U.S. patent application number 10/354774 was filed with the patent office on 2003-11-20 for soluble recombinant botulinum toxin proteins.
This patent application is currently assigned to Allergan, Inc., Allergan Botox Limited. Invention is credited to Thalley, Bruce S., Williams, James A..
Application Number | 20030215468 10/354774 |
Document ID | / |
Family ID | 29423846 |
Filed Date | 2003-11-20 |
United States Patent
Application |
20030215468 |
Kind Code |
A1 |
Williams, James A. ; et
al. |
November 20, 2003 |
Soluble recombinant botulinum toxin proteins
Abstract
The present invention includes recombinant proteins derived from
Clostridium botulinum toxins. In particular, soluble recombinant
Clostridium botulinum type A, type B and type E toxin proteins are
provided. Methods which allow for the isolation of recombinant
proteins free of significant endotoxin contamination are provided.
The soluble, endotoxin-free recombinant proteins are used as
immunogens for the production of vaccines and antitoxins. These
vaccines and antitoxins are useful in the treatment of humans and
other animals at risk of intoxication with clostridial toxin.
Inventors: |
Williams, James A.;
(Madison, WI) ; Thalley, Bruce S.; (Madison,
WI) |
Correspondence
Address: |
STOUT, UXA, BUYAN & MULLINS LLP
4 VENTURE, SUITE 300
IRVINE
CA
92618
US
|
Assignee: |
Allergan, Inc., Allergan Botox
Limited
2525 Dupont Drive
Irvine
CA
92612
|
Family ID: |
29423846 |
Appl. No.: |
10/354774 |
Filed: |
January 30, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10354774 |
Jan 30, 2003 |
|
|
|
08704159 |
Aug 28, 1996 |
|
|
|
10354774 |
Jan 30, 2003 |
|
|
|
08405496 |
Mar 16, 1995 |
|
|
|
5919665 |
|
|
|
|
Current U.S.
Class: |
424/239.1 ;
435/252.3; 435/70.21; 530/388.4 |
Current CPC
Class: |
C07K 16/02 20130101;
C07K 2317/34 20130101; C07K 2319/00 20130101; Y02A 50/30 20180101;
Y02A 50/469 20180101; C07K 14/245 20130101; C07K 14/33 20130101;
C07K 16/1282 20130101; A61K 2039/505 20130101; A61K 39/00
20130101 |
Class at
Publication: |
424/239.1 ;
435/252.3; 435/70.21; 530/388.4 |
International
Class: |
A61K 039/08; C12P
021/04; C12N 001/21; C07K 016/12 |
Claims
1. A host cell containing a recombinant expression vector, said
vector encoding a protein comprising at least a portion of a
Clostridium botulinum toxin, said toxin selected from the group
consisting of type B toxin and type E toxin.
2. The host cell of claim 1, wherein and said host cell is capable
of expressing said protein at a level greater than or equal to 5%
of the total cellular protein.
3. The host cell of claim 1, wherein and said host cell is capable
of expressing said protein as a soluble protein at a level greater
than or equal to 0.25% of the total soluble cellular protein.
4. The host cell of claim 1, wherein said host cell is an
Escherichia coli cell.
5. The host cell of claim 1, wherein said host cell is an insect
cell.
6. The host cell of claim 1, wherein said host cell is a yeast
cell.
7. A host cell containing a recombinant expression vector, said
vector encoding a fusion protein comprising a non-toxin protein
sequence and at least a portion of a Clostridium botulinum toxin,
said toxin selected from the group consisting of type B toxin and
type E toxin.
8. The host cell of claim 7, wherein said portion of said toxin
comprises the receptor binding domain.
9. The host cell of claim 7, wherein said non-toxin protein
sequence comprises a poly-histidine tract.
10. A vaccine comprising a fusion protein, said fusion protein
comprising a non-toxin protein sequence and at least a portion of a
Clostridium botulinum toxin, said toxin selected from the group
consisting of type B toxin and type E toxin.
11. The vaccine of claim 10 further comprising a fusion protein
comprising a non-toxin protein sequence and at least a portion of
Clostridium botulinum type A toxin.
12. The vaccine of claim 10, wherein said portion of said
Clostridium botulinum toxin comprises the receptor binding
domain.
13. The vaccine of claim 10 wherein said non-toxin protein sequence
comprises a poly-histidine tract.
14. The vaccine of claim 10, wherein said vaccine is substantially
endotoxin-free.
15. A method of generating antibody directed against a Clostridium
botulinum toxin comprising: a) providing in any order: i) an
antigen comprising a fusion protein comprising a non-toxin protein
sequence and at least a portion of a Clostridium botulinum toxin,
said toxin selected from the group consisting of type B toxin and
type E toxin, and ii) a host; and b) immunizing said host with said
antigen so as to generate an antibody.
16. The method of claim 15, wherein said antigen further comprises
a fusion protein comprising a non-toxin protein sequence and at
least a portion of Clostridium botulinum type A toxin.
17. The method of claim 15, wherein said portion of said
Clostridium botulinum toxin comprises the receptor binding
domain.
18. The method of claim 15 wherein said non-toxin protein sequence
comprises a poly-histidine tract.
19. The method of claim 15 wherein said host is a mammal.
20. The method of claim 19 wherein said mammal is a human.
21. The method of claim 15 further comprising step c) collecting
said antibodies from said host.
22. The method of claim 21 further comprising step d) purifying
said antibodies.
23. The antibody raised according to the method of claim 15.
24. The antibody raised according to the method of claim 16.
Description
[0001] This application is a Continuation-In-Part of copending
application Ser. No. 08/405,496, filed Mar. 16, 1995.
FIELD OF THE INVENTION
[0002] The present invention relates to the isolation of
polypeptides derived from Clostridium botulinum neurotoxins and the
use thereof as immunogens for the production of vaccines, including
multivalent vaccines, and antitoxins.
BACKGROUND OF THE INVENTION
[0003] The genus Clostridium is comprised of gram-positive,
anaerobic, spore-forming bacilli. The natural habitat of these
organisms is the environment and the intestinal tracts of humans
and other animals. Indeed, clostridia are ubiquitous; they are
commonly found in soil, dust, sewage, marine sediments, decaying
vegetation, and mud. [See e.g., P. H. A. Sneath et al.,
"Clostridium," Bergey's Manual.RTM. of Systematic Bacteriology,
Vol. 2, pp. 1141-1200, Williams & Wilkins (1986). Despite the
identification of approximately 100 species of Clostridium, only a
small number have been recognized as etiologic agents of medical
and veterinary importance. Nonetheless, these species are
associated with very serious diseases, including botulism, tetanus,
anaerobic cellulitis, gas gangrene, bacteremia, pseudomembranous
colitis, and clostridial gastroenteritis. Table 1 lists some of the
species of medical and veterinary importance and the diseases with
which they are associated. As virtually all of these species have
been isolated from fecal samples of apparently healthy persons,
some of these isolates may be transient, rather than permanent
residents of the colonic flora.
1TABLE 1 Clostridium Species Of Medical And Veterinary Importance*
Species Disease C. aminovalericum Bacteriuria (pregnant women) C.
argentinense Infected wounds; Bacteremia; Botulism; Infections of
amniotic fluid C. baratii Infected war wounds; Peritonitis;
Infectious processes of the eye, ear and prostate C. beijerinckikii
Infected wounds C. bifermentans Infected wounds; Abscesses; Gas
Gangrene; Bacteremia C. botulinum Food poisoning; Botulism (wound,
food, infant) C. butyricum Urinary tract, lower respiratory tract,
pleural cavity, and abdominal infections; Infected wounds;
Abscesses; Bacteremia C. cadaveris Abscesses; Infected wounds C.
carnis Soft tissue infections; Bacteremia C. chauvoei Blackleg C.
clostridioforme Abdominal, cervical, scrotal, pleural, and other
infections; Septicemia; Peritonitis; Appendicitis C. cochlearium
Isolated from human disease processes, but role in disease unknown.
C. difficile Antimicrobial-associated diarrhea; Pseudomembranous
enterocolitis; Bacteremia; Pyogenic infections C. fallax Soft
tissue infections C. ghnoii Soft tissue infections C. glycolicum
Wound infections; Abscesses; Peritonitis C. hastiforme Infected war
wounds; Bacteremia; Abscesses C. histolyticum Infected war wounds;
Gas gangrene; Gingival plaque isolate C. indolis Gastrointestinal
tract infections C. innocuum Gastrointestinal tract infections;
Empyema C. irregulare Penile lesions C. leptum Isolated from human
disease processes, but role in disease unknown. C. limosum
Bacteremia; Peritonitis; Pulmonary infections C. malenominatum
Various infectious processes C. novyi Infected wounds; Gas
gangrene; Blackleg, Big head (ovine); Redwater disease (bovine) C.
oroticum Urinary tract infections; Rectal abscesses C.
paraputrificum Bacteremia; Peritonitis; Infected wounds;
Appendicitis C. perfringens Gas gangrene; Anaerobic cellulitis;
Intra-abdominal abscesses; Soft tissue infections; Food poisoning;
Necrotizing pneumonia; Empyema; Meningitis; Bacteremia; Uterine
Infections; Enteritis necrotans; Lamb dysentery; Struck; Ovine
Enterotoxemia; C. putrefaciens Bacteriuria (Pregnant women with
bacteremia) C. putrificum Abscesses; Infected wounds; Bacteremia C.
ramosum Infections of the abdominal cavity, genital tract, lung,
and biliary tract; Bacteremia C. sartagoforme Isolated from human
disease processes, but role in disease unknown. C. septicum Gas
gangrene; Bacteremia; Suppurative infections; Necrotizing
enterocolitis; Braxy C. sordellii Gas gangrene; Wound infections;
Penile lesions; Bacteremia; Abscesses; Abdominal and vaginal
infections C. sphenoides Appendicitis; Bacteremia; Bone and soft
tissue infections; Intraperitoneal infections; Infected war wounds;
Visceral gas gangrene; Renal abscesses C. sporogenes Gas gangrene;
Bacteremia; Endocarditis; central nervous system and
pleuropulmonary infections; Penile lesions; Infected war wounds;
Other pyogenic infections C. subterminale Bacteremia; Empyema;
Biliary tract, soft tissue and bone infections C. symbiosum Liver
abscesses; Bacteremia; Infections resulting due to bowel flora C.
tertium Gas gangrene; Appendicitis; Brain abscesses; Intestinal
tract and soft tissue infections; Infected war wounds;
Periodontitis; Bacteremia C. tetani Tetanus; Infected gums and
teeth; Corneal ulcerations; Mastoid and middle ear infections;
Intraperitoneal infections; Tetanus neonatorum; Postpartum uterine
infections; Soft tissue infections, especially related to trauma
(including abrasions and lacerations); Infections related to use of
contaminated needles C. thermosaccharolyticum Isolated from human
disease processes, but role in disease unknown. *Compiled from P.
G. Engelkirk et al. "Classification", Principles and Practice of
Clinical Anaerobic Bacteriology, pp. 22-23, Star Publishing Co.,
Belmont, CA (1992); J. Stephen and R. A. Petrowski, "Toxins Which
Traverse Membranes and Deregulate Cells," in Bacterial # Toxins, 2d
ed., pp. 66-67, American Society for Microbiology (1986); R. Berkow
and A. J. Fletcher (eds.), "Bacterial Diseases," Merck Manual of
Diagnosis and Therapy, 16th ed., pp. 116-126, Merck Research
Laboratories, Rahway, N. J. (1992); and O. H. Sigmund and C. M.
Fraser (eds.), # "Clostridial Infections,"Merck Veterinary Manual,
5th ed., pp. 396-409, Merck & Co., Rahway, N. J. (1979).
[0004] In most cases, the pathogenicity of these organisms is
related to the release of powerful exotoxins or highly destructive
enzymes. Indeed, several species of the genus Clostridium produce
toxins and other enzymes of great medical and veterinary
significance. [C. L. Hatheway, Clin. Microbiol. Rev. 3:66-98
(1990).]
[0005] Perhaps because of their significance for human and
veterinary medicine, much research has been conducted on these
toxins, in particular those of C. botulinum and C. difficile.
[0006] C. botulinum
[0007] Several strains of Clostridium botulinum produce toxins of
significance to human and animal health. [C. L. Hatheway, Clin.
Microbiol. Rev. 3:66-98 (1990)] The effects of these toxins range
from diarrheal diseases that can cause destruction of the colon, to
paralytic effects that can cause death. Particularly at risk for
developing clostridial diseases are neonates and humans and animals
in poor health (e.g., those suffering from diseases associated with
old age or immunodeficiency diseases).
[0008] Clostridium botulinum produces the most poisonous biological
toxin known. The lethal human dose is a mere 10.sup.-9 mg/kg
bodyweight for toxin in the bloodstream. Botulinal toxin blocks
nerve transmission to the muscles, resulting in flaccid paralysis.
When the toxin reaches airway and respiratory muscles, it results
in respiratory failure that can cause death. [S. Arnon, J. Infect.
Dis. 154:201-206 (1986)]
[0009] C. botulinum spores are carried by dust and are found on
vegetables taken from the soil, on fresh fruits, and on
agricultural products such as honey. Under conditions favorable to
the organism, the spores germinate to vegetative cells which
produces toxin. [S. Amon, Ann. Rev. Med. 31:541 (1980)]
[0010] Botulism disease may be grouped into four types, based on
the method of introduction of toxin into the bloodstream.
Food-borne botulism results from ingesting improperly preserved and
inadequately heated food that contains botulinal toxin. There were
355 cases of food-borne botulism in the United States between 1976
and 1984. [K. L. MacDonald et al., Am. J. Epidemiol. 124:794
(1986).] The death rate due to botulinal toxin is 12% and can be
higher in particular risk groups. [C. O. Tacket et al., Am. J. Med.
76:794 (1984).] Wound-induced botulism results from C. botulinum
penetrating traumatized tissue and producing toxin that is absorbed
into the bloodstream. Since 1950, thirty cases of wound botulism
have been reported. [M. N. Swartz, "Anaerobic Spore-Forming
Bacilli: The Clostridia," pp. 633-646, in B. D. Davis et
al.,(eds.), Microbiology, 4th edition, J. B. Lippincott Co.
(1990).] Inhalation botulism results when the toxin is inhaled.
Inhalation botulism has been reported as the result of accidental
exposure in the laboratory [E. Holzer, Med. Klin. 41:1735 (1962)]
and could arise if the toxin is used as an agent of biological
warfare [D. R. Franz et al., in Botulinum and Tetanus Neurotoxins,
B. R. DasGupta, ed., Plenum Press, New York (1993), pp. 473-476].
Infectious infant botulism results from C. botulinum colonization
of the infant intestine with production of toxin and its absorption
into the bloodstream. It is likely that the bacterium gains entry
when spores are ingested and subsequently germinate. [S. Amon, J.
Infect. Dis. 154:201 (1986).] There have been 500 cases reported
since it was first recognized in 1976. [M. N. Swartz, supra.]
[0011] Infant botulism strikes infants who are three weeks to
eleven months old (greater than 90% of the cases are infants less
than six months). [S. Arnon, J. Infect. Dis. 154:201 (1986).] It is
believed that infants are susceptible, due, in large part, to the
absence of the full adult complement of intestinal microflora. The
benign microflora present in the adult intestine provide an acidic
environment that is not favorable to colonization by C. botulinum.
Infants begin life with a sterile intestine which is gradually
colonized by microflora. Because of the limited microflora present
in early infancy, the intestinal environment is not as acidic,
allowing for C. botulinum spore germination, growth, and toxin
production. In this regard, some adults who have undergone
antibiotic therapy which alters intestinal microflora become more
susceptible to botulism.
[0012] An additional factor accounting for infant susceptibility to
infectious botulism is the immaturity of the infant immune system.
The mature immune system is sensitized to bacterial antigens and
produces protective antibodies. Secretory IgA produced in the adult
intestine has the ability to agglutinate vegetative cells of C.
botulinum. [S. Arnon, J. Infect. Dis. 154:201 (1986).] Secretory
IgA may also act by preventing intestinal bacteria and their
products from crossing the cells of the intestine. [S. Amon,
Epidemiol. Rev. 3:45 (1981).] The infant immune system is not
primed to do this.
[0013] Clinical symptoms of infant botulism range from mild
paralysis, to moderate and severe paralysis requiring
hospitalization, to fulminant paralysis, leading to sudden death.
[S. Arnon, Epidemiol. Rev. 3:45 (1981).]
[0014] The chief therapy for severe infant botulism is ventilatory
assistance using a mechanical respirator and concurrent elimination
of toxin and bacteria using cathartics, enemas, and gastric lavage.
There were 68 hospitalizations in California for infant botulism in
a single year with a total cost of over $4 million for treatment.
[T. L. Frankovich and S. Arnon, West. J. Med. 154:103 (1991).]
[0015] Different strains of Clostridium botulinum each produce
antigenically distinct toxin designated by the letters A-G.
Serotype A toxin has been implicated in 26% of the cases of food
botulism; types B, E and F have also been implicated in a smaller
percentage of the food botulism cases [H. Sugiyama, Microbiol. Rev.
44:419 (1980)]. Wound botulism has been reportedly caused by only
types A or B toxins [H. Sugiyama, supra]. Nearly all cases of
infant botulism have been caused by bacteria producing either type
A or type B toxin. (Exceptionally, one New Mexico case was caused
by Clostridium botulinum producing type F toxin and another by
Clostridium botulinum producing a type B-type F hybrid.) [S. Amon,
Epidemiol. Rev. 3:45 (1981).] Type C toxin affects waterfowl,
cattle, horses and mink. Type D toxin affects cattle, and type E
toxin affects both humans and birds.
[0016] A trivalent antitoxin derived from horse plasma is
commercially available from Connaught Industries Ltd. as a therapy
for toxin types A, B, and E. However, the antitoxin has several
disadvantages. First, extremely large dosages must be injected
intravenously and/or intramuscularly. Second, the antitoxin has
serious side effects such as acute anaphylaxis which can lead to
death, and serum sickness. Finally, the efficacy of the antitoxin
is uncertain and the treatment is costly. [C. O. Tacket et al., Am.
J. Med. 76:794 (1984).]
[0017] A heptavalent equine botulinal antitoxin which uses only the
F(ab')2 portion of the antibody molecule has been tested by the
United States Military. [M. Balady, USAMRDC Newsletter, p. 6
(1991).] This was raised against impure toxoids in those large
animals and is not a high titer preparation.
[0018] A pentavalent human antitoxin has been collected from
immunized human subjects for use as a treatment for infant
botulism. The supply of this antitoxin is limited and cannot be
expected to meet the needs of all individuals stricken with
botulism disease. In addition, collection of human sera must
involve screening out HIV and other potentially serious human
pathogens. [P. J. Schwarz and S. S. Amon, Western J. Med. 156:197
(1992).]
[0019] Infant botulism has been implicated as the cause of
mortality in some cases of Sudden Infant Death Syndrome (SIDS, also
known as crib death). SIDS is officially recognized as infant death
that is sudden and unexpected and that remained unexplained despite
complete post-mortem examination. The link of SIDS to infant
botulism came when fecal or blood specimens taken at autopsy from
SIDS infants were found to contain C. botulinum organisms and/or
toxin in 3-4% of cases analyzed. [D. R. Peterson et al., Rev.
Infect. Dis. 1:630 (1979).] In contrast, only 1 of 160 healthy
infants (0.6%) had C. botulinum organisms in the feces and no
botulinal toxin. (S. Amon et al., Lancet, pp. 1273-76, Jun. 17,
1978.)
[0020] In developed countries, SIDS is the number one cause of
death in children between one month and one year old. (S. Arnon et
al., Lancet, pp. 1273-77, Jun. 17, 1978.) More children die from
SIDS in the first year than from any other single cause of death in
the first fourteen years of life. In the United States, there are
8,000-10,000 SIDS victims annually. Id.
[0021] What is needed is an effective therapy against infant
botulism that is free of dangerous side effects, is available in
large supply at a reasonable price, and can be safely and gently
delivered so that prophylactic application to infants is
feasible.
[0022] Immunization of subjects with toxin preparations has been
done in an attempt to induce immunity against botulinal toxins. A
C. botulinum vaccine comprising chemically inactivated (i.e.,
formaldehyde-treated) type A, B, C, D and E toxin is commercially
available for human usage. However, this vaccine preparation has
several disadvantages. First, the efficacy of this vaccine is
variable (in particular, only 78% of recipients produce protective
levels of anti-type B antibodies following administration of the
primary series). Second, immunization is painful (deep subcutaneous
inoculation is required for administration), with adverse reactions
being common (moderate to severe local reactions occur in
approximately 6% of recipients upon initial injection; this number
rises to approximately 11% of individuals who receive booster
injections) [Informational Brochure for the Pentavalent (ABCDE)
Botulinum Toxoid, Centers for Disease Control]. Third, preparation
of the vaccine is dangerous as active toxin must be handled by
laboratory workers.
[0023] What is needed are safe and effective vaccine preparations
for administration to those at risk of exposure to C. botulinum
toxins.
[0024] C. difficile
[0025] C. difficile, an organism which gained its name due to
difficulties encountered in its isolation, has recently been proven
to be an etiologic agent of diarrheal disease. (Sneath et al., p.
1165.). C. difficile is present in the gastrointestinal tract of
approximately 3% of healthy adults, and 10-30% of neonates without
adverse effect (Swartz, at p. 644); by other estimates, C.
difficile is a part of the normal gastrointestinal flora of 2-10%
of humans. [G. F. Brooks et al., (eds.) "Infections Caused by
Anaerobic Bacteria," Jawetz, Melnick, & Adelberg's Medical
Microbiology, 19th ed., pp. 257-262, Appleton & Lange, San
Mateo, Calif. (1991).] As these organisms are relatively resistant
to most commonly used antimicrobials, when a patient is treated
with antibiotics, the other members of the normal gastrointestinal
flora are suppressed and C. difficile flourishes, producing
cytopathic toxins and enterotoxins. It has been found in 25% of
cases of moderate diarrhea resulting from treatment with
antibiotics, especially the cephalosporins, clindamycin, and
ampicillin. [M. N. Swartz at 644.]
[0026] Importantly, C. difficile is commonly associated with
nosocomial infections. The organism is often present in the
hospital and nursing home environments and may be carried on the
hands and clothing of hospital personnel who care for debilitated
and immunocompromised patients. As many of these patients are being
treated with antimicrobials or other chemotherapeutic agents, such
transmission of C. difficile represents a significant risk factor
for disease. (Engelkirk et al., pp. 64-67.) C. difficile is
associated with a range of diarrhetic illness, ranging from
diarrhea alone to marked diarrhea and necrosis of the
gastrointestinal mucosa with the accumulation of inflammatory cells
and fibrin, which forms a pseudomembrane in the affected area.
(Brooks et al.) It has been found in over 95% of pseudomembranous
enterocolitis cases. (Swartz, at p. 644.) This occasionally fatal
disease is characterized by diarrhea, multiple small colonic
plaques, and toxic megacolon. (Swartz, at p. 644.) Although stool
cultures are sometimes used for diagnosis, diagnosis is best made
by detection of the heat labile toxins present in fecal filtrates
from patients with enterocolitis due to C. difficile. (Swartz, at
p. 644-645; and Brooks et al., at p. 260.) C. difficile toxins are
cytotoxic for tissue/cell cultures and cause enterocolitis when
injected intracecally into hamsters. (Swartz, at p. 644.)
[0027] The enterotoxicity of C. difficile is primarily due to the
action of two toxins, designated A and B, each of approximately
300,000 in molecular weight. Both are potent cytotoxins, with toxin
A possessing direct enterocytotoxic activity. [Lyerly et al.,
Infect. Immun. 60:4633 (1992).] Unlike toxin A of C. perfringens,
an organism rarely associated with antimicrobial-associated
diarrhea, the toxin of C. difficile is not a spore coat constituent
and is not produced during sporulation. (Swartz, at p. 644.) C.
difficile toxin A causes hemorrhage, fluid accumulation and mucosal
damage in rabbit ileal loops and appears to increase the uptake of
toxin B by the intestinal mucosa. Toxin B does not cause intestinal
fluid accumulation, but it is 1000 times more toxic than toxin A to
tissue culture cells and causes membrane damage. Although both
toxins induce similar cellular effects such as actin
disaggregation, differences in cell specificity occurs.
[0028] Both toxins are important in disease. [Borriello et al.,
Rev. Infect. Dis., 12(suppl. 2):S185 (1990); Lyerly et al., Infect.
Immun., 47:349 (1985); and Rolfe, Infect. Immun., 59:1223 (1990).]
Toxin A is thought to act first by binding to brush border
receptors, destroying the outer mucosal layer, then allowing toxin
B to gain access to the underlying tissue. These steps in
pathogenesis would indicate that the production of neutralizing
antibodies against toxin A may be sufficient in the prophylactic
therapy of CDAD. However, antibodies against toxin B may be a
necessary additional component for an effective therapeutic against
later stage colonic disease. Indeed, it has been reported that
animals require antibodies to both toxin A and toxin B to be
completely protected against the disease. [Kim and Rolfe, Abstr.
Ann. Meet. Am. Soc. Microbiol., 69:62 (1987).]
[0029] C. difficile has also been reported to produce other toxins
such as an enterotoxin different from toxins A and B [Banno et at,
Rev. Infect. Dis., 6(Suppl. 1:S11-S20 (1984)], a low molecular
weight toxin [Rihn et al., Biochem. Biophys. Res. Comm.,
124:690-695 (1984)], a motility altering factor [Justus et al.,
Gastroenterol., 83:836-843 (1982)], and perhaps other toxins.
Regardless, C. difficile gastrointestinal disease is of primary
concern.
[0030] It is significant that due to its resistance to most
commonly used antimicrobials, C. difficile is associated with
antimicrobial therapy with virtually all antimicrobial agents
(although most commonly ampicillin, clindamycin and
cephalosporins). It is also associated with disease in patients
undergoing chemotherapy with such compounds as methotrexate,
5-fluorouracil, cyclophosphamide, and doxorubicin. [S. M. Finegold
et al., Clinical Guide to Anaerobic Infections, pp. 88-89, Star
Publishing Co., Belmont, Calif. (1992).]
[0031] Treatment of C. difficile disease is problematic, given the
high resistance of the organism. Oral metronidazole, bacitracin and
vancomycin have been reported to be effective. (Finegold et al., p.
89.) However there are problems associated with treatment utilizing
these compounds. Vancomycin is very expensive, some patients are
unable to take oral medication, and the relapse rate is high
(20-25%), although it may not occur for several weeks. Id.
[0032] C. difficile disease would be prevented or treated by
neutralizing the effects of these toxins in the gastrointestinal
tract. Thus, what is needed is an effective therapy against C.
difficile toxin that is free of dangerous side effects, is
available in large supply at a reasonable price, and can be safely
delivered so that prophylactic application to patients at risk of
developing pseudomembranous enterocolitis can be effectively
treated.
DESCRIPTION OF THE DRAWINGS
[0033] FIG. 1 shows the reactivity of anti-C. botulinum IgY by
Western blot.
[0034] FIG. 2 shows the IgY antibody titer to C, botulinum type A
toxoid in eggs, measured by ELISA.
[0035] FIG. 3 shows the results of C. difficile toxin A
neutralization assays.
[0036] FIG. 4 shows the results of C. difficile toxin B
neutralization assays.
[0037] FIG. 5 shows the results of C. difficile toxin B
neutralization assays.
[0038] FIG. 6 is a restriction map of C. difficile toxin A gene,
showing sequences of primers 1-4 (SEQ ID NOS:1-4).
[0039] FIG. 7 is a Western blot of C. difficile toxin A reactive
protein.
[0040] FIG. 8 shows C. difficile toxin A expression constructs.
[0041] FIG. 9 shows C. difficile toxin A expression constructs.
[0042] FIG. 10 shows the purification of recombinant C. difficile
toxin A.
[0043] FIG. 11 shows the results of C. difficile toxin A
neutralization assays with antibodies reactive to recombinant toxin
A.
[0044] FIG. 12 shows the results for a C. difficile toxin A
neutralization plate.
[0045] FIG. 13 shows the results for a C. difficile toxin A
neutralization plate.
[0046] FIG. 14 shows the results of recombinant C. difficile toxin
A neutralization assays.
[0047] FIG. 15 shows C. difficile toxin A expression
constructs.
[0048] FIG. 16 shows a chromatograph plotting absorbance at 280 nm
against retention time for a pMA1870-680 IgY PEG preparation.
[0049] FIG. 17 shows two recombinant C. difficile toxin B
expression constructs.
[0050] FIG. 18 shows C. difficile toxin B expression
constructs.
[0051] FIG. 19 shows C. difficile toxin B expression
constructs.
[0052] FIG. 20 shows C. difficile toxin B expression
constructs.
[0053] FIG. 21 is an SDS-PAGE gel showing the purification of
recombinant C. difficile toxin B fusion protein.
[0054] FIG. 22 is an SDS-PAGE gel showing the purification of two
histidine-tagged recombinant C. difficile toxin B proteins.
[0055] FIG. 23 shows C. difficile toxin B expression
constructs.
[0056] FIG. 24 is a Western blot of C. difficile toxin B reactive
protein.
[0057] FIG. 25 shows C. botulinum type A toxin expression
constructs; constructs used to provide C. botulinum or C. difficile
sequences are also shown.
[0058] FIG. 26 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of recombinant C. botulinum type A toxin
fusion proteins.
[0059] FIG. 27 shows C. botulinum type A toxin expression
constructs; constructs used to provide C. botulinum sequences are
also shown.
[0060] FIG. 28 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of pHisBot protein using the Ni-NTA
resin.
[0061] FIG. 29 is an SDS-PAGE gel stained with Coomaisse blue
showing the expression of pHisBot protein in BL21(DE3) and
BL21(DE3)pLysS host cells.
[0062] FIG. 30 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of pHisBot protein using a batch
absorption procedure.
[0063] FIG. 31 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of pHisBot and pHisBot(native) proteins
using a Ni-NTA column.
[0064] FIG. 32 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of pHisBotA protein expressed in
pHisBotA(syn) kan lacIq T7/pACYCGro/BL21(DE3) cells using an IDA
column.
[0065] FIG. 33 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of pHisBotA, pHisBotB and pHisBotE
proteins by IDA chromatography followed by chromatography on S-100
to remove folding chaperones.
[0066] FIG. 34 is an SDS-PAGE gel stained with Coomaisse blue
showing the extracts derived from pHisBotB amp T7lac/BL21(DE3)
cells before and after purification on a Ni-NTA column.
[0067] FIG. 35 is an SDS-PAGE gel run under native conditions and
stained with Coomaisse blue showing the removal of folding
chaperones from IDA-purified BotB protein using a S-100 column.
[0068] FIG. 36 is an SDS-PAGE gel stained with Coomaisse blue
showing proteins that eluted during an imidazole step gradient
applied to a IDA column containing a lysate of pHisBotB kan lacIq
T7/pACYCGro/BL21(DE3) cells.
[0069] FIG. 37 is an SDS-PAGE gel run under native conditions and
stained with Coomaisse blue showing IDA-purified BotB protein
before and after ultrafiltration.
[0070] FIG. 38 is an SDS-PAGE gel stained with Coomaisse blue
showing the purification of BotE protein using a NiNTA column.
[0071] FIG. 39 is an SDS-PAGE gel stained with Coomaisse blue
showing extracts derived from pHisBotA kan T7 lac/BL21(DE3) pLysS
cells grown in fermentation culture.
[0072] FIG. 40 is a chromatogram showing proteins present after
IDA-purified BotE protein was applied to a S-100 column.
[0073] Definitions
[0074] To facilitate understanding of the invention, a number of
terms are defined below.
[0075] As used herein, the term "neutralizing" is used in reference
to antitoxins, particularly antitoxins comprising antibodies, which
have the ability to prevent the pathological actions of the toxin
against which the antitoxin is directed.
[0076] As used herein, the term "overproducing" is used in
reference to the production of clostridial toxin polypeptides in a
host cell and indicates that the host cell is producing more of the
clostridial toxin by virtue of the introduction of nucleic acid
sequences encoding said clostridial toxin polypeptide than would be
expressed by said host cell absent the introduction of said nucleic
acid sequences. To allow ease of purification of toxin polypeptides
produced in a host cell it is preferred that the host cell express
or overproduce said toxin polypeptide at a level greater than 1
mg/liter of host cell culture.
[0077] "A host cell capable of expressing a recombinant protein at
a level greater than or equal to 5% of the total cellular protein"
is a host cell in which the recombinant protein represents at least
5% of the total cellular protein. To determine what percentage of
total cellular protein the recombinant protein represents, the
following steps are taken. A total of 10 OD.sub.600 units of
recombinant host cells (e.g., 200 .mu.l of cells at
OD.sub.600=50/ml) are removed (at a timepoint known to represent
the peak of expression of the desired recombinant protein) to a 1.5
ml microfuge tube and pelleted for 2 min at maximum rpm in a
microfuge. The pellets are resuspended in 1 ml of 50 mM
NaHPO.sub.4, 0.5 M NaCl, 40 mM imidazole buffer (pH 6.8) containing
1 mg/ml lysozyme. The samples are incubated for 20 min at room
temperature and stored ON at -70.degree. C. Samples are thawed
completely at room temperature and sonicated 2.times.10 seconds
with a Branson Sonifier 450 microtip probe at #3 power setting. The
samples are centrifuged for 5 min. at maximum rpm in a microfuge.
An aliquot (20 .mu.l) of the protein sample is removed to 20 .mu.l
2.times. sample buffer (this represents the total protein extract).
The samples are heated to 95.degree. C. for 5 min, then cooled and
5 or 10 .mu.l are loaded onto 12.5% SDS-PAGE gels. High molecular
weight protein markers are also loaded to allow for estimation of
the MW of identified recombinant proteins. After electrophoresis,
protein is detected generally by staining with Coomassie blue and
the stained gel is scanned using a densitometer to determine the
percentage of protein present in each band. In this manner, the
percentage of protein present in the band corresponding to the
recombinant protein of interest may be determined. It is not
necessary that Coomassie blue be employed for the detection of
protein, a number of fluorescent dyes [e.g., Sypro orange S-6651
(Molecular Probes, Eugene, Oreg.] may be employed and the stained
gel scanned using a fluoroimager [e.g., Fluor Imager SI (Molecular
Dynamics, Sunnyvale, Calif.)].
[0078] "A host cell capable of expressing a recombinant protein as
a soluble protein at a level greater than or equal to 0.25% of the
total soluble cellular protein" is a host cell in which the amount
of soluble recombinant protein present represents at least 0.25% of
the total cellular protein. As used herein "total soluble cellular
protein" refers to a clarified PEI lysate prepared as described in
Example 31(c)(iv). Briefly, cells are harvested following induction
of expression of recombinant protein (at a point of maximal
expression). The cells are resuspended in cell resuspension buffer
(CRB: 50 mM NaPO.sub.4, 0.5 M NaCl, 40 mM imidazole, pH 6.8) to
create a 20% cell suspension (wet weight of cells/volume of CRB)
and cell lysates are prepared as described in Example 31(c)(iv)
(i.e., sonication or homogenization followed by centrifugation).
The cell lysate is then flocculated utilizing polyethyleneimine
(PEI) prior to centrifugation. PEI (a 2% solution in dH.sub.2O, pH
7.5 with HCl) is added to the cell lysate to a final concentration
of 0.2%, and stirred for 20 min at room temperature prior to
centrifugation [8,500 rpm in JAIO rotor (Beckman) for 30 minutes at
4.degree. C.]. This treatment removes RNA, DNA and cell wall
components, resulting in a clarified, low viscosity lysate ("PEI
clarified lysate"). The recombinant protein present in the PEI
clarified lysate is then purified (e.g., by chromatography on an
IDA column for his-tagged proteins). The amount of purified
recombinant protein (i.e., the eluted protein) is divided by the
concentration of protein present in the PEI clarified lysate
(typically 8 mg/ml when using a 20% cell suspension as the starting
material) and multiplied by 100 to determine what percentage of
total soluble cellular protein is comprised of the soluble
recombinant protein (see Example 33b).
[0079] As used herein, the term "fusion protein" refers to a
chimeric protein containing the protein of interest (i.e., C.
botulinum toxin A, B, C, D, E, F, or G and fragments thereof)
joined to an exogenous protein fragment (the fusion partner which
consists of a non-toxin protein). The fusion partner may enhance
solubility of the C. botulinum protein as expressed in a host cell,
may provide an affinity tag to allow purification of the
recombinant fusion protein from the host cell or culture
supernatant, or both. If desired, the fusion protein may be removed
from the protein of interest (i.e., toxin protein or fragments
thereof) prior to immunization by a variety of enzymatic or
chemical means known to the art.
[0080] As used herein the term "non-toxin protein" or "non-toxin
protein sequence" refers to that portion of a fusion protein which
comprises a protein or protein sequence which is not derived from a
bacterial toxin protein.
[0081] The term "protein of interest" as used herein refers to the
protein whose expression is desired within the fusion protein. In a
fusion protein the protein of interest will be joined or fused with
another protein or protein domain, the fusion partner, to allow for
enhanced stability of the protein of interest and/or ease of
purification of the fusion protein.
[0082] As used herein, the term "maltose binding protein" refers to
the maltose binding protein of E. coli. A portion of the maltose
binding protein may be added to a protein of interest to generate a
fusion protein; a portion of the maltose binding protein may merely
enhance the solubility of the resulting fusion protein when
expressed in a bacterial host. On the other hand, a portion of the
maltose binding protein may allow affinity purification of the
fusion protein on an amylose resin.
[0083] As used herein, the term "poly-histidine tract" when used in
reference to a fusion protein refers to the presence of two to ten
histidine residues at either the amino- or carboxy-terminus of a
protein of interest. A poly-histidine tract of six to ten residues
is preferred. The poly-histidine tract is also defined functionally
as being a number of consecutive histidine residues added to the
protein of interest which allows the affinity purification of the
resulting fusion protein on a nickel-chelate or IDA column.
[0084] As used herein, the term "purified" or "to purify" refers to
the removal of contaminants from a sample. For example, antitoxins
are purified by removal of contaminating non-immunoglobulin
proteins; they are also purified by the removal of immunoglobulin
that does not bind toxin. The removal of non-immunoglobulin
proteins and/or the removal of immunoglobulins that do not bind
toxin results in an increase in the percent of toxin-reactive
immunoglobulins in the sample. In another example, recombinant
toxin polypeptides are expressed in bacterial host cells and the
toxin polypeptides are purified by the removal of host cell
proteins; the percent of recombinant toxin polypeptides is thereby
increased in the sample. Additionally, the recombinant toxin
polypeptides are purified by the removal of host cell components
such as lipopolysaccharide (e.g., endotoxin).
[0085] The term "recombinant DNA molecule" as used herein refers to
a DNA molecule which is comprised of segments of DNA joined
together by means of molecular biological techniques.
[0086] The term "recombinant protein" or "recombinant polypeptide"
as used herein refers to a protein molecule which is expressed from
a recombinant DNA molecule.
[0087] The term "native protein" as used herein refers to a protein
which is isolated from a natural source as opposed to the
production of a protein by recombinant means.
[0088] As used herein the term "portion" when in reference to a
protein (as in "a portion of a given protein") refers to fragments
of that protein. The fragments may range in size from four amino
acid residues to the entire amino acid sequence minus one amino
acid.
[0089] As used herein "soluble" when in reference to a protein
produced by recombinant DNA technology in a host cell is a protein
which exists in solution in the cytoplasm of the host cell; if the
protein contains a signal sequence the soluble protein is exported
to the periplasmic space in bacteria hosts and is secreted into the
culture medium in eucaryotic cells capable of secretion or by
bacterial host possessing the appropriate genes (i.e., the kil
gene). In contrast, an insoluble protein is one which exists in
denatured form inside cytoplasmic granules (called inclusion
bodies) in the host cell. High level expression (i.e., greater than
10-20 mg recombinant protein/liter of bacterial culture) of
recombinant proteins often results in the expressed protein being
found in inclusion bodies in the bacterial host cells. A soluble
protein is a protein which is not found in an inclusion body inside
the host cell or is found both in the cytoplasm and in inclusion
bodies and in this case the protein may be present at high or low
levels in the cytoplasm.
[0090] A distinction is drawn between a soluble protein (i.e., a
protein which when expressed in a host cell is produced in a
soluble form) and a "solubilized" protein. An insoluble recombinant
protein found inside an inclusion body may be solubilized (i.e.,
rendered into a soluble form) by treating purified inclusion bodies
with denaturants such as guanidine hydrochloride, urea or sodium
dodecyl sulfate (SDS). These denaturants must then be removed from
the solubilized protein preparation to allow the recovered protein
to renature (refold). Not all proteins will refold into an active
conformation after solubilization in a denaturant and removal of
the denaturant. Many proteins precipitate upon removal of the
denaturant. SDS may be used to solubilize inclusion bodies and will
maintain the proteins in solution at low concentration. However,
dialysis will not always remove all of the SDS (SDS can form
micelles which do not dialyze out); therefore, SDS-solubilized
inclusion body protein is soluble but not refolded.
[0091] A distinction is drawn between proteins which are soluble
(i.e., dissolved) in a solution devoid of significant amounts of
ionic detergents (e.g., SDS) or denaturants (e.g., urea, guanidine
hydrochloride) and proteins which exist as a suspension of
insoluble protein molecules dispersed within the solution. A
soluble protein will not be removed from a solution containing the
protein by centrifugation using conditions sufficient to remove
bacteria present in a liquid medium (i.e., centrifugation at
12,000.times.g for 4-5 minutes). For example, to test whether two
proteins, protein A and protein B, are soluble in solution, the two
proteins are placed into a solution selected from the group
consisting of PBS-NaCl (PBS containing 0.5 M NaCl), PBS-NaCl
containing 0.2% Tween 20, PBS, PBS containing 0.2% Tween 20, PBS-C
(PBS containing 2 mM CaCl.sub.2), PBS-C containing either 0.1 or
0.5% Tween 20, PBS-C containing either 0.1 or 0.5% NP-40, PBS-C
containing either 0.1 or 0.5% Triton X-100, PBS-C containing 0.1%
sodium deoxycholate. The mixture containing proteins A and B is
then centrifuged at 5000.times.g for 5 minutes. The supernatant and
pellet formed by centrifugation are then assayed for the presence
of protein A and B. If protein A is found in the supernatant and
not in the pellet [except for minor amounts (i.e., less than 10%)
as a result of trapping], protein is said to be soluble in the
solution tested. If the majority of protein B is found in the
pellet (i.e., greater than 90%), then protein B is said to exist as
a suspension in the solution tested.
[0092] As used herein, the term "therapeutic arnount" refers to
that amount of antitoxin required to neutralize the pathologic
effects of one or more clostridial toxins in a subject.
[0093] The term "pyrogen" as used herein refers to a
fever-producing substance. Pyrogens may be endogenous to the host
(e.g., prostaglandins) or may be exogenous compounds (e.g.,
bacterial endo- and exotoxins, nonbacterial compounds such as
antigens and certain steroid compounds, etc.). The presence of
pyrogen in a pharmaceutical solution may be detected using the U.S.
Pharmacopeia (USP) rabbit fever test (United States Pharmacopeia,
Vol. XXII (1990) United States Pharmacopeial Convention, Rockville,
Md., p. 151).
[0094] The term "endotoxin" as used herein refers to the high
molecular weight complexes associated with the outer membrane of
grain-negative bacteria. Unpurified endotoxin contains lipids,
proteins and carbohydrates. Highly purified endotoxin does not
contain protein and is referred to as lipopolysaccharide (LPS).
Because unpurified endotoxin is of concern in the production of
pharmaceutical compounds (e.g., proteins produced in E. coli using
recombinant DNA technology), the term endotoxin as used herein
refers to unpurified endotoxin. Bacterial endotoxin is a well known
pyrogen.
[0095] As used herein, the term "endotoxin-free" when used in
reference to a composition to be administered parenterally (with
the exception of intrathecal administration) to a host means that
the dose to be delivered contains less than 5 EU/kg body weight
[FDA Guidelines for Parenteral Drugs (December 1987)]. Assuming a
weight of 70 kg for an adult human, the dose must contain less than
350 EU to meet FDA Guidelines for parenteral administration.
Endotoxin levels are measured herein using the Limulus Amebocyte
Lysate (LAL) test (Limulus Amebocyte Lysate Pyrochrome.TM.,
Associates of Cape Cod, Inc. Woods Hole, Mass.). To measure
endotoxin levels in preparations of recombinant proteins, 0.5 ml of
a solution comprising 0.5 mg of purified recombinant protein in 50
mM NaPO.sub.4, pH 7.0, 0.3M NaCl and 10% glycerol is used in the
LAL assay according to the manufacturer's instructions for the
endpoint chromogenic without diazo-coupling method [the specific
components of the buffer containing recombinant protein to be
analyzed in the LAL test are not important; any buffer having a
neutral pH may be employed (see for example, alternative buffers
employed in Examples 34, 40 and 45)]. Compositions containing less
than or equal to than 250 endotoxin units (EU)/mg of purified
recombinant protein are herein defined as "substantially
endotoxin-free." Preferably the composition contains less than or
equal to 100, and most preferably less than or equal to 60, (EU)/mg
of purified recombinant protein. Typically, administration of
bacterial toxins or toxoids to adult humans for the purpose of
vaccination involves doses of about 10-500 .mu.g protein/dose.
Therefore, administration of 10-500 .mu.g of a purified recombinant
protein to a 70 kg human, wherein said purified recombinant protein
preparation contains 60 EU/mg protein, results in the introduction
of only 0.6 to 30 EU (i.e., 0.2 to 8.6% of the maximum allowable
endotoxin burden per parenteral dose). Administration of 10-500
.mu.g of a purified recombinant protein to a 70 kg human, wherein
said purified recombinant protein preparation contains 250 EU/mg
protein, results in the introduction of only 2.5 to 125 EU (i.e.,
0.7 to 36% of the maximum allowable endotoxin burden per parenteral
dose).
[0096] The LAL test is accepted by the U.S. FDA as a means of
detecting bacterial endotoxins (21 C.F.R. .sctn..sctn.660.100-105).
Studies have shown that the LAL test is equivalent or superior to
the USP rabbit pyrogen test for the detection of endotoxin and thus
the LAL test can be used as a surrogate for pyrogenicity studies in
animals [F. C. Perason, Pyrogens: endotoxins, LAL testing and
depyrogenation, Marcel Dekker, New York (1985), pp.150-155]. The
FDA Bureau of Biologics accepts the LAL assay in place of the USP
rabbit pyrogen test so long as the LAL assay utilized is shown to
be as sensitive as, or more sensitive as the rabbit test [Fed.
Reg., 38, 26130 (1980)].
[0097] The term "monovalent" when used in reference to a
clostridial vaccine refers to a vaccine which is capable of
provoking an immune response in a host animal directed against a
single type of clostridial toxin. For example, if immunization of a
host with C. botulinum type A toxin vaccine induces antibodies in
the immunized host which protect against a challenge with type A
toxin but not against challenge with type B, C, D, E, F or G
toxins, then the type A vaccine is said to be monovalent. In
contrast, a "multivalent" vaccine provokes an immune response in a
host animal directed against several (i.e., more than one)
clostridial toxins. For example, if immunization of a host with a
vaccine comprising C. botulinum type A and B toxins induces the
production of antibodies which protect the host against a challenge
with both type A and B toxin, the vaccine is said to be multivalent
(in particular, this hypothetical vaccine is bivalent).
[0098] As used herein the term "immunogenically-effective amount"
refers to that amount of an immunogen required to invoke the
production of protective levels of antibodies in a host upon
vaccination.
[0099] The term "protective level", when used in reference to the
level of antibodies induced upon immunization of the host with an
immunogen which comprises a bacterial toxin, means a level of
circulating antibodies sufficient to protect the host from
challenge with a lethal dose of the toxin.
[0100] As used herein the terms "protein" and "polypeptide" refer
to compounds comprising amino acids joined via peptide bonds and
are used interchangeably.
[0101] The terms "toxin" and "neurotoxin" when used in reference to
toxins produced by members (i.e., species and strains) of the genus
Clostridium are used interchangeably and refer to the proteins
which are poisonous to nerve tissue.
[0102] The term "receptor-binding domain" when used in reference to
a C. botulinum toxin refers to the carboxy-terminal portion of the
heavy chain (H.sub.C or the C fragment) of the toxin which is
presumed to be responsible for the binding of the active toxin
(i.e., the derivative toxin comprising the H and L chains joined
via disulfide bonds) to receptors on the surface of synaptosomes.
The receptor-binding domain for C. botulinum type A toxin is
defined herein as comprising amino acid residues 861 through 1296
of SEQ ID NO:28. The receptor-binding domain for C. botulinum type
B toxin is defined herein as comprising amino acid residues 848
through 1291 of SEQ ID NO:40 (strain Eklund 17B). The
receptor-binding domain of C. botulinum type C1 toxin is defined
herein as comprising amino acid residues 856 through 1291 of SEQ ID
NO:60. The receptor-binding domain of C. botulinum type D toxin is
defined herein as comprising amino acid residues 852 through 1276
of SEQ ID NO:66. The receptor-binding domain of C. botulinum type E
toxin is defined herein as comprising amino acid residues 835
through 1250 of SEQ ID NO:50 (Beluga strain). The receptor-binding
domain of C. botulinum type F toxin is defined herein as comprising
amino acid residues 853 through 1274 of SEQ ID NO:71. The
receptor-binding domain of C. botulinum type G toxin is defined
herein as comprising amino acid residues 853 through 1297 of SEQ ID
NO:77. Within a given serotype, small variations in the primary
amino acid sequence of the botulinal toxins isolated from different
strains has been reported [Whelan et al. (1992), supra and Minton
(1995) Curr. Top. Microbiol. Immunol. 195:161-194]. The present
invention contemplates fusion proteins comprising the
receptor-binding domain of C. botulinum toxins from serotypes A-G
including the variants found among different strains within a given
serotype. The receptor-binding domains listed above are used as the
prototype for each strain within a serotype. Fusion proteins
containing an analogous region from a strain other than the
prototype strain are encompassed by the present invention.
[0103] Fusion proteins comprising the receptor binding domain
(i.e., C fragment) of botulinal toxins may include amino acid
residues located beyond the termini of the domains defined above.
For example, the pHisBotB protein contains amino acid residues
846-1291 of SEQ ID NO:40; this fusion protein thus comprises the
receptor-binding domain for C. botulinum type B toxin as defined
above (i.e., Ile-848 through Glu-1291). Similarly, pHisBotE
contains amino acid residues 827-1252 of SEQ ID NO:50 and pHisBotG
contains amino acid residues 851-1297 of SEQ ID NO:77. Thus, both
pHisBotE and pHisBotG fusion proteins contain a few amino acids
located beyond the N-terminus of the defined receptor-binding
domain.
[0104] The terms "native gene" or "native gene sequences" are used
to indicate DNA sequences encoding a particular gene which contain
the same DNA sequences as found in the gene as isolated from
nature. In contrast, "synthetic gene sequences" are DNA sequences
which are used to replace the naturally occurring DNA sequences
when the naturally occurring sequences cause expression problems in
a given host cell. For example, naturally-occurring DNA sequences
encoding codons which are rarely used in a host cell may be
replaced (e.g., by site-directed mutagenesis) such that the
synthetic DNA sequence represents a more frequently used codon. The
native DNA sequence and the synthetic DNA sequence will preferably
encode the same amino acid sequence.
SUMMARY OF THE INVENTION
[0105] The present invention relates to the production of
polypeptides derived from toxins particularly in recombinant host
cells. In one embodiment, the present invention provides a host
cell containing a recombinant expression vector, said vector
encoding a protein comprising at least a portion of a Clostridium
botulinum toxin, said toxin selected from the group consisting of
type B toxin and type E toxin. The present invention is not limited
by the nature of sequences encoding portions of the C. botulinum
toxin. These sequences may be derived from the native gene
sequences or alternatively they may comprise synthetic gene
sequences. Synthetic gene sequences are employed when expression of
the native gene sequences is problematic in a given host cell
(e.g., when the native gene sequences contain sequences resembling
yeast transcription termination signals and the desired host cell
is a yeast cell).
[0106] In one embodiment, the host cell is capable of expressing
the recombinant C. botulinum toxin protein at a level greater than
or equal to 2% to 40% of the total cellular protein and preferably
at a level greater than or equal to 5% of the total cellular
protein. In another embodiment, the host cell is capable of
expressing the recombinant C. botulinum toxin protein as a soluble
protein at a level greater than or equal to 0.25% of the total
cellular protein and preferably at a level greater than or equal to
0.25% to 10% of the total cellular protein.
[0107] The present invention is not limited by the nature of the
host cell employed for the production of recombinant C. botulinum
toxin proteins. In a preferred embodiment, the host cell is an E.
coli cell. In another preferred embodiment, the host cell is an
insect cell; particularly preferred insect host cells are
Spodoptera frugiperda (Sf9) cells. In another preferred embodiment,
the host cell is a yeast cell; particularly preferred yeast cells
are Pichia pastoris cells.
[0108] In another embodiment, the invention provides a host cell
containing a recombinant expression vector, said vector encoding a
fusion protein comprising a non-toxin protein sequence and at least
a portion of a Clostridium botulinum toxin, said toxin selected
from the group consisting of type B toxin and type E toxin. The
invention is not limited by the nature of the portion of the
Clostridium botulinum toxin selected. In a preferred embodiment,
the portion of the toxin comprises the receptor binding domain
(i.e., the C fragment of the toxin). The present invention is not
limited by the nature of the non-toxin protein sequence employed.
In a preferred embodiment, the non-toxin protein sequence comprises
a poly-histidine tract. A number of alternative fusion tags or
fusion partners are known to the art (e.g., MBP, GST, protein A,
etc.) and may be employed for the production of fusion proteins
comprising a portion of a botulinal toxin.
[0109] The present invention further provides a vaccine comprising
a fusion protein, said fusion protein comprising a non-toxin
protein sequence and at least a portion of a Clostridium botulinum
toxin, said toxin selected from the group consisting of type B
toxin and type E toxin. The vaccine may be a monovalent vaccine
(i.e., containing only a toxin B fusion protein or a toxin E fusion
protein), a bivalent vaccine (i.e., containing both a toxin B
fusion protein and a toxin E fusion protein) or a trivalent or
higher valency vaccine. In a preferred embodiment, the toxin B
fusion protein and/or toxin E fusion protein is combined with a
fusion protein comprising a non-toxin protein sequence and at least
a portion of Clostridium botulinum type A toxin. The present
invention is not limited by the nature of the portion of the
Clostridium botulinum toxin selected. In a preferred embodiment,
the portion of the toxin comprises the receptor binding domain
(i.e., the C fragment of the toxin). The present invention is not
limited by the nature of the non-toxin protein sequence employed.
In a preferred embodiment, the non-toxin protein sequence comprises
a poly-histidine tract. A number of alternative fusion tags or
fusion partners are known to the art (e.g., MBP, GST, protein A,
etc.) and may be employed for the generation of fusion proteins
comprising vaccines. When a fusion partner (i.e., the non-toxin
protein sequence) is employed for the production of a recombinant C
botulinal toxin protein, the fusion partner may be removed from the
recombinant C botulinal toxin protein if desired (i.e., prior to
administration of the protein to a subject) using a variety of
methods known to the art (e g., digestion of fusion proteins
containing Factor Xa or thrombin recognition sites with the
appropriate enzyme). A number of the pETHis vectors employed herein
provide an N-terminal his-tag followed by a Factor Xa cleavage site
(see Example 28a); the botulinal C fragment sequences follow the
Factor Xa site and thus, Factor Xa can be used to remove the
his-tag from the botulinal fusion protein. In a preferred
embodiment, the vaccine is substantially endotoxin-free.
[0110] The present invention is not limited by the method employed
for the generation of vaccine comprising fusion proteins comprising
a non-toxin protein sequence and at least a portion of a
Clostridium botulinum toxin. The fusion proteins may be produced by
recombinant DNA means using either native or synthetic gene
sequences expressed in a host cell. The present invention is not
limited to the production of vaccines using recombinant host cells;
cell free in vitro transcription/translation systems may be
employed for the expression of the nucleic acid constructs encoding
the fusion proteins of the present invention. An example of such a
cell-free system is the commercially available TnT.TM. Coupled
Reticulocyte Lysate System (Promega Corporation, Madison, Wis.).
Alternatively, the fusion proteins of the present invention may be
generated by synthetic means (i.e., peptide synthesis).
[0111] The present invention further provides a method of
generating antibody directed against a Clostridium botulinum toxin
comprising: a) providing in any order: i) an antigen comprising a
fusion protein comprising a non-toxin protein sequence and at least
a portion of a Clostridium botulinum toxin, said toxin selected
from the group consisting of type B toxin and type E toxin, and ii)
a host; and b) immunizing the host with the antigen so as to
generate an antibody. In a preferred embodiment, the antigen used
to immunize the host also contains a fusion protein comprising a
non-toxin protein sequence and at least a portion of Clostridium
botulinum type A toxin. The present invention is not limited by the
nature of the portion of the Clostridium botulinum toxin selected.
In a preferred embodiment, the portion of the toxin comprises the
receptor binding domain (i.e., the C fragment of the toxin). The
present invention is not limited by the nature of the non-toxin
protein sequence employed. In a preferred embodiment, the non-toxin
protein sequence comprises a poly-histidine tract. A number of
alternative fusion tags or fusion partners are known to the art
(e.g., MBP, GST, protein A, etc.) and may be employed for the
generation of fusion proteins comprising vaccines. When a fusion
partner (i.e., the non-toxin protein sequence) is employed for the
production of a recombinant C botulinal toxin protein, the fusion
partner may be removed from the recombinant C botulinal toxin
protein if desired (i.e., prior to administration of the protein to
a subject) using a variety of methods known to the art (e.g.,
digestion of fusion proteins containing Factor Xa or thrombin
recognition sites with the appropriate enzyme).
[0112] The present invention is not limited by the nature of the
host employed for the production of the antibodies of the
invention. In a preferred embodiment, the host is a mammal,
preferably a human. The antibodies of the present invention may be
generated using non-mammalian hosts such as birds, preferably
chickens. In a preferred embodiment the method of the present
invention further comprised the step c) of collecting the
antibodies from the host. In yet another embodiment, the method of
the present invention further comprises the step d) of purifying
the antibodies.
[0113] The present invention further provides antibodies raised
according to the above methods.
[0114] The present invention further contemplates multivalent
vaccines comprising at least two recombinant C. botulinum toxin
proteins derived from the group consisting of C. botulinum
serotypes A, B, C, D, E, F, and G. The invention contemplates
bivalent, trivalent, quadravalent, pentavalent, heptavalent and
septivalent vaccines comprising recombinant C. botulinum toxin
proteins. Preferably the recombinant C. botulinum toxin protein
comprises the receptor binding domain (i.e., C fragment) of the
toxin.
DESCRIPTION OF THE INVENTION
[0115] The present invention contemplates vaccinating humans and
other animals with polypeptides derived from C. botulinum
neurotoxins which are substantially endotoxin-free. These botulinal
peptides are also useful for the production of antitoxin.
Anti-botulinal toxin antitoxin is useful for the treatment of
patients effected by or at risk of symptoms due to the action of C.
botulinum toxins. The organisms, toxins and individual steps of the
present invention are described separately below.
[0116] I. Clostridium Species, Clostridial Diseases And Associated
Toxins
[0117] A preferred embodiment of the method of the present
invention is directed toward obtaining antibodies against
Clostridium species, their toxins, enzymes or other metabolic
by-products, cell wall components, or synthetic or recombinant
versions of any of these compounds. It is contemplated that these
antibodies will be produced by immunization of humans or other
animals. It is not intended that the present invention be limited
to any particular toxin or any species of organism. In one
embodiment, toxins from all Clostridium species are contemplated as
immunogens. Examples of these toxins include the neuramimidase
toxin of C. butyricum, C. sordellii toxins HT and LT, toxins A, B,
C, D, E, F, and G of C. botulinum and the numerous C. perfringens
toxins. In one preferred embodiment, toxins A, B, and E of C.
botulinum are contemplated as immunogens. Table 2 above lists
various Clostridium species, their toxins and some antigens
associated with disease.
2TABLE 2 Clostridial Toxins Organism Toxins and Disease-Associated
Antigens C. botulinum A, B, C.sub.1, C.sub.2, D, E, F, G C.
butyricum Neuraminidase C. difficile A, B, Enterotoxin (not A nor
B), Motility Altering Factor, Low Molecular Weight Toxin, Others C.
perfringens .alpha., .beta., .epsilon., .iota., .gamma., .delta.,
.nu., .theta., .kappa., .lambda., .mu., .upsilon. C. sordelli/ HT,
LT, .alpha., .beta., .gamma. C. bifermentans C. novyi .alpha.,
.beta., .gamma., .delta., .epsilon., .zeta., .nu., .theta. C.
septicum .alpha., .beta., .gamma., .delta. C. histolyticum .alpha.,
.beta., .gamma., .delta., .epsilon. plus additional enzymes C.
chauvoei .alpha., .beta., .gamma., .delta.
[0118] It is not intended that antibodies produced against one
toxin will only be used against that toxin. It is contemplated that
antibodies directed against one toxin (e.g., C. perfringens type A
enterotoxin) may be used as an effective therapeutic against one or
more toxin(s) produced by other members of the genus Clostridium or
other toxin producing organisms (e.g., Bacillus cereus,
Staphylococcus aureus, Streptococcus mutans, Acinetobacter
calcoaceticus, Pseudomonas aeruginosa, other Pseudomonas species,
etc.). It is further contemplated that antibodies directed against
the portion of the toxin which binds to mammalian membranes (e.g.,
C. perfringens enterotoxin A) can also be used against other
organisms. It is contemplated that these membrane binding domains
are produced synthetically and used as immunogens.
[0119] II. Obtaining Antibodies in Non-Mammals
[0120] A preferred embodiment of the method of the present
invention for obtaining antibodies involves immunization. However,
it is also contemplated that antibodies could be obtained from
non-mammals without immunization. In the case where no immunization
is contemplated, the present invention may use non-mammals with
preexisting antibodies to toxins as well as non-mammals that have
antibodies to whole organisms by virtue of reactions with the
administered antigen. An example of the latter involves
immunization with synthetic peptides or recombinant proteins
sharing epitopes with whole organism components.
[0121] In a preferred embodiment, the method of the present
invention contemplates immunizing non-mammals with bacterial
toxin(s). It is not intended that the present invention be limited
to any particular toxin. In one embodiment, toxin from all
clostridial bacteria sources (see Table 2) are contemplated as
immunogens. Examples of these toxins are C. butyricum neuramimidase
toxin, toxins A, B, C, D, E, F, and G from C. botulinum, C.
perfringens toxins .alpha., .beta., .epsilon., and .iota., and C.
sordellii toxins HT and LT. In a preferred embodiment, C. botulinum
toxins A, B, C, D, E, and F (or fragments thereof) are contemplated
as immunogens.
[0122] A particularly preferred embodiment involves the use of
bacterial toxin protein or fragments of toxin proteins produced by
molecular biological means (i.e., recombinant toxin proteins). In a
preferred embodiment, the immunogen comprises the receptor-binding
domain (i.e., the .about.50 kD carboxy-terminal portion of the
heavy chain; also referred to as the C fragment) of C. botulinum
serotype A neurotoxin produced by recombinant DNA technology. In
another preferred embodiment, the immunogen comprises the
receptor-binding domain of C. botulinum serotype B neurotoxin
produced by recombinant DNA technology. In yet another preferred
embodiment, the immunogen comprises the receptor-binding domain
region of C. botulinum serotype E neurotoxin produced by
recombinant DNA technology. In yet another preferred embodiment,
the immunogen comprises the receptor-binding domain region of C.
botulinum serotype C1 neurotoxin produced by recombinant DNA
technology. In yet another preferred embodiment, the immunogen
comprises the receptor-binding domain region of C. botulinum
serotype C2 neurotoxin produced by recombinant DNA technology. In
yet another preferred embodiment, the immunogen comprises the
receptor-binding domain region of C. botulinum serotype D
neurotoxin produced by recombinant DNA technology. In yet another
preferred embodiment, the immunogen comprises the receptor-binding
domain region of C. botulinum serotype F neurotoxin produced by
recombinant DNA technology. In yet another preferred embodiment,
the immunogen comprises the receptor-binding domain region of C.
botulinum serotype G neurotoxin produced by recombinant DNA
technology. In a preferred embodiment, the recombinant botulinal
toxin proteins are expressed as fusion proteins (e.g., as
histidine-tagged proteins). In a still further preferred
embodiment, the immunogen is a multivalent vaccine comprising the
receptor-binding domain region of C. botulinum toxin from two or
more toxins selected from the group consisting of type A, type B,
type C (including C1 and C2), type D, type E, and type F toxin.
