U.S. patent application number 10/283741 was filed with the patent office on 2003-09-25 for device and methods for directed synthesis of chemical libraries.
Invention is credited to Battersby, Bronwyn J., Johnston, Angus, Miller, Christopher R., Trau, Mathias, Way, Jeffery C..
Application Number | 20030182068 10/283741 |
Document ID | / |
Family ID | 23291196 |
Filed Date | 2003-09-25 |
United States Patent
Application |
20030182068 |
Kind Code |
A1 |
Battersby, Bronwyn J. ; et
al. |
September 25, 2003 |
Device and methods for directed synthesis of chemical libraries
Abstract
The invention features a sort computer which interfaces with a
sorting device in order to control the sorting of beads on a bead
by bead basis. The invention further features novel methods for the
directed synthesis of encoded libraries of oligomers, e.g.,
oligonucleotides, on beads. These methods allow the synthesis of
libraries that are sufficiently large to permit complex genomic
analyses to be carried out. New methods of using the encoded
libraries also are described.
Inventors: |
Battersby, Bronwyn J.;
(Riverhills, AU) ; Miller, Christopher R.;
(MacGregor, AU) ; Trau, Mathias; (Balmoral,
AU) ; Way, Jeffery C.; (Cambridge, MA) ;
Johnston, Angus; (St. Lucia, AU) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
23291196 |
Appl. No.: |
10/283741 |
Filed: |
October 30, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60330759 |
Oct 30, 2001 |
|
|
|
Current U.S.
Class: |
702/22 ; 506/15;
506/16; 506/18; 506/19; 506/31; 506/42; 506/9; 702/27 |
Current CPC
Class: |
B01J 2219/00695
20130101; B01J 2219/00576 20130101; B01J 2219/00725 20130101; B01J
2219/00702 20130101; B01J 19/0046 20130101; B01J 2219/00466
20130101; B01J 2219/00463 20130101; B01J 2219/00554 20130101; B01J
2219/00454 20130101; B01J 2219/00722 20130101; B01J 2219/00286
20130101; C07B 2200/11 20130101; C40B 40/06 20130101; C07K 1/047
20130101; B01J 2219/00729 20130101; C40B 70/00 20130101; B01J
2219/00502 20130101; C40B 40/10 20130101; B01J 2219/00545 20130101;
B01J 2219/00698 20130101; B01J 2219/00585 20130101; B01J 2219/00689
20130101; B01J 2219/005 20130101; B01J 2219/00596 20130101; B01J
2219/00592 20130101 |
Class at
Publication: |
702/22 ;
702/27 |
International
Class: |
G01N 031/00; G06F
019/00 |
Claims
What is claimed is:
1. A method for directing the synthesis of a combinatorial library
of oligomers, said method comprising the steps of: (a) prior to
coupling, assigning a predetermined oligomer sequence to each of a
plurality of carriers, wherein each of said plurality of carriers
comprises a distinguishable feature; (b) sorting said plurality of
carriers into a plurality of reaction vessels, wherein the vessel
into which each carrier is sorted is determined by the oligomer
assigned to each carrier based on said distinguishable feature, and
wherein each carrier is sorted independently of the other carriers;
(c) performing a reaction to couple a chemical moiety to each
carrier in each vessel, wherein the chemical moiety is the same or
different in different vessels; (d) repeating steps (b) and (c) at
least once, wherein, in each step, a subsequent chemical moiety is
coupled to the previously added chemical moiety to produce a
plurality of oligomers, thereby directing the synthesis of a
combinatorial library of oligomers.
2. The method of claim 1, further comprising the step, between
steps (c) and (d), of pooling the carriers in each of said
vessels.
3. The method of claim 1, wherein each carrier in said plurality of
carriers comprises a unique distinguishable feature.
4. The method of claim 1, wherein said chemical moiety comprises a
deoxyribonucleotide, a ribonucleotide, an amino acid, a saccharide,
a peptide nucleic acid, a carbonate, a sulphone, a sulfoxide, a
nucleoside, a carbohydrate, a urea, a phosphonate, a lipid, or an
ester.
5. The method of claim 1, wherein said chemical moiety is
protected.
6. The method of claim 1, wherein prior to step (c), a linker is
coupled to each of said plurality of carriers.
7. The method of claim 6, wherein said linker is cleavable.
8. The method of claim 7, further comprising, after step (e),
cleaving said linker.
9. The method of claim 6, wherein said linker is not cleavable.
10. The method of claim 1, wherein each carrier comprises a
reactive group.
11. The method of claim 1, wherein in step (a), said plurality of
carriers is sorted into at least four vessels.
12. The method of claim 1, wherein in step (a), said carriers are
sorted in a flow cytometer.
13. The method of claim 1, wherein said distinguishable feature is
detectable by fluorescence, light scatter, color, luminescence,
phosphorescence, infrared radiation, x-ray scatter, light
absorbance, surface plasmon resonance, electrical impedance, or a
combination thereof.
14. The method of claim 1, further comprising step (e), cleaving at
least one of said plurality of oligomers from one of said plurality
of carriers.
15. The method of claim 1, wherein said carrier is a bead.
16. A library of encoded carriers, said library comprising a
plurality of carriers wherein each of said carriers comprises a
unique distinguishing feature and a unique oligomer bound to said
carrier.
17. The library of claim 16, wherein said library comprises at
least 1,000, 10,000, 100,000, or 1,000,000 carriers.
18. The library of claim 16, wherein said library comprises between
1,000 and 1,000,000 carriers.
19. The library of claim 16, wherein said oligomer comprises a
deoxyribonucleotide, a ribonucleotide, an amino acid, a saccharide,
a peptide nucleic acid, a carbonate, a sulphone, a sulfoxide, a
nucleoside, a carbohydrate, a urea, a phosphonate, a lipid, or an
ester.
20. The library of claim 16, wherein said unique oligomer is bound
to said carrier via a linker.
21. The library of claim 20, wherein said linker is cleavable.
22. The library of claim 20, wherein said linker is not
cleavable.
23. The library of claim 16, wherein said carriers are beads.
24. A device for sorting carriers, said device comprising: (a) a
sorter comprising a flow path that splits into at least two
branches into which carriers can be sorted; (b) one or more
detectors capable of detecting said carriers in said flow path,
wherein said one or more detectors are disposed to detect said
carriers prior to passing into one of said branches; (c) a computer
that determines the branch into which each carrier is sorted based
on one or more signals from each carrier obtained from said one or
more detectors.
25. The device of claim 24, wherein said sorter is a flow
cytometer.
26. The device of claim 24, wherein said flow path splits into at
least four branches.
27. The device of claim 24, wherein one of said one or more
detectors detects fluorescence, light scatter, color, luminescence,
phosphorescence, infrared radiation, x-ray scatter, light
absorbance, surface plasmon resonance, or electrical impedance.
28. A sort computer, said computer comprising: (a) an interface
that is capable of receiving data that encodes a distinguishable
feature of a carrier as it is passed through a sorting device
comprising a flow path that splits into at least two branches; (b)
one or more memories that store the number of carriers having each
distinguishable feature; (c) a controller that is capable of
controlling said sorting device to sort said carrier into one of
said branches; and (d) a sorting selector that determines into
which branch said carrier is sorted based on the number of carriers
having that distinguishable feature stored in said one or more
memories.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 60/330,759, filed Oct. 30, 2001, hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The invention relates to the fields of cytometry and
combinatorial chemistry.
[0003] Recently, the demand for more economical and flexible
alternatives in genomics, proteomics, and drug discovery research
has greatly increased. While incremental improvements continue to
be made in the technology as applied to these applications, the
technology is still largely limited to two-dimensional array
approaches for screening libraries. Currently, this research is
performed using DNA microarrays, protein microarrays, or
microplates coupled with sophisticated robotic and detection
instrumentation. The widespread adoption of microarrays has been
limited by their expense and the fact that the arrays typically
cannot be custom-made at individual companies or institutions.
Microarrays are complex and expensive to produce and use, and even
the best DNA arrays are limited to several hundred thousand
oligonucleotide probes. This number is not ideal for sequencing,
SNP analysis, or other operations that may be required for cost
effective research, diagnostic, and therapeutic applications of
genomics. Furthermore, although microarrays have the capability of
detecting a wide range of gene expression levels, such measurements
are subject to variability relating to probe hybridization
differences and cross-reactivity, differences between elements
within microarrays, and differences from one array to another
[Audic, S. and Claverie, J. 1997. Genome Res. 7, 986-995; Wittes,
J. and Friedman, H. P. 1999. J. Natl. Cancer Inst. 91, 400-401;
Richmond, C. S. et al. .1999; Nucleic Acids Res. 27, 3821-3835].
Similarly, the miniaturization of existing microplate formats is
intrinsically limited by the physical constraints of delivering
small volumes to wells.
[0004] Large numbers of compounds may be synthesized on or coupled
to libraries of beads. Colloid-based libraries are inexpensive to
produce in enormous numbers, can be conveniently stored in small
volumes of fluid, and can be "optically barcoded" and screened
using various detection technologies. Depending on the specific
application, such colloid-based chemical libraries may be comprised
of different families of chemical compounds. For example, certain
genomics applications require a library containing single-stranded
DNA molecules (oligonucleotides), each of which has a unique
sequence. Proteomics studies employ a library of proteins to
explore protein diversity, interaction, structure, and function.
For drug discovery applications, a wide variety of molecular
families (e.g., polypeptides and polysaccharides) can be attached
to the colloidal supports and screened for biological activity.
[0005] One of the most powerful library synthesis methods is the
iterative split and mix synthesis on colloidal support beads. This
technique is an efficient method for accessing all combinations of
chosen monomers, such as nucleic acids, amino acids, or sugars, in
a small number of reactions. In a split and mix synthesis, a large
number of solid support beads is partitioned into several vessels,
a different monomer is reacted with each portion, and the beads are
recombined to complete the cycle. The split and mix process is
repeated for a chosen number of cycles, resulting in a chemical
library, ideally consisting of all monomer combinations. Compound
identification from such large pools of compounds, bound to solid
supports (one compound per bead) or free in solution, may be
achieved through covalent attachment of molecular tags to the beads
or through iterative deconvolution technologies. The quantity of
compound on a microscopic colloid is often adequate to allow
detection of bioactivity; however, the amount is typically
insufficient to permit structural elucidation by conventional
analysis techniques. Compounds on colloidal particles are not
positionally-encoded as they are in microarrays or microplates, and
thus alternative methods of encoding are required. This requirement
is particularly important in combinatorial libraries that involve a
large number of different colloid-based moieties. The covalent
binding of molecular identifier tags (e.g., oligonucleotides,
electrophoretic molecular tags, cleavable dialkylamine tags,
secondary amines, fluorophenyl ethers, and trityl mass-tags) to the
colloids in parallel with the compound synthesis is a common
approach to reducing this problem. The requirement, however, for
compatible compound and tag synthesis places substantial
limitations on the procedure. Additional chemical steps are also
needed to synthesize the tags, and artifacts may arise as a result
of interfering chemistries between the combinatorial step and the
tagging step. Furthermore, tag analysis frequently involves
laborious and expensive procedures.
[0006] In order to make tag analysis quicker, some workers have
attempted to use fluorophores for tagging solid supports. The
concept of tagging solid support beads with fluorophores has been
present in the literature for several years. In 1994, Furka and
colleagues recognized that fluorophores and chromophores could be
covalently synthesized onto aminoalkyl resins before or during
split-and-mix synthesis [Campian, E. et al. (1994) Drug Develop.
Res. 33, 98-101; Campian, E. et al. (1994) Colored and fluorescent
solid supports in Innovation and Perspectives in Solid Phase
Synthesis and Complementary Technologies (Epton, R., ed.), pp
469-472, Mayflower.] In 1997, Egner et al. presented a study in
which six dyes were covalently coupled to six portions of TentaGel
beads to encode the first reaction step in the synthesis of a small
peptide library (448 compounds) [Egner, B. J. et al. (1997) Chem.
Commun. 8, 735-736]. Scott and Balasubramanian [Scott, R. H. and
Balasubramanian S. (1997) Bioorg. Medic. Chem. Lett. 7, 1567-1572]
explored the fluorescence properties of a variety of commonly used
fluorophores attached to TentaGel and aminomethylpolystyrene-1%
divinylbenzene at high and low loading levels. A self quenching
effect on the fluorescence in the resin bead was examined by Yan et
al. [Yan, B. et al. (1999) J. Comb. Chem. 1, 78-81], who called for
careful selection of fluorophores and rigorous control of the
labeling reaction yield in order to generate labeled beads for
combinatorial chemistry. Nanthakumar and co-workers demonstrated
oligonucleotide synthesis on fluorescently encoded support beads
generated by covalent attachment of linkers and dye and showed the
feasibility of using flow sorting to identify and separate four
bead sets [Nanthakumar, A. et al. (2000) Bioconj. Chem. 11,
282-288]. The sequences synthesized on each bead set were
identified by performing hybridization with fluorescently labeled
complementary sequences. A common theme behind all of these
examples is the covalent manner in which attachment of the
fluorescent tags is performed. Despite the fact that fluorescent
encoding of combinatorial libraries has been well documented for
several years, the maximum library size that can be encoded is
surprisingly small.
[0007] The major disadvantages of using fluorophores as tags in
this way include fluorescence resonance energy transfer (FRET), and
the high incidence of non-specific binding (i.e., non-covalent
adsorption) of the dyes inside or on the surface of beads. The dyes
which are not covalently bound will leach out of the bead when
placed into different solvents, and thus the optical signature will
be significantly altered.
[0008] A method of keeping track of the reaction history in
chemical synthesis is the Irori method. This method involves the
use of NanoKan reactors, which are rigid containers with mesh
sidewalls and a mesh cap. Kan reactors have a 75-micron mesh. Each
Kan contains a radiofrequency tag (reusable devices that act as a
unique identifier for each Kan reactor) and the actual solid phase
resin used for synthesis. Each NanoKan is used to synthesize one
discrete compound. The NanoKan Sorting Station implements a
directed sorting approach to library generation. The NanoKan
Sorting Station reads the RF tag of each NanoKan and sorts it
according to its predetermined chemical destiny. Sorting is
performed before and between each synthesis step. One of the major
disadvantages of the Irori technology is that only one discrete
compound is synthesized in each NanoKan. This system does not
permit combinatorial chemistry to be performed efficiently, without
use of an extremely large volume of beads. Another disadvantage of
the encoding system is a radiofrequency tag that encodes large
batches of beads (8 mg of beads, 200 .mu.m in diameter) rather than
one uniquely encoded bead. This encoding means that batches of
beads are processed together, rather than on a bead by bead basis.
The mesh used in the NanoKans is also 75 .mu.m, which is too large
to permit the use of 10-20 .mu.m beads.
[0009] The technique of using multiple intensities and multiple
emission wavelengths (i.e., multiplexed encoding) to barcode
colloids (3-6 .mu.m in diameter) for small library applications has
been employed by a number of groups. By entrapping various ratios
of two fluorescent dyes or lanthanide complexes in the interior of
colloidal particles, up to 100 different colloidal suspensions have
been produced [K. G. Oliver, J. R. Kettman, R. J. Fulton, Clin.
Chem., 1998, 44, 2057; P. L. Smith, C. R. WalkerPeach, R. J.
Fulton, D. B. DuBois, Clin. Chem., 1998, 44, 2054; R. J. Fulton, R.
L. McDade, P. L. Smith, L. J. Kienker, J. R. Kettman Jr., Clin.
Chem., 1997, 43, 1749; D. A. A. Vignali, J. Immunol. Methods, 2000,
243, 243; F. Szurdoki, K. L. Michael, D. R. Walt, Anal. Biochem.,
2001, 291,219; D. R. Walt, Science, 2000, 287(5452), 451; M. Lee
and D. R. Walt, Anal. Biochem., 2000, 282, 142; F. J. Steemers, J.
A. Ferguson, D. R. Walt, Nat. Biotechnol., 2000, 18, 91]. For each
suspension, the polymeric colloids are swollen in a solvent/dye
mixture containing a certain ratio of the two dyes/complexes. Rapid
contraction of the colloids occurs upon exposure to an aqueous or
alcoholic solution, thereby entrapping the fluorescent
dyes/complexes within the colloids. Typical solvents used are
dimethylformamide or tetrahydrofuran. Decoding the colloids is
achieved by a variety of methods including flow cytometry and
optical fibre microarrays.
[0010] An alternative method of optical barcoding involves the
incorporation of zinc sulfide-capped cadmium selenide nanocrystals
into 1.2 .mu.m polymer colloids in controlled ratios [M. Han, X.
Gao, J. Z. Su and S. Nie, Nature Biotech., 2001, 19, 631]. Many
sizes of nanocrystals can be excited at a single wavelength,
resulting in several emission wavelengths (colours) that can be
detected simultaneously. Nie and colleagues reported a DNA
hybridisation experiment which involved four oligonucleotide probes
and four colloidal suspensions barcoded with nanocrystals.
Barcoding was performed by swelling polymer colloids (0.1-5.0
.mu.m) in a propanol (or butanol)/chloroform mixture and adding a
controlled ratio of three nanocrystal colours (sizes) to the
mixture. The colloids are sealed with a thin polysilane layer which
seals in the nanocrystals and improves their stability in aqueous
conditions.
[0011] Screening of Combinatorial Libraries
[0012] It is often desirable to screen large libraries of related
compounds. For example, Hudson et al. (Genome Res. 1997, 7:1169-73)
constructed a so-called "uni-gene" set of the yeast coding
sequences. This construction was acheived by synthesizing PCR
primers corresponding to the 5' and 3' ends of each open reading
frame in the yeast genome, then using the primer pairs to amplify
each coding sequence using PCR and yeast DNA as a template.
However, the synthesis of the .about.12,000 primers by conventional
techniques was laborious and expensive.
[0013] Similarly, Ren et al. (Science 2000, 290:2306-9) constructed
a set of hybridization probes corresponding to the intergenic
spaces in yeast. Again, the probes were constructed by laborious
synthesis of pairs of oligonucleotides followed by PCR
amplification of intergenic regions from the yeast genome.
[0014] Such experiments are feasible only because the yeast genome
contains 6,000 genes. To perform analogous experiments with
organisms having larger genomes, such as C. elegans, D.
melanogaster, or a mammal such as a human, many tens or hundreds of
thousands of specific oligonucleotides would need to be
synthesized, rendering existing methods impractical.
[0015] One approach to screening combinatorial libraries involves
on-bead assays in which the fluorescent labeling of beads
facilitates the identification of beads that display a positive
outcome (i.e., a `hit`). Positive beads can be detected using flow
cytometry or fluorescence microscopy. Alternatively, the compound
can be cleaved in a multi-well plate, and the fluorescence measured
in solution by, for example, fluorescence polarization, homogeneous
time resolved fluorescence, or fluorescence correlation
spectroscopy.
