U.S. patent application number 10/181543 was filed with the patent office on 2003-11-13 for antisense modulation of glycogen synthase kinase 3 beta expression.
Invention is credited to Butler, Madeline M., McKay, Robert, Monia, Brett P., Wyatt, Jacqueline.
Application Number | 20030211608 10/181543 |
Document ID | / |
Family ID | 23945168 |
Filed Date | 2003-11-13 |
United States Patent
Application |
20030211608 |
Kind Code |
A1 |
Butler, Madeline M. ; et
al. |
November 13, 2003 |
Antisense modulation of glycogen synthase kinase 3 beta
expression
Abstract
Antisense compounds, compositions and methods are provided for
modulating the expression of glycogen synthase kinase 3 beta. The
compositions comprise antisense compounds, particularly antisense
oligonucleotides, targeted to nucleic acids encoding glycogen
synthase kinase 3 beta. Methods of using these compounds for
modulation of glycogen synthase kinase 3 beta expression and for
treatment of diseases associated with expression of glycogen
synthase kinase 3 beta are provided.
Inventors: |
Butler, Madeline M.; (Rancho
Santa Fe, CA) ; McKay, Robert; (San Diego, CA)
; Monia, Brett P.; (Encinitas, CA) ; Wyatt,
Jacqueline; (Encinitas, CA) |
Correspondence
Address: |
MARSHALL, GERSTEIN & BORUN
6300 SEARS TOWER
233 SOUTH WACKER DRIVE
CHICAGO
IL
60606-6357
US
|
Family ID: |
23945168 |
Appl. No.: |
10/181543 |
Filed: |
November 4, 2002 |
PCT Filed: |
January 12, 2001 |
PCT NO: |
PCT/US01/01085 |
Current U.S.
Class: |
435/375 ;
514/44A; 536/23.2 |
Current CPC
Class: |
A61P 25/28 20180101;
A61P 5/48 20180101; A61P 25/18 20180101; C12N 2310/315 20130101;
A61P 25/24 20180101; C12N 2310/3525 20130101; C12N 2310/346
20130101; C12N 15/1137 20130101; A61P 3/10 20180101; C12N 2310/321
20130101; A61P 43/00 20180101; C12N 2310/3341 20130101; C12N
2310/321 20130101; Y02P 20/582 20151101; C12N 2310/341 20130101;
A61P 25/00 20180101; A61K 38/00 20130101; C12Y 207/11026
20130101 |
Class at
Publication: |
435/375 ; 514/44;
536/23.2 |
International
Class: |
A61K 048/00; C07H
021/04; C12N 005/00 |
Claims
What is claimed is:
1. An antisense compound 8 to 30 nucleobases in length targeted to
a nucleic acid molecule encoding glycogen synthase kinase 3 beta,
wherein said antisense compound specifically hybridizes with and
inhibits the expression of glycogen synthase kinase 3 beta.
2. The antisense compound of claim 1 which is an antisense
oligonucleotide.
3. The antisense compound of claim 2 wherein the antisense
oligonucleotide has a sequence comprising SEQ ID NO: 11, 12, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 58, 60, 61, 62, 63, 65, 66, 67, 68, 69,
70, 71, 72, 74, 75, 76, 78, 79, 80, 81, 82, 83, 84 or 85.
4. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
5. The antisense compound of claim 4 wherein the modified
internucleoside linkage is a phosphorothioate linkage.
6. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
7. The antisense compound of claim 6 wherein the modified sugar
moiety is a 2'-O-methoxyethyl sugar moiety.
8. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
9. The antisense compound of claim 8 wherein the modified
nucleobase is a 5-methylcytosine.
10. The antisense compound of claim 2 wherein the antisense
oligonucleotide is a chimeric oligonucleotide.
11. A composition comprising the antisense compound of claim 1 and
a pharmaceutically acceptable carrier or diluent.
12. The composition of claim 11 further comprising a colloidal
dispersion system.
13. The composition of claim 11 wherein the antisense compound is
an antisense oligonucleotide.
14. A method of inhibiting the expression of glycogen synthase
kinase 3 beta in cells or tissues comprising contacting said cells
or tissues with the antisense compound of claim 1 so that
expression of glycogen synthase kinase 3 beta is inhibited.
15. A method of treating a human having a disease or condition
associated with glycogen synthase kinase 3 beta comprising
administering to said animal a therapeutically or prophylactically
effective amount of the antisense compound of claim 1 so that
expression of glycogen synthase kinase 3 beta is inhibited.
16. The method of claim 15 wherein the disease or condition is an
insulin regulation disorder.
17. The method of claim 16 wherein the insulin regulation disorder
is diabetes.
18. The method of claim 15 wherein the disease or condition is a
neurological disorder.
19. The method of claim 18 wherein the neurological disorder is
Alzheimer's disease.
20. The method of claim 15 wherein the neurological disorder is
bipolar illness.
Description
FIELD OF THE INVENTION
[0001] The present invention provides compositions and methods for
modulating the expression of glycogen synthase kinase 3 beta. In
particular, this invention relates to antisense compounds,
particularly oligonucleotides, specifically hybridizable with
nucleic acids encoding glycogen synthase kinase 3 beta. Such
oligonucleotides have been shown to modulate the expression of
glycogen synthase kinase 3 beta.
BACKGROUND OF THE INVENTION
[0002] One of the principal mechanisms by which cellular regulation
is effected is through the transduction of extracellular signals
across the membrane that in turn modulate biochemical pathways
within the cell. Protein phosphorylation, orchestrated by enzymes
known as kinases, represents one course by which intracellular
signals are propagated from molecule to molecule resulting in a
cellular response These signal transduction cascades are highly
regulated and often overlapping as evidenced by the existence of
many protein kinases as well as phosphatases, which remove
phosphate moieties. It is currently believed that a number of
disease states and/or disorders are a result of either aberrant
activation or functional mutations in the molecular components of
kinase cascades. Consequently, considerable attention has been
devoted to the characterization of kinases, especially those
involved in energy metabolism. One such kinase is glycogen synthase
kinase 3.
[0003] Two different mammalian isoforms of glycogen synthase kinase
3 have been identified and each is encoded by a separate gene (Shaw
et al., Genome, 1998, 41, 720-727; Woodgett, Embo J., 1990, 9,
2431-2438). These isoforms, designated alpha and beta are expressed
in different cell types and in different proportions. In some
cells, the expression of these isoforms is under developmental
control.
[0004] Glycogen synthase kinase 3 beta (also known as tau protein
kinase I and GSK3B) is a serine/threonine protein kinase first
described as a factor involved in glycogen synthesis. In this
pathway, glycogen synthase kinase 3 phosphorylates select residues
of glycogen synthase, the rate-limiting enzyme of glycogen
deposition, thereby inactivating the enzyme. Therefore, glycogen
synthase kinase 3 plays a predominant role in glycogen metabolism
and has consequently been investigated as a potential therapeutic
target in disease conditions such as diabetes and insulin
regulation disorders (Cross et al., FEBS Lett., 1997, 406, 211-215;
Eldar-Finkelman et al., Proc. Natl. Acad. Sci. U.S.A., 1996, 93,
10228-10233; Eldar-Finkelman and Krebs, Proc. Natl. Acad. Sci.
U.S.A., 1997, 94, 9660-9664; Eldar-Finkelman et al., Diabetes,
1999, 48, 1662-1666). Upstream, glycogen synthase kinase 3 beta is
regulated by protein kinase C (Goode et al., J. Biol. Chem., 1992,
267, 16878-16882).
[0005] It has been demonstrated that glycogen synthase kinase 3
beta is identical to a previously identified protein known as tau
protein kinase-I, which phosphorylates tau, a protein component of
paired helical filaments (PHF) found in Alzheimer's brains
(Ishiguro et al., FEBS Lett., 1993, 325, 167-172; Lovestone et
al.,Neuroscience, 1996, 73, 1145-1157; Yamaguchi et al., Acta.
Neuropathol. (Berl), 1996, 92, 232-241). The accumulation of these
filaments is implicated in the pathological change in brain tissue
(Ishiguro et al., FEBS Lett., 1993, 325, 167-172). Glycogen
synthase kinase 3 beta is enriched in brain and due to its ability
to phosphorylate the tau protein, has been suggested to play a
critical role in the development of Alzheimer's disease (Pei et
al., J. Neuropathol. Exp. Neurol., 1997, 56, 70-78). Increased
synthesis of the enzyme has been shown to increase the cellular
maturation of another protein related to Alzheimer's disease, APP
(Aplin et al., Neuroreport., 1997, 8, 639-643). It is the aberrant
processing of APP that leads to deposition of a beta amyloid in
neuritic plaques.
[0006] Currently, there are no known therapeutic agents which
effectively inhibit the synthesis of glycogen synthase kinase 3
beta and to date, investigative strategies aimed at modulating
glycogen synthase kinase 3 beta function have involved the use of
antibodies, antisense technology and chemical inhibitors. A method
for treating a biological condition mediated by glycogen synthase
kinase 3 (GSK3) activity, said method comprising administering an
effective amount of a pharmaceutical composition comprising a
selective GSK3 inhibitor is disclosed in U.S. Pat. No. 6,057,117.