[0123] When immunization is used, the preferred non-mammal is from
the class Aves. All birds are contemplated (e.g., duck, ostrich,
emu, turkey, etc.). A preferred bird is a chicken. Importantly,
chicken antibody does not fix mammalian complement. [See H. N.
Benson et al., J. Immunol. 87:616 (1961).] Thus, chicken antibody
will normally not cause a complement-dependent reaction. [A. A.
Benedict and K. Yamaga, "Immunoglobulins and Antibody Production in
Avian Species," in Comparative Immunology (J. J. Marchaloni, ed.),
pp. 335-375, Blackwell, Oxford (1966).] Thus, the preferred
antitoxins of the present invention will not exhibit
complement-related side effects observed with antitoxins known
presently.
[0124] When birds are used, it is contemplated that the antibody
will be obtained from either the bird serum or the egg. A preferred
embodiment involves collection of the antibody from the egg. Laying
hens transport immunoglobulin to the egg yolk ("IgY") in
concentrations equal to or exceeding that found in serum. [See R.
Patterson et al., J. Immunol. 89:272 (1962); and S. B. Carroll and
B. D. Stollar, J. Biol. Chem. 258:24 (1983).] In addition, the
large volume of egg yolk produced vastly exceeds the volume of
serum that can be safely obtained from the bird over any given time
period. Finally, the antibody from eggs is purer and more
homogeneous; there is far less non-immunoglobulin protein (as
compared to serum) and only one class of immunoglobulin is
transported to the yolk.
[0125] When considering immunization with toxins, one may consider
modification of the toxins to reduce the toxicity. In this regard,
it is not intended that the present invention be limited by
immunization with modified toxin. Unmodified ("native") toxin is
also contemplated as an immunogen.
[0126] It is also not intended that the present invention be
limited by the type of modification--if modification is used. The
present invention contemplates all types of toxin modification,
including chemical and heat treatment of the toxin. The preferred
modification, however, is formaldehyde treatment.
[0127] It is not intended that the present invention be limited to
a particular mode of immunization; the present invention
contemplates all modes of immunization, including subcutaneous,
intramuscular, intraperitoneal, and intravenous or intravascular
injection, as well as per os administration of immunogen.
[0128] The present invention further contemplates immunization with
or without adjuvant. (Adjuvant is defined as a substance known to
increase the immune response to other antigens when administered
with other antigens.) If adjuvant is used, it is not intended that
the present invention be limited to any particular type of
adjuvant--or that the same adjuvant, once used, be used all the
time. While the present invention contemplates all types of
adjuvant, whether used separately or in combinations, the preferred
use of adjuvant is the use of Complete Freund's Adjuvant followed
sometime later with Incomplete Freund's Adjuvant. Another preferred
use of adjuvant is the use of Gerbu Adjuvant. The invention also
contemplates the use of RIBI fowl adjuvant and Quil A adjuvant.
[0129] When immunization is used, the present invention
contemplates a wide variety of immunization schedules. In one
embodiment, a chicken is administered toxin(s) on day zero and
subsequently receives toxin(s) in intervals thereafter. It is not
intended that the present invention be limited by the particular
intervals or doses. Similarly, it is not intended that the present
invention be limited to any particular schedule for collecting
antibody. The preferred collection time is sometime after day
100.
[0130] Where birds are used and collection of antibody is performed
by collecting eggs, the eggs may be stored prior to processing for
antibody. It is preferred that eggs be stored at 4.degree. C. for
less than one year.
[0131] It is contemplated that chicken antibody produced in this
manner can be buffer-extracted and used analytically. While
unpurified, this preparation can serve as a reference for activity
of the antibody prior to further manipulations (e.g.,
immunoaffinity purification).
[0132] III. Increasing the Effectiveness of Antibodies
[0133] When purification is used, the present invention
contemplates purifying to increase the effectiveness of both
non-mammalian antitoxins and mammalian antitoxins. Specifically,
the present invention contemplates increasing the percent of
toxin-reactive immunoglobulin. The preferred purification approach
for avian antibody is polyethylene glycol (PEG) separation.
[0134] The present invention contemplates that avian antibody be
initially purified using simple, inexpensive procedures. In one
embodiment, chicken antibody from eggs is purified by extraction
and precipitation with PEG. PEG purification exploits the
differential solubility of lipids (which are abundant in egg yolks)
and yolk proteins in high concentrations of PEG 8000. [Polson et
al., Immunol. Comm. 9:495 (1980).] The technique is rapid, simple,
and relatively inexpensive and yields an immunoglobulin fraction
that is significantly purer in terms of contaminating
non-immunoglobulin proteins than the comparable ammonium sulfate
fractions of mammalian sera and horse antibodies. The majority of
the PEG is removed from the precipitated chicken immunoglobulin by
treatment with ethanol. Indeed, PEG-purified antibody is
sufficiently pure that the present invention contemplates the use
of PEG-purified antitoxins in the passive immunization of
intoxicated humans and animals.
[0135] IV. Treatment The present invention contemplates antitoxin
therapy for humans and other animals intoxicated by bacterial
toxins. A preferred method of treatment is by intravenous
administration of anti-boutlinal antitoxin; oral administration is
also contemplated for other clostridial antitoxins.
[0136] A. Dosage of Antitoxin
[0137] It was noted by way of background that a balance must be
struck when administering currently available antitoxin which is
usually produced in large animals such as horses; sufficient
antitoxin must be administered to neutralize the toxin, but not so
much antitoxin as to increase the risk of untoward side effects.
These side effects are caused by: i) patient sensitivity to foreign
(e.g, horse) proteins; ii) anaphylactic or immunogenic properties
of non-immunoglobulin proteins; iii) the complement fixing
properties of mammalian antibodies; and/or iv) the overall burden
of foreign protein administered. It is extremely difficult to
strike this balance when, as noted above, the degree of
intoxication (and hence the level of antitoxin therapy needed) can
only be approximated.
[0138] The present invention contemplates significantly reducing
side effects so that this balance is more easily achieved.
Treatment according to the present invention contemplates reducing
side effects by using PEG-purified antitoxin from birds.
[0139] In one embodiment, the treatment of the present invention
contemplates the use of PEG-purified antitoxin from birds. The use
of yolk-derived, PEG-purified antibody as antitoxin allows for the
administration of: 1) non(mammalian)-complement-fixing, avian
antibody; 2) a less heterogeneous mixture of non-immunoglobulin
proteins; and 3) less total protein to deliver the equivalent
weight of active antibody present in currently available
antitoxins. The non-mammalian source of the antitoxin makes it
useful for treating patients who are sensitive to horse or other
mammalian sera.
[0140] B. Delivery of Antitoxin
[0141] Although it is not intended to limit the route of delivery,
the present invention contemplates a method for antitoxin treatment
of bacterial intoxication in which delivery of antitoxin is oral.
In one embodiment, antitoxin is delivered in a solid form (e.g.,
tablets). In an alternative embodiment antitoxin is delivered in an
aqueous solution. When an aqueous solution is used, the solution
has sufficient ionic strength to solubilize antibody protein, yet
is made palatable for oral administration. The delivery solution
may also be buffered (e.g., carbonate buffer pH 9.5) which can
neutralize stomach acids and stabilize the antibodies when the
antibodies are administered orally. In one embodiment the delivery
solution is an aqueous solution. In another embodiment the delivery
solution is a nutritional formula. Preferably, the delivery
solution is infant formula. Yet another embodiment contemplates the
delivery of lyophilized antibody encapsulated or microencapsulated
inside acid-resistant compounds.
[0142] Methods of applying enteric coatings to pharmaceutical
compounds are well known to the art [companies specializing in the
coating of pharmaceutical compounds are available; for example, The
Coating Place (Verona, Wis.) and AAI (Wilmington, N.C.)]. Enteric
coatings which are resistant to gastric fluid and whose release
(i.e., dissolution of the coating to release the pharmaceutical
compound) is pH dependent are commercially available [for example,
the polymethacrylates Eudragit.RTM. L and Eudragit.RTM. S (Rohm
GmbH)]. Eudragit.RTM. S is soluble in intestinal fluid from pH 7.0;
this coating can be used to microencapsulate lyophilized antitoxin
antibodies and the particles are suspended in a solution having a
pH above or below pH 7.0 for oral administration. The
microparticles will remain intact and undissolved until they
reached the intestines where the intestinal pH would cause them to
dissolve thereby releasing the antitoxin.
[0143] The invention contemplates a method of treatment which can
be administered for treatment of acute intoxication. In one
embodiment, antitoxin is administered orally in either a delivery
solution or in tablet form, in therapeutic dosage, to a subject
intoxicated by the bacterial toxin which served as immunogen for
the antitoxin.
[0144] The invention also contemplates a method of treatment which
can be administered prophylactically. In one embodiment, antitoxin
is administered orally, in a delivery solution, in therapeutic
dosage, to a subject, to prevent intoxication of the subject by the
bacterial toxin which served as immunogen for the production of
antitoxin. In another embodiment, antitoxin is administered orally
in solid form such as tablets or as microencapsulated particles.
Microencapsulation of lyophilized antibody using compounds such as
Eudragit.RTM. (Rohm GmbH) or polyethylene glycol, which dissolve at
a wide range of pH units, allows the oral administration of solid
antitoxin in a liquid form (i.e., a suspension) to recipients
unable to tolerate administration of tablets (e.g., children or
patients on feeding tubes). In one preferred embodiment the subject
is a child. In another embodiment, antibody raised against whole
bacterial organism is administered orally to a subject, in a
delivery solution, in therapeutic dosage.
[0145] V. Vaccines Against Clostridial Species
[0146] The invention contemplates the generation of mono- and
multivalent vaccines for the protection of an animal (particularly
humans) against several clostridial species. Of particular interest
are vaccines which stimulate the production of a humoral immune
response to C. botulinum, C. tetani and C. difficile in humans. The
antigens comprising the vaccine preparation may be native or
recombinantly produced toxin proteins from the clostridial species
listed above. When toxin proteins are used as immunogens they are
generally modified to reduce the toxicity. This modification may be
by chemical or genetic (i e., recombinant DNA technology) means. In
general genetic detoxification (i.e., the expression of nontoxic
fragments in a host cell) is preferred as the expression of
nontoxic fragments in a host cell precludes the presence of intact,
active toxin in the final preparation. However, when chemical
modification is desired, the preferred toxin modification is
formaldehyde treatment.
[0147] The invention contemplates that recombinant C. botulinum
toxin proteins be used as antigens in mono- and multivalent vaccine
preparations. Soluble, substantially endotoxin-free recombinant C.
botulinum toxin proteins derived from serotypes A, B and E may be
used individually (i.e., as mono-valent vaccines) or in combination
(i.e., as a multi-valent vaccine). In addition, the recombinant C.
botulinum toxin proteins derived from serotpes A, B and E may be
used in conjunction with either recombinant or native toxins or
toxoids from other serotypes of C. botulinum, C. difficile and C.
tetani as antigens for the preparation of these mono- and
multivalent vaccines. It is contemplated that, due to the
structural similarity of C. botulinum and C. tetani toxin proteins,
a vaccine comprising C. difficile and botulinum toxin proteins
(native or recombinant or a mixture thereof) be used to stimulate
an immune response against C. botulinum, C. tetani and C.
difficile.
[0148] The present invention further contemplates multi-valent
vaccines comprising two or more botulinal toxin proteins selected
from the group comprising recombinant C. botulinum toxin proteins
derived from serotypes A, B, C (including C1 and C2), D, E, F and
G.
[0149] The adverse consequences of exposure to botulinal toxin
would be avoided by immunization of subjects at risk of exposure to
the toxin with nontoxic preparations which confer immunity such as
chemically or genetically detoxified toxin.
[0150] Vaccines which confer immunity against one or more of the
toxin types A, B, E, F and G would be useful as a means of
protecting humans from the deleterious effects of those C.
botulinum toxins known to affect man. Indeed as the possibility
exists that humans could be exposed to any of the seven serotypes
of C. botulinum toxin (e.g., during biological warfare or the
production of toxin in a laboratory setting), multivalent vaccines
capable of conferring immunity against toxin types A-G (including
both C1 and C2 toxins) would be useful for the protection of
humans. Vaccines which confer immunity against one or more of the
toxin types C, D and E would be useful for veterinary
applications.
[0151] The botulinal neurotoxin is synthesized as a single
polypeptide chain which is processed into a heavy (H; .about.100
kD) and a light (L; .about.50 kD) chain by cleavage with
proteolytic enzymes; these two chains are held together via
disulfide bonds in the active toxin (referred to as derivative
toxin) [B. R. DasGupta and H. Sugiyama, Biochem. Biophys. Res.
Commun. 48:108 (1972); reviewed in B. R. DasGupta, J. Physiol.
84:220 (1990), H. Sugiyama, Microbiol. Rev. 44:419 (1980) and C. L.
Hatheway, Clin. Microbiol. Rev. 3:66 (1990)]. The heavy chain of
the active toxin is cleaved by trypsin to produce two fragments
termed H.sub.C (also referred to as H.sub.1 or C) and H.sub.N (also
referred to as H.sub.2 or B). The H.sub.C fragment (46 kD)
comprises the carboxy end of the H chain. The H.sub.N fragment
(.about.49 kD) comprises the animo end and remains attached to the
L chain (H.sub.NL). Neither H.sub.C or H.sub.NL is toxic. H.sub.C
competes with whole derivative toxin for binding to synaptosomes
and therefore H.sub.C is said to contain the receptor binding site.
The H.sub.C and H.sub.N fragments of botulinal toxin are analogous
to the fragments C and B of tetanus toxin which are produced by
papain cleavage. The C fragment of tetanus toxin has been shown to
be responsible for the binding of tetanus toxin to purified
gangliosides and neuronal cells [Halpern and Loftus, J. Biol. Chem.
288:11188 (1993)].
[0152] Antisera raised against purified preparations of isolated
botulinal H and L chains have been shown to protect mice against
the lethal effects of the toxin; however, the effectiveness of the
two antisera differ with the anti-H sera being more potent (H.
Sugiyama, supra). While the different botulinal toxins show
structural similarity to one another, the different serotypes are
reported to be immunologically distinct (i.e., sera raised against
one toxin type does not cross-react to a significant degree with
other types). Thus, the generation of multivalent vaccines may
require the use of more than one type of toxin.
[0153] C. botulinum toxin genes from all seven serotypes have been
cloned and sequenced (Minton (1995), supra); in addition, partial
amino acid sequence is available for a number of C. botulinum
toxins isolated from different strains within a given serotype. The
C. botulinum toxins contain about 1250-1300 amino acid residues. On
the DNA level, the overall degree of homology between C. botulinum
serotypes A, B, C, D and E toxins averages between 50 and 60%
identity with a greater degree of homology being found between H
chain-encoding regions than between those encoding L chains [Whelan
et al. (1992) Appl. Environ. Microbiol. 58:2345]. The degree of
identity between C. botulinum toxins on the amino acid level
reflects the level of DNA sequence homology. The most divergent
area of DNA and amino acid sequence is found within the
carboxy-terminal area of the various C. botulinum H chain genes.
This portion of the toxin (i.e., H.sub.C or the C fragment) plays a
major role in cell binding. As toxin from different serotypes is
thought to bind to distinct cell receptor molecules, it is not
surprising that the toxins diverge significantly over this
region.
[0154] Within a given serotype, small variations in the primary
amino acid sequence of the botulinal toxins isolated from different
strains has been reported [Whelan et al. (1992), supra and Minton
(1995), supra]. The present invention contemplates fusion proteins
comprising portions of C. botulinum toxins from serotypes A-G
including the variants found among different strains within a given
serotype. The present invention provides oligonucleotide primers
which may be used to amplify the C fragment or receptor-binding
region of the toxin gene from various strains of C. botulinum
serotype A, serotype B, serotype C(C1 and C2), serotype D, serotype
E, serotype F and serotype G. A large number of different strains
of C. botulinum serotype A, serotype B, serotype C, serotype D
serotype E and serotype F are available from the American Type
Culture Collection (ATCC; Rockville, Md.). For example, the ATCC
provides the following: Type A strains: 174 (ATCC 3502), 457 (ATCC
17862), and NCTC 7272 (ATCC 19397); Type B strains: 34 (ATCC 439),
62A (ATCC 7948), NCA 213 B (ATCC 7949), 13114 (ATCC 8083), 3137
(ATCC 17780), 1347 (ATCC 17841), 2017 (ATCC 17843), 2217 (ATCC
17844), 2254 (ATCC 17845) and VP 1731 (ATCC 25765); Type C strains:
2220 (ATCC 17782), 2239 (ATCC 17783), 2223 (ATCC 17784; a type
C-.beta. strain; C-.beta. strains produce C2 toxin), 662 (ATCC
17849; a type C-.alpha. strain; C-.alpha. strains produce mainly C1
toxin and a small amount of C2 toxin), 2021 (ATCC 17850; a type
C-.alpha. strain) and VPI 3803 (ATCC 25766); Type D strains: ATCC
9633, 2023 (ATCC 17851), and VPI 5995 (ATCC 27517); Type E strains:
ATCC 43181, 36208 (ATCC 9564), 2231 (ATCC 17786), 2229 (ATCC
17852), 2279 (ATCC 17854) and 2285 (ATCC 17855) and Type F strains:
202F (ATCC 23387), VPI 4404 (ATCC 25764), VPI 2382 (ATCC 27321) and
Langeland (ATCC 35415). Type G strain, 113/30 (NCFB 3012) may be
obtained from the National Collection of Food Bacteria (NCFB, AFRC
Institute of Food Research, Reading, United Kingdom).
[0155] Purification methods have been reported for native toxin
types A, B, C, D, E, and F [reviewed in G. Sakaguchi, Pharmac.
Ther. 19:165 (1983)]. As the different botulinal toxins are
structurally related, the invention contemplates the expression of
any of the botulinal toxins (e.g, types A-G) as soluble recombinant
fusion proteins.
[0156] In particular, methods for purification of the type A
botulinum neurotoxin have been developed [L. J. Moberg and H.
Sugiyama, Appl. Environ. Microbiol. 35:878 (1978)]. Immunization of
hens with detoxified purified protein results in the generation of
neutralizing antibodies [B. S. Thalley et al., in Botulinum and
Tetanus Neurotoxins, B. R. DasGupta, ed., Plenum Press, New York
(1993), p. 467].
[0157] The currently available C. botulinum pentavalent vaccine
comprising chemically inactivated (i.e., formaldehyde treated) type
A, B, C, D and E toxins is not adequate. The efficacy is variable
(in particular, only 78% of recipients produce protective levels of
anti-type B antibodies following administration of the primary
series) and immunization is painful (deep subcutaneous inoculation
is required for administration), with adverse reactions being
common (moderate to severe local reactions occur in approximately
6% of recipients upon initial injection; this number rises to
approximately 11% of individuals who receive booster injections)
[Informational Brochure for the Pentavalent (ABCDE) Botulinum
Toxoid, Centers for Disease Control]. Preparation of this vaccine
is dangerous as active toxin must be handled by laboratory
workers.
[0158] In general, chemical detoxification of bacterial toxins
using agents such as formaldehyde, glutaraldehyde or hydrogen
peroxide is not optimal for the generation of vaccines or
antitoxins. A delicate balance must be struck between too much and
too little chemical modification. If the treatment is insufficient,
the vaccine may retain residual toxicity. If the treatment is too
excessive, the vaccine may lose potency due to destruction of
native immunogenic determinants. Another major limitation of using
botulinal toxoids for the generation of antitoxins or vaccines is
the high production expense. For the above reasons, the development
of methods for the production of nontoxic but immunogenic C.
botulinum toxin proteins is desirable.
[0159] The C. botulinum and C tetanus toxin proteins have similar
structures [reviewed in E. J. Schantz and E. A. Johnson, Microbiol.
Rev. 56:80 (1992)]. The carboxy-terminal 50 kD fragment of the
tetanus toxin heavy chain (fragment C) is released by papain
cleavage and has been shown to be non-toxic and immunogenic.
Recombinant tetanus toxin fragment C has been developed as a
candidate vaccine antigen [A. J. Makoff et al., Bio/Technology
7:1043 (1989)]. Mice immunized with recombinant tetanus toxin
fragment C were protected from challenge with lethal doses of
tetanus toxin. No studies have demonstrated that the recombinant
tetanus fragment C protein confers immunity against other botulinal
toxins such as the C. botulinum toxins.
[0160] Recombinant tetanus fragment C has been expressed in E. coli
(A. J. Makoff et al., Bio/Technology, supra and Nucleic Acids Res.
17:10191 (1989); J. L. Halpern et al., Infect. Immun. 58:1004
(1990)], yeast [M. A. Romanos et al., Nucleic Acids Res. 19:1461
(1991)] and baculovirus [I. G. Charles et al., Infect. Immun.
59:1627 (1991)]. Synthetic tetanus toxin genes had to be
constructed to facilitate expression in yeast (M. A. Romanos et
al., supra) and E. coli [A. J. Makoff et al., Nucleic Acids Res.,
supra], due to the high A-T content of the tetanus toxin gene
sequences. High A-T content is a common feature of clostridial
genes (M. R. Popoff et al., Infect. Immun. 59:3673 (1991); H. F.
LaPenotiereu et al., in Botulinum and Tetanus Neurotoxins, B. R.
DasGupta, ed., Plenum Press, New York (1993), p. 463] which creates
expression difficulties in E. coli and yeast due primarily to
altered codon usage frequency and fortuitous polyadenylation sites,
respectively.
[0161] The C fragment of the C. botulinum type A neurotoxin heavy
chain has been evaluated as a vaccine candidate. The C. botulinum
type A neurotoxin gene has been cloned and sequenced [D. E.
Thompson et al., Eur. J. Biochem. 189:73 (1990)]. The C fragment of
the type A toxin was expressed as either a fusion protein
comprising the botulinal C fragment fused with the maltose binding
protein (MBP) or as a native protein [H. F. LaPenotiere et al,
(1993) supra, H. F. LaPenotiere et al., Toxicon. 33:1383 (1995) and
Middlebrook and Brown (1995), Curr. Top. Microbiol. Immunol.
195:89-122]. The plasmid construct encoding the native protein was
reported to be unstable, while the fusion protein was expressed
primarily in inclusion bodies as insoluble protein. Immunization of
mice with crudely purified MBP fusion protein resulted in
protection against IP challenge with 3 LD.sub.50 doses of toxin
[LaPenotiere et al., (1993) and (1995), supra]. However, this
recombinant C. botulinum type A toxin C fragment/MBP fusion protein
is not a suitable immunogen for the production of vaccines as it is
expressed as an insoluble protein in E. coli. Furthermore, this
recombinant C. botulinum type A toxin C fragment/BP fusion protein
was not shown to be substantially free of endotoxin contamination.
Experience with recombinant C. botulinum type A toxin C
fragment/MBP fusion proteins shows that the presence of the MBP on
the fusion protein greatly complicates the removal of endotoxin
from preparations of the recombinant fusion protein (see Ex. 24,
infra). Expression of a synthetic gene encoding C. botulinum type A
toxin C fragment as a soluble protein excreted from insect cells
has been reported [Middlebrook and Brown (1995), supra]; no details
regarding the level of expression achieved or the presence of
endotoxin or other pyrogens were provided. Like the insoluble
protein expressed in E. coli, immunization with the recombinant
protein produced in insect cells was reported to protect mice from
challenge with C. botulinum toxin A.
[0162] Inclusion body protein must be solubilized prior to
purification and/or administration to a host. The harsh treatment
of inclusion body protein needed to accomplish this solubilization
may reduce the immunogenicity of the purified protein. Ideally,
recombinant proteins to be used as vaccines are expressed as
soluble proteins at high levels (i.e., greater than or equal to
about 0.75% of total cellular protein) in E. coli or other host
cells (e.g., yeast, insect cells, etc.). This facilitates the
production and isolation of sufficient quantities of the immunogen
in a highly purified form (i.e., substantially free of endotoxin or
other pyrogen contamination). The ability to express recombinant
toxin proteins as soluble proteins in E. coli is advantageous due
to the low cost of growth compared to insect or mammalian tissue
culture cells.
[0163] The C. botulinum type B neurotoxin gene has been cloned and
sequenced from two strains of C. botulinum type B [Whelan et al.
(1992) Appl. Environ. Microbiol. 58:2345 (Danish strain) and Hutson
et al. (1994) Curr. Microbiol. 28:101 (Eklund 17B strain)]. The
nucleotide sequence of the toxin gene derived from the Eklund 17B
strain (ATCC 25765) is available from the EMBL/GemBank sequence
data banks under the accession number X71343; the nucleotide
sequence of the coding region is listed in SEQ ID NO:39. The amino
acid sequence of the C. botulinum type B neurotoxin derived from
the strain Eklund 17B is listed in SEQ ID NO:40. The nucleotide
sequence of the C. botulinum serotype B toxin gene derived from the
Danish strain is listed in SEQ ID NO:41. The amino acid sequence of
the C. botulinum type B neurotoxin derived from the Danish strain
is listed in SEQ ID NO:42.
[0164] The C. botulinum type B neurotoxin gene is synthesized as a
single polypeptide chain which is processed to form a dimer
composed of a light and a heavy chain linked via disulfide bonds.
The light chain is responsible for pharmacological activity (i.e.,
inhibition of the release of acetylcholine at the neuromuscular
junction). The N-terminal portion of the heavy chain is thought to
mediate channel formation while the C-terminal portion mediates
toxin binding; the type B neurotoxin has been reported to exist as
a mixture of predominantly single chain with some double chain
(Whelan et al., supra). The 50 kD carboxy-terminal portion of the
heavy chain is referred to as the C fragment or the H.sub.C domain.
The present invention reports for the first time, the expression of
the C fragment of C. botulinum type B toxin in heterologous hosts
(e.g., E. coli).
[0165] The C. botulinum type E neurotoxin gene has been cloned and
sequenced from a number of different strains [Poulet et al. (1992)
Biochem. Biophys. Res. Commun. 183:107; Whelan et al. (1992) Eur.
J. Biochem. 204:657; and Fujii et al. (1993) J. Gen. Microbiol.
139:79]. The nucleotide sequence of the type E toxin gene is
available from the EMBL sequence data bank under accession numbers
X62089 (strain Beluga) and X62683 (strain NCTC 11219); the
nucleotide sequence of the coding region (strain Beluga) is listed
in SEQ ID NO:45. The amino acid sequence of the C. botulinum type E
neurotoxin derived from strain Beluga is listed in SEQ ID NO:46.
The type E neurotoxin gene is synthesized as a single polypeptide
chain which may be converted to a double-chain form (i.e., a heavy
chain and a light chain) by cleavage with trypsin; unlike the type
A neurotoxin, the type E neurotoxin exists essentially only in the
single-chain form. The 50 kD carboxy-terminal portion of the heavy
chain is referred to as the C fragment or the H.sub.C domain. The
present invention reports for the first time, the expression of the
C fragment of C. botulinum type E toxin in heterologous hosts
(e.g., E. coli).
[0166] The C. botulinum type C1, D, F and G neurotoxin genes have
been cloned and sequenced. The nucleotide and amino acid sequences
of these genes and toxins are provided herein. The invention
provides methods for the expression of the C fragment from each of
these toxin genes in heterologous hosts and the purification of the
resulting recombinant proteins.
[0167] The subject invention provides methods which allow the
production of soluble C. botulinum toxin proteins in economical
host cells (e.g., E coli). In addition the subject invention
provides methods which allow the production of soluble botulinal
toxin proteins in yeast and insect cells. Further, methods for the
isolation of purified soluble C. botulinum toxin proteins which are
suitable for immunization of humans and other animals are provided.
These soluble, purified preparations of C. botulinum toxin proteins
provide the basis for improved vaccine preparations and facilitate
the production of antitoxin.
[0168] When recombinant clostridial toxin proteins produced in
gram-negative bacteria (e.g., E. coli) are used as vaccines, they
are purified to remove endotoxin prior to administration to a host
animal. In order to vaccinate a host, an immunogenically-effective
amount of purified substantially endotoxin-free recombinant
clostridial toxin protein is administered in any of a number of
physiologically acceptable carriers known to the art. When
administered for the purpose of vaccination, the purified
substantially endotoxin-free recombinant clostridial toxin protein
may be used alone or in conjunction with known adjutants, including
potassium alum, aluminum phosphate, aluminum hydroxide, Gerbu
adjuvant (GMDP; C.C. Biotech Corp.), RIBI adjuvant (MPL; RIBI
Immunochemical Research, Inc.), QS21 (Cambridge Biotech). The alum
and aluminum-based adjutants are particularly preferred when
vaccines are to be administered to humans; however, any adjuvant
approved for use in humans may be employed. The route of
immunization may be nasal, oral, intramuscular, intraperitoneal or
subcutaneous.
[0169] The invention contemplates the use of soluble, substantially
endotoxin-free preparations of fusion proteins comprising the C
fragment of the C. botulinum type A, B, C, D, E, F, and G toxin as
vaccines. In one embodiment, the vaccine comprises the C fragment
of either the C. botulinum type A, B, C, D, E, F, or G toxin and a
poly-histidine tract (also called a histidine tag). In a
particularly preferred embodiment, a fusion protein comprising the
histidine tagged C fragment is expressed using the pET series of
expression vectors (Novagen). The pET expression system utilizes a
vector containing the T7 promoter which encodes the fusion protein
and a host cell which can be induced to express the T7 DNA
polymerase (i.e., a DE3 host strain). The production of C fragment
fusion proteins containing a histidine tract is not limited to the
use of a particular expression vector and host strain. Several
commercially available expression vectors and host strains can be
used to express the C fragment protein sequences as a fusion
protein containing a histidine tract (For example, the pQE series
(pQE-8, 12, 16, 17, 18, 30, 31, 32, 40, 41, 42, 50, 51, 52, 60 and
70) of expression vectors (Qiagen) which are used with the host
strains M15[pREP4] (Qiagen) and SG13009[pREP4] (Qiagen) can be used
to express fusion proteins containing six histidine residues at the
amino-terminus of the fusion protein). Furthermore a number of
commercially available expression vectors which provide a histidine
tract also provide a protease cleavage site between the histidine
tract and the protein of interest (e.g., botulinal toxin
sequences). Cleavage of the resulting fusion protein with the
appropriate protease will remove the histidine tag from the protein
of interest (e.g., botulinal toxin sequences) (see Example 28a,
infra). Removal of the histidine tag may be desirable prior to
administration of the recombinant botulinal toxin protein to a
subject (e.g., a human).
[0170] VI. Detection of Toxin
[0171] The invention contemplates detecting bacterial toxin in a
sample. The term "sample" in the present specification and claims
is used in its broadest sense. On the one hand it is meant to
include a specimen or culture. On the other hand, it is meant to
include both biological and environmental samples.
[0172] Biological samples may be animal, including human, fluid,
solid (e.g., stool) or tissue; liquid and solid food products and
ingredients such as dairy items, vegetables, meat and meat
by-products, and waste. Environmental samples include environmental
material such as surface matter, soil, water and industrial
samples, as well as samples obtained from food and dairy processing
instruments, apparatus, equipment, disposable and non-disposable
items. These examples are not to be construed as limiting the
sample types applicable to the present invention.
[0173] The invention contemplates detecting bacterial toxin by a
competitive immunoassay method that utilizes recombinant toxin A
and toxin B proteins, antibodies raised against recombinant
bacterial toxin proteins. A fixed amount of the recombinant toxin
proteins are immobilized to a solid support (e.g., a microtiter
plate) followed by the addition of a biological sample suspected of
containing a bacterial toxin. The biological sample is first mixed
with affinity-purified or PEG fractionated antibodies directed
against the recombinant toxin protein. A reporter reagent is then
added which is capable of detecting the presence of antibody bound
to the immobilized toxin protein. The reporter substance may
comprise an antibody with binding specificity for the antitoxin
attached to a molecule which is used to identify the presence of
the reporter substance. If toxin is present in the sample, this
toxin will compete with the immobilized recombinant toxin protein
for binding to the anti-recombinant antibody thereby reducing the
signal obtained following the addition of the reporter reagent. A
control is employed where the antibody is not mixed with the
sample. This gives the highest (or reference) signal.
[0174] The invention also contemplates detecting bacterial toxin by
a "sandwich" immunoassay method that utilizes antibodies directed
against recombinant bacterial toxin proteins. Affinity-purified
antibodies directed against recombinant bacterial toxin proteins
are immobilized to a solid support (e.g., microtiter plates).
Biological samples suspected of containing bacterial toxins are
then added followed by a washing step to remove substantially all
unbound antitoxin. The biological sample is next exposed to the
reporter substance, which binds to antitoxin and is then washed
free of substantially all unbound reporter substance. The reporter
substance may comprise an antibody with binding specificity for the
antitoxin attached to a molecule which is used to identify the
presence of the reporter substance. Identification of the reporter
substance in the biological tissue indicates the presence of the
bacterial toxin.
[0175] It is also contemplated that bacterial toxin be detected by
pouring liquids (e.g. soups and other fluid foods and feeds
including nutritional supplements for humans and other animals)
over immobilized antibody which is directed against the bacterial
toxin. It is contemplated that the immobilized antibody will be
present in or on such supports as cartridges, columns, beads, or
any other solid support medium. In one embodiment, following the
exposure of the liquid to the immobilized antibody, unbound toxin
is substantially removed by washing. The exposure of the liquid is
then exposed to a reporter substance which detects the presence of
bound toxin. In a preferred embodiment the reporter substance is an
enzyme, fluorescent dye, or radioactive compound attached to an
antibody which is directed against the toxin (i.e., in a "sandwich"
immunoassay). It is also contemplated that the detection system
will be developed as necessary (e.g., the addition of enzyme
substrate in enzyme systems; observation using fluorescent light
for fluorescent dye systems; and quantitation of radioactivity for
radioactive systems).
[0176] Experimental
[0177] The following examples serve to illustrate certain preferred
embodiments and aspects of the present invention and are not to be
construed as limiting the scope thereof.
[0178] In the disclosure which follows, the following abbreviations
apply: .degree. C. (degrees Centigrade); rpm (revolutions per
minute); BBS-Tween (borate buffered saline containing Tween); BSA
(bovine serum albumin); ELISA (enzyme-linked immunosorbent assay);
CFA (complete Freund's adjuvant); IFA (incomplete Freund's
adjuvant); IgG (immunoglobulin G); IgY (immunoglobulin Y); IM
(intramuscular); IP (intraperitoneal); IV (intravenous or
intravascular); SC (subcutaneous); H.sub.2O (water); HCl
(hydrochloric acid); LD.sub.100 (lethal dose for 100% of
experimental animals); aa (amino acid); HPLC (high performance
liquid chromatography); kD (kilodaltons); gm (grams); .mu.g
(micrograms); mg (milligrams); ng (nanograms); .mu.l (microliters);
ml (milliliters); mm (millimeters); nm (nanometers); .mu.m
(micrometer); M (molar); mM (millimolar); MW (molecular weight);
sec (seconds); min(s) (minute/minutes); hr(s) (hour/hours); MgCl,
(magnesium chloride); NaCl (sodium chloride); Na.sub.2CO.sub.3
(sodium carbonate); OD.sub.280 (optical density at 280 nm);
OD.sub.600 (optical density at 600 nm); PAGE (polyacrylamide gel
electrophoresis); PBS [phosphate buffered saline (150 mM NaCl, 10
mM sodium phosphate buffer, pH 7.2)]; PEG (polyethylene glycol);
PMSF (phenylmethylsulfonyl fluoride); SDS (sodium dodecyl sulfate);
Tris (tris(hydroxymethyl)aminomethane); Ensure.RTM. ((Ensure.RTM.,
Ross Laboratories, Columbus Ohio); Enfamil.RTM. (Enfamil.RTM., Mead
Johnson); w/v (weight to volume); v/v (volume to volume); Amicon
(Amicon, Inc., Beverly, Mass.); Amresco (Amresco, Inc., Solon,
Ohio); ATCC (American Type Culture Collection, Rockville, Md.); BBL
(Baltimore Biologics Laboratory, (a division of Becton Dickinson),
Cockeysville, Md.); Becton Dickinson (Becton Dickinson Labware,
Lincoln Park, N.J.); BioRad (BioRad, Richmond, Calif.); Biotech
(C-C Biotech Corp., Poway, Calif.); Charles River (Charles River
Laboratories, Wilmington, Mass.); Cocalico (Cocalico Biologicals
Inc., Reamstown, Pa.); CytRx (CytRx Corp., Norcross, Ga.); Falcon
(e.g. Baxter Healthcare Corp., McGaw Park, Ill. and Becton
Dickinson); FDA (Federal Food and Drug Administration); Fisher
Biotech (Fisher Biotech, Springfield, N.J.); GIBCO (Grand Island
Biologic Company/BRL, Grand Island, N.Y.); Gibco-BRL (Life
Technologies, Inc., Gaithersburg, Md.); Harlan Sprague Dawley
(Harlan Sprague Dawley, Inc., Madison, Wis.); Mallinckrodt (a
division of Baxter Healthcare Corp., McGaw Park, Ill.); Millipore
(Millipore Corp., Marlborough, Mass.); New England Biolabs (New
England Biolabs, Inc., Beverly, Mass.); Novagen (Novagen, Inc.,
Madison, Wis.); Pharmacia (Pharmacia, Inc., Piscataway, N.J.);
Qiagen (Qiagen, Chatsworth, Calif.); Sasco (Sasco, Omaha, Nebr.);
Showdex (Showa Denko America, Inc., New York, N.Y.); Sigma (Sigma
Chemical Co., St. Louis, Mo.); Sterogene (Sterogene, Inc., Arcadia,
Calif.); Tech Lab (Tech Lab, Inc., Blacksburg, Va.); and Vaxcell
(Vaxcell, Inc., a subsidiary of CytRX Corp., Norcross, Ga.).
[0179] When a recombinant protein is described in the specification
it is referred to in a short-hand manner by the amino acids in the
toxin sequence present in the recombinant protein rounded to the
nearest 10. For example, the recombinant protein pMB1850-2360
contains amino acids 1852 through 2362 of the C. difficile toxin B
protein. The specification gives detailed construction details for
all recombinant proteins such that one skilled in the art will know
precisely which amino acids are present in a given recombinant
protein.
EXAMPLE 1
Production of High-Titer Antibodies to Clostridium difficile
Organisms in a Hen
[0180] Antibodies to certain pathogenic organisms have been shown
to be effective in treating diseases caused by those organisms. It
has not been shown whether antibodies can be raised, against
Clostridium difficile, which would be effective in treating
infection by this organism. Accordingly, C. difficile was tested as
immunogen for production of hen antibodies.
[0181] To determine the best course for raising high-titer egg
antibodies against whole C. difficile organisms, different
immunizing strains and different immunizing concentrations were
examined. The example involved (a) preparation of the bacterial
immunogen, (b) immunization, (c) purification of anti-bacterial
chicken antibodies, and (d) detection of anti-bacterial antibodies
in the purified IgY preparations.
[0182] a) Preparation Of Bacterial Immunogen C. difficile strains
43594 (serogroup A) and 43596 (serogroup C) were originally
obtained from the ATCC. These two strains were selected because
they represent two of the most commonly-occurring serogroups
isolated from patients with antibiotic-associated pseudomembranous
colitis. [Delmee et al., J. Clin. Microbiol., 28(10):2210 (1990).]
Additionally, both of these strains have been previously
characterized with respect to their virulence in the Syrian hamster
model for C. difficile infection. [Delmee et al., J. Med
Microbiol., 33:85 (1990).]
[0183] The bacterial strains were separately cultured on brain
heart infusion agar for 48 hours at 37.degree. C. in a Gas Pack 100
Jar (BBL, Cockeysville, Md.) equipped with a Gas Pack Plus
anaerobic envelope (BBL). Forty-eight hour cultures were used
because they produce better growth and the organisms have been
found to be more cross-reactive with respect to their surface
antigen presentation. The greater the degree of cross-reactivity of
our IgY preparations, the better the probability of a broad range
of activity against different strains/serogroups. [Toma et al., J.
Clin. Microbiol., 26(3):426 (1988).]
[0184] The resulting organisms were removed from the agar surface
using a sterile dacron-tip swab, and were suspended in a solution
containing 0.4% formaldehyde in PBS, pH 7.2. This concentration of
formaldehyde has been reported as producing good results for the
purpose of preparing whole-organism immunogen suspensions for the
generation of polyclonal anti-C. difficile antisera in rabbits.
[Delmee et al., J. Clin. Microbiol., 21:323 (1985); Davies et al.,
Microbial Path., 9:141 (1990).] In this manner, two separate
bacterial suspensions were prepared, one for each strain. The two
suspensions were then incubated at 4.degree. C. for 1 hour.
Following this period of formalin-treatment, the suspensions were
centrifuged at 4,200.times.g for 20 min., and the resulting pellets
were washed twice in normal saline. The washed pellets, which
contained formalin-treated whole organisms, were resuspended in
fresh normal saline such that the visual turbidity of each
suspension corresponded to a #7 McFarland standard. [M. A. C.
Edelstein, "Processing Clinical Specimens for Anaerobic Bacteria:
Isolation and Identification Procedures," in S. M. Finegold et al
(eds.)., Bailey and Scott's Diagnostic Microbiology, pp. 477-507,
C. V. Mosby Co., (1990). The preparation of McFarland nephelometer
standards and the corresponding approximate number of organisms for
each tube are described in detail at pp. 172-173 of this volume.]
Each of the two #7 suspensions was then split into two separate
volumes. One volume of each suspension was volumetrically adjusted,
by the addition of saline, to correspond to the visual turbidity of
a #1 McFarland standard. [Id.] The #1 suspensions contained
approximately 3.times.10.sup.8 organisms/ml, and the #7 suspensions
contained approximately 2.times.10.sup.9 organisms/ml. [Id.] The
four resulting concentration-adjusted suspensions of
formalin-treated C. difficile organisms were considered to be
"bacterial immunogen suspensions." These suspensions were used
immediately after preparation for the initial immunization. [See
section (b).]
[0185] The formalin-treatment procedure did not result in 100%
non-viable bacteria in the immunogen suspensions. In order to
increase the level of killing, the formalin concentration and
length of treatment were both increased for subsequent immunogen
preparations, as described below in Table 3. (Although viability
was decreased with the stronger formalin treatment, 100%
inviability of the bacterial immunogen suspensions was not
reached.) Also, in subsequent immunogen preparations, the formalin
solutions were prepared in normal saline instead of PBS. At day 49,
the day of the fifth immunization, the excess volumes of the four
previous bacterial immunogen suspensions were stored frozen at
-70.degree. C. for use during all subsequent immunizations.
[0186] b) Immunization
[0187] For the initial immunization, 1.0 ml volumes of each of the
four bacterial immunogen suspensions described above were
separately emulsified in 1.2 ml volumes of CFA (GIBCO). For each of
the four emulsified immunogen suspensions, two four-month old White
Leghorn hens pre-laying) were immunized. (It is not necessary to
use pre-laying hens; actively-laying hens can also be utilized.)
Each hen received a total volume of approximately 1.0 ml of a
single emulsified immunogen suspension via four injections (two
subcutaneous and two intramuscular) of approximately 250 .mu.l per
site. In this manner, a total of four different immunization
combinations, using two hens per combination, were initiated for
the purpose of evaluating both the effect of immunizing
concentration on egg yolk antibody (IgY) production, and
interstrain cross-reactivity of IgY raised against heterologous
strains. The four immunization groups are summarized in Table
3.
3TABLE 3 Immunization Groups Approximate Group Designation
Immunizing Strain Immunizing Dose CD 43594, #1 C. difficile 1.5
.times. 10.sup.8 organisms/hen strain 43594 CD 43594, #7 " 1.0
.times. 10.sup.9 organisms/hen CD 43596, #1 C. difficile 1.5
.times. 10.sup.8 organisms/hen strain 43596 CD 43596, #7 " 1.0
.times. 10.sup.9 organisms/hen
[0188] The time point for the first series of immunizations was
designated as "day zero." All subsequent immunizations were
performed as described above except that the bacterial immunogen
suspensions were emulsified using IFA (GIBCO) instead of CFA, and
for the later time point immunization, the stored frozen
suspensions were used instead of freshly-prepared suspensions. The
immunization schedule used is listed in Table 4.
4TABLE 4 Immunization Schedule Immunogen Day Of Immunization
Formalin-Treatment Preparation Used 0 1%, 1 hr. freshly-prepared 14
1%, overnight " 21 1%, overnight " 35 1%, 48 hrs. " 49 1%, 72 hrs.
" 70 " stored frozen 85 " " 105 " "
[0189] c) Purification of Anti-Bacterial Chicken Antibodies
[0190] Groups of four eggs were collected per immunization group
between days 80 and 84 post-initial immunization, and chicken
immunoglobulin (IgY) was extracted according to a modification of
the procedure of A. Polson et al., Immunol. Comm., 9:495 (1980). A
gentle stream of distilled water from a squirt bottle was used to
separate the yolks from the whites, and the yolks were broken by
dropping them through a funnel into a graduated cylinder. The four
individual yolks were pooled for each group. The pooled, broken
yolks were blended with 4 volumes of egg extraction buffer to
improve antibody yield (egg extraction buffer is 0.01 M sodium
phosphate, 0.1 M NaCl, pH 7.5, containing 0.005% thimerosal), and
PEG 8000 (Amresco) was added to a concentration of 3.5%. When all
the PEG dissolved, the protein precipitates that formed were
pelleted by centrifugation at 13,000.times.g for 10 minutes. The
supernatants were decanted and filtered through cheesecloth to
remove the lipid layer, and the PEG was added to the supernatants
to a final concentration of 12% (the supernatants were assumed to
contain 3.5% PEG). After a second centrifugation, the supernatants
were discarded and the pellets were centrifuged a final time to
extrude the remaining PEG. These crude IgY pellets were then
dissolved in the original yolk volume of egg extraction buffer and
stored at 4.degree. C. As an additional control, a preimmune IgY
solution was prepared as described above, using eggs collected from
unimmunized hens.
[0191] d) Detection of Anti-Bacterial Antibodies in the Purified
IgY Preparations
[0192] In order to evaluate the relative levels of specific anti-C.
difficile activity in the IgY preparations described above, a
modified version of the whole-organism ELISA procedure of N. V.
Padhye et al., J. Clin. Microbiol. 29:99-103 (1990) was used.
Frozen organisms of both C. difficile strains described above were
thawed and diluted to a concentration of approximately
1.times.10.sup.7 organisms/ml using PBS, pH 7.2. In this way, two
separate coating suspensions were prepared, one for each immunizing
strain. Into the wells of 96-well microtiter plates (Falcon,
Pro-Bind Assay Plates) were placed 100 .mu.l volumes of the coating
suspensions. In this manner, each plate well received a total of
approximately 1.times.10.sup.6 organisms of one strain or the
other. The plates were then incubated at 4.degree. C. overnight.
The next morning, the coating suspensions were decanted, and all
wells were washed three times using PBS. In order to block
non-specific binding sites, 100 .mu.l of 0.5% BSA (Sigma) in PBS
was then added to each well, and the plates were incubated for 2
hours at room temperature. The blocking solution was decanted, and
100 .mu.l volumes of the IgY preparations described above were
initially diluted 1:500 with a solution of 0.1% BSA in PBS, and
then serially diluted in 1:5 steps. The following dilutions were
placed in the wells: 1:500, 1:2,500, 1:62,5000, 1:312,500, and
1:1,562,500. The plates were again incubated for 2 hours at room
temperature. Following this incubation, the IgY-containing
solutions were decanted, and the wells were washed three times
using BBS-Tween (0.1 M boric acid, 0.025 M sodium borate, 1.0 M
NaCl, 0.1% Tween-20), followed by two washes using PBS-Tween (01%
Tween-20), and finally, two washes using PBS only. To each well,
100 .mu.l of a 1:750 dilution of rabbit anti-chicken IgG
(whole-molecule)-alkaline phosphatase conjugate (Sigma) (diluted in
0.1% BSA in PBS) was added. The plates were again incubated for 2
hours at room temperature. The conjugate solutions were decanted
and the plates were washed as described above, substituting 50 mM
Na.sub.2CO.sub.3, pH 9.5 for the PBS in the final wash. The plates
were developed by the addition of 100 .mu.l of a solution
containing 1 mg/ml para-nitrophenyl phosphate (Sigma) dissolved in
50 mM Na.sub.2CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 to each well, and
incubating the plates at room temperature in the dark for 45
minutes. The absorbance of each well was measured at 410 nm using a
Dynatech MR 700 plate reader. In this manner, each of the four IgY
preparations described above was tested for reactivity against both
of the immunizing C. difficile strains; strain-specific, as well as
cross-reactive activity was determined.
[0193] Table 5 shows the results of the whole-organism ELISA. All
four IgY preparations demonstrated significant levels of activity,
to a dilution of 1:62,500 or greater against both of the immunizing
organism strains. Therefore, antibodies raised against one strain
were highly cross-reactive with the other strain, and vice versa.
The immunizing concentration of organisms did not have a
significant effect on organism-specific IgY production, as both
concentrations produced approximately equivalent responses.
Therefore, the lower immunizing concentration of approximately
1.5.times.10.sup.8 organisms/hen is the preferred immunizing
concentration of the two tested. The preimmune IgY preparation
appeared to possess relatively low levels of C. difficile-reactive
activity to a dilution of 1:500, probably due to prior exposure of
the animals to environmental clostridia.
[0194] An initial whole-organism ELISA was performed using IgY
preparations made from single CD 43594, #1 and CD 43596, #1 eggs
collected around day 50 (data not shown). Specific titers were
found to be 5 to 10-fold lower than those reported in Table 5.
These results demonstrate that it is possible to begin immunizing
hens prior to the time that they begin to lay eggs, and to obtain
high titer specific IgY from the first eggs that are laid. In other
words, it is not necessary to wait for the hens to begin laying
before the immunization schedule is started.
5TABLE 5 Results Of The Anti-C. difficile Whole-Organism ELISA
Dilution Of 43594- 43596- IgY Preparation IgY Prep Coated Wells
Coated Wells CD 43594, #1 1:500 1.746 1.801 1:2,500 1.092 1.670
1:12,500 0.202 0.812 1:62,500 0.136 0.179 1:312,500 0.012 0.080
1:1,562,500 0.002 0.020 CD 43594, #7 1:500 1.780 1.771 1:2,500
1.025 1.078 1:12,500 0.188 0.382 1:62,500 0.052 0.132 1:312,500
0.022 0.043 1:1,562,500 0.005 0.024 CD 43596, #1 1:500 1.526 1.790
1:2,500 0.832 1.477 1:12,500 0.247 0.452 1:62,500 0.050 0.242
1:312,500 0.010 0.067 1:1,562,500 0.000 0.036 CD 43596, #7 1:500
1.702 1.505 1:2,500 0.706 0.866 1:12,500 0.250 0.282 1:62,500 0.039
0.078 1:312,500 0.002 0.017 1:1,562,500 0.000 0.010 Preimmune IgY
1:500 0.142 0.309 1:2,500 0.032 0.077 1:12,500 0.006 0.024 1:62,500
0.002 0.012 1:312,500 0.004 0.010 1:1,562,500 0.002 0.014
EXAMPLE 2
Treatment Of C. difficile Infection with Anti-C. difficile
Antibody
[0195] In order to determine whether the immune IgY antibodies
raised against whole C. difficile organisms were capable of
inhibiting the infection of hamsters by C. difficile, hamsters
infected by these bacteria were utilized. [Lyerly et al., Infect.
Immun., 59:2215-2218 (1991).] This example involved: (a)
determination of the lethal dose of C. difficile organisms; and (b)
treatment of infected animals with immune antibody or control
antibody in nutritional solution.
[0196] a) Determination of the Lethal Dose of C. difficile
Organisms
[0197] Determination of the lethal dose of C. difficile organisms
was carried out according to the model described by D. M. Lyerly et
al., Infect. Immun., 59:2215-2218 (1991). C. difficile strain ATCC
43596 (serogroup C, ATCC) was plated on BHI agar and grown
anaerobically (BBL Gas Pak 100 system) at 37.degree. C. for 42
hours. Organisms were removed from the agar surface using a sterile
dacron-tip swab and suspended in sterile 0.9% NaCl solution to a
density of 10.sup.8 organisms/ml.
[0198] In order to determine the lethal dose of C. difficile in the
presence of control antibody and nutritional formula, non-immune
eggs were obtained from unimmunized hens and a 12% PEG preparation
made as described in Example 1(c). This preparation was redissolved
in one fourth the original yolk volume of vanilla flavor
Ensure.RTM..
[0199] Starting on day one, groups of female Golden Syrian hamsters
(Harlan Sprague Dawley), 8-9 weeks old and weighing approximately
100 gm, were orally administered 1 ml of the preimmune/Ensure.RTM.
formula at time zero, 2 hours, 6 hours, and 10 hours. At 1 hour,
animals were orally administered 3.0 mg clindamycin HCl (Sigma) in
1 ml of water. This drug predisposes hamsters to C. difficile
infection by altering the normal intestinal flora. On day two, the
animals were given 1 ml of the preimmune IgY/Ensure.RTM. formula at
time zero, 2 hours, 6 hours, and 10 hours. At 1 hour on day two,
different groups of animals were inoculated orally with saline
(control), or 10.sup.2, 10.sup.4, 10.sup.6, or 10.sup.8 C.
difficile organisms in 1 ml of saline. From days 3-12, animals were
given 1 ml of the preimmune IgY/Ensure.RTM. formula three times
daily and observed for the onset of diarrhea and death. Each animal
was housed in an individual cage and was offered food and water ad
libitum.
[0200] Administration of 10.sup.6-10.sup.8 organisms resulted in
death in 3-4 days while the lower doses of 10.sup.2-10.sup.4
organisms caused death in 5 days. Cecal swabs taken from dead
animals indicated the presence of C. difficile. Given the
effectiveness of the 10.sup.2 dose, this number of organisms was
chosen for the following experiment to see if hyperimmune anti-C.
difficile antibody could block infection.
[0201] b) Treatment of Infected Animals with Immune Antibody or
Control Antibody in Nutritional Formula
[0202] The experiment in (a) was repeated using three groups of
seven hamsters each. Group A received no clindamycin or C.
difficile and was the survival control. Group B received
clindamycin, 10.sup.2 C. difficile organisms and preimmune IgY on
the same schedule as the animals in (a) above. Group C received
clindamycin, 10.sup.2 C. difficile organisms, and hyperimmune
anti-C. difficile IgY on the same schedule as Group B. The anti-C.
difficile IgY was prepared as described in Example 1 except that
the 12% PEG preparation was dissolved in one fourth the original
yolk volume of Ensure.RTM..
[0203] All animals were observed for the onset of diarrhea or other
disease symptoms and death. Each animal was housed in an individual
cage and was offered food and water ad libitum. The results are
shown in Table 6.
6TABLE 6 The Effect Of Oral Feeding Of Hyperimmune IgY Antibody on
C. difficile Infection Animal Group Time To Diarrhea.sup.a Time To
Death.sup.a A pre-immune IgY only no diarrhea no deaths B
Clindamycin, 30 hrs. 49 hrs. C. difficile, preimmune IgY C
Clindamycin, 33 hrs. 56 hrs. C. difficile, immune IgY .sup.aMean of
seven animals.
[0204] Hamsters in the control group A did not develop diarrhea and
remained healthy during the experimental period. Hamsters in groups
B and C developed diarrheal disease. Anti-C. difficile IgY did not
protect the animals from diarrhea or death, all animals succumbed
in the same time interval as the animals treated with preimmune
IgY. Thus, while immunization with whole organisms apparently can
improve sub-lethal symptoms with particular bacteria (see U.S. Pat.
No. 5,080,895 to H. Tokoro), such an approach does not prove to be
productive to protect against the lethal effects of C.
difficile.
EXAMPLE 3
Production of C. botulinum Type A Antitoxin in Hens
[0205] In order to determine whether antibodies could be raised
against the toxin produced by clostridial pathogens, which would be
effective in treating clostridial diseases, antitoxin to C.
botulinum type A toxin was produced. This example involves: (a)
toxin modification; (b) immunization; (c) antitoxin collection; (d)
antigenicity assessment; and (e) assay of antitoxin titer.
[0206] a) Toxin Modification
[0207] C. botulinum type A toxoid was obtained from B. R. DasGupta.
From this, the active type A neurotoxin (M. W. approximately 150
kD) was purified to greater than 99% purity, according to published
methods. [B. R. DasGupta & V. Sathyamoorthy, Toxicon, 22:415
(1984).] The neurotoxin was detoxified with formaldehyde according
to published methods. [B. R. Singh & B. R. DasGupta, Toxicon,
27:403 (1989).]
[0208] b) Immunization
[0209] C. botulinum toxoid for immunization was dissolved in PBS (1
mg/ml) and was emulsified with an approximately equal volume of CFA
(GIBCO) for initial immunization or IFA for booster immunization.
On day zero, two white leghorn hens, obtained from local breeders,
were each injected at multiple sites (intramuscular and
subcutaneous) with 1 ml inactivated toxoid emulsified in 1 ml CFA.
Subsequent booster immunizations were made according to the
following schedule for day of injection and toxoid amount: days 14
and 21-0.5 mg; day 171-0.75 mg; days 394, 401, 409-0.25 mg. One hen
received an additional booster of 0.150 mg on day 544.
[0210] c) Antitoxin Collection
[0211] Total yolk immunoglobulin (IgY) was extracted as described
in Example 1(c) and the IgY pellet was dissolved in the original
yolk volume of PBS with thimerosal.
[0212] d) Antigenicity Assessment
[0213] Eggs were collected from day 409 through day 423 to assess
whether the toxoid was sufficiently immunogenic to raise antibody.
Eggs from the two hens were pooled and antibody was collected as
described in the standard PEG protocol. [Example 1(c).]
Antigenicity of the botulinal toxin was assessed on Western blots.
The 150 kD detoxified type A neurotoxin and unmodified, toxic, 300
kD botulinal type A complex (toxin used for intragastric route
administration for animal gut neutralization experiments; see
Example 6) were separated on a SDS-polyacrylamide reducing gel. The
Western blot technique was performed according to the method of
Towbin. [H. Towbin et al., Proc. Natl. Acad. Sci. USA, 76:4350
(1979).] Ten .mu.g samples of C. botulinum complex and toxoid were
dissolved in SDS reducing sample buffer (1% SDS, 0.5%
2-mercaptoethanol, 50 mM Tris, pH 6.8, 10% glycerol, 0.025% w/v
bromphenol blue, 10% .beta.-mercaptoethanol), heated at 95.degree.
C. for 10 min and separated on a 1 mm thick 5% SDS-polyacrylamide
gel. [K. Weber and M. Osborn, "Proteins and Sodium Dodecyl Sulfate:
Molecular Weight Determination on Polyacrylamide Gels and Related
Procedures," in The Proteins, 3d Edition (H. Neurath & R. L.
Hill, eds), pp. 179-223, (Academic Press, NY, 1975).] Part of the
gel was cut off and the proteins were stained with Coomassie Blue.
The proteins in the remainder of the gel were transferred to
nitrocellulose using the Milliblot-SDE electro-blotting system
(Millipore) according to manufacturer's directions. The
nitrocellulose was temporarily stained with 10% Ponceau S [S. B.
Carroll and A. Laughon, "Production and Purification of Polyclonal
Antibodies to the Foreign Segment of .beta.-galactosidase Fusion
Proteins," in DNA Cloning: A Practical Approach, Vol.III, (D.
Glover, ed.), pp. 89-111, IRL Press, Oxford, (1987)] to visualize
the lanes, then destained by running a gentle stream of distilled
water over the blot for several minutes. The nitrocellulose was
immersed in PBS containing 3% BSA overnight at 4.degree. C. to
block any remaining protein binding sites.
[0214] The blot was cut into strips and each strip was incubated
with the appropriate primary antibody. The avian anti-C. botulinum
antibodies [described in (c)] and pre-immune chicken antibody (as
control) were diluted 1:125 in PBS containing 1 mg/ml BSA for 2
hours at room temperature. The blots were washed with two changes
each of large volumes of PBS, BBS-Tween and PBS, successively (10
min/wash). Goat anti-chicken IgG alkaline phosphatase conjugated
secondary antibody (Fisher Biotech) was diluted 1:500 in PBS
containing 1 mg/ml BSA and incubated with the blot for 2 hours at
room temperature. The blots were washed with two changes each of
large volumes of PBS and BBS-Tween, followed by one change of PBS
and 0.1 M Tris-HCl, pH 9.5. Blots were developed in freshly
prepared alkaline phosphatase substrate buffer (100 .mu.g/ml
nitroblue tetrazolium (Sigma), 50 .mu.g/ml
5-bromo-4-chloro-3-indolyl phosphate (Sigma), 5 mM MgCl.sub.2 in 50
mM Na.sub.2CO.sub.3, pH 9.5).
[0215] The Western blots are shown in FIG. 1. The anti-C. botulinum
IgY reacted to the toxoid to give a broad immunoreactive band at
about 145-150%D on the reducing gel. This toxoid is refractive to
disulfide cleavage by reducing agents due to formalin crosslinking.
The immune IgY reacted with the active toxin complex, a 97 kD C.
botulinum type A heavy chain and a 53 kD light chain. The preimmune
IgY was unreactive to the C. botulinum complex or toxoid in the
Western blot.
[0216] e) Antitoxin Antibody Titer
[0217] The IgY antibody titer to C. botulinum type A toxoid of eggs
harvested between day 409 and 423 was evaluated by ELISA, prepared
as follows. Ninety-six-well Falcon Pro-bind plates were coated
overnight at 4.degree. C. with 100 .mu.l/well toxoid [B. R. Singh
& B. R. Das Gupta, Toxicon 27:403 (1989)] at 2.5 .mu.g/ml in
PBS, pH 7.5 containing 0.005% thimerosal. The following day the
wells were blocked with PBS containing 1% BSA for 1 hour at
37.degree. C. The IgY from immune or preimmune eggs was diluted in
PBS containing 1% BSA and 0.05% Tween 20 and the plates were
incubated for 1 hour at 37.degree. C. The plates were washed three
times with PBS containing 0.05% Tween 20 and three times with PBS
alone. Alkaline phosphatase-conjugated goat-anti-chicken IgG
(Fisher Biotech) was diluted 1:750 in PBS containing 1% BSA and
0.05% Tween 20, added to the plates, and incubated 1 hour at
37.degree. C. The plates were washed as before, and p-nitrophenyl
phosphate (Sigma) at 1 mg/ml in 0.05 M Na.sub.2CO.sub.3, pH 9.5, 10
mM MgCl.sub.2 was added.
[0218] The results are shown in FIG. 2. Chickens immunized with the
toxoid generated high titers of antibody to the immunogen.
Importantly, eggs from both immunized hens had significant
anti-immunogen antibody titers as compared to preimmune control
eggs. The anti-C. botulinum IgY possessed significant activity, to
a dilution of 1:93,750 or greater.
EXAMPLE 4
Preparation of Avian Egg Yolk Immunoglobulin in an Orally
Administrable Form
[0219] In order to administer avian IgY antibodies orally to
experimental mice, an effective delivery formula for the IgY had to
be determined. The concern was that if the crude IgY was dissolved
in PBS, the saline in PBS would dehydrate the mice, which might
prove harmful over the duration of the study. Therefore,
alternative methods of oral administration of IgY were tested. The
example involved: (a) isolation of immune IgY; (b) solubilization
of IgY in water or PBS, including subsequent dialysis of the
IgY-PBS solution with water to eliminate or reduce the salts (salt
and phosphate) in the buffer; and (c) comparison of the quantity
and activity of recovered IgY by absorbance at 280 nm and PAGE, and
enzyme-linked immunoassay (ELISA).
[0220] a) Isolation of Immune IgY
[0221] In order to investigate the most effective delivery formula
for IgY, we used IgY which was raised against Crotalus durissus
terrificus venom. Three eggs were collected from hens immunized
with the C. durissus terrificus venom and IgY was extracted from
the yolks using the modified Polson procedure described by Thalley
and Carroll [Bio/Technology, 8:934-938 (1990)] as described in
Example 1(c).
[0222] The egg yolks were separated from the whites, pooled, and
blended with four volumes of PBS. Powdered PEG 8000 was added to a
concentration of 3.5%. The mixture was centrifuged at 10,000 rpm
for 10 minutes to pellet the precipitated protein, and the
supernatant was filtered through cheesecloth to remove the lipid
layer. Powdered PEG 8000 was added to the supernatant to bring the
final PEG concentration to 12% (assuming a PEG concentration of
3.5% in the supernatant). The 12%. PEG/IgY mixture was divided into
two equal volumes and centrifuged to pellet the IgY.