[0016] From the foregoing description, it is apparent that improved
methods for synthesizing and screening large sets of defined
oligonucleotides and other compounds are greatly desired. New
methods for synthesizing and screening compounds on solid
substrates are also highly desirable.
SUMMARY OF THE INVENTION
[0017] The invention features a device for sorting carriers and
methods of use thereof. The device couples the detection of a
distinguishable feature of each carrier with a procedure that
determines the direction in which each carrier is sorted, once it
is identified. Methods of the invention include the directed
synthesis of large combinatorial libraries using encoded carrier
support systems. The libraries can be separated and identified
using various detection schemes, for example, by flow cytometry.
The methods are useful, for example, for synthesis of large sets of
oligonucleotides or peptides. Beads represent an exemplary carrier
although the invention is not limited to the use of beads.
[0018] In one aspect, the invention features a method for directing
the synthesis of a combinatorial library of oligomers including the
steps of assigning, prior to coupling, a predetermined oligomer
sequence to each of a plurality of carriers each of which includes
a distinguishable feature; sorting the carriers into a plurality of
reaction vessels, wherein the vessel into which each carrier is
sorted is determined by the oligomer assigned to each carrier based
on the distinguishable feature, and wherein each carrier is sorted
independently of the other carriers; performing a reaction to
couple a chemical moiety to each carrier in each vessel, wherein
the chemical moiety is the same or different in different vessels;
and repeating the sorting and coupling steps at least once,
wherein, in each step, a subsequent chemical moiety is coupled to
the previously added chemical moiety to produce a plurality of
oligomers. In one embodiment, the carriers in each of the vessels
are pooled prior to the second, and any subsequent, sorting steps.
In alternative embodiments, a linker, e.g., one that is cleavable
or not cleavable, is coupled to each of the plurality of carriers
prior to a coupling step. The method may further include cleaving
an oligomer from a carrier, e.g., by cleaving a linker or any bond
between an oligomer and a carrier. Desirably, each carrier in the
plurality has a unique distinguishable feature. In preferred
embodiments, the plurality of carriers is sorted into at least four
vessels.
[0019] The invention further features a library of encoded carriers
that includes a plurality of carriers wherein each of the carriers
includes a unique distinguishing feature and a unique oligomer
bound to the carrier. In desirable embodiments, the library
includes at least 1,000, 10,000, 100,000, or 1,000,000 carriers,
e.g., between 1,000 and 1,000,000 carriers.
[0020] In another aspect, the invention features a device for
sorting carriers including a sorter that includes a flow path that
splits into at least two branches into which carriers can be
sorted; one or more detectors capable of detecting carriers in the
flow path, wherein the one or more detectors are disposed to detect
the carriers prior to passing into one of the branches; and a
computer that determines the branch into which each carrier is
sorted based on one or more signals from each carrier obtained from
the one or more detectors. In desirable embodiments, the flow path
splits into at least four branches. At least one of the detectors
desirably detects fluorescence, light scatter, color, luminescence,
phosphorescence, infrared radiation, x-ray scatter, light
absorbance, surface plasmon resonance, or electrical impedance.
[0021] In yet another aspect, the invention features a sort
computer including an interface that is capable of receiving data
that encodes a distinguishable feature of a carrier as it is passed
through a sorting device comprising a flow path that splits into at
least two branches; one or more memories that store the number of
carriers having each distinguishable feature; a controller that is
capable of controlling the sorting device to sort a carrier into
one of the branches; and a sorting selector that determines into
which branch a carrier is sorted based on the number of carriers
having that distinguishable feature stored in the one or more
memories. In an alternative embodiment, the sorting selector is
replaced with means responsive to the data that encodes the
distinguishable feature that determines into which branch a carrier
is sorted based on the number of carriers having that
distinguishable feature stored in the one or more memories. The
sort computer may further include the sorting device electrically
coupled to the interface. The sort computer may also include a
fluorescence compensation device that is capable of performing
real-time hardware linear fluorescence compensation on the data
that encodes the distinguishable feature of the carrier, wherein
the fluorescence compensation device accesses the raw data from the
sorting device and passes linearly compensated data to the
interface.
[0022] The invention further features a method for discontinuously
sorting carriers including the step of passing a plurality of
carriers, each of which comprises a distinguishable feature,
through a flow path that splits into at least two branches, wherein
each carrier is sorted into one of the branches independently of
the other carriers. In onve embodiment, the flow path is included
in a flow cytometer. Exemplary distinguishable features include
intensity of light scatter and fluorescence intensity. At least one
of the plurality of carriers may be coupled to an oligomer.
Desirably, carriers with widely varying distinguishable features
are directed into the same branch or carriers with similar
distinguishable features are directed into the same branch.
[0023] In another aspect, the invention features a method for
identifying an oligomer that binds to a species including the steps
of contacting a plurality of carriers, each of which comprises a
unique oligomer and a unique distinguishable feature, with a tagged
species; passing the plurality of carriers through a flow path;
detecting any tagged species associated with any of the plurality
of carriers, thereby identifying the oligomer that binds to the
species by identification of its unique distinguishable feature. In
one embodiment, the tagged species includes a first sequence of
nucleotides and each of the oligomers includes a second sequence of
oligonucleotides, wherein each of the second sequences is
identifiable by the unique distinguishable feature on each carrier,
and the distinguishing feature of the carrier to which said tagged
species is associated is indicative of the second sequence. An
exemplary second sequence includes a polymorphism, e.g., a single
nucleotide polymorphism. In other embodiments, the flow path splits
into at least a first and a second branch, and any carrier to which
the tagged species is associated is directed down the first branch,
and any carrier to which the tagged species is not associated is
directed down said second branch. The method may further include
repeating the above three steps with the plurality of carriers
formed by the carriers directed down the first branch.
[0024] In still another aspect, the invention features a method of
synthesizing a library of oligonucleotides including the steps of
providing a plurality of carriers, wherein each of the carriers
includes a unique distinguishable feature; assigning a
predetermined sequence of nucleotides to be coupled to each
carrier, wherein the distinguishable feature of each carrier is
indicative of the sequence to be coupled to each carrier; passing
the carriers through a flow path that splits into at least four
branches; detecting the distinguishable feature of each carrier as
it passes through the flow path; directing each carrier through one
of the branches into a vessel based on the first nucleotide of each
carrier, wherein the vessel represents a nitrogenous base; in each
vessel, coupling the first nucleotide comprising the nitrogenous
base to the carriers; and repeating the passing, detecting,
directing, and coupling steps, wherein in each step, the subsequent
nucleotide in each of the sequences is added to the previous
nucleotide until each assigned predetermined sequence is coupled to
each carrier. The method may further include the step of coupling a
linker to the predetermined sequence and sequentially adding a
complementary sequence of nucleotides to the linker by the method
above, wherein the complementary sequence is capable of hybridizing
to at least a portion of the predetermined sequence to form a
hairpin structure.
[0025] The invention further features a method of isolating a
subpopulation of carriers from a diverse population of carriers
including the steps of synthesizing a diverse population of
carriers, each of which includes a distinguishable feature, wherein
at least three dimensions of parameters are required to
characterize the distinguishable features of all carriers; defining
a gate around a region of parameters in at least two dimensions in
a flow cytometer; and passing the diverse population of carriers
through the flow cytometer, wherein all of the carriers with
distinguishable features within the gate are sorted into a vessel
and all of the carriers with distinguishable features not within
the gate are not sorted into the vessel. The parameters of the
distinguishable features of any carriers within the gate may be
stored in a memory.
[0026] In another aspect, the invention features a method of
identifying an oligomer that binds to a species including the steps
of providing a plurality of populations of carriers, wherein each
population includes a plurality of carriers, each of which includes
a distinguishable feature that is present in only one population;
coupling a different oligomer to the carriers in each population;
combining an aliquot of carriers from each population; contacting
the combined aliquots with a tagged species; detecting any tagged
species associated with any of carriers; and determining the number
of carriers from each population to which the tagged species binds,
wherein each of the numbers is indicative of the relative binding
ability of the tagged species to the oligomer of each
population.
[0027] In yet another aspect, the invention features a method of
making a non-combinatorial library including the steps of producing
a subpopulation of carriers by the steps of synthesizing a diverse
population of carriers, each of which includes a distinguishable
feature, wherein at least three dimensions of parameters are
required to characterize the distinguishable features of all
carriers; defining a gate around a region of parameters in at least
two dimensions in a flow cytometer; and passing the diverse
population of carriers through the flow cytometer, wherein all of
the carriers with distinguishable features within the gate are
sorted into a vessel and all of the carriers with distinguishable
features not within the gate are not sorted into the vessel; and
coupling one or more compounds to the subpopulation of
carriers.
[0028] The invention further features a method of synthesizing a
combinatorial library including the steps of producing a plurality
of subpopulations of carriers by the steps of passing a plurality
of carriers through a sorting device comprising a flow path that
splits into at least two branches; and sorting each carrier down
one of the branches into a vessel independently of the other
carriers, wherein the carriers in each subpopulation are sorted
into different vessels; wherein each of the subpopulations includes
a plurality of carriers, each of which includes a distinguishable
feature that is present in only one subpopulation; for each
subpopulation, coupling a chemical moiety to the carriers in that
population; and repeating the coupling step at least once, wherein
subsequent chemical moieties are coupled to the previously added
chemical moiety to produce a different oligomer for each
subpopulation.
[0029] In another aspect, the invention features a machine readable
data memory including a oligomer encoding database that includes a
list of sequences of chemical moieties that form an oligomer, with
each chemical moiety associated with at least one combination of
particular values of bead parameters at a given step in a
synthesis, and wherein particular values of beads are accessible by
machine to provide identification data for a synthesis and wherein
parameter values of beads indicate that a bead should be sorted in
a given direction. The sequences may be, for example, nucleotide or
peptide.
[0030] The invention also features a method of synthesizing a
library of oligomers including the steps of providing a plurality
of carriers that include distinguishable features based on a set of
independent parameters; providing machine readable data memory
including an oligomer encoding database that includes a list of
sequences of chemical moieties that form an oligomer, with each
chemical moiety associated with at least one combination of values
of said independent parameters at a given step in a synthesis;
passing the carriers through a flow path that splits into at least
two branches; detecting the distinguishable feature of each carrier
as it passes through the flow path; directing each carrier down one
of the branches into a vessel based on the chemical moiety in the
database for the carrier; for each vessel, coupling the chemical
moiety to each carrier in the vessel; and repeating the above steps
until oligomer synthesis is complete, thereby synthesizing a
library of oligomers. The method may further include pooling the
carriers in each of said vessels prior to sorting.
[0031] In yet another aspect, the invention features a population
of carriers from at least two topologically disconnected grid
spaces, wherein each of the carriers includes a distinguishable
feature that includes at least two parameters, and wherein each
grid space has an upper bound of greater than zero for each
parameter.
[0032] In various embodiments of the invention, exemplary chemical
moieties include a deoxyribonucleotide, a ribonucleotide, an amino
acid, a saccharide, a peptide nucleic acid, a carbonate, a
sulphone, a sulfoxide, a nucleoside, a carbohydrate, a urea, a
phosphonate, a lipid, or an ester. A chemical moiety may also be
protected. Each carrier may also include a reactive group. An
exemplary sorting device is a flow cytometer. Distinguishable
feature may be detectable by fluorescence, light scatter, color,
luminescence, phosphorescence, infrared radiation, x-ray scatter,
light absorbance, surface plasmon resonance, electrical impedance,
or a combination thereof. An exemplary carrier is a bead. Oligomers
may be bound to a carrier via a linker, which may be cleavable or
not cleavable.
[0033] The term "carrier" as used herein embraces a solid support
with appropriate sites for oligomeric compound synthesis and, in
some embodiments, tag attachment. The carrier may have any suitable
size or shape or composition. Desirably, carriers are heterogeneous
in size, shape, or composition. In general, the carrier size is in
the range of between about 1 nm to 1 mm, e.g., at most 750 .mu.m,
500 .mu.m, 250 .mu.m, 100 .mu.m, 75 .mu.m, 50 .mu.m, 25 .mu.m, 10
.mu.m, 5 .mu.m, 1 .mu.m, 750 nm, 500 nm, 250 nm, 100 nm, 75 nm, 50
nm, 25 nm, 10 nm, or 5 nm. The carrier may be shaped in the form of
spheres, cubes, rectangular prisms, pyramids, cones, ovoids,
sheets, cylinders, or any arbitrary shape. Beads represent
preferred carriers according to the invention.
[0034] By "bead" is meant a carrier of essentially spherical shape.
Beads may, however, be slightly irregular (e.g., oviodal) or have
rough or porous surfaces.
[0035] The term "oligomer" as used herein refers to molecules that
include a sequence of chemical moieties including any structural
unit that can be formed and/or assembled by known or conceivable
synthetic operations. Thus, the oligomers of the present invention
are formed from the chemical or enzymatic addition of separate
moieties. Such oligomers include, for example, both linear, cyclic,
and branched oligomers or polymers of nucleic acids,
polysaccharides, phospholipids, ribonucleotides, peptide nucleic
acids and peptides having, for example, either .alpha.-, .beta.-,
or .omega.-amino acids, heteropolymers in which, for example, a
known drug is covalently bound to any of the above, polyurethanes,
polyesters, polycarbonates, polyureas, polyamides,
polyethyleneimines, polyarylene sulphides, polysiloxanes,
polyimides, polyacetates, or other polymers which will be readily
apparent to one skilled in the art. The number quoted and the types
of oligomers listed are merely illustrative and are not
limiting.
[0036] As used herein "chemical moiety" and "monomer" include any
molecule that can be joined to another molecule to form a desired
compound. Chemical moieties or monomers include, without
limitation, nucleotides, amino acids, peptide nucleic acids,
carbonates, sulphones, sulfoxides, nucleosides, carbohydrates,
ureas, phosphonates, lipids, and esters. Alternatively, the
chemical moiety or monomer may include inorganic units such as for
example silicates and aluminosilicates. Accordingly, chemical
moieties or monomers useful in the present invention include, but
are not restricted to, for peptide synthesis, L-amino acids,
D-amino acids, synthetic amino acids, and peptide nucleic acids. It
will also be understood that different chemical moieties or
monomers may be used at successive steps in the synthesis of a
compound of the invention.
[0037] By "distinguishable feature" or "tag" is meant any molecule
or group of molecules having one or more detectable parameters
including, but not limited to, shape, size, color, optical density,
differential absorbance or emission of light, chemical reactivity,
magnetic or electronic encoded information, or any other
distinguishable attribute. Exemplary parameters include
fluorescence emission and light scattering.
[0038] By "parameter" is meant any property measured by a detector,
e.g., fluorescence or light scatter.
[0039] By "detector" is meant the equipment used to detect one of
the parameters described above. Often the detector is a
photomultiplier tube in the case of fluorescent or side scatter
parameters, or a photodiode in the case of the forward scatter
parameter. Each parameter may be associated with an individual
detector.
[0040] By "gate" is meant a criteria on which carriers, e.g.,
beads, are classified by a sorting device.
[0041] By "combinatorial library" is meant a library of discrete
compounds, preferably bound to a solid support phase such as a
bead, that is synthesized in parallel, e.g., using the well-known
split-and-mix process, without resorting to synthesizing each
discrete compound sequentially.
[0042] By "non-combinatorial library" is meant a library of
discrete compounds, preferably bound to a solid support phase such
as a bead, that is synthesized by directly attaching chemical
moieties, such as an oligomer or peptide.
[0043] By "encoded population" is meant a population of beads that
are encoded in some fashion such that each bead can be decoded or
distinguished from each other by an appropriate detecting
system.
[0044] By "cleavable" is meant able to be physically separated,
e.g., a cleavable linker contains a bond to a carrier or chemical
moiety that is labile under certain conditions, such as presence of
acid or base.
[0045] By "sorting device" is meant any device that can physically
separate an entity, e.g., a carrier or cell, from a larger
population based on a distinguishing feature.
[0046] By "flow path" is meant a channel through which fluids flow,
e.g., as in a flow cytometer. A flow path may split into two or
more branches.
[0047] By an "oligomer-carrier database" is meant a database
consisting of a list of sequences of oligomers, e.g.,
oligonucleotides or oligopeptides, coupled to a list of
distinguishable features of a carrier. The carriers are chosen such
that they can be sorted independently of one another. More than one
carrier with a given distinguishable feature may be present in
practice in order to produce more than one carrier with a specific
oligomer. A particular sequence element corresponds to a flow path
for a carrier at each step in a multi-step synthesis.
[0048] By "parameter value" is meant the magnitude of a parameter,
e.g., fluorescence intensity, as measured by a detector. Initially
this value is a raw analogue current from the detector, but it may
be converted into a digital value by an analog-to-digital converter
(ADC) board. The number of bits per parameter value is determined
by the resolution of the ADC board.
[0049] By "parameter range" is meant the range of values that a
parameter can have.
[0050] By "threshold detector" is meant a detector that registers a
minimum or maximum signal level. When the magnitude of a
measurement at that detector exceeds a pre-set value (i.e., the
threshold), a sorting device is triggered.
[0051] When a sorting device is "triggered" a sequence of steps
occurs that includes the recording of a value for each parameter.
This process takes a certain amount of time to occur, known as the
dead-time, during which no other event can cause a trigger.
[0052] By "event" is meant an entity whose detection causes a
sorting device to trigger. An event can be, without limitation, a
cell, bead, dust particle, air bubble, electrical noise, or any
other entity that triggers the sorting device. For ease of
discussion, the term event and carrier are often used in an
interchangeable manner herein.
[0053] By "sort region" is meant either (a) a subrange of values of
a single parameter, or (b) a rectangular, elliptical, or polygonal
region of values of two or more parameters. The sort region is
typically given a unique number for identification, e.g., region 1
or R1.
[0054] By "sort direction" is meant a particular direction of flow
into which a sorting device physically separates a given element.
In a two-way sort, there are two sort directions, e.g., left and
right. In a four-way sort, there are four sort directions, e.g.,
left, right, half-left, and half-right.
[0055] By "sort logic" is meant the sort direction in which a given
event should be sorted. This logic is usually a combination of
Boolean logic and a number of sort regions, e.g., if inside region
1 and not inside region 3, then sort left. Software associated with
a sorting device allows the user to define a sort logic.
[0056] By "lookup table" or "LUT" is meant a device or memory
capable of storing either a one- or two-parameter sort region as
described above. Based on information in the LUT, a determination
is made on whether parameter values obtained from an event are
inside or outside the sort region. The result of this test (often
only one bit is needed, 1=inside, 0=outside) are placed onto the
data bus. Many LUTs can be stored on one LUT board, and many LUT
boards can be placed on the data bus.
[0057] By "sort classifier" is meant a procedure that produces a
sort decision based on the user-defined sort logic and the data
from the LUTs, and places the result on the event bus.
[0058] By "dimension" is meant parameter, and the term carries its
usual mathematical meaning.
