U.S. patent application number 10/236373 was filed with the patent office on 2003-09-11 for device and method for photoactivation.
This patent application is currently assigned to Cerus Corporation. Invention is credited to Cimino, George D., Hearst, David Paul, Hearst, John Eugene, Isaacs, Stephen T..
Application Number | 20030170141 10/236373 |
Document ID | / |
Family ID | 27112449 |
Filed Date | 2003-09-11 |
United States Patent
Application |
20030170141 |
Kind Code |
A1 |
Hearst, David Paul ; et
al. |
September 11, 2003 |
Device and method for photoactivation
Abstract
A device comprising a light source, a sample support and a
temperature control compartment. The sample support is positioned
to support multiple sample vessels for irradiation by the light
source. The temperature control compartment maintains the
temperature of the sample vessels within a desired range. The light
source, sample support and temperature control compartment are all
contained within an opaque housing.
Inventors: |
Hearst, David Paul; (Redwood
City, CA) ; Cimino, George D.; (Lafayette, CA)
; Hearst, John Eugene; (Berkeley, CA) ; Isaacs,
Stephen T.; (Orinda, CA) |
Correspondence
Address: |
John W. Tessman
Cerus Corporation
Suite 300
2525 Stanwell Drive
Concord
CA
94520
US
|
Assignee: |
Cerus Corporation
2525 Stanwell Drive, Suite 300
Concord
CA
94520
|
Family ID: |
27112449 |
Appl. No.: |
10/236373 |
Filed: |
September 6, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10236373 |
Sep 6, 2002 |
|
|
|
09878542 |
Jun 11, 2001 |
|
|
|
6461567 |
|
|
|
|
09878542 |
Jun 11, 2001 |
|
|
|
09148520 |
Sep 4, 1998 |
|
|
|
6258319 |
|
|
|
|
09148520 |
Sep 4, 1998 |
|
|
|
08805456 |
Feb 25, 1997 |
|
|
|
5854967 |
|
|
|
|
08805456 |
Feb 25, 1997 |
|
|
|
08477670 |
Jun 7, 1995 |
|
|
|
5683661 |
|
|
|
|
08477670 |
Jun 7, 1995 |
|
|
|
08320126 |
Oct 7, 1994 |
|
|
|
5503721 |
|
|
|
|
08320126 |
Oct 7, 1994 |
|
|
|
07965083 |
Oct 22, 1992 |
|
|
|
07965083 |
Oct 22, 1992 |
|
|
|
07732750 |
Jul 18, 1991 |
|
|
|
07732750 |
Jul 18, 1991 |
|
|
|
07428510 |
Oct 26, 1989 |
|
|
|
5184020 |
|
|
|
|
Current U.S.
Class: |
422/22 ;
250/455.11; 422/186 |
Current CPC
Class: |
B01L 7/00 20130101; C12Q
1/6848 20130101; C12Q 2523/101 20130101; C12Q 2521/531 20130101;
H01L 27/11 20130101; C07D 493/04 20130101; C12Q 1/6848 20130101;
B01J 19/123 20130101; Y10S 204/902 20130101; G11C 11/412 20130101;
B01L 7/52 20130101 |
Class at
Publication: |
422/22 ; 422/186;
250/455.11 |
International
Class: |
A61L 002/00; B01J
019/08 |
Claims
What is claimed is:
1. A device, comprising: a) a source of electromagnetic radiation;
b) a support for liquid sample vessels positioned such that said
vessels can be irradiated by said electromagnetic radiation; c) a
compartment configured to maintain the temperature of said vessels
within a desired range during said irradiation; and d) an opaque
housing containing said source of electromagnetic radiation, said
support, and said compartment.
2. The device of claim 1, wherein said source of electromagnetic
radiation is a fluorescent source that emits wavelengths between
300 and 400 nm.
3. The device of claim 2, wherein said source of electromagnetic
radiation provides an intensity flux to the sample vessels of
greater than 15 mW/cm.sup.2 for the wavelengths between 300 and 400
nm. A device comprising a light source, a sample support and a
temperature control compartment. The sample support is positioned
to support multiple sample vessels for irradiation by the light
source. The temperature control compartment maintains the
temperature of the sample vessels within a desired range. The light
source, sample support and temperature control compartment are all
contained within an opaque housing.
Description
[0001] The present application is a continuation of U.S. patent
application Ser. No. 09/878,542, filed Jun. 11, 2001, which is a
continuation of U.S. patent application Ser. No. 09/148,520, filed
Sep. 4, 1998, now issued as U.S. Pat. No. 6,258,319, which is a
continuation of U.S. patent application Ser. No. 08/805,456 filed
Feb. 25, 1997, now issued as U.S. Pat. No. 5,854,967, which is a
continuation of U.S. patent application Ser. No. 08/477,670 filed
Jun. 7, 1995, now issued as U.S. Pat. No. 5,683,661, which is a
continuation of U.S. Pat. Ser. No. 08/320,126 filed Oct. 7, 1994,
now issued as U.S. Pat. No. 5,503,721, which is a continuation of
U.S. patent application Ser. No. 07/967,083 filed Oct. 22, 1992,
abandoned, which is a continuation of U.S. patent application Ser.
No. 07/732,750 filed Jul. 18, 1991, abandoned, which is a
continuation of U.S. patent application Ser. No. 07/428,510, filed
Oct. 26, 1989, now issued as U.S. Pat. No. 5,184,020.
FIELD OF THE INVENTION
[0002] The present invention relates to a device and method for
photoactivation.
BACKGROUND
[0003] With the prospect of inadvertently releasing nucleic acid
sequences into nature that are either a) modified but present in
their normal host species, or b) normal but present in a foreign
host species, there is some concern that nucleic acid techniques
pose a risk to human health. Regulatory approaches to this risk
have focused on physical containment of organisms that contain
modified nucleic acid sequences.
[0004] Such approaches are bolstered by studies that assess the
impact of different laboratory protocols and various types of error
and equipment failures on the incidence and extent of uncontained
organisms. E. Fisher and D. R. Lincoln, Recomb. DNA Tech. Bull. 7:1
(1984).
[0005] With this effort directed at nucleic acids in organisms,
little attention has been paid to the problem of naked nucleic
acid, i.e. nucleic acid that is free from a host organism.
Depending on the particular circumstances, naked nucleic acid can
be an infectious or transforming agent. R. W. Old and S. B.
Primrose, Principles of Gene Manipulation, pp. 167-168 (Univ. of
Cal. Press, 2d Edition 1981). Furthermore, naked nucleic acid can
interfere with other laboratory reactions because of carryover.
Carryover
[0006] Carryover is broadly defined here as the accidental
introduction of nucleic acid into a reaction mixture. Of course,
the types of accidental introductions are numerous. Nucleic acids
can be introduced during a spill or because of poor laboratory
technique (e.g. using the same reaction vessel or the same pipette
twice). Of more concern, however, is the introduction of nucleic
acids that occurs even during normal laboratory procedures,
including inadvertent transfer from contaminated gloves. As with
modified organisms, one of the most troubling source of this type
of accident is aerosolization.
[0007] Aerosols are suspensions of fine liquid or solid particles,
as in a mist. Aerosols can occur by disturbing a solution (e.g.
aerosols are created during a spill), but they can also occur
simply by disturbing the small amount of material on a container
surface (e.g. the residue on the inner surface of a cap of a
plastic tube is frequently aerosolized at the moment the tube is
opened). Because of the latter, any container having highly
concentrated amounts of nucleic acid is a potential source of
nucleic acid carryover.
[0008] It should be pointed out that the question of whether there
is carryover is only significant to the extent that such carryover
interferes with a subsequent reaction. In general, any laboratory
reaction that is directed at detecting and/or amplifiying a nucleic
acid sequence of interest among vastly larger amounts of nucleic
acid is susceptible to interference by nucleic acid carryover.
Amplification Techniques
[0009] The circumstances in the modern laboratory where both a)
containers having highly concentrated amounts of nucleic acid are
present, and b) reactions directed at amplifying nucleic acid
sequences are performed, are relatively common. The screening of
genomic DNA for single copy genes is perhaps the best example of
procedure involving both concentrated nucleic acid and
amplification. There are a number of alternative methods for
nucleic acid amplification, including 1) the replication of
recombinant phage through lytic growth, 2) amplification of
recombinant RNA hybridization probes, and 3) the Polymerase Chain
Reaction.
[0010] 1. Recombinant Vectors. Most cloning vectors are DNA viruses
or bacterial plasmids with genomic sizes from 2 to approximately 50
kilobases (kb). The amplification of genomic DNA into a viral or
plasmid library usually involves i) the isolation and preparation
of viral or plasmid DNA, ii) the ligation of digested genomic DNA
into the vector DNA, iii) the packaging of the viral DNA, iv) the
infection of a permissive host (alternatively, the transformation
of the host), and v) the amplification of the genomic DNA through
propagation of virus or plasmid. At this point, the recombinant
viruses or plasmids carrying the target sequence may be identified.
T. Maniatis et al., Molecular Cloning, pp. 23-24 (Cold Spring
Harbor Laboratory 1982). Identification of the recombinant viruses
or plasmids carrying the target sequence is often carried out by
nucleic acid hybridization using plasmid-derived probes.
[0011] Bacterial viruses (bacteriophage) can infect a host
bacterium, replicate, mature, and cause lysis of the bacterial
cell. Bacteriophage DNA can, in this manner, be replicated many
fold, creating a large quantity of nucleic acid.
[0012] Plasmids are extrachromosomal elements found naturally in a
variety of bacteria. Like bacteriophages, they are double-stranded
and can incorporate foreign DNA for replication in bacteria. In
this manner, large amounts of probes can be made.
[0013] The use of plasmid-derived probes for the screening of phage
libraries in hybridization reactions avoids the problem of
hybridization of vector DNA (e.g. phage-phage, plasmid-plasmid). In
the construction of a viral library, it is therefore essential that
no plasmid DNA carryover into the phage-genomic DNA mixture. If,
for example, 10 picograms of clonable plasmid DNA were to carryover
into a viral-genomic mixture containing 1 microgram of genomic DNA
(0.001% carryover by weight), every 11 clones assessed to contain
the target sequence would, on average, represent 10 false positives
(i.e. plasmid-plasmid hybridization) and only 1 true positive
(probe-target hybridization), assuming a frequency of 1 target
insert in 1.times.10.sup.6 inserts.
[0014] 2. Reconbinant RNA Probes. P. M. Lizardi et al.,
Biotechnology 6:1197 (1988), describe recombinant-RNT molecules
that function both as hybridization probes and as templates for
exponential amplification by QB replicase. Each recombinant
consists of a specific sequence (i.e. an "internal probe") within
the sequence of MDV-1 RNA. MDV-1 RNA is a natural template for the
replicase. D. L. Kacian et al., Proc. Nat. Acad. Sci USA 69:3038
(1972). The recombinant can hybridize to target sequence that is
complementary to the internal probe and that is present in a
mixture of nucleic acid. Various isolation techniques (e.g.
washing) can then be employed to separate the hybridized
recombinant/target complex from a) unbound recombinant and b)
nucleic acids that are non-complementary to the internal probe. B.
C. F. Chu et al., Nucleic Acids Res. 14:5591 (1986). See also
Biotechnology 7:609 (1989). Following isolation of the complex, QB
replicase is added. In minutes a one-billion fold amplification of
the recombinant (i.e. "recombinant RNA probe amplification")
occurs, indicating that specific hybridization has taken place with
a target sequence.
[0015] While a promising technique, recombinant RNA probe
amplification works so well that carryover is of particular
concern. As little as one molecule of template RNA can, in
principle, initiate replication. Thus, the carryover of a single
molecule of the amplified recombinant RNA probe into a new reaction
vessel can cause RNA to be synthesized in an amount that is so
large it can, itself, be a source of further carryover.
[0016] 3. Polymerase Chain Reaction. K. B. Mullis et al., U.S. Pat.
Nos. 4,683,195 and 4,683,202, describe a method for increasing the
concentration of a segment of a target sequence in a mixture of
genomic DNA without cloning or purification. This process for
amplifying the target sequence consists of introducing a large
excess of two oligonucleotide primers to the DNA mixture containing
the desired target sequence, followed by a precise sequence of
thermal cycling in the presence of a DNA polymerase. The two
primers are complementary to their respective strands of the double
stranded target sequence. To effect amplification, the mixture is
denatured and the primers then to annealed to their complementary
sequences within the target molecule. Following annealing, the
primers are extended with a polymerase so as to form a new pair of
complementary strands. The steps of denaturation, primer annealing,
and polymerase extension can be repeated many times (i.e.
denaturation, annealing and extension constitute one "cycle;" there
can be numerous "cycles") to obtain a high concentration of an
amplified segment of the desired target sequence. The length of the
amplified segment of the desired target sequence is determined by
the relative positions of the primers with respect to each other,
and therefore, this length is a controllable parameter. By virtue
of the repeating aspect of the process, the method is referred to
by the inventors as the "Polymerase Chain Reaction" (hereinafter
PCR). Because the desired amplified segments of the target sequence
become the predominant sequences (in terms of concentration) in the
mixture, they are said to be "PCR amplified".
[0017] With PCR, it is possible to amplify a single copy of a
specific target sequence in genomic DNA to a level detectable by
several different methodologies (e.g. hybridization with a labelled
probe; incorporation of biotinylated primers followed by
avidin-enzyme conjugate detection; incorporation of .sup.32P
labelled deoxynucleotide triphosphates, e.g. dCTP or dATP, into the
amplified segment). In addition to genomic DNA, any oligonucleotide
sequence can be amplified with the appropriate set of primer
molecules. In particular, the amplified segments created by the PCR
process itself are, themselves, efficient templates for subsequent
PCR amplifications.
[0018] The PCR amplification process is known to reach a plateau
concentration of specific target sequences of approximately
10.sup.-8 M. A typical reaction volume is 100 .mu.ml, which
corresponds to a yield of 6.times.10.sup.11 double stranded product
molecules. At this concentration, as little as one femtoliter
(10.sup.-9 microliter) of the amplified PCR reaction mixture
contains enough product molecules to generate a detectable signal
in a subsequent 30 cycle PCR amplification. If product molecules
from a previous PCR are carried over into a new PCR amplification,
it can result in a false positive signal during the detection step
for the new PCR reaction.
[0019] Handling of the reaction mixture after PCR amplification can
result in carryover such that subsequent PCR amplifications contain
sufficient previous product molecules to result in a false positive
signal. S. Kwok and R. Higuchi, Nature 339, 286 (1989). PCR
Technology, H. A. Erlich (ed.) (Stockton Press 1989). This can
occur either through aerosols or through direct introduction, as
described above for other types of carryover.
Control of Carryover
[0020] At present, there are three approaches for the control of
carryover. These can be broadly defined as: 1) containment, 2)
elimination, and/or 3) prevention. With the containment approach,
amplification is performed in a closed system. Usually, this means
a designated part of the laboratory that is closed off from all
other space. Of course, the designated area must be appropriately
configured for the particular amplification assay. In the case of
replication of recombinant phage through lytic growth, the area
must allow for the amplification of the genomic DNA through
propagation of virus or plasmid. The area must also provide all the
requisite equipment and reagents for amplification and subsequent
detection of the amplified segment of the target sequence.
[0021] The problem with containment is that it is very
inconvenient. In order for the containment area to be configured to
provide conditions appropriate for all the steps of amplification,
the laboratory must commit a separate set of equipment. This
duplicate set of equipment, furthermore, is also subject to
carryover. Over time it can be rendered unusable.
[0022] The elimination approach is used when carryover has already
occurred. New stocks of enzymes, buffers, and other reagents are
prepared along with a complete and thorough cleaning of the
laboratory area where amplification is performed. All surfaces are
scrubbed and all disposable supplies replaced. Suspect laboratory
equipment is either discarded or removed from the area.
[0023] The elimination approach is also unsatisfactory. First, it
does not entirely render the area free of carryover. Indeed, the
cleaning process can, itself, generate aerosols. Second, the level
of thoroughness needed in the cleaning requires too much time.
Finally, it is not practical to constantly be discarding or
removing laboratory equipment.
[0024] One preventative approach to dealing with plasmid carryover
in phage libraries is the purification of the probe. Purifying the
probe so that it is essentially free of plasmid DNA can reduce the
incidence of plasmid-plasmid hybridization.
[0025] There are a number of problems with this approach. First,
while reducing the incidence of plasmid-plasmid hybridization, this
method leaves the carryover in the library. Second, purification is
never 100%; the method can only reduce, not eliminate, the problem.
This carryover is an inherent problem with all cloning vectors
including not only bacterial viruses and plasmids, but also animal
and plant viruses and plasmids as well as the more recent
technologies such as yeast chromosomal vectors.
[0026] There is at present one preventative approach to dealing
with recombinant-RNA probe carryover. This involves base treatment
to destroy RNA carryover. This approach will not harm DNA target.
However, it is obviously inadequate as a treatment for RNA
target.
[0027] The only prevention method for PCR carryover that has been
considered up to now involves the use of nested primers. While
originally applied to PCR to improve specificity, the nested primer
technique can also be applied to PCR as a means of reducing the
problem of carryover. Nested primers are primers that anneal to the
target sequence in an area that is inside the annealing boundaries
of the two primers used to start PCR. K. B. Mullis et al., Cold
Spring Harbor Symposia, Vol. LI, pp. 263-273 (1986). When applied
to the carryover problem, nested primers are used that have
non-overlapping sequences with the starting primers. Because the
nested primers anneal to the target inside the annealing boundaries
of the starting primers, the predominant PCR-amplified product of
the starting primers is necessarily a longer sequence than that
defined by the annealing boundaries of the nested primers. The PCR
amplified product of the nested primers is an amplified segment of
the target sequence that cannot, therefore, anneal with the
starting primers. If this PCR-amplified product of the nested
primers is the nucleic acid carried over into a subsequent PCR
amplification, the use of the starting primers will not amplify
this carryover.
[0028] There are at least two problems with the nested primer
solution to carryover in PCR reactions. First, the carryover is
neither removed, nor inactivated (inactivation is defined as
rendering nucleic acid unamplifiable in PCR). Second, the amplified
product of the nested primers will be amplified if the same nested
primers are used in a subsequent PCR.
[0029] Of course, another solution to carryover in subsequent PCR
amplifications is to use different primers altogether. This is not,
however, a practical solution. First, making new primers for every
new PCR amplification would be extremely time consuming and costly.
Second, PCR amplification with each primer pair must be
individually optimized. Third, for a target sequence of a given
length, there is a limit to the number of non-overlapping primers
that can be constructed.
[0030] The present invention offers the first definitive method for
controlling carryover. These methods involve the use of compounds,
including psoralens and isopsoraleiis.
[0031] Psoralens. Psoralens are tricyclic compounds formed by the
linear fusion of a furan ring with a courarin. Psoralens can
intercalate between the base pairs of adducts to pyrimidine bases
upon absorption of longwave ultraviolet light. G. D. Cimino et al.,
Ann. Rev. Biochem. 54:1151 (1985). Hearst et al., Quart. Rev.
Biophys. 17:1 (1984). If there is a second pyrimidine adjacent to a
psoralen-pyrimidine monoadduct and on the opposite strand,
absorption of a second photon can lead to formation of a diadduct
which functions as an interstrand crosslink. S. T. Isaacs et al.,
Biochemistry 16:1058 (1977). S. T. Isaacs et al., Trends in
Photobiology (Plenum) pp. 279-294 (1982). J. Tessman et al.,
Biochem. 24:1669 (1985). Hearst et al., U.S. Pat. 4,124,589 (1978).
Hearst et al., U.S. Pat. 4,169,204 (1980). Hearst et al., U.S. Pat.
4,196,281 (1980).
[0032] Isopsoralens. Isopsoralens, like psoralens, are tricyclic
compounds formed by the fusion of a furan ring with a coumarin. See
Baccichetti et al., U.S. Pat. No. 4,312,883. F. Bordin et al.,
Experientia 35:1567 (979). F. Dall'Acqua et al., Medeline Biologie
Envir. 9:303 (1981). S. Caffieri et al., Medecine Biologie Envir.
11:386 (1983). F. Dall'Acqua et al., Photochem Photobio. 37:373
(1983). G. Guiotto et al., Eur. J. Med. Chem-Chim. Ther. 16:489
(1981). F. Dall'Acqua et al., J. Med. Chem. 24:178 (1984). Unlike
psoralens, the rings of isopsoralen are not linearly annulated.
While able to intercalate between the base pairs of double-stranded
nucleic acids and form covalent adducts to nucleic acid bases upon
absorption of longwave ultraviolet light, isopsoralens, due to
their angular geometry, normally cannot form crosslinks with DNA.
See generally, G. D. Cimino et al., Ann. Rev. Biochem. 54:1151
(1985).
[0033] Objects and advantages of the present invention will be
apparent from the following description when read in connection
with the accompanying figures.
SUMMARY OF THE INVENTION
[0034] The present invention relates to a device and method for
photoactivating new and known compounds. The present invention
further contemplates devices for binding new and known compounds to
nucleic acid.
[0035] In general, the present invention relates to a
photoactivation device for treating photoreactive compounds,
comprising: a) means for providing appropriate wavelengths of
electromagnetic radiation to cause activation of at least one
photoreactive compound; b) means for supporting a plurality of
sample vessels in a fixed relationship with the radiation providing
means during activation; and c) means for maintaining the
temperature of the sample vessels within a desired temperature
range during activation. In one embodiment, the photoactivation
device further comprises means for controlling the radiation
providing means. In one embodiment, the controlling means comprises
a timer.
[0036] In a preferred embodiment, the photoactivation device
further comprises means for containing the radiation providing
means, such that a user is shielded from said wavelengths of
electromagnetic radiation. The radiation containing means, in one
embodiment, comprises an opaque housing surrounding the radiation
providing means.
[0037] In a preferred embodiment, the temperature maintaining means
comprises a chamber positioned interior to the housing and in a
fixed relationship to the radiation providing means, and the sample
vessel supporting means comprises intrusions in the chamber. In
another preferred embodiment, the chamber has exterior and interior
walls, the interior walls of said chamber form a trough, and the
sample vessel supporting means comprises a sample rack detachably
coupled to the housing above the trough. Alternative sample covers
are contemplated to be dimensioned to overlay the sample rack.
[0038] It is preferred that the chamber has inlet and outlet ports
so that temperature control liquid may enter and exit.
[0039] In another embodiment, a photoactivation device for treating
photoreactive compounds, comprises: a) means for providing
electromagnetic radiation, having a wavelength cutoff at 300
nanometers, to cause activation of at least one photoreactive
compound; b) means for supporting a plurality of sample vessels in
a fixed relationship with the radiation providing means during
activation; and c) means for maintaining the temperature of the
sample vessels within a desired temperature range during
activation.
[0040] In still another embodiment, the photoactivation device for
treating photoreactive compounds, comprises: a) a fluorescent
source of ultraviolet radiation having wavelengths capable of
causing activation of at least one photoreactive compound; b) means
for supporting a plurality of sample vessels in a fixed
relationship with the fluorescent radiation source during
activation; and c) means for maintaining the temperature of the
sample vessels within a desired temperature range during
activation.
[0041] In still another embodiment, the photoactivation device for
treating photoreactive compounds, comprises: a) a fluorescent
source of ultraviolet radiation having wavelengths capable of
causing activation of at least one photoreactive compound; b) means
for supporting a plurality of sample vessels positioned with
respect to the fluorescent source, so that, when measured for the
wavelengths between 300 and 400 nanometers, an intensity flux
greater than 15 mW cm.sup.-2 is provided to the sample vessels; and
c) means for maintaining the temperature of the sample vessels
within a desired temperature range during activation.
[0042] In still another embodiment, the photoactivation device for
treating photoreactive compounds comprises: a) means for
continuously flowing sample liquid containing photoreactive
compound; and b) means for providing appropriate wavelengths of
electromagnetic radiation in a fixed relationship with said
continuous flowing means to cause activation of at least one
photoreactive compound. In one embodiment, the continuous flow
photoactivation device further comprises means for maintaining the
temperature of the continuously flowing sample liquid within a
desired temperature range during activation. In another embodiment,
the continuous flow photoactivation further comprises means for
containing the radiation providing means, such that a user is
shielded from wavelengths of electromagnetic radiation. The
radiation containing means, in one embodiment, comprises an opaque
housing surrounding the radiation providing means. In one
embodiment, the continuous flowing means comprises a chamber
interior to the housing and positioned in a fixed relationship to
the radiation providing means. The continuous flow photoactivation
device chamber, in one embodiment, has inlet and outlet ports so
that sample liquid may enter and exit.
[0043] The present invention also contemplates a method for
photoactivating photoreactive compounds, comprising: a) supporting
a plurality of sample vessels, containing one or more photoreactive
compounds, in a fixed relationship with a fluorescent source of
electromagnetic radiation; b) irradiating the sample vessels
simultaneously with electromagnetic radiation to cause activation
of at least one photoreactive compound; and c) maintaining the
temperature of sample vessels within a desired temperature range
during activation.
DESCRIPTION OF THE DRAWINGS
[0044] FIG. 1 sets forth a compound synthesis scheme of the present
invention where the starting material is 5-methylresorcinol.
[0045] FIG. 2 sets forth a compound synthesis scheme of the present
invention where the starting material is resorcinol.
[0046] FIG. 3 schematically shows the steps involved in screening
activation compounds for sterilizing compounds.
[0047] FIG. 4 schematically shows the steps involved in amplifying
nucleic acid according to one particular amplification system.
[0048] FIG. 5 schematically shows a manner of determining compound
solubility.
[0049] FIG. 6 is a perspective view of an embodiment (CE-I) of the
photoactivation device of the present invention.
[0050] FIG. 7 is a cross-sectional view of CE-I along lines a--a of
FIG. 6.
[0051] FIG. 8 is a cross-sectional view of CE-I along lines b--b of
FIG. 6.
[0052] FIG. 9 is a perspective view of an alternative embodiment
(CE-II) of the photoactivation device of the present invention.
[0053] FIG. 10 is a cross-sectional view of CE-II along lines c--c
of FIG. 9.
[0054] FIG. 11 is a perspective view of yet another alternative
embodiment (CE-III) of the photoactivation device of the present
invention.
[0055] FIG. 12 is a cross-sectional view of CE-III along lines d--d
of FIG. 11.
[0056] FIG. 13 is a cross-sectional view of CE-III along lines e--e
of FIG. 11.
[0057] FIG. 14 is a perspective view of a removable sample tray for
processing large numbers of samples.
[0058] FIG. 15 shows the impact of irradiation time on temperature
of the sample.
[0059] FIG. 16 shows the relative energy output of the alternative
embodiments of the device of the present invention.
[0060] FIG. 17 is a flow chart schematically showing a manner of
measuring binding.
[0061] FIG. 18 shows covalent binding according to particular
embodiment of the photoactivation device of the present
invention.
[0062] FIG. 19 shows the intensity of the light of one embodiment
of the device of the present invention according to sample
position.
[0063] FIG. 20 shows covalent binding according to sample
position.
[0064] FIG. 21 shows schematically a manner of measuring production
of photoproduct.
[0065] FIG. 22 shows the production of photoproduct over time.
[0066] FIG. 23 show production of photoproduct according to the
embodiment of the photoactivation device of the present
invention.
[0067] FIG. 24 show production of photoproduct from a novel
compound of the present invention.
[0068] FIG. 25 shows binding as a function of concentration.
[0069] FIG. 26 shows the oligonucleotide system used for the
synthesis and extension of 71-mers containing a single
monoadduct.
[0070] FIG. 27 shows a manner of synthesizing monoadducted
templates.
[0071] FIG. 28 shows a manner of measuring primer extension.
[0072] FIG. 29 is an autoradiograph after gel electrophoresis,
showing polymerase inhibition results with MIP.
[0073] FIG. 30 is an autoradiograph after gel electrophoresis,
showing polymerase inhibition results with AMIP.
[0074] FIG. 31 is an autoradiograph after gel electrophoresis,
showing polymerase inhibition results with AMDMIP.
[0075] FIG. 32 is an autoradiograph after gel electrophoresis,
showing Taq polymerase inhibition results with AMIP, AMDMIP, and
MIP 71-mer monoadducts.
[0076] FIG. 33 is an autoradiograph after gel electrophoresis,
showing Taq polymerase inhibition results with AMIP, AMDMIP, and
MIP 71-mer monoadducts after repeated cycles.
[0077] FIG. 34 is an autoradiograph after gel electrophoresis,
showing inhibition results of HPLC-repurified 5-MIP monoadduct.
[0078] FIG. 35 is an autoradiograph after gel electrophoresis,
showing Tag polymerase inhibition results with an HMT 71-mer
monoadduct.
[0079] FIG. 36 shows the oligonucleotide system for amplification
and subsequent detection of HIV DNA.
[0080] FIG. 37 is an autoradiograph after gel electrophoresis,
showing sterilization of PCR with photoproduct.
[0081] FIG. 38 is a plot of counts (CPM) from bands cut after gel
electrophoresis, showing sterilization of PCR according to
concentration of photoproduct.
[0082] FIGS. 39 is an autoradiograph after gel electrophoresis,
showing sterilization of PCR according to the photoactivation
device used.
[0083] FIG. 40 shows schematically a manner of measuring PCR
sterilization according to cycle number.
[0084] FIG. 41 is an autoradiograph after gel electrophoresis, PCR
sterilization according to cycle number.
[0085] FIG. 42 shows schematically a preferred manner of measuring
PCR sterilization.
[0086] FIG. 43 is an autoradiograph after gel electrophoresis,
showing a PCR sterilization.
[0087] FIG. 44 shows plotted counts of PCR product bands that were
visualized by autoradiography, cut, and counted in a liquid
scintillation counter, illustrating the effect of modification
density and target length on sterilization.
[0088] FIG. 45 shows schematically two different hybridization
formats: 1) Oligonucleotide Hybridization (OH) and 2) Crosslinkable
Oligonucleotide Probe Analysis (COP).
[0089] FIG. 46 is an autoradiograph after gel electrophoresis,
showing hybridization after sterilization by Crosslinkable
Oligonucleotide Probe Analysis (COP).
[0090] FIG. 47 is an autoradiograph after gel electrophoresis,
showing hybridization after sterilization by Oligonucleotide
Hybridization (OH).
[0091] FIG. 48 is an autoradiograph after gel electrophoresis,
showing PCR sterilization of an HLA DNA system.
[0092] FIG. 49 is an autoradiograph after gel electrophoresis,
showing inhibition of PCR with non-furocoumarin compounds.
DESCRIPTION OF THE INVENTION
[0093] The present invention relates to a device and method for
photoactivating new and known compounds.
[0094] The description of the invention is divided into I) Compound
Synthesis, II) Photoactivation Devices and Methods, III) Binding of
Compounds to Nucleic Acid, IV) Capture of Nucleic Acid, V)
Inhibiting Template-Dependent Enzymatic Synthesis, and VI)
Sterilization.
[0095] I. Compound Synthesis
[0096] "Activation compounds" defines a family of compounds that
undergo chemical change in response to triggering stimuli.
Triggering stimuli include, but are not limited to, thermal
stimuli, chemical stimuli and electromagnetic stimuli.
"Photoreactive, activation compounds" (or simply "photoreactive
compounds"), defines a genus of compounds in the activation
compound family that undergo chemical change in response to
electromagnetic radiation (Table 1). One species of photoreactive
compounds
1TABLE 1 Photoreactive Compounds Actinomycins Anthracyclinones
Anthramycin Benzodipyrones Fluorenes and fluorenones Furocoumarins
Mitomycin Monostral Fast Blue Norphillin A Organic dyes
Phenanthridines Phenazathionium Salts Phenazines Phenothiazines
Phenylazides Polycyclic hydrocarbons Quinolines Thiaxanthenones
[0097] described herein is commonly referred to as the
furocoumarins. The furocoumarins belong to two main categories: 1)
psoralens [7H-furo(3,2-g)-(1)-benzopyran-7-one, or .delta.-lactone
of 6-hydroxy-5-benzofuranacrylic acid], which are linear: 1
[0098] and in which the two oxygen residues appended to the central
aromatic moiety have a 1, 3 orientation, and further in which the
furan ring moiety is linked to the 6 position of the two ring
coumarin system, and 2) the isopsoralens
[2H-furo(2,3-h)-(1)-benzopyran-2-one, or .delta.-lactone of
4-hydroxy-5-benzofuranacrylic acid], which are angular: 2
[0099] in which the two oxygen residues appended to the central
aromatic moiety have a 1, 3 orientation, and further in which the
furan ring moiety is linked to the 8 position of the two ring
coumarin system. Psoralen derivatives are derived from substitution
of the linear furocoumarin at the 3, 4, 5, 8, 4', or 5' positions,
while isopsoralen derivatives are derived from substitution of the
angular furocoumarin at the 3, 4, 5, 6, 4', or 5 positions.
[0100] Tables 2 and 3 set forth the nomenclature used for the
furocoumarin derivatives discussed herein. FIGS. 1 and 2 set forth
the overall scheme for the synthesis of the furocoumarin
derivatives of the present invention.
[0101] The present invention contemplates labelled and unlabelled
furocoumarin derivatives. FIGS. 1 and 2 set forth how each
furocoumarin derivative may be labelled. Where both an unlabelled
and radiolabelled version of a compound may be synthesized by
methods of the present invention, the radiolabel is indicated in
parentheses.
[0102] If labelled, the compounds will have at least one label
attached or integrated into its structure. Labels are generally
intended to facilitate i) the detection of the inhibiting
compounds, as well as ii) the detection of molecules bound to the
inhibiting compounds (e.g. nucleic acid). Labels are chosen from
the group consisting of enzymes, fluorophores, high-affinity
conjugates, chemiphores and radioactive atoms ("radiolabels").
While others may be used, 1) enzymes contemplated include alkaline
phosphatase, .beta.-galactosidase and glucose oxidase, 2) an
affinity conjugate system contemplated is the biotin-avidin system,
3) fluorescein is contemplated as a fluorophore, 4) luminol is
contemplated as chemiphore, and 4) the preferred radiolabels
contemplated by the present invention include .sup.3H and
.sup.14C.
[0103] It is not intended that the present invention be limited by
the nature of the label used. The present invention contemplates
single labelling (e.g. a radiolabel, a fluorophore, etc.) and
double labelling
2TABLE 2 Furocoumarin Derivatives (MIP Series) # Compound Abbrev. 1
7-Hydroxy-5-methylcoumarin H5MC 2
7-(2,2-diethoxyethyloxy)-5-methylcoumarin DEKC 3
5-Methylisopsoralen KIP 4 [4',5'-H.sub.2]-4',5'-dihydro-5-methyl-
DHMIP isopsoralen 5 5-Halomethylisopsoralen XMIP
5-Bromomethylisopsoralen BMIP 5-Chloromethylisopsoralen CKIP 6
5-Hydroxymethylisopsoralen HKIP 7 5-Formylisopsoralen FIP 8
5-Iodomethyl isopsoralen IKIP 9 5-Hexamethylenetetraminomethyl-
isopsoralen HKTAKIP 10 5-Aminomethylisopsoralen AKIP 11
5-N-(N,N'-Dimethyl-1,6-hexanediamine)- DMHMIP methyl-isopsoralen
12a 5-N-[N,N'-Dimethyl-(6-[biotinamido]- BIOMIP
hexanoate)-1,6-hexanediamine])- methyl-isopsoralen 12b
5-N-[N,N'-dimethyl-N'-(2-{biotinamido}- DITHIOMIP
ethyl-1,3-dithiopropionate)-1,6- hexanediamine]- methyl-isopsoralen
12c 5-N-[N,N'-dimethyl-N'- (carboxyfluorescein FLUORMIP
ester)-1,6-hexanediamine)- methyl-isopsoralen
[0104]
3TABLE 3 Furocoumarin Derivatives (DMIP Series) 13
7-Hydroxy-4-methylcoumarin H4MC 14
7-(.beta.-haloallyloxy)-4-methylcoumarin XAMC
7-(.beta.-chloroallyloxy)-4-methylcoumarin CAMC 15
7-Allyloxy-6-(.beta.-haloallyl)- RXAMC 4-methylcoumarin
7-Butyroxy-6-(.beta.-chloroallyl)- BCAMC 4-methylcoumarin 16
4,5'-Dimethylisopsoralen DMIP 17 [4',5'-.sup.3H.sub.2]-4',5'-di-
hydro-4,5'- DHDMIP dimethylisopsoralen 18
4'-Halomethyl-4,5'-dimethylisopsoralen XMDMIP
4'-Chloromethyl-4,5'-dimethylisopsoralen CMDMIP
4'-Bromomethyl-4,5'-dimethylisopsoralen BMDKIP 19
4'-Hydroxymethyl-4,5'-dimethylisopsoralen HKDMIP 20
4'-Formyl-4,5'-dimethylisopsoralen FDMIP 21
4'-Phthalimidomethyl-4,5'- PHIMDMIP dimethylisopsoralen 22
4'-Aminomethyl-4,5'-dimethylisopsoralen AMDMIP 23
4'-Iodomethyl-4,5'-dimethylisopsoralen IMDMIP 24
4'-N-(N,N'-dimethyl-1,6-hexanediamine)- HDAMDMIP
methyl-4,5'-dimethylisopsoralen 25a 4'-N-[N,N'-dimethyl-N'-(6-{bio-
tinamido}- BIODMIP hexanoate)-1,6-hexanediamine]-
methyl-4,5'-dimethylisopsoralen 25b 4'-N-[N,N'-dimethyl-N'-(2-{bio-
tinamido}- DITHIODMIP ethyl-1,3-dithiopropionate)-1,6-
hexanediamine]-methyl-4,5'- dimethylisopsoralen 25c
4'-N-[N,N'-dimethyl-N'-(6-carboxyfluorescein FLUORDMIP
ester)-1,6-hexanediamine)-methyl- 4,5'-dimethylisopsoralen
[0105] (e.g. two radiolabels, a radiolabel and a fluorphore,
etc.)
[0106] While not limited to any particular label, a preferred label
of the present invention for facilitating the detection of
compounds is tritium (.sup.3H). A preferred label of the present
invention for facilitating the detection of molecules bound to the
compounds is biotin. While FIGS. 1 and 2 have been drafted to show
these preferred labels (as well as some other labels), it is not
intended thereby to limit the present invention.
[0107] As shown in FIGS. 1 and 2, the synthesis pathway for the
compounds of the present invention involves starting with: 3
[0108] where R is either --CH.sub.3 or --H, respectively.
[0109] Where R is --CH.sub.3 (FIG. 1; Table 2), the starting
compound is 5-methylresorcinol. Where R is --H (FIG. 2; Table 3),
the starting compound is resorcinol. Accordingly, the description
of the compound synthesis methods of the present invention proceeds
in two parts.
[0110] A. Part One: R Equals --CH.sub.3
[0111] Where R is --CH.sub.3 (FIG. 1; Table 2), the synthesis
proceeds via one of two new synthesis methods to MIP (Compound #3),
a known compound. One of these novel synthesis methods for MIP
proceeds via new compound DEMC (Compound #2).
