U.S. patent application number 10/435750 was filed with the patent office on 2003-10-09 for high affinity nucleic acid ligands of complement system proteins.
This patent application is currently assigned to GILEAD SCIENCES, INC.. Invention is credited to Biesecker, Gregory, Gold, Larry.
Application Number | 20030191084 10/435750 |
Document ID | / |
Family ID | 26696880 |
Filed Date | 2003-10-09 |
United States Patent
Application |
20030191084 |
Kind Code |
A1 |
Biesecker, Gregory ; et
al. |
October 9, 2003 |
High affinity nucleic acid ligands of complement system
proteins
Abstract
Methods are described for the identification and preparation of
high-affinity Nucleic Acid Ligands to Complement System Proteins.
Methods are described for the identification and preparation of
high affinity Nucleic Acid Ligands to Complement System Proteins
C1q, C3 and C5. Included in the invention are specific RNA ligands
to C1q, C3 and C5 identified by the SELEX method.
Inventors: |
Biesecker, Gregory;
(Boulder, CO) ; Gold, Larry; (Boulder,
CO) |
Correspondence
Address: |
Swanson & Bratschun, L. L. C.
1745 Shea Center Drive, Suite 330
Highlands Ranch
CO
80129
US
|
Assignee: |
GILEAD SCIENCES, INC.
|
Family ID: |
26696880 |
Appl. No.: |
10/435750 |
Filed: |
May 8, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10435750 |
May 8, 2003 |
|
|
|
10037282 |
Jan 3, 2002 |
|
|
|
6566343 |
|
|
|
|
10037282 |
Jan 3, 2002 |
|
|
|
09163025 |
Sep 29, 1998 |
|
|
|
6395888 |
|
|
|
|
09163025 |
Sep 29, 1998 |
|
|
|
09023228 |
Feb 12, 1998 |
|
|
|
6140490 |
|
|
|
|
09023228 |
Feb 12, 1998 |
|
|
|
PCT/US97/01739 |
Jan 30, 1997 |
|
|
|
PCT/US97/01739 |
Jan 30, 1997 |
|
|
|
08595335 |
Feb 1, 1996 |
|
|
|
10435750 |
May 8, 2003 |
|
|
|
10037986 |
Oct 18, 2001 |
|
|
|
10037986 |
Oct 18, 2001 |
|
|
|
09502344 |
Feb 10, 2000 |
|
|
|
6331398 |
|
|
|
|
09502344 |
Feb 10, 2000 |
|
|
|
09143190 |
Aug 27, 1998 |
|
|
|
6110900 |
|
|
|
|
09143190 |
Aug 27, 1998 |
|
|
|
08469609 |
Jun 6, 1995 |
|
|
|
5843653 |
|
|
|
|
08469609 |
Jun 6, 1995 |
|
|
|
08428964 |
Apr 25, 1995 |
|
|
|
08469609 |
Jun 6, 1995 |
|
|
|
08409442 |
Mar 24, 1995 |
|
|
|
5696249 |
|
|
|
|
08469609 |
Jun 6, 1995 |
|
|
|
08412110 |
Mar 27, 1995 |
|
|
|
5670637 |
|
|
|
|
07714131 |
Jun 10, 1991 |
|
|
|
07536428 |
Jun 11, 1990 |
|
|
|
Current U.S.
Class: |
514/44R ;
536/23.2 |
Current CPC
Class: |
C12N 15/1048 20130101;
A61P 9/10 20180101; C12N 15/115 20130101; C40B 40/00 20130101; A61K
38/00 20130101; C07K 14/472 20130101; A61P 13/12 20180101; A61P
25/28 20180101; C12N 2310/322 20130101; C12N 2310/151 20130101;
C07H 21/00 20130101; C12N 2310/315 20130101; A61P 21/00 20180101;
A61P 37/06 20180101; A61P 9/00 20180101 |
Class at
Publication: |
514/44 ;
536/23.2 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
We claim:
1. A method for treating a Complement System-mediated disease
comprising administering to a patient in need thereof a
pharmaceutically effective amount of a Nucleic Acid Ligand of a
Complement System Protein.
2. The method of claim 1 wherein said Nucleic Acid Ligand is
identified according to a method comprising: a) preparing a
candidate mixture of nucleic acids; b) contacting the candidate
mixture of nucleic acids with a Complement System Protein, wherein
nucleic acids having an increased affinity to said Complement
System Protein relative to the candidate mixture may be partitioned
from the remainder of the candidate mixture; c) partitioning the
increased affinity nucleic acids from the remainder of the
candidate mixture; and d) amplifying the increased affinity nucleic
acids to yield a mixture of nucleic acids enriched for nucleic acid
sequences with relatively higher affinity and specificity for
binding said Complement System Protein, wherein Nucleic Acid
Ligands of said Complement System Protein may be identified.
3. The method of claim 1 wherein said Complement System Protein is
selected from the group consisting of C1q, C3 and C5.
4. The method of claim 1 wherein said Complement System-mediated
disease is selected from the group consisting of myocardial
infarction and Alzheimer's disease.
5. A method of treating a Complement System-mediated disease
comprising administering to a patient in need thereof a
pharmaceutical agent which specifically treats said disease and
administering a Nucleic Acid Ligand C1q inhibitor in an amount
effective to inhibit activation of the Complement System.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/037,282, filed Jan. 3, 2002, which is a
continuation of U.S. patent application Ser. No. 09/163,025, filed
Sep. 29, 1998, now U.S. Pat. No. 6,395,888, which is a
continuation-in-part of U.S. patent application Ser. No.
09/023,228, filed Feb. 12, 1998, now U.S. Pat. No. 6,140,490, which
is a continuation-in-part of PCT/US97/01739 (International
Publication No. WO 97/28178), filed Jan. 30, 1997, which is a
continuation-in-part of U.S. patent. application Ser. No.
08/595,335, filed Feb. 1, 1996, now abandoned. This application is
also a continuation-in-part of U.S. patent application Ser. No.
10/037,986, filed Oct. 18, 2001, which is a continuation of U.S.
patent application Ser. No. 09/502,344, filed Feb. 10, 2000, now
U.S. Pat. No. 6,331,398, which is a continuation of U.S. Patent.
application Ser. No. 09/143,190, filed Aug. 27, 1998, now U.S. Pat.
No. 6,110,900, which is a continuation of U.S. patent application
Ser. No. 08/469,609, filed Jun. 6, 1995, now U.S. Pat. No.
5,843,653, which is a continuation of U.S. patent application Ser.
No. 08/428,964, filed Apr. 25, 1995, now abandoned. U.S. patent
application Ser. No. 08/469,609 is also a continuation of U.S.
patent application Ser. No. 08/409,442, filed Mar. 24, 1995, now
U.S. Pat. No. 5,696,249 and a continuation of U.S. patent
application Ser. No. 08/412,110, filed Mar. 27, 1995, now U.S. Pat.
No. 5,670,637. Ser. Nos. 08/428,964, 08/409,442, and 08/412,110 are
continuations of U.S. patent application Ser. No. 07/714,131, filed
Jun. 10, 1991, now U.S. Pat. No. 5,475,096, which is a
continuation-in-part application of U.S. patent application Ser.
No. 07/536,428, filed Jun. 11, 1990, now abandoned.
FIELD OF THE INVENTION
[0002] Described herein are methods for identifying and preparing
high-affinity Nucleic Acid Ligands to Complement System Proteins.
The method utilized herein for identifying such Nucleic Acid
Ligands is called SELEX.TM., an acronym for Systematic Evolution of
Ligands by EXponential enrichment. Described herein are methods for
identifying and preparing high-affinity Nucleic Acid Ligands to the
Complement System Proteins C1q, C3 and C5. This invention includes
high affinity Nucleic Acid Ligands of C1q, C3 and C5. Also
disclosed are RNA ligands of C1q, C3 and C5. Also disclosed are
Nucleic Acid Ligands that inhibit and/or activate the Complement
System. The oligonucleotides of the present invention are useful as
pharmaceuticals or diagnostic agents.
BACKGROUND OF THE INVENTION
[0003] The complement system comprises a set of at least 20 plasma
and membrane proteins that act together in a regulated cascade
system to attack extracellular forms of pathogens (Janeway et al.
(1994) Immunobiology: The Immune System in Health and Disease.
Current Biology Ltd, San Francisco, pp. 8:35-8:55; Morgan (1995)
Crit. Rev. in Clin Lab. Sci. 32(3):265-298). There are two distinct
enzymatic activation cascades, the classical and alternative
pathways, and a non-enzymatic pathway known as the membrane attack
pathway.
[0004] The classical pathway is usually triggered by an antibody
bound to a foreign particle. It comprises several components, C1,
C4, C2, C3 and C5 (listed by order in the pathway). Initiation of
the classical pathway of the Complement System occurs following
binding and activation of the first complement component (C1) by
both immune and non-immune activators (Cooper (1985) Adv. Immunol.
37:151). C1 comprises a calcium-dependent complex of components
C1q, C1r and C1s, and is activated through binding of the C1q
component. C1 q contains six identical subunits and each subunit
comprises three chains (the A, B and C chains). Each chain has a
globular head region which is connected to a collagen-like tail.
Binding and activation of C1q by antigen-antibody complexes occurs
through the C1q head group region. Numerous non-antibody C1q
activators, including proteins, lipids and nucleic acids (Reid et
al. (1993) The Natural Immune System: Humoral Factors. E. Sim, ed.
IRL Press, Oxford, p. 151) bind and activate through a distinct
site on the collagen-like stalk region.
[0005] Non-antibody C1q protein activators include C-reactive
protein (CRP) (Jiang et al. (1991) J. Immunol. 146:2324) and serum
amyloid protein (SAP) (Bristow et al. (1986) Mol. Immunol.
23:1045); these will activate C1q when aggregated by binding to
phospholipid or carbohydrate, respectively. Monomeric CRP or SAP do
not activate C1q. C1q is also activated through binding to
aggregated .beta.-amyloid peptide (Schultz et al. (1994) Neurosci.
Lett. 175:99; Snyder et al. (1994) Exp. Neurol. 128:136), a
component of plaques seen in Alzheimer's disease (Jiang et al.
(1994) J. Immunol. 152:5050; Eikelenboom and Stam (1982) Acta
Neuropathol (Berl) 57:239; Eikelenboom et al. (1989) Virchows Arch.
[B] 56:259; Rogers et al. (1992) Proc. Natl. Acad. Sci. USA
89:10016; Dietzschold et al. (1995) J. Neurol. Sci. 130:11). C1q
activation might also exacerbate the tissue damage associated with
Alzheimer's disease. These activators bind C1q on its collagen-like
region, distant from the head-group region where immunoglobulin
activators bind. Other proteins which bind the C1q collagen-like
region include collagen (Menzel et al. (1981) Biochim. Biophys.
Acta 670:265), fibronectin (Reid et al. (1984) Acta Pathol.
Microbiol. Immunol. Scand. Sect. C 92 (Suppl. 284):11), laminin
(Bohnsack et al. (1985) Proc. Natl. Acad. Sci. USA 82:3824),
fibrinogen and fibrin (Entwistle et al. (1988) Biochem. 27:507),
HIV rsgp41 (Stoiber et al. (1995) Mol. Immunol. 32:371), actin
(Nishioka et al. (1982) Biochem. Biophys. Res. Commun. 108:1307)
and tobacco glycoprotein (Koethe et al. (1995) J. Immunol.
155:826).
[0006] C1q also binds and can be activated by anionic carbohydrates
(Hughes-Jones et al. (1978) Immunology 34:459) including
mucopolysaccharides (Almeda et al. (1983) J. Biol. Chem. 258:785),
fucans (Blondin et al. (1994) Mol. Immunol. 31 :247), proteoglycans
(Silvestri et al. (1981) J. Biol. Chem. 256:7383), and by lipids
including lipopolysaccharide (LPS) (Zohair et al. (1989) Biochem.
J. 257:865; Stoiber et al. (1994) Eur. J. Immunol. 24:294). Both
DNA (Schravendijk and Dwek (1982) Mol. Immunol. 19:1179; Rosenberg
et al. (1988) J. Rheumatol 15:1091; Uwatoko et al. (1990) J.
Immunol. 144:3484) and RNA (Acton et al. (1993) J. Biol. Chem.
268:3530) can also bind and potentially activate C1q. Intracellular
components which activate C1q include cellular and subcellular
membranes (Linder (1981) J. Immunol. 126:648; Pinckard et al.
(1973) J. Immunol. 110: 1376; Storrs et al. (1981) J. Biol. Chem.
256:10924; Giclas et al. (1979) J. Immmunol. 122:146; Storrs et al.
(1983) J. Immunol. 131:416), intermediate filaments (Linder et al.
(1979) Nature 278:176) and actin (Nishioka et al. (1982) Biochem.
Biophys. Res. Commun. 108:1307). All of these interactions would
recruit the classical pathway for protection against bacterial (or
viral) infection, or as a response to tissue injury (Li et al.
(1994) J. Immunol. 152:2995) in the absence of antibody.
[0007] A binding site for non-antibody activators including CRP
(Jiang et al. (1991) J. Immunol. 146:2324), SAP (Ying et al. (1993)
J. Immunol. 150:169), .beta.-amyloid peptide (Newman (1994) Curr.
Biol. 4:462) and DNA (Jiang et al. (1992) J. Biol. Chem. 267:25597)
has been localized to the amino terminus of C1q A chain at residues
14-26. A synthetic peptide comprising this sequence effectively
inhibits both binding and activation. The peptide 14-26 contains
several basic residues and matches one of the heparin binding
motifs (Yabkowitz et al. (1989) J. Biol. Chem. 264:10888; Cardin et
al. (1989) Arteriosclerosis 9:21). The peptide is also highly
homologous with peptide 145-156 in collagen-tailed
acetylcholinesterase; this site is associated with heparin-sulfate
basement membrane binding (Deprez et al. (1995) J. Biol. Chem.
270:11043). A second C1q A chain site at residues 76-92 also might
be involved in weaker binding; this site is at the junction of the
globular head region and the collagen-like tail.
[0008] The second enzymatically activated cascade, known as the
alternative pathway, is a rapid, antibody-independent route for the
Complement System activation and amplification. The alternative
pathway comprises several components, C3, Factor B, and Factor D.
Activation of the alternative pathway occurs when C3b, a
proteolytic cleavage form of C3, is bound to an activating surface
such as a bacterium. Factor B is then bound to C3b, and cleaved by
Factor D to yield the active enzyme, Ba. The enzyme Ba then cleaves
more C3 to C3b, producing extensive deposition of C3b-Ba complexes
on the activating surface. When a second C3b is deposited, forming
a C3b-C3b-Ba complex, the enzyme can then cleave C5 and trigger
activation of the terminal pathway.
[0009] The non-enzymatic terminal pathway, also known as the
membrane attack pathway, comprises the components C5, C6, C7, C8
and C9. Activation of this membrane attack pathway results when the
C5 component is enzymatically cleaved by either the classical or
alternative pathway to yield the small C5a polypeptide (9 kDa) and
the large C5b fragment (200 kDa). The C5a polypeptide binds to a 7
transmembrane G-protein coupled receptor which was originally
described on leukocytes and is now known to be expressed on a
variety of tissues including hepatocytes (Haviland et al. (1995) J.
Immunol. 154:1861) and neurons (Gasque et al. (1997) Am. J. Pathol.
150:31). The C5a molecule is the primary chemotactic component of
the human Complement System and can trigger a variety of biological
responses including leukocyte chemotaxis, smooth muscle
contraction, activation of intracellular signal transduction
pathways, neutrophil-endothelial adhesion (Mulligan et al. (1997)
J. Immunol. 158:1857), cytokine and lipid mediator release and
oxidant formation. The larger C5b fragment binds sequentially to
later components to form the C5b-9 membrane attack complex (MAC).
The C5b-9 MAC can directly lyse erythrocytes, and in greater
quantities is lytic for leukocytes and is damaging to tissues such
as muscle, epithelial and endothelial cells (Stahl et al. (1997)
Circ. Res. 76:575). In sublytic amounts the MAC can stimulate
upregulation of adhesion molecules, intracellular calcium increase
and cytokine release (Ward (1996) Am. J. Pathol. 149:1079). In
addition, the C5b-9 MAC can stimulate cells such as endothelial
cells and platelets without causing cell lysis. The non-lytic
effects of C5a and the C5b-9 MAC are sometimes quite similar.
[0010] The Complement System has an important role in defense
against bacterial and viral infection, and possibly in immune
surveillance against tumors. This is demonstrated most clearly in
humans who are deficient in complement components. Individuals
deficient in early components (C1, C4, C2 or C3) suffer from
recurrent infections, while individuals deficient in late
components (C5 through C9) are susceptible to nisseria infection.
Complement classical pathway is activated on bacteria by
antibodies, by binding of CRP or SAP, or by direct activation
through LPS. Complement alternative pathway is activated through
binding of C3 to the cell coat. Complement can be activated by
viruses through antibodies, and can also be activated on viral
infected cells because these are recognized as foreign. In a
similar way, transformed cells can be recognized as foreign and can
be lysed by the Complement System or targeted for immune
clearance.
[0011] Activation of the Complement System can and has been used
for therapeutic purposes. Antibodies which were produced against
tumor cells were then used to activate the Complement System and
cause tumor rejection. Also, the Complement System is used together
with polyclonal or monoclonal antibodies to eliminate unwanted
lymphocytes. For example, anti-lymphocyte globulin or monoclonal
anti-T-cell antibodies are used prior to organ transplantation to
eliminate lymphocytes which would otherwise mediate rejection.
[0012] Although the Complement System has an important role in the
maintenance of health, it has the potential to cause or contribute
to disease. The Complement System has been implicated in numerous
renal, rheumatological, neurological, dermatological,
hematological, vascular/pulmonary, allergy, infectious,
biocompatibility/shock and other diseases or conditions (Morgan
(1995) Crit. Rev. in Clin Lab. Sci. 32(3 :265-298; Matis and
Rollins (1995) Nature Medicine 1(8):839-842). The Complement System
is not necessarily the only cause of the disease state, but it may
be one of several factors, each of which contributes to
pathogenesis.
[0013] Several pharmaceuticals have been developed that inhibit the
Complement System in vivo, however, many cause toxicity or are poor
inhibitors (Morgan (1995) Crit. Rev. in Clin Lab. Sci.
32(3):265-298). Heparins, K76COOH and nafamstat mesilate have been
shown to be effective in animal studies (Morgan (1995) Crit. Rev.
in Clin Lab. Sci. 32(3):265-298). Recombinant forms of naturally
occurring inhibitors of the Complement System have been developed
or are under consideration, and these include the membrane
regulatory proteins Complement Receptor 1 (CR1), Decay Accelerating
Factor (DAF), Membrane Cofactor Protein (MCP) and CD59.
[0014] C5 is an attractive target for the development of a
Complement System inhibitor, as both the classical and alternative
pathways converge at component C5 (Matis and Rollins (1995) Nature
Medicine 1(8):839-842). In addition, inhibition of C5 cleavage
blocks both the C5a and the C5b effects on leukocytes and on tissue
such as endothelial cells (Ward (1996) Am. J. Pathol. 149:1079);
thus C5 inhibition can have therapeutic benefits in a variety of
diseases and situations, including lung inflammation (Mulligan et
al. (1998) J. Clin. Invest. 98:503), extracorporeal complement
activation (Rinder et al. (1995) J. Clin. Invest. 96:1564) or
antibody-mediated complement activation (Biesecker et al. (1989) J.
Immunol. 142:2654). Matis and Rollins ((1995) Nature Medicine
1(8):839-842) have developed C5-specific monoclonal antibodies as
an anti-inflammatory biopharmaceutical. Both C5a and the MAC have
been implicated in acute and chronic inflammation associated with
human disease, and their role in disease states has been confirmed
in animal models. C5a is required for complement- and
neutrophil-dependent lung vascular injury (Ward (1997) J. Lab.
Clin. Med. 129:400; Mulligan et al. (1998) J. Clin. Invest.
98:503), and is associated with neutrophil and platelet activation
in shock and in burn injury (Schmid et al. (1997) Shock 8:119). The
MAC mediates muscle injury in acute autoimmune myasthenia gravis
(Biesecker and Gomez (1989) J. Immunol. 142:2654), organ rejection
in transplantation (Baldwin et al. (1995) Transplantation 59:797;
Brauer et al. (1995) Transplantation 59:288; Takahashi et al.
(1997) Immunol. Res. 16:273) and renal injury in autoimmune
glomerulonephritis (Biesecker (1981) J. Exp. Med. 39:1779; Nangaku
(1997) Kidney Int. 52:1570). Both C5a and the MAC are implicated in
acute myocardial ischemia (Homeister and Lucchesi (1994) Annu. Rev.
Pharmacol. Toxicol. 34:17), acute (Bednar et al. (1997) J.
Neurosurg. 86:139) and chronic CNS injury (Morgan (1997) Exp. Clin.
Immunogenet. 14:19), leukocyte activation during extracorporeal
circulation (Sun et al. (1995) Nucleic Acids Res. 23:2909; Spycher
and Nydegger (1995) Infushionsther. Transfusionsmed. 22:36) and in
tissue injury associated with autoimmune diseases including
arthritis and lupus (Wang et al. (1996) Immunology 93:8563). Thus,
inhibiting cleavage of C5 prevents generation of two potentially
damaging activities of the Complement System. Inhibiting C5a
release eliminates the major Complement System chemotactic and
vasoactive activity, and inhibiting C5b formation blocks assembly
of the cytolytic C5b-9 MAC. Furthermore, inhibition of C5 prevents
injury by the Complement System while leaving intact important
Complement System defense and clearance mechanisms, such as C3 and
C1q phagocytic activity, clearance of immune complexes and the
innate immune response (Carrol (1998) Ann. Rev. Immunol.
