U.S. patent application number 10/367708 was filed with the patent office on 2003-10-02 for expression monitoring by hybridization to high density oligonucleotide arrays.
This patent application is currently assigned to AFFYMETRIX, INC.. Invention is credited to Dower, William J., Fodor, Stephen P.A., Solas, Dennis W..
Application Number | 20030186296 10/367708 |
Document ID | / |
Family ID | 27496813 |
Filed Date | 2003-10-02 |
United States Patent
Application |
20030186296 |
Kind Code |
A1 |
Fodor, Stephen P.A. ; et
al. |
October 2, 2003 |
Expression monitoring by hybridization to high density
oligonucleotide arrays
Abstract
The present invention provides methods for comparing and
identifying differences in nucleic acid sequences using a plurality
of sequence specific recognition reagents (i.e., probes comprising
a nucleic acid complementary to a nucleic acid sequence in
collections to be compared) bound to a solid surface.
Inventors: |
Fodor, Stephen P.A.; (Palo
Alto, CA) ; Solas, Dennis W.; (San Francisco, CA)
; Dower, William J.; (Menlo Park, CA) |
Correspondence
Address: |
MORGAN LEWIS & BOCKIUS LLP
1111 PENNSYLVANIA AVENUE, N.W.
WASHINGTON
DC
20004
US
|
Assignee: |
AFFYMETRIX, INC.
|
Family ID: |
27496813 |
Appl. No.: |
10/367708 |
Filed: |
February 19, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10367708 |
Feb 19, 2003 |
|
|
|
09851312 |
May 9, 2001 |
|
|
|
6551784 |
|
|
|
|
09851312 |
May 9, 2001 |
|
|
|
08529115 |
Sep 15, 1995 |
|
|
|
6040138 |
|
|
|
|
09851312 |
May 9, 2001 |
|
|
|
08670118 |
Jun 25, 1996 |
|
|
|
5800992 |
|
|
|
|
08670118 |
Jun 25, 1996 |
|
|
|
08168904 |
Dec 15, 1993 |
|
|
|
08168904 |
Dec 15, 1993 |
|
|
|
07624114 |
Dec 6, 1990 |
|
|
|
07624114 |
Dec 6, 1990 |
|
|
|
07362901 |
Jun 7, 1989 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/287.2; 435/6.14 |
Current CPC
Class: |
B01J 2219/00608
20130101; B82Y 30/00 20130101; G03F 7/00 20130101; G03F 7/265
20130101; B01J 2219/00644 20130101; B01J 2219/00315 20130101; B01J
2219/005 20130101; B01J 2219/00637 20130101; B01J 2219/00436
20130101; B01J 2219/00626 20130101; C12Q 1/6827 20130101; G03F 7/38
20130101; B01J 2219/0059 20130101; C12Q 1/6809 20130101; C12Q
1/6874 20130101; C12Q 2565/507 20130101; C12Q 2565/507 20130101;
C12Q 2521/325 20130101; B01J 2219/00596 20130101; B01J 2219/0061
20130101; B01J 19/0046 20130101; B01J 2219/00695 20130101; C40B
40/06 20130101; B01J 2219/00529 20130101; B01J 2219/00432 20130101;
B01J 2219/00711 20130101; C07H 19/10 20130101; B01J 2219/00434
20130101; B01J 2219/00617 20130101; C07K 17/14 20130101; B01J
2219/00605 20130101; C07K 17/06 20130101; B01J 2219/00531 20130101;
B01J 2219/00621 20130101; B82Y 10/00 20130101; C12Q 1/6837
20130101; B01J 2219/00585 20130101; B01J 2219/00612 20130101; B01J
2219/00648 20130101; C12Q 1/6837 20130101; B01J 2219/00527
20130101; C40B 40/10 20130101; B01J 2219/00468 20130101; B01J
2219/00619 20130101; B01J 2219/00659 20130101; C07K 1/042 20130101;
C12Q 1/6837 20130101; C40B 60/14 20130101; B01J 2219/00459
20130101; B01J 2219/00689 20130101; B01J 2219/00475 20130101; G01N
15/1475 20130101; C07H 21/00 20130101; C12Q 1/6809 20130101; G11C
13/0014 20130101; C07K 1/045 20130101; C07B 2200/11 20130101; B01J
2219/00722 20130101; C12Q 1/6816 20130101; B01J 2219/00725
20130101; G11C 13/0019 20130101; G03F 7/0045 20130101 |
Class at
Publication: |
435/6 ;
435/287.2 |
International
Class: |
C12Q 001/68; C12M
001/34 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 13, 1996 |
PCT/US96/14839 |
Claims
What is claimed is:
1. A substrate with a surface having at least 1000 distinct
polynucleotide or polypeptide biopolymers per cm.sup.2 surface
area, each distinct biopolymer sample (i) being disposed at
separtate, defined positions in said array, (ii) having a length of
at least 50 subunits, and (iii) being present in an effective
amount to be detectable when hybridized to a target by detection of
a labeled sample.
2. A method of detecting differential expression of each of a
plurality of genes in a first cell type with respect to expression
of the same genes in second cell type, said method comprising:
producing labeled mRNA or mRNA products isolated from the two cell
types; adding a mixture of labeled said mRNA or mRNA products from
the two cell types to a high density array of polynucleotdes
representing a plurality of known genes derived from at least the
two cell types, under conditions that result in hybridization to
complementary sequence polynucleotides in the array; and examining
the array by fluroescence under fluorescence excitation conditions
in which (i) polynucleotides in the array that are hybridized.
3. The method as recited in claim 2 wherein the labeled mRNA or
mRNA products are fluoroscein labeled.
4. The method as recited in claim 2 wherein the labeled mRNA or
mRNA products from the two cell types are labeled with labels of
first and second fluorescent reporters.
5. The method as recited in claim 4 wherein said first and second
fluorescent reporters are different colors of fluroescent
reporters.
6. The method as recited in claim 5 wherein said colors are red and
green.
7. The method as recited in claim 2 wherein said array is formed by
placing biologically prepared DNA or RNA on a solid support.
8. The method as recited in claim 2 wherein said array is formed by
synthesis of RNA or DNA on a solid support.
9. A method of performing an analysis on a sample comprising the
steps of: placing or forming one or more high density arrays of
oligonucleotides on one or more solid supports, said arrays
comprising more than 100 oligonucleotides per square centimeter,
said oligonucleotides formed on said solid supports or preformed
and placed on said solid support at known locations; extracting
messenger RNA sample from at least two cell populations and
labeling said messenger RNA or products of said messenger RNA from
said at least two cell populations; exposing products of said
extracting and labeling step to said one or more high density
arrays; detecting where said products have hybridized to said high
density arrays; based on said detecting step, determining a level
of expression of said messenger RNA in said at least two cell
populations.
10. A method of simultaneously monitoring the expression of a
multiplicity of genes, said method comprising: (a) providing a pool
of target nucleic acids comprising RNA transcripts of one or more
of said genes, or nucleic acids derived from said RNA transcripts;
(b) hybridizing said pool of nucleic acids to an array of
oligonucleotide probes immobilized on a surface, said array
comprising more than 100 different oligonucleotides wherein: each
different oligonucleotide is localized in a predetermined region of
said surface; each different oligonucleotide is attached to said
surface through a single covalent bond; the density of said
different oligonucleotides is greater than about 60 different
oligonucleotides per 1 cm.sup.2; and said oligonucleotide probes
are complementary to a subsequence of said RNA transcripts or said
nucleic acids derived from said RNA transcripts; and (c)
quantifying the hybridization of said nucleic acids to said array
wherein said quantifying provides a measure of the levels of
transcription of said genes.
11. A method of comparing a level of different RNA or DNA sequences
in a sample comprising the steps of: labeling a first RNA or DNA
sequence in said sample with a first fluorescent dye; labeling a
second RNA or DNA sequence in said sample with a second dye, said
second dye emitting light upon excitation at a wavelength different
from said first fluorescent dye; exposing said sample to RNA or DNA
probes affixed to a solid support; determining a relative amount of
said first and said second RNA or DNA sequences based upon a level
of emission of light from said substrate at said first and said
second wavelenghts.
12. A method for comparing copy number of nucleic acid sequences
two or more collections of nucleic acid molecules, the method
comprising: providing a plurality of target elements bound to a
solid surface, each target element comprising a target nucleic
acid; contacting the target elements with a first collection of
labeled nucleic acid comprising a sequence substantially
complementary to a target nucleotide sequence, and at least a
second labeled nucleic acid comprising a sequence complementary to
the target nucleotide sequence; wherein said first and second
labels are distinguishable from each other; and detecting the
amount of binding of the first and second labeled complementary
nucleic acids to the target nucleic acids.
13. The method of claim 12 wherein the target nucleic acids are
DNA.
14. The method of claim 12 wherein the target nucleic acids are
cDNA.
15. The method of claim 12 wherein the first and second labeled
nucleic acids comprise human DNA.
16. The method of claim 12 wherein the target nucleic acids are
greater than about 25 nucleotides in complexity.
17. The method of claim 12 wherein the solid support is glass.
18. The method of claim 12 wherein the first and second labels are
fluorescent labels.
19. The method of claim 12 wherein the first labeled nucleic acids
comprise mRNA or cDNA from a test cell and the second labeled
nucleic acids comprise mRNA or cDNA from a reference cell.
20. The method of claim 12 wherein the first labeled nucleic acids
are from a test genome and the second labeled nucleic acids are
from a normal reference genome.
21. The method of claim 12 wherein the first labeled nucleic acids
are from a tumor.
22. A kit for performing the assay of claim 12.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation-in-part of U.S. Ser. No. 08/529,115
filed on Sep. 15, 1995 which is herein incorporated by reference
for all purposes, and claims priority to WO/96/14839. This
application is also a continuation-in-part of U.S. Ser. No.
08/670,118 filed on Jun. 25, 1996, which is a division of U.S. Ser.
No. 08/168,904 filed Dec. 15, 1993, which is a continuation of U.S.
Ser. No. 07/624,114 filed Dec. 6, 1990. U.S. Ser. No. 07/624,114 is
a CIP of U.S. Ser. No. 07/362,901 filed Jun. 7, 1990. All of the
above applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] A portion of the disclosure of this patent document contains
material which subject to copyright protection. The copyright owner
has no objection to the xerographic reproduction by anyone of the
patent document or the patent disclosure in exactly the form it
appears in the Patent and Trademark Office patent file or records,
but otherwise reserves all copyright rights whatsoever.
[0003] Many disease states are characterized by differences in the
expression levels of various genes either through changes in the
copy number of the genetic DNA or through changes in levels of
transcription (e.g. through control of initiation, provision of RNA
precursors, RNA processing, etc.) of particular genes. For example,
losses and gains of genetic material play an important role in
malignant transformation and progression. These gains and losses
are thought to be "driven" by at least two kinds of genes.
Oncogenes are positive regulators of tumorgenesis, while tumor
suppressor genes are negative regulators of tumorgenesis (Marshall,
Cell, 64: 313-326 (1991); Weinberg, Science, 254: 1138-1146 (1991))
incorporated herein by reference for all purposes. Therefore, one
mechanism of activating unregulated growth is to increase the
number of genes coding for oncogene proteins or to increase the
level of expression of these oncogenes (e.g. in response to
cellular or environmental changes), and another is to lose genetic
material or to decrease the level of expression of genes that code
for tumor suppressors. This model is supported by the losses and
gains of genetic material associated with glioma progression
(Mikkelson et al. J. Cellular Biochm. 46: 3-8 (1991)). Thus,
changes in the expression (transcription) levels of particular
genes (e.g. oncogenes or tumor suppressors), serve as signposts for
the presence and progression of various cancers.
[0004] Similarly, control of the cell cycle and cell development,
as well as diseases, are characterized by the variations in the
transcription levels of particular genes. Thus, for example, a
viral infection is often characterized by the elevated expression
of genes of the particular virus. For example, outbreaks of Herpes
simplex, Epstein-Barr virus infections (e.g. infectious
mononucleosis), cytomegalovirus, Varicella-zoster virus infections,
parvovirus infections, human papillomavirus infections, etc. are
all characterized by elevated expression of various genes present
in the respective virus. Detection of elevated expression levels of
characteristic viral genes provides an effective diagnostic of the
disease state. In particular, viruses such as herpes simplex, enter
quiescent states for periods of time only to erupt in brief periods
of rapid replication. Detection of expression levels of
characteristic viral genes allows detection of such active
proliferative (and presumably infective) states.
[0005] Oligonucleotide probes have long been used to detect
complementary nucleic acid sequences in a nucleic acid of interest
(the "target" nucleic acid) and have been used to detect expression
of particular genes (e.g., a Northern Blot). In some assay formats,
the oligonucleotide probe is tethered, i.e., by covalent
attachment, to a solid support, and arrays of oligonucleotide
probes immobilized on solid supports have been used to detect
specific nucleic acid sequences in a target nucleic acid.
[0006] The use of "traditional" hybridization protocols for
monitoring or quantifying gene expression is problematic. For
example two or more gene products of approximately the same
molecular weight will prove difficult or impossible to distinguish
in a Northern blot because they are not readily separated by
electrophoretic methods. Similarly, as hybridization efficiency and
cross-reactivity varies with the particular subsequence (region) of
a gene being probed it is difficult to obtain an accurate and
reliable measure of gene expression with one, or even a few, probes
to the target gene.
[0007] The development of VLSIPS.TM. technology provided methods
for synthesizing arrays of many different oligonucleotide probes
that occupy a very small surface area. See U.S. Pat. No. 5,143,854
and PCT patent publication No. WO 90/15070. U.S. patent application
Ser. No. 082,937, filed Jun. 25, 1993, describes methods for making
arrays of oligonucleotide probes that can be used to provide the
complete sequence of a target nucleic acid and to detect the
presence of a nucleic acid containing a specific nucleotide
sequence.
SUMMARY OF THE INVENTION
[0008] The present invention is premised, in part, on the discovery
that microfabricated arrays of large numbers of different
oligonucleotide probes (DNA chips) may effectively be used to not
only detect the presence or absence of target nucleic acid
sequences, but to quantify the relative abundance of the target
sequences in a complex nucleic acid pool. In addition, it was also
a surprising discovery that relatively short oligonucleotide probes
(e.g., 20 mer) are sufficiently specific to allow quantitation of
gene expression in complex mixtures of nucleic acids particularly
when provided as in high density oligonucleotide probe arrays.
[0009] Prior to this invention it was unknown that hybridization to
high density probe arrays would permit small variations in
expression levels of a particular gene to be identified and
quantified in a complex population of nucleic acids that out number
the target nucleic acids by 1,000 fold to 1,000,000 fold or more.
It was also unknown that the transcription levels of specific genes
can be quantitated in a complex nucleic acid mixture with only a
few (e.g., less than 20 or even less than 10) relatively short
oligonucleotide probes.
[0010] Thus, this invention provides for a method of simultaneously
monitoring the expression (e.g. detecting and or quantifying the
expression) of a multiplicity of genes. The levels of
transcription, RNA processing and degradation for virtually any
number of genes may be determined simultaneously. Typically, at
least about 10 genes, preferably at least about 100, more
preferably at least about 1000 and most preferably at least about
10,000 different genes are assayed at one time.
[0011] The method involves providing a pool of target nucleic acids
comprising RNA transcripts of one or more of said genes, or nucleic
acids derived from the RNA transcripts; hybridizing the pool of
nucleic acids to an array of oligonucleotide probes immobilized on
a surface, where the array comprises more than 100 different
oligonucleotides, each different oligonucleotide is localized in a
predetermined region of said surface, each different
oligonucleotide is attached to the surface through a single
covalent bond, the density of the different oligonucleotides is
greater than about 60 different oligonucleotides (where different
oligonucleotides refers to oligonucleotides having different
sequences) per 1 cm.sup.2, and the oligonucleotide probes are
complementary to the RNA transcripts or nucleic acids derived from
the RNA transcripts; and quantifying the hybridized nucleic acids
in the array. The method can additionally include a step of
quantifying the hybridization of the target nucleic acids to the
array. The quantification preferably provides a measure of the
levels of transcription of the genes. In a preferred embodiment,
the pool of target nucleic acids is one in which the concentration
of the target nucleic acids (pre-mRNA transcripts, mRNA transcripts
or nucleic acids derived from the RNA transcripts) is proportional
to the expression levels of genes encoding those target nucleic
acids.
[0012] In a preferred embodiment, the array of oligonucleotide
probes is a high density array comprising greater than about 100,
preferably greater than about 1,000 more preferably greater than
about 16,000 and most preferably greater than about 65,000 or
250,000 or even 1,000,000 different oligonucleotide probes. Such
high density arrays comprise a probe density of generally greater
than about 60, more generally greater than about 100, most
generally greater than about 600, often greater than about 1000,
more often greater than about 5,000, most often greater than about
10,000, preferably greater than about 40,000 more preferably
greater than about 100,000, and most preferably greater than about
400,000 different oligonucleotide probes per cm.sup.2 (where
different oligonucleotides refers to oligonucleotides having
different sequences). The oligonucleotide probes range from about 5
to about 500, preferably 5 to 50, nucleotides, preferably from
about 5 to about 45 nucleotides, still more preferably from about
10 to about 40 nucleotides and most preferably from about 15 to
about 40 nucleotides in length. Particularly preferred arrays
contain probes ranging from about 20 to about 25 oligonucleotides
in length. The array may comprise more than 10, preferably more
than 50, more preferably more than 100, and most preferably more
than 1000 oligonucleotide probes specific for each target gene. In
a preferred embodiment, the array comprises at least 10 different
oligonucleotide probes for each gene. In another preferred
embodiment, the array has 20 or fewer oligonucleotides
complementary each gene. Although a planar array surface is
preferred, the array may be fabricated on a surface of virtually
any shape or even a multiplicity of surfaces.
[0013] The array may further comprise mismatch control probes.
Where such mismatch controls are present, the quantifying step may
comprise calculating the difference in hybridization signal
intensity between each of the oligonucleotide probes and its
corresponding mismatch control probe. The quantifying may further
comprise calculating the average difference in hybridization signal
intensity between each of the oligonucleotide probes and its
corresponding mismatch control probe for each gene.
[0014] The probes present in the high density array can be
oligonucleotide probes selected according to selection and
optimization methods described below. Alternatively, non-optimal
probes may be included in the array, but the probes used for
quantification (analysis) can be selected according to the
optimization methods described below.
[0015] Oligonucleotide arrays for the practice of some embodiments
of this invention are, in preferred embodiments, chemically
synthesized by parallel immobilized polymer synthesis methods, more
preferably by light directed polymer synthesis methods. Chemically
synthesized arrays are advantageous in that probe preparation does
not require cloning, a nucleic acid amplification step, or
enzymatic synthesis. Indeed, the preparation of the probes does not
require handling of any biological materials.
[0016] The array includes test probes which are oligonucleotide
probes each of which has a sequence that is complementary to a
subsequence of one of the genes (or the mRNA or the corresponding
antisense cRNA) whose expression is to be detected. In addition,
the array can contain normalization controls, mismatch controls and
expression level controls as described herein.
[0017] In a particularly preferred embodiment, the variation
between different copies (within and/or between batches) of each
array is less than 20%, more preferably less than about 10%, and
most preferably less than about 5% where the variation is measured
as the coefficient of variation in hybridization intensity averaged
over at least 5 oligonucleotide probes for each gene whose
expression the array is to detect.
[0018] The pool of nucleic acids may be labeled before, during, or
after hybridization, although in a preferred embodiment, the
nucleic acids are labeled before hybridization. Fluorescence labels
are particularly preferred, more preferably labeling with a single
fluorophore, and, where fluorescence labeling is used,
quantification of the hybridized nucleic acids is by quantification
of fluorescence from the hybridized fluorescently labeled nucleic
acid. Such quantification is facilitated by the use of a
fluorescence microscope which can be equipped with an automated
stage to permit automatic scanning of the array, and which can be
equipped with a data acquisition system for the automated
measurement recording and subsequent processing of the fluorescence
intensity information. Preferred devices for reading such arrays
are the GeneChip.TM. reader, available from Affymetrix, Inc. of
Santa Clara, Calif.
[0019] In a preferred embodiment, hybridization is at low
stringency (e.g. about 20.degree. C. to about 50.degree. C., more
preferably about 30.degree. C. to about 40.degree. C., and most
preferably about 37.degree. C. and SSPE-T or lower) with at least
one wash at higher stringency. Hybridization may include subsequent
washes at progressively increasing stringency until a desired level
of hybridization specificity is reached.
[0020] Quantification of the hybridization signal can be by any
means known to one of skill in the art. However, in a particularly
preferred embodiment, quantification is achieved by use of a
confocal fluorescence microscope. Data is preferably evaluated by
calculating the difference in hybridization signal intensity
between each oligonucleotide probe and its corresponding mismatch
control probe. It is particularly preferred that this difference be
calculated and evaluated for each gene. Particularly preferred
analytical methods are provided herein.
[0021] The pool of target nucleic acids can be the total
polyA.sup.+ mRNA isolated from a biological sample, or cDNA made by
reverse transcription of the RNA or second strand cDNA or RNA
transcribed from the double stranded cDNA intermediate.
Alternatively, the pool of target nucleic acids can be treated to
reduce the complexity of the sample and thereby reduce the
background signal obtained in hybridization. In one approach, a
pool of mRNAs, derived from a biological sample, is hybridized with
a pool of oligonucleotides comprising the oligonucleotide probes
present in the high density array. The pool of hybridized nucleic
acids is then treated with RNase A which digests the single
stranded regions. The remaining double stranded hybridization
complexes are then denatured and the oligonucleotide probes are
removed, leaving a pool of mRNAs enhanced for those mRNAs
complementary to the oligonucleotide probes in the high density
array.
[0022] In another approach to background reduction, a pool of mRNAs
derived from a biological sample is hybridized with paired target
specific oligonucleotides where the paired target specific
oligonucleotides are complementary to regions flanking subsequences
of the mRNAs complementary to the oligonucleotide probes in the
high density array. The pool of hybridized nucleic acids is treated
with RNase H which digests the hybridized (double stranded) nucleic
acid sequences. The remaining single stranded nucleic acid
sequences which have a length about equivalent to the region
flanked by the paired target specific oligonucleotides are then
isolated (e.g. by electrophoresis) and used as the pool of nucleic
acids for monitoring gene expression.
[0023] Finally, a third approach to background reduction involves
eliminating or reducing the representation in the pool of
particular preselected target mRNA messages (e.g., messages that
are characteristically overexpressed in the sample). This method
involves hybridizing an oligonucleotide probe that is complementary
to the preselected target mRNA message to the pool of polyA.sup.+
mRNAs derived from a biological sample. The oligonucleotide probe
hybridizes with the particular preselected polyA.sup.+ mRNA
(message) to which it is complementary. The pool of hybridized
nucleic acids is treated with RNase H which digests the double
stranded (hybridized) region thereby separating the message from
its polyA.sup.+ tail. Isolating or amplifying (e.g., using an oligo
dT column) the polyA.sup.+ mRNA in the pool then provides a pool
having a reduced or no representation of the preselected target
mRNA message.
[0024] It will be appreciated that the methods of this invention
can be used to monitor (detect and/or quantify) the expression of
any desired gene of known sequence or subsequence. Moreover, these
methods permit monitoring expression of a large number of genes
simultaneously and effect significant advantages in reduced labor,
cost and time. The simultaneous monitoring of the expression levels
of a multiplicity of genes permits effective comparison of relative
expression levels and identification of biological conditions
characterized by alterations of relative expression levels of
various genes. Genes of particular interest for expression
monitoring include genes involved in the pathways associated with
various pathological conditions (e.g., cancer) and whose expression
is thus indicative of the pathological condition. Such genes
include, but are not limited to the HER2 c-erbB-2/neu)
proto-oncogene in the case of breast cancer, receptor tyrosine
kinases (RTKs) associated with the etiology of a number of tumors
including carcinomas of the breast, liver, bladder, pancreas, as
well as glioblastomas, sarcomas and squamous carcinomas, and tumor
suppressor genes such as the P53 gene and other "marker" genes such
as RAS, MSH2, MLH1 and BRCA1. Other genes of particular interest
for expression monitoring are genes involved in the immune response
(e.g., interleukin genes), as well as genes involved in cell
adhesion (e.g., the integrins or selectins), apoptosis and signal
transduction (e.g., tyrosine kinases), etc. Of course, the
invention is not limited to the monitoring of expression in human
samples, but may also be used in the evaluation of bacterial or
viral genes.
[0025] In another embodiment, this invention provides a method of
identifying genes the expression of which is affected by one or
more drugs, or conversely, screening a number of drugs to identify
those that have an effect on particular gene(s). This involves
providing a pool of target nucleic acids from one or more cells
contacted with the drug or drugs and hybridizing that pool to any
of the high density oligonucleotide arrays described herein. The
expression levels of the genes targeted by the probes in the array
are determined and compared to expression levels of genes from
"control" cells not exposed to the drug or drugs. The genes that
are overexpressed or underexpressed in response to the drug or
drugs are identified or conversely the drug or drugs that alter
expression of one or more genes are identified.
[0026] In still yet another embodiment, this invention provide for
a composition comprising any of the high density oligonucleotide
arrays disclosed herein where the oligonucleotide probes are
specifically hybridized to one or more fluorescently labeled
nucleic acids (which are the transcription products of genes or
derived from those transcription products) thereby forming a
fluorescent array in which the fluorescence of the array is
indicative of the transcription levels of the multiplicity of
genes. One of skill will appreciate that such a hybridized array
may be used as a reference, control, or standard (e.g., provided in
a kit) or may itself be a diagnostic array indicating the
expression levels of a multiplicity of genes in a sample.
[0027] This invention also provides kits for simultaneously
monitoring expression levels of a multiplicity of genes. The kits
include an array of immobilized oligonucleotide probes
complementary to subsequences of the multiplicity of target genes,
as described herein. The kit may also include instructions
describing the use of the array for detection and/or quantification
of expression levels of the multiplicity of genes. The kit may
additionally include one or more of the following: buffers,
hybridization mix, wash and read solutions, labels, labeling
reagents (enzymes etc.), "control" nucleic acids, software for
probe selection, array reading or data analysis and any of the
other materials or reagents described herein for the practice of
the claimed methods.
[0028] In another embodiment, this invention provides for a method
of selecting a set of oligonucleotide probes that specifically bind
to a target nucleic acid (e.g., a gene or genes whose expression is
to be monitored or nucleic acids derived from the gene or its
transcribed mRNA). The method involves providing a high density
array of oligonucleotide probes where the array comprises a
multiplicity of probes wherein each probe is complementary to a
subsequence of the target nucleic acid. The target nucleic acid is
then hybridized to the array of oligonucleotide probes to identify
and select those probes where the difference in hybridization
signal intensity between each probe and its mismatch control is
detectable (preferably greater than about 10% of the background
signal intensity, more preferably greater than about 20% of the
background signal intensity and most preferably greater than about
50% of the background signal intensity). The method can further
comprise hybridizing the array to a second pool of nucleic acids
comprising nucleic acids other than the target nucleic acids; and
identifying and selecting probes having the lowest hybridization
signal and where both the probe and its mismatch control have a
hybridization intensity equal to or less than about 5 times the
background signal intensity, preferably equal to or less than about
2 times the background signal intensity, more preferably equal to
or less than about 1 times the background signal intensity, and
most preferably equal or less than about half the background signal
intensity.
[0029] In a preferred embodiment, the multiplicity of probes can
include every different probe of length n that is complementary to
a subsequence of the target nucleic acid. The probes can, in one
embodiment, range from about 10 to about 500 nucleotide bases in
length. The array is preferably a high density array as described
above. Similarly, the hybridization methods, conditions, times,
fluid volumes, detection methods are as herein.
[0030] In another embodiment, the invention provides a
computer-implemented method of monitoring expression of genes
comprising the steps of: receiving input of hybridization
intensities for a plurality of nucleic acid probes including pairs
of perfect match probes and mismatch probes, the hybridization
intensities indicating hybridization affinity between the plurality
of nucleic acid probes and nucleic acids corresponding to a gene,
and each pair including a perfect match probe that is perfectly
complementary to a portion of the nucleic acids and a mismatch
probe that differs from the perfect match probe by at least one
nucleotide; comparing the hybridization intensities of the perfect
match and mismatch probes of each pair; and indicating expression
of the gene according to results of the comparing step. Preferably,
the differences between the hybridization intensities of the
perfect match and mismatch probes of each pair are calculated.
[0031] Additionally, the invention provides a computer-implemented
method for monitoring expression of genes comprising the steps of:
receiving input of a nucleic acid sequence constituting a gene;
generating a set of probes that are perfectly complementary to the
gene; and identifying a subset of probes, including less than all
of the probes in the set, for monitoring the expression of the
gene. Each probe of the set may be analyzed by criteria that
specify characteristics indicative of low hybridization or high
cross hybridization. The criteria may include if occurrences of a
specific nucleotide in a probe crosses a threshold value, if the
number of a specific nucleotide that repeats sequentially in a
probe crosses a threshold value, if the length of a palindrome in a
probe crosses a threshold value, and the like.
[0032] Definitions
[0033] The phrase "massively parallel screening" refers to the
simultaneous screening of at least about 100, preferably about
1000, more preferably about 10,000 and most preferably about
1,000,000 different nucleic acid hybridizations.
[0034] The terms "nucleic acid" or "nucleic acid molecule" refer to
a deoxyribonucleotide or ribonucleotide polymer in either single-or
double-stranded form, and unless otherwise limited, would encompass
analogs of natural nucleotide that can function in a similar manner
as naturally occurring nucleotide.
[0035] An oligonucleotide is a single-stranded nucleic acid ranging
in length from 2 to about 500 bases.
[0036] As used herein a "probe" is defined as an oligonucleotide
(or a nucleic acid) capable of binding to a target nucleic acid of
complementary sequence through one or more types of chemical bonds,
usually through complementary base pairing, usually through
hydrogen bond formation. As used herein, a probe may include
natural (i.e. A, G, U, C, or T) or modified bases
(7-deazaguanosine, inosine, etc.). In addition, the bases in probes
may be joined by a linkage other than a phosphodiester bond, so
long as it does not interfere with hybridization. Thus, probes may
be peptide nucleic acids in which the constituent bases are joined
by peptide bonds rather than phosphodiester linkages.
[0037] The term "target nucleic acid" refers to a nucleic acid
(often derived from a biological sample), to which the probe is
designed to specifically hybridize. It is either the presence or
absence of the target nucleic acid that is to be detected, or the
amount of the target nucleic acid that is to be quantified. The
target nucleic acid has a sequence that is complementary to the
nucleic acid sequence of the corresponding probe directed to the
target. The term target nucleic acid may refer to the specific
subsequence of a larger nucleic acid to which the probe is directed
or to the overall sequence (e.g., gene or mRNA) whose expression
level it is desired to detect. The difference in usage will be
apparent from context.
[0038] The term "mRNA" refers to transcripts of a gene. Transcripts
are RNA including, for example, mature messenger RNA ready for
translation, products of various stages of transcript processing.
Transcript processing may include splicing and degradation.
[0039] "Subsequence" refers to a sequence of nucleic acids that
comprise a part of a longer sequence of nucleic acids.
[0040] The term "complexity" is used here according to standard
meaning of this term as established by Britten et al. Methods of
Enzymol. 29:363 (1974). See, also Cantor and Schimmel Biophysical
Chemistry: Part III at 1228-1230 for further explanation of nucleic
acid complexity.
[0041] "Bind(s) substantially" refers to complementary
hybridization between a probe nucleic acid and a target nucleic
acid and embraces minor mismatches that can be accommodated by
reducing the stringency of the hybridization media to achieve the
desired detection of the target polynucleotide sequence.
[0042] The phrase "hybridizing specifically to", refers to the
binding, duplexing, or hybridizing of a molecule substantially to
or only to a particular nucleotide sequence or sequences under
stringent conditions when that sequence is present in a complex
mixture (e.g., total cellular) DNA or RNA. The term "stringent
conditions" refers to conditions under which a probe will hybridize
to its target subsequence, but with only insubstantial
hybridization to other sequences or to other sequences such that
the difference may be identified. Stringent conditions are
sequence-dependent and will be different in different
circumstances. Longer sequences hybridize specifically at higher
temperatures. Generally, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point (Tm) for
the specific sequence at a defined ionic strength and pH. The Tm is
the temperature (under defined ionic strength, pH, and nucleic acid
concentration) at which 50% of the probes complementary to the
target sequence hybridize to the target sequence at equilibrium.
(As the target sequences are generally present in excess, at Tm,
50% of the probes are occupied at equilibrium). Typically,
stringent conditions will be those in which the salt concentration
is at least about 0.01-to 1.0 M Na ion concentration (or other
salts) at pH 7.0 to 8.3 and the temperature is at least about
30.degree. C. for short probes (e.g., 10 to 50 nucleotide).
Stringent conditions may also be achieved with the addition of
destabilizing agents such as formamide.
[0043] The term "perfect match probe" refers to a probe that has a
sequence that is perfectly complementary to a particular target
sequence. The test probe is typically perfectly complementary to a
portion (subsequence) of the target sequence. The perfect match
(PM) probe can be a "test probe", a "normalization control" probe,
an expression level control probe and the like. A perfect match
control or perfect match probe is, however, distinguished from a
"mismatch control" or "mismatch probe."
[0044] The term "mismatch control" or "mismatch probe" refer to
probes whose sequence is deliberately selected not to be perfectly
complementary to a particular target sequence. For each mismatch
(MM) control in a high-density array there typically exists a
corresponding perfect match (PM) probe that is perfectly
complementary to the same particular target sequence. The mismatch
may comprise one or more bases. While the mismatch(s) may be
locates anywhere in the mismatch probe, terminal mismatches are
less desirable as a terminal mismatch is less likely. to prevent
hybridization of the target sequence. In a particularly preferred
embodiment, the mismatch is located at or near the center of the
probe such that the mismatch is most likely to destabilize the
duplex with the target sequence under the test hybridization
conditions.
[0045] The terms "background" or "background signal intensity"
refer to hybridization signals resulting from non-specific binding,
or other interactions, between the labeled target nucleic acids and
components of the oligonucleotide array (e.g., the oligonucleotide
probes, control probes, the array substrate, etc.). Background
signals may also be produced by intrinsic fluorescence of the array
components themselves. A single background signal can be calculated
for the entire array, or a different background signal may be
calculated for each target nucleic acid. In a preferred embodiment,
background is calculated as the average hybridization signal
intensity for the lowest 5% to 10% of the probes in the array, or,
where a different background signal is calculated for each target
gene, for the lowest 5% to 10% of the probes for each gene. Of
course, one of skill in the art will appreciate that where the
probes to a particular gene hybridize well and thus appear to be
specifically binding to a target sequence, they should not be used
in a background signal calculation. Alternatively, background may
be calculated as the average hybridization signal intensity
produced by hybridization to probes that are not complementary to
any sequence found in the sample (e.g. probes directed to nucleic
acids of the opposite sense or to genes not found in the sample
such as bacterial genes where the sample is mammalian nucleic
acids). Background can also be calculated as the average signal
intensity produced by regions of the array that lack any probes at
all.
[0046] The term "quantifying" when used in the context of
quantifying transcription levels of a gene can refer to absolute or
to relative quantification. Absolute quantification may be
accomplished by inclusion of known concentration(s) of one or more
target nucleic acids (e.g. control nucleic acids such as Bio B or
with known amounts the target nucleic acids themselves) and
referencing the hybridization intensity of unknowns with the known
target nucleic acids (e.g. through generation of a standard curve).
Alternatively, relative quantification can be accomplished by
comparison of hybridization signals between two or more genes, or
between two or more treatments to quantify the changes in
hybridization intensity and, by implication, transcription
level.
[0047] The "percentage of sequence identity" or "sequence identity"
is determined by comparing two optimally aligned sequences or
subsequences over a comparison window or span, wherein the portion
of the polynucleotide sequence in the comparison window may
optionally comprise additions or deletions (i.e., gaps) as compared
to the reference sequence (which does not comprise additions or
deletions) for optimal alignment of the two sequences. The
percentage is calculated by determining the number of positions at
which the identical subunit (e.g. nucleic acid base or amino acid
residue) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison and multiplying the
result by 100 to yield the percentage of sequence identity.
Percentage sequence identity when calculated using the programs GAP
or BESTFIT (see below) is calculated using default gap weights.
[0048] Methods of alignment of sequences for comparison are well
known in the art. Optimal alignment of sequences for comparison may
be conducted by the local homology algorithm of Smith and Waterman,
Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm
of Needleman and Wunsch J. Mol. Biol. 48: 443 (1970), by the search
for similarity method of Pearson and Lipman, Proc. Natl. Acad Sci.
USA 85: 2444 (1988), by computerized implementations of these
algorithms (including, but not limited to CLUSTAL in the PC/Gene
program by Intelligenetics, Moutain View, Calif., GAP, BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package,
Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.,
USA), or by inspection. In particular, methods for aligning
sequences using the CLUSTAL program are well described by Higgins
and Sharp in Gene, 73: 237-244 (1988) and in CABIOS 5: 151-153
(1989)).
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] FIG. 1 shows a schematic of expression monitoring using
oligonucleotide arrays. Extracted poly (A).sup.+ RNA is converted
to cDNA, which is then transcribed in the presence of labeled
ribonucleotide triphosphates. L is either biotin or a dye such as
fluorescein. RNA is fragmented with heat in the presence of
magnesium ions. Hybridizations are carried out in a flow cell that
contains the two-dimensional DNA probe arrays. Following a brief
washing step to remove unhybridized RNA, the arrays are scanned
using a scanning confocal microscope. Alternatives in which
cellular mRNA is directly labeled without a cDNA intermediate are
described in the Examples. Image analysis software converts the
scanned array images into text files in which the observed
intensities at specific physical locations are associated with
particular probe sequences.
[0050] FIG. 2A shows a fluorescent image of a high density array
containing over 16,000 different oligonucleotide probes. The image
was obtained following hybridization (15 hours at 40.degree. C.) of
biotin-labeled randomly fragmented sense RNA transcribed from the
murine B cell (T10) cDNA library, and spiked at the level of
1:3,000 (50 pM equivalent to about 100 copies per cell) with 13
specific RNA targets. The brightness at any location is indicative
of the amount of labeled RNA hybridized to the particular
oligonucleotide probe. FIG. 2B shows a small portion of the array
(the boxed region of FIG. 2A) containing probes for IL-2 and IL-3
RNAS. For comparison, FIG. 2C shows shown the same region of the
array following hybridization with an unspiked T10 RNA samples (T10
cells do not express IL-2 and IL-3). The variation in the signal
intensity was highly reproducible and reflected the sequence
dependence of the hybridization efficiencies. The central cross and
the four comers of the array contain a control sequence that is
complementary to a biotin-labeled oligonucleotide that was added to
the hybridization solution at a constant concentration (50 pM). The
sharpness of the images near the boundaries of the features was
limited by the resolution of the reading device (11.25 .mu.m) and
not by the spatial resolution of the array synthesis. The pixels in
the border regions of each synthesis feature were systematically
ignored in the quantitative analysis of the images.
[0051] FIG. 3 provides a log/log plot of the hybridization
intensity (average of the PM-MM intensity differences for each
gene) versus concentration for 11 different RNA targets. The
hybridization signals were quantitatively related to target
concentration. The experiments were performed as described in the
Examples herein and in FIG. 2. The ten 10 cytokine RNAs (plus bioB)
were spiked into labeled T10 RNA at levels ranging from 1:300,000
to 1:3,000. The signals continued to increase with increased
concentration up to frequencies of 1:300, but the response became
sublinear at the high levels due to saturation of the probe sites,
The linear range can be extended to higher concentrations by using
shorter hybridization times. RNAs from genes expressed in T10 cells
(IL-10, .beta.-actin and GAPDH) were also detected at levels
consistent with results obtained by probing cDNA libraries.
[0052] FIG. 4 shows cytokine mRNA levels in the murine 2D6 T helper
cell line at different times following stimulation with PMA and a
calcium ionophore. Poly (A).sup.+ RNA was extracted at 0, 2, 6, and
24 hours following stimulation and converted to double stranded
cDNA containing an RNA polymerase promoter. The cDNA pool was then
transcribed in the presence of biotin labeled ribonucleotide
triphosphates, fragmented, and hybridized to the oligonucleotide
probe arrays for 2 and 22 hours. The fluorescence intensities were
converted to RNA frequencies by comparison with the signals
obtained for a bacterial RNA (biotin synthetase) spiked into the
samples at known amounts prior to hybridization. A signal of 50,000
corresponds to a frequency of approximately 1:100,000 to a
frequency of 1:5,000, and a signal of 100 to a frequency of
1:50,000. RNAs for IL-2, IL-4, IL-6, and IL-12p40 were not detected
above the level of approximately 1:200,000 in these experiments.
The error bars reflect the estimated uncertainty (25 percent) in
the level for a given RNA relative to the level for the same RNA at
a different time point. The relative uncertainty estimate was based
on the results of repeated spiking experiments, and on repeated
measurements of IL-10, .beta.-actin and GAPDH RNAs in preparations
from both T10 and 2D6 cells (unstimulated). The uncertainty in the
absolute frequencies includes message-to-message differences in the
hybridization efficiency as well as differences in the mRNA
isolation, cDNA synthesis, and RNA synthesis and labeling steps.
The uncertainty in the absolute frequencies is estimated to be a
factor of three.
[0053] FIG. 5 shows a fluorescence image of an array containing
over 63,000 different oligonucleotide probes for 118 genes. The
image was obtained following overnight hybridization of a labeled
murine B cell RNA sample. Each square synthesis region is
50.times.50 .mu.m and contains 107 to 108 copies of a specific
oligonucleotide. The array was scanned at a resolution of 7.5 .mu.m
in approximately 15 minutes. The bright rows indicate RNAs present
at high levels. Lower level RNAs were unambiguously detected based
on quantitative evaluation of the hybridization patterns. A total
of 21 murine RNAs were detected at levels ranging from
approximately 1:300,000 to 1:100. The cross in the center, the
checkerboard in the comers, and the MUR-1 region at the top contain
probes complementary to a labeled control oligonucleotide that was
added to all samples.
[0054] FIG. 6 shows an example of a computer system used to execute
the software of an embodiment of the present invention.
[0055] FIG. 7 shows a system block diagram of a typical computer
system used to execute the software of an embodiment of the present
invention.
[0056] FIG. 8 shows the high level flow of a process of monitoring
the expression of a gene by comparing hybridization intensities of
pairs of perfect match and mismatch probes.
[0057] FIG. 9 shows the flow of a process of determining if a gene
is expressed utilizing a decision matrix.
[0058] FIGS. 10A and 10B show the flow of a process of determining
the expression of a gene by comparing baseline scan data and
experimental scan data.
[0059] FIG. 11 shows the flow of a process of increasing the number
of probes for monitoring the expression of genes after the number
of probes has been reduced or pruned.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0060] I. High Density Arrays for Monitoring Gene Expression
[0061] This invention provides methods of monitoring (detecting
and/or quantifying) the expression levels of one or more genes. The
methods involve hybridization of a nucleic acid target sample to a
high density array of nucleic acid probes and then quantifying the
amount of target nucleic acids hybridized to each probe in the
array.
[0062] While nucleic acid hybridization has been used for some time
to determine the expression levels of various genes (e.g., Northern
Blot), it was a surprising discovery of this invention that high
density arrays are suitable for the quantification of the small
variations in expression (transcription) levels of a gene in the
presence of a large population of heterogenous nucleic acids. The
signal may be present at a concentration of less than about 1 in
1,000, and is often present at a concentration less than 1 in
10,000 more preferably less than about 1 in 50,000 and most
preferably less than about 1 in 100,000, 1 in 300,000, or even 1 in
1,000,000.
[0063] Prior to this invention, it was expected that hybridization
of such a complex mixture to a high density array might overwhelm
the available probes and make it impossible to detect the presence
of low-level target nucleic acids. It was thus unclear that a low
level signal could be isolated and detected in the presence of
misleading signals due to cross-hybridization and non-specific
binding both to substrate and probe. It was therefore a surprising
discovery that, to the contrary, high density arrays are
particularly well suited for monitoring expression of a
multiplicity of genes and provide a level of sensitivity and
discrimination hitherto unexpected.
[0064] It was also a surprising discovery of this invention that
when used in a high-density array, even relatively short
oligonucleotides can be used to accurately detect and quantify
expression (transcription) levels of genes. Thus oligonucleotide
arrays having oligonucleotides as short as 10 nucleotide, more
preferably 15 oligonucleotides and most preferably 20 or 25
oligonucleotides are used to specifically detect and quantify gene
expression levels. Of course arrays containing longer
oligonucleotides, as described herein, are also suitable.
[0065] A. Advantages of Oligonucleotide Arrays
[0066] In one preferred embodiment, the high density arrays used in
the methods of this invention comprise chemically synthesized
oligonucleotides. The use of chemically synthesized oligonucleotide
arrays, as opposed to, for example, blotted arrays of genomic
clones, restriction fragments, oligonucleotides, and the like,
offers numerous advantages. These advantages generally fall into
four categories:
[0067] 1) Efficiency of production;
[0068] 2) Reduced intra- and inter-array variability;
[0069] 3) Increased information content; and
[0070] 4) Higher signal to noise ratio (improved sensitivity).
