U.S. patent application number 10/435567 was filed with the patent office on 2003-10-02 for novel immunotoxins and methods of inducing immune tolerance.
Invention is credited to Hu, Huaizhong, Kenchtle, Stuart, Ma, Shenglin, Neville, David M., Thomas, Judith M., Thompson, Jerry T..
Application Number | 20030185825 10/435567 |
Document ID | / |
Family ID | 21908461 |
Filed Date | 2003-10-02 |
United States Patent
Application |
20030185825 |
Kind Code |
A1 |
Neville, David M. ; et
al. |
October 2, 2003 |
Novel immunotoxins and methods of inducing immune tolerance
Abstract
Provided are novel DT- and ETA-based immunotoxins and a method
of treating an immune system disorder not involving T cell
proliferation, comprising administering to the animal an
immunotoxin comprising a mutant diphtheria toxin moiety linked to
an antibody moiety which routes by the anti-CD3 pathway, or
derivatives thereof under conditions such that the disorder is
treated. Thus, the present method can treat graft-versus-host
disease. Also provided is a method of inhibiting a rejection
response by inducing immune tolerance in a recipient to a foreign
mammalian donor tissue or cells, comprising the steps of: a)
exposing the recipient to an immunotoxin so as to reduce the
recipients's peripheral blood T-cell lymphocyte population by at
least 80%, wherein the immunotoxin is anti-CD3 antibody linked to a
diphtheria protein toxin, wherein the protein has a binding site
mutation; and b) transplanting the donor cells into the recipient,
whereby a rejection response by the recipient to the donor organ
cell is inhibited, and the host is tolerized to the donor cell.
Inventors: |
Neville, David M.;
(Bethesda, MD) ; Kenchtle, Stuart; (Oregon,
WI) ; Thomas, Judith M.; (Birmingham, AL) ;
Thompson, Jerry T.; (Frenchville, PA) ; Hu,
Huaizhong; (Singapore, SG) ; Ma, Shenglin;
(Birmingham, AL) |
Correspondence
Address: |
NEEDLE & ROSENBERG, P.C.
SUITE 1000
999 PEACHTREE STREET
ATLANTA
GA
30309-3915
US
|
Family ID: |
21908461 |
Appl. No.: |
10/435567 |
Filed: |
May 9, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10435567 |
May 9, 2003 |
|
|
|
09380484 |
Dec 6, 1999 |
|
|
|
09380484 |
Dec 6, 1999 |
|
|
|
PCT/US98/04303 |
Mar 5, 1998 |
|
|
|
60039987 |
Mar 5, 1997 |
|
|
|
Current U.S.
Class: |
424/144.1 ;
424/93.7; 514/179; 514/469; 514/546; 530/391.1 |
Current CPC
Class: |
A61P 37/06 20180101;
A61K 39/395 20130101; A61K 39/39541 20130101; A61K 39/395 20130101;
A61K 39/395 20130101; A61K 47/6849 20170801; C07K 16/2809 20130101;
A61K 38/00 20130101; A61K 39/39541 20130101; A61K 47/6829 20170801;
A61K 39/395 20130101; A61K 2039/505 20130101; C07K 2317/24
20130101; A61K 39/395 20130101; A61K 2300/00 20130101; C07K
2317/622 20130101; A61K 31/365 20130101; A61K 2300/00 20130101;
A61K 31/365 20130101; A61K 31/505 20130101; A61K 31/57 20130101;
A61K 31/16 20130101; A61K 31/57 20130101; A61K 31/16 20130101; A61K
39/39541 20130101; A61K 47/6879 20170801; A61K 39/395 20130101;
A61K 39/39541 20130101; A61K 39/39541 20130101; C07K 14/34
20130101; C07K 2319/00 20130101; C07K 2317/77 20130101 |
Class at
Publication: |
424/144.1 ;
530/391.1; 514/179; 514/469; 424/93.7; 514/546 |
International
Class: |
A61K 039/395; A61K
045/00; A61K 031/573; A61K 031/365; A61K 031/22 |
Claims
What is claimed:
1. A divalent anti-T cell immunotoxin targeting moiety, comprising
two monovalent antibody chains joined by a disulfide bond is at
C337 of residues 228-340 within the natural IgM domain in
.mu.CH2.
2. A divalent anti-T cell immunotoxin targeting moiety, comprising
two monovalent antibody chains joined by a disulfide bond at C227
or C229, or C227 and C229, of residues 216-238 of the .gamma.IgG
hinge region, and wherein C220 is changed to P.
3. The divalent anti-T cell immunotoxin targeting moiety of claim
1, further comprising residues 447-576 in .mu.CH4, or residues
344-446 in .mu.CH3 or residues 376-346 in .gamma.CH3 or
combinations thereof.
4. The divalent anti-T cell immunotoxin targeting moiety of claim
2, further comprising residues 447-576 in .mu.CH4, or residues
344-446 in .mu.CH3 or residues 376-346 in .gamma.CH3 or
combinations thereof.
5. A divalent anti-T cell immunotoxin, comprising the targeting
moiety of claims 1 and a toxin moiety, wherein the orientation of
the targeting moiety to the toxin moiety is fixed so that the
catalytic domain of the toxin becomes a free entity when
proteolytically processed at its natural processing site under
reducing conditions.
6. A divalent anti-T cell immunotoxin, comprising the targeting
moiety of claims 2 and a toxin moiety, wherein the orientation of
the targeting moiety to the toxin moiety is fixed so that the
catalytic domain of the toxin becomes a free entity when
proteolytically processed at its natural processing site under
reducing conditions.
7. The divalent anti-T cell immunotoxin of claim 5, wherein the
toxin moiety is diphtheria toxin, and the toxin moiety is at the
amino terminus of the fusion immunotoxin.
8. The divalent anti-T cell immunotoxin of claim 6, wherein the
toxin moiety is diphtheria toxin, and the toxin moiety is at the
amino terminus of the fusion immunotoxin.
9. The divalent anti-T cell immunotoxin of claim 5, wherein the
toxin moiety is diphtheria toxin, and the toxin moiety is at the
carboxy terminus of the fusion immunotoxin, and the toxin is
connected to the carboxy terminus of the antibody domain via a
peptide linker containing a furin proteolytic cleavage site
(RXR/KR).
10. The divalent anti-T cell immunotoxin of claim 6, wherein the
toxin moiety is diphtheria toxin, and the toxin moiety is at the
carboxy terminus of the fusion immunotoxin, and the toxin is
connected to the carboxy terminus of the antibody domain via a
peptide linker containing a furin proteolytic cleavage site
(RXR/KR).
11. A divalent anti-T cell immunotoxin, comprising the targeting
moiety of claim 7 and a toxin moiety, wherein the toxin moiety and
the targeting moiety are thioether coupled, a single cysteine is
inserted within the binding domain of the toxin moiety, and the
targeting moiety has only a single free cysteine per chain.
12. A divalent anti-T cell immunotoxin, comprising the targeting
moiety of claim 8 and a toxin moiety, wherein the toxin moiety and
the targeting moiety are thioether coupled, a single cysteine is
inserted within the binding domain of the toxin moiety, and the
targeting moiety has only a single free cysteine per chain.
13. The divalent anti-T cell immunotoxin of claim 11, wherein the
single cysteine projects into the solvent away from interchain
contacts with the targeting moiety.
14. The divalent anti-T cell immunotoxin of claim 12, wherein the
single cysteine projects into the solvent away from interchain
contacts with the targeting moiety.
15. The divalent anti-T cell immunotoxin of claim 13, wherein the
single cysteine of the targeting moiety used for thioether coupling
is selected from the group consisting of .mu.CH3 C414, .mu.CH4 C575
and C447 of .gamma.CH3.
16. The divalent anti-T cell immunotoxin of claim 14, wherein the
single cysteine of the targeting moiety used for thioether coupling
is selected from the group consisting of .mu.CH3 C414, .mu.CH4 C575
and C447 of .gamma.CH3.
17. The divalent anti-T cell immunotoxin of claim 11, wherein the
toxin moiety binding domain comprises a mutation that reduces toxin
binding activity by at least 1000 fold compared to wild type
toxin.
18. The divalent anti-T cell immunotoxin of claim 12, wherein the
toxin moiety binding domain comprises a mutation that reduces toxin
binding activity by at least 1000 fold compared to wild type
toxin.
19. The divalent anti-T cell immunotoxin of claim 17, wherein the
toxin moiety is full length mutant S525F (CRM9).
20. The divalent anti-T cell immunotoxin of claim 18, wherein the
toxin moiety is full length mutant S525F (CRM9).
21. The divalent anti-T cell immunotoxin of claim 19, wherein the
immunotoxin is a fusion protein and the sequence of domains from
the amino terminus from left to right is selected from the group
consisting of: toxin moiety,.mu.CH2,.mu.CH3,VL,L,VH; toxin
moiety,.mu.CH2,.mu.CH3,.m- u.CH4,VL,L,VH; toxin
moiety,.gamma.CH3,H,VL,L,VH; toxin moiety,H,VL,L,VH; and toxin
moiety,.mu.CH2,VL,L,VH, toxin moiety,VL,L,VH,H,.gamma.CH3 toxin
moiety,VL,L,VH,.mu.CH2 toxin moiety,VL,L,VH,L,VL,L,VH wherein L is
a (G4S)3 linker, VL and VH are the variable light and heavy domains
of the anti-CD3 antibody UCHT1, and H is the .gamma.IgG hinge.
22. The divalent anti-T cell immunotoxin of claim 20, wherein the
immunotoxin is a fusion protein and the sequence of domains from
the amino terminus from left to right is selected from the group
consisting of: toxin moiety,.mu.CH2,.mu.CH3,VL,L,VH; toxin
moiety,.mu.CH2,.mu.CH3,.m- u.CH4,VL,L,VH; toxin
moiety,.gamma.CH3,H,VL,L,VH; toxin moiety,H,VL,L,VH; and toxin
moiety,.mu.CH2,VL,L,VH, toxin moiety,VL,L,VH,H,.gamma.CH3 toxin
moiety,VL,L,VH,.mu.CH2 toxin moiety,VL,L,VH,L,VL,L,VH wherein L is
a (G4S)3 linker, VL and VH are the variable light and heavy domains
of the anti-CD3 antibody UCHT1, and H is the .gamma.IgG hinge.
23. The divalent anti-T cell immunotoxin of claim 17, wherein the
toxin moiety is truncated at 390 or 486.
24. The divalent anti-T cell immunotoxin of claim 18, wherein the
toxin moiety is truncated at 390 or 486.
25. The divalent anti-T cell immunotoxin of claim 23, wherein the
immunotoxin is a fusion protein and the sequence of domains from
the amino terminus from left to right is selected from the group
consisting of: toxin moiety,.mu.CH2,.mu.CH3,VL, L,VH; toxin
moiety,.mu.CH2,.mu.CH3,.- mu.CH4,VL,L,VH; toxin
moiety,.gamma.CH3,H,VL,L,VH; toxin moiety,H,VL,L,VH; and toxin
moiety,.mu.CH2,VL,L,VH toxin moiety,VL,L,VH,H,.gamma.CH3 toxin
moiety,VL,L,VH,.mu.CH2 toxin moiety,VL,L,VH,L,VL,L,VH wherein L is
a (G4S)3 linker, VL and VH are the variable light and heavy domains
of the anti-CD3 antibody UCHT1, and H is the .gamma.IgG hinge.
26. The divalent anti-T cell immunotoxin of claim 24, wherein the
immunotoxin is a fusion protein and the sequence of domains from
the amino terminus from left to right is selected from the group
consisting of: toxin moiety,.mu.CH2,.mu.CH3,VL,L,VH; toxin
moiety,.mu.CH2,.mu.CH3,.m- u.CH4,VL,L,VH; toxin
moiety,.gamma.CH3,H,VL,L,VH; toxin moiety,H,VL,L,VH; and toxin
moiety,.mu.CH2,VL,L,VH toxin moiety,VL,L,VH,H,.gamma.CH3 toxin
moiety,VL,L,VH,.mu.CH2 toxin moiety,VL,L,VH,L,VL,L,VH wherein L is
a (G4S)3 linker, VL and VH are the variable light and heavy domains
of the anti-CD3 antibody UCHT1, and H is the .gamma.IgG hinge.
27. A method of inhibiting a rejection response by inducing immune
tolerance in a recipient to foreign mammalian donor cells,
comprising the steps of: a) exposing the recipient to an
immunotoxin so as to safely reduce the recipients's T-cell
lymphocyte population by at least 80%; and b) transplanting the
donor cells into the recipient, such that a rejection response by
the recipient to the donor organ cell is inhibited.
28. The method of claim 27, wherein the immunotoxin is the
immunotoxin of claim 1.
29. The method of claim 27, wherein the immunotoxin is the
immunotoxin of claim 2.
30. The method of claim 27, wherein the donor cells constitute an
organ.
31. The method of claim 27, wherein the donor cells constitute
tissue from an organ.
32. The method of claim 27, wherein the donor cells are
allogeneic.
33. The method of claim 27, wherein the donor cells are
xenogeneic.
34. The method of claim 27, further comprising administering an
immunosuppressant compound to enhance the anti-T cell effects of
the immunotoxin.
35. The method of claim 34, wherein the immunosuppressant compound
blocks IL-12-induced induction of interferon-.gamma..
36. The method of claim 34, wherein the immunosuppressant compound
is mycophenolate mofetil.
37. The method of claim 34, wherein the immunosuppressant compound
is deoxyspergualin.
38. The method of claim 27, further comprising administering a
corticosteroid.
39. The method of claim 27, wherein the immunotoxin is administered
from up to several hours before to several days after the
transplanting step.
40. The method of claim 34, wherein the immunosuppressant is
administered beginning within about 0 to 6 hours before the
transplanting step and continuing for up to several weeks after the
transplantation step.
41. The method of claim 40, wherein the donor organ cell is from a
cadaver.
42. The method of claim 27, further comprising administering donor
bone marrow at the same time, or after, the exposure step.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] This invention generally relates to an immunotoxin and to
techniques for inducing immunological tolerance in primates. It
appears to be especially well suited to provide a method for
inhibiting rejection of transplanted organs. The invention further
relates to a method of treating T cell leukemias or lymphomas,
graft-versus-host diseases, and autoimmune diseases by
administering an immunotoxin.
[0003] 2. Background Art
[0004] The number of organ transplants performed in the United
States is approximately 19,000 annually and consists predominantly
of kidney transplants (11,000), liver transplants (3,600), heart
transplants (2,300), and smaller numbers of pancreas, lung,
heart-lung, and intestinal transplants. Since 1989 when the United
Network for Organ Sharing began keeping national statistics,
approximately 190,000 organ transplants have been performed in the
United States. A large but difficult to ascertain number of
transplants were performed in the United States prior to 1989 and a
similarly large number of transplants are performed in Europe and
Australia and a smaller number in Asia.
[0005] Transplant tolerance remains an elusive goal for patients
and physicians whose ideal would be to see a successful, allogeneic
organ transplant performed without the need for indefinite,
non-specific maintenance immunosuppressive drugs and their
attendant side effects. Over the past 10 years the majority of
these patients have been treated with cyclosporin, azathioprine,
and prednisone with a variety of other immunosuppressive agents
being used as well for either induction or maintenance
immunosuppression. The average annual cost of maintenance
immunosuppressive therapy in the United States is approximately
$10,000. While the efficacy of these agents in preventing rejection
is good, the side effects of immunosuppressive therapy are
considerable because the unresponsiveness which they induce is
nonspecific. For example, recipients can become very susceptible to
infection. A major goal in transplant immunobiology is the
development of specific immunologic tolerance to organ transplants
with the potential of freeing patients from the side effects of
continuous pharmacologic immunosuppression and its attendant
complications and costs.
[0006] Anti-T cell therapy (anti-lymphocyte globulin) has been used
in rodents in conjunction with thymic injection of donor cells
(Posselt et al. Science 1990; 249: 1293-1295 and Remuzzi et al.
Lancet 1991; 337: 750-752). Thymic tolerance has proved successful
in rodent models and involves the exposure of the recipient thymus
gland to donor alloantigen prior to an organ allograft from the
same donor. However, thymic tolerance has never been reported in
large animals, and its relevance to tolerance in humans in
unknown.
[0007] One approach to try to achieve such immunosuppression has
been to expose the recipient to cells from the donor prior to the
transplant, with the hope of inducing tolerance to a later
transplant. This approach has involved placement of donor cells
(e.g. bone marrow) presenting MHC Class I antigens in the
recipient's thymus shortly after application of anti-lymphocyte
serum (ALS) or radiation. However, this approach has proved
difficult to adapt to live primates (e.g. monkeys; humans). ALS
and/or radiation render the host susceptible to disease or
side-effects and/or are insufficiently effective.
[0008] If a reliable, safe approach to specific immunologic
tolerance could be developed, this would be of tremendous value and
appeal to patients and transplant physicians throughout the world
with immediate application to new organ transplants and with
potential application to existing transplants in recipients with
stable transplant function. Thus, a highly specific
immunosuppression is desired. Furthermore, there is a need for a
means for imparting tolerance in primates, without the adverse
effects of using ALS or radiation. Moreover, the goal is to achieve
more than simply delaying the rejection response. Rather, an
important goal is to inhibit the rejection response to the point
that rejection is not a factor in reducing average life span among
transplant recipients.
[0009] The present invention meets these needs by providing a
method of inducing immune tolerance.
[0010] Pseudomonas exotoxin A (ETA) has been widely employed for
immunotoxin construction (62-63). However, the only form of
available ETA having reduced receptor binding activity that can be
coupled or fused with a divalent antibody under the restrictions
enumerated above, ETA-60EF61Cys161, is non-toxic to human T cells
at 10 nM over 20 hours when using anti-CD3 antibody UCHT1 or
anti-CD5 antibody T101 (Hybritech Corp., San Diego, Calif.).
ETA-60EF61 achieves loss of binding site activity by insertion of
two amino acids at position between residues 60 and 61. In
addition, coupling is achieved by converting Met 161 to cysteine
permitting thioether linkage. This toxin construct exhibits very
high toxicity when targeted at the human transferrin receptor
(IC50=1 pM) or the murine B cell IgM receptor (64). ETA is known to
be much more difficult to proteolytically process than DT and many
cells cannot perform this function (53-55). It also appears that
the ability to process the toxin by a cell is dependent on the
targeted epitope or the routing pathway (55). The toxin cannot be
processed in vitro like DT because the processing site is "hidden"
at neutral pH and only becomes available at acidic pH which
inactivates toxin in vitro (53).
[0011] Derivatives of ETA which do not require processing have been
made by truncating binding domain I back to the processing site at
residue 280. However, covalent non-reducible couplings cannot be
made to the distal 37 kD structure without greatly decreasing
translocation efficiency. Therefore, these derivatives cannot be
used with divalent antibodies as thioether coupled structures or
fusion structures.
[0012] Disulfide conjugates with divalent antibodies have been
described but they suffer from low in vivo life times due to
reduction of the disulfide bond within the vascular compartment
(62). A sc truncated ETA fusion protein has been described
containing two Fv domains. However, dose response toxicity curves
show only a three fold increase in affinity at best compared to
single Fv constructs, suggesting that the double Fv construct is
not behaving as a typical divalent antibody (65). Consequently, it
would be of considerable utility to have either a form of
ETA-60EF61Cys161 that had less stringent processing characteristics
or did not require processing.
[0013] The present invention provides these derivatives. They can
be used to target T cells with anti-CD3 or other anti-T cell
antibodies either by coupling to available cysteines or as fusion
proteins with the single chain divalent antibodies added at the
amino terminus.
SUMMARY OF THE INVENTION
[0014] It is an object of this invention to provide an immunotoxin
for treating immune system disorders.
[0015] It is a further object of the invention to provide a method
of treating an immune system disorder not involving T cell
proliferation, comprising administering to the afflicted animal an
immunotoxin comprising a mutant diphtheria toxin (DT) or
pseudomonas exotoxin A (ETA) toxin moiety linked to an antibody
moiety. The antibody or targeting moiety preferably routes by a T
cell epitope pathway, for example, the CD3 pathway. Thus, the
present method can treat graft-versus-host disease.
[0016] It is a further object of the invention to provide a method
of inducing immune tolerance. Thus, the invention provides a method
of inhibiting a rejection response by inducing immune tolerance in
a recipient to a foreign mammalian donor tissue or cells,
comprising the steps of: a) exposing the recipient to an
immunotoxin so as to reduce the recipients's peripheral blood and
lymph node T-cell lymphocyte population by at least 75%, preferably
80%, wherein the immunotoxin is anti-CD3 antibody linked to a
diphtheria protein toxin, wherein the protein has a binding site
mutation; or the antibody is linked to a pseudomonas protein
exotoxin A wherein the protein has a binding site mutation and a
second mutation achieving or facilitating proteolytic processing of
the toxin, and b) transplanting the donor cells into the recipient,
whereby a rejection response by the recipient to the donor organ
cell is inhibited, and the host is made tolerant to the donor
cell.
[0017] The objects of the invention therefore include providing
methods of the above kind for inducing tolerance to transplanted
organs or cells from those organs. This and still other objects and
advantages of the present invention will be apparent from the
description which follows.
BRIEF DESCRIPTION OF THE DRAWING
[0018] FIGS. 1a, 1b and 1c show that the epitopes involved in human
serum's inhibition of toxicity lie in the last 150 amino acids of
DT. A schematic diagram of the DT mutants CRM9, CRM197 and MSPA5 is
presented (FIG. 1a). The A- and B-subfragments and their relative
size and position are shown. The filled circle represents a point
mutation as described in the text. Goat (FIG. 1b) or human (FIG.
1c) serum (human serum was a pool from all samples with positive
ELISA for anti-DT antibodies) was incubated with increasing molar
concentrations of CRM197 (-.smallcircle.-), MSP.DELTA.5 (-X-) or
the B-subfragment (-.DELTA.-) of DT for 30 minutes at room
temperature. To this reaction, UCHT1-CRM9 was added to a final
concentration of 1.times.10.sup.-10 M. This mixture was then
diluted 10-fold onto Jurkat cells in a protein synthesis inhibition
assay as described in the Materials and Methods. Immunotoxin
incubated with medium only inhibited protein synthesis to 4% of
controls. The results are representative of two independent
assays.
[0019] FIGS. 2a and 2b show that sFv-DT390 maintains specificity
for the CD3 complex but is 16-fold less toxic than UCHT1-CRM9 to
Jurkat cells. FIG. 2a shows increasing concentrations of sFv-DT390
(-.DELTA.-) or UCHT1-CRM9 (-.smallcircle.-) tested in protein
synthesis inhibition assays as described in the Materials and
Methods. The results are an average of four separate experiments.
FIG. 2b shows increasing concentrations of UCHT1 antibody mixed
with a 1.times.10.sup.-10 M UCHT1-CRM9 (-.smallcircle.-) or
3.3.times.10.sup.-10 M sFv-DT390 (-.DELTA.-) and then added to
cells for a protein synthesis inhibition assay.
[0020] FIG. 3 shows the schematic flow sheet for generation of the
single chain antibody scUCHT1 gene construct. PCR: polymerase chain
reaction; L: linker; SP: signal peptide. P1 to P6, SP1, and SP2 are
primers used in PCR, and listed in table 1.
