U.S. patent application number 10/277292 was filed with the patent office on 2003-10-23 for nucleic acid and corresponding protein named 158p1d7 useful in the treatment and detection of bladder and other cancers.
Invention is credited to Afar, Daniel E. H., Challita-Eid, Pia, Faris, Mary, Hubert, Rene S., Jakobovits, Aya, Levin, Elana, Raitano, Arthur B..
Application Number | 20030199470 10/277292 |
Document ID | / |
Family ID | 26921162 |
Filed Date | 2003-10-23 |
United States Patent
Application |
20030199470 |
Kind Code |
A1 |
Faris, Mary ; et
al. |
October 23, 2003 |
Nucleic acid and corresponding protein named 158P1D7 useful in the
treatment and detection of bladder and other cancers
Abstract
A novel gene (designated 158P1D7) and its encoded protein are
described. While 158P1D7 exhibits tissue specific expression in
normal adult tissue, it is aberrantly expressed in multiple cancers
including set forth in Table 1. Consequently, 158P1D7 provides a
diagnostic and/or therapeutic target for cancers,. The 158P1D7 gene
or fragment thereof, or its encoded protein or a fragment thereof,
can be used to elicit an immune response.
Inventors: |
Faris, Mary; (Los Angeles,
CA) ; Hubert, Rene S.; (Los Angeles, CA) ;
Raitano, Arthur B.; (Los Angeles, CA) ; Afar, Daniel
E. H.; (Brisbane, CA) ; Levin, Elana; (Los
Angeles, CA) ; Challita-Eid, Pia; (Encino, CA)
; Jakobovits, Aya; (Beverly Hills, CA) |
Correspondence
Address: |
Kate H. Murashige
Morrison & Foerster LLP
Suite 500
3811 Valley Centre Drive
San Diego
CA
92130-2332
US
|
Family ID: |
26921162 |
Appl. No.: |
10/277292 |
Filed: |
October 21, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10277292 |
Oct 21, 2002 |
|
|
|
09935430 |
Aug 22, 2001 |
|
|
|
60227098 |
Aug 22, 2000 |
|
|
|
60282739 |
Apr 10, 2001 |
|
|
|
Current U.S.
Class: |
514/44A ;
424/155.1; 435/6.14; 435/7.23; 514/19.3; 514/19.4; 514/19.5;
514/19.8 |
Current CPC
Class: |
A61P 35/00 20180101;
C07K 14/47 20130101 |
Class at
Publication: |
514/44 ; 514/12;
424/155.1; 435/6; 435/7.23 |
International
Class: |
A61K 048/00; A61K
038/17; C12Q 001/68; G01N 033/574; A61K 039/395 |
Claims
1. A method for monitoring 158P1D7 gene products in a biological
sample from a patient who has or who is suspected of having cancer,
the method comprising: determining the status of 158P1D7 gene
products expressed by cells in a tissue sample from an individual;
comparing the status so determined to the status of 158P1D7 gene
products in a corresponding normal sample; and, identifying the
presence of aberrant 158P1D7 gene products in the sample relative
to the normal sample.
2. A method of monitoring the presence of cancer in an individual
comprising: performing the method of claim 1 whereby the presence
of elevated 158P1D7 mRNA or protein expression in the test sample
relative to the normal tissue sample provides an indication of the
presence or status of a cancer.
3. The method of claim 2, wherein the cancer occurs in a tissue set
forth in Table I.
4. A composition comprising: a substance that modulates the status
of 158P1D7 or a molecule that is modulated by 158P1D7 and thereby
modulates the status of a cell that expresses 158P1D7.
5. The composition of claim 4, further comprising a
pharmaceutically acceptable carrier.
6. A pharmaceutical composition that comprises the composition of
claim 4 in a human unit dose form.
7. A composition of claim 4 that comprises a 158P1D7-related
protein.
8. A composition of claim 4 that comprises an antibody or fragment
thereof that specifically binds to a 158P1D7-related protein.
9. A composition of claim 4 that comprises a polynucleotide that
encodes a single chain monoclonal antibody that immunospecifically
binds to an 158P1D7-related protein.
10. A composition of claim 4 that comprises a polynucleotide
comprising a 158P1D7-related protein coding sequence.
11. A composition of claim 4 that comprises an antisense
polynucleotide complementary to a polynucleotide having a 158P1D7
coding sequence.
12. A pharmaceutical composition of claim 4 that comprises a
ribozyme capable of cleaving a polynucleotide having 158P1D7 coding
sequence and a physiologically acceptable carrier.
13. A method of inhibiting growth of cancer cells that expresses
158P1D7, the method comprising: administering to the cells the
composition of claim 4.
14. A method of claim 13 of inhibiting growth of cancer cells that
express 158P1D7, the method comprising steps of: administering to
said cells an antibody or fragment thereof that specifically binds
to a 158P1D7-related protein.
15. A method of treating a patient with a cancer that expresses
158P1D7, the method comprising steps of: administering to said
patient a vector that comprises the composition of claim 9, such
that the vector delivers the single chain monoclonal antibody
coding sequence to the cancer cells and the encoded single chain
antibody is expressed intracellularly therein.
16. A method of claim 13 of inhibiting growth of cancer cells that
express 158P1D7, the method comprising steps of: administering to
said cells a polynucleotide comprising a 158P1D7-related protein
coding sequence.
17. A method of claim 13 of inhibiting growth of cancer cells that
express 158P1D7, the method comprising steps of: administering to
said cells an antisense polynucleotide complementary to a
polynucleotide having a 158P1D7 coding sequence.
18. A method of treating a patient with a cancer that expresses
158P1D7, the method comprising steps of: identifying that the
patient has a cancer the cells of which express 158P1D7;
administering to the patient a pharmaceutical composition of claim
12 that comprises a ribozyme capable of cleaving a polynucleotide
having a 158P1D7 coding sequence.
19. A method of generating a mammalian immune response directed to
158P1D7, the method comprising: exposing cells of the mammal's
immune system to an immunogenic portion of an 158P1D7-related
protein or a nucleotide sequence that encodes said protein, whereby
an immune response is generated to 158P1D7.
20. A method of delivering a cytotoxic agent to a cell that
expresses 158P1D7, said method comprising: providing a cytotoxic
agent conjugated to an antibody or fragment thereof that
specifically binds to 158P1D7; and, exposing the cell to the
antibody-agent conjugate.
21. A method of inducing an immune response to a 158P1D7 protein,
said method comprising: providing a 158P1D7-related protein that
comprises at least one T cell or at least one B cell epitope;
contacting the epitope with an immune system T cell or B cell
respectively, whereby the immune system T cell or B cell is
induced.
22. The method of claim 21, wherein the immune system cell is a B
cell, whereby the induced B cell generates antibodies that
specifically bind to the 158P1D7-related protein.
23. The method of claim 21, wherein the immune system cell is a T
cell that is a cytotoxic T cell (CTL), whereby the activated CTL
kills an autologous cell that expresses the 158P1D7 protein.
24. The method of claim 21, wherein the immune system cell is a T
cell that is a helper T cell (HTL), whereby the activated HTL
secretes cytokines that facilitate the cytotoxic activity of a CTL
or the antibody producing activity of a B cell.
25. An antibody or fragment thereof that specifically binds to a
158P1D7-related protein.
26. The antibody or fragment thereof of claim 25, which is
monoclonal.
27. A recombinant protein comprising the antigen-binding region of
a monoclonal antibody of claim 26.
28. The antibody or fragment thereof of claim 25, which is labeled
with a detectable marker.
29. The recombinant protein of claim 27, which is labeled with a
detectable marker.
30. The antibody fragment of claim 25, which is an Fab, F(ab')2, Fv
or sFv fragment.
31. The antibody of claim 25, which is a human antibody.
32. The recombinant protein of claim 27, which comprises murine
antigen binding region residues and human constant region
residues.
33. A non-human transgenic animal that produces an antibody of
claim 25.
34. A hybridoma that produces an antibody of claim 26.
35. A single chain monoclonal antibody that comprises the variable
domains of the heavy and light chains of a monoclonal antibody of
claim 26.
36. A vector comprising a polynucleotide that encodes a single
chain monoclonal antibody of claim 35 that immunospecifically binds
to a 158P1D7-related protein.
37. An assay for detecting the presence of a 158P1D7-related
protein or polynucleotide in a biological sample from a patient who
has or who is suspected of having cancer, comprising steps of:
contacting the sample with an antibody or another polynucleotide,
respectively, that specifically binds to the 158P1D7-related
protein or polynucleotide, respectively; and, determining that
there is a complex of the antibody and 158P1D7-related protein or
the another polynucleotide and 158P1D7-related polynucleotide.
38. The assay in accordance with claim 37 for detecting the
presence of a 158P1D7-related protein or polynucleotide in a
biological sample from a patient who has or who is suspected of
having cancer, comprising the steps of: obtaining a sample from a
patient who has or who is suspected of having cancer.
39. The assay of claim 37 for detecting the presence of an 158P1D7
polynucleotide in a biological sample, comprising: contacting the
sample with a polynucleotide probe that specifically hybridizes to
a polynucleotide encoding an 158P1D7-related protein having the
amino acid sequence SEQ ID NO.: 657; and, detecting the presence of
a hybridization complex formed by the hybridization of the probe
with 158P1D7 polynucleotide in the sample, wherein the presence of
the hybridization complex indicates the presence of 158P1D7
polynucleotide within the sample.
40. An assay for detecting the presence of 158P1D7 mRNA in a
biological sample from a patient who has or who is suspected of
having cancer, said method comprising: (a) producing cDNA from the
sample by reverse transcription using at least one primer; (b)
amplifying the cDNA so produced using 158P1D7 polynucleotides as
sense and antisense primers, wherein the 158P1D7 polynucleotides
used as the sense and antisense primers are capable of amplifying
the 158P1D7 cDNA contained within the plasmid as deposited with
American Type Culture Collection as Accession No. (to be assigned);
and (c) detecting the presence of the amplified 158P1D7 cDNA.
41. A composition comprising a polynucleotide from position number
23 through number 2548 of SEQ ID NO.: 656.
42. The composition of claim 41, wherein T is substituted with
U.
43. A composition comprising SEQ ID NO.: 656.
44. The composition of claim 43, wherein T is substituted with
U.
45. A composition comprising a polynucleotide that encodes an
158P1D7-related protein that is at least 90% homologous to the
entire amino acid sequence shown in SEQ ID NO.: 657.
46. An analog peptide of eight, nine ten or eleven contiguous amino
acids of SEQ ID NO.: 657
47. A polynucleotide that encodes an analog peptide of claim
46.
48. The composition of claim 45, wherein the polynucleotide encodes
an 158P1D7-related protein that is at least 90% identical to the
entire amino acid sequence shown in SEQ ID NO: 657.
49. A composition comprising a polynucleotide that encodes at least
one peptide set forth in Tables V-XVIII.
50. A composition comprising a polynucleotide that encodes a
peptide region of at least 5 amino acids of SEQ ID NO.: 657 in any
whole number increment up to 841 that includes an amino acid
position selected from: an amino acid position having a value
greater than 0.5 in the Hydrophilicity profile of FIG. 11, an amino
acid position having a value less than 0.5 in the Hydropathicity
profile of FIG. 12; an amino acid position having a value greater
than 0.5 in the Percent Accessible Residues profile of FIG. 13; an
amino acid position having a value greater than 0.5 in the Average
Flexibility profile on FIG. 14; or an amino acid position having a
value greater than 0.5 in the Beta-turn profile of FIG. 15.
51. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 41.
52. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 42.
53. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 43.
54. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 44.
55. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 45.
56. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 48.
57. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 49.
58. A composition comprising a polynucleotide that is fully
complementary to a polynucleotide of claim 48.
59. A composition comprising a polynucleotide that encodes a
158P1D7-related protein whose sequence is encoded by the cDNAs
contained in the plasmid designated p158P1D7-Turbo/3PX deposited
with American Type Culture Collection as Accession No. (to be
assigned).
60. A composition comprising a polypeptide at least 90% homologous
to SEQ ID NO.: 657.
61. The composition of claim 60, wherein the polypeptide is at
least 90% identical to SEQ ID NO.: 657.
62. The composition of claim 61, wherein the polypeptide comprises
SEQ ID NO.: 657.
63. A composition comprising a CTL polypeptide epitope from SEQ ID
NO.: 657.
64. The composition of claim 63, wherein the CTL epitope comprises
a polypeptide selected from Tables V-XVIII.
65. A composition comprising a peptide region of at least 5 amino
acids of SEQ ID NO.: 657 in any whole number increment up to 841
that includes an amino acid position selected from: an amino acid
position having a value greater than 0.5 in the Hydrophilicity
profile of FIG. 11, an amino acid position having a value less than
0.5 in the Hydropathicity profile of FIG. 12; an amino acid
position having a value greater than 0.5 in the Percent Accessible
Residues profile of FIG. 13; an amino acid position having a value
greater than 0.5 in the Average Flexibility profile on FIG. 14; or
an amino acid position having a value greater than 0.5 in the
Beta-turn profile of FIG. 15.
66. A composition comprising a 158P1D7-related protein whose
sequence is encoded by the cDNAs contained in the plasmid
designated p158P1D7-Turbo/3PX deposited with American Type Culture
Collection as Accession No. (to be assigned).
Description
[0001] This application claims the benefit of U.S. Provisional
Patent Applications 60/227,098, filed Aug. 22, 2000, and
60/282,739, filed Apr. 10, 2001, the entire contents of which are
incorporated herein by reference as if fully set forth.
FIELD OF THE INVENTION
[0002] The invention described herein relates to a novel nucleic
acid sequence and its encoded protein, referred to as 158P1D7, and
to diagnostic and therapeutic methods and compositions useful in
the management of various cancers that express 158P1D7.
BACKGROUND OF THE INVENTION
[0003] Cancer is the second leading cause of human death next to
coronary disease. Worldwide, millions of people die from cancer
every year. In the United States alone, as reported by the American
Cancer Society, cancer causes the death of well over a half-million
people annually, with over 1.2 million new cases diagnosed per
year. While deaths from heart disease have been declining
significantly, those resulting from cancer generally are on the
rise. In the early part of the next century, cancer is predicted to
become the leading cause of death.
[0004] Of all new cases of cancer in the United States, bladder
cancer represents approximately 5 percent in men (fifth most common
neoplasm) and 3 percent in women (eighth most common neoplasm). The
incidence is increasing slowly, concurrent with an increasing older
population. In 1998, there was an estimated 54,500 cases, including
39,500 in men and 15,000 in women. The age-adjusted incidence in
the United States is 32 per 100,000 for men and 8 per 100,000 in
women. The historic male/female ratio of 3:1 may be decreasing
related to smoking patterns in women. There were an estimated
11,000 deaths from bladder cancer in 1998 (7,800 in men and 3,900
in women). Bladder cancer incidence and mortality strongly increase
with age and will be an increasing problem as the population
becomes more elderly.
[0005] Bladder cancers comprise a heterogeneous group of diseases.
The main determinants of disease control and survival are histology
and extent of disease. The main codes for these factors include
pathology classification, the International Classification of
Diseases-Oncology (ICDO), and staging classification of extent of
disease, the TNM classification.(Table XXI). For a general
discussion of bladder and other urogenital cancers, see, e.g.,
Volgelzang, et al, Eds. Comprehensive Textbook of Genitourinary
Oncology, (Williams & Wilkins, Baltimore 1996), in particular
pages 295-556.
[0006] Three primary types of tumors have been reported in the
bladder. The most common type of bladder cancer is Transitional
cell carcinoma (TCC); this accounts for about 90% of all bladder
cancers. The second form of bladder cancer is squamous cell
carcinoma, which accounts for about 8% of all bladder cancers where
schistosomiasis is not endemic, and approximately 75% of bladder
carcinomas where schistosomiasis is endemic. Squamous cell
carcinomas tend to invade deeper layers of the bladder. The third
type of bladder cancer is adenocarcinoma, which account for 1%-2%
of bladder cancers; these are primarily invasive forms of
cancer.
[0007] Bladder cancer is commonly detected and diagnosed using
cytoscopy and urine cytology. However these methods demonstrate
poor sensitivity. Relatively more reliable methods of detection
currently used in the clinic include the bladder tumor antigen
(BTA) stat test, NMP22 protein assay, telomerase expression and
hyaluronic acid and hyaluronidase (HA-HAase) urine test. The
advantage of using such markers in the diagnosis of bladder cancer
is their relative high sensitivity in earlier tumor stages compared
to standard cytology.
[0008] For example, the BTA stat test has 60-80% sensitivity and
50-70% specificity for bladder cancer, while the HA-HAase urine
test shows 90-92% sensitivity and 80-84% specificity for bladder
cancer (J Urol 2001 165:1067). In general, sensitivity for stage Ta
tumors was 81% for nuclear matrix protein (NMP22), 70% for
telomerase, 32% for bladder tumor antigen (BTA) and 26% for
cytology (J Urol 2001 166:470; J Urol 1999, 161:810). Although the
telomeric repeat assay which measures telomerase activity is
relatively sensitive, instability of telomerase in urine presently
renders this detection method unreliable.
[0009] Most bladder cancers recur in the bladder. Generally,
bladder cancer is managed with a combination of transurethral
resection of the bladder (TUR) and intravesical chemotherapy or
immunotherapy. The multifocal and recurrent nature of bladder
cancer points out the limitations of TUR. Most muscle-invasive
cancers are not cured by TUR alone. Radical cystectomy and urinary
diversion is the most effective means to eliminate the cancer but
carry an undeniable impact on urinary and sexual function.
[0010] Intravesical bacilli Calmette-Guerin (BCG) is a common and
efficacious immunotherapeutic agent used in the treatment of
bladder cancer. BCG is also used as a prophylactic agent to prevent
recurrence of bladder cancer. However, 30% of patients fail to
respond to BCG therapy and go on to develop invasive and metastatic
disease (Catalona et al. J Urol 1987, 137:220-224). BCG-related
side effects have been frequently observed such as drug-induced
cystitis, risk of bacterial infection, and hematuria, amongst
others. Other alternative immunotherapies have been used for the
treatment of bladder cancer, such as KLH (Flamm et al. Urologe
1994; 33:138-143) interferons (Bazarbashi et al. J Surg Oncol.
2000; 74:181-4), and MAGE-3 peptide loaded dendritic cells
(Nishiyama et al. Clin Cancer Res 2001; 7:23-31). All these
approaches are still experimental (Zlotta et al. Eur Urol 2000; 37
Suppl 3:10-15). There continues to be a significant need for
diagnostic and treatment modalities that are beneficial for bladder
cancer patients. Furthermore, from a worldwide standpoint, several
cancers stand out as the leading killers. In particular, carcinomas
of the lung, prostate, breast, colon, pancreas, and ovary are
primary causes of cancer death. These and virtually all other
carcinomas share a common lethal feature. With very few exceptions,
metastatic disease from a carcinoma is fatal. Moreover, even for
those cancer patients who initially survive their primary cancers,
their lives are dramatically altered. Many cancer patients
experience strong anxieties driven by the awareness of the
potential for recurrence or treatment failure. Many cancer patients
experience physical debilitations following treatment. Furthermore,
many cancer patients experience a recurrence.
[0011] Prostate cancer is the fourth most prevalent cancer in men
worldwide. In North America and Northern Europe, it is by far the
most common cancer in males and is the second leading cause of
cancer death in men. In the United States alone, well over 30,000
men die annually of this disease, second only to lung cancer.
Despite the magnitude of these figures, there is still no effective
treatment for metastatic prostate cancer. Surgical prostatectomy,
radiation therapy, hormone ablation therapy, surgical castration
and chemotherapy continue to be the main treatment modalities.
Unfortunately, these treatments are ineffective for many and are
often associated with undesirable consequences.
[0012] On the diagnostic front, the lack of a prostate tumor marker
that can accurately detect early-stage, localized tumors remains a
significant limitation in the diagnosis and management of this
disease. Although the serum prostate specific antigen (PSA) assay
has been a very useful tool, however its specificity and general
utility is widely regarded as lacking in several important
respects. While previously identified markers such as PSA, PSM,
PCTA and PSCA have facilitated efforts to diagnose and treat
prostate cancer, there is need for the identification of additional
markers and therapeutic targets for prostate and related cancers in
order to further improve diagnosis and therapy.
[0013] Renal cell carcinoma (RCC) accounts for approximately 3
percent of adult malignancies. Once adenoras reach a diameter of 2
to 3 cm, malignant potential exists. In the adult, the two
principal malignant renal tumors are renal cell adenocarcinoma and
transitional cell carcinoma of the renal pelvis or ureter. The
incidence of renal cell adenocarcinoma is estimated at more than
29,000 cases in the United States, and more than 11,600 patients
died of this disease in 1998. Transitional cell carcinoma is less
frequent, with an incidence of approximately 500 cases per year in
the United States.
[0014] Surgery has been the primary therapy for renal cell
adenocarcinoma for many decades. Until recently, metastatic disease
has been refractory to any systemic therapy. With recent
developments in systemic therapies, particularly immunotherapies,
metastatic renal cell carcinoma may be approached aggressively in
appropriate patients with a possibility of durable responses.
Nevertheless, there is a remaining need for effective therapies for
these patients.
[0015] An estimated 130,200 cases of colorectal cancer occurred in
2000 in the United States, including 93,800 cases of colon cancer
and 36,400 of rectal cancer. Colorectal cancers are the third most
common cancers in men and women. Incidence rates declined
significantly during 1992-1996 (-2.1% per year). Research suggests
that these declines have been due to increased screening and polyp
removal, preventing progression of polyps to invasive cancers.
There were an estimated 56,300 deaths (47,700 from colon cancer,
8,600 from rectal cancer) in 2000, accounting for about 11% of all
U.S. cancer deaths.
[0016] At present, surgery is the most common form of therapy for
colorectal cancer, and for cancers that have not spread, it is
frequently curative. Chemotherapy, or chemotherapy plus radiation
is given before or after surgery to most patients whose cancer has
deeply perforated the bowel wall or has spread to the lymph nodes.
A permanent colostomy (creation of an abdominal opening for
elimination of body wastes) is occasionally needed for colon cancer
and is infrequently required for rectal cancer. There continues to
be a need for effective diagnostic and treatment modalities for
colorectal cancer.
[0017] There were an estimated 164,100 new cases of lung and
bronchial cancer in 2000, accounting for 14% of all U.S. cancer
diagnoses. The incidence rate of lung and bronchial cancer is
declining significantly in men, from a high of 86.5 per 100,000 in
1984 to 70.0 in 1996. In the 1990s, the rate of increase among
women began to slow. In 1996, the incidence rate in women was 42.3
per 100,000.
[0018] Lung and bronchial cancer caused an estimated 156,900 deaths
in 2000, accounting for 28% of all cancer deaths. During 1992-1996,
mortality from lung cancer declined significantly among men (-1.7%
per year) while rates for women were still significantly increasing
(0.9% per year). Since 1987, more women have died each year of lung
cancer than breast cancer, which, for over 40 years, was the major
cause of cancer death in women. Decreasing lung cancer incidence
and mortality rates most likely resulted from decreased smoking
rates over the previous 30 years; however, decreasing smoking
patterns among women lag behind those of men. Of concern, although
the declines in adult tobacco use have slowed, tobacco use in youth
is increasing again.
[0019] Treatment options for lung and bronchial cancer are
determined by the type and stage of the cancer and include surgery,
radiation therapy, and chemotherapy. For many localized cancers,
surgery is usually the treatment of choice. Because the disease has
usually spread by the time it is discovered, radiation therapy and
chemotherapy are often needed in combination with surgery.
Chemotherapy alone or combined with radiation is the treatment of
choice for small cell lung cancer; on this regimen, a large
percentage of patients experience remission, which in some cases is
long lasting. There is however, an ongoing need for effective
treatment and diagnostic approaches for lunch and bronchial
cancers.
[0020] An estimated 182,800 new invasive cases of breast cancer
were expected to have occured among women in the United States
during 2000. Additionally, about 1,400 new cases of breast cancer
were expected to be diagnosed in men in 2000. After increasing
about 4% per year in the 1980s, breast cancer incidence rates in
women have leveled off in the 1990s to about 110.6 cases per
100,000.
[0021] In the U.S. alone, there were an estimated 41,200 deaths
(40,800 women, 400 men) in 2000 due to breast cancer. Breast cancer
ranks second among cancer deaths in women. According to the most
recent data, mortality rates declined significantly during
1992-1996 with the largest decreases in younger women, both white
and black. These decreases were probably the result of earlier
detection and improved treatment.
[0022] Taking into account the medical circumstances and the
patient's preferences, treatment of breast cancer may involve
lumpectomy (local removal of the tumor) and removal of the lymph
nodes under the arm; mastectomy (surgical removal of the breast)
and removal of the lymph nodes under the arm; radiation therapy;
chemotherapy; or hormone therapy. Often, two or more methods are
used in combination. Numerous studies have shown that, for early
stage disease, long-term survival rates after lumpectomy plus
radiotherapy are similar to survival rates after modified radical
mastectomy. Significant advances in reconstruction techniques
provide several options for breast reconstruction after mastectomy.
Recently, such reconstruction has been done at the same time as the
mastectomy.
[0023] Local excision of ductal carcinoma in situ (DCIS) with
adequate amounts of surrounding normal breast tissue may prevent
the local recurrence of the DCIS. Radiation to the breast and/or
tamoxifen may reduce the chance of DCIS occurring in the remaining
breast tissue. This is important because DCIS, if left untreated,
may develop into invasive breast cancer. Nevertheless, there are
serious side effects or sequelae to these treatments. There is,
therefore, a need for efficacious breast cancer treatments.
[0024] There were an estimated 23,100 new cases of ovarian cancer
in the United States in 2000. It accounts for 4% of all cancers
among women and ranks second among gynecologic cancers. During
1992-1996, ovarian cancer incidence rates were significantly
declining. Consequent to ovarian cancer, there were an estimated
14,000 deaths in 2000. Ovarian cancer causes more deaths than any
other cancer of the female reproductive system.
[0025] Surgery, radiation therapy, and chemotherapy are treatment
options for ovarian cancer. Surgery usually includes the removal of
one or both ovaries, the fallopian tubes (salpingo-oophorectomy),
and the uterus (hysterectomy). In some very early tumors, only the
involved ovary will be removed, especially in young women who wish
to have children. In advanced disease, an attempt is made to remove
all intra-abdominal disease to enhance the effect of chemotherapy.
There continues to be an important need for effective treatment
options for ovarian cancer.
[0026] There were an estimated 28,300 new cases of pancreatic
cancer in the United States in 2000. Over the past 20 years, rates
of pancreatic cancer have declined in men. Rates among women have
remained approximately constant but may be beginning to decline.
Pancreatic cancer caused an estimated 28,200 deaths in 2000 in the
United States. Over the past 20 years, there has been a slight but
significant decrease in mortality rates among men (about -0.9% per
year) while rates have increased slightly among women.
[0027] Surgery, radiation therapy, and chemotherapy are treatment
options for pancreatic cancer. These treatment options can extend
survival and/or relieve symptoms in many patients but are not
likely to produce a cure for most. There is a significant need for
additional therapeutic and diagnostic options for pancreatic
cancer.
SUMMARY OF THE INVENTION
[0028] The present invention relates to a novel nucleic acid
sequence and its encoded polypeptide, designated 158P1D7. As used
herein, "158P1D7" may refer to the novel polynucleotides or
polypeptides or both of the disclosed invention.
[0029] Nucleic acids encoding 158P1D7 are over-expressed in the
cancer(s) listed in Table I. Northern blot expression analysis of
158P1D7 expression in normal tissues shows a restricted expression
pattern in adult tissues. The nucleotide (FIG. 2) and amino acid
(FIG. 2, and FIG. 3) sequences of 158P1D7 are provided. The
tissue-related profile of 158P1D7 in normal adult tissues, combined
with the over-expression observed in bladder tumors, shows that
158P1D7 is aberrantly over-expressed in at least some cancers.
Thus, 158P1D7 nucleic acids and polypeptides serve as a useful
diagnostic agent (or indicator) and/or therapeutic target for
cancers of the tissues, such as those listed in Table I.
[0030] The invention provides polynucleotides corresponding or
complementary to all or part of the 158P1D7 nucleic acids, mRNAs,
and/or coding sequences, preferably in isolated form, including
polynucleotides encoding 158P1D7-related proteins and fragments of
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, or more than 25 contiguous amino acids; at least
about 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or
more than 100 contiguous amino acids of a 158P1D7-related protein,
as well as the peptides/proteins themselves; DNA, RNA, DNA/RNA
hybrids, and related molecules (such as PNAs), polynucleotides or
oligonucleotides complementary or having at least a 90% homology to
158P1D7 nucleic acid sequences or mRNA sequences or parts thereof,
and polynucleotides or oligonucleotides that hybridize to the
158P1D7 genes, mRNAs, or to 158P1D7-encoding polynucleotides. Also
provided are means for isolating cDNAs and the gene(s) encoding
158P1D7. Recombinant DNA molecules containing 158P1D7
polynucleotides, cells transformed or transduced with such
molecules, and host-vector systems for the expression of 158P1D7
gene products are also provided. The invention further provides
antibodies that bind to 158P1D7 proteins and polypeptide fragments
thereof, including polyclonal and monoclonal antibodies, murine and
other mammalian antibodies, chimeric antibodies, humanized and
fully human antibodies, and antibodies labeled with a detectable
marker. The invention also comprises T cell clones that recognize
an epitope of 158P1D7 in the context of a particular HLA
molecule.
[0031] The invention further provides methods for detecting the
presence, amount, and status of 158P1D7 polynucleotides and
proteins in various biological samples, as well as methods for
identifying cells that express 158P1D7 polynucleotides and
polypeptides. A typical embodiment of this invention provides
methods for monitoring 158P1D7 polynucleotides and polypeptides in
a tissue or hematology sample having or suspected of having some
form of growth dysregulation such as cancer.
[0032] The invention further provides various immunogenic or
therapeutic compositions and strategies for treating cancers that
express 158P1D7 such as bladder cancers, including therapies aimed
at inhibiting the transcription, translation, processing or
function of 158P1D7 as well as cancer vaccines.
BRIEF DESCRIPTION OF THE FIGURES
[0033] FIG. 1. 158P1D7 SSH nucleic acid sequence. The 158P1D7 SSH
sequence contains 231 bp. (SEQ ID. NO.: 655)
[0034] FIG. 2. The cDNA (SEQ ID. NO.: 656) and amino acid (SEQ ID.
NO.: 657) sequences of 158P1D7. The start methionine is underlined.
The open reading frame extends from nucleic acid 23 to 2548
including the stop codon.
[0035] FIG. 3. Amino acid sequence of 158P1D7 (SEQ ID. NO.:
657).
[0036] FIG. 4. Sequence alignment of 158P1D7 with human
hypothetical protein FLJ22774, clone KAIA1575 (SEQ ID. NO.:
658).
[0037] FIG. 5a. Amino acid sequence alignment of 158P1D7 with human
protein (FLJ227744, SEQ ID. NO.: 659).
[0038] FIG. 5b. Amino acid sequence alignment of 158P1D7 with human
protein similar to IGFALS (SEQ ID. NO.: 660).
[0039] FIG. 6. Expression of 158P1D7 by RT-PCR. First strand cDNA
was prepared from vital pool 1 (VP1: liver, lung and kidney), vital
pool 2 (VP2, pancreas, colon and stomach), prostate xenograft pool
(LAPC-4AD, LAPC-4AI, LAPC-9AD, LAPC-9AI), prostate cancer pool,
bladder cancer pool, colon cancer pool, lung cancer pool, ovary
cancer pool, breast cancer pool, and metastasis pool. Normalization
was performed by PCR using primers to actin and GAPDH.
Semi-quantitative PCR, using primers to 158P1D7, was performed at
30 cycles of amplification. Strong expression of 158P1D7 is
observed in bladder cancer pool and breast cancer pool. Lower
levels of expression are observed in VP1, VP2, xenograft pool,
prostate cancer pool, colon cancer pool, lung cancer pool, ovary
cancer pool, and metastasis pool.
[0040] FIG. 7. Expression of 158P1D7 in normal human tissues. Two
multiple tissue northern blots, with 2 .mu.g of mRNA/lane, were
probed with the 158P1D7 fragment. Size standards in kilobases (kb)
are indicated on the side. The results show expression of 158P1D7
in prostate, liver, placenta, heart and, to lower levels, in small
intestine and colon.
[0041] FIGS. 8A and 8B. Expression of 158P1D7 in bladder cancer
patient specimens. RNA was extracted from the bladder cancer cell
lines (CL), normal bladder (N), bladder tumors (T) and matched
normal adjacent tissue (N.sub.AT) isolated from bladder cancer
patients. Northern blots with 10 .mu.g of total RNA/lane were
probed with the 158P1D7 fragment. Size standards in kilobases (kb)
are indicated on the side. The results show expression of 158P1D7
in 1 of 3 bladder cancer cell lines. In patient specimens, 158P1D7
expression is detected in 4 of 6 tumors tested (8A). In another
study, 158P1D7 expression is detected in all patient tumors tested
(8B). The expression observed in normal adjacent tissues (isolated
from diseased tissues) but not in normal tissue, isolated from
healthy donors, may indicate that these tissues are not fully
normal and that 158P1D7 may be expressed in early stage tumors.
[0042] FIG. 9. Expression of 158P1D7 in lung cancer patient
specimens. RNA was extracted from lung cancer cell lines (CL), lung
tumors (T), and their normal adjacent tissues (N.sub.AT) isolated
from lung cancer patients. Northern blot with 10 .mu.g of total
RNA/lane was probed with the 158P1D7 fragment. Size standards in
kilobases (kb) are indicated on the side. The results show
expression of 158P1D7 in 1 of 3 lung cancer cell lines and in all 3
lung tumors tested, but not in normal lung tissues.
[0043] FIG. 10. Expression of 158P1D7 in breast cancer patient
specimens. RNA was extracted from breast cancer cell lines (CL),
normal breast (N), and breast tumors (T) isolated from breast
cancer patients. Northern blot with 10 .mu.g of total RNA/lane was
probed with the 158P1D7 fragment. Size standards in kilobases (kb)
are indicated on the side. The results show expression of 158P1D7
in 2 of 3 breast cancer cell lines and in 2 breast tumors, but not
in normal breast tissue.
[0044] FIG. 11. Hydrophilicity amino acid profile of 158P1D7
determined by computer algorithm sequence analysis using the method
of Hopp and Woods (Hopp T. P., Woods K. R., 1981. Proc. Natl. Acad.
Sci. U.S.A. 78:3824-3828) accessed on the Protscale website
(www.expasy.ch/cgi-bin/pr- otscale.pl) through the ExPasy molecular
biology server.
[0045] FIG. 12. Hydropathicity amino acid profile of 158P1D7
determined by computer algorithm sequence analysis using the method
of Kyte and Doolittle (Kyte J., Doolittle R. F., 1982. J. Mol.
Biol. 157:105-132) accessed on the ProtScale website
(www.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular
biology server.
[0046] FIG. 13. Percent accessible residues amino acid profile of
158P1D7 determined by computer algorithm sequence analysis using
the method of Janin (Janin J., 1979 Nature 277:491-492) accessed on
the ProtScale website (www.expasy.ch/cgi-bin/protscale.pl) through
the ExPasy molecular biology server.
[0047] FIG. 14. Average flexibility amino acid profile of 158P1D7
determined by computer algorithm sequence analysis using the method
of Bhaskaran and Ponnuswamy (Bhaskaran R., and Ponnuswamy P. K.,
1988. Int. J. Pept. Protein Res. 32:242-255) accessed on the
ProtScale website (www.expasy.ch/cgi-bin/protscale.pl) through the
ExPasy molecular biology server.
[0048] FIG. 15. Beta-turn amino acid profile of 158P1D7 determined
by computer algorithm sequence analysis using the method of Deleage
and Roux (Deleage, G., Roux B. 1987 Protein Engineering 1:289-294)
accessed on the ProtScale website
(www.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular
biology server.
[0049] FIGS. 16A and 16B. Transmembrane region and orientation
prediction for 158P1D7.
DETAILED DESCRIPTION OF THE INVENTION
[0050] Outline of Sections
[0051] I.) Definitions
[0052] II.) 158P1D7 Polynucleotides
[0053] II.A.) Uses of 158P1D7 Polynucleotides
[0054] II.A.1.) Monitoring of Genetic Abnormalities
[0055] II.A.2.) Antisense Embodiments
[0056] II.A3.) Primers and Primer Pairs
[0057] II.A.4.) Isolation of 158P1D7-Encoding Nucleic Acid
Molecules
[0058] II.5.) Recombinant Nucleic Acid Molecules and Host-Vector
Systems
[0059] III.) 158P1D7-related Proteins
[0060] III.A.) Motif-bearing Protein Embodiments
[0061] III.B.) Expression of 158P1D7-related Proteins
[0062] III.C.) Modifications of 158P1D7-related Proteins
[0063] III.D.) Uses of 158P1D7-related Proteins
[0064] IV.) 158P1D7 Antibodies
[0065] V.) 158P1D7 Cellular Immune Responses
[0066] VI.) 158P1D7 Transgenic Animals
[0067] VII.) Methods for the Detection of 158P1D7
[0068] VIII.) Methods for Monitoring the Status of 158P1D7-related
Genes and Their Products
[0069] IX.) Identification of Molecules That Interact With
158P1D7
[0070] X.) Therapeutic Methods and Compositions
[0071] X.A.) Anti-Cancer Vaccines
[0072] X.B.) 158P1D7 as a Target for Antibody-Based Therapy
[0073] X.C.) 158P1D7 as a Target for Cellular Immune Responses
[0074] X.C.1. Minigene Vaccines
[0075] X.C.2. Combinations of CTL Peptides with Helper Peptides
[0076] X.C.3. Combinations of CTL Peptides with T Cell Priming
Agents
[0077] X.C.4. Vaccine Compositions Comprising DC Pulsed with CTL
and/or HTL Peptides
[0078] X.D.) Adoptive Immunotherapy
[0079] X.E.) Administration of Vaccines for Therapeutic or
Prophylactic Purposes
[0080] XI.) Diagnostic and Prognostic Embodiments of 158P1D7.
[0081] XII.) Inhibition of 158P1D7 Protein Function
[0082] XII.A.) Inhibition of 158P1D7 With Intracellular
Antibodies
[0083] XII.B.) Inhibition of 158P1D7 with Recombinant Proteins
[0084] XII.C.) Inhibition of 158P1D7 Transcription or
Translation
[0085] XII.D.) General Considerations for Therapeutic
Strategies
[0086] XIII.) KITS
[0087] I.) Definitions:
[0088] Unless otherwise defined, all terms of art, notations and
other scientific terms or terminology used herein are intended to
have the meanings commonly understood by those of skill in the art
to which this invention pertains. In some cases, terms with
commonly understood meanings are defined herein for clarity and/or
for ready reference, and the inclusion of such definitions herein
should not necessarily be construed to represent a substantial
difference over what is generally understood in the art. Many of
the techniques and procedures described or referenced herein are
well understood and commonly employed using conventional
methodology by those skilled in the art, such as, for example, the
widely utilized molecular cloning methodologies described in
Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd.
edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. As appropriate, procedures involving the use of
commercially available kits and reagents are generally carried out
in accordance with manufacturer defined protocols and/or parameters
unless otherwise noted.
[0089] The terms "invasive bladder cancer" means bladder cancers
that have extended into the bladder muscle wall, and are meant to
include stage stage T2-T4 and disease under the TNM (tumor, node,
metastasis) system. In general, these patients have substantially
less favorable outcomes compared to patients having non-invasive
cancer. Following cystectomy, 50% or more of the patients with
invasive cancer will develop metastasis (Whittmore. Semin Urol
1983; 1:4-10).
[0090] "Altering the native glycosylation pattern" is intended for
purposes herein to mean deleting one or more carbohydrate moieties
found in native sequence 158P1D7 (either by removing the underlying
glycosylation site or by deleting the glycosylation by chemical
and/or enzymatic means), and/or adding one or more glycosylation
sites that are not present in the native sequence 158P1D7. In
addition, the phrase includes qualitative changes in the
glycosylation of the native proteins, involving a change in the
nature and proportions of the various carbohydrate moieties
present.
[0091] The term "analog" refers to a molecule which is structurally
similar or shares similar or corresponding attributes with another
molecule (e.g. a 158P1D7-related protein). For example an analog of
the 158P1D7 protein can be specifically bound by an antibody or T
cell that specifically binds to 158P1D7 protein.
[0092] The term "antibody" is used in the broadest sense. Therefore
an "antibody" can be naturally occurring or man-made such as
monoclonal antibodies produced by conventional hybridoma
technology. Anti-158P1D7 antibodies bind 158P1D7 proteins, or a
fragment thereof, and comprise monoclonal and polyclonal antibodies
as well as fragments containing the antigen-binding domain and/or
one or more complementarity determining regions of these
antibodies.
[0093] An "antibody fragment" is defined as at least a portion of
the variable region of the immunoglobulin molecule that binds to
its target, i.e., the antigen-binding region. In one embodiment it
specifically covers single anti-158P1D7 antibodies and clones
thereof (including agonist, antagonist and neutralizing antibodies)
and anti-158P1D7 antibody compositions with polyepitopic
specificity.
[0094] The term "codon optimized sequences" refers to nucleotide
sequences that have been optimized for a particular host species by
replacing any one or more than one codon having a usage frequency
of less than about 20%, more preferably less than about 30% or 40%.
A sequence may be "completely optimized" to contain no codon having
a usage frequency of less than about 20%, more preferably less than
about 30% or 40%. Nucleotide sequences that have been optimized for
expression in a given host species by elimination of spurious
polyadenylation sequences, elimination of exon/intron splicing
signals, elimination of transposon-like repeats and/or optimization
of GC content in addition to codon optimization are referred to
herein as an "expression enhanced sequences."
[0095] The term "cytotoxic agent" refers to a substance that
inhibits or prevents one or more than one function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes chemotherapeutic agents, and toxins such as
small molecule toxins or enzymatically active toxins of bacterial,
fungal, plant or animal origin, including fragments and/or variants
thereof. Examples of cytotoxic agents include, but are not limited
to maytansinoids, yttrium, bismuth, ricin, ricin A-chain,
doxorubicin, daunorubicin, taxol, ethidium bromide, mitomycin,
etoposide, tenoposide, vincristine, vinblastine, colchicine,
dihydroxy anthracin dione, actinomycin, diphtheria toxin,
Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain, modeccin A
chain, alpha-sarcin, gelonin, mitogellin, retstrictocin,
phenomycin, enomycin, curicin, crotin, calicheamicin, sapaonaria
officinalis inhibitor, and glucocorticoid and other
chemotherapeutic agents, as well as radioisotopes such as
At.sup.211, I.sup.131, I.sup.125, Y.sup.90, Re.sup.186, Re.sup.188,
Sm.sup.153, Bi.sup.212, P.sup.32 and radioactive isotopes of Lu.
Antibodies may also be conjugated to an anti-cancer pro-drug
activating enzyme capable of converting the pro-drug to its active
form.
[0096] The term "homolog" refers to a molecule which exhibits
homology to another molecule, by for example, having sequences of
chemical residues that are the same or similar at corresponding
positions.
[0097] "Human Leukocyte Antigen" or "HLA" is a human class I or
class II Major Histocompatibility Complex (MHC) protein (see, e.g.,
Stites, et al., IMMUNOLOGY, 8.sup.TH ED., Lange Publishing, Los
Altos, Calif. (1994).
[0098] The terms "hybridize", "hybridizing", "hybridizes" and the
like, used in the context of polynucleotides, are meant to refer to
conventional hybridization conditions, preferably such as
hybridization in 50% formamide/6.times.SSC/0.1% SDS/100 .mu.g/ml
ssDNA, in which temperatures for hybridization are above 37 degrees
C. and temperatures for washing in 0.1.times.SSC/0.1% SDS are above
55 degrees C.
[0099] The phrases "isolated" or "biologically pure" refer to
material which is substantially or essentially free from components
which normally accompany the material as it is found in its native
state. Thus, isolated peptides in accordance with the invention
preferably do not contain materials normally associated, or
present, with the peptides in their in situ environment. For
example, a polynucleotide is said to be "isolated" when it is
substantially separated from contaminant polynucleotides that
correspond or are complementary to nucleic acids other than those
of 158P1D7 or that encode polypeptides other than 158P1D7 gene
product or fragments thereof. A skilled artisan can readily employ
nucleic acid isolation procedures to obtain an isolated 158P1D7
polynucleotide. A protein is said to be "isolated," for example,
when physical, mechanical and/or chemical methods are employed to
remove the 158P1D7 protein from cellular constituents that are
normally associated, or present, with the protein. A skilled
artisan can readily employ standard purification methods to obtain
an isolated 158P1D7 protein. Alternatively, an isolated protein can
be prepared by synthetic or chemical means.
[0100] The term "mammal" refers to any organism classified as a
mammal, including mice, rats, rabbits, dogs, cats, cows, horses and
humans. In one embodiment of the invention, the mammal is a mouse.
In another embodiment of the invention, the mammal is a human.
[0101] The terms "metastatic bladder cancer" and "metastatic
disease" mean bladder cancers that have spread to regional lymph
nodes or to distant sites, and are meant to stage
T.times.N.times.M+ under the TNM system. The most common site for
bladder cancer metastasis is lymph node. Other common sites for
metastasis include lung, bone and liver.
[0102] The term "monoclonal antibody" refers to an antibody
obtained from a population of substantially homogeneous antibodies,
i.e., the antibodies comprising the population are identical except
for possible naturally occurring mutations that are present in
minor amounts.
[0103] A "motif", as in biological motif of an 158P1D7-related
protein, refers to any pattern of amino acids forming part of the
primary sequence of a protein, that is associated with a particular
function (e.g. protein-protein interaction, protein-DNA
interaction, etc) or modification (e.g. that is phosphorylated,
glycosylated or amidated), or localization (e.g. secretory
sequence, nuclear localization sequence, etc.) or a sequence that
is correlated with being immunogenic, either humorally or
cellularly. A motif can be either contiguous or capable of being
aligned to certain positions that are generally correlated with a
certain function or property. In the context of HLA motifs, "motif"
refers to the pattern of residues in a peptide of defined length,
usually a peptide of from about 8 to about 13 amino acids for a
class I HLA motif and from about 6 to about 25 amino acids for a
class II HLA motif, which is recognized by a particular HLA
molecule. Peptide motifs for HLA binding are typically different
for each protein encoded by each human HLA allele and differ in the
pattern of the primary and secondary anchor residues.
[0104] A "pharmaceutical excipient" comprises a material such as an
adjuvant, a carrier, pH-adjusting and buffering agents, tonicity
adjusting agents, wetting agents, preservative, and the like.
[0105] "Pharmaceutically acceptable" refers to a non-toxic, inert,
and/or composition that is physiologically compatible with mammals,
such as humans.
[0106] The term "polynucleotide" means a polymeric form of
nucleotides of at least 3, 4, 5, 6, 7, 8, 9, or 10 bases or base
pairs in length, either ribonucleotides or deoxynucleotides or a
modified form of either type of nucleotide, and is meant to include
single and double stranded forms of DNA and/or RNA. In the art,
this term is often used interchangeably with "oligonucleotide",
although "oligonucleotide" may be used to refer to the subset of
polynucleotides less than about 50 nucleotides in length. A
polynucleotide can comprise a nucleotide sequence disclosed herein
wherein thymidine (T) (as shown for example in SEQ ID NO: 656) can
also be uracil (U); this definition pertains to the differences
between the chemical structures of DNA and RNA, in particular the
observation that one of the four major bases in RNA is uracil (U)
instead of thymidine (T).
[0107] The term "polypeptide" means a polymer of at least about 4,
5, 6, 7, or 8 amino acids. Throughout the specification, standard
three letter or single letter designations for amino acids are
used. In the art, this term is often used interchangeably with
"peptide" or "protein", thus "peptide" may be used to refer to the
subset of polypeptides less than about 50 amino acids in
length.
[0108] An HLA "primary anchor residue" is an amino acid at a
specific position along a peptide sequence which is understood to
provide a contact point between the immunogenic peptide and the HLA
molecule. One to three, usually two, primary anchor residues within
a peptide of defined length generally defines a "motif" for an
immunogenic peptide. These residues are understood to fit in close
contact with peptide binding groove of an HLA molecule, with their
side chains buried in specific pockets of the binding groove. In
one embodiment, for example, the primary anchor residues for an HLA
class I molecule are located at position 2 (from the amino terminal
position) and at the carboxyl terminal position of a 8, 9, 10, 11,
or 12 residue peptide epitope in accordance with the invention. In
another embodiment, for example, the primary anchor residues of a
peptide that will bind an HLA class II molecule are spaced relative
to each other, rather than to the termini of a peptide, where the
peptide is generally of at least 9 amino acids in length. The
primary anchor positions for each motif and supermotif are set
forth in Table IV. For example, analog peptides can be created by
altering the presence or absence of particular residues in the
primary and/or secondary anchor positions shown in Table IV. Such
analogs are used to modulate the binding affinity and/or population
coverage of a peptide comprising a particular HLA motif or
supermotif.
[0109] A "recombinant" DNA or RNA molecule is a DNA or RNA molecule
that has been subjected to molecular manipulation in vitro.
"Stringency" of hybridization reactions is readily determinable by
one of ordinary skill in the art, and generally is an empirical
calculation dependent upon probe length, washing temperature, and
salt concentration. In general, longer probes require higher
temperatures for proper annealing, while shorter probes need lower
temperatures. Hybridization generally depends on the ability of
denatured nucleic acid sequences to reanneal when complementary
strands are present in an environment below their melting
temperature. The higher the degree of desired homology between the
probe and hybridizable sequence, the higher the relative
temperature that can be used. As a result, it follows that higher
relative temperatures would tend to make the reaction conditions
more stringent, while lower temperatures less so. For additional
details and explanation of stringency of hybridization reactions,
see Ausubel et al., Current Protocols in Molecular Biology, Wiley
Interscience Publishers, (1995).
[0110] "Stringent conditions" or "high stringency conditions", as
defined herein, are identified by, but not limited to, those that:
(1) employ low ionic strength and high temperature for washing, for
example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium
dodecyl sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer atpH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42.degree. C.; or
(3) employ 50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium
citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium
pyrophosphate, 5.times. Denhardt's solution, sonicated salmon sperm
DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree.
C., with washes at 42.degree. C. in 0.2.times.SSC (sodium
chloride/sodium. citrate) and 50% formamide at 55.degree. C.,
followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C. "Moderately stringent conditions"
are described by, but not limited to, those in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, New York: Cold Spring
Harbor Press, 1989, and include the use of washing solution and
hybridization conditions (e.g., temperature, ionic strength and %
SDS) less stringent than those described above. An example of
moderately stringent conditions is overnight incubation at
37.degree. C. in a solution comprising: 20% formamide, 5.times.SSC
(150 mM NaCl, 15 mN4 trisodium citrate), 50 mM sodium phosphate (pH
7.6), 5.times. Denhardt's solution, 10% dextran sulfate, and 20
mg/mL denatured sheared salmon sperm DNA, followed by washing the
filters in 1.times.SSC at about 37-50.degree. C. The skilled
artisan will recognize how to adjust the temperature, ionic
strength, etc. as necessary to accommodate factors such as probe
length and the like.
[0111] An HLA "supermotif" is a peptide binding specificity shared
by HLA molecules encoded by two or more HLA alleles.
[0112] A "transgenic animal" (e.g., a mouse or rat) is an animal
having cells that contain a transgene, which transgene was
introduced into the animal or an ancestor of the animal at a
prenatal, e.g., an embryonic stage. A "transgene" is a DNA that is
integrated into the genome of a cell from which a transgenic animal
develops.
[0113] As used herein, an HLA or cellular immune response "vaccine"
is a composition that contains or encodes one or more peptides of
the invention. There are numerous embodiments of such vaccines,
such as a cocktail of one or more individual peptides; one or more
peptides of the invention comprised by a polyepitopic peptide; or
nucleic acids that encode such individual peptides or polypeptides,
e.g., a minigene that encodes a polyepitopic peptide. The "one or
more peptides" can include any whole unit integer from 1-150 or
more, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34,35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115,
120, 125, 130, 135, 140, 145, or 150 or more peptides of the
invention. The peptides or polypeptides can optionally be modified,
such as by lipidation, addition of targeting or other sequences.
HLA class I peptides of the invention can be admixed with, or
linked to, HLA class II peptides, to facilitate activation of both
cytotoxic T lymphocytes and helper T lymphocytes. HLA vaccines can
also comprise peptide-pulsed antigen presenting cells, e.g.,
dendritic cells.
[0114] The term "variant" refers to a molecule that exhibits a
variation from a described type or norm, such as a protein that has
one or more different amino acid residues in the corresponding
position(s) of a specifically described protein (e.g. the 158P1D7
protein shown in FIG. 2 or FIG. 3). An analog is an example of a
variant protein.