[0071] 1. Efficiency of Production
[0072] In a preferred embodiment, the arrays are synthesized using
methods of spatially addressed parallel synthesis (see, e.g.,
Section V, below). The oligonucleotides are synthesized chemically
in a highly parallel fashion covalently attached to the array
surface. This allows extremely efficient array production. For
example, arrays containing tens (or even hundreds) of thousands of
specifically selected 20 mer oligonucleotides are synthesized in
fewer than 80 synthesis cycles. The arrays are designed and
synthesized based on sequence information alone. Thus, unlike
blotting methods, the array preparation requires no handling of
biological materials. There is no need for cloning steps, nucleic
acid amplifications, cataloging of clones or amplification
products, and the like. The preferred chemical synthesis of
expression monitoring arrays in this invention is thus more
efficient blotting methods and permits the production of highly
reproducible high-density arrays with relatively little labor and
expense.
[0073] 2. Reduced Intra- and Inter-Array Variability
[0074] The use of chemically synthesized high-density
oligonucleotide arrays in the methods of this invention improves
intra- and inter-array variability. The oligonucleotide arrays
preferred for this invention are made in large batches (presently
49 arrays per wafer with multiple wafers synthesized in parallel)
in a highly controlled reproducible manner. This makes them
suitable as general diagnostic and research tools permitting direct
comparisons of assays performed anywhere in the world.
[0075] Because of the precise control obtainable during the
chemical synthesis the arrays of this invention show less than
about 25%, preferably less than about 20%, more preferably less
than about 15%, still more preferably less than about 10%, even
more preferably less than about 5% and most preferably less than
about 2% variation between high density arrays (within or between
production batches) having the same probe composition. Array
variation is assayed as the variation in hybridization intensity
(against a labeled control target nucleic acid mixture) in one or
more oligonucleotide probes between two or more arrays. More
preferably, array variation is assayed as the variation in
hybridization intensity (against a labeled control target nucleic
acid mixture) measured for one or more target genes between two or
more arrays.
[0076] In addition to reducing inter- and intra-array variability,
chemically synthesized arrays also reduce variations in relative
probe frequency inherent in spotting methods, particularly spotting
methods that use cell-derived nucleic acids (e.g., cDNAs). Many
genes are expressed at the level of thousands of copies per cell,
while others are expressed at only a single copy per cell. A cDNA
library will reflect this very large bias as will a cDNA library
made from this material. While normalization (adjustment of the
amount of each different probe e.g., by comparison to a reference
cDNA) of the library will reduce the representation of
over-expressed sequences, normalization has been shown to lessen
the odds of selecting highly expressed cDNAs by only about a factor
of 2 or 3. In contrast, chemical synthesis methods can insure that
all oligonucleotide probes are represented in approximately equal
concentrations. This decreases the inter-gene (intra-array)
variability and permits direct comparison between
characteristically overexpressed and underexpressed nucleic
acids.
[0077] 3. Increased Information Content
[0078] As indicated above, it was a discovery of this invention
that the use of high density oligonucleotide arrays for expression
monitoring provides a number of advantages not found with other
methods. For example, the use of large numbers of different probes
that specifically bind to the transcription product of a particular
target gene provides a high degree of redundancy and internal
control that permits optimization of probe sets for effective
detection of particular target genes and minimizes the possibility
of errors due to cross-reactivity with other nucleic acid
species.
[0079] Apparently suitable probes often prove ineffective for
expression monitoring by hybridization. For example, certain
subsequences of a particular target gene may be found in other
regions of the genome and probes directed to these subsequences
will cross-hybridize with the other regions and not provide a
signal that is a meaningful measure of the expression level of the
target gene. Even probes that show little cross reactivity may be
unsuitable because they generally show poor hybridization due to
the formation of structures that prevent effective hybridization.
Finally, in sets with large numbers of probes, it is difficult to
identify hybridization conditions that are optimal for all the
probes in a set. Because of the high degree of redundancy provided
by the large number of probes for each target gene, it is possible
to eliminate those probes that function poorly under a given set of
hybridization conditions and still retain enough probes to a
particular target gene to provide an extremely sensitive and
reliable measure of the expression level (transcription level) of
that gene.
[0080] In addition, the use of large numbers of different probes to
each target gene makes it possible to monitor expression of
families of closely-related nucleic acids. The probes may be
selected to hybridize both with subsequences that are conserved
across the family and with subsequences that differ in the
different nucleic acids in the family. Thus, hybridization with
such arrays permits simultaneous monitoring of the various members
of a gene family even where the various genes are approximately the
same size and have high levels of homology. Such measurements are
difficult or impossible with traditional hybridization methods.
[0081] Because the high density arrays contain such a large number
of probes it is possible to provide numerous controls including,
for example, controls for variations or mutations in a particular
gene, controls for overall hybridization conditions, controls for
sample preparation conditions, controls for metabolic activity of
the cell from which the nucleic acids are derived and mismatch
controls for non-specific binding or cross hybridization.
[0082] Moreover, as explained above, it was a surprising discovery
of this invention that effective detection and quantitation of gene
transcription in complex mammalian or other cell message
populations can be determined with relatively short
oligonucleotides and with relative few (e.g., fewer than 40,
preferably fewer than 30, more preferably fewer than 25, and most
preferably fewer than 20, 15, or even 10) oligonucleotide probes
per gene. In general, it was a discovery of this invention that
there are a large number of probes which hybridize both strongly
and specifically for each gene. This does not mean that a large
number of probes is required for detection, but rather that there
are many from which to choose and that choices can be based on
other considerations such as sequence uniqueness (gene families),
checking for splice variants, or genotyping hot spots (things not
easily done with cDNA spotting methods).
[0083] Based on these discoveries, sets of four arrays are made
that contain approximately 400,000 probes each can readily be
fabricated at reasonable cost. Sets of about 40 probes (20 probe
pairs) are chosen that are complementary to each of about 40,000
genes for which there are ESTs in the public database. This set of
ESTs covers roughly one-third to one-half of all human genes and
these arrays will allow the levels of all of them to be monitored
in a parallel set of overnight hybridizations.
[0084] 4. Improved Signal to Noise Ratio
[0085] Blotted nucleic acids typically rely on ionic,
electrostatic, and hydrophobic interactions to attach the blotted
nucleic acids to the substrate. Bonds are formed at multiple points
along the nucleic acid restricting degrees of freedom and
interfering with the ability of the nucleic acid to hybridize to
its complementary target. In contrast, the preferred arrays of this
invention are chemically synthesized. The oligonucleotide probes
are attached to the substrate by a single terminal covalent bond.
The probes have more degrees of freedom and are capable of
participating in complex interactions with their complementary
targets. Consequently, the probe arrays of this invention show
significantly higher hybridization efficiencies (10 times, 100
times, and even 1000 times more efficient) than blotted arrays.
Less target oligonucleotide is used to produce a given signal
thereby dramatically improving the signal to noise ratio.
Consequently the methods of this invention permit detection of only
a few copies of a nucleic acid in extremely complex nucleic acid
mixtures.
[0086] B. Preferred High Density Arrays
[0087] Preferred high density arrays of this invention comprise
greater than about 100, preferably greater than about 1000, more
preferably greater than about 16,000 and most preferably greater
than about 65,000 or 250,000 or even greater than about 1,000,000
different oligonucleotide probes, preferably in less than 1 cm2 of
surface area. The oligonucleotide probes range from about 5 to
about 50 or about 5 to about 45 nucleotide, more preferably from
about 10 to about 40 nucleotide and most preferably from about 15
to about 40 nucleotide in length. In particular preferred
embodiments, the oligonucleotide probes are 20 or 25 nucleotide in
length. It was a discovery of this invention that relatively short
oligonucleotide probes sufficient to specifically hybridize to and
distinguish target sequences. Thus in one preferred embodiment, the
oligonucleotide probes are less than 50 nucleotide in length,
generally less than 46 nucleotide, more generally less than 41
nucleotide, most generally less than 36 nucleotide, preferably less
than 31 nucleotide, more preferably less than 26 nucleotide, and
most preferably less than 21 nucleotide in length. The probes can
also be less than 16 nucleotide or less than even 11 nucleotide in
length.
[0088] The location and sequence of each different oligonucleotide
probe sequence in the array is known. Moreover, the large number of
different probes occupies a relatively small area providing a high
density array having a probe density of generally greater than
about 60, more generally greater than about 100, most generally
greater than about 600, often greater than about 1000, more often
greater than about 5,000, most often greater than about 10,000,
preferably greater than about 40,000 more preferably greater than
about 100,000, and most preferably greater than about 400,000
different oligonucleotide probes per cm.sup.2. The small surface
area of the array (often less than about 10 cm.sup.2, preferably
less than about 5 cm.sup.2 more preferably less than about 2
cm.sup.2, and most preferably less than about 1.6 cm.sup.2) permits
extremely uniform hybridization conditions (temperature regulation,
salt content, etc.) while the extremely large number of probes
allows massively parallel processing of hybridizations.
[0089] Finally, because of the small area occupied by the high
density arrays, hybridization may be carried out in extremely small
fluid volumes (e.g., 250 .mu.l or less, more preferably 100 .mu.l
or less, and most preferably 10 .mu.l or less). In small volumes,
hybridization may proceed very rapidly. In addition, hybridization
conditions are extremely uniform throughout the sample, and the
hybridization format is amenable to automated processing.
[0090] II. Uses of Expression Monitoring
[0091] This invention demonstrates that hybridization with high
density oligonucleotide probe arrays provides an effective means of
monitoring expression of a multiplicity of genes. In addition this
invention provides for methods of sample treatment and array
designs and methods of probe selection that optimize signal
detection at extremely low concentrations in complex nucleic acid
mixtures.
[0092] The expression monitoring methods of this invention may be
used in a wide variety of circumstances including detection of
disease, identification of differential gene expression between two
samples (e.g., a pathological as compared to a healthy sample),
screening for compositions that upregulate or downregulate the
expression of particular genes, and so forth.
[0093] In one preferred embodiment, the methods of this invention
are used to monitor the expression (transcription) levels of
nucleic acids whose expression is altered in a disease state. For
example, a cancer may be characterized by the overexpression of a
particular marker such as the HER2 (c-erbB-2/neu) proto-oncogene in
the case of breast cancer. Similarly, overexpression of receptor
tyrosine kinases (RTKs) is associated with the etiology of a number
of tumors including carcinomas of the breast, liver, bladder,
pancreas, as well as glioblastomas, sarcomas and squamous
carcinomas (see Carpenter, Ann. Rev. Biochem., 56: 881-914 (1987)).
Conversely, a cancer (e.g., colerectal, lung and breast) may be
characterized by the mutation of or underexpression of a tumor
suppressor gene such as P53 (see, e.g., Tominaga et al. Critical
Rev. in Oncogenesis, 3: 257-282 (1992)).
[0094] In another preferred embodiment, the methods of this
invention are used to monitor expression of various genes in
response to defined stimuli, such as a drug. The methods are
particularly advantageous because they permit simultaneous
monitoring of the expression of thousands of genes. This is
especially useful in drug research if the end point description is
a complex one, not simply asking if one particular gene is
overexpressed or underexpressed. Thus, where a disease state or the
mode of action of a drug is not well characterized, the methods of
this invention allow rapid determination of the particularly
relevant genes.
[0095] As indicated above, the materials and methods of this
invention are typically used to monitor the expression of a
multiplicity of different genes simultaneously. Thus, in one
embodiment, the invention provide for simultaneous monitoring of at
least about 10, preferably at least about 100, more preferably at
least about 1000, still more preferably at least about 10,000, and
most preferably at least about 100,000 different genes.
[0096] The expression monitoring methods of this invention can also
be used for gene discovery. Many genes that have been discovered to
date have been classified into families based on commonality of the
sequences. Because of the extremely large number of probes it is
possible to place in the high density array, it is possible to
include oligonucleotide probes representing known or parts of known
members from every gene class. In utilizing such a "chip" (high
density array) genes that are already known would give a positive
signal at loci containing both variable and common regions. For
unknown genes, only the common regions of the gene family would
give a positive signal. The result would indicate the possibility
of a newly discovered gene.
[0097] The expression monitoring methods of this invention can also
be used for monitoring the processing and eventual degradation of
transcripts. RNA processing is monitored by quantifying nascent
transcripts, processing intermediates, mature mRNA, and degradation
products. The use of oligonucleotide arrays provides a means for
simultaneous quantification of processing intermediates and
alternatively spliced mRNA of many or all expressed genes.
[0098] The expression monitoring method is also used for sequencing
or mutation detection in conjunction with the monitoring of
expression. Transcripts are not only detected and quantified, but
also can be partially or completely sequenced. Thus, using a sample
from a patient, this method can not only detect whether certain
genes are up or down regulated, but also detect whether those genes
are mutated, and identify the exact mutations. Specific methods for
mutation detection (or "resequencing") are disclosed in, for
example, Kozal et al., Nature Medicine, Vol. 2, No. 7, July 1996,
pp. 753-757, and Chee et al., Science, Vol. 274, Oct. 25, 1996,
pp.610-614, both incorporated herein by reference.
[0099] The expression monitoring methods of this invention also
allow the development of "dynamic" gene databases. The Human Genome
Project and commercial sequencing projects have generated large
static databases which list thousands of sequences without regard
to function or genetic interaction. Expression analysis using the
methods of this invention produces "dynamic" databases that define
a gene's function and its interactions with other genes. Without
the ability to monitor the expression of large numbers of genes
simultaneously ,however, the work of creating such a database is
enormous. The tedious nature of using DNA sequence analysis for
determining an expression pattern involves preparing a cDNA library
from the RNA isolated from the cells of interest and then
sequencing the library. As the DNA is sequenced, the operator lists
the sequences that are obtained and counts them. Thousands of
sequences would have to be determined and then the frequency of
those gene sequences would define the expression pattern of genes
for the cells being studied.
[0100] By contrast, using an expression monitoring array to obtain
the data according to the methods of this invention is relatively
fast and easy. The process involves stimulating the cells to induce
expression, obtaining the RNA from the cells and then either
labeling the RNA directly or creating a cDNA copy of the RNA. If
cDNA is to be hybridized to the chip, fluorescent molecules are
incorporated during the DNA polymerization. Either the labeled RNA
or the labeled cDNA is then hybridized to a high density array in
one overnight experiment. The hybridization provides a quantitative
assessment of the levels of every single one of the genes with no
additional sequencing. In addition the methods of this invention
are much more sensitive allowing a few copies of expressed genes
per cell to be detected. This procedure is demonstrated in the
examples provided herein.
[0101] III. Methods of Monitoring Gene Expression
[0102] Generally the methods of monitoring gene expression of this
invention involve (1) providing a pool of target nucleic acids
comprising RNA transcript(s) of one or more target gene(s), or
nucleic acids derived from the RNA transcript(s); (2) hybridizing
the nucleic acid sample to a high density array of probes
(including control probes); and (3) detecting the hybridized
nucleic acids and calculating a relative expression (transcription)
level.
[0103] A. Providing a Nucleic Acid Sample
[0104] One of skill in the art will appreciate that in order to
measure the transcription level (and thereby the expression level)
of a gene or genes, it is desirable to provide a nucleic acid
sample comprising mRNA transcript(s) of the gene or genes, or
nucleic acids derived from the mRNA transcript(s). As used herein,
a nucleic acid derived from an mRNA transcript refers to a nucleic
acid for whose synthesis the mRNA transcript or a subsequence
thereof has ultimately served as a template. Thus, a cDNA reverse
transcribed from an mRNA, an RNA transcribed from that cDNA, a DNA
amplified from the cDNA, an RNA transcribed from the amplified DNA,
etc., are all derived from the mRNA transcript and detection of
such derived products is indicative of the presence and/or
abundance of the original transcript in a sample. Thus, suitable
samples include, but are not limited to, mRNA transcripts of the
gene or genes, cDNA reverse transcribed from the mRNA, cRNA
transcribed from the cDNA, DNA amplified from the genes, RNA
transcribed from amplified DNA, and the like.
[0105] In a particularly preferred embodiment, where it is desired
to quantify the transcription level (and thereby expression) of a
one or more genes in a sample, the nucleic acid sample is one in
which the concentration of the mRNA transcript(s) of the gene or
genes, or the concentration of the nucleic acids derived from the
mRNA transcript(s), is proportional to the transcription level (and
therefore expression level) of that gene. Similarly, it is
preferred that the hybridization signal intensity be proportional
to the amount of hybridized nucleic acid. While it is preferred
that the proportionality be relatively strict (e.g., a doubling in
transcription rate results in a doubling in mRNA transcript in the
sample nucleic acid pool and a doubling in hybridization signal),
one of skill will appreciate that the proportionality can be more
relaxed and even nonlinear. Thus, for example, an assay where a 5
fold difference in concentration of the target mRNA results in a 3
to 6 fold difference in hybridization intensity is sufficient for
most purposes. Where more precise quantification is required
appropriate controls can be run to correct for variations
introduced in sample preparation and hybridization as described
herein. In addition, serial dilutions of "standard" target mRNAs
can be used to prepare calibration curves according to methods well
known to those of skill in the art. Of course, where simple
detection of the presence or absence of a transcript is desired, no
elaborate control or calibration is required.
[0106] In the simplest embodiment, such a nucleic acid sample is
the total mRNA isolated from a biological sample. The term
"biological sample", as used herein, refers to a sample obtained
from an organism or from components (e.g., cells) of an organism.
The sample may be of any biological tissue or fluid. Frequently the
sample will be a "clinical sample" which is a sample derived from a
patient. Such samples include, but are not limited to, sputum,
blood, blood cells (e.g., white cells), tissue or fine needle
biopsy samples, urine, peritoneal fluid, and pleural fluid, or
cells therefrom. Biological samples may also include sections of
tissues such as frozen sections taken for histological
purposes.
[0107] The nucleic acid (either genomic DNA or mRNA) may be
isolated from the sample according to any of a number of methods
well known to those of skill in the art. One of skill will
appreciate that where alterations in the copy number of a gene are
to be detected genomic DNA is preferably isolated. Conversely,
where expression levels of a gene or genes are to be detected,
preferably RNA (mRNA) is isolated.
[0108] Methods of isolating total mRNA are well known to those of
skill in the art. For example, methods of isolation and
purification of nucleic acids are described in detail in Chapter 3
of Laboratory Techniques in Biochemistry and Molecular Biology:
Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid Preparation, P. Tijssen, ed. Elsevier, N.Y. (1993) and Chapter
3 of Laboratory Techniques in Biochemistry and Molecular Biology:
Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid Preparation, P. Tijssen, ed. Elsevier, N.Y. (1993)).
[0109] In a preferred embodiment, the total RNA is isolated from a
given sample using, for example, an acid
guanidinium-phenol-chloroform extraction method and polyA.sup.+
mRNA is isolated by oligo dT column chromatography or by using
(dT)n magnetic beads (see, e.g., Sambrook et al., Molecular
Cloning: A Laboratory Manual (2nd ed.), Vols. 1-3, Cold Spring
Harbor Laboratory, (1989), or Current Protocols in Molecular
Biology, F. Ausubel et al., ed. Greene Publishing and
Wiley-Interscience, New York (1987)).
[0110] Frequently, it is desirable to amplify the nucleic acid
sample prior to hybridization. One of skill in the art will
appreciate that whatever amplification method is used, if a
quantitative result is desired, care must be taken to use a method
that maintains or controls for the relative frequencies of the
amplified nucleic acids to achieve quantitative amplification.
[0111] Methods of "quantitative" amplification are well known to
those of skill in the art. For example, quantitative PCR involves
simultaneously co-amplifying a known quantity of a control sequence
using the same primers. This provides an internal standard that may
be used to calibrate the PCR reaction. The high density array may
then include probes specific to the internal standard for
quantification of the amplified nucleic acid.
[0112] One preferred internal standard is a synthetic AW106 cRNA.
The AW106 cRNA is combined with RNA isolated from the sample
according to standard techniques known to those of skill in the
art. The RNA is then reverse transcribed using a reverse
transcriptase to provide copy DNA. The cDNA sequences are then
amplified (e.g., by PCR) using labeled primers. The amplification
products are separated, typically by electrophoresis, and the
amount of radioactivity (proportional to the amount of amplified
product) is determined. The amount of mRNA in the sample is then
calculated by comparison with the signal produced by the known
AW106 RNA standard. Detailed protocols for quantitative PCR are
provided in PCR Protocols, A Guide to Methods and Applications,
Innis et al., Academic Press, Inc. N.Y., (1990).
[0113] Other suitable amplification methods include, but are not
limited to polymerase chain reaction (PCR) (Innis, et al., PCR
Protocols. A guide to Methods and Application. Academic Press, Inc.
San Diego, (1990)), ligase chain reaction (LCR) (see Wu and
Wallace, Genomics, 4: 560 (1989), Landegren, et al., Science, 241:
1077 (1988) and Barringer, et al., Gene, 89: 117 (1990),
transcription amplification (Kwoh, et al., Proc. Natl. Acad. Sci.
USA, 86: 1173 (1989)), and self-sustained sequence replication
(Guatelli, et al., Proc. Nat. Acad. Sci. USA, 87: 1874 (1990)).
[0114] In a particularly preferred embodiment, the sample mRNA is
reverse transcribed with a reverse transcriptase and a primer
consisting of oligo dT and a sequence encoding the phage T7
promoter to provide single stranded DNA template. The second DNA
strand is polymerized using a DNA polymerase. After synthesis of
double-stranded cDNA, T7 RNA polymerase is added and RNA is
transcribed from the cDNA template. Successive rounds of
transcription from each single cDNA template results in amplified
RNA. Methods of in vitro polymerization are well known to those of
skill in the art (see, e.g., Sambrook, supra.) and this particular
method is described in detail by Van Gelder, et al., Proc. Natl.
Acad. Sci. USA, 87: 1663-1667 (1990) who demonstrate that in vitro
amplification according to this method preserves the relative
frequencies of the various RNA transcripts. Moreover, Eberwine et
al. Proc. Natl. Acad. Sci. USA, 89: 3010-3014 provide a protocol
that uses two rounds of amplification via in vitro transcription to
achieve greater than 10.sup.6 fold amplification of the original
starting material thereby permitting expression monitoring even
where biological samples are limited.
[0115] It will be appreciated by one of skill in the art that the
direct transcription method described above provides an antisense
(aRNA) pool. Where antisense RNA is used as the target nucleic
acid, the oligonucleotide probes provided in the array are chosen
to be complementary to subsequences of the antisense nucleic acids.
Conversely, where the target nucleic acid pool is a pool of sense
nucleic acids, the oligonucleotide probes are selected to be
complementary to subsequences of the sense nucleic acids. Finally,
where the nucleic acid pool is double stranded, the probes may be
of either sense as the target nucleic acids include both sense and
antisense strands.
[0116] The protocols cited above include methods of generating
pools of either sense or antisense nucleic acids. Indeed, one
approach can be used to generate either sense or antisense nucleic
acids as desired. For example, the cDNA can be directionally cloned
into a vector (e.g., Stratagene's p Bluscript II KS (+) phagemid)
such that it is flanked by the T3 and T7 promoters. In vitro
transcription with the T3 polymerase will produce RNA of one sense
(the sense depending on the orientation of the insert), while in
vitro transcription with the T7 polymerase will produce RNA having
the opposite sense. Other suitable cloning systems include phage
lambda vectors designed for Cre-loxP plasmid subcloning (see e.g.,
Palazzolo et al., Gene, 88: 25-36 (1990)).
[0117] In a particularly preferred embodiment, a high activity RNA
polymerase (e.g. about 2500 units/.mu.L for T7, available from
Epicentre Technologies) is used.
[0118] B. Labeling Nucleic Acids
[0119] In a preferred embodiment, the hybridized nucleic acids are
detected by detecting one or more labels attached to the sample
nucleic acids. The labels may be incorporated by any of a number of
means well known to those of skill in the art. However, in a
preferred embodiment, the label is simultaneously incorporated
during the amplification step in the preparation of the sample
nucleic acids. Thus, for example, polymerase chain reaction (PCR)
with labeled primers or labeled nucleotides will provide a labeled
amplification product. In a preferred embodiment, transcription
amplification, as described above, using a labeled nucleotide (e.g.
fluorescein-labeled UTP and/or CTP) incorporates a label into the
transcribed nucleic acids.
[0120] Alternatively, a label may be added directly to the original
nucleic acid sample (e.g., mRNA, polyA mRNA, cDNA, etc.) or to the
amplification product after the amplification is completed. Means
of attaching labels to nucleic acids are well known to those of
skill in the art and include, for example nick translation or
end-labeling (e.g. with a labeled RNA) by kinasing of the nucleic
acid and subsequent attachment (ligation) of a nucleic acid linker
joining the sample nucleic acid to a label (e.g., a
fluorophore).
[0121] Detectable labels suitable for use in the present invention
include any composition detectable by spectroscopic, photochemical,
biochemical, immunochemical, electrical, optical or chemical means.
Useful labels in the present invention include biotin for staining
with labeled streptavidin conjugate, magnetic beads (e.g.,
Dynabeads.TM.), fluorescent dyes (e.g., fluorescein, texas red,
rhodamine, green fluorescent protein, and the like), radiolabels
(e.g., .sup.3H, .sup.125I, .sup.35S, .sup.14C, or .sup.32P),
enzymes (e.g., horse radish peroxidase, alkaline phosphatase and
others commonly used in an ELISA), and colorimetric labels such as
colloidal gold or colored glass or plastic (e.g., polystyrene,
polypropylene, latex, etc.) beads. Patents teaching the use of such
labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350;
3,996,345; 4,277,437; 4,275,149; and 4,366,241.
[0122] Means of detecting such labels are well known to those of
skill in the art. Thus, for example, radiolabels may be detected
using photographic film or scintillation counters, fluorescent
markers may be detected using a photodetector to detect emitted
light. Enzymatic labels are typically detected by providing the
enzyme with a substrate and detecting the reaction product produced
by the action of the enzyme on the substrate, and colorimetric
labels are detected by simply visualizing the colored label.
Colloidal gold label can be detected by measuring scattered
light.
[0123] The label may be added to the target (sample) nucleic
acid(s) prior to, or after the hybridization. So called "direct
labels" are detectable labels that are directly attached to or
incorporated into the target (sample) nucleic acid prior to
hybridization. In contrast, so called "indirect labels" are joined
to the hybrid duplex after hybridization. Often, the indirect label
is attached to a binding moiety that has been attached to the
target nucleic acid prior to the hybridization. Thus, for example,
the target nucleic acid may be biotinylated before the
hybridization. After hybridization, an aviden-conjugated
fluorophore will bind the biotin bearing hybrid duplexes providing
a label that is easily detected. For a detailed review of methods
of labeling nucleic acids and detecting labeled hybridized nucleic
acids see Laboratory Techniques in Biochemistry and Molecular
Biology, Vol. 24: Hybridization With Nucleic Acid Probes, P.
Tijssen, ed. Elsevier, N.Y., (1993)).
[0124] Fluorescent labels are preferred and easily added during an
in vitro transcription reaction. In a preferred embodiment,
fluorescein labeled UTP and CTP are incorporated into the RNA
produced in an in vitro transcription reaction as described
above.
[0125] C. Modifying Sample to Improve Signal/Noise Ratio
[0126] The nucleic acid sample may be modified prior to
hybridization to the high density probe array in order to reduce
sample complexity thereby decreasing background signal and
improving sensitivity of the measurement. In one embodiment,
complexity reduction is achieved by selective degradation of
background mRNA. This is accomplished by hybridizing the sample
mRNA (e.g., polyA.sup.+ RNA) with a pool of DNA oligonucleotides
that hybridize specifically with the regions to which the probes in
the array specifically hybridize. In a preferred embodiment, the
pool of oligonucleotides consists of the same probe
oligonucleotides as found on the high density array.
[0127] The pool of oligonucleotides hybridizes to the sample mRNA
forming a number of double stranded (hybrid duplex) nucleic acids.
The hybridized sample is then treated with RNase A, a nuclease that
specifically digests single stranded RNA. The RNase A is then
inhibited, using a protease and/or commercially available RNase
inhibitors, and the double stranded nucleic acids are then
separated from the digested single stranded RNA. This separation
may be accomplished in a number of ways well known to those of
skill in the art including, but not limited to, electrophoresis,
and gradient centrifugation. However, in a preferred embodiment,
the pool of DNA oligonucleotides is provided attached to beads
forming thereby a nucleic acid affinity column. After digestion
with the RNase A, the hybridized DNA is removed simply by
denaturing (e.g., by adding heat or increasing salt) the hybrid
duplexes and washing the previously hybridized mRNA off in an
elution buffer.
[0128] The undigested mRNA fragments which will be hybridized to
the probes in the high density array are then preferably
end-labeled with a fluorophore attached to an RNA linker using an
RNA ligase. This procedure produces a labeled sample RNA pool in
which the nucleic acids that do not correspond to probes in the
array are eliminated and thus unavailable to contribute to a
background signal.
[0129] Another method of reducing sample complexity involves
hybridizing the mRNA with deoxyoligonucleotides that hybridize to
regions that border on either size the regions to which the high
density array probes are directed. Treatment with RNAse H
selectively digests the double stranded (hybrid duplexes) leaving a
pool of single-stranded mRNA corresponding to the short regions
(e.g., 20 mer) that were formerly bounded by the
deoxyoligonucleotide probes and which correspond to the targets of
the high density array probes and longer mRNA sequences that
correspond to regions between the targets of the probes of the high
density array. The short RNA fragments are then separated from the
long fragments (e.g., by electrophoresis), labeled if necessary as
described above, and then are ready for hybridization with the high
density probe array.
[0130] In a third approach, sample complexity reduction involves
the selective removal of particular (preselected) mRNA messages. In
particular, highly expressed mRNA messages that are not
specifically probed by the probes in the high density array are
preferably removed. This approach involves hybridizing the
polyA.sup.+ mRNA with an oligonucleotide probe that specifically
hybridizes to the preselected message close to the 3' (poly A) end.
The probe may be selected to provide high specificity and low cross
reactivity. Treatment of the hybridized message/probe complex with
RNase H digests the double stranded region effectively removing the
polyA.sup.+ tail from the rest of the message. The sample is then
treated with methods that specifically retain or amplify
polyA.sup.+ RNA (e.g., an oligo dT column or (dT)n magnetic beads).
Such methods will not retain or amplify the selected message(s) as
they are no longer associated with a polyA.sup.+ tail. These highly
expressed messages are effectively removed from the sample
providing a sample that has reduced background mRNA.
[0131] IV. Hybridization Array Design
[0132] A. Probe Composition
[0133] One of skill in the art will appreciate that an enormous
number of array designs are suitable for the practice of this
invention. The high density array will typically include a number
of probes that specifically hybridize to the nucleic acid(s)
expression of which is to be detected. In addition, in a preferred
embodiment, the array will include one or more control probes.
[0134] 1. Test Probes
[0135] In its simplest embodiment, the high density array includes
"test probes". These are oligonucleotides that range from about 5
to about 45 or 5 to about 50 nucleotides, more preferably from
about 10 to about 40 nucleotides and most preferably from about 15
to about 40 nucleotides in length. In other particularly preferred
embodiments the probes are 20 or 25 nucleotides in length. These
oligonucleotide probes have sequences complementary to particular
subsequences of the genes whose expression they are designed to
detect. Thus, the test probes are capable of specifically
hybridizing to the target nucleic acid they are to detect.
[0136] In addition to test probes that bind the target nucleic
acid(s) of interest, the high density array can contain a number of
control probes. The control probes fall into three categories
referred to herein as 1) Normalization controls; 2) Expression
level controls; and 3) Mismatch controls.
[0137] 2. Normalization Controls
[0138] Normalization controls are oligonucleotide probes that are
perfectly complementary to labeled reference oligonucleotides that
are added to the nucleic acid sample. The signals obtained from the
normalization controls after hybridization provide a control for
variations in hybridization conditions, label intensity, "reading"
efficiency and other factors that may cause the signal of a perfect
hybridization to vary between arrays. In a preferred embodiment,
signals (e.g., fluorescence intensity) read from all other probes
in the array are divided by the signal (e.g., fluorescence
intensity) from the control probes thereby normalizing the
measurements.
[0139] Virtually any probe may serve as a normalization control.
However, it is recognized that hybridization efficiency varies with
base composition and probe length. Preferred normalization probes
are selected to reflect the average length of the other probes
present in the array, however, they can be selected to cover a
range of lengths. The normalization control(s) can also be selected
to reflect the (average) base composition of the other probes in
the array, however in a preferred embodiment, only one or a few
normalization probes are used and they are selected such that they
hybridize well (i.e. no secondary structure) and do not match any
target-specific probes.
[0140] Normalization probes can be localized at any position in the
array or at multiple positions throughout the array to control for
spatial variation in hybridization efficiently. In a preferred
embodiment, the normalization controls are located at the corners
or edges of the array as well as in the middle.
[0141] 3. Expression Level Controls
[0142] Expression level controls are probes that hybridize
specifically with constitutively expressed genes in the biological
sample. Expression level controls are designed to control for the
overall health and metabolic activity of a cell. Examination of the
covariance of an expression level control with the expression level
of the target nucleic acid indicates whether measured changes or
variations in expression level of a gene is due to changes in
transcription rate of that gene or to general variations in health
of the cell. Thus, for example, when a cell is in poor health or
lacking a critical metabolite the expression levels of both an
active target gene and a constitutively expressed gene are expected
to decrease. The converse is also true. Thus where the expression
levels of both an expression level control and the target gene
appear to both decrease or to both increase, the change may be
attributed to changes in the metabolic activity of the cell as a
whole, not to differential expression of the target gene in
question. Conversely, where the expression levels of the target
gene and the expression level control do not covary, the variation
in the expression level of the target gene is attributed to
differences in regulation of that gene and not to overall
variations in the metabolic activity of the cell.
[0143] Virtually any constitutively expressed gene provides a
suitable target for expression level controls. Typically expression
level control probes have sequences complementary to subsequences
of constitutively expressed "housekeeping genes" including, but not
limited to the .beta.-actin gene, the transferrin receptor gene,
the GAPDH gene, and the like.
[0144] 4. Mismatch Controls
[0145] Mismatch controls may also be provided for the probes to the
target genes, for expression level controls or for normalization
controls. Mismatch controls are oligonucleotide probes identical to
their corresponding test or control probes except for the presence
of one or more mismatched bases. A mismatched base is a base
selected so that it is not complementary to the corresponding base
in the target sequence to which the probe would otherwise
specifically hybridize. One or more mismatches are selected such
that under appropriate hybridization conditions (e.g. stringent
conditions) the test or control probe would be expected to
hybridize with its target sequence, but the mismatch probe would
not hybridize (or would hybridize to a significantly lesser
extent). Preferred mismatch probes contain a central mismatch.
Thus, for example, where a probe is a 20 mer, a corresponding
mismatch probe will have the identical sequence except for a single
base mismatch (e.g., substituting a G, a C or a T for an A) at any
of positions 6 through 14 (the central mismatch).
[0146] Mismatch probes thus provide a control for non-specific
binding or cross-hybridization to a nucleic acid in the sample
other than the target to which the probe is directed. Mismatch
probes thus indicate whether a hybridization is specific or not.
For example, if the target is present the perfect match probes
should be consistently brighter than the mismatch probes. In
addition, if all central mismatches are present, the mismatch
probes can be used to detect a mutation. Finally, it was also a
discovery of the present invention that the difference in intensity
between the perfect match and the mismatch probe (I(PM)-I(MM))
provides a good measure of the concentration of the hybridized
material.
[0147] 5. Sample Preparation/Amplification Controls
[0148] The high density array may also include sample
preparation/amplification control probes. These are probes that are
complementary to subsequences of control genes selected because
they do not normally occur in the nucleic acids of the particular
biological sample being assayed. Suitable sample
preparation/amplification control probes include, for example,
probes to bacterial genes (e.g., Bio B) where the sample in
question is a biological from a eukaryote.
[0149] The RNA sample is then spiked with a known amount of the
nucleic acid to which the sample preparation/amplification control
probe is directed before processing. Quantification of the
hybridization of the sample preparation/amplification control probe
then provides a measure of alteration in the abundance of the
nucleic acids caused by processing steps (e.g. PCR, reverse
transcription, in vitro transcription, etc.).
[0150] B. Probe Selection and Optimization
[0151] In a preferred embodiment, oligonucleotide probes in the
high density array are selected to bind specifically to the nucleic
acid target to which they are directed with minimal non-specific
binding or cross-hybridization under the particular hybridization
conditions utilized. Because the high density arrays of this
invention can contain in excess of 1,000,000 different probes, it
is possible to provide every probe of a characteristic length that
binds to a particular nucleic acid sequence. Thus, for example, the
high density array can contain every possible 20 mer sequence
complementary to an IL-2 mRNA.
[0152] There, however, may exist 20 mer subsequences that are not
unique to the IL-2 mRNA. Probes directed to these subsequences are
expected to cross hybridize with occurrences of their complementary
sequence in other regions of the sample genome. Similarly, other
probes simply may not hybridize effectively under the hybridization
conditions (e.g., due to secondary structure, or interactions with
the substrate or other probes). Thus, in a preferred embodiment,
the probes that show such poor specificity or hybridization
efficiency are identified and may not be included either in the
high density array itself (e.g., during fabrication of the array)
or in the post-hybridization data analysis.
[0153] In addition, in a preferred embodiment, expression
monitoring arrays are used to identify the presence and expression
(transcription) level of genes which are several hundred base pairs
long. For most applications it would be useful to identify the
presence, absence, or expression level of several thousand to one
hundred thousand genes. Because the number of oligonucleotides per
array is limited in a preferred embodiment, it is desired to
include only a limited set of probes specific to each gene whose
expression is to be detected.
[0154] It is a discovery of this invention that probes as short as
15, 20, or 25 nucleotide are sufficient to hybridize to a
subsequence of a gene and that, for most genes, there is a set of
probes that performs well across a wide range of target nucleic
acid concentrations. In a preferred embodiment, it is desirable to
choose a preferred or "optimum" subset of probes for each gene
before synthesizing the high density array.
[0155] 1. Hybridization and Cross-Hybridization Data
[0156] Thus, in one embodiment, this invention provides for a
method of optimizing a probe set for detection of a particular
gene. Generally, this method involves providing a high density
array containing a multiplicity of probes of one or more particular
length(s) that are complementary to subsequences of the mRNA
transcribed by the target gene. In one embodiment the high density
array may contain every probe of a particular length that is
complementary to a particular mRNA. The probes of the high density
array are then hybridized with their target nucleic acid alone and
then hybridized with a high complexity, high concentration nucleic
acid sample that does not contain the targets complementary to the
probes. Thus, for example, where the target nucleic acid is an RNA,
the probes are first hybridized with their target nucleic acid
alone and then hybridized with RNA made from a cDNA library (e.g.,
reverse transcribed polyA.sup.+ mRNA) where the sense of the
hybridized RNA is opposite that of the target nucleic acid (to
insure that the high complexity sample does not contain targets for
the probes). Those probes that show a strong hybridization signal
with their target and little or no cross-hybridization with the
high complexity sample are preferred probes for use in the high
density arrays of this invention.
[0157] The high density array may additionally contain mismatch
controls for each of the probes to be tested. In a preferred
embodiment, the mismatch controls contain a central mismatch. Where
both the mismatch control and the target probe show high levels of
hybridization (e.g., the hybridization to the mismatch is nearly
equal to or greater than the hybridization to the corresponding
test probe), the test probe is preferably not used in the high
density array.
[0158] In a particularly preferred embodiment, optimal probes are
selected according to the following method: First, as indicated
above, an array is provided containing a multiplicity of
oligonucleotide probes complementary to subsequences of the target
nucleic acid. The oligonucleotide probes may be of a single length
or may span a variety of lengths ranging from 5 to 50 nucleotide.
The high density array may contain every probe of a particular
length that is complementary to a particular mRNA or may contain
probes selected from various regions of particular mRNAs. For each
target-specific probe the array also contains a mismatch control
probe; preferably a central mismatch control probe.
[0159] The oligonucleotide array is hybridized to a sample
containing target nucleic acids having subsequences complementary
to the oligonucleotide, probes and the difference in hybridization
intensity between each probe and its mismatch control is
determined. Only those probes where the difference between the
probe and its mismatch control exceeds a threshold hybridization
intensity (e.g. preferably greater than 10% of the background
signal intensity, more preferably greater than 20% of the
background signal intensity and most preferably greater than 50% of
the background signal intensity) are selected. Thus, only probes
that show a strong signal compared to their mismatch control are
selected.
[0160] The probe optimization procedure can optionally include a
second round of selection. In this selection, the oligonucleotide
probe array is hybridized with a nucleic acid sample that is not
expected to contain sequences complementary to the probes. Thus,
for example, where the probes are complementary to the RNA sense
strand a sample of antisense RNA is provided. Of course, other
samples could be provided such as samples from organisms or cell
lines known to be lacking a particular gene, or known for not
expressing a particular gene.
[0161] Only those probes where both the probe and its mismatch
control show hybridization intensities below a threshold value
(e.g. less than about 5 times the background signal intensity,
preferably equal to or less than about 2 times the background
signal intensity, more preferably equal to or less than about 1
times the background signal intensity, and most preferably equal or
less than about half background signal intensity) are selected. In
this way probes that show minimal non-specific binding are
selected. Finally, in a preferred embodiment, the n probes (where n
is the number of probes desired for each target gene) that pass
both selection criteria and have the highest hybridization
intensity for each target gene are selected for incorporation into
the array, or where already present in the array, for subsequent
data analysis. Of course, one of skill in the art, will appreciate
that either selection criterion could be used alone for selection
of probes.
[0162] 2. Heuristic Rules
[0163] Using the hybridization and cross-hybridization data
obtained as described above, graphs can be made of hybridization
and cross-hybridization intensities versus various probe properties
e.g., number of As, number of Cs in a window of 8 bases, palindomic
strength, etc. The graphs can then be examined for correlations
between those properties and the hybridization or
cross-hybridization intensities. Thresholds can be set beyond which
it looks like hybridization is always poor or cross hybridization
is always very strong. If any probe fails one of the criteria, it
is rejected from the set of probes and therefore, not placed on the
chip. This will be called the heuristic rules method.
[0164] One set of rules developed for 20 mer probes in this manner
is the following:
[0165] Hybridization rules:
[0166] 1) Number of As is less than 9.
[0167] 2) Number of Ts is less than 10 and greater than 0.
[0168] 3) Maximum run of As, Gs, or Ts is less than 4 bases in a
row.
[0169] 4) Maximum run of any 2 bases is less than 11 bases.
[0170] 5) Palindrome score is less than 6.
[0171] 6) Clumping score is less than 6.
[0172] 7) Number of As+Number of Ts is less than 14
[0173] 8) Number of As+number of Gs is less than 15
[0174] With respect to rule number 4, requiring the maximum run of
any two bases to be less than 11 bases guarantees that at least
three different bases occur within any 12 consecutive nucleotide. A
palindrome score is the maximum number of complementary bases if
the oligonucleotide is folded over at a point that maximizes self
complementarity. Thus, for example a 20 mer that is perfectly
self-complementary would have a palindrome score of 10. A clumping
score is the maximum number of three-mers of identical bases in a
given sequence. Thus, for example, a run of 5 identical bases will
produce a clumping score of 3 (bases 1-3, bases 2-4, and bases
3-5).
[0175] If any probe failed one of these criteria (1-8), the probe
was not a member of the subset of probes placed on the chip. For
example, if a hypothetical probe was 5'-AGCTTTTTTCATGCATCTAT-3' the
probe would not be synthesized on the chip because it has a run of
four or more bases (i.e., run of six).
[0176] The cross hybridization rules developed for 20 mers were as
follows:
[0177] 1) Number of Cs is less than 8;
[0178] 2) Number of Cs in any window of 8 bases is less than 4.
[0179] Thus, if any probe failed any of either the hybridization
ruses (1-8) or the cross-hybridization rules (1-2), the probe was
not a member of the subset of probes placed on the chip. These
rules eliminated many of the probes that cross hybridized strongly
or exhibited low hybridization, and performed moderate job of
eliminating weakly hybridizing probes.
[0180] These heuristic rules may be implemented by hand
calculations, or alternatively, they may be implemented in software
as is discussed below in Section IV.B.7.
[0181] 3. Neural Net
[0182] In another embodiment, a neural net can be trained to
predict the hybridization and cross-hybridization intensities based
on the sequence of the probe or on other probe properties. The
neural net can then be used to pick an arbitrary number of the
"best" probes. One such neural net was developed for selecting
20-mer probes. This neural net was produced a moderate (0.7)
correlation between predicted intensity and measured intensity,
with a better model for cross hybridization than hybridization.
Details of this neural net are provided in Example 6.
[0183] 4. ANOVA Model
[0184] An analysis of variance (ANOVA) model may be built to model
the intensities based on positions of consecutive base pairs. This
is based on the theory that the melting energy is based on stacking
energies of consecutive bases. The annova model was used to find
correlation between the a probe sequence and the hybridization and
cross-hybridization intensities. The inputs were probe sequences
broken down into consecutive base pairs. One model was made to
predict hybridization, another was made to predict cross
hybridization. The output was the hybridization or
crosshybridization intensity.
