U.S. patent application number 10/449317 was filed with the patent office on 2003-10-30 for ig/ob fusions and uses thereof.
Invention is credited to Mann, Michael Benjamin, Pelleymounter, Mary Ann, Toombs, Christopher Francis.
Application Number | 20030203837 10/449317 |
Document ID | / |
Family ID | 22247996 |
Filed Date | 2003-10-30 |
United States Patent
Application |
20030203837 |
Kind Code |
A1 |
Pelleymounter, Mary Ann ; et
al. |
October 30, 2003 |
IG/OB fusions and uses thereof
Abstract
The present invention teaches compositions and methods relating
to leptin fusion proteins comprising an antibody constant regions
optionally attached to the N-terminus of the OB proteins. The
compositions of the present invention may be used for treating
obesity, diabetes, increasing lean muscle mass or for control of
body composition.
Inventors: |
Pelleymounter, Mary Ann;
(Thousand Oaks, CA) ; Toombs, Christopher Francis;
(Camarillo, CA) ; Mann, Michael Benjamin;
(Thousand Oaks, CA) |
Correspondence
Address: |
PERKINS COIE LLP
POST OFFICE BOX 1208
SEATTLE
WA
98111-1208
US
|
Family ID: |
22247996 |
Appl. No.: |
10/449317 |
Filed: |
May 30, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10449317 |
May 30, 2003 |
|
|
|
09094931 |
Jun 15, 1998 |
|
|
|
09094931 |
Jun 15, 1998 |
|
|
|
09056719 |
Apr 7, 1998 |
|
|
|
09056719 |
Apr 7, 1998 |
|
|
|
08561732 |
Nov 22, 1995 |
|
|
|
Current U.S.
Class: |
424/139.1 ;
514/21.2; 514/4.8; 530/350 |
Current CPC
Class: |
C07K 14/5759 20130101;
A61K 38/2264 20130101; C07K 2319/30 20130101 |
Class at
Publication: |
514/2 ;
530/350 |
International
Class: |
A61K 038/17; C07K
014/47 |
Claims
We claim:
1. A fusion protein optionally having an N-terminal methionine
comprising an antibody constant region or portion thereof attached
to the N-terminus of an OB protein.
2. The fusion protein of claim 1, wherein the fusion protein and a
pharmaceutically acceptable carrier comprise a pharmaceutical
composition.
3. The fusion protein of claim 2, wherein the composition increases
lean tissue mass.
4. The fusion protein of claim 1, wherein the OB protein is
selected from the group consisting of: (a) the amino acid sequence
1-146 as set forth in SEQ ID NO: 2; (b) the amino acid sequence
1-146 as set forth in SEQ ID NO: 4; (c) the amino acid sequence
1-146 as set forth in SEQ ID NO: 4, having a lysine residue at
position 35 and an isoleucine residue at position 74.
5. The fusion protein of claim 4, wherein the fusion protein and a
pharmaceutically acceptable carrier comprise a pharmaceutical
composition.
6. The fusion protein of claim 5, wherein the composition increases
lean tissue mass.
7. A fusion protein optionally having an N-terminal methionine
comprising an antibody constant region or portion thereof attached
to the N-terminus of an OB protein, wherein the OB protein is
selected from the group consisting of: (a) the amino acid sequence
1-146 as set forth in SEQ ID NO: 2; (b) the amino acid sequence
1-146 as set forth in SEQ ID NO: 4; (c) the amino acid sequence
1-146 as set forth in SEQ ID NO: 4, having a lysine residue at
position 35 and an isoleucine residue at position 74.
8. A pharmaceutical composition for increasing lean muscle tissue
mass comprising a fusion protein of claim 7, and a pharmaceutically
acceptable carrier.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. application Ser.
No. 09/094,931 filed Jun. 15, 1998 and now pending, which is a
Continuation of U.S. application Ser. No. 09/056,719 filed Apr. 7,
1998, which is a Continuation of U.S. application Ser. No.
08/561,732 filed Nov. 22, 1995 and, now abandoned. The disclosures
of these applications are incorporated herein by reference in their
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to methods of using OB protein
compositions for increasing lean tissue mass.
BACKGROUND OF THE INVENTION
[0003] Although the molecular basis for obesity is largely unknown,
the identification of the "OB gene" and protein encoded ("OB
protein") has shed some light on mechanisms the body uses to
regulate body fat deposition. Zhang et al., Nature 372: 425-432
(1994); see also, the Correction at Nature 374: 479 (1995). The OB
protein is active in vivo in both ob/ob mutant mice (mice obese due
to a defect in the production of the OB gene product) as well as in
normal, wild type mice. The biological activity manifests itself
in, among other things, weight loss. See generally, Barinaga,
"Obese" Protein Slims Mice, Science 269:475-476 (1995).
[0004] The other biological effects of OB protein are not well
characterized. It is known, for instance, that in ob/ob mutant
mice, administration of OB protein results in a decrease in serum
insulin levels, and serum glucose levels. It is also known that
administration of OB protein results in a decrease in body fat.
This was observed in both ob/ob mutant mice, as well as non-obese
normal mice. Pelleymounter et al., Science 269: 540-543 (1995);
Halaas et al., Science 269: 543-546 (1995). See also, Campfield et
al., Science 269: 546-549 (1995)(Peripheral and central
administration of microgram doses of OB protein reduced food intake
and body weight of ob/ob and diet-induced obese mice but not in
db/db obese mice.) In none of these reports have toxicities been
observed, even at the highest doses.
[0005] The elucidation of other biological effects of the OB
protein, particularly on animals which may not benefit from or may
not need weight reduction, will provide additional uses for the OB
protein.
[0006] One such use, as provided by the present invention, is in
the increase in lean tissue mass.
[0007] Of course, modulation of diet and exercise is one way to
increase muscle size. There are also compositions used to increase
lean mass. Current compositions thought to increase lean tissue
mass include anabolic steroids, such as testosterone and
derivatives, and human growth hormone. These are noted to have
undesireable side effects however. (The summary below is fully
explained in Remington's Pharmaceutical Sciences, 18th Ed. (1990,
Mack Publishing Co., Easton, Pa. 18042) Chapter 50, at pages
948-1001.))
[0008] Human growth hormone, such as Protropin and Somatropin are
noted to frequently cause hypercalciuria, which usually regresses
in 2 to 3 months. Hyperglycemia and frank diabetes mellitus are
also noted to occur. Myalgia and early morning headaches are noted
to be relatively frequent, and occasionally cases of hypothyroidism
and supersaturation of cholesterol in bile may occur. If the
epiphyses are closed, the hormone should not be used because
continued stimulation of growth of the phalanges and jawbone, but
not other bones, can cause abnormal body proportions.
[0009] Anabolic steroids increase athletic performance and
aggressiveness. Their use has been condemned by the American
College of Sports Medicine. Female performance is improved, but at
the expense of virilization and acne vulgaris. Androgens cause
hirsutism, deepening or hoarseness of the voice, precocious puberty
and epiphyseal closure in immature males, increased libido (in both
male and female) priapism, oligospermia, and testicular atrophy,
enlargement of the clitoris in the female, flushing, decreased
ejaculatory volume and sperm population, gynecomastia,
hypersensitivity, acne, weight gain, edema and hypercalcemia.
Prolonged use increases aggressiveness, sometimes enormously, and
many assaults are stated to be attributable to androgen abuse.
Paranoia-like and other psychotic behavior has been reported.
Biliary stasis and jaundice occur. There have been a few cases
reported of hepatoma following long term therapy.
[0010] It is therefore desireable to have a therapeutic or cosmetic
composition which increases lean tissue mass without side effects
seen in the presently available drugs.
SUMMARY OF THE INVENTION
[0011] The present invention stems from the observation that
administration of OB protein to non-obese as well as obese animals
results in an increase of lean tissue mass. Thus, OB protein has
the capacity to act, in addition to acting as a weight reducing
agent, as an agent affecting lean tissue mass. As such, numerous
lean tissue-mass increasing therapies are contemplated, even for
patients who would not necessarily benefit from weight reduction.
Thus, one aspect of the present invention is the use of OB protein
(or analogs or derivatives thereof) for increasing lean tissue
mass.
[0012] In another aspect, the present invention relates to methods
of treating diabetes, and reducing the levels of insulin necessary
for the treatment of diabetes. The increase in lean tissue mass,
with concomitant decrease in fat tissue mass, increases sensitivity
to insulin. Therefore, the present methods relate to use of OB
protein (or analogs or derivatives thereof) for decreasing the
amount of insulin necessary for the treatment of diabetes.