[0115] The 158P1D7-related proteins of the invention include those
specifically identified herein, as well as allelic variants,
conservative substitution variants, analogs and homologs that can
be isolated/generated and characterized without undue
experimentation following the methods outlined herein or readily
available in the art. Fusion proteins that combine parts of
different 158P1D7 proteins or fragments thereof, as well as fusion
proteins of a 158P1D7 protein and a heterologous polypeptide are
also included. Such 158P1D7 proteins are collectively referred to
as the 158P1D7-related proteins, the proteins of the invention, or
158P1D7. The term "158P1D7-related protein" refers to a polypeptide
fragment or an 158P1D7 protein sequence of 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more
than 25 amino acids; or, at least about 30, 35, 40, 45, 50, 55, 60,
65, 70, 80, 85, 90, 95, 100 or more than 100 amino acids.
[0116] II.) 158P1D7 Polynucleotides
[0117] One aspect of the invention provides polynucleotides
corresponding or complementary to all or part of an 158P1D7 gene,
mRNA, and/or coding sequence, preferably in isolated form,
including polynucleotides encoding an 158P1D7-related protein and
fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules,
polynucleotides or oligonucleotides complementary to an 158P1D7
gene or mRNA sequence or a part thereof, and polynucleotides or
oligonucleotides that hybridize to an 158P1D7 gene, mRNA, or to an
158P1D7 encoding polynucleotide (collectively, "158P1D7
polynucleotides"). In all instances when referred to in this
section, T can also be U in FIG. 2.
[0118] Embodiments of a 158P1D7 polynucleotide include: a 158P1D7
polynucleotide having the sequence shown in FIG. 2, the nucleotide
sequence of 158P1D7 as shown in FIG. 2, wherein T is U; at least 10
contiguous nucleotides of a polynucleotide having the sequence as
shown in FIG. 2; or, at least 10 contiguous nucleotides of a
polynucleotide having the sequence as shown in FIG. 2 where T is U.
For example, embodiments of 158P1D7 nucleotides comprise, without
limitation:
[0119] (a) a polynucleotide comprising or consisting of the
sequence as shown in FIG. 2, wherein T can also be U;
[0120] (b) a polynucleotide comprising or consisting of the
sequence as shown in FIG. 2, from nucleotide residue number 23
through nucleotide residue number 2548, wherein T can also be
U;
[0121] (c) a polynucleotide that encodes a 158P1D7-related protein
whose sequence is encoded by the cDNAs contained in the plasmid
designated p158P1D7-Turbo/3PX deposited with American Type Culture
Collection as Accession No. PTA-______ on Aug. 22, 2001 (sent via
Federal Express on Aug. 20, 2001);
[0122] (d) a polynucleotide that encodes an 158P1D7-related protein
that is at least 90% homologous to the entire amino acid sequence
shown in FIG. 2;
[0123] (e) a polynucleotide that encodes an 158P1D7-related protein
that is at least 90% identical to the entire amino acid sequence
shown in FIG. 2;
[0124] (f) a polynucleotide that encodes at least one peptide set
forth in Tables V-XVIII;
[0125] (g) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
841 that includes an amino acid position having a value greater
than 0.5 in the Hydrophilicity profile of FIG. 11;
[0126] (h) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
841 that includes an amino acid position having a value less than
0.5 in the Hydropathicity profile of FIG. 12;
[0127] (i) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
841 that includes an amino acid position having a value greater
than 0.5 in the Percent Accessible Residues profile of FIG. 13;
[0128] (j) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
841 that includes an amino acid position having a value greater
than 0.5 in the Average Flexibility profile on FIG. 14;
[0129] (k) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
841 that includes an amino acid position having a value greater
than 0.5 in the Beta-turn profile of FIG. 15;
[0130] (l) a polynucleotide that is fully complementary to a
polynucleotide of any one of (a)-(k);
[0131] (m) a polynucleotide that selectively hybridizes under
stringent conditions to a polynucleotide of (a)-(l);
[0132] (n) a peptide that is encoded by any of (a)-(k); and,
[0133] (o) a polynucleotide of any of (a)-(m) or peptide of (n)
together with a pharmaceutical excipient and/or in a human unit
dose form.
[0134] As used herein, a range is understood to specifically
disclose all whole unit positions thereof.
[0135] Typical embodiments of the invention disclosed herein
include 158P1D7 polynucleotides that encode specific portions of
the 158P1D7 mRNA sequence (and those which are complementary to
such sequences) such as those that encode the protein and fragments
thereof, for example of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275,
300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600,
625, 650, 675, 700, 725, 750, 775, 800, 825 or 841 contiguous amino
acids.
[0136] For example, representative embodiments of the invention
disclosed herein include: polynucleotides and their encoded
peptides themselves encoding about amino acid 1 to about amino acid
10 of the 158P1D7 protein shown in FIG. 2 or FIG. 3,
polynucleotides encoding about amino acid 10 to about amino acid 20
of the 158P1D7 protein shown in FIG. 2, or FIG. 3, polynucleotides
encoding about amino acid 20 to about amino acid 30 of the 158P1D7
protein shown in FIG. 2 or FIG. 3, polynucleotides encoding about
amino acid 30 to about amino acid 40 of the 158P1D7 protein shown
in FIG. 2 or FIG. 3, polynucleotides encoding about amino acid 40
to about amino acid 50 of the 158P1D7 protein shown in FIG. 2 or
FIG. 3, polynucleotides encoding about amino acid 50 to about amino
acid 60 of the 158P1D7 protein shown in FIG. 2 or FIG. 3,
polynucleotides encoding about amino acid 60 to about amino acid 70
of the 158P1D7 protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 70 to about amino acid 80 of the 158P1D7
protein shown in FIG. 2 or FIG. 3, polynucleotides encoding about
amino acid 80 to about amino acid 90 of the 158P1D7 protein shown
in FIG. 2 or FIG. 3, polynucleotides encoding about amino acid 90
to about amino acid 100 of the 158P1D7 protein shown in FIG. 2 or
FIG. 3, in increments of about 10 amino acids, ending at the
carboxyl terminal amino acid set forth in FIG. 2 or FIG. 3.
Accordingly polynucleotides encoding portions of the amino acid
sequence (of about 10 amino acids), of amino acids 100 through the
carboxyl terminal amino acid of the 158P1D7 protein are embodiments
of the invention. Wherein it is understood that each particular
amino acid position discloses that position plus or minus five
amino acid residues.
[0137] Polynucleotides encoding relatively long portions of the
158P1D7 protein are also within the scope of the invention. For
example, polynucleotides encoding from about amino acid 1 (or 20 or
30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of
the 158P1D7 protein shown in FIG. 2 or FIG. 3 can be generated by a
variety of techniques well known in the art. These polynucleotide
fragments can include any portion of the 158P1D7 sequence as shown
in FIG. 2 or FIG. 3.
[0138] Additional illustrative embodiments of the invention
disclosed herein include 158P1D7 polynucleotide fragments encoding
one or more of the biological motifs contained within the 158P1D7
protein sequence, including one or more of the motif-bearing
subsequences of the 158P1D7 protein set forth in Tables V-XVIII. In
another embodiment, typical polynucleotide fragments of the
invention encode one or more of the regions of 158P1D7 that exhibit
homology to a known molecule. In another embodiment of the
invention, typical polynucleotide fragments can encode one or more
of the 158P1D7 N-glycosylation sites, cAMP and cGMP-dependent
protein kinase phosphorylation sites, casein kinase II
phosphorylation sites or N-myristoylation site and amidation
sites.
[0139] II.A.) Uses of 158P1D7 Polynucleotides
[0140] II.A.1.) Monitoring of Genetic Abnormalities
[0141] The polynucleotides of the preceding paragraphs have a
number of different specific uses. The human 158P1D7 gene maps to
the chromosomal location set forth in Example 3. For example,
because the 158P1D7 gene maps to this chromosome, polynucleotides
that encode different regions of the 158P1D7 protein are used to
characterize cytogenetic abnormalities of this chromosomal locale,
such as abnormalities that are identified as being associated with
various cancers. In certain genes, a variety of chromosomal
abnormalities including rearrangements have been identified as
frequent cytogenetic abnormalities in a number of different cancers
(see e.g. Krajinovic et al., Mutat. Res. 382(3-4): 81-83 (1998);
Johansson et al., Blood 86(10): 3905-3914 (1995) and Finger et al.,
P.N.A.S. 85(23): 9158-9162 (1988)). Thus, polynucleotides encoding
specific regions of the 158P1D7 protein provide new tools that can
be used to delineate, with greater precision than previously
possible, cytogenetic abnormalities in the chromosomal region that
encodes 158P1D7 that may contribute to the malignant phenotype. In
this context, these polynucleotides satisfy a need in the art for
expanding the sensitivity of chromosomal screening in order to
identify more subtle and less common chromosomal abnormalities (see
e.g. Evans et al., Am. J. Obstet. Gynecol 171(4): 1055-1057
(1994)).
[0142] Furthermore, as 158P1D7 was shown to be highly expressed in
bladder and other cancers, 158P1D7 polynucleotides are used in
methods assessing the status of 158P1D7 gene products in normal
versus cancerous tissues. Typically, polynucleotides that encode
specific regions of the 158P1D7 protein are used to assess the
presence of perturbations (such as deletions, insertions, point
mutations, or alterations resulting in a loss of an antigen etc.)
in specific regions of the 158P1D7 gene, such as such regions
containing one or more motifs. Exemplary assays include both RT-PCR
assays as well as single-strand conformation polymorphism (SSCP)
analysis (see, e.g., Marrogi et al., J. Cutan. Pathol. 26(8):
369-378 (1999), both of which utilize polynucleotides encoding
specific regions of a protein to examine these regions within the
protein.
[0143] II.A.2.) Antisense Embodiments
[0144] Other specifically contemplated nucleic acid related
embodiments of the invention disclosed herein are genomic DNA,
cDNAs, ribozymes, and antisense molecules, as well as nucleic acid
molecules based on an alternative backbone, or including
alternative bases, whether derived from natural sources or
synthesized, and include molecules capable of inhibiting the RNA or
protein expression of 158P1D7. For example, antisense molecules can
be RNAs or other molecules, including peptide nucleic acids (PNAs)
or non-nucleic acid molecules such as phosphorothioate derivatives,
that specifically bind DNA or RNA in a base pair-dependent manner.
A skilled artisan can readily obtain these classes of nucleic acid
molecules using the 158P1D7 polynucleotides and polynucleotide
sequences disclosed herein.
[0145] Antisense technology entails the administration of exogenous
oligonucleotides that bind to a target polynucleotide located
within the cells. The term "antisense" refers to the fact that such
oligonucleotides are complementary to their intracellular targets,
e.g., 158P1D7. See for example, Jack Cohen, Oligodeoxynucleotides,
Antisense Inhibitors of Gene Expression, CRC Press, 1989; and
Synthesis 1:1-5 (1988). The 158P1D7 antisense oligonucleotides of
the present invention include derivatives such as
S-oligonucleotides (phosphorothioate derivatives or S-oligos, see,
Jack Cohen, supra), which exhibit enhanced cancer cell growth
inhibitory action. S-oligos (nucleoside phosphorothioates) are
isoelectronic analogs of an oligonucleotide (O-oligo) in which a
nonbridging oxygen atom of the phosphate group is replaced by a
sulfur atom. The S-oligos of the present invention can be prepared
by treatment of the corresponding O-oligos with
3H-1,2-benzodithiol-3-one-1,1-dioxide, which is a sulfur transfer
reagent. See Iyer, R. P. et al, J. Org. Chem. 55:4693-4698 (1990);
and Iyer, R. P. et al., J. Am. Chem. Soc. 112:1253-1254 (1990).
Additional 158P1D7 antisense oligonucleotides of the present
invention include morpholino antisense oligonucleotides known in
the art (see, e.g., Partridge et al., 1996, Antisense & Nucleic
Acid Drug Development 6: 169-175).
[0146] The 158P1D7 antisense oligonucleotides of the present
invention typically can be RNA or DNA that is complementary to and
stably hybridizes with the first 100 5' codons or last 100 3'
codons of the 158P1D7 genomic sequence or the corresponding mRNA.
Absolute complementarity is not required, although high degrees of
complementarity are preferred. Use of an oligonucleotide
complementary to this region allows for the selective hybridization
to 158P1D7 mRNA and not to mRNA specifying other regulatory
subunits of protein kinase. In one embodiment, 158P1D7 antisense
oligonucleotides of the present invention are 15 to 30-mer
fragments of the antisense DNA molecule that have a sequence that
hybridizes to 158P1D7 mRNA. Optionally, 158P1D7 antisense
oligonucleotide is a 30-mer oligonucleotide that is complementary
to a region in the first 10 5' codons or last 10 3' codons of
158P1D7. Alternatively, the antisense molecules are modified to
employ ribozymes in the inhibition of 158P1D7 expression, see,
e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet 12:
510-515 (1996).
[0147] II.A.3.) Primers and Primer Pairs
[0148] Further specific embodiments of this nucleotides of the
invention include primers and primer pairs, which allow the
specific amplification of polynucleotides of the invention or of
any specific parts thereof, and probes that selectively or
specifically hybridize to nucleic acid molecules of the invention
or to any part thereof. Primers may also be used as probes and can
be labeled with a detectable marker, such as, for example, a
radioisotope, fluorescent compound, bioluminescent compound, a
chemiluminescent compound, metal chelator or enzyme. Such probes
and primers are used to detect the presence of a 158P1D7
polynucleotide in a sample and as a means for detecting a cell
expressing a 158P1D7 protein.
[0149] Examples of such probes include polypeptides comprising all
or part of the human 158P1D7 cDNA sequence shown in FIG. 2.
Examples of primer pairs capable of specifically amplifying 158P1D7
mRNAs are also described in the Examples. As will be understood by
the skilled artisan, a great many different primers and probes can
be prepared based on the sequences provided herein and used
effectively to amplify and/or detect a 158P1D7 mRNA. Preferred
probes of the invention are polynucleotides of more than about 9,
about 12, about 15, about 18, about 20, about 23, about 25, about
30, about 35, about 40, about 45, and about 50 consecutive
nucleotides found in 158P1D7 nucleic acids disclosed herein.
[0150] The 158P1D7 polynucleotides of the invention are useful for
a variety of purposes, including but not limited to their use as
probes and primers for the amplification and/or detection of the
158P1D7 gene(s), mRNA(s), or fragments thereof; as reagents for the
diagnosis and/or prognosis of bladder cancer and other cancers; as
coding sequences capable of directing the expression of 158P1D7
polypeptides; as tools for modulating or inhibiting the expression
of the 158P1D7 gene(s) and/or translation of the 158P1D7
transcript(s); and as therapeutic agents.
[0151] II.A.4.) Isolation of 158P1D7-Encoding Nucleic Acid
Molecules
[0152] The 158P1D7 cDNA sequences described herein enable the
isolation of other polynucleotides encoding 158P1D7 gene
product(s), as well as the isolation of polynucleotides encoding
158P1D7 gene product homologs, alternatively spliced isoforms,
allelic variants, and mutant forms of the 158P1D7 gene product as
well as polynucleotides that encode analogs of 158P1D7-related
proteins. Various molecular cloning methods that can be employed to
isolate full length cDNAs encoding an 158P1D7 gene are well known
(see, for example, Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual, 2d edition, Cold Spring Harbor Press, New York,
1989; Current Protocols in Molecular Biology. Ausubel et al., Eds.,
Wiley and Sons, 1995). For example, lambda pliage cloning
methodologies can be conveniently employed, using commercially
available cloning systems (e.g., Lambda ZAP Express, Stratagene).
Phage clones containing 158P1D7 gene cDNAs can be identified by
probing with a labeled 158P1D7 cDNA or a fragment thereof. For
example, in one embodiment, the 158P1D7 cDNA (FIG. 2) or a portion
thereof can be synthesized and used as a probe to retrieve
overlapping and full-length cDNAs corresponding to a 158P1D7 gene.
The 158P1D7 gene itself can be isolated by screening genomic DNA
libraries, bacterial artificial chromosome libraries (BACs), yeast
artificial chromosome libraries (YACs), and the like, with 158P1D7
DNA probes or primers.
[0153] The present invention includes the use of any probe as
described herein to identify and isolate a 158P1D7 or 158P1D7
related nucleic acid sequence from a naturally occurring source,
such as humans or other mammals, as well as the isolated nucleic
acid sequence per se, which would comprise all or most of the
sequences found in the probe used.
[0154] II.A.5.) Recombinant Nucleic Acid Molecules and Host-Vector
Systems
[0155] The invention also provides recombinant DNA or RNA molecules
containing an 158P1D7 polynucleotide, a fragment, analog or
homologue thereof, including but not limited to phages, plasmids,
phagemids, cosmids, YACs, BACs, as well as various viral and
non-viral vectors well known in the art, and cells transformed or
transfected with such recombinant DNA or RNA molecules. Methods for
generating such molecules are well known (see, for example,
Sambrook et al, 1989, supra). The invention further provides a
host-vector system comprising a recombinant DNA molecule containing
a 158P1D7 polynucleotide, fragment, analog or homologue thereof
within a suitable prokaryotic or eukaryotic host cell. Examples of
suitable eukaryotic host cells include a yeast cell, a plant cell,
or an animal cell, such as a mammalian cell or an insect cell
(e.g., a baculovirus-infectible cell such as an Sf9 or HighFive
cell). Examples of suitable mammalian cells include various bladder
cancer cell lines such as SCaBER, UM-UC3, HT1376, RT4, T24,
TCC-SUP, J82 and SW780, other transfectable or transducible bladder
cancer cell lines, as well as a number of mammalian cells routinely
used for the expression of recombinant proteins (e.g., COS, CHO,
293, 293T cells). More particularly, a polynucleotide comprising
the coding sequence of 158P1D7 or a fragment, analog or homolog
thereof can be used to generate 158P1D7 proteins or fragments
thereof using any number of host-vector systems routinely used and
widely known in the art.
[0156] A wide range of host-vector systems suitable for the
expression of 158P1D7 proteins or fragments thereof are available,
see for example, Sambrook et al., 1989, supra; Current Protocols in
Molecular Biology, 1995, supra). Preferred vectors for mammalian
expression include but are not limited to pcDNA 3.1 myc-His-tag
(Invitrogen) and the retroviral vector pSR.alpha.tkneo (Muller et
al., 1991, MCB 11:1785). Using these expression vectors, 158P1D7
can be expressed in several bladder cancer and non-bladder cell
lines, including for example SCaBER, UM-UC3, HT1376, RT4, T24,
TCC-SUP, J82 and SW780. The host-vector systems of the invention
are useful for the production of a 158P1D7 protein or fragment
thereof. Such host-vector systems can be employed to study the
functional properties of 158P1D7 and 158P1D7 mutations or
analogs.
[0157] Recombinant human 158P1D7 protein or an analog or homolog or
fragment thereof can be produced by mammalian cells transfected
with a construct encoding a 158P1D7-related nucleotide. For
example, 293T cells can be transfected with an expression plasmid
encoding 158P1D7 or fragment, analog or homolog thereof, the
158P1D7 or related protein is expressed in the 293T cells, and the
recombinant 158P1D7 protein is isolated using standard purification
methods (e.g., affinity purification using anti-158P1D7
antibodies). In another embodiment, a 158P1D7 coding sequence is
subcloned into the retroviral vector pSR.alpha.MSVtkneo and used to
infect various mammalian cell lines, such as NIH 3T3, TsuPr1, 293
and rat-1 in order to establish 158P1D7 expressing cell lines.
Various other expression systems well known in the art can also be
employed. Expression constructs encoding a leader peptide joined in
frame to the 158P1D7 coding sequence can be used for the generation
of a secreted form of recombinant 158P1D7 protein.
[0158] As discussed herein, redundancy in the genetic code permits
variation in 158P1D7 gene sequences. In particular, it is known in
the art that specific host species often have specific codon
preferences, and thus one can adapt the disclosed sequence as
preferred for a desired host. For example, preferred analog codon
sequences typically have rare codons (i.e., codons having a usage
frequency of less than about 20% in known sequences of the desired
host) replaced with higher frequency codons. Codon preferences for
a specific species are calculated, for example, by utilizing codon
usage tables available on the INTERNET such as at URL
www.dna.affrc.go.jp/.about.nakamura/codon.html.
[0159] Additional sequence modifications are known to enhance
protein expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon/intron
splice site signals, transposon-like repeats, and/or other such
well-characterized sequences that are deleterious to gene
expression. The GC content of the sequence is adjusted to levels
average for a given cellular host, as calculated by reference to
known genes expressed in the host cell. Where possible, the
sequence is modified to avoid predicted hairpin secondary mRNA
structures. Other useful modifications include the addition of a
translational initiation consensus sequence at the start of the
open reading frame, as described in Kozak, Mol. Cell Biol.,
9:5073-5080 (1989). Skilled artisans understand that the general
rule that eukaryotic ribosomes initiate translation exclusively at
the 5' proximal AUG codon is abrogated only under rare conditions
(see, e.g., Kozak PNAS 92(7): 2662-2666, (1995) and Kozak NAR
15(20): 8125-8148 (1987)).
[0160] III.) 158P1D7-Related Proteins
[0161] Another aspect of the present invention provides
158P1D7-related proteins. Specific embodiments of 158P1D7 proteins
comprise a polypeptide having all or part of the amino acid
sequence of human 158P1D7 as shown in FIG. 2 or FIG. 3.
Alternatively, embodiments of 158P1D7 proteins comprise variant,
homolog or analog polypeptides that have alterations in the amino
acid sequence of 158P1D7 shown in FIG. 2 or FIG. 3.
[0162] In general, naturally occuring allelic variants of human
158P1D7 share a high degree of structural identity and homology
(e.g., 90% or more homology). Typically, allelic variants of the
158P1D7 protein contain conservative amino acid substitutions
within the 158P1D7 sequences described herein or contain a
substitution of an amino acid from a corresponding position in a
homologue of 158P1D7. One class of 158P1D7 allelic variants are
proteins that share a high degree of homology with at least a small
region of a particular 158P1D7 amino acid sequence, but further
contain a radical departure from the sequence, such as a
non-conservative substitution, truncation, insertion or frame
shift. In comparisons of protein sequences, the terms, similarity,
identity, and homology each have a distinct meaning as appreciated
in the field of genetics. Moreover, orthology and paralogy can be
important concepts describing the relationship of members of a
given protein family in one organism to the members of the same
family in other organisms.
[0163] Amino acid abbreviations are provided in Table II.
Conservative amino acid substitutions can frequently be made in a
protein without altering either the conformation or the function of
the protein. Proteins of the invention can comprise 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more conservative
substitutions. Such changes include substituting any of isoleucine
(I), valine (V), and leucine (L) for any other of these hydrophobic
amino acids; aspartic acid (D) for glutamic acid (E) and vice
versa; glutamine (Q) for asparagine (N) and vice versa; and serine
(S) for threonine (T) and vice versa. Other substitutions can also
be considered conservative, depending on the environment of the
particular amino acid and its role in the three-dimensional
structure of the protein. For example, glycine (G) and alanine (A)
can frequently be interchangeable, as can alanine (A) and valine
(V). Methionine (M), which is relatively hydrophobic, can
frequently be interchanged with leucine and isoleucine, and
sometimes with valine. Lysine (K) and arginine (R) are frequently
interchangeable in locations in which the significant feature of
the amino acid residue is its charge and the differing pK's of
these two amino acid residues are not significant. Still other
changes can be considered "conservative" in particular environments
(see, e.g. Table III herein; pages 13-15 "Biochemistry" 2.sup.nd
ED. Lubert Stryer ed (Stanford University); Henikoff et al., PNAS
1992 Vol 89 10915-10919; Lei et al., J Biol Chem May 19, 1995;
270(20):11882-6).
[0164] Embodiments of the invention disclosed herein include a wide
variety of art-accepted variants or analogs of 158P1D7 proteins
such as polypeptides having amino acid insertions, deletions and
substitutions. 158P1D7 variants can be made using methods known in
the art such as site-directed mutagenesis, alanine scanning, and
PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl.
Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res.,
10:6487 (1987)), cassette mutagenesis (Wells et al., Gene, 34:315
(1985)), restriction selection mutagenesis (Wells et al., Philos.
Trans. R. Soc. London SerA, 317:415 (1986)) or other known
techniques can be performed on the cloned DNA to produce the
158P1D7 variant DNA.
[0165] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence that
is involved in a specific biological activity such as a
protein-protein interaction. Among the preferred scanning amino
acids are relatively small, neutral amino acids. Such amino acids
include alanine, glycine, serine, and cysteine. Alanine is
typically a preferred scanning amino acid among this group because
it eliminates the side-chain beyond the beta-carbon and is less
likely to alter the main-chain conformation of the variant. Alanine
is also typically preferred because it is the most common amino
acid. Further, it is frequently found in both buried and exposed
positions (Creighton, The Proteins, (W. H. Freeman & Co.,
N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine
substitution does not yield adequate amounts of variant, an
isosteric amino acid can be used.
[0166] As defined herein, 158P1D7 variants, analogs or homologs,
have the distinguishing attribute of having at least one epitope
that is "cross reactive" with a 158P1D7 protein having the amino
acid sequence of SEQ ID NO: 657. As used in this sentence, "cross
reactive" means that an antibody or T cell that specifically binds
to an 158P1D7 variant also specifically binds to the 158P1D7
protein having the amino acid sequence of SEQ ID NO: 657. A
polypeptide ceases to be a variant of the protein shown in SEQ ID
NO: 657 when it no longer contains any epitope capable of being
recognized by an antibody or T cell that specifically binds to the
158P1D7 protein. Those skilled in the art understand that
antibodies that recognize proteins bind to epitopes of varying
size, and a grouping of the order of about four or five amino
acids, contiguous or not, is regarded as a typical number of amino
acids in a minimal epitope. See, e.g., Nair et al., J. Immunol 2000
165(12): 6949-6955; Hebbes et al., Mol Immunol (1989) 26(9):865-73;
Schwartz et al., J Immunol (1985) 135(4):2598-608.
[0167] Another class of 158P1D7-related protein variants share 70%,
75%, 80%, 85% or 90% or more similarity with the amino acid
sequence of SEQ ID NO: 657 or a fragment thereof. Another specific
class of 158P1D7 protein variants or analogs comprise one or more
of the 158P1D7 biological motifs described herein or presently
known in the art. Thus, encompassed by the present invention are
analogs of 158P1D7 fragments (nucleic or amino acid) that have
altered functional (e.g. immunogenic) properties relative to the
starting fragment. It is to be appreciated that motifs now or which
become part of the art are to be applied to the nucleic or amino
acid sequences of FIG. 2 or FIG. 3.
[0168] As discussed herein, embodiments of the claimed invention
include polypeptides containing less than the full amino acid
sequence of the 158P1D7 protein shown in FIG. 2 or FIG. 3. For
example, representative embodiments of the invention comprise
peptides/proteins having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15 or more contiguous amino acids of the 158P1D7 protein shown in
FIG. 2 or FIG. 3.
[0169] Moreover, representative embodiments of the invention
disclosed herein include polypeptides consisting of about amino
acid 1 to about amino acid 10 of the 158P1D7 protein shown in FIG.
2 or FIG. 3, polypeptides consisting of about amino acid 10 to
about amino acid 20 of the 158P1D7 protein shown in FIG. 2 or FIG.
3, polypeptides consisting of about amino acid 20 to about amino
acid 30 of the 158P1D7 protein shown in FIG. 2 or FIG. 3,
polypeptides consisting of about amino acid 30 to about amino acid
40 of the 158P1D7 protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 40 to about amino acid 50 of the
158P1D7 protein shown in FIG. 2 or FIG. 3, polypeptides consisting
of about amino acid 50 to about amino acid 60 of the 158P1D7
protein shown in FIG. 2 or FIG. 3, polypeptides consisting of about
amino acid 60 to about amino acid 70 of the 158P1D7 protein shown
in FIG. 2 or FIG. 3, polypeptides consisting of about amino acid 70
to about amino acid 80 of the 158P1D7 protein shown in FIG. 2 or
FIG. 3, polypeptides consisting of about amino acid 80 to about
amino acid 90 of the 158P1D7 protein shown in FIG. 2 or FIG. 3,
polypeptides consisting of about amino acid 90 to about amino acid
100 of the 158P1D7 protein shown in FIG. 2 or FIG. 3, etc.
throughout the entirety of the 158P1D7 amino acid sequence.
Moreover, polypeptides consisting of about amino acid 1 (or 20 or
30 or 40 etc.) to about amino acid 20, (or 130, or 140 or 150 etc.)
of the 158P1D7 protein shown in FIG. 2 or FIG. 3 are embodiments of
the invention. It is to be appreciated that the starting and
stopping positions in this paragraph refer to the specified
position as well as that position plus or minus 5 residues.
[0170] 158P1D7-related proteins are generated using standard
peptide synthesis technology or using chemical cleavage methods
well known in the art. Alternatively, recombinant methods can be
used to generate nucleic acid molecules that encode a
158P1D7-related protein. In one embodiment, nucleic acid molecules
provide a means to generate defined fragments of the 158P1D7
protein (or variants, homologs or analogs thereof).
[0171] III.A.) Motif-Bearing Protein Embodiments
[0172] Additional illustrative embodiments of the invention
disclosed herein include 158P1D7 polypeptides comprising the amino
acid residues of one or more of the biological motifs contained
within the 158P1D7 polypeptide sequence set forth in FIG. 2 or FIG.
3. Various motifs are known in the art, and a protein can be
evaluated for the presence of such motifs by a number of publicly
available Internet sites (see, e.g., URL addresses:
pfam.wustl.edu/; searchlauncher.bcm.tmc.edu/seq-search/struc-p-
redict.html psort.ims.u-tokyo.ac.jp/; www.cbs.dtu.dk/;
www.ebi.ac.uk/interpro/scan.html;
www.expasy.ch/tools/scnpsitl.html; Epimatrix.TM. and Epimer.TM.,
Brown University, www.brown.edu/Research/TB- -HIV
Lab/epimatrix/epimatrix.html; and BIMAS, bimas.dcrt.nih.gov/.).
[0173] Motif bearing subsequences of the 158P1D7 protein are set
forth and identified in Table XIX.
[0174] Table XX sets forth several frequently occurring motifs
based on pfam searches (see URL address pfam.wustl.edu/). The
columns of Table XX list (1) motif name abbreviation, (2) percent
identity found amongst the different member of the motif family,
(3) motif name or description and (4) most common function;
location information is included if the motif is relevant for
location.
[0175] Polypeptides comprising one or more of the 158P1D7 motifs
discussed above are useful in elucidating the specific
characteristics of a malignant phenotype in view of the observation
that the 158P1D7 motifs discussed above are associated with growth
dysregulation and because 158P1D7 is overexpressed in certain
cancers (See, e.g., Table I). Casein kinase II, cAMP and
camp-dependent protein kinase, and Protein Kinase C, for example,
are enzymes known to be associated with the development of the
malignant phenotype (see e.g. Chen et al., Lab Invest., 78(2):
165-174 (1998); Gaiddon et al., Endocrinology 136(10): 4331-4338
(1995); Hall et al., Nucleic Acids Research 24(6): 1119-1126
(1996); Peterziel et al., Oncogene 18(46): 6322-6329 (1999) and
O'Brian, Oncol. Rep. 5(2): 305-309 (1998)). Moreover, both
glycosylation and myristoylation are protein modifications also
associated with cancer and cancer progression (see e.g. Dennis et
al., Biochem Biophys. Acta 1473(1):21-34 (1999); Raju et al., Exp.
Cell Res. 235(1): 145-154 (1997)). Amidation is another protein
modification also associated with cancer and cancer progression
(see e.g. Treston et al., J. Natl. Cancer Inst. Monogr. (13):
169-175 (1992)).
[0176] In another embodiment, proteins of the invention comprise
one or more of the immunoreactive epitopes identified in accordance
with art-accepted methods, such as the peptides set forth in Tables
V-XVIII. CTL epitopes can be determined using specific algorithms
to identify peptides within an 158P1D7 protein that are capable of
optimally binding to specified HLA alleles (e.g., Table IV;
Epimatrix.TM. and Epimer.TM., Brown University, URL
www.brown.edu/Research/TB-HIV Lab/epimatrix/epimatrix.html; and
BIMAS, URL bimas.dcrt.nih.gov/.) Moreover, processes for
identifying peptides that have sufficient binding affinity for HLA
molecules and which are correlated with being immunogenic epitopes,
are well known in the art, and are carried out without undue
experimentation. In addition, processes for identifying peptides
that are immunogenic epitopes, are well known in the art, and are
carried out without undue experimentation either in vitro or in
vivo.
[0177] Also known in the art are principles for creating analogs of
such epitopes in order to modulate immunogenicity. For example, one
begins with an epitope that bears a CTL or HTL motif (see, e.g.,
the HLA Class I and HLA Class II motifs/supermotifs of Table IV).
The epitope is analoged by substituting out an amino acid at one of
the specified positions, and replacing it with another amino acid
specified for that position. For example, one can substitute out a
deleterious residue in favor of any other residue, such as a
preferred residue as defined in Table IV; substitute a
less-preferred residue with a preferred residue as defined in Table
IV; or substitute an originally-occurring preferred residue with
another preferred residue as defined in Table IV. Substitutions can
occur at primary anchor positions or at other positions in a
peptide; see, e.g., Table IV.
[0178] A variety of references reflect the art regarding the
identification and generation of epitopes in a protein of interest
as well as analogs thereof. See, for example, WO 9733602 to Chesnut
et al.; Sette, Immunogenetics 1999 50(3-4): 201-212; Sette et al.,
J. Immunol. 2001 166(2): 1389-1397; Sidney et al., Hum. Immunol.
1997 58(1): 12-20; Kondo et al., Immunogenetics 1997 45(4):
249-258; Sidney et al., J. Immunol. 1996 157(8): 3480-90; and Falk
et al., Nature 351: 290-6 (1991); Hunt et al., Science 255:1261-3
(1992); Parker et al., J. Immunol. 149:3580-7 (1992); Parker et
al., J. Immunol. 152:163-75 (1994)); Kast et al., 1994 152(8):
3904-12; Borras-Cuesta et al., Hum. Immunol. 2000 61(3): 266-278;
Alexander et al., J. Immunol. 2000 164(3); 164(3): 1625-1633;
Alexander et al., PMID: 7895164, UI: 95202582; O'Sullivan et al.,
J. Immunol. 1991 147(8): 2663-2669; Alexander et al., Immunity 1994
1(9): 751-761 and Alexander et al., Immunol. Res. 1998 18(2):
79-92.
[0179] Related embodiments of the inventions include polypeptides
comprising combinations of the different motifs set forth in Table
XIX, and/or, one or more of the predicted CTL epitopes of Table V
through Table XVIII, and/or, one or more of the T cell binding
motifs known in the art. Preferred embodiments contain no
insertions, deletions or substitutions either within the motifs or
the intervening sequences of the polypeptides. In addition,
embodiments which include a number of either N-terminal and/or
C-terminal amino acid residues on either side of these motifs may
be desirable (to, for example, include a greater portion of the
polypeptide architecture in which the motif is located). Typically
the number of N-terminal and/or C-terminal amino acid residues on
either side of a motif is between about 1 to about 100 amino acid
residues, preferably 5 to about 50 amino acid residues.
158P1D7-related proteins are embodied in many forms, preferably in
isolated form. A purified 158P1D7 protein molecule will be
substantially free of other proteins or molecules that impair the
binding of 158P1D7 to antibody, T cell or other ligand. The nature
and degree of isolation and purification will depend on the
intended use. Embodiments of a 158P1D7-related proteins include
purified 158P1D7-related proteins and functional, soluble
158P1D7-related proteins. In one embodiment, a functional, soluble
158P1D7 protein or fragment thereof retains the ability to be bound
by antibody, T cell or other ligand.
[0180] The invention also provides 158P1D7 proteins comprising
biologically active fragments of the 158P1D7 amino acid sequence
shown in FIG. 2 or FIG. 3. Such proteins exhibit properties of the
158P1D7 protein, such as the ability to elicit the generation of
antibodies that specifically bind an epitope associated with the
158P1D7 protein; to be bound by such antibodies; to elicit the
activation of HTL or CTL; and/or, to be recognized by HTL or
CTL.
[0181] 158P1D7-related polypeptides that contain particularly
interesting structures can be predicted and/or identified using
various analytical techniques well known in the art, including, for
example, the methods of Chou-Fasman, Garnier-Robson,
Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf
analysis, or on the basis of immunogenicity. Fragments that contain
such structures are particularly useful in generating
subunit-specific anti-158P1D7 antibodies, or T cells or in
identifying cellular factors that bind to 158P1D7.
[0182] CTL epitopes can be determined using specific algorithms to
identify peptides within an 158P1D7 protein that are capable of
optimally binding to specified HLA alleles (e.g., by using the
SYFPEITHI site at World Wide Web URL syfpeithi.bmi-heidelberg.com/;
the listings in Table IV(A)-(E); Epimatrix.TM. and Epimer.TM.,
Brown University, URL (www.brown.edu/Research/TB-HIV
Lab/epimatrix/epimatrix.html); and BIMAS, URL bimas.dcrt.nih.gov/).
Illustrating this, peptide epitopes from 158P1D7 that are presented
in the context of human MHC class I molecules HLA-A1, A2, A3, A11,
A24, B7 and B35 were predicted (Tables V-XVIII). Specifically, the
complete amino acid sequence of the 158P1D7 protein was entered
into the HLA Peptide Motif Search algorithm found in the
Bioinformatics and Molecular Analysis Section (BIMAS) web site
listed above. The HLA peptide motif search algorithm was developed
by Dr. Ken Parker based on binding of specific peptide sequences in
the groove of HLA Class I molecules, in particular HLA-A2 (see,
e.g., Falk et al., Nature 351: 290-6 (1991); Hunt et al., Science
255:1261-3 (1992); Parker et al., J. Immunol. 149:3580-7 (1992);
Parker et al., J. Immunol. 152:163-75 (1994)). This algorithm
allows location and ranking of 8-mer, 9-mer, and 10-mer peptides
from a complete protein sequence for predicted binding to HLA-A2 as
well as numerous other HLA Class I molecules. Many HLA class I
binding peptides are 8-, 9-, 10 or 11-mers. For example, for class
I HLA-A2, the epitopes preferably contain a leucine (L) or
methionine (M) at position 2 and a valine (V) or leucine (L) at the
C-terminus (see, e.g., Parker et al., J. Immunol. 149:3580-7
(1992)). Selected results of 158P1D7 predicted binding peptides are
shown in Tables V-XVIII herein. In Tables V-XVIII, the top 50
ranking candidates, 9-mers and 10-mers, for each family member are
shown along with their location, the amino acid sequence of each
specific peptide, and an estimated binding score. The binding score
corresponds to the estimated half time of dissociation of complexes
containing the peptide at 37.degree. C. at pH 6.5. Peptides with
the highest binding score are predicted to be the most tightly
bound to HLA Class I on the cell surface for the greatest period of
time and thus represent the best immunogenic targets for T-cell
recognition.
[0183] Actual binding of peptides to an HLA allele can be evaluated
by stabilization of HLA expression on the antigen-processing
defective cell line T2 (see, e.g., Xue et al., Prostate 30:73-8
(1997) and Peshwa et al., Prostate 36:129-38 (1998)).
Immunogenicity of specific peptides can be evaluated in vitro by
stimulation of CD8+ cytotoxic T lymphocytes (CTL) in the presence
of antigen presenting cells such as dendritic cells.
[0184] It is to be appreciated that every epitope predicted by the
BIMAS site, Epimer.TM. and Epimatrix.TM. sites, or specified by the
HLA class I or class II motifs available in the art or which become
part of the art such as set forth in Table IV (or determined using
World Wide Web site URL syfpeithi.bmi-heidelberg.com/) are to be
"applied" to the 158P1D7 protein. As used in this context "applied"
means that the 158P1D7 protein is evaluated, e.g., visually or by
computer-based patterns finding methods, as appreciated by those of
skill in the relevant art. Every subsequence of the 158P1D7 of 8,
9, 10, or 11 amino acid residues that bears an HLA Class I motif,
or a subsequence of 9 or more amino acid residues that bear an HLA
Class II motif are within the scope of the invention.
[0185] III.B.) Expression of 158P1D7-Related Proteins
[0186] In an embodiment described in the examples that follow,
158P1D7 can be conveniently expressed in cells (such as 293T cells)
transfected with a commercially available expression vector such as
a CMV-driven expression vector encoding 158P1D7 with a C-terminal
6.times. His and MYC tag (pcDNA3.1/mycHIS, Invitrogen or Tag5,
GenHunter Corporation, Nashville Tenn.). The Tag5 vector provides
an IgGK secretion signal that can be used to facilitate the
production of a secreted 158P1D7 protein in transfected cells. The
secreted HIS-tagged 158P1D7 in the culture media can be purified,
e.g., using a nickel column using standard techniques.
[0187] III.C.) Modifications of 158P1D7-Related Proteins
[0188] Modifications of 158P1D7-related proteins such as covalent
modifications are included within the scope of this invention. One
type of covalent modification includes reacting targeted amino acid
residues of a 158P1D7 polypeptide with an organic derivatizing
agent that is capable of reacting with selected side chains or the
N- or C-terminal residues of the 158P1D7. Another type of covalent
modification of the 158P1D7 polypeptide included within the scope
of this invention comprises altering the native glycosylation
pattern of a protein of the invention. Another type of covalent
modification of 158P1D7 comprises linking the 158P1D7 polypeptide
to one of a variety of nonproteinaceous polymers, e.g.,
polyethylene glycol (PEG), polypropylene glycol, or
polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos.
4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
4,179,337.
[0189] The 158P1D7-related proteins of the present invention can
also be modified to form a chimeric molecule comprising 158P1D7
fused to another, heterologous polypeptide or amino acid sequence.
Such a chimeric molecule can be synthesized chemically or
recombinantly. A chimeric molecule can have a protein of the
invention fused to another tumor-associated antigen or fragment
thereof. Alternatively, a protein in accordance with the invention
can comprise a fusion of fragments of the 158P1D7 sequence (amino
or nucleic acid) such that a molecule is created that is not,
through its length, directly homologous to the amino or nucleic
acid sequences shown in FIG. 2 or FIG. 3. Such a chimeric molecule
can comprise multiples of the same subsequence of 158P1D7. A
chimeric molecule can comprise a fusion of a 158P1D7-related
protein with a polyhistidine epitope tag, which provides an epitope
to which immobilized nickel can selectively bind, with cytokines or
with growth factors. The epitope tag is generally placed at the
amino- or carboxyl-terminus of the 158P1D7. In an alternative
embodiment, the chimeric molecule can comprise a fusion of a
158P1D7-related protein with an immunoglobulin or a particular
region of an immunoglobulin. For a bivalent form of the chimeric
molecule (also referred to as an "immunoadhesin"), such a fusion
could be to the Fc region of an IgG molecule. The Ig fusions
preferably include the substitution of a soluble (transmembrane
domain deleted or inactivated) form of a 158P1D7 polypeptide in
place of at least one variable region within an Ig molecule. In a
preferred embodiment, the immunoglobulin fusion includes the hinge,
CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGI
molecule. For the production of immunoglobulin fusions see, e.g.,
U.S. Pat. No. 5,428,130 issued Jun. 27, 1995.
[0190] III.D.) Uses of 158P1D7-Related Proteins
[0191] The proteins of the invention have a number of different
uses. As 158P1D7 is highly expressed in bladder and other cancers,
158P1D7-related proteins are used in methods that assess the status
of 158P1D7 gene products in normal versus cancerous tissues,
thereby elucidating the malignant phenotype. Typically,
polypeptides from specific regions of the 158P1D7 protein are used
to assess the presence of perturbations (such as deletions,
insertions, point mutations etc.) in those regions (such as regions
containing one or more motifs). Exemplary assays utilize antibodies
or T cells targeting 158P1D7-related proteins comprising the amino
acid residues of one or more of the biological motifs contained
within the 158P1D7 polypeptide sequence in order to evaluate the
characteristics of this region in normal versus cancerous tissues
or to elicit an immune response to the epitope. Alternatively,
158P1D7-related proteins that contain the amino acid residues of
one or more of the biological motifs in the 158P1D7 protein are
used to screen for factors that interact with that region of
158P1D7.
[0192] 158P1D7 protein fragments/subsequences are particularly
useful in generating and characterizing domain-specific antibodies
(e.g., antibodies recognizing an extracellular or intracellular
epitope of an 158P1D7 protein), for identifying agents or cellular
factors that bind to 158P1D7 or a particular structural domain
thereof, and in various therapeutic and diagnostic contexts,
including but not limited to diagnostic assays, cancer vaccines and
methods of preparing such vaccines.
[0193] Proteins encoded by the 158P1D7 genes, or by analogs,
homologs or fragments thereof, have a variety of uses, including
but not limited to generating antibodies and in methods for
identifying ligands and other agents and cellular constituents that
bind to an 158P1D7 gene product. Antibodies raised against an
158P1D7 protein or fragment thereof are useful in diagnostic and
prognostic assays, and imaging methodologies in the management of
human cancers characterized by expression of 158P1D7 protein, such
as those listed in Table I. Such antibodies can be expressed
intracellularly and used in methods of treating patients with such
cancers. 158P1D7-related nucleic acids or proteins are also used in
generating HTL or CTL responses.
[0194] Various immunological assays useful for the detection of
158P1D7 proteins are used, including but not limited to various
types of radioimmunoassays, enzyme-linked immunosorbent assays
(ELISA), enzyme-linked immunofluorescent assays (ELIFA),
immunocytochemical methods, and the like. Antibodies can be labeled
and used as immunological imaging reagents capable of detecting
158P1D7-expressing cells (e.g., in radioscintigraphic imaging
methods). 158P1D7 proteins are also particularly useful in
generating cancer vaccines, as further described herein
[0195] IV.) 158P1D7 Antibodies
[0196] Another aspect of the invention provides antibodies that
bind to 158P1D7-related proteins. Preferred antibodies specifically
bind to a 158P1D7-related protein and do not bind (or bind weakly)
to peptides or proteins that are not 158P1D7-related proteins. For
example, antibodies bind 158P1D7 can bind 158P1D7-related proteins
such as the homologs or analogs thereof.
[0197] 158P1D7 antibodies of the invention are particularly useful
in bladder cancer diagnostic and prognostic assays, and imaging
methodologies. Similarly, such antibodies are useful in the
treatment, diagnosis, and/or prognosis of other cancers, to the
extent 158P1D7 is also expressed or overexpressed in these other
cancers. Moreover, intracellularly expressed antibodies (e.g.,
single chain antibodies) are therapeutically useful in treating
cancers in which the expression of 158P1D7 is involved, such as
advanced or metastatic bladder cancers.
[0198] The invention also provides various immunological assays
useful for the detection and quantification of 158P1D7 and mutant
158P1D7-related proteins. Such assays can comprise one or more
158P1D7 antibodies capable of recognizing and binding a
158P1D7-related protein, as appropriate. These assays are performed
within various immunological assay formats well known in the art,
including but not limited to various types of radioimmunoassays,
enzyme-linked immunosorbent assays (ELISA), enzyme-linked
immunofluorescent assays (ELIFA), and the like.
[0199] Immunological non-antibody assays of the invention also
comprise T cell immunogenicity assays (inhibitory or stimulatory)
as well as major histocompatibility complex (MHC) binding
assays.
[0200] In addition, immunological imaging methods capable of
detecting bladder cancer and other cancers expressing 158P1D7 are
also provided by the invention, including but not limited to
radioscintigraphic imaging methods using labeled 158P1D7
antibodies. Such assays are clinically useful in the detection,
monitoring, and prognosis of 158P1D7 expressing cancers such as
bladder cancer.
[0201] 158P1D7 antibodies are also used in methods for purifying a
158P1D7-related protein and for isolating 158P1D7 homologues and
related molecules. For example, a method of purifying a
158P1D7-related protein comprises incubating an 158P1D7 antibody,
which has been coupled to a solid matrix, with a lysate or other
solution containing a 158P1D7-related protein under conditions that
permit the 158P1D7 antibody to bind to the 158P1D7-related protein;
washing the solid matrix to eliminate impurities; and eluting the
158P1D7-related protein from the coupled antibody. Other uses of
the 158P1D7 antibodies of the invention include generating
anti-idiotypic antibodies that mimic the 158P1D7 protein.
[0202] Various methods for the preparation of antibodies are well
known in the art. For example, antibodies can be prepared by
immunizing a suitable mammalian host using a 158P1D7-related
protein, peptide, or fragment, in isolated or immunoconjugated form
(Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane
(1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
In addition, fusion proteins of 158P1D7 can also be used, such as a
158P1D7 GST-fusion protein. In a particular embodiment, a GST
fusion protein comprising all or most of the amino acid sequence of
FIG. 2 or FIG. 3 is produced, then used as an immunogen to generate
appropriate antibodies. In another embodiment, a 158P1D7-related
protein is synthesized and used as an immunogen.
[0203] In addition, naked DNA immunization techniques known in the
art are used (with or without purified 158P1D7-related protein or
158P1D7 expressing cells) to generate an immune response to the
encoded immunogen (for review, see Donnelly et al., 1997, Ann. Rev.
Immunol. 15: 617-648).
[0204] The amino acid sequence of 158P1D7 as shown in FIG. 2 or
FIG. 3 can be analyzed to select specific regions of the 158P1D7
protein for generating antibodies. For example, hydrophobicity and
hydrophilicity analyses of the 158P1D7 amino acid sequence are used
to identify hydrophilic regions in the 158P1D7 structure (see,
e.g., the Example entitled "Antigenicity profiles"). Regions of the
158P1D7 protein that show immunogenic structure, as well as other
regions and domains, can readily be identified using various other
methods known in the art, such as Chou-Fasman, Hopp and Woods,
Kyte-Doolittle, Janin, Bhaskaran and Ponnuswamy, Deleage and Roux,
Garnier-Robson, Eisenberg, Karplus-Schultz, or Jameson-Wolf
analysis. Thus, each region identified by any of these programs or
methods is within the scope of the present invention. Methods for
the generation of 158P1D7 antibodies are further illustrated by way
of the examples provided herein. Methods for preparing a protein or
polypeptide for use as an immunogen are well known in the art. Also
well known in the art are methods for preparing immunogenic
conjugates of a protein with a carrier, such as BSA, KLH or other
carrier protein. In some circumstances, direct conjugation using,
for example, carbodiimide reagents are used; in other instances
linking reagents such as those supplied by Pierce Chemical Co.,
Rockford, Ill., are effective. Administration of a 158P1D7
immunogen is often conducted by injection over a suitable time
period and with use of a suitable adjuvant, as is understood in the
art. During the immunization schedule, titers of antibodies can be
taken to determine adequacy of antibody formation.
[0205] 158P1D7 monoclonal antibodies can be produced by various
means well known in the art. For example, immortalized cell lines
that secrete a desired monoclonal antibody are prepared using the
standard hybridoma technology of Kohler and Milstein or
modifications that immortalize antibody-producing B cells, as is
generally known. Immortalized cell lines that secrete the desired
antibodies are screened by immunoassay in which the antigen is a
158P1D7-related protein. When the appropriate immortalized cell
culture is identified, the cells can be expanded and antibodies
produced either from in vitro cultures or from ascites fluid.
[0206] The antibodies or fragments of the invention can also be
produced, by recombinant means. Regions that bind specifically to
the desired regions of the 158P1D7 protein can also be produced in
the context of chimeric or complementarity determining region (CDR)
grafted antibodies of multiple species origin. Humanized or human
158P1D7 antibodies can also be produced, and are preferred for use
in therapeutic contexts. Methods for humanizing murine and other
non-human antibodies, by substituting one or more of the non-human
antibody CDRs for corresponding human antibody sequences, are well
known (see for example, Jones et al., 1986, Nature 321: 522-525;
Riechmann et al., 1988, Nature 332: 323-327; Verhoeyen et al.,
1988, Science 239: 1534-1536). See also, Carter et al., 1993, Proc.
Natl. Acad. Sci. USA 89: 4285 and Sims et al., 1993, J. Immunol.
151: 2296.
[0207] Methods for producing fully human monoclonal antibodies
include phage display and transgenic methods (for review, see
Vaughan et al., 1998, Nature Biotechnology 16: 535-539). Fully
human 158P1D7 monoclonal antibodies can be generated using cloning
technologies employing large human Ig gene combinatorial libraries
(i.e., phage display) (Griffiths and Hoogenboom, Building an in
vitro immune system: human antibodies from phage display libraries.
In: Protein Engineering of Antibody Molecules for Prophylactic and
Therapeutic Applications in Man, Clark, M. (Ed.), Nottingham
Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from
combinatorial libraries. Id., pp 65-82). Fully human 158P1D7
monoclonal antibodies can also be produced using transgenic mice
engineered to contain human immunoglobulin gene loci as described
in PCT Patent Application WO98/24893, Kucherlapati and Jakobovits
et al., published Dec. 3, 1997 (see also, Jakobovits, 1998, Exp.
