U.S. patent application number 10/465071 was filed with the patent office on 2003-10-30 for methods for analysis of gene expression.
This patent application is currently assigned to Althea Technologies, Inc.. Invention is credited to Loehrlein, Christine, Monforte, Joseph, Pollart, Dan, Shaler, Thomas, Stephens, Kathy, Tan, Yuping, Wong, Linda.
Application Number | 20030204322 10/465071 |
Document ID | / |
Family ID | 22654838 |
Filed Date | 2003-10-30 |
United States Patent
Application |
20030204322 |
Kind Code |
A1 |
Loehrlein, Christine ; et
al. |
October 30, 2003 |
Methods for analysis of gene expression
Abstract
This invention provides methods, compositions and kits for gene
expression analysis and gene expression profiling. The methods of
the invention are highly sensitive; have a wide dynamic range; are
rapid and inexpensive; have a high throughput; and allow the
simultaneous differential analysis of a defined set of genes. The
methods, compositions and kits of the invention also provide tools
for gene expression data collection and relational data
analysis.
Inventors: |
Loehrlein, Christine;
(Alameda, CA) ; Pollart, Dan; (Alameda, CA)
; Shaler, Thomas; (Fremont, CA) ; Stephens,
Kathy; (Fremont, CA) ; Tan, Yuping; (Fremont,
CA) ; Wong, Linda; (Daly City, CA) ; Monforte,
Joseph; (Berkeley, CA) |
Correspondence
Address: |
QUINE INTELLECTUAL PROPERTY LAW GROUP, P.C.
P O BOX 458
ALAMEDA
CA
94501
US
|
Assignee: |
Althea Technologies, Inc.
|
Family ID: |
22654838 |
Appl. No.: |
10/465071 |
Filed: |
June 18, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10465071 |
Jun 18, 2003 |
|
|
|
09771372 |
Jan 27, 2001 |
|
|
|
6618679 |
|
|
|
|
60179006 |
Jan 28, 2000 |
|
|
|
Current U.S.
Class: |
702/20 ; 435/6.1;
435/6.18 |
Current CPC
Class: |
C12Q 1/6853 20130101;
G16B 25/00 20190201; C12Q 1/6809 20130101; G16B 25/10 20190201;
C12Q 1/686 20130101; C12Q 1/6809 20130101; C12Q 2537/143 20130101;
C12Q 2525/15 20130101; C12Q 1/6809 20130101; C12Q 2537/143
20130101; C12Q 2525/161 20130101; C12Q 2525/155 20130101; C12Q
1/6853 20130101; C12Q 2537/143 20130101; C12Q 2525/15 20130101;
C12Q 1/6853 20130101; C12Q 2537/143 20130101; C12Q 2525/161
20130101; C12Q 2525/155 20130101; C12Q 1/686 20130101; C12Q
2537/143 20130101; C12Q 2525/15 20130101 |
Class at
Publication: |
702/20 ;
435/6 |
International
Class: |
C12Q 001/68; G06F
019/00; G01N 033/48; G01N 033/50 |
Goverment Interests
[0002] The United States government may own rights in the present
invention pursuant to grant numbers HG01700-02, R43-CA83382 and
N43-ES-81006 from the National Institutes of Health.
Claims
What is claimed is:
1. A method for analyzing gene expression comprising: a) obtaining
a plurality of target sequences, wherein the plurality of target
sequences comprises cDNA; b) multiplex amplifying said plurality of
target sequences, wherein multiplex amplifying comprises combining
the plurality of target sequences, a plurality of target-specific
primers, and one or more universal primers, thereby producing a
plurality of amplification products; c) separating one or more
members of the plurality of amplification products; d) detecting
one or more members of the plurality of amplification products,
thereby generating a set of gene expression data; e) storing the
set of gene expression data in a database; and f) performing a
comparative analysis on the set of gene expression data, thereby
analyzing the gene expression.
2. The method of claim 1, wherein obtaining the target sequences
comprises performing reverse transcription of mRNA.
3. The method of claim 2, wherein the mRNA comprises mRNA derived
from cultured cells.
4. The method of claim 2, wherein said mRNA comprises mRNA derived
from cultured cells subjected to a specific treatment.
5. The method of claim 4, wherein said specific treatment comprises
a chemical exposure, an environmental stress, or an exposure to one
or more viable organisms or cells.
6. The method of claim 1, wherein multiplex amplifying comprises
simultaneously amplifying a plurality of cDNA in the same reaction
mixture; wherein said plurality of target-specific primers
comprises one or more target-specific primer pairs, each pair
comprising a forward target-specific primer and a reverse
target-specific primer; and wherein the one or more
universal-primers comprises one or more universal primer pairs,
each pair comprising a forward universal primer and a reverse
universal primer.
7. The method of claim 1, wherein said plurality of target
sequences further comprises one or more reference sequences,
wherein a portion of the one or more reference sequences is
homologous to at least one member of the plurality of
target-specific primers.
8. The method of claim 7, wherein one or more of the reference
sequences comprises sequences endogenously present in the cDNA.
9. The method of claim 7, wherein one or more of the reference
sequences comprises sequences exogenously added to the cDNA.
10. The method of claim 1, wherein at least one member of the
plurality of target-specific primers or universal primers further
comprises a modified nucleotide.
11. The method of claim 10, wherein the modified nucleotide
prevents amplification of one or more portions of the at least one
member of the plurality of target-specific primers or universal
primers
12. The method of claim 10, wherein the modified nucleotide
comprises one or more non-nucleotide linkers, alkyl chains, or
abasic nucleotides.
13. The method of claim 1, wherein at least one member of the
plurality of target-specific primers or universal primers further
comprises a cleavable linker.
14. The method of claim 1, wherein at least one universal primer
further comprises a label.
15. The method of claim 14, wherein the label comprises one or more
of a chromaphore, a fluorophore, a dye, a releasable label, a mass
label, an affinity label, a friction moiety, a hydrophobic group,
or an isotopic label.
16. The method of claim 1, wherein each member of the plurality of
target-specific primers comprises a first sequence that is derived
from a target gene of interest and positioned within a 3' region of
the member, and a second sequence that is complementary to the
universal primer and positioned within a 5' region of the
member.
17. The method of claim 1, wherein the one or more universal
primers comprise one or more semi-universal primers.
18. The method of claim 17, wherein the one or more semi-universal
primers comprise primers which are complementary to one or more
forward target-specific primers, one or more reverse
target-specific primers, or a combination thereof.
19. The method of claim 18, wherein the one or more semi-universal
primers comprise a first semi-universal primer that is
complementary to all of the one or more forward target-specific
primers, and a second semi-universal primer that is complementary
to all of the one or more reverse target-specific primers.
20. The method of claim 17, wherein each of the one or more
semi-universal primers comprises a unique label.
21. The method of claim 1, wherein multiplex amplifying comprises
providing the universal primer in an excess concentration relative
to the target-specific primer.
22. The method of claim 21, wherein a universal primer:
target-specific primer concentration ratio ranges from about 5: 1
to about 100:1.
23. The method of claim 21, wherein a universal primer:
target-specific primer concentration ratio is about 10:1.
24. The method of claim 1, wherein an annealing temperature of the
universal primer is higher than an annealing temperature of the
target-specific primer.
25. The method of claim 1, wherein obtaining a plurality of target
sequences comprises providing two or more target sequences having
two or more target-specific primer annealing temperatures.
26. The method of claim 1, wherein multiplex amplifying the cDNA
comprises amplifying target genes that have comparable expression
levels.
27. The method of claim 1, wherein multiplex amplifying the cDNA
comprises attenuating an amplification of abundant target
genes.
28. The method of claim 27, wherein attenuating the amplification
of abundant target genes comprises using one or more modified
target-specific primers.
29. The method of claim 28, wherein the one or more modified
target-specific primer comprises a blocking group attached at a 3'
end of the modified target-specific primer.
30. The method of claim 28, wherein the one or more modified
target-specific primer comprises one or more abasic nucleotides or
mismatch nucleotides.
31. The method of claim 28, wherein using one or more modified
target-specific primers comprises providing a mixture of the one or
more modified target-specific primers with one or more unmodified
target-specific primers, at a ratio optimized for a desired amount
of attenuation.
32. The method of claim 28, wherein the one or more modified
target-specific primer comprises a blocking group attached at a 3'
end of a reverse target-specific primer.
33. The method of claim 28, wherein the one or more modified
target-specific primers comprise primers having a phosphate group
on the terminal 3'-hydroxyl of the target-specific primer.
34. The method of claim 28, wherein the one or more modified
target-specific primers comprise primers having a nucleotide
penultimate to the terminal 3'-nucleotide and attached via a 3'-3'
phosphodiester linkage.
35. The method of claim 1, wherein multiplex amplifying
further-comprises altering the length of one or more of the
universal primers or one or more of the plurality of
target-specific primers prior to combining.
36. The method of claim 35, wherein altering the length comprises
adding nucleotides to an end of a universal primer or a
target-specific primer.
37. The method of claim 35, wherein altering the length comprises
inserting nucleotides within a universal primer or a
target-specific primer.
38. The method of claim 37, wherein altering the length of a
target-specific primer comprises inserting nucleotides between a
universal sequence and a target-specific sequence of the
target-specific primer.
39. The method of claim 35, wherein altering the length comprises
incorporating a non-nucleotide linker into a universal primer or a
target-specific primer.
40. The method of claim 35, wherein altering the length comprises
cleaving the one or more universal primers or the one or more
target-specific primers.
41. The method of claim 35, wherein one or more of the universal
primers or one or more of the plurality of target-specific primers
comprise semi-universal primers.
42. The method of claim 1, wherein the plurality of amplification
products comprises a plurality of labels at predetermined molar
ratios.
43. The method of claim 42, wherein the plurality of labels is
incorporated on a single oligonucleotide primer.
44. The method of claim 42, wherein the plurality of labels is
incorporated on a plurality of oligonucleotide primers.
45. The method of claim 1, wherein separating the one or more
members of the plurality of amplification products comprises
performing one or more size separation techniques.
46. The method of claim 45, wherein separating the one or more
members of the plurality of amplification products comprises
performing mass spectrometry.
47. The method of claim 45, wherein separating the one or more
members of the plurality of amplification products comprises
employing an electrophoresis platform.
48. The method of claim 47, wherein the electrophoresis platform
comprises one or more of a capillary platform, a microcapillary
platform, a microfluidics platform, an agarose gel, an acrylamide
gel, an agarose/acrylamide gel or a chromatographic platform.
49. The method of claim 45, wherein separating the one or more
members of the plurality of amplification products comprises
performing HPLC or FPLC.
50. The method of claim 1, wherein separating the one or more
members of the plurality of amplification products comprises
performing HPLC followed by mass spectroscopy.
51. The method of claim 1, wherein detecting the one or more
members of the plurality of amplification products comprises
measuring one or more inherent properties of the amplification
products.
52. The method of claim 51, wherein the one or more inherent
properties comprise mass, light absorption, or an electrochemical
property.
53. The method of claim 1, wherein detecting the one or more
members of the plurality of amplification products comprises
measuring the presence, absence, or quantity of a labeled
amplification product.
54. The method of claim 53, wherein the labeled amplification
product comprises a singly labeled amplification product, a
multiply-labeled amplification product, or a combination
thereof.
55. The method of claim 53, wherein detecting comprises resolving a
first signal from a singly labeled amplification product and a
second signal from a multiply labeled amplification product by
deconvolution of the data.
56. The method of claim 53, wherein detecting comprises resolving a
first signal from a singly labeled amplification product and a
second signal from a multiply labeled amplification product by
reciprocal subtraction of the first or second signal from an
overlapping signal.
57. The method of claim 1, wherein performing the comparative
analysis comprises measuring a ratio of each target gene to each
reference gene.
58. The method of claim 1, wherein one or more of the multiplex
amplifying, separating and detecting is performed in a high
throughput format.
59. A method for analyzing gene expression comprising: a) obtaining
cDNA from a plurality of samples for a plurality of target
sequences; b) performing a plurality of multiplexed amplifications
of the target sequences, thereby producing a plurality of
multiplexed amplification products; c) pooling the plurality of
multiplexed amplification products; d) separating the plurality of
multiplexed amplification products; e) detecting the plurality of
multiplexed amplification products, thereby generating a set of
gene expression data; f) storing the set of gene expression data in
a database; and g) performing a comparative analysis of the set of
gene expression data.
60. The method of claim 59, wherein performing the plurality of
multiplexed amplifications comprises combining the plurality of
target sequences, one or more target-specific primers, and one or
more universal primers
61. The method of claim 60, wherein at least one of the one or more
universal primers or one or more target-specific primers comprises
a label.
62. The method of claim 61, wherein a first multiplexed
amplification is performed with a primer comprising a first label
that produces a first signal, and a second multiplexed
amplification is performed with a primer comprising a second label
that produces a second signal, wherein the first and second signals
are distinguishable from one another.
63. The method of claim 62, wherein the first and second signals
are distinguishable by deconvolution of signals obtained from the
plurality of multiplexed amplification products.
64. The method of claim 61, wherein the first or second label
comprises a high-affinity intercalating dye.
65. The method of claim 60, wherein performing the plurality of
amplifications of the target sequences comprises using universal
primers having two or more lengths, and wherein detecting the
plurality of multiplexed amplification products comprises measuring
one or more size shifts among the plurality of multiplexed
amplification products.
66. The method of claim 60, wherein performing the plurality of
amplifications of the target sequences comprises using
target-specific primers having two or more lengths, and wherein
detecting the plurality of multiplexed amplification products
comprises measuring one or more size shifts among the plurality of
multiplexed amplification products.
67. The method of claim 66, performing the plurality of
amplifications of the target sequences comprises using universal
primers comprising one or more cleavage sites, and wherein
detecting the plurality of multiplexed amplification products
comprises measuring one or more size shifts among the plurality of
multiplexed amplification products.
68. The method of claim 60, wherein separating the plurality of
multiplexed amplification products comprises shifting the mobility
of member amplification products relative to one another.
69. The method of claim 68, wherein shifting the mobility comprises
incorporating a friction moiety into one or more of the universal
primers, thereby creating a reduction in mobility of the
amplification products.
70. The method of claim 59, wherein separating comprises applying
each set of multiplex amplification products to a separation
platform at different times.
71. The method of claim 59, wherein performing the plurality of
amplifications comprises performing a polymerase chain reaction, a
transcription-based amplification, a self-sustained sequence
replication, a nucleic acid sequence based amplification, a ligase
chain reaction, a ligase detection reaction, a strand displacement
amplification, a repair chain reaction, a cyclic probe reaction, a
rapid amplification of cDNA ends, an invader assay, a solid phase
assay, a solution phase assay, or a combination thereof.
72. The method of claim 71, wherein the solid phase assay comprises
a bridge amplification or rolling circle amplification.
73. The method of claim 59, wherein one or more of the performing,
separating and detecting is performed in a high throughput
format.
74. The method of claim 73, wherein one or more of the performing,
separating and detecting steps is performed at a rate of about 1000
samples per hour.
75. A method for analyzing gene expression comprising: a) obtaining
cDNA from multiple samples; b) amplifying a plurality of target
sequences from the cDNA, thereby producing a multiplex set of
amplification products; c) separating and detecting the
amplification products using a high throughput platform, wherein
detecting generates a set of gene expression data; and d) storing
the set of gene expression data in a database; and e) performing a
comparative analysis of the set of gene expression data.
76. The method of claim 75, wherein amplifying the plurality of
target sequences comprises using one or more universal primers.
77. The method of claim 75, wherein amplifying the plurality of
target sequences comprises using one or more target-specific
primers.
78. The method of claim 77, wherein the one or more universal
primers or the one or more target-specific primers comprise one or
more non-nucleotide linkers.
79. The method of claim 75, wherein separating and detecting the
amplification products comprises performing mass spectrometry,
polyacrylamide gel electrophoresis, HPLC, capillary
electrophoresis, microcapillary electrophoresis, or a combination
thereof.
80. The method of claim 75, wherein separating and detecting the
amplification products is performed using microfluidic devices.
81. The method of claim 75, wherein the high throughput platform
comprises an HPLC for separating the amplification products and a
mass spectrometer for detecting the amplification products.
82. The method of claim 75, wherein the high throughput platform
comprises one or more miniaturized scale platforms.
83. The method of claim 75, wherein one or more of the amplifying,
separating and detecting steps is performed at a rate of about 100
samples per hour to about 5,000 samples per hour.
84. The method of claim 75, wherein one or more of the amplifying,
separating and detecting steps is performed at a rate of about 1000
samples per hour.
85. The method of claim 75, wherein amplifying the plurality of
target sequences comprises performing on or more of a polymerase
chain reaction, a transcription-based amplification, a
self-sustained sequence replication, a nucleic acid sequence based
amplification, a ligase chain reaction, a ligase detection
reaction, a strand displacement amplification, a repair chain
reaction, a cyclic probe reaction, a rapid amplification of cDNA
ends, an invader assay, a solution phase amplification assay, or a
solid phase amplification assay.
86. The method of claim 85, wherein the solid phase amplification
assay comprises a bridge amplification or rolling circle
amplification.
87. A pool of amplification products prepared by the method of
claim 1.
88. A pool of amplification products prepared by the method of
claim 59.
89. A pool of amplification products prepared by the method of
claim 75.
90. A system for analyzing gene expression, the system comprising:
a) an amplification module for producing a plurality of
amplification products from a pool of target sequences, the
amplification module comprising at least one pair of universal
primers and at least one pair of target-specific primers; b) a
detection module for detecting one or more members of the plurality
of amplification products, wherein the detection module detects a
presence, absence, or quantity of the one or more members, and
generates a set of gene expression data comprising a plurality of
data points; and c) an analyzing module in operational
communication with the detection module, the analyzing module
comprising a computer or computer-readable medium comprising one or
more logical instructions which organize the plurality of data
points into a database and one or more logical instructions which
analyze the plurality of data points.
91. The system of claim 90, wherein one or more of the
amplification module, the detection module, and the analyzing
module a comprise high throughput system.
92. The system of claim 90, wherein the at least one pair of
universal primers or the at least one pair of target-specific
primers comprise one or more abasic nucleotides.
93. The system of claim 90, wherein the amplification module
comprises a unique pair of universal primers for each target
sequence.
94. The system of claim 90, wherein the amplification module
comprises components to perform a polymerase chain reaction, a
transcription-based amplification, a self-sustained sequence
replication, a nucleic acid sequence based amplification, a ligase
chain reaction, a ligase detection reaction, a strand displacement
amplification, a repair chain reaction, a cyclic probe reaction, a
rapid amplification of cDNA ends, an invader assay, a solid phase
amplification reaction, a solution phase amplification reaction, or
a combination thereof.
95. The system of claim 90, wherein the detection module comprises
a mass spectrometer.
96. The system of claim 90, wherein the detection module comprises
an electrophoretic device.
97. The system of claim 90, wherein the one or more logical
instructions for analyzing the plurality of data points comprises
software for generating a graphical representation of the plurality
of data points.
98. The system of claim 90, wherein the one or more logical
instructions which analyze the plurality of data points are
embodied in system software which performs combinatorial analysis
on the plurality of data points.
99. The system of claim 90, wherein the one or more logical
instructions for analyzing the plurality of data points comprises
software for performing difference analysis upon the plurality of
data points.
100. The system of claim 90, the analyzing module further
comprising an output file.
101. A composition for preparing a plurality of amplification
products from a plurality of mRNA target sequences, the composition
comprising: one or more pairs of universal primers; and one or more
pairs of target-specific primers, wherein the target-specific
primers comprise one or more regions complementary to the one or
more pairs of universal primers and one or more regions
complementary to one or more target mRNA sequences.
102. The composition of claim 101, wherein one or more members of
the one or more pairs of universal primers or one or more pairs of
target-specific primers comprises a non-nucleotide linkage.
103. The composition of claim 101, wherein one or more members of
the one or more pairs of universal primers or one or more pairs of
target-specific primers comprise one or more cleavable
nucleotides.
104. A kit for obtaining a multiplex set of amplification products
of target genes and references-genes, the kit comprising: a) at
least one pair of universal primers; b) at least one pair of
target-specific primers; c) at least one pair of reference
gene-specific primers; and d) one or more amplification reaction
enzymes, reagents, or buffers.
105. The kit of claim 83, further comprising: e) software for
storing and analyzing data obtained from the amplification
reactions.
106. The kit of claim 83, wherein the universal-primers comprises
labeled primers.
107. The kit of claim 83, wherein the simultaneous amplification of
the reference-genes allows quantitation of the amplification
products.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims priority to and benefit of U.S.
application No. 60/179,006, filed Jan. 28, 2000, the full
disclosure of which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] Functional genomics is a rapidly growing area of
investigation, which includes research into genetic regulation and
expression, analysis of mutations that cause changes in gene
function, and development of experimental and computational methods
for nucleic acid and protein analyses. The Human Genome Project has
been the major catalyst driving this research; it has been through
the development of high-throughput technologies that it has been
possible to map and sequence complex genomes. However, while the
nucleic acid sequence information elicited by these technologies
represents the "structural" aspects of the genome, it is the
interworkings of the genes encoded therein, and the gene products
derived from these sequences, that will give a meaningful context
to this information. In particular, gene expression monitoring can
be utilized to examine groups of related genes, interlocking
biochemical pathways, and biological networks as a whole.
[0004] This rapidly growing set of cloned human genes provides a
plethora of candidate drug targets for testing against complex
chemical libraries. In order to efficiently test the impact(s) of a
large number of putative drug compounds on the expression profile
of one or more sets of genes, methods are needed that are
sensitive, quantitative, extremely rapid, and adaptable to
automation, in order to be cost-effective. Present day technologies
do not meet these demands. The present invention addresses this
need by providing novel methods for analyzing gene expression,
systems for implementing these techniques, compositions for
preparing a plurality of amplification products from a plurality of
mRNA target sequences, and related pools of amplification
products.
SUMMARY OF THE INVENTION
[0005] The present invention provides methods for analyzing gene
expression. The methods include obtaining a plurality of cDNA
target sequences, and multiplex amplifying these sequences, a
process which involves combining the plurality of target sequences
with a plurality of target-specific primers and one or more
universal primers, to produce a plurality of amplification
products. The target sequences are obtained in any of a number of
manners, such as by performing reverse transcription on a set of
mRNA molecules. The mRNA molecules are optionally derived from
cells, organisms, or cell cultures, which are optionally exposed to
one or more specific treatments that potentially alter the
biological state of the cell, organism, or cell culture.
[0006] Target-specific primers for use in the methods of the
present invention include oligonucleotides comprising a first
sequence that is derived from a target gene of interest and
positioned within a 3' region of the oligonucleotide, and a second
sequence that is complementary to a universal primer and positioned
within the 5' region of the oligonucleotide. The target specific
primers can be categorized as forward primers or reverse primers,
depending upon the relative orientation whether the primer versus
the polarity of the nucleic acid sequence (e.g., whether the primer
binds to the coding strand or a complementary (noncoding) strand of
the target sequence).
