U.S. patent application number 10/262794 was filed with the patent office on 2003-11-06 for insecticidal protein toxins from photorhabdus.
Invention is credited to Blackburn, Michael B., Bowen, David J., Ciche, Todd A., Ensign, Jerald C., Fatig, Raymond, Ffrench-Constant, Richard H., Guo, Lining, Hey, Timothy D., Merlo, Donald J., Orr, Gregory L., Petell, James, Roberts, Jean L., Rocheleau, Thomas A., Schoonover, Sue, Strickland, James A., Sukhapinda, Kitisri.
Application Number | 20030207806 10/262794 |
Document ID | / |
Family ID | 29408200 |
Filed Date | 2003-11-06 |
United States Patent
Application |
20030207806 |
Kind Code |
A1 |
Ensign, Jerald C. ; et
al. |
November 6, 2003 |
Insecticidal protein toxins from Photorhabdus
Abstract
Proteins from the genus Photorhabdus are toxic to insects upon
exposure. Photorhabdus luminescens (formerly Xenorhabdus
luminescens) have been found in mammalian clinical samples and as a
bacterial symbiont of entomopathogenic nematodes of genus
Heterorhabditis. These protein toxins can be applied to, or
genetically engineered into, insect larvae food and plants for
insect control.
Inventors: |
Ensign, Jerald C.; (Madison,
WI) ; Bowen, David J.; (Oregon, WI) ; Petell,
James; (Zionsville, IN) ; Fatig, Raymond;
(Zionsville, IN) ; Schoonover, Sue; (Brownsburg,
IN) ; Ffrench-Constant, Richard H.; (Madison, WI)
; Rocheleau, Thomas A.; (Madison, WI) ; Blackburn,
Michael B.; (Madison, WI) ; Hey, Timothy D.;
(Zionsville, IN) ; Merlo, Donald J.; (Carmel,
IN) ; Orr, Gregory L.; (Indianapolis, IN) ;
Roberts, Jean L.; (Arcadia, IN) ; Strickland, James
A.; (Lebanon, IN) ; Guo, Lining; (Brownsburg,
IN) ; Ciche, Todd A.; (Madison, WI) ;
Sukhapinda, Kitisri; (Zionsville, IN) |
Correspondence
Address: |
DOW AGROSCIENCES LLC
9330 ZIONSVILLE RD
INDIANAPOLIS
IN
46268
US
|
Family ID: |
29408200 |
Appl. No.: |
10/262794 |
Filed: |
October 2, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10262794 |
Oct 2, 2002 |
|
|
|
08851567 |
May 5, 1997 |
|
|
|
6528484 |
|
|
|
|
08851567 |
May 5, 1997 |
|
|
|
08743699 |
Nov 6, 1996 |
|
|
|
08743699 |
Nov 6, 1996 |
|
|
|
08705484 |
Aug 29, 1996 |
|
|
|
08705484 |
Aug 29, 1996 |
|
|
|
08608423 |
Feb 28, 1996 |
|
|
|
08608423 |
Feb 28, 1996 |
|
|
|
08395947 |
Feb 28, 1995 |
|
|
|
08395947 |
Feb 28, 1995 |
|
|
|
08063615 |
May 18, 1993 |
|
|
|
Current U.S.
Class: |
800/302 ;
435/252.3; 435/419; 435/69.2; 514/4.5; 530/350; 536/23.5;
800/279 |
Current CPC
Class: |
C07K 14/195 20130101;
C07K 14/24 20130101; C12N 9/52 20130101; Y02A 40/146 20180101; A01N
63/50 20200101; C12N 15/8286 20130101; A01N 63/50 20200101; A01N
63/20 20200101 |
Class at
Publication: |
514/12 ; 800/279;
536/23.5; 530/350; 435/69.2; 435/252.3; 435/419 |
International
Class: |
A01N 063/00; A01H
005/00; C07H 021/04; C12P 021/02; C12N 001/21; C07K 014/195; C12N
005/04; C12N 015/82 |
Claims
We claim:
1. A composition, comprising an effective amount of a Photorhabdus
protein toxin that has functional activity against an insect.
2. The composition of claim 1, wherein the Photorhabdus toxin is
produced by a purified culture of Photorhabdus, a transgenic plant,
baculovirus, or heterologous microbial host.
3. The composition of claim 2, wherein the Photorhabdus toxin
produced by a purified culture of Photorhabdus luminescens.
4. The composition of claim 2, wherein the toxin is produced from a
purified culture of Photorhabdus luminescens strain designated ATCC
55397.
5. The composition of claim 2, wherein the toxin is produced by a
purified culture of Photorhabdus luminescens strain designated
W-14.
6. The composition of claim 1, wherein the toxin is produced by a
purified culture of Photorhabdus strain designated WX-1, WX-2,
WX-3, WX-4, WX-5, WX6, WX-7, WX-8, WX-9, WX-10, WX-11, WX-12,
WX-14, WX-15, H9, Hb, Hm, HP88, NC-1, W30, WIR, B2, ATCC#43948,
ATCC#43949, ATCC#43950, ATCC#43951, ATCC#43952, DEP1, DEP2, DEP3,
P. zealandrica, P. hepialus, HB-Arg, HB Oswego, HB Oswego, HB
Lewiston, K-122, HMGD, Indicus, GD, PWH-5, Megidis, HF-85, A. Cows,
MP1, MP2, MP3, MP4, MP5, GL98, GL101, GL138, GL55, GL217, or
GL257.
7. The composition of claim 2, wherein the toxin is produced from a
purified culture of Photorhabdus luminescens strain designated
WX-1, WX-2, WX-3, WX-4, WX-5, WX-6, WX-7, WX-8, WX-9, WX-10, WX-11,
WX-12, WX-14, WX-15, H9, Hb, Hm, HP88, NC-1, W30, WIR, B2,
ATCC#43948, ATCC#43949, ATCC#43950, ATCC#43951, ATCC#43952, DEP1,
DEP2, DEP3, P. zealandrica, P. hepialus, HB-Arg, HB Oswego, HB
Oswego, HB Lewiston, K-122, HMGD, Indicus, GD, PWH-5, Megidis,
HF-85, A. Cows, MP1, MP2, MP3, MP4, MP5, GL98, GL101, GL138, GL55,
GL217, or GL257.
8. The composition of claim 1, wherein the toxin is represented by
amino acid sequence is SEQ ID NO:12.
9. The composition of claim 6, wherein the composition is a mixture
of one or more toxins produced from purified cultures of
Photorhabdus.
10. The composition of claim 1 or 6, wherein the insect is of the
order Lepidoptera, Coleoptera, Hymenoptera, Diptera, Dictyoptera,
Acarina or Homoptera.
11. The composition of claim 1 or 6, wherein the insect species is
from order Coleoptera and is Southern Corn Rootworm, Western Corn
Rootworm, Colorado Potato Beetle, Mealworm, Boll Weevil or Turf
Grub.
12. The composition of claim 1 or 6, wherein the insect species is
from order Lepidoptera and is Beet Armyworm, Black Cutworm, Cabbage
Looper, Codling Moth, Corn Earworm, European Corn Borer, Tobacco
Hornworm, or Tobacco Budworm.
13. The composition of claim 1 or 6, wherein the toxin is
formulated as a sprayable insecticide.
14. The composition of claim 1 or claim 6, wherein the toxin is
formulated as a bait matrix and delivered in an above ground or
below ground bait station.
15. A method of controlling an insect, comprising orally delivering
to an insect an effective amount of a protein toxin that has
functional activity against an insect, wherein the protein is
produced by a purified bacterial culture of the genus
Photorhabdus.
16. The method of claim 15, wherein the bacterium is a purified
culture of Photorhabdus luminescens.
17. The method of claim 15, wherein the toxin is produced from a
purified culture of Photorhabdus luminescens strain designated ATCC
55397.
18. The method of claim 16, wherein the toxin is produced from a
purified culture of Photorhabdus luminescens strain designated
W-14.
19. The method of claim 15, wherein the toxin is produced from a
purified culture of Photorhabdus strains designated WX-1, WX-2,
WX-3, WX-4, WX-5, WX-6, WX-7, WX-8, WX-9, WX-10, WX-11, WX-12,
WX-14, WX-15, H9, Hb, Hm, HP88, NC-1, W30, WIR, B2, ATCC#43948,
ATCC#43949, ATCC#43950, ATCC#43951, ATCC#43952, DEP1, DEP2, DEP3,
P. zealandrica, P. hepialus, HB-Arg, HB Oswego, HB Oswego, HB
Lewiston, K-122, HMGD, Indicus, GD, PWH-5, Megidis, HF-85, A. Cows,
MP1, MP2, MP3, MP4, MP5, GL98, GL101, GL138, GL155, GL217, or
GL257.
20. The method of claim 15, wherein the toxin is produced from a
purified culture of Photorhabdus luminescens strains designated
WX-1, WX-2, WX-3, WX-4, WX-5, WX-6, WX-7, WX-8, WX-9, WX-10, WX-11,
WX-12, WX-14, WX-15, H9, Hb, Hm, HP88, NC-1, W30, WIR, B2,
ATCC#43948, ATCC#43949, ATCC#43950, ATCC#43951, ATCC#43952, DEP1,
DEP2, DEP3, P. zealandrica, P. hepialus, HB-Arg, HB Oswego, HB
Oswego, HB Lewiston, K-122, HMGD, Indicus, GD, PWH-5, Megidis,
HF-85, A. Cows, MP1, MP2, MP3, MP4, MP5, GL98, GL101, GL138, GL155,
GL217, or GL257.
21. The method of claim 19, wherein a mixture of one or more toxins
is produced from a purified culture of Photorhabdus and said toxins
are orally delivered to an insect.
22. The method of claim 15, wherein the toxin is produced by a
prokaryotic host transformed with a gene encoding the toxin.
23. The method of claim 15, wherein the toxin is produced by a
eukaryotic host transformed with a gene encoding the toxin.
24. The method of claim 23, wherein the eukaryotic host is
baculovirus.
25. The method of claim 15 or 19, wherein the insect is of the
order Lepidoptera, Coleoptera, Hymenoptera, Diptera, Dictyoptera,
Acarina or Homoptera.
26. The method of claim 15 or 19, wherein the insect species is
from order Coleoptera and is Southern Corn Rootworm, Western Corn
Rootworm, Colorado Potato Beetle, Mealworm, Boll Weevil or Turf
Grub.
27. The method of claim 15 or 19, wherein the insect species is
from order Lepidoptera and is Beet Armyworm, Black Cutworm, Cabbage
Looper, Codling Moth, Corn Earworm, European Corn Borer, Tobacco
Hornworm, or Tobacco Budworm.
28. The method of claim 15 or 19, wherein the toxin is formulated
as a sprayable insecticide.
29. The method of claim 15 or claim 19, wherein the toxin is
formulated as a bait matrix and delivered in an above ground or
below ground bait station.
30. A method of isolating a gene coding for a protein subunit,
comprising the steps of: constructing at least one RNA or DNA
oligonucleotide molecule that corresponds to at least a part of a
DNA coding region of an amino acid sequence selected from a group
consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4,
SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9,
SEQ ID NO:10, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID
NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ
ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:36,
SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID
NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:62, SEQ ID NO:72, SEQ
ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77,
SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID
NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ
ID NO:87, and SEQ ID NO:88, wherein the nucleotide molecule is used
to isolate genetic material from Photorhabdus or Photorhabdus
luminescens.
31. A method for expressing a protein produced by a purified
bacterial culture of the genus Photorhabdus in a prokaryotic or
eukaryotic host in an effective amount so that the protein has
functional activity against an insect, wherein the method
comprises: constructing a chimeric DNA construct having 5' to 3' a
promoter, a DNA sequence encoding a protein, a transcription
terminator, and then transferring the chimeric DNA construct into
the host.
32. The method of claim 31, wherein the protein has functional
activity against insects selected from a group consisting of
Coleoptera, Lepidoptera, Diptera, Homoptera, Hymenoptera,
Dictyoptera, and Acarina.
33. The method of claim 31, wherein the protein encoded by the DNA
sequence has an N-terminal amino acid sequence selected from the
group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20,
SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ
ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:62, SEQ ID NO:72,
SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID
NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ
ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86,
SEQ ID NO:87, and SEQ ID NO:88.
34. The method of claim 31, wherein the protein encoded by the DNA
sequence includes the amino acid sequence selected from the group
consisting of SEQ ID NO:12, SEQ ID NO:26, SEQ ID NO:28, SEQ ID
NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:47, SEQ
ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57,
SEQ ID NO:59, and SEQ ID NO:61.
35. A chimeric DNA construct, adapted for expression in a
prokaryotic or eukaryotic host comprising, 5' to 3' a
transcriptional promoter active in the host; a DNA sequence
encoding a Photorhabdus protein that has functional activity
against an insect; and a transcriptional terminator.
36. A chimeric DNA construct of claim 35, wherein the protein
encoded by the DNA sequence has an N-terminal amino acid sequence
selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ
ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 13, SEQ ID NO:14, SEQ
ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:24, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ
ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:62,
SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID
NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ
ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85,
SEQ ID NO:86, SEQ ID NO:87, and SEQ ID NO:88.
37. The chimeric DNA construct of claim 35, wherein the protein
encoded by the DNA sequence has an amino acid sequence selected
from the group consisting of SEQ ID NO:12, SEQ ID NO:26, SEQ ID
NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:35, SEQ
ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55,
SEQ ID NO:57, SEQ ID NO:59, and SEQ ID NO:61.
38. The chimeric DNA construct of claim 35, wherein the DNA
sequence encoding the Photorhabdus luminescens protein is selected
from the group comprising SEQ ID NO:11, SEQ ID NO:25, SEQ ID NO:27,
SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:46, SEQ ID
NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ
ID NO: 58, and SEQ ID NO:60.
39. The chimeric DNA construct of claim 35, wherein the host is
baculovirus or a plant cell.
40. An isolated and substantially purified preparation comprising,
a DNA molecule capable of encoding an effective amount of a protein
that is produced by a bacterium of the genus Photorhabdus and that
has functional activity against an insect.
41. The preparation of claim 40, wherein the bacterium is
Photorhabdus luminescens.
42. A purified preparation comprising, a protein produced by
Photorhabdus or Photorhabdus luminescens having an N-terminal amino
acid sequence selected from the group consisting of SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6,
SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 13,
SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38,
SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID
NO:43, SEQ ID NO:62, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ
ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79,
SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID
NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, and SEQ ID
NO:88.
43. A purified protein preparation comprising, a protein that has
an N-terminal amino acid sequence selected from the group
consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4,
SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9,
and SEQ ID NO:10, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID
NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ
ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:38,
SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID
NO:43, SEQ ID NO:62, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ
ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79,
SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID
NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, and SEQ ID
NO:88.
44. A purified protein preparation comprising, a protein selected
from the group of SEQ ID NO:12, SEQ ID NO:26, SEQ ID NO:28, SEQ ID
NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:47, SEQ
ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57,
SEQ ID NO:59, and SEQ ID NO:61.
45. A purified DNA preparation comprising, a DNA sequence selected
from the group consisting of SEQ ID NO:11, SEQ ID NO:25, SEQ ID
NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:46, SEQ
ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56,
SEQ ID NO:58 and SEQ ID NO:60, wherein the DNA sequence is isolated
from its native host.
46. A purified protein preparation comprising, a Photorhabdus
luminescens protein with at least one subunit having an approximate
molecular weight between 18 kDa to about 230 kDa; between about 160
kDa to about 230 kDa; 100 kDa to 160 kDa; about 80 kDa to about 100
kDa; or about 50 kDa to about 80 kDa.
47. A purified protein preparation comprising, a Photorhabdus
luminescens protein with at least one subunit having an approximate
molecular weight of about 280 kDa.
48. A substantially pure microorganism culture comprising, ATCC
55397.
49. The culture of claim 48, wherein the culture is a derivative of
ATCC 55397 that produces a protein toxin that has functional
activity against an insect.
50. A transgenic plant comprising in its genome, a chimeric
artificial gene construction imbuing the plant with an ability to
express an effective amount of a Photorhabdus protein that has
functional activity against an insect.
51. The transgenic plant of claim 50, wherein the plant is
transformed using acceleration of genetic material coated onto
microparticles directly into cells, Agrobacteria, whiskers, or
electroporation techniques
52. The transgenic plant of claim 50, wherein the selectable marker
is selected from the group consisting of kanamycin, neomycin,
glyphosate, hygromycin, methotrexate, phosphinothricin (bialophos),
chlorosulfuron, bromoxynil, dalapon and the like.
53. The transgenic plant of claim 50, wherein the promoter is
selected from the group consisting of octopine synthase, nopaline
synthase, mannopine synthase, 35S, 19S, 35T,
ribulose-1,6-bisphosphate (RUBP) carboxylase small subunit (ssu),
beta-conglycinin, phaseolin, alcohol dehydrogenase (ADH),
heat-shock, ubiquitin, zein, oleosin, napin, or acyl carier protein
(ACP).
54. The transgenic plant of claim 50, wherein embryogenic tissue,
callus tissue type I or II, hypocotyl, meristem, or plant tissue
during dedifferentiation is used in preparing the transgenic
plant.
55. The transgenic plant of claim 50, wherein the chimeric gene is
a DNA sequence which encodes a Photorhabdus protein that has
functional activity against an insect and at least one codon of the
gene has been modified so that the codon is a plant preferred
codon.
56. A method of controlling an insect comprising orally delivering
to an insect an effective amount of a protein toxin, wherein the
protein is produced by a transgenic plant, which said insect
feeds.
57. A composition of matter, comprising a purified DNA sequence
from a purified bacterial culture from the genus Photorhabdus.
58. A substantially pure microorganism culture comprising, H9.
59. A substantially pure microorganism culture comprising, Hb.
60. A substantially pure microorganism culture comprising, Hm.
61. A substantially pure microorganism culture comprising,
HP88.
62. A substantially pure microorganism culture comprising,
NC-1.
63. A substantially pure microorganism culture comprising, W30.
64. A substantially pure microorganism culture comprising, WIR.
65. A substantially pure microorganism culture comprising, B2.
66. A substantially pure microorganism culture comprising, P.
zealandrica.
67. A substantially pure microorganism culture comprising, P.
hepialus.
68. A substantially pure microorganism culture comprising,
HB-Arg.
69. A substantially pure microorganism culture comprising, HB
Oswego.
70. A substantially pure microorganism culture comprising, HB
Lewiston.
71. A substantially pure microorganism culture comprising,
K-122.
72. A substantially pure microorganism culture comprising,
HMGD.
73. A substantially pure microorganism culture comprising,
Indicus.
74. A substantially pure microorganism culture comprising, GD.
75. A substantially pure microorganism culture comprising,
PWH-5.
76. A substantially pure microorganism culture comprising,
Megidis.
77. A substantially pure microorganism culture comprising,
HF-85.
78. A substantially pure microorganism culture comprising, A.
Cows.
79. A substantially pure microorganism culture comprising, MP1.
80. A substantially pure microorganism culture comprising, MP2.
81. A substantially pure microorganism culture comprising, MP3.
82. A substantially pure microorganism culture comprising, MP4.
83. A substantially pure microorganism culture comprising, MP5.
84. A substantially pure microorganism culture comprising,
GL98.
85. A substantially pure microorganism culture comprising,
GL155.
86. A substantially pure microorganism culture comprising,
GL101.
87. A substantially pure microorganism culture comprising,
GL138.
88. A substantially pure microorganism culture comprising,
GL217.
89. A substantially pure microorganism culture comprising,
GL257.
90. A method of making an antibody against a protein fragment that
is part of a protein having functional activity, where the protein
is produced by bacteria of the Enterobacteracaea family, wherein
the method comprises: a) isolating a fragment of the protein, where
the protein fragment is at least six amino acids; b) immunizing a
mammalian species with the protein fragment; and c) harvesting
serum containing antibody or antibody from the spleen of the
mammalian species, where the antibody harvested is antibody to the
protein fragment having functional activity.
91. The method of claim 1, wherein the protein fragment is selected
from the group consisting of SEQ ID NO:63, SEQ ID NO:64, SEQ ID
NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ
ID NO:70, and SEQ ID NO:71.
92. The method of claim 90, wherein the bacteria is from the genus
Photorhabdus.
93. The method of claim 90, wherein the bacteria is from the genus
Photorhabdus luminescens.
94. A method of selecting a DNA fragment which encodes a portion of
a protein that has functional activity, where the protein is
produced from a bacteria of the Enterobacteracaea family, wherein
the method comprises: a) isolating a fragment of the DNA sequence
having at least 30 nucleotides; b) tagging the DNA fragment with a
radioactive or chemical agent; c) hybridizing the DNA fragment to a
DNA library, where the DNA library is an Enterobacteracaea cDNA or
Enterobacteracaea genomic library; and. d) selecting the fragment
that is hybridized to the DNA in the library that encodes for the
protein that has functional activity.
95. The method of claim 94, wherein the bacteria is from the genus
Photorhabdus.
96. The method of claim 95, wherein the bacteria is from the genus
Photorhabdus luminescens.
97. A method of selecting a DNA fragment which encodes a portion of
a protein that has functional activity, where the protein is
produced from a bacteria of the Enterobacteracaea family, wherein
the method comprises: a) isolating at least two primers, where a
primer is a fragment of DNA having at least twelve nucleotides; b)
using the primers from step a), amplifying a DNA fragment from
Enterobacteracaea by using primers with polymerase chain reaction
technology and purifying the DNA fragment; c) tagging the purified
DNA fragment with a radioactive or chemical agent; d) hybridizing
the purified DNA fragment to a DNA library, where the DNA library
is an Enterobacteracaea cDNA or Enterobacteracaea genomic
library;.and e) selecting a DNA fragment that is equal or larger in
size to the purified DNA fragment from the library, where the
selected DNA fragment or portion thereof encodes for a protein that
has functional activity.
98. The method of claim 97, wherein the bacteria is from the genus
Photorhabdus.
99. The method of claim 98, wherein the bacteria is from the genus
Photorhabdus luminescens.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This patent application is a continuation-in-part of U.S.
patent application Ser. No. 08/743,699 filed on Nov. 6, 1996, which
is a continuation-in-part of U.S. patent application Ser. No.
08/705,484 filed on Aug. 28, 1996, which is a continuation-in-part
of U.S. patent application Ser. No. 08/608,423 filed Feb. 28, 1996,
which is a continuation-in-part of U.S. patent application Ser. No.
08/395,947 filed Feb. 28, 1995, which was a continuation-in-part of
U.S. patent application Ser. No. 08/063,615 filed May 18, 1993.
This application is also a continuation-in-part of provisional U.S.
Patent Application Serial No. 60/007,255 filed Nov. 6, 1995.
FIELD OF THE INVENTION
[0002] The present invention relates to toxins isolated from
bacteria and the use of said toxins as insecticides.
BACKGROUND OF THE INVENTION
[0003] Many insects are widely regarded as pests to homeowners, to
picnickers, to gardeners, and to farmers and others whose
investments in agricultural products are often destroyed or
diminished as a result of insect damage to field crops.
Particularly in areas where the growing season is short,
significant insect damage can mean the loss of all profits to
growers and a dramatic decrease in crop yield. Scarce supply of
particular agricultural products invariably results in higher costs
to food processors and, then, to the ultimate consumers of food
plants and products derived from those plants.
[0004] Preventing insect damage to crops and flowers and
eliminating the nuisance of insect pests have typically relied on
strong organic pesticides and insecticides with broad toxicities.
These synthetic products have come under attack by the general
copulation as being too harsh on the environment and on those
exposed to such agents. Similarly in non-agricultural settings,
homeowners would be satisfied to have insects avoid their homes or
outdoor meals without needing to kill the insects.
[0005] The extensive use of chemical insecticides has raised
environmental and health concerns for farmers, companies that
produce the insecticides, government agencies, public interest
groups, and the public in general. The development of less
intrusive pest management strategies has been spurred along both by
societal concern for the environment and by the development of
biological tools which exploit mechanisms of insect management.
Biological control agents present a promising alternative to
chemical insecticides.
[0006] Organisms at every evolutionary development level have
devised means to enhance their own success and survival. The use of
biological molecules as tools of defense and aggression is known
throughout the animal and plant kingdoms. In addition, the
relatively new tools of the genetic engineer allow modifications to
biological insecticides to accomplish particular solutions to
particular problems.
[0007] One such agent, Bacillus thuringiensis (Bt), is an effective
insecticidal agent, and is widely commercially used as such. In
fact, the insecticidal agent of the Bt bacterium is a protein which
has such limited toxicity, it can be used on human food crops on
the day of harvest. To non-targeted organisms, the Bt toxin is a
digestible non-toxic protein.
[0008] Another known class of biological insect control agents are
certain genera of nematodes known to be vectors of transmission for
insect-killing bacterial symbionts. Nematodes containing
insecticidal bacteria invade insect larvae. The bacteria then kill
the larvae. The nematodes reproduce in the larval cadaver. The
nematode progeny then eat the cadaver from within. The
bacteria-containing nematode progeny thus produced can then invade
additional larvae.
[0009] In the past, insecticidal nematodes in the Steinernema and
Heterorhabditis genera were used as insect control agents.
Apparently, each genus of nematode hosts a particular species of
bacterium. In nematodes of the Heterorhabditis genus, the symbiotic
bacterium is Photorhabdus luminescens.
[0010] Although these nematodes are effective insect control
agents, it is presently difficult, expensive, and inefficient to
produce, maintain, and distribute nematodes for insect control.
[0011] It has been known in the art that one may isolate an
insecticidal toxin from Photorhabdus luminescens that has activity
only when injected into Lepidopteran and Coleopteran insect larvae.
This has made it impossible to effectively exploit the insecticidal
properties of the nematode or its bacterial symbiont. What would be
useful would be a more practical, less labor-intensive wide-area
delivery method of an insecticidal toxin which would retain its
biological properties after delivery. It would be quite desirous to
discover toxins with oral activity produced by the genus
Photorhabdus. The isolation and use of these toxins are desirous
due to efficacious reasons. Until applicants' discoveries, these
toxins had not been isolated or characterized.
SUMMARY OF THE INVENTION
[0012] The native toxins are protein complexes that are produced
and secreted by growing bacteria cells of the genus Photorhabdus,
of interest are the proteins produced by the species Photorhabdus
luminescens. The protein complexes, with a molecular size of
approximately 1,000 kDa, can be separated by SDS-PAGE gel analysis
into numerous component proteins. The toxins contain no hemolysin,
lipase, type C phospholipase, or nuclease activities. The toxins
exhibit significant toxicity upon exposure administration to a
number of insects.
[0013] The present invention provides an easily administered
insecticidal protein as well as the expression of toxin in a
heterologous system.
[0014] The present invention also provides a method for delivering
insecticidal toxins that are functional active and effective
against many orders of insects.
[0015] Objects, advantages, and features of the present invention
will become apparent from the following specification.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is an illustration of a match of cloned DNA isolates
used as a part of sequence genes for the toxin of the present
invention.
[0017] FIG. 2 is a map of three plasmids used in the sequencing
process.
[0018] FIG. 3 is a map illustrating the inter-relationship of
several partial DNA fragments.
[0019] FIG. 4 is an illustration of a homology analysis between the
protein sequences of TcbA.sub.ii and TcaB.sub.ii proteins.
[0020] FIG. 5 is a phenogram of Photorhabdus strains. Relationship
of Photorhabdus Strains was defined by rep-PCR. The upper axis of
FIG. 5 measures the percentage similarity of strains based on
scoring of rep-PCR products (i.e., 0.0 [no similarity] to 1.0 [100%
similarity]). At the right axis, the numbers and letters indicate
the various strains tested; 14=W-14, Hm=Hm, H9=H9, 7=WX-7, 1=WX-1,
2=WX-2, 88=HP88, NC-1=NC-1, 4=WX-4, 9=WX-9, 8=WX-8, 10=WX-10,
WIR=WIR, 3=WX-3, 11=WX-11, 5=WX-5, 6=WX-6, 12=WX-12, x14=WX-14,
15=WX-15, Hb=Hb, B2=B2, 48 through 52=ATCC 43948 through ATCC
43952. Vertical lines separating horizontal lines indicate the
degree of relatedness (as read from the extrapolated intersection
of the vertical line with the upper axis) between strains or groups
of strains at the base of the horizontal lines (e.g., strain W-14
is approximately 60% similar to strains H9 and Hm).
[0021] FIG. 6 is an illustration of the genomic maps of the W-14
Strain.
[0022] FIG. 6A is an illustration of the tca and tcb loci and
primary gene products.
[0023] FIG. 7 is a phenogram of Photorhabdus strains as defined by
rep-PCR. The upper axis of FIG. 7 measures the percentage
similarity of strains based on scoring of rep-PCR products (i.e.,
0.0 [no similarity] to 1.0 [100% similarity]). At the right axis,
the numbers and letters indicate the various strains tested.
Vertical lines separating horizontal lines indicate the degree of
relatedness (as read from the extrapolated intersection of the
vertical line with the upper axis) between strains or groups of
strains at the base of the horizontal lines (e.g., strain Indicus
is approximately 30% similar to strains MP1 and HB Oswego). Note
that the Photorhabdus strains on the phenogram are as follows:
14=W-14; Hm=Hm; H9=H9; 7=WX-7; 1=WX-1; 2=WX-2; 88=HP88; NC1=NC-1;
4=WX-4; 9=WX-9; 8=WX-8; 10=WX-10; 30=W30; WIR=WIR; 3-WX-3;
11=WX-11; 5=WX-5; 6=WX-6; 12=WX-12; 15=WX-15; X14=WX-14; Hb=Hb;
B2=B2; 48=ATCC 43948; 49=ATCC 43949; 50=ATCC 43950; 51=ATCC 43951;
52=ATCC 43952.
DETAILED DESCRIPTION OF THE INVENTION
[0024] The present inventions are directed to the discovery of a
unique class of insecticidal protein toxins from the genus
Photorhabdus that have oral toxicity against insects. A unique
feature of Photorhabdus is its bioluminescence. Photorhabdus may be
isolated from a variety of sources. One such source is nematodes,
more particularly nematodes of the genus Heterorhabditis. Another
such source is from human clinical samples from wounds, see Farmer
et al. 1989 J. Clin. Microbiol. 27 pp. 1594-1600. These saprohytic
strains are deposited in the American Type Culture Collection
(Rockville, Md.) ATCC #s 43948, 43949, 43950, 43951, and 43952, and
are incorporated herein by reference. It is possible that other
sources could harbor Photorhabdus bacteria that produce
insecticidal toxins. Such sources in the environment could be
either terrestrial or aquatic based.
[0025] The genus Photorhabdus is taxonomically defined as a member
of the Family Enterobacteriaceae, although it has certain traits
atypical of this family. For example, strains of this genus are
nitrate reduction negative, yellow and red pigment producing and
bioluminescent. This latter trait is otherwise unknown within the
Enterobacteriaceae. Photorhabdus has only recently been described
as a genus separate from the Xenorhabdus (Boemare et al., 1993 Int.
J. Syst. Bacteriol. 43, 249-255). This differentiation is based on
DNA-DNA hybridization studies, phenotypic differences (e.g.,
presence (Photorhabdus) or absence (Xenorhabdus) of catalase and
bioluminescence) and the Family of the nematode host (Xenorhabdus;
Steinernematidae, Photorhabdus; Heterorhabditidae). Comparative,
cellular fatty-acid analyses (Janse et al. 1990, Lett. Appl.
Microbiol 10, 131-135; Suzuki et al. 1990, J. Gen. Appl.
Microbiol., 36, 393-401) support the separation of Photorhabdus
from Xenorhabdus.
[0026] In order to establish that the strain collection disclosed
herein was comprised of Photorhabdus strains, the strains were
characterized based on recognized traits which define Photorhabdus
and differentiate it from other Enterobacteriaceae and Xenorhabdus
species. (Farmer, 1984 Bergey's Manual of Systemic Bacteriology
Vol. 1 pp.510-511; Akhurst and Boemare 1988, J. Gen. Microbiol. 134
pp. 1835-1845; Boemare et al. 1993 Int. J. Syst. Bacteriol. 43 pp.
249-255, which are incorporated herein by reference). The traits
studied were the following: gram stain negative rods, organism
size, colony pigmentation, inclusion bodies, presence of catalase,
ability to reduce nitrate, bioluminescence, dye uptake, gelatin
hydrolysis, growth on selective media, growth temperature, survival
under anerobic conditions and motility. Fatty acid analysis was
used to confirm that the strains herein all belong to the single
genus Photorhabdus.
[0027] Currently, the bacterial genus Photorhabdus is comprised of
a single defined species, Photorhabdus luminescens (ATCC Type
strain #29999, Poinar et al., 1977, Nematologica 23, 97-102). A
variety of related strains have been described in the literature
(e.g., Akhurst et al. 1988 J. Gen. Microbiol., 134, 1835-1845;
Boemare et al. 1993 Int. J. Syst. Bacteriol. 43 pp. 249-255; Putz
et al. 1990, Appl. Environ. Microbiol., 56, 181-186). Numerous
Photorhabdus strains have been characterized herein. Because there
is currently only one species (luminescens) defined within the
genus Photorhabdus, the luminescens species traits were used to
characterize the strains herein. As can be seen in FIG. 5, these
strains are quite diverse. It is not unforeseen that in the future
there may be other Photorhabdus species that will have some of the
attributes of the luminescens species as well as some different
characteristics that are presently not defined as a trait of
Photorhabdus luminescens. However, the scope of the invention
herein is to any Photorhabdus species or strains which produce
proteins that have functional activity as insect control agents,
regardless of other traits and characteristics.
[0028] Furthermore, as is demonstrated herein, the bacteria of the
genus Photorhabdus produce proteins that have functional activity
as defined herein. Of particular interest are proteins produced by
the species Photorhabdus luminescens. The inventions herein should
in no way be limited to the strains which are disclosed herein.
These strains illustrate for the first time that proteins produced
by diverse isolates of Photorhabdus are toxic upon exposure to
insects. Thus, included within the inventions described herein are
the strains specified herein and any mutants thereof, as well as
any strains or species of the genus Photorhabdus that have the
functional activity described herein.
[0029] There are several terms that are used herein that have a
particular meaning and are as follows:
[0030] By "functional activity" it is meant herein that the protein
toxin(s) function as insect control agents in that the proteins are
orally active, or have a toxic effect, or are able to disrupt or
deter feeding, which may or may not cause death of the insect. When
an insect comes into contact with an effective amount of toxin
delivered via transgenic plant expression, formulated protein
compositions(s), sprayable protein composition(s), a bait matrix or
other delivery system, the results are typically death of the
insect, or the insects do not feed upon the source which makes the
toxins available to the insects.
[0031] By the use of the term "genetic material" herein, it is
meant to include all genes, nucleic acid, DNA and RNA.
[0032] By "homolog" it is meant an amino acid sequence that is
identified as possessing homology to a reference W-14 toxin
polypeptide amino acid sequence.
[0033] By "homology" it is meant an amino acid sequence that has a
similarity index of at least 33% and/or an identity index of at
least 26% to a reference W-14 toxin polypeptide amino acid
sequence, as scored by the GAP algorithm using the B10sum 62
protein scoring matrix (Wisconsin Package Version 9.0, Genetics
Computer Group (GCG), Madison, Wis.).
[0034] By "identity" is meant an amino acid sequence that contains
an identical residue at a given position, following alignment with
a reference W-14 toxin polypeptide amino acid sequence by the GAP
algorithm.
[0035] The protein toxins discussed herein are typically referred
to as "insecticides". By insecticides it is meant herein that the
protein toxins have a "functional activity" as further defined
herein and are used as insect control agents.
[0036] By the use of the term "oligonucleotides" it is meant a
macromolecule consisting of a short chain of nucleotides of either
RNA or DNA. Such length could be at least one nucleotide, but
typically are in the range of about 10 to about 12 nucleotides. The
determination of the length of the oligonucleotide is well within
the skill of an artisan and should not be a limitation herein.
Therefore, oligonucleotides may be less than 10 or greater than
12.
[0037] By the use of the term "Photorhabdus toxin" it is meant any
protein produced by a Photorhabdus microorganism strain which has
functional activity against insects, where the Photorhabdustoxin
could be formulated as a sprayable composition, expressed by a
transgenic plant, formulated as a bait matrix, delivered via
baculovirus, or delivered by any other applicable host or delivery
system.
[0038] By the use of the term "toxic" or "toxicity" as used herein
it is meant that the toxins produced by Photorhabdus have
"functional activity" as defined herein.
[0039] By "truncated peptide" it is meant herein to include any
peptide that is fragment(s) of the peptides observed to have
functional activity.
[0040] By "substantial sequence homology" is meant either: a DNA
fragment having a nucleotide sequence sufficiently similar to
another DNA fragment to produce a protein having similar
biochemical properties; or a polypeptide having an amino acid
sequence sufficiently similar to another polypeptide to exhibit
similar biochemical properties.
[0041] Fermentation broths from selected strains reported in Table
20 were used to determine the following: breadth of insecticidal
toxin production by the Photorhabdus genus, the insecticidal
spectrum of these toxins, and to provide source material to purify
the toxin complexes. The strains characterized herein have been
shown to have oral toxicity against a variety of insect orders.
Such insect orders include but are not limited to Coleoptera,
Homoptera, Lepidoptera, Diptera, Acarina, Hymenoptera and
Dictyoptera.
[0042] As with other bacterial toxins, the rate of mutation of the
bacteria in a population causes many related toxins slightly
different in sequence to exist. Toxins of interest here are those
which produce protein complexes toxic to a variety of insects upon
exposure, as described herein. Preferably, the toxins are active
against Lepidoptera, Coleoptera, Homopotera, Diptera, Hymenoptera,
Dictyoptera and Acarina. The inventions herein are intended to
capture the protein toxins homologous to protein toxins produced by
the strains herein and any derivative strains thereof, as well as
any protein toxins produced by Photorhabdus. These homologous
proteins may differ in sequence, but do not differ in function from
those toxins described herein. Homologous toxins are meant to
include protein complexes of between 300 kDa to 2,000 kDa and are
comprised of at least two (2) subunits, where a subunit is a
peptide which may or may not be the same as the other subunit.
Various protein subunits have been identified and are taught in the
Examples herein. Typically, the protein subunits are between about
18 kDa to about 230 kDa; between about 160 kDa to about 230 kDa;
100 kDa to 160 kDa; about 80 kDa to about 100 kDa; and about 50 kDa
to about 80 kDa.
[0043] As discussed above, some Photorhabdus strains can be
isolated from nematodes. Some nematodes, elongated cylindrical
parasitic worms of the phylum Nematoda, have evolved an ability to
exploit insect larvae as a favored growth environment. The insect
larvae provide a source of food for growing nematodes and an
environment in which to reproduce. One dramatic effect that follows
invasion of larvae by certain nematodes is larval death. Larval
death results from the presence of, in certain nematodes, bacteria
that produce an insecticidal toxin which arrests larval growth and
inhibits feeding activity.
[0044] Interestingly, it appears that each genus of insect
parasitic nematode hosts a particular species of bacterium,
uniquely adapted for symbiotic growth with that nematode. In the
interim since this research was initiated, the name of the
bacterial genus Xenorhabdus was reclassified into the Xenorhabdus
and the Photorhabdus. Bacteria of the genus Photorhabdus are
characterized as being symbionts of Heterorhabditus nematodes while
Xenorhabdus species are symbionts of the Steinernema species. This
change in nomenclature is reflected in this specification, but in
no way should a change in nomenclature alter the scope of the
inventions described herein.
[0045] The peptides and genes that are disclosed herein are named
according to the guidelines recently published in the Journal of
Bacteriology "Instructions to Authors" p. i-xii (January 1996),
which is incorporated herein by reference. The following peptides
and genes were isolated from Photorhabdus strain W-14.
1TABLE 1 Peptide/Gene Nomenclature Toxin Complex 1 2 3 4 Peptide
Peptide Gene Gene Name Sequence ID No.* Name Sequence ID No.* tca
genomic region TcaA 34.sup.c tcaA 33 TcaA.sub.i pro-peptide tcaA --
TcaA.sub.ii [15].sup.a, 34.sup.c tcaA -- TcaA.sub.iii [4].sup.a,
35.sup.c tcaA -- TcaA.sub.iv [62].sup.a tcaA -- TcaB [3].sup.a,
(19, 20).sup.b, 26.sup.c tcaB 25 TcaB.sub.i [3].sup.a, (19,
20).sup.b, 28.sup.c tcaB 27 TcaB.sub.ii [5].sup.a, 30.sup.c tcaB 29
TcaC [2].sup.a, 32.sup.c tcaC 31 tcb genomic region TcbA 12.sup.c,
[16].sup.a, (21, tcbA 11 22, 23, 24).sup.b TcbA.sub.i pro-peptide
tcbA -- TcbA.sub.ii [1].sup.a, (21, 22, 23, tcbA 52 24).sup.b,
53.sup.c TcbA.sub.iii [40].sup.a, 55.sup.c tcbA 54 tcc genomic
region TccA [8].sup.a, 57.sup.c tccA 56 TccB [7].sup.a, 59.sup.c
tccB 58 TccC 61.sup.c tccC 60 tcd genomic region TcdA (17, 18, 37,
38, tcdA (36).sup.d, 46 39, 42, 43).sup.b, 47.sup.c TcdA.sub.i
pro-peptide tcdA -- TcdA.sub.ii [13].sup.a, (17, 18, 37, tcdA 48
38, 39).sup.b, 49.sup.c TcdA.sub.iii [41].sup.a, (42, 43).sup.b,
tcdA 50 51.sup.c TcdB [14].sup.a tcdB -- .sup.aSequence ID No. 's
in brackets are peptide N-termini; .sup.bNumbers in parentheses are
N-termini of internal peptide tryptic fragments .sup.cdeduced from
gene sequence .sup.dinternal gene fragment
[0046] The sequences listed above are grouped by genomic region.
More specifically, the Photorhabdus luminesence bacteria (W-14) has
at least four distinct genomic regions--tca, tcb, tcc and tcd. As
can be seen in Table 1, peptide products are produced from these
distinct genomic regions. Furthermore, as illustrated in the
Examples, specifically Examples 15 and 21, individual gene products
produced from three genomic regions are associated with insect
activity. There is also considerable homology between these four
genomic regions.
[0047] As is further illustrated in the Examples, the tcbA gene was
expressed in E. coli as two possible biological active protein
fragments (TcbA and TcbA.sub.ii/iii). The tcdA gene was also
expressed in E. coli. As illustrated in Example 16, when the native
unprocessed TcbA toxin was treated with the endogeneous
metalloproteases or insect gut contents containing proteases, the
TcbA protein toxin was processed into smaller subunits that were
less than the size of the native peptides and Southern Corn
Rootworm activity increased. The smaller toxin peptides remained
associated as part of a toxin complex. It may be desirable in some
situations to increase activation of the toxin(s) by proteolytic
processing or using truncated peptides. Thus, it may be more
desirable to use truncated peptide(s) in some applications, i.e.,
commercial transgenic plant applications.
[0048] In addition to the W-14 strain, there are other species
within the Photorhabdus genus that have functional activity which
is differential (specifically see Tables 20 and 36). Even though
there is differential activity, the amino acid sequences in some
cases have substantial sequence homology. Moreover, the molecular
probes indicate that some genes contained in the strains are
homologous to the genes contained in the W-14 strain. In fact all
of the strains illustrated herein have one or more homologs of W-14
toxin genes. The antibody data in Example 26 and the N-terminal
sequence data in Example 25 further support the conclusion that
there is homology and identity (based on amino acid sequence)
between the protein toxin(s) produced by these strains. At the
molecular level, the W-14 gene probes indicated that the homologs
or the W-14 genes themselves (Tables 37, 38, and 39) are dispersed
throughout the Photorhabdus genus. Further, it is possible that new
toxin genes exist in other strains which are not homologous to
W-14, but maintain overall protein attributes (see specifically
Examples 14 and 25).
