U.S. patent application number 10/352806 was filed with the patent office on 2003-09-11 for crude biological derivatives competent for nucleic acid detection.
Invention is credited to Pasloske, Brittan L..
Application Number | 20030170617 10/352806 |
Document ID | / |
Family ID | 27663090 |
Filed Date | 2003-09-11 |
United States Patent
Application |
20030170617 |
Kind Code |
A1 |
Pasloske, Brittan L. |
September 11, 2003 |
Crude biological derivatives competent for nucleic acid
detection
Abstract
The invention relates to methods for the detection of a specific
sequence of RNA in a cell or tissue sample. The invention also
relates to methods to enzymatically manipulate the RNA in a crude
cell lysate in a number of applications.
Inventors: |
Pasloske, Brittan L.;
(Austin, TX) |
Correspondence
Address: |
Charles P. Landrum
FULBRIGHT & JAWORSKI L.L.P.
SUITE 2400
600 CONGRESS AVENUE
AUSTIN
TX
78701
US
|
Family ID: |
27663090 |
Appl. No.: |
10/352806 |
Filed: |
January 28, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60352402 |
Jan 28, 2002 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/270;
435/6.14; 435/6.16 |
Current CPC
Class: |
C12Q 1/6806 20130101;
C12N 15/1096 20130101; C12Q 2521/301 20130101; C12Q 2521/537
20130101; C12Q 2521/537 20130101; C12Q 2521/319 20130101; C12Q
2521/107 20130101; C12P 19/34 20130101; C12Q 2600/158 20130101;
C12N 15/1003 20130101; C12Q 1/6806 20130101; C12Q 1/6806
20130101 |
Class at
Publication: |
435/5 ; 435/6;
435/270 |
International
Class: |
C12Q 001/70; C12Q
001/68; C12N 001/08 |
Claims
What is claimed is:
1. A method comprising: obtaining at least one biological unit
containing RNA; obtaining at least one catabolic enzyme; preparing
an admixture of the biological unit and the catabolic enzyme; and
incubating the admixture under conditions where the catabolic
enzyme is active.
2. The method of claim 1, further comprising obtaining at least two
catabolic enzymes.
3. The method of claim 2, wherein the at least two catabolic
enzymes are a protease and a nuclease.
4. The method of claim 3, wherein the protease is Proteinase K and
the nuclease is DNase I.
5. The method of claim 1, wherein the biological unit is a
cell.
6. The method of claim 5, wherein the admixture contains a
concentration of cells from about 5 to about 50,000
cells/.mu.l.
7. The method of claim 6, wherein the concentration of cells is
about 10,000 cells/.mu.l.
8. The method of claim 5, wherein the cell is in obtained from a
cell culture.
9. The method of claim 5, wherein the cell is a prokaryotic
cell.
10. The method of claim 5, wherein the cell is a fungal cell.
11. The method of claim 5, wherein the cell is a eukaryotic
cell.
12. The method of claim 11, wherein the cell is a human cell.
13. The method of claim 5, wherein the biological unit is obtained
from a subject.
14. The method of claim 5, wherein the biological unit is obtained
from a sample of body fluid.
15. The method of claim 14, wherein the body fluid is whole blood,
plasma, serum, cerebral spinal fluid or urine.
16. The method of claim 13, wherein the biological unit is in a
tissue sample.
17. The method of claim 1, wherein the biological unit is a
virus.
18. The method of claim 1, wherein the catabolic enzyme is a
protease.
19. The method of claim 18, further defined as a method of
inactivating ribonucleases in the admixture.
20. The method of claim 18, wherein the protease is proteinase
K.
21. The method of claim 1, wherein the catabolic enzyme degrades
carbohydrates.
22. The method of claim 21, wherein the catabolic enzyme is amylase
or cellulase.
23. The method of claim 1, wherein the catabolic enzyme degrades
lipids.
24. The method of claim 23, wherein the catabolic enzyme is
lipase.
25. The method of claim 1, wherein the catabolic enzyme degrades
DNA.
26. The method of claim 1, wherein the catabolic enzyme is bovine
pancreatic DNase I.
27. The method of claim 1, further comprising adding an RNase
inhibitor to the admixture.
28. The method of claim 28, wherein the RNase inhibitor is a
non-proteinaceous RNase inhibitor
29. The method of claim 28, wherein the RNase inhibitor is ADP or a
vanadyl complex.
30. The method of claim 27, wherein in the RNase inhibitor is a
proteinaceous inhibitor.
31. The method of claim 30, wherein the proteinaceous inhibitor is
placental ribonuclease inhibitor or an anti-RNase antibody.
32. The method of claim 1, wherein preparing an admixture of the
biological unit and the catabolic enzyme is further defined as
comprising preparing an extract of the biological unit and
preparing an admixture of the extract of the biological unit and
the catabolic enzyme.
33. The method of claim 32, wherein preparing an admixture of the
extract of the biological unit and the catabolic enzyme comprises:
first preparing the extract; and then mixing the extract with the
catabolic enzyme.
34. The method of claim 32, wherein preparing an admixture of the
extract of the biological unit and the catabolic enzyme comprises:
first mixing the biological unit and the catabolic enzyme; and then
preparing the extract from the biological unit in the presence of
the catabolic enzyme.
35. The method of claim 1, further defined as a method for
producing cDNA from one or more biological units and further
comprising incubating the admixture with reverse transcriptase
under conditions to promote reverse transcription.
36. The method of claim 35, further comprising amplifying the
products of the reverse transcription.
37. The method of claim 35, further comprising incubating said
admixture with a deoxyribonuclease prior to the reverse
transcription reaction.
38. The method of claim 35, wherein the catabolic enzyme is
proteinase K and the final concentration of the proteinase K
between 0.0001 and 5 mg/ml in the admixture.
39. The method of claim 1, wherein the catabolic enzyme is
comprised in a buffer composition prior to admixing.
40. The method of claim 1, wherein the admixture is incubated at
between 0.degree. C. and 100.degree. C.
41. A method for producing cDNA from one or more biological units
comprising: obtaining at least one biological unit; obtaining at
least one catabolic enzyme; preparing an admixture of the
biological unit and the catabolic enzyme; and incubating the
admixture at a temperature where the catabolic enzyme is active and
with reverse transcriptase under conditions to allow reverse
transcription.
42. The method of claim 41, further comprising obtaining at least
two catabolic enzymes.
43. The method of claim 42, wherein the at least two catabolic
enzymes are a protease and a nuclease.
44. The method of claim 43, wherein the protease is Proteinase K
and the nuclease is DNase I.
45. The method of claim 41, wherein the reverse transcriptase is
added to the admixture after a time sufficient to allow the
catabolic enzyme to function.
46. The method of claim 41, wherein the biological unit is a
cell.
47. The method of claim 41, wherein the biological unit is a
virus.
48. The method of claim 41, wherein the catabolic enzyme is a
protease.
49. The method of claim 48, wherein the protease is proteinase
K.
50. The method of claim 41, wherein the catabolic enzyme degrades
carbohydrates.
51. The method of claim 41, wherein the catabolic enzyme degrades
lipids.
52. The method of claim 41, wherein the catabolic enzyme degrades
DNA.
53. The method of claim 41, wherein preparing an admixture of the
biological unit and the catabolic enzyme is further defined as
comprising preparing an extract of the biological unit and
preparing an admixture of the extract of the biological unit and
the catabolic enzyme.
54. The method of claim 53, wherein preparing an admixture of the
extract of the biological unit and the catabolic enzyme comprises:
first preparing the extract; and then mixing the extract with the
catabolic enzyme.
55. The method of claim 53, wherein preparing an admixture of the
extract of the biological unit and the catabolic enzyme comprises:
first mixing the biological unit and the catabolic enzyme; and then
preparing the extract from the biological unit in the presence of
the catabolic enzyme.
56. The method of claim 41, further comprising amplifying the
products of the reverse transcription.
57. The method of claim 41, further comprising incubating said
admixture with a deoxyribonuclease prior to the reverse
transcription reaction.
58. A kit for producing cDNA from a biological unit, comprising, in
a suitable container: a buffer; and a catabolic enzyme.
59. The kit of claim 58, wherein the buffer and the catabolic
enzyme are comprised in the same container.
60. The kit of claim 58, further comprising, in one or more
container(s): a reverse transcription buffer a reverse
transcriptase; and a dNTP mix.
61. The kit of claim 58, further comprising a
deoxyribonuclease.
62. The kit of claim 58, wherein said catabolic enzyme is
proteinase K.
63. The kit of claim 58, further comprising an RNase inhibitor.
64. A kit for producing cDNA from a biological unit comprising, in
one or more suitable container(s): a biological unit lysis buffer;
a deoxyribonuclease; an RNase inhibitor; a reverse transcription
buffer; reverse transcriptase; dNTPs; and an Armored RNA.RTM.
control.