[0223] b) Solubilization of the IgY in Water or PBS
[0224] One pellet was resuspended in 1/2 the original yolk volume
of PBS, and the other pellet was resuspended in 1/2 the original
yolk volume of water. The pellets were then centrifuged to remove
any particles or insoluble material. The IgY in PBS solution
dissolved readily but the fraction resuspended in water remained
cloudy.
[0225] In order to satisfy anticipated sterility requirements for
orally administered antibodies, the antibody solution needs to be
filter-sterilized (as an alternative to heat sterilization which
would destroy the antibodies). The preparation of IgY resuspended
in water was too cloudy to pass through either a 0.2 or 0.45 .mu.m
membrane filter, so 10 ml of the PBS resuspended fraction was
dialyzed overnight at room temperature against 250 ml of water. The
following morning the dialysis chamber was emptied and refilled
with 250 ml of fresh H.sub.2O for a second dialysis. Thereafter,
the yields of soluble antibody were determined at OD.sub.280 and
are compared in Table 7.
7TABLE 7 Dependence Of IgY Yield On Solvents Absorbance Of 1:10
Percent Fraction Dilution At 280 nm Recovery PBS dissolved 1.149
100% H.sub.2O dissolved 0.706 61% PBS dissolved/H.sub.2O dialyzed
0.885 77%
[0226] Resuspending the pellets in PBS followed by dialysis against
water recovered more antibody than directly resuspending the
pellets in water (77% versus 61%). Equivalent volumes of the IgY
preparation in PBS or water were compared by PAGE, and these
results were in accordance with the absorbance values (data not
shown).
[0227] c) Activity of IgY Prepared with Different Solvents
[0228] An ELISA was performed to compare the binding activity of
the IgY extracted by each procedure described above. C. durissus
terrificus (C.d.t.) venom at 2.5 .mu.g/ml in PBS was used to coat
each well of a 96-well microtiter plate. The remaining protein
binding sites were blocked with PBS containing 5 mg/ml BSA. Primary
antibody dilutions (in PBS containing 1 mg/ml BSA) were added in
duplicate. After 2 hours of incubation at room temperature, the
unbound primary antibodies were removed by washing the wells with
PBS, BBS-Tween, and PBS. The species specific secondary antibody
(goat anti-chicken immunoglobulin alkaline-phosphatase conjugate
(Sigma) was diluted 1:750 in PBS containing 1 mg/ml BSA and added
to each well of the microtiter plate. After 2 hours of incubation
at room temperature, the unbound secondary antibody was removed by
washing the plate as before, and freshly prepared alkaline
phosphatase substrate (Sigma) at 1 mg/ml in 50 mM Na.sub.2CO.sub.3,
10 mM MgCl.sub.2, pH 9.5 was added to each well. The color
development was measured on a Dynatech MR 700 microplate reader
using a 412 nm filter. The results are shown in Table 8.
[0229] The binding assay results parallel the recovery values in
Table 7, with PBS-dissolved IgY showing slightly more activity than
the PBS-dissolved/H.sub.2O dialyzed antibody. The water-dissolved
antibody had considerably less binding activity than the other
preparations.
EXAMPLE 5
Survival of Antibody Activity After Passage Through the
Gastrointestinal Tract
[0230] In order to determine the feasibility of oral administration
of antibody, it was of interest to determine whether orally
administered IgY survived passage through the gastrointestinal
tract. The example involved: (a) oral administration of specific
immune antibody mixed with a nutritional formula; and (b) assay of
antibody activity extracted from feces.
8TABLE 8 Antigen-Binding Activity Of IgY Prepared With Different
Solvents Dilution Preimmune PBS Dissolved H.sub.2O Dissolved
PBS/H.sub.2O 1:500 0.005 1.748 1.577 1.742 1:2,500 0.004 0.644
0.349 0.606 1:12,500 0.001 0.144 0.054 0.090 1:62,500 0.001 0.025
0.007 0.016 1:312,500 0.010 0.000 0.000 0.002
[0231] a) Oral Administration of Antibody
[0232] The IgY preparations used in this example are the same
PBS-dissolve 20 dialyzed antivenom materials obtained in Example 4
above, mixed with an equal volume of Enfamil.RTM.. Two mice were
used in this experiment, each receiving a different diet as
follows:
[0233] 1) water and food as usual;
[0234] 2) immune IgY preparation dialyzed against water and mixed
1:1 with Enfamil.RTM.. (The mice were given the corresponding
mixture as their only source of food and water).
[0235] b) Antibody Activity after Ingestion
[0236] After both mice had ingested their respective fluids, each
tube was refilled with approximately 10 ml of the appropriate fluid
first thing in the morning. By mid-morning there was about 4 to 5
ml of liquid left in each tube. At this point stool samples were
collected from each mouse, weighed, and dissolved in approximately
500 .mu.l PBS per 100 mg stool sample. One hundred and sixty mg of
control stools (no antibody) and 99 mg of experimental stools
(specific antibody) in 1.5 ml microfuge tubes were dissolved in 800
and 500 .mu.l PBS, respectively. The samples were heated at
37.degree. C. for 10 minutes and vortexed vigorously. The
experimental stools were also broken up with a narrow spatula Each
sample was centrifuged for 5 minutes in a microfuge and the
supernatants, presumably containing the antibody extracts, were
collected. The pellets were saved at 2-8.degree. C. in case future
extracts were needed. Because the supernatants were tinted, they
were diluted five-fold in PBS containing 1 mg/ml BSA for the
initial dilution in the enzyme immunoassay (ELISA). The primary
extracts were then diluted five-fold serially from this initial
dilution. The volume of primary extract added to each well was 190
.mu.l. The ELISA was performed exactly as described in Example
4.
9TABLE 9 Specific Antibody Activity After Passage Through The
Gastrointestinal Tract Dilution Preimmune IgY Control Fecal Extract
EXP. Fecal Extract 1:5 <0 0.000 0.032 1:25 0.016 <0 0.016
1:125 <0 <0 0.009 1:625 <0 0.003 0.001 1:3125 <0 <0
0.000
[0237] There was some active antibody in the fecal extract from the
mouse given the specific antibody in Enfamil.RTM. formula, but it
was present at a very low level. Since the samples were assayed at
an initial 1:5 dilution, the binding observed could have been
higher with less dilute samples. Consequently, the mice were
allowed to continue ingesting either regular food and water or the
specific IgY in Enfamil.RTM. formula, as appropriate, so the assay
could be repeated. Another ELISA plate was coated overnight with 5
.mu.g/ml of C.d.t. venom in PBS.
[0238] The following morning the ELISA plate was blocked with 5
mg/ml BSA, and the fecal samples were extracted as before, except
that instead of heating the extracts at 37.degree. C., the samples
were kept on ice to limit proteolysis. The samples were assayed
undiluted initially, and in 5.times. serial dilutions thereafter.
Otherwise the assay was carried out as before.
10TABLE 10 Specific Antibody Survives Passage Through The
Gastrointestinal Tract Dilution Preimmune IgY Control Extract Exp.
Extract undiluted 0.003 <0 0.379 1:5 <0 <0 0.071 1:25
0.000 <0 0.027 1:125 0.003 <0 0.017 1:625 0.000 <0 0.008
1:3125 0.002 <0 0.002
[0239] The experiment confirmed the previous results, with the
antibody activity markedly higher. The control fecal extract showed
no anti-C.d.t. activity, even undiluted, while the fecal extract
from the anti-C.d.t. IgY/Enfamil.RTM.-fed mouse showed considerable
anti-C.d.t. activity. This experiment (and the previous experiment)
clearly demonstrate that active IgY antibody survives passage
through the mouse digestive tract, a finding with favorable
implications for the success of IgY antibodies administered orally
as a therapeutic or prophylactic.
EXAMPLE 6
In Vivo Neutralization of Type C. botulinum Type A Neurotoxin by
Avian Antitoxin Antibody
[0240] This example demonstrated the ability of PEG-purified
antitoxin, collected as described in Example 3, to neutralize the
lethal effect of C. botulinum neurotoxin type A in mice. To
determine the oral lethal dose (LD.sub.100) of toxin A, groups of
BALB/c mice were given different doses of toxin per unit body
weight (average body weight of 24 grams). For oral administration,
toxin A complex, which contains the neurotoxin associated with
other non-toxin proteins was used. This complex is markedly more
toxic than purified neurotoxin when given by the oral route. [I.
Ohishi et al., Infect. Immun., 16:106 (1977).] C. botulinum toxin
type A complex, obtained from Eric Johnson (University Of
Wisconsin, Madison) was 250 .mu.g/ml in 50 mM sodium citrate, pH
5.5, specific toxicity 3.times.10.sup.7 mouse LD.sub.50/mg with
parenteral administration. Approximately 40-50 ng/gm body weight
was usually fatal within 48 hours in mice maintained on
conventional food and water. When mice were given a diet ad libitum
of only Enfamil.RTM. the concentration needed to produce lethality
was approximately 2.5 times higher (125 ng/gm body weight).
Botulinal toxin concentrations of approximately 200 ng/gm body
weight were fatal in mice fed Enfamil.RTM. containing preimmune IgY
(resuspended in Enfamil.RTM. at the original yolk volume).
[0241] The oral LD.sub.100 of C. botulinum toxin was also
determined in mice that received known amounts of a mixture of
preimmune IgY-Ensure.RTM. delivered orally through feeding needles.
Using a 22 gauge feeding needle, mice were given 250 .mu.l each of
a preimmune IgY-Ensure.RTM. mixture (preimmune IgY dissolved in 1/4
original yolk volume) 1 hour before and 1/2 hour and 5 hours after
administering botulinal toxin. Toxin concentrations given orally
ranged from approximately 12 to 312 ng/gm body weight (0.3 to 7.5
.mu.g per mouse). Botulinal toxin complex concentration of
approximately 40 ng/gm body weight (1 .mu.g per mouse) was lethal
in all mice in less than 36 hours.
[0242] Two groups of BALB/c mice, 10 per group, were each given
orally a single dose of 1 .mu.g each of botulinal toxin complex in
100 .mu.l of 50 mM sodium citrate pH 5.5. The mice received 250
.mu.l treatments of a mixture of either preimmune or immune IgY in
Ensure.RTM. (1/4 original yolk volume) 1 hour before and 1/2 hour,
4 hours, and 8 hours after botulinal toxin administration. The mice
received three treatments per day for two more days. The mice were
observed for 96 hours. The survival and mortality are shown in
Table 11.
11TABLE 11 Neutralization Of Botulinal Toxin A In Vivo Toxin Number
Number Dose Antibody Of Mice Of Mice ng/gm Type Alive Dead 41.6
non-immune 0 10 41.6 anti-botulinal toxin 10 0
[0243] All mice treated with the preimmune IgY-Ensure.RTM. mixture
died within 46 hours post-toxin administration. The average time of
death in the mice was 32 hours post toxin administration.
Treatments of preimmune IgY-Ensure.RTM. mixture did not continue
beyond 24 hours due to extensive paralysis of the mouth in mice of
this group. In contrast, all ten mice treated with the immune
anti-botulinal toxin IgY-Ensure.RTM. mixture survived past 96
hours. Only 4 mice in this group exhibited symptoms of botulism
toxicity (two mice about 2 days after and two mice 4 days after
toxin administration). These mice eventually died 5 and 6 days
later. Six of the mice in this immune group displayed no adverse
effects to the toxin and remained alive and healthy long term.
Thus, the avian anti-botulinal toxin antibody demonstrated very
good protection from the lethal effects of the toxin in the
experimental mice.
EXAMPLE 7
Production of an Avian Antitoxin Against Clostridium difficile
Toxin A
[0244] Toxin A is a potent cytotoxin secreted by pathogenic strains
of C. difficile, that plays a direct role in damaging
gastrointestinal tissues. In more severe cases of C. difficile
intoxication, pseudomembranous colitis can develop which may be
fatal. This would be prevented by neutralizing the effects of this
toxin in the gastrointestinal tract. As a first step, antibodies
were produced against a portion of the toxin. The example involved:
(a) conjugation of a synthetic peptide of toxin A to bovine serum
albumin; (b) immunization of hens with the peptide-BSA conjugate;
and (c) detection of antitoxin peptide antibodies by ELISA.
[0245] a) Conjugation Of A Synthetic Peptide Of Toxin A To Bovine
Serum Albumin
[0246] The synthetic peptide CQTIDGKKYYFN--NH.sub.2 (SEQ ID NO:82)
was prepared commercially (Multiple Peptide Systems, San Diego,
Calif.) and validated to be>80% pure by high-pressure liquid
chromatography. The eleven amino acids following the cysteine
residue represent a consensus sequence of a repeated amino acid
sequence found in Toxin A. [Wren et al., Infect. Immun.,
59:3151-3155 (1991).] The cysteine was added to facilitate
conjugation to carrier protein.
[0247] In order to prepare the carrier for conjugation, BSA (Sigma)
was dissolved in 0.01 M NaPO.sub.4, pH 7.0 to a final concentration
of 20 mg/ml and n-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS;
Pierce) was dissolved in N,N-dimethyl formamide to a concentration
of 5 mg/ml. MBS solution, 0.51 ml, was added to 3.25 ml of the BSA
solution and incubated for 30 minutes at room temperature with
stirring every 5 minutes. The MBS-activated BSA was then purified
by chromatography on a Bio-Gel P-10 column (Bio-Rad; 40 ml bed
volume) equilibrated with 50 mM NaPO.sub.4, pH 7.0 buffer. Peak
fractions were pooled (6.0 ml).
[0248] Lyophilized toxin A peptide (20 mg) was added to the
activated BSA mixture, stirred until the peptide dissolved and
incubated 3 hours at room temperature. Within 20 minutes, the
reaction mixture became cloudy and precipitates formed. After 3
hours, the reaction mixture was centrifuged at 10,000.times.g for
10 min and the supernatant analyzed for protein content. No
significant protein could be detected at 280 nm. The conjugate
precipitate was washed three times with PBS and stored at 4.degree.
C. A second conjugation was performed with 15 mg of activated BSA
and 5 mg of peptide and the conjugates pooled and suspended at a
peptide concentration of 10 mg/ml in 10 mM NaPO.sub.4, pH 7.2.
[0249] b) Immunization of Hens with Peptide Conjugate
[0250] Two hens were each initially immunized on day zero by
injection into two subcutaneous and two intramuscular sites with 1
mg of peptide conjugate that was emulsified in CFA (GIBCO). The
hens were boosted on day 14 and day 21 with 1 mg of peptide
conjugate emulsified in IFA (GIBCO).
[0251] c) Detection of Antitoxin Peptide Antibodies by ELISA
[0252] IgY was purified from two eggs obtained before immunization
(pre-immune) and two eggs obtained 31 and 32 days after the initial
immunization using PEG fractionation as described in Example 1.
[0253] Wells of a 96-well microtiter plate (Falcon Pro-Bind Assay
Plate) were coated overnight at 4.degree. C. with 100 .mu.g/ml
solution of the toxin A synthetic peptide in PBS, pH 7.2 prepared
by dissolving 1 mg of the peptide in 1.0 ml of H.sub.2O and
dilution of PBS. The pre-immune and immune IgY preparations were
diluted in a five-fold series in a buffer containing 1% PEG 8000
and 0.1% Tween-20 (v/v) in PBS, pH 7.2. The wells were blocked for
2 hours at room temperature with 150 .mu.l of a solution containing
5% (v/v) Carnation.RTM. nonfat dry milk and 1% PEG 8000 in PBS, pH
7.2. After incubation for 2 hours at room temperature, the wells
were washed, secondary rabbit anti-chicken IgG-alkaline phosphatase
(1:750) added, the wells washed again and the color development
obtained as described in Example 1. The results are shown in Table
12.
12TABLE 12 Reactivity Of IgY With Toxin Peptide Absorbance At 410
nm Dilution Of PEG Prep Preimmune Immune Anti-Peptide. 1:100 0.013
0.253 1:500 0.004 0.039 1:2500 0.004 0.005
[0254] Clearly, the immune antibodies contain titers against this
repeated epitope of toxin A.
EXAMPLE 8
Production of Avian Antitoxins Against Clostridium difficile Native
Toxins A and B
[0255] To determine whether avian antibodies are effective for the
neutralization of C. difficile toxins, hens were immunized using
native C. difficile toxins A and B. The resulting egg yolk
antibodies were then extracted and assessed for their ability to
neutralize toxins A and B in vitro. The Example involved (a)
preparation of the toxin immunogens, (b) immunization, (c)
purification of the antitoxins, and (d) assay of toxin
neutralization activity.
[0256] a) Preparation of the Toxin Immunogens
[0257] Both C. difficile native toxins A and B, and C. difficile
toxoids, prepared by the treatment of the native toxins with
formaldehyde, were employed as immunogens. C. difficile toxoids A
and B were prepared by a procedure which was modified from
published methods (Ehrich et al., Infect. Immun. 28:1041 (1980).
Separate solutions (in PBS) of native C. difficile toxin A and
toxin B (Tech Lab) were each adjusted to a concentration of 0.20
mg/ml, and formaldehyde was added to a final concentration of 0.4%.
The toxin/formaldehyde solutions were then incubated at 37.degree.
C. for 40 hrs. Free formaldehyde was then removed from the
resulting toxoid solutions by dialysis against PBS at 4.degree. C.
In previously published reports, this dialysis step was not
performed. Therefore, free formaldehyde must have been present in
their toxoid preparations. The toxoid solutions were concentrated,
using a Centriprep concentrator unit (Amicon), to a final toxoid
concentration of 4.0 mg/ml. The two resulting preparations were
designated as toxoid A and toxoid B.
[0258] C. difficile native toxins were prepared by concentrating
stock solutions of toxin A and toxin B (Tech Lab, Inc), using
Centriprep concentrator units (Amicon), to a final concentration of
4.0 mg/ml.
[0259] b) Immunization
[0260] The first two immunizations were performed using the toxoid
A and toxoid B immunogens described above. A total of 3 different
immunization combinations were employed. For the first immunization
group, 0.2 ml of toxoid A was emulsified in an equal volume of
Titer Max adjuvant (CytRx). Titer Max was used in order to conserve
the amount of immunogen used, and to simplify the immunization
procedure. This immunization group was designated "CTA." For the
second immunization group, 0.1 ml of toxoid B was emulsified in an
equal volume of Titer Max adjuvant. This group was designated
"CTB." For the third immunization group, 0.2 ml of toxoid A was
first mixed with 0.2 ml of toxoid B, and the resulting mixture was
emulsified in 0.4 ml of Titer Max adjuvant. This group was
designated "CTAB." In this way, three separate immunogen emulsions
were prepared, with each emulsion containing a final concentration
of 2.0 mg/ml of toxoid A (CTA) or toxoid B (CTB) or a mixture of
2.0 mg/ml toxoid A and 2.0 mg/ml toxoid B (CTAB).
[0261] On day 0, White Leghorn hens, obtained from a local breeder,
were immunized as follows: Group CTA. Four hens were immunized,
with each hen receiving 200%g of toxoid A, via two intramuscular
(I.M.) injections of 50 .mu.l of CTA emulsion in the breast area.
Group CTB. One hen was immunized with 200 .mu.g of toxoid B, via
two I.M. injections of 50 .mu.l of CTB emulsion in the breast area.
Group CTAB. Four hens were immunized, with each hen receiving a
mixture containing 200 .mu.g of toxoid A and 200 .mu.g of toxoid B,
via two I.M. injections of 100 .mu.l of CTAB emulsion in the breast
area. The second immunization was performed 5 weeks later, on day
35, exactly as described for the first immunization above.
[0262] In order to determine whether hens previously immunized with
C. difficile toxoids could tolerate subsequent booster
immunizations using native toxins, a single hen from group CTAB was
immunized for a third time, this time using a mixture of the native
toxin A and native toxin B described in section (a) above (these
toxins were not formaldehyde-treated, and were used in their active
form). This was done in order to increase the amount (titer) and
affinity of specific antitoxin antibody produced by the hen over
that achieved by immunizing with toxoids only. On day 62, 0.1 ml of
a toxin mixture was prepared which contained 200 .mu.g of native
toxin A and 200%g of native toxin B. This toxin mixture was then
emulsified in 0.1 ml of Titer Max adjuvant. A single CTAB hen was
then immunized with the resulting immunogen emulsion, via two I.M.
injections of 100 .mu.l each, into the breast area. This hen was
marked with a wing band, and observed for adverse effects for a
period of approximately 1 week, after which time the hen appeared
to be in good health.
[0263] Because the CTAB hen described above tolerated the booster
immunization with native toxins A and B with no adverse effects, it
was decided to boost the remaining hens with native toxin as well.
On day 70, booster immunizations were performed as follows: Group
CTA. A 0.2 ml volume of the 4 mg/ml native toxin A solution was
emulsified in an equal volume of Titer Max adjuvant. Each of the 4
hens was then immunized with 200 .mu.g of native toxin A, as
described for the toxoid A immunizations above. Group CTB. A 50
.mu.l volume of the 4 mg/ml native toxin B solution was emulsified
in an equal volume of Titer Max adjuvant. The hen was then
immunized with 200 .mu.g of native toxin B, as described for the
toxoid B immunizations above. Group CTAB. A 0.15 ml volume of the 4
mg/ml native toxin A solution was first mixed with a 0.15 ml volume
the 4 mg/ml native toxin B solution. The resulting toxin mixture
was then emulsified in 0.3 ml of Titer Max adjuvant. The 3
remaining hens (the hen with the wing band was not immunized this
time) were then immunized with 200%g of native toxin A and 200%g of
native toxin B as described for the toxoid A+ toxoid B
immunizations (CTAB) above. On day 85, all hens received a second
booster immunization using native toxins, done exactly as described
for the first boost with native toxins above.
[0264] All hens tolerated both booster immunizations with native
toxins with no adverse effects. As previous literature references
describe the use of formaldehyde-treated toxoids, this is
apparently the first time that any immunizations have been
performed using native C. difficile toxins.
[0265] c) Purification of Antitoxins
[0266] Eggs were collected from the hen in group CTB 10-12 days
following the second immunization with toxoid (day 35 immunization
described in section (b) above), and from the hens in groups CTA
and CTAB 20-21 days following the second immunization with toxoid.
To be used as a pre-immune (negative) control, eggs were also
collected from unimmunized hens from the same flock. Egg yolk
immunoglobulin (IgY) was extracted from the 4 groups of eggs as
described in Example 1(c), and the final IgY pellets were
solubilized in the original yolk volume of PBS without thimerosal.
Importantly, thimerosal was excluded because it would have been
toxic to the CHO cells used in the toxin neutralization assays
described in section (d) below.
[0267] d) Assay of Toxin Neutralization Activity
[0268] The toxin neutralization activity of the IgY solutions
prepared in section (c) above was determined using an assay system
that was modified from published methods. [Ehrich et al., Infect.
Immun. 28:1041-1043 (1992); and McGee et al. Microb. Path.
12:333-341 (1992).] As additional controls, affinity-purified goat
anti-C. difficile toxin A (Tech Lab) and affinity-purified goat
anti-C. difficile toxin B (Tech Lab) were also assayed for toxin
neutralization activity.
[0269] The IgY solutions and goat antibodies were serially diluted
using F 12 medium (GIBCO) which was supplemented with 2% FCS
(GIBCO)(this solution will be referred to as "medium" for the
remainder of this Example). The resulting antibody solutions were
then mixed with a standardized concentration of either native C.
difficile toxin A (Tech Lab), or native C. difficile toxin B (Tech
Lab), at the concentrations indicated below. Following incubation
at 37.degree. C. for 60 min., 100 .mu.l volumes of the
toxin+antibody mixtures were added to the wells of 96-well
microtiter plates (Falcon Microtest III) which contained
2.5.times.10.sup.4 Chinese Hamster Ovary (CHO) cells per well (the
CHO cells were plated on the previous day to allow them to adhere
to the plate wells). The final concentration of toxin, or dilution
of antibody indicated below refers to the final test concentration
of each reagent present in the respective microtiter plate wells.
Toxin reference wells were prepared which contained CHO cells and
toxin A or toxin B at the same concentration used for the toxin
plus antibody mixtures (these wells contained no antibody).
Separate control wells were also prepared which contained CHO cells
and medium only. The assay plates were then incubated for 18-24
hrs. in a 37.degree. C., humidified, 5% CO.sub.2 incubator. On the
following day, the remaining adherent (viable) cells in the plate
wells were stained using 0.2% crystal violet (Mallinckrodt)
dissolved in 2% ethanol, for 10 min. Excess stain was then removed
by rinsing with water, and the stained cells were solubilized by
adding 1001 .mu.l of 1% SDS (dissolved in water) to each well. The
absorbance of each well was then measured at 570 nm, and the
percent cytotoxicity of each test sample or mixture was calculated
using the following formula: 1 % CHO Cell Cytotoxicity = [ 1 - (
Abs . Sample Abs . Control ) ] .times. 100
[0270] Unlike previous reports which quantitate results visually by
counting cell rounding by microscopy, this Example utilized
spectrophotometric methods to quantitate the C. difficile toxin
bioassay. In order to determine the toxin A neutralizing activity
of the CTA, CTAB, and pre-immune IgY preparations, as well as the
affinity-purified goat antitoxin A control, dilutions of these
antibodies were reacted against a 0.1 .mu.g/ml concentration of
native toxin A (this is the approx. 50% cytotoxic dose of toxin A
in this assay system). The results are shown in FIG. 3.
[0271] Complete neutralization of toxin A occurred with the CTA IgY
(antitoxin A, above) at dilutions of 1:80 and lower, while
significant neutralization occurred out to the 1:320 dilution. The
CTAB IgY (antitoxin A+ toxin B, above) demonstrated complete
neutralization at the 1:320-1:160 and lower dilutions, and
significant neutralization occurred out to the 1:1280 dilution. The
commercially available affinity-purified goat antitoxin A did not
completely neutralize toxin A at any of the dilutions tested, but
demonstrated significant neutralization out to a dilution of
1:1,280. The preimmune IgY did not show any toxin A neutralizing
activity at any of the concentrations tested. These results
demonstrate that IgY purified from eggs laid by hens immunized with
toxin A alone, or simultaneously with toxin A and toxin B, is an
effective toxin A antitoxin.
[0272] The toxin B neutralizing activity of the CTAB and pre-immune
IgY preparations, and also the affinity-purified goat antitoxin B
control was determined by reacting dilutions of these antibodies
against a concentration of native toxin B of 0.1 ng/ml
(approximately the 50% cytotoxic dose of toxin B in the assay
system). The results are shown in FIG. 4.
[0273] Complete neutralization of toxin B occurred with the CTAB
IgY (antitoxin A+toxin B, above) at the 1:40 and lower dilutions,
and significant neutralization occurred out to the 1:320 dilution.
The affinity-purified goat antitoxin B demonstrated complete
neutralization at dilutions of 1:640 and lower, and significant
neutralization occurred out to a dilution of 1:2,560. The preimmune
IgY did not show any toxin B neutralizing activity at any of the
concentrations tested. These results demonstrate that IgY purified
from eggs laid by hens immunized simultaneously with toxin A and
toxin B is an effective toxin B antitoxin.
[0274] In a separate study, the toxin B neutralizing activity of
CTB, CTAB, and pre-immune IgY preparations was determined by
reacting dilutions of these antibodies against a native toxin B
concentration of 0.1 .mu.g/ml (approximately 100% cytotoxic dose of
toxin B in this assay system). The results are shown in FIG. 5.
[0275] Significant neutralization of toxin B occurred with the CTB
IgY (antitoxin B, above) at dilutions of 1:80 and lower, while the
CTAB IgY (antitoxin A+toxin B, above) was found to have significant
neutralizing activity at dilutions of 1:40 and lower. The preimmune
IgY did not show any toxin B neutralizing activity at any of the
concentrations tested. These results demonstrate that IgY purified
from eggs laid by hens immunized with toxin B alone, or
simultaneously with toxin A and toxin B, is an effective toxin B
antitoxin.
EXAMPLE 9
In Vivo Protection of Golden Syrian Hamsters from C. difficile
Disease by Avian Antitoxins Against C. difficile Toxins A and B
[0276] The most extensively used animal model to study C. difficile
disease is the hamster. [Lyerly et al, Infect. Immun. 47:349-352
(1992).] Several other animal models for antibiotic-induced
diarrhea exist, but none mimic the human form of the disease as
closely as the hamster model. [R. Fekety, "Animal Models of
Antibiotic-Induced Colitis," in O. Zak and M. Sande (eds.),
Experimental Models in Antimicrobial Chemotherapy, Vol. 2,
pp.61-72, (1986).] In this model, the animals are first predisposed
to the disease by the oral administration of an antibiotic, such as
clindamycin, which alters the population of normally-occurring
gastrointestinal flora (Fekety, at 61-72). Following the oral
challenge of these animals with viable C. difficile organisms, the
hamsters develop cecitis, and hemorrhage, ulceration, and
inflammation are evident in the intestinal mucosa. [Lyerly et al.,
Infect. Immun. 47:349-352 (1985).] The animals become lethargic,
develop severe diarrhea, and a high percentage of them die from the
disease. [Lyerly et al., Infect. Immun. 47:349-352 (1985).] This
model is therefore ideally suited for the evaluation of therapeutic
agents designed for the treatment or prophylaxis of C. difficile
disease.
[0277] The ability of the avian C. difficile antitoxins, described
in Example 1 above, to protect hamsters from C. difficile disease
was evaluated using the Golden Syrian hamster model of C. difficile
infection. The Example involved (a) preparation of the avian C.
difficile antitoxins, (b) in vivo protection of hamsters from C.
difficile disease by treatment with avian antitoxins, and (c)
long-term survival of treated hamsters.
[0278] a) Preparation of the Avian C. difficile Antitoxins
[0279] Eggs were collected from hens in groups CTA and CTAB
described in Example 1(b) above. To be used as a pre-immune
(negative) control, eggs were also purchased from a local
supermarket. Egg yolk immunoglobulin (IgY) was extracted from the 3
groups of eggs as described in Example 1(c), and the final IgY
pellets were solubilized in one fourth the original yolk volume of
Ensure.RTM. nutritional formula.
[0280] b) In Vivo Protection of Hamsters Against C. difficile
Disease by Treatment with Avian Antitoxins
[0281] The avian C. difficile antitoxins prepared in section (a)
above were evaluated for their ability to protect hamsters from C.
difficile disease using an animal model system which was modified
from published procedures. [Fekety, at 61-72; Borriello et al., J.
Med. Microbiol., 24:53-64 (1987); Kim et al., Infect. Immun.,
55:2984-2992 (1987); Borriello et al., J. Med. Microbiol.,
25:191-196 (1988); Delmee and Avesani, J. Med. Microbiol., 33:85-90
(1990); and Lyerly et al., Infect. Immun. 59:2215-2218 (1991).] For
the study, three separate experimental groups were used, with each
group consisting of 7 female Golden Syrian hamsters (Charles
River), approximately 10 weeks old and weighing approximately 100
gms. each. The three groups were designated "CTA," "CTAB" and
"Pre-immune." These designations corresponded to the antitoxin
preparations with which the animals in each group were treated.
Each animal was housed in an individual cage, and was offered food
and water ad libitum through the entire length of the study. On day
1, each animal was orally administered 1.0 ml of one of the three
antitoxin preparations (prepared in section (a) above) at the
following timepoints: 0 hrs., 4 hrs., and 8 hrs. On day 2, the day
1 treatment was repeated. On day 3, at the 0 hr. timepoint, each
animal was again administered antitoxin, as described above. At 1
hr., each animal was orally administered 3.0 mg of clindamycin-HCl
(Sigma) in 1 ml of water. This treatment predisposed the animals to
infection with C. difficile. As a control for possible endogenous
C. difficile colonization, an additional animal from the same
shipment (untreated) was also administered 3.0 mg of
clindamycin-HCl in the same manner. This clindamycin control animal
was left untreated (and uninfected) for the remainder of the study.
At the 4 hr. and 8 hr. timepoints, the animals were administered
antitoxin as described above. On day 4, at the 0 hr. timepoint,
each animal was again administered antitoxin as described above. At
1 hr., each animal was orally challenged with 1 ml of C. difficile
inoculum, which contained approx. 100 C. difficile strain 43596
organisms in sterile saline. C. difficile strain 43596, which is a
serogroup C strain, was chosen because it is representative of one
of the most frequently-occurring serogroups isolated from patients
with antibiotic-associated pseudomembranous colitis. [Delmee et
al., J. Clin. Microbiol., 28:2210-2214 (1985).] In addition, this
strain has been previously demonstrated to be virulent in the
hamster model of infection. [Delmee and Avesani, J. Med.
Microbiol., 33:85-90 (1990).] At the 4 hr. and 8 hr. timepoints,
the animals were administered antitoxin as described above. On days
5 through 13, the animals were administered antitoxin 3.times. per
day as described for day 1 above, and observed for the onset of
diarrhea and death. On the morning of day 14, the final results of
the study were tabulated. These results are shown in Table 13.
[0282] Representative animals from those that died in the
Pre-Immune and CTA groups were necropsied. Viable C. difficile
organisms were cultured from the ceca of these animals, and the
gross pathology of the gastrointestinal tracts of these animals was
consistent with that expected for C. difficile disease (inflamed,
distended, hemorrhagic cecum, filled with watery diarrhea-like
material). In addition, the clindamycin control animal remained
healthy throughout the entire study period, therefore indicating
that the hamsters used in the study had not previously been
colonized with endogenous C. difficile organisms prior to the start
of the study. Following the final antitoxin treatment on day 13, a
single surviving animal from the CTA group, and also from the CTAB
group, was sacrificed and necropsied. No pathology was noted in
either animal.
13TABLE 13 Treatment Results No. Animals No. Animals Treatment
Group Surviving Dead Pre-Immune 1 6 CTA (Antitoxin A only) 5 2 CTAB
(Antitoxin A + Antitoxin B) 7 0
[0283] Treatment of hamsters with orally-administered toxin A and
toxin B antitoxin (group CTAB) successfully protected 7 out of 7
(100%) of the animals from C. difficile disease. Treatment of
hamsters with orally-administered toxin A antitoxin (group CTA)
protected 5 out of 7 (71%) of these animals from C. difficile
disease. Treatment using pre-immune IgY was not protective against
C. difficile disease, as only 1 out of 7 (14%) of these animals
survived. These results demonstrate that the avian toxin A
antitoxin and the avian toxin A+toxin B antitoxin effectively
protected the hamsters from C. difficile disease. These results
also suggest that although the neutralization of toxin A alone
confers some degree of protection against C. difficile disease, in
order to achieve maximal protection, simultaneous antitoxin A and
antitoxin B activity is necessary.
[0284] c) Long-Term Survival of Treated Hamsters
[0285] It has been previously reported in the literature that
hamsters treated with orally-administered bovine antitoxin IgG
concentrate are protected from C. difficile disease as long as the
treatment is continued, but when the treatment is stopped, the
animals develop diarrhea and subsequently die within 72 hrs.
[Lyerly et al., Infect. Immun., 59(6):2215-2218 (1991).]
[0286] In order to determine whether treatment of C. difficile
disease using avian antitoxins promotes long-term survival
following the discontinuation of treatment, the 4 surviving animals
in group CTA, and the 6 surviving animals in group CTAB were
observed for a period of 11 days (264 hrs.) following the
discontinuation of antitoxin treatment described in section (b)
above. All hamsters remained healthy through the entire
post-treatment period. This result demonstrates that not only does
treatment with avian antitoxin protect against the onset of C.
difficile disease (i.e., it is effective as a prophylactic), it
also promotes long-term survival beyond the treatment period, and
thus provides a lasting cure.
EXAMPLE 10
In Vivo Treatment of Established C. difficile Infection in Golden
Syrian Hamsters with Avian Antitoxins Against C. difficile Toxins A
and B
[0287] The ability of the avian C. difficile antitoxins, described
in Example 8 above, to treat an established C. difficile infection
was evaluated using the Golden Syrian hamster model. The Example
involved (a) preparation of the avian C. difficile antitoxins, (b)
in vivo treatment of hamsters with established C. difficile
infection, and (c) histologic evaluation of cecal tissue.
[0288] a) Preparation Of The Avian C. difficile Antitoxins
[0289] Eggs were collected from hens in group CTAB described in
Example 8(b) above, which were immunized with C. difficile toxoids
and native toxins A and B. Eggs purchased from a local supermarket
were used as a pre-immune (negative) control. Egg yolk
immunoglobulin (IgY) was extracted from the 2 groups of eggs as
described in Example 1(c), and the final IgY pellets were
solubilized in one-fourth the original yolk volume of Ensure.RTM.
nutritional formula.
[0290] b) In Vivo Treatment of Hamsters with Established C.
difficile Infection
[0291] The avian C. difficile antitoxins prepared in section (a)
above were evaluated for the ability to treat established C.
difficile infection in hamsters using an animal model system which
was modified from the procedure which was described for the hamster
protection study in Example 8(b) above.
[0292] For the study, four separate experimental groups were used,
with each group consisting of 7 female Golden Syrian hamsters
(Charles River), approx. 10 weeks old, weighing approximately 100
gms. each. Each animal was housed separately, and was offered food
and water ad libitum through the entire length of the study.
[0293] On day 1 of the study, the animals in all four groups were
each predisposed to C. difficile infection by the oral
administration of 3.0 mg of clindamycin-HCl (Sigma) in 1 ml of
water.
[0294] On day 2, each animal in all four groups was orally
challenged with 1 ml of C. difficile inoculum, which contained
approximately 100 C. difficile strain 43596 organisms in sterile
saline. C. difficile strain 43596 was chosen because it is
representative of one of the most frequently-occurring serogroups
isolated from patients with antibiotic-associated pseudomembranous
colitis. [Delmee et al., J. Clin. Microbiol., 28:2210-2214 (1990).]
In addition, as this was the same C. difficile strain used in all
of the previous Examples above, it was again used in order to
provide experimental continuity.
[0295] On day 3 of the study (24 hrs. post-infection), treatment
was started for two of the four groups of animals. Each animal of
one group was orally administered 1.0 ml of the CTAB IgY
preparation (prepared in section (a) above) at the following
timepoints: 0 hrs., 4 hrs., and 8 hrs. The animals in this group
were designated "CTAB-24." The animals in the second group were
each orally administered 1.0 ml of the pre-immune IgY preparation
(also prepared in section (a) above) at the same timepoints as for
the CTAB group. These animals were designated "Pre-24." Nothing was
done to the remaining two groups of animals on day 3.
[0296] On day 4, 48 hrs. post-infection, the treatment described
for day 3 above was repeated for the CTAB-24 and Pre-24 groups, and
was initiated for the remaining two groups at the same timepoints.
The final two groups of animals were designated "CTAB-48" and
"Pre-48" respectively.
[0297] On days 5 through 9, the animals in all four groups were
administered antitoxin or pre-immune IgY, 3.times. per day, as
described for day 4 above. The four experimental groups are
summarized in Table 14.
14TABLE 14 Experimental Treatment Groups Group Designation
Experimental Treatment CTAB-24 Infected, treatment w/antitoxin IgY
started @ 24 hrs. post-infection. Pre-24 Infected, treatment
w/pre-immune IgY started @ 24 hrs. post-infection. CTAB-48
Infected, treatment w/antitoxin IgY started @ 48 hrs.
post-infection. Pre-48 Infected, treatment w/pre-immune IgY started
@ 48 hrs. post-infection.
[0298] All animals were observed for the onset of diarrhea and
death through the conclusion of the study on the morning of day 10.
The results of this study are displayed in Table 15.
15TABLE 15 Experimental Outcome-Day 10 Treatment Group No. Animals
Surviving No. Animals Dead CTAB-24 6 1 Pre-24 0 7 CTAB-48 4 3
Pre-48 2 5
[0299] Eighty-six percent of the animals which began receiving
treatment with antitoxin IgY at 24 hrs. post-infection (CTAB-24
above) survived, while 57% of the animals treated with antitoxin
IgY starting 48 hrs. post-infection (CTAB-48 above) survived. In
contrast, none of the animals receiving pre-immune IgY starting 24
hrs. post-infection (Pre-24 above) survived, and only 29% of the
animals which began receiving treatment with pre-immune IgY at 48
hrs. post-infection (Pre-48 above) survived through the conclusion
of the study. These results demonstrate that avian antitoxins
raised against C. difficile toxins A and B are capable of
successfully treating established C. difficile infections in
vivo.
[0300] c) Histologic Evaluation of Cecal Tissue
[0301] In order to further evaluate the ability of the IgY
preparations tested in this study to treat established C. difficile
infection, histologic evaluations were performed on cecal tissue
specimens obtained from representative animals from the study
described in section (b) above.
[0302] Immediately following death, cecal tissue specimens were
removed from animals which died in the Pre-24 and Pre-48 groups.
Following the completion of the study, a representative surviving
animal was sacrificed and cecal tissue specimens were removed from
the CTAB-24 and CTAB-48 groups. A single untreated animal from the
same shipment as those used in the study was also sacrificed and a
cecal tissue specimen was removed as a normal control. All tissue
specimens were fixed overnight at 4.degree. C. in 10% buffered
formalin. The fixed tissues were paraffin-embedded, sectioned, and
mounted on glass microscope slides. The tissue sections were then
stained using hematoxylin and eosin (H and E stain), and were
examined by light microscopy.
[0303] Upon examination, the tissues obtained from the CTAB-24 and
CTAB-48 animals showed no pathology, and were indistinguishable
from the normal control. This observation provides further evidence
for the ability of avian antitoxins raised against C. difficile
toxins A and B to effectively treat established C. difficile
infection, and to prevent the pathologic consequences which
normally occur as a result of C. difficile disease.
[0304] In contrast, characteristic substantial mucosal damage and
destruction was observed in the tissues of the animals from the
Pre-24 and Pre-48 groups which died from C. difficile disease.
Normal tissue architecture was obliterated in these two
preparations, as most of the mucosal layer was observed to have
sloughed away, and there were numerous large hemorrhagic areas
containing massive numbers of erythrocytes.
EXAMPLE 11
Cloning and Expression of C. difficile Toxin A Fragments
[0305] The toxin A gene has been cloned and sequenced, and shown to
encode a protein of predicted MW of 308 kd. [Dove et al., Infect.
Immun., 58:480-488 (1990).] Given the expense and difficulty of
isolating native toxin A protein, it would be advantageous to use
simple and inexpensive procaryotic expression systems to produce
and purify high levels of recombinant toxin A protein for
immunization purposes. Ideally, the isolated recombinant protein
would be soluble in order to preserve native antigenicity, since
solubilized inclusion body proteins often do not fold into native
conformations. To allow ease of purification, the recombinant
protein should be expressed to levels greater than 1 mg/liter of E.
coli culture.
[0306] To determine whether high levels of recombinant toxin A
protein can be produced in E coli, fragments of the toxin A gene
were cloned into various prokaryotic expression vectors, and
assessed for the ability to express recombinant toxin A protein in
E. coli. Three prokaryotic expression systems were utilized. These
systems were chosen because they drive expression of either fusion
(pMALc and pGEX2T) or native (pET23a-c) protein to high levels in
E. coli, and allow affinity purification of the expressed protein
on a ligand containing column. Fusion proteins expressed from pGEX
vectors bind glutathione agarose beads, and are eluted with reduced
glutathione. pMAL fusion proteins bind amylose resin, and are
eluted with maltose. A poly-histidine tag is present at either the
N-terminal (pET16b) or C-terminal (pET23a-c) end of pET fusion
proteins. This sequence specifically binds Ni.sub.2.sup.+ chelate
columns, and is eluted with imidazole salts. Extensive descriptions
of these vectors are available [Williams et al. (1995) DNA Cloning
2: Expression Systems, Glover and Hames, eds. IRL Press, Oxford,
pp. 15-58], and will not be discussed in detail here. The Example
involved (a) cloning of the toxin A gene, (b) expression of large
fragments of toxin A in various prokaryotic expression systems, (c)
identification of smaller toxin A gene fragments that express
efficiently in E. coli, (d) purification of recombinant toxin A
protein by affinity chromatography, and (e) demonstration of
functional activity of a recombinant fragment of the toxin A gene.
a) Cloning of the Toxin A Gene
[0307] A restriction map of the toxin A gene is shown in FIG. 6.
The encoded protein contains a carboxy terminal ligand binding
region, containing multiple repeats of a carbohydrate binding
domain. [von Eichel-Streiber and Sauerbom, Gene 96:107-113 (1990).]
The toxin A gene was cloned in three pieces, by using either the
polymerase chain reaction (PCR) to amplify specific regions,
(regions 1 and 2, FIG. 6) or by screening a constructed genomic
library for a specific toxin A gene fragment (region 3, FIG. 6).
The sequences of the utilized PCR primers are P1: 5' GGAAAT.TM.
TAGCTGCAGCATCTGAC 3' (SEQ ID NO.: 1); P2: 5' TCTAGCAAATTCGCTTGT
GTTGAA 3' (SEQ ID NO.:2); P3: 5' CTCGCATATAGCATTAGACC 3' (SEQ ID
NO.:3); and P4: 5' CTATCTAGGCCTAAAGTAT 3' (SEQ ID NO.:4). These
regions were cloned into prokaryotic expression vectors that
express either fusion (pMALc and pGEX2T) or native (pET23a-c)
protein to high levels in E. coli, and allow affinity purification
of the expressed protein on a ligand containing column.
[0308] Clostridium difficile VPI strain 10463 was obtained from the
ATCC (ATCC #43255) and grown under anaerobic conditions in
brain-heart infusion medium (BBL). High molecular-weight C.
difficile DNA was isolated essentially as described by Wren and
Tabaqchali (1987) J. Clin. Microbiol., 25:2402, except proteinase K
and sodium dodecyl sulfate (SDS) was used to disrupt the bacteria,
and cetyltrimethylammonium bromide precipitation [as described in
Ausubel et al., Current Protocols in Molecular Biology (1989)] was
used to remove carbohydrates from the cleared lysate. The integrity
and yield of genomic DNA was assessed by comparison with a serial
dilution of uncut lambda DNA after electrophoresis on an agarose
gel.
[0309] Fragments 1 and 2 were cloned by PCR, utilizing a
proofreading thermostable DNA polymerase (native pfu polymerase;
Stratagene). The high fidelity of this polymerase reduces the
mutation problems associated with amplification by error prone
polymerases (e.g., Taq polymerase). PCR amplification was performed
using the indicated PCR primers (FIG. 6) in 50 .mu.l reactions
containing 10 mM Tris-HCl(8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, 200
.mu.M each dNTP, 0.2 .mu.M each primer, and 50 ng C. difficile
genomic DNA. Reactions were overlaid with 100 .mu.l mineral oil,
heated to 94.degree. C. for 4 min, 0.5 .mu.l native pfu polymerase
(Stratagene) added, and the reaction cycled 30.times. at 94.degree.
C. for 1 min, 50.degree. C. for 1 min, 72.degree. C. for 4 min,
followed by 10 min at 72.degree. C. Duplicate reactions were
pooled, chloroform extracted, and ethanol precipitated. After
washing in 70% ethanol, the pellets were resuspended in 50 .mu.l TE
buffer [10 mM Tris-HCL, 1 mM EDTA pH 8.0]. Aliquots of 101 .mu.l
each were restriction digested with either EcoRI/HincII (fragment
1) or EcoRI/PstI (fragment 2), and the appropriate restriction
fragments were gel purified using the Prep-A-Gene kit (BioRad), and
ligated to either EcoRI/SmaI-restricted pGEX2T (Pharmacia) vector
(fragment 1), or the EcoRI/PstI pMAlc (New England Biolabs) vector
(fragment 2). Both clones are predicted to produce in-frame fusions
with either the glutathione-S-transferase protein (pGEX vector) or
the maltose binding protein (pMAL vector). Recombinant clones were
isolated, and confirmed by restriction digestion, using standard
recombinant molecular biology techniques. [Sambrook et al.,
Molecular Cloning, A Laboratory Manual (1989), and designated
pGA30-660 and pMA660-1100, respectively (see FIG. 6 for description
of the clone designations).]
[0310] Fragment 3 was cloned from a genomic library of size
selected PstI digested C. difficile genomic DNA, using standard
molecular biology techniques (Sambrook et al.). Given that the
fragment 3 internal PstI site is protected from cleavage in C.
difficile genomic DNA [Price et al, Curr. Microbiol., 16:55-60
(1987)], a 4.7 kb fragment from PstI restricted C. difficile
genomic DNA was gel purified, and ligated to PstI restricted,
phosphatase treated pUC9 DNA. The resulting genomic library was
screened with a oligonucleotide primer specific to fragment 3, and
multiple independent clones were isolated. The presence of fragment
3 in several of these clones was confirmed by restriction
digestion, and a clone of the indicated orientation (FIG. 6) was
restricted with BamHI/HindIII, the released fragment purified by
gel electrophoresis, and ligated into similarly restricted pET23c
expression vector DNA (Novagen). Recombinant clones were isolated,
and confirmed by restriction digestion. This construct is predicted
to create both a predicted in frame fusion with the pET protein
leader sequence, as well as a predicted C-terminal poly-histidine
affinity tag, and is designated pPA1100-2680 (see FIG. 6 for the
clone designation).
[0311] b) Expression of Large Fragments of Toxin A in E. coli
[0312] Protein expression from the three expression constructs made
in (a) was induced, and analyzed by Western blot analysis with an
affinity purified, goat polyclonal antiserum directed against the
toxin A toxoid (Tech Lab). The procedures utilized for protein
induction, SDS-PAGE, and Western blot analysis are described in
detail in Williams et al (1995), supra. In brief, 5 ml 2.times. YT
(16 g tryptone, 10 g yeast extract, 5 g NaCl per liter, pH 7.5+100
.mu.g/ml ampicillin were added to cultures of bacteria (BL21 for
pMA1 and pGEX plasmids, and BL21(DE3)LysS for pET plasmids)
containing the appropriate recombinant clone which were induced to
express recombinant protein by addition of IPTG to 1 mM. Cultures
were grown at 37.degree. C., and induced when the cell density
reached 0.5 OD.sub.600. Induced protein was allowed to accumulate
for two hrs after induction. Protein samples were prepared by
pelleting 1 ml aliquots of bacteria by centrifugation (1 min in a
microfuge), and resuspension of the pelleted bacteria in 150 .mu.l
of 2.times. SDS-PAGE sample buffer [Williams et al. (1995), supra].
The samples were heated to 95.degree. C. for 5 min, the cooled and
5 or 10 .mu.l aliquots loaded on 7.5% SDS-PAGE gels. BioRad high
molecular weight protein markers were also loaded, to allow
estimation of the MW of identified fusion proteins. After
electrophoresis, protein was detected either generally by staining
gels with Coomassie blue, or specifically, by blotting to
nitrocellulose for Western blot detection of specific
immunoreactive protein. Western blots, (performed as described in
Example 3) which detect toxin A reactive protein in cell lysates of
induced protein from the three expression constructs are shown in
FIG. 7. In this figure, lanes 1-3 contain cell lysates prepared
from E. coli strains containing pPA1100-2860 in Bl21(DE3)lysE
cells; lanes 4-6 contain cell lysates prepared from E. coli strains
containing pPA1200-2860 in Bl21(DE3)lysS cells; lanes 7-9 contain
cell lysates prepared from E. coli strains containing pMA30-660;
lanes 10-12 contain cell lysates prepared from E. coli strains
containing pMA660-1100. The lanes were probed with an affinity
purified goat antitoxin A polyclonal antibody (Tech Lab). Control
lysates from uninduced cells (lanes 1, 7, and 10) contain very
little immunoreactive material compared to the induced samples in
the remaining lanes. The highest molecular weight band observed for
each clone is consistent with the predicted size of the full length
fusion protein.
[0313] Each construct directs expression of high molecular weight
(HMW) protein that is reactive with the toxin A antibody. The size
of the largest immunoreactive bands from each sample is consistent
with predictions of the estimated MW of the intact fusion proteins.
This demonstrates that the three fusions are in-frame, and that
none of the clones contain cloning artifacts that disrupt the
integrity of the encoded fusion protein. However, the Western blot
demonstrates that fusion protein from the two larger constructs
(pGA30-660 and pPA1100-2680) are highly degraded. Also, expression
levels of toxin A proteins from these two constructs are low, since
induced protein bands are not visible by Coomassie staining (not
shown). Several other expression constructs that fuse large
sub-regions of the toxin A gene to either pMALc or pET23a-c
expression vectors, were constructed and tested for protein
induction. These constructs were made by mixing gel purified
restriction fragments, derived from the expression constructs shown
in FIG. 6, with appropriately cleaved expression vectors, ligating,
and selecting recombinant clones in which the toxin A restriction
fragments had ligated together and into the expression vector as
predicted for in-frame fusions. The expressed toxin A interval
within these constructs are shown in FIG. 8, as well as the
internal restriction sites utilized to make these constructs.
[0314] As used herein, the term "interval" refers to any portion
(i.e., any segment of the toxin which is less than the whole toxin
molecule) of a clostridial toxin. In a preferred embodiment,
"interval" refers to portions of C. difficile toxins such as toxin
A or toxin B. It is also contemplated that these intervals will
correspond to epitopes of immunologic importance, such as antigens
or immunogens against which a neutralizing antibody response is
effected. It is not intended that the present invention be limited
to the particular intervals or sequences described in these
Examples. It is also contemplated that sub-portions of intervals
(e.g., an epitope contained within one interval or which bridges
multiple intervals) be used as compositions and in the methods of
the present invention.
[0315] In all cases, Western blot analysis of each of these
constructs with goat antitoxin A antibody (Tech Lab) detected HMW
fusion protein of the predicted size (not shown). This confirms
that the reading frame of each of these clones is not prematurely
terminated, and is fused in the correct frame with the fusion
partner. However, the Western blot analysis revealed that in all
cases, the induced protein is highly degraded, and, as assessed by
the absence of identifiable induced protein bands by Coomassie Blue
staining, are expressed only at low levels. These results suggest
that expression of high levels of intact toxin A recombinant
protein is not possible when large regions of the toxin A gene are
expressed in E. coli using these expression vectors.
[0316] c) High Level Expression of Small Toxin A Protein Fusions in
E. coli
[0317] Experience indicates that expression difficulties are often
encountered when large (greater than 100 kd) fragments are
expressed in E. coli. A number of expression constructs containing
smaller fragments of the toxin A gene were constructed, to
determine if small regions of the gene can be expressed to high
levels without extensive protein degradation. A summary of these
expression constructs are shown in FIG. 9. All were constructed by
in-frame fusions of convenient toxin A restriction fragments to
either the pMALc or pET23a-c vectors. Protein preparations from
induced cultures of each of these constructs were analyzed by both
Coomassie Blue staining and Western analysis as in (b) above. In
all cases, higher levels of intact, full length fusion proteins
were observed than with the larger recombinants from section
(b).
[0318] d) Purification of Recombinant Toxin A Protein
[0319] Large scale (500 ml) cultures of each recombinant from (c)
were grown, induced, and soluble and insoluble protein fractions
were isolated. The soluble protein extracts were affinity
chromatographed to isolate recombinant fusion protein, as described
[Williams et al. (1994), supra]. In brief, extracts containing
tagged pET fusions were chromatographed on a nickel chelate column,
and eluted using imidazole salts as described by the distributor
(Novagen). Extracts containing soluble pMAL fusion protein were
prepared and chromatographed in column buffer (10 mM NaPO.sub.4,
0.5M NaCl, 10 mM .beta.-mercaptoethanol, pH 7.2) over an amylose
resin column (New England Biolabs), and eluted with column buffer
containing 10 mM maltose as described [Williams et al. (1995),
supra]. When the expressed protein was found to be predominantly
insoluble, insoluble protein extracts were prepared by the method
described in Example 17, infra. The results are summarized in Table
16. FIG. 10 shows the sample purifications of recombinant toxin A
protein. In this figure, lanes 1 and 2 contain MBP fusion protein
purified by affinity purification of soluble protein.
16TABLE 16 Purification Of Recombinant Toxin A Protein Yield
Affinity Yield Intact Protein Purified Soluble % Intact Soluble
Insoluble Fusion Clone.sup.(a) Solubility Protein.sup.(b) Fusion
Protein.sup.(c) Protein pMA30-270 Soluble 4 mg/500 mls 10% NA
PMA30-300 Soluble 4 mg/500 mls 5-10% NA pMA300-660 Insoluble -- NA
10 mg/500 ml pMA660-1100 Soluble 4.5 mg/500 mls 50% NA pMA1100-1610
Soluble 18 mg/500 mls 10% NA pMA1610-1870 Both 22 mg/500 mls 90% 20
mg/500 ml pMA1450-1870 Insoluble -- NA 0.2 mg/500 ml pPA1100-1450
Soluble 0.1 mg/500 mls 90% NA pPA1100-1870 Soluble 0.02 mg/500 mls
90% NA pMA1870-2680 Both 12 mg/500 mls 80% NA pPa1870-2680
Insoluble -- NA 10 mg/500 ml .sup.(a)pP = pET23 vector, pM = pMALc
vector, A = toxin A. .sup.(b)Based on 1.5 OD.sub.280 = 1 mg/ml
(extinction coefficient of MBP). .sup.(c)Estimated by Coomassie
staining of SDS-PAGE gels.
[0320] Lanes 3 and 4 contain MBP fusion protein purified by
solubilization of insoluble inclusion bodies. The purified fusion
protein samples are pMA1870-2680 (lane 1), pMA660-1100 (lane 2),
pMA300-600 (lane 3) and pMA1450-1870 (lane 4).
[0321] Poor yields of affinity purified protein were obtained when
poly-histidine tagged pET vectors were used to drive expression
(pPA1100-1450, pP1100-1870). However, significant protein yields
were obtained from pMAL expression constructs spanning the entire
toxin A gene, and yields of full-length soluble fusion protein
ranged from an estimated 200-400 .mu.g/500 ml culture (pMA30-300)
to greater than 20 mg/500 ml culture (pMA1610-1870). Only one
interval was expressed to high levels as strictly insoluble protein
(pMA300-660). Thus, although high level expression was not observed
when using large expression constructs from the toxin A gene,
usable levels of recombinant protein spanning the entire toxin A
gene were obtainable by isolating induced protein from a series of
smaller pMAL expression constructs that span the entire toxin A
gene. This is the first demonstration of the feasibility of
expressing recombinant toxin A protein to high levels in E.
coli.
[0322] e) Hemagglutination Assay Using the Toxin A Recombinant
Proteins
[0323] The carboxy terminal end consisting of the repeating units
contains the hemagglutination activity or binding domain of C.
difficile toxin A. To determine whether the expressed toxin A
recombinants retain functional activity, hemagglutination assays
were performed. Two toxin A recombinant proteins, one containing
the binding domain as either soluble affinity purified protein
(pMA1870-2680) or SDS solubilized inclusion body protein
(pPA1870-2680) and soluble protein from one region outside that
domain (pMA1100-1610) were tested using a described procedure. [H.
C. Krivan et. al., Infect. Immun., 53:573 (1986).] Citrated rabbit
red blood cells (RRBC)(Cocalico) were washed several times with
Tris-buffer (0.1M Tris and 50 mM NaCl) by centrifugation at
450.times.g for 10 minutes at 4.degree. C. A 1% RRBC suspension was
made from the packed cells and resuspended in Tris-buffer.
Dilutions of the recombinant proteins and native toxin A (Tech
Labs) were made in the Tris-buffer and added in duplicate to a
round-bottomed 96-well microtiter plate in a final volume of 100
.mu.l. To each well, 50 .mu.l of the 1% RRBC suspension was added,
mixed by gentle tapping, and incubated at 4.degree. C. for 3-4
hours. Significant hemagglutination occurred only in the
recombinant proteins containing the binding domain (pMA1870-2680)
and native toxin A. The recombinant protein outside the binding
domain (pMA1100-1610) displayed no hemagglutination activity. Using
equivalent protein concentrations, the hemagglutination titer for
toxin A was 1:256, while titers for the soluble and insoluble
recombinant proteins of the binding domain were 1:256 and about
1:5000. Clearly, the recombinant proteins tested retained
functional activity and were able to bind RRBC's.
EXAMPLE 12
Functional Activity of IgY Reactive Against Toxin A
Recombinants
[0324] The expression of recombinant toxin A protein as multiple
fragments in E. coli has demonstrated the feasibility of generating
toxin A antigen through use of recombinant methodologies (Example
11). The isolation of these recombinant proteins allows the
immunoreactivity of each individual subregion of the toxin A
protein to be determined (i.e., in a antibody pool directed against
the native toxin A protein). This identifies the regions (if any)
for which little or no antibody response is elicited when the whole
protein is used as a immunogen. Antibodies directed against
specific fragments of the toxin A protein can be purified by
affinity chromatography against recombinant toxin A protein, and
tested for neutralization ability. This identifies any toxin A
subregions that are essential for producing neutralizing
antibodies. Comparison with the levels of immune response directed
against these intervals when native toxin is used as an immunogen
predicts whether potentially higher titers of neutralizing
antibodies can be produced by using recombinant protein directed
against a individual region, rather than the entire protein.
Finally, since it is unknown whether antibodies reactive to the
recombinant toxin A proteins produced in Example 11 neutralize
toxin A as effectively as antibodies raised against native toxin A
(Examples 9 and 10), the protective ability of a pool of antibodies
affinity purified against recombinant toxin A fragments was
assessed for its ability to neutralize toxin A.
[0325] This Example involved (a) epitope mapping of the toxin A
protein to determine the titre of specific antibodies directed
against individual subregions of the toxin A protein when native
toxin A protein is used as an immunogen, (b) affinity purification
of IgY reactive against recombinant proteins spanning the toxin A
gene, (c) toxin A neutralization assays with affinity purified IgY
reactive to recombinant toxin A protein to identify subregions of
the toxin A protein that induce the production of neutralizing
antibodies, and determination of whether complete neutralization of
toxin A can be elicited with a mixture of antibodies reactive to
recombinant toxin A protein.
[0326] a) Epitope Mapping of the Toxin A Gene
[0327] The affinity purification of recombinant toxin A protein
specific to defined intervals of the toxin A protein allows epitope
mapping of antibody pools directed against native toxin A. This has
not previously been possible, since previous expression of toxin A
recombinants has been assessed only by Western blot analysis,
without knowledge of the expression levels of the protein [e.g.,
von Eichel-Streiber et al, J. Gen. Microbiol., 135:55-64 (1989)].
Thus, high or low reactivity of recombinant toxin A protein on
Western blots may reflect protein expression level differences, not
immunoreactivity differences. Given that the purified recombinant
protein generated in Example 11 have been quantitated, the issue of
relative immunoreactivity of individual regions of the toxin A
protein was precisely addressed.
[0328] For the purposes of this Example, the toxin A protein was
subdivided into 6 intervals (1-6), numbered from the amino
(interval 1) to the carboxyl (interval 6) termini.
[0329] The recombinant proteins corresponding to these intervals
were from expression clones (see Example 11(d) for clone
designations) pMA30-300 (interval 1), pMA300-660 (interval 2),
pMA660-1100 (interval 3), pPA1100-1450 (interval 4), pMA1450-1870
(interval 5) and pMA1870-2680 (interval 6). These 6 clones were
selected because they span the entire protein from amino acids
numbered 30 through 2680, and subdivide the protein into 6 small
intervals. Also, the carbohydrate binding repeat interval is
contained specifically in one interval (interval 6), allowing
evaluation of the immune response specifically directed against
this region. Western blots of 7.5% SDS-PAGE gels, loaded and
electrophoresed with defined quantities of each recombinant
protein, were probed with either goat antitoxin A polyclonal
antibody (Tech Lab) or chicken antitoxin A polyclonal antibody
[pCTA IgY, Example 8(c)]. The blots were prepared and developed
with alkaline phosphatase as previously described [Williams et al.
(1995), supra]. At least 90% of all reactivity, in either goat or
chicken antibody pools, was found to be directed against the ligand
binding domain (interval 6). The remaining immunoreactivity was
directed against all five remaining intervals, and was similar in
both antibody pools, except that the chicken antibody showed a much
lower reactivity against interval 2 than the goat antibody.
[0330] This clearly demonstrates that when native toxin A is used
as an immunogen in goats or chickens, the bulk of the immune
response is directed against the ligand binding domain of the
protein, with the remaining response distributed throughout the
remaining 2/3 of the protein.