[0021] FIG. 4 shows the western blotting analysis of the single
chain antibody scUCHT1. scUCHT1 was immunoprecipitated, and
separated on 4-20% SDS/PAGE gradient gel. After transferring to
Problott.TM. membrane, scUCHT1 was visualized by an anti-human IgM
antibody labeled with phosphatase. scUCHT1 secreted was mainly a
dimeric form. Lane 1-3 representing electrophoresis under reducing
conditions, and 4-6 non-reducing conditions. Lane 1 and 6 are human
IgM; lane 1: IgM heavy chain. The light chain is not visible,
because the anti-IgM antibody is directed at the heavy chain; lane
6: IgM pentamer is shown as indicated by the arrow. Lane 2 and 4
scUCHT1 from COS-7 cells; 3 and 5 scUCHT1 from SP2/0 cells.
[0022] FIG. 5 shows that scUCHT1 had the same specificity and
affinity as its parental antibody UCHT1. In the competition assay,
.sup.125I-UCHT1 was used as tracer in binding Jurkat cells. scUCHT1
from COS-7 (.quadrature.) and SP2/0 cells (.DELTA.), or unlabeled
UCHT1 (.smallcircle.) with indicated concentrations were included
as competitor. Results were expressed as a percentage of the
.sup.125I-UCHT1 bound to cells in the absence of competitors.
[0023] FIG. 6 shows that scUCHT1 did not induce human T cell
proliferation response. scUCHT1 from COS-7 (.DELTA.) and SP2/0
(.smallcircle.) cells and UCHT1 (.quadrature.) were added to human
PBMCs at indicated concentrations and T cell proliferation was
assayed by [3H]thymidine incorporation. UCHT1 induced a vigorous
proliferation response. On the contrary, scUCHT1 had little effect
at any doses.
[0024] FIG. 7a shows that UCHT1 and scUCHT1 had little effect on
TNF-.alpha. secretion, and scUCHT1 from both COS-7 (.DELTA.) and
SP2/0 (.smallcircle.) cells and UCHT1 (.quadrature.) were added to
cultures of human blood mononuclear cells. Culture supernatant was
harvested and used for ELISA determination of TNF-.alpha. and
IFN-.gamma. as described in materials and methods.
[0025] FIG. 7b shows that UCHT1 and scUCHT1 inhibited the basal
production of IFN-.gamma.. scUCHT1 from both COS-7 (.DELTA.) and
SP2/0 (.smallcircle.) cells and UCHT1 (.quadrature.) were added to
cultures of human blood mononuclear cells. Culture supernatant was
harvested and used for ELISA determination of TNF-.alpha. and
IFN-.gamma. as described in materials and methods.
[0026] FIG. 8 is a western blot showing the secreted scUCHT1
immunotoxin.
[0027] FIG. 9 shows one clone expressing the divalent immunotoxin
fusion protein.
[0028] FIG. 10a shows CD3+ cell depletion and recovery in
peripheral blood following immunotoxin treatment. Days refer to
days after the first dose of immunotoxin.
[0029] FIG. 10b shows CD3+ cell depletion in lymph nodes following
immunotoxin treatment.
[0030] FIG. 11 is a schematic of several divalent coupled
immunotoxins wherein the single chain antibody variable light (VL)
and variable heavy (VH) cloned murine domains are connected by a
linker (L) and fused with either the .mu.CH2 of human IgM or hinge
region of .gamma.IgG (H) to provide the interchain disulfide that
forms the divalent structure. The toxins are coupled either to a
added carboxy terminal cysteine (C) of .gamma.CH3 or to C414 of
.mu.CH3 or to C575 of .mu.CH4 via a thioether linkage. The toxin
moieties based on DT or ETA are binding site mutants containing a
cysteine replacement within the binding chain. ETA based toxins
have been additionally altered to render them independent of
proteolytic processing at acidic pH. Schematics show proteins with
amino terminus on the left.
[0031] FIG. 12 is a schematic of a several divalent coupled
immunotoxins similar to FIG. 11 except that the VL and VH domains
are generated on separate chains from a dicystronic expression
vector. These constructs have the advantage of enhanced antibody
moiety stability.
[0032] FIG. 13 is a schematic of several divalent immunotoxin
single chain fusion proteins based on ETA wherein the ETA catalytic
domain occupies the carboxy terminus of the fusion protein.
Interchain disulfides are generated as in FIG. 11. The ETA based
mutant toxins have been additionally altered to render them
independent of proteolytic processing at acidic pH, permitting
translocation of the free 37 kD catalytic domain following neutral
pH processing and reduction.
[0033] FIG. 14 is a schematic of several divalent single chain
immunotoxin fusion proteins similar to FIG. 13 except based on DT
wherein the DT catalytic domain occupies the amino terminus of the
fusion protein, permitting translocation of the free toxin A chain
following neutral pH processing and reduction.
[0034] FIG. 15 shows the rise in serum IL-12 following FN18-CRM9
immunotoxin treatment in post kidney transplant monkeys with and
without treatment with DSG (deoxyspergualin) and solumedrol.
[0035] FIG. 16 shows the rise in serum IFN-gamma following
FN18-CRM9 immunotoxin treatment in post kidney transplant monkeys
with and without treatment with DSG and solumedrol. The treatment
dramatically attenuates the rise of IFN-gamma.
[0036] FIG. 17 shows that DSG and solumedrol treatment in the
peritransplant period following immunotoxin suppresses weight gain,
a sign of vascular leak syndrome related to IFN-gamma
elevation.
[0037] FIG. 18 shows that DSG and solumedrol treatment in the
peritransplant period following immunotoxin suppresses
hypoproteinemia, a sign of vascular leak syndrome related to
IFN-gamma elevation.
DETAILED DESCRIPTION OF THE INVENTION
[0038] The invention provides immunotoxins and methods of using
them to induce immune tolerance and to treat disease.
[0039] Immunotoxin.
[0040] The present invention relates to an immunotoxin. More
specifically, an immunotoxin comprising a mutant toxin moiety
(e.g., DT toxin or ETA toxin) linked to a single chain (sc)
variable region antibody moiety (targeting moiety) is provided.
Thus, the invention provides an immunotoxin having recombinantly
produced antibody moiety linked (coupled) to a recombinantly
produced toxin moiety and a fusion immunotoxin (where both toxin
and antibody domains are produced from a recombinant construct). As
the application provides the necessary information regarding the
arrangement of toxin and antibody domains, and the sub regions
within them, it will be recognized that any number or chemical
coupling or recombinant DNA methods can be used to generate an
immunotoxin or the invention. Thus, reference to a fusion toxin or
a coupled toxin is not necessarily limiting.
[0041] The antibody moiety preferably routes by the anti-CD3
pathway or other T cell epitope pathway. The immunotoxin can be
monovalent, but divalent antibody moieties are presently preferred
since they have been found to enhance cell killing by about 15
fold. The immunotoxin can be a fusion protein produced
recombinantly. The immunotoxin can be made by chemical thioether
linkage at unique sites of a recombinantly produced divalent
antibody (targeting moiety) and a recombinantly produced mutant
toxin moiety. The targeting moiety of the immunotoxin can comprise
the human .mu.CH2, .mu.CH3 and .mu.CH4 regions and VL and VH
regions from murine Ig antibodies. These regions can be from the
antibody UCHT1 so that the antibody moiety is scUCHT1, which is a
single chain CD3 antibody having human .mu.CH2, .mu.CH3 and .mu.CH4
regions and mouse variable regions as shown in the figures. These
are believed to be the first instances of sc anti-CD3 antibodies.
Numerous DT mutant toxin moieties are described herein, for example
DT390. Thus, as just one specific example the immunotoxin, the
invention provides scUCHT1-DT390. Derivatives of this immunotoxin
are designed and constructed as described herein. Likewise, ETA
immunotoxins are also described herein.
[0042] The toxin moiety retains its toxic function, and membrane
translocation function to the cytosol in full amounts. The loss in
binding function located in the receptor binding domain of the
protein diminishes systemic toxicity by reducing binding to
non-target cells. Thus, the immunotoxin can be safely administered.
The routing function normally supplied by the toxin binding
function is supplied by the targeting antibody anti-CD3. The
essential routing pathway is (1) localization to coated pits for
endocytosis, (2) escape from lysosomal routing, and (3) return to
the plasma membrane. In addition, ETA may also route through late
endosomes and into endoplasmic reticulum through the Golgi
compartment. An advantage of using ETA rather than DT is that its
different routing may better complement T cell epitopes other than
CD3 which may exist on certain T cell subsets. A further advantage
is that very few humans contain antibodies to ETA as is the case
with DT. Specific examples are described below.
[0043] Any antibody which can route in this manner will be
effective with the toxin moiety, irrespective of the epitope to
which the antibody is directed, provided that the toxin achieves
adequate proteolytic processing along this route. Adequate
processing can be determined by the level of cell killing. This
processing is particularly important for ETA and is absent in
certain cells (53-55). Therefore, ETA mutants in which the
processing has been performed during synthesis or mutants which
facilitate in vitro or in vivo processing are described. Thus, a
wide variety of cell types can be targeted.
[0044] When antibodies dissociate from their receptors due to
changes in receptor configuration induced in certain receptors as a
consequence of endosomal acidification, they enter the lysosomal
pathway. This can be prevented or minimized by directing the
antibody towards an ectodomain epitope on the same receptor which
is closer to the plasma membranes (Ruud, et al. (1989) Scand. J.
Immunol. 29:299; Herz et al. (1990) J. Biol. Chem. 265:21355).
[0045] The mutant DT toxin moiety can be a truncated mutant, such
as DT390, DT383, DT370 or other truncated mutants, as well as a
full length toxin with point mutations, such as DTM1, as described
in Examples 9-11, or CRM9 (cloned in C. ulcerans), scUCHT1 fusion
proteins with DTM1 and DT483, DT390 and DT370 have been cloned and
expressed in E. coli. The antibody moiety can be scUCHT1 or other
anti-CD3 or anti-T cell antibody having the routing and other
characteristics described in detail herein. Thus, one example of an
immunotoxin for use in the present methods is the fusion protein
immunotoxin UCHT1-DT390. In principal, described immunotoxins can
be used in the methods of the invention.
[0046] The recombinant immunotoxins can be produced from
recombinant sc divalent antibody or recombinant dicystronic
divalent antibody and recombinant mutant toxins each containing a
single unpaired cysteine residue. An advantage of this method is
that the toxins are easily produced and properly folded by their
native bacteria while the antibodies are better produced and folded
in eukaryote cells. In addition, this addresses differences in
coding preferences between eukaryotes and prokaryotes which can be
troublesome with some immunotoxin fusion proteins.
[0047] The general principles of producing the present divalent
recombinant anti-T cell immunotoxins are:
[0048] 1. The disulfide bond bridging the two monovalent chains is
chosen from a natural Ig domain, for example from .mu.CH2 (C337 of
residues 228-340 or the .gamma.IgG hinge region, C227 of residues
216-238 [with C220P])(see FIGS. 11-14).
[0049] 2. Sufficient non-covalent interaction between the
monovalent chains is supplied by including domains having high
affinity interactions and close crystallographic or solution
contacts, such as .mu.CH2, .mu.CH4 (residues 447-576) or .gamma.CH3
(residues 376-346). These non-covalent interactions facilitate
proper folding for formation of the interchain disulfide bond.
[0050] 3. For fusion immunotoxins the orientation of the antibody
to the toxin is chosen so that the catalytic domain of the toxin
moiety becomes a free entity when it undergoes proteolysis at its
natural processing site under reducing conditions. Thus, in the ETA
based IT, the toxin moiety is at the carboxy terminus (FIG. 13) and
in DT based fusion IT the DT based toxin moiety is at the amino
terminus of the fusion protein (FIG. 14).
[0051] 4. For chemically coupled immunotoxins, a single cysteine is
inserted within the toxin binding domain. The antibody is
engineered to have only a single free cysteine per chain which
projects into the solvent away from interchain contacts such as
.mu.CH3 414, .mu.CH4 575 or the addition to .mu.CH3 at C447.
Crystal structure indicates this region is highly solvent
accessible. Excess free cysteines are converted to alanine (FIGS.
11-12).
[0052] 5. Toxins are mutated in their binding domain by point
mutations, insertions or deletions, have at least a 1000 fold
reduction in binding activity over wild type, and are free of
translocation defects.
[0053] 6. Toxin binding site mutants, if not capable of proteolytic
processing at neutral pH, are modified in the processing region to
achieve this result.
[0054] A binding site mutant (CRM9) of full length diphtheria toxin
residues 1-535 using the numbering system described by Kaczovek et
al. (56) S525F (57) can be further modified for chemical coupling
by changing a residue in the binding domain (residues 379-535) to
cysteine. Presently preferred residues are those with exposed
solvent areas greater than 38%. These residues are K516, V518,
D519, H520, T521, V523, K526, F530, E532, K534 and S535 (57). Of
these K516 and F530 are presently preferred since they are likely
to block any residual binding activity (57). However, maximal
coupling of the new cysteine residue will be enhanced by the
highest exposed solvent surface and proximity to a positively
charged residue (which has the effect of lowering cysteine --SH
pKa). These residues are at D519 and S535 so that these are
presently preferred from the above list of possibilities.
[0055] A double mutant of DT containing the S525F mutation of CRM9
plus an additional replacement within the 514-525 exposed binding
site loop to introduce a cysteine coupling site for example T521C
can be produced in Corynebacterium ulcerans preceded by the CRM9
promoter and signal sequence. The double mutant is made in
Corynebacterium ulcerans by a recombination event between the
plasmid producing CRM9-antibody fusion protein and PCR generated
mutant DNA with a stop codon at 526 (gapped plasmid mutagenesis).
This CRM9-C's can be used to form specific thioether mutant toxin
divalent antibody constructs by adding excess bismaleimidohexane to
CRM9-C's and coupling to single chain divalent antibody containing
a free cysteine at either the end of the .mu.CH4 domain or the
.mu.CH3 domain (see Ser. No. 08/739,703, hereby incorporated by
reference).
[0056] These and other mutations are accomplished by gapped plasmid
PCR mutagenesis (58) using the newly designed E. coli/C. ulcerans
shuttle vector yCE96 containing either the double mutant DT S508F
S525F or a CRM9 COOH terminus fusion protein construct having
reduced toxicity due to the COOH terminal added protein domain
(59). The sequence of vector yCE96 is shown in SEQ ID NO:1.
Residues from positions 1 to 373 and 2153 to 3476 are from the
vector LITMUS 29 and contain the polycloning linker sites and the
ampicillin resistance marker respectively. Residues from positions
374 to 2152 were the origin sequences from the plasmid pNG2. Both
of these constructs follow current NIH guidelines for cloning DT
derivatives into E. coli (60) in that they contain two mutations
which both individually diminish toxicity and therefore greatly
reduce the chance of introducing a wild type toxin into E. coli by
a single base pair reversion.
[0057] The mutagenesis is performed by deleting the COOH terminal
52 base pairs of the toxin construct using the restriction site Sph
I at the toxin nucleotide position 1523 (56) and the restriction
site used to clone the COOH terminal part of the toxin into the
polylinker cloning sites of CE96 (Xba or BamHI for example). Since
Sph I, Xba, and BamHI only occur singly within vector yCE96
containing the inserted toxin construct, a gapped linearized
plasmid deleted in the COOH terminal coding region is the result.
Using PCR the COOH terminal region of CRM9 is rebuilt introducing
the desired mutation and including 30-40 base pairs homologous to
the down stream and upstream regions adjacent to the gap. The
amplified product is gel purified and electroporated into C.
ulcerans along with the gapped plasmid (58). Recombination at the
homologous regions occurs intracellularly accomplishing site
specific mutagenesis of DT products within Corynebacteriae which
are not specifically subject to NIH toxin cloning restrictions
(60). An example of a novel vectors is the yCE96, the sequence of
which is provided in SEQ ID NO:1.
[0058] The mutated toxins are produced and purified analogously to
the parent toxin except that low levels of reducing agent
(equivalent to 2 mM betamercaptoethanol) are included in the
purification to protect the unpaired introduced --SH group.
Thioether chemical coupling is achieved to a single unpaired
cysteine within the divalent antibody construct at either residue
414 in domain .mu.CH3 (see FIGS. 11-12) or residue 575 in domain
.mu.CH4 when this domain is included. In this case domain .mu.CH3
is mutated C414A to provide only a single coupling site. An
advantage of including .mu.CH4 is enhanced stability of the
divalent antibody. A disadvantage is that the extra domain
increases size and thereby reduces the secretion efficiency during
antibody production. The advantage of terminating with the CH3
domain is that, in another variant, a His6 purification tag can be
added at the .mu.CH3 COOH terminus to facilitate antibody
purification. Another variant is to use the .gamma. hinge region to
form the interchain disulfide and to couple through a .mu.CH3 or
.mu.CH4. This variant has the advantage of being smaller in size
and places the toxin moiety closer to the CD3 epitope binding
domains, which could increase toxin membrane translocation
efficiency (see FIGS. 11-12). A His tag can be included at the
carboxy terminus as a purification aid. SH- CRM9 is concentrated to
10 mg/ml in PBS pH 8.5 and reacted with a 15 fold molar excess of
bismaleimidohexane (BMH) (Pierce, Rockford, Ill.). Excess BMH is
removed by passing over a small G25F column (Pharmacia, Piscataway,
N.J.). The maleimide derived toxin at about 5 mg/ml is now added to
scUCHT1 divalent antibody at 10 mg/ml at room temperature. After 1
hr the conjugate is separated from non-reactive starting products
by size exclusion HPLC on a 2 inch by 10 inch MODcol column packed
with Zorbax (DuPont) GF250 6 micron resin (for large scale
production). Derivatives of ETAG0EF61cys161 are also coupled to
scUCHT1 divalent antibody by the same method.
[0059] Another variant of the divalent antibody that can be used
for coupling to CRM9 containing an added cysteine is an engineered
chimeric antibody containing the VL and VH regions of UCHT1.
However, in this case the VL domain is followed by the kappa CL
domain followed by a stop codon. The amino terminus of this
construct contains the VL signal sequence. This gene is inserted in
an appropriate vector dependent on the expression system and
preceded by an appropriate promoter. The vector also contains a
second promoter followed by the VH signal sequence, VH from UCHT1
followed by .mu.CH1, .mu.CH2, .mu.CH3 and .mu.CH4. If .mu.CH4 is
included Cys 575 is changed to alanine and coupling is performed as
previously described through Cys 414 of .mu.CH3. .mu.CH4 may
however be deleted. A carboxy terminal His tag can be used to
facilitate purification. This construct will be secreted as a
properly folded divalent antibody containing .mu. heavy chains from
eukaryote cells. It will be a monomeric antibody due to the
deletion of Cys 575. The advantage of this construct is the
enhanced stability of the VL VH association provided by the CH1 and
CL domains, and the enhanced secretion due to the fact that the
heavy chains are preceded by a heavy chain signal sequence, in
contrast to the case in single chain antibody construction where
the light chain signal sequence is used for secreting the entire
single chain structure (Peisheng et al., 1995).
[0060] Divalent anti-T cell fusion immunotoxins based on DT are
provided, wherein the toxin domain (also referred to herein as
"toxin moiety" or "tox") is either full length mutant S525F (CRM9)
or truncated at 390 or 486 (collectively Tox) and the sequence of
domains from the amino terminus from left to right can be selected
from among the following:
[0061] Tox,.mu.CH2,.mu.CH3,VL,L,VH where L is a (G4S)3 linker and
VL and VH are the variable light and heavy domains of the anti-CD3
antibody UCHT1.
[0062] Tox,.mu.CH2,.mu.CH3,.mu.CH4,VL,L,VH
[0063] Tox,.gamma.CH3,H,VL,L,VH where H is the .gamma.IgG hinge
[0064] Tox,H,VL,L,VH
[0065] Tox,.mu.CH2,VL,L,VH
[0066] Tox,VL,L,VH,H,.gamma.CH3
[0067] Tox,VL,L,VH,.mu.CH2
[0068] Tox,VL,L,VH,L,VL,L,VH
[0069] (see FIG. 14).
[0070] Requirements of Non-diphtheria Toxin Based Anti-T Cell
Divalent Immunotoxins.
[0071] Other types of protein toxin moieties can be utilized in
anti-T cell immunotoxins for the induction of tolerance and the
treatment of autoimmune diseases and GVHD. All that is required is
that a 1-2 log kill of T cells within the blood and lymph node
compartments can be achieved without undue systemic toxicity. This
in turn requires that the routing epitope routes in parallel with
the toxin intoxication pathway and that binding site mutants are
available or that toxins truncated in their binding domain are
available that reduce toxin binding by 1000 fold compared to wild
type toxins without compromising toxin translocation efficiency
(see U.S. Pat. No. 5,167,956 issued Dec. 1, 1992). In addition when
using targeting via antibodies, divalent antibodies are generally
required under in vivo conditions to achieve sufficient cell
killing due to the 15 fold lower affinity of monovalent antibodies
(FIGS. 2a, 2b). However, the method of linking the toxin to the
divalent antibody either as a single chain fusion protein or
through specific engineered coupling sites must not interfere with
translocation efficiency. This could occur due to the larger size
of many divalent antibodies compared to monovalent scFv antibodies
unless care is taken so that the catalytic domain of the toxin can
achieve unencumbered translocation. This is achieved for DT based
immunotoxins using DT based binding site mutants where the fusion
protein antibody moiety is contiguous with the COOH terminus of the
toxin binding chain as described above (FIG. 14). This allows the
catalytic A chain to translocate as soon as the disulfide loop
spanning the Arg/Ser proteolytic processing site residues 193/194
is reduced. Most targeted cells are capable of performing this
processing event, and when chemically coupled CRM9 is used the
processing is performed by trypsin prior to coupling. The impact of
this relationship for non-DT immunotoxins is further described
below.
[0072] Pseudomonas Exotoxin A Derivatives Freed from Processing
Restrictions
[0073] ETA-60EF61Cys161 can be made with a break in the peptide
backbone between residues 279-280, when the proteolytic processing
site is synthesized from a dicystronic message. Nucleotides coding
residues 1-279 are placed behind the toxin promoter and followed by
a stop codon. The promoter is repeated followed by a second stop
codon. ITs made in this manner are referred to as a "dicystronic".
A large fraction of the secreted protein will be in the form of the
full length properly folded protein held together by the S-S loop
265-287 spanning the peptide backbone break at 279/280 much the
same way that antibody Fd pieces are produced from dicystronic
messages of heavy and light chains (66). Other expression vectors
can be used. This construct is referred to as
ETA-60EF61Cys161,279//280.
[0074] ETA-60EF61Cys161 and ETA-60EF61 can be modified by site
specific mutagenesis in the region of the processing site and
bridging S--S loop 265-287 to make this region more similar to that
in DT which is easily processed in vitro at neutral pH or in vivo
ecto cell membrane associated furin prior to endosomal
acidification. Three additional mutants are described having
increasing similarity to DT in this area. They are shown for the
Cys 161 derivative, but can also be made without the Cys
substitution for use in fusion proteins, the added residues for the
antibody domains being supplied at the amino terminus (FIGS. 11,
12, 13).
[0075] Divalent anti-T cell fusion immunotoxins based on
pseudomonas exotoxin A is provided, wherein the toxin moiety
(collectively known as Tox2) is a full length mutant binding site
insertional mutant ETA60EF61 that has been further modified in its
proteolytic processing region to permit neutral pH proteolytic
trypsin/furin like processing can be as follows:
[0076] ETA-60EF61,M161C,P278R
[0077] ETA-60EF61,M161C,P278R,Q277V,H275N,R274G
[0078] ETA-60EF61,M161C,P278R,Q277V,H275N,R274G,T273A,
F272C,C265A.
[0079] The sequence of domains in these immunotoxins from the amino
terminus from left to right can be selected from the following:
[0080] VL,L,VH,H,.mu.CH3,Tox2
[0081] VL,L,VH,H,.mu.CH4,Tox2
[0082] VL,L,VH,.mu.CH2,.mu.CH4,Tox2
[0083] VL,L,VH,.mu.CH2,.mu.CH3,.mu.CH4,Tox2.