[0112] After MIP is formed, the synthesis can continue on to create
i) new compounds XMIP (Compound #5), HMIP (Compound #6), FMIP
(Compound #7), IMIP (Compound #8), HMTAMIP (Compound #9), AMIP
(Compound #10), DMHMIP (Compound #11), BIOMIP (Compound #12a),
DITHIOMIP (Compound 12b), and/or FLUORMIP (Compound 12c), or ii)
radiolabelled compounds. (In FIG. 1, radiolabels are indicated in
parathesis where the compound can be synthesised unlabelled as well
as labelled.) In addition to the tritiated compounds indicated in
FIG. 1, the analogous .sup.14C derivatives may be prepared .sup.14C
labelled 5-methylresorcinol.
[0113] All methods for synthesizing new compounds AMIP, BIOMIP,
DITHIOMIP and FLUORMIP proceed via new compound intermediate XMIP.
XMIP is defined as either CMIP or BMIP. Some methods for
synthesizing IMIP, BIOMIP, DITHIOMIP and FLUORMIP proceed from XMIP
through new compound IMIP (Compound #8).
[0114] The synthesis methods of the present invention where R
equals --CH.sub.3 begins with novel synthesis methods for MIP.
[0115] 1) MIP Synthesis
[0116] The invention contemplates novel approaches to the synthesis
of MIP and/or labelled MIP prior to the synthesis of novel MIP
derivatives.
[0117] Two new methods are provided for the synthesis of MIP (FIG.
1). The first step of the first method for MIP synthesis involves a
reaction of 5-methylresorcinol with malic acid to yield H5MC
(Compound #1). The second step of the first method involves a
reaction of H5MC with a haloacetaldehyde diethylacetal to yield the
diethoxyethylether of H5MC, DEMC (Compound #2). The
haloacetaldehyde diethylacetal can be chloro-, iodo- or
bromo-acetaldehyde diethylacetal. In the third step of the first
method, DEMC is treated to close the ring to yield the two isomers,
5-methylpsoralen and MIP, which are separated to isolate pure MIP
(Compound #3).
[0118] The first step of the second method for MIP synthesis is
identical to the first step of the first method. The second step of
the second method, however, involves the synthesis of MIP directly
from H5MC (i.e., compound #2 to #3) via a haloethylene
carbonate.
[0119] 1') Radiolabelled MIP Synthesis
[0120] Methods are provided for the synthesis of radiolabelled MIP
(FIG. 1). These methods build on the two methods of MIP synthesis
with additional known steps: 1) catalytic hydrogenation of the
4',5' (furan-side) double bond using tritium gas to provide the
tritiated compound, DHMIP, followed by 2) catalytic reoxidation of
this bond with a hydrogen donor to yield the tritiated MIP
(.sup.3H-MIP). S. Isaacs et al., Nat. Cancer Inst. Monograph No. 66
(1985). Alternatively, the reaction can be continued until
catalytic hydrogenation of the 3,4 (pyrone-side) double bond
resulting in the formation of the
3,4,4',5'-tetrahydro-[.sup.3H.sub.4]-5-methylisopsoralen (THMIP).
THMIP has the advantage of allowing for compounds of higher
specific activity and the disadvantage of poor yield relative to
DHMIP (for convenience only DHMIP is shown in FIG. 1).
[0121] The present invention contemplates that the catalyst is
selected from the group consisting of palladium on charcoal,
palladium on barium sulfate, Adams catalyst
[(NH.sub.4).sub.2PtCl.sub.6], PtO.sub.2, rhoduim, ruthenium, copper
chromite and Raney nickel. The present invention contemplates that
the hydrogen donor in the reoxidation step is selected from the
group consisting of diphenylether and cyclohexene.
[0122] 2) XMIP Synthesis
[0123] As noted above, all methods for synthesizing new compounds
AMIP, BIOMIP, DITHIOMIP and FLUORMIP proceed via new compound XMIP
as an intermediate. XMIP is defined a halomethylisopsoralen
selected from the group consisting of bromomethylisopsoralen (BMIP)
and chloromethylisopsoralen (CMIP).
[0124] The synthesis method of XMIP of the present invention is a
free radical halogenation of MIP with an N-halosuccinimide and a
peroxide initiator. The preferred N-halosuccinimide is
N-bromosuccinimide but the present invention contemplates the use
of N-chlorosuccinimide as well.
[0125] 2') Radiolabelled XMIP Synthesis
[0126] The present invention contemplates radiolabelled XMIP.
Methods are provided for the synthesis of radiolabelled XMIP (FIG.
1). In one embodiment, the method builds on the methods of
synthesizing radiolabelled MIP (e.g. #3 to #4*, #4* to #3*, and #3*
to #5*, where * indicates a radiolabelled compound). In another
embodiment, the methods proceed via new compounds HMIP and FMIP
(e.g. #5 to #6, #6 to #7, #7 to #6*, and #6* to #5*, where *
indicates a radiolabelled compound). Combining the radiolabelling
steps for MIP with the HMIP/FMIP radiolabelling method provides for
double-radiolabelling of XMIP (e.g., #3 to #4*, #4* to #3*, and #3*
to #5*, #5* to #6*, #6* to #7*, #7* to #6**, and #6** to #5**,
where ** indicates a double-radiolabelled compound).
[0127] 3) AMIP Synthesis
[0128] As shown in FIG. 1, four alternative synthesis methods are
provided when proceeding via new compound intermediate XMIP as
starting material to new compound AMIP. One method proceeds in four
steps from XMIP to new compound AMIP via new compound intermediate
HMIP (i.e., compound #5 to #6, #6 to #5, #5 to #9, and #9 to #10).
Another method proceeds in five steps from XMIP to new compound
AMIP via new compound intermediates HMIP and IMIP (i.e., #5 to #6,
#6 to #5, #5 to #8, #8 to #9, and #9 to #10) Still another proceeds
in two steps from XMIP to new compound AMIP (i.e, compound #5 to
#9, and #9 to #10). Still another proceeds in three steps from XMIP
to new compound AMIP via new compound IMIP (i.e., #5 to #8, #8 to
#9, #9 to #10).
[0129] Methods one and two allow the synthesis to be interrupted at
new compound intermediate HMIP, which is stable and can be stored
indefinitely without decomposition. The third method (the preferred
method) proceeds in two steps from XMIP to new compound AMIP. While
this third method offers the most direct route to new compound
AMIP, it is inappropriate if stopping the synthesis sequence prior
to completion is anticipated. This follows from the hydrolytic
instability of XMIP, which must be maintained in a strictly inert
environment to prevent hydrolytic decomposition. Again, XMIP is
selected from the group bromomethylisopsoralen (BNIP) and
chloromethylisopsoralen (CMIP) (instability increases in the order
BMIP>CMIP).
[0130] In the four step method and the five step method, XMIP may
be the same halomethylisopsoralen or may be a different
isopsoralen. (In general, the reactivity of XMIP will increase as X
is changed from chloro to bromo; a significant advantage of higher
reactivity is correspondingly shorter reaction times for
conversions such as XMIP.fwdarw.HMIP.)
[0131] In the fourth method for synthesizing AMIP, the synthesis
proceeds via IMIP. In this regard, it is known that benzyl iodides
are more reactive than the corresponding bromides or chlorides,
which follows from the relative ability of each halide to act as a
leaving group in an S.sub.N2 (second order, nucleophilic
displacement) reaction. Accordingly, to take advantage of the
resulting high reactivity and corresponding short reaction times
provided by the benzyl iodide analog, the new compound IMIP is
prepared in the method of the present invention via the Finkelstein
reaction.
[0132] When combined with the two methods for producing MIP, the
present invention provides eight methods for synthesizing AMIP from
5-methylresorcinol:
4 I #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #9, and
#9 to #10. II #1 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #9, and
#9 to #10. III #1 to #2, #2 to #3, #3 to #5, #5 to #9, and #9 to
#10. IV #1 to #3, #3 to #5, #5 to #9, and #9 to #10 V #1 to #2, #2
to #3, #3 to #5, #5 to #8, #8 to #9, and #9 to #10. VI #1 to #3, #3
to #5, #5 to #8, #8 to #9, and #9 to #10. VII #1 to #2, #2 to #3,
#3 to #5, #5 to #6, #6 to #5, #5 to #8, #8 to #9, and #9 to #10.
VIII #1 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #6, #8 to #9,
and #9 to #10.
[0133] 3') Radiolabelled AMIP Synthesis
[0134] FIG. 1 also shows two methods provided for proceeding via
new compound intermediate XMIP as starting material to new
compound, radiolabelled AMIP. Both of the methods proceeding via
new compound intermediate XMIP as starting material to new
compound, radiolabelled AMIP, proceed via HMIP and new compound
FMIP. One method is a six step method (i.e., compound #5 to #6, #6
to #7, #7 to #6*, #6* to #5*, #5* to #9*, and #9* to #10*); the
other is a seven step method (i.e., compound #5 to #6, #6 to #7, #7
to #6*, #6* to #5*, #5* to #8*, #8* to #9*, and #9* to #10*).
[0135] When combined with the two methods for producing MIP, the
present invention provides two additional methods (for a total of
four methods) for synthesizing radiolabelled AMIP from
5-methyl-resorcinol; when combined with the two methods for
producing radiolabelled MIP, the present invention provides eight
additional methods for producing radiolabelled AMIP for a total of
twelve methods:
5 I #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to
#6*, #6* to #5*, #5* to #9*, and #9* to #10*. II #1 to #3, #3 to
#4*, #4* to #3*, #3* to #5*, #5* to #6*, #6* to #5*, #5* to #9*,
#9* to #10*. III #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to
#5*, #5* to #6*, #6* to #5*, #5* to #8*, #8* to #9*, and #9* to
#10*. IV #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #6*,
#6* to #5*, #5* to #8*, #8* to #9*, and #9* to #10*. V #1 to #2, #2
to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #9*, and #9* to
#10*. VI #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #9*,
and #9* to #10*. VII #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3*
to #5*, #5* to #8*, #8* to #9*, and and #9* to #10*. VIII #1 to #3,
#3 to #4*, #4* to #3*, #3* to #5*, #5* to #8*, #8* to #9*, and #9*
to #10*. IX #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #7*, #7*
to #6*, #6* to #5*, #5* to #9*, and #9* to #10*. X #1 to #3, #3 to
#5, #5 to #6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #9*, and
#9* to #10*. XI #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #7*,
#7* to #6*, #6* to #5*, #5* to #8*, #8* to #9*, and #9* to #10*.
XII #1 to #3, #3 to #5, #5 to #6, #6 to #7*, #7* to #6*, #6* to
#5*, #5* to #8*, #8* to #9*, and #9* to #10*. where * indicates a
labelled compound. Methods V, VI, IX and X are preferred.
[0136] The present invention also contemplates double-labelling. In
one embodiment, the double-labelling method of the present
invention involves the combination of the labelling steps for MIP
(Compound #3 to Compound #4) and the labelling steps for AMIP.
Where the label is a radiolabel, this provides, among other
advantages, the advantage of increasing the specific activity of
the compounds of the present invention. The present invention
contemplates the following double-radiolabelling methods (where **
indicates a double-labelled compound):
6 I #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to
#6*, #6* to #7*, #7* to #6**, #6** to #5**, #5** to #9**, and #9**
to #10**. II #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to
#6*, #6* to #7*, #7* to #6**, #6** to #5**, #5** to #9**, and #9**
to #10**. III #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to
#5*, #5* to #6*, #6* to #7*, #7* to #6**, #6** to #5**, #5** to
#8**, #8** to #9**, and #9** to #10**. IV #1 to #3, #3 to #4*, #4*
to #3*, #3* to #5*, #5* to #6*, #6* to #7*, #7* to #6**, #6** to
#5**, #5** to #8**, #8** to #9**, and #9** to #10**.
[0137] Methods I and II are preferred.
[0138] 4) BIOMIP, DITHIOMIP and FLUORMIP Synthesis
[0139] The BIO-, DITHIO- and FLUOR-derivatives of MIP of the
present invention (compounds # 12a, 12b, and 12c, respectively) can
each be generally described as a three part compound consisting of
the following three units:
[0140] MIP--space--label
[0141] The spacer contemplated by the present invention has the
general formula R.sub.1HN--(CH.sub.2).sub.n--NHR.sub.2. In general,
R.sub.1=--H, --CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7 or
--C.sub.4H.sub.9, R.sub.2=--H or --CH.sub.3, --C.sub.2H.sub.5,
--C.sub.3H.sub.7 or --C.sub.4H.sub.9, and n is between 6 and 16,
inclusive. It is contemplated that, where the BIOMIP compound is
bound to another molecule (e.g. nucleic acid), sufficient length is
provided for the biotin moiety to span the distance between the
site of attachment to another molecule and the avidin binding site
when n.gtoreq.6. Since the biotin binding site is reported to be 9
.ANG. below the surface of the avidin molecule [Green et al.,
Biochem. J. 125:781 (1971)], shorter spacers [see e.g. J. P.
Albarella et al., Nucleic Acids Res. 17:4293 (1983)] may hinder the
formation of the biotin-avidin complex. Adequate chain length helps
reduce steric hinderance associated with the avidin-biotin
interaction, and accordingly, the stability of the avidin-biotin
complex should increase when the appropriate chain length is
employed.
[0142] Chemical (synthetic) considerations come into play when
considering the preferred spacer for the BIO-, DITHIO- and
FLUOR-derivatives of MIP. While for spacer
R.sub.1HN--(CH.sub.2).sub.n--NHR.sub.2, R.sub.1 can be --H,
--CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7 or --C.sub.4H.sub.9,
and R.sub.2 can be --H, --CH.sub.3, C.sub.2H.sub.5, C.sub.3H.sub.7
or C.sub.4H.sub.9, most preferably R.sub.1 and R.sub.2 are both
--CH.sub.3, C.sub.2H.sub.5, --C.sub.3H.sub.7 or C.sub.4H.sub.9.
While not limited to any particular theory, in the reaction to
prepare DMHMIP from XMIP (or IMIP) where R.sub.1 and R.sub.2 are
both --CH.sub.3, the spacer nitrogens can react at either nitrogen
with only one or two equivalents of XMIP (or IMIP).
[0143] So that the desired mono-N-substituted product (i.e. DMHMIP)
is favored, the present invention contemplates that a high ratio of
spacer to XMIP (or IMIP) is employed in the reaction. Nonetheless,
even where 1) R.sub.1 and R.sub.2 are both --CH.sub.3,
--C.sub.2H.sub.5, --C.sub.3H.sub.7 or --C.sub.4H.sub.9, and 2) a
high ratio of spacer to XMIP (or IMIP) is employed, the present
invention contemplates side products from the reaction of more than
one XMIP (or IMIP) with the spacer. These side products include one
di-N,N-substituted product (i.e. two isopsoralens at the same
nitrogen on the spacer), one di-N,N'-substituted product (i.e. two
isopsoralens at each of the spacer nitrogens), one
tri-N,N,N'-substituted product and one tetra-N,N,N',N'-substituted
product.
[0144] As noted, the present invention does contemplate the case
where R.sub.1 and R.sub.2 are --H. While this spacer can be used,
the number of possible multi-substituted spacer side products is
increased, making subsequent purification of the desired
mono-N-substituted product (i.e. DMHMIP) more difficult.
[0145] The label on the BIO-, DITHIO- and FLUOR-derivatives of MIP
of the present invention is comprised of two elements: 1) the
reporter moiety, and 2) the linking arm which binds the reporter
moiety to the spacer. Two types of reporter moieties are shown in
FIG. 1. The first, biotin, is an indirect reporter moiety, as it
functions to bind avidin, which in turn is attached to the signal
generating system (e.g., BluGENE; BRL). The second, fluorescein, is
a direct reporter moiety which provides a highly fluorescent signal
upon excitation with appropriate wavelengths of light. Both biotin
and fluorescein are appended to the spacer via an amide bond, with
zero to seven bridging atoms making up the linking arm between the
spacer amido carbonyl and the reporter moiety. In some cases (e.g.
DITHIOMIP), the linking arm may contain a disulfide linkage, which
is useful for subsequent cleavage of the reporter moiety from the
isopsoralen.
[0146] The reaction to form the amide bond between the spacer
nitrogen and the label carbonyl uses an activated ester, preferably
the N-hydroxy-succinimide ester. Other active esters, however, are
contemplated, such as the imidazolides (from N,
N'-carbonyldiimidizoles) and the sulfosuccinimidyl esters.
[0147] a) BIOMIP Synthesis
[0148] As shown in FIG. 1, the present invention contemplates four
alternative synthesis methods for proceeding via new compound
intermediate XMIP to new compound BIOMIP (Compound #12a). Two of
the four methods proceed via HMIP; one proceeds from HMIP via IMIP
(i.e., #5 to #6, #6 to #5, #5 to #8, #8 to #11, and #11 to #12a)
and one proceeds from HMIP via DMHMIP (i.e., #5 to #6, #6 to #5, #5
to #11, and #11 to #12a). The other two methods proceed directly
from XMIP (i.e. without HMIP); one proceeds from XMIP via IMIP
(i.e., #5 to #8, #8 to #11, and #11 to #12a) and one proceeds from
XMIP via DMHMIP (i.e., #5 to #11, and #11 to #12a). The latter is
preferred.
[0149] As discussed above for the synthesis of AMIP, the routes via
HMIP offer the advantage of allowing for interruptions in the
synthesis (often necessary in a production facility) because of the
stability of HMIP. The XMIP route is more direct, however, and
should be used where continued synthesis is possible.
[0150] When combined with the two methods for synthesizing MIP, the
present invention provides eight methods for synthesizing BIOMIP
(methods III and IV are preferred):
7 I #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #11,
and #11 to #12a. II #1 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to
#11, and #11 to #12a. III #1 to #2, #2 to #3, #3 to #5, #5 to #11,
and #11 to #12a. IV #1 to #3, #3 to #5, #5 to #11, and #11 to #12a.
V #1 to #2, #2 to #3, #3 to #5, #5 to #8, #8 to #11, and #11 to
#12a. VI #1 to #3, #3 to #5, #5 to #8, #8 to #11, and #11 to #12a.
VII #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #8, #8
to #11, and #11 to #12a. VIII #1 to #3, #3 to #5, #5 to #6, #6 to
#5, #5 to #8, #8 to #11, and #11 to #l2a.
[0151] a') Radiolabelled BIOMIP Synthesis
[0152] The present invention further contemplates synthesis methods
for proceeding via new compound intermediate XMIP to radiolabelled
BIOMIP. Both methods involve synthesis of HMIP and labelled HMIP.
One proceeds via IMIP (i.e., #5 to #6, #6 to #7, #7 to #6*, #6* to
#5*, #5* to #8*, #8* to #11*, and #11* to #12a*) and one proceeds
directly via DMHMIP (i.e., #5 to #6, #6 to #7, #7 to #6*, #6* to
#5*, #5* to #11*, and #11* to #12a*).
[0153] When combined with the two methods to produce MIP and two
methods to produce labelled MIP, the present invention provides
twelve methods for synthesizing radiolabelled BIOMIP (methods V,
VI, IX and X are preferred):
8 I #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to
#6*, #6* to #5*, #5* to #11*, and #11* to #12a*. II #1 to #3, #3 to
#4*, #4* to #3*, #3* to #5*, #5* to #6*, #6* to #5*, #5* to #11*,
and #11* to #12a*. III #1 to #2, #2 to #3, #3 to #4*, #4* to #3*,
#3* to #5*, #5* to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and
#11* to #12a*. IV #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5*
to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and #11* to #12a*. V
#1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #11*,
and #11* to #12a*. VI #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*,
#5* to #11*, and #11* to #12a*. VII #1 to #2, #2 to #3, #3 to #4*,
#4* to #3*, #3* to #5*, #5* to #8*, #8* to #11*, and #11* to #12a*.
VIII #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #8*, #8*
to #11*, and #11* to #12a*. IX #1 to #2, #2 to #3, #3 to #5, #5 to
#6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #11*, and #11* to
#12a*. X #1 to #3, #3 to #5, #5 to #6, #6 to #7*, #7* to #6*, #6*
to #5*, #5* to #11*, and #11* to #12a*. XI #1 to #2, #2 to #3, #3
to #5, #5 to #6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #8*, #8*
to #11*, and #11* to #12a*. XII #1 to #3, #3 to #5, #5 to #6, #6 to
#7*, #7* to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and #11* to
#12a*.
[0154] These twelve methods of radiolabelling BIOMIP offer one
approach to double-labelling (the compound has both .sup.3H and
biotin). As with labelled AMIP, the present invention also
contemplates double-radiolabelling of BIOMIP (in this case,
however, to create a triple-labelled compound). The
double-radiolabelling method combines the radiolabelling steps for
MIP with the radiolabelling steps for BIOMIP.
[0155] b) DITHIOMIP Synthesis
[0156] As shown in FIG. 1, the present invention contemplates four
alternative synthesis methods for proceeding via new compound
intermediate XMIP to new compound DITHIOMIP (Compound #12b). As
with the synthesis for BIOMIP, two of the four methods proceed via
HMIP; one proceeds from HMIP via IMIP (i.e., #5 to #6, #6 to #5, #5
to #8, #8 to #11, and #11 to #12b) and one proceeds from HMIP via
DMHMIP (i.e., #5 to #6, #6 to #5, #5 to #11, and #11 to #12b). The
other two methods proceed directly from XMIP (i.e. without HMIP);
one proceeds from XMIP via IMIP (i.e., #5 to #8, #8 to #11, and #11
to #12b) and one (the preferred) proceeds from XMIP via DMHMIP
(i.e., #5 to #11, and #11 to #12b). The HMIP route advantages
discussed above must again be balanced with the more direct
routes.
[0157] When combined with the two methods for synthesizing MIP, the
present invention provides eight methods for synthesizing DITHIOMIP
(methods III and IV are preferred):
9 I #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #11,
and #11 to #12b. II #1 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to
#11, and #11 to #12b. III #1 to #2, #2 to #3, #3 to #5, #5 to #11,
and #11 to #12b. IV #1 to #3, #3 to #5, #5 to #11, and #11 to #12b.
V #1 to #2, #2 to #3, #3 to #5, #5 to #8, #8 to #11, and #11 to
#12b. VI #1 to #3, #3 to #5, #5 to #8, #8 to #11, and #11 to #12b.
VII #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #8, #8
to #11, and #11 to #12b. VIII #1 to #3, #3 to #5, #5 to #6, #6 to
#5, #5 to #8, #8 to #11, and #11 to #12b.
[0158] b') Radiolabelled DITHIOMIP Synthesis
[0159] The present invention further contemplates synthesis methods
for proceeding via new compound intermediate XMIP to radiolabelled
DITHIOMIP. Both methods involve synthesis of HMIP and labelled
HMIP. One proceeds via IMIP (i.e., #5 to #6, #6 to #7, #7 to #6*,
#6* to #5*, #5* to #8*, #8* to #11*, and #11* to #12b*) and one
proceeds directly via DMHMIP (i.e., #5 to #6, #6 to #7, #7 to #6*,
#6* to #5*, #5* to #11*, and #11* to #12b*).
[0160] When combined with the two methods to produce MIP and two
methods to produce labelled MIP, the present invention provides
twelve methods for synthesizing radiolabelled DITHIOMIP (methods V,
VI, IX and X are preferred):
10 I #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to
#6*, #6* to #5*, #5* to #11*, and #11* to #12b*. II #1 to #3, #3 to
#4*, #4* to #3*, #3* to #5*, #5* to #6*, #6* to #5*, #5* to #11*,
and #11* to #12b*. III #1 to #2, #2 to #3, #3 to #4*, #4* to #3*,
#3* to #5*, #5* to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and
#11* to #12b*. IV #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5*
to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and #11* to #12b*. V
#1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #11*,
and #11* to #12b*. VI #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*,
#5* to #11*, and #11* to #12b*. VII #1 to #2, #2 to #3, #3 to #4*,
#4* to #3*, #3* to #5*, #5* to #8*, #8* to #11*, and #11* to #12b*.
VIII #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #8*, #8*
to #11*, and #11* to #12b*. IX #1 to #2, #2 to #3, #3 to #5, #5 to
#6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #11*, and #11* to
#12b*. X #1 to #3, #3 to #5, #5 to #6, #6 to #7*, #7* to #6*, #6*
to #5*, #5* to #11*, and #11* to #12b*. XI #1 to #2, #2 to #3, #3
to #5, #5 to #6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #8*, #8*
to #11*, and #11* to #12b*. XII #1 to #3, #3 to #5, #5 to #6, #6 to
#7*, #7* to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and #11* to
#12b*.
[0161] These twelve methods of radiolabelling DITHIOMIP offer one
approach to double-labelling (the compound has both .sup.3H and
cleavable biotin). As with labelled BIOMIP, the present invention
also contemplates double-radiolabelling of DITHIOMIP (creating a
triple-labelled compound). The double-radiolabelling method
combines the radiolabelling steps for MIP with the radiolabelling
steps for DITHIOMIP.
[0162] c) FLUORMIP Synthesis
[0163] As shown in FIG. 1, the present invention contemplates four
alternative synthesis methods for proceeding via new compound
intermediate XMIP to new compound FLUORMIP (Compound #12c). As with
both BIOMIP and DITHIOMIP, two of the four methods proceed via
HMIP; the other two methods proceed directly from XMIP. When
combined with the two methods for synthesizing MIP, the present
invention provides eight methods for synthesizing FLUORMIP (methods
III and IV are preferred):
11 I #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #11,
and #11 to #12c. II #1 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to
#11, and #11 to #12c. III #1 to #2, #2 to #3, #3 to #5, #5 to #11,
and #11 to #12c. IV #1 to #3, #3 to #5, #5 to #11, and #11 to #12c.
V #1 to #2, #2 to #3, #3 to #5, #5 to #8, #8 to #11, and #11 to
#12c. VI #1 to #3, #3 to #5, #5 to #8, #8 to #11, and #11 to #12c.
VII #1 to #2, #2 to #3, #3 to #5, #5 to #6, #6 to #5, #5 to #8, #8
to #11, and #11 to #12c. VIII #1 to #3, #3 to #5, #5 to #6, #6 to
#5, #5 to #8, #8 to #11, and #11 to #12c.
[0164] c') Radiolabelled FLUORMIP Synthesis
[0165] The present invention further contemplates synthesis methods
for proceeding via new compound intermediate XMIP to radiolabelled
FLUORMIP. As with BIOMIP and DITHIOMIP, both methods involve
synthesis of HMIP and labelled HMIP.
[0166] When combined with the two methods to produce MIP and two
methods to produce labelled MIP, the present invention provides
twelve methods for synthesizing radiolabelled FLUORMIP (methods V,
VI, IX and X are preferred):
12 I #1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to
#6*, #6* to #5*, #5* to #11*, and #11* to #12c*. II #1 to #3, #3 to
#4*, #4* to #3*, #3* to #5*, #5* to #6*, #6* to #5*, #5* to #11*,
and #11* to #12c*. III #1 to #2, #2 to #3, #3 to #4*, #4* to #3*,
#3* to #5*, #5* to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and
#11* to #12c*. IV #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5*
to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and #11* to #12c*. V
#1 to #2, #2 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #11*,
and #11* to #12c*. VI #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*,
#5* to #11*, and #11* to #12c*. VII #1 to #2, #2 to #3, #3 to #4*,
#4* to #3*, #3* to #5*, #5* to #8*, #8* to #11*, and #11* to #12c*.
VIII #1 to #3, #3 to #4*, #4* to #3*, #3* to #5*, #5* to #8*, #8*
to #11*, and #11* to #12c*. IX #1 to #2, #2 to #3, #3 to #5, #5 to
#6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #11*, and #11* to
#12c*. X #1 to #3, #3 to #5, #5 to #6, #6 to #7*, #7* to #6*, #6*
to #5*, #5* to #11*, and #11* to #12c*. XI #1 to #2, #2 to #3, #3
to #5, #5 to #6, #6 to #7*, #7* to #6*, #6* to #5*, #5* to #8*, #8*
to #11*, and #11* to #12c*. XII #1 to #3, #3 to #5, #5 to #6, #6 to
#7*, #7* to #6*, #6* to #5*, #5* to #8*, #8* to #11*, and #11* to
#12c*.
[0167] These twelve methods of radiolabelling FLUORMIP offer one
approach to double-labelling (the compound has both .sup.3H and
fluorescein). The present invention also contemplates
double-radiolabelling of FLUORMIP to create a triple-labelled
compound. The double-radiolabelling method combines the
radiolabelling steps for MIP with the radiolabelling steps for
[0168] One important advantage of the synthesis methods of the
present invention for new compounds AMIP, BIOMIP, DITHIOMIP, and
FLUORMIP (and new compound intermediates) as well as the
above-named radiolabelled compounds, is that these synthesis
methods avoid the use of toxic compounds. As discussed below,
preparation of some isopsoralens derivatives requires the use of
chloromethylmethyl ether. This compound is highly volatile,
extremely toxic and a well known carcinogen (OSHA regulated
carcinogen CFR Title 29, Part 1910.1006; L. Bretherick, Hazards in
the Chemical Laboratory, (Royal Society, London 1981) (p.247). Its
use requires special equipment and precautions to avoid exposure of
the worker or release to the environment. The synthesis methods for
providing MIP derivatives of the present invention do not require
this hazardous compound.
[0169] Other advantages of the synthesis methods of the present
invention for the MIP derivatives are i) ease of synthesis (fewer
steps) and ii) superior overall yield. In this regard, the
preparation of the new compounds first requires the synthesis of
MIP, which has been previously reported by Baccichetti et al. U.S.
Pat. 4,312,883. Eur. J. Med. Chem. 16:489 (1981). The methods of
the present invention differ from the methods reported by
Baccichetti in that Baccichetti's two methods include a four step
procedure:
[0170]
5-methylresorcinol.fwdarw.H5MC.fwdarw.7-allyloxy-5-methylcoumarin.f-
wdarw.8-allyl-7-hydroxy-5-methyl-coumarin.fwdarw.MIP and a seven
step procedure:
[0171]
5-methylresorcinol.fwdarw.H5MC.fwdarw.7-allyloxy-5-methylcoumarin.f-
wdarw.8-allyl-7-hydroxy-5-methyl-coumarin.fwdarw.7-acetoxy-8-allyl-5-methy-
lcoumarin.fwdarw.7-acetoxy-8-(2',3'-epoxypropyl)-5-methyl-coumarin.fwdarw.-
8-(7-acetoxy-5-methyl)-coumarinylacetaldehyde.fwdarw.MIP.
[0172] The overall yields of these two methods of Baccichetti are
approximately 3.8% and 2.8%, respectively.
[0173] By contrast, the present invention provides a two and a
three step method for MIP synthesis (see FIG. 1). The overall
yields of these methods of the present invention are approximately
8.4% and 7.1%. Thus, the methods of the present invention for MIP
synthesis involve fewer steps and a better overall yield.
[0174] B. Part Two: R Equals --H
[0175] Where R is --H (FIG. 2; Table 3), the present invention
contemplates a novel synthesis method for DMIP (Compound #16), a
known compound; the method proceeds via new compounds XAMC
(Compound #14) and RXAMC (Compound #15). From DMIP, the synthesis
builds on the novel synthesis to yield known compound AMDMIP
(Compound #22) or proceeds to new compounds HDMADMIP (Compound
#24), BIODMIP (compound #25a), DITHIODMIP (compound #24b),
FLUORDMIP (compound #24c). New methods for radiolabelling compounds
are also shown. In addition to the tritiated compounds indicated in
FIG. 2, the analogous .sup.14C derivatives may be prepared from
labelled 5-methylresorcinol.
[0176] 1) DMIP Synthesis
[0177] The present invention provides a new synthesis method for
DMIP. The approach utilizes a Claisen rearrangement to build the
furan ring. This approach has heretofore only been used for
synthesizing psoralens. See D. R. Bender et al., J. Org. Chem.
44:2176 (1979). D. R. Bender et al., U.S. Pat. No. 4,398, 031.
[0178] Baccichetti et al. have reported the synthesis of DMIP from
7-hydroxy-4-methylcoumarin in five steps. These workers elected to
build the 5'-methylfuran moiety via a five step conversion: 1)
o-alkylation with allyl bromide, 2) Claisen rearrangement to
provide the mixed isomers (6-allyl and 8-allyl), 3) acetylation of
the pheonlic hydroxide, 4) bromination of the allylic bond, and 5)
alkaline ring closure to provide DM1P. They report an overall yield
for the five steps of 7.7%. Eur. J. Med. Chem. (1981).
[0179] The synthesis procedure described in the present invention,
by contrast, requires fewer steps and provides a better yield of
DMIP. DMIP is prepared in three steps: 1) 0-alkylation with a
2,3-dihalo-alkene, 2) Claisen rearrangement to provide the two
allylic isomers (6-allyl and 8-allyl), and 3) ring closure to
provide DMIP. The overall three step yield is 26%.
[0180] The method of the new synthesis improves the prior procedure
as follows. First, an alkyl anhydride is used during the Claisen
rearrangement, which provides the esterified phenol (instead of
esterifying as a separate step). Esterification concomitant with
rearrangement enhances the yield of the rearranged product due to
protection of the phenolate from subsequent undesired high
temperature oxidation. While acetic or proprionic anhydrides may be
used, the higher boiling butyric anhydride is preferred because it
allows the reaction temperature to remain closer to the boiling
point of the solvent (diisopropylbenzene). Second, the present
invention uses a 2,3-dihaloalkene instead of the allyl moiety,
which obviates the requirement for subsequent bromination prior to
the ring closure step. Like the O-allyl moiety, the
O-(2-halo)alkene undergoes Claisen rearrangement primarily to the 8
position of the coumarin, but distinct from the allylic moiety, the
rearranged haloalkene is in fact a masked ketone. Under acidic
conditions, conversion of the haloalkene to the ketone occurs along
with simultaneous acid catalyzed cleavage of the alkylester. The
resulting phenolic ketone subsequently undergoes conversion to the
ring closed compound. A third advantage of the new synthesis is
that alkaline conditions are avoided in all steps, which eliminates
loss of product due to hydrolysis of the coumarin lactone to the
cis cinnimate, which undergoes subsequent (irreversible)
isomerization to the thermodynamically more favored trans
isomer.
[0181] 1') Radiolabelled DMIP
[0182] The present invention also contemplates labelled DMIP. A two
step method is provided: 1) mixing DMIP with a catalyst, acetic
acid and tritium gas to yield the tritiated compound DHDMIP, and 2)
mixing DHDMIP with a catalyst and diphenyl ether to yield tritiated
DMIP (.sup.3H-DMIP).
[0183] The present invention contemplates that the catalyst is
selected from the group consisting of palladium on charcoal,
palladium on barium sulfate, Adams catalyst
[(NH.sub.4).sub.2PtCl.sub.6], PtO.sub.2, rhoduim, ruthenium, copper
chromite and Raney nickel.
[0184] 2) AMDMIP Synthesis
[0185] The present invention contemplates a new approach to the
synthesis of known compound AMDMIP and new compound .sup.3H-AMDMIP.
The approach builds on the novel synthesis method described above
for DMIP. AMDMIP is thereafter made in one of two ways: i) with a
halomethylation step, or ii) without a halo-methylation step.
[0186] a) AMDMIP via Halomethylation
[0187] In one method of the present invention for synthesizing
AMDMIP, DMIP is made by the novel synthesis method described above;
AMDMIP is then made by derivatizing DMIP to provide a halomethyl
derivative followed by hydrazinolysis of the corresponding
phthalimidomethyl derivative (prepared by the Gabriel synthesis)
with hydrazine hydrate according to the method described by F.
Dall'Acqua et al., J. Med. Chem 24:178 (1981).
[0188] Because of the novel synthesis method of the present
invention for DMIP, the approach of the present invention has the
advantage over other methods of synthesizing AMDMIP. For example,
the procedure reported by Baccichetti et al. (U.S. Pat. No.
4,312,883) for the synthesis of AMDMIP relies on a method of DMIP
synthesis that, as discussed above, is less efficient.
[0189] As shown in FIG. 2, the present invention contemplates a
number of variations using the halomethylation step. After XMDMIP
(Compound #18) is synthesized, the synthesis can proceed via HMDMIP
(Compound #19) in two ways:
[0190]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.PHIMDMIP.fwdarw.AMDMIP
[0191] or
[0192] XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.IMDMIP
.fwdarw.PHIMDMIP.fwdarw.AMDMIP.
[0193] On the other hand, the present invention also contemplates
two ways of proceeding to AMDMIP without HMDMIP:
[0194] XMDMIP.fwdarw.PHIMDMIP.fwdarw.AMDMIP
[0195] or
[0196] XMDMIP.fwdarw.IMDMIP.fwdarw.PHIMDMIP.fwdarw.AMDMIP
[0197] As discussed with respect to the hydroxy derivative of MIP,
HMIP, the hydroxy derivative of DMIP, HMDMIP, is stable and can be
stored. This offers the convenience of interrupting the synthesis
scheme. The non-HMDMIP routes, however, are more direct. They are,
therefore, preferred where interruptions in the synthesis scheme
are not anticipated.
[0198] a') Radiolabelled AMDMIP via Halomethylation
[0199] The halomethylation route for the synthesis of AMDMIP can
further be used to synthesize labelled AMDMIP. In one approach of
the present invention, radiolabelled AMDMIP is synthesized via new
compound FDMIP (Compound #20). The present invention contemplates
two methods that are variations of this approach:
[0200]
XMDMIP.fwdarw.HMDMIP.fwdarw.FMDMIP.fwdarw.*HMDMIP.fwdarw.*XMDMIP.fw-
darw.*PHIMDMIP.fwdarw.*AMDMIP
[0201] and
[0202]
XMDMIP.fwdarw.HMDMIP.fwdarw.FMDMIP.fwdarw.*HMDMIP.fwdarw.*XMDMIP.fw-
darw.*IMDMIP.fwdarw.*PHIMDMIP.fwdarw.*AMDMIP
[0203] where (*) indicates a radiolabelled compound.
[0204] Together with the novel radiolabelling method of. the
present invention for DMIP, the present invention provides the
following four (single) radiolabelling methods for AMDMIP (methods
I and III are preferred):
13 I #13 to #14, #14 to #15, #15 to #16, #16 to #17*, #17* to #16*,
#16* to #18*, #18* to #21*, #21* to #22*. II #13 to #14, #14 to
#15, #15 to #16, #16 to #17*, #17* to #16*, #16* to #18*, #18* to
#23*, #23* to #21*, #21* to #22*. III #13 to #14, #14 to #15, #15
to #16, #16 to #18, #18 to #19, #19 to #20, #20 to #19*, #19* to
#18*, #18* to #21*, #21* to #22*. IV #13 to #14, #14 to #15, #15 to
#16, #16 to #18, #18 to #19, #19 to #20, #20 to #19*, #19* to #18*,
#18* to #23*, #23* to #21*, #21* to #22*.
[0205] The present invention also contemplates double-labelling,
including double-radiolabelling. FIG. 2 shows two ways for
synthesizing double-radiolabelled AMDMIP.
