U.S. patent application number 10/083259 was filed with the patent office on 2003-09-18 for modified peptide nucleic acid (pna) molecules.
This patent application is currently assigned to Pantheco A/S and Peter E. Nielsen. Invention is credited to Beck, Frederik, Giwercman, Birgit Kjaeldgaard, Good, Liam, Hansen, Henrik Frydenlund, Malik, Leila, Nielsen, Peter E., Schou, Carsten, Wissenbach, Margit.
Application Number | 20030176325 10/083259 |
Document ID | / |
Family ID | 46149889 |
Filed Date | 2003-09-18 |
United States Patent
Application |
20030176325 |
Kind Code |
A1 |
Nielsen, Peter E. ; et
al. |
September 18, 2003 |
Modified peptide nucleic acid (PNA) molecules
Abstract
The present invention relates to novel drugs which may be used
in combating infectious micro-organisms, particularly bacteria.
More specifically, the invention relates to peptide nucleic acid
(PNA) sequences that are modified by conjugating cationic peptides
to the PNA moiety in order to obtain novel PNA molecules that
exhibit enhanced anti-infective properties
Inventors: |
Nielsen, Peter E.;
(Kokkedal, DK) ; Good, Liam; (Stockholm, SE)
; Hansen, Henrik Frydenlund; (Rodovre, DK) ; Beck,
Frederik; (Frederiksberg C, DK) ; Malik, Leila;
(Copenhagen NV, DK) ; Schou, Carsten; (Holte,
DK) ; Wissenbach, Margit; (Copenhagen N, DK) ;
Giwercman, Birgit Kjaeldgaard; (Charlottenlund, DK) |
Correspondence
Address: |
Woodcock Washburn LLP
One Liberty Place - 46th Floor
Philadelphia
PA
19103
US
|
Assignee: |
Pantheco A/S and Peter E.
Nielsen
|
Family ID: |
46149889 |
Appl. No.: |
10/083259 |
Filed: |
October 19, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10083259 |
Oct 19, 2001 |
|
|
|
09689155 |
Oct 12, 2000 |
|
|
|
60159684 |
Oct 15, 1999 |
|
|
|
60211758 |
Jun 14, 2000 |
|
|
|
60159679 |
Oct 15, 1999 |
|
|
|
60211878 |
Jun 14, 2000 |
|
|
|
60211435 |
Jun 14, 2000 |
|
|
|
Current U.S.
Class: |
514/3.2 ;
514/1.3; 514/20.9; 530/322 |
Current CPC
Class: |
C12N 2310/3181 20130101;
A61K 38/00 20130101; A61K 47/62 20170801; C12N 2310/33 20130101;
C12N 15/113 20130101; C12N 2310/152 20130101; C12N 2310/3233
20130101; A61L 2/0082 20130101; C12N 2310/323 20130101; C12N
2310/3513 20130101 |
Class at
Publication: |
514/8 ;
530/322 |
International
Class: |
A61K 048/00; C07K
009/00 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 13, 1999 |
DK |
PA 1999 01467 |
Oct 13, 1999 |
DK |
PA 1999 01471 |
Dec 3, 1999 |
DK |
PA 1999 01735 |
Dec 3, 1999 |
DK |
PA 1999 01734 |
Mar 28, 2000 |
DK |
PA 2000 00522 |
Apr 19, 2000 |
DK |
PA 2000 00671 |
Apr 19, 2000 |
DK |
PA 2000 00670 |
Claims
We claim:
1. A modified oligonucleotide having formula (III):
Peptide-L-Oligon (III) wherein L is a linker or a bond, Peptide is
any amino acid sequence, and Oligon is an oligonucleotide or analog
thereof.
2. A composition comprising the modified oligonucleotide of claim 1
or a pharmaceutically acceptable salt thereof.
3. The composition of claim 2 further comprising an antibiotic.
4. The modified oligonucleotide of claim 1 wherein L comprises at
least one of the following: 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate
(SMCC), 6-aminohexanoic acid (AHEX), 4-aminobutyric acid,
4-aminocyclohexylcarboxylic acid, polyethylene glycol, any amino
acid, or any combination thereof.
5. A modified peptide nucleic acid (PNA) molecule having formula
(I): Peptide-L-PNA (I) wherein L is a linker or a bond, Peptide is
any amino acid sequence, and PNA is a peptide nucleic acid.
6. The modified PNA molecule of claim 5 wherein Peptide is a
cationic peptide or peptide analog or a functionally similar moiety
having formula (II): C-(B-A).sub.n-D, (II) wherein: A is from 1 to
8 non-charged amino acids and/or amino acid analogs; B is from 1 to
3 positively charged amino acids and/or amino acid analogs; C is
from 0 to 4 non-charged amino acids and/or amino acid analogs; D is
from 0 to 3 positively charged amino acids and/or amino acid
analogs; and n is 1-10; wherein the total number of amino acids
and/or amino acid analogs is from 3 to 20.
7. The modified PNA molecule of claim 5 wherein L comprises at
least one of the following: 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate
(SMCC), 6-aminohexanoic acid (AHEX), 4-aminobutyric acid,
4-aminocyclohexylcarboxylic acid, polyethylene glycol, any amino
acid, or any combination thereof.
8. The modified PNA molecule of claim 7 wherein L comprises a
combination of .beta..ALA or ADO and any one of SMCC, AHEX,
4-aminobutyric acid, 4-aminocyclohexylcarboxylic acid, polyethylene
glycol, and any amino acid.
9. The modified PNA molecule of claim 8 wherein L is selected from
the group consisting of: -achc-.beta..ala-, -achc-ado-,
-lcsmcc-.beta..ala-, -mbs-.beta..ala-, -emcs-.beta..ala-,
-lcsmcc-ado-, -mbs-ado-, -emcs-ado- or -smph-ado-.
10. The modified PNA molecule of claim 5 wherein A comprises from 1
to 6 non-charged amino acids and/or amino acid analogs and B
comprises 1 or 2 positively charged amino acids and/or amino acid
analogs.
11. The modified PNA molecule of claim 10 wherein A comprises from
1 to 4 non-charged amino acids and/or amino acid analogs.
12. The modified PNA molecule of claim 5 wherein the positively
charged amino acids and amino acid analogs are selected from the
group consisting of lysine, arginine, diamino butyric acid (DAB)
and ornithine.
13. The modified PNA molecule of claim 5 wherein the non-charged
amino acids and amino acid analogs are selected from the group
consisting of Ala, Val, Leu, Ile, Pro, Phe, Trp, Met, Gly, Ser,
Thr, Cys, Tyr, Asn, Gln and the non-naturally occurring amino acids
2-aminobutyric acid, .beta.-cyclohexylalanine,
4-chlorophenylalanine, norleucine, and phenylglycine.
14. The modified PNA molecule of claim 5 wherein the non-charged
amino acids and amino acid analogs are selected from the group
consisting of Ala, Val, Leu, Ile, Pro, Phe, Trp, Met and the
non-naturally occurring non-polar amino acids
.beta.-cyclohexylalanine, 4-chlorophenylalanine, and
norleucine.
15. The modified PNA molecule of claim 5 wherein the total number
of amino acids and/or amino acid analogs is 15 or less.
16. The modified PNA molecule of claim 5 wherein the total number
of amino acids and/or amino acid analogs is 12 or less.
17. The modified PNA molecule of claim 5 wherein the total number
of amino acids and/or amino acid analogs is 10 or less.
18. The modified PNA molecule of claim 5 wherein the Peptide is
(KFF).sub.3K (SEQ ID NO: 161) or subunits thereof comprising at
least 3 amino acids.
19. The modified PNA molecule of claim 18 wherein the Peptide is
(KFF).sub.3 (SEQ ID NO: 1.
20. The modified PNA molecule of claim 5 wherein the Peptide is
selected from the group consisting of FFRFFRFFR (SEQ ID NO: 6),
LLKLLKLLK (SEQ ID NO: 7), LLRLLRLLR (SEQ ID NO: 8), LLKKLAKAL (SEQ
ID NO: 9), KFKVKFVVKK (SEQ ID NO: 1), LLKLLLKLLLK (SEQ ID NO: 12),
LLKKLAKALK (SEQ ID NO: 13), RRLFPWWWPFRRVC (SEQ ID NO: 14),
GRRWPWWPWKWPLIC (SEQ ID NO: 15), LVKKVATTLKKIFSKWKC (SEQ ID NO:
16), KKFKVKFVVKKC (SEQ ID NO: 17), and any subunit thereof
comprising at least 3 amino acids, wherein at least one amino acid
is a positively charged amino acid.
21. A modified PNA molecule comprising:
30 H-KFFKFFKFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 24)
H-FFKFFKFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 25)
H-FKFFKFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 26)
H-KFFKLFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 27)
H-FFKFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 28)
H-FKFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 29)
H-KFFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 30)
H-FFK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 31)
H-FK-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 32)
H-K-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 33)
H-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 34)
H-KFFKFFKFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 35)
H-FFKFFKFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 36)
H-FKFFKFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 37)
H-KFFKFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 38)
H-FFKFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 39)
H-FKFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 40)
H-KFF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 41)
H-FF-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 42)
H-F-ado-CATAGCTGTTTC-NH.sub.2, (SEQ ID NO: 43) H-KFFKFFKFFK-ado-TTC
AAA CAT AGT-NH.sub.2, (SEQ ID NO: 18) H-KFFKFFKFFK-ado-TGA CTA GAT
GAG-NH.sub.2, (SEQ ID NO: 44) H-KFFKFFKFFK-ado-CCA TCT AAT
CCT-NH.sub.2, (SEQ ID NO: 45) H-FFKFFKFFK-GGC-smcc-ado-TTC AAA CAT
AGT-NH.sub.2, (SEQ ID NO: 53) H-FFRFFRFFR-GGC-smcc-ado-TTC AAA CAT
AGT-NH.sub.2, (SEQ ID NO: 54) H-LLKLLKLLK-GGC-Smcc-ado-TTC AAA CAT
AGT-NH.sub.2, (SEQ ID NO: 55) H-LLRLLRLLR-GGC-smcc-ado-TT- C AAA
CAT AGT-NH.sub.2, (SEQ ID NO: 56) H-LLKKLAKALK-GC-smcc-ado-TTC AAA
CAT AGT-NH.sub.2, (SEQ ID NO: 57) H-KRRWPWWPWKK-C-smcc-ado-TTC AAA
CAT AGT-NH.sub.2, (SEQ ID NO: 58) H-KFKVKFVVKK-GC-smcc-ado-TTC AAA
CAT AGT-NH.sub.2, (SEQ ID NO: 59) H-LLKLLLKLLLK-C-smcc-ado-TTC AAA
CAT AGT-NH.sub.2, (SEQ ID NO: 60) H-FFKFFKFFK-GGC-Smcc-ado-TT- C
AAA CAT AGT-NH.sub.2, (SEQ ID NO: 61) H-KFFKFFKFFK-C-smcc-ado-TTC
AAA CAT AGT-NH.sub.2, (SEQ ID NO: 62) H-F-ado-CCA TCT AAT
CCT-NH.sub.2, (SEQ ID NO: 63) H-FF-ado-CCA TCT AAT CCT-NH.sub.2,
(SEQ ID NO: 64) H-KFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 65)
H-FKFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 66)
H-FFKFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 67)
H-KFFKFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 68)
H-FKFFKFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 69)
H-FFKFFKFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 70)
H-KFFKFFKFF-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 71)
H-LLKKLAKALKG-ahex-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 21)
H-LLKKLAKALKG-ado-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 72)
H-KFFKFFKFFK-ado-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID NO: 73)
H-KFFKFFKFFK-ahex-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ JD NO: 74)
H.sub.2N-KFFKFFKFFK-C-smcc-ado-CCA TCT AAT CCT-NH.sub.2, (SEQ ID
NO: 75) H.sub.2N-LLKKLAKALK-GC-smcc- -ado-CCA TCT AAT CCT-NH.sub.2,
(SEQ ID NO: 76) H.sub.2N-KFFKFF-C-smcc-ado-CCA TCT AAT
CCT-NH.sub.2, (SEQ ID NO: 77) H-ado-TTC AAA CAT AGT-NH.sub.2, (SEQ
ID NO: 78) H.sub.2N-KFFKVKFVVKK-C-smcc-ado-TTC AAA CAT
AGT-NH.sub.2, (SEQ ID NO: 79) H.sub.2N-KFFKVKFVVKK-C-smcc-ado-TTG
TGC CCC GTC-NH.sub.2, (SEQ ID NO: 80) H.sub.2N-KKFKVKFVVKKC-achc--
.beta..ala-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 81)
H-KFFKFFKFFK-achc-.beta..ala-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 82)
H.sub.2N-KKFKVKFVVKKC-lcsmcc-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO:
83) H.sub.2N-KKFKVKFVVKKC-mbs-ado-TTCAAACATAGT-NH.sub- .2, (SEQ ID
NO: 84) H.sub.2N-KKFKVKFVVKKC-emcs-ado-TTCAAAC- ATAGT-NH.sub.2,
(SEQ ID NO: 85) H.sub.2N-KKFKVKFVVKKC-smph-
-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 86)
H.sub.2N-KKFKVKFVVKKC-amas-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO:
87) H.sub.2N-KKFKVKFVVKKC-smpb-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID
NO: 88) H.sub.2N-KKFKVKFVVKKC-lcsmcc-gly-TTCAAACATAGT-NH.- sub.2,
(SEQ ID NO: 89) H.sub.2N-KKFKVKFVVKKC-lcsmcc-.beta.-
.ala-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 90)
H.sub.2N-KKFKVKFVVKKC-lcsmcc-.beta..cypr-TTCAAACATAGT-NH.sub.2,
(SEQ ID NO: 91) H.sub.2N-KKFKVKFVVKKC-lcsmcc-aha-TTCAAACATAGT-NH.-
sub.2, (SEQ ID NO: 92) H.sub.2N-KKFKVKFVVKKC-Icsmcc-adc-TT-
CAAACATAGT-NH.sub.2, (SEQ ID NO: 93)
H-KFFKFFKFFK-ado-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 94)
H-KFFKFFKFFK-ado-Gly-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 95)
H-KFFKFFKFFK-ado-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 96)
H-KFFKFFKFFK-ado-aha-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 97)
H-KFFKFFKFFK-ado-.beta..ala-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 98)
H-KFFKFFKFFK-ado-achc-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 99)
H-KFFKFFKFFK-Gly-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 100)
H-KFFKFFKFFK-Gly-Gly-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 101)
H-KFFKFFKFFK-Gly-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 102)
H-KFFKFFKFFK-Gly-aha-TTCAAACATAGT-NH.sub- .2, (SEQ ID NO: 103)
H-KFFKFFKFFK-Gly-.beta..ala-TTCAAACAT- AGT-NH.sub.2, (SEQ ID NO:
104) H-KFFKFFKFFK-Gly-achc-TTCAA- ACATAGT-NH.sub.2, (SEQ ID NO:
105) H-KFFKFFKFFK-P-ado-TTCA- AACATAGT-NH.sub.2, (SEQ ID NO: 106)
H-KFFKFFKFFK-P-Gly-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 107)
H-KFFKFFKFFK-P-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 108)
H-KFFKFFKFFK-P-aha-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 109)
H-KFFKFFKFFK-P-.beta..ala-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 110)
H-KFFKFFKFFK-P-achc-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 111)
H-KFFKFFKFFK-aha-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 112)
H-KFFKFFKFFK-aha-Gly-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 113)
H-KFFKFFKFFK-aha-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 114)
H-KFFKFFKFFK-aha-aha-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 115)
H-KFFKFFKFFK-aha-.beta..ala-TTCAAACATAGT-NH.s- ub.2, (SEQ ID NO:
116) H-KFFKFFKFFK-aha-achc-TTCAAACATAGTN- H.sub.2, (SEQ ID NO: 117)
H-KFFKFFKFFK-.beta..ala-ado-TTCA- AACATAGT-NH.sub.2, (SEQ ID NO:
118) H-KFFKFFKFFK-.beta..ala-Gly-TTCAAACATAGT-NH.sub.2, (SEQ ID NO:
119) H-KFFKFFKFFK-.beta..ala-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO:
120) H-KFFKFFKFFK-.beta..ala-aha-TTCAAACATAGT-NH.sub.2, (SEQ ID NO:
121) H-KFFKFFKFFK-.beta..ala-.beta..ala-TTCAA- ACATAGT-NH.sub.2,
(SEQ ID NO: 122) H-KFFKFFKFFK-.beta..ala-
-achc-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 123)
H-KFFKFFKFFK-P-p-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 124)
H-KFFKFFKFFK-P-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 125)
H-KFFKFFKFFK-K-K-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 126)
H-KFFKFFKFFK-F-F-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 127)
H-KFFKFFKFFK-F-K-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 128)
H-KFFKFFKFFK-K-F-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 129)
H-KFFKFFKFFK-phg-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 130)
H-KFFKFFKFFK-phg-Gly-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 131)
H-KFFKFFKFFK-phg-P-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 132)
H-KFFKFFKFFK-phg-aha-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 133)
H-KFFKFFKFFK-phg-.beta..ala-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 134)
H-KFFKFFKFFK-phg-achc-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 135)
H-KFFKFFKFFK-achc-ado-TTCAAACATAGT-NH.sub.2, (SEQ ID NO: 136)
H-KFFKFFKFFK-achc-Gly-TTCAAACATAGT-NH.su- b.2, (SEQ ID NO: 137)
H-KFFKFFKFFK-achc-P-TTCAAACATAGT-NH.- sub.2, (SEQ ID NO: 138)
H-KFFKFFKFFK-achc-aha-TTCAAACATAGT- -NH.sub.2, (SEQ ID NO: 139)
H-KFFKFFKFFK-achc-.beta..ala-T- TCAAACATAGT-NH.sub.2, or (SEQ ID
NO: 140) H-KFFKFFKFFK-achc-achc-TTCAAACATAGT-NH.sub.2. (SEQ ID NO:
141)
22. The modified PNA molecule of claim 5 wherein the PNA sequence
is complementary to at least one nucleotide sequence in a
bacterium.