16:545).
[0015] C3 is an attractive target for the development of a
Complement System inhibitor, as it is common to both pathways.
Inhibition of C3 using recombinant versions of a natural inhibitors
(Kalli et al. (1994) Springer Semin. Immunopathol. 15:417) can
prevent cell-mediated tissue injury (Mulligan et al. (1992) J.
Immunol. 148:1479) and this has been shown to have therapeutic
benefit in diseases such as myocardial infarction (Weisman et al.
(1990) Science 249:146) and liver ischemia/reperfusion
(Chavez-Cartaya et al. (1995) Transplantation 59:1047). Controlling
C3 limits most biological activities of the Complement System. Most
natural inhibitors, including DAF, MCP, CR1 and Factor H target
C3.
[0016] SELEX.TM.
[0017] A method for the in vitro evolution of Nucleic Acid
molecules with highly specific binding to target molecules has been
developed. This method, Systematic Evolution of Ligands by
EXponential enrichment, termed the SELEX process, is described in
U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990,
entitled "Systematic Evolution of Ligands by Exponential
Enrichment," now abandoned; U.S. patent application Ser. No.
07/714,131, filed Jun. 10, 1991, entitled "Nucleic Acid Ligands,"
now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No.
07/931,473, filed Aug. 17, 1992, entitled "Methods for Identifying
Nucleic Acid Ligands," now U.S. Pat. No. 5,270,163 (see also WO
91/19813), each of which is herein specifically incorporated by
reference in its entirety. Each of these applications, collectively
referred to herein as the SELEX Patent Applications, describes a
fundamentally novel method for making a Nucleic Acid Ligand to any
desired Target molecule.
[0018] The SELEX method involves selection from a mixture of
candidate oligonucleotides and step-wise iterations of binding,
partitioning and amplification, using the same general selection
scheme, to achieve virtually any desired criterion of binding
affinity and selectivity. Starting from a mixture of Nucleic Acids,
preferably comprising a segment of randomized sequence, the SELEX
method includes steps of contacting the mixture with the Target
under conditions favorable for binding, partitioning unbound
Nucleic Acids from those Nucleic Acids which have bound
specifically to Target molecules, dissociating the Nucleic
Acid-Target complexes, amplifying the Nucleic Acids dissociated
from the Nucleic Acid-Target complexes to yield a ligand-enriched
mixture of Nucleic Acids, then reiterating the steps of binding,
partitioning, dissociating and amplifying through as many cycles as
desired to yield highly specific, high affinity Nucleic Acid
Ligands to the Target molecule.
[0019] The basic SELEX method has been modified to achieve a number
of specific objectives. For example, U.S. patent application Ser.
No. 07/960,093, filed Oct. 14, 1992, entitled "Method for Selecting
Nucleic Acids on the Basis of Structure," now abandoned (see also
U.S. Pat. No. 5,707,796), describes the use of the SELEX method in
conjunction with gel electrophoresis to select Nucleic Acid
molecules with specific structural characteristics, such as bent
DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17,
1993, entitled "Photoselection of Nucleic Acid Ligands," now
abandoned, (see also U.S. Pat. No. 5,763,177) describes a
SELEX-based method for selecting Nucleic Acid Ligands containing
photoreactive groups capable of binding and/or photocrosslinking to
and/or photoinactivating a Target molecule. U.S. patent application
Ser. No. 08/134,028, filed Oct. 7, 1993, entitled "High-Affinity
Nucleic Acid Ligands That Discriminate Between Theophylline and
Caffeine," now abandoned (see also U.S. Pat. No. 5,580,737),
describes a method for identifying highly specific Nucleic Acid
Ligands able to discriminate between closely related molecules,
termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564,
filed Oct. 25, 1993, entitled "Systematic Evolution of Ligands by
EXponential Enrichment: Solution SELEX," now abandoned, (see also
U.S. Pat. No. 5,567,588) and U.S. patent application Ser. No.
08/792,075, filed Jan. 31, 1997, entitled "Flow Cell SELEX," now
U.S. Pat. No. 5,861,254, describe SELEX-based methods which achieve
highly efficient partitioning between oligonucleotides having high
and low affinity for a Target molecule. U.S. patent application
Ser. No. 07/964,624, filed Oct. 21, 1992, entitled "Nucleic Acid
Ligands to HIV-RT and HIV-1 Rev," now U.S. Pat. No. 5,496,938,
describes methods for obtaining improved Nucleic Acid Ligands after
the SELEX process has been performed. U.S. patent application Ser.
No. 08/400,440, filed Mar. 8, 1995, entitled "Systematic Evolution
of Ligands by EXponential Enrichment: Chemi-SELEX," now U.S. Pat.
No. 5,705,337, describes methods for covalently linking a ligand to
its Target.
[0020] The SELEX method encompasses the identification of
high-affinity Nucleic Acid Ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or improved delivery characteristics. Examples of
such modifications include chemical substitutions at the ribose
and/or phosphate and/or base positions. SELEX-identified Nucleic
Acid Ligands containing modified nucleotides are described in U.S.
patent application Ser. No. 08/117,991, filed Sep. 8, 1993,
entitled "High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides," now abandoned, (see also U.S. Pat. No. 5,660,985)
that describes oligonucleotides containing nucleotide derivatives
chemically modified at the 5- and 2'-positions of pyrimidines. U.S.
patent application Ser. No. 08/134,028, now U.S. Pat. No.
5,580,737, supra, describes highly specific Nucleic Acid Ligands
containing one or more nucleotides modified with 2'-amino
(2'-NH.sub.2), 2'-fluoro (2'-F), and/or 2'-O-methyl (2'-OMe). U.S.
patent application Ser. No. 08/264,029, filed Jun. 22, 1994,
entitled "Novel Method of Preparation of Known and Novel 2'
Modified Nucleosides by Intramolecular Nucleophilic Displacement,"
now abandoned, describes oligonucleotides containing various
2'-modified pyrimidines.
[0021] The SELEX method encompasses combining selected
oligonucleotides with other selected oligonucleotides and
non-oligonucleotide functional units as described in U.S. patent
application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled
"Systematic Evolution of Ligands by Exponential Enrichment:
Chimeric SELEX," now U.S. Pat. No. 5,637,459 and U.S. patent
application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Blended
SELEX," now U.S. Pat. No. 5,683,867, respectively. These
applications allow the combination of the broad array of shapes and
other properties, and the efficient amplification and replication
properties, of oligonucleotides with the desirable properties of
other molecules. Each of the above described patent applications
which describe modifications of the basic SELEX procedure are
specifically incorporated by reference herein in their
entirety.
BRIEF SUMMARY OF THE INVENTION
[0022] The present invention includes methods of identifying and
producing Nucleic Acid Ligands to Complement System Proteins and
homologous proteins and the Nucleic Acid Ligands so identified and
produced. By homologous proteins it is meant a degree of amino acid
sequence identity of 80% or more. Exemplified herein is a method of
identifying and producing Nucleic Acid Ligands to C1q, C3 and C5,
and the Nucleic Acid Ligands so produced. Nucleic Acid Ligand
sequences are provided that are capable of binding specifically to
C1q, C3 and C5. In particular, RNA sequences are provided that are
capable of binding specifically the C1q, C3 and C5. Specifically
included in the invention are the RNA ligand sequences shown in
Tables 2-6, 8, 10 and 12-13 and FIGS. 5A-B (SEQ ID NOS: 5-155 and
160-196). Also included in the invention are Nucleic Acid Ligands
that inhibit the function of proteins of the Complement System.
Specifically included in the invention herein are RNA ligands that
inhibit the function of C1 q, C3 and C5. Also included are Nucleic
Acid Ligands that inhibit and/or activate the Complement
System.
[0023] Further included in this invention is a method of
identifying Nucleic Acid Ligands and Nucleic Acid Ligand sequences
to Complement System Proteins comprising the steps of (a) preparing
a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate
Mixture of Nucleic Acids with a Complement System Protein, (c)
partitioning between members of said Candidate Mixture on the basis
of affinity to said Complement System Protein, and (d) amplifying
the selected molecules to yield a mixture of Nucleic Acids enriched
for Nucleic Acid sequences with a relatively higher affinity for
binding to said Complement System Protein.
[0024] Also included in this invention is a method of identifying
Nucleic Acid Ligands and Nucleic Acid Ligand sequences to C1q, C3
and C5, comprising the steps of (a) preparing a Candidate Mixture
of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic
Acids with C1q, C3 or C5, (c) partitioning between members of said
Candidate Mixture on the basis of affinity to C1q, C3 or C5, and
(d) amplifying the selected molecules to yield a mixture of Nucleic
Acids enriched for Nucleic Acid sequences with a relatively higher
affinity for binding to C1q, C3 or C5.
[0025] More specifically, the present invention includes the RNA
ligands to C1q, C3 and C5 identified according to the
above-described method, including RNA ligands to C1q, including
those ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ
ID NOS: 84-155), RNA ligands to C3, including those sequences shown
in Table 3 (SEQ ID NOS:21-46), and RNA ligands to C5, including
those sequences shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ
ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID
NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID
NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193). Also included
are RNA ligands to C1q, C3 and C5 that are substantially homologous
to any of the given ligands and that have substantially the same
ability to bind C1q, C3 or C5, and inhibit the function of C1q, C3
or C5. Further included in this invention are Nucleic Acid Ligands
to C1q, C3 and C5 that have substantially the same structural form
as the ligands presented herein and that have substantially the
same ability to bind C1q, C3 or C5 and inhibit the function of C1q,
C3 or C5.
[0026] The present invention also includes modified nucleotide
sequences based on the RNA ligands identified herein and mixtures
of the same.
BRIEF DESCRIPTION OF THE FIGURES
[0027] FIG. 1 shows the results of an inhibition assay in which
2'-F RNA ligands C 12 (SEQ ID NO:59), A6 (SEQ ID NO:48), K7 (SEQ ID
NO:50), C9 (SEQ ID NO:58), E5c (SEQ ID NO:47) and F8 (SEQ ID NO:49)
to human C5 were incubated with antibody-coated sheep erythrocytes
and whole human serum. The results are presented as optical density
(OD) versus concentration of ligand in nM.
[0028] FIG. 2 shows the % C5a generation as a function of
concentration of clone C6 (SEQ ID NO:51).
[0029] FIG. 3A shows a sequencing gel of 5'-kinase-labeled clone C6
(SEQ ID NO:51) after alkaline hydrolysis or digestion with T.sub.1
nuclease. The 3'-sequence (5'-end labeled) is aligned with the
alkaline hydrolysis ladder. On the left is the T.sub.1 ladder and
on the right are RNA selected with 5.times. and 1.times.
concentrations of C5. The boundary where removal of a base
eliminates binding is shown by the arrow. The asterisk shows a G
which is hypersensitive to T.sub.1.
[0030] FIG. 3B shows a sequencing gel of 3'-pCp-ligated clone C6
after alkaline hydrolysis or digestion with T.sub.1 nuclease. The
5'-sequence (3'-end-labled) is aligned with the alkaline hydrolysis
ladder. The T.sub.1 and protein lanes, boundary and hypersensitive
G nucleotides are as described for FIG. 3A.
[0031] FIG. 4 shows the results of the 2'-O-methyl interference
assay. Positions where 2'-OH purines can be substituted with
2'-O-methyl were determined from binding interference. Plotted is
the ratio of (the intensity of bands selected by protein)/(the band
intensity for oligonucleotides not selected by protein) with a
linear curve fit (open circles). The same ratio for mixed
2'-OH:2'-OMe nucleotides is also plotted (closed circles).
[0032] FIG. 5A shows the proposed structure of the 38 mer truncate
(SEQ ID NO:160) of clone C6 (SEQ ID NO:51) together with
alternative bases.
[0033] FIG. 5B shows the 2'-O-methyl substitution pattern of a 38
mer truncate (SEQ ID NO: 193 of clone C6 (SEQ ID NO:51). Positions
where 2'-OMe substitutions can be made are shown in bold. Positions
which must be 2'-OH are underlined.
[0034] FIG. 6 shows the % hemolysis verses concentration of nucleic
acid ligand (.mu.m) for a 38 mer truncate of clone YL-13 (SEQ ID
NO: 175) without 2'-OMe substitution (SEQ ID NO:194; open circles),
with a 2'-OMe substitution at position 20 (SEQ ID NO:195; closed
triangles) and with 2'-OMe substitutions at positions 2, 7, 8, 13,
14, 15, 20, 21, 22, 26, 27, 28, 36 and 38 (SEQ ID NO:196; closed
circles).
DETAILED DESCRIPTION OF THE INVENTION
[0035] This application describes Nucleic Acid Ligands to
Complement System Proteins identified generally according to the
method known as SELEX. As stated earlier, the SELEX technology is
described in detail in the SELEX Patent Applications which are
incorporated herein by reference in their entirety. Certain terms
used to describe the invention herein are defined as follows:
[0036] "Nucleic Acid Ligand" as used herein is a non-naturally
occurring Nucleic Acid having a desirable action on a Target. A
desirable action includes, but is not limited to, binding of the
Target, catalytically changing the Target, reacting with the Target
in a way which modifies/alters the Target or the functional
activity of the Target, covalently attaching to the Target as in a
suicide inhibitor, and facilitating the reaction between the Target
and another molecule. In the preferred embodiment, the desirable
action is specific binding to a Target molecule, such Target
molecule being a three dimensional chemical structure other than a
polynucleotide that binds to the Nucleic Acid Ligand through a
mechanism which predominantly depends on Watson/Crick base pairing
or triple helix binding, wherein the Nucleic Acid Ligand is not a
Nucleic Acid having the known physiological function of being bound
by the Target molecule. Nucleic Acid Ligands include Nucleic Acids
that are identified from a Candidate Mixture of Nucleic Acids, said
Nucleic Acid Ligand being a ligand of a given Target by the method
comprising: a) contacting the Candidate Mixture with the Target,
wherein Nucleic Acids having an increased affinity to the Target
relative to the Candidate Mixture may be partitioned from the
remainder of the Candidate Mixture; b) partitioning the increased
affinity Nucleic Acids from the remainder of the Candidate Mixture;
and c) amplifying the increased affinity Nucleic Acids to yield a
ligand-enriched mixture of Nucleic Acids.
[0037] "Candidate Mixture" is a mixture of Nucleic Acids of
differing sequence from which to select a desired ligand. The
source of a Candidate Mixture can be from naturally-occurring
Nucleic Acids or fragments thereof, chemically synthesized Nucleic
Acids, enzymatically synthesized Nucleic Acids or Nucleic Acids
made by a combination of the foregoing techniques. In a preferred
embodiment, each Nucleic Acid has fixed sequences surrounding a
randomized region to facilitate the amplification process.
[0038] "Nucleic Acid" means both DNA, RNA, single-stranded or
double-stranded and any chemical modifications thereof.
Modifications include, but are not limited to, those which provide
other chemical groups that incorporate additional charge,
polarizability, hydrogen bonding, electrostatic interaction, and
fluxionality to the Nucleic Acid Ligand bases or to the Nucleic
Acid Ligand as a whole. Such modifications include, but are not
limited to, 2'-position sugar modifications, 5-position pyrimidine
modifications, 8-position purine modifications, modifications at
exocyclic amines, substitution of 4-thiouridine, substitution of
5-bromo or 5-iodo-uracil, backbone modifications, methylations,
unusual base-pairing combinations such as the isobases isocytidine
and isoguanidine and the like. Modifications can also include 3'
and 5' modifications such as capping.
[0039] "SELEX.TM." methodology involves the combination of
selection of Nucleic Acid Ligands which interact with a Target in a
desirable manner, for example binding to a protein, with
amplification of those selected Nucleic Acids. Iterative cycling of
the selection/amplification steps allows selection of one or a
small number of Nucleic Acids which interact most strongly with the
Target from a pool which contains a very large number of Nucleic
Acids. Cycling of the selection/amplification procedure is
continued until a selected goal is achieved. In the present
invention, the SELEX methodology is employed to obtain Nucleic Acid
Ligands to C1q, C3 and C5. The SELEX methodology is described in
the SELEX Patent Applications.
[0040] "Target" means any compound or molecule of interest for
which a ligand is desired. A Target can be a protein, peptide,
carbohydrate, polysaccharide, glycoprotein, hormone, receptor,
antigen, antibody, virus, substrate, metabolite, transition state
analog, cofactor, inhibitor, drug, dye, nutrient, growth factor,
etc. without limitation. In this application, the Target is a
Complement System Protein, preferably C1q, C3 and C5.
[0041] "Complement System Protein" means any protein or component
of the Complement System including, but not limited to, C1, C1q,
C1r, C1s, C2, C3, C3a, C3b, C4, C4a, C5, C5a, C5b, C6, C7, C8, C9,
Factor B (B), Factor D (D), Factor H (H) and receptors thereof, and
other soluble and membrane inhibitors/control proteins.
[0042] "Complement System" is a set of plasma and membrane proteins
that act together in a regulated cascade system to attack
extracellular forms of pathogens or infected or transformed cells,
and in clearance of immune reactants or cellular debris. The
Complement System can be activated spontaneously on certain
pathogens or by antibody binding to the pathogen. The pathogen
becomes coated with Complement System Proteins (opsonized) for
uptake and destruction. The pathogen can also be directly lysed and
killed. Similar mechanisms target infected, transformed or damaged
cells. The Complement System also participates in clearance of
immune and cellular debris.
[0043] The SELEX process is described in U.S. patent application
Ser. No. 07/536,428, filed Jun. 11, 1990, entitled "Systematic
Evolution of Ligands by EXponential Enrichment," now abandoned;
U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991,
entitled "Nucleic Acid Ligands," now U.S. Pat. No. 5,475,096; U.S.
patent application Ser. No. 07/931,473, filed Aug. 17, 1992,
entitled "Methods for Identifying Nucleic Acid Ligands," now U.S.
Pat. No. 5,270,163 (see also WO 91/19813). These applications, each
specifically incorporated herein by reference, are collectively
called the SELEX Patent Applications.
[0044] In its most basic form, the SELEX process may be defined by
the following series of steps:
[0045] 1) A Candidate Mixture of Nucleic Acids of differing
sequence is prepared. The Candidate Mixture generally includes
regions of fixed sequences (i.e., each of the members of the
Candidate Mixture contains the same sequences in the same location)
and regions of randomized sequences. The fixed sequence regions are
selected either: (a) to assist in the amplification steps described
below, (b) to mimic a sequence known to bind to the Target, or (c)
to enhance the concentration of a given structural arrangement of
the Nucleic Acids in the Candidate Mixture. The randomized
sequences can be totally randomized (i.e., the probability of
finding a base at any position being one in four) or only partially
randomized (e.g., the probability of finding a base at any location
can be selected at any level between 0 and 100 percent).
[0046] 2) The Candidate Mixture is contacted with the selected
Target under conditions favorable for binding between the Target
and members of the Candidate Mixture. Under these circumstances,
the interaction between the Target and the Nucleic Acids of the
Candidate Mixture can be considered as forming Nucleic Acid-Target
pairs between the Target and those Nucleic Acids having the
strongest affinity for the Target.
[0047] 3) The Nucleic Acids with the highest affinity for the
Target are partitioned from those Nucleic Acids with lesser
affinity to the Target. Because only an extremely small number of
sequences (and possibly only one molecule of Nucleic Acid)
corresponding to the highest affinity Nucleic Acids exist in the
Candidate Mixture, it is generally desirable to set the
partitioning criteria so that a significant amount of the Nucleic
Acids in the Candidate Mixture (approximately 5-50%) are retained
during partitioning.
[0048] 4) Those Nucleic Acids selected during partitioning as
having the relatively higher affinity to the Target are then
amplified to create a new Candidate Mixture that is enriched in
Nucleic Acids having a relatively higher affinity for the
Target.
[0049] 5) By repeating the partitioning and amplifying steps above,
the newly formed Candidate Mixture contains fewer and fewer weakly
binding sequences, and the average degree of affinity of the
Nucleic Acids to the Target will generally increase. Taken to its
extreme, the SELEX process will yield a Candidate Mixture
containing one or a small number of unique Nucleic Acids
representing those Nucleic Acids from the original Candidate
Mixture having the highest affinity to the Target molecule.
[0050] The SELEX Patent Applications describe and elaborate on this
process in great detail. Included are Targets that can be used in
the process; methods for partitioning Nucleic Acids within a
Candidate Mixture; and methods for amplifying partitioned Nucleic
Acids to generate enriched Candidate Mixture. The SELEX Patent
Applications also describe ligands obtained to a number of target
species, including both protein Targets where the protein is and is
not a Nucleic Acid binding protein.
[0051] The SELEX method further encompasses combining selected
Nucleic Acid Ligands with lipophilic or Non-Immunogenic, High
Molecular Weight compounds in a diagnostic or therapeutic complex
as described in U.S. patent application Ser. No. 08/434,465, filed
May 4, 1995, entitled "Nucleic Acid Ligand Complexes," now U.S.