[0059] By "parameter space" is meant the n-dimensional matrix
defined by the number of parameters, n, and the ranges of each of
those parameters. This space represents all the combinations of
parameter values a given event could possess. Each event is
essentially an n-dimensional vector into this parameter space. For
example, when a population of white blood cells is labeled with
fluorescently labeled antibodies directed against CD4 and CD8, and
then analyzed by flow cytometry, the results may be displayed in a
two-dimensional scatter plot. Such a plot represents the
two-dimensional parameter space, and the scattered points represent
the positions of labeled cells within the parameter space.
[0060] By "division" is meant the number of divisions, d, into
which a given parameter is divided. The divisions are numbered from
0 to (d-1).
[0061] By "grid space" is meant an n-dimensional volume of
parameter space that is defined by a given division on each
parameter. It is identical in concept to how an event is described
by its combination of parameter values. Any event that has an
n-dimensional vector into a given grid space is said to belong to
that grid space. In FIG. 47A, the square is an example of a grid
space. A grid space is characterized by its rectangularity in two
dimensions or a higher-dimensional equivalent of rectangularity.
Grid spaces form the basis of the grid space procedure, in which
typically only one event per grid space is allowed. In this case,
the status of a given grid space can be represented by a single
bit, in which 1=full and 0=empty.
[0062] By "grid space memory" is meant a memory that represents the
status of each grid space. Typically, the size of the grid space
memory, in bits, is equal to the number of grid spaces. Each sort
direction requires a grid space memory, e.g., for a four-way sort,
four grid space memories are required. The sort computer of the
invention, in combination with a FACS machine, is able to identify
beads as being within a grid space and sort them into a desired
sort direction.
[0063] By a "sort computer" is meant the collection of equipment
that implements the grid space procedure in a sorting device. In
the exemplary sort computer described herein, it includes the sort
computer board, fluorescence compensation board, additional
computer, associated software, and interface cables.
[0064] By "sort computer board" is meant an electronic board that
interfaces with the data bus of a sorting device and implements the
grid space procedure. The sort computer board obtains its data from
the fluorescence compensation board if enabled, otherwise it uses
the data from digital signal processing (DSP) board of the sorting
device. It may be interfaced with an additional computer using both
serial and enhanced parallel port (EPP) connections. The EPP
connections are used to upload/download the grid space memory and
delta event log as well as any initialization settings. The serial
connection is used for debugging and monitoring of the status of
the sort computer board. The grid space and delta event log memory
devices are located on the sort computer board.
[0065] By "fluorescence compensation board" is meant an electronic
board that implements the linear fluorescence compensation
procedure described in Bagwell & Adams, Annals New York Academy
of Sciences, 677, p.167, (1993). It obtains raw parameter values
from the event bus of a sorting device, and outputs the compensated
values to a sort computer board.
[0066] Throughout this specification and the claims, unless the
context requires otherwise, the words "comprise", "comprises" and
"comprising" will be understood to imply the inclusion of a stated
integer or step or group of integers or steps but not the exclusion
of any other integer or step or group of integers or steps.
[0067] By a "grid space library" is meant a collection of objects
that can be positioned in discrete, topologically disconnected grid
spaces within a parameter space. In FIG. 58B, the objects within
the two squares, taken together, are an example of a grid space
library. A sort computer of the invention, in combination with a
sorting device, is able to identify objects within topologically
disconnected unit blocks and sort them into the same channel.
[0068] Other features and advantages of the invention will be
apparent from the following description and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0069] FIG. 1 is a plot of data from a sort computer showing
optically unique beads sorted from an optically diverse population.
The beads were pre-encoded with Oregon Green 488, Rhodamine B, and
AlexaFluor 350 dyes. Fluorescence was detected through the FL1
(.lambda.=530/40), FL2 (.lambda.=580/30) and FL4 (.lambda.=450/65)
parameters.
[0070] FIG. 2 is a diagram of a division of two-dimensional
parameter space into grid spaces. The width of each grid space can
be different for each parameter.
[0071] FIGS. 3A-E are an example of a real-time algorithm for
selecting optically unique beads. In (a), five beads have already
been collected and hence the corresponding grid space labels have
been labeled full. In (b), a new bead occupies a vacant grid space
and hence is sorted in (c). In (d), another new bead occupies a
full grid space and hence is rejected from the system in (e).
[0072] FIG. 4 is a schematic diagram of a method of selecting
optically unique beads. Only beads that occupy the internal sort
region are collected. No beads are collected from the buffer
region.
[0073] FIG. 5 is a schematic diagram of a random combinatorial
synthesis, where each bead is tracked by a sorting device/sort
computer after the coupling reaction.
[0074] FIG. 6 is a schematic diagram of a directed synthesis, where
the optical signature of each bead is recorded by the sort computer
before the coupling reaction, and/or each bead is directed into a
vessel according to a predetermined reaction sequence.
[0075] FIG. 7 is a conceptual diagram of how a bead is detected and
measured by a flow cytometer.
[0076] FIG. 8 is a schematic diagram of a sort computer.
[0077] FIG. 9 is a picture of the main screen of Cytowin.
[0078] FIG. 10 is a picture of the file menu of Cytowin.
[0079] FIG. 11 is a picture of the configure menu of Cytowin.
[0080] FIG. 12 is a picture of the configure menu--lookup table
settings of Cytowin.
[0081] FIG. 13 is a picture of the configure menu--compensation
settings of Cytowin.
[0082] FIG. 14 is a schematic diagram of the interactions between a
sort computer board, a fluorescence compensation board, and an
event bus during an event.
[0083] FIGS. 15-28 are schematic circuit diagrams for a sort
computer board. The manufacturers of the chips are given in FIG.
15.
[0084] FIGS. 29-40 are schematic circuit diagrams for a
fluorescence compensation board. The manufacturers of the chip are
given in FIG. 29.
[0085] FIG. 41 is a schematic diagram of how sort computer board
implements gridspace algorithm.
[0086] FIG. 42 is a flow chart of delta event logging.
[0087] FIG. 43A is a graph of an optodiverse population of
QFITC-coated 4 .mu.m blue-green beads on two parameters (FL1 and
FL3) before pre-encoding. (
[0088] FIG. 43B is a graph of fifty-six optically unique beads
extracted from the population in FIG. 43A (rl=rh=30).
[0089] FIG. 44 is a schematic diagram of recording the reaction
history of a population of beads through a combinatorial
synthesis.
[0090] FIG. 45 is a schematic diagram of directed synthesis using a
sort computer.
[0091] FIG. 46 is a graph of the number of unique beads obtained as
a function of population size for random data. The total number of
available grid spaces is 10,000.
[0092] FIG. 47A is a schematic example of a unit block. A unit
block is a particular type of a "sort region" further characterized
by its rectangularity in two dimensions or a higher-dimensional
equivalent of rectangularity.
[0093] FIG. 47B is a schematic diagram of objects within the two
squares, taken together, forming a unit block library. A sort
computer of the invention, in combination with a sorting device, is
able to identify objects within topologically disconnected unit
blocks and sort them into the same channel.
[0094] FIG. 48 is a schematic diagram of grid space memories
employed for directed synthesis. To perform directed synthesis,
upload predetermined grid space memories to a sort computer board
(one grid space memory per sort direction). Wherever there is a 0,
the bead corresponding to that grid space will be sorted in that
sort direction.
[0095] FIG. 49 is a flow chart of sorting an event.
[0096] FIG. 50 is a schematic diagram of assaying a library with
the `hits` detected by a sorting device such as a flow
cytometer.
[0097] FIG. 51 is an example of a hairpin structure. Each bead has
a linker group on which an oligonucleotide sequence is synthesized,
followed by a spacer group, followed by the complementary sequence,
thereby forming a hairpin duplex.
[0098] FIG. 52 is a three-dimensional plot of intensity parameters
from three detectors (FL1, FL6, and FL9) in a flow cytomer, which
demonstrates the optical diversity in a combinatorially synthesized
set of beads using FITC, BODIPY 630, and AlexaFluor 350. Parameters
were FL1 (.lambda.=530/20), FL6 (.lambda.=670/20), and FL9
(.lambda.=450/15).
[0099] FIG. 53 is a graph of a gating experiment. An optically
diverse population of beads is sorted in a flow cytometer, and only
those beads which appear in the 16 gates (illustrated by the 16
white boxes) are collected. The rest of the beads run to waste.
[0100] FIGS. 54A-B are graphs of the number of hybridizations of a
tagged sequence to (A) a mismatched sequence and (B) a
complementary sequence. DNA hybridization of complementary
(5'TACAGGCCTCACGTTACCTG) and mismatched (5'CAGGTAACGTGAGGCCTGTT)
sequences was performed by hybridizing the beads with fluorescently
labeled target sequences (5'CAGGTAACGTGAGGCCTGTT). These data show
that the complementary sequence (average fluorescent intensity of
287 A.U.) can be discriminated from the non-complementary
mismatched sequence (average fluorescent intensity of 16 A.U.)
using a flow cytometer.
[0101] FIG. 55 is a graph of an optically diverse set of beads
before they are sorted in a flow cytometer. The beads contained
Oregon Green 488 and Rhodamine B dyes, which emit at 530 nm and 580
nm respectively.
[0102] FIG. 56 is a graph of the distinct populations of the beads
from FIG. 55 after they have been sorted by the flow cytometer and
passed through the flow cytometer for a second time.
[0103] FIG. 57 is a graph of the same set of particles as in FIG.
56, passed through the flow cytometer for a third time.
[0104] FIGS. 58A-D are schematic diagrams of grid spaces that
define subsets of beads that are scattered within a two-dimensional
parameter space. Locations of beads in the parameter space are
represented by small black dots. FIG. 58A shows a single grid space
(small square) that can be defined by conventional flow cytometers.
FIG. 58B shows two grid spaces, one square and one circular, that
can be defined by a sort computer of the invention. A sort computer
coupled to a sorting device is capable of simultaneously sorting
beads within both the circle and the square into a single channel.
FIG. 58C shows three grid spaces defined within the parameter
space, enclosing a subset of beads that may be sorted into a
channel by a flow cytometer with an attached sort computer. FIG.
58D shows the population of beads sorted from FIG. 58C. These beads
lie within discrete grid spaces in the parameter space, and this
population of beads is essentially depleted of beads lying outside
the grid spaces.
DETAILED DESCRIPTION OF THE INVENTION
[0105] The invention is based on the use of a sort computer that
interfaces with a device for sorting carriers, e.g., a flow
cytometer. The sort computer receives data from the detection of
individual carriers. Based on user defined sorting logic (i.e.,
which carriers are to be sorted in which directions), the sort
computer directs the sorter to send a particular carrier down a
specified path. This ability is useful in many applications
including the separation of a subpopulation of diverse carriers
from a larger population, the separation of unique carriers from a
large population (FIG. 1), and the directed synthesis of oligomers
on carriers. Other methods employing the sort computer are
described herein. The following discussion focuses on the use of
beads as exemplary carriers, but the discussion is also applicable
to any type of carrier.
[0106] Sort Computer
[0107] A sort computer includes an interface that can write data to
and retrieve data from a sorting device, e.g., a flow cytometer.
The sort computer implements a grid space procedure, for example,
as described in WO 00/32542 for flow cytometry, that uses
user-defined sorting logic (i.e., which beads are directed into
which paths) to control the direction that a particular bead is
sorted. See Shapiro, H, Practical Flow Cytometry, 3.sup.rd Ed.,
Wiley and Sons, 1995 for a discussion of flow cytometry, as
exemplary sorting device for use in the invention.
[0108] Grid Space
[0109] To identify a given bead positively in a population by
measurement of its detectable properties requires that the given
bead has a set of properties that is unique from every other bead
in the population. For two beads to be different, they need only
differ in one of their properties. That is, all of their respective
properties could be identical except for one distinguishable
difference.
[0110] When a sorting device, e.g., a flow cytometer, measures each
property or parameter, the electrical current output from the
corresponding detector, e.g., photomultiplier tube, is converted to
a relative value or channel number, which is an integer value
between 0 and 1023 for an instrument operating in linear mode at a
resolution of 1024 channels. Therefore, using only one optical
property, e.g., light scattering intensity at 90.degree., the
maximum possible number of unique beads would be 1024.
[0111] If an additional property is measured, each of the original
1024 unique values could be paired with any of the 1024 new values,
leading to 1024.sup.2 possible combinations. For a total of k
measurable parameters, the maximum number of unique combinations
would hence be 1024.sup.k.
[0112] Using set theory (Hrbacek and Jech 1984, "Introduction to
set theory" 2nd Ed, New York, M. Dekker), this can be expressed
as:
Set of values possible for the ith
property=R.sub.1={x.epsilon.Z+.vertline- .0.ltoreq.x<max}
(1.1)
[0113] where Z+ is the set of all positive integers including zero.
The value of max is equal to the resolution of the instrument,
which throughout this discussion is assumed to be 1024.
[0114] If the instrument can measure k independent properties, then
each bead in the population can be represented by:
Ordered set of k properties for a given bead=S.sub.1=<r.sub.1,
r.sub.2, r.sub.3, . . . r.sub.k> (1.2)
[0115] where r.sub.1.epsilon.R.sub.1, r.sub.2.epsilon.R.sub.2,
r.sub.3.epsilon.R.sub.3, etc.
[0116] For an unordered collection of beads:
Population of n beads=P={S.sub.1, S.sub.2, S.sub.3, . . . ,
S.sub.n} (1.3)
[0117] where S.sub.1=S.sub.j means that the two beads, S.sub.i and
S.sub.j, are indistinguishable from the k properties measured. The
number of unique beads in the population, P is thus:
.vertline.U.vertline. where UP and
(.A-inverted.S.sub.i,S.sub.j.epsilon.U) S.sub.i.noteq.S.sub.j
(1.4)
[0118] Diversity
[0119] To maximize the number of unique beads in the system, a
diverse population needs to be synthesized.
[0120] Diversity is a recursive term that is based on the
measurement of several independent parameters. A population of
beads is deemed diverse over k parameters if a sub-population of
beads with identical values for one of the parameters is
indistinguishable from the total population when both populations
are measured using only the remaining (i.e., k-1) parameters.
[0121] A diverse population of beads would thus be expressed
by:
DP and DR.sub.1xR.sub.2xR.sub.3 . . . xR.sub.k (1.5)
[0122] where R.sub.1xR.sub.2xR.sub.3 . . . xR.sub.k is the
parameter space for the k parameters. P is a subset of D because
not every population is necessarily diverse. The parameter space is
also a subset of D to allow for the possibility of
indistinguishable beads within an overall diverse population.
[0123] Pre-Screening of Diverse Beads
[0124] The above carries two crucial assumptions: a given bead does
not vary in any of its intrinsic properties, and there is no
variation in the detection of each bead. A large body of work
(Shapiro, H. M., 1995, Practical Flow Cytometry, 3.sup.rd ed,
Brisbane, Wiley-Liss; Melamed M R, Lindmo, T, Mendelsohn, M L,
1990, Flow cytometry and sorting, 2.sup.nd ed, New York,
Wiley-Liss; Kettman J R, Davies, T, Chandler, D, Oliver, K G,
Fulton, R J, 1998 Cytometry, 33: 234-243) suggests that both of
these assumptions are invalid due to factors such as the effects of
photodegradation, solvent polarity, and pH on fluorophores, not to
mention the inherent error in any detection system.
[0125] This problem may be overcome by describing each property of
a given bead as a range of values instead of just a single value.
The range of values represents the possible variation in repeated
measurements of the same bead by the detector employed.
[0126] The maximum number of unique beads using only one property
then becomes equal to the resolution of the instrument divided by
the range, with the range expressed in channel numbers.
[0127] For k measurable properties, the maximum number of unique
beads would thus equal: 1 U = 1024 k i = 1 k ( v i ) ( 1.6 )
[0128] where v.sub.i is the range of the ith optical parameter.
[0129] A procedure employed by the sort computer of the invention
divides the parameter space into smaller pre-defined grid spaces
(see FIG. 2). Initially all the grid spaces are labeled empty
(represented by a zero). As beads from a sample population pass
through the sorting device, e.g., in single file, the combination
of properties belonging to each bead will correspond to a
particular grid space. Two possible outcomes can then occur: the
grid space is labeled as empty, the bead is sorted and the grid
space label is changed to present (e.g., represented by a one); and
if the grid space is already labeled as present, the bead may be
rejected or sorted as a second copy of a particular type of bead.
In desirable embodiments, only one copy of each type of bead is
retained in a population of beads.
[0130] An example of this process is given in FIG. 3. As there is a
one-to-one relationship between the beads and the grid spaces, each
bead can be represented by the grid space it occupies.
[0131] A further refinement of each grid space is preferably
required to avoid the case of a bead with a range that overlaps
multiple grid spaces. An internal sort region is thus established
within each grid space, surrounded by a buffer region defined by
the lower, rl, and higher, rh, ranges required for each parameter
(see FIG. 4). Beads may now only be collected if they fall into the
internal sort region of each grid space. In this manner, a
population of unique beads can be extracted from a raw
population.
[0132] Tracking Beads Through Combinatorial Synthesis
[0133] Having generated a population of unique beads from a raw
population using the real-time procedure, the population is now
pre-encoded for use in a combinatorial split-and-mix synthesis.
[0134] Every time the population is split into m batches, each one
of the batches is analyzed using a sorting device to determine
which of the unique beads are in each batch. A database of all the
beads (or corresponding grid spaces) can thus be updated to show
the synthetic history of the compound synthesized on each bead. The
internal sort region, as described above, is no longer required.
Each bead should now remain within the confines of its allotted
grid space. Hence, all the beads in a given batch can be
identified. In fact, the entire synthetic history of every bead
could be determined at a later stage by compiling all the recorded
data from every batch in every cycle of the complete combinatorial
synthesis.
[0135] Description of Sort Computer
[0136] Described below is an exemplary sort computer that was
developed to interface with a flow cytometer to illustrate the
general principles of the sort computer. Based on this description,
one skilled in the art could adapt the sort computer to the
electronics, detectors, and data structures of any other type of
sorting device.
[0137] The following description is for a stream-in-air flow
cytometer with 8 parameters, 12-bit resolution, and a four-way sort
capability. To understand how the sort computer works, it is useful
to first understand how a bead is detected, and its properties
measured, by a flow cytometer. The use of a flow cytometer or other
fluorescence detection device for tracking encoded,
solvent-resistant solid support beads through a combinatorial
split-and-mix synthesis based on their "optical signatures" is
described in WO 00/32542 (see FIGS. 5 and 6).
[0138] For a bead to be detected by a flow cytometer it must first
cause the intensity on a detector, such as a photodiode or
photomultiplier tube, to exceed a user-defined threshold value.
Once this condition is met, a sequence of well-defined electronic
steps, known as an event packet, occurs (FIG. 7):
[0139] 1. Each detector will generate an electrical current
dependent upon the intensity of the signal from a bead.