23. The modified PNA molecule of claim 22 wherein the PNA sequence
is complementary to at least one ribosomal RNA sequence, messenger
RNA sequence, or DNA sequence in said bacterium.
24. The modified PNA molecule of claim 5 wherein the PNA sequence
is in a parallel or anti-parallel orientation.
25. The modified PNA of claim 22 wherein said at least one
nucleotide sequence is essential for the survival of said bacterium
and said PNA sequence inhibits the function of said at least one
nucleotide sequence.
26. The modified PNA molecule of claim 5 wherein said PNA sequence
comprises from 5 to 20 nucleobases.
27. The modified PNA molecule of claim 5 wherein said PNA sequence
comprises from 7 to 15 nucleobases.
28. The modified PNA molecule of claim 5 wherein said PNA sequence
comprises from 8 to 12 nucleobases.
29. A modified PNA molecule comprising:
31 H-KFFKFFKFF-ado-JTJTJJT-ado-ado-ado-TCCCTCTC-Lys-NH.sub.2, (SEQ
ID NO: 22) H-KFF-ado-JTJTJJT-ado-ado-ado-TCCTCTC-Lys-NH.- sub.2,
(SEQ ID NO: 46) H-FKFF-ado-JTJTJJT-ado-ado-ado-TCCT-
CTC-Lys-NH.sub.2, (SEQ ID NO: 47) H-FFKFF-ado-JTJTJJT-ado--
ado-ado-TCCTCTC-Lys-NH.sub.2, (SEQ ID NO: 48)
H-KFFKFF-ado-JTJTJJT-ado-ado-ado-TCCTCTC-Lys-NH.sub.2, (SEQ ID NO:
49) H-FKFFKFF-ado-JTJTJJT-ado-ado-ado-TCCTCTC-Lys-NH.sub.2, (SEQ ID
NO: 50) H-FFKFFKFF-ado-JTJTJJT-ado-ado-ado-TCCTCTC-Lys- -NH.sub.2,
or (SEQ ID NO: 51) H-KFFKFFKFF-ado-JTJTJJT-ado--
ado-ado-TCCTCTC-Lys-NH.sub.2. (SEQ ID NO: 52)
30. A composition comprising the modified PNA molecule of claim 5
or a pharmaceutically acceptable salt thereof.
31. The composition of claim 30 further comprising an
antibiotic.
32. A composition comprising two or more modified PNA molecules of
claim 5 or pharmaceutically acceptable salts thereof.
33. The composition of claim 32 further comprising an
antibiotic.
34. A method of treating an infectious disease in a mammal
comprising administering an effective amount of a modified PNA
molecule of claim 5 to said mammal.
35. The method of claim 34 wherein said infectious disease is a
bacterial infection.
36. A method of treating an infectious disease in a mammal
comprising administering an effective amount of modified
oligonucleotide of claim 1 to said mammal.
37. The method of claim 36 wherein said infectious disease is a
bacterial infection.
38. A method of treating an infectious disease in a mammal
comprising administering an effective amount of a composition of
claim 30 to said mammal.
39. A method of treating an infectious disease in a mammal
comprising administering an effective amount of a composition of
claim 32 to said mammal.
40. A method of identifying a PNA sequence in a PNA molecule useful
for inhibiting or reducing growth of at least one bacterium
comprising: contacting a first bacterium with a first modified PNA
molecule of claim 5 having a first PNA sequence, wherein said PNA
sequence is complementary to at least one nucleotide sequence in
said first bacterium; contacting a second bacterium with a second
modified PNA molecule of claim 5 having a second PNA sequence,
wherein said PNA sequence is complementary to at least one
nucleotide sequence in said second bacterium; and identifying which
PNA sequence is more effective in inhibiting or reducing growth of
said bacterium.
41. The method of claim 40 wherein said first and second PNA
molecules are identical except for said PNA sequence, and said
first and second bacterium are the same species.
42. A method for disinfecting a non-living object comprising
contacting said object with a modified oligonucleotide of claim
1.
43. A method for disinfecting a non-living object comprising
contacting said object with a modified PNA molecule of claim 5.
44. A method for disinfecting a non-living object comprising
contacting said object with a composition comprising a modified
oligonucleotide of claim 1.
45. A method for disinfecting a non-living object comprising
contacting said object with a composition comprising a modified PNA
molecule of claim 5.
46. The method of claim 42 wherein said object is a surgery tool,
hospital inventory, dental tool, slaughterhouse inventory,
slaughterhouse tool, dairy inventory, or dairy tool.
47. The method of claim 43 wherein said object is a surgery tool,
hospital inventory, dental tool, slaughterhouse inventory,
slaughterhouse tool, dairy inventory, or dairy tool.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to Danish Application No.
PA 1999 01467 filed Oct. 13, 1999; U.S. Provisional Application No.
60/159,684 filed Oct. 15, 1999; Danish Application No. PA 1999
01735 filed Dec. 3, 1999; Danish Application No. PA 2000 00522
filed Mar. 28, 2000; U.S. Provisional Application No. 60/211,758
filed Jun. 14, 2000; Danish Application No. PA 1999 01471 filed
Oct. 13, 1999; U.S. Provisional Application No. 60/159,679 filed
Oct. 15, 1999, Danish Application No. PA 1999 01734 filed Dec. 3,
1999; Danish Application No. PA 2000 00670 filed Apr. 19, 2000;
U.S. Provisional Application No. 60/211,878 filed Jun. 14, 2000;
Danish Application No. PA 2000 00671 filed Apr. 19, 2000; and U.S.
Provisional Application No. 60/211,435 filed Jun. 14, 2000, each of
which are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to novel drugs for use in
combating, for example, infectious microorganisms, particularly
bacteria. More specifically, the invention relates to peptide
nucleic acid (PNA) sequences that are modified in order to obtain
novel PNA molecules which exhibit enhanced anti-infective
properties.
BACKGROUND OF THE INVENTION
[0003] The discovery of penicillin in the 1940's marked the
beginning of the search for new antibiotics. Many antibiotics have
been discovered or developed from existing drugs, and the number of
antibiotic drugs currently used by clinicians is more than 100.
Many strains of bacteria have, unfortunately, become resistant to
one or more of the currently available antibiotics.
[0004] Most antibiotics are products of natural microbic
populations and resistant traits found in these populations can
disseminate between species and appear to have been acquired by
pathogens under selective pressure from antibiotics used in
agriculture and medicine (Davis et al., Science, 1994, 264, 375).
Antibiotic resistance may develop in bacteria harbouring genes that
encode enzymes that either chemically alter or degrade antibiotics.
Resistant bacteria may also encode enzymes that make the cell wall
impervious to antibiotics or encode efflux pumps that eject
antibiotics from the cell before the antibiotics can exert their
effects. Due to the emergence of antibiotic-resistant bacterial
pathogens, a need for new therapeutic strategies has arisen. One
strategy for avoiding problems caused by resistance genes is the
development of anti-infective drugs from novel chemical classes for
which specific resistance traits do not exist.
[0005] Antisense agents offer a novel strategy for combatting
disease, as well as opportunities to employ new chemical classes in
drug design. Oligonucleotides can interact with native DNA and RNA
in several ways, including duplex formation between an
oligonucleotide and a single-stranded nucleic acid and triplex
formation between an oligonucleotide and double-stranded DNA to
form a triplex structure. The use of anti-sense methods in basic
research has been encouraging, and antisense oligonucleotide drug
formulations that target viral and disease-causing human genes are
progressing through clinical trials. Antisense inhibition of
bacterial genes could also have wide application; however, few
attempts have been made to extend antisense technology to
bacteria.
[0006] Peptide nucleic acids (PNA) are similar to oligonucleotides
and oligonucleotide analogs and may mimic DNA and RNA. The
deoxyribose backbone of DNA is replaced in PNA by a pseudo-peptide
backbone (Nielsen et al., Science, 1991, 254, 1475; see FIG. 1).
Each subunit, or monomer, has a naturally occurring or
non-naturally occurring nucleobase attached to the backbone. One
such backbone consists of repeating units of
N-(2-aminoethyl)glycine linked through amide bonds. PNA hybridizes
to complementary nucleic acids through Watson and Crick base
pairing and helix formation results (Egholm et al., Nature, 1993,
365, 566). The Pseudo-peptide backbone provides superior
hybridization properties (Egholm et al., Nature, 1993, 365, 566),
resistance to enzymatic degradation (Demidov et al., P.E. Biochem.
Pharmacol., 1994, 48, 1310) and access to a variety of chemical
modifications (Nielsen et al., Chemical Society Reviews, 1997,
73).
[0007] PNA binds both DNA and RNA to form PNA/DNA or PNA/RNA
duplexes. The resulting PNA/DNA or PNA/RNA duplexes are bound with
greater affinity than corresponding DNA/DNA or DNA/RNA duplexes, as
determined by T.sub.ms. The thermal stability of PNA/DNA and
PNA/RNA duplexes could be due to the lack of charge repulsion in
the neutral backbone of PNA. In addition to increased affinity, PNA
has also been shown to hybridize to DNA with increased specificity,
as compared to DNA/DNA duplexes. When a PNA/DNA duplex mismatch is
melted relative to a DNA/DNA duplex, an 8 to 20.degree. C. drop in
the T.sub.m results. Furthermore, homopyrimidine PNA oligomers form
extremely stable PNA.sub.2-DNA triplexes with
sequence-complementary targets in DNA or RNA oligomers. Finally,
PNAs may bind to double-stranded DNA or RNA by helix invasion.
[0008] One advantage of PNA, as compared to oligonucleotides, is
the nuclease and protease reisitance of the PNA polyamide backbone.
PNA is not recognized by either nucleases or proteases and is thus
not susceptible to cleavage; consequently, PNAs are resistant to
degradation by enzymes, unlike nucleic acids and peptides. In
antisense applications, target-bound PNA can cause steric hindrance
of DNA and RNA polymerases, reverse transcripase, telomerase and
ribosomes (Hanvey et al., Science, 1992, 258, 1481; Knudsen et al.,
Nucleic Acids Res., 1996, 24, 494; Good et al., Proc. Natl. Acad.
Sci USA, 1998, 95, 2073; Good, et al., Nature Biotechnology, 1998,
16, 355).
[0009] A general difficulty in the use of antisense agents is cell
uptake. A variety of strategies to improve uptake have been
explored and reports of improved uptake into eukaryotic cells using
lipids (Lewis et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 3176),
encapsulation (Meyer et al., J. Biol. Chem., 1998, 273, 15621) and
carrier strategies (Nyce et al., Nature, 1997, 385, 721; Pooga et
al., Nature Biotechnology, 1998, 16, 857) have been made. WO
99/05302 discloses a PNA conjugate consisting of PNA and the
transporter peptide transportan, in which the peptide can be used
for transport cross a lipid membrane and for delivery of the PNA
into interactive contact with intracellular polynucleotides. U.S.
Pat. No. 5,777,078 discloses a pore-forming compound which
comprises a delivery agent that recognizes the target cell and is
linked to a pore-forming agent, such as a bacterial exotoxin. The
compound is administered together with a drug such as PNA.
[0010] PNAs have unique advantages as an antisense agent for
microorganisms. PNA-based antisense agents can control cell growth
and growth phenotypes when targeted to Escherichia coli rRNA and
mRNA (Good et al., Proc. Natl. Acad. Sci USA, 1998, 95, 2073; Good
et al., Nature Biotechnology, 1998, 16, 355; and WO 99/13893).
[0011] None of the cited disclosures discuss methods of
transporting PNA across the bacterial cell wall and membrane. Poor
uptake of PNA is expected because bacteria have stringent barriers
against entry of foreign molecules and antisense
oligomer-containing nucleobases appear to be too large for
efficient uptake. The results obtained by Good and Nielsen (Good et
al., Proc. Natl. Acad. Sci USA, 1998, 95, 2073; Good, et al.,
Nature Biotechnology, 1998, 16, 355) indicate that PNA oligomers
enter bacterial cells poorly by passive diffusion across the lipid
bilayers.
[0012] U.S. Pat. No. 5,834,430 discloses the use of potentiating
agents, such as short cationic peptides, in the potentiation of
antibiotics. The agent and the antibiotic are co-administered. WO
96/11205 discloses PNA conjugates, wherein a conjugated moiety may
be placed on terminal or non-terminal parts of the backbone of PNA
in order to functionalize the PNA. The conjugated moieties may be
reporter enzymes or molecules, steroids, carbohydrate, terpenes,
peptides, proteins, etc. The conjugates possess improved transfer
properties for crossing cellular membranes; however, WO 96/11205
does not disclose conjugates that can cross bacterial
membranes.
[0013] WO 98/52614 discloses a method of enhancing transport over
biological membranes, e.g., a bacterial cell wall. According to
this publication, biologically active agents such as PNA may be
conjugated to a transporter polymer in order to enhance
transmembrane transport. The transporter polymer consists of 6-25
subunits, at least 50% of which contain a guanidino or amidino side
chain moiety, and wherein at least 6 contiguous subunits contain
guanidino and/or amidino side chains. A preferred transporter
polymer is a polypeptide containing 9-arginine. Despite the
promising results obtained with the use of the PNA technology,
there is a great need in the art for development of new PNA
antisense drugs that are effective in combatting
microorganisms.
SUMMARY OF THE INVENTION
[0014] The present invention relates to a new strategy for
combatting bacteria. Antisense PNA can inhibit the growth of
bacteria; however, due to slow diffusion of PNA across the
bacterial cell wall, the use of PNA as an antibiotic has not been
possible. According to the present invention, a practical
application for PNA in combatting bacteria can be achieved by
modifying the PNA through linkage of a peptide or peptide-like
sequence that enhances the activity of the PNA.
[0015] Surprisingly, it has been demonstrated that incorporation of
a peptide in PNA results in an enhanced anti-infective effect. An
important feature of the modified PNA molecules is a pattern
comprising positively charged and lipophilic amino acids or amino
acid analogues. An anti-infective effect is found with different
orientations of the peptide relative to the PNA sequence. Thus, one
aspect of the present invention is directed to a modified PNA
molecule, and pharmaceutically acceptable salt thereof, of Formula
I:
Peptide-L-PNA (I)
[0016] wherein L is a linker or a bond, Peptide is any amino acid
sequence, and PNA is a Peptide Nucleic Acid.
[0017] More particularly, the present invention is directed to a
modified PNA molecule of Formula I
Peptide-L-PNA (I)
[0018] wherein Peptide is a cationic peptide or cationic peptide
analogue or a functionally similar moiety, the peptide or peptide
analogue having the Formula II:
C-(B-A).sub.n-D, (II)
[0019] wherein A is from 1 to 8 non-charged amino acids and/or
amino acid analogs, B is from 1 to 3 positively charged amino acids
and/or amino acid analogs, C is from 0 to 4 non-charged amino acids
and/or amino acid analogs, D is from 0 to 3 positively charged
amino acids and/or amino acid analogs, n is 1-10, and the total
number of amino acids and/or amino acid analogs is from 3 to
20.
[0020] In one embodiment, the Peptide of the present invention
comprises from 2 to 60 amino acids. The amino acids can be
negatively charged, non-charged, or positively charged
naturally-occurring, rearranged, or modified amino acids. In a
preferred embodiment of the invention, the peptide comprises from 2
to 18 amino acids, and most preferably from 5 to 15 amino
acids.
[0021] In another preferred embodiment of the invention, A in
Formula II comprises from 1 to 6 non-charged amino acids and/or
amino acid analogs and B comprises 1 or 2 positively charged amino
acids and/or amino acid analogs. In another embodiment, A comprises
from 1 to 4 non-charged amino acids and/or amino acid analogs and B
comprises 1 or 2 positively charged amino acids and/or amino acid
analogs.
[0022] In a preferred embodiment of the invention, the modified PNA
molecules of Formula I are used, for example, in the treatment or
prevention of infections caused by Escherichia coli or
vancomycin-resistant enterococci such as Enterococcus faecalis and
Enterococcus faecium or infections caused by methicillin-resistant
and methicillin-vancomycin-resistant Staphylococcus aureus.
[0023] The peptide moiety in a modified PNA molecule is linked to
the PNA sequence via the amino (N-terminal) or carboxy (C-terminal)
end. In a preferred embodiment, the peptide is linked to the PNA
sequence via the carboxy end.