[0185] There were 304 (19*16) possible inputs, consisting of the 14
possible two base combinations, and the 19 positions that those
combinations could be found in. For example, the sequence aggctga .
. . has "ag" in the first position, "gg" in the second position,
"gc" in the third, "ct" in the fourth and so on.
[0186] The resulting model assigned a component of the output
intensity to each of the possible inputs, so to estimate the
intensity for a given sequence one simply adds the intensities for
each of it's 19 components.
[0187] 5. Pruning (Removal) of Similar Probes
[0188] One of the causes of poor signals in expression chips is
that genes other than the ones being monitored have sequences which
are very similar to parts of the sequences which are being
monitored. The easiest way to solve this is to remove probes which
are similar to more than one gene. Thus, in a preferred embodiment,
it is desirable to remove (prune) probes that hybridize to
transcription products of more than one gene.
[0189] The simplest pruning method is to line up a proposed probe
with all known genes for the organism being monitored, then count
the number of matching bases. For example, given a probe to gene 1
of an organism and gene 2 of an organism as follows: probe from
gene 1: aagcgcgatcgattatgctc
1 probe from gene 1: aagcgcgatcgattatgctc .vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline.
gene 2: atctcggatcgatcggataagcgcgatcgatt atgctcggcga
[0190] has 8 matching bases in this alignment, but 20 matching
bases in the following alignment:
2 probe from gene 1: aagcgcgatcgattatgctc
.vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
gene 2: atctcggatcgatcggataagcgcgatcgattatgctcggcga
[0191] More complicated algorithms also exist, which allow the
detection of insertion or deletion mismatches. Such sequence
alignment algorithms are well known to those of skill in the art
and include, but are not limited to BLAST, or FASTA, or other gene
matching programs such as those described above in the definitions
section.
[0192] In another variant, where an organism has many different
genes which are very similar, it is difficult to make a probe set
that measures the concentration only one of those very similar
genes. One can then prune out any probes which are dissimilar, and
make the probe set a probe set for that family of genes.
[0193] 6. Synthesis Cycle Pruning
[0194] The cost of producing masks for a chip is approximately
linearly related to the number of synthesis cycles. In a normal set
of genes the distribution of the number of cycles any probe takes
to build approximates a Gausian distribution. Because of this the
mask cost can normally be reduced by 15% by throwing out about 3
percent of the probes. In a preferred embodiment, synthesis cycle
pruning simply involves eliminating (not including) those probes
those probes that require a greater number of synthesis cycles than
the maximum number of synthesis cycles selected for preparation of
the particular subject high density oligonucleotide array. Since
the typical synthesis of probes follows a regular pattern of bases
put down (acgtacgtacgt . . . ) counting the number of synthesis
steps needed to build a probe is easy. The listing shown in Table 1
povides typical code for counting the number of synthesis cycles a
probe will need.
3TABLE 1 Typical code for counting synthesis cycles required for
the chemical synthesis of a probe. static char base[] = "acgt"; //
a b c d e f g h i j k l m n o p q r s t u v w x y z static short
index[] = {0, 0, 1, 0, 0, 0, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
3, 0, 0, 0, 0, 0, 0 }; short lookupIndex( char aBase ) { if(
isupper( aBase ) .parallel. !isalpha( aBase) ){ errorHwnd( "illegal
base"); return -1; } if(strchr(base, aBase) == NULL){
errorHwnd("non-dna base"); return 0; } return index[ aBase - `a`];
} static short calculateMinNumberOfSyn- thesisStepsForComplement(
char local * buffer ) { short i, last, current, cycles = 1; char
buffer1[40]; for(i = 3D 0; buffer[i] !=0; i++) { switch(
tolower(buffer[i]) ){ case `a`: buffer1[i] = `t`;break; case `c`:
buffer1[i] = `g`;break; case `g`: buffer1[i] = `c`;break; case `t`:
buffer1[i] = `a`;break; } } buffer1[i] = 0; if(buffer1[0] == 0)
return 0; last = lookupIndex( buffer1[0] ); for(i = 1; buffer1[i]
!= 0; i++){ current = lookupIndex( buffer1[i] ); if(current <=
last) cycles++; last = current; } return (short)((cycles -1) * 4 +
current +1); }
[0195] 7. Combination of Selection Methods
[0196] The heuristic rules, neural net and annova model provide
ways of pruning or reducing the number of probes for monitoring the
expression of genes. As these methods do not necessarily produce
the same results, or produce entirely independent results, it may
be advantageous to combine the methods. For example, probes may be
pruned or reduced if more than one method (e.g. two out of three)
indicate the probe will not likely produce good results. Then,
synthesis cycle pruning may be performed to reduce costs.
[0197] FIG. 11 shows the flow of a process of increasing the number
of probes for monitoring the expression of genes after the number
of probes has been reduced or pruned. In one embodiment, a user is
able to specify the number of nucleic acid probes that should be
placed on the chip to monitor the expression of each gene. As
discussed above, it is advantageous to reduce probes that will not
likely produce good results; however, the number of probes may be
reduced to substantially less than the desired number of
probes.
[0198] At step 402, the number of probes for monitoring multiple
genes is reduced by the heuristic rules method, neural net, annova
model, synthesis cycle pruning, or any other method, or combination
of methods. A gene is selected at step 404.
[0199] A determination is made whether the remaining probes for
monitoring the selected gene number greater than 80% (which may be
varied or user defined) of the desired number of probes. If yes,
the computer system proceeds to the next gene at step 408 which
will generally return to step 404.
[0200] If the remaining probes for monitoring the selected gene do
not number greater than 80% of the desired number of probes, a
determination is made whether the remaining probes for monitoring
the selected gene number greater than 40% (which may be varied or
user defined) of the desired number of probes. If yes, an "i" is
appended to the end of the gene name to indicate that after
pruning, the probes were incomplete at step 412.
[0201] At step 414, the number of probes is increased by loosening
the constraints that rejected probes. For example, the thresholds
in the heuristic rules may be increased by 1. Therefore, if
previously probes were rejected if they had four As in a row, the
rule may be loosened to five As in a row.
[0202] A determination is then made whether the remaining probes
for monitoring the selected gene number greater than 80% of the
desired number of probes at step 416. If yes, an "r" is appended to
the end of the gene name at step 412 to indicate that the rules
were loosened to generate the number of synthesized probes for that
gene.
[0203] At step 420, a check is made to see if the probes for
monitoring the selected gene only conflict with one or two other
genes. If yes, the full set of probes complementary to the gene (or
target sequence) are taken and pruned so that the probes remaining
are exactly complementary to the selected gene exclusively at step
422.
[0204] A determination is then made whether the remaining probes
for monitoring the selected gene number greater than 80% of the
desired number of probes at step 424. If yes, an "s" is appended to
the end of the gene name at step 426 to indicate that the only a
few genes were similar to the selected gene.
[0205] At step 428, the probes for monitoring the selected gene are
not reduced by conflicts at all. A determination is then made
whether the remaining probes for monitoring the selected gene
number greater than 80% of the desired number of probes at step
430. If yes, an "f" is appended to the end of the gene name at step
432 to indicate that the probes include the whole family of probes
perfectly complementary to the gene.
[0206] If there are still not 80% of the desired number of probes,
an error is reported at step 434. Any number of error handling
procedures may be undertaken. For example, an error message may be
generated for the user and the probes for the gene may not be
stored. Alternatively, the user may be prompted to enter a new
desired number of probes.
[0207] V. Synthesis of High Density Arrays
[0208] Methods of forming high density arrays of oligonucleotides,
peptides and other polymer sequences with a minimal number of
synthetic steps are known. The oligonucleotide analogue array can
be synthesized on a solid substrate by a variety of methods,
including, but not limited to, light-directed chemical coupling,
and mechanically directed coupling. See Pirrung et al., U.S. Pat.
No. 5,143,854 (see also PCT Application No. WO 90/15070) and Fodor
et al., PCT Publication Nos. WO 92/10092 and WO 93/09668 and U.S.
Ser. No. 07/980,523 which disclose methods of forming vast arrays
of peptides, oligonucleotides and other molecules using, for
example, light-directed synthesis techniques. See also, Fodor et
al., Science, 251, 767-77 (1991). These procedures for synthesis of
polymer arrays are now referred to as VLSIPS.TM. procedures. Using
the VLSIPS.TM. approach, one heterogenous array of polymers is
converted, through simultaneous coupling at a number of reaction
sites, into a different heterogenous array. See, U.S. application
Ser. Nos. 07/796,243 and 07/980,523.
[0209] The development of VLSIPS.TM. technology as described in the
above-noted U.S. Pat. No. 5,143,854 and PCT patent publication Nos.
WO 90/15070 and 92/10092, is considered pioneering technology in
the fields of combinatorial synthesis and screening of
combinatorial libraries. More recently, patent application Ser. No.
08/082,937, filed Jun. 25, 1993 describes methods for making arrays
of oligonucleotide probes that can be used to check or determine a
partial or complete sequence of a target nucleic acid and to detect
the presence of a nucleic acid containing a specific
oligonucleotide sequence.
[0210] In brief, the light-directed combinatorial synthesis of
oligonucleotide arrays on a glass surface proceeds using automated
phosphoramidite chemistry and chip masking techniques. In one
specific implementation, a glass surface is derivatized with a
silane reagent containing a functional group, e.g., a hydroxyl or
amine group blocked by a photolabile protecting group. Photolysis
through a photolithogaphic mask is used selectively to expose
functional groups which are then ready to react with incoming
5'-photoprotected nucleoside phosphoramidites. The phosphoramidites
react only with those sites which are illuminated (and thus exposed
by removal of the photolabile blocking group). Thus, the
phosphoramidites only add to those areas selectively exposed from
the preceding step. These steps are repeated until the desired
array of sequences have been synthesized on the solid surface.
Combinatorial synthesis of different oligonucleotide analogues at
different locations on the array is determined by the pattern of
illumination during synthesis and the order of addition of coupling
reagents.
[0211] In the event that an oligonucleotide analogue with a
polyamide backbone is used in the VLSIPS.TM. procedure, it is
generally inappropriate to use phosphoramidite chemistry to perform
the synthetic steps, since the monomers do not attach to one
another via a phosphate linkage. Instead, peptide synthetic methods
are substituted. See, e.g., Pirrung et al. U.S. Pat. No.
5,143,854.
[0212] Peptide nucleic acids are commercially available from, e.g.,
Biosearch, Inc. (Bedford, Mass.) which comprise a polyamide
backbone and the bases found in naturally occurring nucleosides.
Peptide nucleic acids are capable of binding to nucleic acids with
high specificity, and are considered "oligonucleotide analogues"
for purposes of this disclosure.
[0213] In addition to the foregoing, additional methods which can
be used to generate an array of oligonucleotides on a single
substrate are described in co-pending applications Ser. No.
07/980,523, filed Nov. 20, 1992, and 07/796,243, filed Nov. 22,
1991 and in PCT Publication No. WO 93/09668. In the methods
disclosed in these applications, reagents are delivered to the
substrate by either (1) flowing within a channel defined on
predefined regions or (2) "spotting" on predefined regions or (3)
through through the use of photoresist. However, other approaches,
as well as combinations of spotting and flowing, may be employed.
In each instance, certain activated regions of the substrate are
mechanically separated from other regions when the monomer
solutions are delivered to the various reaction sites.
[0214] A typical "flow channel" method applied to the compounds and
libraries of the present invention can generally be described as
follows. Diverse polymer sequences are synthesized at selected
regions of a substrate or solid support by forming flow channels on
a surface of the substrate through which appropriate reagents flow
or in which appropriate reagents are placed. For example, assume a
monomer "A" is to be bound to the substrate in a first group of
selected regions. If necessary, all or part of the surface of the
substrate in all or a part of the selected regions is activated for
binding by, for example, flowing appropriate reagents through all
or some of the channels, or by washing the entire substrate with
appropriate reagents. After placement of a channel block on the
surface of the substrate, a reagent having the monomer A flows
through or is placed in all or some of the channel(s). The channels
provide fluid contact to the first selected regions, thereby
binding the monomer A on the substrate directly or indirectly (via
a spacer) in the first selected regions.
[0215] Thereafter, a monomer B is coupled to second selected
regions, some of which may be included among the first selected
regions. The second selected regions will be in fluid contact with
a second flow channel(s) through translation, rotation, or
replacement of the channel block on the surface of the substrate;
through opening or closing a selected valve; or through deposition
of a layer of chemical or photoresist. If necessary, a step is
performed for activating at least the second regions. Thereafter,
the monomer B is flowed through or placed in the second flow
channel(s), binding monomer B at the second selected locations. In
this particular example, the resulting sequences bound to the
substrate at this stage of processing will be, for example, A, B,
and AB. The process is repeated to form a vast array of sequences
of desired length at known locations on the substrate.
[0216] After the substrate is activated, monomer A can be flowed
through some of the channels, monomer B can be flowed through other
channels, a monomer C can be flowed through still other channels,
etc. In this manner, many or all of the reaction regions are
reacted with a monomer before the channel block must be moved or
the substrate must be washed and/or reactivated. By making use of
many or all of the available reaction regions simultaneously, the
number of washing and activation steps can be minimized.
[0217] One of skill in the art will recognize that there are
alternative methods of forming channels or otherwise protecting a
portion of the surface of the substrate. For example, according to
some embodiments, a protective coating such as a hydrophilic or
hydrophobic coating (depending upon the nature of the solvent) is
utilized over portions of the substrate to be protected, sometimes
in combination with materials that facilitate wetting by the
reactant solution in other regions. In this manner, the flowing
solutions are further prevented from passing outside of their
designated flow paths.
[0218] The "spotting" methods of preparing compounds and libraries
of the present invention can be implemented in much the same manner
as the flow channel methods. For example, a monomer A can be
delivered to and coupled with a first group of reaction regions
which have been appropriately activated. Thereafter, a monomer B
can be delivered to and reacted with a second group of activated
reaction regions. Unlike the flow channel embodiments described
above, reactants are delivered by directly depositing (rather than
flowing) relatively small quantities of them in selected regions.
In some steps, of course, the entire substrate surface can be
sprayed or otherwise coated with a solution. In preferred
embodiments, a dispenser moves from region to region, depositing
only as much monomer as necessary at each stop. Typical dispensers
include a micropipette to deliver the monomer solution to the
substrate and a robotic system to control the position of the
micropipette with respect to the substrate. In other embodiments,
the dispenser includes a series of tubes, a manifold, an array of
pipettes, or the like so that various reagents can be delivered to
the reaction regions simultaneously.
[0219] VI. Hybridization
[0220] Nucleic acid hybridization simply involves providing a
denatured probe and target nucleic acid under conditions where the
probe and its complementary target can form stable hybrid duplexes
through complementary base pairing. The nucleic acids that do not
form hybrid duplexes are then washed away leaving the hybridized
nucleic acids to be detected, typically through detection of an
attached detectable label. It is generally recognized that nucleic
acids are denatured by increasing the temperature or decreasing the
salt concentration of the buffer containing the nucleic acids.
Under low stringency conditions (e.g., low temperature and/or high
salt) hybrid duplexes (e.g., DNA:DNA, RNA:RNA, or RNA:DNA) will
form even where the annealed sequences are not perfectly
complementary. Thus specificity of hybridization is reduced at
lower stringency. Conversely, at higher stringency (e.g., higher
temperature or lower salt) successful hybridization requires fewer
mismatches.
[0221] One of skill in the art will appreciate that hybridization
conditions may be selected to provide any degree of stringency. In
a preferred embodiment, hybridization is performed at low
stringency in this case in 6.times.SSPE-T at 37.degree. C. (0.005%
Triton X-100) to ensure hybridization and then subsequent washes
are performed at higher stringency (e.g., 1.times.SSPE-T at
37.degree. C.) to eliminate mismatched hybrid duplexes. Successive
washes may be performed at increasingly higher stringency (e.g.,
down to as low as 0.25.times.SSPE-T at 37.degree. C. to 50.degree.
C.) until a desired level of hybridization specificity is obtained.
Stringency can also be increased by addition of agents such as
formamide. Hybridization specificity may be evaluated by comparison
of hybridization to the test probes with hybridization to the
various controls that can be present (e.g., expression level
control, normalization control, mismatch controls, etc.).
[0222] In general, there is a tradeoff between hybridization
specificity (stringency) and signal intensity. Thus, in a preferred
embodiment, the wash is performed at the highest stringency that
produces consistent results and that provides a signal intensity
greater than approximately 10% of the background intensity. Thus,
in a preferred embodiment, the hybridized array may be washed at
successively higher stringency solutions and read between each
wash. Analysis of the data sets thus produced will reveal a wash
stringency above which the hybridization pattern is not appreciably
altered and which provides adequate signal for the particular
oligonucleotide probes of interest.
[0223] In a preferred embodiment, background signal is reduced by
the use of a detergent (e.g., C-TAB) or a blocking reagent (e.g.,
sperm DNA, cot-1 DNA, etc.) during the hybridization to reduce
non-specific binding. In a particularly preferred embodiment, the
hybridization is performed in the presence of about 0.5 mg/ml DNA
(e.g., herring sperm DNA). The use of blocking agents in
hybridization is well known to those of skill in the art (see,
e.g., Chapter 8 in P. Tijssen, supra.)
[0224] The stability of duplexes formed between RNAs or DNAs are
generally in the order of RNA:RNA>RNA:DNA>DNA:DNA, in
solution. Long probes have better duplex stability with a target,
but poorer mismatch discrimination than shorter probes (mismatch
discrimination refers to the measured hybridization signal ratio
between a perfect match probe and a single base mismatch probe).
Shorter probes (e.g., 8-mers) discriminate mismatches very well,
but the overall duplex stability is low.
[0225] Altering the thermal stability (T.sub.m) of the duplex
formed between the target and the probe using, e.g., known
oligonucleotide analogues allows for optimization of duplex
stability and mismatch discrimination. One useful aspect of
altering the T.sub.m arises from the fact that adenine-thymine
(A-T) duplexes have a lower T.sub.m than guanine-cytosine (G-C)
duplexes, due in part to the fact that the A-T duplexes have 2
hydrogen bonds per base-pair, while the G-C duplexes have 3
hydrogen bonds per base pair. In heterogeneous oligonucleotide
arrays in which there is a non-uniform distribution of bases, it is
not generally possible to optimize hybridization for each
oligonucleotide probe simultaneously. Thus, in some embodiments, it
is desirable to selectively destabilize G-C duplexes and/or to
increase the stability of A-T duplexes. This can be accomplished,
e.g., by substituting guanine residues in the probes of an array
which form G-C duplexes with hypoxanthine, or by substituting
adenine residues in probes which form A-T duplexes with 2,6
diaminopurine or by using the salt tetramethyl ammonium chloride
(TMACl) in place of NaCl.
[0226] Altered duplex stability conferred by using oligonucleotide
analogue probes can be ascertained by following, e.g., fluorescence
signal intensity of oligonucleotide analogue arrays hybridized with
a target oligonucleotide over time. The data allow optimization, of
specific hybridization conditions at, e.g., room temperature (for
simplified diagnostic applications in the future).
[0227] Another way of verifying altered duplex stability is by
following the signal intensity generated upon hybridization with
time. Previous experiments using DNA targets and DNA chips have
shown that signal intensity increases with time, and that the more
stable duplexes generate higher signal intensities faster than less
stable duplexes. The signals reach a plateau or "saturate" after a
certain amount of time due to all of the binding sites becoming
occupied. These data allow for optimization of hybridization, and
determination of the best conditions at a specified
temperature.
[0228] Methods of optimizing hybridization conditions are well
known to those of skill in the art (see, e.g., Laboratory
Techniques in Biochemistry and Molecular Biology, Vol. 24:
Hybridization With Nucleic Acid Probes, P. Tijssen, ed. Elsevier,
N.Y., (1993)).
[0229] VII. Signal Detection
[0230] Means of detecting labeled target (sample) nucleic acids
hybridized to the probes of the high density array are known to
those of skill in the art. Thus, for example, where a colorimetric
label is used, simple visualization of the label is sufficient.
Where a radioactive labeled probe is used, detection of the
radiation (e.g with photographic film or a solid state detector) is
sufficient.
[0231] In a preferred embodiment, however, the target nucleic acids
are labeled with a fluorescent label and the localization of the
label on the probe array is accomplished with fluorescent
microscopy. The hybridized array is excited with a light source at
the excitation wavelength of the particular fluorescent label and
the resulting fluorescence at the emission wavelength is detected.
In a particularly preferred embodiment, the excitation light source
is a laser appropriate for the excitation of the fluorescent
label.
[0232] The confocal microscope may be automated with a
computer-controlled stage to automatically scan the entire high
density array. Similarly, the microscope may be equipped with a
phototransducer (e.g., a photomultiplier, a solid state array, a
ccd camera, etc.) attached to an automated data acquisition system
to automatically record the fluorescence signal produced by
hybridization to each oligonucleotide probe on the array. Such
automated systems are described at length in U.S. Pat. No:
5,143,854, PCT Application 20 92/10092, and copending U.S. Ser. No.
08/195,889 filed on Feb. 10, 1994. Use of laser illumination in
conjunction with automated confocal microscopy for signal detection
permits detection at a resolution of better than about 100 .mu.m,
more preferably better than about 50 .mu.m, and most preferably
better than about 25 .mu.m.
[0233] VIII. Signal Evaluation
[0234] One of skill in the art will appreciate that methods for
evaluating the hybridization results vary with the nature of the
specific probe nucleic acids used as well as the controls provided.
In the simplest embodiment, simple quantification of the
fluorescence intensity for each probe is determined. This is
accomplished simply by measuring probe signal strength at each
location (representing a different probe) on the high density array
(e.g., where the label is a fluorescent label, detection of the
amount of florescence (intensity) produced by a fixed excitation
illumination at each location on the array). Comparison of the
absolute intensities of an array hybridized to nucleic acids from a
"test" sample with intensities produced by a "control" sample
provides a measure of the relative expression of the nucleic acids
that hybridize to each of the probes.
[0235] One of skill in the art, however, will appreciate that
hybridization signals will vary in strength with efficiency of
hybridization, the amount of label on the sample nucleic acid and
the amount of the particular nucleic acid in the sample. Typically
nucleic acids present at very low levels (e.g., <1 pM) will show
a very weak signal. At some low level of concentration, the signal
becomes virtually indistinguishable from background. In evaluating
the hybridization data, a threshold intensity value may be selected
below which a signal is not counted as being essentially
indistinguishable from background.
[0236] Where it is desirable to detect nucleic acids expressed at
lower levels, a lower threshold is chosen. Conversely, where only
high expression levels are to be evaluated a higher threshold level
is selected. In a preferred embodiment, a suitable threshold is
about 10% above that of the average background signal.
[0237] In addition, the provision of appropriate controls permits a
more detailed analysis that controls for variations in
hybridization conditions, cell health, non-specific binding and the
like. Thus, for example, in a preferred embodiment, the
hybridization array is provided with normalization controls as
described above in Section IV.A.2. These normalization controls are
probes complementary to control sequences added in a known
concentration to the sample. Where the overall hybridization
conditions are poor, the normalization controls will show a smaller
signal reflecting reduced hybridization. Conversely, where
hybridization conditions are good, the normalization controls will
provide a higher signal reflecting the improved hybridization.
Normalization of the signal derived from other probes in the array
to the normalization controls thus provides a control for
variations in hybridization conditions. Typically, normalization is
accomplished by dividing the measured signal from the other probes
in the array by the average signal produced by the normalization
controls. Normalization may also include correction for variations
due to sample preparation and amplification. Such normalization may
be accomplished by dividing the measured signal by the average
signal from the sample preparation/amplfication control probes
(e.g., the Bio B probes). The resulting values may be multiplied by
a constant value to scale the results.
[0238] As indicated above, the high density array can include
mismatch controls. In a preferred embodiment, there is a mismatch
control having a central mismatch for every probe (except the
normalization controls) in the array. It is expected that after
washing in stringent conditions, where a perfect match would be
expected to hybridize to the probe, but not to the mismatch, the
signal from the mismatch controls should only reflect non-specific
binding or the presence in the sample of a nucleic acid that
hybridizes with the mismatch. Where both the probe in question and
its corresponding mismatch control both show high signals, or the
mismatch shows a higher signal than its corresponding test probe,
there is a problem with the hybridization and the signal from those
probes is ignored. The difference in hybridization signal intensity
between the target specific probe and its corresponding mismatch
control is a measure of the discrimination of the target-specific
probe. Thus, in a preferred embodiment, the signal of the mismatch
probe is subtracted from the signal from its corresponding test
probe to provide a measure of the signal due to specific binding of
the test probe.
[0239] The concentration of a particular sequence can then be
determined by measuring the signal intensity of each of the probes
that bind specifically to that gene and normalizing to the
normalization controls. Where the signal from the probes is greater
than the mismatch, the mismatch is subtracted. Where the mismatch
intensity is equal to or greater than its corresponding test probe,
the signal is ignored. The expression level of a particular gene
can then be scored by the number of positive signals (either
absolute or above a threshold value), the intensity of the positive
signals (either absolute or above a selected threshold value), or a
combination of both metrics (e.g., a weighted average).
[0240] It is a surprising discovery of this invention, that
normalization controls are often unnecessary for useful
quantification of a hybridization signal. Thus, where optimal
probes have been identified in the two step selection process as
described above, in Section II.B., the average hybridization signal
produced by the selected optimal probes provides a good quantified
measure of the concentration of hybridized nucleic acid.
[0241] IX. Computer-Implemented Expression Monitoring
[0242] The methods of monitoring gene expression of this invention
may be performed utilizing a computer. The computer typically runs
a software program that includes computer code incorporating the
invention for analyzing hybridization intensities measured from a
substrate or chip and thus, monitoring the expression of one or
more genes. Although the following will describe specific
embodiments of the invention, the invention is not limited to any
one embodiment so the following is for purposes of illustration and
not limitation.
[0243] FIG. 6 illustrates an example of a computer system used to
execute the software of an embodiment of the present invention. As
shown, shows a computer system 100 includes a monitor 102, screen
104, cabinet 106, keyboard 108, and mouse 110. Mouse 110 may have
one or more buttons such as mouse buttons 112. Cabinet 106 houses a
CD-ROM drive 114, a system memory and a hard drive (both shown in
FIG. 7) which may be utilized to store and retrieve software
programs incorporating computer code that implements the invention,
data for use with the invention, and the like. Although a CD-ROM
116 is shown as an exemplary computer readable storage medium,
other computer readable storage media including floppy disks, tape,
flash memory, system memory, and hard drives may be utilized.
Cabinet 106 also houses familiar computer components (not shown)
such as a central processor, system memory, hard disk, and the
like.
[0244] FIG. 7 shows a system block diagram of computer system 100
used to execute the software of an embodiment of the present
invention. As in FIG. 6, computer system 100 includes monitor 102
and keyboard 108. Computer system 100 further includes subsystems
such as a central processor 120, system memory 122, I/O controller
124, display adapter 126, removable disk 128 (e.g., CD-ROM drive),
fixed disk 130 (e.g., hard drive), network interface 132, and
speaker 134. Other computer systems suitable for use with the
present invention may include additional or fewer subsystems. For
example, another computer system could include more than one
processor 120 (i.e., a multi-processor system) or a cache
memory.
[0245] Arrows such as 136 represent the system bus architecture of
computer system 100. However, these arrows are illustrative of any
interconnection scheme serving to link the subsystems. For example,
a local bus could be utilized to connect the central processor to
the system memory and display adapter. Computer system 100 shown in
FIG. 7 is but an example of a computer system suitable for use with
the present invention. Other configurations of subsystems suitable
for use with the present invention will be readily apparent to one
of ordinary skill in the art.
[0246] FIG. 8 shows a flowchart of a process of monitoring the
expression of a gene. The process compares hybridization
intensities of pairs of perfect match and mismatch probes that are
preferably covalently attached to the surface of a substrate or
chip. Most preferably, the nucleic acid probes have a density
greater than about 60 different nucleic acid probes per 1 cm.sup.2
of the substrate. Although the flowcharts show a sequence of steps
for clarity, this is not an indication that the steps must be
performed in this specific order. One of ordinary skill in the art
would readily recognize that many of the steps may be reordered,
combined, and deleted without departing from the invention.
[0247] Initially, nucleic acid probes are selected that are
complementary to the target sequence (or gene). These probes are
the perfect match probes. Another set of probes is specified that
are intended to be not perfectly complementary to the target
sequence. These probes are the mismatch probes and each mismatch
probe includes at least one nucleotide mismatch from a perfect
match probe. Accordingly, a mismatch probe and the perfect match
probe from which it was derived make up a pair of probes. As
mentioned earlier, the nucleotide mismatch is preferably near the
center of the mismatch probe.
[0248] The probe lengths of the perfect match probes are typically
chosen to exhibit high hybridization affinity with the target
sequence. For example, the nucleic acid probes may be all 20-mers.
However, probes of varying lengths may also be synthesized on the
substrate for any number of reasons including resolving
ambiguities.
[0249] The target sequence is typically fragmented, labeled and
exposed to a substrate including the nucleic acid probes as
described earlier. The hybridization intensities of the nucleic
acid probes is then measured and input into a computer system. The
computer system may be the same system that directs the substrate
hybridization or it may be a different system altogether. Of
course, any computer system for use with the invention should have
available other details of the experiment including possibly the
gene name, gene sequence, probe sequences, probe locations on the
substrate, and the like.
[0250] Referring to FIG. 8, after hybridization, the computer
system receives input of hybridization intensities of the multiple
pairs of perfect match and mismatch probes at step 202. The
hybridization intensities indicate hybridization affinity between
the nucleic acid probes and the target nucleic acid (which
corresponds to a gene). Each pair includes a perfect match probe
that is perfectly complementary to a portion of the target nucleic
acid and a mismatch probe that differs from the perfect match probe
by at least one nucleotide.
[0251] At step 204, the computer system compares the hybridization
intensities of the perfect match and mismatch probes of each pair.
If the gene is expressed, the hybridization intensity (or affinity)
of a perfect match probe of a pair should be recognizably higher
than the corresponding mismatch probe. Generally, if the
hybridizations intensities of a pair of probes are substantially
the same, it may indicate the gene is not expressed. However, the
determination is not based on a single pair of probes, the
determination of whether a gene is expressed is based on an
analysis of many pairs of probes. An exemplary process of comparing
the hybridization intensities of the pairs of probes will be
described in more detail in reference to FIG. 9.
[0252] After the system compares the hybridization intensity of the
perfect match and mismatch probes, the system indicates expression
of the gene at step 206. As an example, the system may indicate to
a user that the gene is either present (expressed), marginal or
absent (unexpressed).
[0253] FIG. 9 shows a flowchart of a process of determining if a
gene is expressed utilizing a decision matrix. At step 252, the
computer system receives raw scan data of N pairs of perfect match
and mismatch probes. In a preferred embodiment, the hybridization
intensities are photon counts from a fluorescein labeled target
that has hybridized to the probes on the substrate. For simplicity,
the hybridization intensity of a perfect match probe will be
designed "I.sub.pm" and the hybridization intensity of a mismatch
probe will be designed "I.sub.mm."
[0254] Hybridization intensities for a pair of probes is retrieved
at step 254. The background signal intensity is subtracted from
each of the hybridization intensities of the pair at step 256.
Background subtraction may also be performed on all the raw scan
data at the same time.
[0255] At step 258, the hybridization intensities of the pair of
probes are compared to a difference threshold (D) and a ratio
threshold (R). It is determined if the difference between the
hybridization intensities of the pair (I.sub.pm-I.sub.mm) is
greater than or equal to the difference threshold AND the quotient
of the hybridization intensities of the pair (I.sub.pm/I.sub.mm) is
greater than or equal to the ratio threshold. The difference
thresholds are typically user defined values that have been
determined to produce accurate expression monitoring of a gene or
genes. In one embodiment, the difference threshold is 20 and the
ratio threshold is 1.2.
[0256] If I.sub.pm-I.sub.mm>=D and I.sub.pm/I.sub.mm>=R, the
value NPOS is incremented at step 260. In general, NPOS is a value
that indicates the number of pairs of probes which have
hybridization intensities indicating that the gene is likely
expressed. NPOS is utilized in a determination of the expression of
the gene.
[0257] At step 262, it is determined if I.sub.mm-I.sub.pm>=D and
I.sub.mm/I.sub.pm>=R. If this expression is true, the value NNEG
is incremented at step 264. In general, NNEG is a value that
indicates the number of pairs of probes which have hybridization
intensities indicating that the gene is likely not expressed. NNEG,
like NPOS, is utilized in a determination of the expression of the
gene.
[0258] For each pair that exhibits hybridization intensities either
indicating the gene is expressed or not expressed, a log ratio
value (LR) and intensity difference value (IDIF) are calculated at
step 266. LR is calculated by the log of the quotient of the
hybridization intensities of the pair (I.sub.pm/I.sub.mm. The IDIF
is calculated by the difference between the hybridization
intensities of the pair (I.sub.pm-I.sub.mm). If there is a next
pair of hybridization intensities at step 268, they are retrieved
at step 254.
[0259] At step 272, a decision matrix is utilized to indicate if
the gene is expressed. The decision matrix utilizes the values N,
NPOS, NNEG, and LR (multiple LRs). The following four assignments
are performed:
[0260] P1=NPOS/NNEG
[0261] P2=NPOS/N
[0262] P3 =(10*SUM(LR))/(NPOS+NNEG)
[0263] These P values are then utilized to determine if the gene is
expressed.
[0264] For purposes of illustration, the P values are broken down
into ranges. If P1 is greater than or equal to 2.1, then A is true.
If P1 is less than 2.1 and greater than or equal to 1.8, then B is
true. Otherwise, C is true. Thus, P1 is broken down into three
ranges A, B and C. This is done to aid the readers understanding of
the invention.
[0265] Thus, all of the P values are broken down into ranges
according to the following:
[0266] A=(P1>=2.1)
[0267] B=(2.1>P1>=1.8)
[0268] C=(P1<1.8)
[0269] X=(P2>=0.35)
[0270] Y=(0.35>P2>=0.20)
[0271] Z=(P2<0.20)
[0272] Q=(P3>=1.5)
[0273] R=(1.5>P3>=1.1)
[0274] S=(P3<1.1)
[0275] Once the P values are broken down into ranges according to
the above boolean values, the gene expression is determined.
[0276] The gene expression is indicated as present (expressed),
marginal or absent (not expressed). The gene is indicated as
expressed if the following expression is true: A and (X or Y) and
(Q or R). In other words, the gene is indicated as expressed if
P1>=2.1, P2>=0.20 and P3>1.1. Additionally, the gene is
indicated as expressed if the following expression is true: B and X
and Q.
[0277] With the forgoing explanation, the following is a summary of
the gene expression indications:
4 Present A and (X or Y) and (Q or R) B and X and I Marginal A and
X and S B and X and R B and Y and (Q or R) Absent All others cases
(e.g., any C combination)
[0278] In the output to the user, present may be indicated as "P,"
marginal as "M" and absent as "A" at step 274.
[0279] Once all the pairs of probes have been processed and the
expression of the gene indicated, an average of ten times the LRs
is computed at step 275. Additionally, an average of the IDIF
values for the probes that incremented NPOS and NNEG is calculated.
These values may be utilized for quantitative comparisons of this
experiments with other experiments.
[0280] Quantitative measurements may be performed at step 276. For
example, the current experiment may be compared to a previous
experiment (e.g., utilizing values calculated at step 270).
Additionally, the experiment may be compared to hybridization
intensities of RNA (such as from bacteria) present in the
biological sample in a known quantity. In this manner, one may
verify the correctness of the gene expression indication or call,
modify threshold values, or perform any number of modifications of
the preceding.
[0281] For simplicity, FIG. 9 was described in reference to a
single gene. However, the process may be utilized on multiple genes
in a biological sample. Therefore, any discussion of the analysis
of a single gene is not an indication that the process may not be
extended to processing multiple genes.
[0282] FIGS. 10A and 10B show the flow of a process of determining
the expression of a gene by comparing baseline scan data and
experimental scan data. For example, the baseline scan data may be
from a biological sample where it is known the gene is expressed.
Thus, this scan data may be compared to a different biological
sample to determine if the gene is expressed. Additionally, it may
be determined how the expression of a gene or genes changes over
time in a biological organism.
[0283] At step 302, the computer system receives raw scan data of N
pairs of perfect match and mismatch probes from the baseline. The
hybridization intensity of a perfect match probe from the baseline
will be designed "I.sub.pm" and the hybridization intensity of a
mismatch probe from the baseline will be designed "I.sub.mm." The
background signal intensity is subtracted from each of the
hybridization intensities of the pairs of baseline scan data at
step 304.
[0284] At step 306, the computer system receives raw scan data of N
pairs of perfect match and mismatch probes from the experimental
biological sample. The hybridization intensity of a perfect match
probes from the experiment will be designed "J.sub.pm" and the
hybridization intensity of a mismatch probe from the experiment
will be designed "J.sub.mm." The background signal intensity is
subtracted from each of the hybridization intensities of the pairs
of experimental scan data at step 308.
[0285] The hybridization intensities of an I and J pair may be
normalized at step 310. For example, the hybridization intensities
of the I and J pairs may be divided by the hybridization intensity
of control probes as discussed in Section II.A.2.
[0286] At step 312, the hybridization intensities of the I and J
pair of probes are compared to a difference threshold (DDIF) and a
ratio threshold (RDIF). It is determined if the difference between
the hybridization intensities of the one pair (J.sub.pm-J.sub.mm)
and the other pair (I.sub.pm-I.sub.mm) are greater than or equal to
the difference threshold AND the quotient of the hybridization
intensities of one pair (J.sub.pm-J.sub.mm) and the other pair
(I.sub.pm-I.sub.mm) are greater than or equal to the ratio
threshold. The difference thresholds are typically user defined
values that have been determined to produce accurate expression
monitoring of a gene or genes.
[0287] If (J.sub.pm-J.sub.mm)-(I.sub.pm-I.sub.mm)>=DDIF and
(J.sub.pm-J.sub.mm)/(I.sub.pm-I.sub.mm)>=RDIF, the value NINC is
incremented at step 314. In general, NINC is a value that indicates
the experimental pair of probes indicates that the gene expression
is likely greater (or increased) than the baseline sample. NINC is
utilized in a determination of whether the expression of the gene
is greater (or increased), less (or decreased) or did not change in
the experimental sample compared to the baseline sample.
[0288] At step 316, it is determined if
(J.sub.pm-J.sub.mm)-(I.sub.pm-I.su- b.mm)>=DDIF and
(J.sub.pm-J.sub.mm)/(I.sub.pm/I.sub.mm)>=RDIF. If this
expression is true, NDEC is incremented. In general, NDEC is a
value that indicates the experimental pair of probes indicates that
the gene expression is likely less (or decreased) than the baseline
sample. NDEC is utilized in a determination of whether the
expression of the gene is greater (or increased), less (or
decreased) or did not change in the experimental sample compared to
the baseline sample.
[0289] For each of the pairs that exhibits hybridization
intensities either indicating the gene is expressed more or less in
the experimental sample, the values NPOS, NNEG and LR are
calculated for each pair of probes. These values are calculated as
discussed above in reference to FIG. 9. A suffix of either "B" or
"E" has been added to each value in order to indicate if the value
denotes the baseline sample or the experimental sample,
respectively. If there are next pairs of hybridization intensities
at step 322, they are processed in a similar manner as shown.
[0290] Referring now to FIG. 10B, an absolute decision computation
is performed for both the baseline and experimental samples at step
324. The absolute decision computation is an indication of whether
the gene is expressed, marginal or absent in each of the baseline
and experimental samples. Accordingly, in a preferred embodiment,
this step entails performing steps 272 and 274 from FIG. 9 for each
of the samples. This being done, there is an indication of gene
expression for each of the samples taken alone.
[0291] At step 326, a decision matrix is utilized to determine the
difference in gene expression between the two samples. This
decision matrix utilizes the values, N, NPOSB, NPOSE, NNEGB, NNEGE,
NINC, NDEC, LRB, and LRE as they were calculated above. The
decision matrix performs different calculations depending on
whether NINC is greater than or equal to NDEC. The calculations are
as follows.
[0292] If NINC>=NDEC, the following four P values are
determined:
[0293] P1=NINC/NDEC
[0294] P2=NINC/N
[0295] P3=((NPOSE-NPOSB)-(NNEGE-NNEGB))/N
[0296] P4=10*SUM(LRE-LRB)/N
[0297] These P values are then utilized to determine the difference
in gene expression between the two samples.
[0298] For purposes of illustration, the P values are broken down
into ranges as was done previously. Thus, all of the P values are
broken down into ranges according to the following:
[0299] A=(P1>=2.7)
[0300] B=(2.7>P1>=1.8)
[0301] C=(P1<1.8)
[0302] X=(P2>=0.24)
[0303] Y=(0.24>P2>=0.16)
[0304] Z=(P2<0.160)
[0305] M=(P3>=0.17)
[0306] N=(0.17>P3>=0.10)
[0307] O=(P3<0.10)
[0308] Q=(P4>=1.3)
[0309] R=(1.3>P4>=0.9)
[0310] S=(P4<0.9)
[0311] Once the P values are broken down into ranges according to
the above boolean values, the difference in gene expression between
the two samples is determined.
[0312] In this case where NINC>=NDEC, the gene expression change
is indicated as increased, marginal increase or no change. The
following is a summary of the gene expression indications:
[0313] Increased A and (X or Y) and (Q or R) and (M or N or O) A
and (X or Y) and (Q or R or S) and (M or N) B and (X or Y) and (Q
or R) and (M or N) A and X and (Q or R or S) and (M or N or O)
[0314] Marginal A or Y or S or O
[0315] Increase B and (X or Y) and (Q or R) and O B and (X or Y)
and S and (M or N) C and (X or Y) and (Q or R) and (M or N)
[0316] No Change All others cases (e.g., any Z combination)
[0317] In the output to the user, increased may be indicated as
"I," marginal increase as "MI" and no change as "NC."
[0318] If NINC<NDEC, the following four P values are
determined:
[0319] P1=NDEC/NINC
[0320] P2=NDEC/N
[0321] P3=((NNEGE-NNEGB)-(NPOSE-NPOSB))/N
[0322] P4=10*SUM(LRE-LRB)/N
[0323] These P values are then utilized to determine the difference
in gene expression between the two samples.
[0324] The P values are broken down into the same ranges as for the
other case where NINC >=NDEC. Thus, P values in this case
indicate the same ranges and will not be repeated for the sake of
brevity. However, the ranges generally indicate different changes
in the gene expression between the two samples as shown below.
[0325] In this case where NINC<NDEC, the gene expression change
is indicated as decreased, marginal decrease or no change. The
following is a summary of the gene expression indications:
5 Decreased A and (X or Y) and (Q or R) and (M or N or O) A and (X
or Y) and (Q or R or S) and (M or N) B and (X or Y) and (Q or R)
and (M or N) A and X and (Q or R or S) and (M or N or O) Marginal A
or Y or S or O Decrease B and (X or Y) and (Q or R) and O B and (X
or Y) and S and (M or N) C and (X or Y) and (Q or R) and (M or N)
No Change All others cases (e.g., any Z combination)
[0326] In the output to the user, decreased may be indicated as
"D," marginal decrease as "MD" and no hange as "NC."
[0327] The above has shown that the relative difference between the
gene expression between a baseline sample and an experimental
sample may be determined. An additional test may be performed that
would change an I, MI, D, or MD (ie., not NC) call to NC if the
gene is indicated as expressed in both samples (e.g., from step
324) and the following expressions are all true:
[0328] Average(IDIFB)>=200
[0329] Average(IDIFE)>=200
[0330] 1.4>=Average(IDIFE)/Average(IDIFB)>=0.7
[0331] Thus, when a gene is expressed in both samples, a call of
increased or decreased (whether marginal or not) will be changed to
a no change call if the average intensity difference for each
sample is relatively large or substantially the same for both
samples. The IDIFB and IDIFE are calculated as the sum of all the
IDIFs for each sample divided by N.
[0332] At step 328, values for quantitative difference evaluation
are calculated. An average of
((J.sub.pm-J.sub.mm)-(I.sub.pm-I.sub.mm)) for each of the pairs is
calculated. Additionally, a quotient of the average of
J.sub.pm-J.sub.mm and the average of I.sub.pm-I.sub.mm is
calculated. These values may be utilized to compare the results
with other experiments in step 330.
[0333] X. Monitoring Expression Levels
[0334] As indicated above, the methods of this invention may be
used to monitor expression levels of a gene in a wide variety of
contexts. For example, where the effects of a drug on gene
expression is to be determined the drug will be administered to an
organism, a tissue sample, or a cell. Nucleic acids from the tissue
sample, cell, or a biological sample from the organism and from an
untreated organism tissue sample or cell are isolated as described
above, hybridized to a high density probe array containing probes
directed to the gene of interest and the expression levels of that
gene are determined as described above.