DETAILED DESCRIPTION
[0013] As stated above, the methods of the present invention are
those for increasing lean tissue mass in an individual. This
increase in lean tissue mass has been observed to accompany a
decrease in fat mass. Thus, even if administration of OB protein
(or analogs or derivatives thereof) does not result in a desired
amount of weight loss, administration of OB protein may be useful
to reconfigure body mass in reducing body fat, while increasing
lean mass.
[0014] Additionally, the increase in lean tissue mass may make an
individual more sensitive to insulin, and thus the present methods
of using OB protein (or analogs or derivatives thereof) are also
related to increasing insulin sensitivity in a diabetic patient.
While the precise mode of action is uncertain, lean tissue (e g.,
muscle), as compared to fat tissue, may be more sensitive to the
effects of insulin. Therefore, an increase in lean tissue may make
available more cells which are sensitive to insulin. Further,
elimination of fat (e.g., adipose) tissue may have the additional
benefit of providing lean tissue with additional exposure to the
peripheral circulation, where circulating insulin is found. It is
therefore another aspect of the present invention that a method of
increasing sensitivity to insulin is provided. Put another way, a
method of decreasing the dosage of insulin needed by a diabetic is
thus also provided.
[0015] The increase in lean tissue may be an increase in muscle
tissue such increase is observed to be an overall increase, rather
than localized to particular areas (e.g., Examples 1 and 2 below).
As such, overall strength may increase. With the increase in
overall strength, other benefits may result, such as a decrease in
bone resorption, with the potential to reverse or improve frailty
such as osteoporosis. In patients desiring improved athletic
performance, an increase in overall strength may also provide as
such. There may be an increase in red blood cell production or
effectiveness, and an increase in oxygenated blood. As such, mental
as well as physical performance may be improved.
[0016] The OB protein may be selected from recombinant murine set
forth below (SEQ. ID No. 2), or recombinant human protein as set
forth in Zhang et al., Nature, supra. herein incorporated by
reference) or those lacking a glutaminyl residue at position 28.
(See Zhang et al, Nature, supra, at page 428.) One may also use the
recombinant human OB protein analog as set forth in SEQ.ID.NO. 4,
which contains 1) an arginine in place of lysine at position 35 and
2) a leucine in place of isoleucine at position 74. (A shorthand
abbreviation for this analog is the recombinant human
R->K.sup.35, L->I.sup.74). The amino acid sequences for the
recombinant human analog and recombinant murine proteins are set
forth below with a methionyl residue at the -1 position, however,
as with any of the present OB proteins and analogs, the methionyl
residue may be absent.
[0017] The murine protein is substantially homologous to the human
protein, particularly as a mature protein, and, further,
particularly at the N-terminus. One may prepare an analog of the
recombinant human protein by altering (such as substituting amino
acid residues), in the recombinant human sequence, the amino acids
which diverge from the murine sequence. Because the recombinant
human protein has biological activity in mice, such analog would
likely be active in humans. For example, using a human protein
having a lysine at residue 35 and an isoleucine at residue 74
according to the numbering of SEQ. ID NO. 4, wherein the first
amino acid is valine, and the amino acid at position 146 is
cysteine, one may substitute with another amino acid one or more of
the amino acids at positions 32, 35, 50, 64, 68, 71, 74, 77, 89,
97, 100, 105, 106, 107, 108, 111, 118, 136, 138, 142, and 145. One
may select the amino acid at the corresponding position of the
murine protein, (SEQ. ID. NO. 2), or another amino acid.
[0018] One may further prepare "consensus" molecules based on the
rat OB protein sequence. Murakami et al., Biochem. Biophys. Res.
Comm. 209: 944-952 (1995) herein incorporated by reference. Rat OB
protein differs from human OB protein at the following positions
(using the numbering of SEQ. ID. NO. 4): 4, 32, 33, 35, 50, 68, 71,
74, 77, 78, 89, 97, 100, 101, 102, 105, 106, 107, 108, 111, 118,
136, 138 and 145. One may substitute wish another amino acid one or
more of the amino acids at these divergent positions. The positions
in bold print are those which in which the murine OB protein as
well as the rat OB protein are divergent from the human OB protein,
and thus, are particularly suitable for alteration. At one or more
of these positions, one may substitute an amino acid from the
corresponding rat OB protein, or another amino acid.
[0019] The positions from both rat and murine OB protein which
diverge from the mature human OB protein are: 4, 32, 33, 35, 50,
64, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111,
118, 136, 138, 142, and 145. A human OB protein according to SEQ.
ID. No. 4 (with lysine at position 35 and isoleucine at position
74) having one or more of the above amino acids deleted or replaced
with another amino acid, such as the amino acid found in the
corresponding rat or murine sequence, may also be effective.
[0020] In addition, the amino acids found in rhesus monkey OB
protein which diverge from the mature human OB protein are (with
identitites noted in parentheses in one letter amino acid
abbreviation): 8 (S), 35 (R), 48(V), 53(Q), 60(I), 66(I), 67(N),
68((L), 89(L), 100(L), 108(E), 112 (D), and 118 (L). Since (as
described in Example 2, below) the recombinant human OB protein is
active in cynomolgus monkeys, a human OB protein according to SEQ.
ID. NO. 4 (with lysine at position 35 and isoleucine at position
74) having one or more of the rhesus monkey divirgent amino acids
replaced with another amino acid, such as the amino acids in
parentheses, may be effective. It should be noted that certain
rhesus divergent amino acids are also those found in the above
murine species (positions 35, 68, 89, 100 and 112). Thus, one may
prepare a murine/rhesus/human consensus molecule having (using the
numbering of SEQ.ID. NO. 4 having a lysine at position 35 and an
isoleucine at position 74) having one or more of the amino acids at
positions replaced by another amino acid: 4, 8, 32, 33, 35, 48, 50,
53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106,
107, 108, 111, 112, 118, 136, 138, 142, and 145.
[0021] Other analogs may be prepared by deleting a part of the
protein amino acid sequence. For example, the mature protein lacks
a leader sequence (-22 to -1). One may prepare the following
truncated forms of human OB protein molecules (using the numbering
of SEQ. ID. NO. 4):
[0022] (a) amino acids 98-146
[0023] (b) amino acids 1-32
[0024] (c) amino acids 40-116
[0025] (d) amino acids 1-99 and (connected to) 112-146.
[0026] (e) amino acids 1-99 and (connected to) 112-146 having one
or more of amino acids 100-111 placed between amino acids 99 and
112.
[0027] In addition, the truncated forms may also have altered one
or more of the amino acids which are divergent (in the rhesus, rat
or murine OB protein) from human OB protein. Furthermore, any
alterations may be in the form of altered amino acids, such as
peptidomimetics or D-amino acids.
[0028] The present protein (herein the term "protein" is used to
include "peptide" and OB analogs, such as those recited infra,
unless otherwise indicated) may also be derivatized by the
attachment of one or more chemical moieties to the protein moiety.
The chemically modified derivatives may be further formulated for
intraarterial, intraperitoneal, intramuscular, subcutaneous,
intravenous, oral, nasal, pulmonary, topical or other routes of
administration. Chemical modification of biologically active
proteins has been found to provide additional advantages under
certain circumstances, such as increasing the stability and
circulation time of the therapeutic protein and decreasing
immunogenicity. See U.S. Pat. No. 4,179,337, Davis et al., issued
Dec. 18, 1979. For a review, see Abuchowski et al., in Enzymes as
Drugs. (J. S. Holcerberg and J. Roberts, eds. pp. 367-383 (1981)).
A review article describing protein modification and fusion
proteins is Francis, Focus on Growth Factors 3: 4-10 (May 1992)
(published by Mediscript, Mountview Court, Friern Barnet Lane,
London N20, OLD, UK).
[0029] The chemical moieties suitable for derivatization may be
selected from among various water soluble polymers. The polymer
selected should be water soluble so that the protein to which it is
attached does not precipitate in an aqueous environment, such as a
physiological environment. Preferably, for therapeutic use of the
end-product preparation, the polymer will be pharmaceutically
acceptable. One skilled in the art will be able to select the
desired polymer based on such considerations as whether the
polymer/protein conjugate will be used therapeutically, and if so,
the desired dosage, circulation time, resistance to proteolysis,
and other considerations. For the present proteins and peptides,
the effectiveness of the derivatization may be ascertained by
administering the derivative, in the desired form (i.e., by osmotic
pump, or, more preferably, by injection or infusion, or, further
formulated for oral, pulmonary or nasal delivery, for example), and
observing biological effects as described herein.
