U.S. patent application number 10/072571 was filed with the patent office on 2003-10-16 for co-administration of interleukin-3 mutant polypeptides with csf's for multi-lineage hematopoietic cell production.
Invention is credited to Abrams, Mark, Bauer, S. Christopher, Braford-Goldberg, Sarah, Caparon, Maire, Easton, Alan, Klein, Barbara, McKearn, John P., Olins, Peter, Paik, Kumnan, Thomas, John.
Application Number | 20030194783 10/072571 |
Document ID | / |
Family ID | 28794946 |
Filed Date | 2003-10-16 |
United States Patent
Application |
20030194783 |
Kind Code |
A1 |
McKearn, John P. ; et
al. |
October 16, 2003 |
Co-administration of interleukin-3 mutant polypeptides with CSF's
for multi-lineage hematopoietic cell production
Abstract
The present invention relates to human interleukin-3 (hIL-3)
variant or mutant proteins (muteins) functionally co-administered
with a other colony stimulating factors (CSF), cytokines,
lymphokines, interleukins, hematopoietic growth factors or IL-3
variants.
Inventors: |
McKearn, John P.; (Glencoe,
MO) ; Olins, Peter; (San Diego, CA) ; Thomas,
John; (Potomac, MD) ; Caparon, Maire;
(Chesterfield, MO) ; Easton, Alan; (Maryland
Heights, MO) ; Klein, Barbara; (St. Louis, MO)
; Bauer, S. Christopher; (New Haven, MO) ; Abrams,
Mark; (St. Louis, MO) ; Paik, Kumnan; (US)
; Braford-Goldberg, Sarah; (Chesterfield, MO) |
Correspondence
Address: |
LaVern Hall
800 N. Linderbergh
Mail Zone O4E
St. Louis
MO
63167
US
|
Family ID: |
28794946 |
Appl. No.: |
10/072571 |
Filed: |
February 8, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10072571 |
Feb 8, 2002 |
|
|
|
08446871 |
Jun 6, 1995 |
|
|
|
6361976 |
|
|
|
|
08446871 |
Jun 6, 1995 |
|
|
|
08193373 |
Feb 4, 1994 |
|
|
|
6153183 |
|
|
|
|
08193373 |
Feb 4, 1994 |
|
|
|
PCT/US93/11197 |
Nov 22, 1993 |
|
|
|
PCT/US93/11197 |
Nov 22, 1993 |
|
|
|
07981044 |
Nov 24, 1992 |
|
|
|
Current U.S.
Class: |
435/69.52 ;
435/320.1; 435/325; 530/351; 536/23.5 |
Current CPC
Class: |
C07K 2319/02 20130101;
A61K 38/18 20130101; A61K 38/00 20130101; A61K 38/27 20130101; A61K
38/18 20130101; A61K 38/1816 20130101; A61K 38/1816 20130101; A61K
2300/00 20130101; A61K 2300/00 20130101; A61K 38/20 20130101; A61K
38/20 20130101; A61K 38/27 20130101; A61K 38/193 20130101; A61K
2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00 20130101;
A61K 38/193 20130101; C07K 14/5403 20130101; C07K 2319/00
20130101 |
Class at
Publication: |
435/69.52 ;
530/351; 435/325; 435/320.1; 536/23.5 |
International
Class: |
C12P 021/04; C07H
021/04; C12N 005/06; C07K 014/54 |
Claims
What is claimed is:
1. A composition, comprising: a human interleukin-3 mutant
polypeptide of the Formula:
24 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:1] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Lys, Gly, Asp, Met, Gln, or Arg; Xaa at position 18 is Asn,
His, Leu, Ile, Phe, Arg, or Gln; Xaa at position 19 is Met, Phe,
Ile, Arg, Gly, Ala, or Cys; Xaa at position 20 is Ile, Cys, Gln,
Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg,
Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is
Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa
at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Leu, Ser,
or Arg; Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala; Xaa at
position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is
Gln, Asn, Leu, Pro, Arg, or Val; Xaa at position 30 is Pro, His,
Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa at position 31 is Pro,
Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at position 32 is Leu, Val,
Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at position 33 is Pro, Leu,
Gln, Ala, Thr, or Glu; Xaa at position 34 is Leu, Val, Gly, Ser,
Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35
is Leu, Ala, Gly, Asn, Pro, Gln, or Val; Xaa at position 36 is Asp,
Leu, or Val; Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile; Xaa
at position 38 is Asn, or Ala; Xaa at position 40 is Leu, Trp, or
Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val,
Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn,
Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at
position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn,
Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met,
Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa
at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His,
Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, Gly, Val,
Ser, Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg,
Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position
49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp; Xaa at position 50
is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe,
Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or
His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or
Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn,
Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser,
Leu, or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu,
Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57
is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val,
or Cys; Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa
at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr; Xaa at position
61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is
Asn His, Val, Arg, Pro, Thr, Asp, or Ile; Xaa at position 63 is
Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val; Xaa at position 64 is
Ala, Asn, Pro, Ser, or Lys; Xaa at position 65 is Val, Thr, Pro,
His, Leu, Phe, or Ser; Xaa at position 66 is Lys, Ile, Arg, Val,
Asn, Glu, or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly,
Asn, Ile, Pro, or His; Xaa at position 68 is Leu, Val, Trp, Ser,
Ile, Phe, Thr, or His; Xaa at position 69 is Gln, Ala, Pro, Thr,
Glu, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn, Leu, Val,
Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg,
Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu, Met,
Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu, Asp,
Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Met, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, Gln, or Leu; Xaa at position 76 is Ser, Val, Ala,
Asn, Trp, Glu, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser,
Arg, Thr, or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe,
Gly, or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile,
Gly, or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu,
Glu, or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg,
Val, or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp,
Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at
position 83 is Pro, Ala, Thr, Trp, Arg, or Met; Xaa at position 84
is Cys, Glu, Gly, Arg, Met, or Val; Xaa at position 85 is Leu, Asn,
Val, or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa
at position 87 is Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala,
Lys, Arg, Val, or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu,
Val, Glu, His, Asn, or Ser; Xaa at position 90 is Ala, Pro, Ser,
Thr, Gly, Asp, Ile, or Met; Xaa at position 91 is Ala, Pro, Ser,
Thr, Phe, Leu, Asp, or His; Xaa at position 92 is Pro, Phe, Arg,
Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr,
Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at position 94 is Arg,
Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro; Xaa at
position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys,
Ser, Ala, Trp, Phe, Ile, or Tyr; Xaa at position 96 is Pro, Lys,
Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile, Val, Lys, Ala, or
Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu,
Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99
is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His; Xaa at
position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro; Xaa
at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu,
Asn, Ser, Ala, Gly, Ile, Leu, or Gln; Xaa at position 102 is Gly,
Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 103 is Asp, or
Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu,
Gln, Lys, Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala,
Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at
position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or
Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His,
Glu, Ser, Ala, or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp,
or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser,
or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr,
Asp, Lys, Leu, Ile, Val or Asn; Xaa at position 114 is Tyr, Cys,
His, Ser, Trp, Arg, or Leu; Xaa at position 115 is Leu, Asn, Val,
Pro, Arg, Ala, His, Thr, Trp, or Met; Xaa at position 116 is Lys,
Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala,
Tyr, Phe, Gln, or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile,
Trp, Lys, or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu,
Cys, Asp, or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu,
Thr, Tyr, or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His,
Val, or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys,
Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe,
Pro, His, Ile, Tyr, or Cys; Xaa at position 123 is Ala, Met, Glu,
His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 44 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133) human interleukin-3; a colony stimulating factor;
and at least one non-toxic pharmaceutically acceptable carrier.
2. A composition, comprising: a human interleukin-3 mutant
polypeptide of the Formula:
25 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:2] 1 5 10 15 Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu Xaa 50 55 60 Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Gly, Asp, Met, or Gln; Xaa at position 18 is Asn, His, or
Ile; Xaa at position 19 is Met or Ile; Xaa at position 21 is Asp or
Glu; Xaa at position 23 is Ile, Ala, Leu, or Gly; Xaa at position
24 is Ile, Val, or Leu; Xaa at position 25 is Thr, His, Gln, or
Ala; Xaa at position 26 is His or Ala; Xaa at position 29 is Gln,
Asn, or Val; Xaa at position 30 is Pro, Gly, or Gln; Xaa at
position 32 is Leu, Art, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 33 is Pro or Glu; Xaa at position 34 is Leu, Val, Gly,
Ser, Lys, Ala, Arg, Gln, Glu,Ile, Phe, Thr or Met; Xaa at position
35 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at position 37 is Phe,
Ser, Pro, or Trp; Xaa at position 38 is Asn or Ala; Xaa at position
42 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg; Xaa
at position 44 is Asp or Glu; Xaa at position 45 is Gln, Val, Met,
Leu, Thr, Ala, Asn, Glu, Ser or Lys; Xaa at position 46 is Asp,
Phe, Ser, Thr, Ala, Asn Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 50 is Glu, Ala, Asn, Ser or Asp; Xaa at position 51
is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at position 54 is Arg
or Ala; Xaa at position 55 is Arg, Thr, Val, Leu, or Gly; Xaa at
position 56 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr,
Val or Lys; Xaa at position 60 is Ala or Ser; Xaa at position 62 is
Asn, Pro, Thr, or Ile; Xaa at position 63 is Arg or Lys; Xaa at
position 64 is Ala or Asn; Xaa at position 65 is Val or Thr; Xaa at
position 66 is Lys or Arg; Xaa at position 67 is Ser, Phe, or His;
Xaa at position 68 is Leu, Ile, Phe, or His; Xaa at position 69 is
Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at position 71 is Ala,
Pro, or Arg; Xaa at position 72 is Ser, Glu, Arg, or Asp; Xaa at
position 73 is Ala or Leu; Xaa at position 76 is Ser, Val, Ala,
Asn, Glu, Pro, or Gly; Xaa at position 77 is Ile or Leu; Xaa at
position 79 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa
at position 80 is Asn, Gly, Glu, or Arg; Xaa at position 82 is Leu,
Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 83 is Pro or Thr; Xaa at position 85 is
Leu or Val; Xaa at position 87 is Leu or Ser; Xaa at position 88 is
Ala or Trp; Xaa at position 91 is Ala or Pro; Xaa at position 93 is
Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 95 is His,
Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 96
is Pro or Tyr; Xaa at position 97 is Ile or Val; Xaa at position 98
is His, Ile, Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 99 is Ile, Leu, or Val; Xaa at
position 100 is Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position
101 is Asp, Pro, Met, Lys, His, Thr, Pro, Asn, Ile, Leu or Tyr; Xaa
at position 104 is Trp or Leu; Xaa at position 105 is Asn, Pro,
Ala, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at
position 106 is Glu or Gly; Xaa at position 108 is Arg, Ala, or
Ser; Xaa at position 109 is Arg, Thr, Glu, Leu, or Ser; Xaa at
position 112 is Thr, Val, or Gln; Xaa at position 114 is Tyr or
Trp; Xaa at position 115 is Leu or Ala; Xaa at position 116 is Lys,
Thr, Val, Trp, Ser, Ala, His, Met, Phe, Tyr or Ile; Xaa at position
117 is Thr or Ser; Xaa at position 120 is Asn, Pro, Leu, His, Val,
or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Asp, or
Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His,
Ile, Tyr, or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser,
Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 35 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133)human interleukin-3; a colony stimulating factor
selected from the group consisting of GM-CSF, CSF-1, G-CSF, Meg-CSF
(more recently referred to as c-mpl ligand), M-CSF, erythropoietin
(EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10,
IL-11, IL-12, IL-13, LIF, flt3/flk2, human growth hormone, B-cell
growth factor, B-cell differentiation factor, eosinophil
differentiation factor and stem cell factor (SCF); and at least one
non-toxic pharmaceutically acceptable carrier.
3. A composition of claim 2, wherein said human interleukin-3
mutant polypeptide is of the Formula:
26 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:3] 1 5 10 15 Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu Ala 50 55 60 Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp Xaa 95 100 105 Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Gly, Asp, or Gln; Xaa at position 18 is Asn, His, or Ile;
Xaa at position 23 is Ile, Ala, Leu, or Gly; Xaa at position 25 is
Thr, His, or Gln; Xaa at position 26 is His or Ala; Xaa at position
29 is Gln or Asn; Xaa at position 30 is Pro or Gly; Xaa at position
32 is Leu, Arg, Asn, or Ala; Xaa at position 34 is Leu, Val, Ser,
Ala, Arg, Gln, Glu, Ile, Phe, Thr, or Met; Xaa at position 35 is
Leu, Ala, Asn, or Pro; Xaa at position 38 is Asn or Ala; Xaa at
position 42 is Gly, Asp, Ser, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 45 is Gln, Val, Met, Leu, Ala, Asn, Glu, or Lys;
Xaa at position 46 is Asp, Phe, Ser, Gln, Glu, His, Val or Thr; Xaa
at position 50 is Glu Asn, Ser or Asp; Xaa at position 51 is Asn,
Arg, Pro, Thr, or His; Xaa at position 55 is Arg, Leu, or Gly; Xaa
at position 56 is Pro, Gly, Ser, Ala, Asn, Val, Leu or Gln; Xaa at
position 62 is Asn, Pro, or Thr; Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr; Xaa at position 67 is Ser or Phe;
Xaa at position 68 is Leu or Phe; Xaa at position 69 is Gln, Ala,
Glu, or Arg; Xaa at position 76 is Ser, Val, Asn, Pro, or Gly; Xaa
at position 77 is Ile or Leu; Xaa at position 79 is Lys, Gly, Asn,
Met, Arg, Ile, or Gly; Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Asn, Glu, His, Met,
Phe, Ser, Thr, Tyr or Val; Xaa at position 87 is Leu or Ser; Xaa at
position 88 is Ala or Trp; Xaa at position 91 is Ala or Pro; Xaa at
position 93 is Thr, Asp, or Ala; Xaa at position 95 is His, Pro,
Arg, Val, Gly, Asn, Ser or Thr; Xaa at position 98 is His, Ile,
Asn, Ala, Thr, Gln, Glu, Lys, Met, Ser, Tyr, Val or Leu; Xaa at
position 99 is Ile or Leu; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, Met, Lys, Thr, His, Pro, Asn, Ile, Leu
or Tyr; Xaa at position 105 is Asn, Pro, Ser, Ile or Asp; Xaa at
position 108 is Arg, Ala, or Ser; Xaa at position 109 is Arg, Thr,
Glu, Leu, or Ser; Xaa at position 112 is Thr or Gln; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, Tyr or Ile; Xaa at
position 117 is Thr or Ser; Xaa at position 120 is Asn, Pro, Leu,
His, Val, or Gln; Xaa at position 121 is Ala, Ser, Ile, Pro, or
Asp; Xaa at position 122 is Gln, Met, Trp, Phe, Pro, His, Ile, or
Tyr; Xaa at position 123 is Ala, Met, Glu, Ser, or Leu;
and which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 44 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133)human interleukin-3.
4. A composition of claim 3, wherein said human interleukin-3
mutant polypeptide is of the Formula:
27 Xaa at position 42 is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
Xaa at position 45 is Gln, Val, Met or Asn; Xaa at position 46 is
Asp, Ser, Gln, His or Val; Xaa at position 50 is Glu or Asp; Xaa at
position 51 is Asn, Pro or Thr; Xaa at position 62 is Asn or Pro;
Xaa at position 76 is Ser, or Pro; Xaa at position 82 is Leu, Trp,
Asp, Asn Glu, His, Phe, Ser or Tyr; Xaa at position 95 is His, Arg,
Thr, Asn or Ser; Xaa at position 98 is His, Ile, Leu, Ala, Gln,
Lys, Met, Ser, Tyr or Val; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, His, Asn, Ile or Leu; Xaa at position
105 is Asn, or Pro; Xaa at position 108 is Arg, Ala, or Ser; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, or Tyr; Xaa at
position 121 is Ala, or Ile; Xaa at position 122 is Gln, or Ile;
and Xaa at position 123 is Ala, Met or Glu.
5. A composition, comprising: a human interleukin-3 mutant
polypeptide of the Formula:
28 Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa [SEQ
ID NO:4] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or
Arg; Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa
at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys; Xaa at
position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position
7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln,
Leu, Val, or Gly; Xaa at position 9 is Ile, Val, Ala, Leu, Gly,
Trp, Lys, Phe, Leu, Ser, or Arg; Xaa at position 10 is Ile, Gly,
Val, Arg, Ser, Phe, or Leu; Xaa at position 11 is Thr, His, Gly,
Gln, Arg, Pro, or Ala; Xaa at position 12 is His, Thr, Phe, Gly,
Arg, Ala, or Trp; Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or
Ala; Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or
Trp; Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val; Xaa at
position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa
at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at
position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro, Leu, Gln, Ala, Thr, or Glu; Xaa at position 20
is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or
Met; Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val; Xaa at position 23 is Phe,
Ser, Pro, Trp, or Ile; Xaa at position 24 is Asn, or Ala; Xaa at
position 26 is Leu, Trp, or Arg; Xaa at position 27 is Asn, Cys,
Arg, Leu, His, Met, Pro; Xaa at position 28 is Gly, Asp, Ser, Cys,
Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met; Xaa at
position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg,
Thr, Gly or Ser; Xaa at position 30 is Asp, Ser, Leu, Arg, Lys,
Thr,Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 31 is Gln,
Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile,
Glu, His or Trp; Xaa at position 32 is Asp, Phe, Ser, Thr, Cys,
Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position
33 is Ile, Gly, Val, Ser, Arg, Pro, or His; Xaa at position 34 is
Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or
Asn; Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or
Asp; Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser,
Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 37 is Asn,
Arg, Met, Pro, Ser, Thr, or His; Xaa at position 38 is Asn, His,
Arg, Leu, Gly, Ser, or Thr; Xaa at position 39 is Leu, Thr, Ala,
Gly, Glu, Pro, Lys, Ser, Met, or; Xaa at position 40 is Arg, Asp,
Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position
41 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 42 is Pro,
Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or
Lys; Xaa at position 43 is Asn or Gly; Xaa at position 44 is Leu,
Ser, Asp, Arg, Gln, Val, or Cys; Xaa at position 45 is Glu Tyr,
His, Leu, Pro, or Arg; Xaa at position 46 is Ala, Ser, Pro, Tyr,
Asn, or Thr; Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or
Ser; Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or
Ile; Xaa at position 49 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or
Val; Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys; Xaa at
position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser; Xaa at
position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa
at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His; Xaa at
position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu; Xaa
at position 56 is Asn, Leu, Val, Trp, Pro, or Ala; Xaa at position
57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at
position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp; Xaa at
position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at
position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position
61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu; Xaa at
position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp; Xaa
at position 63 is Ile, Ser, Arg, Thr, or Leu; Xaa at position 64 is
Leu, Ala, Ser, Glu, Phe, Gly, or Arg; Xaa at position 65 is Lys,
Thr, Gly, Asn, Met, Arg, Ile, or Asp; Xaa at position 66 is Asn,
Trp, Val, Gly, Thr, Leu, Glu, or Arg; Xaa at position 67 is Leu,
Gln, Gly, Ala, Trp, Arg, Val, or Lys; Xaa at position 68 is Leu,
Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe,
Ile, Met or Val; Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or
Met; Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val; Xaa at
position 71 is Leu, Asn, Val, or Gln; Xaa at position 72 is Pro,
Cys, Arg, Ala, or Lys; Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp; Xaa at position
75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser; Xaa at
position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met; Xaa at
position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His,
Ala or Pro; Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu,
Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position
82 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 83 is Ile,
Val, Lys, Ala, or Asn; Xaa at position 84 is His, Ile, Asn, Leu,
Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser,
Phe, or His; Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile,
Ser, Gln, Pro; Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr,
Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position
88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 89 is
Asp, or Ser; Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met,
Pro, Leu, Gln, Lys, Ala, Phe, or Gly; Xaa at position 91 is Asn,
Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa
at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or
Pro; Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu,
Ser, Ala or Trp; Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys,
Leu, Ile, Val or Asn; Xaa at position 100 is Tyr, Cys, His, Ser,
Trp, Arg, or Leu; Xaa at position 101 is Leu, Asn, Val, Pro, Arg,
Ala, His, Thr, Trp, or Met; Xaa at position 102 is Lys, Leu, Pro,
Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe,
Gln, or Ile; Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys,
or Pro; Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp,
or Tyr; Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr,
or Arg; Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or
Gln; Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly; Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His,
Ile, Tyr, or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser,
Pro, Tyr, or Leu;
and which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding native
amino acids of (1-133) human interleukin-3; a colony stimulating
factor selected from the group consisting of GM-CSF, CSF-1, G-CSF,
Meg-CSF (more recently referred to as c-mpl ligand), M-CSF,
erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, LIF, flt3/flk2, human growth
hormone, B-cell growth factor, B-cell differentiation factor,
eosinophil differentiation factor and stem cell factor (SCF); and
at least one non-toxic pharmaceutically acceptable carrier.
6. A composition of claim 5, wherein said human interleukin-3
mutant polypeptide is of the Formula:
29 Asn Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu Lys Xaa ]SEQ
ID NO:5] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu 35 40 45 Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu; Xaa at position 9 is lie, Ala,
Leu, or Gly; Xaa at position 10 is Ile, Val, or Leu; Xaa at
position ii is Thr, His, Gln, or Ala; Xaa at position 12 is His or
Ala; Xaa at position 15 is Gln, Asn, or Val; Xaa at position 16 is
Pro, Gly, or Gln; Xaa at position i7 is Pro, Asp, Gly, or Gln; Xaa
at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro or Glu; Xaa at position 20 is Leu, Val, Gly,
Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met; Xaa at position
21 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at position 23 is Phe,
Ser, Pro, or Trp; Xaa at position 24 is Asn or Ala; Xaa at position
28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg; Xaa
at position 30 is Asp or Glu; Xaa at position 31 is Gln, Val, Met,
Leu, Thr, Ala, Asn, Glu, Ser or Lys; Xaa at position 32 is Asp,
Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp; Xaa at position 37
is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at position 40 is Arg
or Ala; Xaa at position 41 is Arg, Thr, Val, Leu, or Gly; Xaa at
position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr,
Val or Lys; Xaa at position 46 is Ala or Ser; Xaa at position 48 is
Asn, Pro, Thr, or Ile; Xaa at position 49 is Arg or Lys; Xaa at
position 50 is Ala or Asn; Xaa at position 51 is Val or Thr; Xaa at
position 52 is Lys or Arg; Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His; Xaa at position 55 is
Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at position 57 is Ala,
Pro, or Arg; Xaa at position 58 is Ser, Glu, Arg, or Asp; Xaa at
position 59 is Ala or Leu; Xaa at position 62 is Ser, Val, Ala,
Asn, Glu, Pro, or Gly; Xaa at position 63 is Ile or Leu; Xaa at
position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa
at position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 69 is Pro or Thr; Xaa at position 71 is
Leu or Val; Xaa at position 73 is Leu or Ser; Xaa at position 74 is
Ala or Trp; Xaa at position 77 is Ala or Pro; Xaa at position 79 is
Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 81 is His,
Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 82
is Pro or Tyr; Xaa at position 83 is Tie or Val; Xaa at position 84
is His, Ile, Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 85 is Ile, Leu, or Val; Xaa at
position 86 is Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position 87
is Asp, Pro, Met, Lys, His, Thr, Asn, Ile, Leu or Tyr; Xaa at
position 90 is Trp or Leu; Xaa at position 91 is Asn, Pro, Ala,
Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 92
is Glu, or Gly; Xaa at position 94 is Arg, Ala, or Ser; Xaa at
position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position 98 is
Thr, Val, or Gln; Xaa at position 100 is Tyr or Trp; Xaa at
position 101 is Leu or Ala; Xaa at position 102 is Lys, Thr, Val,
Trp, Ser, Ala, His, Met, Phe, Tyr or Ile; Xaa at position 103 is
Thr or Ser; Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly; Xaa at
position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr,
or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr,
or Leu;
which can additionally have Met- or Met-Ala- preceding the amino
acid in position 1; and wherein from 4 to 35 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native human interleukin-3.
7. A composition of claim 6, wherein said human interleukin-3
mutant polypeptide is of the Formula:
30 Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa [SEQ
ID NO:6] 1 5 10 15 Xaa Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu 35 40 45 Ala Phe Xaa Arg Xaa Xaa LYS Xaa Xaa Xaa
Asn Ala Ser Ala Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp 80 85 90 Xaa Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Gly, Asp, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 9 is Ile, Ala, Leu,
or Gly; Xaa at position 11 is Thr, His, or Gln; Xaa at position 12
is His or Ala; Xaa at position 15 is Gln or Asn; Xaa at position 16
is Pro or Gly; Xaa at position 18 is Leu, Arg, Asn, or Ala; Xaa at
position 20 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile, Phe, Thr or
Met; Xaa at position 21 is Leu, Ala, Asn, or Pro; Xaa at position
24 is Asn or Ala; Xaa at position 28 is Gly, Asp, Ser, Ala, Asn,
Ile, Leu, Met, Tyr or Arg; Xaa at position 31 is Gln, Val, Met,
Leu, Ala, Asn, Glu or Lys; Xaa at position 32 is Asp, Phe, Ser,
Ala, Gln, Glu, His, Val or Thr; Xaa at position 36 is Glu, Asn, Ser
or Asp; Xaa at position 37 is Asn, Arg, Pro, Thr, or His; Xaa at
position 41 is Arg, Leu, or Gly; Xaa at position 42 is Pro, Gly,
Ser, Ala, Asn, Val, Leu or Gln; Xaa at position 48 is Asn, Pro, or
Thr; Xaa at position 50 is Ala or Asn; Xaa at position 51 is Val or
Thr; Xaa at position 53 is Ser or Phe; Xaa at position 54 is Leu or
Phe; Xaa at position 55 is Gln, Ala, Glu, or Arg; Xaa at position
62 is Ser, Val, Asn, Pro, or Gly; Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Asn, Met, Arg, Ile, or Gly; Xaa at
position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 73 is Leu or Ser; Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro; Xaa at position 79 is Thr, Asp,
or Ala; Xaa at position 81 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr; Xaa at position 84 is His, Ile, Asn, Ala, Thr, Arg, Gln, Glu,
Lys, Met, Ser, Tyr, Val or Leu; Xaa at position 85 is Ile or Leu;
Xaa at position 86 is Lys or Arg; Xaa at position 87 is Asp, Pro,
Met, Lys, His, Pro, Asn, Ile, Leu or Tyr; Xaa at position 91 is
Asn, Pro, Ser, Ile or Asp; Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position
98 is Thr or Gln; Xaa at position 102 is Lys, Val, Trp, or Ile; Xaa
at position 103 is Thr, Ala, His, Phe, Tyr or Ser; Xaa at position
106 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position 107 is Ala,
Ser, Ile, Pro, or Asp; Xaa at position 108 is Gln, Met, Trp, Phe,
Pro, His, Ile, or Tyr; Xaa at position 109 is Ala, Met, Glu, Ser,
or Leu;
and which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 26 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3.
8. The composition of claim 7, wherein said human interleukin-3
mutant polypeptide is of the Formula:
31 Xaa at position 17 is Ser, Lys, Asp, Met, Gln, or Arg; Xaa at
position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at
position 19 is Met, Arg, Gly, Ala, or Cys; Xaa at position 20 is
Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp,
Phe, Lys, Arg, Ala, Gly, or Val; Xaa at position 22 is Glu, Trp,
Pro, Ser, Ala, His, or Gly; Xaa at position 23 is Ile, Ala, Gly,
Trp, Lys, Leu, Ser, or Arg; Xaa at position 24 is Ile, Gly, Arg, or
Ser; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln,
Asn, Pro, Arg, or Val; Xaa at position 30 is Pro, His, Thr, Gly,
Asp, Gln, Ser, Leu, or Lys; Xaa at position 31 is Pro, Asp, Gly,
Arg, Leu, or Gln; Xaa at position 32 is Leu, Arg, Gln, Asn, Gly,
Ala, or Glu; Xaa at position 33 is Pro, Leu, Gln, Thr, or Glu; Xaa
at position 34 is Leu, Gly, Ser, or Lys; Xaa at position 35 is Leu,
Ala, Gly, Asn, Pro, or Gln; Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, or Pro; Xaa at position 38 is Asn,
or Ala; Xaa at position 40 is Leu, Trp, or Arg; Xaa at position 41
is Asn, Cys, Arg, Leu, His, Met, Pro; Xaa at position 42 is Gly,
Asp, Ser, Cys, or Ala; Xaa at position 42 is Glu, Asn, Tyr, Leu,
Phe, Asp, Ala, Cys, or Ser; Xaa at position 44 is Asp, Ser, Leu,
Arg, Lys, Thr, Met, Trp, or Pro; Xaa at position 45 is Gln, Pro,
Phe, Val, Met, Leu, Thr, Lys, or Trp; Xaa at position 46 is Asp,
Phe, Ser, Thr, Cys, or Gly; Xaa at position 47 is Ile, Gly, Ser,
Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg, His,
Phe, or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn,
His, or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, or Tyr; Xaa
at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at
position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or; Xaa at
position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, or Leu; Xaa at
position 55 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 56
is Pro, Gly, Cys, Ser, Gln, or Lys; Xaa at position 57 is Asn or
Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa at
position 60 is Ala, Ser, Tyr, Asn, or Thr; Xaa at position 61 is
Phe, Asn, Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is Asn
His, Val, Arg, Pro, Thr, or Ile; Xaa at position 63 is Arg, Tyr,
Trp, Ser, Pro, or Val; Xaa at position 64 is Ala, Asn, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 66 is Lys, Ile, Val, Asn, Glu, or Ser; Xaa at position 67
is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa at position
68 is Leu, Val, Trp, Ser, Thr, or His; Xaa at position 69 is Gln,
Ala, Pro, Thr, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn,
Leu, Val, Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu,
Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu,
Met, Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu,
Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, or Leu; Xaa at position 76 is Ser, Val, Ala, Asn,
Trp, Glu, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser, Arg, or
Thr; Xaa at position 78 is Leu, Ala, Ser, Glu, Gly, or Arg; Xaa at
position 79 is Lys, Thr, Gly, Asn, Met, Ile, or Asp; Xaa at
position 80 is Asn, Trp, Val, Gly, Thr, Leu, or Arg; Xaa at
position 81 is Leu, Gln, Gly, Ala, Trp, Arg, or Lys; Xaa at
position 82 is Leu, Gln, Lys, Trp, Arg, or Asp; Xaa at position 83
is Pro, Thr, Trp, Arg, or Met; Xaa at position 84 is Cys, Glu, Gly,
Arg, Met, or Val; Xaa at position 85 is Leu, Asn, or Gln; Xaa at
position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa at position 87 is
Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala, Lys, Arg, Val, or
Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, or
Asn; Xaa at position 90 is Ala, Ser, Asp, Ile, or Met; Xaa at
position 91 is Ala, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 92 is Pro, Phe, Arg, Ser, Lys, His, or Leu; Xaa at
position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at
position 94 is Arg, Ile, Ser, Glu, Leu, Val, or Pro; Xaa at
position 95 is His, Gln, Pro, Val, Leu, Thr or Tyr; Xaa at position
96 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile,
Lys, Ala, or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp,
Ala, Thr, or Pro; Xaa at position 99 is Ile, Arg, Asp, Pro, Gln,
Gly, Phe, or His; Xaa at position 100 is Lys, Tyr, Leu, His, Ile,
Ser, Gln, or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His,
Thr, Val, Tyr, or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys,
Ser, Tyr, or Pro; Xaa at position 103 is Asp, or Ser; Xaa at
position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys,
Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser,
Trp, Gln, Tyr, Leu, Lys, Ile, or His; Xaa at position 106 is Glu,
Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at position 108 is Arg,
Asp, Leu, Thr, Ile, or Pro; Xaa at position 109 is Arg, Thr, Pro,
Glu, Tyr, Leu, Ser, or Gly.
