U.S. patent application number 10/438683 was filed with the patent office on 2003-10-02 for method and reagent for inhibiting p-glycoprotein (mdr-1 gene).
This patent application is currently assigned to Ribozyme Pharmaceuticals, Inc.. Invention is credited to Thompson, James D..
Application Number | 20030186923 10/438683 |
Document ID | / |
Family ID | 25381540 |
Filed Date | 2003-10-02 |
United States Patent
Application |
20030186923 |
Kind Code |
A1 |
Thompson, James D. |
October 2, 2003 |
Method and reagent for inhibiting P-glycoprotein (mdr-1 gene)
Abstract
An enzymatic RNA molecule which specifically cleaves mRNA
encoded by an mdr-1 gene.
Inventors: |
Thompson, James D.;
(Lafayette, CO) |
Correspondence
Address: |
Andrew W. Williams
McDonnell Boehnen Hulbert & Berghoff
32nd Floor
300 S. Wacker Drive
Chicago
IL
60606
US
|
Assignee: |
Ribozyme Pharmaceuticals,
Inc.
|
Family ID: |
25381540 |
Appl. No.: |
10/438683 |
Filed: |
May 15, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10438683 |
May 15, 2003 |
|
|
|
09378553 |
Aug 19, 1999 |
|
|
|
09378553 |
Aug 19, 1999 |
|
|
|
08192942 |
Feb 7, 1994 |
|
|
|
5989906 |
|
|
|
|
08192942 |
Feb 7, 1994 |
|
|
|
07882885 |
May 14, 1992 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/320.1; 435/325; 435/366; 435/456; 536/23.1 |
Current CPC
Class: |
C12N 2310/121 20130101;
C12N 2310/122 20130101; C12N 15/1138 20130101; C12N 15/113
20130101; C12N 15/1135 20130101; C12N 2310/124 20130101; C12N
2310/123 20130101; C12N 2310/126 20130101 |
Class at
Publication: |
514/44 ; 435/366;
435/325; 536/23.1; 435/456; 435/320.1 |
International
Class: |
A61K 048/00; C07H
021/02; C12N 005/08; C12N 015/86 |
Claims
1. An enzymatic RNA molecule which is active to specifically cleave
mRNA expressed from an mdr 1 gene.
2. The enzymatic RNA molecule of claim 1 which cleaves the sequence
shown as any of SEQ. ID. NOS. 1-9.
3. The enzymatic RNA molecule of claim 1 wherein said RNA molecule
is in a hammerhead motif.
4. The enzymatic RNA molecule of claim 1 wherein said RNA molecule
is in a hairpin, hepatitis Delta virus, group 1 intro, or RnaseP
RNA motif.
5. A mammalian cell including an enzymatic RNA molecule of claim
1.
6. A mammalian cell including an enzymatic RNA molecule of claim
2.
7. A mammalian cell including an enzymatic RNA molecule of claim
3.
8. A mammalian cell including an enzymatic RNA molecule of claim
4.
9. The cell of claim 5, wherein said cell is a human cell.
10. The cell of claim 6, wherein said cell is a human cell.
11. The cell of claim 7, wherein said cell is a human cell.
12. The cell of claim 8, wherein said cell is a human cell.
13. An expression vector including nucleic acid encoding the
catalytic RNA molecule of any of claim 1, in a manner which allows
expression of that enzymatic RNA molecule within a mammalian
cell.
14. An expression vector including nucleic acid encoding the
catalytic RNA molecule of any of claim 2, in a manner which allows
expression of that enzymatic RNA molecule within a mammalian
cell.
15. An expression vector including nucleic acid encoding the
catalytic RNA molecule of any of claim 3, in a manner which allows
expression of that enzymatic RNA molecule within a mammalian cell.
Description
BACKGROUND OF THE INVENTION
[0001] This invention relates to methods for treating cancer.
[0002] Transformation is a cumulative process whereby normal
control of cell growth and differentiation is interrupted, usually
through the accumulation of mutations affecting the expression of
genes that regulate cell growth and differentiation.
[0003] Scanlon WO91/18625, WO91/18624, and WO91/18913 describes a
ribozyme effective to cleave oncogene RNA in the Hras gene. This
ribozyme is said to inhibit C-fos expression in response to
cis-plantin or other stimuli.
SUMMARY OF THE INVENTION
[0004] This invention concerns use of a ribozyme targeted to the
P-glycoprotein (mdr-1 gene) prior to and/or during administration
of anticancer chemotherapeutic agents. Inclusion of such a ribozyme
increases the susceptibility of the transformed cells to such
agents.
[0005] Applicant notes that relapse of disease caused by cancerous
cells after administration of chemotherapeutic agents is a major
problem in obtaining lasting remissions in a clinic. In some
neoplasias, relapse is caused by the expansion of a population of
transformed cells resistant to the initial and subsequent forms of
chemotherapy due to inappropriate expression of the mdr-1 gene,
also called P-glycoprotein. Such expression is usually caused by
selection of transformed cells that have amplified the mdr-1 gene
and thus produce increased amounts of the mdr-1 gene product.
Applicant describes treatment of and prevention of this condition
by use of ribozymes targeted to the mRNA encoded by this gene.
[0006] The MDR1 gene encodes a 170 kDa integral membrane transport
protein that confers resistance to certain chemotherapeutic agents
such as colchicine, doxorubicin, actinomycin D and vinblastine
(reviewed in Gottesman and Pastan 263 J. Biol. Chem. 12163, 1988).
The gene has been isolated from both human and rodent cells
selected in vitro for resistance to such agents (Roninson et al 309
Nature 626, 1984; and Roninson et al. 83 Proc. Natl. Acad. Sci USA,
4538, 1986), and the entire 4.5-kb MDR1 transcript encoding the
human MDR1 has been sequenced (Chen et al., 47 Cell 381, 1986, EMBL
accession # M14758). The gene is normally expressed in the cells of
the colon, small intestine, kidney, liver and adrenal gland. High
levels of MDR1 transcript have been found in adenocarcinomas that
are intrinsically resistant to a broad range of chemotherapeutic
agents, such as those derived from adrenal, kidney, liver and
bowel.
[0007] Ribozymes are RNA molecules having an enzymatic activity
which is able to repeatedly cleave other separate RNA molecules in
a nucleotide base sequence specific manner. Such enzymatic RNA
molecules can be targeted to virtually any RNA transcript and
efficient cleavage has been achieved in vitro. Kim et al., 84 Proc.
Nat. Acad. of Sci. USA 8788, 1987, Hazeloff et al., 234 Nature 585,
1988, Cech, 260 JAMA 3030, 1988, and Jefferies et al., 17 Nucleic
Acid Research 1371, 1989.