[0030] The water soluble polymer may be selected from the group
consisting of, for example, polyethylene glycol, copolymers of
ethylene glycol/propylene glycol, carboxymethylcellulose, dextran,
polyvinyl alcohol, polyvinyl pyrolidone, poly-1,3-dioxolane, poly
1,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids
(either homopolymers or random or non-random copolymers), and
dextran or poly(n-vinyl pyrolidone)polyethylene glycol, propylene
glycol homopolymers, polypropylene oxide/ethylene oxide
co-polymers, polyoxyethylated polyols, polystyrenemaleate and
polyvinyl alcohol. Polyethylene glycol propionaldenhyde may have
advantages in manufacturing due to its stability in water.
[0031] Fusion proteins may be prepared by attaching polyaminoacids
to the OB protein (or analog) moiety. For example, the polyamino
acid may be a carrier protein which serves to increase the
circulation half life of the protein. For the present therapeutic
or cosmetic purposes, such polyamino acid should be those which do
not create neutralizing antigenic response, or other adverse
response. Such polyamino acid may be selected from the group
consisting of serum album (such as human serum albumin), an
antibody or portion thereof (such as an antibody constant region,
sometimes called "Fc",) or other polyamino acids As indicated
below, the location of attachment of the polyamino acid may be at
the N-terminus of the OB protein moiety, or other place, and also
may be connected by a chemical "linker" moiety to the OB
protein.
[0032] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 2 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog).
[0033] The number of polymer molecules so attached may vary, and
one skilled in the art will be able to ascertain the effect on
function. One may mono-derivatize, or may provide, for a di-, tri-,
tetra- or some combination of derivatization, with the same or
different chemical moieties (e.g., polymers, such as different
weights of polyethylene glycols). The proportion of polymer
molecules to protein (or peptide) molecules will vary, as will
their concentrations in the reaction mixture. In general, the
optimum ratio (in terms of efficiency of reaction in that there is
no excess unreacted protein or polymer) will be determined by
factors such as the desired degree of derivatization (e.g., mono,
di-, tri-, etc.), the molecular weight of the polymer selected,
whether the polymer is branched Cr unbranched, and the reaction
conditions.
[0034] The chemical moieties should be attached to the protein with
consideration of effects on functional or antigenic domains of the
protein. There are a number of attachment methods available to
those skilled in the art. E.g., EP 0 401 384 herein incorporated by
reference (coupling PEG to G-CSF), see also Malik et al., Exp.
Hematol. 20: 1028-1035 (1992) (reporting pegylation of GM-CSF using
tresyl chloride). For example, polyethylene glycol may be
covalently bound through amino acid residues via a reactive group,
such as, a free amino or carboxyl group. Reactive groups are those
to which an activated polyethylene glycol molecule may be bound.
The amino acid residues having a free amino group may include
lysine residues and the N-terminal amino acid residue. Those having
a free carboxyl group may include aspartic acid residues, glutamic
acid residues, and the C-terminal amino acid residue. Sulfhydrl
groups may also be used as a reactive group for attaching the
polyethylene glycol molecule(s). Preferred for therapeutic purposes
is attachment at an amino group, such as attachment at the
N-terminus or lysine group. Attachment at residues-important for
receptor binding should be avoided if receptor binding is
desired.
[0035] One may specifically desire N-terminally chemically modified
protein. Using polyethylene glycol as an illustration of the
present compositions, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein molecules in
the reaction mix, the type of pegylation reaction to be performed,
and the method of obtaining the selected N-terminally pegylated
protein. The method of obtaining the N-terminally pegylated
preparation (i.e., separating this moiety from other monopegylated
moieties if necessary) may be by purification of the N-terminally
pegylated material from a population of pegylated protein
molecules. Selective N-terminal chemical modification may be
accomplished by reductive alkylation which exploits differential
reactivity of different types of primary amino groups (lysine
versus the N-terminal) available for derivatization in a particular
protein. Under the appropriate reaction conditions, substantially
selective derivatization of the protein at the N-terminus with a
carbonyl group containing polymer is achieved. For example, one may
selectively N-terminally pegylate the protein by performing the
reaction at a pH which allows one to take advantage of the pK.sub.a
differences between the .epsilon.-amino group of the lysine
residues and that of the (amino group of the N-terminal residue of
the protein. By such selective derivatization, attachment of a
water soluble polymer to a protein is controlled: the conjugation
with the polymer takes place predominantly at the N-terminus of the
protein and no significant modification of other reactive groups,
such as the lysine side chain amino groups, occurs. Using reductive
alkylation, the water soluble polymer may be of the type described
above, and should have a single reactive aldehyde for coupling to
the protein. Polyethylene glycol propionaldehyde, containing a
single reactive aldehyde, may be used.
[0036] An N-terminally monopegylated derivative is preferred for
ease in production of a therapeutic. N-terminal pegylation ensures
a homogenous product as, characterization of the product is
simplified relative to di-, tri- or other multi pegylated products.
The use of the above reductive alkylation process for preparation
of an N-terminal product is preferred for ease in commercial
manufacturing.
[0037] In yet another aspect of the present invention, provided are
methods of using pharmaceutical compositions of the proteins, and
derivatives. Such pharmaceutical compositions may be for
administration by injection, or for oral, pulmonary, nasal,
transdermal or other forms of administration. In general,
comprehended by the invention are pharmaceutical compositions
comprising effective amounts of protein or derivative products of
the invention together with pharmaceutically acceptable diluents,
preservatives, solubilizers, emulsifiers, adjuvants and/or
carriers. Such compositions include diluents of various buffer
content (e.g., Tris-HCl, acetate, phosphate), pH and ionic
strength; additives such as detergents and solubilizing agents
(e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic
acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl
alcohol) and bulking substances (e.g., lactose, mannitol);
incorporation of the material into particulate preparations of
polymeric compounds such as polylactic acid, polyglycolic acid,
etc. or into liposomes. Hylauronic acid may also be used, and this
may have the effect of promoting sustained duration in the
circulation. Such compositions may influence the physical state,
stability, rate of in vivo release, and rate of in vivo clearance
of the present proteins and derivatives. See, e.g., Remington's
Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co.,
Easton, Pa. 18042) pages 1435-1712 which are herein incorporated by
reference. The compositions may be prepared in liquid form, or
maybe in dried powder, such as lyophilized form. Implantable
sustained release formulations are also contemplated, as are
transdermal formulations.
[0038] Contemplated for use herein are oral solid dosage forms,
which are described generally in Remington's Pharmaceutical
Sciences, 18th Ed. 1990 (Mack Publishing Co. Easton Pa. 18042) at
Chapter 89, which is herein incorporated by reference. Solid dosage
forms include tablets, capsules, pills, troches or lozenges,
cachets or pellets. Also, liposomal or proteinoid encapsulation may
be used to formulate the present compositions (as, for example,
proteinoid microspheres reported in U.S. Pat. No. 4,925,673).
Liposomal encapsulation may be used and the liposomes may be
derivatized with various polymers (E.g., U.S. Pat. No. 5,013,556).
A description of possible solid dosage forms for the therapeutic is
given by Marshall, K. In: Modern Pharmaceutics Edited by G. S.
Banker and C. T. Rhodes Chapter 10, 1979, herein incorporated by
reference. In general, the formulation will include the protein (or
analog or derivative), and inert ingredients which allow for
protection against the stomach environment, and release of the
biologically active material in the intestine.
[0039] Also specifically contemplated are oral dosage forms of the
above derivatized proteins. Protein may be chemically modified so
that oral delivery of the derivative is efficacious. Generally, the
chemical modification contemplated is the attachment of at least
one moiety to the protein (or peptide) molecule itself, where said
moiety permits (a) inhibition of proteolysis and (b) uptake into
the blood stream from the stomach or intestine. Also desired is the
increase in overall stability of the protein and increase in
circulation time in the body. Examples of such moieties include:
Polyethylene glycol, copolymers of ethylene glycol and propylene
glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol,
polyvinyl pyrrolidone and polyproline. Abuchowski and Davis,
Soluble Polymer-Enzyme Adducts. In: "Enzymes as Drugs", Hocenberg
and Roberts, eds., Wiley-Interscience, New York, N.Y., (1981), pp
367-383; Newmark, et al., J. Appl. Biochem. 4: 185-189 (1982).