Pat. No. 6,011,020. VEGF Nucleic Acid Ligands that are associated
with a Lipophilic Compound, such as diacyl glycerol or dialkyl
glycerol, in a diagnostic or therapeutic complex are described in
U.S. patent application Ser. No. 08/739,109, filed Oct. 25, 1996,
entitled "Vascular Endothelial Growth Factor (VEGF) Nucleic Acid
Ligand Complexes," now U.S. Pat. No. 5,859,228. VEGF Nucleic Acid
Ligands that are associated with a Lipophilic Compound, such as a
glycerol lipid, or a Non-Immunogenic, High Molecular Weight
Compound, such as polyalkylene glycol, are further described in
U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997,
entitled "Vascular Endothelial Growth Factor (VEGF) Nucleic Acid
Ligand Complexes," now U.S. Pat. No. 6,051,698. VEGF Nucleic Acid
Ligands that are associated with a Non-Immunogenic, High Molecular
Weight compound or a lipophilic compound are also further described
in PCT/US97/18944, filed Oct. 17, 1997, entitled "Vascular
Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes."
Each of the above described patent applications which describe
modifications of the basic SELEX procedure are specifically
incorporated by reference herein in their entirety.
[0052] Certain embodiments of the present invention provide a
complex comprising one or more Nucleic Acid Ligands to a Complement
System Protein covalently linked with a Non-Immunogenic, High
Molecular Weight compound or lipophilic compound. A complex as used
herein describes the molecular entity formed by the covalent
linking of the Nucleic Acid Ligand of a Complement System Protein
to a Non-Immunogenic, High Molecular Weight compound. A
Non-Immunogenic, High Molecular Weight compound is a compound
between approximately 100 Da to 1,000,000 Da, more preferably
approximately 1000 Da to 500,000 Da, and most preferably
approximately 1000 Da to 200,000 Da, that typically does not
generate an immunogenic response. For the purposes of this
invention, an immunogenic response is one that causes the organism
to make antibody proteins. In one preferred embodiment of the
invention, the Non-Immunogenic, High Molecular Weight compound is a
polyalkylene glycol. In the most preferred embodiment, the
polyalkylene glycol is polyethylene glycol (PEG). More preferably,
the PEG has a molecular weight of about 10-80K. Most preferably,
the PEG has a molecular weight of about 20-45K. In certain
embodiments of the invention, the Non-Immunogenic, High Molecular
Weight compound can also be a Nucleic Acid Ligand.
[0053] Another embodiment of the invention is directed to complexes
comprised of a Nucleic Acid Ligand to a Complement System Protein
and a lipophilic compound. Lipophilic compounds are compounds that
have the propensity to associate with or partition into lipid
and/or other materials or phases with low dielectric constants,
including structures that are comprised substantially of lipophilic
components. Lipophilic compounds include lipids as well as
non-lipid containing compounds that have the propensity to
associate with lipids (and/or other materials or phases with low
dielectric constants). Cholesterol, phospholipid, and glycerol
lipids, such as dialkyl glycerol, diacyl glycerol, and glycerol
amide lipids are further examples of lipophilic compounds. In a
preferred embodiment, the lipophilic compound is a glycerol
lipid.
[0054] The Non-Immunogenic, High Molecular Weight compound or
lipophilic compound may be covalently bound to a variety of
positions on the Nucleic Acid Ligand to a Complement System
Protein, such as to an exocyclic amino group on the base, the
5-position of a pyrimidine nucleotide, the 8-position of a purine
nucleotide, the hydroxyl group of the phosphate, or a hydroxyl
group or other group at the 5' or 3' terminus of the Nucleic Acid
Ligand to a Complement System Protein. In embodiments where the
lipophilic compound is a glycerol lipid, or the Non-Immunogenic,
High Molecular Weight compound is polyalkylene glycol or
polyethylene glycol, preferably the Non-Immunogenic, High Molecular
Weight compound is bonded to the 5' or 3' hydroxyl of the phosphate
group thereof. In the most preferred embodiment, the lipophilic
compound or Non-Immunogenic, High Molecular Weight compound is
bonded to the 5' hydroxyl of the phosphate group of the Nucleic
Acid Ligand. Attachment of the Non-Immunogenic, High Molecular
Weight compound or lipophilic compound to the Nucleic Acid Ligand
of the Complement System Protein can be done directly or with the
utilization of linkers or spacers.
[0055] A linker is a molecular entity that connects two or more
molecular entities through covalent bonds or non-covalent
interactions, and can allow spatial separation of the molecular
entities in a manner that preserves the functional properties of
one or more of the molecular entities. A linker can also be
referred to as a spacer.
[0056] The complex comprising a Nucleic Acid Ligand to a Complement
System Protein and a Non-Immunogenic, High Molecular Weight
compound or lipophilic compound can be further associated with a
lipid construct. Lipid constructs are structures containing lipids,
phospholipids, or derivatives thereof comprising a variety of
different structural arrangements which lipids are known to adopt
in aqueous suspension. These structures include, but are not
limited to, lipid bilayer vesicles, micelles, liposomes, emulsions,
lipid ribbons or sheets, and may be complexed with a variety of
drugs and components which are known to be pharmaceutically
acceptable. In a preferred embodiment, the lipid construct is a
liposome. The preferred liposome is unilamellar and has a relative
size less than 200 nm. Common additional components in lipid
constructs include cholesterol and alpha-tocopherol, among others.
The lipid constructs may be used alone or in any combination which
one skilled in the art would appreciate to provide the
characteristics desired for a particular application. In addition,
the technical aspects of lipid constructs and liposome formation
are well known in the art and any of the methods commonly practiced
in the field may be used for the present invention.
[0057] The methods described herein and the Nucleic Acid Ligands
identified by such methods are useful for both therapeutic and
diagnostic purposes. Therapeutic uses include the treatment or
prevention of diseases or medical conditions in human patients,
specifically diseases or conditions caused by activation of the
Complement System. The Complement System does not have to be the
only cause of the disease state, but it may be one of several
factors, each of which contributes to pathogenesis. Such diseases
or conditions include, but are not limited to, renal diseases, such
as lupus nephritis and membranoproliferative glomerulonephritis
(MPGN), membranous nephritis, IgA nephropathy; rheumatological
diseases, such as rheumatoid arthritis, systemic lupus
erythematosus (SLE), Behcet's syndrome, juvenile rheumatoid
arthritis, Sjogren's syndrome and systemic sclerosis; neurological
diseases, such as myasthenia gravis, multiple sclerosis, cerebral
lupus, Guillain-Barr syndrome and Alzheimer's disease;
dermatological diseases, such as Pemphigus/pemphigoid, phototoxic
reactions, vasculitis and thermal bums; hematological diseases,
such as paroxysmal nocturnal hemoglobinuria (PNH), hereditary
erythroblastic multinuclearity with positive acidified serum lysis
test (HEMPAS) and idiopathic thrombocytopenic purpura (ITP);
biocompatibility/shock diseases, such as post-bypass syndrome,
adult respiratory distress syndrome (ARDS), catheter reactions,
anaphylaxis, transplant rejection, pre-eclampsia, hemodialysis and
platelet storage; vascular/pulmonary diseases, such as
atherosclerosis, myocardial infarction, stroke and reperfusion
injury; allergies, such as anaphylaxis, asthma and skin reactions;
infection, such as septic shock, viral infection and bacterial
infection; and other conditions, such as atheroma, bowel
inflammation, thyroiditis, infertility, paroxysmal nocturnal
hemoglobinuria (PNH) and hemolytic anemia.
[0058] The Complement System can be inhibited at several points in
the activation cascade by targeting different components.
Inhibition of C1q would block the initiation by either antibody or
non-antibody mechanisms. Antibodies activate C1q in many diseases
including SLE, myasthenia gravis and arthritis. Non-antibody
Complement System activation occurs in many diseases including
Alzheimer's disease, myocardial infarction and septic shock.
Blocking C1q could prevent the complement-mediated tissue injury in
these diseases.
[0059] The Complement can also be activated in the absence of
antibodies directly at the C3 stage. Activating surfaces including
bacteria, virus particles or damaged cells can trigger Complement
System activation that does not require C1q. An inhibitor of C3
could prevent Complement System activation and damage in these
situations.
[0060] In other instances the inhibition of C5 is most useful.
Activation of the Complement System by either C1q or C3 mechanisms
both lead to activation of C5, so that inhibition of C5 could
prevent Complement System-mediated damage by either pathway.
However, both C1q and C3 are important in normal defense against
microorganisms and in clearance of immune components and damaged
tissue, while C5 is mostly dispensable for this function.
Therefore, C5 can be inhibited either for a short term or a long
term and the protective role of Complement System would not be
compromised, whereas long term inhibition of C1q or C3 is not
desirable. Finally, the C5 fragments C5a and C5b directly cause the
majority of tissue injury and disease associated with unwanted
Complement System activation. Therefore, inhibition of C5 is the
most direct way of producing therapeutic benefit.
[0061] In other instances, the activation of the Complement System
is desirable in the treatment or prevention of diseases or medical
conditions in human patients. For example, the activation of the
Complement System is desirable in treating bacterial or viral
infections and malignancies. In addition, the activation of the
Complement System on T-cells prior to transplantation could prevent
rejection of an organ or tissue by eliminating the T-cells that
mediate the rejection.
[0062] Furthermore, Nucleic Acid Ligands that bind to cell surface
Targets could be made more efficient by giving them the ability to
activate the Complement System. Nucleic Acid binding would then
both inhibit a Target function and also eliminate the cell, for
example, by membrane attack complex lysis and cell clearance
through opsonization. Nucleic Acid Ligands could activate the
Complement System through either the classical or the alternative
pathways. C1q Nucleic Acid Ligands can be conjugated to other
structures that target a cell surface component. For example, C1q
Nucleic Acid Ligands can be conjugated to antibodies to cell
targets, cytokines, growth factors or a ligand to a cell receptor.
This would allow the C1q Nucleic Acid Ligands to multimerize on the
targeted cell surface and activate the Complement System, thereby
killing the cell.
[0063] The prototype classical pathway activators are immune
aggregates, which activate the Complement System through binding to
globular head groups on the C1q component. Generally, binding of
two or more Fc domains to C1q is required; pentameric IgM is an
especially efficient activator. In contrast, Nucleic Acid Ligands
can activate through binding at a separate site on the C1q
collagen-like tail region. This site also binds to a variety of
other non-antibody activators including C-reactive protein, serum
amyloid protein, endotoxin, .beta.-amyloid peptide 1-40 and
mitochondrial membranes. As with immunoglobulin, these non-antibody
activators need to be multimerized to activate.
[0064] Nucleic Acid Ligands that bind to sites on the collagen-like
region of C1q may also become activators when aggregated. Such a
Complement System-activating aggregate may be lytic if formed on a
cell surface, such as binding to a tumor-specific antigen (TSA) or
to a leukocyte antigen. The extent of Nucleic Acid Ligand-mediated
activation increases with the extent of Nucleic Acid Ligand
aggregation (i.e., multiplicity of Nucleic Acid Ligand-C1q
interaction). The Complement System-mediated killing is especially
specific if the Nucleic Acid Ligands circulate as monomers which do
not activate, but become activators when they are multimerized on
the targeted cell surface.
[0065] As with any Complement System activation, the extent and
specificity is determined by the amount of C3 deposited onto the
targeted cell. Deposited C3 forms an enzyme convertase that cleaves
C5 and initiates membrane attack complex formation. C3 is also the
classical serum opsonin for targeting phagocytic ingestion. The
prototype alternative pathway activators are repeating carbohydrate
units including bacterial and yeast cell walls, fucoidin and
Sepharose, or glycolipids such as endotoxin or the glycocalyx.
Nucleic Acid Ligands could activate the alternative pathway by
aggregating the C3 component on the cell surface. Depositing C3 on
a cell promotes Factor B binding and alternative pathway C3
convertase formation. Binding of a Nucleic Acid Ligand to C3 blocks
binding of the inhibitor Factor H and prevents C3b decay. This
would also increase C3 convertase formation and alternative path
activation. Nucleic Acid Ligands to C3 may have this activity since
heparin binds activated C3 and can promote alternative pathway
activation. Binding of Nucleic Acid Ligands to C3 blocks binding to
C3 of the membrane-associated inhibitors CR1, CR2, MCP and DAF,
preventing C3b convertase decay and stimulating alternative pathway
activation. This alternative pathway mechanism can be as efficient
as C1q-dependent activation in cell killing and lysis.
[0066] Nucleic Acid Ligand-mediated Complement System cell killing
could be employed in several ways, for example, by: a) direct
killing of tumor cells; b) lysis of targeted microorganisms or
infected cells; and c) elimination of lymphocytes or lymphocyte
subsets. Nucleic Acid Ligands could replace antibodies currently
used for these purposes.
[0067] Diagnostic utilization may include either in vivo or in
vitro diagnostic applications. The SELEX method generally, and the
specific adaptations of the SELEX method taught and claimed herein
specifically, are particularly suited for diagnostic applications.
The SELEX method identifies Nucleic Acid Ligands that are able to
bind targets with high affinity and with surprising specificity.
These characteristics are, of course, the desired properties one
skilled in the art would seek in a diagnostic ligand.
[0068] The Nucleic Acid Ligands of the present invention may be
routinely adapted for diagnostic purposes according to any number
of techniques employed by those skilled in the art. Diagnostic
agents need only be able to allow the user to identify the presence
of a given target at a particular locale or concentration. Simply
the ability to form binding pairs with the target may be sufficient
to trigger a positive signal for diagnostic purposes. Those skilled
in the art would also be able to adapt any Nucleic Acid Ligand by
procedures known in the art to incorporate a labeling tag in order
to track the presence of such ligand. Such a tag could be used in a
number of diagnostic procedures. The Nucleic Acid Ligands to C1q,
C3 and C5 described herein may specifically be used for
identification of the C1q, C3 or C5 protein.
[0069] The SELEX process provides high affinity ligands of a target
molecule. This represents a singular achievement that is
unprecedented in the field of Nucleic Acids research. The present
invention applies the SELEX procedure to the specific target C1q,
which is part of the first component (C1) of the classical pathway
of Complement System activation, to the specific target C3, which
is part of both the classical and alternative pathway, and to the
specific target C5, which is part of the terminal pathway. In the
Example section below, the experimental parameters used to isolate
and identify the Nucleic Acid Ligands to C1q, C3 and C5 are
described.
[0070] In order to produce Nucleic Acids desirable for use as a
pharmaceutical, it is preferred that the Nucleic Acid Ligand (1)
binds to the target in a manner capable of achieving the desired
effect on the target; (2) be as small as possible to obtain the
desired effect; (3) be as stable as possible; and (4) be a specific
ligand to the chosen target. In most situations, it is preferred
that the Nucleic Acid Ligand have the highest possible affinity to
the Target.
[0071] Pharmaceutical agents, which include, but are not limited
to, small molecules, antisense oligonucleotides, nucleosides, and
polypeptides can activate the Complement System in an undesirable
manner. Nucleic Acid Ligands to Complement System Proteins could be
used as a prophylactic by transiently inhibiting the Complement
System, so that a pharmaceutical agent could be administered and
achieve a therapeutically effective amount without eliciting the
undesirable side effect of activating the Complement System.
[0072] In co-pending and commonly assigned U.S. patent application
Ser. No. 07/964,624, filed October 21, 1992, now U.S. Pat. No.
5,496,938, (the '938 Patent), methods are described for obtaining
improved Nucleic Acid Ligands after SELEX has been performed. The
'938 Patent, entitled "Nucleic Acid Ligands to HIV-RT and HIV-1
Rev," is specifically incorporated herein by reference in its
entirety.
[0073] In the present invention, SELEX experiments were performed
in order to identify RNA with specific high affinity for C1q, C3
and C5 from a degenerate library containing 30 or 50 random
positions (30N or 50N). This invention includes the specific RNA
ligands to C1q shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ
ID NOS:84-155), identified by the method described in Examples 2
and 6, the specific RNA ligands to C3 shown in Table 3 (SEQ ID
NOS:21-46), identified by method described in Example 3, and the
specific RNA ligands to C5 shown in Table 4 (SEQ ID NOS:47-74),
Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table
10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13
(SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193)
identified by methods described in Examples 4, 9, 10 and 11. This
invention further includes RNA ligands to C1q, C3 and C5 which
inhibit the function of C1q, C3 and C5. The scope of the ligands
covered by this invention extends to all Nucleic Acid Ligands of
C1q, C3 and C5, modified and unmodified, identified according to
the SELEX procedure. More specifically, this invention includes
Nucleic Acid sequences that are substantially homologous to the
ligands shown in Tables 2-6, 8, 10 and 12-13 and FIGS. 5A-B (SEQ ID
NOS:5-155 and 160-196). By substantially homologous, it is meant a
degree of primary sequence homology in excess of 70%, most
preferably in excess of 80%, and even more preferably in excess of
90%, 95% or 99%. The percentage of homology as described herein is
calculated as the percentage of nucleotides found in the smaller of
the two sequences which align with identical nucleotide residues in
the sequence being compared when 1 gap in a length of 10
nucleotides may be introduced to assist in that alignment. A review
of the sequence homologies of the ligands of C1q shown in Table 2
(SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155) shows that
sequences with little or no primary homology may have substantially
the same ability to bind C1q. Similarly, a review of the sequence
homologies of the ligands of C3 shown in Table 3 (SEQ ID NOS:21-46)
shows that sequences with little or no primary homology may have
substantially the same ability to bind C3. Similarly, a review of
the sequence homologies of the ligands of C5 shown in Table 4 (SEQ
ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75,
160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID
NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID
NOS:160 and 193) shows that sequences with little or no primary
homology may have substantially the same ability to bind C5. For
these reasons, this invention also includes Nucleic Acid Ligands
that have substantially the same structure and ability to bind C1q
as the Nucleic Acid Ligands shown in Table 2 (SEQ ID NOS:5-20) and
Table 6 (SEQ ID NOS:84-155), Nucleic Acid Ligands that have
substantially the same structure and ability to bind C3 as the
Nucleic Acid Ligands shown in Table 3 (SEQ ID NOS:21-46) and
Nucleic Acid Ligands that have substantially the same structure and
ability to bind C5 as the Nucleic Acid Ligands shown in Table 4
(SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID
NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID
NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID
NOS:160 and 193). Substantially the same ability to bind C1q, C3 or
C5 means that the affinity is within one or two orders of magnitude
of the affinity of the ligands described herein. It is well within
the skill of those of ordinary skill in the art to determine
whether a given sequence--substantially homologous to those
specifically described herein--has substantially the same ability
to bind C1q, C3 or C5.
[0074] The invention also includes Nucleic Acid Ligands that have
substantially the same postulated structure or structural motifs.
Substantially the same structure or structural motifs can be
postulated by sequence alignment using the Zukerfold program (see
Zucker (1989) Science 244:48-52). As would be known in the art,
other computer programs can be used for predicting secondary
structure and structural motifs. Substantially the same structure
or structural motif of Nucleic Acid Ligands in solution or as a
bound structure can also be postulated using NMR or other
techniques as would be known in the art.
[0075] One potential problem encountered in the therapeutic,
prophylactic and in vivo diagnostic use of Nucleic Acids is that
oligonucleotides in their phosphodiester form may be quickly
degraded in body fluids by intracellular and extracellular enzymes
such as endonucleases and exonucleases before the desired effect is
manifest. Certain chemical modifications of the Nucleic Acid Ligand
can be made to increase the in vivo stability of the Nucleic Acid
Ligand or to enhance or to mediate the delivery of the Nucleic Acid
Ligand. See, e.g., U.S. patent application Ser. No. 08/117,991,
filed Sep. 8, 1993, entitled "High Affinity Nucleic Acid Ligands
Containing Modified Nucleotides," now abandoned (see also U.S. Pat.
No. 5,660,985) and U.S. patent application Ser. No. 08/434,465,
filed May 4, 1995, entitled "Nucleic Acid Ligand Complexes," which
are specifically incorporated herein by reference in their
entirety. Modifications of the Nucleic Acid Ligands contemplated in
this invention include, but are not limited to, those which provide
other chemical groups that incorporate additional charge,
polarizability, hydrophobicity, hydrogen bonding, electrostatic
interaction, and fluxionality to the Nucleic Acid Ligand bases or
to the Nucleic Acid Ligand as a whole. Such modifications include,
but are not limited to, 2'-position sugar modifications, 5-position
pyrimidine modifications, 8-position purine modifications,
modifications at exocyclic amines, substitution of 4-thiouridine,
substitution of 5-bromo or 5-iodo-uracil, backbone modifications,
phosphorothioate or alkyl phosphate modifications, methylations,
unusual base-pairing combinations such as the isobases isocytidine
and isoguanidine and the like. Modifications can also include 3'
and 5' modifications such as capping.
[0076] Where the Nucleic Acid Ligands are derived by the SELEX
method, the modifications can be pre- or post-SELEX modifications.
Pre-SELEX modifications yield Nucleic Acid Ligands with both
specificity for their SELEX Target and improved in vivo stability.
Post-SELEX modifications made to 2'-OH Nucleic Acid Ligands can
result in improved in vivo stability without adversely affecting
the binding capacity of the Nucleic Acid Ligand. The preferred
modifications of the Nucleic Acid Ligands of the subject invention
are 5' and 3' phosphorothioate capping and/or 3'-3' inverted
phosphodiester linkage at the 3' end. In one preferred embodiment,
the preferred modification of the Nucleic Acid Ligand is a 3'-3'
inverted phosphodiester linkage at the 3' end. Additional 2'-fluoro
(2'-F) and/or 2'-amino (2'-NH.sub.2) and/or 2'-O-methyl (2'-OMe)
modification of some or all of the nucleotides is preferred.