[0008] Ribozymes act by first binding to a target RNA. Such binding
occurs through the target RNA binding portion of a ribozyme which
is held in close proximity to an enzymatic portion of the RNA which
acts to cleave the target RNA. Thus, the ribozyme first recognizes
and then binds a target RNA through complementary base-pairing, and
once bound to the correct site, acts enzymatically to cut the
target RNA. Strategic cleavage of such a target RNA will destroy
its ability to direct synthesis of an encoded protein. After a
ribozyme has bound and cleaved its RNA target it is released from
that RNA to search. for another target and can repeatedly bind and
cleave new targets.
[0009] The enzymatic nature of a ribozyme is advantageous over
other technologies, such as antisense technology (where a nucleic
acid molecule simply binds to a nucleic acid target to block its
translation) since the effective concentration of ribozyme
necessary to effect a therapeutic treatment is lower than that of
an antisense oligonucleotide. This advantage reflects the ability
of the ribozyme to act enzymatically. Thus, a single ribozyme
molecule is able to cleave many molecules of target RNA. In
addition, the ribozyme is a highly specific inhibitor, with the
specificity of inhibition depending not only on the base pairing
mechanism of binding, but also on the mechanism by which the
molecule inhibits the expression of the RNA to which it binds. That
is, the inhibition is caused by cleavage of the RNA target and so
specificity is defined as the ratio of the rate of cleavage of the
targeted RNA over the rate of cleavage of non-targeted RNA. This
cleavage mechanism is dependent upon factors additional to those
involved in base pairing. Thus, it is thought that the specificity
of action of a ribozyme is greater than that of antisense
oligonucleotide binding the same RNA site.
[0010] Thus, the invention features novel enzymatic RNA molecules,
or ribozymes, and methods for their use for inhibiting mdr-1 mRNA
expression. Such ribozymes can be used in a method for treatment of
disease caused by expression of the mdr-1 gene in man and other
animals, including other primates. This conclusion, as noted above,
is based upon the finding that many forms of cancer become
unresponsive to certain chemotherapeutic agents as a result of
overexpression of the mdr-1 gene. The advantage of using ribozymes
of the present invention is their ability to specifically cleave
the targeted mRNA, ultimately leading to a reduction in target gene
activity through a decrease in level of the gene product. Use of
mdr-1 specific ribozymes removes the mechanism of drug resistance
used by transformed cells, and thus enhances drug therapies for
tumor cell growth. These agents can be administered prior to and
during chemotherapeutic treatment of those neoplasias known to have
a high incidence of drug resistance, or can be used
prophylactically for all neoplasias.
[0011] Thus, in the first aspect the invention features an
enzymatic RNA molecule (or ribozyme) which cleaves mdr-1 mRNA
(i.e., mRNA expressed from the mdr-1 gene), or its equivalent. In
particular, the invention features hammerhead ribozymes designed to
cleave accessible areas of the mdr-1 mRNA. Such areas include those
listed below:
1 NT303 UCUUCCAAGCUCAAAGAAGCAGA SEQ. ID. NO. 1 NT476
AAACUGAACAAUAAAAGUGAA SEQ. ID. NO. 2 NT497 AAAGAUAAGAAGGAAAAG SEQ.
ID. NO. 3 NT514 GAAACCAACUGUCAGUGUA SEQ. ID. NO. 4 NT546
GCUAUUCAAAUUGGCUUGACAA SEQ. ID. NO. 5 NT585 GAACUUUGGC SEQ. ID. NO.
6 NT612 CUGGACUUCC SEQ. ID. NO. 7 NT641 GGAGAAAUGAC SEQ. ID. NO. 8
NT686 CUCAUGUCAAACAUCACUAAUA SEQ. ID. NO. 9
[0012] By "enzymatic RNA molecule" it is meant an RNA molecule
which has complementarity in a substrate binding region to a
specified gene target, and also has an enzymatic activity which is
active to specifically cleave RNA in that target. That is, the
enzymatic RNA molecule is able to intermolecularly cleave RNA and
thereby inactivate a target RNA molecule. This complementarity
functions to allow sufficient hybridization of the enzymatic RNA
molecule to the target RNA to allow the cleavage to occur. One
hundred percent complementarity is preferred, but complementarity
as low as 50-75% may also be useful in this invention. By
"equivalent" RNA to mdr-1 mRNA is meant to include those naturally
occurring mRNA molecules associated with neoplastic diseases in
various animals, including humans, and other primates, which have
similar structures and functions to that mdr-1 mRNA in humans. The
deduced sequences of the mouse and human P-glycoproteins are 80%
identical.
[0013] In preferred embodiments, the enzymatic RNA molecule is
formed in a hammerhead motif, but may also be formed in the motif
of a hairpin, hepatitis delta virus, group I intron or RNaseP RNA
(in association with an RNA guide sequence). Examples of such
hammerhead motifs are described by Rossi et al., 8 AIDS RESEARCH
AND HUMAN RETROVIRUSES 183, 1992, of hairpin motifs, Hampel and
Tritz, 28 Biochemistry 4929, 1989 and Hampel et al., 18 Nucleic
Acids Research 299, 1990, and an example of the hepatitis delta
virus motif is described by Perrotta and Been, 31 Biochemistry 16,
1992, of the RNaseP motif by Guerrier-Takada et al., 35 Cell 849,
1983, and of the group I intron by Cech et al., U.S. Pat. No.
4,987,071. These specific motifs are not limiting in the invention
and those skilled in the art will recognize that all that is
important in an enzymatic RNA molecule of this invention is that it
has a specific substrate binding site which is complementary to one
or more of the target mRNA regions, and that it have nucleotide
sequences within or surrounding that substrate binding site which
impart an mRNA cleaving activity to the molecule.
[0014] In a second related aspect, the invention features a
mammalian cell which includes an enzymatic RNA molecule as
described above. Preferably, the mammalian cell is a human or other
primate cell.
[0015] In a third related aspect, the invention features an
expression vector which includes nucleic acid encoding the
enzymatic RNA molecules described above, located in the vector,
e.g., in a manner which allows expression of that enzymatic RNA
molecule within a mammalian cell.
[0016] In a fourth related aspect, the invention features a method
for treatment of an mdr-1 gene-related disease by administering to
a patient an enzymatic RNA molecule which cleaves mdr-1 mRNA.
[0017] The invention provides a class of chemical cleaving agents
which exhibit a high degree of specificity for the mRNA encoded by
an mdr-1 gene. If desired, such ribozymes can be designed to target
equivalent single-stranded DNAs by methods known in the art. The
ribozyme molecule is preferably targeted to a highly conserved
sequence region of the mdr-1 mRNA. Such enzymatic RNA molecules can
be delivered exogenously to affected cells. In the preferred
hammerhead motif the small size (less than 40 nucleotides,
preferably between 32 and 36 nucleotides in length) of the molecule
allows the cost of treatment to be reduced compared to other
ribozyme motifs.