[0084] VL,L,VH,H,Tox2
[0085] Divalent anti-T cell thioether coupled immunotoxins the full
length toxin binding site mutant moiety contains a binding domain
conversion to cysteine (collectively known as Tox3) based on
pseudomonas exotoxin A ETA60EF61Cys161, where Cys161 is an
engineered replacement of Met161 for coupling purposes. The ETA
toxin moiety can be further modified to permit proteolytic
processing or synthesized in a processed form. Alternatively, if
the toxin moiety is based on full length diphtheria toxin, it can
include the following mutations:
[0086] S525F, K530C
[0087] S525F, K516C
[0088] S525F, D519C
[0089] S525F, S535C.
[0090] In these immunotoxins, the sequence of domains from the
amino terminus from left to right can be selected from the
following:
[0091] VL,L,VH,H,.gamma.CH3,C where C is a non-native C terminal
cysteine coupling residue,
[0092] VL,L,VH,H,.mu.CH4 where coupling is via .mu.CH4 C575,
[0093] VL,L,VH.sub.11CH2,.mu.CH4 where coupling is via .mu.CH4
C575, and
[0094] VL,L,VH,.mu.CH2,.mu.CH3,.mu.CH4 where C575A where coupling
is via .mu.CH3 C414.
[0095] Divalent dicystronic anti-T cell thioether coupled
immunotoxins wherein the full length toxin binding site mutant
moiety contains a binding domain conversion to cysteine
(collectively known as Tox2) based on pseudomonas exotoxin A
ETA60EF61Cys161 or further modified to permit proteolytic
processing, or synthesized in a processed form are provided.
Alternatively, if based on full length diphtheria toxin they can
include the following mutations:
[0096] S525F, K530C
[0097] S525F, K516C
[0098] S525F, D519C
[0099] S525F, S535C.
[0100] In these immunotoxins, one cystron secretes from the amino
terminus a fusion protein of the variable heavy domain of UCHT1
followed by the .gamma. constant light domain and the other cystron
secretes one of the following domains from the amino terminus from
left to right:
[0101] VL,.gamma.CH1,H,.mu.CH3,.mu.CH4, where C575A and coupling is
via .mu.CH3 C414,
[0102] VL,.gamma.CH1,H,.mu.CH4, and coupling is via .mu.CH4
C575,
[0103] VL,.gamma.CH1,H,.mu.CH3,C, where C is an engineered C
terminal cysteine coupling residue, and
[0104] VL,.gamma.CH1,H,.mu.CH4, where coupling is via .mu.CH4
C575.
[0105] Pseudomonas exotoxin A ETA60EF61Cys161 can be further
modified to achieve a peptide backbone break between residue
279/280 by expression in a dicystronic construct encoding separate
mRNAs for Pseudomonas residues 1-279 and residues 280-612. This
immunotoxin does not require proteolytic processing.
[0106] The antibody-toxin constructs of the invention can be
expected to be effective as immunotoxins, because the relevant
parameters are known. The following discussion of parameters is
relevant to the use of the immunotoxin in tolerance induction. The
relevant binding constants, number of receptors and translocation
rates for humans have been determined and used. Binding values for
anti-CD3-CRM9 for targeted and non-targeted cells in vitro and
rates of translocation for the anti-CD3-CRM9 conjugate to targeted
and non-targeted cells in vitro are described (Greenfield et al.
(1987) Science 238:536; Johnson et al. (1988) J. Biol. Chem.
263:1295; Johnson et al. (1989) J. Neurosurg. 70:240; and Neville
et al. (1989) J. Biol. Chem. 264:14653). The rate limiting
translocation rate to targeted cells in vitro is recited in FIG.
2a, wherein it is shown that an anti-CD3-CRM9 conjugate at
10.sup.-11 M is translocated to about 75% of the target cells
present as measured by inhibition of protein synthesis in about 75%
of cells with 20 hours. Inhibition of protein synthesis is complete
in cells into which the conjugate translocates.
[0107] Parameters determined in in vivo studies in nude mice
include the following: Tumor burden is described in Example 1 as a
constant mass equal to 0.1% of body weight; the receptor number and
variation of receptor number are described in Example 3; "favorable
therapeutic margin" is defined as an in vivo target cell 3 log kill
at 0.5 MLD (minimum lethal dose) comparison of efficacy with an
established treatment of 0.5 MLD immunotoxin equivalent (group 1)
to a radiation dose of 500-600 cGy (groups 8 and 9).
[0108] The parameters determined in vitro allowed the prediction of
success in the in vivo nude mouse study. The prediction of in vivo
success was verified by the data in Examples 3-4. Using the target
cell number from the mouse study as being equivalent to the local T
cell burden in a monkey or man successful T cell ablation and
immunosuppression in monkeys could be predicted. This prediction
has been verified by the monkey data in Examples 5 and 7-8. Using
the same parameters, a scientist skilled in this field can make a
prediction of success in humans with confidence, because these
parameters have been previously shown to have predictive
success.
[0109] In another embodiment, the present invention relates to a
pharmaceutical composition comprising anti-CD3-DT mutant in an
amount effective to treat T cell leukemias or lymphomas which carry
the CD3 epitope, graft-versus-host disease or autoimmune diseases,
and a pharmaceutically acceptable diluent, carrier, or excipient.
One skilled in the art will appreciate that the amounts to be
administered for any particular treatment protocol can readily be
determined. Suitable amounts might be expected to fall within the
range of 0.1 to 0.2 mg (toxin content) per kg of body weight over
one to three days.
[0110] Non-Toxic Mutant of Diphtheria Toxin.
[0111] Most human sera contain anti-DT neutralizing antibodies from
childhood immunization. To compensate for this the therapeutic dose
of anti-CD3-CRM9 can be appropriately raised without affecting the
therapeutic margin. Alternatively, the present application provides
a non-toxic DT mutants reactive with neutralizing antisera (e.g.,
CRM197)that can be administered in conjunction with the
immunotoxin.
[0112] A non-toxic mutant of diphtheria toxin for use in the
present methods can be DTM2 or CRM197. DTM2 and CRM197 are
non-toxic mutants of DT, having a point mutation in the enzymatic
chain. The non-toxic mutant can be DT E148S, S525F. However, they
have the full antigenic properties of DT and CRM9, and CRM197 is
used for immunization (Barbour et al. 1993. Pediatr Infect. Dis. J.
12:478-84). Other non-toxic DT mutants that can be used in the
present method will share the characteristic of either totally
lacking A chain enzymatic activity or attenuating its activity by
about a 1000 fold or more.
[0113] The purpose of administering the non-toxic toxin is to bind
preexisting anti-CRM9 anti-DT antibodies in a subject and compete
with their effect and/or induce their removal from the circulation.
This substantially avoids any host immune response to the
immunotoxin that might interfere with the activity of the
immunotoxin. The protein synthesis inhibition assay in the presence
of human serum samples or pooled human sera described in the
Examples becomes an important part of the evaluation of the optimal
immunotoxin for the individual patient and is provide for this
purpose. This assay makes routine the systematic evaluation of
additional combinations of DT point mutations and carboxy terminal
deletions for the purpose of minimizing blockade of immunotoxin in
vivo by anti-human antitoxin.
[0114] The non-toxic mutant is preferably administered concurrently
with or shortly before the immunotoxin. For example, the non-toxic
DT mutant can be administered within an hour, and preferably about
5 minutes prior to the administration of immunotoxin. A range of
doses of the non-toxic mutant can be administered. For example, an
approximately 3 to 100 fold excess of non-toxic mutant over the
CRM9 content of the immunotoxin to be administered can be
administered by i.v. route.
[0115] Another use of the non-toxic DT mutant in the present
methods is to run recipient patient's blood through a column
containing the non-toxic DT mutant to remove some or all of the
patients serum antibodies against DT.
[0116] Method of Inducing Immune Tolerance.
[0117] One embodiment to the invention provides a method of
inhibiting a rejection response by inducing immune tolerance in a
recipient to a foreign mammalian donor organ cell by exposing the
recipient to an immunotoxin so as to reduce the recipients's
peripheral blood T-cell lymphocyte population by at least 80%, and
preferably 95% or higher, wherein the immunotoxin is an anti-CD3
antibody linked to a diphtheria protein toxin, and wherein the
protein has a binding site mutation. The term "donor cell" refers
to a donor organ or a cell or cells of the donor organ, as
distinguished from donor lymphocytes or donor bone marrow. When the
donor organ or cells of the donor is transplanted into the
recipient, a rejection response by the recipient to the donor organ
cell is inhibited and the recipient is tolerized to the donor organ
cell. Alternatively, a non-toxic DT mutant such as DTM2 or CRM197
can first be administered followed by the immunotoxin. This method
can use any of the immunotoxins (e.g., anti-CD3-CRM9,
scUCHT1-DT390, etc.) or non-toxic DT mutants described herein with
the dosages and modes of administration as described herein or
otherwise determined by the practitioner.
[0118] As further described in the Examples, the above-described
method for inducing tolerance can be augmented by additional
treatment regimens. For example, the method can further include
administering to the thymus gland a thymic apoptosis signal before,
at the same time, or after, the immunotoxin exposure step. The
thymic apoptosis signal can be high dose corticosteroids (also
referred to as "immunosuppressants" in this context). The thymic
apoptosis signal can be lymphoid irradiation.
[0119] In a further example of the method of inducing tolerance,
thymic injection of donor leukocytes or lymphocytes having MHC
antigen of the same haplotype as the MHC of the donor cell can be
administered to the recipient. Thymic injection of a saline
solution or a crystalloid or colloid solution to disrupt thymic
integrity and increase access of immunotoxin to the thymus can also
be beneficial.
[0120] The present tolerance induction method can also include
administering an immunosuppressant compound before, at the same
time, or after, the immunotoxin exposure step. The
immunosuppressant compound can be cyclosporin or other
cyclophylins, mycophenolate mofetil (Roche), deoxyspergualin
(Bristol Myers) FK506 or other known immunosuppressants. It will be
appreciated that certain of these immunosuppressants have major
effects on cytokine release occurring in the peritransplant period
that may aid in the induction of the tolerant state. The method of
inducing immune tolerance can further comprise administering donor
bone marrow at the same time, or after, the exposure step.
[0121] Any one, two, or more of these adjunct therapies can be used
together in the present tolerance induction method. Thus, the
invention includes at least six methods of inducing tolerance using
immunotoxin (IT): (1) tolerance induction by administering IT
alone; (2) tolerance induction by administering IT plus other drugs
that alter thymic function such as high dose corticosteroids; (3)
tolerance induction by administering IT plus immunosuppressant
drugs such as mycophenolate mofetil and/or deoxyspergualin (4)
tolerance induction by administering IT plus other drugs that alter
thymic function, plus immunosuppressant drugs; (5) tolerance
induction by administering IT and bone marrow; and (6) tolerance
induction by administering IT plus bone marrow, plus other drugs
that alter thymic function, plus immunosuppressant drugs. The
adjunct therapy can be administered before, at the same time or
after the administration of immunotoxin. Different adjunct
therapies can be administered to the recipient at different times
or at the same time in relation to the transplant event or the
administration of immunotoxin, as further described below.
[0122] Because the immunosuppressant can be administered before the
immunotoxin and/or other treatments, the present method can be used
with a patient that has undergone an organ transplant and is on an
immunosuppressant regimen. This presents a significant opportunity
to reduce or eliminate traditional immunosuppressant therapy and
its well documented negative side-effects. Also, as described
below, treatment with immunosuppressants prior to transplantation
could be particularly useful in cadaveric transplants. In such a
setting of pre-transplant treatment with immunosuppressant, the
administration of immunotoxin can be delayed for up to seven or
more days post-transplantation.
[0123] An example of a schedule of immunotoxin and
immunosuppressant administration for patients receiving organ
transplants is as follows:
1 day -6 -0 hours begin immunosuppressant treatment; day 0 perform
transplant; day 0 immediately following transplant administer 1st
immunotoxin dose day 1 2nd immunotoxin dose day 2 3rd and final
immunotoxin dose;
[0124] Immunosuppressant treatment may end at day 3 or extend to
day 14. Immunosuppressant treatment is also effective if begun at
the time of transplantation, and can continue for up to several
weeks after transplantation.
[0125] The immunotoxin injection can, alternatively, be made within
a week or two prior to the donor cell treatment. If the donor organ
or cell from donor organ is from a live donor, the immunotoxin is
administered from 15 hours to 7 days before the transplanting step
or just after transplantation. If the donor organ is kidney or
kidney cells and is from a cadaver, the immunotoxin is preferably
administered from 6 to 15 hours before the transplanting step. If
the donor organ or cell from the donor organ is cadaveric and is
selected from the group consisting of heart, lung, liver, pancreas,
pancreatic islets and intestine, the immunotoxin is preferably
administered from 0 to 6 hours before the transplanting step. For
practical reasons immunotoxin treatment and transplantation
generally take place at about the same time (e.g., within 15
hours), because advanced planning for cadaveric transplants is
difficult. Various schedules of apoptotic and immunosuppressant
therapies can be used with the above methods. In any of the above
scenarios, donor bone marrow, if desired, can be administered at
approximately the time of the transplant or after.
[0126] The presently preferred doses of the immunotoxin are those
sufficient to deplete peripheral blood T-cell levels to 80%,
preferably 90% (or especially preferably 95% or higher) of
preinjection levels. This should require mg/kg levels for humans
similar to those for monkeys (e.g., 0.05 mg/kg to 0.2 mg/kg body
weight), which toxicity studies indicate should be well tolerated
by humans. Thus, the immunotoxin can be administered to safely
reduce the recipients T cell population.
[0127] Method of Treating Graft-Versus-Host Disease.
[0128] In another embodiment, the invention relates to a method of
treating an immune system disorder not involving T cell
proliferation which is amenable to T cell suppression. More
specifically, a method of treating graft-versus-host disease in an
animal is also provided. It comprises administering to the animal
an immunotoxin comprising a diphtheria toxin binding mutant moiety
or an ETA binding mutant moiety and an antibody moiety which routes
by the anti-CD3 pathway or other T cell epitope pathway, or
derivatives thereof under conditions such that the
graft-versus-host disease is treated, i.e., the symptoms of the
graft-versus-host disease improve. Alternatively, as further
described, a non-toxic DT mutant such as DTM2 or CRM197 (or mutants
having combinations of the mutations in CRM9 and CRM197) can first
be administered followed by the immunotoxin. This method can use
any of the immunotoxins or non-toxic DT mutants described herein
with the dosages and modes of administration as described herein or
otherwise determined by the practitioner. As with the induction of
tolerance, certain immunosuppressants that modify cytokine release
patterns, such as corticosteroids, deoxyspergualin and
mycophenolate mofetil may also be used short term to increase
efficacy and reduce side effects.
[0129] GVHD is a morbid complication of bone marrow transplantation
which is often performed as anti-leukemia/lymphoma therapy. GVHD is
caused by circulating donor T cells within the host which are
acquired in bone marrow grafts unless specifically depleted prior
to grafting (Gale and Butturini (1988) Bone Marrow Transplant
3:185; Devergie et al. (1990) ibid 5:379; Filipovich et al. (1987)
Transplantation 44). Successful donor T cell depletion techniques
have been associated with a higher frequency of graft rejection and
leukemia relapses (Gale and Butturini (1988) Bone Marrow Transplant
3:185; Devergie et al. (1990) ibid 5:379; Filipovich et al. (1987)
Transplantation 44). Therefore, the donor T cells appear to aid
engraftment and to provide a graft-versus-leukemia effect as well
as causing GVHD. Because the T cell burden following bone marrow
transplantation is low for the first 14 days (<10% of normal)
the log kill of donor T cells would be proportionally enhanced
(Marsh and Neville (1987) Ann. N.Y. Acad. Sci. 507:165; Yan et al.,
submitted; Gale and Butturini (1988) Bone Marrow Transplant 3:185;
Devergie et al. (1990) ibid 5:379; Filipovich et al. (1987)
Transplantation 44). It is expected that donor T cells can be
eliminated at set times during the early post transplantation
period using the present method. In this way the useful attributes
of grafted T cells might be maximized and the harmful effects
minimized.
[0130] Method of Treating an Autoimmune Disease.
[0131] Another embodiment of the invention provides a method of
treating an autoimmune disease in an animal comprising
administering to the animal an immunotoxin comprising a diphtheria
toxin binding mutant moiety or an ETA binding mutant moiety and an
antibody moiety which routes by the anti-CD3 pathway or other T
cell epitope pathway, or derivatives thereof, under conditions such
that the autoimmune disease is treated, e.g., the symptoms of the
autoimmune disease improve. A further method of treating an
autoimmune disease in an animal comprises administering to the
animal a non-toxic mutant of diphtheria toxin followed by an
antibody CRM9 conjugate which routes by the anti-CD3 pathway, or
derivatives thereof, under conditions such that the autoimmune
disease is treated. This method can use any of the immunotoxins or
non-toxic DT mutants described herein with the dosages and modes of
administration as described herein or otherwise determined by the
practitioner. Again, certain immunosuppressants modifying cytokine
release may be beneficial as short term adjuncts to IT.
[0132] Method of Treating T Cell Leukemias or Lymphomas.
[0133] A further embodiment of the invention provides a method of
treating T cell leukemias or lymphomas which carry the CD3 epitope
in an animal comprising administering to the animal an immunotoxin
comprising a binding site mutant of diphtheria toxin moiety and an
antibody moiety which routes by the anti-CD3 pathway, or
derivatives thereof, under conditions such that the T cell
leukemias or lymphomas are treated. Alternatively, a further
embodiment is a method of treating T cell leukemias or lymphomas in
an animal comprising administering to the animal a non-toxic mutant
of diphtheria toxin followed by an antibody-CRM9 conjugate which
routes by the anti-CD3 pathway, or derivatives thereof, under
conditions such that the T cell leukemias or lymphomas are treated.
This method can use any of the immunotoxins or non-toxic DT mutants
described herein with the dosages and modes of administration as
described herein or otherwise determined by the practitioner.
EXAMPLE 1
Establishment of Tumors
[0134] The experimental design of the studies that give rise to the
present invention was dictated by the goal of having an animal
model as closely relevant to human in vivo tumor therapy as
possible. In order to minimize the host killer cell immune
response, bg/nu/xid strain of nude mice were used (Kamel-Reid and
Dick (1988) Science 242:1706). The human T cell leukemia cell line,
Jurkat, was chosen because of previous studies with this line and
its relatively normal average complement of CD3 receptors (Preijers
et al. (1988) Scand. J. Immunol. 27:553). The line was not cloned
so that receptor variation among individual cells existed. A scheme
was developed whereby well established tumors of constant mass
equal to 0.1% of body weight (.apprxeq.4.times.10.sup.7 cells)
could be achieved 7 days after inoculation of Jurkat cells (see
Dillman et al. (1988) Cancer Res. 15:5632). This required prior
irradiation and inoculation-with lethally irradiated helper feeder
cells (see Dillman et al. (1988) Cancer Res. 15:5632).
[0135] Nude mice bg/nu/xid maintained in a semi-sterile environment
are preconditioned with 400 cGy whole body .sup.137CS .gamma.
radiation on day -7. On day 0, 2.5.times.10.sup.7 Jurkat cells
(human T cell leukemia CD3+, CD4+, CD5+) are injected
subcutaneously with 1.times.10.sup.7 HT-1080 feeder cells (human
sarcoma) which have received 6000 cGy. Jurkat cells were passaged
every other week in mice as subcutaneous tumors and dissociated by
collagenase/dispase prior to inoculation. This cell population
exhibits a 40% inhibition of protein synthesis after 5 hours
exposure to 10.sup.11M anti-CD3-DT. Clones isolated from this
population by infinite dilution exhibit varying sensitivity to
anti-CD3DT (4 less sensitive, 3 more sensitive) corresponding to a
1.5 log variation in dose response curves. Immunotoxin treatment is
given by intraperitoneal injection starting on day 7 when the tumor
is visibly established. Evaluation takes place on day 37.
EXAMPLE 2
Guinea Pig Studies
[0136] Immunotoxin toxicity studies were performed in guinea pigs,
an animal (like humans) with a high sensitivity to diphtheria toxin
(mice are highly resistant to diphtheria toxin). Therapy of CRM9
conjugates was set at 1/2 the guinea pig minimum lethal dose. In
this study, minimum lethal dose (MLD) is defined as the minimum
tested dose which results in both non-survivors and survivors over
a 4 week evaluation period. All animals survive when a MLD is
reduced by 0.5. MLD was evaluated in guinea pigs (300-1000 g) by
subcutaneous injection. The following MLDs were found and are
listed as .mu.g of toxin/kg body weight; DT, 0.15; CRM9, 30;
anti-CD5-DT (cleavable), 0.65; anti-CD5-CRM9 (non-cleavable), 150.
Finally, the therapeutic efficacy of the immunotoxin treatment in
producing tumor regressions was compared to graded doses of whole
body irradiation which resulted in similar tumor regressions.
EXAMPLE 3
Comparison of Immunotoxins
[0137] Several types of immunotoxins were compared in this study.
They were synthesized as previously described by thiolating both
the monoclonal antibody moiety and the toxin moiety and then
crosslinking the bismaleimide crosslinkers (Neville et al. (1989)
J. Biol. Chem. 264:14653). Purification was performed by size
exclusion HPLC columns and fractions containing 1:1 toxin:antibody
mol ratios were isolated for these studies. Conjugates made with an
acid-labile crosslinker bismaleimidoethoxy propane were compared
with a non-cleavable, bismaleimidohexane. Conjugates made with this
cleavable crosslinker have been shown to hydrolyze within the
acidifying endosome releasing free toxin moieties with half-times
of hydrolysis measured at pH 5.5 of 36 min (Neville et al. (1989)
J. Biol. Chem. 264:14653).
[0138] The results of this study are tabulated in Table I.
Non-treatment groups such as group 10, groups treated with anti-CD5
immunotoxins (groups 5 and 6), and group 4 treated with a mixture
of anti-CD3 and CRM9 did not show regression. The vascularized
tumor nodules that weighed 20 mg on day 7 grew to between 1.5 to
7.8 g on day 37 and weighed between 7.9 and 11.6 on day 56. No late
spontaneous regressions were noted. In contrast, group 1 consisting
of treatment with anti-CD3-CRM9 non-cleavable conjugate (NC) given
at 25 .mu.g/kg on days 7, 8, and 9 showed only 1 tumor out of 6 by
day 37. Some of the remaining animals were subject to autopsy and
they failed to reveal residual tumor or even scaring. Tumors
identified as regressed on day 37 by superficial inspection did not
reappear during the course of the study (56 days).
2TABLE 1 IMMUNOTOXIN AND RADIATION TREATMENT ON SUBCUTANEOUS HUMAN
T CELL TUMORS (JURKAT) IN NUDE MICE Dose Animals Bearing Tumors %
Tumor Group Treatment (intraperitoneal) At Day 37/Group Animals
Regressions 1 Anti-CD3-CRM9 (NC).sup.a 25 .mu.g/kg. .times. 3d 1/6
83 2 Anti-CD3-CRM9 (NC) 19 .mu.g/kg. .times. 2d 1/4 75
Anti-CD5-CRM9 (C) 19 .mu.g/kg. .times. 2d 3 Anti-CD3-CRM9 (C) 25
.mu.g/kg. .times. 3d 2/4 50 4 Anti-CD3+CRM9 25 .mu.g/kg. .times. 3d
4/4 0 5 Anti-CD5-CRM9 (C) 25 .mu.g/kg. .times. 3d 5/5 0 6
Anti-CD5-DT (NC) 25 .mu.g/kg. .times. 1d 9/9 0 7 .gamma.radiation
.sup.137Cs 400 cGy 2/2 0 8 .gamma.radiation .sup.137Cs 500 cGy 3/6
50 9 .gamma.radiation .sup.137Cs 600 cGy .sup. 0/2.sup.b 100 10
None 6/6 0 .sup.aAnti-CD3 refers to the monoclonal antibody UCHT1
and was purchased from Oxoid USA, Inc. Anti-CDS refers to the
monoclonal antibody T101 and was a gift from Hybritech (San Diego).
