNF-.alpha. receptor Type I and soluble TNF-.alpha. receptor Type
II.
36. The method of claim 26, wherein said proteinase inhibitor is
selected from the group consisting of TIMP-1, TIMP-2, TIMP-3,
TIMP-4, PAIs and serpins.
37. The method of claim 24, wherein said recombinant vector is
selected from the group consisting of a viral vector and a
non-viral vector.
38. The method of claim 37, wherein said viral vector is selected
from the group consisting of a retroviral vector, an
adeno-associated viral vector, adenovirus and a herpes viral
vector.
39. The method of claim 38, including employing a retrovirus
selected from the group consisting MFG and pLJ.
40. The method of claim 37, wherein said recombinant vector is a
plasmid DNA vector.
41. The method of claim 24, wherein infection is accomplished by
intraarticular injection of the recombinant vector.
42. The method of claim 41, wherein the recombinant vector is an
adenoviral vector and the gene encodes for a member selected from
the group consisting of IRAP; soluble interleukin-1 receptor;
soluble TNF-.alpha. receptor; and a cytokine selected from the
group consisting of IL-10 and vIL-10.
43. The method of claim 41, wherein the recombinant vector is one
or more adenoviral vectors containing genes encoding soluble
TNF-.alpha. receptor and soluble interleukin-1 receptor.
44. The method of claim 24, wherein the target cells are infected
in an area selected from the group consisting of a joint space,
bone marrow and bloodstream of said host.
45. A method for treating a connective tissue disorder comprising
introducing at least one DNA sequence encoding one or more genes of
interest into at least one target cell in vivo in a first joint of
a host by employing non-viral means selected from the group
consisting of at least one liposome, calcium phosphate,
electroporation, DEAE-dextran, and direct injection of naked DNA,
such that subsequent expression of said gene or genes in said host
reduces at least one deleterious joint pathology or indicia of
inflammation normally associated with a connective tissue disorder
both in the first joint and in one or more additional joints in the
host; wherein said gene of interest is one or more therapeutic
genes selected from the group consisting of: interleukin-1 receptor
antagonist protein; a LacZ marker gene; soluble IL-1 receptor;
soluble TNF-.alpha. receptor; a proteinase inhibitor; a cytokine;
CTLA4; FasL; and biologically active derivatives or fragments of
these genes.
46. The method of claim 22, including employing a liposome selected
from the group consisting of DC-cholesterol and SF-cholesterol.
47. The method of claim 15, including employing a high titer
concentration of retroviral vector.
48. The method of claim 38, including employing a high titer
concentration of retroviral vector.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This is a continuation-in-part application of U.S.
application Ser. No. 08/685,212, filed Jul. 23, 1996, which is a
continuation of U.S. application Ser. No. 08/027,750, filed Mar. 8,
1993, now abandoned, which was a continuation-in-part of U.S.
application Ser. No. 07/630,981, filed Dec. 20, 1990, now
abandoned.
BACKGROUND OF THE INVENTION
[0002] 1. Field Of The Invention
[0003] The present invention relates to a method of introducing at
least one gene encoding a product of interest into at least one
cell of a mammalian host for use in treating the mammalian host.
This method discloses employing vector molecules containing a gene
encoding the product and infecting the target cells of the
mammalian host using the vector molecule. Both viral and non-viral
means call be used for effecting introduction of the gene into the
host.
[0004] Numerous methods are within the scope of the invention for
effecting introduction of a gene into a host. For example, in vivo
methods can be employed to inject a DNA sequence encoding the
product of interest into the host, such as through the use of a
viral or non-viral vector containing the DNA sequence(s) of
interest.
[0005] Alternatively, the gene encoding the product of interest can
be associated with liposomes and injected directly into the host,
such as in the area of the joint, where the liposomes fuse with
target cells, resulting in an in vivo gene transfer to the
connective tissue. In another embodiment, the gene encoding the
product of interest is introduced into the area of the joint as
naked DNA. The naked DNA enters the target cells, resulting in an
in vivo gene transfer to the cells.
[0006] In vitro methods of introducing a gene of interest into a
host are also within the scope of this invention. For example, the
host's own connective tissue cells can be transduced in vitro with
the gene of interest and introduced back into the host, such as
through intraarticular injection or other methods known to those
skilled in the art.
[0007] As an alternative, non-connective tissue cells such as
hematopoietic progenitor cells, stromal cells, bone marrow cells,
myoblasts, leukocytes and mature lymphoid or myeloid cells may be
transfected in vitro, recovered, and injected into the bone marrow
or bloodstream of the host using techniques known to the skilled
artisan.
[0008] The present invention also relates to a method for treating
a connective tissue of a host by introduction of at least one gene
encoding a product of interest to at least one joint of the host,
such that a therapeutic benefit is realized both in the treated
joint and in untreated joints of the same host.
[0009] The methods of the present invention for introducing a gene
of interest into a host result in the expression of the gene within
the host such that a therapeutic benefit is realized. Such benefit
can be seen not only in the targeted )o joint, but in other joints
of the host as well. Enhanced therapeutic benefits are realized
when two or more genes are used together.
BRIEF DESCRIPTION OF THE RELATED ART
[0010] Arthritis involves inflammation of a joint that is usually
accompanied by pain and frequently changes in structure. Arthritis
may result from or be associated with a number of conditions
including infection, immunological disturbances, trauma and
degenerative joint diseases, such as osteoarthritis. The
biochemistry of cartilage degradation in joints and cellular
changes have received considerable investigation.
[0011] In a healthy joint, cells in cartilage (chondrocytes) and
the surrounding synovium (synoviocytes) are in a resting state. In
this resting state, these cells secrete basal levels of
prostaglandins, cytokines and various proteinases, such as
collagenase, gelatinase and stromelysin, with the ability to
degrade cartilage. During the development of an arthritic
condition, these cells become activated. In the activated state,
synoviocytes and chondrocytes synthesize and secrete large amounts
of prostaglandins, cytokines and proteinases.
[0012] In efforts to identify pathophysiologically relevant cell
activators, it has been known that the cytokine interleukin-1
activates chondrocytes and synoviocytes and induces cartilage
breakdown in vitro and in vivo. Additionally, interleukin-1 is a
growth factor for synoviocytes and promotes their synthesis of
matrix, two properties suggesting the involvement of interleukin-1
in the synovial hypertrophy that accompanies arthritis. In
contrast, interleukin-1 inhibits cartilaginous matrix synthesis by
chondrocytes, thereby suppressing repair of cartilage.
Interleukin-1 also induces bone resorption and thus may account,
for the loss of bone density seen in rheumatoid arthritis.
Interleukin-1 is inflammatory, serves as a growth factor for
lymphocytes, is a chemotactic factor and a possible activator of
polymorphonuclear leukocytes (PMNs). When present in a sufficient
concentration, interleukin-1 may cause fever, muscle wasting and
sleepiness.
[0013] The major source of interleukin-1 in the joint is the
synovium. Interleukin-1 is secreted by the resident synoviocytes,
which, are joined under inflammatory conditions by macrophages and
other white blood cells.
[0014] Much attention has been devoted to the development of a
class of agents identified as the "Non-Steroidal Anti-Inflammatory
Drugs" (hereinafter "NSAIDs"). The NSAIDs inhibit cartilage
synthesis and repair and control inflammation. The mechanism of
action of the NSAIDs appears to be associated principally with the
inhibition of prostaglandin synthesis in body tissues. Most of this
development has involved the synthesis of better inhibitors of
cyclo-oxygenase, a key enzyme that catalyzes the formation of
prostaglandin precursors (endoperoxides) from arachidonic acid. The
anti-inflammatory effect of the NSAIDs is thought to be due in part
to inhibition of prostaglandin synthesis and release during
inflammation. Prostaglandins are also believed to play a role in
modulating the rate and extent of leukocyte infiltration during
inflammation. The NSAIDs include drugs such as acetylsalicylic acid
(aspirin), fenoprofen calcium (Nalfon.RTM. Pulvules.RTM., Dista
Products Company), ibuprofen (Motrin.RTM., The Upjohn Company), and
indomethacin (Indocin.RTM., Merck and Company, Inc.).
[0015] Therapeutic intervention in arthritis is hindered by the
inability to target drugs, such as the NSAIDs, to specific areas
within a mammalian host, such as a joint. Traditional routes of
drug delivery, such as oral, intravenous or intramuscular
administration, depend upon vascular perfusion of the synovium to
carry the drug to the joint. This is inefficient because
transynovial transfer of small molecules from the synovial
capillaries to the joint space occurs generally by passive
diffusion. This diffusion is less efficient with increased size of
the target molecule. Thus, the access of large drug molecules, for
example, proteins, to the joint space is substantially restricted.
Intra-articular injection of drugs circumvents those limitations;
however, the half-life of drugs administered intraarticularly is
generally short. Another disadvantage of intra-articular injection
of drugs is that frequent repeated injections are necessary to
obtain acceptable drug levels at the joint spaces for treating a
chronic condition such as, for example, arthritis. Because
therapeutic agents heretofore could not be selectively targeted to
joints, it was necessary to expose the mammalian host to
systemically high concentrations of drugs in order to achieve a
sustained, intra-articular therapeutic dose. Exposure of non-target
organs in this manner exacerbated the tendency of anti-arthritis
drugs to produce serious side effects, such as gastrointestinal
upset and changes in the hematological, cardiovascular, hepatic and
renal systems of the mammalian host.
[0016] It has been shown that genetic material can be introduced
into mammalian cells by chemical or biological means. Moreover, the
introduced genetic material can be expressed so that high levels of
a specific protein can be synthesized by the host cell. Cells
retaining the introduced genetic material may include an antibiotic
resistance gene thus providing a selectable marker for preferential
growth of the transduced cell in the presence of the corresponding
antibiotic. Chemical compounds for inhibiting the production of
interleukin-1 are also known.
[0017] U.S. Pat. No. 4,778,806 discloses a method of inhibiting the
production of interleukin-1 by monocytes and/or macrophages in a
human by administering through the parenteral route a
2-2'-[1,3-propan-2-onediyl-b- is (thio)] bis-1 H-imidazole or a
pharmaceutically acceptable salt thereof. This patent discloses a
chemical compound for inhibiting the production of interleukin-1.
By contrast, in one embodiment of the present invention, gene
therapy is employed that is capable of binding to and neutralizing
interleukin-1.
[0018] U.S. Pat. No. 4,780,470 discloses a method of inhibiting the
production of interleukin-l by monocytes in a human by
administering a 4,5-diaryl-2 (substituted) imidazole. This patent
also discloses a chemical compound for inhibiting the production of
interleukin-1.
[0019] U.S. Pat. No. 4,794,114 discloses a method of inhibiting the
5-lipoxygenase pathway in a human by administering a
diaryl-substituted imidazole fused to a thiazole, pyrolidine or
piperidine ring or a pharmaceutically acceptable salt thereof. This
patent also discloses a chemical compound for inhibiting the
production of interleukin-1.
[0020] U.S. Pat. No. 4,870,101 discloses a method for inhibiting
the release of interleukin-1 and for alleviating interleukin-t
mediated conditions by administering an effective amount of a
pharmaceutically acceptable anti-oxidant compound such as
disulfiram, tetrakis [3-(2,6-di-tert-butyl-4-hydroxyphenyl)
propionyloxy methyl] methane or
2,4-di-isobutyl-6-(N,N-dimethylamino methyl)-phenol. This patent
discloses a chemical compound for inhibiting the release of
interleukin-1.
[0021] U.S. Pat. No. 4,816,436 discloses a process for the use of
interleukin-1 as an anti-arthritic agent. This patent states that
interleukin-1, in association with a pharmaceutical carrier, may be
administered by intra-articular injection for the treatment of
arthritis or inflammation. In contrast, the present invention
discloses a method of using and preparing a gene that is capable of
binding to and neutralizing interleukin-1 as a method of resisting
arthritis.
[0022] U.S. Pat. No. 4,935,343 discloses an immunoassay method for
the detection of interleukin-1 beta that employs a monoclonal
antibody that binds to interleukin-1 beta but does not bind to
interleukin-1 beta. This patent discloses that the monoclonal
antibody binds to interleukin-1 beta and blocks the binding of
interleukin-1 beta to interleukin-l receptors, and thus blocking
the biological activity of interleukin-1 beta. The monoclonal
antibody disclosed in this patent nay be obtained by production of
an immunogen through genetic engineering using recombinant DNA
technology. The immunogen is injected into a mouse and there-after
spleen cells of the mouse are immortalized by fusing the spleen
cells with myeloma cells. The resulting cells include the hybrid
continuous cell lines (hybridomas) that may be later screened for
monoclonal antibodies. This patent states that the monoclonal
antibodies of the invention may be used therapeutically, such as
for example, in the immunization of a patient, or the monoclonal
antibodies may be bound to a toxin to form an immunotoxin or to a
radioactive material or drug to form a radio pharmaceutical or
pharmaceutical.
[0023] U.S. Pat. No. 4,766,069 discloses a recombinant DNA cloning
vehicle having a DNA sequence comprising the human interleukin-1
gene DNA sequence. This patent provides a process for preparing
human interleukin-1 beta, and recovering the human interleukin-1
beta. This patent discloses use of interleukin-1 as an
immunological reagent in humans because of its ability to stimulate
T-cells and B-cells and increase immunoglobulin synthesis.
[0024] U.S. Pat. No. 4,396,601 discloses a method for providing
mammalian hosts with additional genetic capability. This patent
provides that host cells capable of regeneration are removed from
the host and treated with genetic material including at least one
marker which allows for selective advantage for the host cells in
which the genetic material is capable of expression and
replication. This patent states that the modified host cells are
then returned to the host under regenerative conditions.
[0025] U.S. Pat. No. 4,968,607 discloses a DNA sequence encoding a
mammalian interleukin-1 receptor protein which exhibits
interleukin-1 binding activity.
[0026] U.S. Pat. No. 5,081,228 discloses a DNA sequence encoding
both the murine and human interleukin-1 receptor. This patent also
provides a process for the in vitro expression of said DNA
sequences.
[0027] Patent Application WO9634955 discloses a method of treating
an arthritic condition using recombinantly modified articular
chondrocytes.
[0028] U.S. Pat. No. 5,643,752 discloses a host cell transformed
with an expression vector containing nucleic acid amino acids
30-224 of the TIMP-4 polypeptide.
[0029] Patent Application WO9723639 discloses expression vectors
containing DNA encoding a protein having the formula A-X-B, where A
and B are subunits of a dimeric protein or are each a biologically
active protein; X is a linker polypeptide. Transformed hosts
containing the vectors are also disclosed. The method reportedly
can be used for the production of interleukin-12 using DNA coding
for the 40 Kd and 35 Kd subunits of IL-12, joined by a suitable
linker.
[0030] Patent Application WO9700958 discloses an isolated nucleic
acid encoding pCL13, a member of TGF-.beta. family member, having
immunosuppressant, cell differentiation promoting and
anti-proliferative activities.
[0031] In spite of these disclosures, there remains a very real and
substantial need for a method for introducing at least one gene
encoding a product of interest into at least one cell of a
mammalian host in vitro, or alternatively in vivo, for use in
treating the mammalian host. There is also a need for such a method
in which treatment of one joint results in a therapeutic benefit
being realized in non-treated joints as well.
SUMMARY OF THE INVENTION
[0032] The present invention has met the above described needs by
providing methods for introducing at least one gene encoding a
product into at least one cell of a mammalian host for use in
treating the mammalian host. These methods include employing
recombinant techniques to produce a vector molecule containing the
gene encoding for the product of interest, and infecting the target
cell of the mammalian host with the vector molecule containing the
gene. The vector molecule can be any molecule capable of being
delivered and maintained within the target cell or tissue such that
the gene encoding the product of interest can be stably expressed.
The vector molecule preferably utilized in the present invention is
either a viral or retroviral vector molecule or a plasmid DNA
non-viral molecule. This method preferably includes introducing the
gene encoding the product into the cell of the mammalian connective
tissue for a therapeutic or prophylactic use. Unlike previous
pharmacological efforts, the methods of the present invention
employ gene therapy to address the chronic debilitating effects of
joint pathologies.
[0033] More specifically, the methods of the present invention
include employing one or more genes that encode for at least one of
the members selected from the group consisting of (a) a human
interleukin-1 receptor antagonist protein (IRAP); (b) a Lac Z
marker gene capable of encoding a beta-galactosidase protein; (c) a
soluble interleukin-1 receptor protein (sIL-1R); (d) a soluble
TNF-.alpha. receptor protein (sTNF-.alpha.R); (e) a proteinase
inhibitor; (f) a therapeutic cytokine; (g) CTLA4; (h) FasL; (i) an
anti-adhesion molecule; and (j) a free radical antagonist.
Biologically active derivatives and fragments of these genes and/or
the proteins they encode are also within the scope of the present
invention.
[0034] The viral vectors used in the methods of the present
invention can be selected from the group consisting of (a) a
retroviral vector, such as MFG or pLJ; (b) an adeno-associated
virus; (c) an adenovirus; and (d) a herpes virus, including but not
limited to herpes simplex 1 or herpes simplex 2.
[0035] Alternatively, a non-viral vector, such as a DNA plasmid
vector, can be used. Any DNA plasmid vector known to one of
ordinary skill in the art capable of stable maintenance within the
targeted cell or tissue upon delivery, regardless of the method of
delivery utilized is within the scope of the present invention.
[0036] Non-viral means for introducing the gene encoding for the
product into the target cell are also within the scope of the
present invention. Such non-viral means can be selected from the
group consisting of (a) at least one liposome, (b)
Ca.sub.3(PO.sub.4).sub.2, (c) electroporation, (d) DEAE-dextran,
and (e) injection of naked DNA.
