U.S. patent application number 10/213926 was filed with the patent office on 2003-09-11 for combinatorial polyketide libraries produced using a modular pks gene cluster as scaffold.
Invention is credited to Kao, Camilla M., Khosla, Chaitan.
Application Number | 20030170725 10/213926 |
Document ID | / |
Family ID | 27792364 |
Filed Date | 2003-09-11 |
United States Patent
Application |
20030170725 |
Kind Code |
A1 |
Khosla, Chaitan ; et
al. |
September 11, 2003 |
Combinatorial polyketide libraries produced using a modular PKS
gene cluster as scaffold
Abstract
Combinatorial libraries of polyketides can be obtained by
suitable manipulation of a host modular polyketide synthase gene
cluster such as that which encodes the PKS for erythromycin. The
combinatorial library is useful as a source of pharmaceutically
active compounds. In addition, novel polyketides and antibiotics
are prepared using this method.
Inventors: |
Khosla, Chaitan; (Palo Alto,
CA) ; Kao, Camilla M.; (Palo Alto, CA) |
Correspondence
Address: |
Brenda J. Wallach
Morrison & Foerster LLP
Suite 500
3811 Valley Centre Drive
San Diego
CA
92130-2332
US
|
Family ID: |
27792364 |
Appl. No.: |
10/213926 |
Filed: |
August 6, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10213926 |
Aug 6, 2002 |
|
|
|
09073538 |
May 6, 1998 |
|
|
|
6558942 |
|
|
|
|
09073538 |
May 6, 1998 |
|
|
|
08846247 |
Apr 30, 1997 |
|
|
|
6391594 |
|
|
|
|
08846247 |
Apr 30, 1997 |
|
|
|
08486645 |
Jun 7, 1995 |
|
|
|
5712146 |
|
|
|
|
08486645 |
Jun 7, 1995 |
|
|
|
08238811 |
May 6, 1994 |
|
|
|
5672491 |
|
|
|
|
08238811 |
May 6, 1994 |
|
|
|
08164301 |
Dec 8, 1993 |
|
|
|
08164301 |
Dec 8, 1993 |
|
|
|
08123732 |
Sep 20, 1993 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
435/193; 435/252.3; 435/320.1; 435/6.11; 435/6.18; 435/76 |
Current CPC
Class: |
C12P 17/06 20130101;
C12P 7/26 20130101; C12P 17/162 20130101; C07D 323/00 20130101;
C07D 309/36 20130101; C12N 9/93 20130101; C12P 17/08 20130101; C40B
40/00 20130101; C07D 407/06 20130101; C12N 15/52 20130101; C07H
17/08 20130101; C07D 311/92 20130101 |
Class at
Publication: |
435/7.1 ; 435/76;
435/252.3; 435/320.1; 435/193; 435/6 |
International
Class: |
C12Q 001/68; G01N
033/53; C12P 019/62; C12N 009/10; C12N 001/21; C12N 015/74 |
Goverment Interests
[0002] This work was supported in part by a grant from the National
Institutes of Health, CA66736. The U.S. government has certain
rights in this invention.
Foreign Application Data
Date |
Code |
Application Number |
Jul 17, 1998 |
PCT/US98/14911 |
Claims
1. A method to prepare a nucleic acid with a nucleotide sequence
encoding a modified PKS from a nucleotide sequence encoding a
naturally occurring modular PKS wherein said naturally occurring
modular PKS contains first regions which encode enzymatic
activities and second regions which encode scaffolding amino acid
sequences, which method comprises modifying at least one said first
region.
2. The method of claim 1 wherein said modifying comprises deleting
or inactivating at least one said first region; or wherein said
modifying comprises replacing at least one said first region with a
region encoding the corresponding enzymatic activity from a
different naturally occurring PKS gene or from a different region
of the same naturally occurring PKS gene.
3. The method of claim 1 or 2 wherein said nucleotide sequence
encodes at least three PKS modules.
4. The method of any of claims 1-3 wherein said modifying results
in utilization of a different extender unit; and/or wherein said
modifying results in utilization of a different starter unit;
and/or wherein said modification results in a polyketide of a
different chain length.
5. A nucleic acid comprising a nucleotide sequence encoding a
modified PKS obtainable by the method of any of claims 1-4.
6. A cell culture modified to contain the nucleic acid of claim
5.
7. A method to prepare a polyketide which method comprises
culturing the cells of claim 6 under conditions wherein said
polyketide is produced.
8. A novel polyketide prepared by the method of claim 7.
9. A method to prepare an antibiotic which method comprises
glycosylating the polyketide of claim 8.
10. An antibiotic prepared by the method of claim 9.
11. A method to construct a library of colonies containing
expression vectors for a multiplicity of different polyketide
synthases which method comprises transforming recombinant host
cells with a mixture of expression vectors containing the
nucleotide sequences obtained by the method of any of claims 1-4;
and separating the transformed cells into individual colonies, and
culturing the colonies.
12. A method to prepare a polyketide combinatorial library which
method comprises culturing the library of colonies obtained by the
method of claim 11 under conditions wherein said polyketides are
produced.
13. A multiplicity of cell colonies comprising a library of
colonies wherein each colony of the library contains an expression
vector comprising a nucleotide sequence encoding a modular PKS
derived from a naturally occurring PKS gene cluster wherein at
least one enzymatic activity has been deleted and/or replaced by a
different version of said activity or is mutated so as to result in
a polyketide other than that produced by said naturally occurring
PKS and wherein the nucleotide sequence contained in each colony in
the library encodes a different PKS.
14. The multiplicity of cell colonies of claim 13 wherein in said
library of colonies said naturally occurring PKS gene cluster is
the erythromycin gene cluster; and/or wherein, in at least one
colony of said library, said different version is the corresponding
enzymatic activity from a different modular PKS or from another
location in the same PKS gene cluster; and/or wherein the number of
PKS modules contained in the expression vector is different in at
least two colonies of the library; and/or wherein the extender unit
utilized by the encoded PKS is different in at least two colonies
of said library; and/or wherein the starter unit utilized by the
enclosed PKS is different in at least two colonies of said library;
and/or wherein the reduction cycle specificities are different in
at least two colonies of said library.
15. A method to produce a library of modular PKS proteins which
method comprises culturing the multiplicity of cell colonies or the
library of colonies of claim 13 or 14 under conditions wherein said
expression vectors effect production of said modular PKS
proteins.
16. A library of PKS proteins prepared by the method of claim
15.
17. A multiplicity of cell colonies comprising a library of
colonies wherein each colony of the library contains a modular PKS
derived from a naturally occurring PKS wherein at least one
enzymatic activity has been deleted or replaced by a different
version of said activity or is produced from a mutated form of said
gene so as to result in a polyketide other than that produced by
said naturally occurring PKS, and each colony in the library
contains a different PKS.
18. The multiplicity of cell colonies of claim 17 wherein said
naturally occurring PKS is the erythromycin PKS; and/or wherein the
number of modules of PKS is different in at least two colonies of
the library; and/or wherein the extender unit utilized by the PKS
is different in at least two colonies of the library; and/or
wherein the starter unit utilized by the PKS is different in at
least two colonies of the library; and/or wherein the reduction
cycle specificities are different in at least two colonies of said
library.
19. A method to produce a combinatorial library of polyketides
which method comprises culturing the cell colonies or library of
colonies of claim 17 or 18 under conditions wherein polyketides
whose synthesis is effected by said different PKS proteins are
produced.
20. A combinatorial library of polyketides prepared by the method
of claim 19.
21. A multiplicity of polyketides which comprises a combinatorial
library of polyketides which results from culturing colonies
containing polyketide synthases derived from a naturally occurring
PKS wherein at least one enzymatic activity has been deleted and/or
replaced by a different version of said activity or is mutated so
as to result in a polyketide other than that produced by said
naturally occurring PKS, wherein each PKS in said library produces
a different polyketide.
22. The library of claim 21 wherein the chain length is different
in at least two polyketides; and/or which contains at least two
polyketides formed from different extender units; and/or which
contains at least two polyketides of different oxidation states;
and/or which contains at least two polyketides of differing
stereochemistry; and/or which contains at least two polyketides
formed from different starter units.
23. A method to identify a successful candidate polyketide which
binds to or reacts with a target moiety, which method comprises
screening the library of claim 20, 21 or 22 by contacting each
polyketide in said library with the target moiety under conditions
wherein a successful candidate would form a complex with said
target moiety, and detecting any complex formed, thus identifying a
polyketide of the library as the successful candidate.
24. A compound of the formula: 9including the glycosylated and
isolated stereoisomeric forms thereof; wherein R* is a straight
chain, branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-15C; each of R.sup.1 and R.sup.2 is
independently H or alkyl (1-4C) wherein any alkyl at R.sup.1 may
optionally be substituted; X.sup.1 is H.sub.2, HOH or .dbd.O; with
the provisos that: at least one of R.sup.1 and R.sup.2 must be
alkyl (1-4C); and the compound is other than compounds 1, 2, 3, 5
and 6 of FIG. 6A; or of the formula: 10including the glycosylated
and isolated stereoisomeric forms thereof; wherein R* is a straight
chain, branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-8C; each of R.sup.1, R.sup.2 and
R.sup.3 is independently H or alkyl (1-4C) wherein any alkyl at
R.sup.1 may optionally be substituted; each of X.sup.1 and X.sup.2
is independently H.sub.2, HOH or .dbd.O; with the proviso that: at
least two of R.sup.1, R.sup.2 and R.sup.3 are alkyl (1-4C); or of
the formula: 11including the glycosylated and isolated
stereoisomeric forms thereof; wherein R* is a straight chain,
branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-15C; each of R.sup.1, R.sup.2 and
R.sup.3 is independently H or alkyl (1-4C) wherein any alkyl at
R.sup.1 may optionally be substituted; each of X.sup.1, X.sup.2 and
X.sup.3 is independently H.sub.2, HOH or .dbd.O; with the provisos
that: at least one of R.sup.1 and R.sup.2 must be alkyl (1-4C); and
the compound is other than compound 8 of FIG. 6A; or of the
formula: 12including the glycosylated and isolated stereoisomeric
forms thereof; wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-8C; each of R.sup.1, R.sup.2 and R.sup.3 is independently H or
alkyl (1-4C) wherein any alkyl at R.sup.1 may optionally be
substituted; each of X* and X.sup.2 is independently H.sub.2, HOH
or .dbd.O; with the proviso that: at least one of R.sup.2 and
R.sup.3 is alkyl (1-4C); and the compound is other than compound 9
of FIG. 6A; or of the formula: 13including the glycosylated and
isolated stereoisomeric forms thereof; wherein R* is a straight
chain, branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-15C; each of R.sup.1-R.sup.5 is
independently H or alkyl (1-4C) wherein any alkyl at R.sup.1 may
optionally be substituted; R.sup.6 is alkyl (1-5C); each of X.sup.1
and X.sup.3 and X.sup.6 is independently H.sub.2, HOH or .dbd.O;
with the proviso that: at least two of R.sup.1-R.sup.4 are alkyl
(1-4C); or of the formula: 14including the glycoslated and isolated
stereoisomeric forms thereof; wherein R* is a straight chain,
branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-15C; each of R.sup.1-R.sup.5 is
independently H or alkyl (1-4C) wherein any alkyl at R.sup.1 may
optionally be substituted; R.sup.6 is alkyl (1-5C); X.sup.2 is OH
or H; each X.sup.1, X.sup.3, X.sup.4 and X.sup.5 is independently
H.sub.2, HOH or .dbd.O; or X.sup.4 is H and the compound of formula
(8) has a .pi.-bond between positions 9-10, with the proviso that:
if X.sup.2 is H, at least one of X.sup.3 and X.sup.4 is HOH or
.dbd.O.
25. A compound of the formula: 15including the glycosylated and
isolated stereoisomeric forms thereof; wherein R* is a straight
chain, branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-15C; each of R.sup.1, R.sup.2,
R.sup.3, R.sup.4 and R.sup.5 is independently H or alkyl (1-4C)
wherein any alkyl at R.sup.1 may optionally be substituted; each of
X.sup.1, X.sup.2, X.sup.3 and X.sup.4 is independently H.sub.2, HOH
or .dbd.O; or X.sup.1 or X.sup.2 or X.sup.3 or X.sup.4 is H and the
compound of formula (5) contains a .pi.-bond at positions 8-9 or
6-7 or 4-5 or 2-3; with the proviso that: at least two of
R.sup.1-R.sup.5 are alkyl (1-4C); and the compound is other than
compound 13 or 14 of FIG. 6A or compound 205, 210-213 of FIG.
11.
26. The compound of claim 25 wherein at least three of
R.sup.1-R.sup.6 are alkyl (1-4C); and/or wherein X.sup.1 is --OH;
and/or X.sup.2 is .dbd.O; and/or X.sup.3 is H.
27. A compound of the formula: 16including the glycosylated and
isolated stereoisomeric forms thereof; wherein R* is a straight
chain, branched or cyclic, saturated or unsaturated substituted or
unsubstituted hydrocarbyl of 1-15C; each of R.sup.1-R.sup.6 is
independently H or alkyl (1-4C) wherein any alkyl at R.sup.1 may
optionally be substituted; each of X.sup.1-X.sup.5 is independently
H.sub.2, HOH or .dbd.O; or each of X.sup.1-X.sup.4 is independently
H and the compound of formula (5) contains a .pi.-bond in the ring
adjacent to the position of said X at 2-3,4-5, 6-7,8-9 and/or
10-11; with the proviso that: at least two of R.sup.1-R.sup.6 are
alkyl (1-4C); and the compound is other than compounds 17, 24 or 28
of FIG. 6B, compound 301-311 of FIG. 12(A) or compound 312-322 of
FIG. 12(B).
28. The compound of claim 27 wherein at least three of
R.sup.1-R.sup.6 are alkyl; and/or X.sup.2 is =O; and/or X.sup.1 is
OH; and/or X.sup.4 and X.sup.5 are OH; and/or R* is substituted
alkyl and/or R.sup.1 is substituted alkyl.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/846,247 filed Apr. 30, 1997 which is a continuation-in-part of
U.S. Ser. No. 08/486,645 filed Jun. 7, 1995 which is
continuation-in-part of U.S. Ser. No. 08/238,811 filed May 6, 1994.
Priority is claimed under 35 USC .sctn.120. Priority is also
claimed under 35 USC 119(e) with respect to U.S. Provisional
application No. 60/076,919 filed Mar. 5, 1998. The disclosures of
these applications are incorporated herein by reference.
TECHNICAL FIELD
[0003] The invention relates to the field of combinatorial
libraries, to novel polyketides and antibiotics and to methods to
prepare them. More particularly, it concerns construction of new
polyketides and to libraries of polyketides synthesized by
polyketide synthases derived from a naturally occurring PKS, as
illustrated by the erythromycin gene cluster.
BACKGROUND ART
[0004] Polyketides represent a large family of diverse compounds
ultimately synthesized from 2-carbon units through a series of
Claisen-type condensations and subsequent modifications. Members of
this group include antibiotics such as tetracyclines, anticancer
agents such as daunomycin, and immunosuppressants such as FK506 and
rapamycin. Polyketides occur in many types of organisms including
fungi and mycelial bacteria, in particular, the actinomycetes.