[0049] Even though there is homology or identity between toxin
genes produced by the Photorhabdus strains, the strains themselves
are quite diverse. Using polymerase chain reaction technology
further discussed in Example 22, most of the strains illustrated
herein are quite distinguishable. For example as can be seen in
FIG. 5, the percentage relative similarity of some of the strains,
such as HP88 and NC-1, was about 0.8, which indicates that the
strains are similar, while HP88 and Hb was about 0.1, which
indicates substantial diversity. Therefore, even though the insect
toxin genes or gene products that the strains produce are the same
or similar, the strains themselves are diverse.
[0050] In view of the data further disclosed in the Examples and
discussions herein, it is clear that a new and unique family of
insecticidal protein toxin(s) has been discovered. It has been
further illustrated herein that these toxin(s) widely exist within
bacterial strains of the Photorhabdus genus. It may also be the
case that these toxin genes widely exist within the family
Enterobacteracaea. Antibodies prepared as described in Example 21
or gene probes prepared as described in Example 25 may be used to
further screen for bacterial strains within the family
Enterobacteracaea that produce the homologous toxin(s) that have
functional activity. It may also be the case that specific primer
sets exist that could facilitate the identification of new genes
within the Photorhabdus genus or family Enterobacteracaea.
[0051] As stated above, the antibodies may be used to rapidly
screen bacteria of the genus Photorhabdus or the family
Enterbacteracaea for homologous toxin products as illustrated in
Example 26. Those skilled in the art are quite familiar with the
use of antibodies as an analysis or screening tool (see U.S. Pat.
No. 5,430,137, which is incorporated herein by reference).
Moreover, it is generally accepted in the literature that
antibodies are elicited against 6 to 20 amino acid residue segments
that tend to occupy exposed surface of polypeptides (Current
Protocols in Immunology, Coligan et al, National Institutes of
Health, John Wiley & Sons, Inc.). Usually the amino acid
consist of contiguous amino acid residues, however, in certain
cases they may be formed by non-contiguous amino acids that are
constrained by specific conformation. The amino acid segments
recognized by antibodies are highly specific and commonly referred
to epitopes. The amino acid fragment can be generated by chemical
and/or enzymatic cleavage of the native protein, by automated,
solid-phase peptide synthesis, or by production from genetic
engineering organisms. Polypeptide fragments can be isolated by a
variety and/or combination of HPLC and FPLC chromatographic methods
known in the art. Selection of polypeptide fragment can be aided by
the use of algorithms, for example Kyte and Doolittle, 1982,
Journal of Molecular Biology 157: 105-132 and Chou and Fasman,
1974, Biochemistry 13: 222-245, that predict those sequences most
likely to exposed on the surface of the protein. For preparation of
immunogen containing the polypeptide fragment of interest, in
general, polypeptides are covalently coupled using chemical
reactions to carrier proteins such as keyhole limpet hemocyanin via
free amino (lysine), sulfhydyl (cysteine), phenolic (tyrosine) or
carboxylic (aspartate or glutamate) groups. Immunogen with an
adjuvant is injected in animals, such as mice or rabbits, or
chickens to elicit an immune response against the immunogen.
Analysis of antibody titer in antisera of inject animals against
polypeptide fragment can be determined by a variety of
immunological methods such as ELISA and Western blot.
Alternatively, monoclonal antibodies can be prepared using spleen
cells of the injected animal for fusion with tumor cells to produce
immortalized hybridomas cells producing a single antibody species.
Hybridomas cells are screened using immunological methods to select
lines that produce a specific antibody to the polypeptide fragment
of interest. Purification of antibodies from different sources can
be performed by a variety of antigen affinity or antibody affinity
columns or other chromatographic HPLC or FPLC methods.
[0052] The toxins described herein are quite unique in that the
toxins have functional activity, which is key to developing an
insect management strategy. In developing an insect management
strategy, it is possible to delay or circumvent the protein
degradation process by injecting a protein directly into an
organism, avoiding its digestive tract. In such cases, the protein
administered to the organism will retain its function until it is
denatured, non-specifically degraded, or eliminated by the immune
system in higher organisms. Injection into insects of an
insecticidal toxin has potential application only in the
laboratory, and then only on large insects which are easily
injected. The observation that the insecticidal protein toxins
herein described exhibits their toxic activity after oral ingestion
or contact with the toxins permits the development of an insect
management plan based solely on the ability to incorporate the
protein toxins into the insect diet. Such a plan could result in
the production of insect baits.
[0053] The Photorhabdus toxins may be administered to insects in a
purified form. The toxins may also be delivered in amounts from
about 1 to about 100 mg/liter of broth. This may vary upon
formulation condition, conditions of the inoculum source,
techniques for isolation of the toxin, and the like. The toxins may
be administered as an exudate secretion or cellular protein
originally expressed in a heterologous prokaryotic or eukaryotic
host. Bacteria are typically the hosts in which proteins are
expressed. Eukaryotic hosts could include but are not limited to
plants, insects and yeast. Alternatively, the toxins may be
produced in bacteria or transgenic plants in the field or in the
insect by a baculovirus vector. Typically the toxins will be
introduced to the insect by incorporating one or more of the toxins
into the insects' feed.
[0054] Complete lethality to feeding insects is useful but is not
required to achieve useful toxicity. If the insects avoid the toxin
or cease feeding, that avoidance will be useful in some
applications, even if the effects are sublethal. For example, if
insect resistant transgenic crop plants are desired, a reluctance
of insects to feed on the plants is as useful as lethal toxicity to
the insects since the ultimate objective is protection of the
plants rather than killing the insect.
[0055] There are many other ways in which toxins can be
incorporated into an insect's diet. As an example, it is possible
to adulterate the larval food source with the toxic protein by
spraying the food with a protein solution, as disclosed herein.
Alternatively, the purified protein could be genetically engineered
into an otherwise harmless bacterium, which could then be grown in
culture, and either applied to the food source or allowed to reside
in the soil in an area in which insect eradication was desirable.
Also, the protein could be genetically engineered directly into an
insect food source. For instance, the major food source of many
insect larvae is plant material.
[0056] By incorporating genetic material that encodes the
insecticidal properties of the Photorhabdus toxins into the genome
of a plant eaten by a particular insect pest, the adult or larvae
would die after consuming the food plant. Numerous members of the
monocotyledonous and dictyledenous genera have been transformed.
Transgenic agronmonic crops as well as fruits and vegetables are of
commercial interest. Such crops include but are not limited to
maize, rice, soybeans, canola, sunflower, alfalfa, sorghum, wheat,
cotton, peanuts, tomatoes, potatoes, and the like. Several
techniques exist for introducing foreign genetic material into
plant cells, and for obtaining plants that stably maintain and
express the introduced gene. Such techniques include acceleration
of genetic material coated onto microparticles directly into cells
(U.S. Pat. Nos. 4,945,050 to Cornell and 5,141,131 to DowElanco).
Plants may be transformed using Agrobacterium technology, see U.S.
Pat. Nos. 5,177,010 to University of Toledo, 5,104,310 to Texas
A&M, European Patent Application 0131624B1, European Patent
Applications 120516, 159418B1 and 176,112 to Schilperoot, U.S. Pat.
Nos. 5,149,645, 5,469,976, 5,464,763 and 4,940,838 and 4,693,976 to
Schilperoot, European Patent Applications 116718, 290799, 320500
all to MaxPlanck, European Patent Applications 604662 and 627752 to
Japan Tobacco, European Patent Applications 0267159, and 0292435
and U.S. Pat. No. 5,231,019 all to Ciba Geigy, U.S. Pat. Nos.
5,463,174 and 4,762,785 both to Calgene, and U.S. Pat. Nos.
5,004,863 and 5,159,135 both to Agracetus. Other transformation
technology includes whiskers technology, see U.S. Pat. Nos.
5,302,523 and 5,464,765 both to Zeneca. Electroporation technology
has also been used to transform plants, see WO 87/06614 to Boyce
Thompson Institute, U.S. Pat. Nos. 5,472,869 and 5,384,253 both to
Dekalb, WO9209696 and WO9321335 both to PGS. All of these
transformation patents and publications are incorporated by
reference. In addition to numerous technologies for transforming
plants, the type of tissue which is contacted with the foreign
genes may vary as well. Such tissue would include but would not be
limited to embryogenic tissue, callus tissue type I and II,
hypocotyl, meristem, and the like. Almost all plant tissues may be
transformed during dedifferentiation using appropriate techniques
within the skill of an artisan.
[0057] Another variable is the choice of a selectable marker. The
preference for a particular marker is at the discretion of the
artisan, but any of the following selectable markers may be used
along with any other gene not listed herein which could function as
a selectable marker. Such selectable markers include but are not
limited to aminoglycoside phosphotransferase gene of transposon Tn5
(Aph II) which encodes resistance to the antibiotics kanamycin,
neomycin and G418, as well as those genes which code for resistance
or tolerance to glyphosate; hygromycin; methotrexate;
phosphinothricin (bialophos); imidazolinones, sulfonylureas and
triazolopyrimidine herbicides, such as chlorosulfuron; bromoxynil,
dalapon and the like.
[0058] In addition to a selectable marker, it may be desirous to
use a reporter gene. In some instances a reporter gene may be used
without a selectable marker. Reporter genes are genes which are
typically not present or expressed in the recipient organism or
tissue. The reporter gene typically encodes for a protein which
provides for some phenotypic change or enzymatic property. Examples
of such genes are provided in K. Weising et al. Ann. Rev. Genetics,
22, 421 (1988), which is incorporated herein by reference. A
preferred reporter gene is the glucuronidase (GUS) gene.
[0059] Regardless of transformation technique, the gene is
preferably incorporated into a gene transfer vector adapted to
express the Photorhabdus toxins in the plant cell by including in
the vector a plant promoter. In addition to plant promoters,
promoters from a variety of sources can be used efficiently in
plant cells to express foreign genes. For example, promoters of
bacterial origin, such as the octopine synthase promoter, the
nopaline synthase promoter, the mannopine synthase promoter;
promoters of viral origin, such as the cauliflower mosaic virus
(35S and 19S), reengineered 35S, known as 35T (see PCT/US96/16582,
WO 97/13402 published Apr. 17, 1997, which is incorporated herein
by reference) and the like may be used. Plant promoters include,
but are not limited to ribulose-1,6-bisphosphate (RUBP) carboxylase
small subunit (ssu), beta-conglycinin promoter, phaseolin promoter,
ADH promoter, heat-shock promoters and tissue specific promoters.
Promoters may also contain certain enhancer sequence elements that
may improve the transcription efficiency. Typical enhancers include
but are not limited to Adh-intron 1 and Adh-intron 6. Constitutive
promoters may be used. Constitutive promoters direct continuous
gene expression in all cells types and at all times (e.g., actin,
ubiquitin, CaMV 35S). Tissue specific promoters are responsible for
gene expression in specific cell or tissue types, such as the
leaves or seeds (e.g., zein, oleosin, napin, ACP) and these
promoters may also be used. Promoters may also be are active during
a certain stage of the plants' development as well as active in
plant tissues and organs. Examples of such promoters include but
are not limited to pollen-specific, embryo specific, corn silk
specific, cotton fiber specific, root specific, seed endosperm
specific promoters and the like.
[0060] Under certain circumstances it may be desirable to use an
inducible promoter. An inducible promoter is responsible for
expression of genes in response to a specific signal, such as:
physical stimulus (heat shock genes); light (RUBP carboxylase);
hormone (Em); metabolites; and stress. Other desirable
transcription and translation elements that function in plants may
be used. Numerous plant-specific gene transfer vectors are known to
the art.
[0061] In addition, it is known that to obtain high expression of
bacterial genes in plants it is preferred to reengineer the
bacterial genes so that they are more efficiently expressed in the
cytoplasm of plants. Maize is one such plant where it is preferred
to reengineer the bacterial gene(s) prior to transformation to
increase the expression level of the toxin in the plant. One reason
for the reengineering is the very low G+C content of the native
bacterial gene(s) (and consequent skewing towards high A+T
content). This results in the generation of sequences mimicking or
duplicating plant gene control sequences that are known to be
highly A+T rich. The presence of some A+T-rich sequences within the
DNA of the gene(s) introduced into plants (e.g., TATA box regions
normally found in gene promoters) may result in aberrant
transcription of the gene(s). On the other hand, the presence of
other regulatory sequences residing in the transcribed mRNA (e.g.,
polyadenylation signal sequences (AAUAAA), or sequences
complementary to small nuclear RNAs involved in pre-mRNA splicing)
may lead to RNA instability. Therefore, one goal in the design of
reengineered bacterial gene(s), more preferably referred to as
plant optimized gene(s), is to generate a DNA sequence having a
higher G+C content, and preferably one close to that of plant genes
coding for metabolic enzymes. Another goal in the design of the
plant optimized gene(s) is to generate a DNA sequence that not only
has a higher G+C content, but by modifying the sequence changes,
should be made so as to not hinder translation.
[0062] An example of a plant that has a high G+C content is maize.
The table below illustrates how high the G+C content is in maize.
As in maize, it is thought that G+C content in other plants is also
high.
2TABLE 2 Compilation of G + C Contents of Protein Coding Regions of
Maize Genes Protein Class.sup.a Range % G + C Mean % G + C.sup.b
Metabolic Enzymes (40) 44.4-75.3 59.0 (8.0) Storage Proteins Group
I (23) 46.0-51.9 48.1 (1.3) Group II (13) 60.4-74.3 67.5 (3.2)
Group I + II (36) 46.0-74.3 .sup. 55.1 (9.6).sup.c Structural
Proteins (18) 48.6-70.5 63.6 (6.7) Regulatory Proteins (5)
57.2-68.9 62.0 (4.9) Uncharacterized Proteins (9) 41.5-70.3 64.3
(7.2) All Proteins (108) 44.4-75.3 60.8 (5.2) .sup.aNumber of genes
in class given in parentheses. .sup.bStandard deviations given in
parentheses. .sup.cCombined groups mean ignored in calculation of
overall mean.
[0063] For the data in Table 2, coding regions of the genes were
extracted from GenBank (Release 71) entries, and base compositions
were calculated using the MacVector.TM. program (IBI, New Haven,
Conn.) Intron sequences were ignored in the calculations. Group I
and II storage protein gene sequences were distinguished by their
marked difference in base composition.
[0064] Due to the plasticity afforded by the redundancy of the
genetic code (i.e., some amino acids are specified by more than one
codon), evolution of the genomes of different organisms or classes
or organisms has resulted in differential usage of redundant
codons. This "codon bias" is reflected in the mean base composition
of protein coding regions. For example, organisms with relatively
low G+C contents utilize codons having A or T in the third position
of redundant codons, whereas those having higher G+C contents
utilize codons having G or C in the third position. It is thought
that the presence of "minor" codons within a gene's mRNA may reduce
the absolute translation rate of that mRNA, especially when the
relative abundance of the charged tRNA corresponding to the minor
codon is low. An extension of this is that the diminution of
translation rate by individual minor codons would be at least
additive for multiple minor codons. Therefore, mRNAs having high
relative contents of minor codons would have correspondingly low
translation rates. This rate would be reflected by the synthesis of
low levels of the encoded protein.
[0065] In order to reengineer the bacterial gene(s), the codon bias
of the plant is determined. The codon bias is the statistical codon
distribution that the plant uses for coding its proteins. After
determining the bias, the percent frequency of the codons in the
gene(s) of interest is determined. The primary codons preferred by
the plant should be determined as well as the second and third
choice of preferred codons. The amino acid sequence of the protein
of interest is reverse translated so that the resulting nucleic
acid sequence codes for the same protein as the native bacterial
gene, but the resulting nucleic acid sequence corresponds to the
first preferred codons of the desired plant. The new sequence is
analyzed for restriction enzyme sites that might have been created
by the modification. The identified sites are further modified by
replacing the codons with second or third choice preferred codons.
Other sites in the sequence which could affect the transcription or
translation of the gene of interest are the exon:intron 5' or 3'
junctions, poly A addition signals, or RNA polymerase termination
signals. The sequence is further analyzed and modified to reduce
the frequency of TA or GC doublets. In addition to the doublets, G
or C sequence blocks that have more than about four residues that
are the same can affect transcription of the sequence. Therefore,
these blocks are also modified by replacing the codons of first or
second choice, etc. with the next preferred codon of choice. It is
preferred that the plant optimized gene(s) contains about 63% of
first choice codons, between about 22% to about 37% second choice
codons, and between 15% and 0% third choice codons, wherein the
total percentage is 100%. Most preferred the plant optimized
gene(s) contain about 63% of first choice codons, at least about
22% second choice codons, about 7.5% third choice codons, and about
7.5% fourth choice codons, wherein the total percentage is 100%.
The method described above enables one skilled in the art to modify
gene(s) that are foreign to a particular plant so that the genes
are optimally expressed in plants. The method is further
illustrated in application PCT/US96/16582, WO 97/13402 published
Apr. 17, 1997.
[0066] Thus, in order to design plant optimized gene(s) the amino
acid sequence of the toxins are reverse translated into a DNA
sequence, utilizing a nonredundant genetic code established from a
codon bias table compiled for the gene DNA sequence for the
particular plant being transformed. The resulting DNA sequence,
which is completely homogeneous in codon usage, is further modified
to establish a DNA sequence that, besides having a higher degree of
codon diversity, also contains strategically placed restriction
enzyme recognition sites, desirable base composition, and a lack of
sequences that might interfere with transcription of the gene, or
translation of the product mRNA.
[0067] It is theorized that bacterial genes may be more easily
expressed in plants if the bacterial genes are expressed in the
plastids. Thus, it may be possible to express bacterial genes in
plants, without optimizing the genes for plant expression, and
obtain high express of the protein. See U.S. Pat. Nos. 4,762,785;
5,451,513 and 5,545,817, which are incorporated herein by
reference.
[0068] One of the issues regarding commercial exploiting transgenic
plants is resistance management. This is of particular concern with
Bacillus thuringiensis toxins. There are numerous companies
commerically exploiting Bacillus thuringiensis and there has been
much concern about Bt toxins becoming resistant. One strataegy for
insect resistant management would be to combine the toxins produced
by Photorhabdus with toxins such as Bt, vegetative insect proteins
(Ciba Geigy) or other toxins. The combinations could be formulated
for a sprayable application or could be molecular combinations.
Plants could be transformed with Photorhabdus genes that produce
insect toxins and other insect toxin genes such as Bt as with other
insect toxin genes such as Bt.
[0069] European Patent Application 0400246A1 describes
transformation of 2 Bt in a plant, which could be any 2 genes.
Another way to produce a transgenic plant that contains more than
one insect resistant gene would be to produce two plants, with each
plant containing an insect resistant gene. These plants would be
backcrossed using traditional plant breeding techniques to produce
a plant containing more than one insect resistant gene.
[0070] In addition to producing a transformed plant containing
plant optimized gene(s), there are other delivery systems where it
may be desirable to reengineer the bacterial gene(s). Along the
same lines, a genetically engineered, easily isolated protein toxin
fusing together both a molecule attractive to insects as a food
source and the insecticidal activity of the toxin may be engineered
and expressed in bacteria or in eukaryotic cells using standard,
well-known techniques. After purification in the laboratory such a
toxic agent with "built-in" bait could be packaged inside standard
insect trap housings.
[0071] Another delivery scheme is the incorporation of the genetic
material of toxins into a baculovirus vector. Baculoviruses infect
particular insect hosts, including those desirably targeted with
the Photorhabdus toxins. Infectious baculovirus harboring an
expression construct for the Photorhabdus toxins could be
introduced into areas of insect infestation to thereby intoxicate
or poison infected insects.
[0072] Transfer of the insecticidal properties requires nucleic
acid sequences encoding the coding the amino acid sequences for the
Photorhabdus toxins integrated into a protein expression vector
appropriate to the host in which the vector will reside. One way to
obtain a nucleic acid sequence encoding a protein with insecticidal
properties is to isolate the native genetic material which produces
the toxins from Photorhabdus, using information deduced from the
toxin's amino acid sequence, large portions of which are set forth
below. As described below, methods of purifying the proteins
responsible for toxin activity are also disclosed.
[0073] Using N-terminal amino acid sequence data, such as set forth
below, one can construct oligonucleotides complementary to all, or
a section of, the DNA bases that encode the first amino acids of
the toxin. These oligonucleotides can be radiolabeled and used as
molecular probes to isolate the genetic material from a genomic
genetic library built from genetic material isolated from strains
of Photorhabdus. The genetic library can be cloned in plasmid,
cosmid, phage or phagemid vectors. The library could be transformed
into Escherichia coli and screened for toxin production by the
transformed cells using antibodies raised against the toxin or
direct assays for insect toxicity.
[0074] This approach requires the production of a battery of
oligonucleotides, since the degenerate genetic code allows an amino
acid to be encoded in the DNA by any of several three-nucleotide
combinations. For example, the amino acid arginine can be encoded
by nucleic acid triplets CGA, CGC, CGG, CGT, AGA, and AGG. Since
one cannot predict which triplet is used at those positions in the
toxin gene, one must prepare oligonucleotides with each potential
triplet represented. More than one DNA molecule corresponding to a
protein subunit may be necessary to construct a sufficient number
of oligonucleotide probes to recover all of the protein subunits
necessary to achieve oral toxicity.
[0075] From the amino acid sequence of the purified protein,
genetic materials responsible for the production of toxins can
readily be isolated and cloned, in whole or in part, into an
expression vector using any of several techniques well-known to one
skilled in the art of molecular biology. A typical expression
vector is a DNA plasmid, though other transfer means including, but
not limited to, cosmids, phagemids and phage are also envisioned.
In addition to features required or desired for plasmid
replication, such as an origin of replication and antibiotic
resistance or other form of a selectable marker such as the bar
gene of Streptomyces hygroscopicus or viridochromogenes, protein
expression vectors normally additionally require an expression
cassette which incorporates the cis-acting sequences necessary for
transcription and translation of the gene of interest. The
cis-acting sequences required for expression in prokaryotes differ
from those required in eukaryotes and plants.
[0076] A eukaryotic expression cassette requires a transcriptional
promoter upstream (5') to the gene of interest, a transcriptional
termination region such as a poly-A addition site, and a ribosome
binding site upstream of the gene of interest's first codon. In
bacterial cells, a useful transcriptional promoter that could be
included in the vector is the T7 RNA Polymerase-binding promoter.
Promoters, as previously described herein, are known to efficiently
promote transcription of mRNA. Also upstream from the gene of
interest the vector may include a nucleotide sequence encoding a
signal sequence known to direct a covalently linked protein to a
particular compartment of the host cells such as the cell
surface.
[0077] Insect viruses, or baculoviruses, are known to infect and
adversely affect certain insects. The affect of the viruses on
insects is slow, and viruses do not stop the feeding of insects.
Thus viruses are not viewed as being useful as insect pest control
agents. Combining the Photorhabdus toxins genes into a baculovirus
vector could provide an efficient way of transmitting the toxins
while increasing the lethality of the virus. In addition, since
different baculoviruses are specific to different insects, it may
be possible to use a particular toxin to selectively target
particularly damaging insect pests. A particularly useful vector
for the toxins genes is the nuclear polyhedrosis virus. Transfer
vectors using this virus have been described and are now the
vectors of choice for transferring foreign genes into insects. The
virus-toxin gene recombinant may be constructed in an orally
transmissible form. Baculoviruses normally infect insect victims
through the mid-gut intestinal mucosa. The toxin gene inserted
behind a strong viral coat protein promoter would be expressed and
should rapidly kill the infected insect.
[0078] In addition to an insect virus or baculovirus or transgenic
plant delivery system for the protein toxins of the present
invention, the proteins may be encapsulated using Bacillus
thuringiensis encapsulation technology such as but not limited to
U.S. Pat. Nos. 4,695,455; 4,695,462; 4,861,595 which are all
incorporated herein by reference. Another delivery system for the
protein toxins of the present invention is formulation of the
protein into a bait matrix, which could then be used in above and
below ground insect bait stations. Examples of such technology
include but are not limited to PCT Patent Application WO 93/23998,
which is incorporated herein by reference.
[0079] As is described above, it might become necessary to modify
the sequence encoding the protein when expressing it in a
non-native host, since the codon preferences of other hosts may
differ from that of Photorhabdus. In such a case, translation may
be quite inefficient in a new host unless compensating
modifications to the coding sequence are made. Additionally,
modifications to the amino acid sequence might be desirable to
avoid inhibitory cross-reactivity with proteins of the new host, or
to refine the insecticidal properties of the protein in the new
host. A genetically modified toxin gene might encode a toxin
exhibiting, for example, enhanced or reduced toxicity, altered
insect resistance development, altered stability, or modified
target species specificity.
[0080] In addition to the Photorhabdus genes encoding the toxins,
the scope of the present invention is intended to include related
nucleic acid sequences which encode amino acid biopolymers
homologous to the, toxin proteins and which retain the toxic effect
of the Photorhabdus proteins in insect species after oral
ingestion.
[0081] For instance, the toxins used in the present invention seem
to first inhibit larval feeding before death ensues. By
manipulating the nucleic acid sequence of Photorhabdus toxins or
its controlling sequences, genetic engineers placing the toxin gene
into plants could modulate its potency or its mode of action to,
for example, keep the eating-inhibitory activity while eliminating
the absolute toxicity to the larvae. This change could permit the
transformed plant to survive until harvest without having the
unnecessarily dramatic effect on the ecosystem of wiping out all
target insects. All such modifications of the gene encoding the
toxin, or of the protein encoded by the gene, are envisioned to
fall within the scope of the present invention.
[0082] Other envisioned modifications of the nucleic acid include
the addition of targeting sequences to direct the toxin to
particular parts of the insect larvae for improving its
efficiency.
[0083] Strains W-14, ATCC 55397, 43948, 43949, 43950, 43951, 43952
have been deposited in the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md. 20852 USA. Amino acid and nucleotide
sequence data for the W-14 native toxin (ATCC 55397) is presented
below. Isolation of the genomic DNA for the toxins from the
bacterial hosts is also exemplified herein. The other strains
identified herein have been deposited with the United States
Department of Agriculture, 1815 North University Drive, Peoria,
Ill. 61604.
[0084] Standard and molecular biology techniques were followed and
taught in the specification herein. Additional information may be
found in Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989),
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press;
Current Protocalsin Molecular Biology, ed. F. M. Ausubel et al.,
(1997), which are both incorporated herein by reference.
[0085] The following abbreviations are used throughout the
Examples: Tris=tris (hydroxymethyl) amino methane; SDS=sodium
dodecyl sulfate; EDTA=ethylenediaminetetraacetic acid,
IPTG=isopropylthio-B-galactoside,
X-gal=5-bromo-4-chloro-3-indoyl-B-D-galactoside,
CTAB=cetyltrimethylammon- ium bromide; kbp=kilobase pairs; dATP,
dCTP, dGTP, dTTP, I=2'-deoxynucleoside 5'-triphosphates of adenine,
cytosine, guanine, thymine, and inosine, respectively;
ATP=adenosine 5' triphosphate.
EXAMPLE 1
Purification of Toxin from Photorhabdus luminescens and
Demonstration of Toxicity after Oral Delivery of Purified Toxin
[0086] The insecticidal protein toxin of the present invention was
purified from Photorhabdus luminescens strain W-14, ATCC Accession
Number 55397. Stock cultures of Photorhabdus luminescens were
maintained on petri dishes containing 2% Proteose Peptone No. 3
(i.e., PP3, Difco Laboratories, Detroit Mich.) in 1.5% agar,
incubated at 25.degree. C. and transferred weekly. Colonies of the
primary form of the bacteria were inoculated into 200 ml of PP3
broth supplemented with 0.5% polyoxyethylene sorbitan mono-stearate
(Tween 60, Sigma Chemical Company, St. Louis, Mo.) in a one liter
flask. The broth cultures were grown for 72 hours at 30.degree. C.
on a rotary shaker. The toxin proteins can be recovered from
cultures grown in the presence or absence of Tween; however, the
absence of Tween can affect the form of the bacteria grown and the
profile of proteins produced by the bacteria. In the absence of
Tween, a variant shift occurs insofar as the molecular weight of at
least one identified toxin subunit shifts from about 200 kDa to
about 185 kDa.
[0087] The 72 hour cultures were centrifuged at 10,000.times.g for
30 minutes to remove cells and debris. The supernatant fraction
that contained the insecticidal activity was decanted and brought
to 50 mM K.sub.2HPO.sub.4 by adding an appropriate volume of 1.0 M
K.sub.2HPO.sub.4. The pH was adjusted to 8.6 by adding potassium
hydroxide. This supernatant fraction was then mixed with
DEAE-Sephacel (Pharmacia LKB Biotechnology) which had been
equilibrated with 50 mM K.sub.2HPO.sub.4. The toxic-activity was
adsorbed to the DEAE resin. This mixture was then poured into a
2.6.times.40 cm column and washed with 50 mM K.sub.2HPO.sub.4 at
room temperature at a flow rate of 30 ml/hr until the effluent
reached a steady baseline UV absorbance at 280 nm. The column was
then washed with 150 mM KCl until the effluent again reached a
steady 280 nm baseline. Finally the column was washed with 300 mM
KCl and fractions were collected.
[0088] Fractions containing the toxin were pooled and filter
sterilized using a 0.2 micron pore membrane filter. The toxin was
then concentrated and equilibrated to 100 mM KPO.sub.4, pH 6.9,
using an ultrafiltration membrane with a molecular weight cutoff of
100 kDa at 4.degree. C. (Centriprep 100, Amicon Division-W. R.
Grace and Company). A 3 ml sample of the toxin concentrate was
applied to the top of a 2.6.times.95 cm Sephacryl S-400 HR gel
filtration column (Pharmacia LKB Biotechnology). The eluent buffer
was 100 mM KPO.sub.4, pH 6.9, which was run at a flow rate of 17
ml/hr, at 4.degree. C. The effluent was monitored at 280 nm.
[0089] Fractions were collected and tested for toxic activity.
Toxicity of chromatographic fractions was examined in a biological
assay using Manduca sexta larvae. Fractions were either applied
directly onto the insect diet (Gypsy moth wheat germ diet, ICN
Biochemicals Division--ICN Biomedicals, Inc.) or administered by
intrahemocelic injection of a 5 .mu.l sample through the first
proleg of 4th or 5th instar larva using a 30 gauge needle. The
weight of each larva within a treatment group was recorded at 24
hour intervals. Toxicity was presumed if the insect ceased feeding
and died within several days of consuming treated insect diet or if
death occurred within 24 hours after injection of a fraction.
[0090] The toxic fractions were pooled and concentrated using the
Centriprep-100 and were then analyzed by HPLC using a 7.5
mm.times.60 cm TSK-GEL G-4000 SW gel permeation column with 100 mM
potassium phosphate, pH 6.9 eluent buffer running at 0.4 ml/min.
This analysis revealed the toxin protein to be contained within a
single sharp peak that eluted from the column with a retention time
of approximately 33.6 minutes. This retention time corresponded to
an estimated molecular weight of 1,000 kDa. Peak fractions were
collected for further purification while fractions not containing
this protein were discarded. The peak eluted from the HPLC absorbs
UV light at 218 and 280 nm but did not absorb at 405 nm. Absorbance
at 405 nm was shown to be an attribute of xenorhabdin antibiotic
compounds.
[0091] Electrophoresis of the pooled peak fractions in a
non-denaturing agarose gel (Metaphor Agarose, FMC BioProducts)
showed that two protein complexes are present in the peak. The peak
material, buffered in 50 mM Tris-HCl, pH 7.0, was separated on a
1.5% agarose stacking gel buffered with 100 mM Tris-HCl at pH 7.0
and 1.9% agarose resolving gel buffered with 200 mM Tris-borate at
pH 8.3 under standard buffer conditions (anode buffer 1M Tris-HCl,
pH 8.3; cathode buffer 0.025 M Tris, 0.192 M glycine). The gels
were run at 13 mA constant current at 15.degree. C. until the
phenol red tracking dye reached the end of the gel. Two protein
bands were visualized in the agarose gels using Coomassie brilliant
blue staining.
[0092] The slower migrating band was referred to as "protein band
1" and faster migrating band was referred to as "protein band 2."
The two protein bands were present in approximately equal amounts.
The Coomassie stained agarose gels were used as a guide to
precisely excise the two protein bands from unstained portions of
the gels. The excised pieces containing the protein bands were
macerated and a small amount of sterile water was added. As a
control, a portion of the gel that contained no protein was also
excised and treated in the same manner as the gel pieces containing
the protein. Protein was recovered from the gel pieces by
electroelution into 100 mM Tris-borate pH 8.3, at 100 volts
(constant voltage) for two hours. Alternatively, protein was
passively eluted from the gel pieces by adding an equal volume of
50 mM Tris-HCl, pH 7.0, to the gel pieces, then incubating at
30.degree. C. for 16 hours. This allowed the protein to diffuse
from the gel into the buffer, which was then collected.
[0093] Results of insect toxicity tests using HPLC-purified toxin
(33.6 min. peak) and agarose gel purified toxin demonstrated
toxicity of the extracts. Injection of 1.5 .mu.g of the HPLC
purified protein kills within 24 hours. Both protein bands 1 and 2,
recovered from agarose gels by passive elution or electroelution,
were lethal upon injection. The protein concentration estimated for
these samples was less than 50 ng/larva. A comparison of the weight
gain and the mortality between the groups of larvae injected with
protein bands 1 or 2 indicate that protein band 1 was more toxic by
injection delivery.
[0094] When HPLC-purified toxin was applied to larval diet at a
concentration of 7.5 .mu.g/larva, it caused a halt in larval weight
gain (24 larvae tested). The larvae begin to feed, but after
consuming only a very small portion of the toxin treated diet they
began to show pathological symptoms induced by the toxin and the
larvae cease feeding. The insect frass became discolored and most
larva showed signs of diarrhea. Significant insect mortality
resulted when several 5 .mu.g toxin doses were applied to the diet
over a 7-10 day period.
[0095] Agarose-separated protein band 1 significantly inhibited
larval weight gain at a dose of 200 ng/larva. Larvae fed similar
concentrations of protein band 2 were not inhibited and gained
weight at the same rate as the control larvae. Twelve larvae_were
fed eluted protein and 45 larvae were fed protein-containing
agarose pieces. These two sets of data indicate that protein band 1
was orally toxic to Manduca sexta. In this experiment it appeared
that protein band 2 was not toxic to Manduca sexta.
[0096] Further analysis of protein bands 1 and 2 by SDS-PAGE under
denaturing conditions showed that each band was composed of several
smaller protein subunits. Proteins were visualized by Coomassie
brilliant blue staining followed by silver staining to achieve
maximum sensitivity.
[0097] The protein subunits in the two bands were very similar.
Protein band 1 contains 8 protein subunits of 25.1, 56.2, 60.8,
65.6, 166, 171, 184 and 208 kDa. Protein band 2 had an identical
profile except that the 25.1, 60.8, and 65.6 kDa proteins were not
present. The 56.2, 60.8, 65.6, and 184 kDa proteins were present in
the complex of protein band 1 at approximately equal concentrations
and represent 80% or more of the total protein content of that
complex.
[0098] The native HPLC-purified toxin was further characterized as
follows. The toxin was heat labile in that after being heated to
60.degree. C. for 15 minutes it lost its ability to kill or to
inhibit weight gain when injected or fed to Manduca sexta larvae.
Assays were designed to detect lipase, type C phospholipase,
nuclease or red blood cell hemolysis activities and were performed
with purified toxin. None of these activities were present.
Antibiotic zone inhibition assays were also done and the purified
toxin failed to inhibit growth of Gram-negative or -positive
bacteria, yeast or filamentous fungi, indicating that the toxic is
not a xenorhabdin antibiotic.
[0099] The native HPLC-purified toxin was tested for ability to
kill insects other than Manduca sexta. Table 3 lists insects killed
by the HPLC-purified Photorhabdus luminescens toxin in this
study.
3TABLE 3 Insects Killed by Photorhabdus luminescens Toxin Genus and
Route of Common Name Order species Delivery Tobacco Lepidoptera
Manduca sexta Oral and horn worm injected Mealworm Coleoptera
Tenebrio molitor Oral Pharaoh ant Hymenoptera Monomorium pharoanis
Oral German Dictyoptera Blattella germanica Oral and cockroach
injected Mosquito Diptera Aedes aegypti Oral
[0100] Further Characterization of the High Molecular Weight Toxin
Complex
[0101] In yet further analysis, the toxin protein complex was
subjected to further characterization from W-14 growth medium. The
culture conditions and initial purification steps through the S-400
HR column were identical to those described above. After isolation
of the high molecular weight toxin complex from the S-400 HR column
fractions, the toxic fractions were equilibrated with 10 mM
Tris-HCl, pH 8.6, and concentrated in the centriplus 100 (Amicon)
concentrators. The protein toxin complex was then applied to a weak
anion exchange (WAX) column, Vydac 301VPH575 (Hesparia, Calif.), at
a flow rate of 0.5 ml/min. The proteins were eluted with a linear
potassium chloride gradient, 0-250 mM KCl, in 10 mM Tris-HCl pH 8.6
for 50 min. Eight protein peaks were detected by absorbance at 280
nm.
[0102] Bioassays using neonate southern corn rootworm (Diabrotica
undecimpunctata howardi, SCR) larvae and tobacco horn worm (Manduca
sexta, THW) were performed on all fractions eluted from the HPLC
column. THW were grown on Gypsy Moth wheat germ diet (ICN) at
25.degree. C. with a 16 hr light 8 hr dark cycle. SCR were grown on
Southern Corn Rootworm Larval Insecta-Diet (BioServ) at 25.degree.
C. with a 16 hr light/8 hr dark cycle.
[0103] The highest mortality for SCR and THW larvae was observed
for peak 6, which eluted with ca. 112 mM to 132 mM KCl. SDS-PAGE
analysis of peak 6 showed predominant peptides of 170 kDa, 66 kDa,
63 kDa, 59.5 kDa and 31 kDa. Western blot analysis was performed on
peak 6 protein fraction with a mixture of polyclonal antibodies
made against TcaA.sub.ii-syn, TcaA.sub.iii-syn, TcaB.sub.ii-syn,
TcaC-syn, and TcbA.sub.ii-syn peptides (described in Example 21)
and C5F2, a monoclonal antibody against the TcbA.sub.iii peptide.
Peak 6 contained immuno-reactive bands of 170 kDa, 90 kDa, 66 kDa,
59.5 kDa and 31 kDa. These are very close to the predicted sizes
for the TcaC (166 kDa), TcaA.sub.ii+TcaA.sub.iii (92 kDa),
TcaA.sub.iii (66 kDa), TcaB.sub.ii (60 kDa) and TcaA.sub.ii (25
kDa), respectively. Peak 6 which was further analyzed by native
agarose gel electrophoresis, as described herein, migrated as a
single band with similar mobility to that of band 1.
[0104] The protein concentration of the purified peak 6 toxin
protein was determined using the BCA reagents (Pierce). Dilutions
of the protein were made in 10 mM Tris, pH 8.6 and applied to the
diet bioassays. After 240 hours all neonate larvae on diet
bioassays that received 450 ng or greater of the peak 6 protein
fraction were dead. The group of larvae that received 90 ng of the
same fraction had 40% mortality. After 240 hrs the survivors that
received 90 ng and 20 ng of peak 6 protein fraction were ca. 10%
and 70%, respectively, of the control weight.
EXAMPLE 2
Insecticide Utility
[0105] The Photorhabdus luminescens utility and toxicity were
further characterized. Photorhabdus luminescens (strain W-14)
culture broth was produced as follows. The production medium was 2%
Bacto Proteose Peptone.RTM. Number 3 (PP3, Difco Laboratories,
Detroit, Mich.) in Milli-Q.RTM. deionized water. Seed culture
flasks consisted of 175 ml medium placed in a 500 ml tribaffled
flask with a Delong neck, covered with a Kaput and autoclaved for
20 minutes, T=250.degree. F. Production flasks consisted of 500 mls
in a 2.8 liter 500 ml tribaffled flask with a Delong neck, covered
by a Shin-etsu silicon foam closure. These were autoclaved for 45
minutes, T=250.degree. F. The seed culture was incubated at
28.degree. C. at 150 rpm in a gyrotory shaking incubator with a 2
inch throw. After 16 hours of growth, 1% of the seed culture was
placed in the production flask which was allowed to grow for 24
hours before harvest. Production of the toxin appears to be during
log phase growth. The microbial broth was transferred to a 1 L
centrifuge bottle and the cellular biomass was pelleted (30 minutes
at 2500 RPM at 4.degree. C., [R.C.F.=about 1600] HG-4L Rotor RC3
Sorval centrifuge, Dupont, Wilmington, Del.). The primary broth was
chilled at 4.degree. C. for 8-16 hours and recentrifuged at least 2
hours (conditions above) to further clarify the broth by removal of
a putative mucopolysaccharide which precipitated upon standing. (An
alternative processing method combined both steps and involved the
use of a 16 hour clarification centrifugation, same conditions as
above.) This broth was then stored at 4.degree. C. prior to
bioassay or filtration.
[0106] Photorhabdus culture broth and protein toxin(s) purified
from this broth showed activity (mortality and/or growth
inhibition, reduced adult emergence) against a number of insects.
More specifically, the activity is seen against corn rootworm
(larvae and adult), Colorado potato beetle, and turf grubs, which
are members of the insect order Coleoptera. Other members of the
Coleoptera include wireworms, pollen beetles, flea beetles, seed
beetles and weevils. Activity has also been observed against aster
leafhopper, which is a member of the order, Homoptera. Other
members of the Homoptera include planthoppers, pear pyslla, apple
sucker, scale insects, whiteflies, and spittle bugs, as well as
numerous host specific aphid species. The broth and purified
fractions are also active against beet armyworm, cabbage looper,
black cutworm, tobacco budworm, European corn borer, corn earworm,
and codling moth, which are members of the order Lepidoptera. Other
typical members of this order are clothes moth, Indian mealmoth,
leaf rollers, cabbage worm, cotton bollworm, bagworm, Eastern tent
caterpillar, sod webworm, and fall armyworm. Activity is also seen
against fruitfly and mosquito larvae, which are members of the
order Diptera. Other members of the order Diptera are pea midge,
carrot fly, cabbage root fly, turnip root fly, onion fly, crane
fly, house fly, and various mosquito species. Activity is seen
against carpenter ant and Argentine ant, which are members of the
order that also includes fire ants, oderous house ants, and little
black ants.
[0107] The broth/fraction is useful for reducing populations of
insects and were used in a method of inhibiting an insect
population. The method may comprise applying to a locus of the
insect an effective insect inactivating amount of the active
described. Results are reported in Table 4.
[0108] Activity against corn rootworm larvae was tested as follows.
Photorhabdus culture broth (filter sterilized, cell-free) or
purified HPLC fractions were applied directly to the surface (about
1.5 cm.sup.2) of 0.25 ml of artificial diet in 30 .mu.l aliquots
following dilution in control medium or 10 mM sodium phosphate
buffer, pH 7.0, respectively. The diet plates were allowed to
air-dry in a sterile flow-hood and the wells were infested with
single, neonate Diabrotica undecimpunctata howardi (Southern corn
rootworm, SCR) hatched from sterilized eggs, with second instar SCR
grown on artificial diet or with second instar Diabrotica virgifera
virgifera (Western corn rootworm, WCR) reared on corn seedlings
grown in Metromix.RTM.. Second instar larvae were weighed prior to
addition to the diet. The plates were sealed, placed in a
humidified growth chamber and maintained at 27.degree. C. for the
appropriate period (4 days for neonate and adult SCR, 2-5 days for
WCR larvae, 7-14 days for second instar SCR). Mortality and weight
determinations were scored as indicated. Generally, 16 insects per
treatment were used in all studies. Control mortalities were as
follows: neonate larvae, <5%, adult beetles, 5%.