65. The kit of claim 64, further comprising a protease
inhibitor.
66. The kit of claim 65, wherein the protease inhibitor is
PMSF.
67. The kit of claim 64, further comprising a thermostable DNA
polymerase.
68. A Cell Lysis Buffer comprising a catabolic enzyme, 1 mM
CaCl.sub.2, 3 mM MgCl.sub.2, 1 mM EDTA, 1% Triton X100, and 10 mM
Tris pH 7.5.
69. The Cell Lysis Buffer of claim 68, wherein the catabolic enzyme
is Proteinase K.
70. The Cell Lysis Buffer of claim 69, wherein Proteinase K is at a
concentration of about 0.2 mg/ml.
Description
[0001] The present application claims priority to provisional U.S.
patent application Ser. No. 60/352,402 filed Jan. 28, 2002. The
entire text of the above referenced application is incorporated
herein by reference and without disclaimer.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the field of RNA
analysis, more specifically it teaches a more direct method for the
detection of a specific sequence of RNA in a biological unit, for
example a virus, cell or tissue sample. More generally, the
invention may be used to enzymatically manipulate and protect the
RNA in a crude cell lysate for a number of applications.
[0004] 2. Description of Related Art
[0005] Reverse transcription followed by the polymerase chain
reaction (RT-PCR) is one of the main methods used for measuring
mRNA levels from a small number of cells. As well, reverse
transcription is the first step in several strategies towards
amplifying a small quantity of total or poly (A) RNA (U.S. Pat. No.
5,554,516; U.S. Pat. No. 5,891,636; Phillips, 1996). The amplified
RNA can be used to probe arrays for monitoring the expression of
multiple genes (Lockhart, 1996; U.S. Pat. No. 6,316,608). Prior to
performing any of these methods, the substrate RNA is isolated from
a biological sample, in most cases. Current procedures for RNA
isolation involve numerous steps and are not very amenable to high
throughout analysis.
[0006] In general, the techniques used for RNA isolation involve
phenol-chloroform extraction (Mesink, 1998) or guanidinium lysis
followed by adsorbing the RNA to a glass fiber filter (Su, 1997).
By streamlining the RNA isolation step, the analysis of a large
number of samples involving reverse transcription or some other
enzymatic manipulation becomes much faster, simpler, and less
expensive. Klebe et al. (1996) developed a strategy of creating a
crude cell lysate by freeze-thawing cells at a concentration of 10
cells/.mu.l in the presence of placental RNase inhibitor. The crude
lysate, containing no more than 250 cells, was then used for
reverse transcription to produce cDNA. This technology serves as
the basis for the "cDNA Direct from Cells" kit sold by PCG (Cat.
#62-613100). As pointed out by Klebe (1996), this method is limited
in that the RNase inhibitor is only specific for RNase A. There are
many other types of RNases in a cell that may contribute to RNA
degradation and would not be inhibited by a single specific RNase
inhibitor. Another problem is that some types of cells have a much
higher concentration of RNase activity thereby making it more
difficult to maintain the intactness of the RNA in a crude lysate
(O'Leary, 1999). A similar protocol was used by Yan. (2002) to
detect an mRNA from one cell by RT-PCR. However, it differed in
that it also included a DNase treatment to remove genomic DNA and
only 1 to 3 cells were used in the reactions.
[0007] Busche (2000) used a procedure similar to Klebe (1996) to
reverse transcribe RNA from a few cells. Ten myocyte section
profiles from various samples were selected by laser-assisted
picking, transferred into 10 .mu.l of first strand buffer
containing 4% ribonuclease inhibitor, cooled on ice for 5 minutes
and snap frozen. The samples were incubated 70.degree. C. for 10
minutes and cooled on ice for 5 minutes. Reverse transcription was
performed in a total of 17.5 .mu.l using 5 .mu.l of the sample and
an MMLV-RT, and incubated 20.degree. C. for 10 minutes followed by
43.degree. C. for 60 minutes. The cDNA was subsequently used for
PCR.
[0008] Brady (1993) generated cDNA from a few cells for creating
cDNA banks using lysed cells. One to 40 cells in less than 0.5
.mu.l volume are added to 4 .mu.l of first-strand buffer and stored
on ice for less than one hour before reverse transcription. The
first strand buffer contains 0.5% Nonidet P-40 (NP-40) to lyse the
cellular membrane and an RNase inhibitor to protect the RNA from
degradation. The NP-40 does not lyse the nuclear membrane and
therefore, the nucleus can be pelted by centrifugation (e.g.,
centrifugation at 12,000.times.g, 4.degree. C., for 50 seconds), to
deplete the cell lysate of genomic DNA if desired. The cytoplasmic
RNA is used for reverse transcription. The cell lysate in the first
strand buffer is incubated at 65.degree. C. for 1 minute to unfold
the mRNA. The reaction is cooled to room temperature for 3 minutes
to anneal the oligo (dT) primer. One .mu.l of a 1:1 mix of MMLV-RT
and AMV-RT is added to the reaction and incubated 15 minutes at
37.degree. C. The reaction was stopped by heating to 65.degree. C.
for 10 minutes. This procedure does not involve any protease
treatment, any DNase treatment and is only recommended for no more
than 40 cells.
[0009] A kit called ExpressDirect.TM. (Pierce Chemical Company,
Cat. #20146), isolates poly(A) RNA directly from a cell lysate. The
wells of a 96-well plate have oligo dT immobilized to them. Cells
are lysed in the wells and the poly(A) RNA hybridizes to the oligo
dT. After hybridization, the cell lysates are removed and the wells
washed to remove cell debris. The poly(A) RNA may then be eluted
from the well and then reverse transcribed. Alternatively, the
poly(A) RNA could be reverse transcribed directly in the 96-well
plate. The immobilized oligo dT serves as the primer.
[0010] Protocols exist for the detection of bacterial DNA sequences
from tissue culture in order to assay for Mycoplasma contamination
(U.S. Pat. No. 5,693,467; and Tang, 2000). This procedure involves
incubating the cells from tissue culture with proteinase K.
However, there is no mention of using this procedure to synthesize
cDNA. In the Mycoplasma Detection kit from the American Type
Culture Collection (Cat. #90-1001K) cells to be tested for
Mycoplasma from tissue culture can be subjected directly to PCR if
the Mycoplasma contamination is suspected to be severe. However, to
achieve maximum sensitivity the cells are incubated in a lysis
buffer (1.times. PCR buffer, 0.5% NP-40, 0.5% Tween 20) with
proteinase K (18 .mu.g/ml) at 60.degree. C. for one hour. The
lysate is then incubated at 95.degree. C. for 10 minutes to
inactivate the proteinase K. The manual states that the DNA extract
may be used directly as the template for PCR without further
purification. However, it cautions that the completion of the
secondary DNA extraction procedure facilitates removal of all
possible PCR inhibitors. The secondary extraction protocol involves
adding 500 .mu.l water, mixing well, adding 600 .mu.l isopropanol
and 1 .mu.l glycogen (20 mg/ml), mixing well, incubating at
-20.degree. C. for at least 30 minutes, centrifuging to pellet the
DNA and then removing the supernatant. The DNA pellet is washed
with 75% ethanol, centrifuged again and the supernatant removed. No
mention is made in that this procedure can be used to prepare RNA
for reverse transcription.
[0011] Fink (2000a; 2000b) used a proteinase K treatment to
increase the efficiency of RT-PCR from cells isolated by
laser-assisted cell picking. Between 15 and 20 frozen or fixed
cells were selected by laser-assisted cell picking, harvested by a
syringe needle, added to 10 .mu.l of first-strand-buffer and frozen
in liquid nitrogen. After thawing the cells, proteinase K was added
to the sample to 100 .mu.g/ml, the sample was incubated at
53.degree. C. for 30 minutes and then heated at 99.degree. C. for 7
minutes to denature the proteinase K and RNA. Reverse transcription
was performed directly on the sample using murine maloney leukemia
virus--reverse transcriptase (MMLV-RT), at 20.degree. C. for 10
minutes and 43.degree. C. for 60 minutes. The cDNA from this
reaction was used for PCR. In both of these publications, the fixed
cells were frozen before the proteinase K treatment, the
concentration of cells was no more than 2 cells/.mu.l and no DNase
treatment was used to remove genomic DNA.