[0005] A number of lactones of keto acids have been synthesized
using standard organic chemistry. These include a series of
unsaturated ketolactones synthesized by Vedejes et al., J. Am Chem
Soc (1987) 109:5437-5446, shown as formulas 201, 202 and 203 in
FIG. 11 herein. Additional compounds of formulas 204 and 205, also
shown in FIG. 11 were synthesized as reported by Vedejes et al. J.
Am Chem Soc (1989) 111:8430-8438. In addition, compounds 206-208
(FIG. 11) were synthesized by Borowitz ______ (1975) ______;
compound 209 has been synthesized by Ireland et al., J Org Chem
(1980) 45:1868-1880.
[0006] The polyketides are synthesized in vivo by polyketide
synthases (PKS). This group of enzymatically active proteins is
considered in a different category from the fatty acid synthases
which also catalyze condensation of 2-carbon units to result in,
for example, fatty acids and prostaglandins. Two major types of PKS
are known which are vastly different in their construction and mode
of synthesis. These are commonly referred to as Type I or "modular"
and Type II, "aromatic."
[0007] The PKS scaffold that is the subject of the present
invention is a member of the group designated Type I or "modular"
PKS. In this type, a set of separate active sites exists for each
step of carbon chain assembly and modification, but the individual
proteins contain a multiplicity of such separate active sites.
There may be only one multifunctional protein of this type, such as
that required for the biosynthesis of 6-methyl salicylic acid
(Beck, J. et al., Eur J Biochem (1990) 192:487-498; Davis, R. et
al., Abstracts of Genetics of Industrial Microorganism Meeting,
Montreal, Abstract P288 (1994)). More commonly, and in
bacterial-derived Type I PKS assemblies, there are several such
multifunctional proteins assembled to result in the end product
polyketide. (Cortes, J. et al., Nature (1990) 348:176; Donadio, S.
et al., Science (1991) 252:675; MacNeil, D. J. et al., Gene (1992)
115:119.)
[0008] A number of modular PKS genes have been cloned. U.S. Pat.
No. 5,252,474 describes cloning of genes encoding the synthase for
avermectin; U.S. Pat. No. 5,098,837 describes the cloning of genes
encoding the synthase for spiramycin; European application 791,655
and European application 791,656 describe the genes encoding the
synthases for tylosin and platenolide respectively.
[0009] The PKS for erythromycin, used as an illustrative system is
a modular PKS. Erythromycin was originally isolated from S.
erythraeus (since reclassified as Saccharopolyspora erythrea) which
was found in a soil sample from the Philippine archipelago. Cloning
the genes was described by Donadio, S. et al., Science (1991)
252:675. The particulars have been reviewed by Perun, T. J. in Drug
Action and Drug Resistance in Bacteria, Vol. 1, S. Mitsuhashi (ed.)
University Park Press, Baltimore, 1977. The antibiotic occurs in
various glycosylated forms, designated A, B and C during various
stages of fermentation. The entire erythromycin biosynthetic gene
cluster from S. erythraeus has been mapped and sequenced by Donadio
et al. in Industrial Microorganisms: Basic and Applied Molecular
Genetics (1993) R. H. Baltz, G. D. Hegeman, and P. L. Skatrud
(eds.) (Amer Soc Microbiol) and the entire PKS is an assembly of
three such multifunctional proteins usually designated DEBS-1,
DEBS-2, and DEBS-3, encoded by three separate genes.
[0010] Expression of the genes encoding the PKS complex may not be
sufficient to permit the production by the synthase enzymes of
polyketides when the genes are transformed into host cells that do
not have the required auxiliary phosphopantetheinyl transferase
enzymes which posttranslationally modify the ACP domains of the
PKS. Genes encoding some of these transferases are described in
WO97/13845. In addition, enzymes that mediate glycosylation of the
polyketides synthesized are described in WO97/23630. U.S. Ser. No.
08/989,332 filed Dec. 11, 1997 describes the production of
polyketides in hosts that normally do not produce them by supplying
appropriate phosphopantetheinyl transferase expression systems. The
contents of this application are incorporated herein by
reference.
[0011] There have been attempts to alter the polyketide synthase
pathway of modular PKS clusters. For example, European application
238,323 describes a process for enhancing production of polyketides
by introducing a rate-limiting synthase gene and U.S. Pat. No.
5,514,544 describes use of an activator protein for the synthase in
order to enhance production. U.S. Pat. Nos. 4,874,748 and 5,149,639
describe shuttle vectors that are useful in cloning modular PKS
genes in general. Methods of introducing an altered gene into a
microorganism chromosome are described in WO93/13663. Modification
of the loading module for the DEBS-1 protein of the
erythromycin-producing polyketide synthase to substitute the
loading module for the avermectin-producing polyketide synthase in
order to vary the starter unit was described by Marsden, Andrew F.
A. et al. Science (1998) 279:199-202 and Oliynyk, M. et al.
Chemistry and Biology (1996) 3:833-839. WO 98/01571, published Jan.
15, 1998, describes manipulation of the erythromycin PKS and novel
polyketides resulting from such manipulation. In addition, WO
98/0156, also published Jan. 15, 1998 describes a hybrid modular
PKS gene for varying the nature of the starter and extender units
to synthesize novel polyketides.
[0012] In addition, U.S. Pat. Nos. 5,063,155 and 5,168,052 describe
preparation of novel antibiotics using modular PKS systems. A
number of modular PKS have been cloned. See, e.g., U.S. Pat. No.
5,098,837, EP 791,655, EP 791,656 and U.S. Pat. No. 5,252,474.
[0013] Type II PKS, in contrast to modular PKS, include several
proteins, each of which is simpler than those found in Type I
polyketide synthases. The active sites in these enzymes are used
iteratively so that the proteins themselves are generally
monofunctional or bifunctional. For example, the aromatic PKS
complexes derived from Streptomyces have so far been found to
contain three proteins encoded in three open reading frames. One
protein provides ketosynthase (KS) and acyltransferase (AT)
activities, a second provides a chain length determining factor
(CLDF) and a third is an acyl carrier protein (ACP).
[0014] The present invention is concerned with PKS systems derived
from modular PKS gene clusters. The nature of these clusters and
their manipulation are further described below.
DISCLOSURE OF THE INVENTION
[0015] The invention provides recombinant materials for the
production of combinatorial libraries of polyketides wherein the
polyketide members of the library are synthesized by various PKS
systems derived from naturally occurring PKS systems by using these
systems as scaffolds. Generally, many members of these libraries
may themselves be novel compounds, and the invention further
includes novel polyketide members of these libraries. The invention
methods may thus be directed to the preparation of an individual
polyketide. The polyketide may or may not be novel, but the method
of preparation permits a more convenient method of preparing it.
The resulting polyketides may be further modified to convert them
to antibiotics, typically through glycosylation. The invention also
includes methods to recover novel polyketides with desired binding
activities by screening the libraries of the invention. Thus, in
one aspect, the invention is directed to a method to prepare a
nucleic acid which contains a nucleotide sequence encoding a
modified polyketide synthase.
[0016] The method comprises using a naturally occurring PKS
encoding sequence as a scaffold and modifying the portions of the
nucleotide sequence that encode enzymatic activities, either by
mutagenesis, inactivation, or replacement. The thus modified
nucleotide sequence encoding a PKS can then be used to modify a
suitable host cell and the cell thus modified employed to produce a
polyketide different from that produced by the PKS whose
scaffolding has been used to support modifications of enzymatic
activity. The invention is also directed to polyketides thus
produced and the antibiotics to which they may then be
converted.
[0017] In another aspect, the invention is directed to a
multiplicity of cell colonies comprising a library of colonies
wherein each colony of the library contains an expression vector
for the production of a different modular PKS, but derived from a
naturally occurring PKS. In a preferred embodiment, the different
PKS are derived from the erythromycin PKS. In any case, the library
of different modular PKS is obtained by modifying one or more of
the regions of a naturally occurring gene or gene cluster encoding
an enzymatic activity so as to alter that activity, leaving intact
the scaffold portions of the naturally occurring gene. If desired,
more than one scaffold source may be used, but basing the cluster
of modules on a single scaffold is preferred. In another aspect,
the invention is directed to a multiplicity of cell colonies
comprising a library of colonies wherein each colony of the library
contains a different modular PKS derived from a naturally occurring
PKS, preferably the erythromycin PKS. The invention is also
directed to methods to produce libraries of PKS complexes and to
produce libraries of polyketides by culturing these colonies, as
well as to the libraries so produced. In addition, the invention is
directed to methods to screen the resulting polyketide libraries
and to novel polyketides contained therein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1A is a diagram of the erythromycin PKS complex from S.
erythraeus showing the function of each multifunctional protein,
and also shows the structure of 6dEB and of D-desosamine and
L-cladinose.
[0019] FIG. 1B shows a diagram of the post-PKS biosynthesis of
erythromycins A-D.
[0020] FIG. 2 is a diagram of DEBS-1 from S. erythraeus showing the
functional regions separated by linker regions.
[0021] FIG. 3 shows a diagram of a vector containing the entire
erythromycin gene cluster.
[0022] FIG. 4 shows a method for the construction of the vector of
FIG. 3.
[0023] FIG. 5 shows a diagram of the erythromycin gene cluster with
locations of restriction sites introduced for ease of
manipulation.
[0024] FIGS. 6A-6H show the structures of polyketides produced by
manipulating the erythromycin PKS gene cluster.
[0025] FIGS. 7A (SEQ ID NO:1), 7B (SEQ ID NO:4) and 7C (SEQ ID
NOS:1-3) show the construction of derivative PKS gene clusters from
the vector of FIG. 3.
[0026] FIG. 8 shows antibiotics obtained from the polyketides of
FIGS. 6A-6F.
[0027] FIG. 9 shows the preparation of a polyketide containing an
unsaturated starter moiety and the corresponding antibiotic.
[0028] FIG. 10 shows the preparation of a reagent used to
glycosylate polyketides to prepare the D-desosamine derivatives
with antibiotic activity.
[0029] FIG. 11 shows the structures of known, previously produced,
12-member macrolides.
[0030] FIGS. 12A and 12B show the structures of known and
previously produced 14-member macrolides.
MODES OF CARRYING OUT THE INVENTION
[0031] It may be helpful to review the nature of the erythromycin
PKS complex and the gene cluster that encodes it as a model for
modular PKS, in general.
[0032] FIG. 1A is a diagrammatic representation of the gene cluster
encoding the synthase for the polyketide backbone of the antibiotic
erythromycin. The erythromycin PKS protein assembly contains three
high-molecular-weight proteins (>200 kD) designated DEBS-1,
DEBS-2 and DEBS-3, each encoded by a separate gene (Caffrey et al.,
FEBS Lett (1992) 304:225). The diagram in FIG. 1A shows that each
of the three proteins contains two modules of the synthase--a
module being that subset of reactivities required to provide an
additional 2-carbon unit to the molecule. As shown in FIG. 1A,
modules 1 and 2 reside on DEBS-1; modules 3 and 4 on DEBS-2 and
modules 5 and 6 on DEBS-3. The minimal module is typified in module
3 which contains a ketosynthase (KS), an acyltransferase (AT) and
an acyl carrier protein (ACP). These three functions are sufficient
to activate an extender unit and attach it to the remainder of the
growing molecule. Additional activities that may be included in a
module relate to reactions other than the Claisen condensation, and
include a dehydratase activity (DH), an enoylreductase activity
(ER) and a ketoreductase activity (KR). The first module also
contains repeats of the AT and ACP activities because it catalyzes
the initial condensation, i.e. it begins with a "loading domain"
represented by AT and ACP, which determine the nature of the
starter unit. Although not shown, module 3 has a KR region which
has been inactivated by mutation. The "finishing" of the molecule
is regulated by the thioesterase activity (TE) in module 6. This
thioesterase appears to catalyze cyclization of the macrolide ring
thereby increasing the yield of the polyketide product.
[0033] The product in this case is 6dEB; the structure and
numbering system for this molecule are shown in FIG. 1A. Conversion
to the antibiotics erythromycin A, B, C and D would require
glycosylation generally by D-desosamine or L-mycarose, which may
ultimately be converted to cladinose at appropriate locations. FIG.
1B diagrams the post-PKS biosynthesis of the erythromycins through
addition of glycosyl groups.
[0034] As shown, 6dEB is converted by the gene eryF to
erythronolide B which is, in turn, glycosylated by eryB to obtain
3-O-mycarosylerythronol- ide B which contains L-mycarose at
position 3. The enzyme eryC then converts this compound to
erythromycin D by glycosylation with D-desosamine at position 5.
Erythromycin D, therefore, differs from 6dEB through glycosylation
and by the addition of a hydroxyl group at position 6. Erythromycin
D can be converted to erythromycin B in a reaction catalyzed by
eryG by methylating the L-mycarose residue at position 3.
Erythromycin D is converted to erythromycin C by the addition of a
hydroxyl group at position 12. Erythromycin A is obtained from
erythromycin C by methylation of the mycarose residue catalyzed by
eryG. The series of erythromycin antibiotics, then, differs by the
level of hydroxylation of the polyketide framework and by the
methylation status of the glycosyl residues.
[0035] FIG. 2 shows a detailed view of the regions in the first two
modules which comprise the first open reading frame encoding
DEBS-1. The regions that encode enzymatic activities are separated
by linker or "scaffold"-encoding regions. These scaffold regions
encode amino acid sequences that space the enzymatic activities at
the appropriate distances and in the correct order. Thus, these
linker regions collectively can be considered to encode a scaffold
into which the various activities are placed in a particular order
and spatial arrangement. This organization is similar in the
remaining genes, as well as in other naturally occurring modular
PKS gene clusters.
[0036] The three DEBS-1, 2 and 3 proteins are encoded by the
genetic segments ery-AI, ery-AII and ery-AIII, respectively. These
reading frames are located on the bacterial chromosome starting at
about 10 kb distant from the erythromycin resistance gene (ermE or
eryR).
[0037] The detailed description above referring to erythromycin is
typical for modular PKS in general. Thus, rather than the
illustrated erythromycin, the polyketide synthases making up the
libraries of the invention can be derived from the synthases of
other modular PKS, such as those which result in the production of
rapamycin, avermectin, FK-506, FR-008, monensin, rifamycin,
soraphen-A, spinocyn, squalestatin, or tylosin, and the like.
[0038] Regardless of the naturally occurring PKS gene used as a
scaffold, the invention provides libraries or individual modified
forms, ultimately of polyketides, by generating modifications in
the erythromycin PKS or other naturally occurring PKS gene cluster
so that the protein complexes produced by the cluster have altered
activities in one or more respects, and thus produce polyketides
other than the natural product of the PKS. Novel polyketides may
thus be prepared, or polyketides in general prepared more readily,
using this method. By providing a large number of different genes
or gene clusters derived from a naturally occurring PKS gene
cluster, each of which has been modified in a different way from
the native cluster, an effectively combinatorial library of
polyketides can be produced as a result of the multiple variations
in these activities. All of the PKS encoding sequences used in the
present invention represent modular polyketide synthases "derived
from" a naturally occurring PKS, illustrated by the erythromycin
PKS. As will be further described below, the metes and bounds of
this derivation can be described on both the protein level and the
encoding nucleotide sequence level.
