U.S. patent application number 10/419341 was filed with the patent office on 2003-09-25 for polynucleotide molecules encoding neospora proteins.
This patent application is currently assigned to Pfizer, Inc.. Invention is credited to Brake, David A., Durtschi, Becky, Krishnan, B. Rajendra, Madura, Rebecca, Yoder, Christine.
Application Number | 20030180785 10/419341 |
Document ID | / |
Family ID | 26761953 |
Filed Date | 2003-09-25 |
United States Patent
Application |
20030180785 |
Kind Code |
A1 |
Krishnan, B. Rajendra ; et
al. |
September 25, 2003 |
Polynucleotide molecules encoding Neospora proteins
Abstract
The present invention provides isolated polynucleotide molecules
comprising nucleotide sequences encoding GRA1, GRA2, SAG1, MIC1 and
MAG1 proteins from Neospora caninum, as well as recombinant
vectors, transformed host cells, and recombinantly-expressed
proteins. The present invention further provides a polynucleotide
molecule comprising the nucleotide sequence of the bidirectional
GRA1/MAG1 promoter of N. caninum. The present invention further
provides genetic constructs based on the polynucleotide molecules
of the present invention that are useful in preparing modified
strains of Neospora cells for use in vaccines against
neosporosis.
Inventors: |
Krishnan, B. Rajendra; (East
Lyme, CT) ; Madura, Rebecca; (Westerly, RI) ;
Yoder, Christine; (Salem, CT) ; Durtschi, Becky;
(Ledyard, CT) ; Brake, David A.; (East Lyme,
CT) |
Correspondence
Address: |
SCULLY SCOTT MURPHY & PRESSER, PC
400 GARDEN CITY PLAZA
GARDEN CITY
NY
11530
|
Assignee: |
Pfizer, Inc.
New York
NY
Pfizer Products, Inc.
Groton
CT
|
Family ID: |
26761953 |
Appl. No.: |
10/419341 |
Filed: |
April 21, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10419341 |
Apr 21, 2003 |
|
|
|
09276438 |
Mar 25, 1999 |
|
|
|
6600027 |
|
|
|
|
60112282 |
Dec 15, 1998 |
|
|
|
60079389 |
Mar 26, 1998 |
|
|
|
Current U.S.
Class: |
435/6.15 ;
424/190.1; 435/252.3; 435/320.1; 435/69.1; 530/350; 536/23.7 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 25/00 20180101; A61P 15/06 20180101; A61K 39/00 20130101; C07K
14/44 20130101; A61P 33/00 20180101; A61P 31/04 20180101; A61P
33/02 20180101; A61P 31/00 20180101; A61P 31/12 20180101 |
Class at
Publication: |
435/6 ; 435/69.1;
435/252.3; 435/320.1; 530/350; 424/190.1; 536/23.7 |
International
Class: |
C12Q 001/68; C07H
021/04; C07K 014/195; C12P 021/02; A61K 039/02; C12N 001/21 |
Claims
What is claimed is:
1. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a Neospora GRA1 protein, said nucleotide sequence
selected from the group consisting of the nucleotide sequence of
the open reading frame (ORF) of SEQ ID NO: 1 from about nt 205 to
about nt 777; the nucleotide sequence of the ORF of SEQ ID NO: 3
from about nt 605 to about nt 1304; the nucleotide sequence of the
GRA1-encoding ORF of plasmid pRC77 (ATCC 209685); and a nucleotide
sequence that is homologous to any of the aforementioned nucleotide
sequences.
2. The isolated polynucleotide molecule of claim 1, comprising the
nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
3. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a polypeptide that is homologous to a polypeptide
comprising the amino acid sequence of SEQ ID NO: 2.
4. An isolated polynucleotide molecule consisting of a nucleotide
sequence that is a substantial portion of the nucleotide sequence
of the polynucleotide molecule of claim 1.
5. An isolated polynucleotide molecule comprising a nucleotide
sequence selected from the group consisting of SEQ ID NO: 1 from
about nt 1 to about nt 204; SEQ ID NO: 1 from about nt 778 to about
nt 1265; SEQ ID NO: 3 from about nt 1 to about nt 604; SEQ ID NO: 3
from about nt 1305 to about nt 1774; and a substantial portion of
any of the aforementioned nucleotide sequences.
6. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a Neospora GRA2 protein, said nucleotide sequence
selected from the group consisting of the nucleotide sequence of
the ORF of SEQ ID NO: 4 from about nt 25 to about nt 660; the
nucleotide sequence of the GRA2-encoding ORF of plasmid pRC5 (ATCC
209686); and a nucleotide sequence that is homologous to any of the
aforementioned nucleotide sequences.
7. The isolated polynucleotide molecule of claim 6, comprising the
nucleotide sequence of SEQ ID NO: 4.
8. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a polypeptide that is homologous to a polypeptide
comprising the amino acid sequence of SEQ ID NO: 5.
9. An isolated polynucleotide molecule consisting of a nucleotide
sequence that is a substantial portion of the nucleotide sequence
of the polynucleotide molecule of claim 6.
10. An isolated polynucleotide molecule comprising a nucleotide
sequence selected from the group consisting of SEQ ID NO: 4 from
about nt 1 to about nt 24; SEQ ID NO: 4 from about nt 661 to about
nt 1031; and a substantial portion of any of the aforementioned
nucleotide sequences.
11. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a Neospora SAG1 protein, said nucleotide sequence
selected from the group consisting of the nucleotide sequence of
the ORF of SEQ ID NO: 6 from about nt 130 to about nt 1089; the
nucleotide sequence of the SAG1-encoding ORF of plasmid pRC102
(ATCC 209687); and a nucleotide sequence that is homologous to any
of the aforementioned nucleotide sequences.
12. The isolated polynucleotide molecule of claim 11, comprising
the nucleotide sequence of SEQ ID NO: 6.
13. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a polypeptide that is homologous to a polypeptide
comprising the amino acid sequence of SEQ ID NO: 7.
14. An isolated polynucleotide molecule consisting of a nucleotide
sequence that is a substantial portion of the nucleotide sequence
of the polynucleotide molecule of claim 11.
15. An isolated polynucleotide molecule comprising a nucleotide
sequence selected from the group consisting of SEQ ID NO: 6 from
about nt 1 to about nt 129; SEQ ID NO: 6 from about nt 1090 to
about nt 1263; and a substantial portion of any of the
aforementioned nucleotide sequences.
16. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a Neospora MIC1 protein, said nucleotide sequence
selected from the group consisting of the nucleotide sequence of
the ORF of SEQ ID NO: 8 from about nt 138 to about nt 1520; the
nucleotide sequence of the ORF of SEQ ID NO: 10; the nucleotide
sequence of the MIC1-encoding ORF of plasmid pRC340 (ATCC 209688);
and a nucleotide sequence that is homologous to any of the
aforementioned nucleotide sequences.
17. The isolated polynucleotide molecule of claim 16, comprising
the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 10.
18. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a polypeptide that is homologous to a polypeptide
comprising the amino acid sequence of SEQ ID NO: 9.
19. An isolated polynucleotide molecule consisting of a nucleotide
sequence that is a substantial portion of the nucleotide sequence
of the, polynucleotide molecule of claim 16.
20. An isolated polynucleotide molecule comprising a nucleotide
sequence selected from the group consisting of SEQ ID NO: 8 from
about nt 1 to about nt 137; SEQ ID NO: 8 from about nt 1521 to
about nt 2069; and a substantial portion of any of the
aforementioned nucleotide sequences.
21. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a Neospora MAG1 protein, said nucleotide sequence
selected from the group consisting of the nucleotide sequence of
the ORF of SEQ ID NO: 11 from about nt 1305 to about nt 2786; the
nucleotide sequence of the ORF of SEQ ID NO: 12 from about nt 122
to about nt 1381 the nucleotide sequence of the MAG1-encoding ORF
of plasmid bd304 (ATCC 203413); and a nucleotide sequence that is
homologous to any of the aforementioned nucleotide sequences.
22. The isolated polynucleotide molecule of claim 21, comprising
the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
23. An isolated polynucleotide molecule comprising a nucleotide
sequence encoding a polypeptide that is homologous to a polypeptide
comprising the amino acid sequence of SEQ ID NO: 13.
24. An isolated polynucleotide molecule consisting of a nucleotide
sequence that is a substantial portion of the nucleotide sequence
of the polynucleotide molecule of claim 21.
25. An isolated polynucleotide molecule comprising a nucleotide
sequence selected from the group consisting of SEQ ID NO: 11 from
about nt 1 to about nt 1304; SEQ ID NO: 11 from about nt 2787 to
about nt 4242; SEQ ID NO: 12 from about nt 1 to about nt 121; SEQ
ID NO: 12 from about nt 1382 to about nt 1892; and a substantial
portion of any of the aforementioned nucleotide sequences.
26. An isolated polynucleotide molecule, comprising the nucleotide
sequence of SEQ ID NO: 11 from about nt 127 to about nt 703.
27. An oligonucleotide molecule comprising a nucleotide sequence
selected from the group consisting of SEQ ID NOS: 14 to 26 and 28
to 34, and the complements thereof.
28. A recombinant vector, comprising a polynucleotide molecule: (a)
comprising a nucleotide sequence encoding a N. caninum GRA1, GRA2,
SAG1, MIC1 or MAG1 protein; (b) comprising a nucleotide sequence
that is homologous to the nucleotide sequence of (a); or (c)
consisting of a nucleotide sequence that is a substantial portion
of the nucleotide sequence of (a) or(b).
29. The recombinant vector of claim 28, selected from the group
consisting of plasmid pRC77 (ATCC 209685); plasmid pRC5 (ATCC
209686); plasmid pRC102 (ATCC 209687); plasmid pRC340 (ATCC
209688), and plasmid bd304 (ATCC 203413).
30. The recombinant vector of claim 28, wherein the polynucleotide
molecule further comprises a nucleotide sequence encoding a carrier
or fusion partner such that expression of the recombinant vector
results in production of a fusion protein comprising the carrier or
fusion partner fused to a protein or polypeptide encoded by the
recombinant vector of claim 28.
31. A transformed host cell, comprising the recombinant vector of
claim 28.
32. A substantially purified or isolated polypeptide selected from
the group consisting of: (a) an N. caninum GRA1, GRA2, SAG1, MIC1
or MAG1 protein; (b) a polypeptide having an amino acid sequence
that is homologous to an N. caninum GRA1, GRA2, SAG1, MIC1 or MAG1
protein; (c) a polypeptide consisting of a substantial portion of
an N. caninum GRA1, GRA2, SAG1, MIC1 or MAG1. protein, or
polypeptide which is homologous thereto; (d) a fusion protein
comprising the protein or polypeptide of (a), (b) or (c) fused to a
carrier or fusion partner; and (e) an analog or derivative of the
protein or polypeptide of (a), (b), (c) or (d).
33. The polypeptide of claim 32, wherein the GRA1 protein comprises
the amino acid sequence of SEQ ID NO: 2; the GRA2 protein comprises
the amino acid sequence of SEQ ID NO: 5; the SAG1 protein comprises
the amino acid sequence of SEQ ID NO: 7; the MIC1 protein comprises
the amino acid sequence of SEQ ID NO: 9; and the MAG1 protein
comprises the amino acid sequence of SEQ ID NO: 13.
34. An isolated antibody that specifically reacts to a N. caninum
protein selected from the group consisting of GRA1, GRA2, SAG1,
MIC1 and MAG1.
35. A genetic construct comprising a polynucleotide molecule that
can be used to disable a Neospora gene, comprising: (a) a
polynucleotide molecule comprising a nucleotide sequence that is
otherwise the same as a nucleotide sequence of a GRA1, GRA2, SAG1,
MIC1 or MAG1 gene from N. caninum, or that is otherwise the same as
a nucleotide sequence that is homologous thereto, or a substantial
portion of said nucleotide sequence, but which nucleotide sequence
further comprises one or more mutations capable of disabling the
GRA1, GRA2, SAG1, MIC1 or MAG1 gene from N. caninum; or (b) a
polynucleotide molecule comprising a nucleotide sequence that
naturally flanks in situ the ORF of a Neospora GRA1, GRA2, SAG1,
MIC1, or MAG1 gene, or a nucleotide sequence that is homologous to
said flanking sequence; such that transformation of a Neospora cell
with the genetic construct of (a) or (b) results in disabling of
the GRA1, GRA2, SAG 1, MIC1 or MAG1 gene.
36. The genetic construct of claim 35, further comprising a
selectable marker.
37. The genetic construct of claim 35, wherein the respective gene
is disabled as the result of a homologous recombination event.
38. A Neospora cell that has been modified by transformation with
the genetic construct of claim 35 such that the GRA1, GRA2, SAG1,
MIC1 or MAG1 gene, or a combination of said genes, has been
disabled.
39. A method of preparing modified Neospora cells, comprising
transforming Neospora cells with the genetic construct of claim 35,
and selecting transformed cells that express a mutant phenotype
selected from the group consisting of GRA1.sup.-, GRA2.sup.-,
SAG.sup.-, MIC1.sup.-, and MAG.sup.- as a result of said
transformation.
40. A vaccine against neosporosis, comprising an immunologically
effective amount of a component comprising: (a) a polypeptide
selected from the group consisting of: (i) an N. caninum GRA1,
GRA2, SAG1, MIC1 or MAG1 protein; (ii) a polypeptide having an
amino acid sequence that is homologous to an N. caninum GRA1, GRA2,
SAG1, MIC1 or MAG1 protein; (iii) a polypeptide consisting of a
substantial portion of an N. caninum GRA1, GRA2, SAG1, MIC1 or MAG1
protein, or polypeptide which is homologous thereto; (iv) a fusion
protein comprising the protein or polypeptide of (i), (ii) or
(iii); and (v) an analog or derivative of the protein or
polypeptide of (i), (ii), (iii) or (iv); (b) a polynucleotide
molecule comprising a nucleotide sequence encoding the polypeptide
of (a); or (c) a Neospora cell that has been modified by
transformation with the genetic construct of claim 35 such that the
GRA1, GRA2, SAG1, MIC1 or MAG1 gene, or a combination of said
genes, in said cell has been disabled; and a veterinarily
acceptable carrier.
41. The vaccine of claim 40, wherein the modified Neospora cells
are live cells.
42. The vaccine of claim 40, wherein the modified Neospora cells
are inactivated cells.
43. The vaccine of claim 40, further comprising an adjuvant or a
cytokine.
44. The vaccine of claim 43, wherein the adjuvant is selected from
the group consisting of the RIBI adjuvant system, alum, mineral
gel, an oil-in-water emulsion, a water-in-oil emulsion, Block
copolymer, QS-21, SAF-M, AMPHIGEN.RTM. adjuvant, saponin, Quil A,
monophosphoryl lipid A, Avridine lipid-amine adjuvant, SEAM62, and
SEAM1/2.
45. The vaccine of claim 40, which further comprises an
immunologically effective amount of a second component that is
capable of inducing a protective response against a disease or
pathological condition that afflicts a mammal.
46. The vaccine of claim 45, wherein the second component is
capable of inducing, or contributing to the induction of, a
protective response against a pathogen selected from the group
consisting of bovine herpes virus, bovine respiratory syncitial
virus, bovine viral diarrhea virus, parainfluenza virus types I,
II, or III, Leptospira spp., Campylobacter spp., Staphylococcus
aureus, Streptococcus agalactiae, Mycoplasma spp., Klebsiella spp.,
Salmonella, spp., rotavirus, coronavirus, rabies, Pasteurella
hemolytica, Pasteurella multocida, Clostridia spp., Tetanus toxoid,
E. coli, Cryptosporidium spp., Eimeria spp., and Trichomonas
spp.
47. A method of preparing a vaccine against neosporosis, comprising
combining an immunologically effective amount of: (a) a polypeptide
selected from the group consisting of: (i) an N. caninum GRA1,
GRA2, SAG1, MIC1 or MAG1 protein; (ii) a polypeptide having an
amino acid sequence that is homologous to an N. caninum GRA1, GRA2,
SAG1, MIC1 or MAG1 protein; (iii) a polypeptide consisting of a
substantial portion of an N. caninum GRA1, GRA2, SAG1, MIC1 or MAG1
protein, or polypeptide which is homologous thereto; (iv) a fusion
protein comprising the protein or polypeptide of (i), (ii) or
(iii); and (v) an analog or derivative of the protein or
polypeptide of (i), (ii), (iii) or (iv); (b) a polynucleotide
molecule comprising a nucleotide sequence encoding the polypeptide
of (a); or (c) a Neospora cell that has been modified by
transformation with the genetic construct of claim 35 such that the
GRA1, GRA2, SAG1, MIC1 or MAG1 gene, or a combination of said
genes, in said cell has been disabled; with a veterinarily
acceptable carrier.
48. A method of vaccinating a mammal against neosporosis,
comprising administering to the mammal the vaccine of claim 40.
49. A kit for vaccinating a mammal against neosporosis, comprising
a container comprising an immunologically effective amount of: (a)
a polypeptide selected from the group consisting of: (i) an N.
caninum GRA1, GRA2, SAG1, MIC1 or MAG1 protein; (ii) a polypeptide
having an amino acid sequence that is homologous to an N. caninum
GRA1, GRA2, SAG1, MIC1 or MAG1 protein; (iii) a polypeptide
consisting of a substantial portion of an N. caninum GRA1, GRA2,
SAG1, MIC1 or MAG1 protein, or polypeptide which is homologous
thereto; (iv) a fusion protein comprising the protein or
polypeptide of (i), (ii) or (iii); or (v) an analog or derivative
of the protein or polypeptide of (i), (ii), (iii) or (iv); (b) a
polynucleotide molecule comprising a nucleotide sequence encoding
the polypeptide of (a); or (c) Neospora cells that have been
modified by transformation with the genetic construct of claim 35
such that the GRA1, GRA2, SAG1, MIC1 or MAG1 gene, or a combination
of said genes, in said cells has been disabled.
50. The kit of claim 49, further comprising a second container
comprising a veterinarily acceptable carrier or diluent.
Description
1. FIELD OF THE INVENTION
[0001] The present invention is in the field of animal health, and
is directed to vaccine compositions and diagnostics for disease.
More particularly, the present invention relates to polynucleotide
molecules comprising nucleotide sequences encoding GRA1, GRA2,
SAG1, MIC1, and MAG1 proteins from Neospora, which polynucleotide
molecules and proteins are useful in the production of vaccines
against neosporosis, and as diagnostic reagents.
2. BACKGROUND OF THE INVENTION
[0002] Neospora is a pathogenic protozoan parasite of animals that
has been recognized as a major cause of abortion, neonatal death,
congenital infection, and encephalitic disease in mammals. Dubey
and Lindsay, 1996, Vet. Parasitol. 67:1-59; Dubey and Lindsay,
1993, Parasitology Today, 9:452458. Neospora caninum infects dogs,
and congenitally infects pups, often leading to paralysis.
Tachyzoites of N. caninum have been isolated from naturally
infected pups. Lindsay and Dubey, 1989, J. Parasitol. 75:163-165.
Neospora is a major cause of abortion in dairy and beef cattle.
Cases of Neospora-related disease, i.e., neosporosis, have also
been reported in goats, sheep and horses.
[0003] Although N. caninum is superficially similar to the
pathogen, Toxoplasma gondii, N. caninum and T. gondii have been
distinguished from each other both antigenically and
ultrastructurally. Dubey and Lindsay, 1993, above. In addition,
Neospora-like protozoan parasites isolated from the brains of
aborted bovine fetuses and continuously cultured in vitro were
shown to be antigenically and ultrastructurally distinct from both
T. gondii and Hammondia hammondi, and were most similar to N.
caninum. Conrad et al., 1993, Parasitology 106:239-249.
Furthermore, analysis of nuclear small subunit ribosomal RNA genes
revealed no nucleotide differences between strains of Neospora
isolated from cattle and dogs, but showed consistent differences
between Neospora and T. gondii. Marsh et al., 1995, J. Parasitol.
81:530-535.
[0004] The etiologic role of a bovine isolate of Neospora in bovine
abortion and congenital disease has been confirmed. Barr et al.,
1994, J. Vet. Diag. Invest. 6:207-215. A rodent model of central
nervous system neosporosis has been developed using inbred BALB/c
mice infected with N. caninum. Lindsay et al., 1995, J. Parasitol.
81:313-315. In addition, models to study transplacental
transmission of N. caninum in pregnant outbred and inbred mice have
been described by Cole et al., 1995, J. Parasitol. 81:730-732, and
by Long et al., 1996, J. Parasitol. 82:608-611, respectively. An
experimental N. caninum pygmy goat model that closely resembles
naturally acquired Neospora-induced cattle abortion has been
demonstrated. Lindsay et al., 1995, Am. J. Vet. Res. 56:1176-1180.
An experimental N. caninum sheep model that closely resembles
naturally acquired Neospora-induced cattle abortion has also been
demonstrated. Buxton et al., 1997, J. Comp. Path. 117:1-16.
[0005] In T. gondii, electron dense granules comprising an
excretory-secretory group of antigens are present in the cytoplasm
of tachyzoites. These antigens have been designated as GRA
proteins. The GRA1 protein of T. gondii has been reported to have a
molecular weight ranging from about 22-27 kDa, and the GRA2 protein
of T. gondii has been reported to have a molecular weight of about
28 kDa. Sam-Yellowe, 1996, Parasitol. Today 12:308-315. Similar
electron dense granules are present in the cytoplasm of N. caninum
tachyzoites (Bjerkas et al., 1994, Clin. Diag. Lab. Immunol.
1:214-221; Hemphill et al., 1998, Intl. J. Parasitol.
28:429438).
[0006] T. gondii cells are also known to comprise a group of major
surface antigens that have been designated as SAG. The SAG1 protein
of T. gondii is reported to have a molecular weight of about 30
kDa. Kasper et al., 1983, J. Immunol. 130:2407-2412. Monoclonal
antibodies directed against T. gondii SAG1 protein significantly
blocked the ability of T. gondii tachyzoites to invade bovine
kidney cells under tissue culture conditions. Grimwood and Smith,
1996, Intl. J. Parasitol. 26: 169-173. Because T. gondii SAG1
appears to play a role in the invasion process, it has been
hypothesized that SAG1 may be necessary to support the virulence
phenotype. Windeck and Gross, 1996, Parasitol. Res. 82:715-719.
Consistent with this hypothesis is the observation that mice
immunized with T. gondii SAG1 protein and then challenged with T.
gondii had reduced toxoplasma cyst formation in their brains than
did control mice. Debard et al., 1996, Infect. Immun.,
64:2158-2166. T. gondii SAG1 may be functionally related to a
similar molecule in N. caninum designated as NC-p36 described by
Hemphill et al., 1997, Parasitol. 115:371-380.
[0007] Micronemes are intracelluar organelles located at the apical
end of tachyzoites of both T. gondii and Neospora, and may play a
role in host cell recognition and attachment to the host cell
surface during invasion. Formaux et al., 1996, Curr. Top.
Microbiol. Immunol. 219:55-58. At least 4 different
microneme-associated (MIC) proteins have been identified in T.
gondii. The MIC1 protein of T. gondii is about 60 kDa, binds to the
surface of host cells, and has been reported to have partial
homology to thrombospondin-related adhesive protein (TRAP) from
Plasmodium falciparum which binds to human hepatocytes. Robson et
al. 1995 EMBO J. 14:3883-3894.
[0008] The conversion of parasites from tachyzoites to bradyzoites
is critical for chronic infection and persistence of T. gondii. A
gene expressing an immunodominant, bradyzoite-specific 65 kD
antigen, designated as MAG1, has been identified in T. gondii.
Parmley et al., 1994, Mol. Biochem. Parasitol. 66:283-296. MAG1 has
been reported to be specifically expressed in bradyzoite cysts, but
not in the tachyzoite stage. This specificity of expression may
indicate the involvement of MAG1 in the conversion between
tachyzoite and bradyzoite stages of the life cycle of the parasite.
Bohne et al., 1996, Curr. Topics Microbiol. Immunol. 219:81-91.
[0009] Identification in Neospora of protein homologs of T. gondii
GRA1, GRA2, SAG1, MIC1, and MAG1 proteins, and the nucleotide
sequence of polynucleotide molecules encoding said Neospora
proteins, will serve to facilitate the development of vaccines
against neosporosis, as well as diagnostic reagents.
3. SUMMARY OF THE INVENTION
[0010] The present invention provides an isolated polynucleotide
molecule comprising a nucleotide sequence encoding the GRA1 protein
from N. caninum. In a preferred embodiment, the GRA1 protein has
the amino acid sequence of SEQ ID NO: 2. In a further preferred
embodiment, the isolated GRA1-encoding polynucleotide molecule of
the present invention comprises a nucleotide sequence selected from
the group consisting of the nucleotide sequence of SEQ ID NO: 1
from about nt 205 to about nt 777, the nucleotide sequence of the
open reading frame (ORF) of the GRA1 gene, which is presented in
SEQ ID NO: 3 from about nt 605 to about nt 1304, and the nucleotide
sequence of the GRA1-encoding ORF of plasmid pRC77 (ATCC 209685).
In a non-limiting embodiment, the isolated GRA1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3. The present
invention further provides an isolated polynucleotide molecule
having a nucleotide sequence that is homologous to the nucleotide
sequence of a GRA1-encoding polynucleotide molecule of the present
invention. The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence that
encodes a polypeptide that is homologous to the GRA1 protein of N.
caninum. The present invention further provides a polynucleotide
molecule consisting of a nucleotide sequence that is a substantial
portion of any of the aforementioned GRA1-related polynucleotide
molecules.
[0011] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the GRA2 protein from N. caninum. In a preferred embodiment, the
GRA2 protein has the amino acid sequence of SEQ ID NO: 5. In a
further preferred embodiment, the isolated GRA2-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of the ORF of SEQ ID NO: 4, which is from about
nt 25 to about nt 660, and the nucleotide sequence of the
GRA2-encoding ORF of plasmid pRC5 (ATCC 209686). In a non-limiting
embodiment, the isolated GRA2-encoding polynucleotide molecule of
the present invention comprises the nucleotide sequence of SEQ ID
NO: 4. The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a GRA2-encoding
polynucleotide molecule of the present invention. The present
invention further provides an isolated polynucleotide molecule
comprising a nucleotide sequence that encodes a polypeptide that is
homologous to the GRA2 protein of N. caninum. The present invention
further provides a polynucleotide molecule consisting of a
nucleotide sequence that is a substantial portion of any of the
aforementioned, GRA2-related polynucleotide molecules,
[0012] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the SAG1 protein from N. caninum. In a preferred embodiment, the
SAG1 protein has the amino acid sequence of SEQ ID NO: 7. In a
further preferred embodiment, the isolated SAG1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of the ORF of SEQ ID NO: 6, which is from about
nt 130 to about nt 1089, and the nucleotide sequence of the
SAG1-encoding ORF of plasmid pRC102 (ATCC 209687). In a
non-limiting embodiment, the isolated SAG1-encoding polynucleotide
molecule of the present invention comprises the nucleotide sequence
of SEQ ID NO: 6. The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a SAG1-encoding
polynucleotide molecule of the present invention. The present
invention further provides an isolated polynucleotide molecule
comprising a nucleotide sequence that encodes a polypeptide that is
homologous to the SAG1 protein of N. caninum. The present invention
further provides a polynucleotide molecule consisting of a
nucleotide sequence that is a substantial portion of any of the
aforementioned SAG1-related polynucleotide molecules.