[0007] The universal primers used in the methods of the present
invention are sequences common to a plurality of target-specific
primers, but preferably not present in the template nucleic acid
(i.e., the plurality of target sequences). As such, a universal
primer typically does not hybridize to the target sequence template
during a PCR reaction. However, since the universal primer sequence
is complementary to a portion of one or more target-specific
primers used in the present invention, the universal primer can
initiate polymerization using a target-specific primer-amplified
product as a template. In some embodiments of the present
invention, multiple universal primers having sequences distinct
from one another are utilized; these universal primers are then
called "semi-universal" primers. As one example, a plurality of
semi-universal primers can include primer sequences that are
complementary to one or more forward target-specific primers, one
or more reverse target-specific primers, or a combination
thereof.
[0008] Optionally, the multiplex amplification process involves
simultaneously amplifying a plurality of cDNA molecules in the same
reaction mixture. This can be achieved, for example, by employing
one or more target-specific primer pairs (where each pair
comprising a forward target-specific primer and a reverse
target-specific primer) and one or more universal primer pairs,
(also comprising pairs of forward and reverse universal primers).
In some embodiments of the present invention, the multiplex
amplification involves providing the universal primer in an excess
concentration relative to the target-specific primer.
[0009] In some embodiments of the methods of the present invention,
the length of one or more of the universal primers or
target-specific primers is altered prior to combination in the
multiplex amplification step. This alteration in length can be
achieved, e.g., by adding nucleotides to the end of the primer
sequence, inserting nucleotides within the primer sequence,
incorporating a non-nucleotide linker within the primer sequence,
or cleaving a cleavable linkage within the primer sequence. As one
example, alteration of the length of a target-specific primer is
achieved by inserting nucleotides between the universal sequence
portion (i.e., that sequence complementary to the universal primer
sequence) and the target-specific sequence of the primer.
[0010] One or more of the nucleic acid sequences used as universal
primers and target-specific primers in the methods of the present
invention can optionally include a cleavable linkage or a
non-nucleotide linker as a sequence element. This non-nucleotide
linker can include, e.g., non-cleavable linkages, alkyl chains, or
abasic nucleotides. Furthermore, the nucleic acid sequences used as
universal primers and target-specific primers in the methods of the
present invention can optionally include one or more labels. Labels
for use in the methods of the present invention can include, e.g.,
a chromaphore, a fluorophore, a dye, a releasable label, a mass
label, an affinity label, a friction moiety, a hydrophobic group,
an isotopic label, or a combination thereof. The same label can be
incorporated into disparate primers used in a multiplexed
amplification; alternatively, unique labels or combination of
labels can be associated with each member of the plurality of
primers.
[0011] Furthermore, the multiplex amplification optionally includes
a reference sequence that contains a region homologous to at least
one member of the plurality of target-specific primers. The
reference sequence (or sequences) can be endogenously present in
the cDNA containing the target sequence, or it can be exogenously
added to the cDNA sample.
[0012] One or more members of the plurality of amplification
products are separated by any of a variety of techniques known to
those of skill in the art. In a preferred embodiment of the present
invention, the members are separated using one or more separation
techniques, such as mass spectrometry, electrophoresis (using, for
example, capillary electrophoresis, microcapillary electrophoresis,
agarose and/or acrylamide gel platforms), chromatography (e.g.,
such as HPLC or FPLC), or various microfluidic techniques.
[0013] The one or more members are detected by any of a number of
techniques, thereby generating one or more sets of gene expression
data. For example, in a preferred embodiment, the amplification
products are separated and detected by performing HPLC followed by
mass spectroscopy.
[0014] Detection is performed, for example, by measuring the
presence, absence, or quantity/amplitude of one or more properties
of the amplification products. Example properties of the
amplification products include, but are not limited to, mass, light
absorption or emission, and one or more electrochemical properties.
In embodiments in which one or more of the primers includes a
label, the inherent property can be dependent upon the identity of
the label. In one embodiment, detection of the amplification
products involves resolving a first signal from a singly labeled
amplification product and a second signal from a single labeled (or
multiply labeled) amplification product by deconvolution of the
data. In an alternative embodiment, detection of the amplification
products involves resolving a first signal from a singly labeled
amplification product and a second signal from a single or multiply
labeled amplification product by reciprocal subtraction of the
first or second signal from an overlapping signal. Thus, one or
more amplification products are detected and the information
collected is used to generate a set of gene expression data.
[0015] The set of gene expression data are stored in a database;
this data is then used, e.g., to perform a comparative analysis
(for example, by measuring a ratio of each target gene to each
reference gene or other analysis of interest).
[0016] The present invention also provides methods for analyzing
gene expression including the steps of obtaining cDNA from a
plurality of samples for a plurality of target sequences;
performing a plurality of multiplexed amplifications of the target
sequences, thereby producing a plurality of multiplexed
amplification products; pooling the plurality of multiplexed
amplification products; separating the plurality of multiplexed
amplification products; detecting the plurality of multiplexed
amplification products, thereby generating a set of gene expression
data; storing the set of gene expression data in a database; and
performing a comparative analysis of the set of gene expression
data. As in the previous embodiments, a plurality of
target-specific primers and universal primers are employed in the
multiplexed amplification step. Either the universal primer(s) or
the target-specific primer(s) can be labeled. In one embodiment of
these methods, a first multiplexed amplification is performed using
a primer having a first label that produces a first signal, and a
second multiplexed amplification is performed with a primer
comprising a second label that produces a second signal, wherein
the first and second signals are distinguishable from one
another.
[0017] In another embodiment, the plurality of amplification
products are detected by shifting the mobility of member
amplification products relative to one another For example,
amplification of the target sequences is performed using universal
primers having two or more lengths; detection of the plurality of
multiplexed amplification products produced using these primers
involves measuring one or more size shifts among the plurality of
multiplexed amplification products. Alternatively, the method is
performed using target-specific primers having two or more lengths,
leading to generation of differentially-sized amplification
products. The shift in size can be achieved, for example, by using
primers having cleavable linkages incorporated into their
sequences. Alternatively, the shift in size can be achieved by
incorporation of a friction moiety into one or more of the
universal primers, thereby creating a reduction in mobility of the
amplification products.
[0018] The multiplex amplification reaction used in the methods of
the present invention includes, but is not limited to, a polymerase
chain reaction, a transcription-based amplification, a
self-sustained sequence replication, a nucleic acid sequence based
amplification, a ligase chain reaction, a ligase detection
reaction, a strand displacement amplification, a repair chain
reaction, a cyclic probe reaction, a rapid amplification of cDNA
ends, an invader assay, a bridge amplification or rolling circle
amplification, or a combination thereof.
[0019] The present invention also provides methods for analyzing
gene expression including the steps of obtaining cDNA from multiple
samples; amplifying a plurality of target sequences from the cDNA,
thereby producing a multiplex of amplification products; separating
and detecting the amplification products using a high throughput
platform, wherein detecting generates a set of gene expression
data; storing the set of gene expression data in a database; and
performing a comparative analysis of the set of gene expression
data.
[0020] The methods of the present invention optionally include
performing one or more of the amplifying, separating or detecting
steps in a high throughput format. For example, the reactions can
be performed in multi-well plates. Optionally, anywhere between
about 96 and about 5000 reactions, preferably between about 500 and
2000 reactions, and more preferably about 1000 reactions, are
performed per hour using the methods of the present invention.
Furthermore, one or more miniaturized scale platforms can be used
to perform the methods of the present invention.
[0021] The present invention also provides systems for analyzing
gene expression. The elements of the system include, but are not
limited to, a) an amplification module for producing a plurality of
amplification products from a pool of target sequences; b) a
detection module for detecting one or more members of the plurality
of amplification products and generating a set of gene expression
data comprising a plurality of data points; and c) an analyzing
module in operational communication with the detection module, the
analyzing module comprising a computer or computer-readable medium
comprising one or more logical instructions which organize the
plurality of data points into a database and one or more logical
instructions which analyze the plurality of data points. Any or all
of these modules can comprise high throughput technologies and/or
systems.
[0022] The amplification module of the present invention includes
at least one pair of universal primers and at least one pair of
target-specific primers for use in the amplification process.
Optionally, the amplification module includes a unique pair of
universal primers for each target sequence. Furthermore, the
amplification module can include components to perform one or more
of the following reactions: a polymerase chain reaction, a
transcription-based amplification, a self-sustained sequence
replication, a nucleic acid sequence based amplification, a ligase
chain reaction, a ligase detection reaction, a strand displacement
amplification, a repair chain reaction, a cyclic probe reaction, a
rapid amplification of cDNA ends, an invader assay, or various
solution phase and/or solid phase assays (for example, bridge
amplification or rolling circle amplification). The detection
module can include systems for implementing separation of the
amplification products; exemplary detection modules include, but
are not limited to, mass spectrometry instrumentation and
electrophoretic devices.
[0023] The analyzing module of the system includes one or more
logical instructions for analyzing the plurality of data points
generated by the detection system. For example, the instructions
can include software for performing difference analysis upon the
plurality of data points. Additionally (or alternatively), the
instructions can include or be embodied in software for generating
a graphical representation of the plurality of data points.
Optionally, the instructions can be embodied in system software
which performs combinatorial analysis on the plurality of data
points.
[0024] The present invention also provides kits for obtaining a
multiplex set of amplification products of target genes and
references-genes. The kits of the present invention include a) at
least one pair of universal primers; b) at least one pair of
target-specific primers; c) at least one pair of reference
gene-specific primers; and d) one or more amplification reaction
enzymes, reagents, or buffers. The kits optionally further include
software for storing and analyzing data obtained from the
amplification reactions.
[0025] Additionally, the present invention provides compositions
for preparing a plurality of amplification products from a
plurality of mRNA target sequences. The compositions include one or
more pairs of universal primers; and one or more pairs of
target-specific primers. The present invention also provides for
the use of the kits of the present invention for practicing any of
the methods of the present invention, as well as the use of a
composition or kit as provided by the present invention for
practicing a method of the present invention. Furthermore, the
present invention provides assays utilizing any of these uses.
BRIEF DESCRIPTION ON THE FIGURES
[0026] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0027] FIG. 1: Schematic of one embodiment of a set of
target-specific primers and a universal primer employed in the
present invention. The abbreviation "TSP" indicates a
target-specific primer, while "UP" indicates a universal primer.
Different line patterns (bold, dashed, etc.) symbolize different
DNA sequences.
[0028] FIG. 2: Schematic drawing depicting coupled target-specific
and universal priming of a PCR reaction.
[0029] FIG. 3: Schematic depiction of exemplary reactions occurring
in a multiplexed reverse transcriptase-based polymerase chain
reaction (RT-PCR) reaction, using a combination of target-specific
and universal primers.
[0030] FIG. 4: Exemplary profiles of original and "shifted"
multiplex gene sets.
[0031] FIG. 5: Exemplary profiles of multiplex gene sets using
multiple fluorescent dye labels.
DETAILED DISCUSSION
[0032] Definitions
[0033] Before describing the present invention in detail, it is to
be understood that this invention is not limited to particular
compositions or biological systems, which can, of course, vary. It
is also to be understood that the terminology used herein is for
the purpose of describing particular embodiments only, and is not
intended to be limiting. As used in this specification and the
appended claims, the singular forms "a", "an" and "the" include
plural referents unless the content clearly dictates otherwise.
Thus, for example, reference to "a device" includes a combination
of two or more such devices, reference to "a gene fusion construct"
includes mixtures of constructs, and the like.
[0034] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the present
invention, currently preferred materials and methods are described
herein.
[0035] In describing and claiming the present invention, the
following terminology will be used in accordance with the
definitions set out below.
[0036] The term "absolute abundance" or "absolute gene expression
levels" refers to the amount of a particular species (e.g., gene
expression product) present in a sample.
[0037] The term "amplified product" refers to a nucleic acid
generated by any method of nucleic acid amplification.
[0038] The term "attenuation" refers to a method of reducing the
signal intensities of extremely abundant reaction products in a
multiplex, such that the signals from all products of a multiplex
set of products fall within the dynamic range of the detection
platform used for the assay.
[0039] The term "blocking group" refers to a chemical modification
at the 3' end of an amplification primer that does not interfere
with hybridization between the primer and its target sequence, but
cannot be extended by a DNA polymerase.
[0040] The term "cDNA" refers to complementary or "copy" DNA.
Generally cDNA is synthesized by a DNA polymerase using any type of
RNA molecule (e.g., typically mRNA) as a template. Alternatively,
the cDNA can be obtained by directed chemical syntheses.
[0041] The term "chemical treatment" refers to the process of
exposing a cell, cell line, tissue or organism to a chemical or
biochemical compound (or library of compounds) that has/have the
potential to alter its gene expression profile.
[0042] The term "complementary" refers to nucleic acid sequences
capable of base-pairing according to the standard Watson-Crick
complementary rules, or being capable of hybridizing to a
particular nucleic acid segment under relatively stringent
conditions. Nucleic acid polymers are optionally complementary
across only portions of their entire sequences.
[0043] The term "environmental stress" refers to an externally
applied factor or condition that may cause an alteration in the
gene expression profile of a cell.
[0044] The term "friction group" refers to a chemical or physical
moiety attached to a nucleic acid for the purposes of reducing the
mobility by frictional drag of that nucleic acid in a matrix or
fluid across which an electric field is applied.
[0045] The term "gene" refers to a nucleic acid sequence encoding a
gene product. The gene optionally comprises sequence information
required for expression of the gene (e.g., promoters, enhancers,
etc.).
[0046] The term "gene expression" refers to transcription of a gene
into an RNA product, and optionally to translation into one or more
polypeptide sequences.
[0047] The term "gene expression data" refers to one or more sets
of data that contain information regarding different aspects of
gene expression. The data set optionally includes information
regarding: the presence of target-transcripts in cell or
cell-derived samples; the relative and absolute abundance levels of
target transcripts; the ability of various treatments to induce
expression of specific genes; and the ability of various treatments
to change expression of specific genes to different levels.
[0048] The term "high throughput format" refers to analyzing more
than about 10 samples per hour, preferably about 50 or more samples
per hour, more preferably about 100 or more samples per hour, most
preferably about 250, about 500, about 1000 or more samples per
hour.
[0049] The term "hybridization" refers to duplex formation between
two or more polynucleotides, e.g., to form a double-stranded
nucleic acid. The ability of two regions of complementarity to
hybridize and remain together depends of the length and continuity
of the complementary regions, and the stringency of hybridization
conditions.
[0050] The term "label" refers to any detectable moiety. A label
may be used to distinguish a particular nucleic acid from others
that are unlabeled, or labeled differently, or the label may be
used to enhance detection.
[0051] The terms "microplate," "culture plate," and "multiwell
plate" interchangeably refer to a surface having multiple chambers,
receptacles or containers and generally used to perform a large
number of discreet reactions simultaneously.
[0052] The term "miniaturized format" refers to procedures or
methods conducted at submicroliter volumes, including on both
microfluidic and nanofluidic platforms.
[0053] The term "multiplex reaction" refers to a plurality of
reactions conducted simultaneously in a single reaction
mixture.
[0054] The term "multiplex amplification" refers to a plurality of
amplification reactions conducted simultaneously in a single
reaction mixture.
[0055] The term "nucleic acid" refers to a polymer of ribonucleic
acids or deoxyribonucleic acids, including RNA, mRNA, rRNA, tRNA,
small nuclear RNAs, cDNA, DNA, PNA, or RNA/DNA copolymers. Nucleic
acid may be obtained from a cellular extract, genomic or
extragenomic DNA, viral RNA or DNA, or artificially/chemically
synthesized molecules.
[0056] The term "platform" refers to the instrumentation method
used for sample preparation, amplification, product separation,
product detection, or analysis of data obtained from samples.
[0057] The term "primer" refers to any nucleic acid that is capable
of hybridizing at its 3' end to a complementary nucleic acid
molecule, and that provides a free 3' hydroxyl terminus which can
be extended by a nucleic acid polymerase.
[0058] The term "reference sequence" refers to a nucleic acid
sequence serving as a target of amplification in a sample that
provides a control for the assay. The reference may be internal (or
endogenous) to the sample source, or it may be an externally added
(or exogenous) to the sample. An external reference may be either
RNA, added to the sample prior to reverse transcription, or DNA
(e.g., cDNA), added prior to PCR amplification.
[0059] The term "relative abundance" or "relative gene expression
levels" refers to the abundance of a given species relative to that
of a second species. Optionally, the second species is a reference
sequence.
[0060] The term "RNA" refers to a polymer of ribonucleic acids,
including RNA, mRNA, rRNA, tRNA, and small nuclear RNAs, as well as
to RNAs that comprise ribonucleotide analogues to natural
ribonucleic acid residues, such as 2-O-methylated residues.
[0061] The term "semi-universal primer" refers to a primer that is
capable of hybridizing with more than one, but not all, of the
target-specific primers in a multiplexed reaction.
[0062] The term "separation system" refers to any of a set of
methodologies that can be employed to effect a size separation of
the products of a reaction.
[0063] The term "size separation" refers to physical separation of
a complex mixture of species into individual components according
to the size of each species.
[0064] The term "target," "target sequence," or "target gene
sequence" refers to a specific nucleic acid sequence, the presence,
absence or abundance of which is to be determined. In a preferred
embodiment of the invention, it is a unique sequence within the
mRNA of an expressed gene.
[0065] The term "target-specific primer" refers to a primer capable
of hybridizing with its corresponding target sequence. Under
appropriate conditions, the hybridized primer can prime the
replication of the target sequence.
[0066] The term "template" refers to any nucleic acid polymer that
can serve as a sequence that can be copied into a complementary
sequence by the action of, for example, a polymerase enzyme.
[0067] The term "transcription" refers to the process of copying a
DNA sequence of a gene into an RNA product, generally conducted by
a DNA-directed RNA polymerase using the DNA as a template.
[0068] The term "treatment" refers to the process of subjecting one
or more cells, cell lines, tissues, or organisms to a condition,
substance, or agent (or combinations thereof) that may cause the
cell, cell line, tissue or organism to alter its gene expression
profile. A treatment may include a range of chemical concentrations
and exposure times, and replicate samples may be generated.
[0069] The term "universal primer" refers to a replication primer
comprising a universal sequence.
[0070] The term "universal sequence" refers to a sequence contained
in a plurality of primers, but preferably not in a complement to
the original template nucleic acid (e.g., the target sequence),
such that a primer composed entirely of universal sequence is not
capable of hybridizing with the template.
[0071] Gene Expression as a Measure of the Biological State of a
Cell
[0072] Transcription of genes into RNA is a critical early step in
gene expression. Consequently, the coordinated activation or
suppression of transcription of particular genes is an important
component of the overall regulation of expression. A variety of
well-developed techniques have been established that provide ways
to analyze and quantitate gene transcription.
[0073] Some of the earliest methods are based on detection of a
label in RNA hybrids or protection of RNA from enzymatic
degradation (see, for example, Current Protocols in Molecular
Biology, F. M. Ausubel et al., eds., Current Protocols, a joint
venture between Greene Publishing Associates, Inc. and John Wiley
& Sons, Inc., supplemented through 1999). Methods based on
detecting hybrids include northern blots and slot/dot blots. These
two techniques differ in that the components of the sample being
analyzed are resolved by size in a northern blot prior to
detection, which enables identification of more than one species
simultaneously. Slot blots are generally carried out using
unresolved mixtures or sequences, but can be easily performed in
serial dilution, enabling a more quantitative analysis. Both
techniques are very time-consuming and require a fair amount of
manual manipulation, making them expensive and unsuitable for high
throughput applications.
[0074] In situ hybridization is a technique that monitors
transcription by directly visualizing RNA hybrids in the context of
a whole cell. This method provides information regarding
subcellular localization of transcripts. However, it is not very
quantitative, and is extremely technically demanding and
time-consuming. As a consequence, this technique is best suited for
basic research applications.
[0075] Techniques to monitor RNA that make use of protection from
enzymatic degradation include S1 analysis and RNAse protection
assays (RPAs). Both of these assays employ a labeled nucleic acid
probe, which is hybridized to the RNA species being analyzed,
followed by enzymatic degradation of single-stranded regions of the
probe. Analysis of the amount and length of probe protected from
degradation is used to determine the quantity and endpoints of the
transcripts being studied. Although both methods can yield
quantitative results, they are time-consuming and cumbersome,
making them poor candidates for a high-throughput, low cost general
assay for gene expression.
[0076] A second family of assays developed for monitoring
transcription makes use of cDNA derived from mRNA. Because the
material analyzed is DNA, these assays are less sensitive to
degradation, and also provide partial and/or full clones with which
to localize and clone genes or coding sequences of interest.
Methods include sequencing cDNA inserts of an expressed sequence
tag (EST) clone library (Adams et al. (1991) Science
252:1651-1656), which may be coupled with subtractive hybridization
to improve sensitivity (Sagerstrom et al. (1997) Annul Rev.
Biochem. 66:751-783), and serial analysis of gene expression
("SAGE", described in U.S. Pat. No. 5,866,330 to Kinzler et al.;
Velculescu et al. (1995) Science 270:484-487); and Zhang et al.
(1997) Science 276:1268-1272). Both of these methods have been
useful for identification of novel, differentially expressed genes.
However, their methodologies yield untargeted information, i.e.,
they survey the whole spectrum of mRNA in a sample rather than
focusing on a predetermined set. As a result, very large data sets
are required to derive reliable quantitative data, making these
methods inappropriate and far too costly for high throughput
screening strategies.
[0077] Reverse transcriptase-mediated PCR (RT-PCR) gene expression
assays are directed at specified target gene products, overcoming
some of the shortcomings described above. These assays are
derivatives of PCR in which amplification is preceded by reverse
transcription of mRNA into cDNA. Because the mRNA is amplified,
this type of assay can detect transcripts of very low abundance;
however, the assay is not quantitative. Adaptations of this assay,
called competitive RT-PCR (Becker-Andre and Hahlbrock (1989)
Nucleic Acids Res. 17:9437-9446; Wang et al. (1989) Proc. Natl.
Acad. Sci. USA 86:9717-9721; Gilliland et al. (1990) Proc. Natl.
Acad. Sci. USA 87:2725-2729) have been developed that are more
quantitative. In these assays, a known amount of exogenous template
is added to the reaction mixture, to compete with the target for
amplification. The exogenous competitor is titrated against the
target, allowing for quantitation of a specified cDNA in the sample
by comparing the amplification of both templates within the same
reaction mixture. Because titration is required to generate
quantitative data, multiple reactions are required for each
analysis. While this type of assay is very sensitive and
quantitative, these assays require multiple steps in development,
execution, and analysis, making them very time-consuming,
cumbersome, and expensive. The need to perform a titration reduces
the overall throughput of the assay, and the requirement for an
internal competitor for each target reduces the multiplexing
capacity. These limitations restrict the usefulness of this assay
in analysis of large numbers of gene sets.