Other polymers that could be used are poly-1,3-dioxolane and
poly-1,3,6-tioxocane.
[0040] For the protein (or derivative) the location of release may
be-the stomach, the small intestine (the duodenum, the jejunem, or
the ileum), or the large intestine. One skilled in the art has
available formulations which will not dissolve in the stomach, yet
will release the material in the duodenum or elsewhere in the
intestine. Preferably, the release will avoid the deleterious
effects of the stomach environment, either by protection of the
protein (or derivative) or by release of the biologically active
material beyond the stomach environment, such as in the
intestine.
[0041] To ensure full gastric resistance a coating impermeable to
at least pH 5.0 is essential. Examples of the more common inert
ingredients that are used as enteric coatings are cellulose acetate
trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP),
HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit
L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L,
Eudragit S, and Shellac. These coatings may be used as mixed
films.
[0042] A coating or mixture of coatings can also be used on
tablets, which are not intended for protection against the stomach.
This can include sugar coatings, or coatings which make the tablet
easier to swallow. Capsules may consist of a hard shell (such as
gelatin) for delivery of dry therapeutic i.e. powder; for liquid
forms, a soft gelatin shell may be used. The shell material of
cachets could-be thick starch or other edible paper. For pills,
lozenges, molded tablets or tablet triturates, moist massing
techniques can be used.
[0043] The therapeutic can be included in the formulation as fine
multiparticulates in the form of granules or pellets of particle
size about 1 mm. The formulation of the material for capsule
administration could also be as a powder, lightly compressed plugs
or even as tablets. The therapeutic could be prepared by
compression.
[0044] Colorants and flavoring agents may all be included. For
example, the protein (or derivative) may be formulated (such as by
liposome or microsphere encapsulation) and then further contained
within an edible product, such as a refrigerated beverage
containing colorants and flavoring agents.
[0045] One may dilute or increase the volume of the therapeutic
with an inert material. These diluents could include carbohydrates,
especially mannitol, .alpha.-lactose, anhydrous lactose, cellulose,
sucrose, modified dextrans and starch. Certain inorganic salts may
be also be used as fillers including calcium triphosphate,
magnesium carbonate and sodium chloride. Some commercially
available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and
Avicell.
[0046] Disintegrants may be included in the formulation of the
therapeutic into a solid dosage form. Materials used as
disintegrates include but are not limited to starch including the
commercial disintegrant based on starch, Explotab. Sodium starch
glycolate, Amberlite, sodium carboxymethylcellulose,
ultramylopectin, sodium alginate, gelatin, orange peel, acid
carboxymethyl cellulose, natural sponge and bentonite may all be
used. Another form of the disintegrants are the insoluble cationic
exchange resins. Powdered gums may be used as disintegrants and as
binders and these can include powdered gums such as agar, Karaya or
tragacanth. Alginic acid and its sodium salt are also useful as
disintegrants.
[0047] Binders may be used to hold the therapeutic agent together
to form a hard tablet and include materials from natural products
such as acacia, tragacanth, starch and gelatin. Others include
methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl
cellulose (CMC). Polyvinyl pyrrolidone (PVP) and
hydroxypropylmethyl cellulose (HPMC) could both be used in
alcoholic solutions to granulate the therapeutic.
[0048] An antifrictional agent may be included in the formulation
of the therapeutic to prevent sticking during the formulation
process. Lubricants may be used as a layer between the therapeutic
and the die wall, and these can include but are not limited to;
stearic acid including its magnesium and calcium salts,
polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and
waxes. Soluble lubricants may also be used such as sodium lauryl
sulfate, magnesium lauryl sulfate, polyethylene glycol of various
molecular weights, Carbowax 4000 and 6000.
[0049] Glidants that might improve the flow properties of the drug
during formulation and to aid rearrangement during compression
might be added. The glidants may include starch, talc, pyrogenic
silica and hydrated silicoaluminate.
[0050] To aid dissolution of the therapeutic into the aqueous
environment a surfactant might be added as a wetting agent.
Surfactants may include anionic detergents such as sodium lauryl
sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium
sulfonate. Cationic detergents might be used and could include
benzalkonium chloride or benzethomium chloride. The list of
potential nonionic detergents that could be included in the
formulation as surfactants are lauromacrogol 400, polyoxyl 40
stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60,
glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty
acid ester, methyl cellulose and carboxymethyl cellulose. These
surfactants could be present in the formulation of the protein or
derivative either alone or as a mixture in different ratios.
[0051] Additives which potentially enhance uptake of the protein
(or derivative) are for instance the fatty acids oleic acid,
linoleic acid and linolenic acid.
[0052] Controlled release formulation may be desirable. The drug
could be incorporated into an inert matrix which permits release by
either diffusion or leaching mechanisms i.e. gums. Slowly
degenerating matrices may also be incorporated into the
formulation. Another form of a controlled release of this
therapeutic is by a method based on the Oros therapeutic system
(Alza Corp.), i.e. the drug is enclosed in a semipermeable membrane
which allows water to enter and push drug out through a single
small opening due to osmotic effects. Some entric coatings also
have a delayed release effect.
[0053] Other coatings may be used for the formulation. These
include a variety of sugars which could be applied in a coating
pan. She therapeutic agent could also be given in a film coated
tablet and the materials used in this instance are divided into 2
groups. The first are the nonenteric materials and include methyl
cellulose ethyl cellulose, hydroxyethyl cellulose,
methylhydroxy-ethyl cellulose, hydroxypropyl cellulose,
hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose,
providone and the polyethylene glycols. The second group consists
of the enteric materials that are commonly esters of phthalic
acid.
[0054] A mix of materials sight be used to provide the optimum film
coating. Film coating may be carried out in a pan coater or in a
fluidized bed or by compression coating.
[0055] Also contemplated herein is pulmonary delivery of the
present protein, or derivative thereof. The protein (derivative) is
delivered to the lungs of a mammal while inhaling nd traverses
across the lung epithelial lining to the blood stream. (Other
reports of this include Adjei at al., Pharmaceutical Research 7:
565-569 (1990); Adjei et al., International Journal of
Pharmaceutics 63: 135-144 (1990)(leuprolide acetate); Braquet et
al., Journal of Cardiovascular pharmacology 13(suppl. 5): s.143-146
(1989)(endothelin-1); Hubbard et al., Annals of Internal Medicine
3: 206-212 (1989)(.alpha.1-antitrypsin); Smith et al., J. Clin.
Invest. 84: 1145-1146 (1989)(.alpha.-1-proteinase); Oswein et al.
"Aerosolization of Proteins", Proceedings of Symposium on
Respiratory Drug Delivery II, Keystone, Colo., March, 1990
(recombinant human growth hormone); Debs et al., The Journal of
Immunology 140: 3482-3488 (1988)(interferon-.gamma. and tumor
necrosis factor alpha) and Platz et al. U.S. Pat. No. 5,284,656
(granulocyte colony stimulating factor).
[0056] Contemplated for use in the practice of this invention are a
wide range of mechanical devices designed for pulmonary delivery of
therapeutic produces, including but not limited to nebulizers,
metered dose inhalers, and powder inhalers all of-which are
familiar to those skilled in the art.
[0057] Some specific examples of commercially available devices
suitable for the practice of this invention are the Ultravent
nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the
Acorn II nebulizer, manufactured by Marquest Medical Products,
Englewood, Colo.; the ventolin metered dose inhaler, manufactured
by Glaxo Inc., Research Triangle Park, N.C.; and the Spinhaler
powder inhaler, manufactured by Fisons Corp., Bedford, Mass.
[0058] All such devices require the use of formulations suitable
for the dispensing of protein (or analog or derivative). Typically,
each formulation is specific to the type of device employed and may
involve the use of an appropriate propellant material, in addition
to diluents, adjuvants and/or carriers useful in therapy.
[0059] The protein (or derivative) should most advantageously be
prepared in particulate form with an average particle size of less
than 10 .mu.m (or microns), most preferably 0.5 to 5 .mu.m, for
most effective delivery to the distal lung.