Described herein are Nucleic Acid Ligands that were 2'-NH.sub.2
modified or 2'-F modified and incorporated into the SELEX process.
Further described herein are 2'-F modified Nucleic Acid Ligands
derived from the SELEX process which were modified to comprise
2'-OMe purines in post-SELEX modifications.
[0077] Other modifications are known to one of ordinary skill in
the art. Such modifications may be made post-SELEX (modification of
previously identified unmodified ligands) or by incorporation into
the SELEX process.
[0078] As described above, because of their ability to selectively
bind C1q, C3 and C5, the Nucleic Acid Ligands to C1q, C3 and C5
described herein are useful as pharmaceuticals. This invention,
therefore, also includes a method for treating Complement
System-mediated diseases by administration of a Nucleic Acid Ligand
capable of binding to a Complement System Protein or homologous
proteins. Certain diseases or conditions such as Alzheimer's
disease or myocardial infarction activate C1q through the
collagen-like region. In Alzheimer's disease, .beta.-amyloid
activates C1q. Structures in heart muscle that are exposed during
myocardial infarction such as intermediate filaments, mitochondrial
membranes or actin activate C1q. Nucleic Acid Ligands to C3 or to
C5 could also inhibit Complement System activation in Alzheimer's
disease or myocardial infarction, whether the Complement System is
activated through C1q by antibody or non-antibody mechanisms, or
independent of C1q through the alternative pathway. Thus, the
Nucleic Acid Ligands of the present invention may be useful in
treating Alzheimer's disease or myocardial infarction.
[0079] Therapeutic compositions of the Nucleic Acid Ligands may be
administered parenterally by injection, although other effective
administration forms, such as intraarticular injection, inhalant
mists, orally active formulations, transdermal iontophoresis or
suppositories are also envisioned. One preferred carrier is
physiological saline solution, but it is contemplated that other
pharmaceutically acceptable carriers may also be used. In one
preferred embodiment, it is envisioned that the carrier and the
Nucleic Acid Ligand constitute a physiologically-compatible, slow
release formulation. The primary solvent in such a carrier may be
either aqueous or non-aqueous in nature. In addition, the carrier
may contain other pharmacologically-acceptable excipients for
modifying or maintaining the pH, osmolarity, viscosity, clarity,
color, sterility, stability, rate of dissolution, or odor of the
formulation. Similarly, the carrier may contain still other
pharmacologically-acceptable excipients for modifying or
maintaining the stability, rate of dissolution, release or
absorption of the ligand. Such excipients are those substances
usually and customarily employed to formulate dosages for parental
administration in either unit dose or multi-dose form.
[0080] Once the therapeutic composition has been formulated, it may
be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or dehydrated or lyophilized powder. Such
formulations may be stored either in a ready to use form or
requiring reconstitution immediately prior to administration. The
manner of administering formulations containing Nucleic Acid
Ligands for systemic delivery may be via subcutaneous,
intramuscular, intravenous, intranasal or vaginal or rectal
suppository.
[0081] The following Examples are provided to explain and
illustrate the present invention and are not intended to be
limiting of the invention. These Examples describe the use of SELEX
methodology to identify high affinity RNA ligands to C1q, C3 and
C5. Example 1 describes the various materials and experimental
procedures used in Examples 2, 3, 4 and 6. Example 2 describes the
generation of 2'-NH.sub.2 RNA ligands to C1q. Example 3 describes
the generation of 2'-F Nucleic Acid Ligands of Complement System
Protein C3. Example 4 describes the generation of 2'-F Nucleic Acid
Ligands of Complement System Protein C5. Example 5 describes the
activation of the Complement System through C1q ligands. Example 6
describes the generation of 2'-F RNA ligands to C1q. Example 7
describes an assay for hemolytic inhibition for 2'-F RNA ligands to
C5. Example 8 describes an assay for inhibition of C5a release by a
Nucleic Acid Ligand (clone C6) to Human C5. Example 9 describes
boundary experiments performed to determine the minimum binding
sequence for Nucleic Acid Ligands to Human C5. Example 10 describes
a Biased SELEX experiment performed to improve Nucleic Acid Ligand
affinity, using a 42 mer truncated sequence of clone C6 as the
random sequence in the template. Example 11 describes the results
of 2'-OMe purine substitutions in a Human C5 Nucleic Acid Ligand in
an interference assay. Example 12 describes the structure of a 38
mer truncate of a Nucleic Acid Ligand to human C5. Example 13
describes a hemolytic assay of 2'-OMe purine substituted Nucleic
Acid Ligands to human C5.
Example 1
[0082] Experimental Procedures
[0083] This example provides general procedures followed and
incorporated in Examples 2, 3, 4 and 6 for the identification of
2'-NH.sub.2 and 2'-F RNA ligands to C1q, and 2'-F ligands to C3 and
C5.
[0084] A. Biochemicals
[0085] C1q, C3, C5 and C4-deficient guinea pig sera were obtained
from Quidel (San Diego, Calif.). Bovine serum albumin (BSA), rabbit
anti-BSA, CRP, SAP and .beta.-amyloid peptides 1-40 and 1-42 were
obtained from Sigma (St. Louis, Mo.). Nucleotides GTP, ATP and
deoxynucleotides were obtained from Pharmacia (Uppsala, Sweden).
Taq polymerase was obtained from Perkin-Elmer (Norwalk, Conn.).
Modified nucleotides 2'-NH.sub.2-CTP and 2'-NH.sub.2-UTP, and
2'-F-CTP and 2'-F-UTP, were prepared as described in Jellinek et
al. (1995) Biochem. 34:11363. Avian reverse transcriptase was
obtained from Life Sciences (St. Petersburg, Fla.) and T7 RNA
polymerase from USB (Cleveland, Ohio.). Nitrocellulose filters were
obtained from Millipore (Bedford, Mass.). All chemicals were the
highest grade available.
[0086] B. RNA SELEX Procedures
[0087] The SELEX procedure has been described in detail in the
SELEX Patent Applications (see also Jellinek et al. (1995) Biochem.
34:11363; Jellinek et al. (1994) Biochem. 33:10450). Briefly, a DNA
template was synthesized with a 5' fixed region containing the T7
promoter, followed by a 30N or a 50N stretch of random sequence,
and then with a 3'-fixed region (Table 1; SEQ ID NOS:1 and 156).
For the initial round of the SELEX process, 1 nmole
(.about.10.sup.14 unique sequences) of RNA (Table 1; SEQ ID NOS:2
and 157) was in vitro transcribed by T7 polymerase (Milligan et al.
(1987) Nucleic Acids Res. 12:785) using mixed GTP/ATP and
2'-NH.sub.2-CTP/UTP or 2'-F-CTP/UTP nucleotides, and with the
addition of .alpha.-[.sup.32P]-ATP. For this and subsequent rounds
of the SELEX process, the RNA was purified by electrophoresis on 8%
acrylamide gels with 7 M urea, 10 mM Tris-Borate, 2 mM EDTA, pH 8.3
running buffer. After autoradiography, the band containing labeled,
modified RNA transcript was excised and frozen at -70.degree. C.,
then 400 .mu.L of 100 mM NaCl, 2 mM EDTA was added, the gel was
mashed, and the slurry was spun through 2 cm of glass-wool
(Rnase-free--Alltech Associates, Deerfield, Ill.) and two
nitrocellulose filters. The RNA was precipitated by addition of 1/5
vol of 6.6 M NH.sub.4OAc, pH 7.7, plus 2 vol of ethanol. The pellet
was washed twice with 80% ethanol, and taken to dryness. The dry
RNA pellet was dissolved in phosphate buffered saline (Sambrook et
al. (1989) Molecular Cloning. A laboratory Manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY) containing 1 mM
MgCl.sub.2 (MgPBS).
[0088] For each round of the SELEX process, the RNA was incubated
with C1q, C3 or C5 in MgPBS for 10 minutes at 37.degree. C. Then
the sample was filtered through a 43 mm nitrocellulose filter, and
the filter was washed with 10 mL of MgPBS. For some rounds, the
diluted RNA was pre-soaked with nitrocellulose filters overnight to
reduce background. Four samples were run in parallel for most
rounds with lesser amounts (chosen to be in suitable range to
measure binding) of both RNA and C1q, C3 or C5 to measure binding
Kd for each sample. In addition, at each round, a sample of RNA was
filtered without protein to determine background.
[0089] Filters were air-dried, sliced into strips, counted, and
then extracted for 60 minutes at 37.degree. C. with 400 .mu.L of 1%
SDS, 0.5 mg/mL Proteinase K (Boehringer Mannheim, Indianapolis,
Ind.), 1.5 mM DTT, 10 mM EDTA, 0.1 M Tris, pH 7.5, with addition of
40 .mu.g tRNA carrier. The aqueous RNA was extracted with phenol,
phenol/chloroform (1:1), and chloroform and then precipitated
following addition of NH.sub.4OAc/EtOH as above. The RNA was
reverse transcribed in a volume of 50 .mu.L for between 1 hour and
overnight. The DNA was PCR amplified with specific primers (Table
1; SEQ ID NOS:3-4) in a volume of 500 .mu.L for 12-14 cycles, and
then phenol/chloroform extracted and NaOAc/EtOH precipitated. The
DNA pellet was taken up in H.sub.2O, and an aliquot was T7
transcribed for the next round of the SELEX process.
[0090] C. Cloning DNA from the 12.sup.th or the 14.sup.th round was
PCR amplified with primers which also contained a ligation site to
facilitate cloning. The DNA was cloned into a pUC9 vector, and
colonies were picked for overnight growth and plasmid mini-preps
(PERFECTprep, 5'-3', Boulder, Colo.). The purified plasmids were
PCR amplified with original 3' and 5' primers (as above), and
products were analyzed by agarose gel electrophoresis (Sambrook et
al. (1989) Molecular Cloning. A laboratory Manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.). DNA was T7
transcribed with .alpha.-[.sup.32P]-ATP to prepare radiolabeled RNA
for binding analysis and without radiolabel to prepare RNA for
inhibition studies.
[0091] D. Sequencing Plasmids purified using the PERFECTprep kit
were sequenced with ABI dRhodamine Terminator cycling kit
(Perkin-Elmer). Samples were sequenced on the ABI Prism 377 DNA
Sequencer.
[0092] E. Binding Assays
[0093] Individual cloned DNA was T7 transcribed with
.alpha.-[.sup.32P]-ATP and the full length
[.sup.32P]-2'-NH.sub.2-RNA or 2'-F-RNA was gel-purified (as above).
RNA was suspended at approximately 5,000 cpm per 30 .mu.L sample
(<10 pM), and aliquots were incubated with various
concentrations of C1q, C3 or C5 in MgPBS for 10 minutes at
37.degree. C. Samples were then filtered through nitrocellulose,
the filters washed with buffer and dried under an infrared lamp,
and counted with addition of scintillation fluid (Ecoscint A,
National Diagnostics, Atlanta, Ga.). A background sample of RNA
alone was run in parallel. To measure inhibition of ligand binding
to C1q, the RNA Nucleic Acid Ligand plus C1q plus inhibitor (e.g.,
the A-chain residue 14-26 site, SAP, .beta.-amyloid peptide, CRP)
were incubated for 10 minutes at 37.degree. C., and then filtered.
Filters were washed and counted.
[0094] RNA ligand binding to C1q was also measured in the presence
of immune-complexes, which would block the binding of ligands to
C1q head-groups. Immune complexes (IC) were formed by mixing 620
.mu.g BSA at equivalence with 1 mL of rabbit anti-BSA (Sigma, St.
Louis, Mo.) plus PEG 8000 added to 1% final concentration, and then
the samples were incubated overnight at 4.degree. C. The IC were
pelleted by microfugation at 12,000 rpm for 10 minutes, washed five
times with PBS, and suspended in 1 mL of MgPBS. For measurement of
C1q RNA clone binding to C1q-immune complexes (C1q-IC), 20 .mu.L of
the purified [.sup.32P]-RNA plus 20 .mu.L of the IC were mixed with
20 .mu.L of C1q at various concentrations at between 10.sup.-11 and
10.sup.-7 M in MgPBS plus 1% Triton. Samples were incubated for 30
minutes at room temperature, microfuged, and the pellets and
supernatants counted.
[0095] F. Hemolytic Assays
[0096] Complement System consumption was measured by C4 hemolytic
assay as described (Gaither et al. (1974) J. Immunol. 113:574). All
samples were diluted and the assay run in veronal-buffered saline
containing calcium, magnesium and 1% gelatin (GVB.sup.++-complement
buffer). For measurement of C4 consumption by .beta.-amyloid
peptide consumption, the peptide was added at 250 .mu.g/mL to a 1/8
dilution of whole human serum and then incubated for 60 minutes at
37.degree. C. The sample was then diluted for assay of C4 hemolytic
activity. For assay of inhibition of .beta.-amyloid peptide
mediated complement consumption by C1 q 2'-NH.sub.2-RNA clones, the
C1q RNA Nucleic Acid Ligand was included in the initial
.beta.-amyloid peptide-whole human serum incubation mixture, and
then C4 amounts assayed as above.
[0097] Complement System inhibition by C5 Nucleic Acid Ligands was
measured using human serum and antibody-coated sheep red blood
cells. The red blood cells were incubated with a 1:40 dilution of
fresh human serum and with serial dilutions of C5 ligand for 30
minutes at 37.degree. C. Dilutions of serum and ligand were made in
complement buffer (see previous paragraph). After incubation the
samples were then diluted with 4.degree. C. buffer containing EDTA
to stop the reaction, and the hemoglobin release was quantitated
from the optical density at 412 nm.
Example 2
[0098] 2'-NH.sub.2 RNA Ligands to C1q
[0099] A. RNA SELEX
[0100] The pool of random 50N7-2'-NH.sub.2 RNA bound to C1q by
nitrocellulose filter assay with a K.sub.d of 2.3 .mu.M. For round
1 of the SELEX process, the C1q concentration was between
0.156-1.25 .mu.M and the RNA concentration was 15 .mu.M. Throughout
the SELEX process, the RNA concentrations were maintained at
approximately 10-fold greater than the concentration of C1q, which
was reduced at each round with a final round 14 C1q concentration
of 136 pM. Background binding of RNA to nitrocellulose filters
remained low throughout the SELEX procedure, in part because RNA
was pre-adsorbed with nitrocellulose filters. The binding of pool
RNA to C1q improved at each round. The evolved round 14 pool
2'-NH.sub.2 RNA bound C1q with a K.sub.d=670 pM, yielding an
overall improvement in binding K.sub.d of 3400-fold.
[0101] Bulk RNA was then cloned for sequence determination and
evaluation of binding. Through comparison of binding at 0.1 and 0.5
nM C1q, individual clones were ranked, and clones with C1q binding
above background were sequenced and are shown in Table 2 (SEQ ID
NOS:5-20). Family 1 contained 12 of the 19 total sequences. Family
2 contained three sequences. Both Family 3 and Family 4 contained
two sequences. Both Family 1 and Family 2 sequences contain G-rich
regions and both have the repeated sequence motifs GGAG and GGUG.
The identity and homology of Family 1 members is greatest in the 5'
half, which is G-rich. The C-rich 3' half has only short stretches
of sequence homology, and these are shown only with inclusion of
large gap regions. Sequences from all families can be folded to
give stem-loop structures with extensive Watson-Crick base-pairing.
Full binding curves for the highest affinity ligands yielded a
K.sub.d range from 290 pM to 3.9 nM; the high affinity ligands were
found in all four sequence families. All of the binding curves were
monophasic. The binding maximum is not 100% because of variable
amounts of nucleic acid alterations taking place during
purification. This is known because usually ligands can be bound to
protein, extracted, and then re-bound, and give maximum binding
approaching 100% (data not shown).
[0102] B. Competition
[0103] 2'-NH.sub.2 RNA ligands from different families interact
with the same or overlapping sites on C1q, as shown by
cross-competition. This site is on the collagen-like region, at or
near the A-chain 14-26 residue site (Jiang et al. (1994) J.
Immunol. 152:5050) as shown by two lines of evidence. First, C1q
when bound to IC still binds the ligand #50 (SEQ ID NO:12); binding
to immunoglobulin Fc would block the head region, but leave the
collagen-like tail available, suggesting that nucleic acid ligands
derived by the SELEX process are bound to the tail. Second, and
more direct, ligand #50 is competed by proteins which are known to
bind the A-chain residue 14-26 site, including SAP, .beta.-amyloid
peptide and CRP. Finally, ligand #50 is competed by a peptide that
has the same amino acid sequence as residues 14-26 on the A-chain.
This result is further supported by results for hemolytic
inhibition as described below.
[0104] C. Consumption
[0105] Binding of a nucleic acid ligand derived by the SELEX
process to the A-chain 14-26 amino acid site could activate C1q or
alternatively, SELEX-derived nucleic acid ligands could inhibit the
binding of other molecules and prevent C1q activation. This was
tested by measuring C4 consumption in serum after incubation with a
2'-NH.sub.2 SELEX-derived nucleic acid ligands, or after incubation
with a known C1q activator together with a 2'-NH.sub.2 nucleic acid
ligand. The SELEX-derived nucleic acid ligands when incubated in
serum do not consume C4, and thus are not C1q activators. Nor do
these ligands at this concentration inhibit serum lysis of
antibody-coated sheep erythrocytes, which would occur if ligands
bound near the C1q head groups (data not shown). The ligands do
inhibit C4 consumption by another C1q activator, the .beta.-amyloid
1-40 peptide. This peptide is known to activate C1q through binding
at the A-chain 14-26 residue site; therefore, this inhibition
confirms that SELEX-derived nucleic acid ligands bind at this
A-chain site. Control ligands from the SELEX process that did not
bind C1q by nitrocellulose assay were also ineffective in blocking
the .beta.-amyloid 1-40 peptide C1q activation.
Example 3
[0106] 2'-Fluoro Nucleic Acid Ligands of Complement System Protein
C3
[0107] In order to generate ligands to complement protein C3, a
library of about 10.sup.14 RNA was generated that contained 30
nucleotides of contiguous random sequence flanked by defined
sequences. In this experiment, 30N random nucleotides of the
initial Candidate Mixture were comprised of 2'-F pyrimidine bases.
The rounds of selection and amplification were carried out as
described in Example 1 using art-known techniques. In round 1 the
30N7-2'-F-RNA and C3 were both incubated at 3 .mu.M. There was
barely detectable binding at this round. Both the RNA and C3
concentrations were decreased during the SELEX procedure. Sequences
derived from the SELEX procedure are shown in Table 3 (SEQ ID
NOS:21-46).
Example 4
[0108] 2'-Fluoro Nucleic Acid Ligands of Complement System Protein
C5
[0109] In order to generate ligands to human complement protein C5,
a library of about 10.sup.14 RNA was generated that contained 30
nucleotides of contiguous random sequence flanked by defined
sequences. In this experiment, the 30N random nucleotides of the
initial Candidate Mixture were comprised of 2'-F pyrimidine bases.
Briefly, a DNA template was synthesized with a 5'-fixed region
containing the T7 promoter, followed by a 30N stretch of random
sequence, and then with a 3'-fixed region (Table 1; SEQ ID NO:1).
The rounds of selection and amplification were carried out as
described in Example 1 using art-known techniques. The initial
rounds of the SELEX experiment were set up with high concentrations
of 2'-F RNA (7.5 .mu.M) and protein (3 .mu.M), as the binding of C5
to unselected RNA was quite low. The SELEX experiment was designed
to promote binding of RNA at the C5a-C5b cleavage site. RNA and C5
were incubated together with small amounts of trypsin, with the
reasoning that limited trypsin treatment of C5 produces a single
site cleavage and generates C5a-like activity (Wetsel and Kolb
(1983) J. Exp. Med. 157:2029). This cleavage led to a slight
increase in random RNA binding. Enhanced RNA binding associated
structurally with exposure of the C5a-like domain could evolve
Nucleic Acid Ligands that bind near the C5 convertase site and
could interfere with or inhibit C5 cleavage. The SELEX experiment
was performed simultaneously to both the native and to the
mildly-trypsinized protein, so that Nucleic Acid Ligand evolution
would pick the highest affinity winner. With this procedure the
highest affinity winner against the multiple protein species would
be evolved, and multiple aptamers and specific aptamers might be
obtained out of a single SELEX experiment.
[0110] For each round of the SELEX process, the procedure was
performed in parallel in separate tubes with approximately 5-fold
excess of RNA either in buffer alone or with addition of trypsin at
between 0.3 and 0.0001 mg/mL. Samples were incubated in MgPBS for
45 minutes at 37.degree. C., and then filtered through
nitrocellulose. The filters were washed, dried and counted,
extracted, reverse-transcribed, then PCR amplified and finally T7
transcribed in vitro into RNA using mixed GTP/ATP and 2'-F-CTP/UTP
nucleotides and .alpha.-[.sup.32P]-ATP. RNA was purified by
electrophoresis in 8% acrylamide gels with 7M urea and Tris-Borate
EDTA buffer (TBE). RNA was isolated and precipitated with
NH.sub.4OAc/ethanol, and then dissolved in phosphate-buffered
saline containing 1 nM MgCl.sub.2 (MgPBS). Filters with the highest
binding were carried forward. At the end of each round, all of the
RNA that bound to the protein (either with or without trypsin) was
pooled. The protein and RNA concentrations at each round were
reduced, with final concentrations of 2.5 nM and 10 nM
respectively. Trypsin was added at concentrations between 0.3 and
0.0001 .mu.g/mL. Background binding was monitored at each round,
and starting at round four the transcribed RNA was presoaked
overnight with nitrocellulose filters prior to the SELEX rounds to
reduce background.