[0078] In order to increase the throughput of the RT-PCR assay, Su
et al. (BioTechniques (1997) 22:1107-1113) combined
microplate-based RNA extraction with multiplexed RT-PCR. With this
method, they demonstrated simultaneous analysis of three different
target mRNAs amplified from samples prepared from a 96 well
microplate. However, changes in gene expression were only presented
qualitatively.
[0079] Other methods for targeted mRNA analysis include
differential display reverse transcriptase PCR (DDRT-PCR) and RNA
arbitrarily primed PCR (RAP-PCR) (see U.S. Pat. No. 5,599,672;
Liang and Pardee (1992) Science 257:967-971; Welsh et al. (1992)
Nucleic Acids Res. 20:4965-4970). Both methods use random priming
to generate RT-PCR fingerprint profiles of transcripts in an
unfractionated RNA preparation. The signal generated in these types
of analyses is a pattern of bands separated on a sequencing gel.
Differentially expressed genes appear as changes in the fingerprint
profiles between two samples, which can be loaded in separate wells
of the same gel. This type of readout allows identification of both
up- and down-regulation of genes in the same reaction, appearing as
either an increase or decrease in intensity of a band from one
sample to another. However, due to the complexity of the
fingerprint profile, amplification products are strongly biased
towards more abundant transcripts. Simultaneous amplification of
hundreds to thousands of different products dramatically compresses
the dynamic range of measurement. The combined result of
amplification bias, dynamic range compression and other biases that
result from the use of a complex mix of primers eliminates the
ability to quantitate relative changes in expression between the
different genes in a sample. Furthermore, the methodology is
designed for identification of changes in the transcriptional
profile of a whole cell, but does not provide any information about
the identities of the PCR products. To identify a species, a band
must be excised from the gel, subcloned, sequenced, and finally
matched to a gene in a sequence database. The complexity of the
profile prohibits complete resolution of PCR products on the gel,
causing a high incidence of false positives arising from multiple
species existing in the same region of the gel. These
characteristics make general fingerprinting techniques unsuitable
for investigation of already identified transcripts, and precludes
a high-throughput quantitative analysis.
[0080] The TaqMan assay (Livak et al. (1995) PCR Methods Appl.
4:357-362) is a quenched fluorescent dye system for quantitating
targeted mRNA levels in a complex mixture. The assay has good
sensitivity and dynamic range, and yields quantitative results. But
because detection is based on fluorescence of unfractionated
products, it can be multiplexed only to the very low levels (i.e.,
two to four) as allowed by resolution of emission spectra of the
chromaphores. Furthermore, due to overlapping emission spectra,
multiplexing reduces the accuracy of quantitation. This limitation
makes differential analysis problematic and increases the cost.
Also, the assay is performed in real time during thermal cycling,
greatly reducing the throughput of the assay.
[0081] Nucleic acid microarrays have been developed recently, which
have the benefit of assaying for sample hybridization to a large
number of probes in a highly parallel fashion. They can be used for
quantitation of mRNA expression levels, and dramatically surpass
the above mentioned techniques in terms of multiplexing capability.
These arrays comprise short DNA sequences, PCR products, or mRNA
isolates fixed onto a solid surface, which can then be used in a
hybridization reaction with a target sample, generally a whole cell
extract (see, for example, U.S. Pat. Nos. 5,143,854 and 5,807,522;
Fodor et al. (1991) Science 251:767-773; and Schena et al. (1995)
Science 270:467-470). Microarrays can be used to measure the
expression levels of several thousands of genes simultaneously,
generating a gene expression profile of the entire genome of
relatively simple organisms. Each reaction, however, is performed
with a single sample against a very large number of gene probes. As
a consequence, microarray technology does not facilitate high
throughput analysis of very large numbers of unique samples against
an array of known probes.
[0082] The present invention addresses the need for gene expression
detection and quantitation methodologies by providing novel methods
for analyzing gene expression, systems for implementing these
techniques, compositions for preparing a plurality of amplification
products from a plurality of mRNA target sequences, and related
pools of amplification products. The methods of the present
invention include the steps of (a) obtaining a plurality of target
cDNA sequences; (b) multiplex amplifying the target sequences using
a plurality of target-specific primers and one or more universal
primers; (c) separating one or more members of the resulting
plurality of amplification products; (d) detecting the one or more
members of the plurality of amplification products, thereby
generating a set of gene expression data; (e) storing the data in a
database; and (f) performing a comparative analysis on the set of
gene expression data, thereby analyzing the gene expression. The
methods of the invention are highly sensitive; have a wide dynamic
range; are rapid and inexpensive; have a high throughput; and allow
the simultaneous differential analysis of a defined set of genes.
The methods, compositions and kits of the invention also provide
tools for gene expression data collection and relational data
analysis.
[0083] Methods for Quantitating Gene Expression Levels
[0084] The controlled expression of particular genes or groups of
genes in a cell is the molecular basis for regulation of biological
processes and, ultimately, for the physiological or pathological
state of the cell. Knowledge of the "expression profile" of a cell
is of key importance for answering many biological questions,
including the nature and mechanism of cellular changes, or the
degree of differentiation of a cell, organ, or organism.
Furthermore, the factors involved in determining the expression
profile may lead to the discovery of cures that could reverse an
adverse pathological or physiological condition. A defined set of
genes can be demonstrated to serve as indicators of a particular
state of a cell, and can therefore serve as a model for monitoring
the cellular profile of gene expression in that state.
[0085] The pharmaceutical drug discovery process has traditionally
been dominated by biochemical and enzymatic studies of a designated
pathway. Although this approach has been productive, it is very
laborious and time-consuming, and is generally targeted to a single
gene or defined pathway. Molecular biology and the development of
gene cloning have dramatically expanded the number of genes that
are potential drug targets, and this process is accelerating
rapidly as a result of the progress made in sequencing the human
genome. In addition to the growing set of available genes,
techniques such as the synthesis of combinatorial chemical
libraries have created daunting numbers of candidate drugs for
screening. In order to capitalize on these available materials,
methods are needed that are capable of extremely fast and
inexpensive analysis of gene expression levels.
[0086] The present invention provides novel methods for the
analysis of changes in expression levels of a set of genes. These
methods include providing a plurality of target sequences, which
are then analyzed simultaneously in a multiplexed reaction.
Multiplexing the analysis improves the accuracy of quantitation;
for example, signals from one or more target genes can be compared
to an internal control. Multiplexing also reduces the time and cost
required for analysis. Thus, the methods of the present invention
provide for rapid generation of a differential expression profile
of a defined set of genes, through the comparison of data from
multiple reactions.
[0087] The methods of the present invention include the steps of
(a) obtaining a plurality of target nucleic acid sequences,
generally cDNA sequences; (b) multiplex amplifying the target
sequences using a plurality of target-specific primers and one or
more universal primers; (c) separating one or more members of the
resulting plurality of amplification products; (d) detecting the
one or more members of the plurality of amplification products,
thereby generating a set of gene expression data; (e) storing the
data in a database; and (f) performing a comparative analysis on
one or more components of the set of gene expression data, thereby
analyzing the gene expression. In an alternative embodiment, the
methods of the present invention include the steps of obtaining
cDNA from a plurality of samples for a plurality of target
sequences; performing a plurality of multiplexed amplifications of
the target sequences, thereby producing a plurality of multiplexed
amplification products; pooling the plurality of multiplexed
amplification products; separating the plurality of multiplexed
amplification products; detecting the plurality of multiplexed
amplification products, thereby generating a set of gene expression
data; storing the set of gene expression data in a database; and
performing a comparative analysis of the set of gene expression
data. In yet another embodiment, the methods of the present
invention include the steps of (a) obtaining cDNA from multiple
samples; (b) amplifying a plurality of target sequences from the
cDNA, thereby producing a multiplex of amplification products; (c)
separating and detecting the amplification products using a high
throughput platform, wherein detecting generates a set of gene
expression data; (d) storing the set of gene expression data in a
database; and (e) performing a comparative analysis of the set of
gene expression data. In a further embodiment, the present
invention provides methods for analyzing gene expression, including
the steps of (a) obtaining cells, e.g. culturing one of several
designated cell lines; (b) optionally subjecting a set of the
cultures to a specified treatment; (c) lysing the cells and
isolating one or more RNA molecules; (d) synthesizing cDNA first
strand molecules from a designated set of the mRNA molecules; (e)
quantitatively amplifying the resulting set of cDNA products using
target-specific primers in early rounds, coupled with amplifying
the whole set by universal primers that have partial homology with
all of the target-specific primers, and that contain a detectable
label, preferably a fluorescent chromaphore, on at least one of the
primers; (f) optionally pooling products of two or more separate
reactions; (g) physically separating amplified products according
to their length; (h) detecting and quantitating the separated
amplification products, for example, by deconvolution of data from
any species of the same length (arising from reactions that were
pooled); (i) determining the relative abundance levels using an
internal reference target; (j) storing the information in a gene
expression database; and (k) performing a comparative analysis of
the expression patterns. Each aspect of these methods of the
present invention is addressed in greater detail below.
[0088] Sources of Target Sequences
[0089] Target sequences for use in the methods of the present
invention are obtained from a number of sources. For example, the
target sequences can be derived from organisms or from cultured
cell lines. Cell types utilized in the present invention can be
either prokaryotic or eukaryotic cell types and/or organisms,
including, but not limited to, animal cells, plants, yeast, fungi,
bacteria, viruses, and the like. Target sequences can also be
obtained from other sources, for example, needle aspirants or
tissue samples from an organism (including, but not limited to,
mammals such as mice, rodents, guinea pigs, rabbits, dogs, cats,
primates and humans; or non-mammalian animals such as nematodes,
frogs, amphibians, various fishes such as the zebra fish, and other
species of scientific interest), non-viable organic samples or
their derivatives (such as a cell extract or a purified biological
sample), or environmental sources, such as an air or water sample.
Furthermore, target sequences can also be commercially or
synthetically prepared, such as a chemical, phage, or plasmid
library. DNA and/or RNA sequences are available from a number of
commercial sources, including The Midland Certified Reagent Company
(mcrc@oligos.com), The Great American Gene Company
(http://www.genco.com), ExpressGen Inc. (www.expressgen.com),
Operon Technologies Inc. (Alameda, Calif.) and many others.
[0090] Cell lines which can be used in the methods of the present
invention include, but are not limited to, those available from
cell repositories such as the American Type Culture Collection
(www.atcc.org), the World Data Center on Microorganisms
(http://wdcm.nig.ac.jp), European Collection of Animal Cell Culture
(www.ecacc.org) and the Japanese Cancer Research Resources Bank
(http://cellbank.nihs.go.jp). These cell lines include, but are not
limited to, the following cell lines: 293, 293Tet-Off, CHO-AA8
Tet-Off, MCF7, MCF7 Tet-Off, LNCap, T-5, BSC-1, BHK-21, Phinx-A,
3T3, HeLa, PC3, DU145, ZR 75-1, HS 578-T, DBT, Bos, CV1, L-2, RK13,
HTTA, HepG2, BHK-Jurkat, Daudi, RAMOS, KG-1, K562, U937, HSB-2,
HL-60, MDAHB231, C2C12, HTB-26, HTB-129, HPIC5, A-431, CRL-1573,
3T3L1, Cama-1, J774A.1, HeLa 229, PT-67, Cos7, OST7, HeLa-S, THP-1,
and NXA. Additional cell lines for use in the methods and matrices
of the present invention can be obtained, for example, from cell
line providers such as Clonetics Corporation (Walkersville, Md.;
www.clonetics.com). Optionally, the plurality of target sequences
are derived from cultured cells optimized for the analysis of a
particular disease area of interest, e.g., cancer, inflammation,
cardiovascular disease, diabetes, infectious diseases,
proliferative diseases, an immune system disorder, or a central
nervous system disorder.
[0091] A variety of cell culture media are described in The
Handbook of Microbiological Media, Atlas and Parks (eds) (1993, CRC
Press, Boca Raton, Fla.). References describing the techniques
involved in bacterial and animal cell culture include Sambrook et
al., Molecular Cloning--A Laboratory Manual (2nd Ed.), Vol. 1-3
(1989, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.);
Current Protocols in Molecular Biology, F. M. Ausubel et al., eds.,
Current Protocols, (a joint venture between Greene Publishing
Associates, Inc. and John Wiley & Sons, Inc., supplemented
through 2000); Freshney, Culture of Animal Cells, a Manual of Basic
Technique, third edition (1994, Wiley-Liss, New York) and the
references cited therein; Humason, Animal Tissue Techniques, fourth
edition (1979, W. H. Freeman and Company, New York); and
Ricciardelli, et al. (1989) In Vitro Cell Dev. Biol. 25:1016-1024.
Information regarding plant cell culture can be found in Plant Cell
and Tissue Culture in Liquid Systems, by Payne et al. (1992, John
Wiley & Sons, Inc. New York, N.Y.); Plant Cell, Tissue and
Organ Culture: Fundamental Methods by Gamborg and Phillips, eds.
(1995, Springer Lab Manual, Springer-Verlag, Berlin), and is also
available in commercial literature such as the Life Science
Research Cell Culture Catalogue (1998) from Sigma-Aldrich, Inc (St
Louis, Mo.) (Sigma-LSRCCC) and the Plant Culture Catalogue and
supplement (1997) also from Sigma-Aldrich, Inc (St Louis, Mo.)
(Sigma-PCCS).
[0092] In an exemplary embodiment of methods of the present
invention, either primary or immortalized (or other) cell lines are
grown in a master flask, then trypsinized (if they are adherent)
and transferred to a 96-well plate, seeding each well at a density
of 10.sup.4 to 10.sup.6 cells/well. If the gene expression profile
in response to a chemical treatment is sought, the chemical agent
of choice is prepared in a range of concentrations. After a time of
recovery and growth as appropriate to the cell line, cells are
exposed to the chemical for a period of time that will not
adversely impact the viability of the cells. Preferably, assays
include a range of chemical concentrations and exposure times, and
would include replicate samples. After treatment, medium is removed
and cells are immediately lysed.
[0093] In further embodiments of cell culture, formats other than a
96-well plate may be used. Other multiwell or microplate formats
containing various numbers of wells, such as 6, 12, 48, 384, 1536
wells, or greater, are also contemplated. Culture formats that do
not use conventional flasks, as well as microtiter formats, may
also be used.
[0094] Treatment of Cells
[0095] The cells lines or sources containing the target nucleic
acid sequences, are optionally subjected to one or more specific
treatments, or in the case of organisms, may already be in
different pathological or physiological stages that induce changes
in gene expression. For example, a cell or cell line can be treated
with or exposed to one or more chemical or biochemical
constituents, e.g., pharmaceuticals, pollutants, DNA damaging
agents, oxidative stress-inducing agents, pH-altering agents,
membrane-disrupting agents, metabolic blocking agent; a chemical
inhibitors, cell surface receptor ligands, antibodies,
transcription promoters/enhancers/inhibitors, translation
promoters/enhancers/inhibitor- s, protein-stabilizing or
destabilizing agents, various toxins, carcinogens or teratogens,
characterized or uncharacterized chemical libraries, proteins,
lipids, or nucleic acids. Optionally, the treatment comprises an
environmental stress, such as a change in one or more environmental
parameters including, but not limited to, temperature (e.g. heat
shock or cold shock), humidity, oxygen concentration (e.g.,
hypoxia), radiation exposure, culture medium composition, or growth
saturation. Alternatively, cultured cells may be exposed to other
viable organisms, such as pathogens or other cells, to study
changes in gene-expression that result from biological events, such
as infections or cell-cell interactions. Responses to these
treatments may be followed temporally, and the treatment can be
imposed for various times and at various concentrations. Target
sequences can also be derived from cells or organisms exposed to
multiple specific treatments as described above, either
concurrently or in tandem (i.e., a cancerous tissue sample may be
further exposed to a DNA damaging agent while grown in an altered
medium composition).
[0096] RNA Isolation
[0097] In some embodiments of the present invention, total RNA is
isolated from samples for use as target sequences. Cellular samples
are lysed once culture with or without the treatment is complete
by, for example, removing growth medium and adding a
guanidinium-based lysis buffer containing several components to
stabilize the RNA. In some embodiments of the present invention,
the lysis buffer also contains purified RNAs as controls to monitor
recovery and stability of RNA from cell cultures. Examples of such
purified RNA templates include the Kanamycin Positive Control RNA
from Promega (Madison, Wis.), and 7.5 kb Poly(A)-Tailed RNA from
Life Technologies (Rockville, Md.). Lysates may be used immediately
or stored frozen at, e.g., -80.degree. C.
[0098] Optionally, total RNA is purified from cell lysates (or
other types of samples) using silica-based isolation in an
automation-compatible, 96-well format, such as the Rneasy.RTM.
purification platform (Qiagen, Inc.; Valencia, Calif.).
Alternatively, RNA is isolated using solid-phase oligo-dT capture
using oligo-dT bound to microbeads or cellulose columns. This
method has the added advantage of isolating mRNA from genomic DNA
and total RNA, and allowing transfer of the mRNA-capture medium
directly into the reverse transcriptase reaction. Other RNA
isolation methods are contemplated, such as extraction with
silica-coated beads or guanidinium. Further methods for RNA
isolation and preparation can be devised by one skilled in the
art.
[0099] Alternatively, the methods of the present invention are
performed using crude cell lysates, eliminating the need to isolate
RNA. RNAse inhibitors are optionally added to the crude samples.
When using crude cellular lysates, genomic DNA could contribute one
or more copies of target sequence, depending on the sample. In
situations in which the target sequence is derived from one or more
highly expressed genes, the signal arising from genomic DNA may not
be significant. But for genes expressed at very low levels, the
background can be eliminated by treating the samples with DNAse, or
by using primers that target splice junctions. For example, one of
the two target-specific primers could be designed to span a splice
junction, thus excluding DNA as a template. As another example, the
two target-specific primers are designed to flank a splice
junction, generating larger PCR products for DNA or unspliced mRNA
templates as compared to processed mRNA templates. One skilled in
the art could design a variety of specialized priming applications
that would facilitate use of crude extracts as samples for the
purposes of this invention.
[0100] Primer Design and Multiplex Strategies
[0101] Multiplex amplification of the target sequence involves
combining the plurality of target sequences with a plurality of
target-specific primers and one or more universal primers, to
produce a plurality of amplification products. A multiplex set of
target sequences optionally comprises between about two targets and
about 100 targets. In one embodiment of the present invention, the
multiplex reaction includes at least 5 target sequences, but
preferably at least ten targets or at least fifteen targets.
Multiplexes of much larger numbers (e.g., about 20, about 50, about
75 and greater) are also contemplated.
[0102] In one embodiment of the methods of the present invention,
at least one of the amplification targets in the multiplex set is a
transcript that is endogenous to the sample and has been
independently shown to exhibit a fairly constant expression level
(for example, a "housekeeping" gene). The signal from this
endogenous reference sequence provides a control for converting
signals of other gene targets into relative expression levels.
Optionally, a plurality of control mRNA targets/reference sequences
that have relatively constant expression levels may be included in
the multiplexed amplification to serve as controls for each other.
Alternatively, a defined quantity of an exogenous purified RNA
species is added to the multiplex reaction or to the cells, for
example, with the lysis reagents. Almost any purified, intact RNA
species can be used, e.g. the Kanamycin Positive Control RNA or the
7.5 kb Poly(A)-Tailed RNA mentioned previously. This
exogenously-added amplification target provides a way to monitor
the recovery and stability of RNA from cell cultures. It can also
serve as an exogenous reference signal for converting the signals
obtained from the sample mRNAs into relative expression levels. In
still another embodiment, a defined quantity of a purified DNA
species is added to the PCR to provide an exogenous reference
target for converting the signals obtained from sample mRNA targets
into relative expression levels.
[0103] In one embodiment of the present invention, once the targets
that comprise a multiplex set are determined, primer pairs
complementary to each target sequence are designed, including both
target-specific and universal primers. This can be accomplished
using any of several software products that design primer
sequences, such as OLIGO (Molecular Biology Insights, Inc., CO),
Gene Runner (Hastings Software Inc., NY), or Primer3 (The Whitehead
Institute, MA). FIG. 1 illustrates the elements of design of
exemplary target-specific primers (TSPs) and universal primers
(UPs). Target specific primers (TSP1, TSP2, TSP3, TSP4 and TSP5)
are comprised of at least two portions. One portion, shown as a
solid line within the 5' region of each of the five TSP sequences,
includes a region complementary to a selected "universal sequence."
The universal sequence is utilized to allow amplification of
multiple targets (having divergent sequences) while using the same
primer (e.g., the UP). The universal sequence is contained only in
the primers, and preferably is not present in any nucleic acid (or
complement thereof) provided by the sample being tested. A second
portion of the TSPs, shown as variable lines (solid, dotted,
dashed, etc) within the 3' region of the sequence, represents the
sequence that is complementary to and will hybridize with one of a
plurality of designated target sequences In FIG. 1, a single
universal primer (labeled as "UP") is depicted; however, multiple
universal primers having different or unique sequences or labels
can be employed in the methods of the present invention.
Optionally, the primer design also includes consideration of
properties beyond the encoded sequence of the primer, such as
annealing temperature, 3'-end hybridization stability, and
minimization of sequences that would allow annealing among the
primers themselves.
[0104] Oligonucleotide primers are typically prepared by the
phosphoramidite approach. In this automated, solid-phase procedure,
each nucleotide is individually added to the 5'-end of the growing
oligonucleotide chain, which is in turn attached at the 3'-end to a
solid support. The added nucleotides are in the form of trivalent
3'-phosphoramidites that are protected from polymerization by a
dimethoxytrityl ("DMT") group at the 5'-position. After base
induced phosphoramidite coupling, mild oxidation to give a
pentavalent phosphotriester intermediate and DMT removal provides a
new site for oligonucleotide elongation. These syntheses may be
performed on, for example, a Perkin Elmer/Applied Biosystems
Division DNA synthesizer. The oligonucleotide primers are then
cleaved off the solid support, and the phosphodiester and exocyclic
amino groups are deprotected with ammonium hydroxide.
[0105] Nucleic Acid Hybridization
[0106] The length of complementary sequence between each primer and
its binding partner (i.e. the target sequence or the universal
sequence) should be sufficient to allow hybridization of the primer
only to its target within a complex sample at the annealing
temperature used for the PCR. A complementary sequence of, for
example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or
more nucleotides is preferred for both the target-specific and
universal regions of the primers. A particularly preferred length
of each complementary region is about 20 bases, which will promote
formation of stable and specific hybrids between the primer and
target.