[0037] An additional method for introducing at least one gene
encoding a product into at least one cell of a mammalian host for
use in treating the mammalian host utilizes biological means such
as a virus. Preferably, the virus is a pseudo-type retrovirus, the
genome having been altered such that the pseudo-type retrovirus is
capable only of delivery and stable maintenance within the target
cell, but not retaining an ability to replicate within the target
cell or tissue. The altered viral genome is further manipulated by
recombinant DNA techniques such that the viral genome acts as a DNA
vector molecule containing the gene of interest to be expressed
within the target cell or tissue.
[0038] A further embodiment of this invention includes a method to
produce an animal model for the study of connective tissue
pathologies which includes introducing at least one gene encoding a
product into at least one cell of a mammalian host.
[0039] In a specific method disclosed as an example of the animal
model, and not as a limitation to the present invention, a DNA
plasmid vector containing the interleukin-1 beta coding sequence
was ligated downstream of the cytomegalovirus (CMV) promoter. This
DNA plasmid construction was encapsulated within liposomes and
injected intraarticularly into the knee joints of recipient
rabbits. Interleukin-1 beta (IL-1.beta.) was expressed and
significant amounts of interleukin-1 beta were recovered from the
synovial tissue. An alternative is injection of the naked plasmid
DNA into the knee joint, allowing direct transfection of the DNA
into the synovial tissue. Injection of IL-1.beta. into the joint of
a mammalian host allows for prolonged study of various joint
pathologies and systemic indices of inflammation, as described
within this specification.
[0040] A preferred method of using the genes of this invention
involves employing recombinant techniques to generate a cell line
which produces infectious retroviral particles containing the gene
encoding for the product of interest. The producer cell line is
generated by inserting the gene into a retroviral vector under the
regulation of a suitable eukaryotic promoter, transfecting the
retroviral vector containing the gene into the retroviral packaging
cell line for the production of a viral particle that is capable of
expressing the gene, and infecting synovial cells of a mammalian
host using the viral particle. Infection can be accomplished
directly by intra-articular injection into a joint space of a
mammalian host that is lined with synovial cells. In a preferred
embodiment, synoviocytes recovered from the knee joint are cultured
in vitro for subsequent utilization as a delivery system for gene
therapy. Other connective tissue cells could also be used, as could
other non-connective tissue cells, such as skin cells, for in vitro
culture techniques. The methods of this invention may be employed
both prophylactically and in the therapeutic treatment of arthritis
in any susceptible joint.
[0041] In another embodiment of this invention, a method of using a
gene coding for the soluble interleukin-1 receptor (sIL-1R)
involves employing recombinant techniques to generate a cell line
which produces infectious viral particles coding for sIL-1R. The
producer cell line is generated by inserting the gene into a viral
vector under the regulation of a suitable eukaryotic promoter,
transfecting the viral vector containing the gene into the viral
packaging cell line for the production of a viral particle capable
of expressing the gene coding for sIL-1R, and infecting target
cells, such as synovial cells, of a mammalian host using the viral
particle. The cells can be infected in culture (ex vivo) with viral
particles and subsequently transplanted back into the joint, or can
be infected in vivo by direct administration of the viral particles
to the host joint. This method may be employed in both prophylactic
and therapeutic treatment of joint pathologies in any area.
[0042] In an example of one embodiment of this invention,
recombinant techniques are used to produce a viral vector carrying
two genes. The first gene encodes the product of interest, such as
the soluble interleukin-1 receptor, and the second gene encodes for
selectable antibiotic resistance. This method of use involves
transfecting the viral vector into a viral packaging cell line to
obtain a cell line producing infectious viral particles carrying
the gene.
[0043] Another embodiment of this invention provides a method for
preparing a gene encoding a product of interest including
synthesizing the gene by a polymerase chain reaction, introducing
the amplified coding sequence into a retroviral vector,
transfecting the retroviral vector into a retrovirus packaging cell
line and collecting viral particles from the retrovirus packaging
cell line.
[0044] In another embodiment of this invention, a compound for
parenteral administration to a patient in a therapeutically or
prophylactically effective amount is provided that contains a gene
encoding a product of interest in a suitable pharmaceutical
carrier.
[0045] In another preferred embodiment of the invention, connective
tissue cells are transfected in vivo following direct
intraarticular injection of a DNA molecule containing the gene of
interest into the joint. Transfection of the recipient tissue cells
according to this embodiment bypasses the requirement of removal,
culturing, in vitro transfection, selection and transplanting the
DNA vector-containing target cells to promote stable expression of
the heterologous gene of interest. Methods of injecting the DNA
molecule into the joint include, but are not limited to,
association of the DNA molecule with cationic liposomes or the
direct injection of the DNA molecule itself into the joint. The DNA
molecule, regardless of the form of presentation to the joint, is
preferably presented as a vector molecule, either as a viral DNA
vector molecule, or more preferably, a DNA plasmid vector molecule.
Expression of the heterologous gene of interest is ensured by
inserting a promoter fragment active in eukaryotic cells directly
upstream of the coding region of the heterologous gene. One of
ordinary skill in the art may utilize known strategies and
techniques of vector construction to ensure appropriate levels of
expression subsequent to entry of the DNA molecule into the host
cells. Alternatively, non-connective tissue cells can be targeted
in vivo in any of the methods described above.
[0046] In another preferred embodiment of this invention, one or
more genes are introduced to a first joint of a patient through any
of the delivery means described throughout the specification.
Expression of the gene(s) in the first joint results in a
therapeutically or prophylactically beneficial effect in the first
joint. Such a beneficial effect is also observed in other joints of
the patient. Thus, the methods of the present invention provide for
direct treatment of joints as well as indirect treatment of
untreated joints of the same patient.
[0047] It is an object of the present invention to provide a method
of introducing at least one gene encoding a product into at least
one cell of a mammalian host for use in treating the mammalian
host.
[0048] It is an object of the invention to provide a method of
introducing a gene encoding a product into at least one cell of a
mammalian host for a therapeutic use.
[0049] It is an object of the present invention to provide a method
of introducing into the synovial lining cells of a mammalian
arthritic joint at least one gene which codes for proteins having
therapeutic properties.
[0050] It is an object of the present invention to provide an
animal model for the study of connective tissue pathology.
[0051] It is an object of the present invention to provide a method
of introducing, by either ex vivo or in vivo methods, a gene coding
for the sIL-1R that is capable of binding to and neutralizing
substantially all isoforms of interleukin-1, including
interleukin-1 alpha and interleukin-1 beta.
[0052] It is an object of the present invention to provide a method
of introducing, by either ex vivo or in vivo methods in a mammalian
host, a gene that is capable of binding to and neutralizing
substantially all isoforms of interleukin-1 and thus substantially
resists the degradation of cartilage and protects surrounding soft
tissues of the joint space.
[0053] It is an object of the present invention to provide a method
of introducing, by either ex vivo or in vivo methods, a gene coding
for the sIL-1R that is capable of binding to and neutralizing
substantially all isoforms of interleukin-1 for the prevention of
arthritis in patients that demonstrate a high susceptibility for
developing the disease.
[0054] It is an object of the present invention to provide a method
of introducing, by either ex vivo or in vivo methods, a gene coding
for an sIL-1R that is capable of binding to and neutralizing
substantially all isoforms of interleukin-1 for the treatment of
patients with arthritis.
[0055] It is an object of the present invention to provide a method
of introducing, by either ex vivo or in vivo methods, a gene or
genes that address chronic debilitating joint
pathophysiologies.
[0056] It is a further object of the present invention to provide a
compound for parenteral administration to a patient which comprises
a gene encoding a product of interest in a suitable pharmaceutical
carrier.
[0057] Another object of this invention is to provide a method of
introducing more than one gene encoding more than one product of
interest such that expression of the proteins results in an
enhanced therapeutic benefit.
[0058] A further object of the present invention is to provide a
method for treating at least one symptom of a connective tissue
disorder by treating one joint of a mammalian host, such that a
therapeutic benefit is realized in both the treated joint and
non-treated joints.
[0059] These and other objects of the invention will be more fully
understood from the following description of the invention, the
referenced drawings and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0060] FIG. 1 shows the structure of the cDNA encoding the human
interleukin-1 receptor antagonist protein (IRAP) gene inserted into
the NcoI and BamHI cloning sites of the retroviral vector MFG.
[0061] FIG. 2 shows the structure of the cDNA encoding the human
interleukin-1 receptor antagonist protein (IRAP) gene with a
selectable neo marker inserted into the retroviral vector MFG.
[0062] FIG. 3 shows a micrograph of synovium recovered from the
knee of a rabbit approximately one month after intra-articular
injection of Lac Z.sup.+, neo.sup.+ synoviocytes employing the
methods of this invention.
[0063] FIG. 4 shows a Western blot demonstrating the production of
interleukin-1 receptor antagonist protein by four cultures of
HIG-82 cells (Georgescu 1988) infected using the method of this
invention employing the MFG-IRAP viral vector.
[0064] FIG. 5 shows data demonstrating the inhibition of gelatinase
production by chondrocytes by the addition of medium conditioned by
MFG-IRAP infected HIG-82 cells.
[0065] FIG. 6 shows the uptake and expression of the Lac Z gene by
synoviocytes using lipofection. Well 1--Control cells, treated with
liposomes alone; Well 2--Control cells, treated with DNA alone;
Well 3--DNA+150 nmole liposomes; Well 4--DNA+240 nmole liposomes;
Well 5--DNA+300 nmole liposomes; Well 6--DNA+600 nmole
liposomes.
[0066] FIG. 7 shows the interleukin-1 binding domain amino acid
arrangement.
[0067] FIGS. 8A-8C show the amino acid and nucleotide sequence of
the human (SEQ ID NOS: 1-2) and mouse (SEQ ID NOS: 3-4)
interleukin-1 receptors.
[0068] FIG. 9 shows gene encoding a soluble interleukin-1 receptor
inserted into a retroviral vector.
[0069] FIG. 10 shows anti-inflammatory properties of the MFG-IRAP
transgene. MFG-IRAP/HIG-82 cells (10.sup.7) or untransduced HIG-82
cells (10.sup.7) were transplanted to the knee joints of rabbits 3
days before intraarticular challenge with the indicated amounts of
recombinant human interleukin-1 beta (rhIL-1.beta.). Lavage of
joints occurred 18 hours later, after which infiltrating leukocytes
were counted.
[0070] FIG. 11 shows levels of human IRAP in rabbit knees four days
following transplant of synoviocytes. Either untransduced (naive)
HIG-82 cells or cells carrying a human IRAP gene (MGF-IRAP/HIG-82)
were injected intraarticularly in the knee joints or rabbits (
10.sup.7 cells/knee). Four days later, knees were lavaged and the
concentration of human IRAP determined by ELISA. Values given are
means .+-.S.D. (n=15).
[0071] FIG. 12 shows inhibition of IL-1 induced leukocyte
infiltration in knees expressing IRAP gene. Either naive or
IRAP-transduced HIG-82 cells were transplanted into rabbit knee
joints, as indicated. Three days later 0-100 pg/knee hIL-1.beta.
was intraarticularly injected at the indicated doses. The following
day, knee joints were lavaged and the leukocytic infiltrate
analyzed by counting with a hemocytometer and by cytospinning.
Means .+-.S.E. (n=3). (a) White blood cells (WBC) per knee. (b)
Stained cytospin preparation of lavages from control knee injected
with IL-1. Preparation was diluted 1:10 prior to cytospinning. (c)
Stained cytospin preparation of lavages from IRAP-secreting knee
injected with IL-1. The preparation was not diluted.
[0072] FIG. 13 shows suppression of IL-1 induced loss of
proteoglycans from articular cartilage. Either naive or
IRAP-transduced HIG-82 cells were transplanted into rabbits knee
joints. Three days later, 0-200 pg/knee hrIL-1 was intraarticularly
injected at the indicated doses. The following day, knee joints
were lavaged and the level of glycosaminoglycans (GAG) as an index
of cartilage breakdown was determined.
[0073] FIGS. 14a-d shows suppression of IL-1 mediated synovial
changes in knees expressing IRAP. Ten pg hrIL-1B was injected
intraarticularly in each case. Synovia were harvested 18 hours
after injection of IL-1.beta., i.e. 4 days after transplantation of
naive or IRAP-secreting HIG-82 cells. (a) Control synovium
following injection of IL-1, magnification .times.10. (b)
IRAP-secreting synovium following injection of IL-1, magnification
.times.10. (c) Control synovium following injection of IL-1,
magnification .times.160. (d) IRAP-secreting synovium,
magnification .times.160.
[0074] FIG. 15 shows expression of human IRAP in normal and
arthritic knees of rabbits. Antigen-induced arthritis was initiated
by injecting 5 mg ovalbumin into one knee joint (arthritic knee) of
pre-sensitized rabbits on Day 1. The untreated knee (non-arthritic
knee) received carrier solution only. On Day 2, autologous
synoviocytes (10.sup.7/knee in 1 ml saline) were transferred to
selected knee joints by intraarticular injection. Certain
non-arthritic knees and arthritic knees received cells transduced
with the human IRAP gene. Other non-arthritic and arthritic knees
received untransduced cells or cells transduced with lac Z and neo
genes (controls). As the results obtained with these two types of
control cells were indistinguishable, they have been pooled in the
figures. Detailed methods for synoviocyte culture, transduction and
intraarticular implantation are disclosed throughout this
specification.
[0075] On Day 4, knees were lavaged with 1 ml saline. On Day 7,
rabbits were killed and the knees again lavaged. The concentrations
of human IRAP in the lavage fluids were determined by ELISA using a
commercial kit (R&D Systems, Minneapolis, Minn.). Values given
are means .+-.S.E. Numbers of knees are shown above each column.
Asterisks denote values which differ at p<0.05 (t-test).
[0076] FIG. 16 shows concentrations of rabbit IL-1.beta. in the
normal and arthritic knee joints of rabbits. Experimental
conditions were identical to those described in FIG. 15. However,
lavage fluids were assayed for rabbit IL-1.alpha. and rabbit
IL-1.beta. by RIA using a commercial kit (Cytokine Sciences,
Boston, Mass.). Low levels of IL-1.beta. are present in
non-arthritic knees as a reflection of the slight inflammatory
effects provoked by intraarticular injection. No IL-1.alpha. was
detectable in any of the samples. Values given are means .+-.S.E.
Numbers of knees are shown above each column. Asterisks denote
values which differ at p<0.05 (t-test).
[0077] FIGS. 17a-b shows the effect of IRAP gene transfer on
cartilage matrix metabolism. Experimental conditions were as
described for FIG. 15, except that rabbits were killed both at days
4 and 7. GAG concentrations in the lavage fluids (FIG. 17a) were
measured spectrophotometrically by the dimethymethylene blue assay
(Farndale, et al., Biochim. Biophys. Acta. 883:173-177 (1986)).
Fragments of articular cartilage were shaved from the femoral
condyles of the knees and GAG synthesis (FIG. 17b) was measured as
the uptake of .sup.35SO.sub.4.sup.2- into macromolecular material
as described (Taskiran, et al., Biochem. Biophys. Res. Commun. 200:
142-148 (1994)). Results are shown in each case as percent of
control. Values given are means .+-.S.E. Numbers of knees are shown
above each column.
[0078] FIG. 18 shows effects of IRAP gene transfer on leukocytosis.
Experimental conditions were identical to those described in FIG.
15. Numbers of leukocytes in the lavage fluids were determined with
a hemocytometer. Values shown are means .+-.S.E. Numbers of knees
are shown above each column. Asterisks denote values which differ
at p<0.05 (t-test).
[0079] FIG. 19 shows the levels of IRAP expressed in the rabbit
knee 0.2 and 7 days after intraarticular injection of MFG-IRAP
vectors, determined according to the method of Example XVI.
[0080] FIG. 20a shows the ELISA measurements of the sTNF-.alpha.R
and sIL-1R taken from rabbit knees according to the method of
Example XVII. FIG. 20b plots the relative density versus
microliters of sTNF-.alpha.R-Ig and sIL-1R-Ig taken from rabbit
knees according to the method of Example XVII.
[0081] FIG. 21 shows the level of sTNF-.alpha.R expression in
rabbit knees injected with Ad.sTNF-.alpha.R-Ig, Ad.lacZ, or
Ad.sIL-1R-Ig and AD.sTNF-.alpha.R-Ig determined according to the
method of Example XVII.
[0082] FIG. 22a shows the white blood cell count .times.10.sup.5 in
rabbit knees measured 3 and 7 days after injection determined
according to the method of Example XVII. FIG. 22b shows the GAG
levels in rabbit knees measured 3 and 7 days after injection
determined according to the method of Example XVII.
[0083] FIG. 23 shows the results of a histological analysis of
synovial tissue recovered from rabbit knees, determined according
to the method of Example
[0084] FIG. 24 shows expression of luciferase activity in various
tissues following intraarticular injection of Ad.luciferase into
a.i.a. knees, determined according to the method of Example
XVII.
[0085] FIG. 25 shows a bar graph of % paws with arthritis following
injection of left side paws with Ad.vIL-10, determined according to
the methods of Example XVIII.
[0086] FIG. 26 shows a bar graph of % paws with arthritis following
injection of Ad.vIL-10 in rear paws, determined according to the
methods of Example XVIII.
[0087] FIG. 27 shows a bar graph of % paws with arthritis following
injection of Ad.vIL-10 in front right and left rear paws,
determined according to the methods of Example XVIII.
[0088] FIG. 28 compares vIL-10 expression in a paw injected with
Ad.vIL-10 and protected against arthritis to vIL-10 expression in a
control paw, determined according to the methods of Example
XVIII.
[0089] FIG. 29 compares vIL-10 expression in a paw injected with
Ad.vIL-10 and not protected against arthritis to vIL-10 expression
in a control paw, determined according to the methods of Example
XVIII.
[0090] FIG. 30 shows a bar graph of vIL-10 expression in lymph
nodes of mice injected in vivo with Ad.vIL-10, determined according
to the methods of Example XVIII.
[0091] FIG. 31a shows the white blood cell counts in Ad.iNOS knees
and Ad.LacZ knees determined according to the methods of Example
XIX. FIG. 31b shows the GAG release in Ad.iNOS and Ad.LacZ knees
determined according to the methods of Example XIX.