[0039] By a modular PKS "derived from" the erythromycin or other
naturally occurring PKS is meant a modular polyketide synthase (or
its corresponding encoding gene(s)) that retains the scaffolding of
all of the utilized portion of the naturally occurring gene. (Not
all modules need be included in the constructs.) On the constant
scaffold, at least one enzymatic activity is mutated, deleted or
replaced, so as to alter the activity. Alteration results when
these activities are deleted or are replaced by a different version
of the activity, or simply mutated in such a way that a polyketide
other than the natural product results from these collective
activities. This occurs because there has been a resulting
alteration of the starter unit and/or extender unit, and/or
stereochemistry, and/or chain length or cyclization and/or
reductive or dehydration cycle outcome at a corresponding position
in the product polyketide. Where a deleted activity is replaced,
the origin of the replacement activity may come from a
corresponding activity in a different naturally occurring
polyketide synthase or from a different region of the same PKS. In
the case of erythromycin, for example, any or all of the DEBS-1,
DEBS-2 and DEBS-3 proteins may be included in the derivative or
portions of any of these may be included; but the scaffolding of an
erythromycin PKS protein is retained in whatever derivative is
considered. Similar comments pertain to the corresponding ery-AI,
ery-AII and ery-AIII genes.
[0040] The derivative may contain preferably at least a
thioesterase activity from the erythromycin or other naturally
occurring PKS gene cluster.
[0041] In summary, a polyketide synthase "derived from" a naturally
occurring PKS contains the scaffolding encoded by all or the
portion employed of the naturally occurring synthase gene, contains
at least two modules that are functional, preferably three modules,
and more preferably four or more modules and contains mutations,
deletions, or replacements of one or more of the activities of
these functional modules so that the nature of the resulting
polyketide is altered. This definition applies both at the protein
and genetic levels. Particular preferred embodiments include those
wherein a KS, AT, KR, DH or ER has been deleted or replaced by a
version of the activity from a different PKS or from another
location within the same PKS. Also preferred are derivatives where
at least one noncondensation cycle enzymatic activity (KR, DH or
ER) has been deleted or wherein any of these activities has been
mutated so as to change the ultimate polyketide synthesized.
[0042] Thus, there are five degrees of freedom for constructing a
polyketide synthase in terms of the polyketide that will be
produced. First, the polyketide chain length will be determined by
the number of modules in the PKS. Second, the nature of the carbon
skeleton of the PKS will be determined by the specificities of the
acyl transferases which determine the nature of the extender units
at each position--e.g., malonyl, methyl malonyl, or ethyl malonyl,
etc. Third, the loading domain specificity will also have an effect
on the resulting carbon skeleton of the polyketide. Thus, the
loading domain may use a different starter unit, such as acetyl,
propionyl, and the like. Fourth, the oxidation state at various
positions of the polyketide will be determined by the dehydratase
and reductase portions of the modules. This will determine the
presence and location of ketone, alcohol, double bonds or single
bonds in the polyketide. Finally, the stereochemistry of the
resulting polyketide is a function of three aspects of the
synthase. The first aspect is related to the AT/KS specificity
associated with substituted malonyls as extender units, which
affects stereochemistry only when the reductive cycle is missing or
when it contains only a ketoreductase since the dehydratase would
abolish chirality. Second, the specificity of the ketoreductase
will determine the chirality of any .beta.-OH. Finally, the enoyl
reductase specificity for substituted malonyls as extender units
will influence the result when there is a complete KR/DH/ER
available.
[0043] In the working examples below, the foregoing variables for
varying loading domain specificity which controls the starter unit,
a useful approach is to modify the KS activity in module 1 which
results in the ability to incorporate alternative starter units as
well as module 1 extended units. This approach was illustrated in
PCT application US/96/11317 wherein the KS-I activity was
inactivated through mutation.
[0044] Polyketide synthesis is then initiated by feeding chemically
synthesized analogs of module 1 diketide products. Working examples
of this aspect are also presented hereinbelow.
[0045] Thus, the modular PKS systems, and in particular, the
erythromycin PKS system, permit a wide range of polyketides to be
synthesized. As compared to the aromatic PKS systems, a wider range
of starter units including aliphatic monomers (acetyl, propionyl,
butyryl, isovaleryl, etc.), aromatics (aminohydroxybenzoyl),
alicyclics (cyclohexanoyl), and heterocyclics (thiazolyl) are found
in various macrocyclic polyketides. Recent studies have shown that
modular PKSs have relaxed specificity for their starter units (Kao
et al. Science (1994), supra). Modular PKSs also exhibit
considerable variety with regard to the choice of extender units in
each condensation cycle. The degree of P-ketoreduction following a
condensation reaction has also been shown to be altered by genetic
manipulation (Donadio et al. Science (1991),supra; Donadio, S. et
al. Proc Natl Acad Sci USA (1993) 90:7119-7123). Likewise, the size
of the polyketide product can be varied by designing mutants with
the appropriate number of modules (Kao, C. M. et al. J Am Chem Soc
(1994) 116:11612-11613). Lastly, these enzymes are particularly
well-known for generating an impressive range of asymmetric centers
in their products in a highly controlled manner. The polyketides
and antibiotics produced by the methods of the present invention
are typically single stereoisomeric forms. Although the compounds
of the invention can occur as mixtures of stereoisomers, it is more
practical to generate individual stereoisomers using this system.
Thus, the combinatorial potential within modular PKS pathways based
on any naturally occurring modular, such as the erythromycin, PKS
scaffold is virtually unlimited.
[0046] In general, the polyketide products of the PKS must be
further modified, typically by glycosylation, in order to exhibit
antibiotic activity. Methods for glycosylating the polyketides are
generally known in the art; the glycosylation may be effected
intracellularly by providing the appropriate glycosylation enzymes
or may be effected in vitro using chemical synthetic means.
[0047] The antibiotic modular polyketides may contain any of a
number of different sugars, although D-desosamine, or a close
analog thereof, is most common. Erythromycin, picromycin,
narbomycin and methymycin contain desosamine. Erythromycin also
contains L-cladinose (3-O-methyl mycarose). Tylosin contains
mycaminose (4-hydroxy desosamine), mycarose and 6-deoxy-D-allose.
2-acetyl-1-bromodesosamine has been used as a donor to glycosylate
polyketides by Masamune et al. J Am Chem Soc (1975) 97:3512, 3513.
Other, apparently more stable, donors include glycosyl fluorides,
thioglycosides, and trichloroacetimidates; Woodward, R. B. et al. J
Am Chem Soc (1981) 103:3215; Martin, S. F. et al. Am Chem Soc
(1997) 119:3193; Toshima, K. et al. J Am Chem Soc (1995) 117:3717;
Matsumoto, T. et al Tetrahedron Lett (1988) 29:3575. Glycosylation
can also be effected using the macrolides as starting materials and
using mutants of S. erythraea that are unable to synthesize the
macrolides to make the conversion. A method is illustrated in the
Examples hereinbelow.
[0048] Methods to Construct Multiple Modular PKS Derived from a
Naturally Occurring PKS
[0049] The derivatives of the a naturally occurring PKS can be
prepared by manipulation of the relevant genes. A large number of
modular PKS gene clusters have been mapped and/or sequenced,
including erythromycin, soraphen A, rifamycin, and rapamycin, which
have been completely mapped and sequenced, and FK506 and
oleandomycin which have been partially sequenced, and candicidin,
avermectin, and nemadectin which have been mapped and partially
sequenced. Additional modular PKS gene clusters are expected to be
available as time progresses. These genes can be manipulated using
standard techniques to delete or inactivate activity encoding
regions, insert regions of genes encoding corresponding activities
form the same or different PKS system, or otherwise mutated using
standard procedures for obtaining genetic alterations. Of course,
portions of, or all of, the desired derivative coding sequences can
be synthesized using standard solid phase synthesis methods such as
those described by Jaye et al., J Biol Chem (1984) 259:6331 and
which are available commercially from, for example, Applied
Biosystems, Inc.
[0050] In order to obtain nucleotide sequences encoding a variety
of derivatives of the naturally occurring PKS, and thus a variety
of polyketides for construction of a library, a desired number of
constructs can be obtained by "mixing and matching" enzymatic
activity-encoding portions, and mutations can be introduced into
the native host PKS gene cluster or portions thereof.
[0051] Mutations can be made to the native sequences using
conventional techniques. The substrates for mutation can be an
entire cluster of genes or only one or two of them; the substrate
for mutation may also be portions of one or more of these genes.
Techniques for mutation include preparing synthetic
oligonucleotides including the mutations and inserting the mutated
sequence into the gene encoding a PKS subunit using restriction
endonuclease digestion. (See, e.g., Kunkel, T. A. Proc Natl Acad
Sci USA (1985) 82:448; Geisselsoder et al. BioTechniques (1987)
5:786.) Alternatively, the mutations can be effected using a
mismatched primer (generally 10-20 nucleotides in length) which
hybridizes to the native nucleotide sequence (generally cDNA
corresponding to the RNA sequence), at a temperature below the
melting temperature of the mismatched duplex. The primer can be
made specific by keeping primer length and base composition within
relatively narrow limits and by keeping the mutant base centrally
located. Zoller and Smith, Methods Enzymol (1983) 100:468. Primer
extension is effected using DNA polymerase, the product cloned and
clones containing the mutated DNA, derived by segregation of the
primer extended strand, selected. Selection can be accomplished
using the mutant primer as a hybridization probe. The technique is
also applicable for generating multiple point mutations. See, e.g.,
Dalbie-McFarland et al. Proc Natl Acad Sci USA (1982) 79:6409. PCR
mutagenesis will also find use for effecting the desired
mutations.
[0052] Random mutagenesis of selected portions of the nucleotide
sequences encoding enzymatic activities can be accomplished by
several different techniques known in the art, e.g., by inserting
an oligonucleotide linker randomly into a plasmid, by irradiation
with X-rays or ultraviolet light, by incorporating incorrect
nucleotides during in vitro DNA synthesis, by error-prone PCR
mutagenesis, by preparing synthetic mutants or by damaging plasmid
DNA in vitro with chemicals. Chemical mutagens include, for
example, sodium bisulfite, nitrous acid, nitrosoguanidine,
hydroxylamine, agents which damage or remove bases thereby
preventing normal base-pairing such as hydrazine or formic acid,
analogues of nucleotide precursors such as 5-bromouracil,
2-aminopurine, or acridine intercalating agents such as proflavine,
acriflavine, quinacrine, and the like. Generally, plasmid DNA or
DNA fragments are treated with chemicals, transformed into E. coli
and propagated as a pool or library of mutant plasmids.
[0053] In addition to providing mutated forms of regions encoding
enzymatic activity, regions encoding corresponding activities from
different PKS synthases or from different locations in the same PKS
synthase can be recovered, for example, using PCR techniques with
appropriate primers. By "corresponding" activity encoding regions
is meant those regions encoding the same general type of
activity--e.g., a ketoreductase activity in one location of a gene
cluster would "correspond" to a ketoreductase-encoding activity in
another location in the gene cluster or in a different gene
cluster; similarly, a complete reductase cycle could be considered
corresponding--e.g., KR/DH/ER would correspond to KR alone.
[0054] If replacement of a particular target region in a host
polyketide synthase is to be made, this replacement can be
conducted in vitro using suitable restriction enzymes or can be
effected in vivo using recombinant techniques involving homologous
sequences framing the replacement gene in a donor plasmid and a
receptor region in a recipient plasmid. Such systems,
advantageously involving plasmids of differing temperature
sensitivities are described, for example, in PCT application WO
96/40968.
[0055] The vectors used to perform the various operations to
replace the enzymatic activity in the host PKS genes or to support
mutations in these regions of the host PKS genes may be chosen to
contain control sequences operably linked to the resulting coding
sequences in a manner that expression of the coding sequences may
be effected in a appropriate host. However, simple cloning vectors
may be used as well.
[0056] If the cloning vectors employed to obtain PKS genes encoding
derived PKS lack control sequences for expression operably linked
to the encoding nucleotide sequences, the nucleotide sequences are
inserted into appropriate expression vectors.
[0057] This need not be done individually, but a pool of isolated
encoding nucleotide sequences can be inserted into host vectors,
the resulting vectors transformed or transfected into host cells
and the resulting cells plated out into individual colonies.
[0058] Suitable control sequences include those which function in
eucaryotic and procaryotic host cells. Preferred host include
fungal systems such as yeast and procaryotic hosts, but single cell
cultures of, for example, mammalian cells could also be used. There
is no particular advantage, however, in using such systems.
Particularly preferred are yeast and procaryotic hosts which use
control sequences compatible with Streptomyces spp. Suitable
controls sequences for single cell cultures of various types of
organisms are well known in the art. Control systems for expression
in yeast, including controls which effect secretion are widely
available are routinely used. Control elements include promoters,
optionally containing operator sequences, and other elements
depending on the nature of the host, such as ribosome binding
sites. Particularly useful promoters for procaryotic hosts include
those from PKS gene clusters which result in the production of
polyketides as secondary metabolites, including those from aromatic
(Type II) PKS gene clusters. Examples are act promoters, tcm
promoters, spiramycin promoters, and the like. However, other
bacterial promoters, such as those derived from sugar metabolizing
enzymes, such as galactose, lactose (lac) and maltose, are also
useful. Additional examples include promoters derived from
biosynthetic enzymes such as tryptophan (trp), the .beta.-lactamase
(bla), bacteriophage lambda PL, and T5. In addition, synthetic
promoters, such as the tac promoter (U.S. Pat. No. 4,551,433), can
be used.
[0059] Other regulatory sequences may also be desirable which allow
for regulation of expression of the PKS replacement sequences
relative to the growth of the host cell. Regulatory sequences are
known to those of skill in the art, and examples include those
which cause the expression of a gene to be turned on or off in
response to a chemical or physical stimulus, including the presence
of a regulatory compound. Other types of regulatory elements may
also be present in the vector, for example, enhancer sequences.
[0060] Selectable markers can also be included in the recombinant
expression vectors. A variety of markers are known which are useful
in selecting for transformed cell lines and generally comprise a
gene whose expression confers a selectable phenotype on transformed
cells when the cells are grown in an appropriate selective medium.
Such markers include, for example, genes which confer antibiotic
resistance or sensitivity to the plasmid. Alternatively, several
polyketides are naturally colored and this characteristic provides
a built-in marker for screening cells successfully transformed by
the present constructs.
[0061] The various PKS nucleotide sequences, or a cocktail of such
sequences, can be cloned into one or more recombinant vectors as
individual cassettes, with separate control elements, or under the
control of, e.g., a single promoter. The PKS subunits or cocktail
components can include flanking restriction sites to allow for the
easy deletion and insertion of other PKS subunits or cocktail
components so that hybrid PKSs can be generated. The design of such
unique restriction sites is known to those of skill in the art and
can be accomplished using the techniques described above, such as
site-directed mutagenesis and PCR.
