U.S. patent application number 10/323032 was filed with the patent office on 2003-09-18 for therapy and diagnosis of conditions related to telomere length and/or telomerase activity.
This patent application is currently assigned to University of Texas System Board of Regents. Invention is credited to Shay, Jerry, West, Michael D., Wright, Woodring.
Application Number | 20030175766 10/323032 |
Document ID | / |
Family ID | 26715521 |
Filed Date | 2003-09-18 |
United States Patent
Application |
20030175766 |
Kind Code |
A1 |
West, Michael D. ; et
al. |
September 18, 2003 |
Therapy and diagnosis of conditions related to telomere length
and/or telomerase activity
Abstract
Method and compositions are provided for the determination of
telomere length and telomerase activity, as well as the ability to
inhibit telomerase activity in the treatment of proliferative
diseases. Particularly, primers are elongated under conditions
which minimize interference from other genomic sequences, so as to
obtain accurate determinations of telomeric length or telomerase
activity. In addition, compositions are provided for intracellular
inhibition of telomerase activity.
Inventors: |
West, Michael D.; (Belmont,
CA) ; Shay, Jerry; (Dallas, TX) ; Wright,
Woodring; (Arlington, TX) |
Correspondence
Address: |
PERKINS COIE LLP
P.O. BOX 2168
MENLO PARK
CA
94026
US
|
Assignee: |
University of Texas System Board of
Regents
|
Family ID: |
26715521 |
Appl. No.: |
10/323032 |
Filed: |
December 18, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10323032 |
Dec 18, 2002 |
|
|
|
08483144 |
Jun 7, 1995 |
|
|
|
08483144 |
Jun 7, 1995 |
|
|
|
08038766 |
Mar 24, 1993 |
|
|
|
5489508 |
|
|
|
|
08038766 |
Mar 24, 1993 |
|
|
|
07882438 |
May 13, 1992 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
514/44R |
Current CPC
Class: |
C12N 5/0018 20130101;
C12N 15/1137 20130101; Y10S 977/801 20130101; G01N 2333/91245
20130101; Y10S 977/918 20130101; C12N 2510/04 20130101; Y02A 50/30
20180101; Y10T 436/10 20150115; C12N 5/163 20130101; C12Q 1/6876
20130101; Y10S 977/927 20130101; A61P 43/00 20180101; C12N 9/1241
20130101; C12Q 2600/136 20130101; A61K 31/7076 20130101; Y02A
50/411 20180101; Y10S 977/773 20130101; A61K 38/00 20130101; Y02A
50/409 20180101; C12N 15/10 20130101; C12N 2501/70 20130101; C12Q
2600/112 20130101; C12Q 1/686 20130101; A61K 31/522 20130101; A61K
31/70 20130101; A61P 35/00 20180101; C12Q 1/48 20130101; Y10T
436/11 20150115; C12N 15/113 20130101; Y10T 436/105831 20150115;
C12Q 1/6886 20130101; Y10T 436/115831 20150115; C12Y 207/07049
20130101; C12Q 1/68 20130101; C12Q 1/6827 20130101; C12Q 1/703
20130101; A61K 31/711 20130101; C12Q 1/6827 20130101; C12Q 2521/113
20130101; C12Q 1/68 20130101; C12Q 2521/113 20130101 |
Class at
Publication: |
435/6 ;
514/44 |
International
Class: |
C12Q 001/68; A61K
048/00 |
Claims
1. Method for treatment of a condition associated with an elevated
level of telomerase activity within a cells comprising the step of:
administering to said cell a therapeutically effective amount of an
inhibitor of said telomerase activity.
2. Method for treatment of a condition associated with an increased
rate of proliferation of a cell, comprising the step of:
administering to said cell a therapeutically effective amount of an
agent active to reduce loss of telomere length within said cell
during said proliferation.
3. Method for extending the ability of a cell to replicate,
comprising the step of: administering to said cell a replication
extending amount of an agent active to reduce loss of telomere
length within said cell during cellular replication.
4. A pharmaceutical composition comprising a therapeutically
effective amount of an inhibitor of telomerase activity in a
pharmaceutically acceptable buffer.
5. A pharmaceutical composition comprising a therapeutically
effective amount of an agent active to reduce loss of telomere
length within a cell during proliferation of said cell, in a
pharmaceutically acceptable buffer.
6. Method for diagnosis of a condition in a patient associated with
an elevated level of telomerase activity within a cell, comprising
the step of: determining the presence or amount of telomerase
within said cells in said patient.
7. Method for diagnosis of a condition associated with an increased
rate of proliferation in a cell in an individual, comprising the
steps of determining the length of telomeres within said cell.
8. Method for determining telomere length of an animal chromosome
or group of chromosomes, said method comprising: bringing together
in a reaction mixture said chromosome(s) or telomere comprising
fragment(s) thereof, a primer having at least two telomeric repeat
units, and nucleotide triphosphates having the same nucleosides as
the non-protruding strand of said telomere, wherein at least one of
said nucleotide triphosphates or primer is labeled with a
detectable label; and a DNA polymerase; incubating said reaction
mixture for sufficient time for said primer to be extended to
provide a primer extended sequence; separating said primer extended
by size; and determining the size of said primer extended sequence
by means of said label.
9. Method according to claim 8, wherein one of nucleotide
triphosphates is labeled with a radioisotope and said size is
determined by the level of radioactivity in relation to the amount
of DNA present.
10. Method according to claim 8, wherein said nucleosides are
combinations of A, T and C, or A, T and G.
11. Method of determining telomere length of an animal chromosome
or group of chromosomes, said method comprising: fragmenting said
chromosome(s) by a restriction endonuclease having a four base
recognition site absent in the telomere sequence; bringing together
said fragments and a primer for said telomeric sequence, wherein
said primer is labeled to allow for binding of said primer to a
surface; cross-linking said primer to said telomeric sequence;
isolating said telomeric sequence by means of said label; and
determining the size of said telomeric sequence bound to said
surface.
12. Method according to claim 11, wherein said primer is conjugated
with (1) an agent capable of cross-linking nucleic acids upon
irradiation; and (2) a specific binding pair member; and said
surface is conjugated with the complementary specific binding pair
member.
13. Method according to claim 11, wherein said primer is conjugated
with (1) an agent capable of cross-linking nucleic acids upon
irradiation; and (2) a particle.
14. Method of reducing the rate of telomere shortening in a
proliferating cellular composition, said method comprising:
introducing into cells of said cellular composition primers having
from 2 to 3 repeats of the repeating unit of the cellular
telomere.
15. Method of measuring the telomerase activity of a composition,
said method comprising: combining 1 or more repeats of the telomere
unit sequence and nucleotide triphosphates lacking cytidine
nucleotide, wherein at least one of said primer or nucleotide
triphosphates is labeled with a detectable label, with the proviso
that when said composition lacks a telomere sequence complementary
to said probe, said telomere sequence is added to said composition;
incubating said composition for a predetermined time for said
primer to be extended to provide an extended sequence; and
determining the rate of formation of said extended sequence.
16. Method according to claim 15, wherein one of said nucleotide
triphosphates is labeled with a radioisotope, and said determining
is by measuring radioactivity per unit weight of DNA.
17. Method of inhibiting the proliferation of telomerase comprising
immortalized cells, said method comprising: contacting said
immortalized cells with a telomerase inhibitor under conditions
wherein said inhibitor enters said cells; whereby said
proliferation of said cells is inhibited.
18. Method according to claim 17, wherein said inhibitor inhibits
expression of telomerase.
19. Method of according to claim 17, wherein said inhibition is an
oligonucleotide sequence comprising the complementary sequence of
the telomerase RNA.
20. Method according to claim 17, wherein said oligonucleotide
sequence is a ribozyme.
21. Method for extending the proliferative capability of a
mammalian cell population, said method comprising: adding to said
cells oligonucleotides comprising at least two repeats
complementary to the sequence of the protruding strand of the
telomere of the chromosomes of said cells, whereby the shortening
of said telomere is slowed.
Description
[0001] This application is a continuation-in-part of Michael D.
West et al., entitled "Telomerase Activity Modulation and Telomere
Diagnosis", filed May 13, 1992, and assigned U.S. Ser. No.
07/882,438, hereby incorporated by reference herein.
[0002] This invention relates to methods for therapy and diagnosis
of cellular senescence and immortalization.
BACKGROUND OF THE INVENTION
[0003] The following is a general description of art relevant to
the present invention. None is admitted to be prior art to the
invention. Generally, this art relates to observations relating to
cellular aging, and theories or hypothesis which explain such aging
and the mechanisms by which cells escape senescence and
immortalize.
[0004] The finite replicative capacity of normal human cells, e.g.,
fibroblasts, is characterized by a cessation of proliferation in
spite of the presence of serum growth factors. This cessation of
replication after a maximum of 50 to 100 population doublings in
vitro is referred to as cellular senescence. See, Goldstein, 249
Science 1129, 1990; Hayflick and Moorehead, 25 Exp. Cell Res. 585,
1961;. Hayflick, ibid., 37:614, 1985; Ohno, 11 Mech. Aging Dev.
179, 1979; Ham and McKeehan, (1979) "Media and Growth
Requirements", W. B. Jacoby and I. M. Pastan (eds), in: Methods in
Enzymology, Academic Press, NY, 58:44-93. The replicative life span
of cells is inversely proportional to the in vivo age of the donor
(Martin et al., 23 Lab. Invest. 86, 1979; Goldstein et al., 64
Proc. Natl. Acad. Sci. USA 155, 1969; and Schneider and Mitsui,
ibid., 73:3584, 1976), and is therefore suggested to reflect in
vivo aging on a cellular level.
[0005] Cellular immortalization (unlimited life span) may be
thought of as an abnormal escape from cellular senescence. Shay et
al., 196 Exp. Cell Res. 33, 1991. Normal human somatic cells appear
to be mortal, i.e., have finite replication potential. In contrast,
the germ line and malignant tumor cells are immortal (have
indefinite proliferative potential). Human cells cultured in vitro
appear to require the aid of transforming oncoproteins to become
immortal and even then the frequency of immortalization is
10.sup.-6 to 10.sup.-7. Shay and Wright, 184 Exp. Cell Res. 109,
1989. A variety of hypotheses have been advanced over the years to
explain the causes of cellular senescence. While examples of such
hypotheses are provided below, there appears to be no consensus or
universally accepted hypothesis.
[0006] For example, a free radical theory suggests that free
radical-mediated damage to DNA and other macromolecules is
causative in critical loss of cell function (Harmon, 11 J.
Gerontol. 298, 1956; Harmon, 16 J. Gerontol. 247, 1961), somatic
mutation theories propose that without genetic recombination cells
lack the ability to proliferate indefinitely due to a progressive
loss of genetic information (Burnet, "Intrinsic Mutagenesis--A
Genetic Approach to Aging", Wile, NY, 1976; Hayflick, 27 Exp.
Gerontol. 363, 1992), and theories concerning genetically
programmed senescence suggest that the expression of
senescent-specific genes actively inhibit cell proliferation
perhaps under the direction of a mitotic clock (Martin et al., 74
Am. J. Pathol. 137, 1974; Goldstein, 249 Science 1129, 1990).
[0007] Smith and Whitney, 207 Science 82, 1980, discuss a mechanism
for cellular aging and state that their data is:
[0008] compatible with the process of genetically controlled
terminal differentiation . . . . The gradual decrease in
proliferation potential would also be compatible with a continuous
build up of damage or errors, a process that has been theorized.
However, the wide variability in doubling potentials, especially in
mitotic pairs, suggests an unequalled partitioning of damage or
errors at division.
[0009] Olovnikov, 41 J. Theoretical Biology 181, 1973, describes
the theory of marginotomy to explain the limitations of cell
doubling potential in somatic cells. He states that an:
[0010] informative oligonucleotide, built into DNA after a telogene
and controlling synthesis of a repressor of differentiation, might
serve as a means of counting mitosis performed in the course of
morphogenesis. Marginotomic elimination of such an oligonucleotide
would present an appropriate signal for the beginning of further
differentiation. Lengthening of the telogene would increase the
number of possible mitoses in differentiation.
[0011] Harley et al., 345 Nature 458, 1990, state that the amount
and length of telomeric DNA in human fibroblasts decreases as a
function of serial passage during aging in vitro, and possibly in
vivo, but do not know whether this loss of DNA has a causal role in
senescence. They also state:
[0012] Tumour cells are also characterized by shortened telomeres
and increased frequency of aneuploidy, including telomeric
associations. If loss of telomeric DNA ultimately causes cell-cycle
arrest in normal cells, the final steps in this process may be
blocked in immortalized cells. Whereas normal cells with relatively
long telomeres and a senescent phenotype may contain little or no
telomerase activity, tumour cells with short telomeres may have
significant telomerase activity. Telomerase may therefore be an
effective target for anti-tumour drugs.
[0013] . . .
[0014] There are a number of possible mechanisms for loss of
telomeric DNA during ageing, including incomplete replication,
degradation of termini (specific or nonspecific), and unequal
recombination coupled to selection of cells with shorter telomeres.
Two features of our data are relevant to this question. First, the
decrease in mean telomere length is about 50 bp per mean population
doubling and, second, the distribution does not change
substantially with growth state or cell arrest. These data are most
easily explained by incomplete copying of the template strands at
their 3' termini. But the absence of detailed information about the
mode of replication or degree of recombination at telomeres means
that none of these mechanisms can be ruled out. Further research is
required to determine the mechanism of telomere shortening in human
fibroblasts and its significance to cellular senescence. [Citations
omitted.]
[0015] Hastie et al., 346 Nature 866, 1990, while discussing colon
tumor cells, state that:
[0016] [T]here is a reduction in the length of telomere repeat
arrays relative to the normal colonic mucosa from the same
patient.
[0017] . . .
[0018] Firm figures are not available, but it is likely that the
tissues of a developed fetus result from 20-50 cell divisions,
whereas several hundred or thousands of divisions have produced the
colonic mucosa and blood cells of 60-year old individuals. Thus the
degree of telomere reduction is more or less proportional to the
number of cell divisions. It has been shown that the ends of
Drosophila chromosomes without normal telomeres reduce in size by
.about.4 base pairs (bp) per cell division and that the ends of
yeast chromosomes reduce by a similar degree in a mutant presumed
to lack telomerase function If we assume the same rate of reduction
is occurring during somatic division in human tissues, then a
reduction in TRA by 14 kb would mean that 3,500 ancestral cell
divisions lead to the production of cells in the blood of a 60-year
old individual; using estimates of sperm telomere length found
elsewhere we obtain a value of 1,000-2,000. These values compare
favourably with those postulated for mouse blood cells. Thus, we
propose that telomerase is indeed lacking in somatic tissues. In
this regard it is of interest to note that in maize, broken
chromosomes are only healed in sporophytic (zygotic) tissues and
not in endosperm (terminally differentiated), suggesting that
telomerase activity is lacking in the differentiated tissues.
[Citations omitted.]
[0019] The authors propose that in some tumors telomerase is
reactivated, as proposed for HeLa cells in culture, which are known
to contain telomerase activity. But, they state:
[0020] One alternative explanation for our observations is that in
tumours the cells with shorter telomeres have a growth advantage
over those with larger telomeres, a situation described for
vegetative cells of tetrahymena. [Citations omitted.]
[0021] Harley, 256 Mutation Research 271, 1991, discusses
observations allegedly showing that telomeres of human somatic
cells act as a mitotic clock shortening with age both in vitro and
in vivo in a replication dependent manner. He states:
[0022] Telomerase activation may be a late, obligate event in
immortalization since many transformed cells and tumour tissues
have critically short telomeres. Thus, telomere length and
telomerase activity appear to be markers of the replicative history
and proliferative potential of cells; the intriguing possibility
remains that telomere loss is a genetic time bomb and hence
causally involved in cell senescence and immortalization.
[0023] . . .
[0024] Despite apparently stable telomere length in various tumour
tissues or transformed cell lines, this length was usually found to
be shorter than those of the tissue of origin. These data suggest
that telomerase becomes activated as a late event in cell
transformation, and that cells could be viable (albeit genetically
unstable) with short telomeres stably maintained by telomerase. If
telomerase was constitutively present in a small fraction of normal
cells, and these were the ones which survived crisis or became
transformed, we would expect to find a greater frequency of
transformed cells with long telomeres. [Citations omitted.]
[0025] He proposes a hypothesis for human cell aging and
transformation as "[a] semi-quantitative model in which telomeres
and telomerase play a causal role in cell senescence and cancer"
and proposes a model for this hypothesis.
[0026] De Lange et al., 10 Molecular and Cellular Biology 518,
1990, generally discuss the structure of human chromosome ends or
telomeres. They state:
[0027] we do not know whether telomere reduction is strictly
coupled to cellular proliferation. If the diminution results from
incomplete replication of the telomere, such a coupling would be
expected; however, other mechanisms, such as exonucleolytic
degradation, may operate independent of cell division. In any
event, it is clear that the maintenance of telomeres is impaired in
somatic cells. An obvious candidate activity that may be reduced or
lacking is telomerase. A human telomerase activity that can add
TTAGGG repeats to G-rich primers has recently been identified (G.
Morin, personal communication). Interestingly, the activity was
demonstrated in extracts of HeLa cells, which we found to have
exceptionally long telomeres. Other cell types have not been tested
yet, but such experiments could now establish whether telomerase
activity is (in part) responsible for the dynamics of human
chromosome ends.