[0018] Synthesis of ribozymes greater than 100 nucleotides in
length is very difficult using automated methods, and the
therapeutic cost of such molecules is prohibitive. Delivery of
ribozymes by expression vectors is primarily feasible using only ex
vivo treatments. This limits the utility of this approach. In this
invention, small ribozyme motifs (e.g., of the hammerhead
structure, shown generally in FIG. 1) are used for exogenous
delivery. The simple structure of these molecules also increases
the ability of the ribozyme to invade targeted regions of the mRNA
structure. Thus, unlike the situation when the hammerhead structure
is included within longer transcripts, there are no non-ribozyme
flanking sequences to interfere with correct folding of the
ribozyme structure or with complementary binding of the ribozyme to
the mRNA target region.
[0019] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DESCRIPTION OF THE PREFERRED EMBODIMENT
[0020] The drawing will first briefly be described.
DRAWING
[0021] FIG. 1 is a diagrammatic representation of a hammerhead
motif ribozyme showing stems I, II and III (marked (I), (II) and
(III) respectively) interacting with a target region. The 5' and 3'
ends of both ribozyme and target are shown. Dashes indicate
base-paired nucleotides.
TARGET SITES
[0022] Ribozymes targeting selected regions of the mdr-1 mRNA are
preferably chosen to cleave the target RNA in a manner which
inhibits translation of the mRNA. Selection of effective target
sites within these critical regions of mRNA entails testing. the
accessibility of the target mRNA to hybridization with various
oligonucleotide probes. These studies can be performed using RNA
probes and assaying accessibility by cleaving the hybrid molecule
with RNaseH (see below). Alternatively, such a study can use
ribozyme probes designed from secondary structure predictions of
the RNAs, and assaying cleavage products by polyacrylamide gel
electrophoresis (PAGE), to detect the presence of cleaved and
uncleaved molecules.
[0023] The following is but one example of a method by which
suitable target sites can be identified and is not limiting in this
invention. Generally, the method involves identifying potential
cleavage sites for a hammerhead ribozyme, and then testing each of
these sites to determine their suitability as targets by ensuring
that secondary structure formation is minimal.
[0024] The sequence of the mRNA is studied to determine putative
ribozyme cleavage sites. These sites represent the preferred sites
for hammerhead or other ribozyme cleavage within these target
RNAs.
[0025] Short RNA substrates corresponding to each of the gene sites
are designed. Each substrate is composed of two to three
nucleotides at the 5' and 3' ends that will not base pair with a
corresponding ribozyme recognition region. The unpaired regions
flank a central region of 12-14 nucleotides to which complementary
arms in the ribozyme are designed.
[0026] The structure of each substrate sequence is predicted using
a PC fold computer program. Sequences which give a positive free
energy of binding are accepted. Sequences which give a negative
free energy are modified by trimming one or two bases from each of
the ends. If the modified sequences are still predicted to have a
strong secondary structure, they are rejected.
[0027] After substrates are chosen, ribozymes are designed to each
of the RNA substrates. Ribozyme folding is also analyzed using PC
fold.
[0028] Ribozyme molecules are sought which form hammerhead motif
stem II (see FIG. 1) regions and contain flanking arms which are
devoid of intramolecular base pairing. Often the ribozymes are
modified by trimming a base from the ends of the ribozyme, or by
introducing additional base pairs in stem II to achieve the desired
fold. Ribozymes with incorrect folding are rejected. After
substrate/ribozyme pairs are found to contain correct
intramolecular structures, the molecules are folded together to
predict intermolecular interactions. A schematic representation of
a ribozyme with its coordinate base pairing to its cognate target
sequence is shown in FIG. 1.
[0029] Those targets thought to be useful as ribozyme targets
can-be tested to determine accessibility to nucleic acid probes in
a ribonuclease H assay (see below). This assay provides a quick
test of the use of the target site without requiring synthesis of a
ribozyme. It can be used to screen for sites most suited for
ribozyme attack.
[0030] Synthesis of Ribozymes
[0031] Ribozymes useful in this invention can be produced by gene
transcription as described by Cech, supra, or by chemical
synthesis. Chemical synthesis of RNA is similar to that for DNA
synthesis. The additional 2'-OH group in RNA, however, requires a
different protecting group strategy to deal with selective 3'-5'
internucleotide bond formation, and with RNA susceptibility to
degradation in the presence of bases. The recently developed method
of RNA synthesis utilizing the t-butyldimethylsilyl group for the
protection of the 2' hydroxyl is the most reliable method for
synthesis of ribozymes. The method reproducibly yields RNA with the
correct 3'-5' internucleotide linkages, with average coupling
yields in excess of 99%, and requires only a two-step deprotection
of the polymer.
[0032] A method, based upon H-phosphonate chemistry gives a
relatively lower coupling efficiency than a method based upon
phosphoroamidite chemistry. This is a problem for synthesis of DNA
as well. A promising approach to scale-up of automatic
oligonucleotide synthesis has been described recently for the
H-phosphonates. A combination of a proper coupling time and
additional capping of "failure" sequences gave high yields in the
synthesis of oligodeoxynucleotides in scales in the range of 14
.mu.moles with as little as 2 equivalents of a monomer in the
coupling step. Another alternative approach is to use soluble
polymeric supports (e.g., polyethylene glycols), instead of the
conventional solid supports. This method can yield short
oligonucleotides in hundred milligram quantities per batch
utilizing about 3 equivalents of a monomer in a coupling step.
[0033] Various modifications to ribozyme structure can be made to
enhance the utility of ribozymes. Such modifications will enhance
shelf-life, half-life in vitro, stability, and ease of introduction
of such ribozymes to the target site, e.g., to enhance penetration
of cellular membranes, and confer the ability to recognize and bind
to targeted cells.
[0034] Exogenous delivery of ribozymes benefits from chemical
modification of the backbone, e.g., by the overall negative charge
of the ribozyme molecule being reduced to facilitate diffusion
across the cell membrane. The present strategies for reducing the
oligonucleotide charge include: modification of internucleotide
linkages by methylphosphonates, use of phosphoramidites, linking
oligonucleotides to positively charged molecules, and creating
complex packages composed of oligonucleotides, lipids and specific
receptors or effectors for targeted cells. Examples of such
modifications include sulfur-containing ribozymes containing
phosphorothioates and phosphorodithioates as internucleotide
linkages in RNA. Synthesis of such sulfur-modified ribozymes is
achieved by use of the sulfur-transfer reagent,
.sup.3H-1,2-benzenedithiol-3-one 1,1-dioxide. Ribozymes may also
contain ribose modified ribonucleotides. Pyrimidine analogues are
prepared from uridine using a procedure employing diethylamino
sulphur trifluoride (DAST) as a starting reagent. Ribozymes can
also be either electrostatically or covalently attached to
polymeric cations for the purpose of reducing charge. The polymer
can be attached to the ribozyme by simply converting the 3'-end to
a ribonucleoside dialdehyde which is obtained by a periodate
cleavage of the terminal 2',3'-cis diol system. Depending on the
specific requirements for delivery systems, other possible
modifications may include different linker arms containing
carboxyl, amino or thiol functionalities. Yet further examples
include use of methylphosphonates and 2'-o-methylribose and 5' or
3' capping or blocking with m.sub.7GpppG or
m.sub.3.sup.2,2,7GpppG.