Opin. Invest. Drugs 7(4): 607-614; U.S. Pat. Nos. 6,162,963 issued
Dec. 19, 2000; 6,150,584 issued Nov. 12, 2000; and, 6,114598 issued
Sep. 5, 2000). This method avoids the in vitro manipulation
required with phage display technology and efficiently produces
high affinity authentic human antibodies.
[0208] Reactivity of 158P1D7 antibodies with an 158P1D7-related
protein can be established by a number of well known means,
including Western blot, immunoprecipitation, ELISA, and FACS
analyses using, as appropriate, 158P1D7-related proteins,
158P1D7-expressing cells or extracts thereof. A 158P1D7 antibody or
fragment thereof can be labeled with a detectable marker or
conjugated to a second molecule. Suitable detectable markers
include, but are not limited to, a radioisotope, a fluorescent
compound, a bioluminescent compound, chemiluminescent compound, a
metal chelator or an enzyme. Further, bi-specific antibodies
specific for two or more 158P1D7 epitopes are generated using
methods generally known in the art. Homodimeric antibodies can also
be generated by cross-linking techniques known in the art (e.g.,
Wolff et al., Cancer Res. 53: 2560-2565).
[0209] V.) 158P1D7 Cellular Immune Responses
[0210] The mechanism by which T cells recognize antigens has been
delineated. Efficacious peptide epitope vaccine compositions of the
invention induce a therapeutic or prophylactic immune responses in
very broad segments of the world-wide population. For an
understanding of the value and efficacy of compositions of the
invention that induce cellular immune responses, a brief review of
immunology-related technology is provided.
[0211] A complex of an HLA molecule and a peptidic antigen acts as
the ligand recognized by HLA-restricted T cells (Buus, S. et al.,
Cell 47:1071, 1986; Babbitt, B. P. et al., Nature 317:359, 1985;
Townsend, A. and Bodmer, H., Annu. Rev. Immunol. 7:601, 1989;
Germain, R. N., Annu. Rev. Immunol. 11:403, 1993). Through the
study of single amino acid substituted antigen analogs and the
sequencing of endogenously bound, naturally processed peptides,
critical residues that correspond to motifs required for specific
binding to HLA antigen molecules have been identified and are set
forth in Table IV (see also, e.g., Southwood, et al., J Immunol.
160:3363, 1998; Rammensee, et al., Immunogenetics 41:178, 1995;
Rammensee et a., SYFPEITHI, access via World Wide Web at URL
syfpeithi.bmi-heidelberg.com/; Sette, A. and Sidney, J. Curr. Opin.
Immunol. 10:478, 1998; Engelhard, V. H., Curr. Opin. Immunol. 6:13,
1994; Sette, A. and Grey, H. M., Curr. Opin. Immunol. 4:79, 1992;
Sinigaglia, F. and Hammer, J. Curr. Biol. 6:52, 1994; Ruppert et
al., Cell 74:929-937, 1993; Kondo et al., J. Immunol.
155:4307-4312, 1995; Sidney et al., J. Immunol. 157:3480-3490,
1996; Sidney et al., Human Immunol. 45:79-93, 1996; Sette, A. and
Sidney, J. Immunogenetics November 1999; 50(3-4):201-12,
Review).
[0212] Furthermore, x-ray crystallographic analyses of HLA-peptide
complexes have revealed pockets within the peptide binding
cleft/groove of HLA molecules which accommodate, in an
allele-specific mode, residues borne by peptide ligands; these
residues in turn determine the HLA binding capacity of the peptides
in which they are present. (See, e.g., Madden, D. R. Annu. Rev.
Immunol. 13:587, 1995; Smith, et al., Immunity 4:203, 1996; Fremont
et al., Immunity 8:305, 1998; Stern et al., Structure 2:245, 1994;
Jones, E. Y. Curr. Opin. Immunol. 9:75, 1997; Brown, J. H. et al.,
Nature 364:33, 1993; Guo, H. C. et al., Proc. Natl. Acad. Sci. USA
90:8053, 1993; Guo, H. C. et al., Nature 360:364, 1992; Silver, M.
L. et al., Nature 360:367, 1992; Matsumura, M. et al., Science
257:927, 1992; Madden et al., Cell 70:1035, 1992; Fremont, D. H. et
al., Science 257:919, 1992; Saper, M. A., Bjorkman, P. J. and
Wiley, D. C., J. Mol. Biol. 219:277, 1991.)
[0213] Accordingly, the definition of class I and class II
allele-specific HLA binding motifs, or class I or class II
supermotifs allows identification of regions within a protein that
are correlated with binding to particular HLA antigen(s).
[0214] Thus, by a process of HLA motif identification, candidates
for epitope-based vaccines have been identified; such candidates
can be further evaluated by HLA-peptide binding assays to determine
binding affinity and/or the time period of association of the
epitope and its corresponding HLA molecule. Additional confirmatory
work can be performed to select, amongst these vaccine candidates,
epitopes with preferred characteristics in terms of population
coverage, and/or immunogenicity.
[0215] Various strategies can be utilized to evaluate cellular
immunogenicity, including:
[0216] 1) Evaluation of primary T cell cultures from normal
individuals (see, e.g., Wentworth, P. A. et al., Mol. Immunol.
32:603,1995; Celis, E. et al., Proc. Natl. Acad. Sci. USA 91:2105,
1994; Tsai, V. et al., J. Immunol. 158:1796, 1997; Kawashima, I. et
al., Human Immunol. 59:1, 1998). This procedure involves the
stimulation of peripheral blood lymphocytes (PBL) from normal
subjects with a test peptide in the presence of antigen presenting
cells in vitro over a period of several weeks. T cells specific for
the peptide become activated during this time and are detected
using, e.g., a lymphokine- or .sup.51Cr-release assay involving
peptide sensitized target cells.
[0217] 2) Immunization of HLA transgenic mice (see, e.g.,
Wentworth, P. A. et al., J. Immunol. 26:97, 1996; Wentworth, P. A.
et al., Int. Immunol. 8:651, 1996; Alexander, J. et al., J.
Immunol. 159:4753, 1997). For example, in such methods peptides in
incomplete Freund's adjuvant are administered subcutaneously to HLA
transgenic mice. Several weeks following immunization, splenocytes
are removed and cultured in vitro in the presence of test peptide
for approximately one week. Peptide-specific T cells are detected
using, e.g., a .sup.51Cr-release assay involving peptide sensitized
target cells and target cells expressing endogenously generated
antigen.
[0218] 3) Demonstration of recall T cell responses from immune
individuals who have been either effectively vaccinated and/or from
chronically ill patients (see, e.g., Rehermann, B. et al., J. Exp.
Med. 181:1047, 1995; Doolan, D. L. et al., Immunity 7:97, 1997;
Bertoni, R. et al., J. Clin. Invest. 100:503, 1997; Threlkeld, S.
C. et al., J. Immunol. 159:1648, 1997; Diepolder, H. M. et al., J.
Virol. 71:6011, 1997). Accordingly, recall responses are detected
by culturing PBL from subjects that have been exposed to the
antigen due to disease and thus have generated an immune response
"naturally", or from patients who were vaccinated against the
antigen. PBL from subjects are cultured in vitro for 1-2 weeks in
the presence of test peptide plus antigen presenting cells (APC) to
allow activation of "memory" T cells, as compared to "naive" T
cells. At the end of the culture period, T cell activity is
detected using assays including .sup.51Cr release involving
peptide-sensitized targets, T cell proliferation, or lymphokine
release.
[0219] VI.) 158P1D7 Transgenic Animals
[0220] Nucleic acids that encode a 158P1D7-related protein can also
be used to generate either transgenic animals or "knock out"
animals which, in turn, are useful in the development and screening
of therapeutically useful reagents. In accordance with established
techniques, cDNA encoding 158P1D7 can be used to clone genomic DNA
that encodes 158P1D7. The cloned genomic sequences can then be used
to generate transgenic animals containing cells that express DNA
that encode 158P1D7. Methods for generating transgenic animals,
particularly animals such as mice or rats, have become conventional
in the art and are described, for example, in U.S. Pat. Nos.
4,736,866 issued Apr. 12, 1988, and 4,870,009 issued Sep. 26, 1989.
Typically, particular cells would be targeted for 158P1D7 transgene
incorporation with tissue-specific enhancers.
[0221] Transgenic animals that include a copy of a transgene
encoding 158P1D7 can be used to examine the effect of increased
expression of DNA that encodes 158P1D7. Such animals can be used as
tester animals for reagents thought to confer protection from, for
example, pathological conditions associated with its
overexpression. In accordance with this aspect of the invention, an
animal is treated with a reagent and a reduced incidence of a
pathological condition, compared to untreated animals that bear the
transgene, would indicate a potential therapeutic intervention for
the pathological condition.
[0222] Alternatively, non-human homologues of 158P1D7 can be used
to construct a 158P1D7 "knock out" animal that has a defective or
altered gene encoding 158P1D7 as a result of homologous
recombination between the endogenous gene encoding 158P1D7 and
altered genomic DNA encoding 158P1D7 introduced into an embryonic
cell of the animal. For example, cDNA that encodes 158P1D7 can be
used to clone genomic DNA encoding 158P1D7 in accordance with
established techniques. A portion of the genomic DNA encoding
158P1D7 can be deleted or replaced with another gene, such as a
gene encoding a selectable marker that can be used to monitor
integration. Typically, several kilobases of unaltered flanking DNA
(both at the 5' and 3' ends) are included in the vector (see, e.g.,
Thomas and Capecchi, Cell, 51:503 (1987) for a description of
homologous recombination vectors). The vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in
which the introduced DNA has homologously recombined with the
endogenous DNA are selected (see, e.g., Li et al., Cell, 69:915
(1992)). The selected cells are then injected into a blastocyst of
an animal (e.g., a mouse or rat) to form aggregation chimeras (see,
e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A
Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp.
113-152). A chimeric embryo can then be implanted into a suitable
pseudopregnant female foster animal, and the embryo brought to term
to create a "knock out" animal. Progeny harboring the homologously
recombined DNA in their germ cells can be identified by standard
techniques and used to breed animals in which all cells of the
animal contain the homologously recombined DNA. Knock out animals
can be characterized, for example, for their ability to defend
against certain pathological conditions or for their development of
pathological conditions due to absence of the 158P1D7
polypeptide.
[0223] VII.) Methods for the Detection of 158P1D7
[0224] Another aspect of the present invention relates to methods
for detecting 158P1D7 polynucleotides and polypeptides and
158P1D7-related proteins, as well as methods for identifying a cell
that expresses 158P1D7. The expression profile of 158P1D7 makes it
a diagnostic marker for metastasized disease. Accordingly, the
status of 158P1D7 gene products provides information useful for
predicting a variety of factors including susceptibility to
advanced stage disease, rate of progression, and/or tumor
aggressiveness. As discussed in detail herein, the status of
158P1D7 gene products in patient samples can be analyzed by a
variety protocols that are well known in the art including
immunohistochemical analysis, the variety of Northern blotting
techniques including in situ hybridization, RT-PCR analysis (for
example on laser capture micro-dissected samples), Western blot
analysis and tissue array analysis.
[0225] More particularly, the invention provides assays for the
detection of 158P1D7 polynucleotides in a biological sample, such
as urine, serum, bone, prostatic fluid, tissues, semen, cell
preparations, and the like. Detectable 158P1D7 polynucleotides
include, for example, a 158P1D7 gene or fragment thereof, 158P1D7
mRNA, alternative splice variant 158P1D7 mRNAs, and recombinant DNA
or RNA molecules that contain a 158P1D7 polynucleotide. A number of
methods for amplifying and/or detecting the presence of 158P1D7
polynucleotides are well known in the art and can be employed in
the practice of this aspect of the invention.
[0226] In one embodiment, a method for detecting an 158P1D7 mRNA in
a biological sample comprises producing cDNA from the sample by
reverse transcription using at least one primer; amplifying the
cDNA so produced using an 158P1D7 polynucleotides as sense and
antisense primers to amplify 158P1D7 cDNAs therein; and detecting
the presence of the amplified 158P1D7 cDNA. Optionally, the
sequence of the amplified 158P1D7 cDNA can be determined.
[0227] In another embodiment, a method of detecting a 158P1D7 gene
in a biological sample comprises first isolating genomic DNA from
the sample; amplifying the isolated genomic DNA using 158P1D7
polynucleotides as sense and antisense primers; and detecting the
presence of the amplified 158P1D7 gene. Any number of appropriate
sense and antisense probe combinations can be designed from the
nucleotide sequence provided for the 158P1D7 (FIG. 2) and used for
this purpose.
[0228] The invention also provides assays for detecting the
presence of an 158P1D7 protein in a tissue or other biological
sample such as urine, serum, semen, bone, prostate, cell
preparations, and the like. Methods for detecting a 158P1D7-related
protein are also well known and include, for example,
immunoprecipitation, immunohistochemical analysis, Western blot
analysis, molecular binding assays, ELISA, ELIFA and the like. For
example, a method of detecting the presence of a 158P1D7-related
protein in a biological sample comprises first contacting the
sample with a 158P1D7 antibody, a 158P1D7-reactive fragment
thereof, or a recombinant protein containing an antigen binding
region of a 158P1D7 antibody; and then detecting the binding of
158P1D7-related protein in the sample.
[0229] Methods for identifying a cell that expresses 158P1D7 are
also within the scope of the invention. In one embodiment, an assay
for identifying a cell that expresses a 158P1D7 gene comprises
detecting the presence of 158P1D7 mRNA in the cell. Methods for the
detection of particular mRNAs in cells are well known and include,
for example, hybridization assays using complementary DNA probes
(such as in situ hybridization using labeled 158P1D7 riboprobes,
Northern blot and related techniques) and various nucleic acid
amplification assays (such as RT-PCR using complementary primers
specific for 158P1D7, and other amplification type detection
methods, such as, for example, branched DNA, SISBA, TMA and the
like). Alternatively, an assay for identifying a cell that
expresses a 158P1D7 gene comprises detecting the presence of
158P1D7-related protein in the cell or secreted by the cell.
Various methods for the detection of proteins are well known in the
art and are employed for the detection of 158P1D7-related proteins
and cells that express 158P1D7-related proteins.
[0230] 158P1D7 expression analysis is also useful as a tool for
identifying and evaluating agents that modulate 158P1D7 gene
expression. For example, 158P1D7 expression is significantly
upregulated in bladder cancer, and is expressed in cancers of the
tissues listed in Table I. Identification of a molecule or
biological agent that inhibits 158P1D7 expression or
over-expression in cancer cells is of therapeutic value. For
example, such an agent can be identified by using a screen that
quantifies 158P1D7 expression by RT-PCR, nucleic acid hybridization
or antibody binding.
[0231] VIII.) Methods for Monitoring the Status of 158P1D7-Related
Genes and Their Products
[0232] Oncogenesis is known to be a multistep process where
cellular growth becomes progressively dysregulated and cells
progress from a normal physiological state to precancerous and then
cancerous states (see, e.g., Alers et al., Lab Invest. 77(5):
437438 (1997) and Isaacs et al., Cancer Surv. 23: 19-32 (1995)). In
this context, examining a biological sample for evidence of
dysregulated cell growth (such as aberrant 158P1D7 expression in
cancers) allows for early detection of such aberrant physiology,
before a pathologic state such as cancer has progressed to a stage
that therapeutic options are more limited and or the prognosis is
worse. In such examinations, the status of 158P1D7 in a biological
sample of interest can be compared, for example, to the status of
158P1D7 in a corresponding normal sample (e.g. a sample from that
individual or alternatively another individual that is not affected
by a pathology). An alteration in the status of 158P1D7 in the
biological sample (as compared to the normal sample) provides
evidence of dysregulated cellular growth. In addition to using a
biological sample that is not affected by a pathology as a normal
sample, one can also use a predetermined normative value such as a
predetermined normal level of mRNA expression (see, e.g., Grever et
al., J. Comp. Neurol. December 1996; 376(2):306-14 and U.S. Pat.
No. 5,837,501) to compare 158P1D7 status in a sample.
[0233] The term "status" in this context is used according to its
art accepted meaning and refers to the condition or state of a gene
and its products. Typically, skilled artisans use a number of
parameters to evaluate the condition or state of a gene and its
products. These include, but are not limited to the location of
expressed gene products (including the location of 158P1D7
expressing cells) as well as the level, and biological activity of
expressed gene products (such as 158P1D7 mRNA, polynucleotides and
polypeptides). Typically, an alteration in the status of 158P1D7
comprises a change in the location of 158P1D7 and/or 158P1D7
expressing cells and/or an increase in 158P1D7 mRNA and/or protein
expression.
[0234] 158P1D7 status in a sample can be analyzed by a number of
means well known in the art, including without limitation,
immunohistochemical analysis, in situ hybridization, RT-PCR
analysis on laser capture micro-dissected samples, Western blot
analysis, and tissue array analysis. Typical protocols for
evaluating the status of the 158P1D7 gene and gene products are
found, for example in Ausubel et al. eds., 1995, Current Protocols
In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern
Blotting), 15 (Immunoblotting) and 18 (PCR Analysis). Thus, the
status of 158P1D7 in a biological sample is evaluated by various
methods utilized by skilled artisans including, but not limited to
genomic Southern analysis (to examine, for example perturbations in
the 158P1D7 gene), Northern analysis and/or PCR analysis of 158P1D7
mRNA (to examine, for example alterations in the polynucleotide
sequences or expression levels of 158P1D7 mRNAs), and, Western
and/or immunohistochemical analysis (to examine, for example
alterations in polypeptide sequences, alterations in polypeptide
localization within a sample, alterations in expression levels of
158P1D7 proteins and/or associations of 158P1D7 proteins with
polypeptide binding partners). Detectable 158P1D7 polynucleotides
include, for example, a 158P1D7 gene or fragment thereof, 158P1D7
mRNA, alternative splice variants, 158P1D7 mRNAs, and recombinant
DNA or RNA molecules containing a 158P1D7 polynucleotide.
[0235] The expression profile of 158P1D7 makes it a diagnostic
marker for local and/or metastasized disease, and provides
information on the growth or oncogenic potential of a biological
sample. In particular, the status of 158P1D7 provides information
useful for predicting susceptibility to particular disease stages,
progression, and/or tumor aggressiveness. The invention provides
methods and assays for determining 158P1D7 status and diagnosing
cancers that express 158P1D7, such as cancers of the tissues listed
in Table I. For example, because 158P1D7 mRNA is so highly
expressed in bladder and other cancers relative to normal bladder
tissue, assays that evaluate the levels of 158P1D7 mRNA transcripts
or proteins in a biological sample can be used to diagnose a
disease associated with 158P1D7 dysregulation, and can provide
prognostic information useful in defining appropriate therapeutic
options.
[0236] The expression status of 158P1D7 provides information
including the presence, stage and location of dysplastic,
precancerous and cancerous cells, predicting susceptibility to
various stages of disease, and/or for gauging tumor aggressiveness.
Moreover, the expression profile makes it useful as an imaging
reagent for metastasized disease. Consequently, an aspect of the
invention is directed to the various molecular prognostic and
diagnostic methods for examining the status of 158P1D7 in
biological samples such as those from individuals suffering from,
or suspected of suffering from a pathology characterized by
dysregulated cellular growth, such as cancer.
[0237] As described above, the status of 158P1D7 in a biological
sample can be examined by a number of well-known procedures in the
art. For example, the status of 158P1D7 in a biological sample
taken from a specific location in the body can be examined by
evaluating the sample for the presence or absence of 158P1D7
expressing cells (e.g. those that express 158P1D7 mRNAs or
proteins). This examination can provide evidence of dysregulated
cellular growth, for example, when 158P1D7-expressing cells are
found in a biological sample that does not normally contain such
cells (such as a lymph node), because such alterations in the
status of 158P1D7 in a biological sample are often associated with
dysregulated cellular growth. Specifically, one indicator of
dysregulated cellular growth is the metastases of cancer cells from
an organ of origin (such as the bladder) to a different area of the
body (such as a lymph node). By example, evidence of dysregulated
cellular growth is important because occult lymph node metastases
can be detected in a substantial proportion of patients with
prostate cancer, and such metastases are associated with known
predictors of disease progression (see, e.g., Murphy et al.,
Prostate 42(4): 315-317 (2000); Su et al., Semin. Surg. Oncol.
18(1): 17-28 (2000) and Freeman et al., J Urol August 1995 154(2 Pt
1):474-8).
[0238] In one aspect, the invention provides methods for monitoring
158P1D7 gene products by determining the status of 158P1D7 gene
products expressed by cells from an individual suspected of having
a disease associated with dysregulated cell growth (such as
hyperplasia or cancer) and then comparing the status so determined
to the status of 158P1D7 gene products in a corresponding normal
sample. The presence of aberrant 158P1D7 gene products in the test
sample relative to the normal sample provides an indication of the
presence of dysregulated cell growth within the cells of the
individual.
[0239] In another aspect, the invention provides assays useful in
determining the presence of cancer in an individual, comprising
detecting a significant increase in 158P1D7 mRNA or protein
expression in a test cell or tissue sample relative to expression
levels in the corresponding normal cell or tissue. The presence of
158P1D7 mRNA can, for example, be evaluated in tissue samples
including but not limited to those listed in Table I. The presence
of significant 158P1D7 expression in any of these tissues is useful
to indicate the emergence, presence and/or severity of a cancer,
since the corresponding normal tissues do not express 158P1D7 mRNA
or express it at lower levels.
[0240] In a related embodiment, 158P1D7 status is determined at the
protein level rather than at the nucleic acid level. For example,
such a method comprises determining the level of 158P1D7 protein
expressed by cells in a test tissue sample and comparing the level
so determined to the level of 158P1D7 expressed in a corresponding
normal sample. In one embodiment, the presence of 158P1D7 protein
is evaluated, for example, using immunohistochemical methods.
158P1D7 antibodies orbiting partners capable of detecting 158P1D7
protein expression are used in a variety of assay formats well
known in the art for this purpose.
[0241] In a further embodiment, one can evaluate the status of
158P1D7 nucleotide and amino acid sequences in a biological sample
in order to identify perturbations in the structure of these
molecules. These perturbations can include insertions, deletions,
substitutions and the like. Such evaluations are useful because
perturbations in the nucleotide and amino acid sequences are
observed in a large number of proteins associated with a growth
dysregulated phenotype (see, e.g., Marrogi et al., 1999, J. Cutan.
Pathol. 26(8):369-378). For example, a mutation in the sequence of
158P1D7 may be indicative of the presence or promotion of a tumor.
Such assays therefore have diagnostic and predictive value where a
mutation in 158P1D7 indicates a potential loss of function or
increase in tumor growth.
[0242] A wide variety of assays for observing perturbations in
nucleotide and amino acid sequences are well known in the art. For
example, the size and structure of nucleic acid or amino acid
sequences of 158P1D7 gene products are observed by the Northern,
Southern, Western, PCR and DNA sequencing protocols discussed
herein. In addition, other methods for observing perturbations in
nucleotide and amino acid sequences such as single strand
conformation polymorphism analysis are well known in the art (see,
e.g., U.S. Pat. Nos. 5,382,510 issued Sep. 7, 1999, and 5,952,170
issued Jan. 17, 1995).
[0243] Additionally, one can examine the methylation status of the
158P1D7 gene in a biological sample. Aberrant demethylation and/or
hypermethylation of CpG islands in gene 5' regulatory regions
frequently occurs in immortalized and transformed cells, and can
result in altered expression of various genes. For example,
promoter hypermethylation of the DBCCR1, PAX6 and APC genes have
been detected in bladder cancers leading to aberrant expression of
the genes (Esteller et al., Cancer Res 2001; 61:3225-3229) A
variety of assays for examining methylation status of a gene are
well known in the art. For example, one can utilize, in Southern
hybridization approaches, methylation-sensitive restriction enzymes
which cannot cleave sequences that contain methylated CpG sites to
assess the methylation status of CpG islands. In addition, MSP
(methylation specific PCR) can rapidly profile the methylation
status of all the CpG sites present in a CpG island of a given
gene. This procedure involves initial modification of DNA by sodium
bisulfite (which will convert all unmethylated cytosines to uracil)
followed by amplification using primers specific for methylated
versus unmethylated DNA. Protocols involving methylation
interference can also be found for example in Current Protocols In
Molecular Biology, Unit 12, Frederick M. Ausubel et al. eds.,
1995.
[0244] Gene amplification is an additional method for assessing the
status of 158P1D7. Gene amplification is measured in a sample
directly, for example, by conventional Southern blotting or
Northern blotting to quantitate the transcription of mRNA (Thomas,
1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies are employed that recognize specific duplexes, including
DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or
DNA-protein duplexes. The antibodies in turn are labeled and the
assay carried out where the duplex is bound to a surface, so that
upon the formation of duplex on the surface, the presence of
antibody bound to the duplex can be detected.
[0245] Biopsied tissue or peripheral blood can be conveniently
assayed for the presence of cancer cells using for example,
Northern, dot blot or RT-PCR analysis to detect 158P1D7 expression.
The presence of RT-PCR amplifiable 158P1D7 mRNA provides an
indication of the presence of cancer. RT-PCR assays are well known
in the art. RT-PCR detection assays for tumor cells in peripheral
blood are currently being evaluated for use in the diagnosis and
management of a number of human solid tumors.
[0246] A further aspect of the invention is an assessment of the
susceptibility that an individual has for developing cancer. In one
embodiment, a method for predicting susceptibility to cancer
comprises detecting 158P1D7 mRNA or 158P1D7 protein in a tissue
sample, its presence indicating susceptibility to cancer, wherein
the degree of 158P1D7 mRNA expression correlates to the degree of
susceptibility. In a specific embodiment, the presence of 158P1D7
in bladder or other tissue is examined, with the presence of
158P1D7 in the sample providing an indication of bladder cancer
susceptibility (or the emergence or existence of a bladder tumor).
Similarly, one can evaluate the integrity 158P1D7 nucleotide and
amino acid sequences in a biological sample, in order to identify
perturbations in the structure of these molecules such as
insertions, deletions, substitutions and the like. The presence of
one or more perturbations in 158P1D7 gene products in the sample is
an indication of cancer susceptibility (or the emergence or
existence of a tumor).
[0247] The invention also comprises methods for gauging tumor
aggressiveness. In one embodiment, a method for gauging
aggressiveness of a tumor comprises determining the level of
158P1D7 mRNA or 158P1D7 protein expressed by tumor cells, comparing
the level so determined to the level of 158P1D7 mRNA or 158P1D7
protein expressed in a corresponding normal tissue taken from the
same individual or a normal tissue reference sample, wherein the
degree of 158P1D7 mRNA or 158P1D7 protein expression in the tumor
sample relative to the normal sample indicates the degree of
aggressiveness. In a specific embodiment, aggressiveness of a tumor
is evaluated by determining the extent to which 158P1D7 is
expressed in the tumor cells, with higher expression levels
indicating more aggressive tumors. Another embodiment is the
evaluation of the integrity of 158P1D7 nucleotide and amino acid
sequences in a biological sample, in order to identify
perturbations in the structure of these molecules such as
insertions, deletions, substitutions and the like. The presence of
one or more perturbations indicates more aggressive tumors.
[0248] Another embodiment of the invention is directed to methods
for observing the progression of a malignancy in an individual over
time. In one embodiment, methods for observing the progression of a
malignancy in an individual over time comprise determining the
level of 158P1D7 mRNA or 158P1D7 protein expressed by cells in a
sample of the tumor, comparing the level so determined to the level
of 158P1D7 mRNA or 158P1D7 protein expressed in an equivalent
tissue sample taken from the same individual at a different time,
wherein the degree of 158P1D7 mRNA or 158P1D7 protein expression in
the tumor sample over time provides information on the progression
of the cancer. In a specific embodiment, the progression of a
cancer is evaluated by determining 158P1D7 expression in the tumor
cells over time, where increased expression over time indicates a
progression of the cancer. Also, one can evaluate the integrity
158P1D7 nucleotide and amino acid sequences in a biological sample
in order to identify perturbations in the structure of these
molecules such as insertions, deletions, substitutions and the
like, where the presence of one or more perturbations indicates a
progression of the cancer.
[0249] The above diagnostic approaches can be combined with any one
of a wide variety of prognostic and diagnostic protocols known in
the art. For example, another embodiment of the invention is
directed to methods for observing a coincidence between the
expression of 158P1D7 gene and 158P1D7 gene products (or
perturbations in 158P1D7 gene and 158P1D7 gene products) and a
factor that is associated with malignancy, as a means for
diagnosing and prognosticating the status of a tissue sample. A
wide variety of factors associated with malignancy can be utilized,
such as the expression of genes associated with malignancy (e.g.
PSCA, H-rasand p53 expression etc.) as well as gross cytological
observations (see, e.g., Bocking et al., 1984, Anal. Quant. Cytol.
6(2):74-88; Epstein, 1995, Hum. Pathol. 26(2):223-9; Thorson et
al., 1998, Mod. Pathol. 11(6):543-51; Baisden et al., 1999, Am. J.
Surg. Pathol. 23(8):918-24). Methods for observing a coincidence
between the expression of 158P1D7 gene and 158P1D7 gene products
(or perturbations in 158P1D7 gene and 158P1D7 gene products) and
another factor that is associated with malignancy are useful, for
example, because the presence of a set of specific factors that
coincide with disease provides information crucial for diagnosing
and prognosticating the status of a tissue sample.
[0250] In one embodiment, methods for observing a coincidence
between the expression of 158P1D7 gene and 158P1D7 gene products
(or perturbations in 158P1D7 gene and 158P1D7 gene products) and
another factor associated with malignancy entails detecting the
overexpression of 158P1D7 mRNA or protein in a tissue sample,
detecting the overexpression of BLCA-4A mRNA or protein in a tissue
sample (or PSCA expression), and observing a coincidence of 158P1D7
mRNA or protein and BLCA-4 mRNA or protein overexpression (or PSCA
expression) (Amara et al., 2001, Cancer Res 61:4660-4665; Konety et
al., Clin Cancer Res, 2000, 6(7):2618-2625). In a specific
embodiment, the expression of 158P1D7 and BLCA-4 mRNA in bladder
tissue is examined, where the coincidence of 158P1D7 and BLCA-4
mRNA overexpression in the sample indicates the existence of
bladder cancer, bladder cancer susceptibility or the emergence or
status of a bladder tumor.
[0251] Methods for detecting and quantifying the expression of
158P1D7 mRNA or protein are described herein, and standard nucleic
acid and protein detection and quantification technologies are well
known in the art. Standard methods for the detection and
quantification of 158P1D7 mRNA include in situ hybridization using
labeled 158P1D7 riboprobes, Northern blot and related techniques
using 158P1D7 polynucleotide probes, RT-PCR analysis using primers
specific for 158P1D7, and other amplification type detection
methods, such as, for example, branched DNA, SISBA, TMA and the
like. In a specific embodiment, semi-quantitative RT-PCR is used to
detect and quantify 158P1D7 mRNA expression. Any number of primers
capable of amplifying 158P1D7 can be used for this purpose,
including but not limited to the various primer sets specifically
described herein. In a specific embodiment, polyclonal or
monoclonal antibodies specifically reactive with the wild-type
158P1D7 protein can be used in an immunohistochemical assay of
biopsied tissue.
[0252] IX.) Identification of Molecules that Interact with
158P1D7
[0253] The 158P1D7 protein and nucleic acid sequences disclosed
herein allow a skilled artisan to identify proteins, small
molecules and other agents that interact with 158P1D7, as well as
pathways activated by 158P1D7 via any one of a variety of art
accepted protocols. For example, one can utilize one of the
so-called interaction trap systems (also referred to as the
"two-hybrid assay"). In such systems, molecules interact and
reconstitute a transcription factor which directs expression of a
reporter gene, whereupon the expression of the reporter gene is
assayed. Other systems identify protein-protein interactions in
vivo through reconstitution of a eukaryotic transcriptional
activator, see, e.g., U.S. Pat. Nos. 5,955,280 issued Sep. 21,
1999, 5,925,523 issued Jul. 20, 1999, 5,846,722 issued Dec. 8, 1998
and 6,004,746 issued Dec. 21, 1999. Algorithms are also available
in the art for genome-based predictions of protein function (see,
e.g., Marcotte, et al., Nature 402: Nov. 4, 1999, 83-86).
[0254] Alternatively one can screen peptide libraries to identify
molecules that interact with 158P1D7 protein sequences. In such
methods, peptides that bind to 158P1D7 are identified by screening
libraries that encode a random or controlled collection of amino
acids. Peptides encoded by the libraries are expressed as fusion
proteins of bacteriophage coat proteins, the bacteriophage
particles are then screened against the 158P1D7 protein.
[0255] Accordingly, peptides having a wide variety of uses, such as
therapeutic, prognostic or diagnostic reagents, are thus identified
without any prior information on the structure of the expected
ligand or receptor molecule. Typical peptide libraries and
screening methods that can be used to identify molecules that
interact with 158P1D7 protein sequences are disclosed for example
in U.S. Pat. Nos. 5,723,286 issued Mar. 3, 1998 and 5,733,731
issued Mar. 31, 1998.
[0256] Alternatively, cell lines that express 158P1D7 are used to
identify protein-protein interactions mediated by 158P1D7. Such
interactions can be examined using immunoprecipitation techniques
(see, e.g., Hamilton B J, et al. Biochem. Biophys. Res. Commun.
1999, 261:646-51). 158P1D7 protein can be immunoprecipitated from
158P1D7-expressing cell lines using anti-158P1D7 antibodies.
Alternatively, antibodies against His-tag can be used in a cell
line engineered to express fusions of 158P1D7 and a His-tag
(vectors mentioned above). The immunoprecipitated complex can be
examined for protein association by procedures such as Western
blotting, .sup.35S-methionine labeling of proteins, protein
microsequencing, silver staining and two-dimensional gel
electrophoresis.
[0257] Small molecules and ligands that interact with 158P1D7 can
be identified through related embodiments of such screening assays.
For example, small molecules can be identified that interfere with
protein function, including molecules that interfere with 158P1D7's
ability to mediate phosphorylation and de-phosphorylation,
interaction with DNA or RNA molecules as an indication of
regulation of cell cycles, second messenger signaling or
tumorigenesis. Similarly, small molecules that modulate 158P1D7
related ion channel, protein pump, or cell communication functions
158P1D7are identified and used to treat patients that have a cancer
that expresses 158P1D7 (see, e.g., Hille, B., Ionic Channels of
Excitable Membranes 2.sup.nd Ed., Sinauer Assoc., Sunderland,
Mass., 1992). Moreover, ligands that regulate 158P1D7 function can
be identified based on their ability to bind 158P1D7 and activate a
reporter construct. Typical methods are discussed for example in
U.S. Pat. No. 5,928,868 issued Jul. 27, 1999, and include methods
for forming hybrid ligands in which at least one ligand is a small
molecule. In an illustrative embodiment, cells engineered to
express a fusion protein of 158P1D7 and a DNA-binding protein are
used to co-express a fusion protein of a hybrid ligand/small
molecule and a cDNA library transcriptional activator protein. The
cells further contain a reporter gene, the expression of which is
conditioned on the proximity of the first and second fusion
proteins to each other, an event that occurs only if the hybrid
ligand binds to target sites on both hybrid proteins. Those cells
that express the reporter gene are selected and the unknown small
molecule or the unknown ligand is identified. This method provides
a means of identifying modulators which activate or inhibit
158P1D7.
[0258] An embodiment of this invention comprises a method of
screening for a molecule that interacts with an 158P1D7 amino acid
sequence shown in FIG. 2 or FIG. 3, comprising the steps of
contacting a population of molecules with the 158P1D7 amino acid
sequence, allowing the population of molecules and the 158P1D7
amino acid sequence to interact under conditions that facilitate an
interaction, determining the presence of a molecule that interacts
with the 158P1D7 amino acid sequence, and then separating molecules
that do not interact with the 158P1D7 amino acid sequence from
molecules that do. In a specific embodiment, the method further
comprises purifying, characterizing and identifying a molecule that
interacts with the 158P1D7 amino acid sequence. The identified
molecule can be used to modulate a function performed by 158P1D7.
In a preferred embodiment, the 158P1D7 amino acid sequence is
contacted with a library of peptides.
[0259] X.) Therapeutic Methods and Compositions
[0260] The identification of 158P1D7 as a protein that is normally
expressed in a restricted set of tissues, but which is also
expressed in bladder and other cancers, opens a number of
therapeutic approaches to the treatment of such cancers. As
contemplated herein, 158P1D7 functions as a transcription factor
involved in activating tumor-promoting genes or repressing genes
that block tumorigenesis.
[0261] Accordingly, therapeutic approaches that inhibit the
activity of the 158P1D7 protein are useful for patients suffering
from a cancer that expresses 158P1D7. These therapeutic approaches
generally fall into two classes. One class comprises various
methods for inhibiting the binding or association of the 158P1D7
protein with its binding partner or with other proteins. Another
class comprises a variety of methods for inhibiting the
transcription of the 158P1D7 gene or translation of 158P1D7
mRNA.
[0262] X.A.) Anti-Cancer Vaccines
[0263] The invention provides cancer vaccines comprising a
158P1D7-related protein or 158P1D7-related nucleic acid. In view of
the expression of 158P1D7, cancer vaccines prevent and/or treat
158P1D7-expressing cancers with minimal or no effects on non-target
tissues. The use of a tumor antigen in a vaccine that generates
humoral and/or cell-mediated immune responses as anti-cancer
therapy is well known in the art (see, e.g., Hodge et al., 1995,
Int. J. Cancer 63:231-237; Fong et al., 1997, J. Immunol.
159:3113-3117).
[0264] Such methods can be readily practiced by employing a
158P1D7-related protein, or a 158P1D7-encoding nucleic acid
molecule and recombinant vectors capable of expressing and
presenting the 158P1D7 immunogen (which typically comprises a
number of antibody or T cell epitopes). Skilled artisans understand
that a wide variety of vaccine systems for delivery of
immunoreactive epitopes are known in the art (see, e.g., Heryln et
al., Ann Med February 1999 31(1):66-78; Maruyama et al., Cancer
Immunol Immunother June 2000 49(3):123-32) Briefly, such methods of
generating an immune response (e.g. humoral and/or cell-mediated)
in a mammal, comprise the steps of: exposing the mammal's immune
system to an immunoreactive epitope (e.g. an epitope present in the
158P1D7 protein shown in SEQ ID NO: 657 or analog or homolog
thereof) so that the mammal generates an immune response that is
specific for that epitope (e.g. generates antibodies that
specifically recognize that epitope). In a preferred method, the
158P1D7 immunogen contains a biological motif, see e.g., Tables
V-XVIII, or a peptide of a size range from 158P1D7 indicated in
FIG. 9, FIG. 10, FIG. 11, FIG. 12, and FIG. 13.
[0265] The entire 158P1D7 protein, immunogenic regions or epitopes
thereof can be combined and delivered by various means. Such
vaccine compositions can include, for example, lipopeptides (e.g.,
Vitiello, A. et al., J. Clin. Invest. 95:341, 1995), peptide
compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG")
microspheres (see, e.g., Eldridge, et al., Molec. Immunol.
28:287-294, 1991: Alonso et al., Vaccine 12:299-306, 1994; Jones et
al., Vaccine 13:675-681, 1995), peptide compositions contained in
immune stimulating complexes (ISCOMS) (see, e.g., Takahashi et al.,
Nature 344:873-875, 1990; Hu et al., Clin Exp Immunol. 113:235-243,
1998), multiple antigen peptide systems (MAPs) (see e.g., Tam, J.
P., Proc. Natl. Acad. Sci U.S.A. 85:5409-5413, 1988; Tam, J. P., J.
Immunol. Methods 196:17-32, 1996), peptides formulated as
multivalent peptides; peptides for use in ballistic delivery
systems, typically crystallized peptides, viral delivery vectors
(Perkus, M. E. et al., In: Concepts in vaccine development,
Kaufmann, S. H. E., ed., p. 379, 1996; Chakrabarti, S. et al.,
Nature 320:535, 1986; Hu, S. L. et al., Nature 320:537, 1986;
Kieny, M. -P. et al., AIDS Bio/Technology 4:790, 1986; Top, F. H.
et al., J. Infect. Dis. 124:148, 1971; Chanda, P. K. et al.,
Virology 175:535, 1990), particles of viral or synthetic origin
(e.g., Kofler, N. et al., J. Immunol. Methods. 192:25, 1996;
Eldridge, J. H. et al., Sem. Hematol. 30:16, 1993; Falo, L. D., Jr.
et al., Nature Med. 7:649, 1995), adjuvants (Warren, H. S., Vogel,
F. R., and Chedid, L. A. Annu. Rev. Immunol. 4:369, 1986; Gupta, R.
K. et al., Vaccine 11:293, 1993), liposomes (Reddy, R. et al., J.
Immunol. 148:1585, 1992; Rock, K. L., Immunol. Today 17:131, 1996),
or, naked or particle absorbed cDNA (Ulmer, J. B. et al., Science
259:1745, 1993; Robinson, H. L., Hunt, L. A., and Webster, R. G.,
Vaccine 11:957, 1993; Shiver, J. W. et al., In: Concepts in vaccine
development, Kaufmann, S. H. E., ed., p. 423, 1996; Cease, K. B.,
and Berzofsky, J. A., Annu. Rev. Immunol. 12:923, 1994 and
Eldridge, J. H. et al., Sem. Hematol. 30:16, 1993). Toxin-targeted
delivery technologies, also known as receptor mediated targeting,
such as those of Avant Immunotherapeutics, Inc. (Needham, Mass.)
may also be used.
[0266] In patients with 158P1D7-associated cancer, the vaccine
compositions of the invention can also be used in conjunction with
other treatments used for cancer, e.g., surgery, chemotherapy, drug
therapies, radiation therapies, etc. including use in combination
with immune adjuvants such as IL-2, IL-12, GM-CSF, and the
like.
[0267] Cellular Vaccines:
[0268] CTL epitopes can be determined using specific algorithms to
identify peptides within 158P1D7 protein that bind corresponding
HLA alleles (see e.g., Table IV; Epimer.TM. and Epimatrix.TM.,
Brown University (URL
www.brown.edu/Research/TB-HIV_Lab/epimatrix/epimatrix.htm- l); and,
BIMAS, (URL bimas.dcrt.nih.gov/; SYFPEITHI at URL
syfpeithi.bmi-heidelberg.com/). In a preferred embodiment, the
158P1D7 immunogen contains one or more amino acid sequences
identified using techniques well known in the art, such as the
sequences shown in Tables V-XVIII or a peptide of 8, 9, 10 or 11
amino acids specified by an HLA Class I motif/supermotif (e.g.,
Table IV (A), Table IV (D), or Table IV (E)) and/or a peptide of at
least 9 amino acids that comprises an HLA Class II motif/supermotif
(e.g., Table IV (B) or Table IV (C)). As is appreciated in the art,
the HLA Class I binding groove is essentially closed ended so that
peptides of only a particular size range can fit into the groove
and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11
amino acids long. In contrast, the HLA Class II binding groove is
essentially open ended; therefore a peptide of about 9 or more
amino acids can be bound by an HLA Class II molecule. Due to the
binding groove differences between HLA Class I and II, HLA Class I
motifs are length specific, i.e., position two of a Class I motif
is the second amino acid in an amino to carboxyl direction of the
peptide. The amino acid positions in a Class II motif are relative
only to each other, not the overall peptide, i.e., additional amino
acids can be attached to the amino and/or carboxyl termini of a
motif-bearing sequence. HLA Class II epitopes are often 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino
acids long, or longer than 25 amino acids.
[0269] Antibody-Based Vaccines
[0270] A wide variety of methods for generating an immune response
in a mammal are known in the art (for example as the first step in
the generation of hybridomas). Methods of generating an immune
response in a mammal comprise exposing the mammal's immune system
to an immunogenic epitope on a protein (e.g. the 158P1D7 protein)
so that an immune response is generated. A typical embodiment
consists of a method for generating an immune response to 158P1D7
in a host, by contacting the host with a sufficient amount of at
least one 158P1D7 B cell or cytotoxic T-cell epitope or analog
thereof; and at least one periodic interval thereafter
re-contacting the host with the 158P1D7 B cell or cytotoxic T-cell
epitope or analog thereof. A specific embodiment consists of a
method of generating an immune response against a 158P1D7-related
protein or a man-made multiepitopic peptide comprising:
administering 158P1D7 immunogen (e.g. the 158P1D7 protein or a
peptide fragment thereof, an 158P1D7 fusion protein or analog etc.)
in a vaccine preparation to a human or another mammal. Typically,
such vaccine preparations further contain a suitable adjuvant (see,
e.g., U.S. Pat. No. 6,146,635) or a universal helper epitope such
as a PADRE.TM. peptide (Epimmune Inc., San Diego, Calif.; see,
e.g., Alexander et al., J. Immunol. 2000 164(3); 164(3): 1625-1633;
Alexander et al., Immunity 1994 1(9): 751-761 and Alexander et al.,
Immunol Res. 1998 18(2): 79-92). An alternative method comprises
generating an immune response in an individual against a 158P1D7
immunogen by: administering in vivo to muscle or skin of the
individual's body a DNA molecule that comprises a DNA sequence that
encodes an 158P1D7 immunogen, the DNA sequence operatively linked
to regulatory sequences which control the expression of the DNA
sequence; wherein the DNA molecule is taken up by cells, the DNA
sequence is expressed in the cells and an immune response is
generated against the immunogen (see, e.g., U.S. Pat. No.
5,962,428). Optionally a genetic vaccine facilitator such as
anionic lipids; saponins; lectins; estrogenic compounds;
hydroxylated lower alkyls; dimethyl sulfoxide; and urea is also
administered.
[0271] Nucleic Acid Vaccines:
[0272] Vaccine compositions of the invention include nucleic
acid-mediated modalities. DNA or RNA that encode protein(s) of the
invention can be administered to a patient. Genetic immunization
methods can be employed to generate prophylactic or therapeutic
humoral and cellular immune responses directed against cancer cells
expressing 158P1D7. Constructs comprising DNA encoding a
158P1D7-related protein/immunogen and appropriate regulatory
sequences can be injected directly into muscle or skin of an
individual, such that the cells of the muscle or skin take-up the
construct and express the encoded 158P1D7 protein/immunogen.
Alternatively, a vaccine comprises a 158P1D7-related protein.
Expression of the 158P1D7-related protein immunogen results in the
generation of prophylactic or therapeutic humoral and cellular
immunity against cells that bear 158P1D7 protein. Various
prophylactic and therapeutic genetic immunization techniques known
in the art can be used (for review, see information and references
published at Internet address www.genweb.com). Nucleic acid-based
delivery is described, for instance, in Wolff et. al., Science
247:1465 (1990) as well as U.S. Pat. Nos. 5,580,859; 5,589,466;
5,804,566; 5,739,118; 5,736,524; 5,679,647; WO 98/04720. Examples
of DNA-based delivery technologies include "naked DNA", facilitated
(bupivicaine, polymers, peptide-mediated) delivery, cationic lipid
complexes, and particle-mediated ("gene gun") or pressure-mediated
delivery (see, e.g., U.S. Pat. No. 5,922,687).
[0273] For therapeutic or prophylactic immunization purposes,
proteins of the invention can be expressed via viral or bacterial
vectors. Various viral gene delivery systems that can be used in
the practice of the invention include, but are not limited to,
vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus,
adeno-associated virus, lentivirus, and sindbis virus (see, e.g.,
Restifo, 1996, Curr. Opin. Immunol. 8:658-663; Tsang et al. J.
Natl. Cancer Inst. 87:982-990 (1995)). Non-viral delivery systems
can also be employed by introducing naked DNA encoding a
158P1D7-related protein into the patient (e.g., intramuscularly or
intradermally) to induce an anti-tumor response.
[0274] Vaccinia virus is used, for example, as a vector to express
nucleotide sequences that encode the peptides of the invention.
Upon introduction into a host, the recombinant vaccinia virus
expresses the protein immunogenic peptide, and thereby elicits a
host immune response. Vaccinia vectors and methods useful in
immunization protocols are described in, e.g., U.S. Pat. No.
4,722,848. Another vector is BCG (Bacille Calmette Guerin). BCG
vectors are described in Stover et al., Nature 351:456-460 (1991).
A wide variety of other vectors useful for therapeutic
administration or immunization of the peptides of the invention,
e.g. adeno and adeno-associated virus vectors, retroviral vectors,
Salmonella typhi vectors, detoxified anthrax toxin vectors, and the
like, will be apparent to those skilled in the art from the
description herein.
[0275] Thus, gene delivery systems are used to deliver a
158P1D7-related nucleic acid molecule. In one embodiment, the
full-length human 158P1D7 cDNA is employed. In another embodiment,
158P1D7 nucleic acid molecules encoding specific cytotoxic T
lymphocyte (CTL) and/or antibody epitopes are employed.
[0276] Ex Vivo Vaccines
[0277] Various ex vivo strategies can also be employed to generate
an immune response. One approach involves the use of antigen
presenting cells (APCs) such as dendritic cells (DC) to present
158P1D7 antigen to a patient's immune system. Dendritic cells
express MHC class I and II molecules, B7 co-stimulator, and IL-12,
and are thus highly specialized antigen presenting cells. In
bladder cancer, autologous dendritic cells pulsed with peptides of
the MAGE-3 antigen are being used in a Phase I clinical trial to
stimulate bladder cancer patients' immune systems (Nishiyama et
al., 2001, Clin Cancer Res, 7(1):23-31). Thus, dendritic cells can
be used to present 158P1D7 peptides to T cells in the context of
MHC class I or II molecules. In one embodiment, autologous
dendritic cells are pulsed with 158P1D7 peptides capable of binding
to MHC class I and/or class II molecules. In another embodiment,
dendritic cells are pulsed with the complete 158P1D7 protein. Yet
another embodiment involves engineering the overexpression of the
158P1D7 gene in dendritic cells using various implementing vectors
known in the art, such as adenovirus (Arthur et al., 1997, Cancer
Gene Ther. 4:17-25), retrovirus (Henderson et al., 1996, Cancer
Res. 56:3763-3770), lentivirus, adeno-associated virus, DNA
transfection (Ribas et al., 1997, Cancer Res. 57:2865-2869), or
tumor-derived RNA transfection (Ashley et al., 1997, J. Exp. Med.
186:1177-1182). Cells that express 158P1D7 can also be engineered
to express immune modulators, such as GM-CSF, and used as
immunizing agents.
[0278] X.B.) 158P1D7 as a Target for Antibody-Based Therapy
[0279] 158P1D7 is an attractive target for antibody-based
therapeutic strategies. A number of antibody strategies are known
in the art for targeting both extracellular and intracellular
molecules (see, e.g., complement and ADCC mediated killing as well
as the use of intrabodies). Because 158P1D7 is expressed by cancer
cells of various lineages relative to corresponding normal cells,
systemic administration of 158P1D7-immunoreactive compositions are
prepared that exhibit excellent sensitivity without toxic,
non-specific and/or non-target effects caused by binding of the
immunoreactive composition to non-target organs and tissues.
Antibodies specifically reactive with domains of 158P1D7 are useful
to treat 158P1D7-expressing cancers systemically, either as
conjugates with a toxin or therapeutic agent, or as naked
antibodies capable of inhibiting cell proliferation or
function.
[0280] 158P1D7 antibodies can be introduced into a patient such
that the antibody binds to 158P1D7 and modulates a function, such
as an interaction with a binding partner, and consequently mediates
destruction of the tumor cells and/or inhibits the growth of the
tumor cells. Mechanisms by which such antibodies exert a
therapeutic effect can include complement-mediated cytolysis,
antibody-dependent cellular cytotoxicity, modulation of the
physiological function of 158P1D7, inhibition of ligand binding or
signal transduction pathways, modulation of tumor cell
differentiation, alteration of tumor angiogenesis factor profiles,
and/or apoptosis.
[0281] Those skilled in the art understand that antibodies can be
used to specifically target and bind immunogenic molecules such as
an immunogenic region of the 158P1D7 sequence shown in FIG. 2 or
FIG. 3. In addition, skilled artisans understand that it is routine
to conjugate antibodies to cytotoxic agents (see, e.g., Slevers et
al. Blood 93:11 3678-3684 (Jun. 1, 1999)). When cytotoxic and/or
therapeutic agents are delivered directly to cells, such as by
conjugating them to antibodies specific for a molecule expressed by
that cell (e.g. 158P1D7), the cytotoxic agent will exert its known
biological effect (i.e. cytotoxicity) on those cells.
[0282] A wide variety of compositions and methods for using
antibody-cytotoxic agent conjugates to kill cells are known in the
art. In the context of cancers, typical methods entail
administering to an animal having a tumor a biologically effective
amount of a conjugate comprising a selected cytotoxic and/or
therapeutic agent linked to a targeting agent (e.g. an anti-158P1D7
antibody) that binds to a marker (e.g. 158P1D7) expressed,
accessible to binding or localized on the cell surfaces. A typical
embodiment is a method of delivering a cytotoxic and/or therapeutic
agent to a cell expressing 158P1D7, comprising conjugating the
cytotoxic agent to an antibody that immunospecifically binds to a
158P1D7 epitope, and, exposing the cell to the antibody-agent
conjugate. Another illustrative embodiment is a method of treating
an individual suspected of suffering from metastasized cancer,
comprising a step of administering parenterally to said individual
a pharmaceutical composition comprising a therapeutically effective
amount of ad antibody conjugated to a cytotoxic and/or therapeutic
agent.