[0111] Based on binding of RNA to native C5 by nitrocellulose
assay, round twelve DNA was cloned and sequences were obtained as
shown in Table 4 (SEQ ID NOS:47-74). Sequences were grouped
according to homology and function. Group I sequences are highly
homologous and might have arisen by PCR mutation from a single
original sequence. Binding affinities of the Group I Nucleic Acid
Ligands are very similar and are shown in Table 7. Group II Nucleic
Acid Ligands generally bound with similar affinity to Group I
Nucleic Acid Ligands, although some weak binders were also present.
Group II sequences and length are more diverse than Group I Nucleic
Acid Ligands. The C5 Nucleic Acid Ligands do not bind other
complement components including C1q, C3, or factors B, H, or D.
[0112] Nucleic Acid Ligands from each family were also assayed for
inhibition of rat Complement System activity (Table 5; SEQ ID
NOS:76-83). Nucleic Acid Ligands from Family I and Family III
inhibited rat complement, whereas a Nucleic Acid Ligand from Family
II did not. An inhibitory Nucleic Acid Ligand can be used to
inhibit Complement System activity in various rat disease models
including, but not limited to, myasthenia gravis, myocardial
infarction, glomerulonephritis, ARDS, arthritis and
transplantation.
Example 5
[0113] Activation of the Complement System through C1q Nucleic Acid
Ligands
[0114] Oligonucleotides can activate both classical and alternative
pathways. Particularly, poly-G oligonucleotides which can form
G-quartet structures and can interact with the C1q collagen-like
region are able to form high molecular weight aggregates, which
both bind and activate C1q. Phosphorothioate oligonucleotides,
which have increased non-specific binding as compared with
phosphodiester oligonucleotides, are also efficient Complement
System activators, particularly poly-G containing phosphorothioate
oligonucleotides. Results for oligonucleotide activation of
solution phase Complement are shown below where classical pathway
activation is measure by the release of C4d fragment by ELISA
(Quidel, San Diego, Calif.), and alternative pathway activation is
measure by Bb ELISA (Quidel, San Diego, Calif.). Although these
pathways are separate, there is evidence to suggest that
oligonucleotide activation of both pathways is C1q dependent.
1 [C4d] .mu.g [Bb] .mu.g Sample (Class.) (Altern.) Poly-AG Random
Co-Polymer 8.1 18.9 Poly-G Random Co-Polymer 1.2 29.3 Poly-I Random
Co-Polymer 0 14.7 Poly-A Random Co-Polymer 0 0 Poly-U Random
Co-Polymer 0 1.8 Poly-C Random Co-Polymer 0 2.5 Phosphorothioate
Oligonucleotides GGCGGGGCTACGTACCGGGGCTTTGTAAAACCCCGCC -7.1 32.4
SEQ ID NO: 197 CTCTCGCACCCATCTCTCTCCTTCT 0.0 3.9 SEQ ID NO: 198
BSA-anti-BSA Immune Complexes 8.0 11.9 .beta.-Amyloid Peptide 2.7
n/d Fucoidan Sulfated Carbohydrate 27 buffer 0.0 0.0
[0115] Complement System activation is also initiated on the
erythrocyte membrane and is tested by hemolytic assays. Known
activators, including 2'-OH poly-G and phosphorothioate
oligonucleotides, as well as potential activators such as
multimerized C1q Nucleic Acid Ligands and small (e.g., 15-mer) 2'-F
poly-G oligonucleotides are coated on sheep erythrocytes and
subsequent lysis of the erythrocytes by serum complement is
measured. Methods of coating oligonucleotides and Nucleic Acid
Ligands on cells include passive adsorption, chemical conjugation,
streptavidin-biotin coupling and specific Nucleic Acid binding.
Following treatment with fresh rat or human serum, the deposition
of complement components on the cell, membrane damage and lysis are
measured by standard methods as would be known by one of skill in
the art.
[0116] A. Aggregation of C1q Nucleic Acid Ligands
[0117] C1q Nucleic Acid Ligands are dimerized using chemical
cross-linkers of various lengths. Alternatively, Nucleic Acid
Ligand monomers are biotinylated and then multimerized with
streptavidin. Each of these multimers are tested for complement
activation and lysis of erythrocytes.
[0118] The addition of poly-G sequence to C1q Nucleic Acid Ligands
provides additional binding ability and increases the ability of
the oligonucleotide to activate the Complement System. In addition,
short poly-G sequences on individual C1 q Nucleic Acid Ligands can
interact to form higher order structures, which serve to
multimerize the C1q Nucleic Acid Ligands and cause activation.
[0119] B. Lysis of Erythrocytes and Leukocytes
[0120] Nucleic Acid Ligands that promote erythrocyte lysis are
tested on nucleated cells, including lymphocytes and tumor cells.
Nucleated cells have mechanisms of complement resistance that
erythrocytes lack. For example, nucleated cells can shed antigens,
bleb off membrane vesicles containing the complement components and
express increased levels of complement inhibitors as compared with
erythrocytes and may up-regulate protective mechanisms upon initial
complement attack. As high levels of activation are important for
cell killing, activators are compared for amount of Complement
System component deposition and extent of membrane damage. Also,
different types and sources of tumor cells and lymphocytes are
tested to determine if susceptibility is cell-type specific.
[0121] Nucleic Acid Ligands can be generated for virtually any
target as described in the SELEX Patent Applications. Nucleic Acid
Ligands to L-Selectin have been generated (See U.S. patent
application Ser. No. 08/479,724, filed Jun. 7, 1995, entitled "High
Affinity Nucleic Acid Ligands to Lectins," now U.S. Pat. No.
5,780,228, which is incorporated herein by reference in its
entirety). The diversity of lectin mediated functions provides a
vast array of potential therapeutic targets for lectin antagonists.
For example, antagonists to the mammalian selecting, a family of
endogenous carbohydrate binding lectins, may have therapeutic
applications in a variety of leukocyte-mediated disease states.
Inhibition of selectin binding to its receptor blocks cellular
adhesion and consequently may be useful in treating inflammation,
coagulation, transplant rejection, tumor metastasis, rheumatoid
arthritis, reperfusion injury, stroke, myocardial infarction, bums,
psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic and
traumatic shock, acute lung injury and ARDS. The coupling of C1q
Nucleic Acid Ligands to L-Selectin Nucleic Acid Ligands makes the
L-Selectin Nucleic Acid Ligand more efficient by promoting cell
killing at the target. C1q Nucleic Acid Ligands are coupled to
L-Selectin Nucleic Acid Ligands, and the conjugates are tested for
leukocyte lysis as described above. Also, Nucleic Acid Ligands to
other cell surface targets, antibodies to all targets that do not
themselves activate complement, cytokines, growth factors, or a
ligand to a cell receptor could be coupled to a C1q Nucleic Acid
Ligand and used for cell killing.
[0122] C. In Vivo Testing of Complement Activation
[0123] Nucleic Acid Ligand-mediated Complement System activation is
tested in animals to evaluate in vivo Nucleic Acid Ligand action.
Erythrocytes and/or lymphocytes are coated with Nucleic Acid
Ligands and injected into rats to test cell killing and lysis in
vivo. Activating Nucleic Acid Ligands are also coupled to a Mab
that does not activate the Complement System, where the antibody is
directed against a rat cell antigen (e.g., lymphocyte antigen).
These cells are then coated with the Nucleic Acid Ligand-antibody
conjugate and injected into rats. Alternatively, the Nucleic Acid
Ligand-antibody conjugate is injected directly into the rat and
then in vivo leukocyte killing is measured.
[0124] It is also possible that C1q Nucleic Acid Ligands
cross-react with non-human C1q, and non-human C1q could be used for
in vivo assays. C1q Nucleic Acid Ligands are tested against species
such as mouse, rat and rabbit C1q. C1q is purified from serum and
cross-reactivity with C1q Nucleic Acid Ligands is tested by
nitrocellulose binding assay. Alternatively, C1q is bound to immune
complexes which are added to serum and then C1q Nucleic Acid Ligand
binding to the aggregate is tested. If Nucleic Acid Ligands are
species-specific, then rat serum is depleted of rat C1q by
continuous perfusion over a Ig-Sepharose column, and the serum is
reconstituted with human C1 q by methods known to one of skill in
the art. These reconstituted animals are then used to test C1q
Nucleic Acid Ligands for targeted Complement System activation and
cell killing.
Example 6
[0125] 2'-Fluoro RNA Ligands of Complement System Protein C1q
[0126] A. RNA SELEX
[0127] The pool of random 30N7-2'-F RNA bound to C1q by
nitrocellulose filter assay with a K.sub.d of 2.3 .mu.M. For round
1 of the SELEX process, the C1q concentration was between
0.156-1.25 .mu.M and the RNA concentration was 15 .mu.M. Throughout
the SELEX process, the RNA concentrations were maintained at
approximately 10-fold greater than the concentration of C1q, which
was reduced at each round with a final round 14 C1q concentration
of 136 pM. Background binding of RNA to nitrocellulose filters
remained low throughout the SELEX procedure, in part because RNA
was pre-adsorbed with nitrocellulose filters. The binding of pool
RNA to C1q improved at each round. The evolved round 14 pool 2'-F
RNA bound C1q with a K.sub.d of 2 nM, yielding an overall
improvement in binding K.sub.d of 1-3000-fold.
[0128] Bulk RNA was then cloned for sequence determination and
evaluation of binding. Through comparison of binding at 0.1 and 0.5
nM C1q, individual clones were ranked for binding affinity.
Sequences of 2'-F RNA ligands are shown in Table 6 (SEQ ID
NOS:84-155). The 2'-F-RNA sequences are not easily grouped into
families, but these sequences are G-rich and are similar but not
homologous with the 2'-NH.sub.2 RNA sequences described in Example
2.
Example 7
[0129] Hemolytic Inhibition for 2'-F RNA Ligands to C5
[0130] The 2'-F RNA Nucleic Acid Ligands to C5 (Example 4) were
assayed for hemolytic inhibition by including dilutions in a
standard assay for human serum lysis of antibody-coated sheep
erythrocytes. Sheep cells were mixed with a 1:40 dilution of serum
containing Nucleic Acid Ligand or buffer, and incubated for 30
minutes at 37.degree. C. After quenching with cold EDTA buffer, the
samples were spun and supernatants read at OD 412 nm. Group I
Nucleic Acid Ligands inhibited almost to background at 1 .mu.M,
with a K.sub.i of 60-100 nM. The results are shown in FIG. 1. The
results of the hemolysis inhibition assay suggested that 2'-F RNA
Nucleic Acid Ligands to C5 target a specific site on C5, where they
block interaction of C5 with the Complement C5 convertase. These
results also confirmed that the 2'-F RNA Nucleic Acid Ligands are
stable in serum.
Example 8
[0131] Inhibition of C5a Release
[0132] Nucleic Acid Ligand-C5 interaction that inhibits cleavage of
C5 would prevent formation of the C5b and MAC assembly. Inhibition
of C5 cleavage should also inhibit C5a release, and this was shown
in the following experiment with clone C6 (SEQ ID NO:51) (Example
4). For this experiment, dilutions of clone C6 were incubated with
whole human serum in GVB.sup.++ (veronal-buffered saline containing
calcium, magnesium and 1% gelatin) plus addition of zymosan for 30
minutes at 37.degree. C. The samples were then quenched with
EDTA-buffer and spun, and supernatants were assayed for C5a by
radioimmunoassay (RIA) (Wagner and Hugli (1984) Anal. Biochem.
136:75). The results showed that clone C6 inhibited C5a release
with a K.sub.i of approximately 100 nM (FIG. 2), whereas control
random pool RNA gave no inhibition (data not shown). This assay
also demonstrated the serum stability of clone C6.
Example 9
[0133] Boundaries of Clone C6
[0134] Clone C6 (SEQ ID NO:51) (Example 4) was selected for
determination of a minimal binding sequence. This was done in the
following two ways.
[0135] 1) The minimal RNA sequences (5' and 3' boundaries) required
for binding of clone C6 to C5 were determined by partially
hydrolyzing clone C6 and determining protein binding (Green et al.
(1995) Chem. Biol. 2:683). Briefly, clone C6 was synthesized as
either 5'-[.sup.32p]-kinase labeled (to determine the 3' boundary)
or 3'-[.sup.32P]-pCp labeled (to determine the 5' boundary) and the
oligonucleotides were purified. Then the oligonucleotides were
subjected to alkaline hydrolysis, which cleaves oligonucleotides
from the 3' end to purine bases. The partially hydrolyzed RNA was
then incubated with C5, and RNA which bound to the C5 protein was
partitioned on nitrocellulose and eluted from the protein. The
partitioned RNA together with an RNA ladder were run on an 8%
acrylamide/7M urea sequencing gel. The boundary where removal of
one more base would reduce or eliminate binding was determined by
comparison of selected RNA (RNA which bound to C5) versus
non-selected RNA (RNA which did not bind to C5).
[0136] The labeled RNA was also digested with T.sub.1 nuclease
(which cleaves oligonucleotides from the 3' end to A residues),
incubated with C5 and partitioned as above, for a second ladder.
FIG. 3A shows the results of the digestion of the 5'-kinase-labeled
RNA. In this figure, the 3'-sequence (5'-end labeled) is aligned
with the alkaline hydrolysis ladder. On the left is the T.sub.1
ladder and on the right are RNA selected with 5.times. and 1.times.
concentrations of C5. The boundary where removal of a base
eliminates binding is shown by the arrow. The asterisk shows a G
which is hypersensitive to T.sub.1. Other G nucleotides in the
minimal sequences are protected from T.sub.1 digestion. FIG. 3B
shows the results of the 3'-pCp-ligated RNA. In this figure, the
5'-sequence (3'-end-labled) is aligned with the alkaline hydrolysis
ladder. The T.sub.1 and protein lanes, boundary and hypersensitive
G nucleotides are as described for FIG. 3A.
[0137] 2) In a second experiment, the results obtained from the
boundary experiments described above were used to construct
synthetic truncated Nucleic Acid Ligands to C5. Several truncates
between 34 and 42 nucleotides were synthesized by removing residues
at both ends of clone C6 (SEQ ID NO:51), and assayed for C5 binding
(Table 8). The shortest oligonucleotide which bound to C5 was a 38
mer (SEQ ID NO:160), which confirms the boundary gel and which
provides a preliminary structure for further Nucleic Acid Ligand
development. In the minimal 38 mer sequence, 30 bases originated
from the random region and eight bases were from the 5' fixed
region of clone C6. Removing a base from both 5' and 3' ends of the
38 mer to produce a 36 mer (SEQ ID NO:161) reduced the binding. A
34 mer (SEQ ID NO:162) did not bind. Other truncated
oligonucleotides with internal deletions also failed to bind.
Example 10
[0138] Biased SELEX
[0139] A biased SELEX experiment was performed to improve Nucleic
Acid Ligand affinity and to further define the structure. The
sequence of the 42 mer truncate (SEQ ID NO:75) from Example 9
(Table 8)was used as a template for the Biased SELEX experiment. A
synthetic template comprising a 42N random region flanked by new n8
fixed regions (Table 10; SEQ ID NO:163) was constructed and
synthesized (Oligos, Etc., CT), where the random region was biased
toward the 42 mer truncate of clone C6 from the first SELEX
experiment. A 42 mer random region was chosen rather than the
minimal 38 mer sequence, as the four extra bases extended a
terminal helix. While not wishing to be bound by any theory, the
inventors believed that although these four extra bases were not
essential for binding, a longer helix was thought desirable to aid
in selecting the Nucleic Acid Ligand structure and in minimizing
the possible use of fixed regions in the newly selected Nucleic
Acid Ligand structure. Each base in the random region was
synthesized to contain 0.67 mole fraction of the base corresponding
to the base in the 42 mer sequence and 0.125 mole fraction of each
of the other three bases. The Biased SELEX experiment was performed
as described for the standard SELEX experiment in Example 1. PCR
amplification was performed using primers shown in Table 1 (SEQ ID
NOS:158-159).
[0140] The Biased SELEX experiment was performed with native C5
protein since clone C6 already inhibits hemolysis and trypsin
treatment is not required for binding. The binding of the starting
RNA pool to C5 was very low, so the protein and RNA concentrations
were started at 2.6 .mu.M and 7.1 .mu.M, respectively, similar to
the first SELEX experiment. The binding rapidly improved at round
three. RNA and protein concentrations were gradually reduced at
each subsequent round to final concentrations by round nine of 62.5
pM and 31 pM, respectively. The binding of the RNA pool to C5 was
approximately 5 nM (Table 9), as compared to approximately 100 M
for the RNA pool from the first SELEX experiment. Some of the
improvements in the affinity of the pool results from absence of
lower affinity ligands, size mutants and background binders, which
were not allowed to build up to appreciable concentrations during
this more rapid SELEX experiment.
[0141] The RNA pool after eight rounds of the Biased SELEX process
was improved by 20-50 fold over the round twelve pool from the
first SELEX experiment. The overall improvement in K.sub.d from the
random pool to pool from eight rounds of the Biased SELEX process
is estimated to be greater than 10.sup.5-fold. The isolated and
cloned sequences from the Biased SELEX experiment are shown in
Table 10 (SEQ ID NOS:164-189). In the sequences shown in Table 10,
the two base-pair stem which is dispensable for binding is
separated from the minimal 38 mer sequence. These bases show no
selective pressure except to maintain the stem. None of the
sequences exactly match the original template sequence.
[0142] Clones from the Biased SELEX experiment were assayed and
representative binding affinities are shown in Table 11. Most
clones bound with a K.sub.d between 10 and 20 nM and are higher
affinity binding ligands than the template (SEQ ID NO:163). One of
the clones, YL-13 (SEQ ID NO:175), bound approximately five-fold
higher affinity than other clones from the Biased SELEX experiment
and approximately 10-fold higher affinity than clone C6 (SEQ ID
NO:51). None of Nucleic Acid Ligand sequences exactly matched the
sequence used for the template in the Biased SELEX experiment. Some
bases substitutions are unique to this Biased SELEX experiment
sequence set and might account for increased Nucleic Acid Ligand
affinity.
Example 11
[0143] 2'-O-Methyl Substitution for Nuclease Protection
[0144] To further stabilize the Nucleic Acid Ligand, positions
where 2'-OH-purine nucleotides could be substituted with
nuclease-resistant 2'-O-methyl nucleosides were determined. An
assay for simultaneously testing several positions for 2'-O-methyl
interference was used following the method described in Green et
al. (1995) Chem. Biol. 2:683.
[0145] In the 2'-O-methyl interference assay, three sets of
oligonucleotides based on a 38 mer truncate of sequence YL-13 (SEQ
ID NO:175) from the Biased SELEX experiment were synthesized. These
sets of sequences, indicated as M3010 (SEQ ID NO:190), M3020 (SEQ
ID NO:191) and M3030 (SEQ ID NO:192) in Table 12 were synthesized
on an automated RNA synthesizer in a manner wherein each of the
nucleotides indicated by bold underline in Table 12 were
synthesized 50% as a 2'-OH-nucleotide and 50% as a
2'-OMe-substituted nucleotide. This resulted in a mixture of
2.sup.5 or 32 different sequences for each of sets M3010, M3020 and
M3030.
[0146] The partially substituted 2'-OMe oligonucleotides were
5'-[.sup.32P]-kinase-labeled. The oligonucleotides were selected at
100 nM and 10 nM C5 and the binding to protein was greater than
10-fold over background filter binding. The oligonucleotides were
eluted from the protein, alkaline hydrolyzed and then run on a 20%
acrylamide/7 M urea/TBE sequencing gel. On adjacent tracks were run
oligonucleotides not selected with C5. Band intensities were
quantitated with on an InstantImager (Packard, Meriden, Conn.).
When these oligonucleotides were separated on an acrylamide gel the
mixed OH:OMe positions showed up at 50% intensity of a full 2'-OH
position, because the 2'-OMe is resistant to hydrolysis. 2'-F
pyrimidines are also resistant and do not show on the gel.
[0147] For each position, the ratio of (the intensity of the bands
selected by protein binding)/(band intensity for oligonucleotide
not selected to protein) was calculated. These ratios were plotted
versus nucleotide position and a linear fit determined (FIG. 4,
open circles). The same calculation was made for mixed 2'-OH/2'-OMe
oligonucleotides, and these ratios were compared with previously
determined curve (FIG. 4, closed circles). Where 2'-OMe
substitution did not interfere with binding the ratio was within
one standard deviation of the 2'-OH ratio. However, where 2'-OMe
substitution interfered with binding, the binding preference for
2'-OH purine increased the ratio. Two nucleotides at positions 16
and 32 were determined to require 2'-OH nucleotides. Separately,
residue g5 was determined independently to require 2'-OH and
residue G20 was determined to allow 2'-OMe substitution, and these
were used to normalize lanes. These results were confirmed by
synthesis and assay of 2'-OMe substituted oligonucleotides. The
obligate 2'-OH positions are in one of two bulges, or in the loop
in the putative folding structure, suggesting these features are
involved in the protein interaction. Once the permissible 2'-OMe
positions were determined, substituted oligonucleotides were
synthesized and relative binding affinities were measured.