[0331] b) Affinity Purification of IgY Reactive Against Recombinant
Toxin A Protein
[0332] Affinity columns, containing recombinant toxin A protein
from the 6 defined intervals in (a) above, were made and used to
(i) affinity purify antibodies reactive to each individual interval
from the CTA IgY preparation [Example 8(c)], and (ii) deplete
interval specific antibodies from the CTA IgY preparation. Affinity
columns were made by coupling 1 ml of PBS-washed Actigel resin
(Sterogene) with region specific protein and {fraction (1/10)}
final volume of Ald-coupling solution (1M sodium cyanoborohydride).
The total region specific protein added to each reaction mixture
was 2.7 mg (interval 1), 3 mg (intervals 2 and 3), 0.1 mg (interval
4), 0.2 mg (interval 5) and 4 mg (interval 6). Protein for
intervals 1, 3, and 6 was affinity purified pMA1 fusion protein in
column buffer (see Example 11). Interval 4 was affinity purified
poly-histidine containing pET fusion in PBS; intervals 2 and 5 were
from inclusion body preparations of insoluble pMAL fusion protein,
dialyzed extensively in PBS. Aliquots of the supernatants from the
coupling reactions, before and after coupling, were assessed by
Coomassie staining of 7.5% SDS-PAGE gels. Based on protein band
intensities, in all cases greater than 50% coupling efficiencies
were estimated. The resins were poured into 5 ml BioRad columns,
washed extensively with PBS, and stored at 4.degree. C.
[0333] Aliquots of the CTA IgY polyclonal antibody preparation were
depleted for each individual region as described below. A 20 ml
sample of the CTA IgY preparation [Example 8(c)] was dialyzed
extensively against 3 changes of PBS (1 liter for each dialysis),
quantitated by absorbance at OD.sub.280, and stored at 4.degree. C.
Six 1 ml aliquots of the dialyzed IgY preparation were removed, and
depleted individually for each of the six intervals. Each 1 ml
aliquot was passed over the appropriate affinity column, and the
eluate twice reapplied to the column. The eluate was collected, and
pooled with a 1 ml PBS wash. Bound antibody was eluted from the
column by washing with 5 column volumes of 4 M Guanidine-HCl (in 10
mM Tris-HCl, pH 8.0). The column was reequilibrated in PBS, and the
depleted antibody stock reapplied as described above. The eluate
was collected, pooled with a 1 ml PBS wash, quantitated by
absorbance at OD.sub.280, and stored at 4.degree. C. In this
mariner, 6 aliquots of the CTA IgY preparation were individually
depleted for each of the 6 toxin A intervals, by two rounds of
affinity depletion. The specificity of each depleted stock was
tested by Western blot analysis. Multiple 7.5% SDS-PAGE gels were
loaded with protein samples corresponding to all 6 toxin A
subregions. After electrophoresis, the gels were blotted, and
protein transfer confirmed by Ponceau S staining [protocols
described in Williams et al. (1995), supra]. After blocking the
blots 1 hr at 20.degree. C. in PBS+0.1% Tween 20 (PBST) containing
5% milk (as a blocking buffer), 4 ml of either a {fraction (1/500)}
dilution of the dialyzed CTA IgY preparation in blocking buffer, or
an equivalent amount of the six depleted antibody stocks (using
OD.sub.280 to standardize antibody concentration) were added and
the blots incubated a further 1 hr at room temperature. The blots
were washed and developed with alkaline phosphatase (using a rabbit
anti-chicken alkaline phosphate conjugate as a secondary antibody)
as previously described [Williams et al. (1995), supra]. In all
cases, only the target interval was depleted for antibody
reactivity, and at least 90% of the reactivity to the target
intervals was specifically depleted.
[0334] Region specific antibody pools were isolated by affinity
chromatography as described below. Ten mls of the dialyzed CTA IgY
preparation were applied sequentially to each affinity column, such
that a single 10 ml aliquot was used to isolate region specific
antibodies specific to each of the six subregions. The columns were
sequentially washed with 10 volumes of PBS, 6 volumes of BBS-Tween,
10 volumes of TBS, and eluted with 4 ml Actisep elution media
(Sterogene). The eluate was dialyzed extensively against several
changes of PBS, and the affinity purified antibody collected and
stored at 4.degree. C. The volumes of the eluate increased to
greater than 10 mls during dialysis in each case, due to the high
viscosity of the Actisep elution media. Aliquots of each sample
were 20.times. concentrated using Centricon 30 microconcentrators
(Amicon) and stored at 4.degree. C. The specificity of each region
specific antibody pool was tested, relative to the dialyzed CTA IgY
preparation, by Western blot analysis, exactly as described above,
except that 4 ml samples of blocking buffer containing 100 .mu.l
region specific antibody (unconcentrated) were used instead of the
depleted CTA IgY preparations. Each affinity purified antibody
preparation was specific to the defined interval, except that
samples purified against intervals 1-5 also reacted with interval
6. This may be due to non-specific binding to the interval 6
protein, since this protein contains the repetitive ligand binding
domain which has been shown to bind antibodies nonspecifically.
[Lyerly et al., Curr. Microbiol., 19:303-306 (1989).]
[0335] The reactivity of each affinity purified antibody
preparation to the corresponding proteins was approximately the
same as the reactivity of the {fraction (1/500)} diluted dialyzed
CTA IgY preparation standard. Given that the specific antibody
stocks were diluted {fraction (1/40)}, this would indicate that the
unconcentrated affinity purified antibody stocks contain {fraction
(1/10)}-{fraction (1/20)} the concentration of specific antibodies
relative to the starting CTA IgY preparation.
[0336] c) Toxin A Neutralization Assay Using Antibodies Reactive
Toward Recombinant Toxin A Protein
[0337] The CHO toxin neutralization assay [Example 8(d)] was used
to assess the ability of the depleted or enriched samples generated
in (b) above to neutralize the cytotoxicity of toxin A. The general
ability of affinity purified antibodies to neutralize toxin A was
assessed by mixing together aliquots of all 6 concentrated stocks
of the 6 affinity purified samples generated in (b) above, and
testing the ability of this mixture to neutralize a toxin A
concentration of 0.1 .mu.g/ml. The results, shown in FIG. 11,
demonstrate almost complete neutralization of toxin A using the
affinity purified (AP) mix. Some epitopes within the recombinant
proteins utilized for affinity purification were probably lost when
the proteins were denatured before affinity purification [by
Guanidine-HCl treatment in (b) above]. Thus, the neutralization
ability of antibodies directed against recombinant protein is
probably underestimated using these affinity purified antibody
pools. This experiment demonstrates that antibodies reactive to
recombinant toxin A can neutralize cytotoxicity, suggesting that
neutralizing antibodies may be generated by using recombinant toxin
A protein as immunogen.
[0338] In view of the observation that the recombinant expression
clones of the toxin A gene divide the protein into 6 subregions,
the neutralizing ability of antibodies directed against each
individual region was assessed. The neutralizing ability of
antibodies directed against the ligand binding domain of toxin A
was determined first.
[0339] In the toxin neutralization experiment shown in FIG. 11,
interval 6 specific antibodies (interval 6 contains the ligand
binding domain) were depleted from the dialyzed PEG preparation,
and the effect on toxin neutralization assayed. Interval 6
antibodies were depleted either by utilizing the interval 6
depleted CTA IgY preparation from (b) above ("-6 aff. depleted" in
FIG. 11), or by addition of interval 6 protein to the CTA IgY
preparation (estimated to be a 10 fold molar excess over
anti-interval 6 immunoglobulin present in this preparation) to
competitively compete for interval 6 protein ("-6 prot depleted" in
FIG. 11). In both instances, removal of interval 6 specific
antibodies reduces the neutralization efficiency relative to the
starting CTA IgY preparation. This demonstrates that antibodies
directed against interval 6 contribute to toxin neutralization.
Since interval 6 corresponds to the ligand binding domain of the
protein, these results demonstrate that antibodies directed against
this region in the PEG preparation contribute to the neutralization
of toxin A in this assay. However, it is significant that after
removal of these antibodies, the PEG preparation retains
significant ability to neutralize toxin A (FIG. 11). This
neutralization is probably due to the action of antibodies specific
to other regions of the toxin A protein, since at least 90% of the
ligand binding region reactive antibodies were removed in the
depleted sample prepared in (b) above. This conclusion was
supported by comparison of the toxin neutralization of the affinity
purified (AP) mix compared to affinity purified interval 6 antibody
alone. Although some neutralization ability was observed with AP
interval 6 antibodies alone, the neutralization was significantly
less than that observed with the mixture of all 6 AP antibody
stocks (not shown).
[0340] Given that the mix of all six affinity purified samples
almost completely neutralized the cytotoxicity of toxin A (FIG.
11), the relative importance of antibodies directed against toxin A
intervals 1-5 within the mixture was determined. This was assessed
in two ways. First, samples containing affinity purified antibodies
representing 5 of the 6 intervals were prepared, such that each
individual region was depleted from one sample. FIG. 12
demonstrates a sample neutralization curve, comparing the
neutralization ability of affinity purified antibody mixes without
interval 4 (-4) or 5 (-5) specific antibodies, relative to the mix
of all 6 affinity purified antibody stocks (positive control).
While the removal of interval 5 specific antibodies had no effect
on toxin neutralization (or intervals 1-3, not shown), the loss of
interval 4 specific antibodies significantly reduced toxin
neutralization (FIG. 12).
[0341] Similar results were seen in a second experiment, in which
affinity purified antibodies, directed against a single region,
were added to interval 6 specific antibodies, and the effects on
toxin neutralization assessed. Only interval 4 specific antibodies
significantly enhanced neutralization when added to interval 6
specific antibodies (FIG. 13). These results demonstrate that
antibodies directed against interval 4 (corresponding to clone
pPA1100-1450 in FIG. 9) are important for neutralization of
cytotoxicity in this assay. Epitope mapping has shown that only low
levels of antibodies reactive to this region are generated when
native toxin A is used as an immunogen [Example 12(a)]. It is
hypothesized that immunization with recombinant protein specific to
this interval will elicit higher titers of neutralizing antibodies.
In summary, this analysis has identified two critical regions of
the toxin A protein against which neutralizing antibodies are
produced, as assayed by the CHO neutralization assay.
EXAMPLE 13
Production and Evaluation of Avian Antitoxin Against C. difficile
Recombinant Toxin A Polypeptide
[0342] In Example 12, we demonstrated neutralization of toxin A
mediated cytotoxicity by affinity purified antibodies reactive to
recombinant toxin A protein. To determine whether antibodies raised
against a recombinant polypeptide fragment of C. difficile toxin A
may be effective in treating clostridial diseases, antibodies to
recombinant toxin A protein representing the binding domain were
generated. Two toxin A binding domain recombinant polypeptides,
expressing the binding domain in either the pMALc (pMA1870-2680) or
pET 23(pPA1870-2680) vector, were used as immunogens. The pMAL
protein was affinity purified as a soluble product [Example 12(d)]
and the pET protein was isolated as insoluble inclusion bodies
[Example 12(d)] and solubilized to an immunologically active
protein using a proprietary method described in a pending patent
application (U.S. patent application Ser. No. 08/129,027). This
Example involves (a) immunization, (b) antitoxin collection, (c)
determination of antitoxin antibody titer, (d) anti-recombinant
toxin A neutralization of toxin A hemagglutination activity in
vitro, and (e) assay of in vitro toxin A neutralizing activity.
[0343] a) Immunization
[0344] The soluble and the inclusion body preparations each were
used separately to immunize hens. Both purified toxin A
polypeptides were diluted in PBS and emulsified with approximately
equal volumes of CFA for the initial immunization or IFA for
subsequent booster immunizations. On day zero, for each of the
recombinant preparations, two egg laying white Leghorn hens
(obtained from local breeder) were each injected at multiple sites
(intramuscular and subcutaneous) with 1 ml of recombinant adjuvant
mixture containing approximately 0.5 to 1.5 mgs of recombinant
toxin A. Booster immunizations of 1.0 mg were given on days 14 and
day 28.
[0345] b) Antitoxin Collection
[0346] Total yolk immune IgY was extracted as described in the
standard PEG protocol (as in Example 1) and the final IgY pellet
was dissolved in sterile PBS at the original yolk volume. This
material is designated "immune recombinant IgY" or "immune
IgY."
[0347] c) Antitoxin Antibody Titer
[0348] To determine if the recombinant toxin A protein was
sufficiently immunogenic to raise antibodies in hens, the antibody
titer of a recombinant toxin A polypeptide was determined by ELISA.
Eggs from both hens were collected on day 32, the yolks pooled and
the antibody was isolated using PEG as described. The immune
recombinant IgY antibody titer was determined for the soluble
recombinant protein containing the maltose binding protein fusion
generated in p-Mal (pMA1870-2680). Ninety-six well Falcon Pro-bind
plates were coated overnight at 4.degree. C. with 100 .mu.L/well of
toxin A recombinant at 2.5 .mu.g/.mu.l in PBS containing 0.05%
thimerosal. Another plate was also coated with maltose binding
protein (MBP) at the same concentration, to permit comparison of
antibody reactivity to the fusion partner. The next day, the wells
were blocked with PBS containing 1% bovine serum albumin (BSA) for
1 hour at 37.degree. C. IgY isolated from immune or preimmune eggs
was diluted in antibody diluent (PBS containing 1% BSA and 0.05%
Tween-20), and added to the blocked wells and incubated for 1 hour
at 37.degree. C. The plates were washed three times with PBS with
0.05% Tween-20, then three times with PBS. Alkaline phosphatase
conjugated rabbit anti-chicken IgG (Sigma) diluted 1:1000 in
antibody diluent was added to the plate, and incubated for 1 hour
at 37.degree. C. The plates were washed as before and substrate was
added, [p-nitrophenyl phosphate (Sigma)] at 1 mg/ml in 0.05M
Na.sub.2CO.sub.3, pH 9.5 and 10 mM MgCl.sub.2. The plates were
evaluated quantitatively on a Dynatech MR 300 Micro EPA plate
reader at 410 nm about 10 minutes after the addition of
substrate.
[0349] Based on these ELISA results, high antibody titers were
raised in chickens immunized with the toxin A recombinant
polypeptide. The recombinant appeared to be highly immunogenic, as
it was able to generate high antibody titers relatively quickly
with few immunizations. Immune IgY titer directed specifically to
the toxin A portion of the recombinant was higher than the immune
IgY titer to its fusion partner, the maltose binding protein, and
significantly higher than the preimmune IgY. ELISA titers
(reciprocal of the highest dilution of IgY generating a signal) in
the preimmune IgY to the MBP or the recombinant was <1:30 while
the immune IgY titers to MBP and the toxin A recombinant were
1:18750 and >1:93750 respectively. Importantly, the
anti-recombinant antibody titers generated in the hens against the
recombinant polypeptide is much higher, compared to antibodies to
that region raised using native toxin A. The recombinant antibody
titer to region 1870-2680 in the CTA antibody preparation is at
least five-fold lower compared to the recombinant generated
antibodies (1:18750 versus >1:93750). Thus, it appears a better
immune response can be generated against a specific recombinant
using that recombinant as the immunogen compared to the native
toxin A.
[0350] This observation is significant, as it shows that because
recombinant portions stimulate the production of antibodies, it is
not necessary to use native toxin molecules to produce antitoxin
preparations. Thus, the problems associated with the toxicity of
the native toxin are avoided and large-scale antitoxin production
is facilitated.
[0351] d) Anti-Recombinant Toxin A Neutralization of Toxin A
Hemagglutination Activity In Vitro
[0352] Toxin A has hemagglutinating activity besides cytotoxic and
enterotoxin properties. Specifically, toxin A agglutinates rabbit
erythrocytes by binding to a trisaccharide (gal 1-3B1-4GlcNAc) on
the cell surface. [H. Krivan et al., Infect. Immun., 53:573-581
(1986).] We examined whether the anti-recombinant toxin A (immune
IgY, antibodies raised against the insoluble product expressed in
pET) can neutralize the hemagglutination activity of toxin A in
vitro. The hemagglutination assay procedure used was described by
H. C. Krivan et al. Polyethylene glycol-fractionated immune or
preimmune IgY were pre-absorbed with citrated rabbit erythrocytes
prior to performing the hemagglutination assay because we have
found that IgY alone can agglutinate red blood cells. Citrated
rabbit red blood cells (RRBC's)(Cocalico) were washed twice by
centrifugation at 450.times.g with isotonic buffer (0.1 M Tris-HCl,
0.05 M NaCl, pH 7.2). RRBC-reactive antibodies in the IgY were
removed by preparing a 10% RRBC suspension (made by adding packed
cells to immune or preimmune IgY) and incubating the mixture for 1
hour at 37.degree. C. The RRBCs were then removed by
centrifugation. Neutralization of the hemagglutination activity of
toxin A by antibody was tested in round-bottomed 96-well microtiter
plates. Twenty-five .mu.l of toxin A (36 .mu.g/ml) (Tech Lab) in
isotonic buffer was mixed with an equal volume of different
dilutions of immune or preimmune IgY in isotonic buffer, and
incubated for 15 minutes at room temperature. Then, 50 .mu.l of a
1% RRBC suspension in isotonic buffer was added and the mixture was
incubated for 3 hours at 4.degree. C. Positive control wells
containing the final concentration of 9 .mu.g/ml of toxin A after
dilution without IgY were also included. Hemagglutination activity
was assessed visually, with a diffuse matrix of RRBC's coating the
bottom of the well representing a positive hemagglutination
reaction and a tight button of RRBC's at the bottom of the well
representing a negative reaction. The anti-recombinant immune IgY
neutralized toxin A hemagglutination activity, giving a
neutralization titer of 1:8. However, preimmune IgY was unable to
neutralize the hemagglutination ability of toxin A.
[0353] e) Assay of In Vitro Toxin A Neutralizing Activity
[0354] The ability of the anti-recombinant toxin A IgY (immune IgY
antibodies raised against pMA1870-2680, the soluble recombinant
binding domain protein expressed in pMAL, designated as Anti-tox.
A-2 in FIG. 14, and referred to as recombinant region 6) and
pre-immune IgY, prepared as described in Example 8(c) above, to
neutralize the cytotoxic activity of toxin A was assessed in vitro
using the CHO cell cytotoxicity assay, and toxin A (Tech Lab) at a
concentration of 0.1 .mu.g/ml, as described in Example 8(d) above.
As additional controls, the anti-native toxin A IgY (CTA) and
pre-immune IgY preparations described in Example 8(c) above were
also tested. The results are shown in FIG. 14.
[0355] The anti-recombinant toxin A IgY demonstrated only partial
neutralization of the cytotoxic activity of toxin A, while the
pre-immune IgY did not demonstrate any significant neutralizing
activity.
EXAMPLE 14
In Vivo Neutralization of C. difficile Toxin A
[0356] The ability of avian antibodies (IgY) raised against
recombinant toxin A binding domain to neutralize the enterotoxin
activity of C. difficile toxin A was evaluated in vivo using Golden
Syrian hamsters. The Example involved:
[0357] (a) preparation of the avian anti-recombinant toxin A IgY
for oral administration;
[0358] (b) in vivo protection of hamsters from C. difficile toxin A
enterotoxicity by treatment of toxin A with avian anti-recombinant
toxin A IgY; and (c) histologic evaluation of hamster ceca.
[0359] a) Preparation of the Avian Anti-Recombinant Toxin A IgY for
Oral Administration
[0360] Eggs were collected from hens which had been immunized with
the recombinant C. difficile toxin A fragment pMA1870-2680
(described in Example 13, above). A second group of eggs purchased
at a local supermarket was used as a pre-immune (negative) control.
Egg yolk immunoglobulin (IgY) was extracted by PEG from the two
groups of eggs as described in Example 8(c), and the final IgY
pellets were solubilized in one-fourth the original yolk volume
using 0.1M carbonate buffer (mixture of NaHCO.sub.3 and
Na.sub.2CO.sub.3), pH 9.5. The basic carbonate buffer was used in
order to protect the toxin A from the acidic pH of the stomach
environment.
[0361] b) In Vivo Protection of Hamsters Against C. difficile Toxin
A Enterotoxicity by Treatment of Toxin A with Avian
Anti-Recombinant Toxin A IgY
[0362] In order to assess the ability of the avian anti-recombinant
toxin A IgY, prepared in section (a) above to neutralize the in
vivo enterotoxin activity of toxin A, an in vivo toxin
neutralization model was developed using Golden Syrian hamsters.
This model was based on published values for the minimum amount of
toxin A required to elicit diarrhea (0.08 mg toxin A/Kg body wt.)
and death (0.16 mg toxin A/Kg body wt.) in hamsters when
administered orally (Lyerly et al. Infect. Immun., 47:349-352
(1985).
[0363] For the study, four separate experimental groups were used,
with each group consisting of 7 female Golden Syrian hamsters
(Charles River), approx. three and one-half weeks old, weighing
approx. 50 gms each. The animals were housed as groups of 3 and 4,
and were offered food and water ad libitum through the entire
length of the study.
[0364] For each animal, a mixture containing either 100 .mu.g of
toxin A (0.2 mg/Kg) or 30 .mu.g of toxin A (0.6 mg/Kg) (C.
difficile toxin A was obtained from Tech Lab and 1 ml of either the
anti-recombinant toxin A IgY or pre-immune IgY (from section (a)
above) was prepared. These mixtures were incubated at 37.degree. C.
for 60 min. and were then administered to the animals by the oral
route. The animals were then observed for the onset of diarrhea and
death for a period of 24 hrs. following the administration of the
toxin A+IgY mixtures, at the end of which time, the following
results were tabulated and shown in Table 17:
17TABLE 17 Study Outcome At 24 Hours Study Outcome at 24 Hours
Experimental Group Healthy.sup.1 Diarrhea.sup.2 Dead.sup.3 10 .mu.g
Toxin A + 7 0 0 Antitoxin Against Interval 6 30 .mu.g Toxin A + 7 0
0 Antitoxin Against Interval 6 10 .mu.g Toxin A + 0 5 2 Pre-Immune
Serum 30 .mu.g Toxin A + 0 5 2 Pre-Immune .sup.1Animals remained
healthy through the entire 24 hour study period. .sup.2Animals
developed diarrhea, but did not die. .sup.3Animals developed
diarrhea, and subsequently died.
[0365] Pretreatment of toxin A at both doses tested, using the
anti-recombinant toxin A IgY, prevented all overt symptoms of
disease in hamsters. Therefore, pretreatment of C. difficile toxin
A, using the anti-recombinant toxin A IgY, neutralized the in vivo
enterotoxin activity of the toxin A. In contrast, all animals from
the two groups which received toxin A which had been pretreated
using pre-immune IgY developed disease symptoms which ranged from
diarrhea to death. The diarrhea which developed in the animals
which did not die in each of the two pre-immune groups,
spontaneously resolved by the end of the 24 hr. study period.
[0366] c) Histologic Evaluation of Hamster Ceca
[0367] In order to further assess the ability of anti-recombinant
toxin A IgY to protect hamsters from the enterotoxin activity of
toxin A, histologic evaluations were performed on the ceca of
hamsters from the study described in section (b) above.
[0368] Three groups of animals were sacrificed in order to prepare
histological specimens. The first group consisted of a single
representative animal taken from each of the 4 groups of surviving
hamsters at the conclusion of the study described in section (b)
above. These animals represented the 24 hr. timepoint of the
study.
[0369] The second group consisted of two animals which were not
part of the study described above, but were separately treated with
the same toxin A+pre-immune IgY mixtures as described for the
animals in section (b) above. Both of these hamsters developed
diarrhea, and were sacrificed 8 hrs. after the time of
administration of the toxin A+pre-immune IgY mixtures. At the time
of sacrifice, both animals were presenting symptoms of diarrhea.
These animals represented the acute phase of the study.
[0370] The final group consisted of a single untreated hamster from
the same shipment of animals as those used for the two previous
groups. This animal served as the normal control.
[0371] Samples of cecal tissue were removed from the 7 animals
described above, and were fixed overnight at 4.degree. C. using 10%
buffered formalin. The fixed tissues were paraffin-embedded,
sectioned, and mounted on glass microscope slides. The tissue
sections were then stained using hematoxylin and eosin (H and E
stain), and were examined by light microscopy.
[0372] The tissues obtained from the two 24 hr. animals which
received mixtures containing either 10 .mu.g or 30 .mu.g of toxin A
and anti-recombinant toxin A IgY were indistinguishable from the
normal control, both in terms of gross pathology, as well as at the
microscopic level. These observations provide further evidence for
the ability of anti-recombinant toxin A IgY to effectively
neutralize the in vivo enterotoxin activity of C. difficile toxin
A, and thus its ability to prevent acute or lasting toxin A-induced
pathology.
[0373] In contrast, the tissues from the two 24 hr. animals which
received the toxin A+pre-immune IgY mixtures demonstrated
significant pathology. In both of these groups, the mucosal layer
was observed to be less organized than in the normal control
tissue. The cytoplasm of the epithelial cells had a vacuolated
appearance, and gaps were present between the epithelium and the
underlying cell layers. The lamina propria was largely absent.
Intestinal villi and crypts were significantly diminished, and
appeared to have been overgrown by a planar layer of epithelial
cells and fibroblasts. Therefore, although these animals overtly
appeared to recover from the acute symptoms of toxin A
intoxication, lasting pathologic alterations to the cecal mucosa
had occurred.
[0374] The tissues obtained from the two acute animals which
received mixtures of toxin A and pre-immune IgY demonstrated the
most significant pathology. At the gross pathological level, both
animals were observed to have severely distended ceca which were
filled with watery, diarrhea-like material. At the microscopic
level, the animal that was given the mixture containing 10 .mu.g of
toxin A and pre-immune IgY was found to have a mucosal layer which
had a ragged, damaged appearance, and a disorganized, compacted
quality. The crypts were largely absent, and numerous breaks in the
epithelium had occurred. There was also an influx of erythrocytes
into spaces between the epithelial layer and the underlying tissue.
The animal which had received the mixture containing 30 .mu.g of
toxin A and pre-immune IgY demonstrated the most severe pathology.
The cecal tissue of this animal had an appearance very similar to
that observed in animals which had died from C. difficile disease.
Widespread destruction of the mucosa was noted, and the epithelial
layer had sloughed. Hemorrhagic areas containing large numbers of
erythrocytes were very prevalent. All semblance of normal tissue
architecture was absent from this specimen. In terms of the
presentation of pathologic events, this in vivo hamster model of
toxin A-intoxication correlates very closely with the pathologic
consequences of C. difficile disease in hamsters. The results
presented in this Example demonstrate that while anti-recombinant
toxin A (Interval 6) IgY is capable of only partially neutralizing
the cytotoxic activity of C. difficile toxin A, the same antibody
effectively neutralizes 100% of the in vivo enterotoxin activity of
the toxin. While it is not intended that this invention be limited
to this mechanism, this may be due to the cytotoxicity and
enterotoxicity of C. difficile Toxin A as two separate and distinct
biological functions.
EXAMPLE 15
In Vivo Neutralization of C. Difficile Toxin A by Antibodies
Against Recombinant Toxin A Polypeptides
[0375] The ability of avian antibodies directed against the
recombinant C. difficile toxin A fragment 1870-2680 (as expressed
by pMA1870-2680; see Example 13) to neutralize the enterotoxic
activity of toxin A was demonstrated in Example 14. The ability of
avian antibodies (IgYs) directed against other recombinant toxin A
epitopes to neutralize native toxin A in vivo was next evaluated.
This example involved: (a) the preparation of IgYs against
recombinant toxin A polypeptides; (b) in vivo protection of
hamsters against toxin A by treatment with anti-recombinant toxin A
IgYs and (c) quantification of specific antibody concentration in
CTA and Interval 6 IgY PEG preparations.
[0376] The nucleotide sequence of the coding region of the entire
toxin A protein is listed in SEQ ID NO:5. The amino acid sequence
of the entire toxin A protein is listed in SEQ ID NO:6. The amino
acid sequence consisting of amino acid residues 1870 through 2680
of toxin A is listed in SEQ ID NO:7. The amino acid sequence
consisting of amino acid residues 1870 through 1960 of toxin A is
listed in SEQ ID NO:8.
[0377] a) Preparation of IgY's Against Recombinant Toxin A
Polypeptides
[0378] Eggs were collected from Leghorn hens which have been
immunized with recombinant C. difficile toxin A polypeptide
fragments encompassing the entire toxin A protein. The polypeptide
fragments used as immunogens were: 1) pMA 1870-2680 (Interval 6),
2) pPA 1100-1450 (Interval 4), and 3) a mixture of fragments
consisting of pMA 30-300 (Interval 1), pMA 300-660 (Interval 2),
pMA 660-1100 (Interval 3) and pMA 1450-1870 (Interval 5). This
mixture of immunogens is referred to as Interval 1235. The location
of each interval within the toxin A molecule is shown in FIG. 15A.
In FIG. 15A, the following abbreviations are used: pP refers to the
pET23 vector (New England BioLabs); pM refers to the pMAL.TM.-c
vector (New England BioLabs); A refers to toxin A; the numbers
refer to the amino acid interval expressed in the clone. (For
example, the designation pMA30-300 indicates that the recombinant
clone encodes amino acids 30-300 of toxin A and the vector used was
pMAL.TM.-c).
[0379] The recombinant proteins were generated as described in
Example 11. The IgYs were extracted and solubilized in 0.1M
carbonate buffer pH 9.5 for oral administration as described in
Example 14(a). The IgY reactivities against each individual
recombinant interval was evaluated by ELISA as described in Example
13(c).
[0380] b) In Vivo Protection of Hamsters Against Toxin A by
Treatment with Anti-Recombinant Toxin A Antibodies
[0381] The ability of antibodies raised against recombinant toxin A
polypeptides to provide in vivo protection against the enterotoxic
activity of toxin A was examined in the hamster model system. This
assay was performed as described in Example 14(b). Briefly, for
each 40-50 gram female Golden Syrian hamster (Charles River), 1 ml
of IgY 4.times. (i.e., resuspended in 1/4 of the original yolk
volume) PEG prep against Interval 6, Interval 4 or Interval 1235
was mixed with 30 .mu.g (LD.sub.100 oral dose) of C. difficile
toxin A (Tech Lab). Preimmune IgY mixed with toxin A served as a
negative control. Antibodies raised against C. difficile toxoid A
(Example 8) mixed with toxin A (CTA) served as a positive control.
The mixture was incubated for 1 hour at 37.degree. C. then orally
administered to lightly etherized hamsters using an 18G feeding
needle. The animals were then observed for the onset of diarrhea
and death for a period of approximately 24 hours. The results are
shown in Table 18.
18TABLE 18 Study Outcome After 24 Hours Treatment group
Healthy.sup.1 Diarrhea.sup.2 Dead.sup.3 Preimmune 0 0 7 CTA 5 0 0
Interval 6 6 1 0 Interval 4 0 1 6 Interval 1235 0 0 7 .sup.1Animal
shows no sign of illness. .sup.2Animal developed diarrhea, but did
not die. .sup.3Animal developed diarrhea and died.
[0382] Pre-treatment of toxin A with IgYs against Interval 6
prevented diarrhea in 6 of 7 hamsters and completely prevented
death in all 7. In contrast, as with preimmune IgY, IgYs against
Interval 4 and Interval 1235 had no effect on the onset of diarrhea
and death in the hamsters.
[0383] c) Quantification of Specific Antibody Concentration in CTA
and Interval 6 IgY PEG Preparations
[0384] To determine the purity of IgY PEG preparations, an aliquot
of a pMA1870-2680 (Interval 6) IgY PEG preparation was
chromatographed using HPLC and a KW-803 sizing column (Shodex). The
resulting profile of absorbance at 280 nm is shown in FIG. 16. The
single large peak corresponds to the predicted MW of IgY.
Integration of the area under the single large peak showed that
greater than 95% of the protein eluted from the column was present
in this single peak. This result demonstrated that the majority
(>95%) of the material absorbing at 280 nm in the PEG
preparation corresponds to IgY. Therefore, absorbance at 280 nm can
be used to determine the total antibody concentration in PEG
preparations.
[0385] To determine the concentration of Interval 6-specific
antibodies (expressed as percent of total antibody) within the CTA
and pMA1870-2680 (Interval 6) PEG preparations, defined quantities
of these antibody preparations were affinity purified on a
pPA1870-2680(H) (shown schematically in FIG. 15B) affinity column
and the specific antibodies were quantified. In FIG. 15B the
following abbreviations are used: pP refers to the pET23 vector
(New England BioLabs); pM refers to the pMAL.TM.-c vector (New
England BioLabs); pG refers to the pGEX vector (Pharmacia); pB
refers to the PinPoint.TM. Xa vector (Promega); A refers to toxin
A; the numbers refer to the amino acid interval expressed in the
clone. The solid black ovals represent the MBP; the hatched ovals
represent glutathione S-transferase; the hatched circles represent
the biotin tag; and HHH represents the poly-histidine tag.
[0386] An affinity column containing recombinant toxin A repeat
protein was made as follows. Four ml of PBS-washed Actigel resin
(Sterogene) was coupled with 5-10 mg of pPA1870-2680 inclusion body
protein [prepared as described in Example (17) and dialyzed into
PBS] in a 15 ml tube (Falcon) containing {fraction (1/10)} final
volume Ald-coupling solution (1 M sodium cyanoborohydride).
Aliquots of the supernatant from the coupling reactions, before and
after coupling, were assessed by Coomassie staining of 7.5%
SDS-PAGE gels. Based upon protein band intensities, greater than 6
mg of recombinant protein was coupled to the resin. The resin was
poured into a 10 ml column (BioRad), washed extensively with PBS,
pre-eluted with 4 M guanidine-HCl (in 10 mM Tris-HCl, pH 8.0;
0.005% thimerosal) and re-equilibrated with PBS. The column was
stored at 4.degree. C.
[0387] Aliquots of a pMA1870-2680 (Interval 6) or a CTA IgY
polyclonal antibody preparation (PEG prep) were affinity purified
on the above affinity column as follows. The column was attached to
an UV monitor (ISCO) and washed with PBS. For pMA1870-2680 IgY
purification, a 2.times. PEG prep (filter sterilized using a
0.45.mu. filter; approximately 500 mg total IgY) was applied. The
column was washed with PBS until the baseline was re-established
(the column flow-through was saved), washed with BBSTween to elute
nonspecifically binding antibodies and re-equilibrated with PBS.
Bound antibody was eluted from the column in 4 M guanidine-HCl (in
10 mM Tris-HCl, pH 8.0; 0.005% thimerosal). The entire elution peak
was collected in a 15 ml tube (Falcon). The column was
re-equilibrated and the column eluate was re-chromatographed as
described above. The antibody preparation was quantified by UV
absorbance (the elution buffer was used to zero the
spectrophotometer). Total purified antibody was approximately 9 mg
and 1 mg from the first and second chromatography passes,
respectively. The low yield from the second pass indicated that
most specific antibodies were removed by the first round of
chromatography. The estimated percentage of Interval 6 specific
antibodies in the pMA1870-2680 PEG prep is approximately 2%.
[0388] The percentage of Interval 6 specific antibodies in the CTA
PEG prep was determined (utilizing the same column and methodology
described above) to be approximately 0.5% of total IgY.
[0389] A 4.times. PEG prep contains approximately 20 mg/ml IgY.
Thus in b) above, approximately 400 .mu.g specific antibody in the
Interval 6 PEG prep neutralized 30 .mu.g toxin A in vivo.
EXAMPLE 16
In Vivo Treatment of C. difficile Disease in Hamsters by
Recombinant Interval 6 Antibodies
[0390] The ability of antibodies directed against recombinant
Interval 6 of toxin A to protect hamsters in vivo from C. difficile
disease was examined. This example involved: (a) prophylactic
treatment of C. difficile disease and (b) therapeutic treatment of
C. difficile disease.
[0391] a) Prophylactic Treatment of C. difficile Disease
[0392] This experiment was performed as described in Example 9(b).
Three groups each consisting of 7 female 100 gram Syrian hamsters
(Charles River) were prophylactically treated with either preimmune
IgYs, IgYs against native toxin A and B [CTAB; see Example 8 (a)
and (b)] or IgYs against Interval 6. IgYs were prepared as 4.times.
PEG preparations as described in Example 9(a).
[0393] The animals were orally dosed 3 times daily, roughly at 4
hour intervals, for 12 days with 1 ml antibody preparations diluted
in Ensure.RTM.. Using estimates of specific antibody concentration
from Example 15(c), each dose of the Interval 6 antibody prep
contained approximately 400 .mu.g of specific antibody. On day 2
each hamster was predisposed to C. difficile infection by the oral
administration of 3.0 mg of Clindamycin-HCl (Sigma) in 1 ml of
water. On day 3 the hamsters were orally challenged with 1 ml of C.
difficile inoculum strain ATCC 43596 in sterile saline containing
approximately 100 organisms. The animals were then observed for the
onset of diarrhea and subsequent death during the treatment period.
The results are shown in Table 19.
19TABLE 19 Lethality After 12 Days Of Treatment Treatment Group
Number Animals Alive Number Animals Dead Preimmune 0 7 CTAB 6 1
Interval 6 7 0
[0394] Treatment of hamsters with orally-administered IgYs against
Interval 6 successfully protected 7 out of 7 (100%) of the animals
from C. difficile disease. One of the hamsters in this group
presented with diarrhea which subsequently resolved during the
course of treatment. As shown previously in Example 9, antibodies
to native toxin A and toxin B were highly protective. In this
Example, 6 out of 7 animals survived in the CTAB treatment group.
All of the hamsters treated with preimmune sera came down with
diarrhea and died. The survivors in both the CTAB and Interval 6
groups remained healthy throughout a 12 day post-treatment period.
In particular, 6 out of 7 Interval 6-treated hamsters survived at
least 2 weeks after termination of treatment which suggests that
these antibodies provide a long-lasting cure. These results
represent the first demonstration that antibodies generated against
a recombinant region of toxin A can prevent CDAD when administered
passively to animals. These results also indicate that antibodies
raised against Interval 6 alone may be sufficient to protect
animals from C. difficile disease when administered
prophylactically.
[0395] Previously others had raised antibodies against toxin A by
actively immunizing hamsters against a recombinant polypeptide
located within the Interval 6 region [Lyerly, D. M., et al. (1990)
Curr. Microbiol. 21:29]. FIG. 17 shows schematically the location
of the Lyerly, et al intra-Interval 6 recombinant protein (cloned
into the pUC vector) in comparison with the complete Interval 6
construct (pMA1870-2680) used herein to generate neutralizing
antibodies directed against toxin A. In FIG. 17, the solid black
oval represents the MBP which is fused to the toxin A Interval 6 in
pMA1870-2680.
[0396] The Lyerly, et al. antibodies (intra-Interval 6) were only
able to partially protect hamsters against C. difficile infection
in terms of survival (4 out of 8 animals survived) and furthermore,
these antibodies did not prevent diarrhea in any of the animals.
Additionally, animals treated with the intra-Interval 6 antibodies
[Lyerly, et al. (1990), supra] died when treatment was removed.
[0397] In contrast, the experiment shown above demonstrates that
passive administration of anti-Interval 6 antibodies prevented
diarrhea in 6 out of 7 animals and completely prevented death due
to CDAD. Furthermore, as discussed above, passive administration of
the anti-Interval 6 antibodies provides a long lasting cure (i.e.,
treatment could be withdrawn without incident).
[0398] b) Therapeutic Treatment of C. difficile Disease: In Vivo
Treatment of an Established C. difficile Infection in Hamsters with
Recombinant Interval 6 Antibodies
[0399] The ability of antibodies against recombinant interval 6 of
toxin A to therapeutically treat C. difficile disease was examined.
The experiment was performed essentially as described in Example
10(b). Three groups, each containing seven to eight female Golden
Syrian hamsters (100 g each; Charles River) were treated with
either preimmune IgY, IgYs against native toxin A and toxin B
(CTAB) and IgYs against Interval 6. The antibodies were prepared as
described above as 4.times. PEG preparations.
[0400] The hamsters were first predisposed to C. difficile
infection with a 3 mg dose of Clindamycin-HCl (Sigma) administered
orally in 1 ml of water. Approximately 24 hrs later, the animals
were orally challenged with 1 ml of C. difficile strain ATCC 43596
in sterile saline containing approximately 200 organisms. One day
after infection, the presence of toxin A and B was determined in
the feces of the hamsters using a commercial immunoassay kit
(Cytoclone A+B EPA, Cambridge Biotech) to verify establishment of
infection. Four members of each group were randomly selected and
tested. Feces from an uninfected hamster was tested as a negative
control. All infected animals tested positive for the presence of
toxin according to the manufacturer's procedure. The initiation of
treatment then started approximately 24 hr post-infection.
[0401] The animals were dosed daily at roughly 4 hr intervals with
1 ml antibody preparation diluted in Ensure.RTM. (Ross Labs). The
amount of specific antibodies given per dose (determined by
affinity purification) was estimated to be about 400 .mu.g of
anti-interval 6 IgY (for animals in the Interval 6 group) and 100
.mu.g and 70 .mu.g of anti-toxin A (Interval 6-specific) and
anti-toxin B (Interval 3-specific; see Example 19), respectively,
for the CTAB preparation. The animals were treated for 9 days and
then observed for an additional 4 days for the presence of diarrhea
and death. The results indicating the number of survivors and the
number of dead 4 days post-infection are shown in Table 20.
20TABLE 20 In vivo Therapeutic Treatment With Interval 6 Antibodies
Treatment Group Number Animals Alive Number Animals Dead Preimmune
4 3 CTAB 8 0 Interval 6 8 0
[0402] Antibodies directed against both Interval 6 and CTAB
successfully prevented death from C. difficile when therapeutically
administered 24 hr after infection. This result is significant
since many investigators begin therapeutic treatment of hamsters
with existing drugs (e.g., vancomycin, phenelfamycins, tiacumicins,
etc.) 8 hr post-infection [Swanson, et al. (1991) Antimicrobial
Agents and Chemotherapy 35:1108 and (1989) J. Antibiotics
42:94].
[0403] Forty-two percent of hamsters treated with preimmune IgY
died from CDAD. While the anti-Interval 6 antibodies prevented
death in the treated hamsters, they did not eliminate all symptoms
of CDAD as 3 animals presented with slight diarrhea. In addition,
one CTAB-treated and one preimmune-treated animal also had diarrhea
14 days post-infection. These results indicate that anti-Interval 6
antibodies provide an effective means of therapy for CDAD.
EXAMPLE 17
Induction of Toxin A Neutralizing Antibodies Requires Soluble
Interval 6 Protein
[0404] As shown in Examples 11(d) and 15, expression of recombinant
proteins in E. coli may result in the production of either soluble
or insoluble protein. If insoluble protein is produced, the
recombinant protein is solubilized prior to immunization of
animals. To determine whether, one or both of the soluble or
insoluble recombinant proteins could be used to generate
neutralizing antibodies to toxin A, the following experiment was
performed. This example involved a) expression of the toxin A
repeats and subfragments of these repeats in E. coli using a
variety of expression vectors; b) identification of recombinant
toxin A repeats and sub-regions to which neutralizing antibodies
bind; and c) determination of the neutralization ability of
antibodies raised against soluble and insoluble toxin A repeat
immunogen.
[0405] a) Expression of the Toxin A Repeats and Subfragments of
these Repeats in E. coli Using a Variety of Expression Vectors
[0406] The Interval 6 immunogen utilized in Examples 15 and 16 was
the pMA1870-2680 protein, in which the toxin A repeats are
expressed as a soluble fusion protein with the MBP (described in
Example 11). Interestingly, expression of this region (from the
SpeI site to the end of the repeats, see FIG. 15B) in three other
expression constructs, as either native (pPA1870-2680), poly-His
tagged [pPA1870-2680 (H)] or biotin-tagged (pBA1870-2680) proteins
resulted in completely insoluble protein upon induction of the
bacterial host (see FIG. 15B). The host strain BL21 (Novagen) was
used for expression of pBA1870-2680 and host strain BL21(DE3)
(Novagen) was used for expression of pPA1870-2680 and
pPA1870-2680(H). These insoluble proteins accumulated to high
levels in inclusion bodies. Expression of recombinant plasmids in
E. coli host cells grown in 2.times. YT medium was performed as
described [Williams, et al (1995), supra].
[0407] As summarized in FIG. 15B, expression of fragments of the
toxin A repeats (as either N-terminal SpeI-EcoRI fragments, or
C-terminal EcoRI-end fragments) also yielded high levels of
insoluble protein using pGEX (pGA1870-2190), PinPoint.TM.-Xa
(pBA1870-2190 and pBA2250-2680) and pET expression systems
(pPA1870-2190). The pGEX and pET expression systems are described
in Example 11. The PinPoint.TM.-Xa expression system drives the
expression of fusion proteins in E. coli. Fusion proteins from
PinPoint.TM.-Xa vectors contain a biotin tag at the amino-terminal
end and can be affinity purified SoftLink.TM. Soft Release avidin
resin (Promega) under mild denaturing conditions (5 mM biotin).
[0408] The solubility of expressed proteins from the pPG1870-2190
and pPA1870-2190 expression constructs was determined after
induction of recombinant protein expression under conditions
reported to enhance protein solubility [These conditions comprise
growth of the host at reduced temperature (30.degree. C.) and the
utilization of high (1 mM IPTG) or low (0.1 mM IPTG) concentrations
of inducer [Williams et al. (1995), supra]. All expressed
recombinant toxin A protein was insoluble under these conditions.
Thus, expression of these fragments of the toxin A repeats in pET
and pGEX expression vectors results in the production of insoluble
recombinant protein even when the host cells are grown at reduced
temperature and using lower concentrations of the inducer. Although
expression of these fragments in pMa1 vectors yielded affinity
purifiable soluble fusion protein, the protein was either
predominantly insoluble (pMA1870-2190) or unstable (pMA2250-2650).
Attempts to solubilize expressed protein from the pMA1870-2190
expression construct using reduced temperature or lower inducer
concentration (as described above) did not improve fusion protein
solubility.
[0409] Collectively, these results demonstrate that expression of
the toxin A repeat region in E. coli results in the production of
insoluble recombinant protein, when expressed as either large (aa
1870-2680) or small (aa 1870-2190 or aa 2250-2680) fragments, in a
variety of expression vectors (native or poly-his tagged pET, pGEX
or PinPoint.TM.-Xa vectors), utilizing growth conditions shown to
enhance protein solubility. The exception to this rule were fusions
with the MBP, which enhanced protein solubility, either partially
(pMA1870-2190) or fully (pMA1870-2680).
[0410] b) Identification Of Recombinant Toxin A Repeats and
Sub-Regions to which Neutralizing Antibodies Bind
[0411] Toxin A repeat regions to which neutralizing antibodies bind
were identified by utilizing recombinant toxin A repeat region
proteins expressed as soluble or insoluble proteins to deplete
protective antibodies from a polyclonal pool of antibodies against
native C. difficile toxin A. An in vivo assay was developed to
evaluate proteins for the ability to bind neutralizing
antibodies.
[0412] The rational for this assay is as follows. Recombinant
proteins were first pre-mixed with antibodies against native toxin
A (CTA antibody; generated in Example 8) and allowed to react.
Subsequently, C. difficile toxin A was added at a concentration
lethal to hamsters and the mixture was administered to hamsters via
IP injection. If the recombinant protein contains neutralizing
epitopes, the CTA antibodies would lose their ability to bind toxin
A resulting in diarrhea and/or death of the hamsters.
[0413] The assay was performed as follows. The lethal dose of toxin
A when delivered orally to nine 40 to 50 g Golden Syrian hamsters
(Sasco) was determined to be 10 to 30 .mu.g. The PEG-purified CTA
antibody preparation was diluted to 0.5.times. concentration (i.e.,
the antibodies were diluted at twice the original yolk volume) in
0.1 M carbonate buffer, pH 9.5. The antibodies were diluted in
carbonate buffer to protect them from acid degradation in the
stomach. The concentration of 0.5.times. was used because it was
found to be the lowest effective concentration against toxin A. The
concentration of Interval 6-specific antibodies in the 0.5.times.
CTA prep was estimated to be 10-15 .mu.g/ml (estimated using the
method described in Example 15).
[0414] The inclusion body preparation [insoluble Interval 6
protein; pPA1870-2680(H)] and the soluble Interval 6 protein
[pMA1870-2680; see FIG. 15] were both compared for their ability to
bind to neutralizing antibodies against C. difficile toxin A (CTA).
Specifically, 1 to 2 mg of recombinant protein was mixed with 5 ml
of a 0.5.times. CTA antibody prep (estimated to contain 60-70 .mu.g
of Interval 6-specific antibody). After incubation for 1 hr at
37.degree. C., CTA (Tech Lab) at a final concentration of 30
.mu.g/ml was added and incubated for another 1 hr at 37.degree. C.
One ml of this mixture containing 30 .mu.g of toxin A (and 10-15
.mu.g of Interval 6-specific antibody) was administered orally to
40-50 g Golden Syrian hamsters (Sasco). Recombinant proteins that
result in the loss of neutralizing capacity of the CTA antibody
would indicate that those proteins contain neutralizing epitopes.
Preimmune and CTA antibodies (both at 0.5.times.) without the
addition of any recombinant protein served as negative and positive
controls, respectively.
[0415] Two other inclusion body preparations, both expressed as
insoluble products in the pET vector, were tested; one containing a
different insert (toxin B fragment) other than Interval 6 called
pPB1850-2070 (see FIG. 18) which serves as a control for insoluble
Interval 6, the other was a truncated version of the Interval 6
region called pPA1870-2190 (see FIG. 15B). The results of this
experiment are shown in Table 21.
21TABLE 21 Binding Of Neutralizing Antibodies By Soluble Interval 6
Protein Study Outcome After 24 Hours Treatment Group.sup.1
Healthy.sup.2 Diarrhea.sup.3 Dead.sup.4 Preimmune Ab 0 3 2 CTA Ab 4
1 0 CTA Ab + Int 6 (soluble) 1 2 2 CTA Ab + Int 6 (insoluble) 5 0 0
CTA Ab + pPB1850-2070 5 0 0 CTA Ab + pPA1870-2190 5 0 0 .sup.1C.
difficile toxin A (CTA) was added to each group. .sup.2Animals
showed no signs of illness. .sup.3Animals developed diarrhea but
did not die. .sup.4Animals developed diarrhea and died.
[0416] Preimmune antibody was ineffective against toxin A, while
anti-CTA antibodies at a dilute 0.5.times. concentration almost
completely protected the hamsters against the enterotoxic effects
of CTA. The addition of recombinant proteins pPB1850-2070 or
pPA1870-2190 to the anti-CTA antibody had no effect upon its
protective ability, indicating that these recombinant proteins do
not bind to neutralizing antibodies. On the other hand, recombinant
Interval 6 protein was able to bind to neutralizing anti-CTA
antibodies and neutralized the in vivo protective effect of the
anti-CTA antibodies. Four out of five animals in the group treated
with anti-CTA antibodies mixed with soluble Interval 6 protein
exhibited toxin associated toxicity (diarrhea and death). Moreover,
the results showed that Interval 6 protein must be expressed as a
soluble product in order for it to bind to neutralizing anti-CTA
antibodies since the addition of insoluble Interval 6 protein had
no effect on the neutralizing capacity of the CTA antibody
prep.
[0417] c) Determination of Neutralization Ability of Antibodies
Raised Against Soluble and Insoluble Toxin A Repeat Immunogen
[0418] To determine if neutralizing antibodies are induced against
solubilized inclusion bodies, insoluble toxin A repeat protein was
solubilized and specific antibodies were raised in chickens.
Insoluble pPA1870-2680 protein was solubilized using the method
described in Williams et al. (1995), supra. Briefly, induced
cultures (500 ml) were pelleted by centrifugation at 3,000.times.g
for 10 min at 4.degree. C. The cell pellets were resuspended
thoroughly in 10 ml of inclusion body sonication buffer (25 mM
HEPES pH 7.7, 100 mM KCl, 12.5 mM MgCl.sub.2, 20% glycerol, 0.1%
(v/v) Nonidet P-40, 1 mM DTT). The suspension was transferred to a
30 ml non-glass centrifuge tube. Five hundred .mu.l of 10 mg/ml
lysozyme was added and the tubes were incubated on ice for 30 min.
The suspension was then frozen at -70.degree. C. for at least 1 hr.
The suspension was thawed rapidly in a water bath at room
temperature and then placed on ice. The suspension was then
sonicated using at least eight 15 sec bursts of the microprobe
(Branson Sonicator Model No. 450) with intermittent cooling on
ice.
[0419] The sonicated suspension was transferred to a 35 ml Oakridge
tube and centrifuged at 6,000.times.g for 10 min at 4.degree. C. to
pellet the inclusion bodies. The pellet was washed 2 times by
pipetting or vortexing in fresh, ice-cold RIPA buffer [0.1% SDS, 1%
Triton X-100, 1% sodium deoxycholate in TBS (25 mM Tris-Cl pH 7.5,
150 mM NaCl)]. The inclusion bodies were recentrifuged after each
wash. The inclusion bodies were dried and transferred using a small
metal spatula to a 15 ml tube (Falcon). One ml of 10% SDS was added
and the pellet was solubilized by gently pipetting the solution up
and down using a 1 ml micropipettor. The solubilization was
facilitated by heating the sample to 95.degree. C. when
necessary.
[0420] Once the inclusion bodies were in solution, the samples were
diluted with 9 volumes of PBS. The protein solutions were dialyzed
overnight against a 100-fold volume of PBS containing 0.05% SDS at
room temperature. The dialysis buffer was then changed to PBS
containing 0.01% SDS and the samples were dialyzed for several
hours to overnight at room temperature. The samples were stored at
4.degree. C. until used. Prior to further use, the samples were
warmed to room temperature to allow any precipitated SDS to go back
into solution.
[0421] The inclusion body preparation was used to immunize hens.
The protein was dialyzed into PBS and emulsified with approximately
equal volumes of CFA for the initial immunization or IFA for
subsequent booster immunizations. On day zero, for each of the
recombinant recombinant preparations, two egg laying white Leghorn
hens were each injected at multiple sites (IM and SC) with 1 ml of
recombinant protein-adjuvant mixture containing approximately
0.5-1.5 mg of recombinant protein. Booster immunizations of 1.0 mg
were given of days 14 and day 28. Eggs were collected on day 32 and
the antibody isolated using PEG as described in Example 14(a). High
titers of toxin A specific antibodies were present (as assayed by
ELISA, using the method described in Example 13). Titers were
determined for both antibodies against recombinant polypeptides
pPA1870-2680 and pMA1870-2680 and were found to be comparable at
>1:62,500.
[0422] Antibodies against soluble Interval 6 (pMA1870-2680) and
insoluble Interval 6 [(inclusion body), pPA1870-2680] were tested
for neutralizing ability against toxin A using the in vivo assay
described in Example 15(b). Preimmune antibodies and antibodies
against toxin A (CTA) served as negative and positive controls,
respectively. The results are shown in Table 22.
22TABLE 22 Neutralization Of Toxin A By Antibodies Against Soluble
Interval 6 Protein Study Outcome After 24 Hours Antibody Treatment
Group Healthy.sup.1 Diarrhea.sup.2 Dead.sup.3 Preimmune 1 0 4 CTA 5
0 0 Interval 6 (Soluble).sup.4 5 0 0 Interval 6 (Insoluble) 0 2 3
.sup.1Animals showed no sign of illness. .sup.2Animal developed
diarrhea but did not die. .sup.3Animal developed diarrhea and died.
.sup.4400 .mu.g/ml.
[0423] Antibodies raised against native toxin A were protective
while preimmune antibodies had little effect. As found using the in
vitro CHO assay [described in Example 8(d)] where antibodies raised
against the soluble Interval 6 could partially neutralize the
effects of toxin A, here they were able to completely neutralize
toxin A in vivo. In contrast, the antibodies raised against the
insoluble Interval 6 was unable to neutralize the effects of toxin
A in vivo as shown above (Table 22) and in vitro as shown in the
CHO assay [described in Example 8(d)].
[0424] These results demonstrate that soluble toxin A repeat
immunogen is necessary to induce the production of neutralizing
antibodies in chickens, and that the generation of such soluble
immunogen is obtained only with a specific expression vector (pMa1)
containing the toxin A region spanning aa 1870-2680. That is to
say, insoluble protein that is subsequently solubilized does not
result in a toxin A antigen that will elicit a neutralizing
antibody.
EXAMPLE 18
Cloning and Expression of the C. difficile Toxin B Gene
[0425] The toxin B gene has been cloned and sequenced; the amino
acid sequence deduced from the cloned nucleotide sequence predicts
a MW of 269.7 kD for toxin B [Barroso et al., Nucl. Acids Res.
18:4004 (1990)]. The nucleotide sequence of the coding region of
the entire toxin B gene is listed in SEQ ID NO:9. The amino acid
sequence of the entire toxin B protein is listed in SEQ ID NO:10
The amino acid sequence consisting of amino acid residues 1850
through 2360 of toxin B is listed in SEQ ID NO:11. The amino acid
sequence consisting of amino acid residues 1750 through 2360 of
toxin B is listed in SEQ ID NO:12.
[0426] Given the expense and difficulty of isolating native toxin B
protein, it would be advantageous to use simple and inexpensive
procaryotic expression systems to produce and purify high levels of
recombinant toxin B protein for immunization purposes. Ideally, the
isolated recombinant protein would be soluble in order to preserve
native antigenicity, since solubilized inclusion body proteins
often do not fold into native conformations. Indeed as shown in
Example 17, neutralizing antibodies against recombinant toxin A
were only obtained when soluble recombinant toxin A polypeptides
were used as the immunogen. To allow ease of purification, the
recombinant protein should be expressed to levels greater than 1
mg/liter of E. coli culture.
[0427] To determine whether high levels of recombinant toxin B
protein could be produced in E. coli, fragments of the toxin B gene
were cloned into various prokaryotic expression vectors, and
assessed for the ability to express recombinant toxin B protein in
E. coli. This Example involved (a) cloning of the toxin B gene and
(b) expression of the toxin B gene in E. coli.
[0428] a) Cloning of the Toxin B Gene
[0429] The toxin B gene was cloned using PCR amplification from C.
difficile genomic DNA. Initially, the gene was cloned in two
overlapping fragments, using primer pairs P5/P6 and P7/P8. The
location of these primers along the toxin B gene is shown
schematically in FIG. 18. The sequence of each of these primers
is:
23 P5: 5' TAGAAAAAATGGCAAATGT 3'; (SEQ ID NO:11) P6: 5'
TTTCATCTTGTAGAGTCAAAG 3'; (SEQ ID NO:12) P7: 5'
GATGCCACAAGATGATTTAGTG 3'; (SEQ ID NO:13) and P8: 5'
CTAATTGAGCTGTATCAGGATC 3'. (SEQ ID NO:14)
[0430] FIG. 18 also shows the location of the following primers
along the toxin B gene: P9 which consists of the sequence 5'
CGGAATTCCTAGAAAAAATGGCAA ATG 3' (SEQ ID NO:15); P10 which consists
of the sequence 5' GCTCTAGAATGA CCATAAGCTAGCCA 3' (SEQ ID NO:16);
P11 which consists of the sequence 5' CGGAATTCGAGTTGGTAGAAAGGTGGA
3' (SEQ ID NO: 17); P13 which consists of the sequence 5'
CGGAATTCGGTTATTATCTTAAGGATG 3' (SEQ ID NO:18); and P14 which
consists of the sequence 5' CGGAATTCTTGATAACTGGAT TTGTGAC 3' (SEQ
ID NO:19). The amino acid sequence consisting of amino acid
residues 1852 through 2362 of toxin B is listed in SEQ ID NO:20.
The amino acid sequence consisting of amino acid residues 1755
through 2362 of toxin B is listed in SEQ ID NO:21.
[0431] Clostridium difficile VPI strain 10463 was obtained from the
American Type Culture Collection (ATCC 43255) and grown under
anaerobic conditions in brain-heart infusion medium (Becton
Dickinson). High molecular-weight C. difficile DNA was isolated
essentially as described [Wren and Tabaqchali (1987) J. Clin.
Microbiol., 25:2402], except 1) 100 .mu.g/ml proteinase K in 0.5%
SDS was used to disrupt the bacteria and 2) cetytrimethylammoniun
bromide (CTAB) precipitation [as described by Ausubel et al, Eds.,
Current Protocols in Molecular Biology, Vol. 2 (1989) Current
Protocols] was used to remove carbohydrates from the cleared
lysate. Briefly, after disruption of the bacteria with proteinase K
and SDS, the solution is adjusted to approximately 0.7 M NaCl by
the addition of a {fraction (1/7)} volume of 5M NaCl. A {fraction
(1/10)} volume of CTAB/NaCl (10% CTAB in 0.7 M NaCl) solution was
added and the solution was mixed thoroughly and incubated 10 min at
65.degree. C. An equal volume of chloroform/isoamyl alcohol (24:1)
was added and the phases were thoroughly mixed. The organic and
aqueous phases were separated by centrifugation in a microfuge for
5 min. The aqueous supernatant was removed and extracted with
phenol/chloroform/isoamyl alcohol (25:24:1). The phases were
separated by centrifugation in a microfuge for 5 min. The
supernatant was transferred to a fresh tube and the DNA was
precipitated with isopropanol. The DNA precipitate was pelleted by
brief centrifugation in a microfuge. The DNA pellet was washed with
70% ethanol to remove residual CTAB. The DNA pellet was then dried
and redissolved in TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA).
The integrity and yield of genomic DNA was assessed by comparison
with a serial dilution of uncut lambda DNA after electrophoresis on
an agarose gel.
[0432] Toxin B fragments were cloned by PCR utilizing a
proofreading thermostable DNA polymerase [native Pfu polymerase
(Stratagene)]. The high fidelity of this polymerase reduces the
mutation problems associated with amplification by error prone
polymerases (e.g., Taq polymerase). PCR amplification was performed
using the PCR primer pairs P5 (SEQ ID NO:11) with P6 (SEQ ID NO:12)
and P7 (SEQ ID NO: 13) with P8 (SEQ ID NO:14) in 50 .mu.l reactions
containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl.sub.2, 200
.mu.M of each dNTP, 0.2 .mu.M each primer, and 50 ng C. difficile
genomic DNA. Reactions were overlaid with 100 .mu.l mineral oil,
heated to 94.degree. C. for 4 min, 0.5 .mu.l native Pfu polymerase
(Stratagene) was added, and the reactions were cycled 30 times at
94.degree. C. for 1 min, 50.degree. C. for 1 min, 72.degree. C. (2
min for each kb of sequence to be amplified), followed by 10 min at
72.degree. C. Duplicate reactions were pooled, chloroform
extracted, and ethanol precipitated. After washing in 70% ethanol,
the pellets were resuspended in 50 .mu.l TE buffer (10 mM Tris-HCl
pH 8.0, 1 mM EDTA).
[0433] The P5/P6 amplification product was cloned into pUC19 as
outlined below. 10 .mu.l aliquots of DNA were gel purified using
the Prep-a-Gene kit (BioRad), and ligated to SmaI restricted pUC19
vector. Recombinant clones were isolated and confirmed by
restriction digestion using standard recombinant molecular biology
techniques (Sambrook et al., 1989). Inserts from two independent
isolates were identified in which the toxin B insert was oriented
such that the vector BamHI and SacI sites were 5' and 3' oriented,
respectively (pUCB10-1530). The insert-containing BamHI/SacI
fragment was cloned into similarly cut pET23a-c vector DNA, and
protein expression was induced in small scale cultures (5 ml) of
identified clones.
[0434] Total protein extracts were isolated, resolved on SDS-PAGE
gels, and toxin B protein identified by Western analysis utilizing
a goat anti-toxin B affinity purified antibody (Tech Lab).
Procedures for protein induction, SDS-PAGE, and Western blot
analysis were performed as described in Williams et al. (1995),
supra. In brief, 5 ml cultures of bacteria grown in 2XYT containing
100 .mu.g/ml ampicillin containing the appropriate recombinant
clone were induced to express recombinant protein by addition of
IPTG to 1 mM. The E. coli hosts used were: BL21(DE3) or
BL21(DE3)LysS (Novagen) for pET plasmids.
[0435] Cultures were induced by the addition of IPTG to a final
concentration of 1.0 mM when the cell density reached 0.5
OD.sub.600, and induced protein was allowed to accumulate for two
hrs after induction. Protein samples were prepared by pelleting 1
ml aliquots of bacteria by centrifugation (1 min in microfuge), and
resuspension of the pelleted bacteria in 150 .mu.l of 2.times.
SDS-PAGE sample buffer (0.125 mM Tris-HCl pH 6.8, 2 mM EDTA, 6%
SDS, 20% glycerol, 0.025% bromophenol blue; .beta.-mercaptoethanol
is added to 5% before use). The samples were heated to 95.degree.