[0028] Starling et al., 18 Nucleic Acids Research 6881, 1990,
indicate that mice have large telomeres and discusses this length
in relationship to human telomeres. They state:
[0029] Recently it has been shown that there is reduction in TRA
length with passage number of human fibroblasts in vitro and that
cells in a senescent population may lack telomeres at some ends
altogether. Thus in vitro, telomere loss may play a role in
senescence, a scenario for which there is evidence in S. cerevisae
and Tetrahymena. Some of the mice we have been studying are old in
mouse terms, one and a half years, yet they still have TRA's
greater than 30 kb in all tissues studied. In humans, telomeres
shorten with age at a rate of 100 bp per year, hence, it is
conceivable that the same is happening in the mouse, but the
removal of a few 100 bps of terminal DNA during its lifetime would
not be detectable. [Citations omitted.]
[0030] D'Mello and Jazwinski, 173 J. Bacteriology 6709, 1991,
state:
[0031] We propose that during the life span of an organism,
telomere shortening does not play a role in the normal aging
process. However, mutations or epigenetic changes that affect the
activity of the telomerase, like any other genetic change, might
affect the life span of the individual in which they occur.
[0032] . . .
[0033] In summary, the telomere shortening with age observed in
human diploid fibroblasts may not be a universal phenomenon.
Further studies are required to examine telomere length and
telomerase activity not only in different cell types as they age
but also in the same cell type in different organisms with
differing life spans. This would indicate whether telomere
shortening plays a causal role in the senescence of a particular
cell type or organism.
[0034] Hiyama et al., 83 Jpn. J. Cancer Res. 159, 1992, provide
findings that "suggest that the reduction of telomeric repeats is
related to the proliferative activity of neuroblastoma cells and
seems to be a useful indicator of the aggressiveness of
neuroblastoma . . . . Although we do not know the mechanism of the
reduction and the elongation of telomeric repeats in neuroblastoma,
we can at least say that the length of telomeric repeats may be
related to the progression and/or regression of neuroblastoma."
[0035] Counter et al., 11 EMBO J. 1921, 1992, state "loss of
telomeric DNA during cell proliferation may-play a role in ageing
and cancer." They propose that the expression of telomerase is one
of the events required for a cell to acquire immortality and note
that:
[0036] This model may have direct relevance to tumourigenesis in
vivo. For example, the finite lifespan of partially transformed
(pre-immortal) cells which lack telomerase might explain the
frequent regression of tumours after limited growth in vivo. In
bypassing the checkpoint representing normal replicative
senescence, transformation may confer an additional 20-40
population doublings during which an additional .apprxeq.2 kbp of
telomeric DNA is lost. Since 20-40 doublings (10.sup.6-10.sup.12
cells in a clonal population) potentially represents a wide range
of tumour sizes, it is possible that many benign tumours may lack
telomerase and naturally regress when telomeres become critically
shortened. We predict that more aggressive, perhaps metastatic
tumours would contain immortal cells which express telomerase. To
test this hypothesis, we are currently attempting to detect
telomerase in a variety of tumour tissues and to correlate activity
with proliferative potential. Anti-telomerase drugs or mechanisms
to repress telomerase expression could be effective agents against
tumours which depend upon the enzyme for maintenance of telomeres
and continued cell growth.
[0037] Levy et al., 225 J. Mol. Biol. 951, 1992, state that:
[0038] Although it has not been proven that telomere loss
contributes to senescence of multicellular organisms, several lines
of evidence suggest a causal relationship may exist.
[0039] . . .
[0040] It is also possible that telomere loss with age is
significant in humans, but not in mice. [Citations omitted.]
[0041] Windle and McGuire, 33 Proceedings of the American
Association for Cancer Research 594, 1992, discuss the role of
telomeres and state that:
[0042] These and other telomere studies point in a new direction
regarding therapeutic targets and strategies to combat cancer. If
the cell can heal broken chromosomes preventing genomic disaster,
then there may be a way to facilitate or artificially create this
process. This could even provide a preventive means of stopping
cancer which could be particularly applicable in high risk
patients. The difference in telomere length in normal versus tumor
cells also suggests a strategy where the loss of telomeres is
accelerated. Those cells with the shortest telomeres, such as those
of tumor metastasis would be the most susceptible.
[0043] Goldstein, 249 Science 1129, 1990, discusses various
theories of cellular senescence including that of attrition of
telomeres. He states:
[0044] However, such a mechanism is not easily reconciled with the
dominance of senescent HDF over young HDF in fusion hybrids,
particularly in short-term heterokaryons. One could again invoke
the concept of dependence and the RAD9 gene example, such that
complete loss of one or a few telomeres leads to the elaboration of
a negative signal that prevents initiation of DNA synthesis,
thereby mimicking the differentiated state. This idea, although
speculative, would not only explain senescent replicative arrest
but also the chromosomal aberrations observed in senescent HDS that
would specifically ensue after loss of telomeres. [Citations
omitted.]
[0045] The role of telomere loss in cancer is further discussed by
Jankovic et al. and Hastie et al., both at 350 Nature 1991, in
which Jankovic indicates that telomere shortening is unlikely to
significantly influence carcinogenesis in men and mice. Hastie et
al. agree that if telomere reduction does indeed reflect cell
turnover, this phenomenon is unlikely to play a role in pediatric
tumors, and those of the central nervous system. Hastie et al.,
however, feel "our most original and interesting conclusion was
that telomere loss may reflect the number of cell division in a
tissue history, constituting a type of clock."
[0046] Kipling and Cooke, 1 Human Molecular Genetics 3, 1992,
state:
[0047] It has been known for some years that telomeres in human
germline cells (e.g. sperm) are longer than those in somatic tissue
such as blood. One proposed explanation for this is the absence of
telomere repeat addition (i.e. absence of telomerase activity) in
somatic cells. If so, incomplete end replication would be expected
to result in the progressive loss of terminal repeats as somatic
cells undergo successive rounds of division. This is indeed what
appears to happen in vivo for humans, with both blood and skin
cells showing shorter telomeres with increasing donor age, and
telomere loss may contribute to the chromosome aberrations
typically seen in senescent cells. Senescence and the measurement
of cellular time is an intriguingly complex subject and it will be
interesting to see to what extent telomere shortening has a causal
role. The large telomeres possessed by both young and old mice
would seem to preclude a simple relationship between telomere loss
and ageing, but more elaborate schemes cannot be ruled out.
[Citations omitted.]
[0048] Greider, 12 BioEssays 363, 1990, provides a review of the
relationship between telomeres, telomerase, and senescence. She
indicates that telomerase contains an RNA component which provides
a template for telomere repeat synthesis. She notes that an
oligonucleotide "which is complementary to the RNA up to and
including the CAACCCCAA sequence, competes with d(TTGGGG)n primers
and inhibits telomerase in vitro" (citing Greider and Blackburn,
337 Nature 331, 1989). She also describes experiments which she
believes "provide direct evidence that telomerase is involved in
telomere synthesis in vivo." She goes on to state:
[0049] Telomeric restriction fragments in many transformed cell
lines are much shorter than those in somatic cells. In addition,
telomere length in tumor tissues is significantly shorter than in
the adjacent non-tumor tissue. When transformed cell lines are
passaged in vitro there is no change in telomere length. Thus if
untransformed cells lack the ability to maintain a telomere length
equilibrium, most transformed cells appear to regain it and to
reset the equilibrium telomere length to a size shorter than seen
in most tissues in vivo. The simplest interpretation of these data
is that enzymes, such as telomerase, involved in maintaining
telomere length may be required for growth of transformed cells and
not required for normal somatic cell viability. This suggests that
telomerase may be a good target for anti-tumor drugs. [Citations
omitted.]
[0050] Blackburn, 350 Nature 569, 1991, discusses the potential for
drug action at telomeres stating:
[0051] The G-rich strand of the telomere is the only essential
chromosomal DNA sequence known to be synthesized by the copying of
a separate RNA sequence. This unique mode of synthesis, and the
special structure and behavior of telomeric DNA, suggest that
telomere synthesis could be a target for selective drug action.
Because telomerase activity seems to be essential for protozoans or
yeast, but not apparently for mammalian somatic cells, I propose
that telomerase should be explored as a target for drugs against
eukaryotic pathogenic or parasitic microorganisms, such as
parasitic protozoans or pathogenic yeasts. A drug that binds
telomerase selectively, either through its reverse-transcriptase or
DNA substrate-binding properties, should selectively act against
prolonged maintenance of the dividing lower eukaryote, but not
impair the mammalian host over the short term, because telomerase
activity in its somatic cells may normally be low or absent.
Obvious classes of drugs to investigate are those directed
specifically against reverse transcriptases as opposed to other DNA
or RNA polymerases, and drugs that would bind telomeric DNA itself.
These could include drugs that selectively bind the G.cndot.G
base-paired forms of the G-rich strand protrusions at the
chromosome termini, or agents which stabilize an inappropriate
G.cndot.G base-paired form, preventing it from adopting a structure
necessary for proper function in vivo. Telomeres have been
described as the Achilles heel of chromosomes: perhaps it is there
that drug strategies should now be aimed. [Citations omitted.]
[0052] Shay et al., 27 Experimental Gerontology 477, 1992, and 196
Exp. Cell Res. 33, 1991 describe a two-stage model for human cell
mortality to explain the ability of Simian Virus 40 Tag to
immortalize human cells. The mortality stage 1 mechanism (M1) is
the target of certain tumor virus proteins, and an independent
mortality stage 2 mechanism (M2) produces crisis and prevents these
tumor viruses from directly immortalizing human cells. The authors
utilized T-antigen driven by a mouse mammary tumor virus promoter
to cause reversible immortalization of cells. The Simian Virus 40
T-antigen is said to extend the replicative life span of human
fibroblast by an additional 40-60%. The authors postulate that the
M1 mechanism is overcome by T-antigen binding to various cellular
proteins, or inducing new activities to repress the M1 mortality
mechanism. The M2 mechanism then causes cessation of proliferation,
even though the M1 mechanism is blocked. Immortality is achieved
only when the M2 mortality mechanism is also disrupted.
[0053] Other review articles concerning telomeres include Blackburn
and Szostak, 53 Ann. Rev. Biochem. 163, 1984; Blackburn, 350 Nature
569, 1991; Greider, 67 Cell 645, 1991, and Mayzis 265 Scientific
American 48, 1991. Relevant articles on various aspects of
telomeres include Cooke and Smith, Cold Spring Harbor Symposia on
Quantitative Biology Vol. LI, pp. 213-219; Morin, 59 Cell 521,
1989; Blackburn et al., 31 Genome 553, 1989; Szostak, 337 Nature
303, 1989; Gall, 344 Nature 108, 1990; Henderson et al., 29
Biochemistry 732, 1990; Gottschling et al., 63 Cell 751, 1990;
Harrington and Grieder, 353 Nature 451, 1991; Muller et al., 67
Cell 815, 1991; Yu and Blackburn, 67 Cell 823, 1991; and Gray et
al., 67 Cell 807, 1991. Other articles or discussions of some
relevance include Lundblad and Szostak, 57 Cell 633, 1989; and Yu
et al., 344 Nature 126, 1990.
SUMMARY OF THE INVENTION
[0054] This invention concerns therapies associated with control of
telomere length and telomerase activity. Therapeutic strategies of
this invention include reducing the rate or absolute amount of
telomere length loss during cell proliferation, thereby providing
for the postponement of cellular senescence and reducing the level
of chromosomal fusions and other chromosomal aberrations. In
addition, inhibition of telomerase activity in vivo or in vitro may
be used to control diseases associated with cell immortalization,
such as neoplasia.
[0055] The invention also concerns the determination of cellular
status by analysis of telomere length and telomerase activity, as a
diagnostic of cellular capacity for proliferation. Assays for
telomere length are performed to provide useful information on the
relative age and remaining proliferative capability of a wide
variety of cell types in numerous tissues. Telomerase activity and
the presence of the enzyme is used as a marker for diagnosing and
staging neoplasia.
[0056] Applicant has determined that inhibition of telomerase
activity in a cell in vitro is causally related to reducing the
ability of that cell to proliferate. Applicant has also determined
that inhibition of telomere shortening in a cell in vitro is
causally related to increasing the ability of that cell to
proliferate. Thus, applicant is the first to provide data which
clearly indicates that inhibition of telomere shortening in vivo or
in vitro, and that inhibition of telomerase activity in vivo or in
vitro, is therapeutically beneficial. Prior to applicant's
experiments, as indicated above, there was no consensus by those in
the art that one could predict that such experiments would provide
the data observed by applicant, or that such manipulations would
have therapeutic utility.
[0057] In addition, applicant's experiments have, for the first
time, determined a causal relationship between telomerase activity
and the ability of a cell to proliferate in an immortal fashion, as
well as a causal relationship between telomere length and the
potential remaining life span of a cell. As noted above, there was
no consensus in the art that one could predict that such a
relationship existed. In contrast, applicant has defined this
relationship, and thus has now defined useful therapeutic tools by
which to determine diagnostically useful data. Such data can be
used to define a therapeutic protocol, or the futility of such a
protocol.
[0058] Thus, in the first aspect, the invention features a method
for treatment of a condition associated with an elevated level of
telomerase activity within a cell. The method involves
administering to that cell a therapeutically effective amount of an
inhibitor of the telomerase activity.
[0059] The level of telomerase activity can be measured as
described below, or by any other existing method or equivalent
method. By "elevated level" of such activity is meant that the
absolute level of telomerase activity in the particular cell is
elevated compared to normal cells in that individual, or compared
to normal cells in other individuals not suffering from the
condition. Examples of such conditions include cancerous
conditions, or conditions associated with the presence of cells
which are not normally present in that individual, such as
protozoan parasites or opportunistic pathogens, and which have some
level of telomerase activity. Administration of an inhibitor can be
achieved by any desired means well known to those of ordinary skill
in the art.
[0060] In addition, the term "therapeutically effective amount" of
an inhibitor is a well recognized phrase. The amount actually
applied will be dependent upon the individual or animal to which
treatment is to be applied, and will preferably be an optimized
amount such that an inhibitory effect is achieved without
significant side-effects (to the extent that those can be avoided
by use of the inhibitor). That is, if effective inhibition can be
achieved with no side-effects with the inhibitor at a certain
concentration, that concentration should be used as opposed to a
higher concentration at which side-effects may become evident. If
side-effects are unavoidable, however, the minimum amount of
inhibitor that is necessary to achieve the inhibition desired
should be used.
[0061] By "inhibitor" is simply meant any reagent, drug or chemical
which is able to inhibit a telomerase activity in vitro or in vivo.
Such inhibitors can be readily identified using standard screening
protocols in which a protein or other moiety having telomerase
activity is placed in contact with a potential inhibitor, and the
level of telomerase activity measured in the presence or absence of
the inhibitor, or in the presence of varying amounts of inhibitor.
In this way, not only can useful inhibitors be identified, but the
optimum level of such an inhibitor can be determined in vitro.
[0062] One example of a suitable telomerase inhibitor assay is
carried out in 96-well microtiter plates. One microtiter plate is
used to make dilutions of the test compounds, while another plate
is used for the actual assay. Duplicate reactions of each sample
are performed. A mixture is made containing the appropriate amount
of buffer, template oligonucleotide, and telomerase extract for the
number of the samples to be tested, and aliquots are placed in the
assay plate. The test compounds are added individually and the
plates are pre-incubated at 30.degree. C. The .sup.32P-dGTP is then
added and the reaction allowed to proceed for 10 minutes at
30.degree. C. The total volume of each reaction 10 .mu.l. The
reaction is then terminated by addition of Tris and EDTA, and half
the volume (5 .mu.l) spotted onto DE81 filter paper. The samples
are allowed to air dry and then the filter paper is rinsed in 0.5 M
NaPhosphate several times to wash away the unincorporated labeled
nucleotide. After drying, the filter paper is exposed to a phosphor
imaging plate and the amount of signal quantitated. By comparing
the amount of signal for each of the test samples to control
samples, the percent of inhibition can be determined. This assay
has been used to find compounds active as inhibitors in the
femptoMolar and nanoMolar ranges, e.g., oxclinic acid, nalidixic
acid and AZT.
[0063] In addition, a large number of potentially useful inhibitors
can be screened in a single test, since it is inhibition of
telomerase activity that is desired. Thus, if a panel of 1,000
inhibitors is to be screened, all 1,000 inhibitors can potentially
be placed into microtiter wells. If such an inhibitor is
discovered, then the pool of 1,000 can be subdivided into 10 pools
of 100 and the process repeated until an individual inhibitor is
identified. As discussed herein, one particularly useful inhibitor
includes oligonucleotides which are able to either bind with the
RNA present in telomerase or able to prevent binding of that RNA to
its DNA target. Even more preferred are those oligonucleotides
which cause inactivation or cleavage of the RNA present in a
telomerase. That is, the oligonucleotide is chemically modified or
has enzyme activity which causes such cleavage. The above screening
may include screening of a pool of many different such
oligonucleotide sequences.
[0064] In a second aspect, the invention features a method for
treatment of a condition associated with an increased rate of
proliferation of a cell, e.g., telomere repeat loss associated with
cell proliferation in the absence of telomerase. The method
involves administering to the cell a therapeutically effective
amount of an agent active to reduce loss of telomere length within
the cell during its proliferation. Such therapeutics may be
especially applicable to conditions of increased cell
proliferation.