[0109] Activity against Colorado potato beetle was tested as
follows. Photorhabdus culture broth or control medium was applied
to the surface (about 2.0 cm.sup.2) of 1.5 ml of standard
artificial diet held in the wells of a 24-well tissue culture
plate. Each well received 50 .mu.l of treatment and was allowed to
air dry. Individual second instar Colorado potato beetle
(Leptinotarsa decemlineata, CPB) larvae were then placed onto the
diet and mortality was scored after 4 days. Ten larvae per
treatment were used in all studies. Control mortality was 3.3%.
[0110] Activity against Japanese beetle grubs and beetles was
tested as follows. Turf grubs (Popillia japonica, 2-3rd instar)
were collected from infested lawns and maintained in the laboratory
in soil/peat mixture with carrot slices added as additional diet.
Turf beetles were pheromone-trapped locally and maintained in the
laboratory in plastic containers with maple leaves as food.
Following application of undiluted Photorhabdus culture broth or
control medium to corn rootworm artificial diet (30 .mu.l/1.54
cm.sup.2, beetles) or carrot slices (larvae), both stages were
placed singly in a diet well and observed for any mortality and
feeding. In both cases there was a clear reduction in the amount of
feeding (and feces production) observed.
[0111] Activity against mosquito larvae was tested as follows. The
assay was conducted in a 96-well microtiter plate. Each well
contained 200 .mu.l of aqueous solution (Photorhabdus culture
broth, control medium or H.sub.2O) and approximately 20, 1-day old
larvae (Aedes aegypti). There were 6 wells per treatment. The
results were read at 2 hours after infestation and did not change
over the three day observation period. No control mortality was
seen.
[0112] Activity against fruitflies was tested as follows. Purchased
Drosophila melanogaster medium was prepared using 50% dry medium
and a 50% liquid of either water, control medium or Photorhabdus
culture broth. This was accomplished by placing 8.0 ml of dry
medium in each of 3 rearing vials per treatment and adding 8.0 ml
of the appropriate liquid. Ten late instar Drosophila melanogaster
maggots were then added to each vial. The vials were held on a
laboratory bench, at room temperature, under fluorescent ceiling
lights. Pupal or adult counts were made after 3, 7 and 10 days of
exposure. Incorporation of Photorhabdus culture broth into the diet
media for fruitfly maggots caused a slight (17%) but significant
reduction in day-10 adult emergence as compared to water and
control medium (3% reduction).
[0113] Activity against aster leafhopper was tested as follows. The
ingestion assay for aster leafhopper (Macrosteles severini) is
designed to allow ingestion of the active without other external
contact. The reservoir for the active/"food" solution is made by
making 2 holes in the center of the bottom portion of a 35.times.10
mm Petri dish. A 2 inch Parafilm M.RTM. square is placed across the
top of the dish and secured with an "O" ring. A 1 oz. plastic cup
is then infested with approximately 7 leafhoppers and the reservoir
is placed on top of the cup, Parafilm down. The test solution is
then added to the reservoir through the holes. In tests using
undiluted Photorhabdus culture broth, the broth and control medium
were dialyzed against water to reduce control mortality. Mortality
is reported at day 2 where 26.5% control mortality was seen. In the
tests using purified fractions (200 mg protein/ml) a final
concentration of 5% sucrose was used in all treatments to improve
survivability of the aster leafhoppers. The assay was held in an
incubator at 28.degree. C., 70% RH with a 16/8 photoperiod. The
assay was graded for mortality at 72 hours. Control mortality was
5.5%.
[0114] Activity against Argentine ants was tested as follows. A 1.5
ml aliquot of 100% Photorhabdus culture broth, control medium or
water was pipetted into 2.0 ml clear glass vials. The vials were
plugged with a piece of cotton dental wick that was moistened with
the appropriate treatment. Each vial was placed into a separate
60.times.16 mm Petri dish with 8 to 12 adult Argentine ants
(Linepithema humile). There were three replicates per treatment.
Bioassay plates were held on a laboratory bench, at room
temperature under fluorescent ceiling lights. Mortality readings
were made after 5 days of exposure. Control mortality was 24%.
[0115] Activity against carpenter ant was tested as follows. Black
carpenter ant workers (Camponotus pennsylvanicus) were collected
from trees on DowElanco property in Indianapolis, Ind. Tests with
Photorhabdus culture broth were performed as follows. Each plastic
bioassay container (71/8".times.3") held fifteen workers, a paper
harborage and 10 ml of broth or control media in a plastic shot
glass. A cotton wick delivered the treatment to the ants through a
hole in the shot glass lid. All treatments contained 5% sucrose.
Bioassays were held in the dark at room temperature and graded at
19 days. Control mortality was 9%. Assays delivering purified
fractions utilized artificial ant diet mixed with the treatment
(purified fraction or control solution) at a rate of 0.2 ml
treatment/2.0 g diet in a plastic test tube. The final protein
concentration of the purified fraction was less than 10 .mu.g/g
diet. Ten ants per treatment, a water source, harborage and the
treated diet were placed in sealed plastic containers and
maintained in the dark at 27.degree. C. in a humidified incubator.
Mortality was scored at day 10. No control mortality was seen.
[0116] Activity against various lepidopteran larvae was tested as
follows. Photorhabdus culture broth or purified fractions were
applied directly to the surface (about 1.5 cm.sup.2) of 0.25 ml of
standard artificial diet in 30 .mu.l aliquots following dilution in
control medium or 10 mM sodium phosphate buffer, pH 7.0,
respectively. The diet plates were allowed to air-dry in a sterile
flow-hood and the wells were infested with single, neonate larva.
European corn borer (Ostrinia nubilalis) and corn earworm
(Helicoverpa zea) eggs were supplied from commercial sources and
hatched in-house, whereas beet armyworm (Spodoptera exigua),
cabbage looper (Trichoplusia ni), tobacco budworm (Heliothis
virescens), codling moth (Laspeyresia pomonella) and black cutworm
(Agrotis epsilon) larvae were supplied internally. Following
infestation with larvae, the diet plates were sealed, placed in a
humidified growth chamber and maintained in the dark at 27.degree.
C. for the appropriate period. Mortality and weight determinations
were scored at days 5-7 for Photorhabdus culture broth and days 4-7
for the purified fraction. Generally, 16 insects per treatment were
used in all studies. Control mortality ranged from 4-12.5% for
control medium and was less than 10% for phosphate buffer.
4TABLE 4 Effect of Photorhabdus luminescens (Strain W-14) Culture
Broth and Purified Toxin Fraction on Mortality and Growth
Inhibition of Different Insect Orders/Species Broth Purified
Fraction Insect Order/Species % Mort. % G.I. % Mort. % G.I.
COLEOPTERA Corn Rootworm Southern/neonate larva 100 na 100 na
Southern/2.sup.nd instar na 38.5 nt nt Southern/adult 45 nt nt nt
Western/2.sup.nd instar na 35 nt nt Colorado Potato Beetle 93 nt nt
nt 2.sup.nd instar Turf Grub na a.f. nt nt 3.sup.rd instar na a.f.
nt nt adult DIPTERA Fruit Fly (adult emergence) 17 nt nt nt
Mosquito larvae 100 na nt nt HOMOPTERA Aster Leafhopper 96.5 na 100
na HYMENOPTERA Argentine Ant 75 na nt na Carpenter Ant 71 na 100 na
LEPIDOPTERA Beet Armyworm 12.5 36 18.75 41.4 Black Cutworm nt nt 0
71.2 Cabbage Looper nt nt 21.9 66.8 Codling Moth nt nt 6.25 45.9
Corn Earworm 56.3 94.2 97.9 na European Corn Borer 96.7 98.4 100 na
Tobacco Budworm 13.5 52.5 19.4 85.6 Mort. = mortality, G.I. =
growth inhibition, na = not applicable, nt = not tested, a.f. =
anti-feedant
EXAMPLE 3
Insecticide Utility upon Soil Application
[0117] Photorhabdus luminescens (strain W-14) culture broth was
shown to be active against corn rootworm when applied directly to
soil or a soil-mix (Metromix.RTM.). Activity against neonate SCR
and WCR in Metromix.RTM. was tested as follows (Table 5). The test
was run using corn seedlings (United Agriseeds brand CL614) that
were germinated in the light on moist filter paper for 6 days.
After roots were approximately 3-6 cm long, a single
kernel/seedling was planted in a 591 ml clear plastic cup with 50
gm of dry Metromix.RTM.. Twenty neonate SCR or WCR were then placed
directly on the roots of the seedling and covered with
Metromix.RTM.. Upon infestation, the seedlings were then drenched
with 50 ml total volume of a diluted broth solution. After
drenching, the cups were sealed and left at room temperature in the
light for 7 days. Afterwards, the seedlings were washed to remove
all Metromix.RTM. and the roots were excised and weighed. Activity
was rated as the percentage of corn root remaining relative to the
control plants and as leaf damage induced by feeding. Leaf damage
was scored visually and rated as either -, +, ++, or +++, with -
representing no damage and +++ representing severe damage.
[0118] Activity against neonate SCR in soil was tested as follows
(Table 6). The test was run using corn seedlings (United Agriseeds
brand CL614) that were germinated in the light on moist filter
paper for 6 days. After the roots were approximately 3-6 cm long, a
single kernel/seedling was planted in a 591 ml clear plastic cup
with 150 gm of soil from a field in Lebanon, Ind. planted the
previous year with corn. This soil had not been previously treated
with insecticides. Twenty neonate SCR were then placed directly on
the roots of the seedling and covered with soil. After infestation,
the seedlings were drenched with 50 ml total volume of a diluted
broth solution. After drenching, the unsealed cups were incubated
in a high relative humidity chamber (80%) at 78.degree. F.
Afterwards, the seedlings were washed to remove all soil and the
roots were excised and weighed. Activity was rated as the
percentage of corn root remaining relative to the control plants
and as leaf damage induced by feeding. Leaf damage was scored
visually and rated as either -, +, ++, or +++, with - representing
no damage and +++ representing severe damage.
5TABLE 5 Effect of Photorhabdus luminescens (Strain W-14) Culture
Broth on Rootworm Larvae after Post-Infestation Drenching (Metromix
.RTM.) Treatment Larvae Leaf Damage Root Weight (g) % Southern Corn
Rootworm Water - - 0.4916 .+-. 0.023 100 Medium (2.0% v/v) - -
0.4416 .+-. 0.029 100 Broth (6.25% v/v) - - 0.4641 .+-. 0.081 100
Water + +++ 0.1410 .+-. 0.006 28.7 Media (2.0% v/v) + +++ 0.1345
.+-. 0.028 30.4 Broth (1.56% v/v) + - 0.4830 .+-. 0.031 104 Western
Corn Rootworm Water - - 0.4446 .+-. 0.019 100 Broth (2.0% v/v) - -
0.4069 .+-. 0.026 100 Water + - 0.2202 .+-. 0.015 49 Broth (2.0%
v/v) + - 0.3879 .+-. 0.013 95
[0119]
6TABLE 6 Effect of Photorhabdus luminescens (Strain W-14) Culture
Broth on Southern Corn Rootworm Larvae after Post-Infestation
Drenching (Soil) Treatment Larvae Leaf Damage Root Weight(g) %
Water - - 0.2148 .+-. 0.014 100 Broth (50% v/v) - - 0.2260 .+-.
0.016 103 Water + +++ 0.0916 .+-. 0.009 43 Broth (50% v/v) + -
0.2428 .+-. 0.032 113
[0120] Activity of Photorhabdus luminescens (strain W-14) culture
broth against second instar turf grubs in Metromix.RTM. was
observed in tests conducted as follows (Table 7) - Approximately 50
gm of dry Metromix.RTM. was added to a 591 ml clear plastic cup.
The Metromix.RTM. was then drenched with 50 ml total volume of a
50% (v/v) diluted Photorhabdus broth solution. The dilution of
crude broth was made with water, with 50% broth being prepared by
adding 25 ml of crude broth to 25 ml of water for 50 ml total
volume. A 1% (w/v) solution of proteose peptone #3 (PP3), which is
a 50% dilution of the normal media concentration, was used as a
broth control. After drenching, five second instar turf grubs were
placed on the top of the moistened Metromix.RTM.. Healthy turf grub
larvae burrowed rapidly into the Metromix.RTM.. Those larvae that
did not burrow within 1 h were removed and replaced with fresh
larvae. The cups were sealed and placed in a 28.degree. C.
incubator, in the dark. After seven days, larvae were removed from
the Metromix.RTM. and scored for mortality. Activity was rated the
percentage of mortality relative to control.
7TABLE 7 Effect of Photorhabdus luminescens (Strain W-14) Culture
Broth on Turf Grub after Pre-Infestation Drenching (Metromix .RTM.)
Treatment Mortality* Mortality % Water 7/15 47 Control medium 12/19
63 (1.0% w/v) Broth 17/20 85 (50% v/v) *expressed as a ratio of
dead/living larvae
EXAMPLE 4
Insecticide Utility Upon Leaf Application
[0121] Activity of Photorhabdus broth against European corn borer
was seen when the broth was applied directly to the surface of
maize leaves (Table 8). In these assays Photorhabdus broth was
diluted 100-fold with culture medium and applied manually to the
surface of excised maize leaves at a rate of about 6.0
.mu.l/cm.sup.2 of leaf surface. The leaves were air dried and cut
into equal sized strips approximately 2.times.2 inches. The leaves
were rolled, secured with paper clips and placed in 1 oz plastic
shot glasses with 0.25 inch of 2% agar on the bottom surface to
provide moisture. Twelve neonate European corn borers were then
placed onto the rolled leaf and the cup was sealed. After
incubation for 5 days at 27.degree. C. in the dark, the samples
were scored for feeding damage and recovered larvae.
8TABLE 8 Effect of Photorhabdus luminescens (Strain W-14) Culture
Broth on European Corn Borer Larvae Following Pre-Infestation
Application to Excised Maize Leaves Treatment Leaf Damage Larvae
Recovered Weight (mg) Water Extensive 55/120 0.42 mg Control Medium
Extensive 40/120 0.50 mg Broth (1.0% v/v) Trace 3/120 0.15 mg
[0122] Activity of the culture broth against neonate tobacco
budworm (Heliothis virescens) was demonstrated using a leaf dip
methodology. Fresh cotton leaves were excised from the plant and
leaf disks were cut with an 18.5 mm cork-borer. The disks were
individually emersed in control medium (PP3) or Photorhabdus
luminescens (strain W-14) culture broth which had been concentrated
approximately 10-fold using an Amicon (Beverly, Mass.), Proflux M12
tangential filtration system with a 10 kDa filter. Excess liquid
was removed and a straightened paper clip was placed through the
center of the disk. The paper clip was then wedged into a plastic,
1.0 oz shot glass containing approximately 2.0 ml of 1% Agar. This
served to suspend the leaf disk above the agar. Following drying of
the leaf disk, a single neonate tobacco budworm larva was placed on
the disk and the cup was capped. The cups were then sealed in a
plastic bag and placed in a darkened, 27.degree. C. incubator for 5
days. At this time the remaining larvae and leaf material were
weighed to establish a measure of leaf damage (Table 9).
9TABLE 9 Effect of Photorhabdus luminescens (Strain W-14) Culture
Broth on Tobacco Budworm Neonates in a Cotton-Leaf Dip Assay Final
Weights (mg) Treatment Leaf Disk Larvae Control leaves 55.7 .+-.
1.3 na* Control Medium 34.0 .+-. 2.9 4.3 .+-. 0.91 Photorhabdus
broth 54.3 .+-. 1.4 0.0** *not applicable, **no live larvae
found
EXAMPLE 5, Part A
Characterization of Toxin Peptide Components
[0123] In a subsequent analysis, the toxin protein subunits of the
bands isolated as in Example 1 were resolved on a 7% SDS
polyacrylamide electrophoresis gel with a ratio of 30:0.8
(acrylamide:BIS-acrylamide). This gel matrix facilitates better
resolution of the larger proteins. The gel system used to estimate
the Band 1 and Band 2 subunit molecular weights in Example 1 was an
18% gel with a ratio of 38:0.18 (acrylamide:BIS-acrylamide), which
allowed for a broader range of size separation, but less resolution
of higher molecular weight components.
[0124] In this analysis, 10, rather than 8, protein bands were
resolved. Table 10 reports the calculated molecular weights of the
10 resolved bands, and directly compares the molecular weights
estimated under these conditions to those of the prior example. It
is not surprising that additional bands were detected under the
different separation conditions used in this example. Variations
between the prior and new estimates of molecular weight are also to
be expected given the differences in analytical conditions. In the
analysis of this example, it is thought that the higher molecular
weight estimates are more accurate than in Example 1, as a result
of improved resolution. However, these are estimates based on SDS
PAGE analysis, which are typically not analytically precise and
result in estimates of peptides and which may have been further
altered due to post- and co-translational modifications.
[0125] Amino acid sequences were determined for the N-terminal
portions of five of the 10 resolved peptides. Table 10 + correlates
the molecular weight of the proteins and the identified sequences.
In SEQ ID No:2, certain analyses suggest that the proline at
residue 5 may be an asparagine (asn). In SEQ ID NO:3, certain
analyses suggest that the amino acid residues at positions 13 and
14 are both arginine (arg). In SEQ ID NO:4, certain analyses
suggest that the amino acid residue at position 6 may be either
alanine (ala) or serine (ser). In SEQ ID NO:5, certain analyses
suggest that the amino acid residue at position 3 may be aspartic
acid (asp).
10TABLE 10 ESTIMATE NEW ESTIMATE* SEQ. LISTING 208 200.2 kDa SEQ ID
NO: 1 184 175.0 kDa SEQ ID NO: 2 65.6 68.1 kDa SEQ ID NO: 3 60.8
65.1 kDa SEQ ID NO: 4 56.2 58.3 kDa SEQ ID NO: 5 25.1 23.2 kDa SEQ
ID NO: 15 *New estimates are based on SDS PAGE and are not based on
gene sequences. SDS PAGE is not analytically precise.
EXAMPLE 5, Part B
Characterization of Toxin Peptide Components
[0126] New N-terminal sequence, SEQ ID NO:15, Ala Gln Asp Gly Asn
Gln Asp Thr Phe Phe Ser Gly Asn Thr, was obtained by further
N-terminal sequencing of peptides isolated from Native
HPLC-purified toxin as described in Example 5, Part A, above. This
peptide comes from the tcaA gene. The peptide labeled TcaA.sub.ii,
starts at position 254 and goes to position 491, where the
TcaA.sub.iii peptide starts, SEQ ID NO:4. The estimated size of the
peptide based on the gene sequence is 25,240 Da.
EXAMPLE 6
Characterization of Toxin Peptide Components
[0127] In yet another analysis, the toxin protein complex was
re-isolated from the Photorhabdus luminescens growth medium (after
culture without Tween) by performing a 10%-80% ammonium sulfate
precipitation followed by an ion exchange chromatography step (Mono
Q) and two molecular sizing chromatography steps. These conditions
were like those used in Example 1. During the first molecular
sizing step, a second biologically active peak was found at about
100.+-.10 kDa. Based upon protein measurements, this fraction was
20-50 fold less active than the larger, or primary, active peak of
about 860.+-.100 kDa (native). During this isolation experiment, a
smaller active peak of about 325.+-.50 kDa that retained a
considerable portion of the starting biological activity was also
resolved. It is thought that the 325 kDa peak is related to or
derived from the 860 kDa peak.
[0128] A 56 kDa protein was resolved in this analysis. The
N-terminal sequence of this protein is presented in SEQ ID NO:6. It
is noteworthy that this protein shares significant identity and
conservation with SEQ ID NO:5 at the N-terminus, suggesting that
the two may be encoded by separate members of a gene family and
that the proteins produced by each gene are sufficiently similar to
both be operable in the insecticidal toxin complex.
[0129] A second, prominent 185 kDa protein was consistently present
in amounts comparable to that of protein 3 from Table 10, and may
be the same protein or protein fragment. The N-terminal sequence of
this 185 kDa protein is shown at SEQ ID NO:7.
[0130] Additional N-terminal amino acid sequence data were also
obtained from isolated proteins. None of the determined N-terminal
sequences appear identical to a protein identified in Table 10.
Other proteins were present in isolated preparation. One such
protein has an estimated molecular weight of 108 kDa and an
N-terminal terminal sequence as shown in SEQ ID NO:8. A second such
protein has an estimated molecular weight of 80 kDa and an
N-terminal sequence as shown in SEQ ID NO:9.
[0131] When the protein material in the approximately 325 kDa
active peak was analyzed by size, bands of approximately 51, 31,
28, and 22 kDa were observed. As in all cases in which a molecular
weight was determined by analysis of electrophoretic mobility,
these molecular weights were subject to error effects introduced by
buffer ionic strength differences, electrophoresis power
differences, and the like. One of ordinary skill would understand
that definitive molecular weight values cannot be determined using
these standard methods and that each was subject to variation. It
was hypothesized that proteins of these sizes are degradation
products of the larger protein species (of approximately 200 kDa
size) that were observed in the larger primary toxin complex.
[0132] Finally, several preparations included a protein having the
N-terminal sequence shown in SEQ ID NO:10. This sequence was
strongly homologous to known chaperonin proteins, accessory
proteins known to function in the assembly of large protein
complexes. Although the applicants could not ascribe such an
assembly function to the protein identified in SEQ ID NO:10, it was
consistent with the existence of the described toxin protein
complex that such a chaperonin protein could be involved in its
assembly. Moreover, although such proteins have not directly been
suggested to have toxic activity, this protein may be important to
determining the overall structural nature of the protein toxin, and
thus, may contribute to the toxic activity or durability of the
complex in vivo after oral delivery.
[0133] Subsequent analysis of the stability of the protein toxin
complex to proteinase K was undertaken. It was determined that
after 24 hour incubation of the complex in the presence of a
10-fold molar excess of proteinase K, activity was virtually
eliminated (mortality on oral application dropped to about 5%).
These data confirm the proteinaceous nature of the toxin.
[0134] The toxic activity was also retained by a dialysis membrane,
again confirming the large size of the native toxin complex.
EXAMPLE 7
Isolation, Characterization and Partial Amino Acid Sequencing of
Photorhabdus Toxins
[0135] Isolation and N-Terminal Amino Acid Sequencing
[0136] In a set of experiments conducted in parallel to Examples 5
and 6, ammonium sulfate precipitation of Photorhabdus proteins was
performed by adjusting Photorhabdus broth, typically 2-3 liters, to
a final concentration of either 10% or 20% by the slow addition of
ammonium sulfate crystals. After stirring for 1 hour at 4.degree.
C., the material was centrifuged at 12,000.times.g for 30 minutes.
The supernatant was adjusted to 80% ammonium sulfate, stirred at
4.degree. C. for 1 hour, and centrifuged at 12,000.times.g for 60
minutes. The pellet was resuspended in one-tenth the volume of 10
mM Na.sub.2.PO.sub.4, pH 7.0 and dialyzed against the same
phosphate buffer overnight at 4.degree. C. The dialyzed material
was centrifuged at 12,000.times.g for 1 hour prior to ion exchange
chromatography.
[0137] A HR 16/50 Q Sepharose (Pharmacia) anion exchange column was
equilibrated with 10 mM Na.sub.2.PO.sub.4, pH 7.0. Centrifuged,
dialyzed ammonium sulfate pellet was applied to the Q Sepharose
column at a rate of 1.5 ml/min and washed extensively at 3.0 ml/min
with equilibration buffer until the optical density (O.D. 280)
reached less than 0.100. Next, either a 60 minute NaCl gradient
ranging from 0 to 0.5 M at 3 ml/min, or a series of step elutions
using 0.1 M, 0.4 M and finally 1.0 NaCl for 60 minutes each was
applied to the column. Fractions were pooled and concentrated using
a Centriprep 100. Alternatively, proteins could be eluted by a
single 0.4 M NaCl wash without prior elution with 0.1 M NaCl.
[0138] Two milliliter aliquots of concentrated Q Sepharose samples
were loaded at 0.5 ml/min onto a HR 16/50 Superose 12 (Pharmacia)
gel filtration column equilibrated with 10 mM Na.sub.2.PO.sub.4, pH
7.0. The column was washed with the same buffer for 240 min at 0.5
ml/min and 2 min samples were collected. The void volume material
was collected and concentrated using a Centriprep 100. Two
milliliter aliquots of concentrated Superose 12 samples were loaded
at 0.5 ml/min onto a HR 16/50 Sepharose 4B-CL (Pharmacia) gel
filtration column equilibrated with 10 mM Na.sub.2.PO.sub.4, pH
7.0. The column was washed with the same buffer for 240 min at 0.5
ml/min and 2 min samples were collected.
[0139] The excluded protein peak was subjected to a second
fractionation by application to a gel filtration column that used a
Sepharose CL-4B resin, which separates proteins ranging from about
30 kDa to 1000 kDa. This fraction was resolved into two peaks; a
minor peak at the void volume (>1000 kDa) and a major peak which
eluted at an apparent molecular weight of about 860 kDa. Over a one
week period subsequent samples subjected to gel filtration showed
the gradual appearance of a third peak (approximately 325 kDa) that
seemed to arise from the major peak, perhaps by limited
proteolysis. Bioassays performed on the three peaks showed that the
void peak had no activity, while the 860 kDa toxin complex fraction
was highly active, and the 325 kDa peak was less active, although
quite potent. SDS PAGE analysis of Sepharose CL-4B toxin complex
peaks from different fermentation productions revealer two distinct
peptide patterns, denoted "P" and "S". The two patterns had marked
differences in the molecular weights and concentrations of peptide
components in their fractions. The "S" pattern, produced most
frequently, had 4 high molecular weight peptides (>150 kDa)
while the "P" pattern had 3 high molecular weight peptides. In
addition, the "S" peptide fraction was found to have 2-3 fold more
activity against European Corn Borer. This shift may be related to
variations in protein expression due to age of inoculum and/or
other factors based on growth parameters of aged cultures.
[0140] Milligram quantities of peak toxin complex fractions
determined to be "P" or "S" peptide patterns were subjected to
preparative SDS PAGE, and transblotted with TRIS-glycine
(Seprabuff.TM. to PVDF membranes (ProBlott.TM., Applied Biosystems)
for 3-4 hours. Blots were sent for amino acid analysis and
N-terminal amino acid sequencing at Harvard MicroChem and Cambridge
ProChem, respectively. Three peptides in the "S" pattern had unique
N-terminal amino acid sequences compared to the sequences
identified in the previous example. A 201 kDa (TcdA.sub.ii) peptide
set forth as SEQ ID NO:13 below shared between 33% amino acid
identity and 50% similarity (similarity and identity were
calculated by hand) with SEQ ID NO:1 (TcbA.sub.ii) (in Table 10
vertical lines denote amino acid identities and colons indicate
conservative amino acid substitutions). A second peptide of 197
kDa, SEQ ID NO:14 (TcdB), had 42% identity and 58% similarity with
SEQ ID NO:2 (TcaC) (similarity and identity were calculated by
hand). Yet a third peptide of 205 kDa was denoted TcdA.sub.ii. In
addition, a limited N-terminal amino acid sequence, SEQ ID NO:16
(TcbA), of a peptide of at least 235 kDa was identical with the
amino acid sequence, SEQ ID NO:12, deduced from a cloned gene
(tcbA), SEQ ID NO:11, containing a deduced amino acid sequence
corresponding to SEQ ID NO:1 (TcbA.sub.ii). This indicates that the
larger 235+ kDa peptide was proteolytically processed to the 201
kDa peptide, (TcbA.sub.ii), (SEQ ID NO:1) during fermentation,
possibly resulting in activation of the molecule. In yet another
sequence, the sequence originally reported as SEQ ID NO:5
(TcaB.sub.ii) reported in Example 5 above, was found to contain an
aspartic acid residue (Asp) at the third position rather than
glycine (Gly) and two additional amino acids Gly and Asp at the
eighth and ninth positions, respectively. In yet two other
sequences, SEQ ID NO:2 (TcaC) and SEQ ID NO:3 (TcaB.sub.i),
additional amino acid sequence was obtained. Densitometric
quantitation was performed using a sample that was identical to the
"S" preparation sent for N-terminal analysis. This analysis showed
that the 201 kDa and 197 kDa peptides represent 7.0% and 7.2%,
respectively, of the total Coomassie brillant blue stained protein
in the "S" pattern and are present in amounts similar to the other
abundant peptides. It was speculated that these peptides may
represent protein homologs, analogous to the situation found with
other bacterial toxins, such as various CryI Bt toxins. These
proteins vary from 40-90% similarity at their N-terminal amino acid
sequence, which encompasses the toxic fragment.
[0141] Internal Amino Acid Sequencing
[0142] To facilitate cloning of toxin peptide genes, internal amino
acid sequences of selected peptides were obtained as followed.
Milligram quantities of peak 2A fractions determined to be "P" or
"S" peptide patterns were subjected to preparative SDS PAGE, and
transblotted with TRIS-glycine (Seprabuff.TM. to PVDF membranes
(ProBlott.TM., Applied Biosystems) for 3-4 hours. Blots were sent
for amino acid analysis and N-terminal amino acid sequencing at
Harvard MicroChem and Cambridge ProChem, respectively. Three
peptides, referred to as TcbA.sub.ii (containing SEQ ID NO:1),
TcdA.sub.ii, and TcaB.sub.i (containing SEQ ID NO:3) were subjected
to trypsin digestion by Harvard MicroChem followed by HPLC
chromatography to separate individual peptides. N-terminal amino
acid analysis was performed on selected tryptic peptide fragments.
Two internal peptides were sequenced for the peptide TcdA.sub.ii
(205 kDa peptide) referred to as TcdA.sub.ii-PT111 (SEQ ID NO:17)
and TcdA.sub.ii-PT79 (SEQ ID NO:18). Two internal peptides were
sequenced for the peptide TcaB.sub.i (68 kDa peptide) referred to
as TcaB.sub.i-PT158 (SEQ ID NO:19) and TcaB.sub.i-PT108 (SEQ ID
NO:20). Four internal peptides were sequenced for the peptide
TcbA.sub.ii (201 kDa peptide) referred to as TcbA.sub.ii-PT103 (SEQ
ID NO:21), TcbA.sub.ii-PT56 (SEQ ID NO:22), TcbA.sub.ii-PT81(a)
(SEQ ID NO:23), and TcbA.sub.ii-PT81(b) (SEQ ID NO:24).
11TABLE 11 N-Terminal Amino Acid Sequences (similarity and identity
were calculated by hand) 201 kDa (33% identity & 50% similarity
to SEQ ID NO.1) L I G Y N N Q F S G * A SEQ ID NO:13 : .vertline.
.vertline. .vertline. : .vertline. F I Q G Y S D L F G N - A SEQ ID
NO:1 197 kDa (42% identity & 58% similarity SEQ ID NO.2) M Q N
S Q T F +E,INS S V G E L SEQ ID NO.14 .vertline. .vertline. :
.vertline. .vertline. : : .vertline. M Q D S P E V S I T T L SEQ ID
NO.2
EXAMPLE 8
Construction of a Cosmid Library of Photorhabdus luminescens W-14
Genomic DNA and its Screening to Isolate Genes Encoding Peptides
Comprising the Toxic Protein Preparation
[0143] As a prerequisite for the production of Photorhabdus insect
toxic proteins in heterologous hosts, and for other uses, it is
necessary to isolate and characterize the genes that encode those
peptides. This objective was pursued in parallel. One approach,
described later, was based on the use of monoclonal and polyclonal
antibodies raised against the purified toxin which were then used
to isolate clones from an expression library. The other approach,
described in this example, is based on the use of the N-terminal
and internal amino acid sequence data to design degenerate
oligonucleotides for use in PCR amplication. Either method can be
used to identify DNA clones that contain the peptide-encoding genes
so as to permit the isolation of the respective genes, and the
determination of their DNA base sequence.
[0144] Genomic DNA Isolation
[0145] Photorhabdus luminescens strain W-14 (ATCC accession number
55397) was grown on 2% proteose peptone #3 agar (Difco
Laboratories, Detroit, Mich.) and insecticidal toxin competence was
maintained by repeated bioassay after passage, using the method
described in Example 1 above. A 50 ml shake culture was produced in
a 175 ml baffled flask in 2% proteose peptone #3 medium, grown at
28.degree. C. and 150 rpm for approximately 24 hours. 15 ml of this
culture was pelleted and frozen in its medium at -20.degree. C.
until it was thawed for DNA isolation. The thawed culture was
centrifuged, (700.times.g, 30 min) and the floating orange
mucopolysaccharide material was removed. The remaining cell
material was centrifuged (25,000.times.g, 15 min) to pellet the
bacterial cells, and the medium was removed and discarded.
[0146] Genomic DNA was isolated by an adaptation of the CTAB method
described in section 2.4.1 of Current Protocols in Molecular
Biology (Ausubel et al. eds, John Wiley & Sons, 1994) [modified
to include a salt shock and with all volumes increased 10-fold].
The pelleted bacterial cells were resuspended in TE buffer (10 mM
Tris-HCl, 1 mM EDTA, pH 8.0) to a final volume of 10 ml, then 12 ml
of 5 M NaCl was added; this mixture was centrifuged 20 min at
15,000.times.g. The pellet was resuspended in 5.7 ml TE and 300 ml
of 10% SDS and 60 ml of 20 mg/ml proteinase K (Gibco BRL Products,
Grand Island, N.Y.; in sterile distilled water) were added to the
suspension. This mixture was incubated at 37.degree. C. for 1 hr;
then approximately 10 mg lysozyme (Worthington Biochemical Corp.,
Freehold, N.J.) was added. After an additional 45 min, 1 ml of 5 M
NaCl and 800 ml of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl)
were added. This preparation was incubated 10 min at 65.degree. C.,
then gently agitated and further incubated and agitated for
approximately 20 min to assist clearing of the cellular material.
An equal volume of chloroform/isoamyl alcohol solution (24:1, v/v)
was added, mixed gently and centrifuged. After two extractions with
an equal volume of PCI (phenol/chloroform/isoamyl alcohol; 50:49:1,
v/v/v; equilibrated with 1 M Tris-HCl, pH 8.0; Intermountain
Scientific Corporation, Kaysville, Utah), the DNA was precipitated
with 0.6 volume of isopropanol. The DNA precipitate was gently
removed with a glass rod, washed twice with 70% ethanol, dried, and
dissolved in 2 ml STE (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 1 mM
EDTA). This preparation contained 2.5 mg/ml DNA, as determined by
optical density at 260 nm (i.e., OD.sub.260).
[0147] The molecular size range of the isolated genomic DNA was
evaluated for suitability for library construction. CHEF gel
analysis was performed in 1.5% agarose (Seakem.RTM. LE, FMC
BioProducts, Rockland, Me.) gels with 0.5.times.TBE buffer (44.5 mM
Tris-HCl pH 8.0, 44.5 mM H.sub.3BO.sub.3, 1 mM EDTA) on a BioRad
CHEF-DR II apparatus with a Pulsewave 760 Switcher (Bio-Rad
Laboratories, Inc., Richmond, Calif.). The running parameters were:
initial A time, 3 sec; final A time, 12 sec; 200 volts; running
temperature, 4-18.degree. C.; run time, 16.5 hr. Ethidium bromide
staining and examination of the gel under ultraviolet light
indicated the DNA ranged from 30-250 kbp in size.
[0148] Construction of Library
[0149] A partial Sau3A 1 digest was made of this Photorhabdus
genomic DNA preparation. The method was based on section 3.1.3 of
Ausubel (supra.). Adaptions included running smaller scale
reactions under various conditions until nearly optimal results
were achieved. Several scaled-up large reactions with varied
conditions were run, the results analyzed on CHEF gels, and only
the best large scale preparation was carried forward. In the
optimal case, 200 .mu.g of Photorhabdus genomic DNA was incubated
with 1.5 units of Sau3A 1 (New England Biolabs, "NEB", Beverly,
Mass.) for 15 min at 37.degree. C. in 2 ml total volume of
1.times.NEB 4 buffer (supplied as 10.times. by the manufacturer).
The reaction was stopped by adding 2 ml of PCI and centrifuging at
8000.times.g for 10 min. To the supernatant were added 200 .mu.l of
5 M NaCl plus 6 ml of ice-cold ethanol. This preparation was
chilled for 30 min at -20.degree. C., then centrifuged at
12,000.times.g for 15 min. The supernatant was removed and the
precipitate was dried in a vacuum oven at 40.degree. C., then
resuspended in 400 .mu.l STE. Spectrophotometric assay indicated
about 40% recovery of the input DNA. The digested DNA was size
fractionated on a sucrose gradient according to section 5.3.2 of
CPMB (op. cit.). A 10% to 40% (w/v) linear sucrose gradient was
prepared with a gradient maker in Ultra-Clear.TM. tubes (Beckman
Instruments, Inc., Palo Alto, Calif.) and the DNA sample was
layered on top. After centrifugation, (26,000 rpm, 17 hr, Beckman
SW41 rotor, 20.degree. C.), fractions (about 750 .mu.l) were drawn
from the top of the gradient and analyzed by CHEF gel
electrophoresis (as described earlier). Fractions containing Sau3A
1 fragments in the size range 20-40 kbp were selected and DNA was
precipitated by a modification (amounts of all solutions increased
approximately 6.3-fold) of the method in section 5.3.3 of Ausubel
(supra.). After overnight precipitation, the DNA was collected by
centrifugation (17,000.times.g, 15 min), dried, redissolved in TE,
pooled into a final volume of 80 .mu.l, and reprecipitated with the
addition of 8 .mu.l 3 M sodium acetate and 220 .mu.l ethanol. The
pellet collected by centrifugation as above was resuspended in 12
.mu.l TE. Concentration of the DNA was determined by Hoechst 33258
dye (Polysciences, Inc., Warrington, Pa.) fluorometry in a Hoefer
TKO100 fluorimeter (Hoefer Scientific Instruments, San Francisco,
Calif.). Approximately 2.5 .mu.g of the size-fractionated DNA was
recovered.
[0150] Thirty .mu.g of cosmid pWE15 DNA (Stratagene, La Jolla,
Calif.) was digested to completion with 100 units of restriction
enzyme BamH 1 (NEB) in the manufacturer's buffer (final volume of
200 .mu.l, 37.degree. C., 1 hr). The reaction was extracted with
100 .mu.l of PCI and DNA was precipitated from the aqueous phase by
addition of 20 .mu.l 3M sodium acetate and 550 .mu.l-20.degree. C.
absolute ethanol. After 20 min at -70.degree. C., the DNA was
collected by centrifugation (17,000.times.g, 15 min), dried under
vacuum, and dissolved in 180 .mu.l of 10 mM Tris-HCl, pH 8.0. To
this were added 20 .mu.l of 10.times.CIP buffer (100 mM Tris-HCl,
pH 8.3; 10 mM ZnCl.sub.2; 10 mM MgCl.sub.2), and 1 .mu.l (0.25
units) of 1:4 diluted calf intestinal alkaline phosphatase
(Boehringer Mannheim Corporation, Indianapolis, Ind.). After 30 min
at 37.degree. C., the following additions were made: 2 .mu.l 0.5 M
EDTA, pH 8.0; 10 .mu.l 10% SDS; 0.5 .mu.l of 20 mg/ml proteinase K
(as above), followed by incubation at 55.degree. C. for 30 min.
Following sequential extractions with 100 .mu.l of PCI and 100
.mu.l phenol (Intermountain Scientific Corporation, equilibrated
with 1 M Tris-HCl, pH 8.0), the dephosphorylated DNA was
precipitated by addition of 72 .mu.l of 7.5 M ammonium acetate and
550 .mu.l-20.degree. C. ethanol, incubation on ice for 30 min, and
centrifugation as above. The pelleted DNA was washed once with 500
.mu.l-20.degree. C. 70% ethanol, dried under vacuum, and dissolved
in 20 .mu.l of TE buffer.
[0151] Ligation of the size-fractionated Sau3A 1 fragments to the
BamH 1-digested and phosphatased pWE15 vector was accomplished
using T4 ligase (NEB) by a modification (i.e., use of premixed
10.times.ligation buffer supplied by the manufacturer) of the
protocol in section 3.33 of Ausubel. Ligation was carried out
overnight in a total volume of 20 .mu.l at 15.degree. C., followed
by storage at -20.degree. C.
[0152] Four .mu.l of the cosmid DNA ligation reaction, containing
about 1 .mu.g of DNA, was packaged into bacteriophage lambda using
a commercial packaging extract (Gigapack.RTM. III Gold Packaging
Extract, Stratagene), following the manufacturer's directions. The
packaged preparation was stored at 4.degree. C. until use. The
packaged cosmid preparation was used to infect Escherichia coli XL1
Blue MR cells (Stratagene) according to the Gigapack.RTM. III Gold
protocols ("Titering the Cosmid Library"), as follows. XL1 Blue MR
cells were grown in LB medium (g/L: Bacto-tryptone, 10; Bacto-yeast
extract, 5; Bacto-agar, 15; NaCl, 5; [Difco Laboratories, Detroit,
Mich.]) containing 0.2% (w/v) maltose plus 10 mM MgSO.sub.4, at
37.degree. C. After 5 hr growth, cells were pelleted at 700.times.g
(15 min) and resuspended in 6 ml of 10 mM MgSO.sub.4. The culture
density was adjusted with 10 mM MgSO.sub.4 to OD.sub.600=0.5. The
packaged cosmid library was diluted 1:10 or 1:20 with sterile SM
medium (0.1 M NaCl, 10 mM MgSO.sub.4, 50 mM Tris-HCl pH 7.5, 0.01%
w/v gelatin), and 25 .mu.l of the diluted preparation was mixed
with 25 .mu.l of the diluted XL1 Blue MR cells. The mixture was
incubated at 25.degree. C. for 30 min (without shaking), then 200
.mu.l of LB broth was added, and incubation was continued for
approximately 1 hr with occasional gentle shaking. Aliquots (20-40
.mu.l) of this culture were spread on LB agar plates containing 100
mg/l ampicillin (i.e., LB-Amp.sub.100) and incubated overnight at
37.degree. C. To store the library without amplification, single
colonies were picked and inoculated into individual wells of
sterile 96-well microwell plates; each well containing 75 .mu.l of
Terrific Broth (TB media: 12 g/l Bacto-tryptone, 24 g/l Bacto-yeast
extract, 0.4% v/v glycerol, 17 mM KH.sub.2PO.sub.4, 72 mM
K.sub.2HPO.sub.4) plus 100 mg/l ampicillin (i.e., TB-Amp.sub.100)
and incubated (without shaking) overnight at 37.degree. C. After
replicating the 96-well plate into a copy plate, 75 .mu.l/well of
filter-sterilized TB:glycerol (1:1, v/v; with, or without, 100 mg/l
ampicillin) was added to the plate, it was shaken briefly at 100
rpm, 37.degree. C., and then closed with Parafilm.RTM. (American
National Can, Greenwich, Conn.) and placed in a -70.degree. C.
freezer for storage. Copy plates were grown and processed
identically to the master plates. A total of 40 such master plates
(and their copies) were prepared.
[0153] Screening of the Library with Radiolabeled DNA Probes
[0154] To prepare colony filters for probing with radioactively
labeled probes, ten 96-well plates of the library were thawed at
25.degree. C. (bench top at room temperature). A replica plating
tool with 96 prongs was used to inoculate a fresh 96-well copy
plate containing 75 .mu.l/well of TB-Amp.sub.100. The copy plate
was grown overnight (stationary) at 37.degree. C., then shaken
about 30 min at 100 rpm at 37.degree. C. A total of 800 colonies
was represented in these copy plates, due to nongrowth of some
isolates. The replica tool was used to inoculate duplicate
impressions of the 96-well arrays onto Magna NT (MSI, Westboro,
Mass.) nylon membranes (0.45 micron, 220.times.250 mm) which had
been placed on solid LB-Amp.sub.100 (100 ml/dish) in Bio-assay
plastic dishes (Nunc, 243.times.243.times.18 mm; Curtin Mathison
Scientific, Inc., Wood Dale, Ill.). The colonies were grown on the
membranes at 37.degree. C. for about 3 hr.