The selective GSK3 inhibitors generally disclosed include peptides,
peptoids, small organic molecules, and polynucleotides. Disclosed
in U.S. Pat. No. 5,837,853 are antisense oligonucleotides targeting
the nucleotides which encode the first six amino acids of human
glycogen synthase kinase beta intended for use in the treatment of
Alzheimer's disease and the prevention of neuronal cell death
(Takashima et al., 1998). Disclosed in the PCT publication WO
97/41854 are methods to identify inhibitors of glycogen synthase
kinase 3 and the use of these inhibitors for the treatment of
bipolar disorders, mania, Alzheimer's disease, diabetes and
leukopenia (Klein and Melton, 1997). Other inhibitory compounds are
disclosed in WO 99/21859. These heterocyclic compounds are intended
for the treatment of a disease mediated by a protein kinase, one of
which is glycogen synthase kinase 3 (Cheung et al., 1999). Two
other compounds, lithium and valproate, both used in the treatment
of bipolar disorders, have been shown to inhibit glycogen synthase
kinase 3 beta activity (Chen et al., J. Neurochem., 1999, 72,
1327-1330; Hong et al., J. Biol. Chem., 1997, 272,
25326-25332).
[0007] There remains, however, a long felt need for additional
agents capable of effectively inhibiting glycogen synthase kinase 3
beta function. The pharmacological modulation of glycogen synthase
kinase 3 beta activity or expression may therefore be an
appropriate point of therapeutic intervention in pathological
conditions.
[0008] Antisense technology is emerging as an effective means for
reducing the expression of specific gene products and may therefore
prove to be uniquely useful in a number of therapeutic, diagnostic,
and research applications for the modulation of glycogen synthase
kinase 3 beta expression.
[0009] The present invention provides compositions and methods for
modulating glycogen synthase kinase 3 beta expression.
SUMMARY OF THE INVENTION
[0010] The present invention is directed to antisense compounds,
particularly oligonucleotides, which are targeted to a nucleic acid
encoding glycogen synthase kinase 3 beta, and which modulate the
expression of glycogen synthase kinase 3 beta. Pharmaceutical and
other compositions comprising the antisense compounds of the
invention are also provided. Further provided are methods of
modulating the expression of glycogen synthase kinase 3 beta in
cells or tissues comprising contacting said cells or tissues with
one or more of the antisense compounds or compositions of the
invention. Further provided are methods of treating an animal,
particularly a human, suspected of having or being prone to a
disease or condition associated with expression of glycogen
synthase kinase 3 beta by administering a therapeutically or
prophylactically effective amount of one or more of the antisense
compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0011] The present invention employs oligomeric antisense
compounds, particularly oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding glycogen synthase
kinase 3 beta, ultimately modulating the amount of glycogen
synthase kinase 3 beta produced. This is accomplished by providing
antisense compounds which specifically hybridize with one or more
nucleic acids encoding glycogen synthase kinase 3 beta. As used
herein, the terms "target nucleic acid" and "nucleic acid encoding
glycogen synthase kinase 3 beta" encompass DNA encoding glycogen
synthase kinase 3 beta, RNA (including pre-mRNA and mRNA)
transcribed from such DNA, and also cDNA derived from such RNA. The
specific hybridization of an oligomeric compound with its target
nucleic acid interferes with the normal function of the nucleic
acid. This modulation of function of a target nucleic acid by
compounds which specifically hybridize to it is generally referred
to as "antisense". The functions of DNA to be interfered with
include replication and transcription. The functions of RNA to be
interfered with include all vital functions such as, for example,
translocation of the RNA to the site of protein translation,
translation of protein from the RNA, splicing of the RNA to yield
one or more mRNA species, and catalytic activity which may be
engaged in or facilitated by the RNA. The overall effect of such
interference with target nucleic acid function is modulation of the
expression of glycogen synthase kinase 3 beta. In the context of
the present invention, "modulation" means either an increase
(stimulation) or a decrease (inhibition) in the expression of a
gene. In the context of the present invention, inhibition is the
preferred form of modulation of gene expression and mRNA is a
preferred target.
[0012] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
In the present invention, the target is a nucleic acid molecule
encoding glycogen synthase kinase 3 beta. The targeting process
also includes determination of a site or sites within this gene for
the antisense interaction to occur such that the desired effect,
e.g., detection or modulation of expression of the protein, will
result. Within the context of the present invention, a preferred
intragenic site is the region encompassing the translation
initiation or termination codon of the open reading frame (ORF) of
the gene. Since, as is known in the art, the translation initiation
codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in
the corresponding DNA molecule), the translation initiation codon
is also referred to as the "AUG codon," the "start codon" or the
"AUG start codon". A minority of genes have a translation
initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG,
and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
Thus, the terms "translation initiation codon" and "start codon"
can encompass many codon sequences, even though the initiator amino
acid in each instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
glycogen synthase kinase 3 beta, regardless of the sequence(s) of
such codons.
[0013] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0014] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0015] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0016] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0017] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed.
[0018] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0019] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotides have been safely and effectively
administered to humans and numerous clinical trials are presently
underway. It is thus established that oligonucleotides can be
useful therapeutic modalities that can be configured to be useful
in treatment regimes for treatment of cells, tissues and animals,
especially humans. In the context of this invention, the term
"oligonucleotide" refers to an oligomer or polymer of ribonucleic
acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This
term includes oligonucleotides composed of naturally-occurring
nucleobases, sugars and covalent internucleoside (backbone)
linkages as well as oligonucleotides having non-naturally-occurring
portions which function similarly. Such modified or substituted
oligonucleotides are often preferred over native forms because of
desirable properties such as, for example, enhanced cellular
uptake, enhanced affinity for nucleic acid target and increased
stability in the presence of nucleases.
[0020] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 30 nucleobases (i.e. from about 8 to about 30
linked nucleosides). Particularly preferred antisense compounds are
antisense oligonucleotides, even more preferably those comprising
from about 12 to about 25 nucleobases. As is known in the art, a
nucleoside is a base-sugar combination. The base portion of the
nucleoside is normally a heterocyclic base. The two most common
classes of such heterocyclic bases are the purines and the
pyrimidines. Nucleotides are nucleosides that further include a
phosphate group covalently linked to the sugar portion of the
nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to either the 2', 3' or 5'
hydroxyl moiety of the sugar. In forming oligonucleotides, the
phosphate groups covalently link adjacent nucleosides to one
another to form a linear polymeric compound. In turn the respective
ends of this linear polymeric structure can be further joined to
form a circular structure, however, open linear structures are
generally preferred. Within the oligonucleotide structure, the
phosphate groups are commonly referred to as forming the
internucleoside backbone of the oligonucleotide. The normal linkage
or backbone of RNA and DNA is a 3' to 5' phosphodiester
linkage.
[0021] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0022] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotri-esters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thiono-alkylphosphonates, thionoalkylphosphotriesters, and
borano-phosphates having normal 3'-5' linkages, 2'-5' linked
analogs of these, and those having inverted polarity wherein the
adjacent pairs of nucleoside units are linked 31-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are
also included.
[0023] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos.: 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, certain
of which are commonly owned with this application, and each of
which is herein incorporated by reference.
[0024] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
O, S and CH.sub.2 component parts.
[0025] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, certain of which are commonly owned with this
application, and each of which is herein incorporated by
reference.
[0026] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. : 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0027] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0028] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(
CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about
10. Other preferred oligonucleotides comprise one of the following
at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted
lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH,
SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylamino-ethoxyethoxy (also known in the art as
2'-O-dimethylamino-ethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0029] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos.: 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and
5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0030] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and
cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further
nucleobases include those disclosed in U.S. Pat. No. 3,687,808,
those disclosed in The Concise Encyclopedia Of Polymer Science And
Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley &
Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613, and those disclosed by
Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993.
Certain of these nucleobases are particularly useful for increasing
the binding affinity of the oligomeric compounds of the invention.
These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and O-6 substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and
Lebleu, B., eds., Antisense Research and Applications, CRC Press,
Boca Raton, 1993, pp. 276-278) and are presently preferred base
substitutions, even more particularly when combined with
2'-0-methoxyethyl sugar modifications.
[0031] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.:
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, certain
of which are commonly owned with the instant application, and each
of which is herein incorporated by reference, and United States
Pat. No. 5,750,692, which is commonly owned with the instant
application and also herein incorporated by reference.
[0032] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. Such
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937.
[0033] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos.: 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0034] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Cleavage of the RNA target can be routinely detected
by gel electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0035] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos.: 5,013,830; 5,149,797;
5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350;
5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which
are commonly owned with the instant application, and each of which
is herein incorporated by reference in its entirety.
[0036] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0037] The antisense compounds of the invention are synthesized in
vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules. The compounds of the invention
may also be admixed, encapsulated, conjugated or otherwise
associated with other molecules, molecule structures or mixtures of
compounds, as for example, liposomes, receptor targeted molecules,
oral, rectal, topical or other formulations, for assisting in
uptake, distribution and/or absorption. Representative United
States patents that teach the preparation of such uptake,
distribution and/or absorption assisting formulations include, but
are not limited to, U.S. Pat. Nos.: 5,108,921; 5,354,844;
5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020;
5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804;
5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978;
5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152;
5,556,948; 5,580,575; and 5,595,756, each of which is herein
incorporated by reference.
[0038] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
invention, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0039] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention are prepared as SATE [(S-acetyl-2-thioethyl)phosphate]
derivatives according to the methods disclosed in WO 93/24510 to
Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 to Imbach
et al.
[0040] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0041] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety of
inorganic and organic acids, such as, for example, with inorganic
acids, such as for example hydrochloric acid, hydrobromic acid,
sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfoic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0042] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0043] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. For therapeutics, an animal, preferably a human,
suspected of having a disease or disorder which can be treated by
modulating the expression of glycogen synthase kinase 3 beta is
treated by administering antisense compounds in accordance with
this invention. The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of an
antisense compound to a suitable pharmaceutically acceptable
diluent or carrier. Use of the antisense compounds and methods of
the invention may also be useful prophylactically, e.g., to prevent
or delay infection, inflammation or tumor formation, for
example.