[0065] By "increased rate of proliferation" of a cell is meant that
that cell has a higher rate of cell division compared to normal
cells of that cell type, or compared to normal cells within other
individuals of that cell type. Examples of such cells include the
CD4.sup.+ cells of HIV-infected individuals (see example below),
connective tissue fibroblasts associated with degenerative joint
diseases, age-related macular degeneration, astrocytes associated
with Alzheimer's Disease and endothelial cells associated with
atherosclerosis (see example below). In each case, one particular
type of cell or a group of cells is found to be replicating at an
increased level compared to surrounding cells in those tissues, or
compared to normal individuals, e.g., individuals not infected with
the HIV virus. Thus, the invention features administering to those
cells an agent which reduces loss of telomere length in those cells
while they proliferate. The agent itself need not slow the
proliferation process, but rather allow that proliferation process
to continue for more cell divisions than would be observed in the
absence of the agent. The agent may also be useful to slow telomere
repeat loss occurring during normal aging, and for reducing
telomere repeat loss while expanding cell number ex vivo for
cell-based therapies.
[0066] Again, as described above, useful agents can be readily
identified by those of ordinary skill in the art using routine
screening procedures. For example, a particular cell having a known
telomere length is chosen and allowed to proliferate, and the
length of telomere is measured during proliferation. Agents which
are shown to reduce the loss of telomere length during such
proliferation are useful in this invention. Particular examples of
such agents are provided below. For example, oligonucleotides which
are able to promote synthesis of DNA at the telomere ends are
useful in this invention. In addition, telomerase may be added to a
cell either by gene therapy techniques, or by injection of the
enzyme or its equivalent into a cell.
[0067] In related aspects, the invention features pharmaceutical
compositions which include therapeutically effective amounts of the
inhibitors or agents described above, in pharmaceutically
acceptable buffers much as described below. These pharmaceutical
compositions may include one or more of these inhibitors or agents,
and be co-administered with other drugs. For example, AZT is
commonly used for treatment of HIV, and may be co-administered with
an inhibitor or agent of the present invention.
[0068] In a related aspect, the invention features a method for
extending the ability of a cell to replicate. In this method, a
replication extending amount of an agent which is active to reduce
loss of telomere length within the cell is provided during cell
replication. As will be evident to those of ordinary skill in the
art, this agent is similar to that useful for treatment of a
condition associated with an increased rate of proliferation of a
cell. However, this method is useful for the treatment of
individuals not suffering from any particular condition, but in
which one or more cell types are limiting in that patient, and
whose life can be extended by extending the ability of those cells
to continue replication. That is, the agent is added to delay the
onset of cell senescence characterized by the inability of that
cell to replicate further in an individual. One example of such a
group of cells includes lymphocytes present in patients suffering
from Downs Syndrome (although treatment of such cells may also be
useful in individuals not identified as suffering from any
particular condition or disease, but simply-recognizing that one or
more cells, or collections of cells are becoming limiting in the
life span of that individual).
[0069] It is notable that administration of such inhibitors or
agents is not expected to be detrimental to any particular
individual. However, should gene therapy be used to introduce a
telomerase into any particular cell population, care should be
taken to ensure that the activity of that telomerase is carefully
regulated, for example, by use of a promoter which can be regulated
by the nutrition of the patient. Thus, for example, the promoter
may only be activated when the patient eats a particular nutrient,
and is otherwise inactive. In this way, should the cell population
become malignant, that individual may readily inactivate
replication of the cell and cause it to become senescent simply by
no longer eating that nutrient.
[0070] In a further aspect, the invention features a method for
diagnosis of a condition in a patient associated with an elevated
level of telomerase activity within a cell. The method involves
determining the presence or amount of telomerase within the cells
in that patient.
[0071] In yet another aspect, the invention features a method for
diagnosis of a condition associated with an increased rate of
proliferation in that cell in an individual. Specifically, the
method involves determining the length of telomeres within the
cell.
[0072] The various conditions for which diagnosis is possible are
described above. As will be exemplified below, many methods exist
for measuring the presence or amount of telomerase within a cell in
a patient, and for determining the length of telomeres within the
cell. It will be evident that the presence or amount of telomerase
may be determined within an individual cell, and for any particular
telomerase activity (whether it be caused by one particular enzyme
or a plurality of enzymes). Those in the art can readily formulate
antibodies or their equivalent to distinguish between each type of
telomerase present within a cell, or within an individual. In
addition, the length of telomeres can be determined as an average
length, or as a range of lengths much as described below. Each of
these measurements will give precise information regarding the
status of any particular individual.
[0073] Thus, applicant's invention has two prongs--a diagnostic and
a therapeutic prong. These will now be discussed in detail.
[0074] The therapeutic prong of the invention is related to the now
clear observation that the ability of a cell to remain immortal
lies in the ability of that cell to maintain or increase the
telomere length of chromosomes within that cell. Such a telomere
length can be maintained by the presence of sufficient activity of
telomerase, or an equivalent enzyme, within the cell. Thus,
therapeutic approaches to reducing the potential of a cell to
remain immortal focus on the inhibition of telomerase activity
within those cells in which it is desirable to cause cell death.
Examples of such cells include cancerous cells, which are one
example of somatic cells which have regained the ability to express
telomerase, and have become immortal. Applicant has now shown that
such cells can be made mortal once more by inhibition of telomerase
activity. As such, inhibition can be achieved in a multitude of
ways including, as illustrated below, the use of oligonucleotides
which, in some manner, block the ability of telomerase to extend
telomeres in vivo.
[0075] Thus, oligonucleotides can be designed either to bind to a
telomere (to block the ability of telomerase to bind to that
telomere, and thereby extend that telomere), or to bind to the
resident oligonucleotide (RNA) present in telomerase to thereby
block telomerase activity on any nucleic acid (telomere). Such
oligonucleotides may be formed from naturally occurring
nucleotides, or may include modified nucleotides to either increase
the stability of the therapeutic agent, or cause permanent
inactivation of the telomerase. In addition, non-oligonucleotide
based therapies can be readily devised by screening for those
molecules which have an ability to inhibit telomerase activity in
vitro, and then using those molecules in vivo. Such a screen is
readily performed and will provide a large number of useful
therapeutic molecules. These molecules may be used for treatment of
cancers, of any type, including solid tumors and leukemias
(including those in which cells are immortalized, including:
apudoma, choristoma, branchioma, malignant carcinoid syndrome,
carcinoid heart disease, carcinoma (e.g., Walker, basal cell,
basosquamous, Brown-Pearce, ductal, Ehrlich tumor, in situ, Krebs
2, merkel cell, mucinous, non-small cell lung, oat cell, papillary,
scirrhous, bronchiolar, bronchogenic, squamous cell, and
transitional cell), histiocytic disorders, leukemia (e.g., b-cell,
mixed-cell, null-cell, T-cell, T-cell chronic, HTLV-II-associated,
lyphocytic acute, lymphocytic chronic, mast-cell, and myeloid),
histiocytosis malignant, Hodgkin's disease, immunoproliferative
small, non-Hodgkin's lymphoma, plasmacytoma, reticuloendotheliosis,
melanoma, chondroblastoma, chondroma, chondrosarcoma, fibroma,
fibrosarcoma, giant cell tumors, histiocytoma, lipoma, liposarcoma,
mesothelioma, myxoma, myxosarcoma, osteoma, osteosarcoma, Ewing's
sarcoma, synovioma, adenofibroma, adenolymphoma, carcinosarcoma,
chordoma, craniopharyngioma, dysgerminoma, hamartoma, mesenchymoma,
mesonephroma, myosarcoma, ameloblastoma, cementoma, odontoma,
teratoma, thymoma, trophoblastic tumor, adenocarcinoma, adenoma,
cholangioma, cholesteatoma, cylindroma, cystadenocarcinoma,
cystadenoma, granulosa cell tumor, gynandroblastoma, hepatoma,
hidradenoma, islet cell tumor, leydig cell tumor, papilloma,
sertoli cell tumor, theca cell tumor, leiomyoma, leiomyosarcoma,
myoblastoma, myoma, myosarcoma, rhabdomyoma, rhabdomyosarcoma,
ependymoma, ganglioneuroma, glioma, medulloblastoma, meningioma,
neurilemmoma, neuroblastoma, neuroepithelioma, neurofibroma,
neuroma, paraganglioma, paraganglioma nonchromaffin, angiokeratoma,
angiolymphoid hyperplasia with eosinophilia, angioma sclerosing,
angiomatosis, glomangioma, hemangioendothelioma, hemangioma,
hemangiopericytoma, hemangiosarcoma, lymphangioma, lymphangiomyoma,
lymphangiosarcoma, pinealoma, carcinosarcoma, chondrosarcoma,
cystosarcoma phyllodes, fibrosarcoma, hemangiosarcoma,
leiomyosarcoma, leukosarcoma, liposarcoma, lymphangiosarcoma,
myosarcoma, myxosarcoma, osteosarcoma, rhabdomyosarcoma, sarcoma
(e.g., Ewing's, experimental, Kaposi's, and mast-cell), neoplasms
(e.g., bone, breast, digestive system, colorectal, liver,
pancreatic, pituitary, testicular, orbital, head and neck, central
nervous system, acoustic, pelvic, respiratory tract, and
urogenital), neurofibromatosis, and cervix dysplasia), and for
treatment of other conditions in which cells have become
immortalized.
[0076] Applicant has also determined that it is important to slow
the loss of telomere sequences, in particular, cells in association
with certain diseases (although such treatment is not limited to
this, and can be used in normal aging and ex vivo treatments). For
example, some diseases are manifest by the abnormally fast rate of
proliferation of one or more particular groups of cells Applicant
has determined that it is the senescence of those groups of cells
at an abnormally early age (compared to the age of the patient),
that eventually leads to death of that patient. One example of such
a disease is AIDS, in which death is caused by the early senescence
of CD4.sup.+ cells. It is important to note that such cells age,
not because of abnormal loss of telomere sequences (although this
may be a factor), but rather because the replicative rate of the
CD4.sup.+ cells is increased such that telomere attrition is caused
at a greater rate than normal for that group of cells. Thus,
applicant provides therapeutic agents which can be used for
treatment of such diseases, and also provides a related diagnostic
procedure by which similar diseases can be detected so that
appropriate therapeutic protocols can be devised and followed.
[0077] Specifically, the loss of telomeres within any particular
cell population can be reduced by provision of an oligonucleotide
which reduces the extent of telomere attrition during cell
division, and thus increases the number of cell divisions that may
occur before a cell becomes senescent. Other reagents, for example,
telomerase, may be provided within a cell in order to reduce
telomere loss, or to make that cell immortal. Those of ordinary
skill in the art will recognize that other enzymatic activities may
be used to enhance the lengthening of telomeres within such cells,
for example, by providing certain viral sequences within a cell. In
addition, equivalent such molecules, or other molecules may be
readily screened to determine those that will reduce loss of
telomeres. Such screens may occur in vitro, and the therapeutic
agents discovered by such screening utilized in the above method in
vivo.
[0078] With regard to diagnostic procedures, examples of such
procedures become evident from the discussion above with regard to
therapy. Applicant has determined that the length of the telomere
is indicative of the life expectancy of a cell containing that
telomere, and of an individual containing that cell. Thus, the
length of a telomere is directly correlated to the life span of an
individual cell. As discussed above, certain populations of cells
may lose telomeres at a greater rate than the other cells within an
individual, and those cells may thus become age-limiting within an
individual organism. However, diagnostic procedures can now be
developed (as described herein) which can be used to indicate the
potential life span of any individual cell type, and to follow
telomere loss so that a revised estimate to that life span can be
made with time.
[0079] In certain diseases, for example, the AIDS disease discussed
above, it would, of course, be important to follow the telomere
length in CD4.sup.+ cells. In addition, the recognition that
CD4.sup.+ cells are limiting in such individuals allows a
therapeutic protocol to be devised in which CD4.sup.+ cells can be
removed from the individual at an early age when AIDS is first
detected, stored in a bank, and then reintroduced into the
individual at a later age when that individual no longer has the
required CD4.sup.+ cells available. Thus, an individual's life can
be extended by a protocol involving continued administration of
that individual's limiting cells at appropriate time points. These
appropriate points can be determined by following CD4.sup.+ cell
senescence, or by determining the length of telomeres within such
CD4.sup.+ cells (as an indication of when those cells will become
senescent). In this way, rather than wait until a cell becomes
senescent (and thereby putting an individual at risk of death)
telomere length may be followed until the length is reduced below
that determined to be pre-senescent, and thereby the timing of
administration of new CD4.sup.+ cells can be optimized.
[0080] Thus, the diagnostic procedures of this invention include
procedures in which telomere length in different cell populations
is measured to determine whether any particular cell population is
limiting in the life span of an individual, and then determining a
therapeutic protocol to insure that such cells are no longer
limiting to that individual. In addition, such cell populations may
be specifically targeted by specific drug administration to insure
that telomere length loss is reduced, as discussed above.
[0081] Other diagnostic procedures include measurement of
telomerase activity as an indication of the presence of immortal
cells within an individual. A more precise measurement of such
immortality is the presence of the telomerase enzyme itself. Such
an enzyme can be readily detected using standard procedures,
including assay of telomerase activities, but also by use of
antibodies to telomerase, or by use of oligonucleotides that bind
the nucleic acid (RNA) present in telomerase. The presence of
telomerase is indicative of cells which are metastatic, and such a
diagnostic allows pinpointing of such metastatic cells, much as
CD44 is alleged to do so. See, Leff, 3(217) BioWorld Today 1, 3,
1992.
[0082] It is evident that the diagnostic procedures of the present
invention provide the first real method for determining how far
certain individuals have progressed in a certain disease. For
example, in the AIDS disease, this is the first methodology which
allows prior determination of the time at which an HIV positive
individual will become immunocompromised. This information is
useful for determining the timing of drug administration, such as
AZT administration, and will aid in development of new drug
regimens or therapies. In addition, the determination of the
optimum timing of administration of certain drugs will reduce the
cost of treating an individual, reduce the opportunity for the drug
becoming toxic to the individual, and reduce the potential for the
individual developing resistance to such a drug.
[0083] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0084] The drawings will first briefly be described.
DRAWINGS
[0085] FIGS. 1-3 are graphs where the cell type and/or the culture
conditions are varied, plotting days in culture (horizontal axis)
length versus cell number (vertical axis).
[0086] FIG. 4 is a linear plot of mean terminal restriction
fragment (TRF) length versus PDL for human umbilical vein
endothelial cell cultures. The plot had a slope (m) of -190.+-.10
bp/PD, r=-O.98, P=0.01.
[0087] FIG. 5 is a plot of mean TRF of endothelial cell cultures
from human iliac arteries and iliac veins as a.sup.- function of
donor age. Parameters for iliac arteries are: m=-102 bp/yr,
r=-0.98, P=0.01 and for iliac veins are: m=-42 bp/yr, r=-0.71,
P=0.14.
[0088] FIG. 6 is a plot of decrease in mean TRF of medial tissue
from the aortic arch, abdominal aorta, iliac artery and iliac vein
as a function of donor age. Parameters for linear plot are: m=-47
bp/yr, r=-0.85, P=0.05.
[0089] FIG. 7 is a plot of mean TRF length from quantitative
analysis of autoradiograms of PBLs plotted as a function of donor
age. The slope of the linear regression line (-41.+-.2.6 bp/y) is
significantly different from 0 (p<0.00005).
[0090] FIG. 8 is a plot showing accelerated telomere loss in Down's
Syndrome (DS) patients. Genomic DNA isolated from PBS of DS
patients was analyzed as described in FIG. 7. Mean TRF length is
shown as a function of donor age, for DS patients (open squares),
and age matched controls (.box-solid.). The slope of the linear
regression lines (-133.+-.15 bp/y, trisomy, vs -43.+-.7.7, normals)
are significantly different (p<0.0005).
[0091] FIG. 9 is a plot showing decrease in mean TRF length as a
function of population doublings (shown for DNA from two normal
individuals). Donor ages for these cells were not available. The
slopes of these lines (-80.+-.19 (.box-solid.) and -102.+-.5.4 (0)
bp/doubling) are significantly different from zero (p<0.0001).
Mean TRF length at terminal passage from a third donor for which
multiple passages were not available is also shown (upsidedown
V-symbol).
[0092] FIG. 10 is a copy of an autoradiogram showing TRF lengths of
ovarian carcinoma and control normal cells. DNA from cells in
ascitic fluid from 2 patients (cas and wad) was digested with HinfI
and RsaI separated by electrophoresis, hybridized to the telomeric
probe .sup.32P(CCCTAA).sub.3, stringently washed and
autoradiographed. The cells of ascitic fluid from 7 other patients
(cra, sol, ing, sib, ric, pres and mac) were separated into
adhering normal cells (N) and tumour clumps in the media (T). The
DNA was extracted and run as above. DNA from patient lep was
obtained from both the first and forth paracentesis. Tumour cells
from patients sib, ric, pres and mac were cultured and DNA was
obtained at the respected population doublings (pd).
[0093] FIG. 11 shows telomerase activity in ovarian carcinoma
cells. S100 extracts from control cell line 293 CSH, tumour cell
line HEY, purified tumour cell population PRES and cells directly
from the ascitic fluid from patients mur, dem, wad and cas were
incubated with the telomere primer (TTAGGG).sub.3 in the presence
of dA/TTP, .sup.32PdGTP and buffer. The reaction products were
separated on a sequencing gel and exposed to a phosphoimager
screen. Either single (1) or double reactions (2) were tested.
[0094] FIG. 12 is a copy of an autoradiogram showing telomere
lengths in various cells.
[0095] FIG. 13 is a copy of an autoradiogram showing the effect of
CTO on telomere length.
[0096] FIG. 14 is a graph showing extension of the life span of
cells.
[0097] FIGS. 15 and 16 are copies of autoradiograms showing the
effect of GTO on telomerase activity.