[0107] Nucleic acids "hybridize" when they associate, typically in
solution. Nucleic acids hybridize due to a variety of well
characterized physico-chemical forces, such as hydrogen bonding,
solvent exclusion, base stacking and the like. An extensive guide
to the hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, part I, chapter 2,
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays," (Elsevier, N.Y.), as well as in
Ausubel, supra. Hames and Higgins (1995) Gene Probes 1, IRL Press
at Oxford University Press, Oxford, England (Hames and Higgins 1)
and Hames and Higgins (1995) Gene Probes 2, IRL Press at Oxford
University Press, Oxford, England (Hames and Higgins 2) provide
details on the synthesis, labeling, detection and quantification of
DNA and RNA, including oligonucleotides.
[0108] "Stringent hybridization wash conditions" in the context of
nucleic acid hybridization experiments, such as Southern and
northern hybridizations, are sequence dependent, and are different
under different environmental parameters. An extensive guide to the
hybridization of nucleic acids is found in Tijssen (1993), supra,
and in Hames and Higgins 1 and Hames and Higgins 2, supra.
[0109] For purposes of the present invention, generally, "highly
stringent" hybridization and wash conditions are selected to be
about 5.degree. C. or less lower than the thermal melting point
(T.sub.m) for the specific sequence at a defined ionic strength and
pH (as noted below, highly stringent conditions can also be
referred to in comparative terms). The T.sub.m is the temperature
(under defined ionic strength and pH) at which 50% of the test
sequence hybridizes to a perfectly matched primer. Very stringent
conditions are selected to be equal to the T.sub.m for a particular
primer.
[0110] The T.sub.m is the temperature of the nucleic acid duplexes
indicates the temperature at which the duplex is 50% denatured
under the given conditions and its represents a direct measure of
the stability of the nucleic acid hybrid. Thus, the T.sub.m
corresponds to the temperature corresponding to the midpoint in
transition from helix to random coil; it depends on length,
nucleotide composition, and ionic strength for long stretches of
nucleotides.
[0111] After hybridization, unhybridized nucleic acid material can
be removed by a series of washes, the stringency of which can be
adjusted depending upon the desired results. Low stringency washing
conditions (e.g., using higher salt and lower temperature) increase
sensitivity, but can product nonspecific hybridization signals and
high background signals. Higher stringency conditions (e.g., using
lower salt and higher temperature that is closer to the
hybridization temperature) lowers the background signal, typically
with only the specific signal remaining. See, Rapley, R. and
Walker, J. M. eds., Molecular Biomethods Handbook (Humana Press,
Inc. 1998) (hereinafter "Rapley and Walker"), which is incorporated
herein by reference in its entirety for all purposes.
[0112] Thus, one measure of stringent hybridization is the ability
of the primer to hybridize to one or more of the target nucleic
acids (or complementary polynucleotide sequences thereof) under
highly stringent conditions. Stringent hybridization and wash
conditions can easily be determined empirically for any test
nucleic acid.
[0113] For example, in determining highly stringent hybridization
and wash conditions, the hybridization and wash conditions are
gradually increased (e.g., by increasing temperature, decreasing
salt concentration, increasing detergent concentration and/or
increasing the concentration of organic solvents, such as formalin,
in the hybridization or wash), until a selected set of criteria are
met. For example, the hybridization and wash conditions are
gradually increased until a target nucleic acid, and complementary
polynucleotide sequences thereof, binds to a perfectly matched
complementary nucleic acid.
[0114] A target nucleic acid is said to specifically hybridize to a
primer nucleic acid when it hybridizes at least 1/2 as well to the
primer as to a perfectly matched complementary target, i.e., with a
signal to noise ratio at least 1/2 as high as hybridization of the
primer to the target under conditions in which the perfectly
matched primer binds to the perfectly matched complementary target
with a signal to noise ratio that is at least about
2.5.times.-10.times., typically 5.times.-10.times. as high as that
observed for hybridization to any of the unmatched target nucleic
acids.
[0115] Optionally, primers are designed such that the annealing
temperature of the universal sequence is higher/greater than that
of the target-specific sequences. Method employing these primers
further include increasing the annealing temperature of the
reaction after the first few rounds of amplification. This increase
in reaction temperature suppresses further amplification of sample
nucleic acids by the TSPs, and drives amplification by the UP.
Depending on the application envisioned, one skilled in the art can
employ varying conditions of hybridization to achieve varying
degrees of selectivity of primer towards the target sequence. For
example, varying the stringency of hybridization or the position of
primer hybridization can reveal divergence within gene
families.
[0116] Optionally, each candidate primer is shown or proven to be
compatible with the other primers used in a multiplex reaction. In
a preferred embodiment, each target-specific primer pair produces a
single amplification product of a predicted size from a sample
minimally containing all of the targets of the multiplex, and more
preferably from a crude RNA mixture. Preferably, amplification of
each individual target by its corresponding primers is not
inhibited by inclusion of any other primers in the multiplex. None
of the primers, either individually or in combination, should
produce spurious products. These issues are easily addressed by one
of skill in the art without the need for excessive undue
experimentation.
[0117] Inherent Properties and Labels
[0118] Primer sequences are optionally designed to accommodate one
or more detection techniques that can be employed while performing
the methods of the present invention. For example, detection of the
amplification products is optionally based upon one or more
inherent properties of the amplification products themselves, such
as mass or mobility. Other embodiments utilize methods of detection
based on monitoring a label associated with the PCR products. In
these embodiments, generally one or more of the universal primers
contains the label. Optionally, the label is a fluorescent
chromaphore. A fluorescent label may be covalently attached,
noncovalently intercalated, or may be an energy transfer label.
Other useful labels include mass labels, which are incorporated
into amplification products and released after the reaction for
detection, chemiluminescent labels, electrochemical and infrared
labels, isotopic derivatives, nanocrystals, or any of various
enzyme-linked or substrate-linked labels detected by the
appropriate enzymatic reaction.
[0119] One preferred embodiment of the methods of the present
invention includes the use and detection of one or more fluorescent
labels. Generally, fluorescent molecules each display a distinct
emission spectrum, thereby allowing one to employ a plurality of
fluorescent labels in a multiplexed reaction, and then separate the
mixed data into its component signals by spectral deconvolution.
Exemplary fluorescent labels for use in the methods of the present
invention include a single dye covalently attached to the molecule
being detected, a single dye noncovalently intercalated into
product DNA, or an energy-transfer fluorescent label.
[0120] Other embodiments of labeling include mass labels, which are
incorporated into amplification products and released after the
reaction for detection; chemiluminescent, electrochemical, and
infrared labels; radioactive isotopes; and any of various
enzyme-linked or substrate-linked labels detectable by the
appropriate enzymatic reaction. Many other useful labels are known
in the art, and one skilled in the art can envision additional
strategies for labeling amplification products of the present
invention.
[0121] Cleavable Linkages and Size-Shifting of Amplification
Products
[0122] Primers can also be designed to produce amplification
products having sizes which can selectively be changed, or
"shifted" after amplification, in order to better resolve the
amplification products prior to or during detection. For example, a
primer can be designed to incorporate a restriction enzyme site
within a portion of the amplified product. The products of this
reaction can then optionally be cleaved enzymatically to generate
size-shifted amplification products. Alternatively, primers can be
designed to incorporate various chemically-cleavable linkages, mass
labels, or other linkers which can optionally be used in the
detection of one or more of the amplification products.
[0123] Linking groups, or linkers, can also be incorporated into
the primers of the present invention. Linking groups of use in the
present invention can have a range of structures, substituents and
substitution patterns. They can, for example be derivitized with
nitrogen, oxygen and/or sulfur containing groups which are pendent
from, or integral to, the linker group backbone. Examples include,
polyethers, polyacids (polyacrylic acid, polylactic acid), polyols
(e.g., glycerol,), polyamines (e.g., spermine, spermidine) and
molecules having more than one nitrogen, oxygen and/or sulfur
moiety (e.g., 1,3-diamino-2-propanol, taurine). See, for example,
Sandier et al. Organic Functional Group Preparations 2nd Ed.,
Academic Press, Inc. San Diego 1983.
[0124] Methods for preparing linkers that can be incorporated into
primers for use in the methods of the present invention are known
in the art. Numerous linking groups compatible with phosphoramidite
chemistry are commercially available (Glen Research, Sterling, Va.)
and can readily be incorporate into oligonucleotides during
automated synthesis procedures.
[0125] One of skill will recognize that a linker that is
appropriate for incorporation into a nucleic acid oligomer
synthesis can also be utilized to derivatize a nucleic acid
monomer. For example, chemically cleavable primers can be used in
the amplification step of the methods of the present invention. In
these embodiments, one or more of the primers used in amplification
contain a chemical linkage, such as a thiophosphate moiety, that
can be selectively cleaved, generating two separate fragments from
the primer. Cleavage is optionally performed after the
amplification reaction, e.g., by removing a fixed number of
nucleotides from the 5' end of products made from that primer.
Design and use of such primers is described in detail in, for
example, Li et al (Electrophoresis (1999) 20:1258-1265), PCT
publication WO 96/37630 (Monforte et al.) and U.S. Pat. No.
5,700,642 (Monforte et al.) and U.S. Pat. No. 6,090,558 (Butler et
al.), which are incorporated herein by reference in their entirety
for all purposes.
[0126] Exemplary Primer Designs for Use in a Multiplexed
Amplification Reaction
[0127] A preferred embodiment of the invention utilizes a
combination of TSPs that will hybridize with one of a plurality of
designated target sequences, and universal primers (UPs) for
amplification of multiple targets in the multiplexed reaction.
Optionally, the primary way of separating the signals of the
multiplexed amplification is according to product sizes.
Alternatively, the signals can be resolved using differential
labeling to separate signals from products of similar size. To
separate products according to size, the predicted sizes must be
considered in primer design. FIG. 1 illustrates the elements of
design of these primers. Each of the TSPs has a universal sequence
within the 5' region, which is shared among the primers, but not
contained in the original template (i.e. the target sequence). This
universal sequence may be the same or different for the forward and
reverse TSPs. Following the 3' end of the universal sequence is a
target-specific sequence for annealing to and amplifying the target
sequence (e.g., gene) of interest.
[0128] The universal primer is composed of the universal sequence
held in common within the 5' regions of the TSPs. If a single UP is
to be used, the universal sequence will be the same within all
TSPs. If a UP pair is to be used, the universal sequence will be
different in the forward and reverse primers of the TSPs. The UP
may also contain a detectable label on at least one of the primers,
such as a fluorescent chromaphore. Both the target-specific and
universal sequences are of sufficient length and sequence
complexity to form stable and specific duplexes, allowing
amplification and detection of the target gene.
[0129] Elimination of Variations in Primer Annealing Efficiency
[0130] Variations in primer length and sequence can also have a
large impact on the efficiency with which primers anneal to their
target and prime replication. In a typical multiplexed reaction in
which each product is amplified by a unique primer pair, the
relative quantities of amplified products may be significantly
altered from the relative quantities of targets due to difference
in annealing efficiencies. Embodiments of the methods of the
present invention that couple the use of target-specific primers
and universal primers eliminates this bias, producing amplification
products that accurately reflect relative mRNA levels.
[0131] Coupled Target-Specific and Universal Priming of the PCR
[0132] In the methods of the present invention, the amounts of each
designated target are amplified to improve the sensitivity and
dynamic range of the assay. In some embodiments to monitor gene
expression, cellular RNA is isolated and reverse transcribed to
obtain cDNA, which is then used as template for amplification. In
other embodiments, cDNA may be provided and used directly. The
primers described for use in the present invention can be used in
any one of a number of template-dependent processes that amplify
sequences of the target gene and/or its expressed transcripts
present in a given sample. Other types of templates may also be
used, such as tRNA, rRNA, or other transcription products, genomic
DNA, viral nucleic acids, and synthetic nucleic acid polymers.
Several methods described below are contemplated.
[0133] A preferred embodiment of the methods of the present
invention employs PCR, which is described in detail in U.S. Pat.
No. 4,683,195 (Mullis et al.), U.S. Pat. No. 4,683,202 (Mullis),
and U.S. Pat. No. 4,800,159 (Mullis et al.), and in PCR Protocols A
Guide to Methods and Applications (Innis et al., eds.) Academic
Press Inc. San Diego, Calif. (1990). PCR utilizes pairs of primers
having sequences complimentary to opposite strands of target
nucleic acids, and positioned such that the primers are converging.
The primers are incubated with template DNA under conditions that
permit selective hybridization. Primers may be provided in
double-stranded or single-stranded form, although the
single-stranded form is preferred. If the target gene(s) sequence
is present in a sample, the primers will hybridize to form a
nucleic-acid:primer complex. An excess of deoxynucleoside
triphosphates is added, along with a thermostable DNA polymerase,
e.g. Taq polymerase. If the target gene(s):primer complex has been
formed, the polymerase will extend the primer along the target
gene(s) sequence by adding nucleotides. After polymerization, the
newly-synthesized strand of DNA is dissociated from its
complimentary template strand by raising the temperature of the
reaction mixture. When the temperature is subsequently lowered, new
primers will bind to each of these two strands of DNA, and the
process is repeated. Multiple cycles of raising and lowering the
temperature are conducted, with a round of replication in each
cycle, until a sufficient amount of amplification product is
produced.
[0134] FIG. 2 illustrates the TSP-UP coupled priming strategy.
Heavier lines represent a DNA template; thinner lines depict the
oligonucleotide primers. Primer nomenclature is as described in the
legend to FIG. 1. The lower case "f" and "r" in the primer names
indicate a forward or reverse orientation. Lines "A," "B," "C," and
"D" represent unique nucleic acid sequences, and "A'," "B'," "C',"
and "D'" indicate their respective complementary sequences. "B" and
"C" sequences derive from the template; "A" and "D" sequences
derive from universal primer sequences. Arrowheads indicate
directionality. A vertical bar indicates an endpoint of the DNA
strand. The first set of reactions (first arrow) occur in the early
PCR cycles (for example, in only the first and second PCR cycles);
in these reaction, primarily the TSPs are used as primers, and the
resulting products will have UP sequences added to both ends,
flanking the amplified target sequence. The second set of reactions
(second, reiterative arrow) occur in all subsequent PCR cycles;
both TSP and UP primers are used, but the UPs dominate when present
in molar excess over the TSPs.
[0135] In early rounds of the amplification, replication is primed
primarily by the TSPs. The first round will add the universal
sequence to the 5' regions of the amplification products. The
second cycle will generate sequence complementary to the universal
sequence within the 3' region of the complementary strand, creating
a template that can be amplified by the universal primers alone.
Optionally, the reaction is designed to contain limiting amounts of
each of the TSPs and a molar excess of the UP, such that the UP
will generally prime replication once its complementary sequence
has been established in the template. The molar excess of UP over a
TSP can range from about 5:1 to about 100: 1; optionally, the
reaction utilizes approximately 10:1 molar excess of UP over the
amount of each TSP. Because all of the TSPs contain the same
universal sequence, the same universal primer will amplify all
targets in the multiplex, eliminating the quantitative variation
that results from amplification from different primers.
[0136] Amplification Methods
[0137] In a preferred embodiment of the methods of the present
invention, RNA is converted to cDNA using a target-specific primer
complementary to the RNA for each gene target being monitored in
the multiplex set in a reverse-transcription (RT) reaction. Methods
of reverse transcribing RNA into cDNA are well known, and described
in Sambrook, supra. Alternative methods for reverse transcription
utilize thermostable DNA polymerases, as described in the art. As
an exemplary embodiment, avian myeloblastosis virus reverse
transcriptase (AMV-RT), or Maloney murine leukemia virus reverse
transcriptase (MoMLV-RT) is used, although other enzymes are
contemplated. An advantage of using target-specific primers in the
RT reaction is that only the desired sequences are converted into a
PCR template. No superfluous primers or cDNA products are carried
into the subsequent PCR amplification.
[0138] In another embodiment of the amplifying step, RNA targets
are reverse transcribed using non-specific primers, such as an
anchored oligo-dT primer, or random sequence primers. An advantage
of this embodiment is that the "unfractionated" quality of the mRNA
sample is maintained because the sites of priming are non-specific,
i.e., the products of this RT reaction will serve as template for
any desired target in the subsequent PCR amplification. This allows
samples to be archived in the form of DNA, which is more stable
than RNA.
[0139] In other embodiments of the methods of the present
invention, transcription-based amplification systems (TAS) are
used, such as that first described by Kwoh et al. (Proc. Natl.
Acad. Sci. (1989) 86(4):1173-7), or isothermal transcription-based
systems such as 3SR (Self-Sustained Sequence Replication; Guatelli
et al. (1990) Proc. Natl. Acad. Sci. 87:1874-1878) or NASBA
(nucleic acid sequence based amplification; Kievits et al. (1991) J
Virol Methods. 35(3):273-86). In these methods, the mRNA target of
interest is copied into cDNA by a reverse transcriptase. The primer
for cDNA synthesis includes the promoter sequence of a designated
DNA-dependent RNA polymerase 5' to the primer's region of homology
with the template. The resulting cDNA products can then serve as
templates for multiple rounds of transcription by the appropriate
RNA polymerase. Transcription of the cDNA template rapidly
amplifies the signal from the original target mRNA. The isothermal
reactions bypass the need for denaturing cDNA strands from their
RNA templates by including RNAse H to degrade RNA hybridized to
DNA.
[0140] In other embodiments, amplification is accomplished by used
of the ligase chain reaction (LCR), disclosed in European Patent
Application No. 320,308 (Backman and Wang), or by the ligase
detection reaction (LDR), disclosed in U.S. Pat. No. 4,883,750
(Whiteley et al.). In LCR, two probe pairs are prepared, which are
complimentary each other, and to adjacent sequences on both strands
of the target. Each pair will bind to opposite strands of the
target such that they abut. Each of the two probe pairs can then be
linked to form a single unit, using a thermostable ligase. By
temperature cycling, as in PCR, bound ligated units dissociate from
the target, then both molecules can serve as "target sequences" for
ligation of excess probe pairs, providing for an exponential
amplification. The LDR is very similar to LCR. In this variation,
oligonucleotides complimentary to only one strand of the target are
used, resulting in a linear amplification of ligation products,
since only the original target DNA can serve as a hybridization
template. It is used following a PCR amplification of the target in
order to increase signal.
[0141] In further embodiments, several methods generally known in
the art would be suitable methods of amplification. Some additional
examples include, but are not limited to, strand displacement
amplification (Walker et al. (1992) Nucleic Acids Res.
20:1691-1696), repair chain reaction (REF), cyclic probe reaction
(REF), solid-phase amplification, including bridge amplification
(Mehta and Singh (1999) BioTechniques 26(6): 1082-1086), rolling
circle amplification (Kool, U.S. Pat. No. 5,714,320), rapid
amplification of cDNA ends (Frohman (1988) Proc. Natl. Acad. Sci.
85: 8998-9002), and the "invader assay" (Griffin et al. (1999)
Proc. Natl. Acad. Sci. 96: 6301-6306).
[0142] Attenuation of Strong Signals
[0143] The set of targets included in a multiplex reaction
generally all yield signal strengths within the dynamic range of
the detection platform used in order for quantitation of gene
expression to be accurate. In some embodiments, it may be desirable
or necessary to include a very highly expressed gene in a multiplex
assay. However, the highly-expressed gene can impact the accuracy
of quantitation for other genes expressed at very low levels if its
signal is not attenuated. The methods of the current invention
provide ways for attenuating the signals of relatively abundant
targets during the amplification reaction such that they can be
included in a multiplexed set without impacting the accuracy of
quantitation of that set.
[0144] Toward this end, amplification primers are optionally used
that block polymerase extension of the 3' end of the primer. One
preferred embodiment is modification of the 3'-hydroxyl of the
oligonucleotide primer by addition of a phosphate group. Another
preferred embodiment is attachment of the terminal nucleotide via a
3'-3' linkage. One skilled in the art can conceive of other
chemical structures or modifications that can be used for this
purpose. The modified and the corresponding unmodified primer for
the highly abundant target are mixed in a ratio empirically
determined to reduce that target's signal, such that it falls
within the dynamic range of other targets of the multiplex.
Preferably, the reverse target-specific primer is modified, thereby
attenuating signal by reduction of the amount of template created
in the reverse transcriptase reaction.
[0145] Another embodiment for signal attenuation entails use of a
target-specific primer that contains the target-specific sequence,
but no universal primer sequence. This abbreviated primer (sans
universal sequence) and the corresponding primer containing the
universal sequence within the 5' region are mixed in a ratio
empirically determined to reduce that target's signal, such that it
then falls within the dynamic range of other targets of the
multiplex system.
[0146] Multiplex Amplification Strategies
[0147] An important embodiment of the methods of the present
invention involves the use of various PCR multiplexing strategies
that are made possible by the combined use of target-specific and
universal primers. An illustration of the fundamental multiplexed
reaction is shown in FIG. 3.
[0148] The numbers 1 through 6 on the left represent six different
reactions occurring simultaneously in a single mixture. Column A
represents the six target sequences of the multiplex. Column B
depicts the templates and primers in the PCR amplification. Lines
shown as parallel and having opposite directionality represent
complementary sequences. The templates are initially
single-stranded mRNA molecules, but eventually are predominantly
DNA amplification products that serve as template in subsequent
cycles. Messenger RNA is converted to cDNA by the action of reverse
transcriptase polymerization from the target-specific reverse
primers (TSPr1-6) for each of the six targets. The six
target-specific forward primers (TSPf1-6) and the universal forward
and reverse primers (UPf1-6, UPr1-6) are added along with a
thermostable polymerase to generate the second strand of cDNA,
followed by PCR amplification. The drawings in Column B show
single-stranded templates with the TSPs aligned (depicted as
parallel) at their sites of hybridization. The UP can anneal to
target DNA only after its complementary universal sequence is added
to the opposite strand through replication across the 5' region of
the TSP. Column C shows the products of PCR amplification. Products
contain the target sequences (TS1-6) that were the targets of
amplification, flanked by the universal primer sequences (UP) that
were added to the ends of the target sequences by the
target-specific primers. The TSPf and TSPr primers are specific, so
by definition they will all be unique. However, the two universal
primers may be the same sequence as each other or different
sequences, i.e., the UPf may be the same sequence as the UPr.
Furthermore, subsets of target sequences in the multiplex set may
be amplified by different UPs, i.e., the UPf1-6 primers and/or
UPr1-6 primers may be of one or multiple sequences.
[0149] All of these examples are variations on the fundamental
RT-PCR assay shown in FIG. 3. For the sake of simplicity, only
strategies using fluorescent dyes are illustrated, although many of
the other labeling strategies previously discussed could be
applied.
[0150] Data Collection
[0151] The number of species than can be detected within a mixture
depends primarily on the resolution capabilities of the separation
platform used, and the detection methodology employed. A preferred
embodiment of the separation step of the methods of the present
invention is based upon size-based separation technologies. Once
separated, individual species are detected and quantitated by
either inherent physical characteristics of the molecules
themselves, or detection of a label associated with the DNA.