[0044] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding glycogen synthase kinase 3 beta, enabling
sandwich and other assays to easily be constructed to exploit this
fact. Hybridization of the antisense oligonucleotides of the
invention with a nucleic acid encoding glycogen synthase kinase 3
beta can be detected by means known in the art. Such means may
include conjugation of an enzyme to the oligonucleotide,
radiolabelling of the oligonucleotide or any other suitable
detection means. Kits using such detection means for detecting the
level of glycogen synthase kinase 3 beta in a sample may also be
prepared.
[0045] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0046] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful.
[0047] Compositions and formulations for oral administration
include powders or granules, suspensions or solutions in water or
non-aqueous media, capsules, sachets or tablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable.
[0048] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to; penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0049] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0050] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0051] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, liquid syrups, soft gels, suppositories, and
enemas. The compositions of the present invention may also be
formulated as suspensions in aqueous, non-aqueous or mixed media.
Aqueous suspensions may further contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0052] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
[0053] Emulsions
[0054] The compositions of the present invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising of two immiscible liquid phases
intimately mixed and dispersed with each other. In general,
emulsions may be either water-in-oil (w/o) or of the oil-in-water
(o/w) variety. When an aqueous phase is finely divided into and
dispersed as minute droplets into a bulk oily phase the resulting
composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily phase is finely divided into and dispersed as minute
droplets into a bulk aqueous phase the resulting composition is
called an oil-in-water (o/w) emulsion. Emulsions may contain
additional components in addition to the dispersed phases and the
active drug which may be present as a solution in either the
aqueous phase, oily phase or itself as a separate phase.
Pharmaceutical excipients such as emulsifiers, stabilizers, dyes,
and anti-oxidants may also be present in emulsions as needed.
Pharmaceutical emulsions may also be multiple emulsions that are
comprised of more than two phases such as, for example, in the case
of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w)
emulsions. Such complex formulations often provide certain
advantages that simple binary emulsions do not. Multiple emulsions
in which individual oil droplets of an o/w emulsion enclose small
water droplets constitute a w/o/w emulsion. Likewise a system of
oil droplets enclosed in globules of water stabilized in an oily
continuous provides an o/w/o emulsion.
[0055] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0056] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0057] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0058] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0059] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0060] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0061] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of reasons of ease
of formulation, efficacy from an absorption and bioavailability
standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 199). Mineral-oil base laxatives,
oil-soluble vitamins and high fat nutritive preparations are among
the materials that have commonly been administered orally as o/w
emulsions.
[0062] In one embodiment of the present invention, the compositions
of oligonucleotides and nucleic acids are formulated as
microemulsions. A microemulsion may be defined as a system of
water, oil and amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically
microemulsions are systems that are prepared by first dispersing an
oil in an aqueous surfactant solution and then adding a sufficient
amount of a fourth component, generally an intermediate
chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically
stable, isotropically clear dispersions of two immiscible liquids
that are stabilized by interfacial films of surface-active
molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o)or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0063] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0064] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0065] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of oligonucleotides and nucleic acids from the
gastrointestinal tract, as well as improve the local cellular
uptake of oligonucleotides and nucleic acids within the
gastrointestinal tract, vagina, buccal cavity and other areas of
administration.
[0066] Microemulsions of the present invention may also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
oligonucleotides and nucleic acids of the present invention.
Penetration enhancers used in the microemulsions of the present
invention may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0067] Liposomes
[0068] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0069] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0070] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0071] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0072] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where the active agent
may act.
[0073] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0074] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0075] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0076] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0077] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0078] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0079] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/po- lyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466).
[0080] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0081] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphat- idylcholine are disclosed in WO
97/13499 (Lim et al.).
[0082] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett.,
1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. Nos.
5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe
PEG-containing liposomes that can be further derivatized with
functional moieties on their surfaces.
[0083] A limited number of liposomes comprising nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0084] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0085] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0086] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0087] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0088] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0089] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0090] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0091] Penetration Enhancers
[0092] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides, to the skin of animals. Most
drugs are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0093] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
p.92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0094] Surfactants: In connection with the present invention,
surfactants (or "surface-active agents") are chemical entities
which, when dissolved in an aqueous solution, reduce the surface
tension of the solution or the interfacial tension between the
aqueous solution and another liquid, with the result that
absorption of oligonucleotides through the mucosa is enhanced. In
addition to bile salts and fatty acids, these penetration enhancers
include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p.92); and perfluorochemical emulsions, such as FC-43.
Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0095] Fatty acids: Various fatty acids and their derivatives which
act as penetration enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol.,
1992, 44, 651-654).
[0096] Bile salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts of the invention include, for example,
cholic acid (or its pharmaceutically acceptable sodium salt, sodium
cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic
acid (sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0097] Chelating Agents: Chelating agents, as used in connection
with the present invention, can be defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of oligonucleotides through the mucosa
is enhanced. With regards to their use as penetration enhancers in
the present invention, chelating agents have the added advantage of
also serving as DNase inhibitors, as most characterized DNA
nucleases require a divalent metal ion for catalysis and are thus
inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618,
315-339). Chelating agents of the invention include but are not
limited to disodium ethylenediaminetetraacetate (EDTA), citric
acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and
homovanilate), N-acyl derivatives of collagen, laureth-9 and
N-amino acyl derivatives of beta-diketones (enamines) (Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page
92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,
43-51).
[0098] Non-chelating non-surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
oligonucleotides through the alimentary mucosa (Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This
class of penetration enhancers include, for example, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0099] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical and other
compositions of the present invention. For example, cationic
lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT Application WO
97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
[0100] Other agents may be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
[0101] Carriers
[0102] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is coadministered with polyinosinic acid, dextran
sulfate, polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al.,
Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
[0103] Excipients
[0104] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc.).
[0105] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0106] Formulations for topical administration of nucleic acids may
include sterile and-non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0107] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0108] Other Components
[0109] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0110] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0111] Certain embodiments of the invention provide pharmaceutical
compositions containing (a) one or more antisense compounds and (b)
one or more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include, but are not limited to, anticancer drugs such as
daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin,
nitrogen mustard, chlorambucil, melphalan, cyclophosphamide,
6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil
(5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine,
vincristine, vinblastine, etoposide, teniposide, cisplatin and
diethylstilbestrol (DES). See, generally, The Merck Manual of
Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway,
N.J., pages 1206-1228). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively).
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0112] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Numerous examples of antisense compounds are known in the
art. Two or more combined compounds may be used together or
sequentially.
[0113] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 ug to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 ug to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0114] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same.
EXAMPLES
Example 1
[0115] Nucleoside Phosphoramidites for oligonucleotide Synthesis
Deoxy and 2'-alkoxy amidites
[0116] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial sources (e.g.
Chemgenes, Needham Mass. or Glen Research, Inc. Sterling Va.).
Other 2'-O-alkoxy substituted nucleoside amidites are prepared as
described in U.S. Pat. No. 5,506,351, herein incorporated by
reference. For oligonucleotides synthesized using 2'-alkoxy
amidites, the standard cycle for unmodified oligonucleotides was
utilized, except the wait step after pulse delivery of tetrazole
and base was increased to 360 seconds.
[0117] Oligonucleotides containing 5-methyl-2'-deoxycytidine
(5-Me-C) nucleotides were synthesized according to published
methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21,
3197-3203] using commercially available phosphoramidites (Glen
Research, Sterling Va. or ChemGenes, Needham Mass.).
[0118] 2'-Fluoro amidites
[0119] 2'-Fluorodeoxyadenosine amidites
[0120] 2'-fluoro oligonucleotides were synthesized as described
previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841]
and U.S. Pat. No. 5,670,633, herein incorporated by reference.
Briefly, the protected nucleoside
N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing
commercially available 9-beta-D-arabinofuranosyladenine as starting
material and by modifying literature procedures whereby the
2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a
2'-beta-trityl group. Thus
N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
[0121] 2'-Fluorodeoxyguanosine
[0122] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-beta-D-arabinofuranosylguani- ne as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidi- tes.
[0123] 2'-Fluorouridine
[0124] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-1-beta-D-ara- binofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0125] 2'-Fluorodeoxycytidine
[0126] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0127] 2'-O-(2-Methoxyethyl) Modified amidites
[0128] 2'-O-Methoxyethyl-substituted nucleoside amidites are
prepared as follows, or alternatively, as per the methods of
Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
[0129] 2,2'
-Anhydro[31-(beta-D-arabinofuranosyl)-5-methyluridine]
[0130] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M),
diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g,
0.024 M) were added to DMF (300 mL). The mixture was heated to
reflux, with stirring, allowing the evolved carbon dioxide gas to
be released in a controlled manner. After 1 hour, the slightly
darkened solution was concentrated under reduced pressure. The
resulting syrup was poured into diethylether (2.5 L), with
stirring. The product formed a gum. The ether was decanted and the
residue was dissolved in a minimum amount of methanol (ca. 400 ml).
The solution was poured into fresh ether (2.5 L) to yield a stiff
gum. The ether was decanted and the gum was dried in a vacuum oven
(60.degree. C. at 1 mm Hg for 24 h) to give a solid that was
crushed to a light tan powder (57 g, 85% crude yield). The NMR
spectrum was consistent with the structure, contaminated with
phenol as its sodium salt (ca. 5%). The material was used as is for
further reactions (or it can be purified further by column
chromatography using a gradient of methanol in ethyl acetate
(10-25%) to give a white solid, mp 222-4.degree. C.).