[0013] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the MIC1 protein from N. caninum. In a preferred embodiment, the
MIC1 protein has the amino acid sequence of SEQ ID NO: 9. In a
further preferred embodiment, the isolated MIC1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of the ORF of SEQ ID NO: 8 from about nt 138 to
about nt 1520, the nucleotide sequence of the ORF of the MIC1 gene,
which is presented as SEQ ID NO: 10, and the nucleotide sequence of
the MIC1-encoding ORF of plasmid pRC340 (ATCC 209688). In a
non-limiting embodiment, the isolated MIC1-encoding polynucleotide
molecule of the present invention comprises a nucleotide sequence
selected from the group consisting of the nucleotide sequence of
SEQ ID NO: 8, and the nucleotide sequence of SEQ ID NO: 10. The
present invention further provides an isolated polynucleotide
molecule having a nucleotide sequence that is homologous to the
nucleotide sequence of a MIC1-encoding polynucleotide molecule of
the present invention. The present invention further provides an
isolated polynucleotide molecule comprising a nucleotide sequence
that encodes a polypeptide that is homologous to the MIC1 protein
of N. caninum. The present invention further provides a
polynucleotide molecule consisting of a nucleotide sequence that is
a substantial portion of any of the aforementioned MIC1-related
polynucleotide molecules.
[0014] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the MAG1 protein from N. caninum. The MAG1 protein has a putative
amino acid sequence shown in SEQ ID NO: 13. In a preferred
embodiment, the isolated MAG1-encoding polynucleotide molecule of
the present invention comprises a nucleotide sequence selected from
the group consisting of the nucleotide sequence presented in SEQ ID
NO: 11 from about nt 1305 to about nt 2786, a cDNA molecule
prepared therefrom, such as a cDNA molecule having the ORF of SEQ
ID NO: 12 from about nt 122 to about nt 1381, and the nucleotide
sequence of the MAG1-encoding ORF present in plasmid bd304 (ATCC
203413). The present invention further provides a polynucleotide
molecule having a nucleotide sequence of any ORF present in SEQ ID
NO: 11. In a non-limiting embodiment, the isolated MAG1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 11 and SEQ ID NO: 12. The present invention further provides an
isolated polynucleotide molecule having a nucleotide sequence that
is homologous to the nucleotide sequence of a MAG1-encoding
polynucleotide molecule of the present invention. The present
invention further provides an isolated polynucleotide molecule
comprising a nucleotide sequence that encodes a polypeptide that is
homologous to the MAG1 protein of N. caninum. The present invention
further provides a polynucleotide molecule consisting of a
nucleotide sequence that is a substantial portion of any of the
aforementioned MAG1-related polynucleotide molecules.
[0015] The present invention further provides a polynucleotide
molecule comprising the nucleotide sequence of the promoters of the
N. caninum GRA1 and MAG1 genes, which is presented in SEQ ID NO: 11
from about nt 127 to about nt 703, and includes its complementary
sequence.
[0016] The present invention further provides oligonucleotide
molecules that hybridize to any of the polynucleotide molecules of
the present invention, or that hybridize to a polynucleotide
molecule having a nucleotide sequence that is the complement of any
of the polynucleotide molecules of the present invention.
[0017] The present invention further provides compositions and
methods for cloning and expressing any of the polynucleotide
molecules of the present invention, including recombinant cloning
vectors, recombinant expression vectors, transformed host cells
comprising any of said vectors, and novel strains or cell lines
derived therefrom. More particularly, the present invention
provides a recombinant vector comprising a polynucleotide molecule
having a nucleotide sequence encoding the GRA1, GRA2, SAG1, MIC1 or
MAG1 protein of N. caninum. In specific, though non-limiting,
embodiments, the present invention provides plasmid pRC77 (ATCC
209685) encoding GRA1; plasmid pRC5 (ATCC 209686) encoding GRA2;
plasmid pRC102 (ATCC 209687) encoding SAG1; plasmid pRC340 (ATCC
209688) encoding MIC1; and plasmid bd304 (ATCC 203413) comprising
the MAG1 gene sequence and the MAG1/GRA1 bidirectional promoter
region.
[0018] The present invention further provides a substantially
purified or isolated N. caninum polypeptide selected from the group
consisting of GRA1, GRA2, SAG1, MIC1 and MAG1 proteins. In a
preferred embodiment, the N. caninum GRA1 protein has the amino
acid sequence of SEQ ID NO: 2. In another preferred embodiment, the
N. caninum GRA2 protein has the amino acid sequence of SEQ ID NO:
5. In another preferred embodiment, the N. caninum SAG1 protein has
the amino acid sequence of SEQ ID NO: 7. In another preferred
embodiment, the N. caninum MIC1 protein has the amino acid sequence
of SEQ ID NO: 9. In another preferred embodiment, the N. caninum
MAG1 protein has the amino acid sequence of SEQ ID NO: 13. The
present invention further provides substantially purified or
isolated polypeptides that are homologous to any of the
aforementioned N. caninum proteins. The present invention further
provides polypeptides which are fusion proteins comprising any of
the aforementioned polypeptides fused to a carrier or fusion
partner, as known in the art. The present invention further
provides polypeptides consisting of a substantial portion of any of
the aforementioned polypeptides. The polypeptides of the present
invention are useful both in vaccine compositions to protect
mammals against neosporosis and as diagnostic reagents.
[0019] The present invention further provides a method of preparing
any of the aforementioned polypeptides, comprising culturing host
cells transformed with a recombinant expression vector, said vector
comprising a polynucleotide molecule comprising a nucleotide
sequence encoding any of the aforementioned polypeptides, wherein
the nucleotide sequence is in operative association with one or
more regulatory elements, under conditions conducive to the
expression of the polypeptide, and recovering the expressed
polypeptide from the cell culture.
[0020] The present invention further provides antibodies
specifically directed against a N. caninum GRA1, GRA2, SAG1, MIC1
or MAG1 protein.
[0021] The present invention further provides genetic constructs
for use in mutating a Neospora GRA1, GRA2, SAG1, MIC1 or MAG1 gene
to produce modified Neospora cells. Such modified Neospora cells
are useful in vaccine compositions to protect mammals against
neosporosis. In a preferred though non-limiting embodiment, a
genetic construct of the present invention comprises a
polynucleotide molecule comprising a nucleotide sequence that is
otherwise the same as a nucleotide sequence encoding a GRA1, GRA2,
SAG1, MIC1 or MAG1 protein from N. caninum, or a substantial
portion thereof, but that further comprises one or more mutations,
i e., one or more nucleotide deletions, insertions and/or
substitutions, that can serve to mutate the gene. Once transformed
into cells of Neospora, the polynucleotide molecule of the genetic
construct is specifically targeted, e.g., by homologous
recombination, to the particular Neospora gene, and either deletes
or replaces the gene or a portion thereof, or inserts into the
gene. As a result of this recombination event, the Neospora gene is
mutated. The resulting mutated gene is preferably partially or
fully disabled in that it encodes either a partially defective or
fully defective protein, or fails to encode a protein. The present
invention further provides Neospora cells which have been modified
by one or more of said gene mutations, and methods of preparing
modified Neospora cells using a genetic construct of the present
invention.
[0022] The present invention further provides a vaccine against
neosporosis, comprising an immunologically effective amount of a
polypeptide of the present invention, or an immunologically
effective amount of a polynucleotide molecule of the present
invention, or an immunologically effective amount of modified
Neospora cells of the present invention; and a veterinarily
acceptable carrier. In a preferred embodiment, the vaccine of the
present invention comprises modified live cells of N. caninum that
express a GRA1.sup.-, GRA2.sup.-, SAG1.sup.-, MIC1.sup.- or
MAG1.sup.- phenotype, or a combination of said phenotypes. In a
non-limiting embodiment, the vaccine is a combination vaccine for
protecting a mammal against neosporosis and, optionally, one or
more other diseases or pathological conditions that can afflict the
mammal, which combination vaccine comprises an immunologically
effective amount of a first component comprising a polypeptide,
polynucleotide molecule, or modified Neospora cells of the present
invention; an immunologically effective amount of a second
component that is different from the first component, and that is
capable of inducing, or contributing to the induction of, a
protective response against a disease or pathological condition
that can afflict the mammal; and a veterinarily acceptable
carrier.
[0023] The present invention further provides a method of preparing
a vaccine against neosporosis, comprising combining an
immunologically effective amount of a N. caninum polypeptide of the
present invention, or an immunologically effective amount of a
polynucleotide molecule of the present invention, or an
immunologically effective amount of modified Neospora cells of the
present invention, with a veterinarily acceptable carrier, in a
form suitable for administration to a mammal.
[0024] The present invention further provides a method of
vaccinating a mammal against neosporosis, comprising administering
to the mammal an immunologically effective amount of a vaccine of
the present invention.
[0025] The present invention further provides a kit for vaccinating
a mammal against neosporosis, comprising a first container having
an immunologically effective amount of a polypeptide of the present
invention, or an immunologically effective amount of a
polynucleotide molecule of the present invention, or an
immunologically effective amount of modified Neospora cells of the
present invention; and a second container having a veterinarily
acceptable carrier or diluent.
4. DETAILED DESCRIPTION OF THE INVENTION
[0026] 4.1. Polynucleotide Molecules
[0027] An isolated polynucleotide molecule of the present invention
can have a nucleotide sequence derived from any species or strain
of Neospora, but is preferably from a pathogenic species of
Neospora such as N. caninum. A non-limiting example of a strain of
N. caninum from which a polynucleotide molecule of the present
invention can be isolated or derived is strain NC-1, which is
available in host MARC-145 monkey kidney cells under Accession No.
CRL-12231 from the American Type Culture Collection (ATCC), located
at 10801 University Blvd, Manassas, Va., 20110, USA. Strain NC-1 is
also described in Dubey et al., 1988, J. Am. Vet. Med. Assoc.
193:1259-63, which publication is incorporated herein by reference.
Alternatively, pathogenic strains or species of Neospora for use in
practicing the present invention can be isolated from organs,
tissues or body fluids of infected animals using standard isolation
techniques such as those described in the publications reviewed
above.
[0028] As used herein, the terms "polynucleotide molecule,"
"polynucleotide sequence." "coding sequence," "open-reading frame
(ORF)," and the like, are intended to refer to both DNA and RNA
molecules, which can either be single-stranded or double-stranded,
and that can include one or more prokaryotic sequences, cDNA
sequences, genomic DNA sequences including exons and introns, and
chemically synthesized DNA and RNA sequences, and both sense and
corresponding anti-sense strands. As used herein, the term "ORF"
refers to the minimal nucleotide sequence required to encode a
particular Neospora protein, i.e., either a GRA1, GRA2, SAG1, MIC1
or MAG1 protein, without any intervening termination codons.
[0029] Production and manipulation of the polynucleotide molecules
and oligonucleotide molecules disclosed herein are within the skill
in the art and can be carried out according to recombinant
techniques described, among other places, in Maniatis et al., 1989,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al., 1989,
Current Protocols In Molecular Biology, Greene Publishing
Associates & Wiley Interscience, NY; Sambrook et al., 1989,
Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.; Innis et al. (eds),
1995, PCR Strategies, Academic Press, Inc., San Diego; and Erlich
(ed), 1992, PCR Technology, Oxford University Press, New York, all
of which are incorporated herein by reference.
[0030] 4.1.1. GRA1-Related Polynucleotide Molecules
[0031] References herein below to the nucleotide sequences shown in
SEQ ID NOS: 1 and 3, and to substantial portions thereof, are
intended to also refer to the corresponding nucleotide sequences
and substantial portions thereof, respectively, as present in
plasmid pRC77 (ATCC 209685), unless otherwise indicated. In
addition, references herein below to the amino acid sequences shown
in SEQ ID NO: 2, and to substantial portions and peptide fragments
thereof, are intended to also refer to the corresponding amino acid
sequences, and substantial portions and peptide fragments thereof,
respectively, encoded by the corresponding GRA1-encoding nucleotide
sequence present in plasmid pRC77 (ATCC 209685), unless otherwise
indicated.
[0032] The present invention provides an isolated polynucleotide
molecule comprising a nucleotide sequence encoding the GRA1 protein
from N. caninum. In a preferred embodiment, the GRA1 protein has
the amino acid sequence of SEQ ID NO: 2. In a further preferred
embodiment, the isolated GRA1-encoding polynucleotide molecule of
the present invention comprises a nucleotide sequence selected from
the group consisting of the nucleotide sequence of SEQ ID NO: 1
from about nt 205 to about nt 777, the nucleotide sequence of the
open reading frame (ORF) of the GRA1 gene, which is presented in
SEQ ID NO: 3 from about nt 605 to about nt 1304, and the nucleotide
sequence of the GRA1-encoding ORF of plasmid pRC77 (ATCC 209685):
In a non-limiting embodiment, the isolated GRA1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from, the group consisting of the
nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3. The GRA1 gene
presented in SEQ ID NO: 3 comprises an ORF from nt 605 to nt 855
and from nt 983 to nt 1304 with an intervening intron extending
from nt 856 to nt 982. In addition, putative promoter motifs have
been identified within 150 bp 5' of the mRNA start site that are
similar to those found in T. gondii GRA genes (see Section 5.3,
below).
[0033] The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a GRA1-encoding
polynucleotide molecule of the present invention. The term
"homologous" when used to refer to a GRA1-related polynucleotide
molecule means a polynucleotide molecule having a nucleotide
sequence: (a) that encodes the same protein as one of the
aforementioned GRA1-encoding polynucleotide molecules of the
present invention, but that includes one or more silent changes to
the nucleotide sequence according to the degeneracy of the genetic
code; or (b) that hybridizes to the complement of a polynucleotide
molecule having a nucleotide sequence that encodes the amino acid
sequence of the N. caninum GRA1 protein, under moderately stringent
conditions, i.e., hybridization to filter-bound. DNA in 0.5 M
NaHPO.sub.4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at
65.degree. C., and washing in 0.2.times.SSC/0.1% SDS at 42.degree.
C. (see Ausubel et al. (eds.), 1989, Current Protocols in Molecular
Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley
& Sons, Inc., New York, at p. 2.10.3), and that is useful in
practicing the present invention. In a preferred embodiment, the
homologous polynucleotide molecule hybridizes to the complement of
a polynucleotide molecule having a nucleotide sequence that encodes
the amino acid sequence of the N. caninum GRA1 protein under highly
stringent conditions, i.e., hybridization to filter-bound DNA in
0.5 M NaHPO.sub.4, 7% SDS, 1 mM EDTA at 65.degree. C., and washing
in 0.1.times.SSC/0.1% SDS at68.degree. C. (Ausubel et al., 1989,
above), and is useful in practicing the present invention. In a
more preferred embodiment, the homologous polynucleotide molecule
hybridizes under highly stringent conditions to the complement of a
polynucleotide molecule consisting of a nucleotide sequence
selected from the group consisting of the ORF of SEQ ID NO: 1,
which is from about nt 205 to about nt 777, and the ORF of the GRA1
gene, which is presented in SEQ ID NO: 3 from about nt 605 to about
nt 1304, and which is useful in practicing the present
invention.
[0034] As used herein, a polynucleotide molecule is "useful in
practicing the present invention" where the polynucleotide molecule
can be used to amplify a Neospora-specific polynucleotide molecule
using standard amplification techniques, or as a diagnostic reagent
to detect the presence of a Neospora-specific polynucleotide in a
fluid or tissue sample from a Neospora-infected animal;
[0035] Polynucleotide molecules of the present invention having
nucleotide sequences that are homologous to the nucleotide sequence
of a GRA1-encoding polynucleotide molecule of the present invention
do not include polynucleotide molecules having the native
nucleotide sequence of T. gondii encoding a T. gondii GRA protein,
and further have no more than about 90%, and preferably no more
than about 80%, sequence identity to such a T. gondii
polynucleotide molecule, wherein sequence identity is determined by
use of the BLASTN algorithm (GenBank, National Center for
Biotechnology Information).
[0036] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence that
encodes a polypeptide that is homologous to the N. caninum GRA1
protein. As used herein to refer to polypeptides that are
homologous to the N. caninum GRA1 protein, the term "homologous"
refers to a polypeptide otherwise having the amino acid sequence of
the N. caninum GRA1 protein, but in which one or more amino acid
residues have been conservatively substituted with a different
amino acid residue, where the resulting polypeptide is useful in
practicing the present invention. Conservative amino acid
substitutions are well-known in the art. Rules for making such
substitutions include those described by Dayhof, M. D., 1978, Nat.
Biomed. Res. Found., Washington, D.C., Vol. 5, Sup. 3, among
others. More specifically, conservative amino acid substitutions
are those that generally take place within a family of amino acids
that are related in acidity, polarity, or bulkiness of their side
chains. Genetically encoded amino acids are generally divided into
fours groups: (1) acidic=aspartate, glutamate: (2) basic=lysine,
arginine, histidine; (3) non-polar=alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan; and (4)
uncharged polar=glycine, asparagine, glutamine, cysteine, serine,
threonine, tyrosine. Phenylalanine, tryptophan and tyrosine are
also jointly classified as aromatic amino acids. One or more
replacements within any particular group, e.g., of a leucine with
an isoleucine or valine, or of an aspartate with a glutamate, or of
a threonine with a serine, or of any other amino acid residue with
a structurally related amino acid residue, e.g., an amino acid
residue with similar acidity, polarity, bulkiness of side chain, or
with similarity in some combination thereof, will generally have an
insignificant effect on the function or immunogenicity of the
polypeptide. In a preferred embodiment, the homologous polypeptide
has at least about 70%, more preferably at least about 80%, and
most preferably at least about 90% sequence identity to SEQ ID NO:
2.
[0037] As used herein, a polypeptide is "useful in practicing the
present invention" where the polypeptide can be used as a
diagnostic reagent to detect the presence of Neospora-specific
antibodies in a blood or serum sample from an animal that is
currently infected, or that has been infected, with Neospora.
[0038] The present invention further provides a polynucleotide
molecule consisting of a substantial portion of any of the
aforementioned Neospora GRA1-related polynucleotide molecules of
the present invention. As used herein, a "substantial portion" of a
GRA1-related polynucleotide molecule means a polynucleotide
molecule consisting of less than the complete nucleotide sequence
of the GRA1-related polynucleotide molecule, but comprising at
least about 5%, more preferably at least about 10%, and most
preferably at least about 20%, of the nucleotide sequence of the
GRA1-related polynucleotide molecule, and that is useful in
practicing the present invention, as usefulness is defined above
for polynucleotide molecules.
[0039] In addition to the nucleotide sequences of any of the
aforementioned GRA1-related polynucleotide molecules,
polynucleotide molecules of the present invention can further
comprise, or alternatively may consist of, nucleotide sequences
selected from those that naturally flank the GRA1 ORF or gene in
situ in N. caninum, and include the nucleotide sequences shown in
SEQ ID NO: 1 from about nt 1 to about nt 204 and from about nt 778
to about nt 1265, or as shown in SEQ ID NO: 3 from about nt 1 to
about nt 604, and from about nt 1305 to about nt 1774, or
substantial portions thereof.
[0040] 4.1.2. GRA2-Related Polynucleotide Molecules
[0041] References herein below to the nucleotide sequence shown in
SEQ ID NO: 4, and to substantial portions thereof, are intended to
also refer to the corresponding nucleotide sequence and substantial
portions thereof, respectively, as present in plasmid pRC5 (ATCC
209686), unless otherwise indicated. In addition, references herein
below to the amino acid sequence shown in SEQ ID NO: 5, and to
substantial portions and peptide fragments thereof, are intended to
also refer to the corresponding amino acid sequence, and
substantial portions and peptide fragments thereof, respectively,
encoded by the corresponding GRA2-encoding nucleotide sequence
present in plasmid pRC5 (ATCC 209686), unless otherwise
indicated.
[0042] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the GRA2 protein from N. caninum. In a preferred embodiment, the
GRA2 protein has the amino acid sequence of SEQ ID NO: 5. In a
further preferred embodiment, the isolated GRA2-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of the ORF of SEQ, ID NO: 4, which is from
about nt 25 to about nt 660, and the nucleotide sequence of the
GRA2-encoding ORF of plasmid pRC5 (ATCC 209686). In a non-limiting
embodiment, the isolated GRA2-encoding polynucleotide molecule of
the present invention comprises the nucleotide sequence of SEQ ID
NO: 4.
[0043] The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a GRA2-encoding
polynucleotide molecule of the present invention. The term
"homologous" when used to refer to a GRA2-related polynucleotide
molecule means a polynucleotide molecule having a nucleotide
sequence: (a) that encodes the same protein as one of the
aforementioned GRA2-encoding polynucleotide molecules of the
present invention, but that includes one or more silent changes to
the nucleotide sequence according to the degeneracy of the genetic
code; or (b) that hybridizes to the complement of a polynucleotide
molecule having a nucleotide sequence that encodes the amino acid
sequence of the N. caninum GRA2 protein, under moderately stringent
conditions, i.e., hybridization to filter-bound DNA in 0.5 M
NaHPO.sub.4, 7% SDS, 1 mM EDTA at 65.degree. C., and washing in
0.2.times.SSC/0.1% SDS at 42.degree. C. (Ausubel et al., 1989,
above), and that is useful in practicing the present invention, as
usefulness is defined above for polynucleotide molecules. In a
preferred embodiment, the homologous polynucleotide molecule
hybridizes to the complement of a polynucleotide molecule having a
nucleotide sequence that encodes the amino acid sequence of the N.
caninum GRA2 protein under highly stringent conditions, i.e.,
hybridization to filter-bound DNA in 0.5 M NaHPO.sub.4, 7% SDS, 1
mM EDTA at 65.degree. C., and washing in 0.1.times.SSC/0.1%/ SOS
at68.degree. C. (Ausubel et al., 1989, above), and is useful in
practicing the present invention. In a more preferred embodiment,
the homologous polynucleotide molecule hybridizes under highly
stringent conditions to the complement of a polynucleotide molecule
consisting of the nucleotide sequence of the ORF of SEQ ID NO: 4,
which is from about nt 25 to about nt 660, and is useful in
practicing the present invention.
[0044] Polynucleotide molecules of the present invention having
nucleotide sequences that are homologous to the nucleotide sequence
of a GRA2-encoding polynucleotide molecule of the present invention
do not include polynucleotide molecules having the native
nucleotide sequence of T. gondii encoding a T. gondii GRA protein,
and further have no more than about 90%, and preferably no more
than about 80%, sequence identity to such a T. gondii
polynucleotide molecule, wherein sequence identity is determined by
use of the BLASTN algorithm (GenBank NCBI).
[0045] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence that
encodes a polypeptide that is homologous to the N. caninum GRA2
protein. As used herein to refer to polypeptides that are
homologous to the N. caninum GRA2 protein, the term "homologous"
refers to a polypeptide otherwise having the amino acid sequence of
the N. caninum GRA2 protein, but in which one or more amino acid
residues have been conservatively substituted with a different
amino acid residue, as defined above, where the resulting
polypeptide is useful in practicing the present invention, as
usefulness is defined above for polypeptides. In a preferred
embodiment, the homologous polypeptide has at least about 70%, more
preferably at least about 80%, and most preferably at least about
90% sequence identity to SEQ ID NO: 5.
[0046] The present invention further provides a polynucleotide
molecule consisting of a substantial portion of any of the
aforementioned Neospora GRA2-related polynucleotide molecules of
the present invention. As used herein, a substantial portion of a
GRA2-related polynucleotide molecule means a polynucleotide
molecule consisting of less than the complete nucleotide sequence
of the GRA2-related polynucleotide molecule, but comprising at
least about 5%, more preferably at least about 10%, and most
preferably at least about 20%, of the nucleotide sequence of the
GRA2-related polynucleotide molecule, and that is useful in
practicing the present invention, as usefulness is defined above
for polynucleotide molecules.
[0047] In addition to the nucleotide sequences of any of the
aforementioned GRA2-related polynucleotide molecules,
polynucleotide molecules of the present invention can further
comprise, or alternatively may consist of, nucleotide sequences
that naturally flank the GRA2 gene or ORF in situ in N. caninum,
and include the flanking nucleotide sequences shown in SEQ ID NO: 4
from about nt 1 to about nt 24, and from about nt 661 to about nt
1031, or substantial portions thereof.
[0048] 4.1.3. SAG1-Related Polynucleotide Molecules
[0049] References herein below to the nucleotide sequence shown in
SEQ ID NO: 6, and to substantial portions thereof, are intended to
also refer to the corresponding nucleotide sequence and substantial
portions thereof, respectively, as present in plasmid pRC102 (ATCC
209687), unless otherwise indicated. In addition, references herein
below to the amino acid sequence shown in SEQ ID NO: 7, and to
substantial portions and peptide fragments thereof, are intended to
also refer to the corresponding amino acid sequence, and
substantial portions and peptide fragments thereof, respectively,
encoded by the corresponding SAG1-encoding nucleotide sequence
present in plasmid pRC102 (ATCC 209687), unless otherwise
indicated.
[0050] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the SAG1 protein from N. caninum. In a preferred embodiment, the
SAG1 protein has the amino acid sequence of SEQ ID NO: 7. In a
further preferred embodiment, the isolated SAG1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of the ORF of SEQ ID NO: 6, which is from about
nt 130 to about nt 1089, and the nucleotide sequence of the
SAG1-encoding ORF of plasmid pRC102 (ATCC 209687). In a
non-limiting embodiment, the isolated SAG1-encoding polynucleotide
molecule of the present invention comprises the nucleotide sequence
of SEQ ID NO: 6.
[0051] The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a SAG1-encoding
polynucleotide molecule of the present invention. The term
"homologous" when used to refer to a SAG1-related polynucleotide
molecule means a polynucleotide molecule having a nucleotide
sequence: (a) that encodes the same protein as one of the
aforementioned SAG1-encoding polynucleotide molecules of the
present invention, but that includes one or more silent changes to
the nucleotide sequence according to the degeneracy of the genetic
code; or (b) that hybridizes to the complement of a polynucleotide
molecule having a nucleotide sequence that encodes the amino acid
sequence of the N. caninum SAG1 protein, under moderately stringent
conditions, i.e., hybridization to filter-bound DNA in 0.5 M
NaHPO.sub.4, 7% SDS, 1 mM EDTA at 65.degree. C., and washing in
0.2.times.SSC/0.1% SDS at 42.degree. C. (Ausubel et al., 1989,
above), and that is useful in practicing the present invention, as
usefulness is defined above for polynucleotide molecules: In a
preferred embodiment, the homologous polynucleotide molecule
hybridizes to the complement of a polynucleotide molecule having a
nucleotide sequence that encodes the amino acid sequence of the N.
caninum SAG1 protein under highly stringent conditions, i.e.,
hybridization to filter-bound DNA in 0.5 M NaHPO.sub.4, 7% SDS, 1
mM EDTA at 65.degree. C., and washing in 0.1.times.SSC/0.1% SDS at
68.degree. C. (Ausubel et al., 1989, above), and is useful in
practicing the present invention. In a more preferred embodiment,
the homologous polynucleotide molecule hybridizes under highly
stringent conditions to the complement of a polynucleotide molecule
consisting of the nucleotide sequence of the ORF of SEQ ID NO: 6,
which is from about nt 130 to about nt 1089, and is useful in
practicing the present invention.