[0152] Embodiments employing other separation methods are also
described. For example, certain types of labels allow resolution of
two species of the same mass through deconvolution of the data.
Non-size based differentiation methods (such as deconvolution of
data from overlapping signals generated by two different
fluorophores) allow pooling of a plurality of multiplexed reactions
to further increase throughput.
[0153] Optionally, the throughput rate for the detection step is
between about 100 and 5000 samples per hour, preferably between
about 250 and 2500 samples, and more preferably about 1000 samples
per hour per separation system (i.e., one mass spectrometer, one
lane of a gel, or one capillary of a capillary electrophoresis
device). In order to further reduce assay costs and increase the
throughput of the overall process, sample-handling is optionally
conducted in a miniaturized format. For the methods of the present
invention, miniaturized formats are those conducted at
submicroliter volumes, including both microfluidic and nanofluidic
platforms. Any or all of the amplification, separation, and/or
detection steps of the present can utilize miniaturized formats and
platforms. For example, many of the modes of separation described
below are presently available in a miniaturized scale.
[0154] Separation Methods
[0155] Preferred embodiments of the present invention incorporate a
step of separating the products of a reaction based on their size
differences. The PCR products generated during the multiplex
amplification optionally range from about 50 to about 500 bases in
length, which can be resolve from one another by size. Any one of
several devices may be used for size separation, including mass
spectrometry, any of several electrophoretic devices, including
capillary, polyacrylamide gel, or agarose gel electrophoresis, or
any of several chromatographic devices, including column
chromatography, HPLC, or FPLC.
[0156] One preferred embodiment for sample analysis is mass
spectrometry. Several modes of separation that determine mass are
possible, including Time-of-Flight (TOF), Fourier Transform Mass
Spectrometry (FFMS), and quadruple mass spectrometry. Possible
methods of ionization include Matrix-Assisted Laser Desorption and
Ionization (MALDI) or Electrospray Ionization (ESI). A preferred
embodiment for the uses described in this invention is MALDI-TOF
(Wu, et al. (1993) Rapid Communications in Mass Spectrometry 7:
142-146). This method may be used to provide unfragmented mass
spectra of mixed-base oligonucleotides containing between about 1
and about 1000 bases. In preparing the sample for analysis, the
analyte is mixed into a matrix of molecules that resonantly absorb
light at a specified wavelength. Pulsed laser light is then used to
desorb oligonucleotide molecules out of the absorbing solid matrix,
creating free, charged oligomers and minimizing fragmentation. The
preferred solid matrix material for this purpose is
3-hydroxypicolinic acid (Wu, supra), although others are
contemplated.
[0157] In another preferred embodiment, the device of the invention
is a microcapillary for analysis of nucleic acids obtained from the
sample. Microcapillary electrophoresis generally involves the use
of a thin capillary or channel, which may optionally be filled with
a particular medium to improve separation, and employs an electric
field to separate components of the mixture as the sample travels
through the capillary. Samples composed of linear polymers of a
fixed charge-to-mass ratio, such as DNA, will separate based on
size. The high surface to volume ratio of these capillaries allows
application of very high electric fields across the capillary
without substantial thermal variation, consequently allowing very
rapid separations. When combined with confocal imaging methods,
these methods provide sensitivity in the range of attomoles,
comparable to the sensitivity of radioactive sequencing methods.
The use of microcapillary electrophoresis in size separation of
nucleic acids has been reported in Woolley and Mathies (Proc. Natl.
Acad. Sci. USA (1994) 91:11348-11352).
[0158] Capillaries are optionally fabricated from fused silica, or
etched, machined, or molded into planar substrates. In many
microcapillary electrophoresis methods, the capillaries are filled
with an appropriate separation/sieving matrix. Several sieving
matrices are known in the art that may be used for this
application, including, e.g., hydroxyethyl cellulose,
polyacrylamide, agarose, and the like. Generally, the specific gel
matrix, running buffers and running conditions are selected to
obtain the separation required for a particular application.
Factors that are considered include, e.g., sizes of the nucleic
acid fragments, level of resolution, or the presence of undenatured
nucleic acid molecules. For example, running buffers may include
agents such as urea to denature double-stranded nucleic acids in a
sample.
[0159] Microfluidic systems for separating molecules such as DNA
and RNA are commercially available and are optionally employed in
the methods of the present invention. For example, the "Personal
Laboratory System" and the "High Throughput System" have been
developed by Caliper Technologies, Corp. (Mountain View, Calif.).
The Agilent 2100, which uses Caliper Technologies' LabChip.TM.
microfluidic systems, is available from Agilent Technologies (Palo
Alto, Calif.). Currently, specialized microfluidic devices which
provide for rapid separation and analysis of both DNA and RNA are
available from Caliper Technologies for the Agilent 2100. See,
e.g., http://www.calipertech.com.
[0160] Other embodiments are generally known in the art for
separating PCR amplification products by electrophoresis through
gel matrices. Examples include polyacrylamide, agarose-acrylamide,
or agarose gel electrophoresis, using standard methods (Sambrook,
supra).
[0161] Alternatively, chromatographic techniques may be employed
for resolving amplification products. Many types of physical or
chemical characteristics may be used to effect chromatographic
separation in the present invention, including adsorption,
partitioning (such as reverse phase), ion-exchange, and size
exclusion. Many specialized techniques have been developed for
their application including methods utilizing liquid chromatography
or HPLC (Katz and Dong (1990) BioTechniques 8(5):546-55; Gaus et
al. (1993) J. Immunol. Methods 158:229-236).
[0162] In yet another embodiment of the separation step of the
present invention, cDNA products are captured by their affinity for
certain substrates, or other incorporated binding properties. For
example, labeled cDNA products such as biotin or antigen can be
captured with beads bearing avidin or antibody, respectively.
Affinity capture is utilized on a solid support to enable physical
separation. Many types of solid supports are known in the art that
would be applicable to the present invention. Examples include
beads (e.g. solid, porous, magnetic), surfaces (e.g. plates,
dishes, wells, flasks, dipsticks, membranes), or chromatographic
materials (e.g. fibers, gels, screens).
[0163] Certain separation embodiments entail the use of
microfluidic techniques. Technologies include separation on a
microcapillary platform, such as designed by ACLARA BioSciences
Inc. (Mountain View, Calif.), or the LabChip.TM. microfluidic
devices made by Caliper Technologies Inc. Another recent technology
developed by Nanogen, Inc. (San Diego, Calif.), utilizes
microelectronics to move and concentrate biological molecules on a
semiconductor microchip. The microfluidics platforms developed at
Orchid Biosciences, Inc. (Princeton, N.J.), including the
Chemtel.TM. Chip which provides for parallel processing of hundreds
of reactions, can be used in the present invention. These
microfluidic platforms require only nanoliter sample volumes, in
contrast to the microliter volumes required by other conventional
separation technologies.
[0164] Fabrication of microfluidic devices, including
microcapillary electrophoretic devices, has been discussed in
detail, e.g., Regnier et al. (Trends Biotechnol. (1999)
17(3):101-6), Deyl et al. (Forensic Sci. Int. (1998) 92:89-124),
Effenhauser et al. (Electrophoresis (1997) 18:2203-2213), and U.S.
Pat. No. 5,904,824 (Oh). Typically, the methods make use of
photolithographic etching of micron-scale channels on a silica,
silicon, or other crystalline substrate or chip. In some
embodiments, capillary arrays may be fabricated using polymeric
materials with injection-molding techniques. These methods can be
readily adapted for use in miniaturized devices of the present
invention.
[0165] Some of the processes usually involved in genetic analysis
have been miniaturized using microfluidic devices. For example, PCT
publication WO 94/05414 reports an integrated micro-PCR apparatus
for collection and amplification of nucleic acids from a specimen.
U.S. Pat. No. 5,304,487 (Wilding et al.) and U.S. Pat. No.
5,296,375 (Kricka et al.) discuss devices for collection and
analysis of cell-containing samples. U.S. Pat. No. 5,856,174
(Lipshutz et al.) describes an apparatus that combines the various
processing and analytical operations involved in nucleic acid
analysis.
[0166] Additional technologies are also contemplated. For example,
Kasianowicz et al. (Proc. Natl. Acad. Sci. USA (1996)
93:13770-13773) describe the use of ion channel pores in a lipid
bilayer membrane for determining the length of polynucleotides. In
this system, an electric field is generated by the passage of ions
through the pores. Polynucleotide lengths are measured as a
transient decrease of ionic current due to blockage of ions passing
through the pores by the nucleic acid. The duration of the current
decrease was shown to be proportional to polymer length. Such a
system can be applied as a size separation platform in the present
invention.
[0167] The target-specific primers and universal primers of the
present invention are useful both as reagents for hybridization in
solution, such as priming PCR amplification, as well as for
embodiments employing a solid phase, such as microarrays. With
microarrays, sample nucleic acids such as mRNA or DNA are fixed on
a selected matrix or surface. PCR products may be attached to the
solid surface via one of the amplification primers, then denatured
to provide single-stranded DNA. This-spatially-partitioned,
single-stranded nucleic acid is then subject to hybridization with
selected probes under conditions that allow a quantitative
determination of target abundance. In this embodiment,
amplification products from each individual multiplexed reaction
are not physically separated, but are differentiated by hybridizing
with a set of probes that are differentially labeled.
Alternatively, unextended amplification primers may be physically
immobilized at discreet positions on the solid support, then
hybridized with the products of a multiplexed PCR amplification for
quantitation of distinct species within the sample. In this
embodiment, amplification products are separated by way of
hybridization with probes that are spatially separated on the solid
support.
[0168] Separation platforms may optionally be coupled to utilize
two different separation methodologies, thereby increasing the
multiplexing capacity of reactions beyond that which can be
obtained by separation in a single dimension. For example, some of
the RT-PCR primers of a multiplex reaction may be coupled with a
moiety that allows affinity capture, while other primers remain
unmodified. Samples are then passed through an affinity
chromatography column to separate PCR products arising from these
two classes of primers. Flow-through fractions are collected and
the bound fraction eluted. Each fraction may then be further
separated based on other criteria, such as size, to identify
individual components.
[0169] The invention also includes rapid analytical method using
one or more microfluidic handling systems. For example, a subset of
primers in a multiplex reaction would contain a hydrophobic group.
Separation is then performed in two dimensions, with hydrophilic
partitioning in one direction, followed by size separation in the
second direction. The use of a combination of dyes can further
increase the multiplex size.
[0170] Detection Methods
[0171] Following separation of the different products of the
multiplex, one or more of the member species is detected and/or
quantitated. Some embodiments of the methods of the present
invention enable direct detection of products. Other embodiments
detect reaction products via a label associated with one or more of
the amplification primers. Many types of labels suitable for use in
the present invention are known in the art, including
chemiluminescent, isotopic, fluorescent, electrochemical, inferred,
or mass labels, or enzyme tags. In further embodiments, separation
and detection may be a multi-step process in which samples are
fractionated according to more than one property of the products,
and detected one or more stages during the separation process.
[0172] One embodiment of the invention requiring no labeling or
modification of the molecules being analyzed is detection of the
mass-to-charge ratio of the molecule itself. This detection
technique is optionally used when the separation platform is a mass
spectrometer. An embodiment for increasing resolution and
throughput with mass detection is in mass-modifying the
amplification products. Nucleic acids can be mass-modified through
either the amplification primer or the chain-elongating nucleoside
triphosphates. Alternatively, the product mass can be shifted
without modification of the individual nucleic acid components, by
instead varying the number of bases in the primers. Several types
of moieties have been shown to be compatible with analysis by mass
spectrometry, including polyethylene glycol, halogens, alkyl, aryl,
or aralkyl moieties, peptides (described in, for example, U.S. Pat.
No. 5,691,141). Isotopic variants of specified atoms, such as
radioisotopes or stable, higher mass isotopes, are also used to
vary the mass of the amplification product. Radioisotopes can be
detected based on the energy released when they decay, and numerous
applications of their use are generally known in the art. Stable
(non-decaying) heavy isotopes can be detected based on the
resulting shift in mass, and are useful for distinguishing between
two amplification products that would otherwise have similar or
equal masses. Other embodiments of detection that make use of
inherent properties of the molecule being analyzed include
ultraviolet light absorption (UV) or electrochemical detection.
Electrochemical detection is based on oxidation or reduction of a
chemical compound to which a voltage has been applied. Electrons
are either donated (oxidation) or accepted (reduction), which can
be monitored as current. For both UV absorption and electrochemical
detection, sensitivity for each individual nucleotide varies
depending on the component base, but with molecules of sufficient
length this bias is insignificant, and detection levels can be
taken as a direct reflection of overall nucleic acid content.
[0173] Several embodiments of the detecting step of the present
invention are designed to identify molecules indirectly by
detection of an associated label. A number of labels may be
employed that provide a fluorescent signal for detection (see, for
example, www.probes.com). If a sufficient quantity of a given
species is generated in a reaction, and the mode of detection has
sufficient sensitivity, then some fluorescent molecules may be
incorporated into one or more of the primers used for
amplification, generating a signal strength proportional to the
concentration of DNA molecules. Several fluorescent moieties,
including Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY
650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX,
carboxyfluorescein, Cascade Blue, Cy3, Cy5, 6-FAM, Fluorescein,
HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514,
Pacific Blue, REG, Rhodamine Green, Rhodarmine Red, ROX, TAMRA,
TET, Tetramethylrhodamine, and Texas Red, are generally known in
the art and routinely used for identification of discreet nucleic
acid species, such as in sequencing reactions. Many of these dyes
have emission spectra distinct from one another, enabling
deconvolution of data from incompletely resolved samples into
individual signals. This allows pooling of separate reactions that
are each labeled with a different dye, increasing the throughput
during analysis, as described in more detail below.
[0174] The signal strength obtained from fluorescent dyes can be
enhanced through use of related compounds called energy transfer
(ET) fluorescent dyes. After absorbing light, ET dyes have emission
spectra that allow them to serve as "donors" to a secondary
"acceptor" dye that will absorb the emitted light and emit a lower
energy fluorescent signal. Use of these coupled-dye systems can
significantly amplify fluorescent signal. Examples of ET dyes
include the ABI PRISM BigDye terminators, recently commercialized
by Perkin-Elmer Corporation (Foster City, Calif.) for applications
in nucleic acid analysis. These chromaphores incorporate the donor
and acceptor dyes into a single molecule and an energy transfer
linker couples a donor fluorescein to a dichlororhodamine acceptor
dye, and the complex is attached to a DNA replication primer.
[0175] Fluorescent signals can also be generated by non-covalent
intercalation of fluorescent dyes into nucleic acids after their
synthesis and prior to separation. This type of signal will vary in
intensity as a function of the length of the species being
detected, and thus signal intensities must be normalized based on
size. Several applicable dyes are known in the art, including, but
not limited to, ethidium bromide and Vistra Green. Some
intercalating dyes, such as YOYO or TOTO, bind so strongly that
separate DNA molecules can each be bound with a different dye and
then pooled, and the dyes will not exchange between DNA species.
This enables mixing separately generated reactions in order to
increase multiplexing during analysis.
[0176] Alternatively, technologies such as the use of nanocrystals
as a fluorescent DNA label (Alivisatos, et al. (1996) Nature
382:609-11) can be employed in the methods of the present
invention. Another method, described by Mazumder, et al. (Nucleic
Acids Res. (1998) 26:1996-2000), describes hybridization of a
labeled oligonucleotide probe to its target without physical
separation from unhybridized probe. In this method, the probe is
labeled with a chemiluminescent molecule that in the unbound form
is destroyed by sodium sulfite treatment, but is protected in
probes that have hybridized to target sequence.
[0177] In another embodiment, products may be detected and
quantitated by monitoring a set of mass labels, each of which are
specifically associated with one species of amplification reaction.
The labels are released by either chemical or enzymatic mechanisms
after the amplification reaction. Release is followed by size
separation of the mixture of labels to quantitate the amount of
each species of the amplification reaction. Separation methods that
can be employed include mass spectrometry, capillary
electrophoresis, or HPLC. Such strategies, and their applications
for detection of nucleic acids, have been described in, for
example, U.S. Pat. No. 6,104,028 (Hunter et al.) and U.S. Pat. No.
6,051,378 (Monforte et al.), as well as PCT publications WO
98/26095 (Monforte et al.) and WO 97/27327 (Van Ness et al.).
[0178] In further embodiments, both electrochemical and infrared
methods of detection can be amplified over the levels inherent to
nucleic acid molecules through attachment of EC or IR labels. Their
characteristics and use as labels are described in, for example,
PCT publication WO 97/27327. Some preferred compounds that can
serve as an IR label include an aromatic nitrile, aromatic alkynes,
or aromatic azides. Numerous compounds can serve as an EC label;
many are listed in PCT publication WO 97/27327.
[0179] Enzyme-linked reactions are also employed in the detecting
step of the methods of the present invention. Enzyme-linked
reactions theoretically yield an infinite signal, due to
amplification of the signal by enzymatic activity. In this
embodiment, an enzyme is linked to a secondary group that has a
strong binding affinity to the molecule of interest. Following
separation of the nucleic acid products, enzyme is bound via this
affinity interaction. Nucleic acids are then detected by a chemical
reaction catalyzed by the associated enzyme. Various coupling
strategies are possible utilizing well-characterized interactions
generally known in the art, such as those between biotin and
avidin, an antibody and antigen, or a sugar and lectin. Various
types of enzymes can be employed, generating colorimetric,
fluorescent, chemiluminescent, phosphorescent, or other types of
signals. As an illustration, a PCR primer may be synthesized
containing a biotin molecule. After PCR amplification, DNA products
are separated by size, and those made with the biotinylated primer
are detected by binding with streptavidin that is covalently
coupled to an enzyme, such as alkaline phosphatase. A subsequent
chemical reaction is conducted, detecting bound enzyme by
monitoring the reaction product. The secondary affinity group may
also be coupled to an enzymatic substrate, which is detected by
incubation with unbound enzyme. One of skill in the art can
conceive of many possible variations on the different embodiments
of detection methods described above.
[0180] In some embodiments, it may be desirable prior to detection
to separate a subset of amplification products from other
components in the reaction, including other products. Exploitation
of known high-affinity biological interactions can provide a
mechanism for physical capture. In some embodiments of this
process, the 5' region of one of the universal primers contains a
binding moiety that allows capture of the products of that primer.
Some examples of high-affinity interactions include those between a
hormone with its receptor, a sugar with a lectin, avidin and
biotin, or an antigen with its antibody. After affinity capture,
molecules are retrieved by cleavage, denaturation, or eluting with
a competitor for binding, and then detected as usual by monitoring
an associated label. In some embodiments, the binding interaction
providing for capture may also serve as the mechanism of
detection.
[0181] Furthermore, the size of an amplification product or
products are optionally changed, or "shifted," in order to better
resolve the amplification products from other products prior to
detection. For example, chemically cleavable primers can be used in
the amplification reaction. In this embodiment, one or more of the
primers used in amplification contains a chemical linkage that can
be broken, generating two separate fragments from the primer.
Cleavage is performed after the amplification reaction, removing a
fixed number of nucleotides from the 5' end of products made from
that primer. Design and use of such primers is described in detail
in, for example, PCT publication WO 96/37630.
[0182] One preferred embodiment of the methods of the present
invention is the generation of gene expression profiles. However,
several other applications are also possible, as would be apparent
to one skilled in the art from a reading of this disclosure. For
example, the methods of the present invention can be used to
investigate the profile and expression levels of one or more
members of complex gene families. As an illustration, cytochrome
P-450 isozymes form a complex set of closely related enzymes that
are involved in detoxification of foreign substances in the liver.
The various isozymes in this family have been shown to be specific
for different substrates. Design of target-specific primers that
anneal to variant regions in the genes provides an assay by which
their relative levels of induction in response to drug treatments
can be monitored. Other examples include monitoring expression
levels of alleles with allele-specific primers, or monitoring mRNA
processing with primers that specifically hybridize to a spliced or
unspliced region, or to splice variants. One skilled in the art
could envision other applications of the present invention that
would provide a method to monitor genetic variations or expression
mechanisms.
[0183] Systems for Gene Expression Analysis
[0184] The present invention also provides systems for analyzing
gene expression. The elements of the system include, but are not
limited to, an amplification module for producing a plurality of
amplification products from a pool of target sequences; a detection
module for detecting one or more members of the plurality of
amplification products and generating a set of gene expression
data; and an analyzing module for organizing and/or analyzing the
data points in the data set. Any or all of these modules can
comprise high throughput technologies and/or systems.
[0185] The amplification module of the system of the present
invention produces a plurality of amplification products from a
pool of target sequences. The amplification module includes at
least one pair of universal primers and at least one pair of
target-specific primers for use in the amplification process.
Optionally, the amplification module includes a unique pair of
universal primers for each target sequence. Furthermore, the
amplification module can include components to perform one or more
of the following reactions: a polymerase chain reaction, a
transcription-based amplification, a self-sustained sequence
replication, a nucleic acid sequence based amplification, a ligase
chain reaction, a ligase detection reaction, a strand displacement
amplification, a repair chain reaction, a cyclic probe reaction, a
rapid amplification of cDNA ends, an invader assay, a bridge
amplification, a rolling circle amplification, solution phase
and/or solid phase amplifications, and the like.
[0186] The detection module detects the presence, absence, or
quantity of one or more members of the plurality of amplification
products. Additionally, the detection module generates a set of
gene expression data, generally in the form of a plurality of data
points. The detection module optionally further comprises a
separation module for separation of one or more members of the
multiplexed reaction prior to, or during, operation of the
detection module. The detection module, or the optional separation
module, can include systems for implementing separation of the
amplification products; exemplary detection modules include, but
are not limited to, mass spectrometry instrumentation and
electrophoretic devices.
[0187] The third component of the system of the present invention,
the analyzing module, is in operational communication with the
detection module. The analyzing module of the system includes,
e.g., a computer or computer-readable medium having one or more one
or more logical instructions for analyzing the plurality of data
points generated by the detection system. The analyzing system
optionally comprises multiple logical instructions; for example,
the logical instructions can include one or more instructions which
organize the plurality of data points into a database and one or
more instructions which analyze the plurality of data points. The
instructions can include software for performing difference
analysis upon the plurality of data points. Additionally (or
alternatively), the instructions can include or be embodied in
software for generating a graphical representation of the plurality
of data points. Optionally, the instructions can be embodied in
system software which performs combinatorial analysis on the
plurality of data points.