[0131] 2'-O-Methoxyethyl-5-methyluridine
[0132] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of product.
Additional material was obtained by reworking impure fractions.
[0133] 2'-O-Methoxyethyl-5'-0-dimethoxytrityl-5-methyluridine
[0134] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4; filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
[0135]
3,-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0136] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by TLC by first quenching the TLC
sample with the addition of MeOH. Upon completion of the reaction,
as judged by TLC, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%). An additional 1.5 g
was recovered from later fractions.
[0137]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triaz-
oleuridine
[0138] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-51-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2 hours. The first
solution was added dropwise, over a 45 minute period, to the latter
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
[0139] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0140] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (TLC showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
[0141]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0142] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
A, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, TLC showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
[0143]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine--
3'-amidite
[0144]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
(74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L). Tetrazole
diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (TLC showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
[0145] 2'-O-(Aminooxyethyl) nucleoside amidites and
2'-O-(dimethylaminooxyethyl) nucleoside amidites
[0146] 2'-(Dimethylaminooxyethoxy) nucleoside amidites
[0147] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known
in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
[0148] 5
'-0-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0149] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013
eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient
temperature under an argon atmosphere and with mechanical stirring.
tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458
mmol) was added in one portion. The reaction was stirred for 16 h
at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a
complete reaction. The solution was concentrated under reduced
pressure to a thick oil. This was partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer was dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil was
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution was cooled to
[0150] -10.degree. C. The resulting crystalline product was
collected by filtration, washed with ethyl ether (3.times.200 mL)
and dried (40.degree. C., 1 mm Hg, 24 h) to 149 g (74.8%) of white
solid. TLC and NMR were consistent with pure product.
[0151]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0152] In a 2 L stainless steel, unstirred pressure reactor was
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) was added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were
added with manual stirring. The reactor was sealed and heated in an
oil bath until an internal temperature of 160.degree. C. was
reached and then maintained for 16 h (pressure<100 psig). The
reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for
desired product and Rf 0.82 for ara-T side product, ethyl acetate)
indicated about 70% conversion to the product. In order to avoid
additional side product formation, the reaction was stopped,
concentrated under reduced pressure (10 to 1 mm Hg) in a warm water
bath (40-100.degree. C.) with the more extreme conditions used to
remove the ethylene glycol. [Alternatively, once the low boiling
solvent is gone, the remaining solution can be partitioned between
ethyl acetate and water. The product will be in the organic phase.]
The residue was purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions were combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. The yield based on starting
material less pure recovered starting material was 58%. TLC and NMR
were consistent with 99% pure product.
[0153]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne
[0154]
5'-O-tert-Butyldiphenylsilyl-2'-0-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819 g, 86%).
[0155]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine
[0156]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL, 4.64 mmol) was added dropwise at
-10.degree. C. to 0.degree. C. After 1 h the mixture was filtered,
the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase was washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get
2'-O-(aminooxyethyl)thymidine, which was then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1
eq.) was added and the resulting mixture was strirred for 1 h.
Solvent was removed under vacuum; residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri-
dine as white foam (1.95 g, 78%).
[0157]
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-met-
hyluridine
[0158]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture was
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel was removed from the ice bath and stirred at room
temperature for 2 h, the reaction monitored by TLC (5% MeOH in
CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue was dissolved in a solution of 1M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and
the reaction mixture was stirred at room temperature for 10
minutes. Reaction mixture cooled to 10.degree. C. in an ice bath,
sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction
mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes,
the reaction mixture was removed from the ice bath and stirred at
room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3
(25 mL) solution was added and extracted with ethyl acetate
(2.times.25 mL). Ethyl acetate layer was dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to dryness . The residue obtained
was purified by flash column chromatography and eluted with 5% MeOH
in CH.sub.2Cl.sub.2 to get
5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluri-
dine as a white foam (14.6 g, 80%).
[0159] 2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0160] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2HF was then added to
5'-O-tert-butyldiphenylsil-
yl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4
mmol) and stirred at room temperature for 24 hrs. Reaction was
monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent was removed
under vacuum and the residue placed on a flash column and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766mg, 92.55%).
[0161] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0162] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) was dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It was then co-evaporated with anhydrous pyridine (20
mL). The residue obtained was dissolved in pyridine (11 ml) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the
mixture and the reaction mixture was stirred at room temperature
until all of the starting material disappeared. Pyridine was
removed under vacuum and the residue chromatographed and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of
pyridine) to get 5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5--
methyluridine (1.13g, 80%).
[0163]
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2--
cyanoethyl)-N,N-diisopropylphosphoramidite]
[0164] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the
residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was
added and dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. Then the reaction mixture was dissolved in anhydrous
acetonitrile (8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent was evaporated, then the residue was dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL) .
Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained was chromatographed (ethyl acetate
as eluent) to get
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-31-[(2-cyanoe-
thyl)-N,N-diisopropylphosphoramidite] as a foam (1.04 g,
74.9%).
[0165] 2'-(Aminooxyethoxy) nucleoside amidites
[0166] 2'-(Aminooxyethoxy) nucleoside amidites [also known in the
art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as
described in the following paragraphs. Adenosine, cytidine and
thymidine nucleoside amidites are prepared similarly.
[0167]
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-
-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidi-
te]
[0168] The 2'-O-aminooxyethyl guanosine analog may be obtained by
selective 2'-O-alkylation of diaminopurine riboside. Multigram
quantities of diaminopurine riboside may be purchased from Schering
AG (Berlin) to provide 2'-O-(2-ethylacetyl)diaminopurine riboside
along with a minor amount of the 3'-O-isomer.
2'-O-(2-ethylacetyl)diaminopurine riboside may be resolved and
converted to 2'-O-(2-ethylacetyl)guanosine by treatment with
adenosine deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C.
J., WO 94/02501 Al 940203.) Standard protection procedures should
afford 2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine
and
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime-
thoxytrityl)guanosine which may be reduced to provide
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime-
thoxytrityl)guanosine. As before the hydroxyl group may be
displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the
protected nucleoside may phosphitylated as usual to yield
2-N-isobutyryl-6-O-diphen-
ylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine-3'-[-
(2-cyanoethyl)-N,N-diisopropylphosphoramidite].
[0169] 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites
2'-dimethylaminoethoxyethoxy nucleoside amidites (also known in the
art as 2'-O-dimethylaminoethoxyethyl, i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH- .sub.2).sub.2, or 2'-DMAEOE
nucleoside amidites) are prepared as follows. Other nucleoside
amidites are prepared similarly.
[0170] 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl
uridine
[0171] 2[2-(Dimethylamino)ethoxy]ethanol (Aldrich, 6.66 g, 50 mmol)
is slowly added to a solution of borane in tetra-hydrofuran (1 M,
10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas
evolves as the solid dissolves. O.sup.2-,
2'-anhydro-5-methyluridine (1.2 g, 5 mmol), and sodium bicarbonate
(2.5 mg) are added and the bomb is sealed, placed in an oil bath
and heated to 155.degree. C. for 26 hours. The bomb is cooled to
room temperature and opened. The crude solution is concentrated and
the residue partitioned between water (200 mL) and hexanes (200
mL). The excess phenol is extracted into the hexane layer. The
aqueous layer is extracted with ethyl acetate (3.times.200 mL) and
the combined organic layers are washed once with water, dried over
anhydrous sodium sulfate and concentrated. The residue is columned
on silica gel using methanol/methylene chloride 1:20 (which has 2%
triethylamine) as the eluent. As the column fractions are
concentrated a colorless solid forms which is collected to give the
title compound as a white solid.
[0172] 5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)
ethyl)]-5-methyl uridine
[0173] To 0.5 g (1.3 mmol) of
2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5- -methyl uridine in
anhydrous pyridine (8 mL), triethylamine (0.36 mL) and
dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) are added and
stirred for 1 hour. The reaction mixture is poured into water (200
mL) and extracted with CH.sub.2Cl.sub.2 (2.times.200 mL). The
combined CH.sub.2Cl.sub.2 layers are washed with saturated
NaHCO.sub.3 solution, followed by saturated NaCl solution and dried
over anhydrous sodium sulfate. Evaporation of the solvent followed
by silica gel chromatography using MeOH:CH.sub.2Cl.sub.2:Et.sub.3N
(20:1, v/v, with 1% triethylamine) gives the title compound.
[0174]
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-m-
ethyl uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite
[0175] Diisopropylaminotetrazolide (0.6 g) and
2-cyanoethoxy-N,N-diisoprop- yl phosphoramidite (1.1 mL, 2 eq.) are
added to a solution of
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methylur-
idine (2.17 g, 3 mmol) dissolved in CH.sub.2Cl.sub.2 (20 mL) under
an atmosphere of argon. The reaction mixture is stirred overnight
and the solvent evaporated. The resulting residue is purified by
silica gel flash column chromatography with ethyl acetate as the
eluent to give the title compound.
Example 2
[0176] Oligonucleotide Synthesis
[0177] Unsubstituted and substituted phosphodiester (P.dbd.O)
oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine.