C. for 5 min, then cooled and 5 or 10 .mu.ls loaded on 7.5%
SDS-PAGE gels. High molecular weight protein markers (BioRad) were
also loaded, to allow estimation of the MW of identified fusion
proteins. After electrophoresis, protein was detected either
generally by staining the gels with Coomassie Blue, or
specifically, by blotting to nitrocellulose for Western blot
detection of specific immunoreactive protein. The MW of induced
toxin B reactive protein allowed the integrity of the toxin B
reading frame to be determined.
[0436] The pET23b recombinant (pPB10-1530) expressed high MW
recombinant toxin B reactive protein, consistent with predicted
values. This confirmed that frame terminating errors had not
occurred during PCR amplification. A pET23b expression clone
containing the 10-1750aa interval of the toxin B gene was
constructed, by fusion of the EcoRV-SpeI fragment of the P7/P8
amplification product to the P5-EcoRV interval of the P5/P6
amplification product (see FIG. 18) in pPB10-1530. The integrity of
this clone (pPB10-1750) was confirmed by restriction mapping, and
Western blot detection of expressed recombinant toxin B protein.
Levels of induced protein from both pPB10-1530 and pPB10-1750 were
too low to facilitate purification of usable amounts of recombinant
toxin B protein. The remaining 1750-2360 aa interval was directly
cloned into pMAL or pET expression vectors from the P7/P8
amplification product as described below.
[0437] b) Expression of the Toxin B Gene
[0438] i) Overview of Expression Methodologies
[0439] Fragments of the toxin B gene were expressed as either
native or fusion proteins in E. coli. Native proteins were
expressed in either the pET23a-c or pET16b expression vectors
(Novagen). The pET23 vectors contain an extensive polylinker
sequence in all three reading frames (a-c vectors) followed by a
C-terminal poly-histidine repeat. The pET16b vector contains a
N-terminal poly-histidine sequence immediately 5' to a small
polylinker. The poly-histidine sequence binds to Ni-Chelate columns
and allows affinity purification of tagged target proteins
[Williams et al. (1995), supra]. These affinity tags are small (10
aa for pET16b, 6 aa for pET23) allowing the expression and affinity
purification of native proteins with only limited amounts of
foreign sequences.
[0440] An N-terminal histidine-tagged derivative of pET16b
containing an extensive cloning cassette was constructed to
facilitate cloning of N-terminal poly-histidine tagged toxin B
expressing constructs. This was accomplished by replacement of the
promoter region of the pET23a and b vectors with that of the pET16b
expression vector. Each vector was restricted with BglII and NdeI,
and the reactions resolved on a 1.2% agarose gel. The pET16b
promoter region (contained in a 200 bp BglII-NdeI fragment) and the
promoter-less pET23 a or b vectors were cut from the gel, mixed and
Prep-A-Gene (BioRad) purified. The eluted DNA was ligated, and
transformants screened for promoter replacement by NcoI digestion
of purified plasmid DNA (the pET16b promoter contains this site,
the pET23 promoter does not). These clones (denoted pETHisa or b)
contain the pET16b promoter (consisting of a pT7-lac promoter,
ribosome binding site and poly-histidine (10aa) sequence) fused at
the NdeI site to the extensive pET23 polylinker.
[0441] All MBP fusion proteins were constructed and expressed in
the pMAL.TM.-c or pMAL.TM.-p2 vectors (New England Biolabs) in
which the protein of interest is expressed as a C-terminal fusion
with MBP. All pET plasmids were expressed in either the BL21(DE3)
or BL21(DE3)LysS expression hosts, while pMa1 plasmids were
expressed in the BL21 host.
[0442] Large scale (500 mls to 1 liter) cultures of each
recombinant were grown in 2.times.YT broth, induced, and soluble
protein fractions were isolated as described [Williams, et al.
(1995), supra]. The soluble protein extracts were affinity
chromatographed to isolate recombinant fusion protein, as described
[Williams et al., (1995) supra]. In brief, extracts containing
tagged pET fusions were chromatographed on a nickel chelate column,
and eluted using imidazole salts or low pH (pH 4.0) as described by
the distributor (Novagen or Qiagen). Extracts containing soluble
pMAL fusion protein were prepared and chromatographed in PBS buffer
over an amylose resin (New England Biolabs) column, and eluted with
PBS containing 10 mM maltose as described [Williams et al. (1995),
supra].
[0443] ii) Overview of Toxin B Expression
[0444] In both large expression constructs described in (a) above,
only low level (i.e., less than 1 mg/liter of intact or nondegraded
recombinant protein) expression of recombinant protein was
detected. A number of expression constructs containing smaller
fragments of the toxin B gene were then constructed, to determine
if small regions of the gene can be expressed to high levels (i.e.,
greater than 1 mg/liter intact protein) without extensive protein
degradation. All were constructed by in frame fusions of convenient
toxin B restriction fragments to either the pMAL-c, pET23a-c,
pET16b or pETHisa-b expression vectors, or by engineering
restriction sites at specific locations using PCR amplification
[using the same conditions described in (a) above]. In all cases,
clones were verified by restriction mapping, and, where indicated,
DNA sequencing.
[0445] Protein preparations from induced cultures of each of these
constructs were analyzed, by SDS-PAGE, to estimate protein
stability (Coomassie Blue stairung) and immunoreactivity against
anti-toxin B specific antiserum (Western analysis). Higher levels
of intact (i.e., nondegraded), full length fusion proteins were
observed with the smaller constructs as compared with the larger
recombinants, and a series of expression constructs spanning the
entire toxin B gene were constructed (FIGS. 18, 19 and 20 and Table
23).
[0446] Constructs that expressed significant levels of recombinant
toxin B protein (greater than 1 mg/liter intact recombinant
protein) in E coli were identified and a series of these clones
that spans the toxin B gene are shown in FIG. 19 and summarized in
Table 23. These clones were utilized to isolate pure toxin B
recombinant protein from the entire toxin B gene. Significant
protein yields were obtained from pMAL expression constructs
spanning the entire toxin B gene, and yields of full length soluble
fusion protein ranged from an estimated 1 mg/liter culture
(pMB1100-1530) to greater than 20 mg/liter culture
(pMB1750-2360).
[0447] Representative purifications of MBP and
poly-histidine-tagged toxin B recombinants are shown in FIGS. 21
and 22. FIG. 21 shows a Coomassie Blue stained 7.5% SDS-PAGE gel on
which various protein samples extracted from bacteria harboring
pMB1850-2360 were electrophoresed. Samples were loaded as follows:
Lane 1: protein extracted from uninduced culture; Lane 2: induced
culture protein; Lane 3: total protein from induced culture after
sonication; Lane 4: soluble protein; and Lane 5: eluted affinity
purified protein. FIG. 22 depicts the purification of recombinant
proteins expressed in bacteria harboring either pPB1850-2360 (Lanes
1-3) or pPB1750-2360 (Lanes 4-6). Samples were loaded as follows:
uninduced total protein (Lanes 1 and 4); induced total protein
(Lanes 2 and 5); and eluted affinity purified protein (Lanes 3 and
6). The broad range molecular weight protein markers (BioRad) are
shown in Lane 7.
[0448] Thus, although high level expression was not attained using
large expression constructs from the toxin B gene, usable levels of
recombinant protein were obtained by isolating induced protein from
a series of smaller pMAL expression constructs that span the entire
toxin B gene.
[0449] These results represent the first demonstration of the
feasibility of expressing recombinant toxin B protein to high
levels in E. coli. As well, expression of small regions of the
putative ligand binding domain (repeat region) of toxin B as native
protein yielded insoluble protein, while large constructs, or
fusions to MBP were soluble (FIG. 19), demonstrating that specific
methodologies are necessary to produce soluble fusion protein from
this interval.
[0450] iii) Clone Construction and Expression Details
[0451] A portion of the toxin B gene containing the toxin B repeat
region [amino acid residues 1852-2362 of toxin B (SEQ ID NO:20)]
was isolated by PCR amplification of this interval of the toxin B
gene from C. difficile genomic DNA. The sequence, and location
within the toxin B gene, of the two PCR primers [P7 (SEQ ID NO:13)
and P8 (SEQ ID NO: 14)] used to amplify this region are shown in
FIG. 18.
[0452] DNA from the PCR amplification was purified by chloroform
extraction and ethanol precipitation as described above. The DNA
was restricted with SpeI, and the cleaved DNA was resolved by
agarose gel electrophoresis. The restriction digestion with SpeI
cleaved the 3.6 kb amplification product into a 1.8 kb doublet
band. This doublet band was cut from the gel and mixed with
appropriately cut, gel purified pMALc or pET23b vector. These
vectors were prepared by digestion with HindIII, filling in the
overhanging ends using the Klenow enzyme, and cleaving with XbaI
(pMALc) or NheI (pET23b). The gel purified DNA fragments were
purified using the Prep-A-Gene kit (BioRad) and the DNA was
ligated, transformed and putative recombinant clones analyzed by
restriction mapping.
[0453] pET and pMa1 clones containing the toxin B repeat insert (aa
interval 1750-2360 of toxin B) were verified by restriction
mapping, using enzymes that cleaved specific sites within the toxin
B region. In both cases fusion of the toxin B SpeI site with either
the compatible XbaI site (pMa1) or compatible NheI site (pET) is
predicted to create an in frame fusion. This was confirmed in the
case of the pMB1750-2360 clone by DNA sequencing of the clone
junction and 5' end of the toxin B insert using a MBP specific
primer (New England Biolabs). In the case of the pET construct, the
fusion of the blunt ended toxin B 3' end to the filled HindIII site
should create an in-frame fusion with the C-terminal poly-histidine
sequence in this vector. The pPB1750-2360 clone selected had lost,
as predicted, the HindIII site at this clone junction; this
eliminated the possibility that an additional adenosine residue was
added to the 3' end of the PCR product by a terminal transferase
activity of the Pfu polymerase, since fusion of this adenosine
residue to the filled HindIII site would regenerate the restriction
site (and was observed in several clones).
[0454] One liter cultures of each expression construct were grown,
and fusion protein purified by affinity chromatography on either an
amylose resin column (pMAL constructs; resin supplied by New
England Biolabs) or Ni-chelate column (pET constructs; resin
supplied by Qiagen or Novagen) as described [Williams et al.
(1995), supra]. The integrity and purity of the fusion proteins
were determined by Coomassie staining of SDS-PAGE protein gels as
well as Western blot analysis with either an affinity purified goat
polyclonal antiserum (Tech Lab), or a chicken polyclonal PEG prep,
raised against the toxin B protein (CTB) as described above in
Example 8. In both cases, affinity purification resulted in yields
in excess of 20 mg protein per liter culture, of which greater than
90% was estimated to be full-length recombinant protein. It should
be noted that the poly-histidine affinity tagged protein was
released from the Qiagen Ni-NTA resin at low imidazole
concentration (60 mM), necessitating the use of a 40 mM imidazole
rather than a 60 mM imidazole wash step during purification.
[0455] A periplasmically secreted version of pMB1750-2360 was
constructed by replacement of the promoter and MBP coding region of
this construct with that from a related vector (pMAL.TM.-p2; New
England Biolabs) in which a signal sequence is present at the
N-terminus of the MBP, such that fusion protein is exported. This
was accomplished by substituting a BglII-EcoRV promoter fragment
from pMAL-p2 into pMB1750-2360. The yields of secreted, affinity
purified protein (recovered from osmotic shock extracts as
described by Riggs in Current Protocols in Molecular Biology, Vol.
2, Ausubel, et al., Eds. (1989), Current Protocols, pp.
16.6.1-16.6.14] from this vector (pMBp1750-2360) were 6.5 mg/liter
culture, of which 50% was estimated to be full-length fusion
protein.
[0456] The interval was also expressed in two non-overlapping
fragments. pMB1750-1970 was constructed by introduction of a
frameshift into pMB1750-2360, by restriction with HindIII, filling
in the overhanging ends and religation of the plasmid. Recombinant
clones were selected by loss of the HindIII site, and further
restriction map analysis. Recombinant protein expression from this
vector was more than 20 mg/liter of greater than 90% pure
protein.
[0457] The complementary region was expressed in pMB1970-2360. This
construct was created by removal of the 1750-1970 interval of
pMB1750-2360. This was accomplished by restriction of this plasmid
with EcoRI (in the pMa1c polylinker 5' to the insert) and III,
filling in the overhanging ends, and religation of the plasmid. The
resultant plasmid, pMB1970-2360, was made using both
intracellularly and secreted versions of the pMB1750-2360
vector.
[0458] No fusion protein was secreted in the pMBp1970-2360 version,
perhaps due to a conformational constraint that prevents export of
the fusion protein. However, the intracellularly expressed vector
produced greater than 40 mg/liter of greater than 90% full-length
fusion protein.
[0459] Constructs to precisely express the toxin B repeats in
either pMa1c (pMB1850-2360) or pET16b (pPB1850-2360) were
constructed as follows. The DNA interval including the toxin B
repeats was PCR amplified as described above utilizing PCR primers
P14 (SEQ ID NO:19) and P8 (SEQ ID NO:14). Primer P14 adds a EcoRI
site immediately flanking the start of the toxin B repeats.
[0460] The amplified fragment was cloned into the pT7 Blue T-vector
(Novagen) and recombinant clones in which single copies of the PCR
fragment were inserted in either orientation were selected
(pT71850-2360) and confirmed by restriction mapping. The insert was
excised from two appropriately oriented independently isolated
pT71850-2360 plasmids, with EcoRI (5' end of repeats) and PstI (in
the flanking polylinker of the vector), and cloned into EcoRI/PstI
cleaved pMa1c vector. The resulting construct (pMB1850-2360) was
confirmed by restriction analysis, and yielded 20 mg/l of soluble
fusion protein [greater than 90% intact (i.e., nondegraded)] after
affinity chromatography. Restriction of this plasmid with HindIII
and religation of the vector resulted in the removal of the
1970-2360 interval. The resultant construct (pMB1850-1970)
expressed greater than 70 mg/liter of 90% full length fusion
protein.
[0461] The pPB1850-2360 construct was made by cloning a EcoRI
(filled with Klenow)-BamHI fragment from a pT71850-2360 vector
(opposite orientation to that used in the pMB1850-2360
construction) into NdeI (filled)/BamHI cleaved pET16b vector.
Yields of affinity purified soluble fusion protein were 15
mg/liter, of greater than 90% full length fusion protein.
[0462] Several smaller expression constructs from the 1750-2070
interval were also constructed in His-tagged pET vectors, but
expression of these plasmids in the BL21 (DE3) host resulted in the
production of high levels of mostly insoluble protein (see Table 23
and FIG. 19). These constructs were made as follows. pPB1850-1970
was constructed by cloning a BglII-HindIII fragment of pPB1850-2360
into BglII/HindIII cleaved pET23b vector. pPB1850-2070 was
constructed by cloning a BglII-PvuII fragment of pPB1850-2360 into
BglII/HincII cleaved pET23b vector. pPB1750-1970(c) was constructed
by removal of the internal HindIII fragment of a pPB1750-2360
vector in which the vector HindIII site was regenerated during
cloning (presumably by the addition of an A residue to the
amplified PCR product by terminal transferase activity of Pfu
polymerase). The pPB1750-1970(n) construct was made by insertion of
the insert containing the NdeI-HindIII fragment of pPB1750-2360
into identically cleaved pETHisb vector. All constructs were
confirmed by restriction digestion.
[0463] An expression construct that directs expression of the
10-470 aa interval of toxin B was constructed in the pMa1c vector
as follows. A NheI (a site 5' to the insert in the pET23
vector)-AfII (filled) fragment of the toxin B gene from pPB 10-1530
was cloned into XbaI (compatible with NheI)/HindIII (filled) pMa1c
vector. The integrity of the construct (pMB10-470) was verified by
restriction mapping and DNA sequencing of the 5' clone junction
using a MBP specific DNA primer (New England Biolabs). However, all
expressed protein was degraded to the MBP monomer MW.
[0464] A second construct spanning this interval (aa 10-470) was
constructed by cloning the PCR amplification product from a
reaction containing the P9 (SEQ ID NO:15) and P10 (SEQ ID NO:16)
primers (FIG. 18) into the pETHisa vector. This was accomplished by
cloning the PCR product as an EcoRI-blunt fragment into
EcoRI-HincII restricted vector DNA; recombinant clones were
verified by restriction mapping. Although this construct
(pPB10-520) allowed expression and purification (utilizing the
N-terminal polyhistidine affinity tag) of intact fusion protein,
yields were estimated at less than 500 .mu.g per liter culture.
[0465] Higher yield of recombinant protein from this interval (aa
10-520) were obtained by expression of the interval in two
overlapping clones. The 10-330aa interval was cloned in both
pETHisa and pMa1c vectors, using the BamHI-AfIII (filled) DNA
fragment from pPB10-520. This fragment was cloned into
BamHI-HindIII (filled) restricted pMa1c or BamHI-HincII restricted
pETHisa vector. Recombinant clones were verified by restriction
mapping. High level expression of either insoluble (pET) or soluble
(pMa1) fusion protein was obtained. Total yields of fusion protein
from the pMB10-330 construct (FIG. 18) were 20 mg/liter culture, of
which 10% was estimated to be full-length fusion protein. Although
yields of this interval were higher and >90% full-length
recombinant protein produced when expressed from the pET construct,
the pMa1 fusion was utilized since the expressed protein was
soluble and thus more likely to have the native conformation.
[0466] The pMB260-520 clone was constructed by cloning EcoRI-XbaI
cleaved amplified DNA from a PCR reaction containing the P11 (SEQ
ID NO:17) and P10 (SEQ ID NO:16) DNA primers (FIG. 18) into
similarly restricted pMa1c vector. Yields of affinity purified
protein were 10 mg/liter, of which approximately 50% was estimated
to be full-length recombinant protein.
[0467] The aa510-1110 interval was expressed as described below.
This entire interval was expressed as a pMa1 fusion by cloning the
NheI-HindIII fragment of pUCB10-1530 into XbaI-HindIII cleaved
pMa1c vector. The integrity of the construct (pMB510-1110) was
verified by restriction mapping and DNA sequencing of the 5' clone
junction using a MBP specific DNA primer. The yield of affinity
purified protein was 25 mg/liter culture, of which 5% was estimated
to be full-length fusion protein (1 mg/liter).
[0468] To attempt to obtain higher yields, this region was
expressed in two fragments (aa510-820, and 820-1110) in the pMa1c
vector. The pMB510-820 clone was constructed by insertion of a SacI
(in the pMa1c polylinker 5' to the insert)-HpaI DNA fragment from
pMB510-1110 into SacI/StuI restricted pMa1c vector. The pMB820-1110
vector was constructed by insertion of the HpaI-HindIII fragment of
pUCB10-1530 into BamHI (filled)/HindIII cleaved pMa1c vector. The
integrity of these constructs were verified by restriction mapping
and DNA sequencing of the 5' clone junction using a MBP specific
DNA primer.
[0469] Recombinant protein expressed from the pMB510-820 vector was
highly unstable. However, high levels (20 mg/liter) of >90%
full-length fusion protein were obtained from the pMB820-1105
construct. The combination of partially degraded pMB510-1110
protein (enriched for the 510-820 interval) with the pMB820-1110
protein provides usable amounts of recombinant antigen from this
interval.
[0470] The aa1100-1750 interval was expressed as described below.
The entire interval was expressed in the pMa1c vector from a
construct in which the AccI(filled)-SpeI fragment of pPB10-1750 was
inserted into StuI/XbaI (XbaI is compatible with SpeI; StuI and
filled AccI sites are both blunt ended) restricted pMa1c. The
integrity of this construct (pMB1100-1750) was verified by
restriction mapping and DNA sequencing of the clone junction using
a MBP specific DNA primer. Although 15 mg/liter of affinity
purified protein was isolated from cells harboring this construct,
the protein was greater than 99% degraded to MBP monomer size.
[0471] A smaller derivative of pMB1100-1750 was constructed by
restriction of pMB1100-1750 with AfII and SalI (in the pMa1c
polylinker 3' to the insert), filling in the overhanging ends, and
religating the plasmid. The resultant clone (verified by
restriction digestion and DNA sequencing) has deleted the
aa1530-1750 interval, was designated pMB1100-1530. pMB1100-1530
expressed recombinant protein at a yield of greater than 40
mg/liter, of which 5% was estimated to be full-length fusion
protein.
[0472] Three constructs were made to express the remaining
interval. Initially, a BspHI (filled)-SpeI fragment from pPB10-1750
was cloned into EcoRI(filled)/XbaI cleaved pMa1c vector. The
integrity of this construct (pMB1570-1750) was verified by
restriction mapping and DNA sequencing of the 5' clone junction
using a MBP specific DNA primer. Expression of recombinant protein
from this plasmid was very low, approximately 3 mg affinity
purified protein per liter, and most was degraded to MBP monomer
size. This region was subsequently expressed from a PCR amplified
DNA fragment. A PCR reaction utilizing primers P13 [SEQ ID NO:18;
P13 was engineered to introduce an EcoRI site 5' to amplified toxin
B sequences] and P8 (SEQ ID NO: 14) was performed on C. difficile
genomic DNA as described above. The amplified fragment was cleaved
with EcoRI and SpeI, and cloned into EcoRI/XbaI cleaved pMa1c
vector. The resultant clone (pMB1530-1750) was verified by
restriction map analysis, and recombinant protein was expressed and
purified. The yield was greater than 20 mg protein per liter
culture and it was estimated that 25% was full-length fusion
protein; this was a significantly higher yield than the original
pMB1570-1750 clone: The insert of pMB1530-1750 (in a EcoRI-SalI
fragment) was transferred to the pETHisa vector (EcoRI/XhoI
cleaved, XhoI and SalI ends are compatible). No detectable fusion
protein was purified on Ni-Chelate columns from soluble lysates of
cells induced to express fusion protein from this construct.
24TABLE 23 Summary Of Toxin B Expression Constructs.sup.a Clone
Affinity Tag Yield (mg/liter) % Full Length pPB10-1750 none low
(estimated from ? Western blot hyb) pPB10-1530 none low (as above)
? pMB10-470 MBP 15 mg/l 0% pPB10-520 poly-his 0.5 mg/l 20%
pPB10-330 poly-his >20 mg/l (insoluble) 90% pMB10-330 MBP 20
mg/l 10% pMB260-520 MBP 10 mg/l 50% pMB510-1110 MBP 25 mg/l 5%
pMB510-820 MBP degraded (by Western blot hyb) pMB820-1110 MBP 20
mg/l 90% pMB1100-1750 MBP 15 mg/l 0% pMB1100-1530 MBP 40 mg/l 5%
pMB1570-1750 MBP 3 mg/l <5% pPB1530-1750 poly-his no purified
protein ? detected pMB1530-1750 MBP 20 mg/l 25% pMB1750-2360 MBP
>20 mg/l >90% pMBp1750-2360 MBP 6.5 mg/l (secreted) 50%
pPB1750-2360 poly-his >20 mg/l >90% pMB1750-1970 MBP >20
mg/l >90% pMB1970-2360 MBP 40 mg/l >90% pMBp1970-2360 MBP (no
secretion) NA pMB1850-2360 MBP 20 mg/l >90% pPB1850-2360
poly-his 15 mg/l >90% pMB1850-1970 MBP 70 mg/l >90%
pPB1850-1970 poly-his >10 mg/l (insoluble) >90% pPB1850-2070
poly-his >10 mg/l (insoluble) >90% pPB1750-1970(c) poly-his
>10 mg/l (insoluble) >90% pPB1750-1970(n) poly-his >10
mg/l (insoluble) >90% .sup.aClones in italics are clones
currently utilized to purify recombinant protein from each selected
interval.
EXAMPLE 19
Identification, Purification and Induction of Neutralizing
Antibodies Against Recombinant C. difficile Toxin B Protein
[0473] To determine whether recombinant toxin B polypeptide
fragments can generate neutralizing antibodies, typically animals
would first be immunized with recombinant proteins and
anti-recombinant antibodies are generated. These anti-recombinant
protein antibodies are then tested for neutralizing ability in vivo
or in vitro. Depending on the immunogenic nature of the recombinant
polypeptide, the generation of high-titer antibodies against that
protein may take several months. To accelerate this process and
identify which recombinant polypeptide(s) may be the best candidate
to generate neutralizing antibodies, depletion studies were
performed. Specifically, recombinant toxin B polypeptide were
pre-screened by testing whether they have the ability to bind to
protective antibodies from a CTB antibody preparation and hence
deplete those antibodies of their neutralizing capacity. Those
recombinant polypeptides found to bind CTB, were then utilized to
generate neutralizing antibodies. This Example involved: a)
identification of recombinant sub-regions within toxin B to which
neutralizing antibodies bind; b) identification of toxin B
sub-region specific antibodies that neutralize toxin B in vivo; and
c) generation and evaluation of antibodies reactive to recombinant
toxin B polypeptides.
[0474] a) Identification of Recombinant Sub-Regions Within Toxin B
to which Neutralizing Antibodies Bind
[0475] Sub-regions within toxin B to which neutralizing antibodies
bind were identified by utilizing recombinant toxin B proteins to
deplete protective antibodies from a polyclonal pool of antibodies
against native C. difficile toxin B. An in vivo assay was developed
to evaluate protein preparations for the ability to bind
neutralizing antibodies. Recombinant proteins were first pre-mixed
with antibodies directed against native toxin B (CTB antibody; see
Example 8) and allowed to react for one hour at 37.degree. C.
Subsequently, C. difficile toxin B (CTB; Tech Lab) was added at a
concentration lethal to hamsters and incubated for another hour at
37.degree. C. After incubation this mixture was injected
intraperitoneally (IP) into hamsters. If the recombinant
polypeptide contains neutralizing epitopes, the CTB antibodies will
lose its ability to protect the hamsters against death from CTB. If
partial or complete protection occurs with the CTB
antibody-recombinant mixture, that recombinant contains only weak
or non-neutralizing epitopes of toxin B. This assay was performed
as follows.
[0476] Antibodies against CTB were generated in egg laying Leghorn
hens as described in Example 8. The lethal dosage (LD.sub.100) of
C. difficile toxin B when delivered I.P. into 40 g female Golden
Syrian hamsters (Charles River) was determined to be 2.5 to 5
.mu.g. Antibodies generated against CTB and purified by PEG
precipitation could completely protect the hamsters at the I.P.
dosage determined above. The minimal amount of CTB antibody needed
to afford good protection against 5 .mu.g of CTB when injected I.P.
into hamsters was also determined (1.times.PEG prep). These
experiments defined the parameters needed to test whether a given
recombinant protein could deplete protective CTB antibodies.
[0477] The cloned regions tested for neutralizing ability cover the
entire toxin B gene and were designated as Intervals (INT) 1
through 5 (see FIG. 19). Approximately equivalent final
concentrations of each recombinant polypeptide were tested. The
following recombinant polypeptides were used: 1) a mixture of
intervals 1 and 2 (INT-1,2); 2) a mixture of Intervals 4 and 5
(INT-4, 5) and 3) Interval 3 (INT-3). Recombinant proteins (each at
about 1 mg total protein) were first preincubated with a final CTB
antibody concentration of 1.times. [i.e., pellet dissolved in
original yolk volume as described in Example 1(c)] in a final
volume of 5 mls for 1 hour at 37.degree. C. Twenty-five .mu.g of
CTB (at a concentration of 5 .mu.g/ml), enough CTB to kill 5
hamsters, was then added and the mixture was then incubated for 1
hour at 37.degree. C. Five, 40 g female hamsters (Charles River) in
each treatment group were then each given 1 ml of the mixture I.P.
using a tuberculin syringe with a 27 gauge needle. The results of
this experiment are shown in Table 24.
25TABLE 24 Binding Of Neutralizing Antibodies By INT 3 Protein
Number Of Number Of Treatment Group.sup.1 Animals Alive Animals
Dead CTB antibodies 3 2 CTB antibodies + INT1, 2 3 2 CTB antibodies
+ INT4, 5 3 2 CTB antibodies + INT 3 0 5 .sup.1C. difficile toxin B
(CTB) was added to each group.
[0478] As shown in Table 24, the addition of recombinant proteins
from INT-1, 2 or INT-4, 5 had no effect on the in vivo protective
ability of the CTB antibody preparation compared to the CTB
antibody preparation alone. In contrast, INT-3 recombinant
polypeptide was able to remove all of the toxin B neutralizing
ability of the CTB antibodies as demonstrated by the death of all
the hamsters in that group.
[0479] The above experiment was repeated, using two smaller
expressed fragments (pMB 1750-1970 and pMB 1970-2360, see FIG. 19)
comprising the INT-3 domain to determine if that domain could be
further subdivided into smaller neutralizing epitopes. In addition,
full-length INT-3 polypeptide expressed as a nickel tagged protein
(pPB1750-2360) was tested for neutralizing ability and compared to
the original INT-3 expressed MBP fusion (pMB1750-2360). The results
are shown in Table 25.
26TABLE 25 Removal Of Neutralizing Antibodies By Repeat Containing
Proteins Number Of Number Of Treatment Group.sup.1 Animals Alive
Animals Dead CTB antibodies 5 0 CTB antibodies + pPB1750-2360 0 5
CTB antibodies + pMB1750-2360 0 5 CTB antibodies + pMB1970-2360 3 2
CTB antibodies + pMB1750-1970 2 3 .sup.1C. difficile toxin B (CTB)
was added to each group.
[0480] The results summarized in Table 25 indicate that the smaller
polypeptide fragments within the INT-3 domain, pMB1750-1970 and
pMB1970-2360, partially lose the ability to bind to and remove
neutralizing antibodies from the CTB antibody pool. These results
demonstrate that the full length INT-3 polypeptide is required to
completely deplete the CTB antibody pool of neutralizing
antibodies. This experiment also shows that the neutralization
epitope of INT-3 can be expressed in alternative vector systems and
the results are independent of the vector utilized or the
accompanying fusion partner.
[0481] Other Interval 3 specific proteins were subsequently tested
for the ability to remove neutralizing antibodies within the CTB
antibody pool as described above. The Interval 3 specific proteins
used in these studies are summarized in FIG. 23. In FIG. 23 the
following abbreviations are used: pP refers to the pET23 vector; pM
refers to the pMALc vector; B refers to toxin B; the numbers refer
to the amino acid interval expressed in the clone. The solid black
ovals represent the MBP; and HHH represents the poly-histidine tag.
Only recombinant proteins comprising the entire toxin B repeat
domain (pMB1750-2360, pPB1750-2360 and pPB1850-2360) can bind and
completely remove neutralizing antibodies from the CTB antibody
pool. Recombinant proteins comprising only a portion of the toxin B
repeat domain were not capable of completely removing neutralizing
antibodies from the CTB antibody pool (pMB1750-1970 and
pMB1970-2360 could partially remove neutralizing antibodies while
pMB1850-1970 and pPB1850-2070 failed to remove any neutralizing
antibodies from the CTB antibody pool).
[0482] The above results demonstrate that only the complete ligand
binding domain (repeat region) of the toxin B gene can bind and
completely remove neutralizing antibodies from the CTB antibody
pool. These results demonstrate that antibodies directed against
the entire toxin B repeat region are necessary for in vivo toxin
neutralization (see FIG. 23; only the recombinant proteins
expressed by the pMB1750-2360, pPB1750-2360 and pPB1850-2360
vectors are capable of completely removing the neutralizing
antibodies from the CTB antibody pool).
[0483] These results represent the first indication that the entire
repeat region of toxin B would be necessary for the generation of
antibodies capable of neutralizing toxin B, and that sub-regions
may not be sufficient to generate maximal titers of neutralizing
antibodies.
[0484] b) Identification of Toxin B Sub-Region Specific Antibodies
that Neutralize Toxin B In Vivo
[0485] To determine if antibodies directed against the toxin B
repeat region are sufficient for neutralization, region specific
antibodies within the CTB antibody preparation were affinity
purified, and tested for in vivo neutralization. Affinity columns
containing recombinant toxin B repeat proteins were made as
described below. A separate affinity column was prepared using each
of the following recombinant toxin B repeat proteins: pPB750-2360,
pPB850-2360, pMB1750-1970 and pMB1970-2360.
[0486] For each affinity column to be made, four ml of PBS-washed
Actigel resin (Sterogene) was coupled overnight at room temperature
with 5-10 mg of affinity purified recombinant protein (first
extensively dialyzed into PBS) in 15 ml tubes (Falcon) containing a
{fraction (1/10)} final volume Ald-coupling solution (1 M sodium
cyanoborohydride). Aliquots of the supernatants from the coupling
reactions, before and after coupling, were assessed by Coomassie
staining of 7.5% SDS-PAGE gels. Based on protein band intensities,
in all cases greater than 30% coupling efficiencies were estimated.
The resins were poured into 10 ml columns (BioRad), washed
extensively with PBS, pre-eluted with 4M guanidine-HCl (in 10 mM
Tris-HCl, pH 8.0) and reequilibrated in PBS. The columns were
stored at 4.degree. C.
[0487] Aliquots of a CTB IgY polyclonal antibody preparation (PEG
prep) were affinity purified on each of the four columns as
described below. The columns were hooked to a UV monitor (ISCO),
washed with PBS and 40 ml aliquots of a 2.times. PEG prep (filter
sterilized using a 0.45.mu. filter) were applied. The columns were
washed with PBS until the baseline value was re-established. The
columns were then washed with BBStween to elute nonspecifically
binding antibodies, and reequilibrated with PBS. Bound antibody was
eluted from the column in 4M guanidine-HCl (in 10 nM Tris-HCl, pH
8.0). The eluted antibody was immediately dialyzed against a
100-fold excess of PBS at 4.degree. C. for 2 hrs. The samples were
then dialyzed extensively against at least 2 changes of PBS, and
affinity purified antibody was collected and stored at 4.degree. C.
The antibody preparations were quantified by UV absorbance. The
elution volumes were in the range of 4-8 ml. All affinity purified
stocks contained similar total antibody concentrations, ranging
from 0.25-0.35% of the total protein applied to the columns.
[0488] The ability of the affinity purified antibody preparations
to neutralize toxin B in vivo was determined using the assay
outlined in a) above. Affinity purified antibody was diluted 1:1 in
PBS before testing. The results are shown in Table 26.
[0489] In all cases similar levels of toxin neutralization was
observed, such that lethality was delayed in all groups relative to
preimmune controls. This result demonstrates that antibodies
reactive to the repeat region of the toxin B gene are sufficient to
neutralize toxin B in vivo. The hamsters will eventually die in all
groups, but this death is maximally delayed with the CTB PEG prep
antibodies. Thus neutralization with the affinity purified (AP)
antibodies is not as complete as that observed with the CTB prep
before affinity chromatography. This result may be due to loss of
activity during guanidine denaturation (during the elution of the
antibodies from the affinity column) or the presence of antibodies
specific to other regions of the toxin B gene that can contribute
to toxin neutralization (present in the CTB PEG prep).
27TABLE 26 Neutralization Of Toxin B By Affinity Purified
Antibodies Number Number Animals Animals Treatment group.sup.a
Alive.sup.b Dead.sup.b Preimmune.sup.1 0 5 CTB.sup.1; 400 .mu.g 5 0
CTB (AP on pPB1750-2360);.sup.2 875 .mu.g 5 0 CTB (AP on
pMB1750-1970);.sup.2 875 .mu.g 5 0 CTB (AP on pMB1970-2360);.sup.2
500 .mu.g 5 0 .sup.aC. difficile toxin B (CTB) (Tech Lab; at 5
.mu.g/ml, 25 .mu.g total) at lethal concentration to hamsters is
added to antibody and incubated for one hour at 37.degree. C. After
incubation this mixture is injected intraperitoneally (IP) into
hamsters. Each treatment group # received toxin premixed with
antibody raised against the indicated protein, as either: .sup.14X
antibody PEG prep or .sup.2affinity purified (AP) antibody (from
CTB PEG prep, on indicated columns). The amount of specific
antibody in each prep is indicated; the amount is directly
determined for affinity purified preps and is estimated for the 4X
# CTB as described in Example 15. .sup.bThe numbers in each group
represent numbers of hamsters dead or alive, 2 hr post IP
administration of toxin/antibody mixture.
[0490] The observation that antibodies affinity purified against
the non-overlapping pMB1750-1970 and pMB1970-2360 proteins
neutralized toxin B raised the possibility that either 1)
antibodies specific to repeat sub-regions are sufficient to
neutralize toxin B or 2) sub-region specific proteins can bind most
or all repeat specific antibodies present in the. CTB polyclonal
pool. This would likely be due to conformational similarities
between repeats, since homology in the primary amino acid sequences
between different repeats is in the range of only 25-75%
[Eichel-Streiber, et al. (1992) Molec. Gen. Genetics 233:260].
These possibilities were tested by affinity chromatography.
[0491] The CTB PEG prep was sequentially depleted 2.times. on the
pMB1750-1970 column; only a small elution peak was observed after
the second chromatography, indicating that most reactive antibodies
were removed. This interval depleted CTB preparation was then
chromatographed on the pPB 1850-2360 column; no antibody bound to
the column. The reactivity of the CTB and CTB (pMB1750-1970
depleted) preps to pPB1750-2360, pPB1850-2360, pMB1750-1970 and
pMB1970-2360 proteins was then determined by ELISA using the
protocol described in Example 13(c). Briefly, 96-well microtiter
plates (Falcon, Pro-Bind Assay Plates) were coated with recombinant
protein by adding 100 .mu.l volumes of protein at 1-2 .mu.g/ml in
PBS containing 0.005% thimerosal to each well and incubating
overnight at 4.degree. C. The next morning, the coating suspensions
were decanted and the wells were washed three times using PBS. In
order to block non-specific binding sites, 100 .mu.l of 1.0% BSA
(Sigma) in PBS (blocking solution) was then added to each well, and
the plates were incubated for 1 hr. at 37.degree. C. The blocking
solution was decanted and duplicate samples of 150 .mu.l of diluted
antibody was added to the first well of a dilution series. The
initial testing serum dilution was ({fraction (1/200)} for CTB
prep, (the concentration of depleted CTB was standardized by
OD.sub.280) in blocking solution containing 0.5% Tween 20, followed
by 5-fold serial dilutions into this solution. This was
accomplished by serially transferring 30 .mu.l aliquots to 120
.mu.l buffer, mixing, and repeating the dilution into a fresh well.
After the final dilution, 30 .mu.l was removed from the well such
that all wells contained 120 .mu.l final volume. A total of 5 such
dilutions were performed (4 wells total). The plates were incubated
for 1 hr at 37.degree. C. Following this incubation, the serially
diluted samples were decanted and the wells were washed three times
using PBS containing 0.5% Tween 20 (PBST), followed by two 5 min
washes using BBS-Tween and a final three washes using PBST. To each
well, 100 .mu.l of {fraction (1/1000)} diluted secondary antibody
[rabbit anti-chicken IgG alkaline phosphatase (Sigma) diluted in
blocking solution containing 0.5% Tween 20] was added, and the
plate was incubated 1 hr at 37.degree. C. The conjugate solutions
were decanted and the plates were washed 6 times in PBST, then once
in 50 mM Na.sub.2CO.sub.3, 10 mM MgCl.sub.2, pH 9.5. The plates
were developed by the addition of 100 .mu.l of a solution
containing 1 mg/ml para-nitro phenyl phosphate (Sigma) dissolved in
50 mM Na.sub.2CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 to each well. The
plates were then incubated at room temperature in the dark for 5-45
min. The absorbency of each well was measured at 410 nm using a
Dynatech MR 700 plate reader.
[0492] As predicted by the affinity chromatography results,
depletion of the CTB prep on the pMB1750-1970 column removed all
detectable reactivity to the pMB1970-2360 protein. The reciprocal
purification of a CTB prep that was depleted on the pMB1970-2360
column yielded no bound antibody when chromatographed on the
pMB1750-1970 column. These results demonstrate that all repeat
reactive antibodies in the CTB polyclonal pool recognize a
conserved structure that is present in non-overlapping repeats.
Although it is possible that this conserved structure represents
rare conserved linear epitopes, it appears more likely that the
neutralizing antibodies recognize a specific protein conformation.
This conclusion was also suggested by the results of Western blot
hybridization analysis of CTB reactivity to these recombinant
proteins.
[0493] Western blots of 7.5% SDS-PAGE gels, loaded and
electrophoresed with defined quantities of each recombinant
protein, were probed with the CTB polyclonal antibody preparation.
The blots were prepared and developed with alkaline phosphatase as
described in Example 3. The results are shown in FIG. 24.
[0494] FIG. 24 depicts a comparison of immunoreactivity of IgY
antibody raised against either native or recombinant toxin B
antigen. Equal amounts of pMB1750-1970 (lane 1), pMB1970-2360 (lane
2), pPB1850-2360 (lane 3) as well as a serial dilution of
pPB1750-2360 (lanes 4-6 comprising 1.times., {fraction
(1/10)}.times. and {fraction (1/100)} amounts, respectively)
proteins were loaded in duplicate and resolved on a 7.5% SDS-PAGE
gel. The gel was blotted and each half was hybridized with PEG prep
IgY antibodies from chickens immunized with either native CTB or
pPB1750-2360 protein. Note that the full-length pMB1750-1970
protein was identified only by antibodies reactive to the
recombinant protein (arrows).
[0495] Although the CTB prep reacts with the pPB1750-2360,
pPB1850-2360, and pMB1970-2360 proteins, no reactivity to the
pMB1750-1970 protein was observed (FIG. 24). Given that all repeat
reactive antibodies can be bound by this protein during affinity
chromatography, this result indicates that the protein cannot fold
properly on Western blots. Since this eliminates all antibody
reactivity, it is unlikely that the repeat reactive antibodies in
the CTB prep recognize linear epitopes. This may indicate that in
order to induce protective antibodies, recombinant toxin B protein
will need to be properly folded. c) Generation and Evaluation of
Antibodies Reactive To Recombinant Toxin B Polypeptides
[0496] i) Generation of Antibodies Reactive to Recombinant Toxin B
Proteins
[0497] Antibodies against recombinant proteins were generated in
egg laying Leghorn hens as described in Example 13. Antibodies were
raised [using Freunds adjuvant (Gibco) unless otherwise indicated]
against the following recombinant proteins: 1) a mixture of
Interval 1+2 proteins (see FIG. 18); 2) a mixture of interval 4 and
5 proteins (see FIG. 18); 3) pMB1970-2360 protein; 4) pPB1750-2360
protein; 5) pMB1750-2360; 6) pMB1750-2360 [Titermax adjuvant
(Vaxcell)]; 7) pMB1750-2360 [Gerbu adjuvant (Biotech)]; 8)
pMBp1750-2360 protein; 9) pPB1850-2360; and 10) pMB1850-2360.
[0498] Chickens were boosted at least 3 times with recombinant
protein until ELISA reactivity [using the protocol described in b)
above with the exception that the plates were coated with
pPB1750-2360 protein] of polyclonal PEG preps was at least equal to
that of the CTB polyclonal antibody PEG prep. ELISA titers were
determined for the PEG preps from all of the above immunogens and
were found to be comparable ranging from 1:12500 to 1:62500. High
titers were achieved in all cases except in 6) pMB 1750-2360 in
which strong titers were not observed using the Titermax adjuvant,
and this preparation was not tested further.
[0499] ii) Evaluation of Antibodies Reactive to Recombinant
Proteins by Western Blot Hybridization
[0500] Western blots of 7.5% SDS-PAGE gels, loaded and
electrophoresed with defined quantities of recombinant protein
(pMB1750-1970, pPB1850-2360, and pMB1970-2360 proteins and a serial
dilution of the pPB1750-2360 to allow quantification of
reactivity), were probed with the CTB, pPB1750-2360, pMB1750-2360
and pMB1970-2360 polyclonal antibody preparations (from chickens
immunized using Freunds adjuvant). The blots were prepared and
developed with alkaline phosphatase as described above in b).
[0501] As shown in FIG. 24, the CTB and pMB1970-2360 preps reacted
strongly with the pPB1750-2360, pPB1850-2360, and pMB1970-2360
proteins while the pPB1750-2360 and pMB1970-2360 (Gerbu)
preparations reacted strongly with all four proteins. The Western
blot reactivity of the pPB1750-2360 and pMB1970-2360 (Gerbu)
preparations were equivalent to that of the CTB preparation, while
reactivity of the pMB1970-2360 preparation was <10% that of the
CTB prep. Despite equivalent ELISA reactivities only weak
reactivity (approximately 1%) to the recombinant proteins were
observed in PEG preps from two independent groups immunized with
the pMB1750-2360 protein and one group immunized with the
pMB1750-2360 preparation using Freunds adjuvant.
[0502] Affinity purification was utilized to determine if this
difference in immunoreactivity by Western blot analysis reflects
differing antibody titers. Fifty ml 2.times. PEG preparations from
chickens immunized with either pMB 1750-2360 or pMB1970-2360
protein were chromatographed on the pPB1750-2360 affinity column
from b) above, as described. The yield of affinity purified
antibody (% total protein in preparation) was equivalent to the
yield obtained from a CTB PEG preparation in b) above. Thus,
differences in Western reactivity reflect a qualitative difference
in the antibody pools, rather than quantitative differences., These
results demonstrate that certain recombinant proteins are more
effective at generating high affinity antibodies (as assayed by
Western blot hybridization).
[0503] iii) In Vivo Neutralization of Toxin B Using Antibodies
Reactive to Recombinant Protein
[0504] The in vivo hamster model [described in Examples 9 and
14(b)] was utilized to assess the neutralizing ability of
antibodies raised against recombinant toxin B proteins. The results
from three experiments are shown below in Tables 27-29.
[0505] The ability of each immunogen to neutralize toxin B in vivo
has been compiled and is shown in Table 30. As predicted from the
recombinant protein-CTB premix studies (Table 24) only antibodies
to Interval 3 (1750-2366) and not the other regions of toxin B
(i.e., intervals 1-5) are protective. Unexpectedly, antibodies
generated to INT-3 region expressed in pMAL vector (pMB1750-2360
and pMB1750-2360) using Freunds adjuvant were non-neutralizing.
This observation is reproducible, since no neutralization was
observed in two independent immunizations with pMB1750-2360 and one
immunization with pMB1750-2360. The fact that 5.times. quantities
of affinity purified toxin B repeat specific antibodies from
pMB1750-2360 PEG preps cannot neutralize toxin B while 1.times.
quantities of affinity purified anti-CTB antibodies can (Table 28)
demonstrates that the differential ability of CTB antibodies to
neutralize toxin B is due to qualitative rather than quantitative
differences in these antibody preparations. Only when this region
was expressed in an alternative vector (pPB1750-2360) or using an
alternative adjuvant with the pMB1750-2360 protein were
neutralizing antibodies generated. Importantly, antibodies raised
using Freunds adjuvant to pPB1850-2360, which contains a fragment
that is only 100 amino acids smaller than recombinant pPB1750-2360,
are unable to neutralize toxin B in vivo (Table 27); note also that
the same vector is used for both pPB1850-2360 and pPB1750-2360.
28TABLE 27 In Vivo Neutralization Of Toxin B Treatment Group.sup.a
Number Animals Alive.sup.b Number Animals Dead.sup.b Preimmune 0 5
CTB 5 0 INT1 + 2 0 5 INT 4 + 5 0 5 pMB1750-2360 0 5 pMB1970-2360 0
5 pPB1750-2360 5 0 .sup.aC. difficile toxin B (CTB) (at 5 .mu.g/ml;
25 .mu.g total; Tech Lab) at lethal concentration to hamsters is
added to antibody and incubated for one hour at 37.degree. C. After
incubation this mixture is injected intraperitoneally (IP) into
hamsters. Each treatment group received toxin premixed with
antibody raised against the indicated protein, as a 4X antibody PEG
prep. .sup.bThe numbers in each group represent numbers of hamsters
dead or alive, 2 hours post IP administration of toxin/antibody
mixture.
[0506]
29TABLE 28 In Vivo Neutralization Of Toxin B Using Affinity
Purified Antibodies Number Animals Number Animals Treatment
Group.sup.a Alive.sup.b Dead.sup.b Preimmune(1) 0 5 CTB(1) 5 0
pPB1750-2360(1) 5 0 1.5 mg anti-pMB1750-2360(2) 1 4 1.5 mg
anti-pMB1970-2360(2) 0 5 300 .mu.g anti-CTB(2) 5 0 .sup.aC.
difficile toxin B (CTB) (at 5 .mu.g/ml; 25 .mu.g total; Tech Lab)
at lethal concentration to hamsters is added to antibody and
incubated for one hour at 37.degree. C. After incubation, 1 ml of
this mixture is injected intraperitoneally (IP) into hamsters. Each
treatment group received toxin premixed with antibody raised
against the indicated protein, as # either (1) 4X antibody PEG prep
or (2) affinity purified antibody (on a pPB1750-2360 resin), either
1.5 mg/group (anti-pMB1750-2360 and anti-pMB1970-2360; used
undiluted affinity purified antibody) or 350 .mu.g/group (anti-CTB,
repeat specific; used 1/5 diluted anti-CTB antibody). .sup.bThe
numbers in each group represent numbers of hamsters dead or alive,
2 hr post-IP administration of toxin/antibody mixture.
[0507]
30TABLE 29 Generation Of Neutralizing Antibodies Utilizing The
Gerbu Adjuvant Number Animals Number Animals Treatment Group.sup.a
Alive.sup.b Dead.sup.b Preimmune 0 5 CTB 5 0 pMB1970-2360 0 5
pMB1850-2360 0 5 pPB1850-2360 0 5 pMB1750-2360 (Gerbu adj) 5 0
.sup.aC. difficile toxin B (CTB) (Tech Lab) at lethal concentration
to hamsters is added to antibody and incubated for one hour at
37.degree. C. After incubation this mixture is injected
intraperitoneally (IP) into hamsters. Each treatment group received
toxin premixed with antibody raised against the indicated protein,
as a 4X antibody PEG prep. .sup.bThe numbers in each group
represent numbers of hamsters dead or alive, 2 hrs post IP
administration of toxin/antibody mixture.
[0508]
31TABLE 30 In Vivo Neutralization Of Toxin B Antigen In vivo Tested
Utilized Neutral- Immunogen Adjuvant Preparation.sup.a For AP
ization.sup.b Preimmune NA.sup.1 PEG NA no CTB (native) Titermax
PEG NA yes CTB (native) Titermax AP pPB1750-2360 yes CTB (native)
Titermax AP pPB1850-2360 yes CTB (native) Titermax AP pPB1750-1970
yes CTB (native) Titermax AP pPB1970-2360 yes pMB1750-2360 Freunds
PEG NA no pMB1750-2360 Freunds AP pPB1750-2360 no pMB1750-2360
Gerbu PEG NA yes pMB1970-2360 Freunds PEG NA no pMB1970-2360
Freunds AP pPB1750-2360 no pPB1750-2360 Freunds PEG NA yes
pPB1850-2360 Freunds PEG NA no pMB1850-2360 Freunds PEG NA no INT 1
+ 2 Freunds PEG NA no INT 4 + 5 Freunds PEG NA no .sup.aEither PEG
preparation (PEG) or affinity purified antibodies (AP). .sup.b`Yes`
denotes complete neutralization (0/5 dead) while `no` denotes no
neutralization (5/5 dead) of toxin B, 2 hours post-administration
of mixture. .sup.1`NA` denotes not applicable.
[0509] The pPB1750-2360 antibody pool confers significant in vivo
protection, equivalent to that obtained with the affinity purified
CTB antibodies. This correlates with the observed high affinity of
this antibody pool (relative to the pMB 1750-2360 or pMB1970-2360
pools) as assayed by Western blot analysis (FIG. 24). These results
provide the first demonstration that in vivo neutralizing
antibodies can be induced using recombinant toxin B protein as
immunogen.
[0510] The failure of high concentrations of antibodies raised
against the pMB1750-2360 protein (using Freunds adjuvant) to
neutralize, while the use of Gerbu adjuvant and pMB1750-2360
protein generates a neutralizing response, demonstrates that
conformation or presentation of this protein is essential for the
induction of neutralizing antibodies. These results are consistent
with the observation that the neutralizing antibodies produced when
native CTB is used as an immunogen appear to recognize
conformational epitopes [see section b) above]. This is the first
demonstration that the conformation or presentation of recombinant
toxin B protein is essential to generate high titers of
neutralizing antibodies.
EXAMPLE 20
Determination of Quantitative and Qualitative Differences Between
pMB1750-2360, pMB1750-2360 (Gerbu) or pPB1750-2360 IgY Polyclonal
Antibody Preparations
[0511] In Example 19, it was demonstrated that toxin B neutralizing
antibodies could be generated using specific recombinant toxin B
proteins (pPB1750-2360) or specific adjuvants. Antibodies raised
against pMB1750-2360 were capable of neutralizing the enterotoxin
effect of toxin B when the recombinant protein was used to immunize
hens in conjunction with the Gerbu adjuvant, but not when Freunds
adjuvant was used. To determine the basis for these antigen and
adjuvant restrictions, toxin B-specific antibodies present in the
neutralizing and non-neutralizing PEG preparations were isolated by
affinity chromatography and tested for qualitative or quantitative
differences. The example involved a) purification of anti-toxin B
specific antibodies from pMB1750-2360 and pPB1750-2360 PEG
preparations and b) in vivo neutralization of toxin B using the
affinity purified antibody.
[0512] a) Purification of Specific Antibodies from pMB1750-2360 and
pPB1750-2360 PEG Preparations
[0513] To purify and determine the concentration of specific
antibodies (expressed as the percent of total antibody) within the
pPB1750-2360 (Freunds and Gerbu) and pPB1750-2360 PEG preparations,
defined quantities of these antibody preparations were
chromatographed on an affinity column containing the entire toxin B
repeat region (pPB 1750-2360). The amount of affinity purified
antibody was then quantified.
[0514] An affinity column containing the recombinant toxin B repeat
protein, pPB1750-2360, was made as follows. Four ml of PBS-washed
Actigel resin (Sterogene) was coupled with 5 mg of pPB1750-2360
affinity purified protein (dialyzed into PBS; estimated to be
greater than 95% full length fusion protein) in a 15 ml tube
(Falcon) containing {fraction (1/10)} final volume Aid-coupling
solution (1M sodium cyanoborohydride). Aliquots of the supernatant
from the coupling reactions, before and after coupling, were
assessed by Coomassie staining of 7.5% SDS-PAGE gels. Based on
protein band intensities, greater than 95% (approximately 5 mg) of
recombinant protein was coupled to the resin. The coupled resin was
poured into a 10 ml column (BioRad), washed extensively with PBS,
pre-eluted with 4M guanidine-HCl (in 10 mM Tris-HCl, pH 8.0; 0.005%
thimerosal) and re-equilibrated in PBS and stored at 4.degree.
C.
[0515] Aliquots of pMB1750-2360, pMB1750-2360 (Gerbu) or
pPB1750-2360 IgY polyclonal antibody preparations (PEG preps) were
affinity purified on the above column as follows. The column was
attached to an UV monitor (ISCO), and washed with PBS. Forty ml
aliquots of 2.times.PEG preps (filter sterilized using a 0.45.mu.
filter and quantified by OD.sub.280 before chromatography) was
applied. The column was washed with PBS until the baseline was
re-established (the column flow-through was saved), washed with
BBSTween to elute nonspecifically binding antibodies and
re-equilibrated with PBS. Bound antibody was eluted from the column
in 4M guanidine-HCl (in 10 mM Tris-HCL, pH 8.0, 0.005% thimerosal)
and the entire elution peak collected in a 15 ml tube (Falcon). The
column was re-equilibrated, and the column eluate
re-chromatographed as described above. The antibody preparations
were quantified by UV absorbance (the elution buffer was used to
zero the spectrophotometer). Approximately 10 fold higher
concentrations of total purified antibody was obtained upon elution
of the first chromatography pass relative to the second pass. The
low yield from the second chromatography pass indicated that most
of the specific antibodies were removed by the first round of
chromatography.
[0516] Pools of affinity purified specific antibodies were prepared
by dialysis of the column elutes after the first column
chromatography pass for the pMB1750-2360, pMB1750-2360 (Gerbu) or
pPB1750-2360 IgY polyclonal antibody preparations. The elutes were
collected on ice and immediately dialyzed against a 100-fold volume
of PBS at 4.degree. C. for 2 hrs. The samples were then dialyzed
against 3 changes of a 65-fold volume of PBS at 4.degree. C.
Dialysis was performed for a minimum of 8 hrs per change of PBS.
The dialyzed samples were collected, centrifuged to remove
insoluble debris, quantified by OD.sub.280, and stored at 4.degree.
C.
[0517] The percentage of toxin B repeat-specific antibodies present
in each preparation was determined using the quantifications of
antibody yields from the first column pass (amount of specific
antibody recovered after first pass/total protein loaded). The
yield of repeat-specific affinity purified antibody (expressed as
the percent of total protein in the preparation) in: 1) the
pMB1750-2360 PEG prep was approximately 0.5%, 2) the pMB1750-2360
(Gerbu) prep was approximately 2.3%, and 3) the pPB1750-2360 prep
was approximately 0.4%. Purification of a CTB IgY polyclonal
antibody preparation on the same column demonstrated that the
concentration of toxin B repeat specific antibodies in the CTB
preparation was 0.35%.
[0518] These results demonstrate that 1) the use of Gerbu adjuvant
enhanced the titer of specific antibody produced against the
pMB1750-2360 protein 5-fold relative to immunization using Freunds
adjuvant, and 2) the differences seen in the in vivo neutralization
ability of the pMB1750-2360 (not neutralizing) and pPB1750-2360
(neutralizing) and CTB (neutralizing) PEG preps seen in Example 19
was not due to differences in the titers of repeat-specific
antibodies in the three preparations because the titer of
repeat-specific antibody was similar for all three preps; therefore
the differing ability of the three antibody preparations to
neutralize toxin B must reflect qualitative differences in the
induced toxin B repeat-specific antibodies. To confirm that
qualitative differences exist between antibodies raised in hens
immunized with different recombinant proteins and/or different
adjuvants, the same amount of affinity purified anti-toxin B repeat
(aa 1870-2360 of toxin B) antibodies from the different
preparations was administered to hamsters using the in vivo hamster
model as described below.
[0519] b) In Vivo Neutralization of Toxin B Using Affinity Purified
Antibody
[0520] The in vivo hamster model was utilized to assess the
neutralizing ability of the affinity purified antibodies raised
against recombinant toxin B proteins purified in (a) above. As
well, a 4.times. IgY PEG preparation from a second independent
immunization utilizing the pPB1750-2360 antigen with Freunds
adjuvant was tested for in vivo neutralization. The results are
shown in Table 31.
[0521] The results shown in Table 31 demonstrate that:
[0522] 1) as shown in Example 19 and reproduced here, 1.5 mg of
affinity purified antibody from pMB1750-2360 immunized hens using
Freunds adjuvant does not neutralize toxin B in vivo. However, 300
.mu.g of affinity purified antibody from similarly immunized hens
utilizing Gerbu adjuvant demonstrated complete neutralization of
toxin B in vivo. This demonstrates that Gerbu adjuvant, in addition
to enhancing the titer of antibodies reactive to the pMB1750-2360
antigen relative to Freunds adjuvant (demonstrated in (a) above),
also enhances the yield of neutralizing antibodies to this antigen,
greater than 5 fold.
[0523] 2) Complete in vivo neutralization of toxin B was observed
with 1.5 mg of affinity purified antibody from hens immunized with
pPB1750-2360 antigen, but not with pMB1750-2360 antigen, when
Freunds adjuvant was used. This demonstrates, using standardized
toxin B repeat-specific antibody concentrations, that neutralizing
antibodies were induced when pPB1750-2360 but not pMB1750-2360 was
used as the antigen with Freunds adjuvant.
[0524] 3) Complete in vivo neutralization was observed with 300
.mu.g of pMB1750-2360 (Gerbu) antibody, but not with 300 .mu.g of
pPB1750-2360 (Freunds) antibody. Thus the pMB1750-2360 (Gerbu)
antibody has a higher titer of neutralizing antibodies than the
pPB1750-2360 (Freunds) antibody.
[0525] 4) Complete neutralization of toxin B was observed using 300
.mu.g of CTB antibody [affinity purified (AP)] but not 100 .mu.g
CTB antibody (AP or PEG prep). This demonstrates that greater than
100 .mu.g of toxin B repeat-specific antibody (anti-CTB) is
necessary to neutralize 25 .mu.g toxin B in vivo in this assay, and
that affinity purified antibodies specific to the toxin B repeat
interval neutralize toxin B as effectively as the PEP prep of IgY
raised against the entire CTB protein (shown in this assay).
[0526] 5) As was observed with the initial pPB1750-2360 (IgY) PEG
preparation (Example 19), complete neutralization was observed with
a IgY PEG preparation isolated from a second independent group of
pPB1750-2360 (Freunds) immunized hens. This demonstrates that
neutralizing antibodies are reproducibly produced when hens are
immunized with pPB1750-2360 protein utilizing Freunds adjuvant.
32TABLE 31 In vivo Neutralization Of Toxin B Using Affinity
Purified Antibodies Number Animals Number Animals Treatment
Group.sup.a Alive.sup.b Dead.sup.b Preimmune.sup.1 0 5 CTB (300
.mu.g).sup.2 5 0 CTB (100 .mu.g).sup.2 1 4 pMB1750-2360 (G) (5
mg).sup.2 5 0 pMB1750-2360 (G) (1.5 mg).sup.2 5 0 pMB1750-2360 (G)
(300 .mu.g).sup.2 5 0 pMB1750-2360 (F) (1.5 mg).sup.2 0 5
pPB1750-2360 (F) (l.5 mg).sup.2 5 0 pPB1750-2360 (F) (300
.mu.g).sup.2 1 4 CTB (100 .mu.g).sup.3 2 3 pPB1750-2360 (F) (500
.mu.g).sup.1 5 0 .sup.aC. difficile toxin B (CTB) (Tech Lab) at
lethal concentration to hamsters (25 .mu.g) was added to the
antibody (amount of specific antibody is indicated) and incubated
for one hour at 37.degree. C. After incubation, this mixture was
injected IP into hamsters (1/5 total # mix injected per hamster).
Each treatment group received toxin premixed with antibody raised
against the indicated protein (G = gerbu adjuvant, F = Freunds
adjuvant). .sup.1indicates the antibody was a 4X IgY PEG prep;
.sup.2indicates the antibody was affinity purified on a
pPB1850-2360 resin; and .sup.3indicates that the antibody was a 1X
IgY PEG prep. .sup.bThe numbers in each group represent numbers of
hamsters dead or alive, 2 hrs post IP administration of
toxin/antibody mixture.
EXAMPLE 21
Diagnostic Enzyme Immunoassays for C. difficile Toxins A and B
[0527] The ability of the recombinant toxin proteins and antibodies
raised against these recombinant proteins (described in the above
examples) to form the basis of diagnostic assays for the detection
of clostridial toxin in a sample was examined. Two immunoassay
formats were tested to quantitatively detect C. difficile toxin A
and toxin B from a biological specimen. The first format involved a
competitive assay in which a fixed amount of recombinant toxin A or
B was immobilized on a solid support (e.g., microtiter plate wells)
followed by the addition of a toxin-containing biological specimen
mixed with affinity-purified or PEG fractionated antibodies against
recombinant toxin A or B. If toxin is present in a specimen, this
toxin will compete with the immobilized recombinant toxin protein
for binding to the anti-recombinant antibody thereby reducing the
signal obtained following the addition of a reporter reagent. The
reporter reagent detects the presence of antibody bound to the
immobilized toxin protein.
[0528] In the second format, a sandwich immunoassay was developed
using affinity-purified antibodies to recombinant toxin A and B.
The affinity-purified antibodies to recombinant toxin A and B were
used to coat microtiter wells instead of the recombinant
polypeptides (as was done in the competitive assay format).
Biological samples containing toxin A or B were then added to the
wells followed by the addition of a reporter reagent to detect the
presence of bound toxin in the well.