Example 12
[0148] Human C5 Nucleic Acid Ligand Structure
[0149] The putative folding and base-pairing, based on truncation
experiments, nuclease sensitivity, base substitution patterns from
the Biased SELEX experiment, and 2'-OMe substitutions, for the 38
mer truncate of clone C6 together with alternative bases is shown
in FIG. 5A. The basic sequences is the 38 mer truncate (SEQ ID
NO:160). In parentheses are variants from the first SELEX
experiment. In brackets are variants from the Biased SELEX
experiment. Lower case bases are derived from the 5'-n7 fixed
region from the first SELEX experiment. Upper case bases are
derived from the original random region.
[0150] The stem-loop structure has between 12 and 14 base-pairs: a)
the proposed 5', 3'-terminal base pairs (c1-a3, and U36-G38); b)
stem-loop base-pairs (U11-U14 and G24-A27) are supported by
covariant changes during the Biased SELEX procedure; and c) the
middle stem (g7-C10 and G28-C34), which is generally conserved,
U9-A32 which is invariant and g8-C33 conserved during the Biased
SELEX procedure. The u4.fwdarw.c4 change improves binding, and this
change is found in all clones from the Biased SELEX experiment, and
G29, A29 variants are found only in clones from the Biased SELEX
experiment.
[0151] The UUU bulge is generally conserved. One original sequence
contained two U bases, with no reduction in binding, and two
Nucleic Acid Ligands with a single base substitution were found
during Biased SELEX experiment. The C10-G28 base-pair following the
UUU-bulge is conserved. This region with a conserved bulge and stem
is likely involved in protein interaction. The stem-loop G15 to U23
is highly conserved, except for bases 19.
[0152] The 2'-OMe substitution pattern is consistent with this
structure (SEQ ID NO:193; FIG. 5B). Positions where 2'-OMe
substitutions can be made are shown in bold. The three positions
which must be 2'-OH are shown as underlined. The obligate 2'-OH
bases at g5, G17 and A32 are in bulge or loop regions which might
form unique three-dimensional structures required for protein
binding. Allowed positions for 2'-OMe substitution occur in stem
regions where a standard helical structure is more likely.
Example 13
[0153] Hemolytic Assay of 2'-OMe-Substitued Nucleic Acid Ligands to
Human C5
[0154] Three oligonucleotides were synthesized based on clone YL-13
from the Biased SELEX experiment to compare the effect of 2'-OMe
substitution on hemolytic inhibition: (1) a 38 mer truncate B2010
(SEQ ID NO:194), in which all of the nucleotides were 2'-OH; (2) a
38 mer in which one nucleotide (position 20) was a 2'-OMe-G (B2070;
SEQ ID NO:195); and (3) a 38 mer in which the maximum number of
allowable positions (positions 2, 7, 8, 13, 14, 15, 20, 21, 22, 26,
27, 28, 36 and 38) were synthesized as 2'-OMe-G and 2'-OMe-A
(M6040; SEQ ID NO:196) as shown in Table 13. These were assayed in
the hemolytic assay as described in Example 7. The results are
shown in FIG. 6. As shown in FIG. 6, the K.sub.i decreased with
increased 2'-O-Me substitution. The K.sub.d was marginally better
(data not shown). This experiment showed that nucleic acid ligand
stability is increased with 2'-OMe substitution, and that long term
in vivo inhibition of the complement system is feasible.
2TABLE 1 SEQ ID NO. Synthetic DNA Template: 1 and 156
5'-TAATACGACTCACTATAGGGAGGACGATGCGG-[N].sub.30 or 50-
CAGACGACTCGCCCGA-3' Starting random sequence RNA pool: 2 and 157
5'-GGGAGGACGAUGCGG-[N].sub.30 or 50-CAGACGACUCGCCCGA-3' Primer Set
for Standard SELEX: 3 5'-PRIMER:
5'-TAATACGACTCACTATAGGGAGGACGATGCGG-3' 4 3'-PRIMER:
5'-TCGGGCGAGTCGTCTG-3' Primer Set for Biased SELEX: 158 5'-PRIMER:
5'-TAATACGACTCACTATAGGGAGATAAGAATAAACGCTCAA-- 3' 159 3' PRIMER: 5'
GCCTGTTGTGAGCCTCCTGTCGAA-3'
[0155]
3TABLE 2 2'-NH.sub.2 RNA Ligands of Complement System Protein Clq*
SEQ ID Clone No. NO: Kd(nM) Family 1 3
gggaggacgaugcggGAGGAGUGGAGGUAAACAAUAGGUC-
GGUAGCGACUCCCACUAACAGGCCUcagacgacucgcccga 5 12
gggaggacgaugcggGUGGAGUGGAGGUAAACAAUAGGUCGGUAGCGACUCCCAGUAACGGCCUcagacgacu-
cgcccga 6 23 cgggaggacgaugcaaGUGGAGUGGAGGUAUAACGGCCGGUAGGC-
AUCCCACUCGGGCCUAGCUcagacgacucgcccga 7 30
gggaggacgaugcggGUGGAGUGGGGAUCAUACGGCUGGUAGCACGAGCUCCCUAACAGCGGUcagacgacuc-
gcccga 8 36 gggaggacgaugcggGAGGAGUGGAGGUAAACAAUAGGCCGGUAGC-
GACUCCCACUAACAGCCUcagacgacucgcccga 9 0.29 45
gggaggacgaugcggUGGAGUGGAGGUAUACCGGCCGGUAGCGCAUCCCACUCGGGUCUGUGCUcagacgacu-
cgcccga 10 1.38 47 gggaggacgaugcggGUGGAGCGGAGGUUUAUACGGCUG-
GUAGCUCGAGCUCCCUAACACGCGGUagacgacucgcccga 11 50
gggaggacgaugcggGUGGAGUGGAGGUAUAACGGCCGGUAGCGCAUCCCACUCGGGUCUGUGCUagacgacu-
cgcccga 12 0.979 78 gggaggacgaugcggGUGGAGUGGAGGGUAAACAAUGG-
CUGGUGGCAUUCGGAAUCUCCCAACGUagacgacucgcccga 13 Family 2 33
gggaggacgaugcggGUUGCUGGUAGCCUGAUGUGGGUGGAGUGAGUGGAGGGUUGAAAAAUGcaga-
cgacucgcccga 14 3.85 40 gggaggacgaugcggCUGGUAGCAUGUGCAUUGA-
UGGGAGGAGUGGAGGUCACCGUCAACCGUcagacgacucgcccga 15 43
gggaggacgaugcggUUUCUCGGCCAGUAGUUUGCGGGUGGAGUGGAGGUAUAUCUGCGUCCUCGcagacgac-
ucgcccga 16 Family 3 14 gggaggacgaugcggCACCUCACCUCC-
AUAUUGCCGc3UUAUCGCGUAGGGUGAGCCCAGACACGAcagacgacucgcccga 17 2.4 23
gggaggacgaugcggCACUCACCUUCAUAUUGGCCGCCAUCCCCAGGGUUGAGCCCAGACACAGca-
gacgacucgcccga 18 23 Family 4 22
gggaggacgaugcggGCAUAGUGGGCAUCCCAGGGUUGCCUAACGGCAUCCGGGGUUGUUAUUGGcagacgac-
ucgcccga 19 67 gggaggacgaugcggCAGACGACUCGCCCGAGGGGAUCCCCC-
GGGCCUGCAGGAAUUCGAUAUcagacgacucgcccga 20 *Lower case letters
represent the fixed region.
[0156]
4TABLE 3 2'-F RNA Ligands of Complement System Protein of Human C3*
SEQ Clone No. ID NO: C3c 10 gggaggacgaugcgg
AACUCAAUGGGCCUACUUUUUCCGUGGUCCU cagacgacucgcccga 21 C3C 16
gggaggacgaugcgg AACUCAAUGGGCCUACUUUUCCGUGGUCCU cagacgacucgcccga 22
C3C 186 gggaggacgaugcgg AACUCAAUGGGCCGACUUUUUCCGUGUCCU
cagacgacucgcccg 23 C3C 162 gggaggacgaugcgg
AACUCAAUGGGCCGACUUUCCGUGGUCCU cagacgacucgcccga 24 C3C 141
gggaggacgaugcgg AACUCAAUGGGCNUACUUUUCCGUGGUCCU cagacgacucgcccga 25
C3c 32 gggaggacgaugcgg AACUCAAUGGGCCGACUUUUCCGUGGUCCU
cagacgacucgcccga 26 27C3B143 gggaggacgaugcgg
AACUCAAUGGGCCGACUUUUCCGUGGUCCU cagacgacugcccga 27 30C3B149
gggaggacgaugcgg ACGCAGGGGAUGCUCACUUUGACUUUUAG- GC cagacgacucgcccg
28 c3a 29c gggaggacgaugcgg ACUCGGCAUUCACUAACUUUUGCGCUCGU
cagacgacucgcccga 29 C3B 25 gggaggacgaugcgg
AUAACGAUUCGGCAUUCACUAACUUCUCGU cagacgacucgcccga 30 C3c 3
gggaggacgaugcgg AUGACGAUUCGGCAUUCACUAACUUCUCGU cagacacucgcccga 31
C3C 155 gggaggacgaugcgg AUGACGAUUCGGCAUUCACUAACUUCUCAU
cagacgacucgcccga 32 C3C 109 gggaggacgaugcgg
AUGACGAUUCGGCAUUCACUAACUUCUACU cagacgacucgcccga 33 C3-A 18c
gggaggacgaugcgg AUCUGAGCCUAAAGUCAUUGUGAUCAUCCU cagacgacucgcccga 34
C3c 35 gggaggacgaugcggg CGUUGGCGAUUCCUAAGUGUCGUUCUCGU
cagacgacucgcccga 35 C3B 41 gggaggacgaugcgg
CGUCUCGAGCUCUAUGCGUCCUCUGUGGU cagacgacucgcccga 36 C3B 108
gggaggacgaugcgg CGUCACGAGCUUUAUGCGUUCUCUGUGGU cagacgacucgcccga 37
C3c 77 gggaggacgaugcgg CUUAAAGUUGUUUAUGAUCAUUCCGUACGU
cagacgacucgcccga 38 C3B 102 gggaggacgaugcgg
GCGUUGGCGAUUGGUAAGUGUCGUUCUCGU cagacgacucgcccga 39 c3a 9c
gggaggacgaugcgg GCGUCUCGAGCUUUAUGCGUUCUCUGUGGU cagacgacucgcccga 40
C3B 138 gggaggacgaugcgg GCGUCUCGAGCUCUAUGCGUUCUCUGUGGU
cagacgacucgcccga 41 c3-8c ggaggacgaugcgg
GGCCUAAAGUCAAGUGAUCAUCCCCUGCGU cagacganucgcccga 42 C3-230
gggaggacgaugcgg GUGGCGAUUCCAAGUCUUCCGUGAACAUGGU cagacgacucgcccg 43
C3c 36 gggaggacgaugcgg GUGACUCGAUAUCUUCCAAUCUGUACAUGGU
cagacgacucncccga 44 188 gggaggacgaugcgg
UGGCGAUUCCAAGUCUUCCGTGAACATGGT cagacgacucgcccga 45 C3B 23
gggaggacgaugcgg TGGCGATTCCAAGTCTTCCGTGAACAT cagacgacucgcccga 46
*Lower case letters represent the fixed region.
[0157]
5TABLE 4 2'-F RNA Ligands of Complement System Protein Human C5*
SEQ Clone No: ID NO: Group I E5c/E11 gggaggacgaugcgg
UCCGGCGCGCUGAGUGCCGGUUAUCCUCGU cagacgacucgcccga 47 A6
gggaggacgaugcgg UCCGGCGCGCUGAGUGCCGGUUUAUCCUCGU cagacgacucgcccga 48
F8 gggaggacgaugcgg UCUCAUGCGCCGAGUGUGAGUUUACCUUCGU cagacgacucgcccga
49 K7 gggaggacgaugcgg UCUCAUGCGUCGAGUGUGAGUUUAACUGCGU
cagacgacucgcccga 50 C6 gggaggacgaugcgg
UCUCAUGCGUCGAGUGUGAGUUUACCUUCGU cagacgacucgcccga 51 G7
gggaggacgaugcgg UCUGCUACGCUGAGUGGCUGUUUACCUUCGU cagacgacucgcccga 52
H1 gggaggacgaugcgg UCGGAUGCGCCGAGUCUCCGUUUACCUUCGU cagacgacucgcccga
53 Group II F11 gggaggacgaugcgg UGAGCGCGUAUAGCGGUUUCGAUAGAGCUGCGU
cagacgacucgcccga 54 H2 gggaggacgaugcgg
UGAGCGCGUAUAGCGGUUUCGAUAGAGCCU cagacgacucgcccga 55 H6
gggaggacgaugcgg UGAGCGUGGCAAACGGUUUCGAUAGAGCCU cagacgacucgcccga 56
H8 gggaggacgaugcgg UGAGCGUGUAAAACGGUUUCGAUAGAGCCU cagacgacucgcccga
57 C9 gggaggacgaugcgg UGAGCGUGUAAAACGGUUUCGAUAGAGCCU
cagacgacucgcccga 58 C12 gggaggacgaugcgg
UGGGCGUCAGCAUUUCGAUCUUCGGCACCU cagacgacucgcccga 59 G9
gggaggacgaugcgg GAGUUGUUCGGCAUUUAGAUCUCCGCUCCCU cagacgacucgcccga 60
F7 gggaggacgaugcgg GCAAAGUUCGGCAUUCAGAUCUCCAUGCCCU cagacgacucgcccga
61 E9c gggaggacgaugcgg GGCUUCUCACAUAUUCUUCUCUUUCCCCGU
cagacgacucgcccga 62 E4c gggaggaggaucgg UGUUCAGCAUUCAGAUCUU
cagacgacucgcccga 63 G3 gggaggacgaugcgg
UGUUCAGCAUUCAGN/AUCUUCACGUGUCGU cagacgacucgcccga 64 F6
gggaggacgaugcgg UGUUCACCAUUCAGAUCUUCACGUGUCGU cagacgacucgcccga 65
D9 gggaggacgaugc UGUUCAGCAUUCAGAUCUUCACGUGUGU cagacgacucgcccga 66
F4 gggaggacgaugcgg UUUCGAUAGAGACUUACAGUUGAGCGCGGU cagacgacucgcccga
67 D3 gggaggacgaugcgg UUUGUGAUUUGGAAGUGGGGGGGAUAGGGU
cagacgacucgcccga 68 F9 gggaggacgaugcgg
UGAGCGUGGCAAACGGUUUCGAUAGAGCCU cagacgacucgcccga 69 J1c ggagggcgaugg
GGUGAGCGUGUAAAAGGUUGCGAUAGAGCCU cagacgacucgcccga 70 D6
gggaggacgaugcgg GUAUCUUAUCUUGUUUUCGUUUUUCUGCCCU cagacgaucgcccga 71
E8x gggaggacgaugcgg AGGGUUCUUUUCAUCUUCUUUCUUUCCCCU cagacgacucgcccga
72 H11 gggaggacgaugcgg ACGAAGAAGGUGGUGGAGGAGUUUCGUGCU
cagacgacucgcccga 73 G10 gggaggacgaugcgg
ACGAAGAAGGGGGUGGAGGAGUUUCGUGCU cagacuacucgcccga 74 *Lower case
letters represent the fixed region.
[0158]
6TABLE 5 Rat C5 2'F- RNA seguences* SEQ Clone No: ID NO: Family I
RtC5-116 gggaggacgaugcgg CGAUUACUGGGACGGACUCGCGAUGUGAGCC
cagacgacucgcccga 76 RtC5-39 gggaggacgaugcgg
CGAUUACUGGGACAGACUCGCGAUGUGAGCU cagacgacucgcccga 77 RtC5-69
gggaggacgaugcgg CGACUACUGGGAAGGGUCGCGGUGAGCC cagacgacucgcccga 78
RtC5-95 gggaggacgaugcgg CGAUUACUGGGACAGACUCGCGAUGUGAGCU
cagacgacucgcccga 79 RtC5-146 gggaggacgaugcgg
CGACUACUGGGAGAGUACGCGAUGUGUGCC cagacgacucgcccga 80 Family II
RtC5-168 gggaggacgaugcgg GUCCUCGGGGAAAAUUUCGCGACGUGAACCU
cagacgacucgcccga 81 Family III RtC5-74 gggaggacgaugcgg
CUUCUGAAGAUUAUUUCGCGAUGUQAACUUCAGACCCCU cagacgacucgcccga 82
RtC5-100 gggaggacgaugcgg CUUCUGAAGAUUAUUUCGCGAUGUGAACUCCAGACCCCU
cagacgacucgcccga 83 *Lower case letters represent the fixed
region.
