U.S. patent application number 10/223666 was filed with the patent office on 2003-09-25 for high affinity oligonucleotide ligands to growth factors.
This patent application is currently assigned to GILEAD SCIENCES, INC.. Invention is credited to Gold, Larry, Janjic, Nebojsa, Pagratis, Nikos.
Application Number | 20030180744 10/223666 |
Document ID | / |
Family ID | 27569790 |
Filed Date | 2003-09-25 |
United States Patent
Application |
20030180744 |
Kind Code |
A1 |
Gold, Larry ; et
al. |
September 25, 2003 |
High affinity oligonucleotide ligands to growth factors
Abstract
Methods are described for the identification and preparation of
high-affinity nucleic acid ligands to TGF.beta., PDGF and hKGF.
Included in the invention are specific RNA and ssDNA ligands to
TGF.beta.1 and PDGF identified by the SELEX method. Also included
in the invention are specific RNA ligands to hKGF identified by the
SELEX method. Further included are RNA ligands that inhibit the
interaction of TGF.beta.1 and hKGF with their receptors and DNA
ligands that inhibit the interaction of PDGF with its receptor.
Inventors: |
Gold, Larry; (Boulder,
CO) ; Janjic, Nebojsa; (Boulder, CO) ;
Pagratis, Nikos; (Boulder, CO) |
Correspondence
Address: |
SWANSON & BRATSCHUN L.L.C.
1745 SHEA CENTER DRIVE
SUITE 330
HIGHLANDS RANCH
CO
80129
US
|
Assignee: |
GILEAD SCIENCES, INC.
333 Lakeside Drive
Foster City
CA
94404
|
Family ID: |
27569790 |
Appl. No.: |
10/223666 |
Filed: |
August 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10223666 |
Aug 19, 2002 |
|
|
|
09818237 |
Mar 27, 2001 |
|
|
|
09818237 |
Mar 27, 2001 |
|
|
|
08973124 |
May 11, 1998 |
|
|
|
6207816 |
|
|
|
|
08973124 |
May 11, 1998 |
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08465594 |
Jun 5, 1995 |
|
|
|
5846713 |
|
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08465591 |
Jun 5, 1995 |
|
|
|
5837834 |
|
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08479725 |
Jun 7, 1995 |
|
|
|
5674685 |
|
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08479783 |
Jun 7, 1995 |
|
|
|
5668264 |
|
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08618693 |
Mar 20, 1996 |
|
|
|
5723594 |
|
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08458423 |
Jun 2, 1995 |
|
|
|
5731144 |
|
|
|
|
PCT/US96/08014 |
May 30, 1996 |
|
|
|
08458424 |
Jun 2, 1995 |
|
|
|
5731424 |
|
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/91.2; 536/23.5 |
Current CPC
Class: |
C12N 15/115 20130101;
A61P 29/00 20180101; C07K 14/475 20130101; C07K 14/495 20130101;
B82Y 5/00 20130101; C12N 15/111 20130101; A61P 17/06 20180101; A61P
17/00 20180101; C12N 2320/13 20130101; A61P 9/00 20180101; A61P
1/04 20180101; G01N 2333/96433 20130101; C07K 14/49 20130101; A61P
35/00 20180101; A61P 43/00 20180101; C07K 14/50 20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/23.5 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34 |
Claims
1. A method of identifying modified single-stranded ribonucleic
acid ligands to PDGF comprising: a) contacting a candidate mixture
of modified single-stranded ribonucleic acids with PDGF, wherein
ribonucleic acids having an increased affinity to PDGF relative to
the candidate mixture may be partitioned from the remainder of the
candidate mixture; b) partitioning the increased affinity
ribonucleic acids from the remainder of the candidate mixture; and
c) amplifying the increased affinity ribonucleic acids to yield a
mixture of nucleic acids enriched for nucleic acid sequences with
relatively higher affinity and specificity for binding to PDGF,
whereby modified ribonucleic acid ligands of PDGF may be
identified.
2. A method of identifying modified single-stranded ribonucleic
acid ligands to hKGF comprising: a) contacting a candidate mixture
of modified single-stranded ribonucleic acids with hKGF, whereby
ribonucleic acids having an increased affinity to hKGF relative to
the candidate mixture may be partitioned from the remainder of the
candidate mixture; b) partitioning the increased affinity
ribonucleic acids from the remainder of the candidate mixture; and
c) amplifying the increased affinity ribonucleic acids to yield a
mixture of ribonucleic acids enriched for ribonucleic acid
sequences with relatively higher affinity and specificity for
binding to hKGF, whereby modified ribonucleic acid ligands of hKGF
may be identified.
Description
RELATEDNESS OF THE APPLICATION
[0001] This application is a continuation of U.S. application Ser.
No. 09/818,237, filed Mar. 27, 2001, which is a divisional of U.S.
application Ser. No. 08/973,124, filed May 11, 1998, now U.S. Pat.
No. 6,207,816, which is a 35 U.S.C. .sctn.371 national phase
application of International Application No. PCT/US96/08014, filed
May 30, 1996. International Application No. PCT/US96/08014 is a
continuation-in-part of U.S. application Ser. No. 08/465,594, filed
Jun. 5, 1995, now U.S. Pat. No. 5,846,713, a continuation-in-part
of Ser. No. 08/465,591, filed Jun. 5, 1995, now U.S. Pat. No.
5,837,834, a continuation-in-part of U.S. application Ser. No.
08/479,725, filed Jun. 7, 1995, now U.S. Pat. No. 5,674,685, a
continuation-in-part of U.S. application Ser. No. 08/479,783, filed
Jun. 7, 1995, now U.S. Pat. No. 5,668,264, and a
continuation-in-part of U.S. application Ser. No. 08/618,693, filed
Mar. 20, 1996, now U.S. Pat. No. 5,723,594. PCT/US96/08014 also
claims priority from U.S. application Ser. No. 08/458,423, filed
Jun. 2, 1995, now U.S. Pat. No. 5,731,144, and U.S. application
Ser. No. 08/458,424, filed Jun. 2, 1995, now U.S. Pat. No.
5,731,424. U.S. Pat. Nos. 5,731,144 and 5,731,424 are
continuations-in-part of U.S. application Ser. No. 07/714,131,
filed Jun. 10, 1991, now U.S. Pat. No. 5,475,096, and U.S.
application Ser. No. 07/931,473, filed Aug. 17, 1992, now U.S. Pat.
No. 5,270,163.
FIELD OF THE INVENTION
[0002] Described herein are methods for identifying and preparing
high-affinity nucleic acid ligands to TGF.beta., PDGF, and hKGF.
The method utilized herein for identifying such nucleic acid
ligands is called SELEX, an acronym for Systematic Evolution of
Ligands by EXponential enrichment. This invention includes high
affinity nucleic acid ligands of TGF.beta., PDGF and hKGF. Further
disclosed are RNA and DNA ligands to TGF.beta.1 and PDGF and RNA
ligands to hKGF. Also included are oligonucleotides containing
nucleotide derivatives chemically modified at the 2'-positions of
pyrimidines. Additionally disclosed are RNA ligands to TGF.beta.1
and hKGF containing 2'-NH.sub.2-modifications or 2'-F modifications
and RNA ligands to PDGF containing 2'-F modifications. This
invention also includes high affinity nucleic acid inhibitors of
TGF.beta.1, PDGF and hKGF. The oligonucleotides of the present
invention are useful as pharmaceuticals or diagnostic agents.
BACKGROUND OF THE INVENTION
[0003] TGF.beta.
[0004] The transforming growth factor-.beta. (TGF.beta.)
polypeptides influence growth, differentiation, and gene expression
in many cell types. The first polypeptide of this family that was
characterized, TGF.beta.1 has two identical 112 amino acid subunits
which are covalently linked. TGF.beta.1 is a highly conserved
protein with only a single amino acid difference distinguishing
human from mice forms. There are two other members of the TGF.beta.
gene family that are expressed in mammals. TGF.beta.2 is 71%
homologous to TGF.beta.1 (de Martin et al., (1987) EMBO J.
6:3673-3677), whereas TGF.beta.3 is 80% homologous to TGF.beta.1
(Derynck et al., (1988) EMBO J. 7:3737-3743). The structural
characteristics of TGF.beta.1 as determined by nuclear magnetic
resonance (Archer et al., (1993) Biochemistry 32:1164-1171) agree
with the crystal structure of TGF.beta.2 (Daopin et al., (1992)
Science 257:369-374; Schlunegger and Grutter (1992) Nature
358:430-434).
[0005] Even though the TGF.beta.'s have similar three dimensional
structures, they are by no means physiologically equivalent. There
are at least three different extracellular receptors, type I, II
and III, involved in transmembrane signaling of TGF.beta. to cells
carrying the receptors. For reviews, see Derynck (1994) TIBS
19:548-553 and Massague (1990) Annu. Rev. Cell Biol 6:597-641. In
order for TGF.beta.2 to effectively interact with the type II
TGF.beta. receptor, the type III receptor must also be present
(Derynck (1994) TIBS 19:548-553). Vascular endothelial cells lack
the type III receptor. Instead endothelial cells express a
structurally related protein called endoglin (Cheifetz et al.,
(1992) J. Biol. Chem. 267:19027-19030), which only binds TGF.beta.1
and TGF.beta.3 with high affinity. Thus, the relative potency of
the TGF.beta.'s reflect the type of receptors expressed in a cell
and organ system.
[0006] In addition to the regulation of the components in the
multifactorial signaling pathway, the distribution of the synthesis
of TG.beta.3 polypeptides also affects physiological function. The
distribution of TGF.beta.2 and TGF.beta.3 is more limited (Derynck
et al., (1988) EMBO J. 7:3737-3743) than TGF.beta.1, e.g.,
TGF.beta.3 is limited to tissues of mesenchymal origin, whereas
TGF.beta.1 is present in both mesenchymal and epithelial cells.
[0007] TGF.beta.1 is a multifunctional cytokine critical for tissue
repair. High concentrations of TGF.beta.1 are delivered to the site
of injury by platelet granules (Assoian and Sporn, (1986) J Cell
Biol. 102:1217-1223.). TGF.beta.1 initiates a series of events that
promote healing including chemotaxis of cells such as leukocytes,
monocytes and fibroblasts, and regulation of growth factors and
cytokines involved in angiogenesis, cell division associated with
tissue repair and inflammatory responses. TGF.beta.1 also
stimulates the synthesis of extracellular matrix components
(Roberts et al., (1986) Proc. Natl. Acad Sci USA 83:4167-4171;
Sporn et al., (1983) Science 219:1329-1330; Massague, (1987) Cell
49:437-438) and most importantly for understanding the
pathophysiology of TGF.beta.1, TGF.beta.1 autoregulates its own
synthesis (Kim et al., (1989) J Biol Chem 264:7041-7045).
[0008] A number of diseases have been associated with TGF.beta.1
overproduction. Fibrotic diseases associated with TGF.beta.1
overproduction can be divided into chronic conditions such as
fibrosis of kidney, lung and liver and more acute conditions such
as dermal scarring and restenosis. Synthesis and secretion of
TGF.beta.1 by tumor cells can also lead to immune suppression such
as seen in patients with aggressive brain or breast tumors (Arteaga
et al., (1993) J Clin Invest 92: 2569-2576). The course of
Leishmanial infection in mice is drastically altered by TGF.beta.1
(Barral-Netto et al., (1992) Science 257:545-547). TGF.beta.1
exacerbated the disease, whereas TGF.beta.1 antibodies halted the
progression of the disease in genetically susceptible mice.
Genetically resistant mice became susceptible to Leishmanial
infection upon administration of TGF.beta.1.
[0009] The profound effects of TGF.beta.1 on extracellular matrix
deposition have been reviewed (Rocco and Ziyadeh, (1991) in
Contemporary Issues in Nephrology v23, Hormones, autocoids and the
kidney. ed. Jay Stein, Churchill Livingston, NY pp391-410; Roberts
et al., (1988) Rec. Prog. Hormone Res. 44:157-197) and include the
stimulation of the synthesis and the inhibition of degradation of
extracellular matrix components. Since the structure and filtration
properties of the glomerulus are largely determined by the
extracellular matrix composition of the mesangium and glomerular
membrane, it is not surprising that TGF.beta.1 has profound effects
on the kidney. The accumulation of mesangial matrix in
proliferative glomerulonephritus (Border et al., (1990) Kidney Int.
37:689-695) and diabetic nephropathy (Mauer et al., (1984) J. Clin
Invest.74:1143-1155) are clear and dominant pathological features
of the diseases. TGF.beta.1 levels are elevated in human diabetic
glomerulosclerosis (advanced neuropathy) (Yamamoto et al., (1993)
Proc. Natl. Acad. Sci. 90:1814-1818). TGF.beta.1 is an important
mediator in the genesis of renal fibrosis in a number of animal
models (Phan et al., (1990) Kidney Int. 37:426; Okuda et al.,
(1990) J. Clin Invest. 86:453). Suppression of experimentally
induced glomerulonephritus in rats has been demonstrated by
antiserum against TGF.beta.1 (Border et al., (1990) Nature 346:371)
and by an extracellular matrix protein, decorin, which can bind
TGF.beta.1 (Border et al., (1992) Nature 360:361-363).
[0010] Too much TGF.beta.1 leads to dermal scar-tissue formation.
Neutralizing TGF.beta.1 antibodies injected into the margins of
healing wounds in rats have been shown to inhibit scarring without
interfering with the rate of wound healing or the tensile strength
of the wound (Shah et al., (1992) Lancet 339:213-214). At the same
time there was reduced angiogenesis, reduced number of macrophages
and monocytes in the wound, and a reduced amount of disorganized
collagen fiber deposition in the scar tissue.
[0011] TGF.beta.1 may be a factor in the progressive thickening of
the arterial wall which results from the proliferation of smooth
muscle cells and deposition of extracellular matrix in the artery
after balloon angioplasty. The diameter of the restenosed artery
may be reduced 90% by this thickening, and since most of the
reduction in diameter is due to extracellular matrix rather than
smooth muscle cell bodies, it may be possible to open these vessels
to 50% simply by reducing extensive extracellular matrix
deposition. In uninjured pig arteries transfected in vivo with a
TGF.beta.1 gene, TGF.beta.1 gene expression was associated with
both extracellular matrix synthesis and hyperplasia (Nabel et al.,
(1993) Proc. Natl. Acad. Sci USA 90:10759-10763). The TGF.beta.1
induced hyperplasia was not as extensive as that induced with
PDGF-BB, but the extracellular matrix was more extensive with
TGF.beta.1 transfectants. No extracellular matrix deposition was
associated with FGF-1 (a secreted form of FGF) induced hyperplasia
in this gene transfer pig model (Nabel (1993) Nature
362:844-846).
[0012] There are several types of cancer where TGF.beta.1 produced
by the tumor may be deleterious. MATLyLu rat cancer cells (Steiner
and Barrack, (1992) Mol. Endocrinol. 6:15-25) and MCF-7 human
breast cancer cells (Arteaga et al., (1993) Cell Growth and Differ.
4:193-201) became more tumorigenic and metastatic after
transfection with a vector expressing the mouse TGF.beta.1. In
breast cancer, poor prognosis is associated with elevated TGF.beta.
(Dickson et al., (1987) Proc. Natl. Acad. Sci. USA 84:837-841;
Kasid et al., (1987) Cancer Res. 47:5733-5738; Daly et al., (1990)
J Cell Biochem 43:199-211; Barrett-Lee et al., (1990) Br. J Cancer
61:612-617; King et al., (1989) J Steroid Biochem 34:133-138; Welch
et al., (1990) Proc. Natl. Acad. Sci. 87:7678-7682; Walker et al.,
(1992) Eur J Cancer 238: 641-644) and induction of TGF.beta.1 by
tamoxifen treatment (Butta et al., (1992) Cancer Res 52:4261-4264)
has been associated with failure of tamoxifen treatment for breast
cancer (Thompson et al., (1991) Br. J Cancer 63:609-614). Anti
TGF.beta.1 antibodies inhibit the growth of MDA-231 human breast
cancer cells in athymic mice (Arteaga et al., (1993) J Clin Invest
92: 2569-2576), a treatment which is correlated with an increase in
spleen natural killer cell activity. CHO cells transfected with
latent TGF.beta.1 also showed decreased NK activity and increased
tumor growth in nude mice (Wallick et al., (1990) J Exp Med
172:1777-1784). Thus, TGF.beta.1 secreted by breast tumors may
cause an endocrine immune suppression.
[0013] High plasma concentrations of TGF.beta.1 have been shown to
indicate poor prognosis for advanced breast cancer patients
(Anscher et al. (1993) N Engl J Med 328:1592-8). Patients with high
circulating TGF.beta. before high dose chemotherapy and autologous
bone marrow transplantation are at high risk for hepatic
veno-occlusive disease (15-50% of all patients with a mortality
rate up to 50%) and idiopathic interstitial pneumonitis (40-60% of
all patients). The implication of these findings is 1) that
elevated plasma levels of TGF.beta.1 can be used to identify at
risk patients and 2) that reduction of TGF.beta.1 could decrease
the morbidity and mortality of these common treatments for breast
cancer patients.
[0014] PDGF
[0015] Platelet-derived growth factor (PDGF) was originally
isolated from platelet lysates and identified as the major
growth-promoting activity present in serum but not in plasma. Two
homologous PDGF isoforms have been identified, PDGF A and B, which
are encoded by separate genes (on chromosomes 7 and 22). The most
abundant species from platelets is the AB heterodimer, although all
three possible dimers (AA, AB and BB) occur naturally. Following
translation, PDGF dimers are processed into .apprxeq.30 kDa
secreted proteins. Two cell surface proteins that bind PDGF with
high affinity have been identified, a and .beta. (Heldin et al.,
(1981) Proc. Natl. Acad. Sci. 78:3664; Williams et al., (1981)
Proc. Natl. Acad. Sci. 79:5867). Both species contain five
immunoglobulin-like extracellular domains, a single transmembrane
domain and an intracellular tyrosine kinase domain separated by a
kinase insert domain. The functional high affinity receptor is a
dimer and engagement of the extracellular domain of the receptor by
PDGF results in cross-phosphorylation (one receptor tyrosine kinase
phosphorylates the other in the dimer) of several tyrosine
residues. Receptor phosphorylation leads to a cascade of events
that results in the transduction of the mitogenic or chemotactic
signal to the nucleus. For example, in the intracellular domain of
the PDGF .beta. receptor, nine tyrosine residues have been
identified that when phosphorylated interact with different
src-homology 2 (SH2) domain-containing proteins including
phospholipase C-g, phosphatidylinositol 3'-kinase,
GTPase-activating protein and several adapter molecules like Shc,
Grb2 and Nck (Heldin, (1995) Cell 80:213). In the last several
years, the specificities of the three PDGF isoforms for the three
receptor dimers (aa, a.beta., and .beta..beta.) has been
elucidated. The a-receptor homodimer binds all three PDGF isoforms
with high affinity, the .beta.-receptor homodimer binds only PDGF
BB with high affinity and PDGF AB with approximately 10-fold lower
affinity, and the a.beta.-receptor heterodimer binds PDGF BB and
PDGF AB with high affinity (Westermark & Heldin, (1993) Acta
Oncologica 32:101). The specificity pattern results from the
ability of the A-chain to bind only to the a-receptor and of the
B-chain to bind to both a and .beta.-receptor subunits with high
affinity.
[0016] The earliest indication that PDGF expression is linked to
malignant transformation came with the finding that the amino acid
sequence of the PDGF-B chain is virtually identical to that of
p28.sup.sis, the transforming protein of the simian sarcoma virus
(SSV) (Waterfield et al., (1983) Nature 304:35; Johnsson et al.,
(1984) EMBO J. 3:921). The transforming potential of the PDGF-B
chain gene and, to a lesser extent, the PDGF-A gene was
demonstrated soon thereafter (Clarke et al., Nature 308:464 (1984);
Gazit et al., Cell 39:89 (1984); Beckmann et al., Science 241:1346;
Bywater et al., Mol. Cell. Biol. 8:2753 (1988)). Many tumor cell
lines have since been shown to produce and secrete PDGF, some of
which also express PDGF receptors (Raines et al., Peptide Growth
Factors and Their Receptors, Springer-Verlag, Part I, p 173
(1990)). Paracrine and, in some cell lines, autocrine growth
stimulation by PDGF is therefore possible. For example, analysis of
biopsies from human gliomas has revealed the existence of two
autocrine loops: PDGF-B/.beta.-receptor in tumor-associated
endothelial cells and PDGF-A/a-receptor in tumor cells (Hermansson
et al., Proc. Natl. Acad. Sci. 85:7748 (1988); Hermansson et al.,
Cancer Res. 52:3213 (1992)). The progression to high grade glioma
was accompanied by the increase in expression of PDGF-B and the
.beta.-receptor in tumor-associated endothelial cells and PDGF-A in
glioma cells. Increased expression of PDGF and/or PDGF receptors
has also been observed in other malignancies including fibrosarcoma
(Smits et al., Am. J. Pathol. 140:639 (1992)) and thyroid carcinoma
(Heldin et al., Endocrinology 129:2187 (1991)).
[0017] In view of its importance in proliferative disease states,
antagonists of PDGF may find useful clinical applications.
Currently, antibodies to PDGF (Johnsson et al., (1985) Proc. Natl.
Acad. Sci., U.S.A. 82:1721-1725; Ferns et al., (1991) Science
253:1129-1132; Herrenet al. (1993) Biochimica et Biophysica Acta
1173:204-302) and the soluble PDGF receptors (Herrenet al., (1993)
Biochimica et Biophysica Acta 1173:204-302; Duanet al., (1991) J.
Biol. Chem. 266:413-418; Tiesman et al., (1993) J. Biol. Chem.
268:9621-9628) are the most potent and specific antagonists of
PDGF. Neutralizing antibodies to PDGF have been shown to revert the
SSV-transformed phenotype (Johnsson et al., (1985) Proc. Natl.
Acad. Sci., U.S.A. 82:1721-1725) and to inhibit the development of
neointimal lesions following arterial injury (Ferns et al., (1991)
Science 253:1129-1132). Other inhibitors of PDGF such as suramin
(Williams et al., (1984) J. Biol. Chem. 259:5287-5294; Betsholtz et
al., (1984) Cell 39:447-457), neomycin (Vassbotn et al., (1992) J.
Biol. Chem. 267:15635-15641) and peptides derived from the PDGF
amino acid sequence (Engstrom et al., (1992) J. Biol. Chem.
267:16581-16587) have been reported, however, they are either too
toxic or lack sufficient specificity or potency to be good drug
candidates. Other types of antagonists of possible clinical utility
are molecules that selectively inhibit the PDGF receptor tyrosine
kinase (Buchdunger et al., (1995) Proc. Natl. Acad. Sci., U.S.A.
92:2558-2562; Kovalenko et al., (1994) Cancer Res.
54:6106-6114).
[0018] hKGF
[0019] a) Biochemical Properties of hKGF
[0020] Human Keratinocyte Growth Factor (hKGF) is a small (26-28
KD) basic heparin-binding growth factor and a member of the FGF
family. hKGF is a relatively newly identified molecule, which is
also known as FGF-7 (Finch et al., (1989) Science 245:752-755). It
is a growth factor specific for epithelial cells (Rubin et al.,
(1989) Proc Natl Acad Sci USA 86:802-806), and its main function is
in development/morphogenesis (Werner et al., (1994) Science
266:819-822) and in wound healing (Werner et al., (1992) Proc Natl
Acad Sci USA 89:6896-6900). The major in vivo source of hKGF is
stromal fibroblasts (Finch et al., (1989) Science 245:752-755).
Microvascular endothelial cells (Smola et al., (1993) J Cell Biol
122:417-429) and very recently, activated intraepithelial gd T
cells (Boismenu et al., (1994) Science 266:1253-1255) have also
been shown to synthesize hKGF. hKGF expression is stimulated in
wounds (Werner et al., (1992) Proc Natl Acad Sci USA 89:6896-6900).
Several cytokines are shown to be hKGF inducers (Brauchle et al.,
(1994) Oncogene 9:3199-3204), with IL-1 the most potent one
(Brauchle et al., (1994) Oncogene 9:3199-3204; Chedid et al.,
(1994) J Biol Chem 269:10753-10757). Unlike bFGF, hKGF has a signal
peptide and thus is secreted by producing cells (Finch et al.,
(1989) Science 245:752-755). hKGF can be overexpressed in E. coli
and the recombinant protein (.about.19-21 KD) is biologically
active (Ron et al., (1993) J Biol Chem 268:2984-2988). The E. coli
derived recombinant protein is 10 times more mitogenic than the
native protein (Ron et al., (1993) J Biol Chem 268:2984-2988). This
difference maybe due to glycosylation. The native protein has a
potential Asn glycosylation site (Ron et al., (1993) J Biol Chem
268:2984-2988).
[0021] The hKGF bioactivity is mediated through a specific cell
surface receptor (Miki et al., (1991) Science 251:72-75). The hKGF
receptor is a modified FGF receptor resulting from alternative
splicing of the C-terminal extracellular region of the FGF-R2 (Miki
et al., (1992) Proc Natl Acad Sci USA 89:246-250). NIH/3T3 cells
transfected with the hKGF receptor express high affinity
(.about.200 pM) binding sites for hKGF (Miki et al., (1992) Proc
Natl Acad Sci USA 89:246-250). The approximate number of specific
binding sites per NIH/3T3 cell is about 500,000 (D. Bottaro and S.
Aaronson, personal communication). The hKGF receptor binds hKGF and
aFGF with similar affinities, and bFGF with about 20 fold less
affinity (Miki et al., (1991) Science 251:72-75; Miki et al.,
(1992) Proc Natl Acad Sci USA 89:246-250). A variant of the hKGF
receptor has been found to be an amplified gene (i.e., one gene,
multiple copies), designated K-SAM, in a human stomach carcinoma
cell line (Hattori et al., (1990) Proc natl Acad Sci USA
87:5983-5987).
[0022] Heparin has been reported to be an inhibitor of hKGF
bioactivity (Ron et al., (1993) J Biol Chem 268:2984-2988). This is
in contrast to the agonistic effect of heparin for aFGF
(Spivak-Kroixman et al., (1994) Cell 79:1015-1024).
[0023] b) Role of hKGF in Human Disease
[0024] The recombinant hKGF molecule has been available only since
1993. Therefore, there is limited information on the role of hKGF
in human disease. The published literature, however, contains
evidence that strongly suggests a role for hKGF in at least two
human diseases, namely psoriasis and cancer. hKGF has also been
implicated in inflammatory bowel disease (P. Finch, personal
communication).
[0025] Psoriasis
[0026] Psoriasis is a skin disorder which can be debilitating
(Greaves et al., (1995) N Eng J Medicine 332:581-588),
characterized by hyperproliferation of the epidermis and incomplete
differentiation of keratinocytes, together with dermal inflammation
(Abel et al., (1994) Scientific American Medicine III-1 to III-18;
Greaves et al., (1995) N Eng J Medicine 332:581-588). There is not
yet an effective treatment for psoriasis (Anonymous, (1993) Drug
& Market Development 4:89-101; Abel et al., (1994) Scientific
American Medicine III-1 to III-18; Greaves et al., (1995) N Eng J
Medicine 332:581-588). Psoriasis occurs in 0.5 to 2.8 percent of
the population with the highest incidence in Scandinavia. In the US
in 1992, it was estimated that 4-8 million people affected with
psoriasis spent about $600 million for various drugs and related
therapies, none of which is very effective. Most of the expenditure
was made by about 400,000 patients with severe psoriasis spending
$1,000-1,500 annually on treatment. There are about 200,000 new
cases of psoriasis every year.
[0027] The basic cause of the disorder is not known, but it results
from a primary or secondary defect in the mechanisms that regulate
epidermal keratinocyte cell division (Abel et al., (1994)
Scientific American Medicine III-1 to III-18). Psoriasis responds
to steroids and cyclosporine and in that sense is characterized as
an immune disease (Abel et al., (1994) Scientific American Medicine
III-1 to III-18). Since hKGF is the primary specific growth factor
for keratinocytes, its overexpression and deregulation are primary
candidates as the cause of keratinocyte hyperproliferation in
psoriasis. The demonstration that the immune system is a prime
regulator of hKGF release (Boismenu et al., (1994) Science
266:1253-1255; Brauchle et al., (1994) Oncogene 9:3199-3204; Chedid
et al., (1994) J Biol Chem 269:10753-10757) strengthens the notion
that hKGF deregulation is the cause of psoriasis. Furthermore,
application of hKGF in porcine wounds creates a histological
appearance resembling psoriasis (Staiano-Coico et al., (1993) J Ex
Med 178:865-878); keratinocyte derived hKGF in transgenic mice
causes pathology reminiscent to psoriasis (Guo et al., (1993) EMBO
J 12:973-986); in situ hybridization experiments demonstrated a
moderate and a strong upregulation of hKGF and hKGF receptors
respectively in psoriasis (P. Finch, personal communication). In
situ hybridization experiments also demonstrated involvement of
hKGF in another immune disease namely, inflammatory bowel disease
(P. Finch, personal communication).
[0028] Cancer
[0029] It is well established in the literature that deregulation
of the expression of growth factors and growth factor hKGF and/or
its receptor is expected to be the transformation event in some
human cancers. The transforming ability of the hKGF system has been
demonstrated in vitro (Miki et al., (1991) Science 251:72-75). In
another study, carcinoma cell-lines have been found to express the
hKGF receptor and to respond to hKGF but not to aFGF, while sarcoma
cell-lines do not express hKGF receptors and respond to aFGF but
not to hKGF (Ishii et al., (1994) Cancer Res 54:518-522).
