U.S. patent application number 10/272152 was filed with the patent office on 2003-09-18 for detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays.
Invention is credited to Barany, Francis, Barany, George, Day, Joseph, Gerry, Norman P., Hammer, Robert P., Witowski, Nancy E..
Application Number | 20030175750 10/272152 |
Document ID | / |
Family ID | 22419369 |
Filed Date | 2003-09-18 |
United States Patent
Application |
20030175750 |
Kind Code |
A1 |
Barany, Francis ; et
al. |
September 18, 2003 |
Detection of nucleic acid sequence differences using the ligase
detection reaction with addressable arrays
Abstract
The present invention describes a method for identifying one or
more of a plurality of sequences differing by one or more single
base changes, insertions, deletions, or translocations in a
plurality of target nucleotide sequences. The ligation phase
utilizes a ligation detection reaction between one oligonucleotide
probe, which has a target sequence-specific portion and an
addressable array-specific portion, and a second oligonucleotide
probe, having a target sequence-specific portion and a detectable
label. After the ligation phase, the capture phase is carried out
by hybridizing the ligated oligonucleotide probes to a solid
support with an array of immobilized capture oligonucleotides at
least some of which are complementary to the addressable
array-specific portion. Following completion of the capture phase,
a detection phase is carried out to detect the labels of ligated
oligonucleotide probes hybridized to the solid support. The
ligation phase can be preceded by an amplification process. The
present invention also relates to a kit for practicing this method,
a method of forming arrays on solid supports, and the supports
themselves.
Inventors: |
Barany, Francis; (New York,
NY) ; Gerry, Norman P.; (New York, NY) ;
Witowski, Nancy E.; (Edina, MN) ; Day, Joseph;
(Foster City, CA) ; Hammer, Robert P.; (Baton
Rouge, LA) ; Barany, George; (Falcon Heights,
MN) |
Correspondence
Address: |
Michael L. Goldman
NIXON PEABODY LLP
Clinton Square
P.O. Box 31051
Rochester
NY
14603-1051
US
|
Family ID: |
22419369 |
Appl. No.: |
10/272152 |
Filed: |
October 15, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10272152 |
Oct 15, 2002 |
|
|
|
09526992 |
Mar 16, 2000 |
|
|
|
6506594 |
|
|
|
|
60125357 |
Mar 19, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/287.2 |
Current CPC
Class: |
B01J 2219/00612
20130101; C40B 60/14 20130101; B01J 2219/00313 20130101; B01J
2219/00722 20130101; B01J 2219/00585 20130101; C40B 50/08 20130101;
B01J 2219/00659 20130101; C12Q 1/6837 20130101; B01J 2219/00326
20130101; C12Q 1/6858 20130101; B01J 2219/00637 20130101; B01J
2219/00416 20130101; B01J 2219/00729 20130101; B01J 2219/00641
20130101; C12Q 1/6858 20130101; C12Q 2561/125 20130101; B01J
2219/0059 20130101; C12Q 2565/125 20130101; C12Q 2561/125 20130101;
C12Q 2565/125 20130101; C12Q 2561/125 20130101; C12Q 2565/514
20130101; C12Q 2565/125 20130101; C12Q 2565/514 20130101; C12Q
2565/514 20130101; C12Q 1/6827 20130101; B01J 2219/00605 20130101;
C12Q 1/6827 20130101; C40B 40/06 20130101; C12Q 1/6837 20130101;
B01J 2219/00527 20130101; B01J 2219/00599 20130101; B01J 2219/00626
20130101 |
Class at
Publication: |
435/6 ;
435/287.2 |
International
Class: |
C12Q 001/68; C12M
001/34 |
Goverment Interests
[0002] This invention was developed with government funding under
National Institutes of Health Grant Nos. GM-41337-06, GM-43552-05,
GM-42722-07, and GM-51628-02, and NIST Grant No. 1995-08-0006F. The
U.S. Government may have certain rights.
Claims
What is claimed:
1. A method for identifying one or more of a plurality of sequences
differing by one or more single-base changes, insertions,
deletions, or translocations in a plurality of target nucleotide
sequences comprising: providing a sample potentially containing one
or more target nucleotide sequences with a plurality of sequence
differences; providing a plurality of oligonucleotide probe sets,
each set characterized by (a) a first oligonucleotide probe, having
a target-specific portion and an addressable array-specific
portion, and (b) a second oligonucleotide probe, having a
target-specific portion and a detectable reporter label, wherein
the oligonucleotide probes in a particular set are suitable for
ligation together when hybridized adjacent to one another on a
corresponding target nucleotide sequence, but have a mismatch which
interferes with such ligation when hybridized to any other
nucleotide sequence present in the sample; providing a ligase,
blending the sample, the plurality of oligonucleotide probe sets,
and the ligase to form a mixture; subjecting the mixture to one or
more ligase detection reaction cycles comprising a denaturation
treatment, wherein any hybridized oligonucleotides are separated
from the target nucleotide sequences, and a hybridization
treatment, wherein the oligonucleotide probe sets hybridize at
adjacent positions in a base-specific manner to their respective
target nucleotide sequences, if present in the sample, and ligate
to one another to form a ligated product sequence containing (a)
the addressable array-specific portion, (b) the target-specific
portions connected together, and (c) the detectable reporter label,
and, wherein the oligonucleotide probe sets may hybridize to
nucleotide sequences in the sample other than their respective
target nucleotide sequences but do not ligate together due to a
presence of one or more mismatches and individually separate during
the denaturation treatment; providing a solid support having a
porous surface and different capture oligonucleotides immobilized
at particular sites, wherein the capture oligonucleotides have
nucleotide sequences complementary to the addressable
array-specific portions; contacting the mixture, after said
subjecting, with the solid support under conditions effective to
hybridize the addressable array-specific portions to the capture
oligonucleotides in a base-specific manner, thereby capturing the
addressable array-specific portions on the solid support at the
site with the complementary capture oligonucleotide; and detecting
the reporter labels of ligated product sequences captured to the
solid support at particular sites, thereby indicating the presence
of one or more target nucleotide sequences in the sample.
2. A method according to claim 1, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, have a mismatch at a base at the ligation junction which
interferes with such ligation.
3. A method according to claim 2, wherein the mismatch is at the 3'
base at the ligation junction.
4. A method according to claim 1, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, there is a mismatch at a base adjacent to a base at the
ligation junction which interferes with such ligation.
5. A method according to claim 4, wherein the mismatch is at the
base adjacent to the 3' base at the ligation junction.
6. A method according to claim 1, wherein the sample potentially
contains unknown amounts of one or more of a plurality of target
sequences with a plurality of sequence differences, said method
further comprising: quantifying, after said detecting, the amount
of the target nucleotide sequences in the sample by comparing the
amount of captured ligated product sequences generated from the
sample with a calibration curve of captured ligated product
sequences generated from samples with known amounts of the, target
nucleotide sequence.
7. A method according to claim 1, wherein the sample potentially
contains unknown amounts of one or more of a plurality of target
nucleotide sequences with a plurality of sequence differences, said
method further comprising: providing a known amount of one or more
marker target nucleotide sequences; providing a plurality of
marker-specific oligonucleotide probe sets, each set characterized
by (a) a first oligonucleotide probe, having a target-specific
portion complementary to the marker target nucleotide sequence and
an addressable array-specific portion complementary to capture
oligonucleotides on the solid support, and (b) a second
oligonucleotide probe, having a target-specific portion
complementary to the marker target nucleotide sequence and a
detectable reporter label, wherein the oligonucleotide probes in a
particular marker-specific oligonucleotide set are suitable for
ligation together when hybridized adjacent to one another, on a
corresponding marker target nucleotide sequence, but, when
hybridized to any other nucleotide sequence present in the sample
or added marker sequences, there is a mismatch which interferes
with such ligation, wherein said blending comprises blending the
sample, the marker target nucleotide sequences, the plurality of
oligonucleotide probe sets, the plurality of marker-specific
oligonucleotide probe sets, and the ligase to form a mixture;
detecting the reporter labels of the ligated marker-specific
oligonucleotide sets captured on the solid support at particular
sites, thereby indicating the presence of one or more marker target
nucleotide sequences in the sample; and quantifying the amount of
target nucleotide sequences in the sample by comparing the amount
of captured ligated product generated from the known amount of
marker target nucleotide sequences with the amount of captured
other ligated product.
8. A method according to claim 7, wherein the one or more marker
target nucleotide sequences differ from the target nucleotide
sequences in the sample at one or more single nucleotide
positions.
9. A method according to claim 8, wherein the oligonucleotide probe
sets and the marker-specific oligonucleotide probe sets form a
plurality of oligonucleotide probe groups, each group comprised of
one or more oligonucleotide probe sets designed for distinguishing
multiple allele differences at a single nucleotide position,
wherein, in the oligonucleotide probe sets of each group, the first
oligonucleotide probes have a common target-specific portion, and
the second oligonucleotide probes have a differing target-specific
portion which hybridize to a given allele or a marker nucleotide
sequence in a base-specific manner.
10. A method according to claim 8, wherein the oligonucleotide
probe sets and the marker-specific oligonucleotide probe sets form
a plurality of oligonucleotide probe groups, each group comprised
of one or more oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, wherein, in the oligonucleotide probe sets of each group,
the second oligonucleotide probes have a common target-specific
portion and the first oligonucleotide probe have differing
target-specific portions, which hybridize to a given allele or a
marker nucleotide sequence in a base-specific manner.
11. A method according to claim 1, wherein the sample potentially
contains unknown amounts of two or more of a plurality of target
nucleotide sequences with a plurality of sequence differences, said
method further comprising: quantifying, after said detecting, the
relative amount of each of the plurality of target nucleotide
sequences in the sample by comparing the relative amount of
captured ligated product sequences generated by each of the
plurality of target sequences within the sample, thereby providing
a quantitative measure of the relative level of two or more target
nucleotide sequences in the sample.
12. A method according to claim 1, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a single target nucleotide sequence or multiple
allele differences at two or more adjacent nucleotide positions, or
at nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequences are
distinguished with oligonucleotide probe sets having
oligonucleotide probes with target-specific portions which
overlap.
13. A method according to claim 1, wherein the target-specific
portions of the oligonucleotide probe sets have substantially the
same melting temperature so that they hybridize to target
nucleotide sequences under similar hybridization conditions.
14. A method according to claim 1, wherein multiple allele
differences at one or more nucleotide position in a single target
nucleotide sequence or multiple allele differences at one or more
positions in multiple target nucleotide sequences are
distinguished, the oligonucleotide probe sets forming a plurality
of oligonucleotide probe groups, each group comprised of one or
more oligonucleotide probe sets designed for distinguishing
multiple allele differences at a single nucleotide position,
wherein, in the oligonucleotide probes of each group, the second
oligonucleotide probes have a common target-specific portion and
the first oligonucleotide probes have differing target-specific
portions which hybridize to a given allele in a base-specific
manner, wherein, in said detecting, the labels of ligated product
sequences of each group, captured on the solid support at different
sites, are detected, thereby indicating a presence, in the sample
of one or more allele at one or more nucleotide position in one or
more target nucleotide sequences.
15. A method according to claim 14, wherein the oligonucleotide
probes in a given set are suitable for ligation together at a
ligation junction when hybridized adjacent to one another on a
corresponding target nucleotide sequence due to perfect
complementarity at the ligation junction, but, when hybridized to
any other nucleotide sequence present in the sample, the first
oligonucleotide probe has a mismatch at a base at the ligation
junction which interferes with such ligation.
16. A method according to claim 14, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a single target nucleotide sequence or multiple
allele differences at two or more adjacent nucleotide positions, or
at nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequences are
distinguished with oligonucleotide probe groups having
oligonucleotide probes with target-specific portions which
overlap.
17. A method according to claim 16, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, there is a mismatch at a base at the ligation junction
which interferes with such ligation.
18. A method according to claim 1, wherein multiple allele
differences consisting of insertions, deletions, microsatellite
repeats, translocations, or other DNA rearrangements at one or more
nucleotide positions which require overlapping oligonucleotide
probe sets in a single target nucleotide sequence or multiple
allele differences consisting of insertions, deletions,
microsatellite repeats, translocations, or other DNA rearrangements
at one or more nucleotide positions which require overlapping
oligonucleotide probe sets in multiple target nucleotide sequences
are distinguished, the oligonucleotide probe sets forming a
plurality of oligonucleotide probe groups, each group comprised of
one or more oligonucleotide probe sets designed for distinguishing
multiple allele differences selected from the group consisting of
insertions, deletions, microsatellite repeats, translocations, and
other DNA rearrangements at one or more nucleotide positions which
requite overlapping oligonucleotide probe sets, wherein, in the
oligonucleotide probe sets of each group, the second
oligonucleotide probes have a common target-specific portion and
the first oligonucleotide probes have differing target-specific
portions which hybridize to a given allele in a base-specific
manner, wherein, in said detecting, the labels of ligated product
sequences of each group, captured on the solid support at different
sites, are detected, thereby indicating a presence, in the sample,
of one or more allele differences selected from the group
consisting of insertions, deletions, microsatellite repeats,
translocations, and other DNA rearrangements in one or more target
nucleotide sequences.
19. A method according to claim 18, wherein the oligonucleotide
probe sets are designed for distinguishing multiple allele
differences selected from the group consisting of insertions,
deletions, and microsatellite repeats, at one or more nucleotide
positions which require overlapping oligonucleotide probe sets,
wherein, the oligonucleotide probe sets of each group, the second
oligonucleotide probes have a common target-specific portion, and
the first oligonucleotide probes have differing target-specific
portions which contain repetitive sequences of different lengths to
hybridize to a given allele in a base-specific manner.
20. A method according to claim 1, wherein a low abundance of
multiple allele differences at multiple adjacent nucleotide
positions, or at nucleotide positions which require overlapping
oligonucleotide probe sets, in a single target nucleotide sequence,
in the presence of an excess of normal sequence, or a low abundance
of multiple allele differences at multiple nucleotide positions
which require overlapping oligonucleotide probe sets in multiple
target nucleotide sequences, in the presence of an excess of normal
sequence, are distinguished, the oligonucleotide probe sets forming
a plurality of oligonucleotide probe groups, each group comprised
of one or more oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, wherein one or more sets within a group share common
second oligonucleotide probes and the first oligonucleotide probes
have differing target-specific portions which hybridize to a given
allele excluding the normal allele in a base-specific manner,
wherein, in said detecting, the labels of ligated product sequences
of each group captured on the solid support at different sites, are
detected, thereby indicating a presence, in the sample, of one or
more low abundance alleles at one or more nucleotide positions in
one or more target nucleotide sequences.
21. A method according to claim 20, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide. sequence present in the
sample, the first oligonucleotide probes have a mismatch at a base
at the ligation junction which interferes with such ligation.
22. A method according to claim 20, wherein a low abundance of
multiple allele differences at multiple adjacent nucleotide
positions, or at nucleotide positions which require overlapping
oligonucleotide probe sets, in a single target nucleotide sequence,
in the presence of an excess of normal sequence, or a low abundance
of multiple allele differences at multiple nucleotide positions
which require overlapping oligonucleotide probe sets in multiple
target nucleotide sequences, in the presence of an excess of normal
sequence, are quantified in a sample, said method further
comprising: providing a known amount of one or more marker target
nucleotide sequences; providing a plurality of marker-specific
oligonucleotide probe sets, each set characterized by (a) a first
oligonucleotide probe having a target-specific portion
complementary to the marker target nucleotide sequence and an
addressable array-specific portion, and (b) a second
oligonucleotide probe, having a target-specific portion
complementary to the marker target nucleotide sequence and a
detectable reporter label, wherein the oligonucleotide probes in a
particular marker-specific oligonucleotide set are suitable for
ligation together when hybridized adjacent to one another on a
corresponding marker target nucleotide sequence, but, when
hybridized to any other nucleotide sequence present in the sample
or added marker sequences, have a mismatch which interferes with
such ligation; providing a plurality of oligonucleotide probe
groups, each group comprised of one or more oligonucleotide probe
sets or marker-specific oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, including marker nucleotide sequences, wherein one or
more sets within a group share a common second oligonucleotide
probe and the first oligonucleotide probes have different
target-specific probe portions which hybridize to a given allele or
a marker nucleotide sequence excluding the normal allele, in a
base-specific manner, wherein said blending comprises blending the
sample, the marker target nucleotide sequences, the plurality of
oligonucleotide probe sets, the plurality of marker-specific
oligonucleotide probe sets, and the ligase to form a mixture;
detecting the reporter labels of the ligated marker-specific
oligonucleotide sets captured on the solid support at particular
sites, thereby indicating the presence of one or more marker target
nucleotide sequences in the sample; and quantifying the amount of
target nucleotide sequences in the sample by comparing the amount
of captured ligated products generated from the known amount of
marker target nucleotide sequences with the amount of other
captured ligated product generated from the low abundance unknown
sample.
23. A method according to claim 22, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence under selected 5 conditions due to
perfect complementarity at the ligation junction, but, when the
oligonucleotide probes in the set are hybridized to any other
nucleotide sequence present in the sample, the first
oligonucleotide probes have a mismatch at a base at the ligation
junction which interferes with such ligation.
24. A method according to claim 1, wherein multiple allele
differences at one or more nucleotide position in a single target
nucleotide sequence or multiple allele differences at one or more
positions in multiple target nucleotide sequences are
distinguished, the oligonucleotide sets forming a plurality of
oligonucleotide probe groups, each group comprised of one or more
oligonucleotide probe sets designed for distinguishing multiple
allele differences at a single nucleotide position, wherein, in the
oligonucleotide probes of each group, the first oligonucleotide
probes have a common target-specific portion and the second
oligonucleotide probes have differing target-specific portions
which hybridize to a given allele in a base-specific manner,
wherein, in said detecting, different reporter labels of ligated
product sequences of each group captured on the solid support at
particular sites are detected, thereby indicating a presence, in
the sample, of one or more allele at one or more nucleotide
positions in one or more target nucleotide sequences.
25. A method according to claim 24, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, the second oligonucleotide probes have a mismatch at a base
at the ligation junction which interferes with such ligation.
26. A method according to claim 24, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a single target nucleotide sequence, or multiple
allele differences at two or more adjacent nucleotide positions, or
at nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequences are
distinguished, the oligonucleotide probe groups containing
oligonucleotide probes with target-specific portions which
overlap.
27. A method according to claim 26, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, the second oligonucleotide probe has a mismatch at a base
at the ligation junction which interferes with such ligation.
28. A method according to claim 1, wherein multiple allele
differences at one or more nucleotide position in a single target
nucleotide sequence or multiple allele differences at one or more
positions in multiple target nucleotide sequences are
distinguished, the oligonucleotide sets forming a plurality of
probe groups, each group comprised of one or more oligonucleotide
probe sets designed for distinguishing multiple allele differences
at a single nucleotide position, wherein, in the oligonucleotide
probes of different groups, the second oligonucleotide probes have
a common target-specific portion or the first oligonucleotide
probes have a common target-specific portion, wherein, in said
detecting, the one of a plurality of labeled ligated product
sequences of each group captured on the solid support at particular
sites are detected, thereby indicating a presence of one or more
allele at one or more nucleotide positions in one or more target
nucleotide sequences in the sample.
29. A method according to claim 28, wherein the oligonucleotide
probes in a given set are suitable for ligation together at
ligation junction when hybridized adjacent to one another on a
corresponding target nucleotide sequence due to perfect
complementarity at the ligation junction but, when the
oligonucleotides in the set are hybridized to any other nucleotide
sequence present in the sample, the first or second oligonucleotide
probes have a mismatch at a base at the ligation junction which
interferes with such ligation.
30. A method according to claim 28, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a target nucleotide sequence or multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequence are
distinguished, the oligonucleotide probe groups containing probes
with target-specific portions which overlap.
31. A method according to claim 30, wherein oligonucleotide probes
in a set are suitable for ligation together at a ligation junction
when hybridized adjacent to one another on a corresponding target
nucleotide sequence due to perfect complementarity at the ligation
junction, but, when the oligonucleotides in the set are hybridized
to any other nucleotide sequence present in the sample, the first
or second oligonucleotide probes have a mismatch at a base at the
ligation junction which interferes with such ligation.
32. A method according to claim 29, wherein all possible
single-base mutations for a single codon in a single target
nucleotide sequence, all possible single-base mutations for
multiple codons in a single target nucleotide sequence, and all
possible single-base mutations for multiple codons in multiple
target nucleotide sequences are distinguished, the oligonucleotide
sets forming a plurality of oligonucleotide probe groups, each
group comprised of one or more oligonucleotide probe sets designed
for distinguishing all possible single-base mutations for a single
codon, wherein, in the oligonucleotide probes of each group, the
second oligonucleotide probes differ only in their 5' bases at
their ligation junction and contain different reporter labels, the
first oligonucleotide probes differ only in their 3' bases at their
ligation junction and contain different addressable array-specific
portions, or the first oligonucleotide probes differ only in their
3' bases adjacent to the base at the ligation junction and contain
different addressable array-specific portions.
33. A method according to claim 29, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotides in the set are
hybridized to any other nucleotide sequence present in the sample,
the first oligonucleotide probes have a mismatch at the 3' base at
the ligation junction or the base adjacent the base at the ligation
junction or the second oligonucleotide probes have a mismatch at
the 5' base at the ligation junction which interferes with such
ligation.
34. A method according to claim 33, wherein all possible
single-base mutations for a single codon in a single target
nucleotide sequence, or all possible single-base mutations for two
or more adjacent codons, or at nucleotide positions which require
overlapping oligonucleotide probe sets, in multiple target
nucleotide sequences are distinguished, the oligonucleotide probe
groups containing oligonucleotide probes with target-specific
portions which overlap.
35. A method according to claim 1, wherein the denaturation
treatment is at a temperature of about 80.degree.-105.degree.
C.
36. A method according to claim 1, wherein each cycle, comprising a
denaturation treatment and a hybridization treatment, is from about
30 seconds to about five minutes long.
37. A method according to claim 1, wherein said subjecting is
repeated for 2 to 50 cycles.
38. A method according to claim 1, wherein total time for said
subjecting is 1 to 250 minutes.
39. A method according to claim 1, wherein the ligase is selected
from the group consisting of Thermus aquaticus ligase, Thermus
thermophilus ligase, E. coli ligase, T4 ligase, Thermus sp. AK16
ligase, Aquifex aeolicus ligase, Thermotoga maritima ligase, and
Pyrococcus ligase.
40. A method according to claim 1, wherein the detectable reporter
label is selected from the group consisting of chromophores,
fluorescent moieties, enzymes, antigens, heavy metals, magnetic
probes, dyes, phosphorescent groups, radioactive materials,
chemiluminescent moieties, and electrochemical detecting
moieties.
41. A method according to claim 1, wherein the target-specific
portions of the oligonucleotide probes each have a hybridization
temperature of 40-85.degree. C.
42. A method according to claim 1, wherein the target-specific
portions of the oligonucleotide probes are 20 to 28 nucleotides
long.
43. A method according to claim 1, wherein the mixture further
includes a carrier DNA.
44. A method according to claim 1, wherein said subjecting
achieves, for a particular oligonucleotide probe set, a rate of
formation of ligated product sequences that are mismatched at the
site where the oligonucleotide probes for a particular
oligonucleotide probe set are ligated which is less than 0.005 of
the rate of formation of matched ligated product sequences for the
particular oligonucleotide probe set.
45. A method according to claim 1 further comprising: amplifying
the target nucleotide sequences in the sample prior to said
blending.
46. A method according to claim 45, wherein said amplifying is
carried out by subjecting the sample to a polymerase-based
amplifying procedure.
47. A method according to claim 45, wherein said polymerase-based
amplifying procedure is carried out with DNA polymerase.
48. A method according to claim 1, wherein the solid support is
made from a material selected from the group consisting of plastic,
ceramic, metal, resin, gel, glass, silicon, and composites
thereof.
49. A method according to claim 1, wherein said detecting
comprises: scanning the solid support at the particular sites and
identifying if ligation of the oligonucleotide probe sets occurred
and correlating identified ligation to a presence or absence of the
target nucleotide sequences.
50. A method according to claim 1, wherein the plurality of capture
oligonucleotides each have different nucleotide sequences.
51. A method according to claim 50, wherein each capture
oligonucleotide differs from its adjacent capture oligonucleotide
on the array by at least one out of every four of the total number
of nucleotides when the oligonucleotides are aligned at one end
with one another without internal insertion or deletion.
52. A method according to claim 50, wherein each capture
oligonucleotide has adjacent capture oligonucleotides separated
from adjacent capture oligonucleotides by barrier oligonucleotides
to which ligated oligonucleotide probe sets will not hybridize
during said contacting.
53. A method according to claim 1, wherein the oligonucleotide
probe sets hybridize to the target nucleotide sequences at
temperatures which are less than that at which the capture
oligonucleotides hybridize to the addressable array-specific
portion of oligonucleotide probe sets.
54. A method according to claim 1 further comprising: treating the
mixture chemically or enzymatically, after said subjecting the
mixture to a series of ligase detection reaction cycles, to destroy
unligated oligonucleotide probes.
55. A method according to claim 54, wherein said treating is
carried out with an exonuclease.
56. A method according to claim 1 further comprising: removing
oligonucleotides bound to the capture oligonucleotides to permit
reuse of the solid support with immobilized capture
oligonucleotides.
57. A method according to claim 1, wherein the solid support
includes different capture oligonucleotides immobilized at
different sites with different capture oligonucleotides being
complementary to different addressable array-specific portions,
whereby different oligonucleotide probe sets are captured and
detected at different sites on the solid support.
58. A method according to claim 1, wherein the solid support
includes identical capture oligonucleotides immobilized on the
solid support with the capture oligonucleotides being complementary
to all the addressable array-specific portions and the labels
attached to the oligonucleotide probe sets being different, whereby
the different oligonucleotide probe sets are detected and
distinguished by the different labels.
59. A method according to claim 1, wherein the porous surface is a
hydrophilic polymer composed of combinations of acrylamide with
functional monomers containing carboxylate, aldehyde, or amino
groups.
60. A method according to claim 59, wherein the functional monomer
is acrylic acid.
61. A method according to claim 59, wherein the functional monomer
is glycerol monomethacrylate.
62. A method according to claim 59, wherein the hydrophilic polymer
is cross-link-ed at a level of less than 50:1.
63. A method according to claim 62, wherein the hydrophilic polymer
is cross-link-ed at a level of less than 500:1.
64. An array of oligonucleotides on a solid support comprising: a
solid support having a porous surface and an array of positions
each suitable for attachment of an oligonucleotide; a linker or
support suitable for coupling an oligonucleotide to the solid
support attached to the solid support at each of the array
positions; and an array of oligonucleotides on the solid support
with at least some of the array positions being occupied by
oligonucleotides having greater than sixteen nucleotides.
65. An array according to claim 64, wherein different
oligonucleotides are attached at different array positions on the
solid support to detect different nucleic acids.
66. An array according to claim 64, wherein the solid support is
made from a material selected from the group consisting of plastic,
ceramic, metal, resin, gel, glass, silicon, and composites
thereof.
67. An array according to claim 64, wherein the solid support has
an array of positions with oligonucleotides attached to the array
of positions.
68. An array according to claim 64, wherein the porous surface is a
hydrophilic polymer composed of combinations of acrylamide with
functional monomers containing carboxylate, aldehyde, or amino
groups.
69. An array according to claim 68, wherein the functional monomer
is acrylic acid.
70. An array according to claim 68, wherein the functional monomer
is glycerol monomethacrylate.
71. An array according to claim 68, wherein the hydrophilic polymer
is cross-linked at a level of less than 50:1.
72. Am array according to claim 68, wherein the hydrophilic polymer
is cross-linked at a level of less than 500:1.
73. A kit for identifying one or more of a plurality of sequences
differing by single-base changes, insertions, deletions, or
translocations in a plurality of target nucleotide sequences
comprising: a ligase; a plurality oligonucleotide probe sets, each
characterized by (a) a first oligonucleotide probe, having a target
sequence-specific portion and an addressable array-specific
portion, and (b) a second oligonucleotide probe, having a target
sequence-specific portion and detectable reporter label, wherein
the oligonucleotide probes in a particular set are suitable for
ligation together when hybrided adjacent to one another on a
respective target nucleotide sequence, but have a mismatch which
interferes with such ligation when hybridized to any other
nucleotide sequence, present in the sample; and a solid support
with a porous surface and capture oligonucleotides immobilized at
particular sites, wherein the capture oligonucleotides have
nucleotide sequences complementary to the addressable
array-specific portions.
74. A kit according to claim 73, wherein the ligase is selected
from the group consisting of Thermus aquaticus ligase, Thermus
thermophilus ligase, E. coli ligase, T4 ligase, Thermus sp. AK16
ligase, Aquifex aeolicus ligase, Thermotoga maritima ligase, and
Pyrococcus ligase.
75. A kit according to claim 73 further comprising: amplification
primers suitable for preliminary amplification of the target
nucleotide sequences and a polymerase.
76. A kit according to claim 73, wherein the solid support includes
different capture oligonucleotides immobilized at different
particular sites with different capture oligonucleotides being
complementary to different addressable array-specific portions,
whereby different oligonucleotide probe sets are hybridized and
detected at different sites on the solid support.
77. A kit according to claim 73, wherein the solid support includes
identical capture oligonucleotides immobilized on the solid support
with the capture oligonucleotides complementary to all the
addressable array-specific portions and the labels attached to the
oligonucleotide probe sets being different, whereby the
oligonucleotide probe sets are detected and distinguished by the
different labels.
78. A kit according to claim 73, wherein the oligonucleotide probe
sets and the capture oligonucleotides are configured so that the
oligonucleotide probe sets hybridize, respectively, to the target
nucleotide sequences at temperatures which are less than that at
which the capture oligonucleotides hybridize to the addressable
array-specific portions of the oligonucleotide probes sets.
79. A method for identifying one or more of a plurality of
sequences differing by one or more single-base changes, insertions,
deletions, or translocations in a plurality of target nucleotide
sequences comprising: providing a sample potentially containing one
or more target nucleotide sequences with a plurality of sequence
differences; providing a plurality of oligonucleotide probe sets,
each set characterized by (a) a first oligonucleotide probe, having
a target-specific portion and an addressable array-specific
portion, and (b) a second oligonucleotide probe, having a
target-specific portion and a detectable reporter label, wherein
the oligonucleotide probes in a particular set are suitable for
ligation together when hybridized adjacent to one another on a
corresponding target nucleotide sequence, but have a mismatch which
interferes with such ligation when hybridized to any other
nucleotide sequence present in the sample; providing a ligase,
blending the sample, the plurality of oligonucleotide probe sets,
and the ligase to form a mixture; subjecting the mixture to one or
more ligase detection reaction cycles comprising a denaturation
treatment, wherein any hybridized oligonucleotides are separated
from the target nucleotide sequences, and a hybridization
treatment, wherein the oligonucleotide probe sets hybridize at
adjacent positions in a base-specific manner to their respective
target nucleotide sequences, if present in the sample, and ligate
to one another to form a ligated product sequence containing (a)
the addressable array-specific portion, (b) the target-specific
portions connected together, and (c) the detectable reporter label,
and, wherein the oligonucleotide probe sets may hybridize to
nucleotide sequences in the sample other than their respective
target nucleotide sequences but do not ligate together due to a
presence of one or more mismatches and individually separate during
the denaturation treatment; providing a solid support with
different capture oligonucleotides immobilized at particular sites,
wherein the capture oligonucleotides have nucleotide sequences
complementary to the addressable array-specific portions;
contacting the mixture, after said subjecting, with the solid
support under conditions effective to mask negative charges and to
hybridize the addressable array-specific portions to the capture
oligonucleotides in a base-specific manner, thereby capturing the
addressable array-specific portions on the solid support at the
site with the complementary capture oligonucleotide; and detecting
the reporter labels of ligated product sequences captured to the
solid support at particular sites, thereby indicating the presence
of one or more target nucleotide sequences in the sample.
80. A method according to claim 79, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, have a mismatch at a base at the ligation junction which
interferes with such ligation.
81. A method according to claim 80, wherein the mismatch is at the
3' base at the ligation junction.
82. A method according to claim 80, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, there is a mismatch at a base adjacent to a base at the
ligation junction which interferes with such ligation.
83. A method according to claim 82, wherein the mismatch is at the
base adjacent to the 3' base at the ligation junction.
84. A method according to claim 79, wherein the sample potentially
contains unknown amounts of one or more of a plurality of target
sequences with a plurality of sequence differences, said method
further comprising: quantifying, after said detecting, the amount
of the target nucleotide sequences in the sample by comparing the
amount of captured ligated product sequences generated from the
sample with a calibration curve of captured ligated product
sequences generated from samples with known amounts of the target
nucleotide sequence.
85. A method according to claim 79, wherein the sample potentially
contains unknown amounts of one or more of a plurality of target
nucleotide sequences with a plurality of sequence differences, said
method further comprising: providing a known amount of one or more
marker target nucleotide sequences; providing a plurality of
marker-specific oligonucleotide probe sets, each set characterized
by (a) a first oligonucleotide probe, having a target-specific
portion complementary to the marker target nucleotide sequence and
an addressable array-specific portion complementary to capture
oligonucleotides on the solid support, and (b) a second
oligonucleotide probe, having a target-specific portion
complementary to the marker target nucleotide sequence and a
detectable reporter label, wherein the oligonucleotide probes in a
particular marker-specific oligonucleotide set are suitable for
ligation together when hybridized adjacent to one another on a
corresponding marker target nucleotide sequence, but, when
hybridize to any other nucleotide sequence present in the sample or
added marker sequences, there is a mismatch which interferes with
such ligation, wherein said blending comprises blending the sample,
the marker target nucleotide sequences, the plurality of
oligonucleotide probe sets, the plurality of marker-specific
oligonucleotide probe sets, and the ligase to form a mixture;
detecting the reporter labels of the ligated marker-specific
oligonucleotide sets captured on the solid support at particular
sites, thereby indicating the presence of one or more marker target
nucleotide sequences in the sample; and quantifying the amount of
target nucleotide sequences in the sample by comparing the amount
of captured ligated product generated from the known amount of
marker target nucleotide sequences with the amount of captured
other ligated product.
86. A method according to claim 85, wherein the one or more marker
target nucleotide sequences differ from the target nucleotide
sequences in the sample at one or more single nucleotide
positions.
87. A method according to claim 86, wherein the oligonucleotide
probe sets and the marker-specific oligonucleotide probe sets form
a plurality of oligonucleotide probe groups, each group comprised
of one or more oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, wherein, in the oligonucleotide probe sets of each group,
the first oligonucleotide probes have a common target-specific
portion, and the second oligonucleotide probes have a differing
target-specific portion which hybridize to a given allele or a
marker nucleotide sequence in a base-specific manner.
88. A method according to claim 86, wherein the oligonucleotide
probe sets and the marker-specific oligonucleotide probe sets form
a plurality of oligonucleotide probe groups, each group comprised
of one or more oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, wherein, in the oligonucleotide probe sets of each group,
the second oligonucleotide probes have a common target-specific
portion and the first oligonucleotide probe have differing
target-specific portions, which hybridize to a given allele or a
marker nucleotide sequence in a base-specific manner.
89. A method according to claim 79, wherein the sample potentially
contains unknown amounts of two or more of a plurality of target
nucleotide sequences with a plurality of sequence differences, said
method further comprising: quantifying, after said detecting, the
relative amount of each of the plurality of target nucleotide
sequences in the sample by comparing the relative amount of
captured ligated product sequences generated by each of the
plurality of target sequences within the sample, thereby providing
a quantitative measure of the relative level of two or more target
nucleotide sequences in the sample.
90. A method according to claim 79, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a single target nucleotide sequence or multiple
allele differences at two or more adjacent nucleotide positions, or
at nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequences are
distinguished with oligonucleotide probe sets having
oligonucleotide probes with target-specific portions which
overlap.
91. A method according to claim 79, wherein the target-specific
portions of the oligonucleotide probe sets have substantially the
same melting temperature so that they hybridize to target
nucleotide sequences under similar hybridization conditions.