[0092] FIG. 32 shows the NO synthase in counts per minute per
milligram (CPM/mg) of protein in Ad.iNOS and Ad.LacZ knees,
determined according to the methods of XIX.
[0093] FIG. 33 shows a bar graph depicting the leukocytic
infiltration in knees injected with vIL-10, the untreated knee and
control knees 3 and 7 days after injection, determined according to
the methods of Example XX.
[0094] FIG. 34 is a bar graph showing the levels of GAG released in
knees injected with vIL-10, the untreated knee, and control knees 3
and 7 days after injection, determined according to the methods of
Example XX.
[0095] FIG. 35 shows the effects of vIL-10 on GAG synthesis rates
in a.i.a. rabbit knees injected with vIL-10, the untreated knees,
and control knees, determined according to the methods of Example
XX.
[0096] FIG. 36 shows the intraarticular expression of vIL-10 in
rabbit knees 3 and 7 days after injection, determined according to
the methods of Example XX.
[0097] FIG. 37 shows the histological analysis of rabbit knees
injected with Ad.vIL-10, untreated knees, and control knees,
determined according to the methods of Example XX.
[0098] FIG. 38 shows the percentage of mice paws with arthritis 10
weeks after treatment, determined according to the methods of
Example XXI.
[0099] FIG. 39 shows the percentage of arthritic paws injected with
Ad.vIL-10 systematically, determined according to the methods of
Example XXI.
DETAILED DESCRIPTION OF THE INVENTION
[0100] As used herein, the term "patient" includes members of the
animal kingdom including but not limited to human beings.
[0101] As used herein, the term "mammalian host" includes mammalian
members of the animal kingdom including but not limited to human
beings.
[0102] As used herein, the term "target cells" refers to cells that
are targeted for transfection with the gene or genes encoding the
product(s) of interest. Target cells can be either cells that are
removed from a host and cultured with the gene(s) in vitro and
returned to a host in an ex vivo methodology, or cells that are in
the host and are transduced or transfected in vivo. Generally a
target cell when used in reference to ex vivo methods is any cell
that, when injected into a joint of a patient, will survive and
express the gene. When used in reference to in vivo methods, a
target cell is any cell capable of being transduced or transfected
with one or more genes of interest and which will subsequently
express the gene. Target cells include both connective tissue cells
and non-connective tissue cells, as those terms are defined
below.
[0103] As used herein, the term "connective tissue" includes but is
not limited to a ligament, a cartilage, a tendon, a synovium, skin,
bone, meniscus and intervertebral disc tissue of a mammalian
host.
[0104] As used herein, the term "non-connective tissue" includes
but is not limited to hematopoietic progenitor cells, stromal
cells, bone marrow cells, myoblasts, leukocytes, and lymphoid or
myeloid cells of a mammalian host.
[0105] As used herein, the terms "gene", "DNA sequence" or
"product" "of interest" refer to genes, DNA sequences or the
products they encode that are introduced to the host according to
any of the methods of the present invention. For methods used in
the therapeutic or prophylactic treatment of a host, the products
of interest would be those proteins or peptides, or fragments or
derivatives thereof, that have therapeutic and/or prophylactic
properties. For methods used in the animal model, the products of
interest would be those proteins or peptides, or fragments or
derivatives thereof, that have a pathologic effect on the host,
contributing to one or more of the deleterious effects of
connective tissue disorders.
[0106] As used herein, the term "therapeutic" refers to the ability
of a gene, product, protein, peptide, method and the like to
alleviate at least one symptom of a connective tissue disorder, or
the benefit realized from such alleviation. The term "prophylactic"
refers to the ability of a gene, product, protein, peptide, method
and the like to prevent or at least retard the onset of at least
one symptom or a connective tissue disorder, or the benefit
realized from such action.
[0107] As used herein, the term "enhanced therapeutic benefit"
refers to the therapeutic benefit realized when more than one gene
of interest is introduced to a host at the same time; the
therapeutic benefit is greater than the therapeutic benefit of each
of the genes administered separately. The benefit can be either
additive or synergistic.
[0108] As used herein, the term "DC-chol" means a cationic liposome
containing cationic cholesterol derivatives. The "DC-chol" molecule
includes a tertiary amino group, a medium length spacer arm (two
atoms) and a carbamoyl linker bond as described in Biochem.
Biophys. Res. Commun., 179:280-285 (1991), X. Gao and L. Huang.
[0109] As used herein, "SF-chol" is defined as a type of cationic
liposome.
[0110] As used herein, the term "biologically active" used in
relation to liposomes denotes the ability to introduce functional
DNA and/or proteins into the target cell.
[0111] As used herein, the term "biologically active" in reference
to nucleic acid, protein, protein fragment or derivatives thereof
is defined as an ability of the nucleic acid or amino acid sequence
to mimic a known biological function elicited by the wild type form
of the nucleic acid or protein.
[0112] As used herein, the term "maintenance", when used in the
context of liposome delivery, denotes the ability of the introduced
DNA to remain present in the cell. When used in other contexts, it
means the ability of targeted DNA to remain present in the targeted
cell or tissue so as to impart a therapeutic effect.
[0113] As will be appreciated by one skilled in the art, a fragment
or derivative of a nucleic acid sequence or gene that encodes for a
protein or peptide can still function in the same manner as the
entire, wild type gene or sequence. Likewise, forms of nucleic acid
sequences can have variations as compared with the wild type
sequence, while the sequence still encodes a protein or peptide, or
fragments thereof, that retain their wild type function despite
these variations. Proteins, protein fragments, peptides, or
derivatives also can experience deviations from the wild type form
while still functioning in the same manner as the wild type form.
Similarly, derivatives of the genes and products of interest used
in the present invention will have the same biological effect on
the host as the non-derivatized forms. Examples of such derivatives
include but are not limited to dimerized or oligomerized forms of
the genes or proteins, as wells as the genes or proteins modified
by the addition of an immunoglobulin (Ig) group. Biologically
active derivatives and fragments of the genes, DNA sequences,
peptides and proteins of the present invention are therefore also
within the scope of this invention.
[0114] One skilled in the art could test for the biological
activity of derivatives and fragments of the genes listed above by
various methods known to those skilled in the art. To determine if
a fragment or derivative of IRAP is biologically active, a bioassay
can be performed; if the compound blocks the ability of
interleukin-1 to cause inflammation and cartilage breakdown, the
derivative or fragment is a biologically active derivative or
fragment of IRAP. Similarly, a bioassay can be performed to
determine if a fragment or derivative of soluble interleukin-1
receptor protein is biologically active by determining whether the
compound blocks the ability of interleukin-1 to cause inflammation
and cartilage breakdown. To determine if a fragment or derivative
of sTNF-.alpha.R protein is biologically active, a bioassay can be
performed; if the compound prevents cell death in an L929 cell line
in response to TNF-.alpha., the fragment or derivative is
biologically active. To determine if a fragment or derivative of a
proteinase inhibitor is biologically active, a bioassay can be
performed to determine whether the action of a proteinase is
inhibited, such as by monitoring the rate of breakdown of a
proteinaceous substrate. Inhibition of the proteinase would
indicate biological activity. For example, the biological activity
of a TIMP matrix metalloproteinase inhibitor can be determined by
its ability to inhibit the activity of matrix metalloproteinases,
as assayed by methods described by Watanabe et al., Exp. Cell Res.,
167:218-226 (1986). To determine if a fragment or derivative of a
therapeutic cytokine is biologically active, a bioassay can be
performed to determine if the cytokine has a therapeutic or
prophylactic effect in inhibiting any of the symptoms associated
with a connective tissue disorder. For example, the biological
activity of IL-6 can be determined by its ability to promote growth
of B29 cells, as described by Arden et al., Eur. J. Immunol.,
17:1411-1416(1987). The biological activity of IL-10 or vIL-10 can
be determined by the ability of derivatives or fragments of these
compounds to inhibit the production of nitric oxide by activated
macrophages. To determine if a fragment or derivative of a growth
hormone or a growth factor is biologically active, bioassays can be
performed as taught by Taskiran et al., Biochem. Biophys. Res.
Commun., 200:142-148 (1994); biologically active derivatives or
fragments will demonstrate increased proteoglycan synthesis by
cartilage. To determine if a fragment or derivative of an
anti-adhesion molecule is biologically active, a bioassay can be
performed to determine the ability of the derivative or fragment to
inhibit adhesion. To determine if a fragment or derivative of a
free radical antagonist is biologically active, a bioassay can be
performed to determine the ability of the fragment or derivative to
inhibit the production of free radicals. To determine if a
derivative or fragment of CTLA4 is biologically active, a bioassay
can be performed to determine if the compound has the ability to
bind to cells expressing B7.1, in which case it would be active. To
determine if a derivative or fragment of FasL is biologically
active, a bioassay can be performed to determine if the compound
has the ability to induce apoptosis of cells express Fas, which
would indicate biological activity. To determine if a derivative or
fragment of iNOS is biologically active, a bioassay can be
performed to determine if the compound has the ability to
synthesize NO, which would indicate biological activity. Any other
manner for determining biological activity known to those skilled
in the art can also be used.
[0115] Connective tissues are difficult to target therapeutically.
Intravenous and oral routes of drug delivery that are known in the
art provide poor access to these connective tissues and have the
disadvantage of exposing the mammalian host body systemically to
the therapeutic agent. More specifically, known intra-articular
injection of joints provides direct access to a joint. However,
most of the injected drugs have a short intraarticular half-life.
The present invention solves these problems by introducing into the
mammalian host, genes encoding for proteins that may be used to
treat the mammalian host. In a preferred embodiment, this invention
provides a method for introducing into the connective tissue of a
mammalian host genes encoding for proteins with anti-arthritic
properties.
[0116] The present invention provides a method for introducing at
least one gene encoding a product into at least one target cell of
a mammalian host for use in treating the mammalian host, which
method comprises employing recombinant techniques to produce a
vector containing one or more DNA sequences encoding one or more
products of interest and infecting the target cell of the mammalian
host with the vector. This method preferably includes introducing
the gene encoding the product into at least one cell of the
connective tissue of the mammalian host for a therapeutic use. Both
in vivo and ex vivo methods can be used to introduce the gene of
interest to the host.
[0117] Any type of connective tissue cell or non-connective tissue
cells, as those terms are described herein, can be used.
Preferably, if using connective tissue synovial cells are used;
more preferably, for treating a human patient, the patient's own
cells, such as autologous synovial cells, are used. When ligament
cells are used, preferably the ligament is the medial collateral
ligament (MCL). Use of cells and/or tissue from the patellar tendon
and hamstring are also within the scope of the invention.
Preferably, if using non-connective tissue, stromal cells are
used.
[0118] For the ex vivo methods, all of the non-connective tissue
cells can be injected back into the host, such as in the bone
marrow or bloodstream of the host following transduction. Both
connective and non-connective tissue cells can be injected into the
joint space or other areas of the host following transduction. For
the in vivo methods, connective and non-connective tissue cells can
be targeted at any location of the host, including but not limited
to the bone marrow, bloodstream or joint space of the host.
[0119] Use of numerous genes, and biologically active derivatives
and fragments thereof, are within the scope of the invention. Any
gene capable of maintenance and expression, and encoding a product
having a therapeutic and/or prophylactic effect in the treatment of
joint pathologies can be used in the methods of treating a host.
This includes, but is not limited to, DNA sequences encoding one or
more of: interleukin-1 receptor antagonist protein (IRAP); a Lac Z
marker gene capable of encoding a beta-galactosidase; a soluble
interleukin-1 receptor (sIL-1R); a soluble TNF-.alpha. receptor
(sTNF-.alpha.R); a proteinase inhibitor; a therapeutic cytokine;
CTLA4; FasL; an anti-adhesion molecule; and a free radical
antagonist. Any other gene having therapeutic properties and DNA
capable of maintenance and expression can also be used. These genes
can be either commercially obtained through any supplier, or can be
made by one skilled in the art from cDNA libraries or through the
reverse transcriptase polymerase chain reaction (RTPCR) method.
[0120] IRAP is a cytokine known to suppress the inflammatory
responses caused by interleukin-1 in joint spaces. Introduction of
IRAP to these spaces, therefore, causes a reduction in the
inflammation associated with joint pathologies characterized as
having IL-production. It is believed that the IRAP binds with the
interleukin-1 receptors, thereby preventing binding of the IL-1 to
the receptors, and inhibiting the inflammatory effects caused when
IL-1 binds to the receptors, although the inventors do not wish to
be bound by this mechanism.
[0121] Similarly, soluble interleukin-1 receptors (sIL-1R) bind to
IL-1 without transmitting a cellular response, thereby preventing
IL-1 from binding to the native, cell surface receptors. Any sIL-1
receptor can be used, including but not limited to, Type I and Type
II receptors; sIL-1R Type II receptors are preferred because they
do not bind to IRAP, while Type I receptors do. The sIL-1R of the
present invention can be of any type, including Type I and Type II.
The Type I sIL-1R is an 80 Kd glycoprotein that is present on
T-lymphocytes, fibroblasts, and chondrocytes. The Type II sIL-1R is
67 Kd in size and is found predominantly on macrophages and
pre-B-cells.
[0122] Soluble tumor necrosis factor-alpha receptor (sTNF-.alpha.R)
binds TNF-.alpha. and prevents it from having a damaging effect on
the connective tissue of a patient. TNF-.alpha. is a cytokine which
is known to contribute to the pathological effects of connective
tissue disorders. The sTNF-.alpha.R of the present invention can be
of any type, including Type I and Type II. The Type I sTNF-.alpha.R
is an 55 Kd glycoprotein and the Type II sTNF.alpha.-R is 75 Kd in
size. Both type of TNF-.alpha. receptors are widely distributed on
various cell types. Both the sIL-1R and sTNF-.alpha.R have been
shown to alleviate at least some of the symptoms associated with
connective tissue disorders.
[0123] Various proteinase inhibitors are also within the scope of
the present invention. Proteinase inhibitors are substances that
prevent the enzymatic breakdown of proteins. Both proteinase
inhibitors and metalloproteinase inhibitors are within the scope of
the invention; preferred proteinase inhibitors are tissue inhibitor
of metalloproteinase (TIMP), TIMP-1, TIMP-2, TIMP-3, TIMP-4,
plasminogen activator inhibitors (PAIs) and serpins.
[0124] Cytokines are small proteins with the properties of locally
acting hormones. They serve to communicate between cells in a
paracrine manner, and may also act in an autocrine manner on the
same cell that produces the cytokine(s). Certain cytokines are
important in driving pathophysiological changes in arthritic
joints, while other cytokines offer protective effects against
these changes. Cytokines exhibiting a protective effect include
various forms of interleukin (IL) including IL-4, IL-10 and IL-13;
all of these cytokines act in an anti-inflammatory capacity, as an
immuno-suppressive agent, or exert an immunostimulatory effect,
depending on the target cell. It is also believed that they protect
against cartilage breakdown.
[0125] Viral IL-10 (vIL-10), another cytokine, is a variant of
IL-10 produced by the Epstein Barr virus. This virally encoded gene
product is also immuno-suppressive and anti-inflammatory.
[0126] Growth factors are types of cytokines that are
anti-arthritic in that they maintain synthesis of the cartilaginous
matrix. Growth factors include, but are not limited to,
transforming growth factor (TGF), TGF-.beta.1, TGF-.beta.2 and
TGF-.beta.3, fibroblast growth factor (FGF), aFGF and bFGF,
insulin-like growth factor (IGF), IGF-1 and IGF-2. While the effect
of certain growth factors is not known, IGF's are known to maintain
the synthesis of the cartilaginous matrix, and promote cartilage
repair.
[0127] Growth hormone, and at least some of the bone morphogenetic
proteins (BMP) are also cytokines. Growth hormone is believed to
act by inducing local synthesis of IGF-1, although the inventors do
not wish to be bound by this mechanism. There are at least nine
BMP's; the BMP's are members of the TGF-.beta. super family. BMP's
induce the formation of both bone and cartilage. BMP-2 and BMP-7
(also known as osteogenic protein-1 (OP-1)) have shown to be
particularly promising in the therapeutic treatment of connective
tissue disorders, and are therefore the preferred BMP's for use in
the methods of the present invention.
[0128] As used herein, the term "cytokine" refers to all of the
therapeutic cytokines described above.
[0129] CTLA4 is a surface molecule found on T-cells, which binds to
a counter-ligand known as B7 on the surface of antigen-presenting
cells (APC's). In its soluble form, CTLA4 binds to B7 and thereby
prevents B7 from interacting with a co-stimulatory molecule known
as CD28 on the surface of the T-cell. When B7 CD28 interactions are
blocked in this way, T-cell activation and hence the immune
response is prevented. There is evidence that this process can
induce immune tolerance. CTLA4 is typically used in soluble
form.
[0130] Fas ligand (FasL) is a cell surface protein that binds to
another protein, called Fas, found on the surface of other cells,
including lymphocytes. When FasL binds to Fas, the cell expressing
Fas undergoes apoptosis. Soluble FasL may also induce apoptosis and
may be used to kill lymphocytes, as well as other Fas.sup.+ cells
in synovium.
[0131] Various anti-adhesion molecules are also within the scope of
the present invention. These molecules function by inhibiting
cell-cell and cell-matrix interactions and have anti-inflammatory
properties. Examples of such proteins, including their fragments
and derivatives, are soluble ICAM-1 and soluble CD44.
[0132] The use of free radical antagonists is also within the scope
of the present invention. These antagonists function to prevent the
deleterious effects of free radical formation within the afflicted
joint. Examples include but are not limited to the superoxide
dismutase and proteins or protein fragments which inhibit NO and NO
synthase.