[0052] Polynucleotide molecules of the present invention having
nucleotide sequences that are homologous to the nucleotide sequence
of a SAG1-encoding polynucleotide molecule of the present invention
do not include polynucleotide molecules having the native
nucleotide sequence of T. gondii encoding a T. gondii SAG1 protein,
and further have no more than about 90%, and preferably no more
than about 80%, sequence identity to such a T. gondii
polynucleotide molecule, wherein sequence identity is determined by
use of the BLASTN algorithm (GenBank, NCBI).
[0053] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence that
encodes a polypeptide that is homologous to the N. caninum SAG1
protein. As used herein to refer to polypeptides that are
homologous to the N. caninum SAG1 protein, the term "homologous"
refers to a polypeptide otherwise having the amino acid sequence of
the N. caninum SAG1 protein, but in which one or more amino acid
residues have been conservatively substituted with a different
amino acid residue, as defined above, where the resulting
polypeptide is useful in practicing the present invention, as
usefulness is defined above for polypeptides. In a preferred
embodiment, the homologous polypeptide has at least about 70%,.
more preferably at least about 80%, and most preferably at least
about 90% sequence identity to SEQ ID NO: 7.
[0054] The present invention further provides a polynucleotide
molecule consisting of a substantial portion of any of the
aforementioned Neospora SAG1-related polynucleotide molecules of
the present invention. As used herein, a "substantial portion" of a
SAG1-related polynucleotide molecule means a polynucleotide
molecule consisting of less than the complete nucleotide sequence
of the SAG1-related polynucleotide molecule, but comprising at
least about 5%, more preferably at least about 10%, and most
preferably at least about 20%, of the nucleotide sequence of the
SAG1-related polynucleotide molecule, and that is useful in
practicing the present invention, as usefulness is defined above
for polynucleotide molecules.
[0055] In addition to the nucleotide sequences of any of the
aforementioned SAG1-related polynucleotide molecules,
polynucleotide molecules of the present invention can further
comprise, or alternatively may consist of, nucleotide sequences
that naturally flank the SAG1 gene or ORF in situ in N. caninum,
and include the flanking nucleotide sequences shown in SEQ ID NO: 6
from about nt 1 to about nt 129 and from about nt 1090 to about nt
1263, or substantial portions thereof.
[0056] 4.1.4. MIC1-Related Polynucleotide Molecules
[0057] References herein below to the nucleotide sequences shown in
SEQ ID NOS: 8 and 10, and to substantial portions thereof, are
intended to also refer to the corresponding nucleotide sequences
and substantial portions thereof, respectively, as present in
plasmid pRC340 (ATCC 209688), unless otherwise indicated. In
addition, references herein below to the amino acid sequences shown
in SEQ ID NO: 9, and to substantial portions and peptide fragments
thereof, are intended to also refer to the corresponding amino acid
sequences, and substantial portions and peptide fragments thereof,
respectively, encoded by the corresponding MIC1-encoding nucleotide
sequence present in plasmid pRC340 (ATCC 209688), unless otherwise
indicated.
[0058] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the MIC1 protein from N. caninum. In a preferred embodiment, the
MIC1 protein has the amino acid sequence of SEQ ID NO: 9. In a
further preferred embodiment, the isolated MIC1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of the ORF of SEQ ID NO: 8, which is from about
nt 138 to about nt 1520, the nucleotide sequence of the ORF of the
MIC1 gene, which is presented as SEQ ID NO: 10, and the nucleotide
sequence of the MIC1-encoding ORF of plasmid pRC340 (ATCC 209688).
In a non-limiting embodiment, the isolated MIC1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 10.
[0059] The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a MIC1-encoding
polynucleotide molecule of the present invention. The term
"homologous" when used to refer to a MIC1-related polynucleotide
molecule means a polynucleotide molecule having a nucleotide
sequence: (a) that encodes the same protein as one of the
aforementioned MIC1-encoding polynucleotide molecules of the
present invention, but that includes one or more silent changes to
the nucleotide sequence according to the degeneracy of the genetic
code; or (b) that hybridizes to the complement of a polynucleotide
molecule having a nucleotide sequence that encodes the amino acid
sequence of the N. caninum MIC1 protein, under moderately stringent
conditions, i.e., hybridization to filter-bound DNA in 0.5 M
NaHPO.sub.4, 7% SDS, 1 mM EDTA at 65.degree. C., and washing in
0.2.times.SSC/0.1% SDS at 42.degree. C. (Ausubel et al., 1989,
above), and that is useful in practicing the present invention, as
usefulness is defined above for polynucleotide molecules. In a
preferred embodiment, the homologous polynucleotide molecule
hybridizes to the complement of a polynucleotide molecule having a
nucleotide sequence that encodes the amino acid sequence of the N.
caninum MIC1 protein under highly stringent conditions, i.e.,
hybridization to filter-bound DNA in 0.5 M NaHPO.sub.4, 7% SDS, 1
mM EDTA at 65.degree. C., and washing in 0.1.times.SSC/0.1% SDS at
68.degree. C. (Ausubel etal., 1989, above), and is useful in
practicing the present invention. In a more preferred embodiment,
the homologous polynucleotide molecule hybridizes under highly
stringent conditions to the complement of a polynucleotide molecule
consisting of a nucleotide sequence selected from the group
consisting of the ORF of SEQ ID NO: 8 from about nt 138 to about nt
1520, and the ORF of the MIC1 gene, which is presented as SEQ ID
NO: 10, and is useful in practicing the present invention.
[0060] Polynucleotide molecules of the present invention having
nucleotide sequences that are homologous to the nucleotide sequence
of a MIC1-encoding polynucleotide molecule of the present invention
do not include polynucleotide molecules having the native
nucleotide sequence of T. gondii encoding a T. gondii MIC1 protein,
and further have no more than about 90%, and preferably no more
than about 80%, sequence identity to such a T. gondii
polynucleotide molecule, wherein sequence identity is determined by
use of the BLASTN algorithm (GenBank, NCBI).
[0061] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence that
encodes a polypeptide that is homologous to the N. caninum MIC1
protein. As used herein to refer to polypeptides that are
homologous to the N. caninum MIC1 protein, the term "homologous"
refers to a polypeptide otherwise having the amino acid sequence of
the N. caninum MIC1 protein; but in which one or more amino acid
residues have been conservatively substituted with a different
amino acid residue, as defined above, where the resulting
polypeptide is useful in practicing the present invention, as
usefulness is defined above for polypeptides. In a preferred
embodiment, the homologous polypeptide has at least about 70%, more
preferably at least about 80%, and most preferably at least about
90% sequence identity to SEQ ID NO: 9.
[0062] The present invention further provides a polynucleotide
molecule consisting of a substantial portion of any of the
aforementioned Neospora MIC1-related polynucleotide molecules of
the present invention. As used herein, a "substantial portion" of a
MIC1-related polynucleotide molecule means a polynucleotide
molecule consisting of less than the complete nucleotide sequence
of the MIC1-related polynucleotide molecule, but comprising at
least about 5%, more preferably at least about 10%, and most
preferably at least about 20%, of the nucleotide sequence of the
MIC1-related polynucleotide molecule, and that is useful in
practicing the present invention, as usefulness is defined above
for polynucleotide molecules.
[0063] In addition to the nucleotide sequences of any of the
aforementioned MIC1-related polynucleotide molecules,
polynucleotide molecules of the present invention can further
comprise, or alternatively may consist of, nucleotide sequences
that naturally flank the MIC1 ORF or gene in situ in N. caninum,
and include the nucleotide sequences as shown in SEQ ID NO: 8 from
about nt 1 to about 137, and from about nt 1521 to about nt 2069,
or substantial portions thereof.
[0064] 4.1.5. MAG1-Related Polynucleotide Molecules
[0065] References herein below to the nucleotide sequence shown in
SEQ ID NO: 11, and to substantial portions thereof, are intended to
also refer to the corresponding nucleotide sequences and
substantial portions thereof, respectively, as present in plasmid
bd304 (ATCC 203413), unless otherwise indicated. In addition,
references herein below to the amino acid sequence shown in SEQ ID
NO: 13, and to substantial portions and peptide fragments thereof;
are intended to also refer to the corresponding amino acid
sequence, and substantial portions and peptide fragments thereof,
respectively, encoded by the corresponding MAG1-encoding nucleotide
sequence present in plasmid bd304 (ATCC 203413), unless otherwise
indicated.
[0066] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence encoding
the MAG1 protein from N. caninum. In a preferred embodiment, the
MAG1 protein has the amino acid sequence of SEQ ID NO: 13. In a
further preferred embodiment, the isolated MAG1-encoding
polynucleotide molecule of the present invention comprises a
nucleotide sequence selected from the group consisting of the
nucleotide sequence presented in SEQ ID NO: 11 from about nt 1305
to about nt 2786, a cDNA molecule prepared therefrom, such as a
cDNA molecule having the ORF of SEQ ID NO: 12 from about nt 122 to
about nt 1381, and the nucleotide sequence of the MAG1-encoding ORF
present in plasmid bd304 (ATCC 203413). The present invention
further provides a polynucleotide molecule having a nucleotide
sequence of any ORF present in SEQ ID NO: 11. In a non-limiting
embodiment, the isolated MAG1-encoding polynucleotide molecule of
the present invention comprises a nucleotide sequence selected from
the group consisting of the nucleotide sequence of SEQ ID NO: 11
and a cDNA deduced therefrom based on the putative exon/intron
boundaries.
[0067] The present invention further provides an isolated
polynucleotide molecule having a nucleotide sequence that is
homologous to the nucleotide sequence of a MAG1-encoding
polynucleotide molecule of the present invention. The term
"homologous" when used to refer to a MAG1-related polynucleotide
molecule means a polynucleotide molecule having a nucleotide
sequence: (a) that encodes the same protein as one of the
aforementioned MAG1-encoding polynucleotide molecules of the
present invention, but that includes one or more silent changes to
the nucleotide sequence according to the degeneracy of the genetic
code; or (b) that hybridizes to the complement of a polynucleotide
molecule having a nucleotide sequence that encodes the amino acid
sequence of the N. caninum MAG1 protein, under moderately stringent
conditions, i.e., hybridization to filter-bound DNA in 0.5 M
NaHPO.sub.4, 7% SDS, 1 mM EDTA at 65.degree. C., and washing in
0.2.times.SSC/0.1% SDS at 42.degree. C. (Ausubel et al., 1989,
above), and that is useful in practicing the present invention, as
usefulness is defined above for polynucleotide molecules. In a
preferred embodiment, the homologous polynucleotide molecule
hybridizes to the complement of a polynucleotide molecule having a
nucleotide sequence that encodes the amino acid sequence of the N.
caninum MAG1 protein under highly stringent conditions, i.e.,
hybridization to filter-bound DNA in 0.5 M NaHPO.sub.4, 7% SDS, 1
mM EDTA at 65.degree. C., and washing in 0.1.times.SSC/0.1% SDS at
68.degree. C. (Ausubel etal., 1989, above), and is useful in
practicing the present invention. In a more preferred embodiment,
the homologous polynucleotide molecule hybridizes under highly
stringent conditions to the complement of a polynucleotide molecule
consisting of a nucleotide sequence selected: from the group
consisting of the nucleotide sequence of the ORF of the MAG1 gene,
which is presented in SEQ ID NO: 11 from about nt 1305 to about nt
2786 and a cDNA molecule prepared therefrom based on the putative
exon/intron boundaries, such as a cDNA molecule having the ORF of
SEQ ID NO: 12 from about nt 122 to about nt 1381, and is useful in
practicing the present invention.
[0068] Polynucleotide molecules of the present invention having
nucleotide sequences that are homologous to the nucleotide sequence
of a MAG1-encoding polynucleotide molecule of the present invention
do not include polynucleotide molecules having the native
nucleotide sequence of T. gondii encoding a T. gondii MAG1 protein,
and further have no more than about 90%, and preferably no more
than about 80%, sequence identity to such a T. gondii
polynucleotide molecule, wherein sequence identity is determined by
use of the BLASTN algorithm (GenBank, NCBI).
[0069] The present invention further provides an isolated
polynucleotide molecule comprising a nucleotide sequence that
encodes a polypeptide that is homologous to the N. caninum MAG1
protein. As used herein to refer to polypeptides that are
homologous to the N. caninum MAG1 protein, the term "homologous"
refers to a polypeptide otherwise having the amino acid sequence of
the N. caninum MAG1 protein, but in which one or more amino acid
residues have been conservatively substituted with a different
amino acid residue, as defined above, where the resulting
polypeptide is useful in practicing the present invention, as
usefulness is defined above for polypeptides. In a preferred
embodiment, the homologous polypeptide has at least about 70%, more
preferably at least about 80%, and most preferably at least about
90% sequence identity to SEQ ID NO: 13.
[0070] The present invention further provides a polynucleotide
molecule consisting of a substantial portion of any of the
aforementioned Neospora MAG 1-related polynucleotide molecules of
the present invention. As used herein, a "substantial portion" of a
MAG1-related polynucleotide molecule means a polynucleotide
molecule consisting of less than the complete nucleotide sequence
of the MAG1-related polynucleotide molecule, but comprising at
least about 5%, more preferably at least about 10%, and most
preferably at least about 20%, of the nucleotide sequence of the
MAG1-related polynucleotide molecule, and that is useful in
practicing the present invention, as usefulness is defined above
for polynucleotide molecules. For example, a substantial portion of
the polynucleotide molecule of SEQ ID NO: 11 can comprise putative
exon 1 from about nt 704 to about nt 820, or putative exon 2 from
about nt 1301 to about nt 1399, or putative exon 3 from about nt
1510 to about nt 1808, or putative exon 4 from about nt 1921 to
about nt 3297.
[0071] In addition to the nucleotide sequences of any of the
aforementioned MAG1-related polynucleotide molecules,
polynucleotide molecules of the present invention can further
comprise, or alternatively may consist of, nucleotide sequences
that naturally flank the MAG1 gene or ORF in situ in N. caninum,
and include the nucleotide sequences as shown in SEQ ID NO: 11 from
about nt 1 to about nt 1304, and from about nt 2787 to about nt
4242, or that naturally flank the ORF of a cDNA molecule prepared
therefrom based on the putative exon/intron boundaries, and include
flanking sequences of the ORF of a cDNA molecule having the ORF of
SEQ ID NO: 12, from about nt 1 to about nt 121, and from about nt
1382 to about nt 1892, or substantial portions thereof.
[0072] 4.2. Gra1/Mag1 Promoter Region
[0073] The present invention further provides a polynucleotide
molecule comprising the nucleotide sequence of the N. caninum GRA1
and MAG1 gene promoters. During the conduct of the experimental
work disclosed herein, it was determined that the N. caninum GRA1
and MAG1 genes disclosed herein are naturally arranged in situ in a
head-to-head orientation with an intervening nucleotide sequence of
about 577 nt in length. This intervening nucleotide sequence, which
is presented in SEQ ID NO: 11 from nt 127 to nt 703, represents a
putative bidirectional promoter region comprising the promoters of
both the N. caninum GRA1 and MAG1 genes.
[0074] The GRA1/MAG1 bidirectional promoter region of the present
invention, and functional portions thereof, are useful for a
variety of purposes including for controlling the recombinant
expression of either the GRA1 or MAG1 genes, or both genes, or of
one or more other genes or coding sequences, in host cells of N.
caninum or in host cells of any other species of Neospora or other
member of the Apicomplexa, or in any other appropriate host cell.
Such other genes or coding sequences can either be native or
heterologous to the recombinant host cell. The promoter sequence
can be fused to the particular gene or coding sequence using
standard recombinant techniques as known in the art so that the
promoter sequence is in operative association therewith, as
"operative association" is defined below. By using the promoter,
recombinant expression systems can be constructed and used to
screen for compounds and transcriptional factors that can modulate
the expression of the GRA1 and MAG1 genes of Neospora or other
members of the Apicomplexa. In addition, such promoter constructs
can be used to express heterologous polypeptides in Neospora or
other members of the Apicomplexa.
[0075] 4.3. Oligonucleotide Molecules
[0076] The present invention further provides oligonucleotide
molecules that hybridize to any one of the aforementioned
polynucleotide molecules of the present invention, or that
hybridize to a polynucleotide molecule having a nucleotide sequence
that is the complement of any one of the aforementioned
polynucleotide molecules of the present invention. Such
oligonucleotide molecules are preferably at least about 10
nucleotides in length, and more preferably from about 15 to about
30 nucleotides in length, and hybridize to one or more of the
aforementioned polynucleotide molecules under highly stringent
conditions, i.e., washing in 6'SSC/0.5% sodium pyrophosphate at
about 37.degree. C. for .about.14-base oligos, at about 48.degree.
C. for .about.17-base oligos, at about 55.degree. C. for
.about.20-base oligos, and at about 60.degree. C. for
.about.23-base oligos. Other hybridization conditions for longer
oligonucleotide molecules of the present invention can be
determined by the skilled artisan using standard techniques. In a
preferred embodiment, an oligonucleotide molecule of the present
invention is complementary to a portion of at least one of the
aforementioned polynucleotide molecules of the present
invention.
[0077] Specific though non-limiting embodiments of oligonucleotide
molecules useful in practicing the present invention include
oligonucleotide molecules selected from the group consisting of SEQ
ID NOS: 14-26 and 28-34, and the complements thereof.
[0078] The oligonucleotide molecules of the present invention are
useful for a variety of purposes, including as primers in
amplification of a Neospora-specific polynucleotide molecule for
use, e.g., in differential disease diagnosis, or to encode or act
as antisense molecules useful in gene regulation. Regarding
diagnostics, suitably designed primers can be used to detect the
presence of Neospora-specific polynucleotide molecules in a sample
of animal tissue or fluid, such as brain tissue, lung, tissue,
placental tissue, blood, cerebrospinal fluid, mucous, urine,
amniotic fluid, etc. The production of a specific amplification
product can support a diagnosis of Neospora infection, while lack
of an amplified product can point to a lack of infection. Methods
for conducting amplifications, such as the polymerase chain
reaction (PCR), are described, among other plates, in Innis et al.
(eds), 1995, above: and Erlich (ed) 1992, above. Other
amplification techniques known in the art, e.g., the ligase chain
reaction, can alternatively be used. The sequences of the
polynucleotide molecules disclosed herein can also be used to
design primers for use in isolating homologous genes from other
species or strains of Neospora or other members of the
Apicomplexa.
[0079] 4.4. Recombinant Expression Systems
[0080] 4.4.1. Cloning and Expression Vectors
[0081] The present invention further provides compositions for
cloning and expressing any of the polynucleotide molecules of the
present invention, including cloning vectors, expression vectors,
transformed host cells comprising any of said vectors, and novel
strains or cell lines derived therefrom. In a preferred embodiment,
the present invention provides a recombinant vector comprising a
polynucleotide molecule having a nucleotide sequence encoding the
GRA1, GRA2, SAG1, MIC1 or MAG1 protein of N. caninum. In specific
though non-limiting embodiments, the present invention provides
plasmid pRC77 (ATCC 209685), which encodes the N. caninum GRA1
protein; plasmid pRC5 (ATCC 209686), which encodes the N. caninum
GRA2 protein; plasmid pRC102 (ATCC 209687), which encodes the N.
caninum SAG1 protein; plasmid pRC340 (ATCC 209688), which encodes
the N. caninum MIC1 protein; and plasmid bd304 (ATCC 203413), which
encodes the N. caninum. MAG1 protein, and which also comprises the
bidirectional promoter region described above.
[0082] Recombinant vectors of the present invention, particularly
expression vectors, are preferably constructed so that the coding
sequence for the polynucleotide molecule of the invention is in
operative association with one or more regulatory elements
necessary for transcription and translation of the coding sequence
to produce a polypeptide. As used herein, the term "regulatory
element" includes but is not limited to nucleotide sequences that
encode inducible and non-inducible promoters, enhancers, operators
and other elements known in the art that serve to drive and/or
regulate expression of polynucleotide coding sequences. Also, as
used herein, the coding sequence is in "operative association" with
one or more regulatory elements where the regulatory elements
effectively regulate and allow for the transcription of the coding
sequence or the translation of its mRNA, or both.
[0083] Methods are well-known in the art for constructing
recombinant vectors containing particular coding sequences in
operative association with appropriate regulatory elements, and
these can be used to practice the present invention. These methods
include in vitro recombinant techniques, synthetic techniques, and
in vivo genetic recombination. See, e.g., the techniques described
in Maniatis et al., 1989, above; Ausubel et al., 1989, above;
Sambrook et al., 1989, above; Innis et al., 1995, above; and
Erlich, :1992, above.
[0084] A variety of expression vectors are known in the art which
can be utilized to express the GRA1, GRA2, SAG1, MIC1, and MAG1
coding sequences of the present invention, including recombinant
bacteriophage DNA, plasmid DNA, and cosmid DNA expression vectors
containing the particular coding sequences. Typical prokaryotic
expression vector plasmids that can be engineered to contain a
polynucleotide molecule of the present invention include pUC8,
pUC9, pBR322 and pBR329 (Biorad Laboratories, Richmond, Calif.),
pPL and pKK223 (Pharmacia, Piscataway, N.J.), pQE50 (Qiagen,
Chatsworth, Calif.), and pGEM-T EASY (Promega, Madison, Wis.),
among many others. Typical eukaryotic expression vectors that can
be engineered to contain a polynucleotide molecule of the present
invention include an ecdysone-inducible mammalian expression system
(Invitrogen, Carlsbad, Calif.), cytomegalovirus
promoter-enhancer-based systems (Promega, Madison, Wis.;
Stratagene, La Jolla, Calif.; Invitrogen), and baculovirus-based
expression systems (Promega), among others.
[0085] The regulatory elements of these and other vectors can vary
in their strength and specificities. Depending on the host/vector
system utilized, any of a number of suitable transcription and
translation elements can be used. For instance, when cloning in
mammalian cell systems, promoters isolated from the genome of
mammalian cells, e.g., mouse metallothionein promoter, or from
viruses that grow in these cells, e.g., vaccinia virus 7.5K
promoter or Moloney murine sarcoma virus long terminal repeat, can
be used. Promoters obtained, by recombinant DNA or synthetic
techniques can also be used to provide for transcription of the
inserted sequence. In addition, expression from certain promoters
can be elevated in the presence of particular inducers, e.g., zinc
and cadmium ions for metallothionein promoters. Non-limiting
examples of transcriptional regulatory regions or promoters include
for bacteria, the .beta.-gal promoter, the T7 promoter, the TAC
promoter, .lambda. left and right promoters, trp and lac promoters,
trp-lac fusion promoters, etc.; for yeast, glycolytic enzyme
promoters, such as ADH-I and -II promoters, GPK promoter, PGI
promoter, TRP promoter, etc.; and for mammalian cells, SV40 early
and late promoters, adenovirus major late promoters, among others.
The present invention further provides a polynucleotide molecule
comprising the nucleotide sequence of the promoters of both the
GRA1 and MAG1 genes of N. caninum, which can be used to express any
of the coding sequences of the present invention in Neospora or
other members of the Apicomplexa.
[0086] Specific initiation signals are also required for sufficient
translation of inserted coding sequences. These signals typically
include an ATG initiation codon and adjacent sequences. In cases
where the polynucleotide molecule of the present invention
including its own initiation codon and adjacent sequences are
inserted into the appropriate expression vector, no additional
translation control signals may be needed. However, in cases where
only a portion of a coding sequence is inserted, exogenous
translational control signals, including the ATG initiation codon,
may be required. These exogenous translational control signals and
initiation codons can be obtained from a variety of sources, both
natural and synthetic. Furthermore, the initiation codon must be in
phase with the reading frame of the coding regions to ensure
in-frame translation of the entire insert.
[0087] Expression vectors can also be constructed that will express
a fusion protein comprising a protein or polypeptide of the present
invention. Such fusion proteins can be used, e.g., to raise
antisera against a Neospora protein, to study the biochemical
properties of the Neospora protein, to engineer a Neospora protein
exhibiting different immunological or functional properties, or to
aid in the identification or purification, or to improve the
stability, of a recombinantly-expressed Neospora protein. Possible
fusion protein expression vectors include but are not limited to
vectors incorporating sequences that encode .beta.-galactosidase
and trpE fusions, maltose-binding protein fusions,
glutathione-S-transferase fusions and polyhistidine fusions
(carrier regions). Methods are well-known in the art that can be
used to construct expression vectors encoding these and other
fusion proteins.
[0088] The fusion protein can be useful to aid in purification of
the expressed protein. In non-limiting embodiments, e.g., a
GRA1-maltose-binding fusion protein can be purified using amylose
resin; a GRA1-glutathione-S-transferase fusion protein can be
purified using glutathione-agarose beads; and a GRA1-polyhistidine
fusion protein can be purified using divalent nickel resin.
Alternatively, antibodies against a carrier protein or peptide can
be used for affinity chromatography purification of the fusion
protein. For example, a nucleotide sequence coding for the target
epitope of a monoclonal antibody can be engineered into the
expression vector in operative association with the regulatory
elements and situated so that the expressed epitope is fused to a
Neospora protein of the present invention. In a non-limiting
embodiment, a nucleotide sequence coding for the FLAG.TM. epitope
tag (International Biotechnologies Inc.), which is a hydrophilic
marker peptide, can be inserted by standard techniques into the
expression vector at a point corresponding, e.g., to the amino or
carboxyl terminus of the GRA1 protein. The expressed GRA1
protein-FLAG.TM. epitope fusion product can then be detected and
affinity-purified using commercially available anti-FLAG.TM.
antibodies.
[0089] The expression vector can also be engineered to contain
polylinker sequences that encode specific protease cleavage sites
so that the expressed Neospora protein can be released from the
carrier region or fusion partner by treatment with a specific
protease. For example, the fusion protein vector can include a
nucleotide sequence encoding a thrombin or factor Xa cleavage site,
among others.
[0090] A signal sequence upstream from and in reading frame with
the Neospora coding sequence can be engineered into the expression
vector by known methods to direct the trafficking and secretion of
the expressed protein. Non-limiting examples of signal sequences
include those from .alpha.-factor, immunoglobulins, outer membrane
proteins, penicillinase, and T-cell receptors, among others.