[0060] Carriers include carbohydrates such as trehalose, mannitol,
xylitol, sucrose, lactose, and sorbitol. Other ingredients for use
in formulations ray include DPPC, DOPE, DSPC and DOPC. Natural or
synthetic surfactants may be used. Polyethylene glycol may be used
(even apart from its use in derivatizing the protein or analog).
Dextrans, such as cyclodextran, may be used. Bile salts and other
related enhancers may be used. Cellulose and cellulose derivatives
may be used. Amino acids may be used, such as use in a buffer
formulation.
[0061] Also, the use of liposomes, microcapsules or microspheres,
inclusion complexes, or other types of carriers is
contemplated.
[0062] Formulations suitable for use with a nebulizer, either jet
or ultrasonic, will typically comprise protein (or derivative)
dissolved in water at a concentration of about 0.1 to 25 mg of
biologically active protein per mL of solution. The formulation may
also include a buffer and a simple sugar (e.g., for protein
stabilization and regulation of osmotic pressure). The nebulizer
formulation may also contain a surfactant, to reduce or prevent
surface induced aggregation of the protein caused by atomization of
the solution in forming the aerosol.
[0063] Formulations for use with a metered-dose inhaler device will
generally comprise a finely divided powder containing the protein
(or derivative) suspended in a propellant with the aid of a
surfactant. The propellant may be any conventional material
employed for this purpose, such as a chlorofluorocarbon, a
hydrochlorofluorocarbon, a hydrofluorbcarbon, or a hydrocarbon,
including trichlorofluoromethane, dichlorodifluoromethane,
dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or
combinations thereof. Suitable surfactants include sorbitan
trioleate and soya lecithin. Oleic acid may also be useful as a
surfactant.
[0064] Formulations for dispensing from a powder inhaler device
will comprise a finely divided dry powder containing protein (or
derivative) and may also include a bulking agent, such as lactose,
sorbitol, sucrose, mannitol, trehalose, or xylitol in amounts which
facilitate dispersal of the powder from the device, e.g., 50 to 90%
by weight of the formulation.
[0065] Nasal delivery of the protein (or analog or derivative) is
also contemplated. Nasal delivery allows the passage of the protein
to the blood stream directly after administering the therapeutic
product to the nose, without the necessity for deposition of the
product in the lung. Formulations for nasal delivery include those
with dextran or cyclodextran. Delivery via transport across other
mucus membranes is also contemplated.
[0066] One skilled in the art will be able to ascertain effective
dosages by administration and observing the desired therapeutic
effect. Preferably, the formulation of the molecule will be such
that between about 0.10 .mu.g/kg/day and 10 mg/kg/day will yield
the desired therapeutic effect. The effective dosages may be
determined using diagnostic tools over time. For example, a
diagnostic for measuring the amount of OB protein in the blood (or
plasma or serum) may first be used to determine endogenous levels
of OB protein. Such diagnostic tool may be in the form of an
antibody assay, such as an antibody sandwich assay. The amount of
endogenous OB protein is quantified initially, and a baseline is
determined. The therapeutic dosages are determined as the
quantification of endogenous and exogenous OB protein (that is,
protein, analog or derivative found within the body, either
self-produced or administered) is continued over the course of
therapy. The dosages may therefore vary over the course of therapy,
with a relatively high dosage being used initially, until
therapeutic benefit is seen, and lower dosages used to maintain the
therapeutic benefits.
[0067] Ideally, in situations where solely an increase in lean body
mass is desired, the dosage will be insufficient to result in
weight loss. Thus, during an initial course of therapy of an obese
person, dosages may be administered whereby weight loss and
concomitant fat tissue decrease/lean mass increase is achieved.
Once sufficient weight loss is achieved, a dosage sufficient to
prevent re-gaining weight, yet sufficient to maintain desired lean
mass increase (or, prevention of lean mass depletion) may be
administered. These dosages can be determined empirically, as the
effects of OB protein are reversible. E.g., Campfield et al.,
Science 269: 546-549 (1995) at 547. Thus, if a dosage resulting in
weight loss is observed when weight loss is not desired, one would
administer a lower dose in order to achieve the desired increase in
lean tissue mass, yet maintain the desired weight.
[0068] For increasing an individual's sensitivity to insulin,
similar dosage considerations may be taken into account. Lean mass
increase without weight loss may be achieved sufficient to decrease
the amount of insulin (or, potentially, amylin or other potential
diabetes treating drugs) an individual would be administered for
the treatment of diabetes.
[0069] For increasing overall strength, there may be similar dosage
considerations. Lean mass increase with concomitant increase in
overall strength may be achieved with doses insufficient to result
in weight loss. Other benefits, such as an increase in red blood
cells (and oxygenation in the blood) and a decrease in bone
resorption or osteoporosis may also be achieved in the absence of
weight loss.
[0070] The present methods may be used in conjunction with other
medicaments, such as those useful for the treatment of
diabetes.(e.g., insulin, and possibly amylin), cholesterol and
blood pressure lowering medicaments (such as those which reduce
blood lipid levels or other cardiovascular medicaments), and
activity increasing medicaments (e.g., amphetamines). Appetite
suppressants may also be used. Such administration may be
simultaneous or may be in seriatim.
[0071] In addition, the present methods may be used in conjunction
with surgical procedures, such as cosmetic surgeries designed to
alter the overall appearance of a body (e.g., liposuction or laser
surgeries designed to reduce body mass, or implant surgeries
designed to increase the appearance of body mass). The health
benefits of cardiac surgeries, such as bypass surgeries or other
surgeries designed to relieve a deleterious condition caused by
blockage of blood vessels by fatty deposits, such as arterial
plaque, may be increased with concomitant use of the present
compositions and methods. Methods to eliminate gall stones, such as
ultrasonic or laser methods, may also be used either prior to,
during or after a course of the present therapeutic methods.
Furthermore, the present methods may be used as an adjunct to
surgeries or therapies for broken bones, damaged muscle, or other
therapies which would be improved by an increase in lean tissue
mass.
[0072] Therefore, the present invention provides a method for
increasing lean tissue mass, comprised of administering an
effective amount of an OB protein, analog or derivative thereof
selected from among:
[0073] (a) the amino acid sequence 1-146 as set forth in SEQ. ID.
NO. 2 (below) or SEQ ID. NO. 4 (below),
[0074] (b) the amino acid sequence set 1-146 as forth in SEQ. ID.
NO. 4 (below) having a lysine residue at position 35 and an
isoleucine residue at position 74;
[0075] (c) the amino acid sequence of subpart (b) having a
different amino acid substituted in one or more of the following
positions (using the numbering according to SEQ. ID. NO. 4, and
retaining the same numbering even in the absence of a glutaminyl
residue at position 28): 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66,
67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111,
112, 118, 136, 138, 142, and 145;
[0076] (d) the amino acid sequence of subparts (a), (b) or (c)
optionally lacking a glutaminyl residue at position 28;
[0077] (e): the amino acid sequence of subparts (a), (b), (c), or
(d) having a methionyl residue at the N terminus.
[0078] (f) a truncated OB protein analog selected from among:
(using the numbering of SEQ. ID. NO. 4 having a lysine residue at
position 35 and an isoleucine residue at position 74):
[0079] (i) amino acids 98-146
[0080] (ii) amino acids 1-32
[0081] (iii) amino acids 40-116
[0082] (iv) amino acids 1-99 and 112-146
[0083] (v) amino acids 1-99 and 112-146 having one or more of amino
acids 100-111 sequentially placed between amino acids 99 and 112;
and,
[0084] (vi) the truncated OB analog of subpart (i) having one or
more of amino acids 100, 102, 105, 106, 107, 108, 111, 112, 118,
136, 138, 142, and 145 substituted with another amino acid;
[0085] (vii) the truncated analog of subpart (ii) having one or
more of amino acids 4, 8 and 32 substituted with another amino
acid;
[0086] (viii) the truncated analog of subpart (iii) having one or
more of amino acids 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89,
97, 100, 102, 105, 106, 107, 108, 111 and 112 replaced with another
amino acid;
[0087] (vix) the truncated analog of subpart (iv) having one or
more of amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67,
68, 71, 74, 77, 78, 89, 97, 112, 118, 136, 138, 142, and 145
replaced with another amino acid;
[0088] (x) the truncated analog of subpart (v) having one or more
of amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68,
71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112,
118, 136, 138, 142, and 145 replaced with another amino acid;
[0089] (xi) the truncated analog of any of subparts (i)-(x) having
an N-terminal methionyl residue; and
[0090] (g) the OB protein or analog derivative of any of subparts
(a) through (f) comprised of a chemical moiety connected to the
protein moiety;
[0091] (h) a derivative of subpart (g) wherein said chemical moiety
is a water soluble polymer moiety;
[0092] (i) a derivative of subpart (h) wherein said water soluble
polymer moiety is polyethylene glycol;
[0093] (j) A derivative of subpart (h) wherein said water soluble
polymer moiety is a polyamino acid moiety;
[0094] (k) a derivative of subpart (h) wherein said water soluble
polymer moiety is attached at solely the N-terminus of said protein
moiety
[0095] (l) an OB protein, analog or derivative of any of subparts
(a) through (k) in a pharmaceutically acceptable carrier.