[0159]
7TABLE 6 2'-F RNA Ligands of Complement System Protein Clq* SEQ
Clone No: ID NO: c1qrdl7-33c gggaggacgaugcgg
AAAGUGGAAGUGAAUGGCCGACUUGUCUGGU cagacgacucgcccga 84 C1B100
gggaggacgaugcgg AAACCAAAUCGUCGAUCUUUCCACCGUCGU cagacgacucgcecga 85
c1q-a8c gggaggacgaugcgg AACACGAAACGGAGGUUGACUCGAUCUGGC
cagacgacucgcccga 86 C1q5 cggaggacgaugcgg
AACACGGAAGACAGUGCGACUCGAUCUGGUcag- acgacucgcccga 87 32.C1B76
cgggaggacgaugcgg AACAAGGACAAAAGUGCGAUUCUGUCUGG cagacgacucgcccg 88
c110c gggaggacgaugcgg AACAGACGACUCGCGCAACUACUCUGACGU
cagacgacucgcccga 89 C1B121c gggaggacgaugcgg
AACAGGUAGUUGGGUGACUCUGUGUGACCU cagacgacucgcccga 90 C1q11c
cggaggacgaugcgg AACCAAAUCGUCGAUCUUUCCACCGCUCGU cagacgacucgcccga 91
C15c cgggaggacgaugcgg AACCGCUAUUGAAUGUCACUGCUUCGUGCU
cagacgacucgcccga 92 C1Q-A24'c cgggaggacgaugcgg
AACCGCAUGAGUUAGCCUGGCUCG 93 C1Q-A5'c gggaggacgaugcgg
AACCCAAUCGUCUAAUUCGCUGCUCAUCGUcagacgacucg- cccga 94 C121c
gggaggacgaugcgg AACUCAAUGGGCCUACULTUUCCGUGG- UCCUcagacgacucgcccga
95 c1q-a2C gggaggacgaugcgg AAGCGGUGAGUCGUGGCUUUCUCCUCGAUCCUCGU
cagacgacucgcccga 96 c1q-a12C gggaggacgaugcgg
AAGGAUGACGAGGUGGUUGGGGUUUGUGCUcagacgacucgcccga 97 c1qrd17-43c
gggaggacgaugcgg ACAAGACGAGAACGGGGGGAGCUACC- UGGC cagacgacucgcccga
98 CIQ-A7'C gggaggacgaugcgg AGACACUAAACAAAUUGGCGACCUGACCGU
cagacgacucgcccga 99 03.C1Q.137c gggaggacgaugcgg
AGACGCUCAGACGACUCGCCCGACCACGGAUGCGACCU cagacgacucgcccga 100
14.C1Q156c gggaggacgaugcgg AGAUGGAUGGAAGUGCUAGUCUUCUGGGGU
cagacgacucgccc 101 C1B119 cgggaggacgaugcgg
AGAUGGAUGGAAGUGCUAGUCUUUCUGGGGU cagacgacucgcccga 102 C1Q-A28'C
gggaggacgaugcqg AGCAGUUGAAAGACGUGCGUUUCGUUUGGU cagacgacucgcccga 103
15.C1Q.157c gggaggacgaugcgg AGCACAAUUUUUUCCUUUUCUUUUCGUCCACGUGCU
cagacgacucgcccga 104 44c1qb60c gggaggacgaugcgg
AGCUGAUGAAGAUCAUCUCUGACCCCU cagacgacucgcccga 105 06.C1Q.143c
gggaggacgaugcgg AGCUGAAAGCGAAGUGCGAGGUCUU- UGGUC cagacgacucgcccga
106 C1q4c ggaggacgaugcgg AGCGAAAGUGCGAGUGAUUGACCAGGUGCU
cagacgacucgcccga 107 c1qrd17-52c gggaggacgaugcgg
AGCGUGAGAACAGUUGCGAGAUUGCCUGGU cagacgacucgcccga 108 C111c
gggaggacgaugcgg AGGAGAGUGUGGUGAGGGUCGUUUUGAGGGU cagacgacucgcccga
109 44c1Qb60c gggaggacgaugcgg AGGAGCUGAUGAAGAUGAUCUCUGACCCCU
cagacgacucgcccga 110 24c1qb51C gggaggacgaugcgg
AGUUCCCAGCCGCCUUGAUUUCUCCGU- GGU cagacgacucgcccga 111 31c1qb16
cgggaggacgaugcgg AUAAGUGCGAGUGUAUGAGGUGCGUGUGGU cagacgacucgcccga
112 28c1Qb20c gggaggacgaugcgg AUCUGAGGAGCUCUUCGUCGUGCUGAGGGU
cagacgacucgcccga 113 c1qrd17-61c gggaggacgaugcgg
AUCCGAAUCUUCCUUACACGUCCUG- CUCGU cagacgacucgcccga 114 C1q17
cggaggacgaugcgg AUCCGCAAACCGACAGCUCGAGUUCCGCCU cagacgacucgcccga 115
34c1qb27c gggaggacgaugcgg AUGGUACUUUAGUCUUCCUUGAUUCCGCCU
cagacgacucgcccga 116 C1q7c cggaggacgaugcgg
AUGAUGACUGAACGUGCGACUCGACCUGGC cagacgacucgcccga 117 C1q7c
ggaggacgaugcgg AUGAGGAGGAAGAGUCUGAGGUGCUGGGGU cagacgacucgcccga 118
C1Q-A22'C gggaggacgaugcgg AUUUCGGUCGACUAAAUAGGGGUGGCUCGU
cagacgacucgcccga 119 C122c gggaggacgaugcgg
CAAGAGGUCAGACGACUGCCCCGAGUCCUCC- CCCGGU cagacgacucgcccga 120 C115c
gggaggacgaugcgg CAGUGAAAGGCGAGUUUUCUCCUCUCCCU cagacgacucgcccga 121
09.C1Q.149c gggaggacgaugcgg CAUCGUUCAGGAGAAUCCACUUCGCCUCGU
cagacgacucgcccga 122 04.C1Q.138c gggaggacgaugcgg
CAUCUUCCUUGUUCUUCCAACCCUCCUCCU cagacgacucgcccga 123 C1Q-A4'C
gggaggacgaugcgg CAUCGUAAACAAUUUGUUCCAUCUCCGCCU cagacgacucgcccga 124
c1qrdl7-64c gggaggacgaugcgg CAUUGUCCAAGUUUAGCUGUCCGUG- CUCGU
cagacgacucgcccga 125 46C1Qb64c gggaggacgaugcgg
CAUACUCCGGAUACUAGUCACCAGCCUCGU agacgacucgcccga 126 Cliq6c
gggaggacgaugcgg CCGUCUCGAUCCUUCUAUGCCUUCGCUCGU cagacgacucgcccga 127
23C1Qb4x gggaggacgaugcgg CGGGAAGUUUGAGGUGUANUACCUGUUGUCUGGU
cagacgacucgcccga 128 c1qrd17-63c gggaggacgaugcgg
CUCAACUCUCCCACAGACGACUCGCCCGGGCCUCCU cagacgacucgcccga 129
c1qrd17-47c gggaggacgaugcgg GACUCCUCGACCGACUCGACCGGCUCGU
cagacgacucgccga 130 C1g9c ggaggacgaugcgg
GAACCAAAUCGUCGAUCUUUCCACCGCUCGU cagacgacucgcccga 131 C1qrd-A63c10
cggaggacgaugcgg GACCACCUCGAUCCUCAGCGCCAUUGCCCU cagacgacucgcccga 132
C119c gggaggacgaugcgg GAAGUGGAAGGGUAGUUGUGUGACCU cagacgacucgcccga
133 c1qrd17-42c cggaggacgaugegg
GCAAACUTUUUCCUUUUCCCUUUAUCUUCCUUGCCCU cagacgacucgcccga 134 30c1Q24c
gggaggacgaugcgg GGCCGACGAUUCACCAAUGUUCUCUCUGGU cagacgacucgcccga 135
C1q10c ggaggacgaugcgg GGUUCCUCAAUCACGAUCUCCAUUCCGCUCGU
cagacgacucgcccag 136 C1q20c ggaggacgaugcgg
GUCGACAUUGAAGCUGCUCUGCCUUGAUCCU cagacgacucgcccga 137 08.C1Q.147c
gggaggacgaugcgg UCCAAUUCGUUCUCAUGCCUUUCCGCUCGU cagacgacucgcccga 138
11.C1Q.152c gggaggacgaugcgg UCCGCAACUUUAGCACUCACUGCCUCGU
cagacgacucgcccga 139 26c1Qb4c gggaggacgaugcgg
UCCACAUCGAAUUUUCUGUCCGUUCGU cagacgacucgeccga 140 C1B115c
gggaggacgaugcgg UCGAUGUUCUUCCUCACCACUGCUCGUCGCCU cagacgacucgcccga
141 33c1Q26c gggaggacgaugcgg UCGAGCUGAGAGGGGCUACUUGUUCUGGUCA
cagacgacucgcccga 142 01.C1Q.135c gggaggacgaugcgg
UGGAAGCGAAUGGGCUAGGGUGGGC- UGACCUC cagacgacucgcccga 143 47c1qb65
cgggaggacgaugcgg UGGACUUCUUUUCCUCUUUCCUCCUUCCGCCGGU
cagacgacucgcccga 144 C1q14c ggaggacgaugcgg
UUCCAAAUCGUCUAAGCAUCCCUCGCUCGU cagacgacucgcccag 145 c1qrd17-53c
gggaggacgaugcgg UUCCACAUCGCAAUUUUCUGUCCGUGCUC- GU cagacgacucgcccga
146 c1q-a6C gggaggacgaugcgg UUCCACAUCGAAUUUUCUGUCCGUGUCGU
cagacgacucgcccga 147 C1B114 cgggaggacgaugcgg
UUCCGAUCGACUCCACAUACAUCUGCUCGU cagacgacucgcccga 148 c1qrd17-56c
gggaggacgaugcgg UUCCGACAUCGAUGUUGCUCUUCGCCUCGU cagacgacucgcccga 149
05.C1Q.142c gggaggacgaugcgg UUCCGAAGUUCUUCCCCCGAGCCUUCCCCCUC
cagacgacucgcccga 150 30c1q24 cgggaggacgaugcgg
UUCCGACGAUUCUCCAAUGUUCUCUCUGGU cagacgacucgcccga 151 38c1qb45c
gggaggacgaugcgg UUCCGACGAUUCUCCAAUCUUCUCUCU- GGU cagacgacucgcccga
152 10.C1Q151c gggaggacgaugcgg UUCCGCAAGUUUAGACACUCACUGCCUCGU
cagacgacucgcccga 153 C113x gggaggacgaugcgg
UUCCGCAAAGUAGAUAUNUCAUCCGCACCU cagacgacucgcccga 154 10.C1B.134c
gggaggacgaugcgg UUGAGUGGACAGUGCGAUUCGUUUUGGGGU cagacgacucgcccga 155
*Lower case letters represent the fixed region.
[0160]
8TABLE 7 Binding affinity of C5 nucleic acid ligands Clone SEQ ID
NO Kd (nM) A6 48 35 E11 47 60 E4 63 50 C6 51 30 C9 58 45 G3 64 55
F8 49 30
[0161]
9TABLE 8 Effect of truncation of clone C6 on C5 binding Length Kd
SEQ ID NOS: Sequence (nts) (nM) *75 gA
CgAUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUUCg UC 42 160
CgAUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUUCg 38 20 161
gAUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUUC 36 50 162
AUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUU 34 >10.sup.6 *Fragment of SEQ
ID NO:51 (Table 4)
[0162]
10TABLE 9 Binding of SELEX pools SELEX pool Kd random pool >1 nM
First SELEX, round 12 100 nM Biased SELEX, round 8 5 nM
[0163]
11TABLE 10 Clones from Biased SELEX SEQ ID Clone No. NO: template
gggagataagaataaacgctcaag GA CGATGCGGTCTCATGCGTCGAGTGTGAGTTTACCTTCG
TC ttcgacaggaggctcacaacaggc 163 YL-8(10): gggagauaagaauaaacgcucaag
UG CGACGCGGUCUCGAGCGCGGAGUUCGAGUUUACCUUCG CA
uucgacaggaggcucacaacaggc 164 YL-33(2): gggagauaagaauaaacgcucaag CU
CGACGCGGUCCCAGGCGUGGAGUCUGGGUUUACCUUCG AG uucgacaggaggcucacaacaggc
165 YL-79(3): gggagauaagaauaaacgcucaag AA
CCACGCGGUCUCAGGCGUAGAGUCUGAGUUUACCUUGG UU uucgacaggaggcucacaacaggc
166 YL-1(2): gggagauaagaauaaacgcucaag AA
CCACGCGGUCUCAGGCGUAGAGUCUGUGUUUACCUUGG UU uucgacaggaggcucacaacaggc
167 YL-71: gggagauaagaauaaacgcucaag UG
CGACGCGGUCUCGAGCGCGGAGUUCGAGUUCACCUUCG CA uucgacaggaggcucacaacaggc
168 YL-39: gggagauaagaauaaacgcucaag CA
CAACGCGGUCUCAUGCGUCGAGUAUGAGUUUACCUUuG UG uucgacaggaggcucacaacaggc
169 YL-60: gggagauaagaauaaacgcucaag GU
CCUCGCGGUCUCAUGCGCCGAGUAUGAGUUUACCUAGG AC uucgacaggaggcucacaacaggc
170 YL-9: gggagauaagaauaaacgcucaag GU
CGUCGCGGUCUGAUGCGCUGAGUAUCAGUUUACCUACG AC uucgacaggaggcucacaacaggc
171 YL-56: gggagauaagaauaaacgcucaag GU
ACACGCGGUCUGACGCGCUGAGUGUCAGUUUACCUUGU AC uucgacaggaggcucacaacaggc
172 YL-63: gggagauaagaauaaacgcucaag
AAACCACGCGGUCUCAGGCGCAGAGUCUGAGUUACCUUCG CA
uucgacaggaggcucacaacaggc 173 YL-29: gggagauaagaauaaacgcucaag AA
CCACGCGGUCUCAGGCGCAGAGUCUGAGUUACCUUGG UU uucgacaggaggcucacaacaggc
174 YL-13: gggagauaagaauaaacgcucaag GA
CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG UC uucgacaggaggcucacaacaggc
175 YL-24: gggagauaagaauaaacgcucaag GC
UGACGCGGUCUCAGGCGUGGAGUCUGAGUUUACCUUCG GC uucgacaggaggcucacaacaggc
176 YL-3: gggagauaagaauaaacgcucaag CA
UGACGCGGUCUCAGGCGUGGAGUCUGAGUUUACCUUCG UG uucgacaggaggcucacaacaggc
177 YL-67: gggagauaagaauaaacgcucaag GU
CGACGCGGUCUCAGGCGUUGAGUCUGUGUUUACCUUCG AC uucgacaggaggcucacaacaggc
178 YL-69: gggagauaagaauaaacgcucaag GU
CGACGCGGUCUCAGGCGUUGAGUCUGUGUUUACCUUCG AC uucgacaggaggcucacaacaggc
179 YL-81: gggagauaagaauaaacgcucaag GA
CGCCGCGGUCUCAGGCGUUGAGUCUGAGUUUACCUGCG UC uucgacaggaggcucacaacaggc
180 YL-15(7): gggagauaagaauaaacgcucaag GA
CGACGCGGUCUGAUGCGCUGAGUGUCAGUUUACCUUCG UC uucgacaggaggcucacaacaggc
181 YL-84: gggagauaagaauaaacgcucaag AA
CGACGCGGUCUGAUGCGCUGAGUGUCAGUGUACCUUCG UC uuogacaggaggcucacaacaggc
182 YL-4(3): gggagauaagaauaaacgcucaag GU
CGACGCGGUCUGAUGCGUAGAGUGUCAGUUUACCUUCG AC uucgacaggaggcucacaacaggc
183 YL-51: gggagauaagaauaaacgcucaag GU
CGACGCGGUCUGAUGCGUAGAGUGUCAGUUCACCUUCG AC uucgacaggaggcucacaacaggc
184 YL-14(2): gggagauaagaauaaacgcucaag UA
CGACGCGGUCCCGUGCGUGGAGUGCGGGUUUACCUUCG UA uucgacaggaggcucacaacaggc
185 YL-23: gggagauaagaauaaacgcucaag GA
CGACGCGGUCUGAUGCGCAGAGUGUCGGUUUACCUUUG UC uucgacaggaggcucacaacaggc
186 YL-59: gggagauaagaauaaacgcucaag GA
CGACGCNGUCUGAUGCGCAGAGUGUCAGUUUACCUUCG AC uucgacaggaggcucacaacaggc
187 YL-91: gggagauaagaauaaacgcucaag GA
CGACGCGGUCUGAUGCGCAGAGUGUCAGUUUACCUUCG UC uucgacaggaggcucacaacaggc
188 YL-50: gggagauaagaauaaacgcucaag GA
CGACGCGGUCGGAUGCGCAGAGUGUCCGUUUACCUUCG UC uucgacaggaggcucacaacaggc
189 *Lower case letters represent the fixed region.
[0164]
12TABLE 11 Binding affinity of clones from Biased SELEX experiment
SEQ ID NO: Clone Kd (nM) 166 YL-79 15 172 YL-56 12 175 YL-13 6 185
YL-14 25 163 Template 30
[0165]
13TABLE 12 Sequences based on YL-13 from Biased SELEX Clone
Sequence SEQ ID NO: M3010 CGC CGC GGU CUC AGG CGC UGA GUC UGA GUU
UAC CUG CG 190 M3020 CGC CGC GGU CUC GGG CGC UGA GUC UGA GUU UAC
CUG CG 191 M3030 CGC CGC GGU CUC AGGCGC UGA GUC UGA GUU UAC CUG CG
192 G,A = 50% 2'-OH:50% 2'-OMe
[0166]
14TABLE 13 Truncates based on YL-13 for hemolytic assay Clone
Sequence SEQ ID NO: YL-13t CGC CGC GGU CUC AGG CGC UGA GUC UGA GUU
UAC CUG CG 194 B2070 CGC CGC GGU CUC AGG CGC UGA GUC UGA GUU UAC
CUG CG 195 M6040 CGC CGC GGU CUCAGG CGC UGA GUC UGA GUU UAC
CUGCG196 G, A = 100% 2'-OMe
[0167]
Sequence CWU 1
1
198 1 78 DNA Artificial Sequence unsure (33)..(62) Description of
Artificial Sequence Completely Synthesized Nucleic Acid. N's at
position 33-62 are a or c or g or t 1 taatacgact cactataggg
aggacgatgc ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nncagacgac tcgcccga
78 2 61 RNA Artificial Sequence unsure (16)..(55) Description of
Artificial Sequence Completely Synthesized Nucleic Acid. N's at
position 16-55 are a or c or g or u. 2 gggaggacga ugcggnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnncagac gacucgcccg 60 a 61 3 32 DNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 3 taatacgact cactataggg aggacgatgc gg 32 4
16 DNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 4 tcgggcgagt cgtctg 16 5 81 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 5 gggaggacga ugcgggagga guggagguaa
acaauagguc gguagcgacu cccacuaaca 60 ggccucagac gacucgcccg a 81 6 80
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 6 gggaggacga ugcgggugga
guggagguaa acaauagguc gguagcgacu cccaguaacg 60 gccucagacg
acucgcccga 80 7 79 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 7
gggaggacga ugcaagugga guggagguau aacggccggu aggcauccca cucgggccua
60 gcucagacga cucgcccga 79 8 79 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 8
gggaggacga ugcgggugga guggggauca uacggcuggu agcacgagcu cccuaacagc
60 ggucagacga cucgcccga 79 9 80 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 9
gggaggacga ugcgggagga guggagguaa acaauaggcc gguagcgacu cccacuaaca
60 gccucagacg acucgcccga 80 10 80 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 10 gggaggacga ugcgguggag uggagguaua ccggccggua gcgcauccca
cucgggucug 60 ugcucagacg acucgcccga 80 11 80 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 11 gggaggacga ugcgggugga gcggagguuu auacggcugg
uagcucgagc ucccuaacac 60 gcgguagacg acucgcccga 80 12 80 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 12 gggaggacga ugcgggugga guggagguau
aacggccggu agcgcauccc acucgggucu 60 gcgguagacg acucgcccga 80 13 80
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 13 gggaggacga ugcgggugga
guggagggua aacaauggcu gguggcauuc ggaaucuccc 60 gcgguagacg
acucgcccga 80 14 79 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 14
gggaggacga ugcggguugc ugguagccug augugggugg agugagugga ggguugaaaa
60 augcagacga cucgcccga 79 15 79 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 15 gggaggacga ugcggcuggu agcaugugca uugaugggag gaguggaggu
caccgucaac 60 cgucagacga cucgcccga 79 16 81 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 16 gggaggacga ugcgguuucu cggccaguag uuugcgggug gaguggaggu
auaucugcgu 60 ccucgcagac gacucgcccg a 81 17 81 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 17 gggaggacga ugcggcaccu caccuccaua uugccgguua
ucgcguaggg ugagcccaga 60 cacgacagac gacucgcccg a 81 18 80 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 18 gggaggacga ugcggcacuc accuucauau
uggccgccau ccccaggguu gagcccagac 60 acagcagacg acucgcccga 80 19 81
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 19 gggaggacga ugcgggcaua
gugggcaucc caggguugcc uaacggcauc cgggguuguu 60 auuggcagac
gacucgcccg a 81 20 78 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 20
gggaggacga ugcggcagac gacucgcccg aggggauccc ccgggccugc ggaauucgau
60 aucagacgac ucgcccga 78 21 62 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 21
gggaggacga ugcggaacuc aaugggccua cuuuuuccgu gguccucaga cgacucgccc
60 ga 62 22 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 22 gggaggacga
ugcggaacuc aaugggccua cuuuuccgug guccucagac gacucgcccg 60 a 61 23
60 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 23 gggaggacga ugcggaacuc
aaugggccga cuuuuuccgu guccucagac gacucgcccg 60 24 60 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 24 gggaggacga ugcggaacuc aaugggccga cuuuccgugg
uccucagacg acucgcccga 60 25 61 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 25
gggaggacga ugcggaacuc aaugggcnua cuuuuccgug guccucagac gacucgcccg
60 a 61 26 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 26 gggaggacga
ugcggaacuc aaugggccga cuuuuccgug guccucagac gacucgcccg 60 a 61 27
60 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 27 gggaggacga ugcggaacuc
aaugggccga cuuuuccgug guccucagac gacugcccga 60 28 60 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 28 gggaggacga ugcggacgca ggggaugcuc acuuugacuu
uaggccagac gacucgcccg 60 29 60 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 29
gggaggacga ugcggacucg gcauucacua acuuuugcgc ucgucagacg acucgcccga
60 30 61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 30 gggaggacga ugcggauaac
gauucggcau ucacuaacuu cucgucagac gacucgcccg 60 a 61 31 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 31 gggaggacga ugcggaugac gauucggcau
ucacuaacuu cucgucagac gacucgcccg 60 a 61 32 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 32 gggaggacga ugcggaugac gauucggcau ucacuaacuu
cucaucagac gacucgcccg 60 a 61 33 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 33 gggaggacga ugcggaugac gauucggcau ucacuaacuu cuacucagac
gacucgcccg 60 a 61 34 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 34
gggaggacga ugcggaucug agccuaaagu cauugugauc auccucagac gacucgcccg
60 a 61 35 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 35 gggaggacga
ugcgggcguu ggcgauuccu aagugucguu cucgucagac gacucgcccg 60 a 61 36
60 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 36 gggaggacga ugcggcgucu
cgagcucuau gcguccucug uggucagacg acucgcccga 60 37 60 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 37 gggaggacga ugcggcguca cgagcuuuau gcguucucug
uggucagacg acucgcccga 60 38 61 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 38
gggaggacga ugcggcuuaa aguuguuuau gaucauuccg uacgucagac gacucgcccg
60 a 61 39 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 39 gggaggacga
ugcgggcguu ggcgauuggu aagugucguu cucgucagac gacucgcccg 60 a 61 40
61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 40 gggaggacga ugcgggcguc
ucgagcuuua ugcguucucu guggucagac gacucgcccg 60 a 61 41 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 41 gggaggacga ugcgggcguc ucgagcucua
ugcguucucu guggucagac gacucgcccg 60 a 61 42 60 RNA Artificial
Sequence unsure (52) Description of Artificial Sequence Completely
Synthesized Nucleic Acid. N at position 52 is a or c or g or u 42
ggaggacgau gcggggccua aagucaagug aucauccccu gcgucagacg anucgcccga
60 43 61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 43 gggaggacga ugcggguggc
gauuccaagu cuuccgugaa cauggucaga cgacucgccc 60 g 61 44 62 RNA
Artificial Sequence unsure (57) Description of Artificial Sequence
Completely Synthesized Nucleic Acid. N at position 57 is a or c or
g or u 44 gggaggacga ugcgggugac ucgauaucuu ccaaucugua cauggucaga
cgacucnccc 60 ga 62 45 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 45
gggaggacga ugcgguggcg auuccaaguc uuccgugaac auggucagac gacucgcccg
60 a 61 46 58 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 46 gggaggacga
ugcgguggcg auuccaaguc uuccgugaac aucagacgac ucgcccga 58 47 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 47 gggaggacga ugcgguccgg cgcgcugagu
gccgguuauc cucgucagac gacucgcccg 60 a 61 48 62 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 48 gggaggacga ugcgguccgg cgcgcugagu gccgguuuau
ccucgucaga cgacucgccc 60 ga 62 49 62 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 49 gggaggacga ugcggucuca ugcgccgagu gugaguuuac cuucgucaga
cgacucgccc 60 ga 62 50 62 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 50
gggaggacga ugcggucuca ugcgucgagu gugaguuuaa cugcgucaga cgacucgccc
60 ga 62 51 62 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 51 gggaggacga
ugcggucuca ugcgucgagu gugaguuuac cuucgucaga cgacucgccc 60 ga 62 52
62 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 52 gggaggacga ugcggucugc
uacgcugagu ggcuguuuac cuucgucaga cgacucgccc 60 ga 62 53 62 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 53 gggaggacga ugcggucgga ugcgccgagu
cuccguuuac cuucgucaga cgacucgccc 60 ga 62 54 64 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 54 gggaggacga ugcggugagc gcguauagcg guuucgauag
agcugcguca gacgacucgc 60 ccga 64 55 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 55 gggaggacga ugcggugagc gcguauagcg guuucgauag agccucagac
gacucgcccg 60 a 61 56 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 56
gggaggacga ugcggugagc guggcaaacg guuucgauag agccucagac gacucgcccg
60 a 61 57 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 57 gggaggacga
ugcggugagc guguaaaacg guuucgauag agccucagac gacucgcccg 60 a 61 58
61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 58 gggaggacga ugcggugagc
guguaaaacg guuucgauag agccucagac gacucgcccg 60 a 61 59 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 59 gggaggacga ugcggugggc gucagcauuu
cgaucuucgg caccucagac gacucgcccg 60 a 61 60 62 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 60 gggaggacga ugcgggaguu guucggcauu uagaucuccg
cucccucaga cgacucgccc 60 ga 62 61 62 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 61 gggaggacga ugcgggcaaa guucggcauu cagaucucca ugcccucaga
cgacucgccc 60 ga 62 62 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 62
gggaggacga ugcggggcuu cucacauauu cuucucuuuc cccgucagac gacucgcccg
60 a 61 63 49 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 63 gggaggagga
ucgguguuca gcauucagau cuucagacga cucgcccga 49 64 61 RNA Artificial
Sequence unsure (30) Description of Artificial Sequence Completely
Synthesized Nucleic Acid. N at position 30 is a or c or g or u 64
gggaggacga ugcgguguuc agcauucagn aucuucacgu gucgucagac gacucgcccg