[0024] In another aspect of the invention, modified PNA molecules
are used in the manufacture of medicaments for the treatment or
prevention of infectious diseases or for disinfecting non-living
objects. In a further aspect, the invention concerns a composition
for treating or preventing infectious diseases or disinfecting
non-living objects. In yet another aspect, the invention concerns
the treatment or prevention of infectious diseases or treatment of
non-living objects.
[0025] In yet a further aspect, the present invention is directed
to a method of identifying specific advantageous antisense PNA
sequences that may be used in the modified PNA molecule according
to the invention.
[0026] In yet a further aspect, the present invention relates to
other antisense oligonucleotides with the ability to bind to both
DNA and RNA.
[0027] Oligonucleotide analogs are oligomers having a sequence of
nucleotide bases (nucleobases) and a subunit-to-subunit backbone
that allows the oligomer to hybridize to a target sequence in an
mRNA by Watson-Crick base pairing, to form an RNA/Oligomer duplex
in the target sequence. The oligonucleotide analog may have exact
sequence complementarity to the target sequence or near
complementarity, as long as the hybridized duplex structure formed
has sufficient stability to block or inhibit translation of the
mRNA containing target sequence.
[0028] Oligonucleotide analogs of the present invention are
selected from the group consisting of Locked Nucleoside Analogues
(LNA) as described in International PCT Publication WO99/14226,
oligonucleotides as described in International PCT Publication
WO98/03533 or antisense oligomers, in particular morpholino analogs
as described in International PCT Publication WO98/32467.
[0029] PCT Publication WO99/14226, WO98/03533 and WO98/32467 are
all incorporated by reference.
[0030] Thus, further preferred compounds of the invention are
modified oligonucleotides of the Formula (III):
Peptide-L-Oligon (III)
[0031] wherein L is a linker or a bond; Peptide is any amino acid
sequence and Oligon is an oligonucleotide or analog thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 shows representative chemical structures of DNA and
PNA oligomers.
[0033] FIG. 2 is a schematic showing a representative conjugation
using SMCC.
[0034] FIGS. 3A and 3B show the nucleotide sequence of the mrcA
(ponA) gene encoding PBP1A. The sequence of the gene (accession
number X02164) was obtained from the EMBL sequence database
(Heidelberg, Germany) (Broome-Smith et al., Eur J Biochem, 1985,
147, 437). Two possible start codons have been identified (bolded).
Bases 1-2688 are shown (ending with stop codon).
[0035] FIGS. 4A and 4B show the nucleotide sequence of the mrdA
gene encoding PBP2. The sequence (accession number AE000168, bases
4051-5952, numbered 1-2000) was obtained from the E. coli genome
database at the NCBI (Genbank, National Center for Biotechnology
Information, USA). The start codon is bolded.
[0036] FIG. 5 shows representative chemical structures of different
succinimidyl based linking groups used in conjugation of a Peptide
and PNA
DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION
[0037] The present invention relates, in part, to a modified
oligonucleotide of Formula III:
Peptide-L-Oligon (III)
[0038] wherein L is a linker or a bond, Peptide is any amino acid
sequence, and Oligon is an oligonucleotide or analog thereof.
[0039] Oligons useful for the invention include, but are not
limited to, oligonucleotide analogs such as, for example, Locked
Nucleoside Analogues (LNA), as described in International PCT
Publication WO99/14226, or analogs as described in International
PCT Publication WO98/03533, or morpholino analogs as described in
International PCT Publication WO98/32467, each of which are
incorporated herein by reference in their entirety.
[0040] Antisense PNAs can inhibit bacterial gene expression with
gene and sequence specificity (Good et al., Proc. Natl. Acad. Sci
USA, 1998, 95, 2073; Good et al., Nature Biotechnology, 1998, 16,
355; and WO 99/13893). Antisense PNAs may prove to be a practical
tool for functional genomics and a source of novel antimicrobial
drugs. However, improvements in standard PNA techniques are
required in order to increase antisense potencies. The major limit
to antisense activity appears to be cellular entry. Bacteria
effectively exclude the entry of large molecular weight foreign
compounds, and previous results of in vitro and cellular assays
seem to demonstrate that the cell barrier restricts antisense
effects. Accordingly, the present invention concerns strategies to
improve the activity of antisense PNAs.
[0041] Without being bound by theory, it is believed that short
cationic peptides lead to improved PNA uptake over the bacterial
cell wall. It is believed that the short peptides act by
penetrating the cell wall and allowing the modified PNA molecule to
cross the cell wall and gain access to structures inside the cell,
such as the genome, mRNAs, the ribosome, etc. Improved
accessibility to the nucleic acid target or improved binding of the
PNA may also add to the overall effect observed.
[0042] According to one aspect of the invention, nanomolar
concentrations of PNA molecules modified with short,
activity-enhancing peptides enable specific and efficient
inhibition of bacterial gene expression. Antisense potencies in
this concentration range are consistent with practical applications
of the technology. It is believed that the present invention
demonstrates for the first time that peptides with a certain
pattern of cationic and lipophilic amino acids can be used as
carriers to deliver agents and other compounds into
micro-organisms, such as bacteria. Further, the present invention
has made it possible to administer PNA in an efficient
concentration that is also acceptable to the patient. Accordingly,
the present invention concerns novel modified PNA molecules of the
formula:
Peptide-L-PNA, wherein
[0043] L is a linker or a bond, PNA is a peptide nucleic acid
sequence, and Peptide is a cationic peptide or peptide analog or a
functionally similar moiety, the peptide or peptide analog
preferably having the formula:
C-(B-A).sub.n-D, wherein
[0044] A comprises from 1 to 8 non-charged amino acids and/or amino
acid analogs, B comprises from 1 to 3 positively charged amino
acids and/or amino acid analogs, C comprises from 0 to 4
non-charged amino acids and/or amino acid analogs, D comprises from
0 to 3 positively charged amino acids and/or amino acid analogs, n
is 1-10, and the total number of amino acids and/or amino acid
analogs is from 3 to 20.
[0045] A preferred group of modified PNA molecules is the group
wherein A comprises from 1 to 6 non-charged amino acids and/or
amino acid analogs and B comprises 1 or 2 positively charged amino
acids and/or amino acid analogs. In another preferred group, A
comprises from 1 to 4 non-charged amino acids and/or amino acid
analogs and B comprises 1 or 2 positively charged amino acids
and/or amino acid analogs.
[0046] The terms "cationic amino acids and amino acid analogs" and
"positively charged amino acids and amino acid analogs" include,
but are not limited to, any natural or non-naturally occurring
amino acids or amino acid analogs that have a positive charge at
physiological pH. Similarly, the term "non-charged amino acids or
amino acid analogs" includes any natural or non-naturally occurring
amino acids or amino acid analogs that have no charge at
physiological pH. Positively charged amino acids and amino acid
analogs include lysine (Lys, K), arginine (Arg, R), diamino butyric
acid (DAB), and ornithine (Orn). The skilled artisan is aware of
further positively charged amino acids and amino acid analogs.
[0047] The term "cationic peptide" includes any natural or
non-naturally occurring peptide that has a positive charge at
physiological pH.
[0048] The term "peptide analog" includes any natural or
non-naturally occurring peptide, or derivative thereof.
[0049] The non-charged amino acids and amino acid analogs include,
but are not limited to, the naturally occurring amino acids alanine
(Ala, A), valine (Val, V), leucine (Leu, L), isoleucine (Ile, I),
proline (Pro, P), phenylanaline (Phe, F), tryptophan (Trp, W),
methionine (Met, M), glycine (Gly, G), serine (Ser, S), threonine
(Thr, T), cysteine (Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N)
and glutamine (Gln, Q), and the non-naturally occurring amino acids
2-aminobutyric acid, .beta.-cyclohexylalanine,
4-chlorophenylalanine, norleucine and phenylglycine. The skilled
artisan is aware of additional non-charged amino acids and amino
acid analogs. Preferably, the non-charged amino acids and amino
acid analogs are selected from the naturally occurring non-polar
amino acids Ala, Val, Leu, Ile, Phe, Trp and Met or the
non-naturally occurring non-polar amino acids
.beta.-cyclohexylalanine, 4-chlorophenylalanine and norleucine.
[0050] The term "functionally similar moiety" includes all
peptide-like molecules that functionally mimic the Peptide as
defined above and thus impart to the PNA molecule the same
advantageous properties as the peptides comprising natural and
non-natural amino acids as defined above.
[0051] Examples of preferred modified PNA molecules according to
the invention include, but are not limited to, (Lys Phe Phe).sub.3
Lys-L-PNA and any subunits thereof comprising at least three amino
acids. One preferred Peptide is (Lys Phe Phe).sub.3 (SEQ ID NO: 1).
Others include (Lys Phe Phe).sub.2 Lys Phe (SEQ ID NO:2), (Lys Phe
Phe).sub.2 Lys (SEQ ID NO:157), (Lys Phe Phe).sub.2 (SEQ ID NO:3),
Lys Phe Phe Lys Phe (SEQ ID NO:4), Lys Phe Phe Lys (SEQ ID NO:5)
and Lys Phe Phe. Other preferred Peptides are FFRFFRFFR (SEQ ID
NO:6), LLKLLKLLK (SEQ ID NO:7), LLRLLRLLR (SEQ ID NO:8), LLKKLAKAL
(SEQ ID NO:9), KRRWPWWPWKK (SEQ ID NO:10), KFKVKFVVKK (SEQ ID
NO:11), LLKLLLKLLLK (SEQ ID NO:12), LLKKLAKALK (SEQ ID NO:13), and
any subunits thereof comprising at least 3 amino acids whereof at
least one amino acid is a positively charged amino acid. Also
included are derivatives of the peptides having conservative amino
acid substitutions, or insertions or deletions.
[0052] A third group of preferred Peptides is RRLFPWWWPFRRVC (SEQ
ID NO:14), GRRWPWWPWKWPLIC (SEQ ID NO:15), LVKKVATTLKKIFSKWKC (SEQ
ID NO:16), KKFKVKFVVKKC (SEQ ID NO:17) and any subunit thereof
comprising at least 3 amino acids whereof at least one amino acid
is a positively charged amino acid. A fourth group of preferred
Peptides is magainis (Zasloff, Proc. Natl. Acad. Sci. USA, 1987,
84, 5449), for instance the synthetic magainin derivative
GIGKFLHAAKKFAKAFVAEIMNS-NH.sub.2 (SEQ ID NO:158) as well as
.beta.-amino-acid oligomers (.beta.-peptides) as described by
Porter, et al., Nature, 2000, 404, 565.
[0053] The number of amino acids in the peptide can be from 3 to
20. Preferably, at least 3 amino acids, at least one of which is a
positively charged amino acid, are necessary to obtain the
advantageous effect. On the other hand, the upper limit for the
number of amino acids in the peptide seems only to be set by the
overall size of the PNA molecule. Preferably, the total number of
amino acids is 15 or less, more preferably 12 or less, and most
preferably 10 or less.
[0054] In a preferred embodiment of the invention, the PNA contains
from 5 to 20 nucleobases, preferably from 7-15 nucleobases, and
most preferably from 8 to 12 nucleobases. In a further preferred
embodiment of the invention, the PNA backbone is aminoethylglycine
as shown in FIG. 1. PNAs are described in, for example, WO 92/20702
and WO 92/20703, each of which is incorporated herein by reference
in its entirety.
[0055] The PNA molecule is connected to the Peptide moiety through
direct binding or through a linker. A variety of linking groups can
be used to connect the PNA with the Peptide. Linking groups are
described in, for example, WO 96/11205 and WO98/52614, each of
which is incorporated herein by reference in its entirety. Some
linking groups may be advantageous in connection with specific
combinations of PNA and Peptide.
[0056] Preferred linking groups include 8-amino-3,6-dioxaoctanoic
acid (ADO), succinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC),
6-aminohexanoic acid (AHEX or AHA), 4-aminobutyric acid,
4-aminocyclohexylcarboxylic acid, succinimidyl
4-(N-maleimidomethyl)cyclo- hexane-1-carboxy-(6-amido-caproate)
(LCSMCC), succinimidyl m-maleimido-benzoylate (MBS), succinimidyl
N-.epsilon.-maleimido-caproyla- te (EMCS), succinimidyl
6-(.beta.-maleimido-propionamido) hexanoate (SMPH), succinimidyl
N-(.alpha.-maleimido acetate) (AMAS), succinimidyl
4-(p-maleimidophenyl)butyrate (SMPB), .beta.-alanine (.beta..ALA),
Phenylglycine (PHG), 4-aminocyclohexanoic acid (ACHC),
.beta.-(cyclopropyl) alanine (.beta..CYPR), amino dodecanoic acid
(ADC), polyethylene glycols and amino acids. Any of these groups
can be used as a single linking group or together with more groups
in creating a suitable linker. Further, the different linking
groups can be combined in any order and number in order to obtain
different functionalities in the linker arm.
[0057] In a preferred embodiment, the linking group is a
combination of the .beta..ALA linking group or the ADO linking
group with any of the other above mentioned linking groups. Thus,
preferred linkers include, but are not limited to,
-achc-.beta..ala-, -achc-ado-, -lcsmcc-.beta..ala-,
-mbs-.beta..ala-, -emcs-.beta..ala-, -lcsmcc-ado-, -mbs-ado-,
-emcs-ado- or -smph-ado-. Most preferred linkers include the
following: -achc-.beta..ala-, -lcsmcc-ado- and -mbs-ado-. When
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC)
is used in the process of linking PNA to the peptide, it is
necessary to add a cysteine (C) or a similar thiol containing
moiety to the terminal end of the peptide (see FIG. 2).
Additionally, amino acids, such as glycine, can be a part of the
linker. The chemical structures of the different succinimidyl based
linking groups used in the conjugation of the Peptide and PNA is
shown in FIG. 5.
[0058] The Peptide is normally linked to the PNA sequence via the
amino or carboxy end. However, the PNA sequence may also be linked
to an internal part of the peptide, or the PNA sequence is linked
to a peptide via both the amino and the carboxy end.
[0059] The following discussion regarding modified PNA targets is
not limited to targets of modified PNA molecules and is equally
applicable to targets of the modified oligonucleotides of the
invention.
[0060] The modified PNA molecules of the present invention comprise
PNA oligomer sequences that are complementary to at least one
target nucleotide sequence in a microorganism, such as a bacterium.
The target may be a nucleotide sequence of any RNA that is
essential for the growth, and/or reproduction of the bacteria.
Alternatively, the target may be a gene encoding a factor
responsible for resistance to antibiotics. In a preferred
embodiment, the functioning of the target nucleotide sequence is
essential for the survival of the bacteria and the functioning of
the target nucleic acid is blocked by the PNA sequence, in an
antisense manner.
[0061] The binding of a PNA strand to a DNA or RNA strand can occur
in one of two orientations, anti-parallel or parallel. As used in
the present invention, the term "complementary" as applied to PNA
does not in itself specify the orientation parallel or
anti-parallel. It is significant that the most stable orientation
of PNA/DNA and PNA/RNA is anti-parallel. In a preferred embodiment,
PNA targeted to single-stranded RNA is complementary in an
anti-parallel orientation.
[0062] In a another preferred embodiment of the invention, a
bis-PNA consisting of two PNA oligomers covalently linked to each
other is targeted to a homopurine sequence (consisting of only
adenine and/or guanine nucleotides) in RNA (or DNA), with which it
can form a PNA.sub.2-RNA (PNA.sub.2-DNA) triple helix.
[0063] Potential target genes can be chosen based upon knowledge
about bacterial physiology. A target gene can be found among those
involved in one of the major process complexes: cell division, cell
wall synthesis, protein synthesis (translation), nucleic acid
synthesis, fatty acid metabolism, and gene regulation. A target
gene can also be involved in antibiotic resistance. A further
consideration in selecting target genes is that some physiological
processes are primarily active in dividing cells whereas others are
active under non-dividing circumstances as well.
[0064] Known target proteins in cell wall biosynthesis are
penicillin binding proteins, PBPs, the targets of, e.g., the
beta-lactam antibiotic penicillin, which are involved in the final
stages of cross-linking of the murein sacculus. E. coli has 12
PBPs, which include the high molecular weight PBPs: PBP1a, PBP1b,
PBP1c, PBP2 and PBP3, and seven low molecular weight PBPs: PBP 4-7,
DacD, AmpC and AmpH. Only the high molecular weight PBPs are known
to be essential for growth and have therefore been chosen as
targets for PNA antisense molecules. Protein biosynthesis is an
important process throughout the bacterial cell cycle;
consequently, targeting enzymes involved in protein biosynthesis is
not dependent upon cell division.
[0065] Proteins involved in DNA and RNA synthesis are also
antibiotic targets. A target protein in DNA synthesis is gyrase,
which acts in replication, transcription, repair and restriction.
The enzyme consists of two subunits, both of which are candidate
targets for PNA. Examples of potential targets primarily activated
in dividing cells are rpoD, gyrA, gyrB, (transcription), mrcA
(ponA), mrcB (ponb, pbpF), mrdA, ftsI (pbpB) (cell wall
biosynthesis), ftsQ, ftsA and ftsZ (cell division). Examples of
potential targets also activated in non-dividing cells are infA,
infB, infC, tufA/tufB, tsf, fusA, prfA, prfB, and prfC,
(translation).
[0066] Other potential target genes are antibiotic
resistance-genes, with which the skilled artisan is familiar.