[0529] a) Competitive Immunoassay for the Detection of C. difficile
Toxin
[0530] Recombinant toxin A or B was attached to a solid support by
coating 96 well microtiter plates with the toxin protein at a
concentration of 1 .mu.g/ml in PBS. The plates were incubated
overnight at 2-8.degree. C. The following morning, the coating
solutions were removed and the remaining protein binding sites on
the wells were blocked by filling each well with a PBS solution
containing 0.5% BSA and 0.05% Tween-20. Native C. difficile toxin A
or B (Tech Lab) was diluted to 4 .mu.g/ml in stool extracts from
healthy Syrian hamsters (Sasco). The stool extracts were made by
placing fecal pellets in a 15 ml centrifuge tube; PBS was added at
2 ml/pellet and the tube was vortexed to create a uniform
suspension. The tube was then centrifuged at 2000 rpm for 5 min at
room temperature. The supernatant was removed; this comprises the
stool extract. Fifty .mu.l of the hamster stool extract was
pipetted into each well of the microtiter plates to serve as the
diluent for serial dilutions of the 4 .mu.g/ml toxin samples. One
hundred .mu.l of the toxin samples at 4 .mu.g/ml was pipetted into
the first row of wells in the microtiter plate, and 50 .mu.l
aliquots were removed and diluted serially down the plate in
duplicate. An equal volume of affinity purified anti-recombinant
toxin antibodies [1 ng/well of anti-pMA1870-2680 antibody was used
for the detection of toxin A; 0.5 ng/well of
anti-pMB1750-2360(Gerbu) was used for the detection of toxin B]
were added to appropriate wells, and the plates were incubated at
room temperature for 2 hours with gentle agitation. Wells serving
as negative control contained antibody but no native toxin to
compete for binding.
[0531] Unbound toxin and antibody were removed by washing the
plates 3 to 5 times with PBS containing 0.05% Tween-20. Following
the wash step, 100 .mu.l of rabbit anti-chicken IgG antibody
conjugated to alkaline phosphatase (Sigma) was added to each well
and the plates were incubated for 2 hours at room temperature. The
plates were then washed as before to remove unbound secondary
antibody. Freshly prepared alkaline phosphatase substrate (1 mg/ml
p-nitrophenyl phosphate (Sigma) in 50 mM Na.sub.2CO.sub.3, pH 9.5;
10 mM MgCl.sub.2) was added to each well. Once sufficient color
developed, the plates were read on a Dynatech MR700 microtiter
plate reader using a 410 nm filter.
[0532] The results are summarized in Tables 32 and 33. For the
results shown in Table 32, the wells were coated with recombinant
toxin A protein (pMA1870-2680). The amount of native toxin A added
(present as an addition to solubilized hamster stool) to a given
well is indicated (0 to 200 ng). Antibody raised against the
recombinant toxin A protein, pMA1870-2680, was affinity purified on
the an affinity column containing pPA1870-2680 (described in
Example 20). As shown in Table 32, the recombinant toxin A protein
and affinity-purified antitoxin can be used for the basis of a
competitive immunoassay for the detection of toxin A in biological
samples.
[0533] Similar results were obtained using the recombinant toxin B,
pPB 1750-2360, and antibodies raised against pMB1750-2360(Gerbu).
For the results shown in Table 33, the wells were coated with
recombinant toxin B protein (pPB1750-2360). The amount of native
toxin B added (present as an addition to solubilized hamster stool)
to a given well is indicated (0 to 200 ng). Antibody raised against
the recombinant toxin B protein, pMB1750-2360(Gerbu), was affinity
purified on the an affinity column containing pPB 1850-2360
(described in Example 20). As shown in Table 33, the recombinant
toxin B protein and affinity-purified antitoxin can be used for the
basis of a competitive immunoassay for the detection of toxin B in
biological samples.
[0534] In this competition assay, the reduction is considered
significant over the background levels at all points; therefore the
assay can be used to detect samples containing less than 12.5 ng
toxin A/well and as little as 50-100 ng toxin B/well.
33TABLE 32 Competitive Inhibition Of Anti-C. difficile Toxin A By
Native Toxin A ng Toxin A/Well OD.sub.410 Readout 200 0.176 100
0.253 50 0.240 25 0.259 12.5 0.309 6.25 0.367 3.125 0.417 0
0.590
[0535]
34TABLE 33 Competitive Inhibition Of Anti-C. difficile Toxin B By
Native Toxin B ng Toxin B/Well OD.sub.410 Readout 200 0.392 100
0.566 50 0.607 25 0.778 12.5 0.970 6.25 0.902 3.125 1.040 0
1.055
[0536] These competitive inhibition assays demonstrate that native
C. difficile toxins and recombinant C. difficile toxin proteins can
compete for binding to antibodies raised against recombinant C.
difficile toxins demonstrating that these anti-recombinant toxin
antibodies provide effective diagnostic reagents.
[0537] b) Sandwich Immunoassay for the Detection of C. difficile
Toxin
[0538] Affinity-purified antibodies against recombinant toxin A or
toxin B were immobilized to 96 well microtiter plates as follows.
The wells were passively coated overnight at 4.degree. C. with
affinity purified antibodies raised against either pMA1870-2680
(toxin A) or pMB1750-2360(Gerbu) (toxin B). The antibodies were
affinity purified as described in Example 20. The antibodies were
used at a concentration of 1 .mu.g/ml and 100 .mu.l was added to
each microtiter well. The wells were then blocked with 200 .mu.l of
0.5% BSA in PBS for 2 hours at room temperature and the blocking
solution was then decanted. Stool samples from healthy Syrian
hamsters were resuspended in PBS, pH 7.4 (2 ml PBS/stool pellet was
used to resuspend the pellets and the sample was centrifuged as
described above). The stool suspension was then spiked with native
C. difficile toxin A or B (Tech Lab) at 4 .mu.g/ml. The stool
suspensions containing toxin (either toxin A or toxin B) were then
serially diluted two-fold in stool suspension without toxin and 50
.mu.l was added in duplicate to the coated microtiter wells. Wells
containing stool suspension without toxin served as the negative
control.
[0539] The plates were incubated for 2 hours at room temperature
and then were washed three times with PBS. One hundred .mu.l of
either goat anti-native toxin A or goat anti-native toxin B (Tech
Lab) diluted 1:1000 in PBS containing 1% BSA and 0.05% Tween 20 was
added to each well. The plates were incubated for another 2 hours
at room temperature. The plates were then washed as before and 100
.mu.l of alkaline phosphatase-conjugated rabbit anti-goat IgG
(Cappel, Durham, N.C.) was added at a dilution of 1:1000. The
plates were incubated for another 2 hours at room temperature. The
plates were washed as before then developed by the addition of 100
.mu.l/well of a substrate solution containing 1 mg/ml p-nitrophenyl
phosphate (Sigma) in 50 mM Na.sub.2CO.sub.3, pH 9.5; 10 mM
MgCl.sub.2. The absorbance of each well was measured using a plate
reader (Dynatech) at 410 nm. The assay results are shown in Tables
34 and 35.
35TABLE 34 C. difficile Toxin A Detection In Stool Using Affinity-
Purified Antibodies Against Toxin A ng Toxin A/Well OD.sub.410
Readout 200 0.9 100 0.8 50 0.73 25 0.71 12.5 0.59 6.25 0.421 0
0
[0540]
36TABLE 35 C. difficile Toxin B Detection In Stool Using Affinity-
Purified Antibodies Against Toxin B ng Toxin B/Well OD.sub.410
Readout 200 1.2 100 0.973 50 0.887 25 0.846 12.5 0.651 6.25 0.431 0
0.004
[0541] The results shown in Tables 34 and 35 show that antibodies
raised against recombinant toxin A and toxin B fragments can be
used to detect the presence of C. difficile toxin in stool samples.
These antibodies form the basis for a sensitive sandwich
immunoassay which is capable of detecting as little as 6.25 ng of
either toxin A or B in a 50 .mu.l stool sample. As shown above in
Tables 34 and 35, the background for this sandwich immunoassay is
extremely low; therefore, the sensitivity of this assay is much
lower than 6.25 ng toxin/well. It is likely that toxin levels of
0.5 to 1.0 .mu.g/well could be detected by this assay.
[0542] The results shown above in Tables 32-35 demonstrate clear
utility of the recombinant reagents in C. difficile toxin detection
systems.
EXAMPLE 22
Construction and Expression of C. botulinum C Fragment Fusion
Proteins
[0543] The C. botulinum type A neurotoxin gene has been cloned and
sequenced [Thompson, et al., Eur. J. Biochem. 189:73 (1990)]. The
nucleotide sequence of the toxin gene is available from the
EMBL/GenBank sequence data banks under the accession number X52066;
the nucleotide sequence of the coding region is listed in SEQ ID
NO:27. The amino acid sequence of the C. botulinum type A
neurotoxin is listed in SEQ ID NO:28. The type A neurotoxin gene is
synthesized as a single polypeptide chain which is processed to
form a dimer composed of a light and a heavy chain linked via
disulfide bonds. The 50 kD carboxy-terminal portion of the heavy
chain is referred to as the C fragment or the H.sub.C domain.
[0544] Previous attempts by others to express polypeptides
comprising the C fragment of C. botulinum type A toxin as a native
polypeptide (e.g., not as a fusion protein) in E. coli have been
unsuccessful [H.F. LaPenotiere, et al. in Botulinum and Tetanus
Neurotoxins, DasGupta, Ed., Plenum Press, New York (1993), pp.
463-466]. Expression of the C fragment as a fusion with the E. coli
MBP was reported to result in the production of insoluble protein
(H. F. LaPenotiere, et al., supra).
[0545] In order to produce soluble recombinant C fragment proteins
in E. coli, fusion proteins comprising a synthetic C fragment gene
derived from the C. botulinum type A toxin and either a portion of
the C. difficile toxin protein or the MBP were constructed. This
example involved a) the construction of plasmids encoding C
fragment fusion proteins and b) expression of C. botulinum C
fragment fusion proteins in E. coli.
[0546] a) Construction of Plasmids Encoding C Fragment Fusion
Proteins
[0547] In Example 11, it was demonstrated that the C. difficile
toxin A repeat domain can be efficiently expressed and purified in
E. coli as either native (expressed in the pET 23a vector in clone
pPA1870-2680) or fusion (expressed in the pMALc vector as a fusion
with the E. coli MBP in clone pMA1870-2680) proteins. Fusion
proteins comprising a fusion between the MBP, portions of the C.
difficile toxin A repeat domain (shown to be expressed as a soluble
fusion protein) and the C fragment of the C. botulinum type A toxin
were constructed. A fusion protein comprising the C fragment of the
C. botulinum type A toxin and the MBP was also constructed.
[0548] FIG. 25 provides a schematic representation of the botulinal
fusion proteins along with the donor constructs containing the C.
difficile toxin A sequences or C. botulinum C fragment sequences
which were used to generate the botulinal fusion proteins. In FIG.
25, the solid boxes represent C. difficile toxin A gene sequences,
the open boxes represent C. botulinum C fragment sequences and the
solid black ovals represent the E. coli MBP. When the name for a
restriction enzyme appears inside parenthesis, this indicates that
the restriction site was destroyed during construction. An asterisk
appearing with the name for a restriction enzyme indicates that
this restriction site was recreated at the cloning junction.
[0549] In FIG. 25, a restriction map of the pMA1870-2680 and
pPA1100-2680 constructs (described in Example 11) which contain
sequences derived from the C. difficile toxin A repeat domain are
shown; these constructs were used as the source of C. difficile
toxin A gene sequences for the construction of plasmids encoding
fusions between the C. botulinum C fragment gene and the C.
difficile toxin A gene. The pMA1870-2680 expression construct
expresses high levels of soluble, intact fusion protein (20
mg/liter culture) which can be affinity purified on an amylose
column (purification described in Example 11 d).
[0550] The pAlterBot construct (FIG. 25) was used as the source of
C. botulinum C fragment gene sequences for the botulinal fusion
proteins. pAlterBot was obtained from J. Middlebrook and R. Lemley
at the U.S. Department of Defense. pAlterBot contains a synthetic
C. botulinum C fragment inserted in to the pALTER-1.RTM. vector
(Promega). This synthetic C fragment gene encodes the same amino
acids as does the naturally occurring C fragment gene. The
naturally occurring C fragment sequences, like most clostridial
genes, are extremely A/T rich (Thompson et al., supra). This high
A/T content creates expression difficulties in E. coli and yeast
due to altered codon usage frequency and fortuitous polyadenylation
sites, respectively. In order to improve the expression of C
fragment proteins in E. coli, a synthetic version of the gene was
created in which the non-preferred codons were replaced with
preferred codons.
[0551] The nucleotide sequence of the C. botulinum C fragment gene
sequences contained within pAlterBot is listed in SEQ ID NO:22. The
first six nucleotides (ATGGCT) encode a methionine and alanine
residue, respectively. These two amino acids result from the
insertion of the C. botulinum C fragment sequences into the
pALTER.RTM. vector and provide the initiator methionine residue.
The amino acid sequence of the C. botulinum C fragment encoded by
the sequences contained within pAlterBot is listed in SEQ ID NO:23.
The first two amino acids (Met Ala) are encoded by vector-derived
sequences. From the third amino acid residue onward (Arg), the
amino acid sequence is identical to that found in the C. botulinum
type A toxin gene.
[0552] The pMA1870-2680, pPA1100-2680 and pAlterBot constructs were
used as progenitor plasmids to make expression constructs in which
fragments of the C. difficile toxin A repeat domain were expressed
as genetic fusions with the C. botulinum C fragment gene using the
pMAL-c expression vector (New England BioLabs). The pMAL-c
expression vector generates fusion proteins which contain the MBP
at the amino-terminal end of the protein. A construct, pMBot, in
which the C. botulinum C fragment gene was expressed as a fusion
with only the MBP was constructed (FIG. 25). Fusion protein
expression was induced from E. coli strains harboring the above
plasmids, and induced protein was affinity purified on an amylose
resin column.
[0553] i) Construction of pBlueBot
[0554] In order to facilitate the cloning of the C. botulinum C
fragment gene sequences into a number of desired constructs, the
botulinal gene sequences were removed from pAlterBot and were
inserted into the pBluescript plasmid (Stratagene) to generate
pBlueBot (FIG. 25). pBlueBot was constructed as follows. Bacteria
containing the pAlterBot plasmid were grown in medium containing
tetracycline and plasmid DNA was isolated using the QIAprep-spin
Plasmid Kit (Qiagen). One microgram of pAlterBot DNA was digested
with NcoI and the resulting 3' recessed sticky end was made blunt
using the Klenow fragment of DNA polymerase I (here after the
Klenow fragment). The pAlterBot DNA was then digested with HindIII
to release the botulinal gene sequences (the Bot insert) as a blunt
(filled NcoI site)-HindIII fragment. pBluescript vector DNA was
prepared by digesting 200 ng of pBluescript DNA with SmaI and
HindIII. The digestion products from both plasmids were resolved on
an agarose gel. The appropriate fragments were removed from the
gel, mixed and purified utilizing the Prep-a-Gene kit (BioRad). The
eluted DNA was then ligated using T4 DNA ligase and used to
transform competent DH5.alpha. cells (Gibco-BRL). Host cells were
made competent for transformation using the calcium chloride
protocol of Sanbrook et al., supra at 1.82-1.83. Recombinant clones
were isolated and confirmed by restriction digestion using standard
recombinant molecular biology techniques (Sambrook et al, supra).
The resultant clone, pBlueBot, contains several useful unique
restriction sites flanking the Bot insert (i.e., the C. botulinum C
fragment sequences derived from pAlterBot) as shown in FIG. 25.
[0555] ii) Construction Of C. difficile/C. botulinum/MBP Fusion
Proteins
[0556] Constructs encoding fusions between the C. difficile toxin A
gene and the C. botulinum C fragment gene and the MBP were made
utilizing the same recombinant DNA methodology outlined above;
these fusion proteins contained varying amounts of the C. difficile
toxin A repeat domain.
[0557] The pMABot clone contains a 2.4 kb insert derived from the
C. difficile toxin A gene fused to the Bot insert (i.e, the C.
botulinum C fragment sequences derived from pAlterBot). pMABot
(FIG. 25) was constructed by mixing gel-purified DNA from
NotI/HindIII digested pBlueBot (the 1.2 kb Bot fragment), SpeI/NotI
digested pPA1100-2680 (the 2.4 kb C. difficile toxin A repeat
fragment) and XbaI/HindIII digested pMAL-c vector. Recombinant
clones were isolated, confirmed by restriction digestion and
purified using the QIAprep-spin Plasmid Kit (Qiagen). This clone
expresses the toxin A repeats and the botulinal C fragment protein
sequences as an in-frame fusion with the MBP.
[0558] The pMCABot construct contains a 1.0 kb insert derived from
the C. difficile toxin A gene fused to the Bot insert (i.e, the C.
botulinum C fragment sequences derived from pAlterBot). pMCABot was
constructed by digesting the pMABot clone with EcoRI to remove the
5' end of the C. difficile toxin A repeat (see FIG. 25, the pMAL-c
vector contains a EcoRI site 5' to the C. difficile insert in the
pMABot clone). The restriction sites were filled and religated
together after gel purification. The resultant clone (pMCABot, FIG.
25) generated an in-frame fusion between the MBP and the remaining
3' portion of the C. difficile toxin A repeat domain fused to the
Bot gene.
[0559] The pMNABot clone contains the 1 kb SpeI/EcoRI (filled)
fragment from the C. difficile toxin A repeat domain (derived from
clone pPA 1100-2680) and the 1.2 kb C. botulinum C fragment gene as
a NcoI (filled)/HindIII fragment (derived from pAlterBot). These
two fragments were inserted into the pMAL-c vector digested with
XbaI/HindIII. The two insert fragments were generated by digestion
of the appropriate plasmid with EcoRI (pPA1100-2680) or NcoI
(pAlterBot) followed by treatment with the Klenow fragment. After
treatment with the Klenow fragment, the plasmids were digested with
the second enzyme (either SpeI or HindIII). All three fragments
were gel purified, mixed and Prep-a-Gene purified prior to
ligation. Following ligation and transformation, putative
recombinants were analyzed by restriction analysis; the EcoRI site
was found to be regenerated at the fusion junction, as was
predicted for a fusion between the filled EcoRI and NcoI sites.
[0560] A construct encoding a fusion protein between the botulinal
C fragment gene and the MBP gene was constructed (i.e., this fusion
lacks any C. difficile toxin A gene sequences) and termed pMBot.
The pMBot-construct was made by removal of the C. difficile toxin A
sequences from the pMABot construct and fusing the C fragment gene
sequences to the MBP. This was accomplished by digestion of pMABot
DNA with StuI (located in the pMALc polylinker 5' to the XbaI site)
and XbaI (located 3' to the NotI site at the toxA-Bot fusion
junction), filling in the XbaI site using the Klenow fragment, gel
purifying the desired restriction fragment, and ligating the blunt
ends to circularize the plasmid. Following ligation and
transformation, putative recombinants were analyzed by restriction
mapping of the Bot insert (i.e, the C. botulinum C fragment
sequences).
[0561] b) Expression of C. botulinum C Fragment Fusion Proteins in
E. coli
[0562] Large scale (1 liter) cultures of the pMAL-c vector, and
each recombinant construct described above in (a) were grown,
induced, and soluble protein fractions were isolated as described
in Example 18. The soluble protein extracts were chromatographed on
amylose affinity columns to isolate recombinant fusion protein. The
purified recombinant fusion proteins were analyzed by running
samples on SDS-PAGE gels followed by Coomassie staining and by
Western blot analysis as described [Williams et al, (1994) supra].
In brief, extracts were prepared and chromatographed in column
buffer (10 mM NaPO.sub.4, 0.5 M NaCl, 10 mM .beta.-mercaptoethanol,
pH 7.2) over an amylose resin (New England Biolabs) column, and
eluted with column buffer containing 10 mM maltose as described
[Williams, et al. (1994), supra]. An SDS-PAGE gel containing the
purified protein samples stained with Coomassie blue is shown in
FIG. 26.
[0563] In FIG. 26, the following samples were loaded. Lanes 1-6
contain protein purified from E. coli containing the pMAL-c,
pPA1870-2680, pMABot, pMNABot, pMCABot and pMBot plasmids,
respectively. Lane 7 contains broad range molecular weight protein
markers (BioRad).
[0564] The protein samples were prepared for electrophoresis by
mixing 5 .mu.l of eluted protein with 5 .mu.l of 2.times. SDS-PAGE
sample buffer (0.125 mM Tris-HCl, pH 6.8, 2 mM EDTA, 6% SDS, 20%
glycerol, 0.025% bromophenol blue; P-mercaptoethanol is added to 5%
before use). The samples were heated to 95.degree. C. for 5 min,
then cooled and loaded on a 7.5% agarose SDS-PAGE gel. Broad range
molecular weight protein markers were also loaded to allow
estimation of the MW of identified fusion proteins. After
electrophoresis, protein was detected generally by staining the gel
with Coomassie blue.
[0565] In all cases the yields were in excess of 20 mg fusion
protein per liter culture (see Table 36) and, with the exception of
the pMCABot protein, a high percentage (i.e., greater than 20-50%
of total eluted protein) of the eluted fusion protein was of a MW
predicted for the full length fusion protein (FIG. 26). It was
estimated (by visual inspection) that less than 10% of the pMCABot
fusion protein was expressed as the full length fusion protein.
37TABLE 36 Yield Of Affinity Purified C. botulinum C Fragment/ MBP
Fusion Proteins Yield (mg/liter Percentage Of Total Construct of
Culture) Soluble Protein pMABot 24 5.0 pMCABot 34 5.0 pMNABot 40
5.5 pMBot 22 5.0 pMA1870-2680 40 4.8
[0566] These results demonstrate that high level expression of
intact C. botulinum C fragment/C. difficile toxin A fusion proteins
in E. coli is feasible using the pMAL-c expression system. These
results are in contrast to those reported by H. F. LaPenotiere, et
al. (1993), supra. In addition, these results show that it is not
necessary to fuse the botulinal C fragment gene to the C. difficile
toxin A gene in order to produce a soluble fusion protein using the
pMAL-c system in E. coli.
[0567] In order to determine whether the above-described botulinal
fusion proteins were recognized by anti-C. botulinum toxin A
antibodies, Western blots were performed. Samples containing
affinity-purified proteins from E. coli containing the pMABot,
pMCABot, pMNABot, pMBot, pMA1870-2680 or pMALc plasmids were
analyzed. SDS-PAGE gels (7.5% acrylamide) were loaded with protein
samples purified from each expression construct. After
electrophoresis, the gels were blotted and protein transfer was
confirmed by Ponceau S staining (as described in Example 12b).
[0568] Following protein transfer, the blots were blocked by
incubation for 1 hr at 20.degree. C. in blocking buffer [PBST (PBS
containing 0.1% Tween 20 and 5% dry milk)]. The blots were then
incubated in 10 ml of a solution containing the primary antibody;
this solution comprised a {fraction (1/500)} dilution of an anti-C.
botulinum toxin A IgY PEG prep (described in Example 3) in blocking
buffer. The blots were incubated for 1 hr at room temperature in
the presence of the primary antibody. The blots were washed and
developed using a rabbit anti-chicken alkaline phosphatase
conjugate (Boehringer Mannheim) as the secondary antibody as
follows. The rabbit anti-chicken antibody was diluted to 1 .mu.g/ml
in blocking buffer (10 ml final volume per blot) and the blots were
incubated at room temperature for 1 hour in the presence of the
secondary antibody. The blots were then washed successively with
PBST, BBS-Tween and 50 mM Na.sub.2CO.sub.3, pH 9.5. The blots were
then developed in freshly-prepared alkaline phosphatase substrate
buffer (100 .mu.g/ml nitro blue tetrazolium, 50 .mu.g/ml
5-bromo-chloro-indolylphosphate, 5 mM MgCl.sub.2 in 50 mM
Na.sub.2CO.sub.3, pH 9.5). Development was stopped by flooding the
blots with distilled water and the blots were air dried.
[0569] This Western blot analysis detected anti-C. botulinum toxin
reactive proteins in the pMABot, pMCABot, pMNABot and pMBot protein
samples (corresponding to the predicted full length proteins
identified above by Coomassie staining in FIG. 26), but not in the
pMA1100-2680 or pMALc protein samples.
[0570] These results demonstrate that the relevant fusion proteins
purified on an amylose resin as described above in section a)
contained immunoreactive C. botulinum C fragment protein as
predicted.
EXAMPLE 23
Generation of Neutralizing Antibodies by Nasal Administration of
pMBot Protein
[0571] The ability of the recombinant botulinal toxin proteins
produced in Example 22 to stimulate a systemic immune response
against botulinal toxin epitopes was assessed. This example
involved: a) the evaluation of the induction of serum IgG titers
produced by nasal or oral administration of botulinal
toxin-containing C. difficile toxin A fusion proteins and b) the in
vivo neutralization of C. botulinum type A neurotoxin by
anti-recombinant C. botulinum C fragment antibodies.
[0572] a) Evaluation of the Induction of Serum IgG Titers Produced
by Nasal or Oral Administration of Botulinal Toxin-Containing C.
difficile Toxin A Fusion Proteins
[0573] Six groups containing five 6 week old CF female rats
(Charles River) per group were immunized nasally or orally with one
of the following three combinations using protein prepared in
Example 22: (1) 250 .mu.g pMBot protein per rat (nasal and oral);
2) 250 .mu.g pMABot protein per rat (nasal and oral); 3) 125 .mu.g
pMBot admixed with 125 .mu.g pMA1870-2680 per rat (nasal and oral).
A second set of 5 groups containing 3 CF female rats/group were
immunized nasally or orally with one of the following combinations
(4) 250 .mu.g pMNABot protein per rat (nasal and oral) or 5) 250
.mu.g pMAL-c protein per rat (nasal and oral).
[0574] The fusion proteins were prepared for immunization as
follows. The proteins (in column buffer containing 10 mM maltose)
were diluted in 0.1 M carbonate buffer, pH 9.5 and administered
orally or nasally in a 200 .mu.l volume. The rats were lightly
sedated with ether prior to administration. The oral dosing was
accomplished using a 20 gauge feeding needle. The nasal dosing was
performed using a P-200 micro-pipettor (Gilson). The rats were
boosted 14 days after the primary immunization using the techniques
described above and were bled 7 days later. Rats from each group
were lightly etherized and bled from the tail. The blood was
allowed to clot at 37.degree. C. for 1 hr and the serum was
collected.
[0575] The serum from individual rats was analyzed using an ELISA
to determine the anti-C. botulinum type A toxin IgG serum titer.
The ELISA protocol used is a modification of that described in
Example 13c. Briefly, 96-well microtiter plates (Falcon, Pro-Bind
Assay Plates) were coated with C. botulinum type A toxoid (prepared
as described in Example 3a) by placing 100 .mu.l volumes of C.
botulinum type A toxoid at 2.5 .mu.g/ml in PBS containing 0.005%
thimerosal in each well and incubating overnight at 4.degree. C.
The next morning, the coating suspensions were decanted and all
wells were washed three times using PBS.
[0576] In order to block non-specific binding sites, 100 .mu.l of
blocking solution [0.5% BSA in PBS] was then added to each well and
the plates were incubated for 1 hr at 37.degree. C. The blocking
solution was decanted and duplicate samples of 150 .mu.l of diluted
rat serum added to the first well of a dilution series. The initial
testing serum dilution was 1:30 in blocking solution containing
0.5% Tween 20 followed by 5-fold dilutions into this solution. This
was accomplished by serially transferring 30 .mu.l aliquots to 120
.mu.l blocking solution containing 0.5% Tween 20, mixing, and
repeating the dilution into a fresh well. After the final dilution,
30 .mu.l was removed from the well such that all wells contained
120 .mu.l final volume. A total of 3 such dilutions were performed
(4 wells total). The plates were incubated 1 hr at 37.degree. C.
Following this incubation, the serially diluted samples were
decanted and the wells were washed six times using PBS containing
0.5% Tween 20 (PBST). To each well, 100 .mu.l of a rabbit anti-Rat
IgG alkaline phosphatase (Sigma) diluted ({fraction (1/1000)}) in
blocking buffer containing 0.5% Tween 20 was added and the plate
was incubated for 1 hr at 37.degree. C. The conjugate solutions
were decanted and the plates were washed as described above,
substituting 50 mM Na.sub.2CO.sub.3, pH 9.5 for the PBST in the
final wash. The plates were developed by the addition of -100 .mu.l
of a solution containing 1 mg/ml para-nitro phenyl phosphate
(Sigma) dissolved in 50 mM Na.sub.2CO.sub.3, 10 mM MgCl.sub.2, pH
9.5 to each well, and incubating the plates at room temperature in
the dark for 5-45 min. The absorbency of each well was measured at
410 mm using a Dynatech MR 700 plate reader. The results are
summarized in Tables 37 and 38 and represent mean serum
reactivities of individual mice.
38TABLE 37 Determination Of Anti-C. botulinum Type A Toxin Serum
IgG Titers Following Immunization With C. botulinum C Fragment-
Containing Fusion Proteins Nasal Oral pMBot & pMBot & Route
of Immunization pMA1870- pMA1870- Immunogen PREIMMUNE pMBot 2680
pMABot pMBot 2680 pMABot Dilution 1:30 0.080 1.040 1.030 0.060
0.190 0.080 0.120 1:150 0.017 0.580 0.540 0.022 0.070 0.020 0.027
1:750 0.009 0.280 0.260 0.010 0.020 0.010 0.014 1:3750 0.007 0.084
0.090 0.009 0.009 0.010 0.007 # Rats 5 5 5 5 2 2 Tested * Numbers
represent the average values obtained from two ELISA plates,
standardized utilizing the preimmune control.
[0577]
39TABLE 38 Determination Of Anti-C. botulinum Type A Toxin Serum
IgG Titers Following Immunization With C. botulinum C
Fragment-Containing Fusion Proteins Oral Route of Immunization
Nasal pMNA Immunogen PREIMMUNE pMBot pMABot pMNABot Bot Dilution
1:30 0.040 0.557 0.010 0.015 0.010 1:150 0.009 0.383 0.001 0.003
0.002 1:750 0.001 0.140 0.000 0.000 0.000 1:3750 0.000 0.040 0.000
0000 0.000 # Rats 1 1 3 3 Tested
[0578] The above ELISA results demonstrate that reactivity against
the botulinal fusion proteins was strongest when the route of
administration was nasal; only weak responses were stimulated when
the botulinal fusion proteins were given orally. Nasally delivered
pMbot and pMBot admixed with pMA1870-2680 invoked the greatest
serum IgG response. These results show that only the pMBot protein
is necessary to induce this response, since the addition of the
pMA1870-2680 protein did not enhance antibody response (Table 37).
Placement of the C. difficile toxin A fragment between the MBP and
the C. botulinum C fragment protein dramatically reduced anti-bot
IgG titer (see results using pMABot, pMCABot and pMNABot
proteins).
[0579] This study demonstrates that the pMBot protein induces a
strong serum IgG response directed against C. botulinum type A
toxin when nasally administered.
[0580] b) In Vivo Neutralization of C. botulinum Type A Neurotoxin
by Anti-Recombinant C. botulinum C Fragment Antibodies
[0581] The ability of the anti-C. botulinum type A toxin antibodies
generated by nasal administration of recombinant botulinal fusion
proteins in rats (Example 22) to neutralize C. botulinum type A
toxin was tested in a mouse neutralization model. The mouse model
is the art accepted method for detection of botulinal toxins in
body fluids and for the evaluation of anti-botulinal antibodies [E.
J. Schantz and D. A. Kautter, J. Assoc. Off. Anal. Chem. 61:96
(1990) and Investigational New Drug (BB-IND-3703) application by
the Surgeon General of the Department of the Army to the Federal
Food and Drug Administration]. The anti-C. botulinum type A toxin
antibodies were prepared as follows.
[0582] Rats from the group given pMBot protein by nasal
administration were boosted a second time with 250 .mu.g pMBot
protein per rat and serum was collected 7 days later. Serum from
one rat from this group and from a preimmune rat was tested for
anti-C. botulinum type A toxin neutralizing activity in the mouse
neutralization model described below.
[0583] The LD.sub.50 of a solution of purified C. botulinum type A
toxin complex, obtained from Dr. Eric Johnson (University of
Wisconsin Madison), was determined using the intraperitoneal (IP)
method of Schantz and Kautter [J. Assoc. Off. Anal. Chem. 61:96
(1978)] using 18-22 gram female ICR mice and was found to be 3500
LD.sub.50/ml. The determination of the LD.sub.50 was performed as
follows. A Type A toxin standard was prepared by dissolving
purified type A toxin complex in 25 mM sodium phosphate buffer, pH
6.8 to yield a stock toxin solution of 3.15.times.10.sup.7
LD.sub.50/mg. The OD.sub.278 of the solution was determined and the
concentration was adjusted to 10-20 .mu.g/ml. The toxin solution
was then diluted 1:100 in gel-phosphate (30 mM phosphate, pH 6.4;
0.2% gelatin). Further dilutions of the toxin solution were made as
shown below in Table 39. Two mice were injected IP with 0.5 ml of
each dilution shown and the mice were observed for symptoms of
botulism for a period of 72 hours.
40TABLE 39 Determination Of The LD.sub.50 Of Purified C. botulinum
Type A Toxin Complex Dilution Number Dead At 72 hr 1:320 2/2 1:640
2/2 1:1280 2/2 1:2560 0/2 (sick after 72 hr) 1:5120 0/2 (no
symptoms)
[0584] From the results shown in Table 39, the toxin titer was
assumed to be between 2560 LD.sub.50/ml and 5120 LD.sub.50/ml (or
about 3840 LD.sub.50/ml). This value was rounded to 3500
LD.sub.50/ml for the sake of calculation.
[0585] The amount of neutralizing antibodies present in the serum
of rats immunized nasally with pMBot protein was then determined.
Serum from two rats boosted with pMBot protein as described above
and preimmune serum from one rat was tested as follows. The toxin
standard was diluted 1:100 in gel-phosphate to a final
concentration of 350 LD.sub.50/ml. One milliliter of the diluted
toxin standard was mixed with 25 .mu.l of serum from each of the
three rats and 0.2 ml of gel-phosphate. The mixtures were incubated
at room temperature for 30 min with occasional mixing. Each of two
mice were injected with IP with 0.5 ml of the mixtures. The mice
were observed for signs of botulism for 72 hr. Mice receiving serum
from rats immunized with pMBot protein neutralized this challenge
dose. Mice receiving preimmune rat serum died in less than 24
hr.
[0586] The amount of neutralizing anti-toxin antibodies present in
the serum of rats immunized with pMBot protein was then
quantitated. Serum antibody titrations were performed by mixing 0.1
ml of each of the antibody dilutions (see Table 40) with 0.1 ml of
a 1:10 dilution of stock toxin solution (3.5.times.10.sup.4
LD.sub.50/ml) with 1.0 ml of gel-phosphate and injecting 0.5 ml IP
into 2 mice per dilution. The mice were then observed for signs of
botulism for 3 days (72 hr). The results are tabulated in Table
39.
[0587] As shown in Table 40 pMBot serum neutralized C. botulinum
type A toxin complex when used at a dilution of 1:320 or less. A
mean neutralizing value of 168 IU/ml was obtained for the pMBot
serum (an IU is defined as 10,000 mouse LD.sub.50). This value
translates to a circulating serum titer of about 3.7 IU/mg of serum
protein. This neutralizing titer is comparable to the commercially
available bottled concentrated (Connaught Laboratories, Ltd.) horse
anti-C. botulinum antiserum. A 10 ml vial of Connaught antiserum
contains about 200 mg/ml of protein; each ml can neutralize 750 IU
of C. botulinum type A toxin. After administration of one vial to a
human, the circulating serum titer of the Connaught preparation
would be approximately 25 IU/ml assuming an average serum volume of
3 liters). Thus, the circulating anti-C. botulinum titer seen in
rats nasally immunized with pMBot protein (168 IU/ml) is 6.7 time
higher than the necessary circulation titer of anti-C. botulinum
antibody needed to be protective in humans.
41TABLE 40 Quantitation Of Neutralizing Antibodies In pMBot Sera
pMBot.sup.a Dilution Rat 1 Rat 2 1:20 2/2 2/2 1:40 2/2 2/2 1:80 2/2
2/2 1:160 2/2 2/2 1:320 2/2.sup.b 2/2.sup.b 1:640 0/2 0/2 1:1280
0/2 0/2 1:2560 0/2 0/2 .sup.aNumbers represent the number of mice
surviving at 72 hours which received serum taken from rats
immunized with the pMBot protein. .sup.bThese mice survived but
were sick after 72 hr.
[0588] These results demonstrate that antibodies capable of
neutralizing C. botulinum type A toxin are induced when recombinant
C. botulinum C fragment fusion protein produced in E. coli is used
as an immunogen.
EXAMPLE 24
Production of Soluble C. botulinum C Fragment Protein Substantially
Free of Endotoxin Contamination
[0589] Example 23 demonstrated that neutralizing antibodies are
generated by immunization with the pMBot protein expressed in E
coli. These results showed that the pMBot fusion protein is a good
vaccine candidate. However, immunogens suitable for use as vaccines
should be pyrogen-free in addition to having the capability of
inducing neutralizing antibodies. Expression clones and conditions
that facilitate the production of C. botulinum C fragment protein
for utililization as a vaccine were developed.
[0590] The example involved: (a) determination of pyrogen content
of the pMBot protein; (b) generation of C. botulinum C fragment
protein free of the MBP; (c) expression of C. botulinum C fragment
protein using various expression vectors; and (d) purification of
soluble C. botulinum C fragment protein substantially free of
significant endotoxin contamination.
[0591] a) Determination of the Pyrogen Content of the pMBot
Protein
[0592] In order to use a recombinant antigen as a vaccine in humans
or other animals, the antigen preparation must be shown to be free
of pyrogens. The most significant pyrogen present in preparations
of recombinant proteins produced in gram-negative bacteria, such as
E. coli, is endotoxin [F.C. Pearson, Pyrogens: endotoxins, LAL
testing and depyrogentaion, (1985) Marcel Dekker, New York, pp.
23-56]. To evaluate the utility of the pMBot protein as a vaccine
candidate, the endotoxin content in MBP fusion proteins was
determined.
[0593] The endotoxin content of recombinant protein samples was
assayed utilizing the Limulus assay (LAL kit; Associates of Cape
Cod) according to the manufacturer's instructions. Samples of
affinity-purified pMa1-c protein and pMA1870-2680 were found to
contain high levels of endotoxin [>50,000 EU/mg protein; EU
(endotoxin unit)]. This suggested that MBP- or toxin A
repeat-containing fusions with the botulinal C fragment should also
contain high levels of endotoxin. Accordingly, removal of endotoxin
from affinity-purified pMa1-c and pMBot protein preparations was
attempted as follows.
[0594] Samples of pMa1-c and pMBot protein were depyrogenated with
polymyxin to determine if the endotoxin could be easily removed.
The following amount of protein was treated: 29 ml at 4.8
OD.sub.280/ml for pMa1-c and 19 mls at 1.44 OD.sub.280 ml for
pMBot. The protein samples were dialyzed extensively against PBS
and mixed in a 50 ml tube (Falcon) with 0.5 ml PBS-equilibrated
polymyxin B (Affi-Prep Polymyxin, BioRad). The samples were allowed
to mix by rotating the tubes overnight at 4.degree. C. The
polymyxin was pelleted by centrifugation for 30 min in a bench top
centrifuge at maximum speed (approximately 2000.times.g) and the
supernatant was removed. The recovered protein (in the supernatant)
was quantified by OD.sub.280, and the endotoxin activity was
assayed by LAL. In both cases only approximately 1/3 of the input
protein was recovered and the polymyxin-treated protein retained
significant endotoxin contamination (approximately 7000 EU/mg of
pMBot).
[0595] The depyrogenation experiment was repeated using an
independently purified pMa1-c protein preparation and similar
results were obtained. From these studies it was concluded that
significant levels of endotoxin copurifies with these MBP fusion
proteins using the amylose resin. Furthermore, this endotoxin
cannot be easily removed by polymyxin treatment.
[0596] These results suggest that the presence of the MBP sequences
on the fusion protein complicated the removal of endotoxin from
preparations of the pMBot protein.
[0597] b) Generation of C. botulinum C Fragment Protein Free of the
MBP
[0598] It was demonstrated that the pMBot fusion protein could not
be easily purified from contaminating endotoxin in section a)
above. The ability to produce a pyrogen-free (e.g., endotoxin-free)
preparation of soluble botulinal C fragment protein free of the MBP
tag was next investigated. The pMBot expression construct was
designed to facilitate purification of the botulinal C fragment
from the MBP tag by cleavage of the fusion protein by utilizing an
engineered Factor Xa cleavage site present between the MBP and the
botulinal C fragment. The Factor Xa cleavage was performed as
follows.
[0599] Factor Xa (New England Biolabs) was added to the pMBot
protein (using a 0.1-1.0% Factor Xa/pMBot protein ratio) in a
variety of buffer conditions [e.g., PBS-NaCl (PBS containing 0.5 M
NaCl), PBS-NaCl containing 0.2% Tween 20, PBS, PBS containing 0.2%
Tween 20, PBS-C (PBS containing 2 mM CaCl.sub.2), PBS-C containing
either 0.1 or 0.5% Tween 20, PBS-C containing either 0.1 or 0.5%
NP-40, PBS-C containing either 0.1 or 0.5% Triton X-100, PBS-C
containing 0.1% sodium deoxycholate, PBS-C containing 0.1% SDS].
The Factor Xa digestions were incubated for 12-72 hrs at room
temperature.
[0600] The extent of cleavage was assessed by Western blot or
Coomassie blue staining of proteins following electrophoresis on
denaturing SDS-PAGE gels, as described in Example 22. Cleavage
reactions (and control samples of uncleaved pMBot protein) were
centrifuged for 2 min in a microfuge to remove insoluble protein
prior to loading the samples on the gel. The Factor Xa treated
samples were compared with uncleaved, uncentrifuged pMBot samples
on the same gel. The results of this analysis is summarized
below.
[0601] 1) Most (about 90%) pMBot protein could be removed by
centrifugation, even when uncleaved control samples were utilized.
This indicated that the pMBot fusion protein was not fully soluble
(i.e., it exists as a suspension rather than as a solution). [This
result was consistent with the observation that most
affinity-purified pMBot protein precipitates after long term
storage (>2 weeks) at 4.degree. C. Additionally, the majority
(i.e., 75%) of induced pMBot protein remains in the pellet after
sonication and clarification of the induced E. coli. Resuspension
of these insoluble pellets in PBS followed by sonication results in
partial solubilization of the insoluble pMBot protein in the
pellets.]
[0602] 2) The portion of pMBot protein that is fully in solution
(about 10% of pMBot protein) is completely cleaved by Factor Xa,
but the cleaved (released) botulinal C fragment is relatively
insoluble such that only the cleaved MBP remains fully in
solution.
[0603] 3) None of the above reaction conditions enhanced solubility
without also reducing-effective cleavage. Conditions that
effectively solubilized the cleaved botulinal C fragment were not
identified.
[0604] 4) The use of 0.1% SDS in the buffer used for Factor Xa
cleavage enhanced the solubility of the pMBot protein (all of pMBot
protein was soluble). However, the presence of the SDS prevented
any cleavage of the fusion protein with Factor Xa.
[0605] 5) Analysis of pelleted protein from the cleavage reactions
indicated that both full length pMBot (i.e., uncleaved) and cleaved
botulinal C fragment protein precipitated during incubation.
[0606] These results demonstrate that purification of soluble
botulinal C fragment protein after cleavage of the pMBot fusion
protein is complicated by the insolubility of both the pMBot
protein and the cleaved botulinal C fragment protein.
[0607] c) Expression of C. botulinum C Fragment Using Various
Expression Vectors
[0608] In order to determine if the solubility of the botulinal C
fragment was enhanced by expressing the C fragment protein as a
native protein, an N-terminal His-tagged protein or as a fusion
with glutathione-S-transfera- se (GST), alternative expression
plasmids were constructed. These expression constructs were
generated utilizing the methodologies described in Example 22. FIG.
27 provides a schematic representation of the vectors described
below.
[0609] In FIG. 27, the following abbreviations are used. pP refers
to the pET23 vector. pHIS refers to the pETHisa vector. pBlue
refers to the pBluescript vector. pM refers to the pMAL-c vector
and pG refers to the pGEX3T vector (described in Example 11). The
solid black lines represent C. botulinum C fragment gene sequences;
the solid black ovals represent the MBP; the hatched ovals
represent GST; "HHHHH" represents the poly-histidine tag. In FIG.
27, when the name for a restriction enzyme appears inside
parenthesis, this indicates that the restriction site was destroyed
during construction. An asterisk appearing with the name for a
restriction enzyme indicates that this restriction site was
recreated at a cloning junction.
[0610] i) Construction of pPBot
[0611] In order to express the C. botulinum C fragment as a native
(i.e., non-fused) protein, the pPBot plasmid (shown schematically
in FIG. 27) was constructed as follows. The C fragment sequences
present in pAlterBot (Example 22) were removed by digestion of
pAlterBot with NcoI and HindIII. The NcoI/HindIII C fragment insert
was ligated to pETHisa vector (described in Example 18b) which was
digested with NcoI and HindIII. This ligation creates an expression
construct in which the NcoI-encoded methionine of the botulinal C
fragment is the initiator codon and directs expression of the
native botulinal C fragment. The ligation products were used to
transform competent BL21(DE3)pLysS cells (Novagen). Recombinant
clones were identified by restriction mapping.
[0612] ii) Construction of pHisBot
[0613] In order to express the C. botulinum C fragment containing a
poly-histidine tag at the amino-terminus of the recombinant
protein, the pHisBot plasmid (shown schematically in FIG. 27) was
constructed as follows. The NcoI/HindIII botulinal C fragment
insert from pAlterbot was ligated into the pETHisa vector which was
digested with NheI and HindIII. The NcoI (on the C fragment insert)
and NheI (on the pETHisa vector) sites were filled in using the
Klenow fragment prior to ligation; these sites were then blunt end
ligated (the NdeI site was regenerated at the clone junction as
predicted). The ligation products were used to transform competent
BL21(DE3)pLysS cells and recombinant clones were identified by
restriction mapping.
[0614] The resulting pHisBot clone expresses the botulinal C
fragment protein with a histidine-tagged N-terminal extension
having the following sequence: MetGlyH is His
HisHisHisHisHisHisHisHisSerSerGlyHisIleGluGlyArg- HisMetAla (SEQ ID
NO:24); the amino acids encoded by the botulinal C fragment gene
are underlined and the vector encoded amino acids are presented in
plain type. The nucleotide sequence present in the pETHisa vector
which encodes the pHisBot fusion protein is listed in --SEQ ID
NO:25. The amino acid sequence of the pHisBot protein is listed in
SEQ ID NO:26.
[0615] iii) Construction of pGBot
[0616] The botulinal C fragment protein was expressed as a fusion
with the glutathione-S-transferase protein by constructing the
pGBot plasmid (shown schematically in FIG. 27). This expression
construct was created by cloning the NotI/SalI C fragment insert
present in pBlueBot (Example 22) into the pGEX3T vector which was
digested with SmaI and XhoI. The NotI site (present on the
botulinal fragment) was made blunt prior to ligation using the
Klenow fragment. The ligation products were used to transform
competent BL21 cells.
[0617] Each of the above expression constructs were tested by
restriction digestion to confirm the integrity of the
constructs.
[0618] Large scale (1 liter) cultures of pPBot [BL21(DE3)pLysS
host], pHisBot [BL21(DE3)pLysS host] and pGBot (BL21 host) were
grown in 2.times. YT medium and induced (using IPTG to 0.8-1.0 mM)
for 3 hrs as described in Example 22. Total, soluble and insoluble
protein preparations were prepared from 1 ml aliquots of each large
scale culture [Williams et al. (1994), supra] and analyzed by
SDS-PAGE. No obvious induced band was detectable in the pPBot or
pHisBot samples by Coomassie staining, while a prominent insoluble
band of the anticipated MW was detected in the pGBot sample.
Soluble lysates of the pGBot large scale (resuspended in PBS) or
pHisBot large scale [resuspended in Novagen 1.times. binding buffer
(5 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9)] cultures were
prepared and used to affinity purify soluble affinity-tagged
protein as follows.
[0619] The pGBot lysate was affinity purified on a
glutathione-agarose resin (Pharmacia) exactly as described in Smith
and Corcoran [Current Protocols in Molecular Biology, Supplement 28
(1994), pp. 16.7.1-16.7.7]. The pHisBot protein was purified on the
His-Bind resin (Novagen) utilizing the His-bind buffer kit
(Novagen) exactly as described by manufacturer.
[0620] Samples from the purification of both the pGBot and pHisBot
proteins (including uninduced, induced, total, soluble, and
affinity-purified eluted protein) were resolved on SDS-PAGE gels.
Following electrophoresis, proteins were analyzed by Coomassie
staining or by Western blot detection utilizing a chicken anti-C.
botulinum Type A toxoid antibody (as described in Example 22).
[0621] These studies showed that the pGBot protein was almost
entirely insoluble under the utilized conditions, while the pHisBot
protein was soluble. Affinity purification of the pHisBot protein
on this first attempt was inefficient, both in terms of yield (most
of the immunoreactive botulinal protein did not bind to the
His-bind resin) and purity (the botulinal protein was estimated to
comprise approximately 20% of the total eluted protein).
[0622] d) Purification of Soluble C. botulinum C Fragment Protein
Substantially Free of Endotoxin Contamination
[0623] The above studies showed that the pHisBot protein was
expressed in E. coli as a soluble protein. However, the affinity
purification of this protein on the His-bind resin was very
inefficient. In order to improve the affinity purification of the
soluble pHisBot protein (in terms of both yield and purity), an
alternative poly-histidine binding affinity resin (Ni-NTA resin;
Qiagen) was utilized. The Ni-NTA resin was reported to have a
superior binding affinity (Kd=1.times.10.sup.-13 at pH 8.0; Qiagen
user manual) relative to the His-bind resin.
[0624] A soluble lysate (in Novagen IX binding buffer) from an
induced 1 liter 2.times. YT culture was prepared as described
above. Briefly, the culture of pHisBot [Bl21(DE3)pLysS host] was
grown at 37.degree. C. to an OD.sub.600 of 0.7 in 1 liter of
2.times. YT medium containing 100 .mu.g/ml ampicillin, 34 .mu.g/ml
chloramphenicol and 0.2% glucose. Protein expression was induced by
the addition of IPTG to 1 mM. Three hours after the addition of the
IPTG, the cells were cooled for 15 min in a ice water bath and then
centrifuged 10 min at 5000 rpm in a JA10 rotor (Beckman) at
4.degree. C. The pellets were resuspended in a total volume of 40
mls Novagen 1.times. binding buffer (5 mM imidazole, 0.5 M NaCl, 20
mM Tris-HCl, pH 7.9), transferred to two 35 ml Oakridge tubes and
frozen at -70.degree. C. for at least 1 hr. The tubes were thawed
and the cells were lysed by sonication (4.times.20 second bursts
using a Branson Sonifier 450 with a power setting of 6-7) on ice.
The suspension was clarified by centrifugation for 20 min at 9,000
rpm (10,000.times.g) in a JA-17 rotor (Beckman).
[0625] The soluble lysate was brought to 0.1% NP40 and then was
batch absorbed to 7 ml of a 1:1 slurry of Ni-NTA resin:binding
buffer by stirring for 1 hr at 4.degree. C. The slurry was poured
into a column having an internal diameter of 1 or 2.5 cm (BioRad).
The column was then washed sequentially with 15 mls of Novagen IX
binding buffer containing 0.1% NP40, 15 ml of Novagen 1.times.
binding buffer, 15 ml wash buffer (60 mM imidazole, 0.5 M NaCl, 20
mM Tris-HCl, pH 7.9) and 15 ml NaHPO.sub.4 wash buffer (50 mM
NaHPO.sub.4, pH 7.0, 0.3 M NaCl, 10% glycerol). The bound protein
was eluted by protonation of the resin using elution buffer (50 mM
NaHPO.sub.4, pH 4.0, 0.3 M NaCl, 10% glycerol). The eluted protein
was stored at 4.degree. C.
[0626] Samples of total, soluble and eluted protein were resolved
by SDS-PAGE. Protein samples were prepared for electrophoresis as
described in Example 22b. Duplicate gels were stained with
Coomassie blue to visualize the resolved proteins and C. botulinum
type A toxin-reactive protein was detected by Western blot analysis
as described in Example 22b. A representative Coomassie stained gel
is shown in FIG. 28. In FIG. 28, the following samples were loaded
on the 12.5% acrylamide gel. Lanes 1-4 contain respectively total
protein, soluble protein, soluble protein present in the
flow-through of the Ni-NTA column and affinity-purified pHisBot
protein (i.e., protein released from the Ni-NTA resin by
protonation). Lane 5 contains high molecular weight protein markers
(BioRad).
[0627] The purification of pHisBot protein resulted in a yield of 7
mg of affinity purified protein from a 1 liter starting culture of
BL21(DE3)pLysS cells harboring the pHisBot plasmid. The yield of
purified pHisBot protein represented approximately 0.4% of the
total soluble protein in the induced culture. Analysis of the
purified pHisBot protein by SDS-PAGE revealed that at least 90-95%
of the protein was present as a single band (FIG. 28) of the
predicted MW (50 kD). This 50 kD protein band was immunoreactive
with anti-C. botulinum type A toxin antibodies. The extinction
coefficient of the protein preparation was determined to be 1.4
(using the Pierce BCA assay) or 1.45 (using the Lowry assay)
OD.sub.280 per 1 mg/ml solution.
[0628] Samples of pH neutralized eluted pHisBot protein were
resolved on a KB 803 HPLC column (Shodex). Although His-tagged
proteins are retained by this sizing column (perhaps due to the
inherent metal binding ability of the proteins), the relative
mobility of the pHisBot protein was consistent with that expected
for a non-aggregated protein in solution. Most of the induced
pHisBot protein was determined to be soluble under the growth and
solubilization conditions utilized above (i.e., greater than 90% of
the pHisBot protein was found to be soluble as judged by comparison
of the levels of pHisBot protein seen in total and soluble protein
samples prepared from BL21(DE3)pLysS cells containing the pHisBot
plasmid). SDS-PAGE analysis of samples obtained after
centrifugation, extended storage at -20.degree. C., and at least 2
cycles of freezing and thawing detected no protein loss (due to
precipitation), indicating that the pHisBot protein is soluble in
the elution buffer (i.e., 50 mM NaHPO.sub.4, pH 4.0, 0.3 M NaCl,
10% glycerol).
[0629] Determination of endotoxin contamination in the affinity
purified pHisBot preparation (after pH neutralization) using the
LAL assay (Associates of Cape Cod) detected no significant
endotoxin contamination. The assay was performed using the endpoint
chromogenic method (without diazo-coupling) according to the
manufacturer's instructions. This method can detect concentrations
of endotoxin greater than or equal to 0.03 EU/ml (EU refers to
endotoxin units). The LAL assay was run using 0.5 ml of a solution
comprising 0.5 mg pHisBot protein in 50 mM NaHPO.sub.4, pH 7.0, 0.3
M NaCl, 10% glycerol; 30-60 EU were detected in the 0.5 ml sample.
Therefore, the affinity purified pHisBot preparation contains
60-120 EU/mg of protein. FDA Guidelines for the administration of
parenteral drugs require that a composition to be administered to a
human contain less than 5 EU/kg body weight (The average human body
weight is 70 kg; therefore up to 349 EU units can be delivered in a
parental dose.). Because very small amount of protein are
administered in a vaccine preparation (generally in the range of
10-500 .mu.g of protein), administration of affinity purified
pHisBot containing 60-120 EU/mg protein would result in delivery of
only a small percentage of the permissible endotoxin load. For
example, administration of 10-500 .mu.g of purified pHisBot to a 70
kg human, where the protein preparation contains 60 EU/mg protein,
results in the introduction of only 0.6 to 30 EU [i.e., 0.2 to 8.6%
of the maximum allowable endotoxin burden per parenteral dose (less
than 5 EU/kg body weight)].
[0630] The above results demonstrate that endotoxin (LPS) does not
copurify with the pHisBot protein using the above purification
scheme. Preparations of recombinantly produced pHisBot protein
containing lower levels of endotoxin (less than or equal to 2 EU/mg
recombinant protein) may be produced by washing the Ni-NTA column
with wash buffer until the OD.sub.280 returns to baseline levels
(i.e., until no more UV-absorbing material comes off of the
column).
[0631] The above results illustrate a method for the production and
purification of soluble, botulinal C fragment protein substantially
free of endotoxin.
EXAMPLE 25
Optimization of the Expression and Purification of pHisBot
Protein
[0632] The results shown in Example 24d demonstrated that the
pHisBot protein is an excellent candidate for use as a vaccine as
it could be produced as a soluble protein in E. coli and could be
purified free of pyrogen activity. In order to optimize the,
expression and purification of the pHisBot protein, a variety of
growth and purification conditions were tested.
[0633] a) Growth Parameters
[0634] i) Host Strains
[0635] The influence of the host strain utilized upon the
production of soluble pHisBot protein was investigated. A large
scale purification of pHisBot was performed [as described in
Example 24d above] using the BL21(DE3) host (Novagen) rather than
the BL21(DE3)pLysS host. The deletion of the pLysS plasmid in the
BL21(DE3) host yielded higher levels of expression due to
de-repression of the plasmid's T7-lac promoter. However, the yield
of affinity-purified soluble recombinant protein was very low
(approximately 600 .mu.g/liter culture) when purified under
conditions identical to those described in Example 24d above. This
result was due to the fact that expression in the BL21(DE3) host
yielded very high level expression of the pHisBot protein as
insoluble inclusion bodies as shown by SDS-PAGE analysis of protein
prepared from induced BL21(DE3) cultures (FIG. 29, lanes 1-7,
described below). These results demonstrate that the pHisBot
protein is not inherently toxic to E. coli cells and can be
expressed to high levels using the appropriate promoter/host
combination.
[0636] FIG. 29 shows a Coomassie blue stained SDS-PAGE gel (12.5%
acrylamide) onto which extracts prepared from BL21(DE3) cells
containing the pHisBot plasmid were loaded. Each lane was loaded
with 2.5 .mu.l protein sample mixed with 2.5 .mu.l of 2.times. SDS
sample buffer. The samples were handled as described in Example
22b. The following samples were applied to the gel. Lanes 1-7
contain protein isolated from the BL21(DE3) host. Lanes 8-14
contain proteins isolated from the BL21(DE3)pLysS host. Total
protein was loaded in lanes 1, 2, 4, 6, 8, 10 and 12. Soluble
protein was loaded in Lanes 3, 5, 7, 9, 11 and 13. Lane 1 contains
protein from uninduced host cells. Lanes 2-13 contain protein from
host cells induced for 3 hours. IPTG was added to a final
concentration of 0.1 mM (Lanes 6-7), 0.3 mM (Lanes 4-5) or 1.0 mM
(Lanes 2, 3, 8-13). The cultures were grown in LB broth (Lanes
8-9), 2.times. YT broth (Lanes 10-11) or terrific broth (Lanes 1-7,
12-13). The pHisBot protein seen in Lanes 3, 5 and 7 is insoluble
protein which spilled over from Lanes 2, 4 and 6, respectively.
High molecular weight protein markers (BioRad) were loaded in Lane
14.
[0637] A variety of expression conditions were tested to determine
if the BL21(DE3) host could be utilized to express soluble pHisBot
protein at suitably high levels (i.e, about 10 mg/ml). The
conditions altered were temperature (growth at 37 or 30.degree.
C.), culture medium (2.times. YT, LB or Terrific broth) and inducer
levels (0.1, 0.3 or 1.0 mM IPTG). All combinations of these
variables were tested and the induction levels and solubility was
then assessed by S9S-PAGE analysis of total and soluble extracts
[prepared from 1 ml samples as described in Williams et al.,
(1994), supra].
[0638] All cultures were grown in 15 ml tubes (Falcon #2057). All
culture medium was prewarmed overnight at the appropriate
temperature and were supplemented with 100 .mu.g/ml ampicillin and
0.2% glucose. Terrific broth contains 12 g/l bacto-tryptone, 24 g/l
bacto-yeast extract and 100 ml/l of a solution comprising 0.17 M
KH.sub.2PO.sub.4, 0.72 M K.sub.2HPO.sub.4. Cultures were grown in a
incubator on a rotating wheel (to ensure aeration) to an OD.sub.600
of approximately 0.4, and induced by the addition of IPTG. In all
cases, high level expression of insoluble pHisBot protein was
observed, regardless of temperature, medium or inducer
concentration.
[0639] The effect of varying the concentration of IPTG upon
2.times. YT cultures grown at 23.degree. C. was then investigated.
IPTG was added to a final concentration of either 1 mM, 0.1 mM,
0.05 .mu.M or 0.01 nM. At this temperature, similar levels of pHis
Bot protein was induced in the presence of either 1 or 0.1 mM IPTG;
these levels of expression was lower than that observed at higher
temperatures. Induced protein levels were reduced at 0.05 mM IPTG
and absent at 0.01 mM IPTG (relative to 1.0 and 0.1 mM IPTG
inductions at 23.degree. C.). However, no conditions were observed
in which the induced pHisBot protein was soluble in this host.
Thus, although expression levels are superior in the BL21(DE3) host
(as compared to the BL21(DE3)pLysS host), conditions that
facilitate the production of soluble protein in this host could not
be identified.
[0640] These results demonstrate that production of soluble pHisBot
protein was achieved using the BL21(DE3)pLysS host in conjunction
with the T7-lac promoter.
[0641] ii) Effect of Varying Temperature, Medium and IPTG
Concentration and Length of Induction
[0642] The effect growing the host cells in various mediums upon
the expression of recombinant botulinal protein from the pHisBot
expression construct [in the BL21(DE3)pLysS host] was investigated.
BL21(DE3)pLysS cells containing the pHisBot plasmid were grown in
either LB, 2.times. YT or Terrific broth at 37.degree. C. The cells
were induced using 1 mM IPTG for a 3 hr induction period.
Expression of pHisBot protein was found to be the highest when the
cells were grown in 2.times. YT broth (see FIG. 29, lanes
8-13).
[0643] The cells were then grown at 30.degree. C. in 2.times. YT
broth and the concentration of IPTG was varied from 1.0, 0.3 or 0.1
mM and the length of induction was either 3 or 5 hours. Expression
of pHisBot protein was similar at all 3 inducer concentrations
utilized and the levels of induced protein were higher after a 5 hr
induction as compared to a 3 hr induction.
[0644] Using the conditions found to be optimal for the expression
of pHisBot protein, a large scale culture was grown in order to
provide sufficient material for a large scale purification of the
pHisBot protein. Three 1 liter cultures were grown in 2.times. YT
medium containing 100 .mu.g/ml ampicillin, 34 .mu.g/ml
chloramphenicol and 0.2% glucose. The cultures were grown at
30.degree. C. and were induced with 1.0 mM IPTG for a 5 hr period.
The cultures were harvested and a soluble lysate were prepared as
described in Example 18. A large scale purification was performed
as described in Example 24d with the exception that except the
soluble lysate was batch absorbed for 3 hours rather than for 1
hour. The final yield was 13 mg pHisBot protein/liter culture. The
pHisBot protein represented 0.75% of the total soluble protein.
[0645] The above results demonstrate growth conditions under which
soluble pHisBot protein is produced (i.e., use of the
BL21(DE3)pLysS host, 2.times. YT medium, 30.degree. C., 1.0 mM IPTG
for 5 hours).
[0646] b) Optimization Of Purification Parameters
[0647] For optimization of purification conditions, large scale
cultures (3.times.1 liter) were grown at 30.degree. C. and induced
with 1 mM IPTG for 5 hours as described above. The cultures were
pooled, distributed to centrifuge bottles, cooled and pelleted as
described in Example 24d. The cell pellets were frozen at
-70.degree. C. until used. Each cell pellet represented 1/3 of a
liter starting culture and individual bottles were utilized for
each optimization experiment described below. This standardized the
input bacteria used for each experiment, such that the yields of
affinity purified pHisBot protein could be compared between
different optimization experiments.
[0648] i) Binding Specificity (pH Protonation)
[0649] A lysate of pHisBot culture was prepared in PBS (pH 8.0) and
applied to a 3 ml Ni-NTA column equilibrated in PBS (pH 8.0) using
a flow rate of 0.2 ml/min (3-4 column volumes/hr) using an Econo
chromatography system (BioRad). The column was washed with PBS (pH
8.0) until the absorbance (OD.sub.280) of the elute was at baseline
levels. The flow rate was then increased to 2 ml/min and the column
was equilibrated in PBS (pH 7.0). A pH gradient (pH 7.0 to 4.0 in
PBS) was applied in order to elute the bound pHisBot protein from
the column. Fractions were collected and aliquots were resolved on
SDS-PAGE gels. The PAGE gels were subjected to Western blotting and
the pHisBot protein was detected using a chicken anti-C. botulinum
Type A toxoid antibody as described in Example 22.
[0650] From the Western blot analysis it was determined that the
pHisBot protein begins to elute from the Ni-NTA column at pH 6.0.
This is consistent with the predicted elution of a His-tagged
protein monomer at pH 5.9.
[0651] These results demonstrate that the pH at which the pHisBot
protein is protonated (released) from Ni-NTA resin in PBS buffer is
pH 6.0.