[0188] The computer employed in the analyzing module of the present
invention can be, e.g., a PC (Intel x86 or Pentium chip-compatible
DOS.TM., OS2.TM. WINDOWS.TM. WINDOWS NT.TM., WINDOWS95.TM.,
WINDOWS98.TM., or WINDOWS ME.TM.), a LINUX based machine, a
MACINTOSH.TM., Power PC, or a UNIX based machine (e.g., SUN.TM.
work station) or other commercially common computer which is known
to one of skill. Software for computational analysis is available,
or can easily be constructed by one of skill using a standard
programming language such as VisualBasic, Fortran, Basic, C, C++,
Java, or the like. Standard desktop applications such as word
processing software (e.g., Microsoft Word.TM. or Corel
WordPerfect.TM.) and database software (e.g., spreadsheet software
such as Microsoft Excel.TM., Corel Quattro Pro.TM., or database
programs such as Microsoft Access.TM. or Paradox.TM.) can also be
used in the analyzing system of the present invention.
[0189] The computer optionally includes a monitor that is often a
cathode ray tube ("CRT") display, a flat panel display (e.g.,
active matrix liquid crystal display, liquid crystal display), or
others. Computer circuitry is often placed in a box that includes
numerous integrated circuit chips, such as a microprocessor,
memory, interface circuits, and others. The box also optionally
includes a hard disk drive, a floppy disk drive, a high capacity
removable drive such as a writeable CD-ROM, and other common
peripheral elements. Inputting devices such as a keyboard or mouse
optionally provide for input from a user and for user selection of
sequences to be compared or otherwise manipulated in the relevant
computer system.
[0190] The computer typically includes appropriate software for
receiving user instructions, either in the form of user input into
a set parameter fields, e.g., in a GUI, or in the form of
preprogrammed instructions, e.g., preprogrammed for a variety of
different specific operations. The software then converts these
instructions to appropriate language for instructing the operation
of the fluid direction and transport controller to carry out the
desired operation.
[0191] The software can also include output elements for displaying
and/or further analyzing raw data, massaged data, or proposed
results from one or more computational processes involved in the
analysis of the gene expression data set.
[0192] Kits
[0193] In an additional aspect, the present invention provides kits
embodying the methods, compositions, and systems for analysis of
gene expression as described herein. Kits of the present invention
optionally comprise one or more of the following, preferably in a
spatially separate arrangement: a) at least one pair of universal
primers; b) at least one pair of target-specific primers; c) at
least one pair of reference gene-specific primers; and d) one or
more amplification reaction enzymes, reagents, or buffers.
Optionally, the universal primers provided in the kit include
labeled primers, such as those described in the present application
and the references cited herein. The target-specific primers can
vary from kit to kit, depending upon the specified target gene(s)
to be investigated. Exemplary reference gene-specific primers
(e.g., target-specific primers for directing transcription of one
or more reference genes) include, but are not limited to, primers
for .beta.-actin, cyclophilin, GAPDH, and various rRNA
molecules.
[0194] The kits of the invention optionally include one or more
preselected primer sets that are specific for the genes to be
amplified. The preselected primer sets optionally comprise one or
more labeled nucleic acid primers, contained in suitable
receptacles or containers. Exemplary labels include, but are not
limited to, a fluorophore, a dye, a radiolabel, an enzyme tag,
etc., that is linked to a nucleic acid primer itself.
[0195] In one embodiment, kits that are suitable for use in PCR are
provided. In PCR kits, target-specific and universal primers are
provided which include sequences that have sequences from, and
hybridize to spatially distinct regions of one or more target
genes. Optionally, pairs of target-specific primers are provided.
Generally, the target-specific primers are composed of at least two
parts: a universal sequence within the 5' portion that is
complementary to a universal primer sequence, and a sequence within
the 3' portion (and optionally, proximal to the universal sequence)
for recognition of a target gene. In some embodiments of the
invention, the set of targets monitored in an analysis may be
specified by a client for use in a proprietary testing or screening
application. In an alternate embodiment, standardized target sets
may be developed for general applications, and constitute
components of the kits described below. Kits of either of these
embodiment can be used to amplify all genes, unknown and/or known,
that respond to certain treatments or stimuli.
[0196] In addition, one or more materials and/or reagents required
for preparing a biological sample for gene expression analysis are
optionally included in the kit. Furthermore, optionally included in
the kits are one or more enzymes suitable for amplifying nucleic
acids, including various polymerases (RT, Taq, etc.), one or more
deoxynucleotides, and buffers to provide the necessary reaction
mixture for amplification.
[0197] In one preferred embodiment of the invention, the kits are
employed for analyzing gene expression patterns using mRNA as the
starting template. The mRNA template may be presented as either
total cellular RNA or isolated mRNA; both types of sample yield
comparable results. In other embodiments, the methods and kits
described in the present invention allow quantitation of other
products of gene expression, including tRNA, rRNA, or other
transcription products. In still further embodiments, other types
of nucleic acids may serve as template in the assay, including
genomic or extragenomic DNA, viral RNA or DNA, or nucleic acid
polymers generated by non-replicative or artificial mechanism,
including PNA or RNA/DNA copolymers.
[0198] Optionally, the kits of the present invention further
include software to expedite the generation, analysis and/or
storage of data, and to facilitate access to databases. The
software includes logical instructions, instructions sets, or
suitable computer programs that can be used in the collection,
storage and/or analysis of the data. Comparative and relational
analysis of the data is possible using the software provided.
[0199] The kits optionally comprise distinct containers for each
individual reagent and enzyme, as well as for each probe or primer
pair. Each component will generally be suitable as aliquoted in its
respective container. The container of the kits optionally includes
at least one vial, ampule, or test tube. Flasks, bottles and other
container mechanisms into which the reagents can be placed and/or
aliquoted are also possible. The individual containers of the kit
are preferably maintained in close confinement for commercial sale.
Suitable larger containers may include injection or blow-molded
plastic containers into which the desired vials are retained.
Instructions, such as written directions or videotaped
demonstrations detailing the use of the kits of the present
invention, are optionally provided with the kit.
[0200] In a further aspect, the present invention provides for the
use of any composition or kit herein, for the practice of any
method or assay herein, and/or for the use of any apparatus or kit
to practice any assay or method herein.
EXAMPLES
[0201] The methods of the present invention are particularly suited
for analyzing gene expression patterns. The present invention
provides methods for the rapid generation of a differential
expression profile of a defined set of genes through comparison of
data from multiple reactions. Multiple differential expression
profiles can be used for comparison of different cell types, or of
a single cell type exposed to different environmental conditions,
or in various developmental or disease states. The methods of the
present invention provide a way to generate large bodies of
differential expression data, which can be used for modeling a
matrix of gene product interactions for whole cells. Relational
analysis is used with large and complex sets of gene expression
profiles, and is of valuable for identification of potential
therapeutic targets, screening of candidate drugs, diagnostics, and
other potential uses.
[0202] The methods of the present invention can also be suitably
modified for the analysis of other biological processes, including,
but not limited to, genotyping, mapping, mutation analysis,
forensics, or analysis of other RNA molecules such as tRNAs, rRNAs,
or hnRNAs.
[0203] The following examples are included to demonstrate various
embodiments of the present invention. It will be appreciated by
those of skill in the art that the techniques disclosed in the
examples which follow represent techniques determined by the
inventor to function well in the practice of the invention, and
thus can be considered to constitute preferred modes for its
practice. However, those of skill in the art should, in light of
the present disclosure, appreciate that many changes can be made in
the specific embodiments which are disclosed and still obtain a
like or similar result without departing from the spirit and scope
of the invention.
Example 1
Cell Culture and Chemical Exposure
[0204] The hepatocyte cell line, Hep G2 (human hepatocellular
carcinoma, obtained from the American Type Culture Collection,
Rockville Md., ATCC#HB-8065), was used to evaluate the effects of
various chemicals on expression of a set of genes known to be
involved in cellular toxicological responses. The cells were
routinely maintained in T75 flasks in Eagle's MEM medium (with
non-essential amino acids, sodium pyruvate, and Earle's salts) and
10% fetal bovine serum at 37.degree. C. in a humidified atmosphere
of 5% CO2. The chemicals used in exposure experiments included
cadmium chloride (CdCl2) and methyl methane sulfonate (MMS). CdCl2
is a strong inducer of metallothionein, a metal-binding protein,
and is known to be carcinogenic and capable of interfering with DNA
repair. MMS is an alkylating agent that induces DNA damage.
Dilutions of these compounds were prepared from concentrated stocks
obtained from Aldrich Chemical Company (Milwaukee, Wis.). Water was
used as the solvent control in dosing studies. Approximately 0.02
mL of a dilution of each toxin was added to 2 mL of culture medium,
with final concentrations ranging from 10-4M to 10-6M CdCl2 and
from 0.5 mM to 2 mM MMS. These concentration ranges were
empirically determined to not be lethal to cells for the duration
of the exposure period. To perform exposures, cells were
trypsinized and transferred to twelve-well dishes, seeding each
well at a density of 1.times.104 cells/well. After 4 days of
recovery and growth, cells were exposed to the designated toxin for
3 hours. Medium was then removed and cells immediately lysed. Cell
number was quantitated using a dye incorporation assay, CyQUANT
from Molecular Probes (Eugene, Oreg.).
Example 2
RNA Isolation
[0205] Total RNA was purified from crude cell lysates using
Rneasy.RTM. total RNA purification kits from Qiagen Inc. (Valencia,
Calif.), in an automation-compatible, 96-well format. In order to
monitor recovery and stability of RNA from cell cultures, two
purified RNA samples (Kanamycin Positive Control RNA from Promega
(Madison, Wis.), and 7.5 kb Poly(A)-Tailed RNA from Life
Technologies (Rockville, Md.)) were added with the lysis reagents.
After the cellular treatments were complete, growth medium was
removed and cells were lysed under denaturing conditions with RLT
buffer (Qiagen, Valencia, Calif.) containing guanidine
isothiocyanate and beta-mercapto ethanol to inactivate RNAses.
Ethanol was then added to promote binding of RNA to the RNeasy
membrane, and the entire volumes of the samples were loaded into
the wells of a multiwell plate. The silica gel membrane of the
RNeasy kit specifically binds total RNA, allowing contaminants to
be washed away in flow-through processing of the membrane using a
vacuum manifold. Samples bound to the membrane were dried by
centrifugation of the plate. In order to elute RNA, 45 .mu.L of
RNAse-free water was added to each sample well, incubated,
collected by centrifugation, and then the elution process repeated.
Samples were stable in this form, and were stored at -80.degree. C.
for later use in expression assays.
Example 3
Reverse Transcription to Generate cDNA
[0206] A multiplex primer mix was designed to amplify ten target
mRNAs, including four controls and six test targets. Two of the
controls were endogenous cellular mRNAs that exhibit constant
expression levels (.beta.-actin and cyclophilin), allowing for
normalization of signals from other genes. Two additional control
RNA targets were added exogenously in the cell lysis buffer to
provide a means to monitor recovery and stability of RNA from cell
lysates (kanamycin mRNA and the 7.5 kb RNA as previously
described). Six test genes were chosen that had been shown in prior
art to exhibit changes in the amount of mRNA transcribed from those
genes in response to a specific challenge.
[0207] Reverse transcription and PCR.TM. amplification primers were
designed for the gene multiplex set using OLIGO 5.0 (Molecular
Biology Insights, Inc., Cascade, Colo.). The sizes of the predicted
PCR amplification products of the nine targets ranged from 100 to
330 bases, with the smallest size difference being 5 bases. The
length of complementary sequence between each target-specific
primer and its target sequence was 20 bases, and the length of
complementary sequence between the target-specific primers and the
universal primers was 18 bases. Primers were synthesized by Operon
Technologies Inc. (Alameda, Calif.), or by chemists at GeneTrace
Systems Inc. (Alameda, Calif.), utilizing conventional
phosphoramidite synthesis techniques.
[0208] A mixture of reverse target-specific primers appropriate for
the multiplex was prepared and diluted to a working concentration
of 0.02 .mu.M. (Reverse priming of .beta.-actin mRNA is attenuated
by addition of a second, inhibitory reverse target-specific primer.
See Example 4.) To begin the reverse transcription step, 30 ng of
total RNA, prepared as described in Example 2, was mixed with the
reverse primers, 10 units of Moloney Murine Leukemia Virus Reverse
Transcriptase (MoMLV-RT, Promega Inc.), and deoxyribonucleotides (1
mM from Promega) in an appropriate buffer (20 mM Tris HCl, 16.7 mM
MgCl.sub.2, pH 8.3, and 2.5 units RNasin). Samples were incubated
at 42.degree. C. for 30 minutes, followed by 95.degree. C. for 5
minutes to inactivate the enzyme.
Example 4
Signal Attenuation
[0209] If one of the targets in a multiplex set is present at very
high levels, it may be necessary to attenuate the signal generated
by that target to ensure that all signals fall within the dynamic
range of the assay. The .beta.-actin mRNA provided one such
example, as this mRNA is constitutively expressed at very high
levels. Amplification of the .beta.-actin signal was attenuated by
using a mixture of two target-specific reverse primers, the first
terminating at the 3' end with a hydroxyl group which is extendible
by a reverse transcriptase, and the second containing a phosphate
group attached to the 3'-hydroxyl which blocks extension by reverse
transcriptase. The blocked 13-actin primer was used in a 40-fold
excess relative to the extendible primer, and the combined
concentration was equivalent to the concentrations of all other
target-specific reverse primers in the multiplex. This amount of
inhibition typically resulted in about a 70% reduction in
conversion of mRNA to cDNA.
Example 5
Multiplex Amplification of Target Sequences Using a Single
Unlabeled Universal Primer
[0210] After inactivation of the reverse transcriptase, the cDNA
products were used directly as templates in a PCR amplification. A
mixture of forward target-specific primers appropriate for the
multiplex reaction was prepared (SEQ ID No. 1-22). A single
unlabeled universal primer was used for amplification; both the
forward and reverse target-specific primers in the multiplex
composition were designed to contain the same universal sequence
within their 5' regions. The forward target-specific primers and
the universal primer were diluted to a working concentration of 10
nM and 500 nM respectively, and then added to the samples from the
reverse transcriptase reaction, along with 1 unit TaqGOLD.RTM.
(Perkin-Elmer Applied Biosystems Inc., Foster City, Calif.) and 375
.mu.M deoxyribonucleotides in an TaqGOLD-supplied buffer. The
samples were heated at 95.degree. C. for 10 minutes to activate the
enzyme, then cycled at appropriate temperatures and for the
appropriate number of cycles to achieve amplification of the
designated target sequences, while remaining in the exponential
phase of the reaction. For example, the samples are amplified for
between 30-45 cycles using the following temperatures and times,
94.degree. C. for 30 sec., 55.degree. C. for 30 sec., and
68.degree. C. for 1 min. See Innis, supra.
Example 6
Detection of Amplification Products by Mass Spectrometry
[0211] After PCR amplification, samples were ready for separation
and analysis. The method of ionization used for mass spectrometric
analysis was Matrix-Assisted Laser Desorption and Ionization
(MALDI). Mass determinations were made by Time-of-Flight (TOF). A
desorption/ionization matrix for analyzing samples was composed of
a 9:1 ratio of saturated hydroxypicolinic acid (HPA) to picolinic
acid (PA) (Aldrich) in 25% acetonitrile and 25 mM diammonium
citrate. A mass spectrometer analysis plate was spotted in 384
positions with aliquots of the matrix, which were then allowed to
dry and/or crystallize. A defined quantity of an oligonucleotide
(e.g., 0.5 .mu.l of a 5-10 AM solution, depending on the mass of
the oligonucleotide), having a mass within the range of the
amplification products, was added to each PCR reaction to serve as
an internal quantitation standard. An aliquot of approximately
0.5-1 .mu.l of each sample was then pipetted on top of each of the
crystallized spots. Samples were allowed to dry again, forming
DNA:HPA co-crystals.
[0212] The sample plate was placed in the mass spectrometer load
lock chamber, pumped down to a low vacuum pressure, transferred to
the sample chamber, then finally pumped down further to the
required operating vacuum pressure. The sample chamber contains an
X-Y table to orient the samples under the laser beam, and ion
optics to accelerate and direct DNA ions into the flight tube and
towards the detector. Ionized DNA fragments hitting the detector
are assigned a mass based on the time required to travel through
the flight tube. Various parameters were set within the automated
data collection software to enable collection of signal in the
appropriate mass range, and the coordinate positions on the
analysis plate for the samples to be examined were entered. A laser
beam of 355 nm light was focused through a window in the sample
chamber onto the sample being analyzed. The laser power was
adjusted to maximize the signal-to-noise ratio, while minimizing
fragmentation of DNA in the sample. Data was collected according to
the set parameters, generating a signal spectrum for each sample.
The data was further processed using signal calling software
proprietary to GeneTrace. The software smoothed the spectra,
identified signal peaks, assigned masses to the peaks, and
integrated the data to quantitate the relative amount of each
species in the sample. These values were then normalized to the
internal quantitation standard to convert the data to absolute
values.
[0213] Data generated by the signal calling software was imported
into Microsoft Excel (Bellevue, Wash.). Signals from each of the
gene products being quantitated were normalized to the signal from
the reference nucleic acid (the multiplex control target taken to
have a constant abundance level). When a second reference target
was included in the multiplex, this signal was also normalized to
the first reference, and checked to confirm that its abundance
relative to the first reference was constant. Data was stored in
tabular form as normalized signal intensities.
[0214] Additional details regarding analysis by mass spectroscopy
are presented in further examples as detailed below.
Example 7
Multiplex Amplification Using a Single, Labeled Forward Universal
Primer and an Unlabeled Reverse Universal Primer
[0215] The cDNA products of another toxicology multiplex sample
were used as templates in a PCR amplification that generated
labeled products. A mixture of forward target-specific primers
appropriate for the multiplex reaction was prepared. These primers
contained a different universal sequence within their 5' regions as
that of the reverse primers used to generate the cDNA. A forward
universal primer was modified by covalent attachment of a
fluorescein moiety (FAM, available from Perkin-Elmer/Applied
Biosystems, Inc.), while the reverse universal primer remained
unlabeled. The forward target-specific primers and the universal
primers were diluted to a working concentration and then added to
samples from the reverse transcriptase reaction, along with TaqGOLD
and deoxyribonucleotides in an appropriate buffer. The PCR
amplification was carried out as described in Example 5.
Example 8
Generating a Pool of Two Multiplexed Amplifications--Using a Single
Forward Universal Primer Containing One of Two Labels and an
Unlabeled Reverse Universal Primer
[0216] The cDNA products of additional toxicology multiplex samples
were used as templates in two PCR amplifications to generate
differently labeled products. A mixture of forward target-specific
primers appropriate for the multiplex reaction was prepared. These
primers contained a different universal sequence within their 5'
regions as that of the reverse primers used to generate the cDNA.
In addition to the fluorescein-modified primer described in Example
2, a second preparation of the forward universal primer was made,
modifying it by covalent attachment of a hexachlorofluorescein
moiety (HEX, Perkin-Elmer/Applied Biosystems, Inc.). The reverse
universal primer remained unlabeled. The forward target-specific
primers and the universal primers were diluted to a working
concentration (of 10 nM and 500 nM respectively). Forward
target-specific primers, TaqGOLD and deoxyribonucleotides in an
appropriate buffer were added to samples from the reverse
transcriptase reaction. The FAM-modified forward universal primer
was added to one of the PCR amplification reactions, and the
HEX-modified forward universal primer was added to the other. PCR
amplification was carried out as described in Example 5.
Example 9
Detection of Amplification Products by Polyacrylamide Gel
Electrophoresis
[0217] After PCR amplification using the fluorescently-labeled
primers, the multiplexed samples were ready for analysis by
polyacrylamide gel electrophoresis. A standard sequencing gel
composed of 5% polyacrylamide, and containing 6M urea and 890 mM
Tris-borate and 2 mM EDTA, was cast for use on an ABI PRISM 377 DNA
Sequencer (Perkin-Elmer/Applied Biosystems). Amplification products
were diluted and mixed with a solution of GeneScan 500 ROX-labeled
size standards (PE Applied Biosystems, CA) in formamide (1:5).
Samples were loaded on the gel, and the components of the multiplex
reaction mixture were electrophoretically separated by size
according to standard conditions, for example, 1.5 hours running at
2000 V, 60 mA current, 20 W power, gel temperature of 51.degree.
C., and laser power of 40 mW (ABI 377). Fluorescent data was
collected by laser scanning across the gel in real time.
GeneScan.TM. software was used to quantitate fluorescent signals
from the amplification products, and Genotyper.TM. software (both
from Perkin-Elmer/Applied Biosystems) was used for subsequent
calculations and data manipulations.
Example 10
Generating a Pool of Two Multiplexed Amplifications--Using Two
Forward Universal Primers of Different Lengths and With Different
Labels, and an Unlabeled Reverse Universal Primer
[0218] The cDNA products of other toxicology multiplex samples were
used as template in two PCR amplifications to generate equivalent
amplification products of slightly offset sizes, both labeled with
the same chromaphore. A mixture of forward target-specific primers
appropriate for the multiplex was prepared. These primers contained
a different universal sequence at their 5' ends as that of the
reverse primers used to generate the cDNA. Two forward universal
primers were made with the same universal sequence, but one
contained three additional bases at its 5' end. One of the forward
universal primers was modified by covalent attachment of a FAM
moiety, and the other was modified by covalent attachment of a HEX
moiety. The reverse universal primer remained unlabeled. The
forward target-specific primers and the universal primers were
diluted to a working concentration. Forward target-specific
primers, TaqGOLD and deoxyribonucleotides in an appropriate buffer
were added to samples from the reverse transcriptase reaction. One
of the labeled forward universal primers was added to each of the
reactions. PCR amplification was carried out as described in
Example 4.
Example 11
Detection of Amplification Products by Denaturing Capillary
Electrophoresis
[0219] Two PCR multiplex samples are analyzed by capillary
electrophoresis at the end of the PCR amplification. The samples
were combined, diluted 1:10 in CE sample dilution buffer (1:5
dilution of fluorescently labeled ladder in deionized formamide).
The pooled sample was analyzed on an ABI PRISM 310 Genetic
Analyzer, with capillaries containing POP4 acrylamide matrix (PE
Perkin-Elmer Applied Biosystems, CA). Components of the pooled
multiplexes were electrophoretically separated by size according to
standard conditions. Fluorescent data was collected at wavelengths
appropriate for the FAM and HEX labels. Sizes were assigned to each
signal peak based on their migration relative to the ROX size
standards.
Example 12
Data Analysis
[0220] The data collected from the FAM and HEX fluorescent signals
were analyzed using GeneScan analysis software. The fluorescent
signals were deconvoluted to yield information specific for each of
the individual fluorophores in the mixture, to generate a baseline,
to sort the signals into "size bins" relative to the ROX size
standards, and to quantitate the amount of DNA represented in each
bin. The results from this analysis were further processed by
Genotyper software (PE Applied Biosystems, CA) to automate the
repetitive tasks of data analysis. Sample files from GeneScan were
imported into Genotyper, which then assigned data to the size
ranges programmed by the operator. The data generated in this
manner was stored in tabular form, and then imported into Excel.