[0140] 2. These raw current signals are passed to the corresponding
analog-to-digital converter board for each detector, which performs
analog-to-digital (ADC) conversion of the raw signals and places
the converted parameter values onto the event bus. The parameter
values are expressed as channel numbers in a discrete range from
0-(2.sup.n-1), where n equals the resolution or number of bits per
parameter value.
[0141] 3. If necessary, digital signal processing (DSP) may also be
performed on the parameter values, such as fluorescence
compensation or calculating the ratio of two values. The processed
parameter values are then placed onto the event bus.
[0142] 4. Each lookup table (LUT) board obtains the appropriate
values from the event bus and places a result onto the event bus
that indicates if those values satisfy user-defined sort regions or
not.
[0143] 5. The sort classifier board then obtains all the results
from the LUT boards and places a sort decision result onto the
event bus based on the user-defined sort logic. The sort decision
describes whether the droplet containing the bead is to be sorted
left, right, half-left, half-right or not sorted at all.
[0144] 6. The sort unit obtains the sort decision result from the
sort classifier board and arranges for the bead to be sorted in a
particular direction.
[0145] An exemplary sort computer of the invention includes three
main components: (FIG. 8) an electronic board (known as a sort
computer board that can interface with the flow cytometer via its
event bus; an electronic board (known as a fluorescence
compensation board) that can also interface with the sorting
device; and a master computer that is interfaced with the sort
computer board.
[0146] Both the sort computer board and the fluorescence
compensation board may be powered on or off independently of the
sorting device. Through the interface to the cytometer, the sort
computer board can read and write data onto the event bus of the
cytometer. The sort computer board also contains grid space memory
devices, the delta event log memory device, and a
microprocessor.
[0147] The fluorescence compensation board can read data but does
not write data to the event bus. The fluorescence compensation
board is also interfaced to the sort computer board. It cannot
operate independently of the sort computer board and may be enabled
or disabled by the user. When the fluorescence compensation board
is enabled, the sort computer board obtains the parameter values
from the fluorescence compensation board. When the fluorescence
compensation board is disabled, the sort computer instead uses the
parameter values placed by the flow cytometer's DSP board onto the
event bus.
[0148] The master computer is connected via both a serial and an
enhanced parallel port (EPP) connection to the sort computer board.
Other types of ports, e.g., universal serial bus and firewire, may
be used to communicate with a given sorting device. The
fluorescence compensation board can be accessed by the master
computer through the sort computer board. The EPP connection is
used to upload or download data to the memory devices and
microprocessor. The serial connection is used to monitor the status
of the sort computer board, and for debugging purposes. Customized
software is installed on the master computer for use of the sort
computer's functions.
[0149] Software
[0150] For a description of exemplary software (referred to as
Cytowin 1.0) installed on the master computer that is used to
control the operation of the sort computer, see FIGS. 9-13.
[0151] The software has five main features:
[0152] (1) allows the user to alter settings such as the number of
parameters (detectors) used and the compensation matrix values,
etc.
[0153] (2) uploads/downloads data from the sort computer board and
fluorescence compensation board, e.g., via serial and enhanced
parallel port connections.
[0154] (3) allows the user to monitor the status of the sort
computer while in operation.
[0155] (4) allows the user to debug the sort computer board and
fluorescence compensation board.
[0156] (5) allows the user to load or save projects.
[0157] In this exemplary software, for a given project for the sort
computer, three types of files are generated:
[0158] a. An initialization file containing the software settings
used, e.g., the compensation matrix and which parameters were used.
These values are obtained from the software itself and stored as a
text file;
[0159] b. A separate file for each grid space memory. Each grid
space memory is downloaded from the sort computer board and stored
as a binary file; and
[0160] c. A file containing the delta event log memory. The delta
event log memory is downloaded from the sort computer board and
stored as a binary file.
[0161] Referring to FIG. 9, (1) starts the sort computer, i.e.,
events are sorted using the grid space procedure; (2) stops the
sort computer; (3) displays the count of how many events have been
sorted by the sort computer; (4) displays the count as a percentage
of the total number of available grid spaces; and (5) is message
window used for status information and debugging.
[0162] Referring to FIG. 10, the commands in the file menu are
defined as follows:
1 New Project: Clears each grid space memory and the delta event
log memory on the sort computer board. Load Project: Loads a
previous project. Each grid space binary file is uploaded to its
corresponding grid space memory device. The delta event file is
also uploaded to the delta event log memory device. Software
settings are updated to those settings in the initialization file.
Note: this allows directed synthesis to be achieved by uploading
pre- determined grid space memories for each sort direction. Save
Project: Saves the current project. The grid space memories and the
delta event log memory are downloaded and stored as binary files.
Current software settings are saved in the initialization file.
Save Project As: As above, but can specify where to save the
project files. Close Project: Similar to New Project. The current
project needs to be closed before a new or previous project can be
loaded. This prevents accidental loss of data. Save Log: Saves the
text displayed in the message window as a text file. Clear Log:
Clears the text displayed in the message window. Exit: Closes
software program. Prompts to save unsaved project. Referring to
Figure 11, the commands in the configure menu are defined as
follows: Lookup Table: Opens a new window containing settings used
in the grid space procedure, e.g., which parameters are used, how
wide is the internal sort region, etc. (see FIG. 12). Compensation:
Opens a new window containing the compensation matrix and settings
(see FIG. 13). Hardware: Opens a new window which allows user to
select which parallel port is used to communicate with sort
computer board. Status: Retrieves current status information from
sort computer board via the serial port connection. Status
information is displayed in the message window.
[0163] Referring to FIG. 12, the following features are present in
the Lookup Table settings window.
[0164] (1) Window comparison: the settings used in the window
comparator. The lower and higher boundaries of the internal sort
region can be set, using either decimal or hexadecimal notation.
The internal sort region is also displayed graphically in the
adjacent box.
[0165] (2) Lookup table result: the settings that determine where
in the event packet (see FIG. 14) the sort decision made by the
sort computer is placed onto the event bus.
[0166] (3) Channel enable: the settings that determine how many
parameters are to be used. In the diagram, there are four
parameters selected (channels 1 to 4).
[0167] (4) Allows software settings to be saved as defaults.
Referring to FIG. 13, the features of the compensation settings
window are as follows:
[0168] (1) Bus Address: the settings used to match a given channel
with a given parameter on the event bus.
[0169] (2) Crossover matrix percentages: the settings used to
compensate each channel with every other channel. Percentages are
entered either directly into each textbox or by using a slider bar.
The inverse matrix is calculated by the software, and the inverse
matrix is uploaded to the fluorescence compensation matrix memory
devices on the fluorescence compensation board via the parallel
port connection to the sort computer board, which is also
interfaced to the fluorescence compensation board. Alternatively,
the crossover matrix can be reset by the Set Unit Matrix
button.
[0170] (3) Compensation: this checkbox enables or disables the
compensation board.
[0171] (4) Data bias: the settings used to set the
auto-fluorescence correction described in Bagwell and Adams
supra.
[0172] By inputting the appropriate parameters in the above
referenced software, the exemplary sort computer of the invention
can be used to sort beads based on a user-defined sort logic.
Variations to this software may be employed in order to interface
with a particular sorting device. Based on the present description,
one skilled in the art could program software with the
above-described functions. Alternatively, the functions of the sort
computer may be programmed into hardware.
[0173] The circuit diagrams for both the sort computer board and
the fluorescence compensation board are located in FIGS. 15-28 and
29-40, respectively.
[0174] Description of the Sort Computer Board:
[0175] The sort computer board replaces the role of the LUT board
in the above description. If the fluorescence compensation board is
enabled, the parameter values are obtained from the fluorescence
compensation board ((a) in FIG. 14). If it is disabled, the
parameter values are obtained from the data placed on the event bus
by the DSP board ((b) in FIG. 14). Regardless of which input source
is used, the result is placed back onto the event bus when the LUT
boards would normally be expected to place data during the event
packet (i.e., LUT A or B) (FIG. 14).
[0176] For each event that is detected, its parameter values are
checked by the sort computer to see if the event should be sorted
or not (FIG. 41). The three most significant bits of the first
seven 12-bit parameter values are concatenated together to form a
21-bit memory address. This memory address is used to retrieve the
corresponding byte from the grid space memory device. The three
most significant bits from the eighth parameter is used to access a
single bit in the byte. This bit represents the status of the grid
space to which the event belongs. In addition, the nine least
significant bits of each parameter value are passed through a
window comparator to see if the parameter value is within the
user-defined internal region as described above. The window
comparator determines whether the parameter value is higher than
the lower boundary, and lower than the higher boundary.
[0177] In desirable embodiments, if the bit representing the grid
space indicates that the grid space is empty (i.e., bit=0) and
every parameter value is within the internal region, then a sort
result is placed onto the event bus. If the bit representing the
grid space indicates that it is full (i.e., bit=1), or any
parameter value is not within the internal region, then a "don't
sort" result is placed onto the event bus.
[0178] The processing of an individual event by the sort computer
occurs within the time taken for the event packet to be processed,
and is independent of the size of the population of beads.
[0179] In other desirable embodiments, more than one bit could be
used to represent each grid space. The number of bits used places
an upper limit on the number of carriers that could be collected
from each grid space. In this case, the most significant three bits
from all eight parameters would be used to access the address in
the grid space memory. A given event will now be sorted if the
value at an address representing a grid space is less than the
upper limit and every parameter value is within the internal
region. A sort result would then be placed onto the event bus, and
the value of in the grid space memory (number of events) is
incremented by one.
[0180] Description of Fluorescence Compensation Board
[0181] If enabled, the fluorescence compensation board accesses the
raw parameter values placed by the ADC boards onto the event bus. A
user-defined compensation matrix located in the customized software
on the master computer is matrix-inverted and uploaded to the
fluorescence compensation board. The raw parameter values are then
compensated using the method for compensation of n parameters
described in Bagwell & Adams, Annals New York Academy of
Sciences, 677, p.167, (1993). The compensated values are passed to
the sort computer board via the interface between the sort computer
board and the fluorescence compensation board. The fluorescence
compensation board of the sort computer can perform real-time
hardware linear fluorescence compensation between all parameters
used in the grid space procedure.
[0182] Hardware linear fluorescence compensation may be required
for two reasons: (a) fluorescent dyes are known to have broad
emission spectrums, and thus spectral overlap into other detectors
can often occur, and (b) the use of linear data simplifies the grid
space procedure. The fluorescence compensation board may need to be
enabled if a given sorting device is unable to perform hardware
linear fluorescence compensation itself.
[0183] Description of Delta Event Log
[0184] The delta event log records the number of events detected
since the last sorted event, known as the delta event number.
Initially, the delta event number is equal to zero. Every time an
event is detected, the delta event number is incremented by one.
When an event is sorted, the current delta event number is stored
in the delta event log memory device. The delta event number is
then reset to zero. This memory can later be downloaded to the
master computer. This information is useful for determining the
optical diversity of a given population of beads (FIG. 42).
[0185] Computer Memory Requirements
[0186] To determine memory requirements, an exemplary library
calculation is performed as follows. If there are 10 divisions on
11 parameters, this can encode a 10.sup.11 member library. For each
bead in the library, there are 11 parameter values measured by the
flow cytometer. In a MoFlo, each parameter value is represented by
a 12-bit number. In decimal terms, that means it can represent any
whole number from 0 to 4095. So, to hold 11 parameter values of
12-bits each for 10.sup.11 beads would require 1.32.times.10.sup.13
bits of storage space. As there are 8 bits per byte, this equals
1.65.times.10.sup.12 bytes, or 1.65.times.10.sup.12/(1024)3=1- 500
gigabytes.
[0187] However, the sort computer does not need to store all
12-bits of each parameter value. In fact, each unique bead can be
completely represented by a single bit, either a 0 or a 1,
indicating if it is there or not, that corresponds to one element
of a 10.times.11 matrix. This matrix represents a 10.times.11
dimensional grid space that covers all of the measurements made
during the experiment. Storing the information in this way is what
allows the sort computer to make sort decisions for large libraries
"on-the-fly," as each bead is processed independently from the rest
by checking the one-bit value of the grid space to see if a bead
has already been sorted for that grid space or not. Hence, it only
needs 10.sup.11 bits, or 1.25.times.10.sup.10 bytes, which equals
11.6 gigabytes. If these values are stored in a contiguous block of
memory on the sort computer, they are already sorted in order, and
are easily downloaded or uploaded.
[0188] If more than one bead of a particular grid space is desired,
the memory requirements will be increased accordingly. In the above
example, if 11.6 gigabytes are required when one bit is used per
grid space, then (11.6.times.n) gigabytes would be used when a
value of n bits is used per grid space.
[0189] Any suitable memory may be used for storage of any
electronic information, e.g., data and software. Exemplary forms of
memory include diskette-bases, semiconductor, RAM, and ROM (e.g.,
CD-ROM and DVD-ROM).
[0190] Oligomer-Bead Database
[0191] In practice, a oligomer-bead database is used in
synthesizing a diverse set of oligomers onto beads and is set up
before the synthesis begins.
[0192] Two conceptual examples of an oligomer-bead database are
shown below in Tables 1 and 2. The first database in Table 1 shows
the sequences of sixteen different oligonucleotides associated with
two different bead parameters that take four different values. In
this example, for each step in the synthesis, the two parameters
that make up the distinguishable feature of a bead are measured and
compared to the database.
2TABLE 1 Example of an Oligonucleotide-bead Database Pos. Pos. Pos.
Pos. Pos. Pos. Pos. Pos. Pos. First Second 1 2 3 4 5 6 7 8 9
parameter parameter G G A C C A C T T 1 1 A G A C C T T A G 2 1 C C
T C T A A G G 3 1 C T G A C C A G A 4 1 T A C T T C T G A 1 2 A G T
A A T A C T 2 2 A C T C A G A A C 3 2 A T A A G G A G A 4 2 T A G A
G C T G T 1 3 G A G T G T G T C 2 3 C T G T T A C T C 3 3 T A C A G
G T A G 4 3 C T C T C A A G A 1 4 T G T A C T A G T 2 4 A C T C T A
T G T 3 4 G T A A G A A C A 4 4
[0193] In the second example shown in Table 2, the database
consists of twelve oligopeptide sequences and three parameters. The
first parameter has three possible values, while the second and
third parameter have two possible values. In practice, since most
flow cytometers do not have 20 channels that would correspond to
the 20 amino acids, it is necessary to perform multiple sorting for
each synthesis step.
3TABLE 2 Example of an Oligopeptide-bead Database Pos. Pos. Pos.
Pos. Pos. Pos. Pos. Pos. Pos. First Second Third 1 2 3 4 5 6 7 8 9
parameter parameter parameter Gly Pro Ala Cys Tyr Ala Trp Tyr Thr 1
1 1 Pro Phe Gly His His Cys Gln Asn Arg 2 1 1 Gln Gly Val Arg Arg
Lys Arg Ser Trp 3 1 1 Ser Gly Phe Met Ile Val Leu Gly Asp 1 2 1 Tyr
Ala Cys Gly His His Val Arg Arg 2 2 1 Ala Trp His Val Arg Arg Phe
Met Ile 3 2 1 Ser Trp Arg Phe Met Ile Cys Gly His 1 1 2 Gly Asp Met
His Cys Gln His Val Arg 2 1 2 Arg Arg Gln Arg Lys Arg Arg Phe Met 3
1 2 Met Ile Ser Gly Val Arg Arg Asn Phe 1 2 2 Gly His Gln Glu Phe
Met Ile Asp Gly 2 2 2 Met Arg Glu Arg Gln Arg Lys Arg Arg 3 2 2
[0194] A feature of a oligomer-bead database is that the elements
of the oligomer are ordered. This order corresponds to an order of
addition of elements to the oligomer. During a particular round of
synthesis, information in the oligomer-bead database is used to
generate a Lookup Table. For example, the first oligomer-bead
database is organized to direct synthesis of oligonucleotides from
left to right. Since solid phase chemical synthesis of
oligonucleotides proceeds 3' to 5', the order of bases is opposite
the conventional order for nucleic acids. During the first round of
synthesis, beads are sorted into G, A, T, and C channels according
to the following Lookup Table, which derives from the first column
of the oligonucleotide database above.
4TABLE 3 Example of a Lookup Table Sort First Second direction
parameter parameter G 1 1 A 2 1 C 3 1 C 4 1 T 1 2 A 2 2 A 3 2 A 4 2
T 1 3 G 2 3 C 3 3 T 4 3 C 1 4 T 2 4 A 3 4 G 4 4
[0195] The use of a very large oligomer-bead database is described
in Example 2 below.
[0196] One feature of an oligomer-bead database is that a
particular oligomer sequence may be associated with more than one
set of bead parameters. However, a particular set of bead
parameters may not be associated with more than one oligomer
sequence.
[0197] Methods of Use
[0198] The Sort-Computer is a device that interfaces with a sorting
device, for example a flow cytometer. The user inputs into the
memory of the computer a sort logic. The sort logic may be a list
of compounds to be synthesized, or, correspondingly, a list of
reaction sequences that are desired. Alternatively, the sort logic
may be specific optical properties of the beads themselves. Based
on this user-defined sort logic, the sort computer may be employed
in several ways as described below.
[0199] There are three exemplary uses for a sort computer in the
field of combinatorial chemistry and related fields:
[0200] (a) a pre-encoded population of microspheres can be
synthesised from an otherwise non-encoded population of
microspheres (FIG. 43);
[0201] (b) the reaction history of a pre-encoded population of
microspheres through a combinatorial synthesis scheme can be
recorded (FIG. 44); and
[0202] (c) a directed synthesis of a pre-encoded population of
microspheres can be performed (FIG. 45).
[0203] Another novel feature of the sort computer is that it
enables the directed synthesis of large combinatorial libraries by
high-throughput flow cytometry.
[0204] Bead Manipulations
[0205] Formation of a Subpopulation of Beads. The sort computer may
be used to isolate a subpopulation of beads from a larger
population. Any arbitrary subpopulation of beads may be isolated
from a larger population based on the user-defined sort logic. For
example, a set of unique beads may be isolated from a larger
population that contains many copies of the same bead.
Alternatively, a subpopulation of beads with very similar
properties, e.g., that vary only in the intensity of one parameter,
may be isolated. In addition, a subpopulation of beads having very
diverse properties, e.g., each bead is coated with a different
fluorophore, may be obtained.
[0206] The method is simply based on deciding on a sort logic and
encoding this logic in the appropriate grid space memories. Each
sort direction has an associated grid space memory. For example,
for every bead that is not desired a 1 is placed in its grid space
memory, and for every bead that is desired a 0 is placed in its
grid space memory. When a bead is detected by a sorting device, if
its corresponding grid space memory has a 1, then the bead is
discarded. If a desired bead is detected by the sorting device, it
is sorted into a collection vessel, and its grid space memory is
changed from 0 to 1.