92. A method according to claim 79, wherein multiple allele
differences at one or more nucleotide position in a single target
nucleotide sequence or multiple allele differences at one or more
positions in multiple target nucleotide sequences are
distinguished, the oligonucleotide probe sets forming a plurality
of oligonucleotide probe groups, each group comprised of one or
more oligonucleotide probe sets designed for distinguishing
multiple allele differences at a single nucleotide position,
wherein, in the oligonucleotide probes of each group, the second
oligonucleotide probes have a common target-specific portion and
the first oligonucleotide probes have differing target-specific
portions which hybridize to a given allele in a base-specific
manner, wherein, in said detecting, the labels of ligated product
sequences of each group, captured on the solid support at different
sites, are detected, thereby indicating a presence, in the sample
of one or more allele at one or more nucleotide position in one or
more target nucleotide sequences.
93. A method according to claim 92, wherein the oligonucleotide
probes in a given set are suitable for ligation together at a
ligation junction when hybridized adjacent to one another on a
corresponding target nucleotide sequence due to perfect
complementarity at the ligation junction, but, when hybridized to
any other nucleotide sequence present in the sample, the first
oligonucleotide probe has a mismatch at a base at the ligation
junction which interferes with such ligation.
94. A method according to claim 92, where multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a single target nucleotide sequence or multiple
allele differences at two or more adjacent nucleotide positions, or
at nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequences are
distinguished with oligonucleotide probe groups having
oligonucleotide probes with target-specific portions which
overlap.
95. A method according to claim 94, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, there is a mismatch at a base at the ligation junction
which interferes with such ligation.
96. A method according to claim 79, wherein multiple allele
differences consisting of insertions, deletions, microsatellite
repeats, translocations, or other DNA rearrangements at one or more
nucleotide positions which require overlapping oligonucleotide
probe sets in a single target nucleotide sequence or multiple
allele differences consisting of insertions, deletions,
microsatellite repeats, translocations, or other DNA rearrangements
at one or more nucleotide positions which require overlapping
oligonucleotide probe sets in multiple target nucleotide sequences
are distinguished, the oligonucleotide probe sets forming a
plurality of oligonucleotide probe groups, each group comprised of
one or more oligonucleotide probe sets designed for distinguishing
multiple allele differences selected from the group consisting of
insertions, deletions, microsatellite repeats, translocations, and
other DNA rearrangements at one or more nucleotide positions which
require overlapping oligonucleotide probe sets, wherein, in the
oligonucleotide probe sets of each group, the second
oligonucleotide probes have a common target-specific portion and
the first oligonucleotide probes have differing target-specific
portions which hybridize to a given allele in a base-specific
manner, wherein, in said detecting, the labels of ligated product
sequences of each group, captured on the solid support at different
sites, are detected, thereby indicating a presence, in the sample,
of one or more allele differences selected from the group
consisting of insertions, deletions, microsatellite repeats,
translocations, and other DNA rearrangements in one or more target
nucleotide sequences.
97. A method according to claim 79, wherein the oligonucleotide
probe sets are designed for distinguishing multiple allele
differences selected from the group consisting of insertions,
deletions, and microsatellite repeats, at one or more nucleotide
positions which require overlapping oligonucleotide probe sets,
wherein, in the oligonucleotide probe sets of each group, the
second oligonucleotide probes have a common target-specific
portion, and the first oligonucleotide probes have differing
target-specific portions which contain repetitive sequences of
different lengths to hybridize to a given allele in a base-specific
manner.
98. A method according to claim 79, wherein a low abundance of
multiple allele differences at multiple adjacent nucleotide
positions, or at nucleotide positions which require overlapping
oligonucleotide probe sets, in a single target nucleotide sequence,
in the presence of an excess of normal sequence, or a low abundance
of multiple allele differences at multiple nucleotide positions
which require overlapping oligonucleotide probe sets, in multiple
target nucleotide sequences, in the presence of an excess of normal
sequence, are distinguished, the oligonucleotide probe sets forming
a plurality of oligonucleotide probe groups, each group comprised
of one or more oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, wherein one or more sets within a group share common
second oligonucleotide probes and the first oligonucleotide probes
have differing target-specific portions which hybridize to a given
allele excluding the normal allele in a base-specific manner,
wherein, in said detecting, the labels of ligated product sequences
of each group captured on the solid support at different sites, are
detected, thereby indicating a presence, in the sample, of one or
more low abundance alleles at one or more nucleotide positions in
one or more target nucleotide sequences.
99. A method according to claim 98, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any-other nucleotide sequence present in the
sample, the first oligonucleotide probes have a mismatch at a base
at the ligation junction which interferes with such ligation.
100. A method according to claim 99, wherein a low abundance of
multiple allele differences at multiple adjacent nucleotide
positions, or at nucleotide positions which require overlapping
oligonucleotide probe sets, in a single target nucleotide sequence,
in the presence of an excess of normal sequence, or a low abundance
of multiple allele differences at multiple nucleotide positions
which require overlapping oligonucleotide probe sets in multiple
target nucleotide sequences, in the presence of an excess of normal
sequence, are quantified in a sample, said method further
comprising: providing a known amount of one or more marker target
nucleotide sequences; providing a plurality of marker-specific
oligonucleotide probe sets, each set characterized by (a) a first
oligonucleotide probe having a target-specific portion
complementary to the marker target nucleotide sequence and an
addressable array-specific portion, and (b) a second
oligonucleotide probe, having a target-specific portion
complementary to the marker target nucleotide sequence and a
detectable reporter label, wherein the oligonucleotide probes in a
particular marker-specific oligonucleotide set are suitable for
ligation together when hybridized adjacent to one another on a
corresponding marker target nucleotide sequence, but, when
hybridized to any other nucleotide sequence present in the sample
or added marker sequences, have a mismatch which interferes with
such ligation; providing a plurality of oligonucleotide probe
groups, each group comprised of one or more oligonucleotide probe
sets or marker-specific oligonucleotide probe sets designed for
distinguishing multiple allele differences at a single nucleotide
position, including marker nucleotide sequences, wherein one or
more sets within a group share a common second oligonucleotide
probe and the first oligonucleotide probes have different
target-specific probe portions which hybridize to a given allele or
a marker nucleotide sequence excluding the normal allele, in a
base-specific manner, wherein said blending comprises blending the
sample, the marker target nucleotide sequences, the plurality of
oligonucleotide probe sets, the plurality of marker-specific
oligonucleotide probe sets, and the ligase to form a mixture;
detecting the reporter labels of the ligated marker-specific
oligonucleotide sets captured on the solid support at particular
sites, thereby indicating the presence of one or more marker target
nucleotide sequences in the sample; and quantifying the amount of
target nucleotide sequences in the sample by comparing the amount
of captured ligated products generated from the known amount of
marker target nucleotide sequences with the amount of other
captured ligated product generated from the low abundance unknown
sample.
101. A method according to claim 100, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence under selected conditions due to perfect
complementarity at the ligation junction, but, when the
oligonucleotide probes in the set are hybridized to any other
nucleotide sequence present in the sample, the first
oligonucleotide probes have a mismatch at a base at the ligation
junction which interferes with such ligation.
102. A method according to claim 79, wherein multiple allele
differences at one or more nucleotide position in a single target
nucleotide sequence or multiple allele differences at one or more
positions in multiple target nucleotide sequences are
distinguished, the oligonucleotide sets forming a plurality of
oligonucleotide probe groups, each group comprised of one or more
oligonucleotide probe sets designed for distinguishing multiple
allele differences at a single nucleotide position, wherein, in the
oligonucleotide probes of each group, the first oligonucleotide
probes have a common target-specific portion and the second
oligonucleotide probes have differing target-specific portions
which hybridize to a given allele in a base-specific manner,
wherein, in said detecting, different reporter labels of ligated
product sequences of each group captured on the solid support at
particular sites are detected, thereby indicating a presence, in
the sample, of one or more allele at one or more nucleotide
positions in one or more target nucleotide sequences.
103. A method according to claim 102, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, the second oligonucleotide probes have a mismatch at a base
at the ligation junction which interferes with such ligation.
104. A method according to claim 102, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a single target nucleotide sequence, or multiple
allele differences at two or more adjacent nucleotide positions, or
at nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequences are
distinguished, the oligonucleotide probe groups containing
oligonucleotide probes with target-specific portions which
overlap.
105. A method according to claim 104, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotide probes in the set
are hybridized to any other nucleotide sequence present in the
sample, the second oligonucleotide probe has a mismatch at a base
at the ligation junction which interferes, with such ligation.
106. A method according to claim 79, wherein multiple allele
differences at one or more nucleotide position in a single target
nucleotide sequence or multiple allele differences at one or more
positions in multiple target nucleotide sequences are
distinguished, the oligonucleotide sets forming a plurality of
probe groups, each group comprised of one or more oligonucleotide
probe sets designed for distinguishing multiple allele differences
at a single nucleotide position, wherein, in the oligonucleotide
probes of different groups, the second oligonucleotide probes have
a common target-specific portion or the first oligonucleotide
probes have a common target-specific portion, wherein, in said
detecting, the one of a plurality of labeled ligated product
sequences of each group captured on the solid support at particular
sites are detected, thereby indicating a presence of one or more
allele at one or more nucleotide positions in one or more target
nucleotide sequences in the sample.
107. A method according to claim 106, wherein the oligonucleotide
probes in a given set are suitable for ligation together at
ligation junction when hybridized adjacent to one another on a
corresponding target nucleotide sequence due to perfect
complementarity at the ligation junction but, when the
oligonucleotides in the set are hybridized to any other nucleotide
sequence present in the sample, the first or second oligonucleotide
probes have a mismatch at a base at the ligation junction which
interferes with such ligation.
108. A method according to claim 106, wherein multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in a target nucleotide sequence or multiple allele
differences at two or more adjacent nucleotide positions, or at
nucleotide positions which require overlapping oligonucleotide
probe sets, in multiple target nucleotide sequence are
distinguished, the oligonucleotide probe groups containing probes
with target-specific portions which overlap.
109. A method according to claim 108, wherein oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotides in the set are
hybridized to any other nucleotide sequence present in the sample,
the first or second oligonucleotide probes have a mismatch at a
base at the ligation junction which interferes with such
ligation.
110. A method according to claim 107, wherein all possible
single-base mutations for a single codon in a single target
nucleotide sequence, all possible single-base mutations for
multiple codons in a single target nucleotide sequence, and all
possible single-base mutations for multiple codons in multiple
target nucleotide sequences are distinguished, the oligonucleotide
sets forming a plurality of oligonucleotide probe groups, each
group comprised of one or more oligonucleotide probe sets designed
for distinguishing all possible single-base mutations for a single
codon, wherein, in the oligonucleotide probes of each group, the
second oligonucleotide probes differ only in their 5' bases at
their ligation junction and contain different reporter labels, the
first oligonucleotide probes differ only in their 3' bases at their
ligation junction and contain different addressable array-specific
portions, or the first oligonucleotide probes differ only in their
3' bases adjacent to the base at the ligation junction and contain
different addressable array-specific portions.
111. A method according to claim 107, wherein the oligonucleotide
probes in a set are suitable for ligation together at a ligation
junction when hybridized adjacent to one another on a corresponding
target nucleotide sequence due to perfect complementarity at the
ligation junction, but, when the oligonucleotides in the set are
hybridized to any other nucleotide sequence present in the sample,
the first oligonucleotide probes have a mismatch at the 3' base at
the ligation junction or the 3' base adjacent the base at the
ligation junction or the second oligonucleotide probes have a
mismatch at the 5' base at the ligation junction which interferes
with such ligation.
112. A method according to claim 111, wherein all possible
single-base mutations for a single codon in a single target
nucleotide sequence, or all possible single-base mutations for two
or more adjacent codons, or at nucleotide positions which require
overlapping oligonucleotide probe sets, in multiple target
nucleotide sequences are distinguished, the oligonucleotide probe
groups containing oligonucleotide probes with target-specific
portions which overlap.
113. A method according to claim 79, wherein the denaturation
treatment is at a temperature of about 80-105.degree. C.
114. A method according to claim 79, wherein each cycle, comprising
a denaturation treatment and a hybridization treatment, is from
about 30 seconds to about five minutes long.
115. A method according to claim 79, wherein said subjecting is
repeated for 2 to 50 cycles.
116. A method according to claim 79, wherein total time for said
subjecting is 1 to 250 minutes.
117. A method according to claim 79, wherein the ligase is selected
from the group consisting of Thermus aquaticus ligase, Thermus
thermophilus ligase, E. coli ligase, T4 ligase, Thermus sp. AK16
ligase, Aquifex aeolicus ligase, Thermotoga maritima ligase, and
Pyrococcus ligase.
118. A method according to claim 79, wherein the detectable
reporter label is selected from the group consisting of
chromophores, fluorescent moieties, enzymes, antigens, heavy
metals, magnetic probes, dyes, phosphorescent groups, radioactive
materials, chemiluminescent moieties, and electrochemical detecting
moieties.
119. A method according to claim 79, wherein the target-specific
portions of the oligonucleotide probes each have a hybridization
temperature of 40-85.degree. C.
120. A method according to claim 79, wherein the target-specific
portions of the oligonucleotide probes are 20 to 28 nucleotides
long.
121. A method according to claim 79, wherein the mixture further
includes a carrier DNA.
122. A method according to claim 79, wherein said subjecting
achieves, for a particular oligonucleotide probe set, a rate of
formation of ligated product sequences that are mismatched at the
site where the oligonucleotide probes for a particular
oligonucleotide probe set are ligated which is less than 0.005 of
the rate of formation of matched ligated product sequences for the
particular oligonucleotide probe set.
123. A method according to claim 79 further comprising: amplifying
the target nucleotide sequences in the sample prior to said
blending.
124. A method according to claim 123, wherein said amplifying is
carried out by subjecting the sample to a polymerase-based
amplifying procedure.
125. A method according to claim 123, wherein said polymerase-based
amplifying procedure is carried out with DNA polymerase.
126. A method according to claim 79, wherein the solid support is
made from a material selected from the group consisting of plastic,
ceramic, metal, resin, gel, glass, silicon, and composites
thereof.
127. A method according to claim 79, wherein said detecting
comprises: scanning the solid support at the particular sites and
identifying if litigation of the oligonucleotide probe sets
occurred and correlating identified ligation to a presence or
absence of the target nucleotide sequences.
128. A method according to claim 79, wherein the plurality of
capture oligonucleotides each have different nucleotide
sequences.
129. A method according to claim 128, wherein each capture
oligonucleotide differs from its adjacent capture oligonucleotide
on the array by at least one out of every four of the total number
of nucleotides when the oligonucleotides are aligned at one end
with one another without internal insertion or deletion.
130. A method according to claim 128, wherein each capture
oligonucleotide has adjacent capture oligonucleotides separated
from adjacent capture oligonucleotides by barrier oligonucleotides
to which ligated oligonucleotide probe sets will not hybridize
during said contacting.
131. A method according to claim 79, wherein the oligonucleotide
probe sets hybridize to the target nucleotide sequences at
temperatures which are less than that at which the capture
oligonucleotides hybridize to the addressable array-specific
portion of oligonucleotide probe sets.
132. A method according to claim 79 further comprising: treating
the mixture chemically or enzymatically, after said subjecting the
mixture to a series of ligase detection reaction cycles, to destroy
unligated oligonucleotide probes.
133. A method according to claim 132, wherein said treating is
carried out with an exonuclease.
134. A method according to claim 79 further comprising: removing
oligonucleotides bound to the capture oligonucleotides to permit
reuse of the solid support with immobilized capture
oligonucleotides.
135. A method according to claim 79, wherein the solid support
includes different capture oligonucleotides immobilized at
different sites with different capture oligonucleotides being
complementary to different addressable array-specific portions,
whereby different oligonucleotide probe sets are captured and
detected at different sites on the solid support.
136. A method according to claim 79, wherein the solid support
includes identical capture oligonucleotides immobilized on the
solid support with the capture oligonucleotides being complementary
to all the addressable array-specific portions and the labels
attached to the oligonucleotide probe sets being different, whereby
the different oligonucleotide probe sets are detected and
distinguished by the different labels.
137. A method according to claim 79, wherein the conditions
effective to mask negative charges involves carrying out said
contacting in the presence of a divalent cation-containing
compound.
138. A method according to claim 137, wherein the divalent cation
is selected from the group consisting of Mg.sup.+2, Ca.sup.+2,
Mn.sup.+2, and CO.sup.+2.
139. A method according to claim 138, wherein the divalent cation
is Mg.sup.+2.
140. A method according to claim 79, wherein the conditions
effective to mask negative charges involves carrying out said
contacting at a pH at or below 6.0.
141. A method according to claim 79, wherein the conditions
effective to mask negative charges involves capping free carboxylic
acid groups with a neutralizing agent.
142. A method according to claim 141, wherein the neutralizing
agent is selected from the group consisting of ethanolamine,
diethanolamine, propanolamine, dipropanolamine, isopropanolamine,
and diisopropanolamine.
143. A method according to claim 142, wherein the neutralizing
agent is ethanolamine.
144. A method according to claim 79, wherein said contacting is
carried out by mixing the mixture in the presence of the solid
support.
145. A method according to claim 79, wherein the addressable
array-specific portions are hybridized to the capture
oligonucleotides, during said contacting, at a temperature of
60.degree. C. to 70.degree. C.
146. A method according to claim 79, wherein said detecting
indicates the presence of ligated product in a ratio to unligated
oligonucleotide probes of less than 1:300.
147. A method according to claim 146, wherein said detecting
indicates the presence of ligated product in a ratio to unligated
oligonucleotide probes of less than 1:900.
148. A method according to claim 147, wherein said detecting
indicates the presence of ligated product in a ratio to unligated
oligonucleotide probes of less than 1:3000.
149. A method according to claim 148, wherein said detecting
indicates the presence of ligated product in a ratio to unligated
oligonucleotide probes of less than 1:9000.
150. A method according to claim 79, wherein said detecting
indicates the presence of a target nucleotide sequence, which
differs from a non-target nucleotide sequence by a single base
difference, in a ratio of the target nucleotide sequence to
non-target nucleotide sequence of less than 1:20.
151. A method according to claim 150, wherein said detecting
indicates the presence of a target nucleotide sequence, which
differs from a non-target nucleotide sequence by a single base
difference, in a ratio of the target nucleotide sequence to
non-target nucleotide sequence of less than 1:50.
152. A method according to claim 151, wherein said detecting
indicates the presence of a target nucleotide sequence, which
differs from a non-target nucleotide sequence by a single base
difference, in a ratio of the target nucleotide sequence to
non-target nucleotide sequence of less than 1:100.
153. A method according to claim 152, wherein said detecting
indicates the presence of a target nucleotide sequence, which
differs from a non-target nucleotide sequence by a single base
difference, in a ratio of the target nucleotide sequence to
non-target nucleotide sequence of less than 1:200.
Description
[0001] This application claims the benefit of U.S. Provisional
Patent Application Serial No. 60/125,357, filed Mar. 19, 1999.
FIELD OF THE INVENTION
[0003] The present invention relates to the detection of nucleic
acid sequence differences in nucleic acids using a ligation phase,
a capture phase, and a detection phase. The ligation phase utilizes
a ligation detection reaction between one oligonucleotide probe
which has a target sequence-specific portion and an addressable
array-specific portion and a second oligonucleotide probe having a
target sequence-specific portion and a detectable label. The
capture phase involves hybridizing the ligated oligonucleotide
probes to a solid support with an array of immobilized capture
oligonucleotides at least some of which are complementary to the
addressable array-specific portion. The labels of ligated
oligonucleotide probes hybridized to the solid support are detected
during the detection phase.
BACKGROUND OF THE INVENTION
[0004] Detection of Sequence Differences
[0005] Large-scale multiplex analysis of highly polymorphic loci is
needed for practical identification of individuals, e.g., for
paternity testing and in forensic science (Reynolds et al., Anal.
Chem., 63:2-15 (1991)), for organ-transplant donor-recipient
matching (Buyse et al., Tissue Antigens, 41:1-14 (1993) and
Gyllensten et al., PCR Meth. Appl, 1:91-98 (1991)), for genetic
disease diagnosis, prognosis, and pre-natal counseling (Chamberlain
et al., Nucleic Acids Res., 16:11141-11156 (1988) and L. C. Tsui,
Human Mutat., 1: 197-203 (1992)), and the study of oncogenic
mutations (Holistein et al., Science, 253:49-53 (1991)). In
addition, the cost-effectiveness of infectious disease diagnosis by
nucleic acid analysis varies directly with the multiplex scale in
panel testing. Many of these applications depend on the
discrimination of single-base differences at a multiplicity of
sometimes closely space loci.
[0006] A variety of DNA hybridization techniques are available for
detecting the presence of one or more selected polynucleotide
sequences in a sample containing a large number of sequence
regions. In a simple method, which relies on fragment capture and
labeling, a fragment containing a selected sequence is captured by
hybridization to an immobilized probe. The captured fragment can be
labeled by hybridization to a second probe which contains a
detectable reporter moiety.
[0007] Another widely used method is Southern blotting. In this
method, a mixture of DNA fragments in a sample are fractionated by
gel electrophoresis, then fixed on a nitrocellulose filter. By
reacting the filter with one or more labeled probes under
hybridization conditions, the presence of bands containing the
probe sequence can be identified. The method is especially useful
for identifying fragments in a restriction-enzyme DNA digest which
contain a given probe sequence, and for analyzing
restriction-fragment length polymorphisms ("RFLPs").
[0008] Another approach to detecting the presence of a given
sequence or sequences in a polynucleotide sample involves selective
amplification of the sequence(s) by polymerase chain reaction. U.S.
Pat. No. 4,683,202 to Mullis, et al. and R. K. Saiki, et al.,
Science 230:1350 (1985). In this method, primers complementary to
opposite end portions of the selected sequence(s) are used to
promote, in conjunction with thermal cycling, successive rounds of
primer-initiated replication. The amplified sequence may be readily
identified by a variety of techniques. This approach is
particularly useful for detecting the presence of low-copy
sequences in a polynucleotide-containing sample, e.g., for
detecting pathogen sequences in a body-fluid sample.
[0009] More recently, methods of identifying known target sequences
by probe ligation methods have been reported. U.S. Pat. No.
4,883,750 to N. M. Whiteley, et al., D. Y. Wu, et al., Genomics
4:560 (1989), U. Landegren, et al., Science 241:1077 (1988), and E.
Winn-Deen, et al., Clin. Chem. 37:1522 (1991). In one approach,
known as oligonucleotide ligation assay ("OLA"), two probes or
probe elements which span a target region of interest are
hybridized with the target region. Where the probe elements match
(basepair with) adjacent target bases at the confronting ends of
the probe elements, the two elements can be joined by ligation,
e.g., by treatment with ligase. The ligated probe element is then
assayed, evidencing the presence of the target sequence.
[0010] In a modification of this approach, the ligated probe
elements act as a template for a pair of complementary probe
elements. With continued cycles of denaturation, hybridization, and
ligation in the presence of the two complementary pairs of probe
elements, the target sequence is amplified geometrically, i.e.,
exponentially allowing very small amounts of target sequence to be
detected and/or amplified. This approach is referred to as ligase
chain reaction ("LCR"). F. Barany, "Genetic Disease Detection and
DNA Amplification Using Cloned Thermostable Ligase," Proc. Nat'l
Acad. Sci. USA, 88:189-93 (1991) and F. Barany, "The Ligase Chain
Reaction (LCR) in a PCR World," PCR Methods and Applications,
1:5-16 (1991).
[0011] Another scheme for multiplex detection of nucleic acid
sequence differences is disclosed in U.S. Pat. No. 5,470,705 to
Grossman et. al. where sequence-specific probes, having a
detectable label and a distinctive ratio of charge/translational
frictional drag, can be hybridized to a target and ligated
together. This technique was used in Grossman, et. al.,
"High-density Multiplex Detection of Nucleic Acid Sequences:
Oligonucleotide Ligation Assay and Sequence-coded Separation,"
Nucl. Acids Res. 22(21):4527-34 (1994) for the large scale
multiplex analysis of the cystic fibrosis transmembrane regulator
gene.
[0012] Jou, et. al., "Deletion Detection in Dystrophin Gene by
Multiplex Gap Ligase Chain Reaction and Immunochromatographic Strip
Technology," Human Mutation 5:86-93 (1995) relates to the use of a
so called "gap ligase chain reaction" process to amplify
simultaneously selected regions of multiple exons with the
amplified products being read on an immunochromatographic strip
having antibodies specific to the different haptens on the probes
for each exon.
[0013] There is a growing need, e.g., in the field of genetic
screening, for methods useful in detecting the presence or absence
of each of a large number of sequences in a target polynucleotide.
For example, as many as 400 different mutations have been
associated with cystic fibrosis. In screening for genetic
predisposition to this disease, it is optimal to test all of the
possible different gene sequence mutations in the subject's genomic
DNA, in order to make a positive identification of "cystic
fibrosis". It would be ideal to test for the presence or absence of
all of the possible mutation sites in a single assay. However, the
prior-art methods described above are not readily adaptable for use
in detecting multiple selected sequences in a convenient, automated
single-assay format.
[0014] Solid-phase hybridization assays require multiple
liquid-handling steps, and some incubation and wash temperatures
must be carefully controlled to keep the stringency needed for
single-nucleotide mismatch discrimination. Multiplexing of this
approach has proven difficult as optimal hybridization conditions
vary greatly among probe sequences.
[0015] Allele-specific PCR products generally have the same size,
and a given amplification tube is scored by the presence or absence
of the product band in the gel lane associated with each reaction
tube. Gibbs et al., Nucleic Acids Res., 17:2437-2448 (1989). This
approach requires splitting the test sample among multiple reaction
tubes with different primer combinations, multiplying assay cost.
PCR has also discriminated alleles by attaching different
fluorescent dyes to competing allelic primers in a single reaction
tube (F. F. Chehab, et al., Proc. Natl. Acad. Sci. USA,
86:9178-9182 (1989)), but this route to multiplex analysis is
limited in scale by the relatively few dyes which can be spectrally
resolved in an economical manner with existing instrumentation and
dye chemistry. The incorporation of bases modified with bulky side
chains can be used to differentiate allelic PCR products by their
electrophoretic mobility, but this method is limited by the
successful incorporation of these modified bases by polymerase, and
by the ability of electrophoresis to resolve relatively large PCR
products which differ in size by only one of these groups. Livak et
al., Nucleic Acids Res., 20:4831-4837 (1989). Each PCR product is
used to look for only a single mutation, making multiplexing
difficult.
[0016] Ligation of allele-specific probes generally has used
solid-phase capture (U. Landegren et al., Science, 241:1077-1080
(1988); Nickerson et al., Proc. Natl. Acad. Sci. USA, 87:8923-8927
(1990)) or size-dependent separation (D. Y. Wu, et al., Genomics,
4:560-569 (1989) and F. Barany, Proc. Natl. Acad. Sci., 88:189-193
(1991)) to resolve the allelic signals, the latter method being
limited in multiplex scale by the narrow size range of ligation
probes. The gap ligase chain reaction process requires an
additional step--polymerase extension. The use of probes with
distinctive ratios of charge/translational frictional drag
technique to a more complex multiplex will either require longer
electrophoresis times or the use of an alternate form of
detection.
[0017] The need thus remains for a rapid single assay format to
detect the presence or absence of multiple selected sequences in a
polynucleotide sample.
[0018] Use of Oligonucleotide Arrays for Nucleic Acid Analysis
[0019] Ordered arrays of oligonucleotides immobilized on a solid
support have been proposed for sequencing, sorting, isolating, and
manipulating DNA. It has been recognized that hybridization of a
cloned single-stranded DNA molecule to all possible oligonucleotide
probes of a given length can theoretically identify the
corresponding complementary DNA segments present in the molecule.
In such an array, each oligonucleotide probe is immobilized on a
solid support at a different predetermined position. All the
oligonucleotide segments in a DNA molecule can be surveyed with
such an array.
[0020] One example of a procedure for sequencing DNA molecules
using arrays of oligonucleotides is disclosed in U.S. Pat. No.
5,202,231 to Drmanac, et. al. This involves application of target
DNA to a solid support to which a plurality of oligonucleotides are
attached. Sequences are read by hybridization of segments of the
target DNA to the oligonucleotides and assembly of overlapping
segments of hybridized oligonucleotides. The array utilizes all
possible oligonucleotides of a certain length between 11 and 20
nucleotides, but there is little information about how this array
is constructed. See also A. B. Chetverin, et. al., "Sequencing of
Pools of Nucleic Acids on Oligonucleotide Arrays," BioSystems 30:
215-31 (1993); WO 92/16655 to Khrapko et. al.; Kuznetsova, et. al.,
"DNA Sequencing by Hybridization with Oligonucleotides Immobilized
in Gel. Chemical Ligation as a Method of Expanding the Prospects
for the Method," Mol. Biol. 28(20): 290-99(1994); M. A. Livits, et.
al., "Dissociation of Duplexes Formed by Hybridization of DNA with
Gel-Immobilized Oligonucleotides," J. Biomolec. Struct. &
Dynam. 11(4): 783-812 (1994).
[0021] WO 89/10977 to Southern discloses the use of a support
carrying an array of oligonucleotides capable of undergoing a
hybridization reaction for use in analyzing a nucleic acid sample
for known point mutations, genomic fingerprinting, linkage
analysis, and sequence determination. The matrix is formed by
laying nucleotide bases in a selected pattern on the support. This
reference indicates that a hydroxyl linker group can be applied to
the support with the oligonucleotides being assembled by a pen
plotter or by masking.
[0022] WO 94/11530 to Cantor also relates to the use of an
oligonucleotide array to carry out a process of sequencing by
hybridization. The oligonucleotides are duplexes having overhanging
ends to which target nucleic acids bind and are then ligated to the
non-overhanging portion of the duplex. The array is constructed by
using streptavidin-coated filter paper which captures biotinylated
oligonucleotides assembled before attachment.
[0023] WO 93/17126 to Chetverin uses sectioned, binary
oligonucleotide arrays to sort and survey nucleic acids. These
arrays have a constant nucleotide sequence attached to an adjacent
variable nucleotide sequence, both bound to a solid support by a
covalent linking moiety. The constant nucleotide sequence has a
priming region to permit amplification by PCR of hybridized
strands. Sorting is then carried out by hybridization to the
variable region. Sequencing, isolating, sorting, and manipulating
fragmented nucleic acids on these binary arrays are also disclosed.
In one embodiment with enhanced sensitivity, the immobilized
oligonucleotide has a shorter complementary region hybridized to
it, leaving part of the oligonucleotide uncovered. The array is
then subjected to hybridization conditions so that a complementary
nucleic acid anneals to the immobilized oligonucleotide. DNA ligase
is then used to join the shorter complementary region and the
complementary nucleic acid on the array. There is little disclosure
of how to prepare the arrays of oligonucleotides.
[0024] WO 92/10588 to Fodor et. al., discloses a process for
sequencing, fingerprinting, and mapping nucleic acids by
hybridization to an array of oligonucleotides. The array of
oligonucleotides is prepared by a very large scale immobilized
polymer synthesis which permits the synthesis of large, different
oligonucleotides. In this procedure, the substrate surface is
functionalized and provided with a linker group by which
oligonucleotides are assembled on the substrate. The regions where
oligonucleotides are attached have protective groups (on the
substrate or individual nucleotide subunits) which are selectively
activated. Generally, this involves imaging the array with light
using a mask of varying configuration so that areas exposed are
deprotected. Areas which have been deprotected undergo a chemical
reaction with a protected nucleotide to extend the oligonucleotide
sequence where imaged. A binary masking strategy can be used to
build two or more arrays at a given time. Detection involves
positional localization of the region where hybridization has taken
place. See also U.S. Pat. Nos. 5,324,633 and 5,424,186 to Fodor et.
al., U.S. Pat. Nos. 5,143,854 and 5,405,783 to Pirrung, et. al., WO
90/15070 to Pirrung, et. al., A. C. Pease, et. al.,
"Light-generated Oligonucleotide Arrays for Rapid DNA Sequence
Analysis", Proc. Natl. Acad. Sci USA 91: 5022-26 (1994). K. L.
Beattie, et. al., "Advances in Genosensor Research," Clin. Chem.
41(5): 700-09 (1995) discloses attachment of previously assembled
oligonucleotide probes to a solid support.
[0025] There are many drawbacks to the procedures for sequencing by
hybridization to such arrays. Firstly, a very large number of
oligonucleotides must be synthesized. Secondly, there is poor
discrimination between correctly hybridized, properly matched
duplexes and those which are mismatched. Finally, certain
oligonucleotides will be difficult to hybridize to under standard
conditions, with such oligonucleotides being capable of
identification only through extensive hybridization studies.
[0026] The present invention is directed toward overcoming these
deficiencies in the art.
SUMMARY OF THE INVENTION
[0027] The present invention relates to a method for identifying
one or more of a plurality of sequences differing by one or more
single base changes, insertions deletions, or translocations in a
plurality of target nucleotide sequences. The method includes a
ligation phase, a capture phase, and a detection phase.
[0028] The ligation phase requires providing a sample potentially
containing one or more nucleotide sequences with a plurality of
sequence differences. A plurality of oligonucleotide sets are
utilized in this phase. Each set includes a first oligonucleotide
probe, having a target-specific portion and an addressable
array-specific portion, and a second oligonucleotide probe, having
a target-specific portion and a detectable reporter label. The
first and second oligonucleotide probes in a particular set are
suitable for ligation together when hybridized adjacent to one
another on a corresponding target nucleotide sequence. However, the
first and second oligonucleotide probes have a mismatch which
interferes with such ligation when hybridized to another nucleotide
sequence present in the sample. A ligase is also utilized. The
sample, the plurality of oligonucleotide probe sets, and the ligase
are blended to form a mixture. The mixture is subjected to one or
more ligase detection reaction cycles comprising a denaturation
treatment and a hybridization treatment. The denaturation treatment
involves separating any hybridized oligonucleotides from the target
nucleotide sequences. The hybridization treatment involves
hybridizing the oligonucleotide probe sets at adjacent positions in
a base-specific manner to their respective target nucleotide
sequences, if present in the sample, and ligating them to one
another to form a ligated product sequence containing (a) the
addressable array-specific portion, (b) the target-specific
portions connected together, and (c) the detectable reporter label.
The oligonucleotide probe sets may hybridize to nucleotide
sequences in the sample other than their respective target
nucleotide sequences but do not ligate together due to a presence
of one or more mismatches and individually separate during
denaturation treatment.
[0029] The next phase of the process is the capture phase. This
phase involves providing a solid support with capture
oligonucleotides immobilized at particular sites. The capture
oligonucleotides are complementary to the addressable
array-specific portions. The mixture, after being subjected to the
ligation phase, is contacted with the solid support under
conditions effective to hybridize the addressable array-specific
portions to the capture oligonucleotides in a base-specific manner.
As a result, the addressable array-specific portions are captured
on the solid support at the site with the complementary capture
oligonucleotides.
[0030] After the capture phase is the detection phase. During this
portion of the process, the reporter labels of the ligated product
sequences are captured on the solid support at particular sites.
When the presence of the reporter label bound to the solid support
is detected, the respective presence of one or more nucleotide
sequences in the sample is indicated.
[0031] The present invention also relates to a kit for carrying out
the method of the present invention which includes the ligase, the
plurality of oligonucleotide sets, and the solid support with
immobilized capture oligonucleotides.
[0032] Another aspect of the present invention relates to a method
of forming an array of oligonucleotides on a solid support. This
method involves providing a solid support having an array of
positions each suitable for attachment of an oligonucleotide. A
linker or surface (which can be non-hydrolyzable), suitable for
coupling an oligonucleotide to the solid support at each of the
array positions, is attached to the solid support. An array of
oligonucleotides on a solid support is formed by a series of cycles
of activating selected array positions for attachment of multimer
nucleotides and attaching multimer nucleotides at the activated
array positions.
[0033] Yet another aspect of the present invention relates to an
array of oligonucleotides on a solid support per se. The solid
support has an array of positions each suitable for attachment of
an oligonucleotide. A linker or support (which can be
non-hydrolyzable), suitable for coupling an oligonucleotide to the
solid support, is attached to the solid support at each of the
array positions. An array of oligonucleotides are placed on a solid
support with at least some of the array positions being occupied by
oligonucleotides having greater than sixteen nucleotides.
[0034] One aspect of the present invention involves providing the
solid support with a porous surface.
[0035] Another aspect of the present invention involves carrying
out the contacting of the mixture with the solid support under
conditions effective to mask negative charges.