[0133] Preferred genes for use in the present invention for
eliciting a therapeutic and/or prophylactic benefit in a host
include IRAP, sIL-1RI, sIL-1RII. sTNF-.alpha.RI, sTNF-.alpha.RII,
TIMP-1, TIMP-2, TIMP-3, TIMP-4, PAIs, serpins, IL-4, IL-10, IL-13,
IGF-1, IGF-2, vIL-10, CTLA4, BMP-1, BMP-2, BMP-3, BMP-4, BMP-5,
BMP-6, BMP-7, FasL and their derivative forms. Use of other
therapeutic genes is also within the scope of the present
invention.
[0134] The scope of the present invention includes the use of one
or more of the above-recited therapeutic genes in the therapeutic
or prophylactic treatment of a connective tissue disorder. Genes
encoding for more than one protein can be introduced through the
same vector, as described below, or can be introduced through the
use of different vectors, with each vector containing a different
gene of interest. An unexpected discovery of the present invention
is that the use of two or more genes together produces an enhanced
therapeutic benefit. Particularly preferred for use together are
genes encoding for sTNF-.alpha.R and sIL-1R. Other gene
combinations are within the scope of the present invention as well.
When administering two or more different genes through two or more
different vectors or other means of delivery, each of the delivery
means can be introduced simultaneously or can be introduced in
succession. If in succession, introduction of the second, third, or
greater genes is preferably done immediately following introduction
of the first gene, to ensure that the highest levels of expression
of each gene are achieved in the host at the same time.
[0135] Numerous methods known to those skilled in the art can be
used to introduce the gene encoding the product of interest into
the mammalian host. For example, viral and non-viral vectors can be
prepared by recombinant methods to include the gene coding for the
product of interest.
[0136] In one embodiment of this invention, the viral vector is a
retroviral vector. Retroviral vectors include, but are not limited
to, MFG and pLJ. An MFG vector is a simplified Moloney murine
leukemia virus vector (MoMLV) in which the DNA sequences encoding
the pol and env proteins have been deleted so as to render it
replication defective. An MFG vector can be prepared that contains
one DNA sequence of interest. Two (DFG), three (TFG) or even more
DNA sequences of interest can also be included in the MoMLV. Thus,
DFG and TFG are forms of MFG having multiple genes. For ease of
reference, the term MFG, as used herein, includes any singular or
multiple gene forms of the vector. A pLJ retroviral vector is also
a form of the MoMLV and is more fully described by Korman et al.,
Proc. Nat'l Acad. Sci., 84:2150-2154 (1987), which description is
hereby incorporated by reference.
[0137] Preferred embodiments of this invention includes employing a
gene capable of encoding a human IRAP, sIL-1R, sTNF-.alpha.R, and
vIL-10, or biologically active derivatives or fragments thereof,
and employing MFG as the retroviral vector.
[0138] Other viral vectors containing the gene encoding for the
product can also be used, such as an adeno-associated virus, an
adenovirus, and a herpes virus, such as herpes simplex type-1 or
herpes simplex type-2. Other DNA vectors, such as plasmid or viral
vectors can also be used.
[0139] Non-viral means for introducing the gene encoding for the
product into the target cell can also be used. This method includes
employing non-viral means selected from the group consisting of at
least one liposome, Ca.sub.3(PO.sub.4).sub.2, electroporation, and
DEAE-dextran. Direct injection of naked DNA can also be used. The
liposome can be a material selected from the group consisting of
DC-chol, SF-chol and numerous others known to those skilled in the
art. It will be understood that such non-viral means for
introducing the gene encoding for the product into the target cell
provides a non-infectious delivery system. An advantage of the use
of a non-infectious delivery system is the elimination of
insertional mutagenesis and virally induced disease. In addition,
the viral vectors employing a liposome are not limited by cell
division as is required for the retroviruses to effect infection
and integration of target cells.
[0140] Yet another method for introducing at least one gene
encoding a product into at least one cell of a mammalian host for
use in treating the mammalian host includes employing the biologic
means of utilizing a virus to deliver the DNA vector molecule to
the target cell or tissue. Preferably, the virus is a pseudo-type
retrovirus, the genome having been altered such that the
pseudo-type retrovirus is capable only of delivery and stable
maintenance within the target cell, but not retaining an ability to
replicate within the target cell or tissue.
[0141] The altered viral genome is further manipulated by
recombinant DNA techniques such that the viral genome acts as a DNA
vector molecule which contains the heterologous gene of interest to
be expressed within the target cell or tissue.
[0142] As described above, the gene of interest can be introduced
to the mammalian host through a variety of viral and non-viral
means. These means can be employed both in vitro and in vivo.
[0143] For example, this invention provides a method for
introducing at least one gene encoding a product into at least one
target cell of a mammalian host for use in treating the mammalian
host by effecting in vivo the infection of the cell by introducing
the DNA sequence coding for the product directly into the mammalian
host. This in vivo method involves introducing a DNA sequence
directly to the target cell(s). The DNA sequence can be contained
within any of the viral or non-viral vectors disclosed herein or
can be a naked DNA sequence. Preferably, this method includes
effecting the direct introduction into the mammalian host by
intraarticular injection, although any method of introduction known
to those skilled in the art can be used. Upon introduction of the
DNA sequence to the connective or non-connective tissue cells, the
cells are transduced with the DNA sequence, and the product which
the sequence encodes will be expressed within the cell.
[0144] A method for introducing at least one gene encoding a
product into at least one target cell of a mammalian host for use
in treating the mammalian host is provided that includes
introducing the gene into the target cell in vitro and
trans-planting the transduced cell having the gene into the
mammalian host. After introducing the gene encoding for the product
into the target cell and before the transplanting the target cell
into the mammalian host, the target cells having the gene can be
stored. This method includes storing target cells frozen in 10
percent DMSO in liquid nitrogen.
[0145] In a preferred embodiment of the invention, target cells are
transfected in vivo following direct intraarticular injection of a
DNA molecule containing the gene of interest into the joint.
Transfection of the recipient target cells bypasses the requirement
of removal, culturing, in vitro transfection, selection and
transplanting the DNA vector containing--target cells to promote
stable expression of the heterologous gene of interest. Methods of
injecting the DNA molecule into the joint include, but are not
limited to, association of the DNA molecule with cationic liposomes
or the direct injection of the DNA molecule itself into the joint.
Expression of the heterologous gene of interest subsequent to in
vivo transfection of the host tissue is ensured by inserting a
promoter fragment active in eukaryotic cells directly upstream of
the coding region of the heterologous gene. One of ordinary skill
in the art may utilize known strategies and techniques of vector
construction to ensure appropriate levels of expression subsequent
to entry of the DNA molecule into the host tissue.
[0146] As will be appreciated, the in vivo methodology of the
present invention can be used with any of the above-listed
therapeutic genes. One or more therapeutic genes can be used. An
unexpected finding of the present invention is that the concurrent
injection of more than one gene results in an enhanced therapeutic
benefit. Thus, the therapeutic benefit observed when using more
than one gene together is greater than if the genes were introduced
separately. A particularly preferred embodiment involves the
injection of DNA encoding sIL-1R and sTNF-.alpha.R either
concurrently or in succession. Genes encoding these two products,
or any other products, can be introduced to a target cell either by
the same vector or separate vectors, or by other delivery means as
described above. Any of the viral or non-viral vector or biological
means described throughout the specification can be used for the
introduction of one or more genes to the host for the in vivo
therapeutic benefit to be realized. When administering two or more
different genes through two or more different vectors or other
means of delivery, each of the delivery means can be introduced
simultaneously or can be introduced in succession. If in
succession, introduction of the second, third, or greater genes is
preferably done immediately following introduction of the first
gene, to ensure that the highest levels of expression of each gene
are achieved in the host at the same time.
[0147] Also, any of the connective tissue cells or non-connective
tissue cells, as those terms are described herein, can be targeted
by in vivo injection of the gene or genes of interest.
[0148] As described herein, a DNA sequence that encodes a protein
of interest is introduced to a joint of a mammalian host through a
variety of ways. Subsequent expression of the protein is observed.
An unexpected finding of the present invention is that the
introduction of DNA into one joint leads to expression of the
protein in that joint, and also in other joints of the host as
well. Treatment of, for example, one knee joint leads to a
therapeutic effect in other knee joints as well. Thus, the
protective effects of local gene therapy as taught by the present
invention are not limited to the target joint, but can affect
distal joints as well.
[0149] Accordingly, another embodiment of the present invention
provides a method for treating a connective tissue disorder
comprising generating a recombinant vector that comprises at least
one DNA sequence encoding one or more genes of interest and
infecting a population of target cells, in vivo, in a first joint
of a host with the vector such that subsequent expression of the
gene(s) in the host reduces at least one deleterious joint
pathology or indicia of inflammation normally associated with a
connective tissue disorder both in the first joint and in one or
more distal or untreated joints in the host. Any of the therapeutic
genes and vectors as described above can be used. Alternatively,
introduction of the gene(s) of interest can be accomplished by any
of the non-vector means disclosed herein.
[0150] The present invention provides for a distal or systemic-type
method of treatment following local injection. As discussed
particularly in Example XVII, direct intraarticular delivery of
adenoviral vectors encoding IL-1 and TNF.alpha. inhibitors (sIL-1R
and STNF-.alpha.R) have an anti-inflammatory effect that is not
limited to the site of virus injection. One possible explanation
for this observation is that sufficient levels of inhibitor protein
were present in the contralateral joint to confer a protective
effect. However, significant levels (>1 ng/ml) of TNF.alpha.
inhibitor molecules were not detected in sera or lavage fluids from
untreated joints. To test if lower levels of the soluble receptors
could indeed produce local anti-inflammatory effects,
3.5.times.10.sup.6 pfu of each adenoviral inhibitor were injected
into knees of rabbits 24 hours post-induction of a.i.a. This lower
does of adenovirus resulted in a low but detectable level of
sTNF.alpha.-receptor expression ranging from .about.0.5 to 1.5
ng/ml of lavage fluid. However, there was no apparent local
anti-inflammatory effect.
[0151] A second possible mechanism for the observed therapeutic
benefit in untreated joints is that adenoviral particles or virally
transduced cells were migrating from the joint of injection to the
opposite knee or other organs, and thereby causing a systemic
anti-inflammatory effect. To test this possibility, an adenoviral
vector encoding the firefly luciferase reporter gene
(Ad.luciferase) was utilized. A.i.a. was induced in both knees of
two rabbits. Twenty-four hours post induction, 1.5.times.10.sup.9
pfu of the Ad.luciferase virus was injected into one knee of each
rabbit, while the untreated knee received 7.times.10.sup.7 pfu of
Ad.lacZ. At 7 days post injection, the rabbits were bled and
sacrificed, the joints lavaged, and the joint capsules of both
knees harvested along with regional lymphoid tissue, heart, liver,
lung, spleen and kidney. Recovered tissues and leukocytes were then
analyzed for the presence of intracellular luciferase activity. A
low level of luciferase activity was observable in lymphoid tissue
obtained near the site of injection and in synovial tissue of the
untreated knee joint relative to knees receiving the Ad.luciferase
vector. Analysis of similar numbers of leukocytes obtained from
both knee joints and peripheral blood showed luciferase activity in
leukocytes obtained from the injected knee and a lower level in the
untreated knee. No appreciable activity was detected in circulating
leukocytes. These results demonstrate that a population of
transduced leukocytes can migrate to the opposing inflamed knee
joint suggesting a possible mechanism for the observed untreated
effect. The inventors do not wish to be bound by any of these
mechanisms, however.
[0152] The in vivo methods of the invention can be used in the
therapeutic treatment of patients suffering from one or more of the
symptoms associated with joint pathologies, and in the repair
and/or regeneration of connective tissue effected by such
pathologies. The methods can also be used prophylactically, to
prevent or retard onset of the symptoms of connective tissue
disorder in patients susceptible to such disorders.
[0153] The methods of the present invention provide a means for
introduction of one or more products of interest to the connective
tissue of a host. These products are generally known in the art as
being effective against the symptoms of connective tissue
disorders. The amount of each product, in the form of the DNA
sequence encoding the product, to introduce will vary from patient
to patient depending on such factors as the size of the patient,
the joint affected, the severity of the connective tissue disorder,
the gene being used and whether the method is being used
therapeutically or prophylactically. Therapeutic responses are
typically seen based upon delivery of a vector or other delivery
vehicle sufficient to give gene expression in the high pico- to low
nanogram range.
[0154] One skilled in the art can determine the amount of vector or
other delivery means to administer to a patient to achieve these
levels of expression based upon the factors listed above.
Introduction of vectors, such as a retroviral vector, in normal
titer (about 10.sup.5 cfu/ml) is typically sufficient, but high
titer concentrations (equal to or greater than about 10.sup.7
cfu/ml) are preferred.
[0155] Another embodiment of the present invention provides a
method to produce an animal model for the study of connective
tissue pathology. As will be understood by those skilled in the
art, over-expression of interleukin-1 in the joint of a mammalian
host is generally responsible for the induction of an arthritic
condition. This invention provides a method for producing an animal
model using the above described gene transfer technology of this
invention. Preferably, the method of this invention provides a
method for producing an animal model using the various gene
transfer technologies of this invention as described above to
effect an animal model for arthritis. For example, constitutive
expression of interleukin-1 in the joint of a rabbit following the
method of gene transfer provided for by this invention leads to the
onset of an arthritic condition. It will be appreciated by those
skilled in the art that this rabbit model is suitable for use for
the testing of therapeutic agents. This method includes introducing
at least one gene encoding a product into at least one cell of a
connective tissue of a mammalian host comprising (a) employing
recombinant techniques to produce a recombinant vector that
contains the gene encoding for the product and (b) infecting the
target cell of the mammalian host using the recombinant vector
containing the gene coding for the product for effecting the animal
model.
[0156] Any gene known to contribute to one or more of the symptoms
of connective tissue disorders can be used in the animal model. As
with the therapeutic treatment methodology, more than one gene can
be introduced. Genes suitable for use in the animal model methods
of the present invention, therefore, include any genes which cause
such a symptom, including but not limited to various forms of
interleukin such as IL-1.alpha., IL-1.beta., IL-2, IL-7 IL-8,
IL-12, IL-15 and IL-17, TNF-.alpha., TNF-.beta., iNOS and
proteinases including but not limited to aggrecanase, or a matrix
metalloproteinase selected from the group consisting of at least
one collagenase, gelatinase and stromelysin. Inducible nitric oxide
synthase (iNOS or NOSII) is an enzyme found in athritic joints,
which catalyzes the formation of the radical nitric oxide (NO).
[0157] Any biologically active derivatives or fragments of these
genes can also be used. One skilled in the art can test the
biological activity of such derivatives or fragments by evaluating
their ability to contribute to one or more of the deleterious
symptoms associated with connective tissue disorders.
[0158] Any of the viral or non-viral means described in conjunction
with the therapeutic method can be used to effect delivery of the
DNA sequence or sequences of interest in the animal model. Also,
any of the connective or non-connective tissue cells can be
targeted in the animal model, as described above for the
therapeutic methods. It will be appreciated by those skilled in the
art that introduction of any of the deleterious genes listed above
will result in conditions mimicking those seen in an animal
suffering from a connective tissue disorder. The afflicted animal
can then be used to study potential methods for therapeutically
treating such connective tissue disorders experienced by humans.
Thus, the animal model of the present invention provides a
correlatable means of studying connective tissue disorders.
EXAMPLES
[0159] The following examples are intended to illustrate the
present invention and should not be construed as limiting the
invention in any way.
Example I
[0160] Packaging of AAV
[0161] The only cis-acting sequences required for replication and
packaging of recombinant adeno-associated virus (AAV) vector are
the AAV terminal repeats. Up to 4 kb of DNA can be inserted between
the terminal repeats without effecting viral replication or
packaging. The virus rep proteins and viral capsid proteins are
required in trans for virus replication as is an adeno-associated
virus helper. To package a recombinant AAV vector, the plasmid
containing the terminal repeats and the therapeutic gene is
co-transfected into cells with a plasmid that expresses the rep and
capsid proteins. The transfected cells are then infected with
adeno-associated virus and virus isolated from the cells about
48-72 hours post-transfection. The supernatants are heated to about
56.degree. Centigrade to inactivate the adeno-associated virus,
leaving an active virus stock of recombinant AAV.
Example II
[0162] Electroporation
[0163] The connective tissue cells to be electroporated are placed
into Hepes buffer saline (HBS) at a concentration of about 10.sup.7
cells per ml. The DNA to be electroporated is added at a
concentration of about 5-20 ug/ml of HBS. The mixture is placed
into a cuvette and inserted into the cuvette holder that
accompanies the Bio-RAD electroporation device (1414 Harbour Way
South, Richmond, Calif. 94804). A range between about 250 and 300
volts at a capacitance of about 960 ufarads is required for
introduction of DNA into most eukaryotic cell types. Once the DNA
and the cells are inserted into the Bio-RAD holder, a button is
pushed and the set voltage is delivered to the cell-DNA solution.
The cells are removed from the cuvette and replated on plastic
dishes.
Example III
[0164] The cDNA encoding the human interleukin-1 receptor
antagonist (IRAP) was inserted into the NcoI and BamHI cloning
sites of the retroviral vector MFG as shown in FIG. 1.
Specifically, a Pstl to BamHI fragment from the IRAP cDNA was
linked to a synthetic oligonucleotide adapter from the NcoI site
(representing the start site of translation for IRAP) to the Pstl
site (approximately 12 base pairs downstream from the NcoI site) to
the MFG backbone digested at NcoI and BamHI in a three part
ligation reaction. This three part ligation involving a synthetic
oligo and two DNA fragments is well known by those skilled in the
art of cloning. LTR means long terminal repeats, 5'SD means 5'
splice donor, 3'SA means 3' splice acceptor. The straight arrow and
the crooked arrow in FIG. 1 represent unspliced and spliced
messenger RNAs respectively. IRAP is encoded by the spliced
message.
[0165] FIG. 2 shows the cDNA encoding the human interleukin-1
receptor antagonist protein (IRAP) with a selectable neo gene
marker. FIG. 3 shows a low power micrograph of synovium recovered
from the knee of a rabbit one month after intra-articular injection
of Lac Z.sup.+, neo.sup.+ synoviocytes. Tissue was stained
histochemically for the presence of beta-galactosidase. This
microraph counterstained with eosin revealed an area of intensely
stained, transplanted cells demonstrating that these cells have
colonized the synovial lining of the recipient joint.