[0062] As described above, particularly useful control sequences
are those which themselves, or using suitable regulatory systems,
activate expression during transition from growth to stationary
phase in the vegetative mycelium. The system contained in the
illustrated plasmid pCK7, i.e., the actI/actIII promoter pair and
the actII-ORF4, an activator gene, is particularly preferred.
Particularly preferred hosts are those which lack their own means
for producing polyketides so that a cleaner result is obtained.
Illustrative host cells of this type include the modified S.
coelicolor CH999 culture described in PCT application WO 96/40968
and similar strains of S. lividans.
[0063] The expression vectors containing nucleotide sequences
encoding a variety of PKS systems for the production of different
polyketides are then transformed into the appropriate host cells to
construct the library. In one straightforward approach, a mixture
of such vectors is transformed into the selected host cells and the
resulting cells plated into individual colonies and selected for
successful transformants. Each individual colony will then
represent a colony with the ability to produce a particular PKS
synthase and ultimately a particular polyketide. Typically, there
will be duplications in some of the colonies; the subset of the
transformed colonies that contains a different PKS in each member
colony can be considered the library. Alternatively, the expression
vectors can be used individually to transform hosts, which
transformed hosts are then assembled into a library. A variety of
strategies might be devised to obtain a multiplicity of colonies
each containing a PKS gene cluster derived from the naturally
occurring host gene cluster so that each colony in the library
produces a different PKS and ultimately a different polyketide. The
number of different polyketides that are produced by the library is
typically at least four, more typically at least ten, and
preferably at least 20, more preferably at least 50, reflecting
similar numbers of different altered PKS gene clusters and PKS gene
products. The number of members in the library is arbitrarily
chosen; however, the degrees of freedom outlined above with respect
to the variation of starter, extender units, stereochemistry,
oxidation state, and chain length is quite large.
[0064] Methods for introducing the recombinant vectors of the
present invention into suitable hosts are known to those of skill
in the art and typically include the use of CaCl.sub.2 or other
agents, such as divalent cations, lipofection, DMSO, protoplast
transformation and electroporation. As disclosed in copending
application Ser. No. 08/989,332 filed Dec. 11, 1997, incorporated
herein by reference, a wide variety of hosts can be used, even
though some hosts natively do not contain the appropriate
post-translational mechanisms to activate the acyl carrier proteins
of the synthases. These hosts can be modified with the appropriate
recombinant enzymes to effect these modifications.
[0065] The polyketide producing colonies can be identified and
isolated using known techniques and the produced polyketides
further characterized. The polyketides produced by these colonies
can be used collectively in a panel to represent a library or may
be assessed individually for activity.
[0066] The libraries can thus be considered at four levels: (1) a
multiplicity of colonies each with a different PKS encoding
sequence encoding a different PKS cluster but all derived from a
naturally occurring PKS cluster; (2) colonies which contain the
proteins that are members of the PKS produced by the coding
sequences; (3) the polyketides produced; and (4) antibiotics
derived from the polyketides. Of course, combination libraries can
also be constructed wherein members of a library derived, for
example, from the erythromycin PKS can be considered as a part of
the same library as those derived from, for example, the rapamycin
PKS cluster.
[0067] Colonies in the library are induced to produce the relevant
synthases and thus to produce the relevant polyketides to obtain a
library of candidate polyketides. The polyketides secreted into the
media can be screened for binding to desired targets, such as
receptors, signaling proteins, and the like. The supernatants per
se can be used for screening, or partial or complete purification
of the polyketides can first be effected. Typically, such screening
methods involve detecting the binding of each member of the library
to receptor or other target ligand. Binding can be detected either
directly or through a competition assay. Means to screen such
libraries for binding are well known in the art.
[0068] Alternatively, individual polyketide members of the library
can be tested against a desired target. In this event, screens
wherein the biological response of the target is measured can more
readily be included.
[0069] Indeed, a large number of novel polyketides have been
prepared according to the method of the invention as illustrated in
the examples below. These novel polyketides are useful
intermediates in formation of compounds with antibiotic activity
through glycosylation reactions as described above. As indicated
above, the individual polyketides are reacted with suitable sugar
derivatives to obtain compounds of antibiotic activity. Antibiotic
activity can be verified using typical screening assays such as
those set forth in Lehrer, R. et al. J Immunol Meth (1991)
137:167-173.
[0070] New polyketides which are the subject of the invention are
those described below. New antibiotics which are the subject of the
invention include the glycosylated forms of these polyketides.
[0071] In one embodiment, the polyketides of the invention include
the compounds of structure (1) and the glycosylated forms thereof.
Thecompounds include the polyketide structure: 1
[0072] including the isolated stereoisomeric forms thereof,
[0073] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0074] each of R.sup.1 and R.sup.2 is independently H or alkyl
(1-4C) wherein any alkyl at R.sup.1 may optionally be
substituted;
[0075] X.sup.1 is H.sub.2, HOH or .dbd.O;
[0076] with the provisos that:
[0077] at least one of R.sup.1 and R.sup.2 must be alkyl (1-4C);
and
[0078] the compound is other than compounds 1, 2, 3, 5 and 6 of
FIG. 6A.
[0079] Particularly preferred embodiments of formula (1) include
compound 4 shown in FIG. 6A.
[0080] In another embodiment, the polyketides of the invention
include the compounds of formula (2) and the glycosylated forms
thereof. These compounds include the polyketide structure: 2
[0081] including the isolated stereoisomeric forms thereof;
[0082] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0083] each of R.sup.1, R.sup.2 and R.sup.3 is independently H or
alkyl (1-4C) wherein any alkyl at R.sup.1 may optionally be
substituted;
[0084] each of X.sup.1 and X.sup.2 is independently H.sub.2, HOH or
.dbd.O;
[0085] with the provisos that:
[0086] at least two of R.sup.1, R.sup.2 and R.sup.3 are alkyl
(1-4C).
[0087] In another embodiment, the polyketides of the invention
include the compounds of structure (3) and the glycosylated forms
thereof. Thecompounds include the polyketide structure: 3
[0088] including the isolated stereoisomeric forms thereof;
[0089] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0090] each of R.sup.1, R.sup.2 and R.sup.3 is independently H or
alkyl (1-4C) wherein any alkyl at R.sup.1 may optionally be
substituted;
[0091] each of X.sup.1 and X.sup.2 is independently H.sub.2, HOH or
.dbd.O;
[0092] with the provisos that:
[0093] at least one of R.sup.1 and R.sup.2 must be alkyl (1-4C);
and
[0094] the compound is other than compound 8 of FIG. 6A.
[0095] The antibiotic forms of the polyketide of formula (3) are
the corresponding glycosylated forms.
[0096] Still other embodiments are those of the following formula,
including the glycosylated forms thereof. These are derived from
the compound of formula (4) which has the structure: 4
[0097] including the isolated stereoisomeric forms thereof;
[0098] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0099] each of R.sup.1, R.sup.2 and R.sup.3 is independently H or
alkyl (1-4C) wherein any alkyl at R.sup.1 may optionally be
substituted;
[0100] each of X* and X.sup.2 is independently H.sub.2, HOH or
.dbd.O;
[0101] with the proviso that:
[0102] at least one of R.sup.2 and R.sup.3 is alkyl (1-4C); and
[0103] the compound is other than compound 9 of FIG. 6A.
[0104] Still other embodiments are the result of the condensation
of five modules of the polyketide synthase system. The polyketide
forms of these compounds are of the formula: 5
[0105] including the glycosylated and isolated stereoisomeric forms
thereof;
[0106] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0107] each of R.sup.1, R.sup.2, R.sup.3, R.sup.4 and R.sup.5 is
independently H or alkyl (1-4C) wherein any alkyl at R.sup.1 may
optionally be substituted;
[0108] each of X.sup.1, X.sup.2, X.sup.3 and X.sup.4 is
independently H.sub.2, HOH or .dbd.O; or
[0109] X.sup.1 or X.sup.2 or X.sup.3 or X.sup.4 is H and the
compound of formula (5) contains a .pi.-bond at positions 8-9 or
6-7 or 4-5 or 2-3;
[0110] with the proviso that:
[0111] at least two of R.sup.1-R.sup.5 are alkyl (1-4C); and
[0112] the compound is other than compound 13 or 14 of FIG. 6A or
compound 205, 210-213 of FIG. 11.
[0113] Preferred forms of compounds that include formula (5) as
those wherein at least three, more preferably at least four, of
R.sup.1-R.sup.5 are alkyl (1-4C), preferably methyl or ethyl.
[0114] Also preferred are compounds wherein X.sup.1 is --OH and/or
X.sup.2.dbd.O, and/or X.sup.3 is H.
[0115] The glycosylated forms of these compounds are also useful
antibiotics.
[0116] Resulting from the condensation effected by six modules are
the compounds which comprise the formula: 6
[0117] including the glycosylated and isolated stereoisomeric forms
thereof;
[0118] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0119] each of R.sup.1-R.sup.6 is independently H or alkyl (1-4C)
wherein any alkyl at R.sup.1 may optionally be substituted;
[0120] each of X.sup.1-X.sup.5 is independently H.sub.2, HOH or
.dbd.O; or
[0121] each of X.sup.1-X.sup.5 is independently H and the compound
of formula (5) contains a .pi.-bond in the ring adjacent to the
position of said X at 2-3,4-5, 6-7,8-9 and/or 10-11;
[0122] with the proviso that:
[0123] at least two of R.sup.1-R.sup.6 are alkyl (1-4C); and
[0124] the compound is other than compound 17, 24 or 28 of FIG. 6B,
compound 301-311 of FIG. 12(A) or compounds 312-322 of FIG.
12(B).
[0125] Preferred compounds comprising formula 6 are those wherein
at least three of R.sup.1-R.sup.5 are alkyl (1-4C), preferably
methyl or ethyl; more preferably wherein at least four of
R.sup.1-R.sup.5 are alkyl (1-4C), preferably methyl or ethyl.
[0126] Also preferred are those wherein X.sup.2 is H.sub.2.dbd.O or
H . . . OH, and/or X.sup.3 is H, and/or X.sup.1 is OH and/or
X.sup.4 is OH and/or X.sup.5 is OH.
[0127] Particularly preferred are compounds of formulas 18-23,
25-27, 29-75 and 101 and 113 of FIGS. 6B-6F. Also preferred are
compounds with variable R* when R.sup.1-R.sup.5 are methyl, X.sup.2
is .dbd.O, and X.sup.1, X.sup.4 and X.sup.5 are OH examples of
which are depicted in formulas 96-100 and 104-107 of FIGS. 6G and
6H. The glycosylated forms of the foreoging are also preferred.
[0128] Other polyketides which result from the condensation
catalyzed by six modules of a modular PKS include those of the
formula: 7
[0129] including the glycosylated and isolated stereoisomeric forms
thereof;
[0130] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0131] each of R.sup.1-R.sup.5 is independently H or alkyl (1-4C)
wherein any alkyl at R.sup.1 may optionally be substituted;
[0132] R.sup.6 is alkyl (1-5C);
[0133] each of X.sup.1 and X.sup.3 and X.sup.6 is independently
H.sub.2, HOH or .dbd.O;
[0134] with the proviso that:
[0135] at least two of R.sup.1-R.sup.4 are alkyl (1-4C).
[0136] These and their corresponding glycosylated forms are also
included in the invention.
[0137] Still others include those of the formula: 8
[0138] including the isolated stereoisomeric forms thereof;
[0139] wherein R* is a straight chain, branched or cyclic,
saturated or unsaturated substituted or unsubstituted hydrocarbyl
of 1-15C;
[0140] each of R.sup.1-R.sup.5 is independently H or alkyl (1-4C)
wherein any alkyl at R.sup.1 may optionally be substituted;
[0141] R.sup.6 is alkyl (1-5C);
[0142] X is OH or H;
[0143] each X.sup.1, X.sup.3, X.sup.4 and X.sup.5 is independently
H.sub.2, HOH or .dbd.O; or X.sup.3 or X.sup.4 is H and
[0144] the compound of formula (8) has a .pi.-bond between
positions 7-8 or 9-10, with the proviso that:
[0145] if X.sup.2 is H, at least one of X.sup.3 and X.sup.4 is HOH
or .dbd.O.
[0146] These and their corresponding glycosylated forms are also
included in the invention.
[0147] As above, the glycosylated forms are useful antibiotics.
[0148] As set forth above, R* in the compounds of the invention may
be substituted as well as unsubstituted. Suitable substituents
include halo (F, Cl, Br, I), N.sub.3, OH, O-alkyl (1-6C), S-alkyl
(1-6C), CN, O-acyl (1-7C), O-aryl (6-10C), O-alkyl-aryl (7-14C),
NH.sub.2, NH-alkyl (1-6C) and N-(alkyl).sub.2.
[0149] Suitable substituents on R1 are selected from the same group
as those for R*. In addition, the substituents on R.sup.1 and R*
may form a ring system such as an epoxide ring, or a larger
heterocyclic ring including O, or N or S. Preferred substituents
for R and R.sup.1 are halo, OH and NH.sub.2. Unsubstituted forms
are also preferred.
[0150] Particularly useful as antibiotics within the scope of the
invention are compounds of formulas 82-93 as set forth in FIG. 8
herein.
[0151] Still another embodiment of the compounds of the invention
is set forth as compound 94 in FIG. 9. Its glycosylated form, shown
as compound 95, is useful as an antibiotic.
EXAMPLES
[0152] The following examples are intended to illustrate, but not
to limit the invention.
Materials and Methods
General Techniques
[0153] Bacterial strains, plasmids, and culture conditions. S.
coelicolor CH999 described in WO 95/08548, published Mar. 30, 1995
was used as an expression host. DNA manipulations were performed in
Escherichia coli MCI 061. Plasmids were passaged through E. coli
ET12567 (dam dcm hsdS Cm.sup.r) (MacNeil, D. J. J Bacteriol (1988)
170:5607) to generate unmethylated DNA prior to transformation of
S. coelicolor. E. coli strains were grown under standard
conditions. S. coelicolor strains were grown on R2YE agar plates
(Hopwood, D. A. et al. Genetic manipulation of Streptomyces. A
laboratory manual. The John Innes Foundation: Norwich, 1985). pRM5,
also described in WO 95/08548, includes a coleI replicon, an
appropriately truncated SCP2* Streptomyces replicon, two
act-promoters to allow for bidirectional cloning, the gene encoding
the actII-ORF4 activator which induces transcription from act
promoters during the transition from growth phase to stationary
phase, and appropriate marker genes. Engineered restriction sites
facilitate the combinatorial construction of PKS gene clusters
starting from cassettes encoding individual domains of naturally
occurring PKSs.