Examples of such genes include, but are not limited to, genes
encoding beta-lactamases and genes encoding chloramphenicol acetyl
transferase. PNAs against such resistance genes could be used
against resistant bacteria.
[0067] A further potential target gene is the acpP gene encoding
the acyl carrier protein of E. Coli. ACP (acyl carrier protein) is
a small and highly soluble protein, which plays a central role in
type I fatty acid synthase systems. Intermediates of long chain
fatty acids are covalently bound to ACP by a thioester bond between
the carboxyl group of the fatty acid and the thiol group of the
phosphopanthetheine prosthetic group. ACP is one of the most
abundant proteins in E. coli, constituting 0.25% of the total
soluble protein (ca 6.times.10.sup.4 molecules per cell). The
cellular concentration of ACP is regulated, and overproduction of
ACP from an inducible plasmid is lethal to E. coli cells.
[0068] Infectious diseases are caused by micro-organisms including
bacteria, viruses, protozoa, worms and arthropods. PNA can be
modified and used to target RNA in such micro-organisms, whether
the micro-organisms are sensitive or resistant to antibiotics.
[0069] Examples of microorganisms that can be treated in accordance
with the present invention include, but are not limited to,
Gram-positive bacteria such as Streptococcus, Staphylococcus,
Peptococcus, Bacillus, Listeria, Clostridium, Propionebacteria;
Gram-negative bacteria such as Bacteroides, Fusobacterium,
Escherichia, Klebsiella, Salmonella, Shigella, Proteus,
Pseudomonas, Vibrio, Legionella, Haemophilus, Bordetella, Brucella,
Campylobacter, Neisseria, Branhamella; and organisms that stain
poorly or not at all with Gram's stain such as Mycobacteria,
Treponema, Leptospira, Borrelia, Mycoplasma, Clamydia, Rickettsia
and Coxiella,
[0070] The incidence of multiple antimicrobial resistant bacteria
that cause infections in hospitals/intensive care units is
increasing. Such bacteria include methicillin-resistant and
methicillin-vancomycin-resista- nt Staphylococcus aureus,
vancomycin-resistant enterococci such as Enterococcus faecalis and
Enterococcus faecium, penicillin-resistant Streptococcus pneumoniae
and cephalosporin and quinolone resistant gram negative rods
(coliforms) such as E. coli, Klebsiella pneumoniae, Pseudomonas
species and Enterobacter species. Recently, pan antibiotic
(including carbapenems) resistant gram negative bacilli have
emerged. The rapidity of the emergence of these multiple
antibiotic-resistant bacteria is not being matched by the same rate
of development of new antibiotics and it is, therefore, conceivable
that patients with serious infections will soon no longer be
treatable with currently available antimicrobials (Levy, Trends
Microbial, 1996; 2, 341; Levy SB. The antibiotic paradox, how
miracle drugs are destroying the miracle. New York: Plenum, 1992).
Several international reports have highlighted the potential
problems associated with the emergence of antimicrobial resistance
in many areas of medicine and have also outlined the difficulties
in the management of patients with infections caused by these
micro-organisms (House of Lords Select Committee on Science and
Technology. Resistance to antibiotics and other antimicrobial
agents. London: HMSO, 1998; Lepellier et al., Clin Infect Dis,
1999, 3, 548).
[0071] Methicillin-resistant S. aureus (MRSA) (Chambers, Clin
Microbiol Rev, 10, 781; Elliott, Current Medical
Literature-Surgical Infections, 1997, 9), methicillin-vancomycin
resistant S. aureus (VMRSA), and vancomycin resistant enterococci
(VRE) have emerged as major nosocomial pathogens (House of Lords
Select Committee on Science and Technology. Resistance to
antibiotics and other antimicrobial agents. London: HMSO, 1998;
Arthur et al., Trends Microbiol, 1996, 4, 410; Zervos, New, 1996,
4, 385; Carmelli et al., Arch Intern Med, 1999, 159, 2461).
Vancomycin is currently the most reliable treatment for infections
caused by MRSA, but the potential transfer of resistance genes from
VRE to MRSA may leave few therapeutic options in the future. VRE
provide a reservoir of vancomycin resistance genes and can also
cause infections in patients with compromised immunity. Some VRE
strains exhibit resistance to all major classes of antibiotic and
in some hospitals in the United States VRE are responsible for more
than 20% of enterococcal infections (Mcneeley et al., Pediatr
Infect Dis J, 1998,17, 184; Carmelli et al., Arch Intern Med,
1999,159, 2461).
[0072] S. aureus, exhibiting intermediate vancomycin resistance
(VISA), as well as VMRSA, have now been reported in several
centers/hospitals worldwide (Johnson, J Antimicrob Chemother, 1998,
42, 289; Hiramatsu et al., Lancet, 1997, 350, 1670). Of the S.
aureus isolates from the U.S.A., Europe, and Japan, 60-72% were
MRSA. Multi-drug-resistant MRSA are the most common cause of
surgical site infections, comprising 61% of all S. aureus
infections, and are a major cause of increased morbidity and
mortalityof ICU patients (Communicable Disease Report (CDN), 1999,
9, 8; Cookson, J Hosp Infec, 1999, 97; Liu et al., Chong Hua Min
Kuo Hsiao Erh Ko I Hsueh Hui Tsa Chih 1993, 34, 285; Richards et
al., Crit Care Med, 1999, 5, 887).
[0073] Coagulase negative staphylococci (CNS), such as S.
epidermidis, are an important cause of infections associated with
prosthetic devices and catheters (Vincent et al., LAMA, 1995, 27,
639). Although CNS display lower virulence than S aureus, they have
intrinsic low-level resistance to many antibiotics, including
beta-lactams and glycopeptides. In addition, many of these bacteria
produce slime (biofilm), making the treatment of prosthetic
associated infections difficult and often necessitating the removal
of the infected prosthesis or catheter (Costerton et al., Ann Rev
Microbiol., 1987, 41, 435).
[0074] Streptococcus pneumoniae, regarded as fully sensitive to
penicillin for many years, has now acquired the genes for
resistance to oral streptococci. The prevalence of these resistant
strains is increasing rapidly worldwide, which will limit the
therapeutic options in serious pneumococcal infections, including
meningitis and pneumonia (Baquero, Microb Drug Resist, 1995, 1,
115). Streptococcus pneumoniae is the leading cause of infectious
morbidity and mortality worldwide. In the U.S.A. pneumococcus is
responsible for an estimated 50,000 cases of bacteremia, 3,000
cases of meningitis, 7 million cases of otitis media, and several
hundred thousand cases of pneumonia. The overall yearly incidence
of pneumococcal bacteremia is estimated to be 15 to 35 cases per
100,000. Current immunization of small children and the elderly
have not addressed the high incidence of pneumococcal infection
(Dowell, Arch Intern Med, 1999, 159, 2461; Communicable Disease
Report (CDN), 1999, 10, 7; Baquero, Microb Drug Resist, 1995, 1,
115). Multi-drug resistant strains were isolated in the late 1970's
and are now encountered worldwide (Baquero, Microb Drug Resist,
1995, 1, 115).
[0075] Pseudomonas aeruginosa, Pseudomonads species including
Burkholderia cepacia and Xanthomonas malthophilia,
Enterobacteriaceae including E. coli, Enterobacter species, and
Klebsiella species, account for the majority of isolates in which
resistance has emerged (Livermore, Commun Dis Public Health, 1998,
1, 74; Livermore, J Antimicrob Chemother, 1997, 39, 673; House of
Lords Select Committee on Science and Technology. Resistance to
antibiotics and other antimicrobial agents. London: HMSO, 1998).
Cystitis, pneumonia, septicaemi, and postoperative sepsis are the
most common types of infections. Most of the infections in
intensive care unit (ICU) patients result from the patients' own
endogenous flora and, in addition, up to 50% of ICU patients also
acquire nosocomial infections, which are associated with a
relatively high degree of morbidity and mortality (Richards et al.,
Crit Care Med, 1999, 5, 887; Chandrasekar et al., Crit Care Med,
1980, 15, 508; Northey et al., Surg Gynaecol Obstet, 1974, 139,
321). Microorganisms associated with these infections include
Enterobacteriaceae 34%, S. aureus 30%, P. aeruginosa 29%, CNS 19%
and fungi 17%.
[0076] Selective pressure caused by the use of broad-spectrum
antibiotics has lead to multidrug resistance in Gram-negative
bacteria. Each time a new drug is introduced, resistant subclones
appear, and currently the majority of isolates are resistant to at
least one antimicrobial (Lepellier et al., Clin Infect Dis, 1999,
3, 548; Giwercman et al., J Antimicrob Chemother, 1990, 26, 247;
Livermore, Commun Dis Public Health, 1998, 1, 74; Livermore, J
Antimicrob Chemother, 1997, 39, 673).
[0077] The low-permeability cell envelope of P. aeruginosa differs
from that of E. coli. Forty-six percent of P. aeruginosa isolates
from Europe are resistant to one or more antibiotic. The ability of
P. aeruginosa to produce slime (biofilm), and its rapid development
of resistance during treatment, often leads to therapy failure.
Multidrug resistant P. aeruginosa has also become endemic within
some specialized ICUs, such as those treating burns patients and
cystic fibrosis patients (Hsueh et al., J Clin Microbiol, 1998, 36,
1347; Bert et al., J Antimicrob Chemother, 1996, 37, 809).
[0078] Several international reports have highlighted the potential
problems associated with the emergence of antimicrobial resistance
in the bacteria mentioned above, and it is conceivable that
patients with serious infections soon will no longer be treatable
with currently available antimicrobials. The increasing incidence
of resistant strains among clinical isolates of S. aureus, S.
epidermidis (CNS), enterococci, Streptococcus pneumoniae, gram
negative bacilli (coliforms) such as E. coli, Klebsiella
pneumoniae, Pseudomonas species and Enterobacter species, make
these bacteria major candidates for future PNA design.
[0079] In another aspect of the present invention, modified PNA
molecules can be used to identify preferred targets for PNAs. Using
the known or partially known genome of the target micro-organisms,
e.g,. from genome sequencing or cDNA libraries, different PNA
sequences can be constructed and linked to an effective
anti-infective enhancing Peptide and thereafter tested for
anti-infective activity. It may be advantageous to select PNA
sequences that are shared by as many micro-organisms as possible,
or shared by a distinct subset of micro-organisms, such as, for
example, Gram-negative or Gram-positive bacteria, or shared by
distinct micro-organisms, or specific for a single
micro-organism.
[0080] In one embodiment of the invention, modified PNA molecules
are used for the identification of PNA sequences that are effective
in blocking essential functions in bacteria. Various PNA sequences
are incorporated into modified PNA molecules, which are then tested
for their ability to inhibit or reduce the growth of bacteria.
[0081] Another embodiment of the invention involves a method of
identifying PNA sequences that are useful in inhibiting or reducing
the growth of one or more bacteria. The method involves mixing
modified PNA molecules of Formula I, which contain different PNA
sequences, with one or more bacteria. The PNA sequences are
selected so as to be complementary to at least one nucleotide
sequence in each bacteria. PNA sequences that are effective in
inhibiting or reducing the growth of one or more bacteria are
identified.
[0082] The compounds of Formula I can be prepared in the form of
pharmaceutically acceptable salts, especially acid-addition salts,
including salts of organic acids and mineral acids. The term
"pharmaceutically acceptable salts" refers to derivatives of the
modified PNAs of Formula I and the modified oligonucleotides of
Formula III wherein the parent molecule is modified by making acid
or base salts thereof. The term "pharmaceutically acceptable"
refers to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of reasonable medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication, commensurate with a reasonable
benefit/risk ratio.
[0083] Examples of pharmaceutically acceptable salts include, but
are not limited to, salts of organic acids such as formic acid,
fumaric acid, acetic acid, propionic acid, glycolic acid, lactic
acid, pyruvic acid, oxalic acid, succinic acid, malic acid,
tartaric acid, citric acid, benzoic acid, salicylic acid, and the
like. Suitable inorganic acid-addition salts include salts of
hydrochloric, hydrobromic, sulphuric and phosphoric acids, and the
like. Further examples of pharmaceutically acceptable inorganic or
organic acid addition salts include the pharmaceutically acceptable
salts listed in Journal of Pharmaceutical Science, 1977, 66, 2,
which are known to the skilled artisan.
[0084] Pharmaceutically acceptable acid addition salts also include
the hydrates that the compounds of the invention are able to form.
The acid addition salts can be obtained as the direct products of
compound synthesis. In the alternative, the free base can be
dissolved in a suitable solvent containing the appropriate acid,
and the salt isolated by evaporating the solvent or otherwise
separating the salt and solvent. The compounds of this invention
can form solvates with standard low molecular weight solvents using
methods known to the skilled artisan.
[0085] In a further aspect of the present invention, the invention
provides a composition for use in inhibiting growth or reproduction
of infectious micro-organisms, comprising a modified PNA molecule
according to the present invention. The term "composition" includes
pharmaceutically acceptable compositions.
[0086] In one embodiment, the inhibition of the growth of
micro-organisms is obtained through treatment with either the
modified PNA molecule alone or in combination with antibiotics or
other anti-infective agents. In another embodiment, the composition
comprises two or more different modified PNA molecules. A second
modified PNA molecule can be used to target the same bacteria as
the first modified PNA molecule or to target different bacteria. In
the latter situation, specific combinations of target bacteria may
be selected for treatment. Alternatively, the target can be one or
more genes that confer resistance to one or more antibiotics in one
or more bacteria. In such a situation, the composition or the
treatment further comprises the use of said antibiotic(s).
[0087] In another aspect, the present invention includes within its
scope pharmaceutical compositions comprising, as an active
ingredient, at least one of the compounds of the general Formula I,
or a pharmaceutically acceptable salt thereof, together with a
pharmaceutically acceptable carrier or diluent.
[0088] Pharmaceutical compositions of the present invention can be
prepared by conventional techniques, e.g., as described in
Remington: The Science and Practice of Pharmacy, 19.sup.th Ed.,
1995. The compositions can appear in conventional forms, for
example, capsules, tablets, aerosols, solutions, suspensions, or
topical applications.
[0089] Typical compositions include a compound of Formula I or III,
or a pharmaceutically acceptable acid addition salt thereof,
associated with a pharmaceutically acceptable excipient, which may
be a carrier or a diluent. The composition can be diluted by a
carrier, or enclosed within a carrier that can be in the form of a
capsule, sachet, paper or other container. In making the
compositions, conventional techniques for the preparation of
pharmaceutical compositions may be used. For example, the active
compound can be mixed with a carrier, or diluted by a carrier, or
enclosed within a carrier, which may be in the form of a ampoule,
capsule, sachet, paper, or other container. When the carrier serves
as a diluent, it may be a solid, semi-solid, or liquid material
which acts as a vehicle, excipient, or medium for the active
compound. The active compound can be adsorbed on a granular solid
container, for example, in a sachet. Some examples of suitable
carriers include water, salt solutions, alcohols, polyethylene
glycols, polyhydroxyethoxylated castor oil, peanut oil, olive oil,
gelatine, lactose, terra alba, sucrose, glucose, cyclodextrin,
amylose, magnesium stearate, talc, gelatin, agar, pectin, acacia,
stearic acid, or lower alkyl ethers of cellulose, silicic acid,
fatty acids, fatty acid amines, fatty acid monoglycerides and
diglycerides, pentaerythritol fatty acid esters, polyoxyethylene,
hydroxymethylcellulose and polyvinylpyrrolidone.
[0090] The carrier or diluent may include any sustained release
material known in the art, such as glyceryl monostearate or
glyceryl distearate, alone or mixed with a wax. The formulations
may also include wetting agents, emulsifying and suspending agents,
preserving agents, sweetening agents, thickeners or flavouring
agents. The formulations of the invention may be formulated so as
to provide quick, sustained, or delayed release of the active
ingredient after administration to the patient by employing
procedures well known in the art. The pharmaceutical compositions
can be sterilized and mixed, if desired, with auxiliary agents,
emulsifiers, salt for influencing osmotic pressure, buffers and/or
coloring substances, and the like, that do not deleteriously react
with the active compounds.
[0091] The route of administration can be any route that
effectively transports the active compound to the appropriate or
desired site of action, such as oral, nasal, rectal, pulmonary,
transdermal or parenteral, e.g., depot, subcutaneous, intravenous,
intraurethral, intramuscular, intranasal, ophthalmic solution, or
an ointment, the parenteral or the oral route being preferred. If a
solid carrier is used for oral administration, the preparation may
be tabletted, placed in a hard gelatin capsule in powder or pellet
form, or it can be in the form of a troche or lozenge. If a liquid
carrier is used, the preparation may be in the form of a suspension
or solution in water or a non-aqueous media, a syrup, emulsion, or
soft gelatin capsules. Thickeners, flavorings, diluents,
emulsifiers, dispersing aids or binders may be added.
[0092] For nasal administration, the preparation may contain a
compound of formula I dissolved or suspended in a liquid carrier,
in particular an aqueous carrier, for aerosol application. The
carrier may contain additives such as solubilizing agents, e.g,.
propylene glycol, surfactants, absorption enhancers, such as
lecithin (phosphatidylcholine) or cyclodextrin, or preservatives
such as parabenes. For parenteral application, particularly
suitable are injectable solutions or suspensions, preferably
aqueous solutions with the active compound dissolved in
polyhydroxylated castor oil.