[0283] Cancer immunotherapy using anti-158P1D7 antibodies can be
done in accordance with various approaches that have been
successfully employed in the treatment of other types of cancer,
including but not limited to colon cancer (Arlen et al., 1998,
Crit. Rev. Immunol. 18:133-138), multiple myeloma (Ozaki et al.,
1997, Blood 90:3179-3186, Tsunenari et al., 1997, Blood
90:2437-2444), gastric cancer (Kasprzyk et al., 1992, Cancer Res.
52:2771-2776), B-cell lymphoma (Funakoshi et al., 1996, J.
Immunother. Emphasis Tumor Immunol. 19:93-101), leukemia (Zhong et
al., 1996, Leuk. Res. 20:581-589), colorectal cancer (Moun et al.,
1994, Cancer Res. 54:6160-6166; Velders et al., 1995, Cancer Res.
55:4398-4403), and breast cancer (Shepard et al., 1991, J. Clin.
Immunol. 11:1 17-127). Some therapeutic approaches involve
conjugation of naked antibody to a toxin, such as the conjugation
of Y.sup.91 or I.sup.131 to anti-CD20 antibodies (e.g.,
Zevalin.TM., IDEC Pharmaceuticals Corp. or Bexxar.TM., Coulter
Pharmaceuticals), while others involve co-administration of
antibodies and other therapeutic agents, such as Herceptin.TM.
(trastuzumab) with paclitaxel (Genentech, Inc.). To treat bladder
cancer, for example, 158P1D7 antibodies can be administered in
conjunction with radiation, chemotherapy or hormone ablation.
[0284] Although 158P1D7 antibody therapy is useful for all stages
of cancer, antibody therapy can be particularly appropriate in
advanced or metastatic cancers. Treatment with the antibody therapy
of the invention is indicated for patients who have received one or
more rounds of chemotherapy. Alternatively, antibody therapy of the
invention is combined with a chemotherapeutic or radiation regimen
for patients who have not received chemotherapeutic treatment.
Additionally, antibody therapy can enable the use of reduced
dosages of concomitant chemotherapy, particularly for patients who
do not tolerate the toxicity of the chemotherapeutic agent very
well.
[0285] Cancer patients can be evaluated for the presence and level
of 158P1D7 expression, preferably using immunohistochemical
assessments of tumor tissue, quantitative 158P1D7 imaging, or other
techniques that reliably indicate the presence and degree of
158P1D7 expression. Immunohistochemical analysis of tumor biopsies
or surgical specimens is preferred for this purpose. Methods for
immunohistochemical analysis of tumor tissues are well known in the
art.
[0286] Anti-158P1D7 monoclonal antibodies that treat bladder and
other cancers include those that initiate a potent immune response
against the tumor or those that are directly cytotoxic. In this
regard, anti-158P1D7 monoclonal antibodies (mAbs) can elicit tumor
cell lysis by either complement-mediated or antibody-dependent cell
cytotoxicity (ADCC) mechanisms, both of which require an intact Fc
portion of the immunoglobulin molecule for interaction with
effector cell Fc receptor sites on complement proteins. In
addition, anti-158P1D7 mAbs that exert a direct biological effect
on tumor growth are useful to treat cancers that express 158P1D7.
Mechanisms by which directly cytotoxic mAbs act include: inhibition
of cell growth, modulation of cellular differentiation, modulation
of tumor angiogenesis factor profiles, and the induction of
apoptosis. The mechanism(s) by which a particular anti-158P1D7 mAb
exerts an anti-tumor effect is evaluated using any number of in
vitro assays that evaluate cell death such as ADCC, ADMMC,
complement-mediated cell lysis, and so forth, as is generally known
in the art.
[0287] In some patients, the use of murine or other non-human
monoclonal antibodies, or human/mouse chimeric mAbs can induce
moderate to strong immune responses against the non-human antibody.
This can result in clearance of the antibody from circulation and
reduced efficacy. In the most severe cases, such an immune response
can lead to the extensive formation of immune complexes which,
potentially, can cause renal failure. Accordingly, preferred
monoclonal antibodies used in the therapeutic methods of the
invention are those that are either fully human or humanized and
that bind specifically to the target 158P1D7 antigen with high
affinity but exhibit low or no antigenicity in the patient.
[0288] Therapeutic methods of the invention contemplate the
administration of single anti-158P1D7 mAbs as well as combinations,
or cocktails, of different mAbs. Such mAb cocktails can have
certain advantages in as much as they contain mAbs that target
different epitopes, exploit different effector mechanisms or
combine directly cytotoxic mAbs with mAbs that rely on immune
effector functionality. Such mAbs in combination can exhibit
synergistic therapeutic effects. In addition, anti-158P1D7 mAbs can
be administered concomitantly with other therapeutic modalities,
including but not limited to various chemotherapeutic agents,
androgen-blockers, immune modulators (e.g., IL-2, GM-CSF), surgery
or radiation. The anti-158P1D7 mAbs are administered in their
"naked" or unconjugated form, or can have a therapeutic agent(s)
conjugated to them.
[0289] Anti-158P1D7 antibody formulations are administered via any
route capable of delivering the antibodies to a tumor cell. Routes
of administration include, but are not limited to, intravenous,
intraperitoneal, intramuscular, intratumor, intradermal, and the
like. Treatment generally involves repeated administration of the
anti-158P1D7 antibody preparation, via an acceptable route of
administration such as intravenous injection (IV), typically at a
dose in the range of about 0.1 to about 10 mg/kg body weight. In
general, doses in the range of 10-500 mg mAb per week are effective
and well tolerated.
[0290] Based on clinical experience with the Herceptin mAb in the
treatment of metastatic breast cancer, an initial loading dose of
approximately 4 mg/kg patient body weight IV, followed by weekly
doses of about 2 mg/kg IV of the anti-158P1D7 mAb preparation
represents an acceptable dosing regimen. Preferably, the initial
loading dose is administered as a 90 minute or longer infusion. The
periodic maintenance dose is administered as a 30 minute or longer
infusion, provided the initial dose was well tolerated. As
appreciated by those of skill in the art, various factors can
influence the ideal dose regimen in a particular case. Such factors
include, for example, the binding affinity and half life of the Ab
or mAbs used, the degree of 158P1D7 expression in the patient, the
extent of circulating shed 158P1D7 antigen, the desired
steady-state antibody concentration level, frequency of treatment,
and the influence of chemotherapeutic or other agents used in
combination with the treatment method of the invention, as well as
the health status of a particular patient.
[0291] Optionally, patients should be evaluated for the levels of
158P1D7 in a given sample (e.g. the levels of circulating 158P1D7
antigen and/or 158P1D7 expressing cells) in order to assist in the
determination of the most effective dosing regimen, etc. Such
evaluations are also used for monitoring purposes throughout
therapy, and are useful to gauge therapeutic success in combination
with the evaluation of other parameters (for example, urine
cytology and/or ImmunoCyt levels in bladder cancer therapy, or by
analogy, serum PSA levels in prostate cancer therapy).
[0292] Anti-idiotypic anti-158P1D7 antibodies can also be used in
anti-cancer therapy as a vaccine for inducing an immune response to
cells expressing a 158P1D7-related protein. In particular, the
generation of anti-idiotypic antibodies is well known in the art;
this methodology can readily be adapted to generate anti-idiotypic
anti-158P1D7 antibodies that mimic an epitope on a 158P1D7-related
protein (see, for example, Wagner et al., 1997, Hybridoma 16:
33-40; Foon et al., 1995, J. Clin. Invest. 96:334-342; Herlyn et
al., 1996, Cancer Immunol. Immunother. 43:65-76). Such an
anti-idiotypic antibody can be used in cancer vaccine
strategies.
[0293] X.C.) 158P1D7 as a Target for Cellular Immune Responses
[0294] Vaccines and methods of preparing vaccines that contain an
immunogenically effective amount of one or more HLA-binding
peptides as described herein are further embodiments of the
invention. Furthermore, vaccines in accordance with the invention
encompass compositions of one or more of the claimed peptides. A
peptide can be present in a vaccine individually. Alternatively,
the peptide can exist as a homopolymer comprising multiple copies
of the same peptide, or as a heteropolymer of various peptides.
Polymers have the advantage of increased immunological reaction
and, where different peptide epitopes are used to make up the
polymer, the additional ability to induce antibodies and/or CTLs
that react with different antigenic determinants of the pathogenic
organism or tumor-related peptide targeted for an immune response.
The composition can be a naturally occurring region of an antigen
or can be prepared, e.g., recombinantly or by chemical
synthesis.
[0295] Carriers that can be used with vaccines of the invention are
well known in the art, and include, e.g., thyroglobulin, albumins
such as human serum albumin, tetanus toxoid, polyamino acids such
as poly L-lysine, poly L-glutamic acid, influenza, hepatitis B
virus core protein, and the like. The vaccines can contain a
physiologically tolerable (i.e., acceptable) diluent such as water,
or saline, preferably phosphate buffered saline. The vaccines also
typically include an adjuvant. Adjuvants such as incomplete
Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum
are examples of materials well known in the art. Additionally, as
disclosed herein, CTL responses can be primed by conjugating
peptides of the invention to lipids, such as
tripalmitoyl-S-glycerylcysteinlyseryl-serine (P.sub.3CSS).
Moreover, an adjuvant such as a synthetic
cytosine-phosphorothiolated-guanine-containi- ng (CpG)
oligonucleotides has been found to increase CTL responses 10- to
100-fold. (see, e.g. Davila and Celis J. Immunol. 165:539-547
(2000))
[0296] Upon immunization with a peptide composition in accordance
with the invention, via injection, aerosol, oral, transdermal,
transmucosal, intrapleural, intrathecal, or other suitable routes,
the immune system of the host responds to the vaccine by producing
large amounts of CTLs and/or HTLs specific for the desired antigen.
Consequently, the host becomes at least partially immune to later
development of cells that express or overexpress 158P1D7 antigen,
or derives at least some therapeutic benefit when the antigen was
tumor-associated.
[0297] In some embodiments, it may be desirable to combine the
class I peptide components with components that induce or
facilitate neutralizing antibody and or helper T cell responses
directed to the target antigen. A preferred embodiment of such a
composition comprises class I and class II epitopes in accordance
with the invention. An alternative embodiment of such a composition
comprises a class I and/or class II epitope in accordance with the
invention, along with a cross reactive HTL epitope such as
PADRE.TM. (Epimmune, San Diego, Calif.) molecule (described e.g.,
in U.S. Pat. No. 5,736,142).
[0298] A vaccine of the invention can also include
antigen-presenting cells (APC), such as dendritic cells (DC), as a
vehicle to present peptides of the invention. Vaccine compositions
can be created in vitro, following dendritic cell mobilization and
harvesting, whereby loading of dendritic cells occurs in vitro. For
example, dendritic cells are transfected, e.g., with a minigene in
accordance with the invention, or are pulsed with peptides. The
dendritic cell can then be administered to a patient to elicit
immune responses in vivo. Vaccine compositions, either DNA- or
peptide-based, can also be administered in vivo in combination with
dendritic cell mobilization whereby loading of dendritic cells
occurs in vivo.
[0299] Preferably, the following principles are utilized when
selecting an array of epitopes for inclusion in a polyepitopic
composition for use in a vaccine, or for selecting discrete
epitopes to be included in a vaccine and/or to be encoded by
nucleic acids such as a minigene. It is preferred that each of the
following principles be balanced in order to make the selection.
The multiple epitopes to be incorporated in a given vaccine
composition may be, but need not be, contiguous in sequence in the
native antigen from which the epitopes are derived.
[0300] 1.) Epitopes are selected which, upon administration, mimic
immune responses that have been observed to be correlated with
tumor clearance. For HLA Class I this includes 3-4 epitopes that
come from at least one tumor associated antigen (TAA). For HLA
Class II a similar rationale is employed; again 3-4 epitopes are
selected from at least one TAA (see, e.g., Rosenberg et al.,
Science 278:1447-1450). Epitopes from one TAA may be used in
combination with epitopes from one or more additional TAAs to
produce a vaccine that targets tumors with varying expression
patterns of frequently-expressed TAAs.
[0301] 2.) Epitopes are selected that have the requisite binding
affinity established to be correlated with immunogenicity: for HLA
Class I an IC.sub.50 of 500 nM or less, often 200 nM or less; and
for Class II an IC.sub.50 of 1000 nM or less.
[0302] 3.) Sufficient supermotif bearing-peptides, or a sufficient
array of allele-specific motif-bearing peptides, are selected to
give broad population coverage. For example, it is preferable to
have at least 80% population coverage. A Monte Carlo analysis, a
statistical evaluation known in the art, can be employed to assess
the breadth, or redundancy of, population coverage.
[0303] 4.) When selecting epitopes from cancer-related antigens it
is often useful to select analogs because the patient may have
developed tolerance to the native epitope.
[0304] 5.) Of particular relevance are epitopes referred to as
"nested epitopes." Nested epitopes occur where at least two
epitopes overlap in a given peptide sequence. A nested peptide
sequence can comprise B cell, HLA class I and/or HLA class II
epitopes. When providing nested epitopes, a general objective is to
provide the greatest number of epitopes per sequence. Thus, an
aspect is to avoid providing a peptide that is any longer than the
amino terminus of the amino terminal epitope and the carboxyl
terminus of the carboxyl terminal epitope in the peptide. When
providing a multi-epitopic sequence, such as a sequence comprising
nested epitopes, it is generally important to screen the sequence
in order to insure that it does not have pathological or other
deleterious biological properties.
[0305] 6.) If a polyepitopic protein is created, or when creating a
minigene, an objective is to generate the smallest peptide that
encompasses the epitopes of interest. This principle is similar, if
not the same as that employed when selecting a peptide comprising
nested epitopes. However, with an artificial polyepitopic peptide,
the size minimization objective is balanced against the need to
integrate any spacer sequences between epitopes in the polyepitopic
protein. Spacer amino acid residues can, for example, be introduced
to avoid junctional epitopes (an epitope recognized by the immune
system, not present in the target antigen, and only created by the
man-made juxtaposition of epitopes), or to facilitate cleavage
between epitopes and thereby enhance epitope presentation.
Junctional epitopes are generally to be avoided because the
recipient may generate an immune response to that non-native
epitope. Of particular concern is a junctional epitope that is a
"dominant epitope." A dominant epitope may lead to such a zealous
response that immune responses to other epitopes are diminished or
suppressed.
[0306] 7.) Where the sequences of multiple variants of the same
target protein are present, potential peptide epitopes can also be
selected on the basis of their conservancy. For example, a
criterion for conservancy may define that the entire sequence of an
HLA class I binding peptide or the entire 9-mer core of a class II
binding peptide be conserved in a designated percentage of the
sequences evaluated for a specific protein antigen.
[0307] X.C.1. Minigene Vaccines
[0308] A number of different approaches are available which allow
simultaneous delivery of multiple epitopes. Nucleic acids encoding
the peptides of the invention are a particularly useful embodiment
of the invention. Epitopes for inclusion in a minigene are
preferably selected according to the guidelines set forth in the
previous section. A preferred means of administering nucleic acids
encoding the peptides of the invention uses minigene constructs
encoding a peptide comprising one or multiple epitopes of the
invention.
[0309] The use of multi-epitope minigenes is described below and
in, Ishioka et al., J. Immunol. 162:3915-3925, 1999; An, L. and
Whitton, J. L., J. Virol. 71:2292, 1997; Thomson, S. A. et al., J.
Immunol. 157:822, 1996; Whitton, J. L. et al., J. Virol. 67:348,
1993; Hanke, R. et al., Vaccine 16:426, 1998. For example, a
multi-epitope DNA plasmid encoding supermotif- and/or motif-bearing
epitopes derived 158P1D7, the PADRE.RTM. universal helper T cell
epitope (or multiple HTL epitopes from 158P1D7), and an endoplasmic
reticulum-translocating signal sequence can be engineered. A
vaccine may also comprise epitopes that are derived from other
TAAs.
[0310] The immunogenicity of a multi-epitopic minigene can be
confirmed in transgenic mice to evaluate the magnitude of CTL
induction responses against the epitopes tested. Further, the
immunogenicity of DNA-encoded epitopes in vivo can be correlated
with the in vitro responses of specific CTL lines against target
cells transfected with the DNA plasmid. Thus, these experiments can
show that the minigene serves to both: 1.) generate a CTL response
and 2.) that the induced CTLs recognized cells expressing the
encoded epitopes.
[0311] For example, to create a DNA sequence encoding the selected
epitopes (minigene) for expression in human cells, the amino acid
sequences of the epitopes may be reverse translated. A human codon
usage table can be used to guide the codon choice for each amino
acid. These epitope-encoding DNA sequences may be directly
adjoined, so that when translated, a continuous polypeptide
sequence is created. To optimize expression and/or immunogenicity,
additional elements can be incorporated into the minigene design.
Examples of amino acid sequences that can be reverse translated and
included in the minigene sequence include: HLA class I epitopes,
HLA class II epitopes, antibody epitopes, a ubiquitination signal
sequence, and/or an endoplasmic reticulum targeting signal. In
addition, HLA presentation of CTL and HTL epitopes may be improved
by including synthetic (e.g. poly-alanine) or naturally-occurring
flanking sequences adjacent to the CTL or HTL epitopes; these
larger peptides comprising the epitope(s) are within the scope of
the invention.
[0312] The minigene sequence may be converted to DNA by assembling
oligonucleotides that encode the plus and minus strands of the
minigene. Overlapping oligonucleotides (30-100 bases long) may be
synthesized, phosphorylated, purified and annealed under
appropriate conditions using well known techniques. The ends of the
oligonucleotides can be joined, for example, using T4 DNA ligase.
This synthetic minigene, encoding the epitope polypeptide, can then
be cloned into a desired expression vector.
[0313] Standard regulatory sequences well known to those of skill
in the art are preferably included in the vector to ensure
expression in the target cells. Several vector elements are
desirable: a promoter with a down-stream cloning site for minigene
insertion; a polyadenylation signal for efficient transcription
termination; an E. coli origin of replication; and an E. coli
selectable marker (e.g. ampicillin or kanamycin resistance).
Numerous promoters can be used for this purpose, e.g., the human
cytomegalovirus (hCMV) promoter. See, e.g., U.S. Pat. Nos.
5,580,859 and 5,589,466 for other suitable promoter sequences.
[0314] Additional vector modifications may be desired to optimize
minigene expression and immunogenicity. In some cases, introns are
required for efficient gene expression, and one or more synthetic
or naturally-occurring introns could be incorporated into the
transcribed region of the minigene. The inclusion of mRNA
stabilization sequences and sequences for replication in mammalian
cells may also be considered for increasing minigene
expression.
[0315] Once an expression vector is selected, the minigene is
cloned into the polylinker region downstream of the promoter. This
plasmid is transformed into an appropriate E. coli strain, and DNA
is prepared using standard techniques. The orientation and DNA
sequence of the minigene, as well as all other elements included in
the vector, are confirmed using restriction mapping and DNA
sequence analysis. Bacterial cells harboring the correct plasmid
can be stored as a master cell bank and a working cell bank.
[0316] In addition, immunostimulatory sequences (ISSs or CpGs)
appear to play a role in the immunogenicity of DNA vaccines. These
sequences may be included in the vector, outside the minigene
coding sequence, if desired to enhance immunogenicity.
[0317] In some embodiments, a bi-cistronic expression vector which
allows production of both the minigene-encoded epitopes and a
second protein (included to enhance or decrease immunogenicity) can
be used. Examples of proteins or polypeptides that could
beneficially enhance the immune response if co-expressed include
cytokines (e.g., IL-2, IL-12, GM-CSF), cytokine-inducing molecules
(e.g. LeIF), costimulatory molecules, or for HTL responses, pan-DR
binding proteins (PADRE.TM., Epimmune, San Diego, Calif.). Helper
(HTL) epitopes can be joined to intracellular targeting signals and
expressed separately from expressed CTL epitopes; this allows
direction of the HTL epitopes to a cell compartment different than
that of the CTL epitopes. If required, this could facilitate more
efficient entry of HTL epitopes into the HLA class II pathway,
thereby improving HTL induction. In contrast to HTL or CTL
induction, specifically decreasing the immune response by
co-expression of immunosuppressive molecules (e.g. TGF-.beta.) may
be beneficial in certain diseases.
[0318] Therapeutic quantities of plasmid DNA can be produced for
example, by fermentation in E. coli, followed by purification.
Aliquots from the working cell bank are used to inoculate growth
medium, and grown to saturation in shaker flasks or a bioreactor
according to well-known techniques. Plasmid DNA can be purified
using standard bioseparation technologies such as solid phase
anion-exchange resins supplied by QIAGEN, Inc. (Valencia, Calif.).
If required, supercoiled DNA can be isolated from the open circular
and linear forms using gel electrophoresis or other methods.
[0319] Purified plasmid DNA can be prepared for injection using a
variety of formulations. The simplest of these is reconstitution of
lyophilized DNA in sterile phosphate-buffer saline (PBS). This
approach, known as "naked DNA," is currently being used for
intramuscular (IM) administration in clinical trials. To maximize
the immunotherapeutic effects of minigene DNA vaccines, an
alternative method for formulating purified plasmid DNA may be
desirable. A variety of methods have been described, and new
techniques may become available. Cationic lipids, glycolipids, and
fusogenic liposomes can also be used in the formulation (see, e.g.,
as described by WO 93/24640; Mannino & Gould-Fogerite,
BioTechniques 6(7): 682 (1988); U.S. Pat. No. 5,279,833; WO
91/06309; and Felgner, et al., Proc. Nat'l Acad. Sci. USA 84:7413
(1987). In addition, peptides and compounds referred to
collectively as protective, interactive, non-condensing compounds
(PINC) could also be complexed to purified plasmid DNA to influence
variables such as stability, intramuscular dispersion, or
trafficking to specific organs or cell types.
[0320] Target cell sensitization can be used as a functional assay
for expression and HLA class I presentation of minigene-encoded CTL
epitopes. For example, the plasmid DNA is introduced into a
mammalian cell line that is suitable as a target for standard CTL
chromium release assays. The transfection method used will be
dependent on the final formulation. Electroporation can be used for
"naked" DNA, whereas cationic lipids allow direct in vitro
transfection. A plasmid expressing green fluorescent protein (GFP)
can be co-transfected to allow enrichment of transfected cells
using fluorescence activated cell sorting (FACS). These cells are
then chromium-51 (.sup.51Cr) labeled and used as target cells for
epitope-specific CTL lines; cytolysis, detected by .sup.51Cr
release, indicates both production of, and HLA presentation of,
minigene-encoded CTL epitopes. Expression of HTL epitopes may be
evaluated in an analogous manner using assays to assess HTL
activity.
[0321] In vivo immunogenicity is a second approach for functional
testing of minigene DNA formulations. Transgenic mice expressing
appropriate human HLA proteins are immunized with the DNA product.
The dose and route of administration are formulation dependent
(e.g., IM for DNA in PBS, intraperitoneal (i.p.) for
lipid-complexed DNA). Twenty-one days after immunization,
splenocytes are harvested and restimulated for one week in the
presence of peptides encoding each epitope being tested.
Thereafter, for CTL effector cells, assays are conducted for
cytolysis of peptide-loaded, .sup.51Cr-labeled target cells using
standard techniques. Lysis of target cells that were sensitized by
HLA loaded with peptide epitopes, corresponding to minigene-encoded
epitopes, demonstrates DNA vaccine function for in vivo induction
of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic
mice in an analogous manner.
[0322] Alternatively, the nucleic acids can be administered using
ballistic delivery as described, for instance, in U.S. Pat. No.
5,204,253. Using this technique, particles comprised solely of DNA
are administered. In a further alternative embodiment, DNA can be
adhered to particles, such as gold particles.
[0323] Minigenes can also be delivered using other bacterial or
viral delivery systems well known in the art, e.g., an expression
construct encoding epitopes of the invention can be incorporated
into a viral vector such as vaccinia.
[0324] X.C.2. Combinations of CTL Peptides with Helper Peptides
[0325] Vaccine compositions comprising CTL peptides of the
invention can be modified, e.g., analoged, to provide desired
attributes, such as improved serum half life, broadened population
coverage or enhanced immunogenicity.
[0326] For instance, the ability of a peptide to induce CTL
activity can be enhanced by linking the peptide to a sequence which
contains at least one epitope that is capable of inducing a T
helper cell response. Although a CTL peptide can be directly linked
to a T helper peptide, often CTL epitope/HTL epitope conjugates are
linked by a spacer molecule. The spacer is typically comprised of
relatively small, neutral molecules, such as amino acids or amino
acid mimetics, which are substantially uncharged under
physiological conditions. The spacers are typically selected from,
e.g., Ala, Gly, or other neutral spacers of nonpolar amino acids or
neutral polar amino acids. It will be understood that the
optionally present spacer need not be comprised of the same
residues and thus may be a hetero- or homo-oligomer. When present,
the spacer will usually be at least one or two residues, more
usually three to six residues and sometimes 10 or more residues.
The CTL peptide epitope can be linked to the T helper peptide
epitope either directly or via a spacer either at the amino or
carboxy terminus of the CTL peptide. The amino terminus of either
the immunogenic peptide or the T helper peptide may be
acylated.
[0327] In certain embodiments, the T helper peptide is one that is
recognized by T helper cells present in a majority of a genetically
diverse population. This can be accomplished by selecting peptides
that bind to many, most, or all of the HLA class II molecules.
Examples of such amino acid bind many HLA Class II molecules
include sequences from antigens such as tetanus toxoid at positions
830-843 (QYIKANSKFIGITE; SEQ ID NO: 651), Plasmodium falciparum
circumsporozoite (CS) protein at positions 378-398
(DIEKKIAKMEKASSVFNVVNS; SEQ ID NO: 652), and Streptococcus 18 kD
protein at positions 116-131 (GAVDSILGGVATYGAA; SEQ ID NO: 653).
Other examples include peptides bearing a DR 1-4-7 supermotif, or
either of the DR3 motifs.
[0328] Alternatively, it is possible to prepare synthetic peptides
capable of stimulating T helper lymphocytes, in a loosely
HLA-restricted fashion, using amino acid sequences not found in
nature (see, e.g., PCT publication WO 95/07707). These synthetic
compounds called Pan-DR-binding epitopes (e.g., PADRE.TM.,
Epimmune, Inc., San Diego, Calif.) are designed to most preferably
bind most HLA-DR (human HLA class II) molecules. For instance, a
pan-DR-binding epitope peptide having the formula: aKXVAAWTLKAAa
(SEQ ID NO: 654), where "X" is either cyclohexylalanine,
phenylalanine, or tyrosine, and a is either D-alanine or L-alanine,
has been found to bind t,o most HLA-DR alleles, and to stimulate
the response of T helper lymphocytes from most individuals,
regardless of their HLA type. An alternative of a pan-DR binding
epitope comprises all "L" natural amino acids and can be provided
in the form of nucleic acids that encode the epitope.
[0329] HTL peptide epitopes can also be modified to alter their
biological properties. For example, they can be modified to include
D-amino acids to increase their resistance to proteases and thus
extend their serum half life, or they can be conjugated to other
molecules such as lipids, proteins, carbohydrates, and the like to
increase their biological activity. For example, a T helper peptide
can be conjugated to one or more palmitic acid chains at either the
amino or carboxyl termini.
[0330] X.C3. Combinations of CTL Peptides with T Cell Priming
Agents
[0331] In some embodiments it may be desirable to include in the
pharmaceutical compositions of the invention at least one component
which primes B lymphocytes or T lymphocytes. Lipids have been
identified as agents capable of priming CTL in vivo. For example,
palmitic acid residues can be attached to the .epsilon.-and
.alpha.-amino groups of a lysine residue and then linked, e.g., via
one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser,
or the like, to an immunogenic peptide. The lipidated peptide can
then be administered either directly in a micelle or particle,
incorporated into a liposome, or emulsified in an adjuvant, e.g.,
incomplete Freund's adjuvant. In a preferred embodiment, a
particularly effective immunogenic composition comprises palmitic
acid attached to .epsilon.- and .alpha.-amino groups of Lys, which
is attached via linkage, e.g., Ser-Ser, to the amino terminus of
the immunogenic peptide.
[0332] As another example of lipid priming of CTL responses, E.
coli lipoproteins, such as
tripalmitoyl-S-glycerylcysteinlyseryl-serine (P.sub.3CSS) can be
used to prime virus specific CTL when covalently attached to an
appropriate peptide (see, e.g., Deres, et al., Nature 342:561,
1989). Peptides of the invention can be coupled to P.sub.3CSS, for
example, and the lipopeptide administered to an individual to
specifically prime an immune response to the target antigen.
Moreover, because the induction of neutralizing antibodies can also
be primed with P.sub.3CSS-conjugated epitopes, two such
compositions can be combined to more effectively elicit both
humoral and cell-mediated responses.
[0333] X.C.4. Vaccine Compositions Comprising DC Pulsed with CTL
and/or HTL Peptides
[0334] An embodiment of a vaccine composition in accordance with
the invention comprises ex vivo administration of a cocktail of
epitope-bearing peptides to PBMC, or isolated DC therefrom, from
the patient's blood. A pharmaceutical to facilitate harvesting of
DC can be used, such as Progenipoietin.TM. (Pharmacia-Monsanto, St.
Louis, Mo.) or GM-CSF/IL-4. After pulsing the DC with peptides and
prior to reinfusion into patients, the DC are washed to remove
unbound peptides. In this embodiment, a vaccine comprises
peptide-pulsed DCs which present the pulsed peptide epitopes
complexed with HLA molecules on their surfaces.
[0335] The DC can be pulsed ex vivo with a cocktail of peptides,
some of which stimulate CTL responses to 158P1D7. Optionally, a
helper T cell (HTL) peptide, such as a natural or artificial
loosely restricted HLA Class II peptide, can be included to
facilitate the CTL response. Thus, a vaccine in accordance with the
invention is used to treat a cancer which expresses or
overexpresses 158P1D7.
[0336] X.D. Adoptive Immunotherapy
[0337] Antigenic 158P1D7-related peptides are used to elicit a CTL
and/or HTL response ex vivo, as well. The resulting CTL or HTL
cells, can be used to treat tumors in patients that do not respond
to other conventional forms of therapy, or will not respond to a
therapeutic vaccine peptide or nucleic acid in accordance with the
invention. Ex vivo CTL or HTL responses to a particular antigen are
induced by incubating in tissue culture the patient's, or
genetically compatible, CTL or HTL precursor cells together with a
source of antigen-presenting cells (APC), such as dendritic cells,
and the appropriate immunogenic peptide. After an appropriate
incubation time. (typically about 7-28 days), in which the
precursor cells are activated and expanded into effector cells, the
cells are infused back into the patient, where they will destroy
(CTL) or facilitate destruction (HTL) of their specific target cell
(e.g., a tumor cell). Transfected dendritic cells may also be used
as antigen presenting cells.
[0338] X.E. Administration of Vaccines for Therapeutic or
Prophylactic Purposes
[0339] Pharmaceutical and vaccine compositions of the invention are
typically used to treat and/or prevent a cancer that expresses or
overexpresses 158P1D7. In therapeutic applications, peptide and/or
nucleic acid compositions are administered to a patient in an
amount sufficient to elicit an effective B cell, CTL and/or HTL
response to the antigen and to cure or at least partially arrest or
slow symptoms and/or complications. An amount adequate to
accomplish this is defined as "therapeutically effective dose."
Amounts effective for this use will depend on, e.g., the particular
composition administered, the manner of administration, the stage
and severity of the disease being treated, the weight and general
state of health of the patient, and the judgment of the prescribing
physician.
[0340] For pharmaceutical compositions, the immunogenic peptides of
the invention, or DNA encoding them, are generally administered to
an individual already bearing a tumor that expresses 158P1D7. The
peptides or DNA encoding them can be administered individually or
as fusions of one or more peptide sequences. Patients can be
treated with the immunogenic peptides separately or in conjunction
with other treatments, such as surgery, as appropriate.
[0341] For therapeutic use, administration should generally begin
at the first diagnosis of 158P1D7-associated cancer. This is
followed by boosting doses until at least symptoms are
substantially abated and for a period thereafter. The embodiment of
the vaccine composition (i.e., including, but not limited to
embodiments such as peptide cocktails, polyepitopic polypeptides,
minigenes, or TAA-specific CTLs or pulsed dendritic cells)
delivered to the patient may vary according to the stage of the
disease or the patient's health status. For example, in a patient
with a tumor that expresses 158P1D7, a vaccine comprising
158P1D7-specific CTL may be more efficacious in killing tumor cells
in patient with advanced disease than alternative embodiments.
[0342] It is generally important to provide an amount of the
peptide epitope delivered by a mode of administration sufficient to
effectively stimulate a cytotoxic T cell response; compositions
which stimulate helper T cell responses can also be given in
accordance with this embodiment of the invention.
[0343] The dosage for an initial therapeutic immunization generally
occurs in a unit dosage range where the lower value is about 1, 5,
50, 500, or 1,000 .mu.g and the higher value is about 10,000;
20,000; 30,000; or 50,000 .mu.g. Dosage values for a human
typically range from about 500 .mu.g to about 50,000 .mu.g per 70
kilogram patient. Boosting dosages of between about 1.0 .mu.g to
about 50,000 .mu.g of peptide pursuant to a boosting regimen over
weeks to months may be administered depending upon the patient's
response and condition as determined by measuring the specific
activity of CTL and HTL obtained from the patient's blood.
Administration should continue until at least clinical symptoms or
laboratory tests indicate that the neoplasia, has been eliminated
or reduced and for a period thereafter. The dosages, routes of
administration, and dose schedules are adjusted in accordance with
methodologies known in the art.
[0344] In certain embodiments, the peptides and compositions of the
present invention are employed in serious disease states, that is,
life-threatening or potentially life threatening situations. In
such cases, as a result of the minimal amounts of extraneous
substances and the relative nontoxic nature of the peptides in
preferred compositions of the invention, it is possible and may be
felt desirable by the treating physician to administer substantial
excesses of these peptide compositions relative to these stated
dosage amounts.
[0345] The vaccine compositions of the invention can also be used
purely as prophylactic agents. Generally the dosage for an initial
prophylactic immunization generally occurs in a unit dosage range
where the lower value is about 1, 5, 50, 500, or 1000 .mu.g and the
higher value is about 10,000; 20,000; 30,000; or 50,000 .mu.g.
Dosage values for a human typically range from about 500 .mu.g to
about 50,000 .mu.g per 70 kilogram patient. This is followed by
boosting dosages of between about 1.0 .mu.g to about 50,000 .mu.g
of peptide administered at defined intervals from about four weeks
to six months after the initial administration of vaccine. The
immunogenicity of the vaccine can be assessed by measuring the
specific activity of CTL and HTL obtained from a sample of the
patient's blood.
[0346] The pharmaceutical compositions for therapeutic treatment
are intended for parenteral, topical, oral, nasal, intrathecal, or
local (e.g. as a cream or topical ointment) administration.
Preferably, the pharmaceutical compositions are administered
parentally, e.g., intravenously, subcutaneously, intradermally, or
intramuscularly. Thus, the invention provides compositions for
parenteral administration which comprise a solution of the
immunogenic peptides dissolved or suspended in an acceptable
carrier, preferably an aqueous carrier.
[0347] A variety of aqueous carriers may be used, e.g., water,
buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid and the
like. These compositions may be sterilized by conventional,
well-known sterilization techniques, or may be sterile filtered.
The resulting aqueous solutions may be packaged for use as is, or
lyophilized, the lyophilized preparation being combined with a
sterile solution prior to administration.
[0348] The compositions may contain pharmaceutically acceptable
auxiliary substances as required to approximate physiological
conditions, such as pH-adjusting and buffering agents, tonicity
adjusting agents, wetting agents, preservatives, and the like, for
example, sodium acetate, sodium lactate, sodium chloride, potassium
chloride, calcium chloride, sorbitan monolaurate, triethanolamine
oleate, etc.
[0349] The concentration of peptides of the invention in the
pharmaceutical formulations can vary widely, i.e., from less than
about 0.1%, usually at or at least about 2% to as much as 20% to
50% or more by weight, and will be selected primarily by fluid
volumes, viscosities, etc., in accordance with the particular mode
of administration selected.
[0350] A human unit dose form of the peptide composition is
typically included in a pharmaceutical composition that comprises a
human unit dose of an acceptable carrier, preferably an aqueous
carrier, and is administered in a volume of fluid that is known by
those of skill in the art to be used for administration of such
compositions to humans (see, e.g., Remington's Pharmaceutical
Sciences, 17.sup.th Edition, A. Gennaro, Editor, Mack Publishing
Co., Easton, Pa., 1985).
[0351] Proteins(s) of the invention, and/or nucleic acids encoding
the protein(s), can also be administered via liposomes, which may
also serve to: 1) target the proteins(s) to a particular tissue,
such as lymphoid tissue; 2) to target selectively to diseases
cells; or, 3) to increase the half-life of the peptide composition.
Liposomes include emulsions, foams, micelles, insoluble monolayers,
liquid crystals, phospholipid dispersions, lamellar layers and the
like. In these preparations, the peptide to be delivered is
incorporated as part of a liposome, alone or in conjunction with a
molecule which binds to a receptor prevalent among lymphoid cells,
such as monoclonal antibodies which bind to the CD45 antigen, or
with other therapeutic or immunogenic compositions. Thus, liposomes
either filled or decorated with a desired peptide of the invention
can be directed to the site of lymphoid cells, where the liposomes
then deliver the peptide compositions. Liposomes for use in
accordance with the invention are formed from standard
vesicle-forming lipids, which generally include neutral and
negatively charged phospholipids and a sterol, such as cholesterol.
The selection of lipids is generally guided by consideration of,
e.g., liposome size, acid lability and stability of the liposomes
in the blood stream. A variety of methods are available for
preparing liposomes, as described in, e.g., Szoka, et al., Ann.
Rev. Biophys. Bioeng. 9:467 (1980), and U.S. Pat. Nos. 4,235,871,
4,501,728, 4,837,028, and 5,019,369.
[0352] For targeting cells of the immune system, a ligand to be
incorporated into the liposome can include, e.g., antibodies or
fragments thereof specific for cell surface determinants of the
desired immune system cells. A liposome suspension containing a
peptide may be administered intravenously, locally, topically, etc.
in a dose which varies according to, inter alia, the manner of
administration, the peptide being delivered, and the stage of the
disease being treated.
[0353] For solid compositions, conventional nontoxic solid carriers
may be used which include, for example, pharmaceutical grades of
mannitol, lactose, starch, magnesium stearate, sodium saccharin,
talcum, cellulose, glucose, sucrose, magnesium carbonate, and the
like. For oral administration, a pharmaceutically acceptable
nontoxic composition is formed by incorporating any of the normally
employed excipients, such as those carriers previously listed, and
generally 10-95% of active ingredient, that is, one or more
peptides of the invention, and more preferably at a concentration
of 25%-75%.
[0354] For aerosol administration, immunogenic peptides are
preferably supplied in finely divided form along with a surfactant
and propellant. Typical percentages of peptides are about 0.01%-20%
by weight, preferably about 1%-10%. The surfactant must, of course,
be nontoxic, and preferably soluble in the propellant.
Representative of such agents are the esters or partial esters of
fatty acids containing from about 6 to 22 carbon atoms, such as
caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic,
olesteric and oleic acids with an aliphatic polyhydric alcohol or
its cyclic anhydride. Mixed esters, such as mixed or natural
glycerides may be employed. The surfactant may constitute about
0.1%-20% by weight of the composition, preferably about 0.25-5%.
The balance of the composition is ordinarily propellant. A carrier
can also be included, as desired, as with, e.g., lecithin for
intranasal delivery.
[0355] XI.) Diagnostic and Prognostic Embodiments of 158P1D7.
[0356] As disclosed herein, 158P1D7 polynucleotides, polypeptides,
reactive cytotoxic T cells (CTL), reactive helper T cells (HTL) and
anti-polypeptide antibodies are used in well known diagnostic,
prognostic and therapeutic assays that examine conditions
associated with dysregulated cell growth such as cancer, in
particular the cancers listed in Table I (see, e.g., both its
specific pattern of tissue expression as well as its overexpression
in certain cancers as described for example in Example 4).
[0357] 158P1D7 can be used in a manner anogous to, or as
complementary to, the bladder associated antigen combination,
mucins and CEA, represented in a diagnostic kit called
ImmunoCyt.TM.. ImmunoCyt a is a commercialy available assay to
identify and monitor the presence of bladder cancer (see Fradet et
al., 1997, Can J Urol, 4(3):400-405). A variety of other diagnostic
markers are also used in similar contexts including p53 and H-ras
(see, e.g., Tulchinsky et al., Int J Mol Med July 1999 4(1):99-102
and Minimoto et al., Cancer Detect Prev 2000;24(1):1-12).
Therefore, this disclosure of the 158P1D7 polynucleotides and
polypeptides (as well as the 158P1D7 polynucleotide probes and
anti-158P1D7 antibodies used to identify the presence of these
molecules) and their properties allows skilled artisans to utilize
these molecules in methods that are analogous to those used, for
example, in a variety of diagnostic assays directed to examining
conditions associated with cancer.
[0358] Typical embodiments of diagnostic methods which utilize the
158P1D7 polynucleotides, polypeptides, reactive T cells and
antibodies are analogous to those methods from well-established
diagnostic assays which employ, e.g., PSA polynucleotides,
polypeptides, reactive T cells and antibodies. For example, just as
PSA polynucleotides are used as probes (for example in Northern
analysis, see, e.g., Sharief et al., Biochem. Mol. Biol. Int.
33(3):567-74(1994)) and primers (for example in PCR analysis, see,
e.g., Okegawa et al., J. Urol. 163(4): 1189-1190 (2000)) to observe
the presence and/or the level of PSA mRNAs in methods of monitoring
PSA overexpression or the metastasis of prostate cancers, the
158P1D7 polynucleotides described herein can be utilized to detect
158P1D7 overexpression or the metastasis of bladder and other
cancers expressing this gene. Alternatively, just as PSA
polypeptides are used to generate antibodies specific for PSA which
can then be used to observe the presence and/or the level of PSA
proteins in methods to monitor PSA protein overexpression (see,
e.g., Stephan et al., Urology 55(4):560-3 (2000)) or the metastasis
of prostate cells (see, e.g., Alanen et al., Pathol. Res. Pract.
192(3):233-7 (1996)), the 158P1D7 polypeptides described herein can
be utilized to generate antibodies for use in detecting 158P1D7
overexpression or the metastasis of bladder cells and cells of
other cancers expressing this gene.
[0359] Specifically, because metastases involves the movement of
cancer cells from an organ of origin (such as the lung or bladder
etc.) to a different area of the body (such as a lymph node),
assays which examine a biological sample for the presence of cells
expressing 158P1D7 polynucleotides and/or polypeptides can be used
to provide evidence of metastasis. For example, when a biological
sample from tissue that does not normally contain
158P1D7-expressing cells (lymph node) is found to contain
158P1D7-expressing cells such as the 158P1D7 expression seen in
LAPC4 and LAPC9, xenografts isolated from lymph node and bone
metastasis, respectively, this finding is indicative of
metastasis.
[0360] Alternatively 158P1D7 polynucleotides and/or polypeptides
can be used to provide evidence of cancer, for example, when cells
in a biological sample that do not normally express 158P1D7 or
express 158P1D7 at a different level are found to express 158P1D7
or have an increased expression of 158P1D7 (see, e.g., the 158P1D7
expression in the cancers listed in Table I and in patient samples
etc. shown in the accompanying Figures). In such assays, artisans
may further wish to generate supplementary evidence of metastasis
by testing the biological sample for the presence of a second
tissue restricted marker (in addition to 158P1D7) such as
ImmunoCyt.TM., PSCA etc. (see, e.g., Fradet et al., 1997, Can J
Urol, 4(3):400-405; Amara et al., 2001, Cancer Res 61:4660-4665 ).
Just as PSA polynucleotide fragments and polynucleotide variants
are employed by skilled artisans for use in methods of monitoring
PSA, 158P1D7 polynucleotide fragments and polynucleotide variants
are used in an analogous manner. In particular, typical PSA
polynucleotides used in methods of monitoring PSA are probes or
primers which consist of fragments of the PSA cDNA sequence.
Illustrating this, primers used to PCR amplify a PSA polynucleotide
must include less than the whole PSA sequence to function in the
polymerase chain reaction. In the context of such PCR reactions,
skilled artisans generally create a variety of different
polynucleotide fragments that can be used as primers in order to
amplify different portions of a polynucleotide of interest or to
optimize amplification reactions (see, e.g., Caetano-Anolles, G.
Biotechniques 25(3): 472476, 478-480 (1998); Robertson et al.,
Methods Mol. Biol. 98:121-154 (1998)). An additional illustration
of the use of such fragments is provided in Example 4, where a
158P1D7 polynucleotide fragment is used as a probe to show the
expression of 158P1D7 RNAs in cancer cells. In addition, variant
polynucleotide sequences are typically used as primers and probes
for the corresponding mRNAs in PCR and Northern analyses (see,
e.g., Sawai et al., Fetal Diagn. Ther. November-December 1996
11(6):407-13 and Current Protocols In Molecular Biology, Volume 2,
Unit 2, Frederick M. Ausubel et al. eds., 1995)). Polynucleotide
fragments and variants are useful in this context where they are
capable of binding to a target polynucleotide sequence (e.g. the
158P1D7 polynucleotide shown in SEQ ID NO: 655) under conditions of
high stringency.
[0361] Furthermore, PSA polypeptides which contain an epitope that
can be recognized by an antibody or T cell that specifically binds
to that epitope are used in methods of monitoring PSA. 158P1D7
polypeptide fragments and polypeptide analogs or variants can also
be used in an analogous manner. This practice of using polypeptide
fragments or polypeptide variants to generate antibodies (such as
anti-PSA antibodies or T cells) is typical in the art with a wide
variety of systems such as fusion proteins being used by
practitioners (see, e.g., Current Protocols In Molecular Biology,
Volume 2, Unit 16, Frederick M. Ausubel et al. eds., 1995). In this
context, each epitope(s) functions to provide the architecture with
which an antibody or T cell is reactive. Typically, skilled
artisans create a variety of different polypeptide fragments that
can be used in order to generate immune responses specific for
different portions of a polypeptide of interest (see, e.g., U.S.
Pat. No. 5,840,501 and U.S. Pat. No. 5,939,533). For example it may
be preferable to utilize a polypeptide comprising one of the
158P1D7 biological motifs discussed herein or a motif-bearing
subsequence which is readily identified by one of skill in the art
based on motifs available in the art. Polypeptide fragments,
variants or analogs are typically useful in this context as long as
they comprise an epitope capable of generating an antibody or T
cell specific for a target polypeptide sequence (e.g. the 158P1D7
polypeptide shown in SEQ ID NO: 657).
[0362] As shown herein, the 158P1D7 polynucleotides and
polypeptides (as well as the 158P1D7 polynucleotide probes and
anti-158P1D7 antibodies or T cells used to identify the presence of
these molecules) exhibit specific properties that make them useful
in diagnosing cancers such as those listed in Table I. Diagnostic
assays that measure the presence of 158P1D7 gene products, in order
to evaluate the presence or onset of a disease condition described
herein, such as bladder cancer, are used to identify patients for
preventive measures or further monitoring, as has been done so
successfully with PSA for monitoring prostate cancer. Materials
such as 158P1D7 polynucleotides and polypeptides (as well as the
158P1D7 polynucleotide probes and anti-158P1D7 antibodies used to
identify the presence of these molecules) satisfy a need in the art
for molecules having similar or complementary characteristics to
PSA in situations of bladder cancer. Finally, in addition to their
use in diagnostic assays, the 158P1D7 polynucleotides disclosed
herein have a number of other utilities such as their use in the
identification of oncogenetic associated chromosomal abnormalities
in the chromosomal region to which the 158P1D7 gene maps (see
Example 3 below). Moreover, in addition to their use in diagnostic
assays, the 158P1D7-related proteins and polynucleotides disclosed
herein have other utilities such as their use in the forensic
analysis of tissues of unknown origin (see, e.g., Takahama K
Forensic Sci Int Jun. 28, 1996; 80(1-2): 63-9).
[0363] Additionally, 158P1D7-related proteins or polynucleotides of
the invention can be used to treat a pathologic condition
characterized by the over-expression of 158P1D7. For example, the
amino acid or nucleic acid sequence of FIG. 2 or FIG. 3, or
fragments of either, can be used to generate an immune response to
the 158P1D7 antigen. Antibodies or other molecules that react with
158P1D7 can be used to modulate the function of this molecule, and
thereby provide a therapeutic benefit.
[0364] XII.) Inhibition of 158P1D7 Protein Function
[0365] The invention includes various methods and compositions for
inhibiting the binding of 158P1D7 to its binding partner or its
association with other protein(s) as well as methods for inhibiting
158P1D7 function.
[0366] XII.A.) Inhibition of 158P1D7 with Intracellular
Antibodies
[0367] In one approach, a recombinant vector that encodes single
chain antibodies that specifically bind to 158P1D7 are introduced
into 158P1D7 expressing cells via gene transfer technologies.
Accordingly, the encoded single chain anti-158P1D7 antibody is
expressed intracellularly, binds to 158P1D7 protein, and thereby
inhibits its function. Methods for engineering such intracellular
single chain antibodies are well known. Such intracellular
antibodies, also known as "intrabodies", are specifically targeted
to a particular compartment within the cell, providing control over
where the inhibitory activity of the treatment is focused. This
technology has been successfully applied in the art (for review,
see Richardson and Marasco, 1995, TIBTECH vol. 13). Intrabodies
have been shown to virtually eliminate the expression of otherwise
abundant cell surface receptors (see, e.g., Richardson et al.,
1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Beerli et al.,
1994, J. Biol. Chem. 289: 23931-23936; Deshane et al., 1994, Gene
Ther. 1: 332-337).
[0368] Single chain antibodies comprise the variable domains of the
heavy and light chain joined by a flexible linker polypeptide, and
are expressed as a single polypeptide. Optionally, single chain
antibodies are expressed as a single chain variable region fragment
joined to the light chain constant region. Well-known intracellular
trafficking signals are engineered into recombinant polynucleotide
vectors encoding such single chain antibodies in order to precisely
target the intrabody to the desired intracellular compartment. For
example, intrabodies targeted to the endoplasmic reticulum (ER) are
engineered to incorporate a leader peptide and, optionally, a
C-terminal ER retention signal, such as the KDEL amino acid motif.
Intrabodies intended to exert activity in the nucleus are
engineered to include a nuclear localization signal. Lipid moieties
are joined to intrabodies in order to tether the intrabody to the
cytosolic side of the plasma membrane. Intrabodies can also be
targeted to exert function in the cytosol. For example, cytosolic
intrabodies are used to sequester factors within the cytosol,
thereby preventing them from being transported to their natural
cellular destination.
[0369] In one embodiment, intrabodies are used to capture 158P1D7
in the nucleus, thereby preventing its activity within the nucleus.
Nuclear targeting signals are engineered into such 158P1D7
intrabodies in order to achieve the desired targeting. Such 158P1D7
intrabodies are designed to bind specifically to a particular
158P1D7 domain. In another embodiment, cytosolic intrabodies that
specifically bind to the 158P1D7 protein are used to prevent
158P1D7 from gaining access to the nucleus, thereby preventing it
from exerting any biological activity within the nucleus (e.g.,
preventing 158P1D7 from forming transcription complexes with other
factors).
[0370] In order to specifically direct the expression of such
intrabodies to particular cells, the transcription of the intrabody
is placed under the regulatory control of an appropriate
tumor-specific promoter and/or enhancer. In order to target
intrabody expression specifically to bladder, for example, the PSCA
promoter-and/or promoter/enhancer can be utilized (See, for
example, U.S. Pat. No. 5,919,652 issued Jul. 6, 1999 and Lin et al.
PNAS, USA 92(3):679-683 (1995)).
[0371] XII.B.) Inhibition of 158P1D7 with Recombinant Proteins
[0372] In another approach, recombinant molecules bind to 158P1D7
and thereby inhibit 158P1D7 function. For example, these
recombinant molecules prevent or inhibit 158P1D7 from
accessing/binding to its binding partner(s) or associating with
other protein(s). Such recombinant molecules can, for example,
contain the reactive part(s) of a 158P1D7 specific antibody
molecule. In a particular embodiment, the 158P1D7 binding domain of
a 158P1D7 binding partner is engineered into a dimeric fusion
protein, whereby the fusion protein comprises two 158P1D7 ligand
binding domains linked to the Fc portion of a human IgG, such as
human IgG1. Such IgG portion can contain, for example, the C.sub.H2
and C.sub.H3 domains and the hinge region, but not the C.sub.H1
domain. Such dimeric fusion proteins are administered in soluble
form to patients suffering from a cancer associated with the
expression of 158P1D7, whereby the dimeric fusion protein
specifically binds to 158P1D7 and blocks 158P1D7 interaction with a
binding partner. Such dimeric fusion proteins are further combined
into multimeric proteins using known antibody linking
technologies.