[0207] Statistical Analysis of Beads. By recording the number of
detected events that occur between every sorted (i.e., unique)
event, the sort computer allows for the examination of the
diversity of a population of beads, which may be compared to
theory. In the exemplary sort computer described above, memory for
this function (delta event log) is incorporated in the sort
computer board. For example, when encoding a given population of
beads, not every bead detected is necessarily unique. Initially,
there is a high probability that a given bead will be considered
unique, but that probability decreases as the number of sorted
beads increases. Hence, when the number of sorted events is plotted
against the number of detected events an asymptotic relationship
exists, with the asymptote equaling the total number of grid spaces
available (FIG. 46). Note that this only applies to the encoding
step of the invention. Once the population of beads is encoded, all
beads are considered unique, and the relationship would be linear
with a slope equal to 1.
[0208] Encoding a population of beads in real-time. Using a grid
space procedure as described above, the sort computer can sort an
otherwise non-encoded population of beads into an encoded
population of beads "on-the-fly". Each detected bead has a set of n
parameter values that can be considered a vector into n-dimensional
parameter space. If the parameter space is subdivided into smaller
non-overlapping n-dimensional regions (FIG. 47), known as grid
spaces, then the non-origin point of a given vector will exist in
one, and only one, grid space. The bead corresponding to that
vector is said to belong to that grid space. It is possible that
more than one bead in a given population will belong to the same
grid space. The status of each grid space can be stored in the grid
space memory using a single bit per grid space: a logical value of
1 indicates that at least one bead in a given population belongs to
the grid space, a logical value of 0 indicates that no beads in a
given population belong to the grid space. Hence, a given bead can
be represented by the grid space to which it belongs, which in turn
can be represented by a specific bit in the grid space memory.
[0209] To encode a population of beads, every bit in the grid space
memory is initialized to 0 (FIG. 3). As each bead is detected, the
bit representing the grid space to which the bead belongs is
accessed. If the bit equals zero, then the bead is considered
unique and is sorted by the flow cytometer. The bit is then made
equal to 1. If the bit was already 1, then a bead has already been
sorted with similar optical properties, and hence the duplicate
bead is discarded by the flow cytometer. This sort decision occurs
in real-time. By only sorting one bead per grid space, the sorted
population is thus encoded. Any further flow cytometric analyses
can decode a given bead by determining to which grid space it
belongs.
[0210] Perform hardware linearfluorescence compensation in
real-time. Hardware linear fluorescence compensation may be
required for two reasons: (a) fluorescent dyes are known to have
broad emission spectrums, and thus spectral overlap into other
detectors can often occur, and (b) the grid space procedure uses
linear data. The fluorescence compensation board may need to be
enabled, e.g., if a given flow cytometer is unable to perform
hardware linear fluorescence compensation itself.
[0211] The fluorescence compensation board of the sort computer can
perform real-time hardware linear fluorescence compensation between
all parameters used in the grid space procedure. Using an inverted
user-defined compensation matrix, the raw parameter values are
processed by the fluorescence compensation board following the
method described in Bagwell & Adams, Annals New York Academy of
Sciences, 677, p.167, (1993). The compensated values are then used
in the sort computer board to determine in which grid space a given
bead belongs.
[0212] Syntheses
[0213] New methods are provided for the directed synthesis of
encoded libraries of oligonucleotides on beads. These methods allow
the synthesis of libraries that are sufficiently large, for
example, to permit complex genomic analyses to be carried out. The
sort computer described herein can be in random combinatorial
synthesis (e.g., split and mix methods) or in directed synthesis,
as described below. In random synthesis, beads are randomly grouped
and reacted with a monomer. After each round, all of the beads are
combined and randomly split into reactions vessels for reaction
with another monomer. In this method, after each monomer is added,
the beads can be assayed by the sort computer, which records the
distinguishing features of each bead on which a particular monomer
was added during each round of synthesis. When the synthesis is
complete, the record of the distinguishable features enables the
identification of the compound on each bead by identifying the
distinguishing features of each bead.
[0214] In one embodiment, encoded beads are functionalized so that
solid-phase oligomer synthesis can be performed on the beads. The
oligomers can be any oligomeric molecule amenable to synthesis in
stepwise fashion, for example, the oligomers may be
oligonucleotides, peptides, saccharides, peptide nucleic acids, or
any other oligomeric molecules known in the art. The surface
functionality of the beads can be modified to give the desired
surface groups, depending on the final use for the beads. For
peptide work and for cleavable oligomer linkers, a terminal amine
group is preferable; for direct DNA synthesis, terminal hydroxy
groups are preferable; and for coupling presynthesized DNA,
terminal carboxylic acid groups are preferable. In one example, an
amine group may be synthesized on the surface of the beads using
3-isocyanatopropyldimethylchlorosilane. For DNA synthesis, an amine
group may be reacted with a 5'-o-(4,4'-dimethoxytrityl)
base-3'-o-succinic acid (such as
5'-o-(4,4'-dimethoxytrityl)thymidine-3'-o-succinic acid) that when
treated with a base, such as ammonia, is cleaved. Standard
automated DNA synthesis can be performed on the bead after this
first base has been coupled to it.
[0215] In one version of the method, oligonucleotides are
synthesized with a cleavable bead-oligomer linker, for example,
with a linker of the type that is commonly used in standard
silica-based oligonucleotide synthesis. The linker may be cleaved
after completion of oligonucleotide synthesis, for example during
the deprotection step of oligonucleotide synthesis. In a second
version, the linker is not cleaved following synthesis, or a
non-cleavable linker is used, so that the oligonucleotide remains
covalently attached to the bead.
[0216] Since one value of the invention is to be able to synthesize
large numbers of oligonucleotides on a large number of beads, each
of the separation steps is performed using a method that is capable
of quickly separating large numbers of beads. For example, beads
can be encoded using fluorescent dyes and then sorted in a
multichannel fluorescence-activated cell sorter (FACS) or flow
cytometer or any other optically-based sorting machine. Libraries
of encoded beads can be constructed, for example, as described in
PCT applications WO 99/24458 and WO 00/32542 and U.S. application
Ser. No. 10/186,783, filed Jul. 1, 2002.
[0217] Chemical reactions which can be performed by direct
synthesis or random combinatorial synthesis on these beads include,
for example:
[0218] 1. [2+2] cycloadditions including trapping of butadiene;
[0219] 2. [2+3] cycloadditions including synthesis of isoxazolines,
furans, and modified peptides;
[0220] 3. acetal formation including immobilization of diols,
aldehydes and ketones;
[0221] 4. aldol condensation including derivatization of aldehydes,
and synthesis of propanediols;
[0222] 5. benzoin condensation including derivatization of
aldehydes;
[0223] 6. cyclocondensations including benzodiazepines and
hydantoins, thiazolidines, -turn mimetics, porphyrins, and
phthalocyanines;
[0224] 7. Dieckmann cyclization including cyclization of
diesters;
[0225] 8. Diels-Alder reaction including derivitization of acrylic
acid
[0226] 9. electrophilic addition including addition of alcohols to
alkenes;
[0227] 10. Grignard reaction including derivitization of
aldehydes;
[0228] 11. Heck reaction including synthesis of disubstituted
alkenes;
[0229] 12. Henry reaction including synthesis of nitrile oxides in
situ (see [2+3] cycloaddition);
[0230] 13. catalytic hydrogenation including synthesis of
pheromones and peptides (hydrogenation of alkenes);
[0231] 14. Michael reaction including synthesis of sulfanyl ketones
and bicyclo[2.2.2]octanes;
[0232] 15. Mitsunobu reaction including synthesis of aryl ethers,
peptidyl phosphonates, and thioethers;
[0233] 16. nucleophilic aromatic substitutions including synthesis
of quinolones;
[0234] 17. oxidation including synthesis of aldehydes and
ketones;
[0235] 18. Pausen-Kband cycloaddition including cyclization of
norbornadiene with pentynol;
[0236] 19. photochemical cyclization including synthesis of
helicenes;
[0237] 20. reactions with organo-metallic compounds including
derivitization of aldehydes and acyl chlorides;
[0238] 21. reduction with complex hydrides and Sn compounds
including reduction of carbonyl, carboxylic acids, esters, and
nitro groups;
[0239] 22. Soai reaction including reduction of carboxyl
groups;
[0240] 23. Stille reactions including synthesis of biphenyl
derivatives;
[0241] 24. Stork reaction including synthesis of substituted
cyclohexanones;
[0242] 25. reductive amination including synthesis of
quinolones;
[0243] 26. Suzuki reaction including synthesis of phenylacetic acid
derivatives;
[0244] 27. Wittig, Wittig-Horner reaction including reactions of
aldehydes, pheromones, and sulfanyl ketones;
[0245] 28. peptide nucleic acid reactions;
[0246] 29. oligonucleotide synthesis;
[0247] 30. peptide synthesis; and
[0248] 31. peptide and oligonucleotide reactions with synthetic
amino acids, nucleic acids, sugars, or peptide nucleic acids.
[0249] Reference may also be made to Patel et al., (April 1996, DDT
1(4): 134-144) who describe the manufacture or synthesis of
N-substituted glycines, polycarbamates, mercaptoacylprolines,
diketopiperazines, HIV protease inhibitors, 1-3 diols,
hydroxystilbenes, B-lactams, 1,4-benzodiazepine-2-5-diones,
dihydropyridines, and dihydropyrimidines. Reference may also be
made to synthesis of polyketides as discussed, for example, in Rohr
(1995, Angew. Int. Ed. Engl. 34: 881-884).
[0250] Chemical or enzymatic synthesis of the compound libraries of
the present invention takes place on beads. Thus, those of skill in
the art will appreciate that the materials used to construct the
beads are limited primarily by their capacity for derivitization to
attach any of a number of chemically reactive groups and
compatibility with the chemistry of compound synthesis. Except as
otherwise noted, the chemically reactive groups with which such
carriers may be derivatized are those commonly used for solid state
synthesis of the respective compound and thus will be well known to
those skilled in the art. For example, these bead materials may be
derivatized to contain functionalities or linkers including
--NH.sub.2, --COOH, --OH, --SH, or sulphate groups. Linkers for use
with the carriers may be selected from base stable anchor groups as
described in Table 2 of Fruchtel, J. S. and Jung, G. (1996, Polymer
supported organic synthesis: a review. Combinatorial Peptide and
Nonpeptide Libraries, 19-78) or acid stable anchor groups as
described in Table 3 of Fruchtel et al. Suitable linkers are also
described in International Publication WO93/06121 and U.S.
application Ser. No. 10/186,783.
[0251] Generally the anchors developed for peptide chemistry are
stable to either bases or weak acids but for the most part, they
are suitable only for the immobilization of carboxylic acids.
However, for the reversible attachment of special functional
groups, known anchors have to be derivatized and optimized or, when
necessary, completely new anchors must be developed. For example,
an anchor group for immobilization of alcohols is (6
hydroxymethyl)-3,4 dihydro-2H-pyran, whereby the sodium salt is
covalently bonded to chloromethylated Merrifield.TM. resin by a
nucleophilic substitution reaction. The alcohol is coupled to the
support by electrophilic addition in the presence of pyridinium
toluene-4 sulphonate (PPTS) in dichloromethane. The resulting
tetrahydropyranyl ether is stable to base but can be cleaved with
95% trifluoroacetic acid.
[0252] Benzyl halides may be coupled to a photolabile
sulfanyl-substituted phenyl ketone anchor.
[0253] Directed Synthesis
[0254] Unlike traditional random split and mix methods of
synthesis, the directed synthesis approach results in a
combinatorial library that contains only the desired combination of
monomers. In this method, each bead in the encoded population (at
least one bead per desired compound) is represented by a grid space
in the grid space memory array of the sort computer. In addition,
each sort direction on the sorting device has its own grid space
memory array in the sort computer, which is used for generating a
separate encoded population for each monomer used for each round of
synthesis.
[0255] Prior to synthesis, a list of a desired set or library of
oligomers is generated. A collection of encoded beads is designated
to have a particular oligomer synthesized upon its surface. The
library can be designed such that each oligomer is present on one
or more beads, but each bead contains oligomers having a single
sequence. For each round of monomer addition, a particular bead is
directed down a path in a sorting device based on the list of
desired oligomers. For example, for nucleotide synthesis, the beads
are divided according to the identity of each bead into four
groups, corresponding to G, A, T, and C, depending on the first
base of the oligonucleotide to be made on each bead. The beads are
then subjected to a synthesis step where a nucleotide is added,
after which the beads are pooled, then again separated according to
the identity of each bead into four groups, G, A, T, and C,
corresponding to the second base to be added, and so on. In this
way, a bead-oligonucleotide library is constructed wherein the
exact composition of the library is designed rather than random. In
this application, the sort computer thus allows a precise chemical
library to be "written" onto the beads. Similar strategies are
employed for peptides and other oligomers.
[0256] Ideally, the sorting device has as many possible paths as
there are monomers in a given round of synthesis, but this
arrangement is not necessary. For instance, for peptide synthesis
involving sixteen different amino acids, a sorting device with four
sort directions can be used to first separate a population of beads
into four groups, with beads in each group having one of four
possible amino acids in the first position. Each individual group
is then passed through the sorting device and subdivided into four
more groups, with beads in each group having the same amino acid in
the first position. For peptide synthesis involving twenty or more
different amino acids, a third sorting step is required, following
the same general logic as the method described above.
[0257] The general method of directed synthesis may be summarized
as follows. A two-column list comprising the compounds/reaction
sequences and the beads is generated, either by the user or by the
sort computer. Methods for creating such lists are known in the art
of computer science. The beads are then fed into a sorting device
for a first cycle. As each bead is read by the device, the
distinguishing characteristics of the bead are communicated to the
sort computer. The sort computer then identifies the bead on the
two-column list, finds the associated reaction sequence, and
communicates to the sorting device to sort the bead into a bin of
beads that will all undergo a particular first reaction. The beads
are then fed into the sorting device again, and the process is
repeated until the reactions are complete.
[0258] By uploading pre-determined grid space memory arrays into
the sort computer, it is possible to determine which direction a
given bead is sorted. In these uploaded grid space memory arrays
(unlike normal encoding in which every grid space is initialized to
zero), every grid space is initialized to one except for those grid
spaces that correspond to beads that are to be sorted in that sort
direction. Thus, when a given bead is detected, its corresponding
grid space will be checked until a zero is found in the sort
direction that was pre-determined for that bead. The sort
directions represent an individual monomer that is to be added to a
bead. In general, the beads must be passed through the sorting
device once for every monomer (or unique reaction) that is to be
incorporated onto the bead. The operations of the sort computer are
further exemplified in FIGS. 7, 8, 14, 41, 42, 44, 45, 48, and
49.
[0259] Assaying of the library is performed in the conventional
manner with the `hits` detected by the sorting device (FIG. 50).
The structure of each `hit` compound is identified by analyzing the
optical signature of the particles on which the `hit` resides. This
analysis is done automatically using the data that is stored by the
sort-computer during the oligomer synthesis.
[0260] One of the major advantages of directed combinatorial
synthesis (FIG. 6) using a sort computer is the reduced number of
analyses compared with random combinatorial synthesis (FIG. 5). For
example, with the normal split-and-mix synthesis, the total number
of sortings is the number of cycles multiplied by the number of
monomers plus one (the pre-encoding step) plus one (hit detection),
e.g., for a 15-mer oligonucleotide it would be 15.times.4+1+1=62
analyses. For directed synthesis, the sorting step is the splitting
step, and hence there are only the number of monomers plus two
analyses required, e.g., for a 15-mer oligonucleotide it would be
15+1+1=17 analyses.
[0261] Types of compounds that may be synthesized by the directed
synthesis method include deoxyribonucleotides, ribonucleotides,
peptides, sugars, peptide nucleic acids, and organic molecules.
[0262] Enabling of directed synthesis in real-time. Using the
exemplary sort computer described above, it is possible to enable
directed synthesis for flow cytometers that possess more than one
sort direction. The sort directions are placed in a priority order
by the sort computer board, e.g., left, right, half-left,
half-right. A separate grid space memory device is required for
each sort direction. For a given grid space memory associated with
a given sort direction, all of the bits in that grid space memory
are initialized to 1 except for those grid spaces that are
associated with beads that are to be sorted in that given sort
direction, which are instead initialized to 0 (FIG. 48). These grid
space memories are then uploaded to the sort computer board through
the enhanced parallel port (EPP) connection from the master
computer.
[0263] When a bead is detected, the normal grid space procedure is
applied to the highest priority sort direction. If the bit
representing the grid space to which the bead belongs equals 0, the
bead is sorted in the highest priority sort direction. However, if
the bit equals 1, the above process is repeated using the grid
space memory associated with the next highest priority sort
direction. In this manner, every bead in a given population can be
sorted in real-time to a pre-determined sort direction. Thus, the
sort computer allows the directed synthesis of a large encoded
population of beads in real-time using high-throughput flow
cytometry.
[0264] Hairpin Nucleic Acid Synthesis. Single stranded linear
oligonucleotide probes are commonly used in hybridization
reactions. However, it has been shown that a hairpin (HP) capture
probe, which contains a duplex region adjacent to a single stranded
target capture region, hybridizes to its target with a
thermodynamic advantage over a similar linear probe. This target
capturing advantage of the hairpin system can be attributed, at
least in part, to the stacking interaction between the 5' terminal
base of the hairpin probe and the 3' terminal base of the
single-stranded target. Studies have shown that the duplex region
of a partly double-stranded DNA capture molecule can enhance its
target capture ability (Lane M J, Paner T, Kashin I, Faldasz B D,
Li B, Gallo F J, Benight A S, Nucleic Acids Res Feb. 1, 1997;
25(3):611-617.). Hairpin capture probes have been developed, and
their potential utility in various nucleic acid detection assays
has been demonstrated (see, e.g., U.S. Pat. No. 5,770,365). For
example, HP probes exhibit significantly higher rates of target
capture relative to linear capture probes (up to 4.times.better
performance). In addition, HP probes are capable of capturing
greater quantities (up to 4.times.more) across a large target
concentration range and perform significantly better at low target
concentrations relative to linear probes. These properties result
in greater assay sensitivity. Hence, HP probes may significantly
enhance the performance of nucleic acid assays, such as high
throughput diagnostics, single nucleotide polymorphism (SNP)
detection, and microarray based gene expression profiling, where
the current challenge is to develop more rapid and sensitive
detection methods [Riccelli P V, Merante F, Leung K T, Bortolin S,
Zastawny R L, Janeczko R, and Albert S. Benight, Nucleic Acids
Research Feb. 15, 2001; 29(4): 996-1004].
[0265] The subject of the present invention is the synthesis of a
directed combinatorial library on encoded beads where on the end of
each sequence a spacer group is synthesized, for example, a
penta-thymidine sequence. This spacer group forms a hairpin when a
sequence, complementary to the last X bases (where X=10-30 bases)
of the oligonucleotide sequence already on the bead, is
synthesized, as shown in FIG. 51.