[0335] Similarly, where the expression levels of a disease marker
(e.g, P53, RTK, or HER2) are to be detected (e.g., for the
diagnosis of a pathological condition in a patient), comparison of
the expression levels of the disease marker in the sample to
disease markers from a healthy organism will reveal any deviations
in the expression levels of the marker in the test sample as
compared to the healthy sample. Correlation of such deviations with
a pathological condition provides a diagnostic assay for that
condition.
[0336] XI. Other Embodiments
[0337] i. Overall Description
[0338] A. general
[0339] B. VLSIPS substrates
[0340] C. binary masking
[0341] D. applications
[0342] E. detection methods and apparatus
[0343] F. data analysis
[0344] ii. Theoretical Analysis
[0345] A. simple n-mer structure; theory
[0346] B. complications
[0347] C. non-polynucleotide embodiments
[0348] iii. Polynucleotide Sequencing
[0349] A. preparation of substrate matrix
[0350] B. labeling target polynucleotide
[0351] C. hybridization conditions
[0352] D. detection; VLSIPS scanning
[0353] E. analysis
[0354] F. substrate reuse
[0355] G. non-polynucleotide aspects
[0356] iv. Fingerprinting
[0357] A. general
[0358] B. preparation of substrate matrix
[0359] C. labeling target nucleotides
[0360] D. hybridization conditions
[0361] E. detection; VLSIPS scanning
[0362] F. analysis
[0363] G. substrate reuse
[0364] H. non-polynucleotide aspects
[0365] V. Mapping
[0366] A. general
[0367] B. preparation of substrate matrix
[0368] C. labeling
[0369] D. hybridization/specific interaction
[0370] E. detection
[0371] F. analysis
[0372] G. substrate reuse
[0373] H. non-polynucleotide aspects
[0374] vi. Additional Screening
[0375] A. specific interactions
[0376] B. sequence comparisons
[0377] C. categorizations
[0378] D. statistical correlations
[0379] vii. Formation of Substrate
[0380] A. instrumentation
[0381] B. binary masking
[0382] C. synthetic methods
[0383] D. surface immobilization
[0384] viii. Hybridization/Specific Interaction
[0385] A. general
[0386] B. important parameters
[0387] ix. Detection Methods
[0388] A. labeling techniques
[0389] B. scanning system
[0390] x. Data Analysis
[0391] A. general
[0392] B. hardware
[0393] C. software
[0394] xi. Substrate Reuse
[0395] A. removal of label
[0396] B. storage and preservation
[0397] C. processes to avoid degradation of oligomers
[0398] xii. Integrated Sequencing Strategy
[0399] A. initial mapping strategy
[0400] B. selection of smaller clones
[0401] C. actual sequencing procedures
[0402] xiii. Commercial Applications
[0403] A. sequencing
[0404] B. fingerprinting
[0405] C. mapping
[0406] Overall Description
[0407] A. General
[0408] The present invention relies in part on the ability to
synthesize or attach specific recognition reagents at known
locations on a substrate, typically a single substrate. In
particular, the present invention provides the ability to prepare a
substrate having a very high density matrix pattern of positionally
defined specific recognition reagents. The reagents are capable of
interacting with their specific targets while attached to the
substrate, e.g., solid phase interactions, and by appropriate
labeling of these targets, the sites of the interactions between
the target and the specific reagents may be derived. Because the
reagents are positionally defined, the sites of the interactions
will define the specificity of each interaction. As a result, a map
of the patterns of interactions with specific reagents on the
substrate is convertible into information on the specific
interactions taking place, e.g., the recognized features. Where the
specific reagents recognize a large number of possible features,
this system allows the determination of the combination of specific
interactions which exist on the target molecule. Where the number
of features is sufficiently large, the identical same combination,
or pattern, of features is sufficiently unlikely that a particular
target molecule may often be uniquely defined by its features. In
the extreme, the features may actually be the subunit sequence of
the target molecule, and a given target sequence may be uniquely
defined by its combination of features.
[0409] In particular, the methodology is applicable to sequencing
polynucleotides. The specific sequence recognition reagents will
typically be oligonucleotide probes which hybridize with
specificity to subsequences found on the target sequence. A
sufficiently large number of those probes allows the fingerprinting
of a target polynucleotide or the relative mapping of a collection
of target polynucleotides, as described in greater detail
below.
[0410] In the high resolution fingerprinting provided by a
saturating collection of probes which include all possible
subsequences of a given size. Although a polynucleotide sequence
analysis is a preferred embodiment, for which the specific reagents
are most easily accessible, the invention is also applicable to
analysis of other polymers, including polypeptides, carbohydrates,
and synthetic polymers, including .alpha.-, .beta.-, and
.omega.-amino acids, polyurethanes, polyesters, polycarbonates,
polyureas, polyamides, polyethyleneimines, polyarylene sulfides,
polysiloxanes, polyimides, polyacetates, and mixed polymers.
Various optical isomers, e.g., various D- and L-forms of the
monomers, may be used.
[0411] Sequence analysis will take the form of complete sequence
determination, to the level of the sequence of individual subunits
along the entire length of the target sequence. Sequence analysis
also takes the form of sequence homology, e.g., less than absolute
subunit resolution, where "similarity" in the sequence will be
detectable, or the form of selective sequences of homology
interspersed at specific or irregular locations.
[0412] In either case, the sequence is determinable at selective
resolution or at particular locations. Thus, the hybridization
method will be useful as a means for identification, e.g., a
"fingerprint", much like a Southern hybridization method is used.
It is also useful to map particular target sequences.
[0413] B. VLSIPS.TM. Substrates
[0414] The invention is enabled by the development of technology to
prepare substrates on which specific reagents may be either
positionally attached or synthesized. In particular, the very large
scale immobilized polymer synthesis (VLSIPS.TM.) technology allows
for the very high density production of an enormous diversity of
reagents mapped out in a known matrix pattern on a substrate. These
reagents specifically recognize subsequences in a target polymer
and bind thereto, producing a map of positionally defined regions
of interaction. These map positions are convertible into actual
features recognized, and thus would be present in the target
molecule of interest.
[0415] As indicated, the sequence specific recognition reagents
will often be oligonucleotides which hybridize with fidelity and
discrimination to the target sequence. For use with other polymers,
monoclonal or polyclonal antibodies having high sequence
specificity will often be used.
[0416] In the generic sense, the VLSIPS technology allows the
production of a substrate with a high density matrix of
positionally mapped regions with specific recognition reagents
attached at each distinct region. By use of protective groups which
can be positionally removed, or added, the regions can be activated
or deactivated for addition of particular reagents or compounds.
Details of the protection are described below and in related
application Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854) filed
Mar. 7, 1990. In a preferred embodiment, photosensitive protecting
agents will be used and the regions of activation or deactivation
may be controlled by electro-optical and optical methods, similar
to many of the processes used in semiconductor wafer and chip
fabrication.
[0417] In the nucleic acid nucleotide sequencing application, a
VLSIPS substrate is synthesized having positionally defined
oligonucleotide probes. See Ser. No. 07/492,462 (U.S. Pat. No.
5,143,854); and Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678). By
use of masking technology and photosensitive synthetic subunits,
the VLSIPS apparatus allows for the stepwise synthesis of polymers
according to a positionally defined matrix pattern. Each
oligonucleotide probe will be synthesized at known and defined
positional locations on the substrate. This forms a matrix pattern
of known relationship between position and specificity of
interaction. The VLSIPS technology allows the production of a very
large number of different oligonucleotide probes to be
simultaneously and automatically synthesized including numbers in
excess of about 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6,
or even more, and at densities of at least about 10.sup.2,
10.sup.3/cm.sup.2, 10.sup.4/cm.sup.2 , 10.sup.3/cm.sup.2 and up to
10.sup.6/cm.sup.2 or more. This application discloses methods for
synthesizing polymers on a silicon or other suitably derivatized
substrate, methods and chemistry for synthesizing specific types of
biological polymers on those substrates, apparatus for scanning and
detecting whether interaction has occurred at specific locations on
the substrate, and various other technologies related to the use of
a high density very large scale immobilized polymer substrate. In
particular, sequencing, fingerprinting, and mapping applications
are discussed herein in detail, though related technologies are
described in simultaneously filed applications Ser. No. 07/624,120
(U.S. Pat. No. 5,498,678), and Ser. No. 07/517,659 each of which is
hereby incorporated herein by reference.
[0418] In other embodiments, antibody probes will be generated
which specifically recognize particular subsequences found on a
polymer. Antibodies would be generated which are specific for
recognizing a three contiguous amino acid sequence, and monoclonal
antibodies may be preferred. Optimally, these antibodies would not
recognize any sequences other than the specific three amino acid
stretch desired and the binding affinity should be insensitive to
flanking or remote sequences found on a target molecule. Likewise,
antibodies specific for particular carbohydrate linkages or
sequences will be generated. A similar approach could be used for
preparing specific reagents which recognize other polymer subunit
sequences. These reagents would typically be site specifically
localized to a substrate matrix pattern where the regions are
closely packed.
[0419] These reagents could be individually attached at specific
sites on the substrate in a matrix by an automated procedure where
the regions are positionally targeted by some other specific
mechanism, e.g., one which would allow the entire collection of
reagents to be attached to the substrate in a single reaction. Each
reagent could be separately attached to a specific oligonucleotide
sequence by an automated procedure. This would produce a collection
of reagents where, e.g., each monoclonal antibody would have a
unique oligonucleotide sequence attached to it. By virtue of a
VLSIPS substrate which has different complementary oligonucleotides
synthesized on it, each monoclonal antibody would specifically be
bound only at that site on the substrate where the complementary
oligonucleotide has been synthesized. A crosslinking step would fix
the reagent to the substrate. See, e.g., Dattagupta et al. (1985)
U.S. Pat. No. 4,542,102 and (1987) U.S. Pat. No. 4,713,326; and
Chatterjee, M. et al. (1990) J. Am. Chem. Soc. 112:6397-6399, which
are hereby incorporated herein by reference. This allows a high
density positionally specific collection of specific recognition
reagents, e.g., monoclonal antibodies, to be immobilized to a solid
substrate using an automated system.
[0420] The regions which define particular reagents will usually be
generated by selective protecting groups which may be activated or
deactivated. Typically the protecting group will be bound to a
monomer subunit or spatial region, and can be spatially affected by
an activator, such as electromagnetic radiation. Examples of
protective groups with utility herein include nitroveratryl
oxycarbonyl (NVOC), nitrobenzyl oxycarbony (NBOC), dimethyl
dimethoxy benzyloxy carbonyl, 5-bromo-7-nitroindolinyl,
O-hydroxy-.alpha.-methyl cinnamoyl, and 2-oxymethylene
anthraquinone. Examples of activators include ion beams, electric
fields, magnetic fields, electron beams, x-ray, and other forms of
electromagnetic radiation.
[0421] C. Binary Masking
[0422] In fact, the means for producing a substrate useful for
these techniques are explained in Ser. No. 07/492,462 (U.S. Pat.
No. 5,143,854), which is hereby incorporated herein by reference.
However, there are various particular ways to optimize the
synthetic processes. Many of these methods are described in Ser.
No. 07/624,120 (U.S. Pat. No. 5,498,678).
[0423] Briefly, the binary synthesis strategy refers to an ordered
strategy for parallel synthesis of diverse polymer sequences by
sequential addition of reagents which may be represented by a
reactant matrix, and a switch matrix, the product of which is a
product matrix. A reactant matrix is a 1.times.n matrix of the
building blocks to be added. The switch matrix is all or a subset
of the binary numbers from 1 to n arranged in columns. In preferred
embodiments, a binary strategy is one in which at least two
successive steps illuminate half of a region of interest on the
substrate. In most preferred embodiments, binary synthesis refers
to a synthesis strategy which also factors a previous addition
step. For example, a strategy in which a switch matrix for a
masking strategy halves regions that were previously illuminated,
illuminating about half of the previously illuminated region and
protecting the remaining half (while also protecting about half of
previously protected regions and illuminating about half of
previously protected regions). It will be recognized that binary
rounds may be interspersed with non-binary rounds and that only a
portion of a substrate may be subjected to a binary scheme, but
will still be considered to be a binary masking scheme within the
definition herein. A binary "masking" strategy is a binary
synthesis which uses light to remove protective groups from
materials for addition of other materials such as nucleotides or
amino acids.
[0424] In particular, this procedure provides a simplified and
highly efficient method for saturating all possible sequences of a
defined length polymer. This masking strategy is also particularly
useful in producing all possible oligonucleotide sequence probes of
a given length.
[0425] D. Applications
[0426] The technology provided by the present invention has very
broad applications. Although described specifically for
polynucleotide sequences, similar sequencing, fingerprinting,
mapping, and screening procedures can be applied to polypeptide,
carbohydrate, or other polymers. In particular, the present
invention may be used to completely sequence a given target
sequence to subunit resolution. This may be for de novo sequencing,
or may be used in conjunction with a second sequencing procedure to
provide independent verification. See, e.g., (1988) Science
242:1245. For example, a large polynucleotide sequence defined by
either the Maxam and Gilbert technique or by the Sanger technique
may be verified by using the present invention.
[0427] In addition, by selection of appropriate probes, a
polynucleotide sequence can be fingerprinted. Fingerprinting is a
less detailed sequence analysis which usually involves the
characterization of a sequence by a combination of defined
features. Sequence fingerprinting is particularly useful because
the repertoire of possible features which can be tested is
virtually infinite. Moreover, the stringency of matching is also
variable depending upon the application. A Southern Blot analysis
may be characterized as a means of simple fingerprint analysis.
Fingerprinting analysis may be performed to the resolution of
specific nucleotides, or may be used to determine homologies, most
commonly for large segments. In particular, an array of
oligonucleotide probes of virtually any workable size may be
positionally localized on a matrix and used to probe a sequence for
either absolute complementary matching, or homology to the desired
level of stringency using selected hybridization conditions.
[0428] In addition, the present invention provides means for
mapping analysis of a target sequence or sequences. Mapping will
usually involve the sequential ordering of a plurality of various
sequences, or may involve the localization of a particular sequence
within a plurality of sequences. This may be achieved by
immobilizing particular large segments onto the matrix and probing
with a shorter sequence to determine which of the large sequences
contain that smaller sequence. Alternatively, relatively shorter
probes of known or random sequence may be immobilized to the matrix
and a map of various different target sequences may be determined
from overlaps. Principles of such an approach are described in some
detail by Evans et al. (1989) "Physical Mapping of Complex Genomes
by Cosmid Multiplex Analysis," Proc. Natl. Acad. Sci. USA
86:5030-5034; Michiels et al. (1987) "Molecular Approaches to
Genome Analysis: A Strategy for the Construction of Ordered Overlap
Clone Libraries," CABIOS 3:203-210; Olsen et al. (1986)
"Random-Clone Strategy for Genomic Restriction Mapping in Yeast,"
Proc. Natl. Acad. Sci. USA 83:7826-7830; Craig, et al. (1990)
"Ordering of Cosmid Clones Covering the Herpes Simplex Virus Type I
(HSV-I) Genome: A Test Case for Fingerprinting by Hybridization,"
Nuc. Acids Res. 18:2653-2660; and Coulson, et al. (1986) "Toward a
Physical Map of the Genome of the Nematode Caenorhabditis elegans,"
Proc. Natl. Acad. Sci. USA 83:7821-7825; each of which is hereby
incorporated herein by reference.
[0429] Fingerprinting analysis also provides a means of
identification. In addition to its value in apprehension of
criminals from whom a biological sample, e.g., blood, has been
collected, fingerprinting can ensure personal identification for
other reasons. For example, it may be useful for identification of
bodies in tragedies such as fire, flood, and vehicle crashes. In
other cases the identification may be useful in identification of
persons suffering from amnesia, or of missing persons. Other
forensics applications include establishing the identity of a
person, e.g., military identification "dog tags", or may be used in
identifying the source of particular biological samples.
Fingerprinting technology is described, e.g., in Carrano, et al.
(1989) "A High-Resolution, Fluorescence-Based, Semi-automated
method for DNA Fingerprinting," Genomics 4: 129-136, which is
hereby incorporated herein by reference.
[0430] The fingerprinting analysis may be used to perform various
types of genetic screening. For example, a single substrate may be
generated with a plurality of screening probes, allowing for the
simultaneous genetic screening for a large number of genetic
markers. Thus, prenatal or diagnostic screening can be simplified,
economized, and made more generally accessible.
[0431] In addition to the sequencing, fingerprinting, and mapping
applications, the present invention also provides means for
determining specificity of interaction with particular sequences.
Many of these applications were described in Ser. No. 07/362,901,
Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854), Ser. No. 07/435,316,
and Ser. No. 07/612,671.
[0432] E. Detection Methods and Apparatus
[0433] An appropriate detection method applicable to the selected
labeling method can be selected. Suitable labels include
radionucleotides, enzymes, substrates, cofactors, inhibitors,
magnetic particles, heavy metal atoms, and particularly
fluorescers, chemiluminescers, and spectroscopic labels. Patents
teaching the use of such labels include U.S. Pat. Nos. 3,817,837;
3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and
4,366,241.
[0434] With an appropriate label selected, the detection system
best adapted for high resolution and high sensitivity detection may
be selected. As indicated above, an optically detectable system,
e.g., fluorescence or chemiluminescence would be preferred. Other
detection systems may be adapted to the purpose, e.g., electron
microscopy, scanning electron microscopy (SEM), scanning tunneling
electron microscopy (STEM), infrared microscopy, atomic force
microscopy (AFM), electrical condutance, and image plate
transfer.
[0435] With a detection method selected, an apparatus for scanning
the substrate will be designed. Apparatus, as described in Ser. No.
07/362,901; or Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854); or
Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678), are particularly
appropriate. Design modifications may also be incorporated
therein.
[0436] F. Data Analysis
[0437] Data is analyzed by processes similar to those described
below in the section describing theoretical analysis. More
efficient algorithms will be mathematically devised, and will
usually be designed to be performed on a computer. Various computer
programs which may more quickly or efficiently make measurement
samples and distinguish signal from noise will also be devised.
See, particularly, Ser. No. 07/624,120 (U.S. Pat. No.
5,498,678).
[0438] The initial data resulting from the detection system is an
array of data indicative of fluorescent intensity versus location
on the substrate. The data are typically taken over regions
substantially smaller than the area in which synthesis of a given
polymer has taken place. Merely by way of example, if polymers were
synthesized in squares on the substrate having dimensions of 500
microns by 500 microns, the data may be taken over regions having
dimensions of 5 microns by 5 microns. In most preferred
embodiments, the regions over which florescence data are taken
across the substrate are less than about 1/2 the area of the
regions in which individual polymers are synthesized, preferably
less than {fraction (1/10)} the area in which a single polymer is
synthesized, and most preferably less than {fraction (1/100)} the
area in which a single polymer is synthesized. Hence, within any
area in which a given polymer has been synthesized, a large number
of fluorescence data points are collected.
[0439] A plot of number of pixels versus intensity for a scan
should bear a rough resemblance to a bell curve, but spurious data
are observed, particularly at higher intensities. Since it is
desirable to use an average of fluorescent intensity over a given
synthesis region in determining relative binding affinty, these
spurious data will tend to undesirably skew the data. Accordingly,
in one embodiment of the invention the data are corrected for
removal of these spurious data points, and an average of the data
points is thereafter utilized in determining relative binding
efficiency. In general the data are fitted to a base curve and
statistical measures are used to remove spurious data.
[0440] In an additional analytical tool, various degeneracy
reducing analogues may be incorporated in the hybridization probes.
Various aspects of this strategy are described, e.g., in Macevicz,
S. (1990) PCT publication number WO 90/04652, which is hereby
incorporated herein by reference.
[0441] ii. Theoretical Analysis
[0442] The principle of the denovo hybridization sequencing
procedure may be based, in part, upon the ability to determine
overlaps of short segments. The VLSIPS technology provides the
ability to generate reagents which will saturate the possible short
subsequence recognition possibilities. The principle is most easily
illustrated by using a binary sequence, such as a sequence of zeros
and ones. Once having illustrated the application to a binary
alphabet, the principle may easily be understood to encompass three
letter, four letter, five or more letter, even 20 letter alphabets.
A theoretical treatment of analysis of subsequence information to
reconstruction of a target sequence is provided, e.e., in Lysov,
Yu., et al. (1988) Doklady Akademi. Nauk. SSR 303:1508-1511;
Khrapko K., et al. (1989) FEBS Letters 256:118-122; Pevzner, P.
(1989) J. of Biomolecular Structure and Dynamics 7:63-69; and
Drmanac, R. et al. (1989) Genomics 4:114-128; each of which is
hereby incorporated herein by reference.
[0443] The reagents for recognizing the subsequences will usually
be specific for recognizing a particular polymer subsequence
anywhere within a target polymer. It is preferable that conditions
may be devised which allow absolute discrimination between high
fidelity matching and very low levels of mismatching. The reagent
interaction will preferably exhibit no sensitivity to flanking
sequences, to the subsequence position within the target, or to any
other remote structure within the sequence. For polynucleotide
sequencing, the specific reagents can be oligonucleotide probes;
for polypeptides and carbohydrates, antibodies will be useful
reagents. Antibody reagents should also be useful for other types
of polymers.
[0444] A. Simple n-mer Structure: Theory
[0445] 1. Simple Two Letter Alphabet: Example
[0446] A simple example is presented below of how a sequence of ten
digits comprising zeros and ones would be sequenceable using short
segments of five digits. For example, consider the sample ten digit
sequence:
[0447] 1010011100.
[0448] A VLSIPS.TM. substrate could be constructed, as discussed
elsewhere, which would have reagents attached in a defined matrix
pattern which specifically recognize each of the possible five
digit sequences of ones and zeros. The number of possible five
digit subsequences is 2.sup.5=32. The number of possible different
sequences 10 digits long is 2.sup.10=1,024. The five contiguous
digit subsequences within a ten digit sequence number six, i.e.,
positioned at digits 1-5, 2-6, 3-7, 4-8, 5-9, and 6-10. It will be
noted that the specific order of the digits in the sequence is
important and that the order is directional, e.g., running left to
right versus right to left. The first five digit sequence contained
in the target sequence is 10100. The second is 01001, the third is
10011, the fourth is 00111, the fifth is 01110, and the sixth is
11100.
[0449] The VLSIPS substrate would have a matrix pattern of
positionally attached reagents which recognize each of the
different 5-mer subsequences. Those reagents which recognize each
of the 6 contained 5-mers will bind the target, and a label allows
the positional determination of where the sequence specific
interaction has occurred. By correlation of the position in the
matrix pattern, the corresponding bound subsequences can be
determined.
[0450] In the above-mentioned sequence, six different 5-mer
sequences would be determined to be present. They would be:
[0451] 10100
[0452] 01001
[0453] 10011
[0454] 00111
[0455] 01110
[0456] 11100
[0457] Any sequence which contains the first five digit sequence,
10100, already narrows the number of possible sequences (e.g., from
1024 possible sequences) which contain it to less than about 192
possible sequences.
[0458] This is derived from the observation that with the
subsequence 10100 at the far left of the sequence, in positions
1-5, there are only 32 possible sequences. Likewise, for that
particular subsequence in positions 2-6, 3-7,4-8, 5-9, and 6-10.
So, to sum up all of the sequences that could contain 10100, there
are 32 for each position and 6 positions for a total of about 192
possible sequences. However, some of these 10 digit sequences will
have been counted twice. Thus, by virtue of containing the 10100
subsequence, the number of possible 10-mer sequences has been
decreased from 1024 sequences to less than about 192 sequences.
[0459] In this example, not only do we know that the sequence
contains 10100, but we also know that it contains the second five
character sequence, 01001. By virtue of knowing that the sequence
contains 10100, we can look specifically to determine whether the
sequence contains a subsequence of five characters which contains
the four leftmost digits plus a next digit to the left. For
example, we would look for a sequence of X1010, but we find that
there is none. Thus, we know that the 10100 must be at the left end
of the 10-mer. We would also look to see whether the sequence
contains the rightmost four digits plus a next digit to the right,
e.g., 0100X. We find that the sequence also contains the sequence
01001, and that X is a 1. Thus, we know at least that our target
sequence has an overlap of 0100 and has the left terminal sequence
101001.
[0460] Applying the same procedure to the second 5-mer, we also
know that the sequence must include a sequence of five digits
having the sequence 1001Y where Y must be either 0 or 1. We look
through the fragments and we see that we have a 10011 sequence
within our target, thus Y is also 1. Thus, we would know that our
sequence has a sequence of the first seven being 1010011.
[0461] Moving to the next 5-mer, we know that there must be a
sequence of 0011Z, where Z must be either 0 or 1. We look at the
fragments produced above and see that the target sequence contains
a 00111 subsequence and Z is 1. Thus, we know the sequence must
start with 10100111.
[0462] The next 5-mer must be of the sequence 0111W where W must be
0 or 1. Again, looking up at the fragments produced, we see that
the target sequence contains a 01110 subsequence, and W is a 0.
Thus, our sequence to this point is 101001110. We know that the
last 5-mer must be either 1100 or 11101. Looking above, we see that
it is 11100 and that must be the last of our sequence. Thus, we
have determined that our sequence must have been 1010011100.
[0463] However, it will be recognized from the example above with
the sequences provided therein, that the sequence analysis can
start with any known positive probe subsequence. The determination
may be performed by moving linearly along the sequence checking the
known sequence with a limited number of next positions. Given this
possibility, the sequence may be determined, besides by scanning
all possible oligonucleotide probe positions, by specifically
looking only where the next possible positions would be. This may
increase the complexity of the scanning but may provide a longer
time span dedicated towards scanning and detecting specific
positions of interest relative to other sequence possibilities.
Thus, the scanning apparatus could be set up to work its way along
a sequence from a given contained oligonucleotide to only look at
those positions on the substrate which are expected to have a
positive signal.
[0464] It is seen that given a sequence, it can be de-constructed
into n-mers to produce a set of internal contiguous subsequences.
From any given target sequence, we would be able to determine what
fragments would result. The hybridization sequence method depends,
in part, upon being able to work in the reverse, from a set of
fragments of known sequences to the full sequence. In simple cases,
one is able to start at a single position and work in either or
both directions towards the ends of the sequence as illustrated in
the example.
[0465] The number of possible sequences of a given length increases
very quickly with the length of that sequence. Thus, a 10-mer of
zeros and ones has 1024 possibilities, a 12-mer has 4096. A 20-mer
has over a million possibilities, and a 30-mer has over a billion.
However, a given 30-mer has, at most, 26 different internal 5-mer
sequences. Thus, a 30 character target sequence having over a
million possible sequences can be substantially defined by only 26
different 5-mers. It will be recognized that the probe
oligonucleotides will preferably, but need not necessarily, be of
identical length, and that the probe sequences need not necessarily
be contiguous in that the overlapping subsequences need not differ
by only a single subunit. Moreover, each position of the matrix
pattern need not be homogeneous, but may actually contain a
plurality of probes of known sequence. In addition, although all of
the possible subsequence specifications would be preferred, a less
than full set of sequences specifications could be used. In
particular, although a substantial fraction will preferably be at
least about 70%, it may be less than that. About 20% would be
preferred, more preferably at least about 30% would be desired.
Higher percentages would be especially preferred.
[0466] 2. Example of Four Letter Alphabet
[0467] A four letter alphabet may be conceptualized in at least two
different ways from the two letter alphabet. One way is to consider
the four possible values at each position and to analogize in a
similar fashion to the binary example each of the overlaps. A
second way is to group the binary digits into groups.
[0468] Using the first means, the overlap comparisons are performed
with a four letter alphabet rather than a two letter alphabet.
Then, in contrast to the binary system with 10 positions where
2.sup.10=1024 possible sequences, in a 4-character alphabet with 10
positions, there will actually be 4.sup.10=1,048,576 possible
sequences. Thus, the complexity of a four character sequence has a
much larger number of possible sequences compared to a two
character sequence. Note, however, that there are still only 6
different internal 5-mers. For simplicity, we shall examine a 5
character string with 3 character subsequences. Instead of only 1
and 0, the characters may be designated, e.g., A, C, G, and T. Let
us take the sequence GGCTA. The 3-mer subsequences are:
[0469] GGC
[0470] GCT
[0471] CTA
[0472] Given these subsequences, there is one sequence, or at most
only a few sequences which would produce that combination of
subsequences, i.e., GGCTA.
[0473] Alternatively, with a four character universe, the binary
system can be looked at in pairs of digits. The pairs would be 00,
01, 10, and 11. In this manner, the earlier used sequence
1010011100 is looked at as 10,10,01,11,00. Then the first character
of two digits is selected from the possible universe of the four
representations 00, 01, 10, and 11. Then a probe would be in an
even number of digits, e.g., not five digits, but, three pairs of
digits or six digits. A similar comparison is performed and the
possible overlaps determined. The 3-pair subsequences are:
[0474] 10,10,01
[0475] 10,01,11
[0476] 01,11,00
[0477] and the overlap reconstruction produces 10,10,01,11,00.
[0478] The latter of the two conceptual views of the 4 letter
alphabet provides a representation which is similar to what would
be provided in a digital computer. The applicability to a four
nucleotide alphabet is easily seen by assigning, e.g., 00 to A, 01
to C, 10 to G, and 11 to T. And, in fact, if such a correspondence
is used, both examples for the 4 character sequences can be seen to
represent the same target sequence. The applicability of the
hybridization method and its analysis for determining the ultimate
sequence is easily seen if A is the representation of adenine, C is
the representation of cytosine, G is the representation of guanine,
and T is the representation of thymine or uracil.
[0479] 3. Generalization to m-Letter Alphabet
[0480] This reconstruction process may be applied to polymers of
virtually any number of possible characters in the alphabet, and
for virtually any length sequence to be sequenced, though
limitations, as discussed below, will limit its efficiency at
various extremes of length. It will be recognized that the theory
can be applied to a large diversity of systems where sequence is
important.
[0481] For example, the method could be applied to sequencing of a
polypeptide. A polypeptide can have any of twenty natural amino
acid possibilities at each position. A twenty letter alphabet is
amenable to sequencing by this method so long as reagents exist for
recognizing shorter subsequences therein. A preferred reagent for
achieving that goal would be a set of monoclonal antibodies each of
which recognizes a specific three contiguous amino acid
subsequence. A complete set of antibodies which recognize all
possible subsequences of a given length, e.g., 3 amino acids, and
preferably with a uniform affinity, would be 20.sup.3=8000
reagents.
[0482] It will also be recognized that each target sequence which
is recognized by the specific reagents need not have homogeneous
termini. Thus, fragments of the entire target sequence will also be
useful for hybridizing appropriate subsequences. It is, however,
preferable that there not be a significant amount of labeled
homogeneous contaminating extraneous sequences. This constraint
does usually require the purification of the target molecule to be
sequenced, but a specific label technique would dispense with a
purification requirement if the unlabeled extraneous sequences do
not interfere with the labeled sequences.
[0483] In addition, conformational effects of target polypeptide
folding may, in certain embodiments, be negligible if the
polypeptide is fragmented into sufficiently small peptides, or if
the interaction is performed under conditions where conformation,
but not specific interaction, is disrupted.
[0484] B. Complications
[0485] Two obvious complications exist with the method of sequence
analysis by hybridization. The first results from a probe of
inappropriate length while the second relates to internally
repeated sequences.
[0486] The first obvious complication is a problem which arises
from an inappropriate length of recognition sequence, which causes
problems with the specificity of recognition. For example, if the
recognized sequence is too short, every sequence which is utilized
will be recognized by every probe sequence. This occurs, e.g., in a
binary system where the probes are each of sequences which occur
relatively frequently, e.g., a two character probe for the binary
system. Each possible two character probe would be expected to
appear 1/4 of the time in every single two character position.
Thus, the above sequence example would be recognized by each of the
00, 10, 01, and 11. Thus, the sequence information is virtually
lost because the resolution is too low and each recognition reagent
specifically binds at multiple sites on the target sequence.
[0487] The number of different probes which bind to a target
depends on the relationship between the probe length and the target
length. At the extreme of short probe length, the just mentioned
problem exists of excessive redundancy and lack of resolution. The
lack of stability in recognition will also be a problem with
extremely short probes. At the extreme of long probe length, each
entire probe sequence is on a different position of a substrate.
However, a problem arises from the number of possible sequences,
which goes up dramatically with the length of the sequence. Also,
the specificity of recognition begins to decrease as the
contribution to binding by any particular subunit may become
sufficiently low that the system fails to distinguish the fidelity
of recognition. Mismatched hybridization may be a problem with the
polynucleotide sequencing applications, though the fingerprinting
and mapping applications may not be so strict in their fidelity
requirements. As indicated above, a thirty position binary sequence
has over a million possible sequences, a number which starts to
become unreasonably large in its required number of different
sequences, even though the target length is still very short.
Preparing a substrate with all sequence possibilities for a long
target may be extremely difficult due to the many different
oligomers which must be synthesized.
[0488] The above example illustrates how a long target sequence may
be reconstructed with a reasonably small number of shorter
subsequences. Since the present day resolution of the regions of
the substrate having defined oligomer probes attached to the
substrate approaches about 10 microns by 10 microns for resolvable
regions, about 10.sup.6, or 1 million, positions can be placed on a
one centimeter square substrate. However, high resolution systems
may have particular disadvantages which may be outweighed using the
lower density substrate matrix pattern. For this reason, a
sufficiently large number of probe sequences can be utilized so
that any given target sequence may be determined by hybridization
to a relatively small number of probes.
[0489] A second complication relates to convergence of sequences to
a single subsequence. This will occur when a particular subsequence
is repeated in the target sequence. This problem can be addressed
in at least two different ways. The first, and simpler way, is to
separate the repeat sequences onto two different targets. Thus,
each single target will not have the repeated sequence and can be
analyzed to its end. This solution, however, complicates the
analysis by requiring that some means for cutting at a site between
the repeats can be located. Typically a careful sequencer would
want to have two intermediate cut points so that the intermediate
region can also be sequenced in both directions across each of the
cut points. This problem is inherent in the hybridization method
for sequencing but can be minimized by using a longer known probe
sequence so that the frequency of probe repeats is decreased.
[0490] Knowing the sequence of flanking sequences of the repeat
will simplify the use of polymerase chain reaction (PCR) or a
similar technique to further definitively determine the sequence
between sequence repeats. Probes can be made to hybridize to those
known sequences adjacent the repeat sequences, thereby producing
new target sequences for analysis. See, e.g., Innis et al. (eds.)
(1990) PCR Protocols: A Guide to Methods and Applications, Academic
Press; and methods for synthesis of oligonucleotide probes, see,
e.g., Gait (1984) Oligonucleotide Synthesis: A Practical Approach,
IRL Press, Oxford.
[0491] Other means for dealing with convergence problems include
using particular longer probes, and using degeneracy reducing
analogues, see, e.g., Macevicz, S. (1990) PCT publication number WO
90/04652, which is hereby incorporated herein by reference. By use
of stretches of the degeneracy reducing analogues with other probes
in particular combinations, the number of probes necessary to fully
saturate the possible oligomer probes is decreased. For example,
with a stretch of 12-mers having the central 4-mer of degenerate
nucleotides, in combination with all of the possible 8-mers, the
collection numbers twice the number of possible 8-mers, e.g.
65,536+65,536=131,072, but the population provides screening
equivalent to all possible 12-mers.
[0492] By way of further explanation, all possible oligonucleotide
8-mers may be depicted in the fashion:
[0493] N1-N2-N3-N4-N5-N6-N7-N8,
[0494] in which there are 4.sup.8=65,536 possible 8-mers. As
described in Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678),
producing all possible 8-mers requires 4.times.8=32 chemical binary
synthesis steps to produce the entire matrix pattern of 65,536
8-mer possibilities. By incorporating degeneracy reducing
nucleotides, D's, which hybridize nonselectively to any
corresponding complementary nucleotide, new oligonucleotides
12-mers can be made in the fashion:
[0495] N1-N2-N3-N4-D-D-D-D-N5-N6-N7-N8,
[0496] in which there are again, as above, only 4.sup.8=65,536
possible "12-mers", which in reality only have 8 different
nucleotides. However, it can be seen that each possible 12-mer
probe could be represented by a group of the two 8-mer types.
Moreover, repeats of less than 12 nucleotides would not converge,
or cause repeat problems in the analysis. Thus, instead of
requiring a collection of probes corresponding to all 12-mers, or
4.sup.12=16,777,216 different 12-mers, the same information can be
derived by making 2 sets of "8-mers" consisting of the typical
8-mer collection of 4.sup.8=65,536 and the "12-mer" set with the
degeneracy reducing analogues, also requiring making
4.sup.8=65,536. The combination of the two sets, requires making
65,536+65,536=131,072 different molecules, but giving the
information of 16,777,216 molecules. Thus, incorporating the
degeneracy reducing analogue decreases the number of molecules
necessary to get 12-mer resolution by a factor of about
128-fold.
[0497] C. Non-Polynucleotide Embodiments
[0498] The above example is directed towards a polynucleotide
embodiment. This application is relatively easily achieved because
the specific reagents will typically be complementary
oligonucleotides, although in certain embodiments other specific
reagents may be desired. For example, there may be circumstances
where other than complementary base pairing will be utilized. The
polynucleotide targets, will usually be single strand, but may be
double or triple stranded in various applications. However, a
triple stranded specific interaction might be sometimes desired, or
a protein or other specific binding molecule may be utilized. For
example, various promoter or DNA sequence specific binding proteins
might be used, including, e.g., restriction enzyme binding domains,
other binding domains, and antibodies. Thus, specific recognition
reagents besides oligonucleotides may be utilized.
[0499] For other polymer targets, the specific reagents will often
be polypeptides. These polypeptides may be protein binding domains
from enzymes or other proteins which display specificity for
binding. Usually an antibody molecule may be used, and monoclonal
antibodies may be particularly desired. Classical methods may be
applied for preparing antibodies, see, e.g., Harlow and Lane (1988)
Antibodies: A Laboratory Manual Cold Spring Harbor Press, New York;
and Goding (1986) Monoclonal Antibodies: Principles and Practice
(2d Ed.) Academic Press, San Diego. Other suitable techniques for
in vitro exposure of lymphocytes to the antigens or selection of
libraries of antibody binding sites are described, e.g., in Huse et
al. (1989) Science 246:1275-1281; and Ward et al. 91989) Nature
341:544-546, each of which is hereby incorporated herein by
reference. Unusual antibody production methods are also described,
e.g., in Hendricks et al. (1989) Bio Technology 7:1271-1274; and
Hiatt et al. (1989) Nature 342:76-78, each of which is hereby
incorporated herein by reference. Other molecules which may exhibit
specific binding interaction may be useful for attachment to a
VLSIPS substrate by various methods, including the caged biotin
methods, see, e.g., Ser. No. 07/435,316, and Ser. No.
07/612,671.
[0500] The antibody specific reagents should be particularly useful
for the polypeptide, carbohydrate, and synthetic polymer
applications. Individual specific reagents might be generated by an
automated process to generate the number of reagents necessary to
advantageously use the high density positional matrix pattern. In
an alternative approach, a plurality of hybridoma cells may be
screened for their ability to bind to a VLSIPS matrix possessing
the desired sequences whose binding specificity is desired. Each
cell might be individually grown up and its binding specificity
determined by VLSIPS apparatus and technology. An alternative
strategy would be to expose the same VLSIPS matrix to a polyclonal
serum of high titer. By a successively large volume of serum and
different animals, each region of the VLSIPS substrate would have
attached to it a substantial number of antibody molecules with
specificity of binding. The substrate, with non-covalently bound
antibodies could be derivatized and the antibodies transferred to
an adjacent second substrate in the matrix pattern in which the
antibody molecules had attached to the first matrix. If the
sensitivity of detection of binding interaction is sufficiently
high, such a low efficiency transfer of antibody molecules may
produce a sufficiently high signal to be useful for many purposes,
including the sequencing applications.
[0501] In another embodiment, capillary forces may be used to
transfer the selected reagents to a new matrix, to which the
reagents would be positionally attached in the pattern of the
recognized sequences. Or, the reagents could be transversely
electrophoresed, magnetically transferred, or otherwise transported
to a new substrate in their retained positional pattern.
[0502] iii. Polynucleotide Sequencing
[0503] The making of a substrate having a positionally defined
matrix pattern of all possible oligonucleotides of a given length
involves a conceptually simple method of synthesizing each and
every different possible oligonucleotide, and affixing them to a
definable position. Oligonucleotide synthesis is presently
mechanized and enabled by current technology, see, e.g., Ser. No.
7/362,901; Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854); and
instruments supplied by Applied Biosystems, Foster City, Calif.
[0504] A. Preparation of Substrate Matrix
[0505] The production of the collection of specific
oligonucleotides used in polynucleotide sequencing may be produced
in at least two different ways. Present technology certainly allows
production of ten nucleotide oligomers on a solid phase or other
synthesizing system. See, e.g., instrumentation provided by Applied
Biosystems, Foster City, Calif. Although a single oligonucleotide
can be relatively easily made, a large collection of them would
typically require a fairly large amount of time and investment. For
example, there are 4.sup.10=1,048,576 possible ten nucleotide
oligomers. Present technology allows making each and every one of
them in a separate purified form though such might be costly and
laborious.
[0506] Once the desired repertoire of possible oligomer sequences
of a given length have been synthesized, this collection of
reagents may be individually positionally attached to a substrate,
thereby allowing a batchwise hybridization step. Present technology
also would allow the possibility of attaching each and every one of
these 10-mers to a separate specific position on a solid matrix.
This attachment could be automated in any of a number of ways,
particularly through the use of a caged biotin type linking. This
would produce a matrix having each of different possible
10-mers.
[0507] A batchwise hybridization is much preferred because of its
reproducibility and simplicity. An automated process of attaching
various reagents to positionally defined sites on a substrate is
provided in Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854); Ser. No.
07/624,120 (U.S. Pat. No. 5,498,678); and Ser. No. 07/612,671; each
of which is hereby incorporated herein by reference.
[0508] Instead of separate synthesis of each oligonucleotide, these
oligonucleotides are conveniently synthesized in parallel by
sequential synthetic processes on a defined matrix pattern as
provided in Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854); and Ser.
No. 07/624,120 (U.S. Pat. No. 5,498,678), which are incorporated
herein by reference. Here, the oligonucleotides are synthesized
stepwise on a substrate at positionally separate and defined
positions. Use of photosensitive blocking reagents allows for
defined sequences of synthetic steps over the surface of a matrix
pattern. By use of the binary masking strategy, the surface of the
substrate can be positioned to generate a desired pattern of
regions, each having a defined sequence oligonucleotide synthesized
and immobilized thereto.
[0509] Although the prior art technology can be used to generate
the desired repertoire of oligonucleotide probes, an efficient and
cost effective means would be to use the VLSIPS technology
described in Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854) and Ser.
No. 07/624,120 (U.S. Pat. No. 5,498,678). In this embodiment, the
photosensitive reagents involved in the production of such a matrix
are described below.
[0510] The regions for synthesis may be very small, usually less
than about 100 .mu.m.times.100 .mu.m, more usually less than about
50 .mu.m.times.50 .mu.m. The photolithography technology allows
synthetic regions of less than about 10 .mu.m.times.10 .mu.m, about
3 .mu.m.times.3 .mu.m, or less. The detection also may detect such
sized regions, though larger areas are more easily and reliably
measured.
[0511] At a size of about 30 microns by 30 microns, one million
regions would take about 11 centimeters square or a single wafer of
about 4 centimeters by 4 centimeters. Thus the present technology
provides for making a single matrix of that size having all one
million plus possible oligonucleotides. Region size is sufficiently
small to correspond to densities of at least about 5
regions/cm.sup.2, 20 regions/cm.sup.2, 50 regions/cm.sup.2, 100
regions/cm.sup.2, and greater, including 300 regions/cm.sup.2, 1000
regions/cm.sup.2, 3K regions/cm.sup.2, 10K regions/cm.sup.2, 30K
regions/cm,.sup.2100K regions/cm.sup.2, 300K regions/cm.sup.2 or
more, even in excess of one million regions/cm.sup.2.
[0512] Although the pattern of the regions which contain specific
sequences is theoretically not important, for practical reasons
certain patterns will be preferred in synthesizing the
oligonucleotides. The application of binary masking algorithms for
generating the pattern of known oligonucleotide probes is described
in related Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678), which was
filed simultaneously with this application. By use of these binary
masks, a highly efficient means is provided for producing the
substrate with the desired matrix pattern of different sequences.
Although the binary masking strategy allows for the synthesis of
all lengths of polymers, the strategy may be easily modified- to
provide only polymers of a given length. This is achieved by
omitting steps where a subunit is not attached.
[0513] The strategy for generating a specific pattern may take any
of a number of different approaches. These approaches are well
described in related application Ser. No. 07/624,120 (U.S. Pat. No.
5,498,678), and include a number of binary masking approaches which
will not be exhaustively discussed herein. However, the binary
masking and binary synthesis approaches provide a maximum of
diversity with a minimum number of actual synthetic steps.