[0206] b) AMDMIP without Halomethylation
[0207] While the halomethylation route described above, combined
with the novel method of the present invention for the synthesis of
the AMDMIP precursor, DMIP, provides a novel and useful method for
the synthesis of AMDMIP, halomethylation can require toxic
compounds. For example, chloromethylation requires the use of
chloromethylmethyl ether. This compound, as discussed earlier, is
highly volatile, extremely toxic and a well known carcinogen (OSHA
regulated carcinogen CFR Title 29, Part 1910.1006). Its use
requires special equipment and precautions to avoid exposure of the
worker or release to the environment. To avoid the the danger and
inconvenience of using chloromethylmethyl ether, the present
invention provides a novel method for the synthesis of AMDMIP
without halomethylation.
[0208] The present invention contemplates conversion of DMIP to
PHIMDMIP by direct phthalimidomethylation of the 4' furan position
with a nitrogen donor. The present invention contemplates that the
nitrogen donor may be selected from the group consisting of
N-hydroxymethyl phthalimide and derivatives thereof.
[0209] In converting DMIP directly to PHIMDMIP, the present
invention adapts and modifies a procedure that has heretofore only
been used for psoralens. N. D. Heindel et al., J. Hetero. Chem.
22:73 (1985). The present invention contemplates that this adapted
and modified procedure is suitable for isopsoralens which a) do
contain a methyl group at the 4 position, and b) do not contain
hydroxy, amino or other like substituents which result in
poly-substitution.
[0210] This approach is an improvement over the reported procedures
for PHIMDMIP synthesis in that 1) no carcinogen is used, 2) the
method requires one step instead of two, and 3) the method provides
product (PHIMDMIP) in higher yield. From PHIMDMIP, the method
proceeds to AMDMIP as described above.
[0211] b') Radiolabelled AMDMIP without Halomethylation
[0212] The route for the synthesis of AMDMIP without
halomethylation can further be used to synthesize labelled AMDMIP
via radiolabelled DMIP.
[0213] *DMIP.fwdarw.*PHIMDMIP.fwdarw.*AIDDMIP
[0214] where (*) indicates a radiolabelled compound.
[0215] With the novel radiolabelling method of the present
invention for D14IP, the present invention provides the following
single radiolabelling method for AMDMIP without
halomethylation:
14 I #13 to #14, #14 to #15, #15 to #16, #16 to #17*, #17* to #16*,
#16* to #21*, #21* to #22*.
[0216] 3) BIODMIP, DITHIODMIP and FLUORDMIP Synthesis The BIO-,
DITHIO- and FLUOR-derivatives of DMIP of the present invention
(compounds #25a, 25b, and 25c, respectively) can each be generally
described as a three part compound consisting of the following
three units:
[0217] DMIP--SPACER--LABEL
[0218] The spacer contemplated by the present invention has the
general formula R.sub.1HN--(CH.sub.2).sub.n--NHR.sub.2. In general,
R.sub.1=--H, --CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7 or
--C.sub.4H.sub.9, R.sub.2=--H, --CH.sub.3, --C.sub.2H5,
--C.sub.3H.sub.7 or --C.sub.4H.sub.9, and n is between 6 and 16,
inclusive. It is contemplated that, where the BIODMIP compound is
bound to another molecule (e.g. nucleic acid), sufficient length is
provided for the biotin moiety to span the distance between the
site of attachment to another molecule and the avidin binding site
when n.gtoreq.6. As noted earlier, shorter spacers [see e.g. J. P.
Albarella et al., 17:4293 (1989)] may hinder the formation of the
biotin-avidin complex. Adequate chain length helps reduce steric
hinderance associated with the avidin-biotin interaction, and
accordingly, the stability of the avidin-biotin complex should
increase when the appropriate chain length is employed.
[0219] Chemical (synthetic) considerations come into play when
considering the preferred spacer for the BIO-, DITHIO- and
FLUOR-derivatives of DMIP. While for spacer
R.sub.1HN--(CH.sub.2).sub.n--NHR.sub.2, R.sub.1 can be --H,
--CH.sub.3, --C.sub.2H.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.6 or
--C.sub.4H.sub.7, and R.sub.2 can be --H, --CH.sub.3,
--C.sub.2H.sub.5, --C.sub.3H.sub.7 or --C.sub.4H.sub.9, most
preferably R.sub.1 and R.sub.2 are both --CH.sub.3,
--C.sub.2H.sub.5, --C.sub.3H.sub.7 or --C.sub.4H.sub.9. While not
limited to any particular theory, in the reaction to prepare
HDAMDMIP from XMDMIP (or IMDMIP) where R.sub.1 and R.sub.2 are both
--CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7 or --C.sub.4H.sub.9,
the spacer nitrogens can react at either nitrogen with only one or
two equivalents of XMDMIP (or IMDMIP).
[0220] So that the desired mono-N-substituted product (i.e.
HDAMDMIP) is favored, the present invention contemplates that a
high ratio of spacer to XMDMIP (or IMDMIP) is employed in the
reaction. Nonetheless, even where 1) R.sub.1 and R.sub.2 are both
--CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7 or --C.sub.4H.sub.9
and 2) a high ratio of spacer to XMDMIP (or IMDMIP) is employed,
the present invention contemplates side products from the reaction
of more than one XMDMIP (or IMDMIP) with the spacer. These side
products include one di-N,N-substituted product (i.e. two
isopsoralens at the same nitrogen on the spacer), one
di-N,N'-substituted product (i.e. two isopsoralens at each of the
spacer nitrogens), one tri-N,N,N'-substituted product and one
tetra-N, N, N', N'-substituted product.
[0221] As noted, the present invention does contemplate the case
where R.sub.1 and R.sub.2 are --H. While this spacer can be used,
the number of possible multi-substituted spacer side products is
increased, making subsequent purification of the desired
mono-N-substituted product (i.e. HDAMDMIP) more difficult.
[0222] The label on the BIO-, DITHIO- and FLUOR-derivatives of DMIP
of the present invention is comprised of two elements: 1) the
reporter moiety, and 2) the linking arm which binds the reporter
moiety to the spacer. Two types of reporter moieties are shown in
FIG. 2: i) biotin and ii) fluorescein. Both biotin and fluorescein
are appended to the spacer via an amide bond, with zero to seven
bridging atoms making up the linking arm between the spacer amido
carbonyl and the reporter moiety. In some cases (e.g. DITHIODMIP),
the linking arm may contain a disulfide linkage, which is useful
for subsequent cleavage of the reporter moiety from the
isopsoralen.
[0223] The reaction to form the amide bond between the spacer
nitrogen and the label carbonyl uses an activated ester,
preferrably the N-hydroxy-succinimide ester. Other active esters,
however, are contemplated, such as the imidazolides (from N,
N'-carbonyldiimidizoles) and the sulfosuccinimidyl esters.
[0224] a) BIODMIP Synthesis
[0225] As shown in FIG. 2, the present invention contemplates four
alternative synthesis methods for proceeding via new compound
intermediate XMDMIP to new compound BIODMIP (Compound #25a). Two of
the four methods proceed via HMDMIP:
[0226]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.HDAMDMIP.fwdarw.BIODMIP
[0227] or
[0228]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.IMDMIP.fwdarw.HDAMDMIP.fw-
darw.BIODMIP
[0229] The other two methods (the first of which is perferred)
proceed directly from XMDMIP:
[0230] XMDMIP.fwdarw.HDAMDMIP.fwdarw.BIODNIP
[0231] or
[0232] XMDMIP.fwdarw.IMDMIP.fwdarw.HDAMDMIP.fwdarw.BIODMIP
[0233] a') Radiolabelled BIODMIP Synthesis
[0234] The present invention also provides methods for
radiolabelling BIODMIP. Two methods are provided for synthesizing
radiolabelled BIODMIP from DMIP and two methods are provided for
synthesizing (single) radiolabelled BIODMIP from radiolabelled
DMIP, for a total of four (single) radiolabelling methods:
15 I #16 to #18, #18 to #19, #19 to #20, #20 to #19*, #19* to #18*,
#18* to #24*, #24* to #25a*. II #16 to #18, #18 to #19, #19 to #20,
#20 to #19*, #19* to #18*, #18* to #23*, #23* to #24*, #24* to
#25a*. III #16 to #17*, #17* to #16*, #16* to #18*, #18* to #24*,
#24* to #25a*. IV #16 to #17*, #17* to #16*, #16* to #18*, #18* to
#23*, #23* to #24*, #24* to #25a*. where * indicates a labelled
compound. Methods I and III are preferred.
[0235] The present invention also contemplates
double-radiolabelling of BIODMIP. FIG. 2 shows two methods of
double-radiolabelling BIODMIP. In one embodiment, the
double-radiolabelling method of the present invention involves the
combination of the radiolabelling steps for DMIP (Compound #16 to
Compound #17*) and the radiolabelling steps for BIODMIP (above). As
noted, this provides, among other advantages, the advantage of
increasing the specific activity of the compounds of the present
invention. The present invention contemplates the following
double-radiolabelling methods (where ** indicates a double-labelled
compound):
16 I #16 to #17*, #17* to #18*, #18* to #19*, #19* to #20*, #20* to
19**, #19** to #18**, #18** to #24**, #24** to 25a**. II #16 to
#17*, #17* to #18*, #18* to #19*, #19* to #20*, #20* to 19**, #19**
to #18**, #18** to #23**, #23** to #24**, #24** to 25a**.
[0236] b) DIOTHIODMIP Synthesis
[0237] As shown in FIG. 2, the present invention contemplates four
alternative synthesis methods for proceeding via new compound
intermediate XMDMIP to new compound DITHIODMIP (Compound #25b). Two
of the four methods proceed via HMDMIP:
[0238]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.HDAMDMIP.fwdarw.DITHIODMI-
P
[0239] or
[0240]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.IMDMIP.fwdarw.HDAMDMIP.fw-
darw.DITHIODMIP
[0241] The other two methods (the first of which is preferred)
proceed directly from XMDMIP:
[0242] XMDMIP.fwdarw.HDAMDMIP.fwdarw.DITHIODMIP
[0243] or
[0244] XMDMIP.fwdarw.IMDMIP.fwdarw.HDAMDMIP.fwdarw.DITHIODMIP
[0245] b') Radiolabelled DITHIODMIP
[0246] The present invention also provides methods for
radiolabelling DITHIODMIP. Two methods are provided for
synthesizing radiolabelled DITHIODMIP from DMIP and two methods are
provided for synthesizing (single) radiolabelled DITHIODMIP from
radiolabelled DMIP, for a total of four (single) radiolabelling
methods:
17 I #16 to #18, #18 to #19, #19 to #20, #20 to #19*, #19* to #18*,
#18* to #24*, #24* to #25b*. II #16 to #18, #18 to #19, #19 to #20,
#20 to #19*, #19* to #18*, #18* to #23*, #23* to #24*, #24* to
#25b*. III #16 to #17*, #17* to #16*, #16* to #18*, #18* to #24*,
#24* to #25b*. IV #16 to #17*, #17* to #16*, #16* to #18*, #18* to
#23*, #23* to #24*, #24* to #25b*. where * indicates a labelled
compound. Methods I and III are preferred.
[0247] The present invention also contemplates
double-radiolabelling of DITHIODMIP. FIG. 2 shows two methods of
double-radiolabelling DITHIODMIP. In one embodiment, the
double-radiolabelling method of the present invention involves the
combination of the radiolabelling steps for DMIP (Compound #16 to
Compound #17*) and the (single) radiolabelling steps for DITHIODMIP
(above). As noted, this provides, among other advantages, the
advantage of increasing the specific activity of the compounds of
the present invention. The present invention contemplates the
following double-radiolabelling methods (where ** indicates a
double-labelled compound):
18 I #16 to #17*, #17* to #18*, #18* to #19*, #19* to #20*, #20* to
19**, #19** to #18**, #18** to #24**, #24** to 25b**. II #16 to
#17*, #17* to #18*, #18* to #19*, #19* to #20*, #20* to 19**, #19**
to #18**, #18** to #23**, #23** to #24**, #24** to 25b**.
[0248] c) FLUORDMIP Synthesis
[0249] As shown in FIG. 2, the present invention contemplates four
alternative synthesis methods for proceeding via new compound
intermediate XMDMIP to new compound FLUORDMIP (Compound #25c). Two
of the four methods proceed via HMDMIP:
[0250]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.HDAMIDMIP.fwdarw.FLUORDMI-
P
[0251] or
[0252]
XMDMIP.fwdarw.HMDMIP.fwdarw.XMDMIP.fwdarw.IMDMIP.fwdarw.HDAMDMIP.fw-
darw.FLUORDMIP
[0253] The other two methods (the first of which is preferred)
proceed directly from XMDMIP:
[0254] XMDMIP.fwdarw.HDAIDMIP.fwdarw.FLUORDMIP
[0255] or
[0256] XMDMIP.fwdarw.IMDMIP.fwdarw.HDAMDMIP.fwdarw.FLUORDMIP
[0257] c') Radiolabelled FLUORDMTP Synthesis
[0258] The present invention also provides methods for
radiolabelling FLUORDMIP. Two methods are provided for synthesizing
radiolabelled FLUORDMIP from DMIP and two methods are provided for
synthesizing (single) radiolabelled FLUORDMIP from radiolabelled
DMIP, for a total of four (single) radiolabelling methods:
19 I #16 to #18, #18 to #19, #19 to #20, #20 to #19*, #19* to #18*,
#18* to #24*, #24* to #25c*. II #16 to #18, #18 to #19, #19 to #20,
#20 to #19*, #19* to #18*, #18* to #23*, #23* to #24*, #24* to
#25c*. III #16 to #17*, #17* to #16*, #16* to #18*, #18* to #24*,
#24* to #25c*. IV #16 to #17*, #17* to #16*, #16* to #18*, #18* to
#23*, #23* to #24*, #24* to #25C*. where * indicates a labelled
compound. Methods I and III are preferred.
[0259] The present invention also contemplates
double-radiolabelling of FLUORDMIP. FIG. 2 shows two methods of
double-radiolabelling FLUORDMIP. In one embodiment, the
double-radiolabelling method of the present invention involves the
combination of the radiolabelling steps for DMIP (Compound #16 to
Compound #17*) and the radiolabelling steps for FLUORDMIP (above).
The present invention contemplates the following
double-radiolabelling methods (where ** indicates a double-labelled
compound):
20 I #16 to #17*, #17* to #18*, #18* to #19*, #19* to #20*, #20* to
19**, #19** to #18**, #18** to #24**, #24** to 25c**. II #16 to
#17*, #17* to #18*, #18* to #19*, #19* to #20*, #20* to 19**, #19**
to #18**, #18** to #23**, #23** to #24**, #24** to 25c**.
[0260] II. Photoactivation Devices and Methods
[0261] The present invention contemplates devices and methods for
photoactivation and specifically, for activation of photoreactive
compounds. The present invention contemplates devices having an
inexpensive source of electromagnetic radiation that is integrated
into a unit. In general, the present invention contemplates a
photoactivation device for treating photoreactive compounds,
comprising: a) means for providing appropriate wavelengths of
electromagnetic radiation to cause activation of at least one
photoreactive compound; b) means for supporting a plurality of
sample vessels in a fixed relationship with the radiation providing
means during activation; and c) means for maintaining the
temperature of the sample vessels within a desired temperature
range during activation. The present invention also contemplates
methods for photoactivating, comprising: a) supporting a plurality
of sample vessels, containing one or more photoreactive compounds,
in a fixed relationship with a fluorescent source of
electromagnetic radiation; b) irradiating the plurality of sample
vessels simultaneously with said electromagnetic radiation to cause
activation of at least one photoreactive compound; and c)
maintaining the temperature of the sample vessels within a desired
temperature range during activation.
[0262] It is intended that the devices of the present invention
serve to replace the specialized instruments of photochemists
investigating basic photochemistry of a photoactivator in vitro.
These specialized instruments have expensive, high energy, light
sources such as high pressure arc lamps or medium pressure mercury
lamps. In addition, each has its own peculiar sample holders with
varying geometries relative to the lamp source and with varying
filter devices (eg. glass cut-off filters or liquid solutions that
transmit only a specific region of the electromagnetic spectrum or
ultraviolet spectrum). This lack of standardization makes it
difficult to compare data between different labs since there are
both intensity variations in each of the different irradiation
apparatuses and differences in the spectral energy distribution.
Furthermore, the specialized irradiation devices that are available
usually lack inherent safety.
[0263] The major features of one embodiment of the device of the
present invention involve: A) an inexpensive source of ultraviolet
radiation in a fixed relationship with the means for supporting the
sample vessels, B) rapid photoactivation, C) large sample
processing, D) temperature control of the irradiated samples, and
E) inherent safety.
[0264] A. Electromagnetic Radiation Source
[0265] A preferred photoactivation device of the present invention
has an inexpensive source of ultraviolet radiation in a fixed
relationship with the means for supporting the sample vessels.
Ultraviolet radiation is a form of energy that occupies a portion
of the electromagnetic radiation spectrum (the electromagnetic
radiation spectrum ranges from cosmic rays to radio waves).
Ultraviolet radiation can come from many natural and artificial
sources. Depending on the source of ultraviolet radiation, it may
be accompanied by other (non-ultraviolet) types of electromagnetic
radiation (e.g. visible light).
[0266] Particular types of ultraviolet radiation are herein
described in terms of wavelength. Wavelength is herein described in
terms of nanometers ("nm"; 10 .sup.-9meters). For purposes herein,
ultraviolet radiation extends from approximately 180 nm to 400 nm.
When a radiation source does not emit radiation below a particular
wavelength (e.g. 300 nm), it is said to have a "cutoff" at that
wavelength (e.g. "a wavelength cutoff at 300 nanometers").
[0267] When ultraviolet radiation is herein described in terms of
irradiance, it is expressed in terms of intensity flux (milliwatts
per square centimeter or "mW cm.sup.-2"). "Output" is herein
defined to encompass both the emission of radiation (yes or no; on
or off) as well as the level of irradiance.
[0268] A preferred source of ultraviolet radiation is a fluorescent
source. Fluorescence is a special case of luminescence.
Luminescence involves the absorption of electromagnetic radiation
by a substance and the conversion of the energy into radiation of a
different wavelength. With fluorescence, the substance that is
excited by the electromagnetic radiation returns to its ground
state by emitting a quantum of electromagnetic radiation. While
fluorescent sources have heretofore been thought to be of too low
intensity to be useful for photoactivation, in one embodiment the
present invention employs fluorescent sources to achieve results
thus far achievable on only expensive equipment.
[0269] As used here, fixed relationship is defined as comprising a
fixed distance and geometry between the sample and the light source
during the sample irradiation. Distance relates to the distance
between the source and the sample as it is supported. It is knows
that light intensity from a point source is inversely related to
the square of the distance from the point source. Thus, small
changes in the distance from the source can have a drastic impact
on intensity. Since changes in intensity can impact photoactivation
results, changes in distance are avoided in the devices of the
present invention. This provides reproducibility and
repeatability.
[0270] Geometry relates to the positioning of the light source. For
example, it can be imagined that light sources could be placed
around the sample holder in many ways (on the sides, on the bottom,
in a circle, etc.). The geometry used in a preferred embodiment of
the present invention allows for uniform light exposure of
appropriate intensity for rapid photoactivation. The geometry of a
preferred device of the present invention involves multiple sources
of linear lamps as opposed to single point sources. In addition,
there are several reflective surfaces and several absorptive
surfaces. Because of this complicated geometry, changes in the
location or number of the lamps relative to the position of the
samples to be irradiated are to be avoided in that such changes
will result in intensity changes.
[0271] B. Rapid Photoactivation
[0272] The light source of the preferred embodiment of the present
invention allows for rapid photoactivation. The intensity
characteristics of the irradiation device have been selected to be
convenient with the anticipation that many sets of multiple samples
may need to be processed. With this anticipation, a fifteen minute
exposure time is a practical goal.
[0273] A fifteen minute exposure, in addition to its convenience,
provides for reproducible results. In this regard, it should be
noted that the binding levels of photoactive compounds to
polynucleotides increases with increasing exposure to activating
light. A plateau of binding density is ultimately achieved. This
plateau results from competing photochemical reactions. Most
photoreactive compounds which undergo addition reactions to the
base moieties of nucleic acid also undergo photodecomposition
reactions when free in solution. For a given intensity flux
(watts/cm.sup.2) the relative rates of these competing reactions
will determine when, in the course of a time course of an
irradiation process, the plateau level will be achieved. For
reproducible binding, it is desirable to have irradiation protocols
that result in plateau levels of binding. Plateau levels of binding
will avoid minor intensity differences that can arise from small
differences in sample position (i.e. while the means for supporting
the sample vessels can be in a fixed relationship with the source
of irradiation, each sample in a large number of samples cannot
occupy precisely the same point in space relative to the source).
When plateau binding is used, identical reaction mixtures in
different positions will show the same level of binding.
[0274] In designing the devices of the present invention, relative
position of the elements of the preferred device have been
optimized to allow for plateau binding in fifteen minutes of
irradiation time through Eppendorph tubes for most photoreactive
compounds thus far tested. The present invention contemplates for a
preferred device: a) a fluorescent source of ultraviolet radiation,
and b) a means for supporting a plurality of sample vessels,
positioned with respect to the fluorescent source, so that, when
measured for the wavelengths between 300 and 400 nanometers, an
intensity flux greater than 15 mw cm.sup.-2 is provided to the
sample vessels. Similarly, in the preferred method the present
invention, the following steps are contemplated: a) providing a
fluorescent source of ultraviolet radiation, and b) supporting a
plurality of sample vessels with respect to the fluorescent source
of ultraviolet radiation, so that, when measured for the
wavelengths between 300 and 400 nanometers, an intensity flux
greater than 15 mW cm.sup.-2 is provided simultaneously to the
plurality of sample vessels, and c) simultaneously irradiating the
plurality of sample vessels.
[0275] C. Processing of Large Numbers of Samples
[0276] As noted, another important feature of the photoactivation
devices of the present invention is that they provide for the
processing of large numbers of samples. In this regard, one element
of the devices of the present invention is a means for supporting a
plurality of sample vessels. In the preferred embodiment of the
present invention the supporting means comprises a sample rack
detachably coupled to the housing of the device. The sample rack
provides a means for positioning the plurality of sample vessels.
The positioning means has been designed to be useful in combination
with commonly used laboratory sample vessels. Commonly used
laboratory sample vessels include, but are not limited to, test
tubes, flasks, and small volume (0.5-1.5 ml) plastic tubes (such as
Eppendorph tubes). By accepting commonly used laboratory sample
vessels, the sample rack of the preferred embodiment of the present
invention allows for convenient processing of large numbers of
samples.
[0277] The detachable aspect of the sample rack in the preferred
embodiment also provides for interchange-ability of the supporting
means. Sample racks having different features suited to different
size sample vessels and/or different size photoactivation jobs can
be interchanged freely.
[0278] The embodiments of the device of the present invention also
provide for the processing of a large liquid sample. In the
preferred embodiment of the device of the present invention, a
trough is provided for holding temperature control liquid (see next
section). In an alternative embodiment, it is contemplated that the
trough serve as a built-in container for liquid that is to be
irradiated. In such a case, the device of the present invention
provides a flow-through trough, having inlet and outlet ports for
liquid. It is contemplated that the flow-through trough serve as a
container for continuous liquid flow during irradiation.
Temperature control of this flow-through system can still be
achieved by use of an external temperature control means (e.g. a
temperature controlled reservoir).
[0279] D. Temperature Control
[0280] As noted, one of the important features of the
photoactivation devices of the present invention is temperature
control. Temperature control is important because the temperature
of the sample in the sample vessel at the time of exposure to light
can dramatically impact the results. For example, conditions that
promote secondary structure in nucleic acids also enhance the
affinity constants of many psoralen derivatives for nucleic acids.
Hyde and Hearst, Biochemistry, 17, 1251 (1978). These conditions
are a mix of both solvent composition and temperature. With single
stranded 5S ribosomal RNA, irradiation at low temperatures enhances
the covalent addition of HMT to 5S rRNA by two fold at 4.degree. C
compared to 20.degree. C. Thompson et al., J. Mol. Biol. 147:417
(1981). Even further temperature induced enhancements of psoralen
binding have been reported with synthetic polynucleotides. Thompson
et al., Biochemistry 21:1363 (1982).
[0281] Temperature control is also an important factor for
hybridization assays that detect allele specific nucleic acid
targets. Allelic variants of a specific target nucleic acid may
differ by a single base. Sickle cell anemia is an example of a
human genetic disease that results from the change of a single base
(A to T) in the gene for the human B globin molecule. The specific
hybridization of a single oligonucleotide probe to one of two
allelic variants that differ by only a single base requires very
precise temperature control. Wood et al., Proc. Nat. Acad. Sci.
82:1585 (1985). The irradiation of psoralen monoadducted
oligonucleotide probes under hybridization equilibrium conditions
results in the covalent attachment of these probes to their
targets. Allele specific discrimination of a single base change is
possible with these crosslinkable probes. However, discrimination
is sharply dependent upon temperature. A 2.degree. C. change during
the irradiation procedure will have dramatic effect on the level of
discrimination that is observed.
[0282] 5. Inherent Safety
[0283] Ultraviolet radiation can cause severe burns. Depending on
the nature of the exposure, it may also be carcinogenic. The light
source of a preferred embodiment of the present invention is
shielded from the user. This is in contrast to the commercial
hand-held ultraviolet sources as well as the large, high intensity
sources. In a preferred embodiment, the irradiation source is
contained within a housing made of material that obstructs the
transmission of radiant energy (i.e. an opaque housing). As noted
above, sample vessels are placed in the sample rack which is
detachably coupled to the housing above the rack. As a final
precaution, a sample overlay is provided that extends over and
covers the sample vessels. This sample overlay provides two
functions. First, it helps to maintain the position of the sample
vessels when liquid is in the trough. Second, and more importantly,
it closes off the only opening of the housing and, thereby, seals
the device. The sealed device allows no irradiation to pass to the
user. This allows for inherent safety for the user.
[0284] III. Bilding of Compounds to Nucleic Acid
[0285] The present invention contemplates binding new and known
compounds to nucleic acid, including (but not limited to) a)
nucleic acid target sequences, probes, and primers, as well as b)
nucleic acid used as template, and c) amplified nucleic acid.
Target sequences are regions of nucleic acid having one or more
segments of known base sequence. Target sequences are "targets" in
the sense that they are sought to be detected (i.e. sorted out from
other nucleic acid). Detection is frequently performed by
hybridization with probes. Probes are nucleic acids having a base
sequence that is partially or completely complementary with all or
a portion of a target sequence.
[0286] Some molecular biological techniques use template and
primers. Template is defined simply as nucleic acid that is
substrate for enzymatic synthesis. Frequently, it is nucleic acid
suspected of containing target sequence(s). Primers act to control
the point of initiation of synthesis of target sequences when they
are present in the template. Other molecular biological techniques
use template and replicating probes.
[0287] The present invention contemplates that the binding to all
these forms of nucleic acid (as well as others) can be non-covalent
binding and/or covalent binding. The present invention contemplates
specific embodiments of binding including, but not limited to dark
binding and photobinding.
[0288] A. Dark Binding
[0289] One embodiment of the binding of the present invention
involves dark binding. "Dark Binding" is defined as binding to
nucleic acid that occurs in the absence of photoactivating
wavelengths of electromagnetic radiation. Dark binding can be
covalent or non-covalent. "Dark Binding Compounds" are defined as
compounds that are capable of dark binding. In one embodiment, the
dark binding of the present invention involves the steps: a)
providing a dark binding compound; and b) mixing the dark binding
compound with nucleic acid in the absence of photoactivation
wavelengths of light, where the dark binding compound is selected
from the group consisting of DEMC (Compound #2), XMIP (Compound
#5), HMIP (Compound #6), FMIP (Compound #7), IMIP (Compound #8),
HMTAMIP (Compound #9), AMIP (Compound #10), DMHMIP (Compound #11),
BIOMIP (Compound #412a), DITHIOMIP (Compound 12b), FLUORMIP
(Compound 12c), XAMC (Compound #14) RXAMC (Compound #15), BMDMIP
(Compound #18, where X=Br), FDMIP (Compound #20), IMDMIP (Compound
#23), HDMADMIP (Compound #24), BIODMIP (compound #25a), DITHIODMIP
(compound #25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0290] The present invention further contemplates the product of
dark binding, i.e., a dark binding compound:nucleic acid complex,
where the dark binding compound is selected from the group
consisting of DEMC (Compound #2), XMIP (Compound #5), HMIP
(Compound #6), FMIP (Compound #7), IMIP (Compound #8), HMTAMIP
(Compound #9), AMIP (Compound #10), DMHMIP (Compound #11), BIOMIP
(Compound #12a), DITHIOMIP (Compound 12b), FLUORMIP (Compound 12c),
XAMC (Compound #14) RXAMC (Compound #15), BMDMIP (Compound #18,
where X=Br), FDMIP (Compound #20), IMDMIP (Compound #23), HDMADMIP
(Compound #24), BIODMIP (compound #25a), DITHIODMIP (compound
#25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0291] The present invention also contemplates dark binding of
photoproduct. "Photoproduct" is defined as a product of the
reaction of a compound and activating wavelengths of
electromagnetic radiation that, once formed, is later capable of
binding to nucleic acid in the absence of electromagnetic
radiation.
[0292] In considering photoproduct binding, it should be noted that
previous work towards the modification of nucleic acids with
furocoumarins has historically proceeded by a method having the
temporal steps: 1) providing a specific furocoumarin derivative, 2)
providing a particular nucleic acid or nucleic acid sequence, and
3) mixing the furocoumarin with the nucleic acid in the presence of
activating wavelengths of electromagnetic radiation. Depending on
the details of the particular reaction, including the particular
furocoumarin derivative, radiation source irradiation time, buffer,
temperature and other factors used for the procedure, a given level
of covalent modification, with almost exclusively cyclobutyl type
2+2 photocycloaddition products, resulted.
[0293] In one embodiment, the present invention contemplates a
radical departure from this historical approach to photobinding. In
one embodiment of the method of the present invention, the temporal
sequence is the following: 1) providing one or more furocoumarin
derivatives, 2) exposing the furocoumarin derivative(s) to
activating wavelengths of electromagnetic radiation, 3) providing a
particular nucleic acid sample or nucleic acid sequence, and 4)
mixing the irradiated furocoumarin derivative(s) with the nucleic
acid in the absence of activating wavelengths of electromagnetic
radiation. in this embodiment, the furocoumarin derivative is
irradiated prior to mixing with nucleic acid. The experimental
investigation of this novel temporal sequence has established the
existence of furocoumarin photoproduct. Application of the novel
temporal sequence has useful applications but was neither predicted
nor expected from the chemical or biochemical literature concerning
furocoumarins.
[0294] "Photoproduct" is best understood by considering the
possible reactions of photoreactive compound when exposed to
activating wavelengths of electromagnetic radiation. While not
limited to any precise mechanism, it is believed that the reaction
of photoreactive compound in its ground state ("C") with activating
wavelengths of electromagnetic radiation creates a short-lived
excited species ("C*"):
[0295] C.fwdarw.C*
[0296] What happens next is largely a function of what potential
reactants are available to the excited species. Since it is
short-lived, a reaction of this species with nucleic acid ("NA") is
believed to only be possible if nucleic acid is present at the time
the excited species is generated. Thus, the reaction must, in
operational terms, be in the presence of activating wavelengths of
electromagnetic radiation, i.e. it is "photobinding"; it is not
dark binding. The reaction can be depicted as follows:
[0297] C*+NA.fwdarw.NA:C
[0298] The product of this reaction is hereinafter referred to as
"Photoaddition Product" and is to be distinguished from
"Photoproduct."
[0299] With this reaction described, one can now consider the
situation where nucleic acid is not available for binding at the
time the compound is exposed to activating wavelengths of
electromagnetic radiation. Since the excited species is short-lived
and has no nucleic acid to react with, the excited species may
simply return to its ground state:
[0300] C*.fwdarw.C
[0301] On the other hand, the excited species may react with itself
(i.e. a ground state or excited species) to create a ground state
complex ("C:C"). The product of these self-reactions where two
compounds react is referred to as "photodimer" or simply "dimer."
The self-reactions, however, are not limited to two compounds; a
variety of multimers may be formed (trimers, etc.).
[0302] The excited species is not limited to reacting with itself.
It may react with its environment, such as elements of the solvent
("E") (e.g. ions, gases, etc.) to produce other products:
[0303] C*+E.fwdarw.E:C
[0304] Furthermore, it may simply internally rearrange
("isomerize") to a ground state derivative ("["):
[0305] C*.fwdarw.[
[0306] Finally, the excited species may undergo other reactions
than described here.
[0307] The present invention and the understanding of
"photoproduct" does not depend on which one (if any) of these
reactions actually occurs. "Photoproduct"--whatever its nature--is
deemed to exist if, following the reaction of a compound and
activating wavelengths of electromagnetic radiation, there is a
resultant product formed that is later capable of binding to
nucleic acid in the absence of electromagnetic radiation, i.e.
capable of dark binding (whether non-covalent dark binding or
covalent dark binding).
[0308] It is important to note that, while the definition of
"photoproduct" demands that, once formed by exposure to
electromagnetic radiation, the product be "capable" of binding to
nucleic acid in the absence of electromagnetic radiation, it is not
necessary that the product bind only in the dark. Photoproduct may
bind under the condition where there is exposure to electromagnetic
radiation; it simply does not require the condition for binding.
Such a definition allows for both "photobinding" and "photoproduct
binding" to nucleic acid to occur at the same time. Such a
definition also allows a single compound to be "photoproduct" and
"photobinding compound."
[0309] In one embodiment, the present invention contemplates dark
binding of both psoralen photoproduct and isopsoralen photoproduct.
With psoralens such as 4'-hydroxymethyl-4,5',8-trimethylpsoralen
(HMT), the present invention contemplates there are a number of
resultant products produced when the HMT is exposed to activating
wavelengths of electromagnetic radiation. The present invention
contemplates that a number of resultant products are similarly
produced when isopsoralens such as AMIP and AMDMIP are exposed to
activating wavelengths of electromagnetic radiation (particularly
when irradiated with the CE-III device). The major resultant
products of HMT are two cyclobutyl photodimers. In one of the
dimers, the two pyrone rings are linked in a cis-syn configuration,
while in the other dimer, the linkage occurs between the furan end
of one molecule and the pyrone end of the other, again with cis-syn
configuration. A third resultant product of HMT is a monomeric HMT
photoisomer. In this isomer, the central ring oxygens assume a 1, 4
instead of the normal 1, 3 orientation. While the two photodimers
would not be expected to have an intercalating activity due to
geometrical considerations, the photoisomer remains planer, and
accordingly, it is contemplated that it has a positive
intercalative association with double stranded nucleic acid.
Analogously, it is contemplated that some of the resultant products
of AMIP and AMDMIP also have a positive intercalative association
with nucleic acid. While not limited to any particular theory,
non-covalent dark binding is anticipated where monomeric isomers
are formed, and particularly, where the positively charge
aminomethyl moiety is retained in the structure.
[0310] B. Photobinding
[0311] One approach of the present invention to binding activation
compounds to nucleic acid is photobinding. Photobinding, as noted
above, is defined as the binding of photobinding compounds in the
presence of photoactivating wavelengths of light. Photobinding
compounds are compounds that bind to nucleic acid in the presence
of photoactivating wavelengths of light. The present invention
contemplates a number of methods of photobinding, including 1)
photobinding with photobinding compounds of the present invention,
2) high photobinding with new and known compounds, and 3)
photobinding to label nucleic acids.
[0312] 1) Photobinding With New Compounds
[0313] One embodiment of the method of the present invention for
photobinding involves the steps: a) providing a photobinding
compound; and b) mixing the photobinding compound with nucleic acid
in the presence of photoactivation wavelengths of electromagnetic
radiation, where the photobinding compound is selected from the
group consisting of DEIC Compound #2), XMIP (Compound #5), HMIP
(Compound #6), FMIP (Compound #7), IMIP (Compound #8), HMTAMIP
(Compound #9), AMIP (Compound #10), DMHMIP (Compound #11), BIOMIP
(Compound #12a), DITHIOMIP (Compound 12b), FLUORMIP (Compound 12c),
XAMC (Compound #14) RXAMC (Compound #15), BMDMIP (Compound #18,
where X=Br), FDMIP (Compound #20), IMDMIP (Compound #23), HDMADMIP
(Compound #24), BIODMIP (compound #25a), DITHIODMIP (compound
#25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0314] In another embodiment, the steps of the method comprise: a)
providing a photobinding compound; b) providing one or more nucleic
acid target sequences; and c) mixing the photobinding compound with
the nucleic acid target sequences in the presence of
photoactivation wavelengths of electromagnetic radiation. Again, in
one embodiment, the photobinding compound is selected from the
group consisting of DEMC (Compound #2), XMIP (Compound #5), HMIP
(Compound #6), FMIP (Compound #7), IMIP (Compound #8), HMTAMIP
(Compound #9), AMIP (Compound #10), DMHMIP (Compound #11), BIOMIP
(Compound #12a), DITHIOMIP (Compound 12b), FLUORMIP (Compound 12c),
XAMC (Compound #14) RXAMC (Compound #15), BMDMIP (Compound #18,
where #=Br), FDMIP (Compound #20), IMDMIP (Compound #23), HDMADMIP
(Compound #24), BIODMIP (compound #25a), DITHIODMIP (compound
#25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0315] The present invention further contemplates the product of
photobinding, i.e., a photobinding compound: nucleic acid complex.
In one embodiment, the photobinding compound of the complex is
selected from the group consisting of DEMC (Compound #2), XMIP
(Compound #5), HMIP (Compound #6), FMIP (Compound #7), IMIP
(Compound #8), HMTAMIP (Compound #9), AMIP (Compound #10), DMHMIP
(Compound #11), BIOMIP (Compound #12a), DITHIOMIP (Compound 12b),
FLUORMIP (Compound 12c), XAMC (Compound #14) RXAMC (Compound #15),
BMDMIP (Compound #18, where X=Br), FDMIP (Compound #20), IMDMIP
(Compound #23), HDMADMIP (Compound #24), BIODMIP (compound #25a),
DITHIODMIP (compound #25b), FLUORDMIP (compound #25c) , and their
radiolabelled derivatives.