9. A composition of claim 8, wherein said human interleukin-3
mutant polypeptide is of the Formula:
32 1 5 10 (Met).sub.m--Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr
[SEQ ID NO:7] 15 20 Ser Trp Val Asn Cys Ser Xaa Xaa Xaa Asp Glu Ile
Ile 25 30 35 Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa Leu Asp Xaa 40
45 50 Xaa Asn Leu Asn Xaa Glu Asp Xaa Asp Ile Leu Xaa Glu 55 60 Xaa
Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa Xaa 65 70 75 Ala Xaa
Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 80 85 Ile Leu Xaa Asn
Leu Xaa Pro Cys Xaa Pro Xaa Xaa Thr 90 95 100 Ala Xaa Pro Xaa Arg
Xaa Pro Ile Xaa Ile Xaa Xaa Gly 105 110 115 Asp Trp Xaa Glu Phe Arg
Xaa Lys Leu Xaa Phe Tyr Leu 120 125 Xaa Xaa Leu Glu Xaa Ala Gln Xaa
Gln Gln Thr Thr Leu 130 Ser Leu Ala Ile Phe wherein m is 0 or 1;
Xaa at position 18 is Asn or Ile; Xaa at position 19 is Met, Ala or
Ile; Xaa at position 20 is Ile, Pro or Ile; Xaa at position 23 is
Ile, Ala or Leu; Xaa at position 25 is Thr or His; Xaa at position
29 is Gln, Arg, Val or Ile; Xaa at position 32 is Leu, Ala, Asn or
Arg; Xaa at position 34 is Leu or Ser; Xaa at position 37 is Phe,
Pro, or Ser; Xaa at position 38 is Asn or Ala; Xaa at position 42
is Gly, Ala, Ser, Asp or Asn; Xaa at position 45 is Gln, Val, or
Met; Xaa at position 46 is Asp or Ser; Xaa at position 49 is Met,
Ile, Leu or Asp; Xaa at position 50 is Glu or Asp; Xaa at position
Si is Asn Arg or Ser; Xaa at position 55 is Arg, Leu, or Thr; Xaa
at position 56 is Pro or Ser; Xaa at position 59 is Glu or Leu; Xaa
at position 60 is Ala or Ser; Xaa at position 62 is Asn, Val or
Pro; Xaa at position 63 is Arg or His; Xaa at position 65 is Val or
Ser; Xaa at position 67 is Ser, Asn, His or Gln; Xaa at position 69
is Gln or Glu; Xaa at position 73 is Ala or Gly; Xaa at position 76
is Ser, Ala or Pro; Xaa at position 79 is Lys, Arg or Ser; Xaa at
position 82 is Leu, Glu, Val or Trp; Xaa at position 85 is Leu or
Val; Xaa at position 87 is Leu, Ser, Tyr; Xaa at position 88 is Ala
or Trp; Xaa at position 91 is Ala or Pro; Xaa at position 93 is Pro
or Ser; Xaa at position 95 is His or Thr; Xaa at position 98 is
His, Ile, or Thr; Xaa at position 100 is Lys or Arg; Xaa at
position 101 is Asp, Ala or Met; Xaa at position 105 is Asn or Glu;
Xaa at position 109 is Arg, Glu or Leu; Xaa at position 112 is Thr
or Gln; Xaa at position 116 is Lys, Val, Trp or Ser; Xaa at
position 117 is Thr or Ser; Xaa at position 120 is Asn, Gln, or
His; Xaa at position 123 is Ala or Glu; with the proviso that from
four to forty-four of the amino acids designated by Xaa are
different from the corresponding amino acids of native human
interleukin-3.
10. The composition of claim 9, wherein said human interleukin-3
mutant polypeptide is of the Formula:
33 1 5 10 (Met.sub.m--Ala.sub.n).sub.p--Asn Cys Ser Xaa Xaa Xaa Asp
Glu Xaa Ile [SEQ ID NO:8] 15 20 Xaa His Leu Lys Xaa Pro Pro Xaa Pro
Xaa Leu Asp Xaa 25 30 35 Xaa Asn Leu Asn Xaa Glu Asp Xaa Xaa Ile
Leu Xaa Glu 40 45 Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa
Xaa 50 55 60 Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 65
70 75 Ile Leu Xaa Asn Xaa Xaa Pro Cys Xaa Pro Xaa Ala Thr 80 85 Ala
Xaa Pro Xaa Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 90 95 100 Asp Trp
Xaa Glu Phe Arg Xaa Lys Leu Xaa Phe Tyr Leu 105 110 Xaa Xaa Leu Glu
Xaa Ala Gln Xaa Gln Gln wherein m is 0 or 1; n is 0 or 1; p is 0 or
1; Xaa at position 4 is Asn or Ile; Xaa at position 5 is Met, Ala
or Ile: Xaa at position 6 is Ile, Pro or Leu; Xaa at position 9 is
Ile, Ala or Leu; Xaa at position 11 is Thr or His; Xaa at position
15 is Gln, Arg, Val or Ile; Xaa at position 18 is Leu, Ala, Asn or
Arg; Xaa at position 20 is Leu or Ser; Xaa at position 23 is Phe,
Pro, or Ser; Xaa at position 24 is Asn or Ala; Xaa at position 28
is Gly, Ala, Ser, Asp or Asn; Xaa at position 31 is Gln, Val, or
Met; Xaa at position 32 is Asp or Ser; Xaa at position 35 is Met,
Ile or Asp; Xaa at position 36 is Glu or Asp; Xaa at position 37 is
Asn, Arg or Ser; Xaa at position 41 is Arg, Leu, or Thr; Xaa at
position 42 is Pro or Ser; Xaa at position 45 is Glu or Leu; Xaa at
position 46 is Ala or Ser; Xaa at position 48 is Asn, Val or Pro;
Xaa at position 49 is Arg or His; Xaa at position 51 is Val or Ser;
Xaa at position 53 is Ser, Asn, His or Gln; Xaa at position 55 is
Gln or Glu; Xaa at position 59 is Ala or Gly; Xaa at position 62 is
Ser, Ala or Pro; Xaa at position 65 is Lys, Arg or Ser; Xaa at
position 67 is Leu, Glu, or Val; Xaa at position 68 is Leu, Glu,
Val or Trp; Xaa at position 71 is Leu or Val; Xaa at position 73 is
Leu, Ser or Tyr; Xaa at position 74 is Ala or Trp; Xaa at position
77 is Ala or Pro; Xaa at position 79 is Pro or Ser; Xaa at position
81 is His or Thr; Xaa at position 84 is His, Ile, or Thr; Xaa at
position 86 is Lys or Arg; Xaa at position 87 is Asp, Ala or Met;
Xaa at position 91 is Asn or Glu; Xaa at position 95 is Arg, Glu,
Leu; Xaa at position 98 Thr or Gln; Xaa at position 102 is Lys,
Val, Trp or Ser; Xaa at position 103 is Thr or Ser; Xaa at position
106 is Asn, Gln, or His; Xaa at position 109 is Ala or Glu; with
the proviso that from four to forty-four of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (15-125)human interleukin-3.
11. The composition of claim 10, wherein said human interleukin-3
mutant polypeptide is of the Formula:
34 Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO:9] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala
Glu Asp Val Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:10] Lys
Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met
Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile
Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:11] Lys Val Pro Pro
Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu [SEQ ID NO:12] Lys Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu
Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:13] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala
Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn
Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln
Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
[SEQ ID NO:14] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID
NO:15] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn
Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:16] Lys
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln
Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg
Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro
Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn
Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:17] Lys Gln Pro Pro
Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Thr Leu Glu Gln Ala Gln Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu [SEQ ID NO:18] Lys Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn
Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu
Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu
His Ala Gln Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:19] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln
Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
[SEQ ID NO:20] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID
NO:21] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln; Asn
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:22] Lys
Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val
Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile
Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:23] Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu
Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val
Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO:24] Lys Val Pro Pro Ala Pro Leu
Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu
Asn Ala Gln Ala Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu
Ile Ile Thr His Leu [SEQ ID NO:25] Lys Gln Pro Pro Leu Pro Leu Leu
Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn
Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln
Ala Gln Glu Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile
Ile Thr His Leu [SEQ ID NO:26] Lys Gln Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu
Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn
Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp
Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala
Gln Glu Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:27] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln
Glu Gln Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:28] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala
Gln Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO:29] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro
Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala
Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe
Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:30] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:31] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:32] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:33] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:34] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:35] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:36] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:37] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:38] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:39] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser
Leu Glu His Ala Gln Glu Gln Gln. Met Ala Asn Cys Ser Ile Met Ile
Asp Glu Ile Ile [SEQ ID NO:40] His His Leu Lys Arg Pro Pro Ala Pro
Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Asp
Arg Asn Leu Arg Leu Ser Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn
Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys
Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala
Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu
Glu Gln Ala Gln Glu Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu
Ala Ile His His Leu [SEQ ID NO:41] Lys Arg Pro Pro Ala Pro Ser Leu
Asp Pro Asn Asn Leu Asn Asp Glu Asp Met Ser Ile Leu Met Glu Arg Asn
Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln
Ala Gln Glu Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu [SEQ ID NO:42] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro
Asn Asn Leu Asn Asp Glu Asp Met Ser Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln
Glu Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO:43] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ala Glu Asp Val Asp Ile Leu Met Asp Arg Asn Leu Arg Leu Pro
Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala
Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:44] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Asp Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO:45] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp
Glu Asp Met Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln Met Ala
Tyr Pro Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys Asn [SEQ ID NO:46]
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala
Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met
Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys
Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro
Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys
Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr
Leu Glu Gln Ala Gln Glu Gln Gln and Met Ala Tyr Pro Glu Thr Asp Tyr
Lys Asp Asp Asp Asp Lys Asn [SEQ ID NO:47] Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr
Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln.
12. The composition of claim 10, wherein said human interleukin-3
mutant polypeptide is of the Formula:
35 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Leu Ile His His Leu [SEQ
ID NO:48] Lys Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn
Ser Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu
Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu
Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln.
13. The composition of claim 1-12 wherein said CSF is selected from
the group consisting of G-CSF, Meg-CSF and GM-CSF:
14. A method of increasing multi-lineage hematopoietic cell
production in a mammal in need thereof comprising administering a
pharmaceutically effective amount of a human interleukin-3 mutant
polypeptide of the Formula:
36 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:15] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Lys, Gly, Asp, Met, Gln, or Arg; Xaa at position 18 is Asn,
His, Leu, Ile, Phe, Arg, or Gln; Xaa at position 19 is Met, Phe,
Ile, Arg, Giy, Ala, or Cys; Xaa at position 20 is Ile, Cys, Gln,
Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg,
Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is
Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa
at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Leu, Ser,
or Arg; Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala; Xaa at
position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is
Gln, Asn, Leu, Pro, Arg, or Val; Xaa at position 30 is Pro, His,
Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa at position 3i is Pro,
Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at position 32 is Leu, Val,
Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at position 33 is Pro, Leu,
Gln, Ala, Thr, or Glu; Xaa at position 34 is Leu, Val, Gly, Ser,
Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35
is Leu, Ala, Gly, Asn, Pro, Gln, or Val; Xaa at position 36 is Asp,
Leu, or Val; Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile; Xaa
at position 38 is Asn, or Ala; Xaa at position 40 is Leu, Trp, or
Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val,
Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn,
Tyr, Leu, Phe, Asp, Ala, Cys,,Gln, Arg, Thr, Gly or Ser; Xaa at
position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn,
Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met,
Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa
at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His,
Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, Gly, Val,
Ser, Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg,
Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position
49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp; Xaa at position 50
is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe,
Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or
His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or
Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn,
Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser,
Leu, or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu,
Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57
is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val,
or Cys; Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa
at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr; Xaa at position
61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is
Asn His, Val, Arg, Pro, Thr, Asp, or Ile; Xaa at position 63 is
Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val; Xaa at position 64 is
Ala, Asn, Pro, Ser, or Lys; Xaa at position 65 is Val, Thr, Pro,
His, Leu, Phe, or Ser; Xaa at position 66 is Lys, Ile, Arg, Val,
Asn, Glu, or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly,
Asn, Ile, Pro, or His; Xaa at position 68 is Leu, Val, Trp, Ser,
Ile, Phe, Thr, or His; Xaa at position 69 is Gln, Ala, Pro, Thr,
Glu, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn, Leu, Val,
Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg,
Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu, Met,
Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu, Asp,
Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Met, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, Gln, or Leu; Xaa at position 76 is Ser, Val, Ala,
Asn, Trp, Glu, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser,
Arg, Thr, or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe,
Gly, or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile,
Gly, or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu,
Glu, or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg,
Val, or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp,
Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at
position 83 is Pro, Ala, Thr, Trp, Arg, or Met; Xaa at position 84
is Cys, Glu, Gly, Arg, Met, or Val; Xaa at position 85 is Leu, Asn,
Val, or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa
at position 87 is Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala,
Lys, Arg, Val, or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu,
Val, Glu, His, Asn, or Ser; Xaa at position 90 is Ala, Pro, Ser,
Thr, Gly, Asp, Ile, or Met; Xaa at position 91 is Ala, Pro, Ser,
Thr, Phe, Leu, Asp, or His; Xaa at position 92 is Pro, Phe, Arg,
Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr,
Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at position 94 is Arg,
Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro; Xaa at
position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys,
Ser, Ala, Trp, Phe, Ile, or Tyr; Xaa at position 96 is Pro, Lys,
Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile, Val, Lys, Ala, or
Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu,
Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99
is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His; Xaa at
position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro; Xaa
at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu,
Asn, Ser, Ala, Gly, Ile, Leu, or Gln; Xaa at position 102 is Gly,
Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 103 is Asp, or
Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu,
Gln, Lys, Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala,
Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at
position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or
Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His,
Glu, Ser, Ala, or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp,
or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser,
or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr,
Asp, Lys, Leu, Ile, Val or Asn; Xaa at position 114 is Tyr, Cys,
His, Ser, Trp, Arg, or Leu; Xaa at position 115 is Leu, Asn, Val,
Pro, Arg, Ala, His, Thr, Trp, or Met; Xaa at position 116 is Lys,
Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala,
Tyr, Phe, Gln, or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile,
Trp, Lys, or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu,
Cys, Asp, or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu,
Thr, Tyr, or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His,
Val, or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys,
Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe,
Pro, His, Ile, Tyr, or Cys; Xaa at position 123 is Ala, Met, Glu,
His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 44 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133)human interleukin-3: and a colony stimulating
factor selected from the group consisting of GM-CSF, CSF-1, G-CSF,
Meg-CSF (more recently referred to as c-mpl ligand), M-CSF,
erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, LIF, flt2/flk2, human growth
hormone, B-cell growth factor, B-cell differentiation factor,
eosinophil differentiation factor and stem cell factor (SCF).
15. A method of increasing multi-lineage hematopoietic cell
production in a mammal in need thereof comprising administering a
pharmaceutically effective amount of human interleukin-3 mutant
polypeptide of the Formula:
37 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:2] 1 5 10 15 Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu Xaa 50 55 60 Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Gly, Asp, Met, or Gln; Xaa at position 18 is Asn, His, or
Ile; Xaa at position 19 is Met or Ile; Xaa at position 21 is Asp or
Glu; Xaa at position 23 is Ile, Ala, Leu, or Gly; Xaa at position
24 is Tie, Val, or Leu; Xaa at position 25 is Thr, His, Gln, or
Ala; Xaa at position 26 is His or Ala; Xaa at position 29 is Gln,
Asn, or Val; Xaa at position 30 is Pro, Gly, or Gln; Xaa at
position 31 is Pro, Asp, Gly, or Gln; Xaa at position 32 is Leu,
Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu,
Ile, Phe, Thr or Met; Xaa at position 35 is Leu, Ala, Asn, Pro,
Gln, or Val; Xaa at position 37 is Phe, Ser, Pro, or Trp; Xaa at
position 38 is Asn or Ala; Xaa at position 42 is Gly, Asp, Ser,
Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg; Xaa at position 44 is Asp
or Glu; Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn,
Glu, Ser or Lys; Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn
Gln, Glu, His, Ile, Lys, Tyr, Val or Cys; Xaa at position 50 is
Glu, Ala, Asn, Ser or Asp; Xaa at position 51 is Asn, Arg, Met,
Pro, Ser, Thr, or His; Xaa at position 54 is Arg or Ala; Xaa at
position 55 is Arg, Thr, Val, Leu, or Gly; Xaa at position 56 is
Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys; Xaa
at position 60 is Ala or Ser; Xaa at position 62 is Asn, Pro, Thr,
or Ile; Xaa at position 63 is Arg or Lys; Xaa at position 64 is Ala
or Asn; Xaa at position 65 is Val or Thr; Xaa at position 66 is Lys
or Arg; Xaa at position 67 is Ser, Phe, or His; Xaa at position 68
is Leu, Ile, Phe, or His; Xaa at position 69 is Gln, Ala, Pro, Thr,
Glu, Arg, or Gly; Xaa at position 71 is Ala, Pro, or Arg; Xaa at
position 72 is Ser, Glu, Arg, or Asp; Xaa at position 73 is Ala or
Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Ile or Leu; Xaa at position 79 is Lys, Thr,
Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa at position 80 is Asn,
Gly, Glu, or Arg; Xaa at position 82 is Leu, Gln, Trp, Arg, Asp,
Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val; Xaa at
position 83 is Pro or Thr; Xaa at position 85 is Leu or Val; Xaa at
position 87 is Leu or Ser; Xaa at position 88 is Ala or Trp; Xaa at
position 91 is Ala or Pro; Xaa at position 93 is Thr, Asp, Ser,
Pro, Ala, Leu, or Arg; Xaa at position 95 is His, Pro, Arg, Val,
Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val; Xaa at position 98 is His, Ile,
Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser, Tyr, Val or
Pro; Xaa at position 99 is Ile, Leu, or Val; Xaa at position 100 is
Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position 101 is Asp, Pro,
Met, Lys, His, Thr, Pro, Asn, Ile, Leu or Tyr; Xaa at position 104
is Trp or Leu; Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala, or Ser; Xaa at position 109 is
Arg, Thr, Glu, Leu, or Ser; Xaa at position 112 is Thr, Val, or
Gln; Xaa at position 114 is Tyr or Trp; Xaa at position 115 is Leu
or Ala; Xaa at position 116 is Lys, Thr, Val, Trp, Ser, Ala, His,
Met, Phe, Tyr or Ile; Xaa at position 117 is Thr or Ser; Xaa at
position 120 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position
121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly; Xaa at position 122 is
Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys; Xaa at
position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
and which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 35 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133) human interleukin-3; and A pharmaceutically
effective amount of a colony stimulating factor.
16. The method of claim 15, wherein said human interleukin-3 mutant
polypeptide is of the Formula:
38 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:3] 1 5 10 15 Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu Ala 50 55 60 Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp Xaa 95 100 105 Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Gly, Asp, or Gln; Xaa at position 18 is Asn, His, or Ile;
Xaa at position 23 is Ile, Ala, Leu, or Gly; Xaa at position 25 is
Thr, His, or Gln; Xaa at position 26 is His or Ala; Xaa at position
29 is Gln or Asn; Xaa at position 30 is Pro or Gly; Xaa at position
32 is Leu, Arg, Asn, or Ala; Xaa at position 34 is Leu, Val, Ser,
Ala, Arg, Gln, Glu, Ile, Phe, Thr, or Met; Xaa at position 35 is
Leu, Ala, Asn, or Pro; Xaa at position 38 is Asn or Ala; Xaa at
position 42 is Gly, Asp, Ser, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 45 is Gln, Val, Met, Leu, Ala, Asn, Glu, or Lys;
Xaa at position 46 is Asp, Phe, Ser, Gln, Glu, His, Val or Thr; Xaa
at position 50 is Glu Asn, Ser or Asp; Xaa at position 51 is Asn,
Arg, Pro, Thr, or His; Xaa at position 55 is Arg, Leu, or Gly; Xaa
at position 56 is Pro, Gly, Ser, Ala, Asn, Val, Leu or Gln; Xaa at
position 62 is Asn, Pro, or Thr; Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr; Xaa at position 67 is Ser or Phe;
Xaa at position 68 is Leu or Phe; Xaa at position 69 is Gln, Ala,
Glu, or Arg; Xaa at position 76 is Ser, Val, Asn, Pro, or Gly; Xaa
at position 77 is Ile or Leu; Xaa at position 79 is Lys, Gly, Asn,
Met, Arg, Ile, or Gly; Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Asn, Glu, His, Met,
Phe, Ser, Thr, Tyr or Val; Xaa at position 87 is Leu or Ser; Xaa at
position 88 is Ala or Trp; Xaa at position 91 is Ala or Pro; Xaa at
position 93 is Thr, Asp, or Ala; Xaa at position 95 is His, Pro,
Arg, Val, Gly, Asn, Ser or Thr; Xaa at position 98 is His, Ile,
Asn, Ala, Thr, Gln, Glu, Lys, Met, Ser, Tyr, Val or Leu; Xaa at
position 99 is Ile or Leu; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, Met, Lys, Thr, His, Pro, Asn, Ile, Leu
or Tyr; Xaa at position 105 is Asn, Pro, Ser, Ile or Asp; Xaa at
position 108 is Arg, Ala, or Ser; Xaa at position 109 is Arg, Thr,
Glu, Leu, or Ser; Xaa at position 112 is Thr or Gln; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, Tyr or Ile; Xaa at
position 117 is Thr or Ser; Xaa at position 120 is Asn, Pro, Leu,
His, Val, or Gln; Xaa at position 121 is Ala, Ser, Ile, Pro, or
Asp; Xaa at position 122 is Gln, Met, Trp, Phe, Pro, His, Ile, or
Tyr; Xaa at position 123 is Ala, Met, Glu, Ser, or Leu;
and which can additionally have Met- preceding the amino acid in
position 1; and wherein from 1 to 14 amino acids can be deleted
from the N-terminus and/or from 1 to 15 amino acids can be deleted
from the C-terminus; and wherein from 4 to 44 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (1-133) human interleukin-3; and a colony stimulating
factor selected from the group consisting of GM-CSF, CSF-1, G-CSF,
Meg-CSF (more recently referred to as c-mpl ligand), M-CSF,
erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, LIF, flt3/flk2, human growth
hormone, B-cell growth factor, B-cell differentiation factor,
eosinophil differentiation factor and stem cell factor (SCF).
17. The method of claim 16, wherein said human interleukin-3 mutant
polypeptide is of the Formula:
39 Xaa at position 42 is Gly, ASP, Ser, Ile, Leu, Met, Tyr, or Ala;
Xaa at position 45 is Gln, Val, Met or Asn; Xaa at position 46 is
Asp, Ser, Gln, His or Val; Xaa at position 50 is Glu or Asp; Xaa at
position 51 is Asn, Pro or Thr; Xaa at position 62 is Asn or Pro;
Xaa at position 76 is Ser, or Pro; Xaa at position 82 is Leu, Trp,
Asp, Asn Glu, His, Phe, Ser or Tyr; Xaa at position 95 is His, Arg,
Thr, Asn or Ser; Xaa at position 98 is His, Ile, Leu, Ala, Gln,
Lys, Met, Ser, Tyr or Val; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, His, Asn, Ile or Leu; Xaa at position
105 is Asn, or Pro; Xaa at position 108 is Arg, Ala, or Ser; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, or Tyr; Xaa at
position 121 is Ala, or Ile; Xaa at position 122 is Gln, or Ile;
and Xaa at position 123 is Ala, Met or Glu.
18. A method of increasing multi-lineage hematopoietic cell
production in a mammal in need thereof comprising administering a
pharmaceutically effective amount of a human interleukin-3 mutant
polypeptide of the Formula:
40 Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa [SEQ
ID NO:4] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or
Arg; Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa
at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys; Xaa at
position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position
7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln,
Leu, Val, or Gly; Xaa at position 9 is Ile, Val, Ala, Leu, Gly,
Trp, Lys, Phe, Leu, Ser, or Arg; Xaa at position 10 is Ile, Gly,
Val, Arg, Ser, Phe, or Leu; Xaa at position 11 is Thr, His, Gly,
Gln, Arg, Pro, or Ala; Xaa at position 12 is His, Thr, Phe, Gly,
Arg, Ala, or Trp; Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or
Ala; Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or
Trp; Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val; Xaa at
position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa
at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at
position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro, Leu, Gln, Ala, Thr, or Glu; Xaa at position 20
is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or
Met; Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val; Xaa at position 23 is Phe,
Ser, Pro, Trp, or Ile; Xaa at position 24 is Asn, or Ala; Xaa at
position 26 is Leu, Trp, or Arg; Xaa at position 27 is Asn, Cys,
Arg, Leu, His, Met, Pro; Xaa at position 28 is Gly, Asp, Ser, Cys,
Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met; Xaa at
position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg,
Thr, Gly or Ser; Xaa at position 30 is Asp, Ser, Leu, Arg, Lys,
Thr,Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 31 is Gln,
Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile,
Glu, His or Trp; Xaa at position 32 is Asp, Phe, Ser, Thr, Cys,
Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position
33 is Ile, Gly, Val, Ser, Arg, Pro, or His; Xaa at position 34 is
Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or
Asn; Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or
Asp; Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser,
Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 37 is Asn,
Arg, Met, Pro, Ser, Thr, or His; Xaa at position 38 is Asn, His,
Arg, Leu, Gly, Ser, or Thr; Xaa at position 39 is Leu, Thr, Ala,
Gly, Glu, Pro, Lys, Ser, Met, or; Xaa at position 40 is Arg, Asp,
Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position
41 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 42 is Pro,
Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or
Lys; Xaa at position 43 is Asn or Gly; Xaa at position 44 is Leu,
Ser, Asp, Arg, Gln, Val, or Cys; Xaa at position 45 is Glu Tyr,
His, Leu, Pro, or Arg; Xaa at position 46 is Ala, Ser, Pro, Tyr,
Asn, or Thr; Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or
Ser; Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or
Ile; Xaa at position 49 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or
Val; Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys; Xaa at
position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser; Xaa at
position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa
at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His; Xaa at
position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu; Xaa
at position 56 is Asn, Leu, Val, Trp, Pro, or Ala; Xaa at position
57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at
position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp; Xaa at
position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at
position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position
61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu; Xaa at
position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp; Xaa
at position 63 is Ile, Ser, Arg, Thr, or Leu; Xaa at position 64 is
Leu, Ala, Ser, Glu, Phe, Gly, or Arg; Xaa at position 65 is Lys,
Thr, Gly, Asn, Met, Arg, Ile, or Asp; Xaa at position 66 is Asn,
Trp, Val, Gly, Thr, Leu, Glu, or Arg; Xaa at position 67 is Leu,
Gln, Gly, Ala, Trp, Arg, Val, or Lys; Xaa at position 68 is Leu,
Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe,
Ile, Met or Val; Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or
Met; Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val; Xaa at
position 71 is Leu, Asn, Val, or Gln; Xaa at position 72 is Pro,
Cys, Arg, Ala, or Lys; Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp; Xaa at position
75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser; Xaa at
position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met; Xaa at
position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His,
Ala or Pro; Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu,
Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position
82 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 83 is Ile,
Val, Lys, Ala, or Asn; Xaa at position 84 is His, Ile, Asn, Leu,
Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser,
Phe, or His; Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile,
Ser, Gln, Pro; Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr,
Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position
88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 89 is
Asp, or Ser; Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met,
Pro, Leu, Gln, Lys, Ala, Phe, or Gly; Xaa at position 91 is Asn,
Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa
at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or
Pro; Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu,
Ser, Ala or Trp; Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys,
Leu, Ile, Val or Asn; Xaa at position 100 is Tyr, Cys, His, Ser,
Trp, Arg, or Leu; Xaa at position 101 is Leu, Asn, Val, Pro, Arg,
Ala, His, Thr, Trp, or Met; Xaa at position 102 is Lys, Leu, Pro,
Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe,
Gln, or Ile; Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys,
or Pro; Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp,
or Tyr; Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr,
or Arg; Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or
Gln; Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly; Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His,
Ile, Tyr, or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser,
Pro, Tyr, or Leu;
and which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding native
amino acids of (1-133) human interleukin-3; and A pharmaceutically
effective amount of a colony stimulating factor.
19. The method of claim 18, wherein said human interleukin-3 mutant
polypeptide is of the Formula:
41 Asn Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu Lys Xaa [SEQ
ID NO:5] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu 35 40 45 Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu; Xaa at position 9 is Ile, Ala,
Leu, or Gly; Xaa at position 10 is Ile, Val, or Leu; Xaa at
position 11 is Thr, His, Gln, or Ala; Xaa at position 12 is His or
Ala; Xaa at position 15 is Gln, Asn, or Val; Xaa at position 16 is
Pro, Gly, or Gln; Xaa at position 17 is Pro, Asp, Gly, or Gln; Xaa
at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro or Glu; Xaa at position 20 is Leu, Val, Gly,
Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met; Xaa at position
21 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at position 23 is Phe,
Ser, Pro, or Trp; Xaa at position 24 is Asn or Ala; Xaa at position
28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg; Xaa
at position 30 is Asp or Glu; Xaa at position 31 is Gln, Val, Met,
Leu, Thr, Ala, Asn, Glu, Ser or Lys; Xaa at position 32 is Asp,
Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp; Xaa at position 37
is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at position 40 is Arg
or Ala; Xaa at position 41 is Arg, Thr, Val, Leu, or Gly; Xaa at
position 42 is Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr,
Val or Lys; Xaa at position 46 is Ala or Ser; Xaa at position 48 is
Asn, Pro, Thr, or Ile; Xaa at position 49 is Arg or Lys; Xaa at
position 50 is Ala or Asn; Xaa at position 51 is Val or Thr; Xaa at
position 52 is Lys or Arg; Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His; Xaa at position 55 is
Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at position 57 is Ala,
Pro, or Arg; Xaa at position 58 is Ser, Glu, Arg, or Asp; Xaa at
position 59 is Ala or Leu; Xaa at position 62 is Ser, Val, Ala,
Asn, Glu, Pro, or Gly; Xaa at position 63 is Ile or Leu; Xaa at
position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa
at position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 69 is Pro or Thr; Xaa at position 71 is
Leu or Val; Xaa at position 73 is Leu or Ser; Xaa at position 74 is
Ala or Trp; Xaa at position 77 is Ala or Pro; Xaa at position 79 is
Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 81 is His,
Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 82
is Pro or Tyr; Xaa at position 83 is Ile or Val; Xaa at position 84
is His, Ile, Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 85 is Ile, Leu, or Val; Xaa at
position 86 is Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position 87
is Asp, Pro, Met, Lys, His, Thr, Asn, Ile, Leu or Tyr; Xaa at
position 90 is Trp or Leu; Xaa at position 91 is Asn, Pro, Ala,
Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 92
is Glu, or Gly; Xaa at position 94 is Arg, Ala, or Ser; Xaa at
position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position 98 is
Thr, Val, or Gln; Xaa at position 100 is Tyr or Trp; Xaa at
position 101 is Leu or Ala; Xaa at position 102 is Lys, Thr, Val,
Trp, Ser, Ala, His, Met, Phe, Tyr or Ile; Xaa at position 103 is
Thr or Ser; Xaa at position 106 is Asn, Pro, Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly; Xaa at
position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr,
or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr,
or Leu;
which can additionally have Met- or Met-Ala- preceding the amino
acid in position 1; and wherein from 4 to 35 of the amino acids
designated by Xaa are different from the corresponding amino acids
of native human interleukin-3.
20. The method of claim 19, wherein said human interleukin-3 mutant
polypeptide is of the Formula:
42 Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa [SEQ
ID NO:6] 1 5 10 15 Xaa Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu 35 40 45 Ala Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp 80 85 90 Xaa Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Gly, Asp, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 9 is Ile, Ala, Leu,
or Gly; Xaa at position 11 is Thr, His, or Gln; Xaa at position 12
is His or Ala; Xaa at position 15 is Gln or Asn; Xaa at position 16
is Pro or Gly; Xaa at position 18 is Leu, Arg, Asn, or Ala; Xaa at
position 20 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile, Phe, Thr or
Met; Xaa at position 21 is Leu, Ala, Asn, or Pro; Xaa at position
24 is Asn or Ala; Xaa at position 28 is Gly, Asp, Ser, Ala, Asn,
Ile, Leu, Met, Tyr or Arg; Xaa at position 31 is Gln, Val, Met,
Leu, Ala, Asn, Glu or Lys; Xaa at position 32 is Asp, Phe, Ser,
Ala, Gln, Glu, His, Val or Thr; Xaa at position 36 is Glu, Asn, Ser
or Asp; Xaa at position 37 is Asn, Arg, Pro, Thr, or His; Xaa at
position 41 is Arg, Leu, or Gly; Xaa at position 42 is Pro, Gly,
Ser, Ala, Asn, Val, Leu or Gln; Xaa at position 48 is Asn, Pro, or
Thr; Xaa at position 50 is Ala or Asn; Xaa at position 51 is Val or
Thr; Xaa at position 53 is Ser or Phe; Xaa at position 54 is Leu or
Phe; Xaa at position 55 is Gln, Ala, Glu, or Arg; Xaa at position
62 is Ser, Val, Asn, Pro, or Gly; Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Asn, Met, Arg, Ile, or Gly; Xaa at
position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 73 is Leu or Ser; Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro; Xaa at position 79 is Thr, Asp,
or Ala; Xaa at position 81 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr; Xaa at position 84 is His, Ile, Asn, Ala, Thr, Arg, Gln, Glu,
Lys, Met, Ser, Tyr, Val or Leu; Xaa at position 85 is Ile or Leu;
Xaa at position 86 is Lys or Arg; Xaa at position 87 is Asp, Pro,
Met, Lys, His, Pro, Asn, Ile, Leu or Tyr; Xaa at position 91 is
Asn, Pro, Ser, Ile or Asp; Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position
98 is Thr or Gln; Xaa at position 102 is Lys, Val, Trp, or Ile; Xaa
at position 103 is Thr, Ala, His, Phe, Tyr or Ser; Xaa at position
106 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position 107 is Ala,
Ser, Ile, Pro, or Asp; Xaa at position 108 is Gln, Met, Trp, Phe,
Pro, His, Ile, or Tyr; Xaa at position 109 is Ala, Met, Glu, Ser,
or Leu;
and which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 26 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3.