[0012] Cells to cDNA.TM. (Ambion, Inc., #1712 & 1713; U.S.
patent applications Ser. Nos. 09/160,284 and 09/815,577, the entire
disclosures of which are incorporated herein by reference) is a kit
where there is no RNA isolation step. A crude cell lysate is
prepared containing total RNA. Cells from tissue culture are washed
once in PBS and then resuspended in Cell Lysis Buffer. The cells
are incubated at 75.degree. C. for 5 minutes, having two important
effects. First, the cell membranes are lysed, thereby releasing the
RNA into the Cell Lysis Buffer. As well, the heating step
inactivates the endogenous RNases, thus protecting the RNA from
degradation. A key component in the Cell Lysis Buffer is a reducing
agent such as dithiothreitol (DTT). It was discovered that RNases
can be inactivated by heating them in the presence of reducing
agents (U.S. patent applications Ser. Nos. 09/160,284 and
09/815,577). Following cell lysis, the crude cell lysate is
incubated with DNase I to degrade the genomic DNA. After the DNase
I is inactivated by a heating step, the cell lysate is ready for
reverse transcription and then PCR. The Cells-to-cDNA.TM. kit
(Ambion, Inc. Cat. #1712 & 1713) is adapted for use with
samples having low cell concentrations. If higher cell
concentrations are used, then RNA quantification can cease to be
linear and in some cases, the signal can be completely inhibited.
It appears that the reverse transcriptase can be inhibited by the
higher cell concentrations. In general, the maximum optimal cell
concentration the Cells-to-cDNA.TM. kits is 100 to 200 cells per
.mu.l in the Cell Lysis Buffer.
[0013] A procedure that enables the direct use of a cell lysate at
a higher cell concentration would have many more applications and
provide a greater dynamic range for quantification, thereby
complimenting the technology in Cells-to-cDNA. Also, because of the
issue of higher cell concentrations, Cells-to-cDNA is most useful
in the context of cells from tissue culture. As well, methods that
are more useful in the direct use of a tissue in a reverse
transcription reaction would decrease the time and the amount of
handling required to prepare a sample for reverse transcription or
other enzymatic applications.
SUMMARY OF THE INVENTION
[0014] The above-described deficiencies in the art are overcome by
the present invention.
[0015] Broadly, the present invention relates to methods
comprising: obtaining at least one biological unit containing RNA;
obtaining at least one catabolic enzyme; preparing an admixture of
the biological unit and the catabolic enzyme; and incubating the
admixture under conditions where the catabolic enzyme is
active.
[0016] The term "biological unit" is defined to mean any cell or
virus that contains genetic material. In most aspects of the
invention, the genetic material of the biological unit will include
RNA. In some embodiments, the biological unit is a prokaryotic or
eukaryotic cell, for example a bacterial, fungal, plant, protist,
animal, invertebrate, vertebrate, mammalian, rodent, mouse, rat,
hamster, primate, or human cell. Such cells may be obtained from
any source possible, as will be understood by those of skill in the
art. For example, a prokaryotic or eukaryotic cell culture. The
biological unit may also be obtained from a sample from a subject
or the environment. The subject may be an animal, including a
human. The biological unit may also be from a tissue sample or body
fluid, e.g., whole blood, plasma, serum, urine or cerebral spinal
fluid.
[0017] The catabolic enzyme can be any catabolic enzyme known to
those of skill in the art as of the filing of this specification or
at anytime thereafter. In some preferred embodiments, the catabolic
enzyme is a protease, for example, proteinase K. In other
embodiments, the catabolic enzyme degrades carbohydrates, for
example, amylase or cellulase. In some embodiments, the catabolic
enzyme degrades lipids, such as lipase. In other embodiments the
catabolic enzyme degrades DNA, such as, for example, bovine
pancreatic DNase I. Of course, the various embodiments of the
invention may comprise the use of one, two, three, four, five, six,
seven, or more different catabolic enzymes, in order to achieve the
desired goals of a given method. In some embodiments, any enzymes
that digest DNA, lipids, fats, carbohydrates, connective tissue or
any other molecules, proteins, or biological compounds that inhibit
enzymatic reactions, specifically reverse transcription or PCR are
contemplated. In certain embodiments, a catabolic enzyme may or may
not be included in the Cell Lysis Buffer and in some case may be
introduced before, after or simultaneously with the Cell Lysis
Buffer. For example, it is entirely possible, in RT-PCR embodiments
of the invention, to use both proteinase K to destroy RNase in a
cellular extract in combination with one or more other catabolic
enzymes to degrade other portions of the cellular extract to the
benefit of the reaction. Of course, in such cases, it may be
necessary to balance the concentrations and/or timing of the
addition of the various catabolic enzymes, in order to prevent, for
example, the degradation of a cellulase by a proteinase. However,
such balancing will be well within the skill of one of skill in the
art, in view of this specification. Proteases that may be used in
the methods of the invention include, but are not limited to,
Serine proteases that include but are not limited to Trypsin,
Chymotrypsin, Elastase, Subtilisin, Streptogrisin, Thermitase,
Aqualysin, and carboxypeptidase A, D, C, or Y; cysteine proteases
that include but are not limited to Papain and Clostripain; acid
proteases that include but are not limited to Pepsin, Chymosin, and
Cathepsin; metalloproteases that include but are not limited to
Pronase, Thermolysin, Collagenase, Dispase; and various
aminopeptidases and Carboxypeptidase A, B, E/H, M, T, or U. In some
embodiments of the invention, these proteases could be used in
place of proteinase K. It is possible that a mixture of proteases
could be used instead of a single protease to generate a cell
lysate compatible with reverse transcription and PCR.
[0018] In certain embodiments, a protease and a DNase enzyme may be
administered simultaneously or in the same reactions. This
simultaneous treatment using proteases and DNase enzymes is an
unexpected and novel finding, as described below. In some
embodiments, 1, 2, 3, 4, 5, 6, 7, or more catabolic enzymes may be
included in a protease/DNase composition or reaction. For example,
multiple proteases or co-proteases may be included with lipases,
collagenases, nucleases, and virtually any other enzyme that may be
used to remove inhibitors of a reaction, e.g., polymerization
reactions.
[0019] In some aspects of the invention, preparing an admixture of
the biological unit and the catabolic enzyme is further defined as
comprising preparing an extract of the biological unit and
preparing an admixture of the extract of the biological unit and
the catabolic enzyme. Further, preparing an admixture of the
extract of the biological unit and the catabolic enzyme may
comprise: first preparing the extract; and then mixing the extract
with the catabolic enzyme. Alternatively, preparing an admixture of
the extract of the biological unit and the catabolic enzyme could
comprise: first mixing the biological unit and the catabolic
enzyme; and then preparing the extract from the biological unit in
the presence of the catabolic enzyme.
[0020] In some preferred embodiments, the invention relates to
methods for producing cDNA from one or more biological units,
possibly different types of biological units. In some embodiments,
any enzyme that can utilize a nucleic acid or in particular RNA as
template or substrate is contemplated. In certain embodiments, an
admixture may be incubated with a nucleic acid polymerase. In some
embodiments, the nucleic acid polymerase is a ribonucleotide
polymerase, e.g., bacterial or viral RNA polymerase. Preferred
embodiments may further comprise incubating the admixture with
reverse transcriptase under conditions to allow reverse
transcription. Typically, the methods will further comprise
amplifying the products of the reverse transcription, and these
methods may further comprise incubating said admixture with a
deoxyribonuclease prior to the reverse transcription reaction. In
some preferred embodiments the catabolic enzyme is a protease that
is capable of inactivating ribonucleases in the admixture. For
example, the protease may be proteinase K.
[0021] These embodiments have certain benefits in the context of
RT-PCR, with regard to the issues described above. In such methods,
a freezing step is not required. Further, the admixture may contain
1, 5, 10, 100, 200, 300, 400,. 500, 1,000, 2,000, 3,000, 4,000,
5,000, 10,000, or 15,000 or more cells/.mu.l, as well as any
concentration of cells between any two of these concentrations.
Note that these concentration are for typical eukaryotic cells.
Since prokaryotic cells are typically a thousand times smaller
these concentration may be adjusted accordingly. Typically, it is
the reverse transcriptase enzyme that is inhibited by the higher
cell concentrations of cell lysate. In certain embodiments, the
upper limit of cell concentration may be increased by either using
other catabolic enzymes or other methods or compositions to destroy
the inhibitors of the RT or by using RTs that are less inhibited by
the lysates. In addition, DNase I treatment can be included
although this is not necessary in all embodiments, for example, if
the PCR primers are designed properly and the gene structure is
amenable. In view of these improvements, the methods of the
invention are well-suited to the analysis of a large number of
differentially treated samples grown in tissue culture. For
example, the regulation of an mRNA may be followed as cells are
treated with increasing concentrations of a particular chemical
(Sumida, 1999). Alternatively, cells may be treated with a panel of
different drugs to screen for candidates that have the desired
effect on a particular mRNA or a time course may be followed (Su,
1997).
[0022] Some embodiments of the invention further comprise adding an
RNase inhibitor to the admixture, in addition to any proteinase
that inhibits or degrades RNase. For example, the RNase inhibitor
is a non-proteinaceous RNase inhibitor, such as ADP or a vanadyl
complex. Proteinaceous inhibitors could also be used such as
placental ribonuclease inhibitor or antibodies that inactivate
specific ribonucleases.