[0036] The present invention contains a number of advantages over
prior art systems, particularly, its ability to carry out multiplex
analyses of complex genetic systems. As a result, a large number of
nucleotide sequence differences in a sample can be detected at one
time. The present invention is useful for detection of, for
example, cancer mutations, inherited (germline) mutations, and
infectious diseases. This technology can also be utilized in
conjunction with environmental monitoring, forensics, and the food
industry.
[0037] In addition, the present invention provides quantitative
detection of mutations in a high background of normal sequences,
allows detection of closely-clustered mutations, permits detection
using addressable arrays, and is amenable to automation. By
combining the sensitivity of PCR with the specificity of LDR,
common difficulties encountered in allele-specific PCR, such as
false-positive signal generation, primer interference during
multiplexing, limitations in obtaining quantitative data, and
suitability for automation, have been obviated. In addition, by
relying on the specificity of LDR to distinguish single-base
mutations, the major inherent problem of oligonucleotide probe
arrays (i.e. their inability to distinguish single-base changes at
all positions in heterozygous samples) has been overcome. PCR/LDR
addresses the current needs in cancer detection; to quantify
mutations which may serve as clonal markers and to detect minimal
residual disease and micrometastases.
[0038] In carrying out analyses of different samples, the solid
support containing the array can be reused. This reduces the
quantity of solid supports which need to be manufactured and lowers
the cost of analyzing each sample.
[0039] The present invention also affords great flexibility in the
synthesis of oligonucleotides and their attachment to solid
supports. Oligonucleotides can be synthesized off of the solid
support and then attached to unique surfaces on the support. This
technique can be used to attach fall length oligonucleotides or
peptide nucleotide analogues ("PNA") to the solid support.
Alternatively, shorter nucleotide or analogue segments (dimer,
trimer, tetramer, etc.) can be employed in a segment condensation
or block synthesis approach to fall length oligomers on the solid
support.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] FIG. 1 is a flow diagram depicting polymerase chain reaction
("PCR")/ligase detection reaction ("LDR") processes, according to
the prior art and the present invention, for detection of germline
mutations, such as point mutations.
[0041] FIG. 2 is a flow diagram depicting PCR/LDR processes,
according to the prior art and the present invention, for detection
of cancer-associated mutations.
[0042] FIG. 3 is a schematic diagram depicting a PCR/LDR process,
according to the present invention, using addresses on the
allele-specific probes for detecting homo- or heterozygosity at two
polymorphisms (i.e. allele differences) on the same gene.
[0043] FIG. 4 is a schematic diagram depicting a PCR/LDR process,
according to the present invention, using addresses on the
allele-specific probes which distinguishes all possible bases at a
given site.
[0044] FIG. 5 is a schematic diagram depicting a PCR/LDR process,
according to the present invention, using addresses on the
allele-specific probes for detecting the presence of any possible
base at two nearby sites.
[0045] FIG. 6 is a schematic diagram of a PCR/LDR process,
according to the present invention, using addresses on the
allele-specific probes distinguishing insertions and deletions.
[0046] FIG. 7 is a schematic diagram of a PCR/LDR process, in
accordance with the present invention, using addresses on the
allele-specific probes to detect a low abundance mutation (within a
codon) in the presence of an excess of normal sequence.
[0047] FIG. 8 is a schematic diagram of a PCR/LDR process, in
accordance with the present invention, where the address is placed
on the common probe and the allele differences are distinguished by
different fluorescent signals F1, F2, F3, and F4.
[0048] FIG. 9 is a schematic diagram of a PCR/LDR process, in
accordance with the present invention, where both adjacent and
nearby alleles are detected.
[0049] FIG. 10 is a schematic diagram of a PCR/LDR process, in
accordance with the present invention, where all possible
single-base mutations for a single codon are detected.
[0050] FIG. 11 shows the chemical reactions for covalent
modifications, grafting, and oligomer attachments to solid
supports.
[0051] FIGS. 12A-C show proposed chemistries for covalent
attachment of oligonucleotides to solid supports.
[0052] FIGS. 13A-C show two alternative formats for oligonucleotide
probe capture. In FIG. 13B, the addressable array-specific portions
are on the allele-specific probe. Alleles are distinguished by
capture of fluorescent signals on addresses Z1 and Z2,
respectively. In FIG. 13C, the addressable array-specific portions
are on the common probe and alleles are distinguished by capture of
fluorescent signals F1 and F2, which correspond to the two alleles,
respectively.
[0053] FIGS. 14A-E depict a protocol for constructing an 8.times.8
array of oligomers by spotting full-length, individual 24 mer
oligomers at various sites on a solid support.
[0054] FIGS. 15A-E are perspective views of the 8.times.8 array
construction protocol of FIGS. 14A-E.
[0055] FIGS. 16A-C are views of an apparatus used to spot
full-length, individual 24 mer oligomers on a solid support in
accordance with FIGS. 14A-E to 15A-E.
[0056] FIG. 17 shows a design in accordance with the present
invention using 36 tetramers differing by at least 2 bases, which
can be used to create a series of unique 24-mers.
[0057] FIGS. 18A-G are schematic diagrams showing addition of PNA
tetramers to generate a 5.times.5 array of unique 25 mer
addresses.
[0058] FIGS. 19A-E depict a protocol for constructing an 8.times.8
array of 24-mers by sequentially coupling 6 tetramers.
[0059] FIGS. 20A-C are perspective views of the 8.times.8 array
construction protocol of FIGS. 19B-C.
[0060] FIGS. 21A-F show a schematic cross-sectional view of the
synthesis of an addressable array, in accordance with FIGS.
19B-C.
[0061] FIGS. 22A-C are schematic views of an apparatus used to
synthesize the 8.times.8 array of 24 mers on a solid support in
accordance with FIGS. 19B-C, 20A-C, and 21A-G.
[0062] FIGS. 23A-C are perspective views of the 8.times.8 array
construction protocol of FIG. 19 (FIGS. 19D-19E).
[0063] FIGS. 24A-C are schematic views of an apparatus used to
synthesize the 5.times.5 array of 24 mers on a solid support, in
accordance with FIGS. 19D-E and 23A-C.
[0064] FIGS. 25A-C are schematic diagrams of a valve block assembly
capable of routing six input solutions to 5 output ports.
[0065] FIGS. 26A-D are diagrams of a circular manifold capable of
simultaneously channeling 6 input solutions into 5 output
ports.
[0066] FIG. 27 is a schematic drawing of an assay system for
carrying out the process of the present invention.
[0067] FIG. 28 shows phosphorimager data for different derivatized
surfaces.
[0068] FIG. 29 shows phosphorimager data for different crosslinking
conditions of the polymer matrix.
[0069] FIG. 30 shows phosphorimager data for --OH functionalized
slides.
[0070] FIG. 31 shows the reaction scheme for producing a glass
slide silanized with 3-methacryloyloxypropyltrimethoxysilane.
[0071] FIG. 32 shows the reaction scheme for producing polymerized
poly(ethylene glycol)methacrylate on a glass slide silanized with
3-methacryloyloxypropyl-trimethoxy-silane.
[0072] FIG. 33 shows the reaction scheme for producing polymerized
acrylic acid and trimethylolpropane ethoxylate (14/3 EO/OH)
triacrylate on a glass slide silanized with
3-methacryloyloxypropyltrimethoxysilane.
[0073] FIGS. 34A-B show the reaction scheme for producing
polymerized poly(ethylene glycol)methacrylate and
trimethylolpropane ethoxylate (14/3 EO/OH) triacrylate on a glass
slide silanized with 3-methacryloyloxypropyltrimethoxysilane.
[0074] FIGS. 35A-C show a scheme for PCR/LDR detection of mutations
using an addressable array. FIG. 35A shows a schematic
representation of LDR probes used to distinguish mutations. Each
allele specific probe contains an addressable sequence complement
(Z1 or Z3) on the 5'-end and the discriminating base on the 3'-end.
The common LDR probe is phosphorylated on the 5'-end and contains a
fluorescent label on the 3'-end. The probes hybridize adjacent to
each other on target DNA, and the nick will be sealed by the ligase
if and only if there is perfect complementarity at the junction.
FIG. 35B shows the presence and type of mutation is determined by
hybridizing the contents of an LDR reaction to an addressable DNA
array. The sequences of the probes' addressable array-specific
portions are designed to be sufficiently different, so that only
probes containing the correct complement to a given portion will
remain bound at that address. FIG. 35C is a schematic
representation of chromosomal DNA containing the K-ras gene. Exons
are shaded and the position of codons 12 and 13 are shown.
Exon-specific probes were used to selectively amplify K-ras DNA
flanking codons 12 and 13. Probes were designed for LDR detection
of seven possible mutations in these two codons as described in
FIG. 35A above.
[0075] FIGS. 36A-B show the detection of K-ras mutations on a DNA
array. FIG. 36A is a schematic representation of gel-based
addressable array. Glass microscope slides treated with
.gamma.-methacryloxypropyltrimethoxy- -silane are used as the
substrate for the covalent attachment of an acrylamide/acrylic acid
copolymer matrix. Amine-modified, capture oligonucleotides are
coupled to N-hydroxysuccinimide activated surfaces at discrete
locations. Each position in the 3.times.3 grid identifies an
individual address (and corresponding K-ras mutation or wild-type
sequence). FIG. 36B shows arrays hybridized with individual LDR
reactions and fluorescent signal detected using a 2 sec exposure
time. All nine arrays identified the correct mutant and/or
wild-type for each tumor or cell line sample. The small spots seen
in some of the panels, e.g., near the center of the panel
containing the G13D mutant, are not incorrect hybridizations, but
noise due to imperfections in the polymer.
[0076] FIG. 37 shows the determination of addressable array capture
sensitivity using two different detection instruments.
Quadruplicate hybridizations were carried out as described infra.
The graphs depict quantification of the amount of captured 70-mer
complement using either a fluorimager (left) or an epifluorescence
microscope/CCD (right). Each symbol represents hybridizations to an
individual array.
[0077] FIG. 38 shows the detection of minority K-ras mutant DNA in
a majority of wild-type DNA using PCR/LDR with addressable array
capture. DNA from cell line SW620, containing the G12V mutation,
and DNA from normal lymphocytes were PCR amplified in exon 1 of the
K-ras gene. Mixtures containing 10, 20, 40, or 100 fmol of G12V
amplified fragment plus 2,000 fmol of PCR amplified wild-type
fragment were prepared, and the presence of mutant DNA determined
by LDR using probes specific for the G12V mutation (2,000 fmol each
of discriminating and common primer). Images were collected by CCD
using exposure times from 5 to 25 sec. Data was normalized by
dividing fluorescent signal intensity by acquisition time. Each
data point represents the average signal minus average background
signal from hybridizations of four independent DNA arrays.
[0078] FIG. 39 shows the PCR/LDR detection of K-ras mutations using
addressable array capture.
[0079] FIG. 40 shows the ligation of probes to detect 3 specific
mutations in BRCA 1 and BRCA 2 genes.
[0080] FIG. 41 shows the ligation of probes to detect 3 specific
mutations in BRCA 1 and BRCA 2 genes.
[0081] FIG. 42 shows the gel-based identification of 3 specific
mutations in BRCA 1 and BRCA 2 genes detected by LDR.
[0082] FIG. 43 shows oligonucleotides coupled on array addresses.
Labels indicate oligonucleotides spotted as indicated in Table
16.
[0083] FIG. 44 shows the LDR detection of 3 specific mutations in
BRCA 1 and BRCA 2 genes.
DETAILED DESCRIPTION OF THE INVENTION AND DRAWINGS
[0084] The present invention relates to a method for identifying
one or more of a plurality of sequences differing by one or more
single-base changes, insertions, deletions, or translocations in a
plurality of target nucleotide sequences. The method includes a
ligation phase, a capture phase, and a detection phase.
[0085] The ligation phase requires providing a sample potentially
containing one or more nucleotide sequences with a plurality of
sequence differences. A plurality of oligonucleotide sets are
utilized in this phase. Each set includes a first oligonucleotide
probe, having a target-specific portion and an addressable
array-specific portion, and a second oligonucleotide probe, having
a target-specific portion and a detectable reporter label. The
first and second oligonucleotide probes in a particular set are
suitable for ligation together when hybridized adjacent to one
another on a corresponding target nucleotide sequence. However, the
first and second oligonucleotide probes have a mismatch which
interferes with such ligation when hybridized to another nucleotide
sequence present in the sample. A ligase is also utilized. The
sample, the plurality of oligonucleotide probe sets, and the ligase
are blended to form a mixture. The mixture is subjected to one or
more ligase detection reaction cycles comprising a denaturation
treatment and a hybridization treatment. The denaturation treatment
involves separating any hybridized oligonucleotides from the target
nucleotide sequences. The hybridization treatment involves
hybridizing, the oligonucleotide probe sets at adjacent positions
in a base-specific manner to their respective target nucleotide
sequences, if present in the sample, and ligating them to one
another to form a ligated product sequence containing (a) the
addressable array-specific portion, (b) the target-specific
portions connected together, and (c) the detectable reporter label.
The oligonucleotide probe sets may hybridize to nucleotide
sequences in the sample other than their respective target
nucleotide sequences but do not ligate together due to a presence
of one or more mismatches and individually separate during
denaturation treatment.
[0086] The next phase of the process is the capture phase. This
phase involves providing a solid support with capture
oligonucleotides immobilized at particular sites. The capture
oligonucleotides are complementary to the addressable
array-specific portions. The mixture, after being subjected-to the
ligation phase, is contacted with the solid support under
conditions effective to hybridize the addressable array-specific
portions to the capture oligonucleotides in a base-specific manner.
As a result, the addressable array-specific portions are captured
on the solid support at the site with the complementary capture
oligonucleotides.
[0087] One aspect of the present invention involves providing the
solid support with a porous surface.
[0088] Another aspect of the present invention involves carrying
out the contacting of the mixture with the solid support under
conditions effective to mask negative charges.
[0089] After the capture phase is the detection phase. During this
portion of the process, the reporter labels of the ligated product
sequences are captured on the solid support at particular sites.
When the presence of the reporter label bound to the solid support
is detected, the respective presence of one or more nucleotide
sequences in the sample is indicated.
[0090] Often, a number of different single-base mutations,
insertions, or deletions may occur at the same nucleotide position
of the sequence of interest. The method provides for having an
oligonucleotide set, where the second oligonucleotide probe is
common and contains the detectable label, and the first
oligonucleotide probe has different addressable array-specific
portions and target-specific portions. The first oligonucleotide
probe is suitable for ligation to a second adjacent oligonucleotide
probe at a first ligation junction, when hybridized without
mismatch, to the sequence in question. Different first adjacent
oligonucleotide probes would contain different discriminating
base(s) at the junction where only a hybridization without mismatch
at the junction would allow for ligation. Each first adjacent
oligonucleotide would contain a different addressable
array-specific portion, and, thus, specific base changes would be
distinguished by capture at different addresses. In this scheme, a
plurality of different capture oligonucleotides are attached at
different locations on the solid support for multiplex detection of
additional nucleic acid sequences differing from other nucleic
acids by at least a single base. Alternatively, the first
oligonucleotide probe contains common addressable array-specific
portions, and the second oligonucleotide probes have different
detectable labels and target-specific portions.
[0091] Such arrangements permit multiplex detection of additional
nucleic acid sequences differing from other nucleic acids by at
least a single base. The nucleic acids sequences can be on the same
or different alleles when carrying out such multiplex
detection.
[0092] The present invention also relates to a kit for carrying out
the method of the present invention which includes the ligase, the
plurality of different oligonucleotide probe sets, and the solid
support with immobilized capture oligonucleotides. Primers for
preliminary amplification of the target nucleotide sequences may
also be included in the kit. If amplification is by polymerase
chain reaction, polymerase may also be included in the kit.
[0093] FIGS. 1 and 2 show flow diagrams of the process of the
present invention compared to a prior art ligase detection reaction
utilizing capillary or gel electrophoresis/fluorescent
quantification. FIG. 1 relates to detection of a germline mutation
detection, while FIG. 2 shows the detection of cancer.
[0094] FIG. 1 depicts the detection of a germline point mutation,
such as the p53 mutations responsible for Li-Fraumeni syndrome. In
step 1, after DNA sample preparation, exons 5-8 are PCR amplified
using Taq (i.e. Thermus aquaticus) polymerase under hot start
conditions. At the end of the reaction, Taq polymerase is degraded
by heating at 100.degree. C. for 10 min. Products are diluted
20-fold in step 2 into fresh LDR buffer containing allele-specific
and common LDR probes. A tube generally contains about 100 to 200
fmoles of each primer. In step 3, the ligase detection reaction is
initiated by addition of Taq ligase under hot start conditions. The
LDR probes ligate to their adjacent probes only in the presence of
target sequence which gives perfect complementarity at the junction
site. The products may be detected in two different formats. In the
first format 4a., used in the prior art, fluorescently-labeled LDR
probes contain different length poly A or hexaethylene oxide tails.
Thus, each LDR product, resulting from ligation to normal DNA with
a slightly different mobility, yields a ladder of peaks. A germline
mutation would generate a new peak on the electrophorogram. The
size of the new peak will approximate the amount of the mutation
present in the original sample; 0% for homozygous normal, 50% for
heterozygous carrier, or 100% for homozygous mutant. In the second
format 4b., in accordance with the present invention; each
allele-specific probe contains e.g., 24 additional nucleotide bases
on their 5' ends. These sequences are unique addressable sequences
which will specifically hybridize to their complementary address
sequences on an addressable array. In the LDR reaction, each
allele-specific probe can ligate to its adjacent fluorescently
labeled common probe in the presence of the corresponding target
sequence. Wild type and mutant alleles are captured on adjacent
addresses on the array. Unreacted probes are washed away. The black
dots indicate 100% signal for the wild type allele. The white dots
indicate 0% signal for the mutant alleles. The shaded dots indicate
the one position of germline mutation, 50% signal for each
allele.
[0095] FIG. 2 depicts detection of somatic cell mutations in the
p53 tumor suppressor gene but is general for all low sensitivity
mutation detection. In step 1, DNA samples are prepared and exons
5-9 arc PCR amplified as three fragments using fluorescent PCR
primers. This allows for fluorescent quantification of PCR products
in step 2 using capillary or gel electrophoresis. In step 3, the
products are spiked with a {fraction (1/100)} dilution of marker
DNA (for each of the three fragments). This DNA is homologous to
wild type DNA, except it contains a mutation which is not observed
in cancer cells, but which may be readily detected with the
appropriate LDR probes. The mixed DNA products in step 4 are
diluted 20-fold into buffer containing all the LDR probes which are
specific only to mutant or marker alleles. In step 5, the ligase
reaction is initiated by addition of Taq ligase under hot start
conditions. The LDR probes ligate to their adjacent probes only in
the presence of target sequences which give perfect complementarity
at the junction site. The products may be detected in the same two
formats described in FIG. 1. In the format of step 6a, which is
used in the prior art, products are separated by capillary or gel
electrophoresis, and fluorescent signals are quantified. Ratios of
mutant peaks to marker peaks give approximate amount of cancer
mutations present in the original sample divided by 100. In the
format of step 6b, in accordance with the present invention,
products are detected by specific hybridization to complementary
sequences on an addressable array. Ratios of fluorescent signals in
mutant dots to marker dots give the approximate amount of cancer
mutations present in the original sample divided by 100.
[0096] The ligase detection reaction process, in accordance with
the present invention, is best understood by referring to FIGS.
3-10. It is described generally in WO 90/17239 to Barany et al., F.
Barany et al., "Cloning, Overexpression and Nucleotide Sequence of
a Thermostable DNA Ligase-encoding Gene," Gene, 109:1-11 (1991),
and F. Barany, "Genetic Disease Detection and DNA Amplification
Using Cloned Thermostable Ligase," Proc. Natl. Acad. Sci. USA,
88:189-193 (1991), the disclosures of which are hereby incorporated
by reference. In accordance with the present invention, the ligase
detection reaction can use 2 sets of complementary
oligonucleotides. This is known as the ligase chain reaction which
is described in the 3 immediately preceding references, which are
hereby incorporated by reference. Alternatively, the ligase
detection reaction can involve a single cycle which is known as the
oligonucleotide ligation assay. See Landegren, et al., "A
Ligase-Mediated Gene Detection Technique," Science 241:1077-80
(1988); Landegren, et al., "DNA Diagnostics--Molecular Techniques
and Automation," Science 242:229-37 (1988); and U.S. Pat. No.
4,988,617 to Landegren, et al.
[0097] During the ligase detection reaction phase of the process,
the denaturation treatment is carried out at a temperature of
80-105.degree. C., while hybridization takes place at 50-85.degree.
C. Each cycle comprises a denaturation treatment and a thermal
hybridization treatment which in total is from about one to five
minutes long. Typically, the ligation detection reaction involves
repeatedly denaturing and hybridizing for 2 to 50 cycles. The total
time for the ligase detection reaction phase of the process is 1 to
250 minutes.
[0098] The oligonucleotide probe sets can be in the form of
ribonucleotides, deoxynucleotides, modified ribonucleotides,
modified deoxyribonucleotides, peptide nucleotide analogues,
modified peptide nucleotide analogues, modified
phosphate-sugar-backbone oligonucleotides, nucleotide analogs, and
mixtures thereof.
[0099] In one variation, the oligonucleotides of the
oligonucleotide probe sets each have a hybridization or melting
temperature (i.e. T.sub.m) of 66-70.degree. C. These
oligonucleotides are 20-28 nucleotides long.
[0100] It may be desirable to destroy chemically or enzymatically
unconverted LDR oligonucleotide probes that contain addressable
nucleotide array-specific portions prior to capture of the ligation
products on a DNA array. Such unconverted probes will otherwise
compete with ligation products for binding at the addresses on the
array of the solid support which contain complementary sequences.
Destruction can be accomplished by utilizing an exonuclease, such
as exonuclease III (L-H Guo and R. Wu, Methods in Enzymology
100:60-96 (1985), which is hereby incorporated by reference) in
combination with LDR probes that are blocked at the ends and not
involved with ligation of probes to one another. The blocking
moiety could be a reporter group or a phosphorothioate group. T. T.
Nikiforow, et al., "The Use of Phosphorothioate Primers and
Exonuclease Hydrolysis for the Preparation of Single-stranded PCR
Products and their Detection by Solid-phase Hybridization," PCR
Methods and Applications, 3:p.285-291 (1994), which is hereby
incorporated by reference. After the LDR process, unligated probes
are selectively destroyed by incubation of the reaction mixture
with the exonuclease. The ligated probes are protected due to the
elimination of free 3' ends which are required for initiation of
the exonuclease reaction. This approach results in an increase in
the signal-to-noise ratio, especially where the LDR reaction forms
only a small amount of product. Since unligated oligonucleotides
compete for capture by the capture oligonucleotide, such
competition with the ligated oligonucleotides lowers the signal. An
additional advantage of this approach is that unhybridized
label-containing sequences are degraded and, therefore, are less
able to cause a target-independent background signal, because they
can be removed more easily from the DNA array by washing.
[0101] The oligonucleotide probe sets, as noted above, have a
reporter label suitable for detection. Useful labels include
chromophores, fluorescent moieties, enzymes, antigens, heavy
metals, magnetic probes, dyes, phosphorescent groups, radioactive
materials, chemiluminescent moieties, and electrochemical detecting
moieties. The capture oligonucleotides can be in the form of
ribonucleotides, deoxyribonucleotides, modified ribonucleotides,
modified deoxyribonucleotides, peptide nucleotide analogues,
modified peptide nucleotide analogues, modified phosphate-sugar
backbone oligonucleotides, nucleotide analogues, and mixtures
thereof. Where the process of the present invention involves use of
a plurality of oligonucleotide sets, the second oligonucleotide
probes can be the same, while the addressable array-specific
portions of the first oligonucleotide probes differ. Alternatively,
the addressable array-specific portions of the first
oligonucleotide probes may be the same, while the reporter labels
of the second oligonucleotide probes are different.
[0102] Prior to the ligation detection reaction phase of the
present invention, the sample is preferably amplified by an initial
target nucleic acid amplification procedure. This increases the
quantity of the target nucleotide sequence in the sample. For
example, the initial target nucleic acid amplification may be
accomplished using the polymerase chain reaction process,
self-sustained sequence replication, or Q-.beta. replicase-mediated
RNA amplification. The polymerase chain reaction process is the
preferred amplification procedure and is fully described in H.
Erlich, et. al., "Recent Advances in the Polymerase Chain
Reaction," Science 252: 1643-50 (1991); M. Innis, et. al., PCR
Protocols: A Guide to Methods and Applications, Academic Press: New
York (1990); and R. Saiki, et. al., "Primer-directed Enzymatic
Amplification of DNA with a Thermostable DNA Polymerase," Science
239: 487-91 (1988), which are hereby incorporated by reference. J.
Guatelli, et. al., "Isothermal, in vitro Amplification of Nucleic
Acids by a Multienzyme Reaction Modeled After Retroviral
Replication," Proc. Natl. Acad. Sci. USA 87: 1874-78 (1990), which
is hereby incorporated by reference, describes the self-sustained
sequence replication process. The Q-.beta. replicase-mediated RNA
amplification is disclosed in F. Kramer, et. al., "Replicatable RNA
Reporters," Nature 339: 401-02 (1989), which is hereby incorporated
by reference.
[0103] The use of the polymerase chain reaction process and then
the ligase detection process, in accordance with the present
invention, is shown in FIG. 3. Here, homo- or heterozygosity at two
polymorphisms (i.e. allele differences) are on the same gene. Such
allele differences can alternatively be on different genes.
[0104] As shown in FIG. 3, the target nucleic acid, when present in
the form of a double stranded DNA molecule is denatured to separate
the strands. This is achieved by heating to a temperature of
80-105.degree. C. Polymerase chain reaction primers are then added
and allowed to hybridize to the strands, typically at a temperature
of 20-85.degree. C. A thermostable polymerase (e.g., Thermus
aquaticus polymerase) is also added, and the temperature is then
adjusted to 50-85.degree. C. to extend the primer along the length
of the nucleic acid to which the primer is hybridized. After the
extension phase of the polymerase chain reaction, the resulting
double stranded molecule is heated to a temperature of
80-105.degree. C. to denature the molecule and to separate the
strands. These hybridization, extension, and denaturation steps may
be repeated a number of times to amplify the target to an
appropriate level.
[0105] Once the polymerase chain reaction phase of the process is
completed, the ligation detection reaction phase begins, as shown
in FIG. 3. After denaturation of the target nucleic acid, if
present as a double stranded DNA molecule, at a temperature of
80-105.degree. C., preferably 94.degree. C., ligation detection
reaction oligonucleotide probes for one strand of the target
nucleotide sequence are added along with a ligase (for example, as
shown in FIG. 3, a thermostable ligase like Thermus aquaticus
ligase). The oligonucleotide probes are then allowed to hybridize
to the target nucleic acid molecule and ligate together, typically,
at a temperature of 45-85.degree. C., preferably, 65.degree. C.
When there is perfect complementarity at the ligation junction, the
oligonucleotides can be ligated together. Where the variable
nucleotide is T or A, the presence of T in the target nucleotide
sequence will cause the oligonucleotide probe with the addressable
array-specific portion Z1 to ligate to the oligonucleotide probe
with the reporter label F, and the presence of A in the target
nucleotide sequence will cause the oligonucleotide probe with the
addressable array-specific portion Z2 to ligate to the
oligonucleotide probe with reporter label F. Similarly, where the
variable nucleotide is A or G, the presence of T in the target
nucleotide sequence will cause the oligonucleotide probe with
addressable array-specific portion Z4 to ligate to the
oligonucleotide probe with the reporter label F, and the presence
of C in the target nucleotide sequence will cause the
oligonucleotide probe with the addressable array-specific portion
Z3 to ligate to the oligonucleotide probe with reporter label F.
Following ligation, the material is again subjected to denaturation
to separate the hybridized strands. The hybridization/ligation and
denaturation steps can be carried through one or more cycles (e.g.,
1 to 50 cycles) to amplify the target signal. Fluorescent ligation
products (as well as unligated oligonucleotide probes having an
addressable array-specific portion) are captured by hybridization
to capture probes complementary to portions Z1, Z2, Z3, and Z4 at
particular addresses on the addressable arrays. The presence of
ligated oligonucleotides is then detected by virtue of the label F
originally on one of the oligonucleotides. In FIG. 3, ligated
product sequences hybridize to the array at addresses with capture
oligonucleotides complementary to addressable array-specific
portions Z1 and Z3, while unligated oligonucleotide probes with
addressable array-specific portions Z2 and Z4 hybridize to their
complementary capture oligonucleotides. However, since only the
ligated product sequences have label F, only their presence is
detected.
[0106] FIG. 4 is a flow diagram of a PCR/LDR process, in accordance
with the present invention, which distinguishes any possible base
at a given site. Appearance of fluorescent signal at the addresses
complementary to addressable array-specific portions Z1, Z2, Z3,
and Z4 indicates the presence of A, G, C, and T alleles in the
target nucleotide sequence, respectively. Here, the presence of the
A and C alleles in the target nucleotide sequences is indicated due
to the fluorescence at the addresses on the solid support with
capture oligonucleotide probes complementary to portions Z1 and Z3,
respectively. Note that in FIG. 4 the addressable array-specific
portions are on the discriminating oligonucleotide probes, and the
discriminating base is on the 3' end of these probes.
[0107] FIG. 5 is a flow diagram of a PCR/LDR process, in accordance
with the present invention, for detecting the presence of any
possible base at two nearby sites. Here, the LDR primers are able
to overlap, yet are still capable of ligating provided there is
perfect complementarity at the junction. This distinguishes LDR
from other approaches, such as allele-specific PCR where
overlapping primers would interfere with one another. In FIG. 5,
the first nucleotide position is heterozygous at the A and C
alleles, while the second nucleotide position is heterozygous to
the G, C, and T alleles. As in FIG. 4, the addressable
array-specific portions are on the discriminating oligonucleotide
probes, and the discriminating base is on the 3' end of these
probes. The reporter group (e.g., the fluorescent label) is on the
3' end of the common oligonucleotide probes. This is possible for
example with the 21 hydroxylase gene, where each individual has 2
normal and 2 pseudogenes, and, at the intron 2 splice site
(nucleotide 656), there are 3 possible single bases (G, A, and C).
Also, this can be used to detect low abundance mutations in HIV
infections which might indicate emergence of drug resistant (e.g.,
to AZT) strains. Returning to FIG. 5, appearance of fluorescent
signal at the addresses complementary to addressable array-specific
portions Z1, Z2, Z3, Z4, Z5, Z6, Z7, and Z8 indicates the presence
of the A, G, C, and T, respectively, in the site heterozygous at
the A and C alleles, and A, G, C, and T, respectively, in the site
heterozygous at the G, C, and T alleles.
[0108] FIG. 6 is a flow diagram of a PCR/LDR process, in accordance
with the present invention, where insertions (top left set of
probes) and deletions (bottom right set of probes) are
distinguished. On the left, the normal sequence contains 5 A's in a
polyA tract. The mutant sequence has an additional 2As inserted
into the tract. Therefore, the LDR products with addressable
array-specific portions Z1 (representing the normal sequence) and
Z3 (representing a 2 base pair insertion) would be fluorescently
labeled by ligation to the common primer. While the LDR process
(e.g., using a thermostable ligase enzyme) has no difficulty
distinguishing single base insertions or deletions in
mononucleotide repeats, allele-specific PCR is unable to
distinguish such differences, because the 3' base remains the same
for both alleles. On the right, the normal sequence is a (CA)5
repeat (i.e. CACACACACA). The mutant contains two less CA bases
than the normal sequence (i.e. CACACA). These would be detected as
fluorescent LDR products at the addressable array-specific portions
Z8 (representing the normal sequence) and Z6 (representing the 2 CA
deletion) addresses. The resistance of various infectious agents to
drugs can also be determined using the present invention. In FIG.
6, the presence of ligated product sequences, as indicated by
fluorescent label F, at the address having capture oligonucleotides
complementary to Z1 and Z3 demonstrates the presence of both the
normal and mutant poly A sequences. Similarly, the presence of
ligated product sequences, as indicated by fluorescent label F, at
the address having capture oligonucleotides complementary to Z6 and
Z8 demonstrates the presence of both the normal CA repeat and a
sequence with one repeat unit deleted.
[0109] FIG. 7 is a flow diagram of a PCR/LDR process, in accordance
with the present invention, using addressable array-specific
portions to detect a low abundance mutation in the presence of an
excess of normal sequence. FIG. 7 shows codon 12 of the K-ras gene,
sequence GGT, which codes for glycine ("Gly"). A small percentage
of the cells contain the G to A mutation in GAT, which codes for
aspartic acid ("Asp"). The LDR probes for wild-type (i.e. normal
sequences) are missing from the reaction. If the normal LDR probes
(with the discriminating base=G) were included, they would ligate
to the common probes and overwhelm any signal coming from the
mutant target. Instead, as shown in FIG. 7, the existence of a
ligated product sequence with fluorescent label F at the address
with a capture oligonucleotide complementary to addressable
array-specific portion Z4 indicates the presence of the aspartic
acid encoding mutant.
[0110] FIG. 8 is a flow diagram of a PCR/LDR process, in accordance
with the present invention, where the addressable array-specific
portion is placed on the common oligonucleotide probe, while the
discriminating oligonucleotide probe has the reporter label. Allele
differences are distinguished by different fluorescent signals, F1,
F2, F3, and F4. This mode allows for a more dense use of the
arrays, because each position is predicted to light up with some
group. It has the disadvantage of requiring fluorescent groups
which have minimal overlap in their emission spectra and will
require multiple scans. It is not ideally suitable for detection of
low abundance alleles (e.g., cancer associated mutations).
[0111] FIG. 9 is a flow diagram of a PCR/LDR process, in accordance
with the present invention, where both adjacent and nearby alleles
are detected. The adjacent mutations are right next to each other,
and one set of oligonucleotide probes discriminates the bases on
the 3' end of the junction (by use of different addressable
array-specific portions Z1, Z2, Z3, and Z4), while the other set of
oligonucleotide probes discriminates the bases on the 5' end of the
junction (by use of different fluorescent reporter labels F1, F2,
F3, and F4). In FIG. 9, codons in a disease gene (e.g. CFTR for
cystic fibrosis) encoding Gly and arginine ("Arg"), respectively,
are candidates for germline mutations. The detection results in
FIG. 9 show the Gly (GGA; indicated by the ligated product sequence
having portion Z2 and label F2) has been mutated to glutamic acid
("Glu") (GAA; indicated by the ligated product sequence having
portion Z2 and label F1), and the Arg (CGG; indicated by the
ligated product sequence having portion Z7 and label F2) has been
mutated to tryptophan ("Trp") (TGG; indicated by the ligated
product sequence with portion Z8 and label F2). Therefore, the
patient is a compound heterozygous individual (i.e. with allele
mutations in both genes) and will have the disease.
[0112] FIG. 10 is a flow diagram of a PCR/LDR process, in
accordance with the present invention, where all possible
single-base mutations for a single codon are detected. Most amino
acid codons have a degeneracy in the third base, thus the first two
positions can determine all the possible mutations at the protein
level. These amino acids include arginine, leucine, serine,
threonine, proline, alanine, glycine, and valine. However, some
amino acids are determined by all three bases in the codon and,
thus, require the oligonucleotide probes to distinguish mutations
in 3 adjacent positions. By designing four oligonucleotide probes
containing the four possible bases in the penultimate position to
the 3' end, as well as designing an additional four capture
oligonucleotides containing the four possible bases at the 3' end,
as shown in FIG. 10, this problem has been solved. The common
oligonucleotide probes with the reporter labels only have two
fluorescent groups which correspond to the codon degeneracies and
distinguish between different ligated product sequences which are
captured at the same array address. For example, as shown in FIG.
10, the presence of a glutamine ("Gln") encoding codon (i.e., CAA
and CAG) is indicated by the presence of a ligated product sequence
containing portion Z1 and label F2. Likewise, the existence of a
Gln to histidine ("His") encoding mutation (coded by the codon CAC)
is indicated by the presence of ligated product sequences with
portion Z1 and label F2 and with portion Z7 and label F2 There is
an internal redundancy built into this assay due to the fact that
primers Z1 and Z7 have the identical sequence.
[0113] A particularly important aspect of the present invention is
its capability to quantify the amount of target nucleotide sequence
in a sample. This can be achieved in a number of ways by
establishing standards which can be internal (i.e. where the
standard establishing material is amplified and detected with the
sample) or external (i.e. where the standard establishing material
is not amplified, and is detected with the sample).