21. The method of claim 20, wherein said human interleukin-3 mutant
polypeptide is of the Formula:
43 Xaa at position 17 is Ser, Lys, Asp, Met, Gln, or Arg; Xaa at
position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa at
position 19 is Met, Arg, Gly, Ala, or Cys; Xaa at position 20 is
Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp,
Phe, Lys, Arg, Ala, Gly, or Val; Xaa at position 22 is Glu, Trp,
Pro, Ser, Ala, His, or Gly; Xaa at position 23 is Ile, Ala, Gly,
Trp, Lys, Leu, Ser, or Arg; Xaa at position 24 is Ile, Gly, Arg, or
Ser; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln,
Asn, Pro, Arg, or Val; Xaa at position 30 is Pro, His, Thr, Gly,
Asp, Gln, Ser, Leu, or Lys; Xaa at position 31 is Pro, Asp, Gly,
Arg, Leu, or Gln; Xaa at position 32 is Leu, Arg, Gln, Asn, Gly,
Ala, or Glu; Xaa at position 33 is Pro, Leu, Gln, Thr, or Glu; Xaa
at position 34 is Leu, Gly, Ser, or Lys; Xaa at position 35 is Leu,
Ala, Gly, Asn, Pro, or Gln; Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, or Pro; Xaa at position 38 is Asn,
or Ala; Xaa at position 40 is Leu, Trp, or Arg; Xaa at position 41
is Asn, Cys, Arg, Leu, His, Met, Pro; Xaa at position 42 is Gly,
Asp, Ser, Cys, or Ala; Xaa at position 42 is Glu, Asn, Tyr, Leu,
Phe, Asp, Ala, Cys, or Ser; Xaa at position 44 is Asp, Ser, Leu,
Arg, Lys, Thr, Met, Trp, or Pro; Xaa at position 45 is Gln, Pro,
Phe, Val, Met, Leu, Thr, Lys, or Trp; Xaa at position 46 is Asp,
Phe, Ser, Thr, Cys, or Gly; Xaa at position 47 is Ile, Gly, Ser,
Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg, His,
Phe, or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn,
His, or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, or Tyr; Xaa
at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at
position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or; Xaa at
position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, or Leu; Xaa at
position 55 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 56
is Pro, Gly, Cys, Ser, Gln, or Lys; Xaa at position 57 is Asn or
Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa at
position 60 is Ala, Ser, Tyr, Asn, or Thr; Xaa at position 61 is
Phe, Asn, Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is Asn
His, Val, Arg, Pro, Thr, or Ile; Xaa at position 63 is Arg, Tyr,
Trp, Ser, Pro, or Val; Xaa at position 64 is Ala, Asn, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 66 is Lys, Ile, Val, Asn, Glu, or Ser; Xaa at position 67
is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa at position
68 is Leu, Val, Trp, Ser, Thr, or His; Xaa at position 69 is Gln,
Ala, Pro, Thr, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn,
Leu, Val, Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu,
Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu,
Met, Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu,
Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, or Leu; Xaa at position 76 is Ser, Val, Ala, Asn,
Trp, Glu, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser, Arg, or
Thr; Xaa at position 78 is Leu, Ala, Ser, Glu, Gly, or Arg; Xaa at
position 79 is Lys, Thr, Gly, Asn, Met, Ile, or Asp; Xaa at
position 80 is Asn, Trp, Val, Gly, Thr, Leu, or Arg; Xaa at
position 81 is Leu, Gln, Gly, Ala, Trp, Arg, or Lys; Xaa at
position 82 is Leu, Gln, Lys, Trp, Arg, or Asp; Xaa at position 83
is Pro, Thr, Trp, Arg, or Met; Xaa at position 84 is Cys, Glu, Gly,
Arg, Met, or Val; Xaa at position 85 is Leu, Asn, or Gln; Xaa at
position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa at position 87 is
Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala, Lys, Arg, Val, or
Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, or
Asn; Xaa at position 90 is Ala, Ser, Asp, Ile, or Met; Xaa at
position 91 is Ala, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 92 is Pro, Phe, Arg, Ser, Lys, His, or Leu; Xaa at
position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at
position 94 is Arg, Ile, Ser, Gln, Leu, Val, or Pro; Xaa at
position 95 is His, Gln, Pro, Val, Leu, Thr or Tyr; Xaa at position
96 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile,
Lys, Ala, or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp,
Ala, Thr, or Pro; Xaa at position 99 is Ile, Arg, Asp, Pro, Gln,
Gly, Phe, or His; Xaa at position 100 is Lys, Tyr, Leu, His, Ile,
Ser, Gln, or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His,
Thr, Val, Tyr, or Gln; Xaa at position 102 is Gly, Leu, Gln, Lys,
Ser, Tyr, or Pro; Xaa at position 103 is Asp, or Ser; Xaa at
position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys,
Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser,
Trp, Gln, Tyr, Leu, Lys, Ile, or His; Xaa at position 106 is Gln,
Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at position 108 is Arg,
Asp, Leu, Thr, Ile, or Pro; Xaa at position 109 is Arg, Thr, Pro,
Gln, Tyr, Leu, Ser, or Gly.
22. The method of claim 19 wherein said human interleukin-3 mutant
polypeptide is of the Formula:
44 1 5 10 (Met)m-Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr [SEQ
ID NO:7] 15 20 Ser Trp Val Asn Cys Ser Xaa Xaa Xaa Asp Glu Ile Ile
25 30 35 Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa Leu Asp Xaa 40 45
50 Xaa Asn Leu Asn Xaa Glu Asp Xaa Asp Ile Leu Xaa Glu 55 60 Xaa
Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa Xaa 65 70 75 Ala Xaa
Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 80 85 Ile Leu Xaa Asn
Leu Xaa Pro Cys Xaa Pro Xaa Xaa Thr 90 95 100 Ala Xaa Pro Xaa Arg
Xaa Pro Ile Xaa Ile Xaa Xaa Gly 105 110 115 Asp Trp Xaa Glu Phe Arg
Xaa Lys Leu Xaa Phe Tyr Leu 120 125 Xaa Xaa Leu Glu Xaa Ala Gln Xaa
Gln Gln Thr Thr Leu 130 Ser Leu Ala Ile Phe wherein m is 0 or 1;
Xaa at position 18 is Asn or Ile; Xaa at position 19 is Met, Ala or
Ile; Xaa at position 20 is Ile, Pro or Ile; Xaa at position 23 is
lie, Ala or Leu; Xaa at position 25 is Thr or His; Xaa at position
29 is Gln, Arg, Val or Ile; Xaa at position 32 is Leu, Ala, Asn or
Arg; Xaa at position 34 is Leu or Ser; Xaa at position 37 is Phe,
Pro, or Ser; Xaa at position 38 is Asn or Ala; Xaa at position 42
is Gly, Ala, Ser, Asp or Asn; Xaa at position 45 is Gln, Val, or
Met; Xaa at position 46 is Asp or Ser; Xaa at position 49 is Met,
lie, Leu or Asp; Xaa at position 50 is Glu or Asp; Xaa at position
51 is Asn Arg or Ser; Xaa at position 55 is Arg, Leu, or Thr; Xaa
at position 56 is Pro or Ser; Xaa at position 59 is Glu or Leu; Xaa
at position 60 is Ala or Ser; Xaa at position 62 is Asn, Val or
Pro; Xaa at position 63 is Arg or His; Xaa at position 65 is Val or
Ser; Xaa at position 67 is Ser, Asn, His or Gln; Xaa at position 69
is Gln or Glu; Xaa at position 73 is Ala or Gly; Xaa at position 76
is Ser, Ala or Pro; Xaa at position 79 is Lys, Arg or Ser; Xaa at
position 82 is Leu, Glu, Val or Trp; Xaa at position 85 is Leu or
Val; Xaa at position 87 is Leu, Ser, Tyr; Xaa at position 88 is Ala
or Trp; Xaa at position 91 is Ala or Pro; Xaa at position 93 is Pro
or Ser; Xaa at position 95 is His or Thr; Xaa at position 98 is
His, Ile, or Thr; Xaa at position 100 is Lys or Arg; Xaa at
position 101 is Asp, Ala or Met; Xaa at position 105 is Asn or Glu;
Xaa at position 109 is Arg, Giu or Leu; Xaa at position 112 is Thr
or Gln; Xaa at position 116 is Lys, Val, Trp or Ser; Xaa at
position 117 is Thr or Ser; Xaa at position 120 is Asn, Gln, or
His; Xaa at position 123 is Ala or Glu; with the proviso that from
four to forty-four of the amino acids designated by Xaa are
different from the corresponding amino acids of native human
interleukin-3.
23. The method of claim 21 wherein said human interleukin-3 mutant
polypeptide is of the Formula:
45 1 5 10 (Met.sub.m--Ala.sub.n).sub.p--Asn Cys Ser Xaa Xaa Xaa Asp
Glu Xaa Ile [SEQ ID NO:8] 15 20 Xaa His Leu Lys Xaa Pro Pro Xaa Pro
Xaa Leu Asp Xaa 25 30 35 Xaa Asn Leu Asn Xaa Glu Asp Xaa Xaa Ile
Leu Xaa Glu 40 45 Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa
Xaa 50 55 60 Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 65
70 75 Ile Leu Xaa Asn Xaa Xaa Pro Cys Xaa Pro Xaa Ala Thr 80 85 Ala
Xaa Pro Xaa Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 90 95 100 Asp Trp
Xaa Glu Phe Arg Xaa Lys Leu Xaa Phe Tyr Leu 105 110 Xaa Xaa Leu Glu
Xaa Ala Gln Xaa Gln Gln wherein m is 0 or 1; n is 0 or 1; p is 0 or
1; Xaa at position 4 is Asn or Ile; Xaa at position 5 is Met, Ala
or Ile: Xaa at position 6 is Ile, Pro or Leu; Xaa at position 9 is
Ile, Ala or Leu; Xaa at position 11 is Thr or His; Xaa at position
15 is Gln, Arg, Val or Ile; Xaa at position 18 is Leu, Ala, Asn or
Arg; Xaa at position 20 is Leu or Ser; Xaa at position 23 is Phe,
Pro, or Ser; Xaa at position 24 is Asn or Ala; Xaa at position 28
is Gly, Ala, Ser, Asp or Asn; Xaa at position 31 is Gln, Val, or
Met; Xaa at position 32 is Asp or Ser; Xaa at position 35 is Met,
Ile or Asp; Xaa at position 36 is Glu or Asp; Xaa at position 37 is
Asn, Arg or Ser; Xaa at position 41 is Arg, Leu, or Thr; Xaa at
position 42 is Pro or Ser; Xaa at position 45 is Glu or Leu; Xaa at
position 46 is Ala or Ser; Xaa at position 48 is Asn, Val or Pro;
Xaa at position 49 is Arg or His; Xaa at position 51 is Val or Ser;
Xaa at position 53 is Ser, Asn, His or Gln; Xaa at position 55 is
Gln or Glu; Xaa at position 59 is Ala or Gly; Xaa at position 62 is
Ser, Ala or Pro; Xaa at position 65 is Lys, Arg or Ser; Xaa at
position 67 is Leu, Glu, or Val; Xaa at position 68 is Leu, Glu,
Val or Trp; Xaa at position 71 is Leu or Val; Xaa at position 73 is
Leu, Ser or Tyr; Xaa at position 74 is Ala or Trp; Xaa at position
77 is Ala or Pro; Xaa at position 79 is Pro or Ser; Xaa at position
81 is His or Thr; Xaa at position 84 is His, Ile, or Thr; Xaa at
position 86 is Lys or Arg; Xaa at position 87 is Asp, Ala or Met;
Xaa at position 91 is Asn or Glu; Xaa at position 95 is Arg, Glu,
Leu; Xaa at position 98 Thr or Gln; Xaa at position 102 is Lys,
Val, Trp or Ser; Xaa at position 103 is Thr or Ser; Xaa at position
106 is Asn, Gln, or His; Xaa at position 109 is Ala or Glu; with
the proviso that from four to forty-four of the amino acids
designated by Xaa are different from the corresponding amino acids
of native (15-125)human interleukin-3.
24. The method of claim 22 wherein said human interleukin-3 mutant
polypeptide is of the Formula:
46 Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO:9] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala
Glu Asp Val Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:10] Lys
Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met
Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile
Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:11] Lys Val Pro Pro
Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu [SEQ ID NO:12] Lys Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu
Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:13] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala
Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn
Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln
Ala Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
[SEQ ID NO:14] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID
NO:15] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn
Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:16] Lys
Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln
Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn
Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg
Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro
Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Asn
Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID NO:17] Lys Gln Pro Pro
Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Thr Leu Glu Gln Ala Gln Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu [SEQ ID NO:18] Lys Gln Pro Pro Leu Pro Leu
Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn
Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu
Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu
His Ala Gln Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:19] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln
Glu Gln Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
[SEQ ID NO:20] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn
Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu [SEQ ID
NO:21] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly
Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln; Asn
Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:22] Lys
Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val
Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val
Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys
Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro
Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe
Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile
Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:23] Lys Arg Pro Pro
Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu
Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val
Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; Asn Cys Ser Ile Met Ile Asp
Glu Ile Ile His His Leu [SEQ ID NO:24] Lys Val Pro Pro Ala Pro Leu
Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu
Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu
Asn Ala Gln Ala Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu
Ile Ile Thr His Leu [SEQ ID NO:25] Lys Gln Pro Pro Leu Pro Leu Leu
Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn
Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln
Ala Gln Glu Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile
Ile Thr His Leu [SEQ ID NO:26] Lys Gln Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu
Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn
Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp
Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala
Gln Glu Gln Gln; Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu [SEQ ID NO:27] Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln
Glu Gln Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu [SEQ ID NO:28] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn
Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu
Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala
Gln Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO:29] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro
Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala
Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe
Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:30] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile
Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala
Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg
Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:31] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:32] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:33] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:34] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:35] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:36] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:37] Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:38] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn
Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:39] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly
Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu
His Ala Gln Glu Gln Gln. Met Ala Asn Cys Ser Ile Met Ile Asp Glu
Ile Ile His His Leu [SEQ ID NO:40] Lys Arg Pro Pro Ala Pro Leu Leu
Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Asp Arg Asn
Leu Arg Leu Ser Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln
Ala Gln Glu Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile
His His Leu [SEQ ID NO:41] Lys Arg Pro Pro Ala Pro Ser Leu Asp Pro
Asn Asn Leu Asn Asp Glu Asp Met Ser Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln
Glu Gln Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu [SEQ ID NO:42] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Asp Glu Asp Met Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro
Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly
Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala
Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
[SEQ ID NO:43] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Ala Glu Asp Val Asp Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID
NO:44] Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp
Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln Met Ala
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ ID NO:45]
Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp
Met Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe
Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln Met Ala Tyr Pro
Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys Asn [SEQ ID NO:46] Cys Ser
Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu
Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg
Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu
Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu
Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly
Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu
Gln Ala Gln Glu Gln Gln Met Ala Tyr Pro Glu Thr Asp Tyr Lys Asp Asp
Asp Asp Lys Asn [SEQ ID NO:47] Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu
Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu
Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln and
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Leu Ile His His Leu [SEQ ID
NO:48] Lys Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn Ser
Glu Asp Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu
Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln.
25. The method of claim 23 wherein said human interleukin-3 mutant
polypeptide is of the Formula:
47 Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu [SEQ
ID NO:32] Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu
Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu
Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln.
26. The method as recited in claim 14,15,16,17,18,19,20,21,22,23,24
or 25 wherein said colony stimulating factor is selected from the
group consisting of GM-CSF, G-CSF, and Meg-CSF.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the coadministration or
sequential treatment using mutants or variants of human
interleukin-3 (hIL-3) and other colony stimulating factors (CSFs),
cytokines, lymphokines, interleukins, hematopoietic growth factors
or IL-3 variants.
BACKGROUND OF THE INVENTION
[0002] Colony stimulating factors (CSFs) which stimulate the
differentiation and/or proliferation of bone marrow cells have
generated much interest because of their therapeutic potential for
restoring depressed levels of hematopoietic stem cell-derived
cells. CSFs in both human and murine systems have been identified
and distinguished according to their activities. For example,
granulocyte-CSF (G-CSF) and macrophage-CSF (M-CSF) stimulate the in
vitro formation of neutrophilic granulocyte and macrophage
colonies, respectively while GM-CSF and interleukin-3 (IL-3) have
broader activities and stimulate the formation of both macrophage,
neutrophilic and eosinophilic granulocyte colonies. IL-3 also
stimulates the formation of mast, megakaryocyte and pure and mixed
erythroid colonies (when erythropoietin is added).
[0003] Because of its ability to stimulate the proliferation of a
number of different cell types and to support the growth and
proliferation of progenitor cells, IL-3 has potential for
therapeutic use in restoring hematopoietic cells to normal amounts
in those cases where the number of cells has been reduced due to
diseases or to therapeutic treatments such as radiation and/or
chemotherapy.
[0004] Interleukin-3 (IL-3) is a hematopoietic growth factor which
has the property of being able to promote the survival, growth and
differentiation of hematopoietic cells. Among the biological
properties of IL-3 are the ability (a) to support the growth and
differentiation of progenitor cells committed to all, or virtually
all, blood cell lineages; (b) to interact with early multipotential
stem cells; (c) to sustain the growth of pluripotent precursor
cells; (d) to stimulate proliferation of chronic myelogenous
leukemia (CML) cells; (e) to stimulate proliferation of mast cells,
eosinophils and basophils; (f) to stimulate DNA synthesis by human
acute myelogenous leukemia (AML) cells; (g) to prime cells for
production of leukotrienes and histamines; (h) to induce leukocyte
chemotaxis; and (i) to induce cell surface molecules needed for
leukocyte adhesion.
[0005] Mature human interleukin-3 (hIL-3) consists of 133 amino
acids. It has one disulfide bridge and two potential glycosylation
sites (Yang, et al., CELL 47:3 (1986)).
[0006] Murine IL-3 (mIL-3) was first identified by Ihle, et al., J.
IMMUNOL. 126:2184 (1981) as a factor which induced expression of a
T cell associated enzyme, 20'-hydroxysteroid dehydrogenase. The
factor was purified to homogeneity and shown to regulate the growth
and differentiation of numerous subclasses of early hematopoietic
and lymphoid progenitor cells.
[0007] In 1984, cDNA clones coding for murine IL-3 were isolated
(Fung, et al., NATURE 307:233 (1984) and Yokota, et al., PROC.
NATL. ACAD. SCI. USA 81:1070 (1984)). The murine DNA sequence coded
for a polypeptide of 166 amino acids including a putative signal
peptide.
[0008] The gibbon IL-3 sequence was obtained using a gibbon cDNA
expression library. The gibbon IL-3 sequence was then used as a
probe against a human genomic library to obtain a human IL-3
sequence.
[0009] Gibbon and human genomic DNA homologues of the murine IL-3
sequence were disclosed by Yang, et al., CELL 47:3 (1986). The
human sequence reported by Yang, et al. included a serine residue
at position 8 of the mature protein sequence. Following this
finding, others reported isolation of Pro.sup.8 hIL-3 cDNAs having
proline at position 8 of the protein sequence. Thus it appears that
there may be two allelic forms of hIL-3.
[0010] Dorssers, et al., GENE 55:115 (1987), found a clone from a
human cDNA library which hybridized with mIL-3. This hybridization
was the result of the high degree of homology between the 3'
noncoding regions of mIL-3 and hIL-3. This cDNA coded for an hIL-3
(Pro.sup.8) sequence.
[0011] U.S. Pat. No. 4,877,729 and U.S. Pat. No. 4,959,454 disclose
human IL-3 and gibbon IL-3 cDNAs and the protein sequences for
which they code. The hIL-3 disclosed has serine rather than proline
at position 8 in the protein sequence.
[0012] Clark-Lewis, et al., SCIENCE 231:134 (1986) performed a
functional analysis of murine IL-3 analogs synthesized with an
automated peptide synthesizer. The authors concluded that the
stable tertiary structure of the complete molecule was required for
full activity. A study on the role of the disulfide bridges showed
that replacement of all four cysteines by alanine gave a molecule
with {fraction (1/500)}th the activity as the native molecule.
Replacement of two of the four Cys residues by Ala(Cys.sup.79,
Cys.sup.140->Ala.sup.79, Ala.sup.140) resulted in an increased
activity. The authors concluded that in murine IL-3 a single
disulfide bridge is required between cysteines 17 and 80 to get
biological activity that approximates physiological levels and that
this structure probably stabilizes the tertiary structure of the
protein to give a conformation that is optimal for function.
(Clark-Lewis, et al., PROC. NATL. ACAD. SCI. USA 85:7897
(1988)).
[0013] International Patent Application (PCT) WO 88/00598 discloses
gibbon- and human-like IL-3. The hIL-3 contains a
Ser.sup.8->Pro.sup.8 replacement. Suggestions are made to
replace Cys by Ser, thereby breaking the disulfide bridge, and to
replace one or more amino acids at the glycosylation sites.
[0014] EP-A-0275598 (WO 88/04691) illustrates that Ala.sup.1 can be
deleted while retaining biological activity. Some mutant hIL-3
sequences are provided, e.g., two double mutants,
Ala.sup.1->Asp.sup.1, Trp.sup.13->Arg.sup.13 (pGB/IL-302) and
Ala.sup.1->Asp.sup.1, Met.sup.3->Thr.sup.3 (pGB/IL-304) and
one triple mutant Ala.sup.1->Asp.sup.1, Leu.sup.9->Pro.sup.9,
Trp.sup.13->Arg.sup.- 13 (pGB/IL-303).
[0015] WO 88/05469 describes how deglycosylation mutants can be
obtained and suggests mutants of Arg.sup.54Arg.sup.55 and
Arg.sup.108Arg.sup.109Ly- s.sup.110 might avoid proteolysis upon
expression in Saccharomyces cerevisiae by KEX2 protease. No mutated
proteins are disclosed. Glycosylation and the KEX2 protease
activity are only important, in this context, upon expression in
yeast.
[0016] WO 88/06161 mentions various mutants which theoretically may
be conformationally and antigenically neutral. The only actually
performed mutations are Met.sup.2->Ile.sup.2 and
Ile.sup.131->Leu.sup.131. It is not disclosed whether the
contemplated neutralities were obtained for these two
mutations.
[0017] WO 91/00350 discloses nonglycosylated hIL-3 analog proteins,
for example, hIL-3 (Pro.sup.8Asp.sup.15Asp.sup.70), Met.sup.3
rhuIL-3 (Pro.sup.8Asp.sup.15Asp.sup.70); Thr.sup.4 rhuIL-3
(Pro.sup.8Asp.sup.15Asp.sup.70)and Thr.sup.6 rhuIL-3
(Pro.sup.8Asp.sup.15Asp.sup.70). It is said that these protein
compositions do not exhibit certain adverse side effects associated
with native hIL-3 such as urticaria resulting from infiltration of
mast cells and lymphocytes into the dermis. The disclosed analog
hIL-3 proteins may have N termini at Met.sup.3, Thr.sup.4, or
Thr.sup.6.
[0018] WO 91/12874 discloses cysteine added variants (CAVs) of IL-3
which have at least one Cys residue substituted for a naturally
occurring amino acid residue.
[0019] U.S. Pat. No. 4,810,643 discloses the DNA sequence encoding
human G-CSF.
[0020] WO 91/07988 discloses a method to increase megakaryocyte
production comprised of administration of G-CSF with IL-3 or
GM-CSF. Also disclosed is a method for increasing platelet
production comprised of administration of IL-6 with IL-3, G-CSF or
GM-CSF.
SUMMARY OF THE INVENTION
[0021] The present invention encompasses recombinant human
interleukin-3 (hIL-3) variant or mutant proteins (muteins) These
hIL-3 muteins contain amino acid substitutions and may also have
amino acid deletions at either/or both the N- and C- termini. This
invention encompasses coadministration or sequential treatment
using IL-3 variants of the present invention with other colony
stimulating factors (CSFs), cytokines, lymphokines, interleukins,
hematopoietic growth factors (herein after collectively referred to
as "colony stimulating factors") which may have the potential for
therapeutic use in restoring hematopoietic cells to normal amounts
in those cases where the number of cells has been reduced due to
diseases or to therapeutic treatments such as radiation and/or
chemotherapy. Coadministration or sequential treatment using IL-3
variants of the present invention with other colony stimulating
factors may enhance therapeutic value due to the synergistic
effects of the proteins that make up the treatment. The use of
multiple factors may also have the potential advantage by lowering
the demands placed on factor-producing cells and their induction
systems. If there are limitations in the ability of a cell to
produce a factor then by lowering the required concentrations of
each of the factors by using them in combination may usefully
reduce demands on the factor-producing cells. The use of multiple
factors may lower the amount of the factors that would be needed,
probably reducing the likelihood of adverse responses.
[0022] Coadministration or sequential treatment may have the usual
activity of the peptides forming the mixture or it may be further
characterized by having a biological or physiological activity
greater than simply the additive function of the presence of IL-3
or the other growth factors alone. Coadministration or sequential
treatment may also unexpectedly provide an enhanced effect on the
activity or an activity different from that expected by the
presence of IL-3 or the other growth factors. The IL-3 variants of
the present invention may also have an improved activity profile
which may include reduction of undesirable biological activities
associated with native hIL-3.
[0023] The present invention includes mutants of hIL-3 in which
from 1 to 14 amino acids have been deleted from the N-terminus
and/or from 1 to 15 amino acids have been deleted from the
C-terminus, containing multiple amino acid substitutions, which are
used with other growth factors or IL-3 variant. Preferred IL-3
variants of the present invention include variants in which amino
acids 1 to 14 have been deleted from the N-terminus, amino acids
126 to 133 have been deleted from the C-terminus and contain from
about four to about twenty-six amino acid substitutions in the
polypeptide sequence.
[0024] The present invention also provides IL-3 variants which may
function as IL-3 antagonists or as discrete antigenic fragments for
the production of antibodies useful in immunoassay and
immunotherapy protocols. Antagonists of hIL-3 would be particularly
useful in blocking the growth of certain cancer cells like AML, CML
and certain types of B lymphoid cancers. Other conditions where
antagonists would be useful include those in which certain blood
cells are produced at abnormally high numbers or are being
activated by endogenous ligands. Antagonists would effectively
compete for ligands, presumably naturally occurring hemopoietins
including and not limited to IL-3, GM-CSF and IL-5, which might
trigger or augment the growth of cancer cells by virtue of their
ability to bind to the IL-3 receptor complex while intrinsic
activation properties of the ligand are diminished. IL-3, GM-CSF
and/or IL-5 also play a role in certain asthmatic responses. An
antagonist of the IL-3 receptor may have the utility in this
disease by blocking receptor-mediated activation and recruitment of
inflammatory cells.
[0025] In addition to the use of the IL-3 variants of the present
invention with other colony stimulating factors in vivo, it is
envisioned that in vitro uses would include the ability to
stimulate bone marrow and blood cell activation and growth before
infusion into patients.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 is the human IL-3 gene for E. coli expression
(pMON5873), encoding the polypeptide sequence of natural (wild
type) human IL-3 [SEQ ID NO:128], plus an initiator methionine, as
expressed in E. coli, with the amino acids numbered from the
N-terminus of the natural hIL-3.
[0027] FIG. 2 shows the synergistic effects, in the methylcellulose
assay, of the IL-3 variant, pMON13288, with G-CSF compared to the
synergy of native IL-3 with G-CSF. Also shown are the effects of
native IL-3 and the IL-3 variant, pMON13288, alone. The
concentration of IL-3 is plotted versus the colony counts per
100,000 starting CD34+ cells.
[0028] FIG. 3 shows the synergistic effects, in the methylcellulose
assay, of the IL-3 variant, pMON13288, with GM-CSF compared to the
synergy of native IL-3 with GM-CSF. Also shown are the effects of
native IL-3 and the IL-3 variant, pMON13288, alone. The
concentration of IL-3 is plotted versus the colony counts per
100,000 starting CD34+ cells.
[0029] FIG. 4 shows the synergistic effects, in the cord blood
assay, of the IL-3 variant, pMON13288, with stem cell factor (SCF)
compared to the synergy of native IL-3 (pMON5873) with stem cell
factor (SCF). Also shown are the effects of native IL-3 (pMON5873)
and the IL-3 variant, pMON13288, alone. The concentration of IL-3
is plotted versus the colony counts (CFU) per 10,000 starting CD34+
cells.
[0030] FIG. 5 shows the synergistic effects, in the cord blood
assay, of the IL-3 variant, pMON13288, with stem cell factor (SCF)
compared to the synergy of native IL-3 (PMON5873) with stem cell
factor (SCF). Also shown are the effects of native IL-3 (PMON5873)
and the IL-3 variant, pMON13288, alone. The concentration of IL-3
is plotted versus the colony counts (CFU) per 10,000 starting CD34+
cells.
DETAILED DESCRIPTION OF THE INVENTION
[0031] The present invention encompasses the coadministration or
sequential treatment with recombinant human interleukin-3 (hIL-3)
variant or mutant proteins (muteins) with other colony stimulating
factors (CSFs), cytokines, lymphokines, interleukins, hematopoietic
growth factors and variants thereof (herein after collectively
referred to as "colony stimulating factors"). This invention
encompasses the coadministration or sequential treatment using IL-3
variants and other colony stimulating factors colony stimulating
factors, each of which may act through a different and specific
cell receptor to initiate complementary biological activities.
Hematopoiesis requires a complex series of cellular events in which
stem cells generate continuously into large populations of maturing
cells in all major lineages. There are currently at least 20 known
regulators with hematopoietic proliferative activity. Most of these
proliferative regulators can stimulate one or another type of
colony formation in vitro, the precise pattern of colony formation
stimulated by each regulator is quite distinctive. No two
regulators stimulate exactly the same pattern of colony formation,
as evaluated by colony numbers or, more importantly, by the lineage
and maturation pattern of the cells making up the developing
colonies. Proliferative responses can most readily be analyzed in
simplified in vitro culture systems. Three quite different
parameters can be distinguished: alteration in colony size,
alteration in colony numbers and cell lineage. Two or more factors
may act on the progenitor cell, inducing the formation of larger
number of progeny thereby increasing the colony size. Two or more
factors may allow increased number of progenitor cells to
proliferate either because distinct subsets of progenitors cells
exist that respond exclusively to one factor or because some
progenitors require stimulation by two or more factors before being
able to respond. Activation of additional receptors on a cell by
the use of two or more factors is likely to enhance the mitotic
signal because of coalescence of initially differing signal
pathways into a common final pathway reaching the nucleus (Metcalf,
1989). Other mechanism could explain synergy. For example, if one
signaling pathway is limited by an intermediate activation of an
additional signaling pathway by a second factor may result in a
superadditive response. In some cases, activation of one receptor
type can induce an enhanced expression of other receptors (Metcalf,
1993). Two or more factors may result in a different pattern of
cell lineages then from a single factor. The use of the IL-3
variants of the present invention with other colony stimulating
factors may have the potential clinical advantage resulting from a
proliferative response that is not possible by any single
factor.
[0032] Hematopoietic and other growth factors can be grouped in to
two distinct families of related receptors: (1) tyrosine kinase
receptors, including those for epidermal growth factor, M-CSF
(Sherr, 1990) and SCF (Yarden et al., 1987): and (2) hematopoietic
receptors, not containing a tyrosine kinase domain, but exhibiting
obvious homology in their extracellular domain (Bazan, 1990).