[0373] XII.C.) Inhibition of 158P1D7 Transcription or
Translation
[0374] The present invention also comprises various methods and
compositions for inhibiting the transcription of the 158P1D7 gene.
Similarly, the invention also provides methods and compositions for
inhibiting the translation of 158P1D7 mRNA into protein.
[0375] In one approach, a method of inhibiting the transcription of
the 158P1D7 gene comprises contacting the 158P1D7 gene with a
158P1D7 antisense polynucleotide. In another approach, a method of
inhibiting 158P1D7 mRNA translation comprises contacting the
158P1D7 mRNA with an antisense polynucleotide. In another approach,
a 158P1D7 specific ribozyme is used to cleave the 158P1D7 message,
thereby inhibiting translation. Such antisense and ribozyme based
methods can also be directed to the regulatory regions of the
158P1D7 gene, such as the 158P1D7 promoter and/or enhancer
elements. Similarly, proteins capable of inhibiting a 158P1D7 gene
transcription factor are used to inhibit 158P1D7 mRNA
transcription. The various polynucleotides and compositions useful
in the aforementioned methods have been described above. The use of
antisense and ribozyme molecules to inhibit transcription and
translation is well known in the art.
[0376] Other factors that inhibit the transcription of 158P1D7 by
interfering with 158P1D7 transcriptional activation are also useful
to treat cancers expressing 158P1D7. Similarly, factors that
interfere with 158P1D7 processing are useful to treat cancers that
express 158P1D7. Cancer treatment methods utilizing such factors
are also within the scope of the invention.
[0377] XII.D.) General Considerations for Therapeutic
Strategies
[0378] Gene transfer and gene therapy technologies can be used to
deliver therapeutic polynucleotide molecules to tumor cells
synthesizing 158P1D7 (i.e., antisense, ribozyme, polynucleotides
encoding intrabodies and other 158P1D7 inhibitory molecules). A
number of gene therapy approaches are known in the art. Recombinant
vectors encoding 158P1D7 antisense polynucleotides, ribozymes,
factors capable of interfering with 158P1D7 transcription, and so
forth, can be delivered to target tumor cells using such gene
therapy approaches.
[0379] The above therapeutic approaches can be combined with any
one of a wide variety of surgical, chemotherapy or radiation
therapy regimens. The therapeutic approaches of the invention can
enable the use of reduced dosages of chemotherapy (or other
therapies) and/or less frequent administration, an advantage for
all patients and particularly for those that do not tolerate the
toxicity of the chemotherapeutic agent well.
[0380] The anti-tumor activity of a particular composition (e.g.,
antisense, ribozyme, intrabody), or a combination of such
compositions, can be evaluated using various in vitro and in vivo
assay systems. In vitro assays that evaluate therapeutic activity
include cell growth assays, soft agar assays and other assays
indicative of tumor promoting activity, binding assays capable of
determining the extent to which a therapeutic composition will
inhibit the binding of 158P1D7 to a binding partner, etc.
[0381] In vivo, the effect of a 158P1D7 therapeutic composition can
be evaluated in a suitable animal model. For example, xenogenic
bladder cancer models can be used, wherein human bladder cancer
explants or passaged xenograft tissues are introduced into immune
compromised animals, such as nude or SCID mice (Shibayama et al.,
1991, J Urol., 146(4):1136-7; Beecken et al., 2000, Urology,
56(3):521-526). Efficacy can be predicted using assays that measure
inhibition of tumor formation, tumor regression or metastasis, and
the like.
[0382] In vivo assays that evaluate the promotion of apoptosis are
useful in evaluating therapeutic compositions. In one embodiment,
xenografts from tumor bearing mice treated with the therapeutic
composition can be examined for the presence of apoptotic foci and
compared to untreated control xenograft-bearing mice. The extent to
which apoptotic foci are found in the tumors of the treated mice
provides an indication of the therapeutic efficacy of the
composition.
[0383] The therapeutic compositions used in the practice of the
foregoing methods can be formulated into pharmaceutical
compositions comprising a carrier suitable for the desired delivery
method. Suitable carriers include any material that when combined
with the therapeutic composition retains the anti-tumor function of
the therapeutic composition and is generally non-reactive with the
patient's immune system. Examples include, but are not limited to,
any of a number of standard pharmaceutical carriers such as sterile
phosphate buffered saline solutions, bacteriostatic water, and the
like (see, generally, Remington's Pharmaceutical Sciences 16.sup.th
Edition, A. Osal., Ed., 1980).
[0384] Therapeutic formulations can be solubilized and administered
via any route capable of delivering the therapeutic composition to
the tumor site. Potentially effective routes of administration
include, but are not limited to, intravenous, parenteral,
intraperitoneal, intramuscular, intratumor, intradermal,
intraorgan, orthotopic, and the like. A preferred formulation for
intravenous injection comprises the therapeutic composition in a
solution of preserved bacteriostatic water, sterile unpreserved
water, and/or diluted in polyvinylchloride or polyethylene bags
containing 0.9% sterile Sodium Chloride for Injection, USP.
Therapeutic protein preparations can be lyophilized and stored as
sterile powders, preferably under vacuum, and then reconstituted in
bacteriostatic water (containing for example, benzyl alcohol
preservative) or in sterile water prior to injection.
[0385] Dosages and administration protocols for the treatment of
cancers using the foregoing methods will vary with the method and
the target cancer, and will generally depend on a number of other
factors appreciated in the art.
[0386] XIII.) Kits
[0387] For use in the diagnostic and therapeutic applications
described herein, kits are also within the scope of the invention.
Such kits can comprise a carrier, package or container that is
compartmentalized to receive one or more containers such as vials,
tubes, and the like, each of the container(s) comprising one of the
separate elements to be used in the method. For example, the
container(s) can comprise a probe that is or can be detectably
labeled. Such probe can be an antibody or polynucleotide specific
for a 158P1D7-related protein or a 158P1D7 gene or message,
respectively. Where the method utilizes nucleic acid hybridization
to detect the target nucleic acid, the kit can also have containers
containing nucleotide(s) for amplification of the target nucleic
acid sequence and/or a container comprising a reporter-means, such
as a biotin-binding protein, such as avidin or streptavidin, bound
to a reporter molecule, such as an enzymatic, florescent, or
radioisotope label. The kit can include all or part of the amino
acid sequence of FIG. 2 or FIG. 3 or analogs thereof, or a nucleic
acid molecules that encodes such amino acid sequences.
[0388] The kit of the invention will typically comprise the
container described above and one or more other containers
comprising materials desirable from a commercial and user
standpoint, including buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use.
[0389] A label can be present on the container to indicate that the
composition is used for a specific therapy or non-therapeutic
application, and can also indicate directions for either in vivo or
in vitro use, such as those described above. Directions and or
other information can also be included on a label or on an insert
which is included with the kit.
EXAMPLES
[0390] Various aspects of the invention are further described and
illustrated by way of the several examples that follow, none of
which are intended to limit the scope of the invention.
Example 1
SSH-Generated Isolation of a cDNA Fragment of the 158P1D7 Gene
[0391] To isolate genes that are over-expressed in bladder cancer
we used the Suppression Subtractive Hybridization (SSH) procedure
using cDNA derived from bladder cancer tissues, including invasive
transitional cell carcinoma. The 158P1D7 SSH cDNA sequence was
derived from a bladder cancer pool minus normal bladder cDNA
subtraction. Included in the driver were also cDNAs derived from 9
other normal tissues. The 158P1D7 cDNA was identified as highly
expressed in the bladder cancer tissue pool, with lower expression
seen in a restricted set of normal tissues.
[0392] The SSH DNA sequence of 231 bp (FIG. 1) has high homology
(230/231 identity) to a hypothetical protein FLJ22774 (GenBank
accession XM.sub.--033183) derived from a chromosome 13 genomic
clone. A 158P1D7 cDNA clone (TurboScript3PX) of 2,555 bp was
isolated from bladder cancer cDNA, revealing an ORF of 841 amino
acids (FIG. 2 and FIG. 3).
[0393] The 158P1D7 protein has a signal sequence and a
transmembrane domain and is predicted to be localized to the cell
surface using the the PSORT-I program (URL
psort.nibb.ac.jp:8800/form.html). Amino acid sequence analysis of
158P1D7 reveals 100% identity over 798 amino acid region to a human
hypothetical protein FLJ22774 (GenBank Accession XP.sub.--033182,
FIG. 4).
[0394] Materials and Methods
[0395] Human Tissues:
[0396] The bladder cancer patient tissues were purchased from
several sources such as from the NDRI (Philadelphia, Pa.). mRNA for
some normal tissues were purchased from Clontech, Palo Alto,
Calif.
[0397] RNA Isolation:
[0398] Tissues were homogenized in Trizol reagent (Life
Technologies, Gibco BRL) using 10 ml/g tissue isolate total RNA.
Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA
Mini and Midi kits. Total and mRNA were quantified by
spectrophotometric analysis (O.D. 260/280 nm) and analyzed by gel
electrophoresis.
[0399] Oligonucleotides:
[0400] The following HPLC purified oligonucleotides were used.
1 DPNCDN (cDNA synthesis primer): 5'TTTTGATCAAGCTT.sub.303- ' (SEQ
ID NO:661) Adaptor 1:
5'CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAG3' (SEQ ID NO:662)
3'GGCCCGTCCTAG5' (SEQ ID NO:663) Adaptor 2:
5'GTAATAGGACTCACTATAGGGCAGCGTGGTCGCGGGGGAG3' (SEQ ID NO:664)
3'CGGCTCCTAG5' (SEQ ID NO:665) PCR primer 1:
5'CTAATACGACTCACTATAGGGC3' (SEQ ID NO:666) Nested primer (NP) 1:
5'TCGAGCGGCCGCCCGGGCAGGA3' (SEQ ID NO:667) Nested primer (NP)2:
5'AGCGTGGTCGCGGCGGAGGA3' (SEQ ID NO:668)
[0401] Suppression Subtractive Hybridization:
[0402] Suppression Subtractive Hybridization (SSH) was used to
identify cDNAs corresponding to genes that may be differentially
expressed in bladder cancer. The SSH reaction utilized cDNA from
bladder cancer and normal tissues.
[0403] The gene 158P1D7 sequence was derived from a bladder cancer
pool minus normal bladder cDNA subtraction. The SSH DNA sequence
(FIG. 1) was identified.
[0404] The cDNA derived from of pool of normal bladder tissues was
used as the source of the "driver" cDNA, while the cDNA from a pool
of bladder cancer tissues was used as the source of the "tester"
cDNA. Double stranded cDNAs corresponding to tester and driver
cDNAs were synthesized from 2 .mu.g of poly(A).sup.+ RNA isolated
from the relevant xenograft tissue, as described above, using
CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of
oligonucleotide DPNCDN as primer. First- and second-strand
synthesis were carried out as described in the Kit's user manual
protocol (CLONTECH Protocol No. PT1117-1, Catalog No. K1804-1). The
resulting cDNA was digested with Dpn II for 3 hrs at 37.degree. C.
Digested cDNA was extracted with phenol/chloroform (1:1) and
ethanol precipitated.
[0405] Driver cDNA was generated by combining in a 1:1 ratio Dpn II
digested cDNA from the relevant tissue source (see above) with a
mix of digested cDNAs derived from the nine normal tissues:
stomach, skeletal muscle, lung, brain, liver, kidney, pancreas,
small intestine, and heart.
[0406] Tester cDNA was generated by diluting 1 .mu.l of Dpn II
digested cDNA from the relevant tissue source (see above) (400 ng)
in 5 .mu.l of water. The diluted cDNA (2 .mu.l, 160 ng) was then
ligated to 2 .mu.l of Adaptor 1 and Adaptor 2 (10 .mu.M), in
separate ligation reactions, in a total volume of 10 .mu.l at
16.degree. C. overnight, using 400 u of T4 DNA ligase (CLONTECH).
Ligation was terminated with 1 .mu.l of 0.2 M EDTA and heating at
72.degree. C. for 5 min.
[0407] The first hybridization was performed by adding 1.5 .mu.l
(600 ng) of driver cDNA to each of two tubes containing 1.5 .mu.l
(20 ng) Adaptor 1- and Adaptor 2-ligated tester cDNA. In a final
volume of 4 .mu.l, the samples were overlaid with mineral oil,
denatured in an MJ Research thermal cycler at 98.degree. C. for 1.5
minutes, and then were allowed to hybridize for 8 hrs at 68.degree.
C. The two hybridizations were then mixed together with an
additional 1 .mu.l of fresh denatured driver cDNA and were allowed
to hybridize overnight at 68.degree. C. The second hybridization
was then diluted in 200 .mu.l of 20 mM Hepes, pH 8.3, 50 mM NaCl,
0.2 mM EDTA, heated at 70.degree. C. for 7 min. and stored at
-20.degree. C.
[0408] PCR Amplification, Cloning and Sequencing of Gene Fragments
Generated from SSH:
[0409] To amplify gene fragments resulting from SSH reactions, two
PCR amplifications were performed. In the primary PCR reaction 1
.mu.l of the diluted final hybridization mix was added to 1 .mu.l
of PCR primer 1 (10 .mu.M), 0.5 .mu.l dNTP mix (10 .mu.M), 2.5
.mu.l 10.times. reaction buffer (CLONTECH) and 0.5 .mu.l 50.times.
Advantage cDNA polymerase Mix (CLONTECH) in a final volume of 25
.mu.l. PCR 1 was conducted using the following conditions:
75.degree. C for 5 min., 94.degree. C for 25 sec., then 27 cycles
of 94.degree. C. for 10 sec, 66.degree. C. for 30 sec, 72.degree.
C. for 1.5 min. Five separate primary PCR reactions were performed
for each experiment. The products were pooled and diluted 1:10 with
water. For the secondary PCR reaction, 1 .mu.l from the pooled and
diluted primary PCR reaction was added to the same reaction mix as
used for PCR 1, except that primers NP1 and NP2 (10 .mu.M) were
used instead of PCR primer 1. PCR 2 was performed using 10-12
cycles of 94.degree. C. for 10 sec, 68.degree. C. for 30 sec, and
72.degree. C. for 1.5 minutes. The PCR products were analyzed using
2% agarose gel electrophoresis.
[0410] The PCR products were inserted into pCR2.1 using the T/A
vector cloning kit (Invitrogen). Transformed E. coli were subjected
to blue/white and ampicillin selection. White colonies were picked
and arrayed into 96 well plates and were grown in liquid culture
overnight. To identify inserts, PCR amplification was performed on
I ml of bacterial culture using the conditions of PCR1 and NP1 and
NP2 as primers. PCR products were analyzed using 2% agarose gel
electrophoresis.
[0411] Bacterial clones were stored in 20% glycerol in a 96 well
format. Plasmid DNA was prepared, sequenced, and subjected to
nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP
databases.
[0412] RT-PCR Expression Analysis:
[0413] First strand cDNAs can be generated from 1 .mu.g of mRNA
with oligo (dT)12-18 priming using the Gibco-BRL Superscript
Preamplification system. The manufacturer's protocol was used which
included an incubation for 50 min at 42.degree. C. with reverse
transcriptase followed by RNAse H treatment at 37.degree. C. for 20
min. After completing the reaction, the volume can be increased to
200 .mu.l with water prior to normalization. First strand cDNAs
from 16 different normal human tissues can be obtained from
Clontech.
[0414] Normalization of the first strand cDNAs from multiple
tissues was performed by using the primers
5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO: 669) and
5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 670) to amplify
.beta.-actin. First strand cDNA (5 .mu.l) were amplified in a total
volume of 50 .mu.l containing 0.4 .mu.M primers, 0.2 .mu.M each
dNTPs, 1.times. PCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM
MgCl.sub.2, 50 mM KCl, pH8.3) and 1.times. Klentaq DNA polymerase
(Clontech). Five .mu.l of the PCR reaction can be removed at 18,
20, and 22 cycles and used for agarose gel electrophoresis. PCR was
performed using an MJ Research thermal cycler under the following
conditions: Initial denaturation can be at 94.degree. C. for 15
sec, followed by a 18, 20, and 22 cycles of 94.degree. C. for 15,
65.degree. C. for 2 min, 72.degree. C. for 5 sec. A final extension
at 72.degree. C. was carried out for 2 min. After agarose gel
electrophoresis, the band intensities of the 283 b.p. .beta.-actin
bands from multiple tissues were compared by visual inspection.
Dilution factors for the first strand cDNAs were calculated to
result in equal .beta.-actin band intensities in all tissues after
22 cycles of PCR. Three rounds of normalization can be required to
achieve equal band intensities in all tissues after 22 cycles of
PCR.
[0415] To determine expression levels of the 158P1D7 gene, 5 .mu.l
of normalized first strand cDNA were analyzed by PCR using 26, and
30 cycles of amplification. Semi-quantitative expression analysis
can be achieved by comparing the PCR products at cycle numbers that
give light band intensities. The primers used for RT-PCR were
designed using the 158P1D7 SSH sequence and are listed below:
2 158P1D7.1 5' ATAAGCTTTCAATGTTGCGCTCCT 3' (SEQ ID NO:671)
158P1D7.2 5' TGTCAACTAAGACCACGTCCATTC3' (SEQ ID NO:672)
[0416] A typical RT-PCR expression analysis is shown in FIG. 6.
RT-PCR expression analysis was performed on first strand cDNAs
generated using pools of tissues from multiple samples. The cDNAs
were shown to be normalized using beta-actin PCR. Expression of
158P1D7 was observed in bladder cancer pool.
Example 2
Full Length Cloning of 158P1D7
[0417] The 158P1D7 SSH cDNA sequence was derived from a bladder
cancer pool minus normal bladder cDNA subtraction. The SSH cDNA
sequence (FIG. 1) was designated 158P1D7. The full-length cDNA
clone 158P1D7-clone TurboScript3PX (FIG. 2) was cloned from bladder
cancer pool cDNA.
[0418] 158P1D7 clone cDNA was deposited under the terms of the
Budapest Treaty on Aug. 22, 2001, with the American Type Culture
Collection (ATCC; 10801 University Blvd., Manassas, Va. 20110-2209
USA) as plasmid p158P1D7-Turbo/3PX, and has been assigned Accession
No. ______ (docket # ______).
Example 3
Chromosomal Mapping of 158P1D7
[0419] Chromosomal localization can implicate genes in disease
pathogenesis. Several chromosome mapping approaches are available
including fluorescent in situ hybridization (FISH), human/hamster
radiation hybrid (RH) panels (Walter et al., 1994; Nature Genetics
7:22; Research Genetics, Huntsville Ala.), human-rodent somatic
cell hybrid panels such as is available from the Coriell Institute
(Camden, N.J.), and genomic viewers utilizing BLAST homologies to
sequenced and mapped genomic clones (NCBI, Bethesda, Md.).
[0420] 158P1D7 maps to chromosme 13, using 158P1D7 sequence and the
NCBI BLAST tool:
(http://www.ncbi.nlm.nih.gov/genome/seq/page.cgi?F=HsBlast.ht-
ml&&ORG=Hs). This is a region of frequent amplification in
bladder cancer (Prat et al., Urology May 2001; 57(5):986-92;
Muscheck et al., Carcinogenesis September 2000; 21(9):1721-26) and
is associated with rapid tumor cell proliferation in advanced
bladder cancer (Tomovska et al., Int J Oncol June 2001;
18(6):1239-44).
Example 4
Expression Analysis of 158P1D7 in Normal Tissues and Patient
Specimens
[0421] Analysis of 158P1D7 by RT-PCR is shown in FIG. 6. Strong
expression of 158P1D7 is observed in bladder cancer pool and breast
cancer pool. Lower levels of expression are observed in VP1, VP2,
xenograft pool, prostate cancer pool, colon cancer pool, lung
cancer pool, ovary cancer pool, and metastasis pool.
[0422] Extensive northern blot analysis of 158P1D7 in 16 human
normal tissues confirms the expression observed by RT-PCR (FIG. 7).
Two transcripts of approximately 4.6 and 4.2 kb are detected in
prostate and, to lower levels, in heart, placenta, liver, small
intestine and colon.
[0423] Northern blot analysis on patient tumor specimens shows
expression of 158P1D7 in most bladder tumor tissues tested and in
the bladder cancer cell line SCaBER (FIGS. 8A and 8B). The
expression detected in normal adjacent tissues (isolated from
patients) but not in normal tissues (isolated from a healthy donor)
may indicate that these tissues are not fully normal and that
158P1D7 may be expressed in early stage tumors. Expression of
158P1D7 is also detected in 2 of 4 lung cancer cell lines, and in
all 3 lung cancer tissues tested (FIG. 9. In breast cancer samples,
158P1D7 expression is observed in the MCF7 and CAMA-1 breast cancer
cell lines, in breast tumor tissues isolated from breast cancer
patients, but not in normal breast tissues (FIG. 10).
[0424] The restricted expression of 158P1D7 in normal tissues and
the expression detected in prostate cancer, bladder cancer, colon
cancer, lung cancer, ovarian cancer, and breast cancer suggest that
158P1D7 is a potential therapeutic target and a diagnostic marker
for human cancers.
Example 5
Production of Recombinant 158P1D7 in Prokaryotic Systems
[0425] A. In vitro Transcription and Translation Constructs:
[0426] pCRII: To generate 158P1D7 sense and anti-sense RNA probes
for RNA in situ investigations, pCRII constructs (Invitrogen,
Carlsbad Calif.) are generated encoding either all or fragments of
the 158P1D7 cDNA. The pCRII vector has Sp6 and T7 promoters
flanking the insert to drive the transcription of 158P1D7 RNA for
use as probes in RNA in situ hybridization experiments. These
probes are used to analyze the cell and tissue expression of
158P1D7 at the RNA level. Transcribed 158P1D7 RNA representing the
cDNA amino acid coding region of the 158P1D7 gene is used in in
vitro translation systems such as the TnT.TM. Coupled
Reticulolysate Sytem (Promega, Corp., Madison, Wis.) to synthesize
158P1D7 protein.
[0427] B. Bacterial Constructs:
[0428] pGEX Constructs: To generate recombinant 158P1D7 proteins in
bacteria that are fused to the Glutathione S-transferase (GST)
protein, all or parts of the 158P1D7 cDNA protein coding sequence
are fused to the GST gene by cloning into pGEX-6P-1 or any other
GST-fusion vector of the pGEX family (Amersham Pharmacia Biotech,
Piscataway, N.J.). These constructs allow controlled expression of
recombinant 158P1D7 protein sequences with GST fused at the
amino-terminus and a six histidine epitope (6.times. His) at the
carboxyl-terminus. The GST and 6.times. His tags permit
purification of the recombinant fusion protein from induced
bacteria with the appropriate affinity matrix and allow recognition
of the fusion protein with anti-GST and His antibodies. The
6.times. His tag is generated by adding 6 histidine codons to the
cloning primer at the 3' end of the open reading frame (ORF). A
proteolytic cleavage site, such as the PreScission.TM. recognition
site in pGEX-6P-1, may be employed such that it permits cleavage of
the GST tag from 158P1D7-related protein. The ampicillin resistance
gene and pBR322 origin permits selection and maintenance of the
pGEX plasmids in E. coli. For example, constructs are made
utilizing pGEX-6P-1 such that the following regions of 158P1D7 are
expressed as an amino-terminal fusions to GST: amino acids 1 to
841; or any 8, 9, 10, 11, 12, 13, 14, 15, or more contiguous amino
acids from 158P1D7 or analogs thereof.
[0429] pMAL Constructs: To generate recombinant 158P1D7 proteins
that are fused to maltose-binding protein (MBP) in bacterial cells,
all or parts of the 158P1D7 cDNA protein coding sequence are fused
to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X vectors
(New England Biolabs, Beverly, Mass.). These constructs allow
controlled expression of recombinant 158P1D7 protein sequences with
MBP fused at the amino-terminus and a 6.times. His epitope at the
carboxyl-terminus. The MBP and 6.times. His tags permit
purification of the recombinant protein from induced bacteria with
the appropriate affinity matrix and allow recognition of the fusion
protein with anti-MBP and anti-His antibodies. The 6.times. His is
generated by adding the histidine codons to the 3' cloning primer.
A Factor Xa recognition site permits cleavage of the pMAL tag from
158P1D7. The pMAL-c2X and pMAL-p2X vectors are optimized to express
the recombinant protein in the cytoplasm or periplasm respectively.
Periplasm expression enhances folding of proteins with disulfide
bonds. For example, constructs are made utilizing pMAL-c2X and
pMAL-p2X such that the following regions of the 158P1D7 protein are
expressed as amino-terminal fusions to MBP: amino acids 1 to 841;
or any 8, 9, 10, 11, 12, 13, 14, 15, or more contiguous amino acids
from 158P1D7 or analogs thereof.
[0430] pET Constructs: To express 158P1D7 in bacterial cells, all
or parts of the 158P1D7 cDNA protein coding sequence are cloned
into the pET family of vectors (Novagen, Madison, Wis.). These
vectors allow tightly controlled expression of recombinant 158P1D7
protein in bacteria with and without fusion to proteins that
enhance solubility, such as NusA and thioredoxin (Trx), and epitope
tags, such as 6.times. His and S-Tag.TM. that aid purification and
detection of the recombinant protein. For example, constructs are
made utilizing pET NusA fusion system 43.1 such that the following
regions of the 158P1D7 protein are expressed as amino-terminal
fusions to NusA: amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13,
14, 15, or more contiguous amino acids from 158P1D7 or analogs
thereof.
[0431] B. Yeast Constructs:
[0432] pESC Constructs: To express 158P1D7 in the yeast species
Saccharomyces cerevisiae for generation of recombinant protein and
functional studies, all or parts of the 158P1D7 cDNA protein coding
sequence are cloned into the pESC family of vectors each of which
contain 1 of 4 selectable markers, HIS3, TRP1, LEU2, and URA3
(Stratagene, La Jolla, Calif.). These vectors allow controlled
expression from the same plasmid of up to 2 different genes or
cloned sequences containing either Flag.TM. or Myc epitope tags in
the same yeast cell. This system is useful to conform
protein-protein interactions of 158P1D7. In addition, expression in
yeast yields similar post-translational modifications, such as
glycosylations and phosphorylations, that are found when expressed
in eukaryotic cells. For example, constructs are made utilizing
pESC-HIS such that the following regions of the 158P1D7 protein are
expressed: amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13, 14,
15, or more contiguous amino acids from 158P1D7 or analogs
thereof.
[0433] pESP Constructs: To express 158P1D7 in the yeast species
Saccharomyces pombe, all or parts of the 158P1D7 cDNA protein
coding sequence are cloned into the pESP family of vectors. These
vectors allow controlled high level of-expression of a 158P1D7
protein sequence that is fused at either the amino terminus or at
the carboxyl terminus to GST which aids purification of the
recombinant protein. A Flag.TM. epitope tag allows detection of the
recombinant protein with anti-Flag.TM. antibody. For example,
constructs are made utilizing pESP-1 vector such that the following
regions of the 158P1D7 protein are expressed as amino-terminal
fusions to GST: amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13,
14, 15, or more contiguous amino acids from 158P1D7 or analogs
thereof.
Example 6
Production of Recombinant 158P1D7 in Eukaryotic Systems
[0434] A. Mammalian Constructs:
[0435] To express recombinant 158P1D7 in eukaryotic cells, the full
or partial length 158P1D7 cDNA sequences can be cloned into any one
of a variety of expression vectors known in the art. The constructs
can be transfected into any one of a wide variety of mammalian
cells such as 293T cells. Transfected 293T cell lysates can be
probed with the anti-158P1D7 polyclonal serum, described above.
[0436] pcDNA4/HisMax Constructs: To express 158P1D7 in mammalian
cells, the 158P1D7 ORF is cloned into pcDNA4/HisMax Version A
(Invitrogen, Carlsbad, Calif.). Protein expression is driven from
the cytomegalovirus (CMV) promoter and the SP163 translational
enhancer. The recombinant protein has XpressTM and six histidine
epitopes fused to the N-terminus. The pcDNA4/HisMax vector also
contains the bovine growth hormone (BGH) polyadenylation signal and
transcription termination sequence to enhance mRNA stability along
with the SV40 origin for episomal replication and simple vector
rescue in cell lines expressing the large T antigen. The Zeocin
resistance gene allows for selection of mammalian cells expressing
the protein and the ampicillin resistance gene and ColE1 origin
permits selection and maintenance of the plasmid in E. coli. The
following regions of 158P1D7 are expressed in this contruct, amino
acids 1 to 841; or any 8, 9, 10, 11, 12, 13, 14, 15, or more
contiguous amino acids from 158P1D7, variants, or analogs
thereof.
[0437] pcDNA3.1/MycHis Constructs: To express 158P1D7 in mammalian
cells, the ORFs with consensus Kozak translation initiation site
were cloned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad,
Calif.). Protein expression is driven from the cytomegalovirus
(CMV) promoter. The recombinant proteins have the myc epitope and
six histidines fused to the C-terminus. The pcDNA3.1/MycHis vector
also contains the bovine growth hormone (BGH) polyadenylation
signal and transcription termination sequence to enhance mRNA
stability, along with the SV40 origin for episomal replication and
simple vector rescue in cell lines expressing the large T antigen.
The Neomycin resistance gene can be used, as it allows for
selection of mammalian cells expressing the protein and the
ampicillin resistance gene and ColE1 origin permits selection and
maintenance of the plasmid in E. coli. The following regions of
158P1D7 are expressed in this construct, amino acids 1 to 841; or
any 8, 9, 10, 11, 12, 13, 14, 15, or more contiguous amino acids
from 158P1D7, variants, or analogs thereof.
[0438] pcDNA3.1/CT-GFP-TOPO Construct: To express 158P1D7 in
mammalian cells and to allow detection of the recombinant proteins
using fluorescence, the ORFs with consensus Kozak translation
initiation site are cloned into pcDNA3.1CT-GFP-TOPO (Invitrogen,
CA). Protein expression is driven from the cytomegalovirus (CMV)
promoter. The recombinant proteins have the Green Fluorescent
Protein (GFP) fused to the C-terminus facilitating non-invasive, in
vivo detection and cell biology studies. The pcDNA3.1CT-GFP-TOPO
vector also contains the bovine growth hormone (BGH)
polyadenylation signal and transcription termination sequence to
enhance mRNA stability along with the SV40 origin for episomal
replication and simple vector rescue in cell lines expressing the
large T antigen. The Neomycin resistance gene allows for selection
of mammalian cells that express the protein, and the ampicillin
resistance gene and ColE1 origin permits selection and maintenance
of the plasmid in E. coli. An additional construct with a
N-terminal GFP fusion is made in pcDNA3.1/NT-GFP-TOPO spanning the
entire length of the 158P1D7 protein. The following regions of
158P1D7 are expressed in this construct, amino acids 1 to 841; or
any 8, 9, 10, 11, 12, 13, 14, 15, or more contiguous amino acids
from 158P1D7, variants, or analogs thereof.
[0439] PAPtag: The 158P1D7 ORFs are cloned into pAPtag-5 (GenHunter
Corp. Nashville, Tenn.). This construct generates an alkaline
phosphatase fusion at the C-terminus of the 158P1D7 proteins while
fusing the IgGK signal sequence to N-terminus. The resulting
recombinant 158P1D7 proteins are optimized for secretion into the
media of transfected mammalian cells and can be used to identify
proteins such as ligands or receptors that interact with the
158P1D7 proteins. Protein expression is driven from the CMV
promoter and the recombinant proteins also contain myc and six
histidines fused to the C-terminus of alkaline phosphatase. The
Zeocin resistance gene allows for selection of mammalian cells
expressing the protein and the ampicillin resistance gene permits
selection of the plasmid in E. coli. The following regions of
158P1D7 are expressed in this construct, amino acids 1 to 841; or
any 8, 9, 10, 11, 12, 13, 14, 15, or more contiguous amino acids
from 158P1D7, variants, or analogs thereof.
[0440] ptag5: The 158P1D7 ORFs are also cloned into pTag-5. This
vector is similar to pAPtag but without the alkaline phosphatase
fusion. This construct generates an immunoglobulin G1 Fc fusion at
the C-terminus of the 158P1D7 protein while fusing the IgGK signal
sequence to the N-terminus. The resulting recombinant 158P1D7
proteins are optimized for secretion into the media of transfected
mammalian cells, and can be used to identify proteins such as
ligands or receptors that interact with the 158P1D7 proteins.
Protein expression is driven from the CMV promoter and the
recombinant protein also contains myc and six histidines fused to
the C-terminus of alkaline phosphatase. The Zeocin resistance gene
allows for selection of mammalian cells expressing the protein, and
the ampicillin resistance gene permits selection of the plasmid in
E. coli. The following regions of 158P1D7 are expressed in this
construct, amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13, 14,
15, or more contiguous amino acids from 158P1D7, variants, or
analogs thereof.
[0441] PsecFc: The 158P1D7 ORFs are also cloned into psecFc. The
psecFc vector was assembled by cloning immunoglobulin G1 Fc (hinge,
CH2, CH3 regions) into pSecTag2 (Invitrogen, California). This
construct generates an immunoglobulin G1 Fc fusion at the
C-terminus of the 158P1D7 proteins, while fusing the IgG-kappa
signal sequence to N-terminus. The resulting recombinant 158P1D7
protein is optimized for secretion into the media of transfected
mammalian cells, and can be used to identify proteins such as
ligands or receptors that interact with the 158P1D7 protein.
Protein expression is driven from the CMV promoter and the
recombinant protein also contain myc and six histidines fused to
the C-terminus of alkaline phosphatase. The Zeocin resistance gene
allows for selection of mammalian cells that express the protein,
and the ampicillin resistance gene permits selection of the plasmid
in E. coli. The following regions of 158P1D7 are expressed in this
construct, amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13, 14,
15, or more contiguous amino acids from 158P1D7, variants, or
analogs thereof.
[0442] pSR.alpha. Constructs: To generate mammalian cell lines that
express 158P1D7 constitutively, the ORFs are cloned into pSR.alpha.
constructs. Amphotropic and ecotropic retroviruses are generated by
transfection of pSR.alpha. constructs into the 293T-10A1 packaging
line or co-transfection of pSR.alpha. and a helper plasmid
(containing deleted packaging sequences) into the 293 cells,
respectively. The retrovirus can be used to infect a variety of
mammalian cell lines, resulting in the integration of the cloned
gene, 158P1D7, into the host cell-lines. Protein expression is
driven from a long terminal repeat (LTR). The Neomycin resistance
gene allows for selection of mammalian cells that express the
protein, and the ampicillin resistance gene and ColE1 origin permit
selection and maintenance of the plasmid in E. coli. The retroviral
vectors can thereafter be used for infection and generation of
various cell lines using, for example, SCaBER, NIH 3T3, TsuPr1, 293
or rat-1 cells.
[0443] Additional pSR.alpha. constructs are made that fuse an
epitope tag such as the FLAG tag to the C-terminus of 158P1D7
sequences to allow detection using anti-epitope tag antibodies. For
example, the FLAG sequence 5' gat tac aag gat gac gac gat aag 3' is
added to cloning primer at the 3' end of the ORF. Additional
pSR.alpha. constructs are made to produce both N-terminal and
C-terminal GFP and myc/6 HIS fusion proteins of the full-length
158P1D7 proteins. The following regions of 158P1D7 are expressed in
such constructs, amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13,
14, 15, or more contiguous amino acids from 158P1D7, variants, or
analogs thereof.
[0444] Additional Viral Vectors: Additional constructs are made for
viral-mediated delivery and expression of 158P1D7. High virus titer
leading to high level expression of 158P1D7 is achieved in viral
delivery systems such as adenoviral vectors and herpes amplicon
vectors. The 158P1D7 coding sequences or fragments thereof are
amplified by PCR and subcloned into the AdEasy shuttle vector
(Stratagene). Recombination and virus packaging are performed
according to the manufacturer's instructions to generate adenoviral
vectors. Altenatively, 158P1D7 coding sequences or fragments
thereof are cloned into the HSV-1 vector (Imgenex) to generate
herpes viral vectors. The viral vectors are thereafter used for
infection of various cell lines such as SCaBER, NIH 3T3, 293 or
rat-1 cells. The following regions of 158P1D7 are expressed in this
construct, amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13, 14,
15, or more contiguous amino acids from 158P1D7, variants, or
analogs thereof.
[0445] Regulated Expression Systems: To control expression of
158P1D7 in mammalian cells, coding sequences of 158P1D7 are cloned
into regulated mammalian expression systems such as the T-Rex
System (Invitrogen), the GeneSwitch System (Invitrogen) and the
tightly-regulated Ecdysone System (Sratagene). These systems allow
the study of the temporal and concentration dependent effects of
recombinant 158P1D7. These vectors are thereafter used to control
expression of 158P1D7 in various cell lines such as SCaBER, NIH
3T3, 293 or rat-1 cells. The following regions of 158P1D7 are
expressed in these constructs, amino acids 1 to 841; or any 8, 9,
10, 11, 12, 13, 14, 15, or more contiguous amino acids from
158P1D7, variants, or analogs thereof.
[0446] B. Baculovirus Expression Systems
[0447] To generate recombinant 158P1D7 proteins in a baculovirus
expression system, 158P1D7 ORFs are cloned into the baculovirus
transfer vector pBlueBac 4.5 (Invitrogen), which provides a His-tag
at the N-terminus. Specifically, pBlueBac-158P1D7 is co-transfected
with helper plasmid pBac-N-Blue (Invitrogen) into SF9 (Spodoptera
fugiperda) insect cells to generate recombinant baculovirus (see
Invitrogen instruction manual for details). Baculovirus is then
collected from cell supernatant and purified by plaque assay.
[0448] Recombinant 158P1D7 protein is then generated by infection
of HighFive insect cells (Invitrogen) with purified baculovirus.
Recombinant 158P1D7 protein can be detected using anti-158P1D7 or
anti-His-tag antibody. 158P1D7 protein can be purified and used in
various cell-based assays or as immunogen to generate polyclonal
and monoclonal antibodies specific for 158P1D7.
[0449] The following regions of 158P1D7 are expressed in this
construct, amino acids 1 to 841; or any 8, 9, 10, 11, 12, 13, 14,
15, or more contiguous amino acids from 158P1D7, variants, or
analogs thereof.
Example 7
Antigenicity Profiles
[0450] FIG. 11, FIG. 12, FIG. 13, FIG. 14, and FIG. 15 depict
graphically five amino acid profiles of the 158P1D7 amino acid
sequence, each assessment available by accessing the ProtScale
website (URL www.expasy.ch/cgi-bin/protscale.pl) on the ExPasy
molecular biology server.
[0451] These profiles: FIG. 11, Hydrophilicity, (Hopp T. P., Woods
K. R., 1981. Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828); FIG. 12,
Hydropathicity, (Kyte J., Doolittle R. F., 1982. J. Mol. Biol.
157:105-132); FIG. 13, Percentage Accessible Residues (Janin J.,
1979 Nature 277:491-492); FIG. 14, Average Flexibility, (Bhaskaran
R., and Ponnuswamy P. K., 1988. Int. J. Pept. Protein Res.
32:242-255); FIG. 15, Beta-turn (Deleage, G., Roux B. 1987 Protein
Engineering 1:289-294); and optionally others available in the art,
such as on the ProtScale website, were used to identify antigenic
regions of the 158P1D7 protein. Each of the above amino acid
profiles of 158P1D7 were generated using the following ProtScale
parameters for analysis: 1) A window size of 9; 2) 100% weight of
the window edges compared to the window center; and, 3) amino acid
profile values normalized to lie between 0 and 1.
[0452] Hydrophilicity (FIG. 11), Hydropathicity (FIG. 12) and
Percentage Accessible Residues (FIG. 13) profiles were used to
determine stretches of hydrophilic amino acids (i.e., values
greater than 0.5 on the Hydrophilicity and Percentage Accessible
Residues profile, and values less than 0.5 on the Hydropathicity
profile). Such regions are likely to be exposed to the aqueous
environment, be present on the surface of the protein, and thus
available for immune recognition, such as by antibodies.
[0453] Average Flexibility (FIG. 14) and Beta-turn (FIG. 15)
profiles determine stretches of amino acids (i.e., values greater
than 0.5 on the Beta-turn profile and the Average Flexibility
profile) that are not constrained in secondary structures such as
beta sheets and alpha helices. Such regions are also more likely to
be exposed on the protein and thus accessible to immune
recognition, such as by antibodies.
[0454] Antigenic sequences of the 158P1D7 protein indicated, e.g.,
by the profiles set forth in FIG. 11, FIG. 12, FIG. 13, FIG. 14, or
FIG. 15 are used to prepare immunogens, either peptides or nucleic
acids that encode them, to generate therapeutic and diagnostic
anti-158P1D7 antibodies. The immunogen can be any 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25, 25, 30,
35, 40, 45, 50 or more than 50 contiguous amino acids, or the
corresponding nucleic acids that encode them, from the 158P1D7
protein. In particular, peptide immunogens of the invention can
comprise, a peptide region of at least 5 amino acids of FIG. 2 in
any whole number increment up to 841 that includes an amino acid
position having a value greater than 0.5 in the Hydrophilicity
profile of FIG. 11; a peptide region of at least 5 amino acids of
FIG. 2 in any whole number increment up to 841 that includes an
amino acid position having a value less than 0.5 in the
Hydropathicity profile of FIG. 12; a peptide region of at least 5
amino acids of FIG. 2 in any whole number increment up to 841 that
includes an amino acid position having a value greater than 0.5 in
the Percent Accessible Residues profile of FIG. 13; a peptide
region of at least 5 amino acids of FIG. 2 in any whole number
increment up to 841 that includes an amino acid position having a
value greater than 0.5 in the Average Flexibility profile on FIG.
14; and, a peptide region of at least 5 amino acids of FIG. 2 in
any whole number increment up to 841 that includes an amino acid
position having a value greater than 0.5 in the Beta-turn profile
of FIG. 15. Peptide immunogens of the invention can also comprise
nucleic acids that encode any of the forgoing. All immunogens of
the invention, peptide or nucleic acid, can be embodied in human
unit dose form, or comprised by a composition that includes a
pharmaceutical excipient compatible with human physiology.
Example 8
Generation of 158P1D7 Polyclonal Antibodies
[0455] Polyclonal antibodies can be raised in a mammal, for
example, by one or more injections of an immunizing agent and, if
desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. In addition to immunizing with the full
length 158P1D7 protein, computer algorithms are employed in design
of immunogens that, based on amino acid sequence analysis contain
characteristics of being antigenic and available for recognition by
the immune system of the immunized host (see the Example entitled
"Antigenicity Profiles"). Such regions would be predicted to be
hydrophilic, flexible, in beta-turn conformations, and be exposed
on the surface of the protein (see, e.g., FIG. 11, FIG. 12, FIG.
13, FIG. 14, or FIG. 15 for amino acid profiles that indicate such
regions of 158P1D7).
[0456] For example, 158P1D7 recombinant bacterial fusion proteins
or peptides encoding hydrophilic, flexible, beta-turn regions of
the 158P1D7 sequence, such as amino acids 2545 and 250-385 are used
as antigens to generate polyclonal antibodies in New Zealand White
rabbits. It is useful to conjugate the immunizing agent to a
protein known to be immunogenic in the mammal being immunized.
Examples of such immunogenic proteins include, but are not limited
to, keyhole limpet hemocyanin (KLH), serum albumin, bovine
thyroglobulin, and soybean trypsin inhibitor: In one embodiment, a
peptide encoding amino acids 25-45 of 158P1D7 is conjugated to KLH
and used to immunize the rabbit. Alternatively the immunizing agent
may include all or portions of the 158P1D7 protein, analogs or
fusion proteins thereof. For example, the 158P1D7 amino acid
sequence can be fused using recombinant DNA techniques to any one
of a variety of fusion protein partners that are well known in the
art, such as glutathione-S-transferase (GST) and HIS tagged fusion
proteins. Such fusion proteins are purified from induced bacteria
using the appropriate affinity matrix. In one embodiment, a
GST-fusion protein encoding amino acids 250-385 of 158P1D7 is
produced and purified, and a cleavage product is generated in which
GST sequences are removed by proteolytic cleavage. This cleaved
158P1D7 protein is used as immunogen. Other recombinant bacterial
fusion proteins that may be employed include maltose binding
protein, LacZ, thioredoxin, NusA, or an immunoglobulin constant
region (see the section entitled "Production of 158P1D7 in
Prokaryotic Systems" and Current Protocols In Molecular Biology,
Volume 2, Unit 16, Frederick M. Ausubul et al. eds., 1995; Linsley,
P. S., Brady, W., Urnes, M., Grosmaire, L., Damle, N., and
Ledbetter, L.(1991) J. Exp. Med. 174, 561-566).
[0457] In addition to bacterial derived fusion proteins, mammalian
expressed protein antigens are also used. These antigens are
expressed from mammalian expression vectors such as the Tag5 and
Fc-fusion vectors (see the section entitled "Production of
Recombinant 158P1D7 in Eukaryotic Systems"), and retain
post-translational modifications such as glycosylations found in
native 158P1D7 protein. In one embodiment, the predicted
extracellular domain of 158P1D7, amino acids 1-614, is cloned into
the Tag5 mammalian secretion vector. The recombinant protein is
purified by metal chelate chromatography from tissue culture
supernatants of 293T cells stably expressing the recombinant
vector. The purified Tag5 158P1D7 extracellular domain is then used
as immunogen.
[0458] During the immunization protocol, it is useful to mix or
emulsify the antigen in adjuvants that enhance the immune response
of the host animal. Examples of adjuvants include, but are not
limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
[0459] In a typical immunization protocol, rabbits are initially
injected subcutaneously with up to 200 .mu.g, typically 100-200
.mu.g, of fusion protein or peptide conjugated to KLH mixed in
complete Freund's adjuvant (CFA). Rabbits are then injected
subcutaneously every two weeks with up to 200 .mu.g, typically
100-200 .mu.g, of the immunogen in incomplete Freund's adjuvant
(IFA). Test bleeds are taken approximately 7-10 days following each
immunization and used to monitor the titer of the antiserum by
ELISA.
[0460] To test serum, such as rabbit serum, for reactivity with
158P1D7 proteins, the full-length 158P1D7 cDNA can be cloned into
an expression vector such as one that provides a 6.times. His tag
at the carboxyl-terminus (pCDNA 3.1 myc-his, Invitrogen, see the
Example entitled "Production of Recombinant 158P1D7 in Eukaryotic
Systems"). After transfection of the constructs into 293T cells,
cell lysates are probed with the anti-158P1D7 serum and with
anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, Calif.)
to determine specific reactivity to denatured 158P1D7 protein using
the Western blot technique. In addition, recognition of native
protein by the antiserum can be determined by immunoprecipitation
and flow cytometric analyses of 293T and other recombinant
158P1D7-expressing cells. Alternatively, specificity of the
antiserum is tested by Western blot, immunoprecipitation,
fluorescent microscopy, and flow cytometric techniques using cells
that endogenously express 158P1D7.
[0461] Sera from rabbits immunized with fusion proteins, such as
GST and MBP fusion proteins, are purified by depletion of
antibodies reactive to GST, MBP, or other fusion partner sequence
by passage over an affinity column containing the fusion partner
either alone or in the context of an irrelevant fusion protein.
Sera from His-tagged protein and peptide immunized rabbits as well
as fusion partner depleted sera are further purified by passage
over an affinity column composed of the original protein immunogen
or free peptide coupled to Affigel matrix (BioRad).
Example 9
Generation of 158P1D7 Monoclonal Antibodies (mAbs)
[0462] In one embodiment, therapeutic mAbs to 158P1D7 comprise
those that react with epitopes of the protein that would disrupt or
modulate the biological function of 158P1D7, for example those that
would disrupt its interaction with ligands or proteins that mediate
or are involved in its biological activity. Therapeutic mAbs also
comprise those which specifically bind epitopes of 158P1D7 exposed
on the cell surface and thus are useful in targeting mAb-toxin
conjugates. Immunogens for generation of such mAbs include those
designed to encode or contain the entire 158P1D7 protein or regions
of the 158P1D7 protein predicted to be antigenic from computer
analysis of the amino acid sequence (see, e.g., FIG. 11, FIG. 12,
FIG. 13, FIG. 14, or FIG. 15, and the Example entitled
"Antigenicity Profiles"). Immunogens include peptides, recombinant
bacterial proteins, and mammalian expressed Tag 5 proteins and
human and murine IgG FC fusion proteins. In addition, cells
expressing high levels of 158P1D7, such as 293T-158P1D7 cells, are
used to immunize mice.
[0463] To generate mAbs to 158P1D7, mice are first immunized
intraperitoneally (IP) with, typically, 10-50 .mu.g of protein
immunogen or 10.sup.7 158P1D7-expressing cells mixed in complete
Freund's adjuvant. Mice are then subsequently immunized IP every
2-4 weeks with, typically, 10-50 .mu.g of protein immunogen or
10.sup.7 cells mixed in incomplete Freund's adjuvant.
Alternatively, MPL-TDM adjuvant is used in immunizations. In
addition to the above protein and cell-based immunization
strategies, a DNA-based immunization protocol is employed in which
a mammalian expression vector encoding 158P1D7 sequence is used to
immunize mice by direct injection of the plasmid DNA. For example,
the extracellular domain of 158P1D7, amino acids 1-614, is cloned
into the Tag5 mammalian secretion vector and the recombinant vector
is used as immunogen. In another example, the nucleic acid sequence
encoding amino acids 250-385 of 158P1D7 (predicted to be antigenic
from sequence analysis, see, e.g., FIG. 11, FIG. 12, FIG. 13, FIG.
14 or FIG. 15) is cloned into an Fc-fusion secretion vector in
which the 158P1D7 sequence is fused at the amino-terminus to an IgK
leader sequence and at the carboxyl-terminus to the coding sequence
of the murine or human IgG Fc region. This recombinant vector is
then used as immunogen. The plasmid immunization protocols are used
in combination with purified proteins expressed from the same
vector and with cells expressing 158P1D7.
[0464] During the immunization protocol, test bleeds are taken 7-10
days following an injection to monitor titer and specificity of the
immune response. Once appropriate reactivity and specificity is
obtained as determined by ELISA, Western blotting,
immunoprecipitation, fluorescence microscopy, and flow cytometric
analyses, fusion and hybridoma generation is then carried out with
established procedures well known in the art (see, e.g., Harlow and
Lane, 1988).
[0465] In one embodiment for generating 158P1D7 monoclonal
antibodies, a glutathione-S-transferase (GST) fusion protein
encoding amino acids 250-385 of 158P1D7 protein is expressed and
purified. A cleavage fragment encoding 158P1D7 specific amino acids
is then used as immunogen in which GST is removed by site-specific
proteolysis. Balb C mice are initially immunized intraperitoneally
with 25 .mu.g of the 158P1D7 cleavage protein mixed in complete
Freund's adjuvant. Mice are subsequently immunized every two weeks
with 25 .mu.g of 158P1D7 cleavage protein mixed in incomplete
Freund's adjuvant for a total of three immunizations. The titer of
serum from immunized mice is determined by ELISA using the full
length GST-fusion protein and the cleaved immunogen. Reactivity and
specificity of serum to full length 158P1D7 protein is monitored by
Western blotting, immunoprecipitation and flow cytometry using 293T
cells transfected with an expression vector encoding the 158P1D7
cDNA (see e.g., the Example entitled "Production of Recombinant
158P1D7 in Eukaryotic Systems"). Other recombinant
158P1D7-expressing cells or cells endogenously expressing 158P1D7
are also used. Mice showing the strongest reactivity are rested and
given a final injection of 158P1D7 cleavage protein in PBS and then
sacrificed four days later. The spleens of the sacrificed mice are
harvested and fused to SPO/2 myeloma cells using standard
procedures (Harlow and Lane, 1988). Supernatants from growth wells
following HAT selection are screened by ELISA, Western blot,
immunoprecipitation, fluorescent microscopy, and flow cytometry to
identify 158P1D7 specific antibody-producing clones.
[0466] The binding affinity of a 158P1D7 monoclonal antibody is
determined using standard technologies. Affinity measurements
quantify the strength of antibody to epitope binding and are used
to help define which 158P1D7 monoclonal antibodies preferred for
diagnostic or therapeutic use, as appreciated by one of skill in
the art. The BIAcore system (Uppsala, Sweden) is a preferred method
for determining binding affinity. The BIAcore system uses surface
plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1;
Morton and Myszka, 1998, Methods in Enzymology 295:268) to monitor
biomolecular interactions in real time. BIAcore analysis
conveniently generates association rate constants, dissociation
rate constants, equilibrium dissociation constants, and affinity
constants.