[0023] In some embodiments, the final concentration of the
catabolic enzyme added is between about 0.00001, 0.0001, 0.001,
0.01, 0.1, 1, 2, 3, 4, 5, 10, 15, 20, or 25 mg/ml, as well as any
concentration between any two of these concentrations. In some
embodiments, the final concentration of the catabolic enzyme added
is between about 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 2, 3, 4, 5,
10, 15, 20, or 25 mg/ml, as well as any concentration between any
two of these concentrations in the admixture, more preferably,
between 0.001 and 2 mg/ml, and even more preferably, between 0.025
and 1 mg/ml.
[0024] Typically, the catabolic enzyme is comprised in a buffer
composition prior to admixing.
[0025] In some preferred embodiments, the admixture is incubated at
between 0.degree. C. and 75.degree. C. However, this temperature
may vary during the course of the procedure. In certain
embodiments, the admixture may be incubated at between 0.degree. C.
and 100.degree. C. Further, it is entirely possible to raise the
temperature to a point where the catabolic enzyme is ultimately
inactivated. For example, proteinase K tends to be inactivated at
around 75.degree. C. The inventors frequently place proteinase K
containing reactions in a water bath at 75.degree. C., knowing that
when the reaction reaches this temperature, the enzyme activity
will be destroyed, but that the benefit of the enzyme in destroying
RNase will be achieved by that point.
[0026] In preferred embodiments, the invention is related to
methods for producing cDNA from one or more biological units
comprising: obtaining at least one biological unit; obtaining at
least one catabolic enzyme; preparing an admixture of the
biological unit and the catabolic enzyme; incubating the admixture
at a temperature where the catabolic enzyme is active; and
incubating with reverse transcriptase under conditions to allow
reverse transcription. The components of this reaction can be any
of the components described above.
[0027] Other embodiments of the invention relate to kits for
producing cDNA from a biological unit, comprising, in a suitable
container: a buffer; and a catabolic enzyme. In some such kits, the
buffer and the catabolic enzyme are comprised in the same
container. The kits may further comprise a reverse transcription
buffer, a reverse transcriptase, and dNTP mix. The kits may
additionally contain a deoxyribonuclease. In some preferred
embodiments, the catabolic enzyme is proteinase K. The kits may
further comprise an RNase inhibitor.
[0028] In some preferred embodiments, the kits for producing cDNA
from a biological unit comprises, in one or more suitable
container(s): a biological unit lysis buffer; a deoxyribonuclease;
an RNase inhibitor; a reverse transcription buffer; reverse
transcriptase; dNTPs; and an Armored RNA.RTM. control. "Armored
RNA" is a an Ambion trademark for ribonuclease resistant RNA
particles produced according to the methods disclosed in U.S. Pat.
Nos. 6,399,307; 6,214.982; 5,939,262; 5,919,625; and 5,677124, the
entire contents of which are incorporated herein by reference.
These kits may further comprise a protease inhibitor, such as
phenylmethylsulfonyl fluoride (PMSF), and/or a thermostable DNA
polymerase.
[0029] Kits suitable for the practice of the methods described
herein are sold by Ambion under the trademark Cells-to-cDNA
II.TM..
[0030] In other aspects of the invention, a Cell Lysis Buffer
comprising a catabolic enzyme, 1 mM CaCl.sub.2, 3 mM MgCl.sub.2, 1
mM EDTA, 1% Triton X100, and 10 mM Tris pH 7.5 is contemplated. In
certain embodiments, the catabolic enzyme is Proteinase K. In some
embodiments, Proteinase K may is present at a concentration of
about 0.2 mg/ml.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0032] FIG. 1. Illustrates an example of measuring the levels of
GAPDH mRNA and the enterovirus Armored RNA.RTM. by real-time RT-PCR
in the ABI 7700 in different concentrations of HeLa cells. The
cells were processed using the methods of the invention.
[0033] FIG. 2. Illustrates an example of measuring the levels of
GAPDH mRNA by real-time RT-PCR in the ABI 7700 in different
concentrations of HeLa cells that were unfixed or fixed with 1%
formalin for 1 hour. The cells were processed using the methods of
the invention.
[0034] FIG. 3. Illustrates an example of measuring the levels of
18S rRNA and tPA mRNA in HeLa cells that were incubated with
different concentrations of PMA by one-step, real-time RT-PCR in
the ABI 7700. The cells were processed in 96-well plates using the
methods of the invention.
[0035] FIG. 4. Illustrates an example of analyzing Gene Silencing
by siRNA using Cells-to-cDNA II.TM. Automated Protocol. HeLa cells
were transfected with gene specific siRNAs against CDC-2, c-jun,
survivin, and GAPDH or a negative control (NC1). After 48 hours,
cells were processed according to the Cells-to-cDNA II.TM.
automated protocol, and analyzed by real-time one-step RT-PCR for
the indicated genes and normalized to 18S rRNA.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0036] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
EXAMPLE I
[0037] A Basic Procedure for Cells Derived from Tissue Culture
[0038] HeLa cells are used as an exemplary cell type of cells that
are suitable for treatment using the compositions and methods
described herein. However, the invention is in no way limited to
the exemplary cell type. It is expected that the compositions and
methods apply to all cell types. One of ordinary skill would, in
light of the disclosure, expect all other cells types to be
amenable to the methods of the present invention.
[0039] To demonstrate the basic methods for cells derived from
tissue culture, HeLa cells were grown in Dulbecco's Modified Eagle
Medium with 10% fetal bovine serum in a tissue culture flask to 50
to 75% confluency. The medium was removed and then the cells were
incubated with trypsin (0.05% trypsin, 0.53 mM EDTA) for 10 minutes
at 37.degree. C. Trypsin was inactivated by re-suspending the cells
in medium with 10% fetal bovine serum. Cell concentration was
determined with a hemacytometer and then the volume, calculated to
contain 6 million cells, was centrifuged at 3,000 rpm for 5
minutes. The medium was removed and the cells were washed once with
1 ml of cold phosphate buffered saline (PBS). The cells were
resuspended in 30 .mu.l of PBS and dilutions were made in PBS using
the stock solution of 200,000; 100,000; 50,000; 25,000; 10,000;
2,000; 400; 80; and 20 cells/.mu.l. Five .mu.l of each dilution
were added to 95 .mu.l of Cell Lysis Buffer [0.2 mg/ml proteinase K
(Ambion, Inc., #2546), 1 mM CaCl.sub.2, 3 mM MgCl.sub.2, 1 mM EDTA,
1% Triton X100, 10 mM Tris pH 7.5] such that the final cell
concentrations were 10,000; 5,000; 2,500; 1,250; 500; 100; 20; 4
and 1 cells/.mu.l. Two .mu.l of the enterovirus Armored RNA.RTM.
control (Ambion RNA Diagnostics, #42050; Pasloske, 1998) may be
included in the Cell Lysis Buffer as a positive control to a final
concentration of .about.40,000 copies/.mu.l. The EV Armored
RNA.RTM. Primer and probe sequences were as follows: Forward
5'-GATTGTCACCATAAGCAGC-3' (SEQ ID NO. 1); Reverse
5'-CCCCTGAATGCGGCTAATC-- 3' (SEQ ID NO. 2); TaqMan Probe:
5'-(FAM)-CGGAACCGACTACTTTGGGTGTCCGT-(TAMR- A)-3' (SEQ ID NO. 3).
The samples were incubated at 75.degree. C. for 10 minutes and then
cooled to 37.degree. C. DNase I (Ambion, Inc., #2222) was added to
the cell lysate to a concentration of 0.02 to 0.04 U/.mu.l,
incubated at 37.degree. C. for 15 to 30 minutes and then incubated
at 75.degree. C. for 5 minutes to inactivate the DNase I. The cell
lysate is now compatible for reverse transcription and PCR.
[0040] Reverse Transcription Followed by PCR
[0041] Five .mu.l of the cell lysate from above was added to 2
.mu.l of random primers, 4 .mu.l dNTP mix (2.5 mM each) and 5 .mu.l
of RNase-free water (Ambion, Inc., #9932). The mixture was
incubated at 75.degree. C. for 3 minutes and cooled to room
temperature. Two .mu.l 10.times. RT buffer (500 mM Tris pH 8.3, 750
mM KCl, 30 mM MgCl.sub.2, 50 mM DTT), 1 .mu.l (10 U/.mu.l) of
placental RNase Inhibitor (#2687, Ambion, Inc.), and 1 .mu.l of
MMLV-RT (25 U/.mu.l) were added and the reaction was incubated at
42.degree. C. from 15 minutes to 60 minutes to synthesize cDNA.
Negative control reactions were included that do not include
MMLV-RT to assess the level of genomic DNA contamination. Reactions
that do not include MMLV-RT should not generate any detectable
signal during PCR. The reverse transcription reaction was incubated
at 92.degree. C. for 10 minutes to inactivate the MMLV-RT.