NC and C refer, respectively, to non-cleavable and cleavable
conjugates. .sup.bThese animals were evaluated on days 10 and 13 at
the time of death from radiation sickness.
[0139] The cleavable crosslinker confers no therapeutic advantage
to anti-CD3-CRM9 immunotoxins and may be less effective (group 3).
Cleavable crosslinkers confer some advantage with anti-CD5-CRM9
conjugate in vitro (5) but had no effect in this in vivo system
(group 5), and lacked significant potentiating effect when
administered with anti-CD3-CRM9 (group 2). The cleavable
crosslinker conferred a marked therapeutic advantage to anti-CD5
wild type toxin conjugates and tumor regressions were achieved.
However, in these cases the guinea pig toxic dose was exceeded. A
single dose on day 7 of cleavable anti-CD5-DT at 6 .mu.g/kg
produced 8/10 tumor regressions while a cleavable conjugate made
with an irrelevant antibody (OX8) produced no regressions (4/4).
However, this dose exceeded the guinea pig MLD by 9 fold. A rescue
strategy was tried in which the above conjugate dose was given
intravenously followed by DT antitoxin 4 hours later (also
intravenously). The 4 hr rescue could not raise the MLD above 0.65
.mu.g/kg. The 1 hr rescue could not raise the MLD above 0.65
.mu.g/kg. The 1 hr rescue raised the MLD to 36 .mu.g/kg, however,
there were no tumor regressions in 10 mice receiving 21.5 .mu.g/kg
of the cleavable anti-CD5-DT conjugate.
[0140] In groups 7-9 increasing single doses of whole body
radiation (102 cGy/min) were given to animals bearing
3.times.3.times.5 mm tumors. At 400 cGy no complete regressions
occurred. At 500 cGy 50% complete tumor regressions occurred. At
600 cGy 100% regression was achieved as judged on day 10 and 13
when the animals died from radiation sickness. (Groups 7-9 did not
receive prior radiation and tumor takes were less than 100%). It
appears that the 75 .mu.g/kg anti-CD3-CRM9 (NC) immunotoxin is
equal in therapeutic power to between 500 and 600 cGy of
radiation.
EXAMPLE 4
Estimation of Cell Kill
[0141] The actual cell kill achieved by the radiation and the
immunotoxin can be estimated by assuming radiation single hit
inactivation kinetics along with a D.sub.37 value for the
radiation. A value for D.sub.37 of 70-80 cGy with n=1.2-3 is not
unreasonable for a rapidly dividing helper T cell. D.sub.37 is the
dose of radiation which reduces the fraction of surviving cells to
1/e as extrapolated from the linear portion of the log survivors
vs. dose curve and n is the intercept at 0 dose (Anderson and
Warner (1976) in Adv. Immunol., Academic Press Inc., 24:257). At a
dose of 550 cGy the fraction of surviving cells is calculated to be
about 10.sup.3. Since a majority of tumors completely regress at
this dose we estimate that both therapies are producing an
approximate 3 log kill. (The remaining cells,
4.times.10.sup.7.times.10.sup.3=4.times.10.sup.4 cells apparently
cannot maintain the tumor, i.e., the in vivo plating efficiency is
low, a fairly typical situation in the nude mouse xenograft
system.) The reliability of this 3 log kill estimate has been
verified by determining the tissue culture plating efficiency by
limiting dilution of 7 day established Jurkat tumors (following
dispersal) and tumors exposed 18 hours earlier in vivo to 600 cGy.
Plating efficiencies were 0.14 and 1.4.times.10.sup.4,
respectively. (Plating efficiency is the reciprocal of the minimum
average number of cells per well which will grow to form one
colony.
[0142] It should be emphasized that with high affinity
holo-immunotoxins the cell kill is inversely proportional to the
target cell number. This presumably occurs because receptors are
undersaturated at tolerated doses and free conjugate concentration
falls with increasing target cell burden (Marsh and Neville (1987)
Ann. N.Y. Acad. Sci. 507:165; Yan et al. (1991) Bioconjugate Chem.
2:207). To put this in perspective, the tumor burden in this study
is almost equal to the number of T cells in a mouse
(.apprxeq.10.sup.8). It can be expected that a tolerated dose of
anti-CD3-CRM9 immunotoxin can achieve an in vivo 3 log depletion of
a normal number of CD3 positive T cells.
EXAMPLE 5
Cell Depletion in Rhesus Monkeys Induced by FN18-CRM9
[0143] FN18-CRM9 Conjugate
[0144] The monoclonal antibody FN18 is the monkey equivalent of the
human anti-CD3 (UCHT1) and is known to bind the same CD3 receptor
epitopes (.epsilon. and .gamma.) as bound by the human CD3 antibody
and is the same isotype as the human CD3 antibody. Thus, in terms
of the parameters relevant for predicting successful T cell
depletion, the present CD3-CRM9 conjugate and FN18-CRM9 are
expected to have the same activity.
[0145] Administration
[0146] Conjugates can be administered as an I.V. bolus in a carrier
consisting of 0.1 M Na.sub.2SO.sub.4+0.01 M phosphate buffer, pH
7.4. The dose schedule is every other or third day for about 3
days. The total dose is preferably from 50 to 200 micrograms of
toxin per kg of body weight.
[0147] The actual dose of FN18-CRM9 used was varied between
0.167-1.13 of the minimum lethal dose (MLD) in guinea pigs. Since
the estimation of the MLD was performed in an animal lacking an
immunotoxin target cell population (guinea pigs), the true MLD of
FN18-CRM9 and anti-CD3-CRM9 is expected to be higher in monkeys and
humans than in guinea pigs.
[0148] T Cell Kill
[0149] Helper T cell (CD4+ cells) numbers in peripheral blood fell
dramatically after the initial administration of FN18-CRM9 in two
rhesus monkeys. T cell counts began to rise by day 4 (sampled just
prior to the second dose of FN18-CRM9). On day 5 in monkey 8629,
CD4+ cells were depressed below the limit of detection (<50
cells/mm.sup.3) Cells remained below or equal to 200/mm.sup.3 out
to day 21. This low level of CD4+ cells is associated with profound
immunodeficiency in humans and in monkeys (Nooij and Jonker (1987)
Eur. J. Immunol. 17:1089-1093). The remarkable feature of this
study is the long duration of helper T cell depletion (day 21) with
respect to the last administration of immunotoxin (day 4) since
intravenously administered immunotoxins were cleared from the
vascular system with half-lives <9 hours (Rostain-Capaillon and
Casellas (1990) Cancer Research 50:2909-2916), the effect
outlasting circulating immunotoxin. This is in contrast to T cell
depletion induced by unconjugated anti-CD3 antibodies (Nooij and
Jonker (1987) Eur. J. Immunol. 17:1089-1093).
[0150] In monkey 1WS the second dose of conjugate only appeared to
result in a diminished rate of CD4+ cell recovery. However, CD4+
cells were still fewer than normal at day 21. The blunted response
of monkey 1WS to the second dose of immunotoxin was found to be due
to a preexisting immunization of this animal to the toxin. Monkey
1WS had a significant pre-treatment anti-diphtheria toxin titer as
revealed by a Western blot assay. This titer was markedly increased
at day 5, indicative of a classic secondary response. In contrast,
monkey 8629 had no detectable pre-treatment titer and only a trace
titer by day 5 and a moderate titer by day 28.
[0151] The specificity of FN18-CRM9 toward T cells can be seen by
comparing the total white blood cell (WBC) count in the same two
monkeys. WBCs fell, but only to 45% of baseline value on day 2
compared to 6% of baseline values for the CD4+ T cell subset. Most
of the fall in WBC values can be accounted for by the T cell
component of the WBC population (.apprxeq.40%). However, B cells
are initially depleted after FN18-CRM9 although these cells recover
more quickly. FN18 is an IgG, isotype and as such is known to bind
to Fc.sub.II receptors present on B cells and macrophages with low
affinity. The FN18-CRM9 depletion of B cells indicates that
significant interactions between the Fc portion of the FN18
antibody and B cells is taking place.
[0152] The peripheral T cell depletion induced by unconjugated FN18
at a dose known to produce immunosuppression 0.2 mg/kg/day (Nooij
and Jonker (1987) Eur. J. Immunol. 17:1089-1093) was compared to
the immunotoxin FN18-CRM9 administered at {fraction (1/9)}th the
FN18 dose. Peripheral CD4+ T cell depletion is more pronounced and
more long-lasting with the conjugate. The demonstration that
FN18-CRM9 reduces peripheral helper T cell subset (CD4+) to levels
less than or equal to 200 cell/mm.sup.3 for a period as long as 21
days demonstrates that this immunotoxin and its anti-human analogs
are effective immunosuppressive reagents.
[0153] The demonstration that FN18-CRM9 is a potent agent for
inducing T cell depletion in non-human primates demonstrates that
an anti-human homolog of FN18-CRM9, UCHT1-CRM9 (Oxoid USA,
Charlotte, N.C.) for example, is a potent agent for inducing T cell
depletion in humans.
[0154] The Fc binding region of anti-TCR/CD3 monoclonals may or may
not be needed to induce T cell depletion when the anti-TCR/CD3
monoclonals are conjugated to CRM9. The Fc.sub.II binding regions
can be removed, for example, by forming the conjugates with
F(ab').sub.2 derivatives as is indicated in the literature (Thorpe
et al. (1985) J. Nat'l. Cancer Inst. 75:151-159). In addition,
anti-TCR/CD3 IgA switch variants such as monoclonal antibody T3. A
may be used (Ponticelli et al. (1990) Transplantation 50:889-892).
These avoid rapid vascular clearance characteristic of F(ab').sub.2
immunotoxins. F(ab').sub.2 and IgA switch variants of
anti-TCR/CD3-CRM9 immunotoxins are therefore derivative
anti-TCR/CD3 immunotoxins. These derivatives will avoid the B cell
interaction noted and can increase specificity. However, IgG.sub.2a
switch variants will maximize T cell activation through the
Fc.sub.I, receptor and may be useful in certain situations where T
cell activation aids immunotoxin induced toxicity.
[0155] General methods to make antibodies lacking the Fc region or
to make antibodies which are humanized are set forth in Harlow and
Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1988. Thus, as used in the
claims, antibody can mean the entire antibody or any portion of the
antibody sufficient for specific antigen or receptor binding.
EXAMPLE 6
T Cell Depletion and Immunosuppression in Monkeys Using the
Immunotoxin Anti-CD3-CRM9
[0156] CRM9 is a diphtheria toxin (DT) binding site mutant and
forms the basis of the anti-T cell immunotoxin anti-CD3-CRM9. This
immunotoxin has been constructed against human and rhesus T cells
and has shown above to kill 3 logs of human T cells in a nude mouse
xenograft system. The present example demonstrates a 2 log kill of
T cells in rhesus monkey lymph nodes that is also shown to produce
prolongation of skin allograft rejection in monkeys.
[0157] Humans are immunized against diphtheria toxin by exposure to
DPT vaccines in childhood. This long lasting immunity may interfere
with the efficacy of DT based immunotoxins. Many monkeys are
immunized against DT by natural exposure to toxin producing
Corynebacterium. The present method addresses any potential
interference of pre-existing DT antibodies with the activity of the
present immunotoxins.
[0158] ELISA
[0159] ELISA assays were performed in order to determine the levels
of anti-DT titers existing in 9 individuals in a population ages 27
to 55. There were 3 individuals with titers of 1:100 (low) and 6
with titers of 1:1000 (moderate).
[0160] Rhesus monkeys were screened by the same assay and a 1:1000
titered monkey was selected.
[0161] Administration of Non-Toxic Diphtheria Toxin Mutant
[0162] Monkeys were treated by I.V. route 5 min prior to the
immunotoxin dose with a 100 fold excess of CRM197 over the CRM9
content of the immunotoxin to be administered. Just prior to
administering CRM197, a Hl histamine blocking agent such as
Benadryl or Tagevil was given I.V. to minimize any possibility of
an anaphylactic reaction (for Benadryl 4 mg/kg). No histaminic
reaction was detected.
[0163] Anti-CD3-CRM9 was given at a total dose between 0.1 and 0.2
mg/kg (toxin weight) in 3 equally divided doses (approximately
0.033 mg/kg) on 3 consecutive days. In these monkeys, the total
dose of immunotoxin was 0.1 mg/kg.
[0164] Table 1 shows a comparison of the efficacy of anti-CD3-CRM9
in monkeys by comparing the decrease in the lymph node T/B cell
ratio (a measure of lymph node T cell depletion) and the
immunosuppressive effect of the immunotoxin as judged by
prolongation of mismatched skin graft survival. Effects on the
survival of skin grafts is a clear indicator of the general effect
a given treatment has on the subject's immune system.
[0165] The monkey with the preexisting anti-DT titer that was
pretreated with CRM197 shows the same level of T/B cell inversion
as in the negative titered monkey. Skin graft survival was
significantly prolonged over the titered monkey treated without
CRM197. The failure to achieve a prolongation of graft survival
equal to the negatively titered monkey is likely due to the lower
weight of this monkey which causes T cells to repopulate faster, in
this case 3-4 days faster, due to the larger thymic T cell
precursor pool in younger animals. Age related effects such as
these can be compensated for by modification of dosage levels and
timing of administration.
3TABLE 2 Efficacy of Anti-CD3-CRM9 With and Without CRM197 In
Rhesus Monkeys With Positive and Negative Anti-Diphtheria Toxin
Titers. Post Treatment* Day(s) of Anti-DT Lymph node T/B Skin Graft
Monkey Weight kg Titer Treatment Cell Ratio Survival historical 4-7
N/A None 2.1-2.4.sup.+ 9.5 .+-. 08.sup.$ controls B65 5.1 neg
anti-CD3 1.8 12, 12 8838 5.1 neg anti-CD3-CRM9 0.14.sup.xx 19, 20
M93 5.1 1:1000 anti-CD3-CRM9 0.57 11, 12 C81 1.0 1:1000 CRM197 +
0.20 14, 15 anti-CD3-CRM9 *All monkeys received the same dose of
immunotoxin 0.1 mg/kg total in divided doses on day 0, 1 and 2.
Lymph node sampled on day 3. CRM197 when given in 100 fold excess
over CRM9 content. .sup.+In this study untreated animals show this
lymph node T/B ratio .sup.$Historical controls at TNO, Rijswijk
.sup.xxAnti-CD3 given at the same mol. dose as anti-CD3-CRM9
EXAMPLE 7
Immunotoxin UCHT1-CRM9 for the Treatment of Steroid Resistant
Graft-Versus-Host Disease
[0166] Treatment protocols for this type of disease can be expected
to last a year, with Patients being followed for at least 5
years.
[0167] Characterization of UCHT1-CRM9 and CRM197
[0168] UCHT1-CRM9 is a covalent 1:1 conjugate of anti-human CD3
IgG1 monoclonal antibody and CRM9. The conjugate is synthesized,
purified, sterile filtered and assayed for concentration,
biological efficacy toward target cells and non-target cell
toxicity by standardized culture assays. The method of synthesis,
purification assay are identical to that used for FN18-CRM9 which
was used in the pre-clinical monkey studies described in Examples
5-7.
[0169] CRM9 and CRM197 are produced by the Biotechnology Unit, NIH
and purified by the Cooperating Facility. UCHT1 is produced in
mouse ascites fluid and is purified by affinity chromatography over
Protein A Sepharose. The synthesis, purification and storage of
UCHT1-CRM9 is performed in a dedicated secure area. UCHT1-CRM9 is
purified in 2 mg lots which are pooled and stored at 4.degree. C.
Shelf life is documented to be five months at full biological
potency but does not exceed 4 months for this study. Preferably,
most of the immunotoxin is used within 3 months of synthesis.
[0170] Patient Population
[0171] The patient population consists of individuals suffering
from steroid resistant GVHD whose prognosis is poor. Patients are
assayed for anti-CRM9 (anti-DT) titers and antibodies to murine
immunoglobulin. Patients having anti-CRM9 titers of 1:1000 and
below are treated according to the present protocol. Patients who
have a history of receiving murine immunoglobulins or who exhibit
positive anti-Ig titers may require special consideration.
[0172] Dosage of CRM9 Immunotoxin and Non-Toxic Mutant
[0173] UCHT1-CRM9 is administered at a dose which is {fraction
(1/10)} or less of the estimated minimum lethal dose (MLD) in a T
lymphopenic patient. The MLD is expected to be at least 0.15 mg/kg
(CRM9 content) based on the MLD of 0.15 mg/kg of IgG1-CRM9 in
guinea pigs which lack a target cell population for the IgG1. (The
presence of target cells in humans raises the MLD by providing a
sink for the immunotoxin.) The optimal dose schedule has been found
in monkeys to be administration on 3 consecutive days in 3 equally
divided doses, and this schedule can be used throughout the
treatment period. This permits administration of the total dose
before any rise in pre-existing antitoxin titers due to a secondary
response. In addition, the initial repopulation from the thymus is
also eliminated, thus, further lowering the total T lymphocyte
pool. Therefore, a total of 0.0125 mg/kg in three equally divided
doses is given to the patient. This dose does induces T cell
depletion in monkeys so that monitoring of T cell subsets and signs
and symptoms of GVHD is relevant at the lowest dose. For the
administration of this dose patients with anti-CRM9 titers of 1:100
or less will be treated. This permits pretreatment doses of CRM197
at 0.33 mg/kg or {fraction (1/10)} the dose easily tolerated in
monkeys. A second dosage group can include patients selected for
antitoxin titers of 1:330 or less to whom CRM197 will be given at
1.0 mg/kg. A third dosage group can include patients with 1:1000
antitoxin titers or less will be given CRM197 at 3.3 mg/kg, a dose
expected to be tolerable in humans, because it is easily tolerated
by monkeys (see Example 7). The monkey MLD data should be very
similar to humans on a per weight basis. However, GVHD patients are
expected to be more like guinea pigs, because they have a smaller
target cell population compared to non-GVHD patients.
[0174] Dose escalation can be tested by increasing the dose by a
factor of 1.5. The following table exemplifies such a dose
escalation test. For example three patients are used in each dosage
group. There is a 3 to 4 week delay between each patient so that
any late toxicity is detected before a dosage group is
completed:
4 CRM Total Dose each day Dose Week Patient # mg/kg mg/kg Ending 1,
2, 3 0.00417 0.0125 12 4, 5, 6 0.00636 0.019 24 7, 8, 9 0.0083
0.028 36 10, 11, 12 0.0125 0.042 48
[0175] Assuming each patient weighs on the average 70 kg, the first
dosage group will consume 2.6 mg of the CRM9 immunotoxin, and will
be supplied as a pool of two 2 mg batches. The second group will
consume 3.9 mg and will also be supplied as 2 pooled batches. The
third group will require 5.9 mg and will be supplied as three
pooled batches. The fourth group will require 8.9 mg and will be
supplied as three pooled batches and an additional two pooled
batches.
[0176] Administration
[0177] Prior to administering CRM197 a Hl histamine blocking agent
such as Benadryl or Tagevil is given I.V. to minimize any
possibility of an anaphylactic reaction (for Benadryl 4 mg/kg). The
CRM197 is administered I.V. in a 5 mg/ml sterile filtered solution
in phosphate buffered saline pH 7.4 (PBS) over a 5 min time period.
The immunotoxin is then given I.V. at 0.2 mg/ml over 2 min time
period in a sterile filtered solution of 0.90 mM sodium sulfate and
10 mM sodium phosphate pH 7.4.
[0178] Measurements of Biological Parameters
[0179] The following parameters can be measured at various
intervals during treatment (as exemplified by the schedule
below):
[0180] A Cytokines, TNF alpha, gamma IFN, IL-6
[0181] B Routine clinical chemistries
[0182] C WBC, Hct, diff; lymphocyte subsets CD3, CD4, CD8, CD2,
CD16, CD20
[0183] D Body Weight
[0184] E Immune function assays. ELISA assays of serum to monitor
antibody responses to UCHT1 (primary response) and CRM9 (secondary
response). ELISA assays to monitor antibody responses to polio and
DPT reimmunizations done at 1 year following bone marrow
transplantation.
[0185]
5 (before IT) Day 0 A, B, C, D, E Also A 2 hrs post Day 1 A, C, D
Day 2 A, C, D Day 3 A, B, C, D Day 4 C, D Day 7 A, C, D Day 10 B, C
Day 14 A, C, D Day 21 C, D Day 28 A, B, C, D, E Day 45 C, D Day 60,
B, C, D, E
EXAMPLE 8
An anti-CD3 Single-Chain Immunotoxin with a Truncated Diphtheria
Toxin Decreases Inhibition by Pre-Existing Antibodies in Human
Blood
[0186] The present Example examines the effect of human serum with
pre-existing anti-DT antibodies on the toxicity of UCHT1-CRM9, an
immunotoxin directed against CD3 molecules on T-lymphocytes. Sera
with detectable anti-DT antibodies at 1:100 or greater dilutions
inhibited the immunotoxin toxicity. Experiments with
radiolabeled-UCHT1-CRM9 indicate that anti-DT antibodies partially
block its binding to the cell surface as well as inhibit the
translocation from the endosome to the cytosol. The inhibitory
effect could be adsorbed using a full-length DT mutant or
B-subfragment. A C-terminal truncation mutant could not adsorb the
inhibitory effect, suggesting that the last 150 amino acids contain
the epitope(s) recognized by the inhibitory antibodies.
[0187] Therefore, an anti-CD3 single-chain immunotoxin, sFv-DT390,
was made with a truncated DT. The IC.sub.50 of sFv-DT390 was
4.8.times.10.sup.-11 M, {fraction (1/16)} the potency of the
divalent UCHT1-CRM9. More importantly, sFv-DT390 toxicity was only
slightly affected by the anti-DT antibodies in human sera. "sFv"
and "scUCHT1" both are singe chain antibodies containing the
variable region.
[0188] Mutated full-length and truncated diphtheria toxin (DT)
molecules are used for making immunotoxins. These immunotoxins show
strong cytotoxic effects to their target cells, and some of them
have already been used in clinical trials (1-7). Previously, an
immunotoxin directed against the CD3.epsilon. molecule of the
T-cell receptor complex, a pan T-cell marker was constructed. This
construct is made with a monoclonal antibody of mouse-origin,
UCHT1, and a binding site mutant of diphtheria toxin (DT), CRM9
(8). The immunotoxin, UCHT1-CRM9, is capable of regressing
established xenografted human T-cell (Jurkat) tumors in nude mice
(9). A rhesus monkey analog of UCHT1-CRM9, FN18-CRM9 was capable of
not only depleting circulating T-cells but also depleting resident
T-cells in the lymph nodes. This immunotoxin also delayed skin
allograft rejection as compared to antibody treatment and
non-treatment controls.
[0189] In contrast with ricin and Pseudomonas exotoxin (PE) based
immunotoxins, there is a potential problem using UCHT1-CRM9, or
other DT-based immunotoxins, in the treatment of human diseases.