[0093] Tablets, dragees, or capsules having talc and/or a
carbohydrate carrier or binder or the like are particularly
suitable for oral application. Preferable carriers for tablets,
dragees, or capsules include lactose, corn starch, and/or potato
starch. A syrup or elixir can be used in cases where a sweetened
vehicle can be employed.
[0094] In formulations for the treatment or prevention of
infectious diseases in mammals, the amount of active, modified PNA
molecule to be used is determined in accordance with the specific
active drug, organism to be treated, and carrier of the organism.
"Mammals" include, but are not limited to, humans, domestic
animals, such as, for example, household pets, livestock and other
farm animals, and non-domestic animals, such as wildlife.
[0095] Dosage forms suitable for oral, nasal, pulmonal or
transdermal administration comprise from about 0.01 mg to about 500
mg, preferably from about 0.01 mg to about 100 mg of the compounds
of Formula I or III admixed with a pharmaceutically acceptable
carrier or diluent.
[0096] In a further aspect, the present invention relates to the
use of one or more compounds of the general Formula I or III, or
pharmaceutically acceptable salts thereof, for the preparation of a
medicament for the treatment and/or prevention of infectious
diseases.
[0097] The preceding description regarding pharmaceutically
acceptable salts of modified PNA molecules and compositions
comprising the modified PNA molecules of Formula I is not limited
to the modified PNA molecules of Formula I and is equally
applicable to the modified oligonucleotides of Formula III.
[0098] In yet another aspect of the present invention, the present
invention concerns a method of treating or preventing infectious
disease, comprising administering to a patient in need of
treatment, or for prophylactic purposes, an effective amount of
modified PNA or modified oligonucleotide according to the
invention. Such a treatment may be in the form of administering a
composition in accordance with the present invention. In
particular, the treatment may be a combination of traditional
antibiotic treatment and treatment with one or more modified PNA
molecules that target genes responsible for resistance to
antibiotics.
[0099] The phrase "effective amount" refers to that amount of
modified PNA or modified oligonucleotide that is capable of
abolishing, inhibiting, or retarding bacterial growth in
mammals.
[0100] The term "antibiotic" refers to conventional antibiotics as
ordinarily understood in the art, i.e., antimicrobial substances
that have the ability to inhibit the growth of or to destroy
microorganisms. Classes of antibiotics that can be used include,
but are not limited to, tetracyclines (i.e. minocycline),
rifamycins (i.e. rifampin), macrolides (i.e. erythromycin),
penicillins (i.e. nafcillin), cephalosporins (i.e. cefazolin),
other beta-lactam antibiotics (i.e. imipenem, aztreonam),
aminoglycosides (i.e. gentamicin), chloramphenicol, sufonamides
(i.e. sulfamethoxazole), glycopeptides (i.e. vancomycin),
quinolones (i.e. ciprofloxacin), fusidic acid, trimethoprim,
metronidazole, clindamycin, mupirocin, polyenes (i.e. amphotericin
B), azoles (i.e. fluconazole) and beta-lactam inhibitors (i.e.
sulbactam).
[0101] Examples of specific antibiotics that can be used include,
but are not limited to, minocycline, rifampin, erythromycin,
nafcillin, cefazolin, imipenem, aztreonam, gentamicin,
sulfamethoxazole, vancomycin, ciprofloxacin, trimethoprim,
metronidazole, clindamycin, teicoplanin, mupirocin, azithromycin,
clarithromycin, ofloxacin, lomefloxacin, norfloxacin, nalidixic
acid, sparfloxacin, pefloxacin, amifloxacin, enoxacin, fleroxacin,
temafloxacin, tosufloxacin, clinafloxacin, sulbactam, clavulanic
acid, amphotericin B, fluconazole, itraconazole, ketoconazole,
nystatin, and the like. Other examples of antibiotics will readily
suggest themselves to those of ordinary skill in the art.
[0102] The present invention also relates to a method for the
disinfection of objects other than living beings, such as, for
example, surgery tools, hospital inventory, dental tools,
slaughterhouse inventory and tools, dairy inventory and tools,
barber and beautician tools, and the like, which comprises
contacting the stated objects with the modified PNA molecules and
modified oligonucleotides.
[0103] As used herein, the term "contacting" is employed in the
broadest possible sense to mean any method of juxtaposition. Thus,
contacting the object to be disinfected with modified PNA molecules
and modified oligonucleotides includes all manner of applying the
modified PNA molecules and modified oligonucleotides to the object,
including brushing, coating, spraying, mixing, dipping, and the
like. It is also contemplated that contacting includes
juxtaposition for longer or shorter periods of time.
EXAMPLES
[0104] The following examples are merely illustrative of the
present invention and should not be considered as limiting of the
scope of the invention in any way. The principle of the present
invention is shown using E. coli as a test organism. However, as
shown in Example 19, the advantageous effect applies in the same
way to other bacteria. Additional objects, features, and advantages
of the invention will be apparent from the following description of
the presently preferred embodiments.
[0105] The following abbreviations related to reagents are used
herein: (The monomers and the PNA sequences are stated in bold)
1TABLE 1 A monomer N-(2-Boc-aminoethyl)-N-(N.sup.6--
(benzyloxycarbonyl) adenine-9-yl-acetyl)glycine Boc Tert
butyloxycarbonyl Boc- N-.alpha.-Boc-N-.epsilon.-2-chlorobenzyloxyc-
arbonyl-L-lysine Lys(2-Cl-Z)-OH C monomer
N-(2-Boc-aminoethyl)-N-(N.sup.4-(benzyloxycarbonyl)
cytosine-1-yl-acetyl)glycine DCM Dichloromethane DIEA
N,N-diisopropylethylamine DMF N,N-dimethylformamide DMSO Dimethyl
sulfoxide G monomer N-(2-Boc-aminoethyl)-N-(N.sup.2-(benz-
yloxycarbonyl) guanine-9-yl-acetyl)glycine HATU
N-[(1-H-benzotriazole-1-yl)(dimethylamine) methylene]-N-
methylmethanaminiuimhexafluorophosphate N-oxide HBTU
2-(1-H-benzotriazole-1-yl)-1,1,3, 3-tetramethyluronium
hexafluorophosphate J monomer N-(2-Boc-aminoethyl)-N-(N-2-(benzylo-
xycarbonyl) /nucleobase isocytosine-5-yl-acetyl)glycine MBHA resin
p-methylbenzhydrylamine resin NMP N-methyl pyrrolidone T monomer
N-(2-Boc-aminoethyl)-N-(thymine-1-yl-acetyl) glycine TFA
Trifluoroacetic acid TFSMA Trifluoromethanesulphonic acid Tris
2-amino-2-(hydroxymethyl)-1,3-propanediol
[0106] The following abbreviations relating to linking groups are
used herein: (The linking groups as starting materials are
indicated with capital letters whereas the linking groups in the
finished peptide-PNA conjugate are indicated with small
letters.)
2TABLE 2 Abbreviation Linker (IUPAC) SMCC Succinimidyl
4-(N-maleimidomethyl)cyclohexane-1- carboxylate LCSMCC Succinimidyl
4-(N-maleimidomethyl)cyclohexane-1- carboxy-(6-amido-caproate) MBS
Succinimidyl m-maleimido-benzoylate EMCS Succinimidyl
N-.epsilon.-maleimido-caproylate SMPH Succinimidyl
6-(.beta.-maleimido-propionamido) hexanoate AMAS Succinimidyl
N-(.alpha.-maleimido acetate) SMPB Succinimidyl
4-(p-maleimidophenyl)butyrate b.ALA .beta.-alanine PHG
Phenylglycine ACHC 4-aminocyclohexanoic acid b.CYPR
.beta.-(cyclopropyl) alanine AHA, AHEX 6-amino-hexanoic acid ADO,
AEEA-OH ((2-aminoethoxy)ethoxy)acetic acid or 8-amino-3,
6-dioxaoctanoic acid ADC Amino dodecanoic acid
[0107] General Procedures
[0108] The linking groups containing a succinimidyl group are shown
in FIG. 5. All the linking groups are commercially available.
Mixtures of solvents are indicated on a volume basis, i.e. 30/2/10
(v/v/v).
[0109] Preparative HPLC was performed on a DELTA PAK (Waters)(C18,
15 .mu.m, 300 A, 300.times.7.8 mm, 3 ml/minute). A linear gradient
from solvent A: 0.1% TFA in water to B: 0.1% TFA in acetonitrile
was used. 0-2 minutes B 10%, 2-30 minutes 40% B, 30-35 minutes 100%
B, 35-37 minutes 100% B, 37-38 minutes 10% B, 37-50 minutes 10%
B.
[0110] Mass Spectrometry was performed on MALDI (Matrix Assisted
Laser Desorption and lonisation Time of Flight Mass Spectrometry)
as HP MALDI-TOF # G2025A calibrated with peptide nucleic acids of
the following weights: MW1=1584.5 g/mol, MW.sub.2=3179.0 g/mol and
MW.sub.3=4605.4 g/mol.
Example 1
Preparation of H-KFFKFFKFFK-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID NO
18)
[0111] The peptide-PNA-chimera H-KFFKFFKFFK-ado-TTC AAA CAT
AGT-NH.sub.2 (SEQ ID NO: 18) was synthesized on 50 mg MBHA resin
(loading 100 .mu.mol/g) (novabiochem) in a 5 ml glass reactor with
a D-2 glass filter. Deprotection was performed with 2.times.600
.mu.L TFA/m-cresol 95/5 followed by washing with DCM, DMF, 5% DIEA
in DCM and DMF. The coupling mixture was a 200 .mu.l 0.26 M
solution of monomer (Boc-PNA-T-monomer, Boc-PNA-A-monomer,
Boc-PNA-G-monomer, Boc-PNA-C-monomer, Boc-AEEA-OH (ado) (PE
Biosystems Inc.)) in NMP mixed with 200 .mu.l 0.5 M DIEA in
pyridine and activated for 1 minute with 200 .mu.l 0.202 M HATU
(PE-biosystems) in NMP. The coupling mixture for the peptide part
was a 200 .mu.l 0.52 M NMP solution of amino acid (Boc-Phe-OH and
Boc-Lys(2-Cl-Z)-OH (novabiochem)) mixed with 200 .mu.l 1 M DIEA in
NMP and activated for 1 minute with 200 .mu.l 0.45 M HBTU in NMP.
After coupling, the resin was washed with DMF, DCM, and capped with
2.times.500 .mu.l NMP/pyridine/acetic anhydride 60/35/5. Washing
with DCM, DMF and DCM terminated the synthesis cycle. The oligomer
was deprotected and cleaved from the resin using "low-high" TFMSA.
The resin was rotated for 1 hour with 2 ml of
TFA/dimethylsulfid/m-cresol/TFMSA 10/6/2/0.5. The solution was
removed and the resin was washed with 1 ml of TFA and 1.5 ml of
TFMSA/TFA/m-cresol 2/8/1 was added. The mixture was rotated for 1.5
hours and the filtrate was precipitated in 8 ml diethylether.
[0112] The precipitate was washed with 8 ml of diethylether. The
crude oligomer was dissolved in water and purified by HPLC.
Preparative HPLC was performed on a DELTA PAK (Waters) (C18, 15
.mu.m, 300 .ANG., 300.times.7.8 mm, 3 ml/minute) A linear gradient
from solvent A: 0.1% TFA in water to B: 0.1% TFA in acetonitrile
was used. 0-2 minutes B 10%, 2-30 minutes 40% B, 30-35 minutes 100%
B, 35-37 minutes 100% B, 37-38 minutes 10% B, 37-50 minutes 10% B.
MW calculated: 4791.9 g/mol; found on MALDI: 4791 g/mol.
Example 2
Maleimide activation of PNA
[0113] PNA-oligomer ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID NO: 19)
(purified by HPLC) (2 mg, 0.589 .mu.mol, MW 3396.8) was dissolved
and stirred for 15 minutes in NMP:DMSO 8:2 (2 ml). Succinimidyl
4-(N-maleimidomethyl)cycl- ohexane-1-carboxylate (SMCC)
(PIERCE)(1.1 mg, 3.24 .mu.mol, 5.5 eq.), dissolved in NMP (50
.mu.l) and DIEA (34.7 .mu.1, 198.7 .mu.mol), was added to the
solution. The reaction mixture was stirred for 2.5 hours. The
product was precipitated in diethylether (10 mL) and the
precipitate was washed with ether:NMP, 10:1(3.times.10 mL), and
ether (3.times.10 ml). MW calculated: 3615.8 g/mol; found on MALDI:
3613.5 g/mol. The product was used without further
purification.
Example 3
Conjugation of Peptide and Maleimide Activated PNA
[0114] A solution of peptide CKFFKFFKFFK (SEQ ID NO: 20) (0.5 mg in
200 .mu.l degassed Tris buffer 10 mM, pH 7.6 (329 nM)) was added to
a solution of the above activated product (0.2 mg in 200 .mu.l
DMF:Water 1:1). The reaction mixture was stirred overnight. The
target compound was purified by HPLC directly from the crude
reaction mixture. Preparative HPLC was performed on a DELTA PAK
(Waters) (C18, 15 .mu.m, 300 .ANG., 300.times.7.8 mm, 3 ml/minute)
A linear gradient from solvent A: 0.1% TFA in water to B: 0.1% TFA
in acetonitrile was used. 0-2 minutes B 10%, 2-30 minutes 40% B,
30-35 minutes 100% B, 35-37 minutes 100% B, 37-38 minutes 10% B,
37-50 minutes 10% B. MW calculated: 5133.0 g/mol; found on MALDI:
5133 g/mol.
Example 4
Preparation of H-LLKKLAKALKG-ahex-ado-CCATCTAATCCT-NH.sub.2 (SEQ ID
NO: 21)
[0115] Preparation of H-LLKKLAKALKG-ahex-ado-CCATCTAATCCT-NH.sub.2
(SEQ ID NO: 21) was performed in accordance with example 1, except
6-aminohexanoic acid (ahex) and 8-amino-3,6-dioxaoctanoic acid
(ado) were used as linkers.
Example 5
Preparation of
H-KFFKFFKFF-ado-JTJTJJT-ado-ado-ado-TCCCTCTC-Lys-NH.sub.2 (SEQ ID
NO: 22)
[0116] Preparation of
H-KFFKFFKFF-ado-JTJTJJT-ado-ado-ado-TCCCTCTC-Lys-NH.- sub.2 (SEQ ID
NO: 22) was performed in accordance with example 1, except PNA
oligomer ado-JTJTJJT-ado-ado-ado-TCCCTCTC-Lys-NH.sub.2 (SEQ ID NO:
23) was used instead of ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID NO:
19). This PNA is a triplex forming bis-PNA in which C (cytosine) in
the "Hoogsteen strand" is exchanged with the J nucleobases (a
substitute for protonated C). This substitution assures efficient
triplex formation at physiological pH (Egholm, et al., Nucleic
Acids Res., 1995, 23,217).
Example 6
Preparation of Peptide-PNA-Chimeras
[0117] The following peptide-PNA-chimeras were prepared as
described above.