[0042] For PCR, 5 .mu.l of the cDNA were combined with 1 unit of
SuperTaq Polymerase (Ambion, Inc.), 2.5 .mu.l 10.times. PCR buffer
(100 mM Tris-Cl pH 8.3, 500 mM KCl, 8% glycerol, 0.1% Tween 20), 2
.mu.l dNTP mix (2.5 mM each), 3 .mu.l 25 mM MgCl.sub.2, 1 .mu.l of
the primer pair (10 .mu.M mixture of the forward and reverse
primers) and 1 .mu.l of the TaqMan.RTM. probe (2 .mu.M), 0.5 .mu.l
50.times. ROX Standard, 8.8 .mu.l RNase-free water (Ambion, Inc.).
Human GAPDH Primer and probe sequences were employed as follows:
Forward: 5'-GAAGGTGAAGGTCGGAGT-3' (SEQ ID NO. 4); Reverse:
5'-GAAGATGGTGATGGGATTTC-3' (SEQ ID NO. 5); TaqMan Probe:
5'-(FAM)-CAAGCTTCCCGTTCTCAGCC-(TAMRA)-3' (SEQ ID NO. 6). The
reactions were placed in an ABI 7700 Prism thermocycler and ran
using following profile: 94.degree. C., 2 minutes; [94.degree. C.,
20 seconds; 60.degree. C., 20 seconds].times.40 cycles.
[0043] GAPDH was detectable in all samples that included HeLa
cells. A plot of the threshold cycle (Ct value) against cell
concentration was linear up to 2,500 cells/.mu.l. GAPDH signal was
readily detected at cell concentrations greater than 2,500
cells/.mu.l but a slight inhibition of the reactions was observed.
FIG. 1. In addition, the Ct value for the enterovirus Armored
RNA.RTM. was unchanged in all of the cell concentrations up to
2,500 cells/.mu.l indicating that there was no inhibition of the
reverse transcriptase or PCR up to 2,500 cells/.mu.l, which was in
agreement with the GAPDH data. FIG. 1.
[0044] The cDNA synthesis reactions that did not include MMLV-RT
(MMLV-RT minus control) did not generate any signal in the
amplification reaction, demonstrating that genomic DNA was degraded
to undetectable levels and that signals produced by RT-PCR were
attributable solely to the amplification of the cDNA.
EXAMPLE II
[0045] The Invention Functions with Multiple Cell Lines
[0046] In order to show the applicability of the invention across
cell types HeLa S3, MCF-7, COS-7, CHO-K1, and J558 cells were grown
to 50-75% confluency in appropriate growth media. The cells were
harvested by trypsin, re-suspended in growth medium and counted
with a hemacytometer. Two million of each cell type were collected
and the cells were pelleted by centrifugation (3,000 rpm for 5
minutes). The cells were washed with 1.times. PBS (Ambion, Inc.)
and pelleted again by centrifugation (3,000 rpm for 5 minutes). The
cells were resuspended in 40 .mu.l 1.times. PBS and four 1:5
dilutions were made in PBS. Five .mu.l of each cell suspension was
added to 95 .mu.l Cell Lysis Buffer for final cell concentrations
of 2,500; 500; 100; 20; and 4 cells/.mu.l in the Cell Lysis Buffer.
The cells were lysed, DNase I treated, and reverse transcribed
followed by PCR as in EXAMPLE I.
[0047] In each cell line, .beta.-actin mRNA was detected by
real-time PCR at each cell concentration. .beta.-actin primer and
probe sequences were employed as follows:
1 Forward: (SEQ ID NO. 7) 5'-TCACCCACACTGTGCCCATCT- AGGA-3';
Reverse: (SEQ ID NO. 8) 5'-CAGCGGAACCGCTCATTGCCAATGG-3'; TaqMan
Probe: (SEQ ID NO. 9)
5'-(FAM)-ATGCCC-X(TAMRA)-CCCCCATGCCATCCTGCGTp-3'
[0048] where X indicates a linker-arm nucleotide, and p indicates
phosphorylation. The cDNA synthesis reactions that did not include
MMLV-RT (MMLV-RT minus control) did not generate any signal in the
amplification reaction proving that the genomic DNA was degraded to
undetectable levels and that signals produced by RT-PCR were
attributable solely to the amplification of the cDNA in each cell
line.
EXAMPLE III
[0049] Use of Methods on Fixed Cells from Tissue Culture
[0050] To demonstrate the methods of the invention on fixed cells
from tissue culture, HeLa S3 cells were grown to 75% confluency in
Dulbecco's Modified Eagle Medium with 10% fetal bovine serum. The
cells were harvested as described in EXAMPLE I. Approximately 6
million cells were collected and pelted (3,000 rpm for 5 minutes).
The cells were re-suspended in 0.5 ml of 1.times. PBS. A volume of
0.5 ml of a solution containing 2% formalin in PBS was added to
make a final concentration of 1% formalin. The cells were vortexed
and placed at 4.degree. C. for 1 hour. Subsequently, the cells were
formalin fixed.
[0051] The cells were pelleted to remove the formalin. The cells
were resuspended in PBS and washed again to remove trace amounts of
formalin. The cells were re-suspended in 120 .mu.l PBS and four 1:5
dilutions were made. Five .mu.l of each cell suspension was added
to 95 .mu.l cells lysis buffer for a final cell concentration of
2,500; 500; 100; 20 and 4 cells/.mu.l. The same procedure was
performed for cells that were not formalin fixed. The cells were
lysed, DNase I treated, reverse transcribed and followed by PCR as
in EXAMPLE I.
[0052] GAPDH was detected in both the fixed and unfixed cells. A
plot of the threshold cycle (Ct value) against cell concentration
was linear up to 2,500 cells/.mu.l for both the fixed and unfixed
cells FIG. 2. The Ct values for both sets were nearly identical for
both sets.
[0053] The cDNA synthesis reactions that did not include MMLV-RT
(MMLV-RT minus control) did not generate any signal in the
amplification reaction proving that the genomic DNA was degraded to
undetectable levels and that signals produced by RT-PCR were
attributable solely to the amplification of the cDNA.
[0054] The effect of fixing the cells up to 24 hours with a
formalin concentration as high as 4% was tested. There was about a
1 Ct value shift between the fixed cells and the cells that were
not fixed. This was most likely due to loss of cells from washing
the cells twice more with 1.times. PBS to remove the formalin.
[0055] Those of skill would, based on this study, expect that this
same procedure to function equally well with other types of common
fixatives such as glutaraldehyde, acetic acid/ethanol (3:1),
Carnoy's fixative, Bouin's fixative, and Osmium tetroxide
fixative.
EXAMPLE IV
[0056] Use of Methods on Fixed Cells Selected by Laser Capture
Microdissection
[0057] To demonstrate the methods of the invention on fixed cells
selected by laser capture microdissection, frozen sections of mouse
kidney embedded with OCT media (Tissue-Tek), were fixed and stained
with Hematoxylin-Eosin. Sections of 5 to 10 .mu.m were produced
with a cryostat. Areas of 0.04, 0.25, 0.6 and 1.0 mm.sup.2 of
tissue were captured by laser capture microdissection using an
Arcturus PixCell II.TM. system, each on a different cap. The thin
layer of plastic containing the tissue samples was removed and
placed into an 0.5 ml centrifuge tube containing 100 .mu.l Cell
Lysis Buffer and 2 .mu.l of the Armored RNA.RTM. control. The tubes
were incubated at 75.degree. C. for 10 minutes. The lysates were
then subjected to DNase I treatment, reverse transcription, and PCR
as described in EXAMPLE I. Primers and probes to detect a
cyclophilin sequence as well as the Armored RNA.RTM. control were
used in the PCR. Cyclophilin Primer and Probe sequences that may be
employed were as follows:
2 Forward: (SEQ ID NO. 10) 5'-CCATCGTGTCATCAAGGACTTCAT-3'; Reverse:
(SEQ ID NO. 11) 5'-CTT GCC ATC CAG CCA GGA GGT CTT-3'; TaqMan
Probe: (SEQ ID NO. 12) 5'-(FAM)TGGCACAGGAGGAAA-
GAGCATCTATG-(TAMRA)-3'.
[0058] A Cyclophilin signal was detected in all samples. The
Armored RNA.RTM. control ran alongside the cyclophilin reactions
indicated that there was no inhibition from the tissue samples.
EXAMPLE V
[0059] Multi-Well Format for Gene Expression Analysis
[0060] To demonstrate the methods of the invention in a multi-well
format for gene expression analysis, cells were grown overnight in
0.2 ml DME media with 10% FBS with equal number of cells in each
well in a 96 well culture plate (Falcon). The media was removed and
the wells were washed with 0.2 ml 1.times. PBS, and the PBS was
removed. One hundred .mu.l of Cell Lysis Buffer was added to each
well. The plate was then moved to a heating tile set to 75.degree.