[0091] To aid in the selection of host cells transformed or
transfected with a recombinant vector of the present invention, the
vector can be engineered to further comprise a coding sequence for
a reporter gene product or other selectable marker. Such a coding
sequence is preferably in operative association with the regulatory
elements, as described above. Reporter genes that are useful in
practicing the invention are well-known in the art and include
those encoding chloramphenicol acetyltransferase (CAT), green
fluorescent protein, firefly luciferase, and human growth hormone,
among others. Nucleotide sequences encoding selectable markers are
well-known in the art, and include those that encode gene products
conferring resistance to antibiotics or anti-metabolites, or that
supply an auxotrophic requirement. Examples of such sequences
include those that encode thymidine kinase activity, or resistance
to methotrexate, ampicillin, kanamycin, chloramphenicol, zeocin,
pyrimethamine, aminoglycosides, or hygromycin, among others.
[0092] 4.4.2. Transformation of Host Cells
[0093] The present invention further provides transformed host
cells comprising a polynucleotide molecule or recombinant vector of
the present invention, and cell lines derived therefrom. Host cells
useful in practicing the invention can be eukaryotic or prokaryotic
cells. Such transformed host cells include but are not limited to
microorganisms, such as bacteria transformed with recombinant
bacteriophage DNA, plasmid DNA or cosmid DNA vectors, or yeast
transformed with a recombinant vector, or animal cells, such as
insect cells infected with a recombinant virus vector, e.g.,
baculovirus, or mammalian cells infected with a recombinant virus
vector, e.g., adenovirus or vaccinia virus, among others. For
example, a strain of E. coli can be used, such as, e.g., the
DH5.alpha. strain available from the ATCC, Rockville, Md., USA
(Accession No. 31343), or from Stratagene (La Jolla, Calif.).
Eukaryotic host cells include yeast cells, although mammalian
cells, e.g., from a mouse, hamster, cow, monkey, or human cell
line, among others, can also be utilized effectively. Examples of
eukaryotic host cells that can be used to express a recombinant
protein of the invention include Chinese hamster ovary (CHO) cells
(e.g., ATCC Accession No. CCL-61), NIH Swiss mouse embryo cells
NIH/3T3 (e.g., ATCC Accession No. CRL-1658), and Madin-Darby bovine
kidney (MDBK) cells (ATCC Accession No. CCL-22).
[0094] The recombinant vector of the invention is preferably
transformed or transfected into one or more host cells of a
substantially homogeneous culture of cells. The vector is generally
introduced into host cells in accordance with known techniques,
such as, e.g., by protoplast transformation, calcium phosphate:
precipitation, calcium chloride treatment, microinjection,
electroporation, transfection by contact with a recombined virus,
liposome-mediated transfection, DEAE-dextran transfection,
transduction, conjugation, or microprojectile bombardment, among
others. Selection of transformants can be conducted by standard
procedures, such as by selecting for cells expressing a selectable
marker, e.g., antibiotic resistance, associated with the
recombinant expression vector.
[0095] Once an expression vector is introduced into the host cell,
the integration and maintenance of the polynucleotide molecule of
the present invention, either in the host cell genome or
episomally, can be confirmed by standard techniques, e.g., by
Southern hybridization analysis, restriction enzyme analysis, PCR
analysis including reverse transcriptase PCR (rt-PCR), or by
immunological assay to detect the expected protein product. Host
cells containing and/or expressing a polynucleotide molecule of the
present invention can be identified by any of at least four general
approaches that are well-known in the art, including: (i) DNA-DNA,
DNA-RNA, or RNA-antisense RNA hybridization; (ii) detecting the
presence of "marker" gene functions; (iii) assessing the level of
transcription as measured by the expression of specific mRNA
transcripts in the host cell; or (iv) detecting the presence of
mature polypeptide product, e.g., by immunoassay, as known in the
art.
[0096] 4.4.3. Expression and Purification of Recombinant
Polypeptides
[0097] Once a polynucleotide molecule of the present invention has
been stably introduced into an appropriate host cell, the
transformed host cell is clonally propagated, and the resulting
cells are grown under conditions conducive to the maximum
production of the encoded polypeptide. Such conditions typically
include growing transformed cells to high density. Where the
expression vector comprises an inducible promoter, appropriate
induction conditions such as, e.g., temperature shift, exhaustion
of nutrients, addition of gratuitous inducers (e.g., analogs of
carbohydrates, such as isopropyl-.beta.-D-thiogalactopyranosid- e
(IPTG)), accumulation of excess metabolic by-products, or the like,
are employed as needed to induce expression.
[0098] Where the polypeptide is retained inside the host cells, the
cells are harvested and lysed, and the product is substantially
purified or isolated from the lysate under extraction conditions
known in the art to minimize protein degradation such as, e.g., at
4.degree. C., or in the presence of protease inhibitors, or both.
Where the polypeptide is secreted from the host cells, the
exhausted nutrient medium can simply be collected and the
polypeptide substantially purified or isolated therefrom.
[0099] The polypeptide can be substantially purified or isolated
from cell lysates or culture medium, as necessary, using standard
methods, including but not limited to one or more of the following
methods: ammonium sulfate precipitation, size fractionation, ion
exchange chromatography, HPLC, density centrifugation, and affinity
chromatography. If the polypeptide lacks biological activity, it
can be detected as based, e.g., on size, or reactivity with a
polypeptide-specific antibody, or by the presence of a fusion tag.
For use in practicing the present invention, the polypeptide can be
in an unpurified state as secreted into the culture fluid or as
present in a cell lysate, but is preferably substantially purified
or isolated therefrom. As used herein, a polypeptide is
"substantially purified" where the polypeptide constitutes at least
about 20 wt % of the protein in a particular preparation. Also, as
used herein, a polypeptide is "isolated" where the polypeptide
constitutes at least about 80 wt % of the protein in a particular
preparation.
[0100] Thus, the present invention provides a substantially
purified or isolated polypeptide encoded by a polynucleotide of the
present invention. In a non-limiting embodiment, the polypeptide is
a N. caninum protein selected from the group consisting of GRA1,
GRA2, SAG1, MIC1 and MAG1 proteins. In a preferred embodiment, the
N. caninum GRA1 protein has the amino acid sequence of SEQ ID NO:
2. In another preferred embodiment, the N. caninum GRA2 protein has
the amino acid sequence of SEQ ID NO: 5. In another preferred
embodiment, the N. caninum SAG1 protein has the amino acid sequence
of SEQ ID NO: 7. In another preferred embodiment, the N. caninum
MIC1 protein has the amino acid sequence of SEQ ID NO: 9. In
another preferred embodiment, the N. caninum MAG1 protein has the
amino acid sequence of SEQ ID NO: 13.
[0101] The present invention further provides polypeptides that are
homologous to any of the aforementioned N. caninum proteins, as the
term "homologous" is defined above for polypeptides. Polypeptides
of the present invention that are homologous to any of the
aforementioned GRA1, GRA2, SAG1, MIC1 or MAG1 proteins of N.
caninum do not include polypeptides having the native amino acid
sequence of a T. gondii GRA, SAG, MIC or MAG protein, and further
have no more than about 90%, and preferably no more than about 80%,
amino acid sequence identity to such a T. gondii polypeptide,
wherein sequence identity is determined by use of the BLASTP
algorithm (GenBank, NCBI).
[0102] The present invention further provides polypeptides
consisting of a substantial portion of any one of the
aforementioned polypeptides of the present invention. As used
herein, a "substantial portion" of a polypeptide of the present
invention, or "peptide fragment," means a polypeptide consisting of
less than the complete amino acid sequence of the corresponding
full-length polypeptide, but comprising at least about 10%, and
more preferably at least about 20%, of the amino acid sequence
thereof, and that is useful in practicing the present invention, as
defined above for polypeptides. Particularly preferred are, peptide
fragments that are immunogenic, i.e., capable of inducing an immune
response which results in production of antibodies that react
specifically against the corresponding full-length Neospora
polypeptide.
[0103] The present invention further provides fusion proteins
comprising any of the aforementioned polypeptides fused to a
carrier or fusion partner as known in the art.
[0104] The present invention further provides a method of preparing
any of the aforementioned polypeptides, comprising culturing a host
cell transformed with a recombinant expression vector, said
recombinant expression vector comprising a polynucleotide molecule
comprising a nucleotide sequence encoding the particular
polypeptide, which polynucleotide molecule is in operative
association with one or more regulatory elements, under conditions
conducive to the expression of the polypeptide, and recovering the
expressed polypeptide from the cell culture.
[0105] 4.5. Use of Polypeptides
[0106] Once a polypeptide of the present invention of sufficient
purity has been obtained, it can be characterized by standard
methods, including by SDS-PAGE, size exclusion chromatography,
amino acid sequence analysis, immunological activity, biological
activity, etc. The polypeptide can be further characterized using
hydrophilicity analysis (see, e.g., Hopp and Woods, 1981, Proc.
Natl. Acad. Sci. USA 78:3824), or analogous software algorithms, to
identify hydrophobic and hydrophilic regions. Structural analysis
can be carried out to identify regions of the polypeptide that
assume specific secondary structures. Biophysical methods such as
X-ray crystallography (Engstrom, 1974, Biochem. Exp. Biol. 11:
7-13), computer modeling (Fletterick and Zoller (eds), 1986, in:
Current Communications in Molecular Biology, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.), and nuclear magnetic
resonance (NMR) can be used to map and study potential sites of
interaction between the polypeptide and other putative interacting
proteins/receptors/molecules. Information obtained from these
studies can be used to design deletion mutants and vaccine
compositions, and to design or select therapeutic or pharmacologic
compounds that can specifically block the biological function of
the polypeptide in vivo.
[0107] Polypeptides of the present invention, are useful for a
variety of purposes, including as components of vaccine
compositions to protect mammals against neosporosis; or as
diagnostic reagents, e.g., using standard techniques such as ELISA
assays, to screen for Neospora-specific antibodies in blood or
serum samples from animals; or as antigens to raise polyclonal or
monoclonal antibodies, as described below, which antibodies are
useful as diagnostic reagents, e.g., using standard techniques such
as Western blot assays, to screen for Neospora-specific proteins in
cell, tissue or fluid samples from an animal.
[0108] 4.6. Analogs and Derivatives of Polypeptides
[0109] Any polypeptide of the present invention can be modified at
the protein level to improve or otherwise alter its biological or
immunological characteristics. One or more chemical modifications
of the polypeptide can be carried out using known techniques to
prepare analogs therefrom, including but not limited to any of the
following: substitution of one or more L-amino acids of the
polypeptide with corresponding D-amino acids, amino acid analogs,
or amino acid mimics, so as to produce, e.g., carbazates or
tertiary centers; or specific chemical modification, such as, e.g.,
proteolytic cleavage with trypsin, chymotrypsin, papain or V8
protease, or treatment with NaBH.sub.4 or cyanogen bromide, or
acetylation, formylation, oxidation or reduction, etc.
Alternatively or additionally, polypeptides of the present
invention can be modified by genetic recombination techniques.
[0110] A polypeptide of the present invention can be derivatized by
conjugation thereto of one or more chemical groups, including but
not limited to acetyl groups, sulfur bridging groups, glycosyl
groups, lipids, and phosphates, and/or by conjugation to a second
polypeptide of the present invention, or to another protein, such
as, e.g., serum albumin, keyhole limpet hemocyanin, or commercially
activated BSA, or to a polyamino acid (e.g.,. polylysine), or to a
polysaccharide, (e.g., sepharose, agarose, or modified or
unmodified celluloses), among others. Such conjugation is
preferably by covalent linkage at amino acid side chains and/or at
the N-terminus or C-terminus of the polypeptide. Methods for
carrying out such conjugation reactions are well-known in the field
of protein chemistry.
[0111] Derivatives useful in practicing the claimed invention also
include those in which a water-soluble polymer such as, e.g.,
polyethylene glycol, is conjugated to a polypeptide of the present
invention, or to an analog or derivative thereof, thereby providing
additional desirable properties while retaining, at least in part,
the immunogenicity of the polypeptide. These additional desirable
properties include, e.g., increased solubility in aqueous
solutions, increased stability in storage, increased resistance to
proteolytic degradation, and increased in vivo half-life.
Water-soluble polymers suitable for conjugation to a polypeptide of
the present invention include but are not limited to polyethylene
glycol homopolymers, polypropylene glycol homopolymers, copolymers
of ethylene glycol with propylene glycol, wherein said homopolymers
and copolymers are unsubstituted or substituted at one end with an
alkyl group, polyoxyethylated polyols, polyvinyl alcohol,
polysaccharides, polyvinyl ethyl ethers, and
.alpha.,.beta.-poly(2-hydrox- yethyl]-DL-aspartamide. Polyethylene
glycol is particularly preferred. Methods for making water-soluble
polymer conjugates of polypeptides are known in the art and are
described in, among other places, U.S. Pat. No. 3,788,948; U.S.
Pat. No. 3,960,830; U.S. Pat. No. 4,002,531; U.S. Pat. No.
4,055,635; U.S. Pat. No. 4,179,337; U.S. Pat. No. 4,261,973; U.S.
Pat. No. 4,412,989; U.S. Pat. No. 4,414,147; U.S. Pat. No.
4,415,665; U.S. Pat. No. 4,609,546; U.S. Pat. No. 4,732,863; U.S.
Pat. No. 4,745,180; European Patent (EP) 152,847; EP 98,110; and
Japanese Patent 5,792,435, which patents are incorporated herein by
reference.
[0112] 4.7. Antibodies
[0113] The present invention further provides isolated antibodies
directed against a polypeptide of the present invention. In a
preferred embodiment, antibodies can be raised against a GRA1,
GRA2, SAG1, MIC1 or MAG1 protein from N. caninum using known
methods. Various host animals selected from pigs, cows, horses,
rabbits, goats, sheep, or mice, can be immunized with a partially
or substantially purified, or isolated, N. caninum protein, or with
a homolog, fusion protein, substantial portion, analog or
derivative thereof, as these are described above. An adjuvant, such
as described below, can be used to enhance antibody production.
[0114] Polyclonal antibodies can be obtained and isolated from the
serum of an immunized animal and tested for specificity against the
antigen using standard techniques. Alternatively, monoclonal
antibodies can be prepared and isolated using any technique that
provides for the production of antibody molecules by continuous
cell lines in culture. These include but are not limited to the
hybridoma technique originally described by Kohler and Milstein
(Nature, 1975, 256: 495497); the human B-cell hybridoma technique
(Kosbor et al., 1983, Immunology. Today 4:72; Cote et al., 1983,
Proc. Natl. Acad. Sci. USA 80: 2026-2030); and the EBV-hybridoma
technique (Cole et al., 1985, Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96). Alternatively, techniques
described for the production of single chain antibodies (see, e.g.,
U.S. Pat. No. 4,946,778) can be adapted to produce N. caninum
antigen-specific single chain antibodies. These publications are
incorporated herein by reference.
[0115] Antibody fragments that contain specific binding sites for a
polypeptide of the present invention are also encompassed within
the present invention, and can be generated by known techniques.
Such fragments include but are not limited to F(ab').sub.2
fragments, which can be generated by pepsin digestion of an intact
antibody molecule, and Fab fragments, which can be generated by
reducing the disulfide bridges of the F(ab').sub.2 fragments.
Alternatively, Fab expression libraries can be constructed (Huse et
al., 1989, Science 246: 1275-1281) to allow rapid identification of
Fab fragments having the desired specificity to the N. caninum
protein.
[0116] Techniques for the production and isolation of monoclonal
antibodies and antibody fragments are well-known in the art, and
are additionally described, among other places, in Harlow and Lane,
1988, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, and in J. W. Goding, 1986, Monoclonal Antibodies:
Principles and Practice, Academic Press, London, which are
incorporated herein by reference.
[0117] 4.8. Targeted Mutation of Neospora Genes
[0118] Based on the disclosure of the polynucleotide molecules of
the present invention, genetic constructs can be prepared for use
in disabling or otherwise mutating a Neospora GRA1, GRA2, SAG1,
MIC1 or MAG1 gene (which genes are hereinafter referred to
collectively or individually as the "Neospora genes" or a "Neospora
gene," respectively). Each of the Neospora genes can be mutated
using an appropriately designed genetic construct in combination
with genetic techniques now known or to be developed in the future.
For example, a Neospora gene can be mutated using a genetic
construct of the present invention that functions to: (a) delete
all or a portion of the coding sequence or regulatory sequence of
the Neospora gene; or (b) replace all or a portion of the coding
sequence or regulatory sequence of the Neospora gene with a
different nucleotide sequence, or (c) insert into the coding
sequence or regulatory sequence of the Neospora gene one or more
nucleotides, or an oligonucleotide molecule, or polynucleotide
molecule, which can comprise a nucleotide sequence from Neospora or
from a heterologous source; or (d) carry out some combination of
(a), (b) and (c).
[0119] Neospora cells in which a Neospora gene has been mutated are
useful in practicing the present invention where mutating the gene
reduces the pathogenicity of the Neospora cells carrying the
mutated gene compared to cells of the same strain of Neospora where
the gene has not been so mutated, and where such Neospora cells
carrying the disabled gene can be used in a vaccine composition,
particularly in a modified live vaccine, to induce or contribute to
the induction of, a protective response in a mammal against
neosporosis. In a preferred embodiment, the mutation serves, to
partially or completely disable the Neospora gene, or partially or
completely disable the protein encoded by the Neospora gene. In
this context, a Neospora gene or protein is considered to be
partially or completely disabled if either no protein product is
made (for example, the gene is deleted), or a protein product is
made that can no longer carry out its normal biological function or
can no longer be transported to its normal cellular location, or a
product is made that carries out its normal biological function but
at a significantly reduced rate, or if such mutation results in a
detectable decrease in the pathogenicity of cells of a pathogenic
strain of Neospora wherein the gene has been so mutated compared to
cells of the same strain but in which the gene has not be so
mutated.
[0120] In a non-limiting embodiment, a genetic construct of the
present invention is used to mutate a wild-type Neospora gene by
replacement of the coding sequence of the wild-type gene, or a
promoter or other regulatory region thereof, or a portion thereof,
with a different nucleotide sequence such as, e.g., a mutated
coding sequence or mutated regulatory region, or portion, thereof.
Mutated Neospora gene sequences for use in such a genetic construct
can be produced by any of a variety of known methods, including by
use of error-prone PCR, or by cassette mutagenesis. For example,
oligonucleotide-directed mutagenesis can be employed to alter the
coding sequence or promoter sequence of a wild-type Neospora gene
in a defined way, e.g., to introduce a frame-shift or a termination
codon at a specific point within the sequence. Alternatively or
additionally, a mutated nucleotide sequence for use in the genetic
construct of the present invention can be prepared by insertion
into the coding sequence or promoter sequence of one or more
nucleotides, oligonucleotide molecules or polynucleotide molecules,
or by replacement of a portion of the coding sequence or promoter
sequence with one or more different nucleotides, oligonucleotide
molecules or polynucleotide molecules. Such oligonucleotide
molecules or polynucleotide molecules can be obtained from any
naturally occurring source or can be synthetic. The inserted
sequence can serve simply to disrupt the reading frame of the
Neospora gene, or can further encode a heterologous gene product
such as a selectable marker.
[0121] Alternatively or additionally, random mutagenesis can be
used to produce a mutated Neospora gene sequence for use in a
genetic construct of the present invention. Random mutagenesis can
be carried out by any techniques now known or to be developed in
the future such as, e.g., by exposing cells carrying a Neospora
gene to ultraviolet radiation or x-rays, or to chemical mutagens
such as N-methyl-N'-nitrosoguanidine, ethyl methane sulfonate,
nitrous acid or nitrogen mustards, and then selecting for cells
carrying a mutation in the particular gene. See, e.g., Ausubel,
1989, above, for a review of mutagenesis techniques.
[0122] Mutations to produce modified Neospora cells that are useful
in practicing the present invention, as defined above, can occur
anywhere in the Neospora gene, including in the ORF, or in the
promoter or other regulatory region, or in any other sequences that
naturally comprise the gene or ORF. Such Neospora cells include
mutants in which a modified form of the protein normally encoded by
the Neospora gene is produced, or in which no protein normally
encoded by the Neospora gene is produced, and can be null,
conditional or leaky mutants.
[0123] Alternatively, a genetic construct of the present invention
can comprise nucleotide sequences that naturally flank the Neospora
gene or ORF in situ, such as those presented in SEQ ID NOS: 1, 3,
4, 6, 8, 10, 11 and 12, with only a portion or no nucleotide
sequences from the coding region of the gene itself. Such a genetic
construct would be useful, e.g., to delete the entire Neospora gene
or ORF.
[0124] In a preferred embodiment, a genetic construct of the
present invention comprises a polynucleotide molecule that can be
used to disable a Neospora gene, comprising: (a) a polynucleotide
molecule having a nucleotide sequence that is otherwise the same as
a nucleotide sequence encoding a GRA1, GRA2, SAG1, MIC1 or MAG1
protein from N. caninum, but which nucleotide sequence further
comprises one or more disabling mutations; or (b) a polynucleotide
molecule comprising a nucleotide sequence that naturally flanks the
ORF of a Neospora gene in situ. Once transformed into cells of a
strain of Neospora, the polynucleotide molecule of the genetic
construct is specifically targeted to the particular Neospora gene
by homologous recombination, and thereby either replaces the gene
or portion thereof or inserts into the gene. As a result of this
recombination event, the Neospora gene otherwise native to that
particular strain of Neospora is disabled.
[0125] Methods for carrying out homologous gene replacement in
parasitic protozoans are known in the art, and are described, among
other places, in Cruz and Beverley, 1990, Nature 348:171-173; Cruz
et al., 1991, Proc. Natl. Acad. Sci. USA 88:7170-7174; Donald and
Roos, 1994, Mol. Biochem. Parasitol. 63:243-253; and Titus et al.,
1995, Proc. Natl. Acad. Sci. USA 92:10267-10271, all of which are
incorporated herein by reference.
[0126] For targeted gene mutation through homologous recombination,
the genetic construct is preferably a plasmid, either circular or
linearized, comprising a mutated nucleotide sequence as described
above. In a non-limiting embodiment, at least about 200 nucleotides
of the mutated sequence are used to specifically direct the genetic
construct of the present invention to the particular targeted
Neospora gene for homologous recombination, although shorter
lengths of nucleotides can also be effective. In addition, the
plasmid preferably comprises an additional nucleotide sequence
encoding a reporter gene product or other selectable marker that is
constructed so that it will insert into the Neospora genome in
operative association with the regulatory element sequences of the
native. Neospora gene to be disrupted. Reporter genes that can be
used in practicing the invention are well-known in the art and
include those encoding CAT, green fluorescent protein, and
.beta.-galactosidase, among others. Nucleotide sequences encoding
selectable markers are also well-known in the art, and include
those that encode gene products conferring resistance to
antibiotics or anti-metabolites, or that supply an auxotrophic
requirement. Examples of such sequences include those that encode
pyrimethamine resistance, or neomycin phosphotransferase (which
confers resistance to aminoglycosides), or hygromycin
phosphotransferase (which confers resistance to hygromycin).
[0127] Methods that can be used for creating the genetic constructs
of the present invention are well-known in the art, and include in
vitro recombinant techniques, synthetic techniques, and in vivo
genetic recombination, as described, among other places, in
Maniatis et al., 1989, above; Ausubel et al., 1989, above; Sambrook
et al., 1989, above; Innis et al., 1995, above; and, Erlich, 1992,
above.
[0128] Neospora cells can be transformed or transfected with a
genetic construct of the present invention in accordance with known
techniques, such as, e.g., by electroporation. Selection of
transformants can be carried out using standard techniques, such as
by selecting for cells expressing a selectable marker associated
with the construct. Identification of transformants in which a
successful recombination event has occurred and the particular
target gene has been disabled can be carried out by genetic
analysis, such as by Southern blot analysis, or by Northern
analysis to detect a lack of mRNA transcripts encoding the
particular protein, or by the appearance of a novel phenotype, such
as reduced pathogenicity, or cells lacking the particular protein,
as determined, e.g., by immunological analysis, or some combination
thereof.
[0129] Neospora cells that can be modified according to the present
invention are preferably tachyzoites, but can alternatively be
bradyzoites or oocysts. Although cells in certain stages of the
Neospora life cycle are diploid, tachyzoites are haploid. Thus, the
use of tachyzoites in the production of modified Neospora cells
expressing the appropriate mutant phenotype is preferred because
tachyzoites require only a single successful recombination event to
disrupt the particular Neospora gene. Alternatively, in diploid
cells of Neospora, two alleles must be disrupted for each gene.
This can be accomplished by sequentially targeting the first allele
and then the second allele with genetic constructs bearing two
different selectable markers.
[0130] In a further non-limiting embodiment, the genetic construct
of the present invention can additionally comprise a different gene
or coding region from Neospora or from a different pathogen that
infects the animal, which gene or coding region encodes an antigen
useful to induce, or contribute to the induction of, a separate and
distinct protective immune response in the animal upon vaccination
with the modified live Neospora cells of the present invention.
This additional gene or coding region can be further engineered to
contain a signal sequence that leads to secretion of the encoded
antigen from the modified live Neospora cell, thereby allowing for
the antigen to be displayed to the immune system of the vaccinated
animal.
[0131] The present invention thus provides modified live Neospora
cells in which the GRA1, GRA2 SAG1, MIC1 or MAG1 gene has been
mutated. The present invention further provides modified live
Neospora cells in which a combination of two or more of the GRA1 ,
GRA2, SAG1, MIC1, and MAG1 genes have been mutated, which cells can
be prepared using the general methods presented above. In addition,
the present invention provides a method of preparing modified live
Neospora cells, comprising: (a) transforming cells of Neospora with
a genetic construct of the invention; (b) selecting transformed
cells in which the GRA1, GRA2, SAG1, MIC1, or MAG 1 gene has been
mutated by the genetic construct; and (c) selecting from among the
cells of step (b) those cells that can be used in a vaccine to
protect a mammal against neosporosis.
[0132] 4.9. Culturing Neospora Cells
[0133] Neospora cells for use in the present invention can be
cultured and maintained in vitro by infecting any receptive host
cell line, preferably a mammalian cell line, with tachyzoites
according to known techniques described in the art. Mammalian cell
lines in which tachyzoites of Neospora can be cultured include,
e.g., human foreskin fibroblasts (Lindsay et al., 1993, Am. J. Vet.
Res. 54:103-106), bovine cardiopulmonary aortic endothelial cells
(Marsh et al., 1995, above), bovine monocytes (Lindsay and Dubey,
1989, above), and monkey kidney cells, among others. For example,
tachyzoites of N. caninum can be cultured in monolayers of Hs68
human foreskin fibroblast cells (ATCC Accession No. CRL-1635)
(Lindsay et al., 1993, above); and MARC145 monkey kidney cells
infected with tachyzoites of N. caninum strain NC-1 for use in the
present invention are on deposit with the ATCC (Accession No.
12231). Bradyzoites can be similarly cultured and manipulated.
[0134] Mammalian cell cultures can be grown, and cell cultures that
have been infected with Neospora cells can be maintained, in any of
several types of culture media described in the art. For example,
stationary monolayer cultures of bovine cardiopulmonary aortic
endothelial cells infected with tachyzoites of N. caninum can be
grown in Dulbecco's Minimum Essential Medium (DMEM; Gibco
Laboratories, N.Y.), supplemented with 10% (v/v) heat-inactivated
fetal bovine serum (FBS) or adult equine serum (ES), 2 mM
L-glutamine, 50 U/ml penicillin, and 50 .mu.g/ml streptomycin
(Conrad et al., 1993, above). Monolayers of Hs68 human foreskin
fibroblast cells can be maintained in RPMI 1640 containing 2% (v/v)
FBS, 1.0 mM sodium pyruvate, 1.times.10.sup.4 U/ml penicillin,
1.times.10.sup.4 .mu.g/ml streptomycin, 5.times.10.sup.-2 mM
2-mercaptoethanol and 0.3 mg/ml L-glutamine (maintenance medium).