The signals from each of the gene products being quantitated were
normalized to the signal generated by the internal reference (the
multiplex control target taken to have a constant abundance level).
When a second internal reference target was included in the
multiplex, this signal was also normalized to the first reference,
and checked to confirm that its abundance relative to the first
reference was constant. Data was stored in tabular form as
normalized signal intensities.
Example 13
Multiplex Analysis of Cellular Transcription in PC-3 Cells After
Treatment With Battery of Compounds
[0221] Preparation of Target Sequences
[0222] PC-3, a human prostate adenocarcinoma cell line (American
Type Culture Collection, Rockville, Md.) was cultured in T-225
cm.sup.2 flasks (Corning Costar Corp., Cambridge, Mass.) using
Kaighn's Nutrient Mixture F-12 (Irvine Scientific, Santa Ana,
Calif.) containing 7% fetal bovine serum (FBS) (Hyclone, Logan,
Utah) and 1 mM L-glutamine. The cell culture reagents were obtained
from Gibco BRL Life Technologies (Grand Island, N.Y.) except where
otherwise noted. Cells were maintained at 37.degree. C. in a
humidified cell incubator containing 5% CO.sub.2. At approximately
70% confluence, the growth media was aspirated and cells were
rinsed with D-PBS. Cells were harvested by trypsinization, treated
with trypan blue exclusion viability stain and counted using a
hemacytometer. Lidded 96-well microtiter culture plates (Becton
Dickinson, Franklin Lakes, N.J.) were then seeded at
5.times.10.sup.4 cells per well in a 200 .mu.L media volume. Two
wells were left empty to allow the later addition of external
process controls. Seeded plates were incubated for 3 hours
(37.degree. C., 5% CO.sub.2, in a humidified cell incubator) to
allow for cell attachment prior to compound addition.
[0223] A set of 80 known drugs ("Killer Plate 1", from MicroSource
Discovery Systems, Inc., Gaylordsville, Conn.) and an actinomycin-D
positive control were solubilized in 100% DMSO (Sigma Chemical Co.,
St. Louis, Mo.) and diluted to 8.times.working solutions with
growth media prior to cell plate addition. Compounds from a
chemical library (in pooled format) and subsequent confirmation of
individual compound activities were analyzed at a final
concentration of 2.5 .mu.M in 0.25% DMSO. Positive and vehicle
control wells were maintained at 0.25% DMSO (v/v) which had no
effect on cell growth or gene targets. For dose-response analysis,
compounds were plated in triplicate and analyzed using eight
concentrations (between 10 .mu.M and 3.16 nM in 0.25% DMSO), as
prepared by serial dilution. After cell attachment was verified by
phase contrast microscopy, a 25 .mu.L aliquot of media was removed
from the cell plate and an equivalent volume of compound working
solution (8.times.) was introduced with mild trituration of the
well volume, using a MultiMek 96 pipetting station (Beckman
Coulter, Fullerton, Calif.). Cell plates were then returned to the
incubator for a 24 hour exposure period.
[0224] Lysis buffer was prepared by adding 145 mM
.beta.-mercaptoethanol (Sigma Chemical Co., St. Louis, Mo.) and
external mRNA controls (to a final concentration of 500 fM) to RLT
Lysis buffer (Qiagen, Valencia, Calif.). Two external mRNA controls
were used: 7.5 kb poly(A)-tailed RNA and 1.2 kb Kanamycin Positive
Control, which were treated with DNAse to ensure that no
contaminating DNA was present. Following a 24 hour incubation
period, cell media was aspirated from all wells using an EL-404
plate washer (BioTek Instruments, Winooski, Vt.). Lysis buffer (100
.mu.L) was pipetted into each well containing cells. Plates were
then mixed on an orbital shaker (Labline, Melrose Park, Ill.) for
15 seconds. Adhesive aluminum foil strips (E&K Scientific,
Campbell, Calif.) were used to seal the plates prior to frozen
storage at -20.degree. C.
[0225] For gene expression analysis, the cell lysates were thawed,
and total RNA was purified in automated 96-well format using the
Qiagen RNeasy 96 kit according to the manufacturer's recommended
procedure. RNA concentrations were determined fluorometrically
using RiboGreen reagent (Molecular Probes, Eugene, Oreg.), adjusted
in concentration, and aliquoted in 30 ng amounts into 96-well
plates for assay. Total RNA yields ranged from 0.45 to 1.8 .mu.g
per well depending on compound toxicity. RNA samples were verified
to be free from DNA contamination by running controls in which MMLV
reverse transcriptase enzyme was omitted from the multiplex assay
protocol. Purified RNA controls were included on each plate for
process quality control and tracking.
[0226] Primer Design
[0227] Assay specificity was determined by utilizing unique primers
for each gene. Target-specific primers were designed to six target
sequences and two reference sequences (Table 1). Both forward-TSPs
and reverse TSPs were synthesized, having sequences as delineated
in Table 2. The 5' region of the target-specific sequences includes
sequences complementary to one of two universal sequences
1TABLE 1 Target-Specific Primers for Multiplexed Analysis of Gene
Expression in PC-3 cells Target Sequence F-primer R-primer Size
(bp) beta-actin Sp61F T7(P7)R3/R3pi (1:39) 117 cloning vector
lambda EMBL3 SP6/T7 fragment in GibcoBRL 7.5 kp mRNA Sp6(P2)F2
T7(P7)R2 127 INA D Sp6F1 (P2) T7R1 (P7) 147 hSPE Sp6F2 (P2) T7R2
(P7) 157 Sp6F1 (&F2) survivin (P2) T7R2 (P7) 200 HNF 3 alpha
Sp6F3 (P2) T7R3 (P7) 215 GAPDH Sp6F1 (P2) T7R1 (P7) 237 EST
Sp6(P2)F4 T7(P7)R4 266 Hoxb 13 Sp6F1 (P2) T7RL(&R2) (P7) 283
(KanR) aminoglycoside 3'- Sp6(P2)(LP70)F2 phosphotransferase
T7(P7)R2 322
[0228]
2TABLE 2 Target-Specific Primer Sequences Accession # Primer Primer
Name Primer Sequence X00351 .beta.-actin forward Sp6.1F1
AGGTGACACTATAGAATAACCGAT AAGGCCAACCGCGAGAAGATGA X00351 .beta.-actin
reverse T77R3 GTACGACTCACTATAGGGATGGAT .beta.-actin reverse
AGCAACGTACATGGCTG X00351 Phosphorylated T77R3Pi
GTACGACTCACTATAGGGATGGAT U02426 AGCAACGTACATGGCTGPi fragment 7.5 kb
forward Sp6 (P2) F2 AGGTGACACTATAGAATAACTATG U02426 CCGGTATCAGCACC
fragment 7.5 kb reverse T7 (P7) R2 GTACGACTCACTATAGGGAGATGG
CAGCGTGATTTCAC INA D INA D forward Sp6F1 (P2)
AGGTGACACTATAGAATAGTGACA CGTCGCAGAATGAG INA D INA D reverse T7R1
(P7) GTACGACTCACTATAGGGATTGAC CCTTCAGTTGCTTGA hSPE hSPE forward
Sp6F2 (P2) AGGTGACACTATAGAATAGCTTCA TTAGGTGGCTCAACA hSPE hSPE
reverse T7R2 (P7) GTACGACTCACTATAGGGAGGCTC Survivin Sp6F1 (&
F2) AGCTTGTCGTAGTTC Survivin forward (P2) AGGTGACACTATAGAATAGTCAGC
CCAACCTTCACATC Survivin Survivin reverse T7R2 (P7)
GTACGACTCACTATAGGGACCACC HNF 3 alpha CTGCAGCTCTATGAC HNF 3 alpha
forward Sp6F3 (P2) AGGTGACACTATAGAATAACTTCA HNF 3 alpha
AGGCATACGAACAG HNF 3 alpha reverse T7R3 (P7)
GTACGACTCACTATAGGGAGGGAG GAPDH CTAGGAAGTGTTTAG M33197 forward Sp6F1
(P2) AGGTGACACTATAGAATAAAGGTG AAGGTCGGAGTCAA M33197 GAPDH reverse
T7R1 (P7) GTACGACTCACTATAGGGAATGAC GAPDH reverse AAGCTTCCCGTTCTC
M33197 phosphorylated T7R1Pi (P7) GTACGACTCACTATAGGGAATGAC
AAGCTTCCCGTTCTCPi EST EST forward Sp6F4 (P2)
AGGTGACACTATAGAATAGCTCAT CTGCCAACAATC EST EST reverse T7R4 (P7)
GTACGACTCACTATAGGGACTAGC Hoxb 13 GGAAGCAAATTACAC Hoxb 13 forward
Sp6F1 (P2) AGGTGACACTATAGAATAGCGAC- A T7R1 (&R2) TGACTCCCTGTT
Hoxb 13 Hoxb 13 reverse (P7) GTACGACTCACTATAGGGAAACTT J01839 Sp6
(P2) (LP70) GTTAGCCGCATACTC (V00359) KanR forward F2
AGGTGACACTATAGAATAATCATC J01839 AGCATTGCATTCGATTCCTGTTTG (V00359)
KanR reverse T7 (P7) R2 TACGACTCACTATAGGGAATTCCG ACTCGTCCAACATC
[0229] Preparation of Primer Sequences
[0230] Oligonucleotides were prepared using phosphoramidite
methodology on an ABI 394 DNA synthesizer using standard procedures
and reagents, including dG.sup.dmf FastPhosphoramidite (PE
Biosystems 401183), 0.02M Iodine (PE Biosystems 401732) as oxidant,
and 0.25M 5-ethyl-1H-tetrazole (Glen Research 30-3140-52) as
activator. 5'-biotinylated nucleotides were incorporated using
commercially available amidite reagents as described in the
procedure below. Preparation of the cleavable primer sequences
involved the synthesis of a protected 3' thiothymidine reagent
(5'-O-Dimethoxytrityl-3'-thiothymidine-3'-S-(2-cyanoethyl)-N,N-diisopropy-
l phosphorothioamidite). The 3'-thiothymidine nucleotide was
incorporated in an automated fashion using the protected
phosphoramidite reagent described above. Column chromatography was
carried out under a positive pressure of argon gas. HPLC data were
collected on an Hewlett-Packard 1100 series instrument at 260
nm.
[0231] In cases where mass spectrometric analysis was performed,
one universal primer of each target-specific primer pair was
prepared having a biotin moiety incorporated at the 5'-end, and a
chemically-cleavable base, 3'-thiothymidine at an appropriate
position. Cleavage of the amplified PCR product at the position of
the 3'-thiothymidine reduces the measured DNA size, thus providing
fragments suitable for optimal mass spectral resolution and
sensitivity. Furthermore, the cleavable bases could be introduced
in various positions within different universal primers used in
different multiplex reactions. The various cleaved positions yield
a series of non-overlapping mass spectral peaks suitable for
multiplexed readout.
[0232] 5'-biotin phosphoramidite (Glen Research 10-5950-90, 0.1M in
anhydrous acetonitrile) and Thio-T amidite (0.1M in anhydrous
acetonitrile) were employed in the synthesis of the universal
primers. The synthesis was carried out using a 10-minute coupling
time for Biotin and a two 5-minute couplings for Thio-T. The crude
oligonucleotide was deprotected in 28% aqueous NH3 at 55.degree. C.
for two hours. Removal of the solvent gave a white residue that was
desalted on a NAP-10 column (Pharmacia 17-0854-01) with ddH2O. The
product was analyzed by HPLC using a Supelcosil LC-18-T column
(Supelco 58971) and a gradient of 10 to 20% acetonitrile from 5 to
25 min. at 1 mL per min. in 0.1M TEAA. Typical retention times were
about 10 to 15 min., and the purity of the product should exceed
80%.
[0233] For cases where the samples were analyzed on a fluorescence
electrophoretic device, a universal primer was synthesized that
included a dye at the 5' end. Fluorescent dye labeling of primers
with 6-FAM was carried out on an automated DNA synthesis device
using 5'-fluorescein phosphoramidite (Glen Research, Sterling,
Va.). "Shifted" Universal Primers
[0234] Greater assay throughput is achieved by mixing PCR products
of the original gene set (i.e. target sequences) with a "shifted"
gene set so that signals from the products of the two gene sets are
interleaved. The "shifted" genes are separated from the original
genes by the same number of bases for each product in the
multiplexed gene set. The "shifted" genesets are generated by the
addition of nucleotides to the labeled strand of the universal
primer to increase the length of the PCR products. Spacers are used
to separate the label from the specific portion of the universal
primer sequence.
[0235] Shifted target universal primers were synthesized that
contained a normucleotide linker. The normucleotide linker used was
an abasic nucleotide, dSpacer phosphoramidite,
5;-dimethoxytrityl-1,2-dideoxyribose- -3'-cyanoethyl
phosphoramidite (Glen Research, Sterling, Va.) The dSpacer was
incorporated during automated DNA synthesis on a DNA synthesis
device using standard methods. After incorporation of the dSpacer
between 1 to 10 thymidine bases were incorporated and optionally a
dye label was also added.
[0236] For example, the universal primers used in a first series of
multiplex amplifications to generate an original geneset comprises
a FAM-labeled Sp6 universal sequence (forward direction) and an
unlabeled T7 universal sequence (reverse direction)
[0237] Labeled Sp6: 5'-(FAM)-AGG TGA CAC TAT AGA ATA-3' (SEQ ID No.
23)
[0238] Non-labeled T7: 5'-GTA CGA CTC ACT ATA GGG A-3'(SEQ ID No.
24)
[0239] Alternatively, the T7 sequence can carry the fluorescent
label while the Sp6 sequence is unlabelled:
3 Non-labeled Sp6: 5'-AGG TGA CAC TAT AGA ATA-3' Labeled T7:
5'-(FAM)-GTA CGA CTC ACT ATA GGG A-3'
[0240] In a second set of multiplex amplifications, universal
primers containing additional nucleotides are employed (dS=dSpacer
phosphoramidite, available from Glen Research, Sterling Va.), such
that the molecular weight or mass of the resulting amplified
sequences is altered as compared to the first series of
amplification reactions. Exemplary universal primers for generation
of the shifted geneset are:
4 Labeled Sp6: 5'-(FAM)TTTTTTT-dS*-AGG TGA CAC TAT AGA ATA-3'
Non-labeled T7: 5'-GTA CGA CTC ACT ATA GGG A-3'
[0241] As with the primers used in the previously-described
amplification reaction, the label can be carried on either of the
universal sequences employed:
[0242] Non-labeled Sp6: 5'-AGG TGA CAC TAT AGA ATA-3'
5 Labeled T7: 5'-(FAM)-TTTTTTT-dS*-GTA CGA CTC ACT ATA GGG A-3'
[0243] Reactions may also be performed separately for the same set
of target sequences using multiple dyes, which are then mixed to
increase throughput. Labeled universal primers are also "shifted"
in size to avoid overlapping peaks and for improved
reproducibility. All reactions using multiple dyes were performed
with the same non-labeled T7 universal primers. Exemplary labeled
Sp6 universal primers include:
6 FAM-labeled Sp6: 5'-(FAM)-AGG TGA CAC TAT AGA ATA-3' HEX-labeled
Sp6 : 5'-(HEX)-TAG AGG TGA CAC TAT AGA ATA-3' or
5'-(HEX)-TTT-(dS)-AGG TGA CAC TAT AGA ATA-3' NED-labeled Sp6:
5'-(NED)-GAT TAG AGG TGA CAC TAT AGA ATA-3'
[0244] Additional primers can be designed by one of skill in the
art. For example, reactions may also be performed where one of the
universal primers contains a cleavable site and optionally a
biotin, for specific solid-phase capture. Cleavable universal
primers are "shifted" in size once they are cleaved. As an example,
all reactions using cleavable Sp6 primers were performed with a
non-labeled T7 universal primer. Exemplary labeled Sp6 universal
primers include:
7 Cleavable Sp6: 5'-(Biotin)-AGG TGA CAC TAthioT AGA ATA-3'
[0245] Amplification
[0246] The multiplex amplification step utilized solution-phase
quantitative multiplex RT-PCR amplification, and was coupled with
multiplexed fluorescence or mass spectrometric detection. Primer
pairs (SEQ ID Nos. 1-22) for specific genes and controls were
designed using Primer-3 software (Whitehead Institute for
Biomedical Research, Cambridge, Mass.).
[0247] Reverse transcription to generate first strand cDNA was
carried out using 30 ng of total RNA, 0.02 .mu.M primers, 1 mM
dNTPs, RNasin ribonuclease inhibitor (2.5 units, Promega, Madison,
Wis.), and MMLV reverse transcriptase (10 units, Promega, Madison,
Wis.) at 42.degree. C. for 30 minutes. PCR amplifications were
performed using 0.01 .mu.M gene-specific primers, 1 .mu.M universal
primers, 0.375 mM dNTPs (Promega, Madison, Wis.), and AmpliTaq Gold
polymerase (1 unit, Perkin Elmer, Foster City, Calif.) in the
buffer supplied with the enzyme. Thermal cycling was performed on a
Perkin-Elmer GeneAmp 9700 between 30 to 45 cycles using the
following conditions: 94.degree. C. for 30s, 55.degree. C. for 30s,
and 68.degree. C. for 1 minute. Multiplex PCR products were
resolved using either the electrophoresis or capillary systems for
fluorescent readout when they were all in the linear range of
amplification, and were quantified by fluorescence intensity. For
fluorescent readout, one of the universal primer pairs used for PCR
amplification was labeled with the fluorescent dye 6-FAM utilizing
5'-fluorescein phosphoramidite (Glen Research, Sterling, Va.).
[0248] Gel electrophoresis
[0249] The samples were prepared for multiplex fluorescent readout
using a gel electrophoresis system from The Gel Company (San
Francisco, Calif.) by diluting the RT-PCR products 1:4 in GE sample
dilution buffer (a 1:3.3 dilution of fluorescently labeled ladder
(CXR Fluorescent Ladder, Promega, Madison, Wis.), 1:16 dilution of
blue dextran, and 1:1.6 dilution of deionized formamide). The
fluorescent ladder was used as a gel standard with every sample for
normalization of the target PCR product sizes. After denaturing the
samples at 95.degree. C. for 5 minutes and cooling in ice-water
bath for 5 minutes, 0.5 .mu.l of the diluted RT-PCR samples were
loaded onto a 96-well linear loading tray and transferred via
absorption onto a 96-lane paper comb. The comb was then inserted
onto the gel and samples were allowed to run into the gel for
approximately 35 seconds, after which the comb is removed and
discarded.
[0250] Capillary electrophoresis
[0251] RT-PCR products for multiplex fluorescent readout using the
capillary electrophoresis system were diluted 1:10 in CE sample
dilution buffer (1:5 dilution of fluorescently labeled ladder in
deionized formamide). Approximately 10 .mu.l of the diluted RT-PCR
samples were placed in receptacles specific for the capillary
electrophoresis instrument and denatured at 95.degree. C. for 5
minutes. The samples were then cooled for 5 minutes in ice-water
bath prior to performing the capillary electrophoresis.
[0252] Mass Spectroscopic Analysis
[0253] Subsequent to PCR amplification, samples were processed to
prepare them for mass spectrometric analysis. The processing steps
were conducted in 384-well plates on a robotic workdeck containing
a magnetic platform to facilitate manipulation and washing of
magnetic beads.
[0254] Streptavidin-coated magnetic beads were added to each sample
in binding solution, 10 mM Tris, 20 mM ammonium acetate, 1 mM EDTA
buffer, pH 7.2, and incubated at room temperature for 20 minutes to
allow binding of the biotinylated primer. The sample tray was
placed on a magnet platform of a robotic workstation to precipitate
the DNA bound to the beads. After the beads were pelleted, the
supernatant was removed, and the pellet was rinsed once with
binding solution.
[0255] A denaturing solution of 0.1N NaOH was used to rinse the
pelleted beads and to remove the non-biotinylated complementary
strand. A second aliquot of the denaturing added, mixed above the
pelleted beads, then incubated. The mixing process was repeated
four times, then the final supernatant was removed. The beads were
washed five times with a 20 mM ammonium acetate solution, then
twice with deionized water to remove residual salts. The beads were
then resuspended in a cleavage solution (0.1 mM silver nitrate)
land the samples were incubated at 48.degree. C. for 15 minutes.
The tray was returned to the workstation to precipitate the beads,
and the supernatant was transferred to a fresh 384-well tray. A
solution of 70 mM DTT solution was added to samples in the new tray
to quench the reaction, and samples were dried in a vacuum
centrifuge.
[0256] Approximately 0.5 mL of a matrix solution consisting of a
5:1 molar ratio of 3-hydroxypicolinic acid (3-HPA) to picolinic
acid (PA) was added to each well containing dried sample. The
matrix solution was prepared by mixing 18 .mu.L of a freshly
prepared saturated 3-HPA solution (about. 0.5 M) with 2 .mu.L of 1
M PA. The redissolved samples were then spotted (either manually or
robotically) onto a mass spectrometer sample plate, 0.5 .mu.l, and
allowed to crystallize for subsequent analysis.
[0257] For mass spectrometry readout, a linear time-of-flight (TOF)
mass spectrometer was employed, using an acceleration voltage of
+20 kV; delay of +3.6 kV at 1.12 .mu.sec; laser setting of 179 on
the polarizer; mass gate of 5.84 .mu.sec; and 400 shots.
Furthermore, a 2-point mass calibration with a 15-mer (4507.0 Da)
and a 36-mer (10998.2 Da) was utilized.
[0258] Quantitative levels of all genes in each sample, including
target and external spike control genes, were normalized to the
internal controls, and are expressed as ratios to the control
("housekeeping") genes GAPDH and .beta.-actin.
[0259] Validation of Primer Design
[0260] Multiplexed amplifications were validated to ensure that
each primer pair was specific for a particular target sequence and
that there were no interactions among the target sequences in the
multiplex. This was accomplished by conducting drop-out
experiments, in which the multiplex amplification was run in the
absence of a particular primer pair. Additionally, the
amplification reaction was validated by comparing the results of
primers in different multiplex environments, ensuring identical PCR
product sizes in each case. Furthermore, primers were also tested
for efficiency by running the multiplex assay on RNA samples known
to express all of the targeted sequences.
Example 14
Multiplex Strategies
[0261] Table 3 depicts exemplary strategies for multiplexing
samples in the methods of the present invention. Multiplex
reactions A and B illustrate fundamental multiplexing strategies
for use in the methods of the present invention. In these assays,
all of the forward universal primers (UPfs) include the same
universal sequence; in addition, a single type of dye label is
incorporated into the primers. In multiplex reaction A, the reverse
universal primers (UPrs) all have the same sequence with each
other, but a different sequence from the forward universal primers.