[0155] A positive control colony (a bacterial clone containing a
GZ4 sequence insert, see below) was grown on a separate Magna NT
membrane (Nunc, 0.45 micron, 82 mm circle) on LB medium
supplemented with 35 mg/l chloramphenicol (i.e., LB-Cam.sub.35),
and processed alongside the library colony membranes. Bacterial
colonies on the membranes were lysed, and the DNA was denatured and
neutralized according to a protocol taken from the Genius.TM.
System User's Guide version 2.0 (Boehringer Mannheim, Indianapolis,
Ind.). Membranes were placed colony side up on filter paper soaked
with 0.5 N NaOH plus 1.5 M NaCl for 15 min to denature, and
neutralized on filter paper soaked with 1 M Tris-HCl pH 8.0, 1.5 M
NaCl for 15 min. After UV-crosslinking using a Stratagene UV
Stratalinker set on auto crosslink, the membranes were stored dry
at 25.degree. C. until use. Membranes were trimmed into strips
containing the duplicate impressions of a single 96-well plate,
then washed extensively by the method of section 6.4.1 in CPMB (op.
cit.): 3 hr at 25.degree. C. in 3.times.SSC, 0.1% (w/v) SDS,
followed by 1 hr at 65.degree. C. in the same solution, then rinsed
in 2.times.SSC in preparation for the hybridization step
(20.times.SSC=3 M NaCl, 0.3 M sodium citrate, pH 7.0).
[0156] Amplification of a Specific Genomic Fragment of a TcaC
Gene
[0157] Based on the N-terminal amino acid sequence determined for
the purified TcaC peptide fraction [disclosed herein as SEQ ID
NO:2], a pool of degenerate oligonucleotides (pool S4Psh) was
synthesized by standard .beta.-cyanoethyl chemistry on an Applied
BioSystem ABI394 DNA/RNA Synthesizer (Perkin Elmer, Foster City,
Calif.). The oligonucleotides were deprotected 8 hours at
55.degree. C., dissolved in water, quantitated by
spectrophotometric measurement, and diluted for use. This pool
corresponds to the determined N-terminal amino acid sequence of the
TcaC peptide. The determined amino acid sequence and the
corresponding degenerate DNA sequence are given below, where A, C,
G, and T are the standard DNA bases, and I represents inosine:
12 Amino Met Gln Asp Ser Pro Glu Val Acid S4Psh 5' ATG CA(A/G)
GA(T/C) (T/A)(C/G)(T/A) CCI GA(A/G) GT 3'
[0158] Another set of degenerate oligonucleotides was synthesized
(pool P2.3.5R), representing the complement of the coding strand
for the determined amino acid sequence of the SEQ ID NO:17:
13 Amino Ala Phe Asn Ile Asp Asp Val Acid Codons 5' GCN TT(T/C)
AA(T/C) AT(A/T/C) GA(T/C) GA(T/C) GT 3' P2.3.5R 3'CG(A/C/G/T)
AA(A/G) TT(A/G) TA(T/A/G) CT(A/G) CT(A/G) CA 5'
[0159] These oligonucleotides were used as primers in Polymerase
Chain Reactions (PCR.RTM., Roche Molecular Systems, Branchburg,
N.J.) to amplify a specific DNA fragment from genomic DNA prepared
from Photorhabdus strain W-14 (see above). A typical reaction (50
.mu.l) contained 125 pmol of each primer pool P2Psh and P2.3.5R,
253 ng of genomic template DNA, 10 nmol each of dATP, dCTP, dGTP,
and dTTP, 1.times.GeneAmp.RTM. PCR buffer, and 2.5 units of
AmpliTaq.RTM. DNA polymerase (both from Roche Molecular Systems;
10.times.GeneAmp.RTM. buffer is 100 mM Tris-HCl pH 8.3, 500 mM KCl,
0.01% w/v gelatin). Amplifications were performed in a Perkin Elmer
Cetus DNA Thermal Cycler (Perkin Elmer, Foster City, Calif.) using
35 cycles of 94.degree. C. (1.0 min), 55.degree. C. (2.0 min),
72.degree. C. (3.0 min), followed by an extension period of 7.0 min
at 72.degree. C. Amplification products were analyzed by
electrophoresis through 2% w/v NuSieve.RTM. 3:1 agarose (FMC
BioProducts) in TEA buffer (40 mM Tris-acetate, 2 mM EDTA, pH 8.0).
A specific product of estimated size 250 bp was observed amongst
numerous other amplification products by ethidium bromide (0.5
.mu.g/ml) staining of the gel and examination under ultraviolet
light.
[0160] The region of the gel containing an approximately 250 bp
product was excised, and a small plug (0.5 mm dia.) was removed and
used to supply template for PCR amplification (40 cycles). The
reaction (50 .mu.l) contained the same components as above, minus
genomic template DNA. Following amplification, the ends of the
fragments were made blunt and were phosphorylated by incubation at
25.degree. C. for 20 min with 1 unit of T4 DNA polymerase (NEB), 1
nmol ATP, and 2.15 units of T4 kinase (Pharmacia Biotech Inc.,
Piscataway, N.J.).
[0161] DNA fragments were separated from residual primers by
electrophoresis through 1% w/v GTG.RTM. agarose (FMC) in TEA. A gel
slice containing fragments of apparent size 250 bp was excised, and
the DNA was extracted using a Qiaex kit (Qiagen Inc., Chatsworth,
Calif.).
[0162] The extracted DNA fragments were ligated to plasmid vector
pBC KS(+) (Stratagene) that had been digested to completion with
restriction enzyme Sma 1 and extracted in a manner similar to that
described for pWE15 DNA above. A typical ligation reaction (16.3
.mu.l) contained 100 ng of digested pBC KS(+) DNA, 70 ng of 250 bp
fragment DNA, 1 nmol [Co(NH.sub.3).sub.6]Cl.sub.3, and 3.9 Weiss
units of T4 DNA ligase (Collaborative Biomedical Products, Bedford,
Mass.), in 1.times.ligation buffer (50 mM Tris-HCl, pH 7.4; 10 MM
MgCl.sub.2; 10 mM dithiothreitol; 1 mM spermidine, 1 mM ATP, 100
mg/ml bovine serum albumin). Following overnight incubation at
14.degree. C., the ligated products were transformed into frozen,
competent Escherichia coli DH5.alpha. cells (Gibco BRL) according
to the suppliers' recommendations, and plated on LB-Cam.sub.35
plates, containing IPTG (119 .mu.g/ml) and X-gal (50 .mu.g/ml).
Independent white colonies were picked, and plasmid DNA was
prepared by a modified alkaline-lysis/PEG precipitation method
(PRISM.TM. Ready Reaction DyeDeoxy.TM. Terminator Cycle Sequencing
Kit Protocols; ABI/Perkin Elmer). The nucleotide sequence of both
strands of the insert DNA was determined, using T7 primers [pBC
KS(+) bases 601-623: TAAAACGACGGCCAGTGAGCGCG) and LacZ primers [pBC
KS(+) bases 792-816: ATGACCATGATTACGCCAAGCGCGC) and protocols
supplied with the PRISM.TM. sequencing kit (ABI/Perkin Elmer).
Nonincorporated dye-terminator dideoxyribonucleotides were removed
by passage through Centri-Sep 100 columns (Princeton Separations,
Inc., Adelphia, N.J.) according to the manufacturer's instructions.
The DNA sequence was obtained by analysis of the samples on an ABI
Model 373A DNA Sequencer (ABI/Perkin Elmer). The DNA sequences of
two isolates, GZ4 and HB14, were found to be as illustrated in FIG.
1.
[0163] This sequence illustrates the following features: 1) bases
1-20 represent one of the 64 possible sequences of the S4Psh
degenerate oligonucleotides, ii) the sequence of amino acids 1-3
and 6-12 correspond exactly to that determined for the N-terminus
of TcaC (disclosed as SEQ ID NO:2), iii) the fourth amino acid
encoded is a cysteine residue rather than serine. This difference
is encoded within the degeneracy for the serine codons (see above),
iv) the fifth amino acid encoded is proline, corresponding to the
TcaC N-terminal sequence given as SEQ ID NO:2, v) bases 257-276
encode one of the 192 possible sequences designed into the
degenerate pool, vi) the TGA termination codon introduced at bases
268-270 is the result of complementarity to the degeneracy built
into the oligonucleotide pool at the corresponding position, and
does not indicate a shortened reading frame for the corresponding
gene.
[0164] Labeling of a TcaC Peptide Gene-specific Probe
[0165] DNA fragments corresponding to the above 276 bases were
amplified (35 cycles) by PCR.RTM. in a 100 .mu.l reaction volume,
using 100 pmol each of P2Psh and P2.3.5R primers, 10 ng of plasmids
GZ4 or HB14 as templates, 20 nmol each of dATP, dCTP, dGTP, and
dTTP, 5 units of AmpliTAq.RTM. DNA polymerase, and 1.times.
concentration of GeneAmp.RTM. buffer, under the same temperature
regimes as described above. The amplification products were
extracted from a 1% GTG.RTM. agarose gel by Qiaex kit and
quantitated by fluorometry.
[0166] The extracted amplification products from plasmid HB14
template (approximately 400 ng) were split into five aliquots and
labeled with .sup.32P-dCTP using the High Prime Labeling Mix
(Boehringer Mannheim) according to the manufacturer's instructions.
Nonincorporated radioisotope was removed by passage through
NucTrap.RTM. Probe Purification Columns (Stratagene), according to
the supplier's instructions. The specific activity of the labeled
DNA product was determined by scintillation counting to be
3.11.times.10.sup.8 dpm/.mu.g. This labeled DNA was used to probe
membranes prepared from 800 members of the genomic library.
[0167] Screening with a TcaC-peptide Gene Specific Probe
[0168] The radiolabeled HB14 probe was boiled approximately 10 min,
then added to "minimal hyb" solution. [Note: The "minimal hyb"
method is taken from a CERES protocol; "Restriction Fragment Length
Polymorphism Laboratory Manual version 4.0", sections 4-40 and
4-47; CERES/NPI, Salt Lake City, Utah. NPI is now defunct, with its
successors operating as Linkage Genetics]. "Minimal hyb" solution
contains 10% w/v PEG (polyethylene glycol, M.W. approx. 8000), 7%
w/v SDS; 0.6.times.SSC, 10 mM sodium phosphate buffer (from a 1M
stock containing 95 g/l NaH.sub.2PO.1H.sub.2O and 84.5 g/l
Na.sub.2HPO.sub.4.7H.sub.2O), 5 mM EDTA, and 100 mg/ml denatured
salmon sperm DNA. Membranes were blotted dry briefly then, without
prehybridization, 5 strips of membrane were placed in each of 2
plastic boxes containing 75 ml of "minimal hyb" and 2.6 ng/ml of
radiolabeled HB14 probe. These were incubated overnight with slow
shaking (50 rpm) at 60.degree. C. The filters were washed three
times for approximately 10 min each at 25.degree. C. in "minimal
hyb wash solution" (0.25.times.SSC, 0.2%. SDS), followed by two
30-min washes with slow shaking at 60.degree. C. in the same
solution. The filters were placed on paper covered with Saran
Wrap.RTM. (Dow Brands, Indianapolis, Ind.) in a light-tight
autoradiographic cassette and exposed to X-Omat X-ray film (Kodak,
Rochester, N.Y.) with two DuPont Cronex Lightning-Plus C1 enhancers
(Sigma Chemical Co., St. Louis, Mo.), for 4 hr at -70.degree. C.
Upon development (standard photographic procedures), significant
signals were evident in both replicates amongst a high background
of weaker, more irregular signals. The filters were again washed
for about 4 hr at 68.degree. C. in "minimal hyb wash solution" and
then placed again in the cassettes and film was exposed overnight
at -70.degree. C. Twelve possible positives were identified due to
strong signals on both of the duplicate 96-well colony impressions.
No signal was seen with negative control membranes (colonies of XL1
Blue MR cells containing pWE15), and a very strong signal was seen
with positive control membranes (DH5.alpha. cells containing the
GZ4 isolate of the PCR product) that had been processed
concurrently with the experimental samples.
[0169] The twelve putative hybridization-positive colonies were
retrieved from the frozen 96-well library plates and grown
overnight at 37.degree. C. on solid LB-Amp.sub.100 medium. They
were then patched (3/plate, plus three negative controls: XL1 Blue
MR cells containing the pWE15 vector) onto solid LB-Amp.sub.100.
Two sets of membranes (Magna NT nylon, 0.45 micron) were prepared
for hybridization. The first set was prepared by placing a filter
directly onto the colonies on a patch plate, then removing it with
adherent bacterial cells, and processing as below. Filters of the
second set were placed on plates containing LB-Amp.sub.100 medium,
then inoculated by transferring cells from the patch plates onto
the filters. After overnight growth at 37.degree. C., the filters
were removed from the plates and processed.
[0170] Bacterial cells on the filters were lysed and DNA denatured
by placing each filter colony-side-up on a pool (1.0 ml) of 0.5 N
NaOH in a plastic plate for 3 min. The filters were blotted dry on
a paper towel, then the process was repeated with fresh 0.5 N NaOH.
After blotting dry, the filters were neutralized by placing each on
a 1.0 ml pool of 1 M Tris-HCl, pH 7.5 for 3 min, blotted dry, and
reneutralised with fresh buffer. This was followed by two similar
soakings (5 min each) on pools of 0.5 M Tris-HCl pH 7.5 plus 1.5 M
NaCl. After blotting dry, the DNA was UV crosslinked to the filter
(as above), and the filters were washed (25.degree. C., 100 rpm) in
about 100 ml of 3.times.SSC plus 0.1%(w/v) SDS (4 times, 30 min
each with fresh solution for each wash). They were then placed in a
minimal volume of prehybridization solution [6.times.SSC plus 1%
w/v each of Ficoll 400 (Pharmacia), polyvinylpyrrolidone (av. M.W.
360,000; Sigma ) and bovine serum albumin Fraction V; (Sigma)] for
2 hr at 65.degree. C., 50 rpm. The prehybridization solution was
removed, and replaced with the HB14 .sup.32P-labeled probe that had
been saved from the previous hybridization of the library membranes
and which had been denatured at 95.degree. C. for 5 min.
Hybridization was performed at 60.degree. C. for 16 hr with shaking
at 50 rpm.
[0171] Following removal of the labeled probe solution, the
membranes were washed 3 times at 25.degree. C. (50 rpm, 15 min) in
3.times.SSC (about 150 ml each wash). They were then washed for 3
hr at 68.degree. C. (50 rpm) in 0.25.times.SSC plus 0.2% SDS
(minimal hyb wash solution), and exposed to X-ray film as described
above for 1.5 hr at 25.degree. C. (no enhancer screens). This
exposure revealed very strong hybridization signals to cosmid
isolates 22G12, 25A10, 26A5, and 26B10, and a very weak signal with
cosmid isolate 8B10. No signal was seen with the negative control
(pWE15) colonies, and a very strong signal was seen with positive
control membranes (DH5.alpha. cells containing the GZ4 isolate of
the PCR product) that had been processed concurrently with the
experimental samples.
[0172] Amplification of a Specific Genomic Fragment of a TcaB
Gene
[0173] Based on the N-terminal amino acid sequence determined for
the purified TcaB.sub.i peptide fraction (disclosed here as SEQ ID
NO:3) a pool of degenerate oligonucleotides (pool P8F) was
synthesized as described for peptide TcaC. The determined amino
acid sequence and the corresponding degenerate DNA sequence are
given below, where A, C, G, and T are the standard DNA bases, and I
represents inosine:
14 Amino- Leu Phe Thr Gln Thr Leu Lys Glu Ala Arg Acid P8F 5' TTT
ACI CA(A/G) ACI (C/T)TI AAA GAA GCI (A/C)G 3' (C/T)TI
[0174] Another set of degenerate oligonucleotides was synthesized
(pool P8.108.3R), representing the complement of the coding strand
for the determined amino acid sequence of the TcaB.sub.i-PT108
internal peptide (disclosed herein as SEQ ID NO:20):
15 Amino Met Tyr Tyr Ile Gln Ala Gln Gln Acid Codons ATG TA(T/C)
TA(T/C) AT(T/C/A) CA(A/G) GC(A/C/G/T) CA(A/G CA(A/G) P8.108.3R
3'ATCA/G) AT(A/G) TA(A/G/T) GT(T/C) CGI GT(T/C) GT 5' TAG
[0175] These oligonucleotides were used as primers for PCR.RTM.
using HotStart 50 Tubes.TM. (Molecular Bio-Products, Inc., San
Diego, Calif.) to amplify a specific DNA fragment from genomic DNA
prepared from Photorhabdus strain W-14 (see above). A typical
reaction (50 .mu.l) contained (bottom layer) 25 pmol of each primer
pool P8F and P8.108.3R, with 2 nmol each of dATP, dCTP, dGTP, and
dTTP, in 1.times.GeneAmp.RTM. PCR buffer, and (top layer) 230 ng of
genomic template DNA, 8 nmol each of dATP, dCTP, dGTP, and dTTP,
and 2.5 units of AmpliTaq.RTM. DNA polymerase, in
1.times.GeneAmp.RTM. PCR buffer. Amplifications were performed by
35 cycles as described for the TcaC peptide. Amplification products
were analyzed by electrophoresis through 0.7% w/v SeaKem.RTM. LE
agarose (FMC) in TEA buffer. A specific product of estimated size
1600 bp was observed.
[0176] Four such reactions were pooled, and the amplified DNA was
extracted from a 1.0% SeaKem.RTM. LE gel by Qiaex kit as described
for the TcaC peptide. The extracted DNA was used directly as the
template for sequence determination (PRISM.TM. Sequencing Kit)
using the P8F and P8.108.3R primer pools. Each reaction contained
about 100 ng template DNA and 25 pmol of one primer pool, and was
processed according to standard protocols as described for the TcaC
peptide. An analysis of the sequence derived from extension of the
P8F primers revealed the short DNA sequence (and encoded amino acid
sequence):
16 GAT GCA TTG NTT GCT Asp Ala Leu (Val) Ala
[0177] which corresponds to a portion of the N-terminal peptide
sequence disclosed as SEQ ID NO:3 (TcaB.sub.i).
[0178] Labeling of a TcaB.sub.i-peptide Gene-specific Probe
[0179] Approximately 50 ng of gel-purified TcaB.sub.i DNA fragment
was labeled with .sup.32P-dCTP as described above, and
nonincorporated radioisotopes were removed by passage through a
NICK Column.RTM. (Pharmacia). The specific activity of the labelled
DNA was determined to be 6.times.10.sup.9 dpm/.mu.g. This labeled
DNA was used to probe colony membranes prepared from members of the
genomic library that had hybridized to the TcaC-peptide specific
probe.
[0180] The membranes containing the 12 colonies identified in the
TcaC-probe library screen (see above) were stripped of radioactive
TcaC-specific label by boiling twice for approximately 30 min each
time in 1 liter of 0.1.times.SSC plus 0.1% SDS. Removal of
radiolabel was checked with a 6 hr film exposure. The stripped
membranes were then incubated with the TcaB.sub.i peptide-specific
probe prepared above. The labeled DNA was denatured by boiling for
10 min, and then added to the filters that had been incubated for 1
hr in 100 ml of "minimal hyb" solution at 60.degree. C. After
overnight hybridization at this temperature, the probe solution was
removed, and the filters were washed as follows (all in
0.3.times.SSC plus 0.1% SDS): once for 5 min at 25.degree. C., once
for 1 hr at 60.degree. C. in fresh solution, and once for 1 hr at
63.degree. C. in fresh solution. After 1.5 hr exposure to X-ray
film by standard procedures, 4 strongly-hybridizing colonies were
observed. These were, as with the TcaC-specific probe, isolates
22G12, 25A10, 26A5, and 26B10.
[0181] The same TcaB.sub.i probe solution was diluted with an equal
volume (about 100 ml) of "minimal hyb" solution, and then used to
screen the membranes containing the 800 members of the genomic
library. After hybridization, washing, and exposure to X-ray film
as described above, only the four cosmid clones 22G12, 25A10, 26A5,
and 26B10, were found to hybridize strongly to this probe.
[0182] Isolation of Subclones Containing Genes Encoding TcaC and
YcaB.sub.i Peptides, and Determination of DNA Base Sequence
Thereof
[0183] Three hybridization-positive cosmids in strain XL1 Blue MR
were grown with shaking overnight (200 rpm) at 30.degree. C. in 100
ml TB-Amp.sub.100. After harvesting the cells by centrifugation,
cosmid DNA was prepared using a commercially available kit
(BIGprep.TM., 5 Prime 3 Prime, Inc., Boulder, Colo.), following the
manufacturer's protocols. Only one cosmid, 26A5, was successfully
isolated by this procedure. When digested with restriction enzyme
EcoR 1 (NEB) and analyzed by gel electrophoresis, fragments of
approximate sizes 14, 10, 8 (vector), 5, 3.3, 2.9, and 1.5 kbp were
detected. A second attempt to isolate cosmid DNA from the same
three strains (8 ml cultures; TB-Amp.sub.100, 30.degree. C.)
utilized a boiling miniprep method (Evans G. and G. Wahl., 1987,
"Cosmid vectors for genomic walking and rapid restriction mapping."
in Guide to Molecular Cloning Techniques. Meth. Enzymology, Vol.
152, S. Berger and A. Kimmel, eds., pgs. 604-610). Only one cosmid,
25A10, was successfully isolated by this method. When digested with
restriction enzyme EcoR I (NEB) and analyzed by gel
electrophoresis, this cosmid showed a fragmentation pattern
identical to that previously seen with cosmid 26A5.
[0184] A 0.15 .mu.g sample of 26A5 cosmid DNA was used to transform
50 ml of E. coli DH5.alpha. cells (Gibco BRL), by the supplier's
protocols. A single colony isolate of that strain was inoculated
into 4 ml of TB-Amp.sub.100, and grown for 8 hr at 37.degree. C.
Chloramphenicol was added to a final concentration of 225 .mu.g/ml,
incubation was continued for another 24 hr, then cells were
harvested by centrifugation and frozen at -20.degree. C. Isolation
of the 26A5 cosmid DNA was by a standard alkaline lysis miniprep
(Maniatis et al., op. cit., p. 382), modified by increasing all
volumes by 50% and with stirring or gentle mixing, rather than
vortexing, at every step. After washing the DNA pellet in 70%
ethanol, it was dissolved in TE containing 25 .mu.g/ml ribonuclease
A (Boehringer Mannheim).
[0185] Identification of EcoR I Fragments Hybridizing to
GZ4-derived and TcaB.sub.i-Probes
[0186] Approximately 0.4 .mu.g of cosmid 25A10 (from XL1 Blue MR
cells) and about 0.5 .mu.g of cosmid 26A5 (from
chloramphenicol-amplified DH5.alpha. cells) were each digested with
about 15 units of EcoR I(NEB) for 85 min, frozen overnight, then
heated at 65.degree. C. for five min, and electrophoresed in a 0.7%
agarose gel (Seakem.RTM. LE, 1X TEA, 80 volts, 90 min). The DNA was
stained with ethidium bromide as described above, and photographed
under ultraviolet light. The EcoR I digest of cosmid 25A10 was a
complete digestion, but the sample of cosmid 26A5 was only
partially digested under these conditions. The agarose gel
containing the DNA fragments was subjected to depurination,
denaturation and neutralization, followed by Southern blotting onto
a Magna NT nylon membrane, using a high salt (20.times.SSC)
protocol, all as described in section 2.9 of Ausubel et al. (CPMB,
op. cit.) The transferred DNA was then UV-crosslinked to the nylon
membrane as before.
[0187] An TcaC-peptide specific DNA fragment corresponding to the
insert of plasmid isolate GZ4 was amplified by PCR.RTM. in a 100 ml
reaction volume as described previously above. The amplification
products from three such reactions were pooled and were extracted
from a 1% GTG.RTM. agarose gel by Qiaex kit, as described above,
and quantitated by fluorometry. The gel-purified DNA (100 ng) was
labeled with .sup.32p-dCTP using the High Prime Labeling Mix
(Boehringer Mannheim) as described above, to a specific activity of
6.34.times.10.sup.8 dpm/.mu.g.
[0188] The .sup.32P-labeled GZ4 probe was boiled 10 min, then added
to "minimal hyb" buffer (at 1 ng/ml), and the Southern blot
membrane containing the digested cosmid DNA fragments was added,
and incubated for 4 hr at 60.degree. C. with gentle shaking at 50
rpm. The membrane was then washed 3 times at 25.degree. C. for
about 5 min each (minimal hyb wash solution), followed by two
washes for 30 min each at 60.degree. C. The blot was exposed to
film (with enhancer screens) for about 30 min at -70.degree. C. The
GZ4 probe hybridized strongly to the 5.0 kbp (apparent size) EcoR I
fragment of both these two cosmids, 26A5 and 25A10.
[0189] The membrane was stripped of radioactivity by boiling for
about 30 min in 0.1.times.SSC plus 0.1% SDS, and absence of
radiolabel was checked by exposure to film. It was then hybridized
at 60.degree. C. for 3.5 hours with the (denatured) TcaB.sub.i
probe in "minimal hyb" buffer previously used for screening the
colony membranes (above), washed as described previously, and
exposed to film for 40 min at -70.degree. C. with two enhancer
screens. With both cosmids, the TcaB.sub.i probe hybridized lightly
with the about 5.0 kbp EcoR 1 fragment, and strongly with a
fragment of approximately 2.9 kbp.
[0190] The sample of cosmid 26A5 DNA previously described, (from
DH5.alpha. cells) was used as the source of DNA from which to
subclone the bands of interest. This DNA (2.5 .mu.g) was digested
with about 3 units of EcoR I (NEB) in a total volume of 30 .mu.l
for 1.5 hr, to give a partial digest, as confirmed by gel
electrophoresis. Ten .mu.g of pBC KS (+) DNA (Stratagene) were
digested for 1.5 hr with 20 units of EcoR I in a total volume of 20
.mu.l, leading to total digestion as confirmed by electrophoresis.
Both EcoR I-cut DNA preparations were diluted to 50 .mu.l with
water, to each an equal volume of PCI was added, the suspension was
gently mixed, spun in a microcentrifuge and the aqueous supernatant
was collected. DNA was precipitated by 150 .mu.l ethanol, and the
mixture was placed at -20.degree. C. overnight. Following
centrifugation and drying, the EcoR I-digested pBC KS (+) was
dissolved in 100 .mu.l TE; the partially digested 26A5 was
dissolved in 20 .mu.l TE. DNA recovery was checked by
fluorometry.
[0191] In separate reactions, approximately 60 ng of EcoR
I-digested pBC KS(+) DNA was ligated with approximately 180 ng or
270 ng of partially digested cosmid 26A5 DNA. Ligations were
carried out in a volume of 20 .mu.l at 15.degree. C. for 5 hr,
using T4 ligase and buffer from New England BioLabs. The ligation
mixture, diluted to 100 .mu.l with sterile TE, was used to
transform frozen, competent DH5.alpha. cells (Gibco BRL) according
to the supplier's instructions. Varying amounts (25-200 .mu.l) of
the transformed cells were plated on freshly prepared solid
LB-Cam.sub.35 medium with 1 mM IPTG and 50 mg/l X-gal. Plates were
incubated at 37.degree. C. about 20 hr, then chilled in the dark
for approximately 3 hr to intensify color for insert selection.
White colonies were picked onto patch plates of the same
composition and incubated overnight at 37.degree. C.
[0192] Two colony lifts of each of the selected patch plates were
prepared as follows. After picking white colonies to fresh plates,
round Magna NT nylon membranes were pressed onto the patch plates,
the membrane was lifted off, and subjected to denaturation,
neutralization and UV crosslinking as described above for the
library colony membranes. The crosslinked colony lifts were
vigorously washed, including gently wiping off the excess cell
debris with a tissue. One set was hybridized with the GZ4 (TcaC)
probe solution described earlier, and the other set was hybridized
with the TcaB.sub.i probe solution described earlier, according to
the `minimal hyb` protocol, followed by washing and film exposure
as described for the library colony membranes.
[0193] Colonies showing hybridization signals either only with the
GZ4 probe, with both GZ4 and TcaB.sub.i probes, or only with the
TcaB.sub.i probe, were selected for further work and cells were
streaked for single colony isolation onto LB-Cam.sub.35 media with
IPTG and X-gal as before. Approximately 35 single colonies, from 16
different isolates, were picked into liquid LB-Cam.sub.35 media and
grown overnight at 37.degree. C.; the cells were collected by
centrifugation and plasmid DNA was isolated by a standard alkaline
lysis miniprep according to Maniatis et al. (op. cit. p. 368). DNA
pellets were dissolved in TE+25 .mu.g/ml ribonuclease A and DNA
concentration was determined by fluorometry. The EcoR I digestion
pattern was analyzed by gel electrophoresis. The following isolates
were picked as useful. Isolate A17.2 contains religated pBC KS(+)
only and was used for a (negative) control. Isolates D38.3 and
C44.1 each contain only the 2.9 kbp, TcaB.sub.i-hybridizing EcoR I
fragment inserted into pBC KS(+). These plasmids, named pDAB2000
and pDAB2001, respectively, are illustrated in FIG. 2.
[0194] Isolate A35.3 contains only the approximately 5 kbp,
GZ4)-hybridizing EcoR 1 fragment, inserted into pBC KS(+). This
plasmid was named pDAB2002 (also FIG. 2). These isolates provided
templates for DNA sequencing.
[0195] Plasmids pDAB2000 and pDAB2001 were prepared using the
BIGprep.TM. kit as before. Cultures (30 ml) were grown overnight in
TB-Cam.sub.35 to an OD.sub.600 of 2, then plasmid was isolated
according to the manufacturer's directions. DNA pellets were
redissolved in 100 .mu.l TE each, and sample integrity was checked
by EcoR I digestion and gel electrophoretic analysis.
[0196] Sequencing reactions were run in duplicate, with one
replicate using as template pDAB2000 DNA, and the other replicate
using as template pDAB2001 DNA. The reactions were carried out
using the dideoxy dye terminator cycle sequencing method, as
described above for the sequencing of the GZ4/HB14 DNAs. Initial
sequencing runs utilized as primers the LacZ and T7 primers
described above, plus primers based on the determined sequence of
the TcaB.sub.i PCR amplification product
(TH1=ATTGCAGACTGCCAATCGCTTCGG,
TH12=GAGAGTATCCAGACCGCGGATGATCTG).
[0197] After alignment and editing of each sequencing output, each
was truncated to between 250 to 350 bases, depending on the
integrity of the chromatographic data as interpreted by the Perkin
Elmer Applied Biosystems Division SeqEd 675 software. Subsequent
sequencing "steps" were made by selecting appropriate sequence for
new primers. With a few exceptions, primers (synthesized as
described above) were 24 bases in length with a 50% G+C
composition. Sequencing by this method was carried out on both
strands of the approximately 2.9 kbp EcoR I fragment.
[0198] To further serve as template for DNA sequencing, plasmid DNA
from isolate pDAB2002 was prepared by BIGprep.RTM. kit. Sequencing
reactions were performed and analyzed as described above.
Initially, a T3 primer (pBS SK (+) bases 774-796:
CGCGCAATTAACCCTCACTAAAG) and a T7 primer (pBS KS (+) bases 621-643:
GCGCGTAATACGACTCACTATAG) were used to prime the sequencing
reactions from the flanking vector sequences, reading into the
insert DNA. Another set of primers, (GZ4F:
GTATCGATTACAACGCTGTCACTTCCC; TH13: GGGAAGTGACAGCGTTGTAATCGATAC;
TH14: ATGTTGGGTGCGTCGGCTAATGGACATAAC; and LW1-204:
GGGAAGTGACAGCGTTGTAATCGATAC) was made to prime from internal
sequences, which were determined previously by degenerate
oligonucleotide-mediated sequencing of subcloned TcaC-peptide PCR
products. From the data generated during the initial rounds of
sequencing, new sets of primers were designed and used to walk the
entire length of the about 5 kbp fragment. A total of 55 oligo
primers was used, enabling the identification of 4832 total bp of
contiguous sequence.
[0199] When the DNA sequence of the EcoR I fragment insert of
pDAB2002 is combined with part of the determined sequence of the
pDAB2000/pDAB2001 isolates, a total contiguous sequence of 6005 bp
was generated (disclosed herein as SEQ ID NO:25). When long open
reading frames were translated into the corresponding amino acids,
the sequence clearly shows the TcaB.sub.i N-terminal peptide
(disclosed as SEQ ID NO:3), encoded by bases 68-124, immediately
following a methionine residue (start of translation). Upstream
lies a potential ribosome binding site (bases 51-58), and
downstream, at bases 215-277 is encoded the TcaB.sub.i-PT158
internal peptide (disclosed herein as SEQ ID NO:19). Further
downstream, in the same reading frame, at bases 1787-1822, exists a
sequence encoding the TcaB.sub.i-PT108 internal peptide (disclosed
herein as SEQ ID NO:20). Also in the same reading frame, at bases
1946-1972, is encoded the TcaB.sub.ii N-terminal peptide (disclosed
herein as SEQ ID NO:5), and the reading frame continues
uninterrupted to a translation termination codon at nucleotides
3632-3634.
[0200] The lack of an in-frame stop codon between the end of the
sequence encoding TcaB.sub.i-PT108 and the start of the TcaB.sub.ii
encoding region, and the lack of a discernible ribosome binding
site immediately upstream of the TcaB.sub.ii coding region,
indicate that peptides TcaB.sub.ii and TcaB.sub.i are encoded by a
single open reading frame of 3567 bp beginning at base pair 65 in
SEQ ID NO:25), and are most likely derived from a single primary
gene product TcaB of 1189 amino acids (131,586 Daltons; disclosed
herein as SEQ ID NO:26) by post-translational cleavage. If the
amino acid immediately preceding the TcaB.sub.ii N-terminal peptide
represents the C-terminal amino acid of peptide TcaB.sub.i, then
the predicted mass of TcaB.sub.ii (627 amino acids) is 70,814
Daltons (disclosed herein as SEQ ID NO:28), somewhat higher than
the size observed by SDS-PAGE (68 kDa). This peptide would be
encoded by a contiguous stretch of 1881 base pairs (disclosed
herein as SEQ ID NO:27). It is thought that the native C-terminus
of TcaB.sub.i lies somewhat closer to the C-terminus of
TcaB.sub.i-PT108. The molecular mass of PT108 [3.438 kDa;
determined during N-terminal amino acid sequence analysis of this
peptide] predicts a size of 30 amino acids. Using the size of this
peptide to designate the C-terminus of the TcaB.sub.i coding region
[Glu at position 604 of SEQ ID NO:28], the derived size of
TcaB.sub.i is determined to be 604 amino acids or 68,463 Daltons,
more in agreement with experimental observations.
[0201] Translation of the TcaB.sub.ii peptide coding region of 1686
base pairs (disclosed herein as SEQ ID NO:29) yields a protein of
562 amino acids (disclosed herein as SEQ ID NO:30) with predicted
mass of 60,789 Daltons, which corresponds well with the observed 61
kDa.
[0202] A potential ribosome binding site (bases 3682-3687) is found
48 bp downstream of the stop codon for the tcaB open reading frame.
At bases 3694-3726 is found a sequence encoding the N-terminus of
peptide TcaC, (disclosed as SEQ ID NO.2). The open reading frame
initiated by this N-terminal peptide continues uninterrupted to
base 6005 (2361 base pairs, disclosed herein as the first 2361 base
pairs of SEQ ID NO.31). A gene (tcaC) encoding the entire TcaC
peptide, (apparent size about 165 kDa; about 1500 amino acids),
would comprise about 4500 bp.
[0203] Another isolate containing cloned EcoR I fragments of cosmid
26A5, E20.6, was also identified by its homology to the previously
mentioned GZ4 and TcaB.sub.i probes. Agarose gel analysis of EcoR I
digests of the DNA of the plasmid harbored by this strain
(pDAB2004, FIG. 2), revealed insert fragments of estimated sizes
2.9, 5, and 3.3 kbp. DNA sequence analysis initiated from primers
designed from the sequence of plasmid pDAB2002 revealed that the
3.3 kbp EcoR I fragment of pDAB2004 lies adjacent to the 5 kbp EcoR
I fragment represented in pDAB2002. The 2361 base pair open reading
frame discovered in pDAB2002 continues uninterrupted for another
2094 bases in pDAB2004 [disclosed herein as base pairs 2362 to 4458
of SEQ ID NO:31]. DNA sequence analysis using the parent cosmid
26A5 DNA as template confirmed the continuity of the open reading
frame. Altogether, the open reading frame (tcaC SEQ ID NO:31)
comprises 4455 base pairs, and encodes a protein (TcaC) of 1485
amino acids [disclosed herein as SEQ ID NO:32]. The calculated
molecular size of 166,214 Daltons is consistent with the estimated
size of the TcaC peptide (165 kDa), and the derived amino acid
sequence matches exactly that disclosed for the TcaC N-terminal
sequence [SEQ ID NO:2].
[0204] The lack of an amino acid sequence corresponding to SEQ ID
NO:17; used to design the degenerate oligonucleotide primer pool in
the discovered sequence indicates that the generation of the
PCR.RTM. products found in isolates GZ4 and HB14, which were used
as probes in the initial library screen, were fortuitously
generated by reverse-strand priming by one of the primers in the
degenerate pool. Further, the derived protein sequence does not
include the internal fragment disclosed herein as SEQ ID NO:18.
These sequences reveal that plasmid pDAB2004 contains the complete
coding region for the TcaC peptide.
[0205] Further analysis of SEQ ID NO:25 reveals the end of an open
reading frame (bases 1-43), which encodes the final 13 amino acids
of the TcaA.sub.iii peptide, disclosed herein as SEQ ID NO:35. Only
24 bases separate the end of the TcaA.sub.iii coding region and the
start of the TcaB.sub.i coding region. Included within the 24 bases
are sequences that may serve as a ribosome binding site. Although
possible, it is not likely that a Photorhabdus gene promoter is
encoded within this short region. We propose that genomic region
tca, which includes three long open reading frames [tcaA (SEQ ID
NO:33), tcaB (SEQ ID NO:25, bases 65-36334), and tcaC (SEQ ID
NO:31),which is separated from the end of tcaB by only 59 bases] is
regulated as an operon, with transcription initiating upstream of
the start of the tcaA gene (SEQ ID NO:33), and resulting in a
polycistronic messenger RNA.
EXAMPLE 9
Screening of the Photorhabdus Genomic Library for Genes Encoding
the TcbA.sub.ii Peptide
[0206] This example describes a method used to identify DNA clones
that contain the TcbA.sub.ii peptide-encoding genes, the isolation
of the gene, and the determination of its partial DNA base
sequence.
[0207] Primers and PCR Reactions
[0208] The TcbA.sub.ii polypeptide of the insect active preparation
is about 206 kDa. The amino acid sequence of the N-terminus of this
peptide is disclosed as SEQ ID NO:1. Four pools of degenerate
oligonucleotide primers ("Forward primers": TH-4, TH-5, TH-6, and
TH-7) were synthesized to encode a portion of this amino acid
sequence, as described in Example 8, and are shown below.
17TABLE 12 Amino Acid Phe Ile Gln Gly Tyr Ser Asp Leu Phe TH-4
5'-TT(T/C) ATI CA(A/G) GGI TACT/C) TCI GA(T/C) CTI TT-3' TH-5
5'-TT(T/C) ATI CA(A/G) GGI TACT/C) AG(T/C) GA(T/C) CTI TT-3' TH-6
5'-TT(T/C) ATI CA(A/G) GGI TACT/C) TCI GA(T/C) TT(A/G) TT-3' TH-7
5'-TT(T/C) ATI CA(A/G) GGI TA(T/C) AG(T/C) GA(T/C) TT(A/G)
TT-3'
[0209] In addition, a primary ("a") and a secondary ("b") sequence
of an internal peptide preparation (TcbA.sub.ii-PT81) have been
determined and are disclosed herein as SEQ ID NO:23 and SEQ ID
NO:24, respectively. Four pools of degenerate oligonucleotides
("Reverse Primers": TH-8, TH-9, TH-10 and TH-11) were similarly
designed and synthesized to encode the reverse complement of
sequences that encode a portion of the peptide of SEQ ID NO:23, as
shown below.
18TABLE 13 Amino Acid Thr Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn
TH-8 3'TGI AT(A/G) GAI TGI AGI AA(A/G) CT(T/C) GT(T/C) CAI CGI
TT(G/A)-5' TH-9 3'TGI AT(A/G) TT(A/G) TGI AGI AA(A/G) CT(T/C)
GT(T/C) CAT CGI TT(G/A)-5' TH-10 3'TGI AT(A/G) GAI TGI TC(G/A)
AA(A/G) CT(T/C) GT(T/C) CAT CGI TT(G/A)-5' TH-11 3'TGI ATCA/G)
TT(A/G) TGI TC(G/A) AA(A/G) CT(T/C) GT(T/C) CAT CGI TT(G/A)-5'
[0210] Sets of these primers were used in PCR.RTM. reactions to
amplify TcbA.sub.ii-encoding gene fragments from the genomic
Photorhabdus luminescens W-14 DNA prepared in Example 6. All
PCR.RTM. reactions were run with the "Hot Start" technique using
AmpliWax.TM. gems and other Perkin Elmer reagents and protocols.
Typically, a mixture (total volume 11 .mu.l) of MgCl.sub.2, dNTP's,
10.times.GeneAmp.RTM. PCR Buffer II, and the primers were added to
tubes containing a single wax bead. [10.times.GeneAmp.RTM. PCR
Buffer II is composed of 100 mM Tris-HCl, pH 8.3; and 500 mM KCl.]
The tubes were heated to 80.degree. C. for 2 minutes and allowed to
cool. To the top of the wax seals, a solution containing
10.times.GeneAmp.RTM. PCR Buffer II, DNA template, and
AmpliTaq.RTM. DNA polymerase were added. Following melting of the
wax seal and mixing of components by thermal cycling, final
reaction conditions (volume of 50 .mu.l) were: 10 mM Tris-HCl, pH
8.3; 50 mM KCl; 2.5 mM MgCl.sub.2; 200 .mu.M each in dATP, dCTP,
dGTP, dTTP; 1.25 mM in a single Forward primer pool; 1.25 .mu.M in
a single Reverse primer pool, 1.25 units of AmpliTaq.RTM. DNA
polymerase, and 170 ng of template DNA.
[0211] The reactions were placed in a thermocycler (as in Example
8) and run with the following program:
19TABLE 14 Temperature Time Cycle Repetition 94.degree. C. 2
minutes 1X 94.degree. C. 15 seconds 55-65.degree. C. 30 seconds 30X
72.degree. C. 1 minute.sup. 72.degree. C. 7 minutes 1X 15.degree.
C. Constant
[0212] A series of amplifications was run at three different
annealing temperatures (55.degree., 60.degree., 65.degree. C.)
using the degenerate primer pools. Reactions with annealing at
65.degree. C. had no amplification products visible following
agarose gel electrophoresis. Reactions having a 60.degree. C.
annealing regime and containing primers TH-5+TH-10 produced an
amplification product that had a mobility corresponding to 2.9 kbp.
A lesser amount of the 2.9 kbp product was produced under these
conditions with primers TH-7+TH-10. When reactions were annealed at
55.degree. C., these primer pairs produced more of the 2.9 kbp
product, and this product was also produced by primer pairs
TH-5+TH-8 and TH-5+TH-11. Additional very faint 2.9 kbp bands were
seen in lanes containing amplification products from primer pairs
TH-7 plus TH-8, TH-9, TH-10, or TH11.
[0213] To obtain sufficient PCR amplification product for cloning
and DNA sequence determination, 10 separate PCR reactions were set
up using the primers TH-5+TH-10, and were run using the above
conditions with a 55.degree. C. annealing temperature. All
reactions were pooled and the 2.9 kbp product was purified by Qiaex
extraction from an agarose gel as described above.