Monolayer cultures of Hs68 human foreskin fibroblast cells infected
with Neospora can be maintained in identical media, but in which
the FBS is increased to 10% (v/v) (growth medium).
[0135] Neospora-infected monolayer cultures of mammalian cells are
typically maintained under standard tissue culture conditions such
as, e.g., at 37.degree. C. and 5% CO.sub.2. Tachyzoites are
typically passaged to uninfected monolayer cultures when 70-90% of
the mammalian cells in the culture have become infected, which can
be determined microscopically using standard techniques.
Tachyzoites can be collected from the infected mammalian cell
cultures by lysing the host cells using any standard technique and
collecting the tachyzoites, e.g., by filtration or by
centrifugation.
[0136] Modified live Neospora cells of the present invention can
also be cultured in mammalian cells, as described above.
[0137] 4.10. Anti-Neospora Vaccines
[0138] The present invention further provides a vaccine against
neosporosis, comprising an immunologically effective amount of one
or more proteins or polypeptides of the present invention, and a
veterinarily acceptable carrier. In a preferred embodiment, the
vaccine comprises a N. caninum protein selected from the group
consisting of GRA1, GRA2, SAG1, MIC1 and MAG1.
[0139] The present invention further provides a vaccine against
neosporosis, comprising an immunologically effective amount of one
or more polynucleotide molecules of the present invention, and a
veterinarily acceptable carrier. In a preferred embodiment, the
vaccine comprises a polynucleotide molecule having a nucleotide
sequence encoding a N. caninum protein selected from the group
consisting of GRA1, GRA2, SAG1, MIC1, and MAG1.
[0140] The present invention further provides a vaccine against
neosporosis, comprising an immunologically effective amount of
modified Neospora cells of the present invention, and a
veterinarily acceptable carrier. In a preferred embodiment, the
modified Neospora cells for use in the vaccine of the present
invention are live cells of N. caninum which express a GRA1.sup.-,
GRA2.sup.-, SAG1.sup.-, MIC1.sup.-, or MAG1.sup.- phenotype.
Alternatively, the vaccine of the present invention can comprise
any of such modified Neospora cells of the present invention that
have been inactivated. Inactivation of modified Neospora cells can
be carried out using any techniques known in the art, including by
chemical treatment, such as with binary ethylenimine (BEI), or
beta-propiolactone, or by freeze-thawing or heat treatment, or by
homogenization of cells, or by a combination of these types of
techniques. Vaccines prepared from homogenized, modified Neospora
cells can consist of either the entire unfractionated cell
homogenate, or an immunologically effective subfraction
thereof.
[0141] As used herein, the term "immunologically effective amount"
refers to that amount of antigen, e.g., protein, polypeptide,
polynucleotide molecule, or modified cells, capable of inducing a
protective response against neosporosis when administered to a
member of a mammalian species after either a single administration,
or after multiple administrations.
[0142] The phrase "capable of inducing a protective response" is
used broadly herein to include the induction or enhancement of any
immune-based response in the animal in response to vaccination,
including either an antibody or cell-mediated immune response, or
both, that serves to protect the vaccinated animal against
neosporosis. The terms "protective response" and "protect" as used
herein refer not only to the absolute prevention of neosporosis or
absolute prevention of infection by a neosporosis-causing pathogen,
but also to any detectable reduction in the degree or rate of
infection by such a pathogen, or any detectable reduction in the
severity of the disease or any symptom or condition resulting from
infection by the pathogen, including, e.g., any detectable
reduction in the rate of formation, or in the absolute number, of
lesions formed in one or more tissues, or any detectable reduction
in the occurrence of abortion, or the transmission of infection
from a pregnant mammal to its fetus or from a mammal parent to its
offspring, in the vaccinated animal as compared to an unvaccinated
infected animal of the same species.
[0143] In a further preferred embodiment, the vaccine of the
present invention is a combination vaccine for protecting a mammal
against neosporosis and, optionally, one or more other diseases or
pathological conditions that can afflict the mammal, which
combination vaccine comprises an immunologically effective amount
of a first component comprising a polypeptide, polynucleotide
molecule, or modified Neospora cells of the present invention; an
immunologically effective amount of a second component that is
different from the first component, and that is capable of
inducing, or contributing to the induction of, a protective
response against a disease or pathological condition that can
afflict the mammal; and a veterinarily acceptable carrier.
[0144] The second component of the combination vaccine is selected
based on its ability to induce, or contribute to the induction of,
a protective response against either neosporosis or another disease
or pathological condition that can afflict members of the mammalian
species, as known in the art. Any antigenic component now known in
the art, or to be determined in the future, to be useful in a
vaccine composition in the particular mammalian species can be used
as the second component of the combination vaccine. Such antigenic
components include but are not limited to those that provide
protection against pathogens selected from the group consisting of
bovine herpes virus (syn., infectious bovine rhinotracheitis),
bovine respiratory syncitial virus, bovine viral diarrhea virus,
parainfluenza virus types I, II, or III,: Leptospira spp.,
Campylobacter spp., Staphylococcus aureus, Streptococcus
agalactiae, Mycoplasma spp., Klebsiella spp., Salmonella spp.,
rotavirus, coronavirus, rabies, Pasteurella hemolytica, Pasteurella
multocida, Clostridia spp., Tetanus toxoid, E. coli,
Cryptosporidium spp., Eimeria spp., Trichomonas spp., and other
eukaryotic parasites, among others.
[0145] In a non-limiting embodiment, the combination vaccine of the
present invention comprises a combination of two or more components
selected from the group consisting of an immunologically effective
amount of a protein or polypeptide of the present invention, an
immunologically effective amount of a polynucleotide molecule of
the present invention, and an immunologically effective amount of
modified Neospora cells of the present invention. In a preferred
embodiment, the combination vaccine of the present invention
comprises a combination of two or more components selected from the
group consisting of N. caninum GRA1, GRA2, SAG1, MIC1, and MAG1
proteins, polynucleotide molecules encoding any of the N. caninum
GRA1, GRA2, SAG1, MIC1, and MAG1 proteins, and modified live
Neospora cells exhibiting any of the GRA1.sup.-, GRA2.sup.-.
SAG1.sup.-, MIC1.sup.-, and MAG1.sup.- phenotypes.
[0146] The vaccines of the present invention can further comprise
one or more additional immunomodulatory components including, e.g.,
an adjuvant or cytokine, as described below.
[0147] The present invention *further provides a method of
preparing a vaccine against neosporosis, comprising combining an
immunologically effective amount of a N. caninum protein or
polypeptide, or polynucleotide molecule, or modified Neospora cells
of the presents invention, with a veterinarily acceptable carrier,
in a form suitable for administration to a mammal. In a preferred
embodiment, the protein is a N. caninum protein selected from the
group consisting of GRA1, GRA2, SAG1, MIC1 and MAG1; the
polynucleotide molecule preferably comprises a nucleotide sequence
encoding a N. caninum protein selected from the group consisting of
GRA1, GRA2, SAG1, MIC1 and MAG1; and the modified Neospora cells
preferably are live cells that exhibit a phenotype selected from
the group consisting of GRA1.sup.-, GRA2.sup.-, SAG1.sup.-,
MIC1.sup.-, and MAG1.sup.-.
[0148] A vaccine comprising modified live Neospora cells of the
present invention can be prepared using an aliquot of culture fluid
containing said Neospora cells, either free in the medium or
residing in mammalian host cells, or both, and can be administered
directly or in concentrated form to the mammal. Alternatively,
modified live Neospora cells can be combined with a veterinarily
acceptable carrier, with or without an immunomodulatory agent,
selected from those known in the art and appropriate to the chosen
route of administration, preferably where at least some degree of
viability of the modified live Neospora cells in the vaccine
composition is maintained. Modified Neospora cells that can be used
in the vaccine of the present invention are preferably tachyzoites,
but can alternatively be bradyzoites or oocysts, or some
combination thereof.
[0149] Vaccine compositions of the present invention can be
formulated following accepted convention to include veterinarily
acceptable carriers, such as standard buffers, stabilizers,
diluents, preservatives, and/or solubilizers, and can also be
formulated to facilitate sustained release. Diluents include water,
saline, dextrose, ethanol, glycerol, and the like. Additives for
isotonicity include sodium chloride, dextrose, mannitol, sorbitol,
and lactose, among others. Stabilizers include albumin, among
others. Suitable other vaccine vehicles and additives, including
those that are particularly useful in formulating modified live
vaccines, are known or will be apparent to those skilled in the
art,. See, e.g., Remington's Pharmaceutical Science, 18th ed.,
1990, Mack Publishing, which is incorporated herein by
reference.
[0150] The vaccine of the present invention can further comprise
one or more additional immunomodulatory components such as, e.g.,
an adjuvant or cytokine, among others. Non-limiting examples of
adjuvants that can be used in the vaccine of the present invention
include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.),
alum, mineral gels such as aluminum hydroxide gel, oil-in-water
emulsions, water-in-oil emulsions such as, e.g., Freund's complete
and incomplete adjuvants, Block co polymer (CytRx, Atlanta Ga.),
QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron,
Emeryville Calif.), AMPHIGEN.RTM. adjuvant, saponin, Quil A or
other saponin fraction, monophosphoryl lipid A, and Avridine
lipid-amine adjuvant. Specific non-limiting examples of
oil-in-water emulsions useful in the vaccine of the invention
include modified SEAM62 and SEAM 1/2 formulations. Modified SEAM62
is an oil-in-water emulsion containing 5% (v/v) squalene (Sigma),
1% (v/v) SPAN.RTM. 85 detergent (ICI Surfactants), 0.7% (v/v)
TWEEN.RTM. 80 detergent (ICI Surfactants), 2.5% (v/v) ethanol, 200
.mu.g/ml Quil A, 100 .mu.g/ml cholesterol, and 0.5% (v/v) lecithin.
Modified SEAM 1/2 is an oil-in-water emulsion comprising 5% (v/v)
squalene, 1% (v/v) SPAN.RTM. 85 detergent, 0.7% (v/v) Tween 80
detergent, 2.5% (v/v) ethanol, 100 .mu.g/ml Quil A, and 50 .mu.g/ml
cholesterol. Other immunomodulatory agents that can be included in
the vaccine include, e.g., one or more interleukins, interferons,
or other known cytokines. Where the vaccine comprises modified live
Neospora cells, the adjuvant is preferably selected based on the
ability of the resulting vaccine formulation to maintain at least
some degree of viability of the modified live Neospora cells.
[0151] Where the vaccine composition comprises a polynucleotide
molecule, the polynucleotide molecule can either be DNA or RNA,
although DNA is preferred, and is preferably administered to a
mammal to be protected against neosporosis in an expression vector
construct, such as a recombinant plasmid or viral vector, as known
in the art. Examples of recombinant viral vectors include
recombinant adenovirus vectors and recombinant retrovirus vectors.
However, a preferred vaccine formulation comprises a non-viral DNA
vector, most preferably a DNA plasmid-based vector. The
polynucleotide molecule may be associated with lipids to form,
e.g., DNA-lipid complexes, such as liposomes or cochleates. See,
e.g., International Patent Publication WO 93/24640.
[0152] An expression vector useful as a vaccinal agent in a DNA
vaccine preferably comprises a nucleotide sequence encoding one or
more antigenic Neospora proteins, or a substantial portion of such
a nucleotide sequence, in operative association with one or more
transcriptional regulatory elements required for expression of the
Neospora coding sequence in a eukaryotic cell, such as, e.g., a
promoter sequence, as known in the art. In a preferred embodiment,
the regulatory element is a strong viral promoter such as, e.g., a
viral promoter from RSV or CMV. Such an expression vector also
preferably includes a bacterial origin of replication and a
prokaryotic selectable marker gene for cloning purposes, and a
polyadenylation sequence to ensure appropriate termination of the
expressed mRNA. A signal sequence may also be included to direct
cellular secretion of the expressed protein.
[0153] The requirements for expression vectors useful as vaccinal
agents in DNA vaccines are further described in U.S. Pat. No.
5,703,055, U.S. Pat. No. 5,580,859, U.S. Pat. No. 5,589,466,
International Patent Publication WO 98/35562, and in various
scientific publications, including Ramsay et al., 1997, Immunol.
Cell Biol. 75:360-363; Davis, 1997, Cur. Opinion Biotech.
8:635-640; Maniackan et al., 1997, Critical Rev. Immunol.
17:139-154; Robinson, 1997, Vaccine 15(8):785-787; Lai and Bennett,
1998. Critical Rev. Immunol. 18:449484; and Vogel and Sarver, 1995,
Clin. Microbiol. Rev. 8(3):406410, among others.
[0154] Where the vaccine composition comprises modified live
Neospora cells, the vaccine can be stored cold or frozen. Where the
vaccine composition instead comprises a protein, polypeptide,
polynucleotide molecule, or inactivated modified Neospora cells of
the present invention, the vaccine may be stored frozen, or in
lyophilized form to be rehydrated prior to administration using an
appropriate diluent.
[0155] The vaccine of the present invention can optionally be
formulated for sustained release of the antigen. Examples of such
sustained release formulations include antigen in combination with
composites of biocompatible polymers, such as, e.g., poly(lactic
acid), poly(lactic-co-glycolic acid), methylcellulose, hyaluronic
acid, collagen and the like. The structure, selection and use of
degradable polymers in drug delivery vehicles have been reviewed in
several publications, including A. Domb et al., 1992, Polymers for
Advanced Technologies 3: 279-292, which is incorporated herein by
reference. Additional guidance in selecting and using polymers in
pharmaceutical formulations can be found in the text by M. Chasin
and R. Langer (eds), 1990, "Biodegradable Polymers as Drug Delivery
Systems" in: Drugs and the Pharmaceutical Sciences, Vol. 45, M.
Dekker, NY, which is also incorporated herein by reference.
Alternatively, or additionally, the antigen can be
microencapsulated to improve administration and efficacy. Methods
for microencapsulating antigens are well-known in the art, and
include techniques described, e.g., in U.S. Pat. No. 3,137,631;
U.S. Pat. No. 3,959,457; U.S. Pat. No. 4,205,060; U.S. Pat. No.
4,606,940; U.S. Pat. No. 4,744,933; U.S. Pat. No. 5,132,117; and
International Patent Publication WO 95/28227, all of which are
incorporated herein by reference.
[0156] Liposomes can also be used to provide for the sustained,
release of antigen. Details concerning how to make and use
liposomal formulations can be found in, among other places, U.S.
Pat. No. 4,016,100; U.S. Pat. No. 4,452,747; U.S. Pat. No.
4,921,706; U.S. Pat. No. 4,927,637; U.S. Pat. No. 4,944,948; U.S.
Pat. No. 5,008,050; and U.S. Pat. No. 5,009,956, all of which are
incorporated herein by reference.
[0157] The present invention further provides a method of
vaccinating a mammal against neosporosis, comprising administering
to the mammal an immunologically effective amount of a vaccine of
the present invention. The vaccine is preferably administered
parenterally, e.g., either by subcutaneous or intramuscular
injection. However, the vaccine can alternatively be administered
by intraperitoneal or intravenous injection, or by other routes,
including, e.g., orally, intranasally, rectally, vaginally,
intra-ocularly, or by a combination of routes, and also by delayed
release devices as known in the art. The skilled artisan will be
able to determine the most optimal route of vaccine administration,
and will also recognize acceptable formulations for the vaccine
composition according to the chosen route of administration.
[0158] An effective dosage can be determined by conventional means,
starting with a low dose of antigen, and then increasing the dosage
while monitoring the effects. Numerous factors may be taken into
consideration when determining an, optimal dose per animal. Primary
among these is the species, size, age and general condition of the
animal, the presence of other drugs in the animal, the virulence of
a particular species or strain of Neospora against which the animal
is being vaccinated, and the like. The actual dosage is preferably
chosen after consideration of the results from other animal
studies.
[0159] The dose amount of a Neospora protein or polypeptide of the
present invention in a vaccine of the present invention preferably
ranges from about 10 .mu.g to about 10 mg, more preferably from
about 50 .mu.g to about 1 mg, and most preferably from about 100
.mu.g to about 0.5 mg. The dose amount of a Neospora polynucleotide
molecule of the present invention in a vaccine of the present
invention preferably ranges from about 50 .mu.g to about 1 mg. The
dose amount of modified Neospora cells of the present invention in
a vaccine of the present invention preferably ranges from about
1.times.10.sup.3 to about 1.times.10.sup.8 cells/ml, and more
preferably from about 1.times.10.sup.5 to about 1.times.10.sup.7
cells/ml. A suitable dosage size ranges from about 0.5 ml to about
10 ml, and more preferably from about 1 ml to about 5 ml. The dose
amounts of these antigens are also applicable to combination
vaccines of the present invention. Where the second component of
the combination vaccine is an antigen other than a Neospora
protein, polypeptide, polynucleotide or modified cell of the
present invention, the dose amount of the second component for use
in the combination vaccine can be determined from prior vaccine
applications of that second component, as known in the art.
[0160] The vaccine of the present invention is useful to protect
mammals against neosporosis. As used herein, the term "mammal"
refers to any mammalian species that can be protected against
neosporosis using the vaccine of the invention, including dogs,
cows, goats, sheep and horses, among others. The vaccine of the
invention can be administered at any time during the life of a
particular animal depending upon several factors including, e.g.,
the timing of an outbreak of neosporosis among other animals, etc.
The vaccine can be administered to animals of weaning age or
younger, or to more mature animals, e.g., as a pre-breeding vaccine
to protect against Neospora-related congenital disease or abortion.
Effective protection may require only a primary vaccination, or one
or more booster vaccinations may also be needed. One method of
detecting whether adequate immune protection has been achieved is
to determine seroconversion and antibody titer in the animal after
vaccination. The timing of vaccination and the number of boosters,
if any, will preferably be determined by a veterinarian based on
analysis of all relevant factors, some of which are described
above.
[0161] The present invention further provides a kit for vaccinating
a mammal against neosporosis, comprising a container having an
immunologically effective amount of a polypeptide, polynucleotide
molecule, or modified Neospora cells of the present invention, or a
combination thereof. The kit can optionally comprise a second
container having a veterinarily acceptable carrier or diluent. In a
preferred embodiment, the polypeptide is selected from the group
consisting of GRA1, GRA2, SAG1, MIC1 and MAG1 proteins of N.
caninum; the polynucleotide molecule preferably has a nucleotide
sequence that encodes a N. caninum protein selected from the group
consisting of GRA1, GRA2, SAG1, MIC1, and MAG1; and the modified
Neospora cells preferably are live cells that express a GRA1.sup.-,
GRA2.sup.-, SAG1.sup.-, MIC1.sup.- or MAG1.sup.- phenotype.
[0162] The following example is illustrative only, and is not
intended to limit the scope of the present invention.
5. EXAMPLE:
[0163] Isolation of N. caninum cDNA and Gene Sequences
[0164] 5.1. Identification of .lambda. Clones Containing GRA1,
GRA2, SAG1 and MIC1 cDNAs
[0165] A cDNA library of N. caninum tachyzoites was obtained from
Dr. T. Baszler, Washington State University, Pullman, Wash.
Briefly, this library was constructed using RNA purified from N.
caninum NC-1 tachyzoites. cDNAs were cloned in bacteriophage
.lambda.ZAPExpress (Stratagene, La Jolla, Calif.) following
addition of EcoRI and XhoI linkers to the cDNA ends. The library
was estimated to contain .about.99% recombinants based on the
formation of white plaques when aliquots of the library were mixed
with E. coli XL-1 Blue MRA(P2) (Stratagene) and plated on NZY agar
plates containing IPTG.
[0166] The recombinant insert DNA sequences of individual putative
.lambda.ZAPExpress clones identified as described above were
subjected to PCR analyses essentially as described by Krishnan et
al., 1991, Nucl. Acids. Res. 19:6177-6182; and Krishnan et al.,
1993, Meth. Enzym. 218:258-279, which publications are incorporated
herein by reference. Thus, plugs of agar containing well separated
bacteriophage .lambda. plaques were recovered using a sterile
Pasteur pipette and immersed in 100 .mu.l of sterile water for at
least 1 hr. About 10 .mu.l of the diffused bacteriophage .lambda.
particles was used to perform PCR in a total volume of 100 .mu.l
containing: (1) 100 ng each of .lambda.DASH-T3 and .lambda.DASH-T7
oligonucleotide primers specific to the .lambda. bacteriophage
vectors, i.e., .lambda.ZAPExpress, with specificity to the
sequences adjacent to the cloning sites (i.e., EcoRI and XhoI), and
oriented in a 5' to 3' direction towards the insert DNA sequences;
(2) 200 .mu.M dNTPs; (3) PCR buffer (Life Technologies, Inc.,
Gaithersburg, Md.), and (4) .about.1 unit of Taq DNA polymerase
buffer (Life Technologies, Inc.): The sequence of .lambda.DASH-T3
is 5'-AATTAACCCTCACTAAAGGG (SEQ ID NO: 14). The sequence of
.lambda.DASH-T7 is 5'-GTAATACGACTCACTATAGGGC (SEQ ID NO: 15).
Thermal cycling conditions were as follows: 94.degree. C., 5 min, 1
cycle; 94.degree. C., 1. min, 55.degree. C., 1 min, 72.degree. C.,
1 cycle. An aliquot of the reaction mixture (typically 10 .mu.l)
was examined by standard agarose gel electrophoresis, ethidium
bromide staining and visualization under UV illumination. The PCR
mixtures were purified by ion exchange column chromatography using
a PCR purification system (Qiagen), and sequenced directly using
the .lambda.DASH-T3 and .lambda.DASH-T7 primers employing
fluorescent labeling and the Sanger dideoxy chain termination DNA
sequencing technology. Sequences were analyzed for homology to
other known sequences by comparison to DNA sequence databases at
the National Center for Biotechnology Information, Bethesda,
Maryland, 20894, USA. Four sequences, with homology to T. gondii
GRA1, GRA2, SAG1 and MIC1 genes, respectively, were identified.
[0167] 5.2. Identification of Complete ORFs for N. caninum GRA1,
GRA2, SAG1 and MIC1 cDNAs
[0168] The above-described bacteriophage .lambda.ZAPExpress
particles identified as containing N. caninum sequences having
homology to T. gondii GRA1, GRA2, SAG1, and MIC1 genes,
respectively, were subjected to an in vivo excision protocol
following manufacturers instructions (Stratagene) to recover the
insert sequences in plasmid pBluescript. Briefly, the phage
particles were allowed to infect E. coli XL-1 Blue MRF' co-infected
with ExAssist helper phage (Stratagene). Following this treatment,
the supernatant was collected and used to mix with E. coli XLOLR
cells (Stratagene). Aliquots of the cell suspension were then
plated on media containing kanamycin (.about.50 .mu.g/ml), and
kanamycin-resistant colonies were examined for plasmid profile.
Plasmid DNA was purified and the recombinant portion sequenced
using the Sanger dideoxy chain termination DNA sequencing
technology. DNA sequences obtained were analyzed by DNASTAR
(DNASTAR, Inc., Madison, Wis.) to identify ORFs and other features.
The sequences were also analyzed using BLAST algorithms (National
Center for Biotechnology Information) for homology comparison to
DNA sequences in the public databases.
[0169] The recombinant plasmid clone identified as containing the
complete N. caninum GRA1 ORF was designated as pRC77 (ATCC 209685).
The total length of the cDNA insert sequence in pRC77 is 1,265 bp,
with the GRA1 ORF extending from nts 205-777 (SEQ ID NO: 1). The
deduced amino acid sequence of the N. caninum GRA1 protein is
presented as SEQ ID NO: 2. The nucleotide sequence of the N.
caninum GRA1 ORF has .about.55% similarity to the nucleotide
sequence of the T. gondii GRA1 ORF. The deduced amino acid sequence
of the N. caninum GRA1 protein has .about.51% similarity to the
deduced amino acid sequence of the T. gondii GRA1 protein.
[0170] The recombinant plasmid clone identified as containing the
complete N. caninum GRA2 ORF was designated as pRC5 (ATCC 209686).
The total length of the cDNA insert sequence in pRC5 is 1,031 bp,
with the GRA2 ORF extending from nts 25-660 (SEQ ID NO: 4). The
deduced amino acid sequence of the N. caninum GRA2 protein is
presented as SEQ ID NO: 5. The nucleotide sequence of the N.
caninum GRA2 ORF has .about.37% similarity to the nucleotide
sequence of the T. gondii GRA2 ORF. The deduced amino acid sequence
of the N. caninum GRA2 protein has .about.26% similarity to the
deduced amino acid sequence of the T. gondii GRA2 protein.
[0171] The recombinant plasmid clone identified as containing the
complete N. caninum SAG1 ORF was designated as pRC102 (ATCC
209687). The total length of the cDNA insert sequence in pRC102 is
1,263 bp, with the SAG1 ORF extending from nts 130-1,089 (SEQ ID
NO: 6). The deduced amino acid sequence of the N. caninum SAG1
protein is presented as SEQ ID NO: 7. The nucleotide sequence of
the N. caninum SAG1 ORF has .about.58% similarity to the nucleotide
sequence of the T. gondii SAG1 ORF. The deduced amino acid sequence
of the N. caninum SAG1 protein has .about.49% similarity to the
deduced amino acid sequence of the T. gondii SAG1 protein.
[0172] The recombinant plasmid clone identified as containing the
complete N. caninum MIC1 ORF was designated as pRC340 (ATCC
209688). The total length of the cDNA insert sequence in pRC340 is
2,069 bp, with the MIC1 ORF extending from nts 138-1,520 (SEQ ID
NO: 8). The deduced amino acid sequence of the N. caninum MIC1
protein is presented as SEQ ID NO: 9. The nucleotide sequence of
the N. caninum MIC1 ORF has .about.58% similarity to the nucleotide
sequence of the T. gondii MIC1 ORF. The deduced amino acid sequence
of the N. caninum MIC1 protein has .about.47% similarity to the
deduced amino acid sequence of the T. gondii MIC1 protein.
[0173] 5.3. Identification of the GRA1 Gene Sequence
[0174] A genomic DNA library of N. caninum strain NC-1 was
constructed in bacteriophage .lambda.-II vector (Stratagene)
according to conventional techniques. cDNA sequences derived from
pRC77 (ATCC 209685) were PCR amplified as follows, and the
resulting PCR amplified DNA fragment was used as a probe to screen
the N. caninum strain NC-1 genomic DNA library. Primers bd219 and
bd220 specific to N. caninum GRA1 cDNA were used to amplify a 563
bp fragment corresponding to the ORF of N. caninum GRA1 cDNA
(pRC77). bd219 is 5'-GCCGCGACTTCTTTTTCTCT (SEQ ID NO: 16) and bd220
is 5'-CTCGATCGCCTCCUTTACTG (SEQ ID NO: 17). The 563 bp fragment was
purified by electrophoresis using SeaPlaque low melting agarose
(LMA) (FMC Bioproducts). The band was excised from the gel and
subsequently used in random prime labeling reactions to generate a
probe in preparation for screening a Neospora genomic library.