[0098] Telomeres and Telomerase
[0099] All normal diploid vertebrate cells have a limited capacity
to proliferate, a phenomenon that has come to be known as the
Hayflick limit or replicative senescence. In human fibroblasts,
this limit occurs after 50-80 population doublings, after which the
cells remain in a viable but non-dividing senescent state for many
months. This contrasts to the behavior of most cancer cells, which
have escaped from the controls limiting their proliferative
capacity and are effectively immortal.
[0100] One hypothesis to explain the cause of cellular senescence
concerns the role of the distal ends of chromosomes called
telomeres. The hypothesis is that somatic cells lack the ability to
replicate the very ends of DNA molecules. This results in a
progressive shortening of the ends of the chromosomes until some
function changes, at which time the cell loses the capacity to
proliferate.
[0101] DNA polymerase synthesizes DNA in a 5'.fwdarw.3' direction
and requires a primer to initiate synthesis. Because of this, the
"lagging strand" does not replicate to the very ends of linear
chromosomes. The chromosome is thus shortened with every cell
division. The ends of chromosomes are called telomeres, and are
composed of long TTAGGG repeats. The enzyme telomerase can add
TTAGGG repeats to the 3' end of the telomeric DNA, thus extending
the DNA and preventing shortening.
[0102] Germline cells have long telomeres and presumably contain
telomerase. Somatic cells lack telomerase activity, and their
telomeres have been found to shorten with cell division both in
vivo and in culture. Cancer cells are immortal, and have regained
telomerase activity and thus can maintain their chromosome ends.
Examples are provided below of definitive experiments which
indicate that telomere shortening and telomerase activity are key
factors in controlling cellular senescence.
[0103] Methods
[0104] As noted above, the present invention concerns diagnosis and
therapy associated with measuring telomeric length and manipulating
telomerase-dependent extension or telomerase-independent
shortening. While the invention is directed to humans, it may be
applied to other animals, particularly mammals, such as other
primates, and domestic animals, such as equine, bovine, ovine,
porcine, feline, and canine. The invention may be used in both
therapy and diagnosis. In the case of therapy, for example,
telomere shortening may be slowed or inhibited by providing DNA
oligonucleotides or their functional equivalent, or
self-proliferation can be reduced by inhibiting telomerase. In this
case of diagnostics, one may detect the length of telomeres as to a
particular chromosome or group of chromosomes, or the average
length of telomeres. Diagnosis may also be associated with
determining the activity of telomerase in cells, tissue, and the
like.
[0105] Information on the relative age, remaining proliferative
capacity, as well as other cellular characteristics associated with
telomere and telomerase status may be obtained with a wide variety
of cell types and tissues, such as embryonic cells, other stem
cells, somatic cells (such as hepatocytes in the context of
cirrhosis), connective tissue cells (such as fibroblasts,
chondrocytes, and osteoblasts), vascular cells (such as endothelial
and smooth muscle cells), cells located in the central nervous
system (such as brain astrocytes), and different neoplastic
tissues, where it is desirable to determine the remaining
replicative capacity of the hyperplastic cells to predict growth
potential.
[0106] Maintaining Telomere Length
[0107] Telomere length in cells in vitro or in vivo may be usefully
maintained by a variety of procedures. These include those methods
exemplified below. These examples, however, are not limiting in
this invention since those in the art will recognize equivalent
methods. It is expected that all the methods will be useful in
manipulating telomere length now that applicant has demonstrated
this experimentally. Such methods may be based upon provision of
oligonucleotides or other agents which interact with telomeres to
prevent shortening during cell division. In addition, the methods
include treatment with agents which will include telomerase, or its
equivalent activity, within a cell to prevent shortening. Finally,
the methods also include modulation of gene expression associated
with cell senescence.
[0108] Useful agents can be determined by routine screening
procedures. For example, by screening agents which interact in an
in vitro system with telomeres, and block loss of telomere ends, or
aid increase in telomere length. Non-limiting examples of such
methods are provided below. All that is necessary is an assay to
determine whether telomere end shortening is reduced during cell
division. The mechanism by which such agents act need not be known,
so long as the desired outcome is achieved. However, by identifying
useful target genes (e.g., the M2 mortality modulation gene(s)),
antisense and equivalent procedures can be designed to more
appropriately cause desired gene expression or non-expression.
[0109] In a particular example (non-limiting in this invention) one
can reduce the rate of telomere shortening, by providing a nucleic
acid, e.g., DNA or RNA (including modified forms), as a primer to
the cells. Such nucleic acid will usually include 2 to 3 repeats,
more usually 2 repeats, where the repeats are complementary to the
G-rich DNA telomere strand. Such oligonucleotides may be used to
extend the proliferative capability of cells.
[0110] The oligonucleotides can be transferred into the cytoplasm,
either spontaneously (i.e., without specific modification) or by
the use of liposomes which fuse with the cellular membrane, or are
endocytosed by employing ligands which bind to surface membrane
protein receptors of the cell resulting in endocytosis.
Alternatively, the cells may be permeabilized to enhance transport
of the oligonucleotides into the cell, without injuring the host
cells. Another way is to use a DNA binding protein, e.g., HBGF-1,
which-is known to transport an oligonucleotide into a cell. In this
manner, one may substantially reduce the rate of telomere
shortening from an average of about 50 bp per division, to an
average of about 6-12 bp per division (see examples below), thus
significantly extending the number of divisions occurring before
induced cellular senescence.
[0111] By "senescence" is meant the loss of ability of a cell to
replicate in the presence of normally appropriate replicative
signals, and may be associated with the expression of degradative
enzymes, such as collagenase. The term does not include quiescent
cells which might be induced to replicate under appropriate
conditions. This term is exemplified below in the examples, where
the number of cell doubling prior to senescence is increased.
[0112] The above process are useful in vivo. As already indicated,
by using liposomes, particularly where the liposome surface carries
ligands specific for target cells, or the liposomes will be
preferentially directed to a specific organ, one may provide for
the introduction of the oligonucleotides into the target cells in
vivo. For instance, utilizing lipocortin affinity for phosphatidyl
serine, which is released from injured cells, the oligonucleotides
may be directed to such site. Alternatively, catheters, syringes,
depots or the like may be used to provide high localized
concentrations. The introduction of such oligonucleotides into
cells resulting in decreased senescence in response to cell
division can have therapeutic effect.
[0113] The maintenance of telomere length has application in tissue
culture techniques to delay the onset of cellular senescence. For
instance, cell-based therapies which require the clonal expansion
of cells for reintroduction into an autologous patient are limited
to about 20-30 doublings. This invention allows, in the expansion
of cells in the case of gene therapy, both prior to genetic
manipulation and then expansion of the manipulated cells, the
maintenance of telomere length. This in turn allows normal cells to
be cultivated for extended doublings in vitro. Experiments
described below demonstrate the utility of this method in vitro,
and demonstrate its applicability in vivo.
[0114] Critical shortening of telomeres leads to a phenomenon
termed "crisis" or M2 senescence. See, Shay et al., 1992, Supra.
Among the cells in crisis, rare mutants may become immortalized in
which M2 genes have been inactivated, and where expression of
telomerase is reactivated and stabilizes the telomere length. An M2
regulatory gene may be modulated to provide a useful means of
modulating telomere length and telomerase activity. The repression
of the M2 regulatory gene(s) by antisense or other means can
provide a means of activating telomerase reversibly, such that
telomeres may be extended and then telomerase again repressed. In
this manner, proliferative capacity may be extended with or without
the addition of oligonucleotides to slow the telomere shortening.
Such cells may then be used in cell-based therapies, such as bone
marrow transplantation, reconstitution of connective tissue, and
transplantation of early passage adrenal cortical cells,
fibroblasts, epithelial cells, and myoblasts.
[0115] Telomerase Modulation
[0116] As discussed above, cancer cells contain telomerase activity
and thereby are immortal. Thus, it is useful to modulate (e.g.,
decrease) telomerase activity in such cells to reduce their life
span. In addition, cells critical to an individual's survival,
e.g., CD4.sup.+ cells to an HIV-infected individual, may be
immortalized by causing expression of telomerase to cause telomere
shortening to be reduced or reversed.
[0117] Thus, inhibition or induction of telomerase may find
application in various situations. By inhibiting telomerase
intracellularly, one may reduce the ability of cancer cells to
proliferate. Telomerase may be competitively inhibited by adding
synthetic agents, e.g., oligonucleotides comprising 2 or more,
usually not more than about 50 repeats, of the telomeric motif of
the 5'-3' G-rich strand (the strand which acts as the template).
The oligonucleotides may be synthesized from natural or unnatural
units, e.g., the derivatives or carbon derivatives, where a
phosphate-oxygen is substituted with sulfur or methylene, modified
sugars, e.g., arabinose, or the like. As discussed above, other
equivalent agents may also be used to inhibit or cause expression
of telomerase activity.
[0118] The oligonucleotides may be introduced as described above so
as to induce senescence in the immortalized cells, in culture and
in vivo. Where growing cells in culture, where one wishes to
prevent immortalized cells from overgrowing the culture, one may
use the subject oligonucleotides to reduce the probability of such
overgrowth. Thus, by maintaining the oligonucleotides in the
medium, they will be taken up by the cells and inhibit telomerase
activity. One may provide for linkage to the telomeric sequence
with a metal chelate, which results in cleavage of nucleic acid
sequences. Thus, by providing iron chelate bound to the telomeric
motif, the telomerase RNA will be cleaved, so as to be
non-functional.
[0119] Alternatively, one may introduce a ribozyme, having 5' and
3'-terminal sequences complementary to the telomerase RNA, so as to
provide for cleavage of the RNA. In this way, the telomerase
activity may be substantially inhibited, so as to result in a
significant limitation of the ability of the cancer cells to
proliferate. Telomerase may also be inhibited by the administration
of an M2 regulator gene product. By modulating the expression of
any of the proteins directly regulating telomerase expression, one
may also modulate cellular telomerase activity.
[0120] The nucleic acid sequences may be introduced into the cells
as described previously. Various techniques exist to allow for
depots associated with tumors. Thus, the inhibiting agents or
nucleic acids may be administered as drugs, since they will only be
effective only in cells which include telomerase. Since for the
most part, somatic cells lack telomerase activity they will be
unaffected. Some care may be required to prevent entry of such
drugs into germ cells, which may express telomerase activity.
[0121] The subject compositions can therefore be used in the
treatment of neoplasia, as well as other proliferative diseases
associated with the presence of telomerase. In addition, they can
be used for studying cell senescence, the role of telomeres in the
differentiation and maturation of cells from a stem cell, e.g.,
hematopoietic, embryonic, etc., or the like, and the role of
telomerase in spermatogenesis.
[0122] Telomere Length
[0123] Procedures for measuring telomere length are known in the
art and can be used in this invention. Generally, they involve
specific primers of DNA synthesis of telomeres, and determination
of the amount and/or extent of such DNA synthesis. Alternatively,
restriction endonuclease digestion is used (with enzymes which do
not cleave telomerase DNA), and the length of the fragment having
detectable telomere DNA is studied. Given that the DNA sequence of
a telomere is known, detection of such DNA is relatively easy by
use of specific oligonucleotides. Examples of these methods are
provided below.
[0124] For diagnosis, in detection of the telomeric length, one may
study just a particular cell type, all cells in a tissue (where
various cells may be present), or subsets of cell types, and the
like. The preparation of the DNA having such telomeres may be
varied, depending upon how the telomeric length is to be
determined.
[0125] Conveniently, the DNA may be isolated in accordance with any
conventional manner, freeing the DNA of proteins by extraction,
followed by precipitation. Whole genomic DNA may then be melted by
heating to at least about 80.degree. C., usually at least about
94.degree. C., or using high salt content with chaotropic ions,
such as 6.times.SSC, quanidinium thiocyanate, urea, and the like.
Depending upon the nature of the melting process, the medium may
then be changed to a medium which allows for DNA synthesis.
[0126] (a) DNA Synthesis
[0127] In one method, a primer is used having at least about 2
repeats, preferably at least about 3 repeats of the telomeric
sequence, generally not more than about 8 repeats, conveniently not
more than about 6 repeats. The primer is added to the genomic DNA
in the presence of only 3 of the 4 nucleotide triphosphates (having
the complementary nucleosides to the protruding or G-rich strand of
a telomere, e.g., A, T and C for human chromosomes), dATP, dTTP and
dCTP. Usually at least the primer or at least one of the
triphosphates is labeled with a detectable label, e.g., a
radioisotope, which label is retained upon incorporation in the
chain. If no label is used, other methods can be used to detect DNA
synthesis. The primer is extended by means of a DNA polymerase,
e.g., the Klenow fragment of DNA polymerase I, T7 DNA polymerase or
Taq DNA polymerase
[0128] The length of the extended DNA can then be determined by
various techniques, e.g., those which separate synthesized DNA on
the basis of its molecular weight, e.g., gel electrophoresis. The
DNA synthesized may then be detected based on the label, e.g.,
counts incorporated per .mu.g of DNA, where the counts will be
directly proportional to telomere length. Thus, the measure of
radioactivity in relation to the amount of DNA will suffice to
quantitate telomere length.
[0129] If desired, telomeres of known length may be used as
standards, whereby a determination of radioactivity may be read off
a standard curve as related to telomere length. Instead, one may
prepare tissues where individual cells may be assayed for relative
telomere length by in situ hybridization. In this approach, for
example, the primer is labeled with a detectable label, usually
biotin or digoxygenin. Following annealing to prepared tissue
sections or cells, the label is revealed histochemically, usually
using autoradiography (if the label were radioactive), using
avidin/streptavidin (if the label were biotin) or using
antidigoxygenin antibodies (if the label were digoxygenin). The
amount of signal per cell is proportional to the number of
telomeric repeats, and thus to the telomere length. This can be
quantitated by microfluorometry or analogous means, and compared to
the signal from standard cells of known telomere length to
determine the telomere length in the test sample.
[0130] (b) Restriction Endonuclease Digestion
[0131] Alternatively, one may use primers which cause covalent
cross-linking of the primer to telomere DNA. In this situation, one
may totally digest the DNA with restriction endonucleases which
have 4 base recognition sites, which results in the production of
relatively short fragments of DNA, except for telomeric DNA which
lacks the recognition site. Restriction endonucleases which may
find use include AluI, HinfI, MspI, RsaI, and Sau3A, where the
restriction endonucleases may be used individually or in
combination. After digestion of the genomic DNA, the primer may be
added under hybridizing conditions, so as to bind to the protruding
chain of the telomeric sequence. By providing for two moieties
bound to the primer, one for covalent bonding to the telomeric
sequence and the other for complex formation with a specific
binding pair member, one can then provide for linking of a
telomeric sequence to a surface. For example, for covalent bonding
to the telomeric sequence, psoralen, or isopsoralen, may be linked
to one of the nucleotides by a bond or chain and upon UV-radiation,
will form a bridge between the primer and the telomere.
[0132] The specific binding pair member will normally be a hapten,
which binds to an appropriate complementary member, e.g., biotin
and strept/avidin, trinitrobenzoic acid and anti-trinitrobenzamide
antibody, or methotrexate and dihydrofolate reductase. Rather than
having the moiety for covalent bonding covalently bonded to the
primer, one may add a compound into the medium which is
intercalatable into the nucleic acid, so as to intercalate between
double-stranded nucleic acid sequences. In this manner, one may
achieve the same purpose. Use of a substantial excess of the
intercalatable compound will cause it to also intercalate into
other portions of DNA which are present. Various modifications of
this process may be achieved, such as size separation, to reduce
the amount of label containing DNA.
[0133] The specific binding pair member may be used for separation
of telomeric DNA free of contaminating DNA by binding to the
complementary pair member, which may be present on beads, on
particles in a column, or the like. In accordance with the nature
of the separation, the covalently bonded telomere strand may now be
purified and measured for size or molecular weight. Again, if
desired, standards may be employed for comparison of distribution
values.
[0134] The specific binding pair member hapten can be present at
the 5'-terminus of the primer or at intermediate nucleotides.
Specifically, biotin-conjugated nucleotides are generally available
and may be readily introduced into synthetic primer sequences in
accordance with known ways.
[0135] The above-described techniques can also be used for
isolating and identifying DNA contiguous to the telomere.
[0136] (c) Average Telomere Length
[0137] In methods of this invention it may be useful to determine
average telomere length by binding a primer to a telomere prior to
separation of the telomeric portion of the chromosomes from other
parts of the chromosomes. This provides a double-stranded telomeric
DNA comprising the telomeric overhang and the primer. A reaction
may then be carried out which allows for specific identification of
the telomeric DNA, as compared to the other DNA present. The
reaction may involve extension of the primer with only 3 of the
nucleotides (dNTPs), using a labeled nucleotide, covalent bonding
of the primer to the telomeric sequence, or other methods which
allow for separation of the telomeric sequence from other
sequences. The length of the synthesized DNA detected then
represents the average telomere length.
[0138] The determination of telomere length as described above can
be associated with a variety of conditions of diagnostic interest.
Following telomere length in tumor cells provides information
regarding the proliferative capacity of such cells before and
following administration of inhibitors of telomerase (or other
treatments which destabilizes the telomere length as discussed
above). It also provides a means of following the efficacy of any
treatment and providing a prognosis of the course of the
disease.
[0139] Where diseased tissue is involved, the native tissue can be
evaluated as to proliferative capability. By "proliferative
capability" is meant the inherent ability of a cell or cells in a
tissue to divide for a fixed number of divisions under normal
proliferation conditions. That is, the "Hayflick" number of
divisions, exemplified below in the examples. Thus, despite the
fact that the tissue may have a spectrum of cells of different
proliferative capability, the average value will be informative of
the state of the tissue generally. One may take a biopsy of the
tissue and determine the average telomeric length. Using the value,
one may then compare the value to average normal healthy tissue as
to proliferative capability, particularly where the tissue is
compared to other tissue of similar age.