[0316] The invention further contemplates a method for modifying
nucleic acid, comprising the steps: a) providing photobinding
compound and nucleic acid; and b) photobinding the photobinding
compound to the nucleic acid, so that a compound:nucleic acid
complex is formed, wherein the photobinding compound is selected
from the group consisting of DEMC (Compound #2), XMIP (Compound
#5), HMIP (Compound #6), FMIP (Compound #7), IMIP (Compound #8),
HMTAMIP (Compound #9), AMIP (Compound #10), DMHMIP (Compound #11),
BIOMIP (Compound #12a), DITHIOMIP (Compound 12b), FLUORMIP
(Compound 12c), XAMC (Compound #14) RXAMC (Compound #15), BMDMIP
(Compound #18, where X=Br), FDMIP (Compound #20), IMDMIP (Compound
#23), HDMADMIP (Compound #24), BIODMIP (compound #25a), DITHIODMIP
(compound #25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0317] A preferred embodiment of the method of the present
invention for photobinding involves the steps: a) providing a
photobinding compound; and b) mixing the photobinding compound with
nucleic acid in the presence of photoactivation wavelengths of
electromagnetic radiation, where the photobinding compound is
selected from the group consisting of AMIP (Compound #10), BIOMIP
(Compound #12a), DITHIOMIP (Compound 12b), FLUORMIP (Compound 12c),
BIODMIP (compound #25a), DITHIODMIP (compound #25b), FLUORDMIP
(compound #25c) , and their radiolabelled derivatives.
[0318] In another preferred embodiment, the steps of the method
comprise: a) providing a photobinding compound; b) providing one or
more nucleic acid target sequences; and c) mixing the photobinding
compound with the nucleic acid target sequences in the presence of
photoactivation wavelengths of electromagnetic radiation, where the
photobinding compound is selected from the group consisting of AMIP
(Compound #10), BIOMIP (Compound #12a), DITHIOMIP (Compound 12b),
FLUORMIP (Compound 12c), BIODMIP (compound #25a), DITHIODMIP
(compound #25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0319] In still another preferred embodiment, the present invention
contemplates a photobinding compound:nucleic acid complex, where
the photobinding compound of the complex is selected from the group
consisting of AMIP (Compound #10), BIOMIP (Compound #12a),
DITHIOMIP (Compound 12b), FLUORMIP (Compound 12c), BIODMIP
(compound #25a), DITHIODMIP (compound #25b), FLUORDMIP (compound
#25c), and their radiolabelled derivatives.
[0320] In still an additional preferred embodiment, the invention
contemplates a method for modifying nucleic acid, comprising the
steps: a) providing photobinding compound and nucleic acid; and b)
photobinding the photobinding compound to the nucleic acid, so that
a compound:nucleic acid complex is formed, wherein the photobinding
compound is selected from the group consisting of AMIP (Compound
#10), BIOMIP (Compound #12a), DITHIOMIP (Compound 12b), FLUORMIP
(Compound 12c), BIODMIP (compound #25a), DITHIODMIP (compound
#25b), FLUORDMIP (compound #25c), and their radiolabelled
derivatives.
[0321] 2) High Photobinding
[0322] The present invention provides isopsoralens with high
photobinding affinity and conditions for using isopsoralens to
allow for high photobinding. High photobinding is defined here as
photobinding to nucleic acid that results in significantly higher
levels of addition than reported for the known compound AMDMIP.
[0323] Baccichetti et al. and Dall'Acqua et al. previously reported
the nucleic acid binding characterization of AMDMIP. Baccichetti et
al., U.S. Pat. No. 4,312,883; Dall'Acqua et al., J. Med. Chem.
24:178 (1981). These workers reported, while AMDMIP has a high dark
binding affinity for DNA, photobinding with AMDMIP results in low
levels of addition to nucleic acid. In fact, AMDMIP was found to
photobind to DNA less than the parent compound, DMIP. (No RNA
binding data for AMDMIP was provided).
[0324] The present invention provides photobinding methods for i)
known isopsoralens, and ii) new isopsoralens. With respect to
methods for known isopsoralens, the present invention provides
methods for photobinding of AMDMIP that allow for photobinding of
AMDMIP to DNA at a level greater than 1 photobound AMDMIP per 15
base pairs, and to RNA at a level greater than 1 photobound AMDMIP
per 20 RNA bases. With respect to photobinding methods for new
isopsoralens, the present invention provides photobinding methods
for new compound AMIP that allow for photobinding at a level
greater than 1 photobound AMIP per 15 base pairs of DNA and a level
greater than 1 photobound AMIP per 20 bases of RNA.
[0325] While not limited to any particular theory, the photobinding
methods of the present invention take into consideration two
concepts as they relate to photobinding capacity: a) nucleic acid
base pair/compound ratio, and b) isopsoralen structure.
[0326] a) Nucleic Acid Base Pair/Compound Ratio
[0327] Dall'Acqua et al. compared AMDMIP photobinding with the
photobinding of the parent compound, DMIP. The parent compound (as
well as other compounds) was tested at concentrations at or near
its solubility limit (i.e., DMIP was tested at 10.1 .mu.g/ml;
DMIP's maximum aqueous solubility, as reported by Dall'Acqua et
al., is 8 .mu.g/ml). For comparative purposes, AMDMIP was tested in
this concentration range as well (specifically, at 13.1 .mu.g/ml).
Given this concentration range, both DMIP and AMDMIP photobinding
was determined at a DNA base pair:isopsoralen ratio of 24.3 to 1
(1.14.times.10.sup.-3 M DNA : 4.7.times.10.sup.-5 M isopsoralen).
With this ratio, photobinding of AMDMIP resulted in 1 photobound
AMDMIP per 151 DNA base pairs, which was lower photobinding than
that observed for the parent compound, DMIP. Dall'Acqua et al. J.
Med. Chem. 24:178 (1981). Thus, where concentrations of DMIP and
AMDMIP were approximately equal, DMIP was reported as the better
photobinder.
[0328] The photobinding methods of the present invention take into
consideration the nucleic acid base pair/compound ratio. The
photobinding methods of the present invention involve carrying out
the photobinding step under conditions where the isopsoralen
concentration is increased relative to the concentration of nucleic
acid base pairs. Importantly, increasing the isopsoralen
concentration takes advantage of the solubility of the isopsoralen;
with isopsoralens which have high aqueous solubility, higher
concentrations are possible to obtain.
[0329] By increasing the concentration of AMDMIP relative to
nucleic acid, the present invention takes into consideration the
much better solubility of AMDMIP as compared with the parent
compound, DMIP. While DMIP is reported to be a better intrinsic
photobinder than AMDMIP, the level of addition to nucleic acid is
governed by the photobinding compound concentration (relative to
nucleic acid) which is (with the concentration of nucleic acid
constant) governed by solubility of the photobinding compound.
Thus, while DMIP is a better intrinsic photobinder, the poor
solubility of DMIP results in a relatively low level of addition
(adducts per base pair) to nucleic acid.
[0330] By taking advantage of the higher solubility of AMDMIP,
higher concentrations of AMDMIP can be used, thus providing a
higher ratio of photobinding compound to nucleic acid base pairs
prior to irradiation. While AMDMIP is reported to be a less
efficient photobinder relative to DMIP, the present invention
contemplates increasing the concentration of AMDMIP so that a high
level of photoaddition to nucleic acid is achieved, i.e. high
photobinding.
[0331] The nucleic acid base pair/compound ratio of the
photobinding methods of the present invention is preferably less
than 3:1. With this ratio, the methods of the present invention
allow for photobinding of AMDMIP to DNA at a level greater than 1
photobound AMDMIP per 15 base pairs, and to RNA at a level greater
than of 1 photobound AMDMIP per 20 RNA bases.
[0332] b) Isopsoralen Structure
[0333] While the present invention takes into consideration the
nucleic acid base pair/compound ratio, the methods of the present
invention further consider isopsoralen structure. Inspection of the
molecular structure of AMDMIP (FIG. 2) shows two methyl groups at
the 4 and 5' carbons and the aminomethyl moiety at the 4' carbon.
It is known that methylation improves the ability of a psoralen or
isopsoralen to photobind to nucleic acid. It has been reported that
the trialkyl isopsoralens, particularly trimethyl, are better DNA
photobinding ligands than the corresponding dialkyl compounds, and
analogously, the dialkyl compounds are better photobinders than the
monoalkyl analogs. Guiotto et al., J. Med. Chem. 27:959 (1984). In
particular, methyl groups at the 4, 4', 5, 5' and 6 positions of
the isopsoralen system increase photobinding activity.
[0334] Psoralens which contain aminoalkyl moieties at the 4', 5,
5', or 8 positions are charged and show enhanced dark binding and
enhanced photoreactivity relative to the uncharged analogs. In
particular, the 4' and 5' aminoalkyl-trimethylpsoralens show
enhanced photobinding to nucleic acid. S. Isaacs et al.,
Biochemistry 16:1058 (1977). I. Willis and J. M. Menter, Nat.
Cancer Inst. Monograph 66 (1985).
[0335] While not limited to any particular theory, the methods of
the present invention take into consideration these structural
relationships which suggest that the position of the aminomethyl
moiety in AMDMIP may not be optimum for high photobinding activity.
The 4'-aminomethyl moiety, through association with external
phosphate groups, could be skewing the intercalated complex such
that the critical alignment between the 4', 5'and/or 3, 4 double
bonds and the 5, 6 pyrimidine double bond is disfavored, resulting
in a significant reduction in the quantum efficiency of 2+2
photocycloaddition to form the cyclobutane ring.
[0336] The present invention provides new compounds where the
aminomethyl moiety is at the 5 position (e.g. AMIP). It was hoped
that such compounds of the present invention might promote a
different and potentially more favorable double bond geometry,
resulting in higher photobinding than AMDMIP provides. While it was
not predictable that this new geometry could overcome the
disadvantage of a compound having no additional methyl groups
present on the ring system, the new compounds of the present
invention display high photobinding. In this regard, while the
known compound AMDMIP has the highest K.sub.a (DNA association
constant) of all reported isopsoralens, and new compound AMIP of
the present invention has a Ka which is only 28% as strong, AMIP
can provide 43% of the modification density provided by AMDMIP.
Since i) solubility of the two compounds is essentially the same,
and ii) testing was performed (photobinding) at the same
concentration, it appears that placing the aminomethyl moiety at
the 5 position rather than at the 4' position enhances
photobinding, relative to dark binding; AMIP is the better
photobinder per isopsoralen molecule, even though AMDMIP give the
highest number of isopsoralens bound.
[0337] 3) Labelling Nucleic Acid
[0338] As noted, one utility of the compounds is their ability to
bind to nucleic acids (RNA and DNA). Furthermore, because the
compounds bind nucleic acids, they also bind nucleic acid target
sequences. While target sequences are normally present in a mixture
of nucleic acids, they may be purified to homogeneity and reacted
with photoreactive compounds of the present invention.
[0339] While unlabelled compounds bind to nucleic acids, labelled
compounds are particularly useful for assessing the level of
binding to nucleic acids because, as noted above, labels facilitate
detection of the compound as well as the detection of molecules
bound to the compound, such as nucleic acids and nucleic acid
target sequences. In this manner it is also easier to separate
unbound from bound reactants (e.g. unbound isopsoralen from bound
isopsoralen). Furthermore, when there is binding, the separation
and isolation of bound reactants allows for a yield of
substantially pure bound product.
[0340] The present invention contemplates binding of the
above-named compounds to all types of nucleic acids under a wide
variety of conditions and thereby labelling nucleic acids. Of
course, the degree of binding will vary according to the particular
compound, the particular nucleic acid, and the conditions used. The
particular advantage of using isopsoralens such as those of the
present invention is that labelling can be carried out without
interfering with subsequent hybridization.
[0341] The present invention contemplates labelling of nucleic acid
and nucleic acid target sequences by 1) labelled compounds
synthesized by methods of the present invention and 2) labelled
compounds of the present invention synthesized by methods of the
present invention.
[0342] In one embodiment, the present invention contemplates using
BIOMIP and BIODMIP to provide an appended biotin on nucleic acid
target, and then using that labelled nucleic acid in a subsequent
detection step. For example, the present invention contemplates
mixing BIOMIP or BIODMIP with the total DNA extracted from a blood
sample suspected of harboring a virus. Irradiation of the mixture
causes the BIOMIP or BIODMIP to photobind to the nucleic acid. The
present invention contemplates that the next step of the method
involves use of nucleic acid probes specific (i.e. complementary)
for the viral nucleic acid sequences. These probes are added to the
BIOMIP(or BIODMIP)-treated nucleic acid. It is contemplated that
the probes are introduced on a solid support such as polystyrene
beads. After hybridization and washing, the solid support
(containing the probe/target-biotin complex) is treated with a
signal development system (e.g. an avidin-HRP complex) for
detection of binding.
[0343] In a strictly analogous manner, the new compounds FLUORMIP
and FLUORDMIP may be used to provide labelled nucleic acid. With
these compounds, the nucleic acid can be detected by fluorescence
techniques.
[0344] The photochemical labelling methods of the present invention
have advantages over other nucleic acid labelling techniques.
First, as mentioned above, labelling with isopsoralens does not
interfere with subsequent hybridization. Second, photochemical
labelling allows for labelling of an entire nucleic acid target
sequence. This is in contrast to enzymatic labelling methods such
as the BIO-UTP system. P. R. Langer et al., Proc. Nat. Acad. Sci.
U.S.A 78:6633 (1981). Furthermore, enzymatic labelling (e.g. nick
translating) usually results in labelled products that are only
about 200 base pairs in length. Finally, labelling nucleic acid
with isopsoralens offers the additional advantages of repeatability
and low cost.
[0345] It is not intended that the labelling methods of the present
invention be limited by the nature of the nucleic acid. In one
embodiment, the present invention contemplates that nucleic acid is
selected from the group human genomic DNA and human RNA. In another
embodiment, the present invention contemplates that the nucleic
acid sequences are selected from the group consisting of sequences
of viral DNA and sequences of viral RNA. In still a further
embodiment, the present invention contemplates that the nucleic
acid is selected from the group consisting of viral, bacterial,
fungal, mycoplasma and protozoan nucleic acid.
[0346] IV. Capture of Nucleic Acids
[0347] The present invention contemplates that the compounds of the
present invention be used to label and capture nucleic acid and
nucleic acid sequences. In one embodiment, probe DNA is reacted
with a cleavable biotin-isopsoralen, such as DITHIOMIP and
DITHIODMIP, to yield biotinylated (probe) DNA. This
biotin-isopsoralen/nucleic acid complex is then hybridized to
target DNA in a mixture of DNA. After hybridization, the
biotin-probe-target complex is passed through an avidin-agarose
column. The avidin-biotin-probe-target complex is retained on the
column, while non-hybridized (non-target) DNA is washed through.
Following the wash, the probe-target DNA hybrid is recovered by
cleaving the biotin from the isopsoralen via reduction of the
disulfide bond of DITHIOMIP or DITHIODMIP. Reduction is readily
accomplished with reagents such as dithiothreitol or sodium
borohydride.
[0348] The present invention also contemplates capture with
non-cleavable biotin-isopsoralen such as BIOMIP and BIODMIP. In one
embodiment, the probe DNA is reacted with BIOMIP or BIODMIP. The
subsequent hybridization, capture and wash steps are the same as
described for the cleavable compound. However, following the wash,
the present invention contemplates that either the entire
probe-target complex is removed from the avidin column by the
addition of a reagent that breaks up the biotin-avidin interaction
(e.g. 8M guanidinium chloride), or alternatively, the captured
target sequence is specifically released from the probe-target
complex by denaturation of the hybridized nucleic acid. This latter
procedure leaves the probe bound to the column and washes the
target off the column. In one embodiment, this step is accomplished
by elution with a solution that provides denaturing conditions
within the column matrix (e.g. 60% formamide).
[0349] V. Inhibiting Template-Dependent Enzymatic Synthesis
[0350] Enzymatic synthesis that involves nucleic acid, either
solely as a template (e.g. translation involves the use of nucleic
acid as a template to make polypeptides) or as both a template and
a product (replication and transcription use nucleic acid as a
template to produce nucleic acid) is hereinafter referred to as
"template-dependent enzymatic synthesis."
[0351] In the case of replication, nucleic acid polymerases
replicate a nucleic acid molecule ("template") to yield a
complementary ("daughter") nucleic acid molecule. For example, DNA
polymerase I, isolated from E. Coli, catalyzes the addition of
deoxyribonucleoside triphosphates to the 3' end of a short segment
of DNA ("primer") hybridized to a template strand to yield a
daughter of the template, starting from a mixture of precursor
nucleotides (dATP, dGTP, dCTP, and dTTP). This 5' to
3'template-dependent enzymatic synthesis is also called "primer
extension." The reaction will not take place in the absence of
template. The reaction can be measured if one or more of the
precursor nucleotides are labelled (usually they are radiolabelled
with .sup.32P).
[0352] There are a number of known methods of DNA modification that
block template-dependent enzymatic synthesis. For example E. coli
polymerase I terminates copying single stranded DNA one nucleotide
before encountering DNA lesions such as pyrimidine dimers induced
by ultraviolet light, P. D. Moore et al., Proc. Natl. Acad. Sci.
78:110 (1981), carcinogen adducts, P. D. Moore et al., Proc. Natl.
Acad. Sci. 79:7166 (1982), and proflavin-mediated guanine residue
photooxidation, J. G. Piette and P. D. Moore, Photochem. Photobiol.
35:705 (1982).
[0353] C. M. Ou et al., Biochemistry 17:1047 (1978) investigated
whether DNA replication by DNA polymerase I from E. coli. B could
be inhibited by covalently bound 8-methoxypsoralen (8-MOP) or by
5,7-dimethoxycoumarin (DMC). 8-MOP is a psoralen and was used to
crosslink the DNA. DMC is a coumarin derivative that lacks the
furyl carbon-carbon double bond necessary for photoaddition to
pyrimidine bases of DNA; DMC cannot form crosslinks. It was found
that the crosslinked DNA (8-MOP-modified) lost 97% of its template
activity for the enzyme used. The DMC-modified (uncrosslinked) DNA
lost only 50% of its template activity. It was proposed that the
crosslinking of DNA was responsible for the difference in
inhibition of template activity.
[0354] J. G. Piette and J. E. Hearst, Proc. Natl. Acad. Sci.
80:5540 (1983) reported that E. Coli polymerase I, when
nick-translating a double-stranded template, is not inhibited by
covalently bound psoralen
[4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT)] monoadducts or
isopsoralen (5-methylisopsoralen) monoadducts. The enzyme is,
however, effectively blocked by psoralen crosslinks.
[0355] J. G. Piette and J. E. Hearst, Int. J. Radiat. Biol. 48:381
(1985) later reported that E. Coli polymerase I, when carrying out
template-dependent enzymatic synthesis on a single-stranded
template (single-stranded bacteriophage DNA), was inhibited by HMT
monoadducts. It was concluded that DNA structure (single-stranded
versus double-stranded) must account for the different results.
[0356] G. Ericson and P. Wollenzien, Analytical Biochem. 174:215
(1988) examined psoralen crosslinks on RNA and their ability to
block reverse transcriptase. They reported that a psoralen
crosslink is an absolute stop for avian myeloblastosis virus
reverse transcriptase. Psoralen monoaddcuts showed little
inhibition of the enzyme.
[0357] These experiments showed that blocking of enzymatic
synthesis of nucleic acids could be accomplished with psoralen
crosslinks and, in some cases, inhibition could be achieved with
psoralens monoadducts. Importantly, the one attempt to block
enzymatic synthesis with an isopsoralen showed no inhibition.
[0358] The present invention provides the surprising result that
template-dependent enzymatic synthesis of nucleic acid can be
effectively inhibited with one or more "inhibition agents" wherein
the inhibition agents are compounds selected from the group
consisting of isopsoralens and photoproduct. As noted earlier,
isopsoralens cannot form crosslinks. ("Photoproduct" has been
extensively defined and discussed above.)
[0359] The present invention contemplates inhibiting
template-dependent enzymatic synthesis by A) Site-Specific Covalent
Addition, B) Random Covalent Addition, and C) Photoproduct
Addition, and reveals D) Compound/Enzyme Specificity.
[0360] A. Site-specific Addition
[0361] The present invention contemplates inhibiting of
template-dependent elongation by site-specific binding of new and
known isopsoralens to nucleic acid. In one embodiment, the method
of the present invention for the construction of specifically
placed isopsoralen adducts begins with two short oligonucleotides
that are complementary to each other, but that differ in length.
These oligonucleotides, along with an isopsoralen are placed
together under conditions where the oligonucleotides are base
paired as a double stranded molecule. This non-covalent complex is
irradiated to cause addition of the isopsoralen (320-400 nm) or
psoralen (>380 nm) to the oligonucleotides. Following
irradiation, monoadducted oligonucleotides are isolated by HPLC or
denaturing polyacrylamide gel electrophoresis (PAGE). Because of
the differential length of the original short oligonucleotides,
monoadducted oligonucleotides specific to each strand are isolated.
The present invention contemplates further that the short
monoadducted oligonucleotides may be appended to longer
oligonucleotides through the use of a ligation reaction and a
complementary splint molecule (the longer, ligated molecules are
purified by PAGE).
[0362] Such specifically constructed monoadducted oligonucleotides
are useful to determine the differential site-specificity of
photoreactive compounds. The present invention contemplates the use
of different compounds for different site-specifities. For example,
AMIP has a different site-specificity from AMDMIP.
[0363] B. Random Addition
[0364] The present invention also contemplates randomly adding
isopsoralens to produce covalent complexes of isopsoralen and
nucleic acid. By random it is not meant that the particular
isopsoralen will not display preferential placement. By random it
is meant that the level of addition (one, two or three adducts,
etc.) is not limited to one adduct per strand; the compound has
access to a larger number of sites. The present invention further
contemplates mixing isopsoralens to create a "cocktail" for random
addition. Randomly added cocktails can be used where multiple
adducts per strand are desired and where preferential placement is
sought. The present invention contemplates that consideration be
given to the nature of the nucleic acid (A:T rich, A:T poor, etc.)
in selecting both single mixtures and cocktails for random
addition.
[0365] C. Photoproduct Addition
[0366] Previous work towards the blocking of replication of nucleic
acids with furocoumarins has historically proceeded by a method
having the temporal steps: 1) providing a specific psoralen
derivative, 2) providing a particular nucleic acid or nucleic acid
target sequence(s), 3) mixing the psoralen with the nucleic acid in
the presence of activating wavelengths of electromagnetic
radiation. In one embodiment, the present invention contemplates a
radical departure from this historical approach to blocking. In one
embodiment of the method of the present invention, the temporal
sequence is the following: 1) providing furocoumarin derivative(s),
2) exposing the furocoumarin derivative (s) to activating
wavelengths of electromagnetic radiation, 3) providing a particular
nucleic acid or nucleic acid target sequence(s), 4) mixing the
irradiated furocoumarin derivative(s) with the nucleic acid. In
this embodiment, the furocoumarin is irradiated prior to mixing
with nucleic acid. The experimental investigation of this novel
temporal sequence has established that furocoumarin photoproduct
exists and that photoproduct can inhibit template-dependent
enzymatic synthesis, e.g. primer extension.
[0367] In one embodiment, the present invention contemplates using
AMDMIP photoproduct and AMIP photoproduct ("a photoproduct
cocktail") to inhibit polymerase activity. While not limited to any
particular molecular mechanism for inhibition, it is contemplated
that inhibition is specifically due to the interaction of
photoproduct with nucleic acid. In one embodiment, the method of
the present invention comprises: a) providing pre-irradiated AMIP
and AMDMIP; b) providing one or more nucleic acid target sequences;
and c) adding the pre-irradiated AMIP and AMDMIP to the one or more
nucleic acid sequences, so that the one or more sequences cannot be
extended by polymerase. Again, while not limited to any particular
molecular mechanism, it is contemplated that photoproduct is formed
which undergoes subsequent thermal addition to the nucleic acid. It
is believed that the photoproduct:nucleic acid complex cannot serve
as a template for polymerase.
[0368] Advantages of photoproduct inhibiting methods of the present
invention include the ability to pre-form the inhibition agent in
the absence of target. The photoproduct can then be provided at the
appropriate point in the process (i.e., when a polymerase
inhibiting moiety is required to be added to the nucleic acid or
nucleic acid sequence). This pre-irradiation is contemplated
particularly where thermally sensitive reagents are used for
inhibition. For example, compounds which are thermally sensitive
would not be suitable for some types of template-dependent
enzymatic synthesis. Such compounds would lose their utility due to
thermal decomposition prior to photoactivation. With the novel
temporal sequence of the method of photoproduct inhibition of the
present invention, the need for thermal stability is obviated since
photoproduct can be pre-formed and added at the conclusion of
thermal cycling.
[0369] D. Compound/enzyme Specificity
[0370] The present invention provides results that suggest there is
some compound/enzyme specificity, e.g. some isopsoralens inhibit
particular polymerases better than other isopsoralens. For example,
MIP and AMIP adducts will inhibit primer extension by Taq
polymerase, T4 polymerase and reverse transcriptase. MIP and AMIP
adducts, however, do not show the same level of inhibition of
primer extension by E. Coli polymerase or Klenow fragment. By
contrast, AMDMIP adducts show the same level of inhibition of
primer extension by all of these enzymes.
[0371] VI. Sterilization
[0372] The present invention contemplates a method of sterilization
that is useful for, among other uses, solving the carryover problem
associated with amplification of nucleic acid. The overall approach
of the method involves rendering nucleic acid after amplification
substantially unamplifiable (hence "Post-Amplification
Sterilization"), before a carry-over event can occur.
[0373] Post-amplification sterilization is designed to control
carryover. It is desirable to concurrently run reagent controls to
assure that carryover is absent in the first place.
[0374] It was noted earlier that target sequences are "targets" in
the sense that they are sought to be sorted out from other nucleic
acid. Amplification techniques have been designed primarily for
this sorting out. "Amplification" is a special case of replication
involving template specificity. It is to be contrasted with
non-specific template replication (i.e. replication that is
template-dependent but not dependent on a specific template).
Template specificity is here distinguished from fidelity of
replication (i.e. synthesis of the proper polynucleotide sequence)
and nucleotide (ribo- or deoxyribo-) specificity.
[0375] Template specificity is achieved in most amplification
techniques by the choice of enzyme. Amplification enzymes are
enzymes that, under conditions they are used, will process only
specific sequences of nucleic acid in a heterogenous mixture of
nucleic acid. For example, in the case of Q.beta. replicase, MDV-1
RNA is the specific template for the replicase. D. L. Kacian et
al., Proc. Nat. Acad. Sci USA 69:3038 (1972). Other nucleic acid
will not be replicated by this amplification enzyme. Similarly, in
the case of T7 RNA polymerase, this amplification enzyme has a
stringent specificity for its own promoters. M. Chamberlin et al.,
Nature 228:227 (1970). In the case of T4 DNA ligase, the enzyme
will not ligate the two oligonucleotides where there is a mismatch
between the oligonucleotide substrate and the template at the
ligation junction. D. Y. Wu and R. B. Wallace, Genomics 4:560
(1989). Finally, Taq polymerase, by virtue of its ability to
function at high temperature, is found to display high specificity
for the sequences bounded and thus defined by the primers; the high
temperature results in thermodynamic conditions that favor primer
hybridization with the target sequences and not hybridization with
non-target sequences. PCR Technology, H. A. Erlich (ed.) (Stockton
Press 1989).
[0376] Enzymes such as E. coli DNA polymerase I and Klenow are not
specific enzymes. Indeed, within their range of activity
(temperature, pH, etc.), they are promiscuous; they will elongate
any nucleic acid having short double-stranded segments exposing a
hydroxyl residue and a protruding 5' template. This, of course, is
not to say that these enzymes cannot be used in an amplification
protocol. For example, these enzymes can be used with homogeneous
nucleic acid to produce specific target.
[0377] It is not intended that the sterilization method of the
present invention be limited by the nature of the particular
amplification system producing the nucleic acid to be sterilized.
Some amplification techniques take the approach of amplifying and
then detecting target; others detect target and then amplify probe.
Regardless of the approach, amplified nucleic acid can carryover
into a new reaction and be subsequently amplified. The present
invention contemplates sterilizing this amplified nucleic acid
before it can carryover.
[0378] A. Sterilization In General
[0379] Something is "sterilized" when it is rendered incapable of
replication. While the term "sterilization" has typically been
applied only in the context of living organisms, it is here meant
to be applied to in vitro amplification protocols of
polynucleotides where a template polynucleotide functions in the
nature of a germination seed for its further propagation.
[0380] Sterilization "sensitivity" is an operationally defined
term. It is defined only in the context of a "sterilization method"
and the particular detection method that is used to measure
templates (or organisms). Sterilization sensitivity is the number
of germination seeds (e.g., viable bacterial cells or
polynucleotide templates) that result in a measurable signal in
some sterilization method and defined detection assay.
[0381] To appreciate that a "sterilization method" may or may not
achieve "sterilization," it is useful to consider a specific
example. A bacterial culture is said to be sterilized if an aliquot
of the culture, when transferred to a fresh culture plate and
permitted to grow, is undetectable after a certain time period. The
time period and the growth conditions (e.g. temperature) define an
"amplification factor". This amplification factor along with the
limitations of the detection method (e.g. visual inspection of the
culture plate for the appearance of a bacterial colony) define the
sensitivity of the sterilization method. A minimal number of viable
bacteria must be applied to the plate for a signal to be
detectable. With the optimum detection method, this minimal number
is 1 bacterial cell. With a suboptimal detection method, the
minimal number of bacterial cells applied so that a signal is
observed may be much greater than 1. The detection method
determines a "threshold" below which the "sterilization method"
appears to be completely effective (and above which "sterilization"
is, in fact, only partially effective). This interplay between the
amplification factor of an assay and the threshold that the
detection method defines, can be illustrated. Referring now to
Table 4, bacterial cells are applied to a plate under two different
sets of conditions: in one case, the growth conditions and time are
such that an overall amplification of 10.sup.4 has occurred; in the
other case, the growth conditions and time are such that an overall
amplification of 10.sup.8
21TABLE 4 AMPLIFI- # OF VIABLE BACTERIAL CELLS CATION APPLIED TO A
PLATE FACTOR 1 10 100 1000 10.sup.4 10.sup.4 10.sup.5 10.sup.6
10.sup.7 # of Bacterial cells after Amplification - - + ++
Detection (+/-) 10.sup.8 10.sup.8 10.sup.9 10.sup.10 10.sup.11 # of
Bacterial cells after Amplification ++ +++ +++ ++++ Detection
(+/-)
[0382] has occurred. The detection method is arbitarily chosen to
be visual inspection. The detectable signal will be proportional to
the number of bacterial cells actually present after amplification.
For calculation purposes, the detection threshold is taken to be
10.sup.6 cells; if fewer than 10.sup.6 cells are present after
amplification, no cell colonies are visually detectable and the
sterilization method will appear effective. Given the amplification
factor of 10.sup.4 and a detection threshold of 10.sup.6, the
sterilization sensitivity limit would be 100 bacterial cells; if
less than 100 viable bacterial cells were present in the original
aliquot of the bacterial culture after the sterilization method is
performed, the culture would still appear to be sterilized.
Alternatively, if the time and growth conditions permitted an
amplification of 10.sup.8, then the sterilization sensitivity limit
(assuming the same detection threshhold) would be 1 bacterial cell.
Under the latter conditions, the sterilization method must be
sufficiently stringent that all bacterial cells are, in fact,
incapable of replication for sterilization to appear complete (i.e.
the sterilization method would need to cause sterilization, not
just substantial sterilization).
[0383] B. Sterilization of Potential Carryover
[0384] The same considerations of detection threshold and
amplification factor are present when determining the sensitivity
limit of a sterilization method for nucleic acid. Again, by
"sterilization" it is meant that the nucleic acid is rendered
incapable of replication, and specifically, unamplifiable.
[0385] The post-amplification sterilization method of the present
invention renders nucleic acid substantially unamplifiable. In one
embodiment, the post-amplification sterilization method renders
amplified nucleic acid unamplifiable but detectable. In still
another embodiment, the post-amplification sterilization method of
the present invention contemplates that the number of carryover
molecules of amplifiable nucleic acid that has occurred is small
enough that, in a subsequent amplification, any amplified product
reflects the presence of true target in the sample. In a preferred
embodiment, the post-amplification sterilization method of the
present invention renders amplified segments of a target sequence
substantially unamplifiable but detectable prior to a carryover
event.
[0386] It is not intended that the post-amplification sterilization
method of the present invention be limited by the nature of the
nucleic acid; it is contemplated that the post-amplification
sterilization method render all forms of nucleic acid (whether DNA,
mRNA, etc.) substantially unamplifiable.
[0387] "Template" encompasses both the situation where the nucleic
acid contains one or more segments of one or more target sequences,
and the situation where the nucleic acid contains no target
sequence (and, therefore, no segments of target sequences).
"Template" also encompasses both the situation where the nucleic
acid contains one or more replicatable probes, and the situation
where the nucleic acid contains no replicatable probes. Where
template is used for amplification and amplification is carried
out, there is "amplification product." Just as "template"
encompasses the situation where no target or probe is present,
"amplification product" encompasses the situation where no
amplified target or probe is present.
[0388] The present invention provides "sterilizing compounds" and
methods for using "sterilizing compounds." "Sterilizing compounds"
are defined such that, when used to treat nucleic acid according to
the sterilization method of the present invention, the nucleic acid
is rendered substantially unamplifiable, i.e. substantially
sterilized. The preferred sterilizing compounds of the present
invention are activation compounds.
[0389] While it is not intended that the present invention be
limited to any theory by which nucleic acid is rendered
substantially unamplifiable by the methods and compounds, it is
expected that sterilization occurs by either 1) modification of
nucleic acid, or 2) inhibition of the amplification enzyme itself.
Again, while not limited to any mechanism, it is expected that, if
modification of nucleic acid occurs with sterilizing compounds, it
probably occurs because the compounds react with amplified nucleic
acid to create sufficient adducts per base (i.e. sufficient
"modification density") such that statistically all strands are
prevented from either 1) subsequent use of the denatured nucleic
acid in single stranded form as template for amplification or 2)
dissociation of the double stranded form of the nucleic acid into
single strands, thereby preventing it from acting as a template for
subsequent amplification. On the other hand, it is expected that,
if direct inhibition of the amplification enzyme occurs, it
probably occurs because the sterilizing compound acts via 1)
hydrophobic and hydrophylic interactions, or 2) steric
hindrance.
[0390] In the case of sterilizing compounds modifying nucleic acid,
it is preferred that interaction of the nucleic acid (whether DNA,
mRNA, etc.) with the sterilizing compound causes the amplification
enzyme to differentiate between actual target sequences and
carryover nucleic acid, such that, should amplified nucleic acid be
carried over into a subsequent amplification, it will not be
amplified.
[0391] C. Selective Sterilization
[0392] It is further contemplated that the sterilization method of
the present is useful in conjunction with amplification, without
regard to the carryover problem. In one embodiment, it is
contemplated that sterilization is performed in a selective manner
so that with respect to a mixture of nucleic acid, nucleic acid
desired to be rendered unamplifiable is rendered substantially
unamplifiable, but nucleic acid desired to remain amplifiable
(hereinafter "sheltered nucleic acid") remains amplifiable. The
present invention contemplates three general approaches to this
selective sterilization (and consequent selective
amplification).
[0393] First, the present invention contemplates taking advantage
of the site-specificity of activation compounds, and in particular,
photoreactive activation compounds. In this approach, an activation
compound is selected that has a known site-specificity (or site
preference) for nucleic acid (e.g. TpA site-specificity). It is
preferred that the site-specificity is selected with the knowledge
of the sequence of the sheltered nucleic acid. In this manner, a
site-specificity can be chosen where the activation compound will
bind at non-sterilizing modification densities to the sheltered
nucleic acid (or not bind at all) but will bind at sterilizing
modification densities to the remaining nucleic acid.
[0394] Second, the present invention contemplates taking advantage
of the unique secondary and tertiary structural requirements of
some activation compounds for binding with nucleic acid. In this
case, the sheltered nucleic acid must have different secondary or
tertiary structure than the remaining nucleic acid. An activation
compound requiring secondary or tertiary structure that is lacking
in the sheltered nucleic acid is selected and added to the nucleic
acid mixture. The activation compound binds at non-sterilizing
modification densities with the sheltered nucleic acid and
sterilizing modification densities with the remaining nucleic
acid.
[0395] Finally, the present invention contemplates multiple
sterilizations,in a multiple amplification protocol. Multiple
amplifications systems have been suggested where a first
amplification is carried out by a first polymerase, followed by a
second amplification with a second polymerase. For example, the
first amplification can be used to introduce promotor sites for the
enzyme of the second amplification. Mullis et al., Cold Springs
Harbor Symposia, Vol. L1, p. 263 (1986). G. J. Murakawa et al., DNA
7:287 (1988). In the sterilization approach to these multiple
amplification systems, the present invention takes advantage of the
unique polymerase specificities of activation compounds, and in
particular photoreactive activation compounds. A first activation
compound is selected that, when bound to nucleic acid, will inhibit
amplification by the first polymerase in the first amplification,
but that will not inhibit the second polymerase in the second
amplification. Post-amplification sterilization is carried out
after the first amplification with this first activation compound.
Amplified nucleic acid treated in this manner will not be amplified
by the first polymerase but can be amplified by the second
polymerase. Post-amplification sterilization can later performed
after the second amplification with a second activation compound
that, when bound to nucleic acid, will inhibit amplification with
the second polymerase.
[0396] D. Selecting Activation Compounds for Sterilization
[0397] As noted above, the preferred sterilizing compounds of the
present invention are activation compounds. FIG. 3 outlines the
methods by which activation compounds can be screened for use as
sterilizing compounds. Four "Sterilization Modes" are shown along
with the temporal points where potential reactants of each Mode are
added to the amplification system (the amplification system is
contemplated to encompass all amplification methods, e.g.
target-amplifying or probe-amplifying).
[0398] The Sterilization Modes consist of the following temporal
steps:
22 Mode I Add activation compound then amplify sample, followed by
activation ("triggering") of the activation compound Mode II
Amplify sample then add activation compound, followed by activation
("triggering") of the activation compound Mode III Add
pre-activated ("triggered") activation compound then amplify sample
Mode IV Amplify sample then add pre-activated ("triggered")
activation compound
[0399] In the general case, an activation compound is "triggered"
to an active form. This form provides the sterilizing activity to
the system. The type of triggering required depends on the
properties of the sterilizing compound. For example, thermally
reactive compounds are triggered by providing the correct
temperature while photoreactive compounds are triggered by
providing the appropriate activating wavelengths of electromagnetic
radiation. Thoughtful consideration of FIG. 3 allows any activation
compound to be analyzed as a potential sterilizing compound and
defines its appropriate Mode of application (if any).
[0400] A new compound ("X") can be evaluated as a potential
sterilizing compound. X is initially evaluated in Step A of Mode I.
In Step A, X is added to the sample during the sample preparation
step prior to amplification. The amplification process is performed
and the yield of the amplified product compared to an identical
sample amplified without X. If the amplification yield is similar
in both samples, the sterilization activity of X is evaluated in
Step B of Mode I. In Step B, the appropriate "trigger" is pulled to
activate X after amplification has occurred. For example, if X is a
thermal reagent, the appropriate temperature is provided to
generate the activated form of the compound (X*=generically
activated X). The sterilization effect of X* on the amplified
products is then determined by reamplification of the amplified
products after treatment. If an acceptable level of sterilization
is realized, a separate evaluation is performed to determine the
effect of the modification provided by X* on subsequent detection
of the modified target molecules. In this manner, both the
effectiveness of X as a Mode I sterilization reagent and the
compatibility of the modified amplified target with subsequent
detection formats is evaluated.