[0030] Gastrointestinal Cancer
[0031] Several poorly differentiated stomach cancers have an
amplified gene, designated K-sam, which is an isoform of the
hKGF-receptor (Katoh et al., (1992) Proc Natl Acad Sci USA
89:2960-2964). In vivo administration of hKGF to rats causes
proliferation of pancreatic ductal epithelial cell (Yi et al.,
(1994) Am J Pathol 145:80-85), hepatocytes, and epithelial cells
throughout the gastrointestinal tract (Housley Et al., (1994) J
Clin Invest 94:1764-1777).
[0032] Lung Cancer
[0033] Administration of hKGF to rats causes type II pneumocyte
hyperplasia similar to the bronchoalveolar cell variant of lung
carcinoma (Ulich et al., (1994) J Clin Invest 93:1298-1306).
[0034] Breast Cancer
[0035] In vivo, hKGF causes mammary duct dilation and rampant
epithelial hyperplasia, both of which are common features of breast
cancers (Ulich et al., (1994) Am J Pathol 144:862-868; Yi et al.,
(1994) Am J Pathol 145:1015-1022). However, the ductal epithelium
of breastfeeding rats is resistant to the growth promoting effects
of hKGF and this is of interest in regard to epidemiological
observations that pregnancy in women decreases susceptibility to
breast cancer and that dairy cows almost never develop breast
cancer (Kuzma, 1977, Breast in Pathology, Mosby Co.). There is
additional supporting evidence implicating hKGF in breast cancer.
hKGF mRNA has been detected recently in normal human breast tissue
and in 12 of 15 breast tumor samples tested (Koos et al., (1993) J
Steroid Biochem Molec Biol 45:217-225). The presence of hKGF mRNA
in breast tumors considered in conjunction with the observation
that hKGF is present in nonneoplastic mammary glands and that hKGF
causes rampant proliferation of mammary epithelium suggests that
hKGF may be an autocrine or paracrine growth factor important in
the regulation of the growth of normal and neoplastic mammary
epithelium (Ulich et al., (1994) Am J Pathol 144:862-868).
Infiltrating ductal mammary adenocarcinoma is characteristically
enveloped by a desmoplasmic stroma that has been postulated to
represent a defensive host response to the carcinoma (Ulich et al.,
(1994) Am J Pathol 144:862-868). Since hKGF is stroma derived it is
possible that the desmoplasmic stroma contributes rather than
inhibits the growth of the tumor.
[0036] Prostate Cancer
[0037] The growth promoting effect of androgens on prostate tumors
appears to be mediated through hKGF (Yan et al., (1992) Mol Endo
6:2123-2128), as androgens induce the expression of hKGF in
prostate stroma cells. Prostate tumors that are androgen dependent
in vivo, are androgen independent in vitro, but hKGF dependent (Yan
et al., (1992) Mol Endo 6:2123-2128). In agreement with the role of
hKGF as andromedin is the observation that hKGF functions in
epithelial induction during seminal vesicle development, a process
that is directed by androgen (Alarid et al., (1994) Proc Natl Acad
Sci USA 91:1074-1078). Furthermore, hKGF causes aberrant activation
of the androgen receptor, thus probably contributing to the failure
of androgen ablation therapy in prostate cancer (Culig et al.,
(1994) Cancer Res 54:5474-5478). Based on this information, it is
possible that genetic alterations cause hKGF to escape androgen
regulation and thus convert the androgen dependent tumor into an
androgen independent, highly malignant tumor. Such tumors would
still be able to express the androgen regulated marker PSA, as hKGF
also causes the aberrant activation of the androgen receptor. It is
also likely that hKGF might be responsible for Benign Prostate
Hypertrophy (BPH), a common health problem in older men (D.
Bottaro, personal communication).
[0038] d) hKGF Competitors
[0039] To date, a monoclonal antibody and a short hKGF-receptor
derived peptide (25-mer) have been described as hKGF competitors
(Bottaro et al., (1993) J Biol Chem 268:9180-9183). The monoclonal
antibody, designated 1G4, has a Kd of 200 pM for hKGF. The short
peptide inhibits hKGF binding to the cell surface of NIH/3T3 cells
expressing the human receptor with a Ki of about 1-5 .mu.M. Bottaro
et al. (WO 94/25057) provide hKGF-receptor peptides which inhibit
binding between hKGF and its receptor. Also provided is a method of
assaying test compounds for the ability to inhibit hKGF
receptor-mediated cell proliferation.
[0040] e) Assaying for Receptor-Growth Factor Interaction
[0041] Blocking the interaction of growth factors and lymphokines
with their cell surface receptor using antagonists has been an
approach for disease treatment. The discovery of such antagonists
requires the availability of biochemical assays for the
receptor-growth factor or lymphokine interaction. A classic assay
has been the competitive inhibition of radiolabeled growth factor
or lymphokine (tracer) to its cell surface receptor. These types of
assays utilize cell lines that express the relevant receptor on
their surface and determine the amount of cell bound tracer in the
presence of various concentrations of potential antagonists.
Additionally, other assays utilize membrane extracts from cell
lines that express the relevant receptor, and tracer binding is
followed by filter binding (see Nenquest Drug Discovery System:
Human Tumor Necrosis Factor-Alpha, NEN Research Products, E. I.
DuPont de Nemours & Co. (Inc.), Boston, Mass.) or by
immobilizing the membrane extracts onto solid supports (Urdal et
al., (1988) J Biol Chem 263:2870-2877; Smith et al., (1991) Bioch
Bioph Res Comm 176:335-342). Receptor induced electrophoretic
mobility shift of tracer has been applied to identify the presence
and size of cell surface receptors by crosslinking the receptor to
the tracer and then analyzing on denaturing gels (for example see
Kull et al., (1985) Proc natl Acad Sci USA 82:5756-5760; Hohmann et
al., (1989) J Biol Chem 264:14927-14934; Stauber et al., (1989) J
Biol Chem 264:3573-3576). The use of native gels and
non-crosslinked complexes has not been described for growth factors
or lymphokines and their receptors, but has been widely applied to
study nucleic acid protein interactions (Sambrook et al., (1989)
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.).
[0042] Screening of various cancer cell lines for the presence of
hKGF receptors by PCR, revealed that all carcinoma cell lines
express hKGF receptor mRNA while sarcoma cell lines do not. The
presence of mRNA does not necessarily mean that hKGF receptor will
be present on the surface of these cells. For hKGF, only cell based
assays have been described using Balb/MK keratinocytes (Weissman,
(1983) Cell 32:599-606) or NIH/3T3 cells transfected with the hKGF
receptor (Miki, (1992) Proc. Natl. Acad. Sci. USA 89:246-250).
[0043] SELEX
[0044] A method for the in vitro evolution of nucleic acid
molecules with highly specific binding to target molecules has been
developed. This method, Systematic Evolution of Ligands by
EXponential enrichment, termed SELEX, is described in U.S.
application Ser. No. 07/536,428, entitled "Systematic Evolution of
Ligands by Exponential Enrichment," now abandoned, U.S. application
Ser. No. 07/714,131, filed Jun. 10, 1991, entitled "Nucleic Acid
Ligands," now U.S. Pat. No. 5,475,096, and U.S. application Ser.
No. 07/931,473, filed Aug. 17, 1992, entitled "Nucleic Acid
Ligands," now U.S. Pat. No. 5,270,163 (see also PCT/US91/04078),
each of which is herein specifically incorporated by reference.
Each of these applications, collectively referred to herein as the
SELEX Patent Applications, describes a fundamentally novel method
for making a nucleic acid ligand to any desired target
molecule.
[0045] The SELEX method involves selection from a mixture of
candidate oligonucleotides and step-wise iterations of binding,
partitioning and amplification, using the same general selection
scheme, to achieve virtually any desired criterion of binding
affinity and selectivity. Starting from a mixture of nucleic acids,
preferably comprising a segment of randomized sequence, the SELEX
method includes steps of contacting the mixture with the target
under conditions favorable for binding, partitioning unbound
nucleic acids from those nucleic acids which have bound
specifically to target molecules, dissociating the nucleic
acid-target complexes, amplifying the nucleic acids dissociated
from the nucleic acid-target complexes to yield a ligand-enriched
mixture of nucleic acids, then reiterating the steps of binding,
partitioning, dissociating and amplifying through as many cycles as
desired to yield highly specific, high affinity nucleic acid
ligands to the target molecule.
[0046] The basic SELEX method has been modified to achieve a number
of specific objectives. For example, U.S. application Ser. No.
07/960,093, filed Oct. 14, 1992, entitled "Method for Selecting
Nucleic Acids on the Basis of Structure," describes the use of
SELEX in conjunction with gel electrophoresis to select nucleic
acid molecules with specific structural characteristics, such as
bent DNA. U.S. application Ser. No. 08/123,935, filed Sep. 17,
1993, entitled "Photoselection of Nucleic Acid Ligands," describes
a SELEX based method for selecting nucleic acid ligands containing
photoreactive groups capable of binding and/or photocrosslinking to
and/or photoinactivating a target molecule. U.S. application Ser.
No. 08/134,028, filed Oct. 7, 1993, entitled "High-Affinity Nucleic
Acid Ligands That Discriminate Between Theophylline and Caffeine,"
describes a method for identifying highly specific nucleic acid
ligands able to discriminate between closely related molecules,
termed "Counter-SELEX." U.S. application Ser. No. 08/143,564, filed
Oct. 25, 1993, entitled "Systematic Evolution of Ligands by
EXponential Enrichment: Solution SELEX," now abandoned (see U.S.
Pat. No. 5,567,588), describes a SELEX-based method which achieves
highly efficient partitioning between oligonucleotides having high
and low affinity for a target molecule. U.S. application Ser. No.
07/964,624, filed Oct. 21, 1992, entitled "Nucleic Acid Ligands to
HIV-RT and HIV-1 Rev," now U.S. Pat. No. 5,496,938, describes
methods for obtaining improved nucleic acid ligands after SELEX has
been performed. U.S. application Ser. No. 08/400,440, filed Mar. 8,
1995, entitled "Systematic Evolution of Ligands by EXponential
Enrichment: Chemi-SELEX," now U.S. Pat. No. 5,705,337, describes
methods for covalently linking a ligand to its target.
[0047] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or improved delivery characteristics. Examples of
such modifications include chemical substitutions at the ribose
and/or phosphate and/or base positions. SELEX-identified nucleic
acid ligands containing modified nucleotides are described in U.S.
application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled "High
Affinity Nucleic Acid Ligands Containing Modified Nucleotides," now
abandoned (see U.S. Pat. No. 5,660,985), that describes
oligonucleotides containing nucleotide derivatives chemically
modified at the 5- and 2'-positions of pyrimidines. U.S.
application Ser. No. 08/134,028, supra, describes highly specific
nucleic acid ligands containing one or more nucleotides modified
with 2'-amino (2'-NH.sub.2), 2'-fluoro (2'-F), and/or 2'-O-methyl
(2'-OMe). U.S. application Ser. No. 08/264,029, filed Jun. 22,
1994, entitled "Novel Method of Preparation of Known and Novel 2'
Modified Nucleosides by Intramolecular Nucleophilic Displacement,"
describes oligonucleotides containing various 2'-modified
pyrimidines.
[0048] The SELEX method encompasses combining selected
oligonucleotides with other selected oligonucleotides and
non-oligonucleotide functional units as described in U.S.
application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled
"Systematic Evolution of Ligands by Exponential Enrichment:
Chimeric SELEX," now U.S. Pat. No. 5,637,459, and U.S. application
Ser. No. 08/234,997, filed Apr. 28, 1994, entitled "Systematic
Evolution of Ligands by Exponential Enrichment: Blended SELEX," now
U.S. Pat. No. 5,683,867, respectively. These applications allow the
combination of the broad array of shapes and other properties, and
the efficient amplification and replication properties, of
oligonucleotides with the desirable properties of other molecules.
Each of the above described patent applications which describe
modifications of the basic SELEX procedure are specifically
incorporated by reference herein in their entirety.
BRIEF SUMMARY OF THE INVENTION
[0049] The present invention includes methods of identifying and
producing nucleic acid ligands to transforming growth factor beta
(TGF.beta.), platelet-derived growth factor (PDGF), and human
keratinocyte growth factor (hKGF), and homologous proteins, and the
nucleic acid ligands so identified and produced. For the purpose of
this application, TGF.beta. includes human TGF.beta.1, TGF.beta.2,
and TGF.beta.3 and TGF.beta.'s that are substantially homologous
thereto. By substantially homologous it is meant a degree of amino
acid sequence identity of 70% or more. For the purposes of this
application, PDGF refers to PDGF AA, AB, and BB isoforms and
homologous proteins. Specifically included in the definition are
human PDGF AA, AB and BB isoforms. In particular, RNA sequences are
provided that are capable of binding specifically to TGF.beta.1,
PDGF, and hKGF. Also provided are ssDNA sequences that are capable
of binding specifically to TGF.beta. and PDGF. Specifically
included in the invention are the RNA ligand sequences shown in
Tables 3, 13, 16, and 23 (SEQ ID NOS:12-42, 128-170, 189-262,
272-304). The RNA ligand sequences of TGF.beta. shown in Table 3
include both pre and post SELEX modifications. Also included in the
invention are ssDNA ligands of TGF.beta. and PDGF shown in Tables
6, 8, 9, and FIGS. 3, 4, and 9 (SEQ ID NOS:55-89, 93-124, 171-176).
Also included in this invention are RNA ligands of TGF.beta.1 and
hKGF that inhibit the function of TGF.beta.1 and hKGF, presumably
by inhibition of the interaction of TGF.beta. and hKGF with their
receptors. Also included in this invention are ssDNA ligands of
PDGF that inhibit the function of PDGF, presumably by inhibition of
the interaction of PDGF with its receptor.
[0050] Further included in this invention is a method of
identifying nucleic acid ligands and nucleic acid ligand sequences
to a target selected from the group consisting of TGF.beta., PDGF,
and hKGF comprising the steps of (a) contacting a candidate mixture
of nucleic acids with the target (b) partitioning between members
of said candidate mixture on the basis of affinity to the target
and (c) amplifying the selected molecules to yield a mixture of
nucleic acids enriched for nucleic acid sequences with a relatively
higher affinity for binding to the target.
[0051] More specifically, the present invention includes the RNA
and ssDNA ligands to TGF.beta. identified according to the
above-described method, including those ligands shown in Tables 3
and 6 (SEQ ID NOS:12-42, 55-89). Also included are nucleic acid
ligands to TGF.beta. that are substantially homologous to any of
the given ligands and that have substantially the same ability to
bind TGF.beta. and inhibit the function of TGF.beta.. Further
included in this invention are nucleic acid ligands to TGF.beta.
that have substantially the same structural form as the ligands
presented herein and that have substantially the same ability to
bind TGF.beta. and inhibit the function of TGF.beta..
[0052] Additionally, the present invention includes the ssDNA and
RNA ligands to PDGF identified according to the above-described
method, including those ligands shown in Tables 8 and 13, and FIGS.
3, 4, and 9 (SEQ ID NOS:93-124, 128-176). Also included are DNA and
RNA ligands to PDGF that are substantially homologous to any of the
given ligands and that have substantially the same ability to bind
PDGF. Further included in this invention are nucleic acid ligands
to PDGF that have substantially the same structural form as the
ligands presented herein and that have substantially the same
ability to bind PDGF.
[0053] In addition, the present invention includes the RNA ligands
to hKGF identified according to the above-described method,
including those ligands shown in Tables 16 and 23 (SEQ ID
NOS:189-264, 268-304). Also included are RNA ligands to hKGF that
are substantially homologous to any of the given ligands and that
have substantially the same ability to bind hKGF and inhibit the
interaction of hKGF with its receptor. Further included in this
invention are nucleic acid ligands to hKGF that have substantially
the same structural form as the ligands presented herein and that
have substantially the same ability to bind hKGF and inhibit the
interaction of hKGF with its receptor.
[0054] The present invention also includes other modified
nucleotide sequences based on the RNA ligands identified herein and
mixtures of the same.
[0055] Further included in this invention is a method of assaying a
test compound for the ability to inhibit hKGF receptor-mediated
cell proliferation comprising the steps of (a) contacting the test
compound with a hKGF nucleic acid ligand and a keratinocyte growth
factor; and (b) detecting the ability of the test compound to
inhibit binding between the hKGF nucleic acid ligand and the
keratinocyte growth factor.
[0056] Also included in this invention is a method of assaying a
test compound for the ability to inhibit the interaction of a
growth factor with its plasma membrane bound receptor comprising
the steps of (a) solubilizing cells containing the plasma membrane
bound receptor; (b) creating a plasma membrane extract of the
cells; (c) reacting the extract with labeled growth factor alone
and in the presence of the test compound thereby creating
complexes; (d) analyzing the complexes by electrophoresis under
native conditions; (e) visualizing the complexes by imaging; and
(f) comparing the image of the extract with labeled growth factor
alone to the image of the extract in the presence of the test
compound to determine whether the test compound inhibited the
interaction between the growth factor and its plasma membrane bound
receptor.
[0057] Further included in this invention is a method for assaying
cells to determine whether they express a growth factor plasma
membrane bound receptor comprising the steps of (a) solubilizing
the cells; (b) creating a plasma membrane extract of the cells; (c)
reacting the plasma membrane extract with a labeled growth factor;
(d) analyzing the reaction between the plasma membrane extract with
the labeled growth factor by electrophoresis under native
conditions; (e) comparing the electrophoresis of step (d) with
electrophoresis of labeled growth factor; and (f) visualizing the
results of the electrophoresis to determine whether a complex is
formed with altered mobility relative to the mobility of a labeled
growth factor alone.
BRIEF DESCRIPTION OF THE FIGURES
[0058] FIG. 1 shows the binding analysis of the 40D7 DNA library
for TGF.beta.1. Binding data obtained from Round 19 (triangles) and
Round 0 (circles) are shown.
[0059] FIG. 2 shows the results of the PAI-luciferase assay of
TGF.beta.1 (10 pM) incubated with oligonucleotides (0.1 .mu.M) or
anti-TGF.beta. (60 .mu.g/ml).
[0060] FIG. 3 shows the consensus secondary structure for the
sequence set shown in Table 9. R=A or G, Y=C or T, K=G or T, N and
N' indicate any base pair.
[0061] FIG. 4 shows the minimal ligands 20t, 36t and 41t folded
according to the consensus secondary structure motif. [3'T]
represents a 3'-3' linked thymidine nucleotide added to reduce
3'-exonuclease degradation.
[0062] FIGS. 5A, 5B and 5C show the binding of minimal high
affinity DNA ligands to PDGF. The fraction of .sup.32P 5'
nd-labeled DNA ligands bound to varying concentrations of PDGF was
determined by the nitrocellulose filter binding method. Minimal
ligands tested were 20t (o), 36t (.DELTA.), and 41t (.quadrature.).
Oligonucleotide concentrations in these experiments were
.apprxeq.10 pM (PDGF-AB and PDGF-BB) and .apprxeq.50 pM (PDGF AA).
Data points were fitted to eq. 1 (for binding of the DNA ligands to
PDGF-AA) or to eq. 2 (for binding to PDGF AB and BB) using the
non-linear least squares method. Binding reactions were done at
37.degree. C. in binding buffer (PBSM with 0.01% HSA).
[0063] FIG. 6 shows the dissociation rate determination for the
high affinity interaction between the minimal DNA ligands and PDGF
AB. The fraction of 5 .sup.32P end-labeled ligands 20t (o), 36t
(.DELTA.), and 41t (.quadrature.), all at 0.17 nM, bound to PDGF AB
(1 nM) was measured by nitrocellulose filter binding at the
indicated time points following the addition of a 500-fold excess
of the unlabeled competitor. The dissociation rate constant
(k.sub.off) values were determined by fitting the data points to
eq. 3. The experiments were performed at 37.degree. C. in binding
buffer.
[0064] FIG. 7 shows the effect of DNA ligands on the binding of
.sup.125I-PDGF-BB and .sup.125I-PDGF-AA to PDGF .alpha.-receptors
expressed in PAE cells.
[0065] FIG. 8 shows the effect of DNA ligands on the mitogenic
effect of PDGF-BB on PAE cells expressing the PDGF
.beta.-receptors.
[0066] FIG. 9 shows the 2'-O-methyl-2'-deoxy- and
2'-fluoro-2'-deoxyribonu- cleotide substitution pattern compatible
with high affinity binding to PDGF-AB. Underlined symbols indicate
2'-O-methyl-2'-deoxynucleotides; italicized symbols indicate
2'-fluoro-2'-deoxynucleotides; normal font indicates
2'-deoxyribonucleotides; [3'T] indicates inverted orientation
(3'3') thymidine nucleotide (Glen Research, Sterling, Va.); PEG in
the loops of helices II and III indicates pentaethylene glycol
spacer phosphoramidite (Glen Research, Sterling, Va.).
[0067] FIG. 10A shows the saturation binding of radiolabeled hKGF
on the surface of the PC-3 cells. TB (total binding) is the binding
observed in the absence of competing unlabeled hKGF, whereas NSB
(nonspecific binding) is the binding observed in the presence of
100 fold molar excess of unlabeled hKGF. SB (specific binding)
demonstrates the specific binding, and this curve was derived by
subtracting the NSB curve from the TB curve. FIG. 10B is the
Scatchard analysis of the data points shown in 10A for the SB
curve.
[0068] FIG. 11 shows the shift of the electrophoretic mobility due
to plasma membrane extracts from PC-3 cells. In lanes 1-8, the
membrane extracts were reacted with various concentrations of
radiolabeled hKGF as shown under each lane. In addition to the
radiolabeled hKGF (as shown under each lane) for lanes 9-12 a 100
fold molar excess was included of unlabeled hKGF. C1 and C2
represent two observed complexes due to the presence of hKGF
binding moieties in the PC-3 plasma membrane extracts.
[0069] FIGS. 12A-D show the proposed alignment of 2'F and
2'NH.sub.2 ligands. Lower case, italicized sequence residues
indicate the constant region of the template. In the consensus
sequences, capital and lower case letters are used for residues
found in greater than or equal to 80% and 60% of the members of
each family respectively. K.sub.d and K.sub.i values are also shown
next to the designation of each ligand. The K.sub.i values shown
here were calculated using the formula
K.sub.i=IC50/(1+(C/K.sub.d)), where IC50 is the measured half
maximal inhibitory concentration of each ligand in the PC-3 cell
assay as described in Example 16; C is the concentration of
.sup.125I-KGF; and K.sub.d is the equilibrium dissociation constant
of KGF for its receptor, (about 150 pM). The ligands marked with
stars show biphasic binding curves.
[0070] FIGS. 12A and 12B show the proposed alignment of 2'F
ligands. The majority of 2'F ligands can be folded into pseudoknot
structures. Two classes are proposed as shown. The summary
structure for each class is also shown. Bases participating in stem
1 (S1) are underlined with single lines while bases of stem 2 (S2)
are underlined with double lines. Spaces were introduced for
alignment of the various elements of the pseudoknots.
[0071] FIGS. 12C and 12D show the proposed folding of 2'NH.sub.2
ligands. These ligands are assigned into two classes. As shown in
the summary structures, class 1 and class 2 ligands can form a
stem-loop and dumbbell structure, respectively. Spaces were
introduced to allow sequence alignment. Residues participating in
stems are underlined. In the summary structures, periods (.)
indicate a variable number of residues. Ligands 2N and 54N are
circular permutations of the same dumbbell structure. For alignment
of the corresponding loops these ligands are wrapped around two
lines.
[0072] FIG. 13 shows the minimal sequence requirement for binding
of ligand 6F and 14F to hKGF. The predicted folding of each ligand
is shown. Constant regions of the ligands are shown in lower case.
Conserved sequences are underlined. Circles and triangles mark the
3' ends of active and inactive truncates respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0073] This application describes high-affinity nucleic acid
ligands to TGF.beta., PDGF, and hKGF identified through the method
known as SELEX. SELEX is described in U.S. application Ser. No.
07/536,428, entitled "Systematic Evolution of Ligands by
EXponential Enrichment," now abandoned, U.S. application Ser. No.
07/714,131, filed Jun. 10, 1991, entitled "Nucleic Acid Ligands,"
now U.S. Pat. No. 5,475,096, and U.S. application Ser. No.
07/931,473, filed Aug. 17, 1992, entitled "Methods for Identifying
Nucleic Acid Ligands," now U.S. Pat. No. 5,270,163, (see also WO
91/19813). These applications, each specifically incorporated
herein by reference, are collectively called the SELEX Patent
Applications.
[0074] In its most basic form, the SELEX process may be defined by
the following series of steps:
[0075] 1) A candidate mixture of nucleic acids of differing
sequence is prepared. The candidate mixture generally includes
regions of fixed sequences (i.e., each of the members of the
candidate mixture contains the same sequences in the same location)
and regions of randomized sequences. The fixed sequence regions are
selected either: (a) to assist in the amplification steps described
below, (b) to mimic a sequence known to bind to the target, or (c)
to enhance the concentration of a given structural arrangement of
the nucleic acids in the candidate mixture. The randomized
sequences can be totally randomized (i.e., the probability of
finding a base at any position being one in four) or only partially
randomized (e.g., the probability of finding a base at any location
can be selected at any level between 0 and 100 percent).
[0076] 2) The candidate mixture is contacted with the selected
target under conditions favorable for binding between the target
and members of the candidate mixture. Under these circumstances,
the interaction between the target and the nucleic acids of the
candidate mixture can be considered as forming nucleic acid-target
pairs between the target and those nucleic acids having the
strongest affinity for the target.
[0077] 3) The nucleic acids with the highest affinity for the
target are partitioned from those nucleic acids with lesser
affinity to the target. Because only an extremely small number of
sequences (and possibly only one molecule of nucleic acid)
corresponding to the highest affinity nucleic acids exist in the
candidate mixture, it is generally desirable to set the
partitioning criteria so that a significant amount of the nucleic
acids in the candidate mixture (approximately 5-50%) are retained
during partitioning.
[0078] 4) Those nucleic acids selected during partitioning as
having the relatively higher affinity to the target are then
amplified to create a new candidate mixture that is enriched in
nucleic acids having a relatively higher affinity for the
target.
[0079] 5) By repeating the partitioning and amplifying steps above,
the newly formed candidate mixture contains fewer and fewer weakly
binding sequences, and the average degree of affinity of the
nucleic acids to the target will generally increase. Taken to its
extreme, the SELEX process will yield a candidate mixture
containing one or a small number of unique nucleic acids
representing those nucleic acids from the original candidate
mixture having the highest affinity to the target molecule.
[0080] The SELEX Patent Applications describe and elaborate on this
process in great detail. Included are targets that can be used in
the process; methods for partitioning nucleic acids within a
candidate mixture; and methods for amplifying partitioned nucleic
acids to generate enriched candidate mixture. The SELEX Patent
Applications also describe ligands obtained to a number of target
species, including both protein targets where the protein is and is
not a nucleic acid binding protein.
[0081] The nucleic acid ligands described herein can be complexed
with a lipophilic compound (e.g., cholesterol) or attached to or
encapsulated in a complex comprised of lipophilic components (e.g.,
a liposome). The complexed nucleic acid ligands can enhance the
cellular uptake of the nucleic acid ligands by a cell for delivery
of the nucleic acid ligands to an intracellular target. U.S.
application Ser. No. 08/434,465, filed May 4, 1995, entitled
"Nucleic Acid Ligand Complexes," now U.S. Pat. No. 6,011,020, which
is incorporated in its entirety herein, describes a method for
preparing a therapeutic or diagnostic complex comprised of a
nucleic acid ligand and a lipophilic compound or a non-immunogenic,
high molecular weight compound.
[0082] The methods described herein and the nucleic acid ligands
identified by such methods are useful for both therapeutic and
diagnostic purposes. Therapeutic uses include the treatment or
prevention of diseases or medical conditions in human patients.
Diagnostic utilization may include both in vivo or in vitro
diagnostic applications. The SELEX method generally, and the
specific adaptations of the SELEX method taught and claimed herein
specifically, are particularly suited for diagnostic applications.
SELEX identifies nucleic acid ligands that are able to bind targets
with high affinity and with surprising specificity. These
characteristics are, of course, the desired properties one skilled
in the art would seek in a diagnostic ligand.
[0083] The nucleic acid ligands of the present invention may be
routinely adapted for diagnostic purposes according to any number
of techniques employed by those skilled in the art. Diagnostic
agents need only be able to allow the user to identify the presence
of a given target at a particular locale or concentration. Simply
the ability to form binding pairs with the target may be sufficient
to trigger a positive signal for diagnostic purposes. Those skilled
in the art would also be able to adapt any nucleic acid ligand by
procedures known in the art to incorporate a labeling tag in order
to track the presence of such ligand. Such a tag could be used in a
number of diagnostic procedures. The nucleic acid ligands described
herein may specifically be used for identification of the
TGF.beta., PDGF, and hKGF proteins.
[0084] SELEX provides high affinity ligands of a target molecule.
This represents a singular achievement that is unprecedented in the
field of nucleic acids research. The present invention applies the
SELEX procedure to the specific targets of TGF.beta., PDGF, and
hKGF. In the Example section below, the experimental parameters
used to isolate and identify the nucleic acid ligands to TGF.beta.,
PDGF, and hKGF are described.