Most people have been immunized against DT. Therefore these people
have a pre-existing anti-DT antibody titer which could potentially
inhibit or alter the efficacy of these immunotoxins. This
limitation also occurred in rhesus monkey studies. FN18-CRM9 could
deplete T cells in the blood, but to a much lesser extent in
animals with anti-DT antibodies, and the T cells repopulated
several days earlier compared to those monkeys without anti-DT
titers. In order to overcome this antibody mediated inhibition, the
first examination of the effect and the mechanism of human sera
containing anti-DT antibodies on UCHT1-CRM9 toxicity was done.
[0190] A DT point-mutant, a truncation mutant and DT-subfragments
were used in an attempt to neutralize the anti-DT effect in human
sera. Based on the neutralization data, a single-chain immunotoxin
was constructed with a C-terminal deletion mutant of DT which is
expected to bypass the inhibitory effect of the pre-existing
anti-DT antibodies.
[0191] Cells.
[0192] Jurkat cells (ATCC) were maintained in RPMI 1640
supplemented with 10% fetal calf serum, 25 mM sodium bicarbonate
and 50 .mu.g/ml of gentamycin sulfate.
[0193] Serum and Adsorbing Molecules.
[0194] Goat anti-DT serum was provided by Dr. Randall K. Holmes
(USUHS, Bethesda, Md.). Human serum samples were provided by Dr.
Henry McFarland (NINDS, NIH, Bethesda Md.). CRM197, an
A-subfragment mutant (Gly 52 to Glu) of DT (see FIG. 1A), with no
enzymatic activity (10) is available from Biocine-IRIS (Siena,
Italy). MSP.DELTA.5, a truncation mutant (amino acid 385) of DT
with an additional 5 amino acids at the C-terminus was provided by
Dr. Richard Youle (NINDS, NIH, Bethesda Md.). Purification of the
DT B-subfragment has been described (11). Immunotoxins-UCHT1-CRM9
synthesis has been described (12).
[0195] The recombinant immunotoxin, sFv-DT390, was generated in two
phases. First the coding sequences for the variable light (V.sub.L)
and variable heavy (V.sub.H) chain regions of the UCHT1 antibody
were amplified by a two step protocol of RT-PCR using primers based
on the published sequence (13). The 5' V.sub.L primer added a
unique NcoI restriction enzyme site while the 3' VH primer added a
termination codon at the J to constant region junction and an EcoRI
site. The V.sub.L region was joined to the V.sub.H region by
single-stranded overlap extension and the two regions are separated
by a (Gly.sub.3Ser).sub.4 linker that should allow for proper
folding of the individual variable domains to form a function
antibody binding site (14). Second, genomic DNA was isolated from a
strain of C. diphtheriae producing the DT mutant CRM9
(C7[.beta..sup.htox-201tox-9h']) as described (15). This DNA was
used for PCR. The 5' primer was specific for the toxin gene
beginning at the signal sequence and added a unique NdeI
restriction site. The 3' primer was specific for the DT sequence
terminating at amino acid 390 and added an NcoI site in frame with
the coding sequence. The PCR products were digested with the
appropriate restriction enzymes and cloned into the E. coli
expression plasmid pET-17b (Novagen, Inc., Madison, Wis., USA)
which had been linearized with NdeI and EcoRI. The resulting
plasmid was used to transformed E. coli BL21/DE3 cells. Cells were
grown to an OD.sub.590 of 0.5, induced with 0.5 M IPTG (Invitrogen,
San Diego, Calif., USA) and incubated for an additional 3 hours.
The sFv-DT390 protein was isolated in the soluble fraction after
cells were broken with a French Press and the lysate subjected to
centrifugation at 35,000.times. g.
[0196] Protein Synthesis Inhibition Assay.
[0197] Inhibition assays were performed as described (12) with the
following modifications. Immunotoxins were incubated for 30 minutes
with the indicated serum sample or leucine free medium at room
temperature prior to addition to cells. In some experiments the
serum was pre-incubated for 30 minutes with an adsorbing molecule
at the given concentrations to bind the antibodies. The
immunotoxin/serum mixture was incubated with Jurkat cells
(5.times.10.sup.4 cells/well in 96 well plate) for 20 hours. A 1
hour pulse of [.sup.3H]-leucine (4.5 .mu.Ci/ml) was given before
cells were collected onto filters with a Skatron harvester. Samples
were counted in a Beckman scintillation counter. Each experiment
was performed in 4 replicates. Results were calculated into a mean
value, and recorded as a percentage of control cells.
[0198] Serum Antibody Detection.
[0199] Anti-DT antibodies were detected in human serum by ELISA.
CRM9 (10 .mu.g/ml) was adsorbed to Costar 96-well EIA/RIA flat
bottom plates (Costar, Cambridge, Mass., USA) for 2 hours and then
washed in phosphate buffered saline (PBS) containing 0.1% Tween 20.
Each well was then incubated with PBS containing 3% gelatin to
prevent non-specific binding of antibodies to the plastic. Serum
samples were diluted in PBS containing 0.1% Tween 20 and 0.3%
gelatin prior to addition to the plate. After 1 hour incubation,
the wells were washed as above, and incubated for an additional
hour with protein A/G-alkaline phosphatase (1:5,000; Pierce,
Rockford, Ill., USA). Wells were washed, and phosphatase substrate
(Pierce) was added following the manufacturer's directions. After
30 minutes color development was stopped with NaOH and the optical
density (OD) was measured with a kinetic microplate reader
(Molecular Devices Corporation, Palo Alto, Calif., USA). Each
sample was performed in triplicate. Results are presented as O.D.
values and antibody titers.
[0200] Endocytosis Assay.
[0201] UCHT1-CRM9 was iodinated using the Bolton-Hunter reagent
(NEN Dupont, Wilmington, Del., USA) as described (16). Jurkat cells
were washed twice with binding medium (RPMI 1640 supplemented with
0.2% bovine serum albumin, 10 mM Hepes (pH 7.4) and without sodium
bicarbonate). Cells (1.5.times.10.sup.6) were incubated for 2 hours
on ice with .sup.125I-UCHT1-CRM9 (1.times.10.sup.-9 M) that had
been pre-incubated with serum or binding medium. Unbound antibody
was removed by washing the cells twice in PBS (pH 7.4) with
centrifugation and resuspension. Duplicate samples were incubated
for 30 minutes on ice or at 37.degree. C. One sample from each
temperature point was centrifuged at 800.times.g to separate the
total cell associated (pellet) from the exocytosed or dissociated
counts (supernatant). Both fractions were counted in a Beckman a
.gamma.-counter. To determine the amount of internalized
immunotoxin, cells from the second sample at each temperature were
incubated in low pH medium (binding medium containing 10 mM
morpholinoethanesulfonic acid, all of which was titrated to pH 2.0
with HCl) for 5 minutes to dissociate the surface bound
.sup.125I-immunotoxin (17). Samples were centrifuged at
800.times.;0 g to separate the internalized (pellet) from the
membrane bound (supernatant). Both fractions were counted in a
Beckman .gamma.-counter (Beckman, Fullerton, Calif., USA).
[0202] Serum with Anti-DT Antibodies Inhibits UCHT1-CRM9
Toxicity.
[0203] Since humans are immunized against DT, the presence of
anti-DT antibodies in the serum was determined by ELISA (Table 3).
In a limited sample population, 80% of the serum samples had an
anti-DT antibody titer of 1:100 or above. The vaccination status of
the donors was not available. To determine the effect of these
antibodies on UCHT1-CRM9 toxicity, the immunotoxin was
pre-incubated with different concentrations of serum and the
toxicity of the mixture was assayed (Table 3). Serum samples
without a significant ELISA O.D. (2 fold above background) were
incapable of affecting UCHT1-CRM9 toxicity at high concentrations
of serum (1:10). However, serum samples with a positive ELISA
result could neutralize the cytotoxic effect at 1:10 dilution, and
those with a high ELISA O.D. (7-11 fold above background) inhibited
toxicity even at a 1:100 dilution. Similar results were seen in
assays conducted with monkey serum samples.
6TABLE 3 Human serum with anti-DT antibodies inhibits the toxicity
of UCHT1-CRM9 and the inhibition correlates with the anti-DT titer
ELISA Protein Synthesis.sup.b (% control) Sample O.C. (X .+-. S.D.)
Titer 1:10 1:100 1:1,000 10010 0.738 .+-. 0.017 1:750 97 .+-. 3 79
.+-. 8 2 .+-. 0 10011 0.568 .+-. 0.048 1:500 104 .+-. 13 .+-. 2 2
.+-. 0 10012 0.491 .+-. 0.025 ND.sup.c 96 .+-. 3 19 .+-. 2 2 .+-. 0
10013 0.411 .+-. 0.052 1:500 105 .+-. 8 7 .+-. 1 2 .+-. 0 10014
0.390 .+-. 0.047 1:500 96 .+-. 2 7 .+-. 0 2 .+-. 0 10015 0.353 .+-.
0.008 1:250 125 .+-. 6 6 .+-. 4 2 .+-. 0 10019 0.359 .+-. 0.019
1:250 101 .+-. 7 6 .+-. 1 2 .+-. 0 10016 0.141 .+-. 0.015 1:100 22
.+-. 1 3 .+-. 0 2 .+-. 0 10017 0.100 .+-. 0.006 <1:100 4 .+-. 0
3 .+-. 0 2 .+-. 0 10018 0.071 .+-. 0.001 <1:100 2 .+-. 0 2 .+-.
0 2 .+-. 0 Goat 1.450 .+-. 0.013 1:10.sup.5 102 .+-. 19 104 .+-. 3
.sup.aELISA was performed in triplicate for each serum sample as
described under "Materials and Methods." The O.D. values were
derived from 1:100 dilutions and presented as a mean value .+-. SD.
The background value was 0.060 .+-. 0.02. titers are recorded as
the highest serum dilution that showed a positive reaction in
ELISA. .sup.bUCHT1-CRM9 (2 .times. 10.sup.-10) was incubated with
different dilutions of serum for 30 min. The mixture was then added
to cells as described under "Materials and Methods." Four
replicates were performed for each sample. Data are presented as a
mean value .+-. S.C. in percentage of the control counts.
UCHT1-CRM9 inhibited protein synthesis to 2.0% of controls. The
goat anti-DT serum could be diluted to 1:10,000 and still
completely # inhibited the toxicity of UCHT1-CRM9. .sup.cND, not
done
[0204] Sera Do Not Inhibit Endocytosis of UCHT1-CRM9.
[0205] The inhibitory effect of serum on UCHT1-CRM9 toxicity could
be due to prevention of the immunotoxin binding to the cell surface
or the endocytosis of UCHT1-CRM9 into the cell. Endocytosis assays
were conducted using .sup.125I-UCHT1-CRM9 to determine if either of
these processes were affected by anti-DT antibodies present in
sera. The results indicate that the presence of serum (goat anti-DT
or human) reduces as much as 80% of the immunotoxin counts binding
to the cell surface (Table 4). While this is a significant
reduction in binding, limiting 90% of input immunotoxin (one log
less UCHT1-CRM9) in toxicity assays reduces protein synthesis to
<25% of controls (see FIG. 2). In contrast, the inhibitory
effect of serum containing anti-DT antibodies is 100%. Therefore
the effect of the anti-DT antibodies is not all at the level of
inhibition of binding to the cell surface. The pre-incubation of
.sup.125I-UCHT1-CRM9 for 2 hours on ice and subsequent washing at
room temperature resulted in 18 to 25% of the total cell associated
counts internalized (Table 4). After incubation for 30 minutes at
37.degree. C., there is a doubling of internalized counts both with
and without serum, indicating that the same percentage of labeled
immunotoxin is endocytosed. The identical dilutions of serum were
incubated with non-labeled UCHT1-CRM9 and used in protein synthesis
inhibition assays. The results demonstrate that the ratio of
immunotoxin to serum used was capable of completely inhibiting the
toxicity (Table 4), although the endocytosis of UCHT1-CRM9 was not
affected.
7TABLE 4 Inhibition of UCHT1-CRM9 toxicity by serum does not
correlate with inhibition of endocytosis. Protein Serum Time % of
Bound Synthesis Sample (37.degree. C.) % Bound internalized (%
Control) -- 0 100 23.6. N.D..sup.a -- 30 100 58.8 3 .+-. 1 Human 0
20 18.1 N.D..sup.a Human 30 19 35.9 105 .+-. 5 -- 0 100 25.3
N.D..sup.a -- 30 100 54.0 3 .+-. 1 Goat 0 37 24.4 N.D..sup.a Goat
30 33 50.7 92 .+-. 14 [.sup.125I]-UCHT1-CRM9 (2 .times. 10.sup.-9
M) was incubated with medium or anti-DT serum (1:4 dilution of
human sample 10010 or a 1:1,000 dilution of goat serum; Table 3)
for 30 minutes at room temperature. This mixture was added to
Jurkat cells (1.5 .times. 106) for 2 hours on ice (final
concentration of [.sup.125I]-UCHT1-CRM9 was 1 .times. 10.sup.-10).
The cells were then washed and endocytosis assays performed as
described in Materials and Methods. The % # Bound value represents
the cell associated counts divided by the cell associtated counts
divided by the cell associated counts without serum. Non-labeled
UCHT1-CRM9 was incubated with the above dilutions of sera and the
resulting mixture was used in protein synthesis inhibition assays.
The results shown are representative of two independent assays.
n.d.: not done.
[0206] The Inhibitory Effect of Anti-DT Antibodies can be Removed
by Adsorption.
[0207] To prevent the inhibitory effect of serum as well as gain
insight into the mechanism by which serum inhibits toxicity,
experiments were designed to adsorb the protective anti-DT
antibodies from the serum. The serum (a pool of all human sera with
positive anti-DT ELISA or goat anti-DT) was pre-incubated for 30
minutes with increasing concentrations of CRM197 (an A-chain mutant
of DT with no enzymatic activity), MSPA5 (a truncation mutant
missing the last 150 amino acids) and the purified A- and
B-subfragments of DT (FIG. 1A). The adsorbed serum was then
incubated with UCHT1-CRM9 in protein synthesis inhibition assays.
CRM197, the full length DT-like construct, was capable of
completely adsorbing the protective antibodies from both goat (FIG.
1B) and pooled human serum (FIG. 1C). The B-subfragment of DT is
also capable of complete adsorption, however .about.100 fold more
is required. The A-subfragment of DT had little or no effect on
either serum, although the serum samples were demonstrated to
contain antibodies reactive to both the A- and the B-subfragments
by Western Blot analysis. Of interest were the results seen with
MSPA5, the truncation mutant. Adsorption of goat serum with MSPA5
gave a dose dependent removal of the serum's protecting effect
(FIG. 1B). However, this adsorption could not bring toxicity down
to levels obtained when CRM197 or the B-subfragment was used.
[0208] In contrast to the results observed with the goat serum,
MSPA5 had little effect on pooled human serum (FIG. 1C). These
results suggest that the pre-existing anti-DT antibodies important
for the protecting effect in human serum are mainly directed
against the last 150 amino acids of DT.
[0209] sFv-DT390 is Relatively Resistant to Inhibition by Anti-DT
Antibodies Present in Human Sera.
[0210] Having observed that the epitope(s) recognized by the
antibodies important for protection lay in the C-terminal 150 amino
acids, a single-chain immunotoxin was generated with the first 390
amino acids (out of 535) of DT. Position 390 was chosen for 2
reasons: first, the 3 dimensional structure of DT suggested that
this position was an external point on the molecule away from the
enzymatic domain (18), and second, fusion toxins have been
generated with longer DT subfragments with no reports of serum
effects (19). The DNA encoding the first 390 amino acids of DT was
ligated to DNA encoding the anti-CD3.epsilon.sFv (V.sub.L linked to
V.sub.H using a (Gly.sub.3Ser).sub.4 linker sequence). The
predicted molecular weight for the fusion protein is 71,000 Daltons
and has been confirmed by Western Blot analysis of both in vitro
transcribed and translated protein as well as protein isolated from
E. coli using goat anti-DT antibodies. The toxicity of sFv-DT390
protein, isolated from E. coli strain BL21/DE3, was compared to
UCHT1-CRM9 in protein synthesis inhibition assays (FIG. 2A]). The
ICSO (concentration required to inhibit protein synthesis to 50% of
controls) of sFv-DT390 was 4.8.times.10.sup.-11 M compared to
2.9.times.10.sup.-12 M for UCHT1-CRM9, a 16-fold difference. To
demonstrate the specificity of the sFv-DT390 construct, competition
experiments were performed using increasing concentrations of UCHT1
antibody as competitor (FIG. 2B). The results showed that
approximately 1/8 antibody is needed to compete the sFv-DT390
toxicity to 50% as compared to UCHT1-CRM9. The antibody was capable
of totally competing toxicity of both constructs thereby showing
their specificity. The immunotoxins were then subjected to protein
synthesis assays in the presence of increasing dilutions of serum
(Table 5).
[0211] UCHT1-CRM9 toxicity was completely inhibited with a 1:10
dilution of the human sera but at a 1:100 dilution toxicity was
equivalent to controls without serum. In contrast, the sFv-DT390
immunotoxin is only partially inhibited with the 1:10 dilution of
the human sera and the 1:100 dilution no effect on the toxicity.
Both immunotoxins are completely inhibited by goat anti-DT serum
(1:1,000 dilution). These results indicate that the sFv-DT390
immunotoxin partially evades the pre-existing anti-DT antibodies
present in most human sera.
[0212] These results indicate that the pre-existing anti-DT
antibodies present in human serum inhibit the toxicity of the
immunotoxin UCHT1-CRM9. This inhibition of toxicity was also
observed with goat anti-DT serum, however less goat serum was
needed to completely inhibit toxicity. The experiments were
designed in such a way to mimic the in vivo situation. The peak
concentration of circulating immunotoxin currently being tested in
animal models is 1.times.10.sup.-9 M. The immunotoxin concentration
incubated with the 1:10 dilution of human serum was
1.times.10.sup.-10 M, thus approximating in vivo conditions. The
inhibition of toxicity correlates with the serum antibody levels as
determined by ELISA (Table 4), indicating that sera with higher
anti-DT titers have a stronger inhibitory effect. Similarly, the
goat anti-DT serum which gave the highest ELISA value could be
diluted 10,000 times and still completely inhibited UCHT1-CRM9
toxicity. Since this correlation exists, there is no indication
that any other component of the serum inhibits the toxicity of
UCHT1-CRM9.
[0213] Furthermore, the data show that a titer of 1:100 dilution is
necessary for an inhibition of the immunotoxin toxicity. A
construct in which the first 486 amino acids of DT were fused to
interleukin-2, DAB.sub.4861L-2, was used in lymphoid malignancy
patients. A partial response to DAB.sub.48611L-2 was observed in
several patients who had a anti-DT titer below 1:100 dilution prior
to the treatment.
[0214] Intoxication of cells by immunotoxins can be subdivided into
four general stages: 1) specific binding to the cell surface, 2)
endocytosis into the cell, 3) translocation of enzymatic domain of
the toxin out of the endosome and 4) enzymatic inactivation of the
target molecule. The results presented indicate that, while the
amount of immunotoxin reaching the cell surface is lower in the
presence of serum, the same percentage of bound immunotoxin is
endocytosed. Taking into account the reduced amount of immunotoxin
bound to the cell, the amount of endocytosed immunotoxin should
intoxicate the cells to below 25% of controls. However, the
immunotoxin had no effect on protein synthesis in the presence of
serum containing anti-DT antibodies. Since the A-subfragment of DT
could not adsorb the protective effect of serum while the
B-subfragment could, the effect of serum is not likely to be at the
level of inhibiting enzymatic activity of the toxin. Therefore, the
anti-DT antibodies probably affect the translocation of the
A-subfragment into the cytosol.
[0215] CRM197, B-subfragment, and MSP.DELTA.5 could adsorb the
protecting anti-DT antibodies from the goat and rhesus monkey sera.
However, among the 3 DT mutants, MSPA5 could not prevent the
UCHT1-CRM9 toxicity in the presence of the human sera, showing a
difference in the anti-DT antibody repertoire among humans, goat
and rhesus monkeys. This difference does not seem to be due to
immunization routes, because monkeys used in the present study were
not immunized for DT and presumably acquire the antibodies after a
natural infection with toxigenic strains of C. diphtheriae. There
have been reports showing that rhesus monkeys and humans shared a
similar antibody repertoire (21), but the present results suggest
that the effect of antibodies from the host for whom immunotoxin
treatment is intended should be useful.
[0216] To overcome the blocking effect of the pre-existing anti-DT
antibodies in human sera, there are basically two pathways
existing. One is to neutralize the antibodies with non-toxic DT
mutants, and the other is to modify the DT structure used for
making immunotoxin (3). The antibody neutralization pathway has
been tested in monkey studies of FN18-CRM9 treatment as described
above.
[0217] The present results showed that although antibodies against
both A- and B-subfragments existed in human sera, MSP5 could not
neutralize the pre-existing protective anti-DT antibodies, and
therefore could not prevent the inhibition of the cytotoxicity of
UCHT1-CRM9. However, it did block the inhibitory effect of the goat
and monkey sera. This prompted the construction of the present
recombinant immunotoxin, sFv-DT390. The IC.sub.50 of sFv-DT390 is
4.8.times.10.sup.-11 M, {fraction (1/16)} as potent as UCHT1-CRM9.
Like many other single-chain constructs, sFv-DT390 is monovalent as
compared to immunotoxins generated with full length, bivalent
antibodies. The reduced toxicity in sFv-DT390 could be explained
primarily on this affinity difference. Immunotoxins generated with
purified F(ab)' fragments of antibodies also show an in vitro loss
in toxicity (generally a 1.5 log difference) when compared to their
counterparts generated with full length antibodies (22). The
toxicity of sFv-DT390 is comparable to that reported for DAB4861L-2
(23). From the present data some advantages of sFv-DT390 are
expected. First, sFv-DT390 is only 1/3 of the molecular weight of
UCHT1-CRM9. The molar concentration of sFv-DT390 will be 3 times
higher than that of UCHT1-CRM9 if the same amount is given (for
example, 0.2 mg/kg). Therefore, their difference in potency could
be reduced to approximately 5 times. Second, in an in vitro
experiment (Table 5), the same molar concentration of sFv-DT390 and
UCHT1-CRM9 was used for serum inhibition test, although the former
is only {fraction (1/16)} potent compared to the latter. The
pre-existing anti-DT antibodies in human sera could only partially
block the toxicity of sFv-DT390 while the effect of UCHT1-CRM9 was
completely blocked. Thus, sFv-DT390 is expected to bypass the
anti-DT antibodies in in vivo situations while UCHT1-CRM9 cannot.
Third, sFv-DT390 contains only the variable region of UCHT1, and is
expected to have less immunogenicity in human anti-mouse antibody
(HAMA) responses than the native murine antibody UCHT1. Finally,
the production cost of sFv-DT390 is much lower than that of
UCHT1-CRM9. Based on these reasons, sFv-DT390, or others with
similar properties, are expected to be useful in the treatment of
T-cell mediated diseases in humans, especially in anti-DT positive
individuals and in patients who need repeated treatments. To obtain
evidence supporting this assumption, it is only necessary to
construct a rhesus monkey analog of sFv-DT390, and test it in
monkey models as described in previous examples.
8TABLE 5 Anti-DT antibodies present in human sera have reduced
effect on sFv-DT390 toxicity. Protein synthesis (% Control) ELISA
UCHT1CRM9 sFv-DT390 Serum Sample value (.+-.S.D.) 1:10 1:10.sup.2
1:10.sup.3 1:10 1:10.sup.2 1:10.sup.3 10012 0.491 .+-. 0.025 119
.+-. 24 8 .+-. 2 ND.sup.a 47 .+-. 9 21 .+-. 8 ND Pooled 0.331 .+-.