[0140] In cases of cellular diseases, such as liver disease, e.g.,
cirrhosis, or muscle disease, e.g., muscular dystrophy, knowledge
of the proliferative capability can be useful in diagnosing the
likely recuperative capability of the patient. Other situations
involve injury to tissue, such as in surgery, wounds, burns, and
the like, where the ability of fibroblasts to regenerate the tissue
will be of interest. Similarly, in the case of loss of bone,
osteoarthritis, or other diseases requiring reformation of bone,
renewal capability of osteoblasts and chondrocytes will be of
interest.
[0141] While methods are described herein to evaluate the
proliferative capacity of a tissue by taking an average measure of
telomere length it is noted that the tissue may have a spectrum of
cells of different proliferative capability. Indeed, many tissues,
including liver, regenerate from only a small number of stem cells
(less than a few percent of total cells). Therefore, it is useful
in this invention to use in situ hybridization (such as with
fluorescently labeled telomeric probes), to identify and quantitate
such stem cells, and/or the telomeric status of such cells on an
individual, rather than collective basis. This is performed by
measuring the fluorescent intensity for each individual cell
nucleus using, e.g., automated microscopy imaging apparatus. In
addition to in situ hybridization, gel electrophoresis is useful in
conjunction with autoradiography to determine not only the average
telomere length in cells in a tissue sample, but also the longest
telomere lengths (possibly indicating the presence of stem cells)
and the size distribution of telomere lengths (which may reflect
different histological cell types within a tissue, see FIGS.
10-11). Thus, the autoradiogram, or its equivalent provides useful
information as to the total telomere status of a cell, or group of
cells. Each segment of such information is useful in diagnostic
procedures of this invention.
[0142] Telomerase Activity
[0143] Telomerase activity is of interest as a marker of growth
potential, particularly as to neoplastic cells, or progenitor
cells, e.g., embryonic cells. Human telomerase activity may be
determined by measuring the rate of elongation of an appropriate
repetitive sequence (primer), having 2 or more, usually 3 or more,
repeats of the telomere unit sequence, TTAGGG. The sequence is
labeled with a specific binding pair member at a convenient site,
e.g., the 5'-terminus, which specific binding pair member allows
for separation of extended sequences. By using one or more
radioactive nucleotide triphosphates or other labeled nucleotide
triphosphate, as described previously, one can measure the
incorporated radioactivity as cpm per unit weight of DNA as a
function of unit of time, as a measure of telomerase activity. Any
other detectable signal and label may also be used, e.g.,
fluorescein.
[0144] The activity may be measured with cytoplasmic extracts,
nuclear extracts, lysed cells, whole cells, and the like. The
particular sample which is employed and the manner of pretreatment
will be primarily one of convenience. The pretreatment will be
carried out under conditions which avoids denaturation of the
telomerase, so as to maintain the telomerase activity The primer
sequence will be selected or labeled so as to allow it to be
separated from any other DNA present in the sample. Thus, a
haptenic label may be used to allow ready separation of the
elongated sequence, which represents the telomerase activity of the
sample. The nucleotide triphosphates which may be employed may
include at least one nucleotide triphosphate which is labeled. The
label will usually be radiolabel, but other labels may also be
present. The labels may include specific binding pair members,
where the reciprocal member may be labeled with fluorescers,
enzymes, or other detectable label. Alternatively, the nucleotide
triphosphates may be directly labeled with other labels, such as
fluorescent labels.
[0145] The sequence elongation usually will be carried out at a
convenient temperature, generally from about 20.degree. C. to
40.degree. C., and for a time sufficient to allow for at least
about 100 bp to be added on the average to the initial sequence,
generally about 30-90 minutes. After the incubation time to allow
for the telomerase catalyzed elongation, the reaction may be
terminated by any convenient means, such as denaturation, e.g.,
heating, addition of an inhibitor, rapid removal of the sequence by
means of the label, and washing, or the like. The separated DNA may
then be washed to remove any non-specific binding DNA, followed by
a measurement of the label by any conventional means.
[0146] The determination of telomerase activity may be used in a
wide variety of ways. It can be used to determine whether a cell is
immortalized, e.g., when dealing with tissue associated with
neoplasia. Thus, one can determine at the margins of a tumor,
whether the cells have telomerase activity and may be immortalized.
The presence and activity of the telomerase may also be associated
with staging of cancer or other diseases. Other diagnostic
interests associated with telomerase include measurement of
activity as an assay for efficacy in treatment regimens designated
to inhibit the enzyme.
[0147] Other techniques for measuring telomerase activity can use
antibodies specific for the telomerase protein, where one may
determine the amount of telomerase protein in a variety of ways.
For example, one may use polyclonal antisera bound to a surface of
monoclonal antibody for a first epitope bound to a surface and
labeled polyclonal antisera or labeled monoclonal antibody to a
second epitope dispersed in a medium, where one can detect the
amount of label bound to the surface as a result of the telomerase
or subunit thereof bridging between the two antibodies.
Alternatively, one may provide for primers to the telomerase RNA
and using reverse transcriptase and the polymerase chain reaction,
determine the presence and amount of the telomerase RNA as
indicative of the amount of telomerase present in the cells.
[0148] The following examples are offered by way of illustration
and not by way of limitation.
EXAMPLES
[0149] The following are examples of specific aspects of the
invention to merely illustrate this invention to those in the art.
These examples are not limiting in the invention, but provide an
indication of specific methodology useful in practice of the
invention. They also provide clear indication of the utility of the
invention and of the correlation between telomere length,
telomerase activity and cellular senescence. Such correlation
indicates to those in the art the breadth of the invention beyond
these examples.
Example 1
Telomere Length and Cell Proliferation
[0150] The effects of telomere length modulation on cellular
proliferation were studied. An average of 50 bp are lost per cell
division in somatic cells. The telomere end is thought to have a
single-stranded region as follows (although the amount of overhang
is unknown):
1 5'TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
(Seq. ID No. 1) 3'AATCCCAATCCC
[0151] Applicant postulated that loss of this single-stranded
overhang should be significantly slowed if cells were provided with
a synthetic oligonucleotide of the sequence CCCTAACCCTAA (Seq. ID
No. 2). This oligonucleotide should hybridize to the exposed
single-stranded region, and serve as a primer for DNA synthesis by
the normal DNA polymerase present in somatic cells. In this way,
rather than shortening by an average of 50 bp per division, the
telomeres may only shorten by a lesser amount per division, thus
significantly extending the number of divisions required before
telomere shortening induced cellular senescence. This hypothesis
was tested by measuring both the change in proliferative lifespan
and rate of telomere shortening in cultured cells treated with this
indicated oligonucleotide, versus control oligonucleotides.
[0152] The efficacy of the CTO-12 oligonucleotide
(5'-CCCTAACCCTAA-3' Seq. ID No. 2) to reduce telomere shortening
associated with cellular senescence (FIG. 1) was studied using
target cells cultured under standard cell culture conditions in
minimal essential medium supplemented with 10% fetal calf serum.
The cells were subcultivated every four days by trypsinization upon
reaching confluency and were fed new medium at subcultivation or
every two days, whichever came first. Cells at various population
doubling levels were seeded at 10,000 cells per well and fed medium
containing oligonucleotides at various concentrations.
Oligonucleotides studied were the cytidine-rich terminal
oligonucleotide (CTO-12), guanidine-rich terminal
oligonucleotide-12 bp (GTO-12, having the sequence
5'-TTAGGGTTAGGG-3' (Seq. ID No. 3)), and a 12 base pair randomer
with a random nucleotide in every position. As an additional
control, cells were fed identical medium without oligonucleotide.
Cells were fed oligonucleotide every 48 hours from 10.times.stocks.
(Such oligonucleotides may be modified to enhance stability, e.g.,
with phosphorothioates, dithioate and 2-O-methyl RNA.)
[0153] Specifically, IMR-90 human lung fibroblasts with a
proliferative capacity of approximately 55 population doublings
(PD) were seeded at PD45 at 10,000 cells per well in a 48 well
tissue culture dish, and fed medium only or medium supplemented
with CTO-12 (at 1.0 .mu.M and 0.1 .mu.M) and 12 base pair randomer
at 1.0 .mu.M. As shown in FIG. 1, cells grown in medium without
oligonucleotide, or with CTO-12 at less than 1.0 .mu.M or with
oligonucleotide of random sequence reached replicative senescence
in a similar fashion at about 52 population doublings. Cells fed
the CTO-12 oligonucleotide at 1.0 M, however, continued to
proliferate for approximately 10 doublings more than control
cells.
Example 2
Inhibition of Telomerase in Cancer Cells
[0154] One way by which cancer cells are able to escape cellular
senescence is by regaining telomerase activity, which permits them
to maintain the length of their telomeres in the face of multiple
rounds of cell division. The enzyme telomerase contains an RNA
complementary to TTAGGG, which allows it to recognize the telomeres
and extend them by the addition of additional TTAGGG repeats. In
fact, one assay for telomerase uses a TTAGGGTTAGGG primer and
measures the ability of cell extracts to synthesis a ladder of 6 bp
additions to this substrate. Telomerase activity in cancer cells is
likely to be present in limiting amounts since telomere length is
relatively stable (thus only about 50 bp per telomere are added, so
that lengthening and shortening are balanced).
[0155] Applicant hypothesized that feeding cells a synthetic
TTAGGGTTAGGG oligonucleotide (Seq. ID No. 3) should competitively
inhibit the ability of telomerase to elongate chromosome ends, and
thus should lead to telomere shortening and senescence in cancer
cells. Since somatic cells lack telomerase activity, the effects of
this treatment should be strictly limited to cancer cells and the
germ line.
[0156] Specifically, MDA 157 human breast cancer cells with an
immortal phenotype were seeded at 10,000 cells per well in 12 well
tissue culture dishes and fed medium only or medium supplemented
with GTO-12 (at 1.0 .mu.M, 0.1 .mu.M, and 0.01 .mu.M). As shown in
FIG. 2, cells grown in medium without oligonucleotide, or with
doses of less than 1.0 .mu.M continued replicating in an immortal
phenotype. Cells fed the GTO-12 oligonucleotide, at 1.0 .mu.M,
however, ceased to proliferate after less than 10 doublings. Cells
grown in the presence of 1:0 .mu.M CTO-12 or 1.0 .mu.M CTO-12 and
1.0 .mu.M GTO-12 (G+C) continued to express the immortal phenotype
suggesting that the GTO-12 oligonucleotide was not intrinsically
toxic (FIG. 3). The lack of effect of-the G+C mixture may reflect
the CTO-12 oligonucleotide, competing with or base pairing with the
GTO-12 oligonucleotide, this preventing its inhibitory effect on
the cancer cell telomerase.
Example 3
Telomere Length as a Biomarker
[0157] In the U.S. and Western Europe, atherosclerosis is the
principal contributor to mortality from cardiovascular diseases
(Ross, 314 N. Engl. J. Med. 488, 1986). Atherosclerosis is
characterized by the mural and focal formation of lipid and
cell-rich lesions or "plaques" on the intimal surfaces of arterial
tissues. This is followed by an age-dependent expansion of the
lesion into the lumen, potentially leading to occlusion and to
myocardial and/or cerebral infarction (Haust, (1981) in Vascular
Injury and Atherosclerosis, ed. Moore, S. (Marcel Dekker Inc., New
York), pp. 1-22; Ross and Glomset, 295(7) N. Engl. J. Med. 369,
1976; and Ross, 295(8) N. Engl. J. Med. 420, 1976). Prominent among
the mechanisms proposed to explain the pathogenesis of
atherosclerosis is the "response-to-injury" hypothesis (Ross, 314
N. Engl. J. Med. 488, 1986; Moore, (1981) in Vascular Injury and
Atherosclerosis, ed. Moore, S. (Marcel Dekker Inc., New York), pp.
131-148; and Moore, 29(5) Lab. Invest. 478, 1971) in which repeated
mechanical, hemodynamic and/or immunological injury to the
endothelium is the initiating event.
[0158] A prediction of this hypothesis is that the intimal and
medial tissue in the area comprising the atherosclerotic plaque
will have a higher rate of cell turnover than the surrounding
normal tissue. Several lines of evidence support this prediction.
Ross et al., (Ross and Glomset, 295(7) N. Engl. J. Med. 369, 1976;
Ross, 295(8) N. Engl. J. Med. 420, 1976) showed that cultured
smooth muscle cells from fibrous plaques displayed lower
responsiveness to growth serum when compared to cells from the
underlying medial layer. Moss and Benditt 78(2) (1973) Am. J.
Pathol. 175, 1973, showed that the replicative life-span of cell
cultures from arterial plaques were equal to or less than the
replicative life-spans from cells of nonplaque areas. Dartsch et
al., 10 Arteriosclerosis 62, 1992, showed that human smooth muscle
cells obtained from primary stenosing lesions became senescent in
culture far later than smooth muscle cells from restenosing
lesions. These results suggest that cells derived from regions of
atherosclerotic plaques undergo more cellular divisions than cells
from non-plaque areas hence rendering them older and nearer to
their maximum replicative capacity.
[0159] Thus, to understand the pathogenesis of atherosclerosis, one
must examine the alterations in the behavior of cell turnover on
and adjacent to the arterial lesions. One requires a biomarker for
the cell turnover of intimal and medial tissue. Several workers
have examined biomarkers for the progression of atherosclerosis or
for the propensity of an individual to develop atherosclerosis. The
former objective entailed the measurement of a number of
biochemical compounds which are detected in the plasma but
originate from the endothelium. Examples are serum Type III
collagen (Bonnet et al., 18 Eur. J. Clin. Invest. 18, 1988), von
Willebrand's Factor (Factor VIII) (Baron et al., 10
Arteriosclerosis 1074, 1990), cholesterol, triglycerides,
apolipoprotein B (Stringer and Kakkar, 4 (1990) Eur. J. Vasc. Surg.
513, 1990), lipoprotein (a) (Breckenridge, 143 Can. Med. Assoc. J.
115, 1990; Mezdour et al., 48 Ann. Biol. Clin. (Paris) 139, 1990;
and Scanu, 14 Clin. Cardiol. 135, 1991), endothelin (Lerman et al.,
325 N. Engl. J. Med. 997, 1991) and heparin-releasable Platelet
Factor 4 (Sadayasu et al., 14 (1991) Clin. Cardiol. 725, 1991). A
number of markers originate from the cell surface (Hanson et al.,
11 (1991) Arterioscler. Thromb. 745, 1991; and Cybulsky and
Girnbrone, 251 Science 788, 1991). Other markers monitor
physiological aberrations as a result of atherogenesis (Vita et
al., 81 (1990) Circulation 491, 1990). Candidate genes used to
delineate the RFLP profile of those susceptible to atherogenesis
(Sepehrnia et al., 38 (1988) Hum. Hered. 136, 1988; and Chamberlain
and Galton, 46 Br. Med. Bull. 917, 1990) have also been
established. However, there have been relatively few markers
developed to monitor directly cell turnover.
[0160] Applicant now shows that telomere length may serve as a
biomarker of cell turnover in tissues involved in atherogenesis.
The results show that endothelial cells lose telomeres in vitro as
a function of replicative age and that in vivo telomere loss is
generally greater for tissues of the atherosclerotic plaques
compared to control tissue from non-plaque regions.
[0161] In general, telomere lengths were assessed by Southern
analysis of terminal restriction fragments (TRF, generated through
HinfI/RsaI digestion of human genomic DNA. TRFs were resolved by
gel electrophoresis and hybridized with a telomeric oligonucleotide
(.sup.32P-(CCCTAA).sub.3)- . (Seq. ID No. 4). Mean TRF length
decreased as a function of population doublings in human
endothelial cell cultures from umbilical veins (m=-190 bp/PD,
P=0.01), and as a function of donor age in iliac arteries (m=-120
bp/PD, P=0.05) and iliac veins (m=-160 bp/PD, P=O.05). Thus, mean
TRF length decreased with the in vitro age of all cell cultures.
When early passage cell cultures were assessed for mean TRF length
as a function of donor age, there was a significant decrease for
iliac arteries (m=-102 bp/y, P=0.01) but not for iliac vein (m=47
bp/y, P=0.14). Mean TRF length of medial tissue decreased
significantly (P=0.05) as a function of donor age. Intimal tissues
from one individual who displayed extensive development of
atherosclerotic plaques possessed mean TRF lengths close to those
observed for senescent cells in vitro (.sup..about.6 kbp). These
observations indicate that telomere size indeed serves as a
biomarker for the replicative history of intima and media and that
replicative senescence of endothelial cells is involved in
atherogenesis.
[0162] Specifically, the following materials and methods were used
to achieve the results noted below.
[0163] Endothelial Cell Cultures
[0164] Human umbilical vein endothelial cells (HUVEC) were obtained
from Dr. Thomas Maciag of the Jerome H. Holland Laboratory of the
American Red Cross. Human endothelial cells from the iliac arteries
and iliac veins were obtained from the Cell Repository of the
National Institute of Aging (Camden, N.J.) Cells were grown at
37.degree. C. in 5% CO.sub.2 on 100 mm tissue plates whose
interiors were treated with an overnight coating of 0.4% gelatin
(37.degree. C.). The supplemented media consisted of M199, 15%
fetal bovine serum, 5 U/ml heparin and 20 .mu.g/ml crude
Endothelial Cell Growth Supplement (Collaborative Research) or
crude Endothelial Cell Growth Factor (Boehringer-Mannheim).