[0266] Non-combinatorial Libraries. Pre-existing libraries of small
molecules can be covalently linked to subpopulations of encoded
beads to establish non-combinatorial encoded libraries. These
libraries can then be screened against other large libraries or
against selected targets.
[0267] An optically diverse set of beads is prepared according to
methods described in the art. The beads have an appropriate linker
group and/or functionality to permit covalent or physical binding
of a full length (pre-synthesized, or preexisting) compound, such
as a cDNA, or oligonucleotide. The sorting device, e.g., a flow
cytometer, either in conjunction with the sort computer or not,
sorts an optically diverse set of beads into subpopulations based
on their similar optical signature (rather than their unique
optical signature). The beads in each subpopulation have similar
optical signatures within a chosen optical range, this range being
different from any other range or fluorescence intensity.
[0268] Peptide synthesis and small-molecule synthesis. The
invention can also be used to synthesize, for example, peptide
libraries. The invention is particularly useful when it is
desirable to synthesize a library where amino acids at two or more
positions can have only certain side chains, such that the side
chains are correlated to allow correct folding of a peptide. For
example, it may be useful to construct a library in which, if an
amino acid at a given position is a cysteine, the amino acid at a
particular second position is always preferred to be a cysteine,
and if the amino acid at the given position is not a cysteine, the
amino acid at the second position should never be a cysteine. In
this way, the peptides can be designed in such a way that they
contain or lack a disulfide bond, but never contain an unpaired
cysteine that could oxidize.
[0269] It is also useful to construct combinatorial chemistry
libraries using the invention. Random combinatorial chemistry
libraries generated by split-and-pool synthesis are often large in
size. In some cases, for example, certain monomers are incompatible
with certain other monomers (e.g., amino groups and activated
esters), such that the resulting compounds are chemically unstable
or have some other undesired feature. The method of the invention
allows the synthesis of combinatorial chemistry libraries on beads
in which the library does not contain undesired combinations of
monomers.
[0270] It is also sometimes useful to create a relatively small
library that samples a large area of chemical space. The invention
allows the directed synthesis of a subset of all the compounds that
would be created by a standard split-and-pool synthesis, such that
diversity can be maintained.
[0271] Assays
[0272] Compounds prepared with by the methods of the present
invention may be screened for an activity of interest. Such
screening may be effected by flow cytometry as described by Needels
et al. (1993, Proc. Natl. Acad. Sci. USA 90: 10700-10704) and WO
97/15390.
[0273] Compounds that may be screened include agonists and
antagonists for cell membrane receptors, toxins, venoms, viral
epitopes, hormones, sugars, cofactors, peptides, enzyme substrates,
drugs inclusive of opiates and steroids, oligonucleotides, cDNA,
RNA, proteins including antibodies, monoclonal antibodies, antisera
reactive with specific antigenic determinants, nucleic acids,
lectins, polysaccharides, cellular membranes and organelles.
[0274] Sequence by Hybridization. The present invention also
provides methods that employ a plurality of unique polynucleotide
or oligonucleotide sequences for sequence by hybridization (SBH) or
gene expression analyses.
[0275] SBH uses a set of short oligonucleotide probes of defined
sequence to search for complementary sequences on a longer target
strand of DNA. The hybridization pattern is used to reconstruct the
target DNA sequence. Accordingly, in the context of the present
invention, an aqueous solution of fluorescently labeled single
stranded DNA (ssDNA) of unknown sequence may be passed over the
library of polynucleotide or oligonucleotide compounds and
adsorption (hybridization) of the ssDNA will occur only on beads
which contain polynucleotide or oligonucleotide sequences
complementary to those on the ssDNA. These beads may be identified
by their distinguishable features, which are indicative a
nucleotide sequence bound to the beads. Beads may be detected by
flow cytometry, fluorescence optical microscopy, or any other
suitable technique.
[0276] Once a compound having the desired activity is obtained, the
sequence of reaction steps experienced by the bead on which the
compound was synthesized may be deconvoluted simply by analyzing
the tracking data for that bead which was stored by the sort
computer during combinatorial synthesis. The sequence of synthons
defining the compound of interest may thus be ascertained and a
molecule comprising this sequence can by synthesized by
conventional means (e.g., amino acid synthesis, peptide nucleic
acid synthesis, or oligonucleotide synthesis) as is known in the
art.
[0277] Gene Expression/Comparative Gene Expression Profiling. With
the completion of The Human Genome Project, attention is now firmly
focused on developing ways to use the valuable information
obtained. Individual genetic variation and gene expression are just
two important types of information that can be exploited to
identify new drug targets. By comparing the ways in which genes are
expressed in a normal and diseased organ, the genes, and hence the
associated proteins that are part of the disease process, can be
identified. This information can then be used to synthesize drugs
that interact with those proteins, thus reducing the effect of the
disease on the body.
[0278] One of the key components of future genomic research will be
the study of drug or environment induced changes in gene expression
indicative of disease and/or pharmacological or environmental
exposure. Whether a particular cell or tissue type is healthy or
diseased can depend on which genes are being expressed and at what
levels. Thus by comparative gene expression studies one may be able
to determine an altered expression pattern that is indicative of
disease or toxic shock. This approach will also allow investigators
to determine the effect of therapeutics on gene expression and to
discover which genes underlie a given pharmacological or
physiological state.
[0279] Mapping ofsingle nucleotide polymorphisms using directed
synthesis oligonucleotide-bead libraries. The invention further
features methods of mapping single-nucleotide polymorphisms. In
this case, for example, the sequences of human SNPs are obtained
from a public resource such as the SNP Consortium. A list of SNPs
whose analysis is desired is generated. It is estimated that there
are between 100,000 and 1,000,000 SNPs in the human genome, and it
is straightforward to generate a library of beads of this size
using the methods described in WO 00/32542 and U.S. application
Ser. No. 10/186,783.
[0280] A particular method for constructing a library is described
here by way of illustration, although it will be clear to those
skilled in the art of nucleic acid hybridization that several
variant methods are possible. Oligonucleotides capable of
hybridizing to allelic SNP regions are synthesized on beads. The
oligonucleotides are about 25 bases long. For each SNP allele,
about 10 to 20 different oligonucleotides are synthesized,
consisting of distinct, overlapping DNA segments corresponding to
the region including the SNP and adjacent sequences. Thus,
depending on how many SNPs are to be scored, the entire bead
library will have 1 to 20 million unique members. Depending on the
purpose, it is generally useful to have duplicates of a given
oligonucleotide present in a hybridization experiment.
[0281] Before performing the hybridization with genomic DNA, it is
often useful to sort the beads by a sorting device, e.g., a FACS,
coupled to a sort computer into several classes corresponding to
the predicted melting temperature of the perfectly base-paired
oligo. Separate hybridization reactions are then performed at
temperatures correlated with the predicted melting temperatures of
each class of bead-oligonucleotide.
[0282] Human genomic DNA is harvested, purified, and labeled
according to standard techniques. For example, DNA is
nick-translated with fluorescently labeled precursors, such that
the products are about a hundred to a few hundred bases. The
reaction product is denatured and then hybridized to the beads.
[0283] As described above for mRNA expression profiling, the
fluorescent label on the nucleic acid sample is different from the
labels used to encode the beads, and all of the labels can be
independently scored by flow cytometry.
[0284] SNP Analysis. Analysis for known single nucleotide
polymorphisms (SNPs) can be readily accomplished by the preparation
of directed libraries of a combination of oligonucleotides that
uniquely code for each SNP through overlapping hybridization. Given
the massive directed libraries that can be synthesized using the
technology, simultaneous detection of many thousands of SNPs could
be readily accomplished. Further, the detection of the SNPs by this
method would be sufficiently fast and inexpensive to allow routine
diagnostic application of multiple SNP analysis at the hospital or
clinic level.
[0285] SNP/Mutation Identification. It is estimated that the human
genome contains between 100,000 and 1,000,000 SNPs, which are
single nucleotide mutations that occur in at least 1% of the human
population. These SNPs are expected to be important in genetic
mapping studies of human disease genes and pharmacogenomic
screening. Some SNPs produce a change in a gene or gene product in
a manner which results in a functional consequence. For example,
such consequences include genetic diseases such as cystic fibrosis
and sickle cell anemia. Accurate identification of SNPs is expected
to require hybridization with 10 to 30 test oligonucleotides each,
such that 1 to 30 million hybridizations will be required to
determine the SNPs in a human genome. This large number of
hybridizations is beyond the capability of current two-dimensional
array technology, but well within the capacity of the present
invention. The speed of currently available off-the-shelf flow
cytometers would allow 30 million bead-based hybridization tests to
be scored in about 20 minutes thus making this application feasible
for widespread clinical and diagnostic use.
[0286] Comparative SNP Analysis. By the use of massive libraries
containing up to all possible oligonucleotides of an optimized
number of bases to analyze pooled samples of patient DNA and pooled
samples of control DNA, the whole family of SNPs or gene mutations
associated with the disease state of the pooled patient DNA should
be readily identified. This approach is beyond the capabilities of
current methods.
[0287] Pharmacogenomics/Clinical Trials. Using the same approach as
with comparative SNP analysis, the technology could provide the
first opportunity to follow genetic markers prior to, during,
and/or subsequent to clinical trials. This ability could
significantly enhance the possibilities of new drug approvals as
each year dozens of promising drugs fail to make it to market
because they cause serious side effects in a very small number of
test patients. By analyzing the DNA of each potential or actual
participant in the trial, one may identify genetic markers which
are unique to, and therefore predictive of, adverse reactions to
the drugs being assayed. Such a method could thus be used to
prescreen for patient selection in the trials or to identify those
patients who should not be treated with an approved drug. This
approach constitutes a major breakthrough in pharmacogenomics, the
practice of identifying and studying genes that affect individual
responses to drugs, that is simply not attainable with today's
technology and could be used by clinical trial sponsors, either
voluntarily or as required by regulatory authorities, and treating
physicians.
[0288] Pathogen diagnosis with SNP/Mutation identification. Another
clinical application is the diagnosis of pathogens by DNA
hybridization. Using the directed synthesis technology, kits could
be created that can simultaneously diagnose hundreds of different
viral, bacterial, and parasitic pathogens in clinical samples, and
also indicate the presence of drug-resistance genes and mutations
in the pathogen genomes.
[0289] It is readily apparent to those skilled in the art of
molecular biology that many variations of these biochemical
procedures are possible. Targeted drug delivery systems, in situ
diagnostics, rapid pathogen/toxin identification (biological
warfare) and cell-based assays are but a few examples of this
potential.
[0290] Other Applications
[0291] Other applications exist where a sort computer may be
modified such that it can sort beads or cells in a high throughput
way based on color (e.g., beads encoded with chromophores) or
fluorescence spectrum (i.e., beads which give a convoluted
fluorescence spectrum will give a certain optical fingerprint which
may be sorted by a modified sort computer). The sort computer may
be modified to sort based on other electromagnetic attributes
wherein the electromagnetic radiation-related attribute is selected
from the group for example consisting of fluorescence emission,
luminescence, phosphorescence, infrared radiation, electromagnetic
scattering including light and X-ray scattering, light
transmittance, light absorbance, surface plasmon resonance and
electrical impedance.
[0292] Beads
[0293] Beads suitable for use in the methods described herein are
designed to resist the solvents and reagents used in solid phase
organic synthesis (e.g., dimethylformamide, dichloromethane, and
diisopropylethylamine) and assays and are derivatized with
appropriate functional groups to permit on-bead synthesis. A wide
variety of fluorescent dyes can be covalently bound into these
beads. By careful selection of dye excitation and emission
properties, as well as dye concentration, an optically diverse
(optodiverse) population of particles can be produced (FIG. 52).
This optical diversity can be exploited as a way of encoding
millions of solid support beads onto which biologically interesting
molecules (e.g., DNA, polypeptides, proteins, and polysaccharides)
can be chemically attached. By measuring the types and intensities
of dyes in the final bead, e.g., using a high performance flow
cytometer (FIG. 50), one can uniquely identify a massive number of
beads used to encode a library.
[0294] Synthesizing various fluorescent silica shells in a random
order and with varying intensities around core particles gives the
resulting multi-shell carrier beads a high degree of optical
diversity. The synthesis of such beads is described in WO 00/32542.
U.S. application Ser. No. 10/186,783 describes a new class of
nanoarchitectured ceramic beads for use as solid support beads in
high-throughput screening (HTS). These beads have a smooth external
surface, with a controlled, porous internal structure. The beads
are highly functionalized and organic linkers can be coupled onto
the particles, thereby making the beads suitable for solid phase
synthesis of chemical libraries. Other beads are known in the
art.
[0295] The present inventors have found that the larger the
diversity of detectable and/or quantifiable attributes of a bead,
the greater the degree of decipherability or resolution of the bead
in a large population of beads. In this regard, each detectable
and/or quantifiable attribute of a bead provides at least a part of
the information required to distinctively identify the bead. The
larger the number of such attributes, the more detailed the
identifying information that is compilable for a given bead, which
may be used to distinguish that bead from others.
[0296] In general, any bead that is detectable and capable of
withstanding the conditions under which an oligomer is coupled to
its surface is suitable for use in the methods described herein.
Distinguishable features that may be present on a bead include
fluorescence emission, fluorescence intensity, size, refractive
index profile, color, luminescence, phosphorescence, infrared
radiation, light scatter, x-ray scatter, light absorbance, surface
plasmon resonance, and electrical impedance. These attributes can
be detected by an instrument such as a high-performance flow
cytometer (HPFC) at an extremely high rate (up to 100,000 particles
s.sup.-1).
[0297] Beads may include any solid material capable of providing a
base for combinatorial synthesis. For example, the carriers may be
polymeric supports such as polymeric beads, which are preferably
formed from polystyrene cross-linked with 1-5% divinylbenzene.
Polymeric beads may also be formed from
hexamethylenediamine-polyacryl resins and related polymers,
poly[N-{2-(4-hydroxylphenyl)ethyl }] acrylamide (i.e., (one Q)),
silica, cellulose beads, polystyrene (PS) beads,
poly(halomethylstyrene) beads, poly(halostyrene) beads,
poly(acetoxystyrene) beads, latex beads, grafted copolymer beads
such as polyethylene glycol/polystyrene, porous silicates for
example controlled pore-glass beads, polyacrylamide beads for
example poly(acryloylsarcosine methyl ester) beads,
dimethylacrylamide beads optionally cross-linked with
N,N'-bis-acrylolyl ethylene diamine, glass particles coated with a
hydrophobic polymer inclusive of cross-linked polystyrene or a
fluorinated ethylene polymer which provides a material having a
rigid or semi-rigid surface, poly(N-acryloylpyrrolidine) resins,
Wang.TM. (p-Benzyloxybenzyl Alcohol) resins, PAM
(4-hydroxymethylphenylacetomidome- thyl) resins, Merrifield.TM.
(chloromethylpolystyrene-divinylbenzene) resins, PAP
(polyethyleneglycol is attached to the polystyrene backbone via a
benzyl ether linkage) and SPARE polyamide resins, polyethylene
functionalized with acrylic acid, kieselguhr/polyamide (Pepsyn K),
polyHipe.TM. (Polymerized High Internal Phase Emulsions),
polystyrene/polydimethylacrylamide copolymers, controlled pore
glass, polystyrene macrobeads and Tentagel.TM.
(polyethyleneglycol/polystyrene), and
polyethyleneglycol-polystyrene/divinylbenzene copolymers.
[0298] It will also be appreciated that the polymeric beads may be
replaced by other suitable supports such as pins or chips as is
known in the art, e.g. as discussed in Gordon et al. (1994, J. Med.
Chem. 37(10):1385-1401). The beads may also include pellets, discs,
capillaries, hollow fibers, or needles as is known in the art.
Reference also may be made to International Publication WO93/06121,
which describes a broad range of supports that may constitute beads
for use in the methods of the present invention. By way of example,
these beads may be formed from appropriate materials inclusive of
latex, glass, gold or other colloidal metal particles and the like.
Reference may also be made to International Publications WO95/25737
and WO97/15390, which disclose examples of suitable beads.
[0299] Suitable tags, such as fluorescent dyes include fluorescein
and its derivatives, rhodamine and its derivatives, dansyl,
aminocoumarines umbelliferone, ALEXFLUOR.RTM. (from Molecular
Probes Inc.), IC664, and BODIPY.RTM. (from Molecular Probes Inc.).
Additional dyes are known in the art. Exemplary fluorescent dyes
for encoding beads are succinimidyl ester and isothiocyanate
functionalized dyes, such as fluorescein isothiocyanate, Alexafluor
350 succinimidyl ester, Oregon Green (from Molecular Probes Inc.),
BODIPY 530 SE, BODIPY 581, BODIPY TR-X, Texas Red (from Molecular
Probes Inc.), TAMRA, BODIPY 630 succinimidyl ester, BODIPY 650
succinimidyl ester, and Rhodamine B isothiocyanate, but any
fluorescent dye that can react with a functional group present on a
bead, e.g., thiol, amine, or activated ester, could be employed.
When tagged oligomers will also be used, e.g., in a hybridization
assay, the tag on the oligomer may limit the dyes used to label the
beads. For example, when Cy3 is used to tag an oligomer, Rhodamine
B is not used to label the beads, and when Cy5 is used to tag an
oligomer, BODIPY 650 is not used to label the beads.
[0300] The beads and their encoding molecules (such as fluorescent
dyes) are typically highly resistant to the harsh chemical
conditions of combinatorial synthesis, obviating the primary
limitation of previous bead-based combinatorial approaches to high
throughput drug discovery. The beads preferably contain fluorescent
dyes which undergo little or no photobleaching. Such dyes are known
in the art. The beads desirably undergo little or no swelling so
their optical signature can be reproducible in the sort computer
and/or sorting device. Typically, in combinatorial synthesis,
particle swelling desirably increases particle surface area.
Particle swelling may alter the distinguishable features of a bead
(e.g., by leaching a dye out of a bead) and may degrade the encoded
information.
[0301] The following examples are merely intended to illustrate
various aspects of the invention and are not intended to be
limiting in any way.
EXAMPLE 1
Implementation of a Sort Computer on a Flow Cytometer
[0302] The following instructions use a Cytomation MoFlo Build 839
and Summit 3.1 (DakoCytomation, Fort Collins, Colo. 80525,
USA):
[0303] Hardware:
[0304] 1. Power off the MoFlo electronic rack.
[0305] 2. Remove all LUT boards except for the first one. The order
of the boards can be determined by reading the jumper switch at the
base of each board. Sorting cannot occur unless at least one LUT
board is present.
[0306] 3. Connect the sort computer board to the event bus of the
MoFlo electronic rack.
[0307] 4. Connect the fluorescence compensation board to the event
bus of the MoFlo electronic rack.
[0308] 5. Connect the fluorescence compensation board to the sort
computer board.
[0309] 6. Connect the serial port on the sort computer board to the
serial port on the master computer.
[0310] 7. Connect the parallel port on the sort computer board to
the parallel port on the master computer.