The reverse universal primers do not have an incorporated dye. In
multiplex reaction B, all of the forward universal primers and
reverse universal primers contain the same sequence, and therefore
both strands of the products will have an incorporated dye. In the
given example, at the end of each type of reaction, the multiplexed
samples contain 12 strands of amplified products (two complementary
strands from each of six templates), with dye incorporated in
either half (for example A) or all (multiplex reaction B) of the
strands. Because the dye is the same for all targets, detection of
individual products depends on their separation (in this case,
based on size).
[0262] Multiplex reaction C depicts an embodiment in which
semi-universal primers are used to shift the mobility of a subset
of the amplification products during size separation of otherwise
overlapping peaks. Two forward universal primers are used for
designated subsets of targets. Both primers are labeled with the
same dye, but one of them additionally contains a friction group
(i.e., an attached moiety that generates drag on molecules as they
migrate through a non-matrixed, liquid solution). See, for example,
Hubert and Slater (1995) Electrophoresis 16:2137-2142. In this
example, the sizes of products 1 and 4, 2 and 5, and 3 and 6 are
the same or overlapping, but corresponding peaks 1, 2, and 3, as
well as 4, 5, and 6 are different sizes. The friction group will be
incorporated into products 4, 5, and 6, while leaving products 1,
2, and 3 unmodified. As a result, the mobilities of products 4-6
will be retarded relative to 1-3, resolving these otherwise
overlapping sets into six separate peaks. The illustration
represents the reverse universal primers as all being the same
sequence, but these primers may also comprise a set of
semi-universal primers.
[0263] Multiplex reaction D illustrates another embodiment of the
components of the multiplex reaction which can be employed in order
to resolve overlapping signals. In this reaction profile, two
amplification products of the multiplex are the same size. The
mobility of one of the two overlapping signals can be shifted by
adding a nucleic acid sequence to one or both of the TSPs for one
of the target sequences, lengthening its amplification product. A
similar effect is obtained by designing semi-universal primers of
different sizes.
[0264] Multiplex reaction E illustrates an important embodiment of
the methods of the present invention, which provides a mechanism by
which the signals for multiple species are resolved by separating
other than by size. A set of semi-universal primers is employed in
the multiplex reaction; each UPf is labeled with one of a set of
independent labels, each of which can be detected uniquely. As with
multiplex reaction C, the sizes of products 1 and 4, 2 and 5, and 3
and 6 are taken as the same or overlapping, but peaks 1, 2, and 3,
as well as 4, 5, and 6 are different sizes. Products 1-3 will be
labeled with dye number 1, and products 4-6 with dye number 2. The
two sets of three products will still have overlapping mobilities,
but the fluorescent signals given by each of the two dyes can now
be separated by deconvolution of the emission spectral data. As in
the previous example, the UPrs can also be designed as
semi-universal primers.
[0265] Multiplex reaction F illustrates a method for obtaining
signals from a greater number of unresolved species than the number
of available dyes. Two dyes were used in the multiplex illustration
of multiplex reaction E, enabling resolution of two overlapping
signals. In the embodiment described in multiplex reaction E, the
signal from three unresolved products are obtained using only two
dyes with three different UPf primers. In this embodiment, the
third signal is obtained by double-labeling the amplification
products of that target. Because the signal from this product is
known to contain an equivalent fluorescent signal from each of the
two dyes, its signal can be separated from the signals of the two
singly-labeled products. This application requires that the three
types of products are not completely overlapping, which would make
deconvolution of their signals very difficult. Ideally, the signals
from the two singly-labeled species should not overlap, but some
overlap can be resolved by signal processing of the data. More
complex combinations are obviously possible when more than two dyes
are used.
[0266] These six cases are provided for illustration of the more
important embodiments of multiplexing reactions described in this
invention. To one skilled in the art, many variations in
multiplexing strategies are possible by combining separate elements
of these examples. In particular, combination strategies can be
employed making use of the separate forward and reverse universal
primers, or the combinations of target-specific and universal
primers, or semi-universal primers. In all cases, the selection of
the particular TSP sequences for each target within a multiplex can
be performed carefully to select the size of each PCR product and
ensure that each product can be detected uniquely.
[0267] Optionally, the methods of the present invention include
methods to increase the number of samples simultaneously analyzed
by pooling the products of separate reactions. This strategy
increases the throughput and reduces the cost of the assay for
situations in which the pooled products cannot be generated in the
same reaction (for example, when each separate reaction is already
maximized in multiplexing potential). For example, samples are
pooled after the RT-PCR reaction is complete, and prior to analysis
and quantitation.
8TABLE 3 Multiplexing Strategies for the RT-PCR Example UPf UPf
label UPr UPr label Application A UPf 1-6 = dye #1 UPr 1-6 = none
Resolution of a simple multiplex sequence "A" sequence "B" by size
(two universal primers) B UPf 1-6 = dye #1 UPr 1-6 = dye #1
Resolution of a simple multiplex sequence "A" sequence "A" by size
(one universal primer) C UPf 1-3 set, dye #1 UPr 1-6 = none Use
semi-universal primers to sequence "A" sequence "B" create
resolution by affecting + mobility UPf 4-6 set, dye #1 + Create
resolution by size shifting sequence "A" friction (where
amplification products 1-3 group have overlapping masses with
products 4-6) D UPf 1-6 = dye #1 UPr 1-6 = none Create resolution
by shifting size sequence "A" sequence "B" (TSP length was changed
to shift the mass of it's amplicon) E UPf 1-3 = dye #1 UPr 1-6 =
none Use semi-universal primers to sequence "A" sequence "C"
resolve by size & fluorescence UPf 4-6 set, dye #2
(multiplexing with dyes) sequence "B" F UPf 1 = dye #1 UPr 1-6 =
none Increase dye multiplexing capacity sequence "A" sequence "D"
possible with a fixed number of + dyes UPf2 = dyes #1 sequence "B"
and 2 + (50:50) UPf3 = dye #2 sequence "C"
Example 15
Pooling of Samples Using Interleaving Genesets or Multiple Dyes
[0268] RT-PCR samples for the same multiplexed reaction may be
mixed at appropriate ratios by combining either the original set of
target sequences with the "shifted" target sequence set, and/or by
combining reactions with multiple dyes. These mixed samples are
then diluted in the appropriate sample dilution buffer and loaded
onto the gel or capillary electrophoresis system. Exemplary
profiles of original and "shifted" multiplex genesets are shown in
FIG. 4. Examples of profiles generated by multiplexed amplification
with different dyes using multiplex genesets are shown in FIG. 5.
Several illustrations of pooling strategies are listed in Table 4,
and described below.
[0269] Multiplex reaction G illustrates an embodiment of a
fundamental pooling strategy for use in the methods of the present
invention. In this example, two separate reactions (G1 and G2)
comprise different multiplexes. The combined products of the two
separate reactions are resolvable by size. (For examples G through
M, it is assumed for illustration that all of the products of each
separate multiplex are resolvable by size.) As an example, each
separate reaction may be performed with the same UPf primer,
labeled with the same chromaphore. After the reaction, the samples
are combined for analysis. All of the individual signals from the
two reactions are then resolved by size.
[0270] The embodiments provided in Cases H-L illustrate various
ways of resolving the same set of amplified sequences generated in
separate reactions. Multiplex reaction H illustrates the use of
isotopic or chemical modification to generate shifts in the masses
of otherwise equivalent amplification products. For example,
deuterated dNTPs may be used to generate "heavy" amplification
products (designated as sequence A.sup.H in reaction H2) in one
reaction, while unmodified dNTPs are used in another (reaction H1).
The heavier deuterium isotopes of hydrogen that are incorporated in
one set of reaction products will generate a shift in the mass of
each product relative to the equivalent amplicon of the other
reaction.
[0271] The embodiment illustrated with multiplex reaction I makes
use of the friction molecules described previously in multiplex
reaction C. In multiplex reaction I, two reactions (I1 and I2) of
the same multiplex set are performed, the first with unmodified UPf
primers and the second with UPf primers containing a friction
group. Both primers are labeled with the same dye. After the
reaction, samples are combined for analysis. The friction group
will be incorporated into all of the products of reaction I2. As a
result, the otherwise overlapping signals will be separated by the
frictional drag of one species relative to the other.
[0272] Multiplex reaction J provides a way for detecting duplicate
multiplex sets by a mass shift. In this embodiment, two UPf primers
are used, one of which is shorter (in reaction J1) than the other
(reaction J2). Two separate reactions are conducted, each using
different universal primers. This will result in a duplicate signal
pattern in which one group is offset from the other by a fixed
size. This size offset can also be accomplished by using two UPf
primers coupled with two UPr primers, and changing the lengths of
one pair of UPf and UPr primers by a lesser amount.
[0273] FIG. 4 depicts exemplary detection profiles of original and
"shifted" multiplex genesets, as prepared by methods of the present
invention. The position of the signal along the X-axis generally
correlates with number of nucleotides in the amplified product,
while the Y axis indicates intensity of fluorescent signal. Panel A
represents data as collected for an "original" geneset, while panel
B depicts data for a "shifted" geneset (for which, in this example,
the amplified products appear to have a greater mass or friction
coefficient as compared to the unmodified amplification sequences).
Panel C presents the original and shifted genesets together,
demonstrating the resolution introduced into the products of the
"shifted" amplification reaction.
[0274] Multiplex reaction K illustrates a pooling strategy based on
a mass shift between duplicate multiplex sets, just as with
multiplex reaction J. In this illustration primers of the same
sequence and length are used for both multiplexes. However, for one
of the reactions (K2), the UPf incorporates a site of cleavage
between two nucleotides in the extension product. (Thus, the label
must be incorporated 3' to the cleavage site in order for it to
remain with the extension product). After amplification is
complete, the products made with the modified primer are cleaved,
removing a fixed number of nucleotides from the 5' end of the
labeled strand. Cleavage may be performed after pooling of separate
reactions. Cleavage sites can be situated in one of several
positions in a primer sequence, facilitating pooling of multiple
reactions.
[0275] In the embodiment illustrated in multiplex reaction L,
identical multiplexed reactions are generated (reactions L1, L2 and
L3). Rather than mixing the reactions prior to loading on the
separation platform, they are simply loaded individually, but with
time delays, in order to generate an offset in their relative
positions in the separation medium.
[0276] Multiplex reaction M illustrates the use of multiple labels,
e.g. fluorescent dyes, each of which can be uniquely detected. In
this embodiment, three separate reactions (M1, M2 and M3) are
performed with a single UPf primer sequence, but that contains one
of three different labels. After the reaction, the three samples
are combined for analysis. Each particular target from each
reaction will have the same size as those from each of the other
reactions. The triplicate sets of signals from the three reactions
will be resolved by deconvolution of the fluorescence data.
Examples of profiles generated by multiplexed amplification with
different dyes using multiplex genesets are shown in FIG. 5. The
position of the signal along the X-axis correlates with number of
nucleotides in the amplified product, while the Y axis indicates
intensity of fluorescent signal. Panel A=FAM-labeled products;
panel B=HEX-labeled products; panel C=NED-labeled products; and
panel D=FAM, HEX, & NED-labeled products combined. As with all
other case illustrations, the UPr primers can be utilized in
conjunction with the UPf primers to design more complex
strategies.
9TABLE 4 Pooling Strategies for Analysis Reaction UPf (product)
Label UPr (product) Label Application G1 UPf 1-6 (seq A) dye #1 UPr
1-6 (seq B) none Resolution by size. G2 UPf 7-12 (seq B) dye #1 UPr
7-12 (seq B) none H1 UPf 1-6 (seq A) dye #1 UPr 1-6 (seq B) none
Separate reactions have relative mobility shifts from use of
different H2 UPf 1-6 (seq A.sup.H) dye #1 UPr 1-6 (seq B) none
isotopes I1 UPf 1-6 (seq A) dye #1 UPr 1-6 (seq B) none Separate
reactions have relative I2 UPf 1-6 (seq A) dye #1 + UPr 1-6 (seq B)
none mobility shifts resulting from the friction "friction" group.
(Note: product masses group J1 TSP f, set #1 (seq A) dye #1 UPr 1-6
(seq B) none Separate reactions have relative mass off sets
resulting from primer J2 TSP f, set #2 (seq A + dye #1 UPr 7-12
(seq B) none length differences. 5 bases) K1 UPf 1-6 (seq A) dye #1
UPr 1-6 (seq B) none Separate reactions have relative K2 UPf 1-6
(seq A + dye #1 UPr 1-6 (seq B) none mobility shifts from removal
of cleavage site) nucleotides by cleavage within the primer. L1 UPf
1-6 (seq A) dye #1 UPr 1-6 (seq B) none Seperate reactions have
relative L2 UPf 1-6 (seq A) dye #1 UPr 1-6 (seq B) none mobility
shifts resulting from L3 UPf 1-6 (seq A) dye #1 UPr 1-6 (seq B)
none staggered sample loading on the separation platform M1 UPf 1-6
(seq A) dye #1 UPr 1-6 (seq B) none Three seperate reactions are
pooled for M2 UPf 1-6 (seq A) dye #2 UPr 1-6 (seq B) none analysis.
Resolution by size & M3 UPf 1-6 (seq A) dye #3 UPr 1-6 (seq B)
none fluorescence (multiplexing with dyes). (Note: products masses
of the three reactions overlap.) Note: "Product" refers to the
amplification product; product seq A.sup.H represents a "heavy"
version of seq A
[0277]
10TABLE 5 PRIMER SEQUENCES SEQ ID No. Accession # Primer Primer
Name Primer Sequence SEQ ID No 1 X00351 beta-actin forward Sp6.1F1
AGGTGACACTATAGAATAACCGA TAAGGCCAACCGCGAGAAGATGA SEQ ID No. 2 X00351
beta-actin reverse T77R3 GTACGACTCACTATAGGGATGGA TAGCAACGTACATGGCTG
SEQ ID No. 3 X00351 beta-actin reverse T77R3Pi
GTACGACTCACTATAGGGATGGA Phosphorylated TAGCAACGTACATGGCTGPi SEQ ID
No. 4 U02426 7.5 kb forward Sp6 (P2) F2 AGGTGACACTATAGAATAACTAT
fragment GCCGGTATCAGCACC SEQ ID No. 5 U02426 7.5 kb reverse T7 (P7)
R2 GTACGACTCACTATAGGGAGATG fragment GCAGCGTGATTTCAC SEQ ID No. 6
n/a INA D forward Sp6F1 (P2) AGGTGACACTATAGAATAGTGAC
ACGTCGCAGAATGAG SEQ ID No. 7 n/a INA D reverse T7R1 (P7)
GTACGACTCACTATAGGGATTGA CCCTTCAGTTGCTTGA SEQ ID No. 8 n/a hSPE
forward Sp6F2 (P2) AGGTGACACTATAGAATAGCTTC ATTAGGTGGCTCAACA SEQ ID
No. 9 n/a hSPE reverse T7R2 (P7) GTACGACTCACTATAGGGAGGCT
CAGCTTGTCGTAGTTC SEQ ID No. 10 n/a Survivin forward Sp6F1 (&
F2) AGGTGACACTATAGAATAGTCAG (P2) CCCAACCTTCACATC SEQ ID No. 11 n/a
Survivin reverse T7R2 (P7) GTACGACTCACTATAGGGACCAC CCTGCAGCTCTATGAC
SEQ ID No. 12 n/a HNF 3 alpha Sp6F3 (P2) AGGTGACACTATAGAATAACTTC
forward AAGGCATACGAACAG SEQ ID No. 13 n/a HNF 3 alpha T7R3 (P7)
GTACGACTCACTATAGGGAGGGA reverse GCTAGGAAGTGTTTAG SEQ ID No. 14
M33197 GAPDH forward Sp6F1 (P2) AGGTGACACTATAGAATAAAGGT
GAAGGTCGGAGTCAA SEQ ID No. 15 M33197 GAPDH reverse T7R1 (P7)
GTACGACTCACTATAGGGAATGA CAAGCTTCCCGTTCTC SEQ ID No. 16 M33197 GAPDH
reverse T7RIPi (P7) GTACGACTCACTATAGGGAATGA phosphorylated
CAAGCTTCCCGTTCTCPi SEQ ID No. 17 n/a EST forward Sp6F4 (P2)
AGGTGACACTATAGAATAGCTCA TCTGCCAACAATC SEQ ID No. 18 n/a EST reverse
T7R4 (P7) GTACGACTCACTATAGGGACTAG CGGAAGCAAATTACAC SEQ ID No. 19
n/a Hoxb 13 forward Sp6F1 (P2) AGGTGACACTATAGAATAGCGAC
ATGACTCCCTGTT SEQ ID No. 20 n/a Hoxb 13 reverse T7R1 (& R2)
GTACGACTCACTATAGGGAAACT (P7) TGTTAGCCGCATACTC SEQ ID No. 21 J01839
KanR forward Sp6 (P2) AGGTGACACTATAGAATAATCAT (V00359) (LP70) F2
CAGCATTGCATTCGATTCCTGTT TG SEQ ID No. 22 J01839 KanR reverse T7
(P7) R2 TACGACTCACTATAGGGAATTCC (V00359) GACTCGTCCAACATC SEQ ID No.
23 n/a Sp6 universal AGGTGACACTATAGAATA primer SEQ ID No. 24 n/a T7
universal GTACGACTCACTATAGGGA primer
[0278] The cases described above are provided for illustrative
purposes. One skilled in the art can envision other embodiments
that would achieve the general purpose of increasing sample
throughput during separation and data collection.
[0279] While the foregoing invention has been described in some
detail for purposes of clarity and understanding, it will be clear
to one skilled in the art from a reading of this disclosure that
various changes in form and detail can be made without departing
from the true scope of the present invention. For example, all the
techniques and compositions described above may be used in various
combinations. All of the compositions and/or methods disclosed and
claimed herein can be made and executed without undue
experimentation in light of the present disclosure. While the
compositions and methods of this invention have been described in
terms of preferred embodiments, it will be apparent to those of
skill in the art that variations may be applied to the compositions
and/or methods, and in the steps or in the sequence of steps of the
method described herein without departing from the concept, spirit
and scope of the invention. More specifically, it will be apparent
that certain agents which are both chemically and physiologically
related may be substituted for the agents described herein while
the same or similar results would be achieved. All such similar
substitutes and modifications apparent to those skilled in the art
are deemed to be within the spirit, scope and concept of the
invention as defined by the appended claims. All publications,
patents, patent applications, and/or other documents cited in this
application are incorporated by reference in their entirety for all
purposes to the same extent as if each individual publication,
patent, patent application, and/or other document were individually
indicated to be incorporated by reference for all purposes.
Sequence CWU 1
1
30 1 46 DNA Artificial Sequence Description of Artificial Sequence
Primer 1 aggtgacact atagaataac cgataaggcc aaccgcgaga agatga 46 2 41
DNA Artificial Sequence Description of Artificial Sequence Primer 2
gtacgactca ctatagggat ggatagcaac gtacatggct g 41 3 41 DNA
Artificial Sequence Description of Artificial Sequence Primer 3
gtacgactca ctatagggat ggatagcaac gtacatggct g 41 4 38 DNA
Artificial Sequence Description of Artificial Sequence Primer 4
aggtgacact atagaataac tatgccggta tcagcacc 38 5 38 DNA Artificial
Sequence Description of Artificial Sequence Primer 5 gtacgactca
ctatagggag atggcagcgt gatttcac 38 6 38 DNA Artificial Sequence
Description of Artificial Sequence Primer 6 aggtgacact atagaatagt
gacacgtcgc agaatgag 38 7 39 DNA Artificial Sequence Description of
Artificial Sequence Primer 7 gtacgactca ctatagggat tgacccttca
gttgcttga 39 8 39 DNA Artificial Sequence Description of Artificial
Sequence Primer 8 aggtgacact atagaatagc ttcattaggt ggctcaaca 39 9
39 DNA Artificial Sequence Description of Artificial Sequence
Primer 9 gtacgactca ctatagggag gctcagcttg tcgtagttc 39 10 38 DNA
Artificial Sequence Description of Artificial Sequence Primer 10
aggtgacact atagaatagt cagcccaacc ttcacatc 38 11 39 DNA Artificial
Sequence Description of Artificial Sequence Primer 11 gtacgactca
ctatagggac caccctgcag ctctatgac 39 12 38 DNA Artificial Sequence
Description of Artificial Sequence Primer 12 aggtgacact atagaataac
ttcaaggcat acgaacag 38 13 39 DNA Artificial Sequence Description of
Artificial Sequence Primer 13 gtacgactca ctatagggag ggagctagga
agtgtttag 39 14 38 DNA Artificial Sequence Description of
Artificial Sequence Primer 14 aggtgacact atagaataaa ggtgaaggtc
ggagtcaa 38 15 39 DNA Artificial Sequence Description of Artificial
Sequence Primer 15 gtacgactca ctatagggaa tgacaagctt cccgttctc 39 16
39 DNA Artificial Sequence Description of Artificial Sequence
Primer 16 gtacgactca ctatagggaa tgacaagctt cccgttctc 39 17 36 DNA
Artificial Sequence Description of Artificial Sequence Primer 17
aggtgacact atagaatagc tcatctgcca acaatc 36 18 39 DNA Artificial
Sequence Description of Artificial Sequence Primer 18 gtacgactca
ctatagggac tagcggaagc aaattacac 39 19 36 DNA Artificial Sequence
Description of Artificial Sequence Primer 19 aggtgacact atagaatagc
gacatgactc cctgtt 36 20 39 DNA Artificial Sequence Description of
Artificial Sequence Primer 20 gtacgactca ctatagggaa acttgttagc
cgcatactc 39 21 48 DNA Artificial Sequence Description of
Artificial Sequence Primer 21 aggtgacact atagaataat catcagcatt
gcattcgatt cctgtttg 48 22 38 DNA Artificial Sequence Description of
Artificial Sequence Primer 22 tacgactcac tatagggaat tccgactcgt
ccaacatc 38 23 18 DNA Artificial Sequence Description of Artificial
Sequence Primer 23 aggtgacact atagaata 18 24 19 DNA Artificial
Sequence Description of Artificial Sequence Primer 24 gtacgactca
ctataggga 19 25 25 DNA Artificial Sequence Description of
Artificial Sequence Primer 25 tttttttagg tgacactata gaata 25 26 26
DNA Artificial Sequence Description of Artificial Sequence Primer
26 tttttttgta cgactcacta taggga 26 27 21 DNA Artificial Sequence
Description of Artificial Sequence Primer 27 tagaggtgac actatagaat
a 21 28 21 DNA Artificial Sequence Description of Artificial
Sequence Primer 28 tttaggtgac actatagaat a 21 29 24 DNA Artificial
Sequence Description of Artificial Sequence Primer 29 gattagaggt
gacactatag aata 24 30 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 30 aggtgacact atagaata 18
* * * * *
References