[0514] The length of oligonucleotides used in sequencing
applications will be selected on criteria determined to some extent
by the practical limits discussed above. For example, if probes are
made as oligonucleotides, there will be 65,536 possible eight
nucleotide sequences. If a nine subunit oligonucleotide is
selected, there are 262,144 possible permeations of sequences. If a
ten-mer oligonucleotide is selected, there are 1,048,576 possible
permeations of sequences. As the number gets larger, the required
number of positionally defined subunits necessary to saturate the
possibilities also increases. With respect to hybridization
conditions, the length of the matching necessary to confer
stability of the conditions selected can be compensated for. See,
e.g., Kanehisa, M. (1984) Nuc. Acids Res. 12:203-213, which is
hereby incorporated herein by reference.
[0515] Although not described in detail here, but below for
oligonucleotide probes, the VLSIPS technology would typically use a
photosensitive protective group on an oligonucleotide. In
particular, the photoprotective group on the nucleotide molecules
may be selected from a wide variety of positive light reactive
groups preferably including nitro aromatic compounds such as
o-nitro-benzyl derivatives or benzylsulfonyl. See, e.g., Gait
(1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press,
Oxford, which is hereby incorporated herein by reference. In a
preferred embodiment, 6-nitro-veratryl oxycarbony (NVOC),
2-nitrobenzyl oxycarbonyl (NBOC), MeNVOC, MeNPOC, or
.alpha.,.alpha.-dimethyl-dimethoxy- benzyl oxycarbonyl (DEZ) is
used. Photoremovable protective groups are described in, e.g.,
Patchornik (1970) J. Amer. Chem, Soc. 92:6333-6335; and Amit et al.
(1974) J. Organic Chem. 39:192-196, and U.S. Ser. No. 08/444,598;
each of which is hereby incorporated herein by reference. A
photosensitive blocked nucleotide may be attached to specific
locations of unblocked prior cycles of attachments on the substrate
and can be successively built up to the correct length
oligonucleotide probe.
[0516] It should be noted that multiple substrates may be
simultaneously exposed to a single target sequence where each
substrate is a duplicate of one another or where, in combination,
multiple substrates together provide the complete or desired subset
of possible subsequences. This provides the opportunity to overcome
a limitation of the density of positions on a single substrate by
using multiple substrates. In the extreme case, each probe might be
attached to a single bead or substrate and the beads sorted by
whether there is a binding interaction. Those beads which do bind
might be encoded to indicate the subsequence specificity of
reagents attached thereto.
[0517] Then, the target may be bound to the whole collection of
beads and those beads that have appropriate specific reagents on
them will bind to the target. Then a sorting system may be utilized
to sort those beads that actually bind the target from those that
do not. This may be accomplished by presently available cell
sorting devices or a similar apparatus. After the relatively small
number of beads which have bound the target have been collected,
the encoding scheme may be read off to determine the specificity of
the reagent on the bead. An encoding system may include a magnetic
system, a shape encoding system, a color encoding system, or a
combination of any of these, or any other encoding system. Once
again, with the collection of specific interactions that have
occurred, the binding may be analyzed for sequence information,
fingerprint information, or mapping information.
[0518] The parameters of polynucleotide sizes of both the probes
and target sequences are determined by the applications and other
circumstances. The length of the oligonucleotide probes used will
depend in part upon the limitations of the VLSIPS technology to
provide the number of desired probes. For example, in an absolute
sequencing application, it is often useful to have virtually all of
the possible oligonucleotides of a given length. As indicated
above, there are 65,536 8-mers, 262,144 9-mers, 1,048,576 10-mers,
4,194,304 11-mers, etc. As the length of the oligomer increases the
number of different probes which must be synthesized also increases
at a rate of a factor of 4 for every additional nucleotide.
Eventually the size of the matrix and the limitations in the
resolution of regions in the matrix will reach the point where an
increase in number of probes becomes disadvantageous. However, this
sequencing procedure requires that the system be able to
distinguish, by appropriate selection of hybridization and washing
conditions, between binding of absolute fidelity and binding of
complementary sequences containing mismatches. On the other hand,
if the fidelity is unnecessary, this discrimination is also
unnecessary and a significantly longer probe may be used.
Significantly longer probes would typically be useful in
fingerprinting or mapping applications.
[0519] The length of the probe is selected for a length that will
allow the probe to bind with specificity to possible targets. The
hybridization conditions are also very important in that they will
determine how closely the homology of complementary binding will be
detected. In fact, a single target may be evaluated at a number of
different conditions to determine its spectrum of specificity for
binding particular probes. This may find use in a number of other
applications besides the polynucleotide sequencing fingerprinting
or mapping. For example, it will be desired to determine the
spectrum of binding affinities and specificities of cell surface
antigens with binding by particular antibodies immobilized on the
substrate surface, particularly under different interaction
conditions. In a related fashion, different regions with reagents
having differing affinities or levels of specificity may allow such
a spectrum to be defined using a single incubation, where various
regions, at a given hybridization condition, show the binding
affinity. For example, fingerprint probes of various lengths, or
with specific defined non-matches may be used. Unnatural
nucleotides or nucleotides exhibiting modified specificity of
complementary binding are described in greater detail in Macevicz
(1990) PCT pub. No. WO 90/04652; and see the section on modified
nucleotides in the Sigma Chemical Company catalogue.
[0520] B. Labeling Target Nucleotide
[0521] The label used to detect the target sequences will be
determined, in part, by the detection methods being applied. Thus,
the labeling method and label used are selected in combination with
the actual detecting systems being used.
[0522] Once a particular label has been selected, appropriate
labeling protocols will be applied, as described below for specific
embodiments. Standard labeling protocols for nucleic acids are
described, e.g., in Sambrook et al.; Kambara, H. et al. (1988)
BioTechnology 6:816-821; Smith, L. et al. (1985) Nuc. Acids Res.
13:2399-2412; for polypeptides, see, e.g., Allen G. (1989)
Sequencing of Proteins and Peptides, Elsevier, New York, especially
chapter 5, and Greenstein and Winitz (1961) Chemistry of the Amino
Acids, Wiley and Sons, New York. Carbohydrate labeling is
described, e.g., in Chaplin and Kennedy (1986) Carbohydrate
Analysis: A Practical Approach, IRL Press, Oxford. Labeling of
other polymers will be performed by methods applicable to them as
recognized by a person having ordinary skill in manipulating the
corresponding polymer.
[0523] In some embodiments, the target need not actually be labeled
if a means for detecting where interaction takes place is
available. As described below, for a nucleic acid embodiment, such
may be provided by an intercalating dye which intercalates only
into double stranded segments, e.g., where interaction occurs. See,
e.g., Sheldon et al. U.S. Pat. No. 4,582,789.
[0524] In many uses, the target sequence will be absolutely
homogeneous, both with respect to the total sequence and with
respect to the ends of each molecule. Homogeneity with respect to
sequence is important to avoid ambiguity. It is preferable that the
target sequences of interest not be contaminated with a significant
amount of labeled contaminating sequences. The extent of allowable
contamination will depend on the sensitivity of the detection
system and the inherent signal to noise of the system. Homogeneous
contamination sequences will be particularly disruptive of the
sequencing procedure.
[0525] However, although the target polynucleotide must have a
unique sequence, the target molecules need not have identical ends.
In fact, the homogeneous target molecule preparation may be
randomly sheared to increase the numerical number of molecules.
Since the total information content remains the same, the shearing
results only in a higher number of distinct sequences which may be
labeled and bind to the probe. This fragmentation may give a vastly
superior signal relative to a preparation of the target molecules
having homogeneous ends. The signal for the hybridization is likely
to be dependent on the numerical frequency of the target-probe
interactions. If a sequence is individually found on a larger
number of separate molecules a better signal will result. In fact,
shearing a homogeneous preparation of the target may often be
preferred before the labeling procedure is performed, thereby
producing a large number of labeling groups associated with each
subsequence.
[0526] C. Hybridization Conditions
[0527] The hybridization conditions between probe and target should
be selected such that the specific recognition interaction, i.e.,
hybridization, of the two molecules is both sufficiently specific
and sufficiently stable. See, e.g., Hames and Higgins (1985)
Nucleic Acid Hybridisation: A Practical Approach, IRL Press,
Oxford. These conditions will be dependent both on the specific
sequence and often on the guanine and cytosine (GC) content of the
complementary hybrid strands. The conditions may often be selected
to be universally equally stable independent of the specific
sequences involved. This typically will make use of a reagent such
as an arylammonium buffer. See, Wood et al. (1985) "Base
Composition-independent Hybridization in Tetramethylammonium
Chloride: A Method for Oligonucleotide Screening of Highly Complex
Gene Libraries," Proc. Natl. Acad. Sci. USA, 82:1585-1588; and
Krupov et al. (1989) "An Oligonucleotide Hybridization Approach to
DNA Sequencing," FEBS Letters, 256:118-122; each of which is hereby
incorporated herein by reference. An arylammonium buffer tends to
minimize differences in hybridization rate and stability due to GC
content. By virtue of the fact that sequences then hybridize with
approximately equal affinity and stability, there is relatively
little bias in strength or kinetics of binding for particular
sequences. Temperature and salt conditions along with other buffer
parameters should be selected such that the kinetics of
renaturation should be essentially independent of the specific
target subsequence or oligonucleotide probe involved. In order to
ensure this, the hybridization reactions will usually be performed
in a single incubation of all the substrate matrices together
exposed to the identical same target probe solution under the same
conditions.
[0528] Alternatively, various substrates may be individually
treated differently. Different substrates may be produced, each
having reagents which bind to target subsequences with
substantially identical stabilities and kinetics of hybridization.
For example, all of the high GC content probes could be synthesized
on a single substrate which is treated accordingly. In this
embodiment, the arylammonium buffers could be unnecessary. Each
substrate is then treated in a manner such that the collection of
substrates show essentially uniform binding and the hybridization
data of target binding to the individual substrate matrix is
combined with the data from other substrates to derive the
necessary subsequence binding information. The hybridization
conditions will usually be selected to be sufficiently specific
such that the fidelity of base matching will be properly
discriminated. Of course, control hybridizations should be included
to determine the stringency and kinetics of hybridization.
[0529] D. Detection: VLSIPS.TM. Technology Scanning
[0530] The next step of the sequencing process by hybridization
involves labeling of target polynucleotide molecules. A quickly and
easily detectable signal is preferred. The VLSIPS apparatus is
designed to easily detect a fluorescent label, so fluorescent
tagging of the target sequence is preferred. Other suitable labels
include heavy metal labels, magnetic probes, chromogenic labels
(e.g., phosphorescent labels, dyes, and fluorophores) spectroscopic
labels, enzyme linked labels, radioactive labels, and labeled
binding proteins. Additional labels are described in U.S. Pat. No.
4,366,241, which is incorporated herein by reference.
[0531] The detection methods used to determine where hybridization
has taken place will typically depend upon the label selected
above. Thus, for a fluorescent label a fluorescent detection step
will typically be used. Ser. No. 07/492,462 (U.S. Pat. No.
5,143,854) and Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678)
describe apparatus and mechanisms for scanning a substrate matrix
using fluorescence detection, but a similar apparatus is adaptable
for other optically detectable labels.
[0532] The detection method provides a positional localization of
the region where hybridization has taken place. However, the
position is correlated with the specific sequence of the probe
since the probe has specifically been attached or synthesized at a
defined substrate matrix position. Having collected all of the data
indicating the subsequences present in the target sequence, this
data may be aligned by overlap to reconstruct the entire sequence
of the target, as illustrated above.
[0533] It is also possible to dispense with actual labeling if some
means for detecting the positions of interaction between the
sequence specific reagent and the target molecule are available.
This may take the form of an additional reagent which can indicate
the sites either of interaction, or the sites of lack of
interaction, e.g., a negative label. For the nucleic acid
embodiments, locations of double strand interaction may be detected
by the incorporation of intercalating dyes, or other reagents such
as antibody or other reagents that recognize helix formation, see,
e.g., Sheldon, et al. (1986) U.S. Pat. No. 4,582,789, which is
hereby incorporated herein by reference.
[0534] E. Analysis
[0535] Although the reconstruction can be performed manually as
illustrated above, a computer program will typically be used to
perform the overlap analysis. A program may be written and run on
any of a large number of different computer hardware systems. The
variety of operating systems and languages useable will be
recognized by a computer software engineer. Various different
languages may be used, e.g., BASIC; C; PASCAL; etc.
[0536] F. Substrate Reuse
[0537] Finally, after a particular sequence has been hybridized and
the pattern of hybridization analyzed, the matrix substrate should
be reusable and readily prepared for exposure to a second or
subsequent target polynucleotides. In order to do so, the hybrid
duplexes are disrupted and the matrix treated in a way which
removes all traces of the original target. The matrix may be
treated with various detergents or solvents to which the substrate,
the oligonucleotide probes, and the linkages to the substrate are
inert. This treatment may include an elevated temperature
treatment, treatment with organic or inorganic solvents,
modifications in pH, and other means for disrupting specific
interaction. Thereafter, a second target may actually be applied to
the recycled matrix and analyzed as before.
[0538] G. Non-Polynucleotide Aspects
[0539] Although the sequencing, fingerprinting, and mapping
functions will make use of the natural sequence recognition
property of complementary nucleotide sequences, the
non-polynucleotide sequences typically require other sequence
recogrution reagents. These reagents will take the form, typically,
of proteins exhibiting binding specificity, e.g., enzyme binding
sites or antibody binding sites.
[0540] Enzyme binding sites may be derived from promoter proteins,
restriction enzymes, and the like. See, e.g., Stryer, L. (1988)
Biochemistry, W. H. Freeman, Palo Alto. Antibodies will typically
be produced using standard procedures, see, e.g., Harlow and Lane
(1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Press,
New York; and Goding (1986) Monoclonal Antibodies: Principles and
Practice, (2d Ed.) Academic Press, San Diego.
[0541] Typically, an antigen, or collection of antigens are
presented to an immune system. This may take the form of
synthesized short polymers produced by the VLSIPS technology, or by
the other synthetic means, or from isolation of natural products.
For example, antigen for the polypeptides may be made by the VLSIPS
technology, by standard peptide synthesis, by isolation of natural
proteins with or without degradation to shorter segments, or by
expression of a collection of short nucleic acids of random or
defined sequences. See, e.g., Tuerk and Gold (1990) Science
249:505-510, for generation of a collection of randomly mutagenized
oligonucleotides useful for expression.
[0542] The antigen or collection is presented to an appropriate
immune system, e.g., to a whole animal as in a standard
immunization protocol, or to a collection of immune cells or
equivalent. In particular, see Ward et al. (1989) Nature
341:544-546; and Huse et al. (1989) Science 246:1275-1281, each of
which is hereby incorporated herein by reference.
[0543] A large diversity of antibodies will be generated, some of
which have specificities for the desired sequences. Antibodies may
be purified having the desired sequence specificities by isolating
the cells producing them. For example, a VLSIPS substrate with the
desired antigens synthesized thereon may be used to isolate cells
with cell surface reagents which recognize the antigens. The VLSIPS
substrate may be used as an affinity reagent to select and recover
the appropriate cells. Antibodies from those cells may be attached
to a substrate using the caged biotin methodology, or by attaching
a targeting molecule, e.g., an oligonucleotide. Alternatively, the
supernatants from antibody producing cells can be easily assayed
using a VLSIPS substrate to identify the cells producing the
appropriate antibodies.
[0544] Although cells may be isolated, specific antibody molecules
which perform the sequence recognition will also be sufficient.
Preferably populations of antibody with a known specificity can be
isolated. Supernatants from a large population of producing cells
may be passed over a VLSIPS substrate to bind to the desired
antigens attached to the substrate. When a sufficient density of
antibody molecules are attached, they may be removed by an
automated process, preferably as antibody populations exhibiting
specificity of binding.
[0545] In one particular embodiment, a VLSIPS substrate, e.g., with
a large plurality of fingerprint antigens attached thereto, is used
to isolate antibodies from a supernatant of a population of cells
producing antibodies to the antigens. Using the substrate as an
affinity reagent, the antibodies will attach to the appropriate
positionally defined antigens. The antibodies may be carefully
removed therefrom, preferably by an automated system which retains
their homogeneous specificities. The isolated antibodies can be
attached to a new substrate in a positionally defined matrix
pattern.
[0546] In a further embodiment, these spatially separated
antibodies may be isolated using a specific targeting method for
isolation. In this embodiment, a linker molecule which attaches to
a particular portion of the antibody, preferably away from the
binding site, can be attached to the antibodies. Various reagents
will be used, including staphylococcus protein A or antibodies
which bind to domains remote from the binding site. Alternatively,
the antibodies in the population, before affinity purification, may
be derivatized with an appropriate reagent compatible with new
VLSIPS synthesis. A preferred reagent is a nucleotide which can
serve as a linker to synthetic VLSIPS steps for synthesizing a
specific sequence thereon. Then, by successive VLSIPS cycles, each
of the antibodies attached to the defined antigen regions can have
a defined oligonucleotide synthesized thereon and corresponding in
area to the region of the substrate having each antigen attached.
These defined oligonucleotides will be useful as targeting reagents
to attach those antibodies possessing the same target sequence
specificity at defined positions on a new substrate, by virtue of
having bound to the antigen region, to a new VLSIPS substrate
having the complementary target oligonucleotides positionally
located on it. In this fashion, a VLSIPS substrate having the
desired antigens attached thereto can be used to generate a second
VLSIPS substrate with positionally defined reagents which recognize
those antigens.
[0547] The selected antigens will typically be selected to be those
which define particular functionalities or properties, so as to be
useful for fingerprinting and other uses. They will also be useful
for mapping and sequencing embodiments.
[0548] iv. Fingerprinting
[0549] A. General
[0550] Many of the procedures and techniques used in the
polynucleotide sequencing section are also appropriate for
fingerprinting applications. See, e.g., Poustka, et al. (1986) Cold
Spring Harbor Symposia on Quant. Biol., vol. LI, 131-139, Cold
Spring Harbor Press, New York; which is hereby incorporated herein
by reference. The fingerprinting method provided herein is based,
in part, upon the ability to positionally localize a large number
of different specific probes onto a single substrate. This high
density matrix pattern provides the ability to screen for, or
detect, a very large number of different sequences simultaneously.
In fact, depending upon the hybridization conditions,
fingerprinting to the resolution of virtually absolute matching of
sequence is possible thereby approaching an absolute sequencing
embodiment. And the sequencing embodiment is very useful in
identifying the probes useful in further fingerprinting uses. For
example, characteristic features of genetic sequences will be
identified as being diagnostic of the entire sequence. However, in
most embodiments, longer probe and target will be used, and for
which slight mismatching may not need to be resolved.
[0551] B. Preparation of Substrate Matrix
[0552] A collection of specific probes may be produced by either of
the methods described above in the section on sequencing. Specific
oligonucleotide probes of desired lengths may be individually
synthesized on a standard oligonucleotide synthesizer. The length
of these probes is limited only by the ability of the synthesizer
to continue to accurately synthesize a molecule. Oligonucleotides
or sequence fragments may also be isolated from natural sources.
Biological amplification methods may be coupled with synthetic
synthesizing procedures such as, e.g., polymerase chain
reaction.
[0553] In one embodiment, the individually isolated probes may be
attached to the matrix at defined positions. These probe reagents
may be attached by an automated process making use of the caged
biotin methodology described in Ser. No. 07/612,671, or using
photochemical reagents, see, e.g., Dattagupta et al. (1985) U.S.
Pat. No. 4,542,102 and (1987) U.S. Pat. No. 4,713,326. Each
individually purified reagent can be attached individually at
specific locations on a substrate.
[0554] In another embodiment, the VLSIPS synthesizing technique may
be used to synthesize the desired probes at specific positions on a
substrate. The probes may be synthesized by successively adding
appropriate monomer subunits, e.g., nucleotides, to generate the
desired sequences.
[0555] In another embodiment, a relatively short specific
oligonucleotide is used which serves as a targeting reagent for
positionally directing the sequence recognition reagent. For
example, the sequence specific reagents having a separate
additional sequence recognition segment (usually of a different
polymer from the target sequence) can be directed to target
oligonucleotides attached to the substrate. By use of non-natural
targeting reagents, e.g., unusual nucleotide analogues which pair
with other unnatural nucleotide analogues and which do not
interfere with natural nucleotide interactions, the natural and
non-natural portions can coexist on the same molecule without
interfering with their individual functionalities. This can combine
both a synthetic and biological production system analogous to the
technique for targeting monoclonal antibodies to locations on a
VLSIPS substrate at defined positions. Unnatural optical isomers of
nucleotides may be useful unnatural reagents subject to similar
chemistry, but incapable of interfering with the natural biological
polymers. See also, Ser. No. 07/626,730, which is hereby
incorporated herein by reference.
[0556] After the separate substrate attached reagents are attached
to the targeting segment, the two are crosslinked, thereby
permanently attaching them to the substrate. Suitable crosslinking
reagents are known, see, e.g., Dattagupta et al. (1985) U.S. Pat.
No. 4,542,102 and (1987) "Coupling of nucleic acids to solid
support by photochemical methods," U.S. Pat. No. 4,713,326, each of
which is hereby incorporated herein by reference. Similar linkages
for attachment of proteins to a solid substrate are provided, e.g.,
in Merrifield (1986) Science 232:341-347, which is hereby
incorporated herein by reference.
[0557] C. Labeling Target Nucleotides
[0558] The labeling procedures used in the sequencing embodiments
will also be applicable in the fingerprinting embodiments. However,
since the fingerprinting embodiments often will involve relatively
large target molecules and relatively short oligonucleotide probes,
the amount of signal necessary to incorporate into the target
sequence may be less critical than in the sequencing applications.
For example, a relatively long target with a relatively small
number of labels per molecule may be easily amplified or detected
because of the relatively large target molecule size.
[0559] In various embodiments, it may be desired to cleave the
target into smaller segments as in the sequencing embodiments. The
labeling procedures and cleavage techniques described in the
sequencing embodiments would usually also be applicable here.
[0560] D. Hybridization Conditions
[0561] The hybridization conditions used in fingerprinting
embodiments will typically be less critical than for the sequencing
embodiments. The reason is that the amount of mismatching which may
be useful in providing the fingerprinting information would
typically be far greater than that necessary in sequencing uses.
For example, Southern hybridizations do not typically distinguish
between slightly mismatched sequences. Under these circumstances,
important and valuable information may be arrived at with less
stringent hybridization conditions while providing valuable
fingerprinting information. However, since the entire substrate is
typically exposed to the target molecule at one time, the binding
affinity of the probes should usually be of approximately
comparable levels. For this reason, if oligonucleotide probes are
being used, their lengths should be approximately comparable and
will be selected to hybridize under conditions which are common for
most of the probes on the substrate. Much as in a Southern
hybridization, the target and oligonucleotide probes are of lengths
typically greater than about 25 nucleotides. Under appropriate
hybridization conditions, e.g., typically higher salt and lower
temperature, the probes will hybridize irrespective of imperfect
complementarity. In fact, with probes of greater than, e.g., about
fifty nucleotides, the difference in stability of different sized
probes will be relatively minor.
[0562] Typically the fingerprinting is merely for probing
similarity or homology. Thus, the stringency of hybridization can
usually be decreased to fairly low levels. See, e.g., Wetmur and
Davidson (1968) "Kinetics of Renaturation of DNA," J. Mol. Biol.,
31:349-370; and Kanehisa, M. (1984) Nuc. Acids Res.,
12:203-213.
[0563] E. Detection: VLSIPS.TM. Technology Scanning
[0564] Detection methods will be selected which are appropriate for
the selected label. The scanning device need not necessarily be
digitized or placed into a specific digital database, though such
would most likely be done. For example, the analysis in
fingerprinting could be photographic. Where a standardized
fingerprint substrate matrix is used, the pattern of hybridizations
may be spatially unique and may be compared photographically. In
this manner, each sample may have a characteristic pattern of
interactions and the likelihood of identical patterns will
preferably be such low frequency that the fingerprint pattern
indeed becomes a characteristic pattern virtually as unique as an
individual's fingertip fingerprint. With a standardized substrate,
every individual could be, in theory, uniquely identifiable on the
basis of the pattern of hybridizing to the substrate.
[0565] Of course, the VLSIPS.TM. Technology scanning apparatus may
also be useful to generate a digitized version of the fingerprint
pattern. In this way, the identification pattern can be provided in
a linear string of digits. This sequence could also be used for a
standardized identification system providing significant useful
medical transferability of specific data. In one embodiment, the
probes used are selected to be of sufficiently high resolution to
measure the antigens of the major histo compatibility complex. It
might even be possible to provide transplantation matching data in
a linear stream of data. The fingerprinting data may provide a
condensed version, or summary, of the linear genetic data, or any
other information data base.
[0566] F. Analysis
[0567] The analysis of the fingerprint will often be much simpler
than a total sequence determination. However, there may be
particular types of analysis which will be substantially simplified
by a selected group of probes. For example, probes which exhibit
particular populational heterogeneity may be selected. In this way,
analysis may be simplified and practical utility enhanced merely by
careful selection of the specific probes and a careful matrix
layout of those probes.
[0568] G. Substrate Reuse
[0569] As with the sequencing application, the fingerprinting
usages may also take advantage of the reusability of the substrate.
In this way, the interactions can be disrupted, the substrate
treated, and the renewed substrate is equivalent to an unused
substrate.
[0570] H. Non-Polynucleotide Aspects
[0571] Besides polynucleotide applications, the fingerprinting
analysis may be applied to other polymers, especially polypeptides,
carbohydrates, and other polymers, both organic and inorganic.
Besides using the fingerprinting method for analyzing a particular
polymer, the fingerprinting method may be used to characterize
various samples. For example, a cell or population of cells may be
tested for their expression of specific antigens or their mRNA
sequence content. For example, a T-cell may be classified by virtue
of its combination of expressed surface antigens. With specific
reagents which interact with these antigens, a cell or a population
of cells or a lysed cell may be exposed to a VLSIPS substrate. The
biological sample may be classified or characterized by analyzing
the pattern of specific interaction. This may be applicable to a
cell or tissue type, to the messenger RNA population expressed by a
cell to the genetic content of a cell, or to virtually any sample
which can be classified and/or identified by its combination of
specific molecular properties.
[0572] The ability to generate a high density means for screening
the presence or absence of specific interactions allows for the
possibility of screening for, if not saturating, all of a very
large number of possible interactions. This is very powerful in
providing the means for testing the combinations of molecular
properties which can define a class of samples. For example, a
species of organism may be characterized by its DNA sequences,
e.g., a genetic fingerprint. By using a fingerprinting method, it
may be determined that all members of that species are sufficiently
similar in specific sequences that they can be easily identified as
being within a particular group. Thus, newly defined classes may be
resolved by their similarity in fingerprint patterns.
Alternatively, a non-member of that group will fail to share those
many identifying characteristics. However, since the technology
allows testing of a very large number of specific interactions, it
also provides the ability to more finely distinguish between
closely related different cells or samples. This will have
important applications in diagnosing viral, bacterial, and other
pathological on nonpathological infections.
[0573] In particular, cell classification may be defined by any of
a number of different properties. For example, a cell class may be
defined by its DNA sequences contained therein. This allows species
identification for parasitic or other infections. For example, the
human cell is presumably genetically distinguishable from a monkey
cell, but different human cells will share many genetic markers. At
higher resolution, each individual human genome will exhibit unique
sequences that can define it as a single individual.
[0574] Likewise, a developmental stage of a cell type may be
definable by its pattern of expression of messenger RNA. For
example, in particular stages of cells, high levels of ribosomal
RNA are found whereas relatively low levels of other types of
messenger RNAs may be found. The high resolution distinguishability
provided by this fingerprinting method allows the distinction
between cells which have relatively minor differences in its
expressed mRNA population. Where a pattern is shown to be
characteristic of a stage, a stage may be defined by that
particular pattern of messenger RNA expression.
[0575] In a similar manner, the antigenic determinants found on a
protein may very well define the cell class. For example,
immunological T-cells are distinguishable from B-cells because, in
part, the cell surface antigens on the cell types are
distinguishable. Different T-cell subclasses can be also
distinguished from one another by whether they contain particular
T-cell antigens. The present invention provides the possibility for
high resolution testing of many different interactions
simultaneously, and the definition of new cell types will be
possible.
[0576] The high resolution VLSIPS.TM. substrate may also be used as
a very powerful diagnostic tool to test the combination of
presence, of a plurality of different assays from a biological
sample. For example, a cancerous condition may be indicated by a
combination of various different properties found in the blood. For
example, a cancerous condition may be indicated by a combination of
expression of various soluble antigens found in the blood along
with a high number of various cellular antigens found on
lymphocytes and/or particular cell degradation products. With a
substrate as provided herein, a large number of different features
can be simultaneously performed on a biological sample. In fact,
the high resolution of the test will allow more complete
characterization of parameters which define particular diseases.
Thus, the power of diagnostic tests may be limited by the extent of
statistical correlation with a particular condition rather than
with the number of antigens or interactions which are tested. The
present invention provides the means to generate this large
universe of possible reagents and the ability to actually
accumulate that correlative data.
[0577] In another embodiment, a substrate as provided herein may be
used for genetic screening. This would allow for simultaneous
screening of thousands of genetic markers. As the density of the
matrix is increased, many more molecules can be simultaneously
tested. Genetic screening then becomes a simpler method as the
present invention provides the ability to screen for thousands,
tens of thousands, and hundreds of thousands, even millions of
different possible genetic features. However, the number of high
correlation genetic markers for conditions numbers only in the
hundreds. Again, the possibility for screening a large number of
sequences provides the opportunity for generating the data which
can provide correlation between sequences and specific conditions
or susceptibility. The present invention provides the means to
generate extremely valuable correlations useful for the genetic
detection of the causative mutation leading to medical conditions.
In still another embodiment, the present invention would be
applicable to distinguishing two individuals having identical
genetic compositions. The antibody population within an individual
is dependent both on genetic and historical factors. Each
individual experiences a unique exposure to various infectious
agents, and the combined antibody expression is partly determined
thereby. Thus, individuals may also be fingerprinted by their
immunological content, either of actively expressed antibodies, or
their immunological memory; Similar sorts of immunological and
environmental histories may be useful for fingerprinting, perhaps
in combination with other screening properties. In particular, the
present invention may be useful for screening allergic reactions or
susceptibilities, and a simple IgE specificity test may be useful
in determining a spectrum of allergies.
[0578] With the definition of new classes of cells, a cell sorter
will be used to purify them. Moreover, new markers for defining
that class of cells will be identified. For example, where the
class is defined by its RNA content, cells may be screened by
antisense probes which detect the presence or absence of specific
sequences therein. Alternatively, cell lysates may provide
information useful in correlating intracellular properties with
extracellular markers which indicate functional differences. Using
standard cell sorter technology with a fluorescence or labeled
antisense probe which recognizes the internal presence of the
specific sequences of interest, the cell sorter will be able to
isolate a relatively homogeneous population of cells possessing the
particular marker. Using successive probes the sorting process
should be able to select for cells having a combination of a large
number of different markers.
[0579] In a non-polynucleotide embodiment, cells may be defined by
the presence of other markers. The markers may be carbohydrates,
proteins, or other molecules. Thus, a substrate having particular
specific reagents, e.g., antibodies, attached to it should be able
to identify cells having particular patterns of marker expression.
Of course, combinations of these made be utilized and a cell class
may be defined by a combination of its expressed mRNA, its
carbohydrate expression, its antigens, and other properties. This
fingerprinting should be useful in determining the physiological
state of a cell or population of cells.
[0580] Having defined a cell type whose function or properties are
defined by the reagents attachable to a VLSIPS substrate, such as
cellular antigens, these structural manifestations of function may
be used to sort cells to generate a relatively homogeneous
population of that class of cells. Standard cell sorter technology
may be applied to purify such a population, see, e.g., Dangl, J.
and Herzenberg (1982) "Selection of hybridomas and hybridoma
variants using the fluorescence activated cell sorter," J.
Immunological Methods 52:1-14; and Becton Dickinson, Fluorescence
Activated Cell Sorter Division, San Jose, Calif., and Coulter
Diagnostics, Hialeah, Fla.
[0581] With the fingerprinting method an identification means
arises from mosaicism problems in an organism. A mosaic organism is
one whose genetic content in different cells is significantly
different. Various clonal populations should have similar genetic
fingerprints, though different clonal populations may have
different genetic contents. See, for example, Suzuki et al. An
Introduction to Genetic Analysis (4th Ed.), Freeman and Co., New
York, which is hereby incorporated herein by reference. However,
this problem should be a relatively rare problem and could be more
carefully evaluated with greater experience using the
fingerprinting methods.
[0582] The invention will also find use in detecting changes, both
genetic and antigenic, e.g., in a rapidly "evolving" protozoa
infection, or similarly changing organism.
[0583] v. Mapping
[0584] A. General
[0585] The use of the present invention for mapping parallels its
use for fingerprinting and sequencing. Where a polymer is a linear
molecule, the mapping provides the ability to locate particular
segments along the length of the polymer. Branched polymers can be
treated as a series of individual linear polymers. The mapping
provides the ability to locate, in a relative sense, the order of
various subsequences. This may be achieved using at least two
different approaches.
[0586] The first approach is to take the large sequence and
fragment it at specific points. The fragments are then ordered and
attached to a solid substrate. For example, the clones resulting
from a chromosome walking process may be individually attached to
the substrate by methods, e.g., caged biotin techniques, indicated
earlier. Segments of unknown map position will be exposed to the
substrate and will hybridize to the segment which contains that
particular sequence. This procedure allows the rapid determination
of a number of different labeled segments, each mapping requiring
only a single hybridization step once the substrate is generated.
The substrate may be regenerated by removal of the interaction, and
the next mapping segment applied.
[0587] In an alternative method, a plurality of subsequences can be
attached to a substrate. Various short probes may be applied to
determine which segments may contain particular overlaps. The
theoretical basis and a description of this mapping procedure is
contained in, e.g., Evans et al. 1989 "Physical Mapping of Complex
Genomes by Cosmid Multiplex Analysis," Proc. Natl. Acad. Sci. USA
86:5030-5034, and other references cited above in the Section
labeled "Overall Description." Using this approach, the details of
the mapping embodiment are very similar to those used in the
fingerprinting embodiment.
[0588] B. Preparation of Substrate Matrix
[0589] The substrate may be generated in either of the methods
generally applicable in the sequencing and fingerprinting
embodiments. The substrate may be made either synthetically, or by
attaching otherwise purified probes or sequences to the matrix. The
probes or sequences may be derived either from synthetic or
biological means. As indicated above, the solid phase substrate
synthetic methods may be utilized to generate a matrix with
positionally defined sequences. In the mapping embodiment, the
importance of saturation of all possible subsequences of a
preselected length is far less important than in the sequencing
embodiment, but the length of the probes used may be desired to be
much longer. The processes for making a substrate which has longer
oligonucleotide probes should not be significantly different from
those described for the sequencing embodiments, but the
optimization parameters may be modified to comply with the mapping
needs.
[0590] C. Labeling
[0591] The labeling methods will be similar to those applicable in
sequencing and fingerprinting embodiments. Again, it may be
desirable to fragment the target sequences.
[0592] D. Hybridization/Specific Interaction
[0593] The specificity of interaction between the targets and probe
would typically be closer to those used for fingerprinting
embodiments, where homology is more important than absolute
distinguishability of high fidelity complementary hybridization.
Usually, the hybridization conditions will be such that merely
homologous segments will interact and provide a positive signal.
Much like the fingerprinting embodiment, it may be useful to
measure the extent of homology by successive incubations at higher
stringency conditions. Or, a plurality of different probes, each
having various levels of homology may be used. In either way, the
spectrum of homologies can be measured.
[0594] Where non-nucleic acid hybridization is involved, the
specific interactions may also be compared in a fingerprint-like
manner. The specific reagents may have less specificity, e.g.,
monoclonal antibodies which recognize a broader spectrum of
sequences may be utilized relative to a sequencing embodiment.
Again, the specificity of interaction may be measured under various
conditions of increasing stringency to determine the spectrum of
matching across the specific probes selected, or a number of
different stringency reagents may be included to indicate the
binding affinity.
[0595] E. Detection
[0596] The detection methods used in the mapping procedure will be
virtually identical to those used in the fingerprinting embodiment.
The detection methods will be selected in combination ith the
labeling methods.
[0597] F. Analysis
[0598] The analysis of the data in a mapping embodiment will
typically be somewhat different from that in fingerprinting. The
fingerprinting embodiment will test for the presence or absence of
specific or homologous segments. However, in the mapping
embodiment, the existence of an interaction is coupled with some
indication of the location of the interaction. The interaction is
mapped in some manner to the physical polymer sequence. Some means
for determining the relative positions of different probes is
performed. This may be achieved by synthesis of the substrate in
pattern, or may result from analysis of sequences after they have
been attached to the substrate.
[0599] For example, the probes may be randomly positioned at
various locations on the substrate. However, the relative positions
of the various reagents in the original polymer may be determined
by using short fragments, e.g., individually, as target molecules
which determine the proximity of different probes. By an automated
system of testing each different short fragment of the original
polymer, coupled with proper analysis, it will be possible to
determine which probes are adjacent one another on the original
target sequence and correlate that with positions on the matrix. In
this way, the matrix is useful for determining the relative
locations of various new segments in the original target molecule.
This sort of analysis is described in Evans, and the related
references described above.
[0600] G. Substrate Reuse
[0601] The substrate should be reusable in the manner described in
the fingerprinting section. The substrate is renewed by removal of
the specific interactions and is washed and prepared for successive
cycles of exposure to new target sequences.
[0602] H. Non-Polynucleotide Aspects
[0603] The mapping procedure may be used on other molecules than
polynucleotides. Although hybridization is one type of specific
interaction which is clearly useful for use in this mapping
embodiment, antibody reagents may also be very useful. In the same
way that polypeptide sequencing or other polymers may be sequenced
by the reagents and techniques described in the sequencing section
and fingerprinting section, the mapping embodiment may also be used
similarly.
[0604] In another form of mapping, as described above in the
fingerprinting section, the developmental map of a cell or
biological system may be measured using fingerprinting type
technology. Thus, the mapping may be along a temporal dimension
rather than along a polymer dimension. The mapping or
fingerprinting embodiments may also be used in determining the
genetic rearrangements which may be genetically important, as in
lymphocyte and B-cell development. In another example, various
rearrangements or chromosomal dislocations may be tested by either
the fingerprinting or mapping methods. These techniques are similar
in many respects and the fingerprinting and mapping embodiments may
overlap in many respects.
[0605] vi. Additional Screening and Applications
[0606] A. Specific Interactions
[0607] As originally indicated in the parent filing of VLSIPS.TM.,
the production of a high density plurality of spatially segregated
polymers provides the ability to generate a very large universe or
repertoire of individually and distinct sequence possibilities. As
indicated above, particular oligonucleotides may be synthesized in
automated fashion at specific locations on a matrix. In fact, these
oligonucleotides may be used to direct other molecules to specific
locations by linking specific oligonucleotides to other reagents
which are in batch exposed to the matrix and hybridized in a
complementary fashion to only those locations where the
complementary oligonucleotide has been synthesized on the matrix.
This allows for spatially attaching a plurality of different
reagents onto the matrix instead of individually attaching each
separate reagent at each specific location. Although the caged
biotin method allows automated attachment, the speed of the caged
biotin attachment process is relatively slow and requires a
separate reaction for each reagent being attached. By use of the
oligonucleotide method, the specificity of position can be done in
an automated and parallel fashion. As each reagent is produced,
instead of directly attaching each reagent at each desired
position, the reagent may be attached to a specific desired
complementary oligonucleotide which will ultimately be specifically
directed toward locations on the matrix having a complementary
oligonucleotide attached thereat.
[0608] In addition, the technology allows screening for specificity
of interaction with particular reagents. For example, the
oligonucleotide sequence specificity of binding of a potential
reagent may be tested by presenting to the reagent all of the
possible subsequences available for binding. Although secondary or
higher order sequence specific features might not be easily
screenable using this technology, it does provide a convenient,
simple, quick, and thorough screen of interactions between a
reagent and its target recognition sequences. See, e.g., Pfeifer et
al. (1989) Science 246:810-812.
[0609] For example, the interaction of a promoter protein with its
target binding sequence may be tested for many different, or all,
possible binding sequences. By testing the strength of interactions
under various different conditions, the interaction of the promoter
protein with each of the different potential binding sites may be
analyzed. The spectrum of strength of interactions with each
different potential binding site may provide significant insight
into the types of features which are important in determining
specificity.
[0610] An additional example of a sequence specific interaction
between reagents is the testing of binding of a double stranded
nucleic acid structure with a single stranded oligonucleotide.
Often, a triple stranded structure is produced which has
significant aspects of sequence specificity. Testing of such
interactions with either sequences comprising only natural
nucleotides, or perhaps the testing of nucleotide analogs may be
very important in screening for particularly useful diagnostic or
therapeutic reagents. See, e.g., Hner and Dervan (1990)
Biochemistry 29:9761-6765, and references therein.
[0611] B. Sequence Comparisons
[0612] Once a gene is sequenced, the present invention provides a
means to compare alleles or related sequences to locate and
identify differences from the control sequence. This would be
extremely useful in further analysis of genetic variability at a
specific gene locus.
[0613] C. Categorizations
[0614] As indicated above in the fingerprinting and mapping
embodiments, the present invention is also useful in defining
specific stages in the temporal sequence of cells, e.g.,
development, and the resulting tissues within an organism. For
example, the developmental stage of a cell, or population of cells,
can be dependent upon the expression of particular messenger RNAs
or cellular antigens. The screening procedures provided allow for
high resolution definition of new classes of cells. In addition,
the temporal development of particular cells will be characterized
by the presence or expression of various mRNAs. Means to
simultaneously screen a plurality or very large number of different
sequences are provided. The combination of different markers made
available dramatically increases the ability to distinguish fairly
closely related cell types. Other markers may be combined with
markers and methods made available herein to define new
classifications of biological samples, e.g., based upon new
combinations of markers.
[0615] The presence or absence of particular marker sequences will
be used to define temporal developmental stages. Once the stages
are defined, fairly simple methods can be applied to actually
purify those particular cells. For example, antisense probes or
recognition reagents may be used with a cell sorter to select those
cells containing or expressing the critical markers. Alternatively,
the expression of those sequences may result in specific antigens
which may also be used in defining cell classes and sorting those
cells away from others. In this way, for example, it should be
possible to select a class of omnipotent immune system cells which
are able to completely regenerate a human immune system. Based upon
the cellular classes defined by the parameters made available by
this technology, purified classes of cells having identifiable
differences, structural or functional, are made available.
[0616] In an alternative embodiment, a plurality of antigens or
specific binding proteins attached to the substrate may be used to
define particular cell types. For example, subclasses of T-cells
are defined, in part, by the combination of expressed cell surface
antigens. The present invention allows for the simultaneous
screening of a large plurality of different antigens together.
Thus, higher resolution classification of different T-cell
subclasses becomes possible and, with the definitions and
functional differences which correlate with those antigenic or
other parameters, the ability to purify those cell types becomes
available. This is applicable not only to T-cells, but also to
lymphocyte cells, or even to freely circulating cells. Many of the
cells for which this would be most useful will be immobile cells
found in particular tissues or organs. Tumor cells will be
diagnosed or detected using these fingerprinting techniques.
Coupled with a temporal change in structure, developmental classes
may also be selected and defined using these technologies. The
present invention also provides the ability not only to define new
classes of cells based upon functional or structural differences,
but it also provides the ability to select or purify populations of
cells which share these particular properties. Standard cell
sorting procedures using antibody markers may be used to detect
extracellular features. Intracellular features would also be
detectable by introducing the label reagents into the cell. In
particular, antisense DNA or RNA molecules may be introduced into a
cell to detect RNA sequences therein. See, e.g., Weintraub (1990)
Scientific American 262:40-46.
[0617] D. Statistical Correlations
[0618] In an additional embodiment, the present invention also
allows for the high resolution correlation of medical conditions
with various different markers. For example, the present available
technology, when applied to amniocentesis or other genetic
screening methods, typically screen for tens of different markers
at most. The present invention allows simultaneous screening for
tens, hundreds, thousands, tens of thousands, hundreds of
thousands, and even millions of different genetic sequences. Thus,
applying the fingerprinting methods of the present invention to a
sufficiently large population allows detailed statistical analysis
to be made, thereby correlating particular medical conditions with
particular markers, typically antigenic or genetic. Tumor specific
antigens will be identified using the present invention.
[0619] Various medical conditions may be correlated against an
enormous data base of the sequences within an individual. Genetic
propensities and correlations then become available and high
resolution genetic predictability and correlation become much more
easily performed. With the enormous data base, the reliability of
the predictions is also better tested. Particular markers which are
partially diagnostic of particular medical conditions or medical
susceptibilities will be identified and provide direction in
further studies and more careful analysis of the markers involved.
Of course, as indicated above in the sequencing embodiment, the
present invention will find much use in intense sequencing
projects. For example, sequencing of the entire human genome in the
human genome project will be greatly simplified and enabled by the
present invention.
[0620] vi. Formation of Substrate
[0621] The substrate is provided with a pattern of specific
reagents which are positionally localized on the surface of the
substrate. This matrix of positions is defined by the automated
system which produces the substrate. The instrument will typically
be one similar to that described in Ser. No. 07/492,462 (U.S. Pat.
No. 5,143,854), and Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678).