Included in the later group are erythropoietin (D'Andrea et al.,
1989), GM-CSF (Gearing et al., 1989), IL-3 (Kitamura et al., 1991),
G-CSF (Fukunaga et al., 1990), IL-4 (Harada et al., 1990), IL-5
(Takaki et al., 1990), IL-6 (Yamasaki et al., 1988), IL-7 (Goodwin
et al., 1990), LIF (Gearing et al., 1991) and IL-2 (Cosman et al.,
1987). Most of the later group of receptors exists in high-affinity
form as a heterodimers. After ligand binding, the specific
.alpha.-chains become associated with at least one other receptor
chain (.beta.-chain, .gamma.-chain). Many of these factors share a
common receptor subunit. The .alpha.-chains for GM-CSF, IL-3 and
IL-5 share the same .beta.-chain (Kitamura et al., 1991) and
receptor complexes for IL-6, LIF and IL-11 share a common
.beta.-chain (gp130) (Taga et al., 1989; Gearing et al., 1992). The
receptor complexes of IL-2, IL-4 and IL-7 share a common
.gamma.-chain (Kondo et al., 1993; Russell et al., 1993; Noguchi et
al., 1993).
[0033] GM-CSF accelerates recovery of neutrophils and maintains
functional capacity, yet has little demonstrable effect on platelet
recovery. In contrast IL-3 promotes a slower increase recovery in
neutrophils and monocytes while accelerating the recovery of
platelets.
[0034] Recent studies in normal primates indicate that when IL-3
was administered before GM-CSF that the combination of IL-3 and
GM-CSF promoted a synergistic rise in peripheral white blood cells
and platelets (Donahue R. E. et al., 1988; Krumwieh D. et al.,
1988; and Stahl C. P. et al., 1992). The synergistic effect
observed in the sequential combination of IL-3 before GM-CSF may
result from the expansion of GM-CSF sensitive cells by IL-3
resulting in a more efficient production of neutrophils. The
coadministration of GM-CSF and IL-3 resulted in diminished
neutrophils production relative to GM-CSF alone (Farese et al.,
1993). The coadministration of IL-3 and GM-CSF, may result in down
regulation of GM-CSF receptors by IL-3 thereby dampening the GM-CSF
induced increase in neutrophils. However the coadministration of
IL-3 and GM-CSF in a marrow-ablated rhesus monkeys promoted
accelerated platelets and neutrophil recovery relative to
sequential cytokine treatment or with either IL-3 or GM-CSF alone
(Farese et al., 1993).
[0035] The in vitro activity of both IL-3 and GM-CSF has been shown
to be additive with respect to stimulating larger colonies than
either cytokine alone (Robinson et al., 1987; Bruno et al., 1989;
Metcalf et al., 1992; Bruno et al., 1991; Bridell et al., 1990).
Recently IL-12 has been shown to synergize with IL-3 and c-kit
(stem cell factor) to enhance the recovery of hemopoietic stem
cells in liquid culture (Ploemacher et al., 1993).
[0036] Recent in vitro (Emerson et al., 1988: Sonodo et al., 1988)
and in vivo (Ganser et al., 1992; Donahue R. E. et al., 1988;
Krumwieh D. et al., 1988; and Stahl C. P. et al., 1992) results of
combined IL-3 and GM-CSF treatment suggests an increased clinical
efficacy in cytokine combination treatment.
[0037] As mentioned earlier some of the factors that are involved
in hematopoiesis are limited to a specific cell lineage and others
have much broader effects and may result in the proliferation and
support of multi-lineages and there may be considerable overlap
between these factors but that the proliferative profiles are
distinct. This suggests that the coadministration or sequential
treatment with multiple factors may have a clinical advantage. IL-3
variants of the present invention that have an increased
therapeutic index, compared to native IL-3, may have a distinct
clinical advantage when coadministered or used sequentially in
treatment.
[0038] The use of multiple factors may also have potential
advantage by lowering the demands placed on factor-producing cells
and their induction systems. If there are limitations in the
ability of a cell to produce a factor then by lowering the required
concentrations of each of the factors by using them in combination
may usefully reduce demands on the factor-producing cells. The use
of multiple factors may lower the amount of the factors that would
be needed, probably reducing the likelihood of adverse
responses.
[0039] A non-exclusive list of growth factors, colony stimulating
factors (CSFs) including; cytokines, lymphokines, interleukins,
hematopoietic growth factors, which can be used in coadministration
or sequential treatment with the hIL-3 variant of the present
invention include GM-CSF, CSF-1, G-CSF, Meg-CSF (more recently
referred to as c-mpl ligand), M-CSF, erythropoietin (EPO), IL-1,
IL-4, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12,
IL-13, LIF, flt3/flk2, human growth hormone, B-cell growth factor,
B-cell differentiation factor, eosinophil differentiation factor
and stem cell factor (SCF) also known as steel factor or c-kit
ligand and variants thereof.
[0040] The present invention relates to novel variants of human
interleukin-3 (hIL-3) in which amino acid substitutions have been
made at four or more positions in amino acid sequence of the
polypeptide used in sequential treatment or coadministration with
other colony stimulating factors. Preferred IL-3 variants of the
present invention which have deletions of amino acids 1 to 14 at
the N-terminus and 126 to 133 at the C-terminus and which also have
four or more amino acid substitutions in the polypeptide used in
coadministered or sequential treatment with other colony
stimulating factors or IL-3 variants. Among the preferred IL-3
variants are those having twenty-six amino acid substitutions. The
present invention includes mutant polypeptides comprising minimally
amino acids 15 to 118 of hIL-3 with or without additional amino
acid extensions to the N-terminus and/or C-terminus which further
contain four or more amino acid substitutions in the amino acid
sequence of the polypeptide.
[0041] As used herein human interleukin-3 corresponds to the amino
acid sequence (1-133) as depicted in FIG. 1 and (15-125) hIL-3
corresponds to the 15 to 125 amino acid sequence of the hIL-3
polypeptide. Naturally occurring variants of hIL-3 polypeptide
amino acids are also included in the present invention (for
example, the allele in which proline rather than serine is at
position 8 in the hIL-3 polypeptide sequence) as are variant hIL-3
molecules which are modified post-translationally (e.g.
glycosylation).
[0042] "Mutant amino acid sequence," "mutant protein" or "mutant
polypeptide" refers to a polypeptide having an amino acid sequence
which varies from a native sequence or is encoded by a nucleotide
sequence intentionally made variant from a native sequence. "Mutant
protein," "variant protein" or "mutein" means a protein comprising
a mutant amino acid sequence and includes polypeptides which differ
from the amino acid sequence of native hIL-3 due to amino acid
deletions, substitutions, or both. "Native sequence" refers to an
amino acid or nucleic acid sequence which is identical to a
wild-type or native form of a gene or protein.
[0043] Human IL-3 can be characterized by its ability to stimulate
colony formation by human hematopoietic progenitor cells. The
colonies formed include erythroid, granulocyte, megakaryocyte,
granulocytic macrophages and mixtures thereof. Human IL-3 has
demonstrated an ability to restore bone marrow function and
peripheral blood cell populations to therapeutically beneficial
levels in studies performed initially in primates and subsequently
in humans (Gillio, A. P., et al. (1990); Ganser, A, et al. (1990);
Falk, S., et al. (1991). Additional activities of hIL-3 include the
ability to stimulate leukocyte migration and chemotaxis; the
ability to prime human leukocytes to produce high levels of
inflammatory mediators like leukotrienes and histamine; the ability
to induce cell surface expression of molecules needed for leukocyte
adhesion; and the ability to trigger dermal inflammatory responses
and fever. Many or all of these biological activities of hIL-3
involve signal transduction and high affinity receptor binding.
Coadministration or sequential treatment using the IL-3 variants of
the present invention with other colony stimulating factors may
exhibit useful properties such as having similar or greater
biological activity when compared to native hIL-3 or by having
improved half-life or decreased adverse side effects, or a
combination of these properties. The IL-3 variants of the present
invention may also be useful as antagonists. IL-3 variants which
have little or no activity when compared to native hIL-3 may still
be useful as antagonists, as antigens for the production of
antibodies for use in immunology or immunotherapy, as genetic
probes or as intermediates used to construct other useful hIL-3
muteins.
[0044] The use of IL-3 variants of the present invention when
coadministered or as part of sequential treatment will preferably
have at least one biological property of human IL-3.
Coadministration or sequential treatment may also have more than
one IL-3-like biological property, or an improved property, or a
reduction in an undesirable biological property of human IL-3. Some
mutant polypeptides of the present invention may also exhibit an
improved side effect profile. For example, they may exhibit a
decrease in leukotriene release or histamine release when compared
to native hIL-3 or (15-125) hIL-3. Such hIL-3 or hIL-3-like
biological properties may include one or more of the following
biological characteristics and in vivo and in vitro activities.
[0045] One such property is the support of the growth and
differentiation of progenitor cells committed to erythroid,
lymphoid, and myeloid lineages. For example, in a standard human
bone marrow assay, an IL-3-like biological property is the
stimulation of granulocytic type colonies, megakaryocytic type
colonies, monocyte/macrophage type colonies, and erythroid bursts.
Other IL-3-like properties are the interaction with early
multipotential stem cells, the sustaining of the growth of
pluripotent precursor cells, the ability to stimulate chronic
myelogenous leukemia (CML) cell proliferation, the stimulation of
proliferation of mast cells, the ability to support the growth of
various factor-dependent cell lines, and the ability to trigger
immature bone marrow cell progenitors. Other biological properties
of IL-3 have been disclosed in the art. Human IL-3 also has some
biological activities which may in some cases be undesirable, for
example the ability to stimulate leukotriene release and the
ability to stimulate increased histamine synthesis in spleen and
bone marrow cultures and in vivo.
[0046] Biological activity of hIL-3 and hIL-3 variant proteins of
the present invention is determined by DNA synthesis by human acute
myelogenous leukemia cells (AML). The factor-dependent cell line
AML 193 was adapted for use in testing biological activity. The
biological activity of hIL-3 and hIL-3 variant proteins of the
present invention is also determined by counting the colony forming
units in a bone marrow assay.
[0047] Other in vitro cell based assays may also be useful to
determine the synergistic effect of multiple colony stimulating
factors that comprise the mixture. The following are examples of
other useful assays.
[0048] TF-1 proliferation assay: The TF-1 cell line was derived
from bone marrow of a patient with erythroleukemia (Kitamura et
al., 1989). TF-1 cells respond to IL-3, GM-CSF, EPO and IL-5. 32D
proliferation assay: 32D is a murine IL-3 dependent cell line which
does not respond to human IL-3 but does respond to human G-CSF
which is not species restricted.
[0049] T1165 proliferation assay: T1165 cells are a IL-6 dependent
murine cell line (Nordan et al., 1986) which respond to IL-6 and
IL-11.
[0050] Human Plasma Clot meg-CSF Assay: Used to assay megakaryocyte
colony formation activity (Mazur et al., 1981).
[0051] One object of the present invention is to provide hIL-3
variant with four or more amino acid substitutions in the
polypeptide sequence used in coadministration or sequential
treatment with other colony stimulating factors or IL-3 variants,
which have similar or improved biological activity in relation to
native hIL-3 or the other colony stimulating factors or IL-3
variant.
[0052] The hIL-3 variants of the present invention may have hIL-3
or hIL-3-like activity. For example, they may possess one or more
of the biological activities of native hIL-3 and may be useful in
stimulating the production of hematopoietic cells by human or
primate progenitor cells. The IL-3 variants of the present
invention and pharmaceutical compositions containing them may be
useful in the treatment of conditions in which hematopoietic cell
populations have been reduced or destroyed due to disease or to
treatments such as radiation or chemotherapy. Pharmaceutical
compositions containing IL-3 variants of the present invention can
be administered parenterally, intravenously, or subcutaneously.
[0053] Native hIL-3 possesses considerable inflammatory activity
and has been shown to stimulate synthesis of the arachidonic acid
metabolites LTC.sub.4, LTD.sub.4, and LTE.sub.4; histamine
synthesis and histamine release. Human clinical trials with native
hIL-3 have documented inflammatory responses (Biesma, et al.,
BLOOD, 80:1141-1148 (1992) and Postmus, et al., J. CLIN. ONCOL.,
10:1131-1140 (1992)). A recent study indicates that leukotrienes
were involved in IL-3 actions in vivo and may contribute
significantly to the biological effects of IL-3 treatment
(Denzlinger, C., et al., BLOOD, 81:2466-2470 (1993))
[0054] Some IL-3 variants of the present invention, when
co-administered with other CSFs, cytokines, lymphokines,
interleukins, hematopoietic growth factors or IL-3 variants, may
have an improved therapeutic profile as compared to native hIL-3 or
(15-125)hIL-3. For example, some IL-3 variants of the present
invention may have a similar or more potent growth factor activity
relative to native hIL-3 or (15-125)hIL-3 without having a similar
or corresponding increase in the stimulation of leukotriene or
histamine. These IL-3 variants would be expected to have a more
favorable therapeutic profile since the amount of polypeptide which
needs to be given to achieve the desired growth factor activity
(e.g. cell proliferation) would have a diminished leukotriene or
histamine stimulating effect. In studies with native hIL-3, the
stimulation of inflammatory factors has been an undesirable side
effect of the treatment. Reduction or elimination of the
stimulation of mediators of inflammation would provide an advantage
over the use of native hIL-3.
[0055] Novel IL-3 variants of the present invention may also be
useful as antagonists which block the hIL-3 receptor by binding
specifically to it and preventing binding of the agonist.
[0056] One potential advantage of the novel IL-3 variants of the
present invention, particularly those which retain activity similar
to or better than that of native hIL-3, is that it may be possible
to use a smaller amount of the biologically active mutein to
produce the desired therapeutic effect. This may make it possible
to reduce the number of treatments necessary to produce the desired
therapeutic effect. The use of smaller amounts may also reduce the
possibility of any potential antigenic effects or other possible
undesirable side effects. For example, if a desired therapeutic
effect can be achieved with a smaller amount of polypeptide it may
be possible to reduce or eliminate side effects associated with the
administration of native IL-3 such as the stimulation of
leukotriene and/or histamine release. The novel IL-3 variants of
the present invention may also be useful in the activation of stem
cells or progenitors which have low receptor numbers.
[0057] Compounds of this invention are preferably made by genetic
engineering techniques now standard in the art U.S. Pat. No.
4,935,233 and Sambrook et al., "Molecular Cloning. A Laboratory
Manual", Cold Spring Harbor Laboratory (1989)]. One method of
creating the preferred hIL-3 (15-125) mutant genes is cassette
mutagenesis [Wells, et al. (1985)] in which a portion of the coding
sequence of hIL-3 in a plasmid is replaced with synthetic
oligonucleotides that encode the desired amino acid substitutions
in a portion of the gene between two restriction sites. In a
similar manner amino acid substitutions could be made in the
full-length hIL-3 gene, or genes encoding variants of hIL-3 in
which from 1 to 14 amino acids have been deleted from the
N-terminus and/or from 1 to 15 amino acids have been deleted from
the C-terminus. When properly assembled these oligonucleotides
would encode hIL-3 variants with the desired amino acid
substitutions and/or deletions from the N-terminus and/or
C-terminus. These and other mutations could be created by those
skilled in the art by other mutagenesis methods including;
oligonucleotide-directed mutagenesis [Zoller and Smith (1982, 1983,
1984), Smith (1985), Kunkel (1985), Taylor, et al. (1985), Deng and
Nickoloff (1992)] or polymerase chain reaction (PCR) techniques
[Saiki, (1985)].
[0058] Plasmid DNA can be treated with the chosen restriction
endonucleases then ligated to the annealed oligonucleotides. The
ligated mixtures can be used to transform competent JM101 cells to
resistance to an appropriate antibiotic. Single colonies can be
picked and the plasmid DNA examined by restriction analysis and/or
DNA sequencing to identify plasmids with mutant hIL-3 genes.
[0059] Suitable cells or cell lines for the production of the
proteins claimed in the present invention may be bacterial cells.
For example, the various strains of E. coli are well-known as host
cells in the field of biotechnology. Examples of such strains
include E. coli strains JM101 [Yanish-Perron, et al. (1985)] and
MON105 [Obukowicz, et al. (1992)]. Also included in the present
invention is the expression of the IL-3 variant protein utilizing a
chromosomal expression vector for E. coli based on the
bacteriophage Mu (Weinberg et al., 1993). Various strains of B.
subtilis may also be employed as host cells for expression of the
polypeptides of the present invention. Many strains of yeast cells
known to those skilled in the art are also available as host cells
for expression of the polypeptides of the present invention. When
expressed in the E. coli cytoplasm, the above-mentioned mutant
hIL-3 variants of the present invention may also be constructed
with Met-Ala- at the N-terminus so that upon expression the Met is
cleaved off leaving Ala at the N-terminus. The IL-3 variant
proteins of the present invention may include polypeptides having
Met-, Ala- or Met-Ala- attached to the N-terminus. When the IL-3
variant polypeptides are expressed in the cytoplasm of E. coli,
polypeptides with and without Met attached to the N-terminus are
obtained. The N-termini of proteins made in the cytoplasm of E.
coli are affected by posttranslational processing by methionine
aminopeptidase (Ben-Bassat et al., 1987) and possibly by other
peptidases. These IL-3 variant proteins may also be expressed in E.
coli by fusing a signal peptide to the N-terminus. This signal
peptide is cleaved from the polypeptide as part of the secretion
process. Secretion in E. coli can be used to obtain the correct
amino acid at the N-terminus (e.g., Asn.sup.15 in the (15-125)
hIL-3 polypeptide) due to the precise nature of the signal
peptidase. This is in contrast to the heterogeneity which may be
observed at the N-terminus of proteins expressed in the cytoplasm
in E. coli.
[0060] Also suitable for use in the present invention are mammalian
cells, such as Chinese hamster ovary cells (CHO). General methods
for expression of foreign genes in mammalian cells are reviewed in:
Kaufman, R. J. (1987) High level production of proteins in
mammalian cells, in Genetic Engineering, Principles and Methods,
Vol. 9, J. K. Setlow, editor, Plenum Press, New York. An expression
vector is constructed in which a strong promoter capable of
functioning in mammalian cells drives transcription of a eukaryotic
secretion signal peptide coding region, which is translationally
fused to the coding region for the IL-3 variant. For example,
plasmids such as pcDNA I/Neo, pRc/RSV, and pRc/CMV (obtained from
Invitrogen Corp., San Diego, Calif.) can be used. The eukaryotic
secretion signal peptide coding region can be from the hIL-3 gene
itself or it can be from another secreted mammalian protein (Bayne,
M. L. et al. (1987) Proc. Natl. Acad. Sci. USA 84, 2638-2642).
After construction of the vector containing the hIL-3 variant gene,
the vector DNA is transfected into mammalian cells. Such cells can
be, for example, the COS7, HeLa, BHK, CHO, or mouse L lines. The
cells can be cultured, for example, in DMEM media (JRH Scientific).
The hIL-3 variant secreted into the media can be recovered by
standard biochemical approaches following transient expression
24-72 hours after transfection of the cells or after establishment
of stable cell lines following selection for neomycin resistance.
The selection of suitable mammalian host cells and methods for
transformation, culture, amplification, screening and product
production and purification are known in the art. See, e.g.,
Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively,
Kaufman et al, Mol. Cell. Biol., 5(7):1750-1759 (1985) or Howley et
al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line
is the monkey COS-1 cell line. A similarly useful mammalian cell
line is the CV-1 cell line.
[0061] Where desired, insect cells may be utilized as host cells in
the method of the present invention. See, e.g. Miller et al,
Genetic Engineering, 8:277-298 (Plenum Press 1986) and references
cited therein. In addition, general methods for expression of
foreign genes in insect cells using Baculovirus vectors are
described in: Summers, M. D. and Smith, G. E. (1987)--A manual of
methods for Baculovirus vectors and insect cell culture procedures,
Texas Agricultural Experiment Station Bulletin No. 1555. An
expression vector is constructed comprising a Baculovirus transfer
vector, in which a strong Baculovirus promoter (such as the
polyhedron promoter) drives transcription of a eukaryotic secretion
signal peptide coding region, which is translationally fused to the
coding region for the IL-3 variant polypeptide. For example, the
plasmid pVL1392 (obtained from Invitrogen Corp., San Diego, Calif.)
can be used. After construction of the vector carrying the gene
encoding the IL-3 variant polypeptide, two micrograms of this DNA
is cotransfected with one microgram of Baculovirus DNA (see Summers
& Smith, 1987) into insect cells, strain SF9. Pure recombinant
Baculovirus carrying the IL-3 variant gene is used to infect cells
cultured, for example, in Excell 401 serum-free medium (JRH
Biosciences, Lenexa, Kans.). The IL-3 variant protein secreted into
the medium can be recovered by standard biochemical approaches.
Supernatants from mammalian or insect cells expressing the IL-3
variant protein can be first concentrated using any of an number of
commercial concentration units.
[0062] Coadministration or sequential treatment using IL-3 variants
of the present invention with other colony stimulating factors may
be useful in the treatment of diseases characterized by a decreased
levels of either myeloid, erythroid, lymphoid, or megakaryocyte
cells of the hematopoietic system or combinations thereof. In
addition, they may be used to activate mature myeloid and/or
lymphoid cells. Among conditions susceptible to treatment with the
polypeptides of the present invention is leukopenia, a reduction in
the number of circulating leukocytes (white cells) in the
peripheral blood. Leukopenia may be induced by exposure to certain
viruses or to radiation. It is often a side effect of various forms
of cancer therapy, e.g., exposure to chemotherapeutic drugs,
radiation and of infection or hemorrhage. Therapeutic treatment of
leukopenia with these IL-3 variants of the present invention with
other colony stimulating factors may avoid undesirable side effects
caused by treatment with presently available drugs.
[0063] Coadministration or sequential treatment using IL-3 variants
of the present invention with other colony stimulating factors may
be useful in the treatment of neutropenia and, for example, in the
treatment of such conditions as aplastic anemia, cyclic
neutropenia, idiopathic neutropenia, Chediak-Higashi syndrome,
systemic lupus erythematosus (SLE), leukemia, myelodysplastic
syndrome and myelofibrosis.
[0064] The IL-3 variants of the present invention, when
coadministered or used in sequential treatment with other colony
stimulating factors, may be useful in the treatment or prevention
of thrombocytopenia. Currently the only therapy for
thrombocytopenia is platelet transfusions which are costly and
carry the significant risks of infection (HIV, HBV) and
alloimunization. The IL-3 variants, when coadministered or used in
sequential treatment with other colony stimulating factors, may
alleviate or diminish the need for platelet transfusions. Severe
thrombocytopenia may result from genetic defects such as Fanconi's
Anemia, Wiscott-Aldrich, or May-Hegglin syndromes. Acquired
thrombocytopenia may result from auto- or allo-antibodies as in
Immune Thrombocytopenia Purpura, Systemic Lupus Erythromatosis,
hemolytic anemia, or fetal maternal incompatibility. In addition,
splenomegaly, disseminated intravascular coagulation, thrombotic
thrombocytopenic purpura, infection or prosthetic heart valves may
result in thrombocytopenia. Severe thrombocytopenia may also result
from chemotherapy and/or radiation therapy or cancer.
Thrombocytopenia may also result from marrow invasion by carcinoma,
lymphoma, leukemia or fibrosis.
[0065] The IL-3 variants of the present invention, when
coadministered or used in sequential treatment with other colony
stimulating factors, may be useful in the mobilization of
hematopoietic progenitors and stem cells into peripheral blood.
Peripheral blood derived progenitors have been shown to be
effective in reconstituting patients in the setting of autologous
marrow transplantation. Hematopoietic growth factors including
G-CSF and GM-CSF have been shown to enhance the number of
circulating progenitors and stem cells in the peripheral blood.
This has simplified the procedure for peripheral stem cell
collection and dramatically decreased the cost of the procedure by
decreasing the number of pheresis required. The IL-3 variants, when
coadministered or used in sequential treatment with other colony
stimulating factors, may be useful in mobilization of stem cells
and further enhance the efficacy of peripheral stem cell
transplantation.
[0066] Another projected clinical use of growth factors has been in
the in vitro activation of hematopoietic progenitors and stem cells
for gene therapy. In order to have the gene of interest
incorporated into the genome of the hematopoietic progenitor or
stem cell one needs to stimulate cell division and DNA replication.
Hematopoietic stem cells cycle at a very low frequency which means
that growth factors may be useful to promote gene transduction and
thereby enhance the clinical prospects for gene therapy.
[0067] Many drugs may cause bone marrow suppression or
hematopoietic deficiencies. Examples of such drugs are AZT, DDI,
alkylating agents and anti-metabolites used in chemotherapy,
antibiotics such as chloramphenicol, penicillin, gancyclovir,
daunomycin and sulfa drugs, phenothiazones, tranquilizers such as
meprobamate, analgesics such as aminopyrine and dipyrone,
anticonvulsants such as phenytoin or carbamazepine antithyroids
such as propylthiouracil and methimazole and diuretics.
Coadministration or sequential treatment using IL-3 variants of the
present invention with other colony stimulating factors may be
useful in preventing or treating the bone marrow suppression or
hematopoietic deficiencies which often occur in patients treated
with these drugs.
[0068] Hematopoietic deficiencies may also occur as a result of
viral, microbial or parasitic infections and as a result of
treatment for renal disease or renal failure, e.g., dialysis.
Coadministration or sequential treatment using IL-3 variants of the
present invention with other colony stimulating factors may be
useful in treating such hematopoietic deficiency.
[0069] The treatment of hematopoietic deficiency may include
administration of a pharmaceutical composition containing the IL-3
variants with other colony stimulating factors to a patient.
Coadministration or sequential treatment using IL-3 variants of the
present invention with other colony stimulating factors may also be
useful for the activation and amplification of hematopoietic
precursor cells by treating these cells in vitro with the
coadministration or sequential treatment using IL-3 variants of the
present invention with other colony stimulating factors prior to
injecting the cells into a patient.
[0070] Various immunodeficiencies e.g., in T and/or B lymphocytes,
or immune disorders, e.g., rheumatoid arthritis, may also be
beneficially affected by treatment with the coadministration or
sequential treatment using IL-3 variants of the present invention
with other colony stimulating factors molecules of the present
invention. Immunodeficiencies may be the result of viral infections
e.g. HTLVI, HTLVII, HTLVIII, severe exposure to radiation, cancer
therapy or the result of other medical treatment. IL-3 variants of
the present invention may also be employed, alone or in combination
with other hematopoietins, in the treatment of other blood cell
deficiencies, including thrombocytopenia (platelet deficiency), or
anemia. Other uses for these novel polypeptides are in the
treatment of patients recovering from bone marrow transplants in
vivo and ex vivo, and in the development of monoclonal and
polyclonal antibodies generated by standard methods for diagnostic
or therapeutic use.
[0071] Other aspects of the present invention are methods and
therapeutic compositions for treating the conditions referred to
above. Such compositions comprise a therapeutically effective
amount of one or more of the IL-3 variants of the present invention
with other colony stimulating factors in a mixture with a
pharmaceutically acceptable carrier. This composition can be
administered either parenterally, intravenously or subcutaneously.
When administered, the therapeutic composition for use in this
invention is preferably in the form of a pyrogen-free, parenterally
acceptable aqueous solution. The preparation of such a parenterally
acceptable protein solution, having due regard to pH, isotonicity,
stability and the like, is within the skill of the art.
[0072] The dosage regimen involved in a method for treating the
above-described conditions will be determined by the attending
physician considering various factors which modify the action of
drugs, e.g. the condition, body weight, sex and diet of the
patient, the severity of any infection, time of administration and
other clinical factors. Generally, a daily regimen may be in the
range of 0.2-150 .mu.g/kg of IL-3 variant protein per kilogram of
body weight. This dosage regimen is referenced to a standard level
of biological activity which recognizes that native IL-3 generally
possesses an EC.sub.50 at or about 10 picoMolar to 100 picoMolar in
the AML proliferation assay described herein. Therefore, dosages
would be adjusted relative to the activity of a given IL-3 variant
protein vs. the activity of native (reference) IL-3 and it would
not be unreasonable to note that dosage regimens may include doses
as low as 0.1 microgram and as high as 1 milligram per kilogram of
body weight per day. In addition, there may exist specific
circumstances where dosages of IL-3 variant protein would be
adjusted higher or lower than the range of 10-200 micrograms per
kilogram of body weight. These include co-administration with other
CSF, cytokine, lymphokine, interleukin, hematopoietic growth factor
or IL-3 variant or growth factors; co-administration with
chemotherapeutic drugs and/or radiation; the use of glycosylated
IL-3 proteins; and various patient-related issues mentioned earlier
in this section. As indicated above, the therapeutic method and
compositions may also include co-administration with other human
factors. A non-exclusive list of other appropriate hematopoietins,
CSFs, cytokines, lymphokines, hematopoietic growth factors and
interleukins for simultaneous or serial co-administration with the
polypeptides of the present invention includes GM-CSF, CSF-1,
G-CSF, Meg-CSF (more recently referred to as c-mpl ligand), M-CSF,
erythropoietin (EPO), IL-1, IL-4, IL-2, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, LIF, flt3/flk2, human growth
hormone, B-cell growth factor, B-cell differentiation factor and
eosinophil differentiation factor, stem cell factor (SCF) also
known as steel factor or c-kit ligand, or combinations thereof. The
dosage recited above would be adjusted to compensate for such
additional components in the therapeutic composition. Progress of
the treated patient can be monitored by periodic assessment of the
hematological profile, e.g., differential cell count and the
like.
[0073] The present invention includes the following
compositions:
[0074] 1. A composition comprising:
[0075] A human interleukin-3 mutant polypeptide of the Formula:
1 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:1] 1 5 10 15 Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Lys, Gly, Asp, Met, Gln, or Arg; Xaa at position 18 is Asn,
His, Leu, Ile, Phe, Arg, or Gln; Xaa at position 19 is Met, Phe,
Ile, Arg, Gly, Ala, or Cys; Xaa at position 20 is Ile, Cys, Gln,
Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg,
Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is
Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa
at position 23 is Ile, Val, Ala, Leu, Gly, Trp, Lys, Phe, Leu, Ser,
or Arg; Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala; Xaa at
position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is
Gln, Asn, Leu, Pro, Arg, or Val; Xaa at position 30 is Pro, His,
Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa at position 31 is Pro,
Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at position 32 is Leu, Val,
Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at position 33 is Pro, Leu,
Gln, Ala, Thr, or Glu; Xaa at position 34 is Leu, Val, Gly, Ser,
Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35
is Leu, Ala, Gly, Asn, Pro, Gln, or Val; Xaa at position 36 is Asp,
Leu, or Val; Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile; Xaa
at position 38 is Asn, or Ala; Xaa at position 40 is Leu, Trp, or
Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val,
Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn,
Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at
position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn,
Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met,
Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa
at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His,
Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, Gly, Val,
Ser, Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg,
Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position
49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp; Xaa at position 50
is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe,
Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or
His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or
Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn,
Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser,
Leu, or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu,
Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57
is Asn or Gly; Xaa at position 58 is Leu. Ser, Asp, Arg, Gln, Val,
or Cys; Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa
at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr; Xaa at position
61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is
Asn His, Val, Arg, Pro, Thr, Asp, or Ile; Xaa at position 63 is
Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val; Xaa at position 64 is
Ala, Asn, Pro, Ser, or Lys; Xaa at position 65 is Val, Thr, Pro,
His, Leu, Phe, or Ser; Xaa at position 66 is Lys, Ile, Arg, Val,
Asn, Glu, or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly,
Asn, Ile, Pro, or His; Xaa at position 68 is Leu, Val, Trp, Ser,
Ile, Phe, Thr, or His; Xaa at position 69 is Gln, Ala, Pro, Thr,
Glu, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn, Leu, Val,
Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg,
Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu, Met,
Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu, Asp,
Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Met, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, Gln, or Leu; Xaa at position 76 is Ser, Val, Ala,
Asn, Trp, Glu, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser,
Arg, Thr, or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe,
Gly, or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile,
Gly, or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu,
Glu, or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg,
Val, or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp,
Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at
position 83 is Pro, Ala, Thr, Trp, Arg, or Met; Xaa at position 84
is Cys, Glu, Gly, Arg, Met, or Val; Xaa at position 85 is Leu, Asn,
Val, or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa
at position 87 is Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala,
Lys, Arg, Val, or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu,
Val, Glu, His, Asn, or Ser; Xaa at position 90 is Ala, Pro, Ser,
Thr, Gly, Asp, Ile, or Met; Xaa at position 91 is Ala, Pro, Ser,
Thr, Phe, Leu, Asp, or His; Xaa at position 92 is Pro, Phe, Arg,
Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr,
Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at position 94 is Arg,
Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro; Xaa at
position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys,
Ser, Ala, Trp, Phe, Ile, or Tyr; Xaa at position 96 is Pro, Lys,
Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile, Val, Lys, Ala, or
Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu,
Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99
is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His; Xaa at
position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro; Xaa
at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu,
Asn, Ser, Ala, Gly, Ile, Leu, or Gln; Xaa at position 102 is Gly,
Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 103 is Asp, or
Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu,
Gln, Lys, Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala,
Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at
position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or
Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His,
Glu, Ser, Ala, or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp,
or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser,
or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr,
Asp, Lys, Leu, Ile, Val or Asn; Xaa at position 114 is Tyr, Cys,
His, Ser, Trp, Arg, or Leu; Xaa at position 115 is Leu, Asn, Val,
Pro, Arg, Ala, His, Thr, Trp, or Met; Xaa at position 116 is Lys,
Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala,
Tyr, Phe, Gln, or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile,
Trp, Lys, or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu,
Cys, Asp, or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu,
Thr, Tyr, or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His,
Val, or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys,
Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe,
Pro, His, Ile, Tyr, or Cys; Xaa at position 123 is Ala, Met, Glu,
His, Ser, Pro, Tyr, or Leu;
[0076] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133) human interleukin-3;
[0077] A colony stimulating factor selected from the group
consisting of GM-CSF, CSF-1, G-CSF, Meg-CSF (more recently referred
to as c-mpl ligand), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, LIF,
flt3/flk2, human growth hormone, B-cell growth factor, B-cell
differentiation factor, eosinophil differentiation factor and stem
cell factor (SCF); and
[0078] At least one non-toxic pharmaceutically acceptable
carrier.