Example 10
HLA Class I and Class II Binding Assays
[0467] HLA class I and class II binding assays using purified HLA
molecules are performed in accordance with disclosed protocols
(e.g., PCT publications WO 94/20127 and WO 94/03205; Sidney et al.,
Current Protocols in Immunology 18.3.1 (1998); Sidney, et al., J.
Immunol. 154:247 (1995); Sette, et al., Mol. Immunol. 31:813
(1994)). Briefly, purified MHC molecules (5 to 500 nM) are
incubated with various unlabeled peptide inhibitors and 1-10 nM
.sup.125I-radiolabeled probe peptides as described. Following
incubation, MHC-peptide complexes are separated from free peptide
by gel filtration and the fraction of peptide bound is determined.
Typically, in preliminary experiments, each MHC preparation is
titered in the presence of fixed amounts of radiolabeled peptides
to determine the concentration of HLA molecules necessary to bind
10-20% of the total radioactivity. All subsequent inhibition and
direct binding assays are performed using these HLA
concentrations.
[0468] Since under these conditions [label]<[HLA] and
IC.sub.50.gtoreq.[HLA], the measured IC.sub.50 values are
reasonable approximations of the true K.sub.D values. Peptide
inhibitors are typically tested at concentrations ranging from 120
.mu.g/ml to 1.2 ng/ml, and are tested in two to four completely
independent experiments. To allow comparison of the data obtained
in different experiments, a relative binding figure is calculated
for each peptide by dividing the IC.sub.50 of a positive control
for inhibition by the IC.sub.50 for each tested peptide (typically
unlabeled versions of the radiolabeled probe peptide). For database
purposes, and inter-experiment comparisons, relative binding values
are compiled. These values can subsequently be converted back into
IC.sub.50 nM values by dividing the IC.sub.50 nM of the positive
controls for inhibition by the relative binding of the peptide of
interest. This method of data compilation is accurate and
consistent for comparing peptides that have been tested on
different days, or with different lots of purified MHC.
[0469] Binding assays as outlined above may be used to analyze HLA
supermotif and/or HLA motif-bearing peptides.
Example 11
Identification of HLA Supermotif- and Motif-Bearing CTL Candidate
Epitopes
[0470] HLA vaccine compositions of the invention can include
multiple epitopes. The multiple epitopes can comprise multiple HLA
supermotifs or motifs to achieve broad population coverage. This
example illustrates the identification and confirmation of
supermotif- and motif-bearing epitopes for the inclusion in such a
vaccine composition. Calculation of population coverage is
performed using the strategy described below.
[0471] Computer Searches and Algorithms for Identification of
Supermotif and/or Motif-Bearing Epitopes
[0472] The searches performed to identify the motif-bearing peptide
sequences in the Example entitled "Antigenicity Profiles" and
Tables V-XVIII employ the protein sequence data from the gene
product of 158P1D7 set forth in FIGS. 2 and 3.
[0473] Computer searches for epitopes bearing HLA Class I or Class
II supermotifs or motifs are performed as follows. All translated
158P1D7 protein sequences are analyzed using a text string search
software program to identify potential peptide sequences containing
appropriate HLA binding motifs; such programs are readily produced
in accordance with information in the art in view of known
motif/supermotif disclosures. Furthermore, such calculations can be
made mentally.
[0474] Identified A2-, A3-, and DR-supermotif sequences are scored
using polynomial algorithms to predict their capacity to bind to
specific HLA-Class I or Class II molecules. These polynomial
algorithms account for the impact of different amino acids at
different positions, and are essentially based on the premise that
the overall affinity (or .DELTA.G) of peptide-HLA molecule
interactions can be approximated as a linear polynomial function of
the type:
".DELTA.G"=a.sub.1i.times.a.sub.2i.times.a.sub.3i . . .
.times.a.sub.ni
[0475] where a.sub.ji is a coefficient which represents the effect
of the presence of a given amino acid (j) at a given position (i)
along the sequence of a peptide of n amino acids. The crucial
assumption of this method is that the effects at each position are
essentially independent of each other (i.e., independent binding of
individual side-chains). When residue j occurs at position i in the
peptide, it is assumed to contribute a constant amount j.sub.i to
the free energy of binding of the peptide irrespective of the
sequence of the rest of the peptide.
[0476] The method of derivation of specific algorithm coefficients
has been described in Gulukota et al., J. Mol. Biol. 267:1258-126,
1997; (see also Sidney et al., Human Immunol. 45:79-93, 1996; and
Southwood et al., J. Immunol. 160:3363-3373, 1998). Briefly, for
all i positions, anchor and non-anchor alike, the geometric mean of
the average relative binding (ARB) of all peptides carrying j is
calculated relative to the remainder of the group, and used as the
estimate of j.sub.i. For Class II peptides, if multiple alignments
are possible, only the highest scoring alignment is utilized,
following an iterative procedure. To calculate an algorithm score
of a given peptide in a test set, the ARB values corresponding to
the sequence of the peptide are multiplied. If this product exceeds
a chosen threshold, the peptide is predicted to bind. Appropriate
thresholds are chosen as a function of the degree of stringency of
prediction desired.
[0477] Selection of HLA-A2 Supertype Cross-Reactive Peptides
[0478] Complete protein sequences from 158P1D7 are scanned
utilizing motif identification software, to identify 8-, 9- 10- and
11-mer sequences containing the HLA-A2-supermotif main anchor
specificity. Typically, these sequences are then scored using the
protocol described above and the peptides corresponding to the
positive-scoring sequences are synthesized and tested for their
capacity to bind purified HLA-A*0201 molecules in vitro (HLA-A*0201
is considered a prototype A2 supertype molecule).
[0479] These peptides are then tested for the capacity to bind to
additional A2-supertype molecules (A*0202, A*0203, A*0206, and
A*6802). Peptides that bind to at least three of the five
A2-supertype alleles tested are typically deemed A2-supertype
cross-reactive binders. Preferred peptides bind at an affinity
equal to or less than 500 nM to three or more HLA-A2 supertype
molecules.
[0480] Selection of HLA-A3 Supermotif-Bearing Epitopes
[0481] The 158P1D7 protein sequence scanned above is also examined
for the presence of peptides with the HLA-A3-supermotif primary
anchors. Peptides corresponding to the HLA A3 supermotif-bearing
sequences are then synthesized and tested for binding to HLA-A*0301
and HLA-A*1101 molecules, the molecules encoded by the two most
prevalent A3-supertype alleles. The peptides that bind at least one
of the two alleles with binding affinities of .ltoreq.500 nM, often
.ltoreq.200 nM, are then tested for binding cross-reactivity to the
other common A3-supertype alleles (e.g., A*3101, A*3301, and
A*6801) to identify those that can bind at least three of the five
HLA-A3-supertype molecules tested.
[0482] Selection of HLA-B7 Supermotif Bearing Epitopes
[0483] The 158P1D7 protein is also analyzed for the presence of 8-,
9- 10-, or 1-mer peptides with the HLA-B7-supermotif Corresponding
peptides are synthesized and tested for binding to HLA-B*0702, the
molecule encoded by the most common B7-supertype allele (i.e., the
prototype B7 supertype allele). Peptides binding B*0702 with
IC.sub.50 of .ltoreq.500 nM are identified using standard methods.
These peptides are then tested for binding to other common
B7-supertype molecules (e.g., B*3501, B*5101, B*5301, and B*5401).
Peptides capable of binding to three or more of the five
B7-supertype alleles tested are thereby identified.
[0484] Selection of A1 and A24 Motif-Bearing Epitopes
[0485] To further increase population coverage, HLA-A1 and -A24
epitopes can also be incorporated into vaccine compositions. An
analysis of the 158P1D7 protein can also be performed to identify
HLA-A1- and A24-motif-containing sequences.
[0486] High affinity and/or cross-reactive binding epitopes that
bear other motif and/or supermotifs are identified using analogous
methodology.
Example 12
Confirmation of Immunogenicity
[0487] Cross-reactive candidate CTL A2-supermotif-bearing peptides
that are identified as described herein are selected to confirm in
vitro immunogenicity. Confirmation is performed using the following
methodology:
[0488] Target Cell Lines for Cellular Screening:
[0489] The 0.221A2.1 cell line, produced by transferring the
HLA-A2.1 gene into the HLA-A, -B, -C null mutant human
B-lymphoblastoid cell line 721.221, is used as the peptide-loaded
target to measure activity of HLA-A2.1-restricted CTL. This cell
line is grown in RPMI-1640 medium supplemented with antibiotics,
sodium pyruvate, nonessential amino acids and 10% (v/v) heat
inactivated FCS. Cells that express an antigen of interest, or
transfectants comprising the gene encoding the antigen of interest,
can be used as target cells to confirm the ability of
peptide-specific CTLs to recognize endogenous antigen.
[0490] Primary CTL Induction Cultures:
[0491] Generation of Dendritic Cells (DC): PBMCs are thawed in RPMI
with 30 .mu.g/ml DNAse, washed twice and resuspended in complete
medium (RPMI-1640 plus 5% AB human serum, non-essential amino
acids, sodium pyruvate, L-glutamine and penicillin/streptomycin).
The monocytes are purified by plating 10.times.10.sup.6 PBMC/well
in a 6-well plate. After 2 hours at 37.degree. C., the non-adherent
cells are removed by gently shaking the plates and aspirating the
supernatants. The wells are washed a total of three times with 3 ml
RPMI to remove most of the non-adherent and loosely adherent cells.
Three ml of complete medium containing 50 ng/ml of GM-CSF and 1,000
U/ml of IL-4 are then added to each well. TNF.alpha. is added to
the DCs on day 6 at 75 ng/ml and the cells are used for CTL
induction cultures on day 7.
[0492] Induction of CTL with DC and Peptide: CD8+ T-cells are
isolated by positive selection with Dynal immunomagnetic beads
(Dynabeads.RTM. M-450) and the detacha-bead.RTM. reagent. Typically
about 200-250.times.10.sup.6 PBMC are processed to obtain
24.times.10.sup.6 CD8+ T-cells (enough for a 48-well plate
culture). Briefly, the PBMCs are thawed in RPMI with 30 .mu.g/ml
DNAse, washed once with PBS containing 1% human AB serum and
resuspended in PBS/1% AB serum at a concentration of
20.times.10.sup.6cells/ml. The magnetic beads are washed 3 times
with PBS/AB serum, added to the cells (140 .mu.l
beads/20.times.10.sup.6 cells) and incubated for 1 hour at
4.degree. C. with continuous mixing. The beads and cells are washed
4.times. with PBS/AB serum to remove the nonadherent cells and
resuspended at 100.times.10.sup.6 cells/ml (based on the original
cell number) in PBS/AB serum containing 100 .mu.l/m
detacha-bead.RTM. reagent and 30 .mu.g/ml DNAse. The mixture is
incubated for 1 hour at room temperature with continuous mixing.
The beads are washed again with PBS/AB/DNAse to collect the CD8+
T-cells. The DC are collected and centrifuged at 1300 rpm for 5-7
minutes, washed once with PBS with 1% BSA, counted and pulsed with
40 .mu.g/ml of peptide at a cell concentration of
1-2.times.10.sup.6/ml in the presence of 3 .mu.g/ml
.beta..sub.2-microglobulin for 4 hours at 20.degree. C. The DC are
then irradiated (4,200 rads) washed 1 time with medium and counted
again.
[0493] Setting up induction cultures: 0.25 ml cytokine-generated DC
(at 1.times.10.sup.5 cells/ml) are co-cultured with 0.25 ml of CD8+
T-cells (at 2.times.10.sup.6 cell/ml) in each well of a 48-well
plate in the presence of 10 ng/ml of IL-7. Recombinant human IL-10
is added the next day at a final concentration of 10 ng/ml and
rhuman IL-2 is added 48 hours later at 10 IU/ml.
[0494] Restimulation of the induction cultures with peptide-pulsed
adherent cells: Seven and fourteen days after the primary
induction, the cells are restimulated with peptide-pulsed adherent
cells. The PBMCs are thawed and washed twice with RPMI and DNAse.
The cells are resuspended at 5.times.10.sup.6 cells/ml and
irradiated at .about.4200 rads. The PBMCs are plated at
2.times.10.sup.6 in 0.5 ml complete medium per well and incubated
for 2 hours at 37.degree. C. The plates are washed twice with RPMI
by tapping the plate gently to remove the nonadherent cells and the
adherent cells pulsed with 10 .mu.g/ml of peptide in the presence
of 3 .mu.g/ml .beta..sub.2 microglobulin in 0.25 ml RPMI/5% AB per
well for 2 hours at 37.degree. C. Peptide solution from each well
is aspirated and the wells are washed once with RPMI. Most of the
media is aspirated from the induction cultures (CD8+ cells) and
brought to 0.5 ml with fresh media. The cells are then transferred
to the wells containing the peptide-pulsed adherent cells. Twenty
four hours later recombinant human IL-10 is added at a final
concentration of 10 ng/ml and recombinant human IL2 is added the
next day and again 2-3 days later at 50 IU/ml (Tsai et al.,
Critical Reviews in Immunology 18(1-2):65-75, 1998). Seven days
later, the cultures are assayed for CTL activity in a 51Cr release
assay. In some experiments the cultures are assayed for
peptide-specific recognition in the in situ IFN.gamma. ELISA at the
time of the second restimulation followed by assay of endogenous
recognition 7 days later. After expansion, activity is measured in
both assays for a side-by-side comparison.
[0495] Measurement of CTL Lytic Activity by .sup.51Cr Release.
[0496] Seven days after the second restimulation, cytotoxicity is
determined in a standard (5 hr) 51Cr release assay by assaying
individual wells at a single E:T. Peptide-pulsed targets are
prepared by incubating the cells with 10 .mu.g/ml peptide overnight
at 37.degree. C.
[0497] Adherent target cells are removed from culture flasks with
trypsin-EDTA. Target cells are labelled with 200 .mu.Ci of
.sup.51Cr sodium chromate (Dupont, Wilmington, Del.) for 1 hour at
37.degree. C. Labelled target cells are resuspended at 10.sup.6 per
ml and diluted 1:10 with K562 cells at a concentration of
3.3.times.10.sup.6/ml (an NK-sensitive erythroblastoma cell line
used to reduce non-specific lysis). Target cells (100 .mu.l) and
effectors (100 .mu.l) are plated in 96 well round-bottom plates and
incubated for 5 hours at 37.degree. C. At that time, 100 .mu.l of
supernatant are collected from each well and percent lysis is
determined according to the formula: [(cpm of the test sample-cpm
of the spontaneous .sup.51Cr release sample)/(cpm of the maximal
.sup.51Cr release sample-cpm of the spontaneous .sup.51Cr release
sample)].times.100.
[0498] Maximum and spontaneous release are determined by incubating
the labelled targets with 1% Trition X-100 and media alone,
respectively. A positive culture is defined as one in which the
specific lysis (sample-background) is 10% or higher in the case of
individual wells and is 15% or more at the two highest E:T ratios
when expanded cultures are assayed.
[0499] In situ Measurement of Human IFN.gamma. Production as an
Indicator of Peptide-Specific and Endogenous Recognition
[0500] Immulon 2 plates are coated with mouse anti-human IFN.gamma.
monoclonal antibody (4 .mu.g/ml 0.1M NaHCO.sub.3, pH8.2) overnight
at 4.degree. C. The plates are washed with Ca.sup.2+,
Mg.sup.2+-free PBS/0.05% Tween 20 and blocked with PBS/10% FCS for
two hours, after which the CTLs (100 .mu.l/well) and targets (100
.mu.l/well) are added to each well, leaving empty wells for the
standards and blanks (which received media only). The target cells,
either peptide-pulsed or endogenous targets, are used at a
concentration of 1.times.10.sup.6 cells/ml. The plates are
incubated for 48 hours at 37.degree. C. with 5% CO.sub.2.
[0501] Recombinant human IFN-gamma is added to the standard wells
starting at 400 pg or 1200 pg/100 microliter/well and the plate
incubated for two hours at 37.degree. C. The plates are washed and
100 .mu.l of biotinylated mouse anti-human IFN-gamma monoclonal
antibody (2 microgram/ml in PBS/3% FCS/0.05% Tween 20) are added
and incubated for 2 hours at room temperature. After washing again,
100 microliter HRP-streptavidin (1:4000) are added and the plates
incubated for one hour at room temperature. The plates are then
washed 6.times. with wash buffer, 100 microliter/well developing
solution (TMB 1:1) are added, and the plates allowed to develop for
5-15 minutes. The reaction is stopped with 50 microliter/well 1M
H.sub.3PO.sub.4 and read at OD450. A culture is considered positive
if it measured at least 50 pg of IFN-gamma/well above background
and is twice the background level of expression.
[0502] CTL Expansion.
[0503] Those cultures that demonstrate specific lytic activity
against peptide-pulsed targets and/or tumor targets are expanded
over a two week period with anti-CD3. Briefly, 5.times.10.sup.4
CD8+ cells are added to a T25 flask containing the following:
1.times.10.sup.6 irradiated (4,200 rad) PBMC (autologous or
allogeneic) per ml, 2.times.10.sup.5 irradiated (8,000 rad)
EBV-transformed cells per ml, and OKT3 (anti-CD3) at 30 ng per ml
in RPMI-1640 containing 10% (v/v) human AB serum, non-essential
amino acids, sodium pyruvate, 25 .mu.M 2-mercaptoethanol,
L-glutamine and penicillin/streptomycin. Recombinant human IL2 is
added 24 hours later at a final concentration of 200 IU/ml and
every three days thereafter with fresh media at 50 IU/ml. The cells
are split if the cell concentration exceeds 1.times.10.sup.6/ml and
the cultures are assayed between days 13 and 15 at E:T ratios of
30, 10, 3 and 1:1 in the .sup.51Cr release assay or at
1.times.10.sup.6/ml in the in situ IFN.gamma. assay using the same
targets as before the expansion.
[0504] Cultures are expanded in the absence of anti-CD3.sup.+ as
follows. Those cultures that demonstrate specific lytic activity
against peptide and endogenous targets are selected and
5.times.10.sup.4 CD8.sup.+ cells are added to a T25 flask
containing the following: 1.times.10.sup.6 autologous PBMC per ml
which have been peptide-pulsed with 10 .mu.g/ml peptide for two
hours at 37.degree. C. and irradiated (4,200 rad); 2.times.10.sup.5
irradiated (8,000 rad) EBV-transformed cells per ml RPMI-1640
containing 10% (v/v) human AB serum, non-essential AA, sodium
pyruvate, 25 mM 2-ME, L-glutamine and gentamicin.
[0505] Immunogenicity of A2 Supermotif-Bearing Peptides
[0506] A2-supermotif cross-reactive binding peptides are tested in
the cellular assay for the ability to induce peptide-specific CTL
in normal individuals. In this analysis, a peptide is typically
considered to be an epitope if it induces peptide-specific CTLs in
at least individuals, and preferably, also recognizes the
endogenously expressed peptide.
[0507] Immunogenicity can also be confirmed using PBMCs isolated
from patients bearing a tumor that expresses 158P1D7. Briefly,
PBMCs are isolated from patients, re-stimulated with peptide-pulsed
monocytes and assayed for the ability to recognize peptide-pulsed
target cells as well as transfected cells endogenously expressing
the antigen.
[0508] Evaluation of A*03/A11 Immunogenicity
[0509] HLA-A3 supermotif-bearing cross-reactive binding peptides
are also evaluated for immunogenicity using methodology analogous
for that used to evaluate the immunogenicity of the HLA-A2
supermotif peptides.
[0510] Evaluation of B7 Immunogenicity
[0511] Immunogenicity screening of the B7-supertype cross-reactive
binding peptides identified as set forth herein are confirmed in a
manner analogous to the confirmation of A2-and
A3-supermotif-bearing peptides.
[0512] Peptides bearing other supermotifs/motifs, e.g., HLA-A1,
HLA-A24 etc. are also confirmed using similar methodology
Example 13
Implementation of the Extended Supermotif to Improve the Binding
Capacity of Native Epitopes by Creating Analogs
[0513] HLA motifs and supermotifs (comprising primary and/or
secondary residues) are useful in the identification and
preparation of highly cross-reactive native peptides, as
demonstrated herein. Moreover, the definition of HLA motifs and
supermotifs also allows one to engineer highly cross-reactive
epitopes by identifying residues within a native peptide sequence
which can be analoged to confer upon the peptide certain
characteristics, e.g. greater cross-reactivity within the group of
HLA molecules that comprise a supertype, and/or greater binding
affinity for some or all of those HLA molecules. Examples of
analoging peptides to exhibit modulated binding affinity are set
forth in this example.
[0514] Analoging at Primary Anchor Residues
[0515] Peptide engineering strategies are implemented to further
increase the cross-reactivity of the epitopes. For example, the
main anchors of A2-supermotif-bearing peptides are altered, for
example, to introduce a preferred L, I, V, or M at position 2, and
I or V at the C-terminus.
[0516] To analyze the cross-reactivity of the analog peptides, each
engineered analog is initially tested for binding to the prototype
A2 supertype allele A*0201, then, if A*0201 binding capacity is
maintained, for A2-supertype cross-reactivity.
[0517] Alternatively, a peptide is confirmed as binding one or all
supertype members and then analogued to modulate binding affinity
to any one (or more) of the supertype members to add population
coverage.
[0518] The selection of analogs for immunogenicity in a cellular
screening analysis is typically further restricted by the capacity
of the parent wild type (WT) peptide to bind at least weakly, i.e.,
bind at an IC.sub.50 of 5000 nM or less, to three of more A2
supertype alleles. The rationale for this requirement is that the
WT peptides must be present endogenously in sufficient quantity to
be biologically relevant. Analoged peptides have been shown to have
increased immunogenicity and cross-reactivity by T cells specific
for the parent epitope (see, e.g., Parkhurst et al., J. Immunol.
157:2539, 1996; and Pogue et al., Proc. Natl. Acad. Sci. USA
92:8166, 1995).
[0519] In the cellular screening of these peptide analogs, it is
important to confirm that analog-specific CTLs are also able to
recognize the wild-type peptide and, when possible, target cells
that endogenously express the epitope.
[0520] Analoging of HLA-A3 and B7-Supermotif-Bearing Peptides
[0521] Analogs of HLA-A3 supermotif-bearing epitopes are generated
using strategies similar to those employed in analoging HLA-A2
supermotif-bearing peptides. For example, peptides binding to 3/5
of the A3-supertype molecules are engineered at primary anchor
residues to possess a preferred residue (V, S, M, or A) at position
2.
[0522] The analog peptides are then tested for the ability to bind
A*03 and A*11 (prototype A3 supertype alleles). Those peptides that
demonstrate .ltoreq.500 nM binding capacity are then confirmed as
having A3-supertype cross-reactivity.
[0523] Similarly to the A2- and A3-motif bearing peptides, peptides
binding 3 or more B7-supertype alleles can be improved, where
possible, to achieve increased cross-reactive binding or greater
binding affinity or binding half life. B7 supermotif-bearing
peptides are, for example, engineered to possess a preferred
residue (V, I, L, or F) at the C-terminal primary anchor position,
as demonstrated by Sidney et al. (J. Immunol. 157:3480-3490,
1996).
[0524] Analoging at primary anchor residues of other motif and/or
supermotif-bearing epitopes is performed in a like manner.
[0525] The analog peptides are then be confirmed for
immunogenicity, typically in a cellular screening assay. Again, it
is generally important to demonstrate that analog-specific CTLs are
also able to recognize the wild-type peptide and, when possible,
targets that endogenously express the epitope.
[0526] Analoging at Secondary Anchor Residues
[0527] Moreover, HLA supermotifs are of value in engineering highly
cross-reactive peptides and/or peptides that bind HLA molecules
with increased affinity by identifying particular residues at
secondary anchor positions that are associated with such
properties. For example, the binding capacity of a B7
supermotif-bearing peptide with an F residue at position 1 is
analyzed. The peptide is then analoged to, for example, substitute
L for F at position 1. The analoged peptide is evaluated for
increased binding affinity, binding half life and/or increased
cross-reactivity. Such a procedure identifies analoged peptides
with enhanced properties.
[0528] Engineered analogs with sufficiently improved binding
capacity or cross-reactivity can also be tested for immunogenicity
in HLA-B7-transgenic mice, following for example, IFA immunization
or lipopeptide immunization. Analogued peptides are additionally
tested for the ability to stimulate a recall response using PBMC
from patients with 158P1D7-expressing tumors.
[0529] Other Analoguing Strategies
[0530] Another form of peptide analoguing, unrelated to anchor
positions, involves the substitution of a cysteine with
.alpha.-amino butyric acid. Due to its chemical nature, cysteine
has the propensity to form disulfide bridges and sufficiently alter
the peptide structurally so as to reduce binding capacity.
Substitution of .alpha.-amino butyric acid for cysteine not only
alleviates this problem, but has been shown to improve binding and
crossbinding capabilities in some instances (see, e.g., the review
by Sette et al., In: Persistent Viral Infections, Eds. R. Ahmed and
I. Chen, John Wiley & Sons, England, 1999).
[0531] Thus, by the use of single amino acid substitutions, the
binding properties and/or cross-reactivity of peptide ligands for
HLA supertype molecules can be modulated.
Example 14
Identification and Confirmation of 158P1D7-Derived Sequences with
HLA-DR Binding Motifs
[0532] Peptide epitopes bearing an HLA class II supermotif or motif
are identified and confirmed as outlined below using methodology
similar to that described for HLA Class I peptides.
[0533] Selection of HLA-DR-Supermotif-Bearing Epitopes.
[0534] To identify 158P1D7-derived, HLA class II HTL epitopes, the
158P1D7 antigen is analyzed for the presence of sequences bearing
an HLA-DR-motif or supermotif. Specifically, 15-mer sequences are
selected comprising a DR-supermotif, comprising a 9-mer core, and
three-residue N- and C-terminal flanking regions (15 amino acids
total).
[0535] Protocols for predicting peptide binding to DR molecules
have been developed (Southwood et al., J. Immunol. 160:3363-3373,
1998). These protocols, specific for individual DR molecules, allow
the scoring, and ranking, of 9-mer core regions. Each protocol not
only scores peptide sequences for the presence of DR-supermotif
primary anchors (i.e., at position 1 and position 6) within a 9-mer
core, but additionally evaluates sequences for the presence of
secondary anchors. Using allele-specific selection tables (see,
e.g., Southwood et al., ibid.), it has been found that these
protocols efficiently select peptide sequences with a high
probability of binding a particular DR molecule. Additionally, it
has been found that performing these protocols in tandem,
specifically those for DR1, DR4w4, and DR7, can efficiently select
DR cross-reactive peptides.
[0536] The 158P1D7-derived peptides identified above are tested for
their binding capacity for various common HLA-DR molecules. All
peptides are initially tested for binding to the DR molecules in
the primary panel: DR1, DR4w4, and DR7. Peptides binding at least
two of these three DR molecules are then tested for binding to
DR2w2 .beta.1, DR2w2 .beta.2, DR6w19, and DR9 molecules in
secondary assays. Finally, peptides binding at least two of the
four secondary panel DR molecules, and thus cumulatively at least
four of seven different DR molecules, are screened for binding to
DR4w15, DR5w11, and DR8w2 molecules in tertiary assays. Peptides
binding at least seven of the ten DR molecules comprising the
primary, secondary, and tertiary screening assays are considered
cross-reactive DR binders. 158P1D7-derived peptides found to bind
common HLA-DR alleles are of particular interest.
[0537] Selection of DR3 Motif Peptides
[0538] Because HLA-DR3 is an allele that is prevalent in Caucasian,
Black, and Hispanic populations, DR3 binding capacity is a relevant
criterion in the selection of HTL epitopes. Thus, peptides shown to
be candidates may also be assayed for their DR3 binding capacity.
However, in view of the binding specificity of the DR3 motif,
peptides binding only to DR3 can also be considered as candidates
for inclusion in a vaccine formulation.
[0539] To efficiently identify peptides that bind DR3, target
158P1D7 antigens are analyzed for sequences carrying one of the two
DR3-specific binding motifs reported by Geluk et al. (J. Immunol.
152:5742-5748, 1994). The corresponding peptides are then
synthesized and confirmed as having the ability to bind DR3 with an
affinity of 1 .mu.M or better, i.e., less than 1 .mu.M. Peptides
are found that meet this binding criterion and qualify as HLA class
II high affinity binders.
[0540] DR3 binding epitopes identified in this manner are included
in vaccine compositions with DR supermotif-bearing peptide
epitopes.
[0541] Similarly to the case of HLA class I motif-bearing peptides,
the class II motif-bearing peptides are analoged to improve
affinity or cross-reactivity. For example, aspartic acid at
position 4 of the 9-mer core sequence is an optimal residue for DR3
binding, and substitution for that residue often improves DR 3
binding.
Example 15
Immunogenicity of 158P1D7-Derived HTL Epitopes
[0542] This example determines immunogenic DR supermotif- and DR3
motif-bearing epitopes among those identified using the methodology
set forth herein.
[0543] Immunogenicity of HTL epitopes are confirmed in a manner
analogous to the determination of immunogenicity of CTL epitopes,
by assessing the ability to stimulate HTL responses and/or by using
appropriate transgenic mouse models. Immunogenicity is determined
by screening for: 1.) in vitro primary induction using normal PBMC
or 2.) recall responses from patients who have 158P1D7-expressing
tumors.
Example 16
Calculation of Phenotypic Frequencies of HLA-Supertypes in Various
Ethnic Backgrounds to Determine Breadth of Population Coverage
[0544] This example illustrates the assessment of the breadth of
population coverage of a vaccine composition comprised of multiple
epitopes comprising multiple supermotifs and/or motifs.
[0545] In order to analyze population coverage, gene frequencies of
HLA alleles are determined. Gene frequencies for each HLA allele
are calculated from antigen or allele frequencies utilizing the
binomial distribution formulae gf=1-(SQRT(1-af)) (see, e.g., Sidney
et al., Human Immunol. 45:79-93, 1996). To obtain overall
phenotypic frequencies, cumulative gene frequencies are calculated,
and the cumulative antigen frequencies derived by the use of the
inverse formula [af=1-(1-Cgf).sup.2].
[0546] Where frequency data is not available at the level of DNA
typing, correspondence to the serologically defined antigen
frequencies is assumed. To obtain total potential supertype
population coverage no linkage disequilibrium is assumed, and only
alleles confirmed to belong to each of the supertypes are included
(minimal estimates). Estimates of total potential coverage achieved
by inter-loci combinations are made by adding to the A coverage the
proportion of the non-A covered population that could be expected
to be covered by the B alleles considered (e.g., total=A+B*(1-A)).
Confirmed members of the A3-like supertype are A3, A11, A31,
A*3301, and A*6801. Although the A3-like supertype may also include
A34, A66, and A*7401, these alleles were not included in overall
frequency calculations. Likewise, confirmed members of the A2-like
supertype family are A*0201, A*0202, A*0203, A*0204, A*0205,
A*0206, A*0207, A*6802, and A*6901. Finally, the B7-like
supertype-confirmed alleles are: B7, B*3501-03, B51, B*5301,
B*5401, B*5501-2, B*5601, B*6701, and B*7801 (potentially also
B*1401, B*3504-06, B*4201, and B*5602).
[0547] Population coverage achieved by combining the A2-, A3- and
B7-supertypes is approximately 86% in five major ethnic groups.
Coverage may be extended by including peptides bearing the A1 and
A24 motifs. On average, A1 is present in 12% and A24 in 29% of the
population across five different major ethnic groups (Caucasian,
North American Black, Chinese, Japanese, and Hispanic). Together,
these alleles are represented with an average frequency of 39% in
these same ethnic populations. The total coverage across the major
ethnicities when A1 and A24 are combined with the coverage of the
A2-, A3- and B7-supertype alleles is >95%. An analagous approach
can be used to estimate population coverage achieved with
combinations of class II motif-bearing epitopes.
[0548] Immunogenicity studies in humans (e.g., Bertoni et al., J.
Clin. Invest. 100:503, 1997; Doolan et al., Immunity 7:97, 1997;
and Threlkeld et al., J. Immunol. 159:1648, 1997) have shown that
highly cross-reactive binding peptides are almost always recognized
as epitopes. The use of highly cross-reactive binding peptides is
an important selection criterion in identifying candidate epitopes
for inclusion in a vaccine that is immunogenic in a diverse
population.
[0549] With a sufficient number of epitopes (as disclosed herein
and from the art), an average population coverage is predicted to
be greater than 95% in each of five major ethnic populations. The
game theory Monte Carlo simulation analysis, which is known in the
art (see e.g., Osborne, M. J. and Rubinstein, A. "A course in game
theory" MIT Press, 1994), can be used to estimate what percentage
of the individuals in a population comprised of the Caucasian,
North American Black, Japanese, Chinese, and Hispanic ethnic groups
would recognize the vaccine epitopes described herein. A preferred
percentage is 90%. A more preferred percentage is 95%.
Example 17
CTL Recognition of Endogenously Processed Antigens after
Priming
[0550] This example confirms that CTL induced by native or analoged
peptide epitopes identified and selected as described herein
recognize endogenously synthesized, i.e., native antigens.
[0551] Effector cells isolated from transgenic mice that are
immunized with peptide epitopes, for example HLA-A2
supermotif-bearing epitopes, are re-stimulated in vitro using
peptide-coated stimulator cells. Six days later, effector cells are
assayed for cytotoxicity and the cell lines that contain
peptide-specific cytotoxic activity are further re-stimulated. An
additional six days later, these cell lines are tested for
cytotoxic activity on .sup.51Cr labeled Jurkat-A2.1/K.sup.b target
cells in the absence or presence of peptide, and also tested on
.sup.51Cr labeled target cells bearing the endogenously synthesized
antigen, i.e. cells that are stably transfected with 158P1D7
expression vectors.
[0552] The results demonstrate that CTL lines obtained from animals
primed with peptide epitope recognize endogenously synthesized
158P1D7 antigen. The choice of transgenic mouse model to be used
for such an analysis depends upon the epitope(s) that are being
evaluated. In addition to HLA-A*0201/K.sup.b transgenic mice,
several other transgenic mouse models including mice with human
A11, which may also be used to evaluate A3 epitopes, and B7 alleles
have been characterized and others (e.g., transgenic mice for
HLA-A1 and A24) are being developed. HLA-DR1 and HLA-DR3 mouse
models have also been developed, which may be used to evaluate HTL
epitopes.
Example 18
Activity of CTL-HTL Conjugated Epitopes in Transgenic Mice
[0553] This example illustrates the induction of CTLs and HTLs in
transgenic mice, by use of a 158P1D7-derived CTL and HTL peptide
vaccine compositions. The vaccine composition used herein comprise
peptides to be administered to a patient with a 158P1D7-expressing
tumor. The peptide composition can comprise multiple CTL and/or HTL
epitopes. The epitopes are identified using methodology as
described herein. This example also illustrates that enhanced
immunogenicity can be achieved by inclusion of one or more HTL
epitopes in a CTL vaccine composition; such a peptide composition
can comprise an HTL epitope conjugated to a CTL epitope. The CTL
epitope can be one that binds to multiple HLA family members at an
affinity of 500 nM or less, or analogs of that epitope. The
peptides may be lipidated, if desired.
[0554] Immunization procedures: Immunization of transgenic mice is
performed as described (Alexander et al., J. Immunol.
159:4753-4761, 1997). For example, A2/K.sup.b mice, which are
transgenic for the human HLA A2.1 allele and are used to confirm
the immunogenicity of HLA-A*0201 motif- or HLA-A2
supermotif-bearing epitopes, and are primed subcutaneously (base of
the tail) with a 0.1 ml of peptide in Incomplete Freund's Adjuvant,
or if the peptide composition is a lipidated CTL/HTL conjugate, in
DMSO/saline, or if the peptide composition is a polypeptide, in PBS
or Incomplete Freund's Adjuvant. Seven days after priming,
splenocytes obtained from these animals are restimulated with
syngenic irradiated LPS-activated lymphoblasts coated with
peptide.
[0555] Cell lines: Target cells for peptide-specific cytotoxicity
assays are Jurkat cells transfected with the HLA-A2.1/K.sup.b
chimeric gene (e.g., Vitiello et al., J. Exp. Med. 173:1007,
1991)
[0556] In vitro CTL activation: One week after priming, spleen
cells (30.times.10.sup.6 cells/flask) are co-cultured at 37.degree.
C. with syngeneic, irradiated (3000 rads), peptide coated
lymphoblasts (10.times.10.sup.6 cells/flask) in 10 ml of culture
medium/T25 flask. After six days, effector cells are harvested and
assayed for cytotoxic activity.
[0557] Assay for cytotoxic activity: Target cells (1.0 to
1.5.times.10.sup.6) are incubated at 37.degree. C. in the presence
of 200 .mu.l of .sup.51Cr. After 60 minutes, cells are washed three
times and resuspended in R10 medium. Peptide is added where
required at a concentration of 1 .mu.g/ml. For the assay, 10.sup.4
51Cr-labeled target cells are added to different concentrations of
effector cells (final volume of 200 .mu.l) in U-bottom 96-well
plates. After a six hour incubation period at 37.degree. C., a 0.1
ml aliquot of supernatant is removed from each well and
radioactivity is determined in a Micromedic automatic gamma
counter. The percent specific lysis is determined by the formula:
percent specific release=100.times.(experimental
release-spontaneous release)/(maximum release-spontaneous release).
To facilitate comparison between separate CTL assays run under the
same conditions, % .sup.51Cr release data is expressed as lytic
units/10.sup.6 cells. One lytic unit is arbitrarily defined as the
number of effector cells required to achieve 30% lysis of 10,000
target cells in a six hour .sup.51Cr release assay. To obtain
specific lytic units/10.sup.6, the lytic units/10.sup.6 obtained in
the absence of peptide is subtracted from the lytic units/10.sup.6
obtained in the presence of peptide. For example, if 30% .sup.51Cr
release is obtained at the effector (E): target (T) ratio of 50:1
(i.e., 5.times.10.sup.5 effector cells for 10,000 targets) in the
absence of peptide and 5:1 (i.e., 5.times.10.sup.4 effector cells
for 10,000 targets) in the presence of peptide, the specific lytic
units would be: [(1/50,000)-(1/500,000)].times.10.sup.6=18 LU.
[0558] The results are analyzed to assess the magnitude of the CTL
responses of animals injected with the immunogenic CTL/HTL
conjugate vaccine preparation and are compared to the magnitude of
the CTL response achieved using, for example, CTL epitopes as
outlined above in the Example entitled "Confirmation of
Immunogenicity". Analyses similar to this may be performed to
confirm the immunogenicity of peptide conjugates containing
multiple CTL epitopes and/or multiple HTL epitopes. In accordance
with these procedures, it is found that a CTL response is induced,
and concomitantly that an HTL response is induced upon
administration of such compositions.
Example 19
Selection of CTL and HTL Epitomes for Inclusion in an
158P1D7-Specific Vaccine
[0559] This example illustrates a procedure for selecting peptide
epitopes for vaccine compositions of the invention. The peptides in
the composition can be in the form of a nucleic acid sequence,
either single or one or more sequences (i.e., minigene) that
encodes peptide(s), or can be single and/or polyepitopic
peptides.
[0560] The following principles are utilized when selecting a
plurality of epitopes for inclusion in a vaccine composition. Each
of the following principles is balanced in order to make the
selection.
[0561] Epitopes are selected which, upon administration, mimic
immune responses that are correlated with 158P1D7 clearance. The
number of epitopes used depends on observations of patients who
spontaneously clear 158P1D7. For example, if it has been observed
that patients who spontaneously clear 158P1D7 generate an immune
response to at least three (3) from 158P1D7 antigen, then three or
four (34) epitopes should be included for HLA class I. A similar
rationale is used to determine HLA class II epitopes.
[0562] Epitopes are often selected that have a binding affinity of
an IC.sub.50 of 500 nM or less for an HLA class I molecule, or for
class II, an IC.sub.50 of 1000 nM or less; or HLA Class I peptides
with high binding scores from the BIMAS web site, at URL
bimas.dcrt.nih.gov/.
[0563] In order to achieve broad coverage of the vaccine through
out a diverse population, sufficient supermotif bearing peptides,
or a sufficient array of allele-specific motif bearing peptides,
are selected to give broad population coverage. In one embodiment,
epitopes are selected to provide at least 80% population coverage.
A Monte Carlo analysis, a statistical evaluation known in the art,
can be employed to assess breadth, or redundancy, of population
coverage.
[0564] When creating polyepitopic compositions, or a minigene that
encodes same, it is typically desirable to generate the smallest
peptide possible that encompasses the epitopes of interest. The
principles employed are similar, if not the same, as those employed
when selecting a peptide comprising nested epitopes. For example, a
protein sequence for the vaccine composition is selected because it
has maximal number of epitopes contained within the sequence, i.e.,
it has a high concentration of epitopes. Epitopes may be nested or
overlapping (i.e., frame shifted relative to one another). For
example, with overlapping epitopes, two 9-mer epitopes and one
10-mer epitope can be present in a 10 amino acid peptide. Each
epitope can be exposed and bound by an HLA molecule upon
administration of such a peptide. A multi-epitopic, peptide can be
generated synthetically, recombinantly, or via cleavage from the
native source. Alternatively, an analog can be made of this native
sequence, whereby one or more of the epitopes comprise
substitutions that alter the cross-reactivity and/or binding
affinity properties of the polyepitopic peptide. Such a vaccine
composition is administered for therapeutic or prophylactic
purposes. This embodiment provides for the possibility that an as
yet undiscovered aspect of immune system processing will apply to
the native nested sequence and thereby facilitate the production of
therapeutic or prophylactic immune response-inducing vaccine
compositions. Additionally such an embodiment provides for the
possibility of motif-bearing epitopes for an HLA makeup that is
presently unknown. Furthermore, this embodiment (absent the
creating of any analogs) directs the immune response to multiple
peptide sequences that are actually present in 158P1D7, thus
avoiding the need to evaluate any junctional epitopes. Lastly, the
embodiment provides an economy of scale when producing nucleic acid
vaccine compositions. Related to this embodiment, computer programs
can be derived in accordance with principles in the art, which
identify in a target sequence, the greatest number of epitopes per
sequence length.
[0565] A vaccine composition comprised of selected peptides, when
administered, is safe, efficacious, and elicits an immune response
similar in magnitude to an immune response that controls or clears
cells that bear or overexpress 158P1D7.
Example 20
Construction of "Minigene" Multi-Epitope DNA Plasmids
[0566] This example discusses the construction of a minigene
expression plasmid. Minigene plasmids may, of course, contain
various configurations of B cell, CTL and/or HTL epitopes or
epitope analogs as described herein.
[0567] A minigene expression plasmid typically includes multiple
CTL and HTL peptide epitopes. In the present example, HLA-A2, -A3,
-B7 supermotif-bearing peptide epitopes and HLA-A1 and -A24
motif-bearing peptide epitopes are used in conjunction with DR
supermotif-bearing epitopes and/or DR3 epitopes. HLA class I
supermotif or motif-bearing peptide epitopes derived 158P1D7, are
selected such that multiple supermotifs/motifs are represented to
ensure broad population coverage. Similarly, HLA class II epitopes
are selected from 158P1D7 to provide broad population coverage,
i.e. both HLA DR-1-4-7 supermotif-bearing epitopes and HLA DR-3
motif-bearing epitopes are selected for inclusion in the minigene
construct. The selected CTL and HTL epitopes are then incorporated
into a minigene for expression in an expression vector.
[0568] Such a construct may additionally include sequences that
direct the HTL epitopes to the endoplasmic reticulum. For example,
the Ii protein may be fused to one or more HTL epitopes as
described in the art, wherein the CLIP sequence of the Ii protein
is removed and replaced with an HLA class II epitope sequence so
that HLA class II epitope is directed to the endoplasmic reticulum,
where the epitope binds to an HLA class II molecules.
[0569] This example illustrates the methods to be used for
construction of a minigene-bearing expression plasmid. Other
expression vectors that may be used for minigene compositions are
available and known to those of skill in the art.
[0570] The minigene DNA plasmid of this example contains a
consensus Kozak sequence and a consensus murine kappa Ig-light
chain signal sequence followed by CTL and/or HTL epitopes selected
in accordance with principles disclosed herein. The sequence
encodes an open reading frame fused to the Myc and His antibody
epitope tag coded for by the pcDNA 3.1 Myc-His vector.
[0571] Overlapping oligonucleotides that can, for example, average
about 70 nucleotides in length with 15 nucleotide overlaps, are
synthesized and HPLC-purified. The oligonucleotides encode the
selected peptide epitopes as well as appropriate linker
nucleotides, Kozak sequence, and signal sequence. The final
multiepitope minigene is assembled by extending the overlapping
oligonucleotides in three sets of reactions using PCR. A
Perkin/Elmer 9600 PCR machine is used and a total of 30 cycles are
performed using the following conditions: 95.degree. C. for 15 sec,
annealing temperature (5.degree. below the lowest calculated Tm of
each primer pair) for 30 sec, and 72.degree. C. for 1 min.
[0572] For example, a minigene is prepared as follows. For a first
PCR reaction, 5 .mu.g of each of two oligonucleotides are annealed
and extended: In an example using eight oligonucleotides, i.e.,
four pairs of primers, oligonucleotides 1+2, 3+4, 5+6, and 7+8 are
combined in 100 .mu.l reactions containing Pfu polymerase buffer
(1.times.=10 mM KCL, 10 mM (NH4).sub.2SO.sub.4, 20 mM
Tris-chloride, pH 8.75, 2 mM MgSO.sub.4, 0.1% Triton X-100, 100
.mu.g/ml BSA), 0.25 mM each dNTP, and 2.5 U of Pfu polymerase. The
full-length dimer products are gel-purified, and two reactions
containing the product of 1+2 and 3+4, and the product of 5+6 and
7+8 are mixed, annealed, and extended for 10 cycles. Half of the
two reactions are then mixed, and 5 cycles of annealing and
extension carried out before flanking primers are added to amplify
the full length product. The full-length product is gel-purified
and cloned into pCR-blunt (Invitrogen) and individual clones are
screened by sequencing.
Example 21
The Plasmid Construct and the Degree to which it Induces
Immunogenicity
[0573] The degree to which a plasmid construct, for example a
plasmid constructed in accordance with the previous Example, is
able to induce immunogenicity is confirmed in vitro by determining
epitope presentation by APC following transduction or transfection
of the APC with an epitope-expressing nucleic acid construct. Such
a study determines "antigenicity" and allows the use of human APC.
The assay determines the ability of the epitope to be presented by
the APC in a context that is recognized by a T cell by quantifying
the density of epitope-HLA class I complexes on the cell surface.
Quantitation can be performed by directly measuring the amount of
peptide eluted from the APC (see, e.g., Sijts et al., J. Immunol.
156:683-692, 1996; Demotz et al., Nature 342:682-684, 1989); or the
number of peptide-HLA class I complexes can be estimated by
measuring the amount of lysis or lymphokine release induced by
diseased or transfected target cells, and then determining the
concentration of peptide necessary to obtain equivalent levels of
lysis or lymphokine release (see, e.g., Kageyama et al., J.
Immunol. 154:567-576, 1995).
[0574] Alternatively, immunogenicity is confirmed through in vivo
injections into mice and subsequent in vitro assessment of CTL and
HTL activity, which are analyzed using cytotoxicity and
proliferation assays, respectively, as detailed e.g., in Alexander
et al., Immunity 1:751-761, 1994.
[0575] For example, to confirm the capacity of a DNA minigene
construct containing at least one HLA-A2 supermotif peptide to
induce CTLs in vivo, HLA-A2.1/K.sup.b transgenic mice, for example,
are immunized intramuscularly with 100 .mu.g of naked cDNA. As a
means of comparing the level of CTLs induced by cDNA immunization,
a control group of animals is also immunized with an actual peptide
composition that comprises multiple epitopes synthesized as a
single polypeptide as they would be encoded by the minigene.
[0576] Splenocytes from immunized animals are stimulated twice with
each of the respective compositions (peptide epitopes encoded in
the minigene or the polyepitopic peptide), then assayed for
peptide-specific cytotoxic activity in a .sup.51Cr release assay.
The results indicate the magnitude of the CTL response directed
against the A2-restricted epitope, thus indicating the in vivo
immunogenicity of the minigene vaccine and polyepitopic
vaccine.
[0577] It is, therefore, found that the minigene elicits immune
responses directed toward the HLA-A2 supermotif peptide epitopes as
does the polyepitopic peptide vaccine. A similar analysis is also
performed using other HLA-A3 and HLA-B7 transgenic mouse models to
assess CTL induction by HLA-A3 and HLA-B7 motif or supermotif
epitopes, whereby it is also found that the minigene elicits
appropriate immune responses directed toward the provided
epitopes.
[0578] To confirm the capacity of a class II epitope-encoding
minigene to induce HTLs in vivo, DR transgenic mice, or for those
epitopes that cross react with the appropriate mouse MHC molecule,
I-A.sup.b-restricted mice, for example, are immunized
intramuscularly with 100 .mu.g of plasmid DNA. As a means of
comparing the level of HTLs induced by DNA immunization, a group of
control animals is also immunized with an actual peptide
composition emulsified in complete Freund's adjuvant. CD4+ T cells,
i.e. HTLs, are purified from splenocytes of immunized animals and
stimulated with each of the respective compositions (peptides
encoded in the minigene). The HTL response is measured using a
.sup.3H-thymidine incorporation proliferation assay, (see, e.g.,
Alexander et al. Immunity 1:751-761, 1994). The results indicate
the magnitude of the HTL response, thus demonstrating the in vivo
immunogenicity of the minigene.
[0579] DNA minigenes, constructed as described in the previous
Example, can also be confirmed as a vaccine in combination with a
boosting agent using a prime boost protocol. The boosting agent can
consist of recombinant protein (e.g., Barnett et al., Aids Res. and
Human Retroviruses 14, Supplement 3:S299-S309, 1998) or recombinant
vaccinia, for example, expressing a minigene or DNA encoding the
complete protein of interest (see, e.g., Hanke et al., Vaccine
16:439-445, 1998; Sedegah et al., Proc. Natl. Acad. Sci USA
95:7648-53, 1998; Hanke and McMichael, Immunol. Letters 66:177-181,
1999; and Robinson et al., Nature Med. 5:526-34, 1999).
[0580] For example, the efficacy of the DNA minigene used in a
prime boost protocol is initially evaluated in transgenic mice. In
this example, A2.1/K.sup.b transgenic mice are immunized IM with
100 .mu.g of a DNA minigene encoding the immunogenic peptides
including at least one HLA-A2 supermotif-bearing peptide. After an
incubation period (ranging from 3-9 weeks), the mice are boosted IP
with 10.sup.7 pfu/mouse of a recombinant vaccinia virus expressing
the same sequence encoded by the DNA minigene. Control mice are
immunized with 100 .mu.g of DNA or recombinant vaccinia without the
minigene sequence, or with DNA encoding the minigene, but without
the vaccinia boost. After an additional incubation period of two
weeks, splenocytes from the mice are immediately assayed for
peptide-specific activity in an ELISPOT assay. Additionally,
splenocytes are stimulated in vitro with the A2-restricted peptide
epitopes encoded in the minigene and recombinant vaccinia, then
assayed for peptide-specific activity in an alpha, beta and/or
gamma IFN ELISA.
[0581] It is found that the minigene utilized in a prime-boost
protocol elicits greater immune responses toward the HLA-A2
supermotif peptides than with DNA alone. Such an analysis can also
be performed using HLA-A11 or HLA-B7 transgenic mouse models to
assess CTL induction by HLA-A3 or HLA-B7 motif or supermotif
epitopes. The use of prime boost protocols in humans is described
below in the Example entitled "Induction of CTL Responses Using a
Prime Boost Protocol."
Example 22
Peptide Composition for Prophylactic Uses
[0582] Vaccine compositions of the present invention can be used to
prevent 158P1D7 expression in persons who are at risk for tumors
that bear this antigen. For example, a polyepitopic peptide epitope
composition (or a nucleic acid comprising the same) containing
multiple CTL and HTL epitopes such as those selected in the above
Examples, which are also selected to target greater than 80% of the
population, is administered to individuals at risk for a
158P1D7-associated tumor.
[0583] For example, a peptide-based composition is provided as a
single polypeptide that encompasses multiple epitopes. The vaccine
is typically administered in a physiological solution that
comprises an adjuvant, such as Incomplete Freunds Adjuvant. The
dose of peptide for the initial immunization is from about 1 to
about 50,000 .mu.g, generally 100-5,000 .mu.g, for a 70 kg patient.
The initial administration of vaccine is followed by booster
dosages at 4 weeks followed by evaluation of the magnitude of the
immune response in the patient, by techniques that determine the
presence of epitope-specific CTL populations in a PBMC sample.
Additional booster doses are administered as required. The
composition is found to be both safe and efficacious as a
prophylaxis against 158P1D7-associated disease.
[0584] Alternatively, a composition typically comprising
transfecting agents is used for the administration of a nucleic
acid-based vaccine in accordance with methodologies known in the
art and disclosed herein.