[0035] For example, a kinased ribozyme is contacted with guanosine
triphosphate and guanyltransferase to add a m.sup.3G cap to the
ribozyme. After such synthesis, the ribozyme can be gel purified
using standard procedure. To ensure that the ribozyme has the
desired activity, it may be tested with and without the 5' cap
using standard procedures to assay both its enzymatic activity and
its stability.
[0036] Synthetic ribozymes, including those containing various
modifiers, can be purified by high pressure liquid chromatography
(HPLC). Other liquid chromatography techniques, employing reverse
phase columns and anion exchangers on silica and polymeric supports
may also be used.
[0037] These follow an example of the synthesis of one ribozyme. A
solid phase phosphoramidite chemistry was employed. Monomers used
were 2'-tert-butyl-dimethylsilyl cyanoethylphosphoramidities of
uridine, N-benzoyl-cytosine, N-phenoxyacetyl adenosine and
guanosine (Glen Research, Sterling, Va.). Solid phase synthesis was
carried out on either an ABI 394 or 380B DNA/RNA synthesizer using
the standard protocol provided with each machine. The only
exception was that the coupling step was increased from 10 to 12
minutes. The phosphoramidite concentration was 0.1 M. Synthesis was
done on a 1 .mu.mole scale using a 1 .mu.mole RNA reaction column
(Glen Research). The average coupling efficiencies were between 97%
and 98% for the 394 model, and between 97% and 99% for the 380B
model, as determined by a calorimetric measurement of the released
trityl cation.
[0038] Blocked ribozymes were cleaved from the solid support (e.g.,
CPG), and the bases and diphosphoester moiety deprotected in a
sterile vial by dry ethanolic ammonia (2 mL) at 55.degree. C. for
16 hours. The reaction mixture was cooled on dry ice. Later, the
cold liquid was transferred into a sterile screw cap vial and
lyophilized.
[0039] To remove the 2'-tert-butyl-dimethylsilyl groups from the
ribozyme, the residue was suspended in 1 M tetra-n-butylammonium
fluoride in dry THF (TBAF), using a 20 fold excess of the reagent
for every silyl group, for 16 hours at ambient temperature (about
15-25.degree. C.). The reaction was quenched by adding an equal
volume of sterile 1 M triethylamine acetate, pH 6.5. The sample was
cooled and concentrated on a SpeedVac to the half of the initial
volume.
[0040] The ribozymes were purified in two steps by HPLC on a C4 300
.ANG. 5 mm DeltaPak column in an acetonitrile gradient.
[0041] The first step, or "trityl on" step, was a separation of
5'-DMT-protected ribozyme(s) from failure sequences lacking a
5'-DMT group. Solvents used for this step were: A (0.1 M
triethylammonium acetate, pH 6.8) and B (acetonitrile). The elution
profile was: 20% B for 10 minutes, followed by a linear gradient of
20% B to 50% B over 50 minutes, 50% B for 10 minutes, a linear
gradient of 50% B to 100% B over 10 minutes, and a linear gradient
of 100% B to 0% B over 10 minutes.
[0042] The second step was a purification of a completely deblocked
ribozyme by a treatment of 2% trifluoroacetic acid on a C4 300
.ANG. 5 mm DeltaPak column in an acetonitrile gradient. Solvents
used for this second step were: A (0.1 M Triethylammonium acetate,
pH 6.8) and B (80% acetonitrile, 0.1 M triethylammonium acetate, pH
6.8). The elution profile was: 5% B for 5 minutes, a linear
gradient of 5% B to 15% B over 60 minutes, 15% B for 10 minutes,
and a linear gradient of 15% B to 0% B over 10 minutes.
[0043] The fraction containing ribozyme was cooled and lyophilized
on a SpeedVac. Solid residue was dissolved in a minimum amount of
ethanol and sodium perchlorate in acetone. The ribozyme was
collected by centrifugation, washed three times with acetone, and
lyophilized.
[0044] Expression Vector
[0045] While synthetic ribozymes are preferred in this invention,
those produced by expression vectors can also be used. In designing
a suitable ribozyme expression vector the following factors are
important to consider. The final ribozyme must be kept as small as
possible to minimize unwanted secondary structure within the
ribozyme. A promoter (e.g., a T7 promoter) should be chosen to be a
relatively strong promoter, and expressible both in vitro and in
vivo (e.g., by co-infection with the T7 RNA polymerase gene). Such
a promoter should express the ribozyme at a level suitable to
effect production of enough ribozyme to destroy a target RNA, but
not at too high a level to prevent other cellular activities from
occurring (unless cell death itself is desired).
[0046] A hairpin at the 5' end of the ribozyme is useful to ensure
that the required transcription initiation sequence (GG or GGG or
GGGAG) does not bind to some other part of the ribozyme and thus
affect regulation of the transcription process. The 5' hairpin is
also useful to protect the ribozyme from 5'-3' exonucleases. A
selected hairpin at the 3' end of the ribozyme gene is useful since
it acts as a transcription termination signal, and protects the
ribozyme from 3'-5' exonuclease activity. One example of a known
termination signal is that present on the T7 RNA polymerase system.
This signal is about 30 nucleotides in length. Other 3' hairpins of
shorter length can be used to provide good termination and RNA
stability. Such hairpins can be inserted within the vector
sequences to allow standard ribozymes to be placed in an
appropriate orientation and expressed with such sequences
attached.
[0047] Poly(A) tails are also useful to protect the 3' end of the
ribozyme. These can be provided by either including a poly(A)
signal site in the expression vector (to signal a cell to add the
poly(A) tail in vivo), or by introducing a poly(A) sequence
directly into the expression vector. In the first approach the
signal must be located to prevent unwanted secondary structure
formation with other parts of the ribozyme. In the second approach,
the poly(A) stretch may reduce in size over time when expressed in
vivo, and thus the vector may need to be checked over time. Care
must be taken in addition of a poly(A) tail which binds poly(A)
binding proteins which prevent the ribozyme from acting.
[0048] Ribozyme Testing
[0049] Once the desired ribozymes are selected, synthesized and
purified, they are tested in kinetic and other experiments to
determine their utility. An example of such a procedure is provided
below.