[0178] Phosphorothioates (P.dbd.S) are synthesized as for the
phosphodiester oligonucleotides except the standard oxidation
bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the
phosphite linkages. The thiation wait step was increased to 68 sec
and was followed by the capping step. After cleavage from the CPG
column and deblocking in concentrated ammonium hydroxide at
55.degree. C. (18 h), the oligonucleotides were purified by
precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl
solution. Phosphinate oligonucleotides are prepared as described in
U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0179] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0180] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0181] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0182] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0183] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0184] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0185] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
Example 3
[0186] Oligonucleoside Synthesis
[0187] Methylenemethylimino linked oligonucleosides, also
identified as MMI linked oligonucleosides,
methylenedimethyl-hydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0188] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0189] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 4
[0190] PNA Synthesis
[0191] Peptide nucleic acids (PNAs) are prepared in accordance with
any of the various procedures referred to in Peptide Nucleic Acids
(PNA): Synthesis, Properties and Potential Applications, Bioorganic
& Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared
in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and
5,719,262, herein incorporated by reference.
Example 5
[0192] Synthesis of Chimeric Oligonucleotides
[0193] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[0194] [2'-O-Me]-[2'-deoxy]-[2'-O-Mel Chimeric Phosphorothioate
Oligonucleotides
[0195] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 380B, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphor-amidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
increasing the wait step after the delivery of tetrazole and base
to 600 s repeated four times for RNA and twice for 2'-O-methyl. The
fully protected oligonucleotide is cleaved from the support and the
phosphate group is deprotected in 3:1 ammonia/ethanol at room
temperature overnight then lyophilized to dryness. Treatment in
methanolic ammonia for 24 hrs at room temperature is then done to
deprotect all bases and sample was again lyophilized to dryness.
The pellet is resuspended in 1M TBAF in THF for 24 hrs at room
temperature to deprotect the 2' positions. The reaction is then
quenched with 1M TEAA and the sample is then reduced to 1/2 volume
by rotovac before being desalted on a G25 size exclusion column.
The oligo recovered is then analyzed spectrophotometrically for
yield and for purity by capillary electrophoresis and by mass
spectrometry.
[0196] [2'-O-(2-Methoxyethyl)]-[21-deoxy]-[2'-O-(Methoxyethyl)]
Chimeric Phosphorothioate Oligonucleotides
[0197] [2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxy-ethyl)]
chimeric phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl)amidites for the 2'-O-methyl
amidites.
[0198] [2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy
Phosphorothioate]-[2'-O-(2-Methoxyethyl)Phosphodiester] Chimeric
Oligonucleotides
[0199] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy
phos-phorothioate]-[2'-O-(methoxyethyl)phosphodiester] chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidization with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0200] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 6
[0201] Oligonucleotide Isolation
[0202] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or
oligonucleosides are purified by precipitation twice out of 0.5 M
NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were
analyzed by polyacrylamide gel electrophoresis on denaturing gels
and judged to be at least 85% full length material. The relative
amounts of phosphorothioate and phosphodiester linkages obtained in
synthesis were periodically checked by .sup.31P nuclear magnetic
resonance spectroscopy, and for some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
[0203] Oligonucleotide Synthesis--96 Well Plate Format
[0204] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a standard 96 well
format. Phosphodiester internucleotide linkages were afforded by
oxidation with aqueous iodine. Phosphorothioate internucleotide
linkages were generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial vendors (e.g.
PE-Applied Biosystems, Foster City, Calif., or Pharmacia,
Piscataway, N.J.). Non-standard nucleosides are synthesized as per
known literature or patented methods. They are utilized as base
protected beta-cyanoethyldiisopropyl phosphoramidites.
[0205] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
[0206] Oligonucleotide Analysis--96 Well Plate Format
[0207] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UW absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96 well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and
multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the compounds on the plate were at
least 85% full length.
Example 9
[0208] Cell Culture and Oligonucleotide Treatment
[0209] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following 4 cell types are provided for
illustrative purposes, but other cell types can be routinely used,
provided that the target is expressed in the cell type chosen. This
can be readily determined by methods routine in the art, for
example Northern blot analysis, Ribonuclease protection assays, or
RT-PCR.
[0210] T-24 Cells:
[0211] The transitional cell bladder carcinoma cell line T-24 was
obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.)
supplemented with 10% fetal calf serum (Gibco/Life Technologies,
Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0212] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0213] A549 Cells:
[0214] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence.
[0215] NHDF Cells:
[0216] Human neonatal dermal fibroblast (NHDF) were obtained, from
the Clonetics Corporation (Walkersville Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
[0217] HEK Cells:
[0218] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
[0219] Treatment with Antisense Compounds:
[0220] When cells reached 80% confluency, they were treated with
oligonucleotide. For cells grown in 96-well plates, wells were
washed once with 200 .mu.L OPTI-MEM.TM.-1 reduced-serum medium
(Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM.TM.-1
containing 3.75 .mu.g/mL LIPOFECTIN.TM. (Gibco BRL) and the desired
concentration of oligonucleotide. After 4-7 hours of treatment, the
medium was replaced with fresh medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
[0221] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1,
a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with
a phosphorothioate backbone which is targeted to human H-ras. For
mouse or rat cells the positive control oligonucleotide is ISIS
15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl
gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate
backbone which is targeted to both mouse and rat c-raf. The
concentration of positive control oligonucleotide that results in
80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS
15770) mRNA is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
H-ras or c-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments.
Example 10
[0222] Analysis of oligonucleotide inhibition of glycogen synthase
kinase 3 beta expression Antisense modulation of glycogen synthase
kinase 3 beta expression can be assayed in a variety of ways known
in the art. For example, glycogen synthase kinase 3 beta mRNA
levels can be quantitated by, e.g., Northern blot analysis,
competitive polymerase chain reaction (PCR), or real-time PCR
(RT-PCR). Real-time quantitative PCR is presently preferred. RNA
analysis can be performed on total cellular RNA or poly(A)+mRNA.
Methods of RNA isolation are taught in, for example, Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Volume 1, pp.
4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.
Northern blot analysis is routine in the art and is taught in, for
example, Ausubel, F. M. et al., Current Protocols in Molecular
Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc.,
1996. Real-time quantitative (PCR) can be conveniently accomplished
using the commercially available ABI PRISM.TM. 7700 Sequence
Detection System, available from PE-Applied Biosystems, Foster
City, Calif. and used according to manufacturer's instructions.
Prior to quantitative PCR analysis, primer-probe sets specific to
the target gene being measured are evaluated for their ability to
be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed as
multiplexable. Other methods of PCR are also known in the art.
[0223] Protein levels of glycogen synthase kinase 3 beta can be
quantitated in a variety of ways well known in the art, such as
immunoprecipitation, Western blot analysis (immunoblotting), ELISA
or fluorescence-activated cell sorting (FACS). Antibodies directed
to glycogen synthase kinase 3 beta can be identified and obtained
from a variety of sources, such as the MSRS catalog of antibodies
(Aerie Corporation, Birmingham, Mich.), or can be prepared via
conventional antibody generation methods. Methods for preparation
of polyclonal antisera are taught in, for example, Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Volume 2, pp.
11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of
monoclonal antibodies is taught in, for example, Ausubel, F. M. et
al., Current Protocols in Molecular Biology, Volume 2, pp.
11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
[0224] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 11
[0225] Poly(A)+mRNA Isolation
[0226] Poly(A)+mRNA was isolated according to Miura et al., Clin.
Chem., 1996, 42, 1758-1764. Other methods for poly(A)+mRNA
isolation are taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3,
John Wiley & Sons, Inc., 1993. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.L
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove excess wash buffer and then air-dried for 5 minutes. 60
.mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C. was added to each well, the plate was incubated on a
90.degree. C. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0227] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 12
[0228] Total RNA Isolation
[0229] Total mRNA was isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 100 .mu.L Buffer RLT was
added to each well and the plate vigorously agitated for 20
seconds. 100 .mu.L of 70% ethanol was then added to each well and
the contents mixed by pipetting three times up and down. The
samples were then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum was applied for 15
seconds. 1 mL of Buffer RW1 was added to each well of the RNEASY
96.TM. plate and the vacuum again applied for 15 seconds. 1 mL of
Buffer RPE was then added to each well of the RNEASY 96.TM. plate
and the vacuum applied for a period of 15 seconds. The Buffer RPE
wash was then repeated and the vacuum was applied for an additional
10 minutes. The plate was then removed from the QIAVAC.TM. manifold
and blotted dry on paper towels. The plate was then re-attached to
the QIAVAC.TM. manifold fitted with a collection tube rack
containing 1.2 mL collection tubes. RNA was then eluted by
pipetting 60 .mu.L water into each well, incubating 1 minute, and
then applying the vacuum for 30 seconds. The elution step was
repeated with an additional 60 .mu.L water.
[0230] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 13
[0231] Real-Time Quantitative PCR Analysis of Glycogen Synthase
Kinase 3 Beta mRNA Levels
[0232] Quantitation of glycogen synthase kinase 3 beta mRNA levels
was determined by real-time quantitative PCR using the ABI
PRISM.TM. 7700 Sequence Detection System (PE-Applied Biosystems,
Foster City, Calif.) according to manufacturer's instructions. This
is a closed-tube, non-gel-based, fluorescence detection system
which allows high-throughput quantitation of polymerase chain
reaction (PCR) products in real-time. As opposed to standard PCR,
in which amplification products are quantitated after the PCR is
completed, products in real-time quantitative PCR are quantitated
as they accumulate. This is accomplished by including in the PCR
reaction an oligonucleotide probe that anneals specifically between
the forward and reverse PCR primers, and contains two fluorescent
dyes. A reporter dye (e.g., JOE, FAM, or VIC, obtained from either
Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems,
Foster City, Calif.) is attached to the 5' end of the probe and a
quencher dye (e.g., TAMRA, obtained from either Operon Technologies
Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City,
Calif.) is attached to the 3' end of the probe. When the probe and
dyes are intact, reporter dye emission is quenched by the proximity
of the 3' quencher dye. During amplification, annealing of the
probe to the target sequence creates a substrate that can be
cleaved by the 5'-exonuclease activity of Taq polymerase. During
the extension phase of the PCR amplification cycle, cleavage of the
probe by Taq polymerase releases the reporter dye from the
remainder of the probe (and hence from the quencher moiety) and a
sequence-specific fluorescent signal is generated. With each cycle,
additional reporter dye molecules are cleaved from their respective
probes, and the fluorescence intensity is monitored at regular
intervals by laser optics built into the ABI PRISM.TM. 7700
Sequence Detection System. In each assay, a series of parallel
reactions containing serial dilutions of mRNA from untreated
control samples generates a standard curve that is used to
quantitate the percent inhibition after antisense oligonucleotide
treatment of test samples.