Example IV
[0166] Animal Models
[0167] The methods of this invention of transferring genes to the
synovia of mammalian joints permit the production and analysis of
joint pathologies that were not previously possible. This is
because the only other way of delivering potentially arthritogenic
compounds to the joint is by intra-articular injection. Not only
are such compounds quickly cleared from joints, but the effects of
bolus injections of these compounds do not accurately mimic
physiological conditions where they are constantly produced over a
long period of time. In contrast, the gene transfer technologies of
this invention permit selected proteins of known or suspected
involvement in the arthritic process to be expressed
intraarticularly over an extended period of time, such as for
example, at least a three month period. The animal models of this
invention therefore permits the importance of each gene product to
the arthritic process to be evaluated individually. Candidate genes
include, but are not restricted to, those coding for cytokines such
as interleukin-1 (IL-1) alpha, IL-1 beta, and TNF-alpha, and matrix
metalloproteinases such as collagenases, gelatinases and
stromelysins.
[0168] Additionally, the gene transfer techniques of this invention
are suitable for use in the screening of potentially therapeutic
proteins. In this use, the animal models of the invention are
initiated in joints whose synovia express gene coding for potential
anti-arthritic proteins. Candidate proteins include, but are not
restricted to, inhibitors of proteinases such as, for example, the
tissue inhibitor of metalloproteinases, and cytokines such as, for
example, transforming growth factor-beta.
Example V
[0169] Method For Using Synoviocytes as a Delivery System for Gene
Therapy
[0170] Rabbits are killed by intravenous injection of 4 ml
nembutal, and their knees quickly shaved. Synovia are surgically
removed from each knee under aseptic conditions, and the cells
removed from their surrounding matrix by sequential digestion with
trypsin and collagenase (0.2% w/v in Gey's Balanced Salt Solution)
for about 30 minutes and about 2 hours, respectively. The cells
recovered in this way are seeded into 25 cm.sup.2 culture flasks
with about 4 ml of Ham's F.sub.12 nutrient medium supplemented with
10% fetal bovine serum. 100 U/ml penicillin and 100 .mu.g/ml
streptomycin, and incubated at about 37.degree. in an atmosphere of
95% air, 5% CO.sub.2. Following about 3-4 days incubation, the
cells attain confluence. At this stage, the culture medium is
removed and the cell sheet washed twice with approximately 5 mls of
Gey's Balanced Salt Solution to remove non-adherent cells such as
lymphocytes. The adherent cells are then treated with trypsin
(0.25% w/v in balanced salt solution). This treatment detaches the
fibroblastic, Type B synoviocytes, but leaves macrophages,
polymorphonuclear leukocytes and the Type A synoviocytes attached
to the culture vessel. The detached cells are recovered, re-seeded
into 25 cm.sup.2 culture vessels at a 1:2 split ratio, medium is
added and the culture returned to the incubator. At confluence this
procedure is repeated.
[0171] After the third such passage, the cells are uniformly
fibroblastic and comprise a homogeneous population of Type B
synoviocytes. At this stage, cells are infected with the retroviral
vector.
[0172] Following infection, cells are transferred to fresh nutrient
medium supplemented with about 1 mg/ml G418 (GIBCO/BRL, P.O. Box
68, Grand Island, N.Y. 14072-0068) and returned to the incubator.
Medium is changed every three days as neo cells die and the
neo.sup.+ cells proliferate and attain confluency. When confluent,
the cells are trypsinized and subcultured as described above. One
flask is set aside for staining with X-gal to confirm that the
neo.sup.+ cells are also Lac Z.sup.+. When the subcultures are
confluent, the medium is recovered and tested for the presence of
IRAP, soluble IL-1R or other appropriate gene products as
hereinbefore described. Producing synoviocyte cultures are then
ready for transplantation.
[0173] The cells are recovered by centrifuging, washed several
times by resuspension in Gey's Balanced Salt Solution and finally
resuspended at a concentration of about 10.sup.6-10.sup.7 cells/ml
in Gey's solution. Approximately 1 ml of this suspension is then
introduced into the knee joint of a recipient rabbit by
intra-articular injection. For this purpose a 1 ml syringe with a
25-gauge hypodermic needle is used. Injection is carried out
through the patellar tendon. Experiments in which radiopaque dye
was injected have confirmed that this method successfully
introduces material into all parts of the joint.
[0174] Variations on the disclosed harvesting, culture and
transplantation conditions in regard to the numerous examples
presented within this specification will be evident upon inspection
of this specification. Several tangential points may be useful to
one practicing the ex vivo based gene therapy portion of the
disclosed invention:
[0175] (1) If the yield of synoviocytes from the harvested synovial
tissue is poor, the surgical technique nay be at fault. The
synovium has a strong tendency to retract when cut. Therefore, the
inner capsule is grasped firmly, and with it the synovium, while
excising this tissue. A small (about 2 mm) transverse incision can
be made inferiorly, followed by sliding one point of the forceps
into the joint space so that the synovium and inner capsule are
sandwiched between the points of the forceps. The tissue is then
excised without releasing the tissue thus preventing retraction of
the synovium.
[0176] (2) A two compartment digestion chamber may be used to
initially separate the cells from extracellular debris. In lieu of
this choice, synovial tissue may be digested in a single chamber
vessel and filtered through a nylon monofilament mesh of 45 .mu.m
pore size.
[0177] (3) When resuspending cells, the smallest amount of medium
possible can be used to prevent formation of clumps of cells, which
are difficult to separate once formed. EDTA in millimolar amounts
can also be used to prevent clumps.
[0178] (4) During trypsinization, synoviocytes can lose the
fusiform morphology that they possess in adherence, and assume a
rounded shape. The cells initially will detach in clumps of rounded
cells; one may allow the majority of cells to separate from each
other before stopping trypsinization.
[0179] (5) Synoviocytes may be transduced with multiple transgenes
by use of retroviral vectors containing multiple transgenes or by
sequential transduction by multiple retroviral vectors. In
sequential transduction, the second transduction should be made
following selection, when applicable, and passage after the first
transduction.
[0180] (6) As the synovium is a well-innervated structure,
intra-articular injection can be painful, especially if done
rapidly. Intra-articular injection of a 1 ml volume should take 10
to 15 seconds.
[0181] (7) In the animal model, the depth of the needle stick
should not exceed 1 cm during intraarticular injection, and
depression of the syringe plunger should meet with little to no
resistance. Resistance to advancement of the syringe plunger
indicates that the tip of the needle is not in the joint space.
[0182] (8) In the animal model, to retrieve a useful volume of the
injected Gey's solution during joint lavage, the needle should not
be inserted too deeply, otherwise it may penetrate the posterior
capsule and may lacerate the popliteal artery. Firm massage of the
suprapatellar, infrapatellar, and lateral aspects of the knee
during aspiration helps to increase the amount of fluid recovered;
in general, it should be possible to recover .gtoreq.0.5 ml of
fluid. When knees are badly inflamed, lavage is often difficult
because of the presence of large numbers of leukocytes, fibrin, and
other debris in the joint. The animal can be anesthetized or
sacrificed and the Gey's solution recorded surgically.
Example VI
[0183] The method of Example V for producing generally uniformly
fibroblastic cells of a homogeneous population of Type B
synoviocytes was followed to effect growing cultures of lapine
synovial fibroblasts. These growing cultures of lapine synovial
fibroblasts were subsequently infected with an amphotropic
retroviral vector carrying marker genes coding for
beta-galactosidase (Lac Z) and resistance to the neomycin analogue
G418 (neo.sup.+). Following infection and growth in selective
medium containing about 1 mg/ml G418, all cells stained positively
in a histochemical stain for beta-galactosidase.
[0184] Neo selected cells carrying the Lac Z marker gene were
transplanted back into the knees of recipient rabbits to examine
the persistence and expression of these genes in vivo. Two weeks
following transplantation, islands of Lac Z.sup.+ cells within the
synovium of recipient knees were observed. This confirmed the
ability of the method of this invention to introduce marker genes
into rabbit synovia and to express them in situ.
Example VII
[0185] Neo-selected, Lac Z.sup.+ synoviocytes were recovered from
cell culture, suspended in Gey's Balanced Salt Solution and
injected intra-articularly into the knee joints of recipient
rabbits (about 10.sup.5-10.sup.7 cells per knee). Untreated control
knees received only a carrier solution. At intervals up to 3 months
following transplant, the rabbits were killed and their synovia and
surrounding capsule recovered. Each sample may be analyzed in three
ways. A third of the synovium was stained histochemically en masse
for the presence of beta-galactosidase. A second portion may be
used for immunocytochemistry using antibodies specific for
bacterial beta-galactosidase. The final portion may be digested
with trypsin and collagenase, and the cells thus recovered cultured
in the presence of G418.
[0186] Staining of the bulk synovial tissue revealed extensive
areas of Lac Z.sup.+ cells, visible to the naked eye. Control
synovia remained colorless. Histochemical examination of synovia
revealed the presence of islands of cells staining intensely
positive for beta-galactosidase. These cells were present on the
superficial layer or the synovial lining, and were absent from
control synovia. From such tissue it was possible to grow Lac
Z.sup.+, neo.sup.+ cells. Cells recovered from control tissue were
Lac Z and died when G418 was added to the culture. This indicates
that the transplanted, transduced synovial fibroblasts have
successfully recolonized the synovia of recipient joints, and
continue to express the two marker genes, Lac Z and neo.
Maintaining intra-articular Lac Z and neo expression in
transplanted synoviocytes has been effected for about 6 weeks using
primary cells and about 2 weeks using the HIG-82 cell line.
Example VIII
[0187] Based upon the methods of the hereinbefore presented
examples, and employing standard recombinant techniques well known
by those skilled in the art, the human IRAP gene was incorporated
into an MFG vector as shown in FIG. 1. Following the infection of
synoviocyte cultures of rabbit origin with this viral vector, IRAP
was secreted into the culture medium.
[0188] Western blotting, well known by those skilled in the art,
was carried out using an IRAP-specific rabbit polyclonal antibody
that does not recognize human or rabbit IL-1 alpha or IL-1 beta, or
rabbit IRAP. FIG. 4 shows a Western blot which sets forth the
production of IRAP by four cultures of HIG-82 cells infected with
MFG-IRAP. Three forms of the IRAP are present: a non-glycosylated
form which runs with recombinant standards, and two larger
glycosylated forms. The results of the Western blotting shown in
FIG. 4 demonstrated that IRAP was produced by HIG-82 synoviocyte
cell line (Georgescu, 1988) following infection with the MFG-IRAP
vector of this invention. The Western blotting of FIG. 4 shows the
IRAP concentration of the conditioned medium is as high as 50
ng/ml. This is approximately equal to 500 ng IRAP/10.sup.6
cells/day. Lane 1 and Lane 2 of FIG. 4 show that the recipient
synovia tissue secrete substantial amounts of HIG-IRAP at 3 days
(Lane 2) and 6 days (Lane 1). Lane 3 shows human recombinant IRAP.
Lane 6 indicates that rabbit synovial cells produce a larger
glycosylated version of this molecule after infection with
MFG-IRAP. Lane 7 indicates that native rabbit synovial cells do not
produce this glycosylated form.
[0189] FIG. 5 shows that medium conditioned by IRAP.sup.+
synoviocytes blocks the induction of matrix metalloproteinases in
articular chondrocytes exposed to recombinant human IL-1 beta.
Chondrocytes normally secrete 1 U/10.sup.6 cells, or less,
gelatinase into their culture media. FIG. 5 shows that when to
about 5 U/ml or 10 U/ml IL-1 are added, gelatinase production
increases to over 4 U and 6U/10.sup.8 cells, respectively. Addition
of medium conditioned by MFG-IRAP-infected HIG-82 cells employed by
the method of this invention suppressed gelatinase production by
IL-1 treated chondrocytes. With 5 U/ml IL-1 (FIG. 5, right panel)
inhibition was 100% for one culture and 41% for the other. With 10
U/ml IL-1, inhibition was reduced to 38% and 18% (FIG. 5, left
panel) as is expected of a competitive inhibitor. These data
demonstrate that the IRAP produced by HIG-82 cells infected with
MFG-IRAP is biologically active.
Example IX
[0190] This example demonstrates the uptake and expression of Lac Z
gene by synoviocytes using infection by a liposome (lipofection). A
six well plate containing synoviocyte cultures were transduced with
the Lac Z gene by lipofection. The content of each well is as
follows:
1 Well 1 Control cells, treated with liposornes alone Well 2
Control cells, treated with DNA alone Well 3 DNA + 150 nmole
liposomes Well 4 DNA + 240 nmole liposomes Well 5 DNA + 300 nmole
liposomes Well 6 DNA + 600 nmole liposomes
[0191] Wells 3-6 containing sub-confluent cultures of synovial
fibroblasts were transfected with 6 ug of DNA complexed with
150-600 nmoles/well of "DC-chol" liposome or in the alternative,
with "SF-chol". Three days later, cells were stained
histochemically for expression of beta-galactosidase (FIG. 6).
[0192] Table 1 shows the results of using the liposomes "DC-chol"
and "SF-chol" in converting synoviocyte cultures to the Lac Z.sup.+
phenotype without selection. Table 1 sets forth that the "DC-chol"
liposome in a concentration of about 300 nmole/well converted
generally 30% of the synovial cells in synoviocyte cultures to the
Lac Z.sup.+ phenotype without selection. Reduced expression was
shown in Well 6 for "DC-chol" due to the toxic effect of the high
liposome concentration.
2TABLE 1 Liposome, % Lac Z.sup.+Cells nmole/well DC-chol SF-chol
150 10 0.5 240 22 1.0 300 30 2.8 600 NA 3.5
[0193] In another embodiment of this invention, a gene and method
of using this gene provides for the neutralization of
interleukin-1. Interleukin-1 is a key mediator of cartilage
destruction in arthritis. Interleukin-1 also causes inflammation
and is a very powerful inducer of bone resorption. Many of these
effects result from the ability of interleukin-1 to increase
enormously the cellular synthesis of prostaglandins and various
proteinases including collagenase, gelatinase, stromelysin,
plasminogen activator and aggrecanase. The catabolic effects of
interleukin-1 upon cartilage are exacerbated by its ability to
suppress the synthesis of the cartilaginous matrix by chondrocytes.
Interleukin-1 is present at high concentrations in synovial fluids
aspirated from arthritic joints and it has been demonstrated that
intra-articular injection of recombinant interleukin-1 in animals
causes cartilage breakdown and inflammation.
[0194] Interleukin-1 exists as several species, such as
unglycosylated polypeptide of 17,000 Daltons. Two species have
previously been cloned, interleukin-1 alpha and interleukin-1 beta.
The alpha form has a pI of approximately 5, and the beta form has a
pI around 7. Despite the existence of these isoforms, interleukin-1
alpha and interleukin-1 beta have substantially identical
biological properties and share common celyl surface receptors. The
type I interleukin-1 receptor is a 80 kDa (kilodalton) glycoprotein
and contains an extracellular, interleukin-1 binding portion of 319
amino acids which are arranged in three immunoglobulin-like domains
held together by disulfide bridges as shown in FIG. 7. A 21 amino
acid trans-membrane domain joins the extracellular portion to the
217 amino acid cytoplasmic domain. FIGS. 8A-8C show the amino acid
and nucleotide sequence of the human and mouse interleukin-1
receptors. In FIG. 8B, the 21 amino acid trans-membrane region of
the interleukin-1 receptor is marked by the thicker solid line. In
FIGS. 8A and 8B, the position of the 5' and 3' oligonucleotides for
PCR are marked by thinner short lines, respectively. The lysine
amino acid just 5' to the trans-membrane domain to be mutated to a
stop codon is marked by a solid circle in FIG. 8B.
[0195] Synovium is by far the major, and perhaps the only,
intraarticular source of interleukin-1 in the arthritic joint.
Synovia recovered from arthritic joints secrete high levels of
interleukin-1. Both the resident synoviocytes and infiltrating
blood mononuclear cells within the synovial lining produce
interleukin-1.
[0196] The present invention provides a method of using in vivo a
gene coding for a truncated form of the interleukin-1 receptor
which retains its ability to bind interleukin-1 with high affinity
but which is released extracellularly and therefore inactive in
signal transduction. The binding of this truncated and modified
receptor to interleukin-1 inhibits the intraarticular activity of
interleukin-1.
[0197] This method of using a gene encoding the extracellular
interleukin-1 binding domain of an interleukin-1 receptor that is
capable of binding to and neutralizing interleukin-1 includes
employing a retroviral vector carrying a truncated interleukin-1
receptor gene which encodes a truncated and soluble active form of
the receptor. The expression of the novel interleukin-1 receptor
gene is controlled by regulatory sequences contained within the
vector that are active in eukaryotic cells. This recombinant viral
vector is transfected into cell lines stably expressing the viral
proteins in trans required for production of infectious virus
particles carrying the recombinant vector. These viral particles
are used to deliver the recombinant interleukin-1 receptor to the
recipient synovial cells by direct virus infection in vivo.
[0198] The soluble human interleukin-1 receptor to be inserted into
the retroviral vector may be generated by a polymerase chain
reaction (PCR). An oligonucleotide complementary to the 5' leader
sequence of the human interleukin-1 receptor
(GCGGATCCCCTCCTGAGAAGCT; SEQ ID NO: 5) and an oligonucleotide
complementary to a region just upstream from the transmembrane
domain of the interleukin-1 receptor (GCGGATCCCATGTGCTACTGG; SEQ ID
NO: 6) are used as primers for PCR. The primer for the region of
the interleukin-1 receptor adjacent to the trans-membrane domain
contains a single base change so that the lys codon at amino acid
336 of SEQ ID NOS: 1 and 2 (AAG) is changed to a stop codon (TAG).