[0050] Preparation of Ribozyme
[0051] A Crude synthetic ribozyme (typically 350 .mu.g at a time)
was purified by separation on a 15% denaturing polyacrylamide gel
(0.75 mm thick, 40 cm long) and visualized by UV shadowing. Once
excised, gel slices containing full length ribozyme were soaked in
5 ml gel elution buffer (0.5 M NH.sub.4OAc, 1 mM EDTA) overnight
with shaking at 4.degree. C. The eluent was desalted over a C-18
matrix (Sep-Pak cartridges, Millipore, Milford, Mass.) and vacuum
dried. The dried RNA was resuspended in 50-100 .mu.l TE (TRIS 10
mM, EDTA 1 mM, pH 7.2). An aliquot of this solution was diluted 100
fold into 1 ml TE, half of which was used to spectrophotometrically
quantitate the ribozyme solution. The concentration of this dilute
stock was typically 150-800 nM. Purity of the ribozyme was
confirmed by the presence of a single band on a denaturing
polyacrylamide gel.
[0052] A ribozyme may advantageously be synthesized in two or more
portions. Each portion of a ribozyme will generally have only
limited or no enzymatic activity, and the activity will increase
substantially (by at least 5-10 fold) when all portions are ligated
(or otherwise juxtaposed) together. A specific example of
hammerhead ribozyme synthesis is provided below.
[0053] The method involves synthesis of two (or more) shorter
"half" ribozymes and ligation of them together using T4 RNA ligase.
For example, to make a 34 mer ribozyme, two 17 mers are
synthesized, one is phosphorylated, and both are gel purified.
These purified 17 mers are then annealed to a DNA splint strand
complementary to the two 17 mers. (Such a DNA splint is not always
necessary.) This DNA splint has a sequence designed to locate the
two 17 mer portions with one end of each adjacent each other. The
juxtaposed RNA molecules are then treated with T4 RNA ligase in the
presence of ATP. The 34 mer RNA so formed is then HPLC
purified.
[0054] Preparation of Substrates
[0055] Approximately 10-30 pmoles of unpurified substrate was
radioactively 5' end-labelled with T4 polynucleotide kinase using
25 pmoles of [.gamma.-.sup.32P] ATP. The entire labelling mix was
separated on a 20% denaturing polyacrylamide gel and visualized by
autoradiography. The full length band was excised and soaked
overnight at 4.degree. C. in 100 .mu.l of TE (10 mM Tris-HCl pH
7.6, 0.1 mM EDTA).
[0056] Kinetics Reactions
[0057] For reactions using short substrates (between 8 and 16
bases) a substrate solution was made 1.times. in assay buffer (75
mM Tris-HCl, pH 7.6; 0.1 mM EDTA, 10 mM MgCl.sub.2) such that the
concentration of substrate was less than 1 nM. A ribozyme solution
(typically 20 nM) was made 1.times. in assay buffer and four
dilutions were made using 1.times.assay buffer. Fifteen .mu.l of
each ribozyme dilution (i.e., 20, 16, 12, 8 and 4 nM) was placed in
a separate tube. These tubes and the substrate tube were
pre-incubated at 37.degree. C. for at least five minutes.
[0058] The reaction was started by mixing 15 .mu.l of substrate
into each ribozyme tube by rapid pipetting (note that final
ribozyme concentrations were 10, 8, 6, 4, 2 nM) 5 .mu.l aliquots
were removed at 15 or 30 second intervals and quenched with 5 .mu.l
stop solution (95% formamide, 20 mM EDTA xylene cyanol, and
bromphenol blue dyes). Following the final ribozyme time point, an
aliquot of the remaining substrate was removed as a zero ribozyme
control.
[0059] The samples were separated on either 15% or 20%
polyacrylamide gels. Each gel was visualized and quantitated with
an Ambis beta scanner (Ambis Systems, San Diego, Calif.).
[0060] For the most active ribozymes, kinetic analyses were
performed in substrate excess to determine K.sub.m and K.sub.cat
values.
[0061] For kinetic reactions with long RNA substrates (greater than
15 bases in length) the substrates were prepared by transcription
using T7 RNA polymerase and defined templates containing a T7
promoter, and DNA encoding appropriate nucleotides of the mdr-1
gene RNA. The substrate solution is made 1.times. in assay buffer
(75 mM Tris-HCl, pH 7.6; 0.1 mM EDTA; 10 .mu.M MgCl.sub.2) and
contains 58 nanomolar concentration of the long RNA molecules. The
reaction is started by addition of gel purified ribozymes to 1
.mu.M concentration. Aliquots are removed at 20, 40, 60, 80 and 100
minutes, then quenched by the addition of 5 .mu.l stop solution.
Cleavage products are separated using denaturing PAGE. The bands
are visualized and quantitated with an Ambis beta scanner.
[0062] Kinetic Analysis
[0063] A simple reaction mechanism for ribozyme-mediated cleavage
is: 1 R + S k - 1 k 1 [ R : S ] k 2 [ R : P ] R + P
[0064] where R=ribozyme, S=substrate, and P=products. The boxed
step is important only in substrate excess. Because ribozyme
concentration is in excess over substrate concentration, the
concentration of the ribozyme-substrate complex ([R:S]) is constant
over time except during the very brief time when the complex is
being initially formed, i.e.,: 2 [ R : S ] t = 0
[0065] where t=time, and thus:
(R)(S)k.sub.1=(RS)(k.sub.2+k.sub.1).
[0066] The rate of the reaction is the rate of disappearance of
substrate with time: 3 Rate = - ( S ) t = k 2 ( RS )
[0067] Substituting these expressions: 4 ( R ) ( S ) k 1 = 1 / k 2
- ( S ) t ( k 2 + k 1 )
[0068] or: 5 - d ( S ) S = k 1 k 2 ( k 2 + k 1 ) ( R ) dt
[0069] Integrating this expression with respect to time yields: 6 -
ln S S 0 = k 1 k 2 ( k 2 + k 1 ) ( R ) t
[0070] where S.sub.0=initial substrate. Therefore, a plot of the
negative log of fraction substrate uncut versus time (in minutes)
yields a straight line with slope: 7 slope = k 1 k 2 ( k 2 + k 1 )
( R ) = k obs
[0071] where k.sub.obs=observed rate constant. A plot of slope
(k.sub.obs) versus ribozyme concentration yields a straight line
with a slope which is: 8 slope = k 1 k 2 ( k 2 + k 1 ) which is k
cat K m
[0072] Using these equations the data obtained from the kinetic
experiments provides the necessary information to determine which
ribozyme tested is most useful, or active. Such ribozymes can be
selected and tested in in vivo or ex vivo systems.