[0233] PCR reagents were obtained from PE-Applied Biosystems,
Foster City, Calif.. RT-PCR reactions were carried out by adding 25
.mu.L PCR cocktail (1.times. TAQMAN.TM. buffer A, 5.5 mM
MgCl.sub.2, 300 .mu.M each of DATP, dCTP and dGTP, 600 .mu.M of
dUTP, 100 nM each of forward primer, reverse primer, and probe, 20
Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD.TM., and 12.5 Units
MuLV reverse transcriptase) to 96 well plates containing 25 .TM.L
poly(A) mRNA solution. The RT reaction was carried out by
incubation for 30 minutes at 48.degree. C. Following a 10 minute
incubation at 95.degree. C. to activate the AMPLITAQ GOLD.TM., 40
cycles of a two-step PCR protocol were carried out: 95.degree. C.
for 15 seconds (denaturation) followed by 60.degree. C. for 1.5
minutes (annealing/extension).
[0234] Probes and primers to human glycogen synthase kinase 3 beta
were designed to hybridize to a human glycogen synthase kinase 3
beta sequence, using published sequence information (GenBank
accession number L33801, incorporated herein as SEQ ID NO:3). For
human glycogen synthase kinase 3 beta the PCR primers were:
[0235] forward primer: TTCAGCTTTTGGCAGCATGA (SEQ ID NO: 4)
[0236] reverse primer: GAGTTGCCACCACTGTTGTCA (SEQ ID NO: 5) and the
PCR probe was: FAM-CTTGCTGCCGTCCTTGTCTCTGCTAACT-TAMRA (SEQ ID NO:
6) where FAM (PE-Applied Biosystems, Foster City, Calif.) is the
fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster
City, Calif.) is the quencher dye. For human GAPDH the PCR primers
were:
[0237] forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7)
[0238] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the
PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9)
where JOE (PE-Applied Biosystems, Foster City, Calif.) is the
fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster
City, Calif.) is the quencher dye.
Example 14
[0239] Northern Blot Analysis of Glycogen Synthase Kinase 3 Beta
mRNA Levels
[0240] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer was confirmed by UV visualization.
Membranes were fixed by UW cross-linking using a STRATALINKER.TM.
UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then
robed using QUICKHYB.TM. hybridization solution (Stratagene, La
Jolla, Calif.) using manufacturer's recommendations for stringent
conditions.
[0241] To detect human glycogen synthase kinase 3 beta, a human
glycogen synthase kinase 3 beta specific probe was prepared by PCR
using the forward primer TTCAGCTTTTGGCAGCATGA (SEQ ID NO: 4) and
the reverse primer GAGTTGCCACCACTGTTGTCA (SEQ ID NO: 5). To
normalize for variations in loading and transfer efficiency
membranes were stripped and probed for human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech,
Palo Alto, Calif.).
[0242] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular
Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels
in untreated controls.
Example 15
[0243] Antisense Inhibition of Human Glycogen Synthase Kinase 3
Beta Expression by Chimeric Phosphorothioate Oligonucleotides
Having 2'-MOE Wings and a Deoxy Gap
[0244] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of the
human glycogen synthase kinase 3 beta RNA, using published
sequences (GenBank accession number L33801, incorporated herein as
SEQ ID NO: 3, and GenBank accession number AA132666, incorporated
herein as SEQ ID NO: 10). The oligonucleotides are shown in Table
1. "Target site" indicates the first (5'-most) nucleotide number on
the particular target sequence to which the oligonucleotide binds.
All compounds in Table 1 are chimeric oligonucleotides ("gapmers")
20 nucleotides in length, composed of a central "gap" region
cons-sting of ten 2'-deoxynucleotides, which is flanked on both
sides (5' and 3' directions) by five-nucleotide "wings". The wings
are composed of 2'-methoxyethyl (2'-MOE)nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All cytidine residues are
5-methylcytidines. The compounds were analyzed for their effect on
human glycogen synthase kinase 3 beta mRNA levels by quantitative
real-time PCR as described in other examples herein. Data are
averages from two experiments. If present, "N.D." indicates "no
data".
1TABLE 1 Inhibition of human glycogen synthase kinase 3 beta mRNA
levels by chimeric phosphorothioate oligonucleotides having 2'-MOE
wings and a deoxy gap TARGET TARGET SEQ ID ISIS# REGION SEQ ID NO
SITE SEQUENCE % INHIB NO 117428 Coding 3 60 agctctccgcaaaggaggtg 75
11 117429 Coding 3 65 cttgcagctctccgcaaagg 67 12 117430 Coding 3 70
accggcttgcagctctccgc 13 117431 Coding 3 88 aaagctgaaggctgctgcac 17
14 117432 Coding 3 106 ctaactttcatgctgccaaa 88 15 117433 Coding 3
112 tctctgctaactttcatgct 91 16 117434 Coding 3 123
tgccgtccttgtctctgcta 98 17 117435 Coding 3 154 ccaggagttgccaccactgt
88 18 117436 Coding 3 224 accaaatgatccatttccaa 75 19 117437 Coding
3 235 tgatataccacaccaaatga 72 20 117438 Coding 3 240
tggcttgatataccacacca 95 21 117439 Coding 3 245 aagtttggcttgatatacca
51 22 117440 Coding 3 250 tcacaaagtttggcttgata 79 23 117441 Coding
3 294 tcttgtcctgcaatactttc 49 24 117442 Coding 3 326
tctcatgatctggagctctc 85 25 117443 Coding 3 331 agctttctcatgatctggag
76 26 117444 Coding 3 341 acagtgatctagctttctca 74 27 117445 Coding
3 351 ggactatgttacagtgatct 80 28 117446 Coding 3 366
agaaataacgcaatcggact 70 29 117447 Coding 3 396 cctcatctttcttctcacca
54 30 117448 Coding 3 400 tagacctcatctttcttctc 57 31 117449 Coding
3 404 aagatagacctcatctttct 63 32 117450 Coding 3 428
cggaacatagtccagcacca 83 33 117451 Coding 3 436 actgtttccggaacatagtc
53 34 117452 Coding 3 445 actctgtatactgtttccgg 70 35 117453 Coding
3 456 agtgtctggcaactctgtat 56 36 117454 Coding 3 463
cgactatagtgtctggcaac 84 37 117455 Coding 3 466 gctcgactatagtgtctggc
52 38 117456 Coding 3 476 cgtctgtttggctcgactat 58 39 117457 Coding
3 509 atacatatacaacttgacat 54 40 117458 Coding 3 535
atataggctaaacttcggaa 55 41 117459 Coding 3 545 aaaggaatggatataggcta
87 42 117460 Coding 3 564 tatcccgatggcagattcca 76 43 117461 Coding
3 592 ggatccaacaagaggttctg 80 44 117462 Coding 3 619
tcacagagttttaatacagc 52 45 117463 Coding 3 639 gctgctttgcacttccaaag
64 46 117464 Coding 3 676 gaacagatatacgaaacatt 45 47 117465 Coding
3 695 tggtgccctatagtaccgag 69 48 117466 Coding 3 704
gatcaactctggtgccctat 71 49 117467 Coding 3 706 aagatcaactctggtgccct
80 50 117468 Coding 3 745 gaccatacatctatactaga 27 51 117469 Coding
3 748 gcagaccatacatctatact 75 52 117470 Coding 3 783
gttgtcctagtaacagctca 66 53 117471 Coding 3 793 ggaaatattggttgtcctag
63 54 117472 Coding 3 820 accaactgatccacaccact 67 55 117473 Coding
3 874 ttcatttctctgatttgctc 57 56 117474 Coding 3 880
tttgggttcatttctctgat 7 57 117475 Coding 3 963 caattgcctccggtggagtt
38 58 117476 Coding 3 1002 gggcagttggtgtatactcc 17 59 117477 Coding
3 1024 caagcttccagtggtgttag 47 60 117478 Coding 3 1029
gtgcacaagcttccagtggt 29 61 117479 Coding 3 1034
tgaatgtgcacaagcttcca 63 62 117480 Coding 3 1039
aaaaatgaatgtgcacaagc 69 63 117481 Coding 3 1049
taattcatcaaaaaatgaat 6 64 117482 Coding 3 1059 ttgggtcccgtaattcatca
25 65 117483 Coding 3 1077 catttggatgtttgacattt 26 66 117484 Coding
3 1090 ggtglzgtctcgcccatttgg 48 67 117485 Coding 3 1094
tgcaggtgtgtctcgcccat 76 68 117486 Coding 3 1102
ttgaagagtgcaggtgtgtc 35 69 117487 Coding 3 1126
cttgacagttcttgagtggt 54 70 117488 Coding 3 1155
gaataaggatggtagccaga 65 71 117489 Coding 3 1169
ccgagcatgaggaggaataa 35 72 117490 Coding 3 1184
agcagctgcttgaatccgag 10 73 117491 Coding 3 1244
ggtctgtccacggtctccag 66 74 117492 Coding 3 1249
ttattggtctgtccacggtc 65 75 117493 Coding 3 1273
ttggaagctgatgcagaagc 51 76 117494 Stop 3 1292 cgggactgttcaggtggagt
17 77 Codon 117495 3' UTR 3 1327 agtaactggtggtttttcct 32 78 117496
3' UTR 3 1342 gctgagtgacactcaagtaa 80 79 117497 3' UTR 3 1354
gtgaccagtgttgctgagtg 71 80 117498 3' UTR 3 1356
acgtgaccagtgttgctgag 59 81 117499 3' UTR 3 1359
caaacgtgaccagtgttgct 59 82 117500 3' UTR 3 1364
ctttccaaacgtgaccagtg 49 83 117501 5' UTR 10 21 gttaggttaacgataaatgc
75 84 117502 5' UTR 10 51 cttttcttccttttgtcttt 72 85
[0245] As shown in Table 1, SEQ ID NOs 11, 12, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 58, 60, 61, 62, 63, 65, 66, 67, 68, 69, 70, 71, 72, 74,
75, 76, 78, 79, 80, 81, 82, 83, 84 and 85 demonstrated at least 20%
inhibition of human glycogen synthase kinase 3 beta expression in
this assay and are therefore preferred.