C. and let stand for 10 minutes. To fully inactivate the proteinase
K in the lysis, 2 .mu.l of 0.1 M PMSF in DMSO was added to each
sample and incubated at room temperature for two minutes. Two .mu.l
DNase I was added to each sample and the plate was incubated at
37.degree. C. for 15 minutes while shaking. The plate was then
moved again to the 75.degree. C. heating tile for 5 minutes to
inactivate the DNase I. One-step RT-PCR was performed on each
lysate in a 96-well PCR plate as described in EXAMPLE IX.
[0061] In each sample GAPDH was detected by real-time PCR. An
analysis of the Ct values for each sample gives a mean of 17.28
with a standard deviation of 0.524. This gives a CV of 3.03% with a
high of 18.88 and a low of 15.90.
[0062] If one is using a heating tile that can be set to a higher
temperature such, as 95.degree. C., then it is possible to incubate
the cells on these heating tiles to inactivate the proteinase K
instead of adding PMSF. It is important that the samples themselves
actually reach 75.degree. C. when using proteinase K as the
protease (other proteases may be inactivated at lower
temperatures). If not, then some of the protease may remain active
to digest the reverse transcriptase when the sample was incubated
for cDNA synthesis. Such an event would lessen or completely
diminish a signal from the sample.
EXAMPLE VI
[0063] Use of Other Reverse Transcriptases in Context of
Methods
[0064] MMLV-RT is one of the most commonly used reverse
transcriptases by molecular biologists. However, there are other
reverse transcriptases that function in the invention. For example,
Avian Myelogenous Virus reverse transcriptase (AMV-RT; Retzel,
1980) and the Tth DNA polymerase, which also has reverse
transcriptase activity, can each synthesize cDNA. Further, the DNA
polymerase has reverse transcriptase activity if Mn.sup.+2 is
provided in the buffer (Myers, 1991) and can be used to generate
cDNA from a cell lysate following the protocol of the invention.
Those of skill in the art will understand that the above-described
nucleic acid polymerases and any other nucleic acid polymerases
having reverse transcriptase activity may be adaptable to the
protocols of the invention.
EXAMPLE VII
[0065] Different Concentrations of Proteinase K and Proteases other
than Proteinase K Function in Context of Methods of the
Invention
[0066] Using the procedure listed in EXAMPLE I, proteinase K has
been used at concentrations of 25 and 500 .mu.g/ml. The results
have been essentially the same as using the 200 .mu.g/ml
concentration that was used in the standard protocol.
[0067] Proteases are classified into several groups based on the
mechanism of catalysis. Serine proteases include but are not
limited to Trypsin, Chymotrypsin, Elastase, Subtilisin,
Streptogrisin, Thermitase, Aqualysin, and carboxypeptidase A, D, C,
or Y. Cysteine proteases include but are not limited to Papain and
Clostripain. Acid Proteases include but are not limited to Pepsin,
Chymosin, and Cathepsin. Metalloproteases include but are not
limited to Pronase, Thermolysin, Collagenase, Dispase, various
aminopeptidases, and Carboxypeptidase A, B, E/H, M, T, or U. In
some embodiments of the invention, these proteases or combination
thereof could be used in place of or in addition to proteinase K.
It is possible that a mixture of proteases could be used instead of
a single protease to generate a cell lysate compatible with reverse
transcription and PCR. In certain embodiments a protease or
protease mixture may be used simultaneously with a nuclease, e.g.,
a DNase such as DNas I, or any other catabolic enzyme.
EXAMPLE VIII
[0068] Tissue Samples
[0069] Another type of sample that may be used in regard to the
invention is a piece of tissue consisting of cells ranging from
hundreds to thousands. One such tissue or organ may be leech
ganglia. Another sample type may be a patient needle biopsy that
often consists of thousands of cells. A biopsy could be processed
by the inventive methods and PCR amplified to make a diagnosis or
prognosis by measuring the expression of certain genes. Another
sample may be leukocytes or lymphocytes isolated from a blood
sample. Plasma fractionated from a blood sample may be used in this
invention to detect a virus such as HIV or HCV. Another sample may
be whole blood itself.
EXAMPLE IX
[0070] Coupling of Invention with One-step RT-PCR
[0071] Methods of the invention can be used in a one-step RT-PCR
reaction where the MMLV-RT and Taq polymerase were combined in a
one tube, one buffer system. For example, HeLa S3 cells were grown,
harvested, lysed, and DNase treated as in EXAMPLE I. Cell lysate
concentrations of 1, 4, 20, 100, 500, 1,250, 2,500, 5,000, and
10,000 cells/.mu.l were made and DNase treated as in EXAMPLE I.
Five .mu.l of each lysate was added to 2.5 .mu.l 10.times. RT
buffer (500 mM Tris pH 8.3, 750 mM KCl, 30 mM MgCl.sub.2, 50 mM
DTT), 1 .mu.l (10 U/.mu.l) of placental RNase Inhibitor (cat.
#2687, Ambion, Inc.), 1 .mu.l of MMLV-RT (25 U/.mu.l), 4 .mu.l dNTP
mix (2.5 mM each), 0.5 .mu.l 50.times. ROX standard (Ambion, Inc.),
1 .mu.l PCR primer mix (10 .mu.M mix of forward and reverse
primers), 1 .mu.l TaqMan probe (2 .mu.M), 0.2 .mu.l SuperTaq
(Ambion, Inc.), and 8.8 .mu.l RNase-free water (Ambion, Inc.). The
reactions were placed in an ABI 7700 Prism thermocycler and the
following profile was ran: 42.degree. C., 15 minutes; 94.degree.
C., 2 minutes; [94.degree. C., 20 seconds; 60.degree. C. 20
seconds] .times.40 cycles.
[0072] GAPDH was detected in all samples that included HeLa cells.
A plot of the threshold cycle (Ct value) against cell concentration
was linear up to 2,500 cells/.mu.l. GAPDH signal was detected at
higher cell concentrations but inhibition of the reactions by
higher cell concentrations was indicated by Ct values increasing at
the higher cell concentrations compared to the lower
concentrations.
[0073] The cDNA synthesis reactions that did not include MMLV-RT
(MMLV-RT minus control) did not generate any signal in the
amplification reaction proving that the genomic DNA was degraded to
undetectable levels and that signals produced by RT-PCR are
attributable solely to the amplification of the cDNA.
EXAMPLE X
[0074] Use of Invention Without the DNase Treatment
[0075] The DNase I step in some aspects of the invention is not
necessary if the PCR primers used will not amplify genomic
sequences. This can be done by designing primers that span an
intron within the gene of interest. This greatly reduces the total
time it takes to complete the procedure of the invention because
the DNase I treatment can be eliminated.
[0076] For example, HeLa S3 cells were grown, harvested and lysed
as described in EXAMPLE I. Reverse transcription followed by PCR
was performed, again as in EXAMPLE I. A one-step RT-PCR procedure
on the same lysates was performed as described in EXAMPLE IX using
primers and probe for DDPK. DDPK Primer and Probe sequences, can
be, for example: Forward: 5'-CTGGCCGGTCATCAACTGA-3' (SEQ ID NO.
13); Reverse: 5'-ACAAGCAAACCGAAATCTCTGG-3' (SEQ ID NO. 14); TaqMan
Probe: 5' (FAM)-AATGCGT-(TAMRA)-CCTGAGCAGCAGCCCp-3' (SEQ ID NO.
15). DDPK was detected by real time PCR, and the reverse
transcriptase minus reactions were negative.
EXAMPLE XI
[0077] RNA Amplification
[0078] There are many cases where researchers have a limited amount
of sample and the RNA isolated from the sample is not enough to
perform their desired assay. The technique that this applies to
most often is producing a labeled nucleic acid from the isolated
RNA and then hybridizing the labeled nucleic acid to a microarray.
The signals produced at each of the addresses of the microarray
indicate the level of expression for each of the genes on the
array. Thus, a snapshot is taken of the abundance for each of the
genes probed by the array.
[0079] Typically, the starting material for amplifying RNA is a
minimum of .about.10 ng of total RNA from the sample. Next, the RNA
is reverse transcribed in the presence of an oligonucleotide primer
that encodes an RNA polymerase promoter such as a T7 phage
promoter. In the procedure by Kacian (U.S. Pat. No. 5,554,516), the
material is now transcribed by T7 RNA polymerase to synthesize RNA.
In the procedure by Phillips (1996), a second strand of cDNA is
produced and then the double-stranded DNA is transcribed by a phage
polymerase. Ambion, Inc. produces the MessageAmp kit (Cat. #1750)
based on the procedure of Phillips (1996). Purified total RNA or
poly(A)RNA is the recommended substrate for the MessageAmp kit.
[0080] Cell lysates generated by the Cells-to-cDNA II.TM. procedure
were demonstrated to be suitable substrate for the MessageAmp kit.