[0214] Additional sequences determined for TcbA.sub.ii internal
peptides are disclosed herein as SEQ ID NO:21 and SEQ ID NO:22. As
before, degenerate oligonucleotides (Reverse primers TH-17 and
TH-18) were made corresponding to the reverse complement of
sequences that encode a portion of the amino acid sequence of these
peptides.
20TABLE 15 From SEQ ID NO:21 Amino Acid Met Glu Thr Gln Asn Ile Gln
Glu Pro TH-17 3'-TAC CTT/C TGI GTT/C TTA/G TAI GTT/C GTT/C
GG-5'
[0215]
21TABLE 16 From SEQ ID NO:22 Amino Acid Asn Pro Ile Asn Ile Asn Thr
Gly Ile Asp Th-18 3'-TT(A/G) GGI TAI TT(A/G) TAI TTCA?G) TGI CCI
TAI CT(A/G)-5'
[0216] Degenerate oligonucleotides TH-18 and TH-17 were used in an
amplification experiment with Photorhabdus luminescens W-14 DNA as
template and primers TH-4, TH-5, TH-6, or TH-7 as the 5'-(Forward)
primers. These reactions amplified products of approximately 4 kbp
and 4.5 kbp, respectively. These DNAs were transferred from agarose
gels to nylon membranes and hybridized with a .sup.32P-labeled
probe (as described above) prepared from the 2.9 kbp product
amplified by the TH-5+TH10 primer pair. Both the 4 kbp and the 4.5
kbp amplification products hybridized strongly to the 2.9 kbp
probe. These results were used to construct a map ordering the
TcbA.sub.ii internal peptide sequences as shown in FIG. 3.
Approximate distances between the primers are shown in nucleotides
in FIG. 3.
[0217] DNA Sequence of the 2.9 kbp TcbA.sub.ii-encoding
Fragment
[0218] Approximately 200 ng of the purified 2.9 kbp fragment
(prepared above) was precipitated with ethanol and dissolved in 17
ml of water. One-half of this was used as sequencing template with
25 pmol of the TH-5 pool as primers, the other half was used as
template for TH-10 priming. Sequencing reactions were as given in
Example 8. No reliable sequence was produced using the TH-10 primer
pool; however, reactions with TH-5 primer pool produced the
sequence disclosed below:.
22 1 AATCGTGTTG ATCCCTATGC CGNGCCCGGT TCGGTGGAAT CGATGTCCTC
ACCGGGGGTT 61 TATTNGAGGG ANTNGTCCCG TGAGGCCAAA AANTGGAATG
AAAGAAGTTC AATTTNTTAC 121 CTAGATAAAC GTCGCCCGGN TTTAGAAAGN
TTANTGNTCA GCCAGAAAAT TTTGGTTGAG 181 GAAATTCCAC CGNTGGTTCT
CTCTATTGAT TNGGGCCTGG CCGGGTTCGA ANNAAAACNA 241 GGAAATNCAC
AAGTTGAGGT GATGGNTTTG TNGCNANCTT NTCGTTTAGG TGGGGAGAAA 301
CCTTNTCANC ACGNTTNTGA AACTGTCCGG GAAATCGTCC ATGAMCGTGA NCCAGGNTTN
361 CGCCATTGG
[0219] Based on this sequence, a sequencing primer (TH-21,
5'-CCGGGCGACGTTTATCTAGG-3') was designed to reverse complement
bases 120-139, and initiate polymerization towards the 5' end
(i.e., TH-5 end) of the gel-purified 2.9 kbp TcbA.sub.ii-encoding
PCR fragment. The determined sequence is shown below, and is
compared to the biochemically determined N-terminal peptide
sequence of TcbA.sub.ii SEQ ID NO:1.
[0220] TcbA.sub.ii 2.9 kbp PCR Fragment Sequence Confirmation
[Underlined Amino Acids=Encoded by Degenerate Oligonucleotides]
23 F I O G Y S D L F G - - A SEQ ID NO:1 .vertline. .vertline.
.vertline. .vertline. .vertline. .vertline. .vertline. .vertline.
.vertline. .vertline. .vertline. 2.9 kbp seq GC ATG CAG GGG TAT AGT
GAC CTG TTT GGT AAT CGT GCT M Q G Y S D L F G N R A >
[0221] From the homology of the derived amino acid sequence to the
biochemically determined one, it is clear that the 2.9 kbp PCR
fragment represents the TcbA coding region. This 2.9 kbp fragment
was then used as a hybridization probe to screen the Photorhabdus
W-14 genomic library prepared in Example 8 for cosmids containing
the TcbA.sub.ii-encoding gene.
[0222] Screening the Photorhabdus Cosmid Library
[0223] The 2.9 kb gel-purified PCR fragment was labeled with
.sup.32P using the Boehringer Mannheim High Prime labeling kit as
described in Example 8. Filters containing remnants of
approximately 800 colonies from the cosmid library were screened as
described previously (Example 8), and positive clones were streaked
for isolated colonies and rescreened. Three clones (8A11, 25G8, and
26D1) gave positive results through several screening and
characterization steps. No hybridization of the
TcbA.sub.ii-specific probe was ever observed with any of the four
cosmids identified in Example 8, and which contain the tcab and
tcaC genes. DNA from cosmids 8A11, 25G8, and 26D1 was digested with
restriction enzymes Bgl II, EcoR I or Hind III (either alone or in
combination with one another), and the fragments were separated on
an agarose gel and transferred to a nylon membrane as described in
Example 8. The membrane was hybridized with .sup.32P-labeled probe
prepared from the 4.5 kbp fragment (generated by amplification of
Photorhabdus genomic DNA with primers TH-5+TH-17). The patterns
generated from cosmid DNAs 8A11 and 26D1 were identical to those
generated with similarly-cut genomic DNA on the same membrane. It
is concluded that cosmids 8A11 and 26D1 are accurate
representations of the genomic TcbA.sub.ii encoding locus. However,
cosmid 25G8 has a single Bgl II fragment which is slightly larger
than the genomic DNA. This may result from positioning of the
insert within the vector.
[0224] DNA Sequence of the tcbA-encoding Gene
[0225] The membrane hybridization analysis of cosmid 26D1 revealed
that the 4.5 kbp probe hybridized to a single large EcoR I fragment
(greater than 9 kbp). This fragment was gel purified and ligated
into the EcoR I site of pBC KS (+) as described in Example 8, to
generate plasmid pBC-S1/R1. The partial DNA sequence of the insert
DNA of this plasmid was determined by "primer walking" from the
flanking vector sequence, using procedures described in Example 8.
Further sequence was generated by extension from new
oligonucleotides designed from the previously determined sequence.
When compared to the determined DNA sequence for the tcbA gene
identified by other methods (disclosed herein as SEQ ID NO:11 as
described in Example 12 below), complete homology was found to
nucleotides 1-272, 319-826, 2578-3036, and 3068-3540 (total
bases=1712). It was concluded that both approaches can be used to
identify DNA fragments encoding the TcbA.sub.ii peptide.
[0226] Analysis of the Derived Amino Acid Sequence of the tcbA
Gene
[0227] The sequence of the DNA fragment identified as SEQ ID NO:11
encodes a protein whose derived amino acid sequence is disclosed
herein as SEQ ID NO:12. Several features verify the identity of the
gene as that encoding the TcbA.sub.ii protein. The TcbA.sub.ii
N-terminal peptide (SEQ ID NO:1; Phe Ile Gln Gly Tyr Ser Asp Leu
Phe Gly Asn Arg Ala) is encoded as amino acids 88-100. The
TcbA.sub.ii internal peptide TcbA.sub.ii-PT81(a) (SEQ ID NO:23) is
encoded as amino acids 1065-1077, and TcbA.sub.ii-PT81 (b) (SEQ ID
NO:24) is encoded as amino acids 1571-1592. Further, the internal
peptide TcbA.sub.ii-PT56 (SEQ ID NO:22) is encoded as amino acids
1474-1488, and the internal peptide TcbA.sub.ii-PT103 (SEQ ID
NO:21) is encoded as amino acids 1614-1639. It is obvious that this
gene is an authentic clone encoding the TcbA.sub.ii peptide as
isolated from insecticidal protein preparations of Photorhabdus
luminescens strain W-14.
[0228] The protein isolated as peptide TcbA.sub.ii is derived from
cleavage of a longer peptide. Evidence for this is provided by the
fact that the nucleotides encoding the TcbA.sub.ii N-terminal
peptide SEQ ID NO:1 are preceded by 261 bases (encoding 87
N-terminal-proximal amino acids) of a longer open reading frame
(SEQ ID NO:11). This reading frame begins with nucleotides that
encode the amino acid sequence Met Gln Asn Ser Leu, which
corresponds to the N-terminal sequence of the large peptide TcbA,
and is disclosed herein as SEQ ID NO:16. It is thought that TcbA is
the precursor protein for TcbA.sub.ii.
[0229] Relationship of tcbA, tcaB and tcaC Genes
[0230] The tcaB and tcaC genes are closely linked and may be
transcribed as a single mRNA (Example 8). The tcbA gene is borne on
cosmids that apparently do not overlap the ones harboring the tcaB
and tcaC cluster, since the respective genomic library screens
identified different cosmids. However, comparison of the amino
sequences encoded by the tcab and tcaC genes with the tcbA gene
reveals a substantial degree of homology. The amino acid
conservation (Protein Alignment Mode of MacVector.TM. Sequence
Analysis Software, scoring matrix pam250, hash value=2; Oxford
Molecular Group, Campbell, Calif.) is shown in FIG. 4. On the score
line of each panel in FIG. 4, up carats ({circumflex over ( )})
indicate homology or conservative amino acid changes, and down
carats (v) indicate nonhomology.
[0231] This analysis shows that the amino acid sequence of the TcbA
peptide from residues 1739 to 1894 is highly homologous to amino
acids 441 to 603 of the TcaB.sub.i peptide (162 of the total 627
amino acids of TcaB; SEQ ID NO:28). In addition, the sequence of
TcbA amino acids 1932 to 2459 is highly homologous to amino acids
12 to 531 of peptide TcaB.sub.ii (520 of the total 562 amino acids;
SEQ ID NO:30). Considering that the TcbA peptide (SEQ ID NO:12)
comprises 2505 amino acids, a total of 684 amino acids (27%) at the
C-proximal end of it is homologous to the TcaB.sub.i or TcaB.sub.ii
peptides, and the homologies are arranged colinear to the
arrangement of the putative TcaB preprotein (SEQ ID NO:26). A
sizeable gap in the TcbA homology coincides with the junction
between the TcaB.sub.i and TcaB.sub.ii portions of the TcaB
preprotein. Clearly the TcbA and TcaB gene products are
evolutionarily related, and it is proposed that they share some
common function(s) in Photorhabdus.
Example 10
Characterization of Zinc-metalloproteases in Photorhabdus Broth:
Protease Inhibition, Classification, and Purification
[0232] Protease Inhibition and Classification Assays: Protease
assays were performed using FITC-casein dissolved in water as
substrate (0.08% final assay concentration). Proteolysis reactions
were performed at 25.degree. C. for 1 h in the appropriate buffer
with 25 .mu.l of Photorhabdus broth (150 .mu.l total reaction
volume). Samples were also assayed in the presence and absence of
dithiothreitol. After incubation, an equal volume of 12%
trichloroacetic acid was added to precipitate undigested protein.
Following precipitation for 0.5 h and subsequent centrifugation,
100 .mu.l of the supernatant was placed into a 96-well microtiter
plate and the pH of the solution was adjusted by addition of an
equal volume of 4N NaOH. Proteolysis was then quantitated using a
Fluoroskan II fluorometric plate reader at excitation and emission
wavelengths of 485 and 538 nm, respectively. Protease activity was
tested over a range from pH 5.0-10.0 in 0.5 units increments. The
following buffers were used at 50 mM final concentration: sodium
acetate (pH 5.0-6.5); Tris-HCL (pH 7.0-8.0); and bis-Tris propane
(pH 8.5-10.0). To identify the class of protease(s) observed, crude
broth was treated with a variety of protease inhibitors (0.5
.mu.g/.mu.l final concentration) and then examined for protease
activity at pH 8.0 using the substrate described above. The
protease inhibitors used included E-64
(L-trans-expoxysaccinylleucylamido[4-,-guan- idino]-butane), 3,4
dichloroisocoumarin, Leupeptin, pepstatin, amastatin,
ethylenediaminetetraacetic acid (EDTA) and 1,10 phenanthroline.
[0233] Protease assays performed over a pH range revealed that
indeed protease(s) were present which exhibited maximal activity at
about pH 8.0 (Table 17). Addition of DTT did not have any effect on
protease activity. Crude broth was then treated with a variety of
protease inhibitors (Table 18). Treatment of crude broth with the
inhibitors described above revealed that 1,10 phenanthroline caused
complete inhibition of all protease activity when added at a final
concentration of 50 .mu.g, with the IC.sub.50=5 .mu.g in 100 .mu.l
of a 2 mg/ml crude broth solution. These data indicate that the
most abundant protease(s) found in the Photorhabdus broth are from
the zinc-metalloprotease class of enzymes.
24TABLE 17 Effect of pH on the Protease Activity Found in a Day 1
Production of Photorhabdus luminescens (Strain W-14) Percent pH
Flu. Units.sup.a Activity.sup.b 5.0 3013 .+-. 78 17 5.5 7994 .+-.
448 45 6.0 12965 .+-. 483 74 6.5 14390 .+-. 1291 82 7.0 14386 .+-.
1287 82 7.5 14135 .+-. 198 80 8.0 17582 .+-. 831 100 8.5 16183 .+-.
953 92 9.0 16795 .+-. 760 96 9.5 16279 .+-. 1022 93 10.0 15225 .+-.
210 87 .sup.aFlu. Units = Fluorescence Units (Maximum = about
28,000; background = about 2200). B Percent activity relative to
the maximum at pH 8.0
[0234]
25TABLE 18 Effect of Different Protease Inhibitors on the Protease
Activity at pH 8 Found in a Day 1 Production of Photorhabdus
luminescens (Strain W-14) Inhibitor Corrected Flu. Units.sup.a
Percent Inhibition.sup.b Control 13053 0 E-64 14259 0 1,10
Phenanthroline.sup.c 15 99 3,4 Dichloroisocoumarin.sup.d 7956 39
Leupeptin 13074 0 Pepstatin.sup.c 13441 0 Amastatin 12474 4 DMSO
Control 12005 8 Methanol Control 12125 7 .sup.aCorrected Flu. Units
= Fluorescence Units - background(2200 flu. units). .sup.bPercent
Inhibition relative to protease activity at pH 8.0.
.sup.cInhibitors were dissolved in methanol. .sup.dInhibitors were
dissolved in DMSO.
[0235] The isolation of a zinc-metalloprotease was performed by
applying dialyzed 10-80% ammonium sulfate pellet to a Q Sepharose
column equilibrated at 50 mM Na.sub.2PO.sub.4, pH 7.0 as described
in Example 5 for Photorhabdus toxin. After extensive washing, a 0
to 0.5 M NaCl gradient was used to elute toxin protein. The
majority of biological activity and protein was eluted from
0.15-0.45 M NaCl. However, it was observed that the majority of
proteolytic activity was present in the 0.25-0.35 M NaCl fraction
with some activity in the 0.15-0.25 M NaCl fraction. SDS PAGE
analysis of the 0.25-0.35 M NaCl fraction showed a major peptide
band of approximately 60 kDa. The 0.15-0.25 M NaCl fraction
contained a similar 60 kDa band but at lower relative protein
concentration. Subsequent gel filtration of this fraction using a
Superose 12 HR 16/50 column resulted in a major peak migrating at
57.5 kDa that contained a predominant (>90% of total stained
protein) 58.5 kDa band by SDS PAGE analysis. Additional analysis of
this fraction using various protease inhibitors as described above
determined that the protease was a zinc-metalloprotease. Nearly all
of the protease activity present in Photorhabdus broth at day 1 of
fermentation corresponded to the about 58 kDa
zinc-metalloprotease.
[0236] In yet a second isolation of zinc-metalloprotease(s), W-14
Photorhabdus broth grown for three days was taken and protease
activity was visualized using sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) laced with gelatin as described in
Schmidt, T. M., Bleakley, B. and Nealson, K. M. 1988. SDS running
gels (5.5.times.8 cm) were made with 12.5% polyacrylamide (40%
stock solution of acrylamide/bis-acrylamide; Sigma Chemical Co.,
St. Louis, Mo.) into which 0.1% gelatin final concentration (Biorad
EIA grade reagent; Richmond Calif.) was incorporated upon
dissolving in water. SDS-stacking gels (1.0.times.8 cm) were made
with 5% polyacrylamide, also laced with 0.1% gelatin. Typically,
2.5 .mu.g of protein to be tested was diluted in 0.03 ml of
SDS-PAGE loading buffer without dithiothreitol (DTT) and loaded
onto the gel. Proteins were electrophoresed in SDS running buffer
(Laemmli, U.K. 1970. Nature 227, 680) at 0.degree. C. and at 8 mA.
After electrophoresis was complete, the gel was washed for 2 h in
2.5% (v/v) Triton X-100. Gels were then incubated for 1 h at
37.degree. C. in 0.1 M glycine (pH 8.0). After incubation, gels
were fixed and stained overnight with 0.1% amido black in
methanol-acetic acid-water (30:10:60, vol./vol./vol.; Sigma
Chemical Co.). Protease activity was visualized as light areas
against a dark, amido black stained background due to proteolysis
and subsequent diffusion of incorporated gelatin. At least three
distinct bands produced by proteolytic activity at 58-, 41-, and 38
kDa were observed.
[0237] Activity assays of the different proteases in W-14 day three
culture broth were performed using FITC-casein dissolved in water
as substrate (0.02% final assay concentration). Proteolysis
experiments were performed at 37.degree. C. for 0-0.5 h in 0.1M
Tris-HCl (pH 8.0) with different protein fractions in a total
volume of 0.15 ml. Reactions were terminated by addition of an
equal volume of 12% trichloroacetic acid (TCA) dissolved in water.
After incubation at room temperature for 0.25 h, samples were
centrifuged at 10,000.times.g for 0.25 h and 0.10 ml aliquots were
removed and placed into 96-well microtiter plates. The solution was
then neutralized by the addition of an equal volume of 2 N sodium
hydroxide, followed by quantitation using a Fluoroskan II
fluorometric plate reader with excitation and emission wavelengths
of 485 and 538 nm, respectively. Activity measurements were
performed using FITC-Casein with different protease concentrations
at 37.degree. C. for 0-10 min. A unit of activity was arbitrarily
defined as the amount of enzyme needed to produce 1000 fluorescent
units/min and specific activity was defined as units/mg of
protease.
[0238] Inhibition studies were performed using two
zinc-metalloprotease inhibitors; 1,10 phenanthroline and
N-(a-rhamnopyranosyloxyhydroxyphosphi- nyl)-Leu-Trp(phosphoramidon)
with stock solutions of the inhibitors dissolved in 100% ethanol
and water, respectively. Stock concentrations were typically 10
mg/ml and 5 mg/ml for 1,10 phenanthroline and phosphoramidon,
respectively, with final concentrations of inhibitor at 0.5-1.0
mg/ml per reaction. Treatment of three day W-14 crude broth with
1,10 phenanthroline, an inhibitor of all zinc metalloproteases,
resulted in complete elimination of all protease activity while
treatment with phosphoramidon, an inhibitor of thermolysin-like
proteases (Weaver, L. H., Kester, W. R., and Matthews, B. W. 1977.
J. Mol. Biol. 114, 119-132), resulted in about 56% reduction of
protease activity. The residual proteolytic activity could not be
further reduced with additional phosphoramidon.
[0239] The proteases of three day W-14 Photorhabdus broth were
purified as follows: 4.0 liters of broth were concentrated using an
Amicon spiral ultra filtration cartridge Type S1Y100 attached to an
Amicon M-12 filtration device. The flow-through material having
native proteins less than 100 kDa in size (3.8 L) was concentrated
to 0.375 L using an Amicon spiral ultra filtration cartridge Type
S1Y10 attached to an Amicon M-12 filtration device. The retentate
material contained proteins ranging in size from 10-100 kDa. This
material was loaded onto a Pharmacia HR16/10 column which had been
packed with PerSeptive Biosystem (Framington, Mass.) Poros.RTM. 50
HQ strong anion exchange packing that had been equilibrated in 10
mM sodium phosphate buffer (pH 7.0). Proteins were loaded on the
column at a flow rate of 5 ml/min, followed by washing unbound
protein with buffer until A.sub.280=0.00. Afterwards, proteins were
eluted using a NaCl gradient of 0-1.0 M NaCl in 40 min at a flow
rate of 7.5 ml/min. Fractions were assayed for protease activity,
supra., and active fractions were pooled. Proteolytically active
fractions were diluted with 50% (v/v) 10 mM sodium phosphate buffer
(pH 7.0) and loaded onto a Pharmacia HR 10/10 Mono Q column
equilibrated in 10 mM sodium phosphate. After washing the column
with buffer until A.sub.280=0.00, proteins were eluted using a NaCl
gradient of 0-0.5 M NaCl for 1 h at a flow rate of 2.0 ml/min.
Fractions were assayed for protease activity. Those fractions
having the greatest amount of phosphoramidon-sensitive protease
activity, the phosphoramidon sensitive activity being due to the
41/38 kDa protease, infra., were pooled. These fractions were found
to elute at a range of 0.15-0.25 M NaCl. Fractions containing a
predominance of phosphoramidon-insensitive protease activity, the
58 kDa protease, were also pooled. These fractions were found to
elute at a range of 0.25-0.35 M NaCl. The phosphoramidon-sensitive
protease fractions were then concentrated to a final volume of 0.75
ml using a Millipore Ultrafree.RTM.-15 centrifugal filter device
Biomax-5K NMWL membrane. This material was applied at a flow rate
of 0.5 ml/min to a Pharmacia HR 10/30 column that had been packed
with Pharmacia Sephadex G-50 equilibrated in 10 mM sodium phosphate
buffer (pH 7.0)/0.1 M NaCl. Fractions having the maximal
phosphoramidon-sensitive protease activity were then pooled and
centrifuged over a Millipore Ultrafree.RTM.-15 centrifugal filter
device Biomax-50K NMWL membrane. Proteolytic activity analysis,
supra., indicated this material to have only
phosphoramidon-sensitive protease activity. Pooling of the
phosphoramidon-insensitive protease, the 58 kDa protein, was
followed by concentrating in a Millipore Ultrafree.RTM.-15
centrifugal filter device Biomax-50K NMWL membrane and further
separation on a Pharmacia Superdex-75 column. Fractions containing
the protease were pooled.
[0240] Analysis of purified 58- and 41/38 kDa purified proteases
revealed that, while both types of protease were completely
inhibited with 1,10 phenanthroline, only the 41/38 kDa protease was
inhibited with phosphoramidon. Further analysis of crude broth
indicated that protease activity of day 1 W-14 broth has 23% of the
total protease activity due to the 41/38 kDa protease, increasing
to 44% in day three W-14 broth.
[0241] Standard SDS-PAGE analysis for examining protein purity and
obtaining amino terminal sequence was performed using 4-20%
gradient MiniPlus SepraGels purchased from Integrated Separation
Systems (Natick, Mass.). Proteins to be amino-terminal sequenced
were blotted onto PVDF membrane following purification, infra.,
(ProBlott.TM. Membranes; Applied Biosystems, Foster City, Calif.),
visualized with 0.1% amido black, excised, and sent to Cambridge
Prochem; Cambridge, Mass., for sequencing.
[0242] Deduced amino terminal sequence of the 58-(SEQ ID NO:45) and
41/38 kDa (SEQ ID NO:44) proteases from three day old W-14 broth
were DV-GSEKANEKLK (SEQ ID NO: 45) and DSGDDDKVTNTDIHR (SEQ ID
NO:44), respectively.
[0243] Sequencing of the 41/38 kDa protease revealed several amino
termini, each one having an additional amino acid removed by
proteolysis. Examination of the primary, secondary, tertiary and
quartenary sequences for the 38 and 41 kDa polypeptides allowed for
deduction of the sequence shown above and revealed that these two
proteases are homologous.
EXAMPLE 11, PART A
Screening of Photorhabdus Genomic Library Via Use of Antibodies for
Genes Encoding TcbA Peptide
[0244] In parallel to the sequencing described above, suitable
probing and sequencing was done based on the TcbA.sub.ii peptide
(SEQ ID NO:1). This sequencing was performed by preparing bacterial
culture broths and purifying the toxin as described in Examples 1
and 2 above.
[0245] Genomic DNA was isolated from the Photorhabdus luminescens
strain W-14 grown in Grace's insect tissue culture medium. The
bacteria were grown in 5 ml of culture medium in a 250 ml
Erlenmeyer flask at 28.degree. C. and 250 rpm for approximately 24
hours. Bacterial cells from 100 ml of culture medium were pelleted
at 5000.times.g for 10 minutes. The supernatant was discarded, and
the cell pellets then were used for the genomic DNA isolation.
[0246] The genomic DNA was isolated using a modification of the
CTAB method described in Section 2.4.3 of Ausubel (supra.). The
section entitled "Large Scale CsCl prep of bacterial genomic DNA"
was followed through step 6. At this point, an additional
chloroform/isoamyl alcohol (24:1) extraction was performed followed
by a phenol/chloroform/isoamyl (25:24:1) extraction step and a
final chloroform/isoamyl/alcohol (24:1) extraction. The DNA was
precipitated by the addition of a 0.6 volume of isopropanol. The
precipitated DNA was hooked and wound around the end of a bent
glass rod, dipped briefly into 70% ethanol as a final wash, and
dissolved in 3 ml of TE buffer.
[0247] The DNA concentration, estimated by optical density at
280/260 nm, was approximately 2 mg/ml.
[0248] Using this genomic DNA, a library was prepared.
Approximately 50 .mu.g of genomic DNA was partly digested with Sau3
A1. Then NaCl density gradient centrifugation was used to size
fractionate the partially digested DNA fragments. Fractions
containing DNA fragments with an average size of 12 kb, or larger,
as determined by agarose gel electrophoresis, were ligated into the
plasmid BluScript, Stratagene, La Jolla, Calif., and transformed
into an E. coli DH5.alpha. or DHB10 strain.
[0249] Separately, purified aliquots of the protein were sent to
the biotechnology hybridoma center at the University of Wisconsin,
Madison for production of monoclonal antibodies to the proteins.
The material that was sent was the HPLC purified fraction
containing native bands 1 and 2 which had been denatured at
65.degree. C., and 20 .mu.g of which was injected into each of four
mice. Stable monoclonal antibody-producing hybridoma cell lines
were recovered after spleen cells from unimmunized mouse were fused
with a stable myeloma cell line. Monoclonal antibodies were
recovered from the hybridomas.
[0250] Separately, polyclonal antibodies were created by taking
native agarose gel purified band 1 (see Example 1) protein which
was then used to immunize a New Zealand white rabbit. The protein
was prepared by excising the band from the native agarose gels,
briefly heating the gel pieces to 65.degree. C. to melt the
agarose, and immediately emulsifying with adjuvant. Freund's
complete adjuvant was used for the primary immunizations and
Freund's incomplete was used for 3 additional injections at monthly
intervals. For each injection, approximately 0.2 ml of emulsified
band 1, containing 50 to 100 micrograms of protein, was delivered
by multiple subcontaneous injections into the back of the rabbit.
Serum was obtained 10 days after the final injection and additional
bleeds were performed at weekly intervals for 3 weeks. The serum
complement was inactivated by heating to 56.degree. C. for 15
minutes and then stored at -20.degree. C.
[0251] The monoclonal and polyclonal antibodies were then used to
screen the genomic library for the expression of antigens which
could be detected by the epitope. Positive clones were detected on
nitrocellulose filter colony lifts. An immunoblot analysis of the
positive clones was undertaken.
[0252] An analysis of the clones as defined by both immunoblot and
Southern analysis resulted in the tentative identification of four
genomic regions.
[0253] In the first region was a gene encoding the peptide
designated here as TcbA.sub.ii. Full DNA sequence of this gene
(tcbA) was obtained. It is set forth as SEQ ID NO:11. Confirmation
that the sequence encodes the internal sequence of SEQ ID NO:1 is
demonstrated by the presence of SEQ ID NO:1 at amino acid number 88
from the deduced amino acid sequence created by the open reading
frame of SEQ ID NO:11. This can be confirmed by referring to SEQ ID
NO:12, which is the deduced amino acid sequence created by SEQ ID
NO:11.
[0254] The second region of toxin peptides contains the segments
referred to above as TcaB.sub.i, TcaB.sub.ii and TcaC. Following
the screening of the library with the polyclonal antisera, this
second region of toxin genes was identified by several clones which
produced different size proteins, all of which cross-reacted with
the polyclonal antibody on an immunoblot and were also found to
share DNA homology on a Southern Blot. Sequence comparison revealed
that they belonged to the gene complex designated TcaB and TcaC
above.
[0255] Two other regions of antibody toxin clones were also
isolated in the polyclonal screen. These regions produced proteins
that cross-react with a polyclonal antibody and also shared DNA
homology with the regions as determined by Southern blotting. Thus,
it appears that the Photorhabdus luminescens extracellular protein
genes represent a family of genes which are evolutionarily
related.
[0256] To further pursue the concept that there might be
evolutionarily related variations in the toxin peptides contained
within this organism, two approaches have been undertaken to
examine other strains of Photorhabdus luminescens for the presence
of related proteins. This was done both by PCR amplification of
genomic DNA and by immunoblot analysis using the polyclonal and
monoclonal antibodies.
[0257] The results indicate that related proteins are produced by
Photorhabdus. luminescens strains WX-2, WX-3, WX-4, WX-5, WX-6,
WX-7, WX-8, WX-11, WX-12, WX-15 and W-14.
EXAMPLE 11, PART B
Sequence and Analysis of tcc Toxin Clones
[0258] Further DNA sequencing was performed on plasmids isolated
from E. coli clones described in Example 11, Part A. The nucleotide
sequence from the third region of E. coli clones was shown to be
three closely linked open reading frames at this genomic locus.
This locus was designated tcc with the three open reading frames
designated tccA SEQ ID NO:56, tccB SEQ ID NO:58 and tccc SEQ ID
NO:60. The close linkage between these open reading frames is
revealed by examination of SEQ ID NO:56, in which 93 bp separate
the stop codon of tccA from the start codon of tccb (bases
2992-2994 of SEQ ID NO:56), and by examination of SEQ ID NO:58, in
which 131 bases separate the stop codon of tccB and the tccC (bases
4930-4932 of SEQ ID NO:58). The physical map is presented in FIG.
6B.
[0259] The deduced amino acid sequence from the tccA open reading
frame indicates that the gene encodes a protein of 105,459 Da. This
protein was designated TccA (SEQ ID NO:57). The first 12 amino
acids of this protein match the N-terminal sequence obtained from a
108 kDa protein, SEQ ID NO:8, previously identified as part of the
toxin complex.
[0260] The deduced amino acid sequence from the tccB open reading
frame indicates that this gene encodes a protein of 175,716 Da.
This protein was designated TccB (SEQ ID NO:59). The first 11 amino
acids of this protein match the N-terminal sequence obtained from a
protein with estimated molecular weight of 185 kDa, SEQ ID NO:7.
Similarity analysis revealed that the TccB protein is related to
the proteins identified as TcbA SEQ ID NO:12; 37% similarity and
28% identity, TcdA SEQ ID NO:47; 35% similarity and 28% identity,
and TcaB SEQ ID NO:26; 32% similarity and 26% identity (using the
GAP algorithm Wisconsin Package Version 9.0, Genetics Computer
Group (GCG) Madison Wis.).
[0261] The deduced amino acid sequence of tccC indicated that this
open reading frame encodes a protein of 111,694 Da and the protein
product was designated TccC (SEQ ID NO:61)
EXAMPLE 12
Characterization of Photorhabdus Strains
[0262] In order to establish that the collection described herein
was comprised of Photorhabdus strains, the strains herein were
assessed in terms of recognized microbiological traits that are
characteristic of Photorhabdus and which differentiate it from
other Enterobacteriaceae and Xenorhabdus spp. (Farmer, J. J. 1984.
Bergey's Manual of Systemic Bacteriology, Vol 1. pp. 510-511. (ed.
Kreig N. R. and Holt, J. G.). Williams & Wilkins, Baltimore;
Akhurst and Boemare, 1988, Boemare et al., 1993). These
characteristic traits are as follows: Gram's stain negative rods,
organism size of 0.5-2 .mu.m in width and 2-10 .mu.m in length,
red/yellow colony pigmentation, presence of crystalline inclusion
bodies, presence of catalase, inability to reduce nitrate, presence
of bioluminescence, ability to take up dye from growth media,
positive for protease production, growth-temperature range below
37.degree. C., survival under anaerobic conditions and positively
motile. (Table 20). Reference Escherichia coli, Xenorhabdus and
Photorhabdus strains were included in all tests for comparison. The
overall results are consistent with all strains being part of the
family Enterobacteriaceae and the genus Photorhabdus.
[0263] A luminometer was used to establish the bioluminescence of
each strain and provide a quantitative and relative measurement of
light production. For measurement of relative light emitting units,
the broths from each strain (cells and media) were measured at
three time intervals after inoculation in liquid culture (6, 12,
and 24 hr) and compared to background luminosity (uninoculated
media and water). Prior to measuring light emission from the
various broths, cell density was established by measuring light
absorbance (560 nM) in a Gilford Systems (Oberlin, Ohio)
spectrophotometer using a sipper cell. Appropriate dilutions were
then made (to normalize optical density to 1.0 unit) before
measuring luminosity. Aliquots of the diluted broths were then
placed into cuvettes (300 .mu.l each) and read in a Bio-Orbit 1251
Luminometer (Bio-Orbit Oy, Twiku, Finland). The integration period
for each sample was 45 seconds. The samples were continuously mixed
(spun in baffled cuvettes) while being read to provide oxygen
availability. A positive test was determined as being
.gtoreq.5-fold background luminescence (about 5-10 units). In
addition, colony luminosity was detected with photographic film
overlays and visually, after adaptation in a darkroom. The Gram's
staining characteristics of each strain were established with a
commercial Gram's stain kit (BBL, Cockeysville, Md.) used in
conjunction with Gram's stain control slides (Fisher Scientific,
Pittsburgh, Pa.). Microscopic evaluation was then performed using a
Zeiss microscope (Carl Zeiss, Germany) 100.times. oil immersion
objective lens (with 10.times. ocular and 2.times. body
magnification). Microscopic examination of individual strains for
organism size, cellular description and inclusion bodies (the
latter after logarithmic growth) was performed using wet mount
slides (10.times. ocular, 2.times. body and 40.times. objective
magnification) with oil immersion and phase contrast microscopy
with a micrometer (Akhurst, R. J. and Boemare, N. E. 1990.
Entomopathogenic Nematodes in Biological Control (ed. Gaugler, R.
and Kaya, H.). pp. 75-90. CRC Press, Boca Raton, USA.; Baghdiguian
S., Boyer-Giglio M. H., Thaler, J. O., Bonnot G., Boemare N. 1993.
Biol. Cell 79, 177-185.). Colony pigmentation was observed after
inoculation on Bacto nutrient agar, (Difco Laboratories, Detroit,
Mich.) prepared as per label instructions. Incubation occurred at
28.degree. C. and descriptions were produced after 5-7 days. To
test for the presence of the enzyme catalase, a colony of the test
organism was removed on a small plug from a nutrient agar plate and
placed into the bottom of a glass test tube. One ml of a household
hydrogen peroxide solution was gently added down the side of the
tube. A positive reaction was recorded when bubbles of gas
(presumptive oxygen) appeared immediately or within 5 seconds.
Controls of uninoculated nutrient agar and hydrogen peroxide
solution were also examined. To test for nitrate reduction, each
culture was inoculated into 10 ml of Bacto Nitrate Broth (Difco
Laboratories, Detroit, Mich.). After 24 hours incubation at
28.degree. C., nitrite production was tested by the addition of two
drops of sulfanilic acid reagent and two drops of
alpha-naphthylamine reagent (see Difco Manual, 10th edition, Difco
Laboratories, Detroit, Mich., 1984). The generation of a distinct
pink or red color indicates the formation of nitrite from nitrate.
The ability of each strain to uptake dye from growth media was
tested with Bacto MacConkey agar containing the dye neutral red;
Bacto Tergitol-7 agar containing the dye bromothymol blue and Bacto
EMB Agar containing the dye eosin-Y (agars from Difco Laboratories,
Detroit, Mich., all prepared according to label instructions).
After inoculation on these media, dye uptake was recorded after
incubation at 28.degree. C. for 5 days. Growth on these latter
media is characteristic for members of the family
Enterobacteriaceae. Motility of each strain was tested using a
solution of Bacto Motility Test Medium (Difco Laboratories,
Detroit, Mich.) prepared as per label instructions. A butt-stab
inoculation was performed with each strain and motility was judged
macroscopically by a diffuse zone of growth spreading from the line
of inoculum. In many cases, motility was also observed
microscopically from liquid culture under wet mount slides.
Biochemical nutrient evaluation for each strain was performed using
BBL Enterotube II (Benton, Dickinson, Germany). Product
instructions were followed with the exception that incubation was
carried out at 28.degree. C. for 5 days. Results were consistent
with previously cited reports for Photorhabdus. The production of
protease was tested by observing hydrolysis of gelatin using Bacto
gelatin (Difco Laboratories, Detroit, Mich.) plates made as per
label instructions. Cultures were inoculated and the plates were
incubated at 28.degree. C. for 5 days. To assess growth at
different temperatures, agar plates [2% proteose peptone #3 with
two percent Bacto-Agar (Difco, Detroit, Mich.) in deionized water]
were streaked from a common source of inoculum. Plates were sealed
with Nesco.RTM. film and incubated at 20, 28 and 37.degree. C. for
up to three weeks. Plates showing no growth at 37.degree. C. showed
no cell viability after transfer to a 28.degree. C. incubator for
one week. Oxygen requirements for Photorhabdus strains were tested
in the following manner. A butt-stab inoculation into fluid
thioglycolate broth medium (Difco, Detroit, Mich.) was made. The
tubes were incubated at room temperature for one week and cultures
were then examined for type and extent of growth. The indicator
resazurin demonstrates the level of medium oxidation or the
aerobiosis zone (Difco Manual, 10th edition, Difco Laboratories,
Detroit, Mich.). Growth zone results obtained for the Photorhabdus
strains tested were consistent with those of a facultative
anaerobic microorganism.
26TABLE 19 Taxonomic Traits of Photorhabdus Strains Traits
Assessed* Strain A B C D E F G H I J K L M N O P Q W-14
-.sup..dagger. + + rd S + - + + + O + + + + + + - WX-1 - + + rd S +
- + + + O + + + + + + - WX-2 - + + rd S + - + + + O + + + + + + -
WX-3 - + + rd S + - + + + YT + + + + + + - WX-4 - + + rd S + - + +
+ YT + + + + + + - WX-5 - + + rd S + - + + + LO + + + + + + - WX-6
- + + rd S + - + + + LY + + + + + + - WX-7 - + + rd S + - + + + R +
+ + + + + - WX-8 - + + rd S + - + + + O + + + + + + - WX-9 - + + rd
S + - + + + YT + + + + + + - WX-10 - + + rd S + - + + + Ro + + + +
+ + - WX-11 - + + rd S + - + + + Ro + + + + + + - WX-12 - + + rd S
+ - + + + O + + + + + + - WX-14 - + + rd S + - + + + LR + + + + + +
- WX-15 - + + rd S + - + + + LR + + + + + + - H9 - + + rd S + - + +
+ LY + + + + + + - Hb - + + rd S + - + + + YT + + + + + + - Hm - +
+ rd S + - + + + TY + + + + + + - HP88 - + + rd S + - + + + LY + +
+ + + + - NC-1 - + + rd S + - + + + O + + + + + + - W30 - + + rd S
+ - + + + YT + + + + + + - WIR - + + rd S + - + + + RO + + + + + +
- B2 - + + rd S + - + + + R + + + + + + - 43948 - + + rd S + - + +
+ O + + + + + + - 43949 - + + rd S + - + + + O + + + + + + - 43950
- + + rd S + - + + + O + + + + + + - 43951 - + + rd S + - + + + O +
+ + + + + - 43952 - + + rd S + - + + + O + + + + + + - *A = Gram's
stain, B = Crystaline inclusion bodies, C = Bioluminescence, D =
Cell form, E = Motility, F = Nitrate reduction, G = Presence of
catalase, H = Gelatin hydrolysis, I = Dye uptake, J = Pigmentation,
K = Growth on EMB agar, L = Growth on MacConkey agar, M = Growth on
Tergitol-7 agar, N = Facultative anaerobe, O = Growth at 20.degree.
C., P = Growth at 28.degree. C., Q = Growth at 37.degree. C.,
.sup..dagger.+/- = positive or negative for trait, rd = rod, S =
sized within Genus descriptors, RO = red-orange, LR = light red, R
= red, O = orange, Y = yellow, T = tan, LY = light yellow, YT =
yellow tan, and LO = light orange.
[0264] Cellular fatty acid analysis is a recognized tool for
bacterial characterization at the genus and species level
(Tornabene, T. G. 1985. Lipid Analysis and the Relationship to
Chemotaxonomy in Methods in Microbiology, Vol. 18, 209-234.;
Goodfellow, M. and O'Donnell, A. G. 1993. Roots of Bacterial
Systematics in Handbook of New Bacterial Systematics (ed.
Goodfellow, M. & O'Donnell, A. G.) pp. 3-54. London: Academic
Press Ltd.), these references are incorporated herein by reference,
and were used to confirm that our collection was related at the
genus level. Cultures were shipped to an external, contract
laboratory for fatty acid methyl ester analysis (FAME) using a
Microbial ID (MIDI, Newark, Del., USA) Microbial Identification
System (MIS). The MIS system consists of a Hewlett Packard HP5890A
gas chromatograph with a 25 mm.times.0.2 mm 5% methylphenyl
silicone fused silica capillary column. Hydrogen is used as the
carrier gas and a flame-ionization detector functions in
conjunction with an automatic sampler, integrator and computer. The
computer compares the sample fatty acid methyl esters to a
microbial fatty acid library and against a calibration mix of known
fatty acids. As selected by the contract laboratory, strains were
grown for 24 hours at 28.degree. C. on trypticase soy agar prior to
analysis. Extraction of samples was performed by the contract lab
as per standard FAME methodology. There was no direct
identification of the strains to any luminescent bacterial group
other than Photorhabdus. When the cluster analysis was performed,
which compares the fatty acid profiles of a group of isolates, the
strain fatty acid profiles were related at the genus level.
[0265] The evolutionary diversity of the Photorhabdus strains in
our collection was measured by analysis of PCR (Polymerase Chain
Reaction) mediated genomic fingerprinting using genomic DNA from
each strain. This technique is based on families of repetitive DNA
sequences present throughout the genome of diverse bacterial
species (reviewed by Versalovic, J., Schneider, M., D E Bruijn, F.
J. and Lupski, J. R. 1994. Methods Mol. Cell. Biol., 5, 25-40.).
Three of these, repetitive extragenic palindromic sequence (REP),
enterobacterial repetitive intergenic consensus (ERIC) and the BOX
element are thought to play an important role in the organization
of the bacterial genome. Genomic organization is believed to be
shaped by selection and the differential dispersion of these
elements within the genome of closely related bacterial strains can
be used to discriminate these strains (e.g., Louws, F. J.,
Fulbright, D. W., Stephens, C. T. and D E Bruijn, F. J. 1994. Appl.
Environ. Micro. 60, 2286-2295). Rep-PCR utilizes oligonucleotide
primers complementary to these repetitive sequences to amplify the
variably sized DNA fragments lying between them. The resulting
products are separated by electrophoresis to establish the DNA
"fingerprint" for each strain.