Example 16
[0246] Western Blot Analysis of Glycogen Synthase Kinase 3 Beta
Protein Levels
[0247] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a
16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to glycogen synthase kinase 3 beta is used, with
a radiolabelled or fluorescently labeled secondary antibody
directed against the primary antibody species. Bands are visualized
using a PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
Sequence CWU 1
1
85 1 20 DNA Artificial Sequence Antisense Oligonucleotide 1
tccgtcatcg ctcctcaggg 20 2 20 DNA Artificial Sequence Antisense
Oligonucleotide 2 atgcattctg cccccaagga 20 3 1389 DNA Homo sapiens
CDS (40)...(1302) 3 ggagaaggaa ggaaaaggtg attcgcgaag agagtgatc atg
tca ggg cgg ccc 54 Met Ser Gly Arg Pro 1 5 aga acc acc tcc ttt gcg
gag agc tgc aag ccg gtg cag cag cct tca 102 Arg Thr Thr Ser Phe Ala
Glu Ser Cys Lys Pro Val Gln Gln Pro Ser 10 15 20 gct ttt ggc agc
atg aaa gtt agc aga gac aag gac ggc agc aag gtg 150 Ala Phe Gly Ser
Met Lys Val Ser Arg Asp Lys Asp Gly Ser Lys Val 25 30 35 aca aca
gtg gtg gca act cct ggg cag ggt cca gac agg cca caa gaa 198 Thr Thr
Val Val Ala Thr Pro Gly Gln Gly Pro Asp Arg Pro Gln Glu 40 45 50
gtc agc tat aca gac act aaa gtg att gga aat gga tca ttt ggt gtg 246
Val Ser Tyr Thr Asp Thr Lys Val Ile Gly Asn Gly Ser Phe Gly Val 55
60 65 gta tat caa gcc aaa ctt tgt gat tca gga gaa ctg gtc gcc atc
aag 294 Val Tyr Gln Ala Lys Leu Cys Asp Ser Gly Glu Leu Val Ala Ile
Lys 70 75 80 85 aaa gta ttg cag gac aag aga ttt aag aat cga gag ctc
cag atc atg 342 Lys Val Leu Gln Asp Lys Arg Phe Lys Asn Arg Glu Leu
Gln Ile Met 90 95 100 aga aag cta gat cac tgt aac ata gtc cga ttg
cgt tat ttc ttc tac 390 Arg Lys Leu Asp His Cys Asn Ile Val Arg Leu
Arg Tyr Phe Phe Tyr 105 110 115 tcc agt ggt gag aag aaa gat gag gtc
tat ctt aat ctg gtg ctg gac 438 Ser Ser Gly Glu Lys Lys Asp Glu Val
Tyr Leu Asn Leu Val Leu Asp 120 125 130 tat gtt ccg gaa aca gta tac
aga gtt gcc aga cac tat agt cga gcc 486 Tyr Val Pro Glu Thr Val Tyr
Arg Val Ala Arg His Tyr Ser Arg Ala 135 140 145 aaa cag acg ctc cct
gtg att tat gtc aag ttg tat atg tat cag ctg 534 Lys Gln Thr Leu Pro
Val Ile Tyr Val Lys Leu Tyr Met Tyr Gln Leu 150 155 160 165 ttc cga
agt tta gcc tat atc cat tcc ttt gga atc tgc cat cgg gat 582 Phe Arg
Ser Leu Ala Tyr Ile His Ser Phe Gly Ile Cys His Arg Asp 170 175 180
att aaa ccg cag aac ctc ttg ttg gat cct gat act gct gta tta aaa 630
Ile Lys Pro Gln Asn Leu Leu Leu Asp Pro Asp Thr Ala Val Leu Lys 185
190 195 ctc tgt gac ttt gga agt gca aag cag ctg gtc cga gga gaa ccc
aat 678 Leu Cys Asp Phe Gly Ser Ala Lys Gln Leu Val Arg Gly Glu Pro
Asn 200 205 210 gtt tcg tat atc tgt tct cgg tac tat agg gca cca gag
ttg atc ttt 726 Val Ser Tyr Ile Cys Ser Arg Tyr Tyr Arg Ala Pro Glu
Leu Ile Phe 215 220 225 gga gcc act gat tat acc tct agt ata gat gta
tgg tct gct ggc tgt 774 Gly Ala Thr Asp Tyr Thr Ser Ser Ile Asp Val
Trp Ser Ala Gly Cys 230 235 240 245 gtg ttg gct gag ctg tta cta gga
caa cca ata ttt cca ggg gat agt 822 Val Leu Ala Glu Leu Leu Leu Gly
Gln Pro Ile Phe Pro Gly Asp Ser 250 255 260 ggt gtg gat cag ttg gta
gaa ata atc aag gtc ctg gga act cca aca 870 Gly Val Asp Gln Leu Val
Glu Ile Ile Lys Val Leu Gly Thr Pro Thr 265 270 275 agg gag caa atc
aga gaa atg aac cca aac tac aca gaa ttt aaa ttc 918 Arg Glu Gln Ile
Arg Glu Met Asn Pro Asn Tyr Thr Glu Phe Lys Phe 280 285 290 cct caa
att aag gca cat cct tgg act aag gtc ttc cga ccc cga act 966 Pro Gln
Ile Lys Ala His Pro Trp Thr Lys Val Phe Arg Pro Arg Thr 295 300 305
cca ccg gag gca att gca ctg tgt agc cgt ctg ctg gag tat aca cca
1014 Pro Pro Glu Ala Ile Ala Leu Cys Ser Arg Leu Leu Glu Tyr Thr
Pro 310 315 320 325 act gcc cga cta aca cca ctg gaa gct tgt gca cat
tca ttt ttt gat 1062 Thr Ala Arg Leu Thr Pro Leu Glu Ala Cys Ala
His Ser Phe Phe Asp 330 335 340 gaa tta cgg gac cca aat gtc aaa cat
cca aat ggg cga gac aca cct 1110 Glu Leu Arg Asp Pro Asn Val Lys
His Pro Asn Gly Arg Asp Thr Pro 345 350 355 gca ctc ttc aac ttc acc
act caa gaa ctg tca agt aat cca cct ctg 1158 Ala Leu Phe Asn Phe
Thr Thr Gln Glu Leu Ser Ser Asn Pro Pro Leu 360 365 370 gct acc atc
ctt att cct cct cat gct cgg att caa gca gct gct tca 1206 Ala Thr
Ile Leu Ile Pro Pro His Ala Arg Ile Gln Ala Ala Ala Ser 375 380 385
acc ccc aca aat gcc aca gca gcg tca gat gct aat act gga gac cgt
1254 Thr Pro Thr Asn Ala Thr Ala Ala Ser Asp Ala Asn Thr Gly Asp
Arg 390 395 400 405 gga cag acc aat aat gct gct tct gca tca gct tcc
aac tcc acc tga 1302 Gly Gln Thr Asn Asn Ala Ala Ser Ala Ser Ala
Ser Asn Ser Thr 410 415 420 acagtcccga cgagccagct gcacaggaaa
aaccaccagt tacttgagtg tcactcagca 1362 acactggtca cgtttggaaa gaatatt
1389 4 20 DNA Artificial Sequence PCR Primer 4 ttcagctttt
ggcagcatga 20 5 21 DNA Artificial Sequence PCR Primer 5 gagttgccac
cactgttgtc a 21 6 28 DNA Artificial Sequence PCR Probe 6 cttgctgccg
tccttgtctc tgctaact 28 7 19 DNA Artificial Sequence PCR Primer 7
gaaggtgaag gtcggagtc 19 8 20 DNA Artificial Sequence PCR Primer 8
gaagatggtg atgggatttc 20 9 20 DNA Artificial Sequence PCR Probe 9
caagcttccc gttctcagcc 20 10 326 DNA Homo sapiens unsure 155 unknown
10 ctgtgggaga acttaatgct gcatttatcg ttaacctaac accccaacat
aaagacaaaa 60 ggaagaaaag gaggaaggaa ggaaaaggtg attcgcgaag agagtgatc
atg tca ggg 118 Met Ser Gly 1 cgg ccc aga acc acc tcc ttt gcg gag
agc ttg caa ncg gtg cag cag 166 Arg Pro Arg Thr Thr Ser Phe Ala Glu
Ser Leu Gln Xaa Val Gln Gln 5 10 15 cct tca gct ttt ggc agc atg aan
gtt agc aga gac aag gac ggc agc 214 Pro Ser Ala Phe Gly Ser Met Xaa
Val Ser Arg Asp Lys Asp Gly Ser 20 25 30 35 aag gtg aca aca gtg gtg
gca act cct ggg gca ggg gtc cag aca ggc 262 Lys Val Thr Thr Val Val
Ala Thr Pro Gly Ala Gly Val Gln Thr Gly 40 45 50 cac aag aag tca
gct ata cag aca cta aaa gtt gat tgg aaa tgg atc 310 His Lys Lys Ser
Ala Ile Gln Thr Leu Lys Val Asp Trp Lys Trp Ile 55 60 65 att tgg
tgt ggt ata t 326 Ile Trp Cys Gly Ile 70 11 20 DNA Artificial
Sequence Antisense Oligonucleotide 11 agctctccgc aaaggaggtg 20 12
20 DNA Artificial Sequence Antisense Oligonucleotide 12 cttgcagctc
tccgcaaagg 20 13 20 DNA Artificial Sequence Antisense