For example, K562 cells at concentrations of 200, 600 and 2,000
cells/.mu.l were incubated at 75.degree. C. for 10 minutes in a
Cell Lysis Buffer comprised of 50 mM Tris pH 8.3, 75 mM KCl5 mM
DTT, 1 mM EDTA, 1% TX-100, and 200 .mu.g/ml proteinase K. No DNase
I treatment was performed because it is not needed in this
application. Five .mu.l of each cell lysate concentration was used
as the template in the MessageAmp procedure. RNA was amplified from
860 to 3,000 fold with this procedure (TABLE 1).
3TABLE 1 Fold-Amplification of RNA from a Cell Lysate Generated by
the Cells-to- cDNA II .TM. method using the MessageAmp kit. Number
of Cells *Quantity of Quantity of RNA Fold- Added to RNA in the
After MessageAmp Amplification MessageAmp Reaction Amplification of
Cellular Reaction as Lysate (ng) (.mu.g) RNA 1,000 5 15 3,000 3,000
15 25 1,667 10,000 50 43 860 *Assume 5 pg of total RNA per cell
EXAMPLE XII
[0081] Automation and Monitoring the Effects of Drug Treatment
[0082] Cells were grown overnight in 0.2 ml DME media with 10% FBS
with equal number of cells in each well of a 96-well plate. After
an overnight incubation, phorbol myristate acetate (PMA) is added
to final concentrations of 100, 10, 1, 0.1, and 0 nM in the growth
medium in replicates of eight. The cells were incubated at
37.degree. C. for 24 hours. The 96-well plate and lid were placed
on the Packard MultiPROBE.RTM. II HT Liquid Handling System from
PerkinElmer Life Sciences on the proper deck positions. All
proceeding steps were entered into the WinPrep for automation. The
growth medium was removed and the cells washed with 1.times. PBS. A
volume of 0.1 ml Cell Lysis Buffer is added to each well. The plate
was moved to a heating tile, for example, a tile at 75.degree., and
incubated for 10 minutes. The plate was then moved to a shaker
platform and 2 .mu.l 100 mM PMSF in DMSO was added to each well to
inactivate the proteinase K. PMSF is a serine protease inhibitor
that does not inhibit reverse transcriptase or Taq polymerase. The
plate was shaken for 2 minutes. PMSF can be used when the heating
tile cannot heat the sample to 75.degree. C. to inactivate the
proteinase K. Two .mu.l DNase I (2 U/.mu.l) was added to each well
and the plate was moved to a 37.degree. C. heating tile. The plate
was incubated for 15 minutes while shaking. The plate was then
moved to a heating tile, for example, a tile at 75.degree. C., and
incubated for 5 minutes to inactivate the DNase I. The protocol for
one step RT-PCR found in EXAMPLE IX was followed so that 20 .mu.l
aliquots of the master mix were added to a 96-well PCR plate. Five
.mu.l of lysate was added to each well. The plate was ready for
one-step RT-PCR.
[0083] The one-step RT-PCR was run with primers and TaqMan probes
for both tissue plasminogen activator (t-PA) and 18S ribosomal RNA
with a standard curve ran for each set. tPA Primer and Probe
sequences were: Forward: 5'-GGCGCAGTGCTTCTCTACAG-3' (SEQ ID NO.
16); Reverse: 5'-TAGGGTCTCGTCCCGCTTC-3' (SEQ ID NO. 17); TaqMan
Probe: 5'-(FAM)-TTCTCCAGACCCACCACACCGC-(TAMRA)-3' (SEQ ID NO. 18);
18S Primer and Probe sequences: Forward: 5'TCAAGAACGAAAGTCGGAGG3'
(SEQ ID NO. 19); Reverse: 5'GGACATCTAAGGGCATCACA3' (SEQ ID NO. 20);
TaqMan Probe: 5'-(FAM)-TGGCTGAACGCCACTTGTCCCTCTAA-(TAMRA)-3' (SEQ
ID NO. 21). The real-time PCR data shows there was about a 29-fold
stimulation of t-PA with concentrations of 100 and 10 nM when the
values were normalized to the levels of 18S rRNA which is assumed
to be constant during different experimental conditions. FIG.
3.
[0084] In a similar type of experiment, cells were treated with
short interfering (si)RNA to down regulate specific genes
(Elbashir, 2002). Three thousand HeLa cells grown in a 96-well dish
were transfected with chemically synthesized, 125 nM gene-specific
siRNAs against CDC-2, c-jun, survivin, and GAPDH or a negative
control (NC1) 24 hours after plating using Oligofectamine
transfection reagent (Invitrogen). After 48 hours, cells were
processed according to the Cells-to-cDNA II.TM. automated protocol,
and analyzed by real-time one-step RT-PCR on an ABI 7900 for the
indicated genes and normalized to 18S rRNA. Gene expression was
calculated as a percentage of gene expression compared with the
negative control siRNA. Experiments were performed in replicates of
eight. Using the cell lysate produced by the Cells-to-cDNA II.TM.
procedure and one-tube RT-PCR, gene expression for each of the
target genes was determined to be reduced by more than 70% (FIG.
4).
EXAMPLE XIII
[0085] Multiple Enzymes Used to Produce the Cell Lysate
[0086] In addition to proteases, other types of enzymes may be
included in the Cell Lysis Buffer, such as enzymes to digest
nucleic acids, sugars, fats, connective tissue (collagen and
elastin) and DNA. These enzymes may be more important with regard
to EXAMPLE VIII where the system may be used for small quantities
of tissue. A combination of enzymes may enhance the digestion
process and also destroy the macromolecules that inhibit enzymatic
reactions.
[0087] For example, the initial lysis step containing proteinase K
was combined with the DNase treatment and the cellular DNA was
digested to substantially reduce the signal generated in the
reverse transcriptase minus reactions. This result was unexpected
since it was thought that the proteinase K would digest the DNase I
before the DNase could fully digest the cellular DNA. By combining
these two enzymatic reactions, the Cells-to-cDNA II.TM. process is
further streamlined and only a single incubation event is required
to produce a cell lysate compatible with reverse transcription or
one-step RT-PCR.
[0088] The Cell Lysis Buffer was made with proteinase K
concentrations of 20 to 200 .mu.g/ml and placed on ice. DNase I was
added to the Cell Lysis Buffers at 0.1 U/.mu.l and then the Cell
Lysis Buffers were kept on ice while the cells were harvested.
Cells were added to the different Cell Lysis Buffers at
concentrations of 4 to 2,500 cells/.mu.l. The samples were heated
in a thermocycler at 60.degree. C. for 10 minutes to give the DNase
time to digest the cellular DNA before inactivating the proteinase
K and DNase enzymes at 75.degree. C. for 10 minutes. The same cells
were also treated using the sequential method of EXAMPLE I.
One-step real-time RT-PCR for GAPDH (as in EXAMPLE IX) was
performed on these lysates. The difference between the RT minus and
RT plus reactions were 18 Ct (.about.20,000.times.) indicating that
the DNase I was active in the combined format and that the
proteinase K did not digest the DNase until it had degraded nearly
all of the cellular DNA (TABLE 2).
4TABLE 2 Comparison of the signal obtained for GAPDH by real-time
RT-PCR and PCR (RT-) using a combined or sequential proteinase K
and DNase I treatments of HeLa S3 cells. Cell Concentration
Combined (Ct) Sequential (Ct) (cells/.mu.l) RT(+) RT(-) RT(+) RT(-)
4 21.3 40 21.4 40 20 17.6 40 18.1 40 100 16.9 31.9 15.7 33.5 500
14.6 33.3 14.1 36.7 2,500 12.9 31.5 12.7 31.7
EXAMPLE XIV
[0089] Addition of Cell Lysis Buffer Directly to Tissue Culture
Medium
[0090] Typically, the Cells-to-cDNA II.TM. procedure involves
washing the cells grown in tissue culture with phosphate buffered
saline (PBS), primarily to remove the serum from the sample that
was in the growth medium. The serum can inhibit downstream
enzymatic reactions like reverse transcription and PCR.
[0091] If the cells can be grown in serum-free medium, then the
cell-washing step may be bypassed entirely. As such, the processing
time will be decreased. Also, this procedure makes the handling of
cells grown in suspension much easier because centrifugation is no
longer required for washing. Drosophila cells are commonly grown in
serum-free medium and therefore, the efficiency of the
Cells-to-cDNA II.TM. procedure on these cells, if the cell washing
step were omitted, was tested.
[0092] Schneider L2 Drosophila cells were grown to confluency in
Drosophila-SFM (serum free medium). The cells were harvested in SFM
and diluted to concentrations of 6,500; 1,300; 260; 52; and 10.4
cells/.mu.l in SFM. Eighty .mu.l of each cell concentration was
added to a 0.5 ml tube to which two volumes (160 .mu.l) of Cell
Lysis Buffer was added. These samples were then taken through the
Cells-to-cDNA II.TM. protocol including the DNase I digestion. The
cell lysates were then used in one-step, real-time RT-PCR to detect
Ubiquitin (accession #M22428) and analyzed using the ABI PRISM.RTM.