[0079] 2 A composition, comprising: A human interleukin-3 mutant
polypeptide of the Formula:
2 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:2] 1 5 10 15 Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu Xaa 50 55 60 Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa Xaa 95 100 105 Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Gly, Asp, Met, or Gln; Xaa at position 18 is Asn, His, or
Ile; Xaa at position 19 is Met or Ile; Xaa at position 2i is Asp or
Glu; Xaa at position 23 is Ile, Ala, Leu, or Gly; Xaa at position
24 is Ile, Val, or Leu; Xaa at position 25 is Thr, His, Gln, or
Ala; Xaa at position 26 is His or Ala; Xaa at position 29 is Gln,
Asn, or Val; Xaa at position 30 is Pro, Gly, or Gln; Xaa at
position 31 is Pro, Asp, Gly, or Gln; Xaa at position 32 is Leu,
Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at position 33 is Pro or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Ala, Arg, Gln, Glu,
Ile, Phe, Thr or Met; Xaa at position 35 is Leu, Ala, Asn, Pro,
Gln, or Val; Xaa at position 37 is Phe, Ser, Pro, or Trp; Xaa at
position 38 is Asn or Ala; Xaa at position 42 is Gly, Asp, Ser,
Cys, Ala, Asn, Ile, Leu, Met, Tyr or Arg; Xaa at position 44 is Asp
or Glu; Xaa at position 45 is Gln, Val, Met, Leu, Thr, Ala, Asn,
Glu, Ser or Lys; Xaa at position 46 is Asp, Phe, Ser, Thr, Ala, Asn
Gln, Glu, His, Ile, Lys, Tyr, Val or Cys; Xaa at position 50 is
Glu, Ala, Asn, Ser or Asp; Xaa at position 51 is Asn, Arg, Met,
Pro, Ser, Thr, or His; Xaa at position 54 is Arg or Ala; Xaa at
position 55 is Arg, Thr, Val, Leu, or Gly; Xaa at position 56 is
Pro, Gly, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val or Lys; Xaa
at position 60 is Ala or Ser; Xaa at position 62 is Asn, Pro, Thr,
or Ile; Xaa at position 63 is Arg or Lys; Xaa at position 64 is Ala
or Asn; Xaa at position 65 is Val or Thr; Xaa at position 66 is Lys
or Arg; Xaa at position 67 is Ser, Phe, or His; Xaa at position 68
is Leu, Ile, Phe, or His; Xaa at position 69 is Gln, Ala, Pro, Thr,
Glu, Arg, or Gly; Xaa at position 71 is Ala, Pro, or Arg; Xaa at
position 72 is Ser, Glu, Arg, or Asp; Xaa at position 73 is Ala or
Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Glu, Pro, or Gly;
Xaa at position 77 is Lie or Leu; Xaa at position 79 is Lys, Thr,
Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa at position 80 is Asn,
Gly, Glu, or Arg; Xaa at position 82 is Leu, Gln, Trp, Arg, Asp,
Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr, Tyr or Val; Xaa at
position 83 is Pro or Thr; Xaa at position 85 is Leu or Val; Xaa at
position 87 is Leu or Ser; Xaa at position 88 is Ala or Trp; Xaa at
position 91 is Ala or Pro; Xaa at position 93 is Thr, Asp, Ser,
Pro, Ala, Leu, or Arg; Xaa at position 95 is His, Pro, Arg, Val,
Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 96 is Pro or Tyr;
Xaa at position 97 is Ile or Val; Xaa at position 98 is His, Ile,
Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser, Tyr, Val or
Pro; Xaa at position 99 is Ile, Leu, or Val; Xaa at position 100 is
Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position 101 is Asp, Pro,
Met, Lys, His, Thr, Pro, Asn, Ile, Leu or Tyr; Xaa at position 104
is Trp or Leu; Xaa at position 105 is Asn, Pro, Ala, Ser, Trp, Gln,
Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 106 is Glu or Gly;
Xaa at position 108 is Arg, Ala,.or Ser; Xaa at position 109 is
Arg, Thr, Glu, Leu, or Ser; Xaa at position 112 is Thr, Val, or
Gln; Xaa at position 114 is Tyr or Trp; Xaa at position 115 is Leu
or Ala; Xaa at position 116 is Lys, Thr, Val, Trp, Ser, Ala, His,
Met, Phe, Tyr or Ile; Xaa at position 117 is Thr or Ser; Xaa at
position 120 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position
121 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly; Xaa at position 122 is
Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys; Xaa at
position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu.
[0080] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 35 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3;
[0081] A colony stimulating factor selected from the group
consisting of GM-CSF, CSF-1, G-CSF, Meg-CSF (more recently referred
to as c-mp1 ligand), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, LIF,
flt3/flk2, human growth hormone, B-cell growth factor, B-cell
differentiation factor, eosinophil differentiation factor and stem
cell factor (SCF); and
[0082] At least one non-toxic pharmaceutically acceptable
carrier.
[0083] 3. A composition of 2, wherein said human interleukin-3
mutant polypeptide is of the Formula:
3 Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn [SEQ
ID NO:3] 1 5 10 15 Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu
Lys Xaa Xaa 20 25 30 Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp Xaa 35 40 45 Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu Ala 50 55 60 Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile Glu 65 70 75 Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr Ala 80 85 90 Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp Xaa 95 100 105 Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu Xaa 110 115 120 Xaa Xaa Xaa Gln Gln
Thr Thr Leu Ser Leu Ala Ile Phe 125 130 wherein Xaa at position 17
is Ser, Gly, Asp, or Gln; Xaa at position 18 is Asn, His, or Ile;
Xaa at position 23 is Ile, Ala, Leu, or Gly; Xaa at position 25 is
Thr, His, or Gln; Xaa at position 26 is His or Ala; Xaa at position
29 is Gln or Asn; Xaa at position 30 is Pro or Gly; Xaa at position
32 is Leu, Arg, Asn, or Ala; Xaa at position 34 is Leu, Val, Ser,
Ala, Arg, Gln, Glu, Ile, Phe, Thr, or Met; Xaa at position 35 is
Leu, Ala, Asn, or Pro; Xaa at position 38 is Asn or Ala; Xaa at
position 42 is Gly, Asp, Ser, Ala, Asn, Ile, Leu, Met, Tyr or Arg;
Xaa at position 45 is Gln, Val, Met, Leu, Ala, Asn, Glu, or Lys;
Xaa at position 46 is Asp, Phe, Ser, Gln, Glu, His, Val or Thr; Xaa
at position 50 is Glu Asn, Ser or Asp; Xaa at position 51 is Asn,
Arg, Pro, Thr, or His; Xaa at position 55 is Arg, Leu, or Gly; Xaa
at position 56 is Pro, Gly, Ser, Ala, Asn, Val, Leu or Gln; Xaa at
position 62 is Asn, Pro, or Thr; Xaa at position 64 is Ala or Asn;
Xaa at position 65 is Val or Thr; Xaa at position 67 is Ser or Phe;
Xaa at position 68 is Leu or Phe; Xaa at position 69 is Gln, Ala,
Glu, or Arg; Xaa at position 76 is Ser, Val, Asn, Pro, or Gly; Xaa
at position 77 is Ile or Leu; Xaa at position 79 is Lys, Gly, Asn,
Met, Arg, Ile, or Gly; Xaa at position 80 is Asn, Gly, Glu, or Arg;
Xaa at position 82 is Leu, Gln, Trp, Arg, Asp, Asn, Glu, His, Met,
Phe, Ser, Thr, Tyr or Val; Xaa at position 87 is Leu or Ser; Xaa at
position 88 is Ala or Trp; Xaa at position 91 is Ala or Pro; Xaa at
position 93 is Thr, Asp, or Ala; Xaa at position 95 is His, Pro,
Arg, Val, Gly, Asn, Ser or Thr; Xaa at position 98 is His, Ile,
Asn, Ala, Thr, Gln, Glu, Lys, Met, Ser, Tyr, Val or Leu; Xaa at
position 99 is Ile or Leu; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, Met, Lys, Thr, His, Pro, Asn, Ile, Leu
or Tyr; Xaa at position 105 is Asn, Pro, Ser, Ile or Asp; Xaa at
position 108 is Arg, Ala, or Ser; Xaa at position 109 is Arg, Thr,
Glu, Leu, or Ser; Xaa at position 112 is Thr or Gln; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, Tyr or Ile; Xaa at
position 117 is Thr or Ser; Xaa at position 120 is Asn, Pro, Leu,
His, Val, or Gln; Xaa at position 121 is Ala, Ser, Ile, Pro, or
Asp; Xaa at position 122 is Gln, Met, Trp, Phe, Pro, His, Ile, or
Tyr; Xaa at position 123 is Ala, Met, Glu, Ser, or Leu;
[0084] and which can additionally have Met- preceding the amino
acid in position 1; and wherein from 1 to 14 amino acids can be
deleted from the N-terminus and/or from 1 to 15 amino acids can be
deleted from the C-terminus; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3.
[0085] 4. A composition of 3,wherein said human interleukin-3
mutant polypeptide is of the Formula:
4 Xaa at position 42 is Gly, Asp, Ser, Ile, Leu, Met, Tyr, or Ala;
Xaa at position 45 is Gln, Val, Met or Asn; Xaa at position 46 is
Asp, Ser, Gln, His or Val; Xaa at position 50 is Glu or Asp; Xaa at
position 51 is Asn, Pro or Thr; Xaa at position 62 is Asn or Pro;
Xaa at position 76 is Ser, or Pro; Xaa at position 82 is Leu, Trp,
Asp, Asn Glu, His, Phe, Ser or Tyr; Xaa at position 95 is His, Arg,
Thr, Asn or Ser; Xaa at position 98 is His, Ile, Leu, Ala, Gln,
Lys, Met, Ser, Tyr or Val; Xaa at position 100 is Lys or Arg; Xaa
at position 101 is Asp, Pro, His, Asn, Ile or Leu; Xaa at position
105 is Asn, or Pro; Xaa at position 108 is Arg, Ala, or Ser; Xaa at
position 116 is Lys, Val, Trp, Ala, His, Phe, or Tyr; Xaa at
position 121 is Ala, or Ile; Xaa at position 122 is Gln, or Ile;
and Xaa at position 123 is Ala, Met or Glu.
[0086] 5. A composition, comprising:
[0087] A human interleukin-3 mutant polypeptide of the Formula:
5 Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa [SEQ
ID NO:4] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asn Xaa Xaa
Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Lys, Gly, Asp, Met, Gln, or
Arg; Xaa at position 4 is Asn, His, Leu, Ile, Phe, Arg, or Gln; Xaa
at position 5 is Met, Phe, Ile, Arg, Gly, Ala, or Cys; Xaa at
position 6 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position
7 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 8 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln,
Leu, Val, or Gly; Xaa at position 9 is Ile, Val, Ala, Leu, Gly,
Trp, Lys, Phe, Leu, Ser, or Arg; Xaa at position 10 is Ile, Gly,
Val, Arg, Ser, Phe, or Leu; Xaa at position 11 is Thr, His, Gly,
Gln, Arg, Pro, or Ala; Xaa at position 12 is His, Thr, Phe, Gly,
Arg, Ala, or Trp; Xaa at position 13 is Leu, Gly, Arg, Thr, Ser, or
Ala; Xaa at position 14 is Lys, Arg, Leu, Gln, Gly, Pro, Val or
Trp; Xaa at position 15 is Gln, Asn, Leu, Pro, Arg, or Val; Xaa at
position 16 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys; Xaa
at position 17 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln; Xaa at
position 18 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro, Leu, Gln, Ala, Thr, or Glu; Xaa at position 20
is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or
Met; Xaa at position 21 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 22 is Asp, Leu, or Val; Xaa at position 23 is Phe,
Ser, Pro, Trp, or Ile; Xaa at position 24 is Asn, or Ala; Xaa at
position 26 is Leu, Trp, or Arg; Xaa at position 27 is Asn, Cys,
Arg, Leu, His, Met, Pro; Xaa at position 28 is Gly, Asp, Ser, Cys,
Ala, Lys, Asn, Thr, Leu, Val, Glu, Phe, Tyr, Ile or Met; Xaa at
position 29 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg,
Thr, Gly or Ser; Xaa at position 30 is Asp, Ser, Leu, Arg, Lys,
Thr,Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 31 is Gln,
Pro, Phe, Val, Met, Leu, Thr, Lys, Asp, Asn, Arg, Ser, Ala, Ile,
Glu, His or Trp; Xaa at position 32 is Asp, Phe, Ser, Thr, Cys,
Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position
33 is Ile, Gly, Val, Ser, Arg, Pro, or His; Xaa at position 34 is
Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or
Asn; Xaa at position 35 is Met, Arg, Ala, Gly, Pro, Asn, His, or
Asp; Xaa at position 36 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser,
Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 37 is Asn,
Arg, Met, Pro, Ser, Thr, or His; Xaa at position 38 is Asn, His,
Arg, Leu, Gly, Ser, or Thr; Xaa at position 39 is Leu, Thr, Ala,
Gly, Glu, Pro, Lys, Ser, Met, or; Xaa at position 40 is Arg, Asp,
Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position
41 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 42 is Pro,
Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or
Lys; Xaa at position 43 is Asn or Gly; Xaa at position 44 is Leu,
Ser, Asp, Arg, Gln, Val, or Cys; Xaa at position 45 is Glu Tyr,
His, Leu, Pro, or Arg; Xaa at position 46 is Ala, Ser, Pro, Tyr,
Asn, or Thr; Xaa at position 47 is Phe, Asn, Glu, Pro, Lys, Arg, or
Ser; Xaa at position 48 is Asn, His, Val, Arg, Pro, Thr, Asp, or
Ile; Xaa at position 49 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or
Val; Xaa at position 50 is Ala, Asn, Pro, Ser, or Lys; Xaa at
position 51 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 52 is Lys, Ile, Arg, Val, Asn, Glu, or Ser; Xaa at
position 53 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa
at position 54 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His; Xaa at
position 55 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu; Xaa
at position 56 is Asn, Leu, Val, Trp, Pro, or Ala; Xaa at position
57 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at
position 58 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp; Xaa at
position 59 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at
position 60 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position
61 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu; Xaa at
position 62 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp; Xaa
at position 63 is Ile, Ser, Arg, Thr, or Leu; Xaa at position 64 is
Leu, Ala, Ser, Glu, Phe, Gly, or Arg; Xaa at position 65 is Lys,
Thr, Gly, Asn, Met, Arg, Ile, or Asp; Xaa at position 66 is Asn,
Trp, Val, Gly, Thr, Leu, Glu, or Arg; Xaa at position 67 is Leu,
Gln, Gly, Ala, Trp, Arg, Val, or Lys; Xaa at position 68 is Leu,
Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe,
Ile, Met or Val; Xaa at position 69 is Pro, Ala, Thr, Trp, Arg, or
Met; Xaa at position 70 is Cys, Glu, Gly, Arg, Met, or Val; Xaa at
position 71 is Leu, Asn, Val, or Gln; Xaa at position 72 is Pro,
Cys, Arg, Ala, or Lys; Xaa at position 73 is Leu, Ser, Trp, or Gly;
Xaa at position 74 is Ala, Lys, Arg, Val, or Trp; Xaa at position
75 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser; Xaa at
position 76 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met; Xaa at
position 77 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 78 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 79 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 80 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His,
Ala or Pro; Xaa at position 81 is His, Gln, Pro, Arg, Val, Leu,
Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position
82 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 83 is Ile,
Val, Lys, Ala, or Asn; Xaa at position 84 is His, Ile, Asn, Leu,
Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 85 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser,
Phe, or His; Xaa at position 86 is Lys, Tyr, Leu, His, Arg, Ile,
Ser, Gln, Pro; Xaa at position 87 is Asp, Pro, Met, Lys, His, Thr,
Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position
88 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro; Xaa at position 89 is
Asp, or Ser; Xaa at position 90 is Trp, Val, Cys, Tyr, Thr, Met,
Pro, Leu, Gln, Lys, Ala, Phe, or Gly; Xaa at position 91 is Asn,
Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa
at position 92 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at
position 94 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala, or
Pro; Xaa at position 95 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or
Gly; Xaa at position 96 is Lys, Asn, Thr, Leu, Gln, Arg, His, Glu,
Ser, Ala or Trp; Xaa at position 97 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 98 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 99 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys,
Leu, Ile, Val or Asn; Xaa at position 100 is Tyr, Cys, His, Ser,
Trp, Arg, or Leu; Xaa at position 101 is Leu, Asn, Val, Pro, Arg,
Ala, His, Thr, Trp, or Met; Xaa at position 102 is Lys, Leu, Pro,
Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe,
Gln, or Ile; Xaa at position 103 is Thr, Ser, Asn, Ile, Trp, Lys,
or Pro; Xaa at position 104 is Leu, Ser, Pro, Ala, Glu, Cys, Asp,
or Tyr; Xaa at position 105 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr,
or Arg; Xaa at position 106 is Asn, Ala, Pro, Leu, His, Val, or
Gln; Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or
Gly; Xaa at position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His,
Ile, Tyr, or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser,
Pro, Tyr, or Leu;
[0088] and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 44 of the amino
acids designated by Xaa are different from the corresponding native
amino acids of (1-133) human interleukin-3;
[0089] A colony stimulating factor selected from the group
consisting of GM-CSF, CSF-1, G-CSF, Meg-CSF (more recently referred
to as c-mpl ligand), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, LIF,
flt3/flk2, human growth hormone, B-cell growth factor, B-cell
differentiation factor, eosinophil differentiation factor and stem
cell factor (SCF); and
[0090] At least one non-toxic pharmaceutically acceptable
carrier.
[0091] 6. A composition of 5, wherein said human interleukin-3
mutant polypeptide is of the Formula:
6 Asn Cys Xaa Xaa Xaa Ile Xaa Glu Xaa Xaa Xaa Xaa Leu Lys Xaa [SEQ
ID NO:5] 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Asn Leu Asn
Xaa Glu Xaa 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Xaa Xaa
Xaa Asn Leu Glu 35 40 45 Xaa Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Asn Xaa Xaa Xaa Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Xaa
Cys Xaa Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly Asp Xaa 80 85 90 Xaa Xaa Phe Xaa Xaa Lys Leu
Xaa Phe Xaa Xaa Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Gly, Asp, Met, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 5 is Met or Ile;
Xaa at position 7 is Asp or Glu; Xaa at position 9 is Ile, Ala,
Leu, or Gly; Xaa at position 10 is Ile, Val, or Leu; Xaa at
position ii is Thr, His, Gln, or Ala; Xaa at position 12 is His or
Ala; Xaa at position 15 is Gln, Asn, or Val; Xaa at position 16 is
Pro, Gly, or Gln; Xaa at position 17 is Pro, Asp, Gly, or Gln; Xaa
at position 18 is Leu, Arg, Gln, Asn, Gly, Ala, or Glu; Xaa at
position 19 is Pro or Glu; Xaa at position 20 is Leu, Val, Gly,
Ser, Lys, Ala, Arg, Gln, Glu, Ile, Phe, Thr or Met; Xaa at position
21 is Leu, Ala, Asn, Pro, Gln, or Val; Xaa at position 23 is Phe,
Ser, Pro, or Trp; Xaa at position 24 is Asn or Ala; Xaa at position
28 is Gly, Asp, Ser, Cys, Ala, Asn, Ile, Leu, Met Tyr or Arg; Xaa
at position 30 is Asp or Glu; Xaa at position 31 is Gln, Val, Met,
Leu, Thr, Ala, Asn, Glu, Ser or Lys; Xaa at position 32 is Asp,
Phe, Ser, Thr, Ala, Asn, Gln, Glu, His, Ile, Lys, Tyr, Val or Cys;
Xaa at position 36 is Glu, Ala, Asn, Ser or Asp; Xaa at position 37
is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at position 40 is Arg
or Ala; Xaa at position 41 is Arg, Thr, Val, Leu, or Gly; xaa at
position 42 is Pro, dy, Ser, Gln, Ala, Arg, Asn, Glu, Leu, Thr, Val
or Lys; Xaa at position 46 is Ala or Ser; Xaa at position 48 is
Asn, Pro, Thr, or Ile; Xaa at position 49 is Arg or Lys; Xaa at
position 50 is Ala or Asn; Xaa at position 51 is Val or Thr; Xaa at
position 52 is Lys or Arg; Xaa at position 53 is Ser, Phe, or His;
Xaa at position 54 is Leu, Ile, Phe, or His; Xaa at position 55 is
Gln, Ala, Pro, Thr, Glu, Arg, or Gly; Xaa at position 57 is Ala,
Pro, or Arg; Xaa at position 58 is Ser, Glu, Arg, or Asp; Xaa at
position 59 is Ala or Leu; Xaa at position 62 is Ser, Val, Ala,
Asn, Glu, Pro, or Gly; Xaa at position 63 is Ile or Leu; Xaa at
position 65 is Lys, Thr, Gly, Asn, Met, Arg, Ile, Gly, or Asp; Xaa
at position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Ala, Asn, Glu, His, Ile, Met, Phe, Ser, Thr,
Tyr or Val; Xaa at position 69 is Pro or Thr; Xaa at position 71 is
Leu or Val; Xaa at position 73 is Leu or Ser; Xaa at position 74 is
Ala or Trp; Xaa at position 77 is Ala or Pro; Xaa at position 79 is
Thr, Asp, Ser, Pro, Ala, Leu, or Arg; Xaa at position 81 is His,
Pro, Arg, Val, Leu, Gly, Asn, Phe, Ser or Thr; Xaa at position 82
is Pro or Tyr; Xaa at position 83 is Tie or Val; Xaa at position 84
is His, Ile, Asn, Leu, Ala, Thr, Leu, Arg, Gln, Leu, Lys, Met, Ser,
Tyr, Val or Pro; Xaa at position 85 is Ile, Leu, or Val; Xaa at
position 86 is Lys, Arg, Ile, Gln, Pro, or Ser; Xaa at position 87
is Asp, Pro, Met, Lys, His, Thr, Asn, Ile, Leu or Tyr; Xaa at
position 90 is Trp or Leu; Xaa at position 91 is Asn, Pro, Ala,
Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His; Xaa at position 92
is Glu, or Gly; Xaa at position 94 is Arg, Ala, or Ser; Xaa at
position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position 98 is
Thr, Val, br Gln; Xaa at position 100 is Tyr or Trp; Xaa at
position 101 is Leu or Ala; Xaa at position 102 is Lys, Thr, Val,
Trp, Ser, Ala, His, Met, Phe, Tyr or Ile; Xaa at position 103 is
Thr or Ser; Xaa at position 106 is Asn, Pro; Leu, His, Val, or Gln;
Xaa at position 107 is Ala, Ser, Ile, Asn, Pro, Asp, or Gly; Xaa at
position 108 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr,
or Cys; Xaa at position 109 is Ala, Met, Glu, His, Ser, Pro, Tyr,
or Leu;
[0092] which can additionally have Met- or Met-Ala- preceding the
amino acid in position 1; and wherein from 4 to 35 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native human interleukin-3.
[0093] 7. A composition of 6, wherein said human interleukin-3
mutant polypeptide is of the Formula:
7 Asn Cys Xaa Xaa Met Ile Asp Glu Xaa Ile Xaa Xaa Leu Lys Xaa [SEQ
ID NO:6] 1 5 10 15 Xaa Pro Xaa Pro Xaa Xaa Asp Phe Xaa Asn Leu Asn
Xaa Glu Asp 20 25 30 Xaa Xaa Ile Leu Met Xaa Xaa Asn Leu Arg Xaa
Xaa Asn Leu Glu 35 40 45 Ala Phe Xaa Arg Xaa Xaa Lys Xaa Xaa Xaa
Asn Ala Ser Ala Ile 50 55 60 Glu Xaa Xaa Leu Xaa Xaa Leu Xaa Pro
Cys Leu Pro Xaa Xaa Thr 65 70 75 Ala Xaa Pro Xaa Arg Xaa Pro Ile
Xaa Xaa Xaa Xaa Gly Asp Trp 80 85 90 Xaa Glu Phe Xaa Xaa Lys Leu
Xaa Phe Tyr Leu Xaa Xaa Leu Glu 95 100 105 Xaa Xaa Xaa Xaa Gln Gln
110 wherein Xaa at position 3 is Ser, Gly, Asp, or Gln; Xaa at
position 4 is Asn, His, or Ile; Xaa at position 9 is Ile, Ala, Leu,
or Gly; Xaa at position 11 is Thr, His, or Gln; Xaa at position 12
is His or Ala; Xaa at position 15 is Gln or Asn; Xaa at position 16
is Pro or Gly; Xaa at position 18 is Leu, Arg, Asn, or Ala; Xaa at
position 20 is Leu, Val, Ser, Ala, Arg, Gln, Glu, Ile, Phe, Thr or
Met; Xaa at position 21 is Leu, Ala, Asn, or Pro; Xaa at position
24 is Asn or Ala; Xaa at position 28 is Gly, Asp, Ser, Ala, Asn,
Ile, Leu, Met, Tyr or Arg; Xaa at position 31 is Gln, Val, Met,
Leu, Ala, Asn, Glu or Lys; Xaa at position 32 is Asp, Phe, Ser,
Ala, Gln, Glu, His, Val or Thr; Xaa at position 36 is Glu, Asn, Ser
or Asp; Xaa at position 37 is Asn, Arg, Pro, Thr, or His; Xaa at
position 41 is Arg, Leu, or Gly; Xaa at position 42 is Pro, Gly,
Ser, Ala, Asn, Val, Leu or Gln; Xaa at position 48 is Asn, Pro, or
Thr; Xaa at position 50 is Ala or Asn; Xaa at position 51 is Val or
Thr; Xaa at position 53 is Ser or Phe; Xaa at position 54 is Leu or
Phe; Xaa at position 55 is Gln, Ala, Glu, or Arg; Xaa at position
62 is Ser, Val, Asn, Pro, or Gly; Xaa at position 63 is Ile or Leu;
Xaa at position 65 is Lys, Asn, Met, Arg, Ile, or Gly; Xaa at
position 66 is Asn, Gly, Glu, or Arg; Xaa at position 68 is Leu,
Gln, Trp, Arg, Asp, Asn, Glu, His, Met, Phe, Ser, Thr, Tyr or Val;
Xaa at position 73 is Leu or Ser; Xaa at position 74 is Ala or Trp;
Xaa at position 77 is Ala or Pro; Xaa at position 79 is Thr, Asp,
or Ala; Xaa at position 81 is His, Pro, Arg, Val, Gly, Asn, Ser or
Thr; Xaa at position 84 is His, Ile, Asn, Ala, Thr, Arg, Gln, Glu,
Lys, Met, Ser, Tyr, Val or Leu; Xaa at position 85 is Ile or Leu;
Xaa at position 86 is Lys or Arg; Xaa at position 87 is Asp, Pro,
Met, Lys, His, Pro, Asn, Ile, Leu or Tyr; Xaa at position 91 is
Asn, Pro, Ser, Ile or Asp; Xaa at position 94 is Arg, Ala, or Ser;
Xaa at position 95 is Arg, Thr, Glu, Leu, or Ser; Xaa at position
98 is Thr or Gln; Xaa at position 102 is Lys, Val, Trp, or Ile; Xaa
at position 103 is Thr, Ala, His, Phe, Tyr or Ser; Xaa at position
106 is Asn, Pro, Leu, His, Val, or Gln; Xaa at position 107 is Ala,
Ser, Ile, Pro, or Asp; Xaa at position 108 is Gln, Met, Trp, Phe,
Pro, His, Ile, or Tyr; Xaa at position 109 is Ala, Met, Glu, Ser,
or Leu;
[0094] and which can additionally have Met- or Met-Ala- preceding
the amino acid in position 1; and wherein from 4 to 26 of the amino
acids designated by Xaa are different from the corresponding amino
acids of native (1-133)human interleukin-3.