3TABLE 3 1 H-KFFKFFKFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO:
24) 2 H-FFKFFKFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 25) 3
H-FKFFKFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 26) 4
H-KFFKFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 27) 5
H-FFKFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 28) 6
H-FKFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 29) 7
H-KFFK-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 30) 8 H-FFK-ado-CAT
AGC TGT TTC-NH.sub.2 (SEQ ID NO: 31) 9 H-FK-ado-CAT AGC TGT
TTC-NH.sub.2 (SEQ ID NO: 32) 10 H-K-ado-CAT AGC TGT TTC-NH.sub.2
(SEQ ID NO: 33) 11 H-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 34)
84 H-KFFKFFKFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 35) 85
H-FFKFFKFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ lID NO: 36) 86
H-FKFFKFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 37) 87
H-KFFKFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 38) 88
H-FFKFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 39) 89
H-FKFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 40) 90
H-KFF-ado-CAT AGC TGT TTC-NH.sub.2 (SEQ ID NO: 41) 91 H-FF-ado-CAT
AGC TGT TTC-NH.sub.2 (SEQ ID NO: 42) 92 H-F-ado-CAT AGC TGT
TTC-NH.sub.2 (SEQ ID NO: 43) 109 H-KFFKFFKFFK-ado-TTC AAA CAT
AGT-NH.sub.2 (SEQ ID NO: 18) 136 H-KFFKFFKFFK-ado-TGA CTA GAT
GAG-NH.sub.2 (SEQ ID NO: 44) 130 H-KFFKFFKFFK-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 45) 140 H-KFF-ado-JTJTJJT-ado-ado-ado-TCC
TCT C-Lys-NH.sub.2 (SEQ ID NO: 46) 141
H-FKFF-ado-JTJTJJT-ado-ado-ado-TCC TCT C-Lys-NH.sub.2 (SEQ ID NO:
47) 142 H-FFKFF-ado-JTJTJJT-ado-ado-ado-TCC TCT C-Lys-NH.sub.2 (SEQ
ID NO: 48) 143 H-KFFKFF-ado-JTJTJJT-ado-ado-ado-TCC TCT
C-Lys-NH.sub.2 (SEQ ID NO: 49) 144
H-FKFFKFF-ado-JTJTJJT-ado-ado-ado-TCC TCT C-Lys-NH.sub.2 (SEQ ID
NO: 50) 145 H-FFKFFKFF-ado-JTJTJJT-ado-ado-ado-TCC TCT
C-Lys-NH.sub.2 (SEQ ID NO: 51) 146
H-KFFKFFKFF-ado-JTJTJJT-ado-ado-ado-TCC TCT C-Lys-NH.sub.2 (SEQ ID
NO: 52) 170 H-FFKFFKFFK-GGC-smcc-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ
ID NO: 53) 171 H-FFRFFRFFR-GGC-smcc-ado-TTC AAA CAT AGT-NHhd 2 (SEQ
ID NO: 54) 172 H-LLKLLKLLK-GGC-smcc-ado-TTC AAA CAT AGT-NH.sub.2
(SEQ ID NO: 55) 173 H-LLRLLRLLR-GGC-smcc-ado-TTC AAA CAT
AGT-NH.sub.2 (SEQ ID NO: 56) 174 H-LLKKLAKALK-GC-smcc-ado- -TTC AAA
CAT AGT-NH.sub.2 (SEQ ID NO: 57) 175 H-KRRWPWWPWKK-C-smcc-ado-TTC
AAA CAT AGT-NH.sub.2 (SEQ ID NO: 58) 176
H-KFKVKFVVKK-GC-smcc-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID NO: 59)
177 H-LLKLLLKLLLK-C-smcc-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID NO:
60) 178 H-FFKFFKFFK-GGC-smcc-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID
NO: 61) 179 H-KFFKFFKFFK-C-smcc-ado-- TTC AAA CAT AGT-NH.sub.2 (SEQ
ID NO: 62) 218 H-F-ado-CCA TCT AAT CCT-NH.sub.2 (SEQ ID NO: 63) 219
H-FF-ado-CCA TCT AAT CCT-N.sub.2 (SEQ ID NO: 64) 220 H-KEF-ado-CCA
TCT AAT CCT-NH.sub.2 (SEQ ID NO: 65) 221 H-FKFF-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 66) 222 H-FFKFF-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 67) 223 H-KFFKFF-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 68) 224 H-FKFFKFF-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 69) 225 H-FFKFFKFF-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 70) 226 H-KFFKFFKFF-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 71) 228 H-LLKKLAKALKG-ahex-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 21) 229 H-LLKKLAKALKG-ado-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 72) 230 H-KFFKFFKFFK-ado-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 73) 231 H-KFFKFFKFFK-ahex-ado-CCA TCT AAT
CCT-NH.sub.2 (SEQ ID NO: 74) 232 H.sub.2N-KFFKFFKFFK-C-sm-
cc-ado-CCA TCT AAT CCT-NH.sub.2 (SEQ ID NO: 75) 233
H.sub.2N-LLKKLAKALK-GC-smcc-ado-CCA TCT AAT CCT-NH.sub.2 (SEQ ID
NO: 76) 234 H.sub.2N-KFFKFF-C-smcc-ado-CCA TCT AAT CCT-NH.sub.2
(SEQ ID NO: 77) 249 H-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ ID NO: 78)
371 H.sub.2N-KFFKVKFVVKK-C-smcc-ado-TTC AAA CAT AGT-NH.sub.2 (SEQ
ID NO: 79) 381 H.sub.2N-KFFKVKFVVKK-C-smcc-ado-TTG TGC CCC
GTC-NH.sub.2 (SEQ ID NO: 80)
Example 7
Preparation of Peptide-PNA Chimeras
[0118] The peptide-PNA-chimeras listed in Table 4 were prepared as
described in Example 1 using the linking groups as defined
above.
4TABLE 4 PA no. Sequence MW 437
H.sub.2N-KKFKVKFVVKKC-achc-.beta..ala-TTCAAACATAGT-NH.sub.2 (SEQ ID
NO: 81) 4808 432 H-KFFKFFKFFK-achc-.beta..ala-TT-
CAAACATAGT-NH.sub.2 (SEQ ID NO: 82) 4848 418
H.sub.2N-KKFKVKFVVKKC-lcsmcc-ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
83) 5203 419 H.sub.2N-KKFKVKFVVKKC-mbs-ado-TTCAAACATAGT-NH.su- b.2
(SEQ ID NO: 84) 5070 420 H.sub.2N-KKFKVKFVVKKC-emcs-ad-
o-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 85) 5064 421
H.sub.2N-KKFKVKFVVKKC-smph-ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
86) 5135 422 H.sub.2N-KKFKVKFVVKKC-amas-ado-TTCAAACATAGT-NH.sub.2
(SEQ ID NO: 87) 5008 423 H.sub.2N-KKFKVKFVVKKC-smp.beta.--
ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 88) 5112 446
H.sub.2N-KKFKVKFVVKKC-lcsmcc-gly-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
89) 5109 447 H.sub.2N-KKFKVKFVVKKC-lcsmcc-.beta..ala-TTCAAACA-
TAGT-NH.sub.2 (SEQ ID NO:90) 5121 448
H.sub.2N-KKFKVKFVVKKC-lcsmcc-.beta..cypr-TTCAAACATAGT-NH.sub.2 (SEQ
ID NO: 91) 5147 449 H.sub.2N-KKFKVKFVVKKC-lcsmcc-aha-TTCAAAC-
ATAGT-NH.sub.2 (SEQ ID NO: 92) 5163 450
H.sub.2N-KKFKVKFVVKKC-lcsmcc-adc-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
93) 5247
Example 8
Preparation of Peptide-DNA Chimeras
[0119] The peptide-PNA-chimeras listed in Table 5 were prepared as
described in Example 1 using the linking groups as defined
above.
5TABLE 5 PA no. Mw Sequence S 201 4943,30
H-KFFKFFKFFK-ado-ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 94) S 202
4841,40 H-KFFKFFKFFK-ado-Gly-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 95)
S 203 4881,40 H-KFFKFFKLFFK-ado-P-TTCAAAC- ATAGT-NH.sub.2 (SEQ ID
NO: 96) S 204 4897,50 H-KFFKFFKFFK-ado-aha-TTCAAACATAGT-NH.sub.2
(SEQ ID NO: 97) S 205 4855,40
H-KFFKFFKFFK-ado-.beta..ala-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 98) S
206 4909,50 H-KFFKFFKFFK-ado-achc-TTCAAACATAGT-- NH.sub.2 (SEQ ID
NO: 99) S 207 4841,40 H-KFFKFFKFFK-Gly-ado-TTCAAACATAGT-NH.sub.2
(SEQ ID NO: 100) S 208 4765,40
H-KFFKFFKFFK-Gly-Gly-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 101) S 209
4805,50 H-KFFKFFKFFK-Gly-P-TTCAAACATAGT-NH.sub- .2 (SEQ ID NO: 102)
S 210 4821,50 H-KFFKFFKFFK-Gly-aha-TTC- AAACATAGT-NH.sub.2 (SEQ ID
NO: 103) S 211 4779,40
H-KFFKFFKFFK-Gly-.beta..ala-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 104)
S 212 4833,50 H-KFFKFFKFFK-Gly-achc-TTCAAACATAGT-NH.sub.2 (SEQ ID
NO: 105 S 213 4881,40 H-KFFKFFKFFK-P-ado-TTCAAACATAGT-- NH.sub.2
(SEQ ID NO: 106) S 214 4805,50
H-KFFKFFKFFK-P-Gly-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 107) S 215
4845,50 H-KFFKFFKFFK-P-P-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 108) S
216 4861,60 H-KFFKFFKFFK-P-aha-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
109) S 217 4819,50 H-KFFKFFKFFK-P-.beta..ala-TTCAA-
ACATAGT-NH.sub.2 (SEQ ID NO: 110) S 218 4873,60
H-KFFKFFKFFK-P-achc-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 111) S 219
4897,50 H-KFFKFFKFFK-aha-ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 112)
S 220 4821,50 H-KFFKFFKFFK-aha-Gly-TTCAAACATAGT-NH.s- ub.2 (SEQ ID
NO: 113) S 221 4861,60 H-KFFKFFKFFK-aha-P-TTCAAACATAGT-NH.sub.2
(SEQ ID NO: 114) S 222 4877,60
H-KFFKFFKFFK-aha-aha-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 115) S 223
4835,50 H-KFFKFFKFFK-aha-.beta..ala-TTCAAACATAGT-NH- .sub.2 (SEQ ID
NO:116) S 224 4889,70 H-KFFKFFKFFK-aha-achc-TTCAAACATAGT-NH.sub.2
(SEQ ID NO:117) S 225 4855,40
H-KFFKFFKFFK-.beta..ala-ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:118) S
226 4779,40 H-KFFKFFKFFK-.beta..ala-Gly-TTCAAAC- ATAGT-NH.sub.2
(SEQ ID NO: 119) S 227 4819,50
H-KFFKFFKFFK-.beta..ala-P-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 120) S
228 4835,50 H-KFFKFFKFFK-.beta..ala-aha-TTCAAACATAGT-NH.sub.2 (SEQ
ID NO:121) S 229 4793,50 H-KFFKFFKFFK-.beta..ala-.be-
ta..ala-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 122) S 230 4847,60
H-KFFKFFKFFK-.beta..ala-achc-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 123)
S 231 4845,50 H-KFFKFFKFFK-P-p-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
124) S 232 4845,50 H-KFFKFFKFFK-P-P-TTCAAACAT- AGT-NH.sub.2 (SEQ ID
NO: 125) S 233 4907,70 H-KFFKFFKFFK-K-K-TTCAAACATAGT-NH.sub.2 (SEQ
ID NO: 126) S 234 4945,70 H-KFFKFFKFFK-F-F-TTCAAACATAGT-NH.sub.2
(SEQ ID NO: 127) S 235 4926,60
H-KFFKFFKFFK-F-K-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 128) S 236
4926,60 H-KFFKFFKFFK-K-F-TTCAAACATAGT-NH.s- ub.2 (SEQ ID NO: 129) S
237 4917,50 H-KFFKFFKFFK-phg-ado-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:
130) S 238 4841,50 H-KFFKFFKFFK-phg-Gly-TTCAAACATAGT-NH.sub.2 (SEQ
ID NO: 131) S 239 4881,60 H-KFFKFFKFFK-phg-P-TTCAAACATAGT-NH.sub-
.2 (SEQ ID NO: 132) S 240 4897,60 H-KFFKFFKFFK-phg-aha-TTC-
AAACATAGT-NH.sub.2 (SEQ ID NO: 133) S 241 4855,50
H-KFFKFFKFFK-phg-.beta..ala-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 134)
S 242 4909,60 H-KFFKFFKFFK-phg-achc-TTCAAACATAGT-NH.sub.2 (SEQ ID
NO:135) S 243 4909,50 H-KFFKFFKFFK-achc-ado-TTCAAACATA- GT-NH.sub.2
(SEQ ID NO:136) S 244 4833,50
H-KFFKFFKFFK-achc-Gly-TTCAAACATAGT-NH.sub.2 (SEQ ID NO:137) S 245
4873,60 H-KFFKFFKFFK-achc-P-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 138)
S 246 4889,60 H-KFFKFFKFFK-achc-aha-TTCAAACATAGT-NH.- sub.2 (SEQ ID
NO:139) S 247 4847,60
H-KFFKFFKFFK-achc-.beta..ala-TTCAAACATAGT-NH.sub.2 (SEQ ID NO: 140)
S 248 4901,70 H-KEFKFFKFFK-achc-achc-TTCAAACATAGT-NH.sub.2 (SEQ ID
NO: 141)
Example 9
Measurement of Bacterial Growth and Growth Inhibition
[0120] The ability of the compounds of the present invention to
inhibit bacterial growth can be measured in many ways, which are
clear to the skilled artisan. For the purpose of exemplifying the
present invention, bacterial growth is measured by the use of a
microdilution broth method according to NCCLS guidelines. The
present invention is not limited to this means of detecting
inhibition of bacterial growth. The following procedure illustrates
one means for measuring bacterial growth and growth inhibition.
[0121] Bacterial strain: E.coli K12 MG1655
[0122] Media:
[0123] 10% Mueller-Hinton broth, diluted with sterile water.
[0124] 10% LB broth, diluted with sterile water.
[0125] 100% Mueller-Hinton broth.
[0126] Trays: 96 well trays, Costar # 3474, Biotech Line AS,
Copenhagen. (Extra low sorbent trays are used in order to
prevent/minimize adhesion of PNA to tray surface).
[0127] A logphase culture of E.coli is diluted with fresh preheated
medium and adjusted to a defined OD (here: Optical Density at 600
nm) in order to result in a final concentration of 5.times.10.sup.5
and 5.times.10.sup.4 bacteria/ml medium in each well, which
contains 200 .mu.l of bacterial culture. PNA is added to the
bacterial culture to yield final concentrations ranging from 300 nM
to 1000 nM. Trays are incubated at 37.degree. C. by shaking in a
robot analyzer, PowerWave.sub.x, software KC.sup.4, Kebo.Lab,
Copenhagen, for 16 hours and optical densities are measured at 600
nM throughout the incubation in order to record growth curves.
Wells containing bacterial culture without PNA are used as controls
to ensure correct inoculum size and bacterial growth during the
incubation. Cultures are tested in order to detect
contamination.
[0128] The individual peptide-L-PNA constructs have molecular
weights between approximately 4,200 and 5,000, depending upon the
composition. All tests were therefore performed on a molar basis
rather than on a weight/volume basis. Assuming an average MW of
4,500, a concentration of 500 nM equals 2.25 microgram/ml.
[0129] Growth Inhibitory Effect of PNA-Constructs:
[0130] Bacterial growth is described by the lag phase, i.e., the
period until (before) growth starts, the log phase, i.e., the
period with maximal growth rate, the steady-state phase, and
finally the death phase. These parameters are used to evaluate the
inhibitory (Minimal Inhibitory Concentration, abbr. MIC) and
bactericidal (Minimal Bactericidal Concentration, abbr. MBC) effect
of PNA on bacterial growth by comparing growth curves with and
without PNA. Total inhibition of bacterial growth is defined as: OD
(16 hours)=OD (0 hours,) or no visible growth, according to NCCLS
Guidelines
[0131] In an initial screen modified PNA molecules are tested in
the sensitive 10% medium assay. Positive results are then run in
the 100% medium assay in order to verify the inhibitory effect in a
more "real" environment (cf. the American guidelines (NCCLS)).
Example 10
Measurement of in vivo Antibacterial Efficacy
[0132] In vivo antibacterial efficacy is established by testing a
compound of the invention in the mouse peritonitis/sepsis model as
described by N. Frimodt-M.o slashed.ller et al., 1999, Chap. 14,
Handbook of Animal Models of Infection. A number of female NMRI
mice are inoculated with 10.sup.7 cfu of E. coli ATCC 25922
intraperitoneally. At one hour post-infection the mice are treated
once in groups with: 1) Gentamycin (38 mg/kg s.c.); 2) Ampicillin
(550 mg/kg s.c.); 3) a compound of the invention (50-60 mg/kg
i.v.); and 4) no treatment. Samples are drawn from blood and
peritoneal fluid at 1, 2, 4, and 6 hours post infection, and cfu/ml
are counted.
Example 11
Bacterial Growth Inhibition with PNAs Targeted Against Penicillin
Binding Proteins (PBPs)
[0133] Description of a Primary Screen
[0134] The bacterial growth assay is designed to identify modified
PNA molecules that inhibit or completely abolish bacterial growth.
Growth inhibition results from antisense binding of PNA to mRNA of
the targeted gene. The compound tested is present during the entire
assay.
[0135] Components
[0136] The experimental bacterial strain used is Escherichia coli
K12 MG1655 (E. coli Genentic Stock Center, Yale University, New
Haven). The medium for growth is 10% sterile LB (Lurea Bertani)
medium. E. coli test cells are pre-cultured in LB medium at
37.degree. C. over night (over night culture). The screen is
performed in 96-well microtiter plates at 37.degree. C. with
constant shaking. PNAs are dissolved in H.sub.2O as a
40.times.concentrated stock solution.
[0137] Assay Conditions
[0138] A fresh culture (test culture) is inoculated with an
overnight culture and grown to mid-log-phase (OD.sub.600=0.1
corresponding to 10.sup.7 cells/ml) at 37.degree. C. The test
culture is diluted stepwise in the range 10.sup.5 to 10.sup.1 with
10% LB medium. 195 .mu.l of diluted culture and 5 .mu.l of a
40.times.concentrated PNA stock solution are added to each test
well. 96-well microtiter plates are incubated in a microplate
scanning spectrophotometer at 37.degree. C. under constant shaking.
OD.sub.600 measurements are performed automatically every 3.19
minutes and recorded simultaneously.
[0139] Target Genes:
[0140] Penicillin Binding Proteins (PBPs)
[0141] PBPs act in the biosynthesis of murein (peptidoglycan),
which is part of the envelope of Gram-positive and Gram-negative
bacteria. PBPs are inhibited by the binding of penicillin, which
acts as substrate analogue. Hydrolytic enzymes are activated by the
accumulation of peptidoglycan intermediates and hydrolyze the
peptidoglycan layer, causing lysis.