[0401] Alternatively, X may inhibit the amplification process in
Mode I, Step A. In this event, X cannot be effectively used in Mode
I; X is thereafter evaluated as a Mode II sterilization reagent. In
Mode II, the temporal order of amplification, compound addition and
triggering are changed relative to Mode I. X is added following
amplification in Mode II, thereby avoiding the amplification
inhibition detected in Mode I. In this fashion, the sterilization
effect of X* on the amplified products can be determined
independent of the negative effect of X on amplification.
Evaluation of the Mode II sterilization activity is done in the
same fashion as for Mode I, Step B.
[0402] The two additional methods which use X for sterilization are
Modes III and IV. In both these Mode, X is triggered to provide X*
prior to addition to the sample. X* is then added to the system
either before (Mode III) or after (Mode IV) amplification.
[0403] In Mode III, X* may be provided then added to the sample
prior to amplification. In the case where X is a photoreactive
compound, X* is the resultant product of the exposure of
photoreactive compound to activating wavelengths of electromagnetic
radiation. If amplification is inhibited with this resultant
product, it may reasonably be suspected that exposure of X to
activating wavelengths of electromagnetic radiation results in
photoproduct.
[0404] In Mode IV, X* is provided then added to the system
following amplification, thereby avoiding any issue of compatablity
with the amplification process. X*, whether a thermally activated
or photoactivated, when provided and used according to Mode IV, can
provide effective sterilization via more than one mechanism. X* may
react with amplified target, non-nucleic acid components of the
system, or both.
[0405] Table 5 summarizes the above.
[0406] As noted in FIG. 3, the choice of the appropriate activation
compound for post-amplification sterilization also depends in part
on the detection method employed. If the detection procedure
involves a hybridization step with the amplified nucleic acid
sequences, it is desired that the amplified sequences be both
available and hybridizable, i.e. they should not be irreversibly
double stranded. If the detection procedure need not involve
hybridization (e.g., incorporation of labelled nucleic acid
precursors or the use of biotinylated primers, which are
subsequently detected), the amplified sequence can normally remain
double stranded. With the preferred method of sterilization, it is
desired that the modification caused by the inactivation procedure
not interfere with subsequent detection steps. In the case of
post-amplification modifications to amplified target
23TABLE 5 EVALUATION OF POTENTIAL STERILIZATION REAGENTS Mode/Step
Result* Interpretation/Next Step I/A + ampl Compound is compatible
with amplication/Evaluate in Mode I, Step B I/A - ampl Compound is
incompatible with amplication/Evaluate in Mode II, Steps A and B
I/A + B + ster Compound is a useful sterilization reagent in Mode
I/Evaluate detection I/A + B - ster Compound is ineffective as a
sterilization reagent in Mode I/Evaluate in Modes II, III and IV II
+ ster Compound is useful for sterilization in Mode II/ Evaluate
detection II - ster Compound is ineffective as a sterilization
reagent in Mode II/Evaluate in Modes III and IV III - ampl Compound
may be useful in Mode IV. III + ampl Compound is compatible with
amplification but not useful for sterilization by definition. IV +
ster Compound is a useful sterilization reagent in Mode IV/Evaluate
detection IV - ster Compound is an ineffective as a sterilization
reagent in Mode IV. *+/- ampl = amplifiation inhibited/amplifiation
not inhibited +/- ster = sterilization effective/sterilization
ineffective
[0407] sequences, it is preferred that there be no impact on
hybridization to or detection of the amplified segment of the
target molecule.
[0408] Environmental factors are important
considerations--particularly during sample preparation. The
preferred compound will not require special handling due to
toxicity or sensitivity to the normal laboratory/clinical
environment, including the normal incandescent or fluorescent
lighting found in such environments. Compounds which are toxic to
the user and/or sensitive to room light will require a special
environment for use. Special environments make the assay inherently
more cumbersome and complex and correspondingly more subject to
error. The supporting instrumentation for such assays likewise
becomes more complicated.
[0409] Because it is desired that amplified nucleic acid not be
exposed to the environment until they are sterilized, a preferred
embodiment of the present invention contemplates the use of
photoreactive compounds for sterilization. As noted earlier,
"photoreactive compounds" are defined as compounds that undergo
chemical change in response to appropriate wavelengths of
electromagnetic radiation. Photoreactive compounds possess the
advantage of allowing inactivation without opening the reaction
vessel (when appropriate reaction vessels are used). Furthermore,
because it is desired that the modification of the amplified
nucleic acid not interfere with subsequent steps, the present
invention contemplates the use of photoreactive compounds that do
not interfere with detection.
[0410] In the preferred embodiment, the invention contemplates
amplifying and sterilizing in a closed system, i.e. the amplified
nucleic acid is not exposed to the environment until modified. In
one embodiment, the present invention contemplates having the
photoreactive compound present in the reaction mixture during
amplification. In this manner, the reaction vessel need not be
opened to introduce the sterilizing compound.
[0411] The use of photoreactive compounds in closed containers
requires that sufficient light of appropriate wavelength(s) be
passed through the vessel. Thus, a light instrument must be used in
conjunction with the present invention to irradiate the sample. As
noted above ("II. PHOTOACTIVATION DEVICES"), instruments with these
features are contemplated by the present invention.
[0412] In general, the sterilization method of the present
invention is a method for treating nucleic acid comprising: a)
providing in any order; i) nucleic acid, ii) amplification
reagents, iii) one or more amplification enzymes, iv) one or more
sterilizing compounds, and v) means for containing a reaction, as
reaction components; b) adding to said reaction containing means,
in any order, said nucleic acid and said amplification reagents, to
make a reaction mixture; and c) adding to said reaction Mixture,
without specifying temporal order, i) said one or more
amplification enzymes, and ii) said one or more sterilizing
compounds.
[0413] In a preferred embodiment, sterilization comprises the
sequential steps: a) providing, in any order, i) one or more
photoreactive compounds, ii) nucleic acid, iii) amplification
reagents, iv) one or more amplification enzymes, and v) means for
containing a reaction; b) adding to the reaction containing means,
in any order, one or more photoreactive compounds, nucleic acid,
and amplification reagents, to make a reaction mixture; adding said
one or more amplification enzymes to said reaction mixture; and d)
treating said mixture with appropriate wavelengths of
electromagnetic radiation so that said photoreactive compounds are
photoactivated.
[0414] "Amplification reagents" are defined as those reagents
(primers, deoxyribonucleoside triphosphates, etc.) needed for
amplification except for nucleic acid and the amplification enzyme.
In one embodiment, the means for containing is a reaction vessel
(test tube, microwell, etc.).
[0415] In another embodiment, sterilization comprises the
sequential steps: a) providing, in any order, i) one or more
photoreactive compounds, ii) nucleic acid, iii) amplification
reagents, iv) one or more amplification enzymes, and v) means for
containing a reaction; b) adding to said reaction containing means,
said nucleic acid and said amplification reagents, followed by one
or more amplification enzymes, to make a reaction mixture; c)
adding said one or more photoreactive compounds to said reaction
mixture; d) treating said mixture with appropriate wavelengths of
electromagnetic radiation so that said photoreactive compounds are
photoactivated.
[0416] While the various embodiments illustrate that the mixing of
photoreactive compound(s), amplification reagents, nucleic acid,
and amplification enzyme(s) can be in any order, it is preferred
that photoreactive compound(s) be added prior to initiation of
amplification (note: the adding of amplification enzyme(s) to the
reaction mixture containing amplification reagents and nucleic acid
will initiate amplification). The method of the present invention
ray have the additional step of detecting amplified nucleic
acid.
[0417] In one embodiment, the photoreactive compound is selected
from the group consisting of psoralens and isopsoralens. The
preferred photoreactive compounds are isopsoralens. In one
embodiment, a cocktail of isopsoralens is used. In another
embodiment, the isopsoralen(s) is selected from the group
consisting of 5-methylisopsoralen, 5-bromomethylisopsoralen,
5-chloromethylisopsoralen, 5-hydroxymethylisopsoralen,
5-formylisopsoralen, 5-iodomethylisopsoralen,
5-hexamethylenetetraminomethylisopsoralen,
5-aminomethylisopsoralen,
5-N--(N,N'-dimethyl-1,6-hexanediamine)-methylisopsoralen,
5-N--[N,N'-dimethyl-(6-[biotinamido]-hexanoate)-1,6-hexane-diamine])-meth-
ylisopsoralen,
5-N--[N,N'-dimethyl-N'-(2-{biotinamido}-ethyl-1,3-dithiopro-
pionate)-1,6-hexanediamine]-methylisopsoralen,
5-N-[N,N'-dimethyl-N'-(carb- oxy-fluorescein
ester)-1,6-hexanediamine)-methylisopsoralen, and their
radiolabelled derivatives. In still another embodiment, the
isopsoralen is selected from the group consisting of
4,5'-dimethylisopsoralen, 4'-chloromethyl-4,5'-dimethylisopsoralen,
4'-bromomethyl-4,5'-dimethyliso- psoralen,
4'-hydroxymethyl-4,5'-dimethylisopsoralen,
4'-formyl-4,5'-dimethylisopsoralen,
4'-phthalimidomethyl-4,5'-dimethyliso- psoralen,
4'-aminomethyl-4,5'-dimethylisopsoralen, 4'-iodomethyl-4,5'-dime-
thylisopsoralen,
4'-N-(N,N'-dimethyl-1,6-hexanediamine)-methyl-4,5'-dimeth-
ylisopsoralen,
4'-N--[N,N'-dimethyl-N'-(6-{biotinamido}-hexanoate)-1,6-hex-
anediamine]methyl-4,5'-dimethylisopsoralen,
4'-N--[N,N'-dimethyl-N'-(2-{bi-
otinamido}-ethyl-1,3-dithiopropionate)-1,6-hexanediamine]-methyl-4,5'-dime-
thylisopsoralen, 4'-N--[N,N'-dimethyl-N'-(6-carboxyfluorescein
ester)-1,6-hexanediamine)-methyl-4,5'-dimethylisopsoralen, and
their radiolabelled derivatives.
[0418] While the preferred compound for controlling carryover
according to the methods of the present invention is an
isopsoralen, the present invention contemplates sterilization with
psoralens as well. In one embodiment, the linear furocoumarin
4'-aminomethyl-4,5', 8-trimethylpsoralen (AMT) is used as a
post-amplification sterilization reagent.
[0419] The present invention contemplates using photoproduct for
sterilization. In this embodiment, sterilization comprises the
sequential steps: a) providing, in any order, i) photoproduct, ii)
nucleic acid, iii) amplification reagents, iv) one or more
amplification enzymes, and v) a means for containing a reaction; b)
adding to said reaction containing means, in any order, said
nucleic acid and said amplification reagents, to make a reaction
mixture; c) adding said one or more amplification enzymes to said
reaction mixture; and d) adding said photoproduct to said reaction
mixture.
[0420] In this embodiment, photoproduct is created prior to
amplification but introduced after amplification. In another
embodiment, photoproduct is made after and introduced after
amplification. Photoproduct is made, therefore, at any time prior
to mixing with the amplified nucleic acid. However, in both
embodiments, photoproduct is not present in the reaction mixture
during amplification.
[0421] Photoproduct can be both provided and added manually or by
an automated system. For example, it is contemplated that
photoproduct be made in and introduced from a compartment in a
reaction vessel. The compartment is separated from the remaining
vessel by a barrier (e.g. a menbrane) that is removable in a
controlled manner. In the removable barrier approach, photoproduct
is made by exposing the entire reaction vessel [with the
compartment containing photoreactive compound(s)] to the
appropriate wavelength(s) of electromagnetic radiation. When
photoproduct is to be added, the barrier is then removed and the
newly formed photoproduct added to the amplified product.
[0422] In another embodiment, photoproduct is made separately in a
first reaction vessel and then injected into a second reaction
vessel containing nucleic acid without opening the second reaction
vessel. Injection is by a small needle; the needle can be
permanently fixed in the side of the vessel if desired.
[0423] In still another embodiment, photoproduct is made in a first
reaction vessel and pipetted into a second reaction vessel
containing nucleic acid. While other arrangements are possible, it
is preferred that the pipetting be performed in an automated manner
in the housing of a machine large enough to contain the first
reaction vessel and the second reaction vessel. The housing serves
to contain any carryover while the reaction vessels are open.
[0424] The sterilization method utilizing photoproduct may comprise
additional steps such as a detection step. In one embodiment, the
detection step involves detection of amplified target(s). In
another embodiment, the detection step involves detection of
amplified probe(s).
[0425] E. Polymerase Chain Reaction
[0426] In one embodiment, the present invention contemplates
controlling the carryover associated with PCR. This embodiment is
broadly referred to as "Post-Amplification Sterilization of Target
from PCR" or "PAST PCR." For purposes here, a "target sequence" is
further defined as the region of nucleic acid bounded by the
primers used for PCR. A "segment" is defined as a region of nucleic
acid within the target sequence. As noted above, the present
invention contemplates sterilization whether or not the sample
prepared for amplification contains a segment of a target sequence
that can be amplified. Whether or not their is a segment of a
target sequence that can be amplified, there is "PCR product." For
definitional purposes, "PCR product" refers to the resultant
mixture of compounds after two or more cycles of the PCR steps of
denaturation, annealing and extension are complete. "PCR product"
encompasses both the case where there has been amplification of one
or more segments of one or more target sequences, and the case
where there has been no amplification.
[0427] A general nucleic acid screening protocol involving PCR
amplification is schematically illustrated in FIG. 4. The steps are
broadly characterized as 1) sample preparation, 2) amplification,
and 3) detection. The lower time lines of FIG. 4 schematically
illustrate the temporal sequence for a) the addition of sterilizing
compound(s), and b) the activation of sterilizing compound(s)
according to a preferred embodiment of the method of the present
invention.
[0428] Amplification cycling requires "PCR reagents." "PCR
reagents" are here defined as all reagents necessary to carry out
amplification except polymerase and template. PCR reagents normally
include nucleic acid precursors (dCTP, dTTP, etc.) and primers in
buffer. See K. B. Mullis et al., U.S. Pat. Nos. 4,683,195 and
4,683,202, both of which are hereby incorporated by reference.
[0429] PCR is a polynucleotide amplification protocol. The
amplification factor that is observed is related to the number (n)
of cycles of PCR that have occurred and the efficiency of
replication at each cycle (E), which in turn is a function of the
priming and extension efficiencies during each cycle. Amplification
has been observed to follow the form E.sup.n, until high
concentrations of PCR product are made. At these high
concentrations (approximately 10.sup.-8 M/l) the efficiency of
replication falls off drastically. This is probably due to the
displacement of the short oligonucleotide primers by the longer
complementary strands of PCR product. At concentrations in excess
of 10.sup.-8 M, the kinetics of the two complementary PCR amplified
product strands of finding each other during the priming reactions
become sufficiently fast that they will occur before or
concomitantly with the extension step of the PCR procedure. This
ultimately leads to a reduced priming efficiency, and therefore, a
reduced cycle efficiency. Continued cycles of PCR lead to declining
increases of PCR product molecules. PCS product eventually reaches
a plateau concentration.
[0430] Table 6 illustrates the relationship of PCR cycle number to
the number of PCR product strands that are made as a function of a
wide range of starting target molecules (initial copy number). The
efficiency of amplification was taken to be 1.85 per cycle, a value
measured while using methods of the present invention for the HIV
system with the SK38/SK39 primers. Included in Table 6 is the PCR
product concentration that is observed if the PCR reaction were to
take place in 100 ul volume. The gray area indicates conditions
that give rise to PCR products that are in excess of 10.sup.-8 M/l.
In these gray regions, PCR product would be expected to be
approaching the plateau state. Also shown in Table 6 is a signal
(CPM) for a hybridization assay that is
24TABLE 6 INITIAL COPY NUMBER Amplifi- cation Factor Cycle
(1.85).sup.n 1 10 10.sup.2 10.sup.3 10.sup.4 10.sup.5 3 .times.
10.sup.5* 20 2.20 .times. 10.sup.5 2.2 .times. 10.sup.5 2.2 .times.
10.sup.6 2.2 .times. 10.sup.7.sup. 2.2 .times. 10.sup.8 2.2 .times.
10.sup.9.sup. 2.2 .times. 10.sup.10 6.6 .times. 10.sup.10 PCR
product molecules 3.6 .times. 10.sup.-15 3.6 .times. 10.sup.-14
.sup. 3.6 .times. 10.sup.-13 3.6 .times. 10.sup.-12 3.6 .times.
10.sup.11 .sup. 3.6 .times. 10.sup.-10 1.0 .times. 10.sup.-9 PCR
Pro- duct (M/I) 0 0 2.4 24 240 2,400 7,100 CPM's 25 4.78 .times.
10.sup.6 4.8 .times. 10.sup.6 4.8 .times. 10.sup.7 4.8 .times.
10.sup.8.sup. 4.8 .times. 10.sup.9 4.8 .times. 10.sup.10 4.8
.times. 10.sup.11 1.4 .times. 10.sup.12 7.9 .times. 10.sup.-14 7.9
.times. 10.sup.-13 7.9 .times. 10.sup.12 7.9 .times. 10.sup.-11
.sup. 7.9 .times. 10.sup.-10 7.9 .times. 10.sup.-9 2.4 .times.
10.sup.-8 0 5 52 520 5,200 .sup. 52 .times. 10.sup.4 1.5 .times.
10.sup.5.sup. 30 1.03 .times. 10.sup.8 1.0 .times. 10.sup.8 1.0
.times. 10.sup.9 1.0 .times. 10.sup.10 .sup. 1.0 .times. 10.sup.11
1.0 .times. 10.sup.12 1.7 .times. 10.sup.12 .sup. 1.7 .times.
10.sup.11 1.7 .times. 10.sup.10 1.7 .times. 10.sup.9 1.7 .times.
10.sup.-8 11 110 1,100 1.1 .times. 10.sup.4 1.1 .times.
10.sup.5.sup. 35 2.24 .times. 10.sup.9 2.2 .times. 10.sup.9 .sup.
2.2 .times. 10.sup.10 2.2 .times. 10.sup.11 .sup. 2.2 .times.
10.sup.12 3.6 .times. 10.sup.11 .sup. 3.6 .times. 10.sup.10 3.6
.times. 10.sup.11 .sup. 3.6 .times. 10.sup.-8 240 2,400 2.4 .times.
10.sup.4.sup. 2.4 .times. 10.sup.5 40 .sup. 4.86 .times. 10.sup.10
4.9 .times. 10.sup.10 .sup. 4.9 .times. 10.sup.11 4.9 .times.
10.sup.12 8.0 .times. 10.sup.10 8.0 .times. 10.sup.9 8.0 .times.
10.sup.-8 5,200 5.2 .times. 10.sup.4 5.2 .times. 10.sup.5.sup. *1
ug genomic DNA
[0431] used to detect the presence of PCX product. This signal is
calculated on the basis of having a 10% hybridization efficiency of
a .sup.32P labelled probe (3000 Ci/mM) to a 20 .mu.l aliquot of the
100 .mu.l PCR reaction mix.
[0432] While not limited to any particular theory, the present
invention contemplates that, when an adduct is present on a PCS
target sequence within the segment of the target sequence bounded
by the primer sequences, the extension step of the PCR process will
result in a truncated, complementary strand that is incapable of
being replicated in subsequent cycles of the PCR process. As
discussed above ("V. INHIBITING TEMPLATE-DEPENDENT ENZYMATIC
SYNTHESIS") isopsoralens attached to a DNA polymer represent a stop
for Taq polymerase extension reactions. In one embodiment, the
present invention contemplates that such isopsoralens are effective
in rendering a fraction of the starting target molecules incapable
of amplification by the PCR process with Taq polymerase.
Importantly, the sterilization protocol will be incomplete if some
of the target molecules escape modification by the photochemical
modification process. This process is, by its nature, a statistical
process. This process can be characterized by measuring an average
number (a) of adducts per DNA strand. Not all of the strands will
have a adducts per strand. If the addition reaction is governed by
Poisson statistics, the fraction of molecules that contain n
modifications in a large population of molecules that have an
average of a modifications is giver, by f.sub.a(n) (see Table 7). A
fraction of molecules, f.sub.a(0), will contain no modifications
and are therefore considered non-sterilized. Table 7 evacuates tie
non-sterilized fraction of DNA strands that are expected if an
25TABLE 7 POISSON STATISTICS APPLIED TO STERILIZATION f.sub.a(n) =
[.sub.an.sub.e - a]/n! .sub.N=106, f.sub.a(0) = .sub.e.sup.a a
f.sub.a(0) Nf.sub.a(0) 3 0.050 5.0 .times. 10.sup.4 4 0.018 1.8
.times. 10.sup.4 5 0.007 6.7 .times. 10.sup.3 6 0.0025 2.5 .times.
10.sup.3 7 0.0009 9.1 .times. 10.sup.2 8 0.0003 3.3 .times.
10.sup.2 9 0.00012 1.2 .times. 10.sup.2 10 0.000045 45.0 11
0.000017 17.0 12 0.0000061 6.1 13 0.0000023 2.2 14 0.00000083 .8 15
0.00000030 .3 16 0.00000011 .1 17 0.00000004 0.04 a = Average
number of adducts per strand f.sub.a(0) = Fraction of strands with
zero adducts when the average number of adducts per strand is a.
Nf.sub.a(0) = The number of non-sterilized molecules, calculated
for a total of 10.sup.6 molecules (N = 10.sup.6)
[0433] average of a modifications per strand exists. Although the
fraction of molecules with no modifications is small for all values
of a, the expected number of non-sterilized molecules is large when
sterilization is applied to a large number of molecules (N). For
example, if carryover consisted of 10.sup.6 product strands, Table
7 shows that 2.5.times.10.sup.3 non-sterilized target molecules are
expected if there is an average of 6 effective adducts per strand
of PCR product. Effective adducts are those adducts that occur in
the segment of a target molecule that is bounded by the primer
sequences. For the HIV system this corresponds to 6 adducts in the
56 base long segment between the primer sequences on the 115-mer
target molecule. This level of effective adducts corresponds to an
average strand modification density of 1 adduct per 9.3 bases.
[0434] Ideally, one would like to be able to sterilize a PCR
reaction mixture such that a major spill of the reaction would not
lead to a carryover problem. A 100 .mu.l PCR sample mixture with
PCR product at a plateau concentration of 1.times.10.sup.-8 M
contains 6.times.101 complementary PCR product strands.
Sterilization of this sample to a level where the expected number
of non-sterilizing target molecules is less than one requires that
f.sub.a(0)*6.times.10.sup.11 be less than one (here "sterilized
target molecule" means a target molecule that contains at least one
adduct). By extending the data in Table 7 and assuming a reaction
volume of 100 ul, the statistical view of sterilization predicts
that 28 adducts per strand of PCR product is sufficient to achieve
this level of sterilization. If the number of target strands made
by the PCR procedure are increased or reduced, the average number
of adducts per strand required to achieve this level of
sterilization will change accordingly. For the HIV 115-mer system
that has reached plateau concentrations of product
(6.times.10.sup.11 molecules), this level of sterilization occurs
(28 average effective adducts per strand) when the average
modification density is increased to 1 adduct per 2 bases.
[0435] Alterations of the modification density can be expected
through the use of different photoreactive compounds, or the use of
the same photoreactive compound at different concentrations. In
particular, the modification density is expected to increase
through the use of the same photochemical agent at higher
concentrations, and attaching the photochemical agent by exposure
to actinic light from a device whose optical properties enhance
covalent binding.
[0436] For a fixed modification density there is another method of
improving the sterilization sensitivity limit. The important
statistical parameter for sterilization sensitivity is the average
number of adducts per PCR strand. By choosing PCR primers
judiciously, the length of the PCR products can be varied, and
therefore, the average number of adducts per stand can be varied.
Table 8 illustrates this effect for two different modification
densities. In Case A, a modification density of 1 adduct per 5
bases is assumed. Under these conditions a PCR product
oligonucleotide 200 bases in length should have approximately 30
effective adducts per strand. At this level of modification, less
than one PCR product molecule in a 100 .mu.l PCR reaction tube
would be expected to have no adducts per strand, and therefore,
essentially all of the molecules in the reaction tube would be
expected to be sterilized. Case B in Table 8 considers the
situation in which the modification density is reduced to 1 adduct
per 9 bases. Under these conditions, the same level of
26TABLE 8 EXPECTED NUMBER OF NON-STERILIZED PCR MOLECULES AS A
FUNCTION OF PCR PRODUCT LENGTH Length of *Average effective
Non-Sterilized Molecules PCR Product Adducts/Strand per 6 .times.
10.sup.11 Starting Molecules CASE A: (1 adduct per 5 bases) 100 10
2.7 .times. 10.sup.7 150 20 1.2 .times. 10.sup.3 200 30 <1 250
40 <<1 300 50 <<1 CASE B: (1 adduct per 9 bases) 100
5.5 2.4 .times. 10.sup.9 150 11.1 9.1 .times. 10.sup.6 200 16.6 3.7
.times. 10.sup.4 250 22.2 137 300 27.7 <1 *Assumes that to be
effective, the adducts must be in the segment of the PCR product
that is bounded by the primers. For calculation purposes, the
primer lengths were taken to be 25 bases each.
[0437] sterilization requires that the PCR product be at least 300
bases in length for a sufficient number of effective adducts to be
present on each strand.
EXPERIMENTAL
[0438] The following examples serve to illustrate certain preferred
embodiments and aspects of the present invention and are not to be
construed as limiting the scope thereof.
[0439] In the experimental disclosure which follows, the following
abbreviations apply: eq (equivalents); M (Molar); .mu.M
(micromolar); N (Normal); mol (moles); mmol (millimoles); .mu.mol
(micromoles); nmol (nanomoles); gm (grams); mg (milligrams); .mu.g
(micrograms); L (liters); ml (milliliters); .mu.l (microliters); cm
(centimeters); mm (millimeters); .mu.m (micrometers); nm
(nanometers); .degree. C. (degrees Centigrade); Ci (Curies); mp
(melting point); m/e (ion mass); MW (molecular weight); OD (optical
density); EDTA (ethylenediamine-tetraceti- c acid); 1.times.TE
(buffer: 10 mM Tris/1 mM EDTA, pH 7.5); 1.times.Taq (buffer: 50 mM
KCl, 2.5 mM MgCl.sub.2, 10 mM Tris, pH 8.5, 200 .mu.g/ml gelatin);
C/M (chloroform/methanol); C/E/T (chloroform/ethanol/triethylam-
ine); C/B/A/F (chloroform/n-butanol/acetone/formic acid); DMF
(N,N-dimethylformamide); PAGE (polyacrylamide gel electrophoresis);
UV (ultraviolet); V (volts); W (watts); mA (milliamps); bp (base
pair); CPM (counts per minute); DPM (disintegrations per minute);
TLC (Thin Layer Chromatography); HPLC (High Pressure Liquid
Chromatography); FABMS (Fast Atom Bombardment Mass
Spectrometry--spectra obtained on a Kratos MS50 instrument--Kratos
Analytical, Manchester, England); EIMS (Electron Impact Mass
Spectrometry--spectra obtained on an AEI MS-12 Mass
Spectrometer--Associated Electric Industries, Manchester, England);
NMR (Nuclear Magnetic Resonance; spectra obtained at room
temperature on either a 200 MHz or 250 MHz Fourier Transform
Spectrometer); Aldrich (Aldrich Chemical Co., Milwaukee, Wis.);
Baker (J. T. Baker, Jackson, Tenn.); Beckman (Beckman Instruments,
San Ramon, Calif.); BRL (Bethesda Research Laboratories,
Gaithersburg, Md.); Cyro (Cyro Industries, Wood Cliff Lake, N.J.);
DNEN (Dupont-New England Nuclear, Wilmington, Del. 19805); Gelman
(Gelman Sciences, Ann Arbor, Mich.); Eastman (Eastman Kodak,
Rochester, N.Y.); Eastman TLC Plates (#13181 TLC plates with
fluorescent indicator, Eastman); EM (EM Science, Cherry Hill,
N.J.); Lawrence (Lawrence Berkeley Laboratory, Berkeley, Calif.);
Mallinckrodt (Mallinckrodt, St. Louis, Mo.); Pierce (Pierce
Chemical Co., Rockford, Ill.); Polycast (Polycast Technology Corp.,
Stamford, Conn.); Rohm and Haas (Rohm and Hass Co., Los Angeles,
Calif.); Sigma (Sigma Chemical Co., St. Louis, Mo.); Spectrum
(Spectrum Medical Industries, Los Angeles, Calif.).
[0440] To better characterize the devices of the present invention,
a customized light instrument (hereinafter referred to as "the PTI
device") was constructed from commerically available parts (at a
cost of approximately $10,000.00) to serve as a control. The device
is a modified version of a described device. G. D. Cimino et al.,
Biochemistry 25, 3013 (1986). Some machining was necessary to
retrofit some of the commercial parts and to make specialized
adapters and holders.
[0441] A 500 watt Hg/Xe arc lamp (Model A5000, Photon Technology
International) positioned at the focal point of an elliptical
mirror in a commercial lamp housing provides the light for the PTI
device. The output from the lamp housing passes into an adaptor
tube which provides physical support for additional optical
accessories and prevents harmful stray UV radiation from emanating
into the lab. A mirror deflects the optical bear in the adaptor
tube so that it passes through the other optical components.
[0442] Two water-cooled, liquid filters are used. These filters
have been selected to provide wavelengths of electromagnetic
radiation that are appropriate for furocoumarin photochemistry.
(Other photoreactive compounds may have wavelength requirements
which are quite different from the furocoumarins.) The first filter
is fitted with suprasil windows, filled with H.sub.2O, and is used
to filter out infrared radiation (IR). Exclusion of IR is required
to prevent undesired heating of the sample chamber during
irradiation, since addition of furocoumarins to nucleic acid is
reduced at elevated temperatures. The second liquid filter provides
a window of 320-400 nm light for use with furocoumarin
photochemical reactions. This particular wavelength window (320-400
nm) excludes both shorter and longer wavelengths which are
inappropriate for furocoumarin photochemistry. For example,
furocoumarin:nucleic acid complexes undergo photochemical reversal
at wavelengths below 313 nm. Exclusion of these wavelengths is
necessary for irreversible photobinding of the furocoumarins to
occur. This filter (9 cm in length) is fitted with 0.6 cm pyrex
windows and filled with an aqueous solution of 0.85% cobaltous
nitrate, 2% sodium chloride. An optical diffuser between the the
first filter and the second filter provides even illumination over
the entire width of the light beam. This diffuser consists of a
ground suprasil plate (0.6 cm) fitted into a lens holder.
[0443] Light exiting from the first filter passes through an iris
so that beam intensity can be controlled. Two lenses focus the beam
within the sample holder by first passing the beam through a
shutter system, then through the exit of the adaptor tube and
finally across a second mirror. The shutter system consists of a
rotary solenoid attached to a metal blade which passes between the
exit hole of the adaptor tube and a similar hole in a second
aluminum plate. This second plate resides adjacent to the exit port
of the adaptor tube and also serves as a mount for the solenoid.
The power to the solenoid is controlled by a relay which is run off
a timer. The sample holder is composed of rectangular brass and can
be irradiated either through the side or from the top. It has been
machined with passages for the flow of liquids. Thermoregulation of
a sample is achieved by connecting this holder to a thermoregulated
circulating water bath. The sample holder also contains passages
that allow the flow of gasses over the surfaces of the sample
vessels (ie. cuvette faces, etc.) to prevent condensation of water
on these surfaces while irradiating at low temperatures. The
orifice for the sample vessel in the sample holder is 1 inch by 1
inch by 2.5 inches. A brass adaptor, with slots for the passage of
light, permits standard cuvettes to be used, as well as 13 mm test
tubes and Eppendorf tubes. The base of the sample holder is hollow
so that a bar magnet attached to a small motor can be inserted
beneath the sample vessel and function as a magnetic stirrer.
Alternatively, the holder can be placed on top of a laboratory stir
plate to achieve stirring capabilities. With this irradiation
device, the light beam is approximately 0.8 cm diameter at the
focal point and it has an intensity of 340 mW/cm.sup.2, as measured
with a Model J-221 UV meter (UV Products, San Gabriel, Calif.).
[0444] The PTI device allows for comparisons of the performance
characteristics of the devices of the present invention against the
performance characteristics of the more expensive PTI device. The
performance characteristics examined in some of the examples below
include: A) Thermal Stability, B) Spectral Output, C) Irradiation
Intensity, D) Irradiation Uniformity, and E) Photoactivation
Efficiency.
[0445] Unless otherwise noted, all sample solutions prepared for
irradiation were contained in Eppendorph tubes and irradiated
through the sides of the tubes (CE-I, CE-II and CE-III) or through
the top of the tubes (PTI). Eppendorph tubes have a transmittance
of only 8 to 15% for wavelengths in the range of 300 nm to 400 nm
(data not shown). Therefore, approximately 90% of the actinic light
is lost by the use of these sample vessels. Although Eppendorph
tubes are the most convenient sample vessels for biochemical and
molecular biological procedures, other types of irradiation vessels
having better transmission characteristics are comtemplated (e.g.
quartz, pyrex, polycarbonate etc.)
[0446] Concentrations for photoproduct are given in terms of the
amount of unirradiated starting material, where subsequent
irradiation is performed in the absence of nucleic acid. For
example, if 50 .mu.g/ml of unirradiated starting material is
subsequently irradiated in the absence of DNA, the concentration of
resulting photoproduct is given as 50 .mu.g/ml.
[0447] The starting compound (unirradiated compound) for
photoproduct is sometimes indicated when photoproduct is referred
to. For example, the photoproduct produced following irradiation of
AMDMIP is referred to as AMDMIP photoproduct.
[0448] Where polyacrylamide gel electrophoresis (PAGE) is used,
denaturing (7 or 8 M urea) polyacrylamide gels (28 cm.times.35
cm.times.0.4 mm) were poured and pre-electrophoresed for 30 to 60
minutes at 2000 Volts, 50 Watts, 25 milliamps. 12% gels were used
for oligonucleotides between 40 and 200 base pairs in length; 8%
gels were used for longer sequences. Depending on the length of DNA
to be analyzed, samples were loaded in either 8M urea, containing
0.025% tracking dyes (bromphenol blue and xylene cyanol), or in 80%
formamide, 10% glycerol, 0.025% tracking dyes, then electrophoresed
for 2-4 hours at 2000 Volts, 50 Watts, 25 milliamps. Following
PAGE, individual bands were, in most cases, visualized by
autoradiography. Autoradiography involved exposure overnight at
-70.degree. C. to Kodak XAR-5 films with an intensifying screen. In
some cases, the visualized bands were cut from the gel and
collected for scintillation counting. Scintillation counting
involved the use of a scintillation fluid and a commercial
scintillation counter (Searle Analytic 92, Model # 000 006893).
[0449] Generally, PCR was carried out using 175-200 .mu.M dNTPs
(deoxyribonucleoside 5'-triphosphates) and 0.5 to 1.0 .mu.M
primers. 5 Units/100 .mu.l of Taq polymerase was used. PCR
reactions were overlaid with 30-100 .mu.l light mineral oil. A
typical PCR cycle for HIV amplification using a Perkin-Elmer Cetus
DNA Thermal Cycler (Part No. N8010150) was: denaturation at
93.degree. C. for 30 seconds; annealing at 55.degree. C. for 30
seconds; and extension at 72.degree. C. for 1 minute. PCR cycles
were normally carried out in this manner for 30 cycles followed by
7 minutes at 72.degree. C.
[0450] In many cases, PCR was carried out on an HIV system. This
system provides a 115-mer product designated HRI 46:
[0451] 5'-ATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCT
GGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAA
GACAAGGACCAAA-3'
[0452] and its complement, designated HRI 47:
[0453] 3'-TATTAGGTGGATAGGGTCATCCTCTTTAAATATTTTCTACCTATTAGGA
CCCTAATTTATTTTATCATTCTTACATATCGGGATGGTCGTAAGACCTGTATT
CTGTTCCTGGTTT-5'.
[0454] These sequences were used by C. Y. Ou et al., Science
239:295 (1988).
[0455] In many of,the examples below, compounds are referred to by
their abbreviation (see Tables 2 and 3) and/or number (see FIGS. 1
and 2). For example, "(MIP,3)" indicates the compound is
5-Methylisopsoralen (Table 2) and compound 3 in FIG. 1.
EXAMPLE 1
Synthesis of 5-Methylisopsoralen (MIP,3)
[0456] Method 1 (Three Steps)
[0457] Step 1: 5-methylresorcinol monohydrate (284 gm, 2.0 mol;
Aldrich) was thoroughly mixed with malic acid (280 gm, 2.10 mol;
Aldrich) and then placed in a reaction flask containing sulfuric
acid (600 ml) and a trace of sodium bisulfite (1.0 gm; Aldrich).
The reaction mixture was heated to 90.degree. C. while being
mechanically stirred until evolution of carbon dioxide subsided
(about 5 hours). The resulting reddish-orange solution was poured
into sufficient ice (with vigorous stirring) to make up 1 liter.
The receiving flask was maintained at 0.degree. C. by external
cooling until the addition of the reaction mixture was complete.
The resulting light-orange product that precipitated was collected
by suction filtration then washed thoroughly with water. The crude
product was air dried on the filter, then recrystallized twice from
tetrarethylene glycol (1800 ml) to give pure
7-hydroxy-5-methylcoumarin (H5MC,1) as product (220 gm, 62% yield;
mp 252-255.degree. C.).
[0458] Step 2: H5MC (177 gm. 1.0 mol), bromoacetaldehyde
diethylacetal (207 gm, 1.05 mol. Aldrich), potassium carbonate (100
gm) and freshly distilled dimethylformamide (125 ml) were mixed in
a 3 neck reaction flask fitted with a mechanical stirrier and argon
line. The reaction was heated and stirred at 100.degree. C. for 43
hours after which all the starting material had been converted to a
high Rf TLC spot (Eastman TLC Plates: developed with C/M 98:2:
detection with 260 nm ultraviolet light. Unreacted acetal and
solvent were removed by distillation under reduced pressure. Water
(1500 ml) was added to the residue followed by extraction with
chloroform (1000 ml). The chloroform was then repeatedly washed
with 1N sodium hydroxide until colorless. Evaporation of the
solvent gave the product, the diethoxyethyl ether of
7-hydroxy-5-methylcoumarin (DEMC,2) as an oil (217 gm: 82.4%
yield).
[0459] Step 3: Glacial acetic acid (310 ml) and zinc chloride (98
gm, 0.72 mol) were placed in a flask fitted with an internal
thermometer then heated to between 100.degree. and 114.degree..