[0096] The following examples are offered to more fully illustrate
the invention, but are not to be construed as limiting the scope
thereof. Example 1 demonstrates that OB protein is effective for
increasing lean mass in non-obese animals. Example 2 demonstrates
that OB protein is effective for increasing lean mass in obese
primates. Example 3 through 5 are prophetic examples of human use.
Materials and Methods follow.
EXAMPLE 1
[0097] These data demonstrate that the OB protein, or analogs or
derivatives thereof, is effective for increasing lean mass.
[0098] Recombinant methionyl murine OB protein (as described below)
was continuously administered via osmotic pump infusion for a
period of four weeks. Table 1 data show the average body
composition (for CD1 mice) at the dosages indicated:
1 Dose (mg/kg/day) Water (g) Fat (g) Lean Mass (g) PBS 22.13 +/-
.33 8.39 +/- .67 3.2 +/- .28 0.03 22.09 +/- .55 9.44 +/- .61 2.32
+/- .54 0.1 21.02 +/- .44 6.64 +/- -1 3.85 +/- .57 0.3 22.02 +/-
.31 5.22 +/- .91 4.72 +/- .48 1.0 21.34 +/- .38 1.51 +/- .48 6.94
+/- .25
[0099] In non-obese CD1 mice, recombinant methionyl murine OB
protein continuously administered at a doses of either 0.3 or 1
mg/kg/day was shown to effect an increase in lean mass relative to
the control animals, who were administered PBS.
EXAMPLE 2
[0100] This Example demonstrates that recombinant methionyl human
OB protein causes lean tissue mass increase in primates.
[0101] Obese cynomolgus monkeys having greater than 20% body fat
were administered recombinant methionyl human OB protein
subcutaneously, at a daily dose of 1 mg protein/kg body weight/day
(see Materials and Methods, below). Control animals were
administered phosphate buffered saline. Body composition was
performed using Dual Energy X-Ray Absorptimetry ("DEXA")
analysis.
[0102] Measurements of body composition were taken at 7 day
intervals.
[0103] Tables 2A and 2B show the results of body composition
analysis in terms of mass of fat or lean tissue. Data are presented
in grams. Results for the 2 control animals are in Table 2A. The
data for 4 test animals are presented in Table 2B. (Data for bone
mass are also presented). As can be seen, at day 28, the test
animals lost approximately 264 grams of fat, and gained
approximately 138 grams of lean mass. At day 28, the controls lost
36 grams of fat tissue and gained approximately 25 grams of lean
mass. This demonstrates that OB protein causes an increase in lean
tissue mass.
2TABLE 2A CONTROL (n = 2) BASELINE DAY 7 DAY 14 DAY 21 DAY 28 LEAN
5393 .+-. 5411 .+-. 5467 .+-. 5410 .+-. 5418 .+-. MASS .+-. 894 863
934 983 802 STD DEV FAT 2884 .+-. 2838 .+-. 2835 .+-. 2852 .+-.
2848 .+-. MASS .+-. 1962 1936 .+-. 2113 2271 2122 STD DEV BONE 325
.+-. 324 .+-. 324 .+-. 325 .+-. 321 .+-. MASS .+-. 12 4 11 16 7 STD
DEV
[0104]
3TABLE 2B OB PROTEIN BASE- (n = 4) LINE DAY 7 DAY 14 DAY 21 DAY 28
LEAN MASS .+-. 4877 .+-. 4782 .+-. 4899 .+-. 4957 .+-. 5015* .+-.
STD DEV 960 927 1037 1053 1192 FAT MASS .+-. 2577 .+-. 2536 .+-.
2432 .+-. 2380 .+-. 2313* .+-. STD DEV 1927 1982 1874 1924 1903
BONE MASS .+-. 296 .+-. 296 .+-. 294 .+-. 292 .+-. 291 .+-. STD DEV
96 99 97 96 96 *indicates p-value less than 0.05 for repeated
measures ANOVA
EXAMPLE 3
[0105] A non-obese human patient desires an increase in lean tissue
mass for therapeutic purposes, such as recovery from illness which
depleted lean tissue mass. The patient is administered an effective
amount of OB protein, analog or derivative thereof to result in the
desired increase in lean tissue mass. Increase in lean tissue mass
is monitored using DEXA scanning. Levels of circulating OB protein
or analog or derivative may be monitored using a diagnostic kit,
such as an antibody assay against the OB protein (or other
antigenic source if applicable).
EXAMPLE 4
[0106] A human subject desires an increase in lean tissue mass for
cosmetic or athletic purposes, such as an increase in lean tissue
in order to improve outward appearance. The patient is administered
an effective amount of OB protein, analog or derivative thereof to
result in the desired increase in lean tissue mass. Increase in
lean tissue mass is monitored using DEXA scanning. Oxygen levels in
the blood increase. Levels of circulating OB protein or analog or
derivative may be monitored using a diagnostic kit, such as an
antibody assay against the OB protein (or other antigenic source if
applicable).
EXAMPLE 5
[0107] A diabetic human patient desires to use decreased dosages of
insulin for treatment of diabetes. The patient is administered an
effective amount of OB protein, analog or derivative thereof to
result in an increase in lean tissue mass. The patient's
sensitivity to insulin increases, and She dosage of insulin
necessary to alleviate symptoms of diabetes is decreased, either in
terms of a decrease in the units of insulin needed, or in terms of
a decrease in the number of injections of insulin needed per day.
Levels of circulating OB protein or analog or derivative may be
monitored using a diagnostic kit, such as an antibody assay against
the OB protein (or other antigenic source if applicable).
EXAMPLE 6
[0108] A non-obese elderly human patient desires an increase in
overall strength. The patient is administered an effective amount
of OB protein, analog or derivative thereof to result in an
increase in lean tissue mass, and increase in overall strength.
Bone resorption is also decreased, and an osteoporosis condition is
improved. Levels of circulating OB protein or analog or derivative
may be monitored using a diagnostic kit, such as an antibody assay
against the OB protein (or other antigenic source if
applicable).
[0109] Materials and Methods
[0110] Animals:
[0111] Rodents. Wild type CD1 mice were used for Example 1 (Table 1
data). Animals were maintained under humane conditions.
[0112] Primates: A total of six cynomolgus monkeys were used. All
monkeys were at least 20% fat at the outset of the study. Animals
were randomized for weight, and four animals were tested with OB
protein, two animals were controls.
[0113] Administration of Protein or Vehicle.
[0114] For Rodents. For Example 1, (Table 1 data) recombinant
murine protein (as described below) or vehicle (phosphate buffered
saline, "PBS", pH 7.4) was administered by osmotic pump infusion.
Alzet osmotic minipumps (Alza, Palo Alto, Calif., model no. 2002)
were surgically placed in each mouse in a subcutaneous pocket in
the subscapular area, and replaced after two weeks. The pumps were
calibrated to administer 0.5 .mu.l protein in solution per hour for
the dosages indicated in Table 1.
[0115] For Primates. For Example 2, recombinant methionyl human OB
protein (of SEQ.ID. NO.4 having a lysine at position 35 and an
isoleucine at position 74), dosed at 1 mg/ml PBS, was administered
subcutaneously at a dose of 1 mg protein/.kg body weight/day.
Control animals were administered PBS in the same fashion.
[0116] Rodent Carcass Analysis. Carcass analysis was conducted as
in A. I. Leshner, V. A., Litwin, and R. L. Squibb, Brain Res. 9:
281 (1972). Water composition was determined by subtraction of
carcass weight before and after a 4 day dehydration period. Fat was
extracted from a pre-weighed portion of the ground, dried carcass
with ethyl ether and ethyl alcohol, so that percent fat could be
calculated from the amount of material remaining after the
extraction procedure. Lean mass was defined as the proportion of
ground carcass that remained after dehyration and ether
extraction.