Cultures were trypsinized (0.05%, 3 minutes) at confluence,
reseeded at 25% of the final cell density and refed every 2-3
days
[0165] Tissue Samples
[0166] Tissue samples from the aortic arch, abdominal aorta, iliac
artery and iliac vein were obtained from autopsies at the
Department of Pathology, Health Sciences Center, McMaster
University. Post-mortem times ranged from 51/2 to 81/2 hours. The
intima was obtained by cutting open the arteries or veins and
carefully scraping off the lumenal surface with a No. 10 scalpel
(Lance Blades, Sheffield) (Ryan, 56 Envir. Health Per. 103, 1984).
The resulting material was either treated directly for extraction
of DNA or processed for cell culture.
[0167] The adventitial layer was removed by cutting or scraping the
non-lumenal side of the vessel. The remaining medial layer was
prepared for DNA extraction by freezing it in liquid-N.sub.2 and
grinding it in a liquid-N.sub.2 chilled mortar and pestle (Kennedy
et al., 158 Exp. Cell Res. 445, 1985). After the tissue was ground
to a powder, 5 ml of frozen digestion Buffer (10 mM Tris; 100 mM
NaCl; 25 mM EDTA; 0.5% SDS; pH 8.0) was added and ground into the
powderized tissue. The powder was then transferred to a 50 ml
Falcon tube and incubated at 48.degree. C. until thawed. Proteinase
K (10 mg/ml) was added to a final concentration of 0.2 mg/ml. After
a 12-16 hour incubation, the solution was removed from the water
bath and either prepared for DNA extraction or stored at 20.degree.
C.
[0168] Extraction and Restriction Enzyme Digestion of Genomic
DNA
[0169] DNA was extracted as described previously (Harley et al.,
345 Nature 458, 1990; Allsopp et al., 89 Proc. Natl. Acad. Sci. USA
10114, 1992). In brief, proteinase K-digested lysates were
extracted twice with one volume of phenol:chloroform:isoamyl
alcohol (25:24:1) and once with chloroform. Nucleic acid was
precipitated by adding 2 volumes of 100% EtOH to the aqueous layer,
washed once with 70% EtOH and finally resuspended in 100-200 .mu.l
of 10 mM Tris-HCl, 1 mM EDTA, pH 7.5. DNA was quantified by
fluorometry and 1 .mu.g was digested with 1 unit each of HinfI/RsaI
for 3-24 hours at 37.degree. C. Complete digestion was monitored by
gel electrophoresis. The integrity of the DNA before and after
digestion was monitored in control experiments by gel
electrophoresis.
[0170] Southern Blot Hybridization
[0171] Electrophoresis of digested genomic DNA was performed in
0.5% agarose gels in a standard Tris, sodium borate, EDTA buffer
for a total of 650-700 V/hr as described previously (Harley et al.,
345 Nature 458, 1990; Allsopp et al., 89 Proc. Natl. Acad. Sci. USA
10114, 1992). After electrophoresis, the gel was placed onto 3 mm
Whatman filter paper and dried under vacuum for 25 minutes at
60.degree. C. Gels were denatured by soaking in 0.5 M NaOH, 1.5 M
NaCl for 10 minutes at room temperature and then neutralized
through immersion in 0.5 M Tris, 1.5 M NaCl. Genomic DNA was
immersed in standard hybridization solution (Harley et al., 345
Nature 458, 1990) (6.times.SSC) with the telomeric
.sup.32P-(CCCTAA).sub.3 probe (Seq. ID No. 4) for 12-16 hours at
37.degree. C. The telomeric smears were visualized through
autoradiography on pre-flashed (OD.sub.545=0.15) Kodak XAR-5 film.
The mean lengths of the terminal restriction fragments (TRFs) were
calculated from densitometric scans of the developed films as
described previously (Harley et al., 345 Nature 458, 1990).
[0172] In Vitro Results
[0173] To determine the feasibility of employing telomere length as
a biomarker for cell turnover in atherosclerosis, we first examined
the change in telomere length in cultured endothelial cells where
cell division can be directly monitored in vitro. The DNA was
digested with HinfI and RsaI, and the resulting terminal
restriction fragments (TRF) were subjected to Southern analysis. As
in human skin fibroblasts (Allsopp et al., 89 Proc. Natl. Acad.
Sci. USA 10114, 1992), mean TRF length decreased as a function of
population doubling (PD). Thus, telomere length decreases with in
vitro age of human umbilical vein endothelial cells. Mean TRF
length decreased linearly (P=0.01) at a rate of 190.+-.10 bp/PD
(see FIG. 4). The Y-intercept, which signifies the mean TRF at 0
PDL is 14.0 kbp while mean TRF at senescence was 5.7.+-.0.4
kbp.
[0174] To prove that telomere length decrease occurred in
endothelial cells from other arterial and venous sources, mean TRF
length versus population doubling level (PDL) was determined for
several strains of endothelial cells from human iliac artery and
human iliac vein. In both iliac arteries and iliac veins there was
a significant (P=0.05) linear decrease in mean TRF length with age
of culture: 120.+-.60 bp per population doubling for the iliac
artery and 160.+-.30 bp per population doubling for the iliac veins
from endothelial cells.
[0175] In Vivo Results
[0176] Formation of atherosclerotic plaques occurs more often in
the iliac artery than in the iliac vein (Crawford, (1982) Pathology
of Atherosclerosis (Butterworth and Co. Ltd., U.K.), p. 187-199),
thus it is expected that turnover of intimal tissue in vivo from
the iliac artery should be greater than that from the iliac veins.
To test this, nine different strains of endothelial cell cultures
from iliac arteries and veins of donors ranging in age from 14-58
years of age were cultivated and TRF lengths from the earliest
possible PDL were determined (FIG. 5).
[0177] Consistent with the hypothesis of greater cell turnover in
vivo in arteries than in veins, the rate of decrease in mean TRF
length, was significant over the age range 20-60 years for iliac
arteries (-100 bp/yr, P=0.01) and greater than for the iliac veins
(-47 bp/yr, P=0.14). Among the nine strains of endothelial cells,
there were cultures from the iliac artery and iliac vein from the
same individuals for 3 of the donors, aged 21, 47 and 49 years.
There was a significantly shorter mean TRF length in the cultures
of iliac artery cells as compared to the venous cells for the two
older donors. The younger donor showed no significant difference in
mean TRF length between the two cultures, possibly reflecting
relatively little difference in cell turnover between the vessels
of the 21-year old donor.
[0178] Differences in mean TRF length of the cell cultures from
iliac arteries and iliac veins in donors of different ages will
reflect not only differences in original mean TRF length of the
primary tissues but also differences in the rate of telomere loss
between the different cultures in vitro during the time required to
collect sufficient cells for analysis (approximately 5-10 PDL). To
determine if there is a relationship between cell turnover and the
extent of atherosclerotic plaque formation, we examined mean TRF
length in primary tissue. Autopsies from 3, 11, 12, 14, 18, 26,
75-year old females and a 77-year old male were performed. Sections
of the aortic arch, abdominal aorta, iliac artery and iliac vein
were taken and the intimal and medial tissues separated and
assessed for TRF length.
[0179] Sufficient intimal tissue could be obtained from the aortic
arch, abdominal aorta, iliac arteries and iliac veins of 3 donors
(aged 27, 75 and 77 years) for TRF analysis. There was a striking
difference between the mean TRF lengths averaged over these sites
in the 27-year old female (10.4.+-.0.7 kbp) versus the 75-year old
(8.8+0.6 kbp) and the 77-year old male (6.3+0.4 kbp). It is
noteworthy that the 77-year old male had extensive atherosclerotic
lesions in his vasculature and that the mean TRF length of his
intimal tissue is close to that of endothelial cells, at senescence
in vitro (approximately 6 kbp, FIG. 4).
[0180] FIG. 6 shows that mean TRF of medial tissue (from the aortic
arch) decreases with donor age at a small-but significant rate (47
bp/yr, P=0.05). Thus, medial cells turnover in vivo occurs at a
rate less than that of the venous or arterial endothelial
cells.
[0181] In general, telomere loss in medial tissue underlying an
atherosclerotic plaque was greater than those in non-plaque regions
(Table 1). With the 75-year old female, mean TRF was significantly
reduced in medial DNA from the plaque regions versus the non-plaque
regions of both the aortic arch (P=0.04) and the abdominal aorta
(P=0.01). For the 77-year old male, this was observed in the
abdominal aorta (P=0.01).
2TABLE 1 Mean TRF values for primary medial tissues of plaque and
non-plaque areas Plaque Region Non-Plaque Region P 75-year old
Donor Aortic Arch 10.2 + 0.5 11.1 .+-. 0.1 0.04 Abdominal Aorta 9.5
.+-. 0.6 11.0 .+-. 0.1 0.01 77-year old Donor Aortic Arch 8.2 .+-.
0.4 8.4 .+-. 0.2 NS Abdominal Aorta 7.1 .+-. 0.1 8.2 .+-. 0.4
0.01
[0182] These results show that mean TRF length decreases as a
function of donor age for primary medial and intimal tissue,
suggesting that cell turnover does occur in cardiovascular tissue.
The decrease in mean TRF length for plaque regions versus clear
regions of medial tissue from the same blood vessel is consistent
with augmented cell turnover of tissue associated with
atherosclerotic plaques. Thus, the results indicate that
measurement of telomere length provides a biomarker for alterations
of cellular turnover in tissues associated with cardiovascular
diseases, i.e., cells of the intima and media.
[0183] Measurement of telomere length is a direct register of
proliferative history but to obtain telomeric DNA one must obtain a
biopsy of endothelial tissue. Since removal of the endothelium in
itself can induce plaque formation, the biopsy strategy obviously
entails ethical and practical problems. Based upon experience with
autopsy samples one requires a minimal area of 1 cm.sup.2 in order
to perform a Southern analysis as described in this paper. For a
practical biopsy, this is untenable. A detection technique to
circumvent this problem may be confocal fluorescent microscopy. In
situ hybridization to genomic DNA would require 50 times less
material.
Example 4
Simplified Test for Telomere Length
[0184] Telomere length has been found to be the best predictor of
the remaining lifespan of cells cultured from donors of different
ages. The ability to measure telomere length thus has significant
clinical use. Because of their simple repetitive nature, telomeres
lack DNA sequences recognized by many restriction enzymes. One way
to measure telomere length is to digest DNA with restriction
enzymes with 4-base recognition sites, which cuts most of the DNA
into very small pieces and leaves the telomeres in relative large
TRFs (Terminal Restriction Fragments). A Southern blot of the DNA
is then probed with a radioactive TTAGGGTTAGGGTTAGGG (Seq. ID No.
5) oligonucleotide, and the size of the TRF determined.
[0185] A much simpler method to measure telomere length exploits
the fact that the telomere sequence lacks guanidine residues in the
C-rich strand. Genomic DNA can be melted and mixed with the DNA
synthesis primer CCCTAACCCTAACCCTAACCCTAA (Seq. ID No. 6) in the
presence of DNA polymerase and only three deoxynucleotides (dATP,
dTTP and radioactive dCTP). Rare complementary sequences scattered
throughout the genome would fail to extend due to the lack of dGTP.
The length of the extended DNA can then be determined from a simple
gel electrophoresis. The amount of DNA synthesized (counts
incorporated per .mu.g of DNA) will be directly proportional to
telomere length, and for diagnostic purposes a simple measure of
radioactivity would then suffice to quantitate telomere length.
Example 5
Identification of DNA Sequences Near Telomeres
[0186] There are good reasons to believe that the regulatory
factors that control cellular and organismal senescence are located
near telomeres, and are themselves regulated by the length of the
adjacent telomere. It is thus important to identify and clone them
in order to be able to understand and manipulate the aging process.
In addition, there is great interest in identifying unique
telomeric DNA within the human genome project, since telomeric
markers for mapping purposes are lacking for the ends of the
chromosomes.
[0187] In one method, large telomeric DNA is purified as follows. A
biotinylated CCCATTCCCATTT (Seq. ID No. 7) oligonucleotide is used
to prime DNA synthesis in double-stranded genomic DNA. The only
sequences with which this oligonucleotide can anneal will be the
single-stranded base overhangs at telomere ends. The extended DNA
will then be digested with a restriction enzyme such as NotI to
produce large restriction fragments. Biotinylated fragments are
retrieved using streptavidin coated magnetic beads, and analyzed by
pulsed field electrophoresis. 46 fragments (one for each end of the
23 human chromosomes) are produced.
[0188] Multiple strategies can be used to pursue the successful
isolation of large telomeric DNA. The DNA can be labeled and used
to screen cDNA libraries in order to identify genes located near
telomeres. The expression of these cDNAs can then be examined in
young versus old cells in order to identify those which are
differentially expressed as a function of cellular senescence, and
which are thus candidates to be regulatory factors that control
aging.
[0189] The purified telomeric DNA can also be digested with
additional restriction enzymes, mixed with 100-fold excess of
genomic DNA, melted and reannealed. Under these circumstances, the
repetitive sequences in the telomeric DNA will anneal with genomic
DNA while unique sequences in the purified DNA will self-anneal.
Only the self-annealed unique sequences will contain restriction
overhangs at each end, and thus a simple cloning of the annealed
DNA will result in the successful cloning of only unique
fragments.
Example 6
Telomere Loss in Down's Syndrome Patients
[0190] Loss of telomeric DNA from human chromosomes may ultimately
cause cell cycle exit during replicative senescence. Since
lymphocytes have a limited replicative capacity and blood cells
were previously shown to lose telomeric DNA during aging in vivo,
we wished to determine whether accelerated telomere loss is
associated with the premature immunosenescence of lymphocytes in
individuals with Down's Syndrome (DS), and whether telomeric DNA is
also lost during aging of lymphocytes in vitro.
[0191] To investigate the effects of aging and trisomy 21 on
telomere loss in vivo, genomic DNA was isolated from peripheral
blood lymphocytes of 140 individuals (0-107 y) and 21 DS patients
(0-45 y). Digestion with restriction enzymes HinfI and RsaI
generated terminal restriction fragments (TRFs) which can be
detected by Southern analysis using a telomere-specific probe,
(.sup.32P-(CCCTAA).sub.3). The rate of telomere loss was calculated
from the decrease in mean TRF length as a function of donor age. DS
patients showed a significantly higher rate of telomere loss with
donor age (133.+-.15 bp/y) compared to age-matched controls
(41.+-.7.7 bp/y) (P<0.0065), indicating that accelerated
telomere loss is a biomarker of premature immunosenescence of DS
patients, and may play a role in this process.
[0192] Telomere loss during aging in vitro was calculated for
lymphocytes from two normal individuals grown in culture for 20-30
population doublings. The rate of telomere loss was 90 bp/cell
doubling, that is, it was comparable to that seen in other somatic
cells. Telomere lengths of lymphocytes from centenarians and from
older DS patients were similar to those of senescent lymphocytes in
culture, which suggests that replicative senescence could partially
account for aging of the immune system in DS patients and elderly
individuals.
[0193] The following materials and methods were used to obtain the
results provided below.
[0194] Culture of Human Peripheral Blood T Lymphocytes
[0195] Adult peripheral blood samples were collected, and
mononuclear cells were isolated by Ficoll-Hypaque gradient
centrifugation then cryopreserved in liquid nitrogen. Cultures were
initiated by mixing 10.sup.-6 mononuclear cells with 10.sup.6
irradiated (8000 Rad) lymphoblastoid cells (Epstein-Barr virus
transformed B cells), or 10.sup.6 mononuclear cells with 10
.mu.g/ml phytohemagglutinin (PHA-P, Difco) in each well of a
48-well cluster plate (Costar). After 8 to 11 days, cells were
washed and plated in 2 ml wells of 24-well cluster plates at a
concentration of 2-4.times.10.sup.5/ml. Cultures were passaged
every three to four days, or whenever viable cell concentration
(determined by trypan blue exclusion) reached
.gtoreq.8.times.10.sup.5/ml Cultures were terminated when they
showed no proliferative response to irradiated lymphoblastoid cells
and/or when there were no viable cells present in the entire visual
field of the haemocytometer. Once transferred to the 2 ml wells,
cells were continuously exposed to 25 U/ml of recombinant
interleukin-2 (Amgen). The media used were (a) RPM1 (Irvine
Scientific) supplemented with 10 to 20% fetal calf serum, 2 mM
glutamine, and 1 mM Hepes; (b) AIM V.TM., a DMEM/nutrient mixture
F-12 basal medium, containing purified human albumin, transferrin,
and recombinant insulin (Gibco), supplemented with 25% Ex-cyte (an
aqueous mixture of lipoprotein, cholesterol, phospholipids, and
fatty acids, (Miles Diagnostics).
[0196] At each cell passage, the number of population doublings
(PD) was calculated according to the formula: PD=ln (final viable
cell no. initial cell no.)/ln2.
[0197] Isolation of DNA
[0198] PBLs (including=15% monocytes) were isolated using
Ficoll-Hypaque gradient centrifugation (Boyum et al., 21(97) Scan
J. Clin. Lab. Invest. 77, 1968) and washed 3 times in PBS. Cell
pellets were resuspended in 500 .mu.l of proteinase K digestion
buffer (100 mM NaCl, 10 mM Tris pH 8, 5 mM EDTA, 0.5% SDS)
containing 0.1 mg/ml proteinase K and incubated at 48.degree. C.
overnight. Lysates were extracted twice with
phenol/chloroformisoamyl alcohol (25:24:1 v/v/v) and once with
chloroform. DNA was precipitated with 95% ethanol and dissolved in
TE (10 mM Tris, 1 mM EDTA, pH=8).