By inserting a translation stop codon just upstream from the
transmembrane domain, a truncated form of interleukin-1 receptor
that is secreted by the cell is generated. A BamHI recognition
sequence (GGATCC) is added to the 5' end of the PCR primers, and
following amplification, the resulting interleukin-1 receptor
fragment is cloned into a BamHI site. A cDNA library from human
T-cells is used as a source for the interleukin-1 receptor cDNA. To
amplify the appropriate region of the interleukin-1 receptor from
the cDNA library, the complementary primers are added to the DNA
and 50 cycles of annealing, primer extension and denaturation are
performed using a thermocycler and standard PCR reaction conditions
well known by those persons skilled in the art. Following
amplification of the interleukin-1 soluble receptor using the PCR
process, the resulting fragment is digested with BamHI and inserted
into the pLJ retroviral vector. The pLJ retroviral vector is
available from A. J. Korman and R. C. Mulligan. See also Proc.
Natl. Acad. Sci., Vol. 84, pp. 2150-2154 (April 1987) co-authored
by Alan J. Korman, J. Daniel Frantz, Jack L. Strominger and Richard
C. Mulligan. Restriction analysis was performed to determine the
correct orientation of the insert. It could also be cloned into
MFG.
[0199] The retrovirus vector carrying the truncated interleukin-1
receptor is transferred into the CRIP (Proc. Natl. Acad. Sci., Vol.
85, pp. 6460-6464 (1988), O. Danos and R. C. Mulligan) packaging
cell line using a standard Ca.sub.3(PO.sub.4).sub.2 transfection
procedure and cells wherein the viral vector is stably integrated
and is selected on the basis of resistance to the antibiotic G418.
The viral vector containing the neomycin resistant (neo-r) gene is
capable of imparting resistance of the cell line to G418. The CRIP
cell line expresses the three viral proteins required for packaging
the vector viral RNAs into infectious particles. Moreover, the
viral particles produced by the CRIP cell line are able to
efficiently infect a wide variety of mammalian cell types including
human cells. All retroviral particles produced by this cell line
are defective for replication but retain the ability to stably
integrate into synovial cells thereby becoming an heritable trait
of these cells. Virus stocks produced by this method are
substantially free of contaminating helper-virus particles and are
also non-pathogenic.
[0200] More specifically, the truncated interleukin-1 gene can be
inserted into a retroviral vector under the regulation of a
suitable eukaryotic promoter such as the retroviral promoter
already contained within the gene transfer vector, such as for
example, the pLJ vector shown in FIG. 9. FIG. 9 shows the structure
of the pLJ interleukin receptor retroviral vector and partial
restriction endonuclease map. Reference numeral 10 shows the
interleukin-1 receptor inserted into a retroviral vector. Reference
numeral 12 indicates long terminal repeats (LTR's) at each end of
the structure of the pLJ interleukin receptor retroviral vector
shown in FIG. 8. These LTR's regulate the viral transcription and
expression of the interleukin-1 receptor. Bacterial gene encoding
resistance to the antibiotic neomycin (neo-r) is shown at reference
numeral 16. The Simian Virus 40 enhancer promoter (SV 40) is
indicated at reference numeral 18, and regulates the expression of
the neo-r gene. Reference numbers 20 and 22, respectively, show the
sites wherein the resulting interleukin receptor fragment is
cloned. It will be understood by those persons skilled in the art
that other vectors containing different eukaryotic promoters may
also be utilized to obtain a generally maximal level of
interleukin-1 receptor expression. The vectors containing the
truncated, and modified interleukin-1 receptor will be introduced
into a retroviral packaging cell line (CRIP) by transfection and
stable transformants isolated by selection for the expression of
the neomycin resistance gene also carried by the pLJ vector. The
CRIP cell line expresses all the proteins required for packaging of
the exogenous retroviral RNA. Viral particles produced by the
G418-selected CRIP cell lines will carry a recombinant retrovirus
able to infect mammalian cells and stably express the interleukin-1
truncated receptor. The viral particles can be used to infect
synovial cells directly in vivo by injecting the virus into the
joint space or alternatively in vitro as part of the ex vivo
transplantation methods of the present invention.
[0201] Another embodiment of this invention provides a method for
using the hereinbefore described viral particles to infect in
culture synovial cells obtained from the lining of the joint of a
mammalian host. The advantage of the infection of synovial cells in
culture is that infected cells harboring the interleukin-1 receptor
retroviral construct can be selected using G418 for expression of
the neomycin resistance gene. The infected synovial cells
expressing the interleukin-1 receptor can then be transplanted back
into the joint by intra-articular injection. The transplanted cells
will express high levels of soluble interleukin-1 receptor in the
joint space thereby binding to and neutralizing substantially all
isoforms of interleukin-1, including interleukin-1 alpha and
interleukin-1 beta.
[0202] The method used for transplantation of the synovial cells
within the joint is a routine and relatively minor procedure used
in the treatment of chronic inflammatory joint disease. Although
synovium can be recovered from the joint during open surgery, it is
now common to perform synovectomies, especially of the knee,
through the arthroscope. The arthroscope is a small, hollow rod
inserted into the knee via a small puncture wound. In addition to
permitting the intraarticular insertion of a fibre-option system,
the arthroscope allows access to surgical instruments, such that
synovial tissue can be removed arthroscopically. Such procedures
can be carried out under "spinal" anesthetic and the patient
allowed home the same day. In this manner sufficient synovium can
be obtained from patients who will receive this gene therapy.
[0203] The synovial cells (synoviocytes) contained within the
excised tissue may be aseptically recovered by enzymic digestion of
the connective tissue matrix. Generally, the synovium is cut into
pieces of approximately 1 millimeter diameter and digested
sequentially with trypsin (0.2% w/v in Gey's Balanced Salt
Solution) for 30 minutes at 37.degree. Centigrade, and collagenase
(0.2% w/v in Gey's Balanced Salt Solution) for 2 hours at
37.degree. Centigrade. Cells recovered from this digestion are
seeded into plastic culture dishes at a concentration of
10.sup.4-10.sup.5 cells per square centimeter with Ham's F.sub.12
medium supplemented with 10% fetal bovine serumn and antibiotics.
After 3-7 days, the culture medium is withdrawn. Non-adherent cells
such as lymphocytes are removed by washing with Gey's Balanced Salt
Solution and fresh medium added. The adherent cells can now be used
as they are, allowed to grow to confluency or taken through one or
more subcultures. Subcultivating expands the cell number and
removes non-dividing cells such as macrophages.
[0204] Following genetic manipulation of the cells thus recovered,
they can be removed from the culture dish by trypsinizing, scraping
or other means, and made into a standard suspension. Gey's Balanced
Salt Solution or other isotonic salt solutions of suitable
composition, or saline solution are suitable carriers. A suspension
of cells can then be injected into the recipient mammalian joint.
Intra-articular injections of this type are routine and easily
carried out in the doctor's office. No surgery is necessary. Very
large numbers of cells can be introduced in this way and repeat
injections carried out as needed.
[0205] Another embodiment of this invention is the gene produced by
the hereinbefore described method of preparation. This gene carried
by the retrovirus may be incorporated in a suitable pharmaceutical
carrier, such as for example, buffered physiologic saline, for
parenteral administration. This gene may be administered to a
patient in a therapeutically effective dose. More specifically,
this gene may be incorporated in a suitable pharmaceutical carrier
at a therapeutically effective dose and administered by
intra-articular injection.
[0206] In another embodiment of this invention, this gene may be
administered to patients as a prophylactic measure to prevent the
development of arthritis in those patients determined to be highly
susceptible of developing this disease. More specifically, this
gene carried by the retrovirus may be incorporated in a suitable
pharmaceutical carrier at a prophylactically effective dose and
administered by parenteral injection, including intraarticular
injection.
Example X
[0207] Fifty micrograms of a DNA plasmid vector molecule containing
the interleukin-1 beta coding sequence ligated downstream of the
CMV promoter was encapsulated within cationic liposomes, mixed with
Geys biological buffer and injected intraarticularly into the knee
joints of a rabbit. Forty eight hours subsequent to injection one
nanogram of interleukin-1 beta was recovered from the knee joint
area. Therefore, injection of the DNA containing liposome solution
within the region of the synovial tissue prompted fusion of the
liposomes to the synovial cells, transfer of the DNA plasmid vector
into synovial cells and subsequent expression of the IL-1 beta
gene. Additionally, it is possible to inject non-encapsulated
(i.e., naked) DNA into the joint area and monitor transfection of
the DNA vector into the synovial cells as determined by subsequent
expression of the IL-1 beta gene in synovial cells. Therefore,
either method may be utilized as a plausible alternative to the in
vitro manipulation of synovia also exemplified in the present
invention.
Example XI
[0208] The in vivo biological activity of the MFG-IRAP construct
was tested as the ability to suppress the effects of IL-1.beta..
Rabbit knees were injected with recombinant human IL-1.beta., known
to cause an increased concentration of leukocytes within the
afflicted joint space. Introduction of MFG-IRAP/HIG-82 cells into
rabbit knees strongly suppresses IL-1.beta. production of
leukocytes to the afflicted joint space. In contrast, control
HIG-82 cells do not suppress the leukocyte infiltration to the
joint space challenged with IL-1.beta. (see FIG. 10). Inhibition is
greatest at the lowest doses of human recombinant IL-1.beta.
(hrIL-1.beta.), as expected by the competitive mechanism through
which IRAP antagonizes IL-1. Therefore, this rabbit model confirms
that in vivo, intra-articular expression of IRAP is biologically
active and can protect the joint from inflammation provoked by
IL-1.
Example XII
[0209] This example further evaluates ex vivo delivery into rabbit
knee joints of the MFG-IRAP construct. As known, IRAP is an acidic
glycoprotein of approximately 25 kDa that functions as a natural
antagonist of the biological actions of interleukin-1 (IL-1) by
binding to IL-1 receptors. Unlike IL-1, IRAP has no agonist
activity, instead acting as a competitive inhibitor of the binding
of IL-1.
[0210] This example shows that in vivo expression of IRAP by
genetically modified synovial cells inhibits IL-1.beta.-induced
leukocyte infiltration into the joint space, synovial thickening
and hypercellularity, and loss of proteoglycans from articular
cartilage.
[0211] As disclosed within this specification, the preferred mode
of treating a patient through the ex vivo route will be by
transplanting genetically modified autologous synovial cells by
intra-articular injection. However, HIG-82 cells, easily maintained
in culture, were used for these experiments to show that
intra-articularly expressed IRAP is effective in inhibiting the
physiological sequelae of intra-articularly injected IL-1.
[0212] MFG-IRAP/HIG-82 cells or control (uninfected HIG-82) cells,
were transplanted into rabbit knees by intra-articular injection by
the methods disclosed within this specification. Briefly, cultures
of these cells were infected with MFG-IRAP. Media conditioned for 3
days by infected MFG-IRAP/HIG 82 cells were assayed for human IRAP
by ELISA assay using a commercial kit (R&D Systems,
Minneapolis, Minn., USA) and found to contain approximately 500 ng
IRAP/10.sup.6 cells. Western blotting confirmed the presence of
human IRAP of size 22-25 kDa. HIG-IRAP cells were trypsinized,
suspended in Gey's balanced salt solution and 1 ml of suspension,
containing 10.sup.7 cells, was injected intra-articularly into the
left knee joints of New Zealand White rabbits (2.5 kg). The
untreated control knees received a similar injection of
untransduced HIG-82 cells.
[0213] Three days following transplantation of the cells, knee
joints were challenged by various doses of a single intra-articular
injection of human recombinant IL-1.beta. dissolved in 0.5 ml Gey's
solution. Control knees were injected with 0.5 ml of Gey's
solution.
[0214] Eighteen hours after injection of hrIL-1.beta., rabbits were
killed and the knee joints evaluated histopathologically and for
expression of IRAP. Each joint was first lavaged with 1 ml Gey's
solution containing 10 mM EDTA. Cell counts in these washings were
performed with a hemocytometer. An aliquot was removed for
cytospinning and staining with `DiffQuick` (Baxter Scientific
Products) before examination under light microscopy. Washings were
then centrifuged. Supernatants were removed for IRAP ELISA and for
the determination of glycosaminoglycan (GAG) concentrations as an
index of cartilage breakdown. GAG determinations were carried out
with the dimethylmethylene blue assay (Farndale, et al., Biochim.
Biophys. Acta. 883:173-177 (1986)).
[0215] Synovia were dissected from the knee joints, fixed in 70%
ethanol, dehydrated, embedded in paraffin, sectioned at 5 .mu.m and
stained with hematoxylin and eosin.
[0216] An average of 2.5 ng human IRAP per knee was measured in
joint lavages 4 days following transplant of MFG-IRAP/HIG 82 cells.
Untreated, control knees receiving naive HIG-82 cells had no
detectable human IRAP (FIG. 11). To determine whether the observed
level of IRAP expression was sufficient to inhibit the effects of
IL-1 in vivo, increasing concentrations of IL-1.beta. (0-100 pg)
were injected into both the control and IRAP knees. As is shown in
FIG. 12a, injection of hrIL-1.beta. into control knees provoked a
marked leukocytosis which was strongly suppressed in the
genetically modified knees. There was also a statistically
significant reduction in the white blood cell count in knees
containing MFG-IRAP/HIG 82 cells which had not been injected with
IL-1. This may reflect the influence of IRAP upon the slight
inflammatory effect of injecting cells into joints. The degree of
suppression by IRAP decreased as the amount of injected
hrIL-1.beta. increased, in keeping with the competitive mode of
inhibition existing between IRAP and IL-1. No dose-response for
hrIL-1.beta. alone is evident in these particular experiments
because this specific batch of IL-1 was especially effective in
eliciting maximal response even at the lowest dose used.
[0217] Examination of cytospins (FIGS. 12b, 12c) revealed that most
of the infiltrating leukocytes were neutrophils and monocytes.
These preparations also serve to illustrate the efficiency with
which leukocytosis was suppressed by the IRAP gene. Ten times the
volume of lavage fluid is represented on the cytospin obtained from
the IRAP-producing knees (FIG. 12c) compared to the non-IRAP knees
(FIG. 12b).
[0218] To determine if intra-articularly expressed IRAP was able to
block cartilage breakdown, the concentration of glycosaminoglycans
(GAG) in joint lavages was determined. GAG analyses of the washings
from the control and IRAP expressing knees (FIG. 13) confirmed that
transfer of the IRAP gene partially inhibited breakdown of the
cartilaginous matrix in response to IL-1. Again, inhibition was
strongest at the lowest concentrations of IL-1 and was abolished at
the highest dose of IL-1 (FIG. 13).
[0219] In response to 10 pg of injected hrIL-1.beta., control
synovia became hypertrophic (FIG. 14a) and hypercellular (FIG.
14c). The increased cellularity of the synovia appeared to involve
both increased numbers of synoviocytes and infiltration by
leukocytes. In knees where MFG-IRAP/HIG 82 cells were present,
these changes were completely suppressed and the synovia were
nearly indistinguishable from control synovia (FIGS. 14b, 14d).
[0220] The ex vivo transfer of the human IRAP gene to the synovial
lining of rabbit knees clearly protects these joints from the
pathophysiological sequelae of subsequent intra-articular challenge
by hrIL-1.beta..
[0221] Measurements of the amounts of IL-1 present in human,
recombinant synovial fluids provide values in the range of 0-500
pg/ml (Westacott, et al., 1990, Ann Rheum Dis. 49: 676-681; Malvak,
et al., 1993, Arthritis Rheum 36: 781-789). Thus the amounts of
IRAP expressed intra-articularly during the present, short-term
experiments should be sufficient to block the biological activities
of IL-1 at the concentrations present in human arthritic
joints.
Example XIII
[0222] This example shows that the level of intraarticular IRAP
expressed subsequent to ex vivo transplantation of synoviocytes
transduced with MFG-IRAP is sufficient to inhibit several
pathophysiological changes associated with antigen-induced
arthritis of the rabbit knee. Intraarticularly expressed IRAP has
both a chondroprotective and anti-inflammatory effect during the
acute phase of this disease. Data disclosed in Example XII support
the contention that the invention as disclosed and claimed is a
marked improvement for treating connective tissue disorders such as
arthritis in comparison to delivery of proteins to the afflicted
joint. Example XII shows that ear vivo transfer of MFG-IRAP to the
rabbit knee as disclosed throughout this specification results in
the intraarticular accumulation of nanogram quantities of
glycosylated, biologically active IRAP. This present example shows
that this same gene therapy based product inhibits joint
pathologies in a rabbit model of human rheumatoid arthritis.
[0223] Young adult rabbits were subjected to a surgical, partial
synovectomy of the left knee joint to provide autologous cells.
These autologous cells were used to produce cultures of rabbit
synovial fibroblasts (type B synoviocytes) from these biopsies as
described in Example V and Example IX. Subconfluent cultures were
then transduced by infection with MFG-IRAP. Expression of the
transgene was confirmed by measuring the concentrations of human
IRAP in the conditioned media; values typically range from 100-500
ng IRAP/10.sup.6cells/3 days. Sister cultures of synoviocytes from
the same animal were infected with a BAG virus encoding the lac Z
and neo marker genes, and then selected for growth in the presence
of G418 (1 mg/ml) to serve as controls. Untransduced synoviocytes
were also used as additional controls.
[0224] During the period that the cells were being grown and
transduced, the donor rabbits were sensitized to ovalbumin by a
series of two intradermal injections of 5 mg ovalbumin emulsified
in adjuvant, given two weeks apart. Two weeks after the second
injection, an acute monarticular arthritis was initiated by the
injection of 5 mg ovalbumin dissolved in 1 ml saline into the right
knee joints. By this time the left, donor knees had regenerated
their synovia, and were each injected with 1 ml saline as
controls.