[0114] In accordance with one quantification method, the signal
generated by the reporter label, resulting from capture of ligated
product sequences produced from the sample being analyzed, are
detected. The strength of this signal is compared to a calibration
curve produced from signals generated by capture of ligated product
sequences in samples with known amounts of target nucleotide
sequence. As a result, the amount of target nucleotide sequence in
the sample being analyzed can be determined. This technique
involves use of an external standard.
[0115] Another quantification method, in accordance with the
present invention, relates to an internal standard. Here, a known
amount of one or more marker target nucleotide sequences are added
to the sample. In addition, a plurality of marker-specific
oligonucleotide probe sets are added along with the ligase, the
previously-discussed oligonucleotide probe sets, and the sample to
a mixture. The marker-specific oligonucleotide probe sets have (1)
a first oligonucleotide probe with a target-specific portion
complementary to the marker target nucleotide sequence and an
addressable array-specific portion complementary to capture
oligonucleotides on the support and (2) a second oligonucleotide
probe with a target-specific portion complementary to the marker
target nucleotide sequence and a detectable reporter label. The
oligonucleotide probes in a particular marker-specific
oligonucleotide set are suitable for ligation together when
hybridized adjacent to one another on a corresponding marker target
nucleotide sequence. However, there is a mismatch which interferes
with such ligation when hybridized to any other nucleotide sequence
present in the sample or added marker sequences. The presence of
ligated product sequences captured on the solid support is
identified by detection of reporter labels. The amount of target
nucleotide sequences in the sample is then determined by comparing
the amount of captured ligated product generated from known amounts
of marker target nucleotide sequences with the amount of other
ligated product sequences captured.
[0116] Another quantification method in accordance with the present
invention involves analysis of a sample containing two or more of a
plurality of target nucleotide sequences with a plurality of
sequence differences. Here, ligated product sequences corresponding
to the target nucleotide sequences are detected and distinguished
by any of the previously-discussed techniques. The relative amounts
of the target nucleotide sequences in the sample are then
quantified by comparing the relative amounts of captured ligated
product sequences generated. This provides a quantitative measure
of the relative level of the target nucleotide sequences in the
sample.
[0117] The ligase detection reaction process phase of the present
invention can be preceded by the ligase chain reaction process to
achieve oligonucleotide product amplification. This process is
fully described in F. Barany, et. al., "Cloning, Overexpression and
Nucleotide Sequence of a Thermostable DNA Ligase-encoding Gene,"
Gene 109: 1-11 (1991) and F. Barany, "Genetic Disease Detection and
DNA Amplification Using Cloned Thermostable Ligase," Proc. Natl.
Acad. Sci. USA 88: 189-93 (1991), which are hereby incorporated by
reference. Instead of using the ligase chain reaction to achieve
amplification, a transcription-based amplifying procedure can be
used.
[0118] The preferred thermostable ligase is that derived from
Thermus aquaticus. This enzyme can be isolated from that organism.
M. Takahashi, et al., "Thermophillic DNA Ligase," J. Biol. Chem.
259:10041-47 (1984), which is hereby incorporated by reference.
Alternatively, it can be prepared recombinantly. Procedures for
such isolation as well as the recombinant production of Thermus
aquaticus ligase as well as Thermus themophilus ligase) are
disclosed in WO 90/17239 to Barany, et. al., and F. Barany, et al.,
"Cloning, Overexpression and Nucleotide Sequence of a Thermostable
DNA-Ligase Encoding Gene," Gene 109: 1-11 (1991), which are hereby
incorporated by reference. These references contain complete
sequence information for this ligase as well as the encoding DNA.
Other suitable ligases include E. coli ligase, T4 ligase, Thermus
sp. AK16 ligase, Aquifex aeolicus ligase, Thermotoga maritima
ligase, and Pyrococcus ligase.
[0119] The ligation amplification mixture may include a carrier
DNA, such as salmon sperm DNA.
[0120] The hybridization step, which is preferably a thermal
hybridization treatment, discriminates between nucleotide sequences
based on a distinguishing nucleotide at the ligation junctions. The
difference between the target nucleotide sequences can be, for
example, a single nucleic acid base difference, a nucleic acid
deletion, a nucleic acid insertion, or rearrangement. Such sequence
differences involving more than one base can also be detected.
Preferably, the oligonucleotide probe sets have substantially the
same length so that they hybridize to target nucleotide sequences
at substantially similar hybridization conditions. As a result, the
process of the present invention is able to detect infectious
diseases, genetic diseases, and cancer. It is also useful in
environmental monitoring, forensics, and food science.
[0121] A wide variety of infectious diseases can be detected by the
process of the present invention. Typically, these are caused by
bacterial, viral, parasite, and fungal infectious agents. The
resistance of various infectious agents to drugs can also be
determined using the present invention.
[0122] Bacterial infectious agents which can be detected by the
present invention include Escherichia coli, Salmonella, Shigella,
Klebsiella, Pseudomonas, Listeria monocytogenes, Mycobacterium
tuberculosis, Mycobacterium avium-intracellulare, Yersinia,
Francisella, Pasteurella, Brucella, Clostridia, Bordetella
pertussis, Bacteroides, Staphylococcus aureus, Streptococcus
pneumonia, B-Hemolytic strep., Corynebacteria, Legionella,
Mycoplasma, Ureaplasma, Chlamydia, Neisseria gonorrhea, Neisseria
meningitides, Hemophilus influenza, Enterococcus faecalis, Proteus
vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema
palladium, Borrelia burgdorferi, Borrelia recurrentis, Rickettsial
pathogens, Nocardia, and Acitnomycetes.
[0123] Fungal infectious agents which can be detected by the
present invention include Cryptococcus neoformans, Blastomyces
dermatitidis, Histoplasma capsulatum, Coccidioides immitis,
Paracoccicioides brasiliensis, Candida albicans, Aspergillus
fumigautus, Phycomycetes (Rhizopus), Sporothrix schenckii,
Chromomycosis, and Maduromycosis.
[0124] Viral infectious agents which can be detected by the present
invention include human immunodeficiency virus, human T-cell
lymphocytotrophic virus, hepatitis viruses (e.g., Hepatitis B Virus
and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human
papillomaviruses, orthomyxo viruses, paramyxo viruses,
adenoviruses, corona viruses, rhabdo viruses, polio viruses, toga
viruses, bunya viruses, arena viruses, rubella viruses, and reo
viruses.
[0125] Parasitic agents which can be detected by the present
invention include Plasmodium falciparum, Plasmodium malaria,
Plasmodium vivax, Plasmodium ovale, Onchoverva volvulus,
Leishmania, Trypanosoma spp., Schistosoma spp., Entamoeba
histolytica, Cryptosporidum, Giardia spp., Trichimonas spp.,
Balatidium coli, Wuchereria bancrofti, Toxoplasma spp., Enterobius
vermicularis, Ascaris lumbricoides, Trichuris trichiura,
Dracunculus medinesis, trematodes, Diphyllobothrium latum, Taenia
spp., Pneumocystis carinii, and Necator americanis.
[0126] The present invention is also useful for detection of drug
resistance by infectious agents. For example, vancomycin-resistant
Enterococcus faecium, methicillin-resistant Staphylococcus aureus,
penicillin-resistant Streptococcus pneumoniae, multi-drug resistant
Mycobacterium tuberculosis, and AZT-resistant human
immunodeficiency virus can all be identified with the present
invention.
[0127] Genetic diseases can also be detected by the process of the
present invention. This can be carried out by prenatal screening
for chromosomal and genetic aberrations or post natal screening for
genetic diseases. Examples of detectable genetic diseases include:
21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome,
Turner Syndrome, Duchenne Muscular Dystrophy, Down Syndrome or
other trisomies, heart disease, single gene diseases, HLA typing,
phenylketonuria, sickle cell anemia, Tay-Sachs Syndrome,
thalassemia, Klinefelter's Syndrome, Huntington's Disease,
autoimmune diseases, lipidosis, obesity defects, hemophilia, inborn
errors in metabolism, and diabetes.
[0128] Cancers which can be detected by the process of the present
invention generally involve oncogenes, tumor suppressor genes, or
genes involved in DNA amplification, replication, recombination, or
repair. Examples of these include: BRCA1 gene, p53 gene, Familial
polyposis coli, Her2/Neu amplification, Bcr/Abl, K-ras gene, human
papillomavirus Types 16 and 18, leukemia, colon cancer, breast
cancer, lung cancer, prostate cancer, brain tumors, central nervous
system tumors, bladder tumors, melanomas, liver cancer,
osteosarcoma and other bone cancers, testicular and ovarian
carcinomas, ENT tumors, and loss of heterozygosity.
[0129] In the area of environmental monitoring, the present
invention can be used for detection, identification, and monitoring
of pathogenic and indigenous microorganisms in natural and
engineered ecosystems and microcosms such as in municipal waste
water purification systems and water reservoirs or in polluted
areas undergoing bioremediation. It is also possible to detect
plasmids containing genes that can metabolize xenobiotics, to
monitor specific target microorganisms in population dynamic
studies, or either to detect, identify, or monitor genetically
modified microorganisms in the environment and in industrial
plants.
[0130] The present invention can also be used in a variety or
forensic areas, including for human identification for military
personnel and criminal investigation, paternity testing and family
relation analysis, HLA compatibility typing, and screening blood,
sperm, or transplantation organs for contamination.
[0131] In the food and feed industry, the present invention has a
wide variety of applications. For example, it can be used for
identification and characterization of production organisms such as
yeast for production of beer, wine, cheese, yogurt, bread, etc.
Another area of use is with regard to quality control and
certification of products and processes (e.g., livestock,
pasteurization, and meat processing) for contaminants. Other uses
include the characterization of plants, bulbs, and seeds for
breeding purposes, identification of the presence of plant-specific
pathogens, and detection and identification of veterinary
infections.
[0132] Desirably, the oligonucleotide probes are suitable for
ligation together at a ligation junction when hybridized adjacent
to one another on a corresponding target nucleotide sequence due to
perfect complementarity at the ligation junction. However, when the
oligonucleotide probes in the set are hybridized to any other
nucleotide sequence present in the sample, there is a mismatch at a
base at the ligation junction which interferes with ligation. Most
preferably, the mismatch is at the base adjacent the 3' base at the
ligation junction. Alternatively, the mismatch can be at the bases
adjacent to bases at the ligation junction.
[0133] The process of the present invention is able to detect the
first and second nucleotide sequences in the sample in an amount of
100 attomoles to 250 femtomoles. By coupling the LDR step with a
primary polymerase-directed amplification step, the entire process
of the present invention is able to detect target nucleotide
sequences in a sample containing as few as a single molecule.
Furthermore, PCR amplified products, which often are in the
picomole amounts, may easily be diluted within the above range. The
ligase detection reaction achieves a rate of formation of
mismatched ligated product sequences which is less than 0.005 of
the rate of formation of matched ligated product sequences.
[0134] Once the ligation phase of the process is completed, the
capture phase is initiated. During the capture phase of the
process, the mixture is contacted with the solid support at a
temperature of 25-90.degree. C., preferably 60-80.degree. C., and
for a time period of 10-180 minutes, preferably up to 60 minutes.
Hybridizations may be accelerated or improved by mixing the
ligation mixture during hybridization, or by adding volume
exclusion, chaotropic agents, tetramethylammonium chloride, or
N,N,N, Trimethylglycine (Betaine monohydrate). When an array
consists of dozens to hundreds of addresses, it is important that
the correct ligation products have an opportunity to hybridize to
the appropriate address. This may be achieved by the thermal motion
of oligonucleotides at the high temperatures used, by mechanical
movement of the fluid in contact with the array surface, or by
moving the oligonucleotides across the array by electric fields.
After hybridization, the array is washed with buffer to remove
unhybridized probe and optimize detection of captured probe.
Alternatively, the array is washing sequentially.
[0135] Preferably, the solid support has a porous surface of a
hydrophilic polymer composed of combinations of acrylamide with
functional monomers containing carboxylate, aldehyde, or amino
groups. This surface is formed by coating the support with a
polyacrylamide based gel. Suitable formulations include mixtures of
acrylamide/acrylic acid and N,N-dimethylacrylamide/glycerol
monomethacrylate. A crosslinker, N,N'-methylenebisacryl-amide, is
present at a level less than 50:1, preferably less than 500:1.
[0136] One embodiment of masking negative charges during the
contacting of the solid support with the ligation mixture is
achieved by using a divalent cation. The divalent cation can be
Mg.sup.2+, Ca.sup.2+, MN.sup.2+, or Co.sup.2+. Typically, masking
with the divalent cation is carried out by pre-hydridizing the
solid support with hybridization buffer containing the cation at a
minimum concentration of 10 mM for a period of 15 minutes at room
temperature.
[0137] Another embodiment of masking negative charges during the
contacting of the solid support with the ligation mixtures is
achieved by carrying out the contacting at a pH at or below 6.0.
This is effected by adding a buffer to the ligation mixtures before
or during contact of it with the solid support. Suitable buffers
include 2-(N-morpholino)ethanesu- lfonic acid (MES), sodium
phosphate, and potassium phosphate.
[0138] Another embodiment of masking negative charges during the
contacting of the solid support with the ligation mixture is
achieved by capping free carboxylic acid groups with a neutralizing
agent while preserving the hydrophillicity of the polymer. Suitable
neutralizing agents include ethanolamine diethanolamine,
propanolamine, dipropanolamine, isopropanolamine, and
diisopropanolamine. Typically, masking with neutralizing agents is
carried out by activating the carboxylic acid groups within the
solid support with 1-[3-dimethylamino)propyl]-3-ethylcarbodiimide
hydrochloride and N-hydroxysuccinimide followed by treatment with a
solution of the neutralizing agent in a polar aprotic solvent such
as chloroform, dichloromethane, or tetrahydrfuran.
[0139] By masking the negative charges in accordance with the
present invention, an enhanced ability to detect the presence of
ligated product in the presence of unligated oligonucleotide probes
is achieved. In particular, the present invention is effective to
detect the presence of ligated product in a ratio to unligated
oligonucleotide probes of less than 1:300, preferably less than
1:900, more preferably less than 1:3000, and most preferably less
than 1:9000.
[0140] In addition, by masking the negative charges in accordance
with the present invention, an enhanced ability to detect the
presence of a target nucleotide sequence from a non-target
nucleotide sequence where the target nucleotide sequence differs
from a non-target nucleotide sequence by a single base difference
is achieved. In particular, the present invention is effective to
detect target nucleotide sequence in a ratio of the target
nucleotide sequence to non-target nucleotide sequence of less than
1:20, preferably less than 1:50, more preferably less than 1: 100,
most preferably less than 1:200.
[0141] It is important to select capture oligonucleotides and
addressable nucleotide sequences which will hybridize in a stable
fashion. This requires that the oligonucleotide sets and the
capture oligonucleotides be configured so that the oligonucleotide
sets hybridize to the target nucleotide sequences at a temperature
less than that which the capture oligonucleotides hybridize to the
addressable array-specific portions. Unless the oligonucleotides
are designed in this fashion, false positive signals may result due
to capture of adjacent unreacted oligonucleotides from the same
oligonucleotide set which are hybridized to the target.
[0142] The detection phase of the process involves scanning and
identifying if ligation of particular oligonucleotide sets occurred
and correlating ligation to a presence or absence of the target
nucleotide sequence in the test sample. Scanning can be carried out
by scanning electron microscopy, confocal microscopy,
charge-coupled device, scanning tunneling electron microscopy,
infrared microscopy, atomic force microscopy, electrical
conductance, and fluorescent or phosphor imaging. Correlating is
carried out with a computer.
[0143] Another aspect of the present invention relates to a method
of forming an array of oligonucleotides on a solid support. This
method involves providing a support having an array of positions
each suitable for attachment of an oligonucleotide. A linker or
support (preferably non-hydrolyzable), suitable for coupling an
oligonucleotide to the support at each of the array positions, is
attached to the solid support. An array of oligonucleotides on a
solid support is formed by a series of cycles of activating
selected array positions for attachment of multimer nucleotides and
attaching multimer nucleotides at the activated array
positions.
[0144] Yet another aspect of the present invention relates to an
array of oligonucleotides on a support per se. The solid support
has an array of positions each suitable for an attachment of an
oligonucleotide. A linker or support (preferably non-hydrolyzable),
suitable for coupling an oligonucleotide to the solid support, is
attached to the solid support at each of the array positions. An
array of oligonucleotides are placed on a solid support with at
least some of the array positions being occupied by
oligonucleotides having greater than sixteen nucleotides.
[0145] In the method of forming arrays, multimer oligonucleotides
from different multimer oligonucleotide sets are attached at
different array positions on a solid support. As a result, the
support has an array of positions with different groups of multimer
oligonucleotides attached at different positions.
[0146] The 1,000 different addresses can be unique capture
oligonucleotide sequences (e.g., 24-mer) linked covalently to the
target-specific sequence (e.g., approximately 20- to 25-mer) of a
LDR oligonucleotide probe. A capture oligonucleotide probe sequence
does not have any homology to either the target sequence or to
other sequences on genomes which may be present in the sample. This
oligonucleotide probe is then captured by its addressable
array-specific portion, a sequence complementary to the capture
oligonucleotide on the addressable solid support array. The concept
is shown in two possible formats, for example, for detection of the
p53 R248 mutation (FIGS. 13A-C).
[0147] FIGS. 13A-C show two alternative formats for oligonucleotide
probe design to identify the presence of a germ line mutation in
codon 248 of the p53 tumor suppressor gene. The wild type sequence
codes for arginine (R248), while the cancer mutation codes for
tryptophan (R248W). The bottom part of the diagram is a schematic
diagram of the capture oligonucleotide. The thick horizontal line
depicts the membrane or surface containing the addressable array.
The thin curved lines indicate a flexible linker arm. The thicker
lines indicate a capture oligonucleotide sequence, attached to the
solid surface in the C to N direction. For illustrative purposes,
the capture oligonucleotides are drawn vertically, making the
linker arm in section B appear "stretched". Since the arm is
flexible, the capture oligonucleotide will be able to hybridize 5'
to C and 3' to N in each case, as dictated by base pair
complementarity. A similar orientation of oligonucleotide
hybridization would be allowed if the oligonucleotides were
attached to the membrane at the N-terminus. In this case, DNA/PNA
hybridization would be in standard antiparallel 5' to 3' and 3' to
5'. Other modified sugar-phosphate backbones would be used in a
similar fashion. FIG. 13B shows two LDR probes that are designed to
discriminate wild type and mutant p53 by containing the
discriminating base C or T at the 3' end. In the presence of the
correct target DNA and Tth ligase, the discriminating probe is
covalently attached to a common downstream oligonucleotide. The
downstream oligonucleotide is fluorescently labeled. The
discriminating oligonucleotides are distinguished by the presence
of unique addressable array-specific portions, Z1 and Z2, at each
of their 5' ends. A black dot indicates that target dependent
ligation has taken place. After ligation, oligonucleotide probes
may be captured by their complementary addressable array-specific
portions at unique addresses on the array. Both ligated and
unreacted oligonucleotide probes are captured by the
oligonucleotide array. Unreacted fluorescently labeled common
primers and target DNA are then washed away at a high temperature
(approximately 65.degree. C. to 80.degree. C.) and low salt. Mutant
signal is. distinguished by detection of fluorescent signal at the
capture oligonucleotide complementary to addressable array-specific
portion Z1, while wild type signal-appears at the capture
oligonucleotide complementary to addressable array-specific portion
Z2. Heterozygosity is indicated by equal signals at the capture
oligonucleotides complementary to addressable array-specific
portions Z1 and Z2. The signals may be quantified using a
fluorescent imager. This format uses a unique address for each
allele and may be preferred for achieving very accurate detection
of low levels of signal (30 to 100 attomoles of LDR product). FIG.
13C shows the discriminating signals may be quantified using a
fluorescent imager. This format uses a unique address where
oligonucleotide probes are distinguished by having different
fluorescent groups, F1 and F2, on their 5' end. Either
oligonucleotide probe may be ligated to a common downstream
oligonucleotide probe containing an addressable array-specific
portion Z1 on its 3' end. In this format, both wild type and mutant
LDR products are captured at the same address on the array, and are
distinguished by their different fluorescence. This format allows
for a more efficient use of the array and may be preferred when
trying to detect hundreds of potential gemline mutations.
[0148] The solid support can be made from a wide variety of
materials. The substrate may be biological, nonbiological, organic,
inorganic, or a combination of any of these, existing as particles,
strands, precipitates, gels, sheets, tubing, spheres, containers,
capillaries, pads, slices, films, plates, slides, discs, membranes,
etc. The substrate may have any convenient shape, such as a disc,
square, circle, etc. The substrate is preferably flat but may take
on a variety of alternative surface configurations. For example,
the substrate may contain raised or depressed regions on which the
synthesis takes place. The substrate and its surface preferably
form a rigid support on which to carry out the reactions described
herein. The substrate and its surface is also chosen to provide
appropriate light-absorbing characteristics. For instance, the
substrate may be a polymerized Langmuir Blodgett film,
functionalized glass, Si, Ge, GaAs, GaP, SiO.sub.2, SiN.sub.4,
modified silicon, or any one of a wide variety of gels or polymers
such as (poly)tetrafluoroethyle- ne, (poly)vinylidenedifluoride,
polystyrene, polycarbonate, polyethylene, polypropylene, polyvinyl
chloride, poly(methyl acrylate), poly(methyl methacrylate), or
combinations thereof. Other substrate materials will be readily
apparent to those of ordinary skill in the art upon review of this
disclosure. In a preferred embodiment, the substrate is flat glass
or single-crystal silicon.
[0149] According to some embodiments, the surface of the substrate
is etched using well known techniques to provide for desired
surface features. For example, by way of the formation of trenches,
v-grooves, mesa structures, raised platforms, or the like, the
synthesis regions may be more closely placed within the focus point
of impinging light, be provided with reflective "mirror" structures
for maximization of light collection from fluorescent sources, or
the like.
[0150] Surfaces on the solid substrate will usually, though not
always, be composed of the same material as the substrate. Thus,
the surface may be composed of any of a wide variety of materials,
for example, polymers, plastics, ceramics, polysaccharides, silica
or silica-based materials, carbon, metals, inorganic glasses,
membranes, or composites thereof. The surface is functionalized
with binding members which are attached firmly to the surface of
the substrate. Preferably, the surface functionalities will be
reactive groups such as silanol, olefin, amino, hydroxyl, aldehyde,
keto, halo, acyl halide, or carboxyl groups. In some cases, such
functionalities preexist on the substrate. For example, silica
based materials have silanol groups, polysaccharides have hydroxyl
groups, and synthetic polymers can contain a broad range of
functional groups, depending on which monomers they are produced
from. Alternatively, if the substrate does not contain the desired
functional groups, such groups can be coupled onto the substrate in
one or more steps.
[0151] A variety of commercially-available materials, which include
suitably modified glass, plastic, or carbohydrate surfaces or a
variety of membranes, can be used. Depending on the material,
surface functional groups (e.g., silanol, hydroxyl, carboxyl,
amino) may be present from the outset (perhaps as part of the
coating polymer), or will require a separate procedure (e.g.,
plasma amination, chromic acid oxidation, treatment with a
functionalized side chain alkyltrichlorosilane) for introduction of
the functional group. Hydroxyl groups become incorporated into
stable carbamate (urethane) linkages by several methods. Amino
functions can be acylated directly, whereas carboxyl groups are
activated, e.g., with N,N'-carbonyldiimidazole or water-soluble
carbodiimides, and reacted with an amino-functionalized compound.
As shown in FIG. 11, the solid supports can be membranes or
surfaces with a starting functional group X. Functional group
transformations can be carried out in a variety of ways (as needed)
to provide group X* which represents one partner in the covalent
linkage with group Y*. FIG. 11 shows specifically the grafting of
PEG (i.e. polyethylene glycol), but the same repertoire of
reactions can be used (however needed) to attach carbohydrates
(with hydroxyl), linkers (with carboxyl), and/or oligonucleotides
that have been extended by suitable functional groups (amino or
carboxyl). In some cases, group X* or Y* is pre-activated
(isolatable species from a separate reaction); alternatively,
activation occurs in situ. Referring to PEG as drawn in FIG. 11, Y
and Y* can be the same (homobifunctional) or different
(heterobifunctional); in the latter case, Y can be protected for
further control of the chemistry. Unreacted amino groups will be
blocked by acetylation or succinylation, to ensure a neutral or
negatively charged environment that "repels" excess unhybridized
DNA. Loading levels can be determined by standard analytical
methods. Fields, et al., "Principles and Practice of Solid-Phase
Peptide Synthesis," Synthetic Peptides: A User's Guide, G. Grant,
Editor, W. H. Freeman and Co.: New York. p. 77-183 (1992), which is
hereby incorporated by reference.
[0152] One approach to applying functional groups on a silica-based
support surface is to silanize with a molecule either having the
desired functional group (e.g., olefin, amino, hydroxyl, aldehyde,
keto, halo, acyl halide, or carboxyl) or a molecule A able to be
coupled to another molecule B containing the desired functional
group. In the former case, functionalizing of glass- or
silica-based supports with, for example, an amino group is carried
out by reacting with an amine compound such as 3-aminopropyl
triethoxysilane, 3-aminopropylmethyldiethoxysilane, 3-aminopropyl
dimethylethoxysilane, 3-aminopropyl trimethoxysilane,
N-(2-aminoethyl)-3-aminopropylmethyl dimethoxysilane,
N-(2-aminoethyl-3-aminopropyl) trimethoxysilane, aminophenyl
trimethoxysilane, 4-aminobutyldimethyl methoxysilane, 4-aminobutyl
triethoxysilane, aminoethylaminomethyphenethyl trimethoxysilane, or
mixtures thereof. In the latter case, molecule A preferably
contains olefinic groups, such as vinyl, acrylate, methacrylate, or
allyl, while molecule B contains olefinic groups and the desired
functional groups. In this case, molecules A and B are polymerized
together. In some cases, it is desirable to modify the silanized
surface to modify its properties (e.g., to impart biocompatibility
and to increase mechanical stability). This can be achieved by
addition of olefinic molecule C along with molecule B to produce a
polymer network containing molecules A, B, and C.
[0153] Molecule A is defined by the following formula: 1
[0154] R.sup.1 is H or CH.sub.3
[0155] R.sup.2 is (C.dbd.O)--O--R.sup.6, aliphatic group with or
without functional substituent(s), an aromatic group with or
without functional substituent(s), or mixed aliphatic/aromatic
groups with or without functional substituent(s);
[0156] R.sup.3 is an O-alkyl, alkyl, or halogen group;
[0157] R.sup.4 is an O-alkyl, alkyl, or halogen group;
[0158] R.sup.5 is an O-alkyl, alkyl, or halogen group; and
[0159] R.sup.6 is an aliphatic group with or without functional
substituent(s), an aromatic group with or without functional
substituent(s), or mixed aliphatic/aromatic groups with or without
functional substituent(s). Examples of Molecule A include
3-(trimethoxysilyl)propyl methacrylate,
N-[3-(trimethoxysilyl)propyl]-N'-- (4-vinylbenzyl)ethylenediamine,
triethoxyvinylsilane, triethylvinylsilane, vinyltrichlorosilane,
vinyltrimethoxysilane, and vinylytrimethylsilane.
[0160] Molecule B can be any monomer containing one or more of the
functional groups described above. Molecule B is defined by the
following formula: 2
[0161] (i) R.sup.1 is H or CH.sub.3,
[0162] R.sup.2 is (C.dbd.O), and
[0163] R.sup.3 is OH or Cl.
[0164] or
[0165] (ii) R.sup.1 is H or CH.sub.3 and
[0166] R.sup.2 is (C.dbd.O)--O--R.sup.4, an aliphatic group with or
without functional substituent(s), an aromatic group with or
without functional substituent(s), and mixed aliphatic/aromatic
groups with or without functional substituent(s); and
[0167] R.sup.3 is a functional group, such as OH, COOH, NH.sub.2,
halogen, SH, COCl, or active ester; and
[0168] R.sup.4 is an aliphatic group with or without functional
substituent(s), an aromatic group with or without functional
substituent(s), or mixed aliphatic/aromatic groups with or without
functional substituent(s). Examples of molecule B include acrylic
acid, acrylamide, methacrylic acid, vinylacetic acid,
4-vinylbenzoic acid, itaconic acid, allyl amine, allylethylamine,
4-aminostyrene, 2-aminoethyl methacrylate, acryloyl chloride,
methacryloyl chloride, chlorostyrene, dichlorostyrene,
4-hydroxystyrene, hydroxymethyl styrene, vinylbenzyl alcohol, allyl
alcohol, 2-hydroxyethyl methacrylate, or poly(ethylene glycol)
methacrylate.
[0169] Molecule C can be any molecule capable of polymerizing to
molecule A, molecule B, or both and may optionally contain one or
more of the functional groups described above. Molecule C can be
any monomer or cross-linker, such as acrylic acid, methacrylic
acid, vinylacetic acid, 4-vinylbenzoic acid, itaconic acid, allyl
amine, allylethylamine, 4-aminostyrene, 2-aminoethyl methacrylate,
acryloyl chloride, methacryloyl chloride, chlorostyrene,
dichlorostyrene, 4-hydroxystyrene, hydroxymethyl styrene,
vinylbenzyl alcohol, allyl alcohol, 2-hydroxyethyl methacrylate,
poly(ethylene glycol) methacrylate, methyl acrylate, methyl
methacrylate, ethyl acrylate, ethyl methacrylate, styrene,
1-vinylimidazole, 2-vinylpyridine, 4-vinylpyridine, divinylbenzene,
ethylene glycol dimethacryarylate, N,N'-methylenediacrylamide,
N,N'-phenylenediacrylamide, 3,5-bis(acryloylamido)benzoic acid,
pentaerythritol triacrylate, trimethylolpropane trimethacrylate,
pentaerythritol tetraacrylate, trimethylolpropane ethoxylate (14/3
EO/OH) triacrylate, trimethyolpropane ethoxylate (7/3 EO/OH)
triacrylate, triethylolpropane propoxylate (1 PO/OH) triacrylate,
or trimethyolpropane propoxylate (2 PO/PH triacrylate).
[0170] Generally, the functional groups serve as starting points
for oligonucleotides that will ultimately be coupled to the
support. These functional groups can be reactive with an organic
group that is to be attached to the solid support or it can be
modified to be reactive with that group, as through the use of
linkers or handles. The functional groups can also impart various
desired properties to the support.
[0171] After functionalization (if necessary) of the support,
tailor-made polymer networks containing activated functional groups
that may serve as carrier sites for complementary oligonucleotide
capture probes can be grafted to the support. The advantage of this
approach is that the loading capacity of capture probes can thus be
increased significantly, while physical properties of the
intermediate solid-to-liquid phase can be controlled better.
Parameters that are subject to optimization include the type and
concentration of functional group-containing monomers, as well as
the type and relative concentration of the crosslinkers that are
used.
[0172] The surface of the functionalized substrate is preferably
provided with a layer of linker molecules, although it will be
understood that the linker molecules are not required elements of
the invention. The linker molecules are preferably of sufficient
length to permit polymers in a completed substrate to interact
freely with molecules exposed to the substrate. The linker
molecules should be 6-50 atoms long to provide sufficient exposure.
The linker molecules may be, for example, aryl acetylene, ethylene
glycol oligomers containing 2-10 monomer units, diamines, diacids,
amino acids, or combinations thereof.
[0173] According to alternative embodiments, the linker molecules
are selected based upon their hydrophilic/hydrophobic properties to
improve presentation of synthesized polymers to certain receptors.
For example, in the case of a hydrophilic receptor, hydrophilic
linker molecules will be preferred to permit the receptor to
approach more closely the synthesized polymer.
[0174] According to another alternative embodiment, linker
molecules are also provided with a photocleavable group at any
intermediate position. The photocleavable group is preferably
cleavable at a wavelength different from the protective group. This
enables removal of the various polymers following completion of the
syntheses by way of exposure to the different wavelengths of
light.
[0175] The linker molecules can be attached to the substrate via
carbon-carbon bonds using, for example,
(poly)tri-fluorochloroethylene surfaces or, preferably, by siloxane
bonds (using, for example, glass or silicon oxide surfaces).
Siloxane bonds with the surface of the substrate may be formed in
one embodiment via reactions of linker molecules bearing
trichlorosilyl groups. The linker molecules may optionally be
attached in an ordered array, i.e., as parts of the head groups in
a polymerized monolayer. In alternative embodiments, the linker
molecules are adsorbed to the surface of the substrate.
[0176] It is often desirable to introduce a PEG spacer with
complementary functionalization, prior to attachment of the
starting linker for DNA or PNA synthesis. G. Barany, et al., "Novel
Polyethylene Glycol-polystyrene (PEG-PS) Graft Supports for
Solid-phase Peptide Synthesis," ed. C. H. Schneider and A. N.
Eberle., Leiden, The Netherlands: Escom Science Publishers. 267-268
(1993); Zalipsky, et al., "Preparation and Applications of
Polyethylene Glycol-polystyrene Graft Resin Supports for
Solid-phase Peptide Synthesis," Reactive Polymers, 22:243-58
(1994); J. M. Harris, ed. "Poly(Ethylene Glycol) Chemistry:
Biotechnical and Biomedical Applications," (1992), Plenum Press:
New York, which are hereby incorporated by reference. Similarly,
dextran layers can be introduced as needed. Cass, et al., "Pilot, A
New Peptide Lead Optimization Technique and Its Application as a
General Library Method, in Peptides--Chemistry, Structure and
Biology: Proceedings of the Thirteenth American Peptide Symposium",
R. S. Hodges and J. A. Smith, Editor. (1994), Escom: Leiden, The
Netherlands; Lofas, et al., "A Novel Hydrogel Matrix on Gold
Surface Plasma Resonance Sensors for Fast and Efficient Covalent
Immobilization of Ligands," J. Chem. Soc. Chem. Commun., pp.
1526-1528 (1990), which are hereby incorporated by reference.
Particularly preferred linkers are tris(alkoxy)benzyl carbonium
ions with dilute acid due to their efficient and specific trapping
with indole moieties. DNA oligonucleotides can be synthesized and
terminated with a residue of the amino acid tryptophan, and
conjugated efficiently to supports that have been modified by
tris(alkoxy)benzyl ester (hypersensitive acid labile ("HAL")) or
tris(alkoxy)benzylamide ("PAL") linkers [F. Albericio, et al., J.
Org. Chem., 55:3730-3743(1990); F. Albericio and G. Barany,
Tetrahedron Lett., 32:1015-1018 (1991)], which are hereby
incorporated by reference). Other potentially rapid chemistries
involve reaction of thiols with bromoacetyl or maleimido functions.
In one variation, the terminus of amino functionalized DNA is
modified by bromoacetic anhydride, and the bromoacetyl function is
captured by readily established thiol groups on the support.
Alternatively, an N-acetyl, S-tritylcysteine residue coupled to the
end of the probe provides, after cleavage and depiotection, a free
thiol which can be captured by a maleimido group on the support. As
shown in FIG. 12, chemically synthesized probes can be extended, on
either end. Further variations of the proposed chemistries are
readily envisaged. FIG. 12A shows that an amino group on the probe
is modified by bromoacetic anhydride; the bromoacetyl function is
captured by a thiol group on the support. FIG. 12B shows that an
N-acetyl, S-tritylcysteine residue coupled to the end of the probe
provides, after cleavage and deprotection, a free thiol which is
captured by a maleimido group on the support. FIG. 12C shows a
probe containing an oligo-tryptophanyl tail (n=1 to 3), which is
captured after treatment of a HAL-modified solid support with
dilute acid.
[0177] To prepare the arrays of the present invention, the solid
supports must be charged with DNA oligonucleotides or PNA
oligomers. This is achieved either by attachment of pre-synthesized
probes, or by direct assembly and side-chain deprotection (without
release of the oligomer) onto the support. Further, the support
environment needs to be such as to allow efficient hybridization.
Toward this end, two factors may be identified: (i) sufficient
hydrophilic character of support material (e.g., PEG or
carbohydrate moieties) and (ii) flexible linker arms (e.g.,
hexaethylene oxide or longer PEG chains) separating the probe from
the support backbone. It should be kept in mind that numerous
ostensibly "flat surfaces" are quite thick at the molecular level.
Lastly, it is important that the support material not provide
significant background signal due to non-specific binding or
intrinsic fluorescence.