7900 HT Sequence Detection System Forward Primer:
5'-CACGCATCTTGTTTTCCCAAT-3' (SEQ ID NO: 22); Reverse Primer:
5'-CTCGAGTGCGTTCGTGATTTC-3' (SEQ ID NO: 23); TaqMan Probe:
5'-AATTGGCATCAAAACGCAAACAAATC-3' (SEQ ID NO: 24). Lysate volumes of
5 .mu.l were used in each of the 20 .mu.l reactions.
[0093] It was found that all cell concentrations generated a PCR
signal and that they were in the linear range. In addition, no
signal was detected in the RT minus reactions indicating that the
DNase treatment was effective in the presence of the SFM
medium.
EXAMPLE XV
[0094] Use of an Exemplary Kit for Producing cDNA from Mammalian
Cells in Culture
[0095] Components of an exemplary kit for the preparation of cDNA
from mammalian cells in culture may include one or more of the
following reagents: 1.times. PBS (pH 7.4); Cell Lysis II Buffer (10
mM Tris pH 7.5, 3 mM MgCl.sub.2, 1 mM CaCl.sub.2, 1 mM EDTA pH 8.0,
1% Tx-100 and 200 ug/ml Proteinase K); DNase 1 (2 U/.mu.l);
10.times. RT Buffer (500 mM Tris pH 8.3, 750 mM KCl, 30 mM MgCl2,
50 mM DTT); M-MLV Reverse Transcriptase; RNase Inhibitor (10
U/.mu.l); dNTP Mix (2.5 mM each dNTP); Random Decamers (50 .mu.M);
Oligo(dT).sub.18 Primers (50 .mu.M); Nuclease-free water; RNA
control, e.g., Armored RNA control; control RNA primer pair, e.g.,
Armored RNA primer pair (10 .mu.M each); and an endogenous Primer
Pair (5 .mu.M each). The kit components are supplied in suitable
containers under suitable conditions for shipping or storage. The
parameters for use of the kit components are described herein and
may be used to produce cDNA from mammalian cells in culture without
the isolation of mRNA. In certain embodiments, the cDNA produced
may be used in a variety of assays or procedures including, but not
limited to PCR amplification or automated PCR amplification and
analysis in multiwell formats and RNA amplification.
[0096] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
[0097] References
[0098] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0099] Brady G, Iscove N N. Construction of cDNA libraries from
single cells. Methods Enzymol. 225: 611-623, 1993.
[0100] Busche S, Gallinat S, Bohle R- M, Reinecke A, Seebeck J,
Franke F, Fink L, Zhu M, Sumners C, Unger T. Expression of
angiotensin AT1 and AT2 receptors in adult rat cardiomyocytes after
myocardial infarction: a single-cell reverse
transcriptase-polymerase chain reaction study. J. Am. Pathol. 157:
605-611, 2000.
[0101] Elbashir S M, Harborth J, Weber K, Tuschl T. Analysis of
gene function in somatic mammalian cells using small interfering
RNAs. Methods 26: 199-213, 2002.
[0102] Fink L, Kinfe T, Seeger W, Ermert L, Kummer W, Bohle R M.
Immunostaining for cell picking and real-time mRNA quantitation.
Am. J. Pathol. 157: 1459-1466, 2000a.
[0103] Fink L, Kinfe T, Stein M M, Ermet L, Hanze J, Kummer W,
Seeger W, Bohle R M. Immunostaining and laser-assisted cell picking
for mRNA analysis. Laboratory Invest. 80; 327-333, 2000b.
[0104] Klebe R J, Grant G M, Grant A M, Garcia M A, Giambernardi T
A, Taylor G P. RT-PCR without RNA isolation. BioTechniques 21:
1094-1100, 1996.
[0105] Lockhart D J, Dong H, Byrne M C, et al. Expression
monitoring by hybridization to high-density oligonucleotide arrays.
Nat. Biotechnol. 14: 1675-1680, 1996.
[0106] Mesink E, van de Locht A, Schattenberg A, Linders E, Schaap
N, Geurts van Kessel A, de Witte T. Quantitation of minimal
residual disease in Philadelphia chromosome positive chronic
myeloid leukemia patients using real-time quantitative RT-PCR. Br.
J. Haematol. 102: 768-774, 1998.
[0107] Myers T W, Gelfand D H. Reverse transcription and DNA
amplification by a Thermus thermophilus DNA polymerase.
Biochemistry 30:7661-7666, 1991.
[0108] O'Leary T J. Reducing the impact of endogenous ribonucleases
on reverse transcription-PCR assay systems. Clin. Chem. 45:
449-450, 1999.
[0109] Pasloske B L, WalkerPeach C R, Obermoeller R D, Winkler M,
DuBois D B. Armored RNA technology for the production of
ribonuclease resistant viral RNA controls and standards. J. Clin.
Microbiol. 36: 3590-3594, 1998.
[0110] Phillips J, Eberwine J H. Antisense RNA amplification: a
linear amplification method for analyzing the mRNA population from
single living cells. Methods 10: 283-288, 1996.
[0111] Retzel E F, Collett M S, Faras A J. Enzymatic synthesis of
deoxyribonucleic acid by the avian retrovirus reverse transcriptase
in vitro: optimum conditions required for transcription of large
ribonucleic acid templates. Biochemistry 19: 513-518, 1980.
[0112] Sumida A, Yamamoto I, Zhou Q, Morisaki T, Azuma J.
Evaluation of induction of CYP3A mRNA using the HepG2 cell line and
reverse transcription-PCR. Biol. Pharm. Bull. 22: 61-65, 1999.
[0113] Su S, Vivier R G, Dickson M C, Thomas N, Kendrick M K,
Williamson N M, Anson J G, Houston J G, Craig F F. High-throughput
RT-PCT analysis of multiple transcripts using a microplate RNA
isolation procedure. BioTechniques 22: 1107-1113, 1997.
[0114] Tang J, Hu M, Lee S, Roblin R. A polymerase chain reaction
based method for detecting Mycoplasma/Acholeplasma contaminants in
cell culture. J. Microbiol. Methods 39: 121-126, 2000.
[0115] Yan L, Kaczorowski G, Kohler M. One-tube protocol for
single-cell reverse transcriptase-polymerase chain reaction. Anal.
Biochem. 304: 267-270, 2002.
[0116] Roblin III R O, Hu M, Tang J S, Sunmin L. Mycoplasma
polymerase chain reaction testing system using a set of mixed and
single sequence primers. U.S. Pat. No. 5,693,467.
[0117] Van Gelder R N, von Zastrow M E, Barchas J D, Eberwine J H.
Processes for genetic manipulations using promoters. U.S. Pat. No.
5,891,636.
[0118] Kacian D L, McAllister D L, McDonough S H, Dattagupta N.
Nucleic acid sequence amplification method, composition and kit.
U.S. Pat. No. 5,554,516.
[0119] Reynolds M A, Ruvolo M, Arnold Jr. L J. Combined
polynucleotide sequence as discrete assay endpoints. U.S. Pat. No.
6,316,608.
Sequence CWU 1
1
24 1 19 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 gattgtcacc ataagcagc 19 2 19 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 2
cccctgaatg cggctaatc 19 3 26 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 3 cggaaccgac tactttgggt gtccgt
26 4 18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 4 gaaggtgaag gtcggagt 18 5 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 5
gaagatggtg atgggatttc 20 6 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 6 caagcttccc gttctcagcc 20
7 25 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 7 tcacccacac tgtgcccatc tacga 25 8 25 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 8 cagcggaacc gctcattgcc aatgg 25 9 25 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 9
atgccccccc catgccatcc tgcgt 25 10 24 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 10 ccatcgtgtc
atcaaggact tcat 24 11 24 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 11 cttgccatcc agccaggagg tctt
24 12 26 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 12 tggcacagga ggaaagagca tctatg 26 13 19 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 13 ctggccggtc atcaactga 19 14 22 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 14 acaagcaaac
cgaaatctct gg 22 15 22 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 15 aatgcgtcct gagcagcagc cc 22
16 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 16 ggcgcagtgc ttctctacag 20 17 19 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 17
tagggtctcg tcccgcttc 19 18 22 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 18 ttctccagac ccaccacacc gc
22 19 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 19 tcaagaacga aagtcggagg 20 20 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 20
ggacatctaa gggcatcaca 20 21 26 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 21 tggctgaacg ccacttgtcc
ctctaa 26 22 21 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 22 cacgcatctt gttttcccaa t 21 23 21 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 23 ctcgagtgcg ttcgtgattt c 21 24 26 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 24 aattggcatc
aaaacgcaaa caaatc 26
* * * * *