[0142] E.coli has 7-9 PBPs, including the high molecular weight
PBPs: PBP1A and PBP1B, PBP2, and PBP3, and the low molecular weight
PBPs: PBP 4-9. The high molecular weight PBPs are essential for
growth, whereas the low molecular weight PBPs are not.
[0143] PNA Design No. 1
[0144] PNA26 has been designed according to the sequence of the
mrcA (pona) gene of E. coli, encoding PBP1A. The sequence of the
mrcA gene (accession number X02164) was obtained from the EMBL
sequence database (Heidelberg, Germany) (Broome-Smith et al., Eur J
Biochem, 1985, 147, 437). The sequence of the mrcA gene is shown in
FIG. 3.
[0145] The target region of PNA26 is the following:
6 sense 5'AATGGGAAATTTCCAGTGAAGTTCGTAAAG3' (SEQ ID NO: 142) 121
---------+--------+---------+ 150 antisense
3'TTACCCTTTAAAGGTCACTTCAAGCATTTC5' (SEQ ID NO: 143)
[0146] The coding and the non-coding (antisense) strands of the GTG
start codon region are shown. The sequence of the GTG start codon
region of the antisense strand and PNA26 are shown in the 5' to 3'
orientation:
7 antisense (SEQ ID NO: 143) 5'CTTTACGAACTTCACTGGAAATTT- CCCATT3'
PNA26 (SEQ ID NO: 144)
H-KFFKFFKFFK-ado-CACTGGAAATTT-Lys-NH.sub.2
[0147] PNA26 is a 12mer PNA molecule (shown in bold) coupled to a
10 amino acid peptide. Growth assay with PNA26
[0148] The assay was performed as follows. Dilutions of the test
culture corresponding to 10.sup.5, 10.sup.4, 10.sup.3, 10.sup.2 and
10.sup.1 cells/ml containing PNA26 at a final concentration of 1.5,
2.0, 2.5, 3.0 and 3.5 .mu.M are incubated at 37.degree. C. for 16
hours with constant shaking. Total inhibition of growth can be seen
in cultures with 10.sup.4-10.sup.1 cells/ml and a PNA concentration
of at least 2.5 .mu.M (Table 6).
[0149] PNA Design No. 2
[0150] PNA14 has been designed according to the sequence of the
mrdA gene encoding PBP2. The sequence (accession number AE000168,
bases 4051-5952) was obtained from the E. coli genome database at
the NCBI (Genbank, National Centre for Biotechnology Information,
USA). The sequence of the mrda gene is shown in FIG. 4.
[0151] The target region of PNA14 is the following:
8 sense 5'GAGTAGAAAACGCAGCGGATGAAACTACAGAAC3' (SEQ ID NO: 145) 99
---------+---------+---------+--- 131 antisense
3'CTCATCTTTTGCGTCGCCTACTTTGATGTCTTG5' (SEQ ID NO: 146)
[0152] Both the coding (sense) and the non-coding (antisense)
strand of the GTG start codon region are shown.
[0153] In the following sequence of the ATG start codon region of
the antisense strand and PNA26 are shown in the 5' to 3'
orientation:
9 antisense (SEQ ID NO: 146) 5'GTTCTGTAGTTTCATCCGCTGCGT-
TTTCTACTC3' PNA14 (SEQ ID NO: 147)
H-KFFKFFKFFK-ado-TTTCATCCGCTG-Lys-NH.sub.2
[0154] PNA14 is a 12mer PNA molecule (shown in bold) coupled to a
10 amino acid peptide.
[0155] Growth Assay with PNA14
[0156] The assay was performed as follows. Dilutions of the test
culture corresponding to 10.sup.5, 10.sup.4, 10.sup.3, 10.sup.2 and
10.sup.1 cells/ml containing PNA14 at a final concentration of 1.3,
1.4 and 1.5 .mu.M are incubated at 37.degree. C. for 16 hours with
constant shaking. Total inhibition of growth can be seen in
cultures with 10.sup.4-10.sup.1 cells/ml and a PNA concentration of
at least 1.4 .mu.M (Table 7).
Example 12
Bacterial Growth Inhibition with PNA Targeted Against the LacZ
Gene
[0157] Peptides are truncated versions of the KFF-motif. The basic
peptide sequence is KFFKFFKFFK (SEQ ID NO: 148) (PNA 1). PNA 2, 3,
4, 5, 6, 7, 8, 9, 10 and 11 all contain peptides which are
truncated from the C-terminal end. PNA 84, 85, 86, 87, 88, 89, 90,
91 and 92 all contain peptides which are truncated from the
N-terminal end. The PNA targeted against the LacZ-gene has been
synthesized with and without an --NH.sub.2 terminal lysine.
[0158] The assay was performed as follows. Dilutions of the test
culture E. coli K12 corresponding to 5.times.10.sup.5 and
5.times.10.sup.4 cells/ml, containing truncated versions of the
KFF-motif of the PNAs targeted against the LacZ gene, at final
concentrations of 100, 300, 750 and 1500 nM, were incubated in M9
minimal broth with lactose as the sole carbon source (minimal media
9, Bie & Bemtsen Cph) at 37.degree. C. for 16 hours with
constant shaking.
[0159] Total inhibition of growth was evident in cultures with
5.times.10.sup.4-10.sup.5 cells/ml and a PNA concentration of at
least 300 nM (see Table 8). The results show that the basic KFF
motif 10-mer, as well as truncated peptides thereof (4, 5, 6, and
9-mer), may be used to enhance the inhibitory effect of PNA.
10TABLE 6 Bacterial growth inhibition with PNA 26; E. coli K12 in
10% Mueller-Hinton broth PNA conc. in wells nM PNA 1500 2000 2500
3000-3500 Bacterial 1% 0.1% 0.1% 1% 0.1% 0.1% 1% 0.1% 0.1% 1% 0.1%
0.1% concentration 0.001% 0.0001% 0.001% 0.0001% 0.001% 0.0001%
0.001% 0.0001% 26 - - - - - - (+) + + + + + - - - - + + + + +:
Total inhibition of bacterial growth (+): Significantly extended
lagphase, (more than five times) -: Lagphase extended less than
five times nd: Not done
[0160]
11TABLE 7 Bacterial growth inhibition with PNA 14; E. coli K12 in
10% Mueller-Hinton broth PNA conc. in wells nM PNA 1300 1400 1500
Bacterial 1% 0.1% 0.1% 0.001% 1% 0.1% 0.1% 0.001% 1% 0.1% 0.1%
concentration 0.0001% 0.0001% 0.001% 0.0001% 14 - - - - (+) + + + +
+ + + - + + +: Total inhibition of bacterial growth (+):
Significantly extended lagphase, (more than five times) -: Lagphase
extended less than five times. nd: Not done
[0161]
12 TABLE 8 PNA conc. in well (nM) 100 300 750 1500 No of
bacteria/ml PNA Peptide Lysine 5 .times. 10.sup.5 5 .times.
10.sup.4 5 .times. 10.sup.5 5 .times. 10.sup.4 5 .times. 10.sup.5 5
.times. 10.sup.4 5 .times. 10.sup.5 5 .times. 10.sup.4 1 10-mer + -
- Nd - - (+) - Nd 2 9-mer + - - Nd - - - - Nd 84 9-mer - - - Nd - -
+ - Nd 3 8-mer + - - Nd - - - - Nd 85 8-mer - - - Nd - - - - Nd 4
7-mer + - - Nd - - - - Nd 86 7-mer - - - Nd - - - - Nd 5 6-mer + -
- Nd - - - - Nd 87 6-mer - - - Nd + - + - Nd 6 5-mer + - - Nd - -
(+) - Nd 88 5-mer - - - Nd - - - - Nd 7 4-mer + - - Nd - - (+) - Nd
89 4-mer - - - Nd - - - - Nd 8 3-mer + - - Nd - - - - Nd 90 3-mer -
- - Nd - - - - Nd 9 2-mer + - - Nd - - - - Nd 91 2-mer - - - Nd - -
- - Nd 10 1-mer + - - Nd - - - - Nd 92 1-mer - - - Nd - - - - Nd 11
0-mer + - Nd - - - - Nd +: Total inhibition of bacterial growth.
+): Significantly extended lagphase, (more than five times) -:
Lagphase extended less than five times; Nd: Not done
Example 13
Bacterial Growth Inhibition with PNA Targeted Against the infA Gene
of E. coli (Sequence as PNA 130)
[0162] PNA 130 and PNAs 218-226, targeted against the infA-gene,
were synthesized with peptides which were truncated versions of the
KFF-motif.
[0163] Growth Assay with PNA130
[0164] The assay was performed as follows. Dilutions of the test
culture E. Coli K12, corresponding to 2.times.10.sup.4 and
4.times.10.sup.4cells/ml, containing truncated versions of the
KFF-motif in PNAs targeted against the infa-gene, at final
concentrations of 200, 400, 600 800 and 1000 nM, were incubated in
10% Mueller-Hinton broth at 37.degree. C. for 16 hours with
constant shaking.
[0165] Total inhibition of growth was evident in cultures with
4.times.10.sup.4-2.times.10.sup.4 cells/ml and a PNA concentration
of at least 600 nM (Table 9). The results reveal that the basic KFF
motif 10-mer, as well as truncated peptides thereof (6 and 9-mer),
may be used to enhance the inhibitory effect of PNA.
13 TABLE 9 PNA conc. in wells (nM) 200 400 600 800 1000 No of
bacteria/ml PNA Peptide 4 .times. 10.sup.4 2 .times. 10.sup.4 4
.times. 10.sup.4 2 .times. 10.sup.4 4 .times. 10.sup.4 2 .times.
10.sup.4 4 .times. 10.sup.4 2 .times. 10.sup.4 4 .times. 10.sup.4 2
.times. 10.sup.4 218 1-mr - - - - - - - - - - 219 2-mr - - - - - -
- - - - 220 3-mr - - - - - - - - - - 221 4-mr - - - - - - - - - -
222 5-mr - - - - - - - - - - 223 6-mr - - - - - - (+) (+) (+) (+)
224 7-mr - - - - - - - - - - 225 8-mr - - - - - - - - - - 226 9-mr
- - - - - + (+) + (+) + 130 10-mr - - - - (+) + + + + + +: Total
inhibition of bacterial growth (+): Significantly extended
lagphase, (more than five times) -: Lagphase extended less than
five times nd: Not done
Example 14
Bacterial Growth Inhibition with PNA Targeted Against the
.alpha.-Sarcine Loop of ribosomal RNA
[0166] PNAs 140-146, targeted against the .alpha.-sarcine loop of
ribosomal RNA, were synthesized with peptides which were truncated
versions of the KFF-motif.
[0167] Growth Assay
[0168] The assay was performed as follows. Dilutions of the test
culture E. coli K12, corresponding to 2.times.10.sup.4 and
4.times.10.sup.4 cells/ml, containing truncated versions of the
KFF-motif in PNAs targeted against the a-sarcine loop of ribosomal
RNA, at final concentrations of 200, 400, 600, 800 and 1000 nM,
were incubated in 10% Mueller-Hinton broth at 37.degree. C. for 16
hours with constant shaking.
[0169] Total inhibition of growth was evident in cultures with
5.times.10.sup.5-5.times.10.sup.4 cells/ml and a PNA concentration
of at least 200 nM (Table 10). The results demonstrate that the
basic KFF motif 10-mer, as well as all truncated peptides thereof
comprising at least 3 amino acids, may be used to enhance the
inhibitory effect of PNA.
14 TABLE 10 PNA conc. in wells (nM) 200 400 600 800 1000
Bacteria/ml PNA Peptide 5 .times. 10.sup.5 5 .times. 10.sup.4 5
.times. 10.sup.5 5 .times. 10.sup.4 5 .times. 10.sup.5 5 .times.
10.sup.4 5 .times. 10.sup.5 5 .times. 10.sup.4 5 .times. 10.sup.5 5
.times. 10.sup.4 140 3-mr - - - - - (+) (+) (+) (+) 141 4-mr (+) +
+ + + + + + + + 142 5-mr - (+) (+) + (+) + + + + + 143 6-mr + + + +
+ + + + + + 144 7-mr - (+) + + + + + + + + 145 8-mr (+) (+) (+) + +
+ + + + + 146 9-mr - (+) + + + + + + nd nd +: Total inhibition of
bacterial growth (+): Significantly extended lagphase, (more than
five times) -: Lagphase extended less than five times nd: Not
done
Example 15
Bacterial Growth Inhibition with PNA Against the FtsZ Gene of E.
coli K12
[0170] Growth Assay with PNA170-179 and 109
[0171] The assay was performed as follows. Dilutions of the test
culture E. coli K12, 20 corresponding to 700 and 350 cells/ml,
containing variations of amphipathic 10, 11 and 12-mer structures
with smcc-linker in PNAs targeted against the FtsZ-gene, at final
concentrations of 200, 300, 400, 500, 600, 800 and 1000 nM, were
incubated in 100% Mueller-Hinton broth at 37.degree. C. for 16
hours with constant shaking.
[0172] Total inhibition of growth was evident in cultures with
350-700 cells/ml and a PNA concentration of at least 300 nM (Table
11). When comparing PNA109 with PNA 179, the smcc linker appears to
add some advantages to the molecule. Further, sequence 174 shows
promising results.
15 TABLE 11 Conc. PNA construct 200 nM 300 nM 400 nM 500 nM 600 nM
800 nM 1000 nM No of bacteria/ml PNA Peptide 700 350 700 350 700
350 700 350 700 350 700 350 700 350 170 12-mr - - - - - - - - - - -
- - - 171 12-mr - - - - - - - - - - + + + (+) 172 12-mr - - - - - -
- - - - - - - - 173 12-mr - - - - - - - - - - - - - - 174 12-mr - -
- + - + + + + + + + + + 175 12-mr - - - - - - - - - - - - - - 176
12-mr - - - - - - - - - - (+) (+) + + 177 12-mr - - - - - - - - - -
- - - - 178 12-mr - - - - - - - - - - - - - - 179 11-mr - - + + (+)
(+) + + + + + + + + 109 10-mr - - - - - - - - - - (+) (+) (+) (+)
+: Total inhibition of bacterial growth (+): Significantly extended
lagphase, (more than five times) -: Lagphase extended less than
five times; nd:Not done
Example 16
Bacterial Growth Inhibition by PNAs, Which Contain Various Linkers
and Peptides, Targeted Against the Gene Encoding IF-1 of E.
coli
[0173] For the 7 PNA's in this set-up, the sequence of the
nucleobases is the same as the sequence in PNA 130, but the linking
groups and the peptides vary.
16TABLE 12 PNA Linker Peptide PNA228 ahex-ado G-KLAKALKKLL (SEQ ID
NO: 149) PNA229 ado-ado G-KLAKALKKLL (SEQ ID NO: 150) PNA230
ado-ado KFFKFFKFF (SEQ ID NO: 151) PNA231 ahex-ado KFFKFFKFF (SEQ
ID NO: 152) PNA232 smcc-ado H-C-KFFKFFKFFK-NH.sub.2 (SEQ ID NO:
153) PNA233 smcc-ado H-CG-KLAKALKKLL-NH.sub.2 (SEQ ID NO: 154)
PNA234 smcc-ado H-C-FFKFFK-NH.sub.2 (SEQ ID NO: 155)
[0174] The experimental set-up corresponds to the set-up as
described in Example 15. As is evident from Table 13 and 14, the
smcc-ado linker is the superior linker, demonstrating total
inhibition of growth in cultures with
1.6.times.10.sup.3-8.times.10.sup.2 cells/ml and a PNA
concentration of at least 600 nM.
17 TABLE 13 PNA conc. in wells (nM) 200 400 600 800 1000 No of
bacteria/ml based on counting of colonies on agar plates PNA 1590
795 159 1590 795 159 1590 795 159 1590 795 159 1590 795 159 228 - -
- - - - - - - - - - - - - 229 - - - - - - - - - - - - - - - 230 - -
- - - - - - - - - - - - - 231 - - - - - - - - - - - - - - - 232 - -
- (+) (+) (+) + + + + + + + + + 233 - - - (+) (+) (+) + + + + + + +
+ + 234 - - - - - - - - - - - - - - - Data from 100% MH +: Total
inhibition of bacterial growth (+): Significantly extended
lagphase, (more than five times) -: Lagphase extended less than
five times; nd: Not done
[0175]
18 TABLE 14 PNA conc. in wells (nM) 200 400 600 800 1000 No of
bacteria/ml based on counting of colonies on agar plates PNA
10.sup.5 10.sup.4 10.sup.3 10.sup.5 10.sup.4 10.sup.3 10.sup.5
10.sup.4 10.sup.3 10.sup.5 10.sup.4 10.sup.3 10.sup.5 10.sup.4
10.sup.3 228 - - - - - - - - - - - (+) - (+) + 229 - - - - - - - -
- - (+) (+) - (+) + 230 - - - (+) (+) + + + + + + + + + + 231 - - -
- (+) (+) (+) + + + + + + + + 232 nd 233 nd 234 nd Data from 10% MH
+: Total inhibition of bacterial growth; (+): Significantly
extended lagphase, (more than five times) -: Lagphase extended less
than five times; nd: not done nd: not done
Example 17
Bacterial Growth Inhibition with 9 mer Peptide
[0176] To test the effect of a Peptide without a PNA, peptide no.