[0266] To isolate genomic DNA from our strains, cell pellets were
resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a
final volume of 10 ml and 12 ml of 5 M NaCl was then added. This
mixture was centrifuged 20 min. at 15,000.times.g. The resulting
pellet was resuspended in 5.7 ml of TE and 300 .mu.l of 10% SDS and
60 .mu.l 20 mg/ml proteinase K (Gibco BRL Products, Grand Island,
N.Y.) were added. This mixture was incubated at 37.degree. C. for 1
hr, approximately 10 mg of lysozyme was then added and the mixture
was incubated for an additional 45 min. One milliliter of 5M NaCl
and 800 .mu.l of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) were
then added and the mixture was incubated 10 min. at 65.degree. C.,
gently agitated, then incubated and agitated for an additional 20
min. to aid in clearing of the cellular material. An equal volume
of chloroform/isoamyl alcohol solution (24:1, v/v) was added, mixed
gently then centrifuged. Two extractions were then performed with
an equal volume of phenol/chloroform/isoamyl alcohol (50:49:1).
Genomic DNA was precipitated with 0.6 volume of isopropanol.
Precipitated DNA was removed with a glass rod, washed twice with
70% ethanol, dried and dissolved in 2 ml of STE (10 mM Tris-HCl
pH8.0, 10 mM NaCl, 1 mM EDTA). The DNA was then quantitated by
optical density at 260 nm. To perform rep-PCR analysis of
Photorhabdus genomic DNA the following primers were used, REP1R-I;
5'-IIIICGICGICATCIGGC-3' and REP2-I; 5'-ICGICTTATCIGGCCTAC-3'. PCR
was performed using the following 25 .mu.l reaction: 7.75 .mu.l
H.sub.2O, 2.5 .mu.l 10.times.LA buffer (PanVera Corp., Madison,
Wis.), 16 .mu.l dNTP mix (2.5 mM each), 1 .mu.l of each primer at
50 pM/.mu.l, 1 .mu.l DMSO, 1.5 .mu.l genomic DNA (concentrations
ranged from 0.075-0.480 .mu.g/.mu.l) and 0.25 .mu.l TaKaRa EX Taq
(PanVera Corp., Madison, Wis.). The PCR amplification was performed
in a Perkin Elmer DNA Thermal Cycler (Norwalk, Conn.) using the
following conditions: 95.degree. C./7 min. then 35 cycles of;
94.degree. C./1 min., 44.degree. C./1 min., 65.degree. C./8 min.,
followed by 15 min. at 65.degree. C. After cycling, the 25 .mu.l
reaction was added to 5 .mu.l of 6.times.gel loading buffer (0.25%
bromophenol blue, 40% w/v sucrose in H.sub.2O). A 15.times.20 cm
1%-agarose gel was then run in TBE buffer (0.09 M Tris-borate,
0.002 M EDTA) using 8 .mu.l of each reaction. The gel was run for
approximately 16 hours at 45 v. Gels were then stained in 20
.mu.g/ml ethidium bromide for 1 hour and destained in TBE buffer
for approximately 3 hours. Polaroid.RTM. photographs of the gels
were then taken under UV illumination.
[0267] The presence or absence of bands at specific sizes for each
strain was scored from the photographs and entered as a similarity
matrix in the numerical taxonomy software program, NTSYS-pc (Exeter
Software, Setauket, N.Y.). Controls of E. coli strain HB101 and
Xanthomonas oryzae pv. oryzae assayed at the same time produced PCR
"fingerprints" corresponding to published reports (Versalovic, J.,
Koeuth, T. and Lupski, J. R. 1991. Nucleic Acids Res. 19,
6823-6831; Vera Cruz, C. M., Halda-Alija, L., Louws, F., Skinner,
D. Z., George, M. L., Nelson, R. J., D E Bruijn, F. J., Rice, C.
and Leach, J. E. 1995. Int. Rice Res. Notes, 20, 23-24.; Vera Cruz,
C. M., Ardales, E. Y., Skinner, D. Z., Talag, J., Nelson, R. J.,
Louws, F. J., Leung, H., Mew, T. W. and Leach, J. E. 1996.
Phytopathology (in press, respectively). The data from Photorhabdus
strains were then analyzed with a series of programs within
NTSYS-pc; SIMQUAL (Similarity for Qualitative data) to generate a
matrix of similarity coefficients (using the Jaccard coefficient)
and SAHN (Sequential, Agglomerative, Heirarchical and Nested)
clustering [using the UPGMA (Unweighted Pair-Group Method with
Arithmetic Averages) method] which groups related strains and can
be expressed as a phenogram (FIG. 5). The COPH (cophenetic values)
and MXCOMP (matrix comparison) programs were used to generate a
cophenetic value matrix and compare the correlation between this
and the original matrix upon which the clustering was based. A
resulting normalized Mantel statistic (r) was generated which is a
measure of the goodness of fit for a cluster analysis (r=0.8-0.9
represents a very good fit). In our case r=0.919. Therefore, our
collection is comprised of a diverse group of easily
distinguishable strains representative of the Photorhabdus
genus.
EXAMPLE 13
Insecticidal Utility of Toxin(s) Produced by Various Photorhabdus
Strains
[0268] Initial "seed" cultures of the various Photorhabdus strains
were produced by inoculating 175 ml of 2% Proteose Peptone #3 (PP3)
(Difco Laboratories, Detroit, Mich.) liquid media with a primary
variant subclone in a 500 ml tribaffled flask with a Delong neck,
covered with a Kaput. Inoculum for each seed culture was derived
from oil-overlay agar slant cultures or plate cultures. After
inoculation, these flasks were incubated for 16 hrs at 28.degree.
C. on a rotary shaker at 150 rpm. These seed cultures were then
used as uniform inoculum sources for a given fermentation of each
strain. Additionally, overlaying the post-log seed culture with
sterile mineral oil, adding a sterile magnetic stir bar for future
resuspension and storing the culture in the dark, at room
temperature provided long-term preservation of inoculum in a
toxin-competent state. The production broths were inoculated by
adding 1% of the actively growing seed culture to fresh 2% PP3
media (e.g., 1.75 ml per 175 ml fresh media). Production of broths
occurred in either 500 ml tribaffled flasks (see above), or 2800 ml
baffled, convex bottom flasks (500 ml volume) covered by a silicon
foam closure. Production flasks were incubated for 24-48 hrs under
the above mentioned conditions. Following incubation, the broths
were dispensed into sterile 1 L polyethylene bottles, spun at
2600.times.g for 1 hr at 10.degree. C. and decanted from the cell
and debris pellet. The liquid broth was then vacuum filtered
through Whatman GF/D (2.7 .mu.M retention) and GF/B (1.0 .mu.M
retention) glass filters to remove debris. Further broth
clarification was achieved with a tangential flow microfiltration
device (Pall Filtron, Northborough, Mass.) using a 0.5 .mu.M
open-channel filter. When necessary, additional clarification could
be obtained by chilling the broth (to 4.degree. C.) and
centrifuging for several hours at 2600.times.g. Following these
procedures, the broth was filter sterilized using a 0.2 .mu.M
nitrocellulose membrane filter. Sterile broths were then used
directly for biological assay, biochemical analysis or concentrated
(up to 15-fold) using a 10,000 MW cut-off, M12 ultra-filtration
device (Amicon, Beverly Mass.) or centrifugal concentrators
(Millipore, Bedford, Mass. and Pall Filtron, Northborough, Mass.)
with a 10,000 MW pore size. In the case of centrifugal
concentrators, the broth was spun at 2000.times.g for approximately
2 hr. The 10,000 MW permeate was added to the corresponding
retentate to achieve the desired concentration of components
greater than 10,000 MW. Heat inactivation of processed broth
samples was acheived by heating the samples at 100.degree. C. in a
sand-filled heat block for 10 minutes.
[0269] The broth(s) and toxin complex(es) from different
Photorhabdus strains are useful for reducing populations of insects
and were used in a method of inhibiting an insect population which
comprises applying to a locus of the insect an effective insect
inactivating amount of the active described. A demonstration of the
breadth of insecticidal activity observed from broths of a selected
group of Photorhabdus strains fermented as described above is shown
in Table 20. It is possible that additional insecticidal activities
could be detected with these strains through increased
concentration of the broth or by employing different fermentation
methods. Consistent with the activity being associated with a
protein, the insecticidal activity of all strains tested was heat
labile (see above).
[0270] Culture broth(s) from diverse Photorhabdus strains show
differential insecticidal activity (mortality and/or growth
inhibition, reduced adult emergence) against a number of insects.
More specifically, the activity is seen against corn rootworm
larvae and boll weevil larvae which are members of the insect order
Coleoptera. Other members of the Coleoptera include wireworms,
pollen beetles, flea beetles, seed beetles and Colorado potato
beetle. Activity is also observed against aster leafhopper and corn
plant hopper, which are members of the order Homoptera. Other
members of the Homoptera include planthoppers, pear psylla, apple
sucker, scale insects, whiteflies, spittle bugs as well as numerous
host specific aphid species. The broths and purified toxin
complex(es) are also active against tobacco budworm, tobacco
hornworm and European corn borer which are members of the order
Lepidoptera. Other typical members of this order are beet armyworm,
cabbage looper, black cutworm, corn earworm, codling moth, clothes
moth, Indian mealmoth, leaf rollers, cabbage worm, cotton bollworm,
bagworm, Eastern tent caterpillar, sod webworm and fall armyworm.
Activity is also seen against fruitfly and mosquito larvae which
are members of the order Diptera. Other members of the order
Diptera are, pea midge, carrot fly, cabbage root fly, turnip root
fly, onion fly, crane fly and house fly and various mosquito
species. Activity with broth(s) and toxin complex(es) is also seen
against two-spotted spider mite which is a member of the order
Acarina which includes strawberry spider mites, broad mites, citrus
red mite, European red mite, pear rust mite and tomato russet
mite.
[0271] Activity against corn rootworm larvae was tested as follows.
Photorhabdus culture broth(s) (0-15 fold concentrated, filter
sterilized), 2% Proteose Peptone #3, purified toxin complex(es), 10
mM sodium phosphate buffer, pH 7.0 were applied directly to the
surface (about 1.5 cm.sup.2) of artificial diet (Rose, R. I. and
McCabe, J. M. (1973). J. Econ. Entomol. 66, (398-400) in 40 .mu.l
aliquots. Toxin complex was diluted in 10 mM sodium phosphate
buffer, pH 7.0. The diet plates were allowed to air-dry in a
sterile flow-hood and the wells were infested with single, neonate
Diabrotica undecimpunctata howardi (Southern corn rootworm, SCR)
hatched from surface sterilized eggs. The plates were sealed,
placed in a humidified growth chamber and maintained at 27.degree.
C. for the appropriate period (3-5 days). Mortality and larval
weight determinations were then scored. Generally, 16 insects per
treatment were used in all studies. Control mortality was generally
less than 5%.
[0272] Activity against boll weevil (Anthomonas grandis) was tested
as follows. Concentrated (1-10 fold) Photorhabdus broths, control
medium (2% Proteose Peptone #3), purified toxin complex(es) [0.23
mg/ml] or 10 mM sodium phosphate buffer, pH 7.0 were applied in 60
.mu.l aliquots to the surface of 0.35 g of artificial diet
(Stoneville Yellow lepidopteran diet) and allowed to dry. A single,
12-24 hr boll weevil larva was placed on the diet, and the wells
were sealed and held at 25.degree. C., 50% RH for 5 days. Mortality
and larval weights were then assessed. Control mortality ranged
between 0-13%.
[0273] Activity against mosquito larvae was tested as follows. The
assay was conducted in a 96-well microtiter plate. Each well
contained 200 .mu.l of aqueous solution (10-fold concentrated
Photorhabdus culture broth(s), control medium (2% Proteose Peptone
#3), 10 mM sodium phosphate buffer, toxin complex(es) @ 0.23 mg/ml
or H.sub.2O) and approximately 20, 1-day old larvae (Aedes
aegypti). There were 6 wells per treatment. The results were read
at 3-4 days after infestation. Control mortality was between
0-20%.
[0274] Activity against fruitflies was tested as follows. Purchased
Drosophila melanogaster medium was prepared using 50% dry medium
and a 50% liquid of either water, control medium (2% Proteose
Peptone #3), 10-fold concentrated Photorhabdus culture broth(s),
purified toxin complex(es) [0.23 mg/ml] or 10 mM sodium phosphate
buffer , pH 7.0. This was accomplished by placing 4.0 ml of dry
medium in each of 3 rearing vials per treatment and adding 4.0 ml
of the appropriate liquid. Ten late instar Drosophila melanogaster
maggots were then added to each 25 ml vial. The vials were held on
a laboratory bench, at room temperature, under fluorescent ceiling
lights. Pupal or adult counts were made after 15 days of exposure.
Adult emergence as compared to water and control medium (0-16%
reduction).
[0275] Activity against aster leafhopper adults (Macrosteles
severini) and corn planthopper nymphs (Peregrinus maidis) was
tested with an ingestion assay designed to allow ingestion of the
active without other external contact. The reservoir for the
active/"food" solution is made by making 2 holes in the center of
the bottom portion of a 35.times.10 mm Petri dish. A 2 inch
Parafilm M.RTM. square is placed across the top of the dish and
secured with an "O" ring. A 1 oz. plastic cup is then infested with
approximately 7 hoppers and the reservoir is placed on top of the
cup, Parafilm down. The test solution is then added to the
reservoir through the holes. In tests using 10-fold concentrated
Photorhabdus culture broth(s), the broth and control medium (2%
Proteose Peptone #3) were dialyzed against 10 mM sodium phosphate
buffer, pH 7.0 and sucrose (to 5%) was added to the resulting
solution to reduce control mortality. Purified toxin complex(es)
[0.23 mg/ml] or 10 mM sodium phosphate buffer, pH 7.0 was also
tested. Mortality is reported at day 3. The assay was held in an
incubator at 28.degree. C., 70% RH with a 16/8 photoperiod. The
assays were graded for mortality at 72 hours. Control mortality was
less than 6%.
[0276] Activity against lepidopteran larvae was tested as follows.
Concentrated (10-fold) Photorhabdus culture broth(s), control
medium (2% Proteose Peptone #3), purified toxin complex(es) [0.23
mg/ml] or 10 mM sodium phosphate buffer, pH 7.0 were applied
directly to the surface (about 1.5 cm.sup.2) of standard artificial
lepidopteran diet (Stoneville Yellow diet) in 40 .mu.l aliquots.
The diet plates were allowed to air-dry in a sterile flow-hood and
each well was infested with a single, neonate larva. European corn
borer (Ostrinia nubilalis) and tobacco hornworm (Manduca sexta)
eggs were obtained from commercial sources and hatched in-house,
whereas tobacco budworm (Heliothis virescens) larvae were supplied
internally. Following infestation with larvae, the diet plates were
sealed, placed in a humidified growth chamber and maintained in the
dark at 27.degree. C. for the appropriate period. Mortality and
weight determinations were scored at day 5. Generally, 16 insects
per treatment were used in all studies. Control mortality generally
ranged from about 4 to about 12.5% for control medium and was less
than 10% for phosphate buffer.
[0277] Activity against two-spotted spider mite (Tetranychus
urticae) was determined as follows. Young squash plants were
trimmed to a single cotyledon and sprayed to run-off with 10-fold
concentrated broth(s), control medium (2% Proteose Peptone #3),
purified toxin complex(es), 10 mM sodium phosphate buffer, pH 7.0.
After drying, the plants were infested with a mixed population of
spider mites and held at lab temperature and humidity for 72 hr.
Live mites were then counted to determine levels of control.
27TABLE 20 Observed Insecticidal Spectrum of Broths from Different
Photorhabdus Strains Photorhabdus Strain Sensitive* Insect Species
WX-1 3**, 4, 5, 6, 7, 8 WX-2 2, 4 WX-3 1, 4 WX-4 1, 4 WX-5 4 WX-6 4
WX-7 3, 4, 5, 6, 7, 8 WX-8 1, 2, 4 WX-9 1, 2, 4 WX-10 4 WX-11 1, 2,
4 WX-12 2, 4, 5, 6, 7, 8 WX-14 1, 2, 4 WX-15 1, 2, 4 W30 3, 4, 5, 8
NC-1 1, 2, 3, 4, 5, 6, 7, 8, 9 WIR 2, 3, 5, 6, 7, 8 HP88 1, 3, 4,
5, 7, 8 Hb 3, 4, 5, 7, 8 Hm 1, 2, 3, 4, 5, 7, 8 H9 1, 2, 3, 4, 5,
6, 7, 8 W-14 1, 2, 3, 4, 5, 6, 7, 8, 10 ATCC 43948 4 ATCC 43949 4
ATCC 43950 4 ATCC 43951 4 ATCC 43952 4 *= .gtoreq.25% mortality
and/or growth inhibition vs. control **= 1; Tobacco budworm, 2;
European corn borer, 3; Tobacco hornworm, 4; Southern corn
rootworm, 5; Boll weevil, 6; Mosquito, 7; Fruit Fly, 8; Aster
Leafhopper, 9; Corn planthopper, 10; Two-spotted spider mite.
EXAMPLE 14
Non W-14 Photorhabdus Strains: Purification, Characterization and
Activity Spectrum
[0278] Purification
[0279] The protocol, as follows, is similar to that developed for
the purification of W-14 and was established based on purifying
those fractions having the most activity against Southern corn root
worm (SCR), as determined in bioassays (see Example 13). Typically,
4-20 L of broth that had been filtered, as described in Example 13,
were received and concentrated using an Amicon spiral ultra
filtration cartridge Type S1Y100 attached to an Amicon M-12
filtration device. The retentate contained native proteins
consisting of molecular sizes greater than 100 kDa, whereas the
flow through material contained native proteins less than 100 kDa
in size. The majority of the activity against SCR was contained in
the 100 kDa retentate. The retentate was then continually
diafiltered with 10 mM sodium phosphate (pH=7.0) until the filtrate
reached an A.sub.280<0.100. Unless otherwise stated, all
procedures from this point were performed in buffer as defined by
10 mM sodium phosphate (pH 7.0). The retentate was then
concentrated to a final volume of approximately 0.20 L and filtered
using a 0.45 mm Nalgene.TM. Filterware sterile filtration unit. The
filtered material was loaded at 7.5 ml/min onto a Pharmacia HR16/10
column which had been packed with PerSeptive Biosystem Poros.RTM.
50 HQ strong anion exchange matrix equilibrated in buffer using a
PerSeptive Biosystem Sprint.RTM. HPLC system. After loading, the
column was washed with buffer until an A.sub.280<0.100 was
achieved. Proteins were then eluted from the column at 2.5 ml/min
using buffer with 0.4 M NaCl for 20 min for a total volume of 50
ml. The column was then washed using buffer with 1.0 M NaCl at the
same flow rate for an additional 20 min (final volume=50 ml).
Proteins eluted with 0.4 M and 1.0 M NaCl were placed in separate
dialysis bags (Spectra/Por.RTM. Membrane MWCO: 2,000) and allowed
to dialyze overnight at 4.degree. C. in 12 L buffer. The majority
of the activity against SCR was contained in the 0.4 M fraction.
The 0.4 M fraction was further purified by application of 20 ml to
a Pharmacia XK 26/100 column that had been prepacked with Sepharose
CL4B (Pharmacia) using a flow rate of 0.75 ml/min. Fractions were
pooled based on A.sub.280 peak profile and concentrated to a final
volume of 0.75 ml using a Millipore Ultrafree.RTM.-15 centrifugal
filter device Biomax-50K NMWL membrane. Protein concentrations were
determined using a Biorad Protein Assay Kit with bovine gamma
globulin as a standard.
[0280] Characterization
[0281] The native molecular weight of the SCR toxin complex was
determined using a Pharmacia HR 16/50 that had been prepacked with
Sepharose CL4B in buffer. The column was then calibrated using
proteins of known molecular size thereby allowing for calculation
of the toxin approximate native molecular size. As shown in Table
21, the molecular size of the toxin complex ranged from 777 kDa
with strain Hb to 1,900 kDa with strain WX-14. The yield of toxin
complex also varied, from strain WX-12 producing 0.8 mg/L to strain
Hb, which produced 7.0 mg/L.
[0282] Proteins found in the toxin complex were examined for
individual polypeptide size using SDS-PAGE analysis. Typically, 20
mg protein of the toxin complex from each strain was loaded onto a
2-15% polyacrylamide gel (Integrated Separation Systems) and
electrophoresed at 20 mA in Biorad SDS-PAGE buffer. After
completion of electrophoresis, the gels were stained overnight in
Biorad Coomassie blue R-250 (0.2% in methanol: acetic acid: water;
40:10:40 v/v/v). Subsequently, gels were destained in
methanol:acetic acid:water; 40:10:40 (v/v/v). The gels were then
rinsed with water for 15 min and scanned using a Molecular Dynamics
Personal Laser Densitometer.RTM.. Lanes were quantitated and
molecular sizes were calculated as compared to Biorad high
molecular weight standards, which ranged from 200-45 kDa.
[0283] Sizes of the individual polypeptides comprising the SCR
toxin complex from each strain are listed in Table 22. The sizes of
the individual polypeptides ranged from 230 kDa with strain WX-1 to
a size of 16 kDa, as seen with strain WX-7. Every strain, with the
exception of strain Hb, had polypeptides comprising the toxin
complex that were in the 160-230 kDa range, the 100-160 kDa range,
and the 50-80 kDa range. These data indicate that the toxin complex
may vary in peptide composition and components from strain to
strain, however, in all cases the toxin attributes appears to
consist of a large, oligomeric protein complex.
28TABLE 21 Characterization of a Toxin Complex from Non W-14
Photorhabdus Strains Yield Approx. Active Native Fraction Strain
Molecular wt..sup.a (mg/L).sup.b H9 972,000 1.8 Hb 777,000 7.0 Hm
1,400,000 1.1 HP88 813,000 2.5 NCl 1,092,000 3.3 WIR 979,000 1.0
WX-1 973,000 0.8 WX-2 951,000 2.2 WX-7 1,000,000 1.5 WX-12 898,000
0.4 WX-14 1,900,000 1.9 W-14 860,000 7.5 .sup.aNative molecular
weight determined using a Pharmacia HR 16/50 column packed with
Sepharose CL4B .sup.bAmount of toxin complex recovered from culture
broth.
[0284] Activity Spectrum
[0285] As shown in Table 23, the toxin complexes purified from
strains Hm and H9 were tested for activity against a variety of
insects, with the toxin complex from strain W-14 for comparison.
The assays were performed as described in Example 13. The toxin
complex from all three strains exhibited activity against tobacco
bud worm, European corn borer, Southern corn root worm, and aster
leafhopper. Furthermore, the toxin complex from strains Hm and W-14
also exhibited activity against two-spotted spider mite. In
addition, the toxin complex from W-14 exhibited activity against
mosquito larvae. These data indicate that the toxin complex, while
having similarities in activities between certain orders of
insects, can also exhibit differential activities against other
orders of insects.
29TABLE 22 The Approximate Sizes (in kDa) of Peptides in a Purified
Toxin Complex From Non W-14 Photorhabdus H9 Hb Hm HP 88 NC-1 WIR
WX-1 WX-2 WX-7 WX-12 WX-14 W-14 180 150 170 170 180 170 230 200 200
180 210 190 170 140 140 160 170 160 190 170 180 160 180 180 160 139
100 140 140 120 170 150 110 140 160 170 140 130 81 130 110 110 160
120 87 139 120 160 120 120 72 129 44 89 110 110 75 130 110 150 98
100 68 110 16 79 98 82 43 110 100 130 87 98 49 100 74 76 64 33 92
95 120 84 88 46 86 62 58 37 28 87 80 110 79 81 30 81 51 53 30 26 80
69 93 72 75 22 77 40 41 23 73 49 90 68 69 20 73 39 35 22 59 41 77
60 60 19 60 37 31 21 56 33 69 57 57 58 33 28 19 51 65 52 54 45 30
24 18 37 63 46 49 39 28 22 16 33 60 40 44 35 27 32 51 37 39 25 26
46 37 23 40 35 39 29
[0286]
30TABLE 23 Observed Insecticidal Spectrum of a Purified Toxin
Complex from Photorhabdus Strains Photorhabdus Strain Sensitive*
Insect Species Hm Toxin Complex 1**, 2, 3, 5, 6, 7, 8 H9 Toxin
Complex 1, 2, 3, 6, 7, 8 W-14 Toxin Complex 1, 2, 3, 4, 5, 6, 7, 8
*= >25% mortality or growth inhibition *= >25% mortality or
growth inhibition **= 1, Tobacco bud worm; 2, European corn borer;
3, Southern corn root worm; 4, Mosquito; 5, Two-spotted spider
mite; 6, Aster Leafhopper; 7, Fruit Fly; 8, Boll Weevil
EXAMPLE 15
Sub-Fractionation of Photorhabdus Protein Toxin Complex
[0287] The Photorhabdus protein toxin complex was isolated as
described in Example 14. Next, about 10 mg toxin was applied to a
MonoQ 5/5 column equilibrated with 20 mM Tris-HCl, pH 7.0 at a flow
rate of 1 ml/min. The column was washed with 20 mM Tris-HCl, pH 7.0
until the optical density at 280 nm returned to baseline
absorbance. The proteins bound to the column were eluted with a
linear gradient of 0 to 1.0 M NaCl in 20 mM Tris-HCl, pH 7.0 at 1
ml/min for 30 min. One ml fractions were collected and subjected to
Southern corn rootworm (SCR) bioassay (see Example 13). Peaks of
activity were determined by a series of dilutions of each fraction
in SCR bioassays. Two activity peaks against SCR were observed and
were named A (eluted at about 0.2-0.3 M NaCl) and B (eluted at
0.3-0.4 M NaCl). Activity peaks A and B were pooled separately and
both peaks were further purified using a 3-step procedure described
below.
[0288] Solid (NH.sub.4).sub.2SO.sub.4 was added to the above
protein fraction to a final concentration of 1.7 M. Proteins were
then applied to a phenyl-Superose 5/5 column equilibrated with 1.7
M (NH.sub.4).sub.2SO.sub.4 in 50 mM potassium phosphate buffer, pH
7 at 1 ml/min. Proteins bound to the column were eluted with a
linear gradient of 1.7 M (NH.sub.4).sub.2SO.sub.4, 0% ethylene
glycol, 50 mM potassium phosphate, pH 7.0 to 25% ethylene glycol,
25 mM potassium phosphate, pH 7.0 (no (NH.sub.4).sub.2SO.sub.4) at
0.5 ml/min. Fractions were dialyzed overnight against 10 mM sodium
phosphate buffer, pH 7.0. Activities in each fraction against SCR
were determined by bioassay.
[0289] The fractions with the highest activity were pooled and
applied to a MonoQ 5/5 column which was equilibrated with 20 mM
Tris-HCl, pH 7.0 at 1 ml/min. The proteins bound to the column were
eluted at 1 ml/min by a linear gradient of 0 to 1M NaCl in 20 mM
Tris-HCl, pH 7.0.
[0290] For the final step of purification, the most active
fractions above (determined by SCR bioassay) were pooled and
subjected to a second phenyl-Superose 5/5/ column. Solid
(NH.sub.4).sub.2SO.sub.4 was added to a final concentration of 1.7
M. The solution was then loaded onto the column equilibrated with
1.7 M (NH.sub.4).sub.2SO.sub.4 in 50 mM potassium phosphate buffer,
pH 7 at 1 ml/min. Proteins bound to the column were eluted with a
linear gradient of 1.7 M (NH.sub.4).sub.2SO.sub.4, 50 mM potassium
phosphate, pH 7.0 to 10 mM potassium phosphate, pH 7.0 at 0.5
ml/min. Fractions were dialyzed overnight against 10 mM sodium
phosphate buffer, pH 7.0. Activities in each fraction against SCR
were determined by bioassay.
[0291] The final purified protein by the above 3-step procedure
from peak A was named toxin A and the final purified protein from
peak B was named toxin B.
[0292] Characterization and Amino Acid Sequencing of Toxin A and
Toxin B
[0293] In SDS-PAGE, both toxin A and toxin B contained two major
(>90% of total Commassie stained protein) peptides: 192 kDa
(named A1 and B1, respectively) and 58 kDa (named A2 and B2,
respectively). Both toxin A and toxin B revealed only one major
band in native PAGE, indicating A1 and A2 were subunits of one
protein complex, and B1 and B2 were subunits of one protein
complex. Further, the native molecular weight of both toxin A and
toxin B were determined to be 860 kDa by gel filtration
chromatography. The relative molar concentrations of A1 to A2 was
judged to be a 1 to 1 equivalence as determined by densiometric
analysis of SDS-PAGE gels. Similarly, B1 and B2 peptides were
present at the same molar concentration.
[0294] Toxin A and toxin B were electrophoresed in 10% SDS-PAGE and
transblotted to PVDF membranes. Blots were sent for amino acid
analysis and N-terminal amino acid sequencing at Harvard MicroChem
and Cambridge ProChem, respectively. The N-terminal amino sequence
of B1 was determined to be identical to SEQ ID NO:1, the
TcbA.sub.ii region of the tcbA gene (SEQ ID NO:12, position 87 to
99). A unique N-terminal sequence was obtained for peptide B2 (SEQ
ID NO:40). The N-terminal amino acid sequence of peptide B2 was
identical to the TcbA.sub.iii region of the derived amino acid
sequence for the tcbA gene (SEQ ID NO:12, position 1935 to 1945).
Therefore, the B toxin contained predominantly two peptides,
TcbA.sub.ii and TcbA.sub.iii, that were observed to be derived from
the same gene product, TcbA.
[0295] The N-terminal sequence of A2 (SEQ ID NO:41) was unique in
comparison to the TcbA.sub.iii peptide and other peptides. The A2
peptide was denoted TcdA.sub.iii (see Example 17). SEQ ID NO:6 was
determined to be a mixture of amino acid sequences SEQ ID NO:40 and
41.
[0296] Peptides A1 and A2 were further subjected to internal amino
acid sequencing. For internal amino acid sequencing, 10 .mu.g of
toxin A was electrophoresized in 10% SDS-PAGE and transblotted to
PVDF membrane. After the blot was stained with amido black,
peptides A1 and A2, denoted TcdA.sub.ii and TcdA.sub.iii,
respectively, were excised from the blot and sent to Harvard
MicroChem and Cambridge ProChem. Peptides were subjected to trypsin
digestion followed by HPLC chromatography to separate individual
peptides. N-terminal amino acid analysis was performed on selected
tryptic peptide fragments. Two internal amino acid sequences of
peptide A1 (TcdA.sub.ii-PK71, SEQ ID NO:38 and TcdA.sub.ii-PK44,
SEQ ID NO:39) were found to have significant homologies with
deduced amino acid sequences of the TcbA.sub.ii region of the tcbA
gene (SEQ ID NO:12). Similarly, the N-terminal sequence (SEQ ID
NO:41) and two internal sequences of peptides A2
(TcdA.sub.iii-PK57, SEQ ID NO:42 and TcdA.sub.iii-PK20, SEQ ID
NO.43) also showed significant homology with deduced amino acid
sequences of TcbA.sub.iii region of the tcbA gene (SEQ ID
NO:12).
[0297] In summary of above results, the toxin complex has at least
two active protein toxin complexes against SCR; toxin A and toxin
B. Toxin A and toxin B are similar in their native and subunits
molecular weight, however, their peptide compositions are
different. Toxin A contained peptides TcdA.sub.ii and TcdA.sub.iii
as the major peptides and the toxin B contains TcbA.sub.ii and
TcbA.sub.iii as the major peptides.
[0298] Purification and Characterization of Toxin C, Tca
Peptides
[0299] The Photorhabdus protein toxin complex was isolated as
described above. Next, about 50 mg toxin was applied to a MonoQ
10/10 column equilibrated with 20 mM Tris-HCl, pH 7.0 at a flow
rate of 2 ml/min. The column was washed with 20 mM Tris-HCl, pH7.0
until the optical density at 280 nm returned to baseline level. The
proteins bound to the column were eluted with a linear gradient of
0 to 1M NaCl in 20 mM Tris-HCl, pH 7.0 at 2 ml/min for 60 min. 2 ml
fractions were collected and subjected to Western analysis using
pAb TcaB.sub.ii-syn antibody (see Example 21) as the primary
antibody. Fractions reacted with pAb TcaB.sub.ii-syn antibody were
combined and solid (NH.sub.4).sub.2SO.sub.4 was added to a final
concentration of 1.7 M. Proteins were then applied to a
phenyl-Superose 10/10 column equilibrated with 1.7 M
(NH.sub.4).sub.2SO.sub.4 in 50 mM potassium phosphate buffer, pH 7
at 1 ml/min. Proteins bound to the column were eluted with a linear
gradient of 1.7 M (NH.sub.4).sub.2SO.sub.4, 50 mM potassium
phosphate, pH 7.0 to 10 mM potassium phosphate, pH 7.0 at 1 ml/min
for 120 min. 2 ml Fractions were collected, dialyzed overnight
against 10 mM sodium phosphate buffer, pH 7.0, and analyzed by
Western blots using pAb TcaB.sub.ii-syn antibody as the primary
antibody.
[0300] Fractions cross-reacted with the antibody were pooled and
applied to a MonoQ 5/5 column which was equilibrated with 20 mM
Tris-HCl, pH 7.0 at 1 ml/min. The proteins bound to the column were
eluted at 1 ml/min by a linear gradient of 0 to 1M NaCl in 20 mM
Tris-HCl, pH 7.0 for 30 min.
[0301] Fractions above reacted with pAb TcaB.sub.ii-syn antibody
were pooled and subjected to a phenyl-Superose 5/5/ column. Solid
(NH.sub.4).sub.2SO.sub.4 added to a final concentration of 1.7 M.
The solution was then applied onto the column equilibrated with 1.7
M (NH.sub.4).sub.2SO.sub.4 in 50 mM potassium phosphate buffer, pH
7 at 1 ml/min. Proteins bound to the column were then eluted with a
linear gradient of 1.7 M (NH.sub.4).sub.2SO.sub.4, 50 mM potassium
phosphate, pH 7.0 to 10 mM potassium phosphate, pH 7.0 at 0.5
ml/min for 60 min. Fractions were dialyzed overnight against 10 mM
sodium phosphate buffer, pH 7.0.
[0302] For the final purification step, fractions reacted with pAb
TcaB.sub.ii-syn antibody above determined by Western analysis were
combined and applied to a Mono Q 5/5 column equilibrated with 20 mM
Tris-HCl, pH 7.0 at 1 ml/min. The proteins bound to the column were
eluted at 1 ml/min by a linear gradient of 0 to 1M NaCl in 20 mM
Tris-HCl, pH 7.0 for 30 min.
[0303] The final purified protein fraction contained 6 major
peptides examined by SDS-PAGE: 165 kDa, 90 kDa, 64 kDa, 62 kDa, 58
kDa, and 22 kDa. The LD50 of the insecticidal activities of this
purified fraction were determined to be 100 ng and 500 ng against
SCR and ECB, respectively.
[0304] The above peptides were blotted to PVDF membranes and blots
were sent for amino acids analysis and 5 amino acid long N-terminal
sequencing at Harvard MicroChem and Cambridge ProChem,
respectively. The N-terminal amino acid sequence of the 165 kDa
peptide was determined to be identical to peptide TcaC (SEQ ID 2,
position 1 to 5). The N-terminal amino acid sequence of the 90 kDa
peptide was determined to be TcaA.sub.ii region of the derived
amino acid sequence for the tcaA gene (SEQ ID NO 33, position 254
to 258). The N-terminal amino acid sequence of 64 kDa peptide was
determined to be identical to peptide TcaB.sub.i (SEQ ID 3,
position 1 to 5). The N-terminal amino acid sequence of the 62 kDa
peptide was determined to be TcaA.sub.ii region of the derived
amino acid sequence for the tcaA gene (SEQ ID NO 33, position 489
to 493). The N-terminal amino acid sequence of 58 kDa peptide was
determined to be identical to peptide TcaB.sub.ii (SEQ ID 5,
position 1 to 5). The N-terminal amino acid sequence of the 22 kDa
peptide (SEQ ID NO 62) was determined to be TcaA.sub.i region,
denoted TcaA.sub.iv, of the derived amino acid sequence for the
tcaA gene (SEQ ID NO 34, position 98 to 102). It is noted that all
tcaA, tcaB, and tcaC genes reside in the same tca operon (FIG.
6A).
[0305] Five .mu.g of purified Tca fraction, purified toxin A, and
purified toxin B were analyzed by Western blot using the following
antibodies individually as primary antibody: pAb TcaBii-syn
antibody, mAb CF52 antibody, pAb TcdAii-syn antibody, and pAb
Tcd.sub.iii-syn antibody (Example 21). With pAb TcaB.sub.ii-syn
antibody only the purified Tca peptides fraction reacted, but not
toxin A or toxin B. With mAb CF52 antibody, only toxin B reacted
but not Tca peptides fraction or toxin A. With either pAb
TcdAii-syn antibody or pAb Tcdiii-syr antibody only toxin A
reacted, but not Tca peptides fraction or toxin B. This indicated
that the insecticidal activity observed in the purified Tca
peptides fraction is independent of toxin A and toxin B. The
purified Tca peptide fraction is a third unique protein toxin,
denoted toxin C.
EXAMPLE 16
Cleavage and Activation of TcbA Peptide
[0306] In the toxin B complex, peptide TcbA.sub.ii and TcbA.sub.iii
originate from the single gene product TcbA (Example 15). The
processing of TcbA peptide to TcbA.sub.ii and TcbA.sub.iii is
presumably by the action of Photorhabdus protease(s), and most
likely, the metalloproteases described in Example 10. In some
cases, it was noted that when Photorhabdus W-14 broth was
processed, TcbA peptide was present in toxin B complex as a major
component, in addition to peptides TcbA.sub.ii and TcbA.sub.iii.
Identical procedures, described for the purification of toxin B
complex (Example 15), were used to enrich peptide TcbA from toxin
complex fraction of W-14 broth. The final purified material was
analyzed in a 4-20% gradient SDS-PAGE and major peptides were
quantified by densitometry. It was determined that TcbA,
TcbA.sub.ii and TcbA.sub.iii comprised 58%, 36%, and 6%,
respectively, of total protein. The identities of these peptides
were confirmed by their respective molecular sizes in SDS-PAGE and
Western blot analysis using monospecific antibodies. The native
molecular weight of this fraction was determined to be 860 kDa.
[0307] The cleavage of TcbA was evaluated by treating the above
purified material with purified 38 kDa and 58 kDa W-14 Photorhabdus
metalloproteases (Example 10), and trypsin as a control enzyme
(Sigma, Mo.). The standard reaction consisted 17.5 .mu.g the above
purified fraction, 1.5 unit protease, and 0.1 M Tris buffer, pH 8.0
in a total volume of 100 .mu.l. For the control reaction, protease
was omitted. The reaction mixtures were incubated at 37.degree. C.
for 90 min. At the end of the reaction, 20 .mu.l was taken and
boiled with SDS-PAGE sample buffer immediately for electrophoresis
analysis in a 4-20% gradient SDS-PAGE. It was determined from
SDS-PAGE that in both 38 kDa and 58 kDa protease treatments, the
amount of peptides TcbA.sub.ii and TcbA.sub.iii increased about
3-fold while the amount of TcbA peptide decreased proportionally
(Table 24). The relative reduction and augmentation of selected
peptides was confirmed by Western blot analyses. Furthermore, gel
filtration of the cleaved material revealed that the native
molecular size of the complex remained the same. Upon trypsin
treatment, peptides TcbA and TcbA.sub.ii were nonspecifically
digested into small peptides. This indicated that 38 kDa and 58 kDa
Photorhabdus proteases can specifically process peptide TcbA into
peptides TcbA.sub.ii and TcbA.sub.iii. Protease treated and
untreated control of the remaining 80 .mu.l reaction mixture were
serial diluted with 10 mM sodium phosphate buffer, pH 7.0 and
analyzed by SCR bioassay. By comparing activity in several
dilution, it was determined that the 38 kDa protease treatment
increased SCR insecticidal activity approximately 3 to 4 fold. The
growth inhibition of remaining insects in the protease treatment
was also more severe than control (Table 24).
31TABLE 24 Conversion and Activation of Peptide TcbA into Peptides
TcbA.sub.ii and TcbA.sub.iii by Protease Treatment Control 38 kDa
protease treatment TcbA (% of total protein) 58 18 TcbA.sub.ii (%
of total protein) 36 64 TcbA.sub.iii (% of total protein) 6 18 LD50
(.mu.g protein) 2.1 0.52 SCR Weight (mg/insect)* 0.2 0.1 *an
indication of growth inhibition by measuring the average weight of
live insect after 5 days on diet in the assay.
[0308] Activation and Procession of Toxin B by SCR Gut
Proteases
[0309] In yet a second demonstration of proteolytic activation, it
was examined whether W-14 toxins are processed by insects. Toxin B
purified from Photorhabdus W-14 broth (see Example 15) was
comprised of predominantly intact TcbA peptides as judged by
SDS-PAGE and Western blot analysis using monoclonal antibody. The
LD50 of this fraction against SCR was determined to be around 700
ng.
[0310] SCR larva were grown on coleopteran diet until they reached
the fourth instar stage (about 100-125 mg total weight each
insect). SCR gut content was collected as follows: the guts were
removed using dissecting scissors and forceps. After removing the
excess fatty material that coats the gut lining, about 40 guts were
homogenized in a microcentrifuge tube containing 100 .mu.l sterile
water. The tube was then centrifuged at 14,000 rpm for 10 minutes
and the pellet discarded. The supernatant was stored at a
-70.degree. C. freezer until use.
[0311] The processing of toxin B by insect gut was evaluated by
treating the above purified toxin B with the SCR gut content
collected. The reaction consisted 40 .mu.g toxin B (1 mg/ml), 50
.mu.l SCR gut content, and 0.1M Tris buffer, pH 8.0 in a total
volume of 100 .mu.l. For the control reaction, SCR gut content was
omitted. The reaction mixtures were incubated at 37.degree. C. for
overnight. At the end of reaction, 10 .mu.l was withdraw and boiled
with equal volume 2.times.SDS-PAGE sample buffer for SDS-PAGE
analysis. The remaining 90 .mu.l reaction mixture was serial
diluted with 10 mM sodium phosphate buffer, pH 7.0 and analyzed by
SCR bioassay. SDS-PAGE analysis indicated in SCR gut content
treatment, peptide TcbA was digested completely into smaller
peptides. Analysis of the undenatured toxin fraction showed that
the native size, about 860 kDa, remained the same even though
larger peptides were fragmented. In SCR bioassays, it was found
that the LD50 of SCR gut treated toxin B to be about 70 ng;
representing a 10-fold increase. In a separate experiment, protease
K treatment completely eliminated toxin activity.