DEMC (50 gm, 0.17 mol) was added to the hot solution and stirred
vigorously at temperature for 17 minutes. The hot solution was then
poured onto a mixture of ice (1000 ml) and CHCl.sub.3 layer was
then separated (emulsion) followed by repeated washing with water
(500 ml portions). Wshing was continued until the pH of the water
was neutral. Finally, the CHCl.sub.3 layer was washed with
saturated NaCl (500 ml), dried (MgSO4), and the solvent removed by
distillation. The crude dark product (7.7 gm) (mixture of
5-methylisopsoralen and f-methylpsoralen) was dissolved in a small
volume of chloroform, washed with 1N NaOH (to remove phenols),
washed with water, then brine, then chromatographed on a flash
column (EM silica gel, 200-400 mesh), eluting with ethyl
acetate/hexanes 70:30 to give the pure product, 5-methylisopsoralen
(MIP) (4.7 gm, 13.8%; mp 189.5-191.5.degree. C.). NMR (CDCl3) d
2.59 (3 H, s), 6.37 (1 H, d), 7.05 (1 H, d) , 7.23 (1 H, s) , 7.59
(1 H, d) , 7.96 (1 H, d).
EXAMPLE 2
Synthesis of MIP: Method 2 (Two Steps)
[0460] Step 1: H5MC was made from 5-methylresorcinol hydrate as
described in Step 1 of Method 1 (Example 1).
[0461] Step 2: H5MC (1.76 gm, 10 mmol) and chloroethylene carbonate
(6.13 gm, 50 mmol, Aldrich) were heated between 150-165.degree. C.
for 1.5 hours. Following this period, the dark reaction mixture was
poured onto ice. This was extracted with chloroform, the chloroform
washed with base (0.5N NaOH), water and then dried
(Na.sub.2SO.sub.4). Removal of the solvent under reduced pressure
gave a brownish syrup (0.7 gm), from which pure product, MIP, was
isolated by flash chromatography (EM silica gel, 200-400 mesh),
eluted with C/M 98:2. The yield of MIP by this second method was
270 mg (13.5%).
EXAMPLE 3
Radiolabelled MIP Synthesis
[0462] Step 1: MIP (58 mg; 0.29 mmol), 10% palladium on charcoal
(29 mg, Aldrich), and glacial acetic acid (7.0 ml) were placed in a
small round bottom flask, attached to a vacuum line, frozen with
liquid nitrogen, and then the reaction vessel was evacuated.
Carrier free tritium, gas (Lawrence; 60 Ci/mmol) was added to
slightly below 1 atmosphere, and the round bottomed flask was
warmed briefly in a 60.degree. C. water bath to redissolve the MIP.
The heterogeneous mixture was stirred at room temperature for 1
hour after which approximately 0.31 mmol tritium gas had been
consumed. The mixture was frozen, the tritium gas evacuated,
methanol (10 ml) added, and the slurry centrifuged to remove the
catalyst. The supernatant was decanted, frozen and then
lyophilized. Following lyophilization, TLC (chroloform) of the
residue revealed unreacted strting material, a low Rf blue
fluorescent spot corresponding to
[4',5'-.sup.3H.sub.2]-4'5'-dihydro-5-MIP and a high Rf
nonfluorescent spot corresponding to
[3,4,4',5'-.sup.3H.sub.4]-3,4,4',5'-tetrahydro-5-MI- P.
[4',5'-.sup.3H.sub.2]-4'5'-dihydro-5-MIP was isolated by column
chromatography on a 0.5.times.8-inch silica column (60-200 mesh,
Baker) eluted with CH.sub.2Cl.sub.2. The recovery was 30-40 mg.
This compound was used in Step 2 directly for the preparation of
labelled MIP.
[0463] Step 2: [4',5'-.sup.3H.sub.2]-4'5'-dihydro-5-MIP of Step 1
(30-40 mg), 10% palladium on charcoal (32 mg, Aldrich) and
diphenylether (5.0 ml, Aldrich) were placed in a small round bottom
flask with attached argon line then refluxed for 28 hours.
Following this period, TLC (CH.sub.2Cl.sub.2) indicated that most
of the starting material had been converted to
[4',5'-.sup.3H.sub.2]-5-MIP (as determined by co-chromatography
with authentic MIP). The product was purified by chromatogrphy on 2
silica columns (60-200 mesh, Baker, eluted with CH.sub.2Cl.sub.2).
The fractions containing the purified product were combined, the
solvent evaporated under reduced pressure, and the residue
dissolved in absolute ethanol.
[0464] The specific activity of the compound was established by
measuring the optical density of the stock solution to determine
its concentration, then counting appropriate aliquots of the
stock:. In this manner, the specific activity of tritiated
[4',5'-.sup.3H.sub.2]-5-MIP ("tritiated MIP") product was
determined to be 7.4 Ci/mmol.
[0465] The radiochemical purity was determined by HPLC.
Approximately 10.sup.6 CPM of tritiated MIP was mixed with 10 ug
unlabelled MIP in 50 ul of ethanol (100%). The sample was injected
on a C18 octadecasilyl reverse phase chromatography column
(Beckman) and eluted with a water/methanol gradient as follows:
0-10 minutes, 100% H.sub.2O; 10-70 minutes, 100% H.sub.2O-100%
CH.sub.3OH; 70-80 minutes, 100% CH.sub.3OH. Eighty 1.0 ml fractions
were collected and 40 ul of each fraction counted. Greater than 99%
of the radioactivity co-chromatographed with the optical peak
corresponding to tritiated MIP.
EXAMPLE 4
Halomethylisopsoralen Synthesis
[0466] This example involves the synthesis of a
halomethylisopsoralen, in this case 5-bromomethylisopsoralen
(BMIP,5) from MIP. MIP (1.80 gm, 9 mmol) was dissolved CCl.sub.4
(193 ml) at reflux. N-bromosuccinimide (1.65 gm, 9 mmol, Aldrich)
and dibenzoylperoxide (0.22 gm, 0.9 mmol, Aldrich) were added to
the boiling solution and the mixture refluxed for four hours while
being monitored by TLC (Eastman TLC Plates; developed with C/M
98:2; detection with 260 nm ultraviolet light). Following this
period, the boiling mixture was filtered hot and the filtrate set
aside to cool then held at 0.degree. C. for 24 hrs. The resulting
crystals (light yellow needles) were collected by filtration,
dissolved in CHCl.sub.3 (140 ml) then washed with water (140
ml.times.4). The CHCl.sub.3 solution was dried (anhydrous
MigSo.sub.4) then concentrated by rotary evaporation under reduced
pressure to provide the product, BMIP, as yellow crystals (1.75 gm,
68.7%, m.p. 201-204.degree. C. with decomposition). NMR (CDCl3) d
8.06 (d. H-4), 7.64 (d. H-5') , 7.41 (s, H-6) , 7.05 (m, H-4'),
6.43 (d, H-3), 4.72 (s, CH.sub.2Br).
EXAMPLE 5
Synthesis of 5-Aminomethylisopsoralen (AMIP, 10)
[0467] Method 1 (four steps)
[0468] Step 1: The first step of the first method of the present
invention for synthesizing AMIP from XMIP involves the synthesis of
5-Hydroxymethylisopsoralen (HMIP,6). XMIP is chosen to be BMIP for
purposes of this step.
[0469] BMIP (0.2 gms, 0.71 mmol) was refluxed in distilled water
(20 ml) while being monitored by TLC (Eastman TLC Plates; developed
with C/M 98:2, detection with 260 nm ultraviolet light). After 3
hours, no starting material remained and a new low Rf spot had
appeared. Upon cooling of the reaction mixture, the product, HMIP,
precipitated as very light yellow needles and was collected by
suction filtration (0.15 gms; 96.8%; m.p. 184-187.degree. C.).
[0470] Step 2: The second step of the first method of the present
invention for synthesis of AMIP involves synthesis of XMIP from
HMIP. XMIP is chosen to be 5-chloromethylisopsoralen (CMIP,5) for
purposes of this step.
[0471] HMIP (858 mg, 4.0 mmol; obtained from combining numerous
runs of Step 1) is dissolved in freshly distilled chloroform (60
ml, dried over 4A molecular sieves). Thionyl chloride (1.49 gm,
12.6 mmol, Aldrich) is added followed by stirring at room
temperature. Additional portions of thionyl chloride are added
after 1 hour (990 mg, 8.4 mmole) and 16 hr (990 mg, 8.4 mmol).
After a total of 25 hr, no starting material remains (TLC,
CH.sub.2Cl.sub.2) and a new high Rf spot appears. The new spot
co-chromatographs on TLC with authentic CMIP using several
different solvent systems (CH.sub.2Cl.sub.2; CHCl.sub.3;
EtOAc:Hexanes 1:3).
[0472] Step 3: The third step of the first method of the present
invention for synthesizing AMIP involves the synthesis of
5-hexamethylenetetraminom- ethylisopsoralen (HMTAMIP,9) from XMIP
(in this case, CMIP).
[0473] The product of Step 2, CMIP, is brought up in 30 ml sieve
dried chloroform and hexamethylenetetramine (680 mg, 4.9 mmol) is
added. The mixture is stirred at 55.degree. C. for 43 hours, after
which an additional portion of hexamethylenetetramine (680 mg, 4.9
mmol) is added. The mixture continues to be stirred at 55.degree.
C. for another 48 hours, after which HCl (0.1 N, 60 ml) and
chloroform (30 ml) are added. The chloroform is then removed and
the aqueous phase washed three more times with chloroform (30 ml).
The aqueous phase is evaporated under reduced pressure to yield the
solid product, HMTAMIP. The product is characterized by TLC,
co-chromatographing on TLC with authentic HMTAMIP in several
different solvent systems (C/M 98:2; C/M 95:5; C/M 90:10).
[0474] Step 4: The next step involves the synthesis of AMIP from
HMTAMIP. The solid of Step 3 was suspended in 12 ml
ethanol:concentrated HCl (3:1) at room temperature for 72 hours and
then concentrated in vacuo. The residue was added to dilute NaOH,
extracted with CHCl.sub.3 and washed with water. The CHCl.sub.3
extract was then further extracted with HCl (0.1N). The aqueous
phase was then separated, adjusted to pH 12-13 with NaOH, and
extracted with CHCl.sub.3. The CHCl.sub.3 extract was washed with
water, dried (MgSO.sub.4) and the solvent removed under reduced
pressure to provide the product as the free base, which was
converted to the hydrochloride salt with HCl gas (310 mg, 31%
yield, based on HMIP). Mass spectrum m/e (relative intensity) 215
(M+, 100%).
EXAMPLE 6
Synthesis of AMIP: Method 2 (Five Steps)
[0475] Step 1: The first step of the second method, synthesis of
HMIP from XMIP, is identical to the first step of the first method,
since XMIP has been chosen to be BMIP in both cases. The first step
proceeds, therefore, according to Step 1 of EXAMPLE 5.
[0476] Step 2: The second step of the second method of the present
invention for synthesis of AMIP, synthesis of XMIP from HMIP, is
the same as the second step of the first method since XMIP has been
chosen to be CMIP in both examples. Thus, the second step proceeds
as in Step 2 of EXAMPLE 5.
[0477] Step 3: The third step of the second method of the present
invention for synthesizing AMIP involves the synthesis of
5-iodomethylisopsoralen (IMIP,8) from XMIP (in this case CMIP).
[0478] CMIP (577 mg; 2.25 mmol), sodium iodide (1.77 gm, 11.53
mmol; Baker; dried overnight at 120.degree. C.) and acetone (25 ml,
Mallinckrodt) are refluxed for 48 hours. Following this period, the
reaction mixture is filtered to remove the inorganic salts (mixed
NaCl and NaI), the filtrate evaporated under reduced pressure, the
residual crude product dissolved in chloroform, loaded on a
1/2".times.20" silica gel column (60-200 mesh, Baker), and eluted
with the same solvent. The fractions containing the product, IMIP,
are identified by TLC, combined, and the solvent removed under
reduced pressure (489 mg; 66.7%).
[0479] Step 4: The next step involves the synthesis of HMTAMIP from
IMIP. IMIP (489 mg; 1.5 mmol) and hexamethylenetetramine (360 mg;
2.6 mmol) are refluxed in dry CHCl.sub.3 until all the starting
IMIP is consumed, as shown by TLC. The resulting precipitate is
collected by suction filtration, suspended in dilute acid (0.1 N
HCl), washed several times with an equivalent volume of CHCl.sub.3,
then recovered from the aqueous phase by evaporation. The product,
HMTAMIP, is characterized by comparative TLC in several different
solvent systems (C/M 98:2; C/M 95:5; C/M 90:10).
[0480] Step 5: The final step of this second method involves the
synthesis of AMIP from HMTAMIP. This was carried out in the manner
described in Step 4 of Example 5.
EXAMPLE 7
Synthesis of AMIP: Method 3 (Two Steps)
[0481] In the two step method, XMIP may again be CMIP or BMIP. For
this example, the two step method proceeds according to the
following scheme:
[0482] BMIP.fwdarw.HMTAMIP.fwdarw.AMIP
[0483] Step 1: The first step of the second method of the present
invention for synthesizing AMIP involves the synthesis of HMTAMIP
from XMIP (in this case, BMIP).
[0484] BMIP (540 mg, 2.5 mmol) and hexamethylene-tetramine (610 mg,
4.4 mmol) were refluxed in dry CHCl.sub.3 for 40 hours. The
resulting precipitate was collected by suction filtration and used
directly for Step 2.
[0485] Step 2: The next step involves the synthesis of AMIP from
HMTAMIP. The solid of Step 1 was suspended in 12 ml
ethanol:concentrated HCl (3:1) at room temperature for 72 hours and
then concentrated in vacuo. The step then proceeds as in Step 4 of
Example 5.
EXAMPLE 8
Radiolabelled AMIP Synthesis
[0486] As noted above, the present invention provides twelve
methods for producing radiolabelled AMIP from MIP. Where the method
relies on tritiated MIP, the method proceeds initially according to
the steps of EXAMPLE 3 to make tritiated MIP, and then continues
according to the steps of EXAMPLE 7. In this example, however,
tritiated MIP is not used. For this example, the method proceeds
according to the following scheme (nine steps):
[0487]
5-methylresorcinol.fwdarw.H5MC.fwdarw.MIP.fwdarw.XMIP.fwdarw.HMIP.f-
wdarw.FIP.fwdarw.*HMIP.fwdarw.*XMIP.fwdarw.*HMTAMIP.fwdarw.*AMIP
[0488] where * indicates a labelled compound.
[0489] Steps 1-2: MIP was synthesized via H5MC from
5-methylresorcinol according to the two step method described in
EXAMPLE 2, above.
[0490] Step 3: For this example, the first XMIP was chosen to be
BMIP (later, XMIP is radiolabelled CMIP; see reactions of Step 7
below). BMIP was synthesized from MIP according to the method
described in EXAMPLE 4, above.
[0491] Step 4: HMIP was synthesized from BMIP according to the
method described in Step 1 of method 1 of EXAMPLE 5.
[0492] Step 5: New compound 5-Formylisopsoralen (FIP,7) was
synthesized from HMIP. 3,5-Dimethylpyrazole (180 mg; 1.9 mmol;
Aldrich) was added to a suspension of chromium trioxide (Aldrich;
190 mg; 1.9 mmol) in methylene chloride (6 ml) and the mixture
stirred for 15 minutes under argon at room temperature. HMIP from
Step 4 (150 mg; 0.69 mmol) was added in one portion and the
reaction mixture stirred at room temperature for 2.5 hours, after
which TLC (CHCl.sub.3) indicated the reaction was complete. The
solvent was removed under reduced pressure and the residue
dissolved in a small volume of CHCl.sub.3, loaded on a silica gel
column (Baker; 60-200 mesh) and then eluted with CHCl.sub.3. The
fractions containing product were combined and the solvent removed
to provide the aldehyde (120 mg; 81% yield). Further purification
was accomplished by recrystallization from 95% EtOH giving yellow
needles.
[0493] Step 6: Tritiated HMIP was synthesized from FIP. FIP (71 mg;
0.35 mmol) from Step 5 and .sup.3H.sub.4-sodium borohydride (DNEN;
1.8 mg; 0.0476 mmol) were mixed in 95% ethanol (10 ml) then stirred
at room temperature for one hour. After this period, TLC showed all
the formyl compound had been reduced to
5-(hydroxy-[.sup.3H]-methyl)isopsoralen (".sup.3H-HMIP"). The
solvent was removed under reduced pressure, methanol added (10 ml)
and then evaporated. This was repeated a total of four times. The
residual solid was then dissolved in 3 ml C/M (99:1) and loaded on
a 1 cm.times.30 cm silica gel column (Baker; 60-200 mesh) then
eluted with the same solvent mix. The product fractions were
combined and the solvent evaporated to provide the labelled
alcohol, .sup.3H-HMIP (yield not determined).
[0494] Step 7: The .sup.3H-HMIP of Step 6 was used directly for
conversion to the chloromethyl derivative,
5-(chloro-[.sup.3H]-methyl)isopsoralen (".sup.3H-CMIP").
.sup.3H-HMIP from Step 6 was dissolved in 10 ml chloroform (dried
over 4A molecular sieves), then thionyl chloride (248 mg; 2.1 mmol;
Aldrich) was added. The reaction mix was stirred under argon at
room temperature. Another 165 mg (1.4 mmol) portion of thionyl
chloride was added after one hour. This was left stirring for
another 16 hours at which point a third portion of thionyl chloride
(165 mg; 1.4 mmol) was added. The reaction was evaporated under
reduced pressure after another five hours to give the product,
.sup.3H-CMIP (yield not determined).
[0495] Step 8: The product of Step 7 was brought up in 5 ml
chloroform (sieve dried) and hexamethylene tetramine (85 mg; 0.61
mmol; Aldrich) was added. This was stirred at 55.degree. C. for 43
hours, at which point another portion of hexamethylene tetramine
(95 mg; 0.68 mmol) was added. Heating was continued for another 48
hours, after which HCl (0.1 N; 10 ml) chloroform (5 ml) were added.
The chloroform was removed and the aqueous washed three more times
with chloroform (5 ml). The aqueous phase was then evaporated under
reduced pressure and the solid product,
5-(Hexamethyltetramino-[.sup.3H]-methyl)isopsoralen
(".sup.3H-HMTAMIP"), was brought up in 12 ml ethanol:concentrated
HCl (3:1) for the next reaction.
[0496] Step 9: .sup.3H-HMTAMIP from Step 8 was stirred at room
temperature in the ethanol:HCl mixture. An additional 2 ml of
concentrated HCl was added and the mixture stirred at 40.degree. C.
for 15 hours. Following this period, the pH was adjusted to 7 with
NaOH and the solution evaporated under reduced pressure. The solid
was brought up in 10 ml of 0.1 M NaOH and extracted three times
with chloroform (5 ml). The chloroform washes were combined and
washed twice with water (10 ml). The chloroform was then extracted
with HCl (0.1 N; 10 ml) and the acidic aqueous phase then was
washed three times with chloroform (5 ml). The aqueous was
evaporated under reduced pressure and the solid dissolved in
ethanol (10 ml). Aliquots of this solution were removed and
counted, while the concentration of the stock was determined by UV
absorption. The product,
5-(Aminomethyl-[.sup.3H]-methyl)isopsoralen (".sup.3H-AMIP"), was
determined to be 347 ug/ml and the specific activity
3.1.times.10.sup.5 CPM/ug (117 Ci/mol). Overall recovery was 1.6
mCi, 3.47 mg, 0.014 mmol (72% yield based on
.sup.3H.sub.4-NaBH.sub.4).
EXAMPLE 9
BIOMIP Synthesis
[0497] The BIOMIP synthesis method for the following example
proceeds according to the scheme:
[0498]
XMIP.fwdarw.HMIP.fwdarw.XMIP.fwdarw.IMIP.fwdarw.DMHMIP.fwdarw.BIOMI-
P
[0499] Again, XMIP can be either CMIP or BMIP. For this example,
XMIP is CMIP and BMIP, respectively.
[0500] Step 1: MIP is reacted to form XMIP. In this step, XMIP is
CMIP. MIP (1.80 gm, 9 mmol) is dissolved in CCl.sub.4 at reflux.
N-chlorosuccinimide (1.20 gm, 9 mmol, Aldrich) and
dibenzoylperoxide (0.22 gm, 0.9 mmol, Aldrich) are added and the
mixture boiled until no starting material remains (as determined by
TLC). Following this period, the boiling mixture is filtered (hot)
and the filtrate set aside at 0.degree. C. The resulting
precipitate is collected by suction filtration, dissolved in
CHCl.sub.3, washed with water, dried (anhydrous MgSO.sub.4) and
concentrated by rotary evaporation under reduced pressure to
provide the product, CMIP.
[0501] Step 2: HMIP is then synthesized from XMIP (in this case,
CMIP). CMIP (233 mg, 1.0 mmol) is refluxed in distilled water (50
ml) while being monitored by TLC (Eastman TLC Plates; developed
with chloroform, detection with 260 nm ultraviolet light). After 2
hours, no starting material remains and a new low Rf spot appears.
Upon cooling of the reaction mixture, the product, HMIP,
precipitates as white needles and is collected by suction
filtration.
[0502] Step 3: XMIP is then synthesized from HMIP. In this case,
XMIP is BMIP. HMIP (270 mg; 1.25 mmol) is dissolved in freshly
distilled chloroform (20 ml, dried over 4A molecular sieves).
Thionyl bromide (384 mg; 3.0 mmol; Aldrich) is added followed by
stirring at room temperature. Additional portions of thionyl
bromide are added after 1.5 hours (126 mg, 1.0 mmol) and 3.0 hours
(126 mg; 1.0 mmol). After a total of 6.5 hours, no starting
material remains (Eastman TLC Plates; CH.sub.2Cl.sub.2) and a new
high Rf spot appears. The solvent is removed under reduced pressure
and the residue dissolved in a small volume of CH.sub.2Cl.sub.2,
loaded on a 1/2".times.20" silica gel column (Baker, 60-200 mesh),
and eluted with the same solvent. The fractions containing the
product are identified by TLC, combined, and the solvent removed
under reduced pressure.
[0503] Step 4: IMIP is then synthesized from BMIP via the
Finkelstein reaction. In a small round-bottomed flask fitted with a
reflux condenser and argon line, a mixture of BMIP (279 mg; 1.0
mmol), sodium iodide (767 mg; 5.15 mmol; Baker; dried overnight at
120.degree. C.) and methyl ethyl ketone (10 ml, Mallinckrodt) are
refluxed for 48 hours. Following this period, the reaction mixture
is filtered to remove the inorganic salts (mixed NaI and NaBr), the
filtrate evaporated under reduced pressure, the residual crude
product dissolved in chloroform, loaded on a 1/2".times.20" silica
gel column (60-200 mesh, Baker), and eluted with the same solvent.
The fractions containing the product, IMIP, are identified by TLC,
combined, and the solvent removed under reduced pressure.
[0504] Step 6:
5-N-(N,N'-Dimethyl-1,6-hexanediamine)-methylisopsoralen (DMHMIP,11)
is then synthesized from IMIP. IMIP (935 mg; 2.85 mmol; obtained
from combining product from numerous runs of Step 5) and freshly
distilled N,N'-dimethyl-1,6-hexanediamine (4.1 gm; 28.5 mmol;
Aldrich) are refluxed in dry toluene (45 ml) under argon while
being monitored by TLC. After a short period no starting material
remains and a new, low Rf spot appears. The solvent is removed
under reduced pressure and the solid residue dissolved in HCl (1.0
N; 60 ml), washed with chloroform (3.times.25 ml), the acidic
aqueous phase made basic with 1.0 N NaOH (pH 12), the basic aqueous
phase extracted with chloroform (3.times.50 ml), the chloroform
extract washed with water (2.times.40 ml), saturated sodium
chloride (1.times.40 ml) and finally dried (MgSO.sub.4). The
solvent is removed under reduced pressure, the residue dissolved in
a small volume of C/E/T (9:1:0.25), loaded on a 0.5".times.12"
silica gel column (60-200 mesh, Baker) and eluted with C/E/T. The
fractions containing the pure product, DMHMIP, are identified by
TLC, combined and evaporated to provide the product.
[0505] Step 7:
5-N--[N,N'-Dimethyl-(6-[biotinamido]-hexanoate)-1,6-hexaned-
iamine])methylisopsoralen (BIOMIP,12a) was made from DMHMIP. DMHMIP
(630 mg; 1.8 mmol), biotin-amidocaproate N-hydroxysuccinimide ester
(Pierce; 100 mg; 0.22 mol), and DMF (2.7 ml, freshly distilled onto
4A sieves) were placed in a 10 ml round bottomed flask with
attached argon line. The reaction was magnetically stirred at room
temperature while being monitored by TLC (C/E/T; 9:1:0.25; the
product ran as a high Rf spot relative to starting material). After
the reaction was complete, the solvent was removed under vacuum and
the residue dissolved in a small volume of
CH.sub.2Cl.sub.2:CH.sub.3OH (10:1), loaded on a silica gel column
(60-200 mesh; 0.5".times.20"), and eluted with the same solvent.
The product was isolated, the elution solvent removed, and the free
amine dissolved in 10 ml ethanol. HCl gas was bubbled through the
solution, followed by argon. The ethanol was removed to give the
product, BIOMIP (HCl salt) (190 mg; 14.7% yield; FABMS m/e 682
(MH+, 25%)).
EXAMPLE 10
BIOMIP Synthesis
[0506] The synthesis method for the following example proceeds
according to the scheme:
[0507] XMIP.fwdarw.DMHMIP.fwdarw.BIOMIP
[0508] In this example, XMIP is BMIP.
[0509] Step 1: BMIP (400 mg; 1.43 mmol) , freshly distilled
N,N'-dimethyl-1,6-hexanediamine (3.1 gm; 21.5 mmol; Aldrich) was
refluxed in dry toluene (45 ml) under argon while being monitored
by TLC. After 1.5 hours, no starting material remained and a new,
low Rf spot appeared. The solvent was removed under reduced
pressure and the solid residue dissolved in 1.0 N HCl (60 ml),
washed with chloroform (3.times.25 ml), the acidic aqueous phase
made basic with 1.0 N NaOH (pH 12), the basic aqueous phase
extracted with chloroform (3.times.50 ml), the chloroform extract
washed with water (2.times.40 ml), saturated sodium chloride
(1.times.40 ml) and finally dried (MgSO.sub.4). The solvent was
removed under reduced pressure, the residue dissolved in a small
volume of C/E/T (9:1:0.25), loaded on a 0.5".times.12" silica gel
column (Baker, 60-200 mesh) then eluted with C/E/T. The fractions
containing the pure product were identified by TLC, combined and
evaporated to provide the product, DMHMIP, as a viscous oil which
solidified upon standing (300 mg; 61% yield).
[0510] Step 2: BIOMIP (HCl salt) was then synthesized from DMHMIP
as in Step 7 of Example 9.
EXAMPLE 11
Tritiated BIOMIP Synthesis
[0511] The present invention also provides methods for synthesizing
labelled BIOMIP. One method involves radiolabelling BIOMIP
according to the following scheme:
[0512] .sup.3H-XMIP.fwdarw..sup.3H-DMHMIP.fwdarw..sup.3H-BIOMIP
[0513] In this example, .sup.3H-XMIP is .sup.3H-CMIP.
[0514] Step 1: .sup.3H-CMIP from Step 7 of Example 8 (24 mg, 0.1
mmol) and freshly distilled N, N'-dimethyl-1,6-hexanediamine (0.47
gm; 0.32 mmol) is refluxed in dry toluene (5 ml) under argon while
being monitored by TLC. After several hours, no starting material
remains and a new, low Rf spot appears. The solvent is removed
under reduced pressure and the solid residue dissolved in HCL (1.0
N), extracted with chloroform, the acidic aqueous phase separated
and made basic with NaOH (1.0 N), the basic aqueous phase is
extracted with chloroform, the chloroform extract washed with
water, saturated sodium chloride then dried (MgSO). The solvent is
removed under reduced pressure, the residue dissolved in a small
volume of C/E/T 9:1:0.25, loaded on a 0.5".times.4" silica gel
column (60-200 mesh; Baker) and eluted with C/E/T. The fractions
containing the pure product are identified by TLC, combined and
evaporated to provide the product. The product is further
characterized by UV and TLC (co-chromatography with authentic
material in several different solvent systems). The 5-N-(N,
N'-dimethyl-1,6-hexanediamine)-[.sup.3H]-methylisop- soralen
(.sup.3H-DMHMIP) so prepared is used directly in Step 2 for the
preparation of [.sup.3H]-BIOMIP (and other compounds).
[0515] Step 2: .sup.3H-DMHMIP (17.5 mg; 0.05 mmol),
biotinamidocaproate N-hydroxysuccinimide ester (25 mg; 0.055 mmole;
Pierce), and DMF (1.8 ml, freshly distilled onto 4A sieves) are
placed in a 5 ml round bottomed flask with attached argon line. The
reaction is magnetically stirred at room temperature while being
monitored by TLC (C/E/T; 9:1:0.25; the product runs as a high Rf
spot relative to starting material). After the reaction is
complete, the solvent is removed under vacuum and the residue
dissolved in a small volume of CH.sub.2Cl.sub.2:CH.sub.3OH 10:1,
loaded on a silica gel column (60-200 mesh, 0.5".times.5"), and
eluted with the same solvent. The product is isolated as the free
base, the elution solvent removed, then dissolved in absolute
ethanol. HCl gas is bubbled through the solution, followed by
argon. The ethanol is removed to give 5-N--[N,
N'-dimethyl-N'-(6-biotinamido)-hexanoate)-1,6-hexanediamine]-[.s-
up.3H]-methylisopsoralen (.sup.3H-BIOMIP) as the monohydrochloride
salt.
EXAMPLE 12
DITHIOMIP Synthesis
[0516] The present invention provides methods for synthesizing
DITHIOMIP. For this example, the synthesis proceeds according to
the following scheme:
[0517] XMIP.fwdarw.DMHMIP.fwdarw.DITHIOMIP
[0518] where XMIP is BMIP.
[0519] Step 1: DMHHIP is synthesized from BMIP according to the
method described in Step 1 of EXAMPLE 10.
[0520] Step 2: DMHMIP from Step 1 (41 mg; 1.20 mmol, 1.0 eq) and
sulfosuccinimidyl-2-(biotinamido)-ethyl-1,3-dithiopropionate (102
mg; 0.168 mmol; 1.40 eq) is dissolved in freshly distilled DMF (3.0
ml) in a small, dry round bottomed flask with attached argon line
then stirred at room temperature for 5 hours. After this period,
the DMF is removed under reduced pressure and the residue suspended
in NaOH (1.0 N), extracted with chloroform/isopropanol 3:1, and the
organic extract washed with water (10 ml.times.2) then dried
(MgSO4), filtered and evaporated under reduced pressure to give the
crude product. This is dissolved in ethanol and HCl gas is bubbled
through the solution. The ethanol is removed to give the product,
5-N--[N,N'-dimethyl-N'-(2-{biotinamido}-ethyl-1,3-dithi-
opropionate)-1,6-hexanediamine]-methyl-isopsoralen (DITHIOMIP,12b)
(HCl salt). This is dissolved in ethanol and further characterized
by sample treatment with sodium borohydride (Aldrich) or
mercaptoethanol (Aldrich). The product of these reactions is
compared to untreated material to verify cleavage occurred as
expected.
EXAMPLE 13
.sup.3H-DITHIOMIP Synthesis
[0521] The present invention provides methods for synthesizing
.sup.3H-DITHIOMIP. For this example, the synthesis proceeds
according to the following scheme:
[0522]
.sup.3H-XMIP.fwdarw..sup.3H-DMHMIP.fwdarw..sup.3H-DITHIOMIP
[0523] In this example, .sup.3H-XMIP is .sup.3H-CMIP.
[0524] Step 1: .sup.3H-DMHMIP is prepared as described in Step 1 of
Example 11.
[0525] Step 2: .sup.3H-DMHMIP (24 mg, 0.07 mmol, 1.0 eq) and
sulfosuccinimidyl-2-(biotinamido)-ethyl-1,3-dithiopropionate (60
mg; 0.10 mmol, 1.4 eq) is dissolved in freshly distilled DMF (1.5
ml) in a small, dry round bottomed flask with attached argon line
then stirred at room temperature for 5 hr. After this period, the
DMF is removed under reduced pressure and the residue suspended in
0.1 N NaOH (5 ml), extracted with chloroform/isopropanol 3:1
(3.times.5 ml), and the organic extract washed with water (5
ml.times.2) then dried (MgSO4), filtered and stripped to give the
product, .sup.3H-DITHIOMIP. The product is then characterized by
ultraviolet absorption (comparison with authentic material) and TLC
(co-chromatography with authentic material in several different
solvent systems). Radiochemical purity is determined by HPLC.
Approximately 10.sup.6 CPM of tritiated .sup.3H-DITHIOMIP is mixed
with 10 ug of unlabeled DITHIOMIP in 50 ul ethanol (100%). The
sample is injected on a C18 octadecylsilyl reverse phase
chromatography column (Beckman) and eluted with an
acetonitrile/ammonium acetate (0.1 M, pH 7) gradient, as follows:
0-10 minutes, 100% ammonium acetate; 10-70 minutes, 100% ammonium
acetate.fwdarw.100% acetonitrile; 70-80 minutes, 100% acetonitrile.
Eighty 1.0 ml fractions are collected and 40 ul of each fraction is
then counted. The product is further characterized by dissolving a
sample in ethanol and treating with either sodium borohydride
(Aldrich) or mercaptoethanol (Aldrich). The product of these
reactions is compared to untreated material to verify cleavage
occurs as expected.
EXAMPLE 14
FLUORMIP Synthesis
[0526] The present invention also contemplates methods for
synthesizing FLUORMIP. For this example, the synthesis proceeds
according to the following scheme:
[0527] XMIP.fwdarw.DMHMIP.fwdarw.FLUORMIP
[0528] where XMIP is BMIP.
[0529] Step 1: DMHMIP is synthesized from BMIP according to the
method described in Step 1 of EXAMPLE 10.
[0530] Step 2: DMHMIP from Step 1 (13.7 mg, 0.04 mmol, 1.0 eq) in
DMF (Mallinckrodt; 1.0 ml distilled onto 4 .ANG. sieves), and
6-carboxyfluorescein-N-hydroxy-succinimide ester (Pierce; 20.7 mg,
0.044 mmol, 1.1 eq) in DMF (1.0 ml) are mixed in a 5 ml round
bottomed flask with attached argon line. The reaction mix is
stirred several hours at room temperature. After this period, the
majority of the DMHMIP is consumed as indicated by TLC (C/B/A/F;
4:1:1:1). The solvent is removed with gentle heating
(<50.degree.) under reduced pressure. The residue is dissolved
in HCL (0.1 N) and extracted with chloroform/isopropanol 3:1. The
organic extract is then reduced in volume, loaded onto a glass
backed preparative silica gel TLC plate (20 cm.times.20 cm.times.2
mm; Baker), and eluted with C/B/A/F. The major low Rf band is
scraped from the plate, eluted with C/M (90:10), the silica removed
by filtration and the solvent evaporated under reduced pressure.
The product is dissolved in a small volume of ethanol and HCl gas
bubbled through the solution. The ethanol is then evaporated to
provide 5-N--[N,N'-dimethyl-N'-(carboxy-
fluoresceinester)-1,6-hexanediamine)-methyl-isopsoralen (FLUORMIP,
12c) as the monohydrochloride salt.
EXAMPLE 15
.sup.3H-FLUORMIP Synthesis
[0531] The present invention also contemplates methods for
synthesizing .sup.3H-FLUORMIP. For this example, the synthesis
proceeds according to the following scheme:
[0532] .sup.3H-DMHMIP.fwdarw..sup.3H-FLUORMIP
[0533] .sup.3H-DMHMIP from Step 1 of Example 11 (2.5 mg; 0.007
mmol; 117 Ci/mmol; 1.0 eq) in DMF (Mallinckrodt; 1.0 ml distilled
onto 4 .ANG. sieves) and 6-carboxyfluorescein-N-hydroxy-succinimide
ester (3.7 mg; 0.008 mmol; 1.1 eq; Pierce) in DMF (1.0 ml) are
mixed in a 5 ml round bottomed flask with attached argon line. The
reaction mix is stirred several hours at room temperature. After
this period, the majority of the .sup.3H-DMHMIP is consumed as
indicated by TLC (C/B/A/F; 4:1:1:1). The DMF is removed with gentle
heating (<50.degree.) under reduced pressure. The crude product
is dissolved in HCL (0.1 N; 3 ml) and extracted with
chloroform/isopropanol 3:1 (3 ml.times.3). The organic extract is
then reduced to 2 ml, loaded onto a class backed preparative silica
gel TLC plate (20 cm.times.20 cm.times.2 mm; Baker), and eluted
with C/B/A/F. The major low Rf band is scraped from the plate and
eluted with methanol. The silica is removed by filtration and the
solvent evaporated under reduced pressure. The product is dissolved
in a small volume of ethanol and HCl gas bubbled through the
solution. The ethanol is then evaporated to provide
.sup.3H-FLUORMIP as the monohydrochloride salt. The product is
characterized by ultraviolet absorption (comparison with authentic
material) and TLC (co-chromatography with authentic meterial in
several different solvent systems). The specific activity is
determined by determining the optical density of an ethanolic stock
of the compound and scintillation counting of aliquots of this
solution (117 Ci/mmol). Radiochemical purity is determined by HPLC.
Approximately 10.sup.6 CPM of .sup.3H-FLUORMIP is mixed with 10
.mu.g of unlabelled FLUORMIP in 50 .mu.m ethanol (100%). The sample
is injected on a C18 octadecasilyl reverse phase chromatography
column (Beckman) and eluted with acetonitrile/ammonium acetate (0.1
M; pH 7) gradient, as follows: 0-10 minutes, 100% ammonium acetate;
10-70 minutes, 100% ammonium acetate.fwdarw.100% acetonitrile;
70-80 minutes, 100% acetonitrile. Eighty 1.0 ml fractions are
collected and 40 .mu.l of each fraction is then counted.
EXAMPLE 16
DMIP Synthesis
[0534] This example describes the method of the present invention
for synthesizing DMIP. From resorcinol, the method proceeds in four
steps according to the following scheme:
[0535]
Resorcinol.fwdarw.H4MC.fwdarw.CAMC.fwdarw.BCAMC.fwdarw.DMIP
[0536] Step 1: Resorcinol (110 gm;, 1.0 mol. Aldrich) is mixed with
ethylacetoacetate (130 gm, 1.0 mol, Aldrich) and placed in a
dropping funnel. This mixture is added dropwise to a chilled
(10.degree. C.) solution of sulfuric acid (1000 ml) in a three
necked flask fitted with a mechanical stirrer and internal
thermometer. The rate of addition is such that the internal
temperature does not exceed 10.degree. C. The solution is stirred
for 12 hours then slowly poured onto 2 kg of ice and 3 liters of
water. Following vigorous stirring, the precipitate is collected by
suction filtration, washed with water, dissolved in 5% aqueous NaOH
(1500 ml), then reprecipitated by addition of dilute sulfuric acid
(650 ml) with vigorous stirring. The product,
7-Hydroxy-4-methylcoumarin (H4MC,13), is collected by filtration,
washed with water, then allowed to air dry (145 gm; 41% yield; mp
185.degree. C.).