[0652] ii) Binding Specificity (Imidazole Competition)
[0653] In order to define purification conditions under which the
native E. coli proteins could be removed from the Ni-NTA column
while leaving the pHisBot protein bound to the column, the
following experiment was performed. A lysate of pHisBot culture was
prepared in 50 mM NaHPO.sub.4, 0.5 M NaCl, 8 mM imidazole (pH 7.0).
This lysate was applied to a 3 ml Ni-NTA column equilibrated in 50
mM NaHPO.sub.4, 0.5 M NaCl (pH 7.0) using an Econo chromatography
system (BioRad). A flow rate of 0.2 ml/min (3-4 column volumes/hr)
was utilized. The column was washed with 50 mM NaHPO.sub.4, 0.5 M
NaCl (pH 7.0) until the absorbance of the elute returned to
baseline. The flow rate was then increased to 2 ml/min.
[0654] The column was eluted using an imidazole step gradient [in
50 mM NaHPO.sub.4, 0.5 M NaCl (pH 7.0)]. Elution steps were 20 mM,
40 mM, 60 mM, 80 mM, 100 mM, 200 mM, 1.0 M imidazole, followed by a
wash using 0.1 mM EDTA (to strip the nickel from the column and
remove any remaining protein). In each step, the wash was continued
until the OD.sub.280 returned to baseline. Fractions were resolved
on SDS-PAGE gels, Western blotted, and pHisBot protein detected
using a chicken anti-C. botulinum Type A toxoid antibody as
described in Example 22. Duplicate gels were stained with Coomassie
blue to detect eluted protein in each fraction.
[0655] The results of the PAGE analysis showed that most of the
non-specifically binding bacterial protein was removed by the 20 mM
imidiazole wash, with the remaining bacterial proteins being
removed in the 40 and 60 mM imidazole washes. The pHisBot protein
began to elute at 100 mM imidazole and was quantitatively eluted in
200 mM imidazole.
[0656] These results precisely defined the window of imidazole wash
stringency that optimally removes E. coli proteins from the column
while specifically retaining the pHisBot protein in this buffer.
These results provided conditions under which the pHisBot protein
can be purified free of contaminating host proteins.
[0657] iii) Purification Buffers and Optimized Purification
Protocols
[0658] A variety of purification parameters were tested during the
development of an optimized protocol for batch purification of
soluble pHisBot protein. The results of these analyses are
summarized below.
[0659] Batch purifications were performed (as described in Example
24d) using several buffers to determine if alternative buffers
could be utilized for binding of the pHisBot protein to the Ni-NTA
column. It was determined that quantitative binding of pHisBot
protein to the Ni-NTA resin was achieved in either Tris-HCl (pH
7.9) or NaHPO.sub.4 (pH 8.0) buffers. Binding of the pHisBot
protein in NaHPO.sub.4 buffer was not inhibited using 5 mM, 8 mM or
60 mM imidazole. Quantitative elution of bound pHisBot protein was
obtained in buffers containing 50 mM NaHPO.sub.4, 0.3 M NaCl (pH
3.5-4.0), with or without 10% glycerol. However, quantitation of
soluble affinity purified pHisBot protein before and after a freeze
thaw (following several weeks storage of the affinity purified
elute at -20.degree. C.) revealed that 94% of the protein was
recovered using the glycerol-containing buffer, but only 68% of the
protein was recovered when the buffer lacking glycerol was
employed. This demonstrates that glycerol enhanced the solubility
of the pHisBot protein in this low pH buffer when the eluted
protein was stored at freezing temperatures (e.g., -20.degree. C.).
Neutralization of pH by addition of NaH.sub.2PO.sub.4 buffer did
not result in obvious protein precipitation.
[0660] It was determined that quantitative binding of pHisBot
protein using the batch format occurred after 3 hrs (FIG. 30), but
not after 1 hr of binding at 4.degree. C. (the resin was stirred
during binding). FIG. 30 depicts a Coomaisse blue stained SDS-PAGE
gel (7.5% acrylamide) containing samples of proteins isolated
during the purification of pHisBot protein from lysate prepared
from the BL21(DE3)pLysS host. Each lane was loaded with 5 .mu.l of
protein sample mixed with 5 .mu.l of 2.times. sample buffer and
processed as described in Example 22b. Lane 1 contains high
molecular weight protein markers (BioRad). Lanes 2 and 3 contain
protein eluted from the Ni-NTA resin. Lane 4 contains soluble
protein after a 3 hr batch incubation with the Ni-NTA resin. Lanes
5 and 6 contain soluble and total protein, respectively. FIG. 30
demonstrates that the pHisBot protein is completely soluble
[compare Lanes 5 and 6 which show that a similar amount of the 50
kD pHisBot protein is seen in both; if a substantial amount
(greater than 20%) of the pHisBot protein were partially insoluble
in the host cell, more pHisBot protein would be seen in lane 6
(total protein) as compared to lane 5 (soluble protein)]. FIG. 30
also demonstrates that the pHisBot protein is completely removed
from the lysate after batch absorption with the Ni-NTA resin for 3
hours (compare Lanes 4 and 5).
[0661] The reported high affinity interaction of the Ni-NTA resin
with His-tagged proteins (K.sub.d=1.times.10.sup.-13 at pH 8.0)
suggested that it should be possible to manipulate the
resin-protein complexes without significant release of the bound
protein. Indeed, it was determined that after the recombinant
protein was bound to the Ni-NTA resin, the resin-pHisBot protein
complex was highly stable and remained bound following repeated
rounds of centrifugation of the resin for 2 min at 1600.times.g.
When this centrifugation step was performed in a 50 ml tube
(Falcon), a tight resin pellet formed. This allowed the removal of
spent soluble lysate by pouring off the supernatant followed by
resuspension of the pellet in wash buffer. Further washes can be
performed by centrifugation. The ability to perform additional
washes permits the development of protocols for batch absorption of
large volumes of lysate with removal of the lysate being performed
simply by centrifugation following binding of the recombinant
protein to the resin.
[0662] A simplified, integrated purification protocol was developed
as follows. A soluble lysate was made by resuspending the induced
cell pellet in binding buffer [50 mM NaHPO.sub.4, 0.5 M NaCl, 60 mM
imidazole (pH 8.0)], sonicating 4.times.20 sec and centrifuging for
20 min at 10,000.times.g. NP-40 was added to 0.1% and Ni-NTA resin
(equilibrated in binding buffer) was added. Eight milliliters of a
1:1 slurry (resin:binding buffer) was used per liter of starting
culture. The mixture was stirred for 3 hrs at 4.degree. C. The
slurry was poured into a column having a 1 cm internal diameter
(BioRad), washed with binding buffer containing 0.1% NP40, then
binding buffer until baseline was established (these steps may
alternatively be performed by centrifugation of the resin,
resuspension in binding buffer containing NP40 followed by
centrifugation and resuspension in binding buffer). Imidazole was
removed by washing the resin with 50 mM NaHPO.sub.4, 0.3M NaCl (pH
7.0). Protein bound to the resin was eluted using the same buffer
(50 mM NaHPO.sub.4, 0.3M NaCl) having a reduced pH (pH
3.5-4.0).
[0663] A pilot purification was performed following this protocol
and yielded 18 mg/liter affinity-purified pHisBot. The pHisBot
protein was greater than 90% pure as estimated by Coomassie
staining of an SDS-PAGE gel. This represents the highest observed
yield of soluble affinity-purified pHisBot protein and this
protocol eliminates the need for separate imidazole-containing
binding and wash buffers. In addition to providing a simplified and
efficient protocol for the affinity purification of recombinant
pHisBot protein, the above results provide a variety of
purification conditions under which pHisBot protein can be
isolated.
EXAMPLE 26
The pHisBot Protein is an Effective Immunogen
[0664] In Example 23 it was demonstrated that neutralizing
antibodies are generated in mouse serum after nasal immunization
with the pMBot protein. However, the pMBot protein was found to
copurify with significant amounts of endotoxin which could not be
easily removed. The pHisBot protein, in contrast, could be isolated
free of significant endotoxin contamination making pHisBot a
superior candidate for vaccine production. To further assess the
suitability of pHisBot as a vaccine, the immunogenicity of the
pHisBot protein was determined and a comparison of the relative
immunogenicity of pMBot and pHisBot proteins in mice was performed
as follows.
[0665] Two groups of eight BALBc mice were immunized with either
pMBot protein or pHisBot protein using Gerbu GMDP adjuvant (CC
Biotech). pMBot protein (in PBS containing 10 mM maltose) or
pHisBot protein (in 50 mMNaHPO.sub.4, 0.3 M NaCl, 10% glycerol, pH
4.0) was mixed with Gerbu adjuvant and used to immunize mice. Each
mouse received an IP injection of 100 .mu.l antigen/adjuvant mix
(50 .mu.g antigen plus 1 .mu.g adjuvant) on day 0. Mice were
boosted as described above with the exception that the route of
administration was IM on day 14 and 28. The mice were bled on day
77 and anti-C. botulinum Type A toxoid titers were determined using
serum collected from individual mice in each group (as described in
Example 23). The results are shown in Table 41.
42TABLE 41 Anti-C. botulinum Type A Toxoid Serum IgG Titers In
Individual Mice Immunized With pMBot or pHisBot Protein
Preimmune.sup.1 pMBot.sup.2 pHisBot.sup.2 Sample Dilution Sample
Dilution Sample Dilution Mouse # 1:50 1:250 1:1250 1:6250 1:50
1:250 1:1250 1:6250 1:50 1:250 1:1250 1:620 1 0.678 0.190 0.055
0.007 1.574 0.799 0.320 0.093 2 1.161 0.931 0.254 0.075 1.513 0.829
0.409 0.134 3 1.364 0.458 0.195 0.041 1.596 1.028 0.453 0.122 4
1.622 1.189 0.334 0.067 1.552 0.840 0.348 0.090 5 1.612 1.030 0.289
0.067 1.629 1.580 0.895 0.233 6 0.913 0.242 0.069 0.013 1.485 0.952
0.477 0.145 7 0.910 0.235 0.058 0.014 1.524 0.725 0.269 0.069 8
0.747 0.234 0.058 0.014 1.274 0.427 0.116 0.029 Mean 0.048 0.021
0.011 0.002 1.133 0.564 0.164 0.037 1.518 0.896 0.411 0.114 Titer
.sup.1The preimmune sample represents the average from 2 sets of
duplicate wells containing serum from a individual mouse immunized
with recombinant Staphylococcus enterotoxin B (SEB) antigen. This
antigen is immunologically unrelated to C. botulinum toxin and
provides a control serum. .sup.2Average of duplicate wells.
[0666] The results shown above in Table 41 demonstrate that both
the pMBot and pHisBot proteins are immunogenic in mice as 100% of
the mice (8/8) in each group seroconverted from non-immune to
immune status. The results also show that the average titer of
anti-C. botulinum Type A toxoid IgG is 2-3 fold higher after
immunization with the pHisBot protein relative to immunization with
the pMBot protein. This suggests that the pHisBot protein may be a
superior immunogen to the pMBot protein.
EXAMPLE 27
Immunization with the Recombinant pHisBot Protein Generates
Neutralizing Antibodies
[0667] The results shown in Example 26 demonstrated that both the
pHisBot and pMBot proteins were capable of inducing high titers of
anti-C. botulinum type A toxoid-reactive antibodies in immunized
hosts. The ability of the immune sera from mice immunized with
either the pHisBot or pMBot proteins to neutralize C. botulinum
type A toxoid in vivo was determined using the mouse neutralization
assay described in Example 23b.
[0668] The two groups of eight BALBc mice immunized with either
pMBot protein or pHisBot protein in Example 26 were boosted again
one week after the bleeding on day 77. The boost was performed by
mixing pMBot protein (in PBS containing 10 mM maltose) or pHisBot
protein (in 50 mM NaHPO.sub.4, 0.3 M NaCl, 10% glycerol, pH 4.0)
with Gerbu adjuvant as described in Example 26. Each mouse received
an IP injection of 100 .mu.l antigen/adjuvant mix (50 .mu.g antigen
plus 1 .mu.g adjuvant). The mice were bled 6 days after this boost
and the serum from mice within a group was pooled. Serum from
preimmune mice was also collected (this serum is the same serum
described in the footnote to Table 41).
[0669] The presence of neutralizing antibodies in the pooled or
preimmune serum was detected by challenging mice with 5 LD.sub.50
units of type A toxin mixed with 100 .mu.l of pooled serum. The
challenge was performed by mixing (per mouse to be injected) 100
.mu.l of serum from each pool with 100 .mu.l of purified type A
toxin standard (50 LD.sub.50/ml prepared as described in Example
23b) and 500 .mu.l of gel-phosphate. The mixtures were incubated
for 30 min at room temperature with occasional mixing. Each of four
mice were injected IP with the mixtures (0.7 ml/mouse). The mice
were observed for signs of botulism for 72 hours. Mice receiving
toxin mixed with serum from mice immunized with either the pHisBot
or pMBot proteins showed no signs of botulism intoxication. In
contrast, mice receiving preimmune serum died in less than 24
hours.
[0670] These results demonstrate that antibodies capable of
neutralizing C. botulinum type A toxin are induced when either of
the recombinant C. botulinum C fragment proteins pHisBot or pMBot
are used as immunogens.
EXAMPLE 28
Cloning and Expression of the C Fragment of C. botulinum Serotype A
Toxin in E. coli Utilizing A Native Gene Fragment
[0671] In Example 22 above, a synthetic gene was used to express
the C fragment of C. botulinum serotype A toxin in E. coli. The
synthetic gene replaced non-preferred (i.e., rare) codons present
in the C fragment gene with codons which are preferred by E. coli.
The synthetic gene was generated because it was been reported that
genes which have a high A/T content (such as most clostridial
genes) creates expression difficulties in E. coli and yeast.
Furthermore, LaPenotiere et al. suggested that problems encountered
with the stability (non-fusion constructs) and solubility (MBP
fusion constructs) of the C fragment of C. botulinum serotype A
toxin when expressed in E. coli was most likely due to the extreme
A/T richness of the native C. botulinum serotype A toxin gene
sequences (LaPenotiere, et al, supra).
[0672] In this example, it was demonstrated that successful
expression of the C fragment of C. botulinum type A toxin gene in
E. coli does not require the elimination of rare codons (i.e.,
there is no need to use a synthetic gene). This example involved a)
the cloning of the native C fragment of the C. botulinum serotype A
toxin gene and construction of an expression vector and b) a
comparison of the expression and purification yields of C.
botulinum serotype A C fragments derived from native and synthetic
expression vectors.
[0673] a) Cloning of the Native C Fragment of the C. botulinum
Serotype A Toxin Gene and Construction of an Expression Vector
[0674] The serotype A toxin gene was cloned from C. botulinum
genomic DNA using PCR amplification. The following primer pair was
employed: 5'-CGCCATGGCTAG ATTATTATCTACATTTAC-3' (5' primer, NcoI
site underlined; SEQ ID NO:29) and 5'-GCAAGCTTCTTGACAGACTCATGTAG-3'
(3' primer, HindIII site underlined; SEQ ID NO:30). C. botulinum
type A strain was obtained from the American Type Culture
Collection (ATCC#19397) and grown under anaerobic conditions in
Terrific broth medium. High molecular-weight C. botulinum DNA was
isolated as described in Example 11. The integrity and yield of
genomic DNA was assessed by comparison with a serial dilution of
uncut lambda DNA after electrophoresis on an agarose gel.
[0675] The gene fragment was cloned by PCR utilizing a proofreading
thermostable DNA polymerase (native Pfu polymerase). PCR
amplification was performed using the above primer pair in a 50
.mu.l reaction containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5
mM MgCl.sub.2, 200 .mu.M each dNTP, 0.2 .mu.M each primer, and 50
ng C. botulinum genomic DNA. Reactions were overlaid with 100 .mu.l
mineral oil, heated to 94.degree. C. 4 min, 0.5 .mu.l native Pfu
polymerase (Stratagene) was added, and thirty cycles comprising
94.degree. C. for 1 min, 50.degree. C. for 2 min, 72.degree. C. for
2 min were carried out followed by 10 min at 72.degree. C. An
aliquot (10 .mu.l) of the reaction mixture was resolved on an
agarose gel and the amplified native C fragment gene was gel
purified using the Prep-A-Gene kit (BioRad) and ligated to
pCRScript vector DNA (Stratagene). Recombinant clones were isolated
and confirmed by restriction digestion, using standard recombinant
molecular biology techniques [Sambrook et al. (1989), supra]. In
addition, the sequence of approximately 300 bases located at the 5'
end of the C fragment coding region were obtained using standard
DNA sequencing methods. The sequence obtained was identical to that
of the published sequence.
[0676] An expression vector containing the native C. botulinum
serotype A C fragment gene was created by ligation of the
NcoI-HindIII fragment containing the C fragment gene from the
pCRScript clone to NheI-HindIII restricted pETHisa vector (Example
18b). The NcoI and NheI sites were filled in using the Klenow
enzyme prior to ligation; these sites were thus blunt-end ligated
together. The resulting construct was termed pHisBotA (native).
pHisBotA (native) expresses the C. botulinum serotype A C fragment
with a his-tagged N terminal extension which has the following
sequence: MetGlyHisHisHisHisHisHisHisHisHisHisSerSerGlyHisIleGl-
uGlyArgHisMetAla (SEQ ID NO:24), where the underlining represents
amino acids encoded by the C. botulinum C fragment gene (this N
terminal extension contains the recognition site for Factor Xa
protease, shown in italics, which can be employed to removed the
polyhistdine tract from the N-terminus of the fusion protein). The
pHisBot (native) construct expresses the identical protein as the
pHisBot construct (Ex. 24c; herein after the pHisBotA) which
contains the synthetic gene.
[0677] The predicted DNA sequence encoding the native C. botulinum
serotype A C fragment gene contained within pHisBotA (native) is
listed in SEQ ID NO:3' [the start of translation (ATG) is located
at nucleotides 108-110 and the stop of translation (TAA) is located
at nucleotides 1494-1496 in SEQ ID NO:31] and the corresponding
amino acid sequence is listed in SEQ ID NO:26 (i.e., the same amino
acid sequence as that produced by pHisBotA containing synthetic
gene sequences).
[0678] b) Comparison of the Expression and Purification Yields of
C. botulinum Serotype A C Fragments Derived from Native and
Synthetic Expression Vectors
[0679] Recombinant plasmids containing either the native or the
synthetic C. botulinum serotype A C fragment genes were transformed
into E. coli strain Bl21(DE3) pLysS and protein expression was
induced in 1 liter shaker flask cultures. Total protein extracts
were isolated, resolved on SDS-PAGE gels and C. botulinum C
fragment protein was identified by Western analysis utilizing a
chicken anti-C. botulinum serotype A toxoid antiserum as described
in Example 22.
[0680] Briefly, 1 liter (2.times.YT+100 .mu.g/ml ampicillin and 34
.mu.g/ml chloramphenicol) cultures of bacteria harboring either the
pHisBotA (synthetic) or pHisBotA (native) plasmids in the Bl21(DE3)
pLysS strain were induced to express recombinant protein by
addition of IPTG to 1 mM. Cultures were grown at 30-32.degree. C.,
IPTG was added when the cell density reached an OD.sub.600 0.5-1.0
and the induced protein was allowed to accumulate for 3-4 hrs after
induction.
[0681] The cells were cooled for 15 min in a ice water bath and
then centrifuged for 10 min at 5000 rpm in a JAIO rotor (Beckman)
at 4.degree. C. The cell pellets were resuspended in a total volume
of 40 mls 1.times. binding buffer (40 mM imidazole, 0.5 M NaCl, 50
mM NaPO.sub.4, pH 8.0), transferred to two 50 ml Oakridge tubes and
frozen at -70.degree. C. for at least 1 hr. The tubes were then
thawed and the cells were lysed by sonication (using four
successive 20 second bursts) on ice. The suspension was clarified
by centrifugation 20-30 min at 9,000 rpm (10,000 g) in a JA-17
rotor. The soluble lysate was batch absorbed to 7 ml of a 1:1
slurry of NiNTA resin:binding buffer by stirring 2-4 hr at
4.degree. C. The slurry was centrifuged for 1 min at 500 g in 50 ml
tube (Falcon), resuspended in 5 mls binding buffer and poured into
a 2.5 cm diameter column (BioRad). The column was attached to a UV
monitor (ISCO) and the column was washed with binding buffer until
a baseline was established Imidazole was removed by washing with 50
mM NaPO.sub.4, 0.3 M NaCl, 10% glycerol, pH 7.0 and bound protein
was eluted using 50 mM NaPO.sub.4, 0.3 M NaCl, 10% glycerol, pH
3.5-4.0.
[0682] The eluted proteins were stored at 4.degree. C. Samples of
total, soluble, and eluted proteins were resolved by SDS-PAGE.
Protein samples were prepared for electrophoresis by mixing 1 .mu.l
total (T) or soluble (S) protein with 4 .mu.l PBS and 5 .mu.l
2.times. SDS-PAGE sample buffer, or 5 .mu.l eluted (E) protein and
5 .mu.l 2.times. SDS-PAGE sample buffer. The samples were heated to
95.degree. C. for 5 min, then cooled and 5 or 10 .mu.ls were loaded
on 12.5% SDS-PAGE gels. Broad range molecular weight protein
markers (BioRad) were also loaded to allow the MW of the identified
fusion proteins to be estimated. After electrophoresis, protein was
detected either generally by staining gels with Coomassie blue, or
specifically, by blotting to nitrocellulose for Western blot
detection of specific immunoreactive protein.
[0683] For Western blot analysis, the gels were blotted, and
protein transfer was confirmed by Ponceau S staining as described
in Example 22. After blocking the blots for 1 hr at room
temperature in blocking buffer (PBST and 5% milk), 10 ml of a
{fraction (1/500)} dilution of an anti-C. botulinum toxin A IgY PEG
prep (Ex. 3) in blocking buffer was added and the blots were
incubated for an additional hour at room temperature. The blots
were washed and developed using a rabbit anti-chicken alkaline
phosphatase conjugate (Boehringer Mannheim) as the secondary
antibody as described in Ex. 22. This analysis detected C.
botulinum toxin A-reactive proteins in the pHisBotA (native and
synthetic) protein samples (corresponding to the predicted full
length proteins identified by Coomassie staining).
[0684] A gel containing proteins expressed from the pHisBot and
pHisBot (native) constructs during various stages of purification
and stained with Coomassie blue is shown in FIG. 31. In FIG. 31,
lanes 1-4 and 9 contain proteins expressed by the pHisBotA
construct (i.e., the synthetic gene) and lanes 5-8 contain proteins
expressed by the pHisBotA (native) construct. Lanes 1 and 5 contain
total protein extracts; lanes 2 and 6 contain soluble protein
extracts; lanes 3 and 7 contain proteins which flowed through the
NiNTA columns; lanes 4, 8 and 9 contain protein eluted from the
NiNTA columns and lane 10 contains molecular weight markers.
[0685] The above purification resulted in a yield of 3 mg (native
gene) or 11 mg (synthetic gene) of affinity purified protein from a
1 liter starting culture, of which at least 90-95% of the protein
was a single band of the predicted MW (50kd) and immunoreactivity
for recombinant C. botulinum serotype A C fragment protein. Other
than the level of expression, no difference was observed between
the native and the synthetic gene expression systems.
[0686] These results demonstrate that soluble C. botulinum serotype
A C fragment protein can be expressed in E. coli and purified
utilizing either native or synthetic gene sequences.
EXAMPLE 29
Generation of Neutralizing Antibodies Using a Recombinant C.
botulinum Serotype A C Fragment Protein Containing a Six Residue
His-Tag
[0687] In Example 27, neutralizing antibodies were generated
utilizing the pHisBotA protein, which contains a histidine-tagged
N-terminal extension comprising 10 histidine residues. To determine
if the generation of neutralizing antibodies is dependent on the
presence of this particular his-tag, a protein containing a shorter
N-terminal extension (comprising 6 histidine residues) was produced
and tested for the ability to generate neutralizing antibodies.
This example involved a) the cloning and expression of the
p6HisBotA(syn) protein and b) the generation and characterization
of hyperimmune serum.
[0688] a) Cloning and Expression of the p6HisBotA(syn) Protein
[0689] The p6HisBotA(syn) construct was generated as described
below; the term "syn" designates the presence of synthetic gene
sequences. This construct expresses the C frgament of the C.
botulinum serotype A toxin with a histidine-tagged N terminal
extension having the following sequence:
MetHisHisHisHisHisHisMetAla (SEQ ID NO:32); the amino acids encoded
by the botulinal C fragment gene are underlined and the vector
encoded amino acids are presented in plain type.
[0690] 6.times.His oligonucleotides [5'-TATGCATCACCATCACCATCA-3'
(SEQ ID NO:33) and 5'-CATGTGATGGTGATGGTGATGCA-3' (SEQ ID NO:34)
were annealed as follows. One microgram of each oligonucleotide was
mixed in total of 20 .mu.L 1.times. reaction buffer 2 (NEB) and the
mixture was heated at 70.degree. C. for 5 min and then incubated at
42.degree. C. for 5 min. The annealed oligonucleotides were then
ligated with gel purified NdeI/HindIII cleaved pET23b (T7 promoter)
or pET21b (T7lac promoter) DNA and the gel purified NcoI/HindIII C.
botulinum serotype A C fragment synthetic gene fragment derived
from pAlterBot (Ex. 22). Recombinant clones were isolated and
confirmed by restriction digestion. The DNA sequence encoding the
6.times.his-tagged BotA protein contained within p6HisBotA(syn) is
listed in SEQ ID NO:35. The amino acid sequence of the
p6.times.HisBotA protein is listed in SEQ ID NO:36.
[0691] The resulting recombinant p6.times.HisBotA plasmid was
transformed into the BL21(DE3) pLysS strain, and 1 liter cultures
were grown, induced and harvested as described in Example 28.
His-tagged protein was purified as described in Example 28, with
the following modifications. The binding buffer (BB) contained 5 mM
imidazole rather than 40 mM imidazole and NP40 was added to the
soluble lysate to a final concentration of 0.1%. The bound material
was washed on the column with BB until the baseline was
established, then the column was washed successively with BB+20
.mu.M imidazole and BB+40 mM imidazole. The column was eluted as
described in Example 28.
[0692] In the case of the pET23-derived expression system, high
level expression of insoluble 6HisBotA protein was induced. The
pET21-derived vector expressed lower levels of soluble protein that
bound the NiNTA resin and eluted in the 40 mM imidazole wash rather
than during the low pH elution. These results (i.e., low level
expression of a soluble protein) are consistent with the results
obtained with pHisBotA protein (Ex. 25); the pHisBotA construct,
like the pET21-derived vector, contains the T7lac rather than T7
promoter.
[0693] The 6HisBotA protein thus elutes under less stringent
conditions than the 10.times. histidine-containing pHisBot protein
(100-200 mM imidazole; Ex. 25) presumably due to the reduction in
the length of the his-tag. The eluted protein was of the predicted
size [i.e., slightly reduced in comparison to pHisBotA
protein].
[0694] b) Generation and Characterization of Hyperimmune Serum
[0695] Eight BALBc mice were immunized with purified 6HisBotA
protein using Gerbu GMDP adjuvant (CC Biotech). The 40 mM imidazole
elution was mixed with Gerbu adjuvant and used to immunize mice.
Each mouse received a subcutaneous injection of 100 .mu.l
antigen/adjuvant mix (12 .mu.g antigen+1 .mu.g adjuvant) on day 0.
Mice were subcutaneously boosted as above on day 14 and bled on day
28. Control mice received pHisBotB protein (prepared as described
in Ex. 35 below) in Gerbu adjuvant.
[0696] Anti-C. botulinum serotype A toxoid titers were determined
in serum from individual mice from each group using the ELISA
described in Example 23a with the exception that the initial
testing serum dilution was 1:100 in blocking buffer containing 0.5%
Tween 20, followed by serial 5-fold dilutions into this buffer. The
results of the ELISA demonstrated that seroconversion (relative to
control mice) occurred in all 8 mice.
[0697] The ability of the anti-C. botulinum serotype A C fragment
antibodies present in serum from the immunized mice to neutralize
native C. botulinum type A toxin was tested using the mouse
neutralization assay described in Example 23b. The amount of
neutralizing antibodies present in the serum of the immunized mice
was determined using serum antibody titrations. The various serum
dilutions (0.01 ml) were mixed with 5 LD.sub.50 units of C.
botulinum type A toxin and the mixtures were injected IP into mice.
The neutralizations were performed in duplicate. The mice were then
observed for signs of botulism for 4 days. Undiluted serum was
found to protect 100% of the injected mice while the 1:10 diluted
serum did not. This corresponds to a neutralization titer of
0.05-0.5 IU/ml.
[0698] These results demonstrate that neutralizing antibodies were
induced when the 6HisBotA protein was utilized as the immunogen.
Furthermore, these results demonstrate that seroconversion and the
generation of neutralizing antibodies does not depend on the
specific N terminal extension present on the recombinant C.
botulinum type A C fragment proteins.
EXAMPLE 30
Construction of Vectors for the Expression of His-Tagged C.
botulinum Type A Toxin C Fragment Protein Using the Synthetic
Gene
[0699] A number of expression vectors were constructed which
contained the synthetic C. botulinum type A toxin C fragment gene.
These constructs vary as to the promoter (T7 or T7lac) and
repressor elements (lacIq) present on the plasmid. The T7 promoter
is a stronger promoter than is the T7lac promoter. The various
constructs provide varying expression levels and varying levels of
plasmid stability. This example involved a) the construction of
expression vectors containing the synthetic C. botulinum type A C
fragment gene and b) the determination of the expression level
achieved using plasmids containing either the kanamycin resistance
or the ampicillin resistance genes in small scale cultures.
[0700] a) Construction of Expression Vectors Containing the
Synthetic C. botulinum Type A C Fragment Gene
[0701] Expression vectors containing the synthetic C. botulinum
type A C fragment gene were engineered to utilize the kanamycin
resistance rather than the ampicillin resistance gene. This was
done for several reasons including concerns regarding the presence
of residual ampicillin in recombinant protein derived from plasmids
containing the ampicillin resistance gene. In addition, ampicillin
resistant plasmids are more difficult to maintain in culture; the
.beta.-lactamase secreted by cells containing ampicillin resistant
plasmids rapidly degrades extracellular ampicillin, allowing the
growth of plasmid-negative cells.
[0702] A second altered feature of the expression vectors is the
inclusion of lacIq gene in the plasmid. This repressor lowers
expression from lac regulated promoters (the chromosomally located,
lactose regulated T7 polymerase gene and the plasmid located T7lac
promoter). This down regulates uninduced protein expression and can
enhance the stability of recombinant cell lines. The final
alteration to the vectors is the inclusion of either the T7 or
T7lac promoters that drive high or moderate level expression of
recombinant protein, respectively.
[0703] The expression plasmids were constructed as follows. In all
cases, the protein expressed is the pHisBotA(syn) protein
previously described, and the only differences between constructs
is the alteration of the various regulatory elements described
above.
[0704] i) Construction of pHisBotA(syn) kan T7lac The pHisBotA(syn)
kan T7lac construct was made by inserting the SapI/XhoI fragment
containing the C. botulinum type A C fragment from pHisBotA(syn)
into pET24 digested with SapI/XhoI (Novagen; fragment contains kan
gene and origin of replication). The desired construct was selected
for kanamycin resistance and confirmed by restriction
digestion.
[0705] ii) Construction Of pHisBotA(syn) kan lacIq T7lac
[0706] The pHisBotA(syn) kan lacIq T7lac construct was made by
inserting the XbaI/HindIII fragment containing the C. botulinum
type A C fragment from pHisBotA(syn)kanT7lac into the pET24a vector
digested with XbaI/HindIII. The resulting construct was confirmed
by restriction digestion.
[0707] iii) Construction of pHisBotA(syn) kan lacIq T7
[0708] The pHisBotA(syn) kan lacIq T7 construct was made by
inserting the XbaI/HindIII fragment containing the C. botulinum
type A C fragment from pHisBotA(syn) kan lacIq T7lac into
XbaI/HindIII-digested pHisBotB(syn) kan lacIq T7 (described in Ex
37c below). The resulting construct was confirmed by restriction
digestion.
[0709] b) Determination of the Expression Level Achieved Using
Plasmids Containing Either the Kanamycin Resistance or the
Ampicillin Resistance Genes in Small Scale Cultures
[0710] One liter cultures of pHisBotA(syn) kan T7lac/Bl21(DE3)pLysS
and pHisBotA(syn) amp T7lac/Bl21(DE3)pLysS [this is the previously
designated pHisBotA(syn) construct] were grown, induced and
his-tagged proteins were purified as described in Example 28. No
differences in yield or protein integrity/purity were observed.
[0711] These results demonstrate that the antigen induction levels
from expression constructs were not affected by the choice of
ampicillin versus kanamycin antibiotic resistance genes.
EXAMPLE 31
Fermentation of Cells Expressing Recombinant Botulinal Proteins
[0712] a) Fermentation Culture of Cells Expressing Recombinant
Botulinal Proteins
[0713] Fermentation cultures were grown under the following
conditions which were optimized for growth of the BL21(DE3) strains
containing pET derived expression vectors. An overnight 1 liter
feeder culture was prepared by inoculating of 1 liter media (in a
2L shaker flask) with a fresh colony grown on an LB kan plate. The
feeder culture contained: 600 mls nitrogen source [20 gm yeast
extract (BBL) and 40 gm tryptone (BBL)/600 mls], 200 mls
5.times.fermentation salts (per liter: 48.5 gm K.sub.2HPO.sub.4, 12
gm NaH.sub.2PO.sub.4H.sub.2O, 5 gm NH.sub.4Cl, 2.5 gm NaCl), 180
mls dH.sub.2O, 20 mls 20% glucose, 2 mls 1 M MgSO.sub.4, 5 mls
0.05M CaCl.sub.2 and 4 mls of a 10 mg/ml kanamycin stock. All
solutions were sterilized by autoclaving, except the kanamycin
stock which was filter sterilized.
[0714] An aliquot (5 ml) of the feeder culture broth was removed
prior to inoculation, and grown for 2 days at 37.degree. C. as a
culture broth sterility control. Growth was not observed in this
control culture in any of the fermentations performed.
[0715] The inoculated feeder culture was grown for 12-15 hrs (ON)
at 30-37.degree. C. Care was taken to prevent oversaturation of
this culture. The saturated feeder culture was added to 10L of
fermentation media in fermenter (BiofloIV, New Brunswick
Scientific, Edison, N.J.) as follows. The fermenter was sterilized
120 min at 121.degree. C. with dH.sub.2O. The sterile water was
removed, and fermentation media added as follows: 6 liters nitrogen
source, 2 liters 5.times. fermentation salts, 2 liters 2% glucose,
20 mls 1 M MgSO.sub.4, 50 mls 0.05 M CaCl.sub.2, 2.5-3.5 mls Macol
P 400 antifoam (PPG Industries Inc., Gurnee, Ill.), 40 mls 10 mg/ml
kanamycin and 10 mls trace elements (8 gm FeSO.sub.4.7H.sub.2O, 2
gm MnSO.sub.4.H.sub.2O, 2 gm AlCl.sub.3.6H.sub.2O, 0.8 gm
CoCl.6H.sub.2O, 0.4 gm ZnSO.sub.4.7H.sub.2O, 0.4 gm
Na.sub.2MoO.sub.4.2H.sub.2O, 0.2 gm CuCl.sub.2.2H.sub.2O, 0.2 gm
NiCl.sub.2, 0.1 gm H.sub.3BO.sub.4/200 mls 5 M HCl). All solutions
were sterilized by autoclaving, except the kanamycin stock which
was filter sterilized. Fermentation media was prewarmed to
37.degree. C. before the addition of the feeder culture.
[0716] After the addition of the feeder culture, the culture was
fermented at 37.degree. C., 400 rpm agitation, and 10 l/min air
sparging. The DO.sub.2 control was set to 20% PID and dissolved
oxygen levels were controlled by increasing the rate of agitation
from 400-850 rpm under DO.sub.2 control. DO.sub.2 levels were
maintained at greater than or equal to 20% throughout the entire
fermentation. When agitation levels reached 500-600 rpm the
temperature was lowered to 30.degree. C. to reduce the oxygen
consumption rate. Culture growth was continued until endogenous
carbon sources were depleted. In these fermentations, glucose was
depleted first [monitored with a glucose monitoring kit (Sigma)],
followed by assimilation of acetate and other acidic carbons
[monitored using an acetate test kit (Boehringer Mannheim)]. During
the assimilation phase, the pH rose from 6.6-6.8 (starting pH) to
7.4-7.5, at which time the bulk of the remaining carbon source was
depleted. This was signaled by a drop in agitation rate (from a
maximum of 700-800 rpm) and a rise in DO.sub.2 levels >30%. This
corresponds to a OD.sub.600 reading of 18-20/ml. At this point a
fed batch mode was initiated, in which a feed solution of 50%
glucose was added at a rate of approximately 4 gm glucose/liter/hr.
The pH was adjusted to 7.0 by the addition of 25% H.sub.3PO.sub.4
(approximately 60 mls). Culture growth was continued and reached
peak oxygen consumption within the next 3 hrs of growth (while the
remaining residual non-glucose carbon sources were assimilated).
This phase is characterized by a slow increase in pH, and air
sparging was increased to 1SL/min, to keep the maximum rpm below
850.
[0717] Once the residual acidic carbon sources are depleted the
agitation rate decreases to 650-750 rpm and the pH begins to drop.
pH control was maintained at 7.0 PID by regulated pump addition of
a sterile 4M NaOH solution which was consumed at a steady rate for
the remainder of the fermentation. Growth was continued at
30.degree. C., and the cultures were grown linearly at a growth
rate of 4-7 OD.sub.600 units/hr, to at least 81.5 OD.sub.600
units/ml (>30 g/l dry cell weight) without induction. Antifoam
(a 1:1 dilution with filter sterilized 100% ethanol) was added as
necessary throughout the fermentation to prevent foaming.
[0718] During the fed batch mode, glucose was assimilated
immediately (concentration in media consistently less than 0.1
gm/liter) and acetate was not produced in significant levels by the
pET plasmid/BL21(DE3) cell lines tested (approximately 1 gm/liter
at end of fermentation; this is lower than that observed in
harvests from shaker flask cultures utilizing the same strains).
This was fortuitous, since high levels of acetate has been shown to
inhibit induction levels in a variety of expression systems. The
above described conditions were found to be highly reproducible
between fermentations and utilizing different expression plasmids.
As a result, glucose and acetate level monitoring were no longer
preformed during fermentation.
[0719] b) Induction of Fermentation Cultures
[0720] Induction with IPTG (250 mg-10 gms, depending on the
expression vector and experiment) was initiated 1-3 hrs after
initiation of the glucose feed (30-50 OD.sub.600/ml). The growth
rate after induction was monitored on a hourly basis. Aliquots
(5-10 ml) of cells were harvested at the time of induction, and at
hourly intervals post-induction. Optical density readings were
determined by measuring the absorbance at 600 nm of 10 .mu.l
culture in 990 .mu.l PBS versus a PBS control. The growth rate
after induction was found to vary depending on the expression
system utilized.
[0721] c) Monitoring of Fermentation Cultures
[0722] Fermentation cultures were monitored using the following
control assays.
[0723] i) Colony Forming Ability
[0724] An aliquots of cells were removed from the cultures at each
timepoint sampled (uninduced and at various times after induction)
were serially diluted in PBS (dilution 1=15 .mu.l cells/3 ml PBS,
dilution 2=15 .mu.l of dilution 1/3 ml PBS, dilution 3=3 or 6 .mu.l
of dilution 2/3 mls PBS) and 100 .mu.l of dilution 3 was plated on
an LB or TSA (trypticase soy agar) plate. The plates were incubated
ON at 37.degree. C. and then the colonies are counted and scored
for macro or micro growth.
[0725] ii) Phenotypic Characterization
[0726] Colonies growing on LB or TSA plates (above) from uninduced
and induced timepoints were replica plated onto LB+kan,
LB+chloramphenicol (for fermentations utilizing LysS or pACYCGro
plasmids), LB+kan+1 mM IPTG and LB plates, in this order. The
plates were grown 6-8 hrs at 37.degree. C. and growth was scored on
each plate for a minimum of 40-50 well isolated colonies. The
percentage of cells retaining the plasmid at time of induction
(i.e., uninduced cultures immediately prior to the addition of
IPTG) was determined to be the # colonies LB+Kan (or
chlorarnphenicol) plate/# colonies LB plate.times.100%. The
percentage of cells with mutated pET plasmids was determined to be
the # colonies LB+Kan+IPTG plate/# colonies LB plate.times.100%.
Colonies on all LB plates were scored morphologically for E. coli
phenotype as a contamination control. Morphologically detectable
contaminant colonies were not detected in any fermentation.
[0727] iii) Recombinant BotA Protein Induction
[0728] A total of 10 OD.sub.6000 units of cells (e.g., 200 .mu.l of
cells at OD.sub.600=50/ml) were removed from each timepoint sample
to a 1.5 ml microfuge tube and pelleted for 2 min at maximum rpm in
a microfuge. The pellets were resuspended in 1 ml of 50 mM
NaHPO.sub.4, 0.5 M NaCl, 40 mM imidazole buffer (pH 6.8) containing
1 mg/ml lysozyme. The samples were incubated for 20 min at room
temperature and stored ON at -70.degree. C. Samples were thawed
completely at room temperature and sonicated 2.times.10 seconds
with a Branson Sonifier 450 microtip probe at # 3 power setting.
The samples were centrifuged for 5 min at maximum rpm in a
microfuge.
[0729] An aliquot (20 .mu.l) of the protein samples were removed to
20 .mu.l 2.times. sample buffer, before or after centrifugation,
for total and soluble protein extracts, respectively. The samples
were heated to 95.degree. C. for 5 min, then cooled and 5 or 10
.mu.l were loaded onto 12.5% SDS-PAGE gels. High molecular weight
protein markers (BioRad) were also loaded to allow for estimation
of the MW of identified fusion proteins. After electrophoresis,
protein was detected either generally by staining gels with
Coomassie blue, or specifically, by blotting onto nitrocellulose
(as described in Ex. 28) for Western blot detection of specific
his-tagged proteins utilizing a NiNTA-alkaline phosphatase
conjugate exactly as described by the manufacturer (Qiagen).
[0730] iv) Recombinant Antigen Purification
[0731] At the end of each fermentation run, 1-10 liters of culture
were harvested from the fermenter and the bacterial cells were
pelleted by centrifugation at 6000 rpm for 10 min in a JAIO rotor
(Beckman). The cell pellets were stored frozen at -70.degree. C. or
utilized immediately without freezing. Cell pellets were
resuspended to 15-20% weight to volume in resuspension buffer
(generally 50 mM NaPO.sub.4, 0.5 M NaCl, 40 mM imidazole, pH 6.8)
and lysed utilizing either sonication or high pressure
homogenization.
[0732] For sonication, the resuspension buffer was supplemented
with lysozyme to 1 mg/ml, and the suspension was incubated for 20
min. at room temp. The sample was then frozen ON at -70.degree. C.,
thawed and sonicated 4.times.20 seconds at microtip maximum to
reduce viscosity. For homogenization, the cells were lyzed by 2
passes through a homogenizer (Rannie Mini-lab type 8.30 H) at 600
Bar. Cell lysates were clarified by centrifugation for 30 min at
10,000 rpm in a JA10 rotor.
[0733] For IDA chromatography, samples were flocculated utilizing
polyethyleneimine (PEI) prior to centrifugation. Cell pellets were
resuspended in cell resuspension buffer (CRB: 50 mM NaPO.sub.4, 0.5
M NaCl, 40 mM imidazole, pH 6.8) to create a 20% cell suspension
(wet weight of cells/volume of CRB) and cell lysates were prepared
as described above (sonication or homogenization). PEI (a 2%
solution in dH.sub.2O, pH 7.5 with HCl) was added to the cell
lysate a final concentration of 0.2%, and stirred for 20 min at
room temperature prior to centrifugation (8,500 rpm in JAIO rotor
for 30 minutes at 4.degree. C.). This treatment removed RNA, DNA
and cell wall components, resulting in a clarified, low viscosity
lysate ("PEI clarified lysate").
[0734] His-tagged proteins were purified from soluble lysates by
metal-chelate affinity chromatography using either a NiNTA resin
(as described in Ex. 28) or an IDA (iminodiacetic acid) resin as
described below.
[0735] IDA resin affinity purifications were performed utilizing a
low pressure chromatography system (ISCO). A 7 ml (small scale) or
70 ml (large scale) Chelating Sepharose Fast Flow (Pharmacia)
affinity column was poured; in addition, a second guard column was
poured and attached in line with the first column (to capture Ni
ions that leached off the affinity column). The columns were washed
with 3 column volumes of dH.sub.2O. The guard column was then
removed and the affinity column was washed with 0.3 M NiSO.sub.4
until resistivity was established, then with dH.sub.2O until the
resistivity returned to baseline. The columns were reconnected and
equilibrated with cell resuspension buffer (CRB; 50 mM NaPO.sub.4,
0.5 M NaCl, 40 mM imidazole, pH 6.8). The clarified sample (in CRB)
was loaded. Flow rates were 5 ml/min for small scale columns and 20
m/min for large scale columns. After sample loading, the column was
washed with CRB until a baseline established and bound protein was
eluted with elution buffer (50 mM NaPO.sub.4, 0.5 M NaCl, 800 mM
imidazole, 20% glycerol, pH 6.8 or 8.0). Protein samples were
stored at 4.degree. C. or -20.degree. C. The yield of eluted
protein was established by measuring the OD.sub.280 of the
elutions, with a 1 mg/ml solution of protein assumed to yield an
absorbance reading of 2.0.
[0736] The IDA columns may be regenerated and reused multiple times
(>10). To regenerate the column, the column was washed with 2-3
column volumes of H.sub.2O, then 0.05 M EDTA until all of the
blue/green color was removed followed by a wash with dH.sub.2O. The
IDA columns were sterilized with 0.1 M NaOH (using at least 3
column volumes but not more than 50 minutes contact time with
column packing material), then washed with 3 column volumes 0.05 M
NaPO.sub.4, pH 5.0, then dH.sub.2O and stored at room temperature
in 20% ethanol.
EXAMPLE 32
Construction of a Folding Chaperone Overexpression System
[0737] Co-overexpression of the E. coli GroEL/GroES folding
chaperones in a cell expressing a recombinant foreign protein has
been reported to enhance the solubility of some foreign proteins
that are otherwise insoluble when expressed in E coli [Gragerouu et
al. (1992) Proc. Natl. Acad. Sci. USA 89:10344]. The improvement in
solubility is thought to be due to chaperone-mediated binding and
unfolding of insoluble denatured proteins, thus allowing multiple
attempts for productive refolding of recombinant proteins. By
overexpressing the chaperones, the unfolding/refolding reaction is
driven by excess chaperone, resulting, in some cases, in higher
yields of soluble protein.
[0738] In this example, a chaperone overexpression system,
compatible with pET vector expression systems, was constructed to
facilitate testing chaperone-mediated solubilization of C.
botulinum type A proteins. This example involved the cloning of the
GroEL/ES operon and construction of a pLysS-based chaperone
hyperexpression system.
[0739] The GroEL/GroES operon was PCR amplified and cloned into the
pCRScript vector as described in Example 28. The following primer
pair was used: 5'-CGCAT ATGAATATTCGTCCATTGCATG-3' (SEQ ID NO:37)
[5' primer, start codon of groES gene converted to NdeI site
(underlined)] and 5'-GGAAGCTTGCAGGGCAAT TACATCATG (SEQ ID NO:38)
(3' primer, stop codon of groEL gene italicized, engineered HindIII
site underlined). Following amplification, the chaperone operon was
excised as an NdeI/HindIII fragment and cloned into pET23b digested
with NdeI and HindIII. This construction places the Gro operon
under the control of the T7 promoter of the pET23 vector. The
desired construct was confirmed by restriction digestion.
[0740] The T7 promoter-Gro operon-T7 terminator expression cassette
was then excised as a BglII/BspEI (filled) fragment and cloned into
BamHI (compatible with BglII)/HindIII (filled) cleaved pLysS
plasmid (this removed the T7 lysozyme gene). The resulting
construct was designated pACYCGro, since the plasmid utilizing the
pACYC184 origin from the plysS plasmid. Proper construction was
confirmed by restriction digestion.
[0741] pACYCGro was transformed into BL21(DE3), cultures were grown
and induced with 1 mM IPTG as described in preceding examples.
Total and soluble protein extracts were generated from cells
removed before and after IPTG induction and were resolved on a
12.5% SDS-PAGE gel and stained with Coomassie blue. This analysis
revealed that high levels of soluble GroEI and GroES proteins were
made in the induced cells. These results demonstrated that the
chaperone hyper-expression system was functional.
EXAMPLE 33
Growth of BotA/pACYCGro Cell Lines in Fermentation Cultures
[0742] Induction of BL21(DE3) cells lacking the LysS plasmid which
contained BotA expression constructs grown in shaker flask or
fermentation culture resulted in the expression of primarily
insoluble BotA protein. Fermentation cultures were performed to
determine if the simultaneous overexpression of the Gro operon and
recombinant C. botulinum type A proteins (BotA proteins) resulted
in enhanced solubility of the recombinant BotA protein. This
example involved the fermentation of pHisBotA(syn)kan lacIq
T7lac/pACYCGro BL21(DE3) and pHisBotA(syn)kan lacIq T7/pACYCGro
BL21(DE3) cell lines. The fermentations were repeated exactly as
described in Example 31. Chloramphenicol (34 .mu.g/ml) was included
in the feeder and fermentation cultures.
[0743] a) Fermentation of pHisBotA(syn)kan lacIq T7lac/pACYCGro
BL21(DE3) Cells
[0744] For fermentation of cells containing plasmids comprising the
T7lac promoter, induction was with 2 gms IPTG at 1 hr post
initiation of glucose feed. The OD.sub.600 was 35 at time of
induction, then 48.5, 61.5, 67 at 1-3 hrs post induction. Viable
colony counts decreased from 0-3 hr induction [21 (13), 0, 0, 0;
dilution 3 utilized 3 .mu.l of dilution 2 cells] with numbers in
parenthesis for the indicating microcolonies. Of 28 colonies scored
at the time of induction, 23 retained the pHisBotA(syn)kan lacIq
T7lac plasmid (kan resistant), 22 contained the chaperone plasmid
(chloramphenicol resistant) and no colonies at induction grew on
IPTG+Kan plates (no mutations detected). These results were
indicative of very strong promoter induction, since colony
viability dropped immediately after induction.
[0745] Total and soluble extracts were resolved on a 12.5% SDS-PAGE
gel and stained with Coomassie. High level induction of Gro
chaperones was observed, but very low level expression of soluble
BotA protein was observed, increasing from 1 to 4.0 hrs post
induction (no expression detected in uninduced cells). The
dramatically lower expression of the BotA antigen in the presence
of chaperone may be due to promoter occlusion (i.e., the stronger
T7 promoter on the chaperone plasmid is preferentially
utilized).
[0746] b) Fermentation of pHisBotA(syn)kan lacIq T7/pACYCGro
BL21(DE3) Cells
[0747] A fermentation utilizing the T7-driven BotA expression
plasmid was performed. Induction was with 1 gm IPTG at 2 hrs post
initiation of glucose feed. The OD.sub.600 was 41 at time of
induction, then 51.5, 61.5, 61.5 and 66 at 1-4 hrs post induction.
Viable colony counts decreased from 0-4 hrs induction [71, 1 (34),
1 (1), 1, 0; dilution 3 utilized 6 .mu.l dilution 2 cells) with
numbers in parenthesis for the uninduced timepoint indicating
microcolonies. Of 65 colonies scored at the time of induction, all
65 retained both the pHisBotA(syn)kan lacIq T7 plasmid (kan
resistant) and the chaperone plasmid (chloramphenicol resistant)
and no colonies at induction grew on IPTG+Kan plates (no mutations
detected).
[0748] Total and soluble extracts were resolved on a 12.5% SDS-PAGE
gel and stained with Coomassie. High level induction of Gro
chaperones and moderate level expression of soluble BotA protein
was observed, increasing from 1 to 4.0 hrs post induction (no
expression detected in uninduced cells).
[0749] A PEI-clarified lysate (0.2% final cocnentration PEI) [850
ml from 130 gm cell pellet (2 liters fermentation harvest)] was
purified on a large scale IDA column. A total of 78 mg of protein
was eluted. Extracts from the purification were resolved on a 12.5%
SDS-PAGE gel and stained with Coomassie. The elution was found to
contain an approximately 1:1 mix of BotA/chaperone protein (FIG.
32). PEI lysates prepared in this manner were typically 16
OD.sub.280/ml. This was estimated to be 8 mg protein/ml of lysate
(by BCA assay). Thus, the eluted recombinant BotA protein
represented 0.55% of the total soluble cellular protein applied to
the column.
[0750] In FIG. 32, lane 1 contains molecular weight markers, lanes
2-9 contain extracts from pHisBotA(syn)kan lacIq
T7/pACYCGro/BL21(DE3) cells before or during purification on the
IDA column. Lane 2 contains total protein extract; lane 3 contains
soluble protein extract; lanes 4 and 5 contain PEI-clarified
lysates (duplicates); lanes 6 and 7 contain flow-through from the
IDA column (duplicates) and lanes 8 and 9 contain IDA column elute
(lane 9 contains {fraction (1/10)} the amount applied to lane
8).
[0751] These results demonstrate, that although the majority of the
BotA protein produced was insoluble, 20 mg/liter of soluble
recombinant BotA protein can be purified utilizing the
pHisBotA(syn)kan lacIq T7/pACYCGro/BL21(DE3) expression system.
EXAMPLE 34
Purification of Recombinant BotA Protein from Folding
Chaperones
[0752] In this example of size exclusion chromatography was used to
purify the recombinant BotA protein away from the folding
chaperones and imidazole present in the IDA-purified material (Ex.
33).
[0753] To enhance the solubility of the recombinant BotA protein
during scale-up, the protein was co-expressed with folding
chaperones (Ex. 33). As observed with the recombinant BotB protein
(Example 40 below), the folding chaperones co-eluted with the
recombinant BotA protein during the Ni-IDA purification step.
Because the recombinant BotA and BotB proteins have similar
molecular weights (about {fraction (1/10)} the size of the
non-reduced folding chaperone) and the imidazole step gradient
strategy was unsuccessful in purifying BotB away from the folding
chaperone (see Ex. 40), size exclusion chromatography was examined
for the ability to purify the recombinant BotA protein away from
the folding chaperones.
[0754] A column (2.5.times.24 cm) containing Sephacryl S-100 HR
(Pharmacia) was poured (bed volume.about.110 ml). Proteins having
molecular weights greater than 100 K are expected to elute in the
void volume under these conditions and smaller proteins should be
retained by the beads and elute at different times, depending on
their molecular weights. To maintain solubility of the purified
BotA protein, the Sephacryl column was equilibrated in a buffer
having the same salt concentration as the buffer used to elute the
BotA protein from the IDA column (i.e., 50 mM sodium phosphate, 0.5
M NaCl, 10% glycerol; all reagents from Mallinkrodt, Chesterfield,
Mo.).
[0755] Five milliliters of the IDA-purified recombinant BotA
protein (Ex. 33) was filtered through a 0.45.mu. syringe filter,
applied to the column and the equilibration buffer was pumped
through the column at a flow rate of 1 ml/minute. Eluted proteins
were monitored by absorbance at 280 nm and collected either
manually or with a fraction collector (BioRad). Appropriate
fractions were pooled, if necessary, and the protein was
quantitated by absorbance at 280 nm and/or BCA protein assay
(Pierce). The isolated peaks were then analyzed by native and/or
SDS-PAGE to identify the proteins present and to evaluate purity.
The folding chaperone eluted first, followed by the recombinant
BotA protein and then the imidazole peak.
[0756] SDS-PAGE analysis (12.5% polyacrylamide, reduced samples)
was used to evaluate the purity of the IDA-purified recombinant
BotA protein before and after S-100 purification. FIG. 33 shows the
difference in purity before and after the S-100 purification step.
In FIG. 33, lane 1 contains molecular weight markers (BioRad broad
range). Lane 2 shows the IDA-purified recombinant BotA protein
preparation, which is contaminated with significant amounts of the
folding chaperone. Following S-100 purification, the amount of
folding chaperone present in the BotA sample is reduced
dramatically (lane 3). Lane 4 contains no protein (i.e., it is a
blank lane); lanes 5-8 contain samples of IDA-purified recombinant
BotB and BotE proteins and are discussed infra.
[0757] Endotoxin levels in the S-100 purified BotA preparation were
determined using the LAL assay (Associates of Cape Cod) as describe
in Example 24. The purified BotA preparation was found to contain
22.7 to 45.5 EU/mg recombinant protein.
[0758] These results demonstrate that size exclusion chromatography
was successful in purifying the recombinant BotA protein from
folding chaperones and imidazole following an initial IDA
purification step. Furthermore, these results demonstrate that the
S-100 purified BotA protein was substantially free of
endotoxin.
EXAMPLE 35
Cloning and Expression of the C Fragment of the C. botulinum
Serotype B Toxin Gene
[0759] The C. botulinum type B neurotoxin gene has been cloned and
sequenced [Whelan et al. (1992) Appl. Environ. Microbiol. 58:2345
and Hutson et al. (1994) Curr. Microbiol. 28:101]. The nucleotide
sequence of the toxin gene derived from the Eklund 17B strain (ATCC
25765) is available from the EMBL/GenBank sequence data banks under
the accession number X71343; the nucleotide sequence of the coding
region is listed in SEQ ID NO:39. The amino acid sequence of the C.
botulinum type B neurotoxin derived from the strain Eklund 17B is
listed in SEQ ID NO:40. The nucleotide sequence of the C. botulinum
serotype B toxin gene derived from the Danish strain is listed in
SEQ ID NO:41 and the corresponding amino acid sequence is listed in
SEQ ID NO:42.
[0760] The DNA sequence encoding the native C. botulinum serotype B
C fragment gene derived from the Eklund 17B strain can be expressed
using the pETHisb vector; the resulting coding region is listed in
SEQ ID NO:43 and the corresponding amino acid sequence is listed in
SEQ ID NO:44. The DNA sequence encoding the native C. botulinum
serotype B C fragment gene derived from the Danish strain can be
expressed using the pETHisb vector; the resulting coding region is
listed in SEQ ID NO:45 and the corresponding amino acid sequence is
listed in SEQ ID NO:46. The C frgament region from any strain of C.
botulinum serotype B can be amplified and expressed using the
approach illustrated below using the C fragment derived from C.
botulinum type B 2017 strain.
[0761] The C. botulinum type B neurotoxin gene is synthesized as a
single polypeptide chain which is processed to form a dimer
composed of a light and a heavy chain linked via disulfide bonds;
the type B neurotoxin has been reported to exist as a mixture of
predominatly single chain with some double chain (Whelan et al.,
supra). The 50 kD carboxy-terminal portion of the heavy chain is
referred to as the C fragment or the H.sub.C domain. Expression of
the C fragment of C. botulinum type B toxin in heterologous hosts
(e.g., E. coli) has not been previously reported.
[0762] The native C fragment of the C. botulinum serotype B toxin
gene was cloned and expression constructs were made to facilitate
protein expression in E. coli. This example involved PCR
amplification of the gene, cloning, and construction of expression
vectors.
[0763] The C fragment of the C. botulinum serotype B (BotB) toxin
gene was cloned using the protocols and conditions described in
Example 28 for the isolation of the native BotA gene. The C.
botulinum type B 2017 strain was obtained from the American Type
Culture Collection (ATCC #17843). The following primer pair was
used to amplify the BotB gene: 5'-CGCCATGGCTGATACAATACTAATAGAA
ATG-3' [5' primer, engineered NcoI site underlined (SEQ ID NO:47)]
and 5'-GCAAG CTTTATTCAGTCCACCCTTCATC-3' [3' primer, engineered
HindIII site underlined, native gene termination codon italicized
(SEQ ID NO:48)]. After cloning into the pCRscript vector, the
NheI(filled)/HindIII fragment was cloned into pETHisb vector as
described for BotA C fragment gene in Example 28. The resulting
construct was termed pHisBotB. pHisBotB expresses the BotB gene
sequences under the transcriptional control of the T7 lac promoter
and the resulting protein contains an N-terminal 10.times. His-tag
affinity tag. The pHisBotB expression construct was transformed
into BL21 (DE3) pLysS competent cells and 1 liter cultures were
grown, induced and his-tagged proteins were purified utilizing a
NiNTA resin (eluted in low pH elution buffer) as described in
Example 28. Total, soluble and purified proteins were resolved by
SDS-PAGE and detected by Coomassie staining and Western blot
hybridization utilizing a chicken anti-C. botulinum serotype B
toxoid primary antibody (generated by immunization of hens using C.
botulinum serotype B toxoid as described in Example 3). Samples of
BotA and BotE C fragment proteins were included on the gels for MW
and immunogenicity comparisons. Strong immunoreactivity to only the
BotB protein was detected with the anti-C. botulinum serotype B
toxoid antibodies. The recombinant BotB protein was expressed at
low levels (3 mg/liter) as a soluble protein. The purified BotB
protein migrated as a single band of the predicted MW (i.e.,
.about.50 kD).
[0764] These results demonstrate the cloning of the native C.
botulinum serotype B C fragment gene, the expression and
purification of the recombinant BotB protein as a soluble
his-tagged protein in E. coli.
EXAMPLE 36
Generation of Neutralizing Antibodies Using the Recombinant
pHisBotB Protein
[0765] The ability of the purified pHisBot protein to generate
neutralizing antibodies was examined. Nine BALBc mice were
immunized with BotB protein (purified as described in Ex. 35) using
Gerbu GMDP adjuvant (CC Biotech). The low pH elution was mixed with
Gerbu adjuvant and used to immunize mice. Each mouse received a
subcutaneous injection of 100 .mu.l antigen/adjuvant mix (15 .mu.g
antigen+1 .mu.g adjuvant) on day 0. Mice were subcutaneously
boosted as above on day 14 and bled on day 28. Mice were
subsequently boosted 1-2 weeks after bleeding and were then bled on
day 70.
[0766] Anti-C. botulinum serotype B toxoid titers were determined
in day 28 serum from individual mice from each group using the
ELISA protocol outlined in Example 29 with the exception that the
plates were coated with C. botulinum serotype B toxoid, and the
primary antibody was a chicken anti-C. botulinum serotype B toxoid.
Seroconversion [relative to control mice immunized with pHisBotE
antigen (described below)] was observed with all 9 mice immunized
with the purified pHisBotB protein.
[0767] The ability of the anti-BotB antibodies to neutralize native
C. botulinum type B toxin was tested in a mouse-C. botulinum
neutralization model using pooled mouse serum (see Ex. 23b). The
LD.sub.50 of purified C. botulinum type B toxin complex (Dr. Eric
Johnson, University of Wisconsin, Madison) was determined by a
intraperitoneal (IP) method [Schantz and Kautler (1978), supra]
using 18-22 g female ICR mice. The amount of neutralizing
antibodies present in the serum of the immunized mice was
determined using serum antibody titrations. The various serum
dilutions (0.01 ml) were mixed with 5 LD.sub.50 units of C.
botulinum type B toxin and the mixtures were injected IP into mice.
The neutralizations were performed in duplicate. The mice were then
observed for signs of botulism for 4 days. Undiluted serum (day 28
or day 70) was found to protect 100% of the injected mice while the
1:10 diluted serum did not. This corresponds to a neutralization
titer of 0.05-0.5 IU/ml.
[0768] These results demonstrate that seroconversion occurred and
neutralizing antibodies were induced when the pHisBotB protein was
utilized as the immunogen.
EXAMPLE 37
Construction of Vectors to Facilitate Expression of His-Tagged BotB
Protein in Fermentation Cultures
[0769] A number of expression vectors were constructed to
facilitate the expression of recombinant BotB protein in large
scale fermentation culture. These constructs varied as to the
strength of the promoter utilized (T7 or T7lac) and the presence of
repressor elements (lacIq) on the plasmid. The resulting constructs
varied in the level of expression achieved and in plasmid stability
which facilitated the selection of a optimal expression system for
fermentation scaleup.
[0770] The BotB expression vectors created for fermentation culture
were engineered to utilize the kanamycin rather than the ampicillin
resistance gene, and contained either the T7 or T7lac promoter,
with or without the lacIq gene for the reasons outlined in Example
30.