60 a 61 65 60 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 65 gggaggacga
ugcgguguuc accauucaga ucuucacgug ucgucagacg acucgcccga 60 66 57 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 66 gggaggacga ugcuguucag cauucagauc
uucacgugug ucagacgacu cgcccga 57 67 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 67 gggaggacga ugcgguuucg auagagacuu acaguugagc gcggucagac
gacucgcccg 60 a 61 68 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 68
gggaggacga ugcgguuugu gauuuggaag ugggggggau agggucagac gacucgcccg
60 a 61 69 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 69 gggaggacga
ugcggugagc guggcaaacg guuucgauag agccucagac gacucgcccg 60 a 61 70
59 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 70 ggagggcgau ggggugagcg
uguaaaaggu ugcgauagag ccucagacga cucgcccga 59 71 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 71 gggaggacga ugcggguauc uuaucuuguu uucguuuuuc
ugcccucaga cgaucgcccg 60 a 61 72 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 72 gggaggacga ugcggagggu ucuuuucauc uucuuucuuu ccccucagac
gacucgcccg 60 a 61 73 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 73
gggaggacga ugcggacgaa gaagguggug gaggaguuuc gugcucagac
gacucgcccg 60 a 61 74 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 74
gggaggacga ugcggacgaa gaagggggug gaggaguuuc gugcucagac gacucgcccg
60 a 61 75 42 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 75 gacgaugcgg
ucucaugcgu cgagugugag uuuaccuucg uc 42 76 62 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 76 gggaggacga ugcggcgauu acugggacgg acucgcgaug
ugagcccaga cgacucgccc 60 ga 62 77 62 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 77 gggaggacga ugcggcgauu acugggacag acucgcgaug ugagcucaga
cgacucgccc 60 ga 62 78 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 78
gggaggacga ugcggcgacu acugggaagg gucgcgaagu gagcccagac gacucgcccg
60 a 61 79 62 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 79 gggaggacga
ugcggcgauu acugggacag acucgcgaug ugagcucaga cgacucgccc 60 ga 62 80
61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 80 gggaggacga ugcggcgacu
acugggagag uacgcgaugu gugcccagac gacucgcccg 60 a 61 81 62 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 81 gggaggacga ugcggguccu cggggaaaau
uucgcgacgu gaaccucaga cgacucgccc 60 ga 62 82 70 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 82 gggaggacga ugcggcuucu gaagauuauu ucgcgaugug
aacuucagac cccucagacg 60 acucgcccga 70 83 70 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 83 gggaggacga ugcggcuucu gaagauuauu ucgcgaugug
aacuccagac cccucagacg 60 acucgcccga 70 84 62 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 84 gggaggacga ugcggaaagu ggaagugaau ggccgacuug
ucuggucaga cgacucgccc 60 ga 62 85 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 85 gggaggacga ugcggaaacc aaaucgucga ucuuuccacc gucgucagac
gacucgcccg 60 a 61 86 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 86
gggaggacga ugcggaacac gaaacggagg uugacucgau cuggccagac gacucgcccg
60 a 61 87 60 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 87 ggaggacgau
gcggaacacg gaagacagug cgacucgauc uggucagacg acucgcccga 60 88 59 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 88 gggaggacga ugcggaacaa ggacaaaagu
gcgauucugu cuggcagacg acucgcccg 59 89 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 89 gggaggacga ugcggaacag acgacucgcg caacuacucu gacgucagac
gacucgcccg 60 a 61 90 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 90
gggaggacga ugcggaacag guaguugggu gacucugugu gaccucagac gacucgcccg
60 a 61 91 60 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 91 ggaggacgau
gcggaaccaa aucgucgauc uuuccaccgc ucgucagacg acucgcccga 60 92 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 92 gggaggacga ugcggaaccg cuauugaaug
ucacugcuuc gugcucagac gacucgcccg 60 a 61 93 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 93 gggaggacga ugcggaaccc aaucgucuaa uucgcugcuc
aucgucagac gacucgcccg 60 a 61 94 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 94 gggaggacga ugcggaaccc aaucgucuaa uucgcugcuc aucgucagac
gacucgcccg 60 a 61 95 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 95
gggaggacga ugcggaacuc aaugggccua cuuuuccgug guccucagac gacucgcccg
60 a 61 96 66 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 96 gggaggacga
ugcggaagcg gugagucgug gcuuucuccu cgauccucgu cagacgacuc 60 gcccga 66
97 61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 97 gggaggacga ugcggaagga
ugacgaggug guugggguuu gugcucagac gacucgcccg 60 a 61 98 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 98 gggaggacga ugcggacaag acgagaacgg
ggggagcuac cuggccagac gacucgcccg 60 a 61 99 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 99 gggaggacga ugcggagaca cuaaacaaau uggcgaccug
accgucagac gacucgcccg 60 a 61 100 69 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 100 gggaggacga ugcggagagg cucagacgac ucgcccgacc acggaugcga
ccucagacga 60 cucgcccga 69 101 59 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 101 gggaggacga ugcggagaug gauggaagug cuagucuucu ggggucagac
gacucgccc 59 102 62 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 102
gggaggacga ugcggagaug gauggaagug cuagucuuuc uggggucaga cgacucgccc
60 ga 62 103 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 103 gggaggacga
ugcggagcag uugaaagacg ugcguuucgu uuggucagac gacucgcccg 60 a 61 104
67 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 104 gggaggacga ugcggagcac
aauuuuuucc uuuucuuuuc guccacgugc ucagacgacu 60 cgcccga 67 105 58
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 105 gggaggacga ugcggagcug
augaagauga ucucugaccc cucagacgac ucgcccga 58 106 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 106 gggaggacga ugcggagcug aaagcgaagu gcgagguguu
ugguccagac gacucgcccg 60 a 61 107 60 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 107 ggaggacgau gcggagcgaa agugcgagug auugaccagg ugcucagacg
acucgcccga 60 108 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 108
gggaggacga ugcggagcgu gagaacaguu gcgagauugc cuggucagac gacucgcccg
60 a 61 109 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 109 gggaggacga
ugcggaggag agugugguga gggucguuug agggucagac gacucgcccg 60 a 61 110
61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 110 gggaggacga ugcggaggag
cugaugaaga ugaucucuga ccccucagac gacucgcccg 60 a 61 111 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 111 gggaggacga ugcggaguuc ccagccgccu
ugauuucucc guggucagac gacucgcccg 60 a 61 112 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 112 gggaggacga ugcggauaag ugcgagugua ugaggugcgu
guggucagac gacucgcccg 60 a 61 113 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 113 gggaggacga ugcggaucug aggagcucuu cgucgugcug agggucagac
gacucgcccg 60 a 61 114 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 114
gggaggacga ugcggauccg aaucuuccuu acacguccug cucgucagac gacucgcccg
60 a 61 115 60 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 115 ggaggacgau
gcggauccgc aaaccgacag cucgaguucc gccucagacg acucgcccga 60 116 61
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 116 gggaggacga ugcggauggu
acuuuagucu uccuugauuc cgccucagac gacucgcccg 60 a 61 117 60 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 117 ggaggacgau gcggaugaug acugaacgug
cgacucgacc uggccagacg acucgcccga 60 118 60 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 118 ggaggacgau gcggaugagg aggaagaguc ugaggugcug gggucagacg
acucgcccga 60 119 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 119
gggaggacga ugcggauuuc ggucgacuaa auaggggugg cucgucagac gacucgcccg
60 a 61 120 68 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 120 gggaggacga
ugcggcaaga ggucagacga cugccccgag uccucccccg gucagacgac 60 ucgcccga
68 121 60 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 121 gggaggacga
ugcggcagug aaaggcgagu uuucuccucu cccucagacg acucgcccga 60 122 61
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 122 gggaggacga ugcggcaucg
uucaggagaa uccacuucgc cucgucagac gacucgcccg 60 a 61 123 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 123 gggaggacga ugcggcaucu uccuuguucu
uccaaccgug cuccucagac gacucgcccg 60 a 61 124 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 124 gggaggacga ugcggcaucg uaaacaauuu guuccaucuc
cgccucagac gacucgcccg 60 a 61 125 61 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 125 gggaggacga ugcggcauug uccaaguuua gcuguccgug cucgucagac
gacucgcccg 60 a 61 126 60 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 126
gggaggacga ugcggcauag uccggauacu agucaccagc cucguagacg acucgcccga
60 127 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 127 gggaggacga
ugcggccguc ucgauccuuc uaugccuucg cucgucagac gacucgcccg 60 a 61 128
65 RNA Artificial Sequence unsure (34) Description of Artificial
Sequence Completely Synthesized Nucleic Acid. N at position 34 is a
or c or g or u 128 gggaggacga ugcggcggga aguuugaggu guanuaccug
uugucugguc agacgacucg 60 cccga 65 129 67 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 129 gggaggacga ugcggcucaa cucucccaca gacgacucgc ccgggccucc
ucagacgacu 60 cgcccga 67 130 58 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 130
gggaggacga ugcgggacuc cucgaccgac ucgaccggcu cgucagacga cucgccga 58
131 61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 131 ggaggacgau gcgggaacca
aaucgucgau cuuuccaccg cucgucagac gacucgcccg 60 a 61 132 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 132 gggaggacga ugcgggacca ccucgauccu
cagcgccauu gcccucagac gacucgcccg 60 a 61 133 57 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 133 gggaggacga ugcgggaagu ggaaggguag uugugugacc
ucagacgacu cgcccga 57 134 67 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 134
cggaggacga ugcgggcaaa cuuuuccuuu ucccuuuauc uuccuugccc ucagacgacu
60 cgcccga 67 135 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 135
gggaggacga ugcggggccg acgauucacc aauguucucu cuggucagac gacucgcccg
60 a 61 136 62 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 136 ggaggacgau
gcgggguucc ucaaugacga ucuccauucc gcucgucaga cgacucgccc 60 ag 62 137
61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 137 ggaggacgau gcgggucgac
auugaagcug cucugccuug auccucagac gacucgcccg 60 a 61 138 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 138 gggaggacga ugcgguccaa uucguucuca
ugccuuuccg cucgucagac gacucgcccg 60 a 61 139 59 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 139 gggaggacga ugcgguccgc aaguuuagca cucacugccu
cgucagacga cucgcccga 59 140 58 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 140
gggaggacga ugcgguccac aucgaauuuu cuguccguuc gucagacgac ucgcccga 58
141 63 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 141 gggaggacga ugcggucgau
guucuuccuc accacugcuc gucgccucag acgacucgcc 60 cga 63 142 62 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 142 gggaggacga ugcggucgag cugagagggg
cuacuuguuc uggucacaga cgacucgccc 60 ga 62 143 63 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 143 gggaggacga ugcgguggaa gcgaaugggc uagggugggc
ugaccuccag acgacucgcc 60 cga 63 144 64 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 144 gggaggacga ugcgguggac uucuuuuccu cuuccuccuu ccgccgguca
gacgacucgc 60 ccga 64 145 60 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 145
ggaggacgau gcgguuccaa aucgucuaag caucgcucgc ucgucagacg acucgcccag
60 146 62 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 146 gggaggacga
ugcgguucca caucgcaauu uucuguccgu gcucgucaga cgacucgccc 60 ga 62 147
60 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 147 gggaggacga ugcgguucca
caucgaauuu ucuguccgug ucgucagacg acucgcccga 60 148 61 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 148 gggaggacga ugcgguuccg aucgacucca
cauacaucug cucgucagac gacucgcccg 60 a 61 149 61 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 149 gggaggacga ugcgguuccg acaucgaugu ugcucuucgc
cucgucagac gacucgcccg 60 a 61 150 63 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 150 gggaggacga ugcgguuccg aaguucuucc cccgagccuu cccccuccag
acgacucgcc 60 cga 63 151 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 151
gggaggacga ugcgguuccg acgauucucc aauguucucu cuggucagac gacucgcccg
60 a 61 152 61 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 152 gggaggacga
ugcgguuccg acgauucucc aaucuucucu cuggucagac gacucgcccg 60 a 61 153
61 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 153 gggaggacga ugcgguuccg
caaguuuaga cacucacugc cucgucagac gacucgcccg 60 a 61 154 61 RNA
Artificial Sequence unsure (33) Description of Artificial Sequence
Completely Synthesized Nucleic Acid. N at position 33 is a or c or
g or u 154 gggaggacga ugcgguuccg caaaguagau aunucauccg cacgucagac
gacucgcccg 60 a 61 155 61 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 155
gggaggacga ugcgguugag uggacagugc gauucguuuu ggggucagac gacucgcccg
60 a 61 156 98 DNA Artificial Sequence unsure (33)..(72)
Description of Artificial Sequence Completely Synthesized Nucleic
Acid. N's at positions 33-72 are a or c or g or t. 156 taatacgact
cactataggg aggacgatgc ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60
nnnnnnnnnn nnnnnnnnnn nncagacgac tcgcccga 98 157 81 RNA Artificial
Sequence unsure (16)..(65) Description of Artificial Sequence
Completely Synthesized Nucleic Acid. N's at positions 16-65 are a
or c or g or u. 157 gggaggacga ugcggnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn 60 nnnnncagac gacucgcccg a 81 158 40 DNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 158 taatacgact cactataggg agataagaat
aaacgctcaa 40 159 24 DNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 159
gcctgttgtg agcctcctgt cgaa 24 160 38 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 160 cgaugcgguc ucaugcgucg agugugaguu uaccuucg 38 161 36 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 161 gaugcggucu caugcgucga gugugaguuu
accuuc 36 162 34 RNA Artificial Sequence Description of Artificial
Sequence Completely Synthesized Nucleic Acid 162 augcggucuc
augcgucgag ugugaguuua ccuu 34 163 90 DNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 163 gggagataag aataaacgct caaggacgat gcggtctcat gcgtcgagtg
tgagtttacc 60 ttcgtcttcg acaggaggct cacaacaggc 90 164 90 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 164 gggagauaag aauaaacgcu caagugcgac
gcggucucga gcgcggaguu cgaguuuacc 60 uucgcauucg acaggaggcu
cacaacaggc 90 165 90 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 165
gggagauaag aauaaacgcu caagcucgac gcggucccag gcguggaguc uggguuuacc
60 uucgaguucg acaggaggcu cacaacaggc 90 166 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 166 gggagauaag aauaaacgcu caagaaccac gcggucucag
gcguagaguc ugaguuuacc 60 uugguuuucg acaggaggcu cacaacaggc 90 167 90
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 167 gggagauaag aauaaacgcu
caagaaccac gcggucucag gcguagaguc uguguuuacc 60 uugguuuucg
acaggaggcu cacaacaggc 90 168 90 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 168
gggagauaag aauaaacgcu caagugcgac gcggucucga gcgcggaguu cgaguucacc
60 uucgcauucg acaggaggcu cacaacaggc 90 169 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 169 gggagauaag aauaaacgcu caagcacaac gcggucucau
gcgucgagua ugaguuuacc 60 uuuguguucg acaggaggcu cacaacaggc 90 170 90
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 170 gggagauaag aauaaacgcu
caagguccuc gcggucucau gcgccgagua ugaguuuacc 60 uaggacuucg
acaggaggcu cacaacaggc 90 171 90 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 171
gggagauaag aauaaacgcu caaggucguc gcggucugau gcgcugagua ucaguuuacc
60 uacgacuucg acaggaggcu cacaacaggc 90 172 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 172 gggagauaag aauaaacgcu caagguacac gcggucugac
gcgcugagug ucaguuuacc 60 uuguacuucg acaggaggcu cacaacaggc 90 173 91
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 173 gggagauaag aauaaacgcu
caagaaacca cgcggucuca ggcgcagagu cugaguuuac 60 cuucgcauuc
gacaggaggc ucacaacagg c 91 174 90 RNA Artificial Sequence
Description of Artificial Sequence Completely Synthesized Nucleic
Acid 174 gggagauaag aauaaacgcu caagaaccac gcggucucag gcgcagaguc
ugaguuuacc 60 uugguuuucg acaggaggcu cacaacaggc 90 175 90 RNA
Artificial Sequence Description of Artificial Sequence Completely
Synthesized Nucleic Acid 175 gggagauaag aauaaacgcu caaggacgcc
gcggucucag gcgcugaguc ugaguuuacc 60 ugcgucuucg acaggaggcu
cacaacaggc 90 176 90 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 176
gggagauaag aauaaacgcu caaggcugac gcggucucag gcguggaguc ugaguuuacc
60 uucggcuucg acaggaggcu cacaacaggc 90 177 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 177 gggagauaag aauaaacgcu caagcaugac gcggucucag
gcguggaguc ugaguuuacc 60 uucguguucg acaggaggcu cacaacaggc 90 178 90
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 178 gggagauaag aauaaacgcu
caaggucgac gcggucucag gcguugaguc uguguuuacc 60 uucgacuucg
acaggaggcu cacaacaggc 90 179 90 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 179
gggagauaag aauaaacgcu caaggucgac gcggucucag gcguugaguc uguguuuacc
60 uucgacuucg acaggaggcu cacaacaggc 90 180 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 180 gggagauaag aauaaacgcu caaggacgcc gcggucucag
gcguugaguc ugaguuuacc 60 ugcgucuucg acaggaggcu cacaacaggc 90 181 90
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 181 gggagauaag aauaaacgcu
caaggacgac gcggucugau gcgcugagug ucaguuuacc 60 uucgucuucg
acaggaggcu cacaacaggc 90 182 90 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 182
gggagauaag aauaaacgcu caagaacgac gcggucugau gcgcugagug ucaguguacc
60 uucgucuucg acaggaggcu cacaacaggc 90 183 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 183 gggagauaag aauaaacgcu caaggucgac gcggucugau
gcguagagug ucaguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 184 90
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 184 gggagauaag aauaaacgcu
caaggucgac gcggucugau gcguagagug ucaguucacc 60 uucgacuucg
acaggaggcu cacaacaggc 90 185 90 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 185
gggagauaag aauaaacgcu caaguacgac gcggucccgu gcguggagug cggguuuacc
60 uucguauucg acaggaggcu cacaacaggc 90 186 90 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 186 gggagauaag aauaaacgcu caaggacgac gcggucugau
gcgcagagug ucgguuuacc 60 uuugucuucg acaggaggcu cacaacaggc 90 187 90
RNA Artificial Sequence unsure (33) Description of Artificial
Sequence Completely Synthesized Nucleic Acid. N at position 33 is a
or c or g or u 187 gggagauaag aauaaacgcu caaggacgac gcngucugau
gcgcagagug ucaguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 188 90
RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 188 gggagauaag aauaaacgcu
caaggacgac gcggucugau gcgcagagug ucaguuuacc 60 uucgucuucg
acaggaggcu cacaacaggc 90 189 90 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 189
gggagauaag aauaaacgcu caaggacgac gcggucggau gcgcagagug uccguuuacc
60 uucgucuucg acaggaggcu cacaacaggc 90 190 38 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 190 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 191
37 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 191 cgccgcgguu cgggcgcuga
gucugaguuu accugcg 37 192 38 RNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 192
cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 193 38 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 193 cgaugcgguc ucaugcgucg agugugaguu uaccuucg 38 194
38 RNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 194 cgccgcgguc ucaggcgcug
agucugaguu uaccugcg 38 195 38 RNA Artificial Sequence Description
of Artificial Sequence Completely Synthesized Nucleic Acid 195
cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 196 38 RNA Artificial
Sequence Description of Artificial Sequence Completely Synthesized
Nucleic Acid 196 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 197
37 DNA Artificial Sequence Description of Artificial Sequence
Completely Synthesized Nucleic Acid 197 ggcggggcta cgtaccgggg
ctttgtaaaa ccccgcc 37 198 25 DNA Artificial Sequence Description of
Artificial Sequence Completely Synthesized Nucleic Acid 198
ctctcgcacc catctctctc cttct 25
* * * * *