[0095] 8. The composition of 7, wherein said human interleukin-3
mutant polypeptide is of the Formula:
8 Xaa at position 17 is Ser, Lys, Asp, Met, Gin, or Arg; Xaa at
position 18 is Asn, His, Leu, lie, Phe, Arg, or \ Gln; Xaa at
position 19 is Met, Arg, Gly, Ala, or Cys; Xaa at position 20 is
lie, Cys, Gln, Glu, Arg, Pro, or Ala; Xaa at position 21 is Asp,
Phe, Lys, Arg, Ala, Gly, or Val; Xaa at position 22 is Glu, Trp,
Pro, Ser, Ala, His, or Gly; Xaa at position 23 is Ile, Ala, Gly,
Trp, Lys, Leu, Ser, or Arg; Xaa at position 24 is Ile, Gly, Arg, or
Ser; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Ala, or Trp; Xaa at
position 27 is Leu, Gly, Arg, Thr, Ser, or Ala; Xaa at position 28
is Lys, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln,
Asn, Pro, Arg, or Val; Xaa at position 30 is Pro, His, Thr, Gly,
Asp, Gln, Ser, Leu, or Lys; Xaa at position 31 is Pro, Asp, Gly,
Arg, Leu, or Gln; Xaa at position 32 is Leu, Arg, Gln, Asn, Gly,
Ala, or Glu; Xaa at position 33 is Pro, Leu, Gln, Thr, or Glu; Xaa
at position 34 is Leu, Gly, Ser, or Lys; Xaa at position 35 is Leu,
Ala, Gly, Asn, Pro, or Gln; Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, or Pro; Xaa at position 38 is Asn,
or Ala; Xaa at position 40 is Leu, Trp, or Arg; Xaa at position 41
is Asn, Cys, Arg, Leu, His, Met, Pro; Xaa at position 42 is Gly,
Asp, Ser, Cys, or Ala; Xaa at position 42 is Glu, Asn, Tyr, Leu,
Phe, Asp, Ala, Cys, or Ser; Xaa at position 44 is Asp, Ser, Leu,
Arg, Lys, Thr, Met, Trp, or Pro; Xaa at position 45 is Gln, Pro,
Phe, Val, Met, Leu, Thr, Lys, or Trp; Xaa at position 46 is Asp,
Phe, Ser, Thr, Cys, or Gly; Xaa at position 47 is Ile, Gly, Ser,
Arg, Pro, or His; Xaa at position 48 is Leu, Ser, Cys, Arg, His,
Phe, or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn,
His, or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, or Tyr; Xaa
at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His; Xaa at
position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at
position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or; Xaa at
position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, or Leu; Xaa at
position 55 is Arg, Thr, Val, Ser, Leu, or Gly; Xaa at position 56
is Pro, dy, Cys, Ser, Gln, or Lys; Xaa at position 57 is Asn or
Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa at
position 60 is Ala, Ser, Tyr, Asn, or Thr; Xaa at position 61 is
Phe, Asn, Glu, Pro, Lys, Arg, or Ser; Xaa at position 62 is Asn
His, Val, Arg, Pro, Thr, or Ile; Xaa at position 63 is Arg, Tyr,
Trp, Ser, Pro, or Val; Xaa at position 64 is Ala, Asn, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser; Xaa at
position 66 is Lys, Ile, Val, Asn, Glu, or Ser; Xaa at position 67
is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His; Xaa at position
68 is Leu, Val, Trp, Ser, Thr, or His; Xaa at position 69 is Gln,
Ala, Pro, Thr, Arg, Trp, Gly, or Leu; Xaa at position 70 is Asn,
Leu, Val, Trp, Pro, or Ala; Xaa at position 71 is Ala, Met, Leu,
Arg, Glu, Thr, Gln, Trp, or Asn; Xaa at position 72 is Ser, Glu,
Met, Ala, His, Asn, Arg, or Asp; Xaa at position 73 is Ala, Glu,
Asp, Leu, Ser, Gly, Thr, or Arg; Xaa at position 74 is Ile, Thr,
Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro,
Trp, Arg, Ser, or Leu; Xaa at position 76 is Ser, Val, Ala, Asn,
Trp, Glu, Pro, Gly, or Asp; Xaa at position 77 is Ile, Ser, Arg, or
Thr; Xaa at position 78 is Leu, Ala, Ser, Glu, Gly, or Arg; Xaa at
position 79 is Lys, Thr, Gly, Asn, Met, Ile, or Asp; Xaa at
position 80 is Asn, Trp, Val, Gly, Thr, Leu, or Arg; Xaa at
position 81 is Leu, Gln, Gly, Ala, Trp, Arg, or Lys; Xaa at
position 82 is Leu, Gln, Lys, Trp, Arg, or Asp; Xaa at position 83
is Pro, Thr, Trp, Arg, or Met; Xaa at position 84 is Cys, Glu, Gly,
Arg, Met, or Val; Xaa at position 85 is Leu, Asn, or Gln; Xaa at
position 86 is Pro, Cys, Arg, Ala, or Lys; Xaa at position 87 is
Leu, Ser, Trp, or Gly; Xaa at position 88 is Ala, Lys, Arg, Val, or
Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, or
Asn; Xaa at position 90 is Ala, Ser, Asp, Ile, or Met; Xaa at
position 91 is Ala, Ser, Thr, Phe, Leu, Asp, or His; Xaa at
position 92 is Pro, Phe, Arg, Ser, Lys, His, or Leu; Xaa at
position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg; Xaa at
position 94 is Arg, Ile, Ser, Glu, Leu, Val, or Pro; Xaa at
position 95 is His, Gln, Pro, Val, Leu, Thr or Tyr; Xaa at position
96 is Pro, Lys, Tyr, Gly, Ile, or Thr; Xaa at position 97 is Ile,
Lys, Ala, or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp,
Ala, Thr, or Pro; Xaa at position 99 is Ile, Arg, Asp, Pro, Gln,
Gly, Phe, or His; Xaa at position 100 is Lys, Tyr, Leu, His, Ile,
Ser, Gln, or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His,
Thr, Val, Tyr, or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys,
Ser, Tyr, or Pro; Xaa at position 103 is Asp, or Ser; Xaa at
position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys,
Ala, Phe, or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser,
Trp, Gln, Tyr, Leu, Lys, Ile, or His; Xaa at position 106 is Glu,
Ser, Ala, Lys, Thr, Ile, Gly, or Pro; Xaa at position 108 is Arg,
Asp, Leu, Thr, Ile, or Pro; Xaa at position 109 is Arg, Thr, Pro,
Glu, Tyr, Leu, Ser, or Gly.
[0096] 9. A composition of 8, wherein said human interleukin-3
mutant polypeptide is of the Formula:
9 1 5 10 [SEQ ID NO:7] (Met).sub.m--Ala Pro Met Thr Gln Thr Thr Ser
Leu Lys Thr 15 20 Ser Trp Val Asn Cys Ser Xaa Xaa Xaa Asp Glu Ile
Ile 25 30 35 Xaa His Leu Lys Xaa Pro Pro Xaa Pro Xaa Leu Asp Xaa 40
45 50 Xaa Asn Leu Asn Xaa Glu Asp Xaa Asp Ile Leu Xaa Glu 55 60 Xaa
Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe Xaa Xaa 65 70 75 Ala Xaa
Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu Xaa 80 85 Ile Leu Xaa Asn
Leu Xaa Pro Cys Xaa Pro Xaa Xaa Thr 90 95 100 Ala Xaa Pro Xaa Arg
Xaa Pro Ile Xaa Ile Xaa Xaa Gly 105 110 115 Asp Trp Xaa Glu Phe Arg
Xaa Lys Leu Xaa Phe Tyr Leu 120 125 Xaa Xaa Leu Glu Xaa Ala Gln Xaa
Gln Gln Thr Thr Leu 130 Ser Leu Ala Ile Phe wherein m is 0 or 1;
Xaa at position 18 is Asn or Ile; Xaa at position 19 is Met, Ala or
Ile; Xaa at position 20 is Ile, Pro or Ile; Xaa at position 23 is
Ile, Ala or Leu; Xaa at position 25 is Thr or His; Xaa at position
29 is Gln, Arg, Val or Ile; Xaa at position 32 is Leu, Ala, Asn or
Arg; Xaa at position 34 is Leu or Ser; Xaa at position 37 is Phe,
Pro, or Ser; Xaa at position 38 is Asn or Ala; Xaa at position 42
is Gly, Ala, Ser, Asp or Asn; Xaa at position 45 is Gln, Val, or
Met; Xaa at position 46 is Asp or Ser; Xaa at position 49 is Met,
Ile, Leu or Asp; Xaa at position 50 is Glu or Asp; Xaa at position
51 is Asn Arg or Ser; Xaa at position 55 is Arg, Leu, or Thr; Xaa
at position 56 is Pro or Ser; Xaa at position 59 is Glu or Leu; Xaa
at position 60 is Ala or Ser; Xaa at position 62 is Asn, Val or
Pro; Xaa at position 63 is Arg or His; Xaa at position 65 is Val or
Ser; Xaa at position 67 is Ser, Asn, His or Gln; Xaa at position 69
is Gln or Glu; Xaa at position 73 is Ala or Gly; Xaa at position 76
is Ser, Ala or Pro; Xaa at position 79 is Lys, Arg or Ser; Xaa at
position 82 is Leu, Glu, Val or Trp; Xaa at position 85 is Leu or
Val; Xaa at position 87 is Leu, Ser, Tyr; Xaa at position 88 is Ala
or Trp; Xaa at position 91 is Ala or Pro; Xaa at position 93 is Pro
or Ser; Xaa at position 95 is His or Thr; Xaa at position 98 is
His, Ile, or Thr; Xaa at position 100 is Lys or Arg; Xaa at
position 101 is Asp, Ala or Met; Xaa at position 105 is Asn or Glu;
Xaa at position 109 is Arg, Glu or Leu; Xaa at position 112 is Thr
or Gln; Xaa at position 116 is Lys, Val, Trp or Ser; Xaa at
position 117 is Thr or Ser; Xaa at position 120 is Asn, Gln, or
His; Xaa at position 123 is Ala or Glu; with the proviso that from
four to forty-four of the amino acids designated by Xaa are
different from the corresponding amino acids of native human
interleukin-3.
[0097] 10. The composition of 9, wherein said human interleukin-3
mutant polypeptide is of the Formula:
10 1 5 10 [SEQ ID NO:8] (Met.sub.m--Ala.sub.n).sub.p--Asn Cys Ser
Xaa Xaa Xaa Asp Glu Xaa Ile 15 20 Xaa His Leu Lys Xaa Pro Pro Xaa
Pro Xaa Leu Asp Xaa 25 30 35 Xaa Asn Leu Asn Xaa Glu Asp Xaa Xaa
Ile Leu Xaa Glu 40 45 Xaa Asn Leu Arg Xaa Xaa Asn Leu Xaa Xaa Phe
Xaa Xaa 50 55 60 Ala Xaa Lys Xaa Leu Xaa Asn Ala Ser Xaa Ile Glu
Xaa 65 70 75 Ile Leu Xaa Asn Xaa Xaa Pro Cys Xaa Pro Xaa Ala Thr 80
85 Ala Xaa Pro Xaa Arg Xaa Pro Ile Xaa Ile Xaa Xaa Gly 90 95 100
Asp Trp Xaa Glu Phe Arg Xaa Lys Leu Xaa Phe Tyr Leu 105 110 Xaa Xaa
Leu Glu Xaa Ala Gln Xaa Gln Gln wherein m is 0 or 1; n is 0 or 1; p
is 0 or 1; Xaa at position 4 is Asn or Ile; Xaa at position 5 is
Met, Ala or Ile: Xaa at position 6 is Ile, Pro or Leu; Xaa at
position 9 is Ile, Ala or Leu; Xaa at position 11 is Thr or His;
Xaa at position 15 is Gln, Arg, Val or Ile; Xaa at position 18 is
Leu, Ala, Asn or Arg; Xaa at position 20 is Leu or Ser; Xaa at
position 23 is Phe, Pro, or Ser; Xaa at position 24 is Asn or Ala;
Xaa at position 28 is Gly, Ala, Ser, Asp or Asn; Xaa at position 31
is Gln, Val, or Met; Xaa at position 32 is Asp or Ser; Xaa at
position 35 is Met, Ile or Asp; Xaa at position 36 is Glu or Asp;
Xaa at position 37 is Asn, Arg or Ser; Xaa at position 41 is Arg,
Leu, or Thr; Xaa at position 42 is Pro or Ser; Xaa at position 45
is Glu or Leu; Xaa at position 46 is Ala or Ser; Xaa at position 48
is Asn, Val or Pro; Xaa at position 49 is Arg or His; Xaa at
position 51 is Val or Ser; Xaa at position 53 is Ser, Asn, His or
Gln; Xaa at position 55 is Gln or Glu; Xaa at position 59 is Ala or
Gly; Xaa at position 62 is Ser, Ala or Pro; Xaa at position 65 is
Lys, Arg or Ser; Xaa at position 67 is Leu, Glu, or Val; Xaa at
position 68 is Leu, Glu, Val or Trp; Xaa at position 71 is Leu or
Val; Xaa at position 73 is Leu, Ser or Tyr; Xaa at position 74 is
Ala or Trp; Xaa at position 77 is Ala or Pro; Xaa at position 79 is
Pro or Ser; Xaa at position 81 is His or Thr; Xaa at position 84 is
His, Ile, or Thr; Xaa at position 86 is Lys or Arg; Xaa at position
87 is Asp, Ala or Met; Xaa at position 91 is Asn or Glu; Xaa at
position 95 is Arg, Glu, Leu; Xaa at position 98 Thr or Gln; Xaa at
position 102 is Lys, Val, Trp or Ser; Xaa at position 103 is Thr or
Ser; Xaa at position 106 is Asn, Gln, or His; Xaa at position 109
is Ala or Glu; with the proviso that from four to forty-four of the
amino acids designated by Xaa are different from the corresponding
amino acids of native (15-125)human interleukin-3.
[0098] 11. The composition of 10, wherein said human interleukin-3
mutant polypeptide is of the Formula:
11 [SEQ ID NO:9] Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu
Asp Val Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala
Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile
Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg
His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu
Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ ID
NO:10] Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg
Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp
Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg
Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn
Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile
His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr
Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ ID NO:11] Asn Cys
Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro
Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu
Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser
Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys
Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp
Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu
Glu Asn Ala Gln Ala Gln Gln; [SEQ ID NO:12] Asn Cys Ser Asn Met Ile
Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala
Thr Ala Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn
Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln
Ala Gln Gln; [SEQ ID NO:13] Asn Cys Ser Asn Met Ile Asp Glu Ile Ile
Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn
Gly Glu Asp Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu
Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro
Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg
Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln;
[SEQ ID NO:14] Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu
Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp
Gln Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe
Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu
Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His
Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr
Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ ID NO:15]
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro
Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu
Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln
Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile
Lys Ala Gly Asp Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ ID NO:16] Asn Cys Ser Asn
Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu
Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn
Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn
Ala Gln Ala Gln Gln; [SEQ ID NO:17] Asn Cys Ser Asn Met Ile Asp Glu
Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn
Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro
Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala
Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; [SEQ ID NO:18] Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His
Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu
Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala
Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile
Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg
His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Glu Lys Leu
Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln; [SEQ ID
NO:19] Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln
Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp
Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg
Ala Val Lys Ser Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn
Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile
Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr
Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:20] Asn Cys
Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro
Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu
Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser
Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys
Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala
Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu
Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:21] Asn Cys Ser Asn Met Ile
Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln
Glu Gln Gln; [SEQ ID NO:22] Asn Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu
Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro
Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg
Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln;
[SEQ ID NO:23] Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp
Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe
Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu
Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His
Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr
Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ ID NO:24]
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro
Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu
Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val
Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu
Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro Ile His Ile
Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ ID NO:25] Met Ala Asn Cys
Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro
Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu
Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser
Leu Gln Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys
Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala
Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu
Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:26] Met Ala Asn Cys Ser Asn
Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu
Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn
Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln
Ala Gln Glu Gln Gln; [SEQ ID NO:27] Met Ala Asn Cys Ser Asn Met Ile
Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp Phe
Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu Met Glu Asn Asn Leu Arg
Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln
Glu Gln Gln; [SEQ ID NO:28] Met Ala Asn Cys Ser Ile Met Ile Asp Glu
Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro
Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala
Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala
Ala Pro Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe
Arg Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln
Gln; [SEQ ID NO:29] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu
Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Ala Ile Glu
Ser Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro
Thr Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg
Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln;
[SEQ ID NO:30] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser
Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu
Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Ala Ile Glu Ser
Ile Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr
Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys
Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln; [SEQ
ID NO:31] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu
Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser
Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile
Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg
His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu
Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln; [SEQ ID
NO:32] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu Asp
Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe
Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:33]
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val
Pro Pro Ala Pro Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp
Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg
Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn
Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile
Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr
Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:34] Met Ala
Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro
Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu
Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val
Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val
Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile
Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val
Thr Leu Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:35] Met Ala Asn Cys
Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro
Leu Leu Asp Ser Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu
Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn
Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys
Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala
Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu
Glu Gln Ala Gln Glu Gln Gln; [SEQ ID NO:36] Met Ala Asn Cys Ser Ile
Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu
Asp Pro Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn
Leu Arg Thr Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu
Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro
Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp
Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His
Ala Gln Glu Gln Gln; [SEQ ID NO:37] Met Ala Asn Cys Ser Ile Met Ile
Asp Glu Ile Ile His His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser
Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg
Leu Pro Asn Leu Leu Ala Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala
Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala
Thr Ala Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln
Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln
Glu Gln Gln; [SEQ ID NO:38] Met Ala Asn Cys Ser Ile Met Ile Asp Glu
Ile Ile His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn
Leu Asn Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro
Asn Leu Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly
Ile Glu Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala
Ala Pro Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe
Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln; [SEQ ID NO:39] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu
Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu
Ala Ile Leu Arg Asn Leu Val Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Thr Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Ser Leu Glu His Ala Gln Glu Gln Gln.
[SEQ ID NO:40] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala
Glu Asp Val Asp Ile Leu Met Asp Arg Asn Leu Arg Leu Ser Asn Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID
NO:41] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ala Ile His His Leu
Lys Arg Pro Pro Ala Pro Ser Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp
Met Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe
Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser
Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr
Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu
Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu
Gln Gln [SEQ ID NO:42] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile
Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu
Asn Asp Glu Asp Met Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn
Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile
Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala
Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg
Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln
[SEQ ID NO:43] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His
His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Ala
Glu Asp Val Asp Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu
Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala
Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser
Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys
Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID
NO:44] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu
Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp
Val Ser Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe
Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:45]
Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu Lys Arg
Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp Met Ser
Ile Leu Met Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg
Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn
Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile
Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr
Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln [SEQ ID NO:46] Met Ala
Tyr Pro Glu Thr Asp Tyr Lys Asp Asp Asp Asp Lys Asn Cys Ser Ile Met
Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp
Pro Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met Glu Arg Asn Leu
Arg Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn
Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser
Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp
Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala
Gln Glu Gln Gln [SEQ ID NO:47] Met Ala Tyr Pro Glu Thr Asp Tyr Lys
Asp Asp Asp Asp Lys Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His
Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn Ser Glu
Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala
Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile
Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg
His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu
Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln and [SEQ ID
NO:48] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Leu Ile His His Leu
Lys Ile Pro Pro Asn Pro Ser Leu Asp Ser Ala Asn Leu Asn Ser Glu Asp
Val Ser Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe
Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu Ala Ile Leu
Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His
Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr
Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln.
[0099] 12. The composition of claim 11, wherein said human
interleukin-3 mutant polypeptide is of the Formula:
12 [SEQ ID NO:32] Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile
His His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro Asn Asn Leu Asn
Ser Glu Asp Met Asp Ile Leu Met Glu Arg Asn Leu Arg Thr Pro Asn Leu
Leu Ala Phe Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly Ile Glu
Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro
Ser Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu
Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln
Gln.
[0100] Also included in the present invention is a method of
increasing multi-lineage hematopoietic cell production in a mammal
in need thereof comprising administering a pharmaceutically
effective amount of a human interleukin-3 mutant polypeptide as
disclosed above with CSF preferably G-CSF or GM-CSF more preferably
G-CSF simultaneously as a composition or one after the other.
[0101] Materials and Methods for IL-3 Variant Expression in E.
coli
[0102] Unless noted otherwise, all specialty chemicals were
obtained from Sigma Co., (St. Louis, Mo.). Restriction
endonucleases, T4 poly-nucleotides kinase, E. coli DNA polymerase I
large fragment (Klenow) and T4 DNA ligase were obtained from New
England Biolabs (Beverly, Mass.).
[0103] Escherichia coli strains
[0104] Strain JM101: delta (pro lac), supE, thi, F' (traD36, rpoAB,
lacI-Q, lacZdeltaM15) (Messing, 1979). This strain can be obtained
from the American Type Culture Collection (ATCC), 12301 Parklawn
Drive, Rockville, Md. 20852, accession number 33876. MON105 (W3110
rpoH358) is a derivative of W3110 (Bachmann, 1972) and has been
assigned ATCC accession number 55204. Strain GM48: dam-3, dcm-6,
gal, ara, lac, thr, leu, tonA, tsx (Marinus, 1973) was used to make
plasmid DNA that is not methylated at the sequence GATC.
[0105] Genes and Plasmids
[0106] The gene used for hIL-3 production in E. coli was obtained
from British Biotechnology Incorporated, Cambridge, England,
catalogue number BBG14. This gene is carried on a pUC based plasmid
designated pP0518. Many other human CSF genes can be obtained from
R&D Systems, Inc. (Minn, Minn.) including IL-1 alpha, IL-1
beta, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, G-CSF, GM-CSF and
LIF.
[0107] The plasmids used for production of hIL-3 in E. coli contain
genetic elements whose use has been described (Olins et al., 1988;
Olins and Rangwala, 1990). The replicon used is that of pBR327
(Covarrubias, et al., 1981) which is maintained at a copy number of
about 100 in the cell (Soberon et al., 1980). A gene encoding the
beta-lactamase protein is present on the plasmids. This protein
confers ampicillin resistance on the cell. This resistance serves
as a selectable phenotype for the presence of the plasmid in the
cell.
[0108] For cytoplasmic expression vectors the transcription
promoter is derived from the recA gene of E. coli (Sancar et al.,
1980). This promoter, designated precA, includes the RNA polymerase
binding site and the lexA repressor binding site (the operator).
This segment of DNA provides high level transcription that is
regulated even when the recA promoter is on a plasmid with the
pBR327 origin of replication (Olins et al., 1988) incorporated
herein by reference.
[0109] The ribosome binding site used is that from gene 10 of phage
T7 (Olins et al., 1988). This is encoded in a 100 base pair (bp)
fragment placed adjacent to precA. In the plasmids used herein, the
recognition sequence for the enzyme NcoI (CCATGG) follows the
g10-L. It is at this NcoI site that the hIL-3 genes were joined to
the plasmid. It is expected that the nucleotide sequence at this
junction will be recognized in mRNA as a functional start site for
translation (Olins et al., 1988). The hIL-3 genes used were
engineered to have a HindIII recognition site (AAGCTT) downstream
from the coding sequence of the gene. At this HindIII site is a 514
base pair RsaI fragment containing the origin of replication of the
single stranded phage f1 (Dente et al., 1983; Olins, et al., 1990)
both incorporated herein by reference. A plasmid containing these
elements is pMON2341. Another plasmid containing these elements is
pMON5847 which has been deposited at the American Type Culture
Collection, 12301 Parklawn Drive, Rockville, Md. 20852 under the
accession number ATCC 68912.
[0110] In secretion expression plasmids the transcription promoter
is derived from the ara B, A, and D genes of E. coli (Greenfield et
al., 1978). This promoter is designated pAraBAD and is contained on
a 323 base pair SacII, BglII restriction fragment. The LamB
secretion leader (Wong et al., 1988, Clement et al., 1981) is fused
to the N-terminus of the hIL-3 gene at the recognition sequence for
the enzyme NcoI (5'CCATGG3'). The hIL-3 genes used were engineered
to have a HindIII recognition site (5'AAGCTT3') following the
coding sequence of the gene.
Recombinant DNA Methods
[0111] Synthetic Gene Assembly
[0112] The hIL-3 variant genes and other CSF genes can be
constructed by the assembly of synthetic oligonucleotides.
Synthetic oligonucleotides were designed so that they would anneal
in complementary pairs, with protruding single stranded ends, and
when the pairs were properly assembled would result in a DNA
sequence that encoded a portion of the desired gene. Amino acid
substitutions in the hIL-3 gene were made by designing the
oligonucleotides to encode the desired substitutions. The
complementary oligonucleotides were annealed at concentration of 1
picomole per microliter in ligation buffer plus 50 mM NaCl. The
samples were heated in a 100 ml beaker of boiling water and
permitted to cool slowly to room temperature. One picomole of each
of the annealed pairs of oligonucleotides were ligated with
approximately 0.2 picomoles of plasmid DNA, digested with the
appropriate restriction enzymes, in ligation buffer (25 mM Tris pH
8.0, 10 mM MgCl.sub.2, 10 mM dithiothreitol, 1 mM ATP, 2 mM
spermidine) with T4 DNA ligase obtained from New England Biolabs
(Beverly, Mass.) in a total volume of 20 .mu.l at room temperature
overnight.
[0113] Polymerase Chain Reaction
[0114] Polymerase Chain Reaction (hereafter referred to as PCR)
techniques (Saiki, 1985) used the reagent kit and thermal cycler
from Perkin-Elmer Cetus (Norwalk, Conn.). PCR is based on a
thermostable DNA polymerase from Thermus aquaticus. The PCR
technique is a DNA amplification method that mimics the natural DNA
replication process in that the number of DNA molecules doubles
after each cycle, in a way similar to in vivo replication. The DNA
polymerase mediated extension is in a 5' to 3' direction. The term
"primer" as used herein refers to an oligonucleotide sequence that
provides an end to which the DNA polymerase can add nucleotides
that were complementary to a nucleotide sequence. The latter
nucleotide sequence is referred to as the "template", to which the
primers were annealed. The amplified PCR product is defined as the
region comprised between the 5' ends of the extension primers.
Since the primers have defined sequences, the product will have
discrete ends, corresponding to the primer sequences. The primer
extension reaction is carried out using 20 picomoles (pmoles) of
each of the oligonucleotides and 1 picogram of template plasmid DNA
for 35 cycles (1 cycle is defined as 94 degrees C. for one minute,
50 degrees C. for two minutes and 72 degrees for three minutes.).
The reaction mixture was extracted with an equal volume of
phenol/chloroform (50% phenol and 50% chloroform, volume to volume)
to remove proteins. The aqueous phase, containing the amplified
DNA, and solvent phase were separated by centrifugation for 5
minutes in a microcentrifuge (Model 5414 Eppendorf Inc, Fremont
CA.). To precipitate the amplified DNA the aqueous phase was
removed and transferred to a fresh tube to which was added 1/10
volume of 3M NaOAc (pH 5.2) and 2.5 volumes of ethanol (100% stored
at minus 20 degrees C.). The solution was mixed and placed on dry
ice for 20 minutes. The DNA was pelleted by centrifugation for 10
minutes in a microcentrifuge and the solution was removed from the
pellet. The DNA pellet was washed with 70% ethanol, ethanol removed
and dried in a speedvac concentrator (Savant, Farmingdale, N.Y.).
The pellet was resuspended in 25 microliters of TE (20 mM Tris-HCl
pH 7.9, 1 mM EDTA). Alternatively the DNA was precipitated by
adding equal volume of 4M NH.sub.4OAc and one volume of isopropanol
[Treco et al., (1988)]. The solution was mixed and incubated at
room temperature for 10 minutes and centrifuged. These conditions
selectively precipitate DNA fragments larger than .about.20 bases
and were used to remove oligonucleotide primers. One quarter of the
reaction was digested with restriction enzymes [Higuchi, (1989)] an
on completion heated to 70 degrees C. to inactivate the
enzymes.
[0115] Recovery of Recombinant Plasmids from Ligation Mixes
[0116] E. coli JM101 cells were made competent to take up DNA.
Typically, 20 to 100 ml of cells were grown in LB medium to a
density of approximately 150 Klett units and then collected by
centrifugation. The cells were resuspended in one half culture
volume of 50 mM CaCl.sub.2 and held at 4.degree. C. for one hour.
The cells were again collected by centrifugation and resuspended in
one tenth culture volume of 50 mM CaCl.sub.2. DNA was added to a
150 microliter volume of these cells, and the samples were held at
4.degree. C. for 30 minutes. The samples were shifted to 42.degree.
C. for one minute, one milliliter of LB was added, and the samples
were shaken at 37.degree. C. for one hour. Cells from these samples
were spread on plates containing ampicillin to select for
transformants. The plates were incubated overnight at 37.degree. C.
Single colonies were picked, grown in LB supplemented with
ampicillin overnight at 37.degree. C. with shaking. From these
cultures DNA was isolated for restriction analysis.
[0117] Culture Medium
[0118] LB medium (Maniatis et al., 1982) was used for growth of
cells for DNA isolation. M9 minimal medium supplemented with 1.0%
casamino acids, acid hydrolyzed casein, Difco (Detroit, Mich.) was
used for cultures in which recombinant IL-3 variant was produced.
The ingredients in the M9 medium were as follows: 3 g/liter
KH.sub.2PO.sub.4, 6 g/l Na.sub.2HPO.sub.4, 0.5 g/l NaCl, 1 g/l
NH.sub.4Cl, 1.2 mM MgSO.sub.4, 0.025 mM CaCl.sub.2, 0.2% glucose
(0.2% glycerol with the AraBAD promoter), 1% casamino acids, 0.1
ml/l trace minerals (per liter 108 g FeCl.sub.3.6H.sub.2O, 4.0 g
ZnSO.sub.4.7H.sub.2O, 7.0 CoCl.sub.2.2H.sub.2O, 7.0 g
Na.sub.2MoO.sub.4.2H.sub.2O, 8.0 g CuSO.sub.4.5H.sub.2O, 2.0 g
H.sub.3BO.sub.3, 5.0 g MnSO.sub.4.H.sub.2O, 100 ml concentrated
HCl). Bacto agar was used for solid media and ampicillin was added
to both liquid and solid LB media at 200 micrograms per
milliliter.
[0119] Production of IL-3 Variants in E. coli with Vectors
Employing the recA Promoter
[0120] E. coli strains harboring the plasmids of interest were
grown at 37.degree. C. in M9 plus casamino acids medium with
shaking in a Gyrotory water bath Model G76 from New Brunswick
Scientific (Edison, N.J.). Growth was monitored with a Klett
Summerson meter (green 54 filter), Klett Mfg. Co. (New York, N.Y.).
At a Klett value of approximately 150, an aliquot of the culture
(usually one milliliter) was removed for protein analysis. To the
remaining culture, nalidixic acid (10 mg/ml) in 0.1 N NaOH was
added to a final concentration of 50 .mu.g/ml. The cultures were
shaken at 37.degree. C. for three to four hours after addition of
nalidixic acid. A high degree of aeration was maintained throughout
the bacterial growth in order to achieve maximal production of the
desired gene product. The cells were examined under a light
microscope for the presence of refractile bodies (RBs). One
milliliter aliquots of the culture were removed for analysis of
protein content.
[0121] Extraction, Refolding and Purification of IL-3 Variant
Proteins Expressed as Refractile bodies in E. coli
[0122] Extraction of refractile bodies (RB's):
[0123] For each gram of RB's (and typically one gram is obtained
from a 300 ml E. coli culture), 5 ml of a solution containing 6M
guanidine hydrochloride (GnHCl), 50 mM
2-N-cyclohexylaminoethanesulfonic acid (CHES) pH 9.5 and 20 mM
dithiothreitol (DTT) was added. The RB's were extracted with a
Bio-Homogenizer for 15-30 seconds and gently rocked for 2 hours at
5 degrees centigrade (5.degree. C.) to allow the protein to
completely reduce and denature.
[0124] Refolding of the IL-3 muteins
[0125] The protein solution was transferred to dialysis tubing
(1000 molecular weight cut-off) and dialyzed against at least 100
volumes of 4M GnHCl--50 mM CHES pH 8.0. The dialysis was continued
overnight at 5.degree. C. while gently stirring. Subsequently
dialysis was continued against at least 100 volumes of 2M GnHCl--50
mM CHES pH 8.0 and dialyzed overnight at 5.degree. C. while gently
stirring.
[0126] Purification of the IL-3 Muteins
[0127] The protein solution was removed from the dialysis tubing
and acidified by the addition of 40% acetonitrile
(CH.sub.3CN)--0.2% trifluoroacetic acid (TFA) to a final
concentration of 20% CH.sub.3CN--0.1% TFA. This was centrifuged
(16,000.times.g for 5 minutes) to clarify and the supernatant was
loaded onto a Vydac C-18 reversed phase column (10.times.250 mm)
available from Vydac (Hesperia, Calif.) previously equilibrated in
20% CH.sub.3CN--0.1% TFA. The column was eluted with a linear
gradient (0.2% CH.sub.3CN/minute) between 40-50% CH.sub.3CN--0.1%
TFA at a flow rate of 3 ml/minute while collecting 1.5 ml
fractions. The fractions were analyzed by polyacrylamide gel
electrophoresis (SDS-PAGE) and the appropriate fractions pooled.
The pooled material was dried by lyophilization or in a Speed Vac
concentrator. The dry powder was reconstituted with 10 mM ammonium
bicarbonate pH 7.5, centrifuged (16,000.times.g for 5 minutes) to
clarify and assayed for protein concentration by the method of
Bradford (1976) with bovine serum albumin as the standard. Such
protein can be further analyzed by additional techniques such as,
SDS-PAGE, electrospray mass spectrometry, reverse phase HPLC,
capillary zone electrophoresis, amino acid composition analysis,
and ELISA (enzyme-linked immunosorbent assay).
[0128] hIL-3 SANDWICH ELISA
[0129] The IL-3 variant protein concentrations can be determined
using a sandwich ELISA based on an affinity purified polyclonal
goat anti-rhIL-3. Microtiter plates (Dynatech Immulon II) were
coated with 150 .mu.l goat-anti-rhIL-3 at a concentration of
approximately 1 .mu.g/ml in 100 mM NaHCO3, pH 8.2. Plates were
incubated overnight at room temperature in a chamber maintaining
100% humidity. Wells were emptied and the remaining reactive sites
on the plate were blocked with 200 .mu.l of solution containing 10
mM PBS, 3% BSA and 0.05% Tween 20, pH 7.4 for 1 hour at 37.degree.