[0154] When pRM5 is used for expression of PKS, (i) all relevant
biosynthetic genes are plasmid-borne and therefore amenable to
facile manipulation and mutagenesis in E. coli, (ii) the entire
library of PKS gene clusters can be expressed in the same bacterial
host which is genetically and physiologically well-characterized
and presumably contains most, if not all, ancillary activities
required for in vivo production of polyketides, (iii) polyketides
are produced in a secondary metabolite-like manner, thereby
alleviating the toxic effects of synthesizing potentially bioactive
compounds in vivo, and (iv) molecules thus produced undergo fewer
side reactions than if the same pathways were expressed in
wild-type organisms or blocked mutants.
[0155] Manipulation of DNA and organisms. Polymerase chain reaction
(PCR) was performed using Taq polymerase (Perkin Elmer Cetus) under
conditions recommended by the enzyme manufacturer. Standard in
vitro techniques were used for DNA manipulations (Sambrook, et al.
Molecular Cloning: A Laboratory Manual (Current Edition)). E. coli
was transformed with a Bio-Rad E. Coli Pulsing apparatus using
protocols provided by Bio-Rad. S. coelicolor was transformed by
standard procedures (Hopwood, D. A. et al. Genetic manipulation of
Streptomyces. A laboratory manual. The John Innes Foundation:
Norwich, 1985) and transformants were selected using 2 mL of a 500
.mu.g/ml thiostrepton overlay.
Preparation A
Construction of the Complete Erythromycin PKS Gene Cluster
[0156] Recovery of the Erythromycin PKS Genes
[0157] Although various portions of the erythromycin PKS gene
cluster can be manipulated separately at any stage of the process
of preparing libraries, it may be desirable to have a convenient
source of the entire gene cluster in one place. Thus, the entire
erythromycin PKS gene cluster can be recovered on a single plasmid
if desired. This is illustrated below utilizing derivatives of the
plasmid pMAK705 (Hamilton et al. J Bacteriol (1989) 171:4617) to
permit in vivo recombination between a temperature-sensitive donor
plasmid, which is capable of replication at a first, permissive
temperature and incapable of replication at a second,
non-permissive temperature, and recipient plasmid. The eryA genes
thus cloned gave pCK7, a derivative of pRM5 (McDaniel et al.
Science (1993) 262:1546). A control plasmid, pCK7f, was constructed
to carry a frameshift mutation in eryAI. pCK7 and pCK7f possess a
ColEI replicon for genetic manipulation in E. coli as well as a
truncated SCP2* (low copy number) Streptomyces replicon.
[0158] These plasmids also contain the divergent actI/actIII
promoter pair and actII-ORF4, an activator gene, which is required
for transcription from these promoters and activates expression
during the transition from growth to stationary phase in the
vegetative mycelium. High-level expression of PKS genes occurs at
the onset of the stationary phase of mycelial growth. The
recombinant strains therefore produce the encoded polyketides as
secondary metabolites.
[0159] In more detail, pCK7 (FIG. 4), a shuttle plasmid containing
the complete eryA genes, which were originally cloned from pSI
(Tuan et al. Gene (1990) 90:21), was constructed as follows. The
modular DEBS PKS genes were transferred incrementally from a
temperature-sensitive "donor" plasmid, i.e., a plasmid capable of
replication at a first, permissive temperature and incapable of
replication at a second, non-permissive temperature, to a
"recipient" shuttle vector via a double recombination event, as
depicted in FIG. 5. A 25.6 kb SphI fragment from pS1 was inserted
into the SphI site of pMAK705 (Hamilton et al. J Bacteriol (1989)
171:4617) to give pCK6 (Cm.sup.R), a donor plasmid containing
eryAII, eryAIII, and the 3' end of eryAI. Replication of this
temperature-sensitive pSC101 derivative occurs at 30.degree. C. but
is arrested at 44.degree. C. The recipient plasmid, pCK5 (Ap.sup.R,
Tc.sup.R), includes a 12.2 kb eryA fragment from the eryAI start
codon (Caffrey et al. FEBS Lett (1992) 304:225) to the XcmI site
near the beginning of eryAII, a 1.4 kb EcoRI-BsmI pBR322 fragment
encoding the tetracycline resistance gene (Tc), and a 4.0 kb
NotI-EcoRI fragment from the end of eryAIII. PacI, NdeI, and
ribosome binding sites were engineered at the eryAI start codon in
pCK5. pCK5 is a derivative of pRM5 (described above). The 5' and 3'
regions of homology are 4.1 kb and 4.0 kb, respectively. MC 1061 E.
coli was transformed with pCK5 and pCK6 and subjected to
carbenicillin and chloramphenicol selection at 30.degree. C.
Colonies harboring both plasmids (Ap.sup.R, Cm.sup.R) were then
restreaked at 44.degree. C. on carbenicillin and chloramphenicol
plates. Only cointegrates formed by a single recombination event
between the two plasmids were viable. Surviving colonies were
propagated at 30.degree. C. under carbenicillin selection, forcing
the resolution of the cointegrates via a second recombination
event. To enrich for pCK7 recombinants, colonies were restreaked
again on carbenicillin plates at 44.degree. C. Approximately 20% of
the resulting colonies displayed the desired phenotype (Ap.sup.R,
Tc.sup.S, Cm.sup.S). The final pCK7 candidates were thoroughly
checked via restriction mapping. A control plasmid, pCK7f, which
contains a frameshift error in eryAI, was constructed in a similar
manner. pCK7 and pCK7f were transformed into E. coli ET12567
(MacNeil J Bacteriol (1988) 170:5607) to generate unmethylated
plasmid DNA and subsequently moved into Streptomyces coelicolor
CH999.
[0160] Upon growth of CH999/pCK7 on R2YE medium, the organism
produced abundant quantities of two polyketides. The addition of
propionate (300 mg/L) to the growth medium resulted in
approximately a two-fold increase in yield of polyketide product.
Proton and .sup.13C NMR spectroscopy, in conjunction with
propionic-1-.sup.13C acid feeding experiments, confirmed the major
product as 6dEB (>40 mg/L) (FIG. 1A). The minor product was
identified as 8,8a-deoxyoleandolide (>10 mg/L) (FIG. 1A), which
apparently originates from an acetate starter unit instead of
propionate in the 6dEB biosynthetic pathway. .sup.13C.sub.2 sodium
acetate feeding experiments confirmed the incorporation of acetate
into the minor product. Three high molecular weight proteins
(>200 kDa), presumably DEBS1, DEBS2, and DEBS3 (Caffrey et al.
FEBS Lett (1992) 304:225), were also observed in crude extracts of
CH999/pCK7 via SDS-polyacrylamide gel electrophoresis. No
polyketide products were observed from CH999/pCK7f. The inventors
hereby acknowledge support provided by the American Cancer Society
(IRG-32-34).
Example 1
Preparation of Scaffolds for Replacing DEBS AT and KR Domains
[0161] For each of the six modules of DEBS, a subclone was made
containing endonuclease restriction sites engineered at selected
boundaries of the acyltransferase (AT) and reduction (KR or
DH/ER/KR) domains. The restriction sites were introduced into the
subclones by PCR mutagenesis. A BamHI site was used for the 5'
boundary of AT domains, a PstI site was introduced between the AT
and reductive domains, and XbaI was used at the 3' end of the
reductive domain (see FIG. 5). This resulted in the following
engineered sequences (lowercase indicates engineered restriction
site) (SEQ ID NOS:5-22):
1 Module 1 (pKOS011-16) 5'AT boundary GCGCAGCAGggatccGTCTTCGTC
AT/KR boundary CGCGTCTGGctgcagCCGAAGCCG 3'KR boundary
CCGGCCGAAtctagaGTGGGCGCG Module 2 (pKOS001-11) 5'AT boundary
TCCGACGGTggatccGTGTTCGTC AT/KR boundary CGGTTCTGGctgcagCCGGACCGC
3'KR boundary ACGGAGAGCtctagaGACCGGCTG Module 3 (pKOS024-2) 5'AT
boundary GACGGGCGCggatccGTCTTCCTG AT/KR boundary
CGCTACTGGctgcagCCCGCCGCA 3'KR boundary ACCGGCGAGtctagaCAACGGCTC
Module 4 (pKOS024-3) 5'AT boundary GCGCCGCGCggatccGTCCTGGTC
AT(DH/ER/KR) boundary CGCTTCTGGctgcagCCGCACCGG 3'DH/ER/KR boundary
GGGCCGAACtctagaGACCGGCTC Module 5 (pKOS006-182) 5'AT boundary
ACTCGCCGCggatccGCGATGGTG AT/KR boundary CGGTACTGGctgcagATCCCCACC
3'KR boundary GAGGAGGGCtctagaCTCGCCCAG Module 6 (pKOS015-52) 5'AT
boundary TCCGCCGGCggatccGTTTTCGTC AT/KR boundary
CGGTACTGGctgcagCCGGAGGTG 3'KR boundary GTGGGGGCCtctagaGCGGTGCAG
Example 2
Preparation of Cassettes from the Rapamycin PKS
[0162] A cosmid library of genomic DNA from Streptomyces
hygroscopicus ATCC 29253 was used to prepare DNA cassettes prepared
from the rapamycin PKS gene cluster to be used as replacements into
the enzymatic activity regions of the erythromycin gene cluster.
Cassettes were prepared by PCR amplification from appropriate
cosmids or subclones using the primer pairs listed in Table 1, and
were designed to introduce suitable restriction sites at the ends
of the cassettes. The rapAT2 cassette is flanked by BglII and PstI
sites, and the rapAT14 cassette is flanked by BamHI and PstI sites.
The reductive cycle cassettes are flanked by PstI and XbaI sites.
Large DH/ER/KR cassettes were amplified in two pieces, then joined
at an engineered XhoI site in order to minimize errors introduced
during PCR amplification of long DNA sequences. The rapKR4 cassette
was made by cloning a 1.3 kb NheI/XbaI fragment from the rapDH/KR4
cassette above into the XbaI site in pUC 19. There is a PstI site
that is in-frame and upstream of XbaI in pUC19 that generates the
following junction at the 5'-end of the cassette:
[0163] 5'-ctgcagGTCGACTCTAGCCTGGT . . .
2TABLE I Primer pairs used for PCR amplification of rapamycin PKS
cassettes. All primers are listed from 5' to 3'. Engineered
restriction sites are lower case. Module Primer Sequence (SEQ ID
NOS:24-35) rapAT2 forward: TTfagatctGTGTTCGTCTTCCCGGGT Reverse:
TTTctgcagCCAGTACCGCTGGTGCTGG- AAGGCGTA rapAT14 Forward:
TTTggatccGCCTTCCTGTTCGACGGGCAAGG- C Reverse:
TTTctgcagCCAGTAGGACTGGTGCTGGAACGG rapKR2 Forward:
TTTctgcagGAGGGCACGGACCGGGCGACTGCGGGT Reverse:
TTTtctagaACCGGCGGCAGCGGCCCGCCGAGCAAT rapDH/KR4 Forward:
TTctgcagAGCGTGGACCGGGCGGCT Reverse: TTVtctagaGTCACCGGTAGAGGCGGCCC-
T rapDH/ER/KR1 Forward: TTTctgcagGGCGTGGACCGGGCGGCTGCC (left half)
Reverse: TTTctcgagCACCACGCCCGCAGCCTCACC rapDH/ER/KR1 Forward:
TTTctcgagGTCGGTCCGGAGGTCCAGGAT (right half) Reverse:
TTTtctagaATCACCGGTAGAAGCAGCCCG
Example 3
Replacement of DEBS Modules By Rapamycin PKS Cassettes
[0164] The following are typical procedures. The products are
indicated by their numbers in FIG. 6, where "a" represents the
embodiment where R is methyl; "b" represents the embodiment where R
is hydrogen.
[0165] a) Replacement of DEBS DH/ER/KR4. A portion of the
erythromycin gene of module 4 (eryDH/ER/KR4) was replaced either
with the corresponding rapamycin activities of the first rapamycin
module (rapDH/ER/KR1) or of module 4 of rapamycin (rapDH/KR4). The
replacement utilized the technique of Kao et al. Science (1994)
265:509-512. A donor plasmid was prepared by first amplifying 1 kbp
regions flanking the DH/ER/KR4 of DEBS to contain a PstI site at
the 3' end of the left flank and an XbaI site at the 5' end of the
right flank. The fragments were ligated into a
temperature-sensitive donor plasmid, in a manner analogous to that
set forth for KR6 in paragraph b) of this example. and the
rapamycin cassettes prepared as described in Example 2 were
inserted into the PstI/XbaI sites. The recipient plasmid was pCK7
described in Preparation A. The in vivo recombination technique
resulted in the expression plasmid pKOS011-19
(eryDH/ER/KR4.fwdarw.rapDH/ER/KR1) and pKOS011-21
(eryDH/ER/KR4.fwdarw.rapDH/KR4). The junctions at which the PstI
and XbaI sites were introduced into DEBS in both vectors are as
follows:
3 (SEQ ID NOS: 36-37) GAGCCCCAGCGGTACTGGCTGCAG rap cassette
TCTAGAGCGGTGCAGGCGGCCCCG
[0166] The resulting expression vectors were transformed into S.
coelicolor CH999 and successful transformants grown as described
above. The transformant containing the rapDH/ER/KR1 cassette
produced the polyketide shown in FIG. 6 as 23a,b; the transformant
containing the plasmid with rapDH/KR4 cassette produced the
polyketide shown in FIG. 6 as 24a,b. As shown, these polyketides
differ from 6-deoxyerythronolide B by virtue of a 6,7 alkene in the
case of 24a and by the C6-methyl stereochemistry in the case of
23a.
[0167] b) Replacement of DEBS KR6. In a manner analogous to that
set forth in paragraph a), plasmid pKOS011-25, wherein eryKR6 was
replaced by rapDH/KR4, was prepared by substituting regions
flanking the KR6 domain of DEBS in construction of the donor
plasmid.
[0168] Approximately 1 kb regions flanking the eryKR6 domain were
PCR amplified with the following primers (SEQ ID NOS:38-41):
4 left forward 5'-TTTGGATCCGTTTTCGTCTTCCCAGGTCAG flank reverse
5'-TTTCTGCAGCCAGTACCGCTGGGGCTCGAA right forward
5'-TTTTCTAGAGCGGTGCAGGCGGCCCCGGCG flank reverse
5'-AAAATGCATCTATGAATTCCCTCCGCCCA
[0169] These fragments were then cloned into a pMAK705 derivative
in which the multiple cloning site region was modified to
accommodate the restriction sites of the fragments (i.e.,
BamHI/PstI for the left flank and XbaI/NsiI for the right flank).
Cassettes were then inserted into the PstI/XbaI sites of the above
plasmid to generate donor plasmids for the in vivo recombination
protocol. The resulting PstI and XbaI junctions engineered into
DEBS are as follows:
5 (SEQ ID NOS:42-43) GAACACCAGCGCTTCTGGCTGCAG rap cassette
TCTAGAGACCGGCTCGCCGGTCGG
[0170] Regions flanking the KR6 domain of DEBS were used to
construct the donor plasmids.
[0171] Transformants of S. coelicolor CH999 resulted in the
production of the polyketide shown in FIG. 6 as 74a,b.