[0199] Analysis of Telomeric DNA
[0200] Genomic DNA (10 .mu.g) was digested with HinfI and RsaI
(BRL) (20 U each), re-extracted as above, precipitated with 95%
ethanol, washed with 70% ethanol, dissolved in 50 .mu.l TE, and
quantified by fluorometry. One .mu.g of digested DNA was resolved
by electrophoresis in 0.5% (w/v) agarose gels poured on Gel Bound
(FMC Bioproducts) for 700 V-h. Gels were dried at 60.degree. C. for
30 minutes, denatured, neutralized, and probed with 5' end-labeled
.sup.32P-(CCCTAA) as described above. Autoradiograms exposed within
the linear range of signal response were scanned with a Hoefer
densitometer. The signal was digitized and subdivided into 1 kbp
intervals from 2 kbp to 21 kbp for calculation of the mean TRF
length (L) using the formula
L=.SIGMA.(OD.sub.i-L.sub.i)/.SIGMA.D.sub.i, where
OD.sub.i=integrated signal in interval i, and L=TRF length at the
mid-point of interval i.
[0201] TRF Length vs. Age
[0202] When measured as a function of donor age, mean TRF length in
PBS of 140 unrelated normal individuals (aged 0-107 y) declined at
a rate of 41.+-.2.6 bp/y (p<0.00005, r=0.83). This rate of TRF
loss for PBLs is close to that previously found for peripheral
blood cells-by Hastie et al., 346 Nature 866, 1990. When our data
were separated according to gender it was noticed that males lost
telomeric DNA at a rate slightly faster than that of females
(50.+-.4.2 vs 40.+-.3.6 bp/y), but this difference did not reach
statistical significance (p=0.1). The 18 centenarians (aged 99-107
y) among our population of normal individuals had a mean TRF length
of 5.28.+-.0.4 kbp (FIG. 7). Interestingly, the standard deviation
of mean TRF values for the centenarians (0.4 kbp) was much smaller
than that of other age groups. Although it is possible that this
represents selection of a more homogeneous population of cells with
age, it is also possible that the group of centenarians were less
genetically diverse than the younger populations in our study.
[0203] Mean TRF length was also analyzed in PBLs of 21 Down's
Syndrome individuals (aged 2-45 y) and the rate of loss was
compared to 68 age-matched controls (aged 0-43 y). We found that
cells from DS patients showed a significantly greater rate of
telomere loss (133.+-.15 bp/y vs 41.+-.7.7 bp/y; one tailed t-test,
t=5.71, p<0.0005) (FIG. 8).
[0204] To determine the rate of telomere loss as a function of cell
doublings, we cultured normal lymphocytes from 2 individuals in
vitro until replicative senescence and measured mean TRF length at
several population doubling levels (FIG. 9). Mean TRF length
decreased 90 bp/population doublings in these strains, within the
range observed for other human somatic cell types. The mean TRF
length at senescence for the lymphocyte cell strains shown here and
one other analyzed at terminal passage (FIG. 9), was 5.1.+-.0.35
kbp. The observed TRF values in vivo for PBLs of centenarians
(5.3.+-.0.4 kbp) and old DS patients (4.89.+-.0.59 kbp), were close
to this value, suggesting that a fraction of the cells from these
individuals were close to the limit of their replicative
capacity.
[0205] The results showing that telomeres in PBLs from normal
individuals shorten during aging in vivo and in vitro extend
similar observations on human fibroblasts (Harley et al., 345
Nature 458, 1990) and support the hypothesis that telomere loss is
involved in replicative senescence. We also found that in Down's
Syndrome, the rate of telomere loss in PBS in vivo was
significantly higher than that in age-matched normal donors. Thus,
accelerated telomere loss in PBS of trisomy 21, a syndrome
characterized by premature immunosenescence and other features of
accelerated aging (Martin, "Genetic Syndromes in Man with Potential
Relevance to the Pathobiology of Aging", in: Genetic Effects on
Aging, Bergsma, D. and Harrison D. E. (eds.), pp. 5-39, Birth
Defects: Original article series, no. 14, New York: Alan R. Liss
(1978)), could reflect early senescence of lymphocytes.
[0206] The increased rate of telomere loss in PBS from DS patients
could reflect a higher turnover rate of cells in vivo due to
reduced viability of the trisomy 21 cells. However, it is also
possible that the rate of telomere loss in PBS from DS patients is
greater per cell doubling than that in normal individuals.
[0207] The pathology of DS is similar in many ways to normal aging.
Premature senescence of the immune system possibly plays a role in
this similarity since DS patients have a high incidence of cancer
and suffer from autoimmunity. In support of this idea, lymphocytes
of older DS patients and old individuals share several
characteristics, including diminished response of T-cells to
activate and proliferate in response to antigen, low replicative
capacity, and reduced B- and T-cell counts (Franceschi et al., 621
Ann. NY Acad. Sci. 428, 1991). Our finding that telomere length
decreased faster in DS patients than normal individuals, and that
the mean TRF length in centenarians and old DS patients in vivo
were similar to that of senescent lymphocytes in vitro (=5 kbp) 1
extends these observations. Moreover, these data suggest that
replicative senescence within the lymphoid lineage in vivo
contributes to the compromised immune system of both elderly
individuals and Down's Syndrome patients.
Example 7
Ovarian Cancer and Telomerase Activity
[0208] The following is an example of a method by which telomerase
activity is shown to correlate with the presence of cancer cells.
In addition, the length of TRF was determined as an indication of
the presence of tumor cells. Generally, it was found that tumor
cells had significantly lower TRF values than surrounding normal
cells, and had telomerase activity. Thus, these two features are
markers for the presence of tumor cells.
[0209] The following methods were used to obtain these results:
[0210] Separation of Tumor and Non-Tumor Cells
[0211] In one method, ascitic fluid was obtained by either
diagnostic laparotomy or therapeutic paracentesis (from patients
diagnosed as having ovarian carcinoma), and centrifuged at
600.times.g for 10 minutes at 4.degree. C. The cell pellet was
washed twice in 10 to 30 ml of phosphate buffered saline (PBS: 2.7
mM KCl, 1.5 mM KH.sub.2PO.sub.4, 137 mM NaCl and 8 mM
Na.sub.2HPO.sub.4) and centrifuged at 570.times.g for 4 minutes at
4.degree. C. After the final wash the cell pellet was resuspended
in 20 ml of PBS and filtered through a 30 or 10 .mu.m nylon mesh
filter (Spectrum) which retains the tumor clumps but not single
cells. The filters were backwashed to liberate highly purified
tumor clumps. The flow-through was a combination of fibroblasts,
lymphocytes and tumor cells.
[0212] In another method ascitic fluid cells were collected and
washed as described above. The cellular pellet was resuspended in
.alpha.-MEM with 10% fetal calf serum and cultured in 150 mm
dishes. After 12 hours the media was removed and new plates were
used to separate the adhering fibroblasts from the non-adhering
cells in the medium. After 12 hours the media containing mostly
tumor clumps was removed from the second plates and allowed to
adhere in DMA F12 medium supplemented with 3% fetal calf serum, 5
ng/ml EGF, 5 .mu.g/ml insulin, 10 .mu.g/ml human transferrin,
5.times.10.sup.-5 M phosphoethanolamine and 5.times.10.sup.-5 M
ethanolamine. These tumor cells were cultured for DNA analysis and
S100 extracts.
[0213] DNA Extraction
[0214] Cells were lysed and proteins were digested in 10 mM
Tris-HCl (pH 8.0), 100 mM NaCl, 25 mM EDTA, 0.5% SDS, 0.1 mg/ml
proteinase K at 48.degree. C. overnight. Following 2 extractions
with phenol and 1 with chloroform, DNA was precipitated with
ethanol and dissolved in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA
(TE).
[0215] Determination of TRF Length and Amount of Telomeric DNA
[0216] Genomic DNA was digested with HinfI and RsaI, extracted and
precipitated as above, and redissolved in TE. DNA concentration was
measured by fluorometry (Morgan et al., 7 Nucleic Acids Res. 547,
1979). DNA samples (1 .mu.g each) were loaded onto a 0.5% agarose
gel and electrophoresed for 13 hours at 90 V. The gel was dried at
60.degree. C. for 30 minutes, denatured in 1.5 M NaCl and 0.5 M
NaOH for 15 minutes, neutralized in 1.5 M NaCl, 0.5 M Tris-HCl (pH
8.0) for 10 minutes and hybridized to a 5' .sup.32P(CCCTAA).sub.3
telomeric probe in 5.times.SSC (750 mM NaCl and 75 mM sodium
citrate), 5.times. Denhart's solution (Maniatis et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor (1982)) and 0.1.times.P wash. (0.5 mM pyrophosphate,
10 mM Na.sub.2HPO.sub.4) at 37.degree. C. for 12 hours. Following
three high stringency washes in 0.24.times.SSC at 20-22.degree. C.
(7 minutes each), the gel was autoradiographed on pre-flashed
(OD=0.15) Kodak XAR-5 X-ray films for 3 days with enhancing
screens. Each lane was scanned with a densitometer and the data
used to determine the amount of telomeric DNA and the mean TRF
length as previously described (Harley et al., 345 Nature 458,
1990).
[0217] Preparations of S-100 Cell Extracts
[0218] A minimum of 6.times.10.sup.8 cells were used for each
extract. Ascitic fluid or purified ascitic fluid tumor cells (by
the first method described above) were centrifuged at 570.times.g
for 4 minutes at 4.degree. C. Ascitic fluid tumor cells separated
by the second method described above (grown in monolayer) were
harvested by scraping with a rubber policeman, and centrifuged as
above. The pellets were rinsed twice in cold PBS followed by
centrifugation as above. The final pellet was rinsed in cold
2.3.times.Hypo buffer (lx Hypo buffer: 10 mM Hepes (pH 8.0)), 3 mM
KCl, 1 mM MgCl.sub.2, 1 mM DTT, 0.1 mM PMSF and 10 U/ml of RNAsin,
1 .mu.M leupeptin and 10 .mu.M pepstatin A, centrifuged for 5
minutes and resuspended in 0.75 volumes of 2.3.times.Hypo buffer.
After incubation on ice for 10 minutes the sample was transferred
to an ice cold 7 or 1 ml Dounce homogenizer and homogenized on ice
using a B pestle (25-55 .mu.m clearance). After a further 30
minutes on ice the samples having a volume larger than 1 ml were
centrifuged for 10 minutes at 10,000 rpm (16,000.times.g) at
4.degree. C. in a Beckman J3-13.1 swinging bucket rotor.
One-fiftieth volume of 5 M NaCl was added, and the samples
supernatant were centrifuged for 1 hour at 38,000 rpm
(100,000.times.g) at 4.degree. C. in a Beckman Ti50 rotor. Glycerol
was added to a final concentration of 20% and the extract aliquoted
and stored at -70.degree. C. Samples less than 1 ml were
centrifuged at 55,000 rpm for 1 hour at 4.degree. C. in a TLA 100.2
rotor (Beckman) and NaCl and glycerol were added to the supernatant
as above. Protein concentration in a typical extract was
approximately 4 mg/ml.
[0219] Telomerase Assay
[0220] Telomerase activity was assayed by a modification of the
method of Morin, 59 Cell 521, 1989. Aliquots (20 .mu.l) of S-100
cell extract were diluted to a final volume of 40 .mu.l containing
2 mM dATP, 2 mM dTTP, 1 mM MgCl.sub.21 1 .mu.M (TTAGGG).sub.3
primer, 3.13 .mu.M (50 .mu.Ci) .alpha.-.sup.32P-dGTP (400
Ci/mmole), 1 mM spermidine, 5 mM .beta.-mercaptoethanol, 50 mM
potassium acetate, and 50 mM Tris-acetate (pH 8.5). In some
experiments reaction volumes were doubled. The reactions were
incubated for 60 minutes at 30.degree. C. and stopped by addition
of 50 .mu.l of 20 mM EDTA and 10 mM Tris-HCl (pH 7.5) containing
0.1 mg/ml RNAseA, followed by incubation for 15 minutes at
37.degree. C. To eliminate proteins, 50 .mu.l of 0.3 mg/ml
Proteinase K in 10 mM Tris-HCl (pH 7.5), 0.5% SDS was added for 10
minutes at 37.degree. C. Following extraction with phenol and
chloroform, unincorporated .alpha.-.sup.32P-dGTP was separated by
centrifuging the samples for 4 minutes at 500 g in a swinging
bucket rotor through NICK SPIN columns (Pharmacia). DNA was
precipitated by the addition of 5.3 .mu.l of 4 M NaCl, 4 .mu.g of
carrier tRNA and 500 .mu.l of ethanol at -20.degree. C. DNA pellets
were resuspended in 3 .mu.l of formamide loading dye, boiled for 1
minute, chilled on ice and loaded onto an 8% polyacrylamide, 7 M
urea sequencing gel and run at 1700 V for 2 hours using
0.6.times.TBE buffer. Dried gels were exposed to Kodak XAR-5
pre-flashed film at -70.degree. C. with enhancing screen or to
phosphoimager screens (Molecular Dynamics) for 7 days.
[0221] The results of the above experiments are shown in tables 2
and 3 below:
3TABLE 2 Characteristics of ATCC Ovarian Carcinoma Cell Lines Cell
line Mean TRF Length (kbp) Telomerase Activity HEY stable at 3.7 +
CAOV-3 stable at 3.7 N.D. SKOV-3 Increases at 60 bp/pd N.D.
[0222]
4TABLE 3 Characteristics of Ovarian Carcinoma Tumor Cells from
Ascitic Fluid Mean TRF Telomerase Patient Description Length (kbp)
Activity Pres-3 Purified tumor cells 3.7 + Mac-2 Purified tumor
cells 3.7 N.D. Sib-1 Purified tumor cells 4.2 N.D. Ric 207 Purified
tumor cells 3.3 N.D. Cra-1 Purified tumor cells 5.2 N.D. Ing-1
Purified tumor cells 5.8 N.D. Lep-1 Purified tumor cells 5.8 N.D.
Lep-4 Purified tumor cells 5.6 N.D. Sol-1 Purified tumor cells 5.6
N.D. Rud-1 Ascitic fluid cells 3.4 + Murr-1 Ascitic fluid cells 3.8
+ Dem-1 Ascitic fluid cells N.D. + Cas-1 Ascitic fluid cells 5.3 +
Wad-1,2 Ascitic fluid cells 4.9 N.D.* N.D. = not determined *High
background precluded detection
[0223] In the TRF assay, each tumor clump had significantly lower
TRF lengths than associated normal cells. (See FIG. 10).
[0224] In the telomerase assay, significantly greater telomerase
activity was evident in the ascitic fluid of certain patients than
in the control tumor lines HEY and PRES, or the control cell line
293 CSH (FIG. 11).
Example 8
Effect of HIV Infection on TRF Length
[0225] HIV infection leads to an acute viral infection manifesting
itself as a virus-like syndrome, followed by a prolonged period of
latency characterized by an absence of signs and symptoms. During
this prolonged asymptomatic period (lasting usually 7-10 years),
there is no diagnostic available for staging the course of the
infection other than the presence or absence of antibodies to viral
coat proteins. This does little to stage the disease or to help the
physician measure the effectiveness of prophylactic agents.
[0226] While Meyaard et al., 257 Science 217, 1992, propose a
programmed cell death for CD4.sup.+ and CD8.sup.+ cells of an
HIV-infected individual, we propose that during those 7 to 10 years
the immune system is able to keep the infection relatively
repressed, but there is markedly increased turnover of the infected
CD4.sup.+ T-cells. This may be due in part to viral-mediated cell
destruction. We propose that this essentially accelerates the
replicative senescence of this particular subpopulation of T-cells,
and with time results in a population of precursor pluripotent
cells with markedly reduced proliferative capacity. Finally, this
results in CD4.sup.+ T-cells that are relatively unresponsive to
stimuli to proliferate, as is typical of the replicative senescence
of the cells observed in vitro.
[0227] We also propose that the replicative capacity of total
peripheral lymphocytes or CD4.sup.+ cells in particular, can be
effectively determined by assaying telomere repeat length utilizing
the method described above, e.g., with the oligonucleotide probe 5'
TTAGGGTTAGGGTTAGGGTTAGGG (or one of similar or complementary
sequence) hybridized to CD4.sup.+ lymphocyte DNA isolated from the
patient along with molecular size markers. These assays allow the
physician to chart the course of the disease during the long
intervening asymptomatic period, and to score the effectiveness of
prophylactic therapeutics.
[0228] In order to determine whether TRF length is a useful marker
in diagnosis of HIV infection, CD4.sup.+ cell counting was
performed on asymptomatic HIV-infected individuals, and compared to
TRF length, measured as discussed above. As shown above, peripheral
lymphocytes start with around 10 kb TRF length at birth, and reach
a TRF length of 5.0 at approximately age 120. The results were as
follows:
[0229] A 30 year old HIV+ with a CD4 count of 476 had a TRF of
7.6.
[0230] A 46 year old HIV- control, had a TRF of 7.0.
[0231] A 34 year old HIV+ with a CD4 count of 336, had a TRF of
7.7.
[0232] A 46 year old HIV- control, had a TRF of 7.1.
[0233] A 32 year old HIV+ with a CD4 count of 448, had a TRF of
6.9.
[0234] A 33 year old HIV+ with a CD4 count of 358, had a TRF of 5.0
(i.e., at a length observed for senescent cells)
[0235] The results indicate that the 33 year old HIV+ patient has a
senescent telomere length in his CD4.sup.+ cells, which means that
they are at the end of their replicative capacity. In contrast, the
CD4.sup.+ count provided no indication of the status of this
patient. Indeed, one patient actually had a lower CD4.sup.+
count.