[0178] The linker molecules and monomers used herein are provided
with a functional group to which is bound a protective group.
Preferably, the protective group is on the distal or terminal end
of the linker molecule opposite the substrate. The protective group
may be either a negative protective group (i.e., the protective
group renders the linker molecules less reactive with a monomer
upon exposure) or a positive protective group (i.e., the protective
group renders the linker molecules more reactive with a monomer
upon exposure). In the case of negative protective groups, an
additional step of reactivation will be required. In some
embodiments, this will be done by heating.
[0179] The protective group on the linker molecules may be selected
from a wide variety of positive light-reactive groups preferably
including nitro aromatic compounds such as o-nitrobenzyl
derivatives or benzylsulfonyl. In a preferred embodiment,
6-nitroveratryloxycarbonyl ("NVOC"), 2-nitrobenzyloxycarbonyl
("NBOC"), Benzyloxycarbonyl ("BOC"), fluorenylmethoxycarbonyl
("FMOC"), or .alpha., .alpha.-dimethyl-dimethoxy- benzyloxycarbonyl
("DDZ") is used. In one embodiment, a nitro aromatic compound
containing a benzylic hydrogen ortho to the nitro group is used,
i.e., a chemical of the form: 3
[0180] where R.sub.1 is alkoxy, alkyl, halo, aryl, alkenyl, or
hydrogen; R.sub.2 is alkoxy, alkyl, halo, aryl, nitro, or hydrogen;
R.sub.3 is alkoxy, alkyl, halo, nitro, aryl, or hydrogen; R.sub.4
is alkoxy, alkyl, hydrogen, aryl, halo, or nitro; and R.sub.5 is
alkyl, alkynyl, cyano, alkoxy, hydrogen, halo, aryl, or alkenyl.
Other materials which may be used include o-hydroxy-.alpha.-methyl
cinnamoyl derivatives. Photoremovable protective groups are
described in, for example, Patchornik, J. Am. Chem. Soc. 92:6333
(1970) and Amit et al., J. Org. Chem. 39:192 (1974), both of which
are hereby incorporated by reference.
[0181] In an alternative embodiment, the positive reactive group is
activated for reaction with reagents in solution. For example, a
5-bromo-7-nitro indoline group, when bound to a carbonyl, undergoes
reaction upon exposure to light at 420 nm.
[0182] In a second alternative embodiment, the reactive group on
the linker molecule is selected from a wide variety of negative
light-reactive groups including a cinnamete group.
[0183] Alternatively, the reactive group is activated or
deactivated by electron beam lithography, x-ray lithography, or any
other radiation. A suitable reactive group for electron beam
lithography is a sulfonyl group. Other methods may be used
including, for example, exposure to a current source. Other
reactive groups and methods of activation may be used in view of
this disclosure.
[0184] The linking molecules are preferably exposed to, for
example, light through a suitable mask using photolithographic
techniques of the type known in the semiconductor industry and
described in, for example, Sze, VLSI Technology, McGraw-Hill
(1983), and Mead et al., Introduction to VLSI Systems,
Addison-Wesley (1980), which are hereby incorporated by reference
for all purposes. The light may be directed at either the surface
containing the protective groups or at the back of the substrate,
so long as the substrate is transparent to the wavelength of light
needed for removal of the protective groups.
[0185] The mask is in one embodiment a transparent support material
selectively coated with a layer of opaque material. Portions of the
opaque material are removed, leaving opaque material in the precise
pattern desired on the substrate surface. The mask is brought
directly into contact with the substrate surface. "Openings" in the
mask correspond to locations on the substrate where it is desired
to remove photoremovable protective groups from the substrate.
Alignment may be performed using conventional alignment techniques
in which alignment marks are used accurately to overlay successive
masks with previous patterning steps, or more sophisticated
techniques may be used. For example, interferometric techniques
such as the one described in Flanders et al., "A New
Interferometric Alignment Technique." App. Phys. Lett. 31:426-428
(1977), which is hereby incorporated by reference, may be used.
[0186] To enhance contrast of light applied to the substrate, it is
desirable to provide contrast enhancement materials between the
mask and the substrate according to some embodiments. This contrast
enhancement layer may comprise a molecule which is decomposed by
light such as quinone diazide or a material which is transiently
bleached at the wavelength of interest. Transient bleaching of
materials will allow greater penetration where light is applied,
thereby enhancing contrast. Alternatively, contrast enhancement may
be provided by way of a cladded fiber optic bundle.
[0187] The light may be from a conventional incandescent source, a
laser, a laser diode, or the like. If non-collimated sources of
light are used, it may be desirable to provide a thick- or
multi-layered mask to prevent spreading of the light onto the
substrate. It may, further, be desirable in some embodiments to
utilize groups which are sensitive to different wavelengths to
control synthesis. For example, by using groups which are sensitive
to different wavelengths, it is possible to select branch positions
in the synthesis of a polymer or eliminate certain masking
steps.
[0188] Alternatively, the substrate may be translated under a
modulated laser or diode light source. Such techniques are
discussed in, for example, U.S. Pat. No. 4,719,615 to Feyrer et
al., which is hereby incorporated by reference. In alternative
embodiments, a laser galvanometric scanner is utilized. In other
embodiments, the synthesis may take place on or in contact with a
conventional liquid crystal (referred to herein as a "light valve")
or fiber optic light sources. By appropriately modulating liquid
crystals, light may be selectively controlled to permit light to
contact selected regions of the substrate. Alternatively, synthesis
may take place on the end of a series of optical fibers to which
light is selectively applied. Other means of controlling the
location of light exposure will be apparent to those of skill in
the art.
[0189] The development of linkers and handles for peptide synthesis
is described in Fields, et al., "Principles and Practice of
Solid-Phase Peptide Synthesis, "Synthetic Peptides: A User's Guide,
G. Grant, Editor. W. H. Freeman and Co.: New York. p. 77-183
(1992); G. Barany, et al., "Recent Progress on Handles and Supports
for Solid-phase Peptide Synthesis", Peptides-Chemistry, Structure
and Biology: Proceedings of the Thirteenth American Peptide
Symposium, R. S. Hodges and J. A. Smith, Editor. Escom Science
Publishers: Leiden, The Netherlands pp.1078-80 (1994) , which are
hereby incorporated by reference. This technology is readily
extendable to DNA and PNA. Of particular interest is the
development of PAL (Albericio, et al., "Preparation and Application
of the
5-(4-(9-Fluorenylmethyloxycarbonyl)Aminomethyl-3,5-Dimethoxyphenoxy)V-
aleric Acid (PAL) Handle for the Solid-phase Synthesis of
C-terminal Peptide Amides under Mild Conditions," J. Org. Chem.,
55:3730-3743 (1990), which is hereby incorporated by reference, and
ester (HAL) (Albericio, et al., "Hypersensitive Acid-labile (HAL)
Tris(alkoxy)Benzyl Ester Anchoring for Solid-phase Synthesis of
Protected Peptide Segments," Tetrahedron Lett., 32:1015-1018
(1991), which is hereby incorporated by reference, linkages, which
upon cleavage with acid provide, respectively, C-terminal peptide
amides, and protected peptide acids that can be used as building
blocks for so-called segment condensation approaches. The
stabilized carbonium ion generated in acid from cleavage of PAL or
HAL linkages can be intercepted by tryptophanyl-peptides. While
this reaction is a nuisance for peptide synthesis and preventable
(in part) by use of appropriate scavengers, it has the positive
application of chemically capturing oligo-Trp-end-labelled DNA and
PNA molecules by HAL-modified surfaces.
[0190] The art recognizes several approaches to making
oligonucleotide arrays. Southern, et al., "Analyzing and Comparing
Nucleic Acid Sequences by Hybridization to Arrays of
Oligonucleotides: Evaluation using Experimental Models," Genomics,
13:1008-1017 (1992); Fodor, et al., "Multiplexed Biochemical Assays
with Biological Chips," Nature, 364:555-556 (1993); Khrapko, et
al., "A Method for DNA Sequencing by Hybridization with
Oligonucleotide Matrix," J. DNA Seq. Map., 1:375-388 (1991); Van
Ness, et al., "A Versatile Solid Support System for
Oligodeoxynucleoside Probe-based Hybridization Assays," Nucleic
Acids Res., 19:3345-3350 (1991); Zhang, et al., "Single-base
Mutational Analysis of Cancer and Genetic Diseases Using Membrane
Bound Modified Oligonucleotides," Nucleic Acids Res., 19:3929-3933
(1991); K. Beattie, "Advances in Genosensor Research," Clin. Chem.
41(5):700-06 (1995), which are hereby incorporated by reference.
These approaches may be divided into three categories: (i)
Synthesis of oligonucleotides by standard methods and their
attachment one at a time in a spatial array; (ii) Photolithographic
masking and photochemical deprotection on a silicon chip, to allow
for synthesis of short oligonucleotides (Fodor, et al.,
"Multiplexed Biochemical Assays with Biological Chips," Nature,
364:555-556 (1993) and R. J. Lipshutz, et al., "Using
Oligonucleotide Probe Arrays To Assess Genetic Diversity,"
Biotechniques 19:442-447 (1995), which are hereby incorporated by
reference); and (iii) Physical masking to allow for synthesis of
short oligonucleotides by addition of single bases at the unmasked
areas (Southern, et al., "Analyzing and Comparing Nucleic Acid
Sequences by Hybridization to Arrays of Oligonucleotides:
Evaluation Using Experimental Models," Genomics, 13:1008-1017
(1992); Maskos, et al., "A Study of Oligonucleotide Reassociation
Using Large Arrays of Oligonucleotides Synthesised on a Glass
Support," Nucleic Acids Res., 21:4663-4669 (1993), which are hereby
incorporated by reference).
[0191] Although considerable progress has been made in constructing
oligonucleotide arrays, some containing as many as 256 independent
addresses, these procedures are less preferred, for detecting
specific DNA sequences by hybridizations. More particularly, arrays
containing longer oligonucleotides can currently be synthesized
only by attaching one address at a time and, thus, are limited in
potential size. Current methods for serially attaching an
oligonucleotide take about 1 hour, thus an array of 1,000 addresses
would require over 40 days of around-the-clock work to prepare.
Arrays containing short oligonucleotides of 8- to 10-mers do not
have commercial applicability, because longer molecules are needed
to detect single base differences effectively.
[0192] These prior procedures may still be useful to prepare said
supports carrying an array of oligonucleotides for the method of
detection of the present invention. However, there are more
preferred approaches.
[0193] It is desirable to produce a support with a good loading of
oligonucleotide or PNA oligomer in a relatively small, but
well-defined area. Current, commercially available fluorescent
imagers can detect a signal as low as 3 attomoles per 50 .mu.m
square pixel. Thus, a reasonable size address or "spot" on an array
would be about 4.times.4 pixels, or 200 .mu.m square. Smaller
addresses could be used with CCD detection. The limit of detection
for such an address would be about 48 attomoles per "spot", which
is comparable to the 100 attomole detection limit using a
fluorescent DNA sequencing machine. The capacity of
oligonucleotides which can be loaded per 200 .mu.m square will give
an indication of the potential signal to noise ratio. A loading of
20 fmoles would give a signal to noise ratio of about 400 to 1,
while 200 fmoles would allow for a superb signal to noise ratio of
about 4000 to 1. The oligonucleotide or PNA oligomer should be on a
flexible "linker arm" and on the "outside" or "surface" of the
solid support for easier hybridizations. The support should be
non-fluorescent, and should not interfere with hybridization nor
give a high background signal due to nonspecific binding.
[0194] The complementary capture oligonucleotide addresses on the
solid supports can be either DNA or PNA. PNA-based capture is
preferred over DNA-based capture, because PNA/DNA duplexes are much
stronger than DNA/DNA duplexes, by about 1.degree. C./base-pair. M.
Egholm, et al., "PNA Hybridizes to Complementary Oligonucleotides
Obeying the Watson-Crick Hydrogen-bonding Rules," Nature,
365:566-568 (1993), which is hereby incorporated by reference.
Thus, for a 24-mer DNA/DNA duplex with T.sub.m=72.degree. C., the
corresponding duplex with one PNA strand would have a "predicted"
T.sub.m=96.degree. C. (the actual melting point might be slightly
lower as the above "rule of thumb" is less accurate as melting
points get over 80.degree. C.). Additionally, the melting
difference between DNA/DNA and PNA/DNA becomes even more striking
at low salt.
[0195] The melting temperature of DNA/DNA duplexes can be estimated
as [4n(G.multidot.C)+2m(A.multidot.T)].degree. C. Oligonucleotide
capture can be optimized by narrowing the Tm difference between
duplexes formed by capture oligonucleotides and the complementary
addressable array-specific portions hybridized to one another
resulting from differences in G.multidot.C/A.multidot.T content.
Using 5-propynyl-dU in place of thymine increases the T.sub.m of
DNA duplexes an average of 1.7.degree. C. per substitution.
Froehler, et al., "Oligonucleotides Containing C-5 Propyne Analogs
of 2'-deoxyuridine and 2'-deoxycytidine," Tetrahedron Lett.,
33:5307-5310 (1992) and J. Sagi, et al., Tetrahedron Letters,
34:2191 (1993), which are hereby incorporated by reference. The
same substitution in the capture scheme should lower the T.sub.m
difference between the components of such duplexes and raise the
T.sub.m for all of the duplexes. Phosphoramidite derivatives of
5-propynyl-dU having the following structure can be prepared
according to the immediately preceding Froehler and Sagi
references, which are hereby incorporated by reference. 4
[0196] The 5-propynyluracil PNA monomer with Fmoc amino protection
can be made by the following synthesis (where DMF is
N,N'-dimethylformamide, DCC is N,N'-dicyclohexylcarbodiimide, HOBt
is 1-hydroxybenzotriazole, and THF is tetrahydrofuran): 5
[0197] Using the methods described by Egholm, et al., "Peptide
Nucleic Acids (PNA). Oligonucleotide Analogues with an Achiral
Peptide Backbone," J. Am. Chem. Soc., 114:1895-1897 (1992) and
Egholm, et al., "Recognition of Guanine and Adenine in DNA by
Cytosine and Thymine Containing Peptide Nucleic Acids (PNA)," J.
Am. Chem. Soc., 114:9677-9678 (1992), which are hereby incorporated
by reference. The synthesis scheme above describes the preparation
of a PNA monomer having a 5-propynyl-uracil base component.
5-Iodouracil is first alkylated with iodoacetic acid, and, then,
the propynl group is coupled to the base moiety by a Pd/Cu
catalyst. The remaining steps in the scheme follow from the
above-referenced methods. These monomers can be incorporated into
synthetic DNA and PNA strands.
[0198] There are two preferred general approaches for synthesizing
arrays. In the first approach, full-length DNA oligonucleotides or
PNA oligomers are prepared and are subsequently linked covalently
to a solid support or membrane. In the second approach, specially
designed PNA oligomers or DNA oligonucleotides are constructed by
sequentially adding multimers to the support. These multimers are
added to specific rows or columns on a solid support or membrane
surface. The resulting "checkerboard" pattern generates unique
addressable arrays of full length PNA or DNA.
[0199] FIGS. 14-16 show different modes of preparing full-length
DNA oligonucleotides or PNA oligomers and, subsequently, linking
those full length molecules to the solid support.
[0200] FIGS. 14A-E depict a method for constructing an array of DNA
or PNA oligonucleotides by coupling individual full-length
oligonucleotides to the appropriate locations in a grid. The array
of FIG. 14A shows the pattern of oligonucleotides that would be
generated if oligonucleotides are coupled to sixteen 200
.mu.m.times.200 .mu.m regions of the array surface. Each individual
200 .mu.m.times.200 .mu.m region contains DNA or PNA with a unique
sequence which is coupled to the surface. The individual square
regions will be separated from adjacent squares by 200 .mu.m. The
array of FIG. 14A can thus support 64 (8.times.8) different
oligonucleotides in an 3 mm by 3 mm area. In order to multiplex the
construction of the array, 16 squares separated by a distance of
800 .mu.m will be coupled simultaneously to their specific
oligonucleotides. Therefore, the 8.times.8 grid could be
constructed with only 4 machine steps as shown in FIGS. 14B-14E. In
these diagrams, the dark squares represent locations that are being
altered in the current synthesis step, while the hatched squares
represent regions which have been synthesized in earlier steps. The
first step (FIG. 14B) would immobilize oligonucleotides at
locations A1, E1, 11, M1, A5, E5, 15, M5, A9, E9, 19, M9, A13, E13,
I13, and M13 simultaneously. In the next step (FIG. 14C), the
machine would be realigned to start in Column C. After having
completed Row 1, the next step (FIG. 14D) would start at Row 3.
Finally, the last 16 oligonucleotides would be immobilized in order
to complete the 8.times.8 grid (FIG. 14E). Thus, the construction
of the 8.times.8 array could be reduced to 4 synthesis steps
instead of 64 individual spotting reactions. This method would be
easily extended and an apparatus capable of spotting 96 oligomers
simultaneously could be used rapidly to construct larger
arrays.
[0201] FIGS. 15A-E represent a perspective dimensional view of the
array construction process described in FIG. 14. In FIGS. 15A-E,
the construction of a 4.times.4 (16) array using a machine capable
of spotting four different 24-mers simultaneously is depicted.
First, as shown in FIG. 15A, the machine attaches 4 oligomers at
locations A1, E1, A5, and E5. Next, as shown in FIG. 15B, the
machine is shifted horizontally and attaches 4 oligomers at
locations C1, G1, C5, and G5. Next, as shown in FIG. 15C, the
machine is repositioned and attaches 4 oligomers at locations A3,
E3, A7, and E7. Finally, as shown in FIG. 15D, the machine attaches
the 4 remaining oligomers at positions C3, G3, C7, and G7. The
completed array contains sixteen 24-mers as shown in the
perspective view of FIG. 15E.
[0202] FIGS. 16A-C show views for an application apparatus 2
capable of simultaneously coupling 16 different oligonucleotides to
different positions on an array grid G as shown in FIG. 14. The
black squares in the top view (FIG. 16A) represent sixteen 200
.mu.m.times.200 .mu.m regions that are spatially separated from
each other by 600 .mu.m. The apparatus shown has 16 input ports
which would allow tubes containing different oligonucleotides to
fill the funnel-shaped chambers above different locations on the
array. The side views (FIGS. 16B-C, taken along lines 16B-16B and
16C-16C, of FIG. 16A, respectively) of the apparatus demonstrate
that funnel shaped chambers 4 align with the appropriate region on
the array below the apparatus. In addition, two valves 6 and 8
(hatched squares in FIGS. 16A-C) control the flow of fluid in the
16 independent reaction chambers. One valve 6 controls the entry of
fluids from the input port 10, while the other valve 8 would be
attached to a vacuum line 12 in order to allow loading and clearing
of the reaction chamber 4. The apparatus would first be aligned
over the appropriate 200 .mu.m.times.200 .mu.m regions of the
array. Next, the entire apparatus is firmly pressed against the
array, thus forming a closed reaction chamber above each location.
The presence of raised 10 .mu.m ridges R around each location on
the array ensures the formation of a tight seal which would prevent
leakage of oligomers to adjacent regions on the array. Next, the
valve 8 to vacuum line 12 would be opened, while the valve 10 from
the input solution port 10 would be closed. This would remove air
from the reaction chamber 4 and would create a negative pressure in
the chamber. Then, the valve 8 to vacuum line 12 would be closed
and the valve 10 from the input solution port 10 would be opened.
The solution would flow into the reaction chamber 4 due to negative
pressure. This process eliminates the possibility of an air bubble
forming within the reaction chamber 4 and ensures even distribution
of oligonucleotides across the 200 .mu.m.times.200 .mu.m region.
After the oligonucleotides have been coupled to the activated array
surface, the input valve 6 would be closed, the valve 8 to vacuum
line 12 would be opened, and the apparatus would be lifted from the
array surface in order to remove completely any excess solution
from the reaction chamber. A second apparatus can now be realigned
for the synthesis of the next 16 locations on the array.
[0203] FIGS. 15 to 26 show different modes of constructing PNA
oligomers or DNA oligonucleotides on a solid support by
sequentially adding, respectively, PNA or DNA, multimers to the
support.
[0204] As an example of assembling arrays with multimers, such
assembly can be achieved with tetramers. Of the 256 (4.sup.4)
possible ways in which four bases can be arranged as tetramers, 36
that have unique sequences can be selected. Each of the chosen
tetramers differs from all the others by at least two bases, and no
two dimers are complementary to each other. Furthermore, tetramers
that would result in self-pairing or hairpin formation of the
addresses have been eliminated.
[0205] The final tetramers are listed in Table 1 and have been
numbered arbitrarily from 1 to 36. This unique set of tetramers are
used as design modules for the sometimes desired 24-mer capture
oligonucleotide address sequences. The structures can be assembled
by stepwise (one base at a time) or convergent (tetramer building
blocks) synthetic strategies. Many other sets of tetramers may be
designed which follow the above rules. The segment approach is not
uniquely limited to tetramers, and other units, i.e. dimers,
trimers, pentamers, or hexamers could also be used.
1TABLE 1 List of tetramer PNA sequences and complementary DNA
sequences, which differ from each other by at least 2 bases.
Complement Number Sequence (N-C) (5'-3') G + C 1. TCTG CAGA 2 2.
TGTC GACA 2 3. TCCC GGGA 3 4. TGCG CGCA 3 5. TCGT ACGA 2 6. TTGA
TCAA 1 7. TGAT ATCA 1 8. TTAG CTAA 1 9. CTTG CAAG 2 10. CGTT AACG 2
11. CTCA TGAG 2 12. CACG CGTG 3 13. CTGT ACAG 2 14. CAGC GCTG 3 15.
CCAT ATGG 2 16. CGAA TTCG 2 17. GCTT AAGC 2 18. GGTA TACC 2 19.
GTCT AGAC 2 20. GACC GGTC 3 21. GAGT ACTC 2 22. GTGC GCAC 3 23.
GCAA TTGC 2 24. GGAC GTCC 3 25. AGTG CACT 2 26. AATC GATT 1 27.
ACCT AGGT 2 28. ATCG CGAT 2 29. ACGG CCGT 3 30. AGGA TCCT 2 31.
ATAC GTAT 1 32. AAAG CTTT 1 33. CCTA TAGG 2 34. GATG CATC 2 35.
AGCC GGCT 3 36. TACA TGTA 1
[0206] Note that the numbering scheme for tetramers permits
abbreviation of each address as a string of six numbers (e.g.,
second column of Table 2 infra). The concept of a 24-mer address
designed from a unique set of 36 tetramers (Table 1) allows a huge
number of possible structures, 36.sup.6=2,176,782,336.
[0207] FIG. 17 shows one of the many possible designs of 36
tetramers which differ from each other by at least 2 bases. The
checkerboard pattern shows all 256 possible tetramers. A given
square represents the first two bases on the left followed by the
two bases on the top of the checkerboard. Each tetramer must differ
from each other by at least two bases, and should be
non-complementary. The tetramers are shown in the white boxes,
while their complements are listed as (number)'. Thus, the
complementary sequences GACC (20) and GGTC (20') are mutually
exclusive in this scheme. In addition, tetramers must be
non-palindromic, e.g., TCGA (darker diagonal line boxes), and
non-repetitive, e.g., CACA (darker diagonal line boxes from upper
left to lower right). All other sequences which differ from the 36
tetramers by only 1 base are shaded in light gray. Four potential
tetramers (white box) were not chosen as they are either all
A.multidot.T or G.multidot.C bases. However, as shown below, the
T.sub.m values of A.multidot.T bases can be raised to almost the
level of G.multidot.C bases. Thus, all A.multidot.T or G.multidot.C
base tetramers (including the ones in white boxes) could
potentially be used in a tetramer design. In addition, thymine can
be replaced by 5-propynyl uridine when used within capture
oligonucleotide address sequences as well as in the oligonucleotide
probe addressable array-specific portions. This would increase the
T.sub.m of an A.multidot.T base pair by .about.1.7.degree. C. Thus,
T.sub.m values of individual tetramers should be approximately
15.1.degree. C. to 15.7.degree. C. Tm values for the full length
24-mers should be 95.degree. C. or higher.
[0208] To illustrate the concept, a subset of six of the 36
tetramer sequences were used to construct arrays: 1=TGCG; 2=ATCG;
3=CAGC; 4=GGTA; 5=GACC; and 6=ACCT. This unique set of tetramers
can be used as design modules for the required 24-mer addressable
array-specific portion and 24-mer complementary capture
oligonucleotide address sequences. This embodiment involves
synthesis of five addressable array-specific portion (sequences
listed in Table 2). Note that the numbering scheme for tetramers
allows abbreviation of each portion (referred to as "Zip #") as a
string of six numbers (referred to as "zip code").
2TABLE 2 List of all 5 DNA/PNA oligonucleotide address sequences.
Zip # Zip code Sequence (5' .fwdarw.3' or NH.sub.2 .fwdarw. COOH) G
+ C Zip11 1-4-3-6-6-1 TGCG-GGTA-CAGC-ACCT-ACCT-TGCG (SEQ. ID. No.
1) 15 Zip12 2-4-4-6-1-1 ATCG-GGTA-GGTA-ACCT-TGCG-TGCG (SEQ. ID. No.
2) 14 Zip13 3-4-5-6-2-1 CAGC-GGTA-GACC-ACCT-ATCG-TGCG (SEQ. ID. No.
3) 15 Zip14 4-4-6-6-3-1 GGTA-GGTA-ACCT-ACCT-CAGC-TGCG (SEQ. ID. No.
4) 14 Zip15 5-4-1-6-4-1 GACC-GGTA-TGCG-ACCT-GGTA-TGCG (SEQ. ID. No.
5) 15
[0209] Each of these oligomers contains a hexaethylene oxide linker
arm on their 5' termini [P. Grossman, et al., Nucl. Acids Res.,
22:4527-4534 (1994), which is hereby incorporated by reference],
and ultimate amino-functions suitable for attachment onto the
surfaces of glass slides, or alternative materials. Conjugation
methods will depend on the free surface functional groups [Y.
Zhang, et al., Nucleic Acids Res., 19:3929-3933 (1991) and Z. Guo,
et al., Nucleic Acids Res., 34:5456-5465 (1994), which are hereby
incorporated by reference].
[0210] Synthetic oligonucleotides (normal and complementary
directions, either for capture hybridization or
hybridization/ligation) are prepared as either DNA or PNA, with
either natural bases or nucleotide analogues. Such analogues pair
with perfect complementarity to the natural bases but increase
T.sub.m values (e.g., 5-propynyl-uracil).
[0211] Each of the capture oligonucleotides have substantial
sequence differences to minimize any chances of
cross-reactivity--see FIG. 17 and Table 1. Rather than carrying out
stepwise synthesis to introduce bases one at a time, protected PNA
tetramers can be used as building blocks. These are easy to
prepare; the corresponding protected oligonucleotide intermediates
require additional protection of the internucleotide phosphate
linkages. Construction of the 24-mer at any given address requires
only six synthetic steps with a likely improvement in overall yield
by comparison to stepwise synthesis. This approach eliminates
totally the presence of failure sequences on the support, which
could occur when monomers are added one-at-a-time to the surface.
Hence, in contrast to previous technologies, the possibilities for
false signals are reduced. Moreover, since failure sequences at
each address are shorter and lacking at least four bases, there is
no risk that these will interfere with correct hybridization or
lead to incorrect hybridizations. This insight also means that
"capping" steps will not be necessary.
[0212] Masking technology will allow several addresses to be built
up simultaneously, as is explained below. As direct consequences of
the manufacturing process for the arrays, several further
advantages are noted. Each 24-mer address differs from its nearest
24-mer neighbor by three tetramers, or at least 6 bases. At low
salt, each base mismatch in PNA/DNA hybrids decreases the melting
temperature by 8.degree. C. Thus, the Tm for the correct PNA/DNA
hybridization is at least 48.degree. C. higher than any incorrect
hybridization. Also, neighboring 24-mers are separated by 12-mers,
which do not hybridize with anything and represent "dead" zones in
the detection profile. PNA addresses yield rugged, reusable
arrays.
[0213] The following description discloses the preparation of 36
unique PNA tetramers and shows the mechanical/chemical strategy to
prepare the arrays. This technique can be used to create a
5.times.5 array with 25 addresses of PNA 24-mers. Alternatively,
all 36 tetramers can be incorporated to generate full-size arrays
of 1,296 addresses.
[0214] FIGS. 18A-G are schematic diagrams showing addition of PNA
tetramers to generate a 5.times.5 array of unique 24 mer addresses.
The manufacturing device is able to add PNA tetramers in either
columns, or in rows, by rotating the multi-chamber device or
surface 90.degree.. A circular manifold allows circular permutation
of tetramer addition. Thus, complex unique addresses may be built
by using a simple algorithm. In the first tetramer addition, PNA
tetramers 1, 2, 3, 4, and 5 are linked to the surface in each of
the 5 columns, respectively as shown in FIG. 18A. After rotating
the chamber 90.degree., PNA tetramers 6, 5, 4, 3, and 2 are added
in adjacent rows, as shown in FIG. 18B. In the third step, as shown
in FIG. 18C, tetramers 3, 4, 5, 6, and 1 (note circular
permutation) are added in columns. In the 4th step, as shown in
FIG. 18D, tetramers 2, 1, 6, 5, and 4 are added in adjacent rows,
etc. This process continues in the manner shown in FIGS. 23E-G
described infra. The bottom of the diagram depicts tetramer
sequences which generate unique 24 mers at each position. The
middle row of sequences 1-4-3-6-6-1; 2-4-4-6-1-1; 3-4-5-6-2-1;
4-4-6-6-3 and 5-4-1-6-4-1 are shown in full length in Table 2. The
addition of tetramers in a circularly permuted fashion can be used
to generate larger arrays. Tetramer addition need not be limited to
circular patterns and can be added in many other combinations to
form unique addresses which differ from each other by at least 3
tetramers, which translates to at least 6 bases.
[0215] The present invention has greater specificity than existing
mutation detection methods which use allele-specific PCR,
differential hybridization, or sequencing-by-hybridization. These
methods rely on hybridization alone to distinguish single-base
differences in two otherwise identical oligonucleotides. The
signal-to-noise ratios for such hybridization are markedly lower
than those that can be achieved even with the two most
closely-related capture oligonucleotides in an array. Since each
address is designed by alternating tetramer addition in three rows
and three columns, a given address will differ by at least three
tetramers from its neighbor. Since each tetramer differs from every
other tetramer by at least 2 bases, a given address will differ
from another address by at least 6 bases. However, in practice,
most addresses will differ from most other addresses by
considerably more bases.
[0216] This concept is illustrated below using the two addresses,
Zip 12 and Zip 14. These two addresses are the most related among
the 25 addresses schematically represented in FIGS. 18 and 20
(discussed infra). These two addresses have in common tetramers on
every alternating position (shown as underlined):
3 Zip 12 (2-4-4-6-1-1) = 24 mer 5'-ATCG GGTA GGTA ACCT TGCG TGCG-3'
(SEQ. ID. No. 6) Zip 14 (4-4-6-6-3-1) = 24 mer 5'-GGTA GGTA ACCT
ACCT CAGC TGCG-3' (SEQ. ID. No. 7)
[0217] In addition, they have in common a string of 12 nucleotides,
as well as the last four in common (shown as underlined):
4 Zip 12 (2-4-4-6-1-1) = 24 mer 5'-ATCG GGTA GGTA ACCT TGCG TGCG-3'
(SEQ. ID. No. 8) Zip 14 (4-4-6-6-3-1) = 24 mer 5'-GGTA GGTA ACCT
ACCT CAGC TGCG-3' (SEQ. ID. No. 9)
[0218] Either representation has at least 8 differences between the
oligonucleotides. Although an oligonucleotide complementary to Zip
12 or Zip 14 at the underlined nucleotides could hybridize to both
of these addresses at a lower temperature (e.g., 37.degree. C.),
only the fully complementary oligonucleotide would hybridize at
elevated temperature (e.g., 70.degree. C.).
[0219] Furthermore, for other capture oligonucleotides, such as Zip
3, the number of shared nucleotides is much lower (shown as
underlined):
5 Zip 12 (2-4-4-6-1-1) = 24 mer 5'-ATCG GGTA GGTA ACCT TGCG TGCG-3'
(SEQ. ID. No. 10) Zip 3 (3-6-5-2-2-3) = 24 mer 5'-CAGC ACCT GACC
ATCG ATCG CAGC-3' (SEQ. ID. No. 11)
[0220] Therefore, the ability to discriminate Zip 12 from Zip 3
during hybridization is significantly greater than can be achieved
using any of the existing methods.
[0221] A multi-chamber device with alternating chambers and walls
(each 200 .mu.m thick) will be pressed onto the modified glass or
silicon surface of FIG. 19A prior to delivery of PNA tetramers into
either columns or rows. The surface will be etched to produce 10
.mu.m ridges (black lines) to eliminate leaking between chambers.
Initially, a flexible spacer (linker) is attached to the array
surface. In the first step, as shown in FIG. 19B, PNA tetramers, 1,
2, 3, 4, and 5 are linked to the surface in each of the five
columns, respectively. The multi-chamber device is then rotated
90.degree.. Tetramers 6, 5, 4, 3, and 2 are added in adjacent rows,
as shown in FIG. 19C. The process is repeated a total of three
times to synthesize 24-mer PNA oligomers. Each completed 24-mer
within a given row and column represents a unique PNA sequence,
hence achieving the desired addressable array. Smaller
oligonucleotide sequences represent half-size 12-mers which result
from 3 rounds of synthesis in the same direction. Since each 24-mer
differs from its neighbor by three tetramers and each tetramer
differs from another by at least 2 bases, then each 24-mer differs
from the next by at least 6 bases (i.e., 25% of the nucleotides
differ). Thus, a wrong address would have 6 mismatches in just 24
bases and, therefore, would not be captured at the wrong address,
especially under 75-80.degree. C. hybridization conditions. In
addition, while a particular smaller 12-mer sequence may be found
within a 24-mer sequence elsewhere on the grid, an addressable
array-specific portion will not hybridize to the 12-mer sequence at
temperatures above 50.degree. C.
[0222] The starting surfaces will contain free amino groups, a
non-cleavable amide linkage will connect the C-terminus of PNA to
the support, and orthogonal side-chain deprotection must be carried
out upon completion of segment condensation assembly in a way that
PNA chains are retained at their addresses. A simple masking device
has been designed that contains 200 .mu.m spaces and 200 .mu.m
barriers, to allow each of 5 tetramers to couple to the solid
support in distinct rows (FIG. 20A). After addition of the first
set of tetramers, the masking device is rotated 90.degree., and a
second set of 5 tetramers are added (FIG. 20B). This can be
compared to putting icing on a cake as rows, followed by icing as
columns. The intersections between the rows and columns will
contain more icing, likewise, each intersection will contain an
octamer of unique sequence. Repeating this procedure for a total of
6 cycles generates 25 squares containing unique 24-mers, and the
remaining squares containing common 12-mers (FIGS. 20C and 21A-F).
The silicon or glass surface will contain 10 .mu.m ridges to assure
a tight seal, and chambers will be filled under vacuum. A circular
manifold (FIG. 26) will allow for circular permutation of the six
tetramers prior to delivery into the five rows (or columns). This
design generates unique 24-mers which always differ from each other
by at least 3 tetramers, even though some sequences contain the
same 3 tetramers in a contiguous sequence. This masking device is
conceptually similar to the masking technique disclosed in
Southern, et al., Genomics, 13:1008-1017 (1992) and Maskos, et al.,
Nucleic Acids Res., 21:2267-2268 (1993), which are hereby
incorporated by reference, with the exception that the array is
built with tetramers as opposed to monomers.
[0223] Alternatively, the production of the incomplete 12-mer
sequences can be eliminated if a mask which isolates each location
is used. In the first step (as shown in FIG. 19D), PNA tetramers 1,
2, 3, 4, and 5 are linked to the surface in each of the five
columns respectively. The multi-chamber device is then rotated
90.degree.. Tetramers 6, 5, 4, 3, and 2 are added in adjacent rows,
as shown in FIG. 19E. The process is repeated a total of three
times to synthesize 24-mer PNA oligomers. Each completed 24-mer
within a given row and column represents a unique PNA sequence,
hence achieving the desired addressable array. In addition, each
24-mer will be separated from adjacent oligomers by a 200 .mu.m
region free of PNA oligomers.