[0085] In order to produce nucleic acids desirable for use as a
pharmaceutical, it is preferred that the nucleic acid ligand (1)
binds to the target in a manner capable of achieving the desired
effect on the target; (2) be as small as possible to obtain the
desired effect; (3) be as stable as possible; and (4) be a specific
ligand to the chosen target. In most situations, it is preferred
that the nucleic acid ligand have the highest possible affinity to
the target.
[0086] In co-pending and commonly assigned U.S. application Ser.
No. 07/964,624, filed Oct. 21, 1992 ('624), now U.S. Pat. No.
5,496,938, methods are described for obtaining improved nucleic
acid ligands after SELEX has been performed. The '624 application,
entitled "Nucleic Acid Ligands to HIV-RT and HIV-1 Rev," is
specifically incorporated herein by reference. Further included in
this patent are methods for determining the three-dimensional
structures of nucleic acid ligands. Such methods include
mathematical modeling and structure modifications of the
SELEX-derived ligands, such as chemical modification and nucleotide
substitution.
[0087] In the present invention, SELEX experiments were performed
in order to identify RNA and DNA ligands with specific high
affinity for TGF.beta.1 from degenerate libraries containing 40 or
60 random positions (40N or 60N) (Tables 1 and 5). This invention
includes the specific RNA ligands to TGF.beta.1 shown in Table 3
(SEQ ID NOS:12-42), identified by the methods described in Examples
1 and 2. This invention further includes RNA ligands to TGF.beta.
which inhibit TGF.beta.1 function, presumably by inhibiting the
interaction of TGF.beta.1 with its receptor. This invention
includes the specific ssDNA ligands to TGF.beta.1 shown in Table 6
(SEQ ID NOS:55-89) identified by the methods described in Examples
5 and 6.
[0088] In the present invention, two SELEX experiments were also
performed in order to identify ssDNA and RNA with specific high
affinity for PDGF from degenerate libraries containing 40 and 50
random positions (40N and 50N), respectively (Tables 7 and 12).
This invention includes the specific ssDNA and RNA ligands to PDGF
shown in Tables 8, 9 and 13 and FIGS. 3, 4, and 9 (SEQ ID
NOS:93-124, 128-176), identified by the methods described in
Examples 7 and 15.
[0089] In the present invention, a SELEX experiment was also
performed in search of RNA ligands with specific high affinity for
hKGF from degenerate libraries containing 40 random positions (40N)
(Table 14). This invention includes the specific RNA ligands to
hKGF shown in Tables 16 and 23 and FIG. 12 (SEQ ID NOS:189-262,
268-304), identified by the methods described in Examples 16 and
17. This invention further includes RNA ligands to hKGF which
inhibit the interaction of hKGF with its receptor.
[0090] The scope of the ligands covered by this invention extends
to all nucleic acid ligands of TGF.beta., PDGF, and hKGF, modified
and unmodified, preferably those identified according to the SELEX
procedure. More specifically, this invention includes nucleic acid
sequences that are substantially homologous to the ligands shown in
Tables 3, 6, 8, 9, 13, 16, and 23 and FIGS. 3, 4, 9 and 12 (SEQ ID
NOS:12-42, 55-89, 93-124, 128-176, 189-262, 268-304). By
substantially homologous it is meant a degree of primary sequence
homology in excess of 70%, most preferably in excess of 80%. A
review of the sequence homologies of the nucleic acid ligands shown
in Tables 3 and 6 (SEQ ID NOS.:12-42, 55-89) for TGF.beta., Tables
8 and 13 (SEQ ID NOS:93-124, 128-170) for PDGF, and Tables 16 and
23 (SEQ ID NOS:189-262, 272-304) for hKGF shows that sequences with
little or no primary homology may have substantially the same
ability to bind a given target. For these reasons, this invention
also includes nucleic acid ligands that have substantially the same
structure and ability to bind TGF.beta., PDGF, and hKGF as the
nucleic acid ligands shown in Tables 3, 6, 8, 9, 13, 16, and 23 and
FIGS. 3, 4, 9 and 12 (SEQ ID NOS:12-42, 55-89, 93-124, 128-176,
189-262, 268-304). Substantially the same structure for PDGF
includes all nucleic acid ligands having the common structural
elements shown in FIG. 3 that lead to the affinity to PDGF.
Substantially the same ability to bind TGF.beta., PDGF, or hKGF
means that the affinity is within one or two orders of magnitude of
the affinity of the ligands described herein. It is well within the
skill of those of ordinary skill in the art to determine whether a
given sequence--substantially homologous to those specifically
described herein--has substantially the same ability to bind
TGF.beta., PDGF, or hKGF.
[0091] This invention also includes the ligands as described above,
wherein certain chemical modifications are made in order to
increase the in vivo stability of the ligand or to enhance or
mediate the delivery of the ligand. Examples of such modifications
include chemical substitutions at the sugar and/or phosphate and/or
base positions of a given nucleic acid sequence. See, e.g., U.S.
application Ser. No. 08/117,991, filed Sep. 9, 1993, entitled "High
Affinity Nucleic Acid Ligands Containing Modified Nucleotides," now
abandoned (see U.S. Pat. No. 5,660,985), which is specifically
incorporated herein by reference. Other modifications are known to
one of ordinary skill in the art. Such modifications may be made
post-SELEX (modification of previously identified modified or
unmodified ligands) or by incorporation into the SELEX process.
[0092] Example 20 describes post-SELEX procedure modification of a
nucleic acid ligand to basic fibroblast growth factor (bFGF). The
nucleic acid ligand was modified by the addition of
phosphorothioate caps and substitution of several ribopurines with
2'-deoxy-2'-O-methylpurines.
[0093] As described above, because of their ability to selectively
bind TGF.beta., PDGF, and hKGF, the nucleic acid ligands to
TGF.beta., PDGF, and hKGF described herein are useful as
pharmaceuticals. This invention, therefore, also includes a method
for treating TGF-.beta.-mediated pathological conditions by
administration of a nucleic acid ligand capable of binding to
TGF.beta., a method for treating PDGF-mediated pathological
conditions by administration of a nucleic acid ligand capable of
binding to PDGF, and a method for treating hKGF-mediated
pathological conditions by administration of a nucleic acid ligand
capable of binding to hKGF.
[0094] Therapeutic compositions of the nucleic acid ligands may be
administered parenterally by injection, although other effective
administration forms, such as intraarticular injection, inhalant
mists, orally active formulations, transdermal iontophoresis or
suppositories, are also envisioned. One preferred carrier is
physiological saline solution, but it is contemplated that other
pharmaceutically acceptable carriers may also be used. In one
preferred embodiment, it is envisioned that the carrier and the
ligand constitute a physiologically-compatible, slow release
formulation. The primary solvent in such a carrier may be either
aqueous or non-aqueous in nature. In addition, the carrier may
contain other pharmacologically-acceptable excipients for modifying
or maintaining the pH, osmolarity, viscosity, clarity, color,
sterility, stability, rate of dissolution, or odor of the
formulation. Similarly, the carrier may contain still other
pharmacologically-acceptable excipients for modifying or
maintaining the stability, rate of dissolution, release, or
absorption of the ligand. Such excipients are those substances
usually and customarily employed to formulate dosages for parental
administration in either unit dose or multi-dose form.
[0095] Once the therapeutic composition has been formulated, it may
be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or dehydrated or lyophilized powder. Such
formulations may be stored either in a ready to use form or
requiring reconstitution immediately prior to administration. The
manner of administering formulations containing nucleic acid
ligands for systemic delivery may be via subcutaneous,
intramuscular, intravenous, intranasal or vaginal or rectal
suppository.
[0096] The following examples are provided to explain and
illustrate the present invention and are not intended to be
limiting of the invention. Examples 1-4 describe initial
experiments to identify RNA with specific high affinity for
TGF.beta.1. Example 1 describes the various materials and
experimental procedures used in Examples 2-4. Example 2 describes a
representative method for identifying RNA ligands by the SELEX
method which bind TGF.beta.1. Example 3 describes the affinities
the ligands have for TGF.beta.1 and demonstrates that the ligands
are capable of inhibiting the function of TGF.beta.1, presumably by
inhibiting the interaction of TGF.beta.1 with its receptor. Example
4 describes which regions of the ligands are believed to be
necessary for TGF.beta.1 binding and inhibition of TGF.beta.1
receptor binding. Example 5 describes another representative method
for identifying RNA and DNA ligands by the SELEX method which bind
TGF.beta.1. Example 6 reports on the binding analysis, bioassay,
and sequences of a ssDNA SELEX library. Example 7 describes the
various materials and experimental procedures used in evolving
ssDNA ligands to PDGF described in Examples 8-13. Example 8
describes the ssDNA ligands to PDGF and the predicted secondary
structure of selected nucleic acid ligands. Example 9 describes the
minimal sequence necessary for high affinity binding. Example 10
describes the kinetic stability of PDGF-Nucleic Acid Ligand
complexes. Example 11 describes the thermal melting properties for
selected ligands. Example 12 describes photo-crosslinking of
nucleic acid ligands and PDGF. Example 13 describes the inhibition
by DNA ligands of PDGF isoforms on cultured cells and inhibition of
the mitogenic effects of PDGF in cells by DNA ligands. Example 14
describes the modification of nucleic acid ligands to PDGF with
modified nucleotides. Example 15 describes the experimental
procedures used in evolving RNA ligands to PDGF and shows the
ligand sequences. Example 16 describes the various materials and
experimental procedures used in evolving nucleic acid ligands to
hKGF described in Examples 17-19. Example 17 describes the RNA
ligands to hKGF, the affinities the ligands have for hKGF, and the
specificity of the RNA ligands to hKGF. Example 18 describes
inhibition of hKGF binding to cell surface receptors. Example 19
reports on the inhibition of mitogenic activity of hKGF by a
selected ligand. Example 20 describes the modification of nucleic
acid ligands to bFGF with 2'-deoxy-2'-O-methylpur- ines.
EXAMPLES
Example 1
Experimental Procedures
[0097] This example provides the general procedures followed and
incorporated in Examples 2-4.
[0098] A. Materials.
[0099] Human recombinant TGF.beta.1 used in this SELEX procedure
was acquired from Genentech. Human recombinant TGF.beta.1 can also
be purchased from R&D systems, Minneapolis, Minn., USA.
[0100] Biotinylated TGF.beta.1 was prepared by reacting TGF.beta.1
at 3.6 .mu.M with an 11 fold molar excess of sulfo-NHS-biotin
(Pierce, Rockford, Ill., USA) in 50 mM NaHCO.sub.3 for 3 hr in an
ice bath. The reaction was acidified with 0.036 volumes of 10%
acetic acid and applied to a 40 mg Vydac (The Separations Group,
Hesperia, Calif., USA) reverse phase column made in a siliconized
pipet tip to separate unreacted biotin from biotinylated
TGF.beta.1. The column was prewashed with 200 .mu.l ethanol
followed by 200 .mu.l 1% acetic acid, the biotinylation reaction
was applied, free biotin was washed through with 200 .mu.l of 50 mM
sodium acetate pH 5.5, followed by 200 .mu.l of 20% acetonitrile
and finally eluted with 200 .mu.l of 60% acetonitrile. The sample
was lyophilized and resuspended in 50 mM sodium acetate pH 5.0 at
40 .mu.M and stored at 4.degree. C. The TGF.beta.1 was spiked with
100,000 cpm iodinated TGF.beta.1 in order to follow recovery and to
assess the success of the biotinylation reaction by measuring the
fraction of the radioactivity that would bind to streptavidin
coated agarose beads (Pierce) before and after biotinylation. An
aliquot of the TGF.beta.1 before and after biotinylation was
subjected to analytical reverse phase chromatography. The
biotinylated TGF.beta.1 substantially ran as a single peak which
was retarded with respect to the unbiotinylated TGF.beta.. A small
amount (5%) of unreacted TGF.beta.1 could be detected. The
efficiency of binding of the iodinated, biotinylated TGF.beta.1 to
streptavidin (SA) agarose beads (30 .mu.l) was 30% under the
binding conditions used for SELEX partitioning.
[0101] Iodinated TGF.beta.1 was prepared by the lactoperoxidase
method (50 mM sodium phosphate pH 7.3, 0.16% glucose) with BioRad
Enzymo beads (BioRad, Richmond, Calif., USA) and the bound iodine
separated from the free iodine by gel filtration on G25 Sephadex in
50 mM sodium acetate 0.01% Tween.
[0102] The mink lung cell line expressing the luciferase reporter
gene under the control of PAI 1 promoter (Abe et al. (1994) Anal.
Biochem. 216:276-284) was a gift from Dr. Dan Rifkin (Department of
Cell Biology, New York Medical Center, New York, N.Y. 10016).
Luciferase was assayed by reagents purchased from Analytical
Luminescence Laboratory, San Diego, Calif., USA.
[0103] 2'-NH.sub.2 modified CTP and UTP were prepared according to
the method of Pieken et al. (1991) Science 253:314-317. DNA
oligonucleotides were synthesized using standard procedures either
at NeXstar Pharmaceuticals, Inc. (Boulder, Colo., USA) or by Operon
Technologies (Alameda, Calif., USA). All other reagents and
chemicals were purchased from standard commercial sources and
sources have been indicated.
[0104] B. SELEX Procedure
[0105] SELEX ligands that bind to TGF.beta.1 were derived
essentially as described in U.S. Pat. No. 5,270,163 (see also,
Tuerk and Gold (1990) Science 249:505-510). To generate the
starting pool of PCR template, PCR product from twenty separate PCR
reactions each containing 16.1 pmol of unpurified, single stranded
DNA (at least a total of 2.times.10.sup.12 to 2.times.10.sup.13
different molecules) were pooled before the first transcription.
PCR conditions were 50 mM KCl, 10 mM Tris-HCl, pH 9, 0.1%
Triton-X100, 1.5 mM MgCl.sub.2, 0.2 mM of each dATP, dCTP, dGTP,
and dTTP, 2 .mu.M each primer and 0.075 units/.mu.l of Taq DNA
polymerase, 100 .mu.l per reaction in a siliconized microfuge tube.
All PCR cycles took advantage of hot start using Ampliwax (Perk and
Elmer, Norwalk, Conn., USA). Duration of the initial PCR was 10
cycles; a PCR cycle was 94.degree. C.-1', 52.degree. C.-1',
72.degree. C.-2'. An initial denaturation was 94.degree. C. for 4'
and the final extension at 72.degree. C. for 5'. PCR reactions were
combined, phenol/ chloroform extracted, and isopropanol
precipitated (2.0 M ammonium acetate, 50% isopropanol) to remove
primers.
[0106] Transcription reactions contained 200 nM DNA, 0.9 mM GTP,
0.9 mM 2'-NH.sub.2-UTP, 0.9 mM 2'-NH.sub.2-CTP, 0.5 mM ATP, 87 mM
Tris-HCl pH 8.0, 17 mM MgCl.sub.2, 4.4 mM spermidine, 22 mM DTT,
100 .mu.g/ml acetylated BSA (Promega, Madison, Wis., USA) and 4
units/.mu.l T7 RNA polymerase. (2'-F-UTP and 2'-F-CTP (United
States Biochemical, Cleveland, Ohio, USA) were used at 3.0 mM,
whereas UTP and CTP were used at 0.9 mM each). Transcription
reactions were incubated overnight at 28.degree. C. (at least 10
hours). After transcription the template was digested by addition
of 2 .mu.l RQ1 Dnase (Promega) for 15' at 28.degree. C., and then
extracted with phenol/CHCl.sub.3, followed by three ethanol
precipitations from ammonium acetate (3.9 M ammonium acetate, 72%
ethanol).
[0107] The RNA molecules were incubated with TGF.beta.1 bound to SA
agarose beads as described below in Krebs-Ringer solution (KR) (120
mM NaCl, 4.8 mM KCl, 10 mM Na phosphate buffer pH 7.4, 1.2 mM
MgSO.sub.4, 2.6 mM CaCl.sub.2) modified to include 20 mM Na-Hepes
pH 7.5 and 0.2% Triton X100 (Pierce). This buffer is referred to as
KRHT.
[0108] TGF.beta.1-RNA complexes were separated from unbound RNA by
washing the beads. Recovery of the selected 2'-NH.sub.2 or F
pyrimidine modified RNA from the agarose beads required guanidine
thiocyanate extraction (5M GnSCN, 10 mM Tris-HCl, 0.1 mM EDTA, pH
7.0, 0.1 M beta mercaptoethanol) or from Seradyne SA coated beads
by 2% SDS (0.1 M Tris-HCl pH 7.5, 50 mM NaCl, 1 mM Na.sub.2EDTA, 2%
SDS, 1.5 mM DTT). Regular 2'-OH RNA was easily recovered under less
harsh conditions with the same buffer used for the Seradyne beads
containing only 0.2% SDS. After extraction and precipitation to
purify and concentrate the RNA, the sample was reverse transcribed
with a cloned MMLV RT with the RNase H sequence deleted. The
reaction contained less than or equal to 16 nM RNA, 10 .mu.M 3'
primer, 50 mM Tris-HCL pH 8.3, 75 mM KCl, 5 mM MgCl.sub.2, 10 mM
DTT, 0.5 mM dNTP's. Prior to addition of buffer the RNA and the
primer were boiled together. After addition of buffer and salts the
reaction was annealed for 10 min at 28.degree. C. before addition
of 600 units of Superscript reverse transcriptase (Bethesda
Research Labs, Gaithersburg, Md., USA) and synthesis at 50.degree.
C. for 1 hour.
[0109] PCR amplification of this cDNA (<1 pmol) resulted in
approximately 250 pmol double-stranded DNA, of this, 40 pmols was
transcribed and used to initiate the next round of SELEX.
[0110] C. Partitioning Method for SELEX.
[0111] 2.5 pmols biotinylated TGF.beta.1 were bound to 30 .mu.l SA
agarose beads (Pierce) in 200 .mu.l KRHT. The mixture was incubated
on a rotator at 37.degree. C. for 15 to 30 minutes. The beads were
washed three times by centrifugation and resuspension in 200 .mu.l
cold KRHT to remove unbound TGF.beta.1, and resuspended in a final
volume of 500 .mu.l KRHT. RNA containing 2'-NH.sub.2 pyrimidines
was heated at 70.degree. C. for three minutes (RNAs containing
2'-OH or 2'-F pyrimidines were heated at 95.degree. C.) and diluted
into KRHT containing TGF.beta.1 bound to SA beads. The final
concentration of RNA is 1 .mu.M and the TGF.beta.1 was 5 nM.
Binding occurs with rotation at 37.degree. C. for 30 minutes. Beads
were washed by centrifugation and resuspension three times with 200
.mu.l binding buffer to remove unbound RNA. RNA was eluted from the
beads as described above.
[0112] D. Binding Assays.
[0113] Two binding assays for ligands to TGF.beta.1 gave equivalent
results wherever tested. In the SA bead assay the biotinylated
TGF.beta.1 was serially diluted in KRHT in polypropylene tubes
(Linbro, ICN, Irvine, Calif., USA) and bound to the beads as
described above. After unbound TGF.beta.1 was washed away, trace
quantities of .sup.32P-labeled RNA(<0.1 1 nM) were added to each
tube and vortexed to mix. After static incubation at 37.degree. C.
for 30 minutes, the unbound RNA was removed by washing three times
with 200 .mu.l of KRHT.
[0114] In the nitrocellulose filter binding assay, TGF.beta.1 was
serially diluted in KRH containing 0.1% defatted BSA (Fluka
radioimmunoassay grade, Fluka, Hauppauge, N.Y., USA) as carrier
instead of Triton X-100. Incubation with RNA tracer was as above.
Samples were pipetted with a multiwell pipettor onto a multiwell
manifold holding a sheet of wet BioRad 0.45 micron nitrocellulose,
aspirated, and washed three times with 200 .mu.l KRH (containing no
BSA). The filters were air dried and counted in a liquid
scintillation counter (Beckmann Instruments, Palo Alto, Calif.)
[0115] The equation used to fit the binding of ligands to
TGF.beta.1 describes the binding of a ligand to a receptor (in this
case TGF.beta.1) that follows the laws of mass action and for which
there is a single binding site: Y=Bmax*X/(Kd+X): where Y is the
fraction of the ligand bound, B.sub.max is the maximum fraction of
the ligand bound, X is the concentration of TGF.beta.1 and Kd is
the dissociation constant of TGF.beta.1 and the ligand. Data points
were fit by nonlinear regression using the computer program
Graphpad Prism (Graphpad Software, San Diego, Calif.). The
algorithm minimized the sum of the squares of the actual distance
of the points from the curve. Convergence was reached when two
consecutive iterations changed the sum-of-squares by less than
0.01%.
[0116] E. Cloning and Sequencing.
[0117] SELEX experiments are described in Table 2. Primers for
SELEX experiments 1 and 2 shown in Table 1 contain recognition
sites for the restriction endonucleases SacI (5' primer T7SacBam;
SEQ ID NO:7) and XbaI (3' primer 3XH; SEQ ID NO:9). PCR products
from SELEX experiments 1 and 2 were cloned directionally into
SacI/XbaI digested pGem 9zf (Promega). 5' primer T7SB2N (SEQ ID
NO:8) and 3' primer 3XH (SEQ ID NO:9) (Table 1) were used for SELEX
experiments 3-9. PCR products from SELEX experiments 3-9 were
cloned directionally into the BamHI/XbaI site of a modified pGem9zf
:BamHI cloning vector. The BamH1 site was engineered into pGem9zf
in the following way. A clone isolated from library 2 (lib2-6-2)
that did not bind to TGF.beta.1 (sequence not shown) was digested
with BamH1 and XbaI. The sequence flanking the cloning site of the
modified pGem9zf vector is shown in Table 1 (SEQ ID NOS:10-11).
[0118] After digestion of the plasmid with restriction endonuclease
and dephosphorylation with CIP (calf intestinal phosphatase),
vectors were gel purified. Inserts were ligated and recombinant
plasmids were transformed into E. coli strain DH10B (Bethesda
Research Labs). Plasmid DNA was prepared by alkaline lysis, mini
prep procedure. Twenty-two clones representing 9 unique sequences
were sequenced at random from libraries 1 and 2. 50 clones were
sequenced from libraries 3-9 using a single dideoxy G reaction
(called G track). The sequencing ladders were compared and
organized for similarities. Selected clones from each family were
chosen for complete sequence analysis. TGF.beta.1 binding assays
were performed on transcripts representing different G sequences in
each library. Out of a total of 140 binding assays, 27 ligands
bound with a Kd less than 10 nM, and 21 of these were sequenced.
Clones were sequenced with the Sequenase sequencing kit (United
States Biochemical Corporation, Cleveland, Ohio).
[0119] F. Ligand Truncation.
[0120] Truncation experiments were carried out to determine the
minimal sequence necessary for high affinity binding of the RNA
ligands to TGF.beta.1. For 3' boundary determination, RNA ligands
were 5' end-labeled with .gamma.-.sup.32P-ATP using T4
polynucleotide kinase. 5' boundaries were established with 3'
end-labeled ligands using .alpha.-.sup.32P-pCp and T4 RNA ligase.
After partial alkaline hydrolysis, radiolabeled RNA ligands were
incubated with TGF.beta.1 at concentrations ranging from 1 nM to 50
nM and protein-bound RNA was separated by nitrocellulose
partitioning. RNA truncates were analyzed on a high-resolution
denaturing polyacrylamide gel. A ladder of radioactively labeled
ligands terminating with G-residues was generated by partial RNase
T1 digestion and was used as markers.
[0121] G. Inhibition of TGF.beta.1 Function.
[0122] TGF.beta.1 signal transduction begins with binding to a cell
surface receptor and results in the induction of transcription of a
variety of genes. One of these genes is Pail. The TGF.beta.1 assay
utilizes the mink lung epithelial cell (MLEC) carrying the
luciferase reporter gene fused to the Pail promoter. The MLEC has
TGF.beta.1 receptors on its cell surface. Thus one can measure the
response of the cells to TGF.beta.1 and the effective concentration
of TGF.beta.1 in the culture media by measuring the luciferase
enzyme activity after a period of induction.
[0123] Mink lung epithelial cells (MLEC) carrying the Pail/luc
construct were maintained in DME containing 10% fetal bovine serum
and 400 .mu.g/ml G418. MLEC-Pail/luc cells were plated at
3.2.times.10.sup.4 cells per well in a 96 well Falcon plate, in 100
.mu.l of DME+10% fetal bovine serum overnight. Media was made from
autoclaved water. The cells were washed three times (1100 .mu.l) in
serum free DME plus Solution A (1:1). Solution A is 30 mM Hepes pH
7.6, 10 mM glucose, 3.0 mM KCl, 131 mM NaCl, 1.0 mM disodium
phosphate. Samples (100 .mu.l) were added in DME containing 20 mM
Hepes pH 7.5, and 0.1% BSA (Fluka, radioimmunoassay grade). All
samples were in triplicate. After six hours at 37.degree. C. in a
5% CO.sub.2 incubator the media was removed and cells were washed
three times (100 .mu.l each) in cold PBS. Lysis buffer (75 .mu.l)
(Analytical Luminescence Laboratory) was added and the plates
incubated on ice for 20 min. The plates were sealed and frozen at
-80.degree. C. until assayed. Samples (25 .mu.l) were assayed for
luciferase activity with the Enhanced Luciferase Assay Kit from
Analytical Luminescence Laboratory (San Diego, Calif., USA)
according to the manufacturer's instructions using the Berthold
Microlumat LB96P luminometer. Luminescence is reproducibly a
function of TGF.beta.1 concentration added to the media.
[0124] Ligands tested for inhibition of TGF.beta.1 activity were
tested at a minimum of five concentrations. The ligands were
serially diluted in DME, 20 mM Hepes pH 7.5, 0.1% Fluka BSA in
polypropylene tubes and an equal volume of media containing 12 pM
TGF.beta.1 was added to each tube, vortexed and transferred to the
cells without further incubation. From the TGF.beta.1 standard
curve included on every plate the effective concentration of
TGF.beta.1 in the presence of the inhibitory ligands was determined
by the reduction in luminescence measured. Some ligands were tested
at both 3 pM and 6 pM TGF.beta.1 with the same results. To
determine the IC.sub.50 (the concentration of SELEX ligand
necessary to reduce the TGF.beta.1 activity 50%), the five values
obtained for each ligand were plotted and the value at 50%
inhibition was determined graphically using Graphpad Prism assuming
a hyperbolic fit of the data and using non-linear regression.
Example 2
RNA Ligands to TGF.beta.1
[0125] A. SELEX Experiments
[0126] In order to generate RNA ligands to TGF.beta.1, nine SELEX
experiments, as summarized in Table 2, were performed using the
methods described in Example 1. As shown in Table 1, the RNA pools
differ in the number of random bases present in the central portion
of the molecules: 40 nucleotides in the 40N6 (SEQ ID NO:2) SELEX
and 64 nucleotides in the 64N6 and lib2-6-1RN6 (SEQ ID NOS:1, 3)
SELEX experiment. Since the goal was to select RNA ligands that not
only bound to TGF.beta.1 but also blocked receptor binding, the
large random region (64N) was chosen. In two experiments, a shorter
random region (40N) was also included. Ligands to TGF.beta.1 were
very rare with 40N and were qualitatively the same as the 64N6
ligands selected.
[0127] The sequences of clones from the SELEX experiments are shown
in Table 3 (SEQ ID NOS:12-42). The pyrimidines used in the various
SELEX experiments differed at the 2' position of the sugar (Table
2). In the first two SELEX experiments, ligands were evolved as
2'-OH pyrimidines. Ligands were post-SELEX modified with
2'-NH.sub.2 or 2'-F-substituted pyrimidines to see if they retained
TGF.beta.1 binding. Since the 2' substitutions rendered the ligands
resistant to RNase A they were also tested in the cell culture
assay for inhibition of TGF.beta.1 activity. One such ligand
lib2-6-1 (Group D, Table 3; SEQ ID NO:35) when substituted with
2'-NH.sub.2-UTP and 2'-F-CTP was shown to inhibit TGF.beta.1
receptor mediated activity. To select more ligands, six more
independent SELEX experiments (lib3-7 and lib9) were performed
using the 2'-F and 2'-NH.sub.2-substituted pyrimidines during the
evolution process. In experiment lib8 the biologically active clone
lib2-6-1 (SEQ ID NO:35) was randomized and subjected to
re-selection to see if the binding and inhibition behavior of the
clone could be improved. Lib8 was evolved as a 2'-OH pyrimidine
RNA. In some cases, post-SELEX modification of TGF.beta.1 ligands
derived from experiments 3-9 were performed, e.g., to determine if
a ligand evolved with 2'-F pyrimidine substitutions would also bind
with 2'-NH.sub.2 substitutions.
[0128] Each starting pool for a SELEX experiment contained
3.times.10.sup.14 RNA molecules (500 pmol). The affinity of the
starting RNA for TGF.beta.1 was estimated to be greater than 50 mM.
After 4 rounds of SELEX, the affinities of the evolving pools had
improved to approximately 10 nM and did not shift significantly in
subsequent rounds. RNA was bulk sequenced and found to be
non-random and cloned.
[0129] Lib1 took 20 rounds to evolve since optimum concentrations
of TGF.beta.1 were not used until round 15 and libraries 5, 6 and 7
took longer to evolve because optimum conditions for recovery of
bound ligands during the partitioning step in SELEX were not
introduced until round 8. Optimum TGF.beta.1 concentrations and
partitioning conditions are described in Example 1.