[0771] In all cases, the protein expressed by the various
expression vectors is the pHisBot B protein described in Example
35, with the only differences between clones being the alteration
of various regulatory elements. Using the designations outlined
below, the pHisBotB clone (Ex. 35) is equivalent to pHisBotB amp
T7lac.
[0772] a) Construction of pHisBotB kan T7lac
[0773] pHisBotB kan T7lac was constructed by insertion of the
BglII/HindIII fragment of pHisBotB which contains the BotB gene
sequences into the pPA1870-2680 kan T7lac vector which had been
digested with BglII and HindIII (the pPA1870-2680 kan T7lac vector
contains the pET24 kan gene in the pET23 vector, such that no lacIq
gene is present). Proper construction of pHisBotB kan T7lac was
confirmed by restriction digestion.
[0774] b) Construction of pHisBotB kan lacIq T7lac
[0775] pHisBotB kan lacIq T7lac was constructed by insertion of the
BglII/HindIII fragment of pHisBotB which contains the BotB gene
sequences into similarly cut pET24a vector. Proper construction of
pHisBotB kan lacIq T7lac was confirmed by restriction
digestion.
[0776] c) Construction of pHisBotB kan lacIq T7
[0777] pHisBotB kan lacIq T7 was constructed by inserting the
NdeI/XhoI fragment from pHisBotE kan lacIq T7lac which contains the
BotB gene sequences into similarly cleaved pPA1870-2680 kan lacIq
T7 vector (this vector contains the T7 promoter, the same
N-terminal his-tag as the Bot constructs, the C. difficile toxin A
insert, and the kan lacIq genes; this cloning replaces the C.
difficile toxin A insert with the BotB insert). Proper construction
was confirmed by restriction digestion.
[0778] Expression of recombinant BotB protein from these expression
vectors and purification of the BotB protein is described in
Example 38 below.
EXAMPLE 38
Fermentation and Purification of Recombinant BotB Protein Utilizing
the pHisBotB kan lacIq T7lac, pHisBotB kan T7lac and pHisBotB kan
lacIq T7 Vectors
[0779] The pHisBotB kan lacIq T7lac, pHisBotB kan T7lac and BotB
kan lacIq T7 constructs [all transformed into the Bl21(DE3) strain]
were grown in fermentation cultures to determine the utility of the
various constructs for large scale expression and purification of
soluble BotB protein. All fermentations were performed as described
in Example 31.
[0780] a) Fermentation of pHisBotB kan lacIq T7lac/Bl21(DE3)
Cells
[0781] The fermentation culture was induced 45 min post start of
glucose feed with 1 gm IPTG (final concentration=0.4 mM). pH was
maintained at 6.5 rather than 7.0. The OD.sub.600 was 27 at time of
induction, then 35, 38, and 40 at 1-3 hrs post induction. Duplicate
platings of diluted 1 hr induction samples (dilutions were prepared
as described Ex. 31, dilution 3 utilized 3 .mu.l of dilution 2
cells) on TSA and LB+kan plates yielded 89 TSA colonies and 81 kan
colonies (90% kan resistant).
[0782] Total and soluble protein extracts were resolved on a 12.5%
SDS-PAGE gel and total protein was detected by staining with
Coomassie blue. Low level induction of insoluble Bot B protein was
observed, increasing from 1 to 3 hrs post induction (no expression
was detected in uninduced cells).
[0783] b) Fermentation of pHisBotB kan T7lac/Bl21(DE3) Cells
[0784] The fermentation culture was induced 1 hr post start of
glucose feed with 2 gm IPTG (final concentration=0.8 mM). pH was
maintained at 6.5 rather than 7.0. The OD.sub.600 was 24.5 at time
of induction, then 31.5, 32, and 33 at 1-3 hrs post induction,
respectively. Duplicate platings of diluted 0 hr and 2 hr induction
samples (dilutions were prepared as described Ex. 31; dilution 3
utilized 3 .mu.l of dilution 2 cells) on TSA and LB+kan plates
yielded 32 TSA colonies and 54 kan colonies (all kan resistant) for
uninduced cells, and 1 TSA colony and 0 kan colonies 2 hr post
induction. These results were indicative of strong induction, since
viable counts decreased dramatically 2 hrs post induction.
[0785] Total and soluble extracts were resolved on a 10% SDS-PAGE
gel and total protein was detected by staining with Coomassie blue.
Moderate induction of insoluble BotB protein was observed,
increasing from 1 to 3 hrs post induction (no expression was
detected in uninduced cells).
[0786] c) Fermentation of pHisBotB kan lacIq T7/Bl21(DE3) Cells
[0787] The fermentation was induced 2 hr post start of glucose feed
with 4 gm IPTG (final concentration=1.6 mM). pH was maintained at
6.5 rather than 7.0. The OD.sub.600 was 45 at time of induction,
then 47, 50, and 50 and 55 at 1-4 hrs post induction, respectively.
Viable colony counts decreased after induction (96, 1, 1, 2, 3;
dilution 3 utilized 3 .mu.l of dilution 2 cells). Of 63 colonies
scored at the time of induction, all 63 retaining the BotB plasmid
(kan resistant) and no colonies at induction grew on IPTG+Kan
plates (no mutations detected).
[0788] Total and soluble extracts were resolved on a 12.5% SDS-PAGE
gel and total protein was detected by staining with Coomassie blue.
Moderate level induction of insoluble BotB protein was observed,
increasing from 1 to 4 hrs post induction (lower level expression
was detected in uninduced cells, since the T7 rather than T7lac
promoter was utilized).
[0789] d) Purification of pHisBotB Protein from pHisBotB amp
T7lac/Bl21(DE3) Cells
[0790] Soluble recombinant BotB protein was purified utilizing
NiNTA resin from 80 ml of cell lysate generated from cells
harvested from a pHisBotB fermentation [using the pHisBotB amp
T7lac/Bl21(DE3) strain]. As predicted from the small scale results
above, the majority of the induced protein was insoluble. As well,
the eluted material was contaminated with multiple E. coli
contaminant proteins. A Coomassie blue-stained SDS-PAGE gel
containing extracts derived from pHisBotB amp T7lac/Bl21(DE3) cells
before and during purification is shown in FIG. 34. In FIG. 34,
lane 1 contains broad range protein MW markers (BioRad). Lanes 2-5
contain extracts prepared from pHisBotB amp T7lac/Bl21(DE3) cells
grown in fermentation culture; lane 2 contains total protein; lane
3 contains soluble protein; lane 4 contains protein which did not
bind to the NiNTA column (i.e., the flow-through) and lane 5
contains protein eluted from the NiNTA column.
[0791] Similar results were obtained using a small scale IDA column
utilizing a cell lysate from the pHisBotB kan lacIq T7 fermentation
described above. 250 mls of a 20% w/v PEI clarified lysate (50 gms
cell pellet) of botB kan lacIq T7/Bl21(DE3) cells were purified on
a small scale IDA column. The total yield of eluted protein was 21
mg protein (assuming 1 mg/ml solution=2 OD.sub.280/ml). When
analyzed by SDS-PAGE and Coomassie staining, the BotB protein was
found to comprise approximately 50% of the eluted protein with the
remainder being a ladder of E. coli proteins similar to that
observed with the NiNTA purification.
[0792] The NiNTA alkaline phosphatase conjugate was utilized to
detect his-tagged proteins on a Western blot containing total,
soluble, soluble (PEI clarified), soluble (after IDA column) and
elution samples from the IDA column purification. The results
demonstrated that a small percentage of BotB protein was soluble,
that the soluble protein was not precipitated by PEI treatment and
was quantitatively bound by the IDA column. Since a 1 liter
fermentation harvest yielded a 67.5 gm cell pellet, this indicated
that the yield of soluble affinity purified BotB protein from the
IDA column was 14 mg/liter.
EXAMPLE 39
Co-Expression of Recombinant BotB Proteins and Folding Chaperones
in Fermentation Cultures
[0793] Fermentations were performed to determine if the
simultaneous overexpression of folding chaperones (i.e., the Gro
operon) and the BotB protein resulted in enhanced solubility of the
Bot B protein. This example involved fermentation of the
pHisBotBkan lacIq T7lac/pACYCGro BL21(DE3), pHisBotB kan
T7lac/pACYCGro Bl21(DE3) and pHisBotBkan lacIq T7/pACYCGro
BL21(DE3) cell lines. Fermentation was carried out as described in
Example 31; 34 .mu.g/ml chloramphenicol was included in the feeder
and fermentation cultures.
[0794] a) Fermentation of pHisBotBkan lacIq
[0795] T7lac/pACYCGro BL21(DE3) Cells Induction was with 4 gms IPTG
at 1 hr 15 min post initiation of the glucose feed. The OD.sub.600
was 38 at time of induction, then 50, 58.5, 62 and 68 at 1-4 hrs
post induction. Viable colony counts decreased during induction
(24, 0, 0, 2, 0 at 0-4 hr induction; dilution 3 utilized 3 .mu.l of
dilution 2 cells). Of 24 colonies scored at the time of induction,
24 retained the BotB plasmid (kan resistant), 24 contained the
chaperone plasmid (chloramphenicol resistant) and no colonies at
induction grew on IPTG+Kan plates (no mutations detected).
[0796] Total and soluble extracts were resolved on 12.5% SDS-PAGE
gels and were either stained with Coomassie blue or subjected to
Western blotting (his-tagged proteins were detected utilizing the
NiNTA-alkaline phosphatase conjugate). This analysis revealed that
the Gro chaperones were induced to high levels, but very low level
expression of soluble BotB protein was observed, increasing from 1
to 4.0 hrs post induction (no expression detected in uninduced
cells, induced protein detected only on Western blot). The
dramatically lower expression of BotB protein in the presence of
chaperone may be due to promoter occlusion (i.e., the stronger T7
promoter on the chaperone plasmid was preferentially utilized).
[0797] b) Fermentation of pHisBotB kan T7lac/pACYCGro/Bl21(DE3)
Cells
[0798] Induction was with 4 gms IPTG at 1 hr post initiation of the
glucose feed. The OD.sub.600 was 33.5 at time of induction, then
44, 51, 58.5 and 69 at 1-4 hrs post induction. Viable colony counts
decreased after 2 hrs induction (43, 65, 74, 0 (70), 0 (70) at 0-4
hr induction; bracketed numbers represent microcolonies; dilution 3
utilized 3 .mu.l of dilution 2 cells). Most colonies at induction
retained the BotB plasmid (kan resistant)and the chaperone plasmid
(chloramphenicol resistant) and no colonies at induction grew on
IPTG+Kan plates (no mutations detected).
[0799] Total and soluble extracts were resolved on a 12.5% SDS-PAGE
gel and subjected to Western blotting; his-tagged proteins were
detected utilizing the NiNTA-alkaline phosphatase conjugate. This
analysis revealed that the Gro chaperones were induced to high
levels and low level expression of soluble Bot B protein was
observed, increasing from 1 to 4.0 hrs post induction (no
expression detected in uninduced cells).
[0800] A small scale IDA purification of BotB protein from a 250 ml
PEI clarified 15% w/v extract (37.5 gm cell pellet) yielded
approximately 12.5 mg protein, of which approximately 50% was BotB
protein and 50% was GroEL chaperone (assessed by Coomassie staining
of a 10% SDS-PAGE gel). The NiNTA alkaline phosphatase conjugate
was utilized to detect his-tagged proteins on a Western blot
containing total, soluble, soluble (PEI clarified), soluble (after
IDA column) and elution samples from the IDA column purification.
The results demonstrated that all of the BotB protein produced by
the pHisBotB kan T7lac/pACYCGro/Bl21(DE3) cells was soluble; the
BotB protein was not precipitated by PEI treatment and was
quantitatively bound by the IDA column. Since a 1 liter
fermentation harvest yielded a 75 gm cell pellet, this indicated
that the yield of soluble affinity purified bot B protein from this
fermentation was 12.5 mg/liter. These results also demonstrated
that additional purification steps are necessary to separate the
chaperone proteins from the BotB protein.
[0801] c) Fermentation of pHisBotBkan lacIq T7/pACYCGro/BL21(DE3)
Cells
[0802] Induction was with 4 gms IPTG at 2 hr post initiation of the
glucose feed. The OD.sub.600 was 46 at time of induction, then 56,
63, 69 and 71.5 at 1-4 hrs post induction. Viable colony counts
decreased after induction (58, 3(5), 3, 0, 0 at 0-4 hr induction;
bracketed numbers represent microcolonies; dilution 3 utilized 3
.mu.L of dilution 2 cells). All (53/53) colonies scored at the time
of induction retained the BotB plasmid (kan resistant) and the
chaperone plasmid (chloramphenicol resistant) and no colonies at
induction grew on IPTG+Kan plates (no mutations detected).
[0803] Total and soluble extracts were resolved on a 10% SDS-PAGE
gels and Western blotted and his-tagged proteins were detected
utilizing the NiNTA-alkaline phosphatase conjugate. This analysis
revealed that the Gro chaperones were induced to high levels
(observed by ponceau S staining), and a much higher expression of
soluble Bot B protein (compared to expression in the pHisBotB kan
T7lac/pACYCGro fermentation) was observed at all timepoints,
including uninduced cells (some increase in BotB protein levels
were observed after induction).
[0804] A small scale IDA purification of BotB protein from a 100 ml
PEI clarified 15% w/v extract (15 gm cell pellet) yielded
approximately 40 mg protein, of which approximately 50% was BotB
protein and 50% was GroEL chaperone, as assessed by Coomassie
staining of a 10% SDS-PAGE gel. The NiNTA alkaline phosphatase
conjugate was utilized to detect his-tagged proteins on a Western
blot containing total, soluble, soluble (PEI clarified), soluble
(after IDA column) and elution samples from the IDA column
purification. The results demonstrated that a significant
percentage (i.e., -10-20%) of BotB protein was soluble, that the
solubilized protein was not precipitated by PEI treatment and was
quantitatively bound by the IDA column. Since a 10 liter
fermentation yielded a 108 gm cell pellet, this indicated that the
yield of soluble affinity purified BotB protein from this
fermentation was 144 mg/liter.
[0805] In a scale up experiment, 2 liters of a 20% w/v PEI
clarified lysate of pHisBotB kan lacIq T7/pACYCGro/BL21(DE3) cells
were purified on a large scale IDA column. The purification was
performed in duplicate. The total yield of BotB protein was 220 and
325 mgs protein in the two experiments (assuming 1 mg/ml
solution=2.0 OD.sub.280/ml). This represents 0.7% or 1.0%,
respectively, of the total soluble cellular protein (assuming a PEI
lystate having a concentration of 8 mg protein/ml and that the
eluted material comprises a 1:1 mixture of BotB and folding
chaperone). The NiNTA alkaline phosphatase conjugate was utilized
to detect his-tagged proteins on a Western blot containing total,
soluble, soluble (PEI clarified), soluble (after IDA column) and
elution samples from the IDA column purification. These results
demonstrated that a significant percentage (i.e., .about.10-20%) of
the BotB protein was soluble, that the solubilized protein was not
precipitated by PEI treatment and was quantitatively bound by the
IDA column. Since a 1 liter fermentation harvest yielded a 108 gm
cell pellet, this indicated that the yield of soluble affinity
purified BotB protein from the large scale purification was 60 mg
or 89 mg/liter. These results also demonstrated that further
purification would be necessary to remove the contaminating
chaperone protein.
[0806] The above results provide methodologies for the purification
of soluble BotB protein from fermentation cultures, in a form
contaminated predominantly with a single E. coli protein (the
folding chaperone utilized to enhance solubility). In the next
example, methods are provided for the removal of the contaminating
chaperone protein.
EXAMPLE 40
Removal of Contaminating Folding Chaperone Protein From Purified
Recombinant C. botulinum Type B Protein
[0807] In this example size exclusion chromatography and
ultrafiltration was used to purify recombinant BotB protein from
the folding chaperones and imidazole in IDA-purified material.
[0808] To enhance the solubility of the recombinant BotB protein
during scale-up, the protein was co-expressed with folding
chaperones (see Ex. 39). During the Ni-IDA purification step, the
folding chaperones co-eluted with the BotB protein in 800 mM
imidazole; therefore, a second purification step was required to
isolate the BotB free of folding chaperones. Lane 3 of FIG. 35
contains proteins eluted from an IDA column to which a lysate of
pHisBotB kan lacIq T7/pACYCGro/BL21(DE3) cells had been applied;
the proteins were resolved on a 4-15% polyacrylamide pre-cast
gradient gel (Bio-Rad, Hercules, Calif.) run under native
conditions and then stained with Coomassie blue. In FIG. 35, lanes
1 and 4 contain proteins present in peak 1 and peak 2 from a
Sephacryl S-100 column run as described below; lane 2 is blank.
[0809] As seen in lane 3 of FIG. 35, the IDA-purified sample
consists primarily of the folding chaperones and the BotB protein.
The fact that the chaperones and the Bot B antigen appear as two
distinct bands under native conditions suggested they were not
complexed together and therefore, it should be possible to separate
them, using either a gradient of imidazole concentrations or size
exclusion methods.
[0810] In order to determine whether a gradient of imidazole
concentrations could be used to separate the chaperone from the
BotB protein, a step gradient using imidazole at 200, 400, 600, and
800 mM in 50 mM sodium phosphate, 0.5 M NaCl and 10% glycerol, pH
6.8 was applied to an IDA column (containing proteins bound from a
lysate of pHisBotB kan lacIq T7/pACYCGro/BL21(DE3) cells). By
narrowing the range of imidazole concentrations, it was hoped that
the BotB and chaperone proteins would differentially elute at
different concentrations of imidazole. Eluted proteins were
monitored by absorbance at 280 nm and collected either manually or
with a fraction collector (BioRad). Protein was found to elute at
200 and 400 mM imidazole only.
[0811] FIG. 36 shows a Coomassie stained SDS-PAGE gel containing
protein eluted during the imidazole step gradient. Lane 1 contains
broad range MW markers (BioRad). Lane 2 contains BotB protein
purified by IDA chromatography of an extract of pHisBotB/BL2l(DE3)
pLysS cells grown in shaker flask culture (i.e., no co-expression
of chaperones; Ex. 35). Lane 3 contains a 20% w/v PEI clarified
lysate of pHisBotB kan lacIq T7/pACYCGro/BL21(DE3) cells (i.e., the
lysate prior to purification by IDA chromatography). Lanes 4 and 5
contain protein which eluted at 200 or 400 mM imidazole,
respectively. Lane 6 is blank. Lanes 7 and 8 contain 1/5 the load
present in lanes 4 and 5.
[0812] As shown in FIG. 36, both the chaperone and the BotB protein
eluted in 200 mM imidazole, and more chaperone elutes in 400 mM
imidazole, however no concentration of imidazole tested permitted
the elution of BotB protein alone. Consequently, no significant
purification was achieved using imidazole at these
concentrations.
[0813] Because of the considerable difference in molecular weights
between the folding chaperone, which is a multimer with a total
molecular weight around 400 kD (as determined on a Shodex KB 804
sizing column by HPLC), and the recombinant BotB protein (molecular
weight around 50 kD), size exclusion chromatography was next
examined for the ability to separate these proteins.
[0814] a) Size Exclusion Chromatography
[0815] A column containing Sephacryl S-100 HR(S-100) (Pharmacia)
was poured (2.5 cm.times.24 cm; .about.110 ml bed volume). The
column was equilibrated in a buffer consisting of phosphate
buffered saline (10 mM potassium phosphate, 150 mM NaCl, pH 7.2)
and 10% glycerol (Mallinkrodt). Typically, 5 ml of the IDA-purified
BotB protein was filtered through a 0.45.mu. syringe filter and
applied to the column, and the equilibration buffer was pumped
through the column at a flow rate of 1 ml/minute. Eluted proteins
were monitored by absorbance at 280 nm and collected either
manually or with a fraction collector. Appropriate tubes were
pooled, if necessary, and the protein was quantitated by absorbance
at 280 nm and/or by BCA protein assay. The isolated peaks were then
analyzed by native and/or SDS-PAGE to identify the protein and
evaluate the purity.
[0816] Because of its larger size, the folding chaperone eluted
first, followed by the recombinant BotB protein. A smaller third
peak was observed which failed to stain when analyzed by SDS-PAGE
and therefore was presumed to be imidazole.
[0817] SDS-PAGE analysis (12.5% polyacrylamide, reduced samples)
was used to evaluate the purity of the IDA-purified recombinant
BotB protein before and after S-100 purification. The results are
shown in FIG. 33.
[0818] In FIG. 33, lane 1 contains broad range MW markers (BioRad).
Lane 5 contains IDA-purified BotB protein. Lane 6 contains
IDA-purified BotB protein following S-100 purification. Lane 7 is
blank (lanes 2-4 were discussed in Ex. 34 above).
[0819] The results shown in FIG. 33 show that the IDA-purified BotB
is significantly contaminated with the folding chaperone (molecular
weight about 60 kD under reducing conditions; lane 6). Following
S-100 purification, the amount of folding chaperone present in the
BotB sample was reduced dramatically (lane 7). Visual inspection of
the Coomassie stained SDS-PAGE gel revealed that after S-100
purification, >90% of the total protein present was BotB.
[0820] The IDA-purified BotB and the S-100-purified BotB samples
were analyzed by HPLC on a size exclusion column (Shodex KB 804);
this analysis revealed that the BotB protein represented 64% of the
total protein in the IDA-purified sample and that following S-100
purification, the BotB protein represented >95% of the total
protein in the sample.
[0821] The IDA-purified BotB material was also applied to a ACA 44
(SpectraPor, Houston, Tex.) column. The ACA 44 resin is equivalent
to the S-100 resin and chromatography using the ACA 44 resin was
carried out exactly as described above for the S-100 resin. The ACA
44 resin was found to separate the recombinant BotB protein from
the folding chaperone. The ACA 44-purified BotB sample was analyzed
for endotoxin using the LAL assay (Associates of Cape Cod) as
describe in Example 24. Two aliqouts of the ACA 44-purified BotB
preparation were analyzed and were found to contain either 58 to
116 EU/mg recombinant protein or 94 to 189 EU/mg recombinant
protein.
[0822] These results demonstrate that size exclusion chromatography
can be used to purify the recombinant BotB protein from the folding
chaperone and imidazole in IDA-purified material
[0823] b) Ultrafiltration for the Separation of Recombinant BotB
Protein and Chaperones
[0824] Ultrafiltration was examined as an alternative method for
the separation recombinant BotB protein and folding chaperones in
IDA-purified material. While in this example only mixtures of BotB
and chaperones were separated by ultrafiltration, this technique is
suitable for use with recombinant BotA and BotE proteins as well
provided that the wash buffers used are altered as necessary to
take into account different requirements for solubility.
[0825] The recombinant BotB protein and folding chaperones were
separated using a two-step sequential ultrafiltration method. The
first membrane used had a nominal molecular weight cutoff (MWCO) of
approximately 100 kD; this membrane retains the larger folding
chaperone while allowing the smaller recombinant protein to pass
through. The addition of several volumes of wash buffer may be
required to efficiently wash the recombinant protein through the
membrane. The second step utilized a membrane with a nominal MWCO
of approximately 10 kD. During this step, the recombinant antigen
was retained by the membrane and could be concentrated to the
degree desired and the imidazole and excess wash buffer passed
through the membrane.
[0826] Twenty-seven milliliters of an IDA-purified BotB preparation
was ultrafiltered through a 47 mm YM 100 (100 kD MWCO) membrane
(Amicon) in a 50 ml stirred cell (Amicon). The membrane was washed
in dd H.sub.2O prior to use as recommended by the manufacturer. Six
volumes of 10% glycerol in PBS were washed through to remove most
of the recombinant BotB protein and this wash was collected in a
separate vessel. The resulting BotB protein-rich filtrate was then
concentrated 12-fold using a YM 10 (10 kD MWCO) membrane (Amicon),
to a final volume of 14 ml. The YM 100 and YM 10 concentrates were
analyzed along with the lysate starting material by native PAGE
using a 4-15% pre-cast gradient gel (BioRad). The results are shown
in FIG. 37.
[0827] In FIG. 37, lane 1 contains IDA-purified BotB derived from a
shaker flask culture (i e., no co-expression of chaperones; Ex.
35); lane 2 contains a 20% w/v PEI clarified lysate of pHisBotB kan
lacIq T7/pACYCGro/BL21(DE3) cells; lane 3 shows the lysate of lane
3 after IDA purification; lane 4 contains the YM 10 concentrate and
lane 5 contains the YM 100 concentrate.
[0828] The results shown in FIG. 37 demonstrate that the
recombinant BotB protein can be purified away from the folding
chaperone by ultrafiltration through a 100 kD MWCO membrane (lane
4), leaving the chaperone protein in the 100 kD concentrate (lane
5). Analysis of the sample in lane 5 also showed that very little
of the BotB protein was retained by the 100 kD MWCO membrane after
6 volumes of wash buffer had been applied.
[0829] The BotB samples following IDA chromatography and following
ultrafiltration through the YM 100 membrane were anlyzed by HPLC on
a size exclusion column (Shodex KB 804); this analysis revealed
that the BotB protein represented 64% of the total protein in the
IDA-purified sample and that following ultrafiltration through the
YM 100 membrane, the BotB protein represented >96% of the total
protein in the sample.
[0830] The BotB protein purified by ultrafiltration through the YM
100 membrane was examined for endotoxin using the LAL assay
(Associates of Cape Cod) as describe in Example 24. Two aliqouts of
the YM 100-purified BotB preparation were analyzed and were found
to contain either 18 to 36 EU/mg recombinant protein or 125 to 250
EU/mg recombinant protein.
[0831] The above results demonstrate that size exclusion
chromatography and ultrafiltration can be used to purify
recombinant botulinal toxin proteins away from folding
chaperones.
EXAMPLE 41
Cloning and Expression of the C Fragment of the C. botulinum
Serotype E Toxin Gene
[0832] The C. botulinum type E neurotoxin gene has been cloned and
sequenced from several different strains [Poulet et al. (1992)
Biochem. Biophys. Res. Commun. 183:107 (strain Beluga); Whelan et
al. (1992) Eur. J. Biochem. 204:657 (strain NCTC 11219); Fujii et
al. (1990) Microbiol. Immunol. 34:1041 (partial sequence of strains
Mashike, Iwani and Otaru) and Fujii et al. (1993) J. Gen.
Microbiol. 139:79 (strain Mashike)]. The nucleotide sequence of the
type E toxin gene is available from the EMBL sequence data bank
under accession numbers X62089 (strain Beluga) and X62683 (strain
NCTC 11219). The nucleotide sequence of the coding region (strain
Beluga) is listed in SEQ ID NO:49. The amino acid sequence of the
C. botulinum type E neurotoxin derived from strain Belgua is listed
in SEQ ID NO:50. The nucleotide sequence-of the coding region
(strain NCTC 11219) is listed in SEQ ID NO:51. The amino acid
sequence of the C. botulinum type E neurotoxin derived from strain
NCTC 11219 is listed in SEQ ID NO:52.
[0833] The DNA sequence encoding the native C. botulinum serotype E
C fragment gene derived from the Beluga strain can be expressed as
a histidine-tagged protein using the pETHisb vector; the resulting
coding region is listed in SEQ ID NO:53 and the corresponding amino
acid sequence is listed in SEQ ID NO:54. The DNA sequence encoding
the C fragment of the native C. botulinum serotype E gene derived
from the NCTC 11219 strain can be expressed as a histidine-tagged
fusion protein using the pETHisb vector; the resulting coding
region is listed in SEQ ID NO:55 and the corresponding amino acid
sequence is listed in SEQ ID NO:56. The C fragment region from any
strain of C. botulinum serotype E can be amplified and expressed
using the approach illustrated below using the C fragment derived
from C. botulinum type E 2231strain (ATCC #17786).
[0834] The type E neurotoxin gene is synthesized as a single
polypeptide chain which may be converted to a double-chain form
(i.e., a heavy chain and a light chain) by cleavage with trypsin;
unlike the type A neurotoxin, the type E neurotoxin exists
essentially only in the single-chain form. The 50 kD
carboxy-terminal portion of the heavy chain is referred to as the C
fragment or the H.sub.C domain. Expression of the C fragment of C.
botulinum type E toxin in heterologous hosts (e.g., E. coli) has
not been previously reported.
[0835] The native C fragment of the C. botulinum serotype E toxin
(BotE) gene was cloned and inserted into expression vectors to
facilitate expression of the recombinant BotE protein in E. coli.
This example involved PCR amplification of the gene, cloning, and
construction of expression vectors.
[0836] The BotE serotype gene was isolated using PCR as described
for the BotA serotype gene in Example 28. The C. botulinum type E
strain was obtained from the American Type Culture Collection (ATCC
#17786; strain 2231). The following primer pair was used in the PCR
amplification: 5'-CGCCATGGCTCTTTCTTCTTAT ACAGATGAT-3' (5' primer,
engineered NcoI site underlined) (SEQ ID NO:57) and
5'-GCAAGCTTTTATTTTTCTTGCCATCCATG-3' (3' primer, engineered HindIII
site underlined, native gene termination codon italicized) (SEQ ID
NO:58). The PCR product was inserted into pCRscript as described in
Example 28. The resulting pCRscript BotE clone was confirmed by
restriction digestion, as well as, by obtaining the sequence of
approximately 300 bases located at the 5' end of the C fragment
coding region using standard DNA sequencing methods. The resulting
BotE sequence was identical to that of the published C. botulinum
type E toxin sequence [Whelan et al (1992), supra].
[0837] The NheI(filled)/HindIII fragment from a pCRscript BotE
recombinant was cloned into pETHisb vector as described for BotA C
fragment in Example 28. The resulting construct was termed
pHisBotE. pHisBotE expresses the BotE gene under the control of the
T7 lac promoter and the resulting protein contains an N-terminal
10.times.His-tag affinity tag.
[0838] The pHisBotE expression construct was transformed into
BL21(DE3) pLysS competent cells and 1 liter cultures were grown,
induced and his-tagged proteins were purified utilizing a NiNTA
resin (eluted in low pH elution buffer) as described in Example 28.
Total, soluble and purified proteins were resolved by SDS-PAGE and
detected by Coomassie staining. The results are shown in FIG.
38.
[0839] In FIG. 38, lane 1 contains broad range MW markers (BioRad);
lane 2 contains a total protein extract; lane 3 contains a soluble
protein extract; lane 4 contains proteins present in the flow
through from the NiNTA column (this sample was not diluted prior to
loading and therefore represents a load 5.times. that of the load
applied for the total and soluble extracts in lanes 2 and 3); lane
5 contains proteins eluted from the NiNTA column; lane 6 contains
protein eluted from a NiNTA column which had been stored at
-20.degree. C. for 1 year.
[0840] The pHisBotE protein was expressed at moderate levels (7
mg/liter) as a totally soluble protein. The purified protein
migrated as a single band of the predicted MW.
[0841] Western blot hybridization utilizing a chicken anti-C.
botulinum serotype E toxoid primary antibody (generated by
immunization of hens as described in Example 3 using C. botulinum
serotype E toxoid) was also performed on the total, soluble and
purified BotE proteins. Samples of BotA and BotB C fragments were
also included on the gels to facilitate MW and immunogenicity
comparisons. Strong immunoreactivity was detected using the anti-C.
botulinum type E toxoid antibody only with the BotE protein.
[0842] These results demonstrate that the native BotE gene
sequences can be expressed as a soluble his-tagged protein in E.
coli and purified by metal-chelation affinity chromatography.
EXAMPLE 42
Generation of Neutralizing Antibodies Using the Recombinant
pHisBotE Protein
[0843] The ability of the purified pHisBotE protein to generate
neutralizing antibodies was examined. Nine BALBc mice were
immunized with BotE protein (purified as described in Ex. 41) using
Gerbu GMDP adjuvant (CC Biotech). The low pH elution was mixed with
Gerbu adjuvant and used to immunize mice. Each mouse received a
subcutaneous injection of 100 .mu.l antigen/adjuvant mix (35 .mu.g
antigen+1 .mu.g adjuvant) on day 0. Mice were subcutaneously
boosted as above on day 14 and bled on day 28. Mice were
subsequently boosted and bled on day 70.
[0844] Anti-C. botulinum serotype E toxoid titers were determined
in day 28 serum from individual mice from each group using the
ELISA protocol outlined in Example 29 with the exception that the
plates were coated with C. botulinum serotype E toxoid, and the
primary antibody was a chicken anti-C. botulinum serotype E toxoid.
Seroconversion [relative to control mice immunized with the
p6.times.HisBotA antigen (Ex. 29)] was observed with all 9 mice
immunized with the purified pHisBotE protein.
[0845] The ability of the anti-BotE antibodies to neutralize native
C. botulinum type E toxin was tested in a mouse-C. botulinum
neutralization model using pooled mouse serum (see Ex. 23b). The
LD.sub.50 of purified C. botulinum type E toxin complex (Dr. Eric
Johnson, University of Wisconsin, Madison) was determined by a
intraperitoneal (IP) method [Schantz and Kautler (1978), supra]
using 18-22 g female ICR mice. The amount of neutralizing
antibodies present in the serum of the immunized mice was
determined using serum antibody titrations. The various serum
dilutions (0.01 ml) were mixed with 5 LD.sub.50 units of C.
botulinum type E toxin and the mixtures were injected IP into mice.
The neutralizations were performed in duplicate. The mice were then
observed for signs of botulism for 4 days. Undiluted serum from day
28 did not protect, while undiluted, {fraction (1/10)} diluted and
{fraction (1/100)} diluted day 70 serum protected (1005 of animals)
while {fraction (1/1000)} diluted day 70 serum did not. This
corresponds to a neutralization titer of 50-500 IU/ml.
[0846] These results demonstrate that seroconversion occurred and
neutralizing antibodies were induced when the recombinant BotE
protein was utilized as the immunogen.
EXAMPLE 43
Construction of Vectors to Facilitate Expression of His-Tagged BotE
Protein in Fermentation Cultures
[0847] A number of expression vectors were constructed to
facilitate the expression of recombinant BotE protein in large
scale fermentation culture. These constructs varied as to the
strength of the promoter utilized (T7 or T7lac) and the presence of
repressor elements (lacIq) on the plasmid. The resulting constructs
varied in the level of expression achieved and in plasmid stability
which facilitated the selection of a optimal expression system for
fermentation scaleup. This example involved a) construction of BotE
expression vectors and b) determination of expression levels in
small scale cultures.
[0848] a) Construction of BotE Expression Vectors
[0849] The BotE expression vectors created for fermentation culture
were engineered to utilize the kanamycin rather than the ampicillin
resistance gene, and contained either the T7 or T7lac promoter,
with or without the lacIq gene for the reasons outlined in Example
30.
[0850] In all cases, the protein expressed by the various
expression vectors is the pHisBotE protein described in Example 41,
with the only differences between clones being the alteration of
various regulatory elements. Using the designations outlined below,
the pHisBotE clone (Ex. 41) is equivalent to pHisBotE amp
T7lac.
[0851] i) Construction of pHisBotE kan lacIq T7lac
[0852] pHisBotE kan lacIq T7lac was constructed by inserting the
XbaI/HindIII fragment of pHisBotE which contains the BotE gene
sequences into XbaI/HindIII-cleaved pET24a vector. Proper
construction was confirmed by restriction digestion.
[0853] ii) Construction of pHisBotE kan T7
[0854] pHisBotE kan T7 was constructed by ligating the
BotE-containing XbaI/SapI fragment of pHisBotE kan lacIqT7lac to
the T7 promoter-containing XbaI/SapI fragment of pET23a. Proper
construction was confirmed by restriction digestion.
[0855] iii) Construction of pHisBotE kan lacIqT7
[0856] pHisBotE kan lacIqT7 was constructed by inserting the
BglII/HindIII fragment from pHisBotE kan T7 which contains the BotE
gene sequences into BglII/HindIII-cleaved pET24 vector. Proper
construction was confirmed by restriction digestion.
[0857] b) Determination of BotE Expression Levels in Small Scale
Cultures
[0858] The three BotE kan expression vectors described above were
transformed into Bl21(DE3) competent cells and 50 ml (2.times.YT+40
.mu.g/ml kan) cultures were grown and induced with ITPG as
described in Example 28. Total and soluble protein extracts from
before and after induction made as described in Example 28. The
total and soluble extracts were resolved on a 12.5% SDS-PAGE gel,
and his-tagged proteins were detected on a Western blot utilizing
the NiNTA-alkaline phosphatase conjugate as described in Example
31(c)(iii). The results showed that all three BotE cell lines
expressed his-tagged proteins of the predicted MW for the BotE
protein upon induction. The results also demonstrated that the two
constructs that contained the T7 promoter expressed the BotE
protein before induction, while the T7lac promoter construct did
not. Upon induction, the T7 promoter-containing constructs induced
to higher levels than the T71.alpha.-containing construct, with the
pHisBotE kan lacIqT7/Bl21(DE3) cells accumulating the maximal
levels of BotE protein.
EXAMPLE 44
Expression and Purification of pHisBotE from Fermentation
Cultures
[0859] Based on the small scale inductions performed in Example 43,
the pHisBotE kan lacIq T7/Bl21(DE3) strain was selected for
fermentation scaleup. This example involved the fermentation and
purification of recombinant BotE C fragment protein.
[0860] A fermentation with the pHisBotE kan lacIq T7/Bl21(DE3)
strain was performed as described in Example 31. The fermentation
culture was induced 2 hrs post start of the glucose feed with 4 gm
IPTG (final concentration=1.6 mM). The OD.sub.600 was 42 at time of
induction, then 46.5, 48, 53 and 54 at 1-4 hrs post induction.
Viable colony counts decreased from 0-4 hr induction [131, 4 (28),
7 (3), 7, 8; dilution 3 utilized 6 .mu.l of dilution 2 cells;
bracketed colonies are microcolonies]. All (32/32) colonies scored
at the time of induction retained the BotE plasmid (kan resistant)
and no colonies at induction grew on IPTG+Kan plates (no mutations
detected). These results were indicative of strong promoter
induction, since colony viability reduced after induction, and the
culture stopped growing during fermentation (stopped at 54
OD.sub.600 ml).
[0861] Total and soluble extracts were resolved on a 12.5% SDS-PAGE
gel and total protein was detected by staining with Coomassie blue.
The results are shown in FIG. 39.
[0862] In FIG. 39, lane 1 contains total protein from a pHisBotA
kan T7 lac/Bl21(DE3) pLysS fermentation (Ex. 24). Lanes 2-9 contain
extracts prepared from the above pHisBotE kan lacIq T7/Bl21(DE3)
fermentation; lanes 2-4 contain total protein extracts prepared at
0, 1 and 2 hours post-induction, respectively. Lane 5 contains a
soluble protein extract prepared at 2 hours post-induction. Lanes 6
and 7 contain total and soluble extracts prepared at 3 hours
post-induction, respectively. Lanes 8 and 9 contain total and
soluble extracts prepared at 4 hours post-induction, respectively.
Lane 10 contains broad range MW markers (BioRad).
[0863] The results shown in FIG. 39 demonstrate that moderate level
induction of totally soluble Bot E protein was observed, increasing
from 1 to 4 hrs post induction (no expression was detected in
uninduced cells). From a 2 liter fermentation harvest a 155 gm (wet
wt) cell pellet was obtained and used to make a PEI-clarified
lysate (1 liter in CRB, pH 6.8). The lysate was applied to a large
scale IDA column and 200 mg of BotE protein, which was found to be
greater than 95% pure (as judged by visual inspection of a
Coomassie stained SDS-PAGE gel), was recovered. This represents
2.5% of the total soluble cellular protein (assuming a PEI lysate
having a concentration of 8 mg protein/ml) and corresponds to a
yield of 100 mg BotE protein/liter of fermentation culture.
[0864] The above results demonstrate that high levels of the
recombinant BotE protein can be expressed and purified from
fermentation cultures.
EXAMPLE 45
Removal of Imidazole from Purified Recombinant BotE Protein
Preparations
[0865] The expression of recombinant BotE protein, unlike the BotA
and BotB proteins, did not require the presence of folding
chaperones to maintain solubility during scale-up. A size exclusion
chromatography step was included however to remove the imidazole
from the sample and exchange the IDA elution buffer for one
consistent with the BotA antigen.
[0866] A Sephacryl S-100 HR(S-100; Pharmacia) column was poured
(2.5 cm.times.24 cm; bed volume.about.110 ml). Under these
conditions, the BotE protein should be retained by the beads to a
lesser degree than the smaller imidazole, therefore the BotE
protein should elute from the column before the imidazole. The
column was equilibrated in a buffer consisting of 50 mM sodium
phosphate, 0.5 M NaCl, and 10% glycerol (all reagents from
Mallinkrodt). Five milliliters of the IDA-purified BotE protein
(Ex. 44) was filtered through a 0.45.mu. syringe filter and applied
to the S-100 column, and equilibration buffer was pumped through
the column at a flow rate of 1 ml/minute. Eluted proteins were
monitored by absorbance at 280 nm, and collected either manually or
with a fraction collector. Appropriate tubes were pooled if
necessary, and the protein was quantitated by absorbance at 280 nm
and/or BCA protein assay. The isolated peaks were then analyzed by
native and/or SDS-PAGE to identify the protein(s) and evaluate the
purity.
[0867] FIG. 40 provides a representative chromatogram showing the
purification of IDA-purified BotE on the S-100 column. Even though
folding chaperones were not over-expressed with this antigen, a
small amount of protein eluted at a time consistent with the
folding chaperones expressed with BotA and BotB proteins (Gro) (see
the first peak). The second peak in the chromatogram contained the
BotE protein, and the third peak was presumably imidazole. This
presumed imidazole peak was isolated in comparable levels in
IDA-purified BotA and BotB protein preparations as well.
[0868] These results demonstrate that size exclusion chromatography
can be used to remove imidazole and traces of contaminating high
molecular weight proteins from IDA-purified BotE protein
preparations.
[0869] The S-100-purified BotE protein was tested for endotoxin
contamination using the LAL assay as described in Example 24. This
preparation was found to contain 64 to 128 EU/mg recombinant
protein and is therefore substantially free of endotoxin.
[0870] The S-100 purified BotE was mixed with purified preparations
of BotA and BotB proteins and used to immunize mice; 5 .mu.g of
each Bot protein was used per immunization and alum was included as
an adjuvant. After two immunizations with this trivalent vaccine,
the immunized mice were challanged with C. botulinum toxin. The
immunized mice contained neutralizing antibodies sufficient to
neutralize between 100,000 to 1,000,000 LD.sub.50 of either toxin A
or toxin B and between 1,000 to 10,000 LD.sub.50 of toxin E. The
titer of neutralizing antibodies directed against toxin E would be
expected to increase following subsequent boosts with the vaccine.
These results demonstrate that a trivalent vaccine containing
recombinant BotA, BotB and BotE proteins provokes neutralizing
antibodies.
EXAMPLE 46
Expression of the C Fragment of the C. botulinum Serotype C Toxin
Gene and Generation of Neutralizing Antibodies
[0871] The C. botulinum type Cl neurotoxin gene has been cloned and
sequenced [Kimura et al (1990) Biochem. Biophys. Res. Comm.
171:1304]. The nucleotide sequence of the toxin gene derived from
the C. botulinum type C strain C-Stockholm is available from the
EMBL/GenBank sequence data banks under the accession number D90210;
the nucleotide sequence of the coding region is listed in SEQ ID
NO:59. The amino acid sequence of the C. botulinum type C1
neurotoxin derived from this strain is listed in SEQ ID NO:60.
[0872] The DNA sequence encoding the native C. botulinum serotype
C.sub.1-C fragment gene derived from the C-Stockholm strain can be
expressed using the pETHisb vector; the resulting coding region is
listed in SEQ ID NO:61 and the corresponding amino acid sequence is
listed in SEQ ID NO:62. The C fragment region from any strain of C.
botulinum serotype C can be amplified and expressed using the
approach illustrated below using the C fragment derived from C.
botulinum type C C-Stockholm strain. Expression of the C fragment
of C. botulinum type Cl toxin in heterologous hosts (e.g., E. coli)
has not been previously reported.
[0873] The C fragment of the C. botulinum serotype C1 (BotC1) toxin
gene is cloned using the protocols and conditions described in
Example 28 for the isolation of the native BotA gene. A number of
C. botulinum serotype C strains (expressing either or both C1 and
C2 toxin) are available from the ATCC [eg., 2220 (ATCC 17782), 2239
(ATCC 17783), 2223 (ATCC 17784; a type C-.beta. strain; C-.beta.
strains produce C2 toxin), 662 (ATCC 17849; a type C-.alpha.
strain; C-.alpha. strains produce mainly C1 toxin and a small
amount of C2 toxin), 2021 (ATCC 17850; a type C-.alpha. strain) and
VPI 3803 (ATCC 25766)]. Alternatively, other type C strains may be
employed for the isolation of sequences encoding the C fragment of
C. botulinum serotype C toxin.
[0874] The following primer pair is used to amplify the BotC gene:
5'-CGCCATGGC TTTATTAAAAGATATAATTAATG-3' [5' primer, engineered NcoI
site underlined (SEQ ID NO:63)] and 5'-GCAAGCTTTTATTCACTTACAGGTAC
AAAACC-3' [3' primer, engineered HindIII site underlined, native
gene termination codon italicized (SEQ ID NO:64)]. Following PCR
amplification, the PCR product is inserted into the pCRscript
vector and then the 1.5 kb fragment is cloned into pETHisb vector
as described for BotA C fragment gene in Example 28. The resulting
construct is termed pHisBotC. Proper construction is confirmed by
DNA sequencing of the BotC sequences contained within pHisBotC.
[0875] pHisBotC expresses the BotC gene sequences under the
transcriptional control of the T7 lac promoter and the resulting
protein contains an N-terminal 10.times.His-tag affinity tag. The
pHisBotC expression construct is transformed into BL21(DE3) pLysS
competent cells and 1 liter cultures are grown, induced and
his-tagged proteins are purified utilizing a NiNTA resin (eluted in
250 mM imidazole, 20% glycerol) as described in Example 28. Total,
soluble and purified proteins are resolved by SDS-PAGE and detected
by Coomassie staining and Western blot hybridization utilizing a
Ni-NTA-alkaline phosphatase conjugate (Qiagen) which recognizes
his-tagged proteins as described in Example 31 (c)(iii). This
analysis permits the determination of expression levels of the
pHisBotC protein (i.e., number of mg/liter expressed as a soluble
protein). The purified BotC protein will migrate as a single band
of the predicted MW (i.e., .about.50 kD).
[0876] The level of expression of the pHisBotC protein may be
modified (increased) by substitution of the T7 promoter for the
T7lac promoter, or by inclusion of the lacIq gene on the expression
plasmid, and plasmid expressed in BL21(DE3) cell lines in
fermentation cultures as described in Example 30. If only very low
levels (i.e., less than 0.5%) of soluble pHisBotC protein are
expressed using the above expression systems, the pHisBotC
construct may be co-expressed with pACYCGro construct as described
in Example 32. In this case, the recombinant BotC protein may
co-purify with the folding chaperones. The contaminating chaperones
may be removed as described in Example 34. Preparations of purified
pHisBotC protein are tested for endotoxin contamination using the
LAL assay as described in Example 24.
[0877] The purifed pHisBotC protein is used to generate
neutralizing antibodies. BALBc mice are immunized with the BotC
protein using Gerbu GMDP adjuvant (CC Biotech) as described in
Example 36. The ability of the anti-BotC antibodies to neutralize
native C. botulinum type C toxin is demonstrated using the mouse-C.
botulinum neutralization model described in Example 36.
EXAMPLE 47
Expression of the C Fragment of the C. botulinum Serotype D Toxin
Gene and Generation of Neutralizing Antibodies
[0878] The C. botulinum type D neurotoxin gene has been cloned and
sequenced [Sunagawa et al. (1992) J. Vet. Med. Sci. 54:905 and Binz
et al. (1990) Nucleic Acids Res. 18:5556]. The nucleotide sequence
of the toxin gene derived from the CB16 strain is available from
the EMBL/GenBank sequence data banks under the accession number
S49407; the nucleotide sequence of the coding region is listed in
SEQ ID NO:65. The amino acid sequence of the C. botulinum type D
neurotoxin derived from the CB16 strain is listed in SEQ ID
NO:66.
[0879] The DNA sequence encoding the native C. botulinum serotype D
C fragment gene derived from a BotD expressing strain can be
expressed using the pETHisb vector; the resulting coding region is
listed in SEQ ID NO:67 and the corresponding amino acid sequence is
listed in SEQ ID NO:68. The C fragment region from any strain of C.
botulinum serotype D can be amplified and expressed using the
approach illustrated below using the C fragment derived from C.
botulinum type D CB16 strain. Expression of the C fragment of C.
botulinum type D toxin in heterologous hosts (e.g. E. coli) has not
been previously reported.
[0880] The C fragment of the C. botulinum serotype D (BotD) toxin
gene is cloned using the protocols and conditions described in
Example 28 for the isolation of the native BotA gene. A number of
C. botulinum type D strains are available from the ATCC [e.g., ATCC
9633, 2023 (ATCC 17851), and VPI 5995 (ATCC 27517)].
[0881] The following primer pair is used to amplify the BotD gene:
5'-CGCCATGGC MATTAAAAGATATAATTAATG-3' [5' primer, engineered NcoI
site underlined (SEQ ID NO:63)] and
5'-GCAAGCTTTTACTCTACCCATCCTGGATCCCT-3' [3' primer, engineered
HindIII site underlined, native gene termination codon italicized
(SEQ ID NO:69)]. Following PCR amplification, the PCR product is
inserted into the pCRscript vector and then the 1.5 kb fragment is
cloned into pETHisb vector as described for BotA C fragment gene in
Example 28. The resulting construct is termed pHisBotD. pHisBotD
expresses the BotD gene sequences under the transcriptional control
of the T7 lac promoter and the resulting protein contains an
N-terminal 10.times.His-tag affinity tag. The pHisBotD expression
construct is transformed into BL21(DE3) pLysS competent cells and 1
liter cultures are grown, induced and his-tagged proteins are
purified utilizing a NiNTA resin as described in Example 28. Total,
soluble and purified proteins are resolved by SDS-PAGE and detected
by Coomassie staining and Western blot hybridization utilizing a
Ni-NTA-alkaline phosphatase conjugate (Qiagen) which recognizes
his-tagged proteins as described in Example 31 (c)(iii). This
analysis permits the determination of expression levels of the
pHisBotD protein (i.e., number of mg/liter expressed as a soluble
protein). The purified BotD protein will migrate as a single band
of the predicted MW (i.e., .about.50kD).
[0882] The level of expression of the pHisBotD protein may be
modified (increased) by substitution of the T7 promoter for the
T7lac promoter, or by inclusion of the lacIq gene on the expression
plasmid, and plasmid expressed in BL21(DE3) cell lines in
fermentation cultures as described in Example 30. If only very low
levels (i.e., less than about 0.5%) of soluble pHisBotD protein are
expressed using the above expression systems, the pHisBotD
construct may be co-expressed with pACYCGro construct as described
in Example 32. In this case, the recombinant BotD protein may
co-purify with the folding chaperones. The contaminating chaperones
may be removed as described in Example 34. Preparations of purified
pHisBotD protein are tested for endotoxin contamination using the
LAL assay as described in Example 24.
[0883] The purifed pHisBotD protein is used to generate
neutralizing antibodies. BALBc mice are immunized with the BotD
protein using Gerbu GMDP adjuvant (CC Biotech) as described in
Example 36. The ability of the anti-BotD antibodies to neutralize
native C. botulinum type D toxin is demonstrated using the mouse-C.
botulinum neutralization model described in Example 36.
EXAMPLE 48
Expression of the C Fragment of the C. botulinum Serotype F Toxin
Gene and Generation of Neutralizing Antibodies
[0884] The C. botulinum type F neurotoxin gene has been cloned and
sequenced [East et al. (1992) FEMS Microbiol. Lett. 96:225]. The
nucleotide sequence of the toxin gene derived from the 202F strain
(ATCC 23387) is available from the EMBL/GenBank sequence data banks
under the accession number M92906; the nucleotide sequence of the
coding region is listed in SEQ ID NO:70. The amino acid sequence of
the C. botulinum type F neurotoxin derived from the 202F strain is
listed in SEQ ID NO:71.
[0885] The DNA sequence encoding the native C. botulinum serotype F
C fragment gene derived from the 202F strain can be expressed using
the pETHisb vector; the resulting coding region is listed in SEQ ID
NO:72 and the corresponding amino acid sequence is listed in SEQ ID
NO:73. The C fragment region from any strain of C. botulinum
serotype F can be amplified and expressed using the approach
illustrated below using the C fragment derived from C. botulinum
type F 202F strain. Expression of the C fragment of C. botulinum
type F toxin in heterologous hosts (e.g., E. coli) has not been
previously reported.
[0886] The C fragment of the C. botulinum serotype F (BotF) toxin
gene is cloned using the protocols and conditions described in
Example 28 for the isolation of the native BotA gene. The C.
botulinum type F 202F strain is obtained from the American Type
Culture Collection (ATCC 23387). Alternatively, sequences encoding
the BotF toxin may be isolated from any BotF expressing strain
[e.g., VPI 4404 (ATCC 25764), VPI 2382 (ATCC 27321) and Langeland
(ATCC 35415)]. The following primer pair is used to amplify the
BotF gene: 5'-CGCCATGGC TATTCTAATTATATATTTTAATAG-3' [5' primer,
engineered NcoI site underlined (SEQ ID NO:74)] and
5'-GCAAGCTTTCATTCTTTCCATCCATTCTC-3' [3' primer, engineered HindIII
site underlined, native gene termination codon italicized (SEQ ID
NO:75)]. Following PCR amplification, the PCR product is inserted
into the pCRscript vector and then the 1.5 kb fragment is cloned
into pETHisb vector as described for BotA C fragment gene in
Example 28. The resulting construct is termed pHisBotF. pHisBotF
expresses the BotF gene sequences under the transcriptional control
of the T7 lac promoter and the resulting protein contains an
N-terminal 10.times.His-tag affinity tag. The pHisBotF expression
construct is transformed into BL21(DE3) pLysS competent cells and 1
liter cultures are grown, induced and his-tagged proteins are
purified utilizing a NiNTA resin as described in Example 28. Total,
soluble and purified proteins are resolved by SDS-PAGE and detected
by Coomassie staining and Western blot hybridization utilizing a
Ni-NTA-alkaline phosphatase conjugate (Qiagen) which recognizes
his-tagged proteins as described in Example 31 (c)(iii). This
analysis permits the determination of expression levels of the
pHisBotF protein (i.e., number of mg/liter expressed as a soluble
protein). The purified BotF protein will migrate as a single band
of the predicted MW (i.e., .about.50 kD).
[0887] The level of expression of the pHisBotF protein may be
modified (increased) by substitution of the T7 promoter for the
T7lac promoter, or by inclusion of the lacIq gene on the expression
plasmid, and plasmid expressed in BL21(DE3) cell lines in
fermentation cultures as described in Example 30. If only very low
levels (i.e., less than about 0.5%) of soluble pHisBotF protein are
expressed using the above expression systems. the pHisBotF
construct may be co-expressed with pACYCGro construct as described
in Example 32. In this case, the recombinant BotF protein may
co-purify with the folding chaperones. The contaminating chaperones
may be removed as described in Example 34. Preparations of purified
pHisBotF protein are tested for endotoxin contamination using the
LAL assay as described in Example 24.
[0888] The purifed pHisBotF protein is used to generate
neutralizing antibodies. BALBc mice are immunized with the BotF
protein using Gerbu GMDP adjuvant (CC Biotech) as described in
Example 36. The ability of the anti-BotF antibodies to neutralize
native C. botulinum type F toxin is demonstrated using the mouse-C.
botulinum neutralization model described in Example 36.
EXAMPLE 49
Expression of the C Fragment of the C. botulinum Serotype G Toxin
Gene and Generation of Neutralizing Antibodies
[0889] The C. botulinum type G neurotoxin gene has been cloned and
sequenced [Campbell et al. (1993) Biochimica et Biophysica Acta
1216:487 and Binz et al. (1990) Nucleic Acids Res. 18:5556]. The
nucleotide sequence of the toxin gene derived from the 113/30
strain (NCFB 3012) is available from the EMBL/GenBank sequence data
banks under the accession number X74162; the nucleotide sequence of
the coding region is listed in SEQ ID NO:76. The amino acid
sequence of the C. botulinum type G neurotoxin derived from this
strain is listed in SEQ ID NO:77.
[0890] The DNA sequence encoding the native C. botulinum serotype G
C fragment gene derived from the 113/30 strain can be expressed
using the pETHisb vector; the resulting coding region is listed in
SEQ ID NO:78 and the corresponding amino acid sequence is listed in
SEQ ID NO:79. The C fragment region from any strain of C. botulinum
serotype G can be amplified and expressed using the approach
illustrated below using the C fragment derived from C. botulinum
type G 113/30 strain. Expression of the C fragment of C. botulinum
type G toxin in heterologous hosts (e.g., E. coli) has not been
previously reported.
[0891] The C fragment of the C. botulinum serotype G (BotG) toxin
gene is cloned using the protocols and conditions described in
Example 28 for the isolation of the native BotA gene. The C.
botulinum type G 113/30 strain is obtained from the NCFB. The
following primer pair is used to amplify the BotG gene:
5'-CGCCATGGCTGAC ACAATTTTAATACA AGT-3' [5' primer, engineered NcoI
site underlined (SEQ ID NO:80)] and
5'-GCCTCGAGTTATTCTGTCCATCCTTCATCCAC-3' [3' primer, engineered XhoI
site underlined, native gene termination codon italicized (SEQ ID
NO:81)]. Following PCR amplification, the PCR product is inserted
into the pCRscript vector and then the 1.5 kb fragment is cloned
into pETHisb vector as described for BotA C fragment gene in
Example 28 with the exception that the sequences encoding BotG are
excised from the pCRscript vector by digestion with NcoI and XhoI
and the NcoI site is blunted (the BotG sequences contain an
internal HindIII site). This NcoI(filled)/XhoI fragment is then
ligated to the pETHisb vector which has been digested with NheI and
Salt and the NheI site is blunted. The resulting construct is
termed pHisBotG. pHisBotG expresses the BotG gene sequences under
the transcriptional control of the T7 lac promoter and the
resulting protein contains an N-terminal 10.times.His-tag affinity
tag. The pHisBotG expression construct is transformed into
BL21(DE3) pLysS competent cells and 1 liter cultures are grown,
induced and his-tagged proteins are purified utilizing a NiNTA
resin as described in Example 28. Total, soluble and purified
proteins are resolved by SD S-PAGE and detected by Coomassie
staining and Western blot hybridization utilizing a Ni-NTA-alkaline
phosphatase conjugate (Qiagen) which recognizes his-tagged proteins
as described in Example 31 (c)(iii). This analysis permits the
determination of expression levels of the pHisBotG protein (i.e.,
number of mg/liter expressed as a soluble protein). The purified
BotG protein will migrate as a single band of the predicted MW
(i.e., -50kD).
[0892] The level of expression of the pHisBotG protein may be
modified (increased) by substitution of the T7 promoter for the
T7ac promoter, or by inclusion of the lacIq gene on the expression
plasmid, and plasmid expressed in BL21(DE3) cell lines in
fermentation cultures as described in Example 30. If only very low
levels (i.e., less than about 0.5%) of soluble pHisBotG protein are
expressed using the above expression systems, the pHisBotG
construct may be co-expressed with pACYCGro construct as described
in Example 32. In this case, the recombinant BotG protein may
co-purify with the folding chaperones. The contaminating chaperones
may be removed as described in Example 34. Preparations of purified
pHisBotG protein are tested for endotoxin contamination using the
LAL assay as described in Example 24.
[0893] The purifed pHisBotG protein is used to generate
neutralizing antibodies. BALBc mice are immunized with the BotG
protein using Gerbu GMDP adjuvant (CC Biotech) as described in
Example 36. The ability of the anti-BotG antibodies to neutralize
native C. botulinum type G toxin is demonstrated using the mouse-C.
botulinum neutralization model described in Example 36.
EXAMPLE 50
Expression of Recombinant Botulinal Toxin Proteins in Eucaryotic
Host Cells
[0894] Recombinant botulinal C fragment proteins may be expressed
in eucaryotic host cells, such as yeast and insect cells.
[0895] a) Expression in Yeast
[0896] Botulinal C fragments derived from serotypes A, B, C, D, E,
F and G may be expressed in yeast cells using a variety of
commercially available vectors. For example, the pPIC3K and pPIC9K
expression vectors (Invitrogen) may be employed for expression in
the methylotrophic yeast, Pichia pastoris. When the pPIC3K vector
is employed, expression of the botulinal C fragment protein will be
intracellular. When the pPIC3K vector is employed, the botulinal C
fragment protein will be secreted (the alpha factor secretion
signal is provided on the pPIC9K vector).
[0897] DNA sequences encoding the desired C fragment is inserted
into these vectors using techniques known to the art. Briefly, the
desired botulinal expression cassette (including sequences encoding
the his-tag; described in the preceding examples) is amplified
using the PCR in conjunction with primers that incorporate unique
restriction sites at the termini of the amplified fragment.
Suitable restriction enzyme sites include SnaBI, EcoRI, AvrII and
NotI. When the botulinal C fragment is to be expressed using the
pPIC3K vector, the initiator methionine (ATG) is provided by the
desired Bot gene sequence and a Kozak consensus sequence is
engineered upstream of the ATG (e.g., ACCATGG).
[0898] The amplified restriction fragment containing the botulinal
C fragment gene is then cloned into the desired expression vector.
Recombinant clones are integrated into the Pichia pastoris genome
and recombinant protein expression is induced using methanol
following the manufacturer's instructions (Invitrogen Pichia
expression kit manual).
[0899] C. botulinum genes are A/T rich and contain multiple
sequences that are similar to yeast transcriptional termination
signals (e.g., TTTTTATA). If premature transcription termination is
observed when the botulinal C fragment genes are expressed in
yeast, the transcription termination signals present in the C
fragment genes can be removed by either site directed mutagenesis
(utilizing the pALTER system; Promega) or by construction of
synthetic genes utilizing overlapping synthetic primers.
[0900] The botulinal C fragment genes may be expressed in other
yeast cells using other commercially available vectors [e.g., using
the pYES2 vector (Invitrogen) and S. cerevisiae cells
(Invitrogen)].
[0901] b) Expression in Insect Cells
[0902] Botulinal C fragments derived from serotypes A, B, C, D, E,
F and G may be expressed in insect cells using a variety of
commercially available vectors. For example, the pBlueBac4 transfer
vector (invitrogen) may be employed for expression in Spodoptera
frugiperda (Sf9) insect cells (baculovirus expression system)
(equivalent baculovirus vectors and host cells are avaialble from
other vendors, e.g., Pharmingen, San Diego, Calif.). Botulinal C
fragments contained on NcoI/HindIII fragments contained within the
pHisBotA-G expression constructs (described in the preceding
examples) are cloned into the pBlueBac4 vector (digested with NcoI
and HindIII); the NcoI site present on the C fragment constructs
overlaps with the start codon of the fusion proteins. In the case
of botulinal C fragment clones that contain internal HindIII sites
(e.g., using the BotG sequences described in Ex. 49), the C
fragment gene is contained within a NcoI/XhoI fragment on the
pHisBot construct. This NcoI/XhoI fragment is excised from pHisBot
and inserted into pBlueBac4 digested with NcoI and SalI.
Recombinant baculoviruses are made and the desired recombinant C
fragment is expressed in Sf9 cells using the protocols provided by
the manufacturer (Invitrogen MaxBac manual). The resulting
constructs will express the pHisBot protein intracellularly
(including the N-terminal his-tag) under the control of the
polyhedrin promoter. For extracellular secretion of botulinal C
fragment proteins, the C fragment sequences from the pHisBot
constructs are cloned into the pMelBacB vector (Invitrogen) as
described above for the pBlueBac4 vector. When the pMelBacB vector
is employed, the his-tagged botulinal C fragment proteins are
secreted (utilizing a vector-encoded honeybee melittin secretion
signal) and contain a nine amino acid extension at the
N-terminus.
[0903] His-tagged botulinal C fragments expressed in yeast or
insect cells are purified using metal chelation columns as
described in the preceding examples.
[0904] From the above it is clear that the present invention
provides compositions and methods for the preparation of effective
multivalent vaccines against C. botulinum neurotoxin. It is also
contemplated that the recombinant botulinal proteins be used for
the production of antitoxins. All publications and patents
mentioned in the above specification are herein incorporated by
reference. Various modifications and variations of the described
method and system of the invention will be apparent to those
skilled in the art without departing from the scope and spirit of
the invention.
Sequence CWU 1
1
* * * * *