[0117] Primate Dual Energy X-Ray Absortimetry Scanning: "DEXA"
scanning was performed at the time points indicated in Table 2 A
and B, in Example 2.
[0118] Protein: Sequence ID Nos. 1 and 2 set forth murine
recombinant OB DNA and protein and Sequence ID Nos. 3 and 4 set
forth an analog recombinant human OB DNA and protein. Murine
recombinant protein as in SEQ. ID NO. 2 was used in EXAMPLE 1.
Recombinant human OB protein as in SEQ.ID. NO. 4 having a lysine
residue at position 35 and an isoleucine residue at position 74 was
used in EXAMPLE 2. As indicated above, the below murine and human
analog recombinant proteins are illustrative of the OB protein
which may be used in the present methods of treatment and
manufacture of a medicament. Other OB proteins or analogs or
derivatives thereof may be used.
[0119] Herein, the first amino acid of the amino acid sequence for
recombinant protein is referred to as +1, and is valine, and the
amino acid at position -1 is methionine. The C-terminal amino acid
is number 146 (cysteine).
[0120] Recombinant Murine Met OB (Double Stranded) DNA and Amino
Acid Sequence (Seq. ID. Nos. 1 and 2):
4 TCTAGATTTGAGTTTTAACTTTTAGAAGGAGGAATAACATATGGTACCGATCCAGAAAGT 9
-+---------+---------+---------+---------+---------+-------- 68
AGATCTAAACTCAAAATTGAAAATCTTCCTCCTTATTGTATACCATGGCTAGGTCTTTCA M V P
I Q K V --
TCAGGACGACACCAAAACCTTAATTAAAACGATCGTTACGCGTATCAACGACATCAGTCA 69 -
---------+---------+---------+---------+---------+-------- 128
AGTCCTGCTGTGGTTTTGGAATTAATTTTGCTAGCAATGCGCATAGTTGCTGTAGTCAGT Q D D
T K T L I K T I V T R I N D I S H --
CACCCAGTCGGTCTCCGCTAAACAGCGTGTTACCGGTCTGGACTTCATCCCGGGTCTGCA 129
-+---------+---------+---------+---------+---------+-------- 188
GTGGGTCAGCCAGAGGCGATTTGTCGCACAATGGCCAGACCTGAAGTAGGGCCCAGACGT T Q S
V S A K Q R V T G L D F I P G L H --
CCCGATCCTAAGCTTGTCCAAAATGGACCAGACCCTGGCTGTATACCAGCAGGTGTTAAC 189
-+---------+---------+---------+---------+---------+-------- 248
GGGCTAGGATTCGAACAGGTTTTACCTGGTCTGGGACCGACATATGGTCGTCCACAATTG P I L
S L S K M D Q T L A V Y Q Q V L T --
CTCCCTGCCGTCCCAGAACGTTCTTCAGATCGCTAACGACCTCGAGAACCTTCGCGACCT 249
-+---------+---------+---------+---------+---------+-------- 338
GAGGGACGGCAGGGTCTTGCAAGAAGTCTAGCGATTGCTGGAGCTCTTGGAAGCGCTGGA S L P
S Q N V L Q I A N D L E N L R D L --
GCTGCACCTGCTGGCATTCTCCAAATCCTGCTCCCTGCCGCAGACCTCAGGTCTTCAGAA 309
-+---------+---------+---------+---------+---------+-------- 368
CGACGTGGACGACCGTAAGAGGTTTAGGACGAGGGACGGCGTCTGGAGTCCAGAAGTCTT L H L
L A F S K S C S L P Q T S G L Q K --
ACCGGAATCCCTGGACGGGGTCCTGGAAGCATCCCTGTACAGCACCGAAGTTGTTGCTCT 369
-+---------+---------+---------+---------+---------+-------- 428
TGGCCTTAGGGACCTGCCCCAGGACCTTCGTAGGGACATGTCGTGGCTTCAACAACGAGA P E S
L E A S L Y S T E V V A L --
GTCCCGTCTGCAGGGTTCCCTTCAGGACATCCTTCAGCAGCTGGACGTTTCTCCGGAATG 429
-+---------+---------+---------+---------+---------+-------- 488
CAGGGCAGACGTCCCAAGGGAAGTCCTGTAGGAAGTCGTCGACCTGCAAAGAGGCCTTAC S R L
Q G S L Q D I L Q Q L D V P E C -- TTAATGGATCC 489 -+---------
AATTACCTAGG
[0121] Recombinant Human Met OB Analog (Double Stranded) DNA and
Amino Acid Sequence (SEQ. ID. Nos. 3 and 4)
5 CATATGGTACCGATCCAGAAAGTTCAGGACGACACCAAAACCTTAATTAAAACGATCGTT 1
---------+---------+---------+---------+---------+----------
GTATACCATGGCTAGGTCTTTCAAGTCCTGCTGTGGTTTTGGAATTAATTTTGCTAGCAA +e,ovs
ACGCGT+ee ATCAACGACATCAGTCACACCCAGTCGGTGAGCTCTAAACAGCGTGTT- ACAGGC
61 ---------+---------+---------+---------+---------+-------- ---
TGCGCATAGTTGCTGTAGTCAGTGTGGGTCAGCCACTCGAGATTTGTCGCACAATGTCCG T R I
N D I S H T Q S V S S K Q R V T G --
CTGGACTTCATCCCGGGTCTGCACCCGATCCTGACCTTGTCCAAAATGGACCAGACCCTG 121
---------+---------+---------+---------+---------+----------
GACCTGAAGTAGGGCCCAGACGTGGGCTAGGACTGGAACAGGTTTTACCTGGTCTGGGAC L D F
I P G L H P I L T L S K M D Q T L --
GCTGTATACCAGCAGATCTTAACCTCCATGCCGTCCCGTAACGTTCTTCAGATCTCTAAC 181
---------+---------+---------+---------+---------+----------
CGACATATGGTCGTCTAGAATTGGAGGTACGGCAGGGCATTGCAAGAAGTCTAGAGATTG A V Y
Q Q I L T S M P S R N V L Q I S N --
GACCTCGAGAACCTTCGCGACCTGCTGCACGTGCTGGCATTCTCCAAATCCTGCCACCTG 141
---------+---------+---------+---------+---------+----------
CTGGAGCTCTTGGAAGCGCTGGACGACGTGCACGACCGTAAGAGGTTTAGGACGGTGGAC D L E
N L R D L L H V L A F S K S C H L --
CCATGGGCTTCAGGTCTTGAGACTCTGGACTCTCTGGGCGGGGTCCTGGAAGCATCCGGT 301
---------+---------+---------+---------+---------+---------- 360
GGTACCCGAAGTCCAGAACTCTGAGACCTGAGAGACCCGCCCCAGGACCTTCGTAGGCCA P W A
S G L E T L D S L G G V L E A S G --
TACAGCACCGAAGTTGTTGCTCTGTCCCGTCTGCAGGGTTCCCTTCAGGACATGCTTTGG 361
---------+---------+---------+---------+---------+---------- 420
ATGTCGTGGCTTCAACAACGAGACAGGGCAGACGTCCCAAGGGAAGTCCTGTACGAAACC Y S T
E V V A L S R L Q G S L Q D M L W --
CAGCTGGACCTGTCTCCGGGTTGTTAATGGATCC 421 ---------+---------+--------
--+---- 454 GTCGACCTGGACAGAGGCCCAACAATTACCTAGG Q L D L S P G C
*
[0122] Methods For Production
[0123] The below methods for production have been used to produce
biologically active recombinant methionyl murine or human analog OB
protein. Similar methods may be used to prepare biologically active
recombinant methionyl human OB protein.
[0124] Expression Vector and Host Strain
[0125] The plasmid expression vector used is pCFM1656, ATCC
Accession No. 69576. The above DNA was ligated into the expression
vector pCFM1656 linearized with XbaI and BamHI and transformed into
the E. coli host strain, FM5. E. coli FMS cells were derived at
Amgen Inc., Thousand Oaks, Calif. from E. coli K-12 strain
(Bachmann, et al., Bacteriol. Rev. 40: 116-167 (1976)) and contain
the integrated lambda phage repressor gene, cI.sub.857 (Sussmanet
al., C. R. Acad. Sci. 254: 1517-1579 (1962)). Vector production,
cell transformation, and colony selection were performed by
standard methods. E.g., Sambrook, et al., Molecular Cloning: A
Laboratory Manual, 2d Edition, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. Host cells were grown in LB media.