[0130] B. RNA Sequenes
[0131] Many clones in a SELEX library are identical or similar in
sequence. The libraries were screened by G track and only
representatives of each G track type were tested in a binding
assay. The binding assay was five points (16.5 nM, 5.5 nM, 1.8 nM,
0.6 nM, and 0.2 nM) and could detect only those SELEX clones with a
Kd less than or equal to 10 nM. RNA ligands that bound well
(Kd<10 nM) in the binding assay were sequenced. The sequences
were inspected by eye and analyzed using computer programs which
perform alignments and fold nucleic acid sequences to predict
regions of secondary structure. Ligands were classified into five
groups (A, B, C, D, and orphans) by sequence homology. Each group
has characteristic allowable 2' substitutions.
[0132] 58 clones were identified by G track from 7 separate SELEX
experiments to belong to group A ligands (Table 3; SEQ ID
NOS:12-42). 15 clones were sequenced; 13 were similar but not
identical, whereas 3 clones, lib3-13 (SEQ ID NO:12), lib5-6 and
lib5-13, were identical. Group A ligands were recovered from seven
of the eight SELEX libraries which included libraries evolved as
2'-NH.sub.2, 2'-OH or 2'-F-substituted pyrimidines as well as a
library evolved as 2'-F-UTP, 2'-NH.sub.2-CTP. Post SELEX
modification indicates that 2'-NH.sub.2-UTP, 2'-F-CTP does not
disrupt binding of lib8-9 to TGF.beta.1, thus the structure of
Group A ligands appears to not require a specific 2' moiety on the
pyrimidine sugar in order to maintain binding.
[0133] Group B ligands bind both as 2'-NH.sub.2 and 2'-F pyrimidine
substituted RNA. 28 Group B clones were detected by G track
analysis from 3 libraries. Two of the libraries were evolved as
2'-NH.sub.2 and one as 2'-F library. Four clones were sequenced,
two were identical (lib5-47 and lib4-12; SEQ ID NO:28). An internal
deletion can occur in group B, as in lib 3-44. The 40N orphan,
lib3-42 was placed in Group B on the basis of secondary structure.
The internal deletion in lib3-44, the binding affinity, the
bioactivity and boundary experiments all support the placement of
lib3-42 in this group.
[0134] Group C ligands bind as 2'-OH or 2'-F ligands as expected,
since members of this group were evolved as 2'-OH ligands in lib 1
and as 2'-F pyrimidine substituted ligands in lib 6. Lib1-20-3 (SEQ
ID NO:32) was post SELEX modified and as 2'-F derivative. Lib1-20-3
did not bind with 2'-NH.sub.2 pyrimidines incorporated.
[0135] Group D ligand, lib2-6-1 (SEQ ID NO:35), was isolated after
2'-OH SELEX but was post SELEX modified and binds well as a
2'-NH.sub.2-UTP and 2'-F-CTP pyrimidine derivative. Lib2-6-1 does
not bind well to TGF.beta.1 with 2'-N 2, 2'-F or 2.degree. F.-UTP,
2'-NH.sub.2-CTP-substituted pyrimidines. Variants of Group D were
only reselected in two other SELEX experiments, lib8, a 2'-OH
library, and lib 9, a 2'-NH.sub.2-UTP, 2'-F CTP library, supporting
the observation that there is specificity for the 2' pyrimidine
position in this ligand.
[0136] The group labeled orphans are not homologous to each other
and no variant sequences for these ligands have been determined. G
track indicates that eight 40N clones similar to lib3-45 were
isolated from two libraries. Two of the eight were sequenced and
are identical. Lib3-45 (SEQ ID NO:39) binds whether it contains
2'-NH.sub.2 or 2'-F substituted pyrimidines or the 2'-F-UTP,
2'-NH.sub.2-CTP combination. Lib1-20-5 (SEQ ID NO:40) isolated as a
2'-OH ligand binds as a 2'-F, whereas lib1-20-12 (SEQ ID NO:41) and
lib2-6-8 (SEQ ID NO:42) bind well only as 2'-OH pyrimidines and
will not tolerate 2'-NH.sub.2 or 2'-F post SELEX modifications.
[0137] As it was unusual that similar sequences were obtained from
different SELEX experiments containing different modifications,
another set of SELEX experiments was performed in search of RNA and
ssDNA ligands to TGF.beta.1 as described in examples 5 and 6
infra.
Example 3
Inhibition of TGF.beta.1 Receptor Binding
[0138] The Kds and B.sub.max values reported in Table 4 for Group A
ligands are for the 2'-NH.sub.2 substituted version of the ligand
unless otherwise noted. B.sub.max for the Group A ligands was
0.38.+-.0.12 (n=14) which is in agreement with the measured
retention of TGF.beta.1 on the nitrocellulose filters. The Kd's for
Group A ligands were all similar, 2.2.+-.1.1 nM (n=14). Where
measured nitrocellulose and SA agarose bead binding assays gave
equivalent results.
[0139] The IC.sub.50's in Table 4 for Group A ligands were all
tested with the 2'-NH.sub.2 pyrimidine substituted ligands except
where indicated. 2'-NH.sub.2 ligands were used in the tissue
culture bio-assay since they exhibited the greatest stability under
the conditions of the bio-assay. Five out of ten Group A ligands
tested inhibited TGF.beta.1 receptor activity. IC.sub.50 values for
the inhibitors were typically 25 fold above the Kd for TGF.beta.1.
The data are reproducible; the Kd for ligand lib3-13 was
0.83.+-.0.11 nM (n=3) and the IC.sub.50 for lib3-13 (SEQ ID NO:12)
was 25.+-.14 nM (n=4). RNA concentrations in the bioassays are all
estimates based on an assumed extinction coefficient and 100%
purity of the ligand. The RNA concentrations may, therefore, be
overestimated during the bio-assay which in turn would overestimate
the IC.sub.50.
[0140] Another five Group A ligands did not inhibit TGF.beta.
receptor binding activity. One obvious difference between the
non-bioactive ligands, lib2-6-4 (SEQ ID NO:20), lib5-48 (SEQ ID
NO:19), and lib6-23 (SEQ ID NO:21), and the bioactive ligands is
the substitution at nucleotide 72. Lib7-21 (SEQ ID NO:23) and
lib7-43 (SEQ ID NO:24) were tested as 2'-F-UTP, 2'-NH.sub.2-CTP
ligands for bio-activity. These ligands were not bio-active despite
their high affinity to TGF.beta.. In conclusion, binding and
bioactivity are separable functions of the TGF.beta. Group A
ligands.
[0141] Group B ligands have different binding properties than Group
A ligands (Table 4). Both the Kd (0.63.+-.0.5 nM, n=4) and
B.sub.max (0.14.+-.0.04, n=4) are lower for Group B ligands. One
Group B inhibitor, lib4-12 (SEQ ID NO:28), actually appears to
stimulate TGF.beta.1 activity in the tissue culture bio-assay at
low concentrations. The basis of this mixed agonist/antagonist
behavior has not been determined. The best inhibitor in this group,
lib3-42 (SEQ ID NO:30) has an IC.sub.50 of 22 nM and had no agonist
behavior over the concentration ranges tested.
[0142] Group C ligands were tested as 2'-F derivatives and were not
bio-active. Neither was the 2'-F orphan lib1-20-5 (SEQ ID NO:40).
The 2'-NH.sub.2, 40N orphan, lib3-45 is an example of another
ligand with high affinity for TGF.beta.1 and no ability to inhibit
TGF.beta.1 receptor binding.
[0143] Group D ligands were tested in the bio-assay as
2'-NH.sub.2-UTP, 2'-F-CTP derivatives. Both lib2-6-1 (SEQ ID NO:35)
and the truncated version lib2-6-1-81 (SEQ ID NO:36) can inhibit
TGF.beta.1 receptor binding; however, a single mutation from a C to
a G at position 53 decreases bio-activity in clone lib8-23.
Similarly a 2 base pair deletion in clone lib6-30 (SEQ ID NO:34) at
positions corresponding to nucleotides 67 and 68 in lib2-6-1 (SEQ
ID NO:35) increases binding by 10 fold but eliminates
bio-activity.
[0144] Lib2-6-1 (SEQ ID NO:35) was shown to be fully effective only
against TGF.beta.1 and not TGF.beta.2 and TGF.beta.3. Lib2-6-1 (SEQ
ID NO:35) was biologically active in the presence of 10% horse
serum in the cell culture medium in addition to the 0.1% BSA. Thus
the ligand demonstrates specificity towards TGF.beta.1 which is not
interfered with by the presence of the horse serum in this assay.
The biggest indication that the inhibition of TGF.beta.1 receptor
binding is a specific phenomenon is the fact that not all
TGF.beta.1 ligands block receptor binding, but the ones that do, do
so reproducibly. There are no examples of ligands that do not bind
to TGF.beta.1 blocking TGF.beta.1 receptor binding activity.
[0145] In summary, RNA ligands that can block TGF.beta.1 receptor
binding are a subset of ligands. Binding is necessary but not
sufficient for bio-activity. Roughly 50% of the high affinity
ligands tested were inhibitors. Of the inhibitors, 30% were good
inhibitors (IC.sub.50<25 nM).
Example 4
Boundary Analysis
[0146] Truncation experiments were done on a number of TGF.beta.1
ligands to determine the nucleotides essential for binding. Group A
ligands, lib3-13 (SEQ ID NO:12) and lib8-9 (SEQ ID NO:16), were
truncated with consistent results. The fragment lib3-13-79 binds to
TGF.beta.1, thus none of the nucleotides 3' to nucleotide 79 in
lib3-13 are essential for binding. Similarly when all nucleotides
5' to nucleotide 38 are deleted the remaining fragment,
lib3-13-(38-123) can still bind to TGF.beta.1. The 5' boundary is
in agreement with the sequence lib6-23 (SEQ ID NO:21), which has a
deletion corresponding to nucleotides 19-36 of lib3-13 (SEQ ID
NO:25), and still binds to TGF.beta.1. Thus, all high affinity
binding determinants for Group A clones may lie wholly within the
random region and may correspond to a 42 nucleotide fragment,
lib3-13-(38-79). Many Group A ligands contain deletions or
substitutions within the predicted essential binding domain, in the
region corresponding to lib3-13-(72-81). The deletion and
substitution in lib4-32 have no effect on its 3' boundary which
corresponds to lib3-13 nucleotide 80. Thus, the 3' boundary is
probably correct and the alterations in nucleotide sequence 72-81
are ones that do not significantly alter the nucleic acid structure
required for binding. Mutations in this region, most notably
nucleotide 72 may, however, modify the ability of the ligand to
block TGF.beta.1 receptor binding as noted earlier.
[0147] Boundary analysis of the 3' end of Group B ligand, lib4-12
(SEQ ID NO:28), predicts that nothing beyond nucleotide 72 is
required for TGF.beta.1 binding. When the 5' boundary of lib4-12
was determined, all but the first three nucleotides were required
for binding, indicating that the 5' constant region is an essential
part of the ligand at least when the boundary of the full length
ligand was determined. Assuming that ligand lib3-44 (SEQ ID NO:29)
has a similar binding determinant as lib4-12 (SEQ ID NO:28), we can
also conclude that nucleotides 37-46 of lib4-12 are not required
for binding since these are deleted in lib3-44 and lib3-42 (SEQ ID
NO:30).
[0148] The 3' constant region is not necessary for binding in Group
C and D ligands. Both ligand types bind without the 3' nucleotides
in the constant region. Lib1-20-3-82, an 82 nucleotide truncated
version of lib1-20-3 (SEQ ID NO:32), binds as well as the full
length lib1-20-3. Likewise binding and bioactivity of lib2-6-1 is
unaffected by the 3' truncation found in lib2-6-1-81 (SEQ ID
NO:36).
Example 5
Experimental Procedures
[0149] In the preferred embodiment, a second set of SELEX
experiments was performed in search of RNA and DNA ligands with
specific high affinity for TGF.beta.1 from degenerate libraries
containing 40 random positions (40N). This Example provides the
general procedures followed and incorporated in Example 6.
[0150] A. Materials.
[0151] M-MLV superscript reverse transcriptase was purchased from
Gibco BRL (Gaithersburg, Md.). T7 RNA polymerase was purified
according to standard procedures at NeXstar Pharmaceuticals, Inc.
(Boulder, Colo.). Taq DNA polymerase (Amplitaq) was from Perkin
Elmer/Cetus (Richmond, Calif.). T4 polynucleotide kinase, DNA
polymerase (Klenow fragment), and alkaline phosphatase were
purchased from New England Biolabs, Inc. (Beverly, Mass.). The
2'-amino substituted nucleotide triphosphates amino-UTP and
amino-CTP were synthesized according to standard procedures at
NeXstar Pharmaceuticals, Inc. (Boulder, Colo.). Other reagents used
in this work were of the highest quality obtainable.
[0152] B. Nucleic Acids.
[0153] RNAs were synthesized by in vitro transcription using
double-stranded DNA oligonucleotides and T7 RNA polymerase. DNA
oligonucleotides (Table 5) were purchased from Operon, Inc.
(Alameda, CA) and purified by 6% preparative polyacrylamide gel
electrophoresis. PCR amplification was performed in 50 mM KCl, 10
mM Tris-HCl (pH 8.6), 2.5 mM MgCl.sub.2, 170 mg/mL BSA, and dNTPs
(present at 1 mM each). Taq DNA polymerase was used at 100 units
per 0.1 mL reaction, and the 5'- and 3'-primers were present at 1
mM. Transcription was performed in 40 mM NaCl, 10 mM
dithiothreitol, 50 mM Tris-acetate (pH 8.0), 8 mM magnesium
acetate, 2 mM spermidine, and 2 mM NTP. T7 RNA polymerase was
present at 1 unit/mL. The reaction was incubated at 28 degrees for
16 hours and then treated with 20 units of DNAse I for an
additional 10 min at 37 degrees. The reaction was stopped by the
addition of one half volume of loading buffer (93% formamide, 10 mM
EDTA, pH 8.0) and heated to 95 degrees for 3 min prior to
electrophoresis on a 6% polyacrylamide/8 M urea denaturing gel. The
RNA transcript was visualized by UV shadowing and was excised from
the gel and eluted into TE buffer (10 mM Tris-acetate pH 8.0, 2 mM
EDTA). The RNA transcript was ethanol precipitated, dried under
vacuum, and redissolved in distilled H.sub.2O. The concentration of
RNA as well as single-stranded DNA was quantified by measuring the
A.sub.260 and assuming that 1 A.sub.260 unit equaled 40 mg/mL and
33 mg/mL, respectively.
[0154] C. Evolution of High-Affinity Ligands.
[0155] SELEX ligands that bind to TGF.beta.1 were derived
essentially as described in U.S. Pat. No. 5,270,163 (see also Tuerk
and Gold (1990) Science 249:505-510) using the oligonucleotides
illustrated in Table 5 (SEQ ID NOS:43-54). The DNA templates
contained a 40-nucleotide (40N) variable sequence generated by
mixed-nucleotide DNA synthesis, as well as 5'- and 3'-fixed
sequences, necessary for PCR amplification of the template. The
5'-fixed sequence of oligonucleotides 40N7 (SEQ ID NO:43) and 40N8
(SEQ ID NO:49) also contained a T7 RNA polymerase promoter. RNA for
the first round of RNA SELEX was transcribed from double-stranded
DNA templates generated by primer extension on single-stranded DNA
templates 40N7 and 40N8 with the Klenow fragment of DNA polymerase
I. RNA SELEX consisted of up to 15 rounds of RNA synthesis, binding
to target, partitioning of bound and unbound RNA by nitrocellulose
filtration, cDNA synthesis, and PCR amplification to regenerate the
double-stranded DNA template. Binding to the target by the RNA pool
was performed in binding buffer A (120 mM NaCl, 2.5 mM KCl, 0.12 mM
MgSO.sub.4, 40 mM HEPES, 20 mM NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4
pH 7.4, 0.01% HSA) at 37 degrees for at least 10 min prior to
filtration. In contrast, the first round of single-stranded DNA
SELEX was performed by using the synthetically synthesized
oligonucleotides 40D7 and 40D8 directly. SELEX consisted of 25
rounds of binding to target, partitioning of bound and unbound
single-stranded DNA by nitrocellulose filtration, PCR amplification
to generate a double-stranded DNA population, and preparative
polyacrylamide gel electrophoresis to purify single-stranded DNA
for the next round of SELEX. Binding of the target to the
single-stranded DNA pool was performed in binding buffer B (150 mM
NaCl, 10 mM Tris-acetate pH 7.5, 0.001% BSA) at 37 degrees for at
least 15 min prior to filtration. Radiolabeling of RNA as well as
DNA repertoires was performed by incubation of 5 picomoles nucleic
acid, 2 units of T4 polynucleotide kinase, and 6 mL
[.gamma..sup.32P] ATP (800 Ci/mmol) in a volume of 10 mL at 37
degrees for 30 min. The concentration of nucleic acid at each round
of the SELEX experiment varied between 1500 nM and 1 nM while the
concentration of the target TGF-.beta.1 varied between 150 nM and
0.03 nM.
[0156] D. Cloning and Sequencing of Ligands.
[0157] Cloning of the nucleic acid repertoire was performed as
described by Tuerk and Gold (1990) Science 249:505-510 using
double-stranded DNA that was generated from the RNA repertoire by
PCR amplification. PCR-amplified DNA was digested with the
restriction enzymes SphI and HindIII and ligated into compatible
sites within pGEM. Ligated plasmids were transformed into E. coli
and plated onto LB agar containing 5-bromo-4-chloro-3-indolyl
.beta.-D-galactoside, isopropyl thiogalactoside, and 100 mg/mL
ampicillin. Colonies not expressing .beta.-galactosidase were
analyzed. Sequencing of DNA was performed as described by Tuerk and
Gold (1990) using the dideoxynucleotide procedure of Sanger et al.
(1977) Proc. Natl. Acad. Sci. USA 74:5463-5467. Plasmids were
isolated from E. coli by the alkaline lysis miniprep procedure
(Manitatis et al. (1982) in Molecular Cloning: A laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). DNA
was incubated in 50 mM Tris-HCl (pH 8.3), 60 mM NaCl, 6 mM
magnesium acetate, and 1 mM DTT with 0.4 mM dNTP and 0.2 mM
dideoxy-NTP for 20 min at 48 degrees. DNA polymerase was present at
4 units per reaction. The reactions were stopped by the addition of
10 mL of loading buffer and heated to 95 degrees for 3 min prior to
gel electrophoresis on a 6% polyacrylamine/8 M urea denaturing gel.
G-track sequencing was performed as described and provided a
convenient method to quickly screen the cloned library for ligands
of different sequence. Briefly, the G-track sequencing reaction
contained 50 mM Tris-HCl (pH 8.3), 60 mM NaCl, 6 mM magnesium
acetate, and 1 mM DTT with 0.4 mM dNTP, 0.2 mM dideoxy-GTP, and 4
units of DNA polymerase. The reaction was performed at 48 degrees
for 20 min and was stopped by the addition of 10 uL of loading
buffer and heated to 95 degrees for 3 min prior to gel
electrophoresis on a 6% polyacrylamide/8 M urea denaturing gel.
Example 6
Binding Analysis, Bioassay Results, and Sequences of a ssDNA
Library.
[0158] Binding analysis of the 40D7 DNA library for TGF-B 1 is
shown in FIG. 1. Binding data obtained from round 19 (triangles)
and round 0 (circles) are shown. The experiment was performed by
incubating nucleic acid (less than 1 nM) and the indicated
concentration of TGF-b1 in Binding Buffer (150 mM NaCl, 10 mM
Tris-acetate pH 8.2, 0.001% BSA) for 15 minutes at 37 degrees in a
volume of 0.1 mL. Samples were filtered through nitrocellulose and
were immediately followed by 3 mL of TE Buffer (10 mM Tris-acetate
pH 8.0, 0.1 mM EDTA). The percentage of radiolabel bound was
calculated from the amount of radiolabel retained on the
nitrocellulose filter and the total radiolabel added to the binding
reaction. The results show that the apparent Kd of the 40D7 library
is 1 nM, whereas the starting pool has an apparent Kd of 30 nM.
Thus, the 40D7 library shows an increase of about three fold in
binding.
[0159] A PAI-luciferase assay to detect TGF-.beta.1 activity in the
presence of the nucleic acid libraries generated in Example 5 was
performed as described in Abe et al. (1994) Analytical Biochem.
216:276-284. Mink lung epithelial cells containing the
PAI-luciferase reporter gene were incubated with TGF-.beta.1 (10
pM) and oligonucleotides from the DNA libraries or anti-TGF-.beta.
antibody (60 .mu.g/mL). The mink lung epithelial cells were
incubated for 18 hours and oligonucleotides were pre-incubated with
TGF-.beta.1 before the assay and readded after 8 hours. Addition of
oligonucleotides alone (100 nM) to the cell culture did not affect
the assay (data not shown). The identity of the oligonucleotide
libraries as well as their effect on luciferase activity is
indicated in FIG. 2. The ssDNA library 40N7 completely inhibited
the activity of TGF-.beta.1, while the control (an equal
concentration of randomized nucleic acid) showed a small
stimulation of TGF-.beta.1 activity.
[0160] Based on the results of the binding analysis and
PAI-luciferase assay, DNA ligands from the 40N7 library were
sequenced as described in Example 5. The sequences are shown in
Table 6 (SEQ ID NOS:55-89). As the DNA 40N7 library showed
inhibition in the PAI-luciferase bioassay, it is reasonable to
suggest that the individual clones from the library are TGF.beta.1
binders.
Example 7
Experimental Procedures
[0161] This Example provides the general procedures followed and
incorporated in Examples 8-15 for the evolution of nucleic acid
ligands to PDGF.
[0162] A. Materials.
[0163] Recombinant human PDGF-AA (Mr=29,000), PDGF-AB (Mr=27,000)
and PDGF-BB (Mr=25,000) were purchased from R&D Systems
(Minneapolis, Minn.) in lyophilized form, free from carrier
protein. All three isoforms were produced in E. coli from synthetic
genes based on the sequences for the long form of the mature human
PDGF A-chain (Betsholtz et al.,(1986) Nature 320: 695-699) and the
naturally occurring mature form of human PDGF B-chain (Johnsson et
al., (1984) EMBO J. 3: 921-928). Randomized DNA libraries, PCR
primers and DNA ligands and 5'-iodo-2'-deoxyuridine-substi- tuted
DNA ligands were synthesized by NeXstar Pharmaceuticals, Inc.
(Boulder, Colo.) or by Operon Technologies (Alameda, Calif.) using
the standard solid phase phosphoramidite method (Sinha et al.,
(1984) Nucleic Acids Res. 12:4539-4557).
[0164] B. Single Stranded DNA (ssDNA) Selex
[0165] Essential features of the SELEX procedure have been
described in detail in the SELEX Patent Applications (see also,
Tuerk and Gold, Science 249:505 (1990); Jellinek et al.,
Biochemistry 33:10450 (1994); Jellinek et al., Proc. Natl. Acad.
Sci. 90:11227 (1993)), which are incorporated by reference herein.
The initial ssDNA library containing a contiguous randomized region
of forty nucleotides, flanked by primer annealing regions (Table 7;
SEQ ID NO:90) of invariant sequence, was synthesized by the solid
phase phosphoramidite method using equal molar mixture of the four
phosphoramidites to generate the randomized positions. The ssDNA
library was purified by electrophoresis on an 8% polyacrylamide/7 M
urea gel. The band that corresponds to the full-length DNA was
visualized under UV light, excised from the gel, eluted by the
crush and soak method, ethanol precipitated and pelleted by
centrifugation. The pellet was dried under vacuum and resuspended
in phosphate buffered saline supplemented with 1 mM MgCl.sub.2
(PBSM=10.1 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4, 137 mM
NaCl and 2.7 mM KCl, 1 mM MgCl.sub.2, pH 7.4) buffer. Prior to
incubation with the protein, the ssDNA was heated at 90.degree. C.
for 2 minutes in PBSM and cooled on ice. The first selection was
initiated by incubating approximately 500 pmol (3.times.10.sup.14
molecules) of 5' .sup.32P end-labeled random ssDNA with PDGF-AB in
binding buffer (PBSM containing 0.01% human serum albumin (HSA)).
The mixture was incubated at 4.degree. C. overnight, followed by a
brief (15 min) incubation at 37.degree. C. The DNA bound to PDGF-AB
was separated from unbound DNA by electrophoresis on an 8%
polyacrylamide gel (1:30 bis-acrylamide:acrylamide) at 4.degree. C.
and at 5 V/cm with 89 mM Tris-borate (pH 8.3) containing 2 mM EDTA
as the running buffer. The band that corresponds to the PDGF-ssDNA
complex, which runs with about half the electrophoretic mobility of
the free ssDNA, was visualized by autoradiography, excised from the
gel and eluted by the crush and soak method. In subsequent affinity
selections, the ssDNA was incubated with PDGF-AB for 15 minutes at
37.degree. C. in binding buffer and the PDGF-bound ssDNA was
separated from the unbound DNA by nitrocellulose filtration, as
previously described (Green, et al., (1995) Chemistry and Biology
2, 683-695). All affinity-selected ssDNA pools were amplified by
PCR in which the DNA was subjected to 12-20 rounds of thermal
cycling (30 s at 93.degree. C., 10 s at 52.degree. C., 60 s at
72.degree. C.) in 10 mM Tris-Cl (pH 8.4) containing 50 mM KCl, 7.5
mM MgCl.sub.2, 0.05 mg/ml bovine serum albumin, 1 mM
deoxynucleoside triphosphates, 5 .mu.M primers (Table 7) and 0.1
units/.mu.l Taq polymerase. The 5' PCR primer was 5' end-labeled
with polynucleotide kinase and [.gamma.-.sup.32P]ATP and the 3' PCR
primer was biotinylated at the 5' end using biotin phosphoramidite
(Glen Research, Sterling, Va.). Following PCR amplification,
streptavidin (Pierce, Rockford, Ill.) was added to the unpurified
PCR reaction mixture at a 10-fold molar excess over the
biotinylated primer and incubated for 15 min at room temperature.
The dsDNA was denatured by adding an equal volume of stop solution
(90% formamide, 1% sodium dodecyl sulfate, 0.025% bromophenol blue
and xylene cyanol) and incubating for 20 min at room temperature.
The radiolabeled strand was separated from the streptavidin-bound
biotinylated strand by electrophoresis on 12% polyacrylamide/7M
urea gels. The faster migrating radiolabeled (non-biotinylated)
ssDNA strand was cut out of the gel and recovered as described
above. The amount of ssDNA was estimated from the absorbance at 260
nm using the extinction coefficient of 33 .mu.g/ml/absorbance unit
(Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2
Ed. 3 vols., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor).
[0166] C. Cloning and Sequencing.
[0167] The amplified affinity-enriched pool from SELEX round 12 was
purified on a 12% polyacrylamide gel and cloned between HindIII and
PstI sites in JM109 strain of E. coli (Sambrook, et al., (1989)
Molecular Cloning: A Laboratory Manual, 2 Ed. 3 vols., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor). Individual clones
were used to prepare plasmids by alkaline lysis. Plasmids were
sequenced at the insert region using the forward sequencing primer
and Sequenase 2.0 (Amersham, Arlington Heights, Ill.) according to
the manufacturer's protocol.
[0168] D. Determination of the Apparent Equilibrium Dissociation
Constants and the Dissociation Rate Constants.
[0169] The binding of ssDNA ligands at low concentrations to
varying concentrations of PDGF was determined by the nitrocellulose
filter binding method as described (Green et al., (1995) Chemistry
and Biology 2:683-695). The concentrations of PDGF stock solutions
(in PBS) were determined from the absorbance readings at 280 nm
using the following e.sub.280 values calculated from the amino acid
sequences (Gill, S.C. and von Hippel, P. H. (1989) Anal. Biochem.
182:319-326): 19,500 M.sup.-1cm.sup.-1 for PDGF-AA, 15,700
M.sup.-1cm.sup.-1 for PDGF-AB and 11,800 M.sup.-1cm.sup.-1 for
PDGF-BB. ssDNA for all binding experiments were purified by
electrophoresis on 8% (>80 nucleotides) or 12% (<40
nucleotides) polyacrylamide/7 M urea gels. All ssDNA ligands were
heated at 90.degree. C. in binding buffer at high dilution (1
.mu.M) for 2 min and cooled on ice prior to further dilution into
the protein solution. The binding mixtures were typically incubated
for 15 min at 37.degree. C. before partitioning on nitrocellulose
filters.
[0170] The binding of DNA ligands (L) to PDGF-AA (P) is adequately
described with the bimolecular binding model for which the fraction
of bound DNA at equilibrium (q) is given by eq. 1,
q=(f/2[L].sub.t){[P].sub.t+[L].sub.t+K.sub.d-[([P].sub.t+[L].sub.t+K.sub.d-
).sup.2-4[P].sub.t[L].sub.t].sup.1/2} (1)
[0171] where [P].sub.t and [R].sub.t are total protein and total
DNA concentrations, K.sub.d is the equilibrium dissociation
constant and f is the efficiency of retention of protein-DNA
complexes on nitrocellulose filters (Irvine et al., (1991) J. Mol.
Biol. 222:739-761; Jellinek et al., (1993) Proc. Nat'l. Acad. Sci.
USA 90:11227-11231).