[0537] Step 2: H4MC (145 gm; 0.82 mol; Aldrich) was treated with
2,3-dichloro-1-propene (107.8 gm; 0.97 mol; Aldrich) in DMF (1178
ml; Mallickrodt)/toluene (931 ml; Mallickrodt) in the presence of
potassium carbonate (154 gm; 1.12 mol; Baker) and a catalytic
amount of potassium iodide (7.1 gm; 0.05 mmol; Baker). The mixture
was heated to 95.degree. C. with stirring for 12 hour, after which
TLC indicated no starting material remained. The solvent was
removed under reduced pressure and the residual paste extracted
with hot chloroform. The chloroform was washed with water,
saturated NaCl, dried (MgSO.sub.4) then the solvent removed under
reduced pressure. The residual solid was dissolved in absolute
ethanol at reflux (1200 ml) and set aside. The resulting crystals
were collected by suction filtration, washed with cold ethanol and
vacuum dried to provide 7-(.beta.-chloroallyloxy)-4-methylcoumarin
(CAMC,14) (143.5 gm, 70% yield). NMR (CDCl3) d 7.5 (1H, d), 6.8-6.9
(2H, m), 6.2 (1H, d), 5.5-5.6 (2H, M), 4.2 (2H, m), 2.4 (3H,M).
[0538] Step 3: Rearrangement of CAMC was accomplished in high yield
by refluxing the allyl ether from Step 2 (143.5 gm; 0.55 mole) in a
mixture of p-diisopropylbenzene (Aldrich, 1000 ml) and butyric
anhydride (96 ml, 92.8 gm; 0.59 mol, Aldrich) under argon for 18
hours. The cooled reaction mixture was diluted with chloroform,
washed with water and then saturated sodium bicarbonate, dried
(MgSO.sub.4) then evaporated under reduced pressure. Following
recrystallization from ethanol, 79.9 grams of mixed 6 and
8-(.beta.-chloroallyl)-7-butyroxy-4-methylcoumarin (BCAMC,15) were
obtained. HPLC analysis (Beckman; C18-ODS reverse phase column,
isocratic elution with 60% CH.sub.3OH/40% H.sub.2O) showed the
mixture to contain 85.7% of the desired 8-substituted isomer, of
which a sample was purified by column chromatography (60-200 mesh
silica gel, elution with CH.sub.2Cl.sub.2). The structures of the
two isomers were confirmed by NMR. NMR (CDCl3) d 7.56 (1H, d), 7.11
(1H, d), 6.26 (1h, d), 5.05-5.19 (2H, m), 3.84 (2H, m), 2.55-2.62
(2H, m), 2.43 (3H, d) , 1.78-1.82 (2H, m) , 1.01-1.09 (3H, t).
[0539] Step 4: Ring closure was achieved by treatment of 20 grams
of the mixed isomers with 70% sulfuric acid at 5.degree. C.,
precipitating the product by addition of the reaction mixture to a
50:50 mixture of water and ice (3000 ml). Following extraction with
chloroform, 12.5 grams (94%) of the mixed isomeric products
4,5'-dimethylisopsoralen (DMIP, 16) and 4,5'-dimethylpsoralen were
obtained. Purification of the desired 4,5'-dimethylisopsoralen was
accomplished by repeated recrystallization from ethanol (to give
approximately 85% yield of pure DMIP).
EXAMPLE 17
Radiolabelled DMIP Synthesis
[0540] Step 1: DMIP (21.4 mg, 0.1 mmol), 10% palladium on charcoal
(15 mg, Aldrich) and glacial acetic acid (Mallinkrodt, 2 ml) are
placed in a 25 ml round bottom flask and stirred with tritium gas
(Lawrence; 150 Ci) until no more tritium is absorbed. The catalyst
is removed by centrifugation, followed by evaporation of the
supernatant under vacuum. The residual solid is dissolved in
methylene chloride (1 ml), loaded on a 1/2" by 5" silica gel column
(60-200 mesh, Baker), and eluted with methylene chloride. Column
fractions containing the non-fluorescent
[3,4,4',5'-.sup.3H.sub.4]-tetrahydro-4,5'-dimethylisopsoralen
(.sup.3H-THDMIP,17) are identified by TLC, combined, and the
solvent removed under reduced pressure. This material is further
characterized by comparison with authentic unlabelled compound (UV;
co-chromatography on TLC in CHCl.sub.3; C/M 98:2). 2.45 Ci of
material was recovered, corresponding to a preliminary specific
activity of 24.5 Ci/mmol. This material was then used in Step 2 for
the preparation of tritiated DMIP.
[0541] Step 2: .sup.3H-THDMIP, prepared as described above, is
places in a 25 ml round bottomed flask along with diphenyl ether (5
ml) and 10% palladium on charcoal (30 mg; Aldrich). A nitrogen
bubbler is attached and the mixture refluxed for 24-36 hours. After
cooling to room temperature, absolute ethanol is added (5 ml) and
the catalyst removed by centrifugation. The supernatant is
partially evaporated, loaded on a 1/2" by 5" silica gel column
(Baker, 60-200 mesh), and eluted with methylene chloride. The
fractions containing the product are combined, the solvent volume
reduced and the chromatography repeated on a 1/2".times.10" column
as above. Column fractions containing the product are combined and
the solvent removed. The
(3,4'-[.sup.3H.sub.2])-4,5'-dimethylisopsoralen (.sup.3H-DMIP) so
obtained is stored in ethanol to inhibit radiolysis.
[0542] The specific activity of the .sup.3H-DMIP is established by
measuring the optical density of the stock solution to determine
its concentration, then counting appropriate aliquots of the
stock.
[0543] The radiochemical purity is determined by HPLC.
Approximately 10.sup.6 CPM of .sup.3H-DMIP is mixed with 10 ug
unlabelled DMIP in 50 ul of ethanol (100%). The sample is injected
on a C18 octadecasilyl reverse phase chromatography column
(Beckman) and eluted with a water/methanol gradient as follows:
0-10 minutes, 100% H.sub.2O; 10-70 minutes, 100%
H.sub.2O.fwdarw.100% CH.sub.3OH; 70-80 minutes, 100% CH.sub.3OH.
Eighty 1.0 ml fractions are collected and 40 ul of each fraction
counted. Greater than 99% of the radioactivity co-chromatographs
with the optical peak corresponding to .sup.3H-DMIP.
EXAMPLE 18
CMDMIP Synthesis
[0544] 4'-Chloromethyl-4,5'-dimethylisopsoralen (CMDMIP,18) was
prepared from DMIP as follows: DMIP (11.9 gm; 55.6 mmol) was
dissolved in acetic acid (600 ml) then chloromethyl methylether (46
ml; 48.7 gm; 600 mmol) added. The homogeneous solution remained at
room temperature for 16 hours, after which a second portion of
chloromethyl methylether (46 ml; 48.7 gm; 600 mmol) was added. The
solution was left at room temperature another 53 hours after which
crystals began to form. The reaction flask was cooled at 0.degree.
C. for 78 hours, resulting in the formation of a large mass of
white precipitate, which was collected by suction filtration then
dried on the filter. The yield was 10.9 gm (74.7%). The NMR spectra
of the product, CMDMIP, was consistent with that described by
Dall'Acqua et al., J. Med. Chem 24, 178 (1981).
EXAMPLE 19
Radiolabelled CMDMIP Synthesis
[0545] The present invention also contemplates labelled CMDMIP. The
present example describes one method of the present invention
involving four steps:
[0546]
CMDMIP.fwdarw.HMDMIP.fwdarw.FDMIP.fwdarw..sup.3H-HMDMIP.fwdarw..sup-
.3H-CMDMIP
[0547] Step 1: 4'-Hydroxymethyl-4,5'-dimethylisopsoralen
(HMDMIP,19) was prepared from CMDMIP. CMDMIP (1.0 gm; 3.8 mmol) was
placed in a 250 ml round bottomed flask and refluxed with water for
four hours. TLC (C/M 95:5) showed that all the starting material
had been converted to a single low Rf spot after this time. The
reaction mixture was cooled to 0.degree. C. for 2 hours and then
the product collected by suction filtration.
[0548] Step 2: New compound 4'-Formyl-4,5'-dimethylisopsoralen
(FDMIP,20) was prepared from HMDMIP by a novel synthesis method of
the present invention. 3,5-Dimethylpyrazole (830 mg, 8.7 mmol,
Aldrich) was added to suspension of chromium trioxide (874 mg, 8.8
mmol) in methylene chloride (25 ml) and the mixture stirred for 30
min under argon at room temperature. HMDMIP from Step 1 (800 mg;
3.3 mmol) was added in one portion and the reaction mixture stirred
at room temperature for 2.5 hours. TLC showed the reaction was over
after 3 hours (CHCl.sub.3). The solvent was removed under reduced
pressure and the residue dissolved in a small volume of CHCl.sub.3
loaded on a silica gel column (60-200 mesh, Baker) then eluted with
CH.sub.2Cl.sub.2. The fractions containing product were determined
by TLC, combined and the solvent removed to provide FDMIP (647 mg,
81%). Further purification was accomplished by recrystallization
from 95% EtOH giving yellow needles.
[0549] Step 3:
4'-(hydroxy-[.sup.3H]-methyl)-4,5'-dimethylisopsoralen
(.sup.3H-HMDMIP) was prepared from FDMIP. The FDMIP of Step 2 (18
mg; 0.0743 mmol) and sodium-[.sup.3H.sub.4]-borohydride (DNEN, 1.8
mg, 0.0476 mmol; 60 Ci/mmol) were stirred in 95% ethanol (8 ml) at
room temperature for 5 hours. After this period, TLC showed the
FDMIP (Rf 0.7) had been completely reduced to .sup.3H-HMDMIP (Rf
0.15). The solvent was removed by lyophilization and the residual
solid dissolved in C/M (99:1, 1 ml), loaded on a 1 cm.times.30 cm
chromatography column (60-200 mesh silica gel; Baker) and eluted
with C/M (99:1). The fractions which contained .sup.3H-HMDMIP were
identified by TLC, combined and evaporated. The product was used
directly in Step 4 for the preparation of
4'-([.sup.3H]-Chloromethyl-4,5'-dimethylisopsoralen
(.sup.3H-CMDMIP).
[0550] Step 4: .sup.3H-CMDMIP was prepared from .sup.3H-HMDMIP with
thoinyl chloride. (Alternatively,
4'-([.sup.3H]-Bromomethyl)-4,5'-dimethy- lisopsoralen
(.sup.3H-BMDMIP) can be prepared from .sup.3H-HMDMIP using thionyl
bromide. .sup.3H-BMDMIP is preferred due to its higher reactivity
in S.sub.N2 displacement reactions, such as BMDMIP.fwdarw.HDAMDMIP
and BMDMIP.fwdarw.PHIMDMIP; accordingly, thionyl bromide is the
reagent of choice to provide XMDMIP where X=Br). .sup.3H-HMDMIP,
prepared as described in Step 3, was placed in a small round
bottomed flask and dissolved in freshly distilled chloroform (5 ml,
dried over 4A molecular sieves). Thionyl chloride (41 mg; 0.35
mmol; Aldrich) was added and the yellow solution stirred for one
hour. TLC (CH.sub.2Cl.sub.2) indicated all the starting alcohol had
been converted to the product following this period. The solvent
was removed under reduced pressure, benzene added (5 ml) and then
evaporated under reduced pressure (twice). The white solid residue
was used directly for the preparation of additional labelled
compounds.
EXAMPLE 20
AMDMIP Synthesis
[0551] This example describes the synthesis of AMDMIP from DMIP
according to the following scheme:
[0552] DMIP.fwdarw.PHIMDMIP.fwdarw.AMDMIP
[0553] Step 1: DMIP (51 gm, 0.41 mole) is dissolved with heat in
CH.sub.2Cl.sub.2 then cooled to room temperature.
N-Hydroxymethylphthalim- ide (59.5 gm; 0.34 mol) is added and the
mixture cooled to 8.degree. C. A mixture of CF.sub.3SO.sub.3H (19.8
ml; 33.6 gm; 0.22 mol) and CF.sub.3COOH (280 ml; 189 gm; 1.66 mol)
is added from a dropping funnel over a period of 40-50 min, during
which the temperature of the reaction mix is maintained between
8.degree. C.-12.degree. C. by external cooling. Following the
addition, the reaction flask is brought to room temperature then
refluxed until all the starting material is consumed (TLC;
CH.sub.2Cl.sub.2). After the reaction is complete, one of two
procedures is employed for work-up. In the first, the solvent is
removed under reduced pressure, the residual yellow solid dissolved
in chloroform, the chloroform washed with water, 0.3 M NaOH, water,
then dried (MgSO.sub.4). The product is isolated by column
chromatography (60-200 mesh silica gel, Baker). Alternatively, the
reaction mixture is reduced to half volume, then the crude product
is precipitated by the addition of methanol, followed by
filtration. The precipitate is washed with methanol then
recrystallized from ethanol:chloroform (1:1), providing
4'-phthalimido-4,5'-dimethylisopsoralen (PHIMDMIP, 21).
[0554] Step 2: PHIMDMIP (40 gm; 0.11 mol) is dissolved in 95%
ethanol (1800 ml) followed by the addition of hydrazine hydrate (15
ml; 85% in water; Aldrich). The solution is heated (60.degree. C.)
with stirring for 17 hours after which additional hydrazine (15 ml)
is added. After another 4 hours, TLC (C/M 98:2) indicated all the
starting material is consumed. The solvent is evaporated under
reduced pressure and the residual solid dissolved in a mixture of
chloroform (500 ml) and 0.1 M NaOH (500 ml). The chloroform is
separated and the basic aqueous phase extracted twice more with
chloroform (250 ml). The combined chloroform extracts is washed
twice with water (500 ml), then back-extracted with 0.1 M HCl
(3.times.250 ml) to form the protonated amine. The chloroform is
removed and the acidic aqueous phase washed three more times with
chloroform (250 ml). The acidic aqueous phase is then made basic
with NaOH (1.0 N) and extracted three times with chloroform. The
chloroform extracts are combined, washed with water, dried
(MgSO.sub.4), then evaporated under reduced pressure and the
residual solid dissolved in 1000 ml ethanol. HCL gas is passed
through the chilled ethanol solution to provide the hydrochloride
salt of 4'-aminomethyl-4,5'-dimethylisopsoralen (AMDMIP,22), which
is filtered, washed with ethanol, then dried under vacuum (23 gm;
75% yield). All analytical data (NMR, elemental analysis) is
checked to be consistent with published results.
EXAMPLE 21
Radiolabelled AMDMIP Synthesis
[0555] The present invention also contemplates labelled PHIMDMIP
and labelled AMDMIP. One method of the present invention involves
the scheme:
[0556] .sup.3H-CMDMIP.fwdarw.3H-PHIMDMIP.fwdarw..sup.3H-AMDMIP
[0557] Step 1: .sup.3H-CMDMIP, prepared as described above, was
dissolved in 2 ml freshly distilled DMF in the presence of 4A
molecular sieves. Potassium phthalimide (43 mg, 0.23 mmol) was
added and the mixture heated to 40.degree. C. and stirred for 42
hours. Following this period, the solvent was removed and the
residual solid dissolved in chloroform:methanol 98:2 (1 ml), loaded
on a 1 cm.times.20 cm silica gel column (60-200 mesh) then eluted
with C/M 98:2. The fractions containing product were identified by
TLC (CH.sub.2Cl.sub.2), combined and evaporated under reduced
pressure. The solid residue,
4'-(phthalimido-[.sup.3H]-methyl)-4,5'-dimethylisopsoralen
(.sup.3H-PHIMDMIP), was used directly for the preparation of
tritiated AMDMIP.
[0558] Step 2: .sup.3H-PHIMDMIP, prepared as described above, was
dissolved in 95% ethanol (3 ml). Hydrazine hydrate (5 mg, 0.1 mmol)
was added and the solution heated (60.degree. C.) and stirred for
17 hr after which additional hydrazine (0.04 mmol) was added. After
another 4 hr, TLC indicated all the starting material had been
consumed. The solvent was evaporated under reduced pressure and the
residual solid dissolved in a mixture of chloroform (5 ml) and NaOH
(0.1 N; 5 ml). The chloroform was separated and the basic aqueous
phase extracted twice more with chloroform (5 ml). The combined
chloroform extracts were washed twice with water (10 ml) then
back-extracted With HCl (0.1 N; 10 ml) to form the protonated
amine. The chloroform was removed and the acidic aqueous phase
washed three more times with chloroform (5 ml). The aqueous phase
was then evaporated under reduced pressure and the residual solid
dissolved in ethanol (10 ml). An appropriate dilution of the stock
solution was made, counted, and the concentration determined by
optical density. Overall recovery of the product was 4.57 mg (16.8%
based on .sup.3H-CMDMIP). The specific activity was
2.2.times.10.sup.5 CPM/.mu.g (93 mCi/mmol).
EXAMPLE 22
BIODMIP Synthesis
[0559] This example describes one method of the present invention
for the synthesis of BIODMIP according to the following scheme:
[0560] CMDMIP.fwdarw.HDAMDMIP.fwdarw.BIODMIP
[0561] Step 1: CMDMIP (250 mg, 0.9 mmole, 1.0 eq),
N,N'-dimethyl-1,6-hexan- e-diamine (1.83 gm; 12.7 mmol; 14.0 eq;
Aldrich) and toluene (28 ml, freshly distilled onto 4A sieves) were
placed in a 50 ml round bottomed flask with attached reflux
condenser and argon line. The reaction mix was brought to reflux
with a heating mantle while being magnetically stirred. TLC after 1
hour (benzene/methanol 1:1) found approximately 80% of the starting
material converted to a single low Rf spot. The total reflux time
was 17 hours after which essentially no starting material remained.
The toluene was removed under reduced pressure on the rotovap and
the residual yellowish oil dissolved in a small volume of
chloroform. This solution was loaded on a small (0.5".times.5")
chromatography column (60-200 mesh silica gel; Baker) then eluted
with 95% ethanol:concentrated NH.sub.4OH (4:1), collecting 15 1-ml
fractions. Fractions containing product were identified by TLC,
combined, the solvent removed under reduced pressure, and the
residue reloaded on a second silica column (0.5".times.20") and
re-eluted with C/E/T (9:1:0.25). This solvent system effected
separation of the product from unreacted N,N'dimethyl-1,6-hexane-
diamine. This separation was confirmed by development of the TLC
plate with iodine or ninhydrin (0.5% in ethanol) following elution.
Fractions containing purified product were combined and the solvent
removed under reduced pressure and the residual oil placed under
high vacuum to constant weight. The yield of
4'-N-(N,N'-dimethyl-1,6-hexanediamine)-meth-
yl-4,5'-dimethylisopsoralen (HDAMDMIP, 24) was approximately 50%.
Mass spectrum m/e (relative abundance) 370, (M+, 1.09); absorption
spectra maxima (nm): 252, 303.
[0562] Step 2: HDAMDMIP (18.4 mg, 0.5 mmole, 1.0 eq),
biotinamidocaproate N-hydroxysuccinimide ester (45.5 mg; 0.10 mmol;
2.0 eq; Pierce), and DMF (1.5 ml, freshly distilled onto 4A sieves)
were placed in a 10 ml round bottomed flask with attached argon
line. The reaction was magnetically stirred at room temperature.
TLC after 1 hour (C/E/T 9:1:0.25) showed a high Rf product spot.
After 5 hr reaction time, another 20 mg of biotin starting material
was added and the reaction was continued for another hour. The
solvent was removed under vacuum and the residue dissolved in a
total of 10 ml chloroform isopropanol 3:1 and transferred to a
separatory funnel. HCl (0.1 N; 10 ml) was added and the layers
mixed thoroughly then allowed to separate. The organic phase was
removed and the aqueous phase adjusted to pH 13 then extracted
again with chloroform:isopropanol 3:1. The organic extracts were
combined and the solvent removed under reduced pressure. The
residual solid (39.4 mg) was dissolved in C/E/T, loaded onto a
silica gel column (60-200 meth, 0.5".times.20"), and eluted with
the same solvent. The product was isolated (as the free amine), the
elution solvent removed, and the free amine dissolved in ethanol
(10 ml). HCl gas was bubbled through the solution, followed by
argon. The ethanol was removed to give 31.7 mg of
4'-N--[N,N'-dimethyl-N'-(6-{biotinamido}-h-
exanoate)-1,6-hexanediamine]-methyl-4,5'-dimethylisopsoralen
(BIODMIP, 25a) (HCl salt) (85% yield). FABMS m/e (relative
abundance) 710 (MH+, 60%)
EXAMPLE 23
Radiolabelled BIODMIP Synthesis
[0563] This example describes the synthesis of radiolabelled
HDAMDMIP and BIODMIP from radiolabelled CMDMIP according to the
following scheme:
[0564]
.sup.3H-CMDMIP.fwdarw..sup.3H-HDAMDMIP.fwdarw..sup.3H-BIODMIP
[0565] Step 1: .sup.3H-CMDMIP (70 mg; 0.27 mmol), prepared as
described above, and N,N'-dimethyl-1,6-hexanediamine (500 mg, 3.5
mmole) and freshly distilled toluene (8 ml) were mixed in a 50 ml
round bottomed flask. The solution was stirred overnight. TLC
(chloroform/benzene/aceton- e/formic acid 4:1:1:1) showed that
product had formed and essentially all the starting material had
been consumed. The toluene was removed under reduced pressure and
the residual solid was dissolved in 1-2 ml of C/E/T (9:1:0.25).
This was loaded onto a silica gel column (0.5".times.2", 60-200
mesh, Baker) and eluted with the same solvent. Fractions containing
the product (not separated from the hexanediamine) were combined
and the solvent removed under reduced pressure. The solid was
dissolved in 1-2 ml in the same solvent, loaded onto a larger
column (0.5".times.20") and eluted with the same solvent. The
presence of the hexanediamine compound on TLC was detected by using
1% ninhydrin in ethanol (the solution was sprayed onto the TLC
plates and the plates heated at 70-80.degree.). The column
fractions containing pure
4'-N-(N,N'-dimethyl-1,6-hexanediamine)-[.sup.3H]-methyl-4,5'-dimethylisop-
soralen (.sup.3H-HDAMDMIP) were thus identified, combined and the
solvent removed under reduced pressure, providing 53.7 mg (58%
yield).
[0566] Step 2: .sup.3H-HDAMDMIP (2 mg; 0.005 mmol; 1 eq) and
biotinamidocaproate N-hydroxysuccinimide ester (6.2 mg; 0.014 mmol;
2.8 eq) and DMF (1.0 ml, over sieves) were mixed in a 10 ml round
bottomed flask. The reaction and work-up procedures were identical
to the preparation of the unlabelled compound. Recovered 1.8 mg
product (47% yield) at a specific activity of 2.6.times.10.sup.7
CPM/umol (3.5.times.10.sup.4 CPM/.mu.g).
EXAMPLE 24
DITHIODMIP Synthesis
[0567] This example describes one method of the present invention
for the synthesis of DITHIODMIP according to the following
scheme:
[0568] HDAMDMIP.fwdarw.DITHIODMIP
[0569] HDAMDMIP (30 mg; 0.80 mmol; 1.0 eq) and
sulfosuccinimidyl-2-(biotin- amido)-ethyl-1,3-dithiopropionate (68
mg; 0.112 mmol; 1.40 eq) were dissolved in freshly distilled DMF
(1.5 ml) in a small, dry round bottomed flask with attached argon
line then stirred at room temperature for 3 hr. After this period,
the DMF was removed under reduced pressure and the residue
suspended in 0.1 N NaOH (7 ml), extracted with
chloroform/isopropanol 3:1 (20 ml.times.2), and the organic extract
washed with 0.5 N HCL (20 ml.times.2), water (10 ml.times.2) then
dried (MgSO4), filtered and stripped to give the crude product as a
yellow oil (5.4 mg). The acidic extract from the organic wash was
made basic by the addition of 1.0 N NaOH (30 ml) then extracted
with chloroform (25 ml.times.2). The chloroform was dried
(Na.sub.2SO.sub.4), filtered and stripped to give additional
product (24 mg). To further characterize the product,
4'-N-[N,N'-dimethyl-N'-(2-{biotinamido}-ethyl-1,3-dithiopropiona-
te)-1,6-hexanediamine]-methyl-4,5'-dimethylisopsoralen (DITHIODMIP,
25b) (free base), small aliquots of the stock (ethanolic solution)
were treated with sodium borohydride (Aldrich) or mercaptoethanol
(Aldrich), then the product of these reactions compared to
untreated material. In both cases the product was cleaved as
expected.
EXAMPLE 25
Radiolabelled DITHIODMIP Synthesis
[0570] This example describes one embodiment of the method of the
present invention for the synthesis of .sup.3H-DITHIODMIP according
to the following scheme:
[0571]
.sup.3H-CMDMIP.fwdarw..sup.3H-IMDMIP.fwdarw..sup.3H-HDAMDMIP.fwdarw-
..sup.3H-DITHIODMIP
[0572] Step 1: .sup.3H-CMDMIP (20 mg; 0.75 mmol) prepared as
decribed in Step 4 of Example 19 and sodium iodide (57 mg; 0.38
mmol; dried overnight at 120.degree. C.) and acetone (Mallinckrodt)
are refluxed for 48 hours. Following this period, the reaction
mixture is filtered to remove the resulting NaCl, the filtrate
evaporated under reduced pressure, and the residual crude product
dissolved in chloroform, loaded on a 1/4.times.5" silica gel column
(60-200 mesh; Baker) then eluted with chloroform. The fractions
containing the product, 4'-(iodo-[.sup.3H]-methyl)-4,5'-dimethy-
l-isopsoralen (.sup.3H-IMDMIP, 23), are identified by TLC, combined
and solvent removed under reduced pressure. The product is used
directly for Step 2.
[0573] Step 2: Using the .sup.3H-IMDMIP prepared in Step 1,
.sup.3H-HDAMDMIP is prepared. The synthesis and work-up are
identical to the procedures described in Step 1 of Example 23
except .sup.3H-CMDMIP is replaced by .sup.3H-IMDMIP and the reagent
concentrations used are reduced by two thirds. The resulting crude
.sup.3H-HDAMDMIP is further purified by column chromatography as
described then used directly for the preparation of
.sup.3H-DITHIODMIP.
[0574] Step 3: Using the .sup.3H-HDAMDMIP prepared in Step 3,
.sup.3H-DITHIODMIP is prepared. .sup.3H-HDAMDMIP (5 mg; 0.013 mmol;
1.0 eq) and
sulfosuccinimidyl-2-(biotinamido)-ethyl-1,3-dithiopropionate (11
mg; 0.019 mmol; 1.5 eq) is dissolved in freshly distilled DMF (1.5
ml) in a small, dry round bottomed flask with attached argon line
then stirred at room temperature for 3 hours. After this period,
the DMF is removed under reduced pressure and the residue suspended
in NaOH (0.1 N; 3 ml), extracted with chloroform/isopropanol 3:1 (7
ml.times.2), and the organic extract washed with HCl (0.5 N; 7
ml.times.2), water (5 ml.times.2) then dried (MgSO.sub.4), filtered
and stripped to provide the crude product as a yellow oil. The
product is characterized by ultraviolet absorption (comparison with
authentic material) and TLC (co-chromatography with authentic
material is several different solvent systems). Radiochemical
purity is determined by HPLC. Approximately 10.sup.6 CPM of
tritiated .sup.3H-DITHIODMIP is mixed with 10 .mu.g of unlabelled
DITHIODMIP in 50 .mu.l ethanol (100%). The sample is injected on a
C18 octadecylsilyl reverse phase chromatography column (Beckman)
and eluted with an acetonitrile/ammonium acetate (0.1 M; pH 7)
gradient, as follows: 0-10 minutes, 100% ammonium acetate; 10-70
minutes, 100% ammonium acetate.fwdarw.100% acetonitrile; 70-80
minutes, 100% acetonitrile. Eighty 1.0 ml fractions are collected
and 40 .mu.l of each fraction is then counted. The product is
further characterized by dissolving a sample in ethanol treating
with either sodium borohydride (Aldrich) or mercaptoethanol
(Aldrich). The product of these reactions is compared to untreated
material to verify cleavage occurs as expected.
EXAMPLE 26
FLUORDMIP Synthesis
[0575] This example describes one method of the present invention
for the synthesis of FLUORDMIP according to the following
scheme:
[0576] CMDMIP.fwdarw.HDAMDMIP.fwdarw.FLUORDMIP
[0577] Step 1: HDAMDMIP was prepared from CMDMIP as described in
Step 1 of Example 22.
[0578] Step 2: HDAMDMIP from Step 1 (10 mg; 0.027 mmol; 1.0 eq) in
DMF (1.0 ml, distilled onto 4A sieves; Mallinckrodt) and
6-carboxyfluorescein-N-hydroxysuccinimide ester (15.1 mg; 0.032
mmol; 1.1 eq; Pierce) in DMF (1.0 ml, distilled onto 4A sieves;
Mallinckrodt) were mixed in a 5 ml round bottomed flask with
attached argon line. The reaction mix was stirred for several hours
at room temperature, after which the majority of the starting
material had been consumed as indicated by TLC (C/B/A/F--4:1:1:1).
The solvent was removed with gentle heating (<50.degree. C.)
under reduced pressure. The residue was dissolved in HCl (5 ml; 0.1
N) then extracted with chloroform/isopropyl alcohol (3:1). The
organic extract was then reduced in volume, loaded onto a glass
backed preparative silica gel TCL plate (20 cm.times.20 cm.times.2
mm; Baker) then eluted with C/B/A/F. The major low Rf band was
scraped off, eluted with chloroform/isopropanol (3:1), the silica
removed by filtration and the solvent evaporated under reduced
pressure. The product was dissolved in a small volume of ethanol
and HCl gas bubbled through the solution. The ethanol was then
evaporated to provide
4'-N--[N,N'-dimethyl-N'-(6-carboxyfluoresceinester)-1,6-hexanediamine)-me-
thyl-4,5'-dimethylisopsoralen (FLUORDMIP, 25c) as the
monohydrochloride salt. FABMS (free base) m/e 729, M+; absorption
spectrum relative maximum (nm) 447.
EXAMPLE 27
Radiolabelled FLOURDMIP Synthesis
[0579] This example describes one embodiment of the method of the
present invention for the synthesis of radiolabelled FLUORDMIP
according to the following scheme:
[0580]
FDMIP.fwdarw..sup.3H-HMDMIP.fwdarw..sup.3H-CMDMIP.fwdarw..sup.3H-HD-
AMDMIP.fwdarw..sup.3H-FLUORDMIP
[0581] Step 1: .sup.3H-HMDMIP was prepared from FDMIP as described
in Step 3 of Example 19.
[0582] Step 2: .sup.3H-CMDMIP was prepared from .sup.3H-HMDMIP as
described in Step 4 of Example 19.
[0583] Step 3: .sup.3H-HDAMDMIP was prepared from .sup.3H-CMDMIP as
described in Step 1 of Example 23.
[0584] Step 4: .sup.3H-FLUORDMIP was prepared from
.sup.3H-HDAMDMIP. .sup.3H-HDAMDMIP (3.1 mg; 0.0084 mmol; 1.0 eq) in
DMF (1.7 ml, distilled over 4A sieves) and
6-carboxy-fluorescein-N-hydroxysuccinimide (4.0 mg; 0.0084 mmol;
1.0 eq) in DMF (1.0 ml) were mixed in a 5 ml round bottomed flask
with attached argon line. This mixture was stirred overnight. The
work-up was similar to the preparation in Step 2 of Example 26,
except the preparative TLC plate was eluted with C/B/A/F (5:1:1:1;
this solvent gave a slightly higher Rf and better separation of the
product). Approximately 2.1 mg product was obtained (a 42% yield)
with a specific activity of 93 mCi/mmol.
EXAMPLE 28
Solubility of Photoreactive Compounds
[0585] The solubilities of AMIP, AMDMIP, DMIP, MIP and isopsoralen
(IP) were determined experimentally according to the scheme set
forth in FIG. 5. To perform the solubility measurement, it was
first necessary to establish known optical densities for a 1
.mu.g/ml solution of each compound. These were determined by
preparing either ethanolic or aqueous stocks of each compound at
known concentrations in 1.times.TE, then measuring the optical
density of each solution. From this information, the absorption of
a 1 .mu.g/ml solution was computed. Alternatively, the extinction
coefficient may be thus determined and used in the same fashion. In
this manner, the following absorption data was collected:
27 O.D. 1 .mu.g/ml Compound Wavelength (nm) (1 .times. TE) Emax
AMIP 249 0.087 2.19 .times. 10.sup.4 AMDMIP 249.5 0.082 2.29
.times. 10.sup.4 DMIP 250.5 0.102 2.18 .times. 10.sup.4 MIP 249
0.092 1.97 .times. 10.sup.4 IP 247 0.105 1.95 .times. 10.sup.4
[0586] To determine the solubility of each compound, an excess
(2-25 mg) of each (except for AMDMIP; see below) was placed in
1.times.TE (0.37-2 ml) then heated (50.degree.-70.degree. C.) for
several hours. After this, each mixture was stirred for several
hours at room temperature in the presence of undissolved solid
(this procedure assured that supersaturation did not occur).
Following this step, undissolved compound was removed by filtration
using a 0.2 u nylon-66 syringe filter (Arco LC13; Gelman). The
concentration of the remaining soluble compound was then determined
by measuring the optical density of the filtrate and computing the
solubility from the known optical density of a 1 .mu.g/ml solution
of that compound.
[0587] The solubility of the compounds was thus determined to be as
follows:
28 Compound Solubility in 1 .times. TE (.mu.g/ml) AMIP 21,000
AMDMIP >22,700* DMIP nd** MIP nd IP 2 *The solubility of AMDMIP
was a minimum of 22,700 .mu.g/ml, as the initial mix of the
compound was entirely soluble in the volume of 1 .times. TE used.
**nd = not detectable (solubility was less than 1 .mu.g/ml).
EXAMPLE 29
Dark Binding of Photoreactive Compounds
[0588] Equilibrium Dialysis was used to determine the association
("dark binding") constants of AMIP, AMDMIP and MIP with calf thymus
DNA. The tritium labelled isopsoralens were used for the
experiment. The method was a modification of that of Isaacs et al.
Biochemistry 16, 1058-1066 (1977).
[0589] Spectrapor 2 dialysis tubing (Spectrum) was pretreated by
boiling in saturated sodium bicarbonate then rinsed thoroughly with
double distilled water. Calf thymus DNA (Sigma) was prepared at a
concentration of 50 .mu.g/ml in 1.times.TE. The samples were
prepared by placing 1.0 ml of the DNA solution inside the bag and
using enough isopsoralen to provide an isopsoralen:DNA base pair
ratio of 1:15. The samples were prepared with the tritiated
isopsoralen ("Drug") placed either inside or outside
29TABLE 9 VOLUME OF DNA VOLUME OF 1 .times. TE SAMPLE MASS OF DRUG
LOCATION OF DRUG STOCK IN DIALYSIS BAG STOCK IN DIALYSIS BAG MIP in
1.27 ug inside bag 1 ml 10 ml HMT in 1.43 ug " " " AMIP in 1.30 ug
" " " AMDMIP in 1.01 ug " " " MIP out 1.27 ug outside bag 1 ml 10
ml HMT out 1.43 ug " " " AMIP out 1.30 ug " " " AMDMIP out 1.01 ug
" " "
[0590] of the dialysis bag (each sample was placed in a
scintillation vial containing a small magnetic stir bar). The
samples were stirred at 4.degree. C. for five days in the dark.
After this period the bags were removed, opened, and the
radioactivity inside and outside the bag determined by
scintillation counting. The concentration of the DNA was determined
by measuring optical density at 260 nm. The dissociation constant
(K.sub.a) was calculated from this information (Table 9). Preparing
the samples in duplicate with the isopsoralen both inside and
outside the dialysis bag provided a check that the system had come
to equilibrium at the end of the dialysis period (the amount of
isopsoralen inside and outside the bag at equilibrium should be,
and was, the same in both cases).
[0591] The association constant, K.sub.a is defined here as 1 K a =
[ P : DNA ] [ P ] [ DNA ]
[0592] for the reaction P+DNA=P:DNA where P=free drug in solution,
DNA=DNA binding site for the drug, and P:DNA=drug associated with
the DNA. The following summarizes the K.sub.a values determined for
the compounds:
30 Sample K.sub.e AMIP in 2.96 .times. 10.sup.4 AMIP out 2.21
.times. 10.sup.4 AMDMIP in 7.66 .times. 10.sup.4 AMDMIP out 1.07
.times. 10.sup.5 MIP in 9.08 .times. 10.sup.3 MIP out 2.07 .times.
10.sup.3
EXAMPLE 30
Photoactivation Device
[0593] One embodiment of the photoactivation device of the present
invention is designated "CE-I." CE-I is an irradiation device
having the following features: 1) an inexpensive source of
electromagnetic radiation, 2) temperature control of the sample, 3)
a multisample holder, 4) a multiple sample irradiation format, and
5) a compact design that requires minimal bench space.
[0594] FIG. 6 is a perspective view of CE-I, integrating the
above-named features. The figure shows the bottom platform of a
housing (100) with the rest of the housing removed (not shown),
having six bulbs (101-106) connectable to a power source (not
shown) arranged around a chamber (107) having a plurality of
intrusions (108) for supporting a plurality of sample vessels
(109). The bulbs serve as a source of electromagnetic radiation
and, in one embodiment, ultraviolet radiation. While not limited to
the particular bulb type, the embodiment is configured to accept an
industry standard, F8T5BL hot cathode dual bipin lamp.
[0595] The chamber (107), in addition to holding sample vessels
(109), holds temperature control liquid (not shown), thereby
serving as a means for controlling the temperature of the sample
vessels (109).
[0596] FIG. 7 is a cross-sectional view of CE-I along the lines of
a--a of FIG. 6. FIG. 7 shows the arrangement of the sources
(101-106) around the chamber (107). FIG. 7 also shows the chamber
(107) is punctuated with sample holder intrusions (108) with
dimensions designed to accommodate the sample vessels (109).
[0597] It is not intended that the present invention be limited by
the nature of the material used to form the chamber (107). In one
embodiment, it is made of glass. In another embodiment, it is made
of plastic. In a preferred embodiment, it is made of UV
transmitting acrylic selected from the group of commercial acrylics
consisting of ACRYLIC-UVT (Polycast), PLEXIGLAS 11-UVT (Rohm &
Haas), PLEXIGLAS G-UVT (Rohm & Haas) and ACRYLITE OP-4
(Cyro).
[0598] Similarly, it is not intended that the present invention be
limited by the nature of the method used to form the chamber (107).
In one embodiment, it is molded as one piece. In another
embodiment, it is molded as separate pieces and then assembled.