[0073] Liposome Preparation
[0074] Lipid molecules are dissolved in a volatile organic solvent
(CHCl.sub.3, methanol, diethylether, ethanol, etc.). The organic
solvent is removed by evaporation. The lipid is hydrated into
suspension with 0.1.times.phosphate buffered saline (PBS), then
freeze-thawed 3.times. using liquid nitrogen and incubation at room
temperature. The suspension is extruded sequentially through a 0.4
.mu.m, 0.2 .mu.m and 0.1 .mu.m polycarbonate filters at maximum
pressure of 800 psi. The ribozyme is mixed with the extruded
liposome suspension and lyophilized to dryness. The lipid/ribozyme
powder is rehydrated with water to one-tenth the original volume.
The suspension is diluted to the minimum volume required for
extrusion (0.4 ml for 1.5 ml barrel and 1.5 ml for 10 ml barrel)
with 1.times.PBS and re-extruded through 0.4 .mu.m, 0.2 .mu.m, 0.1
.mu.m polycarbonate filters. The liposome entrapped ribozyme is
separated from untrapped ribozyme by gel filtration chromatography
(SEPHAROSE CL-4B, BIOGEL A5M). The liposome extractions are pooled
and sterilized by filtration through a 0.2 .mu.m filter. The free
ribozyme is pooled and recovered by ethanol precipitation. The
liposome concentration is determined by incorporation of a
radioactive lipid. The ribozyme concentration is determined by
labeling with .sup.32P. Rossi et al., 1992 supra (and references
cited therein) describe other methods suitable for preparation of
liposomes.
[0075] In Vivo Assay
[0076] The efficacy of action of a chosen ribozyme may be tested in
vivo by use of cell cultures sensitive to mdr-1 gene expression,
using standard procedures.
[0077] Ribonuclease Protection Assay
[0078] The accumulation of target mRNA in cells or the cleavage of
the mRNA by ribozymes or RNaseH (in vitro or in vivo) can be
quantified using an RNase protection assay.
[0079] In this method, antisense riboprobes are transcribed from
template DNA using T7 RNA polymerase (U.S. Biochemicals) in 20
.mu.l reactions containing 1.times. transcription buffer (supplied
by the manufacturer), 0.2 mm ATP, GTP and UTP, 1 U/.mu.l pancreatic
RNase inhibitor (Boehringer Mannheim Biochemicals) and 200 .mu.Ci
.sup.32P-labeled CTP (800 Ci/mmol, New England Nuclear) for 1 h at
37.degree. C. Template DNA is digested with 1 U RNase-free DNase I
(U.S. Biochemicals, Cleveland, Ohio) at 37.degree. C. for 15
minutes and unincorporated nucleotides removed by G-50 SEPHADEX
spin chromatography.
[0080] In a manner similar to the transcription of antisense probe,
the target mRNA can be transcribed in vitro using a suitable DNA
template. The transcript is purified by standard methods and
digested with ribozyme at 37.degree. C. according to methods
described later.
[0081] Alternatively, cells expressing the target mRNA are
harvested into 1 ml of PBS, transferred to a 1.5 ml EPPENDORF tube,
pelleted for 30 seconds at low speed in a microcentrifuge, and
lysed in 70 .mu.l of hybridization buffer (4 M guanidine
isothiocyanate, 0.1% sarcosyl, 25 mM sodium citrate, pH 7.5). Cell
lysate (45 .mu.l) or defined amounts of in vitro transcript (also
in hybridization buffer) is then combined with 5 .mu.l of
hybridization buffer containing 5.times.10.sup.5 cpm of each
antisense riboprobe in 0.5 ml Eppendorf tubes, overlaid with 25
.mu.l mineral oil, and hybridization accomplished by heating
overnight at 55.degree. C. The hybridization reactions are diluted
into 0.5 ml RNase solution (20 U/ml RNase A, 2 U/ml RNase T1, 10
U/ml RNase-free DNAse I in 0.4 M NaCl), heated for 30 minutes at
37.degree. C., and 10 .mu.l of 20% SDS and 10 .mu.l of Proteinase K
(10 mg/ml) added, followed by an additional 30 minutes incubation
at 37.degree. C. Hybrids are partially purified by extraction with
0.5 ml of a 1:1 mixture of phenol/chloroform; aqueous phases are
combined with 0.5 ml isopropanol, and RNase-resistant hybrids
pelleted for 10 minutes at room temperature (about 20.degree. C.)
in a microcentrifuge. Pellets are dissolved in 10 .mu.l loading
buffer (95% formamide, 1.times.TBE, 0.1% bromophenol blue, 0.1%
xylene cylanol), heated to 95.degree. C. for five minutes, cooled
on ice, and analyzed on 4% polyacrylamide/7 M urea gels under
denaturing conditions.
[0082] Ribozyme Stability
[0083] The chosen ribozyme can be tested to determine its
stability, and thus its potential utility. Such a test can also be
used to determine the effect of various chemical modifications
(e.g., addition of a poly(A) tail) on the ribozyme stability and
thus aid selection of a more stable ribozyme. For example, a
reaction mixture contains 1 to 5 pmoles of 5' (kinased) and/or 3'
labeled ribozyme, 15 .mu.g of cytosolic extract and 2.5 mM
MgCl.sub.2 in a total volume of 100 .mu.l. The reaction is
incubated at 37.degree. C. Eight .mu.l aliquots are taken at timed
intervals and mixed with 8 .mu.l of a stop mix (20 mM EDTA, 95%
formamide). Samples-are separated on a 15% acrylamide sequencing
gel, exposed to film, and scanned with an Ambis.
[0084] A 3'-labelled ribozyme can be formed by incorporation of the
.sup.32P-labeled cordycepin at the 3' OH using poly(A) polymerase.
For example, the poly(A) polymerase reaction contains 40 mM Tris,
pH 8, 10 mM MgCl.sub.2, 250 mM NaCl, 2.5 mM MnCl.sub.2,; 3 .mu.l
P.sup.32 cordycepin, 500 Ci/mM; and 6 units poly(A) polymerase in a
total volume of 50 .mu.l. The reaction mixture is incubated for 30
minutes at 37.degree. C.
[0085] Effect of Base Substitution Upon Ribozyme Activity
[0086] To determine which primary structural characteristics could
change ribozyme cleavage of substrate, minor base changes can be
made in the substrate cleavage region recognized by a specific
ribozyme. For example, the substrate sequences can be changed at
the central "C" nucleotide, changing the cleavage site from a GUC
to a GUA motif. The K.sub.cat/K.sub.m values for cleavage using
each substrate are then analyzed to determine if such a change
increases ribozyme cleavage rates. Similar experiments can be
performed to address the effects of changing bases complementary to
the ribozyme binding arms. Changes predicted to maintain strong
binding to the complementary substrate are preferred. Minor changes
in nucleotide content can alter ribozyme/substrate interactions in
ways which are unpredictable based upon binding strength alone.