0.015 108 .+-. 37 7 .+-. 1 ND.sup.a 49 .+-. 7 16 .+-. 7 ND Goat
1.450 .+-. 0.013 ND ND 94 .+-. 21 ND ND 8 .+-. 11 .sup.aNot done
UCHT1CRM9 or sFv-DT390 (2 .times. 10.sup.-9 M) was incubated with
the indicated dilutions of serum for 30 min. The mixture was then
added to cells as described under "Materials and Methods." The
final concentration of immunotoxin on cells was 1 .times.
10.sup.-10 M. Four replicates were performed for each sample. Data
are presented as a mean value .+-. S.D. in percentage of the
control counts. UCHT1-CRM9 inhibited protein synthesis to 5% of
controls # while the sFv-DT390 inhibited protein synthesis to 18%
of controls. The ELISA value was determined using a 1:100 dilution
of serum. The results are representative of two independent
experiments.
EXAMPLE 9
Expression and Characterization of A Divalent Chimeric Anti-Human
CD3 Single Chain Antibody
[0218] Murine anti-CD3 monoclonal antibodies (mabs) are used in
clinical practice for immunosuppression. However, there are two
major drawbacks of this treatment: the associated cytokine release
syndrome and human anti-mouse antibody response. To overcome these
side effects, a chimeric anti-human CD3 single chain antibody,
scUCHT1 was generated. It is an IgM variant of the UCHT1 described
in Example 9. scUCHT1 consists of the light and heavy variable
chain binding domains of UCHT1 and a human IgM Fc region (CH.sub.2
to CH.sub.4). The method used was reported by Shu et al. (37) and
is further described below. The following data show that the
engineered chimeric anti-CD3 single chain antibody (scUCHT1) will
be useful in clinical immunosuppressive treatment.
[0219] Oligonucleotide Primers and DNA Amplification.
[0220] Primers used for the antibody engineering are listed in
Table 6, and the primer sequences are based on published data (13).
The procedures of cloning scUCHT1 is schematically depicted in FIG.
3. mRNA isolated from UCHT1 hybridoma cells (provided by Dr. P. C.
Beverley, Imperial Cancer Research Fund, London was reverse
transcribed into cDNA. The V.sub.L and V.sub.H regions of UCHT1
were amplified with polymerase chain reaction (PCR) from the cDNA
using primer pairs P1, P2 and P3, P4 respectively. Primers P2 and
P3 have a 25 bp complementary overlap and each encoded a part of a
linker peptide (Gly.sub.4Ser).sub.3. The single chain variable
fragment (V.sub.L-linker-V.sub.H) was created by recombinant
amplification of V.sub.L and V.sub.H using primers P1 and P4. A
mouse kappa chain signal sequence was added at the V.sub.L 5'-end
by PCR, first with primers SP2 and P4, and then with primers SP1
and P4. The human IgM Fc region (CH.sub.2 to CH.sub.4) was
amplified from the plasmid pBlue-huIgM (kindly provided by Dr. S.
V. S. Kashmiri, National Cancer Institute, Bethesda. This gene
fragment was about 1.8 kb. The V.sub.L-linker-V.sub.H-CH2 region
which is important for antigen recognition was confirmed by
sequence analysis. Finally, the single chain variable fragment and
the human IgM Fc region were cloned into plasmid pBK/CMV
(Stratagene, La Jolla, Calif., USA). Using the generated
pBK/scUCHT1 plasmid as template, an in vitro
transcription-translation assay yielded a product of 75 kDa, the
expected size.
9TABLE 6 Sequences of oligonucleotide primers used for PCR
amplification Primers Sequences RE sites 5' 3' P1(UCHT1 VL5)
GACATCCAGATGACCCAGACC (SEQ ID NO:2) P2(UCHT1 VL3)
CCTCCCGAGCCACCGCCTCCGCTGCCTCCGCCTCCTTTTATCTCCAGCTTG(T)GTC(G- )CC
(SEQ ID NO:3) P3(UCHT1 VH5) GCAGCGGAGGCGGTGGCTCGGGAGGG-
GGAGGCTCGGAGGTGCAGCTTCAGCAGTCT (SEQ ID NO:4) P4(UCHT1 VH3)
GCAAGCTTGAAGACTGTGAGAGTGGTGCCTTG (SEQ ID NO:5) Hind III
P5(HuIgM-CH2) GTCTCTTCAAAGCTTATTGCC(T)GAGCTGCCTCCCAAA (SEQ ID NO:6)
Hind III P6(HuIgM-CH4) GCATCTAGATCAGTAGCAGGTGCCAGCTGTGT (SEQ ID
NO:7) Xba I Sp1 (Signal 1)
CGGTCGACACCATGGAGACAGACACACTCCTGTTATGGGTACTGCTGCTCTGGGTTCCA (SEQ ID
NO:8) Sal I SP2 (Signal 2) GTACTGCTGCTCTGGGTTCCAGGTTCCAC-
TGGGGACATCCAGATGACCCAG (SEQ ID NO:9)
[0221] Expression in COS-7 and SP2/0 Cells.
[0222] The gene fragment encoding scUCHT1 was then cloned into an
expression vector pLNCX (36). The scUCHT1 gene construct was
introduced into COS-7 cells with a calcium-phosphate method (32),
and introduced into SP2/0 myeloma cells by electroporation (33).
Cells transfected were selected with 500 .mu.g/ml G418 (GIBCO/BRL,
Gaithersburg, Md., USA) in DMEM medium. The drug resistant
transfectants were screened for scUCHT1 secretion by an anti-human
IgM ELISA technique. Transfectants secreting scUCHT1 were cloned by
limiting dilution.
[0223] Two stable clones, COS-4C10 and SP2/0-7C8, which could
produce about 0.5 mg/ml scUCHT1 in culture medium, were selected
for further evaluation. The culture supernatant of COS-4C10 and
SP2/0-7C8 cells was analyzed by immunoblotting using anti-human IgM
antibody (FIG. 4). Human IgM antibody was included as a control in
the analysis. Under reducing conditions, scUCHT1 produced by COS-7
and SP2/0 cells had a similar electrophoretic mobility to that of
the control human IgM heavy chain (75 kDa). Under non-reducing
conditions, scUCHT1 from COS-7 cells appeared as a single band of
approximately 150 kDa, which was thought to be a homodimer of the
single chain antibody. SP2/0 cells mainly produced a protein of
similar size with some higher molecular weight products.
[0224] In constructing scUCHT1, the domain orientation of sFv,
V.sub.H-V.sub.L, which Shu et al. used to V.sub.L-V.sub.H
orientation, was changed so that the heavy chain constant domains
were linked to the V.sub.H domain. In mammalian cells, secretion of
immunoglobulin molecules is mediated by light chain, and free light
chain is readily secreted (38). However, free heavy chain is
generally not secreted (39). In a bacterial expression system, the
yield of secreted sFv with a V.sub.L-V.sub.H domain orientation was
about 20-fold more than that obtained with a V.sub.H-V.sub.L domain
orientation (40). It was reasoned that V.sub.L at the NH2-terminal
position and V.sub.H linked to heavy chain constant region in
scUCHT1 construct might enhance the secretion of this
immunoglobulin-like molecule in mammalian cells. In fact scUCHT1
was efficiently produced by both COS-7 and SP2/0 cells. Hollow
fiber culture should increase its production. Moreover, scUCHT1,
the IgM-like molecule, has a secretory tailpiece with a penultimate
cysteine (Cys 575) which is involved in polymerization and also
provides retention and degradation of IgM monomers (41-43).
Replacing the Cys 575 with serine might also greatly improve the
yield.
[0225] scUCHT1 secreted from COS-7 cells was shown to be a divalent
form by immunoblotting, suggesting a disulfide bond linkage of two
monovalent molecules. The disulfide bond is likely situated between
the CH2 and CH3 regions, where the Cys 337-Cys 337 disulfide bond
is thought to exist. Cys 337 is believed to be sufficient for
assembly of IgM monomers, and was neither sufficient nor necessary
for formation of polymers. However, Cys 575 was necessary for
assembly of IgM polymers, and Cys 414 was not required for
formation of IgM monomers or polymers (44). This divalent form of
the single chain antibody should increase its binding affinity.
While scUCHT1 produced from SP2/0 cells was mainly in the divalent
form, a small fraction of the antibody had a higher molecular
weight, nearly comparable to that of the human IgM pentamer, the
natural form of secreted human IgM.
[0226] Western Blotting Analysis of scUCHT1.
[0227] scUCHT1 was precipitated from the culture supernatant using
goat anti-human IgM-Agarose (Sigma, St. Louis, Mo., USA), and
separated on 4-20% SDS-PAGE gradient gel under reducing and
non-reducing conditions. The separated proteins were transferred to
ProBlott.TM. membrane (Applied Biosystems, Foster City, Calif.,
USA) by electroblotting at 50 volts for 1 hour. The membrane was
blocked and incubated with alkaline phosphatase labeled goat
anti-human IgM antibody (PIERCE, Rockford, Ill., USA) following the
manufacturer's instruction. Color development was carried out with
substrate NBT/BCIP (PIERCE).
[0228] Purification of scUCHT1.
[0229] Culture supernatant was mixed with anti-human IgM-Agarose,
and incubated at 4.degree. C. with shaking overnight, and then the
mixture was transferred to a column. The column was washed with
washing buffer (0.01 M Na-phosphate, pH 7.2, 0.5 M NaCl) until the
OD280 of flow-through was <0.01. scUCHT1 was eluted with elution
buffer (0.1 M glycine, pH 2.4, and 0.15 M NaCl). The fractions were
neutralized with 1 M Na-phosphate (pH 8.0) immediately, and then
concentrated and dialyzed against PBS.
[0230] Competitive Binding Assay.
[0231] The parental antibody UCHT1 was iodinated using
Bolton-Hunter Reagent (NEN, Wilmington, Del., USA) as described
previously (34). The .sup.125I-labeled UCHT1 was used as tracer and
diluted with DMEM medium to 0.3-0.6 nM. UCHT1 and the purified
scUCHT1 from COS-7 and SP2/0 transfectant cells were used as
competitors. Human CD3 expressing Jurkat cells were suspended in
DMEM medium (2.times.10.sup.7/ml). 50 .mu.l of such cell suspension
(1.times.10.sup.6) was incubated with 50 .mu.l diluted tracer and
50 ml diluted competitors on ice for 2 hours. Afterwards, cells
were pelleted, and counted in a gamma counter. Results were
expressed as a percentage of the .sup.125I-UCHT1 bound to cells in
the absence of competitors (FIG. 5).
[0232] scUCHT1 from both COS-7 and SP2/0 cells could specifically
inhibit the binding of .sup.125I-UCHT1 to Jurkat cells in a dose
dependent way. As the concentration of the competitors (UCHT1,
scUCHT1 from COS-7 and SP2/0 cells) increased from 1 to 100 nM, the
tracer (.sup.125I iodinated UCHT1) bound to Jurkat cells decreased
from 80% to nearly 0%. No significant difference was observed among
the affinity curves of UCHT1 and scUCHT1 from COS-7 and SP2/0
cells. This indicates that the engineered antibody scUCHT1 has
nearly the same affinity as UCHT1. Moreover, scUCHT1 contains human
IgM constant region, and is expected be less immunogenic than
UCHT1. The degree of its immunogenicity might vary due to the
murine variable region of scUCHT1. Humanized variable regions by
CDR-grafting or human variable regions can be used to further
reduce its immunogenicity (31).
[0233] T-Cell Proliferation Assay.
[0234] T-cell proliferation in response to UCHT1 and scUCHT1 was
tested on human PBMCs from a healthy donor (FIG. 6). Human
peripheral blood mononuclear cells (PBMCs) were isolated from blood
of a healthy adult by density centrifuge over Ficoll-Hypaque
gradient (34). The PBMCs were resuspended in RPMI 1640 supplemented
with 10% FCS and aliquoted to 96-well U-bottom plates at
5.times.10.sup.4 cells/well. Increasing amounts of anti-CD3
antibodies (UCHT1, scUCHT1) were added. After 72 hours of culture
at 37.degree. C. in a humidified atmosphere containing 5% CO.sub.2,
1 .mu.Ci [.sup.3H]thymidine (NEN) was added to each well. 16 hours
later, cells were harvested and [.sup.3H]thymidine incorporation
was counted in a liquid scintillation counter.
[0235] The parental antibody UCHT1 started to induce proliferation
at 0.1 ng/ml, and peaked at 100 ng/ml. A small drop in CPM was
observed as the concentration increased to 1,000 ng/ml. However,
[.sup.3H]thymidine incorporation in PBMCs incubated with scUCHT1
was only slightly increased in the range of 0.1-10 ng/ml, and when
the concentration was higher than 10 ng/ml, the incorporated counts
decreased and were close to 0 counts at 1,000 ng/ml.
[0236] Measurement of TNF-.alpha. and IFN-.gamma..
[0237] TNF-.alpha. and IFN-.gamma. productions of human PBMCs
induced by UCHT1 and scUCHT1 were measured with ELISA.
4.times.10.sup.5 PBMCs were cultured with serial dilutions of
anti-CD3 antibodies (UCHT1, scUCHT1) in 96-well flat-bottom plates
in RPMI 1640 supplemented with 10% FCS. Supernatant was collected
at 36 hours for TNF-.alpha. and 72 hours for IFN-.gamma. after the
start of the culture (35). TNF-.alpha. and IFN-.gamma. were
measured with ELISA kits (Endogen Inc. Cambridge, Mass., USA)
following the manufacturer's instruction.
[0238] The native antibody UCHT1 induced production of both
TNF-.alpha. and IFN-.gamma. in a dose dependent way (FIGS. 7a and
7b). Higher concentration of UCHT1 induced higher production of
TNF-.alpha. and IFN-.gamma.. On the contrary, scUCHT1 did not
induce secretion of TNF-.alpha. at any concentration (FIG. 7a), and
inhibited IFN-.gamma. production when its concentration was higher
than 0.1 ng/ml (FIG. 7b). At the time of supernatant harvesting,
the PBMCs cultured with UCHT1 and scUCHT1 were also checked with
trypan blue exclusion test. Cells were shown to be alive in both
situations. In TNF-.alpha. and IFN-.gamma. ELISA assays, an
unrelated human IgM was included and it did not affect the TNF-a
and IFN-g production.
[0239] Measurement of Possible Complement Binding by scUCHT1
[0240] Divalent scUCHT1 failed to bind detectable quantities of
complement. This feature is an advantage in treating patients with
a foreign protein in that it will minimize immune complex
disease.
[0241] Anti-CD3 mAbs can induce T cell activation and proliferation
both in in vitro and in vivo situations (45). Crossing-linking of
anti-CD3 antibody between T cells and FcR expressing cells is an
essential step in this process (46). T cell activation therefore
reflects an efficient interaction of the mAb with a human FcR.
Previous data of in vitro study indicated that T cell activation
resulted in increased production of TNF-.alpha., IFN-.gamma., and
IL-2 (24). Human IgG Fc receptors (Fc.gamma.R I, Fc.gamma.R II,
Fc.gamma.R III) are distributed on human monocytes, T, B
lymphocytes, and NK cells (47). Fc.gamma.R I and Fc.gamma.R II can
recognize both mouse and human IgG. In accordance with the above
observation, UCHT1 was potent in induction of T cell proliferation
and TNF-.alpha. and IFN-.gamma. release. Human IgM Fc receptor
(Fc.mu.R) was reported to be present mainly on a small fraction of
B lymphocytes, NK cells, and possibly a helper subset of T
lymphocytes (47, 48). Pentamer form of IgM and an intact CH.sub.3
domain are required for optimal binding to Fc.mu.R. Monomeric or
dimeric subunits of IgM are less efficient in binding to Fc.mu.R
(49, 50). Cross-linking of IgM to Fc.mu.R on T cells inhibited the
mitogen-induced T cell proliferation, and Fc.mu.R may function as a
negative signal transducing molecule (51, 52).
[0242] Therefore, it can specifically bind to human CD3 molecule
and Fc.mu.R. It is conceivable that scUCHT1 can cross-link human B
and T cells, and possibly T and T cells. In an in vitro assay,
scUCHT1 from both COS-7 and SP2/0 cells had little effect in the T
cell proliferation assay at low concentrations (below 10 ng/ml),
and became inhibitory as the concentration increased. In accordance
with these results, scUCHT1 did not induce TNF-.alpha. production
and even inhibited the basal yield of IFN-.gamma..
[0243] The present chimeric anti-CD3 single chain antibody scUCHT1
possesses high human CD3 binding specificity and affinity, and does
not induce T cell proliferation and cytokine release. Moreover, it
has a human IgM Fc fragment, which should decrease the possibility
of inducing human anti-mouse antibody response. Thus, scUCHT1 can
be used for clinical immunosuppressive treatment.
EXAMPLE 10
Cloning the Full-Length of DT Gene for the Construction of DTM2
[0244] Corynebacteriophage beta (C. diphtheriae) tox 228 gene
sequence was from genebank. (Science 221, 885-858, 1983): The
sequence is 2220 bp. There are 300 bp of 5' untranslated region (1
to 300) including the promoter sequence around (-180 to -10), 1682
of coding region (301-1983) including signal peptide (301 to 376),
A chain (377 to 955) and B chain (956 to 1983), and 3' untranslated
region (1984 to 2220).
[0245] The full-length DT was amplified in two fragments. The pelB
leader sequence (ATG AAA TAC CTA TTG CCT ACG GCA GCC GCT GGA TTG
TTA TTA CTGCGCT GCC CAA CCA GCG ATG GCC 3') SEQ ID NO:10) was added
to the 5' end of the DT coding sequence to all the constructs
during polymerase chain reaction by primer EcosignalDT-1 and
EcosignalDT-2. The upstream fragment of 311 bp (from position 301
to 546 bp) was amplified by oligo EcosignalDT-2 and p546R with CRM9
DNA as a template and the downstream fragment of 1471 bp was
amplified by p514S and p1983R with the DTM1 DNA as template. Then,
the combined PCR product of full-length DT was amplified with
primer EcosignalDT-1 and p1983R. As a result, the amplified DT
coding sequence (position 376 to 1983 bp) acquired the pelB leader
sequence added to the 5' end and contains the two mutant sites
[(508 Ser to Phe and (525 Ser to Phe)] as DTM1 does.
[0246] Primers:
10 EcosignalDT-1 5' ATG AAA TAC CTATTG CCT ACG GCA GCC (SEQ ID
NO:11) GCT GGA TTG TTA TTA CTC GCT GCC CAA 3' EcosignalDT-2 5' GGA
TTG TTA TTA CTC GCT GCC CAA CAA (SEQ ID NO:12) GCG ATG GCCGGC GCT
GAT GATGTT GTT GAT TC 3' p546R: 5' CGGTACTATAAAACTCTTTCCAATCATCGTC
3' (SEQ ID NO:13) p514S: 5' GACGATGATTGGAAAGAGTTTTATAGTACCG 3' (SEQ
ID NO:14) p1983R: 5'AGATCTGTCGA/CTCATCAGCTTTTGATTTCAAAAAATAGCG 3'.
(SEQ ID NO:15)
[0247] A mutant residue was introduced at position 52. The glycine
(GGG) at position 52 wild type DT was substituted by glutamic acid
(GAG). The two primers p546R and p514S carried the mutant codon
(GGG to GAG). The PCR products of these two primers contained the
substituted codon (GAG) instead of codon GGG. The jointed double
stranded DNA of the two fragments (1683 bp) were cloned into pET
17b by restriction site NdeI and BamHI.
[0248] The data show that anti-human blocking antibodies are
specifically directed at the toxin C-terminus. Although a specific
sequence derived from the UCHT1 VLVH regions is described, anyone
skilled in the art could make sequence variations in VLVH domains
which can be designed to increase the affinity of the
sc-anti-CD3-antibody conferring a more favorable therapeutic ratio
to fusion immunotoxins using this derivative. Such modifications
are within the scope of the present teaching. The disadvantage of
the monovalent antibody VLVH construct, is that it has a lower
affinity for T cells compared to the chemically coupled conjugate
which utilizes a divalent antibody.
[0249] These are believed to be the first instances of a sc
anti-CD3 antibodies. IgM was chosen since very few B cells or
macrophages contain IgM Fc receptors. (Binding of immunotoxin to
cells other than T cells reduces the specificity of the anti-T cell
immunotoxin and this situation is purposefully avoided). However,
using a bacterial expression system no carbohydrate is attached to
the antibody which also eliminates Fc receptor binding. Thus,
substituting other human IgG constant domains would be a routine
modification and should be claimed.
[0250] A variety of divalent fusion protein immunotoxins are
provided. These have been expressed in E. coli, and Western blots
of reduced and non-reduced SDS gels confirm that most of the
immunotoxin is secreted as the dimeric (divalent) species (FIG. 8).
The position of the toxin has been varied in an attempt to minimize
stearic hindrance of the divalent antibody site, yet provide the
best interactions with the CD3 receptor to facilitate toxin
translocation across the membrane. FIG. 9 shows a clone expressing
divalent immunotoxin fusion proteins. The clone producing this
consists of a clone constructed by using the single chain antibody
followed by a stop codon and the single chain immunotoxin, all
under one promotor (Better et al. Proc. Natl. Acad. Sci.
90:457-461, January 1993). After secretion and oxidation of the
interchain disulfide, 3 species are present: sc divalent antibody,
divalent fusion immunotoxin, and a divalent sc antibody containing
only one toxin. This species is isolated by size separation. The
advantage of this species is that stearic hindrance to the divalent
antibody domains is limited by the presence of only one toxin
domain. Other variations are routine to construct given the methods
described herein and in the art. Those diagramed are considered to
be the most likely to exhibit divalent character. Numerous
orientations of toxin relative to antibody domains can be made and
many are expected to be effective.
[0251] In addition, the length of the toxin C-terminus has been
varied to provide optimization between two competing functions. The
numbers after DT refer to the number of amino acid residues
counting the amino terminus of the toxin A chain as 1. The full
length toxin is called DTM1 and was provided by Dr. Richard Youle
NINDS, NIH (Nicholls et al. J. Biol. Chem. 268(7):5302-5308, 1993).
It has point mutations S to F at positions 508 and 525. This full
length toxin mutant has the essential mutation of CRM9, S to F at
525 which reduces binding to the DT receptor by 3-4 logs without
abolishing the translocation function. The other mutation S to F at
508 has been added because of previous restrictions on cloning
mutant DT that can revert to wild type toxin with a minimum lethal
dose of 0.1 microgram/kg by means of a single base pair reversion.
Other mutations can be routinely made in the C terminus to perform
this function (Shen et al. J. Biol. Chem. 269(46):29077-29084,
1994). They are: F530A; K526A; N524A; V523A; K516A Y514A. A clone
having a single point mutation in DT reducing toxicity by 10-100
fold can be made providing that the clone contains an antibody
fragment fusion protein, because chemical conjugation of antibody
to DT has been shown to reduce systemic wild type toxin toxicity by
100 fold (Neville et al. J. Biol. Chem. 264(25):14653-14661, 1989).
Therefore, the present invention provides a full length mutant DT
sequence with the 525 S to F mutation alone as well as those listed
above. These same mutations are also contemplated for the B chain
mutant site in DTM2 and can be made similarly. Previous data with
chemical conjugation has shown that the longer the C-terminus the
better the translocation function (Colombatti et al. J. Biol. Chem.
261(7):3030-3035, 1986). However, the shorter the C-terminus the
less effect of circulating anti-toxin blocking antibodies. Since
patients have different levels of blocking antibodies which can be
measured (see toxicity assay in), the optimal immunotoxin can be
selected for individual patients. scUCHT1 fusion proteins with DTM1
and DT483, DT390 and DT370 have been cloned and expressed in E.
coli. Each of these variations as well as the divalent scUCHT1
fusion proteins using each of these toxin domains are provided.