[0225] One day after the onset of arthritis, 10.sup.7 autologous
cells, transduced with either the IRAP gene, or lac Z and neo
genes, were injected into each arthritic knee, and each untreated,
non-arthritic knee. In other control experiments, knees were
injected with untransduced, autologous cells. Groups of rabbits
were killed 3 and 7 days later, corresponding to the middle and end
of the acute phase of this arthropathy. Knees were lavaged with 1
ml of saline, prior to the removal of synovial tissue and articular
cartilage for analysis.
[0226] Intraarticular expression of the MFG-IRAP transgene was
evaluated by ELISA measurements of human IRAP in the lavage fluids.
IRAP concentrations in the control, non-arthritic knees is shown in
FIG. 15. IRAP concentrations in the arthritic knees were always
several-fold higher than in normal knees at both time points (FIG.
15). In both non-arthritic and arthritic knees transduced with
MFG-IRAP, there was a slight decrease in IRAP expression with time.
No human IRAP could be detected in sera obtained from normal or
arthritic rabbits.
[0227] During the course of these experiments, the intraarticular
concentration of rabbit IL-1 in arthritic knees was in the range of
100-200 pg/knee (FIG. 16). No IL-1.alpha. could be detected by RIA
of the lavage fluids. Thus the concentration of IRAP within these
knees exceeded the concentration of IL-1 by factors of
approximately 10-50. Concentrations of IL-1 were lower in Day 7
arthritic knees receiving the IRAP gene (FIG. 16), suggesting that
IRAP had inhibited an autocrine amplification loop.
[0228] Two major pathologies predominate in the rheumatoid joint:
loss of articular cartilage and inflammation. The former occurs
through a combination of reduced synthesis and enhanced degradation
of the cartilaginous matrix. Whereas inflammation is manifest as a
synovitis accompanied by influx of leukocytes into the joint
space.
[0229] The onset of antigen-induced arthritis in this Example was
accompanied by cartilage destruction, as reflected in the increased
glycosaminoglycan (GAG) content of the lavage fluids (FIG. 17a),
and reduced synthesis of cartilage proteoglycans, as reflected by
lower uptake of .sup.35SO.sub.4.sup.2- (FIG. 17b). Knees expressing
the MFG-IRAP transgene, but not control knees, were substantially
protected from these changes. GAG release (FIG. 17a) was inhibited
55% on Day 4 and 32% on Day 7. Suppression of GAG synthesis (FIG.
17b) was inhibited by 68% on Day 4 and 100% on Day 7. The MFG-IRAP
transgene also strongly reduced the influx of leukocytes into the
joint space (FIG. 18), an effect that was stronger at Day 4 (65%
inhibition) than at Day 7 (38% inhibition); indeed, the difference
at Day 7 failed to reach statistical significance.
[0230] The MFG-IRAP construct is utilized to exemplify the
presently claimed invention. In addition to this construct, the ex
vivo based teachings of this specification have been utilized to
transfer to synovial cells and express in vivo DNA sequences
encoding human IL-1.alpha., human TNF-.alpha. soluble receptor
Types I and II, vIL-10, growth hormone, IL-6, and Lac Z and
neo.sup.r.
Example XIV
[0231] The methods disclosed throughout this specification were
utilized to express MFG-human IL-1 soluble receptor type I and type
II constructs (with neo.sup.r) within in vitro cultured
synoviocytes. These transfected synoviocytes produce 1-2
ng/10.sup.6 cells of IL-1 soluble receptor types I and II,
following neo-selection. The additional methods disclosed
throughout this specification may be utilized to procure in vivo
expression data regarding these MFG-human IL-1 soluble receptor
type I and type II constructs.
Example XV
[0232] Rabbits were injected intraarticularly in one knee joint
with a specific viral or non-viral vector disclosed in Table 2.
Untreated knees were injected with a control, usually with the
identical viral or non-viral vector with a different passenger
gene. At intervals from 2 days to 2 weeks following intraarticular
injection, rabbits were sacrificed and the knee joints harvested
and stained with X-Gal to assay for LacZ expression. The results
are depicted in Table 2. The recombinant adenovirus vector
comprising a CMV-LacZ fusion and the recombinant HSV vector
comprising a CMV-LacZ fusion generated the highest expression level
subsequent to intraarticular injection. The recombinant retroviral
vector, MFG-LacZ, was not expressed in vivo, lending credence to
the concept that retroviral vectors require actively dividing cells
during the infection process and the concomitant low mitotic
activity of synoviocytes in the joint lining.
[0233] However, an intra-articular injection of MFG-IRAP to
synovial cells of an inflamed joint space supported retroviral
transduction. Injection of MFG-IRAP into an inflamed rabbit knee
lead to the intraarticular accumulation of about 0.5 ng/knee at 7
days post injection. The untreated knee did not express human IRAP.
The example shows a MoMLV based retrovirus can be used for in vivo
gene delivery to inflamed joints.
3 TABLE 2 EXPRESSION In Vitro In Vivo LAC Z In Vivo DURATION VECTOR
PROMOTER cells (%) LEVEL (Days) Retrovirus (MFG) LTR 20-30 0 0 HSV
CMV 1 (toxic) +++ 5-7 Adenovirus CMV 100 +++ 14 Liposome CMV 20-30
+ 1-2 (DC-chol) None CMV 0 .+-. 1-2 (naked DNA) Level of in vivo
expression was evaluated subjectively on a scale of 0 -+++, based
upon the degree of staining with X-Gal. LTR + viral long terminal
repeat CMV + cytomegalovirus
Example XVI
[0234] In the following example, a high titer retroviral vector
carrying the gene for human IRAP was introduced by intraarticular
injection to rabbit knees.
[0235] MFG vectors containing the DNA sequence for IRAP were
prepared as described in Example III. Human Kidney 293T cells
(1.5.times.10.sup.6) were plated on 10 cm plates and transfected
the following day with 20 kg pMFG-IRAP, 15 .mu.g pMDg/p and 5 .mu.g
pCMV-VSV-G, plasmid expressing retroviral helper functions, by
calcium phosphate DNA precipitation. Conditioned medium was
harvested at 48 hr and 72 hr after transaction, cleared of debris
by low speed centrifugation, and filtered through 0.45 .mu.m
filters. The supernatant was concentrated by ultracentrifugation.
The control viral vector coded with LacZ gene was from the stable
virus producing cell lines, 293 GPG LacZ. Control knees received
MFG LacZ in a concentration of 5.times.10.sup.8/ml.
[0236] To determine the pMFG-LacZ viral titers, NIH 3T3 cells were
plated at 2.5.times.10.sup.5 per 6 cm plates 16 h before infection
and incubated 24 h with the viral supernatants and concentrated
viruses containing 8 .mu.g/ml polybrene. Viral titers were
determined as the average number of cells with blue nuclei,
multiplied by a factor to account for plate size and dilution of
viral stock. For pMFG-IRAP virus, the quantity of IRAP was measured
by ELISA.
[0237] A rabbit was injected with HIG-IL-1 cells in both rear knees
two days before the viral injection. 36 .mu.l of IRAP expressing
MFG vector was injected into the left knee and 300 .mu.l of
1.times.10.sup.6 cfu/ml pMFG-LacZ virus was injected into the right
knee. Lavages were done at Day 0, Day 2 and Day 7 and the fluid
used for an IRAP assay, WBC infiltration and pathological
dissection. Results are shown in FIG. 19. IRAP expression in knees
injected with MFG-IRAP increased over the seven days. IRAP
expression in control knees was zero for all days tested.
Example XVII
[0238] Adenoviral vectors were used to deliver genes encoding a
soluble IL-1 receptor (sIL-1R) type I IgG fusion protein and/or a
soluble TNF-.alpha. receptor (sTNF-.alpha.R) type I IgG fusion
directly to the knees of rabbits with antigen-induced
arthritis.
[0239] Adenoviral constructs were prepared by growing adenoviral
vectors in 293 cells. To show expression of the soluble proteins in
synovial cells, HIG-82 cells were grown to confluence in 10 cm
dishes in Ham's F12 media supplemented with 10% FCS and 1%
penicillin/streptomycin. The cells were washed, and
7.times.10.sup.7 pfu of adenovirus suspended in 0.5 ml of saline
was added. After incubation at 37.degree. C. for 1 hr, the medium
was replaced. After twenty-four hours the medium was replaced with
Neuman & Tytell serumless media; forty-eight hours later the
culture supernatant was removed and stored at -20.degree. C.
[0240] Tissue culture supernatants were separated and resolved by
SDS-PAGE. Proteins were then transferred to nitrocellulose at 100 V
for 1 hr at 4.degree. C. in 50 mM tris-HCl pH 8.3, 200 mM glycine,
1% SDS and 20% methanol. Membranes were blocked with 5% non-fat
dried milk in 1.times.PBST (140 mM NaCl, 2 mM KCl, 10 mM
Na.sub.2HPO.sub.4, 2 mM KH.sub.2PO.sub.4, pH 7.2 and 0.025%
Tween.RTM. 20) for 1 hr at room temperature. Peroxidase labeled
goat anti-mouse IgG whole molecule (Sigma) diluted 1:20,000 in 5%
milk/1.times.PBST was used to probe the membranes for 1 hr at room
temperature. After extensive washing with 1.times.PBST, proteins of
interest were detected by enhanced chemiluminescence and exposure
to film.
[0241] Rabbits were sensitized to ovalbumin by a series of two
intradermal injections of 5 mg ovalbumin emulsified in the first
injection in Freund's complete adjuvant and Freund's incomplete
adjuvant in the second. Two weeks following the second injections
an acute articular arthritis was initiated in both hind knees of
rabbits by the intraarticular injection of 5 mg ovalbumin dissolved
in 1 ml saline. Twenty-four hours after induction of
antigen-induced arthritis (a.i.a), 7.times.10.sup.7 pfu of
adenovirus encoding either the soluble TNF.alpha. and/or IL-1
receptors or lacZ was suspended in 0.2 ml of saline and injected
into the joint space of the knee through the patellar tendon.
[0242] To lavage rabbit knee joints, 1 ml of GBSS plus 10 mM EDTA
was injected into the joint space through the patellar tendon.
After manipulation of the joint, the needle was reinserted and the
fluid aspirated. Leukocytes in recovered lavage fluids were counted
using a hemocytometer. Human TNF.alpha. receptor type I
concentrations in conditioned media, lavage fluids and blood sera
were measured as directed using ELISA kits from R & D
Systems.
[0243] To measure proteoglycan synthesis rates, articular cartilage
was first shaved from the femoral condyles and weighed.
Approximately 30 mg of cartilage was then incubated in 500 ul of
Neuman Tytell serumless medium with 40 uCi of
.sup.35SO.sub.4.sup.-2 for 24 hrs at 37.degree. C. Afterward, the
media were recovered and stored at -20.degree. C. Proteoglycans
were extracted from the cartilage shavings by incubation for 24 hrs
in 0.5 ml of 0.5 M NaOH at 4.degree. C. with gentle shaking.
Following chromatographic separation of unincorporated
.sup.35SO.sub.4.sup.-2 using PD-10 columns (Pharmacia),
radiolabeled GAGs released into the culture media or recovered by
alkaline extraction were quantitated using scintillation
counting.
[0244] To quantitate glycosaminoglycans (GAGs) released into the
joint space as a result of cartilage proteoglycan degradation,
recovered lavage fluids were first centrifuged at 12,000 g for 10
min to remove debris, and the supernatants recovered. Aliquots of
100 ul were treated with papain. Papain suspension (type III, 20
.mu.l, 19 units.mg protein:Sigma) was added to 1 ml of buffer
containing 10 mM sodium EDTA and 0.4 M sodium acetate, pH 5.2. The
papain solution (100 .mu.l) was added to lavage fluid (100 .mu.l)
and incubated overnight at 60.degree. C. Papain was inactivated by
the addition of iodoacetic acid to a final concentration of 4 mm.
The samples were then centrifuged at 12,000 g for 10 min.
Afterward, 2 units of hyaluronate lyase was added and the samples
incubated at 37.degree. C. overnight. Determination of sulfated GAG
levels was performed in a colormetric dye-binding assay using 1, 9
dimethylene blue as previously described. See, for example,
Farndale et al., Biochim. Biophys. Acta. 883: 173-177 (1986).
[0245] For histological analyses, tissues harvested from dissected
knees were first fixed in 10% formalin for 24 hrs. Tissues
containing bone and cartilage were subsequently decalcified by
incubation in EDTA. The fixed tissues were imbedded in paraffin,
sectioned at 5 um and stained with hematoxylin and eosin.
[0246] To determine luciferase content in rabbit tissues, following
sacrifice tissues were dissected, immediately placed on dry ice,
and later stored at -80.degree. C. At the time of assay, tissues
were thawed on ice, and approximately 0.65 g of each was finely
chopped using a scalpel. The minced tissue was mixed with 2 mls
0.25 Tris-HCl, pH 7.5, and the mixture homogenized by hand with a
tightly fitting dounce homogenizer. The homogenate was then
collected, put through 3 freeze thaw cycles and centrifuged 15 min
at low speed in a table-top clinical centrifuge. The supernatant
was collected and luciferase activity in 100 ul was measured in a
luminometer as directed using a luciferase assay system from
Promega. To measure luciferase activity in leukocytes, cells
recovered from lavage fluid or blood were counted using a
hemocytometer. About 5.times.10.sup.6 cells were then pelleted by
centrifugation at 10,000.times.g for 2 min. Leukocytes were
resuspended in 200 .mu.l of 0.25 M Tris-HCl, pH 7.5 and put through
3 freeze-thaw cycles. Debris from the cell lysate was pelleted by
centrifugation at 10,000.times.g for 2 min. Luciferase activity in
100 .mu.l was then quantitated as above.
[0247] To determine levels of expression of the soluble TNF.alpha.
and IL-1 receptor-Ig fusion constructs following adenoviral
delivery to synoviocytes, approximately 3.times.10.sup.6 cells of a
lapine synovial fibroblast line, HIG-82, were first infected in
vitro with 7.times.10.sup.7 pfu of either the sTNF-.alpha.R or
sIL-1R adenoviral construct (Ad.sTNF-RI-Ig and Ad.sIL-1RI-Ig,
respectively). After 48 hrs culture in serumless media, culture
supernatants were collected and analyzed. As shown in FIG. 20,
ELISA measurements of the sTNF-.alpha.R detected greater than 300
ng per 5 ml of medium per 10.sup.6 cells. Western-blot analyses
using antibody specific for the murine IgG1 portion of the receptor
fusion molecule demonstrated that protein of the approximate
predicted size of the IL-1 receptor-Ig fusion protein (IL-1
inhibitor) was produced by the infected synovial cells and secreted
at a level about 50% of that of the TNF.alpha. receptor-Ig fusion
(TNF.alpha. inhibitor). Furthermore, the biological activity of the
soluble IL-1 and TNF.alpha. receptors was demonstrated by their
ability to partially block the effects of constitutively expressed
human IL-1.beta. in the rabbit knee and TNF.alpha. induction of
NF-kB.
[0248] To test the ability of the respective receptors to inhibit
the acute inflammatory effects of a.i.a. in the rabbit knee joint,
a.i.a. was induced in both knees of 32 rabbits. Twenty-four hours
post induction, approximately 7.times.10.sup.7 pfu of either
Ad.sIL-1RI-Ig, Ad.sTNF-RI-Ig, or both adenoviral vectors were
injected intraarticularly into the left knee of three sets of eight
rabbits. 7.times.10.sup.7 pfu of adenovirus encoding lacZ was
injected into the right knee of all 32 rabbits. A control group of
8 rabbits received an equal volume injection of saline in the left
knee. Three days after injection of the adenovirus, both knees of
each rabbit were lavaged with 1 ml of saline solution. At seven
days post infection, the rabbits were sacrificed, the knees
lavaged, dissected and analyzed for effects of transgene
expression. It should be noted that injections of adenovirus
exceeding 1.times.10.sup.9 pfu proved inflammatory in naive rabbit
joints, and exacerbated the pathology in knees with a.i.a., greatly
increasing leukocytic infiltration into the synovial fluid and
overt pathology of the joint. This was also accompanied by a loss
of transgene expression in 3 to 7 days. Adenoviral doses of
7.times.10.sup.7 pfu or less, however, produced no detectable
leukocytic infiltrate into synovial fluid for up to 14 days post
injection and maintained high levels of gene expression (data not
shown).
[0249] ELISA measurements of TNF.alpha. receptor levels in
recovered lavage fluids detected approximately 20 ng/ml at days 3
and 7 in knees receiving Ad.sTNF-RI-Ig alone. Significant levels of
the receptor were not detected in untreated joints receiving
Ad.LacZ (FIG. 21). Similarly, in knees receiving a mixture of
adenovirus encoding the TNF.alpha. and IL-1 receptors together
TNF.alpha. receptor expression of greater than 15 ng/ml was
observed at both Day 3 and 7. Again, the TNF receptor was not
detected in knees not receiving the Ad.sTNF-R virus or in blood
sera.
[0250] As a quantitative index of inflammation in the rabbit knees,
leukocytes in recovered lavage fluids from each group of rabbits
were counted and compared. As shown in FIG. 22a, in the control
group of rabbits which were injected with Ad.LacZ in the right knee
and saline in the left knee, both knees were similarly inflamed
with mean levels of infiltrating leukocytes exceeding
2.times.10.sup.7 per ml of recovered fluid at both Day 3 and 7
post-adenoviral infection. In the group of rabbits injected with
Ad.sTNF-RI-Ig in the left knee and Ad.LacZ in the right, equally
high numbers of infiltrating leukocytes were seen in both knees at
Day 3. By Day 7, a modest decline in the mean leukocytic
infiltration was observed in knees receiving the Ad.sTNF-RI-Ig
receptor. Rabbit knees injected with Ad.sIL-1RI-Ig showed a mean
65% reduction in infiltration over the control group of rabbits at
Day 3 which increased to about 80% by Day 7. Interestingly, in this
group of rabbits, the untreated knees which were injected with
Ad.LacZ also showed a reduction in infiltration at both Day 3 and 7
relative to the control group of rabbits. Rabbits injected in the
left knee with both Ad.sIL-1RI-Ig and Ad.sTNF-RI-Ig viruses showed
a nearly 85-90% reduction in mean leukocytic infiltration at both
Day 3:and 7 over the control group of rabbits, which was
accompanied by an 80% reduction in the untreated Ad.LacZ+ knee.