Structures in the catalytic core region of the ribozyme recognize
trivial changes in either substrate structure or the three
dimensional structure of the ribozyme/substrate complex.
[0087] To begin optimizing ribozyme design, the cleavage rates of
ribozymes containing varied arm lengths, but targeted to the same
length of short RNA substrate can be tested. Minimal arm lengths
are required and effective cleavage varies with ribozyme/substrate
combinations.
[0088] The cleavage activity of selected ribozymes can be assessed
using mdr-1 mRNA-homologous substrates. The assays are performed in
ribozyme excess and approximate K.sub.cat/K.sub.min values
obtained. Comparison of values obtained with short and long
substrates indicates utility in vivo of a ribozyme.
[0089] Intracellular Stability of Liposome-Delivered
[0090] Ribozymes
[0091] To test the stability of a chosen ribozyme in vivo the
following test is useful. Ribozymes are .sup.32P-end labeled,
entrapped in liposomes and delivered to mdr-1 mRNA containing cells
for three hours. The cells are fractionated and ribozyme is
purified by phenol/chloroform extraction. Alternatively, cells
(1.times.10.sup.7, T-175 flask) are scraped from the surface of the
flask and washed twice with cold PBS. The cells are homogenized by
douncing 35 times in 4 ml of TSE (10 mM Tris, pH 7.4, 0.25 M
Sucrose, mM EDTA). Nuclei are pelleted at 100.times.g for 10
minutes. Subcellular organelles (the membrane fraction) are
pelleted at 200,000.times.g for two hours using an SW60 rotor. The
pellet is resuspended in 1 ml of H buffer (0.25 M Sucrose, 50 mM
HEPES, pH 7.4). The supernatant contains the cytoplasmic fraction
(in approximately 3.7 ml). The nuclear pellet is resuspended in 1
ml of 65% sucrose in TM (50 mM Tris, pH 74., 2.5 mM MgCl.sub.2) and
banded on a sucrose step gradient (1 ml nuclei in 65% sucrose TM, 1
ml 60% sucrose TM, 1 ml 55% sucrose TM, 50% sucrose TM, 300 ul 25%
sucrose TM) for one hour at 37,000.times.g with an SW60 rotor. The
nuclear band is harvested and diluted to 10% sucrose with TM
buffer. Nuclei are pelleted at 37,000.times.g using an SW60 rotor
for 15 minutes and the pellet resuspended in 1 ml of TM buffer.
Aliquots are size fractionated on denaturing polyacrylamide gels
and the intracellular localization determined. By comparison to the
migration rate of newly synthesized ribozyme, the various fraction
containing intact ribozyme can be determined.
[0092] To investigate modifications which would lengthen the
half-life of ribozyme molecules intracellularly, the cells may be
fractioned as above and the purity of each fraction assessed by
assaying enzyme activity known to exist in that fraction.
[0093] The various cell fractions are frozen at -70.degree. C. and
used to determine relative nuclease resistances of modified
ribozyme molecules. Ribozyme molecules may be synthesized with 5
phosphorothioate (ps), or 2'Omethyl (2'-OMe) modifications at each
end of the molecule. These molecules and a phosphodiester version
of the ribozyme are end-labeled with .sup.32P and ATP using T4
polynucleotide kinase. Equal concentrations are added to the cell
cytoplasmic extracts and aliquots of each taken at 10 min.
intervals. The samples are size fractionated by denaturing PAGE and
relative rates of nuclease resistance analyzed by scanning the gel
with an Ambis .beta.-scanner. The results show whether the
ribozymes are digested by the cytoplasmic extract, and which
versions are relatively more nuclease resistant. Modified ribozymes
generally maintain 80-90% of the catalytic activity of the native
ribozyme when short RNA substrates are employed.
[0094] Unlabeled, 5' end-labeled or 3' end-labeled ribozymes can be
used in the assays. These experiments can also be performed with
human cell extracts to verify the observations.
[0095] Administration of Ribozyme
[0096] Selected ribozymes can be administered prophylactically, or
to patients expressing mdr-1 mRNA, e.g., by exogenous delivery of
the ribozyme to an infected tissue by means of an appropriate
delivery vehicle, e.g., a liposome, a controlled release vehicle,
by use of iontophoresis, or ion paired molecules, or covalently
attached adducts, and other pharmacologically approved methods of
delivery. Routes of administration include intramuscular, aerosol,
oral (tablet or pill form), topical, systemic, ocular,
intraperitoneal and/or intrathecal. Expression vectors for
immunization with ribozymes and/or delivery of ribozymes are also
suitable.
[0097] The specific delivery route of any selected ribozyme will
depend on the use of the ribozyme. Generally, a specific delivery
program for each ribozyme will focus on unmodified ribozyme uptake
with regard to intracellular localization, followed by
demonstration of efficacy. Alternatively,. delivery to these same
cells in an organ or tissue of an animal can be pursued. Uptake
studies will include uptake assays to evaluate cellular ribozyme
uptake, regardless of the delivery vehicle or strategy. Such assays
will also determine the intracellular localization of the ribozyme
following uptake, ultimately establishing the requirements for
maintenance of steady-state concentrations within the cellular
compartment containing the target sequence (nucleus and/or
cytoplasm). Efficacy and cytotoxicity can then be tested. Toxicity
will not only include cell viability but also cell function.
[0098] Some methods of delivery that may be used include:
[0099] a. encapsulation in liposomes,
[0100] b. transduction by retroviral vectors,
[0101] c. conjugation with cholesterol,
[0102] d. localization to nuclear compartment utilizing nuclear
targeting site found on most nuclear proteins,
[0103] e. neutralization of charge of ribozyme by using nucleotide
derivatives, and
[0104] f. use of blood stem cells to distribute ribozymes
throughout the body.
[0105] At least three types of delivery strategies are useful in
the present invention, including: ribozyme modifications, particle
carrier drug delivery vehicles, and retroviral expression vectors.
Unmodified ribozymes, like most small molecules, are taken up by
cells, albeit slowly. To enhance cellular uptake, the ribozyme may
be modified essentially at random, in ways which reduce its charge
but maintains specific functional groups. This results in a
molecule which is able to diffuse across the cell membrane, thus
removing the permeability barrier.
[0106] Modification of ribozymes to reduce charge is just one
approach to enhance the cellular uptake of these larger molecules.
The random approach, however, is not advisable since ribozymes are
structurally and functionally more complex than small drug
molecules. The structural requirements necessary to maintain
ribozyme catalytic activity are well understood by those in the
art. These requirements are taken into consideration when designing
modifications to enhance cellular delivery. The modifications are
also designed to reduce susceptibility to nuclease degradation.
Both of these characteristics should greatly improve the efficacy
of the ribozyme. Cellular uptake can be increased by several orders
of magnitude without having to alter the phosphodiester linkages
necessary for ribozyme cleavage activity.