[0224] A silicon or glass surface will be photochemically etched to
produce a crosshatched grid of 10 .mu.m raised ridges in a
checkerboard pattern (see FIG. 20). Alternate squares (200
.mu.m.times.200 .mu.m) will be activated, allowing for the
attachment of C.sub.18 alkyl spacers and PEG hydrophilic linkers
(MW 400-4,000), such that each square is separated by at least one
blank square and two ridges on all sides.
[0225] An example of a universal array using PNA tetramers can be
formed by adding 36 different tetramers to either 36 columns or
rows at the same time. The simplest way to add any tetramer to any
row is to have all 36 tetramer solutions attached by tubings to
minivalves to a circular manifold which has only one opening. The
other side of the circular manifold can be attached to any of 36
minivalves which go to individual rows (or columns). So by rotating
the manifold and minivalves to the chambers (rows), one can pump
any tetramer into any row, one at a time. This can be either a
mechanical device requiring physical rotation or, alternatively,
can be accomplished by using electronic microvalves along a series
of import (tetramers) and export (rows) channels. This process can
occur quite rapidly (5 seconds, including rinsing out the manifold
for its next use), so that it would take about 36.times.5=180 sec.
to add all 36 rows.
[0226] A potentially more rapid way of filling the rows or columns,
would be to fill all of them simultaneously. This is illustrated in
FIG. 20 for a 5.times.5 array. The silicon or glass surface will
contain 10 .mu.m ridges to assure a tight seal, and chambers will
be filled using the vacuum technique described above. A circular
manifold will allow for circular permutation of the six tetramers
prior to delivery into the five rows (or columns). In FIG. 20, the
first step is 5, 4, 3, 2, 1. When rotating the multi-chamber
device, one could continue to add in either numerical, or reverse
numerical order. In the example, a numerical order of 2, 3, 4, 5, 6
for the second step is used. In the third step, the circular
permutation (reverse) gives 1, 6, 5, 4, 3. Fourth step (forward) 4,
5, 6, 1, 2. Fifth step (reverse) 4, 3, 2, 1, 6. Sixth step
(forward) 5, 6, 1, 2, 3. This can be expanded to 36 tetramers into
36 rows (or columns). This approach limits the potential variations
in making the address for the array from 36.sup.6=2,176,782,336 in
every position to 36.sup.6=2,176,782,336 in one position, with the
other 1,295 positions now defined by the first address. This is
still a vast excess of the number of different addresses needed.
Furthermore, each address will still differ from every other
address by at least 6 nucleotides.
[0227] Note that all of these arrays can be manufactured in groups,
just as several silicon chips can be produced on the same wafer.
This is especially true of the tetramer concept, because this
requires adding the same tetramer in a given row or column. Thus,
one row could cover a line of ten arrays, so that a 10.times.10
grid=100 arrays could be manufactured at one time.
[0228] Alternatively, the process described with reference to FIG.
20 can be carried out with one less cycle to make a 20 mer
oligonucleotide. The capture oligonucleotide should be sufficiently
long to capture its complementary addressable array-specific
portion under the selected hybridization conditions.
[0229] FIGS. 21A-F show a schematic cross-sectional view of the
synthesis of an addressable array (legend). FIG. 21A shows
attachment of a flexible spacer (linker) to surface of array. FIG.
21B shows the synthesis of the first rows of oligonucleotide
tetramers. Only the first row, containing tetramer 1, is visible. A
multi-chamber device is placed so that additional rows, each
containing a different tetramer, are behind the first row. FIG. 21C
shows the synthesis of the first columns of oligonucleotide
tetramers. The multi-chamber device or surface has been rotated
90.degree.. Tetramers 9, 18, 7, and 12 were added in adjacent
chambers. FIG. 21D shows the second round synthesis of the
oligonucleotide rows. The first row contains tetramer 2. FIG. 21E
shows the second round of synthesis of oligonucleotides. Tetramers
34, 11, 14, and 23 are added in adjacent chambers during the second
round. FIG. 21F shows the third round synthesis of PNA rows. The
first row contains tetramer 3 to which tetramers 16, 7, 20, and 29
and are added. Note that all 24-mer oligonucleotides within a given
row or column are unique, hence achieving the desired addressable
array. Since each 24-mer differs from its neighbor by three
tetramers, and tetramers differ from each other by at least 2
bases, then each 24-mer differs from the next by at least 6 bases.
Each mismatch significantly lowers T.sub.m, and the presence of 6
mismatches in just 24 bases would make cross hybridization unlikely
even at 35.degree. C. Note that the smaller 12-mer sequences are
identical with one another, but are not at all common with the
24-mer sequences. Even though the particular 12-mer sequence may be
found within a 24-mer elsewhere on the grid, for example
17-1-2-3-28-5, an oligonucleotide will not hybridize to the 12-mer
at temperatures above 50.degree. C.
[0230] FIGS. 22A-C present a design for a masking device 2 capable
of constructing an array grid G as described in FIGS. 19-21. FIG.
22A is a top view of the arrangement of device 2 and array grid G,
while side views FIGS. 22B-22C are, respectively, taken along line
22B-22B and line 22C-22C of FIG. 22A. The masking device contains
200 .mu.m spaces and 200 .mu.m barriers, to allow each of five
tetramers to be coupled to the solid support in distinct rows.
After addition of the first set of tetramers, the masking device is
rotated 90.degree., and a second set of 5 tetramers are added. This
can be compared to putting icing on a cake as rows, followed by
icing as columns. The intersections between the rows and columns
will contain more icing, likewise, each intersection will contain
an octamer of unique sequence. Repeating this procedure for a total
of 6 cycles generates 25 spatially separated squares containing
unique 24-mers, and the remaining squares containing common
12-mers. The silicon or glass surface will contain 10 .mu.m ridges
R to assure a tight seal, and chambers 4 will be filled by opening
valves 8 to a vacuum line 12 to create negative pressure in the
chamber. The multi-chamber device is pressed onto the membrane or
activated solid surface, forming tight seals. The barriers may be
coated with rubber or another material to avoid cross contamination
from one chamber to the next. One must also make sure the membrane
or support surface is properly wetted by the solvents. After
closing valves 8 to vacuum line 12, one proceeds by activating the
surface, deprotecting, and adding a tetramer to a chamber 4 through
lines 10 by opening valves 6. The chamber is unclamped, the
membrane is rotated 90.degree., and reclamped. A second round of
tetramers are added by the above-described vacuum and tetramer
application steps. A valve block assembly (FIGS. 25A-C) will route
each tetramer to the appropriate row. Alternatively, a cylindrical
manifold (FIGS. 26A-D) will allow circular permutation of the six
tetramers prior to delivery into the five rows (or columns). This
design generates unique 24-mers which always differ from each other
by at least 3 tetramers, even though some sequences contain the
same 3 tetramers in a contiguous sequence.
[0231] FIGS. 23A-C represent a perspective view of the array
construction process described in FIG. 19 (FIGS. 19D-19E). In the
first step, as shown in FIG. 23A, PNA tetramers 1, 2, 3, 4, and 5
are linked to the surface in each of the five columns,
respectively. Each of the 5 locations in the columns are isolated,
and there is a 200 .mu.m gap between them where no oligonucleotides
are coupled. The multi-chamber device is then rotated 90.degree.,
as shown in FIG. 23B. Tetramers 6, 5, 4, 3, and 2 are added in
adjacent rows. Each of the 5 locations in the rows are isolated,
and there is a 200 .mu.m gap between them where no oligonucleotides
are coupled. Each completed 24-mer, as shown in FIG. 23C, within a
given row and column represents a unique PNA sequence. Unlike the
design presented in FIGS. 19-22, this array design will not contain
the half-size 12-mers between each complete 24-mer, because a mask
with isolated locations will be used.
[0232] FIGS. 24A-C present a design for a masking device 2 capable
of constructing an array grid G as described in FIG. 23. FIG. 24A
is a top view of the arrangement of device 2 and array grid G,
while side views FIGS. 24B and 24C 30 are, respectively, taken
along line 24B-24B and line 24C-24C of FIG. 24A. The masking device
contains 200 .mu.m spaces and 200 .mu.m barriers, to allow each of
five tetramers to be coupled to the solid support in distinct
locations on the array grid G. After addition of the first set of
tetramers, the masking device or surface is rotated 90.degree., and
a second set of 5 tetramers are added. Repeating this procedure for
a total of 6 cycles generates 25 spatially separated squares
containing unique 24-mers, and the remaining squares containing
common 12-mers. The silicon or glass surface will contain 10 .mu.m
ridges R to assure a tight seal, and chambers 4 will be filled by a
procedure initiated by using a vacuum to create negative pressure
in the chamber 2. This vacuum is created by opening valves 8 to
vacuum line 12. The multi-chamber device is pressed onto the
membrane or activated solid surface, forming tight seals. The
barriers may be coated with rubber or another material to avoid
cross contamination from one chamber to the next. One must also
make sure the membrane or solid support surface is properly wetted
by the solvents. After closing valves 8 to vacuum line 12, one
proceeds by activating the surface, deprotecting, and adding a
tetramer to chamber 4 through lines 10 by opening valves 6. The
chamber is unclamped, the membrane is rotated 90.degree., and
reclamped. A second round of tetramers are added by the
above-described vacuum and tetramer application steps. A valve
block assembly (FIGS. 25A-C) will route each tetramer to the
appropriate row. Alternatively, a cylindrical manifold (FIGS.
26A-D) will allow circular permutation of the six tetramers prior
to delivery into the five rows (or columns). This design generates
unique 24-mers which are separated from each other by a region free
of any oligonucleotides.
[0233] FIGS. 25A-C show a valve block assembly 14 which connects
six input ports 10 to five output ports 16 via a common chamber 18.
Each of the 6 input ports 10 and 5 output ports 16 contains a valve
6 and a valve 20, respectively, which control the flow of fluids.
The 6 input tubes 10 contain different solutions, and the valve
block assembly 14 is capable of routing any one of the input fluids
to one of the 5 output ports 16 at a time. This is accomplished by
opening the valve 6 of one of the input ports 10 and one of the
valves 20 of the output ports 16 simultaneously and allowing fluid
to fill the chamber 18 and exit via the output port 16 connected to
the open valve 20. The valve block assembly 14 is connected to a
source of solvent 22 and a source of vacuum 12 via valves 24 and 8,
respectively, in order to allow cleaning of the central chamber 18
in between fluid transfers. The solvent fills the chamber 18, and
the vacuum is used to remove all fluid from the chamber. This
prepares the chamber 18 for the next fluid transfer step and
prevents cross-contamination of the fluids.
[0234] FIGS. 26A-D depict a cylindrical manifold assembly 114 which
transfers 6 different tubes of input fluids to 5 different output
tubes. The manifold itself contains two separate halves 114A and
114B which are joined by a common, central spoke 134 around which
both halves can independently rotate. The bottom portion 114B is a
cylindrical block with 6 channels 130 drilled through it (see FIG.
26C, which is a bottom view of FIG. 26B taken along line 26C-26C of
FIG. 26B). Each of the 6 channels 130 are attached to 6 different
input tubes 110. The input tubes 110 contain valves 106 which
connect the input channels 130 to either reagents, solvent, or a
vacuum via lines 138 having valves 136 leading to vacuum line 112
having valve 108 and solvent line 122 having valve 124. This allows
different fluids to enter the channels 130 and 132 of the manifold
and allows clearing of the channels 130 and 132 of excess fluid
between fluid transfers. The upper portion of the manifold (see
FIG. 26A, which is a top view of FIG. 26B taken along line 26A-26A
of FIG. 26B) is also a cylindrical block with 5 channels 132
drilled through it. The 5 channels 132 are each connected to a
different output tube 116. The two halves of manifold 114A and 114B
can be independently rotated so that different input channels 130
will line up with different output channels 132. This allows the 6
tubes of input fluids to be transferred to the 5 output tubes
simultaneously. The bottom half of the manifold 114B can be rotated
60 degrees in order to align each input port 110 with the next
output port 116. In this way, each input port 110 can be aligned
with any of the output ports 116. The circular manifold of FIGS.
26A-D differs from the valve block assembly of FIGS. 26A-C in that
the former can simultaneously transfer five of the six input fluids
to the five output ports, because it has 5 channels connecting
input ports to the output ports. This concept could be easily
expanded to deliver 36 tetramers simultaneously to 36
locations.
[0235] The present invention contains a number of advantages over
prior art systems.
[0236] The solid support containing DNA arrays, in accordance with
the present invention, detects sequences by hybridization of
ligated product sequences to specific locations on the array so
that the position of the signal emanating from captured labels
identifies the presence of the sequence. For high throughput
detection of specific multiplexed LDR products, addressable
array-specific portions guide each LDR product to a designated
address on the solid support. While other DNA chip approaches try
to distinguish closely related sequences by subtle differences in
melting temperatures during solution-to-surface hybridization, the
present invention achieves the required specificity prior to
hybridization in solution-based LDR reactions. Thus, the present
invention allows for the design of arrays of capture
oligonucleotides with sequences which are very different from each
other. Each LDR product will have a unique addressable
array-specific portion, which is captured selectively by a capture
oligonucleotide at a specific address on the solid support.
[0237] When the complementary capture oligonucleotides on the solid
support are either modified DNA or PNA, LDR products can be
captured at higher temperatures. This provides the added advantages
of shorter hybridization times and reduced non-specific binding. As
a result, there is improved signal-to-noise ratios.
[0238] Another advantage of the present invention is that PCR/LDR
allows detection of closely-clustered mutations, single-base
changes, and short repeats and deletions. These are not amenable to
detection by allele-specific PCR or hybridization.
[0239] In accordance with the present invention, false
hybridization signals from DNA synthesis errors are avoided.
Addresses can be designed so there are very large differences in
hybridization T.sub.m values to incorrect address. In contrast, the
direct hybridization approaches depend on subtle differences. The
present invention also eliminates problems of false data
interpretation with gel electrophoresis or capillary
electrophoresis resulting from either DNA synthesis errors, band
broadening, or false band migration.
[0240] The use of a capture oligonucleotide to detect the presence
of ligation products, eliminates the need to detect single-base
differences in oligonucleotides using differential hybridization.
Other existing methods in the prior art relying on allele-specific
PCR, differential hybridization, or sequencing-by-hybridization
methods must have hybridization conditions optimized individually
for each new sequence being analyzed. When attempting to detect
multiple mutations simultaneously, it becomes difficult or
impossible to optimize hybridization conditions. In contrast, the
present invention is a general method for high specificity
detection of correct signal, independent of the target sequence,
and under uniform hybridization conditions. The present invention
yields a flexible method for discriminating between different
oligonucleotide sequences with significantly greater fidelity than
by any methods currently available within the prior art.
[0241] The array of the present invention will be universal, making
it useful for detection of cancer mutations, inherited (germline)
mutations, and infectious diseases. Further benefit is obtained
from being able to reuse the array, lowering the cost per
sample.
[0242] The present invention also affords great flexibility in the
synthesis of oligonucleotides and their attachment to supports.
Oligonucleotides can be synthesized off of the support and then
attached to unique surfaces on the support. Segments of multimers
of oligonucleotides, which do not require intermediate backbone
protection (e.g., PNA), can be synthesized and linked onto to the
solid support. Added benefit is achieved by being able to integrate
these synthetic approaches with design of the capture
oligonucleotide addresses. Such production of solid supports is
amenable to automated manufacture, obviating the need for human
intervention and resulting contamination concerns.
[0243] An important advantage of the array of the present invention
is the ability to reuse it with the previously attached capture
oligonucleotides. In order to prepare the solid support for such
reuse, the captured oligonucleotides must be removed without
removing the linking components connecting the captured
oligonucleotides to the solid support. A variety of procedures can
be used to achieve this objective. For example, the solid support
can be treated in distilled water at 95-100.degree. C., subjected
to 0.01 N NaOH at room temperature, contacted with 50%
dimethylformamide at 90-95.degree. C., or treated with 50%
formamide at 90-95.degree. C. Generally, this procedure can be used
to remove captured oligonucleotides in about 5 minutes. These
conditions are suitable for disrupting DNA-DNA hybridizations;
DNA-PNA hybridizations require other disrupting conditions.
[0244] The present invention is illustrated, but not limited, by
the following examples.
EXAMPLES
Example 1
Immobilization of Capture Oligonucleotides to Solid Supports
[0245] The solid support for immobilization was glass, in
particular microscope slides. The immobilization to glass (e.g.,
microscope slides), or other supports such as silicon (e.g.,
chips), membranes (e.g., nylon membranes), beads (e.g.,
paramagnetic or agarose beads), or plastics supports (e.g.,
polyethylene sheets) of capture oligonucleotides in spatially
addressable arrays is comprised of 5 steps:
[0246] A. Silanization of Support
[0247] The silanization reagent was 3-aminopropyl triethoxysilane
("APTS"). Alternatively, 3-glycidoxypropyltrimethoxysilane (K. L.
Beattie, et al., "Advances in Genosensor Research," Clin. Chem.,
41:700-706 (1995); U. Maskos, et al., "Oligonucleotide
Hybridizations on Glass Supports: a Novel Linker for
Oligonucleotide Synthesis and Hybridization Properties of
Oligonucleotides Synthesized in situ," Nucleic Acids Res.,
20:1679-1684 (1992); C. F. Mandenius, et al., "Coupling of
Biomolecules to Silicon Surfaces for Use in Ellipsometry and Other
Related Techniques," Methods Enzymol., pp.388-394 (1988), which are
hereby incorporated by reference) or 3-(trimethoxysilyl)propyl
methacrylate (M. Glad, et al., "Use of Silane Monomers for
Molecular Imprinting and Enzyme Entrapment in Polysiloxane-coated
Porous Silica," J. Chromatogr. 347:11-23 (1985); E. Hedborg, et
al., "Some Studies of Molecularly-imprinted Polymer Membranes in
Combination with Field-effect Devices," Sensors and Actuators A
37-38:796-799 (1993); and M. Kempe, et al., "An Approach Towards
Surface Imprinting Using the Enzyme Ribonuclease A," J. Mol.
Recogn. 8:35-39 (1995), which are hereby incorporated by reference)
can be used as an initial silanization reagent. Prior to
silanization, the support was cleansed and the surface of the
support was rendered hydrophobic. Glass slides (Fisher Scientific,
Extra thick microslides, frosted cat.# 12-550-11) were incubated in
conc. aq. NH.sub.4OH--H.sub.2O.sub.2--H.sub.2O (1:1:5, v/v/v) at
80.degree. C. for 5 min and rinsed in distilled water. The support
was then washed with distilled water, ethanol and acetone as
described in the literature (C. F. Mandenius, et al., "Coupling of
Biomolecules to Silicon Surfaces for Use in Ellipsometry and Other
Related Techniques," Methods Enzymol., pp. 388-394 (1988); Graham,
et al., "Gene Probe Assays on a Fibre-Optic Evanescent Wave
Biosensor," Biosensors & Bioelectronics, 7: 487-493 (1992);
Jonsson, et al., "Adsorption Behavior of Fibronectin on Well
Characterized Silica Surfaces," J. Colloid Interface Sci.,
90:148-163 (1982), which are hereby incorporated by reference). The
support was silanized overnight at room temperature in a solution
of 2% (v/v) 3-aminopropyl triethoxysilane (Sigma, St. Louis, Mo.)
in dry acetone (99.7%) (modified after Z. Guo, et. al., "Direct
Fluorescence Analysis of Genetic Polymorphisms by Hybridization
with Oligonucleotide Arrays on Glass Supports," Nucl. Acids Res.
22:5456-65 (1994), which is hereby incorporated by reference). The
support was then thoroughly washed in dry acetone and dried at
80.degree. C. in a vacuum desiccator.
[0248] B. Derivatization of Silanized Solid Support with Functional
Groups (e.g., Carboxyl or Amino Groups)
[0249] When the silanization reagent was APTS, the desired amino
functionality was introduced directly. Other functional groups can
be introduced, either by choosing an appropriate silanization
reagent primer that already contains the functional group (e.g.,
3-(trimethoxysilyl)prop- yl methacrylate to functionalize the
surface with a polymerizable acrylate, (M. Glad, et al., "Use of
Silane Monomers Imprinting and Enzyme Entrapment in
Polysiloxane-coated Porous Silica," J. Chromatogr. 347:11-23
(1985); E. Hedborg, et al., "Some Studies of Molecularly-imprinted
Polymer Membranes in Combination with Field-effect Devices,"
Sensors and Actuators A 37-38:796-799 (1993); and M. Kempe, et al.,
"An Approach Towards Surface Imprinting Using the Enzyme
Ribonuclease A," J. Mol. Recogn. 8:35-39 (1995), which are hereby
incorporated by reference), or by reacting the amino-functionalized
surface with a reagent that contains the desired functional group
(e.g., after localized light-directed photodeprotection of
protected amino groups used in photolithography, (Fodor, et al.,
"Light-Directed, Spatially Addressable Parallel Chemical
Synthesis," Science, 251:767-773 (1991); Fodor, et al.,
"Multiplexed Biochemical Assays with Biological Chips," Nature,
364:555-556 (1993), which are hereby incorporated by
reference)).
[0250] C. Activation of Functional Groups
[0251] The functional group on the solid support was an amino
group. Using a prefabricated mask with a 5.times.5 array of dots
that have a diameter of 1 mm, and that are 3.25 mm apart, small
amounts (typically 0.2 to 1.0 .mu.l) of a solution containing 70
mg/ml disuccinimidyl adipate ester (Hill, et al., "Disuccinimidyl
Esters as Bifunctional Crosslinking Reagents for Proteins," FEBS
Lett, 102:282-286 (1979); Horton, et al., "Covalent Immobilization
of Proteins by Techniques which Permit Subsequent Release," Methods
Enzymol., pp. 130-141 (1987), which are hereby incorporated by
reference) in anhydrous dimethylformamide ("DMF"); Aldrich,
Milwaukee, Wis.), amended with 1-2% triethylamine (to scavenge the
acid that is generated), were manually applied to the solid support
using a Gilson P-10 pipette. After application, the reaction was
allowed to proceed for 30 min at room temperature in a hood, after
which another loading of disuccinimidyl adipate ester was applied.
After a total reaction time of 1 hour, the support was washed with
anhydrous DMF and dried at room temperature in a vacuum
desiccator.
[0252] In case the functional group is a carboxyl group, the solid
support can be reacted with 1-ethyl-3-(3-dimethylaminopropyl)
carbodiimide hydrochloride ("EDC"). Frank, et al., "Simultaneous
Multiple Peptide Synthesis Under Continuous Flow Conditions on
Cellulose Paper Discs as Segmental Solid Support," Tetrahedron,
44:6031-6040 (1988), which is hereby incorporated by reference.
Prior to this reaction, the surface of the solid support was
protonated by a brief treatment with 0.1 N HCl. Using the above
described prefabricated mask, small amounts (0.2 to 1.0 .mu.l) of a
fresh solution containing 1 M EDC (Sigma, St. Louis, Mo.), 1 mM of
5' amino-modified oligonucleotide and 20 mM KH.sub.2PO.sub.4,
pH=8.3, was manually applied to the solid support. The reaction was
allowed to proceed for 1 hour, after which the support was washed
with distilled water and dried at room temperature in a vacuum
desiccator.
[0253] D. Coupling of Amino-Functionalized Capture Oligonucleotides
to the Preactivated Solid Support
[0254] For supports other than EDC-activated solid supports, small
amounts (0.2 to 1.0 .mu.l) of 1 nmol/.mu.l 5' amino-modified
oligonucleotides (i.e. the sequences in Table 2) in 20 mM
KH.sub.2PO.sub.4, pH 8.3, were manually applied to the activated
support, again using the prefabricated mask described above. The
reaction was allowed to proceed for 1 hour at room temperature.
[0255] E. Quenching of Remaining Reactive Groups on the Solid
Support
[0256] In order to prevent the reaction products from being
nonspecifically captured on the solid support in a capture
probe-independent way, it may be necessary to quench any remaining
reactive groups on the surface of the solid support after capture
of the complementary oligonucleotide probes. Hereto, the support
was incubated for 5 min at room temperature in 0.1 N sodium
hydroxide. Alternatively, quenching can be performed in 0.2 M
lysine, pH=9.0. After quenching, the support was washed with 0.1 N
sodium phosphate buffer, pH 7.2, to neutralize the surface of the
support. After a final wash in distilled water, the support was
dried and stored at room temperature in a vacuum desiccator.
Example 2
Design of the Assay System
[0257] A semi-automated custom-designed assay system was made for
testing hybridizations and subsequent washings of captured
oligonucleotide probe-capture oligonucleotide hybrids in a
high-throughput format using the GeneAmp In Situ PCR System
1000.TM. (Perkin Elmer, Applied Biosystems Division, Foster City,
Calif.) (G. J. Nuovo, PCR in situ Hybridization, New York: Raven
Press (2nd ed. 1994), which is hereby incorporated by reference). A
general flowchart of the system is shown in FIG. 27. The system
consists of a flow-through hybridization chamber which is connected
via a sample loading device and a multiple port system to a battery
of liquid reservoirs, and to a waste reservoir. The fluid delivery
is controlled by a pump. The pump was placed at the end of the
assembly line and operated under conditions to maintain a light
vacuum to prevent leakage and contamination of the system. Since
the hybridization chamber and the liquid reservoirs were designed
to fit precisely within the GeneAmp In Situ PCR System 1000.TM.,
temperatures can be accurately controlled and maintained during the
hybridization and washing steps of the assay.
[0258] The individual parts of the system are described in detail
in the following section:
[0259] A. Hybridization Chamber
[0260] The hybridization chamber is an in situ PCR reagent
containment system that has been modified to accommodate
flow-through characteristics. The containment system is comprised
of a glass microscope slide (76.times.25.times.1.2+0.02 mM) and a
silicone rubber diaphragm, which has been clamped to the slide by a
thin stainless steel clip. The inside oval rim of the metal clip
compresses the edges of the silicon disc against the slide with
enough force to create a water and gas-tight seal ensuring the
containment of hybridization probes and washing liquids. The volume
of the containment is approximately 50 .mu.l. The array of
immobilized capture oligonucleotides is contained in the central
area of the slide (approximately 13 mm.times.15 mm) which is
covered by the silicon disc. The assembly of the different parts is
facilitated by an assembly tool which is provided by the
manufacturer of the in situ PCR system. Once assembled, an inlet
and outlet of the hybridization chamber is created by insertion of
two 25G3/4 needles with 12" tubing and multiple sample luer adapter
(Becton Dickinson, Rutherford, N.J.). The needles are inserted in a
diagonal manner to assure an up-and-across flow pattern during
washing of the probe-target hybrids.
[0261] B. Liquid Reservoirs
[0262] Reservoirs containing different washing solutions were
custom-designed to fit into the vertical slots of the thermal block
of the GeneAmp In Situ PCR System 1000.TM.. Each reservoir consists
of two glass microscope chamber slides (25.times.75.times.1 mm)
containing prefabricated silicone gaskets (Nunc, Inc., Napierville,
Ill.), which were glued to each other using silicone sealant (Dow
Corning, Midland, Mich.). An outlet was created by insertion of a
21G 3/4" needle with 12" long tubing and multiple sample luer
adapter (Becton Dickinson, Rutherford, N.J.) through the silicone
gasket. A second 21 G 3/4" needle without tubing (Becton Dickinson,
Franklin Lakes, N.J.) was inserted through the silicone gasket to
create an air inlet. The liquid reservoirs are leak-free and fit
precisely within the slots of the thermal block, where they are
clamped against the metal fins to assure good heat transfer to the
contained liquid. The volume of each reservoir is approximately 2
ml.
[0263] C. Multi Port System and Sample Loading Device
[0264] Liquid reservoirs, sample loading device and hybridization
chamber are connected through a multiple port system that enables a
manually controlled unidirectional flow of liquids. The system
consists of a series of 3-way nylon stopcocks with luer adapters
(Kontes Scientific Glassware/Instruments, Vineland, N.J.) that are
connected to each other through male-female connections. The female
luer adapters from the liquid reservoirs are connected to the multi
port female luer adapters via a male-to-male luer adapter coupler
(Biorad, Richmond, Calif.). The sample loading device is placed in
between the ports connected to the liquid reservoirs and the port
connected to the hybridization chamber. It consists of a 1 ml
syringe (Becton Dickinson, Franklin Lakes, N.J.) that is directly
connected via a luer adapter to the multi port system. The flow of
liquids can be controlled manually by turning the handles on the
stopcocks in the desired direction.
[0265] D. Waste Reservoir
[0266] The outlet tubing from the hybridization chamber is
connected to a waste reservoir which consists of a 20 ml syringe
with luer adapter (Becton Dickinson, Franklin Lakes, N.J.) in which
the plunger has been secured at a fixed position. A connection to
the pump is established by insertion of a 21G 3/4" needle with 12"
long tubing and multiple sample luer adapter through the rubber
gasket of the plunger. When the pump is activated, a slight vacuum
is built up in the syringe which drives the flow of liquids from
the liquid reservoirs through the hybridization chamber to the
waste reservoir.
[0267] E. Pump
[0268] A peristaltic pump P-1 (Pharmacia, Piscataway, N.J.) was
used to control the flow of liquids through the system. It was
placed at the end of the assembly line in order to maintain a
slight vacuum within the system. The inlet tubing of the pump was
connected to the outlet tubing of the waste reservoir via a 3-way
nylon stopcock. By this construction, release of the vacuum within
the waste reservoir is established, enabling its draining by
gravity.
Example 3
Hybridization and Washing Conditions
[0269] In order to assess the capture specificity of different
capture oligonucleotides, hybridization experiments were carried
out using two capture oligonucelotide probes that had 3 out of 6
tetramers (i.e., 12 out of 24 nucleotides) in common. This example
represents the most difficult case to distinguish between different
capture oligonucleotides. In general, other capture
oligonucleotides would be selected that would have fewer tetramers
in common to separate different amplification products on an
addressable array.
[0270] Typically, 10 pmol of each of the oligonucleotides comp 12
and comp 14 (see Table 3) were 5' end labeled in a volume of 20
.mu.l containing 10 units of T4 polynucleotide kinase (New England
Biolabs, Beverly, Mass.), 2.22 MBq (60 .mu.Ci) [.gamma.-.sup.32P]
ATP, 50 mM Tris-HCl, pH 8, 10 mM MgCl.sub.2,1 mM EDTA, and 10 mM
dithiothreitol, according to a slightly modified standard procedure
described in the literature. Unincorporated radioactive nucleotides
were removed by filtration over a column containing superfine DNA
grade Sephadex G-25 (Pharmacia, Piscataway, N.J.). The Sephadex was
preswollen overnight at 4.degree. C. in 10 mM ammonium acetate. The
labeled oligonucleotide probes were dried in vacuum and dissolved
in hybridization solution (0.5 M Na.sub.2HPO.sub.4 [pH 7.2], 1%
crystalline grade BSA, 1 mM EDTA, 7% SDS). The specific activity of
the labeled oligonucleotide probes comp 12 and comp 14 was
2.86.times.10.sup.6 cpm/pmol and 2.43.times.10.sup.6 cpm/pmol,
respectively.
6TABLE 3 Oligonucleotides used (5' to 3') 12 Aminolink-spacer
18-ATC GGG TAG GTA ACC TTG CGT GCG (SEQ. ID. No. 12) 14
Aminolink-spacer 18-GGT AGG TAA CCT ACC TCA GCT GCG (SEQ. ID. No.
13) comp 12 CGC ACG CAA GGT TAC CTA CCC GAT (SEQ. ID. No. 14) comp
14 CGC AGC TGA GGT AGG TTA CCT ACC (SEQ. ID. No. 15)
[0271] Four hundred picomoles of amino-linked capture
oligonucleotides 12 and 14 (see Table 3) were deposited and reacted
both on carboxyl derivatized and amino derivatized glass microscope
slides as described in the previous section. The capture
oligonucleotides were immobilized in a 2.times.2 matrix array, in
such a way that hybridization with the complementary
oligonucleotide probe comp 12 would result in a positive signal for
the top-left and bottom-right diagonal positions, while
hybridization with the complementary oligonucleotide probe comp 14
would result in a positive signal for the bottom-left and top-right
diagonal positions.
[0272] Radiolabeled oligonucleotide probes comp 12 and comp 14 (see
Table 3) were dissolved in hybridization solution at a
concentration of 2.5 pmol/100 .mu.l and 4.1 pmol/100 .mu.l,
respectively. The hybridization solutions were amended with 5 .mu.l
of a 2% bromophenol blue marker to facilitate the visual monitoring
of the probes during their transport through the assay system. One
hundred microliters of radiolabeled probe was then injected and
pumped into the hybridization chamber. Hybridizations were
performed for 15 min at 70.degree. C.
[0273] After hybridization, the hybridization chamber was
sequentially washed with 2.times.2 ml of low stringency wash buffer
(2.times.SSC buffer contains 300 mM sodium chloride and 30 mM
sodium citrate), 0.1% sodium dodecylsulfate ("SDS")) and 2.times.2
ml of high stringency wash buffer (0.2.times.SSC, 0.1% SDS) at
70.degree. C. (1.times.SSC buffer contains 150 mM sodium chloride
and 15 mM sodium citrate).
Example 4
Detection of Captured Oligonucleotide Probes
[0274] After washing, the capture oligonucleotide-oligonucleotide
probe hybrids, silicon discs, needles and metal cover clips were
removed from the glass microscope slides, and remaining liquid was
absorbed using Kimwipes (Kimberly-Clark, Roswell, Ga.). The
captured oligonucleotide probes were visualized and quantified
using a phosphorimager (Molecular Dynamics, Sunnyvale, Calif.).
After 21 hours of exposure of the glass microscope slide to a
phosphorimager screen, data were collected for the different solid
supports that were tested. The images that were obtained are shown
in FIG. 28. Quantitative data are shown in Tables 4A and 4B.
[0275] Under the conditions that were used, the signals and
cross-reactivity data that were obtained for the
NH.sub.2-functionalized slides were better than those obtained for
the COOH-functionalized slides.
7TABLE 4A Quantification of captured oligonucleotide probe 12
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group capture oligonucleotide 12 capture oligonucleotide 14
cross on slide Probe (pic)* (amol) (pic)* (amol) reactivity --COOH
12 105,333 9.0 0.37 --COOH 12 55,957 4.8 --COOH 12 36,534 3.1
--COOH 12 23,707 2.0 --NH.sub.2 12 353,569 30 0.015 --NH.sub.2 12
10,421,092 889 --NH.sub.2 12 64,999 5.5 --NH.sub.2 12 95,414 8.1
*pic = relative phosphorimager counts
[0276]
8TABLE 4B Quantification of captured oligonucleotide probe 14
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group capture oligonucleotide 12 capture oligonucleotide 14
cross on slide Probe (pic)* (amol) (pic)* (amol) reactivity --COOH
14 35,610 4.0 0.19 --COOH 14 43,362 4.9 --COOH 14 5,587 0.6 --COOH
14 9,379 1.1 --NH.sub.2 14 245,973 28 0.049 --NH.sub.2 14 115,529
13 --NH.sub.2 14 9,775 1.1 --NH.sub.2 14 8,065 0.9 *pic = relative
phosphorimager counts
Example 5
Optimizing Immobilization Parameters of Capture
Oligonucleotides
[0277] Polymer was deposited on slides using a literature
procedure. Barnard, et al., "A Fibre-optic Sensor With Discrete
Sensing Sites," Nature 353:338-40 (1991); Bonk, et al.,
"Fabrication of Patterned Sensor Arrays With Aryl Azides on a
Polymer-coated Imaging Optical Fiber Bundle," Anal. Chem.
66:3319-20 (1994); Smith, et al., "Poly-N-acrylylpyrrolidone--A New
Resin in Peptide Chemistry," Int. J. Peptide Protein Res. 13:109-12
(1979), which are hereby incorporated by reference.
[0278] Four hundred picomoles of amino-linked capture
oligonucleotides 12 and 14 (see Table 3) were deposited and reacted
in a 2.times.2 pattern to a glass microscope slide that contained 4
identical photo-deposited polymer spots. The oligonucleotides were
spotted in such a way that hybridization with the complementary
oligonucleotide probe comp 12 would result in a positive signal for
the top and bottom positions, while hybridization with the
complementary oligonucleotide probe comp 14 would result in a
positive signal for the left and right positions.