EXAMPLE 17
Screening of the Library for a Gene Encoding the TcdA.sub.ii
Peptide
[0312] The cloning and characterization of a gene encoding the
TcdA.sub.ii peptide, described as SEQ ID NO:17 (internal peptide
TcdA.sub.ii-PT111 N-terminal sequence) and SEQ ID NO:18 (internal
peptide TcdA.sub.ii-PT79 N-terminal sequence) was completed. Two
pools of degenerate oligonucleotides, designed to encode the amino
acid sequences of SEQ ID NO:17 (Table 25) and SEQ ID NO:18 (Table
26), and the reverse complements of those sequences, were
synthesized as described in Example 8. The DNA sequence of the
oligonucleotides is given below:
32TABLE 21 Degenerate Oligonucleotide for SEQ ID NO:17 P2-PT111 1 2
3 4 5 6 7 8 Amino Acid Ala Phe Asn Ile Asp Asp Val Ser Codons 5'
GCN TT(T/C) AA(T/C) AT(T/C/A) GA(T/C) GA(T/C) GTN 3' P2.3.6.CB 5'
GC(A/C/G/T) TT(T/C) AAT ATT GAT GAT GT 3' P2.3.5 5' GC(A/C/G/T)
TT(T/C) AA(T/C) AT(T/C/A) GA(T/C) GA(T/C) CT 3' P2.3.5R 5' AC
(G/A)TC (G/A)TC (T/G/A)AT T(G/A)TT (G/A)AA (A/C/G/T)GC 3' P2.3.5RI
5' ACI TCI TCI ATI TTI AAI GC 3' P2.3R.CB 5' CAG (A/G)CT (A/C)AC
ATC ATC AAT ATT AAA 3'
[0313]
33TABLE 26 Degenerate Oligonucleotide for SEQ ID NO:18 P2-PT79 1 2
3 4 5 6 7 8 9 10 11 12 13 Amino Acid Phe Ile Val Tyr Thr Ser Leu
Gly Val Asn Pro Asn Asn Codons* 5'TTY ATH GTN TAY ACH 6 6 GGN GTN
AAY CCN AAY AAY 3' P2.79.2 5'TTY ATY GTK TAT ACY TCI YTR GGY GTK
AAT CCR AAT AAT 3' P2.79.3 5'TTT ATT GTK TAT ACY AGY YTR GGY GTK
AAT CCR AAT AAT 3' P2.79.R.1 5'ATT ATT YGG ATT MAC RCC YAR RCT RGT
ATA MAC AAT AAA 3' P2.79R.CB 5'ATT ATT YGG ATT MAC ACC CAG RCT GGT
ATA MAC AAT AAA 3' * According to IUPAC-TUB codes for nucleotides,
Y = C or T, H = A, C or T, N = A, C, G or T, K = G or T, R = A or
G, and M = A or C
[0314] Polymerase Chain Reactions (PCR) were performed essentially
as described in Example 8, using as forward primers P2.3.6.CB or
P2.3.5, and as reverse primers P2.79.R.1 or P2.79R.CB, in all
forward/reverse combinations, using Photorhabdus W-14 genomic DNA
as template. In another set of reactions, primers P2.79.2 or
P2.79.3 were used as forward primers, and P2.3.5R, P2.3.5RI, and
P2.3R.CB were used as reverse primers in all forward/reverse
combinations. Only in the reactions containing P2.3.6.CB as the
forward primers combined with P2.79.R.1 or P2.79R.CB as the reverse
primers was a non-artifactual amplified product seen, of estimated
size (mobility on agarose gels) of 2500 base pairs. The order of
the primers used to obtain this amplification product indicates
that the peptide fragment TcdA.sub.ii-PT111 lies amino-proximal to
the peptide fragment TcdA.sub.ii-PT79.
[0315] The 2500 bp PCR products were ligated to the plasmid vector
pCR.TM.II (Invitrogen, San Diego, Calif.) according to the
supplier's instructions, and the DNA sequences across the ends of
the insert fragments of two isolates (HS24 and HS27) were
determined using the supplier's recommended primers and the
sequencing methods described previously. The sequence of both
isolates was the same. New primers were synthesized based on the
determined sequence, and used to prime additional sequencing
reactions to obtain a total of 2557 bases of the insert [SEQ ID
NO:36]. Translation of the partial peptide encoded by SEQ ID No: 36
yields the 845 amino acid sequence disclosed as SEQ ID NO:37.
Protein homology analysis of this portion of the TcdA.sub.ii
peptide fragment reveals substantial amino acid homology ((68%
similarity, and 53% identity using the Wisconsin Package Version
8.0, Genetics Computer Group (GCG), Madison, Wis.) to residues 542
to 1390 of protein TcbA [SEQ ID NO:12] or (60% similarity, and 54%
identity using the Wisconsin Package Version 9.0, Genetics Computer
Group (GCG), Madison, Wis. to residues 567 to 1389)). It is
therefore apparent that the gene represented in part by SEQ ID
NO:36 produces a protein of similar, but not identical, amino acid
sequence as the TcbA protein, and which likely has similar, but not
identical biological activity as the TcbA protein.
[0316] In yet another instance, a gene encoding the peptides
TcdA.sub.ii-PK44 and the TcdA.sub.iii 58 kDa N-terminal peptide,
described as SEQ ID NO:39 (internal peptide TcdA.sub.ii-PK44
sequence), and SEQ ID NO:41 (TcdA.sub.iii 58 kDa N-terminal peptide
sequence) was isolated. Two pools of degenerate oligonucleotides,
designed to encode the amino acid sequences described as SEQ ID
NO:39 (Table 28) and SEQ ID NO:41 (Table 27), and the reverse
complements of those sequences, were synthesized as described in
Example 8, and their DNA sequences.
34TABLE 27 Degenerate Oligonucleotide for SEQ ID NO:41 Codon # 1 2
3 4 5 6 7 8 9 10 11 12 13 14 Amino Acid Lei Arg Ser Ala Asn Thr Leu
Thr Asp Leu Phe Leu Pro Gln A2.1 5'YIR CGY AGY CGI AAT ACY YIR ACY
GAT YIR TTT YIR CCR CA 3' A2.2 CGI AAT ACI YIR ACI GAY YIR TTY YIR
CCI CA 3' A2.3.R 5'TG YGG YAR AAA YAR RTC RGT YAR RGT RIT IGC RCT
RCG 3' A2.4.R 5'TG IGG CAG AAA CAG RTC IGT CAG IGT ATT IGC 3'
[0317]
35TABLE 28 Degenerate Oligonucleotide for SEQ ID NO:39 Amino Acid #
(8) (9) (10) (11) (12) (13) (14) (15) (16) Codon # 1 2 3 4 5 6 7 8
9 Amino Acid Gly Pro Val Glu Ile Asn Thr Ala Ile A1.44.1 5'GGY CCR
GTK GAA ATT AAT ACC GCI AT 3' A1.44.1R 5'ATI GCG GTA TTA ATT TCM
ACY GGR CC 3' A1.44.2 5'CCI CCI CTI CAR ATY AAY ACI GCI AT 3'
A1.44.2R 5'ATI GCI GTR TTR ATY TCI ACT GGI CC 3'
[0318] Polymerase Chain Reactions (PCR) were performed essentially
as described in Example 8, using as forward primers A1.44.1 or
A1.44.2, and reverse primers A2.3R or A2.4R, in all forward/reverse
combinations, using Photorhabdus W-14 genomic DNA as template. In
another set of reactions, primers A2.1 or A2.2 were used as forward
primers, and A1.44.1R, and A1.44.2R were used as reverse primers in
all forward/reverse combinations. Only in the reactions containing
A1.44.1 or A1.44.2 as the forward primers combined with A2.3R as
the reverse primer was a non-artifactual amplified product seen, of
estimated size (mobility on agarose gels) of 1400 base pairs. The
order of the primers used to obtain this amplification product
indicates that the peptide fragment TcdA.sub.ii-PK44 lies
amino-proximal to the 58 kDa peptide fragment of TcdA.sub.iii.
[0319] The 1400 bp PCR products were ligated to the plasmid vector
pCR.TM.II according to the supplier's instructions. The DNA
sequences across the ends of the insert fragments of four isolates
were determined using primers similar in sequence to the supplier's
recommended primers and using sequencing methods described
previously. The nucleic acid sequence of all isolates differed as
expected in the regions corresponding to the degenerate primer
sequences, but the amino acid sequences deduced from these data
were the same as the actual amino acid sequences for the peptides
determined previously, (SEQ ID NOS:41 and 39).
[0320] Screening of the W-14 genomic cosmid library as described in
Example 8 with a radiolabeled probe comprised of the DNA prepared
above (SEQ ID NO:36) identified five hybridizing cosmid isolates,
namely 17D9, 20B10, 21D2, 27B10, and 26D1. These cosmids were
distinct from those previously identified with probes corresponding
to the genes described as SEQ ID NO:11 or SEQ ID NO:25. Restriction
enzyme analysis and DNA blot hybridizations identified three EcoR I
fragments, of approximate sizes 3.7, 3.7, and 1.1 kbp, that span
the region comprising the DNA of SEQ ID NO:36. Screening of the
W-14 genomic cosmid library using as probe the radiolabeled 1.4 kbp
DNA fragment prepared in this example identified the same five
cosmids (17D9, 20B10, 21D2, 27B10, and 26D1). DNA blot
hybridization to EcoR I-digested cosmid DNAs also showed
hybridization to the same subset of EcoR I fragments as seen with
the 2.5 kbp TcdA.sub.ii gene probe, indicating that both fragments
are encoded on the genomic DNA.
[0321] DNA sequence determination of the cloned EcoR I fragments
revealed an uninterrupted reading frame of 7551 base pairs (SEQ ID
NO:46), encoding a 282.9 kDa protein of 2516 amino acids (SEQ ID
NO:47). Analysis of the amino acid sequence of this protein
revealed all expected internal fragments of peptides TcdA.sub.ii
(SEQ ID NOS:17, 18, 37, 38 and 39) and the TcdA.sub.iii peptide
N-terminus (SEQ ID NO:41) and all TcdA.sub.iii internal peptides
(SEQ ID NOS:42 and 43). The peptides isolated and identified as
TcdA.sub.ii and TcdA.sub.iii are each products of the open reading
frame, denoted tcdA, disclosed as SEQ ID NO:46. Further, SEQ ID
NO:47 shows, starting at position 89, the sequence disclosed as SEQ
ID NO:13, which is the N-terminal sequence of a peptide of size
approximately 201 kDa, indicating that the initial protein produced
from SEQ ID NO: 46 is processed in a manner similar to that
previously disclosed for SEQ ID NO:12. In addition, the protein is
further cleaved to generate a product of size 209.2 kDa, encoded by
SEQ ID NO:48 and disclosed as SEQ ID NO:49 (TcdA.sub.ii peptide),
and a product of size 63.6 kDa, encoded by SEQ ID NO:50 and
disclosed as SEQ ID NO:51 (TcdA.sub.iii peptide). Thus, it is
thought that the insecticidal activity identified as toxin A
(Example 15) derived from the products of SEQ ID NO:46, as
exemplified by the full-length protein of 282.9 kDa disclosed as
SEQ ID NO:47, is processed to produce the peptides disclosed as SEQ
ID NOS:49 and 51. It is thought that the insecticidal activity
identified as toxin B (Example 15) derives from the products of SEQ
ID NO:11, as exemplified by the 280.6 kDa protein disclosed as SEQ
ID NO:12. This protein is proteolytically processed to yield the
207.6 kDa peptide disclosed as SEQ ID NO:53, which is encoded by
SEQ ID NO:52, and the 62.9 kDa peptide having N-terminal sequence
disclosed as SEQ ID NO:40, and further disclosed as SEQ ID NO:55,
which is encoded by SEQ ID NO:54.
[0322] Amino acid sequence comparisons between the proteins
disclosed as SEQ ID NO:12 and SEQ ID NO:47 reveal that they have
69% similarity and 54% identity using the Wisconsin Package Version
8.0, Genetics Computer Group (GCG), Madison, Wis. or 60% similarity
and 54% identity using version 9.0 of the program. This high degree
of evolutionary relationship is not uniform throughout the entire
amino acid sequence of these peptides, but is higher towards the
carboxy-terminal end of the proteins, since the peptides disclosed
as SEQ ID NO:51 (derived from SEQ ID NO:47) and SEQ ID NO:55
(derived from SEQ ID NO:12) have 76% similarity and 64% identity
using the Wisconsin Package Version 8.0, Genetics Computer Group
(GCG), Madison, Wis. or 71% similarity and 64% identity using
version 9.0 of the program.
EXAMPLE 18
Control of European Cornborer-Induced Leaf Damage on Maize Plants
by Spray Application of Photorhabdus (Strain W-14) Broth
[0323] The ability of Photorhabdus toxin(s) to reduce plant damage
caused by insect larvae was demonstrated by measuring leaf damage
caused by European corn borer (Ostrinia nubilalis) infested onto
maize plants treated with Photorhabdus broth. Fermentation broth
from Photorhabdus strain W-14 was produced and concentrated
approximately 10-fold using ultrafiltration (10,000 MW pore-size)
as described in Example 13. The resulting concentrated broth was
then filter sterilized using 0.2 micron nitrocellulose membrane
filters. A similarly prepared sample of uninoculated 2% proteose
peptone #3 was used for control purposes. Maize plants (an inbred
line) were grown from seed to vegetative stage 7 or 8 in pots
containing a soilless mixture in a greenhouse (27.degree. C. day;
22.degree. C. night, about 50% RH, 14 hr day-length,
watered/fertilized as needed). The test plants were arranged in a
randomized complete block design (3 reps/treatment, 6
plants/treatment) in a greenhouse with temperature about 22.degree.
C. day; 18.degree. C. night, no artificial light and with partial
shading, about 50% RH and watered/fertilized as needed. Treatments
(uninoculated media and concentrated Photorhabdus broth) were
applied with a syringe sprayer, 2.0 mls applied from directly
(about 6 inches) over the whorl and 2.0 additional mls applied in a
circular motion from approximately one foot above the whorl. In
addition, one group of plants received no treatment. After the
treatments had dried (approximately 30 minutes), twelve neonate
European corn borer larvae (eggs obtained from commercial sources
and hatched in-house) were applied directly to the whorl. After one
week, the plants were scored for damage to the leaves using a
modified Guthrie Scale (Koziel, M. G., Beland, G. L., Bowman, C.,
Carozzi, N. B., Crenshaw, R., Crossland, L., Dawson, J., Desai, N.,
Hill, M., Kadwell, S., Launis, K., Lewis, K., Maddox, D.,
McPherson, K., Meghji, M. Z., Merlin, E., Rhodes, R., Warren, G.
W., Wright, M. and Evola, S. V. 1993).
[0324] Bio/Technology, 11, 194-195.) and the scores were compared
statistically [T-test (LSD) p<0.05 and Tukey's Studentized Range
(HSD) Test p<0.1]. The results are shown in Table 29. For
reference, a score of 1 represents no damage, a score of 2
represents fine "window pane" damage on the unfurled leaf with no
pinhole penetration and a score of 5 represents leaf penetration
with elongated lesions and/or mid rib feeding evident on more than
three leaves (lesions <1 inch). These data indicate that broth
or other protein containing fractions may confer protection against
specific insect pests when delivered in a sprayable formulation or
when the gene or derivative thereof, encoding the protein or part
thereof, is delivered via a transgenic plant or microbe.
36TABLE 29 Effect of Photorhabdus Culture Broth on European Corn
Borer-Induced Leaf Damage on Maize Treatment Average Guthrie Score
No Treatment 5.02.sup.a Uninoculated medium 5.15.sup.a Photorhabdus
Broth 2.24.sup.b Means with different letters are statistically
different (p < 0.05 or p < 0.1).
EXAMPLE 19
Genetic Engineering of Genes for Expression in E. coli
[0325] Summary of Constructions
[0326] A series of plasmids were constructed to express the tcbA
gene of Photorhabdus W-14 in Escherichia coli. A list of the
plasmids is shown in Table 30. A brief description of each
construction follows as well as a summary of the E. coli expression
data obtained.
37TABLE 30 Expression Plasmids for the tcbA Gene Plasmid Gene
Vector/Selection Compartment pDAB2025 tcbA pBC/Chl Intracellular
pDAB2026 tcbA pAcGP67B/Amp Baculovirus, secreted pDAB2027 tcbA
pET27b/Kan Periplasm pDAB2028 tcbA pET15-tcbA Intracellular
Abbreviations: Kan = kanamycin, Chl = chloramphenicol, Amp =
ampicillin
[0327] Construction of pDAB2025
[0328] In Example 9, a large EcoR I fragment which hybridizes to
the TcbA.sub.ii probe is described. This fragment was subcloned
into pBC (Stratagene, La Jolla Calif.) to create pDAB2025. Sequence
analysis indicates that the fragment is 8816 base pairs. The
fragment encodes the tcbA gene with the initiating ATG at position
571 and the terminating TAA at position 8086. The fragment
therefore carries 570 base pairs of Photorhabdus DNA upstream of
the ATG and 730 base pairs downstream of the TAA.
[0329] Construction of Plasmid pDAB2026
[0330] The tcbA gene was PCR amplified from plasmid pDAB2025 using
the following primers; 5' primer (SlAc51) 5' TTT AAA CCA TGG GAA
ACT CAT TAT CAA GCA CTA TC 3' and 3' primer (SlAc31) 5' TTT AAA GCG
GCC GCT TAA CGG ATG GTA TAA CGA ATA TG 3'. PCR was performed using
a TaKaRa LA PCR kit from PanVera (Madison, Wis.) in the following
reaction: 57.5 microliters water, 10 microliters 10.times.LA
buffer, 16 microliters dNTPs (2.5 mM each stock solution), 20
microliters each primer at 10 pmoles/ microliters, 300 ng of the
plasmid pDAB2025 containing the W-14 tcbA gene and one microliter
of TaKaRa LA Taq polymerase. The cycling conditions were 98.degree.
C./20 sec, 68.degree. C./5 min, 72.degree. C./10 min for 30 cycles.
A PCR product of the expected about 7526 bp was isolated in a 0.8%
agarose gel in TBE (100 mM Tris, 90 mM boric acid, 1 mM EDTA)
buffer and purified using a Qiaex II kit from Qiagen (Chatsworth,
Calif.). The purified tcbA gene was digested with Nco I and Not I
and ligated into the baculovirus transfer vector pAcGP67B
(PharMingen (San Diego, Calif.)) and transformed into DH5.alpha. E.
coli. The resulting recombinant is called pDAB2026. The tcbA gene
was then cut from pDAB2026 and transferred to pET27b to create
plasmid pDAB2027. A missense mutation in the tcbA gene was repaired
in pDAB2027.
[0331] The repaired tcbA gene contains two changes from the
sequence shown in Sequence ID NO:11; an A>G at 212 changing an
asparagine 71 to serine 71 and a G>A at 229 changing an alanine
77 to threonine 77. These changes are both upstream of the proposed
TcbA.sub.ii N-terminus.
[0332] Construction of pDAB2028
[0333] The tcbA coding region of pDAB2027 was transferred to vector
pET15b. This was accomplished using shotgun ligations, the DNAs
were cut with restriction enzymes Nco I and Xho I. The resulting
recombinant is called pDAB2028.
[0334] Expression of TcbA in E. coli from Plasmid pDAB2028
[0335] Expression of tcbA in E. coli was obtained by modification
of the methods previously described by Studier et al. (Studier, F.
W., Rosenberg, A., Dunn, J., and Dubendorff, J., (1990) Use of T7
RNA polymerase to direct expression of cloned genes. Methods
Enzymol., 185: 60-89.). Competent E. coli cells strain BL21(DE3)
were transformed with plasmid pDAB2028 and plated on LB agar
containing 100 .mu.g/mL ampicillin and 40 mM glucose. The
transformed cells were plated to a density of several hundred
isolated colonies/plate. Following overnight incubation at
37.degree. C. the cells were scraped from the plates and suspended
in LB broth containing 100 .mu.g/mL ampicillin. Typical culture
volumes were from 200-500 mL. At time zero, culture densities
(OD600) were from 0.05-0.15 depending on the experiment. Cultures
were shaken at one of three temperatures (22.degree. C., 30.degree.
C. or 37.degree. C.) until a density of 0.15-0.5 was obtained at
which time they were induced with 1 mM
isopropylthio-.beta.-galactoside (IPTG). Cultures were incubated at
the designated temperature for 4-5 hours and then were transferred
to 4.degree. C. until processing (12-72 hours).
[0336] Purification and Characterization of TcbA Expressed in E.
coli from Plasmid pDAB2028
[0337] E. coli cultures expressing TcbA peptides were processed as
follows. Cells were harvested by centrifugation at 17,000.times.G
and the media was decanted and saved in a separate container.
[0338] The media was concentrated about 8.times. using the M12
(Amicon, Beverly Mass.) filtration system and a 100 kD molecular
mass cut-off filter. The concentrated media was loaded onto an
anion exchange column and the bound proteins were eluted with 1.0 M
NaCl. The 1.0 M NaCl elution peak was found to cause mortality
against Southern corn rootworm (SCR) larvae Table 30). The 1.0 M
NaCl fraction was dialyzed against 10 mM sodium phosphate buffer pH
7.0, concentrated, and subjected to gel filtration on Sepharose
CL-4B (Pharmacia, Piscataway, N.J.). The region of the CL-4B
elution profile corresponding to calculated molecular weight (about
900 kDa) as the native W-14 toxin complex was collected,
concentrated and bioassayed against larvae. The collected 900 kDa
fraction was found to have insecticidal activity (see Table 31
below), with symptomology similar to that caused by native W-14
toxin complex. This fraction was subjected to Proteinase K and heat
treatment, the activity in both cases was either eliminated or
reduced, providing evidence that the activity is proteinaceous in
nature. In addition, the active fraction tested immunologically
positive for the TcbA and TcbA.sub.iii peptides in immunoblot
analysis when tested with an anti-TcbA.sub.iii monoclonal antibody
(Table 31).
38TABLE 31 Results of Immunoblot and SCR Bioassays Native Size SCR
Activity Immunoblot [CL-4B % % Growth Peptides Estimated Fraction
Mortality Inhibit. Detected Size] TcbA Media 1.0 M +++ +++ TcbA Ion
Exchange TcbA Media CL-4B +++ +++ TcbA, about TcbA.sub.iii 900 kDa
TcbA Media CL-4B + ++ +++ NT Proteinase K TcbA Media CL-4B + - - NT
heat treatment TcbA Cell Sup CL-4B - +++ NT about 900 kD PK =
Proteinase K treatment 2 hours; Heat treatment = 100.degree. C. for
10 minutes; ND = None Detected; NT = Not Tested. Scoring system for
mortality and growth inhibition as compared to control samples;
5-24% = "+", 25-49% = "++", 50-100% = "+++".
[0339] The cell pellet was resuspended in 10 mM sodium phosphate
buffer, pH=7.0, and lysed by passage through a Bio-Neb.TM. cell
nebulizer (Glas-Col Inc., Terra Haute, Ind.). The pellets were
treated with DNase to remove DNA and centrifuged at 17,000.times.g
to separate the cell pellet from the cell supernatant. The
supernatant fraction was decanted and filtered through a 0.2 micron
filter to remove large particles and subjected to anion exchange
chromatography. Bound proteins were eluted with 1.0 M NaCl,
dialyzed and concentrated using Biomax.TM. (Millipore Corp,
Bedford, Mass.) concentrators with a molecular mass cut-off of
50,000 Daltons. The concentrated fraction was subjected to gel
filtration chromatography using Sepharose CL-4B beaded matrix.
Bioassay data for material prepared in this way is shown in Table
30 and is denoted as "TcbA Cell Sup".
[0340] In yet another method to handle large amounts of material,
the cell pellets were re-suspended in 10 mM sodium phosphate
buffer, pH=7.0 and thoroughly homogenized by using a Kontes Glass
Company (Vineland, N.J.) 40 ml tissue grinder. The cellular debris
was pelleted by centrifugation at 25,000.times.g and the cell
supernatant was decanted, passed through a 0.2 micron filter and
subjected to anion exchange chromatography using a Pharmacia 10/10
column packed with Poros HQ 50 beads. The bound proteins were
eluted by performing a NaCl gradient of 0.0 to 1.0 M. Fractions
containing the TcbA protein were combined and concentrated using a
50 kDa concentrator and subjected to gel filtration chromatography
using Pharmacia CL-4B beaded matrix. The fractions containing TcbA
oligomer, molecular mass of approximately 900 kDa, were collected
and subjected to anion exchange chromatography using a Pharmacia
Mono Q 10/10 column equilibrated with 20 mM Tris buffer pH=7.3. A
gradient of 0.0 to 1.0 M NaCl was used to elute recombinant TcbA
protein. Recombinant TcbA eluted from the column at a salt
concentration of approximately 0.3-0.4 M NaCl, the same molarity at
which native TcbA oligomer is eluted from the Mono Q 10/10 column.
The recombinant TcbA fraction was found to cause SCR mortality in
bioassay experiments similar to those in Table 31.
[0341] A second set of expression constructions were prepared and
tested for expression of the TcbA protein toxin.
[0342] Construction of pDAB2030: An Expression Plasmid for the tcbA
Coding Region
[0343] The plasmid pDAB2028 (see herein) contains the tcbA coding
region in the commercial vector pET15 (Novagen, Madison, Wis.),
encodes an ampicillin selection marker. The plasmid pDAB2030 was
created to express the tcbA coding region from a plasmid which
encodes a kanamycin selection marker. This was done by cutting
pET27 (Novagen, Madison, Wis.) a kanamycin selection plasmid, and
pDAB2028 with Xba I and Xho I. This releases the entire multiple
cloning site, including the tcbA coding region from plasmid
pDAB2028. The two cut plasmids, were mixed and ligated. Recombinant
plasmids were selected on kanamycin and those containing the
pDAB2028 fragment were identified by restriction analysis. The new
recombinant plasmid is called pDAB2030.
[0344] Construction of Plasmid pDAB2031: Correction of Mutations in
tcbA.sub.i
[0345] The two mutations in the N-terminus of the tcbA coding
region as described in Example 19 (Sequence ID NO:11; A>G at 212
changing an asparagine 71 to serine 71; G>A at 229 changing an
alanine 77 to threonine 77) were corrected as follows: A PCR
product was generated using the primers TH50 (5' ACC GTC TTC TTT
ACG ATC AGT G 3') and SlAc51(5' TTT AAA CCA TGG GAA ACT CAT TAT CAA
GCA CTA TC 3')and pDAB2025 as template to generate a 1778 bp
product. This PCR product was cloned into plasmid pCR2.1
(Invitrogen, San Diego, Calif.) and a clone was isolated and
sequenced. The clone was digested with Nco I and Pin AI and a 1670
bp fragment was purified from a 1% agarose gel. A plasmid
containing the mutated tcbA coding region (pDAB2030) was digested
with Nco I and Not I and purified away from the 1670 bp fragment in
a 0.8% agarose with Qiaex II (Qiagen, Chatsworth, Calif.). The
corrected Nco I/Pin AI fragment was then ligated into pDAB2030. The
ligated DNA was transformed into DH5.alpha. E. coli. A clone was
isolated, sequenced and found to be correct. This plasmid,
containing the corrected tcbA coding region, is called
pDAB2031.
[0346] Construction of pDAB2033 and pDAB2034: Expression Plasmids
for tcbA
[0347] The expression plasmids pDAB2025 and pDAB2027-2031 all rely
on the Bacteriophage T7 expression system. An additional vector
system was used for bacterial expression of the tcbA gene and its
derivatives. The expression vector Trc99a (Pharmacia Biotech,
Piscataway, N.J.) contains a strong trc promoter upstream of a
multiple cloning site with a 5' Nco I site which is compatible with
the tcbA coding region from pDAB2030 and 2031. However, the plasmid
does not have a compatible 3' site. Therefore, the Hind III site of
Trc99a was cut and made blunt by treatment with T4 DNA polymerase
(Boehringer Mannheim, Indianapolis, Ind.). The vector plasmid was
then cut by Nco I followed by treatment with alkaline phosphatase.
The plasmids pDAB2030 and pDAB2031 were each cut with Xho I (cuts
at the 3' end of the tcbA coding region) followed by treatment with
T4 DNA polymerase to blunt the ends. The plasmids were then cut
with Nco I, the DNAs were extracted with phenol, ethanol
precipitated and resuspended in buffer. The Trc99a and pDAB2030 and
pDAB2031 plasmids were mixed separately, ligated and transformed
into DH5.alpha. cells and plated on LB media containing ampicillin
and 50 mM glucose. Recombinant plasmids were identified by
restriction digestion. The new plasmids are called pDAB2033
(contains the tcbA coding sequence with the two mutations in
tcbA.sub.i) and pDAB2034 (contains the corrected version of tcbA
from pDAB2031).
[0348] Construction of Plasmid pDAB2032: An Expression Plasmid for
tcbA.sub.iiA.sub.iii
[0349] A plasmid encoding the TcbA.sub.iiA.sub.iii portion of TcbA
was created in a similar way as plasmid pDAB2031. A PCR product was
generated using TH42 (5' TAG GTC TCC ATG GCT TTT ATA CAA GGT TAT
AGT GAT CTG 3') and TH50 (5' ACC GTC TTC TTT ACG ATC AGT G 3')
primers and plasmid pDAB2025 as template. This yielded a product of
1521 bp having an initiation codon at the beginning of the coding
sequence of tcbA.sub.ii. This PCR product was isolated in a 1%
agarose gel and purified. The purified product was cloned into
pCR2.1 as above and a correct clone was identified by DNA sequence
analysis. This clone was digested with Nco I and Pin AI, a 1414 bp
fragment was isolated in a 1% agarose gel and ligated into the Nco
I and Pin AI sites of plasmid pDAB2030 and transformed into
DH5.alpha. E. coli. This new plasmid, designed to express
TcbA.sub.iiA.sub.iii in E. coli, is called pDAB2032.
[0350] Expression of tcbA and tcbA.sub.iiA.sub.iii from Plasmids
pDAB2030, pDAB2031 and pDAB2032
[0351] Expression of tcbA in E. coli from plasmids pDAB2030,
pDAB2031 and pDAB2032 was as described herein, except expression of
tcbA.sub.iiA.sub.iii was done in E. coli strain HMS174(DE3)
(Novagen, Madison, Wis.).
[0352] Expression of tcbA from Plasmid pDAB2033
[0353] The plasmid pDAB2033 was transformed into BL21 cells
(Novagen, Madison, Wis.) and plated on LB containing 100
micrograms/mL ampicillin and 50 mM glucose. The plates were spread
such that several hundred well separated colonies were present on
each plate following incubation at either 30.degree. C. or
37.degree. C. overnight. The colonies were scraped from the plates
and suspended in LB containing 100 micrograms/mL ampicillin, but no
glucose. Typical culture volume was 250 mL in a single 1 L baffle
bottom flask. The cultures were induced when the culture reached a
density of 0.3-0.6 OD600 nm. Most often this density was achieved
immediately after suspension of the cells from the plates and did
not require a growth period in liquid media. Two induction methods
were used. Method 1: cells were induced with 1 mM IPTG at
37.degree. C. The cultures were shaken at 200 rpm on a platform
shaker for 5 hours and harvested. Method 2: The cultures were
induced with 25 micromolar IPTG at 30.degree. C. and shaken at 200
rpm for 15 hours at either 20.degree. C. or 30.degree. C. The
cultures were stored at 4.degree. C. until used for
purification.
[0354] Purification of TcbA from E. coli
[0355] Purification, bioassay and immunoblot analysis of TcbA and
TcbA.sub.iiA.sub.iii was as described herein. Results of several
representative E. coli expression experiments are shown in Table
32. All materials shown in Table 32 were purified from the media
fraction of the cultures. The predicted native molecular weight is
approximately 900 kD as described herein. The purity of the
samples, the amount of TcbA relative to contaminating proteins,
varied with each preparation.
39TABLE 32 Bioassay Activity and Immunoblot Analysis of TcbA and
Derivatives Produced in E. coli and Purified from the Culture Media
Southern Corn Rootworm Bioassay Peptides Micrograms E. Activity
Detected Protein Coding coli % Growth % by Applied to Plasmid
Region Strain Inhibit. Mortal. Immunoblot Diet pDAB2030 tcbA BL21 -
+++ TcbA + TcbA.sub.iii 1-8 (DE3) pDAB2031 tcbA BL21 - +++ TcbA +
TcbA.sub.iii 1-10 (DE3) pDAB2033 tcbA BL21 - +++ TcbA +
TcbA.sub.iii 1-2 pDAB2032 tcbA.sub.iiA.sub.iii HMS174 +++ +
TcbA.sub.iiA.sub.iii + TcbA.sub.iii 13-27 (DE3) Scoring system for
mortality and growth inhibition on Southern Corn Rootworm as
compared to control samples; 5-24% = "+", 25-49% = "++", 50-100% =
"+++".
EXAMPLE 20
Characterization of Toxin Peptides with Matrix-Assisted Laser
Desorption Ionization Time-of-Flight Mass Spectroscopy
[0356] Toxins isolated from W-14 broth were purified as described
in Example 15. In some cases, the TcaB protein toxin was pretreated
with proteases (Example 16) that had been isolated from W-14 broth
as previously described (Example 15). Protein molecular mass was
determined using matrix-assisted laser desorption ionization
time-of-flight mass spectroscopy, hereinafter MALDI-TOF, on a
VOYAGER BIOSPECTROMETRY workstation with DELAYED EXTRACTION
technology (PerSeptive Biosystems, Framingham, MASS.). Typically,
the protein of interest (100-500 pmoles in 5 .mu.l) was mixed with
1 .mu.l of acetonitrile and dialyzed for 0.5 to 1 h on a Millipore
VS filter having a pore size of 0.025 .mu.M (Millipore Corp.
Bedford, Mass.) Dialysis was performed by floating the filter on
water(shinny side up) followed by adding protein-acetonitrile
mixture as a droplet to the surface of the filter. After dialysis,
the dialyzed protein removed using a pipette and was then mixed
with a matrix consisting of sinapinic acid and trifluoroacetic acid
according to manufacturers instructions. The protein and matrix
were allowed to co-crystallize on a about 3 cm.sup.2 gold-plated
sample plate (PerSeptive Corp.). Excitation of the crystals and
subsequent mass analysis was performed using the following
conditions: laser setting of 3050; pressure of 4.55e-07; low mass
gate of 1500.0; negative ions off; accelerating voltage of 25,000;
grid voltage of 90.0%; guide wire voltage of 0.010%; linear mode;
and a pulse delay time of 350 ns.
[0357] Protein mass analysis data are shown in Table 33. The data
obtained from MALDI-TOF was compared to that hypothesized from gene
sequence information and as previously determined by SDS-PAGE.
40TABLE 33 Molecular Analysis of Peptides by MALDI-TOF, SDS-PAGE
and Predicted Determination Based on Gene Sequence Peptide
Predicted (Gene) SDS PAGE MALDI-TOF TcbA 280,634 Da 240,000 Da
281,040 Da TcbA.sub.i/ii 217,710 Da not resolved 216,812 Da
TcbA.sub.ii 207,698 Da 201,000 Da 206,473 Da TcbA.sub.iii 62,943 Da
58,000 Da 63,520 Da TcdA.sub.ii 209,218 Da 188,000 Da 208,186 Da
TcdA.sub.iii 63,520 Da 56,000 Da 63,544 Da TcbA.sub.ii Protease
Generated 201,000 Da 216,614 Da{circumflex over ( )} 215,123
Da{circumflex over ( )} 210,391 Da{circumflex over ( )} 208,680
Da{circumflex over ( )} TcbA.sub.iii Protease Generated 56,000 Da
64,111 Da {circumflex over ( )}Data normalized TcbA, multiple
fragments observed at TcbAi/ii
EXAMPLE 21
Production of Peptide Specific Polyclonal Antibodies
[0358] Nine peptide components of the W-14 toxin complex, namely,
TcaA, TcaA.sub.iii, TcaB.sub.i, TcaB.sub.ii, TcaC, TcbA.sub.ii,
TcbA.sub.iii, TcdA.sub.ii, and TcdA.sub.iii were selected as
targets against which antibodies were produced. Comprehensive DNA
and deduced amino acid sequence data for these peptides indicated
that the sequence homology between some of these peptides was
substantial. If a whole peptide was used as the immunogen to induce
antibody production, the resulting antibodies might bind to
multiple peptides in the toxin preparation. To avoid this problem
antibodies were generated that would bind specifically to a unique
region of each peptide of interest. The unique region (subpeptide)
of each target peptide was selected based on the analyses described
below.
[0359] Each entire peptide sequence was analyzed using
MacVector.TM. Protein Analysis Tool (IBI Sequence Analysis
Software, International Biotechnologies, Inc., P. O. Box 9558, New
Haven, Conn. 06535) to determine its antigenicity index. This
program was designed to locate possible externally-located amino
acid sequences, i.e., regions that might be antigenic sites. This
method combined information from hydrophilicity, surface
probability, and backbone flexibility predictions along with the
secondary structure predictions in order to produce a composite
prediction of the surface contour of a protein. The scores for each
of the analyses were normalized to a value between -1.0 and +1.0
(MacVector.TM. Manual). The antigenicity index value was obtained
for the entire sequence of the target peptide. From each peptide,
an area covering 19 or more amino acids that showed a high
antigenicity index from the original sequence was re-analyzed to
determine the antigenicity index of the subpeptide without the
flanking residues. This re-analysis was necessary because the
antigenicity index of a peptide could be influenced by the flanking
amino acid residues. If the isolated subpeptide sequence did not
maintain a high antigenicity index, a new region was chosen and the
analysis was repeated.
[0360] Each selected subpeptide sequence was aligned and compared
to all seven target peptide sequences using MacVector.TM. alignment
program. If a selected subpeptide sequence showed identity (greater
than 20%) to another target peptide, a new 19 or more amino acid
region was isolated and re-analyzed. Unique subpeptide sequences
covering 19 or more amino acid showing high antigenicity index were
selected from all target peptides.
[0361] The sequences of seven subpeptides were sent to Genemed
Biotechnology Inc. The last amino acid residue on each subpeptide
was deleted because it showed no apparent effect on the
antigenicity index. A cysteine residue was added to the N-terminal
of each subpeptide sequence, except TcaB.sub.i-syn which contains
an internal cysteine residue. The present of a cysteine residue
facilitates conjugation of a carrier protein (KLH). The final
peptide products corresponding to the appropriate toxin peptides
and SEQ ID NO.s are shown in Table 34.
41TABLE 34 Amino Acid Sequences for Synthetic Peptides SEQ ID No.
Pepide Amino Acid Sequence 63 TcaA.sub.ii-syn NH2-(C) L R G N S P T
N P D K D G I F A Q V A 64 TcaA.sub.iii-syn NH2-(C) Y T P D Q T P S
F Y E T A F R S A D G 65 TcaB.sub.i-syn NH2-H G Q S Y N D N N Y C N
F T L S I N T 66 TcaB.sub.iii-syn NH2-(C) V D P K T L Q R Q Q A G G
D G T G S S 67 TcaC-syn NH2-(C) Y K A P Q R Q E D G D S N A V T Y D
K 68 TcbA.sub.ii-syn NH2-(C) Y N E N P S S E D K K W Y F S S K D D
69 TcbA.sub.iii-syn NH2-(C) F D S Y S Q L Y E E N I N A G E Q R A
70 TcdA.sub.ii-syn NH2-(C) N P N N S S N K L M F Y P V Y Q Y S G N
T 71 TcdA.sub.iii-syn NH2-(C) V S Q G S G S A G S G N N N L A F G A
G
[0362] Each conjugated synthetic peptide was injected into two
rabbits according to Genemed accelerated program. The pre- and
post-immune sera were available for testing after one month.
[0363] The preliminary test of both pre- and post-immune sera from
each rabbit was performed by Genemed Biotechnologies Inc. Genemed
reported that by using both ELISA and Western blot techniques, they
detected the reaction of post-immune sera to the respective
synthetic peptides. Subsequently, the sera were tested with the
whole target peptides, by Western blot analysis. Two batches of
partially purified Photorhabdus strain W-14 toxin complex was used
as the antigen. The two samples had shown activity against the
Southern corn rootworm. Their peptide patterns on an SDS-PAGE gel
were slightly different.
[0364] Pre-cast SDS-polyacrylamide gels with 4-20% gradient
(Integrated Separation Systems, Natick, Mass. 01760) were used.
Between 1 to 8 .mu.g of protein was applied to each gel well.
Electrophoresis was performed and the protein was electroblotted
onto Hybond-ECL.TM. nitrocellulose membrane (Amersham
International). The membrane was blocked with 10% milk in TBST (25
mM Tris HCl pH 7.4, 136 mM NaCl, 2.7 mM KCl, 0.1% Tween 20) for one
hour at room temperature. Each rabbit serum was diluted in 10%
milk/TBST to 1:500. Other dilutions between 1:50 to 1:1000 were
also used. The serum was added to the membrane and placed on a
platform rocker for at least one hour. The membrane was washed
thoroughly with the blocking solution or TBST. A 1:2000 dilution of
secondary antibodies (goat anti-mouse IgG conjugated to horse
radish peroxidase; BioRad Laboratories) in 10% milk/TBST was
applied to the membrane placed on a platform rocker for one hour.
The membrane was subsequently washed with excess amount of TBST.
The detection of the protein was performed by using an ECL
(Enhanced Chemiluminescence) detection kit (Amersham
International).
[0365] Western blot analyses were performed to identify binding
specificity of each anti-synthetic peptide antibodies. All
synthetic polyclonal antibodies showed specificity toward to
processed and, when applicable, unprocessed target peptides from
protein fractions derived from Photorhabdus culture broth. Various
antibodies were shown to recognize either unprocessed or processed
recombinant proteins derived from heterologous expression systems
such as bacteria or insect cells, using baculovirus expression
constructs. In one case, the anti-TcbA.sub.iii-syn antibody showed
some cross-reactivity to anti-TcdA.sub.iii peptide. In a second
case, the anti-TcaC-syn antibody, recognized an unidentified 190
kDa peptide in W-14 toxin complex fractions.
EXAMPLE 22
Characterization of Photorhabdus Strains
[0366] In order to establish that the collection described herein
was comprised of Photorhabdus strains, the strains herein were
assessed in terms of recognized microbiological traits that are
characteristic of the bacterial genus Photorhabdus and which
differentiate it from other Enterobacteriaceae and Xenorhabdus spp.
(Farmer, J. J. 1984. Bergey's Manual of Systemic Bacteriology, Vol
1. pp. 510-511. (ed. Kreig N. R. and Holt, J. G.). Williams &
Wilkins, Baltimore.; Akhurst and Boemare, 1988, J. Gen. Microbiol.
134, 1835-1845; Forst and Nealson, 1996. Microbiol. Rev. 60,
21-43). These characteristic traits are as follows: Gram stain
negative rods, organism size of 0.3-2 .mu.m in width and 2-10 .mu.m
in length [with occasional filaments (15-50 .mu.m) and
spheroplasts], yellow to orange/red colony pigmentation on nutrient
agar, presence of crystalline inclusion bodies, presence of
catalase, inability to reduce nitrate, presence of bioluminescence,
ability to take up dye from growth media, positive for protease
production, growth at temperatures below 37.degree. C., survival
under anaerobic conditions and positively motile. (Table 33). Test
methods were checked using reference Escherichia coli, Xenorhabdus
and Photorhabdus strains. The overall results are consistent with
all strains being part of the family Enterobacteriaceae and the
genus Photorhabdus. Note that DEP1, DEP2, and DEP3 refer to
Photorhabdus strains obtained from the American Type Culture
Collection, 12301 Parklawn Drive, Rockville, Md. 20852 USA (#29304,
29999 and 51583, respectively).
[0367] A luminometer was used to establish the bioluminescence
associated with these Photorhabdus strains. To measure the presence
or absence of relative light emitting units, the broths from each
strain (cells and media) were measured at three time intervals
after inoculation in liquid culture (24, 48, 72 hr) and compared to
background luminosity (uninoculated media). Several Xenorhabdus
strains were tested as negative controls for luminosity. Prior to
measuring light emission from the various broths, cell density was
established by measuring light absorbance (560 nM) in a Gilford
Systems (Oberlin, Ohio) spectrophotometer using a sipper cell. The
resulting light emitting units could then be normalized to density
of cells. Aliquots of the broths were placed into 96-well
microliter plates (100 A1 each) and read in a Packard Lumicount.TM.
luminometer (Packard Instrument Co., Meriden, Conn.). The
measurement period for each sample was 0.1 to 1.0 second. The
samples were agitated in the luminometer for 10 sec prior to taking
readings. A positive test was determined as being about 5-fold
background luminescence (about 1-15 relative light units). In
addition, degree of colony luminosity was confirmed with
photographic film overlays and by eye, after visual adaptation in a
darkroom. The Gram's staining characteristics of each strain were
established with a commercial Gram's stain kit (BBL, Cockeysville,
Md.) used in conjunction with Gram's stain control slides (Fisher
Scientific, Pittsburgh, Pa.). Microscopic evaluation was then
performed using a Zeiss microscope (Carl Zeiss, Germany) 100.times.
oil immersion objective lens (with 10.times. ocular and 2.times.
body magnification). Microscopic examination of individual strains
for organism size, cellular description and inclusion bodies (the
latter two observations after logarithmic growth) was performed
using wet mount slides (10.times. ocular, 2.times. body and
40.times. objective magnification) and phase contrast microscopy
with a micrometer (Akhurst, R. J. and Boemare, N. E. 1990.