[0251] To determine relative cartilage matrix degradation in the
rabbit knees, glycosaminoglycans (GAG) released into synovial fluid
as a result of proteoglycan breakdown were measured in recovered
lavage fluids. The results of these assays, shown in FIG. 22b,
correspond closely with the relative levels of leukocytic
infiltration from FIG. 22a. The control group rabbits receiving
injections of Ad.LacZ and saline in opposing knee joints, had
similarly high levels of GAGs in the lavage fluids of both knees at
both Day 3 and 7. Rabbits injected with Ad.sTNF-RI-Ig and Ad.LacZ
in opposite knees likewise had elevated GAGs in both knees at both
time points. However, rabbits injected in one knee with Ad.IL-1
receptor showed a greater than 50% reduction in mean GAG levels at
both Day 3 and 7 over the control group rabbits. By Day 7, the
untreated knees, which had been injected with Ad.lacZ also showed
nearly a 40% reduction in GAG release. Rabbit knees which were
injected with virus encoding both viruses had a 65% reduction in
mean GAG level, while GAGs in opposing Ad.LacZ+ knees were reduced
over 50%.
[0252] To test the possibility that the observed contralateral
joint effect is that adenoviral particles or virally transduced
cells were migrating from the joint of injection to the opposite
knee or other organs thereby causing a systemic anti-inflammatory
effect, an adenoviral vector encoding the firefly luciferase
reporter gene (Ad.luciferase) was utilized. This reporter gene is
described by deWet, et al., Mol. Cell. Biol. 7:725:737 (1987) and
Ow, et al., Science, 234:856-859 (1986). Similar to experiments
described above, a.i.a. was induced in both knees of two rabbits.
Twenty-four hours post induction, 1.5.times.10.sup.9 pfu of the
Ad.luciferase virus was injected into one knee of each rabbit,
while the untreated knee received 7.times.10.sup.7 pfu of Ad.lacZ.
At 7 days post injection, the rabbits were bled and sacrificed, the
joints lavaged, and the joint capsules of both knees harvested
along with regional lymphoid tissue, heart, liver, lung, spleen and
kidney. Recovered tissues and leukocytes were then analyzed for the
presence of intracellular luciferase activity. As shown in FIG. 24,
a low level of luciferase activity was observable in lymphoid
tissued obtained near the site of injection and in synovial tissue
of the untreated knee joint relative to knees receiving the
Ad.luciferase vector. Analysis of similar numbers of leukocytes
obtained from both knee joints and peripheral blood showed
luciferase activity in leukocytes obtained from the injected knee
and a lower level in the untreated knee. No appreciable activity
was detected in circulating leukocytes. These results demonstrate
that a population of transduced leukocytes can migrate to the
opposing inflamed knee joint suggesting a possible mechanism for
the observed contralateral effect.
[0253] The results of this example show that direct intraarticular
delivery of adenoviral vectors encoding IL-1 and TNF inhibitors has
an anti-inflammatory effect that is not limited to the injected
joint.
[0254] The results of this example further demonstrate that
intraarticular adenoviral gene delivery of soluble receptor
molecules for IL-1 and TNF.alpha. can partially block an acute
inflammatory response in a.i.a. in the rabbit knee. Delivery of the
IL-1 soluble receptor gene alone was found to be considerably more
effective at inhibiting synovial fluid leukocytosis and cartilage
matrix degradation than the TNF.alpha. inhibitor. However,
simultaneous gene delivery of both inhibitors was the most
effective, resulting in a net reduction in leukocytosis, cartilage
matrix degradation and synovitis. The enhanced therapeutic effects
observed following injection of both Ad.sIL-1RI-Ig and
Ad.sTNF-RI-Ig demonstrates that the strategies of the present
invention directed at blocking the activity of both TNF.alpha. and
IL-1 are considerably more effective in the treatment of RA than
targeting either cytokine individually. The coinjection of both
cytokines into the joints of rabbits was found to stimulate
signficantly greater leukocytic infiltration into the synovial
fluid than when either was administered alone. This observation is
consistent with RA being a disorder driven by the imbalance of a
cytokine network and that therapies which target the activities of
multiple inflammatory effectors would be the most beneficial.
[0255] Surprisingly, these anti-inflammatory responses were also
apparent in untreated knees which received adenovirus encoding the
lacZ gene, suggesting that local intraarticular gene therapy may
have distal or systemic anti-inflammatory effects. This example,
therefore, further demonstrates that intraarticular gene delivery
of the IL-1 and TNF.alpha. inhibitors has systemic
anti-inflammatory effects, or at least therapeutic effects which
extend to the untreated knee joint. If this observed untreated
joint effect was due to therapeutic levels of inhibitor molecules
leaking from the joint space to the circulation, it would seem that
they should be detectable in the serum or in lavage fluids
recovered from the untreated joint. However, sTNF.alpha. receptor
was not detected outside the injected joint. In contrast, cell
trafficking studies conducted using the Ad.luciferase vector
indicate that a percentage of leukocytes transduced by adenovirus
in one joint migrate to the opposing inflamed joint. This indicates
that even though significant levels soluble TNF.alpha. receptor
were not detected in animal fluids by ELISA, a population of
leukocytes capable of expressing the inhibitor genes does not
indeed migrate from the site of transduction, and travel either via
the circulatory or lymphatic system.
[0256] Histological analyses of tissue recovered from the knees of
each group of rabbits is shown in FIG. 23. When compared to tissue
recovered from normal, naive rabbits (FIG. 23a), sections from the
Ad.lacZ/saline group showed a severe synovitis typical of that seen
with a.i.a. (FIG. 23b), as reported, for example, by Edwards, et
al., Br. J. Exp. Path. 69:739-748 (1988). The synovium was
dramatically thickened, highly fibrous, and hypercellular with
increased numbers of synovial cells and infiltrating mononuclear
leukocytes. A small population of polymorphonuclear leukocytes was
also present. Treatment of joints with Ad.sTNF-RI-Ig alone had
little observable effect on the severity of synovitis in either the
treated (FIG. 23c) or untreated joint (FIG. 23d). Synovial sections
from this group of rabbits were largely indistinguishable from that
of the a.i.a. knees from the Ad.lacZ/saline group. Although
somewhat variable among the rabbits within the group, knees
receiving intraarticular injection of Ad.sIL-1RI-Ig (FIG. 23e)
showed a limited but distinct reduction in synovitis. The general
pathology was the same as the Ad.lacZ/saline group, but the
severity was observably reduced. Opposing contralateral joints also
had a detectable reduction in synovitis (FIG. 23f). Knees of
rabbits receiving both the Ad.sIL-1RI-Ig and Ad.sTNF-RI-Ig vectors
together showed a marked reduction in synovial pathology (FIG.
23g). As with the IL-1 inhibitor, the extent of the response varied
somewhat between rabbits within the group. In general, the synovium
was considerably less hypertrophied, and fibrous; infiltrating
mononuclear leukocytes were clearly apparent, but in much lower
numbers than the Ad.lacZ/saline a.i.a. knees. Contralateral knees
within this group also showed a significant reduction in synovitis
(FIG. 23h).
[0257] The results of these experiments clearly demonstrate that
adenoviral vectors can be used to efficiently deliver potentially
therapeutic genes directly to intraarticular tissues and that
subsequent expression of these genes can occur at levels sufficient
to observe beneficial effects, both in the treated joint and distal
joints, in an animal model of arthritis.
Example XVIII
[0258] Female DBA/1 lacJ mice were obtained from Jackson
Laboratories, Bar Harbor, Me. An adenovirus vector was prepared
according to the methods of Example XVII, only using a DNA sequence
encoding for vIL-10. vIL-10 is a variation of interleukin-10
produced by the Epstein Barr Virus. Mice were injected with Bovine
type II Collagen (CII) on Day 0 to product a collagen induced
arthritis (c.i.a.).
[0259] Type II collagen-induced arthritis (CIA) in mice is an
experimental model of arthritis with a number of pathological,
immunological and genetic features in common with rheumatoid
arthritis. This disease is induced by immunization of susceptible
strains of mice with type II collagen, the major component of joint
cartilage and leads to progressive, inflammatory arthritis in the
majority of immunized animals. Collagen-induced arthritis is
characterized clinically by erythema and edema, with affected paw
width increases of typically 100%. Histopathology of effected
joints reveals synovitis, pannus formation, and cartilage and bone
erosion. Clinically, paw swelling is followed by distortion and
eventually ankylosis as seen in human RA. This model is now well
established for testing of immunotherapeutic approaches to treating
joint diseases, and has been successfully employed for the study of
both biological and pharmacological agents for treatment of
rheumatoid arthritis.
[0260] The arthritis develops gradually, and vectors were
administered on Day 24 before swelling begins. The Ad.vIL-10
vectors were injected into left front and left rear mouse paws at
concentrations of 10.sup.7, 10.sup.6 or 10.sup.5 pfu, as indicated
in FIG. 30 at Day 24 after collagen injection. Right front and rear
paws were uninjected. Results shown in FIG. 25 illustrate that on
Day 29 following onset of arthritis paws injected with Ad.vIL-10
had no incidence of arthritis, while over 60% of control paws had
arthritis. On days 33 and 42, the number of Ad.vIL-10 paws that had
arthritis was about half the number of control paws that had
arthritis. Similar results were obtained when Ad.vIL-10 was
injected into rear paws, while front paws were uninjected. These
results are shown in FIG. 26. Similar results were also seen with
diagonal injection of Ad.vIL-10 into the front right and left rear
paws while the opposite paws were uninjected. As shown in FIG. 27,
over 50% of control paws had arthritis after Day 29; after clays 33
and 42, about three times as many control paws had arthritis than
paws injected with Ad.vIL-10. The amount of vIL-10 expressed by a
paw injected with Ad.vIL-10 and protected from arthritis and a
control paw was determined by ex vivo production following
euthanasia and removal of the paw. Paws were incubated in a culture
media; the level of vIL-10 in the culture media was determined by
ELISA. Results are shown in FIG. 28; Ad.vIL-10 injected paws had
almost five times the expression of vIL-10 when compared to control
paws. A similar determination was made comparing an injected paw
not protected from arthritis and a control paw. As shown in FIG.
29, the level of expression of vIL-10 in both paws was about the
same.
[0261] In a further investigation, footpads of mice were injected
in vivo with Ad.vIL-10, prepared as described above. Forty-eight
hours after injection, the mice were sacrificed and draining lymph
nodes were surgically removed. Lymph node cells were cultured for
48 hours in vitro. More specifically, the lymph nodes cut out of
the mice were put in 24 well plate with culture medium and allowed
to sit. The supernatant was tested for the presence of vIL-10 by
ELISA. As shown in FIG. 30, the higher the concentration of
Ad.vIL-10 injected, the greater the amount of vIL-10 was
expressed.
[0262] This example demonstrates that in vivo injection of
adenovirus carrying the DNA sequence for vIL-10 results in
expression of vIL-10 in mouse paws. This expression provides a
protective effect against an arthritis challenge. Mouse paws which
withstood the arthritis challenge were shown to have vIL-10
expression almost five times as high as that in control paws,
thereby linking the vIL-10 expression to the protective effect.
Example XIX
[0263] An adenovirus vector was prepared according to the methods
of Example XVII, only using a DNA sequence encoding for iNOS
instead of sTNF-.alpha.R or sIL-1R. Either 10.sup.7, 10.sup.6 or
10.sup.5 pfu of Ad.iNOS vector, as indicated in FIG. 31, were
injected by intraarticular injection to the left knees of rabbits.
Right knees, which served as the control, received an injection of
the Ad.LacZ vector. FIG. 31a shows WBC count in left and right
knees for Days 2 through 7. FIG. 31b shows the GAG release for both
the Ad.iNOS and control knees. FIG. 32 shows a measure of NOS
activity expressed as CMP/mg protein for days 2 through 7. These
results suggest that in knees expressing iNOS, elevated NO,
elevated inflammation and elevated GAG release were observed. Thus,
the iNOS caused joint inflammation and cartilage matrix breakdown.
The example also shows in vivo expression of a gene.
Example XX
[0264] Ad.vIL-10 vectors were prepared as described in Example
XVIII. An antigen induced arthritis was induced in the knees.
Following the initiation, half of the rabbit knees were injected
with Ad.vIL-10 in concentration of 5.times.10.sup.7 pfu by a single
injection into the joint. Control knees received Ad.LacZ. As shown
in FIG. 33, leukocyte infiltration was measured 3 and 7 days after
injection. Knees receiving the vIL-10 injection had a marked
decrease in leukocyte infiltration when compared to control knees.
Untreated knees, which did not receive an injection of either
Ad.vIL-10 or Ad.LacZ, also showed a marked reduction in leukocyte
infiltration. Levels of GAG released was also markedly lower in
vIL-10 and untreated knees as compared with control knees. (FIG.
34). GAG synthesis rate in vIL-10 knees and untreated knees was
higher than that of control knees (FIG. 35). As shown in FIG. 36,
vIL-10 expression increased from Day 3 to day 7, demonstrating that
the methods of the present invention were effective in introducing
a vector containing a gene into a host joint. FIG. 37 provides
pictures of the histological analysis of both the Ad.vIL-10
injected knee (FIG. 37c) and the untreated knee (FIG. 37d), which
shows a significant reduction in synovitis compared to the Ad.LaZ
control knees (FIG. 37b). The synovium in the Ad.vIL-10 treated
joint resembles that of the normal, untreated joint (FIG. 37a).
This example further illustrates that the methods of this invention
can be used to introduce a therapeutic gene to a host, and
subsequent expression of the gene will yield a therapeutic benefit
in the host. vIL-10 is shown to block inflammatory cell
infiltration into the joint of a.i.a. induced rabbits, and may also
be chondroprotective and able to block synovial cell hyperplasia.
This therapeutic benefit is seen both in the joint injected with
the vector containing the gene and the untreated joint.
Example XXI
[0265] C.I.A. was induced in mice as described in Example XVIII.
About 24 days after collagen injection, rear paws were injected
with either Ad.vIL-10 or Ad.luciferase. Injections were done either
intraperitoneally (IP) or intravenously (IV). At 4-5 week post
treatment, the treated animals develop swollen paws which upon
histological analysis resemble human disease. Moreover, the animals
have elevated levels of antibodies to type II collagen. The mice
were then scored for the percentage of swollen paws. As shown in
FIG. 38, delivery of Ad.vIL-10 to the rear paws of the arthritic
mice completely blocks paw swelling. In contrast, injection of
Ad.luciferase had no appreciable effect on the percent of paws
which became swollen. While there was an effect of injection of
vIL-10 in the rear paws on swelling in the front untreated paw,
there was no therapeutic effect of Ad.vIL-10 when delivered
systemically by IV or IP injection (FIG. 39). This result suggests
that local delivery and expression of vIL-10 has a stronger
therapeutic effect than general systemic administration.
[0266] It will be appreciated by those skilled in the art that this
invention provides a method for introducing into a target cell of a
mammalian host in vitro, or in the alternative in vivo, at least
one gene that encodes for at least one protein or peptide with
therapeutic properties. This method includes employing genes having
DNA that is capable of maintenance and expression.
[0267] It will be appreciated by those skilled in the art that this
invention provides a method for introducing at least one gene
encoding a product into at least one target cell of a mammalian
host for treating an arthritic condition of the mammalian host.
[0268] It will be understood by those skilled in the art that this
invention provides a method to repair and regenerate the connective
tissue of a mammalian host.
[0269] It will be further understood that this invention provides a
method to produce an animal model for the study of connective
tissue pathology.
[0270] It will be appreciated by those persons skilled in the art
that this invention provides a method of using and a method of
preparing numerous genes including a gene encoding a soluble
interleukin-1 receptor that is capable of binding to and
neutralizing substantially all isoforms of interleukin-1, and thus
substantially protect cartilage of a mammalian host from
pathological degradation. In addition, it will be understood by
those persons skilled in the art that the method of using the gene
of this invention will reduce inflammation, protect soft tissues of
the joint and suppress the loss of bone that occurs in patients
suffering with joint pathologies.
[0271] It will be appreciated by those persons skilled in the art
that the viral vectors employed in this invention may be employed
to transfect target cells in vivo, or in culture, such as by direct
intraarticular injection or transplantation of autologous target
cells from the patient transduced with the retroviral vector
carrying a gene or genes of interest.
[0272] The present invention provides a method for preparing
various vectors, both viral and non-viral, that contain DNA
sequences encoding for numerous genes of interest. These genes are
known by those skilled in the art to be useful in the therapeutic
treatment of various cartilage defects and connective tissue
disorders. The present invention demonstrates that in vivo
infection of target cells in the joint of a host results in in vivo
expression of the protein encoded by the DNA sequence. Such
expression then leads to the prevention and/or alleviation of
symptoms common to numerous connective tissue disorders. Thus, the
methods of the present invention provide a means for treating a
patient by in vivo infection of the joints of the patient with a
vector containing a DNA sequence encoding a therapeutic
product.
[0273] The present invention also provides a method for treating a
patient for a cartilage defect or connective tissue disorder by
introducing two or more DNA sequences encoding two different
products of interest. Introduction can be simultaneous or in
succession. Multiple genes can all be placed on one vector or on
separate vectors. Expression of two or more different genes has an
enhanced therapeutic benefit.
[0274] The present invention also provides a method for treating a
host in which one joint is treated and a therapeutic benefit is
realized both in the treated joint and in other joints of the host
as well.
[0275] Whereas particular embodiments of this invention have been
described above for purposes of illustration, it will be evident to
those persons skilled in the art that numerous variations of the
details of the present invention may be made without departing from
the invention as defined in the appended claims.
Sequence CWU 1
1
* * * * *