[0311] 8. Connect the sort computer board to the external power
supply.
[0312] 9. Connect the fluorescence compensation board to the
external power supply.
[0313] 10. Power on the master computer and run customized
software.
[0314] 11. Power on the MoFlo electronic rack.
[0315] 12. Power on the external power supply.
[0316] Software:
[0317] 1. Run Summit 3.1.
[0318] 2. Make sure there are no sort regions already defined.
[0319] 3. Create five histograms using five different parameters.
It is unimportant which parameters are chosen.
[0320] 4. On the first histogram, define a sort region, R1, which
spans the entire range of the parameter.
[0321] 5. On the second histogram, define a sort region, R2, which
spans the entire range of the parameter.
[0322] 6. On the third histogram, define a sort region, R3, which
spans the entire range of the parameter.
[0323] 7. On the fourth histogram, define a sort region, R4, which
spans the entire range of the parameter.
[0324] 8. On the fifth histogram, define four non-overlapping sort
regions, R5 to R8.
[0325] 9. Make sure there are four sort directions available.
[0326] 10. In the sort logic, define Left as: R1 and R2 and R3 and
R4 and not R5.
[0327] 11. In the sort logic, define Right as: R1 and R2 and R3 and
R4 and not R6.
[0328] 12. In the sort logic, define Half-Left as: R1 and R2 and R3
and R4 and not R7.
[0329] 13. In the sort logic, define Half-Right as: R1 and R2 and
R3 and R4 and not R8.
[0330] 14. Select appropriate settings using customized software
(FIG. 49).
[0331] 15. On the customized software on the master computer,
select the option that places results of sort computer onto the
event bus in LUT A, bits 4-7. Note:
[0332] bits 0-3 of LUT A are provided by the remaining LUT board.
Bits 8-11 on LUT A, and bits 0-11 on LUT B are all equal to 1 by
default, as their corresponding LUT boards have been removed. By
using the sort logic above, bits 0-3 will always equal 1 for every
event.
[0333] The sort computer is now set up and ready to operate.
EXAMPLE 2
Directed Synthesis of Oligonucleotides for Synthesis of
Hybridization Probes from a Genome.
[0334] This example illustrates how the invention can be used to
synthesize a large family of oligonucleotides. For the purpose of
this Example, the goal is to synthesize oligonucleotides
corresponding to the 5' and 3' ends of all of the genes in
Saccharomyces cerevisiae. As there are about 6,000 genes, about
12,000 oligonucleotides need to be synthesized. These
oligonucleotides can then be used as primers in PCR to amplify all
the coding sequences in yeast as in Hudson J R Jr, et al. (Genome
Res. [1997] 7:1169-73). For the purposes of this example,
essentially the same oligonucleotides described by Hudson et al.
are synthesized, to illustrate the advantages of the compositions
and methods of the invention. The only difference is that the
oligonucleotides of Hudson have a variable length, while the
oligonucleotides synthesized here will have a constant length, with
23 bases corresponding to the 5' and 3' ends of yeast genes.
[0335] The steps in this example include: 1) synthesis of a bead
library; 2) construction of an encoded population of beads using
the grid space procedure; 3) construction of a database associating
grid spaces with oligonucleotide sequences; 4) synthesis of diverse
oligonucleotides on beads to construct a bead-oligonucleotide
library; and 5) sorting the desired oligonucleotide-bead conjugates
from the remainder of the bead-oligonucleotide library, and 6)
cleaving the desired oligonucleotides from the beads and using the
oligomers for a desired purpose.
[0336] Encoded beads are first synthesized by one of the methods
described herein. Desirable beads have about 16 micromoles/gram of
reactive binding sites that can be used for labeling the beads, for
example with fluorescent dyes, and as attachment sites for
oligonucleotide synthesis. Beads of 100 micron diameter are used,
for example. The beads have a weight of about 10.sup.-6 grams and
thus about 10.sup.13 reactive sites per bead.
[0337] In the first step, the beads are fluorescently labeled
according to the method of U.S. application Ser. No. 10/186,783 to
generate a library of about 10.sup.5 to 10.sup.6 beads, which will
have a total volume of about {fraction (1/10)} to 1 milliliter.
About 10.sup.6 beads are preferably used. An encoding strategy is
used that involves five fluorescent dyes that can be distinguished
by a high-end FACS machine such as the MoFlo machine of Cytomation.
Eight different intensity levels will be distinguished, so this
labeling scheme is capable of differently marking 65,536 beads.
When constructing these beads, it is preferable to use less than
10% of the reactive sites on the beads for the labeling, so that
most of the sites can be used for oligonucleotide synthesis. The
following five dyes are preferably used: Alexafluor 350
succinimidyl ester, Oregon Green (from Molecular Probes Inc.),
BODIPY 581, Texas Red (from Molecular Probes Inc.), BODIPY 630
succinimidyl ester.
[0338] The beads are labeled such that most of the beads contain
between 0 and 10.sup.11 molecules of a given dye, with about 10% of
the beads having 0 to 10.sup.10 of a given dye molecule, 10% having
10.sup.10 to 2.times.10.sup.10 of a given dye molecule, and so on.
It is important to keep the amounts of each dye per bead about the
same, when labeling the beads. This is because the beads will
ultimately be scored by flow cytometry, and it is desirable that
the signal from one dye not be masked by the tail of the signal
from another dye that might be present in much greater amounts. For
this reason, it is also preferable to have a linear, rather than
logarithmic, distribution of dye concentrations. The absolute
number of dye molecules per bead is less important. For example, a
starting population of beads with 0 to 10.sup.9 or 0 to 10.sup.8
dye molecules could be used.
[0339] Each bead is considered to occupy a position in a parameter
space, which in this Example is five-dimensional, based on the
amount of each of the five dyes in the bead. As a first step, the
bead library is sorted using the sort computer of the invention
into a first group of 8.sup.5=65,536 beads that is retained and a
second group of other beads that is discarded, as follows. Beads in
the first group have, for example, the following eight possible
amounts of each dye: 0 to 0.75.times.10.sup.10 molecules, 1.25 to
2.times.10.sup.10 molecules, 2.5 to 2.75.times.10.sup.10 molecules,
3.75 to 4.5.times.10.sup.10 molecules, 5 to 5.75.times.10.sup.10
molecules, 6.25 to 7.times.10.sup.10 molecules, 7.5 to
8.25.times.10.sup.10 molecules, and 8.75 to 9.5.times.10.sup.10.
The second group contains beads in which one or more of the dye
amounts falls outside or in between these ranges. Thus, if the
amount of dye in each bead is evenly distributed between 0 and
10.sup.11 molecules, about (0.75/1.25).sup.5=(3/5).sup.5=243/3125
of the beads are retained in group 1, and the remaining about 92%
of the beads are discarded. The resulting beads remaining in group
1 occupy 8.sup.5 discrete grid spaces in the 5-dimensional
parameter space described above.
[0340] During the sorting of beads into group 1 and group 2, the
number of beads in each grid space is recorded and stored in a
database within the sort computer. Because the distribution of
beads in the parameter space is often uneven and because of Poisson
distribution effects, some grid spaces may have relatively few
beads or no beads at all. An aspect of the invention is the
recognition of the utility of creating a set of beads that are
divided into grid spaces, which are topologically disconnected in
the parameter space. Two reasons for the division into grid spaces
are as follows. First, during the oligonucleotide synthesis
described below (or oligopeptide synthesis), there can be some
bleaching of the dyes in a bead, such that the position of the bead
in the parameter space is shifted. Such shifts can accumulate and
result in a significant total shift during the repeated rounds of
synthesis and FACS sorting. For example, as described below, a
given population of beads may be sorted 15 to 30 times during the
combinatorial synthesis of the invention. It is for this reason
that it is also preferable to use dyes with minimal tendency to
bleach. Second, there is some error in the quantification of
fluorescence by a FACS machine. The resulting encoded population of
beads is suitable for synthesis of a directed library, such as the
oligonucleotide library described by Hudson et al.
[0341] Each of the approximately 12,000 nucleotide sequences of
Hudson et al. is placed in a computer database. Each of these
sequences is then associated with one or more grid spaces to form a
sequence/grid space database. In one variation of this method, the
first 12,000 grid spaces containing at least a given number of
beads are associated randomly with the oligo sequences. For
example, after beginning with 10.sup.6 beads and recovering about
80,000 beads in the encoded population as described above, most
grid spaces will have only one bead. Twelve thousand grid spaces
containing one or more bead each are assigned to each oligo
sequences, and then synthesis is initiated. Beads in unassigned
grid spaces are discarded during synthesis. In a second variation,
multiple grid spaces are assigned to a given oligo sequence, such
that the total number of beads for each oligo is about the
same.
[0342] The assignment of grid spaces to oligomer sequences is
performed by a computer program, and is preferably run within the
sort computer. The creation of such a computer program is within
the capabilities of those skilled in the art of computer
programming.
[0343] It is important to recall that the specific oligomers to be
synthesized are either 5' or 3' oligomers. Each 5' oligomer has the
sequence 5' GGAATTCCAGCTACCACCATGN.sub.20 3', which corresponds to
19 bases common to all 5' oligomers, a 3-base start codon, and the
subsequent 20 bases of the 5' end of a yeast gene. Each 3' oligomer
has the sequence 5' GATCCCCGGGAATTGCCATG-END-N.sub.20 3', which
corresponds to 20 bases common to all 3' oligomers, 3 bases
complementary to a stop codon, and the adjacent 20 bases
complementary to the 3' end of a yeast gene. The purpose of the
common sequences is for subsequent amplification by universal
primers.
[0344] In the next step, oligonucleotide synthesis is initiated on
the beads. A cleavable linker is used. When using a standard
phosphoramidite synthesis, the 3' base of an oligonucleotide is the
first to be attached to a silica solid support, and synthesis
proceeds in a 3' to 5' direction. The beads are mixed, placed into
a FACS machine with an associated sort computer, and sorted into
four groups corresponding to G, A, T, and C, which refer to the
3'-most base on each oligonucleotide. The four groups of beads are
then reacted with standard, protected versions of G, A, T, and C
coupled to a cleavable linker, such that the linker-base molecules
covalently attach to the reactive groups on the bead.
[0345] The beads are then sorted again with the FACS machine/sort
computer into G, A, T, and C groups, which now correspond to the
second 3'-most base in the sequence of each oligonucleotide. The
process is repeated a total of 23 times. After the final addition
of the oligonucleotide-specific bases, the oligomer-bead library is
sorted into two groups, corresponding to the 5' oligomer-beads and
the 3' oligomer-beads.
[0346] In the next step, all of the 5' beads are put through a
series of reactions so that they all receive the same terminal 19
bases, and all of the 3' beads are put through a separate series of
reactions so that they receive a common set of 20 bases that are
distinct from those on the 5' beads. The oligonucleotides are now
completely synthesized. It is convenient to store the beads with
oligonucleotides together as a library, and when it is desirable to
obtain two particular oligonucleotides to amplify a particular
yeast gene, the oligomer-bead library is sorted with a FACS machine
and sort-computer. The beads carrying the 5' and 3' oligomers for
the gene of interest are sorted into either two or one channel,
depending on the number of channels in the FACS machine, and all
the other beads are sorted into another channel. The oligomers are
then cleaved from the beads and deprotected using standard
procedures. The concentration of the oligomers is optionally
estimated and then the oligomers are used for a first round of PCR
amplification of the desired yeast gene. The product of this
amplification step is re-amplified with universal primers as
described in Hudson et al.
[0347] The procedures described in this example produces about
10.sup.12 to 10.sup.13 molecules of a given oligonucleotide. This
corresponds to about 130 picomoles. Since a typical PCR reaction
requires about 1 picomole of each oligonucleotide, the procedure
produces enough for this purpose. The entire synthesis produces
about 1.5 micromoles, or about 1.5 milligrams of total
oligonucleotide.
[0348] It is possible to scale down the procedure such that 1
picomole or less is used. For example, smaller beads or fewer beads
per oligomer are used. Since the oligomers are designed to allow
for a second round of PCR using universal 5' and 3' primers as
described by Hudson et al., it is reasonable to contemplate a
synthesis strategy in which less than a picomole of each oligomer
is generated, and then to perform a PCR reaction that is either
suboptimal or is done in a smaller volume than the standard 25 to
50 microliters. It is important to note that the procedure could
easily be modified to generate about 10-fold more oligonucleotides,
such that oligomers capable of amplifying all the coding sequences
in the human genome could be generated.
EXAMPLE 3
Summary of a Flow Cytometric Determination of Combinatorial
Reaction Histories According to the Invention
[0349] A split-process-recombine procedure involving m steps, step
1, step 2, . . . , step m, and n(i) processes at step i (i=1,2, . .
. , m) may be defined as follows. For i=1,2, . . . , m, let the
n(i) processes at step i be P1(i), P2(i), . . . , Pn(i)(i). At each
step i=,2, . . . , m:
[0350] the sort computer partitions the beads into n(i) subsets
S1(i),S2(i), . . . , Sn(i)(i);
[0351] for j=1,2, . . . , n(i) process Pj(i) is performed on the
beads in subset Sj(i);
[0352] the beads are recombined.
[0353] Examples of such processes include the combinatorial
synthesis of oligonucleotide and oligopeptide chains. In these
examples, insoluble beads (colloidal particles, typically 1-1000
.mu.m in diameter) may be used as the carriers onto which monomers
(e.g. nucleic acid, amino acid or peptide nucleic acid) are
attached and sequentially grown. By performing a
split-process-recombine procedure repeatedly for a large number of
beads, with the sort computer directing beads into known vials,
specific oligonucleotide or polypeptide sequences can be
synthesized. Each bead thus contains an attached polymer with a
unique sequence, which is defined by the sequence of processing
events that the bead has experienced.
[0354] In view of the above, the present invention relates to a
novel and convenient method to determine the sequence of processes
applied to each of the beads involved in a split-process-recombine
procedure. This procedure involves, for i=1,2, . . . , m and j=1,2,
. . . , n(i), passing the carriers in the subset Sj(i) through a
sorting device to obtain a signature or code for each of the beads
present in the subset. The code of each bead will be determined by
a combination of features of the beads as described above. The
coding data is stored for the purpose of determining the sequence
of processes (i.e., reaction history of the bead) applied to each
of the beads.
[0355] The code of a particular bead for which the process history
is required is checked against the list of codes which has been
stored for each subset Sj(i). The set of subsets Sj(i) in which the
particular bead's code occurs determines the set of processes Pj(i)
which have been performed on the bead and hence its entire process
history. It is desirable, therefore, that the code of any bead be
reproducible and distinguishable from the code of any other bead
which is used in the split-process-recombine procedure. In this
regard, split-process-recombine procedures may be employed in the
manufacture of beads in order to facilitate efficient production of
extremely large numbers of distinguishable particles. In a
preferred embodiment, flow cytometric techniques are used to sort
and remove subpopulations of indistinguishable beads. However,
partial or complete determination of process histories that are
sought may be obtained without perfect code distinction and
reproducibility. For example, if two beads become detectably
indistinguishable in the seventh step of a 10-step split synthesis,
and then the reaction history of either bead through steps 8 to 10
may be used to deduce the reaction history for those particles.
EXAMPLE 4
Synthesizing an Oligonucleotide Library Using the Directed
Synthesis Method
[0356] An exemplary technique for synthesizing an oligonucleotide
library using the directed synthesis method is carried out as
follows.
[0357] (a) Optically distinguishable carriers suitable for
oligonucleotide synthesis are prepared as described and sorted
using the flow cytometer and sort computer according as above.
Oligonucleotide sequences to be synthesized are selected and their
length chosen.
[0358] (b) The beads are introduced into the fluidics of a flow
cytometer (a Cytomation MoFlo, equipped with a sort computer) as
normal. The sort computer apportions the beads into up to four
reaction vessels (depending on the oligonucleotide sequences
selected in step (a), for example, all of the sequence might start
with an adenine, thus, all of the carriers would be directed into
one vessel). The sort computer determines and records the codes of
the beads in order to track the movement of these individual
detectably distinct beads into the up to four reaction vessels.
[0359] (c) Once collected, each bead solution is thoroughly washed
in acetonitrile to remove trace water. This step is done using
centrifugation or cross-flow filtration.
[0360] (d) Each of the four bead/acetonitrile solutions is placed
into four disposable Twist columns (manufactured by Glen Research,
Stirling, Va., USA), which are designed to fit into a Beckman
Coulter Oligo-1000M automated DNA synthesizer. This step is
performed in the absence of humidity, for example under a nitrogen
or argon atmosphere in a glove box.
[0361] (e) Each set of beads receives a different phosphoramidite
containing one of the nucleic acids, adenine, thymine, cytosine,
and guanine. These phosphoramidites, protected by a DMT protecting
group, are covalently coupled to the linker groups present on the
beads using conventional phosphoramidite chemistry in the automated
synthesizer.
[0362] (f) After synthesis, the beads are pooled and washed with
saline solution identical to that used in the flow cytometer.
[0363] (g) Steps (b) through (f) are repeated as necessary
(according to the oligonucleotide length chosen in step (a)) to
create a directed compound library wherein member compounds of the
library are associated with the detectably distinct beads and
wherein codes of the detectably distinct beads are deconvolutable
using tracking data provided by said recordal steps to identify the
sequence of reactions experienced by the said detectably distinct
beads.
[0364] The conditions for hybridizaton of target single stranded,
fluorescently labelled DNA to the bead-based oligonucleotide probes
is established through testing under various temperature
conditions. The following conditions are used as a starting point,
but these conditions vary according to melting temperature. Buffer:
HEPES 20 nM pH=7.5; KCl 300 mM; IGEPAL 0.1%. Target oligonucleotide
concentration: 1-500 nM. Ideal hybridization temperature is
investigated by conducting experiments at temperatures between
45.degree. C and 75.degree. C in intervals of 3-5.degree. C for
various time periods over one hour.
[0365] Hybridization is scored by flow cytometry in a Cytomation
MoFlo, which has temperature control capability. A great advantage
of this technology is that the beads do not require washing as is
currently done with microarrays; thus, bead based libraries are
allowed to come to equilibrium. The fluorophore used to label the
target DNA is chosen to be spectroscopically different to those
fluorophores used to encode the beads, thus, the target label can
be read independently by a detector especially chosen to read the
`hits`.
[0366] The bead sequences on which hits are found are decoded using
data that was stored by the sort computer during library
synthesis.
EXAMPLE 5
Gene Expression Analysis Using a Bead-Oligomer Library Synthesized
Via a Directed Synthesis
[0367] In this example, a bead-oligo library is constructed in
which each bead has an oligonucleotide sequence corresponding to a
sequence in an mRNA from an organism. The bead-oligo library is
synthesized via a directed synthesis as described herein.