[0172] The binding of DNA ligands to PDGF-AB and PDGF-BB is
biphasic and can be described by a model in which the DNA ligand is
composed of two non-interconverting components (L.sub.1 and
L.sub.2) that bind to the protein with different affinities,
described by corresponding dissociation constants, K.sub.d1 and
K.sub.d2 (Jellinek et al., (1993) Proc. Nat'l. Acad. Sci. USA
90:11227-11231). In this case, the explicit solution for the
fraction of bound DNA (q) is given by eq. 2, 1 q = f ( 1 K d1 1 + K
d1 [ P ] + 2 K d2 1 + K d2 [ P ] ) [ P ] with [ P ] = [ P ] t 1 + 1
K d1 [ L ] t 1 + K d1 [ P ] + 2 K d2 [ L ] t 1 + K d2 [ P ] ( 2
)
[0173] where .chi..sub.1 and .chi..sub.2(=1-.chi..sub.1) are the
mole fractions of L.sub.1 and L.sub.2. The K.sub.d values for the
binding of DNA ligands to PDGF were calculated by fitting the data
points to eq. 1 (for PDGF-AA) or eq. 2 (for PDGF-AB and PDGF-BB)
using the non-linear least squares method.
[0174] The dissociation rate constants (k.sub.off) were determined
by measuring the amount of .sup.32P 5'-end labeled minimal ligands
(0.17 nM) bound to PDGF-AB (1 nM) as a function of time following
the addition of 500-fold excess of unlabeled ligands, using
nitrocellulose filter binding as the partitioning method. The
k.sub.off values were determined by fitting the data points to the
first-order rate equation (eq. 3)
(q-q.sub..infin.)/(q.sub.o-q.sub..infin.)=exp(-k.sub.offt) (3)
[0175] where q, q.sub.o and q.sub..infin. represent the fractions
of DNA bound to PDGF-AB at any time (t), t=0 and t=.infin.,
respectively.
[0176] E. Minimal Ligand Determinations.
[0177] To generate a population of 5' end-labeled DNA ligands
serially truncated from the 3' end, a primer complementary to the
3' invariant sequence region of a DNA ligand template (truncated
primer 5N2, Table 7; SEQ ID NO:92) was radiolabeled at the 5' end
with [.gamma.-.sup.32P]-ATP and T4 polynucleotide kinase, annealed
to the template and extended with Sequenase (Amersham, Arlington
Heights, Ill.) and a mixture of all four dNTPs and ddNTPs.
Following incubation in binding buffer for 15 min at 37.degree. C.,
the fragments from this population that retain high affinity
binding to PDGF-AB were separated from those with weaker affinity
by nitrocellulose filter partitioning. Electrophoretic resolution
of the fragments on 8% polyacrylamide/7 M urea gels, before and
after affinity selection, allows determination of the 3' boundary.
To generate a population of 3' end-labeled DNA ligands serially
truncated from the 5' end, the DNA ligands were radiolabeled at the
3' end with [.alpha.-.sup.32P]-cordycepin-5'-triphosphate (New
England Nuclear, Boston, Mass.) and T4 RNA ligase (Promega,
Madison, Wis.), phosphorylated at the 5' end with ATP and T4
polynucleotide kinase, and partially digested with lambda
exonuclease (Gibco BRL, Gaithersburg, Md.). Partial digestion of 10
pmols of 3'-labeled ligand was done in 100 .mu.L volume with 7 mM
glycine-KOH (pH 9.4), 2.5 mM MgCl.sub.2, 1 .mu.g/ml BSA, 15 .mu.g
tRNA, and 4 units of lambda exonuclease for 15 min at 37.degree..
The 5' boundary was determined in an analogous manner to that
described for the 3' boundary.
[0178] F. Melting Temperature (T.sub.m) Measurements.
[0179] Melting profiles for the minimal DNA ligands were obtained
on a Cary Model 1E spectrophotometer. Oligonucleotides (320-400 nM)
were heated to 95.degree. C. in PBS, PBSM or PBS with 1 mM EDTA and
cooled to room temperature prior to the melting profile
determination. Melting profiles were generated by heating the
samples at the rate of 1.degree. C./min from 15-95.degree. C. and
recording the absorbance every 0.1.degree. C. The first derivative
of the data points was calculated using the plotting program
KaleidaGraph (Synergy Software, Reading, Pa.). The first derivative
values were smoothed using a 55 point smoothing function by
averaging each point with 27 data points on each side. The peak of
the smoothed first derivative curves was used to estimate the
T.sub.m values.
[0180] G. Crosslinking of 5-iodo-2'-deoxyuridine-substituted DNA
Ligands to PDGF-AB.
[0181] DNA ligands containing single or multiple substitutions of
5'-iodo-2'deoxyuridine for thymidine were synthesized using the
solid phase phosphoramidite method. To test for the ability to
crosslink, trace amounts of 5'.sup.32P end-labeled ligands were
incubated with PDGF-AB (100 nM) in binding buffer at 37.degree. C.
for 15 min prior to irradiation. The binding mixture was
transferred to a 1 cm path length cuvette thermostated at
37.degree. C. and irradiated at 308 nm for 25-400 s at 20 Hz using
a XeCl charged Lumonics Model EX748 excimer laser. The cuvette was
positioned 24 cm beyond the focal point of a convergent lens, with
the energy at the focal point measuring 175 mjoules/pulse.
Following irradiation, aliquots were mixed with an equal volume of
formamide loading buffer containing 0.1% SDS and incubated at
95.degree. for 5 min prior to resolution of the crosslinked
PDGF/ligand complex from the free ligand on 8% polyacrylamide/7 M
urea gels.
[0182] To identify the protein site of crosslinking for ligand
20t-I4, binding and irradiation were done on a larger scale.
PDGF-AB and 5' .sup.32P end-labeled ligand, each at 1 .mu.M in
PBSM, were incubated and irradiated (300 s) as described above in
two 1 ml reaction vessels. The reaction mixtures were combined,
ethanol precipitated and resuspended in 0.3 ml of Tris-HCl buffer
(100 mM, pH 8.5). The PDGF-AB/ligand crosslinked complex was
digested with 0.17 .mu.g/.mu.l of modified trypsin (Boehringer
Mannheim) for 20 hours at 37.degree. C. The digest mixture was
extracted with phenol/chloroform, chloroform and then ethanol
precipitated. The pellet was resuspended in water and an equal
volume of formamide loading buffer with 5% (v/v)
.beta.-mercaptoethanol (no SDS), incubated at 95.degree. C. for 5
min, and resolved on a 40 cm 8% polyacrylamide/7 M urea gel. The
crosslinked tryptic-peptide/ligand that migrated as two closely
spaced bands about 1.5 cm above the free ligand band was excised
from the gel and eluted by the crush and soak method and ethanol
precipitated. The dried crosslinked peptide (about 160 pmoles based
on the specific activity) was sequenced by Edman degradation
(Midwest Analytical, Inc., St. Louis, Mo.).
[0183] H. Receptor Binding Assay.
[0184] The binding of .sup.125I-PDGF-AA and .sup.125I-PDGF-BB to
porcine aortic endothelial (PAE) cells transfected with PDGF
.alpha.- or .beta.-receptors were performed as described (Heldin et
al., (1988) EMBO J. 7:1387-1394). Different concentrations of DNA
ligands were added to the cell culture (1.5 cm.sup.2) in 0.2 ml of
phosphate buffered saline supplemented with 1 mg bovine serum
albumin per ml together with .sup.125I-PDGF-AA (2 ng, 100,000 cpm)
or .sup.125I-PDGF-BB (2 ng, 100,000 cpm). After incubation at
4.degree. C. for 90 min, the cell cultures were washed and cell
associated radioactivity determined in a .gamma.-counter (Heldin et
al., (1988) EMBO J. 7:1387-1394).
[0185] I. [.sup.3H] Thymidine Incorporation Assay.
[0186] The incorporation of [.sup.3H]thymidine into PAE cells
expressing PDGF .beta.-receptor in response to 20 ng/ml of PDGF-BB
or 10% fetal calf serum and in the presence of different
concentrations of DNA ligands was performed as described (Mori et
al., (1991) J. Biol. Chem. 266:21158-21164). After incubation for
24 h at 37.degree. C., .sup.3H-radioactivity incorporated into DNA
was determined using a 13-counter.
Example 8
ssDNA Ligands of PDGF
[0187] High affinity DNA ligands to PDGF AB were identified by the
SELEX process from a library of .apprxeq.3.times.10.sup.14
molecules (500 pmol) of single stranded DNA randomized at forty
contiguous positions (Table 7; SEQ ID NO:90). The PDGF-bound DNA
was separated from unbound DNA by polyacrylamide gel
electrophoresis in the first round and by nitrocellulose filter
binding in the subsequent rounds. After 12 rounds of SELEX, the
affinity-enriched pool bound to PDGF-AB with an apparent
dissociation constant (K.sub.d) of .apprxeq.50 pM (data not shown).
This represented an improvement in affinity of .apprxeq.700-fold
compared to the initial randomized DNA library. This
affinity-enriched pool was used to generate a cloning library from
which 39 isolates were sequenced. Thirty-two of these ligands were
found to have unique sequences (Table 8; SEQ ID NOS:93-124).
Ligands that were subjected to the minimal sequence determination
are marked with an asterisk (*) next to the clone number. The clone
numbers that were found to retain high affinity binding as minimal
ligands are italicized. All ligands shown in Table 8 were screened
for their ability to bind to PDGF AB using the nitrocellulose
filter binding method. To identify the best ligands from this
group, we determined their relative affinities for PDGF-AB by
measuring the fraction of 5' .sup.32P end-labeled ligands bound to
PDGF-AB over a range of protein concentrations. For the ligands
that bound to PDGF-AB with high affinity, the affinity toward
PDGF-BB and PDGF-AA was also examined: in all cases, the affinity
of ligands for PDGF-AB and PDGF-BB was comparable while the
affinity for PDGF-AA was considerably lower (data not shown).
[0188] Twenty-one of the thirty-two unique ligands can be grouped
into a sequence family shown in Table 9. The sequences of the
initially randomized region (uppercase letters) are aligned
according to the consensus three-way helix junction motif.
Nucleotides in the sequence-invariant region (lowercase letters)
are only shown where they participate in the predicted secondary
structure. Several ligands were "disconnected" (equality symbol) in
order to show their relatedness to the consensus motif through
circular permutation. The nucleotides predicted to participate in
base pairing are indicated with underline inverted arrows, with the
arrow heads pointing toward the helix junction. The sequences are
divided into two groups, A and B, based on the first single
stranded nucleotide (from the 5' end) at the helix junction (A or
G, between helices II and III). Mismatches in the helical regions
are shown with dots under the corresponding letters (G-T and T-G
base pairs were allowed). In places where single nucleotide bulges
occur, the mismatched nucleotide is shown above the rest of the
sequence between its neighbors.
[0189] This classification is based in part on sequence homology
among these ligands, but in greater part on the basis of a shared
secondary structure motif: a three-way helix junction with a three
nucleotide loop at the branch point (FIG. 3). These ligands were
subdivided into two groups; for ligands in group A, the loop at the
branch point has an invariant sequence AGC and in group B, that
sequence is G(T/G)(C/T). The proposed consensus secondary structure
motif is supported by base-pairing covariation at non-conserved
nucleotides in the helices (Table 10). Since the three-way
junctions are encoded in continuous DNA strands, two of the helices
end in loops at the distal end from the junction. These loops are
highly variable, both in length and in sequence. Furthermore,
through circular permutation of the consensus motif, the loops
occur in all three helices, although they are most frequent in
helices II and III. Together these observations suggest that the
regions distal from the helix junction are not important for high
affinity binding to PDGF-AB. The highly conserved nucleotides are
indeed found near the helix junction (Table 9, FIG. 3).
Example 9
Boundary Analysis
[0190] The minimal sequence necessary for high affinity binding was
determined for the six best ligands to PDGF-AB. In general, the
information about the 3' and 5' minimal sequence boundaries can be
obtained by partially fragmenting the nucleic acid ligand and then
selecting for the fragments that retain high affinity for the
target. With RNA ligands, the fragments can be conveniently
generated by mild alkaline hydrolysis (Tuerk et al., (1990) J. Mol.
Biol. 213:749-761; Jellinek et al., (1994) Biochemistry
33:10450-10456; Jellinek et al., (1995) Biochemistry
34:11363-11372; Green et al., (1995) J. Mol. Biol. 247:60-68).
Since DNA is more resistant to base, an alternative method of
generating fragments is needed for DNA. To determine the 3'
boundary, a population of ligand fragments serially truncated at
the 3' end was generated by extending the 5' end-labeled primer
annealed to the 3' invariant sequence of a DNA ligand using the
dideoxy sequencing method. This population was affinity-selected by
nitrocellulose filtration and the shortest fragments (truncated
from the 3' end) that retain high affinity binding for PDGF-AB were
identified by polyacrylamide gel electrophoresis. The 5' boundary
was determined in an analogous manner except that a population of
3' end-labeled ligand fragments serially truncated at the 5' end
was generated by limited digestion with lambda exonuclease. The
minimal ligand is then defined as the sequence between the two
boundaries. It is important to keep in mind that, while the
information derived from these experiments is useful, the suggested
boundaries are by no means absolute since the boundaries are
examined one terminus at a time. The untruncated (radiolabeled)
termini can augment, reduce or have no effect on binding (Jellinek
et al., (1994) Biochemistry 33:10450-10456).
[0191] Of the six minimal ligands for which the boundaries were
determined experimentally, two (20t (SEQ ID NO:172) and 41t (SEQ ID
NO:174); truncated versions of ligands 20 and 41) bound with
affinities comparable (within a factor of 2) to their full-length
analogs and four had considerably lower affinities. The two minimal
ligands that retained high affinity binding to PDGF, 20t and 41t,
contain the predicted three-way helix junction secondary structure
motif (FIG. 4). The sequence of the third minimal ligand that binds
to PDGF-AB with high affinity, 36t (SEQ ID NO:173), was deduced
from the knowledge of the consensus motif (FIG. 4). In subsequent
experiments, we found that the single-stranded region at the 5' end
of ligand 20t is not important for high affinity binding.
Furthermore, the trinucleotide loops on helices II and III in
ligand 36t (GCA and CCA) can be replaced with pentaethylene glycol
spacers (infra). These experiments provide further support for the
importance of the helix junction region in high affinity binding to
PDGF-AB.
[0192] The binding of minimal ligands 20t, 36t, and 41t to varying
concentrations of PDGF-AA, PDGF-AB and PDGF-BB is shown in FIGS.
5A, 5B and 5C. In agreement with the binding properties of their
full length analogs, the minimal ligands bind to PDGF-AB and
PDGF-BB with substantially higher affinity than to PDGF AA (FIGS.
5A, 5B and 5C, Table 11). In fact, their affinity for PDGF-AA is
comparable to that of random DNA (data not shown). The binding to
PDGF-AA is adequately described with a monophasic binding equation
while the binding to PDGF-AB and PDGF-BB is notably biphasic. In
previous SELEX experiments, biphasic binding has been found to be a
consequence of the existence of separable nucleic acid species that
bind to their target protein with different affinities (Jellinek et
al., (1995) Biochemistry 34:11363-11372, and unpublished results).
The identity of the high and the low affinity fractions is at
present not known. Since these DNA ligands described here were
synthesized chemically, it is possible that the fraction that binds
to PDGF-AB and PDGF-BB with lower affinity represents chemically
imperfect DNA. Alternatively, the high and the low affinity species
may represent stable conformational isomers that bind to the PDGF
B-chain with different affinities. In any event, the higher
affinity binding component is the most populated ligand species in
all cases (FIG. 5). For comparison, a 39-mer DNA ligand that binds
to human thrombin with a K.sub.d of 0.5 nM (ligand T39 (SEQ ID
NO.:177): 5'-CAGTCCGTGGTAGGGCAGGTTG- GGGTGACTTCGTGGAA[3'T], where
[3'T] represents a 3'-3' linked thymidine nucleotide added to
reduce 3'-exonuclease degradation) and has a predicted stem-loop
structure, binds to PDGF-AB with a K.sub.d of 0.23 .mu.M (data not
shown).
Example 10
Kinetic Stability of PDGF-Nucleic Acid Ligand Complexes
[0193] In order to evaluate the kinetic stability of the
PDGF-AB/DNA complexes, the dissociation rates were determined at
37.degree. C. for the complexes of minimal ligands 20t, 36t and 41t
(SEQ ID NOS:172-174) with PDGF-AB by measuring the amount of
radiolabeled ligands (0.17 nM) bound to PDGF-AB (1 nM) as a
function of time following the addition of a large excess of
unlabeled ligands (FIG. 6). At these protein and DNA ligand
concentrations, only the high affinity fraction of the DNA ligands
binds to PDGF-AB. The following values for the dissociation rate
constants were obtained by fitting the data points shown in FIG. 6
to the first-order rate equation: 4.5.+-.0.2.times.10.sup.-3
s.sup.-1 (t.sub.1/2=2.6 min) for ligand 20t,
3.0.+-.0.2.times.10.sup.-3 s.sup.-1 (t.sub.1/2=3.8 min) for ligand
36t, and 1.7.+-.0.1.times.10.sup.-3 s.sup.-1 (t.sub.1/2=6.7 min)
for ligand 41t. The association rates calculated for the
dissociation constants and dissociation rate constants
(k.sub.on=k.sub.off/K.sub.d) are 3.1.times.10.sup.7
M.sup.-1s.sup.-1 for 20t, 3.1.times.10.sup.7 M.sup.-1s.sup.-1 for
36t and 1.2.times.10.sup.7 M.sup.-1s.sup.-1 for 41t.
Example 11
Thermal Melting Properties
[0194] In order to examine the ability of minimal ligands 20t, 36t
and 41t to assume folded structures, their melting temperatures
(T.sub.m's) were determined from the UV absorbance vs. temperature
profiles in PBSM or PBSE buffers. At the oligonucleotide
concentrations used in these experiments (320-440 nM), only the
monomeric species were observed as single bands on non-denaturing
polyacrylamide gels (data not shown). Ligands 20t and 41t underwent
thermal melting that is well described by a two-state (folded and
unfolded) model with linearly sloping baselines (Petersheim and
Turner (1983) Biochem. 22:256-263) with Tm values in PBSM buffer of
43.8.+-.0.4.degree. C. and 49.2.+-.0.5.degree. C., respectively. In
PBSE buffer, similar T.sub.m values were obtained:
44.8.+-.0.5.degree. C. for ligand 20t and 48.0.+-.0.5.degree. C.
for ligand 41t. Ligand 36t exhibited a more complex thermal melting
profile in which two distinct transitions were observed. In this
case, the data were well described by a three-state model in which
the fully folded and the unfolded states are connected through a
partially unfolded intermediate results. Using this model, we
obtained two T.sub.m values for ligand 36t: 47.0.+-.0.9.degree. C.
and 67.1.+-.3.8.degree. C. in PBSM buffer and 44.2.+-.1.7.degree.
C. and 64.3.+-.4.1.degree. C. in PBSE buffer.
Example 12
Photo-Crosslinking of Nucleic Acid Ligands and PDGF
[0195] In order to determine the sites on the DNA ligands and PDGF
that are in close contact, a series of photo-crosslinking
experiments were performed with 5'-iodo-2'-deoxyuridine
(IdU)-substituted DNA ligands 20t, 36t and 41t (SEQ ID
NOS:172-174). Upon monochromatic excitation at 308 nm, 5-iodo- and
5-bromo-substituted pyrimidine nucleotides populate a reactive
triplet state following intersystem crossing from the initial n to
.pi.* transition. The excited triplet state species then reacts
with electron rich amino acid residues (such as Trp, Tyr and H is)
that are in its close proximity to yield a covalent crosslink. This
method has been used extensively in studies of nucleic acid-protein
interactions since it allows irradiation with >300 nm light
which minimizes photodamage (Willis et al., (1994) Nucleic Acids
Res. 22:4947-4952; Stump, W. T., and Hall, K. B. (1995) RNA
1:55-63; Willis et al, (1993) Science 262:1255-1257; Jensen et al.,
(1995) Proc. Natl. Acad. Sci., U.S.A. 92:12220-12224). Analogs of
ligands 20t, 36t and 41t were synthesized in which all thymidine
residues were replaced with IdU residues using the solid phase
phosphoramidite method. The affinity of these IdU-substituted
ligands for PDGF-AB was somewhat enhanced compared to the
unsubstituted ligands and based on the appearance of bands with
slower electrophoretic mobility on 8% polyacrilamide/7 M urea gels,
all three 5' end-labeled IdU-substituted ligands crosslinked to
PDGF-AB upon irradiation at 308 nm (data not shown). The highest
crosslinking efficiency was observed with IdU-substituted ligand
20t. To identify the specific IdU position(s) responsible for the
observed crosslinking, seven singly or multiply IdU-substituted
analogs of 20t were tested for their ability to photo-crosslink to
PDGF-AB: ligands 20t-I1 through 20t-I7
(5'-TGGGAGGGCGCGT.sup.1T.sup.1CT.sup.1T.sup.1CGT.sup.2GGT.sup.3T.sup.4ACT-
.sup.5T.sup.6T.sup.6T.sup.6AGT.sup.7CCCG-3' (SEQ ID NOS:178-184)
where the numbers indicate IdU substitutions at indicated thymidine
nucleotides for the seven ligands). Of these seven ligands,
efficient crosslinking to PDGF-AB was observed only with ligand
20t-I4. The photo-reactive IdU position corresponds to the 3'
proximal thymidine in the loop at the helix junction (FIG. 4).
[0196] To identify the crosslinked amino acid residue(s) on
PDGF-AB, a mixture of 5' end-labeled 20t-I4 and PDGF-AB was
incubated for 15 min at 37.degree. C. followed by irradiation at
308 nm. The reaction mixture was then digested with modified
trypsin and the crosslinked fragments resolved on an 8%
polyacrylamide/7 M urea gel. Edman degradation of the peptide
fragment recovered from the band that migrated closest to the free
DNA band revealed the amino acid sequence KKPIXKK (SEQ ID NO:185),
where X indicates a modified amino acid that could not be
identified with the 20 derivatized amino acid standards. This
peptide sequence, where X is phenylalanine, corresponds to amino
acids 80-86 in the PDGF-B chain (Johnsson et al., (1984) EMBO J.
3:921-928) which in the crystal structure of PDGF-BB comprises a
part of solvent-exposed loop III (Oefner et al., (1992) EMBO J.
11:3921-3926). In the PDGF A-chain, this peptide sequence does not
occur (Betsholtz et al., (1986) Nature 320:695-699). Together,
these data establish a point contact between a specific thymidine
residue in ligand 20t and phenylalanine 84 of the PDGF B-chain.
Example 13
Inhibition of PDGF by Nucleic Acid Ligands
[0197] In order to determine whether the DNA ligands to PDGF were
able to inhibit the effects of PDGF isoforms on cultured cells, the
effects on binding of .sup.125I-labeled PDGF isoforms to PDGF
.alpha.- and .beta.-receptors stably expressed in porcine aortic
endothelial (PAE) cells by transfection was determined. Ligands
20t, 36t and 41t (SEQ ID NOS:172-174) all efficiently inhibited the
binding of .sup.125I-PDGF-BB to PDGF .alpha.-receptors (FIG. 7) or
PDGF .beta.-receptors (data not shown), with half maximal effects
around 1 nM of DNA ligand. DNA ligand T39, directed against
thrombin and included as a control, showed no effect. None of the
ligands was able to inhibit the binding of .sup.125I-PDGF-AA to the
PDGF .alpha.-receptor (FIG. 7), consistent with the observed
specificity of ligands 20t, 36t and 41t for PDGF-BB and
PDGF-AB.
[0198] The ability of the DNA ligands to inhibit the mitogenic
effects of PDGF-BB on PAE cells expressing PDGF 1-receptors was
investigated. As shown in FIG. 8, the stimulatory effect of PDGF-BB
on [.sup.3H]thymidine incorporation was neutralized by ligands 20t,
36t and 41t. Ligand 36t exhibited half maximal inhibition at the
concentration of 2.5 nM; ligands 41t was slightly more efficient
and 20t slightly less efficient. The control ligand T39 had no
effect. Moreover, none of the ligands inhibited the stimulatory
effects of fetal calf serum on [.sup.3H]thymidine incorporation in
these cells, showing that the inhibitory effects are specific for
PDGF.
Example 14
Post-Selex Process Nucleotide Substitutions
[0199] The stability of nucleic acids to nucleases is an important
consideration in efforts to develop nucleic acid-based
therapeutics. Experiments have shown that many, and in some cases
most of the nucleotides in SELEX-derived ligands can be substituted
with modified nucleotides that resist nuclease digestion, without
compromising high affinity binding (Green et al., (1995) Chemistry
and Biology 2:683-695; Green et al., (1995) J. Mol. Biol.
247:60-68). Experiments of this type with the DNA ligands reported
here suggest that substitutions with modified nucleotides are
tolerated at many positions (FIG. 9; SEQ ID NOS:175-176).
Specifically, we have examined the substitution of
2'-O-methyl-2'-deoxy- and 2'-fluoro-2'-deoxyribonucleotides for
2'-deoxyribonucleotides in ligand 36t, by examining the PDGF-AB
binding properties of singly or multiply substituted ligand 36t.
The substitution pattern indicated in FIG. 9 is compatible with
high affinity binding to PDGF-AB. Furthermore, this ligand
tolerates the substitution of pentaethylene glycol spacers (Glen
Research, Sterling, Va.) for the trinucleotide loops at the ends of
helices II and III (FIG. 9). These DNA ligands therefore represent
lead compounds for a novel class of high affinity, specific
antagonists of PDGF-AB and PDGF-BB.
Example 15
Experimental Procedure for Evolving 2'-FLUORO-2'-DEOXYPYRIMIDINE
RNA Ligands to PDGF and RNA Sequences Obtained
[0200] A. 2'-FLUORO-2'-DEOXYPYRIMIDINE RNA SELEX
[0201] SELEX with 2'-fluoro-2'-deoxypyrimidine RNA targeting PDGF
AB was done essentially as described previously (vide supra, and
Jellinek et al., (1993, 1994) supra) using the primer template set
as shown in Table 12 (SEQ ID NOS:125-127). Briefly, the
2'-fluoro-2'-deoxypyrimidine RNA for affinity selections was
prepared by in vitro transcription from synthetic DNA templates
using T7 RNA polymerase (Milligan et al., Nucl. Acids Res. 15:8783
(1987)). The conditions for in vitro transcription described in
detail previously (Jellinek et al., (1994) supra) were used, except
that higher concentration (3 mM) of the 2'-fluoro-2'-deoxypyrimidi-
ne nucleoside triphosphates (2'-F-UTP and 2'-F-CTP) was used
compared to ATP and GTP (1 mM). Affinity selections were done by
incubating PDGF AB with 2'-fluoro-2'-deoxypyrimidine RNA for at
least 15 min at 37.degree. C. in PBS containing 0.01% human serum
albumin. Partitioning of free RNA from protein-bound RNA was done
by nitrocellulose filtration as described (Jellinek et al., (1993,
1994) supra). Reverse transcription of the affinity-selected RNA
and amplification by PCR were done as described previously
(Jellinek et al., (1994) supra). Nineteen rounds of SELEX were
performed, typically selecting between 1-12% of the input RNA. For
the first eight rounds of selection, suramin (3-15 .mu.M) was
included in the selection buffer to increase the selection
pressure. The affinity-enriched pool (round 19) was cloned and
sequenced as described (Schneider et al., (1992) supra). Forty-six
unique sequences have been identified, and the sequences are shown
in Table 13 (SEQ ID NOS:128-170). The unique-sequence ligands were
screened for their ability to bind PDGF AB with high affinity.
While random 2'-fluoropyrimidine RNA (Table 12) bound to PDGF with
a dissociation constant (Kd) of 35.+-.7 nM, many of the
affinity-selected ligands bound to PDGF AB with .apprxeq.100-fold
higher affinities. Among the unique ligands, clones 9
(K.sub.d=91.+-.16 pM), 11 (K.sub.d=120.+-.21 pM), 16
(K.sub.d=116.+-.34 pM), 23 (K.sub.d=173.+-.38 pM), 25
(K.sub.d=80.+-.22 pM), 37 (K.sub.d=97.+-.29 pM), 38
(K.sub.d=74.+-.39 pM), and 40 (K.sub.d=91.+-.32 pM) exhibited the
highest affinity for PDGF AB (binding of all of these ligands to
PDGF AB is biphasic and the K.sub.d for the higher affinity binding
component is given).
Example 16
Experimental Procedures
[0202] This Example provides the general procedures followed and
incorporated in Examples 17-19 for the evolution of nucleic acid
ligands to hKGF.
[0203] A. Materials and Methods
[0204] Recombinant human Keratinocyte Growth Factor (hKGF) and
human Epidermal Growth Factor (hEGF) were purchased from Upstate
Biotechnology Inc.(Lake Placid, N.Y.). haFGF, hbFGF, PDGF-AB,
TGF.beta.1, and anti-KGF neutralizing monoclonal antibody were
purchased from R&D Systems (Minneapolis, Minn.). Recombinant
rat KGF was purchased from QED Advanced Research Technologies (San
Diego, Calif.). Human thrombin was purchased from Enzyme Research
Laboratories (South Bend, Ind.). T4 DNA ligase, HpaII methylase,
and restriction enzymes were purchased from New England Biolabs
(Beverly, Mass.). pCR-Script Amp SK(+) cloning kit was purchased
from Stratagene (La Jolla, Calif.). AMV reverse transcriptase was
purchased from Life Sciences (St. Petersburg, Fla.). Taq DNA
polymerase was purchased from Perkin Elmer (Foster City, Calif.).