[0126] Fermentation Process A three-phase fermentation protocol
known as a fed-batch process was used. Media compositions are set
forth below.
[0127] Batch: A nitrogen and phosphate source were sterilized (by
raising to 122.degree. C. for 35 minutes, 18-20 psi) in the
fermentation vessel (Biolafitte, 12 liter capacity). Upon cooling,
carbon, magnesium, vitamin, and trace metal sources were added
aseptically. An overnight culture of the above recombinant murine
protein-producing bacteria (16 hours or more) of 500 mL (grown in
LB broth) was added to the fermentor.
[0128] Feed I: Upon reaching between 4.0-6.0 OD.sub.600 cultures
were fed with Feed I. The glucose was fed at a limiting rate in
order to control the growth rate (.mu.) An automated system (called
the Distributive Control System) was instructed to control the
growth rate to 0.15 generations per hour.
[0129] Feed II: When the OD.sub.600 had reached 30, culture
temperature were slowly increased to 42.degree. C. and the feed
changed to Feed II, below. The fermentation was allowed to continue
for 10 hours with sampling every 2 hours. After 10 hours, the
contents of the fermentor was chilled to below 20.degree. C. and
harvested by centrifugation.
[0130] Media Composition:
[0131] Batch: 10 g/L Yeast extract
[0132] 5.25 g/L (NH.sub.4).sub.2SO.sub.4
[0133] 3.5 g/L K.sub.2HPO.sub.4
[0134] 4.0 g/L KH.sub.2PO.sub.4
[0135] 5.0 g/L Glucose
[0136] 1.0 g/L MgSO.sub.4.7H.sub.2O
[0137] 2.0 mL/L Vitamin Solution
[0138] 2.0 mL/L. Trace Metal Solution
[0139] 1.0 mL/L P2000 Antifoam
[0140] Feed I: 50 g/L Bacto-tryptone
[0141] 50 g/L Yeast extract
[0142] 450 g/L Glucose
[0143] 8.75 g/L MgSO.sub.4.7H.sub.2O
[0144] 10 mL/L Vitamin Solution
[0145] 10 mL/L Trace Metal Solution
[0146] Feed II: 200 g/L Bacto-tryptone
[0147] 100 g/L Yeast extract
[0148] 110 g/L Glucose
[0149] Vitamin Solution (Batch and Feed I): 0.5 g Biotin, 0.4 g
Folic acid, and 4.2 g riboflavin, was dissolved in 450 mls H.sub.2O
and 3 mls 10 N NaOH, and brought to 500 mLs in H.sub.2O. 14 g
pyridoxine-HCl and 61 g niacin gas dissolved 150 ml H.sub.2O and 50
ml 10 N NaOH, and brought to 250 ml in H.sub.2O. 54 g pantothenic
acid was dissolved in 200 mL H.sub.2O, and brought to 250 mL. The
three solutions were combined and brought to 10 liters total
volume.
[0150] Trace Metal Solution (Batch and Feed I):
[0151] Ferric Chloride (FeCl.sub.3.6H.sub.2O): 27 g/L
[0152] Zinc Chloride (ZnCl.sub.2.4H.sub.2O): 2 g/L
[0153] Cobalt Chloride (CoCl.sub.2.6H.sub.2O): 2 g/L
[0154] Sodium Molybdate (NaMoO.sub.4.2H.sub.2O): 2 g/L
[0155] Calcium Chloride (CaCl.sub.2.2H.sub.2O): 1 g/L
[0156] Cupric Sulfate (CuSO.sub.4.5H.sub.2O): 19.9 g/L
[0157] Boric Acid (H.sub.3BO.sub.3): 0.5 g/L
[0158] Manganese Chloride (MnCl.sub.2.4H.sub.2O): 1.6 g/L
[0159] Sodium Citrate dihydrate: 73.5 g/L
[0160] Purification Process for Murine OS Protein
[0161] Purification was accomplished by the following steps (unless
otherwise noted, the following steps were performed at 4.degree.
C.)
[0162] 1. Cell paste. E. coli cell paste was suspended in 5 times
volume of 7 mM of EDTA, pH 7.0. The cells in the EDTA were further
broken by two passes through a microfluidizer. The broken cells
were centrifuged at 4.2 K rpm for 1 hour in a Beckman J6-B
centrifuge with a JS-4.2 rotor.
[0163] 2. Inclusion body wash #1. The supernatant from above was
removed, and the pellet was resuspended with 5 times volume of 7 mM
EDTA, pH 7.0, and homogenized. This mixture was centrifuged as in
step 1.
[0164] 3. Inclusion body wash #2. The supernatant from above was
removed, and the pellet was resuspended in ten times volume of 20
mM tris, pH 8.5, 10 mM DTT, and 1% deoxycholate, and homogenized.
This mixture was centrifuged as in step 1.
[0165] 4. Inclusion body wash #3. The supernatant from above was
removed and the pellet was resuspended in ten times volume of
distilled water, and homogenized. This mixture was centrifuged as
in step 1.
[0166] 5. Refolding. The pellet was refolded with 15 volumes of 10
mM HEPES, pH 8.5, 1% sodium sarcosine (N-lauroyl sarcosine), at
room temperature. After 60 minutes, the solution was made to be 60
m copper sulfate, and then stirred overnight.
[0167] 6. Removal of sarcosine. The refolding mixture was diluted
with 5 volumes of 10 mM tris buffer, pH 7.5, and centrifuged as in
step 1. The supernatant was collected, and mixed with agitation for
one hour with Dowex.RTM. 1-X4 resin (Dow Chemical Co., Midland
Mich.), 20-50 mesh, chloride form, at 0.066% total volume of
diluted refolding mix. See WO 89/10932 at page 26 for more
information on Dowex.RTM.. This mixture was poured into a column
and the eluant collected. Removal of sarcosine was ascertained by
reverse phase HPLC.
[0168] 7. Acid precipitation. The eluant from the previous step was
collected, and pH adjusted to pH 5.5 and incubated for 30 minutes
at room temperature. This mixture was centrifuged as in step 1.
[0169] 8. Cation exchange chromatography. The pH of the supernatant
from the previous step was adjusted to pH 4.2, and loaded on CM
Sepharose Fast Flow (at 7% volume). 20 column volumes of salt
gradient were done at 20 mM NaOAC, pH 4.2, 0 M to 1.0 M NaCl.
[0170] 9. Hydrophobic interaction chromatography. The CM Sepharose
pool of peak fractions (ascertained from ultraviolet absorbance)
from the above step was made to be 0.2M ammonium sulfate. A 20
column volume reverse salt gradient was done at 5 mM NaOAC, pH 4.2,
with 0.4 M to 0 M ammonium sulfate. This material was concentrated
and diafiltered into PBS.
[0171] Fermentation of recombinant human OB protein analog:
Fermentation of the above host cells to produce recombinant human
OB protein analog (SEQ. ID. NO. 4) can be accomplished using the
conditions and compositions as described above for recombinant
murine material.
[0172] Purification of the recombinant human OB protein analog:
Recombinant human protein analog may be purified using methods
similar to those used for purification of recombinant murine
protein, as in Example 1, above. For preparation of recombinant
human OB protein analog, step 8 should be performed by adjusting
the pH of the supernatant from step 7 to pH 5.0, and loading this
onto a CM Sepharose fast flow column. The 20 column volume salt
gradient should be performed at 20 mM NaOAC, pH 5.5, 0M to 0.5 M
NaCl. Step 9 should be performed by diluting the CM Sepharose pool
four fold with water, and adjusting the pH to 7.5. This mixture
should be made to 0.7 M ammonium sulfate. Twenty column volume
reverse salt gradient should be done at 5 mM NaOAC, pH 5.5, 0.2 M
to 0M ammonium sulfate. Otherwise, the above steps are identical.
For EXAMPLE 2 material, the recombinant human OB protein of
SEQ.ID.NO.4 having lysine 35 and isoleucine 74 was formulated in a
buffer containing 10 mM histidine, 4.3% arginine, at pH 6.0.
[0173] While the present invention has been described in terms of
preferred embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Therefore, it
is intended that the appended claims cover all such equivalent
variations which come within the scope of the invention as claimed.
Sequence CWU 1
1
* * * * *