[0279] Radiolabeled oligonucleotide probe comp 12 (see Table 3) was
dissolved in hybridization solution at a concentration of 2.4
pmol/100 .mu.l. Bromophenol blue marker
[0280] (5 .mu.l of a 2% solution) was added to the hybridization
solution to facilitate the monitoring of the probe during its
transport through the system.
[0281] One hundred microliters of radiolabeled probe comp 12 was
pumped into the hybridization chamber. Hybridization was performed
for 15 min at 70.degree. C. After hybridization, the hybridization
chamber was sequentially washed with 3.times.1 ml of low stringency
wash buffer (2.times.SSC, 0.1% SDS) and 3.times.1 ml of high
stringency wash buffer (0.2.times.SSC, 0.1% SDS) at 70.degree.
C.
[0282] After 24 hours of exposure of the glass microscope slide to
a phosphorimager screen, data were collected for all the different
slides that were tested. The images that were obtained are shown in
FIG. 29. Quantitative data are shown in Table 5.
9TABLE 5 Quantification of captured oligonucleotide probes
Percentage probe 12 Crosslinker crosslinker probe 12 (pic)* (amol)
EGDMA 2 1,055,100 80 1,390,499 106 HDDMA 2 633,208 48 286,9371 218
EGDMA 4 4,449,001 338 2,778,414 211 EGDMA = ethylene glycol
dimethacrylate HDDMA = hexane diol dimethacrylate *pic = relative
phosphorimager counts
[0283] The immobilization chemistry allows for the use of
tailor-made specialty polymer matrices that provide the appropriate
physical properties that are required for efficient capture of
nucleic acid amplification products. The specificity of the
immobilized capture oligonucleotides has been relatively good
compared to current strategies in which single mismatches,
deletions, and insertions are distinguished by differential
hybridization (K. L. Beattie, et. al. "Advances in Genosensor
Research," Clin. Chem. 41:700-06 (1995), which is hereby
incorporated by reference). Finally, it has been demonstrated that
the assay system of the present invention enables the universal
identification of nucleic acid oligomers.
Example 6
Capture of Addressable Oligonucleotide Probes to Solid Support
[0284] Polymer-coated slides were tested for their capture capacity
of addressable oligonucleotide probes following different
procedures for immobilization of capture oligonucleotides. After
being silanized with 3-(trimethoxysilyl) propyl methacrylate,
monomers were then polymerized on the slides. In one case, a
polymer layer having COOH functional groups was formed with a
polyethylene glycol-containing crosslinker. In the other case, a
polyethylene glycol-methacrylate monomer was polymerized onto the
slide to form OH functional groups. The slides with the COOH
functional groups were activated using the EDC-activation procedure
of Example 1.
[0285] The slide with OH functional groups was activated overnight
at room temperature by incubation in a tightly closed 50 ml plastic
disposable tube (Coming Inc., Coming, N.Y.) containing 0.2 M
1,1'-carbonyldiimidazol- e ("CDI") (Sigma Chemical Co., St. Louis,
Mo.) in "low water" acetone (J.T. Baker, Phillipsburg, N.J.). The
slide was then washed with "low water" acetone, and dried in vacuum
at room temperature.
[0286] Amino-linked capture oligonucleotide 14 was manually spotted
on premarked locations on both sides (4 dots per slide). The
reactions were performed in a hood, and the amount of
oligonucleotide that was spotted was 2.times.0.2 .mu.l (0.8
nmol/.mu.1). The total reaction time was 1 hr. The slides were then
quenched for 15 min by the application of few drops of propylamine
on each of the premarked dots. After quenching, the slides were
incubated for 5 min in 0.1 N sodium phosphate buffer, pH 7.2,
washed in double distilled H.sub.2O, and dried in vacuum.
[0287] The complementary capture oligonucleotides on the slides
were hybridized with radioactively labeled oligonucleotide probe
comp 14 (Table 3). One hundred microliters radiolabeled
oligonucleotide probe comp 14 (2.8 pmol; 6,440,000 cpm/pmol) were
pumped into the hybridization chamber. Hybridization was performed
for 15 min at 70.degree. C. in 0.5 M Na.sub.2HPO.sub.4 [pH 7.2], 1%
crystalline grade BSA, 1 mM EDTA, 7% SDS. After hybridization, the
hybridization chamber was sequentially washed with 2.times.2 ml of
low stringency wash buffer (2.times.SSC, 0.1% SDS) and 2.times.2 ml
of high stringency wash buffer (0.2.times.SSC, 0.1% SDS) at
70.degree. C. (1 SSC buffer contains 150 mM sodium chloride and 15
mM sodium citrate).
[0288] After 30 min of exposure of the glass microscope slide to a
phosphorimager screen, data were collected for both slides. After
30 minutes of exposure of the glass microscope slides to a
phosphorimager screen, data were collected. See Table 6 and FIG.
30.
10TABLE 6 Quantification of capture oligonucleotide probe 14 on
OH-functionalized slides Functional Oligonucleotide probe at group
capture oligonucleotide 14 on glass slide Probe (pic)* (fmol) --OH
14 1,864,879 10.9 --OH 14 1,769,403 10.3 *pic = relative
phosphorimager counts
[0289] In this test, better results were obtained with the slide
coated with the polymer containing OH functional groups than with
the slide coated with the polymer containing COOH functional
groups.
[0290] With previously prepared (poly HEMA)-containing polymers
that were polymerized with 20% amine-containing monomers and
crosslinked with 4% EGDMA or HDDMA, it was possible to capture
about 275 amol of radioactively labelled ligated product sequence
(which could only be visualized after 23 hours of exposure to a
phosphorimager screen (Table 5)). Using the
polyethylene-methacrylate polymer formulations, it was possible to
capture about 10.6 fmoles of ligated product sequence. The signal
could be detected after 30 min of exposure.
Example 7
Detection of Captured Oligonucleotides Using a Membrane Support
[0291] In order to assess the capture specificity of different
capture oligonucleotides using a membrane support, hybridization
experiments were carried out using the capture oligonueleotide
probes 12 and 14 (Table 3).
[0292] Strips of OH-functionalized nylon membrane (Millipore,
Bedford, Mass.) were soaked overnight in a 0.2 M solution of
carbonyldiimidazole in "low water" acetone. The strips were washed
in acetone and dried in vacuo. Two volumes of 0.2 .mu.l (1 mM)
capture oligonucleotides 12 and 14 in 20 mM K.sub.2HPO.sub.4, pH
8.3, (Table 3) were loaded on the membrane using a special blotting
device (Immunetics, Cambridge, Mass.). Complementary
oligonucleotide probes were radioactively labeled as described in
Example 3. The oligonucleotide probes were dried in vacuo and taken
up in 200 .mu.l hybridization buffer (0.5 M Na.sub.2HPO.sub.4 [pH
7.2], 1% crystalline grade BSA, 1 mM EDTA, 7% SDS). Membranes were
prehybridized in 800 .mu.l hybridization buffer for 15 min at
60.degree. C. in 1.5 ml Eppendorf tubes in a Hybaid hybridization
oven. The tubes were filled with 500 .mu.l of inert camauba wax
(Strahl & Pitsch, Inc., New York, N.Y.) to reduce the total
volume of the hybridization compartment. After prehybridization,
200 .mu.l of radiolabeled probe was added. The membranes were
hybridized for 15 min at 60.degree. C. After hybridization, the
membranes were washed at 60.degree. C., twice for 15 min with 1 ml
of low stringency wash buffer (2.times.SSC, 0.1% SDS), and twice
for 15 min with 1 ml of high stringency wash buffer (0.2.times.SSC,
0.1% SDS). The captured oligonucleotide probes were quantified
using a phosphorimager (Molecular Dynamics, Sunnyvale, Calif.).
After 45 min of exposure to a phosphorimager screen, data were
collected. The results are shown in Table 7, where the activities
of capture oligonucleotides 12 and 14 are 112 pic/amol and 210
pic/amol, respectively.
11TABLE 7 Quantification of captured oligonucleotides on membranes
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group on capture oligonucleotide 12 capture oligonucleotide
14 cross membrane Probe (pic)* (fmol) (pic)* (fmol) reactivity --OH
12 13,388,487 119.5 337,235 3.01 0.025 --OH 12 13,299,298 118.7
--OH 14 179,345 0.85 1,989,876 9.48 0.071 --OH 14 3,063,387 14.59
*pic = relative phosphorimager counts
[0293] Hybridization temperatures and hybridization times were
further explored in a series of similar experiments. The data shown
in Table 8 (where the activities of capture oligonucleotides 12 and
14 are 251 pic/amol and 268 pic/amol, respectively) represent the
results obtained with the following conditions: 15 min
prehybridization at 65.degree. C. in 800 .mu.l hybridization
buffer; 15 min hybridization at 65.degree. C. in 1 ml hybridization
buffer; 2.times.washings for 5 min at 65.degree. C. with 1 ml of
low stringency wash buffer; and 2.times.washings for 5 min at
65.degree. C. with 1 ml of high stringency wash buffer.
12TABLE 8 Quantification of captured oligonucleotides on membranes
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group on capture oligonucleotide 12 capture oligonucleotide
14 cross membrane Probe (pic)* (fmol) (pic)* (fmol) reactivity --OH
12 41,023,467 163.4 541,483 2.16 0.015 --OH 12 31,868,432 127.0
--OH 14 294,426 1.10 19,673,325 73.41 0.016 --OH 14 18,302,187
68.29 *pic = relative phosphorimager counts
[0294] The data shown in Table 9 (where the activities of capture
20 oligonucleotides 12 and 14 are 487 pic/amol and 506 pic/amol,
respectively) represent the results obtained with the following
conditions: 15 min prehybridization at 70.degree. C. in 150 .mu.l
hybridization buffer; 15 min hybridization at 70.degree. C. in 200
.mu.l hybridization buffer; 2.times.washings for 5 min at
70.degree. C. in 800 .mu.l of low stringency wash buffer; and
2.times.washings for 5 min at 70.degree. C. in 800 .mu.l of high
stringency wash buffer.
13TABLE 9 Quantification of captured oligonucleotides on membranes
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group on capture oligonucleotide 12 capture oligonucleotide
14 cross membrane Probe (pic)* (fmol) (pic)* (fmol) reactivity --OH
12 34,648,385 71.15 1,158,832 2.38 0.027 --OH 12 52,243,549 107.28
--OH 14 1,441,691 2.85 56,762,990 112.18 0.028 --OH 14 45,769,158
90.45 *pic = relative phosphorimager counts
[0295] The data shown in Table 10 represent the results obtained
with the following conditions: 15 min prehybridization at
70.degree. C. in 150 .mu.l hybridization buffer; 5 min
hybridization at 70.degree. C. in 200 .mu.l hybridization buffer;
2.times.washings for 5 min at 70.degree. C. with 800 .mu.l of low
stringency wash buffer; and 2.times.washings for 5 min at
70.degree. C. with 800 .mu.l of high stringency wash buffer.
14TABLE 10 Quantification of captured oligonucleotides on membranes
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group on capture oligonucleotide 12 capture oligonucleotide
14 cross membrane Probe (pic)* (fmol) (pic)* (fmol) reactivity --OH
12 26,286,188 53.98 389,480 0.80 0.013 --OH 12 34,879,649 71.62
--OH 14 539,486 1.07 45,197,674 89.32 0.011 --OH 14 54,409,947
107.53 *pic = relative phosphorimager counts
[0296] The data shown in Table 11 represent the results obtained
with the following conditions: 5 min prehybridization at 70.degree.
C. in 150 .mu.l hybridization buffer; 1 min hybridization at
70.degree. C. in 200 .mu.l hybridization buffer; 2.times.washings
for 2 min at 70.degree. C. with 800 .mu.l of low stringency wash
buffer; and 2.times.washings for 5 min at 70.degree. C. with 800
.mu.l of high stringency wash buffer.
15TABLE 11 Quantification of captured oligonucleotides on membranes
Functional Oligonucleotide probe at Oligonucleotide probe at
Average group on capture oligonucleotide 12 capture oligonucleotide
14 cross membrane Probe (pic)* (fmol) (pic)* (fmol) reactivity --OH
12 5,032,835 10.33 56,777 0.12 0.012 --OH 12 4,569,483 9.38 --OH 14
540,166 1.07 41,988,355 82.98 0.017 --OH 14 20,357,554 40.23 *pic =
relative phosphorimager counts
[0297] These data demonstrate that hybridization of the capture
oligonucleotide probes to their complementary sequences was
specific. In comparison with the previous experiments performed
with glass slides, significantly greater amounts (i.e., fmol
quantities compared to amol quantities) of oligonucleotide probes
were reproducibly captured on the membrane supports. For these two
very closely-related capture oligonucleotide probes, average
cross-reactivity values of about 1% could be obtained. However, for
other pairs of capture oligonucleotides in the array, these values
would be significantly better. In general, such values cannot be
achieved by using existing methods that are known in the art, i.e.,
by allele-specific oligonucleotide hybridization ("ASO") or by
differential hybridization methods, such as sequencing by
hybridization ("SBH").
Example 8
Cleaning Glass Surfaces
[0298] Glass slides (Fisher Scientific, Extra thick microslides,
frosted cat.# 12-550-11) were incubated in conc. aq.
NH.sub.4OH--H.sub.2O.sub.2--- H.sub.2O (1:1:5, v/v/v) at 80.degree.
C. for 5 min and rinsed in distilled water. A second incubation was
performed in cone. aq HCl--H.sub.2O.sub.2--H.sub.2O (1:1:5,v/v/v)
at 80.degree. C. for 5 min. See U. Jonsson, et al., "Absorption
Behavior of Fibronectin on Well Characterized Silica Surfaces," J.
Colloid Interface Sci. 90:148-163 (1982), which is hereby
incorporated by reference. The slides were rinsed thoroughly in
distilled water, methanol, and acetone, and were air-dried at room
temperature.
Example 9
Silanization with 3-methacryloyloxypropyltrimethoxysilane
[0299] Cleaned slides, prepared according to Example 8, were
incubated for 24-48 h at room temperature in a solution consisting
of 2.6 ml of 3-methacryloyloxypropyltrimethoxysilane (Aldrich
Chemical Company, Inc. Milwaukee, Wis. cat.# 23,579-2), 0.26 ml of
triethylamine, and 130 ml of toluene. See E. Hedborg, et. al.,
Sensors Actuators A, 37-38:796-799 (1993), which is hereby
incorporated by reference. The slides were rinsed thoroughly in
acetone, methanol, distilled water, methanol again, and acetone
again, and were air-dried at room temperature. See FIG. 31.
Example 10
Silanization with Dichlorodimethylsilane
[0300] Cleaned slides, prepared according to Example 8, were
incubated for 15 min at room temperature in a solution containing
12 ml of dichlorodimethylsilane and 120 ml of toluene. The slides
were rinsed thoroughly in acetone, methanol, distilled water,
methanol again, and acetone again and were air-dried.
Example 11
Polymerization of Poly(ethylene glycol)methacrylate with
Methacrylate-derivatized Glass
[0301] 2.2 g of poly(ethylene glycol)methacrylate (Aldrich Chemical
Company, Inc. Milwaukee, Wis. cat.# 40,953-7) (average M 306 g/mol)
and 50 mg of 2,2'-azobis(2-methylpropionitrile) in 3.5 ml of
acetonitrile were cooled on ice and purged with a stream of argon
for 3 min. The next steps were performed in a glove-box under argon
atmosphere. 5-15 drops of the polymerization mixture were placed on
a methacrylate-derivatized glass slide, prepared according to
Examples 8 and 9. The methacrylate-derivatized glass slide and the
polymerization mixture were covered by a second glass slide which
had been silanized according to Example 10, and the two glass
slides were pressed together and fixed with clips. The slides were
subsequently transferred to a vacuum desiccator. The polymerization
was thermolytically initiated at 55.degree. C., or photolytically
at 366 nm. See FIG. 32.
Example 12
Polymerization of Acrylic Acid and Trimethylolpropane Ethoxylate
(14/3 EO/OH) Triacrylate with Methacrylate-Derivatized Glass
[0302] 0.5 g of acrylic acid (Aldrich Chemical Company, Inc.
Milwaukee, Wis. cat.# 14,723-0), 1.83 g of trimethylolpropane
ethoxylate (14/3 EO/OH) triacrylate (Aldrich Chemical Company, Inc.
Milwaukee, Wis. cat.# 23,579-2), and 50 mg of
2,2'-azobis(2-methylpropionitrile) in 3.5 ml of acetonitrile were
cooled on ice and purged with a stream of argon for 3 min. The next
steps were performed in a glovebox as described in Example 11. The
slides were subsequently transferred to a vacuum desiccator and
polymerized as described in Example 11. See FIG. 33.
Example 13
Polymerization of Poly(ethylene glycol)methacrylate and
Trimethylolpropane Ethoxylate (14/3 EO/OH) Triacrylate with
Methacrylate-derivatized Glass
[0303] 0.55 g of poly(ethylene glycol)methacrylate (Aldrich
Chemical Company, Inc. Milwaukee, Wis. cat.# 40,953,7), 1.64 g of
trimethylolpropane ethoxylate (14/3 EO/OH triacrylate (Aldrich
Chemical Company, Inc. Milwaukee, Wis. cat.# 23,579-2), and 50 mg
of 2,2'-azobis(2-methylpropionitrile) in 3.5 ml of acetonitrile
were cooled on ice and purged with a stream of argon for 3 min. The
next steps were performed in a glove-box as described in Example
11. The slides were subsequently transferred to a vacuum desiccator
and polymerized as described in Example 11. See FIG. 34.
Example 14
Materials and Methods
[0304] Oligonucleotide Synthesis and Purification. Oligonucleotides
were obtained as custom synthesis products from IDT, Inc.
(Coralville, Iowa), or synthesized in-house on an ABI 394 DNA
Synthesizer (PE Biosystems Inc.; Foster City, Calif.) using
standard phosphoramidite chemistry. Spacer phosphoramidite 18,
3'-amino-modifer C3 CPG, and 3'-fluorescein CPG were purchased from
Glen Research (Sterling, Va.). All other reagents were purchased
from PE Biosystems. Oiigonucleotides with 3'-amino modifications
and/or fluorescent labels were cleaved from the supports of
treatment with concentrated aqueous NH.sub.4OH, 2 h at 25.degree.
C. Texas Red labeling was achieved by adding 0.2 M NaHCO.sub.3 (150
.mu.L) and oligonucleotide (200 .mu.g) to tubes containing a
solution of Texas Red-X succinimidyl ester (500 .mu.g) (Molecular
Probes; Eugene, Oreg.) in anhydrous DMF (28 .mu.L). Following
overnight stirring at 25.degree. C., the majority of unreacted
label was removed by the addition of 3 M NaCl (20 .mu.L) and cold
ethanol (500 .mu.L), chilling in a dry ice-ethanol bath for 30
minutes, and centrifuging at 12,000 g for 30 minutes. The
supernatants were removed, the pelleted oligonucleotides were
washed with 70% ethanol (100 .mu.L)), and dried. FAMcZip13-Prd, a
fluorescein-labeled 70-mer that simulates a full-length LDR product
containing the complementary sequence to Zip13, was synthesized on
1000 .ANG. pore-size CPG. The sequence was:
5'-fluorescein-CGCACGATAGGTGGTCTACCGCTGATATAAACTTG- TGGGGA
GCTAGTGGCGTAGGCAAGAGTGCC-3' (SEQ. ID. No. 16) (the addressable
array-specific portion is in bold). Both labeled and unlabeled
oligonucleotides were purified by electrophoresis on 12% denaturing
polyacrylamide gels. Bands were visualized by UV shadowing, excised
from the gel, and eluted overnight in 0.5 M NaCl, 5 mM EDTA, pH 8.0
at 37.degree. C. Oligonucleotide solutions were desalted on C18
Sep-Paks (Waters Corporation; Milford, Mass.) according to the
manufacturer's instructions, following which the oligonucleotides
were concentrated to dryness (Speed-Vac) and stored at -20.degree.
C.
[0305] Polymer Coated Slides. Microscope slides (Fisher Scientific,
precleaned, 3 in..times.1 in..times.1.2 mm) were immersed in
2%-methacryloxypropyltrimethoxysilane-0.2% triethylamine in
CHCl.sub.3 for 30 min at 25.degree. C., and then washed with
CHCl.sub.3 (2.times.15 min). A monomer solution [20 L: 8%
acrylamide-2% acrylic acid-0.02% N,N'-methylene-bisacrylamide
(500:1 ratio of monomers:crosslinker)-0.8% ammonium persulfate
radical polymerization initiator] was deposited on one end of the
slides and spread out with the aid of a cover slip (24.times.50 mm)
that had been previously silanized [5% (CH.sub.3).sub.2SiCl.sub.2
in CHCl.sub.3]. Polymerization was achieved by heating the slides
on a 70.degree. C. hotplate for 4.5 min. Upon removal of the slides
from the hot plate, the cover slips were immediately peeled off
with aid of a single-edge razor blade. The coated slides were
rinsed with deionized water, allowed to dry in open atmosphere, and
stored under ambient conditions.
[0306] Addressable Arrays. Polymer-coated slides were pre-activated
by immersing them for 30 min at 25.degree. C. in a solution of 0.1
M 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride
plus 20 mM N-hydroxysuccinimide in 0.1 M
K.sub.2HPO.sub.4/KH.sub.2PO.sub.4, pH 6.0. The activated slides
were rinsed with water, and then dried in a 65.degree. C. oven;
they were stable upon storage for 6 months or longer at 25.degree.
C. in a desiccator over Drierite.
[0307] For manual spotting, 0.2 .mu.L aliquots were taken with a
Rainin Pipetman from stock solutions (500 .mu.M) of capture
oligonucleotides in 0.2 M K.sub.2HPO.sub.4/KH.sub.2PO.sub.4, pH
8.3, and deposited in a 3.times.3 array onto the pre-activated
polymeric surfaces. The resulting arrays were incubated for 1 h at
65.degree. C. in humidified chambers containing water-formamide
(1:1). For robotic spotting, 10-50 nL aliquots of capture
oligonucleotides (1.5 mM in the same buffer) were deposited at
25.degree. C. on the pre-activated surfaces by using a robot
equipped with a quill-type spotter in a controlled atmosphere
chamber. Two pairs of 3.times.3 arrays were spotted on each slide,
with addresses consisting of groups of four spots. Following
spotting using either method, uncoupled oligonucleotides were
removed from the polymer surfaces by soaking the slides in 300 mM
bicine, pH 8.0-300 mM NaCl-0.1% SDS, for 30 min at 65.degree. C.,
rinsing with water, and drying. The arrays were stored at
25.degree. C. in slide boxes until needed.
[0308] PCR Amplification of K-ras DNA Samples. PCR amplifications
were carried out under paraffin oil in 20 L reaction mixtures
containing 10 mM Tris.multidot.HCl, pH 8.3-1.5 mM MgCl.sub.2-50 mM
KCl, 800 .mu.M dNTPs, 2.5 .mu.M forward and reverse primers (12.5
pmol of each primer; see Table 12), and 1-50 ng of genomic DNA
extracted from paraffin-embedded tumors or from cell lines.
Following a 2 min denaturation step at 94.degree. C., 0.2 units of
Taq DNA polymerase (PE Biosystems) was added.
16TABLE 12 Primers and probes designed for K-ras mutation detection
by PCR/LDR/Array Hybridization. Primer/Probe Sequence (5' .fwdarw.
3') K-ras exon 1 forward ATAAGGCCTGCTGAAAATGACTGAA (SEQ. ID. No.
17) K-ras exon 1 reverse CTGCACCAGTAATATGCATATTAAAACAAG (SEQ. ID.
No. 18) cZip1-K-ras c12.2WtG
GCTGAGGTCGATGCTGAGGTCGCAAAACTTGTGGTAGTTG- GAGCTGG (SEQ. ID. No. 19)
cZip3-K-ras c12.2D GCTGCGATCGATGGTCAGGTGCTGAAACTTGTGGTAGTTGGAGCTGA
(SEQ. ID. No. 20) cZip5-K-ras c12.2A
GCTGTACCCGATCGCAAGGTGGTCAAACTTGTGGTAGTTGGAGCTG- C (SEQ. ID. No. 21)
cZip11-K-ras c12.2V CGCAAGGTAGGTGCTGTACCCGCAAAACTTGTGGTAGTTGGAGCTGT
(SEQ. ID. No. 22) K-ras c12 Com-2 pTGGCGTAGGCAAGAGTGCCT-fluorescein
(SEQ. ID. No. 23) pTGGCGTAGGCAAGAGTGCCT-Texaa Red (SEQ. ID. No. 24)
cZip13-K-ras c12.1S
CGCACGATAGGTGGTCTACCGCTGATATAAACTTGTGGTAGTTGGAGCT- A (SEQ. ID. No.
25) cZip15-K-ras c12.1R
CGCACGATAGGTGGTCTACCGCTGATATAAACTTGTGGTAGTTGGAGCTC (SEQ. ID. No.
26) cZip21-K-ras c12.1C GGTCAGGTTACCGCTGCGATCGCAATATAAACTTGTGGTAGT-
TGGAGCTT (SEQ. ID. No. 27) K-ras c12 Com-1
pGTGGCGTAGGCAAGAGTGCC-fluorescein (SEQ. ID. No. 28)
pGTGGCGTAGGCAAGAGTGCC-Texas Red (SEQ. ID. No. 29) cZip23-K-ras
c13.4D GGTCCGATTACCGGTCCGATGCTGTGTGGTAGTTGGAGCTGGTGA (SEQ. ID. No.
30) cZip25-K-ras c13.4WtG GGTCTACCTACCCGCACGATGGT-
CTGTGGTAGTTGGAGCTGGTGG' (SEQ. ID. No. 31) K-ras c13 Com-4
pCGTAGGCAAGAGTGCCTTGAC-fluorescein (SEQ. ID. No. 32)
pCGTAGGCAAGAGTGCCTTGAC-Texas Red (SEQ. ID. No. 33) The PCR primers
were specifically designed to amplify exon 1 of K-ras without
co-amplifying N- and H-ras. The allele-specific LDR probes
contained 24-mer addressable array specific portions on their
5'-ends (bold) and the discriminating bases on their 3'-ends
(underlined). The common LDR probes contained 5'-phosphates and
either a fluorescein or a Texas Red label on their 3'-ends.
[0309] Amplification was achieved by thermal cycling for 40 rounds
of 94.degree. C. for 15 sec and 1560.degree. C. for 2 min, followed
by a final elongation step at 65.degree. C. for 5 min. Following
PCR, 1 .mu.L of Proteinase K (18 mg/mL) was added, and reactions
were heated to 70.degree. C. for 10 min and then quenched at
95.degree. C. for 15 min. One .mu.L of each PCR product was
analyzed on a 3% agarose gel to verify the presence of
amplification product of the expected size.
[0310] LDR of K-ras DNA samples. LDR reactions were carried out
under paraffin oil in 20 .mu.L volumes containing 20 mM
Tris.multidot.HCl, pH 8.5-5 mM MgCl.sub.2-100 mM KCl, 10 mM DTT, 1
mM NAD.sup.+, 8 pmol total LDR probes (500 finol each of
discriminating probes+4 pmol fluorescently-labeled common probes),
and 1 pmol PCR products from cell line or tumor samples. Two probe
mixes were prepared, each containing the seven mutation-specific
probes, the three common probes, and either the wild-type
discriminating probe for codon 12 or that for codon 13 (FIG. 35C
and Table 12).
[0311] The reaction mixtures were pre-heated for 2 min at
94.degree. C., and then 25 fmol of wild-type Tth DNA ligase was
added. The LDR reactions were cycled for 20 rounds of 94.degree. C.
for 15 sec and 65.degree. C. for 4 min. An aliquot of 2 .mu.L of
each reaction was mixed with 2 L of gel loading buffer [8% blue
dextran, 50 mM EDTA, pH 8.0-formamide (1:5)], denatured at
94.degree. C. for 2 min, and chilled on ice. One .mu.L of each
mixture was loaded on a 10% denaturing polyacrylamide gel and
electrophoresed on an ABI 377 DNA sequencer at 1500 volts.
[0312] Hybridization ofK-ras LDR Products to DNA Arrays. The LDR
reactions (17 .mu.L) were diluted with 40 .mu.L of
1.4.times.hybridization buffer to produce a final buffer
concentration of 300 mM MES, pH 6.0-10 mM MgCl.sub.2-0.1% SDS.
Arrays were pre-incubated for 15 min at 25.degree. C. in IX
hybridization buffer. Coverwells (Grace, Inc; Sunriver, Oreg.) were
filled with the diluted LDR reactions and attached to the arrays.
The arrays were placed in humidified culture tubes and incubated
for 1 h at 65.degree. C. and 20 rpm in a rotating hybridization
oven. Following hybridization, the arrays were washed in 300 mM
bicine, pH 8.0-10 mM MgCl.sub.2-0.1% SDS for 10 min at 25.degree.
C. Fluorescent signals were measured using a microscope/CCD (see
"Image Analysis").
[0313] Hybridization of Synthetic LDR Products to DNA Arrays.
Quadruplicate hybridization mixtures were prepared containing 100
amol, 1 fmol, 3 fmol, 10 fmol, or 30 fmol FAMcZip13-Prd (a
synthetic 70-mer LDR product complementary to address 13) combined
with 4,500 fmol total fluorescein-labeled common LDR probes and
9.times.500 fmol of each unlabeled, addressable array-specific
portion containing discriminating LDR probe in 55 .mu.L of 300 mM
MES, pH 6.0-10 mM MgCl.sub.2-0.1% SDS. Hybridizations were
conducted according to the protocol described in the preceding
section, and FluorImager as well as epifluorescence microscopy data
were acquired and analyzed (see "Image Analysis").
[0314] LDR and Hybridization of G12V/G12 Dilution Series to DNA
Arrays. These experiments were carried out in a volume of 20 .mu.L.
PCR-amplified SW620 cell line DNA containing the G12V mutation was
diluted from 5 nM (100 fmol={fraction (1/20)}) to 0.050 nM (1
fmol={fraction (1/2,000)}) in LDR mixtures containing 100 nM (2,000
fmol) of wild-type (G12) DNA and 100 nM (2,000 fmol) of both G12V
discriminating probe and Texas Red-labeled common probe. The LDR
and hybridization proceeded as above, and imaging on the
microscope/CCD were carried out as detailed in "Image
Analysis".
[0315] Image Analysis. Arrays were imaged using a Molecular
Dynamics FluorImager 595 (Sunnyvale, Calif.) or an Olympus AX70
epifluorescence microscope (Melville, N.Y.) equipped with a
Princeton Instruments TE/CCD-512 TKBM1 camera (Trenton, N.J.). For
analysis of fluorescein-labeled probes on the FluorImager, the 488
nm excitation was used with a 530/30 emission filter. The spatial
resolution of scans was 100 .mu.m per pixel. The resulting images
were analyzed using ImageQuaNT software provided with the
instrument. The epifluorescence microscope was equipped with a 100
W mercury lamp, a FITC filter cube (excitation 480/40, dichroic
beam splitter 505, emission 535/50), a Texas Red filter cube
(excitation 560/55, dichroic beam splitter 595, emission 645/75),
and a 100 mm macro objective. The macro objective allows
illumination of an object field up to 15 mm in diameter and
projects a 7.times.7 mm area of the array onto the 12.3.times.12.3
mm matrix of the CCD. Images were collected in 16-bit mode using
the Winview32 software provided with the camera. Analysis was
performed using Scion Image (Scion Corporation, Frederick,
Md.).
Example 15
Capture Address Design
[0316] The approach of the present invention relies on designed
capture sequences of 24 bases, termed "address," which are very
different from each other and also lack any homology to either the
target sequence or to other sequences on the genome (Table 13).
17TABLE 13 Address sequences used in prototype array. Tetramer
Zip-code Sequence Zip# order* (5' .fwdarw. 3').dagger. Zip1
1-6-3-2-6-3 TGCG-ACCT-CAGC-ATCG-ACCT-CAGC-spacer-NH.sub.2 (SEQ. ID.
No. 34) Zip3 3-6-5-2-2-3
CAGC-ACCT-GACC-ATCG-ATCG-CAGC-spacer-NH.sub.2 (SEQ. ID. No. 35)
Zip5 5-6-1-2-4-3 GACC-ACCT-TGCG-ATCG-GGTA-CAGC-spacer-NH.sub.2
(SEQ. ID. No. 36) Zip11 1-4-3-6-6-1
TGCG-GGTA-CAGC-ACCT-ACCT-TGCG-spacer-NH.sub.2 (SEQ. ID. No. 37)
Zip13 3-4-5-6-2-1 CAGC-GGTA-GACC-ACCT-ATCG-TGCG-spacer-NH.sub.2
(SEQ. ID. No. 38) Zip15 5-4-1-6-4-1
GACC-GGTA-TGCG-ACCT-GGTA-TGCG-spacer-NH.sub.2 (SEQ. ID. No. 39)
Zip21 1-2-3-4-6-5 TGCG-ATCG-CAGC-GGTA-ACCT-GACC-spacer-NH.sub.2
(SEQ. ID. No. 40) Zip23 3-2-5-4-2-5
CAGC-ATCG-GACC-GGTA-ATCG-GACC-spacer-NH.sub.2 (SEQ. ID. No. 41)
Zip25 5-2-1-4-4-5 GACC-ATCG-TGCG-GGTA-GGTA-GACC-spacer-NH.sub.2
(SEQ. ID. No. 42) * Order of tetramer oligonucleotide segments in
the corresponding address sequence. Six tetramers, randomly chosen
from a full set of thirty-six, are: 1 = TGCG; 2 = ATCG; 3 = CAGC; 4
= GGTA; 5 = GACC; 6 = ACCT. Closely related sequences, {Zip1, 3,
5+56, {Zip11, 13, 15} and {Zip21, 23, 25} differ at the first,
third, and fifth tetramer positions, but are identical at the
second, fourth, and sixth tetramer positions.
.dagger.spacer-NH.sub.2 =
PO.sub.4(CH.sub.2CH.sub.2O).sub.6PO.sub.3(-
CH.sub.2).sub.3NH.sub.2
[0317] Each address sequence is a combination of six sets of
tetramers such that the full length 24-mers have similar T.sub.m
values ranging from 70.degree. C.-82.degree. C. (calculated using
Oligo 6.0, Molecular Biology Insights, Inc., Plymouth Minn. and
Cascade, Colo.). An initial group of thirty-six tetramers was
developed where each tetramer differed from all others by at least
two bases and was neither self-complementary nor complementary to
any other tetramer (see Tables 1 and 13). Tetramers were combined
such that each address sequence differs from all others by at least
three alternating tetramer units (Table 13). This ensures that each
address differs from all other addresses by at least 6 bases, thus
preventing even the closest addressable array-specific portion of
the oligonucleotide probe sets from cross-hybridizing (T.sub.m
values of correct hybridizations are at least 24.degree. C. higher
than of any incorrect hybridization). The presence and type of each
mutation is determined from the positions of those addresses at
which signals are observed. Since different mutation-specific LDR
probes can be appended to the same set of address complement
sequences, this array is universal, and can be programmed to detect
mutations in any gene.
Example 16
Array Preparation
[0318] Numerous types of two- and three-dimensional matrices were
examined with respect to: (i) ease of preparation of the surface;
(ii) oligonucleotide loading capacity; (iii) stability to
conditions required for coupling of oligonucleotides, as well as
for hybridization and washing; and (iv) compatibility with
fluorescence detection. The preferred methodology to construct
addressable arrays involves initial creation of a lightly
crosslinked film of acrylamide/acrylic acid copolymer on a glass
solid support; subsequently, the free carboxyl groups dispersed
randomly throughout the polymeric surface are activated, and amine
terminated capture oligonucleotides are added to form covalent
amide linkages (FIGS. 34A-B and 36A). The described coupling
chemistry is rapid, straightforward, efficient, and amenable to
both manual and robotic spotting. Both the activated surfaces and
the surfaces with attached oligonucleotides are stable to long-term
storage.