[0172] c) Replacement of DEBS KR2. The eryKR2 enzymatic activity
was replaced in a series of vectors using in vitro insertion into
the PstI/XbaI sites of pKAO263. pKAO263 is a derivative of pCK13
described in Kao, C. M. J Am Chem Soc (1996) 118:9184-9185. It was
prepared by introducing the PstI and XbaI restriction sites
positioned identically to those in the analogous 2-module DEBS
system described by Bedford, D. et al. Chem an Biol (1996)
3:827-831. Three expression plasmids were prepared: pKOS009-7
(eryKR2.fwdarw.rapDH/KR4); pKAO392 (eryKR2.fwdarw.rapKR2); and
pKAO410 (eryKR2.fwdarw.rapDH/ER/KR1). these plasmids, when
transformed into S. coelicolor CH999, resulted in the production of
polyketides with the structures 12a,b; 3a,b; and 10a, 11a,b in FIG.
6, respectively. An additional vector, pKAO400
(eryKR2.fwdarw.rapKR4) produced the same results as pKAO392.
[0173] d) Replacement of DEBS AT2. The DEBS AT activity from module
2 was excised after inserting restriction sites BamHI and PstI
flanking the AT module 2 domain into pCK12 (Kao et al. J Am Chem
Soc (1995) 112:9105-9106). After digestion with BamHI/PstI, the
BglII/PstI fragment containing rapAT2 was inserted. The resulting
engineered DEBS/rapAT2 junction is as follows (BamHI/BglII
ligation--GGATCT; PstI--CTGCAG):
[0174] AGTGCCTCCGACGGTGGATCT rapAT2 CTGCAGCCGGACCGCACCACCCCT (SEQ
ID NOS:44-45)
[0175] S. coelicolor CH999 transformed with the resulting plasmid,
pKOS008-51, produced the polyketides 6a,b shown in FIG. 6.
Example 4
Excision of DEBS Reductive Cycle Domains
[0176] The following is a typical procedure. The products are
indicated by their numbers in FIG. 6, where "a" represents the
embodiment where R is methyl; "b" represents the embodiment where R
is hydrogen.
[0177] A duplex oligonucleotide linker (.DELTA.Rdx) was designed to
allow complete excision of reductive cycle domains. Two synthetic
oligonucleotides (SEQ ID NOS:46-47):
6 5'-GCCGGACCGCACCACCCCTCGTGACGGAGAACCGGAGACGGAGAGCT-3'
3'-ACGTCGGCCTGGCGTGGTGGGGAGCACTGCCTCTTGGCCTCTGCCTCTCGAGATC-5' PstI
XbaI
[0178] were designed to generate PstI- and XbaI-compatible ends
upon hybridization. This duplex linker was ligated into the PstI-
and XbaI-sites of the recombination donor plasmid containing the
appropriate left- and right-flanking regions of the reductive
domain to be excised. The in vivo recombination technique of
Example 3, paragraph a) was then used. The donor plasmid contained
the duplex linker .DELTA.Rdx having a PstI and XbaI compatible end
ligated into the PstI and XbaI sites of the plasmid modified to
contain the left and right flanking regions of the reductive domain
to be excised. The donor plasmids were recombined with recipient
plasmid pCK7 to generate pKOS011-13 (eryKR6.fwdarw..DELTA.Rdx) and
with recipient plasmid pCK13 to obtain pKOS005-4
(eryKR2.fwdarw..DELTA.Rdx). When transformed into S. coelicolor
CH999, plasmid pKOS011-13 produced the polyketides 30a,b, 31a,b,
77a,b and 78a,b; in FIG. 6 plasmid pKOS005-4 produced the
polyketide 2a,b.
Example 5
Manipulation of Macrolide Ring Size by Directed Mutagenesis of
DEBS
[0179] The following are typical procedures. The products are
indicated by their numbers in FIG. 6, where "a" represents the
embodiment where R is methyl; "b" represents the embodiment where R
is hydrogen.
[0180] Using the expression system of Kao, C. M. et al. Science
(1994) 265:509-512, the expression of DEBS1 alone (1+2), in the
absence of DEBS2 and DEBS3 (in plasmid pCK9), resulted in the
production of (2R,3S,4S,5R)-2,4-dimethyl-3,5-dihydroxy-n-heptanoic
acid L-lactone ("the heptanoic acid L-lactone" (1a) (see FIGS. 6
and 7)) (1-3 mg/L), the expected triketide product of the first two
modules (Kao, C. M. et al. J Am Chem Soc (1994) 116:11612-11613).
Thus, a thioesterase is not essential for release of a triketide
from the enzyme complex.
[0181] Two additional deletion mutant PKS were constructed. The
first contained DEBS1 fused to the TE, and the second PKS included
the first five DEBS modules fused to the TE. Plasmids pCK12 and
pCK15 respectively contained the genes encoding the bimodular
("1+2+TE") and pentamodular ("1+2+3+4+5+TE") PKSs.
[0182] The 1+2+TE PKS in pCK12 contained a fusion of the
carboxy-terminal end of the acyl carrier protein of module 2
(ACP-2) to the carboxy-terminal end of the acyl carrier protein of
module 6 (ACP-6). Thus ACP-2 is essentially intact and is followed
by the amino acid sequence naturally found between ACP-6 and the
TE. Plasmid pCK12 contained eryA DNA originating from pS1 (Tuan, J.
S. et al. Gene (1990) 90:21). pCK12 is identical to pCK7 (Kao et
al. Science (1994), supra) except for a deletion between the
carboxy-terminal ends of ACP-2 and ACP-6. The fusion occurs between
residues L3455 of DEBS1 and Q2891 of DEBS3. An SpeI site is present
between these two residues so that the DNA sequence at the fusion
is CTCACTAGTCAG (SEQ ID NO:48).
[0183] The 1+2+3+4+5+TE PKS in pCK15 contained a fusion 76 amino
acids downstream of the .beta.-ketoreductase of module 5 (KR-5) and
five amino acids upstream of ACP-6. Thus, the fusion occurs towards
the carboxy-terminal end of the non-conserved region between KR-5
and ACP-5, and the recombinant module 5 was essentially a hybrid
between the wild type modules 5 and 6. Plasmid pCK15 contained eryA
DNA originating from pSI (Tuan et al. Gene (1990), supra). pCK15 is
a derivative of pCK7 (Kao et al. Science (1994), supra) and was
constructed using the in vivo recombination strategy described
earlier (Kao et al. Science (1994), supra). pCK15 is identical to
pCK7 with the exception of a deletion between KR-5 and ACP-6, which
occurs between residues G1372 and A2802 of DEBS3, and the insertion
of a blunted a SalI fragment containing a kanamycin resistance gene
(Oka A. et al. J Mol Biol (1981) 147:217) into the blunted HindIII
site of pCK7. An arginine residue is present between G1372 and
A2802 so that the DNA sequence at the fusion is GGCCGCGCC.
[0184] Plasmids pCK12 and pCK15 were introduced into S. coelicolor
CH999 and polyketide products were purified from the transformed
strains according to methods previously described (Kao et al.
Science (1994), supra). The products obtained from various
transformants: CH999/pCK12 and CH999/pCK15 as well as CH999/pCK9
described above, are shown in FIG. 7.
[0185] CH999/pCK 12 produced the heptanoic acid L-lactone (1a) (20
mg/L) as determined by .sup.1H and .sup.13C NMR spectroscopy. This
triketide product is identical to that produced by CH999/pCK9,
which expresses the unmodified DEBS1 protein alone described above.
However, CH999/pCK12 produced 6Ba in significantly greater
quantities than did CH999/pCK9 (>10 mg/L vs. .about.1 mg/L),
indicating the ability of the TE to catalyze thiolysis of a
triketide chain attached to the ACP domain of module 2. CH999/pCK12
also produced significant quantities of 1b, a novel analog of 1a,
(10 mg/L), that resulted from the incorporation of an acetate start
unit instead of propionate. This is reminiscent of the ability of
CH999/pCK7, which expresses the intact PKS, to produce
8,8a-deoxyoleandolide (see FIG. 1A) in addition to 6dEB described
above.
[0186] Since 1b was not detected in CH999/pCK9, its facile
isolation from CH999/pCK12 provides additional evidence for the
increased turnover rate of DEBS1 due to the presence of the TE. In
other words, the TE can effectively recognize an intermediate bound
to a "foreign" module that is four acyl units shorter than its
natural substrate, 6dEB. However, since the triketide products can
probably cyclize spontaneously into 1a and 1b under typical
fermentation conditions (pH 7), it is not possible to discriminate
between a biosynthetic model involving enzyme-catalyzed
lactonization and one involving enzyme-catalyzed hydrolysis
followed by spontaneous lactonization. Thus, the ability of the
1+2+TE PKS to recognize the C-5 hydroxyl of a triketide as an
incoming nucleophile is unclear.
[0187] CH999/pCK15, produced abundant quantities of
(8R,9S)-8,9-dihydro-8-methyl-9-hydroxy-10-deoxymethonolide
(compound 13 in FIG. 6) (10 mg/L), demonstrating that the
pentamodular PKS is active. Compound 13 was characterized using
.sup.1H and .sup.13C NMR spectroscopy of natural abundance and
.sup.13C-enriched material, homonuclear correlation spectroscopy
(COSY), heteronuclear correlation spectroscopy (HETC OR), mass
spectrometry, and molecular modeling. Compound 13 is an analog of
10-deoxymethonolide (compound 14, Lambalot, R. H. et al. J
Antibiotics (1992) 45:1981-1982), the aglycone of the macrolide
antibiotic methymycin. The production of 13 by a pentamodular
enzyme demonstrates that active site domains in modules 5 and 6 in
DEBS can be joined without loss of activity. Thus, it appears that
individual modules as well as active sites are independent entities
which do not depend on association with neighboring modules to be
functional. The 12-membered lactone ring, formed by esterification
of the terminal carboxyl with the C-11 hydroxyl of the hexaketide
product, indicated the ability of the 1+2+3+4+5+TE PKS, and
possibly the TE itself, to catalyze lactonization of a polyketide
chain one acyl unit shorter than the natural product of DEBS, 6dEB.
Indeed, the formation of the 13 may mimic the biosynthesis of the
closely related 12-membered hexaketide macrolide, methymycin, which
frequently occurs with the homologous 14-membered heptaketide
macrolides, picromycin and/or narbomycin (Cane, D. E. et al. J Am
Chem Soc (1993) 115:522-566). The erythromycin PKS scaffold can
thus be used to generate a wide range of macrolactones with shorter
as well as longer chain lengths.
[0188] The construction of the 1+2+3+4+5+TE PKS resulted in the
biosynthesis of a previously uncharacterized 12-membered
macrolactone that closely resembles, but is distinct from, the
aglycone of a biologically active macrolide. The apparent
structural and functional independence of active site domains and
modules as well as relaxed lactonization specificity suggest the
existence of many degrees of freedom for manipulating these enzymes
to produce new modular PKSs.
Example 6
Production and Analysis of Polyketide Products
[0189] The expression vectors created by domain substitution in
DEBS, as described in Examples 1-5, were transformed into either
Streptomyces coelicolor CH999 or S. lividans K4-114 using standard
techniques (D. A. Hopwood et al. (1985) "Genetic Manipulation of
Streptomyces: A Laboratory Manual," (The John Innes Foundation,
Norwich)). Both host strains have complete deletions of the native
actinorhodin polyketide synthase gene cluster and so produce no
native polyketide products. Transformants were grown on 150 mm R2YE
agar plates for 2 days at 30.degree. C., at which time the agar
slab was lifted from the dish and placed in a new dish which
contained a layer of 4 mm glass beads, 50 mL of liquid R2YE medium
supplemented with 5 mM sodium propionate, and ca. 1 g of XAD-16
resin beads. This was kept at 30.degree. C. for an additional 7
days.
[0190] The XAD-16 resin was collected by vacuum filtration, washed
with water, then extracted twice with 10 mL portions of ethanol.
The extracts were combined and evaporated to a slurry, which was
extracted with ethyl acetate. The ethyl acetate was washed once
with sat. NaHCO.sub.3 and evaporated to yield the crude product.
Samples were dissolved in ethanol and analyzed by LC/MS. The HPLC
used a 4.6.times.150 mm C18 reversed-phase column with a gradient
from 80:19:1H.sub.2O/CH.sub.3CN/CH.- sub.3CO.sub.2H to 99:1
CH.sub.3CN/CH.sub.3CO.sub.2H. Mass spectra were recorded using a
Perkin-Elmer/Sciex API100LC spectrometer fitted with an APCI ion
source. Each genetic construct typically resulted in formation of
products in pairs, indicated in the FIG. 6 and in Table 2 by the
letters "a" (R.dbd.CH3) and "b" (R.dbd.H), arising from priming of
the PKS by and propionyl-CoA and acetyl-CoA, respectively.
Additional Examples
[0191] Using the foregoing techniques, the DEBS constructs shown in
Table 2 were prepared. The products obtained when the constructs
were transformed into S. coelicolor CH999 are indicated by their
numbers in FIG. 6, where "a" represents the embodiment where R is
methyl; "b" represents the embodiment where R is hydrogen. Some of
the expression vectors were prepared by in vitro ligation; multiple
domain substitutions were created by subsequent in vitro ligations
into the singly-substituted expression plasmids. Others were
obtained by in vivo recombination.