[0175] 2.5.times.10.sup.5 pfu from a N. caninum genomic library
(.lambda.DASH Stratagene #845201) were plaque-lifted onto Hybond N+
nylon membrane (Amersham). Duplicate filters were screened using
the 563 bp GRA1 cDNA fragment as a probe. Nine duplicate pfus were
scored positive and subsequently cored in 1 ml SM buffer. Four of
these clones (#5-8) were carried forward to secondary screening. On
secondary screening, 500-1000 pfu per clone were plaque-lifted onto
duplicate filters. All four Gra1 clones were positive on secondary
screening and were isolated as individual plaques.
[0176] A .lambda. clone designated as Gra1#8 was identified by this
procedure, and was used as a template for PCR amplification using
primers bd256 and bd254. Primer bd256 is 5'-TGCTAGTACTGGCGAGTGAA
(SEQ ID NO: 18). Primer bd254 is 5'-CAGGTTTGCCACACATTTTT (SEQ ID
NO: 19). The PCR fragment obtained was subcloned into pGEM-T EASY
vector (Promega, Madison, Wis.). The cloned fragment was sequenced
employing fluorescent labelling and Sanger dideoxy chain
termination sequencing technology. Sequence analysis revealed that
the cloned fragment contained the GRA1 gene. The GRA1 gene sequence
(SEQ ID NO: 3) contains an ORF from nt 605 to nt 855 and from nt
983 to nt 1304, which shares complete identity to the GRA1 cDNA
sequence (SEQ ID NO: 1) of pRC77 (ATCC 209685) from nt 205 to nt
777. However, the GRA1 gene sequence (SEQ ID NO: 3) differs from
the cDNA sequence (SEQ ID NO: 1) at a single nucleotide position in
the 3' untranslated region at nt 1728 of the GRA1 gene where a
thymine resides, instead of a guanine at nt 1201 of pRC77. This
difference may be due to a RFLP or a sequencing error in pRC77
because this nucleotide discrepancy was confirmed in 2 separate
subclones from the GRA1#8 .lambda. genomic clone. The GRA1 gene
sequence (SEQ ID NO: 3) further comprises an intron extending from
nt 856 to nt 982. Furthermore, three promoter motifs have been
identified within 150 bp. 5' of the mRNA start site that are
similar to those found in T. gondii GRA genes (Mercier et al, 1996,
Mol. Microbiol. 21:421-428).
[0177] 5.4. Identification of the SAG1 Gene Sequence
[0178] Oligonucleotide primers specific to the SAG1 gene were
synthesized based on the SAG1 ORF of the DNA sequence obtained from
pRC102. The first primer, designated as NCSAG1 5', was
5'-ATGTTTCCTCCTCGGGCAGTG (SEQ ID NO: 20); and the second primer,
designated as NCSAG1 3', was 5'-TCACGCGACGCCAGCCGCTATCG (SEQ ID NO:
21). It was later determined that primer NCSAG1 5', as presented
above, was inadvertently designed to include an additional three
nucleotides (CCT), and the presence of these three additional
nucleotides was thus taken into account when determining the actual
SAG1 gene sequence.
[0179] PCR was performed using primers NCSAG1 5' (SEQ ID NO: 20)
and NCSAG1 3' (SEQ ID NO: 21) on N. caninum strain NC-1 genomic DNA
as template. An .about.1 kb amplified fragment was obtained, which
was cloned in plasmid pCR2.1 and in pBlunt (Invitrogen, Carlsbad,
Calif.) according to manufacturers recommendations. Recombinant
plasmids identified to contain the genomic SAG1 PCR fragment were
sequenced employing fluorescent labeling and Sanger dideoxy chain
termination sequencing technology using standard `universal`,
`reverse` and the following oligonucleotides: NCSAG1200:
5'-GCCCTGACAATTCGACCGCC (SEQ ID NO: 22); NCSAG1500:
5'-CCCACAACATCCAAGTCGTTC (SEQ. ID NO: 23); NCSAG1660:
5'-GTTTTGCACCATCCTTAGTG (SEQ ID NO: 24); and NCSAG1320:
5'-GAGAGTTTGCTTTGCACCG (SEQ ID NO: 25). The DNA sequences obtained
were assembled using the DNAStar software package, and were found
to be identical to the sequence of the SAG1 ORF educed from pRC102.
Thus, the genomic sequence of the SAG1 gene is identical to that
obtained from cDNA sequencing.
[0180] 5.5. Identification of the MIC1 Gene Sequence
[0181] A .about.2.2 kb DNA fragment was PCR amplified from N.
caninum genomic DNA using oligonucleotides specific for the 5' and
3' ends of the MIC1 cDNA fragment (see sequence of pRC340). Thermal
cycling conditions were as follows: 94.degree. C., 1 min, 1 cycle;
94.degree. C., 45 sec, 54.degree. C., 45 sec, 72.degree. C., 2 min,
29 cycles; 72.degree. C., 5 min, 1 cycle. This .about.2.2 kb
fragment plasmids were into pCR2.1 and into pZEROBLUNT (Invitrogen,
Carlsbad, Calif.). Recombinant plasmids were identified by standard
restriction analysis, and representative clones were sequenced
using fluorescent labelling and Sanger dideoxy chain termination
technology. Locations of exons and introns were identified by
comparison to the MIC1 cDNA sequence from pRC340.
[0182] The total length of the MIC1 gene region is 2278 bp (SEQ ID
NO: 10), comprising an ORF from nt 1 to nt 73, nt 345 to nt 811, nt
1187 to nt 1265, and nt 1515 to nt 2278, with three intervening
introns.
[0183] 5.6. Identification of the MAG1 Gene Sequence
[0184] BspDI, EcoRI and HindIII Vectorette libraries (Genosys) were
prepared according to manufacturer's protocols using genomic clone
Gra1#8 as template DNA. Using the antisense primer bd234 specific
for 5' GRA1 cDNA, and Vectorette :primer II (ER-70); a .infin.2 kb
fragment was amplified from the HindIII Vectorette library using
Klentaq (AB Peptide Inc.) and PFU (Stratagene) polymerases. Primer
bd234 is 5'-CCAGCCGAGTTCGTGTTCAGA (SEQ ID NO: 26), and primer ER-70
is CAACGTGGATCCGATTCAAGCTTC (SEQ ID NO: 27). The product was run on
a 1% LMA gel, excised, and used directly in a cloning reaction with
pGEM-T EASY vector. Transformation into E. coli DH5.alpha. produced
several white colonies. NotI restriction analysis of DNA from
twenty different white clones indicated that 18 of 20 clones
contained the appropriate sized insert. Subclone 2 was selected to
be grown as stock and this plasmid was renamed bd245. The PCR
product from the Vectorette 2 kb Gra1 promoter fragment was
sequenced from both ends using nested primer bd218 and the
Vectorette sequencing primer. The sequence of primer bd218 is
5'-AAAGCTCTTCGGCAGTTCAA (SEQ ID NO: 28). The complete sequence of
plasmid bd245 was generated by standard primer walking using Sanger
fluorescent dideoxy chain termination sequencing technology.
[0185] Primer bd252 was used in combination with a variant of
primer T7, and Gra1#8 DNA as template, in a PCR to map one end of
clone Gra1#8. Primer bd252' is 5'-CCGCGCTACCACTTTCCA (SEQ ID NO:
29). The T7 primer variant is 5'-GTAATACGACTCACTATA (SEQ ID NO:
30). A .about.2.5 kb-fragment was amplified using primer bd252 and
the T7 variant, which product was subcloned into pGEM-T EASY
vector, and this plasmid was named bd282. Primer walking, using
fluorescent labeling and Sanger dideoxy chain termination
sequencing technology, was employed to complete the entire sequence
of plasmid bd282.
[0186] Sequences from plasmids bd245 and bd282 were used to
generate the contiguous sequence shown in SEQ ID NO: 11, encoding
the MAG1 gene which was identified using WU-BLAST2 (Washington
University BLAST version 2). Results indicate that this sequence
has homology to the T. gondii MAG1 gene (Accession No. U09029).
Putative exon/intron boundaries were identified by intron splice
site consensus sequences and alignment with the T. gondii MAG1
sequence, which suggested an mRNA transcript from nt 704 to nt 820
(exon 1), from nt 1301 to nt 1399 (exon 2), from nt 1510 to nt 1808
(exon 3), and from nt 1921 to nt 3297 (exon 4), with intervening
introns. Based on these putative exon/intron boundaries, a proposed
cDNA sequence is presented as SEQ ID NO: 12, and an amino acid
sequence deduced. therefrom is provided as SEQ ID NO: 13.
Comparison of exon and intron boundaries between T. gondii and N.
caninum indicate that exons 1-3 and introns 1-2 of the MAG1 gene
are relatively positionally conserved between the two organisms.
Intron 3 and exon 4 splice sites are unique to N. caninum MAG1. SEQ
ID NO: 11 also comprises a portion of the GRA1 gene sequence of
GRA1, from nt 1 to nt 126, and the complete intervening putative
bidirectional GRA1/MAG1 promoter region, from nt 127 to nt 703.
[0187] DNA from lambda Gra1#8 clone was digested with NotI to
release insert DNA, which was subsequently extracted with
phenol/chloroform, precipitated and resuspended in water. DNA from
this preparation was ligated to purified NotI digested BS KS+
vector DNA (Stratagene), and thereafter transformed into E. coli
DH5.alpha. cells. Clones were screened by PCR using primers
specific for GRA1 and MAG1 genes, and further verified by NotI
restriction, digestion for the presence of the 16 kb lambda GRA1#8
NotI insert. The primers used for PCR were GRA1 primers 219 (SEQ ID
NO: 16) and 220 (SEQ ID NO: 17), and MAG1 primers 261 and 270.
Primer 261 is 5'-CCGCAACGTGCTGTTCCTA (SEQ ID NO: 31); and primer
270 is 5'-CATCAGAGAAACTGGAGT (SEQ ID NO: 32). A positive plasmid
clone containing the BS KS+ vector ligated to the NotI insert from
lambda Gra1#8 was identified and named bd304 (ATCC 203413).
[0188] 5.7. Identification of the MAG1 and GRA1 Promoters of
Neospora
[0189] 5.7.1. Background on T. gondii GRA1 Promoter Elements
[0190] Functional mutational analysis of the T. gondii GRA1
promoter and sequence comparison to another well-defined T. gondii
promoter (SAG1) identified a heptanucleotide motif (TGAGACG) which
confers basal GRA1 promoter activity in an orientation-independent
manner( Mercier et al., 1996, Mol. Micro. 21:421-428). Two
additional heptanucleotide motifs in the GRA1 promoter confer
additional transcriptional activity. The T. gondii GRA1 promoter is
contained within the upstream, proximal region from -129 to -47
relative to the GRA1 transcription start site. Significant promoter
elements in this T. gondii GRA1 region include 1 CAAT box, 1
heptanucleotide motif in direct orientation and 2 heptanucleotide
motifs in an inverse orientation. Three additional heptanucleotide
motifs were identified upstream (-349 to -204) of the T. gondii
GRA1 promoter but do not confer significant increase to the -129 to
-47 promoter element.
[0191] 5.7.2. Neospora MAG1-GRA1 Promoter Elements
[0192] Genomic sequence analysis of the complete MAG1-GRA1 region
of N. caninum strain NC-1 indicates that the two genes are arranged
in a head to head configuration. There is a 577 bp region between
the putative translational start sites for the MAG1, and GRA1 genes
(SEQ ID NO: 11 from nt 127 to nt 703) that contains the putative
MAG1/GRA1 bidirectional promoter. Sequence analysis of this 577 bp
region identifies three inverted: heptanucleotide motifs (CGTCTCA
or CGTCTCT) as described for the T. gondii GRA1 promoter (Mercier
et al., 1996, above). Two CAAT boxes flank these heptanucleotide
motifs; one CAAT box is oriented toward the GRA1 gene and the
second CAAT box is oriented toward the MAG1 gene. The Table below
lists the promoter elements found in the N. caninum MAG1/GRA1
bidirectional promoter region.
1 TABLE position to putative transcriptional start promoter element
site defined by pRC77.sup.a CAAT box -133 to -130 CAAT box
(reverse)* -49 to -52 CGTCTCA** -125 to -119 CGTCTCA** -106 to -100
CGTCTCT** -70 to -64 .sup.aNucleotide positions are in reference to
the putative transcription start site defined by the 5' end of the
GRA1 cDNA (pRC77). *This CAAT box is read from the complement
strand and is oriented toward the MAG1 gene (65 kDa). **Inverted
heptanucleotide promoter motifs; as defined by Mercier et al. 1996,
above.
[0193] 5.7.3. Construction of Neospora GRA1 Promoter Construct
[0194] The functionality of the 577 bp putative MAG1/GRA1
bidirectional promoter containing the two heptanucleotide motifs
and two CAAT boxes was tested by engineering a plasmid containing
the LacZ reporter gene downstream of this defined sequence and then
transfecting this plasmid into NC-1 tachyzoites. A Bluescript
plasmid, designated as GLS, containing the T. gondii GRA1 promoter
driving LacZ expression and containing a T. gondii SAG1 3' end, was
provided by Dr. David Sibley, Washington University School of
Medicine, St. Louis, Mo., USA. HindIII/NsiI digestion of plasmid
GLS removed the T. gondii GRA1 promoter fragment, and subsequent
LMA purification was performed to generate a promoter-less LacZ
reporter vector. Primers HindIII-bd256
(5'-GGCCAAGCTTGCTAGTACTGGCGA; SEQ ID NO: 33) and bd260-NsiI
(5'-ATCCAATGCATCTTGCTGAATGCCTTAAAAG; SEQ ID NO: 34) were used in an
amplification reaction with lambda clone gra1#8 as template, and
PFU and Klentaq polymerases, to generate an .about.600 bp promoter
fragment containing the 5' untranslated region from the Neospora
GRA1 gene. This fragment was digested with HindIII/NsiI, purified
on LMA, and subsequently used in a ligation reaction with the above
described promoter-less LacZ reporter vector to generate plasmid
clone bd266. A PCR reaction with primers HindIII-bd256 and
bd260-NsiI was performed with plasmid clone bd266 to verify
insertion of the N. caninum GRA1 promoter.
[0195] N. caninum NC-1 tachyzoites (1.times.10.sup.7) were
transfected by electroporation with 5 .mu.g or 50 .mu.g of uncut
plasmid bd266 or plasmid GLS at 1.4V, 10 uF, in cytomix buffer as
described by Howe et al., 1997, METHODS: A COMPANION TO METHODS IN
ENZYMOLOGY 13:1-11. Electroporated NC-1 cells were allowed to
infect MARC-145 monkey kidney cells in a T25 flask (80% confluency)
for 3 days before harvesting for a .beta.-galactosidase assay.
Cells were harvested by removing 3 ml of media and using the
remaining 1 ml of media to scrape cells from flask. Harvested cells
were transferred to a microcentrifuge and spun. Supernatant was
discarded, and the pelleted cells were resuspended in 100 .mu.l of
lysis buffer (Howe et al., 1997, above). Tubes were stored at
-20.degree. C. until the .beta.-galactosidase assay was
performed.
[0196] To conduct the .beta.-galactosidase assay, tubes were
thawed, mixed, incubated at 50.degree. C. for 1 hr, and then spun
in a microcentrifuge. Fifty .mu.l of supernatant was used per
sample. The .beta.-galactosidase assay was performed as described
by Howe et al., 1997, above. A standard curve was prepared using a
strain of N. caninum that had been stably transfected with the
plasmid GLS, as provided by Dr. David Sibley. Tachyzoites were
harvested, counted, resuspended in lysis buffer at 10.sup.4
parasites/ml, and subsequently processed as above (i.e., incubated
at 50.degree. C. for 1 hr.). Twelve serial dilutions from this
preparation were made in a range of from about 20,000 to about 10
parasites per well, and were used to create a standard curve in the
.beta.-galactosidase assay.
[0197] 5.7.4. Results
[0198] Samples containing cell lysate from N. caninum strain NC-1
transfected with plasmid bd266 gave the highest
.beta.-galactosidase readings compared to samples containing cell
lysate from N. caninum strain NC-1 transfected with plasmid GLS.
Using the extracted value from the standard curve for bd266 (50
.mu.g plasmid), the .beta.-galactosidase reading was equivalent to
7013 parasites from the N. caninum cell line stably transformed
with plasmid GLS described above. These experiments provide the
first evidence that the N. caninum GRA1 promoter is functional, and
that the promoter elements lie within the .about.600 bp genomic
fragment defined by primers HindIII-bd256 and bd260-NsiI.
6. EXAMPLE
[0199] Expression and Immunoreactivity of a Recombinant N. caninum
MIC1 Protein
[0200] DNA sequences representing the MIC1 ORF were PCR-amplified
and cloned into pQE50 (Qiagen), which is a recombinant system that
facilitates inducible high level expression of the cloned sequence.
The recombinant plasmid was designated as pQEmic1. Whole cell
lysates from uninduced and induced E. coli cells containing pQEmic1
were examined by SDS-PAGE and Coomassie blue protein staining. A
polypeptide with a molecular weight of .about.57 kDa was identified
in induced, but not in uninduced, E. coli cells carrying pQEmic1.
The molecular weight of the MIC1 polypeptide as estimated from the
deduced amino acid sequence of MIC1 (SEQ ID NO: 9) is .about.49
kDa.
[0201] Whole, cell lysates of induced and uninduced E. coli
carrying pQEmic1 were run on SDS-PAGE, and the proteins were
transferred to PVF membranes (Novex) by standard procedures. The
membranes were then blocked using 1% polyvinyl alcohol (PVA) in
phosphate buffered saline (PBS). Following this, the membranes,
were rinsed three times in PBS containing 0.05% Tween-20 (PBST).
The membranes were then incubated for about 1 hr either in a
solution containing pooled polyclonal antisera from a naturally N.
caninum-infected cattle herd (a gift from Dr. John Ellis,
University of Technology, Sydney, Australia), or in a solution
containing polyclonal antisera from rabbits experimentally infected
with T. gondii (a gift from Dr. R. A. Cole, National Wildlife
Health Center, Madison, Wis.). The membranes were then washed
3.times. with PBST, and reacted with goat anti-bovine or
anti-rabbit IgG/alkaline phosphate conjugate (Kirkegaard and Perry
Labs, Gaithersburg, Md.), as appropriate, diluted 1:500 according
to manufacturers recommendations. The membranes were washed in PBST
again and bands were detected by incubating the membranes briefly
in BCIP/NBT reagent ((Kirkegaard and Perry Labs), followed by
rinsing in dH.sub.2O. The recombinantly-expressed MIC1 protein was
found to have specific reactivity to both N. caninum and T. gondii
polyclonal antisera.
7. EXAMPLE
[0202] Vaccine Formulations
[0203] A vaccine against neosporosis is formulated by combining a
N. caninum protein of the present invention, such as, e.g., SAG1,
at about 100 .mu.g/ml with an equal volume of modified SEAM62
adjuvant, followed by gentle mixing, and storage at 4.degree. C.,
for primary and boost immunizations. A primary dose of about 2 ml
(total 100 .mu.g) is administered subcutaneously to cattle,
followed by a booster vaccination three weeks later. After two
weeks following boost vaccination, cattle can be bred. Vaccines
comprising a GRA1, GRA2, MIC1 or MAG1 protein of the present
invention, or combinations thereof, can also be formulated and
administered in this manner.
[0204] Deposit of Biological Materials
[0205] The following biological materials were deposited with the
American Type Culture Collection (ATCC) at 12301 Parklawn Drive,
Rockville, Md., 20852, USA, on Mar. 19, 1998, and were assigned the
following accession numbers:
2 Plasmid ATOC Accession No. pRC77 209685 pRC5 209686 pRC102 209687
pRC340 209688
[0206] The following additional biological material was deposited
with the ATCC, at 10801 University Blvd, Manassas, Va., 20110, USA,
on Nov. 9, 1998, and was assigned the following accession
number:
3 Plasmid ATCC Accession No. bd304 203413
[0207] All patents, patent applications, and publications cited
above are incorporated herein by reference in their entirety.
[0208] The present invention is not limited in scope by the
specific embodiments described, which are intended as single
illustrations of individual aspects of the invention. Functionally
equivalent compositions and methods are within the scope of the
invention. Indeed, various modifications of the invention, in
addition to those shown and described herein, will become apparent
to those skilled in the art from the foregoing description. Such
modifications are intended to fall within the scope of the appended
claims.