[0252] The present invention provides an improvement on CRM197 (a
non-toxic toxin mutant described in U.S. Ser. No. 08/034,509, filed
Sep. 19, 1994) referred to herein as DTM2. DTM2 has the same
mutation as CRM197 plus two mutations in the C-terminus which block
binding (see sheet and FIG. 8). This is expected to reduce the
likelihood of immune complex disease which could result when CRM197
becomes bound to cells and then is further bound by circulating
antitoxin. Kidneys are particularly susceptible. DTM2 cannot bind
to cells thereby lessening the possibility of tissue damage. In
addition DTM2 is made for high level production by including the
pelB secretory signal for production in E. coli or a
iron-independent mutated promoter DT sequence cloned from CRM9 DNA
for production in C. diphtheriae. The essential feature of DTM2 is
the S to F mutation at 525 and the G to E mutation at 52, and a
construct containing these two mutations is provided.
[0253] All of the constructs reported here can be expressed in E.
coli using pelB signal sequences or other appropriate signal
sequences. Expression can also be carried out in C. diphtheriae
using appropriate shuttle vectors (Serwold-Davis et al. FEMS
Microbiol. Letters 66:119-14, 1990) or in protease deficient
strains of B. subtilis and using appropriate shuttle vectors (Wu et
al. Bio. Technol. 11:71, January 1993).
EXAMPLE 11
Thymic Injection and Tolerance Induction in Primates
[0254] Without thymic treatment, rhesus monkey renal allografts
reject at a mean of 7 days. Renal allografts in rhesus monkeys (age
2-5 years; 2-3 kg body weight) were performed. The experimental
protocol consisted of first selecting MHC class I disparate rhesus
monkey donors and recipients. Donor lymphocytes were injected into
the recipient thymus gland 7 days prior to renal allografting from
the same donor. Recipients received the immunotoxin of the present
invention by intravenous injection. Renal allografts were performed
and recipients underwent native nephrectomy.
[0255] Immunotoxin
[0256] Techniques for preparing anti-CD3-CRM9 (where the antibody
is directed at the human T-cell receptor complex "CD3") have
previously been described. See U.S. Pat. No. 5,167,956 and D.
Neville et al., 89 P.N.A.S. USA 2585-2589 (1992). A hybridoma
secreting UCHT1 was kindly provided by Dr. Peter Beverly, Imperial
Cancer Research Fund, and was grown in ascites fluid and purified
over immobilized Protein A. This is an IgG1.
[0257] FN18, also an IgG1, is the rhesus analog of UCHT1 and shares
with it the property of being a T-cell mitogen in the presence of
mixed mononuclear cells. FN18 was produced in hollow fiber and
purified over Protein A. The strain of C. diphtheriae used for
production of CRM9, C7 (.beta.h tox-201 tox-9 h') was obtained from
R. Holmes, Uniformed Services University of Health Sciences,
Bethesda, Md. see also V. Hu et al., 902 Biochimicia et Biophysica
Acta 24-30 (1987).
[0258] Antibody-CRM9 was recovered from the supernatant of 30 liter
fermentation runs under careful control of iron concentration. See
S. L. Welkos et al., 37 J. Virol. 936-945 (1981). CRM9 was purified
by membrane concentration, ammonium sulfate precipitation and
chromatography over DEAE. See S. Carroll et al., 165 Methods In
Enzymology 68 (1988).
[0259] Large scale purification of immunotoxin was accomplished by
HPLC size exclusion chromatography on MODcol (1266 Andes Blvd., St.
Louis, Mo. 63132) 2".times.10" column packed with Zorbax (DuPont
Company) GF-250 5 .mu.m, 150 .ANG.. Fractions containing 1:1
toxin:antibody mol ratios were isolated for these studies.
[0260] Immunotoxins were synthesized as previously described by
thiolating both the monoclonal antibody moiety and the toxin moiety
and then crosslinking with bismaleimidohexane. See D. Neville et
al., 264 J. Biol. Chem. 14653-14661 (1989). CRM9 was nicked and the
monomer (Carroll et al.) was isolated by the MODcol column
described above prior to thiolation.
[0261] While CRM9 is a presently preferred mutant diphtheria toxin
protein, other preferred embodiments include diphtheria mutants
with a mutation in the DT binding region, such as DT390 (see
example 9), should also be suitable (as the concept behind the
immunotoxin is to replace the normal binding function with the
antibody provided T-cell binding function, with minimal
conformational change).
[0262] T-Cell Ablation
[0263] Monoclonal antibody FN18 (specific for rhesus monkey T
lymphocytes),coupled to the immunotoxin CRM9 was-used to deplete
peripheral blood T-cells to levels below 200 cells/M13 in adult
rhesus monkeys (measured six days after the injection). Some modest
B cell depletion occurred. Following depletion, complete T-cell
recovery takes about three to four weeks in a juvenile rhesus
monkey model using this agent. Surprisingly, notwithstanding this
fast recovery, donor T-cells injected into the thymus still were
not impaired in their ability to produce tolerance.
[0264] Four monkeys received 0.2 mg/kg of immunotoxin, in three
divided doses (24 hours apart from each other). Another monkey
received 0.133 mg/kg immunotoxin in two divided doses (24 hours
apart from each other), and the other monkey received 0.1 mg/kg in
two divided doses (24 hours apart from each other). Two days after
the last dose of immunotoxin, all monkeys except the last had at
least 80% (actually greater than 99%) depletion of T cells both in
the peripheral blood and in the lymph nodes. The lowest dose used
in the last monkey reduced, but did not substantially eliminate
either peripheral blood or lymph node lymphocytes.
[0265] Lymphocytes
[0266] Lymphocytes to be donated are preferably pooled from
axillary and cervical lymph nodes of a single donor. The nodes are
harvested, strained through a mesh to separate the lymphocytes,
diluted with saline, and then injected. Alternatively, a
representative "cocktail" of lymphocytes from several primates
other than the donor, at least one of which turns out to be the
same haplotype as the likely donor, should also work (if the donor
is not available early enough).
[0267] Transplantation
[0268] Table 7 summarizes the outcome of renal transplants
performed following thymic injection of donor lymph node
lymphocytes (mixture of T and B cells) combined with immunotoxin
therapy. Cells injected intrathymically consisted of the pooled
axillary and inguinal lymph node lymphocytes in the numbers
listed.
11TABLE 7 Renal Allograft Survival by Treatment Group* Intrathymic
Survival Monkey injection FN18-CMR9 (days) T4T none none 5 X9X none
none 7 1FE none none 7 H7C 10.6 .times. 108 none 1 donor
lymphocytes W7C 9.1 .times. 108 none 1 donor lymphocytes 93023 7.0
.times. 108 donor 0.2 mg/kg >517 lymphocytes 92108** 1.9 .times.
108 donor 0.2 mg/kg 181 lymphocytes POJ 7.5 .times. 108 donor 0.2
mg/kg >340 lymphocytes POF normal saline 0.2 mg/kg >368 PIP
normal saline 0.2 mg/kg >250 W7D none 0.2 mg/kg 51 POG none 0.2
mg/kg 84 PIN none 0.2 mg/kg >165 X3J none 0.2 mg/kg >117
*FN18-CRM9 was given on day -7, -6, -5 at a total dose of 0.2
mg/kg, i.v. Lymphocytes and saline were injected intrathymically on
day -7. **(acute rejection 40 days after skin graft)
[0269] Two monkeys died of pneumonia, one at 39 days and the other
at 13 days. A third monkey died at 8 days of complications stemming
from a urine leak. At autopsy, none of these three monkeys had any
evidence of renal transplant rejection, either grossly or
histologically.
[0270] Monkey #93023, which received the intrathymic injection and
immunotoxin seven days prior to renal transplantation, had normal
renal function more than 180 days post-transplant. A renal biopsy
of his transplanted kidney at 100 days showed no evidence of
rejection.
[0271] Surgical Procedures
[0272] Preferred surgical procedures include partial median
sternotomy for exposure of the thymus and injection of donor
lymphocytes into the thymus gland; inguinal and axillary
lymphadenectomy to procure donor lymphocytes; laparotomy for
procurement of the left kidney from kidney donors; and a second
laparotomy for renal transplantation and native right nephrectomy.
All of these procedures are performed under general anesthesia as
outlined below. Serial blood draws are performed under ketamine and
xylazine anesthesia as outlined below.
[0273] Thymic injection is performed through a midline chest
incision beginning at the sternal notch extending down to the
midportion of the sternum. The sternum is divided and retracted to
expose the underlying thymus gland. The thymus gland is injected
with donor lymphocytes and the sternum reapproximated and the soft
tissue closed.
[0274] Donor nephrectomy is performed under general anesthesia
through an upper midline incision in the abdomen. The
retroperitoneal attachments of the left kidney are divided, the
ureter is ligated and divided near the bladder, and the left renal
artery and vein are dissected free. The left renal artery and vein
are ligated adjacent to the aorta and inferior vena cava, and the
kidney excised and flushed on the back table with preservation
solution.
[0275] The recipient operation for renal transplantation is
performed by making a midline abdominal incision under general
anesthesia. The distal aorta and inferior vena cava are dissected
free. The vena cava is clamped proximally and distally near its
bifurcation and the donor renal vein anastomosed end-to-side to the
recipient inferior vena cava using running 7-0 proline suture. The
aorta is cross-clamped proximally and distally just proximal to its
bifurcation and the donor renal artery anastomosed end-to-side to
the aorta using running 8-0 proline. A ureteroneocystostomy is then
performed by making an anterior cystotomy and anastomosing the
spatulated tip of the donor ureter to the bladder mucosa using B-0
proline suture. The cystotomy is then closed. The abdomen is then
closed.
[0276] Lymphadenectomy is performed through an approximately 2 cm
groin incision for inguinal lymphadenectomy and a similar length
incision for axillary lymphadenectomy. The lymph nodes are excised
and bleeding points cauterized. The skin is then closed with
running 4-0 nylon suture.
[0277] It should be appreciated that kidney transplants are merely
an example application. The invention should be suitable for use
with a wide variety of organs (e.g. liver, heart, lung, pancreas,
pancreatic islets and intestine).
[0278] In sum, surprisingly immunotoxins known to severely deplete
T-lymphocytes will selectively deplete the host lymphocytes,
without interfering with the donor T lymphocytes ability to cause
tolerance. Further, the extreme level of depletion caused by this
immunotoxin facilitates induction of tolerance.
EXAMPLE 12
Anti-CD3-CRM9 Immunotoxin Promotes Tolerance in Primate Renal
Allografts
[0279] The ability of thymic injection and transient T lymphocyte
depletion to permit development of donor-specific tolerance to
rhesus monkey renal allografts was investigated. For T cell
ablation, the immunotoxin FN18-CRM9, was used that depletes T cells
from both the lymph node and blood compartments (see Example 5 and
Neville et al. J Immunother 1996 (In press)). FN18-CRM9 is composed
of an anti-rhesus monkey CD3 monoclonal antibody (mAb), FN18
(Neville et al., 1996), and a binding site mutant of diphtheria
toxin, CRM9 (Neville et al. Proc Natl Acad Sci USA; 89: 2585-2589
(1992)). Compared to other anti-T cell agents used in clinical and
experimental transplantation, FN18-CRM9 produces more effective
killing of T cells, and this was the rationale for its choice as an
agent to promote transplantation tolerance. Anti-CD3-CRM9 alone
successfully delayed graft rejection. T cell depletion with
anti-CD3-CRM9 combined with thymic injection prolonged graft
survival to >150 days in five of five recipients and induced
donor-specific tolerance in four of five recipients. Donor skin
grafts were accepted long-term, whereas third party skin grafts
were promptly rejected. These results are unique in their reliable
induction of donor-specific tolerance as confirmed by skin grafting
in a non-human primate model. This approach to tolerance reasonably
correlates to induction of tolerance in humans.
[0280] MHC Typing and Donor-Recipient Selection.
[0281] Donor-recipient pairs were selected based on maximizing MHC
disparity. This was based on pre-transplant cytotoxic T lymphocyte
(CTL) and mixed lymphocyte reaction (MLR) analysis (Derry H, Miller
R G. Fathman C G, Fitch F W, eds. New York: Academic Press, 510
(1982) and Thomas et al. Transplantation, 57:101-115 (1994)),
analysis of MHC class I differences by one-dimensional isoelectric
focusing (1-D IEF) (Watkins et al. Eur J Immunol; 18:1425-1432
(1988)), and evaluation of MHC class II by PCR-based analysis.
[0282] Flow Cytometry.
[0283] Two.times.10.sup.5 lymphocytes obtained from peripheral
blood or inguinal, axillary, or mesenteric lymph nodes were stained
with FITC-labeled FN18 or isotype control antibody. Cells were
subjected to flow cytometry on a Benton Dickenson FACSCAN.
[0284] Animals and Surgical Procedures.
[0285] Outbred male juvenile rhesus monkeys (ages 1 to 3 years),
virus free, were used as donors and recipients. Surgical procedures
were performed under general anesthesia, using ketamine, 7 mg/kg,
i.m., and xylazine, 6 mg/kg, i.m. induction, and inhalation with 1%
halothane to maintain general anesthesia. Post-operatively, monkeys
received butorphanol, 0.25 mg/kg, i.v., and aspirin, 181 mg, p.o.,
for pain control. Thymic injection was performed via a limited
median sternotomy to expose the thymus gland. Seven days before
renal transplantation, each lobe of the thymus was injected with
donor lymphocytes suspended in 0.75 to 1.0 ml normal saline using a
27 gauge needle. Donor lymphocytes were procured from the inguinal,
axillary, and mesenteric lymph nodes of the donor, counted and
resuspended in normal saline for injection. Heterotopic renal
transplants were performed using the donor left kidney. Following
transplantation, the recipient underwent native nephrectomy. Graft
function was monitored by measuring serum creatinine. Rejection was
diagnosed by rise in serum creatinine to >0.07 mol/L, no
evidence of technical problems, such as urine leak or obstruction
at autopsy, and histologic confirmation. Monkeys were killed with a
lethal dose of sodium pentobarbital if they rejected their kidney,
and were autopsied. To test for tolerance, full thickness skin
grafts were placed using ventral abdominal skin from donors placed
onto the dorsal upper back of recipients. Grafts were evaluated
daily by inspection.
[0286] Immunosuppression.
[0287] FN18-CRM9 was chemically conjugated and purified as
described (Neville et al. 1996). It was administered intravenously
at a dose of 0.2 mg/kg in 3 divided daily doses starting 7 days
prior to renal transplantation. No additional immunosuppressive
drugs were given to any of the monkeys, and monkeys were not
isolated from environmental pathogens.
[0288] The effect of FN18-CRM9 on rhesus peripheral blood
lymphocytes and lymph node lymphocytes is summarized in FIGS. 10a
and 10b. In addition to causing transient T cell depletion from the
peripheral blood, FN18-CRM9 depleted lymph node lymphocytes almost
completely at the dose given and when measured 0-4 days after the
third dose of drug. Absolute leukocyte counts did not change
significantly with treatment. Recovery times were variable, but in
general peripheral blood T lymphocytes returned toward baseline
levels 2 to 4 weeks following treatment. Recovery rates varied
between individual monkeys.
[0289] Untreated monkeys acutely rejected their allografts (n=3)
within one week (Table 7). Monkeys receiving lymphocytes
intrathymically but no anti-CD3-CRM9 developed hyperacute rejection
within 24 hours (Table 7) with the typical histologic features of
hemorrhage, infarction, and a dense neutrophil and lymphocyte
infiltrate. Three of three recipients treated with donor
lymphocytes intrathymically and anti-CD3-CRM9 had long-term graft
survival (Table 7). One monkey (92108) rejected its kidney 40 days
after a donor and third party skin graft were placed to test for
donor-specific tolerance. This monkey rejected its third party skin
graft at 10 days and a lymphocyte infiltrate in the donor skin
graft developed with rejection of the renal allograft 40 days
later. The other two recipients of donor lymphocytes and
anti-CD3-CRM9 were successfully skin grafted from the donor with
survival of these skin grafts for more than 100 days, but rejection
of third party skin grafts at 10 days. All biopsies of their renal
allografts showed an interstitial infiltrate but no evidence of
glomerular or tubular infiltrates or injury. Two monkeys receiving
normal saline injections in the thymus in combination with
anti-CD3-CRM9 became tolerant of their renal allografts. Both of
these monkeys rejected a third party skin graft at 10 days and have
had long-term survival of donor skin grafts. The results of all
skin grafts are summarized in Table 8. Renal biopsies of
long-surviving tolerant recipients demonstrated focal interstitial
mononuclear infiltrates without invasion or damage of tubules or
glomeruli. Monkeys treated with anti-CD3-CRM9 alone developed late
rejection in two cases at day 54 and day 88 and the histology of
their kidneys at autopsy demonstrated a dense lymphocytic
infiltrate. In two other cases, long-term unresponsiveness was
observed (Table 7) to >127 days and >79 days. The thymuses of
the two monkeys which rejected their grafts were markedly decreased
in size at autopsy compared to age-matched controls prior to
treatment, but a small thymic remnant was identified.
[0290] The data demonstrate that anti-CD3-CRM9 is a potent, new
immunosuppressive agent which is capable of inducing tolerance in
outbred MHC class I and class II disparate rhesus monkeys. This
attribute distinguishes it from other currently known
immunosuppressive agents, such as antithymocyte globulin,
cyclosporine, or monoclonal antibodies which have more limited
efficacy or safety in tolerance induction in large mammals or which
require more cumbersome strategies (Powelson et al.,
Transplantation 57: 788-793 (1994) and Kawai et al.,
Transplantation 59: 256-262 (1995)). The degree of T cell depletion
produced by 3 doses of the drug is more complete than that achieved
by a longer course of anti-lymphocyte globulin, which generally
depletes to a much lesser degree (Abouna et al., Transplantation
59: 1564-1568 (1995) and Bourdage J S, Hamlin D M, Transplantation
59:1194-1200 (1995)). Unlike OKT3, an activating antibody which
does not necessarily kill T lymphocytes, anti-CD3-CRM9 is a lytic
therapy with a more profound effect on T cells than OKT3 and better
potential for tolerance induction. Its efficacy may be in part
related to its ability to deplete T cells in the lymph node
compartment, as well as in peripheral blood, since the majority of
potentially alloreactive T cells reside in the lymph node
compartments. The T cell depletion produced by anti-CD3-CRM9 is
more complete than that achieved by any other known pharmacologic
means, including total lymphoid irradiation, and it avoids the
toxic side effects of radiation. Following treatment with the
anti-CD3-CRM9, the thymus decreases markedly in size, although
thymic cortex and medullary structures are still apparent.
Anti-CD3-CRM9 appears to be safe and well tolerated in rhesus
monkeys. No significant adverse drug effects were encountered.
About half of the monkeys were treated with intravenous fluids for
3 to 5 days following administration to prevent dehydration. No
infections were encountered in these experiments and only routine
perioperative antibiotic prophylaxis was used at the time of renal
transplantation and thymic injection. Cytokine release syndrome was
not seen and monkeys did not develop febrile illness following drug
administration.
[0291] The induction of tolerance in monkeys receiving thymic
injection of either donor lymphocytes or normal saline in
conjunction with anti-CD3-CRM9 suggests that thymic injection may
provide an adjunct to tolerance induction using T cell depletion
with anti-CD3-CRM9. Presumably, CD3+lymphocytes present in the
donor lymphocyte inoculum are also killed by the drug administered
to the recipients. This would leave donor B cells to express donor
MHC class I and class II in the recipient thymus. Rodent studies
would suggest that it is the presence of one or both of these
antigens that is crucial to promoting thymic tolerance (Goss J A,
Nakafusa Y, Flye M W, Ann Surg 217: 492-499 (1993); Knechtle et
al., Transplantation 57: 990-996 (1994) and Oluwole et al.,
Transplantation 56: 1523-1527 (1993)). Of even more interest is the
observation that normal saline injected into the thymus in
conjunction with anti-CD3-CRM9 produced tolerance in two of two
recipients. Surprisingly, the success of this approach suggests
that immunotoxin rather than thymic injection is crucial.
Alternately, non-specific disruption of thymic integrity may
contribute
[0292] The observation that two of four recipients treated with
anti-CD3-CRM9 alone became tolerant suggests that transient
depletion of T cells by the drug is crucial in promoting tolerance.
In rodents, transplant tolerance can be achieved by concomitant
administration of donor antigen and anti-T-cell agents (Qin S et
al., J Exp Med 169: 779-794 (1989); Mayumi H, Good R. A., J Exp Med
1989; 169: 213-238 (1989); and Wood M L et al., Transplantation 46:
449-451 (1988)), but this report demonstrates donor-specific
tolerance using T cell specific therapy alone. The depletion of T
cells from the lymph node compartment by anti-CD3-CRM9 may be
crucial in promoting its efficacy as a tolerance inducing agent and
differentiate it from anti-CD3 mAb alone which depletes the
peripheral blood CD3 cells, but has a weaker effect on the lymphoid
tissues (Hirsch et al., J Immunol 140: 3766-3772 (1988)).
[0293] These experiments using an outbred, MHC incompatible
non-human primate model provide a rationale for tolerance
strategies in human organ transplantation. The results are unique
in offering a simple, reliable, and safe approach to tolerance in a
model immunologically analogous to human solid organ
transplantation. An anti-human CD3 immunotoxin (e.g., scUCHT1-DT390
and anti-CD3--CRM9) has been constructed and has T cell killing
properties similar to FN18-CRM9 (see Examples 9 and 11 Neville 1992
and Neville 1996). The preliminary results reported here have broad
implications for tolerance in humans.
[0294] In summary, immunotoxin treatment alone leads to marked
prolongation of graft survival in 100% of the cases to date.
Eliminating the thymic manipulation did not alter the success rate.
No other drug or treatment regimen comes close to achieving these
results in primates.
[0295] Table 8--Skin Graft Results
12 3rd party Interval after skin survival Donor skin Monkey kidney
transplant (days) survival (days) 93023 182 10 >367 92108 140
1040 (and renal allograft rejection) POF 147 10 >221 POJ 188 10
>152 PIP 176 10 >74
EXAMPLE 13
Immunotoxin Alone Induces Tolerance
[0296] Depletion of mature T cells can facilitate stable acceptance
of MHC mismatched allografts, especially when combined with donor
bone marrow infusion. Although ATG and anti-T cell mAbs eliminate
recirculating cells, residual T cells in lymphoid tissue have
potential to orchestrate immune recovery and rejection. Unlike pure
antibodies, CD3-immunotoxin (CD3-IT) can destroy cells following
direct binding and intracellular uptake without limitations of
immune effector mechanisms. Thus, CD3-IT may have superior
immunosuppressive activity. The action of CD3-IT in rhesus monkey
kidney transplant recipients was examined.
[0297] The present example of CD3-IT is a conjugate of IgG1 mAb
anti-rhesus CD3 epsilon (FN18) and a mutant diphtheria toxin CRM9
(FN18-CRM9). The B chain of CRM9 diphtheria toxin bears a mutation
that markedly reduces binding to diphtheria toxin receptors,
allowing specificity to be directed by anti-CD3.
[0298] CD3-IT was administered to 3-5 kg normal male rhesus monkey
allograft recipients at a dose of 67 .mu.g/kg on days-1 and 33
.mu.g/kg on days +0 and +1 without additional immunosuppressive
drugs. Recipient-donor combinations were selected to be
incompatible by MLR and multiple DR allele mismatches; and all were
seronegative for CRM9-reactive antibody to diphtheria toxin. Three
groups received CD3-IT: (1) alone (n=3), (2) in combination with
day 0 infusion of donor bone marrow DR.sup.-CD3.sup.- (n=3), (3) or
with donor bone marrow and 200 cGy lymphoid irradiation given on
days -1 and 0 (n-3).