Ultrapure nucleotide triphosphates were purchased from Pharmacia
(Piscataway, N.J.). .alpha.-.sup.32P-ATP, .gamma.-.sup.32P-ATP, and
5'-.sup.32P-cytidine 3', 5'-bis (phosphate) (5'-32P-pCp) were from
DuPont NEN Research Products (Boston, Mass.). .sup.125I-labeled KGF
was prepared as described before (Bottaro et al., (1990)
J.Biol.Chem. 265:12767-12770). PC-3 prostatic carcinoma cells were
obtained from ATCC (catalog number CRL1435). Balb/MK cells and
NIH3T3 transfected cells with the human KGF receptor (NIH3T3/KGFR)
were a generous gift from S. Aaronson, Mt. Sinai Medical Center,
NY, and have been described elsewhere (Miki et al., (1992)
Proc.Natl.Acad.Sci.USA 89:246-250; Miki et al., (1991) Science
251:72-75; Weissman et al., (1983) Cell 32;599-606). T7 RNA
polymerase, 2'NH.sub.2- and 2'F-modified CTP and UTP were from
NeXstar Pharmaceuticals, Inc. (Boulder, Colo.). DNA
oligonucleotides were obtained from Operon Technologies, Inc.
(Alameda, Calif.). Nitrocellulose/cellulose acetate mixed matrix,
0.45 .mu.m, HA filters were from Millipore (Bedford, Mass.).
Calcium and magnesium containing Dulbeco's Phosphate Buffered
Saline (DPBS) was purchased from Life Technologies (Gaithersburg,
Md.). Chemicals were at least reagent grade and purchased from
commercial sources.
[0205] B. SELEX
[0206] The SELEX procedure has been described in detail in U.S.
Pat. No. 5,270,163 (see also Tuerk and Gold (1990) Science
249:505-510). A single-stranded DNA (ssDNA) pool was used to
generate the double-stranded (dsDNA) template for generating the
initial random sequence RNA pool by transcription. The DNA template
contained 40 random nucleotides, flanked by 5' and 3' constant
regions for primer annealing sites for PCR and cDNA synthesis
(Table 14; SEQ ID NOS:186-188). The 5' primer contains the T7
promotor sequence for in vitro transcriptions. The template was PCR
amplified following an initial denaturation at 93.degree. C. for
3.5 minutes through 15 cycles of 30 second denaturation at
93.degree. C., 1 minute annealing at 60.degree. C., and 1 minute
elongation at 72.degree. C., in 50 mM KCl, 10 mM Tris-HCl, pH 9,
0.1% Triton X-100, 3 mM MgCl.sub.2, 0.5 mM of each dATP, dCTP,
dGTP, and dTTP, 0.1 units/.mu.l Taq DNA polymerase, and 2.5 nM each
of 3G7 and 5G7 primers (Table 14; SEQ ID NOS.187-188). SELEX
experiments for hKGF were initiated with a random sequence pool of
RNA in which all pyrimidines were 2'-NH.sub.2-modified or
2'-F-modified. Transcription reactions were done with about 5 .mu.M
DNA template, 5 units/.mu.l T7 RNA polymerase, 40 mM Tris-HCl (pH
8), 12 mM MgCl.sub.2, 5 mM DTT, 1 mM spermidine, 0.002% Triton
X-100, 4% PEG 8000, 2-4 mM each 2'OH ATP, 2'OH GTP, 2'NH.sub.2 or
2.degree. F. CTP, 2'NH.sub.2 or 2'F UTP, and 0.25 .mu.M
.alpha..sup.32P 2'OH ATP (800 Ci/mmole). The full length
transcripts were gel-purified prior to use. To prepare binding
reactions, the RNA molecules were incubated with recombinant hKGF
in Dulbecco's Phosphate-Buffered Saline (DPBS) with calcium and
magnesium (Life Technologies, Gaithersburg, Md., Cat. No 21300-025)
containing 0.01% human serum albumin. Following incubation at room
temperature (ranging from 10 minutes to 10 hours) the protein-RNA
complexes were partitioned from unbound RNA by filtering through
nitrocellulose. Nitrocellulose filter bound RNA was recovered by
phenol/urea extraction. The partitioned RNA was reverse transcribed
into cDNA by AMV reverse transcriptase at 48.degree. C. for 60 min
in 50 mM Tris-HCl pH 8.3, 60 mM NaCl, 6 mM Mg(OAc).sub.2, 10 mM
DTT, 50 pmol DNA 3' primer (Table 14), 0.4 mM each of dATP, dCTP,
dGTP, and dTTP, and 1 unit/.mu.l AMV RT. The cDNA was PCR amplified
and used to initiate the next SELEX cycle.
[0207] C. Nitrocellulose Filter Partitioning
[0208] In order to partition the protein-RNA complexes, the binding
reactions were filtered through nitrocellulose/cellulose acetated
mixed matrix, 0.45 .mu.m pore size (filter disks, Millipore, Co.,
Bedford, Mass.). For filtration, the filters were placed onto a
vacuum manifold and wetted by aspirating 5 ml of DPBS. The binding
reactions were aspirated through the filters, and following a 5 ml
wash, the filters were counted in a scintillation counter
(Beckmann). Higher wash volumes with DPBS or 0.5 M urea were used
as a means to increase selection stringency as shown in Table 15.
Gel purified, internally .alpha.-.sup.32P-ATP labeled transcripts
were incubated with various concentrations of hKGF in DPBS at
37.degree. C. for 10 minutes. Oligonucleotide protein mixtures were
filtered through prewetted 0.45 .mu.m pore size HA filters,
followed by a 5 ml wash with DPBS. The radioactivity retained on
the filter was counted and corrected for background binding in the
absence of protein. Nonlinear least square method was used to fit
the data into monophasic or biphasic binding curves and to obtain
the equilibrium dissociation constant K.sub.d (Jellinek et al.,
(1993) Proc.Natl.Acad.Sci. USA 90:11227-11231) using the software
package Kaleidagraph (Synergy Software, Reading, Pa.). Biphasic
binding can be described as the binding of two affinity species
that are not in equilibrium.
[0209] D. Cloning and Sequencing
[0210] The RNA recovered from the round 8 filters was reverse
transcribed and PCR amplified. Following column purification with
QIA-quick spin columns (Qiagen, Inc., Chatsworth, Calif.) and
ethanol precipitation, the amplified DNA was methylated with HpaII
methylase (New England Biolabs, Beverly, Mass.). The methylated DNA
was cloned into the SrfI restriction site of pCR-Script Direct
SK(+) plasmid using the pCR-Script Amp SK(+) cloning kit
(Stratagene Cloning Systems, La Jolla, Calif.). About 80 clones
were sequenced with Sequenase sequencing kit (United States
Biochemical Corporation, Cleveland, Ohio). Sequence analysis and
secondary structure prediction was done by using previously
described computer software (Feng and Doolittle (1987) J. Mol.
Evol. 25:351-360; Jaeger et al., (1989) Proc. Natl. Acad. Sci. USA
86:7706-7710; Jaeger et al., (1990) Methods Enzymol. 183:281-306;
Zucker (1989) Science 244:48-52).
[0211] E. Determination of Minimal Sequences Necessary for
Binding
[0212] Oligonucleotide ligands end labeled at the 5' end with
.gamma.-.sup.32P-ATP using T4 polynucleotide kinase, or at the 3'
end with 5'-32P-pCp and T4 RNA ligase, were used to establish 3'
and 5' boundaries respectively (Fitzwater et al., (1996) Methods
Enzymol. 267:275-301). After partial alkaline hydrolysis, the
radiolabeled oligonucleotide was incubated with 0.1, 0.6, and 3.0
nM hKGF, and the protein bound oligonucleotide was isolated by
nitrocellulose filtration. The nitrocellulose retained
oligonucleotide truncates were analyzed on a high resolution
denaturing polyacrylamide gel. An alkaline hydrolysis ladder and a
ladder of radioactively labeled ligands terminated with G-residues,
generated by partial RNase T1 digestion, were used as markers to
map the 3' and 5' boundaries.
[0213] F. Thermal Denaturation Profiles
[0214] Oligonucleotide melting profiles were obtained with a Cary
Model 1E spectrophotometer. Oligonucleotides were heated to
95.degree. C. in PBS (Sambrook et al., (1989) Molecular Cloning; A
Laboratory Manual 2nd Ed., Cold Spring Harbor, N.Y.) or 10 mM
phosphate buffer and cooled to room temperature before recording
the melting profile. The melting profiles generated show the change
in absorbance at 260 nm as a function of temperature. During
recording, the samples were heated at a rate of 1.degree. C.
min.sup.-1 from 20-95.degree. C.
Example 17
RNA Ligands to hKGF
[0215] A. SELEX
[0216] To generate RNA ligands for hKGF, two parallel SELEX
experiments were initiated, one with 2'-NH.sub.2 and the other 2'-F
pyrimidine modified RNA molecules randomized at 40 contiguous
positions. The SELEX conditions and results for each round are
summarized in Table 15. The starting pool contained
5.times.10.sup.14 (500 pmoles) and 2.5.times.10.sup.14 (250 pmoles)
2'-NH.sub.2 and 2'-F pyrimidine modified RNA molecules,
respectively, and bound to hKGF with an approximate K.sub.D of 30
nM. After 8 rounds of SELEX, the evolved pools bound with a K.sub.D
of 0.6 nM. No further improvement in the K.sub.D was observed in
the subsequent two rounds. The RNA pools from the 8th round were
reverse transcribed, PCR amplified and cloned as described.
[0217] B. RNA Sequences
[0218] In the 2'-NH.sub.2 SELEX, 29 out of 31 clones were unique.
In the 2'-F SELEX all 43 clones sequenced were unique. A unique
sequence is defined as one that differs from all others by three or
more nucleotides. Table 16 lists the sequences (SEQ ID NOS:189-262)
of all of the clones sequenced in standard single letter code
(Cornish-Bowden, (1985) Nucleic Acid Res 13:3021-3030). Computer
assisted global and local alignment did not reveal any extensive
homologies among the clones, and no obvious families were apparent.
The 2'-NH.sub.2 clones are in general purine rich while the 2'-F
clones are pyrimidine rich. When the alignment parameters were
relaxed, the Feng/Doolittle algorithm grouped the 2'-NH.sub.2
clones in one family and the 2'-F clones in another. Visual
inspection of the sequences suggested two and three possible
families for the 2'-NH.sub.2 and the 2'-F ligands, respectively.
Using conserved predicted secondary structure, 38 2'F ligands could
be assigned into two classes (FIGS. 12A and 12B). Similarly, 15
2'NH.sub.2 ligands could be assigned into two classes (FIGS. 12C
and 12D). The two proposed classes for the 2'F ligands can be
folded into pseudoknot structures (Wyatt et al., (1993) The RNA
World 465-496; ten Dam, E. (1992) Biochemistry 31:1665-1676). These
structures are very related and in fact they could be circular
permutations of a common structure. Loop 3 (L3) of class 1
pseudoknots presents the conserved sequence 5'RRYuy while loop 1
(L1) of class 2 ligands presents the sequence 5'AaYY. Both of these
sequences contain the consensus 5'RRYY. Some of the 2'F ligands
contain two to three copies of the RRYY sequence (FIGS. 12A and
12B). Another feature of these structures is the unequal
distribution of purines and pyrimidines in stem 1 (S1). One strand
of that stem contains almost exclusively purines while the other
strand contains pyrimidines.
[0219] Class 1 of the 2'NH.sub.2 ligands includes 8 members that
can be folded into stem-loop structures with internal symmetric or
asymmetric loops. The stem contains three consecutive GC base
pairs. The terminal loops are long and present the conserved
sequence 5'GGAA(N).sub.1-14YAA(N- ).sub.1-7RCRR (SEQ ID NO:263).
Both sides of the internal asymmetric loops of the class 1 ligands
contain the sequence 5'AA. Class 2 includes 7 ligands that can be
folded into dumbbells with variable sized loops. One loop contains
the conserved sequence 5'YGAY while the other loop contains the
conserved sequence 5'GGAA(N).sub.0-4YGA (SEQ ID NO:264). Clones 2N
and 54N are circular permutations of the remaining 5 clones.
[0220] C. Affinities
[0221] The dissociation constants of the hKGF ligands were
determined by nitrocellulose filter binding and are listed in Table
17. Eight out of 41 2'-F ligands bound biphasically. The remaining
of the 2'-F and all the 2'-NH.sub.2 ligands bound monophasically.
Under protein excess, biphasic binding suggests that the ligand
exists as two affinity species (presumably isoconformers) that are
not in equilibrium. The best 2'-F-modified ligand, K14F, binds
biphasically with the high and low affinity dissociation constant
at about 0.3-3pM and 2-10 nM respectively. There is some observed
variability in the K.sub.D determinations for the various clones
and the random RNA. Despite the experimental variability in the
K.sub.D determinations, the high affinity species of K14F have a
1,000-5,000 fold better affinity than the random RNA. Among the
monophasic 2'-F-modified ligands, K38F had the best K.sub.D of
about 0.3 nM. The best 2'-NH.sub.2-modified ligands bound with a
K.sub.D of 0.4 nM which represent about 75 fold improvement over
the random RNA.
[0222] D. Determination of Minimal Sequences Necessary for
Binding
[0223] Two 2'F ligands (6F and 14F) (SEQ ID NOS:223 and 231) were
studied further to determine the minimal sequences necessary for
binding. Sequence boundaries were determined by allowing an
alkaline hydrolysis ladder, labeled at the 3' or 5' end, to bind to
hKGF. The partial fragments were affinity purified by
nitrocellulose filtration and analyzed on high resolution
denaturing gels. Boundaries were clearly observed only at the 3'
ends for both ligands (FIG. 13) and are in agreement with the class
1 proposed folding as shown in FIGS. 12A and 12B. Truncated
templates were then used to confirm the boundaries (FIG. 13). Three
truncates were tested for 6F because a run of 7 consecutive
pyrimidines did not allow the precise mapping of the boundary. From
these three truncates, one lost its KGF binding activity as shown
in FIG. 13. A single 14F truncate, designated 14F3'T, was tested.
This truncate was two bases longer than the observed boundary in
order to extend stem 2 (S2) of the proposed pseudoknot structure.
The 14F3'T truncated ligand retained binding activity with affinity
similar to the full length ligand. Like the full length ligand,
14F3'T bound KGF biphasically where the high affinity species
represented about 20% of the molecules and showed K.sub.d values of
about 0.3-3 pM. These high affinity species when partially
separated from the low affinity species on the basis of
differential affinity to KGF, exhibited binding curves with mid
points at 0.3-3 pM and maximum plateaus of about 70% (data not
shown). FIG. 13 shows the predicted folding of the shortest active
truncates for 6F and 14F which are 53 and 49 bases long
respectively. Both proposed pseudoknot structures contain
relatively long stems. The two proposed stems of 6F are separated
by a single base forming a non-H-type pseudoknot. The proposed 6F
structure resembles the solution structure of a similar pseudoknot
motif from a frame-shifting element found in the MMTV RNA (Shen et
al., (1995) J.Mol.Biol. 247:963-978). The two stems (S1 and S2) of
14F could be drawn as two coaxially stacked helices of 16 base
pairs total length (H-type pseudoknot). A Similar pseudoknot
structure has been proposed before, based on NMR data (Du et al.,
(1996) Biochemistry 35:4187-4198). Given the short length of L1, it
is possible that ligand 14F forms a non-H-type pseudoknot where the
last GU base pair of S1 is not formed allowing a more flexible
helical region and a longer L1. Temperature melting curves of 14F
and 14F3'T suggest a remarkable thermostability for this ligand
(data not shown). These melting curves appear to be concentration
independent and biphasic in 150 mM salt. Biphasic melting curves
have been observed before with tRNA (Hilbers et al., (1976)
Biochemistry 15:1874-1882), and have been attributed to the
tertiary folding of the RNA molecule. Multiphasic temperature
transitions have also been proposed for RNA pseudoknots (Du et al.,
(1996) Biochemistry 35:4187-4198). The biphasic curves observed
include a low Tm at about 55.degree. C. and a high Tm of greater
than 85-90.degree. C. In 10 mM salt the low Tm of 14F is not
observed while the high Tm is shifted down to 75-78.degree. C. The
melting profile for 14F appears to be flatter than 14F3'T even
though the Tm values are the same. The data suggest that the
observed thermostability is attributable to just the minimal
49-mer.
[0224] In an effort to identify shorter KGF ligands that retained
binding, the binding activity of various deletions of the shortest
truncate of ligand 14F, namely 14F3'T were tested. Deletions were
tested in all the structural elements of the proposed pseudoknot
structure. The results are summarized in Table 23 (SEQ ID
NOS:272-304). RNA transcripts containing 2'F pyrimidines and 2'OH
purines were obtained by in vitro transcription using synthetic DNA
templates. The activity of each ligand is shown by scoring for both
the high (H) and low (L) affinity component of the 14F3'T binding
curve with +(active) or -(not active). Truncates T35 and T36
represent two complementary halves of 14F3'T molecule and were
additionally tested as an equimolar mixture. The structural
elements of the proposed pseudoknot structure are separated by (1)
and are indicated by symbols S1 (stem 1), S2 (stem 2), L1 (loop 1)
and L3 (loop 3). The proposed pseudoknot structure for 14F3'T is a
non-H-type pseudoknot and lacks L2 (loop 2). The complementary
sequences forming S1 (S1 and S1') and S2 (S2 and S2') are marked by
single and double underlines respectfully. In the tabulated
sequences, deleted bases were replaced with periods (.). Any
deletion attempt in the stems S1 and S2 of the proposed pseudoknot
structure resulted in loss of both the high (H) and low (L)
affinity component of the binding curve as observed with the 14F3'T
ligand. Deletions in loop 3 (L3), however, were tolerated as long
as one copy of the RRYY box remained intact. The shortest ligand
that retained activity is T22 which is a 43-mer. In trying to
obtain shorter ligands by truncating L3 further a mutant version of
T22 (designated T22mu) was used where the last GC base pair of S1
was eliminated by a G to U mutation at position 6. The reasoning
for this mutation was to enhance the flexibility of the double
stranded region of this ligand by allowing an unpaired base between
S1 and S2. Although this mutation did not affect the binding of T22
it did not allow further active truncations in L3.
[0225] E. Specificity of RNA Ligands to hKGF
[0226] The specificity of the K14F ligand was tested by determining
its K.sub.D against rat hKGF, and the heparin binding human growth
factors, aFGF, bFGF, and PDGF (Table 18). The results suggest that
the K14F binds all tested targets like random RNA, except hKGF, and
it can discriminate between hKGF and other similar proteins by a
factor of 400-40,000.
[0227] The specificity of ligand 14F3'T was tested by determining
its K.sub.d against a variety of heparin binding proteins. The
results summarized in Table 22 show that ligand 14F3'T can
discriminate KGF from all other heparin binding proteins tested by
a factor of 1.2.times.10.sup.4-3.times.10.sup.10. Ligand 14F3'T
binds only to KGF with high affinity while it binds all other
heparin binding proteins tested like random RNA. Binding of 14F3'T
to the rat KGF, which is 91% identical to human KGF, is with about
a 5-10 fold reduced affinity. Similar specificity was observed
during the inhibition of the KGF induced DNA synthesis of Balb/MK
cells. Ligand 14F3'T inhibits rat KGF induced DNA synthesis with a
K, of 1.8 nM which is 20-50 fold higher than the K, observed with
the human KGF. Ligand 14F3'T inhibits the DNA synthesis of Balb/MK
cells only if it is the result of KGF but not EGF stimulation (data
not shown).
Example 18
Inhibition of hKGF Binding to Cell Surface Receptors
[0228] A. Receptor Binding Assay
[0229] To test the ability of the hKGF ligands to competitively
inhibit the binding of hKGF to its cell surface receptor, two cell
lines were used. The first cell line, PC-3, is an isolate from a
grade IV prostatic adenocarcinoma (ATCC CRL 1435). The second cell
line is designated as NIH3T3/FGFR-2 and is a recombinant NIH/3T3
cell line carrying the human hKGF receptor at about
0.5-1.times.10.sup.6 high affinity KGF binding sites per cell (Miki
et al., (1992) Proc. Natl. Acad. Sci. USA 89:246-250).
[0230] PC-3 cells were plated in 24-well plates at about 10.sup.5
cells per well. Following growth for 48-36 hours, the cells were
serum starved for 24 hours, washed two times with 500 .mu.l of cold
DPBS, and then incubated with 500 .mu.l binding buffer (BB1; DPBS,
0.5 mM MgCl.sub.2, 0.2% BSA. 0.02% sodium azide) containing various
concentrations of .sup.125I-labeled KGF ranging from 0 to 0.8 nM.
Following 3-3.5 hour incubation at 4.degree. C., the binding mixes
were aspirated and the well-adhered cells were washed two times
with 1 ml BB1 and once with 1 ml BB1 supplemented with 0.5M NaCl.
The remaining bound labeled hKGF was solubilized in 600 .mu.l 0.5%
SDS/0.1M NaOH and counted in a gamma counter (Beckmann).
Nonspecific binding was determined in the presence of 100 fold
molar excess of unlabeled hKGF. For competition assays, the labeled
hKGF was kept constant at 0.3 .mu.M, and varying concentrations of
competitor molecules were included in the binding reactions ranging
from 0-1,000 nM. Binding curves were fitted to the equation:
[Bound Tracer]=([Total Tracer]*[Receptor])/(K.sub.D+[Total
Tracer])
[0231] where [Total Tracer] and [Bound Tracer] were fixed and the
K.sub.D and [Receptor] were determined by regression analysis using
the software Kaleidagraph (Synergy Software, Reading, Pa.).
[0232] NIH3T3/KGFR-2 cells were plated in 24-well plates at about
10.sup.5 cells per well. Following growth overnight, the cells were
serum starved for 1-5 hours, washed two times with 500 .mu.l
binding buffer (BB2: serum-free MEM growth medium, 0.1% BSA, 25 mM
HEPES, pH 7.4), and then incubated with 250 .mu.l BB2 containing 1
.mu.g/ml heparin (from bovine lung, SIGMA, St. Louis, Mo.),
.sup.125I-labeled hKGF at 0.03 nM, and varying concentrations of
competitor molecules (300 nM-0 nM). Following 1 hour incubation at
room temperature, the binding mixes were aspirated, and the wells
were washed two times with 250 .mu.l cold DPBS and once with 250
.mu.l cold DPBS supplemented with 0.5M NaCl. The bound labeled hKGF
was solubilized in 500 .mu.l 0.5% SDS and counted in a
scintillation counter (Beckmann).
[0233] The inhibition constants (Ki) of the RNA ligands were
determined by a nonlinear regression analysis of the data.
[0234] In search of KGF receptors on the surface of PC-3 cells,
different concentrations of .sup.125I-hKGF were used, ranging from
0.002 to 0.8 nM, in the presence and absence of 100 fold molar
excess of unlabeled hKGF, and saturation binding of the tracer on
the surface of PC-3 cells was observed. FIG. 10 shows the plot of
the concentration of bound tracer as a function of the total
concentration of tracer as well as the Scatchard analysis of the
same data. Analysis of the data suggested that there are about
5,000 specific hKGF binding sites per cell with a K.sub.D of
100-200 pM. This K.sub.D is in good agreement with the reported
K.sub.D for hKGF of 200 pM (Miki et al., (1992) Proc natl Acad Sci
USA 89:246-250).
[0235] PC-3 plasma membrane extracts were found to alter the
electrophoretic mobility (gel shift) of radiolabeled hKGF upon
native gel electrophoresis (FIG. 11). For electrophoretic mobility
shift gels, about 3.times.10.sup.7 PC-3 cells were gently spun and
washed with PBS and then lysed by mixing with equal volume of lysis
buffer containing 40 mM Hepes, pH 7.4, 150 mM NaCl, 20% glycerol,
2% triton X-100, 0.1% sodium azide, 3 mM MgCl.sub.2, 3 mM EGTA, 2
.mu.M aprotinin, 2 .mu.M leupeptin, 2 mM PMSF, and 400 .mu.M sodium
orthovanadate. Following 15 min incubation on ice the extract was
spun at 11,000 g at 4.degree. C. for 30 min to remove debris and
nuclei and the supernatant was aliquoted and stored at -70.degree.
C. For gel analysis, 25 .mu.l binding reactions were set in DPBS,
0.01% HSA, 2 mM MgCl.sub.2, containing 3 .mu.l of a 10 fold diluted
PC-3 membrane extract in 0.01% HSA, and various concentrations of
.sup.125I-labeled hKGF. Following a 10 min incubation at room
temperature, 6.times. loading dye was added to achieve 1.times.
concentration, and the samples were loaded onto a 5% or 10% native
TBE polyacrylamide gel. The gel was prerun at room temperature at
100 Volts. Following loading, the gel was run at 200 Volts for 5
min and then at 100 Volts for 30-60 min at room temperature. The
radioactive bands were then visualized by autoradiography. The gel
shift of radiolabeled hKGF is not observed in the presence of 100
fold molar excess of unlabeled hKGF (FIG. 11), demonstrating a
specific interaction between a component found in the PC-3 membrane
extracts and hKGF. The estimated KD from the gel shift experiment
is about 8 nM.
[0236] In agreement with the competition experiments reported in
the literature (Miki et al., Proc Natl Acad Sci USA 89:246-250),
gel shift competition curves using unlabeled hKGF and bFGF as well
as an unrelated small basic protein namely lysozyme were obtained.
Table 21 lists the IC50 values obtained in this experiment. In
agreement with previous reports, the data presented in Table 21
show that bFGF competes about 20 fold worse than hKGF for binding
with the hKGF receptor present in the PC-3 plasma membrane
extracts. The interaction observed by the gel shift appears to be a
specific interaction for FGF and it is not due to a charge-charge
interaction, as lysozyme, another small positively charged
molecule, competes for the PC-3 membrane extract:hKGF complex with
about 100 fold worse affinity than hKGF alone.
[0237] IC50 values for various RNA ligands obtained with the PC-3
assay are shown in Table 19. A subset of these ligands was tested
on the NIH3T3/FGFR-2. Competitive inhibition constants (Ki) were
determined from full competition curves and are summarized in Table
20. In determining the Ki values, it was assumed that 3T3 cells
have 500,000 binding sites per cell and PC-3 cells have 5,000
binding sites per cell.
[0238] The data show that several hKGF ligands can competitively
inhibit binding of hKGF to its cell surface receptors. Some of
these ligands, such as K14F, have potent competitive activities
with Ki's in the low nM range.
[0239] This work not only demonstrates that nucleic acid
competitors for hKGF were obtained, but also identifies a new assay
for screening hKGF competitors including small molecules,
antibodies, and peptides. This new assay includes the use of the
prostate carcinoma cell line, PC-3.
[0240] The two cell lines, PC3 and NIH3T3/FGFR-2, give slightly
different results (see Table 20). KGF binding to PC-3 cells is more
sensitive to inhibition by several ligands and by heparin. Random
RNA, however, does not effectively compete for KGF binding on the
PC-3 cells. KGF binding to NIH3T3/FGFR-2 is resistant to inhibition
by some RNA ligands and heparin. This is because the NIH3T3/KGFR
assay is more stringent since it is done in the presence of 1
.mu.g/ml heparin. The random oligonucleotide competition curve with
the NIH3T3/FGFR-2 is completely flat with K.sub.t>10.sup.-4 M.
Ligands 6F and 14F show the best inhibitory activity with K, values
of 100-200 pM and 2-8 nM in the PC-3 and NIH3T3/FGFR-2 assay
respectively. Only two 2'NH.sub.2 ligands, 14N and 29N, show good
activity with the PC-3 cells (K, value of 1.4 nM). From these two
ligands, only 14N retains its inhibitory activity in the
NIH3T3/FGFR-2 assay showing a K, value of 100 nM. The observed
inhibition of the KGF mitogenic activity by these ligands is not
due to a nonspecific affect in the proliferative ability of the
cell lines because these ligands have no antiproliferative activity
on cells induced by EGF instead of KGF (data not shown).
[0241] This work not only demonstrates that nucleic acid
competitors for hKGF were obtained, but also identifies a new assay
for screening hKGF competitors including small molecules,
antibodies, and peptides. This new assay includes the use of the
prostate carcinoma cell line, PC-3.
Example 19
Inhibition of the Mitogenic Activity of KGF
[0242] One of the biological effects of KGF is the stimulation of
proliferation of epithelial cells (Rubin et al., (1989) Proc Natl
Acad Sci USA 86:802-806). This proliferative effect of KGF can be
measured by the stimulation of .sup.3H-thymidine incorporation in
responding cells after exposure to KGF. Three such cell lines have
been described before (Rubin et al., (1989) Proc Natl Acad Sci USA
86:802-806). Two cell lines were used to test the anti-mitogenic
activity of various ligands. One is 4MBr-5 (ATCC #CCL208), a monkey
epithelial, low passage, cell line (Caputo et al., (1979) In Vitro
15:222-223) while the second is Balb/MK, a transformed rat
keratinocyte cell line (Weissman and Aaronson (1983) Cell
32:599-606). 4-MBr5 cells grown in F12K containing 30 ng/ml, hEGF,
and 10% FCS, were trypsinized and resuspended in M199 containing 10
mM HEPES, pH 7.4, and 10% FCS at 1.4.times.10.sup.5 cells/ml. A
96-well microtiter plate was seeded with 100 .mu.l of cell
suspension and KGF was added at 10 ng/ml (0.5 nM), as well as K14F
ligand at various concentrations ranging from 0-1000 nM. Each
incubation reaction was set in at least triplicates. Following 24 h
incubation at 37.degree. C., .sup.3H-thymidine was added at 1
.mu.Ci/well along with unlabeled thymidine at 10 nM. The cells were
incubated for additional 24 h, the supernatant was aspirated, and
the remaining cells were harvested by lysis in 20 .mu.l of 0.2 N
NaOH. The extent of .sup.3H-thymidine incorporation was determined
by TCA precipitation and filtration through GFC filter disks
(Whattman, Hillsboro, Oreg.).