[0368] The mRNA population to be studied is reverse-transcribed
using fluorescent precursors, so that a labeled cDNA population is
generated. The beads are synthesized such that the label on the
cDNA is different from the fluorescent labels used to encode the
beads, and bead labels and the cDNA label can be read
independently. The labeled cDNA population is hybridized to the
bead-oligo library and washed under standard conditions. The
hybridized library is then scored for hybridization events by flow
cytometry, in which the identity of each bead and the amount of
hybridized material is quantified.
[0369] In this case, the following features may be incorporated
into the library. There are multiple sequences corresponding to
different regions of each MRNA and these sequences can be
synthesized onto beads using the directed synthesis methods as
described. The oligonucleotides on the beads can be any length
amenable to synthesis, but are preferably 15 to 35 bases long, and
more preferably 20 to 30 bases long. Twenty-five bases is a
particularly convenient length to use. In one variation, the base
composition of each oligonucleotide is chosen to be about 50% G+C,
so that the hybridization experiment can be performed at a single
temperature, and incorrect hybridization will be minimized. For
each oligo that should hybridize to a given mRNA, there is a
control oligo in which a central base is altered, which indicates
when incorrect hybridization may be taking place. In one
embodiment, about 50,000 oligonucleotide molecules per square
micron are synthesized onto the surface of the bead. In some
circumstances, it is useful to use other densities. For example,
there are situations in which artifactual hybridization can result
from an mRNA with a repeated mismatched sequence hybridizing to a
bead, due to multivalent hybridization. In such cases it is useful
to reduce the density of the oligomers on the beads.
[0370] Use of the encoded beads allows a more precise
quantification of mRNA levels in a sample. As described above, a
labeled cDNA population is generated from an mRNA population to be
studied. A series of dilutions of the labeled cDNA, such as
ten-fold dilutions, are then prepared. Each dilution is then
hybridized to a replica of the oligo-bead library under conditions
that allow the hybridization to proceed essentially to completion.
With an appropriate starting concentration of cDNAs, more rare
transcripts will simply be absent from the hybridization mixtures
derived from higher dilutions of the starting cDNAs. In principle,
such an experiment could also be performed using two-dimensional
arrays, but the expense of these arrays precludes such an
experiment in practice, and only a single array is used to examine
a given mRNA population.
[0371] Induction of TNF-.alpha. gene in LPS-stimulated murine
macrophage (RAW246) clones is investigated by using libraries of
oligonucleotide prepared by directed synthesis as described
herein.
[0372] Having optimized hybridization conditions and decided on an
appropriate oligonucleotide probe length, induction of TNF-.alpha.
gene in LPS-stimulated RAW246 clones is investigated. mRNA is
isolated from five RAW264 clones with and without a four hour LPS
stimulation, and labeled cDNA is produced by incorporating Cy3 or
Cy5, respectively.
[0373] The mRNA population to be studied is reverse-transcribed
using fluorescent precursors, so that a labeled cDNA population is
generated. The beads are synthesized such that the label on the
cDNA is different from the fluorescent labels used to encode the
beads, and bead labels and the cDNA label can be read
independently. The labeled cDNA population is hybridized to the
bead-oligo library and washed under standard conditions. The
hybridized library is then scored for hybridization events by flow
cytometry, in which the identity of each bead and the amount of
hybridized material is quantified.
EXAMPLE 6
Synthesis of a Directed Oligonucleotide Library Capable of Forming
Hairpin Duplexes
[0374] Optically distinguishable carriers suitable for
oligonucleotide synthesis are prepared as described.
Oligonucleotide sequences to be synthesized are selected and their
length chosen.
[0375] (a) The beads are introduced into the fluidics of the flow
cytometer (e.g. a Cytomation MoFlo, equipped with a sort computer)
as normal. The sort computer apportions the beads into up to four
reaction vessels (depending on the oligonucleotide sequences
selected in step (a), for example, all of the sequence might start
with an adenine, thus, all of the carriers would be directed into
one vessel). The sort computer determines and records the codes of
the beads in order to track the movement of these individual
detectably distinct beads into the up to four reaction vessels.
[0376] (b) Once collected, each bead solution is thoroughly washed
in acetonitrile to remove trace water. This is done using
centrifugation or cross-flow filtration.
[0377] (c) Each of the four bead/acetonitrile solutions is placed
into four disposable Twist columns (manufactured by Glen Research,
Stirling, Va., USA), which are designed to fit into a Beckman
Coulter Oligo-1000M automated DNA synthesizer. This step is
performed in the absence of humidity, for example under a nitrogen
or argon atmosphere in a glove box.
[0378] (d) Each set of beads receives a different phosphoramidite
containing one of the nucleic acids, adenine, thymine, cytosine and
guanine. These phosphoramidites, protected by a DMT protecting
group, are covalently synthesized onto the linker groups present on
the beads using conventional phosphoramidite chemistry in the
automated synthesizer.
[0379] (e) After synthesis, the beads are pooled and washed with
saline solution identical to that used in the flow cytometer.
[0380] (f) Steps (b) through (f) are repeated as necessary
(according to the oligonucleotide length chosen in step (a)) to
create a directed compound library wherein member compounds of the
library are associated with the detectably distinct beads and
wherein codes of the detectably distinct beads are deconvolutable
using tracking data provided by said recordal steps to identify the
sequence of reactions experienced by the said detectably distinct
beads.
[0381] (g) A flexible spacer group is synthesized or attached to
the end of the oligonucleotide sequence. This spacer group must be
able to undergo a conformation to a hairpin structure. These spacer
groups may be one or more nucleotides for example.
[0382] (h) Since the exact sequence prior to the spacer group on
each synthesized oligonucleotide is known by the sort computer, the
complement of the prior sequence can be continued after the spacer
group, such that hybridization can occur (under appropriate buffer
and temperature conditions) on formation of the hairpin turn (FIG.
51).
[0383] The presence of a hairpin turn at the end of each
oligonucleotide may permit the formation of a double helical
structure formed between the two complementary oligonucleotide
subsequences either side of the spacer group. The presence of this
double helix assists in hybridization of target sequence to the
oligonucleotide sequence.
EXAMPLE 7
Screening Libraries More Than Once to Obtain the Best Hit
Discrimination
[0384] Screening of bead libraries involves exposure of the bead
libraries to a fluorescently labeled target molecule. This target
molecule may bind to one or more compounds which are attached to
individual beads. This is known as a "hit", and the consequence of
this is that the bead fluoresces the same color as the label on the
target molecule. Providing the fluorophores used to encode the bead
itself are distinguishable from the target label, the "hit"
sequence can be decoded. Sometimes, there is non-specific binding
of a target sequence to a bead (rather than specific binding to a
compound on the bead) or the target binds to a sequence on a bead
that is not its completely complementary sequence (i.e., it forms a
mismatched sequence). One method for enhancing the mismatch
discrimination, is to expose the bead library more than once to the
target sequence solution, with washing in between.
[0385] To obtain hit discrimination, an example method is as
follows:
[0386] a. expose the bead libraries to the fluorescently labeled
target,
[0387] b. send the beads through the FC as described, sort out hits
and decode using the sort computer. The beads that display a hit
fluorescence above (or below in some cases where the fluorophore
gets cleaved off) a chosen threshold are removed from the other
library members.
[0388] c. the chosen beads are again exposed to the fluorescently
labeled target, and
[0389] d. steps (b) and (c) are repeated for a chosen number of
steps until satisfied the real hits have been discovered. Since the
sort computer stored the optical signature of the beads during
library synthesis, decoding the hit sequences is simple. Note that
the other beads which displayed some but not necessary high
affinity for the target can also be investigated further at a later
date. These sequences are also known, as they were stored by the
sort computer during compound synthesis.
EXAMPLE 8
Preparation of a Subpopulation of Beads from an Optically Diverse
Set of Beads
[0390] Many subpopulations of beads can be easily prepared from an
optically diverse set, where beads within a subpopulation have a
similar optical signature, and where beads from any subpopulation
are optically distinguishable from beads in every other
subpopulation. Rather than synthesizing each subpopulation
individually, an optically diverse set of beads is run through the
flow cytometer where the subpopulations are sorted. This sorting is
accomplished using the software of the flow cytometer to form a
gate around a particular region on the flow cyometry plot (e.g.,
rectangular, square, or circular gate that is X channels wide and Y
channels high in each two dimensional plot), and collecting only
those beads within that region into an individual vessel. This
could be done in parallel with a number of gates, for example,
sixteen, as shown in FIG. 53. Naturally, any combination of
subpopulations can also be collected into the same vessel for later
analysis or additional sorting. Fluorophores chosen for encoding
include those suited towards each of the various commercial flow
cytometers, which have slightly different optical filters as
standard. These flow cytometers include the Cytomation MoFlo,
Becton Dickinson FACSVantage, and the Coulter Epics XL and MXL, for
example.
EXAMPLE 9
Preparation of Subpopulations of Beads from an Optically Diverse
Set of Beads, Using the Sort Computer
[0391] As an alternative to Example 8, the sort computer (rather
than the flow cytometer software) is used to direct beads into
certain subpopulations, so that the beads within a subpopulation
have similar optical signatures. Another variation is to use the
sort computer in combination with the flow cytometer software to
direct beads into certain subpopulations, so that the beads within
a subpopulation have similar optical signatures.
[0392] Another method, is to use the sort computer to direct beads
of widely varying optical signatures into the same vessel, and then
coupling or synthesizing a chosen library compound onto the
beads.
[0393] Each grid space may be represented by a value that may be
encoded by one or more bytes. This value represents the upper limit
of beads to sort in a particular sort direction. The sort computer
could then be instructed to sort beads in predetermined grid spaces
in only one sort direction by appropriate grid space memories
uploaded to the sort computer board. This sorting could be
accomplished by making the values in the grid spaces of interest
equal to zero, and the values in every other grid space equal to
the upper limit.
EXAMPLE 10
Methods for Speeding Up the Collection of Subpopulations from an
Optically Diverse Set of Beads
[0394] Since the current state-of-the-art flow cytometers have only
four way sorting, the methods for collecting subpopulations four at
a time, can be time consuming. Improvements on this technique
include:
[0395] (a) Running the optically diverse bead set through a
multitude of flow cytometers running simultaneously, so that a
different set of four subpopulations can be collected from each
machine.
[0396] (b) Set up multiple streams on one flow cytometer so that
more than four subpopulations can be collected simultaneously.
[0397] (c) Set up more capacitor plates underneath the current
capacitor places used for collection of subpopulations. This would
mean subpopulations of subpopulations etc could be collected,
looking much like a family tree, but being collected all at the
same time.
[0398] (d) Improve the number of directions a flow cytometer can
sort.
EXAMPLE 11
Preparation of a Non-Combinatorial Library on Subpopulations of
Beads
[0399] Once a chosen number of subpopulations of bead have been
sorted according to one or more methods described herein, different
compounds, for example amine modified oligonucleotides, cDNAs, or
small organic molecules, are attached to the functional groups on
each subpopulation of beads. The beads already have an appropriate
linker group and/or functionality to permit covalent or physical
binding of a full length (pre-synthesized, or preexisting)
compound, such as a cDNA, or oligonucleotide. Also, the linker is
chosen such that it is cleavable or non-cleavable, depending on the
purpose of the screen. For example, if there is streptavidin
already coupled to the beads, then biotinylated oligonucleotides
can be attached to the beads under the normal buffer conditions
used for streptavidin/biotin binding. As another example, if the
beads are functionalized with carboxylic acid groups, and the
compounds (e.g., oligonucleotides) are amine modified, then through
the use of a carbodiimide or similar reagent, known in the prior
art, covalent binding will occur under the appropriate conditions,
thereby forming an amide bond.
[0400] To couple presynthesized oligonucleotides to the beads, for
example, a standard coupling procedure of amine modified
oligonucleotides to carboxylic acid beads is used. A 100 .mu.l
aliquot of beads is washed 3 times in pH 5 MES buffer with 0.01%
Triton X100 and 70 .mu.l of 25 .mu.M amine DNA solution is added
and allowed to stand for 30 min. 30 .mu.l of 100 mg/ml solution of
fresh, cold EDC solution is added to the reaction mixture and
allowed to react for 90 min in the refrigerator. The
oligonucleotide coupled beads are then washed 3 times with the pH 5
MES buffer with 0.01% Triton X100.
[0401] Aliquots of each subpopulation are removed, mixed together,
and exposed to one or more fluorescently labeled target molecules
under selected hybridization conditions. DNA hybridization of
complementary (5'TACAGGCCTCACGTTACCTG) and mismatched
(5'CAGGTAACGTGAGGCCTGTT) sequences was performed by hybridizing the
particles with fluorescently labeled target sequences
(5'CAGGTAACGTGAGGCCTGTT) in pH 8 MES with a 100 nM concentration of
fluorescent probe (see FIG. 54) This data clearly shows that the
complementary sequence (average fluorescent intensity of 287 A.U.)
can be discriminated from the non-complementary mismatched sequence
(average fluorescent intensity of 16 A.U.) using a flow
cytometer.
[0402] Hits are scored by the flow cytometer and the beads are
decoded by reviewing the position of the subpopulation on a flow
cytometer plot, and/or by recalling the data that was stored by the
sort computer during sorting of the beads into subpopulations. A
significant advantage of this system is the improvement in hit
discrimination. A hit sequence would only be accepted as a hit if a
significant/chosen number of beads from the same aliquot from a
subpopulation were displayed as hits (at least 10 beads, preferably
up to 1000 or more).
EXAMPLE 12
Preparation of Directed Libraries on Encoded Subpopulations of
Beads
[0403] Once a chosen number of subpopulations of bead have been
sorted according to one or more methods as described herein, a
different compound can be synthesized onto each subpopulation using
conventional solid phase synthesis methods (e.g., peptide
synthesis, oligonucleotide synthesis, or peptide nucleic acid
oligomer synthesis). For example, an oligonucleotide library can be
synthesized. Eight subpopulations of beads are washed in
acetonitrile to remove trace water, placed into separate Twist
columns which are fitted onto an automated oligonucleotide
synthesizer which has capability to perform simultaneous reactions.
Twist columns are desirable for the ability to remove beads easily
after synthesis. Normally, automated synthesizers use controlled
pore glass beads to synthesize oligonucleotides, but these
oligonucleotides are cleaved off. In the case described here, the
oligonucleotides must remain attached to the beads to enable
screening of the oligonucleotides while they are still attached to
beads. In this example, eight different oligonucleotide sequences
are simultaneously synthesized on eight subpopulations of beads.
This process is continued until all of the chosen subpopulations
have a different oligonucleotide synthesized onto them. Aliquots of
each subpopulation are removed, mixed together, and exposed to one
or more fluorescently labeled target molecules under selected
hybridization conditions. Hits are scored by the flow cytometer and
the beads are decoded by reviewing the position of the
subpopulation on a flow cytometer plot, and/or by recalling the
data that was stored by the sort computer during sorting of the
beads into subpopulations. A significant advantage of this system
is the improvement in hit discrimination. A hit sequence would only
be accepted as a hit if a significant/chosen number of beads from
the same aliquot from a subpopulation were displayed as hits.
[0404] Two subpopulations of encoded beads, functionalized with a
primary hydroxy group and sorted according to one or more methods
as described, were chosen. A complementary oligonucleotide sequence
(5'TACAGGCCTCACGTTACCTG) was synthesized on one subpopulation using
the standard phosphoamidite chemistry of the automated DNA
synthesizer, the Beckman-Coulter Oligo-1000M. A mismatched
(5'CAGGTAACGTGAGGCCTGTT) sequence was synthesized on the other
subpopulation using the standard phosphoamidite chemistry of the
Beckman-Coulter Oligo-1000M.
[0405] DNA hybridization of complementary (5'TACAGGCCTCACGTTACCTG)
and mismatched (5'CAGGTAACGTGAGGCCTGTT) sequences is performed by
hybridizing the particles with fluorescently labeled target
sequences (5'CAGGTAACGTGAGGCCTGTT) in pH 8 MES with a 100 nM
concentration of fluorescent probe. The subpopulation with the
complementary sequence is discriminated from the non-complementary
mismatched sequence in the flow cytometer, with results similar to
those shown in FIG. 54.
EXAMPLE 13
Control of Fluorescence Photobleaching on Multiple Passes Through
the Flow Cytometer
[0406] Initially a set of particles (optically diverse in n
dimensions) are passed through the flow cytometer and sorted into x
intensity populations for each dye dimension. In this example a
diverse population containing the dyes Oregon Green and Rhodamine B
in 2 dimensions (n=2) was sorted into 4 intensity populations
(x=4), to give 16 distinct populations. To make the populations
distinguishable it is necessary to space the populations so that
there is no cross contamination of the distinct populations. For
this example the distance between the populations is double the
width of the population.
[0407] FIG. 55 shows the initial diverse set of beads before they
are sorted in the flow cytometer. FIG. 56 shows the distinct
populations of beads after they have been sorted by the flow
cytometer and passed through the machine for a second time. FIG. 57
shows the same set of particles passed through the flow cytometer
for a third time. This demonstrates that multiple passes through
the flow cytometer do not significantly effect the optical
signature of the particles, and are still distinguishable in
distinct populations. The change in fluorescence intensity for each
of the two dyes, as they undergo multiple passes through the flow
cytometer, is presented in Tables 4 and 5.
5TABLE 4 Change in fluorescence intensity for Oregon Green 488 dye
in beads encoded with Oregon Green and Rhodamine B, after multiple
passes through the flow cytometer. Change in Fluorescence Intensity
for Oregon Green Dye Average Fluorescent Intensity Difference in
Intensity Population Initial 1.sup.st Rerun 2.sup.nd Rerun 1.sup.st
Rerun 2.sup.nd Rerun 1 31.2 31.4 32.4 +0.64% +3.85% 2 94.9 97.1
100.6 +2.32% +6.00% 3 159.1 163.4 168.3 +2.70% +5.78% 4 222.5 227.5
231.2 +2.25% +3.91%
[0408]
6TABLE 5 Change in fluorescence intensity for Rhodamine B dye in
beads encoded with Oregon Green and Rhodamine B, after multiple
passes through the flow cytometer. Change in Fluorescent Intensity
for Rhodamine B Dye Average Fluorescent Intensity Difference in
Intensity Population Initial 1.sup.st Rerun 2.sup.nd Rerun 1.sup.st
Rerun 2.sup.nd Rerun 1 31.2 31.9 31.6 +2.24% +1.28% 2 97.0 94.0
93.2 -3.09% -3.92% 3 160.2 155.7 155.1 -2.81% -3.18% 4 224.0 218.4
217.6 -2.50% -2.86%
Other Embodiments
[0409] Each patent, patent application, and publication referenced
in this application is hereby incorporated by reference.
[0410] While the invention has been described in connection with
specific embodiments, it will be understood that it is capable of
further modifications. Therefore, this application is intended to
cover any variations, uses, or adaptations of the invention that
follow, in general, the principles of the invention, including
departures from the present disclosure that come within known or
customary practice within the art.
[0411] Other embodiments are in the claims.
Sequence CWU 0
0
* * * * *