2339, H-KFFKFFKFF-OH (SEQ ID NO: 1), was added to E. coli K12 in
10% and 100% medium (Mueller-Hinton broth).
[0177] Growth Assay of Peptide no. 2339
[0178] The assay was performed as follows. Dilutions of the test
culture corresponding to 10.sup.5, 10.sup.4, and 10.sup.3 cells/ml
containing peptide no. 2339 at a final concentration of 100 to
20,000 nM, were incubated at 37.degree. C. for 16 hours with
constant shaking. Total inhibition of growth was evident in
cultures with 7.9.times.10.sup.3 cells/ml and a peptide
concentration of at least 20,000 nM, and minimal signs of growth
inhibition were detected at concentrations from 5,000 nM (10%
medium: Table 15; 100% medium: Table 16). The peptide was thus
active alone, but only at very high concentrations which were above
the range used for PNA growth assays.
19 TABLE 15 Peptide conc. in wells (nM) 100 300 500 700 No. of
bacteria/ml based on counting of colonies on agar plates Pep- tide
4.0 .times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times. 10.sup.3 4.0
.times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times. 10.sup.3 4.0
.times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times. 10.sup.3 4.0
.times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times. 10.sup.3 2339 - -
- - - - - - - - - - Peptide conc. in wells (nM) 900 1100 1300 1500
No. of bacteria/ml based on counting of colonies on agar plates
Pep- tide 4.0 .times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times.
10.sup.3 4.0 .times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times.
10.sup.3 4.0 .times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times.
10.sup.3 4.0 .times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times.
10.sup.3 2339 - - - - - - - - - - - - Peptide conc. in wells (nM)
2500 5000 10000 15000 No. of bacterial/ml based on counting of
colonies on agar plates Pep- tide 4.0 .times. 10.sup.4 7.9 .times.
10.sup.3 4.0 .times. 10.sup.3 4.0 .times. 10.sup.4 7.9 .times.
10.sup.3 4.0 .times. 10.sup.3 4.0 .times. 10.sup.4 7.9 .times.
10.sup.3 4.0 .times. 10.sup.3 4.0 .times. 10.sup.4 7.9 .times.
10.sup.3 4.0 .times. 10.sup.3 2339 - - - ((+)) ((+)) ((+)) ((+))
((+)) ((+)) ((+)) ((+)) ((+)) Peptide conc. in wells (nM) 20000 No.
of bacterial/ml based on counting of colonies on agar plates
Peptide 4.0 .times. 10.sup.4 7.9 .times. 10.sup.3 4.0 .times.
10.sup.3 2339 ((+)) + + +: Total inhibition of bacterial growth
(+): Significantly extended lagphase, (more than five times) ((+)):
Lagphase extended less than five times, but still with growth curve
effect -: Lagphase extended less than five times; nd: Not done
[0179]
20 TABLE 16 Peptide conc. in wells (nM) 100 300 500 700 900 1100
No. of bacteria/ml based on counting of colonies on agar plates
Peptide 1600 160 16 1600 160 16 1600 160 16 1600 160 16 1600 160 16
1600 160 16 2339 - - - - - - - - - - - - - - - - - - Peptide conc.
in wells (nM) 1300 1500 2500 5000 10000 15000 No. of bacteria/ml
based on counting of colonies on agar plates Peptide 1600 160 16
1600 160 16 1600 160 16 1600 160 16 1600 160 16 1600 160 16 2339 -
- - - - - - - - - - - - - - - - - Peptide conc. in wells (nM) 20000
No. of bacteria/ml based on counting of colonies on agar plates
Peptide 1600 160 16 2339 - - (+) +: Total inhibition of bacterial
growth (+): Significantly extended lagphase, (more than five times)
((+)): Lagphase extended less than five times, but still with
growth curve effect -: Lagphase extended less than five times nd:
Not done
Example 18
Bacterial Growth Inhibition with 9 mer Peptide and Non-Sense
PNA
[0180] Growth Assay of the Peptide No. 2339 Together with Nonsense
PNA 136
[0181] The assay was performed as follows. Dilutions of the test
culture corresponding to 10.sup.5, 10.sup.4 and 10.sup.3 cells/ml,
containing PNA 136 alone or PNA 136 and peptide No. 2339 in equal
amounts, at a final concentration of 400 to 1000 nM, were incubated
at 37.degree. C. for 16 hours with constant shaking. No growth
inhibition was detected at any of the concentrations (Table 17).
The nonsense PNA was thus not active in the chosen range.
21 TABLE 17 PNA/Peptide conc. in wells (nM) 400 500 600 700
Dilution factor for stock solution of bacteria with OD.sub.600 =
0.1 PNA Peptide F10.sup.2 F10.sup.3 F10.sup.4 F10.sup.2 F10.sup.3
F10.sup.4 F10.sup.2 F10.sup.3 F10.sup.4 F10.sup.2 F10.sup.3
F10.sup.4 2339 - - - - - - - - - - - - 136 - - - - - - - - - - - -
PNA/Peptide conc. in wells (nM) 800 900 1000 Dilution factor for
stock solution of bacteria with OD.sub.600 = 0.1 PNA Peptide
F10.sup.2 F10.sup.3 F10.sup.4 F10.sup.2 F10.sup.3 F10.sup.4
F10.sup.2 F10.sup.3 F10.sup.4 2339 - - - - - - - - - 136 - - - - -
- - - - +: Total inhibition of bacterial growth (+): Significantly
extended lagphase, (more than five times) ((+)): Lagphase extended
less than five times, but still with growth curve effect -:
Lagphase extended less than five times; nd: Not done
Example 19
Bacterial Growth Inhibition with PNA (Without Peptide) Targeted
Against the Gene Encoding FtsZ of E. coli and a Peptide
[0182] E. coli K12 was grown in 100% Mueller-Hinton broth. PNA 249
is identical to PNA 109, without the peptide but still with the
ado-linker. The Peptide of PNA 250 has the sequence:
H-CG-KLAKALKKLL-NH.sub.2 (SEQ ID NO: 156). The peptide is also used
for PNA 174. In the wells with both PNA and peptide there is equal
amount PNA and peptide. As can be seen in Table 18, neither 249 nor
250 alone nor 249 and 250 together show any useful effect in the
low concentration end. Only the peptide alone in concentrations
above 2500 nM may show growth inhibition effect.
22 TABLE 18 PNA conc. in wells (nM) 250 500 750 1000 1500 2000 2500
5000 No of bacteria/ml based on counting of colonies on agar plates
PNA Peptide 170 17 8 170 17 8 170 17 8 170 17 8 170 17 8 170 17 8
170 17 8 170 17 8 249 - - - - - - - - - - - - - - - - - - - - - nd
nd nd 250 nd nd nd - - - nd nd nd - - - - - - nd nd nd - - - (+)
(+) + PNA conc. in wells (nM) 10000 20000 500 + 500 1000 + 1000
1500 + 1500 2500 + 2500 No of bacteria/ml based on counting of
colonies on agar plates PNA Peptide 170 17 8 170 17 8 170 17 8 170
17 8 170 17 8 170 17 8 nd nd nd nd nd nd - - - - - - - - - - - -
249 250 + + + + + + +: Total inhibition of bacterial growth. (+):
Significantly extended lagphase, (more than five times) -: Lagphase
extended less than five times; nd: Not done
Example 20
Bacterial Growth Inhibition with PNA Against the Gene Encoding IF-1
of E. coli
[0183] E. coli K12 was grown in 10% Mueller-Hinton broth. Peptides
are versions of the KFF-motif placed C- or N-terminal to the PNA.
From Table 19 it can be seen that both orientation of the Peptide
work. However, for specific combinations of PNA and Peptide, one of
the orientations may be preferred.
23 TABLE 19 PNA conc. in wells (nM) 200 400 600 800 1000 No of
bacteria/ml based on counting of colonies on agar plates 5.2
.times. 2.6 .times. 5.2 .times. 5.2 .times. 2.6 .times. 5.2 .times.
5.2 .times. 2.6 .times. 5.2 .times. 5.2 .times. 2.6 .times. 5.2
.times. 5.2 .times. 2.6 .times. 5.2 .times. PNA Peptide Place
10.sup.4 10.sup.4 10.sup.3 10.sup.4 10.sup.4 10.sup.3 10.sup.4
10.sup.4 10.sup.3 10.sup.4 10.sup.4 10.sup.3 10.sup.4 10.sup.4
10.sup.3 130 10-mr N - - - - (+) (+) (+) + + + + + + + + 214 10-mr
C - - - (+) + + + + + + + + + + + 215 9-mr C - - - (+) + + (+) + +
+ + + + + + 216 6-mr C - - - - - - - - - - - - - (+) (+) 223 6-mr N
- - - - - - - - - - - - - - - 226 9-mr N - - - - - - - (+) + (+) +
+ + + 52 +: Total inhibition of bacterial growth (+): Significantly
extended lagphase, (more than five times) -: Lagphase extended less
than five times nd: Not done
Example 21
Inhibition of Bacterial Growth by PNA-Peptide Specific for the
Ribosomal .alpha.-sarine Loop
[0184] To demonstrate that the present invention may be used for
the treatment of many micro-organisms, a selection of Gram-negative
and Gram-positive bacteria were treated under the same assay
conditions as used in example 14. The modified PNA molecule used
was PNA 146.
24 Inhibition of growth Gram-negative organisms Escherichia coli +
Klebsiella pneumonia + Pseudomonas aeruginosa + Salmonella
typhimurium + Gram-positive organisms Staphylococcus aureus +
Enterococcus faecium + Micrococcos luteus +
[0185] Growth of the bacterial isolates was inhibited. Growth
inhibition of different Gram-negative and Gram-positive organisms
has thus been demonstrated under the same assay conditions as were
used for the testing of E. coli K.12.
Example 22
Preparation of Peptide-PNA-Chimeras
[0186] The following peptide-PNA-chimera was prepared as described
in Example 1:
H.sub.2N-SILAPLGTTLVKKVATTLKKIFSKWKC-smcc-Ado-TTCTAACATTTA-NH.-
sub.2 (SEQ ID NO: 159).
Example 23
Gene Target Selection and Bacterial Growth Inhibition with PNA
[0187] Gene Target Selection in E. faecalis/E. faecium
[0188] The annotated E. faecium genome is, along with 250 other
genomes, commercially available from Integrated Genomics, Chicago.
Single annotated genes from both organisms are also available in
Genbank.
[0189] In vitro Experiments
[0190] The ability of PNA conjugates to inhibit bacterial growth is
measured by the use of a microdilution broth method using 100%
Mueller-Hinton broth, according to NCCLS Guidelines. A logphase
culture of E. faecium is diluted with fresh, prewarmed medium and
adjusted to a defined OD (here: Optical Density at 600 nm) to yield
a final concentration of 1.times.10.sup.4 bacteria/ml medium in
each well, which contain 195 .mu.l of bacterial culture. PNA is
added to the bacterial culture to yield final concentrations
ranging from 450 nM to 1500 nM. Trays (e.g. Costar #3474) are
incubated at 35.degree. C. by shaking in a robot analyzer (96 well
microtiter format), PowerWave.sub.x, software KC.sup.4, Kebo.Lab,
Copenhagen, for 16 hours and optical densities are measured at 600
nm during the incubation in order to record growth curves. All
cultures are tested for the presence of contaminants.
[0191] MIC and MBC
[0192] Experiments were performed to evaluate the relationship
between MIC's and MBC's (Minimal Bactericidal Concentration) of the
PNA. The studies were performed using 3 strains of Enterococcus
faecium obtained from American Type Culture Collection (ATCC).
These strains served as initial indicators of possible interference
from known in vivo-selected vancomycin resistance mechanisms. The
table below summarizes the characteristics of the strains.
[0193] E. facium Strain: Description
[0194] 8803: susceptible to vancomycin, ciprofloxacin, gentamycin,
rifampin, teicoplanin
[0195] ATCC 51550: multidrugresistant (ampicillin, ciprofloxacin,
gentamycin, rifampin, teicoplanin, vancomycin
[0196] ATCC 700221: resistant to vancomycin
[0197] The experimental design is as follows. MIC's were detected
as previously described. Trays were incubated at 35.degree. C. for
an additional 24 hours in order to analyze regrowth of inhibited
bacteria (MBC's). The PNA conjugate from Example 22 was used as
were bacterial strains 8803, 51550, and 700221. The PNA
concentration in wells was 400, 800 and 1600 nM.
[0198] The Minimal Inhibitory Concentrations (MIC's) of the PNA
conjugate were as follows:
25 MIC MBC E. facium Strain .mu.g/ml-(nM) (.mu.g/ml)-nM 8803
.ltoreq.400 .ltoreq.400 ATCC 51550 .ltoreq.400 .ltoreq.400 ATCC
700221 .ltoreq.400 .ltoreq.400 Peptide control >5000 >5000
The peptide conjugate of Example 22
Example 24
Preparation of Peptide-PNA-Chimeras
[0199] The following peptide-PNA-chimera was prepared as described
in Example 1: H.sub.2N-KKFKVKFVVKKC-smcc-Ado-ACTTTGTCGCCC-NH.sub.2
(SEQ ID NO: 160).
Example 25
Gene Target Selection and Bacterial Growth Inhibition with PNA
[0200] The selection of potential gene targets and testing of
resultant PNA constructs were performed with Staphylococcus aureus
NCTC 8325, which was obtained from Prof. J. Iandolo, University of
Oklahoma Health Sciences Center, Department of Microbiology and
Immunology. The genome of S.aureus NCTC 8325 is currently being
sequenced at the S. aureus Genome Sequencing Project at the
University of Oklahoma's Advanced Center for Genome Technology
(OU-ACGT). The genome is 2.80 Mb, and 2,581,379 bp have been
sequenced. Annotated gene sequences are available from Genbank for
a number of putative targets.
[0201] Target Selection Approach
[0202] The basic approach used was similar to that used in the
previous example. Potential target genes were retrieved from the
unfinished genome sequences of S. aureus at the OU-ACGT, as well as
Genbank. The presence of homologous genes and target sequences in
bacterial genomes were tested using the BLAST 2.0 programs at the
NCBI (National Center for Biotechnology Information) www BLAST
server. The antibacterial PNA conjugate prepared in Example 24 was
used in the following experiments.
[0203] In vitro Experiments
[0204] The ability of PNA to inhibit bacterial growth is measured
by the use of a microdilution broth method using 100%
Mueller-Hinton broth, according to NCCLS Guidelines. A logphase
culture of S aureus is diluted with fresh, pre-warmed medium and
adjusted to a defined OD (here: Optical Density at 600 nm) in order
to yield a final concentration of 1.times.10.sup.4 bacteria/ml
medium in each well, which contains 195 .mu.l of bacterial culture.
PNA is added to the wells in order to yield final concentrations of
450 nM to 1500 nM. Trays (e.g. Costar #3474) are incubated at
35.degree. C. by shaking in a robot analyzer (96 well microtiter
format), PowerWave.sub.x, software KC.sup.4. Kebo.Lab, Copenhagen,
for 16 hours and optical densities are measured at 600 nm during
the incubation in order to record growth curves. All cultures are
tested for the presence of contaminants.
[0205] MIC and MBC:
[0206] Experiments were also performed to evaluate the relationship
between MIC's (Minimal Inhibitory Concentration) and MBC's (Minimal
Bactericidal Concentration) of the PNA's. The experiments were
performed using the reference strain Staphylococcus aureus NCTC
8325 obtained from Prof. J. Iandolo, University of Oklahoma Health
Sciences Center, Department of Microbiology and Immunology. Two
vancomycin resistant isolates of S.aureus obtained from American
Type Culture Collection were also used. These strains served as
initial indicators of possible interference from known in
vivo-selected vancomycin resistance mechanisms. The table below
summarizes the characteristics of the strains.
26 Vancomycin S.aureus Strain Description MIC (.mu.g/ml) 8325
susceptible to methicillin, vancomycin <0.5 ATCC 700698
intermediate vancomycin resistance 2 Resistant to methicillin ATCC
700698R highly vancomycinresistant subclone of 11 ATCC 700698
[0207] The experimental design is as follows. MIC's were detected
as described above. Trays were incubated at 35.degree. C. for an
additional 24 hours in order to analyze regrowth of inhibited
bacteria (MBC's). The PNA from Example 24 was used as were
bacterial strains 8325, 700698, and 700698R. PNA concentrations in
the wells were 400, 800 and 1600 nM. The Minimal Inhibitory
Concentrations (MIC) were as follows:
27 MIC MBC S.aureus Strain .mu.g/ml (nM) (.mu.g/ml) nM 8325
800/1600 1600 ATCC 700698 800/1600 1600 ATCC 700698R 800/1600
.gtoreq.1600
[0208] Peptide control
28 The peptide conjugate >5000 >5000 of Example 24
Example 26
Measurement of Antibacterial Effect in vivo
[0209] A compound of the invention was tested for antibacterial
effect in vivo according to the test described by N. Frimodt-M.o
slashed.ller. Untreated animals developed fulminant clinical signs
of infection. At all time points the compound of the invention
suppressed the E. coli cfu/ml as compared to non-treated controls
and was as efficient as the two positive controls.
[0210] All patents, patent publications, and literature references
cited in this specification are hereby incorporated by reference in
their entirety.
Sequence CWU 0
0
* * * * *