Sequence CWU 1
1
34 1 1265 DNA Neospora caninum CDS (205)..(777) 1 gtttcatcgt
tgaactgccg aagagcttta tgtttttgcc gcgacttctt tttctctccc 60
ctgaataaat tgtaccgtgg gtggcgtaca cgtctgaaca cgaactcggc tgggtttgct
120 tttgtggacg tgtttttccg gctcaaataa tttcattttc attgttcata
cgtgtttgtg 180 atctctttta aggcattcag caag atg gtg cgt gtg agc gct
att gtt ggg 231 Met Val Arg Val Ser Ala Ile Val Gly 1 5 gtt gca gcc
tcg gtg gtt ctc tcc ctt tct tcc ggc gtg tac gcg gcc 279 Val Ala Ala
Ser Val Val Leu Ser Leu Ser Ser Gly Val Tyr Ala Ala 10 15 20 25 gag
gga gcg gaa aaa ccc ttg gga ggc gaa ggt caa gcg cct acc ttg 327 Glu
Gly Ala Glu Lys Pro Leu Gly Gly Glu Gly Gln Ala Pro Thr Leu 30 35
40 ttg tca atg cta ggt ggc ggg cgc gcg gga agg ggg ttg tca gtc gga
375 Leu Ser Met Leu Gly Gly Gly Arg Ala Gly Arg Gly Leu Ser Val Gly
45 50 55 caa tca gta gac ctt gac ctg atg ggc aga cgc tac cga gtg
acc aga 423 Gln Ser Val Asp Leu Asp Leu Met Gly Arg Arg Tyr Arg Val
Thr Arg 60 65 70 tcc gag ggt gcg cca gat gtg ctc gag atc tcc gtt
ctg gac gcg gat 471 Ser Glu Gly Ala Pro Asp Val Leu Glu Ile Ser Val
Leu Asp Ala Asp 75 80 85 ggg aag gct tct cac atc ggc ttt gta agc
att ccg gaa gtg atg gac 519 Gly Lys Ala Ser His Ile Gly Phe Val Ser
Ile Pro Glu Val Met Asp 90 95 100 105 acc gtg gcg cgc atg cag aag
gac gag gga att ttc ctt gat gcg tta 567 Thr Val Ala Arg Met Gln Lys
Asp Glu Gly Ile Phe Leu Asp Ala Leu 110 115 120 agt aaa gga gaa aca
gta aag gag gcg atc gag gat gtt gct gca gcg 615 Ser Lys Gly Glu Thr
Val Lys Glu Ala Ile Glu Asp Val Ala Ala Ala 125 130 135 gaa ggt ctt
tct ccc gag cag act gaa aac ctg gag gaa acg gtg gcc 663 Glu Gly Leu
Ser Pro Glu Gln Thr Glu Asn Leu Glu Glu Thr Val Ala 140 145 150 gct
gta gcg act ctt gtt cgt gac gag atg gaa gtt ctt aaa gat cag 711 Ala
Val Ala Thr Leu Val Arg Asp Glu Met Glu Val Leu Lys Asp Gln 155 160
165 gag aag cta gaa gag gat gca gaa aag ctt gcg gga gat tta gaa gct
759 Glu Lys Leu Glu Glu Asp Ala Glu Lys Leu Ala Gly Asp Leu Glu Ala
170 175 180 185 ctt caa ggg caa cat taa tttgcaaagg gattgtcatg
tagccatatg 807 Leu Gln Gly Gln His 190 ttcaatcgcc ctcaaaagtc
gactggggtg ttttggcaca tgtctgcagt tggtttggat 867 cgacggcatg
ggttagcgat ggagaaaacg gatcgatggt tgacagttgc cgaaggaaat 927
cggttgcgtc gtgtaaggaa agtgtcacgg gggcattgag atttggaggg gctcttgaag
987 ccttcctcgg tggcaccaga ggggcagagc tcaacgcaag cgtggtatat
ggagctggag 1047 cagtggccgc aacgcagcag ggcggcgtga attacgttgc
gttagtgctg gcgtgaaacg 1107 tcgtgttctc aacccgagta caatgtagtt
tcaggtggtc gttgctcgaa tccgtgtgtc 1167 gcgcctgtgt tgtatagtgt
ttcgcattat gtggagacgg ggacgttttt aaaaaatcaa 1227 aaatgtgtgg
caaacctgaa aaaaaaaaaa aaaaaaaa 1265 2 190 PRT Neospora caninum 2
Met Val Arg Val Ser Ala Ile Val Gly Val Ala Ala Ser Val Val Leu 1 5
10 15 Ser Leu Ser Ser Gly Val Tyr Ala Ala Glu Gly Ala Glu Lys Pro
Leu 20 25 30 Gly Gly Glu Gly Gln Ala Pro Thr Leu Leu Ser Met Leu
Gly Gly Gly 35 40 45 Arg Ala Gly Arg Gly Leu Ser Val Gly Gln Ser
Val Asp Leu Asp Leu 50 55 60 Met Gly Arg Arg Tyr Arg Val Thr Arg
Ser Glu Gly Ala Pro Asp Val 65 70 75 80 Leu Glu Ile Ser Val Leu Asp
Ala Asp Gly Lys Ala Ser His Ile Gly 85 90 95 Phe Val Ser Ile Pro
Glu Val Met Asp Thr Val Ala Arg Met Gln Lys 100 105 110 Asp Glu Gly
Ile Phe Leu Asp Ala Leu Ser Lys Gly Glu Thr Val Lys 115 120 125 Glu
Ala Ile Glu Asp Val Ala Ala Ala Glu Gly Leu Ser Pro Glu Gln 130 135
140 Thr Glu Asn Leu Glu Glu Thr Val Ala Ala Val Ala Thr Leu Val Arg
145 150 155 160 Asp Glu Met Glu Val Leu Lys Asp Gln Glu Lys Leu Glu
Glu Asp Ala 165 170 175 Glu Lys Leu Ala Gly Asp Leu Glu Ala Leu Gln
Gly Gln His 180 185 190 3 1774 DNA Neospora caninum 3 tgctagtact
ggcgagtgaa atgcgacgct cactgtagcc tccagataca cgacctgttg 60
cggagctgac gctctcccca ctagagttca tgagcgatgg ggcgatggta gaccaacggt
120 ccctagcgct tcggctgttg cgcggcggct cttaagagcg ggacgaccgc
ctttcaggtg 180 aaccgcctag tatcccaagc acacgaacat cccactcatg
ggctggcgga actgctcgca 240 gcggttacgc aaacacagtt gcgacgcaat
gagccgtctc aagttgctgt cctcgtctca 300 tttcggatcg gttcccaggt
cctccggtgc gtctctgtcg gaaggttatt gcaactccgt 360 tctgcgctgg
gattagttta aatcatttca ttaatttgca gtttcatcgt tgaactgccg 420
aagagcttta tgtttttgcc gcgacttctt tttctctccc ctgaataaat tgtaccgtgg
480 gtggcgtaca cgtctgaaca cgaactcggc tgggtttgct tttgtggacg
tgtttttccg 540 gctcaaataa tttcattttc attgttcata cgtgtttgtg
atctctttta aggcattcag 600 caagatggtg cgtgtgagcg ctattgttgg
ggttgcagcc tcggtggttc tctccctttc 660 ttccggcgtg tacgcggccg
agggagcgga aaaacccttg ggaggcgaag gtcaagcgcc 720 taccttgttg
tcaatgctag gtggcgggcg cgcgggaagg gggttgtcag tcggacaatc 780
agtagacctt gacctgatgg gcagacgcta ccgagtgacc agatccgagg gtgcgccaga
840 tgtgctcgag atctcgtaag tagactactg gtgttcaacg aaaaaaaagt
acttgcgctg 900 tggaatgtcg tctgtgtgtt agctgcatca tgtgataagc
aaacatttgt tttcgagcgt 960 gtgttgtctc gcgtgctttc agcgttctgg
acgcggatgg gaaggcttct cacatcggct 1020 ttgtaagcat tccggaagtg
atggacaccg tggcgcgcat gcagaaggac gagggaattt 1080 tccttgatgc
gttaagtaaa ggagaaacag taaaggaggc gatcgaggat gttgctgcag 1140
cggaaggtct ttctcccgag cagactgaaa acctggagga aacggtggcc gctgtagcga
1200 ctcttgttcg tgacgagatg gaagttctta aagatcagga gaagctagaa
gaggatgcag 1260 aaaagcttgc gggagattta gaagctcttc aagggcaaca
ttaatttgca aagggattgt 1320 catgtagcca tatgttcaat cgccctcaaa
agtcgactgg ggtgttttgg cacatgtctg 1380 cagttggttt ggatcgacgg
catgggttag cgatggagaa aacggatcga tggttgacag 1440 ttgccgaagg
aaatcggttg cgtcgtgtaa ggaaagtgtc acgggggcat tgagatttgg 1500
aggggctctt gaagccttcc tcggtggcac cagaggggca gagctcaacg caagcgtggt
1560 atatggagct ggagcagtgg ccgcaacgca gcagggcggc gtgaattacg
ttgcgttagt 1620 gctggcgtga aacgtcgtgt tctcaacccg agtacaatgt
agtttcaggt ggtcgttgct 1680 cgaatccgtg tgtcgcgcct gtgttgtata
gtgtttcgca ttatgtgtag acggggacgt 1740 ttttaaaaaa tcaaaaatgt
gtggcaaacc tgaa 1774 4 1031 DNA Neospora caninum CDS (25)..(660) 4
aaataggggt ttcagcacca cacg atg ttc acg ggg aaa cgt tgg ata ctt 51
Met Phe Thr Gly Lys Arg Trp Ile Leu 1 5 gtt gtt gcc gtt ggc gcc ctg
gtc ggc gcc tcg gta aag gca gcc gat 99 Val Val Ala Val Gly Ala Leu
Val Gly Ala Ser Val Lys Ala Ala Asp 10 15 20 25 ttt tct ggc agg gga
acc gtc aat gga cag ccg gtt ggc agc ggt tat 147 Phe Ser Gly Arg Gly
Thr Val Asn Gly Gln Pro Val Gly Ser Gly Tyr 30 35 40 tcc gga tat
ccc cgt ggc gat gat gtt aga gaa tca atg gct gca ccc 195 Ser Gly Tyr
Pro Arg Gly Asp Asp Val Arg Glu Ser Met Ala Ala Pro 45 50 55 gaa
gat ctg cca ggc gag agg caa ccg gag aca ccc acg gcg gaa gct 243 Glu
Asp Leu Pro Gly Glu Arg Gln Pro Glu Thr Pro Thr Ala Glu Ala 60 65
70 gta aaa cag gca gcg gca aaa gct tat cga tta ctc aag cag ttt act
291 Val Lys Gln Ala Ala Ala Lys Ala Tyr Arg Leu Leu Lys Gln Phe Thr
75 80 85 gcg aag gtc gga cag gaa act gag aac gcc tac tac cac gtg
aag aaa 339 Ala Lys Val Gly Gln Glu Thr Glu Asn Ala Tyr Tyr His Val
Lys Lys 90 95 100 105 gcg aca atg aaa ggc ttt gac gtt gca aaa gac
cag tcg tat aag ggc 387 Ala Thr Met Lys Gly Phe Asp Val Ala Lys Asp
Gln Ser Tyr Lys Gly 110 115 120 tac ttg gcc gtc agg aaa gcc aca gct
aag ggc ctg cag agc gct ggc 435 Tyr Leu Ala Val Arg Lys Ala Thr Ala
Lys Gly Leu Gln Ser Ala Gly 125 130 135 aag agc ctt gag ctt aaa gag
tcg gca ccg aca ggc act acg act gcg 483 Lys Ser Leu Glu Leu Lys Glu
Ser Ala Pro Thr Gly Thr Thr Thr Ala 140 145 150 gcg ccg act gaa aaa
gtg ccc ccc agt ggc ccg cga tca ggt gaa gtt 531 Ala Pro Thr Glu Lys
Val Pro Pro Ser Gly Pro Arg Ser Gly Glu Val 155 160 165 cag cgt act
cgt aaa gag caa aat gac gtg cag caa acc gca gag atg 579 Gln Arg Thr
Arg Lys Glu Gln Asn Asp Val Gln Gln Thr Ala Glu Met 170 175 180 185
ttg gct gag gaa att ctt gag gct ggg ctt aag aag gac gat gga gaa 627
Leu Ala Glu Glu Ile Leu Glu Ala Gly Leu Lys Lys Asp Asp Gly Glu 190
195 200 gga cgg gga acg cca gaa gct gaa gtc aat taa gaaaatcact
aaacgtcaag 680 Gly Arg Gly Thr Pro Glu Ala Glu Val Asn 205 210
ttctttatga ctgctgtaca ccaccacccc cctggactgc ttaagacagc taacaagcgt
740 tggatttcaa tatcctactt aaggtatgtg gggcggatgt cgtgtcacgg
tgtgtatggc 800 gttaaaaaac ggcacacggc attaaatgca gtgcaagtat
gaattgtgcg caggttgtgt 860 gtgacatttt tcggatgtcc tgggctttgt
gtgcgtgcgt gggctgcgaa gagattagat 920 ttatttcttg cgattgcgat
gcgtagtttg ttgcatcgtt atggtcatga aaaaagtcta 980 acgacacaca
taaacgatgg agcaaattaa aaaaaaaaaa aaaaaaaaaa a 1031 5 211 PRT
Neospora caninum 5 Met Phe Thr Gly Lys Arg Trp Ile Leu Val Val Ala
Val Gly Ala Leu 1 5 10 15 Val Gly Ala Ser Val Lys Ala Ala Asp Phe
Ser Gly Arg Gly Thr Val 20 25 30 Asn Gly Gln Pro Val Gly Ser Gly
Tyr Ser Gly Tyr Pro Arg Gly Asp 35 40 45 Asp Val Arg Glu Ser Met
Ala Ala Pro Glu Asp Leu Pro Gly Glu Arg 50 55 60 Gln Pro Glu Thr
Pro Thr Ala Glu Ala Val Lys Gln Ala Ala Ala Lys 65 70 75 80 Ala Tyr
Arg Leu Leu Lys Gln Phe Thr Ala Lys Val Gly Gln Glu Thr 85 90 95
Glu Asn Ala Tyr Tyr His Val Lys Lys Ala Thr Met Lys Gly Phe Asp 100
105 110 Val Ala Lys Asp Gln Ser Tyr Lys Gly Tyr Leu Ala Val Arg Lys
Ala 115 120 125 Thr Ala Lys Gly Leu Gln Ser Ala Gly Lys Ser Leu Glu
Leu Lys Glu 130 135 140 Ser Ala Pro Thr Gly Thr Thr Thr Ala Ala Pro
Thr Glu Lys Val Pro 145 150 155 160 Pro Ser Gly Pro Arg Ser Gly Glu
Val Gln Arg Thr Arg Lys Glu Gln 165 170 175 Asn Asp Val Gln Gln Thr
Ala Glu Met Leu Ala Glu Glu Ile Leu Glu 180 185 190 Ala Gly Leu Lys
Lys Asp Asp Gly Glu Gly Arg Gly Thr Pro Glu Ala 195 200 205 Glu Val
Asn 210 6 1263 DNA Neospora caninum CDS (130)..(1089) 6 tctgcgtgca
gccttccgtt gttctcgctt gtatcacagg tgcctttgtc gtacataaac 60
attgtttcga ttgtagtcta gtcacaccgc actcgtttca tcactggcgc ttttgtttat
120 tcatcgaat atg ttt cct cgg gca gtg aga cgc gcc gtc tcg gtg ggt
gtg 171 Met Phe Pro Arg Ala Val Arg Arg Ala Val Ser Val Gly Val 1 5
10 ttc gcc gcg ccc gca ctg gtg gcg ttc ttt gac tgt gga act atg gca
219 Phe Ala Ala Pro Ala Leu Val Ala Phe Phe Asp Cys Gly Thr Met Ala
15 20 25 30 tca gaa aaa tca cct cta ctt gtc aat caa gtt gtc acc tgt
gac aac 267 Ser Glu Lys Ser Pro Leu Leu Val Asn Gln Val Val Thr Cys
Asp Asn 35 40 45 gaa gag aaa tca tca gtt gcc gtc cta cta tca ccg
aag ctg aac cac 315 Glu Glu Lys Ser Ser Val Ala Val Leu Leu Ser Pro
Lys Leu Asn His 50 55 60 atc acg ctc aag tgc cct gac aat tcg acc
gcc gtg ccc gct gct ctt 363 Ile Thr Leu Lys Cys Pro Asp Asn Ser Thr
Ala Val Pro Ala Ala Leu 65 70 75 ggt tat cca aca aac agg acc gtc
tgc ccg gcg gag tcc gga ggt caa 411 Gly Tyr Pro Thr Asn Arg Thr Val
Cys Pro Ala Glu Ser Gly Gly Gln 80 85 90 act tgt aca ggc aag gag
ata ccg ttg gaa agc ctg ctt ccc ggg gca 459 Thr Cys Thr Gly Lys Glu
Ile Pro Leu Glu Ser Leu Leu Pro Gly Ala 95 100 105 110 aac gat agc
tgg tgg tca ggt gtt gat atc aag act ggc gtt aag ctc 507 Asn Asp Ser
Trp Trp Ser Gly Val Asp Ile Lys Thr Gly Val Lys Leu 115 120 125 aca
att cct gaa gcg agc ttc ccc aca aca tcc aag tcg ttc gac gtc 555 Thr
Ile Pro Glu Ala Ser Phe Pro Thr Thr Ser Lys Ser Phe Asp Val 130 135
140 ggc tgc gtc agc agt gat gcc agc aag agt tgt atg gtc aca gtc aca
603 Gly Cys Val Ser Ser Asp Ala Ser Lys Ser Cys Met Val Thr Val Thr
145 150 155 gtg cca ccc aga gcc tca tcg ctt gtc aac ggt gtc gca atg
tgc tct 651 Val Pro Pro Arg Ala Ser Ser Leu Val Asn Gly Val Ala Met
Cys Ser 160 165 170 tac ggt gca aac gaa act ctc ggc cct atc aca ttg
tcc gag ggc gga 699 Tyr Gly Ala Asn Glu Thr Leu Gly Pro Ile Thr Leu
Ser Glu Gly Gly 175 180 185 190 tct tct acg atg acc ctc gtt tgc ggc
acg gat ggg aag cca gtt cct 747 Ser Ser Thr Met Thr Leu Val Cys Gly
Thr Asp Gly Lys Pro Val Pro 195 200 205 cct gat cct aag cag gtt tgt
tct ggg acg acc gtc aag gat tgt aaa 795 Pro Asp Pro Lys Gln Val Cys
Ser Gly Thr Thr Val Lys Asp Cys Lys 210 215 220 gca aaa ccg ttc act
gat gtt ttc cca aaa ttc agt gct gat tgg tgg 843 Ala Lys Pro Phe Thr
Asp Val Phe Pro Lys Phe Ser Ala Asp Trp Trp 225 230 235 cag gga aaa
ccc gac act aag gat ggt gca aaa cta acg atc aag aaa 891 Gln Gly Lys
Pro Asp Thr Lys Asp Gly Ala Lys Leu Thr Ile Lys Lys 240 245 250 ggt
gca ttt cct cca aag gag gaa aag ttt act ctt ggg tgc aag agc 939 Gly
Ala Phe Pro Pro Lys Glu Glu Lys Phe Thr Leu Gly Cys Lys Ser 255 260
265 270 gta tcg agt ccg gag gtt tac tgt act gtg cag gtg gag gca gag
cgc 987 Val Ser Ser Pro Glu Val Tyr Cys Thr Val Gln Val Glu Ala Glu
Arg 275 280 285 gcg agt gca ggg atc aag tcg tcg gct gaa aat gtt ggt
cgc gtt tcc 1035 Ala Ser Ala Gly Ile Lys Ser Ser Ala Glu Asn Val
Gly Arg Val Ser 290 295 300 ctt ttc gct gta aca att gga ctc gta ggc
tcg ata gcg gct ggc gtc 1083 Leu Phe Ala Val Thr Ile Gly Leu Val
Gly Ser Ile Ala Ala Gly Val 305 310 315 gcg tga gtgacaatcg
ttctgctcgc cattcataaa aataatgcaa gacatgttcg 1139 Ala 320 cgttcgtcat
gtgtgtcttt atcataaaac aacatttact gattacttgt ggtggtttgc 1199
atatgtacaa tcccaaaaac tgctctactg taaagacgtt tagagtaaaa aaaaaaaaaa
1259 aaaa 1263 7 319 PRT Neospora caninum 7 Met Phe Pro Arg Ala Val
Arg Arg Ala Val Ser Val Gly Val Phe Ala 1 5 10 15 Ala Pro Ala Leu
Val Ala Phe Phe Asp Cys Gly Thr Met Ala Ser Glu 20 25 30 Lys Ser
Pro Leu Leu Val Asn Gln Val Val Thr Cys Asp Asn Glu Glu 35 40 45
Lys Ser Ser Val Ala Val Leu Leu Ser Pro Lys Leu Asn His Ile Thr 50
55 60 Leu Lys Cys Pro Asp Asn Ser Thr Ala Val Pro Ala Ala Leu Gly
Tyr 65 70 75 80 Pro Thr Asn Arg Thr Val Cys Pro Ala Glu Ser Gly Gly
Gln Thr Cys 85 90 95 Thr Gly Lys Glu Ile Pro Leu Glu Ser Leu Leu
Pro Gly Ala Asn Asp 100 105 110 Ser Trp Trp Ser Gly Val Asp Ile Lys
Thr Gly Val Lys Leu Thr Ile 115 120 125 Pro Glu Ala Ser Phe Pro Thr
Thr Ser Lys Ser Phe Asp Val Gly Cys 130 135 140 Val Ser Ser Asp Ala
Ser Lys Ser Cys Met Val Thr Val Thr Val Pro 145 150 155 160 Pro Arg
Ala Ser Ser Leu Val Asn Gly Val Ala Met Cys Ser Tyr Gly 165 170 175
Ala Asn Glu Thr Leu Gly Pro Ile Thr Leu Ser Glu Gly Gly Ser Ser 180
185 190 Thr Met Thr Leu Val Cys Gly Thr Asp Gly Lys Pro Val Pro Pro
Asp 195 200 205 Pro Lys Gln Val Cys Ser Gly Thr Thr Val Lys Asp Cys
Lys Ala Lys 210 215 220 Pro Phe Thr Asp Val Phe Pro Lys Phe Ser Ala
Asp Trp Trp Gln Gly 225 230 235 240 Lys Pro Asp Thr Lys Asp Gly Ala
Lys Leu Thr Ile Lys Lys Gly Ala 245 250 255 Phe Pro Pro Lys Glu Glu
Lys Phe Thr Leu Gly Cys Lys Ser Val Ser 260 265 270 Ser Pro Glu Val
Tyr Cys Thr Val Gln Val Glu Ala Glu Arg Ala Ser 275 280 285 Ala Gly
Ile Lys Ser Ser Ala Glu Asn Val Gly Arg Val Ser Leu
Phe 290 295 300 Ala Val Thr Ile Gly Leu Val Gly Ser Ile Ala Ala Gly
Val Ala 305 310 315 8 2069 DNA Neospora caninum CDS (138)..(1520) 8
tcaatccttt cccgtgctaa cttgtaaaat cgctgctttc gttggttggt tttgtttcac
60 gtggctgtta agaggtcgac gcagctgttt aacccgtgcc cctggttctc
caggtgatct 120 gcatcggatt tgcaaag atg ggc cag tcg gtg gtt ttc gtc
atg ctt ttg 170 Met Gly Gln Ser Val Val Phe Val Met Leu Leu 1 5 10
tcg gta ata ttt acc gct ggg gca aaa aca tac gga gaa gcg tcg caa 218
Ser Val Ile Phe Thr Ala Gly Ala Lys Thr Tyr Gly Glu Ala Ser Gln 15
20 25 cca tcg gcc tca gca cgt tcg tta cag ggg gcc ctc gat aca tgg
tgc 266 Pro Ser Ala Ser Ala Arg Ser Leu Gln Gly Ala Leu Asp Thr Trp
Cys 30 35 40 cag gag gtt ttt aaa aaa ctg tgc gat gac gga tat tca
aaa atg tgt 314 Gln Glu Val Phe Lys Lys Leu Cys Asp Asp Gly Tyr Ser
Lys Met Cys 45 50 55 att cca gcc aac cag gta gtt gca cga caa ggc
ctg ggt aga aaa gac 362 Ile Pro Ala Asn Gln Val Val Ala Arg Gln Gly
Leu Gly Arg Lys Asp 60 65 70 75 caa caa aag ctc gta tgg cgg tgc tac
gat tca gcg gcg ttt ctg gcc 410 Gln Gln Lys Leu Val Trp Arg Cys Tyr
Asp Ser Ala Ala Phe Leu Ala 80 85 90 gaa ggc gac gaa aac aat gtc
ctc agc tgc gtg gac gac tgt ggc gtt 458 Glu Gly Asp Glu Asn Asn Val
Leu Ser Cys Val Asp Asp Cys Gly Val 95 100 105 tcg ata ccg tgt cct
ggc gga gtt gat agg gat aat agt acc cac gct 506 Ser Ile Pro Cys Pro
Gly Gly Val Asp Arg Asp Asn Ser Thr His Ala 110 115 120 acg cga cat
gat gag ctt tcc caa tta atc aag gaa gga gta gtg cgc 554 Thr Arg His
Asp Glu Leu Ser Gln Leu Ile Lys Glu Gly Val Val Arg 125 130 135 tat
tgc agt ggt ttc caa gcg gct gcc aac agc tac tgc aac aaa cga 602 Tyr
Cys Ser Gly Phe Gln Ala Ala Ala Asn Ser Tyr Cys Asn Lys Arg 140 145
150 155 tat cct ggg act gtt gcg agg aag tcg aag ggc ttc gga cac aag
gaa 650 Tyr Pro Gly Thr Val Ala Arg Lys Ser Lys Gly Phe Gly His Lys
Glu 160 165 170 cca gtt aaa tgg aga tgt tac aag cca gag agc tta tta
ttt tcg gtt 698 Pro Val Lys Trp Arg Cys Tyr Lys Pro Glu Ser Leu Leu
Phe Ser Val 175 180 185 ttt tct gag tgc gtg agt aac tgc gga aca acc
tgg tcc tgc cct gga 746 Phe Ser Glu Cys Val Ser Asn Cys Gly Thr Thr
Trp Ser Cys Pro Gly 190 195 200 gga cga tta ggg aca gcg aca aat cta
gac aaa aag cat ttc aca gat 794 Gly Arg Leu Gly Thr Ala Thr Asn Leu
Asp Lys Lys His Phe Thr Asp 205 210 215 gag tcc ggg att ctc cag gca
ctc acc tct gtg ccg aaa gca tgt cca 842 Glu Ser Gly Ile Leu Gln Ala
Leu Thr Ser Val Pro Lys Ala Cys Pro 220 225 230 235 gta ggc ctt gtt
tgc ctc ccg agg gat cag aat ccc ccg gcg tgt tta 890 Val Gly Leu Val
Cys Leu Pro Arg Asp Gln Asn Pro Pro Ala Cys Leu 240 245 250 gat gat
aac ggc aac gtc cca gaa gag gag gga ggg cag ccc gta caa 938 Asp Asp
Asn Gly Asn Val Pro Glu Glu Glu Gly Gly Gln Pro Val Gln 255 260 265
ccg cgt gac acg aag ttg ccc gtt gat gat tcg gaa ccg acc gat gaa 986
Pro Arg Asp Thr Lys Leu Pro Val Asp Asp Ser Glu Pro Thr Asp Glu 270
275 280 agt gaa act aca cct ggt gga ggt gat gat cag ccg agc cca aaa
gag 1034 Ser Glu Thr Thr Pro Gly Gly Gly Asp Asp Gln Pro Ser Pro
Lys Glu 285 290 295 gac ggg gac aca gac tca cct gat gaa ggt gac cag
tcc ggg ggt tca 1082 Asp Gly Asp Thr Asp Ser Pro Asp Glu Gly Asp
Gln Ser Gly Gly Ser 300 305 310 315 gag tgg tac aaa cag att ccg gaa
atc cgt gtc atc ggt gac agc ctg 1130 Glu Trp Tyr Lys Gln Ile Pro
Glu Ile Arg Val Ile Gly Asp Ser Leu 320 325 330 caa gca atg ctc cac
gct ggg cag cag ctg atg gtc acc tat agc tct 1178 Gln Ala Met Leu
His Ala Gly Gln Gln Leu Met Val Thr Tyr Ser Ser 335 340 345 ccc caa
ctc cat gtt agt gtg gga tca tgt cac aaa ctc acg gtg aat 1226 Pro
Gln Leu His Val Ser Val Gly Ser Cys His Lys Leu Thr Val Asn 350 355
360 ttc tcc gat tat tat ttg tct ttt gac acc acc tca aag tcg ggg tcc
1274 Phe Ser Asp Tyr Tyr Leu Ser Phe Asp Thr Thr Ser Lys Ser Gly
Ser 365 370 375 gac gaa gtg gaa ctg gac gat gca gcg gga agc gga gag
ctc acg ata 1322 Asp Glu Val Glu Leu Asp Asp Ala Ala Gly Ser Gly
Glu Leu Thr Ile 380 385 390 395 gga ctg gga agc agc ggc cgt gtg act
gtt gtc ttc cag tat gcc aca 1370 Gly Leu Gly Ser Ser Gly Arg Val
Thr Val Val Phe Gln Tyr Ala Thr 400 405 410 aac ggt ggg gga aac aga
tat gtt gct tac acc gtc gga gat tct gga 1418 Asn Gly Gly Gly Asn
Arg Tyr Val Ala Tyr Thr Val Gly Asp Ser Gly 415 420 425 tgc aaa aca
att gaa gct gtt ctc ctt cac ggc ctg aat cct gga gcg 1466 Cys Lys
Thr Ile Glu Ala Val Leu Leu His Gly Leu Asn Pro Gly Ala 430 435 440
aag ctc gtt agg aat acg ata ggc gat aat tct ccg ggt gaa tct gaa
1514 Lys Leu Val Arg Asn Thr Ile Gly Asp Asn Ser Pro Gly Glu Ser
Glu 445 450 455 ttg taa cgactctttg tgttagtagt agccctccct atacagaatg
ggagtgtatt 1570 Leu 460 acattttgtg atcaagggaa gaggagcgat cactacactt