7TABLE 2 Plasmid Modules Domain Substitution Products (see FIG. 6)
In Vitro Ligation KOS011-28 2 eryAT1 .fwdarw. rapAT2 4-nor-TKL
(5a,b) KOS008-51 2 eryAT2 .fwdarw. rapAT2 2-nor-TKL (6a,b)
KOS014-62 2 eryKR2 .fwdarw. rapDH/ER/KR1 3-deoxy-TKL (4a,b) KAO410
3 eryKR2 .fwdarw. rapDH/ER/KR1 KAO410 (10a,b) 3-deoxy-hemiketal
(11a,b) KAO392 3 eryKR2 .fwdarw. rapKR2 3-epi-TKL (3a,b) KOS009-7 3
eryKR2 .fwdarw. rapDH/KR4 KOS009-7 (12a,b) KOS015-30 6 eryAT3
.fwdarw. rapAT2 8-nor-6dEB (18a,b) KOS016-47 6 eryAT5 .fwdarw.
rapAT2 4-nor-6dEB (19a,b) KOS026-18b 6 eryKR5 .fwdarw. rapDH/ER/KR1
5-deoxy-6dEB (26a,b) KOS016-32 6 eryKR5 .fwdarw. rapDH/KR4
4,5-dehydro-6dEB (27a,b) KOS016-28 6 eryKR5 .fwdarw. .DELTA.Rdx
5-oxo-6dEB (28a,b) KOS015-63 6 eryAT6 .fwdarw. rapAT2 2-nor-6dEB
(20a,b) KOS015-83 6 eryAT2 .fwdarw. rapAT2 +
10-nor-10,11-dehydro-6dEB (32a,b) eryKR2 .fwdarw. rapDH/KR4
KOS015-84 6 eryAT2 .fwdarw. rapAT2 + 10-nor-11-deoxy-6dEB (33a,b)
eryKR2 .fwdarw. rapDH/ER/KR1 KOS016-100 6 eryAT5 .fwdarw. rapAT2 +
4-nor-5-oxo-6dEB (38a,b) eryKR5 .fwdarw. .DELTA.rdx KOS015-106 6
eryAT6 .fwdarw. rapAT2 + 2-nor-3-epi-6dEB (42a,b) eryKR6 .fwdarw.
rapKR2 KOS015-109 6 eryAT6 .fwdarw. rapAT2 + 2-nor-3-oxo-6dEB
(31a,b) eryKR6 .fwdarw. .DELTA.rdx KOS011-90 6 eryAT2 .fwdarw.
rapAT2 + 4,5-dehydro-10-nor-6dEB (34a,b) eryKR5 .fwdarw. rapDH/KR4
KOS011-84 6 eryAT2 .fwdarw. rapAT2 + 5-oxo-10-nor-6dEB (35a,b)
eryKR5 .fwdarw. .DELTA.rdx KOS011-82 6 eryKR2 .fwdarw. rapDH/KR4 +
4-nor-10,11-dehydro-6dEB (39a,b) eryAT5 .fwdarw. rapAT2 KOS011-85 6
eryKR2 .fwdarw. rapDH/KR4 + 5-oxo-10,11-dehydro-6dEB (57a,b) eryKR5
.fwdarw. .DELTA.rdx KOS011-87 6 eryKR2 .fwdarw. rapDH/KR4 +
4-nor-5-oxo-10,11-dehydro-6dEB eryAT5 .fwdarw. rapAT2 + (65a,b)
eryKR5 .fwdarw. .DELTA.rdx KOS011-83 6 eryKR2 .fwdarw. rapDH/ER/KR1
+ 4-nor-11-deoxy-6dEB (40a,b) eryAT5 .fwdarw. rapAT2 KOS011-91 6
eryKR2 .fwdarw. rapDH/ER/KR1 + 4,5-dehydro-11-deoxy-6dEB (55a,b)
eryKR5 .fwdarw. rapDH/KR4 KOS011-86 6 eryKR2 .fwdarw. rapDH/ER/KR1
+ 5-oxo-11-deoxy-6dEB (56a,b) eryKR5 .fwdarw. .DELTA.rdx KOS011-88
6 eryKR2 .fwdarw. rapDH/ER/KR1 + 4-nor-5-oxo-11-deoxy-6dEB (69a,b)
eryAT5 .fwdarw. rapAT2 eryKR5 .fwdarw. .DELTA.rdx KOS015-40 6
eryAT2 .fwdarw. rapAT2 + 2,3-dehydro-10-nor-6dEB (76a,b) eryKR6
.fwdarw. rapDH/KR4 KOS015-41 6 eryAT2 .fwdarw. rapAT2 +
3-oxo-10-nor-6dEB (36a,b) eryKR6 .fwdarw. .DELTA.rdx
10-nor-spiroketal (79a,b) KOS015-44 6 eryKR2 .fwdarw. rapDH/ER/KR1
+ 2-nor-11-deoxy-6dEB (45a,b) eryAT6 .fwdarw. rapAT2 KOS015-45 6
eryKR2 .fwdarw. rapDH/ER/KR1 + 2,3-dehydro-11-deoxy-6dEB (75a,b)
eryKR6 .fwdarw. RapDH/KR4 KOS015-46 6 eryKR2 .fwdarw. rapDH/ER/KR1
+ 3-oxo-11-deoxy-6dEB (53a,b) eryKR6 .fwdarw. .DELTA.rdx KOS015-42
6 eryKR2 .fwdarw. rapDH/KR4 + 2-nor-10,11-dehydro-6dEB (46a,b)
eryAT6 .fwdarw. rapAT2 KOS015-43 6 eryKR2 .fwdarw. rapDH/KR4 +
3-oxo-10,11-dehydro-6dEB (54a,b) eryKR6 .fwdarw. .DELTA.rdx
KOS015-88 6 eryKR2 .fwdarw. rapDH/KR4 + 3-epi-10,11-dehydro-6dEB
(48a,b) eryKR6 .fwdarw. rapKR2 KOS015-89 6 eryKR2 .fwdarw.
rapDH/ER/KR1 + 3-epi-11-deoxy-6dEB (49a,b) eryKR6 .fwdarw. rapKR2
KOS015-87 6 eryAT2 .fwdarw. rapAT2 + 3-oxo-10-nor-6dEB (36a,b)
eryKR6 .fwdarw. rapKR2 KOS015-117 6 eryAT2 .fwdarw. rapAT14 +
2,10-bisnor-6dEB (37a,b) eryAT6 .fwdarw. rapAT2 KOS015-120 6 eryAT2
.fwdarw. rapAT14 + 2,10-bisnor-3-oxo-6dEB (58a,b) eryAT6 .fwdarw.
rapAT2 + 2,10-bisnor-spiroketal (80a,b) eryKR6 .fwdarw. .DELTA.rdx
KOS015-121 6 eryKR2 .fwdarw. rapDH/KR4 +
2-nor-3-epi-10,11-dehydro-6dEB eryAT6 .fwdarw. rapAT2 + (62a,b)
eryKR6 .fwdarw. rapKR2 KOS015-122 6 eryKR2 .fwdarw. rapDH/KR4 +
2-nor-3-oxo-10,11-dehydro-6dEB eryAT6 .fwdarw. rapAT2 + (63a,b)
eryKR6 .fwdarw. .DELTA.rdx KOS015-123 6 eryKR2 .fwdarw.
rapDH/ER/KR1 + 2-nor-3-epi-11-deoxy-6dEB (66a,b) eryAT6 .fwdarw.
rapAT2 + eryKR6 .fwdarw. rapKR2 KOS015-125 6 eryKR2 .fwdarw.
rapDH/ER/KR1 + 2-nor-3-oxo-11-deoxy-6dEB (67a,b) eryAT6 .fwdarw.
rapAT2 + eryKR6 .fwdarw. .DELTA.rdx KOS015-127 6 eryAT2 .fwdarw.
rapAT2 + 3-epi-10-nor-10,11-dehydro-6dEB eryKR2 .fwdarw. rapDH/KR4
+ (64a,b) eryKR6 .fwdarw. rapKR2 KOS015-150 6 eryAT2 .fwdarw.
rapAT2 + 2,10-bisnor-10,11-dehydro-6dEB eryKR2 .fwdarw. rapDH/KR4 +
(59a,b) eryAT6 .fwdarw. rapAT2 KOS015-158 6 eryAT2 .fwdarw. rapAT2
+ 3-oxo-10-nor-11-deoxy-6dEB (68a,b) eryKR2 .fwdarw. rapDH/ER/KR1 +
eryKR6 .fwdarw. .DELTA.rdx KOS015-159 6 eryAT2 .fwdarw. rapAT2 +
2,10-bisnor-11-deoxy-6dEB (60a,b) eryKR2 .fwdarw. rapDH/ER/KR1 +
eryAT6 .fwdarw. rapAT2 KOS016-133K 6 eryKR5 .fwdarw. rapDH/KR4 +
3-oxo-4,5-dehydro-6dEB (51a,b) eryKR6 .fwdarw. .DELTA.rdx
3,5-dioxo-6dEB (52a,b) KOS016-150B 6 eryKR5 .fwdarw. .DELTA.rdx +
3-epi-5-oxo-6dEB (50a,b) eryKR6 .fwdarw. rapKR4 KOS016-183F 6
eryAT5 .fwdarw. rapAT2 + 2,4-bisnor-6dEB (41a,b) eryAT6 .fwdarw.
rapAT2 KOS016-183G 6 eryAT5 .fwdarw. rapAT2 + 2,4-bisnor-3-epi-6dEB
(61a,b) eryAT6 .fwdarw. rapAT2 + eryKR6 .fwdarw. rapKR2 KOS016-152E
6 eryKR5 .fwdarw. rapDH/KR4 + 2-nor-4,5-dehydro-6dEB (43a,b) eryAT6
.fwdarw. rapAT2 KOS016-152F 6 eryKR5 .fwdarw. rapDH/KR4 +
2-nor-3-epi-4,5-dehydro-6dEB eryAT6 .fwdarw. rapAT2 + (70a,b)
eryKR6 .fwdarw. rapKR2 KOS016-152G 6 eryKR5 .fwdarw. rapDH/KR4 +
2-nor-3-oxo-4,5-dehydro-6dEB eryAT6 .fwdarw. rapAT2 + (71 a,b)
eryKR6 .fwdarw. .DELTA.rdx hemiketal (81a,b) KOS016-152K 6 eryKR5
.fwdarw. .DELTA.rdx + 2-nor-5-oxo-6dEB (44a,b) eryAT6 .fwdarw.
rapAT2 KOS016-1521 6 eryKR5 .fwdarw. .DELTA.rdx +
2-nor-3-epi-5-oxo-6dEB (72a,b) eryAT6 .fwdarw. rapAT2 + eryKR6
.fwdarw. rapKR2 KOS015-34 6 eryAT3 .fwdarw. rapAT2 +
2,8-bisnor-6dEB (47a,b) eryAT6 .fwdarw. rapAT2 KOS015-162 6 eryKR3
.fwdarw. rapDH/ER/KR1 + 2-nor-5-oxo-11-deoxy-6dEB (73a,b) eryKR5
.fwdarw. .DELTA.rdx + eryAT6 .fwdarw. rapAT2 In Vivo Ligation
KOS005-4 3 KR2 .fwdarw. .DELTA.Rdx 3-keto-TKL (2a,b) KOS011-62 6
AT2 .fwdarw. rapAT2 10-nor-6dEB (17a,b) KOS011-66 6 KR2 .fwdarw.
rapDH/ER/KR1 11-deoxy-6dEB (21a,b) KOS011-64 6 KR2 .fwdarw.
rapDH/KR4 10,11-dehydro-6dEB (22a,b) KOS011-19 6 DH/ER/KR4 .fwdarw.
6-epi-6dEB (23a,b) rapDH/ER/KR1 KOS011-21 6 DH/ER/KR4 .fwdarw.
6,7-dehydro-6dEB (24a,b) rapDH/KR4 KOS011-22 6 DH/ER/KR4 .fwdarw.
.DELTA.Rdx 7-oxo-6dEB (25a,b) KOS011-74 6 KR6 .fwdarw. rapKR2
3-epi-6dEB (29a,b) KOS011-25 6 KR6 .fwdarw. rapDH/KR4
2,3-dehydro-6dEB (74a,b) KOS011-13 6 KR6 .fwdarw. .DELTA.Rdx
3-oxo-6dEB (30a,b) 2-nor-3-oxo-6dEB (31a,b) spiroketal (77a,b)
2-nor-spiroketal (78a,b)
Example 7
Preparation of 14,15-dehydro-6-deoxyerythronolide B (Compound 94 of
FIG. 9)
[0192] A 3 day culture of S. coelicolor CH999/pJRJ2 grown on 3
100-mm R2YE agar plates was overlayed with a solution of 10 mg of
(2S,3R)-3-hydroxy-2-methyl-4-pentenoic acid N-acetylcysteamine
thioester dissolved in 2 mL of 9:1 water/DMSO and allowed to dry.
The culture was incubated at 30.degree. C. for an additional 4
days. The agar was chopped and extracted twice with an equal volume
of ethyl acetate. The extracts were combined and evaporated.
Purification by silica gel chromatography (1:1 ethyl
acetate/hexanes) yielded 0.75 mg of 14,15-dehydro-6-deoxyeryth-
ronolide B, compound 94 in FIG. 9, APCI-MS gives [M+H]+=385.
[0193] Analogous compounds with variations in R.sup.* and/or
R.sup.1 as represented by compounds 96-107 and compound 113 of
FIGS. 6G and 6H are prepared in a similar manner as described in
the previous paragraph but substituting the appropriate diketide as
the N-acetylcysteamine thioester. These compounds are prepared in
this manner and their structures verified.
[0194] The preparation of the appropriate derivatized diketides is
described in Example 17.
Example 8
Synthesis of
1-(2-mercaptopyrimidinyl)-2-O-methoxycarbonyl-(D)-desosamine
[0195] For the glycosylation reactions in the following examples,
the title compound was used as a reagent. The conversions of
paragraph (A) and (B) of this Example are shown in FIG. 9.
[0196] (A) Preparation of 1,2-di-O-methoxycarbonyl-(D)-desosamine:
To 1.00 g of (D)-desosamine (4.74 mmol) in 50 mL CH.sub.2Cl.sub.2
was added 3.06 g of diisopropylethylamine. The mixture was stirred
at ambient temperature for 10 min, then cooled to 4.degree. C.
Methyl chloroformate (1.34 g) was added dropwise at 4.degree. C.
The reaction mixture was allowed to warm to ambient temperature and
stirred overnight. The solvent was evaporated to dryness, ethyl
acetate (150 mL) was added to extract the product, and the
remaining solid was filtered. The ethyl acetate was removed under
vacuum and the crude product was purified on a silica gel column
(ethyl acetate:methanol:triethylamine 84:5:1 v/v/v) to give 1.29 g
of product (88% yield).
[0197] (B) Preparation of
1-(2-mercaptopyrimidinyl)-2-O-methoxycarbonyl-(D- )-desosamine: A
mixture of 1,2-di-O-methoxycarbonyl-(D)-desosamine (1.00 g, 3.436
mmol) and 0.7697 g of 2-mercaptopyrimdine (6.872 mmol) in a 25 mL
2-neck flash is dried under vacuum for 45 minutes. Dichloroethane
(10 mL), toluene (5 mL), and DMF (5 mL) were added and stirred at
ambient temperature followed by addition of 7 mL of SnCl.sub.4 (1M
in CH.sub.2Cl.sub.2). The reaction mixture was kept at 80.degree.
C. overnight. The reaction was terminated by addition of 1N NaOH
until the mixture turned basic. The solution was extracted with 300
mL of ethyl acetate and the organic layer was washed with saturated
aqueous NaHCO.sub.3 (3.times.150 mL), dried over Na.sub.2SO.sub.4,
filtered, and evaporated. The product was purified on a silica gel
column (1:1 ethyl acetate:hexanes to ethyl acetate with 1%
triethylamine) to obtain 0.25 g of
1-(2-mercaptopyrimidinyl)-2-O-methoxycarbonyl-(D)-desosamine and
0.5 g of recovered 1,2-di-O-methoxycarbonyl-(D)-desosamine.