Example 23
Polyepitopic Vaccine Compositions Derived from Native 158P1D7
Sequences
[0585] A native 158P1D7 polyprotein sequence is analyzed,
preferably using computer algorithms defined for each class I
and/or class II supermotif or motif, to identify "relatively short"
regions of the polyprotein that comprise multiple epitopes. The
"relatively short" regions are preferably less in length than an
entire native antigen. This relatively short sequence that contains
multiple distinct or overlapping, "nested" epitopes is selected; it
can be used to generate a minigene construct. The construct is
engineered to express the peptide, which corresponds to the native
protein sequence. The "relatively short" peptide is generally less
than 250 amino acids in length, often less than 100 amino acids in
length, preferably less than 75 amino acids in length, and more
preferably less than 50 amino acids in length. The protein sequence
of the vaccine composition is selected because it has maximal
number of epitopes contained within the sequence, i.e., it has a
high concentration of epitopes. As noted herein, epitope motifs may
be nested or overlapping (i.e., frame shifted relative to one
another). For example, with overlapping epitopes, two 9-mer
epitopes and one 10-mer epitope can be present in a 10 amino acid
peptide. Such a vaccine composition is administered for therapeutic
or prophylactic purposes.
[0586] The vaccine composition will include, for example, multiple
CTL epitopes from 158P1D7 antigen and at least one HTL epitope.
This polyepitopic native sequence is administered either as a
peptide or as a nucleic acid sequence which encodes the peptide.
Alternatively, an analog can be made of this native sequence,
whereby one or more of the epitopes comprise substitutions that
alter the cross-reactivity and/or binding affinity properties of
the polyepitopic peptide.
[0587] The embodiment of this example provides for the possibility
that an as yet undiscovered aspect of immune system processing will
apply to the native nested sequence and thereby facilitate the
production of therapeutic or prophylactic immune response-inducing
vaccine compositions. Additionally such an embodiment provides for
the possibility of motif-bearing epitopes for an HLA makeup that is
presently unknown. Furthermore, this embodiment (excluding an
analoged embodiment) directs the immune response to multiple
peptide sequences that are actually present in native 158P1D7, thus
avoiding the need to evaluate any junctional epitopes. Lastly, the
embodiment provides an economy of scale when producing peptide or
nucleic acid vaccine compositions.
[0588] Related to this embodiment, computer programs are available
in the art which can be used to identify in a target sequence, the
greatest number of epitopes per sequence length.
Example 24
Polyepitopic Vaccine Compositions from Multiple Antigens
[0589] The 158P1D7 peptide epitopes of the present invention are
used in conjunction with epitopes from other target
tumor-associated antigens, to create a vaccine composition that is
useful for the prevention or treatment of cancer that expresses
158P1D7 and such other antigens. For example, a vaccine composition
can be provided as a single polypeptide that incorporates multiple
epitopes from 158P1D7 as well as tumor-associated antigens that are
often expressed with a target cancer associated with 158P1D7
expression, or can be administered as a composition comprising a
cocktail of one or more discrete epitopes. Alternatively, the
vaccine can be administered as a minigene construct or as dendritic
cells which have been loaded with the peptide epitopes in
vitro.
Example 25
Use of Peptides to Evaluate an Immune Response
[0590] Peptides of the invention may be used to analyze an immune
response for the presence of specific antibodies, CTL or HTL
directed to 158P1D7. Such an analysis can be performed in a manner
described by Ogg et al., Science 279:2103-2106, 1998. In this
Example, peptides in accordance with the invention are used as a
reagent for diagnostic or prognostic purposes, not as an
immunogen.
[0591] In this example highly sensitive human leukocyte antigen
tetrameric complexes ("tetramers") are used for a cross-sectional
analysis of, for example, 158P1D7 HLA-A*0201-specific CTL
frequencies from HLA A*0201-positive individuals at different
stages of disease or following immunization comprising an 158P1D7
peptide containing an A*0201 motif. Tetrameric complexes are
synthesized as described (Musey et al., N. Engl. J. Med. 337:1267,
1997). Briefly, purified HLA heavy chain (A*0201 in this example)
and .beta.2-microglobulin are synthesized by means of a prokaryotic
expression system. The heavy chain is modified by deletion of the
transmembrane-cytosolic tail and COOH-terminal addition of a
sequence containing a BirA enzymatic biotinylation site. The heavy
chain, .beta.2-microglobulin, and peptide are refolded by dilution.
The 45-kD refolded product is isolated by fast protein liquid
chromatography and then biotinylated by BirA in the presence of
biotin (Sigma, St. Louis, Mo.), adenosine 5' triphosphate and
magnesium. Streptavidin-phycoerythrin conjugate is added in a 1:4
molar ratio, and the tetrameric product is concentrated to 1 mg/ml.
The resulting product is referred to as tetramer-phycoerythrin.
[0592] For the analysis of patient blood samples, approximately one
million PBMCs are centrifuged at 300 g for 5 minutes and
resuspended in 50 .mu.l of cold phosphate-buffered saline.
Tri-color analysis is performed with the tetramer-phycoerythrin,
along with anti-CD8-Tricolor, and anti-CD38. The PBMCs are
incubated with tetramer and antibodies on ice for 30 to 60 min and
then washed twice before formaldehyde fixation. Gates are applied
to contain >99.98% of control samples. Controls for the
tetramers include both A*0201-negative individuals and
A*0201-positive non-diseased donors. The percentage of cells
stained with the tetramer is then determined by flow cytometry. The
results indicate the number of cells in the PBMC sample that
contain epitope-restricted CTLs, thereby readily indicating the
extent of immune response to the 158P1D7 epitope, and thus the
status of exposure to 158P1D7, or exposure to a vaccine that
elicits a protective or therapeutic response.
Example 26
Use of Peptide Epitopes to Evaluate Recall Responses
[0593] The peptide epitopes of the invention are used as reagents
to evaluate T cell responses, such as acute or recall responses, in
patients. Such an analysis may be performed on patients who have
recovered from 158P1D7-associated disease or who have been
vaccinated with an 158P1D7 vaccine.
[0594] For example, the class I restricted CTL response of persons
who have been vaccinated may be analyzed. The vaccine may be any
158P1D7 vaccine. PBMC are collected from vaccinated individuals and
HLA typed. Appropriate peptide epitopes of the invention that,
optimally, bear supermotifs to provide cross-reactivity with
multiple HLA supertype family members, are then used for analysis
of samples derived from individuals who bear that HLA type.
[0595] PBMC from vaccinated individuals are separated on
Ficoll-Histopaque density gradients (Sigma Chemical Co., St. Louis,
Mo.), washed three times in HBSS (GIBCO Laboratories), resuspended
in RPMI-1640 (GIBCO Laboratories) supplemented with L-glutamine (2
mM), penicillin (50 U/ml), streptomycin (50 .mu.g/ml), and Hepes
(10 mM) containing 10% heat-inactivated human AB serum (complete
RPMI) and plated using microculture formats. A synthetic peptide
comprising an epitope of the invention is added at 10 .mu.g/ml to
each well and HBV core 128-140 epitope is added at 1 .mu.g/ml to
each well as a source of T cell help during the first week of
stimulation.
[0596] In the microculture format, 4.times.10.sup.5 PBMC are
stimulated with peptide in 8 replicate cultures in 96-well round
bottom plate in 100 .mu.l/well of complete RPMI. On days 3 and 10,
100 ul of complete RPMI and 20 U/ml final concentration of rIL-2
are added to each well. On day 7 the cultures are transferred into
a 96-well flat-bottom plate and restimulated with peptide, rIL-2
and 10.sup.5 irradiated (3,000 rad) autologous feeder cells. The
cultures are tested for cytotoxic activity on day 14. A positive
CTL response requires two or more of the eight replicate cultures
to display greater than 10% specific .sup.51Cr release, based on
comparison with non-diseased control subjects as previously
described (Rehermann, et al., Nature Med. 2:1104,1108, 1996;
Rehermann et al., J. Clin. Invest. 97:1655-1665, 1996; and
Rehermann et al. J. Clin. Invest. 98:1432-1440, 1996).
[0597] Target cell lines are autologous and allogeneic
EBV-transformed B-LCL that are either purchased from the American
Society for Histocompatibility and Immunogenetics (ASHI, Boston,
Mass.) or established from the pool of patients as described
(Guilhot, et al. J. Virol. 66:2670-2678, 1992).
[0598] Cytotoxicity assays are performed in the following manner.
Target cells consist of either allogeneic HLA-matched or autologous
EBV-transformed B lymphoblastoid cell line that are incubated
overnight with the synthetic peptide epitope of the invention at 10
.mu.M, and labeled with 100 .mu.Ci of .sup.51Cr (Amersham Corp.,
Arlington Heights, Ill.) for 1 hour after which they are washed
four times with HBSS.
[0599] Cytolytic activity is determined in a standard 4-h, split
well .sup.51Cr release assay using U-bottomed 96 well plates
containing 3,000 targets/well. Stimulated PBMC are tested at
effector/target (E/T) ratios of 20-50:1 on day 14. Percent
cytotoxicity is determined from the formula:
100.times.[(experimental release-spontaneous release)/maximum
release-spontaneous release)]. Maximum release is determined by
lysis of targets by detergent (2% Triton X-100; Sigma Chemical Co.,
St. Louis, Mo.). Spontaneous release is <25% of maximum release
for all experiments.
[0600] The results of such an analysis indicate the extent to which
HLA-restricted CTL populations have been stimulated by previous
exposure to 158P1D7 or an 158P1D7 vaccine.
[0601] Similarly, Class II restricted HTL responses may also be
analyzed. Purified PBMC are cultured in a 96-well flat bottom plate
at a density of 1.5.times.10.sup.5 cells/well and are stimulated
with 10 .mu.g/ml synthetic peptide of the invention, whole 158P1D7
antigen, or PHA. Cells are routinely plated in replicates of 4-6
wells for each condition. After seven days of culture, the medium
is removed and replaced with fresh medium containing 10 U/ml IL-2.
Two days later, 1 .mu.Ci .sup.3H-thymidine is added to each well
and incubation is continued for an additional 18 hours. Cellular
DNA is then harvested on glass fiber mats and analyzed for
.sup.3H-thymidine incorporation. Antigen-specific T cell
proliferation is calculated as the ratio of .sup.3H-thymidine
incorporation in the presence of antigen divided by the
.sup.3H-thymidine incorporation in the absence of antigen.
Example 27
Induction of Specific CTL Response in Humans
[0602] A human clinical trial for an immunogenic composition
comprising CTL and HTL epitopes of the invention is set up as an
IND Phase I, dose escalation study and carried out as a randomized,
double-blind, placebo-controlled trial. Such a trial is designed,
for example, as follows:
[0603] A total of about 27 individuals are enrolled and divided
into 3 groups:
[0604] Group I: 3 subjects are injected with placebo and 6 subjects
are injected with 5 .mu.g of peptide composition;
[0605] Group II: 3 subjects are injected with placebo and 6
subjects are injected with 50 .mu.g peptide composition;
[0606] Group III: 3 subjects are injected with placebo and 6
subjects are injected with 500 .mu.g of peptide composition.
[0607] After 4 weeks following the first injection, all subjects
receive a booster inoculation at the same dosage.
[0608] The endpoints measured in this study relate to the safety
and tolerability of the peptide composition as well as its
immunogenicity. Cellular immune responses to the peptide
composition are an index of the intrinsic activity of this the
peptide composition, and can therefore be viewed as a measure of
biological efficacy. The following summarize the clinical and
laboratory data that relate to safety and efficacy endpoints.
[0609] Safety: The incidence of adverse events is monitored in the
placebo and drug treatment group and assessed in terms of degree
and reversibility.
[0610] Evaluation of Vaccine Efficacy: For evaluation of vaccine
efficacy, subjects are bled before and after injection. Peripheral
blood mononuclear cells are isolated from fresh heparinized blood
by Ficoll-Hypaque density gradient centrifugation, aliquoted in
freezing media and stored frozen. Samples are assayed for CTL and
HTL activity.
[0611] The vaccine is found to be both safe and efficacious.
Example 28
Phase II Trials in Patients Expressing 158P1D7
[0612] Phase II trials are performed to study the effect of
administering the CTL-HTL peptide compositions to patients having
cancer that expresses 158P1D7. The main objectives of the trial are
to determine an effective dose and regimen for inducing CTLs in
cancer patients that express 158P1D7, to establish the safety of
inducing a CTL and HTL response in these patients, and to see to
what extent activation of CTLs improves the clinical picture of
these patients, as manifested, e.g., by the reduction and/or
shrinking of lesions. Such a study is designed, for example, as
follows:
[0613] The studies are performed in multiple centers. The trial
design is an open-label, uncontrolled, dose escalation protocol
wherein the peptide composition is administered as a single dose
followed six weeks later by a single booster shot of the same dose.
The dosages are 50, 500 and 5,000 micrograms per injection.
Drug-associated adverse effects (severity and reversibility) are
recorded.
[0614] There are three patient groupings. The first group is
injected with 50 micrograms of the peptide composition and the
second and third groups with 500 and 5,000 micrograms of peptide
composition, respectively. The patients within each group range in
age from 21-65 and represent diverse ethnic backgrounds. All of
them have a tumor that expresses 158P1D7.
[0615] Clinical manifestations or antigen-specific T-cell responses
are monitored to assess the effects of administering the peptide
compositions. The vaccine composition is found to be both safe and
efficacious in the treatment of 158P1D7-associated disease.
Example 29
Induction of CTL Responses using a Prime Boost Protocol
[0616] A prime boost protocol similar in its underlying principle
to that used to confirm the efficacy of a DNA vaccine in transgenic
mice, such as described above in the Example entitled "The Plasmid
Construct and the Degree to Which It Induces Immunogenicity," can
also be used for the administration of the vaccine to humans. Such
a vaccine regimen can include an initial administration of, for
example, naked DNA followed by a boost using recombinant virus
encoding the vaccine, or recombinant protein/polypeptide or a
peptide mixture administered in an adjuvant.
[0617] For example, the initial immunization may be performed using
an expression vector, such as that constructed in the Example
entitled "Construction of `Minigene` Multi-Epitope DNA Plasmids" in
the form of naked nucleic acid administered IM (or SC or ID) in the
amounts of 0.5-5 mg at multiple sites. The nucleic acid (0.1 to
1000 .mu.g) can also be administered using a gene gun. Following an
incubation period of 3-4 weeks, a booster dose is then
administered. The booster can be recombinant fowlpox virus
administered at a dose of 5-10.sup.7 to 5.times.10.sup.9 pfu. An
alternative recombinant virus, such as an MVA, canarypox,
adenovirus, or adeno-associated virus, can also be used for the
booster, or the polyepitopic protein or a mixture of the peptides
can be administered. For evaluation of vaccine efficacy, patient
blood samples are obtained before immunization as well as at
intervals following administration of the initial vaccine and
booster doses of the vaccine. Peripheral blood mononuclear cells
are isolated from fresh heparinized blood by Ficoll-Hypaque density
gradient centrifugation, aliquoted in freezing media and stored
frozen. Samples are assayed for CTL and HTL activity.
[0618] Analysis of the results indicates that a magnitude of
response sufficient to achieve a therapeutic or protective immunity
against 158P1D7 is generated.
Example 30
Administration of Vaccine Compositions using Dendritic Cells
(DC)
[0619] Vaccines comprising peptide epitopes of the invention can be
administered using APCs, or "professional" APCs such as DC. In this
example, peptide-pulsed DC are administered to a patient to
stimulate a CTL response in vivo. In this method, dendritic cells
are isolated, expanded, and pulsed with a vaccine comprising
peptide CTL and HTL epitopes of the invention. The dendritic cells
are infused back into the patient to elicit CTL and HTL responses
in vivo. The induced CTL and HTL then destroy or facilitate
destruction, respectively, of the target cells that bear the
158P1D7 protein from which the epitopes in the vaccine are
derived.
[0620] For example, a cocktail of epitope-comprising peptides is
administered ex vivo to PBMC, or isolated DC therefrom. A
pharmaceutical to facilitate harvesting of DC can be used, such as
Progenipoietin.TM. (Monsanto, St. Louis, Mo.) or GM-CSF/IL-4. After
pulsing the DC with peptides, and prior to reinfusion into
patients, the DC are washed to remove unbound peptides.
[0621] As appreciated clinically, and readily determined by one of
skill based on clinical outcomes, the number of DC reinfused into
the patient can vary (see, e.g., Nature Med. 4:328, 1998; Nature
Med. 2:52, 1996 and Prostate 32:272, 1997). Although
2-50.times.10.sup.6 DC per patient are typically administered,
larger number of DC, such as 10.sup.7 or 10.sup.8 can also be
provided. Such cell populations typically contain between 50-90%
DC.
[0622] In some embodiments, peptide-loaded PBMC are injected into
patients without purification of the DC. For example, PBMC
generated after treatment with an agent such as Progenipoietin.TM.
are injected into patients without purification of the DC. The
total number of PBMC that are administered often ranges from
10.sup.8 to 10.sup.10. Generally, the cell doses injected into
patients is based on the percentage of DC in the blood of each
patient, as determined, for example, by immunofluorescence analysis
with specific anti-DC antibodies. Thus, for example, if
Progenipoietin.TM. mobilizes 2% DC in the peripheral blood of a
given patient, and that patient is to receive 5.times.10.sup.6 DC,
then the patient will be injected with a total of
2.5.times.10.sup.8 peptide-loaded PBMC. The percent DC mobilized by
an agent such as Progenipoietin.TM. is typically estimated to be
between 2-10%, but can vary as appreciated by one of skill in the
art.
[0623] Ex vivo Activation of CTL/HTL Responses
[0624] Alternatively, ex vivo CTL or HTL responses to 158P1D7
antigens can be induced by incubating, in tissue culture, the
patient's, or genetically compatible, CTL or HTL precursor cells
together with a source of APC, such as DC, and immunogenic
peptides. After an appropriate incubation time (typically about
7-28 days), in which the precursor cells are activated and expanded
into effector cells, the cells are infused into the patient, where
they will destroy (CTL) or facilitate destruction (HTL) of their
specific target cells, i.e., tumor cells.
Example 31
An Alternative Method of Identifying and Confirming Motif-Bearing
Peptides
[0625] Another method of identifying and confirming motif-bearing
peptides is to elute them from cells bearing defined MHC molecules.
For example, EBV transformed B cell lines used for tissue typing
have been extensively characterized to determine which HLA
molecules they express. In certain cases these cells express only a
single type of HLA molecule. These cells can be transfected with
nucleic acids that express the antigen of interest, e.g. 158P1D7.
Peptides produced by endogenous antigen processing of peptides
produced as a result of transfection will then bind to HLA
molecules within the cell and be transported and displayed on the
cell's surface. Peptides are then eluted from the HLA molecules by
exposure to mild acid conditions and their amino acid sequence
determined, e.g., by mass spectral analysis (e.g., Kubo et al., J.
Immunol. 152:3913, 1994). Because the majority of peptides that
bind a particular HLA molecule are motif-bearing, this is an
alternative modality for obtaining the motif-bearing peptides
correlated with the particular HLA molecule expressed on the
cell.
[0626] Alternatively, cell lines that do not express endogenous HLA
molecules can be transfected with an expression construct encoding
a single HLA allele. These cells can then be used as described,
i.e., they can then be transfected with nucleic acids that encode
158P1D7 to isolate peptides corresponding to 158P1D7 that have been
presented on the cell surface. Peptides obtained from such an
analysis will bear motif(s) that correspond to binding to the
single HLA allele that is expressed in the cell.
[0627] As appreciated by one in the art, one can perform a similar
analysis on a cell bearing more than one HLA allele and
subsequently determine peptides specific for each HLA allele
expressed. Moreover, one of skill would also recognize that means
other than transfection, such as loading with a protein antigen,
can be used to provide a source of antigen to the cell.
Example 32
Complementary Polynucleotides
[0628] Sequences complementary to the 158P1D7-encoding sequences,
or any parts thereof, are used to detect, decrease, or inhibit
expression of naturally occurring 158P1D7. Although use of
oligonucleotides comprising from about 15 to 30 base pairs is
described, essentially the same procedure is used with smaller or
with larger sequence fragments. Appropriate oligonucleotides are
designed using, e.g., OLIGO 4.06 software (National Biosciences)
and the coding sequence of 158P1D7. To inhibit transcription, a
complementary oligonucleotide is designed from the most unique 5'
sequence and used to prevent promoter binding to the coding
sequence. To inhibit translation, a complementary oligonucleotide
is designed to prevent ribosomal binding to the 158P1D7-encoding
transcript.
Example 33
Purification of Naturally-Occurring or Recombinant 158P1D7 using
158P1D7 Specific Antibodies
[0629] Naturally occurring or recombinant 158P1D7 is substantially
purified by immunoaffinity chromatography using antibodies specific
for 158P1D7. An immunoaffinity column is constructed by covalently
coupling anti-158P1D7 antibody to an activated chromatographic
resin, such as CNBr-activated SEPHAROSE (Amersham Pharmacia
Biotech). After the coupling, the resin is blocked and washed
according to the manufacturer's instructions.
[0630] Media containing 158P1D7 are passed over the immunoaffinity
column, and the column is washed under conditions that allow the
preferential absorbance of 158P1D7 (e.g., high ionic strength
buffers in the presence of detergent). The column is eluted under
conditions that disrupt antibody/158P1D7 binding (e.g., a buffer of
pH 2 to pH 3, or a high concentration of a chaotrope, such as urea
or thiocyanate ion), and GCR.P is collected.
Example 34
Identification of Molecules which Interact with 158P1D7
[0631] 158P1D7, or biologically active fragments thereof, are
labeled with 1211 Bolton-Hunter reagent.
[0632] (See, e.g., Bolton et al. (1973) Biochem. J. 133:529.)
Candidate molecules previously arrayed in the wells of a multi-well
plate are incubated with the labeled 158P1D7, washed, and any wells
with labeled 158P1D7 complex are assayed. Data obtained using
different concentrations of 158P1D7 are used to calculate values
for the number, affinity, and association of 158P1D7 with the
candidate molecules. Throughout this application, various website
data content, publications, applications and patents are
referenced. (Websites are referenced by their Uniform Resource
Locator, or URL, addresses on the World Wide Web.) The disclosures
of each of these items of information are are hereby incorporated
by reference herein in their entireties.
Example 35
In Vivo Assay for 158P1D7 Tumor Growth Promotion
[0633] The effect of the 158P1D7 protein on tumor cell growth can
be confirmed in vivo by gene overexpression in bladder cancer
cells. For example, SCID mice can be injected SQ on each flank with
1.times.10.sup.6 bladder cancer cells (such as SCaBER, UM-UC-3,
HT1376, RT4, T24, TCC-SUP, J82 and SW780 cells) containing tkNeo
empty vector or 158P1D7.
[0634] At least two strategies may be used: (1) Constitutive
158P1D7 expression under regulation of a promoter such as a
constitutive promoter obtained from the genomes of viruses such as
polyoma virus, fowlpox virus (UK 2,211,504 published Jul. 5, 1989),
adenovirus (such as Adenovirus 2), bovine papilloma virus, avian
sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and
Simian Virus 40 (SV40), or from heterologous mammalian promoters,
e.g., the actin promoter or an immunoglobulin promoter, provided
such promoters are compatible with the host cell systems. (2)
Regulated expression under control of an inducible vector system,
such as ecdysone, tet, etc., can be used provided such promoters
are compatible with the host cell systems. Tumor volume is then
monitored at the appearance of palpable tumors and is followed over
time to determine if 158P1D7-expressing cells grow at a faster rate
and whether tumors produced by 158P1D7-expressing cells demonstrate
characteristics of altered aggressiveness (e.g. enhanced
metastasis, vascularization, reduced responsiveness to
chemotherapeutic drugs). Additionally, mice can be implanted with
the same cells orthotopically to determine if 158P1D7 has an effect
on local growth in the bladder or on the ability of the cells to
metastasize, specifically to lungs or lymph nodes (Fu, X., et al.,
Int. J. Cancer, 1991. 49: p. 938-939; Chang, S., et al., Anticancer
Res., 1997. 17: p. 3239-3242; Peralta, E. A., et al., J. Urol.,
1999. 162: p. 1806-1811). Furthermore, this assay is useful to
confirm the 158P1D7 inhibitory effect of candidate therapeutic
compositions, such as for example, 158P1D7 antibodies or
intrabodies, and 158P1D7 antisense molecules or ribozymes.
Example 36:
158P1D7 Monoclonal Antibody-Mediated Inhibition of Bladder Tumors
in vivo
[0635] The significant expression of 158P1D7 in cancer tissues,
together with its restricted expression in normal tissues, makes
158P1D7 an excellent target for antibody therapy. In cases where
the monoclonal antibody target is a cell surface protein,
antibodies have been shown to be efficacious at inhibiting tumor
growth (See, e.g., (Saffran, D., et al., PNAS 10: 1073-1078 or
www.pnas.org/cgi/doi/10.1073/pnas.051624698). In cases where the
target is not on the cell surface, such as PSA and PAP in prostate
cancer, antibodies have still been shown to recognize and inhibit
growth of cells expressing those proteins (Saffran, D. C., et al.,
Cancer and Metastasis Reviews, 1999. 18: p. 437-449). As with any
cellular protein with a restricted expression profile, 158P1D7 is a
target for T cell-based immunotherapy.
[0636] Accordingly, the therapeutic efficacy of anti-158P1D7 mAbs
in human bladder cancer mouse models is modeled in
158P1D7-expressing bladder cancer xenografts or bladder cancer cell
lines, such as those described in Example (the Example entitled "In
Vivo Assay for 158P1D7 Tumor Growth Promotion", that have been
engineered to express 158P1D7.
[0637] Antibody efficacy on tumor growth and metastasis formation
is confirmed, e.g., in a mouse orthotopic bladder cancer xenograft
model. The antibodies can be unconjugated, as discussed in this
Example, or can be conjugated to a therapeutic modality, as
appreciated in the art. It is confirmed that anti-158P1D7 mAbs
inhibit formation of 158P1D7-expressing bladder tumors.
Anti-158P1D7 mAbs also retard the growth of established orthotopic
tumors and prolong survival of tumor-bearing mice. These results
indicate the utility of anti-158P1D7 mAbs in the treatment of local
and advanced stages of bladder cancer. (See, e.g., Saffran, D., et
al., PNAS 10: 1073-1078 or
www.pnas.org/cgi/doi/10.1073/pnas.051624698)
[0638] Administration of anti-158P1D7 mAbs retard established
orthotopic tumor growth and inhibit metastasis to distant sites,
resulting in a significant prolongation in the survival of
tumor-bearing mice. These studies indicate that 158P1D7 is an
attractive target for immunotherapy and demonstrate the therapeutic
potential of anti-158P1D7 mAbs for the treatment of local and
metastatic bladder cancer.
[0639] This example demonstrates that unconjugated 158P1D7
monoclonal antibodies effectively to inhibit the growth of human
bladder tumors grown in SCID mice; accordingly a combination of
such efficacious monoclonal antibodies is also effective.
[0640] Tumor Inhibition using Multiple Unconjugated 158P1D7
mAbs
[0641] Materials and Methods
[0642] 158P1D7 Monoclonal Antibodies:
[0643] Monoclonal antibodies are raised against 158P1D7 as
described in the Example entitled "Generation of 158P1D7 Monoclonal
Antibodies (mAbs)." The antibodies are characterized by ELISA,
Western blot, FACS, and immunoprecipitation, in accordance with
techniques known in the art, for their capacity to bind 158P1D7.
Epitope mapping data for the anti-158P1D7 mAbs, as determined by
ELISA and Western analysis, recognize epitopes on the 158P1D7
protein. Immunohistochemical analysis of bladder cancer tissues and
cells with these antibodies is performed.
[0644] The monoclonal antibodies are purified from ascites or
hybridoma tissue culture supernatants by Protein-G Sepharose
chromatography, dialyzed against PBS, filter sterilized, and stored
at -20.degree. C. Protein determinations are performed by a
Bradford assay (Bio-Rad, Hercules, Calif.). A therapeutic
monoclonal antibody or a cocktail comprising a mixture of
individual monoclonal antibodies is prepared and used for the
treatment of mice receiving subcutaneous or orthotopic injections
of bladder tumor xenografts.
[0645] Bladder Cancer Cell Lines
[0646] Bladder cancer cell lines (Scaber, J82, UM-UC-3, HT1376,
RT4, T24, TCC-SUP, J82 and SW780) expressing 158P1D7 are generated
by retroviral gene transfer as described in Hubert, R. S., et al.,
STEAP: a prostate-specific cell-surface antigen highly expressed in
human prostate tumors. Proc Natl Acad Sci U S A, 1999.
96(25):14523-8. Anti-158P1D7 staining is detected by using an
FITC-conjugated goat anti-mouse antibody (Southern Biotechnology
Associates) followed by analysis on a Coulter Epics-XL f low
cytometer.
[0647] In Vivo Mouse Models.
[0648] Subcutaneous (s.c.) tumors are generated by injection of
1.times.10.sup.6 158P1D7-expressing bladder cancer cells mixed at a
1:1 dilution with Matrigel (Collaborative Research) in the right
flank of male SCID mice. To test antibody efficacy on tumor
formation, i.p. antibody injections are started on the same day as
tumor-cell injections. As a control, mice are injected with either
purified mouse IgG (ICN) or PBS; or a purified monoclonal antibody
that recognizes an irrelevant antigen not expressed in human cells.
In preliminary studies, no difference is found between mouse IgG or
PBS on tumor growth. Tumor sizes are determined by vernier caliper
measurements, and the tumor volume is calculated as
length.times.width.times.height. Mice with s.c. tumors greater than
1.5 cm in diameter are sacrificed. Circulating levels of
anti-158P1D7 mAbs are determined by a capture ELISA kit (Bethyl
Laboratories, Montgomery, Tex.). (See, e.g., (Saffran, D., et al.,
PNAS 10:1073-1078)
[0649] Orthotopic injections are performed, for example, in two
alternative embodiments, under anesthesia by, for example, use of
ketamine/xylazine. In a first embodiment, an intravesicular
injection of bladder cancer cells is administered directly through
the urethra and into the bladder (Peralta, E. A., et al., J. Urol.,
1999. 162:1806-1811). In a second embodiment, an incision is made
through the abdominal wall, the bladder is exposed, and bladder
tumor tissue pieces (1-2 mm in size) derived from a s.c. tumor are
surgically glued onto the the exterior wall of the bladder, termed
"onplantation" (Fu, X., et al., Int. J. Cancer, 1991. 49: 938-939;
Chang, S., et al., Anticancer Res., 1997. 17: p.3239-3242).
Antibodies can be administered to groups of mice at the time of
tumor injection or onplantation, or after 1-2 weeks to allow tumor
establishment.
[0650] Anti-158P1D7 mAbs Inhibit Growth of 158P1D7-Expressing
Bladder Cancer Tumors
[0651] In one embodiment, the effect of anti-158P1D7 mAbs on tumor
formation is tested by using the bladder onplantation orthotopic
model. As compared with the s.c. tumor model, the orthotopic model,
which requires surgical attachment of tumor tissue directly on the
bladder, results in a local tumor growth, development of metastasis
in distal sites, and subsequent death (Fu, X., et al., Int. J.
Cancer, 1991. 49: p. 938-939; Chang, S., et al., Anticancer Res.,
1997. 17: p. 3239-3242). This features make the orthotopic model
more representative of human disease progression and allows one to
follow the therapeutic effect of mAbs, as well as other therapeutic
modalities, on clinically relevant end points.
[0652] Accordingly, 158P1D7-expressing tumor cells are onplanted
orthotopically, and 2 days later, the mice are segregated into two
groups and treated with either: a) 50-2000 .mu.g, usually 200-500
.mu.g, of anti-158P1D7 Ab, orb) PBS, three times per week for two
to five weeks. Mice are monitored weekly for indications of tumor
growth.
[0653] As noted, a major advantage of the orthotopic bladder cancer
model is the ability to study the development of metastases.
Formation of metastasis in mice bearing established orthotopic
tumors is studied by histological analysis of tissue sections,
including lung and lymph nodes (Fu, X., et al., Int. J. Cancer,
1991. 49:938-939; Chang, S., et al., Anticancer Res., 1997.
17:3239-3242). Additionally, IHC analysis using anti-158P1D7
antibodies can be performed on the tissue sections.
[0654] Mice bearing established orthotopic 158P1D7-expressing
bladder tumors are administered 1000 .mu.g injections of either
anti-158P1D7 mAb or PBS over a 4-week period. Mice in both groups
are allowed to establish a high tumor burden (1-2 weeks growth), to
ensure a high frequency of metastasis formation in mouse lungs and
lymph nodes. Mice are then sacrificed and their local bladder tumor
and lung and lymph node tissue are analyzed for the presence of
tumor cells by histology and IHC analysis.
[0655] These studies demonstrate a broad anti-tumor efficacy of
anti-158P1D7 antibodies on initiation and progression of bladder
cancer in mouse models. Anti-158P1D7 antibodies inhibit tumor
formation and retard the growth of already established tumors and
prolong the survival of treated mice. Moreover, anti-158P1D7 mAbs
demonstrate a dramatic inhibitory effect on the spread of local
bladder tumor to distal sites, even in the presence of a large
tumor burden. Thus, anti-158P1D7 mAbs are efficacious on major
clinically relevant end points including lessened tumor growth,
lessened metastasis, and prolongation of survival.
Example 37
Homology Comparison of 158P1D7 to Known Sequences
[0656] The 158P1D7 protein of FIG. 3 has 841 amino acids with
calculated molecular weight of 95.1 kDa, and pI of 6.07. 158P1D7 is
predicted to be a nuclear protein (65% by PSORT
http://psort.nibb.ac.jp/form2.html) with a possibility of it being
a plasma membrane protein (0.46 PSORT
http://psort.nibb.ac.jp/form.html). 158P1D7 has a potential
cleavage site between aa 626 and 627 and a potential signal site at
aa 3-25.
[0657] By use of the PubMed website of the N.C.B.I. available at
http://www.ncbi.nlm.nih.gov/entrez, it was found at the protein
level that 158P1D7 shows best homology to the hypothetical protein
FLJ22774 (PubMed record: gi 14149932) of unknown function, with 97%
identity and 97% homology. The 158P1D7 protein demonstrates some
homology to a human protein similar to IGFALS (insulin-like growth
factor binding protein, acid labile subunit) (PubMed record: gi
6691962) with 36% identity and 52% homology and to mouse Slit 1
protein (PubMed record: gi 5532493) with 24% identity and 37%
homology (FIGS. 5a and 5b).
[0658] Insulin-like growth factors (IGF) have been shown to play an
important role in tumor growth including prostate, breast, brain
and ovarian cancer (O'Brian et al, Urology. 2001, 58:1; Wang J et
al Oncogene. 2001, 20:3857; Helle S et al, Br J Cancer. 2001,
85:74). IGFs produce their oncogenic effect by binding to specific
cell surface receptors and activating survival as well as mitogenic
pathways (Babajko S et al, Med Pediatr Oncol. 2001, 36:154; Scalia
P et al, J Cell Biochem. 2001, 82:610). The activity of
insulin-like growth factors is regulated by IGF binding proteins
(IGF-BP) and the acid labile subunit (ALS) of IGF-BP (Zeslawski W
et al, EMBO J. 2001, 20:3638; Jones J I. and Clemmons D R. Endocr.
Rev. 1995, 16: 3). In the plasma, most IGFs exist as a ternary
complex containing IGF-BP and ALS (Jones J I. and Clemmons D R.
Endocr. Rev. 1995, 16: 3). Association with ALS allows the
retention of the ternary complex in the vasculature and extends its
lifespan (Ueki I et al, Proc Natl Acad Sci U S A 2000, 97:6868).
Studies in mice demonstrate the contribution of ALS to cell growth
by showing that mice carrying mutant ALS exhibit a growth deficit
(Ueki I et al, Proc Natl Acad Sci U S A 2000, 97:6868), indicating
that ALS plays a critical role in the growth of tumor cells.
[0659] Slit proteins were first identified in Drosophila as
secreted proteins that regulate axon guidance and orientation
(Rajagopalan S et al, Cell. 2000, 103:1033; Chen J et al, J
Neurosci. 2001, 21:1548). Mammalian homologs were cloned in mice
and humans, where they are shown to regulate migration and
chemotaxis (Wu J et al, Nature. 2001, 410:948; Brose K and Tessier
M, Curr Opin Neurobiol. 2001, 10:95). Slit proteins localize at two
distinct subcellular sites within epithelial cells depending on
cell stage, with Slit 3 predominantly localizing in the
mitochondria and targeting to the cell surface in more confluent
cells (Little M H et al, Am J Physiol Cell Physiol. 2001,
281:C486). The differential Slit localization suggests that Slit
may function differently whether it is secreted, associated with
the cell surface or retained in the mitochondria.
[0660] The disclosure of the present invention that 158P1D7 is
highly expressed in several cancers while showing a restricted
expression pattern in normal tissues indicates that the 158P1D7
gene plays an important role in various cancers, including cancers
of the bladder. It is provided by the present invention that
158P1D7 controls tumor growth and progression by regulating
proliferation, survival, migration, gene expression as well as cell
surface availability. Accordingly, when 158P1D7 functions as a
regulator of cell growth and apoptosis, or expression, 158P1D7 is
used for therapeutic, diagnostic, prognostic or preventative
purposes.
[0661] Additionally, FIGS. 16A and 16B set forth a transmembrane
region and orientation prediction for 158P1D7. FIG. 16A is a
schematic representation of the probability of the existence of
transmembrane regions and the extracellular and intracellular
orientation of 158P1D7 based on the algorithm of Sonnhammer, von
Heijne, and Krogh (Erik L. L. Sonnhammer, Gunnar von Heijne, and
Anders Krogh: A hidden Markov model for predicting transmembrane
helices in protein sequences. In Proc. of Sixth Int. Conf. on
Intelligent Systems for Molecular Biology, p 175-182 Ed J. Glasgow,
T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen
Menlo Park, Calif.: AAAI Press, 1998). The method predicts that
158P1D7 contains a single transmembrane region from amino acids
611-633 with high probability that the amino-terminus resides
outside, consistent with the topology of a Type I transmembrane
protein. Also visualized is a short hydrophobic stretch from amino
acids 3-25, consistent with the existence of an amino-terminal
signal peptide. FIG. 16B is a schematic representation of the
probability of existence of transmembrane regions and orientation
of 158P1D7 based on the TMpred algorithm of Hofmann and Stoffel
which utilizes TMBASE (K. Hofmann, W. Stoffel. TMBASE--A database
of membrane spanning protein segments Biol. Chem. Hoppe-Seyler
374:166, 1993). The method predicts that 158P1D7 contains a primary
transmembrane region from amino acids 609-633 and a secondary
transmembrane region from amino acids 3-25 (contiguous amino acids
with values greater than 0 on the plot have high probability of
being transmembrane regions) with an orientation in which the amino
terminus resides inside and the carboxyl terminus outside. An
alternative model is also predicted, consistent with FIG. 16A, that
158P1D7 is a Type 1 transmembrane protein in which the
amino-terminus resides outside and the protein contains a secondary
transmembrane domain signal peptide from amino acids 3-25 and a
primary transmembrane domain from AA 615-633. The transmembrane
prediction algorithms for FIG. 16A and FIG. 16B are accessed
through the ExPasy molecular biology server
(http://www.expasy.ch/tools/).
Example 38
Identification and Confirmation of Signal Transduction Pathways
[0662] Many mammalian proteins have been reported to interact with
signaling molecules and to participate in regulating signaling
pathways. (J Neurochem. 2001; 76:217-223). In particular, IGF and
IGF-BP have been shown to regulate mitogenic and survival pathways
(Babajko S et al, Med Pediatr Oncol. 2001, 36:154; Scalia P et al,
J Cell Biochem. 2001, 82:610). Using immunoprecipitation and
Western blotting techniques, proteins are identified that associate
with 158P1D7 and mediate signaling events. Several pathways known
to play a role in cancer biology are regulated by 158P1D7,
including phospholipid pathways such as PI3K, AKT, etc, adhesion
and migration pathways, including FAK, Rho, Rac-1, etc, as well as
mitogenic/survival cascades such as ERK, p38, etc. (Cell Growth
Differ. 2000, 11:279; J Biol Chem. 1999, 274:801; Oncogene. 2000,
19:3003, J. Cell Biol. 1997, 138:913.). Bioinformatic analysis
revealed that 158P1D7 can become phosphorylated by serine/threonine
as well as tyrosine kinases. Thus, the phosphorylation of 158P1D7
is provided by the present invention to lead to activation of the
above listed pathways.
[0663] Using, e.g., Western blotting techniques, the ability of
158P1D7 to regulate these pathways is confirmed. Cells expressing
or lacking 158P1D7 are either left untreated or stimulated with
cytokines, hormones and anti-integrin antibodies. Cell lysates are
analyzed using anti-phospho-specific antibodies (Cell Signaling,
Santa Cruz Biotechnology) in order to detect phosphorylation and
regulation of ERK, p38, AKT, P13K, PLC and other signaling
molecules. When 158P1 D7 plays a role in the regulation of
signaling pathways, whether individually or communally, it is used
as a target for diagnostic, prognostic, preventative and
therapeutic purposes.
[0664] To confirm that 158P1D7 directly or indirectly activates
known signal transduction pathways in cells, luciferase (luc) based
transcriptional reporter assays are carried out in cells expressing
individual genes. These transcriptional reporters contain
consensus-binding sites for known transcription factors that lie
downstream of well-characterized signal transduction pathways. The
reporters and examples of these associated transcription factors,
signal transduction pathways, and activation stimuli are listed
below:
[0665] 1. NFkB-luc, NFkB/Rel; Ik-kinase/SAPK;
growth/apoptosis/stress
[0666] 2. SRE-luc, SRF/TCF/ELK1; MAPK/SAPK;
growth/differentiation
[0667] 3. AP-1-luc, FOS/JUN; MAPK/SAPK/PKC;
growth/apoptosis/stress
[0668] 4. ARE-luc, androgen receptor; steroids/MAPK;
growth/differentiation/apoptosis
[0669] 5. p53-luc, p53; SAPK; growth/differentiation/apoptosis
[0670] 6. CRE-luc, CREB/ATF2; PKA/p38; growth/apoptosis/stress
[0671] Gene-mediated effects are assayed in cells showing mRNA
expression. Luciferase reporter plasmids are introduced by
lipid-mediated transfection (TFX-50, Promega). Luciferase activity,
an indicator of relative transcriptional activity, is measured by
incubation of cell extracts with luciferin substrate and
luminescence of the reaction is monitored in a luminometer.
[0672] Signaling pathways activated by 158P1D7 are mapped and used
for the identification and validation of therapeutic targets. When
158P1D7 is involved in cell signaling, it is used as target for
diagnostic, prognostic, preventative and therapeutic purposes.
Example 39
Involvement in Tumor Progression
[0673] The 158P1D7 gene can contribute to the growth of cancer
cells. The role of 158P1D7 in tumor growth is confirmed in a
variety of primary and transfected cell lines including prostate,
colon, bladder and kidney cell lines as well as NIH 3T3 cells
engineered to stably express 158P1D7. Parental cells lacking
158P1D7 and cells expressing 158P1D7 are evaluated for cell growth
using a well-documented proliferation assay (see, e.g., Fraser S P,
Grimes J A, Djamgoz M B. Prostate. 2000;44:61, Johnson D E, Ochieng
J, Evans S L. Anticancer Drugs. 1996, 7:288).
[0674] To confirm the role of 158P1D7 in the transformation
process, its effect in colony forming assays is investigated.
Parental NIH3T3 cells lacking 158P1D7 are compared to NHI-3T3 cells
expressing 158P1D7, using a soft agar assay under stringent and
more permissive conditions (Song Z. et al. Cancer Res. 2000,
60:6730).
[0675] To confirm the role of 158P1D7 in invasion and metastasis of
cancer cells, a well-established assay is used, e.g., a Transwell
Insert System assay (Becton Dickinson) (Cancer Res. 1999, 59:6010).
Control cells, including prostate, colon, bladder and kidney cell
lines lacking 158P1D7 are compared to cells expressing 158P1D7,
respectively. Cells are loaded with the fluorescent dye, calcein,
and plated in the top well of the Transwell insert coated with a
basement membrane analog. Invasion is determined by fluorescence of
cells in the lower chamber relative to the fluorescence of the
entire cell population.
[0676] 158P1D7 can also play a role in cell cycle and apoptosis.
Parental cells and cells expressing 158P1D7 are compared for
differences in cell cycle regulation using a well-established BrdU
assay (Abdel-Malek Z A. J Cell Physiol. 1988, 136:247). In short,
cells are grown under both optimal (full serum) and limiting (low
serum) conditions are labeled with BrdU and stained with anti-BrdU
Ab and propidium iodide. Cells are analyzed for entry into the G1,
S, and G2M phases of the cell cycle. Alternatively, the effect of
stress on apoptosis is evaluated in control parental cells and
cells expressing 158P1D7, including normal and tumor bladder cells.
Engineered and parental cells are treated with various
chemotherapeutic agents, such as paclitaxel, gemcitabine, etc, and
protein synthesis inhibitors, such as cycloheximide. Cells are
stained with annexin V-FITC and cell death is measured by FACS
analysis. The modulation of cell death by 158P1D7 can play a
critical role in regulating tumor progression and tumor load.
[0677] When 158P1D7 plays a role in cell growth, transformation,
invasion or apoptosis, it is used as a target for diagnostic,
prognostic, preventative and therapeutic purposes.
Example 40
Involvement in Angiogenesis
[0678] Angiogenesis or new capillary blood vessel formation is
necessary for tumor growth (Hanahan D, Folkman J. Cell. 1996,
86:353; Folkman J. Endocrinology. 1998 139:441). Several assays
have been developed to measure angiogenesis in vitro and in vivo,
such as the tissue culture assays, endothelial cell tube formation,
and endothelial cell proliferation. Using these assays as well as
in vitro neo-vascularization, the effect of 158P1D7 on angiogenesis
is confirmed. For example, endothelial cells engineered to express
158P1D7 are evaluated using tube formation and proliferation
assays. The effect of 158P1D7 is also confirmed in animal models in
vivo. For example, cells either expressing or lacking 158P1D7 are
implanted subcutaneously in immunocompromised mice. Endothelial
cell migration and angiogenesis are evaluated 5-15 days later using
immunohistochemistry techniques. When 158P1D7 affects angiogenesis,
it is used as a target for diagnostic, prognostic, preventative and
therapeutic purposes
Example 41
Regulation of Transcription
[0679] The above-indicated localization of 158P1D7 to the nucleus
and its similarity to IGF-BP which has been found to activate
signalling pathways and to regulate essential cellular functions,
support the present invention use of 158P1D7 based on its role in
the transcriptional regulation of eukaryotic genes. Regulation of
gene expression is confirmed, e.g., by studying gene expression in
cells expressing or lacking 158P1D7. For this purpose, two types of
experiments are performed.
[0680] In the first set of experiments, RNA from parental and
158P1D7-expressing cells are extracted and hybridized to
commercially available gene arrays (Clontech) (Smid-Koopman E et
al. Br J Cancer. 2000. 83:246). Resting cells as well as cells
treated with FBS or androgen are compared. Differentially expressed
genes are identified in accordance with procedures known in the
art. The differentially expressed genes are then mapped to
biological pathways (Chen K et al., Thyroid. 2001. 11:41.).
[0681] In the second set of experiments, specific transcriptional
pathway activation is evaluated using commercially available (e.g.,
Stratagene) luciferase reporter constructs including: NFkB-luc,
SRE-luc, ELK1-luc, ARE-luc, p53-luc, and CRE-luc. These
transcriptional reporters contain consensus binding sites for known
transcription factors that lie downstream of well-characterized
signal transduction pathways, and represent a good tool to
ascertain pathway activation and screen for positive and negative
modulators of pathway activation.
[0682] When 158P1D7 plays a role in gene regulation, it is used as
a target for diagnostic, prognostic, preventative and therapeutic
purposes.
Example 42
Subcellular Localization of 158P1D7
[0683] The cellular location of 158P1D7 is assessed using
subcellular fractionation techniques widely used in cellular
biology (Storrie B, et al. Methods Enzymol. 1990;182:203-25). A
variety of cell lines, including prostate, kidney and bladder cell
lines as well as cell lines engineered to express 158P1D7 are
separated into nuclear, cytosolic and membrane fractions. Gene
expression and location in nuclei, heavy membranes (lysosomes,
peroxisomes, and mitochondria), light membranes (plasma membrane
and endoplasmic reticulum), and soluble protein fractions are
tested using Western blotting techniques.
[0684] Alternatively, 293T cells are transfected with an expression
vector encoding individual genes, HIS-tagged (PCDNA 3.1 MYC/HIS,
Invitrogen) and the subcellular localization of these genes is
determined as described above. In short, the transfected cells are
harvested and subjected to a differential subcellular fractionation
protocol (Pemberton, P. A. et al, 1997, J of Histochemistry and
Cytochemistry, 45:1697-1706). Location of the HIS-tagged genes is
followed by Western blotting.
[0685] Using 158P1D7 antibodies, it is possible to demonstrate
cellular localization by immunofluorescence and
immunohistochemistry. For example, cells expressing or lacking
158P1D7 are adhered to a microscope slide and stained with
anti-158P1D7 specific Ab. Cells are incubated with an FITC-coupled
secondary anti-species Ab, and analyzed by fluorescent microscopy.
Alternatively, cells and tissues lacking or expressing 158P1D7 are
analyzed by IHC as described herein.
[0686] When 158P1D7 is localized to specific cell compartments, it
is used as a target for diagnostic, preventative and therapeutic
purposes.
Example 43
Involvement of 158P1D7 in Protein Trafficking
[0687] Due to its similarity to Slit proteins, 158P1D7 can regulate
intracellular trafficking and retention into mitochondrial and/or
nuclear compartments. Its role in the trafficking of proteins can
be confirmed using well-established methods (Valetti C. et al. Mol
Biol Cell. 1999, 10:4107). For example, FITC-conjugated
.alpha.2-macroglobulin is incubated with 158P1D7-expressing and
158P1D7-negative cells. The location and uptake of
FITC-.alpha.2-macroglobulin is visualized using a fluorescent
microscope. In another approach, the co-localization of 158P1D7
with vesicular proteins is confirmed by co-precipitation and
Western blotting techniques and fluorescent microscopy.
[0688] Alternatively, 158P1D7-expressing and 158P1D7-lacking cells
are compared using bodipy-ceramide labeled bovine serum albumine
(Huber L et al. Mol. Cell. Biol. 1995, 15:918). Briefly, cells are
allowed to take up the labeled BSA and are placed intermittently at
4.degree. C. and 18.degree. C. to allow for trafficking to take
place. Cells are examined under fluorescent microscopy, at
different time points, for the presence of labeled BSA in specific
vesicular compartments, including Golgi, endoplasmic reticulum,
etc.
[0689] In another embodiment, the effect of 158P1D7 on membrane
transport is examined using biotin-avidin complexes. Cells either
expressing or lacking 158P1D7 are transiently incubated with
biotin. The cells are placed at 4.degree. C. or transiently warmed
to 37.degree. C. for various periods of time. The cells are
fractionated and examined by avidin affinity precipitation for the
presence of biotin in specific cellular compartments. Using such
assay systems, proteins, antibodies and small molecules are
identified that modify the effect of 158P1D7 on vesicular
transport. When 158P1D7 plays a role in intracellular trafficking,
158P1D7 target for diagnostic, prognostic, preventative and
therapeutic purposes
Example 44
Protein-Protein Association
[0690] IGF and IGF-BP proteins have been shown to interact with
other proteins, thereby forming protein complexes that can regulate
protein localization, biological activity, gene transcription, and
cell transformation (Zeslawski W et al, EMBO J. 2001, 20:3638; Yu
H, Rohan T, J Natl Cancer Inst. 2000, 92:1472). Using
immunoprecipitation techniques as well as two yeast hybrid systems,
proteins are identified that associate with 158P1D7.
Immunoprecipitates from cells expressing 158P1D7 and cells lacking
158P1D7 are compared for specific protein-protein associations.
[0691] Studies are performed to determine the extent of the
association of 158P1D7 with receptors, such as the EGF and IGF
receptors, and with intracellular proteins, such as IGF-BP,
cytoskeletal proteins etc. Studies comparing 158P1D7 positive and
158P1D7 negative cells, as well as studies comparing
unstimulated/resting cells and cells treated with epithelial cell
activators, such as cytokines, growth factors and anti-integrin Ab
reveal unique protien-protein interactions.
[0692] In addition, protein-protein interactions are confirmed
using two yeast hybrid methodology (Curr Opin Chem Biol. 1999,
3:64). A vector carrying a library of proteins fused to the
activation domain of a transcription factor is introduced into
yeast expressing a 158P1D7-DNA-binding domain fusion protein and a
reporter construct. Protein-protein interaction is detected by
colorimetric reporter activity. Specific association with surface
receptors and effector molecules directs one of skill to the mode
of action of 158P1D7, and thus identifies therapeutic, prognostic,
preventative and/or diagnostic targets for cancer. This and similar
assays are also used to identify and screen for small molecules
that interact with 158P1D7.