[0243] Balb/MK cells grown in Low Ca.sup.++ EMEM with 10% FCS
(dialyzed and heat inactivated) and 5 ng/ml rhEGF were trypsinized
and resuspended in Low Ca.sup.++ EMEM with 1% FCS (dialyzed and
heat inactivated) and 0.5 ng/ml rhEGF and plated on 96 well
fibronectin coated culture plates at 4-6.times.10.sup.4 cells per
well in 100 .mu.l total volume. Following overnight growth, the
medium was replaced with Low Ca.sup.++ EMEM without FCS or rhEGF
and serum starved for about 30 hrs. Human recombinant KGF or EGF
was then added at 16 and 49 pM respectively, along with various
concentrations of competitors ranging from 0-1000 nM. Following
over-night incubation, .sup.3H-thymidine was added at 0.2
.mu.Ci/well and incubation continued for an additional 7-8 hrs. The
extent of .sup.3H-thymidine incorporation was determined by TCA
precipitation and filtration through GFC filter disks.
[0244] The inhibition constants (K.sub.i) of the oligonucleotide
ligands were determined by a nonlinear regression analysis of the
data as described before (Gill et al., (1991) J.Mol.Biol.
220:307-324).
[0245] The two assays give slightly different results. The 4 MBr-5
assay was performed in the presence of fetal calf serum, while the
Balb/MK was done following serum starvation. The Balb/MK assay is
more sensitive and a prototypic assay for the KGF induced mitogenic
activity. Similar to the results obtained with the PC-3 cells, the
4 MBr-5 assay showed a good activity for ligand 14F (K.sub.i value
of 9.8 nM but incomplete inhibition). In the same assay, the random
oligonucleotides showed K.sub.i values of >1 .mu.M while a
monoclonal neutralizing antibody showed a K.sub.i value of 2.9 nM.
It appears that ligand 14F is as good or even better than the
monoclonal neutralizing antibody. The competition curves for the
neutralizing monoclonal antibody and ligand 14N plateau at about
20-40%, suggesting that these antagonists do not completely abolish
the KGF mitogenic activity. In contrast to the monoclonal antibody,
ligand 14F completely blocks the KGF mitogenic activity on the 4
MBr-5 cells. In the Balb/MK assay, 14N showed K.sub.i values of
about 10 nM (incomplete inhibition) while the random
oligonucleotide showed K.sub.i values of about 300 nM. The K.sub.i
values for 6F and 14F are 830 and 92 pM, respectively. Similar to
the 4 MBr-5 assay, ligand 14F appears to be as good if not better
than the monoclonal neutralizing antibody which shows a K.sub.i
value of 980 pM. The best inhibitory activity was observed with
14F3'T with a K.sub.i value of 34 pM.
Example 20
[0246] Nucleic acid ligands that bind to basic fibroblast growth
factor (bFGF) have been derived by the SELEX method as described in
U.S. Pat. No. 5,459,015 (see also U.S. Pat. No. 5,270,163 and Tuerk
and Gold (1990) Science 249:505-510). A 2'NH.sub.2-modified nucleic
acid ligand designated 21A having the sequence
5'-GGGAGACAAGAAUAACGCUCAAGUAGACUAAUGUG- UGGAAGACAGCGG
GUGGUUCGACAGGAGGCUCACAACAGGC (SEQ ID NO:265) was examined by
deletion analysis for the minimal sequence information required for
high affinity binding to bFGF. This analysis led to truncated
ligand 21A-t (GGUGUGUGGAAGACAGCGGGUGGuuc (SEQ ID NO:266) where the
underlined G's are guanines added to improve efficiency of
transcription and lowercase letters are from the constant
region.
[0247] In order to increase the stability of ligand 21A-t against
degradation by nucleases, short phosphorothioate caps were added to
the 5' and the 3' ends. In addition, nine ribopurine positions were
identified that can be substituted with 2'-deoxy-2'-O-methylpurines
without a loss in binding affinity for bFGF, using the method
described in Green et al., Chem.Biol. 2:683-695, resulting in the
ligand designated as NX-286 (5'-TsTsTsTs mGmGaU rGaUrG aUrGrG
mArArG mAaCrA rGaCmG mGmGaU mGmGaU aUaC TsTsTsTsT-3' (SEQ ID
NO:267), where s represents phosphorothioate internucleoside
linkage, aU and aC are 2'-deoxy-2'-aminouridine and
2'-deoxy-2'-aminocytidine residues, respectively, mA and mG are
2'-deoxy-2'-O-methyladenosine and guanosine residues, respecitvely,
rA and rG are adenosine and guanosine residues and T is
2'-deoxythymidine). The modified nucleic acid ligand had a K.sub.d
of 0.4 nM as measured by electrophoretic mobility shift assay.
1TABLE 1 Nucleic Acid Sequences Used in SELEX Experiments described
in Examples 1-4 SEQ ID NO. Starting RNAs: 64N6 transcript:
5'GGGGGAGAACGCGGAUCC [-64N-] AAGCUUCGCUCUAGAUCUCCCUUUAGU 1 GAGGGUUA
3' 40N6 transcript: 5'GGGGGAGAACGCGGAUCC [-40N-]
AAGCUUCGCUCUAGAUCUCCCUUUAGU 2 GAGGGUUA 3' randomized lib2-6-1
transcript*: 5'GGGGGAGAACGCGGAUCC[ugucuccaccgc-
cgauacugggguuccuggggccccuccauggag 3
gaggggggugguucggaga]AAGCUUCGCUC- UAGAUCUCCCUUUAGUGAGGGUUA 3'
Starting DNA templates: Z-54 (64N60): 5'GGGAGAACGCGGATCC [-64N-]
AAGCTTCGCTCTAGA3' 4 Z-55 (40N6): 5'GGGAGAACGCGGATCC [-40N-]
AAGCTTCGCTCTAGA3' 5 D-123(randomized lib2-6-1)*:
5'GGGGGAGAACGCGGATCC[tgtctccaccgccgatactggggttcctggggcccctccatggaggaggg
6 gggtggttcggaga]AAGCTTCGCTCTAG 3' PCR and cloning primers:
T7SacBam: 5'TAATACGACTCACTATAGGGGGAGTCTGCGGATCC3' 7 SacI BamH1
T7SB2N: 5'TAATACGACTCACTATAGGGGGAGAACGCGGATCC3' 8 BamH1 3XH:
5'TAACCCTCACTAAAGGGAGATCTAGA- GCGAAGCTT3' 9 XbaI HindIII BamH1
cloning site engineered into pGem9zf to clone SELEX experiments
3-9. GATTTAGGTGACACTATAGAATATGCATCACTAGTAAGCTTTGCTCTAGA 10 SP6
promoter XbaI GGATCCCGGAGCTCCCTATAGTGAGTCGTATTA 11 BamH1 T7
promoter *GAUC or GATC, these bases only gauc or gact 62.5%
specified base, 12.5% the other three bases
[0248]
2TABLE 2 RNA SELEX Experiments described in Examples 1-4: template,
pyrimidine nucleotides, and round cloned. SELEX 2'substitued
2'substituted Round exp template* UTP CTP cloned lib1 64N6 OH OH 20
lib2 64N6 OH OH 6 lib3 40N6 + 64N6 F F 4 lib4 40N6 + 64N6 NH.sub.2
NH.sub.2 5 lib5 64N6 NH.sub.2 NH.sub.2 13 lib6 64N6 F F 13 lib7
64N6 F NH.sub.2 14 lib8 D-123 OH OH 6 lib9 64N6 NH.sub.2 F 5
*Sequences of templates are described in Table 1.
[0249]
3TABLE 3 TGFb Binding ligands SEQ ID lone 5'CONSTANT VARIABLE
3'CONSTANT NO. Group A gggggagaacgcggaucc [40 or 64N]
aagcuucgcucuagaucucccuuuagugagggu- ua 2 or 1 lib3 13
GAGCAAUCCCAGGCGCAUAGCUUCCGAGUAGACAGGAGGGAG-
GGGUGGAUGUGGCGUCUACUCGGUGUCGUG 12 3
GAGCAACCCCAGGCGCAUAGCUUCCGAGUAGACAGGAGGGAGGGGUGGAUGUGGCGUCUACUCGGUGUCGUG
13 4 GAGCAACCCCAGGCGCAUAGCUUCCGAGUAGACAGGCGGGAGGGGUGGAUG-
UGGCGUCUACUCGGAGUCGUG 14 lib4 32 G
GCAACCCCAGGCGCAUAGCUUCCGAGUAGACAGGCGGGAGGGGUGGAUGUGGCGUC ACGAGG 15
lib8 9 GCAAUCCCAGGCGCAUAGCUUCCGAGUAGACAGGAGGGAGGGGUGGAUG-
UGGCGUCUACUCGGCGUCGUG 16 lib5 5
GAGCAAUCCCAGGCGCAUAGCUUCCGAGUAGACAGGAGGGAGGGGUGGAUGUGGCGUCU CGAGG
17 7 GAGCAAGCCCUGGC AUAGCUUCCGAGUAGACAGGAGGGAGGGGUGGAUGUGGCGUCU-
ACUCGGUGUCGUG 18 48 G GCAAUCCCAGGCGCAUAGCUUCCGAGUAGACAGGAG-
GGAGGGGUGGAUGUGGUGU ACGAGG 19 lib2 6-4
GAGCAAUCCCAGGCGCAUAGCUUCCGAGUAGACAGGAGGGAGGGGUGGAUGUGGUGUCU CGAG 20
lib6 23 A AGCUUC GAGUAGACAGGAGGGAGGGGUGGAUGUGGAGUCU CGAG 21 4
GAGCAAUCCUAA GCAUAGCUUC GAGUAGACAGGAGGGAGGGGUGGAUGUGGCGUCU CGAG 22
lib7 21 GAGCAAUCCCGGGCGCAUAGCUUCCGAGGAGACA-
GGCGGGAGGGGUGGAUGUGGCGUCU CGAG 23 43
GAGCAAUCCCAGGCGCAUAGCUUCCGAGUAGACAGGCGGGAGGGGUGGAUGUGGCGUCU CGAG 24
clone 5'CONSTANT VARIABLE 3'CONSTANT gggggagaacgcggaucc [40 or 64N]
aagcuucgcucuagaucucccuuuagugaggguua 2 or 1 Group B. lib4-12
UGAGAAGGACGUCGGGGUCAACGGGGUGA- GGUGCAGCAGAAAGGGCCGGCACCACAUGACGUAA
28 lib3-44 UGAGAAGGACGUCGGGGU GAGGUGCAGCAGAAAGGGCCGGCACCACAUGACGUAA
29 lib3-42 GGUGGGAAA GUCGGAUU AUGUGU GUAGAUUU GU GUGCGA 30 Group C.
lib1-20-3** UGCUAGACCGAGGAUGCAAAGGGACA-
UGCAUUAGGGAAACCUAUGUAUAAGAACGCGGUCGCAG 32 lib1-20-3H**
UGCUAGACCGAGGAUGCAAAGGGACAUGCAUUAGGGAAACCUAUGUAUAAGAACGCGGUCGCAGA
33 lib6-30** UGCUAGACCGAGGAUGCAAAGGGACAUGCAUUAGGGAAACCUAU
UAUAAGAACGCGGUCGCAG 34 Group D. lib2-6-1*
UGUCUCCACCGCCGAUACUGGGGUUCCUGGGGCCCCUCCAUGCAGGAGGGGGGUGGUUCGGAGA 35
lib2-6-1-81* UGUCUCCACCGCCGAUACUGGGGUUCCUGGGGCCCCUCCAUGCAGGAGGG-
GGGUGGUUCGGAG 36 lib8-23* UGUCUCCACCGCCGAUACUGGGGUUCCUGGGG-
CCGCUCCAUGCAGGAGGGGGGUGGUUCGGAGA 37 lib9-10*
UGUCUCCACCGCCGAUACUGGGGUUCCUGGGGCCCCUCCAUGCAGGAGGGGUGGUUCGGAGA 38
ORPHANS. clone# lib3-45 GGAAGUCUGGUCUUUGGGGAGUCCGCA- UGGCCCUGGCGA
39 lib1-20-5** AAGAAUGUUCGGCCGCACGAGGUGACAGUG-
GUGCGGAUACGGACCGAUUGGGUUUGCC 40 lib1-20-12***
GGUCACCCGGGCAUAUAACAAUGCCGACACUGGGGUACCUGGGACGGGUGGGACUGGACGGAAG 41
lib2-6-8*** AUAACCGGCUGCAUGGGAGGGACAUCCUGGGAAAGGACGGGUCGAGAUGAC-
CUGAGCAGUUCCGGC 42 Group A Boundary Experiments lib3-13 boundaries
5' GCUUCCGAGUAGACAGGAGGGAGGGGUGGAUGUGGCGUCUAC 3' 25 lib8-9
boundaries 5' CUUCCGAGUAGACAGGAGGGAGGGGUGGAUGUGGC- GUCUACUC 3' 26
lib4-32 boundary GGCAACCCCAGGCGCAUAGCUUCCGA-
GUAGACAGGCGGGAGGGGUGGAUGUGGCGUCACG 3' 27 Group B Boundary
Experiments lib4-12 boundaries 5' UGAGAAGGACGUCGGGGUCAACGG-
GGUGAGGUGCAGCAGAAAGGGCCGGCACCA 3' 31 Legend: The constant region of
the ligand is shown in lower case and variable in upper. Sequences
have been aligned. Deletions with respect to the first sequence in
each group are shown by gaps, substitutions are in bold type.
*2'NH2-UTP,2'F-CTP: **2'F-UTP,2'F-CTP. ***2'OH-UTP,2'OH-CTP Group A
and B bind with either 2'NH2- or 2'F-pyrimidines. Ligands bind with
either 2'NH2- or 2'F-pyrimidines unless otherwise indicated
[0250]
4 TABLE 4 Dissociation and Inhibition Constants Group Ligand
B.sub.max K.sub.d IC.sub.50 A lib3-13 0.60 0.9 nM 9.7 nM 0.38 0.7
nM 42 nM 0.55 0.9 nM 18 nM 32 nM lib3-3 0.44 1.7 nM NT lib4-32 0.50
0.8 nM 20 nM 157 nM lib5-5 0.37 2.4 nM 49 nM lib5-7 0.33 3.4 nM 17
nM lib8-9 0.4 1.7 nM 210 nM lib8-9* 0.35 2.8 nM 124 nM lib5-48 0.32
3.8 nM not inhibitory lib2-6-4 0.20 3.1 nM not inhibitory lib6-23
0.35 3.4 nM not inhibitory lib7-21**** 0.18 2.4 nM not inhibitory
lib7-43**** 0.33 3.3 nM not inhibitory B lib4-12 0.15 0.4 nM 109 nM
0.08 0.2 nM 108 nM 69 nM lib3-44 0.18 1.3 nM 119 nM lib3-42 0.16
0.6 nM 22 nM C lib1-20-3** 0.67 30 nM not inhibitory lib1-20-3-82**
0.46 6.1 nM not inhibitory lib6-30** 0.35 8.8 nM not inhibitory D
lib2-6-1* 0.40 14.3 nM 103 nM 112 nM lib2-6-1-81* 0.39 10.7 nM 298
nM 201 nM lib8-23* 0.48 6.6 nM not inhibitory lib9-10* 0.24 1.1 nM
not inhibitory Orphans lib3-45 0.08 1.9 nM not inhibitory
lib1-20-5** 0.42 46 nM not inhibitory lib1-20-12*** 0.34 3.1 nM NT
lib1-6-8*** 0.12 4.7 nM NT Controls lib5-9 nonbinder not inhibitory
random 64N6 nonbinder not inhibitory ligands are 2'- NH2
pyrimidines unless otherwise noted *2'-NH2-UTP, 2'-F-CTP, **2'-F
pyrimidines, ***2'-OH pyrimidines, ****2'-F-UTP,2'-NH2-CTP
[0251]
5TABLE 5 DNA oligonucleotides used in Examples 5 and 6.sup.a SEQ ID
Description Sequence NO. 40N7 Template for RNA SELEX
TCGGGCGAGTCGTCTG[40N]CCGCATCGTCCTCCC 43 5N7 5'-primer for PCR
TAATACGACTCACTATAGGGAGGACGATGCGG 44 3N7 3'-primer for PCR
TCGGGCGAGTCGTCTG 45 40D7 Starting material for DNA SELEX
GGGAGGACGATGCGG[40N]CAGACGACTCGCCCGA 46 5D7 5'-primer for PCR
GGGAGGACGATGCGG 47 3D7 3'-primer for PCR
(biotin).sub.3TCGGGCGAGTCGTCTG 48 40N8 Template for RNA SELEX
GCCTGTTGTGAGCCTCCTGTCGAA[40N]TTGAGCGTTTATTCTT- GTCTCCC 49 5N8
5'-primer for PCR TAATACGACTCACTATAGGGAGACA- AGAATAAACGCTCAA 50 3N8
3'-primer for PCR GCCTGTTGTGAGCCTCCTGTCGAA 51 40D8 Starting
material for DNA SELEX
GGGAGACAAGAATAAACGCTCAA[40N]TTCGACAGGAGGCTCACAACAGGC 52 5D8
5'-primer for PCR GGGAGACAAGAATAAACGCTCAA 53 3D8 3'-primer for PCR
(biotin).sub.3GCCTGTTGTGAGCCTCCTGTCGAA 54 .sup.a.DNA
oligonucleotides 40N7 and 40N8 were used to generate the
double-stranded DNA template for in vitro transcription. The
3'-primers 3N7 and 3N8 were also used to generate cDNA from the RNA
repertoire. Synthetically synthesized DNA oligonucleotides 40D7 and
40D8 were used directly as the starting repertoire for the two
single-stranded DNA SELEX experiments. PCR amplification of the
selected repertoires used the appropriate 5'- or 3'-primer. The
symbol 40N indicated a 40-nucleotide randomized region within the
oligonucleotide.
[0252]
6TABLE 6 TGFB1 40N7 DNA Selex Sequence of fifty randomly chosen
clones. SEQ ID NO. 5' GGGAGGACGATGCGG . . . 40N . . .
CAGACGACTCGCCCGA 3' 46 Group A 20 (11 clones)
CCAGGGGGGGTATGGGGGTGGTGCTACTTACTTGCGTCTT 55 4
CCAGGGGGGGTATGGGGGTAGTGCTACTTACTTGCGTCTT 56 5
CCAGGGGGGGTATGGGGGTAGTACTACTTACTTACGTCTT 57 8
CCAGGGGGGGTATGGGGGTATACTACTTACTTACGTCTT 58 13
CCAGGGGGGGTATGGGGGTAATACTACTTACTTACATCTT 59 16
CCAGGGGGGGTATGGGGGTAATACTACTTACTTACGTCTT 60 40
CCAGGGGGGGTATGGGGGTGGTGTTACTTACTTGCGTCTT 61 48
CCAGGGGGGGTATGGGGGTGGTGCTTCTTACTTGCGTCTT 62 Group B 18
CCAGGGGGGGTATGGGGGTGGTGTACTTTTTCCTGCGTCTTC 63 19
CCAGGGGGGGTATGGGGGTGGTTCGTTTTTCTTTGCGGCTT 64 32
CCAGGGGGGGTGTGGGGGTGGTGTACTTTTTCTTGTCTTC 65 46
CCAGGGGGGGTATGGGGGTGGTTTGGTATGTTGCGTCCGT 66 Group C 12 (3 clones)
CCGGGGTGGGTATGGGGGTAATACTACTTACTTACGTCTT 67 1
CCGGGGGTGGGTAGGGGGGTAGTGCTACTTACTTACGTCTT 68 3
CCAGGGTCGGTGTGGGGGTAGTACTACTTACTTGCGTCTT 69 10
CCAGGGTGGGTATGGGGGTAGTGCTACTTACTTGCGTCTT 70 23
CCGGGGTGGGTATGGGGGTGGTGCTACTTACTTGCGTCTT 71 34
CCTGGGTGGGTATGGGGGTGGTGCTACTTACTTGCGTCTT 72 Group D 2
CCACGGGTGGGTGTGGGGTAGTGTGTCTCACTTTACATCAC 73 6
CCCGGGGTGGGTGTGGGGTAGTGTATTATATTTACAGCCT 74 25 &38
CCAGGGTCGGTGTGGGGTGGTGTACTTTTTCCTGTCCTTC 75 7
CCAGGGTCGGTATGGGGTAGTGTACTTTTTAATGATCTTC 76 9
CCCGGGGGAGAGCGGTGGGTAGTGTTCTATAGTATTCGTGT 77 11
CCAGGGGGGGTATGTTTTTAATACTACTTACTTACGTCTT 78 17
CCAGGGAGGGTATGGGGGTGGTGTTTCTAGTTTTGCGGCGT 79 21
CCAGGGTGGGCATGGGGGTGGTGTGGATTAATTCTTCGTCC 80 24
CCAGGGTCGGTGTGGGGTGGTGTTTTTATTTACTCGTCGC 81 28 &30
GGGGCGGCTTGGAAGAGGTTGCCGGTTGGAGTATTCGAGC 82 29
CCAGGTGTGGGGTGGTTTGGGTTTTCTTTCGTCGCC 83 31
CCAGGGTGGGTATGGGGGTTTAATTAATTCTTCGTCCCA 84 35
GGGGCGGCTTGGAAGAGGTTGCCGGTTGGAGTATTCGAGC 85 36
CCCGGGGTGGGTGTGGGGTGGTGTGAATTAATTCTTCGTCC 86 41
CCCGGGGTGGGTGTGGGGTGGTGTATTATATTTGCGGCCT 87 44 &45
CCAGGGTCGGTGTGGGTGGTGTACTTTTTCCTGTCCTTC 88 50
GGGGCGGCTTGGAAGAGGTTGCCGGTTGGAGTATTCGAGC 89 Bold typeface indicates
a discrepancy with the most common sequence of that group.
[0253]
7TABLE 7 Starting DNA and PCR primers for the ssDNA SELEX
experiment SEQ ID NO. Starting ssDNA:
5'-ATCCGCCTGATTAGCGATACT[-40N-]ACTTGAGCAAAATCACCTGCAGGGG-- 3' 90
PCR Primer 3N2*: 5'-BBBCCCCTGCAGGTGATTTTGCTCA- AGT-3' 91 PCR Primer
5N2**: 5'-CCGAAGCTTAATACGACTCA- CTATAGGGATCCGCCTGATTAGCGATACT-3' 92
*B = biotin phosphoramidite (e.g., Glen Research, Sterling, Va.)
**For rounds 10, 11, and 12, the truncated PCR primer 5N2
(underlined) was used to amplify the template.
[0254]
8TABLE 8 Unique Sequences of the ssDNA high affinity ligands to
PDGF SEQ ID NO 5'-ATCCGCCTGATTAGCGATACT [40N]
ACTTGAGCAAAATCACCTGCAGGGG-3' 90 *14
AGGCTTGACAAAGGGCACCATGGCTTAGTGGTCCTAGT 93 *41
CAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGT 94 6
CCAGGCAGTCATGGTCATTGTTTACAGTCGTGGAGTAGGT 95 23
AGGTGATCCCTGCAAAGGCAGGATAACGTCCTGAGCATC 96 2
ATGTGATCCCTGCAGAGGGAGGANACGTCTGAGCATC 97 34
CACGTGATCCCATAAGGGCTGCGCAAAATAGCAGAGCATC 98 8
GGTGGACTAGAGGGCAGCAAACGATCCTTGGTTAGCGTCC 99 1
GGTGCGACGAGGCTTACACAAACGTACACGTTTCCCCGC 100 5
TGTCGGAGCAGGGGCGTACGAAAACTTTACAGTTCCCCCG 101 *40
AGTGGAACAGGGCACGGAGAGTCAAACTTTGGTTTCCCCC 102 47
GTGGGTAGGGATCGGTGGATGCCTCGTCACTTCTAGTCCC 103 18
GGGCGCCCTAAACAAAGGGTGGTCACTTCTAGTCCCAGGA 104 30
TCCGGGCTCGGGATTCGTGGTCACTTTCAGTCCCGGATATA 105 *20
ATGGGAGGGCGCGTTCTTCGTGGTTACTTTTAGTCCCG 106 35
ACGGGAGGGCACGTTCTTCGTGGTTACTTTTAGTCCCG 107 13
GCTCGTAGGGGGCGATTCTTTCGCCGTTACTTCCAGTCCT 108 16
GAGGCATGTTAACATGAGCATCGTCTCACGATCCTCAGCC 109 *36
CCACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG 110 50
GCGGGCATGGCACATGAGCATCTCTGATCCCGCAATCCTC 111 4
ACCGGGCTACTTCGTAGAGCATCTCTGATCCCGGTGCTCG 112 44
AAAGGGCGAACGTAGGTCGAGGCATCCATTGGATCCCTTC 113 24
ACGGGCTCTGTCACTGTGGCACTAGCAATAGTCCCGTCGC 114 7
GGGCAGACCTTCTGGACGAGCATCACCTATGTGATCCCG 115 *26
AGAGGGGAAGTAGGCTGCCTGACTCGAGAGAGTCCTCCCG 116 19
AGGGGTGCGAAACACATAATCCTCGCGGATTCCCATCGCT 117 48
GGGGGGGCAATGGCGGTACCTCTGGTCCCCTAAATAC 118 46
GCGGCTCAAAGTCCTGCTACCCGCAGCACATCTGTGGTC 119 25
TTGGGCGTGAATGTCCACGGGTACCTCCGGTCCCAAAGAG 120 31
TCCGCGCAAGTCCCTGGTAAAGGGCAGCCCTAACTGGTC 121 12
CAAGTTCCCCACAAGACTGGGGCTGTTCAAACCGCTAGTA 122 15
CAAGTAGGGCGCGACACACGTCCGGGCACCTAAGGTCCCA 123 *38
AAAGTCGTGCAGGGTCCCCTGGAAGCATCTCCGATCCCAG 124 *Indicates a boundary
experiment was performed. Italics indicate the clones that were
found to retain high affinity binding as minimal ligands.
[0255]
9 TABLE 9 1 2
[0256]
10TABLE 10 Frequency of base pairs in the helical regions of the
consensus motif shown in FIG. 3 Base pair.sup.b Position.sup.a AT
TA GC CG TG GT other I-1 0 0 21 0 0 0 0 I-2 0 0 21 0 0 0 0 I-3 5 0
16 0 0 0 0 I-4 3 5 1 4 1 0 7 I-5 2 3 3 4 0 0 9 II-1 0 1 2 17 0 0 1
II-2 5 5 5 1 0 4 1 II-3 3 4 7 6 0 0 1 II-4 3 0 8 5 0 0 4 III-1 21 0
0 0 0 0 0 III-2 0 10 0 11 0 0 0 III-3 0 7 0 13 1 0 0 .sup.aHelices
are numbered with roman numerals as shown in FIG. 3. Individual
base pairs are numbered with arabic numerals starting with position
1 at the helix junction and increasing with increased distance from
the junction. .sup.bWe have included the TG and GT base pairs to
the Watson-Crick base pairs for this analysis. There is a total of
21 sequences in the set.
[0257]
11TABLE 11 Affinities of the minimal DNA ligands to PDGF AA, PDGF
AB and PDGF BB K.sub.d, nM Ligand PDGF AA.sup.a PDGF AB.sup.b PDGF
BB.sup.b 20t 47 .+-. 4 0.147 .+-. 0.011 0.127 .+-. 0.031 36t 72
.+-. 12 0.094 .+-. 0.011 0.093 .+-. 0.009 41t 49 .+-. 8 0.138 .+-.
0.009 0.129 .+-. 0.011 .sup.aData points shown in FIG. 5A were
fitted to eq 1 (Example 7). .sup.bData points in FIGS. 5B and 5C
were fitted to eq. 2. The dissociation constant (K.sub.d) values
shown are for the higher affinity binding component. The mole
fraction of DNA that binds to PDGF AB or PDGF BB as the high
affinity component ranges between 0.58 to 0.88. The K.sub.d values
for the lower affinity interaction range between 13 to 78 nM.
[0258]
12TABLE 12 Starting RNA and PCR primers for the 2'-fluoropyrimidine
RNA SELEX experiment SEQ ID Starting 2'-fluoropyrimidine RNA: NO
Starting RNA: 5'-GGGAGACAAGAAUAACGCUCAA[-50
N-]UUCGACAGGAGGCUCACAACAGGC-3' 125 PCR Primer 1.