The instrumentation described therein is directly applicable to the
applications used here. In particular, the apparatus comprises a
substrate, typically a silicon containing substrate, on which
positions on the surface may be defined by a coordinate system of
positions. These positions can be individually addressed or
detected by the VLSIPS.TM. technology apparatus.
[0622] Typically, the VLSIPS apparatus uses optical methods used in
semiconductor fabrication applications. In this way, masks may be
used to photo-activate positions for attachment or synthesis of
specific sequences on the substrate. These manipulations may be
automated by the types of apparatus described in Ser. No.
07/462,492 and Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678).
[0623] Selectively removable protecting groups allow creation of
well defined areas of substrate surface having differing
reactivities. Preferably, the protecting groups are selectively
removed from the surface by applying a specific activator, such as
electromagnetic radiation of a specific wavelength and intensity.
More preferably, the specific activator exposes selected areas of
surface to remove the protecting groups in the exposed areas.
[0624] Protecting groups of the present invention are used in
conjunction with solid phase oligomer syntheses, such as peptide
syntheses using natural or unnatural amino acids, nucleotide
syntheses using deoxyribonucleic and ribonucleic acids,
oligosaccharide syntheses, and the like. In addition to protecting
the substrate surface from unwanted reaction, the protecting groups
block a reactive end of the monomer to prevent self-polymerization.
For instance, attachment of a protecting group to the amino
terminus of an activated amino acid, such as the
N-hydroxysuccinimide-activated ester of the amino acid prevents the
amino terminus of one monomer from reacting with the activated
ester portion of another during peptide synthesis.
[0625] Alternatively, the protecting group may be attached to the
carboxyl group of an amino acid to prevent reaction at this site.
Most protecting groups can be attached to either the amino or the
carboxyl group of an amino acid, and the nature of the chemical
synthesis will dictate which reactive group will require a
protecting group. Analogously, attachment of a protecting group to
the 5'-hydroxyl group of a nucleoside during synthesis using for
example, phosphate-triester coupling chemistry, prevents the
5'-hydroxyl of one nucleoside from reacting with the 3'-activated
phosphate-triester of another.
[0626] Regardless of the specific use, protecting groups are
employed to protect a moiety on a molecule from reacting with
another reagent. Protecting groups of the present invention have
the following characteristics: they prevent selected reagents from
modifying the group to which they are attached; they are stable
(that is, they remain attached) to the synthesis reaction
conditions; they are removable under conditions that do not
adversely affect the remaining structure; and once removed, do not
react appreciably with the surface or surface-bound oligomer. The
selection of a suitable protecting group will depend, of course, on
the chemical nature of the monomer unit and oligomer, as well as
the specific reagents they are to protect against.
[0627] In a preferred embodiment, the protecting groups will be
photoactivatable. The properties and uses of photoreactive
protecting compounds have been reviewed. See, McCray et al., Ann.
Rev. of Biophys. and Biophys. Chem. (1989) 18:239-270, which is
incorporated herein by reference. Preferably, the photosensitive
protecting groups will be removable by radiation in the ultraviolet
(UV) or visible portion of the electromagnetic spectrum. More
preferably, the protecting groups will be removable by radiation in
the near UV or visible portion of the spectrum. In some
embodiments, however, activation may be performed by other methods
such as localized heating, electron beam lithography, laser
pumping, oxidation or reduction with microelectrodes, and the like.
Sulfonyl compounds are suitable reactive groups for electron beam
lithography. Oxidative or reductive removal is accomplished by
exposure of the protecting group to an electric current source,
preferably using microelectrodes directed to the predefined regions
of the surface which are desired for activation. A more detailed
description of these protective groups is provided in Ser. No.
07/624,120 (U.S. Pat. No. 5,498,678), which is hereby incorporated
herein by reference.
[0628] The density of reagents attached to a silicon substrate may
be varied by standard procedures. The surface area for attachment
of reagents may be increased by modifying the silicon surface. For
example, a matte surface may be machined or etched on the substrate
to provide more sites for attachment of the particular reagents.
Another way to increase the density of reagent binding sites is to
increase the derivitization density of the silicon. Standard
procedures for achieving this are described, below.
[0629] One method to control the derivatization density is to
highly derivatize the substrate with photochemical groups at high
density. The substrate is then photolyzed for various predetermined
times, which photoactivate the groups at a measurable rate, and
react them with a capping reagent. By this method, the density of
linker groups may be modulated by using a desired time and
intensity of photoactivation.
[0630] In many applications, the number of different sequences
which may be provided may be limited by the density and the size of
the substrate on which the matrix pattern is generated. In
situations where the density is insufficiently high to allow the
screening of the desired number of sequences, multiple substrates
may be used to increase the number of sequences tested. Thus, the
number of sequences tested may be increased by using a plurality of
different substrates. Because the VLSIPS apparatus is almost fully
automated, increasing the number of substrates does not lead to a
significant increase in the number of manipulations which must be
performed by humans. This again leads to greater reproducibility
and speed in the handling of these multiple substrates.
[0631] A. Instrumentation
[0632] The concept of using VLSIPS.TM. technology generally allows
a pattern or a matrix of reagents to be generated. The procedure
for making the pattern is performed by any of a number of different
methods. An apparatus and instrumentation useful for generating a
high density VLSIPS substrate is described in detail in Ser. No.
07/492,462 (U.S. Pat. No. 5,143,854) and Ser. No. 07/624,120 (U.S.
Pat. No. 5,498,678).
[0633] B. Binary Masking
[0634] The details of the binary masking are described in an
accompanying application filed simultaneously with this, Ser. No.
07/624,120 (U.S. Pat. No. 5,498,678) whose specification is
incorporated herein by reference.
[0635] For example, the binary masking technique allows for
producing a plurality of sequences based on the selection of either
of two possibilities at any particular location. By a series of
binary masking steps, the binary decision may be the determination,
on a particular synthetic cycle, whether or not to add any
particular one of the possible subunits. By treating various
regions of the matrix pattern in parallel, the binary masking
strategy provides the ability to carry out spatially addressable
parallel synthesis.
[0636] C. Synthetic Methods
[0637] The synthetic methods in making a substrate are described in
the parent application, U.S. Ser. No. 07/492,462 (U.S. Pat. No.
5,143,854). The construction of the matrix pattern on the substrate
will typically be generated by the use of photo-sensitive reagents.
By use of photo-lithographic optical methods, particular segments
of the substrate can be irradiated with light to activate or
deactivate blocking agents, e.g., to protect or deprotect
particular chemical groups. By an appropriate sequence of
photo-exposure steps at appropriate times with appropriate masks
and with appropriate reagents, the substrates can have known
polymers synthesized at positionally defined regions on the
substrate. Methods for synthesizing various substrates are
described in Ser. No. 07/492,462 (U.S. Pat. No. 5,143,854) and Ser.
No. 07/624,120 (U.S. Pat. No. 5,498,678). By a sequential series of
these photo-exposure and reaction manipulations, a defined matrix
pattern of known sequences may be generated, and is typically
referred to as a VLSIPS.TM. technology substrate.
[0638] A matrix pattern of new reagents may be targeted to each
specific oligonucleotide position by attaching a complementary
oligonucleotide to which the substrate bound form is complementary.
For instance, a number of regions may have homogeneous
oligonucleotides synthesized at various locations. Oligonucleotide
sequences complementary to each of these can be individually
generated and linked to a particular specific reagents. Often these
specific reagents will be antibodies. As each of these is specific
for finding its complementary oligonucleotide, each of the specific
reagents will bind through the oligonucleotide to the appropriate
matrix position. A single step having a combination of different
specific reagents being attached specifically to a particular
oligonucleotide will thereby bind to its complement at the defined
matrix position. The oligonucleotides will typically then be
covalently attached, using, e.g., an acridine dye, for
photocrosslinking. Psoralen is a commonly used acridine dye for
photocrosslinking purposes, see, e.g., Song et al. (1979)
Photochem. Photobiol. 29:1177-1197; Cimino et al. (1985) Ann. Rev.
Biochem. 54:1151-1193; Parsons (1980) Photochem. Photobiol.
32:813-821; and Dattagupta et al. (1985) U.S. Pat. No. 4,542,102,
and (1987) U.S. Pat. No. 4,713,326; each of which is hereby
incorporated herein by reference. This method allows a single
attachment manipulation to attach all of the specific reagents to
the matrix at defined positions and results in the specific
reagents being homogeneously located at defined positions. In many
embodiments, the specific reagents will be antibodies.
[0639] In an alternative embodiment, antibody molecules may be used
to specifically direct binding to defined positions on a substrate.
The VLSIPS technology may be used to generate specific epitopes at
each position on the substrate. Antibody molecules having
specificity of interaction may be used to attach oligonucleotides,
thereby avoiding the interference of internal polynucleotide
sequences from binding to the substrate complementary
oligonucleotides. In fact, the specificity of interaction for
positional targeting may be achieved by use of nucleotide analogues
which do not interact with the natural nucleotides. For example,
other synthetic nucleotides have been made which undergo base
pairing, thereby providing the specificity of targeting, but the
synthetic nucleotides also do not interact with the natural
biological nucleotides. Thus, synthetic oligonucleotides would be
useful for attachment to biological nucleotides and specific
targeting. Moreover, the VLSIPS synthetic processes would be useful
in generating the VLSIPS substrate, and standard oligonucleotide
synthesis could be applied, with minor modifications, to produce
the complementary sequences which would be attached to other
specific reagents.
[0640] D. Surface Immobilization
[0641] 1. Caged Biotin
[0642] An alternative method of attaching reagents in a
positionally defined matrix pattern is to use a caged biotin
system. See Ser. No. 07/612,671, which is hereby incorporated
herein by reference, for additional details on the chemistry and
application of caged biotin embodiments. In short, the caged biotin
has a photosensitive blocking moiety which prevents the combination
of avidin to biotin. At positions where the photo-lithographic
process has removed the blocking group, high affinity biotin sites
are generated. Thus, by a sequential series of photolithographic
deblocking steps interspersed with exposure of those regions to
appropriate biotin containing reagents, only those locations where
the deblocking takes place will form an avidin-biotin interaction.
Because the avidin-biotin binding is very tight, this will usually
be virtually irreversible binding.
[0643] 2. Crosslinked Interactions
[0644] The surface immobilization may also take place by photo
crosslinking of defined oligonucleotides linked to specific
reagents. After hybridization of the complementary
oligonucleotides, the oligonucleotides may be crosslinked by a
reagent by psoralen or another similar type of acridine dye. Other
useful cross linking reagents are described in Dattagupta et al.
(1985) U.S. Pat. No. 4,542,102, and (1987) U.S. Pat. No.
4,713,326.
[0645] In another embodiment, colony or phage plaque transfer of
biological polymers may be transferred directly onto a silicon
substrate. For example, a colony plate may be transferred onto a
substrate having a generic oligonucleotide sequence which
hybridizes to another generic complementary sequence contained on
all of the vectors into which inserts are cloned. This will
specifically only bind those molecules which are actually contained
in the vectors containing the desired complementary sequence. This
immobilization allows for producing a matrix onto which a sequence
specific reagent can bind, or for other purposes. In a further
embodiment, a plurality of different vectors each having a specific
oligonucleotide attached to the vector may be specifically attached
to particular regions on a matrix having a complementary
oligonucleotide attached thereto.
[0646] viii. Hybridization/Specific Interaction
[0647] A. General
[0648] As discussed previously in the VLSIPS.TM. technology parent
applications, the VLSIPS.TM. technology substrates may be used for
screening for specific interactions with sequence specific targets
or probes.
[0649] In addition, the availability of substrates having the
entire repertoire of possible sequences of a defined length opens
up the possibility of sequencing by hybridization. This sequence
may be de novo determination of an unknown sequence, particularly
of nucleic acid, verification of a sequence determined by another
method, or an investigation of changes in a previously sequenced
gene, locating and identifying specific changes. For example, often
Maxam and Gilbert sequencing techniques are applied to sequences
which have been determined by Sanger and Coulson. Each of those
sequencing technologies have problems with resolving particular
types of sequences. Sequencing by hybridization may serve as a
third and independent method for verifying other sequencing
techniques. See, e.g., (1988) Science 242:1245.
[0650] In addition, the ability to provide a large repertoire of
particular sequences allows use of short subsequences and
hybridization as a means to fingerprint a sample. This may be used
in a nucleic acid, as well as other polymer embodiments. For
example, fingerprinting to a high degree of specificity of sequence
matching may be used for identifying highly similar samples, e.g.,
those exhibiting high homology to the selected probes. This may
provide a means for determining classifications of particular
sequences. This should allow determination of whether particular
genomes of bacteria, phage, or even higher cells might be related
to one another.
[0651] In addition, fingerprinting may be used to identify an
individual source of biological sample. See, e.g., Lander, E.
(1989) Nature, 339:501-505, and references therein. For example, a
DNA fingerprint may be used to determine whether a genetic sample
arose from another individual. This would be particularly useful in
various sorts of forensic tests to determine, e.g., paternity or
sources of blood samples. Significant detail on the particulars of
genetic fingerprinting for identification purposes are described
in, e.g., Morris et al. (1989) "Biostatistical evolution of
evidence from continuous allele frequency distribution DNA probes
in reference to disputed paternity of identity," J. Forensic
Science 34:1311-1317; and Neufeld et al. (1990) Scientific American
262:46-53; each of which is hereby incorporated herein by
reference.
[0652] In another embodiment, a fingerprinting-like procedure may
be used for classifying cell types by analyzing a pattern of
specific nucleic acids present in the cell. A series of antibodies
may be used to identify cell markers, e.g., proteins, usually on
the cell surface, but intracellular markers may also be used.
Antigens which are extracellularly expressed are preferred so cell
lysis is unnecessary in the screening, but intracellular markers
may also be useful. The markers will usually be proteins, but may
be nucleic acids, lipids, metabolites, carbohydrates, or other
cellular components. See, e.g., Winkelgren, I. (1990) Science News
136:234-237, which indicates extracellular DNA may be common, and
suggesting that such might be characteristic of cell types, stage,
or physiology. This may also be useful in defining the temporal
stage of development of cells, e.g., stem cells or other cells
which undergo temporal changes in development. For example, the
stage of a cell, or group of cells, may be tested or defined by
isolating a sample of mRNA from the population and testing to see
what sequences are present in messenger populations. Direct
samples, or amplified samples, may be used. Where particular mRNA
or other nucleic acid sequences may be characteristic of or shown
to be characteristic of particular developmental stages,
physiological states, or other conditions, this fingerprinting
method may define them. Similar sorts of fingerprinting may be used
for determining T-cell classes or perhaps even to generate
classification schemes for such proteins as major
histocompatibility complex antigens. Thus, the ability to make
these substrates allows both the generation of reagents which will
be used for defining subclasses or classes of cells or other
biological materials, but also provides the mechanisms for
selecting those cells which may be found in defined population
groups.
[0653] In addition to cell classification defined by such a
combination of properties, typically expression of extracellular
antigens, the present invention also provides the means for
isolating homogeneous population of cells. Once the antigenic
determinants which define a cell class have been identified, these
antigens may be used in a sequential selection process to isolate
only those cells which exhibit the combination of defining
structural properties.
[0654] The present invention may also be used for mapping sequences
within a larger segment. This may be performed by at least two
methods, particularly in reference to nucleic acids. Often,
enormous segments of DNA are subcloned into a large plurality of
subsequences. Ordering these subsequences may be important in
determining the overlaps of sequences upon nucleotide
determinations. Mapping may be performed by immobilizing
particularly large segments onto a matrix using the VLSIPS.TM.
technology. Alternatively, sequences may be ordered by virtue of
subsequences shared by overlapping segments. See, e.g., Craig et
al. (1990) Nuc. Acids Res. 18:2653-2660; Michiels et al. (1987)
CABIOS 3:203-210; and Olson et al. (1986) Proc. Natl. Acad. Sci.
USA 83:7826-7830.
[0655] B. Important Parameters
[0656] The extent of specific interaction between reagents
immobilized to the VLSIPS.TM. technology substrate and another
sequence specific reagent may be modified by the conditions of the
interaction. Sequencing embodiments typically require high fidelity
hybridization and the ability to discriminate perfect matching from
imperfect matching. Fingerprinting and mapping embodiments may be
performed using less stringent conditions, depending upon the
circumstances.
[0657] For example, the specificity of antibody/antigen interaction
may depend upon such parameters as pH, salt concentration, ionic
composition, solvent composition, detergent composition and
concentration, and chaotropic agent concentration. See, e.g.,
Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold Spring
Harbor Press, New York. By careful control of these parameters, the
affinity of binding may be mapped across different sequences.
[0658] In a nucleic acid hybridization embodiment, the specificity
and kinetics of hybridization have been described in detail by,
e.g., Wetmur and Davidson (1968) J. Mol. Biol., 31:349-370, Britten
and Kohne (1968) Science 161:529-530, and Kanehisa, (1984) Nuc.
Acids Res. 12:203-213, each of which is hereby incorporated herein
by reference. Parameters which are well known to affect specificity
and kinetics of reaction include salt conditions, ionic composition
of the solvent, hybridization temperature, length of
oligonucleotide matching sequences, guanine and cytosine (GC)
content, presence of hybridization accelerators, pH, specific bases
found in the matching sequences, solvent conditions, and addition
of organic solvents.
[0659] In particular, the salt conditions required for driving
highly mismatched sequences to completion typically include a high
salt concentration. The typical salt used is sodium chloride NaCl),
however, other ionic salts may be utilized, e.g., KCl. Depending on
the desired stringency hybridization, the salt concentration will
often be less than about 3 molar, more often less than 2.5 molar,
usually less than about 2 molar, and more usually less than about
1.5 molar. For applications directed towards higher stringency
matching, the salt concentrations would typically be lower.
Ordinary high stringency conditions will utilize salt concentration
of less than about 1 molar, more often less then about 750
millimolar, usually less than about 500 millimolar, and may be as
low as about 250 or 150 millimolar.
[0660] The kinetics of hybridization and the stringency of
hybridization both depend upon the temperature at which the
hybridization is performed and the temperature at which the washing
steps are performed. Temperatures at which steps for low stringency
hybridization are desired would typically be lower temperatures,
e.g., ordinarily at least about 15.degree. C., more ordinarily at
least about 20.degree. C., usually at least about 25.degree. C.,
and more usually at least about 30.degree. C. For those
applications requiring high stringency hybridization, or fidelity
of hybridization and sequence matching, temperatures at which
hybridization and washing steps are performed would typically be
high. For example, temperatures in excess of about 35.degree. C.
would often be used, more often in excess of about 40.degree. C.,
usually at least about 45.degree. C., and occasionally even
temperatures as high as about 50.degree. C. or 60.degree. C. or
more. Of course, the hybridization of oligonucleotides may be
disrupted by even higher temperatures. Thus, for stripping of
targets from substrates, as discussed below, temperatures as high
as 80.degree. C., or even higher may be used.
[0661] The base composition of the specific oligonucleotides
involved in hybridization affects the temperature of melting, and
the stability of hybridization as discussed in the above
references. However, the bias of GC rich sequences to hybridize
faster and retain stability at higher temperatures can be
compensated for by the inclusion in the hybridization incubation or
wash steps of various buffers. Sample buffers which accomplish this
result include the triethly-and trimethyl ammonium buffers. See,
e.g., Wood et al. (1987) Proc. Natl. Acad. Sci. USA, 82:1585-1588,
and Khrapko, K. et al. (1989) FEBS Letters 256:118-122.
[0662] The rate of hybridization can also be affected by the
inclusion of particular hybridization accelerators. These
hybridization accelerators include the volume exclusion agents
characterized by dextran sulfate, or polyethylene glycol (PEG).
Dextran sulfate is typically included at a concentration of between
1% and 40% by weight. The actual concentration selected depends
upon the application, but typically a faster hybridization is
desired in which the concentration is optimized for the system in
question. Dextran sulfate is often included at a concentration of
between 0.5% and 2% by weight or dextran sulfate at a concentration
between about 0.5% and 5%. Alternatively, proteins which accelerate
hybridization may be added, e.g., the recA protein found in E. coli
or other homologous proteins.
[0663] With respect to those embodiments where specific reagents
are not oligonucleotides, the conditions of specific interaction
would depend on the affinity of binding between the specific
reagent and its target. Typically parameters which would be of
particular importance would be pH, salt concentration anion and
cation compositions, buffer concentration, organic solvent
inclusion, detergent concentration, and inclusion of such reagents
such as chaotropic agents. In particular, the affinity of binding
may be tested over a variety of conditions by multiple washes and
repeat scans or by using reagents with differences in binding
affinity to determine which reagents bind or do not bind under the
selected binding and washing conditions. The spectrum of binding
affinities may provide an additional dimension of information which
may be very useful in identification purposes and mapping.
[0664] Of course, the specific hybridization conditions will be
selected to correspond to a discriminatory condition which provides
a positive signal where desired but fails to show a positive signal
at affinities where interaction is not desired. This may be
determined by a number of titration steps or with a number of
controls which will be run during the hybridization and/or washing
steps to determine at what point the hybridization conditions have
reached the stage of desired specificity.
[0665] ix. Detection Methods
[0666] Methods for detection depend upon the label selected. The
criteria for selecting an appropriate label are discussed below,
however, a fluorescent label is preferred because of its extreme
sensitivity and simplicity. Standard labeling procedures are used
to determine the positions where interactions between a sequence
and a reagent take place. For example, if a target sequence is
labeled and exposed to a matrix of different probes, only those
locations where probes do interact with the target will exhibit any
signal. Alternatively, other methods may be used to scan the matrix
to determine where interaction takes place. Of course, the spectrum
of interactions may be determined in a temporal manner by repeated
scans of interactions which occur at each of a multiplicity of
conditions. However, instead of testing each individual interaction
separately, a multiplicity of sequence interactions may be
simultaneously determined on a matrix.
[0667] A. Labeling Techniques
[0668] The target polynucleotide may be labeled by any of a number
of convenient detectable markers. A fluorescent label is preferred
because it provides a very strong signal with low background. It is
also optically detectable at high resolution and sensitivity
through a quick scanning procedure. Other potential labeling
moieties include, radioisotopes, chemiluminescent compounds,
labeled binding proteins, heavy metal atoms, spectroscopic markers,
magnetic labels, and linked enzymes. Another method for labeling
may bypass any label of the target sequence. The target may be
exposed to the probes, and a double strand hybrid is formed at
those positions only. Addition of a double strand specific reagent
will detect where hybridization takes place. An intercalative dye
such as ethidiun bromide may be used as long as the probes
themselves do not fold back on themselves to a significant extent
forming hairpin loops. See, e.g., Sheldon et al. (1986) U.S. Pat.
No. 4,582,789. However, the length of the hairpin loops in short
oligonucleotide probes would typically be insufficient to form a
stable duplex.
[0669] In another embodiment, different targets may be
simultaneously sequenced where each target has a different label.
For instance, one target could have a green fluorescent label and a
second target could have a red fluorescent label. The scanning step
will distinguish sites of binding of the red label from those
binding the green fluorescent label. Each sequence can be analyzed
independently from one another.
[0670] Suitable chromogens will include molecules and compounds
which absorb light in a distinctive range of wavelengths so that a
color may be observed, or emit light when irradiated with radiation
of a particular wave length or wave length range, e.g.,
fluorescers. Biliproteins, e.g., phycoerythrin, may also serve as
labels.
[0671] A wide variety of suitable dyes are available, being
primarily chosen to provide an intense color with minimal
absorption by their surroundings. Illustrative dye types include
quinoline dyes, triarylmethane dyes, acridine dyes, alizarine dyes,
phthaleins, insect dyes, azo dyes, anthraquinoid dyes, cyanine
dyes, phenazathionium dyes, and phenazoxonium dyes.
[0672] A wide variety of fluorescers may be employed either by
themselves or in conjunction with quencher molecules. Fluorescers
of interest fall into a variety of categories having certain
primary functionalities. These primary functionalities include 1-
and 2-aminonaphthalene, p,p'-diaminostilbenes, pyrenes, quaternary
phenanthridine salts, 9-aminoacridines, p,p'-diaminobenzophenone
imines, anthracenes, oxacarbocyanine, merocyanine,
3-aminoequilenin, perylene, bis-benzoxazole, bis-p-oxazolyl
benzene, 1,2-benzophenazin, retinol, bis-3-aminopyridinium salts,
hellebrigenin, tetracycline, sterophenol,
benzimidzaolylphenylamine, 2-oxo-3-chromen, indole, xanthen,
7-hydroxycoumarin, phenoxazine, salicylate, strophanthidin,
porphyrins, triarylmethanes and flavin. Individual fluorescent
compounds which have functionalities for linking or which can be
modified to incorporate such functionalities include, e.g., dansyl
chloride; fluoresceins such as 3,6-dihydroxy-9-phenylxanthhydrol;
rhodamineisothiocyanate; N-phenyl 1-amino-8-sulfonatonaphthalene;
N-phenyl 2-amino-6-sulfonatonaphthalene;
4-acetamido-4-isothiocyanato-stilbene-2,2'-disulfonic acid;
pyrene-3-sulfonic acid; 2-toluidinonaphthalene-6-sulfonate;
N-phenyl, N-methyl 2-aminoaphthalene-6-sulfonate; ethidium bromide;
stebrine; auromine-0,2-(9'-anthroyl)palmitate; dansyl
phosphatidylethanolamine; N,N'-dioctadecyl oxacarbocyanine;
N,N'-dihexyl oxacarbocyanine; merocyanine, 4-(3'pyrenyl)butyrate;
d-3-aminodesoxy-equilenin; 12-(9'-anthroyl)stearate;
2-methylanthracene; 9-vinylanthracene;
2,2'-(vinylene-p-phenylene)bisbenzoxazole;
p-bis[2-(4-methyl-5-phenyl-oxa- zolyl)]benzene;
6-dimethylamino-1,2-benzophenazin; retinol; bis(3'-aminopyridinium)
1,10-decandiyl diiodide; sulfonaphthylhydrazone of hellibrienin;
chlorotetracycline; N-(7-dimethylamino4-methyl-2-oxo-3-c-
hromenyl)maleimide; N-[p-(2-benzimidazolyl)-phenyl]maleimide;
N-(4-fluoranthyl)maleimide; bis(homovanillic acid); resazarin;
4-chloro-7-nitro-2,1,3-benzooxadiazole; merocyanine 540; resorufin;
rose bengal; and 2,4-diphenyl-3(2H)-furanone.
[0673] Desirably, fluorescers should absorb light above about 300
nm, preferably about 350 nm, and more preferably above about 400
nm, usually emitting at wavelengths greater than about 10 nm higher
than the wavelength of the light absorbed. It should be noted that
the absorption and emission characteristics of the bound dye may
differ from the unbound dye. Therefore, when referring to the
various wavelength ranges and characteristics of the dyes, it is
intended to indicate the dyes as employed and not the dye which is
unconjugated and characterized in an arbitrary solvent.
[0674] Fluorescers are generally preferred because by irradiating a
fluorescer with light, one can obtain a plurality of emissions.
Thus, a single label can provide for a plurality of measurable
events.
[0675] Detectable signal may also be provided by chemiluminescent
and bioluminescent sources. Chemiluminescent sources include a
compound which becomes electronically excited by a chemical
reaction and may then emit light which serves as the detectible
signal or donates energy to a fluorescent acceptor. A diverse
number of families of compounds have been found to provide
chemiluminescence under a variety of conditions. One family of
compounds is 2,3-dihydro-1,-4-phthalazinedione. The most popular
compound is luminol, which is the 5-amino compound. Other members
of the family include the 5-amino-6,7,8-trimethoxy- and the
dimethylamino[ca]benz analog. These compounds can be made to
luminesce with alkaline hydrogen peroxide or calcium hypochlorite
and base. Another family of compounds is the
2,4,5-triphenylimidazoles, with lophine as the common name for the
parent product. Chemiluminescent analogs include para-dimethylamino
and -methoxy substituents. Chemiluminescence may also be obtained
with oxalates, usually oxalyl active esters, e.g., p-nitrophenyl
and a peroxide, e.g., hydrogen peroxide, under basic conditions.
Alternatively, luciferins may be used in conjunction with
luciferase or lucigenins to provide bioluminescence.
[0676] Spin labels are provided by reporter molecules with an
unpaired electron spin which can be detected by electron spin
resonance (ESR) spectroscopy. Exemplary spin labels include organic
free radicals, transitional metal complexes, particularly vanadium,
copper, iron, and manganese, and the like. Exemplary spin labels
include nitroxide free radicals.
[0677] B. Scanning System
[0678] With the automated detection apparatus, the correlation of
specific positional labeling is converted to the presence on the
target of sequences for which the reagents have specificity of
interaction. Thus, the positional information is directly converted
to a database indicating what sequence interactions have occurred.
For example, in a nucleic acid hybridization application, the
sequences which have interacted between the substrate matrix and
the target molecule can be directly listed from the positional
information. The detection system used is described in Ser. No.
07/649,642; and Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678).
Although the detection described therein is a fluorescence
detector, the detector may be replaced by a spectroscopic or other
detector. The scanning system may make use of a moving detector
relative to a fixed substrate, a fixed detector with a moving
substrate, or a combination. Alternatively, mirrors or other
apparatus can be used to transfer the signal directly to the
detector. See, e.g, Ser. No. 07/624,120 (U.S. Pat. No. 5,498,678),
which is hereby incorporated herein by reference.
[0679] The detection method will typically also incorporate some
signal processing to determine whether the signal at a particular
matrix position is a true positive or may be a spurious signal. For
example, a signal from a region which has actual positive signal
may tend to spread over and provide a positive signal in an
adjacent region which actually should not have one. This may occur,
e.g., where the scanning system is not properly discriminating with
sufficiently high resolution in its pixel density to separate the
two regions. Thus, the signal over the spatial region may be
evaluated pixel by pixel to determine the locations and the actual
extent of positive signal. A true positive signal should, in
theory, show a uniform signal at each pixel location. Thus,
processing by plotting number of pixels with actual signal
intensity should have a clearly uniform signal intensity. Regions
where the signal intensities show a fairly wide dispersion, may be
particularly suspect and the scanning system may be programmed to
more carefully scan those positions.
[0680] In another embodiment, as the sequence of a target is
determined at a particular location, the overlap for the sequence
would necessarily have a known sequence. Thus, the system can
compare the possibilities for the next adjacent position and look
at these in comparison with each other. Typically, only one of the
possible adjacent sequences should give a positive signal and the
system might be programmed to compare each of these possibilities
and select that one which gives a strong positive. In this way, the
system can also simultaneously provide some means of measuring the
reliability of the determination by indicating what the average
signal to background ratio actually is.
[0681] More sophisticated signal processing techniques can be
applied to the initial determination of whether a positive signal
exists or not. See, e.g., Ser. No. 07/624,120 (U.S. Pat. No.
5,498,678).
[0682] From a listing of those sequences which interact, data
analysis may be performed on a series of sequences. For example, in
a nucleic acid sequence application, each of the sequences may be
analyzed for their overlap regions and the original target sequence
may be reconstructed from the collection of specific subsequences
obtained therein. Other sorts of analyses for different
applications may also be performed, and because the scanning system
directly interfaces with a computer the information need not be
transferred manually. This provides for the ability to handle large
amounts of data with very little human intervention. This, of
course, provides significant advantages over manual manipulations.
Increased throughput and reproducibility is thereby provided by the
automation of a vast majority of steps in any of these
applications.
[0683] xi. Data Analysis
[0684] A. General
[0685] Data analysis will typically involve aligning the proper
sequences with their overlaps to determine the target sequence.
Although the target "sequence" may not specifically correspond to
any specific molecule, especially where the target sequence is
broken and fragmented in the sequencing process, the sequence
corresponds to a contiguous sequence of the subfragments.
[0686] The data analysis can be performed by a computer using an
appropriate program. See, e.g., Drmanac, R. et al. (1989) Genomics
4:114-128; and a commercially available analysis program available
from the Genetic Engineering Center, P.O. Box 794, 11000 Belgrade,
Yugoslavia. Although the specific manipulations necessary to
reassemble the target sequence from fragments may take many forms,
one embodiment uses a sorting program to sort all of the
subsequences using a defined hierarchy. The hierarchy need not
necessarily correspond to any physical hierarchy, but provides a
means to determine, in order, which subfragments have actually been
found in the target sequence. In this manner, overlaps can be
checked and found directly rather than having to search throughout
the entire set after each selection process. For example, where the
oligonucleotide probes are 10-mers, the first 9 positions can be
sorted. A particular subsequence can be selected as in the
examples, to determine where the process starts. As analogous to
the theoretical example provided above, the sorting procedure
provides the ability to immediately find the position of the
subsequence which contains the first 9 positions and can compare
whether there exists more than 1 subsequence during the first 9
positions. In fact, the computer can easily generate all of the
possible target sequences which contain given combination of
subsequences. Typically there will be only one, but in various
situations, there will be more.
[0687] An exemplary flow chart for a sequencing program is provided
in FIG. 4. In general terms, the program provides for automated
scanning of the substrate to determine the positions of probe and
target interaction. Simple processing of the intensity of the
signal may be incorporated to filter out clearly spurious signals.
The positions with positive interaction are correlated with the
sequence specificity of specific matrix positions, to generate the
set of matching subsequences. This information is further
correlated with other target sequence information, e.g.,
restriction fragment analysis. The sequences are then aligned using
overlap data, thereby leading to possible corresponding target
sequences which will, optimally, correspond to a single target
sequence.
[0688] B. Hardware
[0689] A variety of computer systems may be used to run a
sequencing program. The program may be written to provide both the
detecting and scanning steps together and will typically be
dedicated to a particular scanning apparatus. However, the
components and functional steps may be separated and the scanning
system may provide an output, e.g., through tape or an electronic
connection into a separate computer which separately runs the
sequencing analysis program. The computer may be any of a number of
machines provided by standard computer manufacturers, e.g., IBM
compatible machines, Apple.TM. machines, VAX machines, and others,
which may often use a UNIX.TM. operating system. Of course, the
hardware used to run the analysis program will typically determine
what programming language would be used.
[0690] C. Software
[0691] Software would be easily developed by a person of ordinary
skill in the programming art, following the flow chart provided, or
based upon the input provided and the desired result.
[0692] Of course, an exemplary embodiment is a polynucleotide
sequence system. However, the theoretical and mathematical
manipulations necessary for data analysis of other linear
molecules, such as polypeptides, carbohydrates, and various other
polymers are conceptually similar. Simple branching polymers will
usually also be sequencable using similar technology. However,
where there is branching, it may be desired that additional
recognition reagents be used to determine the nature and location
of branches. This can easily be provided by use of appropriate
specific reagents which would be generated by methods similar to
those used to produce specific reagents for linear polymers.
[0693] xii. Substrate Reuse
[0694] Where a substrate is made with specific reagents that are
relatively insensitive to the handling and processing steps
involved in a single cycle of use, the substrate may often be
reused. The target molecules are usually stripped off of the solid
phase specific recognition molecules. Of course, it is preferred
that the manipulations and conditions be selected as to be mild and
to not affect the substrate. For example, if a substrate is acid
labile, a neutral pH would be preferred in all handling steps.
Similar sensitivities would be carefully respected where recycling
is desired.
[0695] A. Removal of Label
[0696] Typically for a recycling, the previously attached specific
interaction would be disrupted and removed. This will typically
involve exposing the substrate to conditions under which the
interaction between probe and target is disrupted. Alternatively,
it may be exposed to conditions where the target is destroyed. For
example, where the probes are oligonucleotides and the target is a
polynucleotide, a heating and low salt wash will often be
sufficient to disrupt the interactions. Additional reagents may be
added such as detergents, and organic or inorganic solvents which
disrupt the interaction between the specific reagents and target.
In an embodiment where the specific reagents are antibodies, the
substrate may be exposed to a gentle detergent which will denature
the specific binding between the antibody and its target. The
conditions are selected to avoid severe disruption or destruction
of the structure of the antibody and to maintain the specificity of
the antibody binding site. Conditions with specific pH, detergent
concentration, salt concentration, ionic concentration, and other
parameters may be selected which disrupt the specific
interactions.
[0697] B. Storage and Preservation
[0698] As indicated above, the matrix will typically be maintained
under conditions where the matrix itself and the linkages and
specific reagents are preserved. Various specific preservatives may
be added which prevent degradation. For example, if the reagents
are acid or base labile, a neutral pH buffer will typically be
added. It is also desired to avoid destruction of the matrix by
growth of organisms which may destroy organic reagents attached
thereto. For this reason, a preservative such as cyanide or azide
may be added. However, the chemical preservative should also be
selected to preserve the chemical nature of the linkages and other
components of the substrate. Typically, a detergent may also be
included.
[0699] C. Processes to Avoid Degradation of Oligomers
[0700] In particular, a substrate comprising a large number of
oligomers will be treated in a fashion which is known to maintain
the quality and integrity of oligonucleotides. These include
storing the substrate in a carefully controlled environment under
conditions of lower temperature, cation depletion (EDTA and EGTA),
sterile conditions, and inert argon or nitrogen atmosphere.
[0701] xiii. Integrated Sequencing Strategy
[0702] A. Initial Mapping Strategy
[0703] As indicated above, although the VLSIPS.TM. technology may
be applied to sequencing embodiments, it is often useful to
integrate other concepts to simplify the sequencing. For example,
nucleic acids may be easily sequenced by careful selection of the
vectors and hosts used for amplifying and generating the specific
target sequences. For example, it may be desired to use specific
vectors which have been designed to interact most efficiently with
the VLSIPS substrate. This is also important in fingerprinting and
mapping strategies. For example, vectors may be carefully selected
having particular complementary sequences which are designed to
attach to a genetic or specific oligomer on the substrate. This is
also applicable to situations where it is desired to target
particular sequences to specific locations on the matrix.
[0704] In one embodiment, unnatural oligomers may be used to target
natural probes to specific locations on the VLSIPS substrate. In
addition, particular probes may be generated for the mapping
embodiment which are designed to have specific combinations of
characteristics. For example, the construction of a mapping
substrate may depend upon use of another automated apparatus which
takes clones isolated from a chromosome walk and attaches them
individually or in bulk to the VLSIPS substrate.
[0705] In another embodiment, a variety of specific vectors having
known and particular "targeting" sequences adjacent to the cloning
sites may be individually used to clone a selected probe, and the
isolated probe will then be targetable to a site on the VLSIPS
substrate with a sequence complementary to the "target"
sequence.
[0706] B. Selection of Smaller Clones
[0707] In the fingerprinting and mapping embodiments, the selection
of probes may be very important. Significant mathematical analysis
may be applied to determine which specific sequences should be used
as those probes. Of course, for fingerprinting use, these sequences
would be most desired that show significant heterogeneity across
the human population. Selection of the specific sequences which
would most favorably be utilized will tend to be single copy
sequences within the genome.
[0708] Various hybridization selection procedures may be applied to
select sequences which tend not to be repeated within a genome, and
thus would tend to be conserved across individuals. For example,
hybridization selections may be made for non-repetitive and single
copy sequences. See, e.g., Britten and Kohne (1968) "Repeated
Sequences in DNA," Science 161:529-540. On the other hand, it may
be desired under certain circumstances to use repeated sequences.
For example, where a fingerprint may be used to identify or
distinguish different species, or where repetitive sequences may be
diagnostic of specific species, repetitive sequences may be desired
for inclusion in the fingerprinting probes. In either case, the
sequencing capability will greatly assist in the selection of
appropriate sequences to be used as probes.
[0709] Also as indicated above, various means for constructing an
appropriate substrate may involve either mechanical or automated
procedures. The standard VLSIPS automated procedure involves
synthesizing oligonucleotides or short polymers directly on the
substrate. In various other embodiments, it is possible to attach
separately synthesized reagents onto the matrix in an ordered
array. Other circumstances may lend themselves to transfer a
pattern from a petri plate onto a solid substrate. Also, there are
methods for site specifically directing collections of reagents to
specific locations using unnatural nucleotides or equivalent sorts
of targeting molecules.
[0710] While a brute force manual transfer process may be utilized
sequentially for attaching various samples to successive positions,
instrumentation for automating such procedures may also be devised.
The automated system for performing such would preferably be
relatively easily designed and conceptually easily understood.
[0711] xiv. Commercial Applications
[0712] A. Sequencing
[0713] As indicated above, sequencing may be performed either de
novo or as a verification of another sequencing method (sequence
checking). The present hybridization technology provides the
ability to sequence nucleic acids and polynucleotides de novo, or
as a means to verify either the Maxam and Gilbert chemical
sequencing technique or Sanger and Coulson dideoxy-sequencing
techniques. The hybridization method is useful to verify sequencing
determined by any other sequencing technique and to closely compare
two similar sequences, e.g., to identify and locate sequence
differences.
[0714] Besides polynucleotide sequencing, the present invention
also provides means for sequencing other polymers. This includes
polypeptides, carbohydrates, synthetic organic polymers, and other
polymers. Again, the sequencing may be either verification or de
novo.
[0715] Of course, sequencing can be very important in many
different sorts of environments. For example, it will be useful in
determining the genetic sequence of particular markers in various
individuals. In addition, polymers may be used as markers or for
information containing molecules to encode information. For
example, a short polynucleotide sequence may be included in large
bulk production samples indicating the manufacturer, date, and
location of manufacture of a product. For example, various drugs
may be encoded with this information with a small number of
molecules in a batch. For example, a pill may have somewhere from
10 to 100 to 1,000 or more very short and small molecules encoding
this information. When necessary, this information may be decoded
from a sample of the material using a polymerase chain reaction
(PCR) or other amplification method. This encoding system may be
used to provide the origin of large bulky samples without
significantly affecting the properties of those samples. For
example, chemical samples may also be encoded by this method
thereby providing means for identifying the source and
manufacturing details of lots. The origin of bulk hydrocarbon
samples may be encoded. Production lots of organic compounds such
as benzene or plastics may be encoded with a short molecule
polymer. Food stuffs may also be encoded using similar marking
molecules. Even toxic waste samples can be encoded determining the
source or origin. In this way, proper disposal can be traced or
more easily enforced.
[0716] Similar sorts of encoding may be provided by
fingerprinting-type analysis. Whether the resolution is absolute or
less so, the concept of coding information on molecules such as
nucleic acids, which can be amplified and later decoded, may be a
very useful and important application.
[0717] This technology also provides the ability to include markers
for origins of biological materials. For example, a patented animal
line may be transformed with a particular unnatural sequence which
can be traced back to its origin. With a selection of multiple
markers, the likelihood could be negligible that a combination of
markers would have independently arisen from a source other than
the patented or specifically protected source. This technique may
provide a means for tracing the actual origin of particular
biological materials. Bacteria, plants, and animals will be subject
to marking by such encoding sequences.
[0718] B. Fingerprinting
[0719] As indicated above, fingerprinting technology may also be
used for data encryption. Moreover, fingerprinting allows for
significant identification of particular individuals. Where the
fingerprinting technology is standardized, and used for
identification of large numbers of people, related equipment and
peripheral processing will be developed to accompany the underlying
technology. For example, specific equipment may be developed for
automatically taking a biological sample and generating or
amplifying the information molecules within the sample to be used
in fingerprinting analysis. Moreover, the fingerprinting substrate
may be mass produced using particular types of automatic equipment.
Synthetic equipment may produce the entire matrix simultaneously by
stepwise synthetic methods as provided by the VLSIPS.TM.
technology. The attachment of specific probes onto a substrate may
also be automated, e.g., making use of the caged biotin technology.
See, e.g., Ser. No. 07/612,671. As indicated above, there are
automated methods for actually generating the matrix and substrate
with distinct sequence reagents positionally located at each of the
matrix positions. Where such reagents are, e.g., unnatural amino
acids, a targeting function may be utilized which does not
interfere with a natural nucleotide functionality.
[0720] In addition, peripheral processing may be important and may
be dedicated to this specific application. Thus, automated
equipment for producing the substrates may be designed, or
particular systems which take in a biological sample and output
either a computer readout or an encoded instrument, e.g., a card or
document which indicates the information and can provide that
information to others. An identification having a short magnetic
strip with a few million bits may be used to provide individual
identification and important medical information useful in a
medical emergency.
[0721] In fact, data banks may be set up to correlate all of this
information of fingerprinting with medical information. This may
allow for the determination of correlations between various medical
problems and specific DNA sequences. By collating large populations
of medical records with genetic information, genetic propensities
and genetic susceptibilities to particular medical conditions may
be developed. Moreover, with standardization of substrates, the
micro encoding data may be also standardized to reproduce the
information from a centralized data bank or on an encoding device
carried on an individual person. On the other hand, if the
fingerprinting procedure is sufficiently quick and routine, every
hospital may routinely perform a fingerprinting operation and from
that determine many important medical parameters for an
individual.
[0722] In particular industries, the VLSIPS sequencing,
fingerprinting, or mapping technology will be particularly
appropriate. As mentioned above, agricultural livestock suppliers
may be able to encode and determine whether their particular
strains are being used by others. By incorporating particular
markers into their genetic stocks, the markers will indicate origin
of genetic material. This is applicable to seed producers,
livestock producers, and other suppliers of medical or agricultural
biological materials.