[0693] When 158P1D7 associates with proteins or small molecules it
is used as a target for diagnostic, prognostic, preventative and
therapeutic purposes.
[0694] The present invention is not to be limited in scope by the
embodiments disclosed herein, which are intended as single
illustrations of individual aspects of the invention, and any that
are functionally equivalent are within the scope of the invention.
Various modifications to the models and methods of the invention,
in addition to those described herein, will become apparent to
those skilled in the art from the foregoing description and
teachings, and are similarly intended to fall within the scope of
the invention. Such modifications or other embodiments can be
practiced without departing from the true scope and spirit of the
invention.
[0695] All documents and publications recited herein are hereby
incorporated in their entirety as if fully set forth.
Tables
[0696]
3TABLE I Tissues that Express 158P1D7 When Malignant Bladder,
Prostate, Colon, Lung, Breast, Ovary
[0697]
4TABLE II AMINO ACID ABBREVIATIONS SINGLE LETTER THREE LETTER FULL
NAME F Phe phenylalanine L Leu leucine S Ser serine Y Tyr tyrosine
C Cys cysteine W Trp tryptophan P Pro proline H His histidine Q Gln
glutamine R Arg arginine I Ile isoleucine M Met methionine T Thr
threonine N Asn asparagine K Lys lysine V Val valine A Ala alanine
D Asp aspartic acid E Glu glutamic acid G Gly glycine
[0698]
5TABLE III AMINO ACID SUBSTITUTION MATRIX Adapted from the GCG
Software 9.0 BLOSUM62 amino acid substitution matrix (block
substitution matrix). The higher the value, the more likely a
substitution is found in related, natural proteins. (See URL
www.ikp.unibe.ch/manual/blosum62.html ) A C D E F G H I K L M N P Q
R S T V W Y . 4 0 -2 -1 -2 0 -2 -1 -1 -1 -1 -2 -1 -1 -1 1 0 0 -3 -2
A 9 -3 -4 -2 -3 -3 -1 -3 -1 -1 -3 -3 -3 -3 -1 -1 -1 -2 -2 C 6 2 -3
-1 -1 -3 -1 -4 -3 1 -1 0 -2 0 -1 -3 -4 -3 D 5 -3 -2 0 -3 1 -3 -2 0
-1 2 0 0 -1 -2 -3 -2 E 6 -3 -1 0 -3 0 0 -3 -4 -3 -3 -2 -2 -1 1 3 F
6 -2 -4 -2 -4 -3 0 -2 -2 -2 0 -2 -3 -2 -3 G 8 -3 -1 -3 -2 1 -2 0 0
-1 -2 -3 -2 2 H 4 -3 2 1 -3 -3 -3 -3 -2 -1 3 -3 -1 I 5 -2 -1 0 -1 1
2 0 -1 -2 -3 -2 K 4 2 -3 -3 -2 -2 -2 -1 1 -2 -1 L 5 -2 -2 0 -1 -1
-1 1 -1 -1 M 6 -2 0 0 1 0 -3 -4 -2 N 7 -1 -2 -1 -1 -2 -4 -3 P 5 1 0
-1 -2 -2 -1 Q 5 -1 -1 -3 -3 -2 R 4 1 -2 -3 -2 S 5 0 -2 -2 T 4 -3 -1
V 11 2 W 7 Y
[0699]
6TABLE IV A POSITION POSITION POSITION 3 (Primary C Terminus 2
(Primary Anchor) Anchor) (Primary Anchor) SUPERMOTIFS A1 TILVMS FWY
A2 LIVMATQ IVMATL A3 VSMATLI RK A24 YFWIVLMT FIYWLM B7 P VILFMWYA
B27 RHK FYLWMIVA B44 ED FWYLIMVA B58 ATS FWYLIVMA B62 QLIVMP
FWYMIVLA MOTIFS A1 TSM Y A1 DEAS Y A2.1 LMVQIAT VLIMAT A3
LMVISATFCGD KYRHFA A11 VTMLISAGNCDF KRYH A24 YFWM FLIW A*3101
MVTALIS RK A*3301 MVALFIST RK A*6801 AVTMSLI RK B*0702 P LMFWYAIV
B*3501 P LMFWYIVA B51 P LIVFWYAM B*5301 P IMFWYALV B*5401 P
ATIVLMFWY
[0700] Bolded residues are preferred, italicized residues are less
preferred: A peptide is considered motif-bearing if it has primary
anchors at each primary anchor position for a motif or supermotif
as specified in the above table.
7TABLE IV (B) HLA CLASS II SUPERMOTIF 1 6 9 W, F, Y, V, I, L A, V,
I, L, P, C, S, T A, V, I, L, C, S, T, M, Y
[0701]
8TABLE IV (C) MOTIFS 1.degree. anchor 1 2 3 4 5 1.degree. anchor 6
7 8 9 DR4 preferred FMYLIVW M T I VSTCPALIM MH MH deleterious W R
WDE DR1 preferred MFLIVWY PAMQ VMATSPLIC M AVM deleterious C CH FD
CWD GDE D DR7 preferred MFLIVWY M W A IVMSACTPL M IV deleterious C
G GRD N G DR3 MOTIFS 1.degree. anchor 1 2 3 1.degree. anchor 4 5
1.degree. anchor 6 motif a LIVMFY D preferred motif b LIVMFAY
DNQEST KRH preferred DR MFLIVWY VMSTACPLI Supermotif Italicized
residues indicate less preferred or "tolerated" residues.
[0702]
9TABLE IV D POSITION SUPERMOTIFS 1 2 3 4 5 6 7 8 C-terminus A1
1.degree. Anchor 1.degree. Anchor TILVMS FWY A2 1.degree. Anchor
1.degree. Anchor {overscore (LIVMATQ)} LIVMAT A3 preferred
1.degree. Anchor YFW (4/5) YFW (3/5) YFW (4/5) P (4/5) 1.degree.
Anchor VSMATLI RK delete- DE (3/5); DE (4/5) rious P (5/5) A24
1.degree. Anchor 1.degree. Anchor {overscore (YFWIVLMT)} FIYWLM B7
preferred FWY (5/5) 1.degree. Anchor FWY (4/5) FWY (3/5) 1.degree.
Anchor LIVM (3/5) P {overscore (VILFMWYA)} delete- DE (3/5); DE
(3/5) G (4/5) QN (4/5) DE (4/5) rious P (5/5); G (4/5); A (3/5); QN
(3/5) B27 1.degree. Anchor 1.degree. Anchor RHK {overscore
(FYLWMIVA)} B44 1.degree. Anchor 1.degree. Anchor ED {overscore
(FWYLIMVA)} B58 1.degree. Anchor 1.degree. Anchor ATS {overscore
(FWYLIVMA)} B62 1.degree. Anchor 1.degree. Anchor QLIVMP {overscore
(FWYMIVLA)}
[0703]
10TABLE IV E 1 2 3 4 5 A1 preferred GFYW 1.degree. Anchor DEA YFW
9-mer STM deleterious DE RHKLIVMP A G A1 preferred GRHK ASTCLIVM
1.degree. Anchor GSTC 9-mer DEAS deleterious A RHKDEPYFW DE PQN A1
preferred YFW 1.degree. Anchor DEAQN A YFWQN 10-mer STM deleterious
GP RHKGLIVM DE RHK A1 preferred YFW STCLIVM 1.degree. Anchor A YFW
10-mer DEAS deleterious RHK RHKDEPYFW P A2.1 preferred YFW
1.degree. Anchor YFW STC YFW 9-mer LMIVQAT deleterious DEP DERKH
A2.1 preferred AYFW 1.degree. Anchor LVIM G 10-mer LMIVQAT
deleterious DEP DE RKHA P A3 preferred RHK 1.degree. Anchor YFW
PRHKYFW A {overscore (LMVISATFCGD)} deleterious DEP DE A11
preferred A 1.degree. Anchor YFW YFW A {overscore (VTLMISAGNCDF)}
deleterious DEP A24 preferred YFWRHK 1.degree. Anchor STC 9-mer
YFWM deleterious DEG DE G QNP A24 preferred 1.degree. Anchor P YFWP
10-mer YFWM deleterious GDE QN RHK A3101 preferred RHK 1.degree.
Anchor YFW P MVTALIS deleterious DEP DE ADE A3301 preferred
1.degree. Anchor YFW {overscore (MVALFIST)} deleterious GP DE A6801
preferred YFWSTC 1.degree. Anchor YFWLIVM AVTMSLI deleterious GP
DEG RHK B0702 preferred RHKFWY 1.degree. Anchor RHK RHK P
deleterious DEQNP DEP DE DE B3501 preferred FWYLIVM 1.degree.
Anchor FWY P deleterious AGP G B51 preferred LIVMFWY 1.degree.
Anchor FWY STC FWY P deleterious AGPDERHKSTC DE B5301 preferred
LIVMFWY 1.degree. Anchor FWY STC FWY P deleterious AGPQN B5401
preferred FWY 1.degree. Anchor FWYLIVM LIVM P deleterious GPQNDE
GDESTC RHKDE 9 or 6 7 8 C-terminus C-terminus A1 preferred P DEQN
YFW 1.degree. Anchor 9-mer Y deleterious A A1 preferred ASTC LIVM
DE 1.degree. Anchor 9-mer Y deleterious RHK PG GP A1 preferred
PASTC GDE P 1.degree. Anchor 10-mer Y deleterious QNA RHKYFW RHK A
A1 preferred PG YFW 1.degree. Anchor 10-mer Y deleterious G PRHK QN
A2.1 preferred A P 1.degree. Anchor 9-mer VLIMAT deleterious RKH
DERKH A2.1 preferred G RKH FYWL 1.degree. Anchor 10-mer VIM VLIMAT
deleterious RKH DERKH RKH A3 preferred YFW P 1.degree. Anchor
KYRHFA deleterious A11 preferred YFW YFW P 1.degree. Anchor KRYH
deleterious A G A24 preferred YFW YFW 1.degree. Anchor 9-mer FLIW
deleterious DERHK G AQN A24 preferred P 1.degree. Anchor 10-mer
FLIW deleterious DE A QN DEA A3101 preferred YFW YFW AP 1.degree.
Anchor RK deleterious DE DE DE A3301 preferred AYFW 1.degree.
Anchor RK deleterious A6801 preferred YFW P 1.degree. Anchor RK
deleterious A B0702 preferred RHK RHK PA 1.degree. Anchor
{overscore (LMFWYAIV)} deleterious GDE QN DE B3501 preferred FWY
1.degree. Anchor {overscore (LMFWYIVA)} deleterious G B51 preferred
G FWY 1.degree. Anchor {overscore (LIVFWYAM)} deleterious G DEQN
GDE B5301 preferred LIVMFWY FWY 1.degree. Anchor {overscore
(IMFWYALV)} deleterious G RHKQN DE B5401 preferred ALIVM FWYAP
1.degree. Anchor {overscore (ATIVLMFWY)} deleterious DE QNDGE DE
Italicized residues indicate less preferred or "tolerated"
residues. The information in this Table is specific for 9-mers
unless otherwise specified.
[0704]
11TABLE V HLA Peptide Scoring Results - 158P1D7 - A1, 9-mers Score
(Estimate of Half Time of Disassociation of a Molecule Start
Subsequence Residue Containing Rank Position Listing This
Subsequence) Seq.ID# 1 150 VIEPSAFSK 900.000 1. 2 436 NLEYLYLEY
225.000 2. 3 812 LVEQTKNEY 45.000 3. 4 828 HAEPDYLEV 45.000 4. 5
711 GSDAKHLQR 37.500 5. 6 546 CTSPGHLDK 25.000 6. 7 265 SICPTPPVY
10.000 7. 8 351 NIESLSDLR 9.000 8. 9 799 LMETLMYSR 9.000 9. 10 173
ESLPPNIFR 7.500 10. 11 650 DNSPVHLQY 6.250 11. 12 601 LTDAVPLSV
6.250 12. 13 174 SLPPNIFRF 5.000 13. 14 100 IADIEIGAF 5.000 14. 15
682 MVSPMVHVY 5.000 15. 16 102 DIEIGAFNG 4.500 16. 17 134 GLENLEFLQ
4.500 17. 18 47 NCEAKGIKM 4.500 18. 19 383 LVEYFTLEM 4.500 19. 20
401 VLEEGSFMN 4.500 20. 21 388 TLEMLHLGN 4.500 21. 22 749 FQDASSLYR
3.750 22. 23 56 VSEISVPPS 2.700 23. 24 561 NSEILCPGL 2.700 24. 25
431 FLGLHNLEY 2.500 25. 26 291 INDSRMSTK 2.500 26. 27 142 QADNNFITV
2.500 27. 28 502 ILDDLDLLT 2.500 28. 29 522 SCDLVGLQQ 2.500 29. 30
223 NCDLLQLKT 2.500 30. 31 771 ITEYLRKNI 2.250 31. 32 232 WLENMPPQS
1.800 32. 33 171 AIESLPPNI 1.800 33. 34 137 NLEFLQADN 1.800 34. 35
355 LSDLRPPPQ 1.500 35. 36 380 KSDLVEYFT 1.500 36. 37 59 ISVPPSRPF
1.500 37. 38 255 GSILSRLKK 1.500 38. 39 540 VTDDILCTS 1.250 39. 40
308 TKAPGLIPY 1.250 40. 41 817 KNEYFELKA 1.125 41. 42 743 STEFLSFQD
1.125 42. 43 359 RPPPQNPRK 1.000 43. 44 246 VCNSPPFFK 1.000 44. 45
417 YLNGNHLTK 1.000 45. 46 433 GLHNLEYLY 1.000 46. 47 785 DMEAHYPGA
0.900 47. 48 398 RIEVLEEGS 0.900 48. 49 701 EEEEERNEK 0.900 49. 50
833 YLEVLEQQT 0.900 50.
[0705]
12TABLE VI HLA Peptide Scoring Results - 158P1D7 - A1, 10-mers
Score (Estimate of Half Time of Disassociation of a Molecule Start
Subsequence Residue Containing Rank Position Listing This
Subsequence) Seq.ID# 1 56 VSEISVPPSR 27.000 51. 2 669 TTERPSASLY
11.250 52. 3 210 ILDLQLEDNK 10.000 53. 4 781 QLQPDMEAHY 10.000 54.
5 150 VIEPSAFSKL 9.000 55. 6 171 AIESLPPNIF 9.000 56. 7 828
HAEPDYLEVL 9.000 57. 8 123 SLEILKEDTF 9.000 58. 9 398 RIEVLEEGSF
9.000 59. 10 812 LVEQTKNEYF 9.000 60. 11 173 ESLPPNIFRF 7.500 61.
12 546 CTSPGHLDKK 5.000 62. 13 134 GLENLEFLQA 4.500 63. 14 401
VLEEGSFMNL 4.500 64. 15 380 KSDLVEYFTL 3.750 65. 16 456 NPMPKLKVLY
2.500 66. 17 505 DLDLLTQIDL 2.500 67. 18 502 ILDDLDLLTQ 2.500 68.
19 743 STEFLSFQDA 2.250 69. 20 771 ITEYLRKNIA 2.250 70. 21 682
MVSPMVHVYR 2.000 71. 22 214 QLEDNKWACN 1.800 72. 23 355 LSDLRPPPQN
1.500 73. 24 264 ESICPTPPVY 1.500 74. 25 753 SSLYRNILEK 1.500 75.
26 561 NSEILCPGLV 1.350 76. 27 601 LTDAVPLSVL 1.250 77. 28 276
HEDPSGSLHL 1.250 78. 29 590 TTNTADTILR 1.250 79. 30 149 TVIEPSAFSK
1.000 80. 31 106 GAFNGLGLLK 1.000 81. 32 801 ETLMYSRPRK 1.000 82.
33 545 LCTSPGHLDK 1.000 83. 34 824 KANLHAEPDY 1.000 84. 35 525
LVGLQQWIQK 1.000 85. 36 300 TTSILKLPTK 1.000 86. 37 477 HIFSGVPLTK
1.000 87. 38 100 IADIEIGAFN 1.000 88. 39 768 QLGITEYLRK 1.000 89.
40 245 VVCNSPPFFK 1.000 90. 41 721 LLEQENHSPL 0.900 91. 42 700
LEEEEERNEK 0.900 92. 43 102 DIEIGAFNGL 0.900 93. 44 441 YLEYNAIKEI
0.900 94. 45 436 NLEYLYLEYN 0.900 95. 46 36 NCEEKDGTML 0.900 96. 47
513 DLEDNPWDCS 0.900 97. 48 383 LVEYFTLEML 0.900 98. 49 388
TLEMLHLGNN 0.900 99. 50 137 NLEFLQADNN 0.900 100.
[0706]
13TABLE VII HLA Peptide Scoring Results - 158P1D7 - A2, 9-mers
Score (Estimate of Half Time of Disassociation of a Molecule Start
Subsequence Residue Containing Rank Position Listing This
Subsequence) Seq.ID# 1 465 YLNNNLLQV 735.860 101. 2 614 LLIMFITIV
423.695 102. 3 193 NQLQTLPYV 330.059 103. 4 616 IMFITIVFC 285.492
104. 5 140 FLQADNNFI 263.950 105. 6 415 KLYLNGNHL 239.259 106. 7
439 YLYLEYNAI 230.356 107. 8 611 ILGLLIMFI 224.357 108. 9 2
KLWIHLFYS 158.832 109. 10 429 GMFLGLHNL 131.296 110. 11 581
YLMVTTPAT 126.833 111. 12 463 VLYLNNNLL 116.211 112. 13 574
SMPTQTSYL 84.856 113. 14 71 LLNNGLTML 83.527 114. 15 4 WIHLFYSSL
77.017 115. 16 305 KLPTKAPGL 74.768 116. 17 613 GLLIMFITI 73.343
117. 18 213 LQLEDNKWA 71.445 118. 19 826 NLHAEPDYL 57.572 119. 20
803 LMYSRPRKV 54.652 120. 21 501 NILDDLDLL 50.218 121. 22 798
KLMETLMYS 50.051 122. 23 527 GLQQWIQKL 49.134 123. 24 158 KLNRLKVLI
36.515 124. 25 178 NIFRFVPLT 33.135 125. 26 225 DLLQLKTWL 32.604
126. 27 462 KVLYLNNNL 24.206 127. 28 767 QQLGITEYL 21.597 128. 29
116 QLHINHNSL 21.362 129. 30 68 QLSLLNNGL 21.362 130. 31 502
ILDDLDLLT 20.776 131. 32 70 SLLNNGLTM 18.382 132. 33 470 LLQVLPPHI
17.736 133. 34 391 MLHLGNNRI 17.736 134. 35 164 VLILNDNAI 17.736
135. 36 337 VLSPSGLLI 17.736 136. 37 774 YLRKNIAQL 17.177 137. 38
450 ILPGTFNPM 16.047 138. 39 323 QLPGPYCPI 15.649 139. 40 367
KLILAGNII 14.971 140. 41 316 YITKPSTQL 13.512 141. 42 141 LQADNNFIT
12.523 142. 43 214 QLEDNKWAC 9.777 143. 44 582 LMVTTPATT 9.149 144.
45 758 NILEKEREL 8.912 145. 46 17 SLHSQTPVL 8.759 146. 47 182
FVPLTHLDL 8.598 147. 48 609 VLILGLLIM 7.964 148. 49 295 RMSTKTTSI
7.535 149. 50 309 KAPGLIPYI 6.415 150.
[0707]
14TABLE VIII HLA Peptide Scoring Results - 158P1D7 - A2, 10-mers
Score (Estimate of Half Time of Disassociation of a Molecule Start
Subsequence Residue Containing Rank Position Listing This
Subsequence) Seq.ID# 1 613 GLLIMFITIV 922.161 151. 2 431 FLGLHNLEYL
609.108 152. 3 616 IMFITIVFCA 301.064 153. 4 600 SLTDAVPLSV 285.163
154. 5 417 YLNGNHLTKL 226.014 155. 6 473 VLPPHIFSGV 224.653 156. 7
70 SLLNNGLTML 181.794 157. 8 433 GLHNLEYLYL 176.240 158. 9 166
ILNDNAIESL 167.806 159. 10 407 FMNLTRLQKL 163.232 160. 11 174
SLPPNIFRFV 145.364 161. 12 425 KLSKGMFLGL 142.060 162. 13 581
YLMVTTPATT 126.833 163. 14 409 NLTRLQKLYL 117.493 164. 15 610
LILGLLIMFI 114.142 165. 16 746 FLSFQDASSL 98.267 166. 17 213
LQLEDNKWAC 97.424 167. 18 141 LQADNNFITV 93.387 168. 19 465
YLNNNLLQVL 92.666 169. 20 369 ILAGNIIHSL 83.527 170. 21 415
KLYLNGNHLT 83.462 171. 22 140 FLQADNNFIT 81.516 172. 23 158
KLNRLKVLIL 70.507 173. 24 611 ILGLLIMFIT 69.289 174. 25 78
MLHTNDFSGL 69.001 175. 26 615 LIMFITIVFC 54.353 176. 27 802
TLMYSRPRKV 51.468 177. 28 531 WIQKLSKNTV 43.992 178. 29 469
NLLQVLPPHI 38.601 179. 30 67 FQLSLLNNGL 36.864 180. 31 803
LMYSRPRKVL 34.412 181. 32 115 KQLHINHNSL 28.049 182. 33 462
KVLYLNNNLL 24.206 183. 34 86 GLTNAISIHL 21.362 184. 35 401
VLEEGSFMNL 18.106 185. 36 44 MLINCEAKGI 17.736 186. 37 596
TILRSLTDAV 17.338 187. 38 621 IVFCAAGIVV 15.695 188. 39 501
NILDDLDLLT 15.544 189. 40 4 WIHLFYSSLL 13.512 190. 41 486
KVNLKTNQFT 12.552 191. 42 163 KVLILNDNAI 11.822 192. 43 336
KVLSPSGLLI 11.822 193. 44 60 SVPPSRPFQL 10.841 194. 45 282
SLHLAATSSI 10.433 195. 46 110 GLGLLKQLHI 10.433 196. 47 766
LQQLGITEYL 9.923 197. 48 126 ILKEDTFHGL 9.902 198. 49 15 CISLHSQTPV
9.563 199. 50 582 LMVTTPATTT 9.149 200.
[0708]
15TABLE IX HLA Peptide Scoring Results - 158P1D7 - A3, 9-mers Score
(Estimate of Half Time of Disassociation of a Molecule Start
Subsequence Residue Containing Rank Position Listing This
Subsequence) Seq.ID# 1 754 SLYRNILEK 300.000 201. 2 417 YLNGNHLTK
60.000 202. 3 407 FMNLTRLQK 40.000 203. 4 433 GLHNLEYLY 36.000 204.
5 802 TLMYSRPRK 30.000 205. 6 43 TMLINCEAK 30.000 206. 7 342
GLLIHCQER 18.000 207. 8 799 LMETLMYSR 18.000 208. 9 613 GLLIMFITI
16.200 209. 10 429 GMFLGLHNL 13.500 210. 11 174 SLPPNIFRF 13.500
211. 12 768 QLGITEYLR 12.000 212. 13 627 GIVVLVLHR 10.800 213. 14
150 VIEPSAFSK 9.000 214. 15 415 KLYLNGNHL 9.000 215. 16 527
GLQQWIQKL 8.100 216. 17 436 NLEYLYLEY 8.000 217. 18 431 FLGLHNLEY
8.000 218. 19 378 LMKSDLVEY 6.000 219. 20 529 QQWIQKLSK 6.000 220.
21 546 CTSPGHLDK 3.000 221. 22 463 VLYLNNNLL 3.000 222. 23 439
YLYLEYNAI 3.000 223. 24 2 KLWIHLFYS 2.700 224. 25 367 KLILAGNII
2.700 225. 26 297 STKTTSILK 2.000 226. 27 6 HLFYSSLLA 2.000 227. 28
632 VLHRRRRYK 2.000 228. 29 409 NLTRLQKLY 2.000 229. 30 611
ILGLLIMFI 1.800 230. 31 337 VLSPSGLLI 1.800 231. 32 305 KLPTKAPGL
1.800 232. 33 390 EMLHLGNNR 1.800 233. 34 158 KLNRLKVLI 1.800 234.
35 682 MVSPMVHVY 1.800 235. 36 616 IMFITIVFC 1.500 236. 37 659
SMYGHKTTH 1.500 237. 38 628 IVVLVLHRR 1.350 238. 39 614 LLIMFITIV
1.350 239. 40 323 QLPGPYCPI 1.350 240. 41 610 LILGLLIMF 1.350 241.
42 729 PLTGSNMKY 1.200 242. 43 453 GTFNPMPKL 1.012 243. 44 228
QLKTWLENM 0.900 244. 45 450 ILPGTFNPM 0.900 245. 46 615 LIMFITIVF
0.900 246. 47 609 VLILGLLIM 0.900 247. 48 255 GSILSRLKK 0.900 248.
49 482 VPLTKVNLK 0.900 249. 50 774 YLRKNIAQL 0.900 250.
[0709]
16TABLE X HLA Peptide Scoring Results - 158P1D7 - A3, 10-mers Score
(Estimate of Half Time of Disassociation of a Molecule Start
Subsequence Residue Containing Rank Position Listing This
Subsequence) Seq.ID# 1 439 YLYLEYNAIK 300.000 251. 2 798 KLMETLMYSR
121.500 252. 3 632 VLHRRRRYKK 60.000 253. 4 768 QLGITEYLRK 40.000
254. 5 477 HIFSGVPLTK 30.000 255. 6 210 ILDLQLEDNK 20.000 256. 7
481 GVPLTKVNLK 18.000 257. 8 681 HMVSPMVHVY 18.000 258. 9 616
IMFITIVFCA 13.500 259. 10 149 TVIEPSAFSK 13.500 260. 11 158
KLNRLKVLIL 10.800 261. 12 425 KLSKGMFLGL 10.800 262. 13 815
QTKNEYFELK 9.000 263. 14 609 VLILGLLIMF 9.000 264. 15 245
VVCNSPPFFK 9.000 265. 16 614 LLIMFITIVF 9.000 266. 17 811
VLVEQTKNEY 9.000 267. 18 377 SLMKSDLVEY 9.000 268. 19 453
GTFNPMPKLK 7.500 269. 20 781 QLQPDMEAHY 6.000 270. 21 655
HLQYSMYGHK 6.000 271. 22 378 LMKSDLVEYF 6.000 272. 23 75 GLTMLHTNDF
6.000 273. 24 106 GAFNGLGLLK 6.000 274. 25 2 KLWIHLFYSS 5.400 275.
26 86 GLTNAISIHL 5.400 276. 27 401 VLEEGSFMNL 5.400 277. 28 42
GTMLINCEAK 4.500 278. 29 613 GLLIMFITIV 4.050 279. 30 627
GIVVLVLHRR 4.050 280. 31 525 LVGLQQWIQK 4.000 281. 32 134
GLENLEFLQA 3.600 282. 33 433 GLHNLEYLYL 3.600 283. 34 110
GLGLLKQLHI 3.600 284. 35 6 HLFYSSLLAC 3.000 285. 36 470 LLQVLPPHIF
3.000 286. 37 194 QLQTLPYVGF 3.000 287. 38 290 SINDSRMSTK 3.000
288. 39 126 ILKEDTFHGL 2.700 289. 40 357 DLRPPPQNPR 2.700 290. 41
796 ELKLMETLMY 2.400 291. 42 546 CTSPGHLDKK 2.250 292. 43 803
LMYSRPRKVL 2.250 293. 44 729 PLTGSNMKYK 2.250 294. 45 369
ILAGNIIHSL 2.025 295. 46 123 SLEILKEDTF 2.000 296. 47 765
ELQQLGITEY 1.800 297. 48 112 GLLKQLHINH 1.800 298. 49 367
KLILAGNIIH 1.800 299. 50 78 MLHTNDFSGL 1.800 300.
[0710]
17TABLE XI HLA Peptide Scoring Results - 158P1D7 - A11, 9-mers
Score (Estimate of Half Time of Disassociation of a Start
Subsequence Residue Molecule Containing Rank Position Listing This
Subsequence) Seq.ID# 1 529 QQWIQKLSK 2.400 301. 2 297 STKTTSILK
2.000 302. 3 546 CTSPGHLDK 2.000 303. 4 754 SLYRNILEK 1.600 304. 5
656 LQYSMYGHK 1.200 305. 6 150 VIEPSAFSK 1.200 306. 7 407 FMNLTRLQK
0.800 307. 8 802 TLMYSRPRK 0.800 308. 9 417 YLNGNHLTK 0.800 309. 10
627 GIVVLVLHR 0.720 310. 11 628 IVVLVLHRR 0.600 311. 12 440
LYLEYNAIK 0.600 312. 13 246 VCNSPPFFK 0.600 313. 14 359 RPPPQNPRK
0.600 314. 15 664 KTTHHTTER 0.600 315. 16 43 TMLINCEAK 0.600 316.
17 730 LTGSNMKYK 0.500 317. 18 478 IFSGVPLTK 0.400 318. 19 107
AFNGLGLLK 0.400 319. 20 372 GNIIHSLMK 0.360 320. 21 342 GLLIHCQER
0.360 321. 22 482 VPLTKVNLK 0.300 322. 23 728 SPLTGSNMK 0.300 323.
24 420 GNHLTKLSK 0.240 324. 25 749 FQDASSLYR 0.240 325. 26 287
ATSSINDSR 0.200 326. 27 790 YPGAHEELK 0.200 327. 28 328 YCPIPCNCK
0.200 328. 29 255 GSILSRLKK 0.180 329. 30 799 LMETLMYSR 0.160 330.
31 768 QLGITEYLR 0.160 331. 32 20 SQTPVLSSR 0.120 332. 33 454
TFNPMPKLK 0.100 333. 34 550 GHLDKKELK 0.090 334. 35 809 RKVLVEQTK
0.090 335. 36 336 KVLSPSGLL 0.090 336. 37 462 KVLYLNNNL 0.090 337.
38 163 KVLILNDNA 0.090 338. 39 252 FFKGSILSR 0.080 339. 40 351
NIESLSDLR 0.080 340. 41 769 LGITEYLRK 0.060 341. 42 526 VGLQQWIQK
0.060 342. 43 453 GTFNPMPKL 0.060 343. 44 42 GTMLINCEA 0.060 344.
45 629 VVLVLHRRR 0.060 345. 46 608 SVLILGLLI 0.060 346. 47 183
VPLTHLDLR 0.060 347. 48 486 KVNLKTNQF 0.060 348. 49 481 GVPLTKVNL
0.060 349. 50 707 NEKEGSDAK 0.060 350.
[0711]
18TABLE XII HLA Peptide Scoring Results - 158P1D7 - A11, 10-mers
Score (Estimate of Half Time of Start Subsequence Disassociation of
a Molecule Seq. Rank Position Residue Listing Containing This
Subsequence) ID # 1 149 TVIEPSAFSK 9.000 351. 2 245 VVCNSPPFFK
6.000 352. 3 42 GTMLINCEAK 6.000 353. 4 481 GVPLTKVNLK 6.000 354. 5
525 LVGLQQWIQK 4.000 355. 6 453 GTFNPMPKLK 3.000 356. 7 106
GAFNGLGLLK 2.400 357. 8 477 HIFSGVPLTK 1.600 358. 9 416 LYLNGNHLTK
1.200 359. 10 528 LQQWIQKLSK 1.200 360. 11 815 QTKNEYFELK 1.000
361. 12 300 TTSILKLPTK 1.000 362. 13 546 CTSPGHLDKK 1.000 363. 14
798 KLMETLMYSR 0.960 364. 15 200 YVGFLEHIGR 0.800 365. 16 406
SFMNLTRLQK 0.800 366. 17 439 YLYLEYNAIK 0.800 367. 18 768
QLGITEYLRK 0.800 368. 19 632 VLHRRRRYKK 0.800 369. 20 801
ETLMYSRPRK 0.450 370. 21 310 APGLIPYITK 0.400 371. 22 789
HYPGAHEELK 0.400 372. 23 655 HLQYSMYGHK 0.400 373. 24 451
LPGTFNPMPK 0.400 374. 25 689 VYRSPSFGPK 0.400 375. 26 545
LCTSPGHLDK 0.400 376. 27 210 ILDLQLEDNK 0.400 377. 28 590
TTNTADTILR 0.400 378. 29 290 SINDSRMSTK 0.400 379. 30 45 LINCEAKGIK
0.400 380. 31 682 MVSPMVHVYR 0.400 381. 32 182 FVPLTHLDLR 0.400
382. 33 767 QQLGITEYLR 0.360 383. 34 627 GIVVLVLHRR 0.360 384. 35
631 LVLHRRRRYK 0.300 385. 36 221 ACNCDLLQLK 0.200 386. 37 336
KVLSPSGLLI 0.180 387. 38 706 RNEKEGSDAK 0.120 388. 39 254
KGSILSRLKK 0.120 389. 40 462 KVLYLNNNLL 0.090 390. 41 163
KVLILNDNAI 0.090 391. 42 621 IVFCAAGIVV 0.080 392. 43 748
SFQDASSLYR 0.080 393. 44 119 INHNSLEILK 0.080 394. 45 753
SSLYRNILEK 0.060 395. 46 60 SVPPSRPFQL 0.060 396. 47 490 KTNQFTHLPV
0.060 397. 48 700 LEEEEERNEK 0.060 398. 49 628 IVVLVLHRRR 0.060
399. 50 608 SVLILGLLIM 0.060 400.
[0712]
19TABLE XIII HLA Peptide Scoring Results - 158P1D7 - A24, 9-mers
Score (Estimate of Half Time of Disassociation of a Start
Subsequence Residue Molecule Containing Rank Position Listing This
Subsequence) Seq.ID# 1 443 EYNAIKEIL 420.000 1 2 789 HYPGAHEEL
330.000 2 3 819 EYFELKANL 288.000 3 4 804 MYSRPRKVL 200.000 4 5 8
FYSSLLACI 60.000 5 6 386 YFTLEMLHL 20.000 6 7 139 EFLQADNNF 18.000
7 8 462 KVLYLNNNL 17.280 8 9 350 RNIESLSDL 14.400 9 10 599
RSLTDAVPL 12.000 10 11 336 KVLSPSGLL 12.000 11 12 305 KLPTKAPGL
12.000 12 13 736 KYKTTNQST 12.000 13 14 580 SYLMVTTPA 10.500 14 15
415 KLYLNGNHL 9.600 15 16 272 VYEEHEDPS 9.000 16 17 202 GFLEHIGRI
9.000 17 18 438 EYLYLEYNA 9.000 18 19 466 LNNNLLQVL 8.640 19 20 767
QQLGITEYL 8.400 20 21 203 FLEHIGRIL 8.400 21 22 607 LSVLILGLL 8.400
22 23 87 LTNAISIHL 8.400 23 24 537 KNTVTDDIL 8.000 24 25 219
KWACNCDLL 8.000 25 26 758 NILEKEREL 7.920 26 27 408 MNLTRLQKL 7.920
27 28 527 GLQQWIQKL 7.920 28 29 416 LYLNGNHLT 7.500 29 30 199
PYVGFLEHI 7.500 30 31 486 KVNLKTNQF 7.200 31 32 109 NGLGLLKQL 7.200
32 33 196 QTLPYVGFL 7.200 33 34 133 HGLENLEFL 7.200 34 35 225
DLLQLKTWL 7.200 35 36 83 DFSGLTNAI 7.200 36 37 456 NPMPKLKVL 7.200
37 38 561 NSEILCPGL 7.200 38 39 501 NILDDLDLL 7.200 39 40 500
SNILDDLDL 6.000 40 41 221 ACNCDLLQL 6.000 41 42 71 LLNNGLTML 6.000
42 43 604 AVPLSVLIL 6.000 43 44 182 FVPLTHLDL 6.000 44 45 347
CQERNIESL 6.000 45 46 669 TTERPSASL 6.000 46 47 10 SSLLACISL 6.000
47 48 590 TTNTADTIL 6.000 48 49 481 GVPLTKVNL 6.000 49 50 432
LGLHNLEYL 6.000 50
[0713]
20TABLE XIV HLA Peptide Scoring Results - 158P1D7 - A24, 10-mers
Score (Estimate of Half Time of Disassociation of a Start
Subsequence Residue Molecule Containing Rank Position Listing This
Subsequence) Seq.ID# 1 773 EYLRKNIAQL 300.000 401. 2 385 EYFTLEMLHL
200.000 402. 3 438 EYLYLEYNAI 90.000 403. 4 181 RFVPLTHLDL 72.000
404. 5 202 GFLEHIGRIL 50.400 405. 6 677 LYEQHMVSPM 37.500 406. 7
315 PYITKPSTQL 30.000 407. 8 252 FFKGSILSRL 28.000 408. 9 622
VFCAAGIVVL 20.000 409. 10 179 IFRFVPLTHL 20.000 410. 11 359
RPPPQNPRKL 15.840 411. 12 462 KVLYLNNNLL 14.400 412. 13 115
KQLHINHNSL 14.400 413. 14 757 RNILEKEREL 13.200 414. 15 832
DYLEVLEQQT 12.960 415. 16 691 RSPSFGPKHL 12.000 416. 17 428
KGMFLGLHNL 12.000 417. 18 158 KLNRLKVLIL 12.000 418. 19 131
TFHGLENLEF 11.000 419. 20 425 KLSKGMFLGL 9.600 420. 21 150
VIEPSAFSKL 9.504 421. 22 139 EFLQADNNFI 9.000 422. 23 102
DIEIGAFNGL 8.640 423. 24 465 YLNNNLLQVL 8.640 424. 25 67 FQLSLLNNGL
8.640 425. 26 401 VLEEGSFMNL 8.640 426. 27 497 LPVSNILDDL 8.400
427. 28 766 LQQLGITEYL 8.400 428. 29 96 GFNNIADIEI 8.250 429. 30
738 KTTNQSTEFL 8.000 430. 31 380 KSDLVEYFTL 8.000 431. 32 295
RMSTKTTSIL 8.000 432. 33 526 VGLQQWIQKL 7.920 433. 34 407
FMNLTRLQKL 7.920 434. 35 580 SYLMVTTPAT 7.500 435. 36 464
LYLNNNLLQV 7.500 436. 37 828 HAEPDYLEVL 7.200 437. 38 329
CPIPCNCKVL 7.200 438. 39 36 NCEEKDGTML 7.200 439. 40 346 HCQERNIESL
7.200 440. 41 166 ILNDNAIESL 7.200 441. 42 60 SVPPSRPFQL 7.200 442.
43 605 VPLSVLILGL 7.200 443. 44 480 SGVPLTKVNL 7.200 444. 45 603
DAVPLSVLIL 7.200 445. 46 494 FTHLPVSNIL 6.720 446. 47 592
NTADTILRSL 6.720 447. 48 417 YLNGNHLTKL 6.600 448. 49 118
HINHNSLEIL 6.000 449. 50 500 SNILDDLDLL 6.000 450.
[0714]
21TABLE XV HLA Peptide Scoring Results - 158P1D7 - B7, 9-mers Score
(Estimate of Half Time of Disassociation of a Start Subsequence
Residue Molecule Containing Rank Position Listing This Subsequence)
Seq.ID# 1 456 NPMPKLKVL 240.000 451. 2 458 MPKLKVLYL 80.000 452. 3
692 SPSFGPKHL 80.000 453. 4 61 VPPSRPFQL 80.000 454. 5 517
NPWDCSCDL 80.000 455. 6 604 AVPLSVLIL 60.000 456. 7 26 SSRGSCDSL
40.000 457. 8 207 IGRILDLQL 40.000 458. 9 410 LTRLQKLYL 40.000 459.
10 159 LNRLKVLIL 40.000 460. 11 774 YLRKNIAQL 40.000 461. 12 625
AAGIVVLVL 36.000 462. 13 336 KVLSPSGLL 30.000 463. 14 481 GVPLTKVNL
20.000 464. 15 182 FVPLTHLDL 20.000 465. 16 462 KVLYLNNNL 20.000
466. 17 652 SPVHLQYSM 20.000 467. 18 575 MPTQTSYLM 20.000 468. 19
752 ASSLYRNIL 18.000 469. 20 370 LAGNIIHSL 12.000 470. 21 154
SAFSKLNRL 12.000 471. 22 713 DAKHLQRSL 12.000 472. 23 221 ACNCDLLQL
12.000 473. 24 106 GAFNGLGLL 12.000 474. 25 249 SPPFFKGSI 8.000
475. 26 306 LPTKAPGLI 8.000 476. 27 250 PPFFKGSIL 8.000 477. 28 360
PPPQNPRKL 8.000 478. 29 453 GTFNPMPKL 6.000 479. 30 310 APGLIPYIT
6.000 480. 31 316 YITKPSTQL 6.000 481. 32 400 EVLEEGSFM 5.000 482.
33 429 GMFLGLHNL 4.000 483. 34 418 LNGNHLTKL 4.000 484. 35 544
ILCTSPGHL 4.000 485. 36 826 NLHAEPDYL 4.000 486. 37 350 RNIESLSDL
4.000 487. 38 4 WIHLFYSSL 4.000 488. 39 501 NILDDLDLL 4.000 489. 40
109 NGLGLLKQL 4.000 490. 41 607 LSVLILGLL 4.000 491. 42 71
LLNNGLTML 4.000 492. 43 599 RSLTDAVPL 4.000 493. 44 739 TTNQSTEFL
4.000 494. 45 87 LTNAISIHL 4.000 495. 46 130 DTFHGLENL 4.000 496.
47 415 KLYLNGNHL 4.000 497. 48 175 LPPNIFRFV 4.000 498. 49 105
IGAFNGLGL 4.000 499. 50 296 MSTKTTSIL 4.000 500.
[0715]
22TABLE XVI HLA Peptide Scoring Results - 158P1D7 - B7, 10-mers
Score (Estimate of Half Time of Disassociation of a Start
Subsequence Residue Molecule Containing Rank Position Listing This
Subsequence) Seq.ID# 1 249 SPPFFKGSIL 80.000 501. 2 548 SPGHLDKKEL
80.000 502. 3 497 LPVSNILDDL 80.000 503. 4 329 CPIPCNCKVL 80.000
504. 5 790 YPGAHEELKL 80.000 505. 6 605 VPLSVLILGL 80.000 506. 7
359 RPPPQNPRKL 80.000 507. 8 189 DLRGNQLQTL 40.000 508. 9 647
QMRDNSPVHL 40.000 509. 10 566 CPGLVNNPSM 20.000 510. 11 807
RPRKVLVEQT 20.000 511. 12 462 KVLYLNNNLL 20.000 512. 13 60
SVPPSRPFQL 20.000 513. 14 713 DAKHLQRSLL 18.000 514. 15 751
DASSLYRNIL 18.000 515. 16 603 DAVPLSVLIL 12.000 516. 17 624
CAAGIVVLVL 12.000 517. 18 428 KGMFLGLHNL 12.000 518. 19 825
ANLHAEPDYL 12.000 519. 20 220 WACNCDLLQL 12.000 520. 21 803
LMYSRPRKVL 9.000 521. 22 198 LPYVGFLEHI 8.000 522. 23 361
PPQNPRKLIL 8.000 523. 24 176 PPNIFRFVPL 8.000 524. 25 475
PPHIFSGVPL 8.000 525. 26 62 PPSRPFQLSL 8.000 526. 27 179 IFRFVPLTHL
6.000 527. 28 668 HTTERPSASL 6.000 528. 29 383 LVEYFTLEML 6.000
529. 30 608 SVLILGLLIM 5.000 530. 31 393 HLGNNRIEVL 4.000 531. 32
589 TTTNTADTIL 4.000 532. 33 738 KTTNQSTEFL 4.000 533. 34 78
MLHTNDFSGL 4.000 534. 35 16 ISLHSQTPVL 4.000 535. 36 9 YSSLLACISL
4.000 536. 37 814 EQTKNEYFEL 4.000 537. 38 407 FMNLTRLQKL 4.000
538. 39 575 MPTQTSYLMV 4.000 539. 40 4 WIHLFYSSLL 4.000 540. 41 417
YLNGNHLTKL 4.000 541. 42 63 PSRPFQLSLL 4.000 542. 43 757 RNILEKEREL
4.000 543. 44 108 FNGLGLLKQL 4.000 544. 45 409 NLTRLQKLYL 4.000
545. 46 556 ELKALNSEIL 4.000 546. 47 166 ILNDNAIESL 4.000 547. 48
217 DNKWACNCDL 4.000 548. 49 364 NPRKLILAGN 4.000 549. 50 295
RMSTKTTSIL 4.000 550.
[0716]
23TABLE XVIII HLA Peptide Scoring Results - 158P1D7 - B35, 10-mers
Score (Estimate of Half Time of Disassociation of a Start
Subsequence Residue Molecule Containing Rank Position Listing This
Subsequence) Seq.ID# 1 319 KPSTQLPGPY 80.000 601. 2 566 CPGLVNNPSM
40.000 602. 3 728 SPLTGSNMKY 40.000 603. 4 572 NPSMPTQTSY 40.000
604. 5 652 SPVHLQYSMY 40.000 605. 6 359 RPPPQNPRKL 40.000 606. 7
456 NPMPKLKVLY 40.000 607. 8 548 SPGHLDKKEL 30.000 608. 9 790
YPGAHEELKL 30.000 609. 10 329 CPIPCNCKVL 20.000 610. 11 249
SPPFFKGSIL 20.000 611. 12 605 VPLSVLILGL 20.000 612. 13 497
LPVSNILDDL 20.000 613. 14 156 FSKLNRLKVL 15.000 614. 15 824
KANLHAEPDY 12.000 615. 16 807 RPRKVLVEQT 12.000 616. 17 747
LSFQDASSLY 10.000 617. 18 691 RSPSFGPKHL 10.000 618. 19 264
ESICPTPPVY 10.000 619. 20 651 NSPVHLQYSM 10.000 620. 21 69
LSLLNNGLTM 10.000 621. 22 796 ELKLMETLMY 9.000 622. 23 713
DAKHLQRSLL 9.000 623. 24 198 LPYVGFLEHI 8.000 624. 25 517
NPWDCSCDLV 8.000 625. 26 499 VSNILDDLDL 7.500 626. 27 126
ILKEDTFHGL 6.000 627. 28 370 LAGNIIHSLM 6.000 628. 29 458
MPKLKVLYLN 6.000 629. 30 364 NPRKLILAGN 6.000 630. 31 647
QMRDNSPVHL 6.000 631. 32 446 AIKEILPGTF 6.000 632. 33 535
LSKNTVTDDI 6.000 633. 34 25 LSSRGSCDSL 5.000 634. 35 9 YSSLLACISL
5.000 635. 36 173 ESLPPNIFRF 5.000 636. 37 16 ISLHSQTPVL 5.000 637.
38 380 KSDLVEYFTL 4.500 638. 39 220 WACNCDLLQL 4.500 639. 40 435
HNLEYLYLEY 4.000 640. 41 236 MPPQSIIGDV 4.000 641. 42 382
DLVEYFTLEM 4.000 642. 43 35 CNCEEKDGTM 4.000 643. 44 575 MPTQTSYLMV
4.000 644. 45 777 KNIAQLQPDM 4.000 645. 46 191 RGNQLQTLPY 4.000
646. 47 65 RPFQLSLLNN 4.000 647. 48 811 VLVEQTKNEY 4.000 648. 49 46
INCEAKGIKM 4.000 649. 50 556 ELKALNSEIL 3.000 650.
[0717]
24TABLE XIX Motif-bearing Subsequences of the 158P1D7 Protein
Protein Motifs of 158P1D7 N-glycosylation site Number of matches: 3
1 292-295 NDSR 2 409-412 NLTR 3 741-744 NQST cAMP- and
cGMP-dependent protein kinase phosphorylation site 262-265 KKES
Protein kinase C phosphorylation site Number of matches: 3 1 26-28
SSR 2 297-299 STK 3 670-672 TER Casein kinase II phosphorylation
site Number of matches: 12 1 149-152 TVIE 2 186-189 THLD 3 231-234
TWLE 4 290-293 SIND 5 354-357 SLSD 6 510-513 TQID 7 539-542 TVTD 8
600-603 SLTD 9 676-679 SLYE 10 720-723 SLLE 11 748-751 SFQD 12
816-819 TKNE Tyrosine kinase phosphorylation site 798-805 KLMETLMY
N-myristoylation site Number of matches: 8 1 29-34 GSCDSL 2 86-91
GLTNAI 3 106-111 GAFNGL 4 255-260 GSILSR 5 405-410 GSFMNL 6 420-425
GNHLTK 7 429-434 GMFLGL 8 481-486 GVPLTK Two Protein Motifs were
predicted by Pfam 1-Archaeal-ATPase at aa 441-451 2-Leucine rich
repeat C-terminal at aa 218-268 and aa 517-567
[0718]
25TABLE XX Frequently Occurring Motifs avrg. % Name identity
Description Potential Function zf-C2H2 34% Zinc finger, C2H2 type
Nucleic acid-binding protein functions as transcription factor,
nuclear location probable cytochrome_b_N 68% Cytochrome b(N-
membrane bound oxidase, generate terminal)/b6/petB superoxide ig
19% Immunoglobulin domain domains are one hundred amino acids long
and include a conserved intradomain disulfide bond. WD40 18% WD
domain, G-beta repeat tandem repeats of about 40 residues, each
containing a Trp-Asp motif. Function in signal transduction and
protein interaction PDZ 23% PDZ domain may function in targeting
signaling molecules to sub-membranous sites LRR 28% Leucine Rich
Repeat short sequence motifs involved in protein- protein
interactions pkinase 23% Protein kinase domain conserved catalytic
core common to both serine/threonine and tyrosine protein kinases
containing an ATP binding site and a catalytic site PH 16% PH
domain pleckstrin homology involved in intracellular signaling or
as constituents of the cytoskeleton EGF 34% EGF-like domain 30-40
amino-acid long found in the extracellular domain of membrane-bound
proteins or in secreted proteins rvt 49% Reverse transcriptase
(RNA-dependent DNA polymerase) ank 25% Ank repeat Cytoplasmic
protein, associates integral membrane proteins to the cytoskeleton
oxidored_q1 32% NADH- membrane associated. Involved in proton
Ubiquinone/plastoquinone translocation across the membrane (complex
I), various chains efhand 24% EF hand calcium-binding domain,
consists of a12 residue loop flanked on both sides by a 12 residue
alpha-helical domain rvp 79% Retroviral aspartyl protease Aspartyl
or acid proteases, centered on a catalytic aspartyl residue
Collagen 42% Collagen triple helix repeat extracellular structural
proteins involved in (20 copies) formation of connective tissue.
The sequence consists of the G-X-Y and the polypeptide chains forms
a triple helix. fn3 20% Fibronectin type III domain Located in the
extracellular ligand-binding region of receptors and is about 200
amino acid residues long with two pairs of cysteines involved in
disulfide bonds 7tm_1 19% 7 transmembrane receptor seven
hydrophobic transmembrane regions, (rhodopsin family) with the
N-terminus located extracellularly while the C-terminus is
cytoplasmic. Signal through G proteins
[0719]
26TABLE VII TNM CLASSIFICATION OF BLADDER TUMORS Primary tumor (T)
The suffix (m) should be added to the appropriate T category to
indicate multiple tumors. The suffix (is) may be added to any T to
indicate the presence of associated carcinoma in situ. TX Primary
tumor cannot be assessed TO No evidence of primary tumor Ta
Noninvasive papillary carcinoma Tis Carcinoma in situ: "flat tumor"
T1 Tumor invades sub-epithelial connective tissue T2 Tumor invades
superficial muscle (inner half) T3 Tumor invades deep muscle or
perivesical fat T3a Tumor invades deep muscle (outer half) T3b
Tumor invades perivesical fat i. microscopically ii.
macroscopically (extravesical mass) T4 Tumor invades any of the
following: prostate, uterus, vagina, pelvic wall, or abdominal wall
T4a Tumor invades the prostate, uterus, vagina T4b Tumor invades
the pelvic wall or abdominal wall or both Regional lymph nodes (N)
Regional lymph nodes are those within the true pelvis: all others
are distant nodes NX Regional lymph nodes cannot be assessed N0 No
regional lymph node metastasis N1 Metastasis in a single lymph
node, 2 cm or less in greatest dimension N2 Metastasis in a single
lymph node, more than 2 cm but not more than 5 cm in greatest
dimension, or multiple lymph nodes, none more than 5 cm in greatest
dimension N3 Metastasis in a lymph node more than 5 cm in greatest
dimension Distant metastasis (M) MX Presence of distant metastasis
cannot be assessed M0 No distant metastasis M1 Distant metastasis
Stage grouping Stage 0.sub.a Ta N0 M0 0.sub.is Tis N0 M0 I T1 N0 M0
II T2 N0 M0 T3a N0 M0 III T3b N0 M0 T4a N0 M0 IV T4b N0 M0 Any T
N1-3 M0 Any T Any N M1
[0720]
Sequence CWU 0
0
* * * * *
References