gatcacgcgt cgaggtcatt 1630 cgtgcggggc tgcagcttta tggtttgatc
acgcaagaaa agaagcgcaa cacctgcaag 1690 tcgggcatgc gcgagggtcc
catccttagt tttttttagt tttttttttg ccttcccgtc 1750 cgtccatatt
tctcgggtct gtattttcta gcctgagatt ctagcctaga tccaatgcag 1810
tatgtcgcct gaagtcatgt taagtggtca gatgtttctg tctcagtgaa gaaaactgtg
1870 ttatggtgca ttctgtccga ttttatacgt aattcgtcgt acgttccatt
gagttacgtg 1930 aggatgcgaa cgcagcaagt gatgtacgac aagttcgtag
catggtgaca ctgtagaata 1990 caagtgtatt ttacagtcag gcggccggct
actacacatt caagctgagt gacgtcgctt 2050 caaaaaaaaa aaaaaaaaa 2069 9
460 PRT Neospora caninum 9 Met Gly Gln Ser Val Val Phe Val Met Leu
Leu Ser Val Ile Phe Thr 1 5 10 15 Ala Gly Ala Lys Thr Tyr Gly Glu
Ala Ser Gln Pro Ser Ala Ser Ala 20 25 30 Arg Ser Leu Gln Gly Ala
Leu Asp Thr Trp Cys Gln Glu Val Phe Lys 35 40 45 Lys Leu Cys Asp
Asp Gly Tyr Ser Lys Met Cys Ile Pro Ala Asn Gln 50 55 60 Val Val
Ala Arg Gln Gly Leu Gly Arg Lys Asp Gln Gln Lys Leu Val 65 70 75 80
Trp Arg Cys Tyr Asp Ser Ala Ala Phe Leu Ala Glu Gly Asp Glu Asn 85
90 95 Asn Val Leu Ser Cys Val Asp Asp Cys Gly Val Ser Ile Pro Cys
Pro 100 105 110 Gly Gly Val Asp Arg Asp Asn Ser Thr His Ala Thr Arg
His Asp Glu 115 120 125 Leu Ser Gln Leu Ile Lys Glu Gly Val Val Arg
Tyr Cys Ser Gly Phe 130 135 140 Gln Ala Ala Ala Asn Ser Tyr Cys Asn
Lys Arg Tyr Pro Gly Thr Val 145 150 155 160 Ala Arg Lys Ser Lys Gly
Phe Gly His Lys Glu Pro Val Lys Trp Arg 165 170 175 Cys Tyr Lys Pro
Glu Ser Leu Leu Phe Ser Val Phe Ser Glu Cys Val 180 185 190 Ser Asn
Cys Gly Thr Thr Trp Ser Cys Pro Gly Gly Arg Leu Gly Thr 195 200 205
Ala Thr Asn Leu Asp Lys Lys His Phe Thr Asp Glu Ser Gly Ile Leu 210
215 220 Gln Ala Leu Thr Ser Val Pro Lys Ala Cys Pro Val Gly Leu Val
Cys 225 230 235 240 Leu Pro Arg Asp Gln Asn Pro Pro Ala Cys Leu Asp
Asp Asn Gly Asn 245 250 255 Val Pro Glu Glu Glu Gly Gly Gln Pro Val
Gln Pro Arg Asp Thr Lys 260 265 270 Leu Pro Val Asp Asp Ser Glu Pro
Thr Asp Glu Ser Glu Thr Thr Pro 275 280 285 Gly Gly Gly Asp Asp Gln
Pro Ser Pro Lys Glu Asp Gly Asp Thr Asp 290 295 300 Ser Pro Asp Glu
Gly Asp Gln Ser Gly Gly Ser Glu Trp Tyr Lys Gln 305 310 315 320 Ile
Pro Glu Ile Arg Val Ile Gly Asp Ser Leu Gln Ala Met Leu His 325 330
335 Ala Gly Gln Gln Leu Met Val Thr Tyr Ser Ser Pro Gln Leu His Val
340 345 350 Ser Val Gly Ser Cys His Lys Leu Thr Val Asn Phe Ser Asp
Tyr Tyr 355 360 365 Leu Ser Phe Asp Thr Thr Ser Lys Ser Gly Ser Asp
Glu Val Glu Leu 370 375 380 Asp Asp Ala Ala Gly Ser Gly Glu Leu Thr
Ile Gly Leu Gly Ser Ser 385 390 395 400 Gly Arg Val Thr Val Val Phe
Gln Tyr Ala Thr Asn Gly Gly Gly Asn 405 410 415 Arg Tyr Val Ala Tyr
Thr Val Gly Asp Ser Gly Cys Lys Thr Ile Glu 420 425 430 Ala Val Leu
Leu His Gly Leu Asn Pro Gly Ala Lys Leu Val Arg Asn 435 440 445 Thr
Ile Gly Asp Asn Ser Pro Gly Glu Ser Glu Leu 450 455 460 10 2278 DNA
Neospora caninum 10 atgggccagt cggtggtttt cgtcatgctt ttgtcggtaa
tatttaccgc tggggcaaaa 60 acatacggag aaggtaagtc tccagctggt
ttgtttgctt tgcaacaccc cccacctgga 120 gcgtctcgca actgtagatt
gaagaaacta gtggacccgg ttgctggttc ttcaggtacc 180 gtagtacatt
cattggcaac agtgtagtcc ttttcgcata gtagcaaggc gtcgaactgt 240
ttttagtccg gatacaatcg gacgttctgc attgcgtgcg aactgctgtg aggacacctt
300 ctgatgcacg gaactgattt tctggatttg tcgggtgttt gcagcgtcgc
aaccatcggc 360 ctcagcacgt tcgttacagg gggccctcga tacatggtgc
caggaggttt ttaaaaaact 420 gtgcgatgac ggatattcaa aaatgtgtat
tccagccaac caggtagttg cacgacaagg 480 cctgggtaga aaagaccaac
aaaagctcgt atggcggtgc tacgattcag cggcgtttct 540 ggccgaaggc
gacgaaaaca atgtcctcag ctgcgtggac gactgtggcg tttcgatacc 600
gtgtcctggc ggagttgata gggataatag tacccacgct acgcgacatg atgagctttc
660 ccaattaatc aaggaaggag tagtgcgcta ttgcagtggt ttccaagcgg
ctgccaacag 720 ctactgcaac aaacgatatc ctgggactgt tgcgaggaag
tcgaagggct tcggacacaa 780 ggaaccagtt aaatggagat gttacaagcc
agtaaggagg agctggctag attgcattag 840 tctgccctca ccacatcgtc
agcgatcgct tcttgtgggg gataggagac atgatcctgg 900 gtcgcggaag
agatgagcct ggtcctcgtc cgtgttagtg gcagcaaatt aaccccacgg 960
aggtggcagg gattatttag catagcgtat gtacgttttc ggtggagggc aggagcacga
1020 gataactgta gagatccacg gcctctgtgc ctttccagtt atgttcacac
agttttacac 1080 tagctgatag cattcacata cgttttacga agttcccgac
aaacaccaag aggaaagtgg 1140 gggaaatgtt agatttgagg tgcgtactgt
tgttgatgtg ttttaggaga gcttattatt 1200 ttcggttttt tctgagtgcg
tgagtaactg cggaacaacc tggtcctgcc ctggaggacg 1260 attaggtgag
tttaagattc aggaatagca gaaatagtgc cacgaggtgc agcttcagcc 1320
tgtaacgctg cttcttcatc actcgtatcc tggacacccc gagaaaggca tcggattgtt
1380 tttcaggatt taccaaacaa acaatgatgc gagtcgagca gttattctgg
gatttttttt 1440 ctagaatgtg taagccagtt tcaatcgttg gctcatccgg
catctttttc ctgttggcgc 1500 tcggttactt gcagggacag cgacaaatct
agacaaaaag catttcacag atgagtccgg 1560 gattctccag gcactcacct
ctgtgccgaa agcatgtcca gtaggccttg tttgcctccc 1620 gagggatcag
aatcccccgg cgtgtttaga tgataacggc aacgtcccag aagaggaggg 1680
agggcagccc gtacaaccgc gtgacacgaa gttgcccgtt gatgattcgg aaccgaccga
1740 tgaaagtgaa actacacctg gtggaggtga tgatcagccg agcccaaaag
aggacgggga 1800 cacagactca cctgatgaag gtgaccagtc cgggggttca
gagtggtaca aacagattcc 1860 ggaaatccgt gtcatcggtg acagcctgca
agcaatgctc cacgctgggc agcagctgat 1920 ggtcacctat agctctcccc
aactccatgt tagtgtggga tcatgtcaca aactcacagt 1980 gaatttctcc
gattattatt tgtcttttga caccacctca aagtcggggt ccgacgaagt 2040
ggaactggac gatgcagcgg gaagcggaga gctcacgata ggactgggaa gcagcggccg
2100 tgtgactgtt gtcttccagt atgccacaaa cggtggggga aacagatatg
ttgcttacac 2160 cgtcggagat tctggatgca aaacaattga agctgttctc
cttcacggcc tgaatcctgg 2220 agcgaagctc gttaggaata cgataggcga
taattctccg ggtgaatctg aattgtaa 2278 11 4242 DNA Neospora caninum 11
cgggaattcg attccagccg agttcgtgtt cagacgtgta cgccacccac ggtacaattt
60 attcagggga gagaaaaaga agtcgcggca aaaacataaa gctcttcggc
agttcaacga 120 tgaaactgca aattaatgaa atgatttaaa ctaatcccag
cgcagaacgg agttgcaata 180 accttccgac agagacgcac cggaggacct
gggaaccgat ccgaaatgag acgaggacag 240 caacttgaga cggctcattg
cgtcgcaact gtgtttgcgt aaccgctgcg agcagttccg 300 ccagcccatg
agtgggatgt tcgtgtgctt gggatactag gcggttcacc tgaaaggcgg 360
tcgtcccgct cttaagagcc gccgcgcaac agccgaagcg ctagggaccg ttggtctacc
420 atcgccccat cgctcatgaa ctctagtggg gagagcgtca gctccgcaac
aggtcgtgta 480 tctggaggct acagtgagcg tcgcatttca ctcgccagta
ctagcagcct tggcctttgg 540 tagcgttgcg atggcctatg ccagtgcgag
cgcgctaaac tactggcagt agacacacca 600 tctggtgagc tctycctatg
tctaaaacgt gaagatgagc gcgtgtgtgc ggatgacaga 660 ggtatcaaga
catctgtcag gtagaaattt tcttttaaca gttgaacaat cgtttcgtga 720
ctctctggtg gtctgtctgt gtactagatg tactctttcc caagccgctc gaggaacata
780 cgtgaagcac ggtggtactt cctgtagcaa aacatagcag gtaaaggtga
tgtggttcga 840 aactgcagtg tgtactgtac tttggggggt ggcgcacggt
tgggcacgcc catttgctag 900 gggttcgggg aagggaaggg tgtgtggttg
acggtttatc atcagagaaa ctggagtggg 960 gacaagatta taatacgtca
agctgcaagc cgctgtagtt ggagaaagct gtttttgagg 1020 ggcatacttg
tttgcgcgga tgatgtacgt atttcaccta aacatgttga aatacgctcg 1080
ctgagaaacg gaggcaaaat tcaggaggaa tggggaaggg tacccgtatg gtgagcacgc
1140 gttgcaaaag cacaagtagg agaacacgcg acatagaaca actcggcggc
catgtgtgta 1200 aacggcatta acggatgttt ccacccttac acactctcga
tgcgtgggac aatggagtcg 1260 atgaaaacga tgcatggttt ggttgcatga
ctgtgcgcag cacaatggcg ttcggacgag 1320 gcaagagggg actgcacgct
gcagtcatct taggcttctt tgtcctcctc gccacatcat 1380 ctgtaggatt
gggccaaagg tgagtcaaag catgacgtgt tttgctacgt gtaggaacag 1440
cacgttgcgg ttcgaccact tgctcagtag ggtcatgcaa cactttgtgc tgattcaact
1500 ggtgtgcagg gtgcctcgct acccaagtgt ggagtcactc gaagaaagag
ttgccgaggc 1560 tctagggcgc cgtagctccg cagcggccag tactcttcca
gggagtgaca cgaacatgat 1620 atcagatggt cgcgcaggca gggatgaacc
aacagcgagc ccagagcatc attccgtgga 1680 cgctccgacc acgtctgggg
aaggcgaggc agatgctggg aaagtaacgc tgaggaacga 1740 tgagggcctt
gagggtaata tctcagccga ccatgttcta catccccctc ctgacagtga 1800
acacgagggt ttgcaggaac cgggcacgac gcatcaggag gcgcaagaac cagacgcgag
1860 tgaagcaatg gactcttccg cgctaccact ttccacgtcg ggtaccacat
cctaacgaag 1920 tcggttcaac accaggaaca gcgctgcctg ccccgatttt
tagcattcca gagctctcac 1980 cggaggaagt tgtctacgtt ttacgggttc
agggatcagg cgatttcgaa attagtttcc 2040 aagtaggccg ggtggtgagg
cagttggaag ccatcaagag agcatacagg gaggctcacg 2100 ggaagctaga
agctgaggag ctggagtcgg aaaggggacc gacggtttcg actcggacga 2160
aactagttga ctttatcaaa gaaaaccaga gacggctgag ggcggcgttt cagaaggtta
2220 agattcagca aaagttggag gagatcgagg aactgttgca gctgtcacac
gcactaaaat 2280 ctctaggtgc ccgcctgaga ccctgccaaa aaagtaattc
cccaatggag gaagagattt 2340 gtcgtaagac gaaagctttg ggcgaaatgg
ttgcccagaa agcggaggat cttcgtcagc 2400 atgcgtcaac tgtctcggct
ctgctaggtc gcgaagctgt tgagagacag ttgcggcgtg 2460 tcgacagtga
acaaccctat gaacaaacag acgccggggt tgcagccaga gcagaggaat 2520
ttcggaaggc actggagaaa gcagcttccg gtgcgagaca attcgtgggg accacagcgg
2580 acgaaatagt ggaggaagtg aaggaggatg ctcagtacct gcgtgatggt
gcgaaagaag 2640 tgttgacgaa gagccagcgc gcgctagtag acgcgtttca
ggcgatccaa agggctctac 2700 tggaggcgaa ggcaaaggag ctcgtagatg
ccgcatcaaa ggaagctgaa gacgctcgta 2760 agatcttagc ggaacagcca
gcgtgattcg ccgaggacga agttggtaat gcacggtgaa 2820 tgagggttgg
tcatcccaat ccccagcttg atagcgtcac gtgggttttt cgccggggaa 2880
acgatcatta gggaggtgat gtatcgcagt aaacatgggc atatcagcac cagttttttt
2940 acatgtgagg gatgggatcc agtgtaggtg taagggacag ctgtctttca
aatttgggct 3000 tcggttgccg ctcccgttct ttcagcatat gtacaggtat
gtacagtgaa taagtgcgtg 3060 ggccaatgtg ctctcatcaa tcatgtacag
aacatatgtt ttggtcatat ctatgcagcg 3120 cctgcatgag cccatgccgc
tcgtgtttta cgaagccaga tgcggtgccg ccctgtccca 3180 gctacacatg
ctgtgcacgg ggaacaacgg ccatgttgga aaagtcactg ttttataaat 3240
gattgacaac taatgaaaaa gcactcaagc gggaaatgtt tcatgcggtc caaagagcag
3300 gggggaaagt cactgtttta taaatgattg tgacaactat ctaatgaaaa
agcactcaag 3360 cgggaaatgt ttcatgcggt ccaaagagta gggggcgggc
gtggtactga tgattaccgc 3420 gtaacaatga ccacgccggc gcagatgtcg
cagtgctgta gcgtttgatg ttcttttgta 3480 tggcggaagg gtgacaaggc
aaacggcgag agtcgactta cagactcacc accgggcaac 3540 catcggttcc
caggtcaata agctggacta ttgtcagcag atgcgatgat aacgcgtgcc 3600
atacataaag agcgtacccg tgctagttaa agatgcgcac gcggttctgt tggcagaggt
3660 cggaggcttg cctcatggag caaccgaggg ggcgcagttc tgtcttcgtg
tcttccgttt 3720 gtgtgtttga gaacgaacag atacggcgta tgtgcttgcc
ttggtcacag ggagctcacc 3780 acaaagcccg tgtagtcggg ggagtactgc
tggacacagt ggcgagaata cgcgtgatca 3840 atgccggcaa tagagaaatc
ggcatgaaat tgtgtagcgg atggcgttct gtatgtcgta 3900 caagcgaccc
tggatcgtgt gtacccccct acgggcgggc tgccctgtga aggcaatata 3960
aaatgtaatc caatgattcg ttttcatgtt acaccagata ttcttaggac gatggtactg
4020 accatactag catctgagta gtagtctctc ggtgttcggt ggccaatcta
cgactctagc 4080 aatgggttcc ctctctaccc taggttccgt agtgtgggca
catcacatga tgactgtcga 4140 tccagaaatt gatacacgtg catgcttctc
agctatgaca attatgattg ctattcctac 4200 agcagccaac cggatccgaa
ttcttcgccc tatagtgaag tc 4242 12 1892 DNA Neospora caninum CDS
(122)..(1381) 12 gaacaatcgt ttcgtgactc tctggtggtc tgtctgtgta
ctagatgtac tctttcccaa 60 gccgctcgag gaacatacgt gaagcacggt
ggtacttcct gtagcaaaac atagcagcac 120 a atg gcg ttc gga cga ggc aag
agg gga ctg cac gct gca gtc atc tta 169 Met Ala Phe Gly Arg Gly Lys
Arg Gly Leu His Ala Ala Val Ile Leu 1 5 10 15 ggc ttc ttt gtc ctc
ctc gcc aca tca tct gta gga ttg ggc caa agg 217 Gly Phe Phe Val Leu
Leu Ala Thr Ser Ser Val Gly Leu Gly Gln Arg 20 25 30 gtg cct cgc
tac cca agt gtg gag tca ctc gaa gaa aga gtt gcc gag 265 Val Pro Arg
Tyr Pro Ser Val Glu Ser Leu Glu Glu Arg Val Ala Glu 35 40 45 gct
cta ggg cgc cgt agc tcc gca gcg gcc agt act ctt cca ggg agt 313 Ala
Leu Gly Arg Arg Ser Ser Ala Ala Ala Ser Thr Leu Pro Gly Ser 50 55
60 gac acg aac atg ata tca gat ggt cgc gca ggc agg gat gaa cca aca
361 Asp Thr Asn Met Ile Ser Asp Gly Arg Ala Gly Arg Asp Glu Pro Thr
65 70 75 80 gcg agc cca gag cat cat tcc gtg gac gct ccg acc acg tct
ggg gaa 409 Ala Ser Pro Glu His His Ser Val Asp Ala Pro Thr Thr Ser
Gly Glu 85 90 95 ggc gag gca gat gct ggg aaa gta acg ctg agg aac
gat gag ggc ctt 457 Gly Glu Ala Asp Ala Gly Lys Val Thr Leu Arg Asn
Asp Glu Gly Leu 100 105 110 gag ggt aat atc tca gcc gac cat gtt cta
cat ccc cct cct gac agt 505 Glu Gly Asn Ile Ser Ala Asp His Val Leu
His Pro Pro Pro Asp Ser 115 120 125 gaa cac gag gtc ggt tca aca cca
gga aca gcg ctg cct gcc ccg att 553 Glu His Glu Val Gly Ser Thr Pro
Gly Thr Ala Leu Pro Ala Pro Ile 130 135 140 ttt agc att cca gag ctc
tca ccg gag gaa gtt gtc tac gtt tta cgg 601 Phe Ser Ile Pro Glu Leu
Ser Pro Glu Glu Val Val Tyr Val Leu Arg 145 150 155 160 gtt cag gga
tca ggc gat ttc gaa att agt ttc caa gta ggc cgg gtg 649 Val Gln Gly
Ser Gly Asp Phe Glu Ile Ser Phe Gln Val Gly Arg Val 165 170 175 gtg
agg cag ttg gaa gcc atc aag aga gca tac agg gag gct cac ggg 697 Val
Arg Gln Leu Glu Ala Ile Lys Arg Ala Tyr Arg Glu Ala His Gly 180 185
190 aag cta gaa gct gag gag ctg gag tcg gaa agg gga ccg acg gtt tcg
745 Lys Leu Glu Ala Glu Glu Leu Glu Ser Glu Arg Gly Pro Thr Val Ser
195 200 205 act cgg acg aaa cta gtt gac ttt atc aaa gaa aac cag aga
cgg ctg 793 Thr Arg Thr Lys Leu Val Asp Phe Ile Lys Glu Asn Gln Arg
Arg Leu 210 215 220 agg gcg gcg ttt cag aag gtt aag att cag caa aag
ttg gag gag atc 841 Arg Ala Ala Phe Gln Lys Val Lys Ile Gln Gln Lys
Leu Glu Glu Ile 225 230 235 240 gag gaa ctg ttg cag ctg tca cac gca
cta aaa tct cta ggt gcc cgc 889 Glu Glu Leu Leu Gln Leu Ser His Ala
Leu Lys Ser Leu Gly Ala Arg 245 250 255 ctg aga ccc tgc caa aaa agt
aat tcc cca atg gag gaa gag att tgt 937 Leu Arg Pro Cys Gln Lys Ser
Asn Ser Pro Met Glu Glu Glu Ile Cys 260 265 270 cgt aag acg aaa gct
ttg ggc gaa atg gtt gcc cag aaa gcg gag gat 985 Arg Lys Thr Lys Ala
Leu Gly Glu Met Val Ala Gln Lys Ala Glu Asp 275 280 285 ctt cgt cag
cat gcg tca act gtc tcg gct ctg cta ggt cgc gaa gct 1033 Leu Arg
Gln His Ala Ser Thr Val Ser Ala Leu Leu Gly Arg Glu Ala 290 295 300
gtt gag aga cag ttg cgg cgt gtc gac agt gaa caa ccc tat gaa caa
1081 Val Glu Arg Gln Leu Arg Arg Val Asp Ser Glu Gln Pro Tyr Glu
Gln 305 310 315 320 aca gac gcc ggg gtt gca gcc aga gca gag gaa ttt
cgg aag gca ctg 1129 Thr Asp Ala Gly Val Ala Ala Arg Ala Glu Glu
Phe Arg Lys Ala Leu 325 330 335 gag aaa gca gct tcc ggt gcg aga caa
ttc gtg ggg acc aca gcg gac 1177 Glu Lys Ala Ala Ser Gly Ala Arg
Gln Phe Val Gly Thr Thr Ala Asp 340 345 350 gaa ata gtg gag gaa gtg
aag gag gat gct cag tac ctg cgt gat ggt 1225 Glu Ile Val Glu Glu
Val Lys Glu Asp Ala Gln Tyr Leu Arg Asp Gly 355 360 365 gcg aaa gaa
gtg ttg acg aag agc cag cgc gcg cta gta gac gcg ttt 1273 Ala Lys
Glu Val Leu Thr Lys Ser Gln Arg Ala Leu Val Asp Ala Phe 370 375 380
cag gcg atc caa agg gct cta ctg gag gcg aag gca aag gag ctc gta
1321 Gln Ala Ile Gln Arg Ala Leu Leu Glu Ala Lys Ala Lys Glu Leu
Val 385 390 395 400 gat gcc gca tca aag gaa gct gaa gac gct cgt aag
atc tta gcg gaa 1369 Asp Ala Ala Ser Lys Glu Ala Glu Asp Ala Arg
Lys Ile Leu Ala Glu 405 410 415 cag cca gcg tga ttcgccgagg
acgaagttgg taatgcacgg tgaatgaggg 1421 Gln Pro Ala 420 ttggtcatcc
caatccccag cttgatagcg tcacgtgggt ttttcgccgg ggaaacgatc 1481
attagggagg tgatgtatcg cagtaaacat gggcatatca gcaccagttt ttttacatgt
1541 gagggatggg atccagtgta ggtgtaaggg acagctgtct ttcaaatttg
ggcttcggtt 1601 gccgctcccg ttctttcagc atatgtacag gtatgtacag
tgaataagtg cgtgggccaa 1661 tgtgctctca tcaatcatgt acagaacata
tgttttggtc atatctatgc agcgcctgca 1721 tgagcccatg ccgctcgtgt
tttacgaagc cagatgcggt gccgccctgt cccagctaca 1781 catgctgtgc
acggggaaca acggccatgt tggaaaagtc actgttttat aaatgattga 1841
caactaatga aaaagcactc aagcgggaaa tgtttcatgc ggtccaaaga g 1892 13
419 PRT Neospora caninum 13 Met Ala Phe Gly Arg Gly Lys Arg Gly Leu
His Ala Ala Val Ile Leu 1 5 10 15 Gly Phe Phe Val Leu Leu Ala Thr
Ser Ser Val Gly Leu Gly Gln Arg 20 25 30 Val Pro Arg Tyr Pro Ser
Val Glu Ser Leu Glu Glu Arg Val Ala Glu 35 40 45 Ala Leu Gly Arg
Arg Ser Ser Ala Ala Ala Ser Thr Leu Pro Gly Ser 50 55 60 Asp Thr
Asn Met Ile Ser Asp Gly Arg Ala Gly Arg Asp Glu Pro Thr 65 70 75 80
Ala Ser Pro Glu His His Ser Val Asp Ala Pro Thr Thr Ser Gly Glu 85
90 95 Gly Glu Ala Asp Ala Gly Lys Val Thr Leu Arg Asn Asp Glu Gly
Leu 100 105 110 Glu Gly Asn Ile Ser Ala Asp His Val Leu His Pro Pro
Pro Asp Ser 115 120 125 Glu His Glu Val Gly Ser Thr Pro Gly Thr Ala
Leu Pro Ala Pro Ile 130 135 140 Phe Ser Ile Pro Glu Leu Ser Pro Glu
Glu Val Val Tyr Val Leu Arg 145 150 155 160 Val Gln Gly Ser Gly Asp
Phe Glu Ile Ser Phe Gln Val Gly Arg Val 165 170 175 Val Arg Gln Leu
Glu Ala Ile Lys Arg Ala Tyr Arg Glu Ala His Gly 180 185 190 Lys Leu
Glu Ala Glu Glu Leu Glu Ser Glu Arg Gly Pro Thr Val Ser 195 200 205
Thr Arg Thr Lys Leu Val Asp Phe Ile Lys Glu Asn Gln Arg Arg Leu 210
215 220 Arg Ala Ala Phe Gln Lys Val Lys Ile Gln Gln Lys Leu Glu Glu
Ile 225 230 235 240 Glu Glu Leu Leu Gln Leu Ser His Ala Leu Lys Ser
Leu Gly Ala Arg 245 250 255 Leu Arg Pro Cys Gln Lys Ser Asn Ser Pro
Met Glu Glu Glu Ile Cys 260 265 270 Arg Lys Thr Lys Ala Leu Gly Glu
Met Val Ala Gln Lys Ala Glu Asp 275 280 285 Leu Arg Gln His Ala Ser
Thr Val Ser Ala Leu Leu Gly Arg Glu Ala 290 295 300 Val Glu Arg Gln
Leu Arg Arg Val Asp Ser Glu Gln Pro Tyr Glu Gln 305 310 315 320 Thr
Asp Ala Gly Val Ala Ala Arg Ala Glu Glu Phe Arg Lys Ala Leu 325 330
335 Glu Lys Ala Ala Ser Gly Ala Arg Gln Phe Val Gly Thr Thr Ala Asp
340 345 350 Glu Ile Val Glu Glu Val Lys Glu Asp Ala Gln Tyr Leu Arg
Asp Gly 355 360 365 Ala Lys Glu Val Leu Thr Lys Ser Gln Arg Ala Leu
Val Asp Ala Phe 370 375 380 Gln Ala Ile Gln Arg Ala Leu Leu Glu Ala
Lys Ala Lys Glu Leu Val 385 390 395 400 Asp Ala Ala Ser Lys Glu Ala
Glu Asp Ala Arg Lys Ile Leu Ala Glu 405 410 415 Gln Pro Ala 14 20
DNA Neospora caninum 14 aattaaccct cactaaaggg 20 15 22 DNA Neospora
caninum 15 gtaatacgac tcactatagg gc 22 16 20 DNA Neospora caninum
16 gccgcgactt ctttttctct 20 17 20 DNA Neospora caninum 17
ctcgatcgcc tcctttactg 20 18 20 DNA Neospora caninum 18 tgctagtact
ggcgagtgaa 20 19 20 DNA Neospora caninum 19 caggtttgcc acacattttt
20 20 21 DNA Neospora caninum 20 atgtttcctc ctcgggcagt g 21 21 23
DNA Neospora caninum 21 tcacgcgacg ccagccgcta tcg 23 22 20 DNA
Neospora caninum 22 gccctgacaa ttcgaccgcc 20 23 21 DNA Neospora
caninum 23 cccacaacat ccaagtcgtt c 21 24 20 DNA Neospora caninum 24
gttttgcacc atccttagtg 20 25 19 DNA Neospora caninum 25 gagagtttgc
tttgcaccg 19 26 21 DNA Neospora caninum 26 ccagccgagt tcgtgttcag a
21 27 24 DNA Neospora caninum 27 caacgtggat ccgattcaag cttc 24 28
20 DNA Neospora caninum 28 aaagctcttc ggcagttcaa 20 29 18 DNA
Neospora caninum 29 ccgcgctacc actttcca 18 30 18 DNA Neospora
caninum 30 gtaatacgac tcactata 18 31 19 DNA Neospora caninum 31
ccgcaacgtg ctgttccta 19 32 18 DNA Neospora caninum 32 catcagagaa
actggagt 18 33 24 DNA Neospora caninum 33 ggccaagctt gctagtactg
gcga 24 34 31 DNA Neospora caninum 34 atccaatgca tcttgctgaa
tgccttaaaa g 31
* * * * *