[0723] This may also be useful in identifying individual animals or
plants. For example, these markers may be useful in determining
whether certain fish return to their original breeding grounds,
whether sea turtles always return to their original birthplaces, or
to determine the migration patterns and viability of populations of
particular endangered species. It would also provide means for
tracking the sources of particular animal products. For example, it
might be useful for determining the origins of controlled animal
substances such as elephant ivory or particular bird populations
whose importation or exportation is controlled.
[0724] As indicated above, polymers may be used to encode important
information on source and batch and supplier. This is described in
greater detail, e.g., "Applications of PCR to industrial problems,"
(1990) in Chemical and Engineering News 68:145, which is hereby
incorporated herein by reference. In fact, the synthetic method can
be applied to the storage of enormous amounts of information. Small
substrates may encode enormous amounts of information, and its
recovery will make use of the inherent replication capacity. For
example, on regions of 10 .mu.m.times.10 .mu.m, 1 cm.sup.2 has
10.sup.6 regions. In theory, the entire human genome could be
attached in 1000 nucleotide segments on a 3 cm.sup.2 surface.
Genomes of endangered species may be stored on these
substrates.
[0725] Fingerprinting may also be used for genetic tracing or for
identifying individuals for forensic science purposes. See, e.g.,
Morris, J. et al. (1989) "Biostatistical Evaluation of Evidence
From Continuous Allele Frequency Distribution DNA Probes in
Reference to Disputed Paternity and Identity," J. Forensic Science
34:1311-1317, and references provided therein; each of which is
hereby incorporated herein by reference.
[0726] In addition, the high resolution fingerprinting allows the
distinguishability to high resolution of particular samples. As
indicated above, new cell classifications may be defined based on
combinations of a large number of properties. Similar applications
will be found in distinguishing different species of animals or
plants. In fact, microbial identification may become dependent on
characterization of the genetic content. Tumors or other cells
exhibiting abnormal physiology will be detectable by use of the
present invention. Also, knowing the genetic fingerprint of a
microorganism may provide very useful information on how to treat
an infection by such organism.
[0727] Modifications of the fingerprint embodiments may be used to
diagnose the condition of the organism. For example, a blood sample
is presently used for diagnosing any of a number of different
physiological conditions. A multi-dimensional fingerprinting method
made available by the present invention could become a routine
means for diagnosing an enormous number of physiological features
simultaneously. This may revolutionize the practice of medicine in
providing information on an enormous number of parameters together
at one time. In another way, the genetic predisposition may also
revolutionize the practice of medicine providing a physician with
the ability to predict the likelihood of particular medical
conditions arising at any particular moment. It also provides the
ability to apply preventive medicine.
[0728] The present invention might also find application in use for
screening new drugs and new reagents which may be very important in
medical diagnosis or other applications. For example, a description
of generating a population of monoclonal antibodies with defined
specificities may be very useful for producing various drugs or
diagnostic reagents.
[0729] Also available are kits with the reagents useful for
performing sequencing, fingerprinting, and mapping procedures. The
kits will have various compartments with the desired necessary
reagents, e.g., substrate, labeling reagents for target samples,
buffers, and other useful accompanying products.
[0730] C. Mapping
[0731] The present invention also provides the means for mapping
sequences within enormous stretches of sequence. For example,
nucleotide sequences may be mapped within enormous chromosome size
sequence maps. For example, it would be possible to map a
chromosomal location within the chromosome which contains hundreds
of millions of nucleotide base pairs. In addition, the mapping and
fingerprinting embodiments allow for testing of chromosomal
translocations, one of the standard problems for which
amniocentesis is performed.
[0732] Thus, the present invention provides a powerful tool and the
means for performing sequencing, fingerprinting, and mapping
functions on polymers. Although most easily and directly applicable
to polynucleotides, polypeptides, carbohydrates, and other sorts of
molecules can be advantageously utilized using the present
technology.
[0733] XII. Additional Particular Implementations
[0734] This section describes additional particular implmentations
of the above-described methodologies. A reagent-dispensing device
may be useful in practicing the method. The device generally
includes a reagent dispenser having an elongate open capillary
channel adapted to hold a quantity of the reagent solution as will
be described below. The capillary channel is formed by a pair of
spaced-apart, coextensive, elongate members which are tapered
toward one another and converge at a tip or tip region at the lower
end of the channel. More generally, the open channel is formed by
at least two elongate, spaced-apart members adapted to hold a
quantity of reagent solutions and having a tip region at which
aqueous solution in the channel forms a meniscus, such as the
concave meniscus The advantages of the open channel construction of
the dispenser are discussed below.
[0735] The dispenser device also includes structure for moving the
dispenser rapidly toward and away from a support surface, for
effecting deposition of a known amount of solution in the dispenser
on a support. This structure includes a solenoid which is
activatable to draw a solenoid piston rapidly downwardly, then
release the piston, e.g., under spring bias, to a normal, raised
position, as shown. The dispenser is carried by a piston.. The
just-described moving structure is also referred to herein as
dispensing means for moving the dispenser into engagement with a
solid support, for dispensing a known volume of fluid on the
support.
[0736] The dispensing device just described is carried on an arm
that may be moved either linearly or in an x-y plane to position
the dispenser at a selected deposition position, as will be
described. The support is a polymer, glass, or other solid-material
support having a surface.
[0737] In one general embodiment, the surface is a relatively
hydrophilic, i.e., wettable surface, such as a surface having
native, bound or covalently attached charged groups. On such
surface described below is a glass surface having an absorbed layer
of a polycationic polymer, such as poly-1-lysine.
[0738] In another embodiment, the surface has or is formed to have
a relatively hydrophobic character, i.e., one that causes aqueous
medium deposited on the surface to bead. A variety of known
hydrophobic polymers, such as polystyrene, polypropylene, or
polyethylene have desired hydrophobic properties, as do glass and a
variety of lubricant or other hydrophobic films that may be applied
to the support surface.
[0739] Initially, the dispenser is loaded with a selected
analyte-specific reagent solution, such as by dipping the dispenser
tip, after washing, into a solution of the reagent, and allowing
filling by capillary flow into the dispenser channel. The dispenser
is now moved to a selected position with respect to a support
surface, placing the dispenser tip directly above the
support-surface position at which the reagent is to be deposited.
This movement takes place with the dispenser tip in its raised
position where the tip is typically at least several 1-5 mm above
the surface of the substrate.
[0740] With the dispenser so positioned, the solenoid is now
activated to cause the dispenser tip to move rapidly toward and
away from the substrate surface, making momentary contact with the
surface in effect, tapping the tip of the dispenser against the
support surface. The tapping movement of the tip against the
surface acts to break the liquid meniscus in the tip channel,
bringing the liquid in the tip into contact with the support
surface. This, in turn, produces a flowing of the liquid into the
capillary space between the tip and the surface, acting to draw
liquid out of the dispenser channel.
[0741] The fluid from the tip flows onto the support surface, which
in this case is a hydrophobic surface. The figure illustrates that
liquid continues to flow from the dispenser onto the support
surface until it forms a liquid bead. At a given bead size, i.e.,
volume, the tendency of liquid to flow onto the surface will be
balanced by the hydrophobic surface interaction of the bead with
the support surface, which acts to limit the total bead area on the
surface, and by the surface tension of the droplet, which tends
toward a given bead curvature. At this point, a given bead volume
will have formed, and continued contact of the dispenser tip with
the bead, as the dispenser tip is being withdrawn, will have little
or no effect on bead volume.
[0742] For liquid-dispensing on a more hydrophilic surface, the
liquid will have less of a tendency to bead, and the dispensed
volume will be more sensitive to the total dwell time of the
dispenser tip in the immediate vicinity of the support surface
[0743] The desired deposition volume, i.e., bead volume, formed by
this method is preferably in the range 2 pl (picoliters) to 2 nl
(nanoliters), although volumes as high as 100 nl or more may be
dispensed. It will be appreciated that the selected dispensed
volume will depend on (i) the "footprint" of the dispenser tip,
i.e., the size of the area spanned by the tip, (ii) the
hydrophobicity of the support surface, and (iii) the time of
contact with and rate of withdrawal of the tip from the support
surface. In addition, bead size may be reduced by increasing the
viscosity of the medium, effectively reducing the flow time of
liquid from the dispenser onto the support surface. The drop size
may be further constrained by depositing the drop in a hydrophobic
region surrounded by a hydrophobic grid pattern on the support
surface.
[0744] In a typical embodiment, the dispenser tip is tapped rapidly
against the support surface, with a total residence time in contact
with the support of less than about 1 msec, and a rate of upward
travel from the surface of about 10 cm/sec.
[0745] Assuming that the bead that forms on contact with the
surface is a hemispherical bead, with a diameter approximately
equal to the width of the dispenser tip the volume of the bead
formed in relation to dispenser tip width is given in the Table
below. As seen, the volume of the bead ranges between 2 pl to 2 nl
as the width size is increased from about 20 to 200 .mu.m.
6 TABLE d Volume (Ul) 20 .mu.m 2 .times. 10 - 1 50 .mu.m 3.1
.times. 104 100 .mu.m 2.5 .times. 10 - 1 200 .mu.m 2
[0746] At a given tip size, bead volume can be reduced in a
controlled fashion by increasing surface hydrophobicity, reducing
time of contact of the tip with the surface, increasing rate of
movement of the tip away from the surface, and/or increasing the
viscosity of the medium. Once these parameters are fixed, a
selected deposition volume in the desired pl to nl range can be
achieved in a repeatable fashion.
[0747] After depositing a bead at one selected location on a
support, the tip is typically moved to a corresponding position on
a second support, a droplet is deposited at that position, and this
process is repeated until a liquid droplet of the reagent has been
deposited at a selected position on each of a plurality of
supports.
[0748] The tip is then washed to remove the reagent liquid, filled
with another reagent liquid and this reagent is now deposited at
each another array position on each of the supports. In one
embodiment, the tip is washed and refilled by the steps of (i)
dipping the capillary channel of the device in a wash solution,
(ii) removing wash solution drawn into the capillary channel, and
(iii) dipping the capillary channel into the new reagent
solution.
[0749] From the foregoing, it will be appreciated that the
tweezers-like, open-capillary dispenser tip provides the advantages
that (i) the open channel of the tip facilitates rapid, efficient
washing and drying before reloading the tip with a new reagent,
(ii) passive capillary action can load the sample directly from a
standard microwell plate while retaining sufficient sample in the
open capillary reservoir for the printing of numerous arrays, (iii)
open capillaries are less prone to clogging than closed
capillaries, and (iv) open capillaries do not require a perfectly
faced bottom surface for fluid delivery.
[0750] The array is formed of a plurality of analyte-specific
reagent regions where each region may include a different
analyte-specific reagent. As indicated above, the diameter of each
region is preferably between about 20-200 .mu.m. The spacing
between each region and its closest (non-diagonal) neighbor,
measured from center-to-center, is preferably in the range of about
20-400 .mu.m. Thus, for example, an array having a center-to-center
spacing of about 250 .mu.m contains about 40 regions/cm or 1,600
regions/cm.sup.2. After formation of the array, the support is
treated to evaporate the liquid of the droplet forming each region,
to leave a desired array of dried, relatively flat regions. This
drying may be done by heating or under vacuum.
[0751] In some cases, it is desired to first rehydrate the droplets
containing the analyte reagents to allow for more time for
adsorption to the solid support. It is also possible to spot out
the analyte reagents in a humid environment so that droplets do not
dry until the arraying operation is complete.
[0752] In another aspect, the invention includes an automated
apparatus for forming an array of analyte-assay regions on a solid
support, where each region in the array has a known amount of a
selected, analytespecific reagent. A dispenser device in the
apparatus has the basic construction described above and includes a
dispenser having an open-capillary channel terminating at a
tip.
[0753] The dispenser is mounted in the device for movement toward
and away from a dispensing position at which the tip of the
dispenser taps a support surface, to dispense a selected volume of
reagent solution, as described above. This movement is effected by
a solenoid as described above. The solenoid is under the control of
a control unit whose operation will be described below. The
solenoid is also referred to herein as dispensing means for moving
the device into tapping engagement with a support, when the device
is positioned at a defined array position with respect to that
support.
[0754] The dispenser device is carried on an arm which is
threadedly mounted on a worm screw driven (rotated) in a desired
direction by a stepper motor also under the control of unit. At its
left end in the figure screw is carried in a sleeve for rotation
about the screw axis. At its other end, the screw is mounted to the
drive shaft of the stepper motor, which in turn is carried on a
sleeve. The dispenser device, worm screw, the two sleeves mounting
the worm screw, and the stepper motor used in moving the device in
the "x" (horizontal) direction is referred to here collectively as
a displacement assembly.
[0755] The displacement assembly is constructed to produce precise,
micro-range movement in the direction of the screw, i.e., along an
x axis in the figure. In one mode, the assembly functions to move
the dispenser in x-axis increments having a selected distance in
the range 5-25 .mu.m. In another mode, the dispenser unit may be
moved in precise x-axis increments of several microns or more, for
positioning the dispenser at associated positions on adjacent
supports, as will be described below.
[0756] The displacement assembly, in turn, is mounted for movement
in the "y" (vertical) axis of the figure, for positioning the
dispenser at a selected y axis position. The structure mounting the
assembly includes a fixed rod 88 mounted rigidly between a pair of
frame bars and a worm screw mounted for rotation between a pair of
frame bars. The worm screw is driven (rotated) by a stepper motor
which operates under the control of unit. The motor is mounted on a
bar.
[0757] The structure just described, including the worm screw and
motor is constructed to produce precise, micro-range movement in
the direction of the screw, i e., along an y axis in the figure. As
above, the structure functions in one mode to move the dispenser in
y-axis increments having a selected distance in the range 5-250
.mu.m, and in a second mode, to move the dispenser in precise
y-axis increments of several microns (.mu.m) or more, for
positioning the dispenser at associated positions on adjacent
supports.
[0758] The displacement assembly and structure for moving this
assembly in the y axis are referred to herein collectively as
positioning means for positioning the dispensing device at a
selected array position with respect to a support.
[0759] A holder in the apparatus functions to hold a plurality of
supports, such as supports on which the microarrays of regent
regions are to be formed by the apparatus. The holder provides a
number of recessed slots which receive the supports, and position
them at precise selected positions with respect to the frame bars
on which the dispenser moving means is mounted.
[0760] As noted above, the control unit in the device functions to
actuate the two stepper motors and dispenser solenoid in a sequence
designed for automated operation of the apparatus in forming a
selected microarray of reagent regions on each of a plurality of
supports.
[0761] The control unit is constructed, according to conventional
microprocessor control principles, to provide appropriate signals
to each of the solenoid and each of the stepper motors, in a given
timed sequence and for appropriate signalling time. The
construction of the unit, and the settings that are selected by the
user to achieve a desired array patterns will be understood from
the following description of a typical apparatus operation.
[0762] Initially, one or more supports are placed in one or more
slots in the holder. The dispenser is then moved to a position
directly above a well (not shown) containing a solution of the
first reagent to be dispensed on the support(s). The dispenser
solenoid is actuated now to lower the dispenser tip into this well,
causing the capillary channel in the dispenser to fill. Motors are
now actuated to position the dispenser at a selected array position
at the first of the supports. Solenoid actuation of the dispenser
is then effective to dispense a selected-volume droplet of that
reagent at this location. As noted above, this operation is
effective to dispense a selected volume preferably between 2 pl and
2 nl of the reagent solution.
[0763] The dispenser is now moved to the corresponding position at
an adjacent support and a similar volume of the solution is
dispensed at this position. The process is repeated until the
reagent has been dispensed at this preselected corresponding
position on each of the supports.
[0764] Where it is desired to dispense a single reagent at more
than two array positions on a support, the dispenser may be moved
to different array positions at each support, before moving the
dispenser to a new support, or solution can be dispensed at
individual positions on each support, at one selected position,
then the cycle repeated for each new array position.
[0765] To dispense the next reagent, the dispenser is positioned
over a wash solution (not shown), and the dispenser tip is dipped
in and out of this solution until the reagent solution has been
substantially washed from the tip. Solution can be removed from the
tip, after each dipping, by vacuum, compressed air spray, sponge,
or the like.
[0766] The dispenser tip is now dipped in a second reagent well,
and the filled tip is moved to a second selected array position in
the first support. The process of dispensing reagent at each of tho
corresponding second-array positions is then carried as above. This
process is repeated until an entire microarray of reagent solutions
on each of the supports has been formed.
[0767] A. Microarray Substrate
[0768] This section describes embodiments of a substrate having a
microarray of biological polymers carried on the substrate surface.
Subsection A describes a multi cell substrate, each cell of which
contains a microarray, and preferably an identical microarray, of
distinct biopolymers, such as distinct polynucleotides, formed on a
porous surface. Subsection B describes a microarray of distinct
polynucleotides bound on a glass slide coated with a polycationic
polymer.
[0769] 1. Multi-Cell Substrate
[0770] The substrate in one embodiment has an 8.times.12
rectangular array of cells formed on the substrate surface. Each
cell in turn supports a microarray of distinct biopolymers, such as
polypeptides or polynucleotides at known, addressable regions of
the microarray. The 96-cell array shown in has typically array
dimensions between about 12 and 244 mm in width and 8 and 400 im in
length, with the cells in the array having width and length
dimension of {fraction (1/12)} and 1/8 the array width and length
dimensions, respectively, i.e., between about 1 and 20 in width and
1 and 50 mm in length. The substrate includes a water-impermeable
backing, such as a glass slide or rigid polymer sheet. Formed on
the surface of the backing is a water-permeable film. The film is
formed of a porous membrane material, such as nitrocellulose
membrane, or a porous web material, such as a nylon, polypropylene,
or PVDF porous polymer material. The thickness of the film is
preferably between about 10 and 1000 .mu.m. The film may be applied
to the backing by spraying or coating uncured material on the
backing, or by applying a preformed membrane to the backing. The
backing and film may be obtained as a preformed unit from
commercial source, e.g., a plastic-backed nitrocellulose film
available from Schleicher and Schuell Corporation.
[0771] The film-covered surface in the substrate is partitioned
into a desired array of cells by water-impermeable grid lines which
have infiltrated the film down to the level of the backing, and
extend above the surface of the film as shown, typically a distance
of 100 to 2000 .mu.m above the film surface.
[0772] The grid lines are formed on the substrate by laying down an
uncured or otherwise flowable resin or elastomer solution in an
array grid, allowing the material to infiltrate the porous film
down to the backing, then curing or otherwise hardening the grid
lines to form the cell-array substrate.
[0773] One preferred material for the grid is a flowable silicone
available from Loctite Corporation. The barrier material can be
extruded through a narrow syringe e.g., 22 gauge) using air
pressure or mechanical pressure. The syringe is moved relative to
the solid support to print the barrier elements as a grid pattern.
The extruded bead of silicone wicks into the pores of the solid
support and cures to form a shallow waterproof barrier separating
the regions of the solid support.
[0774] In alternative embodiments, the barrier element can be a
wax-based material or a thermoset material such as epoxy. The
barrier material can also be a UV-curing polymer which is exposed
to UV light after being printed onto the solid support. The barrier
material may also be applied to the solid support using printing
techniques such as silk-screen printing. The barrier material may
also be a heat-seal stamping of the porous solid support which
seals its pores and forms a water-impervious barrier element. The
barrier material may also be a shallow grid which is laminated or
otherwise adhered to the solid support.
[0775] In addition to plastic-backed nitrocellulose, the solid
support can be virtually any porous membrane with or without a
non-porous backing. Such membranes are readily available from
numerous vendors and are made from nylon, PVDF, polysulfone and the
like. In an alternative embodiment, the barrier element may also be
used to adhere the porous membrane to a non-porous backing in
addition to functioning as a barrier to prevent cross contamination
of the assay reagents.
[0776] In an alternative embodiment, the solid support can be of a
non-porous material. The barrier can be printed either before or
after the microarray of biomolecules is printed on the solid
support.
[0777] As can be appreciated, the cells formed by the grid lines
and the underlying backing are water-impermeable, having side
barriers projecting above the porous film in the calls. Thus,
defined-volume samples can be placed in each well without risk of
cross-contamination with sample material in adjacent cells.
[0778] As noted above, each well contains a microarray of distinct
biopolymers. In one general embodiment, the microarrays in the well
are identical arrays of distinct biopolymers, e.g., different
sequence polynucleotides. Such arrays can be formed in accordance
with the methods described in Section II, by depositing a first
selected polynucleotide at the same selected microarray position in
each of the cells, then depositing a second polynucleotide at a
different microarray position in each well, and so on until a
complete, identical microarray is formed in each cell.
[0779] In a preferred embodiment, each microarray contains about
10.sup.3 distinct polynucleotide or polypeptide biopolymers per
surface area of less than about 1 cm.sup.2. Also in a preferred
embodiment, the biopolymers in each microarray region are present
in a defined amount between about 0.1 femtomoles and 100
nanomoles.
[0780] Also in a preferred embodiments, the biopolymers are
polynucleotides having lengths of at least about 50 bp, ie.,
substantially longer than oligonucleotides which can be formed in
high-density arrays by schemes involving parallel, step-wise
polymer synthesis on the array surface.
[0781] In the case of a polynucleotide array, in an assay
procedure, a small volume of the labeled DNA probe mixture in a
standard hybridization solution is loaded onto each cell. The
solution will spread to cover the entire microarray and stop at the
barrier elements. The solid support is then incubated in a humid
chamber at the appropriate temperature as required by the
assay.
[0782] Each assay may be conducted in an "open-face" format where
no further sealing step is required, since the hybridization
solution will be kept properly hydrated by the water vapor in the
humid chamber. At the conclusion of the incubation step, the entire
solid support containing the numerous microarrays is rinsed quickly
enough to dilute the assay reagents so that no significant cross
contamination occurs. The entire solid support is then reacted with
detection reagents if needed and arralyzed using standard
colorimetric, radioactive or fluorescent detection means. All
processing and detection steps are performed simultaneously to all
of the microarrays on the solid support ensuring uniform assay
conditions for all of the microarrays on the solid support.
[0783] 2. Glass-Slide Polynucleotide Array
[0784] The substrate includes a glass substrate having formed on
its surface, a coating of a polycationic polymer, preferably a
cationic polypeptide, such as polylysine or polyarginine. Formed on
the polycationic coating is a microarray of distinct
polynucleotides, each localized at known selected array regions,
such as regions.
[0785] The slide is coated by placing a uniform-thickness film of a
polycationic polymer, e.g., poly-1-lysine, on the surface of a
slide and drying the film to form a dried coating. The amount of
polycationic polymer added is sufficient to form at least a
monolayer of polymers on the glass surface. The polymer film is
bound to surface via electrostatic binding between negative
silyl-OH groups on the surface and charged amine groups in the
polymers. Poly-1-lysine coated glass slides may be obtained
commercially, e.g., from Sigma Chemical Co. (St. Louis, Mo.).
[0786] To form the microarray, defined volumes of distinct
polynucleotides are deposited on the polymercoated slide. According
to an important feature of the substrate, the deposited
polynucleotides remain bound to the coated slide surface
non-covalently when an aqueous DNA sample is applied to the
substrate under conditions which allow hybridization of
reporter-labeled polynucleotides in the sample to
complementary-sequence (single-stranded) polynucleotides in the
substrate array.
[0787] To illustrate this feature, a substrate of the type just
described, but having an array of same-sequence polynucleotides,
was mixed with fluorescent-labeled complementary DNA under
hybridization conditions. After washing to remove non-hybridized
material, the substrate was examined by low-power fluorescence
microscopy. The array can be visualized by the relatively uniform
labeling pattern of the array regions.
[0788] In a preferred embodiment, each microarray contains at least
103 distinct polynucleotide or polypeptide biopolymers per surface
area of less than about 1 cm.sup.2. In one embodiment, the
microarray contains 400 regions in an area of about 16 mm.sup.2, or
2.5.times.10.sup.3 regions/cm.sup.2. Also in a preferred
embodiment, the polynucleotides in the each microarray region are
present in a defined amount between about 0.1 femtomoles and 100
nanomoles in the case of polynucleotides. Also in a preferred
embodiments, the polynucleotides have lengths of at least about 50
bp, ie., substantially longer than oligonucleotides which can be
formed in high-density arrays by various in situ synthesis
schemes.
[0789] B. Utility
[0790] Microarrays of immobilized nucleic acid sequences prepared
in accordance with the invention can be used for large scale
hybridization assays in numerous genetic applications, including
genetic and physical napping of genomes, monitoring of gene
expression, DNA sequencing, genetic diagnosis, genotyping of
organisms, and distribution of DNA reagents to researchers.
[0791] For gene mapping, a gene or a cloned DNA fragment is
hybridized to an ordered array of DNA fragments, and the identity
of the DNA elements applied to the array is unambiguously
established by the pixel or pattern of pixels of the array that are
detected. One application of such arrays for creating a genetic map
is described by Nelson, et al. (1993). In constructing physical
maps of the genome, arrays of immobilized cloned DNA fragments are
hybridized with other cloned DNA fragments to establish whether the
cloned fragments in the probe mixture overlap and are therefore
contiguous to the immobilized clones on the array. For example,
Lahrach, et al., describe such a process.
[0792] The arrays of immobilized DNA fragments may also be used for
genetic diagnostics. To illustrate, an array containing multiple
forms of a mutated gene or genes can be probed with a labeled
mixture of a patient's DNA which will preferentially interact with
only one of the immobilized versions of the gene.
[0793] The detection of this interaction can lead to a medical
diagnosis. Arrays of immobilized DNA fragments can also be used in
DNA probe diagnostics. For example, the identity of a pathogenic
microorganism can be established unambiguously by hybridizing a
sample of the unknown pathogen's DNA to an array containing many
types of known pathogenic DNA. A similar technique can also be used
for unambiguous genotyping of any organism. Other molecules of
genetic interest, such as cDNA's and RNA's can be immobilized on
the array or alternately used as the labeled probe mixture that is
applied to the array.
[0794] In one application, an array of cDNA clones representing
genes is hybridized with total cDNA from an organism to monitor
gene expression for research or diagnostic purposes. Labeling total
cDNA from a normal cell with one color fluorophore and total cDNA
from a diseased cell with another color fluorophore and
simultaneously hybridizing the two cDNA samples to the same array
of cDNA clones allows for differential gene expression to be
measured as the ratio of the two fluorophore intensities. This
two-color experiment can be used to monitor gene expression in
different tissue types, disease states, response to drugs, or
response to environmental factors.
[0795] By way of example and without implying a limitation of
scope, such a procedure could be used to simultaneously screen many
patients against all known mutations in a disease gene. This
invention could be used in the form of, for example, 96 identical
0.9 cm.times.2.2 cm microarrays fabricated on a single 12
cm.times.18 cm sheet of plastic-backed nitrocellulose where each
microarray could contain, for example, 100 DNA fragments
representing all known mutations of a given gene. The region of
interest from each of the DNA samples from 96 patients could be
amplified, labeled, and hybridized to the 96 individual arrays with
each assay performed in 100 microliters of hybridization solution.
The approximately 1" thick silicone rubber barrier elements between
individual arrays prevent cross contamination of the patient
samples by sealing the pores of the nitrocellulose and by acting as
a physical barrier between each microarray. The solid support
containing all 96 microarrays assayed with the 96 patient samples
is incubated, rinsed, detected and analyzed as a single sheet of
material using standard radioactive, fluorescent, or colorimetric
detection means (Maniatas, et al., 1989). Previously, such a
procedure would involve the handling, processing and tracking of 96
separate membranes in 96 separate sealed chambers. By processing
all 96 arrays as a single sheet of material, significant time and
cost savings are possible.
[0796] The assay format can be reversed where the patient or
organism's DNA is immobilized as the array elements and each array
is hybridized with a different mutated allele or genetic marker.
The gridded solid support can also be used for parallel non-DNA
ELISA assays. Furthermore, the invention allows for the use of all
standard detection methods without the need to remove the shallow
barrier elements to carry out the detection step.
[0797] In addition to the genetic applications listed above, arrays
of whole cells, peptides, enzymes, antibodies, antigens, receptors,
ligands, phospholipids, polymers, drug cogener preparations or
chemical substances can be fabricated by the means described in
this invention for large scale screening assays in medical
diagnostics, drug discovery, molecular biology, immunology and
toxicology.
[0798] The multi-cell substrate aspect of the invention allows for
the rapid and convenient screening of many DNA probes against many
ordered arrays of DNA fragments. This eliminates the need to handle
and detect many individual arrays for performing mass screenings
for genetic research and diagnostic applications. Numerous
microarrays can be fabricated on the same solid support and each
microarray reacted with a different DNA probe while the solid
support is processed as a single sheet of material.
EXAMPLES
[0799] The following examples are offered to illustrate, but not to
limit the present invention.
Example 1
First Generation Oligonucleotide Arrays Designed to Measure mRNA
Levels for a Small Number of Murine Cytokines
[0800] A. Preparation of Labeled RNA
[0801] 1. From Each of the Preselected Genes
[0802] Fourteen genes (IL-2, IL-3, Il-4, IL-6, Il-10, IL-12p40,
GM-CSF, IFN-.gamma., TNF-.alpha., CTLA8, .beta.-actin, GAPDH, IL-11
receptor, and Bio B) were each cloned into the p Bluescript II KS
(+) phagemid (Stratagene, La Jolla, Calif., USA). The orientation
of the insert was such that T3 RNA polymerase gave sense
transcripts and T7 polymerase gave antisense RNA.
[0803] Labeled ribonucleotides in an in vitro transcription (IVT)
reaction. Either biotin- or fluorescein-labeled UTP and CTP (1:3
labeled to unlabeled) plus unlabeled ATP and GTP were used for the
reaction with 2500 units of T7 RNA polymerase (Epicentre
Technologies, Madison, Wis., USA). In vitro transcription was done
with cut templates in a manner like that described by Melton et
al., Nucleic Acids Research, 12: 7035-7056 (1984). A typical in
vitro transcription reaction used 5 .mu.g DNA template, a buffer
such as that included in Ambion's Maxiscript in vitro Transcription
Kit (Ambion Inc., Huston, Tex., USA) and GTP (3 mM), ATP (1.5 mM),
and CTP and fluoresceinated UTP (3 mM total, UTP: F1-UTP 3:1) or
UTP and fluoresceinated CTP (2 mM total, CTP: F1-CTP, 3:1).
Reactions done in the Ambion buffer had 20 mM DTT and RNase
inhibitor. The reaction was run from 1.5 to about 8 hours.
[0804] Following the reaction, unincorporated nucleotide
triphosphates were removed using a size-selective membrane
(microcon-100) or Pharmacia microspin S-200 column. The total molar
concentration of RNA was based on a measurement of the absorbance
at 260 nm. Following quantitation of RNA amounts, RNA was
fragmented randomly to an average length of approximately 50-100
bases by heating at 94.degree. C. in 40 mM Tris-acetate pH 8.1, 100
mM potassium acetate, 30 mM magnesium acetate for 30-40 minutes.
Fragmentation reduces possible interference from RNA secondary
structure, and minimizes the effects of multiple interactions with
closely spaced probe molecules.
[0805] 2. From cDNA Libraries
[0806] Labeled RNA was produced from one of two murine cell lines;
T10, a B cell plasmacytoma which was known not to express the genes
(except IL-10, actin and GAPDH) used as target genes in this study,
and 2D6, an IL-12 growth dependent T cell line (Th.sub.1 subtype)
that is known to express most of the genes used as target genes in
this study. Thus, RNA derived from the T10 cell line provided a
good total RNA baseline mixture suitable for spiking with known
quantities of RNA from the particular target genes. In contrast,
mRNA derived from the 2D6 cell line provided a good positive
control providing typical endogenously transcribed amounts of the
RNA from the target genes.
[0807] a) The T10 Murine B Cell Line.
[0808] The T10 cell line (B cells) was derived from the IL-6
dependent murine plasmacytoma line T1165 (Nordan et al. (1986)
Science 233: 566-569) by selection in the presence of IL-11. To
prepare the directional cDNA library, total cellular RNA was
isolated from T10 cells using RNAStat60 (Tel-Test B), and poly
(A).sup.+ RNA was selected using the PolyAtract kit (Promega,
Madison, Wis., USA). First and second strand cDNA was synthesized
according to Toole et al., (1984) Nature, 312: 342-347, except that
5-methyldeoxycytidine 5'-triphosphate (Pharmacia LKB, Piscataway,
N.J., USA) was substituted for DCTP in both reactions.
[0809] To determine cDNA frequencies T10 libraries were plated, and
DNA was transfered to nitrocellulose filters and probed with
.sup.32P-labeled .beta.-actin, GAPDH and IL-10 probes. Actin was
represented at a frequency of 1:3000, GAPDH at 1;1000, and IL-10 at
1:35,000. Labeled sense and antisense T10 RNA samples were
synthesized from NotI and SfiI cut CDNA libraries in in vitro
transcription reactions as described above.
[0810] b) The 2D6 Murine Helper T Cells Line.
[0811] The 2D6 cell line is a murine IL-12 dependent T cell line
developed by Fujiwara et al. Cells were cultured in RPMI 1640
medium with 10% heat inactivated fetal calf serum (JRH
Biosciences), 0.05 mM P-mercaptoethanol and recombinant murine
IL-12 (100 units/mL, Genetics Institute, Cambridge, Mass., USA).
For cytokine induction, cells were preincubated overnight in IL-12
free medium and then resuspended (10.sup.6 cells/ml). After
incubation for 0, 2, 6 and 24 hours in media containing 5 nM
calcium ionophore A23187 (Sigma Chemical Co., St. Louis Mo., USA)
and 100 nM 4-phorbol-12-myristate 13-acetate (Sigma), cells were
collected by centrifugation and washed once with phosphate buffered
saline prior to isolation of RNA.
[0812] Labeled 2D6 mRNA was produced by directionally cloning the
2D6 cDNA with .alpha.ZipLox, NotI-SalI arms available from GibcoBRL
in a manner similar to T10. The linearized pZl1 library was
transcribed with T7 to generate sense RNA as described above.
[0813] c) RNA Preparation.
[0814] For material made directly from cellular RNA, cytoplasmic
RNA was extracted from cells by the method of Favaloro et al.,
(1980) Meth. Enzym., 65: 718-749, and poly (A).sup.+ RNA was
isolated with an oligo dT selection step (PolyAtract, Promega,).
RNA was amplified using a modification of the procedure described
by Eberwine et al. (1992) Proc. Natl. Acad. Sci. USA, 89: 3010-3014
(see also Van Gelder et al. (1990) Science 87: 1663-1667). One
microgram of poly (A)+ RNA was converted into double-stranded cDNA
using a cDNA synthesis kit (Life Technologies) with an oligo dT
prime incorporating a T7 RNA polymerase promoter site. After second
strand synthesis, the reaction mixture was extracted with
phenol/chloroform and the double-stranded DNA isolated using a
membrane filtration step (Mircocon-100, Amicon, Inc. Beverly,
Mass., USA). Labeled cRNA was made directly from the cDNA pool with
an IVT step as described above. The total molar concentration of
labeled CRNA was determined from the absorbance at 260 and assuming
an average RNA size of 1000 ribonucleotides. RNA concentration was
calculated using the conventional conversion that 1 OD is
equivalent to 40 .mu.g of RNA, and that 1 .mu.g of cellular mRNA
consists of 3 pmoles of RNA molecules.
[0815] Cellular mRNA was also labeled directly without any
intermediate cDNA or RNA synthesis steps. Poly (A).sup.+ RNA was
fragmented as described above, and the 5' ends of the fragments
were kinased and then incubated ovenight with a biotinylated
oligoribonucleotide (5'-biotin-AAAAAA-3') in the presence of T4 RNA
ligase (Epicentre Technologies). Alternatively, mRNA was labeled
directly by UV-induced crosslinking to a psoralen derivative linked
to biotin (Schleicher & Schuell).
[0816] B. High Density Array Preparation
[0817] A high density array of 20 mer oligonucleotide probes was
produced using VLSIPS technology. The high density array included
the oligonucleotide probes as listed in Table 2. A central mismatch
control probe was provided for each gene-specific probe resulting
in a high density array containing over 16,000 different
oligonucleotide probes.
7TABLE 2 High density array design. For every probe there was also
a mismatch control having a central 1 base mismatch. Probe Type
Target Nucleic Acid Number of Probes Test Probes: IL-2 691 IL-3 751
IL-4 361 IL-6 691 IL-10 481 IL-12p40 911 GM-CSF 661 IFN-.gamma. 991
TNF-.alpha. 641 mCTLA8 391 IL-11 receptor 158 House Keeping Genes:
GAPDH 388 .beta.-actin 669 Bacterial gene (sample Bio B 286
preparation/amplification control) The high density array was
synthesized on a planar glass slide.
[0818] C. Array Hybridization and Scanning
[0819] The RNA transcribed from cDNA was hybridized to the high
density oligonucleotide probe array(s) at low stringency and then
washed under more stringent conditions. The hybridization solutions
contained 0.9 M NaCl, 60 mM NaH.sub.2PO.sub.4, 6 mM EDTA and 0.005%
Triton X-100 , adjusted to pH 7.6 (referred to as 6.times.SSPE-T).
In addition, the solutions contained 0.5 mg/ml unlabeled, degraded
herring sperm DNA (Sigma Chemical Co., St. Louis, Mo., USA). Prior
to hybridization, RNA samples were heated in the hybridization
solution to 9" C. for 10 minutes, placed on ice for 5 minutes, and
allowed to equilibrate at room temperature before being placed in
the hybridization flow cell, Following hybridization, the solution
was removed, the arrays were washed with 6.times.SSPE-T at
22.degree. C. for 7 minutes, and then washed with 0.5.times.SSPE-T
at 40.degree. C. for 15 minutes. When biotin-labeled RNA was used,
the hybridized RNA was stained with a streptavidin-phycoerythri- n
conjugate (Molecular Probes, Inc., Eugene, Oreg., USA) prior to
reading. Hybridized arrays were stained with 2 .mu.g/ml
streptavidinphycoerythrin in 6.times.SSPE-T at 40.degree. C. for 5
minutes.
[0820] The arrays were read using scanning confocal microscope
(Molecular Dynamics, Sunnyvale, Calif., USA) modified for the
purpose. The scanner uses an argon ion laser as the excitation
source, and the emission was detected with a photomultiplier tube
through either a 530 nm bandpass filter (fluorescein) or a 560 nm
longpass filter (phycoerythrin).
[0821] Nucleic acids of either sense or antisense orientations were
used in hybridization experiments. Arrays with for either
orientation (reverse complements of each other) were made using the
same set of photolithographic masks by reversing the order of the
photochemical steps and incorporating the complementary
nucleotide.
[0822] D. Quantitative Analysis of Hybridization Patterns and
Intensities
[0823] The quantitative analysis of the hybridization results
involved counting the instances in which the perfect match probe
(PM) was brighter than the corresponding mismatch probe (MM),
averaging the differences (PM minus MM) for each probe family
(i.e., probe collection for each gene), and comparing the values to
those obtained in a side-by-side experiment on an identically
synthesized array with an unspiked sample (if applicable). The
advantage of the difference method is that signals from random
cross hybridization contribute equally, on average, to the PM and
MM probes while specific hybridization contributes more to the PM
probes. By averaging the pairwise differences, the real signals add
constructively while the contributions from cross hybridization
tend to cancel.
[0824] The magnitude of the changes in the average of the
difference (PM-MM) values was interpreted by comparison with the
results of spiking experiments as well as the signal observed for
the internal standard bacterial RNA spiked into each sample at a
known amount. Analysis was performed using algorithms and software
described herein.
[0825] E. Optimization of Probe Selection
[0826] In order to optimize probe selection for each of the target
genes, the high density array of oligonucleotide probes was
hybridized with the mixture of labeled RNAs transcribed from each
of the target genes. Fluorescence intensity at each location on the
high density array was determined by scanning the high density
array with a laser illuminated scanning confocal fluorescence
microscope connected to a data acquisition system.
[0827] Probes were then selected for further data analysis in a
two-step procedure. First, in order to be counted, the difference
in intensity between a probe and its corresponding mismatch probe
had to exceed a threshold limit (50 counts, or about half
background, in this case). This eliminated from consideration
probes that did not hybridize well and probes for which the
mismatch control hybridizes at an intensity comparable to the
perfect match.
[0828] The high density array was hybridized to a labeled RNA
sample which, in principle, contains none of the sequences on the
high density array. In this case, the oligonucleotide probes were
chosen to be complementary to the sense RNA. Thus, an anti-sense
RNA population should have been incapable of hybridizing to any of
the probes on the array. Where either a probe or its mismatch
showed a signal above a threshold value (100 counts above
background) it was not included in subsequent analysis.
[0829] Then, the signal for a particular gene was counted as the
average difference (perfect match-mismatch control) for the
selected probes for each gene.
[0830] F. Results: The High Density Arrays Provide Specific and
Sensitive Detection of Target Nucleic Acids.
[0831] As explained above, the initial arrays contained more than
16,000 probes that were complementary to 12 murine mRNAs--9
cytokines, 1 cytokine receptor, 2 constitutively expressed genes
(5-actin and glyceraldehyde 3-phosphate dehydrogenase)--1 rat
cytokine and 1 bacterial gene (E. coli biotin synthetase, bioB)
which serves as a quantitation reference. The initial experiments
with these relatively simple arrays were designed to determine
whether short in situ synthesized oligonucleotides can be made to
hybridize with sufficient sensitivity and specificity to
quantitatively detect RNAs in a complex cellular RNA population.
These arrays were intentionally highly redundant, containing
hundreds of oligonucleotide probes per RNA, many more than
necessary for the determination of expression levels. This was done
to investigate the hybridization behavior of a large number of
probes and develop general sequence rules for a priori selection of
minimal probe sets for arrays covering substantially larger numbers
of genes.
[0832] The oligonucleotide arrays contained collections of pairs of
probes for each of the RNAs being monitored. Each probe pair
consisted of a 20-mer that was perfectly complementary (referred to
as a perfect match, or PM probe) to a subsequence of a particular
message, and a companion that was identical except for a single
base difference in a central position. The mismatch (MM) probe of
each pair served as an internal control for hybridization
specificity. The analysis of PM/MM pairs allowed low intensity
hybridization patterns from rare RNAs to be sensitively and
accurately recognized in the presence of crosshybridization
signals.
[0833] For array hybridization experiments, labeled RNA target
samples were prepared from individual clones, cloned cDNA
libraries, or directly from cellular mRNA as described above.
Target RNA for array hybridization was prepared by incorporating
fluorescently labeled ribonucleotides in an in vitro transcription
(IVT) reaction and then randomly fragmenting the RNA to an average
size of 30-100 bases. Samples were hybridized to arrays in a
self-contained flow cell (volume .about.200 .mu.L) for times
ranging from 30 minutes to 22 hours. Fluorescence imaging of the
arrays was accomplished with a scanning confocal microscope
(Molecular Dynamics). The entire array was read at a resolution of
11.25 .mu.m (.about.80-fold oversampling in each of the
100.times.100 .mu.m synthesis regions) in less than 15 minutes,
yielding a rapid and quantitative measure of each of the individual
hybridization reactions.
[0834] 1. Specificity of Hybridization
[0835] In order to evaluate the specificity of hybridization, the
high density array described above was hybridized with 50 pM of the
RNA sense strand of IL-2, IL-3, IL4, IL-6, Actin, GAPDH and Bio B
or IL-10, IL-12p40, GM-CSF, IFN-.gamma., TNF-.alpha., mCTLA8 and
Bio B. The hybridized array showed strong specific signals for each
of the test target nucleic acids with minimal cross
hybridization.
[0836] 2. Detection of Gene Expression Levels in a Complex Target
Sample
[0837] To determine how well individual RNA targets could be
detected in the presence of total mammalian cell message
populations, spiking experiments were carried out. Known amounts of
individual RNA targets were spiked into labeled RNA derived from a
representative cDNA library made from the murine B cell line T10.
The T10 cell line was chosen because of the cytokines being
monitored, only IL-10 is expressed at a detectable level.
[0838] Because simply spiking the RNA mixture with the selected
target genes and then immediately hybridizing might provide an
artificially elevated reading relative to the rest of the mixture,
the spiked sample was treated to a series of procedures to mitigate
differences between the library RNA and the added RNA. Thus the
"spike" was added to the sample which was then heated to 37.degree.
C. and annealed. The sample was then frozen, thawed, boiled for 5
minutes, cooled on ice and allowed to return to room temperature
before performing the hybridization.
[0839] FIG. 2A shows the results of an experiment in which 13
target RNAS were spiked into the total RNA pool at a level of
1:3000 (equivalent to a few hundred copies per cell). RNA
frequencies are given as the molar amount of an individual RNA per
mole of total RNA. FIG. 2B shows a small portion of the array (the
boxed region of 2A) containing probes specific for interleukin-2
and interleukin-3 (IL-2 and IL-3,) RNA, and FIG. 2C shows the same
region in the absence of the spiked targets. The hybridization
signals are specific as indicated by the comparison between the
spiked and unspiked images, and perfect match (PM) hybridizations
are well-discriminated from mismatches (MM) as shown by the pattern
of alternating brighter rows (corresponding to PM probes) and
darker rows (corresponding to MM probes). The observed variation
among the different perfect match hybridization signals was highly
reproducible and reflects the sequence dependence of the
hybridizations. In a few instances, the perfect match (PM) probe
was not significantly brighter than its mismatch (MM) partner
because of cross-hybridization with other members of the complex
RNA population. Because the patterns are highly reproducible and
because detection does not depend on only a single probe per RNA,
infrequent cross hybridization of this type did not preclude
sensitive and accurate detection of even low level RNAS.