Entomopathogenic Nematodes in Biological Control (ed. Gaugler, R.
and Kaya, H.). pp. 75-90. CRC Press, Boca Raton, USA.; Baghdiguian
S., Boyer-Giglio M. H., Thaler, J. O., Bonnot G., Boemare N. 1993.
Biol. Cell 79, 177-185.). Colony pigmentation was observed after
inoculation on Bacto nutrient agar, (Difco Laboratories, Detroit,
Mich.) prepared as per label instructions. Incubation occurred at
28.degree. C. and descriptions were produced after 5 days. To test
for the presence of the enzyme catalase, a colony of the test
organism was removed on a small plug from a nutrient agar plate and
placed into the bottom of a glass test tube. One ml of a household
hydrogen peroxide solution was gently added down the side of the
tube. A positive reaction was recorded when bubbles of gas
(presumptive oxygen) appeared immediately or within 5 seconds.
Controls of uninoculated nutrient agar and hydrogen peroxide
solution were also examined. To test for nitrate reduction, each
culture was inoculated into 10 ml of Bacto Nitrate Broth (Difco
Laboratories, Detroit, Mich.). After 24 hours incubation with
gentle agitation at 28.degree. C., nitrite production was tested by
the addition of two drops of sulfanilic acid reagent and two drops
of alpha-naphthylamine reagent (see Difco Manual, 10th edition,
Difco Laboratories, Detroit, Mich., 1984). The generation of a
distinct pink or red color indicates the formation of nitrite from
nitrate whereas the lack of color formation indicates that the
strain is nitrate reduction negative. In the latter case, finely
powdered zinc was added to further confirm the presence of
unreduced nitrate; established by the formation of nitrite and the
resultant red color. The ability of each strain to uptake dye from
growth media was tested with Bacto MacConkey agar containing the
dye neutral red; Bacto Tergitol-7 agar containing the dye
bromothymol blue and Bacto EMB Agar containing the dye eosin-Y
(formulated agars from Difco Laboratories, Detroit, Mich., all
prepared according to label instructions). After inoculation on
these media, dye uptake was recorded after incubation at 28.degree.
C. for 5 days. Growth on these latter media is characteristic for
members of the family Enterobacteriaceae. Motility of each strain
was tested using a solution of Bacto Motility Test Medium (Difco
Laboratories, Detroit, Mich.) prepared as per label instructions. A
butt-stab inoculation was performed with each strain and motility
was judged macroscopically by a diffuse zone of growth spreading
from the line of inoculum. The production of protease was tested by
observing hydrolysis of gelatin using Bacto gelatin (Difco
Laboratories, Detroit, Mich.) made as per label instructions.
Cultures were inoculated and the tubes or plates were incubated at
28.degree. C. for 5 days. Gelatin hydrolysis was then checked at
room temperature, i.e. less than 22.degree. C. To assess growth at
different temperatures, agar plates [2% proteose peptone #3 with
two percent Bacto-Agar (Difco, Detroit, Mich.) in deionized water]
were streaked from a common source of inoculum. Plates were
incubated at 20, 28 and 37.degree. C. for up to three weeks. The
incubator temperature levels were checked with an electronic
thermocouple and meter to insure valid temperature settings. Oxygen
requirements for Photorhabdus strains were tested in the following
manner. A butt-stab inoculation into fluid thioglycolate broth
medium (Difco, Detroit, Mich.) was made. The tubes were incubated
at room temperature for one week and cultures were then examined
for type and extent of growth. The indicator resazurin demonstrates
the presence of medium oxygenation or the aerobiosis zone (Difco
Manual, 10th edition, Difco Laboratories, Detroit, Mich.). Growth
zone results obtained for the Photorhabdus strains tested were
consistent with those of a facultative anaerobic microorganism. In
the case of unclear results, the final agar concentration of fluid
thioglycolate broth medium was raised to 0.75% and the growth
characteristics rechecked.
42TABLE 35 Taxonomic Traits of Photorhabdus Strains Strain A* B C D
E F G H I J.sup..sctn. K L M N O P Q P. -.sup..dagger. + + rd S + -
+ + + PO + + + + + + - zealandica P. hepialus - + + rd S + - + + +
Y + + + + + + - HB-Arg - + + rd S + - + + + W + + + + + + - HB
Oswego - + + rd S + - + + + W + + + + + + - HB Lewiston - + + rd S
+ - + + + T + + + + + + - K-122 - + + rd S + - + + + Y + + + + + +
- HMGD - + + rd S + - + + + Rd + + + + + + - Indicus - + + rd S + -
+ + + W + + + + + + - GD - + + rd S + - + + + YT + + + + + + -
PWH-5 - + + rd S + - + + + Y + + + + + + - Megidis - + + rd S + - +
+ + R + + + + + + - HF-85 - + + rd S + - + + + R + + + + + + - A.
Cows - + + rd S + - + + + PR + + + + + + - MP1 - + + rd S + - + + +
T + + + + + + - MP2 - + + rd S + - + + + T + + + + + + - MP3 - + +
rd S + - + + + R + + + + + + - MP4 - + + rd S + - + + + Y + + + + +
+ - MP5 - + + rd S + - + + + PR + + + + + + - GL98 - + + rd S + - +
+ + W + + + + + + - GL101 - + + rd S + - + + + W + + + + + + -
GL138 - + + rd S + - + + + W + + + + + + - GL155 - + + rd S + - + +
+ W + + + + + + - GL217 - + + rd S + - + + + Y + + + + + + - GL257
- + + rd S + - + + + O + + + + + + - DEP1 - + + rd S + - + + + W +
+ + + + + - DEP2 - + + rd S + - + + + PR + + + + + + - DEP3 - + +
rd S + - + + + CR + + + + + + - *A = Gram's stain, B = Crystaline
inclusion bodies, C = Bioluminescence, D = Cell form, E = Motility,
F = Nitrate reduction, G = Presence of catalase, H = Gelatin
hydrolysis, I = Dye uptake, J = Pigmentation on Nutrient Agar (some
color shifts after Day 5), K = Growth on EMB agar, L = Growth on
MacConkey agar, M = Growth on #Tergitol-7 agar, N = Facultative
anaerobe, O = Growth at 20.degree. C., P = Growth at 28.degree. C.,
Q = Growth at 37.degree. C. .sup..dagger.+ = positive for trait, -
= negative for trait; rd = rod, S = sized within Genus descriptors.
.sup..sctn.W = white, CR = cream, Y = yellow, YT = yellow tan, T =
tan PO = pale orange, O = orange, PR = pale red, R = red.
[0368] The evolutionary diversity of the Photorhabdus strains in
our collection was measured by analysis of PCR (Polymerase Chain
Reaction) mediated genomic fingerprinting using genomic DNA from
each strain. This technique is based on families of repetitive DNA
sequences present throughout the genome of diverse bacterial
species (reviewed by Versalovic, J., Schneider, M., D E Bruijn, F.
J. and Lupski, J. R. 1994. Methods Mol. Cell. Biol., 5, 25-40).
Three of these, repetitive extragenic palindromic sequence (REP),
enterobacterial repetitive intergenic consensus (ERIC) and the BOX
element are thought to play an important role in the organization
of the bacterial genome. Genomic organization is believed to be
shaped by selection and the differential dispersion of these
elements within the genome of closely related bacterial strains can
be used to discriminate these strains (e.g., Louws, F. J.,
Fulbright, D. W., Stephens, C. T. and D E Bruijn, F. J. 1994. Appl.
Environ. Micro. 60, 2286-2295). Rep-PCR utilizes oligonucleotide
primers complementary to these repetitive sequences to amplify the
variably sized DNA fragments lying between them. The resulting
products are separated by electrophoresis to establish the DNA
"fingerprint" for each strain.
[0369] To isolate genomic DNA from our strains, cell pellets were
resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a
final volume of 10 ml and 12 ml of 5 M NaCl was then added. This
mixture was centrifuged 20 min. at 15,000.times.g. The resulting
pellet was resuspended in 5.7 ml of TE and 300 .mu.l of 10% SDS and
60 .mu.l 20 mg/ml proteinase K (Gibco BRL Products, Grand Island,
N.Y.) were added. This mixture was incubated at 37.degree. C. for 1
hr, approximately 10 mg of lysozyme was then added and the mixture
was incubated for an additional 45 min. One milliliter of 5M NaCl
and 800 .mu.l of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) were
then added and the mixture was incubated 10 min. at 65.degree. C.,
gently agitated, then incubated and agitated for an additional 20
min. to aid in clearing of the cellular material. An equal volume
of chloroform/isoamyl alcohol solution (24:1, v/v) was added, mixed
gently then centrifuged. Two extractions were then performed with
an equal volume of phenol/chloroform/isoamyl alcohol (50:49:1).
Genomic DNA was precipitated with 0.6 volume of isopropanol.
Precipitated DNA was removed with a glass rod, washed twice with
70% ethanol, dried and dissolved in 2 ml of STE (10 mM Tris-HCl
pH8.0, 10 mM NaCl, 1 mM EDTA) The DNA was then quantitated by
optical density at 260 nm. To perform rep-PCR analysis of
Photorhabdus genomic DNA the following primers were used, REP1R-I;
5'-IIIICGICGICATCIGGC-3' and REP2-I; 5'-ICGICTTATCIGGCCTAC-3'. PCR
was performed using the following 25 .mu.l reaction: 7.75 .mu.l
H.sub.2O, 2.5 .mu.l 10.times.LA buffer (PanVera Corp., Madison,
Wis.), 16 .mu.l dNTP mix (2.5 mM each), 1 .mu.l of each primer at
50 pM/.mu.l, 1 .mu.l DMSO, 1.5 .mu.l genomic DNA (concentrations
ranged from 0.075-0.480 .mu.g/.mu.l) and 0.25 .mu.l TaKaRa EX Taq
(PanVera Corp., Madison, Wis.). The PCR amplification was performed
in a Perkin Elmer DNA Thermal Cycler (Norwalk, Conn.) using the
following conditions: 95.degree. C./7 min. then 35 cycles of;
94.degree. C./1 min.,44.degree. C./1 min., 65.degree. C./8 min.,
followed by 15 min. at 65.degree. C. After cycling, the 25 .mu.l
reaction was added to 5 .mu.l of 6.times.gel loading buffer (0.25%
bromophenol blue, 40% w/v sucrose in H.sub.2O). A 15.times.20 cm
1%-agarose gel was then run in TBE buffer (0.09 M Tris-borate,
0.002 M EDTA) using 8 .mu.l of each reaction. The gel was run for
approximately 16 hours at 45v. Gels were then stained in 20
.mu.g/ml ethidium bromide for 1 hour and destained in TBE buffer
for approximately 3 hours. Polaroid.RTM. photographs of the gels
were then taken under UV illumination.
[0370] The presence or absence of bands at specific sizes for each
strain was scored from the photographs and entered as a similarity
matrix in the numerical taxonomy software program, NTSYS-pc (Exeter
Software, Setauket, N.Y.). Controls of E. coli strain HB101 and
Xanthomonas oryzae pv. oryzae assayed under the same conditions
produced PCR fingerprints corresponding to published reports
(Versalovic, J., Koeuth, T. and Lupski, J. R. 1991. Nucleic Acids
Res. 19, 6823-6831; Vera Cruz, C. M., Halda-Alija, L., Louws, F.,
Skinner, D. Z., George, M. L., Nelson, R. J., D E Bruijn, F. J.,
Rice, C. and Leach, J. E. 1995. Int. Rice Res. Notes, 20, 23-24.;
Vera Cruz, C. M., Ardales, E. Y., Skinner, D. Z., Talag, J.,
Nelson, R. J., Louws, F. J., Leung, H., Mew, T. W. and Leach, J. E.
1996. Phytopathology 86, 1352-1359). The data from Photorhabdus
strains were then analyzed with a series of programs within
NTSYS-pc; SIMQUAL (Similarity for Qualitative data) to generate a
matrix of similarity coefficients (using the Jaccard coefficient)
and SAHN (Sequential, Agglomerative, Heirarchical and Nested)
clustering [using the UPGMA (Unweighted Pair-Group Method with
Arithmetic Averages) method] which groups related strains and can
be expressed as a phenogram (FIG. 7). The COPH (cophenetic values)
and MXCOMP (matrix comparison) programs were used to generate a
cophenetic value matrix and compare the correlation between this
and the original matrix upon which the clustering was based. A
resulting normalized Mantel statistic (r) was generated which is a
measure of the goodness of fit for a cluster analysis (r=0.8-0.9
represents a very good fit). In our case r=0.924. Therefore, the
collection is comprised of a diverse group of easily
distinguishable strains representative of the Photorhabdus
genus.
EXAMPLE 23
Insecticidal Utility of Toxin(s) Produced by Various Photorhabdus
Strains
[0371] Initial "storage" cultures of the various Photorhabdus
strains were produced by inoculating 175 ml of 2% Proteose Peptone
#3 (PP3) (Difco Laboratories, Detroit, Mich.) liquid medium with a
primary variant colony in a 500 ml tribaffled flask with a Delong
neck, covered with a Kaput closure. After inoculation, the flask
was incubated for between 24-72 hrs at 28.degree. C. on a rotary
shaker at 150 rpm, until stationary phase was reached. The culture
was transferred to a sterile bottle containing a sterile magnetic
stir bar and the culture was overlayered with sterile mineral oil,
to limit exposure to air. The storage culture was kept in the dark,
at room temperature. These cultures were then used as inoculum
sources for the fermentation of each strain.
[0372] "Seed" flasks or cultures were produced by either
inoculating 2 mls of an oil overlayered storage culture or by
transferring a primary variant colony into 175 ml sterile medium in
a 500 ml tribaffled flask covered with a Kaput closure. (The use of
other inoculum sources is also possible.) Typically, following 16
hours incubation at 28.degree. C. on a rotary shaker at 150 rpm,
the seed culture was transferred into production flasks. Production
flasks were usually inoculated by adding about 1% of the actively
growing seed culture to sterile 2% PP3 medium (e.g. 2.0 ml per 175
ml sterile medium). Production of broths occurred in 500 ml
tribaffled flasks covered with a Kaput. Production flasks were
agitated at 28.degree. C. on a rotary shaker at 150 rpm. Production
fermentations were terminated after 24-72 hrs although successful
fermentation is not confined to this time duration. Following
appropriate incubation, the broths were dispensed into sterile 1.0
L polyethylene bottles, spun at 2600.times.g for 1 hr at 10.degree.
C. and decanted from the cell and debris pellet. Further broth
clarification was achieved with a tangential flow microfiltration
device (Pall Filtron, Northborough, Mass.) using a 0.5 .mu.M
open-channel poly-ether sulfone (PES) membrane filter. The
resulting broths were then concentrated (up to 10-fold) using a
10,000 or 100,000 MW cut-off membrane, M12 ultra-filtration device
(Amicon, Beverly Mass.) or centrifugal concentrators (Millipore,
Bedford, Mass. and Pall Filtron, Northborough, Mass.) with a 10,000
or 100,000 MW pore size. In the case of centrifugal concentrators,
the broth was spun at 2000.times.g for approximately 2 hr. The
membrane permeate was added to the corresponding retentate to
achieve the desired concentration of components greater than the
pore size used. Following these procedures, the broth was used for
biochemical analysis or filter sterilized using a 0.2 .mu.M
cellulose nitrate membrane filter for biological assessment. Heat
inactivation of processed broth samples was achieved by heating the
samples at 100.degree. C. in a sand-filled heat block for 10
minutes.
[0373] The broth(s) and toxin complex(es) from different
Photorhabdus strains are useful for reducing populations of insects
and were used in a method of inhibiting an insect population which
comprises applying to a locus of the insect an effective insect
inactivating amount of the active described. A demonstration of the
breadth of insecticidal activity observed from broths of a selected
group of Photorhabdus strains fermented as described above is shown
in Table 36. It is possible that improved or additional
insecticidal activities could be detected with these strains
through increased concentration of the broth or by employing
different fermentation methods. Consistent with the activity being
associated with a protein, the insecticidal activity of all strains
tested was heat labile.
[0374] Culture broth(s) from diverse Photorhabdus strains show
differential insecticidal activity (mortality and/or growth
inhibition) against a number of insects. More specifically, the
activity is seen against corn rootworm which is a member of the
insect order Coleoptera. Other members of the Coleoptera include
boll weevils, wireworms, pollen beetles, flea beetles, seed beetles
and Colorado potato beetle. The broths and purified toxin
complex(es) are also active against tobacco budworm, tobacco
hornworm and European corn borer which are members of the order
Lepidoptera. Other typical members of this order are beet armyworm,
cabbage looper, black cutworm, corn earworm, codling moth, clothes
moth, Indian mealmoth, leaf rollers, cabbage worm, cotton bollworm,
bagworm, Eastern tent caterpillar, sod webworm and fall armyworm.
Activity is also observed against German cockroach which is a
member of the order Dictyoptera (or Blattodea). Other members of
this order are oriental cockroach and American cockroach.
[0375] Activity against corn rootworm larvae was tested as follows.
Photorhabdus culture broth(s) (10 fold concentrated, filter
sterilized), 2% Proteose Peptone #3 (10 fold concentrated),
purified toxin complex(es), 10 mM sodium phosphate buffer, pH 7.0
were applied directly to the surface (about l.5 cm.sup.2) of
artificial diet (Rose, R. I. and McCabe, J. M. 1973. J. Econ.
Entomol. 66, 398-400) in 40 .mu.l aliquots. Toxin complex was
diluted in 10 mM sodium phosphate buffer, pH 7.0. The diet plates
were allowed to air-dry in a sterile flow-hood and the wells were
infested with single, neonate Diabrotica undecimpunctata howardi
(Southern corn rootworm, SCR) hatched from surface sterilized eggs.
The plates were sealed, placed in a humidified growth chamber and
maintained at 27.degree. C. for the appropriate period (3-5 days).
Mortality and larval weight determinations were then scored.
Generally, 16 insects per treatment were used in all studies.
Control mortality was generally less than 5%.
[0376] Activity against lepidopteran larvae was tested as follows.
Concentrated (10-fold) Photorhabdus culture broth(s), control
medium (2% Proteose Peptone #3), purified toxin complex(es), 10 mM
sodium phosphate buffer, pH 7.0 were applied directly to the
surface (about 1.5 cm.sup.2) of standard artificial lepidopteran
diet (Stoneville Yellow diet) in 40 .mu.l aliquots. The diet plates
were allowed to air-dry in a sterile flow-hood and each well was
infested with a single, neonate larva. European corn borer
(Ostrinia nubilalis) and tobacco hornworm (Manduca sexta) eggs were
obtained from commercial sources and hatched in-house, whereas
tobacco budworm (Heliothis virescens) larvae were supplied
internally. Following infestation with larvae, the diet plates were
sealed, placed in a humidified growth chamber and maintained in the
dark at 27.degree. C. for the appropriate period. Mortality and
weight determinations were scored at day 5. Generally, 16 insects
per treatment were used in all studies. Control mortality generally
ranged from about 0 to about 12.5% for control medium and was less
than 10% for phosphate buffer.
[0377] Activity against cockroach was tested as follows.
Concentrated (10-fold) Photorhabdus culture broth(s) and control
medium (2% Proteose Peptone #3) were applied directly to the
surface (about 1.5 cm.sup.2) of standard artificial lepidopteran
diet (Stoneville Yellow diet) in 40 .mu.l aliquots. The diet plates
were allowed to air-dry in a sterile flow-hood and each well was
infested with a single, CO.sub.2 anesthetized first instar German
cockroach (Blatella germanica). Following infestation, the diet
plates were sealed, placed in a humidified growth chamber and
maintained in the dark at 27.degree. C. for the appropriate period.
Mortality and weight determinations were scored at day 5. Control
mortality less than 10%.
43TABLE 36 Observed Insecticidal Spectrum of Broths from Different
Photorhabdus Strains Photorhabdus Strain Sensitive* Insect Species
P. zealandica 1**, 2, 4 P. hepialus 1, 2, 4 HB-Arg 1, 2, 4 HB
Oswego 1, 2, 4 HB Lewiston 1, 2, 4 K-122 1, 4 HMGD 1, 4 Indicus 1,
2, 4 GD 2, 4 PWH-5 1, 2, 4 Megidis 1, 2, 4 HF-85 1, 2, 4 A. Cows 1,
4 MP1 1, 2, 4 MP2 1, 2, 4 MP3 4 MP4 1, 4 MP5 4 GL98 1, 4 GL101 1,
4, 5 GL138 1, 2, 4 GL155 1, 4 GL217 1, 2, 4 GL257 1, 4 DEP1 1, 4
DEP2 1, 2, 3, 4 DEP3 4 *= .sup.3 25% mortality and/or growth
inhibition vs. control **= 1; Tobacco budworm, 2; European corn
borer, 3; Tobacco hornworm, 4; Southern corn rootworm, 5; German
cockroach.
EXAMPLE 24
Southern Analysis of Non-W-14 Photorhabdus Strains Using W-14 Gene
Probes
[0378] Photorhabdus strais were grown on 2% proteose peptone #3
agar (Difco Laboratories, Detroit, Mich.) and insecticidal toxin
competence was maintained by repeated bioassay after passage. A 50
ml shake culture was produced in 175 ml baffled flasks in 2%
proteose peptone #3 medium, grown at 28.degree. and 150 rpm for
approximately 24 hours. Fifteen ml of this culture were centrifuged
(700.times.g, 30 min) and frozen in its medium at -20.degree. until
it was thawed (slowly in ice water) for DNA isolation. The thawed
W-14 culture was centrifuged (900.times.g, 15 min 4.degree.), and
the floating orange mucopolysaccharide material was removed. The
remaining cell material was centrifuged (25,000.times.g, 40) to
pellet the bacterial cells, and the medium was removed and
discarded.
[0379] Total DNA was isolated by an adaptation of the CTAB method
described in section 2.4.1 of Ausubel et al. (1994). The
modifications included a high salt shock, and all volumes were
increased ten-fold over the "miniprep" recommended volumes. All
centrifugations were at 4.degree. C. unless otherwise specified.
The pelleted bacterial cells were resuspended in TE buffer (10 MM
Tris-HCl, 1 mM EDTA, pH 8) to a final volume of 10 ml, then 12 ml 5
M NaCl were added; this mixture was centrifuged 20 min at
15,000.times.g. The pellet was resuspended in 5.7 ml TE, and 300
.mu.l of 10% SDS and 60 .mu.l of 20 mg/ml proteinase K (in sterile
distilled water, Gibco BRL Products, Grand Island, N.Y.) were added
to the suspension. The mixture was incubated at 37.degree. C. for 1
hr; then approximately 10 mg lysozyme (Worthington Biochemical
Corp., Freehold, N.J.) were added. After an additional 45 min
incubation, 1 ml of 5 M NaCl and 800 .mu.l of CTAB/NaCl solution
(10% w/v CTAB, 0.7 M NaCl) were added. This preparation was
incubated 10 min at 65.degree. C., then gently agitated and further
incubated and agitated for approximately 20 min to assist clearing
of the cellular material. An equal volume of chloroform/isoamyl
alcohol solution (24:1, v:v) was added, mixed very gently, and the
phases separated by centrifugation at 12,000.times.g for 15 min.
The upper (aqueous) phase was gently removed with a wide-bore
pipette and extracted twice as above with an equal volume of PCI
(phenol/choloroform/ isoamyl alcohol; 50:49:1, v:v:v; equilibrated
with 1M Tris-HCl, pH 8.0; Intermountain Scientific Corporation,
Kaysville, Utah). The DNA precipitated with 0.6 volume of
isopropanol was gently removed on a glass rod, washed twice with
70% ethanol, dried, and dissolved in 2 ml STE (10 mM Tris-HCl, 10
mM NaCl, 1 mM EDTA, pH 8). This preparation contained 2.5 mg/ml
DNA, as determined by optical density at 260 nm.
[0380] Identification of Bgl II/Hind III Fragments Hybridizing to
tc-gene Specific Probes
[0381] Approximately 10 .mu.g of genomic DNA was digested to
completion with about 30 units each of Bgl II and Hind III (NEB)
for 180 min, frozen overnight, then heated at 65.degree. C. for
five min, and electrophoresed in a 0.8% agarose gel (Seakem.RTM.
LE, 1.times.TEA, 80 volts, 90 min). The DNA was stained with
ethidium bromide (50 .mu.g/ml) as described earlier, and
photographed under ultraviolet light. The DNA fragments in the
agarose gel were subjected to depurination (5 min in 0.2 M HCl),
denaturation (15 min in 0.5 M NaOH, 1.5 M NaCl), and neutralization
(15 min in 0.5 M Tris HCl pH 8.0, 1.5 M NaCl), with 3 rinses of
distilled water between each step. The DNA was transferred by
Southern blotting from the gel onto a NYTRAN nylon membrane
(Amersham, Arlington Heights, Ill.) using a high salt
(20.times.SSC) protocol, as described in section 2.9 of Ausubel et
al. (CPMB, op. cit.). The transferred DNA was then UV-crosslinked
to the nylon membrane using a Stratagene UV Stratalinker set on
auto crosslink. The membranes were stored dry at 25.degree. C.
until use.
[0382] Hybidization was performed using the ECL.TM.direct
(Amersham, Arlington Heights, Ill.) labeling and detection system
following protocols provided by the manufacturer. In brief, probes
were prepared by covalently linking the denatured DNA to the enzyme
horseradish peroxidase. Once labeled the probe was used under
hybridization conditions which maintain the enzymatic activity.
Unhybridized probe was removed by two gentle washes 20 minutes each
at 42.degree. C. in 0.5.times.SSC, 0.4% SDS, and 6M Urea. This was
followed by two washes 5 minutes each at room temperature in
2.times.SSC. As directed by the manufacturer, ECL.TM. reagents were
used to detect the hybridizing DNA bands. There are several factors
which influence the ability to detect gene relatedness between
various Photorhabdus strains and strain W-14. First, high
stringency conditions have not been employed in these
hybridizations. It is known in the art that varying the stringency
of hybridization and wash conditions will influence the pattern and
intensity of hybridizing bands. Second, Southern blots' blot to
blot variation will influence the mobility of hybridizing bands and
molecular weight estamates. Therefore, W-14 was included as a
standard on all Southern blots.
[0383] Gene specific probes derived from the W-14 toxin genes were
used in these hybridizations. The following lists the specific
coordinates within each gene sequence to which the probe
corresponds. A probe specific for tcaB.sub.i/B.sub.ii: 1174 to 3642
of Sequence ID #25, a probe specific for tcaC: 3637 to 6005 of
Sequence ID #25, a probe specific for tcbA: 2097 to 4964 of
Sequence ID #11, and a probe specific for tcdA: 1660 to 4191 of
sequence ID #46. The following tables summarize Southern Blot
analyses of Photorhabdus strains. In the event that hybridization
of probes occurred, the hybridized fragment(s) were noted as either
identical or different from the pattern observed for the W-14
strain.
44TABLE 37 Southern Analysis of Photorhabdus Strains Strains tcdA
tcbA tcaC tcaB.sub.i/ii WX-1 D D D D WX-2 D D - D WX-3 D D D D WX-4
D D ND D WX-5 D D D D WX-6 D D D D WX-7 D D ND D WX-8 D D D D WX-9
ND D D D WX-10 ND D D D WX-11 ND D D D WX-12 D D D D WX-14 D D D D
WX-15 D D D D HP88 D - D D Hm D - D D Hb D - D - H9 D - I D B2 D -
D - NC-1 D - D D WIR D - D D W30 D D D D W-14 I I I I ND = Not
determined; - = no detectable hybridization product; I = Identical
fragment pattern; D = Different fragment pattern.
[0384]
45TABLE 38 Southern Analysis of Photorhabdus Strains Strains tcdA
tcbA tcaC tcaB.sub.i/ii K-122 3.3, 2.8 D - ND PWH-5 + D D - Indicus
D D 3.0 I Megidis D D D - GD D D D - HF-85 D D D - MP 3 D - D - MP
1 D + D - A. Cows D + D - HB-Arg D ND D - HMGD D D D - HB Lewiston
D D D - HB Oswego D D D - W-14 I I I I ND = Not determined; - = no
detectable hybridization product; I = Identical fragment pattern; D
= Different fragment pattern. + = Hybridization fragment pattern
not determined.
[0385]
46TABLE 39 Southern Analysis of Photorhabdus Strains Strains tcdA
tcbA tcaC tcaB.sub.i/B.sub.ii GL98 + + D GL101 - + D GL138 - + D
GL155 - - - GL217 + - D GL257 + + D MP4 - + - MP5 - - - P hepialus
+ - D P zealandia + - 11.0 DEP1 DEP2 DEP3 W-14 3.8, 2.8 2.8 2.8 ND
= Not determined; - = no detectable hybridization product; I =
Identical fragment pattern; D = Different fragment pattern. + =
Hybridization fragment pattern not determined.
[0386] From these analyses it is apparent that homologs of W-14
genes are dispersed throughout these diverse Photorhabdus strains,
as evidenced by differences in gene fragment sizes between W-14 and
the other strains.
EXAMPLE 25
N-Terminal Amino Acid Sequences of Toxin Complex Peptides from
Different Photorhabdus Strains
[0387] The relationship of peptides isolated from different
Photorhabdus strains, as described in Example 14, were subjected to
N-terminal amino acid sequencing. The N-terminal amino acid
sequences of toxin peptides in several strains were compared to
W-14 toxin peptides. In Table 40, a comparison of toxin peptides
compared to date showed that identical or homologous (at least 40%
similarity to W14 gene/peptides) toxin peptides were present in all
of the strains. For example, the N-terminal amino acid sequence of
TcaC, SEQ ID NO: 2, was found to be identical to that for 160 kDa
peptide in HP88 but also homologs were present in strains WIR, H9,
Hb, WX-1, and Hm. Some W-14 peptides or homologs have not been
observed in other strains; however, not all peptides have been
sequenced for toxin complexes from other strains due to N-terminal
blockage or low abundance. In addition, many other N-terminal amino
acid sequences (SEQ ID NOS: 82 to 88) have been obtained for toxin
complex peptides from other strains that have no similarity to
peptides from W-14 and in some case were identical to each other.
For example, an identical amino acid sequence, SEQ ID NO: 82, was
obtained for 64 kDa peptide present in both HP88 and Hb strains and
a homologous sequence for a 70 kDa peptide in NC-1 strain (SEQ ID
NO: 83).
47TABLE 40 A Comparison of Amino Terminal Sequence Homology Between
Proteins Isolated From Non-W-14 Strains W-14 W-14 W-14 SEQ ID
Peptide Gene SEQ ID NO: Strain Identical Homology TcaAii tcaA 15
TcaAiii tcaA 4 TcaBi tcaB 3 76 H9 -- 74 kDa 76 Hm -- 71 kDa TcaBii
tcaB 5 H9 61 kDa -- Hm 61 kDa -- TcaC tcaA 2 72 Hb -- 160 kDa HP88
160 kDa -- 73 WIR -- 170 kDa 74 H9 -- 180 kDa 75 Hm -- 170 kDa 80
WX-1 -- 170 kDa TcbAii tcbA 1 TcbAiii tcbA 40 TccA tccA 8 77 Hb --
81 kDa TccB tccB 7 WX-1 170 kDa -- WX-2 180 kDa -- WX-14 180 kDa --
WIR 170 kDa -- 78 H9 -- 170 kDa NC-1 140 kDa -- 79 Hm -- 190 kDa
TcdAii tcdA TcdAiii tcdA 41 Hb 57 kDa -- 81 H9 -- 69 kDa ? ? 9 Hb
86 kDa -- HP88 86 kDa -- Homology refers to amino acid sequences
that were at least 40% similarity to W14 gene/peptides. Similar
residues were identified as being a member in one of the following
five groups: (P, A, G, S, T); (Q, N, E, B, D, Z); (H, K, R); (L, I,
V, M); and (F, Y, W).
EXAMPLE 26
Immunological Analysis of Photorhabdus Strains
[0388] Culture broths of Photorhabdus strains were concentrated 10
to 15 times using Centri-10 ultrafiltration device (Amicon, Inc.
Beverly, Mass. 01915). The concentration of the protein ranges from
0.3 to 3.0 mg per ml. Ten to 20 .mu.g of total protein was loaded
in each well of a precast 4-20% polyacrylamide gel (Integrated
Separation Systems, Natick, Mass. 01760). Gel electrophoresis was
performed for 1.25 hours using a constant current set at 25 ma per
gel. The gel was electro-blotted on to Hybond-ECL.TM.
nitrocellulose membrane (Amersham Corporation, Arlington Hts, Ill.
60005) using a semi-dry electro-blotter (Pharmacia Biotech Inc.,
Piscataway , N.J. 08854). A constant current was applied at 0.75 ma
per cm for 2.5 hours. The membrane was blocked with 10% milk in
TBST (25 mM Tris HCl pH 7.4, 136 mM NaCl, 2.7 mM KCl, 0.1% Tween
20) for one hour at room temperature. Each primary antibody was
diluted in 10% milk/TBST to 1:500. Other dilution between 1:50 to
1:1000 was also used. The membrane was incubated in primary
antibody for at least one hour. Then it was washed thoroughly with
the blocking solution or TBST. A 1:2000 dilution of secondary
antibodies (goat anti-mouse IgG or goat anti rabbit TgG conjugated
to horseradish peroxidase; BioRad Laboratories, Hercules, Calif.
94547) in 10% milk/TBST was applied to the membrane which was
placed on a platform rocker for one hour. The membrane was
subsequently washed with excess amount of TBST. The detection of
the protein was performed by using an ECL (Enhanced
Chemiluminescence) detection kit (Amersham International).
[0389] A panel of peptide specific-antibodies generated against
W-14 peptides were used to characterize the protein composition of
broths from nine non-W-14 Photorhabdus strains using Western blot
analysis. In addition, one monoclonal antibody (MAb-C5F2) which
recognizes TcbA.sub.iii protein in W-14-derived toxin complex was
used. The results (Table 39) showed cross recognition of the
antibodies to some of the proteins in these broths. In some cases,
the proteins that were recognized by the antibodies were the same
size as the W-14 target peptides. In other cases, the proteins that
were recognized by the antibodies were smaller than the W-14 target
peptides. This data indicate that some of the non-W-14 Photorhabdus
strains may produce similar proteins to the W-14 strain. The
difference could be due to deletion or protein processing or
degradation process. Some of the strains did not contain protein(s)
that could be recognized by some antibodies, however, it is
possible that the concentration is significantly lower than those
observed for W-14 peptides. When compared for various toxin peptide
homologs these results showed peptide diversity among the
Photorhabdus strains.
48TABLE 41 Cross Recognition by Monoclonal Antibodies or Polyclonal
Antibodies Generated Against W-14 Peptides to Protein(s) in Broths
of Selected Non-W-14 Photorhabdus PAb PAb PAb PAb- PAb PAb PAb PAb
Photorhabdus MAb TcdA.sub.ii- TcdA.sub.iii- TcaC- TcaB.sub.ii-
TcbA.sub.iii- TcaB.sub.i- TcaA.sub.ii- TcaA.sub.iii- Strain C5F2
syn syn syn syn syn syn syn syn MP1 - + + + - + + + + MP2 + + + + -
+ + + + MP3 - + + + - NT + + - A. Cows - + + + - NT + + + Hb-osw -
- NT + + NT + + + H-Arg - + + + - NT + + + Hb-leu - + + + - NT + +
+ Indicus + + + + + NT + + + HF85 - + + + - + + + + W-14 + + + + +
+ + + + +: Positive reaction; -: Negative reaction; NT: Not
Tested
[0390] Additional non-W-14 Photorhabdus strains were characterized
by Western blot analysis using the culture broth and/or partial
purified protein fractions as antigen. The panel of antibodies
include MAb-C5F2, MAb-DE1 (recognizing TcdA.sub.ii), PAb-DE2
(recognizing TcaB), PAb-TcbA.sub.ii-syn, PAb-TcaC-syn, PAb
TcaB.sub.ii-syn, PAb-TcbA.sub.iii-syn, PAb-TcaB.sub.i-syn. These
antibodies showed cross-reactivity with proteins in the broth and
in the partial purified fractions of non-W-14 strains.
[0391] The data indicate that antibodies could be used to identify
proteins in the broth as well as in the partially purified protein
fractions.
49TABLE 42 Cross Recognition by Monoclonal Antibodies or Plyclonal
Antibodies Generated Against W-14 Peptides to Protein(s) in Broths
and/or Partial Purified Protein Fractions of Selected Non-W14
Photorhabdus Monoclonal Polyclonal Antibodies Antibodies PAb PAb
PAb PAb- PAb- Photorhabdus Mab PAb- TcbA.sub.ii- TcaC- TcaB.sub.ii-
TcaA.sub.iii- TcaB.sub.i- Strain C5F2 Mab-DE1 DE2 syn syn syn syn
syn WX-1 + + + + + + + + WX-2 + + + + + + NT + WX-3 + NT + NT NT NT
NT NT WX-5 + NT + NT NT NT NT NT WX-6 + NT NT NT NT NT NT NT WX-7 +
+ + + + + NT + WX-8 + NT NT NT NT NT NT NT WX-9 + NT NT NT NT NT NT
NT WX-10 - NT NT NT NT NT NT NT WX-12 + + + + + + + + WX-14 + + + +
NT + NT + WX-15 + NT NT NT NT NT NT NT W30 + + + NT NT NT NT NT Hb
- NT + NT + NT - + H9 - - + NT + + NT NT Hm - NT + + + + NT ++ HP88
- NT + - + - - + NC-1 + - + + + + NT + WIR - NT + + + + + + W-14 +
+ + + + + + + -: Negative reaction; +: Positive reaction; NT: Not
tested
EXAMPLE 27
Bacterial Expression of the tcdA Coding Region
Engineering of the tcdA Gene for Bacterial Expression
[0392] The 5' and 3' ends of the tcdA coding region (SEQ ID NO:46)
were modified to add useful cloning sites for inserting the segment
into heterologous expression vectors. The ends were modified using
unique primers in Polymerase Chain Reactions (PCR), performed
essentially as described in Example 8. Primer sets, as described
below, were used in conjunction with cosmid 21D2.4 as template, to
created products with the appropriately modified ends.
[0393] The first primer set was used to modify the 5' end of the
gene, to insert a unique Nco I site at the initiator codon using
the forward primer A0F1 (5' GAT CGA TCG ATC CAT GGC CAA CGA GTC TGT
AAA AGA GAT ACC TGA TG TAT TAA AAA GCC AGT GTG 3') and to add
unique Bgl II, Sal I and Not I sites to facilitate insertion of the
remainder of the gene using the reverse primer A0R1 (5' GAT CGA TCG
TAC GCG GCC GCT CGA TCG ATC GTC GAC CCA TTG ATT TGA GAT CTG GGC CGC
GGG TAT CCA GAT AAT AAA CG& AGT CAC 3').
[0394] Another PCR reaction was designed to modify the 3' end of
the gene by adding an additional stop codon and convenient
restriction sites for cloning. The forward primer A0F2 (5' ACT GGC
TGC GTG GTC GAC TGG CGG CGA TTT ACT 3') was used to amplify across
a unique Sal I site in the gene, later used to clone the modified
3' end. The reverse primer A0R2 (5' C.GA TGC ATG CTG CGG CCG CAG
GCC TTC CTC GAG TCA TTA TTT AAT GGT GTA GCG AAT ATG CAA AAT 3') was
used to insert a second stop codon (TGA) and cloning sites Xho I,
Stu I and Not I. Bacterial expression vector pET27b (Novagen,
Madison, Wis.), was modified to delete the Bgl II site at position
446, according to standard molecular biology techniques.
[0395] The 497 bp PCR product from the first amplification reaction
(AOF1+AOR1), to modify the 5' end of the gene, was ligated to the
modified pET27b vector according to the supplier's instructions.
The DNA sequences of the amplified portion of three isolates were
determined using the supplier's recommended primers and the
sequencing methods described previously. The sequence of all
isolates was the same.
[0396] One isolate was then used as a cloning vector to insert the
middle portion of the tcdA gene on a 6341 bp Bgl II to Sal I
fragment. The resulting clone was called MC4 and contained all but
the 3' most portion of the tcdA coding sequence. Finally, to
complete the full-length coding region, the 832 bp PCR product from
the second PCR amplification (AOF2+AOR2), to modify the 3' end of
the gene, was ligated to isolate MC4 on a Sal I to Not I fragment,
according to standard molecular biology techniques. The tcdA coding
region was sequenced and found to be complete, the resulting
plasmid is called pDAB2035.
[0397] Construction of Plasmids pDAB2036, pDAB2037 and pDAB2038 for
Bacterial Expression of tcdA
[0398] The tcdA coding region was cut from plasmid pDAB2035 with
restriction enzymes Nco I and Xho I and gel purified. The fragment
was ligated into the Nco I and Xho I sites of the expression vector
pET15 to create plasmid pDAB2036. Additionally, pDAB2035 was cut
with Nco I and Not I to release the tcdA coding region which was
ligated into the Nco I and Not I sites of the expression vector
pET28b to create plasmid pDAB2037. Finally, plasmid pDAB2035 was
cut with Nco I and Stu I to release the tcdA coding region. This
fragment was ligated into the expression vector Trc99a which was
cut with Hind III followed by treatment with T4 DNA polymerase to
blunt the ends. The vector was then cut with Nco I and ligated with
the Nco I/Stu I cut tcdA fragment. The resulting plasmid is called
pDAB2038.
[0399] Expression of tcdA from Plasmid pDAB2038
[0400] Plasmid pDAB2038 was transformed into BL21 cells and
expressed as described above for plasmid pDAB2033 in Example
19.
[0401] Purification of tcdA from E. coli
[0402] The expression culture was centrifuged at 10,300 g for 30
min and the supernatant was collected. It was diluted with two
volumes of H.sub.2O and applied at a flow rate of 7.5 ml/min to a
poros 50 HQ (Perspective Systems, Mass.) column (1.6 cm.times.10
cm) which was pre-equilibrated with 10 mM sodium phosphate buffer,
pH 7.0 (Buffer A). The column was washed with Buffer A until the
optical density at 280 nm returned to baseline level. The proteins
bound to the column were then eluted with 1M NaCl in Buffer A.
[0403] The fraction was loaded in 20 ml aliquots onto a gel
filtration column, Sepharose CL-4B (2.6.times.100 cm), which was
equilibrated with Buffer A. The protein was eluted in Buffer A at a
flow rate of 0.75 mL/min. Fractions with a retention time between
260 minutes and 460 minutes were pooled and applied at 1 mL/min to
a Mono Q 5/5 column which was equilibrated with 20 mM Tris-HCl, pH
7.0 (Buffer B). The column was washed with Buffer B until the
optical density at 280 nm returned to baseline level. The proteins
bound to the column were eluted with a linear gradient of 0 to 1 M
NaCl in Buffer B at 1 mL/min for 30 min. One milliliter fractions
were collected, serial diluted, and subjected to SCR bioassay.
Fractions eluted out between 0.1 and 0.3 M NaCl were found to have
the highest insecticidal activity. Western analysis of the active
fractions using pAb TcdA.sub.ii-syn antibody and pAb
Tcd.sub.iii-syn antibody indicated the presence of peptides
TcdA.sub.ii and TcdA.sub.iii.
Sequence CWU 1
1
* * * * *