[0236] Two weeks after the assay was performed, this patient
experienced a precipitous drop in CD4.sup.+ count, going from 358
to 159, and was therefore diagnosed AIDS, and rapidly acquired
leukoplakia on the tongue. The other patients remain asymptomatic.
Thus, this diagnostic procedure is able to distinguish patients
near the end of the course of HIV infection, whereas the previously
used marker (CD4.sup.+ count) could not.
[0237] The accelerated replicative senescence of CD4.sup.+
lymphocytes during the course of HIV infection provides an
appropriate indication for therapies designed to forestall telomere
shortening, e.g., utilizing the CTO oligonucleotide described
above. In addition, as described above, CD4.sup.+ cells of an
individual at an early stage of infection can be banked for later
administration to the individual. The efficacy of drugs, such as
AZT, may also be determined to study whether the drug slows the
rate of proliferation of CD4.sup.+ cells, and is thus useful at all
stages of the disease. If not, it can be administered only when
necessary during the course of the disease.
Example 9
Telomere Shortening in Human Mammary Epithelial (HME) Cells
[0238] Referring to FIG. 12, when digested with a restriction
enzyme having 4-base recognition site (like Hinf1), most genomic
DNA is digested into small fragments. However, because the
repetitive telomeric sequences lack restriction sites, telomeres
retain relatively large terminal restriction fragments (TRFs)
composed of 2-4 Kb of subtelomeric DNA and age-dependent amounts of
telomeric repeats. As previously described for human fibroblasts,
lymphocytes and endothelial cells, telomere length shortens in
normal human mammary epithelial cells during in vitro cellular
senescence (compare TRF length in lanes 1 (PDL 21) and 2 (PDL 40)).
In human mammary epithelial cells expressing E6 of human papilloma
virus 16, the TRF length continues to shorten during the extended
lifespan period until crisis and subsequently immortalization
occurs (lane 3 (PDL 68)). The TRFs generally stabilize in
immortalized cells (lane 4 (PDL 81) and lane 5 (PDL 107))
consistent with the re-expression of telomerase activity.
Example 10
Slowing Telomere Loss
[0239] Normal human mammary epithelial cells can be established
from organoids (obtained from reduction mammoplasty) and can be
cultured in defined condition in a standard medium (MCDB170) devoid
of serum. Epithelial cells with typical cobblestone morphology
spread around organoids plated in this medium. After the first
subcultivation these cultures enter a period of growth arrest for
2-3 weeks until a population of small, highly birefringent and
rapidly dividing cells expand among larger cells. The medium
apparently selects for a less differentiated cell type with
increased growth potential. These cells can be subcultured for
40-45 additional doublings before undergoing cellular
senescence.
[0240] As in Example 1, the change in proliferative lifespan and
rate of telomere shortening in cultured mammary epithelial cells
treated with the indicated amounts of CTO versus control random
oligonucleotides. Normal human mammary epithelial cells from a
donor (31) were infected with the E6 gene of human papilloma virus
16. This gene product degrades p53 protein and permits HME31 cells
to have extended life span by proliferating from PDL 42 to PDL 62
when crisis occurs. During this extended lifespan period the TRFs
shorten from an average of approximately 5 kb to 2.5 kb (compare in
FIG. 12 HME31 PD 40 to HME31E6 PD 68).
[0241] As is demonstrated in FIG. 13, experiments initiated using
HME31E6 cells at PDL 36 were cultured in the presence of 3, 10, 30
and 100 .mu.M CTO. As controls the cells were cultured without
oligonucleotides (nil) or with 30 .mu.M random oligonucleotide.
FIG. 13 demonstrates that compared to the nil control and the 30
.mu.M random oligonucleotide, there was a dose related retardation
of TRF shortening between PDL 36 and 50. This is most easily seen
by examining the subpopulation of telomere TRFs that migrate more
slowly than the rest, giving a discrete trailing band. Cells were
maintained in logarithmic growth with medium changed and fresh
oligonucleotide added three times per week.
Example 11
Extension of Life Span of IMR90 Fibroblasts
[0242] Referring to FIG. 14, IMR-90 lung fibroblasts at PDL 30 were
treated with 10 .mu.M, 30 .mu.M or 100 .mu.M phosphodiester CTO or
with only media addition (control). The cells were cultured in
medium containing regular defined supplemented calf serum. The
cells were passaged in 24 well dishes and subcultivated by
trypsinization upon reaching confluency at 25,000 cells per well.
The cells were fed medium containing oligonucleotides at various
concentrations daily. As a control, cells were fed identical medium
without oligonucleotides. As is illustrated in FIG. 14, there was
approximately a 12-15% extension of total life span with CTO. In
these experiments the control cells divided approximately 15-18
times during the experiment, whereas the treated cells divided
23-26 times IMR-90 telomeres shorten approximately 50 b.p. per
division and the TRF length of the control IMR-90 fibroblasts at
senescence was approximately 9 kb. Since the 100 .mu.M CTO-treated
IMR-90 cells senesced at PDL 55, the predicted difference in TRF
length between the control and the 100 .mu.M CTO (9 kb vs 9.4 kb)
is too small to be resolved using current techniques.
Example 12
GTO Experiments
[0243] As in Example 2, an immortalized human fibroblast cell line,
IDH4, which has very short TRFs, was incubated with GTO
oligonucleotide. Referring to FIGS. 15 and 16, cells were incubated
in regular culture medium containing serum in the presence of 10
.mu.M, 30 .mu.M and 100 .mu.M GTO. The cells were fed fresh
phosphodiester GTO oligonucleotide every other day and subcultured
when confluent for a total of 90 days. The cells were still growing
in GTO after 90 days at all concentrations used even though they
grew more slowly at the higher GTO concentrations and went through
fewer population doublings (control, 45 PDL; 10 .mu.M GTO 40 PDL;
30 .mu.M 35 PDL; 100 .mu.M 25 PDL). When TRF analysis was performed
after 90 days the IDH4 cells regained TRF length in a dose
dependent manner with 30 .mu.M and 100 .mu.M being approximately
the same (FIG. 15). This suggests that the presence of excess
single-stranded TTAGGG DNA in the cell was probably influencing the
feedback regulation of telomerase and actually increasing
telomerase activity and extending telomere length. The control and
30 .mu.M GTO were passaged without oligonucleotide addition for an
additional 90 days (approximately 35-40 PDL). As is illustrated in
FIG. 16, the TRFs slowly shorten.
[0244] These data and those in Example 2, indicate that cell lines
differ in their response to GTO oligonucleotide. Thus, prior to use
of such an oligonucleotide in therapeutic compositions it is
important to ensure that the target cells respond as desired.
Should the effect seen above occur, then the oligonucleotide should
be chosen to change the response to that shown in Example 2. This
can be done by choosing an oligonucleotide which binds to
telomerase at a different site from that bound by GTO. Applicant
believes that the effect observed above is caused by binding of GTO
to required proteins, allowing telomerase to be active to expand
the telomeres. Thus, by choosing an oligonucleotide which does not
bind such proteins the desired effect of reducing telomerase
activity can be achieved.
[0245] Compositions
[0246] Compositions or products according to the invention may
conveniently be provided in the form of solutions suitable for
parenteral or nasal or oral administration. In many cases, it will
be convenient to provide an agent in a single solution for
administration.
[0247] If the agents are amphoteric they may be utilized as free
bases, as acid addition salts or as metal salts. The salts must, of
course, be pharmaceutically acceptable, and these will include
metal salts, particularly alkali and alkaline earth metal salts,
e.g., potassium or sodium salts. A wide variety of pharmaceutically
acceptable acid addition salts are available. These include those
prepared from both organic and inorganic acids, preferably mineral
acids. Typical acids which may be mentioned by way of example
include citric, succinic, lactic, hydrochloric and hydrobromic
acids. Such products are readily prepared by procedures well known
to those skilled in the art.
[0248] The agents (and inhibitors) of the invention will normally
be provided as parenteral compositions for injection or infusion.
They can, for example, be suspended in an inert oil, suitably a
vegetable oil such as sesame, peanut, or olive oil. Alternatively,
they can be suspended in an aqueous isotonic buffer solution at a
pH of about 5.6 to 7.4. Useful buffers include sodium
citrate-citric acid and sodium phosphate-phosphoric acid.
[0249] The desired isotonicity may be accomplished using sodium
chloride or other pharmaceutically acceptable agents such as
dextrose, boric acid, sodium tartrate, propylene glycol or other
inorganic or organic solutes. Sodium chloride is preferred
particularly for buffers containing sodium ions.
[0250] If desired, solutions of the above compositions may be
thickened with a thickening agent such as methyl cellulose. They
may be prepared in emulsified form, either water in oil or oil in
water. Any of a wide variety of pharmaceutically acceptable
emulsifying agents may be employed including, for example acacia
powder, or an alkali polyether alcohol sulfate or sulfonate such as
a Triton.
[0251] The therapeutically useful compositions of the invention are
prepared by mixing the ingredients following generally accepted
procedures. For example, the selected components may be simply
mixed in a blender or other standard device to produce a
concentrated mixture which may then be adjusted to the final
concentration and viscosity by the addition of water or thickening
agent and possibly a buffer to control pH or an additional solute
to control tonicity.
[0252] For use by the physician, the compositions will be provided
in dosage unit form containing an amount of agent which will be
effective in one or multiple doses to perform a desired function.
As will be recognized by those in the field, an effective amount of
therapeutic agent will vary with many factors including the age and
weight of the patient, the patient's physical condition, the blood
sugar level to be obtained, and other factors.
[0253] Administration
[0254] Selected agents, e.g., oligonucleotide or ribozymes can be
administered prophylactically, or to patients suffering from a
target disease, e.g., by exogenous delivery of the agent to an
infected tissue by means of an appropriate delivery vehicle, e.g.,
a liposome, a controlled release vehicle, by use of iontophoresis,
electroporation or ion paired molecules, or covalently attached
adducts, and other pharmacologically approved methods of delivery.
Routes of administration include intramuscular, aerosol, oral
(tablet or pill form), topical, systemic, ocular, intraperitoneal
and/or intrathecal. Expression vectors for immunization with
ribozymes and/or delivery of oligonucleotides are also
suitable.
[0255] The specific delivery route of any selected agent will
depend on the use of the agent. Generally, a specific delivery
program for each agent will focus on naked agent uptake with regard
to intracellular localization, followed by demonstration of
efficacy. Alternatively, delivery to these same cells in an organ
or tissue of an animal can be pursued. Uptake studies will include
uptake assays to evaluate, e.g., cellular oligonucleotide uptake,
regardless of the delivery vehicle or strategy. Such assays will
also determine the intracellular localization of the agent
following uptake, ultimately establishing the requirements for
maintenance of steady-state concentrations within the cellular
compartment containing the target sequence (nucleus and/or
cytoplasm). Efficacy and cytotoxicity can then be tested. Toxicity
will not only include cell viability but also cell function.
[0256] Some methods of delivery, e.g., for oligonucleotides, that
may be used include:
[0257] a. encapsulation in liposomes,
[0258] b. transduction by retroviral vectors,
[0259] c. conjugation with cholesterol,
[0260] d. localization to nuclear compartment utilizing antigen
binding site found on most snRNAs,
[0261] e. neutralization of charge of oligonucleotides by using
nucleotide derivatives, and
[0262] f. use of blood stem cells to distribute oligonucleotides
throughout the body.
[0263] At least three types of delivery strategies are useful in
the present invention, including: agent modifications, particle
carrier drug delivery vehicles, and retroviral expression vectors.
Unmodified agents may be taken up by cells, albeit slowly. To
enhance cellular uptake, the agent may be modified essentially at
random, in ways which reduces its charge but maintains specific
functional groups. This results in a molecule which is able to
diffuse across the cell membrane, thus removing the permeability
barrier.
[0264] Modification of agents to reduce charge is just one approach
to enhance the cellular uptake of these larger molecules. The
structural requirements necessary to maintain agent activity are
well understood by those in the art. These requirements are taken
into consideration when designing modifications to enhance cellular
delivery. The modifications are also designed to reduce
susceptibility to enzymatic degradation. Both of these
characteristics should greatly improve the efficacy of the
agent.
[0265] Chemical modifications of the phosphate backbone of
oligonucleotides will reduce the negative charge allowing free
diffusion across the membrane. This principle has been successfully
demonstrated for antisense DNA technology. In the body, maintenance
of an external concentration will be necessary to drive the
diffusion of the modified oligonucleotides into the cells of the
tissue. Administration routes which allow the diseased tissue to be
exposed to a transient high concentration of the oligonucleotide,
which is slowly dissipated by systemic adsorption are preferred.
Intravenous administration with a drug carrier designed to increase
the circulation half-life of the oligonucleotides can be used. The
size and composition of the drug carrier restricts rapid clearance
from the blood stream. The carrier, made to accumulate at the site
of infection, can protect the oligonucleotides from degradative
processes.
[0266] Drug delivery vehicles are effective for both systemic and
topical administration. They can be designed to serve as a slow
release reservoir, or to deliver their contents directly to the
target cell. An advantage of using direct delivery drug vehicles is
that multiple molecules are delivered per uptake. Such vehicles
have been shown to increase the circulation half-life of drugs
which would otherwise be rapidly cleared from the blood stream.
Some examples of such specialized drug delivery vehicles which fall
into this category are liposomes, hydrogels, cyclodextrins,
biodegradable nanocapsules, and bioadhesive microspheres.
[0267] From this category of delivery systems, liposomes are
preferred. Liposomes increase intracellular stability, increase
uptake efficiency and improve biological activity.
[0268] Liposomes are hollow spherical vesicles composed of lipids
arranged in a similar fashion as those lipids which make up the
cell membrane. They have an internal aqueous space for entrapping
water soluble compounds and range in size from 0.05 to several
microns in diameter. Several studies have shown that liposomes can
deliver agents to cells and that the agent remains biologically
active.
[0269] For example, a liposome delivery vehicle originally designed
as a research tool, Lipofectin, has been shown to deliver intact
mRNA molecules to cells yielding production of the corresponding
protein.
[0270] Liposomes offer several advantages: They are non-toxic and
biodegradable in composition; they display long circulation
half-lives; and recognition molecules can be readily attached to
their surface for targeting to tissues. Finally, cost effective
manufacture of liposome-based pharmaceuticals, either in a liquid
suspension or lyophilized product, has demonstrated the viability
of this technology as an acceptable drug delivery system.
[0271] Other controlled release drug delivery systems, such as
nanoparticles and hydrogels may be potential delivery vehicles for
an agent. These carriers have been developed for chemotherapeutic
agents and protein-based pharmaceuticals.
[0272] Topical administration of agents is advantageous since it
allows localized concentration at the site of administration with
minimal systemic adsorption. This simplifies the delivery strategy
of the agent to the disease site and reduces the extent of
toxicological characterization. Furthermore, the amount of material
to be applied is far less than that required for other
administration routes. Effective delivery requires the agent to
diffuse into the infected cells. Chemical modification of the agent
to neutralize negative or positive charges may be all that is
required for penetration. However, in the event that charge
neutralization is insufficient, the modified agent can be
co-formulated with permeability enhancers, such as Azone or oleic
acid, in a liposome. The liposomes can either represent a slow
release presentation vehicle in which the modified agent and
permeability enhancer. transfer from the liposome into the targeted
cell, or the liposome phospholipids can participate directly with
the modified agent and permeability enhancer in facilitating
cellular delivery. In some cases, both the agent and permeability
enhancer can be formulated into a suppository formulation for slow
release.
[0273] Agents may also be systemically administered. Systemic
absorption refers to the accumulation of drugs in the blood stream
followed by distribution throughout the entire body. Administration
routes which lead to systemic absorption include: intravenous,
subcutaneous, intraperitoneal, intranasal, intrathecal and
ophthalmic. Each of these administration routes expose the agent to
an accessible diseased or other tissue. Subcutaneous administration
drains into a localized lymph node which proceeds through the
lymphatic network into the circulation. The rate of entry into the
circulation has been shown to be a function of molecular weight or
size. The use of a liposome or other drug carrier localizes the
agent at the lymph node. The agent can be modified to diffuse into
the cell, or the liposome can directly participate in the delivery
of either the unmodified or modified agent to the cell.
[0274] Most preferred delivery methods include liposomes (10-400
nm), hydrogels, controlled-release polymers, microinjection or
electroporation (for ex vivo treatments) and other pharmaceutically
applicable vehicles. The dosage will depend upon the disease
indication and the route of administration but should be between
10-2000 mg/kg of body weight/day. The duration of treatment will
extend through the course of the disease symptoms, usually at least
14-16 days and possibly continuously. Multiple daily doses are
anticipated for topical applications, ocular applications and
vaginal applications. The number of doses will depend upon disease
delivery vehicle and efficacy data from clinical trials.
[0275] Establishment of therapeutic levels of agent within the
target cell is dependent upon the rate of uptake and degradation.
Decreasing the degree of degradation will prolong the intracellular
half-life of the agent. Thus, chemically modified agents, e.g.,
oligonucleotides with modification of the phosphate backbone, or
capping of the 5' and 3' ends of the oligonucleotides with
nucleotide analogues may require different dosaging.
[0276] It is evident from the above results, that by modulating
telomerase activity and monitoring telomere length and telomerase
activity, one may provide therapies for proliferative diseases and
monitor the presence of neoplastic cells and/or proliferative
capacity of cells, where one is interested in regeneration of
particular cell types. Assays are provided which allow for the
determination of both telomere length, particularly as an average
of a cellular population, or telomerase activity of a cellular
population. This information may then be used in diagnosing
diseases, predicting outcomes, and providing for particular
therapies.
[0277] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0278] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
Sequence CWU 1
1
* * * * *