[0840] Similarly, infrequent poor hybridization due to, for
example, RNA or probe secondary structure, the presence of
polymorphism or database sequence errors does not preclude
detection. An analysis of the observed patterns of hybridization
and cross hybridization led to the formulation of general rules for
the selection of oligonucleotide probes with the best sensitivity
and specificity described herein.
[0841] 3. Relationship Between Target Concentration and
Hybridization Signal
[0842] A second set of spiking experiments was carried out to
determine the range of concentrations over which hybridization
signals could be used for direct quantitation of RNA levels. FIG. 3
shows the results of experiments in which the ten cytokine RNAs
were spiked together into 0.05 mg/ml of labeled RNA from the B cell
(T10) cDNA library at levels ranging from 1:300 to 1:300,000. A
frequency of 1:300,000 is that of an mRNA present at less than a
few copies per cell. In 10 .mu.g of total RNA and a volume of 200
.mu.l, a frequency of 1:300,000 corresponds to a concentration of
approximately 0.5 picomolar and 0.1 femptomole
(.about.6.times.10.sup.7 molecules or about 30 picograms)of
specific RNA.
[0843] Hybridizations were carried out in parallel at 40.degree. C.
for 15 to 16 hours. The presence of each of the 10 cytokine RNAs
was reproducibly detected above the background even at the lowest
frequencies. Furthermore, the hybridization intensity was linearly
related to RNA target concentration between 1:300,000 and 1:3000
(FIG. 3). Between 1:3000 and 1:300, the signals increased by a
factor of 4-5 rather than 10 because the probe sites were beginning
to saturate at the higher concentrations in the course of a 15 hour
hybridization. The linear response range can be extended to higher
concentrations by reducing the hybridization time. Short and long
hybridizations can be combined to quantitatively cover more than a
10.sup.4-fold range in RNA concentration.
[0844] Blind spiking experiments were performed to test the ability
to simultaneously detect and quantitate multiple related RNAs
present at a wide range of concentrations in a complex RNA
population. A set of four samples was prepared that contained 0.05
mg/ml of sense RNA transcribed from the murine B cell cDNA library,
plus combinations of the 10 cytokine RNAs each at a different
concentration. Individual cytokine RNAs were spiked at one of the
following levels: 0, 1:300,000, 1:30,000, 1:3000, or 1:300. The
four samples plus an unspiked reference were hybridized to separate
arrays for 15 hours at 40.degree. C. The presence or absence of an
RNA target was determined by the pattern of hybridization and how
it differed from that of the unspiked reference, and the
concentrations were detected by the intensities. The concentrations
of each of the ten cytokines in the four blind samples were
correctly determined, with no false positives or false
negatives.
[0845] One case is especially noteworthy: IL-10 is expressed in the
mouse B cells used to make the cDNA library, and was known to be
present in the library at a frequency of 1:60,000 to 1:30,000. In
one of the unknowns, an additional amount of-IL-10 RNA
(corresponding to a frequency of 1:300,000) was spiked into the
sample. The amount of the spiked IL-10 RNA was correctly
determined, even though it represented an increase of only 10-20%
above the intrinsic level. These results indicate that subtle
changes in expression are sensitively determined by performing
side-by-side experiments with identically prepared samples on
identically synthesized arrays.
Example 2
T Cell Induction Experiments Measuring Cytokine mRNAs as a Function
of Time Following Stimulation
[0846] The high density arrays of this invention were next used to
monitor cytokine MRNA levels in murine T cells at different times
following a biochemical stimulus. Cells from the murine T helper
cell line (2D6) were treated with the phorbol ester
4-phorbol-12-myristate 13-acetate (PMA) and a calcium ionophore.
Poly (A).sup.+ mRNA was then isolated at 0, 2, 6 and 24 hours after
stimulation. Isolated mRNA (approximately 1 .mu.g) was converted to
labeled antisense RNA using a procedure that combines a
double-stranded cDNA synthesis step with a subsequent in vitro
transcription reaction. This RNA synthesis and labeling procedure
amplifies the entire mRNA population by 20 to 50-fold in an
apparently unbiased and reproducible fashion (Table 2).
[0847] The labeled antisense T-cell RNA from the four time points
was then hybridized to DNA probe arrays for 2 and 22 hours. A large
increase in the .gamma.-interferon mRNA level was observed, along
with significant changes in four other cytokine mRNAs (IL-3, IL-10,
GM-CSF and TNF.alpha.). As shown in FIG. 4, the cytokine messages
were not induced with identical kinetics. Changes in cytokine mRNA
levels of less than 1:130,000 were unambiguously detected along
with the very large changes observed for .gamma.-interferon.
[0848] These results highlight the value of the large experimental
dynamic range inherent in the method. The quantitative assessment
of RNA levels from the hybridization results is direct, with no
additional control hybridizations, sample manipulation,
amplification, cloning or sequencing. The method is also efficient.
Using current protocols, instrumentation and analysis software, a
single user with a single scanner can read and analyze as many as
30 arrays in a day.
Example 3
Higher-Density Arrays Containing 65,000 probes for over 100 Murine
Genes
[0849] FIG. 5 shows an array that contains over 65,000 different
oligonucleotide probes (50 .mu.m feature size) following
hybridization with an entire murine B cell RNA population. Arrays
of this complexity were read at a resolution of 7.5 lim in less
than fifteen minutes. The array contains probes for 118 genes
including 12 murine genes represented on the simpler array
described above, 35 U.S.C. .sctn.102( ) additional murine genes,
three bacterial genes and one phage gene. There are approximately
300 probe pairs per gene, with the probes chosen using the
selection rules described herein. The probes were chosen from the
600 bases of sequence at the 3' end of the translated region of
each gene. A total of 21 murine RNAs were unambiguously detected in
the B cell RNA population, at levels ranging from approximately
1:300,000 to 1:100.
[0850] Labeled RNA samples from the T cell induction experiments
(FIG. 4) were hybridized to these more complex 118-gene arrays, and
similar results were obtained for the set of genes in common to
both chip types. Expression changes were unambiguously observed for
more than 20 other genes in addition to those shown in FIG. 4.
[0851] To determine whether much smaller sets of probes per gene
are sufficient for reliable detection of RNAs, hybridization
results from the 118 gene chip were analyzed using ten different
subsets of 20 probe pairs per gene. That is to say, the data were
analyzed as if the arrays contained only 20 probe pairs per gene.
The ten subsets of 20 pairs were chosen from the approximately 300
probe pairs per gene on the arrays. The initial probe selection was
made utilizing the probe selection and pruning algorithms described
above. The ten subjects of 20 pairs were then randomly chosen from
those probes that survived selection and priming. Labeled RNAs were
spiked into the murine B cell RNA population at levels of 1:25,000,
1:50,000 and 1:100,000. Changes in hybridization signals for the
spiked RNAs were consistently detected at all three levels with the
smaller probe sets. As expected, the hybridization intensities do
not cluster as tightly as when averaging over larger numbers of
probes. This analysis indicates that sets of 20 probe pairs per
gene are sufficient for the measurement of expression changes at
low levels, but that improvements in probe selection and
experimental procedures will are preferred to routinely detect RNAs
at the very lowest levels with such small probe sets. Such
improvements include, but are not limited to higher stringency
hybridizations coupled with use of slightly longer oligonucleotide
probes (e.g., 25 mer probes)) are in progress.
Example 4
Scale Up to Thousands of Genes
[0852] A set of four high density arrays each containing 25-mer
oligonucleotide probes approximately 1650 different human genes
provided probes to a total of 6620 genes. There were about 20
probes for each gene. The feature size on arrays was 50 microns.
This high density array was successfully hybridized to a cDNA
library using essentially the protocols described above. Similar
sets of high density arrays containing oligonucleotide probes to
every known expressed sequence tag (EST) are in preparation.
Example 5
Direct Scale-Up for the Simultaneous Monitoring of Tens of
Thousands of RNAs
[0853] In addition to being sensitive, specific and quantitative,
the approach described here is intrinsically parallel and readily
scalable to the monitoring of very large numbers of mRNAs. The
number of RNAs monitored can be increased greatly by decreasing the
number of probes per RNA and increasing the number of probes per
array. For example, using the above-described technology, arrays
containing as many as 400,000 probes in an area of 1.6 cm.sup.2
(20.times.20 .mu.m synthesis features) are currently synthesized
and read. Using 20 probe pairs per gene allows 10,000 genes to be
monitored on a single array while maintaining the important
advantages of probe redundancy. A set of four such arrays could
cover the more than 40,000 human genes for which there are
expressed sequence tags (ESTS) in the public data bases, and new
ESTs can be incorporated as they become available. Because of the
combinatorial nature of the chemical synthesis, arrays of this
complexity are made in the same amount of time with the same number
of steps as the simpler ones used here. The use of even fewer
probes per gene and arrays of higher density makes possible the
simultaneous monitoring of all sequenced human genes on a single,
or small number of small chips.
[0854] The quantitative monitoring of expression levels for large
numbers of genes will prove valuable in elucidating gene function,
exploring the causes and mechanisms of disease, and for the
discovery of potential therapeutic and diagnostic targets. As the
body of genomic information grows, highly parallel methods of the
type described here provide an efficient and direct way to use
sequence information to help elucidate the underlying physiology of
the cell.
Example 6
Probe Selection Using a Neural Net
[0855] A neural net can be trained to predict the hybridization and
cross hybridization intensities of a probe based on the sequence of
bases in the probe, or on other probe properties. The neural net
can then be used to pick an arbitrary number of the "best" probes.
When a neural net was trained to do this it produced a moderate
(0.7) correlation between predicted intensity and measured
intensity, with a better model for cross hybridization than
hybridization.
[0856] A. Input/Output Mapping
[0857] The neural net was trained to identify the hybridization
properties of 20-mer probes. The 20-mer probes were mapped to an
eighty bit long input vector, with the first four bits representing
the base in the first position of the probe, the next four bits
representing the base in the second position, etc. Thus, the four
bases were encoded as follows:
[0858] A: 1000
[0859] C: 0100
[0860] G: 0010
[0861] T: 0001
[0862] The neural network produced two outputs; hybridization
intensity, and crosshybridization intensity. The output was scaled
linearly so that 95% of the outputs from the actual experiments
fell in the range 0. to 1.
[0863] B. Neural Net Architecture
[0864] The neural net was a backpropagation network with 80 input
neurons, one hidden layer of 20 neurons, and an output layer of two
neurons. A sigmoid transfer function was used:
(s(x)=1/(1+exp(-1*x)) ) that scales the input values from 0 to 1 in
a non-linear (sigmoid) manner.
[0865] C. Neural Net Training
[0866] The network was trained using the default parameters from
Neural Works Professional 2.5 for a backprop network. (Neural Works
Professional is a product of NeuralWare, Pittsburgh Pa., USA). The
training set consisted of approximately 8000 examples of probes,
and the associated hybridization and crosshybridization
intensities.
[0867] D. Neural Net Weights
[0868] Neural net weights are provided in two matrices; an
81.times.20 matrix (Table 3) (weights.sub.--1) and a 2.times.20
matrix Table 4 (weights.sub.--2).
8TABLE 3 Neural net weights (81 .times. 20 matrix) (weights_1).
-0.0316746 -0.0263491 0.15907079 -0.0353881 -0.0529314 0.09014647
0.19370709 -0.0515666 0.06444275 -0.0480836 0.29237783 -0.034054
0.02240546 0.08460676 0.14313674 0.06798329 0.06746746 0.033717
0.16692482 -0.0913482 0.05571244 0.22345543 0.04707823 -0.0035547
0.02129388 0.12105247 0.1405973 -0.0066357 -0.0760119 0.11165894
0.03684745 -0.0714359 0.02903421 0.09420238 0.12839544 0.08542864
0.00603615 0.04986877 0.02134438 0.0852259 0.13453935 0.03089394
0.11111762 0.12571541 0.09278143 0.11373715 0.03250757 -0.0460193
0.01354388 0.1131407 0.06123798 0.14818664 0.07090721 0.05089445
-0.0635492 -0.0227965 0.1081195 0.13419148 0.08916269 -0.010634
0.18790121 0.09624594 -0.0865264 -0.0126238 0.11497019 -0.0057307
0.02378313 0.10295142 0.05553147 -0.0193289 -0.0627925 -0.024633
-0.0403537 0.23566079 0.10335726 0.07325625 0.11329328 0.2555581
-0.0694051 -0.0637478 0.2687766 = -0.0731941 0.08858298 0.39719725
-0.0709359 0.14039235 0.23244983 0.06500423 0.11003297 0.0403917
0.02953459 0.26901209 -0.0605089 0.03036973 0.06836637 0.02345118
0.0206452 -0.0079707 0.20967795 0.17097448 -0.007098 -0.0348659
0.09989586 0.07417496 -0.1236805 0.05442215 0.23686385 0.01979881
-9.80E-06 -0.0549301 0.08891765 0.08683836 0.14047802 0.00982503
0.11756061 0.09054346 -0.028868 0.08829379 0.17881326 0.12465772
0.13134554 0.09500015 0.04572553 0.0749867 0.08564588 0.05334799
0.14341639 0.11468539 0.14277624 0.05022619 0.14544216 0.03519877
0.12799838 0.01427337 0.16172577 0.08078995 -0.0022168 0.05439407
-0.0789278 0.07312368 0.11417327 0.03405219 0.06140256 0.01802093
0.0954654 0.00130152 -0.035995 0.11517255 0.17431773 0.09664405
0.01782892 0.03840308 0.05180788 0.14236264 0.17182963 0.02306779
-0.0489743 -0.0006051 0.19077648 -0.0866363 0.11008894 0.40543473 =
-0.0163019 0.06256609 0.16058824 0.14149499 0.15698175 -0.1197781
0.38030735 0.28241798 0.2882407 -0.2227429 0.34799534 0.38490915
0.23144296 -0.3207987 0.56366867 0.35976714 0.20325871 -0.343972
0.46158856 0.20649959 0.35099933 -0.5071837 0.56459975 0.21605791
0.45084599 -0.5829023 0.51297456 0.33494622 0.43086055 -0.5538613
0.55080342 0.30968052 0.54485208 -0.7155912 0.30799151 0.29871368
0.36848074 -0.5196409 0.33829662 0.21612473 0.41646513 -0.5573701
0.47133151 0.30909833 0.37790757 -0.464661 0.50172138 0.21158406
0.46017882 -0.5331213 0.60684419 0.47586009 0.28597337 -0.3345993
0.33042327 0.4072904 0.24270254 -0.3750777 0.14083703 0.30998308
0.19591335 -0.4028497 0.30585453 0.35896543 0.24851802 -0.2937264
0.19672842 0.16133355 0.21780767 -0.2419563 0.17847325 0.07593013
0.1710967 -0.2728708 0.1234024 0.06987085 0.1741322 0.05922241
0.03326527 0.22045346 0.98782647 = -0.0752053 -0.0571054 -0.1834571
0.14263187 -0.0715346 -0.0524248 -0.0838031 0.01667063 -0.0945634
-0.1137057 -0.1040308 0.04263301 -0.2039919 -0.0532526 -0.0828366
0.1373803 -0.0562212 -0.2127942 -0.0482095 0.04316666 -0.1732933
0.0550463 -0.0526818 0.06739104 -0.0065265 -0.2011867 -0.0434558
-0.0369132 -0.0196296 -0.1314755 0.09420983 -0.0010159 -0.1768979
-0.2365085 -0.0150508 0.14120786 0.00565713 -0.1990354 0.11568499
-0.0690084 -0.1509431 -0.0575663 0.11275655 0.01772332 -0.0016695
-0.249011 0.09066539 0.05357879 -0.0850152 -0.1931012 0.08498721
0.03673514 -0.1446398 -0.199778 0.1065109 0.07205399 -0.1304159
-0.1723315 0.09151162 0.05596334 -0.0922655 -0.1478272 0.08858409
0.14206541 -0.0314846 -0.1985286 0.19862956 -0.0502828 -0.11447
-0.1440073 0.01366408 0.11101657 -0.0721622 -0.1506944 0.14910588
0.03297219 -0.0266356 -0.2501774 0.20344114 -0.061502 -0.1647823 =
0.02848385 0.00254791 -0.0646306 0.02634032 -0.0654473 0.04731949
-0.0742345 -0.0545447 -0.1119258 0.10765317 -0.0606677 0.05693235
-0.0747124 0.13325705 -0.0508435 -0.1761459 -0.0883804 -0.0777852
-0.1090026 -0.0988943 -0.0445145 0.03802977 -0.0484086 -0.0337959
0.07326921 0.02654305 -0.1239398 0.03043288 0.09781751 0.02590732
-0.0586419 -0.08015 -0.0073617 -0.1682889 0.00400978 0.01282504
0.05150735 -0.1449667 0.06144469 0.1005446 0.22570252 -0.3763289
-0.0001517 -0.0521925 0.21106339 -0.4393073 0.0053312 0.13283829
0.12470152 -0.3589714 -0.0061972 0.07370338 0.25447422 -0.3289591
-0.049451 0.05717351 0.14784867 -0.3082401 0.01207511 -0.1141143
0.18880892 -0.3259364 0.04754021 -0.0576587 0.02376083 -0.2828108
0.0234996 -0.1177034 0.02549919 -0.1671077 0.00582423 -0.0715723
0.16712189 -0.0122822 -0.109654 -0.0327367 0.01481733 -0.0636454
-0.0487184 0.01467591 -0.0759871 = 0.146753 -0.0931665 -0.1475015
0.07284982 -0.0609536 -0.0945313 -0.0739603 0.17018235 -0.0636651
0.04693379 -0.2586751 0.15550844 -0.1548294 -0.0908961 -0.0415557
0.04915113 -0.0436857 -0.031472 -0.1728483 0.12621336 -0.1321529
-0.1091831 -0.0989133 0.0294641 -0.0950026 -0.1562225 -0.0917397
0.18711324 0.04599057 -0.2039073 0.07691807 0.13016214 0.10801306
-0.3151104 0.0105284 0.10938062 -0.035349 -0.302975 0.03706082
0.12322487 0.07198878 -0.2535323 0.04664604 0.08887579 -0.0210248
-0.1427284 0.09078772 0.08646259 0.00194441 -0.1631221 0.11259725
-0.0984519 -0.0939511 -0.218395 0.13777457 0.00339417 -0.2007502
-0.0703103 0.1548807 0.13540466 -0.0514387 -0.0722146 0.07706029
0.04593663 -0.2334163 -0.0250262 0.0994828 -0.035077 -0.106266
-0.059766 0.13616422 0.22308858 -0.1571046 -0.1713289 0.14155054
0.00283311 0.01067419 -0.360891 0.13411179 -0.0159559 -0.1296399 =
-0.0304715 -0.0845574 0.17682472 -0.0552084 0.07044557 -0.1482136
0.13328855 -0.1492282 0.11350834 -0.1121938 0.02089526 0.00104415
0.0217719 -0.3102229 0.18922243 -0.0940011 0.08787836 -0.1835242
0.04117605 0.03997391 0.06022124 -0.1808036 0.04742034 -0.0744867
0.08965616 -0.1572192 0.00942572 0.07957069 0.12980177 -0.2440033
0.08670026 0.03785197 0.21052985 -0.3564453 0.01492627 0.04286519
0.00865917 -0.2995701 -0.0835971 0.14536868 0.08446889 -0.1689682
-0.1322389 0.21433547 0.08046963 -0.1548838 -0.021533 0.0558197
0.1623435 -0.3362183 -0.1335399 0.10284293 0.16658102 -0.3004514
-0.0887844 0.07691832 0.11459036 -0.056257 0.01970494 0.08940192
0.08622501 -0.2421202 0.00845924 -0.0151014 0.19088623 -0.1967196
-0.0290916 -0.0839412 0.10590381 -0.1593935 -0.0399097 -0.0861852
0.17453311 -0.1529943 0.02726452 0.06178628 0.06624542 0.01004315
-0.158326 -0.0149114 -0.1479269 = 0.11429903 -0.0432327 0.14520219
0.51860482 0.19151463 -0.1127352 0.33529782 0.24581231 0.07311282
-0.2268714 0.31717882 0.35736522 0.09062219 -0.2974442 0.46336258
0.17145836 0.32802406 -0.3898261 0.49959001 0.22195752 0.32254469
-0.4994924 0.75497276 0.35112098 0.52447188 -0.5555881 0.68481833
0.20251468 0.39860719 -0.7198414 0.78773916 0.45518181 0.71273196
-0.7655811 0.7155844 0.39701831 0.47296903 -0.672706 0.69020337
0.37193877 0.47959387 -0.9032337 0.80210346 0.40167108 0.50383294
-0.6195157 0.80366057 0.3884458 0.45408139 -0.7316507 0.48975253
0.47984859 0.33738744 -0.5510914 0.56882453 0.29653791 0.4472059
-0.5177853 0.36228263 0.40129057 0.4490836 -0.4754149 0.46366793
0.31378582 0.48470935 -0.2453159 0.39600489 0.24787127 0.20359448
-0.203447 0.25734761 0.17168433 0.35209069 -0.203685 0.25115264
0.21313109 0.12461348 0.10632347 0.13266218 0.20236486 1.1078833 =
-0.0112394 0.01601524 0.11363719 -0.1440069 0.05522444 -0.0711868
0.09505147 -0.0220034 0.0714381 -0.1994763 0.12304886 -0.1611445
0.16811867 -0.4498019 0.10313182 -0.0149997 0.47659361 -0.4639786
-0.0380792 -0.0468904 0.37975076 -0.7120748 -0.1078557 0.10635795
0.42699403 -0.6348544 0.00025528 0.06202703 0.57867163 -0.6733171
-0.0381787 0.09532065 0.50065184 -0.7413587 -0.0193744 -0.1180785
0.74187845 -0.8996705 0.03180836 0.04010354 0.82366729 -0.6429569
0.02410492 -0.0632124 0.73732454 -0.8188882 0.04538922 -0.1471086
0.7597335 -0.6287012 0.03615654 -0.1248241 0.56647652 -0.6294683
0.15992545 -0.1780757 0.3820785 -0.5642462 -0.0609947 -0.0350918
0.25537059 -0.4526066 -0.0761788 -0.0242514 0.35473567 -0.3512402
-0.1888455 0.1974159 0.01620384 -0.1306533 -0.1468564 0.25235301
0.08058657 -0.0768841 -0.316401 0.09779498 0.08537519 -0.0738487
-0.2839164 0.12684187 -0.2450078 = -0.1147067 -0.0084124 -0.5239977
-0.5021591 0.02636886 0.1470097 -0.5139894 -0.6221746 -0.3979228
0.30136263 -0.742976 -0.4011821 0.19038832 0.55414283 -1.1652025
-0.3686967 -0.4750175 0.54713631 -0.9312411 -0.410718 -0.1498093
0.55332947 -1.0870041 -0.4378341 -0.5433689 0.92539561 -0.9013531
-0.6145319 -0.5512772 1.0310978 -0.9422795 -0.6914638 -0.7839714
1.4393494 -0.7092296 -0.894987 -0.6896155 1.1251011 -0.8161536
-0.8204682 -0.8957642 1.3315079 -1.0231192 -0.5556009 -0.7499282
1.281976 -0.9347371 -0.6562014 -0.6568274 1.1967098 -1.150661
-0.5503616 -0.6640182 0.84698498 -0.7811472 -0.5740913 -0.4527726
0.64911795 -0.6970047 -0.5759697 -0.4704399 0.51728982 -0.545236
-0.8311051 -0.4240301 0.37167478 -0.7735854 -0.3031097 -0.4083092
-0.0152683 -0.2330878 -0.5839304 -0.1544528 0.2042688 -0.8989772
-0.3088974 -0.2014994 0.11505035 -0.4815812 -0.5319371 -1.3798244 =
0.07143499 -0.1589592 0.04816094 -0.0301291 0.15144217 -0.3037405
0.1549352 -0.0608833 0.21059546 -0.4705076 0.16360784 -0.0684895
0.44703272 -0.6194252 0.19459446 -0.0523894 0.31194624 -0.8030509
0.2595928 -0.119705 0.4913742 -0.8455008 0.15694356 -0.0023983
0.53066176 -0.9705743 0.1324198 0.08982921 0.43900672 -0.8588745
0.1702383 0.02221953 0.44412452 -0.7700244 0.10496679 0.14137991
0.5403164 -0.5077381 0.00849557 0.1611405 0.31764683 -0.5240273
-0.092208 0.21902563 0.25788471 -0.3861519 -0.2022993 0.13711917
0.22238699 -0.156256 -0.2092034 0.16458821 0.20111787 -0.1418906
-0.180493 0.17164391 0.15690604 -0.0254563 -0.1990184 0.10211211
0.17421109 -0.0730809 -0.3717274 0.1436436 -0.0215865 -0.2363243
-0.1982318 0.06996673 0.19735655 0.05625506 -0.241524 0.12768924
0.05979542 -0.0623277 -0.2521037 0.0944353 -0.0492548 0.05238663
-0.1978694 0.05119598 -0.2067173 = 0.06230025 -0.0752745 0.32974288
0.00985043 0.07881941 -0.0835249 0.1073643 -0.090154 -0.0938452
0.00704324 0.2569764 0.08700065 -0.0272076 -0.1014201 0.19723812
-0.0935401 0.0913924 -0.0728388 0.33091745 -0.0610701 0.01335303
0.02156818 0.21619918 -0.0909865 0.01069087 0.02569587 0.11676744
-0.0213131 0.1322203 0.11848255 0.11231339 -0.0392407 0.06117272
-0.0234323 0.14693312 0.13509636 -0.0213237 -0.0261696 0.09474246
-0.0100756 0.10580003 -0.0147534 0.12980145 -0.038394 0.08167668
-0.0105376 0.02142166 -0.0161705 0.15833771 0.01835199 0.04420554
0.02605363 0.27427858 0.05774866 -0.0696303 0.03802699 0.0806741
0.03993953 -0.0121658 0.07568218 0.05538817 0.01067943 0.04131892
-0.0267609 0.14418064 0.0897231 -0.0677462 -0.0772208 0.16641215
0.09142463 0.02115551 -0.0876383 0.14652038 0.06084725 -0.1150111
-0.0687876 0.10878915 0.32776353 -0.1929855 0.00694158 0.26604816 =
-0.0786668 0.05454836 -0.0834711 0.07707115 0.05659099 -0.0285798
-0.0029815 -0.0837616 0.02468397 0.03531792 -0.1437671 0.10122854
-0.1259448 -0.0845026 0.10171869 -0.0541042 0.05257236 0.04065102
-0.1091328 0.0090488 0.06142418 -0.167912 -0.098868 0.02574896
0.00333312 -0.2812204 0.02039073 -0.052828 -0.0439769 -0.0458286
0.14768517 0.02989549 0.09454407 -0.1860176 -0.0505908 0.088718
0.0611263 -0.1895157 0.08583955 0.09382812 -0.0001466 -0.4065202
0.09951859 0.14843601 0.12351749 -0.1327625 0.10949049 0.07129322
0.05554885 -0.3743193 -0.0205463 0.12675567 0.0775801 -0.1869074
0.01806534 0.09599103 -0.0570596 -0.1523381 0.08384241 0.00704122
0.10942505 -0.0473638 0.01151769 0.09737793 0.07082167 -0.2184597
-0.0365961 -0.0962418 0.01007566 -0.0049753 0.01404589 -0.0406134
0.01934035 -0.0073082 -0.0489736 0.10457312 -0.0520154 -0.0454775
-0.0525739 0.06086259 -0.1788069 = 0.19904579 -0.2001437 0.04977471
0.26628217 0.19910193 0.15184447 0.01703933 0.06875326 0.09066898
-0.2003548 0.26507998 0.0629771 0.39202845 -0.6033413 0.57940209
-0.0460919 0.53419203 -0.7680888 0.65535748 0.32430753 0.64831889
-1.0950515 0.80829531 0.05049393 0.95144385 -1.2075449 0.94851351
-0.0852669 0.94320357 -1.680338 0.99852085 0.48870567 1.7470727
-1.7586045 0.56886804 0.66196042 1.2572207 -1.5854638 0.89351815
0.39586932 1.586942 -1.6365775 0.73526824 0.31977594 1.2270083
-1.2818555 0.71813524 0.37488377 0.95438999 -1.2543333 0.55854511
0.1672449 0.56084049 -0.7980669 0.45917389 0.27823627 0.26928344
-0.9804664 0.62299174 0.53984308 0.33946255 -0.5412283 0.1085042
0.44658452 0.39120093 -0.5676367 0.19083619 0.37056214 0.24114503
-0.3020035 0.39015424 0.09788869 0.30190364 -0.3655235 0.33355939
0.44246852 0.17172456 -0.3479928 0.18584418 0.34009755 4.5490937 =
0.13698889 -0.0798945 0.3366704 0.17313539 0.01228174 -0.2679709
0.31540671 0.08274947 0.11212139 -0.428847 0.57447821 -0.0305296
0.00119518 -0.1978176 0.59532708 -0.0309942 -0.0107875 -0.7312108
0.74023747 0.38564634 0.03748908 -0.6475483 0.87958473 0.05327692
0.06987014 -0.5168169 1.0081589 -0.0517421 0.08651814 -0.761238
0.7840901 0.4372991 0.13783893 -0.8574924 0.90612286 0.06334394
0.05702339 -0.5161278 0.66693234 -0.0496743 0.07689167 -0.5775976
0.70519674 0.15731441 0.08724558 -0.7325026 0.65517086 0.29064488
0.11747536 -0.612968 0.98160452 0.02407174 0.02613025 -0.677594
0.81293154 0.18651071 0.03182137 -0.7051651 0.89682412 0.181806
0.24770954 -0.4320194 0.72470272 0.12951751 0.14626819 -0.3964331
0.54755467 0.08819038 0.22105552 -0.3489864 0.4620938 0.06516677
0.03049339 -0.1913544 0.4782092 -0.098419 -0.0160188 0.07177288
0.1008145 0.01412579 0.42727205 = -0.0048454 0.1204864 0.15507312
0.25648347 0.03982652 0.14641231 -0.0273505 0.10494121 0.1988914
0.09454013 -0.0560908 0.07466536 0.1325469 0.15324508 -0.01398
0.08281901 0.07909692 0.36858437 -0.0007111 0.13285491 -0.1658676
0.25348473 0.08835109 0.16466415 -0.118853 0.26435438 -0.0775707
0.09143513 -0.1019902 0.29236633 0.07947435 0.07329605 -0.0903666
0.10754076 0.04456592 0.18368921 -0.162177 0.18712705 0.03216886
0.04698242 -0.0385783 0.2276271 0.04106503 0.08498254 -0.0325038
0.29328787 0.01249749 0.10016124 -0.0012895 0.2371086 0.14713244
-0.053306 -0.0808243 0.28909287 0.13412228 0.10756335 -0.0486093
0.05799349 0.21323961 -0.0118695 -0.142963 0.09792294 0.06907349
0.05942665 -0.143813 0.21673524 0.19903891 0.02989559 0.15750381
-0.0373194 0.12471988 0.10462648 -0.0027455 0.16604523 0.06245366
-0.0775013 -0.0160873 0.21550164 0.25000233 0.05931267 0.22881882 =
0.04679342 0.10158926 -0.122116 0.23491009 -0.0625733 0.19985424
-0.1704439 0.302394 -0.0671487 0.33251444 -0.0581705 0.21095584
-0.215752 0.32740423 -0.1597161 0.18950906 -0.1232446 0.27883759
-0.0430407 0.04886867 -0.0914212 0.28192514 0.05275658 0.21014904
-0.1322077 0.2981362 0.1254565 0.15627012 0.04116358 0.08507752
0.10109599 0.23081669 -0.1617257 0.29508773 -0.0405337 -0.0497829
-0.0808031 0.15750171 0.08072432 0.12990661 -0.1935954 0.29120663
0.13912162 0.04256131 -0.1625126 0.25232118 0.04736055 -0.0530935
-0.2270383 0.22945035 0.18167619 0.00080986 -0.1253632 0.15695702
0.01596376 0.03504543 0.00964208 0.11757879 -0.0230768 0.04350457
-0.1284984 0.24145114 0.20540115 0.07580803 -0.0932236 0.14288881
0.00538179 0.05302088 -0.1001294 0.27505419 0.22654785 0.02395938
-0.0861699 0.05814215 0.21307872 0.01372274 0.04515802 -0.0269269
0.20031671 0.23140682 0.16010799 = 0.37838998 0.00934576 -0.139213
0.29823828 0.40640026 -0.067578 -0.038453 0.24550894 0.30729383
-0.2807365 -0.0689575 0.26537073 0.58336282 -0.2145292 -0.2378269
0.25939462 0.64761585 -0.3581158 0.07741276 0.45081589 0.65251595
-0.4543131 -0.0671543 0.48592216 0.85640681 -0.6068144 -0.1187844
0.35959438 0.71842372 -0.7140775 -0.0642752 0.37914035 0.71409059
-0.7180941 0.21169594 0.27888221 0.79736245 -0.7102081 0.14268413
0.41374633 0.75569016 -0.7394939 0.02592243 0.37013471 0.82774776
-0.8136597 0.24068722 0.45081198 0.88004726 -0.6990998 0.23456772
0.24596012 0.67229778 -0.8148533 0.30492786 0.39735735 0.55497372
-0.6593497 0.20656242 0.3752968 0.54989374 -0.5660355 0.1205707
0.22377795 0.46045718 -0.519361 0.17151839 0.39539635 0.50465524
-0.3791285 0.07184427 0.36315975 0.51068121 -0.3502096 -0.2094818
0.31471297 0.18174268 -0.1241962 -0.1255455 0.35898197 0.79502285 =
0.02952595 -0.0751979 -0.2556099 -0.3040917 -0.0942183 -0.0541431
-0.6262965 -0.1423945 -0.0537339 0.11189342 -0.3791296 -0.3382006
0.02978903 0.20563391 -0.5457558 -0.3666513 -0.1922515 0.29512301
-0.7473708 -0.0415357 0.18283925 0.28153449 -0.7847292 -0.2313099
0.00290797 0.6284017 -0.6397845 -0.5606785 -0.1479581
0.57049137 -1.0829539 -0.1822221 -0.1832336 0.49371469 -0.6362705
-0.2790937 0.06966544 0.75524592 -0.9053063 -0.5826979 -0.114608
0.90401584 -0.8823278 -0.3404879 -0.0334436 0.50130409 -0.57275
-0.3842527 0.0915129 0.44590429 -0.7808504 -0.4399623 -0.1189605
0.59226018 -0.499517 -0.4873153 -0.2889721 0.47303999 -0.4015501
-0.2875251 -0.1106236 0.27437851 -0.6061368 -0.4166524 -0.0637606
0.33875695 -0.6255118 -0.1046614 -0.2710638 0.26425925 -0.4123208
-0.2157291 -0.1468192 -0.1719856 -0.4140109 -0.1058299 0.02873472
-0.1210428 -0.213571 -0.1335077 -0.7155944 = 0.06424081 -0.0978306
-0.1169782 0.13909493 -0.0838893 -0.1300299 -0.1032737 0.11563963
-0.0709175 -0.028875 -0.1718288 -0.026291 0.05533361 -0.033985
-0.049436 0.11520655 -0.0279296 -0.0170352 0.05850215 0.03830531
-0.0893732 -0.0066427 0.06969514 0.13403182 -0.012636 -0.1925185
0.13028348 -0.0045112 0.05260766 -0.2759708 -0.0395793 0.03069885
0.07913893 -0.1470363 0.09080192 0.19741131 -0.0917266 -0.2185763
0.04743406 -0.0364127 0.00991712 -0.2093729 0.23327024 -0.0898143
-0.0578982 -0.2096201 0.09257686 0.00566842 0.10926479 -0.1167006
0.18223672 0.09710353 0.03838636 -0.2026017 0.12219627 0.05705986
-0.0505442 -0.1334345 -0.0204458 0.01167099 -0.1091286 -0.075133
0.02949276 -0.0217044 -0.0782921 -0.1160332 -0.0210903 0.11607172
-0.0943146 -0.1014408 0.02903902 0.02963065 -0.1233738 -0.0760847
0.00098273 0.07522969 0.05794976 -0.1959872 0.06584878 -0.0323083
-0.0581293 =
[0869]
9TABLE 4 Second neural net weighting matrix (2 .times. 21)
(weights_2). -0.5675537 -0.6119734 0.20069507 0.26132998 -0.5071653
0.2793434 -0.5328685 0.31165671 -0.9999997 -0.4128213 -1.0000007
-0.6456627 -0.209518 1.6362301 -1.9999975 -0.2563241 0.04389827
1.7597554 2.0453076 0.08412334 -0.1645829 = 0.55343837 0.68506879
-1.1869608 0.39551663 0.38050765 0.40832204 0.12712023 -1.7462951
0.0818732 6.111361 0.62210494 0.42921746 0.19891988 -4.0000067
-0.5605077 1.3601962 1.7318885 -1.0558798 3.1242371 0.22860088
1.6726165 =
[0870] E. Code for Running the Net
[0871] Code for running the neural net is provided below in Table 5
(neural_n.c) and Table 6 (lin_alg.c).
10TABLE 5 Code for running the neural net (neural_n.c). #define
local far #include <windows.h> #include <alloc.h>
#include "utils.h" #include <string.h> #include
<ctype.h> #include <stdio.h> #include <math.h>
#include <mem.h> #include "des_util.h" #include "chipwin.h"
#include "lin_alg.h" void reportProblem( char local * message,
short errorClass); char iniFileName[] = "designer.ini"; static void
sigmoid( vector local * transformMe ){ short i; for( i = 0; i <
transformMe->size; i++ ) transformMe->values[i] = 1/(1+
exp(-1 * transformMe->values[i])); } static short
getNumCols(char far * buffer){ short count = 1; for( ;*buffer != 0;
buffer++ ) if( *buffer ==`.backslash.t`) count++; return count; }
static short getNumRows(char far * buffer){ char far * last, far *
current; short count = -1; current = buffer; do{ count++; last =
current; current = strchr(last+1, 0 ); }while( current > last+1
); return count; } static void readMatrix(matrix local * theMat,
char far * buffer ){ short i,j; char far * temp; temp = buffer;
for(i = 0; i < theMat->numRows; i++){ for( j = 0; j <
theMat->numCols; j++ ){ while(isspace(*temp ) .parallel. (*temp
== 0 && *(temp-1 ) != 0 ) ) = temp++; sscanf( temp, "%f",
&theMat->values[i][j]); while( !isspace( *temp ) &&
*temp != 0 ) temp++; } } } #define MaxNumLines (20 ) #define
MaxLineSize (1024 ) short readNeuralNetWeights(matrix local
*weights1, matrix local *weights2 ){ char far * buffer; int
copiedLength; short numCols, numRows; buffer = farcalloc(
MaxNumLines * MaxLineSize, sizeof( char ) ); if (buffer == NULL ){
errorHwnd( "failed to allocate file reading = buffer"); return
FALSE;} copiedLength = GetPrivateProfileString("weights_1", NULL,
".backslash.0.backslash.0", buffer, MaxNumLines * MaxLineSize,
iniFileName ); if (copiedLength < 10 .parallel. copiedLength
>= (MaxNumLines * MaxLineSize = -10 ) ){ errorHwnd("failed to
read .ini file"); return FALSE; } numCols = getNumCols( buffer );
numRows = getNumRows( buffer ); if( !allocateMatrix( weights1,
numRows, numCols ) ) return FALSE; readMatrix( weights1, buffer );
copiedLength = GetPrivateProfileString("weights_2", NULL,
".backslash.0.backslash.0", buffer, MaxNumLines * MaxLineSize,
iniFileNarne ); if( copiedLength < 10 .parallel. copiedLength
>= (MaxNumLines * MaxLineSize -10 ) ){ errorHwnd("failed to read
.ini file"); farfree( buffer ); return FALSE; } numCols =
getNumCols( buffer ); numRows = getNumRows( buffer );
if(!allocateMatrix(weights2, numRows, numCols ) ){farfree( buffer
); return FALSE;} readMatrix( weights2, buffer ); farfree( buffer
); return TRUE; } short runForward( vector local *input, vector
local *output, matrix local *weights1, matrix local *weights2 ){
vector hiddenLayer; if( !allocateVector(&hiddenLayer, (short
)(weights1->numRows +1 ) ) ) return FALSE; if(
!vectorTimesMatrix(input, &hiddenLayer, weights1 ) ){
freeVector(&hiddenLayer ); return FALSE; } sigmoid(
&hiddenLayer ); hiddenLayer.values[hiddenLayer.s- ize -1] = 1;
if( !vectorTimesMatrix( &hiddenLayer, output, weights2 ) ) {
freeVector( &hiddenLayer ); return FALSE; } freeVector(
&hiddenLayer ); sigmoid( output ); return TRUE; } static vector
inputVector= {NULL, 0}, outputVector = {NULL, 0}; static matrix
firstWeights = {NULL, 0, 0}, secondWeights = {NULL, 0, 0}; static
short beenHereDoneThis = FALSE; static short makeSureNetIsSetUp(
void ) { if( beenHereDoneThis ) return TRUE; if(
!readNeuralNetWeights( &firstWeights, &secondWeights ) )
return = FALSE; if( !allocateVector( &inputVector,
firstWeights.numCols ) ) return = FALSE; if( !allocateVector(
&outputVector, secondWeights.numRows ) ) return = FALSE;
beenHereDoneThis = TRUE; return TRUE; } void removeNetFromMemory(
void ) { freeVector( &inputVector ); freeVector(
&outputVector ); freeMatrix( &firstWeights ); freeMatrix(
&secondWeights ); beenHereDoneThis = FALSE; } short
nnEstimateHybAndXHyb( float local * hyb, float local * xHyb, char =
local * probe ) { short probeLength, i; if( !makeSureNetIsSetUp( )
) return FALSE; probeLength = ( short )( strlen( probe ) ); if( (
probeLength *4 +1 ) != inputVector.size ) { // reportProblem(
"Neural net not set up to deal with probes of this = length", 0 );
if( ( probeLength *4 + 1 ) > inputVector.size ) { //
reportProblem( "probe being trimmed to do annlysis", 1 );
probeLength = ( short )( inputVector.size / 4 ); } } memset(
inputVector.values, 0, inputVector.size * sizeof( float ) );
inputVector.values[inputVector.size-1] = 1; for( i = 0; i <
probeLength; i++) inputVector.values[i * 4 + lookuplndex( tolower(
probe[i]) )]= 1; runForward( &inputVector, &outputVector,
&firstWeights, &secondWeights ); *hyb =
outputVector.values[0]; *xHyb = outputVector.values[1]; return
TRUE; }
[0872]
11TABLE 6 Code for running the neural net (lin_alg.c ). lin_alg.c
#include "utils.h" #include "lin_alg.h" #include <alloc.h>
short allocateMatrix( matrix local * theMat, short rows, short
columns ){ short i; theMat->values = calloc( rows, sizeof( float
local * ) ); if( theMat->values == NULL ){ errorHwnd( "failed to
allocate = matrix"); return FALSE;} for( i = 0; i < rows; i++ ){
theMat->values[i] = calloc(columns, sizeof(float ) ); if(
theMat->values[i] == NULL ){ errorHwnd ("failed to allocate
matrix"); for( --i; i >= 0; i-- ) free( theMat->values[i] );
return FALSE; } } theMat->numRows = rows; theMat->numCols =
columns; return TRUE; } short allocateVector( vector local *
theVec, short columns ){ theVec->values = calloc( columns,
sizeof( float ) ); if(theVec->values == NULL ) {errorHwnd(
"faile to allocate = vector"); return FALSE;} theVec->size =
columns; return TRUE; } void freeVector( vector local * theVec ) {
free( theVec->values ); theVec->values = NULL;
theVec->size = 0; } void freeMatrix(matrix local * theMat ){
short i; for( i = 0; i < theMat->numRows; i++ ) free(
theMat->values[i] ); free( theMat->values );
theMat->values = NULL; theMat->numRows = theMat->numCols =
0; } float vDot(float local * input1, float local * input2, short
size ){ float returnValue = 0; short i; for( i = 0; i < size;
i++) returnValue += input1[i] * input2[i]; return returnValue; }
short vectorTimesMatrix( vector local *input, vector local *output,
matrix local *mat ){ short i; if( (input->size !=
mat->numCols ) .parallel. (output->size<mat->numRows )
){ errorHwnd( "illegal multiply" ); return FALSE; } for( i = 0; i
< mat->numRows; i++ ) output->values[i] = vDot(
input->values, mat->values[i], input->size = ); return
TRUE; }
[0873] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference for all purposes.
Sequence CWU 1
1
3 1 20 DNA Artificial sequence hypothetical probe 1 agcttttttc
atgcatctat 20 2 20 DNA Artificial sequence gene 1 2 aagcgcgatc
gattatgctc 20 3 43 DNA Artificial sequence gene 2 3 atctcggatc
gatcggataa gcgcgatcga ttatgctcgg cga 43
* * * * *