Example 17
Optimization of Hybridization Conditions
[0319] Hybridizations of a fluorescently-labeled 70-mer probe onto
model addressable arrays were measured as a function of buffer,
metal cofactors, volume, pH, time, and the mechanics of mixing
(Table 14). Even with closely related addresses,
cross-hybridization was negligible or non-existent, with a
signal-to-noise ratio of at least 50:1. These experiments suggest
that different addresses undergo hybridization at approximately the
same rate, i.e., the level of fluorescent signal is relatively
uniform when normalized for the amount of oligonucleotide coupled
per address. Magnesium ion was obligatory to achieve hybridization,
and less than 1 fmol of probe could be detected in the presence of
this divalent cation (Table 14; FIG. 37). The hybridization signal
was doubled upon lowering the pH from 8.0 to 6.0, most likely due
to masking of negative charges (hence reducing repulsive
interactions with oligonucleotides) arising from uncoupled acrylic
acid groups in the bulk polymer matrix. To confirm this hypothesis,
the free carboxyl groups on arrays to which capture
oligonucleotides had already been attached were capped with
ethanolamine under standard coupling conditions. Hybridizations of
the capped arrays at pH 8.0 gave results comparable to
hybridizations at pH 6.0 of the same arrays without capping.
Continuous mixing proved to be crucial for obtaining good
hybridization, and studies of the time course led to 1 h at
65.degree. C. being chosen as the standard. Reducing the
hybridization volume improved the hybridization signal due to the
relative increase in probe concentration. Further improvements may
be achieved using specialized small volume hybridization chambers
that allow for continuous mixing.
18TABLE 14 Effect of hybridization conditions on hybridization
signal.* Hybridization Vol. Time Relative Buffer (L)
Mixing.sup..dagger. (min) Signal Buffer A 55 Inter. 30 1 Buffer A
minus MgCl.sub.2 55 Inter. 30 <0.01 Buffer A 20 Inter. 30 2.5
Buffer B 55 Inter. 30 2 Buffer B 20 Inter. 30 3 Buffer B 55 Cont.
30 4 Buffer B 55 Cont. 60 8 Buffer A + Capped Surface 55 Cont. 60 8
Buffer B minus MgCl.sub.2 55 Cont. 60 <0.01 Buffer B 55 Cont.
180 10 *Hybridizations were carried out with 1 pmol FAMcZip13-Prd
and 3 .times. 3 manually spotted arrays. Buffers were - Buffer A:
300 mM bicine, pH 8.0-10 mM MgCl.sub.2-0.1% SDS; Buffer B: 300 mM
MES, pH 6.0-10 mM MgCl.sub.2-0.1% SDS. .sup..dagger.Mixing was -
Intermittent (Inter.): manual mixing of the sample once every ten
min; Continuous (Cont.): mixing of sample at 20 rpm in a
hybridization oven.
Example 18
Array Hybridization of K-ras LDR Products
[0320] PCR/LDR amplification coupled with detection on an
addressable array was tested with the K-ras gene as a model system.
Exon-specific PCR primers were used to selectively amplify K-ras
DNA flanking codons 12 and 13. LDR probes were designed to detect
the seven most common mutations found in the K-ras gene in
colorectal cancer (FIG. 35C, Table 14). For example, the second
position in codon 12, GGT, may mutate to GAT, coding for aspartate,
which is detected by ligation of the allele-specific probe
containing an addressable array-specific portion complement, cZip3,
on its 5'-end, and a discriminating base, A, on its 3'-end to a
fluorescently labeled common probe (FIG. 35C).
[0321] PCR/LDR reactions were carried out on nine individual DNA
samples derived from cell lines or paraffin-embedded tumors
containing known K-ras mutations. An aliquot (2 .mu.L) was taken
from each reaction and electrophoresed on a sequencing apparatus to
confirm that LDR was successful. Next, the different mutations were
distinguished by hybridizing the LDR product mixtures on 3.times.3
addressable DNA arrays (each address was spotted in quadruplicate),
and detecting the positions of fluorescent spots (FIG. 36B and FIG.
39). The wild-type samples, Wt(G12) and Wt(G13), each displayed
four equal hybridization signals at Zip1 and Zip25, respectively,
as expected. The mutant samples each displayed hybridization
signals corresponding to the mutant, as well as for the wild-type
DNA present in the cell line or tumor. The sole exception to this
was the G12V sample, which was derived from a cell line (SW620)
homozygous for the G12V K-ras allele. The experiment was repeated
several times, using both manually and robotically spotted arrays,
and LDR probes labeled with either fluorescein or Texas Red.
False-positive or false-negative signals were not encountered in
any of these experiments. A minimal amount of noise seen on the
arrays can be attributed to dust, scratches, and/or small bubbles
in the polymer. These flaws are readily recognized, because they
are weak and sporadic, rather than reproducing the quadruplicate
spotting pattern; such noise will be minimized with more stringent
manufacturing conditions.
Example 19
Array Capture Sensitivity
[0322] After an LDR reaction, an excess of unligated discriminating
probe competes with the successfully ligated and
fluorescently-labeled LDR product for hybridization to the correct
address on the array. To determine capture sensitivity, DNA arrays
were hybridized in quadruplicate, under standard conditions, with
from 100 amol (=1/90,000) to 30 (=1/300) fmol of a labeled
synthetic 70-mer, FAMcZip13-Prd (this simulates a full-length LDR
product; see Materials and Methods for sequence), in the presence
of a full set of K-ras LDR probes (combined total of 9,000 fmol of
discriminating and common probes). Array analyses with a
FluorImager (FIG. 37, left side) indicate that a signal-to-noise
ratio of greater than 3:1 can be achieved when starting with a
minimum of 3 fmol (.about.{fraction (1/3,000)}) of FAMcZip13-Prd
labeled probe in the presence of 4,500 fmol FAM-labeled LDR probes
and 4,500 fmol of probes containing an addressable array-specific
portion in the hybridization solution. Results using microscope/CCD
instrumentation to quantify fluorescence were even more striking: a
3:1 signal-to-noise ratio can be maintained starting with 1 fmol
(={fraction (1/9,000)}) labeled product (FIG. 37, right side), and
it is expected that the limit can be extended to 100 amol after
further optimization. For a given array, with fluorescence
quantified by either instrument, the captured counts varied
linearly with the amount of labeled FAMcZip13-Prd added.
Rehybridization of the same probe, at the same concentration, to
the same array, was reproducible within .+-.5%. Variations in
fluorescent signal between arrays may reflect variations in the
amount of capture oligonucleotide coupled, due to the inherent
inaccuracies of manual spotting and/or variations in polymer
uniformity.
Example 20
Detection of Low Abundance Mutations by PCR/LDR/Array
Hybridization.
[0323] To determine the limit of detection of low level mutations
in wild-type DNA using PCR/LDR/array hybridization, a dilution
series was set up and analyzed. PCR-amplified pure G12V DNA was
diluted into wild-type K-ras DNA in ratios ranging from 1:20 to
1:500. Duplicate LDR reactions were carried out on 2,000 fmol total
DNA, using a two-probe set consisting of 2,000 fmol each of the
discriminating and common probes for the G12V mutation. It proved
possible to quantify a positive hybridization signal at a dilution
of 1:200 (FIG. 38); signal was distinguishable even at a dilution
of 1:500, although noise levels due to dust or bubbles in the
polymer prevented accurate quantification of the results in the
latter case. A control of pure wild-type DNA showed no
hybridization signal. These results indicate clearly that
addressable array hybridization, when coupled with PCD/LDR, may
detect polymorphisms present at less than 1% of the total DNA.
These results are consistent with earlier work showing that
PCR/LDR, using a 26-probe set and analyses based on gel
electrophoreses of products, can detect any K-ras mutation in the
presence of up to a 500-fold excess of wild-type, with a signal to
noise ratio of at least 3:1.
Example 21
Polymerization of an Acrylamide-Acrylic Acid Polymer on the Surface
of a Glass Slide Coated with
.gamma.-methacryloxypropyltrimethoxysilane.
[0324] 100 mg of bis-acryloylcystamine (Sigma) was added to 10 ml
of 19% acrylamide-1% bisacrylamide (w/v) solution in water to
produce a 1% (v/v) concentration of acrylic acid. The mixture was
polymerized after adding 33 .mu.l of 2% (w/v) ammonium persulfate
(Biorad), and 1 .mu.l of TEMED per 100 .mu.l aliquot. 25 .mu.l of
the TEMED activated solution was applied to a
.gamma.-methacryloyloxypropyltrimethoxysilane coated glass slide,
as described in Example 9, and allowed to polymerize under a glass
coverslip coated with dichlorodimethylsilane, as described in
Example 10.
Example 22
Attachment of Dye and Dye-labeled Oligonucleotide to an
Acrylamide-Bisacrylamide-Acrylic Acid Copolymer
[0325] A wedge gel composed of acrylamide-bisacrylamide-acrylic
acid copolymer was prepared on a solid support, silanized with
y-methacryloxypropyltrimethoxysilane as described in Example 9.33
.mu.l of 2% ammonium persulfate was added to 1 ml of
acrylamide-bisacrylamide-a- crylic acid (9.5%:0.5%:1% w/v)
solution. 1 .mu.l of TEMED was added to a 100 .mu.l aliquot and 20
.mu.l of this mixture applied to the silanized solid support.
[0326] 0.1 M Fluoresceinamine (Research Organics), 0.1 M
Bodipy-FL-NHS (Molecular Probes) with 0.1 M putrescein, and an
amino-derivatized fluorescein labeled oligonucleotide each in 0.1 M
phosphate buffer pH 7 and 50 mM EDC (Pierce) were applied to the
wedge gel. Coupling was allowed to proceed for 30 min in a
humidified chamber at room temperature. Relative fluorescence units
were measured on a Molecular Dynamics 595 Fluorimager with 488 nm
excitation, 513 nm emission and 700 V potential on the
photomultiplier tube. Table 15 shows relative fluorescence for dyes
attached to the surface. In areas of comparable depth on the gel,
Bodipy-FL had the highest RFU despite being linked to the matrix
via putrescein, whereas fluorescein-amine had lower signal despite
direct attachment to the matrix. Bodipy-FL is known to be less pH
sensitive than fluorescein which may account for the nearly 5-fold
RFU difference. The fluorescein labeled oligonucleotide coupled to
the surface with over 5-fold lower RFUs than fluorescein. The
lowest signal was observed with the fluorescein labeled
amino-oligonucleotide. Dye appeared to more efficiently attach to
the matrix than the oligonucleotide, likely because it can more
readily penetrate the matrix. The ability of the dye to penetrate
the matrix was shown, as in FIG. 40, through measuring relative
fluorescence units (RFU) of the dye along the maximal depth
gradient of a wedge gel. Fluorescein amine RFUs increase as the
thickness of the gel increases.
19TABLE 15 Quantification of relative fluorescence of dye and
oligonucleotides attached to an acrylamide/acrylic acid copolymer
integrated signal Standard Dye attachment (total RFU*) Deviation
Bodipy-FL-NHS putrescein 3895940 701 Fluorescein amine 825186 239
Fluorescein amino-oligonucleotide 144178 326 *RFU = relative
fluorescence units
Example 23
Amplification of BRCA1 and BRCA2 exons for PCR/LDR Detection of
Wild-Type and Mutant Alleles.
[0327] Amplification from genomic DNA was performed starting with a
20 .mu.l reaction mixture containing 50 ng of DNA, 2.5 mM of each
dNTP, 1.times.TCK buffer (20 mM tricine, 200 .mu.g/ml bovine serum
albumin, and 50 mM potassium acetate), and 0.25 UTaq polymerase. To
amplify BRCA1 exon 20 and BRCA2 exon 11, 4 pmol of each forward and
reverse primer were used, with 8 pmol each of BRCA1 exon 2 primers.
The tube was overlaid with mineral oil and preincubated for 1.5
min. at 94.degree. C. A hot start was performed by adding 1 .mu.l
of polymerase diluted in 1.times.buffer to introduce the required
units of polymerase. Each segment was amplified for 40 cycles. Each
cycle consisted of a melting step 94.degree. C. for 15 sec, and a
combined anneal--extension step at 55.degree. C. for 2 min. After
the last cycle, the reactions were held at 55.degree. C. for an
additional 5 min. After PCR, the reactions were treated with
proteinase K for 10 min at 70.degree. C. and 15 min at 90.degree.
C.
[0328] The PCR products were used as templates for competitive LDR
designed to distinguish wild-type from mutant alleles, detectable
on a gel as bands of distinct size with different fluorescent dyes
for each allele. The common probes are 5' phosphorylated and
blocked (Bk) at the 3' terminus with a C3 spacer. Ligation
reactions used 500 fmol of each discrimination probe and 750 fmol
of each common probe, with 15 sec of denaturation at 94.degree. C.
and 2 min of ligation at 65.degree. C. for 10 cycles. LDR products
were separated by electrophoresis using a 10% acrylamide gel and
detected on an ABI 373 fluorecence sequencer. ABI TAMRA-350 size
standards were added to LDR samples.
[0329] LDR probes were redesigned to include addressable
array-specific portions for capture to specific complement
addresses on an array. Two approaches were developed. In the first,
one address was on the array per LDR target with different dyes to
identify each allele (Table 16).
20TABLE 16 Probes for detecting 3 specific mutations in BRCA 1 and
BRCA 2. Capture by hybridization to one address on the array per
LDR target, and signal from different fluorescent dyes to
discriminate between each allele. Mutation Probe Sequence BRCA1
exon2 common Phos-TGTCCCATCTGGTAAGTCAGCACAAAC- (SEQ. ID. No. 43)
185delAG BC1X2PZip1R GCTGAGGTCGATGCTGAGGTGCGA-Block wild-type
Fluor-AACATTAATGCTATGCAGAAAATCTTAGAG (SEQ. ID. No. 44) BC1X2F1WT
mutant Tet-GTCATTAATGCTATGCAGAAAATCTTAG (SEQ. ID. No. 45)
BC1X2TetMT BRCA1 exon20 common Phos-AGGACAGAAAGGTAAAGCTCCCTCC-
(SEQ. ID. No. 46) 5382insC BC1X20PZip3R
GCTGCGATCGATGGTCAGGTGCTG-Block wild-type
Fluor-CAAAGCGAGCAAGAGAATCCC (SEQ. ID. No. 47) BC1X20F1WT mutant
Tet-ACAAAGCGAGCAAGAGAATCCCC (SEQ. ID. No. 48) BC1X20TetMT BRCA2
exon11 common Phos-GGAAAATCTGTCCAGGTATC- AGAT- (SEQ. ID. No. 49)
6174de1T BC2X11PZ5R GCTGTACCCGATGCGAAGGTGGT- C-Block wild-type
Fluor-CAACTTGTGGGATTTTTAGCACAGCAAGT (SEQ. ID No. 50) BC2X11F1WT
mutant Tet-TACTTGTGGGATTTTTAGCACAGCAAG (SEQ. ID. No. 51)
BC2X11EMT
[0330] The probes hybridize to wild-type and mutant PCR products,
but ligate only when both probes are perfectly matched with no gaps
or overlaps (FIG. 41). Each addressable array-specific portion of
the discriminating probe directs the LDR products to a specific
address on the array. In the second approach, all LDR probes that
discriminate between the presence and absence of a mutation have
unique addressable array-specific portions which direct each LDR
product to individual addresses (Table 17).
21TABLE 17 Probes for detecting 3 specific mutations in BRCA 1 and
BRCA 2. Capture on array by hybridization to one unique array
address per Allele Signal derived from a single fluorescent dye.
Mutation Probe Sequence BRCA1 common
Phos-TGTCCCATCTGGTAAGTCAGCACAAAC-Fluor (SEQ. ID. No. 52) exon2
BC1X2PF 185delAG wild-type GCTGGCGACGATTACCAGGTCGAT- (SEQ. ID. No.
53) BC1X2WTZip2R AACATTAATGCTATGCAGAAAATCTTAGAG mutant
GCTGGCTGCGATAGGTAGGTTACC- (SEQ. ID. No. 54) BC1X2MTZip4R
GTCATTAATGCTATGCAGAAAATCTTAG BRCA1 common
Phos-AGGACAGAAAGGTAAAGCTCCCTCC-Fluor (SEQ. ID. No. 55) exon20
BC1X20PF 5382insC wild-type GCGAGCGAAGGYFACCTACCCGAT- (SEQ. ID. No.
56) BC1X20WTZip12R CAAAGCGAGCAAGAGAATCCC mutant
GCGACGATAGGTGGTCTACCGCTG- (SEQ. ID. No. 57) BC1X20MTZip13R
ACAAAGCGAGCAAGAGAATCCCC BRCA2 common
Phos-GGAAAATCTGTCCAGGTATCAGAT-Fluor (SEQ. ID. No. 58) exon11
BC2X11PF 6174de1T wild-type GCGAGCTGAGGTAGGTTACCTACC- (SEQ. ID. No.
59) BC2X11WTZip14R CAACTTGTGGGATTTTTAGCACAGCAAGT mutant
GCGATACCAGGTGCGATACCGGTC- (SEQ. ID. No. 60) BC2X11MTZ15R
TACTTGTGGGATTTTTAGCACAGCAAG
[0331] Only one dye is required (FIG. 43). These products can be
separated by size on a gel to determine the presence or absence of
mutations (FIG. 44). PCR products were screened by LDR for
mutations in parallel using both the single and double dye probe
approaches. Both gels were loaded with LDR products from the same
samples and both show comparable levels of each LDR product. The
dual dye approach makes it easier to visually discriminate mutant
versus wild-type product on the gel since the products may not
fully separate on the gel. However, addressable array-specific
portion hybridization on an array allows complete physical
separation on the array and a single dye is sufficient in this
case. The array was made with multiple addresses (Table 18), four
of each spotted as a group to test reproducibility (FIG. 44).
22TABLE 18 Capture probes coupled to array. Probes Sequence 1
AmSpZip1 AminolinkerSpacerTCGCACCTCAGCA- TCGACCTCAGC (SEQ. ID. No.
61) 2 AmSpZip2 AminolinkerSpacerATCGACCTGGTAATCGTCGCCAGC (SEQ. ID.
No. 62) 3 AmSpZip3 AminolinkerSpacerGAGCACCTGACCATCGATCGCAGC (SEQ.
ID. No. 63) 4 AmSpZip4 AminolinkerSpacerGGTAACCTACCTATCGCAGCCAGC
(SEQ. ID. No. 64) 5 AmSpZip5 AminolinkerSpacerGACCACCTTCG-
CATCGGGTACAGC (SEQ. ID. No. 65)
[0332] The array was imaged on an Olympus Provis AX70 microscope
using a 100 W mercury burner, fluorescein and rhodamine filter
cubes and a Princeton Instruments TEK512/CCD camera.
[0333] The FAM labeled LDR products were imaged independently from
the TET labeled LDR products. The 16-bit greyscale images were
rescaled to more narrowly bracket the LDR signal before conversion
to 8-bit greyscale. The 8-bit images were colored using Photoshop,
where FAM (wild-type) was rendered green, and TET (mutant) was
rendered red (FIG. 45). Finally these images were overlaid in
register to produce the combined image where the presence of both
wild-type and mutant alleles at an address appears yellow.
Wild-type alleles were present in each sample, and only the
addresses complementary to LDR product addressable array-specific
portions had detectable signal. Thus, addressable array
hybridization is very specific. The gel lanes for each sample
hybridized on arrays are shown. The presence of a mutation in each
sample is indicated by underlining the corresponding description of
the array address and the gel band. In each case, the array
reproduced the result of the gel. The dual label approach is
capable of identifying the presence of wild-type and mutant alleles
on the same array address, and this method can identify homozygous
or heterozygous individuals
Example 24
Array Preparation and Use in Hybridization Reactions
[0334] When compared to monolayer coverage of a support, a polymer
coating on a glass microscope slide offers increased coupling
capacity of the capture probes. Toward this end, a support was
prepared with a layer of neutral polymer up to 20 microns thick.
The polymer was an acrylamide based material doped with glycerol
monomethacrylate. When oxidized, the vicinol diols of the glycerol
monomethacrylate were converted to aldehydes which served as anchor
points for the amine-terminated oligonucleotide capture probes.
[0335] To anchor the polymer to the surface, the glass is first
silanized with 3-(trimethoxysilyl)propyl methacrylate according to
the procedure of S. Savard, et al., "Hydrolysis and Condensation of
Silanes in Aqueous Solutions," Polym Compos 5:242-249 (1984), which
is hereby incorporated by reference. A dilute aqueous HCl solution,
pH 2-4, of 3-(trimethoxysilyl)propyl methacrylate (0.04 M) is
vigorously stirred at 25.degree. C. for 30 minutes. Clean
3.times.1" microscope slides (prepared according to Example 8) are
incubated with occasional agitation in this solution for 30 minutes
at 25.degree. C., rinsed in deionized water, blown dry with
nitrogen, and used within 24 hours.
[0336] One and one-thousandth inch stainless steel shims are
positioned on three sides between the methacrylate treated slide
and a second microscope slide which has been rendered hydrophobic
(10% v/v dichlorodimethylsilane in toluene). E. N. Timofeev, et
al., "Regioselective Immobilization of Short Oligonucleotides to
Acrylic Copolymer Gels," Nucleic Acids Res. 24:3142-3148 (1996),
which is hereby incorporated by reference. The three edges
supported by the shims are held in place with clamps leaving a one
1 inch edge of the microscope slide open. The cavity thus formed is
filled with a polymerizable solution containing
N,N-dimethylacrylamide (0.9 M), glycerol monomethacrylate (0.1 M)
(Polysciences, Inc. Warrington, Pa.), N,N-methylene-bisacrylamide
crosslinker (0.0027 M), with N,N,N',N', tetramethylethylenediamine
(0.2% v/v) and freshly prepared 10% ammonium persulfate (2% v/v) to
initiate polymerization. The polymerization proceed for 30 min at
25.degree. C., and the "sandwich" is disassembled. The polymeric
film is rinsed in deionized water, allowed to dry, and stored at
4.degree. C. until further use.
[0337] As practiced in the aforementioned reference, a conventional
protocol is used, employing oxidation with NaIO.sub.4 to generate
an aldehyde in its gel form, a custom designed precursor
copolymerized with N,N-dimethylacrylamide. The aldehyde in the
present invention is generated by treatment of the vicinol diol of
glycerol monomethacrylate with NaIO.sub.4 (0.1 M, 25.degree. C., 1
hour). The aldehyde containing matrix is soaked in deionized water
(1 hour, 25.degree. C.). The slides are removed from the bath, and
excess water is blown off the hydrated surface with a stream of
nitrogen. The polymer is allowed to dry (30 minutes, 25.degree.
C.). Using a 0.5 .mu.l capacity syringe, 0.1 .mu.l of a
fluorescently labeled 24-mer capture oligonucleotide probe (500
.mu.M in 0.2 M sodium acetate buffer at pH .about.5) containing a
primary, terminal amine is deposited onto the aldehydic surface.
One-tenth microliter of sodium cyanoborohydride (0.1 M) is
deposited directly on top of the liquid containing the address. The
reductive amination is allowed to proceed for 24 hours in a
humidity chamber (25.degree. C.). After the coupling reaction, the
matrix is soaked in bicine buffer (300 mM, pH 8), containing 300 mM
NaCl and 0.1% sodium dodecylsulfate for 30 min at 65.degree. C. The
slides are rinsed in deionized water, blown dry with nitrogen and
stored in a desiccator.
[0338] Hybridization are run according to Example 14.
[0339] Fluorescent images are obtained with a Spot Camera from
Universal Imaging using a mercury vapor lamp at a magnification of
4.times.. The exposure time for a rhodamine labeled complement is
10 seconds. Metamorph is used to quantify the amount of light
signal above background. The original image is reduced to 50% and a
circle with a 400 pixel diameter is integrated.
[0340] Table 19 shows capture performance of slides prepared in the
above manner.
23TABLE 19 Fluorescent Quantification of captured probe Fluorescent
counts at Fluorescent counts at Probe capture oligonucleotide 11
capture oligonucleotide 13 Slide 1 11 3.92 .times. 10.sup.6 no
detectable reading Slide 2 11 2.04 .times. 10.sup.6 no detectable
reading Slide 3 11 2.55 .times. 10.sup.6 no detectable reading
Slide 1 13 no detectable reading 5.86 .times. 10.sup.6 Slide 2 13
no detectable reading 2.66 .times. 10.sup.6 Slide 3 13 no
detectable reading 7.25 .times. 10.sup.6
[0341] The present approach to mutation detection has three
orthogonal components: (i) primary PCR amplification; (ii)
solution-phase LDR detection; and (iii) solid-phase hybridization
capture. Therefore, background signal from each step can be
minimized, and, consequently, the overall sensitivity and accuracy
of the present method are significantly enhanced over those
provided by other strategies. For example, "sequencing by
hybridization" methods require: (i) multiple rounds of PCR or
PCR/T7 transcription; (ii) processing of PCR amplified products to
fragment them or render them single-stranded; and (iii) lengthy
hybridization periods (10 h or more) which limit their throughput
(Guo, et al., Nucleic Acids Res., 22:5456-5465 (1994); Hacia,
et.al., Nat. Genet. 14441-447 (1996); Chee, et al., Science,
274:610-614 (1996); Cronin, et al., Human Mutation. 7:244-255
(1996); Wang, et al., Science, 280:1077-1082 (1998); Schena, et
al., Proc. Natl. Acad. Sci. USA, 93:10614-10619 (1996); and Shalon,
et al., Genome Res., 6:639-645 (1996), which are hereby
incorporated by reference). Additionally, since the immobilized
probes on these arrays have a wide range of T.sub.m's, it is
necessary to perform the hybridizations at temperatures from
0.degree. C. to 44.degree. C. The result is increased background
noise and false signals due to mismatch hybridization and
non-specific binding, for example on small insertions and deletions
in repeat sequences (Hacia, et.al., Nat. Genet. 14441-447 (1996);
Cronin, et al., Human Mutation. 7:244-255 (1996); Wang, et al.,
Science, 280:1077-1082 (1998); and Southern, E. M., Trends in
Genet., 12:110-115 (1996), which are hereby incorporated by
reference). In contrast, the approach of the present invention
allows multiplexed PCR in a single reaction (Belgrader, et al.,
Genome Sci. Technol., 1:77-87 (1996), which is hereby incorporated
by reference), does not require an additional step to convert
product into single-stranded form, and can readily distinguish all
point mutations including slippage in repeat sequences (Day, et
al., Genomics, 29:152-162 (1995), which is hereby incorporated by
reference). Alternative DNA arrays suffer from differential
hybridization efficiencies due to either sequence variation or to
the amount of target present in the sample. By using the present
approach of designing divergent address sequences with similar
thermodynamic properties, hybridizations can be carried out at
65.degree. C., resulting in a more stringent and rapid
hybridization. The decoupling of the hybridization step from the
mutation detection stage offers the prospect of quantification of
LDR products, as has already been achieved using gel-based LDR
detection.
[0342] Arrays spotted on polymer surfaces provide substantial
improvements in signal capture, as compared with arrays spotted or
synthesized in situ directly on glass surfaces (Drobyshev, et al.,
Gene, 188:45-52 (1997); Yershov, et al., Proc. Natl. Acad. Sci.
USA, 93:4913-4918 (1996); and Parinov, et al., Nucleic Acids Res.,
24:2998-3004 (1996), which are hereby incorporated by reference).
However, the polymers described by others are limited to using 8-
to 10-mer addresses while the polymeric surface of the present
invention readily allows 24-mer capture oligonucleotides to
penetrate and couple covalently. Moreover, LDR products of length
60 to 75 nucleotide bases are also found to penetrate and
subsequently hybridize to the correct address. As additional
advantages, the polymer gives little or no background fluorescence
and does not exhibit non-specific binding of fluorescently-labeled
oligonucleotides. Finally, capture oligonucleotides spotted and
coupled covalently at a discrete address do not "bleed over" to
neighboring spots, hence obviating the need to physically segregate
sites, e.g., by cutting gel pads.
[0343] The present invention relates to a strategy for
high-throughput mutation detection which differs substantially from
other array-based detection systems presented previously in the
literature. In concert with a polymerase chain reaction/ligase
detection reaction (PCR/LDR) assay carried out in solution, the
array of the present invention allows for accurate detection of
single base mutations, whether inherited and present as 50% of the
sequence for that gene, or sporadic and present at 1% or less of
the wild-type sequence. This sensitivity is achieved, because
thermostable DNA ligase provides the specificity of mutation
discrimination, while the divergent addressable array-specific
portions of the LDR probes guide each LDR product to a designated
address on the DNA array. Since the address sequences remain
constant and their complements can be appended to any set of LDR
probes, the addressable arrays of the present invention are
universal. Thus, a single array design can be programmed to detect
a wide range of genetic mutations.
[0344] Robust methods for the rapid detection of mutations at
numerous potential sites in multiple genes hold great promise to
improve the diagnosis and treatment of cancer patients. Noninvasive
tests for mutational analysis of shed cells in saliva, sputum,
urine, and stool could significantly simplify and improve the
surveillance of high risk populations, reduce the cost and
discomfort of endoscopic testing, and lead to more effective
diagnosis of cancer in its early, curable stage. Although the
feasibility of detecting shed mutations has been demonstrated
clearly in patients with known and genetically characterized tumors
(Sidransky, et al., Science, 256:102-105 (1992), Nollau, et al.,
Int. J. Cancer, 66:332-336 (1996); Calas, et al., Cancer Res.
54:3568-73 (1994); Hasegawa, et al., Oncogene 10:1413-16 (1995);
and Wu et al., Early Detection of Cancer Molecular Markers
(Lippman, et al. ed.) (1994), which are hereby incorporated by
reference), effective presymptomatic screening will require that a
myriad of potential low frequency mutations be identified with
minimal false-positive and false-negative signals. Furthermore, the
integration of technologies for determining the genetic changes
within a tumor with clinical information about the likelihood of
response to therapy could radically alter how patients with more
advanced tumors are selected for treatment. Identification and
validation of reliable genetic markers will require that many
candidate genes be tested in large scale clinical trials. While
costly microfabricated chips can be manufactured with over 100,000
addresses, none of them have demonstrated a capability to detect
low abundance mutations (Hacia, et.al., Nat. Genet. 14441-447
(1996); Chee, et al., Science, 274:610-614 (1996); Kozal, et al.,
Nat. Med., 2:753-759 (1996); and Wang, et al., Science,
280:1077-1082 (1998), which are hereby incorporated by reference),
as required to accurately score mutation profiles in such clinical
tials. The universal addressable array approach of the present
invention has the potential to allow rapid and reliable
identification of low abundance mutations in multiple codons in
numerous genes, as well as quantification of multiple gene
deletions and amplifications associated with tumor progression. In
addition, for mRNA expression profiling, the LDR-universal array
can differentiate highly homologous genes, such as K-, N-, and
H-ras. Moreover, as new therapies targeted to specific genes or
specific mutant proteins are developed, the importance of rapid and
accurate high-throughput genetic testing will undoubtedly
increase.
[0345] Although the invention has been described in detail for the
purpose of illustration, it is understood that such details are
solely for that purpose and variations can be made therein by those
skilled in the art without departing from the spirit and scope of
the invention which is defined by the following claims.
Sequence CWU 1
1
65 1 24 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 1 tgcgggtaca gcacctacct tgcg 24 2 24 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide 2
atcgggtagg taaccttgcg tgcg 24 3 24 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 3 cagcggtaga
ccacctatcg tgcg 24 4 24 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 4 ggtaggtaac ctacctcagc tgcg 24
5 24 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 5 gaccggtatg cgacctggta tgcg 24 6 24 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide 6
atcgggtagg taaccttgcg tgcg 24 7 24 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 7 ggtaggtaac
ctacctcagc tgcg 24 8 24 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 8 atcgggtagg taaccttgcg tgcg 24
9 24 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 9 ggtaggtaac ctacctcagc tgcg 24 10 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 10 atcgggtagg taaccttgcg tgcg 24 11 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 11 cagcacctga ccatcgatcg cagc 24 12 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 12 atcgggtagg taaccttgcg tgcg 24 13 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 13 ggtaggtaac ctacctcagc tgcg 24 14 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 14 cgcacgcaag gttacctacc cgat 24 15 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 15 cgcagctgag gtaggttacc tacc 24 16 65 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 16 cgcacgatag gtggtctacc gctgatataa acttgtgggg
agctagtggc gtaggcaaga 60 gtgcc 65 17 25 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 17 ataaggcctg
ctgaaaatga ctgaa 25 18 30 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 18 ctgcaccagt aatatgcata
ttaaaacaag 30 19 47 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 19 gctgaggtcg atgctgaggt
cgcaaaactt gtggtagttg gagctgg 47 20 47 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 20 gctgcgatcg
atggtcaggt gctgaaactt gtggtagttg gagctga 47 21 47 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide 21
gctgtacccg atcgcaaggt ggtcaaactt gtggtagttg gagctgc 47 22 47 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 22 cgcaaggtag gtgctgtacc cgcaaaactt gtggtagttg
gagctgt 47 23 20 DNA Artificial Sequence Description of Artificial
Sequence oligonucleotide 23 tggcgtaggc aagagtgcct 20 24 20 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 24 tggcgtaggc aagagtgcct 20 25 50 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide 25
cgcacgatag gtggtctacc gctgatataa acttgtggta gttggagcta 50 26 50 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 26 cgcacgatag gtggtctacc gctgatataa acttgtggta
gttggagctc 50 27 50 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 27 ggtcaggtta ccgctgcgat
cgcaatataa acttgtggta gttggagctt 50 28 20 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 28 gtggcgtagg
caagagtgcc 20 29 20 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 29 gtggcgtagg caagagtgcc 20 30
45 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 30 ggtccgatta ccggtccgat gctgtgtggt agttggagct
ggtga 45 31 45 DNA Artificial Sequence Description of Artificial
Sequence oligonucleotide 31 ggtctaccta cccgcacgat ggtctgtggt
agttggagct ggtgg 45 32 21 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 32 cgtaggcaag agtgccttga c 21
33 21 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 33 cgtaggcaag agtgccttga c 21 34 24 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide 34
tgcgacctca gcatcgacct cagc 24 35 24 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 35 cagcacctga
ccatcgatcg cagc 24 36 24 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 36 gaccaccttg cgatcgggta cagc
24 37 24 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 37 tgcgggtaca gcacctacct tgcg 24 38 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 38 cagcggtaga ccacctatcg tgcg 24 39 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 39 gaccggtatg cgacctggta tgcg 24 40 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 40 tgcgatcgca gcggtaacct gacc 24 41 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 41 cagcatcgga ccggtaatcg gacc 24 42 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 42 gaccatcgtg cgggtaggta gacc 24 43 51 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 43 tgtcccatct ggtaagtcag cacaaacgct gaggtcgatg
ctgaggtgcg a 51 44 30 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 44 aacattaatg ctatgcagaa
aatcttagag 30 45 28 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 45 gtcattaatg ctatgcagaa
aatcttag 28 46 49 DNA Artificial Sequence Description of Artificial
Sequence oligonucleotide 46 aggacagaaa ggtaaagctc cctccgctgc
gatcgatggt caggtgctg 49 47 21 DNA Artificial Sequence Description
of Artificial Sequence oligonucleotide 47 caaagcgagc aagagaatcc c
21 48 23 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 48 acaaagcgag caagagaatc ccc 23 49 48 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 49 ggaaaatctg tccaggtatc agatgctgta cccgatgcga
aggtggtc 48 50 29 DNA Artificial Sequence Description of Artificial
Sequence oligonucleotide 50 caacttgtgg gatttttagc acagcaagt 29 51
27 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 51 tacttgtggg atttttagca cagcaag 27 52 27 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 52 tgtcccatct ggtaagtcag cacaaac 27 53 52 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 53 gctggcgacg attaccaggt cgataacatt aatgctatgc
agaaaatctt ag 52 54 50 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 54 gctggctgcg ataggtaggt
taccgtcatt aatgctatgc agaaaatctt 50 55 25 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 55 aggacagaaa
ggtaaagctc cctcc 25 56 43 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 56 gcgagcgaag gttacctacc
cgatcaaagc gagcaagaga atc 43 57 45 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 57 gcgacgatag
gtggtctacc gctgacaaag cgagcaagag aatcc 45 58 24 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide 58
ggaaaatctg tccaggtatc agat 24 59 51 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide 59 gcgagctgag
gtaggttacc tacccaactt gtgggatttt tagcacagca a 51 60 49 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 60 gcgataccag gtgcgatacc ggtctacttg tgggattttt
agcacagca 49 61 24 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide 61 tcgcacctca gcatcgacct cagc
24 62 24 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide 62 atcgacctgg taatcgtcgc cagc 24 63 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 63 cagcacctga ccatcgatcg cagc 24 64 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 64 ggtaacctac ctatcgcagc cagc 24 65 24 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide 65 gaccaccttc gcatcgggta cagc 24
* * * * *