[0107] Chemical modifications of the phosphate backbone will reduce
the negative charge allowing free diffusion across the membrane.
This principle has been successfully demonstrated for antisense DNA
technology. The similarities in chemical composition between DNA
and RNA make this a feasible approach. In the body, maintenance of
an external concentration will be necessary to drive the diffusion
of the modified ribozyme into the cells of the tissue.
Administration routes which allow the diseased tissue to be exposed
to a transient high concentration of the drug, which is slowly
dissipated by systemic adsorption are preferred. Intravenous
administration with a drug carrier designed to increase the
circulation half-life of the ribozyme can be used. The size and
composition of the drug carrier restricts rapid clearance from the
blood stream. The carrier, made to accumulate at the site of
infection, can protect the ribozyme from degradative processes.
[0108] Drug delivery vehicles are effective for both systemic and
topical administration. They can be designed to serve as a slow
release reservoir, or to deliver their contents directly to the
target cell. An advantage of using direct delivery drug vehicles is
that multiple molecules are delivered per uptake. Such vehicles
have been shown to increase the circulation half-life of drugs
which would otherwise be rapidly cleared from the blood stream.
Some examples of such specialized drug delivery vehicles which fall
into this category are liposomes, hydrogels, cyclodextrins,
biodegradable nanocapsules, and bioadhesive microspheres.
[0109] From this category of delivery systems, liposomes are
preferred. Liposomes increase intracellular stability, increase
uptake efficiency and improve biological activity.
[0110] Liposomes are hollow spherical vesicles composed of lipids
arranged in a similar fashion as those lipids which make up the
cell membrane. They have an internal aqueous space for entrapping
water soluble compounds and range in size from 0.05 to several
microns in diameter. Several studies have shown that liposomes can
deliver RNA to cells and that the RNA remains biologically
active.
[0111] For example, a liposome delivery vehicle originally designed
as a research tool, Lipofectin, has been shown to deliver intact
mRNA molecules to cells yielding production of the corresponding
protein.
[0112] Liposomes offer several advantages: They are non-toxic and
biodegradable in composition; they display long circulation
half-lives; and recognition molecules can be readily attached to
their surface for targeting to tissues. Finally, cost effective
manufacture of liposome-based pharmaceuticals, either in a liquid
suspension or lyophilized product, has demonstrated the viability
of this technology as an acceptable drug delivery system.
[0113] Other controlled release drug delivery systems, such as
nonoparticles and hydrogels may be potential delivery vehicles for
a ribozyme. These carriers have been developed for chemotherapeutic
agents and protein-based pharmaceuticals, and consequently, can be
adapted for ribozyme delivery.
[0114] Topical administration of ribozymes is advantageous since it
allows localized concentration at the site of administration with
minimal systemic adsorption. This simplifies the delivery strategy
of the ribozyme to the disease site and reduces the extent of
toxicological characterization. Furthermore, the amount of material
to be applied is far less than that required for other
administration routes. Effective delivery requires the ribozyme to
diffuse into the infected cells. Chemical modification of the
ribozyme to neutralize negative charge may be all that is required
for penetration. However, in the event that charge neutralization
is insufficient, the modified ribozyme can be co-formulated with
permeability enhancers, such as Azone or oleic acid, in a liposome.
The liposomes can either represent a slow release presentation
vehicle in which the modified ribozyme and permeability enhancer
transfer from the liposome into the infected cell, or the liposome
phospholipids can participate directly with the modified ribozyme
and permeability enhancer in facilitating cellular delivery. In
some cases, both the ribozyme and permeability enhancer can be
formulated into a suppository formulation for slow release.
[0115] Ribozymes may also be systemically administered. systemic
absorption refers to the accumulation of drugs in the blood stream
followed by distribution throughout the entire body. Administration
routes which lead to systemic absorption include: intravenous,
subcutaneous, intraperitoneal, intranasal, intrathecal and
ophthalmic. Each of these administration routes expose the ribozyme
to an accessible diseased tissue. Subcutaneous administration
drains into a localized lymph node which proceeds through the
lymphatic network into the circulation. The rate of entry into the
circulation has been shown to be a function of molecular weight or
size. The use of a liposome or other drug carrier localizes the
ribozyme at the lymph node. The ribozyme can be modified to diffuse
into the cell, or the liposome can directly participate in the
delivery of either the unmodified or modified ribozyme to the
cell.
[0116] A liposome formulation which can deliver oligonucleotides to
lymphocytes and macrophages is also useful. This oligonucleotide
delivery system inhibits viral proliferation in these viruses that
infect primary immune cells. Whole blood studies show that the
formulation is taken up by 90% of the lymphocytes after 8 hours at
37.degree. C. Preliminary biodistribution and pharmacokinetic
studies yielded 70% of the injected dose/gm of tissue in the spleen
after one hour following intravenous administration.
[0117] Intraperitoneal administration also leads to entry into the
circulation with the molecular weight or size controlling the rate
of entry.
[0118] Liposomes injected intravenously show accumulation in the
liver, lung and spleen. The composition and size can be adjusted so
that this accumulation represents 30% to 40% of the injected dose.
The remaining dose circulates in the blood stream for up to 24
hours.
[0119] The chosen method of delivery should result in cytoplasmic
accumulation and molecules should have some nuclease-resistance for
optimal dosing. Nuclear delivery may be used but is less
preferable. Most preferred delivery methods include liposomes
(10-400 nm), hydrogels, controlled-release polymers, microinjection
or electroporation (for ex vivo treatments) and other
pharmaceutically applicable vehicles. The dosage will depend upon
the disease indication and the route of administration but should
be between 100-200 mg/kg of body weight/day. The duration of
treatment will extend through the course of the disease symptoms,
possibly continuously. The number of doses will depend upon disease
delivery vehicle and efficacy data from clinical trials.
[0120] Establishment of therapeutic levels of ribozyme within the
cell is dependent upon the rate of uptake and degradation.
Decreasing the degree of degradation will prolong the intracellular
half-life of the ribozyme. Thus, chemically modified ribozymes,
e.g., with modification of the phosphate backbone, or capping of
the 5' and 3' ends of the ribozyme with nucleotide analogs may
require different dosaging. Descriptions of useful systems are
provided in the art cited above, all of which is hereby
incorporated by reference herein.
[0121] The claimed ribozymes are also useful as diagnostic tools to
specifically or non-specifically detect the presence of a target
RNA in a sample. That is, the target RNA, if present in the sample,
will be specifically cleaved by the ribozyme, and thus can be
readily and specifically detected as smaller RNA species. The
presence of such smaller RNA species is indicative of the presence
of the target RNA in the sample.
[0122] Other embodiments are within the following claims.
Sequence CWU 1
1
* * * * *