Oligonucleotide 13 accggcttgc agctctccgc 20 14 20 DNA Artificial
Sequence Antisense Oligonucleotide 14 aaagctgaag gctgctgcac 20 15
20 DNA Artificial Sequence Antisense Oligonucleotide 15 ctaactttca
tgctgccaaa 20 16 20 DNA Artificial Sequence Antisense
Oligonucleotide 16 tctctgctaa ctttcatgct 20 17 20 DNA Artificial
Sequence Antisense Oligonucleotide 17 tgccgtcctt gtctctgcta 20 18
20 DNA Artificial Sequence Antisense Oligonucleotide 18 ccaggagttg
ccaccactgt 20 19 20 DNA Artificial Sequence Antisense
Oligonucleotide 19 accaaatgat ccatttccaa 20 20 20 DNA Artificial
Sequence Antisense Oligonucleotide 20 tgatatacca caccaaatga 20 21
20 DNA Artificial Sequence Antisense Oligonucleotide 21 tggcttgata
taccacacca 20 22 20 DNA Artificial Sequence Antisense
Oligonucleotide 22 aagtttggct tgatatacca 20 23 20 DNA Artificial
Sequence Antisense Oligonucleotide 23 tcacaaagtt tggcttgata 20 24
20 DNA Artificial Sequence Antisense Oligonucleotide 24 tcttgtcctg
caatactttc 20 25 20 DNA Artificial Sequence Antisense
Oligonucleotide 25 tctcatgatc tggagctctc 20 26 20 DNA Artificial
Sequence Antisense Oligonucleotide 26 agctttctca tgatctggag 20 27
20 DNA Artificial Sequence Antisense Oligonucleotide 27 acagtgatct
agctttctca 20 28 20 DNA Artificial Sequence Antisense
Oligonucleotide 28 ggactatgtt acagtgatct 20 29 20 DNA Artificial
Sequence Antisense Oligonucleotide 29 agaaataacg caatcggact 20 30
20 DNA Artificial Sequence Antisense Oligonucleotide 30 cctcatcttt
cttctcacca 20 31 20 DNA Artificial Sequence Antisense
Oligonucleotide 31 tagacctcat ctttcttctc 20 32 20 DNA Artificial
Sequence Antisense Oligonucleotide 32 aagatagacc tcatctttct 20 33
20 DNA Artificial Sequence Antisense Oligonucleotide 33 cggaacatag
tccagcacca 20 34 20 DNA Artificial Sequence Antisense
Oligonucleotide 34 actgtttccg gaacatagtc 20 35 20 DNA Artificial
Sequence Antisense Oligonucleotide 35 actctgtata ctgtttccgg 20 36
20 DNA Artificial Sequence Antisense Oligonucleotide 36 agtgtctggc
aactctgtat 20 37 20 DNA Artificial Sequence Antisense
Oligonucleotide 37 cgactatagt gtctggcaac 20 38 20 DNA Artificial
Sequence Antisense Oligonucleotide 38 gctcgactat agtgtctggc 20 39
20 DNA Artificial Sequence Antisense Oligonucleotide 39 cgtctgtttg
gctcgactat 20 40 20 DNA Artificial Sequence Antisense
Oligonucleotide 40 atacatatac aacttgacat 20 41 20 DNA Artificial
Sequence Antisense Oligonucleotide 41 atataggcta aacttcggaa 20 42
20 DNA Artificial Sequence Antisense Oligonucleotide 42 aaaggaatgg
atataggcta 20 43 20 DNA Artificial Sequence Antisense
Oligonucleotide 43 tatcccgatg gcagattcca 20 44 20 DNA Artificial
Sequence Antisense Oligonucleotide 44 ggatccaaca agaggttctg 20 45
20 DNA Artificial Sequence Antisense Oligonucleotide 45 tcacagagtt
ttaatacagc 20 46 20 DNA Artificial Sequence Antisense
Oligonucleotide 46 gctgctttgc acttccaaag 20 47 20 DNA Artificial
Sequence Antisense Oligonucleotide 47 gaacagatat acgaaacatt 20 48
20 DNA Artificial Sequence Antisense Oligonucleotide 48 tggtgcccta
tagtaccgag 20 49 20 DNA Artificial Sequence Antisense
Oligonucleotide 49 gatcaactct ggtgccctat 20 50 20 DNA Artificial
Sequence Antisense Oligonucleotide 50 aagatcaact ctggtgccct 20 51
20 DNA Artificial Sequence Antisense Oligonucleotide 51 gaccatacat
ctatactaga 20 52 20 DNA Artificial Sequence Antisense
Oligonucleotide 52 gcagaccata catctatact 20 53 20 DNA Artificial
Sequence Antisense Oligonucleotide 53 gttgtcctag taacagctca 20 54
20 DNA Artificial Sequence Antisense Oligonucleotide 54 ggaaatattg
gttgtcctag 20 55 20 DNA Artificial Sequence Antisense
Oligonucleotide 55 accaactgat ccacaccact 20 56 20 DNA Artificial
Sequence Antisense Oligonucleotide 56 ttcatttctc tgatttgctc 20 57
20 DNA Artificial Sequence Antisense Oligonucleotide 57 tttgggttca
tttctctgat 20 58 20 DNA Artificial Sequence Antisense
Oligonucleotide 58 caattgcctc cggtggagtt 20 59 20 DNA Artificial
Sequence Antisense Oligonucleotide 59 gggcagttgg tgtatactcc 20 60
20 DNA Artificial Sequence Antisense Oligonucleotide 60 caagcttcca
gtggtgttag 20 61 20 DNA Artificial Sequence Antisense
Oligonucleotide 61 gtgcacaagc ttccagtggt 20 62 20 DNA Artificial
Sequence Antisense Oligonucleotide 62 tgaatgtgca caagcttcca 20 63
20 DNA Artificial Sequence Antisense Oligonucleotide 63 aaaaatgaat
gtgcacaagc 20 64 20 DNA Artificial Sequence Antisense
Oligonucleotide 64 taattcatca aaaaatgaat 20 65 20 DNA Artificial
Sequence Antisense Oligonucleotide 65 ttgggtcccg taattcatca 20 66
20 DNA Artificial Sequence Antisense Oligonucleotide 66 catttggatg
tttgacattt 20 67 20 DNA Artificial Sequence Antisense
Oligonucleotide 67 ggtgtgtctc gcccatttgg 20 68 20 DNA Artificial
Sequence Antisense Oligonucleotide 68 tgcaggtgtg tctcgcccat 20 69
20 DNA Artificial Sequence Antisense Oligonucleotide 69 ttgaagagtg
caggtgtgtc 20 70 20 DNA Artificial Sequence Antisense
Oligonucleotide 70 cttgacagtt cttgagtggt 20 71 20 DNA Artificial
Sequence Antisense Oligonucleotide 71 gaataaggat ggtagccaga 20 72
20 DNA Artificial Sequence Antisense Oligonucleotide 72 ccgagcatga
ggaggaataa 20 73 20 DNA Artificial Sequence Antisense
Oligonucleotide 73 agcagctgct tgaatccgag 20 74 20 DNA Artificial
Sequence Antisense Oligonucleotide 74 ggtctgtcca cggtctccag 20 75
20 DNA Artificial Sequence Antisense Oligonucleotide 75 ttattggtct
gtccacggtc 20 76 20 DNA Artificial Sequence Antisense
Oligonucleotide 76 ttggaagctg atgcagaagc 20 77 20 DNA Artificial
Sequence Antisense Oligonucleotide 77 cgggactgtt caggtggagt 20 78
20 DNA Artificial Sequence Antisense Oligonucleotide 78 agtaactggt
ggtttttcct 20 79 20 DNA Artificial Sequence Antisense
Oligonucleotide 79 gctgagtgac actcaagtaa 20 80 20 DNA Artificial
Sequence Antisense Oligonucleotide 80 gtgaccagtg ttgctgagtg 20 81
20 DNA Artificial Sequence Antisense Oligonucleotide 81 acgtgaccag
tgttgctgag 20 82 20 DNA Artificial Sequence Antisense
Oligonucleotide 82 caaacgtgac cagtgttgct 20 83 20 DNA Artificial
Sequence Antisense Oligonucleotide 83 ctttccaaac gtgaccagtg 20 84
20 DNA Artificial Sequence Antisense Oligonucleotide 84 gttaggttaa
cgataaatgc
20 85 20 DNA Artificial Sequence Antisense Oligonucleotide 85
cttttcttcc ttttgtcttt 20
* * * * *