Example 9
Preparation of
5-O-[1-.beta.-(2-O-methoxycarbonyl-(D)-desosaminyl)]-6-deox-
yerythronolide B and
5-O-(1-.beta.-(D)-desosaminyl)-deoxyerythronolide B (Compounds 86
and 87 in FIG. 8)
[0198] (A) A mixture of 6-deoxyerythronolide B (6-DEB) (15 mg, 39
mmol) and
1-(2-mercaptopyrimidinyl)-2-O-methoxycarbonyl-(D)-desosamine (65
mg, 200 mmol) was dried under vacuum, then placed under a nitrogen
atmosphere. To this was added CH.sub.2Cl.sub.2 (1 mL), toluene (0.5
mL), and powdered 4A molecular sieves (50 mg), and the mixture was
stirred for 10 minutes at ambient temperature. Silver
trifluoromethanesulfonate (64 mg, 250 mmol) was added and the
reaction was stirred until LC/MS analysis indicated completion
(18-20 hours). The mixture was filtered through anhydrous
Na.sub.2SO.sub.4 and evaporated to yield crude product. The residue
was dissolved in several drops of acetonitrile and loaded on a C-18
solid phase extraction cartridge (Whatman). Unreacted desosamine
was removed by washing with 20% CH.sub.3CN/H.sub.2O and
glycosylation products and the remaining macrolide aglycone were
recovered by eluting with 100% CH.sub.3CN. Final separation was
carried out by HPLC using a semiprep C-18 column (10 mm.times.150
mm) (CH.sub.3CN/H.sub.2O, 20% isocratic over 5 min, then 20% to 80%
over 30 min). HPLC fractions were checked by LC/MS and fractions
containing the same product were combined. The solvent was removed
under vacuum, yielding 8.4 mg of
5-O-[1-.beta.-(2-O-methoxycarbonyl-(D)-desosaminyl)]-6-deoxy-erythronolid-
e B (compound 86 in FIG. 8) (36% yield). APCI-MS gives
[M+H]+=602.
[0199] (B)
5-O-[1-(2-O-methoxycarbonyl-(D)-desosaminyl)]-6-deoxyerythronol-
ide B (1-6 mg) from paragraph (A) was dissolved in 1 mL
methanol,
[0200] 0.2 mL H.sub.2O, and 0.2 mL triethylamine and kept at
70.degree. C. for 3 hours. Removal of the solvent under vacuum gave
crude product. This was dissolved in a few drops of CH3CN and
applied to a Whatman C 18 solid phase extraction cartridge. The
column was washed with 25 mL of 20% CH3CN in water, then the
product was eluted with 100% CH3CN. Evaporation of the solvent gave
5-O-(1-.beta.-(D)-desosaminyl)-6-deoxyerythronolide B (compound 87
in FIG. 8) in quantitative yield. APCI-MS gives [M+H]+=544.
Example 10
Preparation of
5-O-[1-.beta.-(2-O-methoxycarbonyl-(D)-desosaminyl)]-8,8a-d-
eoxyoleandolide and
5-O-(1-.beta.-(D)-desosaminyl)]-8,8a-deoxyoleandolide (Compounds 88
and 89 in FIG. 8)
[0201] (A) Treatment of 8,8a-deoxyoleandolide (12 mg) as described
in Example 9(A) yielded
5-O-[1-.beta.-(2-O-methoxycarbonyl-(D)-desosaminyl)]-
-8,8a-deoxyoleandolide (60% yield) (compound 88 in FIG. 8). APCI-MS
gives [M+H]+25=508.
[0202] (B) Treatment of
5-O-[1-.beta.-(2-methoxycarbonyl-(D)-desosaminyl)]-
-8,8a-deoxyoleandolide of paragraph (A) as described in Example
9(B) gave 5-O-(1-.beta.-(D)-desosaminyl)-8,8a-deoxyoleandolide
(compound 89 in FIG. 8) in quantitative yield.
[0203] APCI-MS gives [M+H]+=530.
Example 11
Preparation of
5-O-[1-.beta.-(2-methoxycarbonyl-(D)-desosaminyl)]-3,6-dide-
oxy-3-oxoerythronolide B (Compound 83 in FIG. 8) and
5,11-bis-(O-[1-.beta.-(2-methoxycarbonyl-(D)-desosaminyl)])-3,6-dideoxy-3-
-oxoerythronolide B (Compound 92 in FIG. 8)
[0204] Treatment of 3,6-dideoxy-3-oxoerythronolide B (6 mg) as
described in Example 9(A) gave
5-O-[1-.beta.-(2-O-methoxycarbonyl-(D)-desosaminyl)]-
-3,6-dideoxy-3-oxoerythronolide B_(compound 83 in FIG. 8) in 44%
yield. APCI-MS gives [M+H]+=600. A second product,
5,11-bis-(O-[1-.beta.-(2-O-me-
thoxycarbonyl-(D)-desosaminyl)])-3,6-dideoxy-3-oxoerythronolide B
(compound 92 in FIG. 8), was also isolated from this mixture in 26%
yield; APCI-MS gives [M+H]+=815.
Example 12
Preparation of
5-O-(1-.beta.-(D)-desosaminyl)-3,6-dideoxy-3-oxoerythronoli- de B
(Compound 91 in FIG. 8) and of
5,11-bis-O-(1-.beta.-(D)-desosaminyl)--
3,6-dideoxy-3-oxoerythronolide B (Compound 93 in FIG. 8)
[0205] Treatment of
5-O-[1-.beta.-(2-methoxycarbonyl-(D)-desosaminyl)]-3,6-
-dideoxy-3-oxoerythronolide B as described in Example 9(B) gave
5-O-(1-.beta.-(D)-desosaminyl)-3,6-dideoxy-3-oxoerythronolide B of
Example 11 (compound 91 in FIG. 8) in quantitative yield. APCI-MS
gives [M+H]+=542.
[0206] Treatment of
5,11-bis-(O-[1-.beta.-(2-methoxycarbonyl-(D)-desosamin-
yl)])-3,6-dideoxy-3-oxoerythronolide B of Example 11 as described
in Example 9(B) gave
5,11-bis-O-(1-.beta.-(D)-desosaminyl)-3,6-dideoxy-3-oxo-
erythronolide B (compound 93 in FIG. 8) in quantitative yield.
APCI-MS gives [M+H]+=699.
Example 13
Preparation of
2'-O-methoxycarbonyl-(8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-
-8-methylmethymycin (Compound 83 in FIG. 8) and
3,9-bis-(O-[1-.beta.-(2-me-
thoxycarbonyl-(D)-desosaminyl)])-(8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8--
methylmethonolide (Compound 84 in FIG. 8)
[0207] Treatment of
(8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8-methylmethymy- cin (12 mg)
according to the procedure of Example 9(A) yielded
2'-O-methoxycarbonyl-(8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8-methylmethy-
mycin (compound 83 in FIG. 8) (34%); APCI-MS gave [M+H]+=544. A
second product,
3,9-bis-(O-[1-.beta.-(2-O-methoxycarbonyl-(D)-desosaminyl)])-(8R-
,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8-methylmethonolide (compound
84 in FIG. 8), was also isolated from this mixture (33%); APCI-MS
gave [M+H]+=759.
Example 14
Preparation of
(8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8-methylmethmycin (Compound
83 in FIG. 8) and of (8R,9S)-10-deoxy-8,9-dihydro-9-(1-.beta.-(-
D)-desosaminyloxy)-8-methylmethymycin (Compound 85 in FIG. 8)
[0208] Treatment of
2'-O-methoxycarbonyl-(8R,9S)-10-deoxy-8,9-dihydro-9-hy-
droxy-8-methylmethymycin of Example 13 as described in Example 9(B)
gave (8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8-methylmethymycin
(compound 83 in FIG. 8) in quantitative yield. APCI-MS gives
[M+H]+=486.
[0209] Treatment of
3,9-bis-(O-[1-.beta.-(2-methoxycarbonyl-(D)-desosaminy-
l)])-(8R,9S)-10-deoxy-8,9-dihydro-9-hydroxy-8-methylmethonolide of
Example 13 as described in Example 9(B) gave
(8R,9S)-10-deoxy-8,9-dihydro-9-hydro- xy-8-methylmethymycin
(compound 85 in FIG. 8) in quantitative yield (elution from the C
18 solid-phase extraction cartridge was with 100% methanol).
APCI-MS gives [M+H]+=643.
Example 15
Preparation of 14,15-dehydroerythromycin A (Compound 95 in FIG.
9)
[0210] A sample of 14,15-dehydro-6-deoxyerythronolide B (0.75 mg)
from Example 7 was dissolved in 0.6 mL of ethanol and diluted to 3
mL with sterile water. This solution was used to overlay a 3 day
old culture of Saccharopolyspora erythraea WHM34 (eryA) grown on a
100 mm R2YE agar plate at 30.degree. C. After drying, the plate was
incubated at 30.degree. C. for 4 days. The agar was chopped and
extracted 3 times with 100 mL portions of 1% triethylamine in ethyl
acetate. The extracts were combined and evaporated. The crude
product was purified by preparative HPLC (C18 reversed phase,
water-acetonitrile gradient containing 1% acetic acid). Fractions
were analyzed by mass spectrometry, and those containing pure
14,15-dehydroerythromycin A (compound 95 in FIG. 8) were pooled,
neutralized with triethylamine, and evaporated to a syrup. This was
dissolved in water and extracted 3 times with equal volumes of
ethyl acetate. The organic extracts were combined, washed once with
saturated aqueous NaHCO3, dried over Na2SO4, filtered, and
evaporated to yield 0.15 mg of product. APCI-MS gives
[M+H]+=733.
Example 16
Preparation of 14-oxo-8,8a-deoxyoleandolide (Compound 108) and
8,8a-deoxyoleandolide-14-carboxylic acid (compound 109) and
Derivatives Thereof
[0211] These compounds can be prepared through ozonolysis of
14,15-dehydro-6-deoxyerythonolide B (compound 94 of FIG. 9).
[0212] A solution of compound 94 in methanol is cooled to
-40.degree. C., and ozone is bubbled into the solution until
formation of I.sub.2 is observed in a KI solution attached to the
outlet of the reaction vessel. Excess ozone is purged from the
solution by sparging with nitrogen gas, providing a solution of the
ozonide of compound 94. Treatment of this solution with Me.sub.2S
will reduce the ozonide to the aldehyde, compound 108.
[0213] Alternatively, the ozonide can be oxidized by addition of
H.sub.2O.sub.2 to provide the corresponding carboxylic acid,
compound 109.
[0214] Methods for converting the aldehyde to amines via reductive
amination (e.g., using an amine and NaBH.sub.3CN under mildly
acidic conditions, or through formation of an oxime followed by
catalytic hydrogenation) are well known in the art. Similarly well
known are methods for converting the carboxylic acid into esters or
amides such as compound 110 (e.g., through activation using a
carbodiimide reagent in the presence of an alcohol or an amine).
Diamines in either procedure are used to produce dimeric macrolides
such as compounds 111 and 112. (See FIG. 6H)
Example 17
Diketide Thioester Synthesis:
(2S,3R)-3-hydroxy-2-methyl-4-pentenoic Acid N-acetylcysteamine
Thioester
[0215] All diketide thioesters were synthesized by a common
procedure. Illustrated here is the synthesis of
(2S,3R)-3-hydroxy-2-methyl-4-penteno- ic acid N-acetylcysteamine
thioester. Enantioselective syn-aldol condensations were performed
according to the procedure of D. A. Evans et al., J Am Chem Soc
(1992) 114:9434-9453. Subsequent manipulations followed the general
procedures of D. E. Cane et al., J Antibiotics (1995) 48:
647-651.
[0216] The synthesis of
[4S,3(2S,3R)]-4-benzyl-3-(3-hydroxy-2-methyl-4-pen-
tenoyl)-2-oxazolidinone by aldol condensation between
(4S)-N-propionyl-4-benzyl-2-oxazolidinone (1.17 g, 5.0 mmol) and
acrolein (0.4 mL, 11 mmol) was performed as described by D. A.
Evans et al., J Am Chem Soc (1992) 114:9434-9453, yielding 0.72 g
of the adduct (50% yield) after chromatography on SiO2(2:1
hexane/ethyl acetate).
[0217] The aldol adduct was treated with t-butyldimethylsilyl
trifluoromethanesulfonate (0.63 mL, 2.7 mmol) and 2,6-lutidine
(0.35 mL, 3 mmol) in THF at 0.degree. C., yielding the O-silyl
ether in quantitative yield after chromatography (4:1 hexane/ethyl
acetate).
[0218] A solution of the O-silyl ether in 20 mL of THF was cooled
on ice, and 2.8 mL of water was added followed by 0.61 mL of 50%
H.sub.2O.sub.2. After 10 min, a solution of 215 mg of LiOH*H.sub.2O
in 2 mL of water was added. The reaction was monitored by TLC,
which revealed completion after 1 hour. A solution of 1.25 g of
sodium sulfite in 8 mL of water was added, and volatiles were
removed by rotary evaporation under reduced pressure. The resulting
aqueous mixture was extracted three times with 20 mL portions of
CH.sub.2Cl.sub.2, then acidified to pH 2 using 6N HCl and extracted
3 times with 50 mL portions of ethyl acetate. The ethyl acetate
extracts were combined, washed with brine, dried over
Na.sub.2SO.sub.4, filtered, and evaporated to provide the product
acid as a colorless oil, 470 mg (70%).
[0219] The acid was dissolved in 10 mL of anhydrous
dimethylformamide and cooled on ice. After addition of
diphenylphosphorylazide (1.25 mL) and triethylamine (1.06 mL), the
mixture was stirred for 2 hrs on ice.
[0220] N-acetylcysteamine (1.5 mL) was added, and the mixture was
stirred overnight at room temperature. After dilution with water,
the mixture was extracted 3 times with ethyl acetate. The extracts
were combined, washed with brine, dried over Na.sub.2SO.sub.4,
filtered, and evaporated to provide the crude O-silyl thioester.
Chromatography (1:1 hexane/ethyl acetate) provided pure product
(460 mg, 70%).
[0221] The O-silyl thioester (400 mg) was dissolved in 25 mL of
acetonitrile, and 5 mL of water was added followed by 2 mL of 48%
HF. After 2 hours, an additional 2 mL of 48% HF was added. After a
total of 3.5 hours, the reaction was stopped by addition of sat.
NaHCO.sub.3 to neutral pH. The product was extracted with 3
portions of ethyl acetate, and the combined extracts were washed
with brine, dried over Na.sub.2SO.sub.4, filtered, and evaporated
to provide the desilylated thioester. Chromatography (Ethyl
acetate) gave 150 mg (56%) of pure
(2S,3R)-3-hydroxy-2-methyl-4-pentenoic acid N-acetylcysteamine
thioester, APCI-MC: [M+H]+=232. .sup.1H-NMR (CDCl.sub.3): d 5.83,
1H, ddd (J=5.6,10.8,17.5); 5.33, 1H, ddd (J=1.6,1.6,16.9); 5.22,
1H, ddd (J=1.5,1.5,10.8); 4.45, 1H, m; 3.45, 2H, m; 3.04, 2H, m;
2.82, 1H, dq (J=4.3,6.8); 1.96, 3H, s; 1.22, 3H, d (J=6.8).
[0222] Other diketide thioesters were prepared by substitution of
appropriate aldehydes in place of acrolein.
Example 18
Measurement of Antibacterial Activity
[0223] Antibacterial activity was determined using either disk
diffusion assays with Bacillus cereus as the test organism or by
measurement of minimum inhibitory concentrations (MIC) in liquid
culture against sensitive and resistant strains of Staphylococcus
pneumoniae.
* * * * *