[0299] Kidney allograft survival was remarkably prolonged. With
CD3-IT alone, graft survival time was 57, 51, and 44 days. In
combination with donor bone marrow infusion, graft survival was
>400, 124, and 36 days. CD3-IT, lymphoid irradiation, and donor
bone marrow resulted in graft survival of >300, 143, and 45
days. Both the 36 or 45 day graft losses were from hydronephrosis
without evidence of rejection. Peripheral blood T cell counts fell
selectively by 2 logs, and time to 50% recovery was 20-60 days. The
peripheral blood CD3+CD4/CD8 ratio increased 2-6 fold before
adjusting to baseline by 3 weeks. B cell/T cell ratios in lymph
nodes were elevated >40-fold on day 5-7, reflecting a 1-2 log
reduction in circulating and fixed tissue T cell compartments. LN
CD4/CD8 ratios were normal at 5-7 days, but CD45RA+CD4 and CD28-CD4
cell subsets increased >1 log while CD28+CD8 cells decreased by
>1 log, suggesting functional subset changes.
[0300] Anti-donor MLR responses became reduced uniformly, but
specific unresponsiveness was seen only in the donor bone
marrow-treated group. Peripheral blood microchimerism was
detectable by allele specific PCR after donor bone marrow-infusion.
These studies show CD3-IT to be an unusually effective and specific
immunosuppressive agent in non-human primate transplantation and
provides clinical tolerance induction strategies applicable to
transplantation in humans.
EXAMPLE 14
Immuotoxin Plus Short Term Immunosuppressant Drugs Induces
Tolerance in Monkeys in Models Simulating Human Cadaveric
Donors
[0301] The efficacy of IT in prolonging allograft survival was
evaluated in a model that stimulates transplantation of organs from
cadaveric donors in humans. Rhesus monkey donor-recipient pairs
were selected on the basis of MHC class I and II disparity. Monkeys
were given anti-CD3-CRM9 immunotoxin 0.2 mg/kg iv in three divided
daily doses starting on the day of the renal allograft (group 1).
In group 2, recipients also received methylprednisolone 125 mg iv
daily for 3 days and mycophenolate mofetil 250 mg po daily for 3
days starting on the day of the transplant. Rejection was monitored
by serum creatinine levels and confirmed histologically.
13 Graft Survival (days) Group 1 Group 2 Group 3 (IT alone) (IT +
MMF + methylprednisolone) (untreated) 19 >90 5 57 >75 7 51
>60 7 >124 >102
[0302] The short burst of intensive anti-T cell therapy given at
the time of the transplant appears to be well tolerated and to
reliably result in long-term allograft survival. The mRNA cytokine
profile of graft infiltrating cells obtained from renal transplant
biopsies in this protocol suggests that IL-2 and .gamma.-IF
(TH.sub.1 associated) are present in measurable levels and IL-4 and
10 (TH.sub.2 associated) are detected at much lower levels. These
results in a non-human primate model provide a strategy that can be
applied to human organ transplant recipients who would benefit
substantially from independence from maintenance immunosuppressive
drugs.
[0303] A second group of rhesus monkeys undergoing mismatched renal
transplantation received anti-CD3-CRM9 (IT) 18 hours pretransplant,
0.067 mg/kg and 0.033 mg/kg on days 0 and +1. Group 1 received only
IT, n=6. Group 2, n=7, received in addition to IT deoxyspergualin
(DSG) IV 2.5 mg/kg/day and solumedrol (SM), 7, 3.5 and 0.33 mg/kg
IV during the IT administration. DSG was continued from 4 to up to
14 days. Plasma samples were tested by ELISA for cytokine release
syndrome by measuring pre and post transplant plasma IL-12 and INF
gamma levels.
Graft Survival (Days)
[0304]
14 Group 1 (IT alone) Group 2 (IT + DSG + SM) 10-57 n = 6
(rejections) >155-200 n = 4 28-45 n = 3 (rejections) 2 deaths
from non-rejection causes
[0305] IT, Group I, (or rhesus anti-CD3 an antibody alone) elevated
both IL-12 and INF-8 gamma. DSG and solumedrol appear to block
IL-12 induced activation of INF-gamma by a mechanism that may be
associated with NF-kappa/beta (see FIGS. 15-16). This treatment is
found to eliminate peritransplant weight gain (FIG. 17) and serum
hypoproteinemia (FIG. 18), both signs of vascular leak syndrome,
which in this study is associated with early graft rejection. This
peritransplant treatment regimen can provide a rejection-free
window for tolerance induction applicable to cadaveric
transplantation.
[0306] It takes over 24 hours for IT to exert most of its lymph
node T cell killing effects. Therefore, IT cadaveric
transplantation protocols (protocols in which organ transplantation
occurs generally within 6 hours of initial therapy and not longer
than 18 hours) benefit substantially from peritransplant
supplemental short term immunosuppressant agents to minimize
peritransplant T cell responses to the new organ as shown by the
above data.
[0307] Throughout this application various publications are
referenced by numbers within parentheses. Full citations for these
publications are as follows. Also, some publications mentioned
hereinabove are hereby incorporated in their entirety by reference.
The disclosures of these publications in their entireties are
hereby incorporated by reference into this application in order to
more fully describe the state of the art to which this invention
pertains.
[0308] While the foregoing invention has been described in some
detail for purposes of clarity and understanding, it will be
appreciated by one skilled in the art from a reading of this
disclosure that various changes in form and detail can be made
without departing from the true scope of the invention and appended
claims.
REFERENCES
[0309] 1. Nicholls, P. J., Johnson, V. G., Andrew, S. M.,
Hoogenboom, H. R., Raus, J. C. and Youle, R. J. (1993) J Biol Chem
268, 5302-5308.
[0310] 2. Neville, D. J. (1987) Ann N Y Acad Sci 507, 155-1643.
[0311] 3. Williams, D. P., Parker, K., Bacha, P., Bishai, W.,
Borowski, M., Genbauffe, F., Strom, T. B. and Murphy, J. R. (1987)
Protein Eng 1,493-498
[0312] 4. Johnson, V. G. and Youle, R. J. (1989) J Biol Chem 264,
17739-17744
[0313] 5. Kreitman, R. J., Chaudhary, V. K., Waldmann, T. A.,
Hanchard, B., Cranston, B., FitzGerald, D. J. and Pastan, I. (1993)
Leukemia 7, 553-562
[0314] 6. Murphy, J. R. (1988) Cancer Treat Res 37, 123-124
[0315] 7. Laske, D. W., Ilercil, O., Akbasak, A., Youle, R. J. and
Oldfield, E. H. (1994) J Neurosurg 80, 520-526
[0316] 8. Neville, D. J., Scharff, J. and Srinivasachar, K. (1992)
J of Controlled Release 24, 133-141
[0317] 9. Neville, D. J., Scharff, J. and Srinivasachar, K. (1992)
Proc Natl Acad Sci USA 89, 2585-2589
[0318] 10. Giannini, G., Rappuoli, R. and Ratti, G. (1984) Nucleic
Acids Res 12, 4063-4069
[0319] 11. Chang, T. M. and Neville, D. M. J. (1977) J Biol Chem
252, 1505-1514
[0320] 12. Neville, D. J., Srinivasachar, K., Stone, R. and
Scharff, J. (1989) J Biol Chem 264, 14653-14661
[0321] 13. Shalaby, M. R., Shepard, H. M., Presta, L., Rodrigues,
M. L., Beberley, P. C. L., Feldman, M. and Carter, P. (1992) J Exp
Med 175, 217-225
[0322] 14. Johnson, S. and Bird, R. E. (1991) in Methods in
Enzymol, pp.88-98, Academic Press, Inc., San Diego, Calif.
[0323] 15. Grimont, F. and Grimont, P. A. D. (1991) in Nucleic acid
techniques in bacterial systematics, pp. 252, E. A. G. Stackebrandt
M. John Wiley and Sons, LTD, West Sussex, England
[0324] 16. Esworthy, R. S. and Neville, D. M. J. (1984) J Biol Chem
258, 11496-11504
[0325] 17. Pelchen-Matthews, A., Armes, J. E., Griffiths, G. and
Marsh, M. (1991) J Exp Med 173, 575-578
[0326] 18. Choe, S., Bennett, M. J., Fujii, G., Curmi, P. M.,
Kantardjieff, K. A., Collier, R. J. and Eisenberg, D. (1992) Nature
357, 216-222
[0327] 19. LeMaistre, C. F., Meneghetti, C., Rosenblum, M., Reuben,
J., Parker, K., Shaw, J., Deisseroth, A., Woodworth, T. and
Parkinson, D. R. (1992) Blood 79, 2547-2554
[0328] 20. Platanias, L. C., Ratain, M. J., O'Brien, S., Larson, R.
A., Vardiman, J. W., Shaw, J. P., Williams, S. F., Baron, J. M.,
Parker, K. and Woodworth, T. G. (1994) Leuk Lymphoma 14,
257-262
[0329] 21. Higashi, K., Asada, H., Kurata, T., Ishikawa, K.,
Hayami, M., Spriatna, Y., Sutarman, Y. and Yamanishi, K. (1989) J
Gen Virol 70,3171-3176
[0330] 22. Youle, R. J. and Neville, D. M. J. (1982) J Biol Chem
257, 1598-1601
[0331] 23. Williams, D. P., Snider, C. E., Strom, T. B. and Murphy,
J. R.(1990) J Biol Chem 265, 11885-11889
[0332] 24. Parlevliet et al. (1992) Transplant Int; 5:234-246.
[0333] 25. Cosimi et al. (1981) Transplantation; 32:535-9.
[0334] 26. Jaffers et al. (1986) Transplantation; 41:572-8.
[0335] 27. Abramowicz et al. (1989) Transplantation; 47:606-8.
[0336] 28. Burns et al. (1982) J Immunol; 129:1451-7.
[0337] 29. Parren et al. (1991) Res Immunol; 142:749-63.
[0338] 30. Waid et al. (1991) Transplant Proc; 23:1062-5.
[0339] 31. Khazaeli et al. (1994) J Immunotherapy; 15:42-52.
[0340] 32. Chen C and Okayama H. (1987); Mol Cell Biol
7:2745-52.
[0341] 33. Slavin-Chiorini et al. (1993) Int J Cancer
53:97-103.
[0342] 34. Rigaut K D, Scharff J E, Neville D M Jr. (1995) Eur J
Immunol; 25:2077-82.
[0343] 35. Woodle E S, Thistlethwaite J R, Jolliffe L K, et al.
(1992) J Immunol; 148:2756-63.
[0344] 36. Miller A D, Rosman G J. (1989) BioTechniques
7:980-90.
[0345] 37. Shu L M, Qi C F, Schlom J, Kashmiri S V S (1993) Proc
Natl Acad Sci USA; 90:7995-9.
[0346] 38. Mosmann T R, Williamson A R (1980) Cell; 20:283-92.
[0347] 39. Capon D J, Chamow S M, Mordenti J, et al. (1989) Nature
337:525-31.
[0348] 40. Anand N N, Mandal S, MacKenzie C R, et al. (1991) J Bio
Chem 266:21874-9.
[0349] 41. Sitia R, Neuberger M, Alberini C M, et al. (1990) Cell;
60:781-90.
[0350] 42. Alberini C M, Bet P, Milstein C, Sitia R. (1990) Nature
347:485-7.
[0351] 43. Fra A M, Fragioli C, Finazzi D, Sitia R, Alberini C M
(1993) The EMBO Journal; 12:4755-61.
[0352] 44. Wiersma E J, Shulman M J (1995); 154:5265-72.
[0353] 45. Smith K G, Austyn J M, Hariri G, Beverley PC, Morris P J
(1986) Eur J Immunol; 16:478-86.
[0354] 46. Tax W J, Hermes F F, Willems R W, Capel P J, Koene R A
(1984) J Immunol; 133:1185-9.
[0355] 47. Lynch, R G, Sandor M., Metzger H, ed. Washington D.C.:
American Society for Microbiology 1990:305-34.
[0356] 48. Moretta I, Webb S R, Grossi C E, Lydyard M, Cooper M D.
(1977) J Exp Med; 146:184-200.
[0357] 49. Ferrarini M, Moretta L, Mingari M C, Tonda P, Pernis B.
(1976) Eur J Immunol; 6:520-1.
[0358] 50. Mathur A, Lynch R G, Kohler G (1988); J Immunol;
140:143-7.
[0359] 51. Pricop L, Rabinowich H, Morel P A, Sulica A, Whiteside T
L, Herberman R B (1993) J Immunol; 151:3018-29.
[0360] 52. Emara M, Sanfilippo F (1992) Cell Immunol;
144:143-54.
[0361] 53. Glu M, Gordon V M, Fitzgerald D J, Leppla S (1996)
Infect. and Immun.; 64(2):524-527.
[0362] 54. Kuan C T, Pastan I (1996) Proc. Natl. Acad. Sci. USA;
93:974-978, 1996.
[0363] 55. Francisco J A, Kiener P A, Moran-Davis P, Ledbetter J A,
Siegall C B (1996) J. Immunol.; 157:1652-1658.
[0364] 56. Kaczorek M, Delpeyroux F, Chenciner N, Streeck R (1983)
Science; 221:855
[0365] 57. Shen W H, Choe S, Eisenberg D, Collier R J (1994) Biol.
Chem.; 469(46):29077-29084.
[0366] 58. Muhlrad D, Hunter R, Parker R (1992) Yeast; 8:79-82.
[0367] 59. Madshus I H, Stenmark H, Snadvig K, Olsnes S (1991) J.
Biol. Chem.; 266(26):17446-53.
[0368] 60. Federal Register, Notices, May 7, 1986), Appendix
F-II-B, p. 16971.
[0369] 61. Perkins S J, Nealis A S, Sutton B J, Feinstein A (1991)
J. Mol. Biol., 221:1345-1366.
[0370] 62. Theuer, C P, Kreitman R J, FitzGerald D J, Pastan I
(1993) Cancer Res., 53:340-347.
[0371] 63. Kihara A, Pastan I (1994) Cancer Res., 54:5154-5159.
[0372] 64. Chaudry G J, Fulton R J, Draper R K (1993) J. Biol.
Chem., 268(13):9437-9441.
[0373] 65. Schmidt M, Hynes N E, Groner B, Wels W (1996) Int. J.
Cancer, 65:538-546.
[0374] 66. Better M, Bernhard S L, Lei S P, Fishwild D M, Lane J A,
Carroll S F, Horwitz A H (1993) Proc. Natl. Acad. Sci USA,
90:457-461.
[0375] 67. Thompson J, Hu H, Scharff J, Neville, Jr. D (1995) J.
Biol. Chem., 24:28037-28041.
[0376] 68. Ma S, Thompson J, Hu H, Neville, Jr. D (1996) Scand. J.
Immunol. 43:134-139.
[0377] 69. Neville, Jr. D, Scharff J, Hu H, Rigaut K, Shiloach J,
Singerland W, Jonker M (1996) J. Immunotherapy 19(2):85-92.
[0378] 70. Knechtle S, Vargo D, Fechner J, Zhai Y, Wang J, Hanaway
M, Scharff J, Hu H, Knapp L, Watkins D, Neville, Jr. D (1997)
Transplantation 63(6):1-6.
[0379]
Sequence CWU 1
1
16 1 3476 DNA Artificial Sequence Description of Artificial
Sequence/note = synthetic construct 1 aaaaaaaagc ccgccgaagc
gggctttatt accaagcgaa gcgccattcg ccattcaggc 60 tgcgcaactg
ttgggaaggg cgatcggtgc gggcctcttc gctattacgc cagctggcga 120
aagggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc cagtcacgac
180 gttgtaaaac gacggccagt ccgtaatacg actcacttaa ggccttgact
agagggaaga 240 tctggatgca ttcgcgcgca cgtacggtct cgaggaattc
ctgcaggata tcgtggatcc 300 aagcttcacc atgggagacg tcaccggttc
tagaacctag ggagctctgg tacccactag 360 tgagtcgtat tacgtaaccg
caggtaaaag gcatattttt cgcgtgtcat ggctagtaaa 420 taacaccggt
gtcatttaga gtcagggaaa gacaatgaaa aacgaagaaa gccaccgggc 480
ggcaacccga tgactttcgc ttatcaccca gcacacacct gggagaaatc acggtcatga
540 gtttacagac tcatgcgcag aatgcgcaca ctaaaacacc tacccgcgtc
gagcgcgacc 600 gtggtggact ggacaacacc ccagcatctg ccagtgaccg
cgacctttta cgcgatcatc 660 taggccgcga tgtactccac ggttcagtca
cacgagactt taaaaaggcc tatcgacgca 720 acgctgacgg cacgaactcg
ccgcgtatgt atcgcttcga gactgatgct ttaggacggt 780 gcgagtacgc
catgctcacc accaagcagt acgccgccgt cctggtcgta gacgttgacc 840
aagtaggtac cgcaggcggt gaccccgcag acttaaaccc gtacgtccgc gacgtggtgc
900 gctcactgat tactcatagc gtcgggccag cctgggtggg tattaaccca
actaacggca 960 aagcccagtt catatggctt attgaccctg tctacgctga
ccgtaacggt aaatctgcgc 1020 agatgaagct tcttgcagca accacgcgtg
tgctgggtga gcttttagac catgacccgc 1080 acttttccca ccgctttagc
cgcaacccgt tctacacagg caaagcccct accgcttatc 1140 gttggtatag
gcagcacaac cgggtgatgc gccttggaga cttgataaag caggtaaggg 1200
atatggcagg acacgaccag ttcaacccca ccccacgcca gcaattcagc tctggccgcg
1260 aacttatcaa cgcggtcaag acccgccgtg aagaagccca agcattcaaa
gcactcgccc 1320 aggacgtaga cgcggaaatc gccggtggtc tcgaccagta
tgacccggaa cttatcgacg 1380 gtgtgcgtgt gctctggatt gtccaaggaa
ccgcagcacg cgacgaaaca gcctttagac 1440 atgcgcttaa gactggccac
cgcttgcgcc agcaaggcca acgcctgaca gacgcagcaa 1500 tcatcgacgc
ctatgagcac gcctacaacg tcgcacacac ccacggcggt gcaggccgcg 1560
acaacgagat gccacccatg cgcgaccgcc aaaccatggc aaggcgcgtg cgcgggtatg
1620 tcgcccaatc caagagcgag acctacagcg gctctaacgc accaggtaaa
gccaccagca 1680 gcgagcggaa agccttggcc acgatgggac gcagaggcgg
acaaaaagcc gcacaacgct 1740 ggaaaacaga ccccgagggc aaatatgcgc
aagcacaaag gtcgaagctt gaaaagacgc 1800 accgtaagaa aaaggctcaa
ggacgatcta cgaagtcccg tattagccaa atggtgaacg 1860 atcagtattt
ccagacaggg acagttccca cgtgggctga aataggggca gaggtaggag 1920
tctctcgcgc cacggttgct aggcatgtcg cggagctaaa gaagagcggt gactatccgg
1980 acgtttaagg ggtctcatac cgtaagcaat atacggttcc cctgccgtta
ggcagttaga 2040 taaaacctca cttgaagaaa accttgaggg gcagggcagc
ttatatgctt caaagcatga 2100 cttcctctgt tctcctagac ctcgcaaccc
tccgccataa cctcaccgaa ttgtgggcca 2160 tcgccctgat agacggtttt
tcgccctttg acgttggagt ccacgttctt taatagtgga 2220 ctcttgttcc
aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa 2280
gggattttgc cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac
2340 gcgaatttta acaaaatatt aacgtttaca atttaaatat ttgcttatac
aatcttcctg 2400 tttttggggc ttttctgatt atcaaccggg gtaaatcaat
ctaaagtata tatgagtaaa 2460 cttggtctga cagttaccaa tgcttaatca
gtgaggcacc tatctcagcg atctgtctat 2520 ttcgttcatc catagttgcc
tgactccccg tcgtgtagat aactacgata cgggagggct 2580 taccatctgg
ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 2640
tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat
2700 ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt
tcgccagtta 2760 atagtttgcg caacgttgtt gccattgcta caggcatcgt
ggtgtcacgc tcgtcgtttg 2820 gtatggcttc attcagctcc ggttcccaac
gatcaaggcg agttacatga tcccccatgt 2880 tgtgcaaaaa agcggttagc
tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 2940 cagtgttatc
actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 3000
taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc
3060 ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca
catagcagaa 3120 ctttaaaagt gctcatcatt ggagaacgtt cttcggggcg
aaaactctca aggatcttac 3180 cgctgttgag atccagttcg atgtaaccca
ctcgtgcacc caactgatct tcagcatctt 3240 ttactttcac cagcgtttct
gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 3300 gaataagggc
gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 3360
gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata
3420 aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgta gttaac
3476 2 21 DNA Artificial Sequence Description of Artificial
Sequence/note = synthetic construct 2 gacatccaga tgacccagac c 21 3
58 DNA Artificial Sequence Description of Artificial Sequence/note
= synthetic construct 3 cctcccgagc caccgcctcc gctgcctccg cctcctttta
tctccagctt gtgtcgcc 58 4 56 DNA Artificial Sequence Description of
Artificial Sequence/note = synthetic construct 4 gcagcggagg
cggtggctcg ggagggggag gctcggaggt gcagcttcag cagtct 56 5 32 DNA
Artificial Sequence Description of Artificial Sequence/note =
synthetic construct 5 gcaagcttga agactgtgag agtggtgcct tg 32 6 37
DNA Artificial Sequence Description of Artificial Sequence/note =
synthetic construct 6 gtctcttcaa agcttattgc ctgagctgcc tcccaaa 37 7
32 DNA Artificial Sequence Description of Artificial Sequence/note
= synthetic construct 7 gcatctagat cagtagcagg tgccagctgt gt 32 8 59
DNA Artificial Sequence Description of Artificial Sequence/note =
synthetic construct 8 cggtcgacac catggagaca gacacactcc tgttatgggt
actgctgctc tgggttcca 59 9 51 DNA Artificial Sequence Description of
Artificial Sequence/note = synthetic construct 9 gtactgctgc
tctgggttcc aggttccact ggggacatcc agatgaccca g 51 10 67 DNA
Artificial Sequence Description of Artificial Sequence/note =
synthetic construct 10 atgaaatacc tattgcctac ggcagccgct ggattgttat
tactgcgctg cccaaccagc 60 gatggcc 67 11 54 DNA Artificial Sequence
Description of Artificial Sequence/note = synthetic construct 11
atgaaatacc tattgcctac ggcagccgct ggattgttat tactcgctgc ccaa 54 12
59 DNA Artificial Sequence Description of Artificial Sequence/note
= synthetic construct 12 ggattgttat tactcgctgc ccaacaagcg
atggccggcg ctgatgatgt tgttgattc 59 13 31 DNA Artificial Sequence
Description of Artificial Sequence/note = synthetic construct 13
cggtactata aaactctttc caatcatcgt c 31 14 31 DNA Artificial Sequence
Description of Artificial Sequence/note = synthetic construct 14
gacgatgatt ggaaagagtt ttatagtacc g 31 15 40 DNA Artificial Sequence
Description of Artificial Sequence/note = synthetic construct 15
agatctgtcg ntcatcagct tttgatttca aaaaatagcg 40 16 15 PRT Artificial
Sequence Description of Artificial Sequence/note = synthetic
construct 16 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser 1 5 10 15
* * * * *