C. and 100% humidity. Wells were emptied and washed 4.times. with
150 mM NaCl containing 0.05% Tween 20 (wash buffer). Each well then
receives 150 .mu.l of dilution buffer (10 mM PBS containing 0.1%
BSA, 0.01% Tween 20, pH 7.4), containing rhIL-3 standard, control,
sample or dilution buffer alone. A standard curve was prepared with
concentrations ranging from 0.125 ng/ml to 5 ng/ml using a stock
solution of rhIL-3 (concentration determined by amino acid
composition analysis). Plates were incubated 2.5 hours at
37.degree. C. and 100% humidity. Wells were emptied and each plate
was washed 4.times. with wash buffer. Each well then received 150
.mu.l of an optimal dilution (as determined in a checkerboard assay
format) of goat anti-rhIL-3 conjugated to horseradish peroxidase.
Plates were incubated 1.5 hours at 37.degree. C. and 100% humidity.
Wells were emptied and each plate was washed 4.times. with wash
buffer. Each well then received 150 .mu.l of ABTS substrate
solution (Kirkegaard and Perry). Plates were incubated at room
temperature until the color of the standard wells containing 5
ng/ml rhIL-3 had developed enough to yield an absorbance between
0.5-1.0 when read at a test wavelength of 410 nm and a reference
wavelength of 570 nm on a Dynatech microtiter plate reader.
Concentrations of immunoreactive rhIL-3 in unknown samples were
calculated from the standard curve using software supplied with the
plate reader.
[0130] The following examples will illustrate the invention in
greater detail although it will be understood that the invention is
not limited to these specific examples.
EXAMPLE 1
Isolation of 1-332 and 1-153 Amino Acid Forms of Meg-CSF
[0131] A. Reverse transcriptase reaction Meg-CSF (more recently
known as c-mpl ligand) sequence based on Genbank accession
#L33410). Human fetal liver A+ RNA was obtained from Clontech (Palo
Alto, Calif.). The first strand cDNA reactions were carried out
using a cDNA Cycle.TM. Kit obtained from Invitrogen (San Diego,
Calif.).
[0132] B. Polymerase chain reactions
[0133] Following the reverse transcriptase (RT) reaction, the 1-332
c-mpl ligand was amplified via PCR using the oligonucleotide
primers c-mplBglII [SEQ ID NO:50] and c-mplEcoRI [SEQ ID NO:51].
Following the RT reaction, the 1-153 c-mpl ligand was amplified
using the oligonucleotide primers c-mplNcoI [SEQ ID NO:52] and
c-mplHindIII [SEQ ID NO:53].
EXAMPLE 2
BHK Expression Vector for Full Length c-mpl Ligand
[0134] The full length c-mpl ligand PCR product is digested with
BglII and EcoRI restriction enzymes for transfer to a mammalian
expression vector. The expression vector, pMON3976, is digested
with BamHI and EcoRI, which allows it to accept the BglII-EcoRI PCR
fragments. pMON3976 is a derivative of pMON3359 which is a
pUC18-based vector containing a mammalian expression cassette. The
cassette, which includes a herpes simplex viral promoter IE110
(-800 to +120) and a SV40 late poly-adenylation (poly-A) signal,
was subcloned into the pUC18 polylinker [Hippenmeyer et al.,
(1993)]. The original EcoRI site 5' to the promoter was removed and
a new EcoRI site added 3' to the BamHI site. These unique
restriction enzyme sites are located between the promoter and
poly-A signal to facilitate subcloning DNA fragments as BamHI-EcoRI
or BglII-EcoRI fragments in a 5' to 3' direction for transcription
and translation. The resulting plasmid encodes the polypeptide with
the following amino acid sequence:
13 Met Glu Leu Thr Glu Leu Leu Leu Val Val Met Leu Leu Leu [SEQ ID
NO:55] Thr Ala Arg Leu Thr Leu Ser Ser Pro Ala Pro Pro Ala Cys Asp
Leu Arg Val Leu Ser Lys Leu Leu Arg Asp Ser His Val Leu His Ser Arg
Leu Ser Gin Cys Pro Glu Val His Pro Leu Pro Thr Pro Val Leu Leu Pro
Ala Val Asp Phe Ser Leu Gly Glu Trp Lys Thr Gin Met Glu Glu Thr Lys
Ala Gin Asp lie Leu Gly Ala Val Thr Leu Leu Leu Glu Gly Val Met Ala
Ala Arg Gly Gin Leu Gly Pro Thr Cys Leu Ser Ser Leu Leu Gly Gin Leu
Ser Gly Gin Vai Arg Leu Leu Leu Giy Ala Leu Gin Ser Leu Leu Gly Thr
Gin Leu Pro Pro Gin Gly Arg Thr Thr Ala His Lys Asp Pro Asn Ala lie
Phe Leu Ser Phe Gin His Leu Leu Arg Gly Lys Val Arg Phe Leu Met Leu
Val Gly Gly Ser Thr Leu Cys Val Arg Arg Ala Pro Pro Thr Thr Ala Val
Pro Ser Arg Thr Ser Leu Val Leu Thr Leu Asn Glu Leu Pro Asn Arg Thr
Ser Gly Leu Leu Glu Thr Asn Phe Thr Ala Ser Ala Arg Thr Thr Gly Ser
Gly Leu Leu Lys Trp Gln Gln Gly Phe Arg Ala Lys Ile Pro Gly Leu Leu
Asn Gln Thr Ser Arg Ser Leu Asp Gln Ile Pro Gly Tyr Leu Asn Arg Ile
His Glu Leu Leu Asn Gly Thr Arg Gly Leu Phe Pro Gly Pro Ser Arg Arg
Thr Leu Gly Ala Pro Asp Ile Ser Ser Gly Thr Ser Asp Thr Gly Ser Leu
Pro Pro Asn Leu Gln Pro Gly Tyr Ser Pro Ser Pro Thr His Pro Pro Thr
Gly Gln Tyr Thr Leu Phe Pro Leu Pro Pro Thr Leu Pro Thr Pro Val Val
Gln Leu His Pro Leu Leu Pro Asp Pro Ser Ala Pro Thr Pro Thr Pro Thr
Ser Pro Leu Leu Asn Thr Ser Tyr Thr His Ser Gln Asn Leu Ser Gln Glu
Gly DNA sequence [SEQ ID NO:54] codes for the foregoing
polypeptide.
EXAMPLE 3
BHK Expression Vector for 1-153 c-mpl Ligand
[0135] The 1-153 c-mpl ligand gene product was digested with NcoI
and HindIII restriction enzymes for subcloning into pMON3934.
pMON3934, a mammalian expression vector, is also derived from
pMON3359, but it contains a modified human IL-3 signal peptide
sequence in addition to the IE110 promoter and poly-A signal. The
signal peptide sequence is flanked by BamHI and NcoI restriction
enzyme sites, which facilitates cloning and expression of genes as
NcoI-HindIII fragments. The HindIII site is 3' to the NcoI site.
The DNA sequence of the signal peptide is shown below (restriction
enzyme sites are indicated above). The ATG (methionine) codon
within the NcoI site is in-frame with the initiator ATG of the
signal peptide (underlined);
14 BamHI [SEQ ID NO:58] GGATCCACCATGAGCCGCCTGCCCGTCCTGCT-
CCTGCTCCAACTCCT [SEQ ID NO:59] MetSerArgLeuProValLeuLeuLe-
uLeuGlnLeuLeu NcoI GGTCCGCCCCGCCATCG ValArgProAlaMet
[0136] The resulting plasmid was designated pMON26448. The plasmid,
pMON26448, encodes the following amino acid sequence:
15 Met Glu Leu Thr Glu Leu Leu Leu Val Val Met Leu Leu Leu [SEQ ID
NO:56] Thr Ala Arg Leu Thr Leu Ser Ser Pro Ala Pro Pro Ala Cys Asp
Leu Arg Val Leu Ser Lys Leu Leu Arg Asp Ser His Val Leu His Ser Arg
Leu Ser Gin Cys Pro Glu Val His Pro Leu Pro Thr Pro Val Leu Leu Pro
Ala Val Asp Phe Ser Leu Gly Glu Trp Lys Thr Gln Met Glu Glu Thr Lys
Ala Gin Asp Ile Leu Gly Ala Val Thr Leu Leu Leu Glu Gly Val Met Ala
Ala Arg Gly Gin Leu Gly Pro Thr Cys Leu Ser Ser Leu Leu Gly Gin Leu
Ser Gly Gin Val Arg Leu Leu Leu Gly Ala Leu Gin Ser Leu Leu Gly Thr
Gln Leu Pro Pro Gin Gly Arg Thr Thr Ala His Lys Asp Pro Asn Ala lie
Phe Leu Ser Phe Gln His Leu Leu Arg Gly Lys Val Arg Phe Leu Met Leu
Val Gly Gly Ser Thr Leu Cys Val Arg DNA sequence [SEQ ID NO:54]
codes the foregoing amino acid sequence.
[0137] For secreted 1-153 c-mpl ligand, the N-terminal sequence
should be SerProAla . . . , like that described elsewhere [de
Sauvage et al., (1994)]. For the 1-332 c-mpl ligand, which contains
its own secretion signal, it also should be cleaved to leave
SerProAla . . . on the N-terminus. Therefore, the numbering system
assumes that SerProAla . . . are the first three amino acids on
either protein.
AML Proliferation Assay for Bioactive Human Interleukin-3
[0138] The factor-dependent cell line AML 193 was obtained from the
American Type Culture Collection (ATCC, Rockville, Md.). This cell
line, established from a patient with acute myelogenous leukemia,
was a growth factor dependent cell line which displayed enhanced
growth in GM/CSF supplemented medium (Lange, B., et al., (1987);
Valtieri, M., et al., (1987). The ability of AML 193 cells to
proliferate in the presence of human IL-3 has also been documented.
(Santoli, D., et al., (1987)). A cell line variant was used, AML
193 1.3, which was adapted for long term growth in IL-3 by washing
out the growth factors and starving the cytokine dependent AML 193
cells for growth factors for 24 hours. The cells were then replated
at 1.times.10.sup.5 cells/well in a 24 well plate in media
containing 100 U/ml IL-3. It took approximately 2 months for the
cells to grow rapidly in IL-3. These cells were maintained as AML
193 1.3 thereafter by supplementing tissue culture medium (see
below) with human IL-3.
[0139] AML 193 1.3 cells were washed 6 times in cold Hanks balanced
salt solution (HBSS, Gibco, Grand Island, N.Y.) by centrifuging
cell suspensions at 250.times.g for 10 minutes followed by
decantation of supernatant. Pelleted cells were resuspended in HBSS
and the procedure was repeated until six wash cycles were
completed. Cells washed six times by this procedure were
resuspended in tissue culture medium at a density ranging from
2.times.10.sup.5 to 5.times.10.sup.5 viable cells/ml. This medium
was prepared by supplementing Iscove's modified Dulbecco's Medium
(IMDM, Hazelton, Lenexa, Kans.) with albumin, transferrin, lipids
and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim,
Indianapolis, Ind.) was added at 500 .mu.g/ml; human transferrin
(Boehringer-Mannheim, Indianapolis, Ind.) was added at 100
.mu.g/ml; soybean lipid (Boehringer-Mannheim, Indianapolis, Ind.)
was added at 50 .mu.g/ml; and 2-mercaptoethanol (Sigma, St. Louis,
Mo.) was added at 5.times.10.sup.-5 M.
[0140] Serial dilutions of human interleukin-3 or human
interleukin-3 variant protein (hIL-3 mutein) were made in
triplicate series in tissue culture medium supplemented as stated
above in 96 well Costar 3596 tissue culture plates. Each well
contained 50 .mu.l of medium containing interleukin-3 or
interleukin-3 variant protein once serial dilutions were completed.
Control wells contained tissue culture medium alone (negative
control). AML 193 1.3 cell suspensions prepared as above were added
to each well by pipetting 50 .mu.l (2.5.times.10.sup.4 cells) into
each well. Tissue culture plates were incubated at 37.degree. C.
with 5% CO.sub.2 in humidified air for 3 days. On day 3, 0.5 .mu.Ci
.sup.3H-thymidine (2 Ci/mM, New England Nuclear, Boston, Mass.) was
added in 50 .mu.l of tissue culture medium. Cultures were incubated
at 37.degree. C. with 5% CO.sub.2 in humidified air for 18-24
hours. Cellular DNA was harvested onto glass filter mats (Pharmacia
LKB, Gaithersburg, Md.) using a TOMTEC cell harvester (TOMTEC,
Orange, Conn.) which utilized a water wash cycle followed by a 70%
ethanol wash cycle. Filter mats were allowed to air dry and then
placed into sample bags to which scintillation fluid (Scintiverse
II, Fisher Scientific, St. Louis, Mo. or BetaPlate Scintillation
Fluid, Pharmacia LKB, Gaithersburg, Md.) was added. Beta emissions
of samples from individual tissue culture wells were counted in a
LKB Betaplate model 1205 scintillation counter (Pharmacia LKB,
Gaithersburg, Md.) and data was expressed as counts per minute of
.sup.3H-thymidine incorporated into cells from each tissue culture
well. Activity of each human interleukin-3 preparation or human
interleukin-3 variant preparation was quantitated by measuring cell
proliferation (.sup.3H-thymidine incorporation) induced by graded
concentrations of interleukin-3 or interleukin-3 variant.
Typically, concentration ranges from 0.05 pM-10.sup.5 pM were
quantitated in these assays. Activity was determined by measuring
the dose of interleukin-3 or interleukin-3 variant which provides
50% of maximal proliferation [EC.sub.50=0.5.times.(maximum average
counts per minute of .sup.3H-thymidine incorporated per well among
triplicate cultures of all concentrations of interleukin-3
tested--background proliferation measured by .sup.3H-thymidine
incorporation observed in triplicate cultures lacking
interleukin-3]. This EC.sub.50 value is also equivalent to 1 unit
of bioactivity. Every assay was performed with native interleukin-3
as a reference standard so that relative activity levels could be
assigned.
Methylcellulose Assay
[0141] This assay provides a reasonable approximation of the growth
activity of colony stimulating factors to stimulate normal bone
marrow cells to produce different types of hematopoietic colonies
in vitro (Bradley et al., 1966, Pluznik et al., 1965).
Methods
[0142] Approximately 30 ml of fresh, normal, healthy bone marrow
aspirate are obtained from individuals. Under sterile conditions
samples are diluted 1:5 with a 1.times. PBS (#14040.059 Life
Technologies, Gaithersburg, Md.) solution in a 50 ml conical tube
(#25339-50 Corning, Corning Md.). Ficoll (Histopaque-1077 Sigma
H-8889) is layered under the diluted sample and centrifuged,
300.times.g for 30 min. The mononuclear cell band is removed and
washed two times in 1.times. PBS and once with 1% BSA PBS (CellPro
Co., Bothel, Wash.). Mononuclear cells are counted and CD34+ cells
are selected using the Ceprate LC (CD34) Kit (CellPro Co., Bothel,
Wash.) column. This fractionation is performed since all stem and
progenitor cells within the bone marrow display CD34 surface
antigen. Alternatively whole bone marrow or peripheral blood may be
used.
[0143] Cultures are set up in triplicate wells with a final volume
of 0.1 ml in 48 well tissue culture plates (#3548 CoStar,
Cambridge, Mass.). Culture medium is purchased from Terry Fox Labs.
(HCC-4330 medium (Terry Fox Labs, Vancouver, B.C., Canada)).
600-1000 CD34+ cells are added per well. Native IL-3 and IL-3
variants are added to give final concentrations ranging from 0.001
nM-10 nM. G-CSF and GM-CSF and C-Kit ligand are added at a final
concentration of 0.1 nM. Native IL-3 and IL-3 variants are supplied
in house. C-Kit Ligand (#255-CS), G-CSF (#214-CS) and GM-CSF
(#215-GM) are purchased from R&D Systems (Minneapolis, Minn.).
Cultures are resuspended using an Eppendorf repeater and 0.1 ml is
dispensed per well. Control (baseline response) cultures received
no colony stimulating factors. Positive control cultures received
conditioned media (PHA stimulated human cells:Terry Fox Lab.
H2400). Cultures are incubated at 37.degree. C., 5% CO2 in
humidified air.
[0144] Hematopoietic colonies which are defined as greater than 50
cells are counted on the day of peak response (days 10-11) using a
Nikon inverted phase microscope with a 40.times. objective
combination. Groups of cells containing fewer than 50 cells are
referred to as clusters. Alternatively colonies can be identified
by spreading the colonies on a slide and stained or they can be
picked, resuspended and spun onto cytospin slides for staining.
EXAMPLE 4
[0145] The synergistic effect of the IL-3 variant, pMON13288, with
G-CSF was evaluated in the methylcellulose assay compared to that
of native IL-3 with G-CSF. G-CSF was added to each culture at a
concentration of 0.1 nM. Native IL-3 and the IL-3 variant,
pMON13288, were added at final concentrations ranging from 0.001 nM
to 10 nM. Colonies were counted on the day of peak response (days
10-11). pMON13288 activates more progenitor cells than native IL-3
(FIG. 2). Native IL-3 plus G-CSF and the IL-3 variant, pMON13288,
plus G-CSF resulted in an increase in colony number greater than
the additive effect of the individual proteins alone (FIG. 2). The
synergistic effect of the IL-3 variant, pMON13288, with G-CSF was
greater than that of native IL-3 with G-CSF. Hematopoietic colony
forming activity of the IL-3 variant, pMON13288, was multi-lineage
whereas G-CSF alone activates primarily granulocytic cells at molar
equivalent doses. In FIG. 2 the concentration of IL-3 is plotted
versus the colony counts per 100,000 starting CD34+ cells.
EXAMPLE 5
[0146] The synergistic effect of the IL-3 variant, pMON13288, with
GM-CSF was evaluated in the methylcellulose assay compared to that
of native IL-3 with GM-CSF. GM-CSF was added to each culture at a
concentration of 0.1 nM. Native IL-3 and the IL-3 variant,
pMON13288, were added at final concentrations ranging from 0.001 nM
to 10 nM. Colonies were counted on the day of peak response (days
10-11). pMON13288 activates more progenitor cells than native IL-3
(FIG. 3). Native IL-3 plus GM-CSF and the IL-3 variant, pMON13288,
plus GM-CSF resulted in an increase in colony number greater than
the effect of the individual proteins alone (FIG. 3). The
synergistic effect of the IL-3 variant, pMON13288, with GM-CSF was
greater than that of native IL-3 with GM-CSF. In FIG. 3 the
concentration of IL-3 is plotted versus the colony counts per
100,000 starting CD34+ cells.
EXAMPLE 6
[0147] Methylcellulose assays for native IL-3, pMON5873, were
carried out in methylcellulose, with or without EPO. Although EPO
increased the total number of colonies, it didn't appear to
increase CFU-GM, which are of more interest. The presence of
erythroid colonies also made scoring more subjective, because one
must distinguish between multifocal BFU-E vs several closely
associated single focus CFU-E. EPO also gave a high background of
total colonies, which would tend to obscure the dose dependent
response of CFU-GM to other CSFs.
[0148] Methylcellulose assays comparing native IL-3 (pMON5873) to
the IL-3 variant, pMON13288 were carried out in the presence of
stem cell factor (SCF) without EPO. SCF gives no background
response in these assays, but appears to increase the dose
dependent response of CFU-GM to both native IL-3 (PMON5873) and the
IL-3 variant, pMON13288. This result is consistent with reports in
the literature of in vitro synergies between IL-3 and SCF
(Migliaccio et al., 1992). The IL-3 variant, pMON13288, appears to
be more potent in these assays, and gives a greater maximum number
of colonies (also larger) than native IL-3 (PMON5873).
Human Cord Blood Hemopoietic Growth Factor Assays
[0149] Bone marrow cells are traditionally used for in vitro assays
of hematopoietic colony stimulating factor (CSF) activity. However,
human bone marrow is not always available, and there is
considerable variability between donors. Umbilical cord blood is
comparable to bone marrow as a source of hematopoietic stem cells
and progenitors (Broxmeyer et al., 1992; Mayani et al., 1993). In
contrast to bone marrow, cord blood is more readily available on a
regular basis. There is also a potential to reduce assay
variability by pooling cells obtained fresh from several donors, or
to create a bank of cryopreserved cells for this purpose. By
modifying the culture conditions, and/or analyzing for lineage
specific markers, it should be possible to assay specifically for
granulocyte/macrophage colonies (CFU-GM), for megakaryocyte CSF
activity, or for high proliferative potential colony forming cell
(HPP-CFC) activity.
METHODS
[0150] Mononuclear cells (MNC) are isolated from cord blood within
24 hrs of collection, using a standard density gradient (1.077 g/ml
Histopaque). Cord blood MNC have been further enriched for stem
cells and progenitors by several procedures, including
immunomagnetic selection for CD14-, CD34+ cells; panning for SBA-,
CD34+ fraction using coated flasks from Applied Immune Science
(Santa Clara, Calif.); and CD34+ selection using a CellPro
(Bothell, Wash.) avidin column. Either freshly isolated or
cryopreserved CD34+ cell enriched fractions are used for the assay.
Duplicate cultures for each serial dilution of sample
(concentration range from 1 pM to 1204 pM) are prepared with
1.times.104 cells in 1 ml of 0.9% methycellulose containing medium
without additional growth factors (Methocult H4230 from Stem Cell
Technologies, Vancouver, BC.). In some experiments, Methocult H4330
containing erythropoietin (EPO) was used instead of Methocult
H4230, or Stem Cell Factor (SCF), 50 ng/ml (Biosource
International, Camarillo, Calif.) was added. After culturing for
7-9 days, colonies containing >30 cells are counted. In order to
rule out subjective bias in scoring, assays are scored blind.
Analysis of c-mpl Ligand Proliferative Activity
METHODS
[0151] 1. Bone marrow proliferation assay
[0152] a. CD34+ Cell Purification:
[0153] Between 15-20 ml bone marrow aspirates were obtained from
normal allogeneic marrow donors after informed consent. Cells were
diluted 1:3 in phosphate buffered saline (PBS, Gibco-BRL), 30 ml
were layered over 15 ml Histopaque-1077 (Sigma) and centrifuged for
30 minutes at 300 RCF. The mononuclear interface layer was
collected and washed in PBS. CD34+ cells were enriched from the
mononuclear cell preparation using an affinity column per
manufacturers instructions (CellPro, Inc, Bothell Wash.). After
enrichment, the purity of CD34+ cells was 70% on average as
determined by using flow cytometric analysis using anti CD34
monoclonal antibody conjugated to fluorescein and anti CD38
conjugated to phycoerythrin (Becton Dickinson, San Jose
Calif.).
[0154] Cells were resuspended at 40,000 cells/ml in X-Vivo 10 media
(Bio-Whittaker, Walkersville, Md.) and 1 ml was plated in 12-well
tissue culture plates (Costar). The growth factor rhIL-3 was added
at 100 ng/ml (pMON5873) was added to some wells. hIL3 variant,
pMON13288 was used at 10 ng/ml or 100 ng/ml. Conditioned media from
BHK cells transfected with plasmid encoding c-mpl ligand were
tested by addition of 100 .mu.l of supernatant added to 1 ml
cultures (approximately a 10% dilution). Cells were incubated at
37.degree. C. for 8-14 days at 5% CO.sub.2 in a 37.degree. C.
humidified incubator.
[0155] b. Cell Harvest and Analysis:
[0156] At the end of the culture period a total cell count was
obtained for each condition. For fluorescence analysis and ploidy
determination cells were washed in megakaryocyte buffer (MK buffer,
13.6 mM Sodium Citrate, 1 mM Theophylline, 2.2 .mu.M PGE1, 11 mM
Glucose, 3% w/v BSA, in PBS, pH 7.4,) [See Tomer et al., Blood 70,
1987, pp. 1736-42] resuspended in 500 .mu.l of MK buffer containing
anti-CD41a FITC antibody (1:200, AMAC, Westbrook, Me.) and washed
in MK buffer. For DNA analysis cells were permeablized in MK buffer
containing 0.5% Tween 20 (Fisher, Fair Lawn N.J.) for 20 min. on
ice followed by fixation in 0.5% Tween-20 and 1% paraformaldehyde
(Fisher Chemical) for 30 minutes followed by incubation in
Propidium Iodide (Calbiochem , La Jolla Calif.) (50 .mu.g/ml) with
RNA-ase (400 U/ml) in 55% v/v MK buffer (200 mOsm) for 1-2 hours on
ice. Cells were analyzed on a FACScan or Vantage flow cytometer
(Becton Dickinson, San Jose, Calif.). Green fluorescence
(CD41a-FITC) was collected along with linear and log signals for
red fluorescence (PI) to determine DNA ploidy. All cells were
collected to determine the percent of cells that were CD41+. Data
analysis was performed using software by LYSIS (Becton Dickinson,
San Jose, Calif.). Percent of cells expressing the CD41 antigen was
obtained from flow cytometry analysis(Percent). Absolute (Abs)
number of CD41+ cells/ml was calculated by: (Abs)=(Cell
Count)*(Percent)/100.
[0157] 2. Megakaryocyte fibrin clot assay.
[0158] CD34+ enriched population were isolated as described above.
Cells were suspended at 25,000 cells/ml with/without cytokine(s) in
a media consisting of a base Iscoves IMDM media supplemented with
0.3% BSA, 0.4 mg/ml apo-transferrin, 6.67.mu.M FeCl.sub.2, 25
.mu.g/ml CaCl.sub.2, 25 .mu.g/ml L-asparagine, 500 .mu.g/ml
E-amino-n-caproic acid and Penicillin/Streptomycin. Prior to
plating into 35 mm plates, thrombin was added (0.25 Units/ml) to
initiate clot formation. Cells were incubated at 37.degree. C. for
13 days at 5% CO.sub.2 in a 37.degree. C. humidified incubator.
[0159] At the end of the culture period plates were fixed with
Methanol:Acetone (1:3), air dried and stored at -20.degree. C.
until staining. A peroxidase immunocytochemistry staining procedure
was used (Zymed, Histostain-SP. San Francisco, Calif.) using a
cocktail of primary monoclonal antibodies consisting of anti CD41a,
CD42 and CD61. Colonies were counted after staining and classified
as negative, CFU-MK (small colonies, 1-2 foci and less that approx.
25 cells), BFU-MK (large, multi-foci colonies with >25 cells) or
mixed colonies (mixture of both positive and negative cells).
EXAMPLE 7
Co-administration of hIL-3 Variant, pMON13288 and c-mpl Ligand
(Meg-CSF) in liquid culture
[0160] Co-administration of hIL-3 variant, pMON13288 and c-mpl
ligand (Meg-CSF) has a more than additive effect on megakaryocyte
expansion than either cytokine alone in the liquid culture assay
CD34+ cells were isolated as described in the methods section. The
assay was set up as described in the methods section except that
cells were plated at 4000 cells/100 .mu.l in a 96-well plate.
pMON26448 or a mock transfectant was evaluated by adding 10 .mu.l
to each well (10% final). Supernatant from transfected BHK cells
were tested +/-hIL3 variant, pMON13288 (10 ng/ml). At day 10
phenotypic analysis was performed by flow cytometry. Supernatant
from pMON26448 induced selective expansion of CD41a+ cells. Total
cell number increased from the 4000 cells plated to 22,000 at the
end of the assay (Table 1). Addition of hIL3 variant, pMON13288
alone increased total cell numbers (19,000 cells at end of assay)
with 17% of cells expressing CD41a. Combination of pMON26448 with
hIL3 variant, pMON13288 resulted in 56% of cells expressing CD41a.
Total cell expansion in the combination assay was more than
additive with 86,000 cells/well. Both the increased total cell
number and the higher percentage of cells expressing CD41a resulted
in an increase in total number CD41+ cells that also was more than
additive as compared to either cytokine alone (48,000 vs. 3,320 and
18,480).
16 TABLE 1 Cytokine % CD41a # CD41+ Treatment Cells/Well Positive
Cells/Well pMON13288 19,000 17 3,230 pMON26448 22,000 84 18,480
pMON26448 + 86,000 56 48,160 pMON13288
EXAMPLE 8
Co-administration of hIL-3 Variant, pMON13288, and c-mpl Ligand
(Meg-CSF) in Liquid Culture
[0161] The co-administration of hIL-3 variant, pMON13288, and c-mpl
ligand (Meg-CSF) has a more than additive effect on megakaryocyte
expansion than either cytokine alone in the liquid culture
assay
[0162] In another experiment CD34+ cells were isolated from Human
bone marrow using a CD34 affinity column (Cellpro). Purified CD34+
cells were resuspended in X-Vivo tissue culture media at 40,000
cells/ml. pMON26448 or a mock transfectant (10%) was evaluated
with/without hIL3 variant, pMON13288 or native IL3. At day 8
phenotypic analysis was done using flow cytometry. As was seen in
the table below (Table 2a-c). IL3, both concentrations of hIL3
variant, pMON13288 and pMON26448 increased total cell number
substantially. Combination of cytokines further expanded cell
populations. pMON26448 increased the percent of CD41+ cells from 2%
in the control group to 35%. IL3 or hIL3 variant, pMON13288
increased the percent of CD41+ cells modestly (from 2% to 5%).
Combining pMON26448 with IL3 or hIL3 variant, pMON13288 resulted in
a more than additive number of CD41+ cells as compared to the sum
of either cytokine alone (Table 2c).
17TABLE 2(a-c) a. Total Cells/Well Cytokine IL-3 pMON13288
pMON13288 treatment Media (100 ng/ml) (10 ng/ml) (100 ng/ml) Media
30,000 112,000 275,000 150,000 Mock 10,000 153,000 235,000 260,000
pMON26448 135,000 655,000 625,000 500,000
[0163]
18 b. % CD41a+ Cytokine IL-3 pMON13288 pMON13288 treatment Media
(100 ng/ml) (10 ng/ml) (100 ng/ml) Media 2 7 5 5 Mock 2 14 5 9
pMON26448 35 35 28 29
[0164]
19 c. Total CD41a+ Cells Cytokine IL-3 pMON13288 pMON13288
treatment Media (100 ng/ml) (10 ng/ml) (100 ng/ml) Media 600 7,840
13,750 7,500 Mock 200 21,420 11,750 23,400 pMON26448 47,250 229,250
175,000 145,000
EXAMPLE 9
Co-administration of hIL-3 Variant, pMON13288, and c-mpl Ligand
(Meg-CSF) in Fibrin Clot Assay
[0165] The co-administration of hIL-3 variant, pMON13288, and c-mpl
ligand (Meg-CSF) has a more than additive effect on megakaryocyte
than either cytokine alone.
[0166] Fibrin clot cultures were set up as described in methods
section. pMON26448 is the 1-153 form of c-mpl ligand (Meg-CSF).
Incubation in the presence of hIL3 variant, pMON13288 gave rise to
colonies that were predominantly negative for megakaryocyte markers
(86/114, (Table 3)) except for number of small CFU-MK colonies
(23/114). pMON26448 alone gave rise primarily to CFU-MK colonies
(172/175) with only a few number of negative colonies (3/175).
Combination of hIL3 variant, pMON13288 and pMON26448 gave rise to a
large number of positive colonies (295/414) that were predominantly
of the BFU-MK morphology. There were a negative colonies as well
(119/414). Total number of positive colonies with co-administration
was more than additive than with either cytokine alone.
20TABLE 3 Cytokine Total treatment Negative CFU-MK BFU-MK Mixed
Colonies Colonies/Well pMON13288 86 23 0 5 114 pMON26448 3 73 98 1
175 pMON26448 + 119 29 244 22 414 pMON13288 Colonies/100,000 plated
pMON13288 344 92 0 20 456 pMON26448 12 292 392 4 700 pMON26448 +
476 116 976 88 1656 pMON13288
IL-3 Mediated Sulfidoleukotriene Release from Human Mononuclear
Cells
[0167] The following assay was used to measure IL-3 mediated
sulfidoleukotriene release from human mononuclear cells.
[0168] Heparin-containing human blood was collected and layered
onto an equal volume of Ficoll-Paque (Pharmacia #17-0840-02) ready
to use medium (density 1.077 g/ml.). The Ficoll was warmed to room
temperature prior to use and clear 50 ml polystyrene tubes were
utilized. The Ficoll gradient was spun at 300.times.g for 30
minutes at room temperature using a H1000B rotor in a Sorvall
RT6000B refrigerated centrifuge. The band containing the
mononuclear cells was carefully removed, the volume adjusted to 50
mls with Dulbecco's phosphate-buffered saline (Gibco Laboratories
cat. #310-4040PK), spun at 400.times.g for 10 minutes at 4.degree.