5'-TAATACGACTCACTATAGGGAGACAAGAATAACGCTCAA-3- ' 126 PCR Primer 2:
5'-GCCTGTTGTGAGCCTCCTGTCGAA-3' 127
[0259]
13TABLE 13 Sequences of the 2'-fluoropyrimidine RNA high affinity
ligands to PDGF AB. SEQ ID NO. 1
CGGUGGCAUUUCUUCACUUCCUUCUCGCUUUCUCGCGUUGGGCNCGA 128 2
CCAACCUUCUGUCGGCGUUGCUUUUUGGACGGCACUCAGGCUCCA 129 3
UCGAUCGGUUGUGUGCCGGACAGCCUUAACCAGGGCUGGGACCGAGGCC 130 4
CUGAGUAGGGGAGGAAGUUGAAUCAGUUGUGGCGCCUCUCAUUCGC 131 5
CAGCACUUUCGCUUUUCAUCAUUUUUUCUUUCCACUGUUGGGCGCGGAA 132 6
UCAGUGCUGGCGUCAUGUCUCGAUGGGGAUUUUUCUUCAGCACUUUGCCA 133 7
UCUACUUUCCAUUUCUCUUUUCUUCUCACGAGCGGGUUUCCAGUGAACCA 134 8
CGAUAGUGACUACGAUGACGAAGGCCGCGGGUUGGAUGCCCGCAUUGA 135 10
GUCGAUACUGGCGACUUGCUCCAUUGGCCGAUUAACGAUUCGGUCAG 136 13
GUGCAAACUUAACCCGGGAACCGCGCGUUUCGAUCGACUUUCCUUUCCA 137 15
AUUCCGCGUUCCGAUUAAUCCUGUGCUCGGAAAUCGGUAGCCAUAGUGCA 138 16
CGAACGAGGAGGGAGUGGCAAGGGAUGGUUGGAUAGGCUCUACGCUCA 139 17
GCGAAACUGGCGACUUGCUCCAUUGGCCGAUAUAACGAUUCGGUUCAU 140 18
CGAACGAGGAGGGAGUCGCAAGGGAUGGUUGGAUAGGCUCUACGCUCAA 141 19
CGAGAAGUGACUACGAUGACGAAGGCCGCGGGUUGAAUCCCUCAUUGA 142 20
AAGCAACGAGACCUGACGCCUGAUGUGACUGUGCUUGCACCCGAUUCUG 143 21
GUGAUUCUCAUUCUCAAUGCUUUCUCACAACUUUUUCCACUUCAGCGUGA 144 22
AAGCAACGAGACUCGACGCCUGAUGUGACUGUGCUUGCACCCGAUUCU 145 23
UCGAUCGGUUGUGUGCCGGACAGCUUUGACCAUGAGCUGGGACCGAGGCC 146 24
NGACGNGUGGACCUGACUAAUCGACUGAUCAAAGAUCCCGCCCAGAUGGG 147 26
CACUGCGACUUGCAGAAGCCUUGUGUGGCGGUACCCCCUUUGGCCUCG 148 27
GGUGGCAUUUCUUCAUUUUCCUUCUCGCUUUCUCCGCCGUUGGGCGCG 149 29
CCUGAGUAGGGGGGAAAGUUGAAUCAGUUGUGGCGCUCUACUCAUUCGCC 150 30
GUCGAAACUGGCGACUUGCUCCAUUGGCCGAUAUAACGAUUCGGUUCA 151 31
GCGAUACUGGCGACUUGCUCCAUUGGCCGAUAUAACGAUUCGGCUCAG 152 32
ACGUGGGGCACAGGACCGAGAGUCCCUCCGGCAAUAGCCGCUACCCCACC 153 33
CACAGCCUNANAGGGGGGAAGUUGAAUCAGUUGUGGCGCUCUACUCAUUCGC 154 34
ANGGGNUAUGGUGACUUGCUCCAUUGGCCGAUAUAACGAUUCGGUCAG 155 35
CCUGCGUAGGGNGGGAAGUUGAAUCAGUUGUGGCGCUCUACUCAUUCGCC 156 39
CGAACGAGGAGGGAGUGGCAAGGGAUGGUUGGAUAGGCUCUACGCUCA 157 41
GUGCAAACUUAACCCGGGAACCGCGCGUUUCGAUUCGCUUUCCNUAUUCCA 158 42
CGAACGAGGAGGGAGUGGCAAGGGACGGUNNAUAGGCUCUACGCUCA 159 43
UCGGUGUGGCUCAGAAACUGACACGCGUGAGCUUCGCACACAUCUGC 160 44
UAUCGCUUUUCAUCAAUUCCACUUUUUCACUCUNUAACUUGGGCGUGCA 161 45
GUGCAAACUUAACCCGGGAACCGCGCGUUUCGAUCCUGCAUCCUUUUUCC 162 46
UCGNUCGGUUGUGUGCCGGCAGCUUUGUCCAGCGUUGGGCCGAGGCC 163 47
AGUACCCAUCUCAUCUUUUCCUUUCCUUUCUUCAAGGCACAUUGAGGGU 164 49
CCUGAGUAGGGGGGGAAGUUGAACCAGUUGUGGCNGCCUACUCAUUCNCCA 165 51
CCNNCCUNCUGUCGGCGCUUGUCUUUUUGGACGGGCAACCCAGGGCUC 166 52
CCAACCUNCUGUCGGCGCUUGUCUUUUUGGACGAGCAACUCAAGGCUCGU 167 53
CCAGCGCAGAUCCCGGGCUGAAGUGACUGCCGGCAACGGCCGCUCCA 168 54
UUCCCGUAACAACUUUUCAUUUUCACUUUUCAUCCAACCAGUGAGCAGCA 169 55
UAUCGCUUUCAUCAAAUUCCACUCCUUCACUUCUUUAACUUGGGCGUGCA 170
[0260]
14TABLE 14 Starting RNAs: 40N7:
5'GGGAGGACGAUGCGG[-40N-]CAGACGACUCGCCCGA 3' (SEQ ID NO: 186) SELEX
PCR Primers: 5G7: 5'TAATACGACTCACTATAGGGAGGACGATGC- GG 3' (SEQ ID
NO: 187) T7 Promoter 3G7: 5'TCGGGCGAGTCGTCTG 3' (SEQ ID NO:
188)
[0261]
15TABLE 15 Conditions and progress of the SELEX against hKGF net %
Signal/ B-Wash.sup.c U-Wash.sup.d [RNA], M [KGF], M bound noise
PF.sup.a Spin.sup.b (ml) (ml) SPKD.sup.e, M KD.sup.f, nM Round 1
1.00E-06 3.00E-07 4.4 11.8 4 5.61E-06 30.0 2 4.00E-06 3.00E-07 1.5
4.2 5 1.58E-05 3 1.00E-06 1.00E-07 5.9 20.6 5 8.52E-07 4 1.00E-06
1.00E-07 14.3 12.8 + 8 3.21E-06 17.0 5 3.00E-07 1.00E-08 2.5 4.5 +
8 7.64E-08 6 3.70E-08 3.70E-09 0.7 2.6 + + 15 15 3.73E-07 7
4.10E-09 4.10E-10 1.1 8.2 + + 20 20 2.46E-08 0.7 8 4.60E-10
4.60E-11 1.5 8.8 + + 25 25 2.04E-09 0.3 9 5.10E-11 5.10E-12 0.7 5.9
+ + 25 25 8.76E-10 10 1.70E-11 1.70E-12 0.3 2.1 + + 25 25 4.12E-10
2'F SELEX 1 1.00E-06 3.00E-07 2.9 11.0 4 3.39E-06 30.0 2 4.00E-06
3.00E-07 2.2 9.9 5 9.28E-06 3 3.00E-06 3.00E-07 5.7 5.7 5 2.15E-06
4 2.50E-06 3.00E-07 3.9 11.7 + 8 4.98E-06 15.0 5 6.70E-07 3.00E-08
2.3 5.8 + 8 3.64E-06 6 1.20E-08 1.23E-09 0.3 1.8 + + 15 15 1.59E-07
7 1.40E-09 1.40E-10 1.1 11.2 + + 20 20 6.86E-09 0.6 8 1.50E-10
1.50E-11 0.4 4.8 + + 25 25 5.36E-10 0.3 9 1.70E-11 1.70E-12 0.2 3.1
+ + 25 25 5.67E-10 10 1.70E-11 1.70E-12 0.3 3.0 + + 25 25 1.42E-10
.sup.aPrefiltered RNA through nitrocellulose to counter select for
nitrocellulose binding molecules .sup.bBrief spinning of the
binding reactions .sup.cVolume of buffer used to wash the captured
complexes .sup.dVolume of 0.5M urea wash following the buffer wash
.sup.eCalculated single point K.sub.D from the binding data at each
round .sup.fK.sub.D values obtained from binding curves
[0262]
16TABLE 16 Sequences of 2'-NH.sub.2 and 2'-F KGF ligands Clone 5'
constant random 3' constant SEQ ID NO: 2'-NH.sub.2 ligands: 1N
GGGAGGACGAUGCGG GAAGGGACGAUAAAGAGGAAUCGAACAACAAGUGGCUGGC
CAGACGACUCGCCCGA 189 2N GGGAGGACGAUGCGG
GCGGGAAGGUCCGAAGACCGGCGAAAGGAACGAGAUUGCC CAGACGACUCGCCCGA 190 4N
GGGAGGACGAUGCGG GUGGUGAAGAGGUACCGGAAUUGCUAAAGAUACCACGGCC
CAGACGACUCGCCCGA 191 6N GGGAGGACGAUGCGG
GCAGGGAGCAAUGAACUCAAGUCAAGCCGGUGCACGUGGG CAGACGACUCGCCCGA 192 10N
GGGAGGACGAUGCGG UAGCUGCUGUCAUGCAAGACACUAGAAGAUUAAGAUGGGG
CAGACGACUCGCCCGA 193 11N GGGAGGACGAUGCGG
GGGCCGGAUUUGAACCGACGACUUCGGGUUAUGAGCCCGACGU CAGACGACUCGCCCGA 194
14N GGGAGGACGAUGCGG UCCAGGGAUUGAAGUGUCGGGGUAGGAACAUAAAGGCGGC
CAGACGACUCGCCCGA 195 16N GGGAGGACGAUGCGG
AAGUUCUAACAAGUUAGUGGAAGGUUCCACUUGAAUGUA CAGACGACUCGCCCGA 196 22N
GGGAGGACGAUGCGG AUGGAGCUGAAAU CAGACGACUCGCCCGA 197 24N
GGGAGGACGAUGCGG GUGGGAAGAUGAGCCGGUCGGCAGUAAUGUGACACUGCGG
CAGACGACUCGCCCGA 198 25N GGGAGGACGAUGCGG
GAGGGAAUGAGGAAACAACUAGCAGAUAACCGAGCUGGC CAGACGACUCGCCCGA 199 27N
GGGAGGACGAUGCGG AUGGAGCUGAAAU CAGACGACUCGCCCGA 200 28N
GGGAGGACGAUGCGG UUGCUCUACAAUGACGCGGUGACUCCGCAGUUCUUGGACA
CAGACGACUCGCCCGA 201 29N GGGAGGACGAUGCGG
GAGGGGAGAAGAAUGCAGGAAACAGCGAAAUGCGUGUGGC CAGACGACUCGCCCGA 202 34N
GGGAGGACGAUGCGG GCGGGAAGAGCUAAUGGAAGUGGAAUCAGUCACAGUGCGG
CAGACGACUCGCCCGA 203 35N GGGAGGACGAUGCGG GCUUAGGGAAAUGGUUCUGAGGUGGU
CAGACGACUCGCCCGA 204 36N GGGAGGACGAUGCGG
GAAGGGAACAGGAUAAGACAAGUCGAACAAAGCCGAGGU- G CAGACGACUCGCCCGA 205 37N
GGGAGGACGAUGCGG AUGGAGCUGAAAU CAGACGACUCGCCCGA 206 42N
GGGAGGACGAUGCGG GGAGACGUAGACGGGAACAUAGAACGAACAUCAACGCGGC
CAGACGACUCGCCCGA 207 43N GGGAGGACGAUGCGG
GAAGUGGAUAGAACAGUCAGAAAUGUAAGCGUGAGGUG CAGACGACUCGCCCGA 208 47N
GGGAGGACGAUGCGG GAAGGGUAGGAAGGUCAAGAGGAAACAGCGCUUCGGGGUG
CAGACGACUCGCCCGA 209 48N GGGAGGACGAUGCGG
GGCAAAGGAAGUUGGAAUCGGGACUAAGUAGUGUGUGGC CAGACGACUCGCCCGA 210 54N
GGGAGGACGAUGCGG AGAACCAACAGAGCCCCCUGGUGGUGGGGGAAGGAUUCU
CAGACGACUCGCCCGA 211 55N GGGAGGACGAUGCGG
ACACACAAGUGAAGGUCAGACGCGAAUUACGUGGGUGGG CAGACGACUCGCCCGA 212 57N
GGGAGGACGAUGCGG UCGUGGGGUGGGUGGGGGCAGCGUUGGAAUAAGUAACUGGUAACGGCUGGC
CAGACGACUCGCCCGA 213 59N GGGAGGACGAUGCGG
GGUGGGUGGUUACCUGUAAUUAUAUUGAUUCUGGCUU- UAG CAGACGACUCGCCCGA 214 60N
GGGAGGACGAUGCGG CCCCUUAGCUCAGUGGUUAGAG CAGACGACUCGCCCGA 215 65N
GGGAGGACGAUGCGG UAACGUGGAAUAGGGUUAAACAGCUGGAAAUAACGUAGGUGGC
CAGACGACUCGCCCGA 216 69N GGGAGGACGAUGCGG
GUAGGGAGUAGGACAGACAUAACAGUGCAACCAUCGUGGC CAGACGACUCGCCCGA 217 71N
GGGAGGACGAUGCGG AAACGGCGUGGCAAAAGUGAGGGGGUAGGAUGUACCAUGGGU
CAGACGACUCGCCCGA 218 72N GGGAGGACGAUGCGG
GAGGGGAAAAUGAGACCGACAGAUUGACGGAAGUACUGGG CAGACGACUCGCCCGA 219 2'-F
ligands: 2F GGGAGGACGAUGCGG GCAUUCGUCAAUACCUUGUUUUAUUCC-
UUUUCUAGCGGCC CAGACGACUCGCCCGA 220 3F GGGAGGACGAUGCGG
AUCGUAAUCGCCACUACUACUUUCCGAACCCGCACGUGGC CAGACGACUCGCCCGA 221 5F
GGGAGGACGAUGCGG CGUCCCGAGUCACGCUGUCCUGAUAACCUUCUCUGUGCC
CAGACGACUCGCCCGA 222 6F GGGAGGACGAUGCGG
GAUCCUUUGUGGGCUCUUGUUGACCCCCUCGUUGUCCCCCC CAGACGACUCGCCCGA 223 7F
GGGAGGACGAUGCGG CGGGUACUCUUCGCCAGCUCCUCCAAGCGCGACCUGUGCC
CAGACGACUCGCCCGA 224 8F GGGAGGACGAUGCGG
UUUCGAAUAGGGCCAUUUCUCACUAGCUAUCCUACCCUGCC CAGACGACUCGCCCGA 225 9F
GGGAGGACGAUGCGG AUAAUGGCUAGAACUAGCUCGCAUCUUGGUGUCCGGUGCC
CAGACGACUCGCCCGA 226 10F GGGAGGACGAUGCGG
GACCAGAUGGCGGAUUUUUCAGCAAUCCUCCCCCGCUGCC CAGACGACUCGCCCGA 227 11F
GGGAGGACGAUGCGG UGAUGGCGACCAGUCAAACCGGUGCUUUUACUCCCCCGC
CAGACGACUCGCCCGA 228 12F GGGAGGACGAUGCGG
GAAUUAACAGGGCCAGAAUUCUCAUCUNNCUUCCCGUGACC CAGACGACUCGCCCGA 229 13F
GGGAGGACGAUGCGG CACCUUAGACCUGUCCUCCAAGCGUGAGUUGCUGUGGCC
CAGACGACUCGCCCGA 230 14F GGGAGGACGAUGCGG
UGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGGC CAGACGACUCGCCCGA 231 15F
GGGAGGACGAUGCGG UCAUGGUGUCUUUCCACAGCUCUUCCCAUGAUCGCCCGGC
CAGACGACUCGCCCGA 232 16F GGGAGGACGAUGCGG
GAAUUCCCAGCGCUUGACUGAUACAAACNUUCCCGUGCCC CAGACGACUCGCCCGA 233 19F
GGGAGGACGAUGCGG CAA-NNNNNNNCUCUCUCCUGGCGUUCCGCAACCCGCCCC
CAGACGACUCGCCCGA 234 20F GGGAGGACGAUGCGG
AGUAUUCCAGCCUGGAUUCAUAGUCAGUGCUCUCCGUGCC CAGACGACUCGCCCGA 235 21F
GGGAGGACGAUGCGG UCCUAGCAGCGAUUCAUCCCCGUUCUCUCAGCGUUGCCCC
CAGACGACUCGCCCGA 236 22F GGGAGGACGAUGCGG
CCUGAAGUACAGGCUCUAAACUCCAAGCGCGACCGUCCGC CAGACGACUCGCCCGA 237 23F
GGGAGGACGAUGCGG CCCUACCACUUUUUCCCUCUACUGUUAUCCUGUCCCC
CAGACGACUCGCCCGA 238 24F GGGAGGACGAUGCGG
UGGUCUCCCUAGAUCUACAGCACUUCCAUCGCAUUGGGC CAGACGACUCGCCCGA 239 26F
GGGAGGACGAUGCGG UCAAGCUUAACAGUCUGGCAAUGGCCAUUAUGGCGCCC
CAGACGACUCGCCCGA 240 27F GGGAGGACGAUGCGG
CaGUCUGGAUCUCUAUUGGAAUUUAGUCCUCAACUGUGCCC CAGACGACUCGCCCGA 241 28F
GGGAGGACGAUGCGG GAUUCUUUCGGCAAGUGAAAAAUAUCCUUGCUUCCCGAGC
CAGACGACUCGCCCGA 242 29F GGGAGGACGAUGCGG
GGACUUCAACUAAGUCCUCAUUUGCCUCGCUCCUCGUGCC CAGACGACUCGCCCGA 243 31F
GGGAGGACGAUGCGG AACGGAGAUGUCCCCUCAAMAUUUACCGUCUCCGUUUGCGCCC
CAGACGACUCGCCCGA 244 35F GGGAGGACGAUGCGG
CGAAAUUAGCUUCUUAUGACUCACGUUUCCUUGCCGCCC CAGACGACUCGCCCGA 245 37F
GGGAGGACGAUGCGG GCCCGAUCUACUGCAUUACCGAAACGAUUUCCCCACUGUG
CAGACGACUCGCCCGA 246 38F GGGAGGACGAUGCGG
NGACUGAUUUUUCCUUGNCAGUGUAAUUUCCUGGCUGCCC CAGACGACUCGCCCGA 247 41F
GGGAGGACGAUGCGG GGACUUUGACAGGCAUUGAUUUCGACCUGUUCCCCGUGGC
CAGACGACUCGCCCGA 248 42F GGGAGGACGAUGCGG
CGACACAAUAGCCUUUGAUCCCAUGAUGGCUCGCCGUGCC CAGACGACUCGCCCGA 249 43F
GGGAGGACGAUGCGG UGUAGUUUCCCUGUAUGCCAUUCUUUCCCAUGCCGCACGC
CAGACGACUCGCCCGA 250 44F GGGAGGACGAUGCGG
UCGAGUGUUCUCCUUCGGUAACUAUUNNNNAUUUCGUGCC CAGACGACUCGCCCGA 251 45F
GGGAGGACGAUGCGG GUCGUAUUCAUCUCCUUGUUCUGUUUCGUUGCACCUGGCC
CAGACGACUCGCCCGA 252 49F GGGAGGACGAUGCGG
GGACUUUGACAGGCaUUGAUUUCGACGUGUUCCCCGUGGC CAGACGACUCGCCCGA 253 50F
GGGAGGACGAUGCGG UGAUCAAUCGGCGCUUUACUCUUGCGCUCACCGUGCCC
CAGACGACUCGCCCGA 254 51F GGGAGGACGAUGCGG
CAGUCUCCCUAGGUUUCAUCUCUGCAGCAUUCCGGGGUNC CAGACGACUCGCCCGA 255 53F
GGGAGGACGAUGCGG AUCAAAAGCACUCAUUCCCGUGCUCGCUUCAUUGGUCCCC
CAGACGACUCGCCCGA 256 54F GGGAGGACGAUGCGG
AAGAUCUCCCAACUGCUGUGGCUAAUAAUUCUCUCCGCGUCCC CAGACGACUCGCCCGA 257
55F GGGAGGACGAUGCGG UCCGUCAUAACGGCCAUAAACUGCGAAUACUCCCUGGCC
CAGACGACUCGCCCGA 258 56F GGGAGGACGAUGCGG
GGACAAWYAGCGGUGUCUUUUCAUUUNKAUCCUCCGACRUCC CAGACGACUCGCCCGA 259 57F
GGGAGGACGAUGCGG UGACUAUCUGGCUCGAUCCAAUCACCCGAGCCCACCGCGC
CAGACGACUCGCCCGA 260 58F GGGAGGACGAUGCGG
GAACUAAUGGCCGUGAUUAACCAAUGCAGGCUUCCUGCGC CAGACGACUCGCCCGA 261 60F
GGGAGGACGAUGCGG UGACAUGGAAUUUUCUACGGGCCCGAUCCUGCCAGCCGUGUG
CAGACGACUCGCCCGA 262
[0263]
17TABLE 17 K.sub.d values hKGF ligands K.sub.d in nM K.sub.d in nM
Clone 1 2 Clone 1 2 1N 0.51 2F 1.77 2N 0.77 3F 4.47 4N 0.75 5F 2.53
6N 0.71 6F 0.05 (37) 3.25 10N 1.10 7F 3.69 11N 1.28 8F 2.63 14N
0.44 9F 0.83 16N 1.40 10F 0.47 22N 5.70 11F 3.74 24N 1.16 12F 1.38
25N 0.87 13F 0.03 (28) 27N ND 14F 0.006-0.03 (25-44) 28N 2.54 15F
0.07 (33) 29N 0.43 16F 0.83 (49) 3.39 34N 0.80 19F 1.6 0.94-2.57
35N 2.32 20F 2.05 8.70 36N 8.27 21F ND 44.8 37N ND 22F 2.75 42N
0.78 23F 2.52 43N 0.79 24F 2.02 47N 1.76 26F 0.23 (43) 2.55 48N
1.34 27F 1.52 54N 5.35 28F ND 55N 1.25 29F 3.24 57N 35.8 31F 1.0
59N 22.0 35F 1.1 60N 7.38 37F 0.46 65N 26.56 38F 0.33 69N 15.20 41F
1.44 71N 3.52 42F 0.9 72N 7.67 43F 1.13 random 30 44F 1.32 45F 4.7
49F 1.0 50F 0.12 (21) 2.10 51F 1.27 53F 0.70 54F 1.23 55F 2.52 56F
0.07 (32) 3.00 57F 1.20 58F 2.52 60F 2.10 random 30 For biphasic
curves, Kd1 is for the high affinity component. Number in
parentheses indicate the per cent of the high affinity
component.
[0264]
18TABLE 18 Binding Specificity of the 2'-F Ligand K14F Ratio:
Target K.sub.DTarget/K.sub.DhKGF human hKGF 1 rat hKGF 1,254 human
aFGF 38,650 human bFGF 1,071 human PDGF 432 The ratios shown are
averages of at least two determinations
[0265]
19TABLE 19 IC.sub.50 values from the PC-3 assay Competitor IC50, nM
hKGF 70 Heparin, 5,000 30 40N7F >1000 K6F 4 K13F 30 K14F 10 K15F
20 K56F 1 K10F 30 K37F 20 K38F 0.6 K43F 80 40N7N >1000 K1N 50
K2N 200 K4N 70 K6N 80 K14N 6 K29N 40 K42N 800 K43N 800
[0266]
20TABLE 20 Ki values of hKGF competitors on the PC3 and
NIH3T3/FGFR-2 competition assay Cell line Competitor Ki, nM R PC-3
hKGF 7.700 0.95519 2'F random 930.000 0.99713 2'NH.sub.2 random
673.000 0.85357 Hep5000 6.500 0.99984 K14F 0.200 0.97735 K6F 0.160
0.95927 K38F 0.220 0.99013 K56F 0.160 0.95927 K14N 1.400 0.94698
NIH3T3/FGFR-2 hKGF 0.034 0.9933 2'F random >10,000.000
2'NH.sub.2 random >10,000.000 Hep5000 26.300 0.97856 partial
comp. K14F 2.700 0.99047 K6F 6.800 0.96202 K38F 20.000 0.98659 K56F
27.400 0.97582 K14N 10.600 0.97856 partial comp.
[0267]
21TABLE 21 IC50 values obtained with the gel shift assay Competitor
IC50, nM KGF 70 bFGF 1,500 Lysozyme 10,000
[0268]
22TABLE 22 Binding Specificity of Ligand K14F3'T random RNA K14F3'T
.sup.aK.sub.d1, K.sub.d1, Protein nM .sup.bK.sub.d2, nM nM
K.sub.d2, nM .sup.cDF hKGF 20.1 0.0008 10.2 1 rKGF 45.3 0.0041 70.0
5 hbFGF 0.0375 10.3 10.0 1.2 .times. 10.sup.4 haFGF 16,000,000
24,000,000 3 .times. 10.sup.10 hPDGF-AB 22.0 50.0 6.2 .times.
10.sup.4 hTGF.beta.1 10.4 98.0 1.2 .times. 10.sup.5 hEGF 2,000 256
3.2 .times. 10.sup.5 Thrombin 7,200,000 22,700,000 2.8 .times.
10.sup.10 .sup.aHigh affinity dissociation constant from biphasic
binding curves. .sup.bLow affinity dissociation constant from
biphasic binding curves or affinity dissociation constant from
monophasic binding curves. .sup.cDiscrimination factor defined as
the ratio of the highest affinity K.sub.d of 14F3'T for the
corresponding protein over the affinity K.sub.d for hKGF.
[0269]
23 TABLE 23 SEQ ID NO: S1 L1 S2 S1' L3 S2' 143'T
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUAAA-
CUUUCU.vertline.CCAUCGUAUC 272 H L T2
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUAAA-
CUUUCU.vertline.CCAUCGUA.. - + 273 T3
GGGAGG.vertline.AC.vertline...UGCGGUGG.vertline.UCUCCC.vertline.AAUUCUAAA-
CUUUCU.vertline.CCAUCGUA.. - - 274 T4
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.....CUAAA-
CUUUCU.vertline.CCAUCGUAUC + + 275 T5
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC + + 276 T6
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUAAA-
CU.....vertline.CCAUCGUAUC .+-. + 277 T7
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUU...AA-
CU.....vertline.CCAUCGUAUC - - 278 T8
..GAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUAAA-
CUUUCU.vertline.CCAUCGUAUC - + 279 T10
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUU.....-
..UUCU.vertline.CCAUCGUAUC - - 280 T11
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
.......vertline.CCAUCGUAUC - - 281 T12
.GGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 282 T13
.GGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCC..vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 283 T14
..GAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 284 T15
..GAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUC...vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 285 T16
GGGAGG.vertline..C.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - .+-. 286 T18
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
...UCU.vertline.CCAUCGUAUC + + 287 T19
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
....CU.vertline.CCAUCGUAUC - - 288 T20
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
.....U.vertline.CCAUCGUAUC - - 289 T21
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCU...-
..UUCU.vertline.CCAUCGUAUC + + 290 T22
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUC....-
..UUCU.vertline.CCAUCGUAUC + + 291 T29
GGG.G..vertline.AC.vertline.GAUGCGGUGG.vertline..C.CCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 292 T30
GGG....vertline.AC.vertline.GAUGCGGUGG.vertline....CCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 293 T31
.....G.vertline.AC.vertline.GAUGCGGUGG.vertline....CCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 294 T32
....GG.vertline.AC.vertline.GAUGCGGUGG.vertline....CCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 295 T33
.......vertline....vertline.GAUGCGGUGG.vertline....CCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 296 T34
.......vertline....vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 297 T35
.......vertline....vertline......GGUGG.vertline.UCUCCC.vertline.AAUUCUA..-
..UUCU.vertline.CCAUCGUAUC - - 298 T36
GGGAGG.vertline.AC.vertline.GAUG.......vertline........vertline..........-
.......vertline........... - - 299 T37
GGGAGG.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUC....-
...UCU.vertline.CCAUCGUAUC - - 300 T39
GGGAGG.vertline.AC.vertline.GAUGCGGUG..vertline.UCUCCC.vertline.AAUUC....-
..UUCU.vertline..CAUCGUAUC - - 301 T40
GGGAGG.vertline.AC.vertline.GAUGCGG.GG.vertline.UCUCCC.vertline.AAUUC....-
..UUCU.vertline.CC.UCGUAUC - - 302 T41
GGGAGG.vertline.AC.vertline.GAUGCGG.G..vertline.UCUCCC.vertline.AAUUC....-
..UUCU.vertline..C.UCGUAUC - - 303 T22mu
GGGAGU.vertline.AC.vertline.GAUGCGGUGG.vertline.UCUCCC.vertline.AAUUC....-
..UUCU.vertline.CCAUCGUAUC - - 304 T35/36 equimolar amounts of T35
and T36 - -
[0270]
Sequence CWU 1
1
* * * * *