C. and the supernatant was carefully removed. The cell pellet was
washed twice with HA Buffer [20 mM Hepes (Sigma #H-3375), 125 mM
NaCl (Fisher #S271-500), 5 mM KCl (Sigma #P-9541), 0.5 mM glucose
(Sigma #G-5000),0.025% Human Serum Albumin (Calbiochem #126654) and
spun at 300.times.g, 10 min., 4.degree. C. The cells were
resuspended in HACM Buffer (HA buffer supplemented with 1 mM CaCl2
(Fisher #C79-500) and 1 mM MgCl2 (Fisher #M-33) at a concentration
of 1.times.106 cells/ml and 180 .mu.l were transferred into each
well of 96 well tissue culture plates. The cells were allowed to
acclimate at 37.degree. C. for 15 minutes. The cells were primed by
adding 10 .mu.ls of a 20.times. stock of various concentrations of
cytokine to each well (typically 100000, 20000, 4000, 800, 160, 32,
6.4, 1.28, 0 fM IL3). The cells were incubated for 15 minutes at
37.degree. C. Sulfidoleukotriene release was activated by the
addition of 10 .mu.ls of 20.times. (1000 nM) fmet-leu-phe
(Calbiochem #344252) final concentration 50 nM FMLP and incubated
for 10 minutes at 37.degree. C. The plates were spun at 350.times.g
at 4.degree. C. for 20 minutes. The supernatants were removed and
assayed for sulfidoleukotrienes using Cayman's Leukotriene C4 EIA
kit (Cat. #420211) according to manufacturers' directions. Native
(15-125)hIL-3 was run as a standard control in each assay.
[0169] Further details known to those skilled in the art may be
found in T. Maniatis, et al., Molecular Cloning, A Laboratory
Manual, Cold Spring Harbor Laboratory (1982) and references cited
therein, incorporated herein by reference; and in J. Sambrook, et
al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold
Spring Harbor Laboratory (1989) and references cited therein,
incorporated herein by reference.
[0170] Amino acids are shown herein by standard one letter or three
letter abbreviations as follows:
21 Abbreviated Designation Amino Acid A Ala Alanine C Cys Cysteine
D Asp Aspartic acid E Glu Glutamic acid F Phe Phenylalanine G Gly
Glycine H His Histidine I Ile Isoleucine K Lys Lysine L Leu Leucine
M Met Methionine N Asn Asparagine P Pro Proline Q Gln Glutamine R
Arg Arginine S Ser Serine T Thr Threonine V Val Valine W Trp
Tryptophan Y Tyr Tyrosine
[0171] Additional details may be found in co-pending U.S. Patent
Application Serial No. PCT/US93/11197 which is hereby incorporated
by reference in its entirety as if written herein.
[0172] All references, patents or applications cited herein are
incorporated by reference in their entirety as if written
herein.
[0173] Various other examples will be apparent to the person
skilled in the art after reading the present disclosure without
departing from the spirit and scope of the invention. It is
intended that all such other examples be included within the scope
of the appended claims.
22TABLE 4 OLIGONUCLEOTIDES c-mplBglII
CATGGCAAGATCTCCGGCCAGAATGGAGCTGACTGA [SEQ ID NO:50] c -mplEcoRI
AATAGCTGAATTCTTACCCTTCCTGAGACAGATT [SEQ ID NO:51] c-mplNcoI
ACGTCCATGGCNTCNCCNGCNCCNCCTGCTTGTGACCTCCGAGTC [SEQ ID NO:52] (where
N=G, C, T or A) c-mplHindIII TGACAAGCTTACCTGACGCAGAGGGTGGACCCT [SEQ
ID NO:53]
[0174]
23TABLE 5 DNA SEQUENCES 1-153 c-mpl ligand ATGGCGTCTC CCGCGCCGCC
TGCTTGTGAC CTCCGAGTCC TCAGTAAACT [SEQ ID NO:54] GCTTCGTGAC
TCCCATGTCC TTCACAGCAG ACTGAGCCAG TGCCCAGAGG TTCACCCTTT GCCTACACCT
GTCCTGCTGC CTGCTGTGGA CTTTAGCTTC GGAGAATGGA AAACCCAGAT GGAGGAGACC
AAGGCACAGG ACATTCTGCG AGCAGTGACC CTTCTGCTGG AGGGAGTGAT GGCAGCACGG
GGACAACTGG GACCCACTTG CCTCTCATCC CTCCTGGGGC AGCTTTCTGG ACAGGTCCGT
CTCCTCCTTG GGGCCCTGCA GAGCCTCCTT GGAACCCAGC TTCCTCCACA GGGCAGGACC
ACAGCTCACA AGGATCCCAA TGCCATCTTC CTGAGCTTCC AACACCTGCT CCGAGGAAAG
GTGCGTTTCC TGATGCTTGT AGGAGGGTCC ACCCTCTGCG TCAGG Full length c-mpl
ligand ATGGAGCTGA CTGAATTGGT CCTCGTGGTC ATGCTTCTCC TAACTGCAAG [SEQ
ID NO:57] CCTAACCCTC TCCAGCCCGG CTCCTCCTGC TTGTGACCTC CGAGTCCTCA
GTAAACTGCT TCGTGACTCC CATGTCCTTC ACAGGAGACT GAGCCAGTGC CCAGAGGTTC
ACCCTTTGCC TACACCTGTC CTGCTGCCTG CTGTGGACTT TAGCTTGGGA GAATGGAAAA
CCCAGATGGA GGAGACCAAG GCACAGGACA TTCTGGGAGC AGTGACCCTT CTGCTGGAGG
GAGTGATGGC AGCACGGGGA CAACTGGGAC CCACTTGCCT CTCATCCCTC CTGGGGCAGC
TTTCTGGACA GGTCCGTCTC CTCCTTGGGG CCCTGCAGAG CCTCCTTGGA ACCCAGCTTC
CTCCACAGGG CAGGACCACA GCTCACAAGG ATCCCAATGC CATCTTCCTG AGCTTCCAAC
ACCTGCTCCG AGGAAAGGTG CGTTTCCTGA TGCTTGTAGG AGGGTCCACC CTCTGCGTCA
GGCGGGCCCC ACCCACCACA GCTGTCCCCA GCAGAACCTC TCTAGTCCTC ACACTGAACG
AGCTCCCAAA CAGGACTTCT GGATTGTTGG AGACAAACTT CACTGCCTCA GCCAGAACTA
CTGGCTCTGG GCTTCTGAAG TGGCAGCAGG GATTCAGAGC CAAGATTCCT GGTCTGCTGA
ACCAAACCTC CAGGTCCCTG GACCAAATCC CCGGATACCT GAACAGGATA CACGAACTCT
TGAATGGAAC TCGTGGACTC TTTCCTGGAC CCTCACGCAG GACCCTAGGA GCCCCGGACA
TTTCCTCAGG AACATCAGAC ACAGGCTCCC TGCCACCCAA CCTCCAGCCT GGATATTCTC
CTTCCCCAAC CCATCCTCCT ACTGGACAGT ATACGCTCTT CCCTCTTCCA CCCACCTTGC
CCACCCCTGT GGTCCAGCTC CACCCCCTGC TTCCTGACCC TTCTGCTCCA ACGCCCACCC
CTACCAGCCC TCTTCTAAAC ACATCCTACA CCCACTCCCA GAATCTGTCT
CAGGAAGGG
References
[0175] Adams, S. P., Kavka, K. S., Wykes, E. J., Holder, S. B. and
Galluppi, G. R. Hindered Dialkyamino Nucleoside Phosphate reagents
in the synthesis of two DNA 51-mers. J. Am. Chem. Soc., 105,
661-663 (1983).
[0176] Atkinson, T. and Smith, M., in Gait, M. J., Oligonucleotide
Synthesis (1984) (IRL Press, Oxford England).
[0177] Bachmann, B., Pedigrees of some mutant strains of
Escherichia coli K-12, Bacteriological Reviews, 36:525-557
(1972).
[0178] Bayne, M. L., Expression of a synthetic gene encoding human
insulin-like growth factor I in cultured mouse fibroblasts. Proc.
Natl. Acad. Sci. USA 84, 2638-2642 (1987).
[0179] Bazan, J. F., Haemopoietic receptors and helical cytokines.
Proc. Natl. Acad. Sci. U.S.A. 87(18):6934-8 (1990).
[0180] Ben-Bassat, A., K. Bauer, S-Y. Chang, K. Myambo, A. Boosman
and S. Ching. Processing of the initiating methionine from
proteins: properties of the Escherichia coli methionine
aminopeptidase and its gene structure. J. Bacteriol., 169: 751-757
(1987).
[0181] Biesma, B. et al., Effects of interleukin-3 after
chemotherapy for advanced ovarian cancer. Blood, 80:1141-1148
(1992).
[0182] Birnboim, H. C. and J. Doly. A rapid alkaline extraction
method for screening recombinant plasmid DNA. Nucleic Acids
Research, 7(6): 1513-1523 (1979).
[0183] Bradford, M. M., A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding, Analytical Biochemistry, 72:
248-254 (1976).
[0184] Bradley, T R and Metcalf, D. The growth of mouse bone marrow
cells in vitro. Aust. Exp. Biol. Med. Sci. 44:287-300, (1966).
[0185] Briddell, R A, Hoffman, R, Cytokine regulation of the human
burst-forming unit megakaryocyte, Blood 76:516, (1990).
[0186] Broxmeyer, H. E. et al, Growth characteristics and expansion
of human umbilical cord blood and estimation of its potential for
transplantation in adults, Proc. Natl. Acad. Sci. USA, vol.89,
4109-4113, 1992.
[0187] Bruno, E, Miller, M E, Hoffman, R, Interacting cytokines
regulate in vitro human megakaryocytopoiesis, Blood 76:671,
(1989).
[0188] Bruno, E, Cooper, R J, Briddell, R A, Hoffman, R, Further
examination of the effects of recombinant cytokines on the
proliferation of human megakaryocyte, progenitor cells, Blood
77:2339, (1991).
[0189] Clark-Lewis, I., L. E. Hood and S. B. H. Kent. Role of
disulfide bridges in determining the biological activity of
interleukin 3, Proc. Natl. Acad. Sci., 85: 7897-7901 (1988).
[0190] Clement, J. M. and Hofnung, M. Gene sequence of the
receptor, an outer membrane protein of E. coli K12. Cell, 27:
507-514 (1981).
[0191] Covarrubias, L., L. Cervantes, A. Covarrubias, X. Soberon,
I. Vichido, A. Blanco, Y. M. Kupersztoch-Portnoy and F. Bolivar.
Construction and characterization of new cloning vehicles. V.
Mobilization and coding properties of pBR322 and several deletion
derivatives including pBR327 and pBR328. Gene 13: 25-35 (1981).
[0192] D'Andrea, A. D., Lodish, H. G., Wong, G. G.:Expression
cloning of the murine erythropoietin receptor. Cell 57:277,
1989
[0193] Deng, W. P. & Nickoloff, J. A. Site-directed mutagenesis
of virtually any plasmid by eliminating a unique site Anal.
Biochem. 200:81 (1992).
[0194] Dente, L., G. Cesareni and R. Cortese, pEMBL: a new family
of single stranded plasmids, Nucleic Acids Research, 11: 1645-1655
(1983).
[0195] Donahue, R E, Seehra, J, Metzger, M, Lefebvre, D, Rock, B,
Corbone, S, Nathan, D G, Garnick, M, Seghal, P K, Laston, D, La
Valle, E, McCoy, J, Schendel, P F, Norton, C, Turner, K, Yang, Y C,
and Clark, S C., Human IL-3 and GM-CSF act synergistically in
stimulating hematopoiesis in primates. Science, 241: 1820,
(1988).
[0196] de Sauvage, F. J., Haas, P. E., Spencer, S. D., Malloy, B.
E., Gurney, A. L., Spencer, S. A., Darbonne, W. C., Henzel, W. J.,
Wong, S. C., Kuang, W., Oles, K. J., Hultgren, B., Solberg, L. A.,
Goeddel, D. V., and Eaton, D. L., Stimulation of
megakaryocytpoiesis and thrombopoiesis by the c-Mp1 ligand. Nature
369:533-538 (1994).
[0197] Dunn, J. J. and Studier, F. W., Complete nucleotide sequence
of bacteriophage T7 DNA and the locations of T7 genetic elements.
J. Mol. Biol. 166:477-535 (1983).
[0198] Emerson, S G, Yang, Y C, Clark, S C, and Long, M W, Human
recombinant human GM-CSF and IL-s have overlapping but distinct
hematopoietic activities, J. Clin. Invest. 82:1282, (1988).
[0199] Falk, S., G. Seipelt, A. Ganser, O. G. Ottmann, D. Hoelzer,
H. J. Stutte and K. Hubner. Hematopathology 95: 355 (1991).
[0200] Farese, A. M., Williams, D. E., Seiler, F. R., and
MacVittie, T. J., Combination protocols fo cytokine therapy with
interleukin-3 and granulocyte-Macrophage colony-stimulating factor
in a primate model of radiation-induced marrow aplasia. Blood
82(10):3012-3018 (1993).
[0201] Fling, M. E., et al. Nucleotide sequence of the transposon
Tn7 gene encoding an aminoglycoside-modifying enzyme,
3"(9)-O-nucleotidyltransfera- se. Nucl. Acids Res. 13:7095-7106
(1985).
[0202] Fukunaga, R., Ishizaka-Ikeda, E., and Nagata, S.,
Purification and characterization of the recptor for murine
granulocyte colonystimulating factor. J. Biol. Chem.
265(23):14008-15 (1990).
[0203] Ganser, A., A. Lindemann, G. Seipelt, O. G. Ottmann, F.
Herrmann, M. Eder, J. Frisch, G. Schulz, R. Mertelsmann and D.
Hoelzer. Effects of Recombinant Human Interleukin-3 in Patients
With Normal Hematopoiesis and in Patients with Bone Marrow Failure,
Blood 76: 666 (1990).
[0204] Ganser, A, Lindemann, A, Ottmann, O G, Seipelt, G, Hess, U,
Geissler, G, Kanz, L, Frisch, J, Schultz, G, Mertelsmann, R, and
Hoelzer, D, Sequential in vivo treatment with two recombinant human
hematopoietic growth factors (IL-3 and GM-CSF) as a new therapeutic
modality to stimulate hematopoiesis: Results of a Phase I study,
Blood 79: 2583, (1992).
[0205] Gearing, D. P., King, J. A., Gough, N. M., Nicola, N. A.:
Expression cloning of a receptor for human granulocyte-macrophage
colony-stimulating factor. EMBO J 8:3667, 1989
[0206] Gearing, D. P., Thut, C. J., VandenBos, T., Gimpel, S. D.,
Delaney, P. B., King, J. A., Price V., Cosman, D., Beckmann M P:
Leukemia inhibitory factor receptor is structurally related to the
IL-6 signal transducer, gp130. EMBO J 10:2839, 1991
[0207] Gearing, D. P., Comeau, M. R., Friend, D. J., Gimpel, S. D.,
Thut, C. J., McGourty, J., Brasher, K. K., King. J. A., Gills, S.,
and Mosely, B., Ziegler, S. F., and Cosman, D., The IL-6 signal
transducer, GP130: an oncostatin M recptor and affinty converter
for the LIF recptor. Science 255(5050):1434-7 (1992).
[0208] Gething and Sambrook, Cell-surface expression of influenza
haemagglutinin from a cloned DNA copy of the RNA gene, Nature, 293:
620-625 (1981).
[0209] Gillio, A. P., C. Gasparetto, J. Laver, M. Abboud, M. A.
Bonilla, M. B. Garnick and R. J. O'Reilly. J. Clin. Invest. 85:
1560 (1990).
[0210] Goodwin, R. G., Friend, D. J., Ziegler, S. F., Jerry, R.,
Falk, B. A., Gimpel, S. D., Cosman, D., Dower, S. K., March, C. J.,
Namen, A. E., Cloning of the human and murine interleukin-7
receptors: demonstration of a sloble form and homology to a new
receptor superfamily. Cell 60(6):941-51 (1990)
[0211] Gouy, M. and G. Gautier, Codon usage in bacteria:
Correlation with gene expressivity, Nucleic Acids Research, 10:
7055-7074 (1982).
[0212] Greenfield, L., T. Boone, and G. Wilcox. DNA sequence of the
araBAD promoter in Escherichia coli B/r. Proc. Natl. Acad. Sci.
USA, 75: 4724-4728 (1978).
[0213] Harada, N., Castle, B. E., Gorman, D. M., Itoh, N.,
Schreurs, J., Barrett R. L., Howard, M., Miyajima, A.: Expression
cloning of a cDNA encoding the murine interleukin 4 receptor based
on ligand binding. Proc Natl Acad Sci USA 87:857, 1990
[0214] Higuchi, R, (1989) in PCR Technology, H. A. Erlich ed.,
Stockton Press, N.Y. chapter 2-6.
[0215] Hippenmeyer, P., and Highkin M. High level, stable
production of recombinant proteins in mammalian cell culture using
the herpesvirus VP16 transactivator. Bio/Technology 11: 1037-1041
(1993).
[0216] Hunkapiller, M. W., R. W. Hewick, R. J. Dreyer and L. E.
Hood. High sensitivity sequencing with a gas-phase sequenator.
Methods in Enzymology 153: 399-413 (1983).
[0217] Kaufman, et al., Coamplification and Coexpression of Human
Tissue-Type Plasminogen Activator and Murine Dihydrofolate
Reductase Sequences in Chinese Hamster Ovary Cells, Mol. Cell.
Biol., 5(7): 1750-1759 (1985).
[0218] Kaufman, R. J. High level production of proteins in
mammalian cells, in Genetic Engineering, Principles and Methods,
Vol. 9, J. K. Setlow, editor, Plenum Press, New York (1987).
[0219] Kelso, A., Gough, N. M.: Coexpession of
granulocyte-macrophage colony-stimulating factor gamma-interferon
and interleukins-3 and 4 is random in murine alloreactive T
lymphocyte clones. Proc Natl Acad Sci USA 85:9189, 1988
[0220] Kitamura, T, Tange, T, Terasawa, T, Chiba, S, Kuwaki, T,
Miyagawa, K, Piao, Y, Miyazono, K, Urabe, A, and Takaku, F,
Establishment and Characterization of a Unique Human Cell Line That
Proliferates Dependently on GM-CSF or Erythropoietin, Journal of
Cellular Physiology, 140: 323-334 (1989)
[0221] Kitamura, T., Sato, N., Arai, K., Miyajima, A.: Expression
cloning of the human IL-3 receptor cDNA reveals a shared beta
subunit for the human IL-3 and GM-CSF receptors. Cell 66:1165,
1991
[0222] Kondo, M., Takeshita, T., Ishii, N., Nakamura, M., Watanabe,
S., Arai, K-I, Sugamura, K.: Sharing of the Interleukin-2 (IL-2)
Receptor gamma Chain Between Receptors for IL-2 and Il-4. Science
262:1874, Dec. 17, 1993.
[0223] Krumwieh, D, Weinmann, E, Seiler, F R, Different effects of
interleukin-3 (IL-3) on the hematopoiesis of subhuman primates due
to various combinations with GM-CSF and G-CSF, Int. J. Cell Cloning
8: 229, (1990).
[0224] Kunkel, T. A. Rapid and efficient site-specific mutagenesis
without phenotypic selection. Proc. Natl. Acad. Sci. USA, 82:
488-492 (1985).
[0225] Laemmli, U. K., Cleavage of structural proteins during
assembly of the head of bacteriophage T4, Nature, 227:680-685
(1970).
[0226] Lange, B., M. Valtieri, D. Santoli, D. Caracciolo, F.
Mavilio, I. Gemperlein, C. Griffin, B. Emanuel, J. Finan, P.
Nowell, and G. Rovera. Growth factor requirements of childhood
acute leukemia: establishment of GM-CSF-dependent cell lines. Blood
70:192 (1987).
[0227] Maekawa, T., Metcalf, D., Gearing, D. P.: Enhanced
suppression of human myeloid leukemic cell lines by combination of
IL-6, LIF, GM-CSF and G-CSF, Int J Cancer 45:353, 1989
[0228] Mahler, H. R. and E. H. Cordes, in Biological Chemistry, p.
128, New York, Harper and Row (1966).
[0229] Maniatis, T., E. F. Fritsch and J. Sambrook, Molecular
Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory
(1982).
[0230] Marinus, M. G. Location of DNA methylation genes on the
Escherichia coli K-12 genetic map. Molec. Gen. Genet. 127: 47-55
(1973).
[0231] McBride, L. J. and Caruthers, M. H. An investigation of
several deoxynucleoside phosphoramidites. Tetrahedron Lett., 24,
245-248 (1983).
[0232] Messing, J., A multipurpose cloning system based on the
single-stranded DNA bacteriophage M13. Recombinant DNA Technical
Bulletin, NIH Publication No. 79-99, Vol. 2, No. 2, pp. 43-48
(1979).
[0233] Mayani, H. et al, Cytokine-induced selective expansion and
maturation of erythroid versus myeloid progenitors from purified
cord blood precursor cells, Blood, vol. 81, 3252-3258, 1993.
[0234] Mazur, E et al, Blood 57:277-286, (1981).
[0235] Metcalf, D., Begley, C. G., Williamson, D., Nice, E. C.,
DeLamarter, J., Mermod J-J, Thatcher, D., Schmidt, A.: Hemopoietic
responses in mice injected with purified recombinant murine GM-CSF.
Exp Hematol 15:1, 1987
[0236] Metcalf, D.: The molecular control of cell division,
differentiation commitment and maturation in haemopoietic cells.
Nature 339:27, 1989
[0237] Metcalf, D., Nicola, N. A.: Direct proliferative actions of
stem cell factor on murine bone marrow cells in vitro. Effects of
combinatin with colony-stimulating factors. Proc Natl Acad Sci USA
88:6239, 1991
[0238] Metcalf, D, Nicola, N A, The clonal proliferation of normal
mouse hematopoietic cells: Enhancement and suppression by colony
stimulating factor combinations, Blood 79: 2861, (1992)
[0239] Metcalf, D, Hematopoietic Regulators: Redundancy or
Subtlety. Blood, 182: 3515-3523 (1993).
[0240] Migliaccio, G. et al, Long-term generation of colony-forming
cells in liquid culture of CD34+ cord blood cells in the presence
of recombinant human Stem Cell Factor, Blood, vol. 79, 2620-2627,
1992.
[0241] Neu, H. C. and L. A. Heppel. The release of enzymes from
Escherichia coli by osmotic shock and during the formation of
spheroplasts. J. Biol. Chem., 240: 3685-3692 (1965).
[0242] Noguchi, M., Nakamura, Y., Russell, S. M., Ziegler, S. F.,
Tsang, M., Xiqing, C., Leonard, W. J.: Interleukin-2 Receptor g
Chain: A Functional Component of the Interleukin-7 Receptor.
Science 262:1877, Dec. 17, 1993.
[0243] Nordon, P, and Potter, M, A Macrophage-Derived Factor
Required by plasmacytomas for Survival and Proliferation in Vitro,
Science 233:566, (1986).
[0244] Obukowicz, M. G., Staten, N. R. and Krivi, G. G., Enhanced
Heterologous Gene Expression in Novel rpoH Mutants of Escherichia
coli. Applied and Environmental Microbiology 58, No. 5, p.
1511-1523 (1992).
[0245] Olins, P. O., C. S. Devine, S. H. Rangwala and K. S. Kavka,
The T7 phage gene 10 leader RNA, a ribosome-binding site that
dramatically enhances the expression of foreign genes in
Escherichia coli, Gene, 73:227-235 (1988).
[0246] Olins, P. O. and S. H. Rangwala, Vector for enhanced
translation of foreign genes in Escherichia coli, Methods in
Enzymology, 185: 115-119 (1990).
[0247] Ploemacher, R E, van Soest, P L, Voorwinden, H, and
Boudewijn, A, Interleukin-12 Synergizes with Interleukin-3 and
Steel Factor to Enhance Recovery of Murine Hemopoietic Stem Cells
in Liquid Culture, Leukimia, 7: no 6, 1381-1388, (1993).
[0248] Pluznik, D H and Sachs, L. Cloning of normal "mast" cells in
tissue culture. J Cell Comp Physiol 66:319-324 (1965).
[0249] Postmus, et al., Effects of recombinant human interleukin-3
in patients with relapsed small-cell lung cancer treated with
chemotherapy: a dose-finding study. J. Clin. Oncol., 10:1131-1140
(1992).
[0250] Prober, J. M., G. L. Trainor, R. J. Dam, F. W. Hobbs, C. W.
Robertson, R. J. Zagursky, A. J. Cocuzza, M. A. Jensen and K.
Baumeister. A system for rapid DNA sequencing with fluorescent
chain-terminating dideoxynucleotides. Science 238: 336-341
(1987).
[0251] Renart J., J. Reiser and G. R. Stark, Transfer of proteins
from gels to diazobenzyloxymethyl-paper and detection with
anti-sera: a method for studying antibody specificity and antigen
structure, Proc. Natl. Acad. Sci. USA, 76:3116-3120 (1979).
[0252] Robinson, B E, McGrath, H E, Quesenberry, P J, Recombinant
murine GM-CSF has megakaryocyte stimulating action and augments
megakaryocyte colony stimulating by IL-3. J. Clin,. Invest. 79:
1548, (1987).
[0253] Russell, S. M., Keegan, A. D., Harada, N., Nakamura, Y.,
Noguchi, M., Leland, P., Friedmann, M. C., Miyajima, A., Puri, R.
K., Paul, W. E., Leonard, W. J.: Interleukin-2 Receptor g Chain: A
Functional Component of the Interleukin-4 Receptor. Science
262:1880, Dec. 17, 1993.
[0254] Saiki, R. K., Schorf, S., Faloona, F., Mullis, K. B., Horn,
G. T., Erlich, H. A. and Arnheim, N., Enzymatic Amplification of
.beta.-Globin Genomic Sequences and Restriction Site Analysis for
Diagnosis of Sickle Cell Anemia, Science, 230: 1350-1354
(1985).
[0255] Sambrook, J., et al., Molecular Cloning, A Laboratory
Manual, 2nd edition, Cold Spring Harbor Laboratory (1989).
[0256] Sancar, A., C. Stachelek, W. Konigsberg and W. D. Rupp,
Sequences of the recA gene and protein, Proc. Natl. Acad. Sci., 77,
2611-2615 (1980).
[0257] Sanger, F., S. Nicklen and A. R. Coulson. DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:
5463-5467 (1977).
[0258] Santoli, D., Y. Yang, S. C. Clark, B. L. Kreider, D.
Caracciolo, and G. Rovera. Synergistic and antagonistic effects of
recombinant human interleukin (IL-3), IL-1', granulocyte and
macrophage colony-stimulating factors (G-CSF and M-CSF) on the
growth of GM-CSF-dependent leukemic cell lines. J. Immunol. 139:348
(1987).
[0259] Sherr, C. J.: Colony-stimulating factor-1 receptor. Blood
75:1, 1990
[0260] Smith, M. In vitro mutagenesis. Ann. Rev. Genet., 19:423-462
(1985).
[0261] Soberon, X., L. Covarrubias and F. Bolivar, Construction and
characterization of new cloning vehicles. IV. Deletion derivatives
of pBR322 and pBR325, Gene, 9: 211-223 (1980).
[0262] Sonoda, Y, Yang, Y C, Wong, G G, Clark, S C, Ogawa, M,
Analysis in serum-free culture of the targets of recombinant human
hemopoietic growth factors: IL-3 and GM-CSF are specific for early
development stages, Proc Natl Acad Sci USA, 85: 4360, (1988).
[0263] Stader, J. A. and T. J. Silhavy. Engineering Escherichia
coli to secrete heterologous gene products, Methods in Enzymology,
185: 166-87 (1990).
[0264] Stahl, C P, Winton, E F, Monroe, M C, Haff, E, Holman, R C,
Meyers, L A, Liehl,E, and Evatt, B, Differential effects of
sequential, simultaneous and single agent IL-3 and and GM-CSF on
megakaryocyte maturation and platelet response in primates, Blood,
80: 2479, (1992).
[0265] Summers, M. D. and G. E. Smith. A manual of methods for
Baculovirus vectors and insect cell culture procedures. Texas
Agricultural Experiment Station Bulletin No. 1555 (1987).
[0266] Taga, T., Hibi, M., Yamasaki, K., Yasukswa, K., Matsuda, T.,
Hirano, T., and Kishimoto, T. Interleukin-6 triggers the
association of its receptor with a possibele signal transducer,
gp130. Cell 58(3):573-81 (1989).
[0267] Takaki, S., Tominage, A., Hitoshi, Y., Mita S., Sonada, E.,
Yamaguchi, N., Takatsu, K.: Molecular cloning and expression of the
murine interleukin-5 receptor. EMBO J 9:4367, 1990
[0268] Taylor, J. W., Ott, J. and Eckstein, F. The rapid generation
of oligonucleotide-directed mutants at high frequency using
phosphorothioate modified DNA. Nucl. Acids Res., 13:8764-8785
(1985).
[0269] Tomer, A., Harker, L. A., and Burstein, S. A. Purification
of human megakaryocytes by Fluoresence-activated cell sorting.
Blood 70(6):1735-1742 (1987). Treco, D. A., (1989) in Current
protocols in Molecular Biology, Seidman et al., eds. J Wiley N.Y.,
unit 2.1.
[0270] Valtieri, M., D. Santoli, D. Caracciolo, B. L. Kreider, S.
W. Altmann, D. J. Tweardy, I. Gemperlein, F. Mavilio, B. J. Lange
and G. Rovera. Establishment and characterization of an
undifferentiated human T leukemia cell line which requires
granulocyte-macrophage colony stimulating factor for growth. J.
Immunol. 138:4042 (1987).
[0271] Voet, D., W. B. Gatzer, R. A. Cox, P. Doty. Absorption
spectra of the common bases. Biopolymers 1: 193 (1963).
[0272] Weinberg, R. A., De Ciechi, P. A., Obukowicz, M.: A
chromosomal expression vector for Escherichia coli based on the
bacteriophage Mu. Gene 126 (1993) 25-33.
[0273] Wells, J. A., Vasser, M., and Powers, D. B. Cassette
mutagenesis: an effective method for generation of multiple mutants
at defined sites. Gene, 34:315-323 (1985).
[0274] Wong, Y. Y., R. Seetharam, C. Kotts, R. A. Heeren, B. K.
Klein, S. B. Braford, K. J. Mathis, B. F. Bishop, N. R. Siegel, C.
E. Smith and W. C. Tacon. Expression of secreted IGF-1 in
Escherichia coli. Gene, 68: 193-203 (1988).
[0275] Yanisch-Perron, C., J. Viera and J. Messing. Improved M13
phage cloning vectors and host strains: nucleotide sequences of the
M13mp18 and pUC19 vectors. Gene 33: 103-119 (1985).
[0276] Yamasaki, K., Taga, T., Hirata, Y., Yawata, H., Kawanishi,
Y., Seed, B., Taniguchi, T., Hirano, T., Kishimoto, T.: Cloning and
expression of the human interleukin-6 (BSF-2?IFN beta 2) receptor.
Science 241:825, 1988
[0277] Yarden Y., Kuang, W-J., Yang-Feng, T., Coussens, L.,
Munemitsu, S., Dull, T. J., Chen, E., Schlesinger, J., Francke, U.,
Ullrich, A., Human proto-oncogene c-kit: A new cell surface
receptor tyrosine kinase for an unidentified ligand. EMBO J 6:3341,
1987
[0278] Zoller, M. J. and Smith, M. Oligonucleotide-directed
mutagenesis using M13-derived vectors: an efficient and general
procedure for the production of point mutations in any fragment of
DNA. Nucleic Acid Research, 10: 6487-6500 (1982).
[0279] Zoller, M. J. and Smith, M. Oligonucleotide-directed
mutagenesis of DNA fragments cloned into M13 vectors. Methods in
Enzymology, 100:468-500 (1983).
[0280] Zoller, M. J. and Smith, M. Oligonucleotide-directed
Mutagenesis: A simple method using two oligonucleotide primers and
a single-stranded DNA template. DNA, 3: 479 (1984).
Sequence CWU 1
1
* * * * *