[0599] FIG. 6 shows that the temperature control liquid is
introduced via a liquid inlet port (111) and removed via a liquid
outlet port (112). It is preferred that the liquid inlet port (111)
and the liquid outlet port (112) connect via tubes (113, 114) to a
liquid source (not shown). It is further preferred that the liquid
source allow for recirculation of the liquid. To improve
temperature control, static temperature control liquid (not shown)
may, be placed in the intrusions (108).
[0600] It is not intended that the present invention be limited to
any particular temperature control liquid. One inexpensive
temperature control liquid contemplated by the invention is
water.
[0601] FIG. 8 shows the CE-I embodiment with seven intrusions (108)
placed within the boundary defined by the inlet (111) and outlet
(112) ports. While the number of intrusions (108) and their
placement may be selected to suit the convenience of the user, some
configurations may impact irradiation efficiency.
[0602] FIGS. 6 and 7 also show an array of reflectors (115, 116,
117). It is preferred that the reflectors are made from UV
reflecting metal.
[0603] While not limited to any particular dimensions (the drawings
are not drawn to scale), it is preferred that the intrusions (108)
be approximately 4 cm deep, that the intrusions be spaced
approximately 3 cm apart, and the the distance from the top surface
of the housing to the opening of the intrusions be approximately
6.5 cm. In such an arrangment, the lower bulbs (103, 104) are
preferrably 2.3 cm apart when measured from their centers (their
centers are preferrably 1.2 cm above the housing when measured from
the surface of the reflector 117). This allows the lower bulbs
(103, 104) to be less than 1.5 cm in distance from the bottom of
the reaction vessel (109).
[0604] The other bulbs can be viewed as two more sets (101, 102 and
105, 106) (for a total of three, two bulb sets in all). Within a
set, it is preferred that the bulbs are 2.3 cm apart when measuring
from their centers (their centers are preferrably 1.2 cm away from
the the surface of the reflectors 115, 116). It is preferred that
the reflectors 115 and 116 are approximately 11 cm apart when
measuring from their sides.
[0605] It is preferred that the relationship of the chamber (107)
length ("CL") to the bulb (101-106) length ("BL") and to the
reflector (115,116,117) length ("RL") is as follows:
[0606] RL>BL>CL
[0607] Preferred lengths are RL=29.5 cm, BL=between 26 cm and 29
cm, and CL=approximately 25 cm.
EXAMPLE 31
Photoactivation Device
[0608] One embodiment of the photoactivation device of the present
invention is designated "CE-II." CE-II is an irradiation device
created to serve as a convenient photoactivation device having the
following features: 1) an inexpensive source of electromagnetic
radiation, 2) temperature control of the sample, 3) a multisample
holder, 4) a multiple sample irradiation format, 5) a housing that
shields the user from stray electromagnetic radiation, and 6) a
compact design that requires minimal bench space.
[0609] FIG. 9 is a perspective view of CE-II, integrating the
above-named features, showing a housing (200) containing six bulbs
(201-206) connectable to a power source (not shown) arranged around
a detachable chamber (207). FIG. 10 shows that the chamber (207)
has a plurality of intrusions (208) for supporting a plurality of
sample vessels (not shown).
[0610] The bulbs serve as a source of electromagnetic radiation
and, in one embodiment, ultraviolet radiation. While not limited to
the particular bulb type, the embodiment is configured to accept an
industry standard, F8T5BL hot cathode dual bipin lamp.
[0611] The housing (200) also serves as a mount for several
electronic components. A main power switch (209) controls the input
current from the AC power source (not shown). For convenience, this
power switch (209) is wired to a count down timer (210) which in
turn is wired in parallel to an hour meter (211) and to the coils
(not shown) of the source of electromagnetic radiation. The count
down timer (210) permits a user to preset the irradiation time to a
desired level of sample exposure. The hour meter (211) maintains a
record of the total number of radiation hours that are provided by
the source of electromagnetic radiation. This feature permits the
bulbs (201-206) to be monitored and changed before their output
diminishes below a minimum level necessary for rapid
photoactivation.
[0612] The chamber (207), in addition to holding sample vessels,
holds temperature control liquid (not shown), thereby serving as a
means for controlling the temperature of the sample vessels.
[0613] It is not intended that the present invention be limited by
the nature of the material used to form the chamber (207). In one
embodiment, it is made of glass. In another embodiment, it is made
of plastic. In a preferred embodiment, it is made of UV
transmitting acrylic selected from the group of commercial acrylics
consisting of ACRYLIC-UVT (Polycast), PLEXIGLAS 11-UVT (Rohm &
Haas), PLEXIGLAS G-UVT (Rohm & Haas) and ACRYLITE OP-4
(Cyro).
[0614] Similarly, it is not intended that the present invention be
limited by the nature of the method used to form the chamber (207).
In one embodiment, it is molded as one piece. In another embodiment
it is molded in separate pieces and then assembled.
[0615] FIG. 9 shows that the temperature control liquid is
introduced via tubes (212, 212) from a liquid source (not shown)
and is circulated via liquid inlet and outlet ports (not shown). It
is not intended that the present invention be limited to any
particular temperature control liquid. One inexpensive temperature
control liquid contemplated by the invention is water.
[0616] FIG. 10 shows the positioning of reflectors (214,215). It is
preferred that the reflectors be made from UV reflecting metal.
[0617] FIG. 9 shows CE-II with twenty intrusions (208) placed
within the boundary defined by tubes (212, 223). While the number
of intrusions (208) and their placement may be selected to suit the
convenience of the user, there can be a significant impact on
irradiation efficiency. In this embodiment, the intrusions (208)
were aligned in two rows with the intrusion (208) of one row lined
up opposite the intrusion (208) of the other row. Performance data
obtained subsequent to the design indicated that this arrangement
of intrusions (208) may cause the electromagnetic radiation to be
partially blocked, i.e. the intrusion (208) of one row is blocking
electromagnetic radiation coming from one side of the device so
that the intrusion (208) opposite from it in the other row receives
less electromagnetic radiation.
[0618] FIG. 10 shows the "V-shape" geometry of the bulb (201-206)
placement of this embodiment in relation to the chamber (207). The
V-shape geometry is, in large part, dictated by the dimension
demands placed on the chamber (207) by virtue of the double row
arrangment of the intrusions (208). The distance from the center of
one intrusion (208) in one row and to the center of the opposite
intrusion (208) in the other row is greater than 5.5 cm. This
causes the upper level bulbs (201, 206) to be placed almost 13.5 cm
apart (measured center to center), the middle level bulbs (202,
205) to be placed almost 11.5 cm apart (measured center to center),
and the lower level bulbs (203, 204) to be placed almost 4.0 cm
apart (measured center to center).
[0619] It is preferred that the relationship of the chamber (207)
length ("CL") to the bulb (201-206) length ("BL") and to the
reflector (214,215) length ("RL") is as follows:
[0620] RL>BL>CL
[0621] In this embodiment, CL=approximately 37 cm.
EXAMPLE 32
Photoactivation Device
[0622] A preferred embodiment of the photoactivation device of the
present invention is designated "CE-III." CE-III is an irradiation
device created to optimize rapid photoactivation having the
following features: 1) an inexpensive source of electromagnetic
radiation, 2) temperature control of the sample, 3) control of
irradiation time, 4) a multisample holder, 5) a multiple sample
irradiation format, 6) a housing that shields the user from stray
electromagnetic radiation, and 7) a compact design that requires
minimal bench space.
[0623] FIGS. 11, 12 and 13 are views of CE-III, integrating the
above-named features, showing a housing (300) containing eight
bulbs (301-308) connectable to a power source (not shown) arranged
around a detachable chamber (309), having interior (310) and
exterior walls (311). The interior walls (310) form a trough (312).
FIGS. 11 and 13 show one embodiment of an interchangeable,
detachable sample rack (313A). The sample rack (313A) is detachably
coupled to the housing (300) above the trough (312). Sample vessels
(315) fit in the sample rack (313A) and are thereby aligned in the
trough (312). A sample overlay (314) extends over and covers the
interchangeable sample rack (313A) sealing the unit and shielding
the user from electromagnetic radiation when the device is in
operation.
[0624] FIG. 14 shows an alternative embodiment of an
interchangeable, detachable sample rack (313B). Note that in this
embodiment, the placement of sample vessels (315) in two rows is
staggered to avoid blocking electromagnetic radiation (compare with
CE-II, above).
[0625] FIG. 12 shows a unitary reflector (316) extending around all
the bulbs (301-308) of the device. It is preferred that the
reflector (316) is made of UV reflecting material.
[0626] The chamber (309) holds circulating temperature control
liquid (317) between the interior (310) and exterior walls (311),
thereby serving as a means for controlling the temperature of the
sample vessels (315). FIG. 13 shows that the circulating
temperature control liquid (317) is introduced from a liquid source
(not shown) via a liquid inlet port (318) and removed via a liquid
outlet port (319), allowing for recirculation of the liquid. To
improve temperature control, static temperature control liquid (not
shown) may be placed in the trough. It is not intended that the
present invention be limited to any particular temperature control
liquid. One inexpensive temperature control liquid contemplated by
the invention is water.
[0627] It is not intended that the present invention be limited by
the nature of the material used to form the chamber (309). In one
embodiment, it is made of glass. In another embodiment, it is made
of plastic. In a preferred embodiment, it is made of UV
transmitting acrylic selected from the group of commercial acrylics
consisting of ACRYLIC-UVT (Polycast), PLEXIGLAS 11-UVT (Rohm &
Haas), PLEXIGLAS G-UVT (Rohm & Haas) and ACRYLITE OP-4
(Cyro).
[0628] Similarly, it is not intended that the present invention be
limited by the nature of the method used to form the chamber (309).
In one embodiment, it is molded as one piece. In another embodiment
it is molded in separate pieces and then assembled.
[0629] The housing (300) also serves as a mount for several
electronic components. A main power switch (320) controls the input
current from the AC power source (not shown). For convenience, this
power switch is wired to a timer activation switch (321); in the
"ON" position, the timer activation switch (321) provides power to
a count down timer (322). The count down timer (322) in turn
controls the current to an hour meter (323) and to the coils (not
shown) of the source of electromagnetic radiation. The count down
timer (322) permits a user to preset the irradiation time to a
desired level of sample exposure. The hour meter (323) maintains a
record of the total number of radiation hours that are provided by
the source of electromagnetic radiation. This feature permits the
bulbs (301-308) to be monitored and changed before the output
diminishes below a level necessary to achieve rapid
photoactivation. In the "OFF" position, timer activation switch
(321) is wired such that it bypasses the count down timer (322) and
provides continual power to the hour meter (323) and the coils (not
shown) of the source of electromagnetic radiation.
[0630] FIG. 12 shows the "U-shape" geometry of the bulb (301-308)
placement of this embodiment in relation to the chamber (309).
(Compare with the V-shape geometry of CE-II.) The U-shape geometry
is, in large part, allowed by the smaller dimensions of the chamber
(207) by virtue of the trough (312) design.
[0631] While not limited by the particular dimensions, the width of
the trough (312), when measured by the length of the bottom
exterior wall (311) is 6 cm. The upper level bulbs (301, 308) are
placed less than 9 cm apart (measured center to center).
[0632] Again, it is preferred that the chamber (309) length ("CL"),
the bulb (301-308) length ("BL") and the reflector (317) length
("RL") follow the relation ship: RL>BL>CL.
EXAMPLE 33
Photoactivation Device: Temperature Control
[0633] Temperature changes can have a drastic impact on
photoactivation chemistry. It is desired that the devices of the
present invention provide temperature control to limit the
possibility of uncontrolled changes on photoactivation results.
[0634] FIG. 15 illustrates the problem of lack of temperature
control for the devices of the present invention. CE-I, CE-III and
the PTI device were allowed to irradiate 1.5 ml Eppendorph tubes
without using the means for controlling the temperature of the
sample vessels of the present invention. The temperature of the
temperature control liquid was measured over time. Measurements
were conducted with a type T thermocouple immersed into a 0.5 ml
Eppendorph tube containing 100 .mu.l of dH.sub.2O. The Eppendorph
tube was irradiated in each device. For irradiations with the PTI
device, the tube was irradiated from the top down, with the cap
closed. Temperature was monitored on an Omega Temperature
Controller, Model 148 (Omega Engineering, Inc., Stamford,
Conn.).
[0635] The results (FIG. 15A) show that the temperature of the
sample vessel rapidly increases in temperature without temperature
control. By contrast, irradiations with temperature control (FIG.
15B) show a constant temperature.
EXAMPLE 34
Photoactivation Device: Energy Output
[0636] This example investigates energy output as it relates to
optimum photobinding kinetics. FIG. 16 shows the relative energy
output of the devices of the present invention. The PTI device has
a tremendously strong intensity relative to CE-III. From the
relative intensity output it would appear that the fluorescent
source of ultraviolet irradiation is not of sufficient flux for
rapid photoactivation. At the very least, a dramatic difference in
kinetics of photobinding was expected for the two machines. The
impact of this difference on binding was investigated as shown in
FIG. 17. .sup.3H-HMT was used to measure binding to calf thymus
DNA. .sup.3H-HMT was mixed with the DNA and irradiated. The product
was then extracted with chloroform to separate the unbound
.sup.3H-HMT. The nucleic acid was then precipitated and
solubilized. Bound HMT was determined by scintillation counting
along with measuring the optical density of the DNA solution.
[0637] The results are shown in FIG. 18. Surprisingly, the kinetics
of the CE-III device are essentially the same as the costly PTI
device. Plateau binding for the CE-III and PTI machines was reached
in less than five minutes. Interestingly, CE-II did not reach
plateau binding under the conditions of the experiment. (Plateau
binding might be reached with the CE-II device in one of two ways:
1) additional radiation time, or 2) use of a sample vessel with
better UV transmission properties such as a polycarbonate
tube).
EXAMPLE 35
Photoactivation Device: Sample Position
[0638] The impact of the small differences in position of samples
within the photoactivation device was investigated. FIG. 19 shows
the intensity of the light of CE-III at the surface of the trough
(FIG. 12, element 312) according to sample position. Samples from
the center position and the end position of the sample rack (FIG.
11, element 313A) were examined for photobinding in the manner
outlined in FIG. 17. The results are shown in FIG. 20. It is clear
that some difference in photoaddition kinetics exists when the
irradiation time is below two minutes. This illustrates the
importance of plateau binding to nullify such small positional
differences (contrast FIG. 20 with FIG. 18).
EXAMPLE 36
Photoactivation Device: Photoproduct
[0639] In the first part of this example, the various embodiments
of the photoactivation device of the present invention were
investigated for their ability to create photoproduct. In the
second part, photoproduct is shown to bind to nucleic acid.
[0640] FIG. 21 shows schematically the manner in which photoproduct
generation was investigated. FIG. 22 shows the production of
photoproduct over time on the CE-III device for known compound
AMDMIP. While the AMDMIP standard (unirradiated compound) shows a
single peak on HPLC (FIG. 22A), AMDMIP photoproduct peaks increase
and the AMDMIP peak diminishes from two minutes (FIG. 22B), five
minutes (FIG. 22C) and fifteen minutes (FIG. 22D).
[0641] FIG. 23 shows production of photoproduct according to the
photoactivation device used for known compound AMDMIP. Again the
AMDMIP standard is a single peak on HPLC (FIG. 23A). By contrast,
the fifteen minute irradiation with CE-III shows increase in
photoproduct peaks and a decrease in the AMDMIP peak (FIG. 23,
compare A to B and note scale change). Irradiation for the same
time period, however, on the PTI device shows very little reduction
in the AMDMIP peak and very little generation of photoproduct peaks
(FIG. 23, compare A to C and note scale change). Clearly, the
CE-III device generates more AMDMIP photoproduct than does the PTI
device.
[0642] FIG. 24 shows production of photoproduct according to the
photoactivation device used for novel compound AMIP. The AMIP
standard is primarily a single peak on HPLC (FIG. 24A). By
contrast, the fifteen minute irradiation with CE-I device shows the
appearance of photoproduct peaks and a decrease in AMIP the peak
(FIG. 24, compare A to B and note scale change). Similarly, the
fifteen minute irradiation with CE-III device shows the appearance
of photoproduct peaks and a decrease in the AMIP peal: (FIG. 24,
compare A to C and note scale change). Interestingly, irradiation
of AMIP for the same time period with the PTI device shows
approximately the same amount of photoproduct formation as with the
CE-I and CE-III devices (FIG. 24, compare D with B and C).
[0643] The nucleic acid binding properties of photoproduct were
investigated with calf thymus DNA. 200 .mu.g/ml of .sup.3H-AMDMIP
(1.times.10.sup.5 CPM/ml) in Taq buffer was irradiated at room
temperature with either the CE-III device or the PTI device. This
irradiation was performed for 15 minutes in the absence of nucleic
acid. Following the irradiations, 200 .mu.l of the irradiated
solution was mixed with 200 .mu.l of 1000 .mu.g/ml DNA solution in
Taq buffer. Several identical samples were prepared in this manner.
One set of samples was allowed to react with the DNA for 2 hours at
room temperature. The other set of samples was subjected to 30
cycles of heating and cooling by placing the samples in a thermal
cycler [Perkin-Elmer Cetus DNA Thermal Cycler (Part No. N8010150);
each cycle involved 93.degree. C. for 30 seconds, 55.degree. C. for
30 seconds and 72.degree. C. for 1 minute]. When the DNA reactions
were complete, all samples were analyzed for DNA-associated tritium
counts (CPM) by following the flow chart outlined in FIG. 17.
[0644] The DNA-associated counts are given in terms of adducts per
100 base pairs in Table 10. For calculation purposes, these adducts
are reported as if they represented monomers of AMDMIP. Regardless
of the accuracy of this approximation, the process of irradiating
.sup.3H-AMDMIP clearly results in a tritiated product which
associates (i.e. binds) with DNA in the absence of subsequent
activating wavelengths of electromagnetic radiation. The extent of
the association is shown in Table 10 to depend upon the reaction
conditions.
[0645] Binding is influenced by the photoactivation device used.
When .sup.3H-AMDMIP irradiated with the CE-III device is compared
with .sup.3H-AMDMIP irradiated with the PTI device, a significantly
greater amount of associated counts is observed. This can be viewed
as consistent with the observation (FIG. 23) that more photoproduct
is made with CE-III than with the PTI device after the same
exposure time. Interestingly, thermal cycling results in a five
fold higher association than a 2 hour reaction at room temperature
(regardless of the device used).
[0646] As seen by the results with no irradiation, the isolation
procedure that was applied to the DNA
31TABLE 10 Binding of Photoproduct to Nucleic Acid ADDUCTS PER DARK
REACTION 1000 BASE DEVICE IRRADIATION TREATMENT PAIRS None None
Room Temp. 1. 1 None None Thermally 0.9 Cycled CE-II 15 mins. Room
Temp. 4.4 CE-III 15 mins. Thermally 24.3 Cycled PTI 15 mins. Room
Temp. 1.7 PTI 15 mins. Thermally 5.7 Cycled
[0647] samples to remove unbound reactants removes most of the
non-covalently associated reactants. The increase in counts seen
when irradiated AMDMIP reacts with DNA, relative to those counts
seen when unirradiated AMDMIP is reacted, is therefore presumed to
be due to covalent association of photoproduct with DNA.
[0648] That is not to say, however, that the counts must be due to
covalent interactions. It is possible that photoproduct has a very
high non-covalent association with nucleic acid. This association
may be high enough that photoproduct is non-covalently associated
with DNA even after the rigorous work up.
EXAMPLE 37
Nucleic Acid Binding
[0649] It will be desirably in some situations to have precise
control of the binding levels of a photoactive compound to nucleic
acids. As shown earlier in FIG. 18, binding levels are a function
of the irradiation time. Providing that the irradiation time is
sufficient to achieve the plateau level, a constant level of
binding can be achieved. In addition to light exposure, the
concentration of the photoactive compound also affects the ultimate
binding levels. As discussed in the introduction, photoactive
compounds such as psoralen and isopsoralen undergo competing
reactions during exposure to actinic light. They will undergo
photodecomposition at the same time as they add to polynucleotides.
Although the structural properties of a particular photoactive
compound determine the relative rates of photodecomposition to
photoaddition reactions, the initial concentration of the compound
does affect the plateau level of binding. This example investigates
the binding levels as a function of concentration. Following the
procedure outlined in FIG. 17, .sup.3H-AMDMIP was used at different
concentrations to measure binding to calf thymus DNA. The results
are shown in FIG. 25. Clearly, the concentration of AMDMIP affects
the binding levels achieved with calf thymus DNA. Providing
irradiations are of sufficient duration to achieve plateau levels,
the concentration dependence can be used to precisely control
addition reactions to a desired level of photobinding.
EXAMPLE 38
Nucleic Acid Binding
[0650] FIG. 17 can again be referred to as a flow chart
schematically showing the manner in which covalent binding was
measured for the compounds synthesized by the methods of the
present invention. .sup.3H-AMIP (3.1.times.10.sup.5 cpm/.mu.g),
.sup.3H-AMDMIP (2.2.times.10.sup.5 cpm/.mu.g), and .sup.3H-MIP
(2.1.times.10.sup.5 cpm/.mu.g) were added to 300 .mu.l of calf
thymus DNA (Sigma) in 1.times.TE buffer. All of the isopsoralen
compounds were added at a nominal concentration of 100 .mu.g/ml.
However, actual concentrations obtained empirically (counted after
sitting overnight at room temperature) were: .sup.3H-AMIP (105
.mu.g/ml), .sup.3H-AMDMIP (115 .mu.g/ml), and .sup.3H-MIP (<10
.mu.g/ml).
[0651] To assess binding, three samples were prepared for each
compound; two were irradiated (15 minutes at 25.degree. C. with the
CE-I device) while one was unirradiated as a control. Following
irradiation, the samples were extracted four times with CHCl.sub.3
then precipitated twice. The final pellet was brought up in 1 ml of
1.times.TE buffer and resuspended by shaking at 40.degree. C.
overnight. 50 .mu.l of each sample was then diluted to 0.5 mls with
H.sub.2O. The concentration of DNA was determined by UV absorption
(A.sub.260) and the amount of covalently bound isopsoralen
("adduct") was determined by scintillation counting (3.times.100
.mu.l aliquots). From these numbers, the following binding ratios
(adducts: DNA base pair) were determined:
32 .sup.3H-Compound Ratio AMIP 1:16.7 AMDMIP 1:7.2 MIP 1:44.2
[0652] From these ratios it is clear that AMDMIP has the highest
binding and MIP has the lowest binding. It is not clear, however,
that MIP's low binding ratio is due to low affinity with DNA.
Indeed, from the fact that empirically determined concentration of
MIP was <10 .mu.g/ml as opposed to 100 .mu.g/ml for AMDMIP, it
would appear that the low ratio is due primarily to low solubility
of MIP.
[0653] On the other hand, the fact that the concentrations of AMIP
and AMDMIP were approximately the same would suggest that the
difference in ratios represents a difference in affinity.
EXAMPLE 39
Nucleic Acid Binding
[0654] .sup.3H-AMIP (0.04 umol) or .sup.3H-AMDMIP (0.035 .mu.mol)
were added to 5 .mu.g (0.1 nmol) each of HRI 46 and HRI 47
(complementary 115-mers) in a total volume of 100 .mu.l of either
standard irradiation buffer (0.1 M NaCl, 10 mM Tris pH 7, and 1 mM
EDTA) or 1.times.Taq buffer (50 mM KCl, 50 mM Tris pH 8.5, 2.5 mM
MgCl.sub.2, 200 .mu.g/ml gelatin). To assess binding, three samples
were prepared for each compound; one was irradiated for 15 minutes
at 25.degree. C. with the CE-I photoactivation device; one was
irradiated for 15 minutes at 25.degree. C. with the PTI
photoactivation device; one was unirradiated as a control. All the
samples were then extracted four times with 100 .mu.l CHCl.sub.3,
brought to 0.2 M NaCl and 5 mM MgCl.sub.2, and precipitated with
250 .mu.l ethanol at -20.degree. C. The pellets were dried,
resuspended and reprecipitated. The final pellets were brought up
in 0.5 ml H.sub.2O. The concentration of DNA was determined by UV
absorption (A.sub.260) and the amount of adduct was determined by
scintillation counting (4.times.100 .mu.l aliquots). Binding was
calculated using molecular weights (AMIP*HCl MW=251.5; AMDMIP*HCl
MW=279.5; 115-mer complex MW=74800) and concentrations (30 .mu.g/ml
oligo per 1 OD at 260 nm). From these numbers, the following
binding ratios (adducts:DNA base pair) were determined:
33 .sup.3H-Compound Device Buffer Ratio AMIP CE-I NaCl 1:9.3 AMIP
PTI NaCl 1:14.2 AMIP CE-I Taq 1:7.6 AMIP PTI Taq 1:12.5 AMDMIP CE-I
NaCl 1:2.7 AMDMIP PTI NaCl 1:3.9 AMDMIP CE-I Taq 1:2.5 AMDMIP PTI
Taq 1:4.2
[0655] From these ratios it is clear that AMDMIP again has the
highest binding. Interestingly, the CE-I device shows better ratios
(regardless of the compound used) than the PTI device. Most
importantly, the use of discreet viral sequences of DNA results in
better binding than calf thymus genomic DNA.
[0656] This latter point is probably due to the A:T rich nature of
the sequences used. HRI 46 and 47 have almost 60% A:T sequences.
Since isopsoralens are thought to intercalate preferentially at
these sites, an A:T rich nucleic acid such as used here should show
increased binding with these photoreactive compounds.
[0657] This increased binding is due to two factors: 1) using a
higher isopsoralen concentration relative to nucleic acid and 2)
the above-mentioned A:T rich nature of the sequences used. It is
expected that increasing the concentration of photoreactive
compound (relative to concentration of nucleic acid) will increase
binding up to a point. A higher relative concentration of AMIP to
DNA was used here as compared to the relative concentration in
Example 38, and a corresponding increase in covalent binding was
realized (1:9.3 versus 1:16.7).
EXAMPLE 40
Nucleic Acid Binding
[0658] BIODMIP (100 .mu.g/ml) was irradiated for 30 minutes at room
temperature with the PTI device in 500 .mu.l of 1.times.TE buffer
with 2 .mu.g of Hind-III restriction fragments of lambda DNA. After
the first irradiation, the mixture was transferred to a new tube
containing 50 .mu.g additional BIODMIP and this was incubated at
37.degree. C. for one hour to dissolve the compound. This was
followed by a second 30 minute irradiation at room temperature with
the PTI device. It was observed that, under these conditions
BIODMIP added to the DNA at a ratio of 1 covalently bound BIODMIP
per 20 base pairs.
EXAMPLE 41
Nucleic Acid Binding
[0659] This example describes photobinding of .sup.3H-AMIP,
.sup.3H-AMDMIP and BIOMIP to RNA. A tRNA stock was prepared at a
concentration of 765 .mu.g/ml in 1.times.TE/10 mM NaCl. Appropriate
amounts of each compound were prepared in separate reaction vessels
such that upon addition of 200 .mu.l of the tRNA solution (153
.mu.g) the final concentration of each compound was 100 .mu.g/ml.
.sup.3H-AMIP and .sup.3H-AMIP were used in the experiment; the
BIOMIP used was unlabelled. Each reaction vessel was then
irradiated for 30 minutes at 25.degree. C. in the CE-III device.
Identical unirradiated reaction mixtures were used as controls for
each compound. Following irradiation, each mixture was extracted
with CHCl.sub.3 (4.times.200 .mu.l) then precipitated (.times.2).
The pellets were resuspended in 1.times.TE and the binding levels
determined as follows. For the two labelled compounds
(.sup.3H-AMDMIP and .sup.3H-AMIP), the nucleic acid concentration
was determined optically and radioactivity measured by
scintillation counting of aliquots of the stock solutions. Binding
of the compounds was then calculated to be as follows:
34 Sample Adducts : RNA Bases AMIP Control 1 : 51000 AMIP + hv 1 :
18 AMDMIP Control 1 : 15000 AMDMIP + hv 1 : 18
[0660] To determine if binding of BIOMIP to tRNA has occurred, it
was necessary to use a non-radioactive format which detected the
biotin moiety on the compound. A commercial kit ("BluGene"; BRL)
was used for this purpose. The kit instructions were followed for
detection of both the control DNA (supplied with the kit) and
BIOMIP treated tRNA. Samples containing 20, 10, 5, 2 or 0 pg of
control DNA and between 1 .mu.g and 10 .mu.g of BIOMIP treated tRNA
(+/-light) were spotted onto a dry nitrocellulose membrane then
fixed by basing under vacuum at 80.degree. C. for 2 hours. The blot
was then developed as specified with the following results. All of
the control DNA samples gave the expected color pattern, with even
the 2 pg sample visible on the blot. A clear increase in signal was
seen for the irradiated samples (1 .mu.g<5 .mu.g<10 .mu.g)
while no signal was evident from the unirradiated controls. This
demonstrated that BIOMIP had covalently bound to the tRNA.
EXAMPLE 42
Template-dependent Enzymatic Synthesis
[0661] The sequences that are presented in FIG. 26 describe several
oligonucleotides that are used in the synthesis of either a normal
71-mer or the identical 71-mer containing a site-specifically
placed psoralen or isopsoralen monoadduct. The 71-mer is a
sub-sequence of the Human Immunodeficiency Virus (HIV) sequence.
(An HIV DNA system is described in a co-pending application, Ser.
No. 225,725.) SK-39 is a primer oligonucleotide that is
complementary to the 3' end of the 71-mers. This primer
oligonucleotide can be extended on the 71-mer template to make a
complementary strand of the 71-mer.
[0662] FIG. 27 shows the manner in which the monoadducted template
was derived. Preparation of 71-mers which contain site-specific
monoadducts involves 1) preparation of different 15-mer monoadducts
from the same unmodified 15-mer (HRI-42), and 2) ligation of the
different 15-mer monoadducts to the same 56-mer "extender
oligonucleotide" (HRI 102) using a 25-mer oligonucleotide (HRI-45)
as a splint. The arrows in FIG. 27 indicate the direction of
synthesis, while the monoadduct is indicated by a short line that
is perpendicular to the oligomer. While each of the 71-mer
monoadducts contains the adduct at a base position that is greater
than 56 bases from the 5' end, the precise position of the
monoadduct is not meant to be indicated.
[0663] To prepare the 15-mer adducts, the 15-mer was incubated with
a complementary 10-mer along with psoralen or isopsoralen under
hybridization conditions. The mixture was then irradiated to
provide the monoadducted 15-mer. While the invention is not
dependent on knowing the precise mechanism of coupling, it has
generally been believed that the 10-mer directs the isopsoralen to
a single TpA site within the double-stranded helix formed by the
10-mer/15-mer hybrid. After isolation of an HPLC peak believed to
contain the 15-mer with a single psoralen or isopsoralen
monoadduct, these 15-mer monoadducts were ligated to a 56-mer
extender in order to provide the monoadducted 71-mers for use as
polymerase templates. The ligation reaction therefore utilized
three oligonucleotides: the particular psoralen or isopsoralen
monoadducted 15-mer, the 56-mer extender, and the 25-mer splint.
The ligation complex was hybridized together then ligated. The
ligated product was then isolated as a single band by denaturing
PAGE.
[0664] To provide highly purified 71-mers which contain a single
monoadduct, it was necessary to provide highly purified 15-mer
monoadduct prior to the ligation step. This was accomplished by
repurification of the HPLC purified monoadducted 15-mers by PAGE.
In this way, essentially all the non-monoadducted 15-mer was
removed prior to ligation. Separation of 15-mer monoadduct from
unmodified 15-mer was readily accomplished by PAGE (while the same
technique is not effective for separation of the corresponding
unmodified 71-mer and monoadducted 71-mer sequences). In this
manner, exceedingly pure monoadducted 71-mers were produced for the
primer extension reactions; monoadducted 71-mers (as well as
unmodified 71-mers) are used in template-dependent enzymatic
extension experiments in examples 43-47 below.
EXAMPLE 43
Template-dependent Enzymatic Synthesis
[0665] In this experiment, monoadducted 71-mers (as well as
unmodified 71-mers) were used in template-dependent enzymatic
extension. AMIP, AMDMIP, and MIP 71-mer monoadducts were made as in
Example 42. FIG. 28 shows the manner in which extension is
achieved. Note that the 3' end of the 71-mer (HRI 55) is
complementary to the primer (SK-39) (see also FIG. 26). Each of the
extension experiments were run at 37.degree. C. for 0, 5 or 15
minutes. Each of the reactions were initiated by providing the
templates and deoxyribonucleoside 5'-triphosphates (dATP, dGTP,
dCTP, and dTTP are collective abbreviated as dNTPs), and by adding
the particular polymerase last to start the reaction. For
detection, the primer extension reaction utilized 5'
.sup.32P-labelled primer. The reactions were stopped by adding
EDTA. Analysis was by denaturing PAGE followed by
autoradiography.
[0666] Reaction conditions for each of the different polymerases
were as follows:
[0667] 1) E. Coli DNA Polymerase:
[0668] 50 mM Tris Buffer (pH 7.5); 10 mM MgCl.sub.2; 1 mM DTT); 50
.mu.g/ml bovine serum albumin (BSA); 100 .mu.M dNTPs; 3 units of
polymerase (for 25 .mu.l volume) ; 1.times.10.sup.-8 M primer;
1.times.10.sup.-9 M 71-mer;
[0669] 2) Klenow Polmerase:
[0670] (same as E.Coli except add 3 units of Klenow instead of E.
Coli polymerase);
[0671] 3) T4 Polymerase:
[0672] 50 mM Tris Buffer (pH 8.0); 5 mM MgCl.sub.2; 5 mM DTT; 50 mM
KCl; 50 .mu.g/ml BSA; 5 units T4 polymerase;
[0673] 4) Reverse Transcriptase:
[0674] 50 mM Tris Buffer (pH 8.0); 5 mM MgCl.sub.2; 5 mM DTT; 50 mM
KCl; 50 .mu.g/ml BSA; 100 .mu.M dNTPs; 20 units of Reverse
Transcriptase.
[0675] The results with MIP, AMIP, and AMDMIP are shown in FIGS.
29, 30 and 31 respectively. Both MIP and AMIP adducts appear to be
complete stops for T4 polymerase and reverse transcriptase, but not
complete stops for E. coli DNA polymerase and Klenow. AMDMIP
adducts appears to be a complete stop for all of the polymerases
tested.
EXAMPLE 44
Template-Dependent Enzymatic Synthesis
[0676] In this experiment, monoadducted 71-mers (as well as
unmodified 71-mers) were used in template-dependent enzymatic
extension. AMIP, AMDMIP, and MIP 71-mer monoadducts were made as in
Example 42. Extension was carried out as in Example 43 except that
in this experiment, Taq I DNA polymerase, a thermostable DNA
polymerase isolated from Thermus aquaticus (Stratagene, Inc., La
Jolla, Calif.) was assessed for its ability to read past
isopsoralens.
[0677] The reaction mixture was in 80 .mu.l total volume and
comprised 1.times.Tag buffer, 200 .mu.M each of dNTP's, 0.05 units
of Taq per .mu.l of reaction volume; 1.times.10.sup.-9 M in 71-mer
MA; 1.times.10.sup.-8 M in .sup.32P-labelled SK-39. Each reaction
was set up with everything except Taq polymerase. The samples were
initially heated to 95.degree. C. for 5 mins, then incubated at
55.degree. C. for 3 mins. The extension reaction was initiated by
addition of Taq polymerase. At the indicated time points (0.5, 1.0,
5.0 mins), 20 .mu.l of the reaction mix was removed to a tube
containing 1 .mu.l of 0.5 M EDTA to stop the reaction. All products
were analyzed on a 20% polyacrylamide, 7 M urea gel followed by
autoradiography.
[0678] The results are shown in FIG. 32. The lanes with the control
template (HRI 55) show the position of the full length 71-mer
extension product. Each time point was measured in duplicate. The
extension reaction appears to be complete at the earliest time
point (30 sec). The lanes with the targets containing the
isopsoralens (MIP, AMIP, and AMDMIP) indicate stops at positions
that are shorter than the full length 71-mer product.
[0679] Unexpectedly, each adduct results in a stop at a different
position within the sequence of the 71-mer. The MIP stop appears to
be at about the position of the TpA sequence in the 10-mer that was
used to create the monoadduct. AMIP has multiple stops, at
differing positions relative to the MIP stop. AMDMIP has a
different stop altogether. The longest extension product with AMIP
and the AMDMIP stop indicate that the isopsoralens are probably
located on the initial 15-mer outside the region of the
10-mer/15-mer interaction. This shows that the isopsoralens don't
necessarily follow the rules reported for psoralen derivatives
(i.e. that an intercalation site is required, and further that a
TpA site is preferred.)
EXAMPLE 45
Template-dependent Enzymatic Synthesis
[0680] This experiment investigated whether blocking of Tag
polymerase by monoadducts is complete or whether monoadducts can be
bypassed by the enzyme. In order to view the process of bypass
synthesis, it is necessary to cycle the extension reaction of the
primer with the 71-mer templates. Cycling in this case consists of
mixing the primer with the 71-mer template, adding Taq polymerase
and appropriate reagents, extending, heating to induce strand
separation, reannealing of the primer to the 71-mer template,
extending again, and subsequent stand separation. This process can
be repeated as necessary. During this process, only the complement
of the 71-mer template is being synthesized. It is accumulating in
a linear fashion with the number of thermal cycles (in contrast to
PCR where both strands are being synthesized and accumulate
geometrically).
[0681] The templates and reaction conditions were as in Example 44
above except that three samples were used for each monoadduct and
each sample was tested under different conditions:
[0682] Samples (1): one sample for each monoadduct was used to
carry out extension at 55.degree. C. as in Example 43;
[0683] Samples (2): one sample for each monoadduct was used to
carry out extension by the following series of steps: denaturing at
95.degree. C.; incubating for 30 seconds at 55.degree. C.; adding
Taq polymerase for 3 minutes at 55.degree. C.; cooling the reaction
for 1 minute at 7.degree. C.; stopping the reaction with EDTA for
one minute at 95.degree. C.:
[0684] Samples (3): one sample for each monoadduct was used to
carry out extension by repeating the following series of steps nine
times: denaturing at 95.degree. C.; incubating for 30 seconds at
55.degree. C.; adding Taq polymerase for 3 minutes at 55.degree.
C.; cooling the reaction for 1 minute at 7.degree. C. At the end,
the reaction is stopped with EDTA for one minute at 95.degree.
C.
[0685] The results are shown in FIG. 33. At either 55.degree. C. or
one cycle of extension, there appears to be no read through (i.e.
Taq polymerase is completely blocked). After nine cycles there is
evidence of full length extension product. It is not clear,
however, if these results indicted actual read through or just
extension of non-monoadducted 71-mer contaminant.
EXAMPLE 46
Template-dependent Enzymatic Synthesis
[0686] It was investigated whether blocking of Tag polymerase is
complete or whether blocking can be overcome. While the results
described in Example 45 suggested bypass occurred (since full
length extension products were produced after 10 cycles using
isopsoralen monoadducted 71-mer template), it was not clear if the
result were due to actual bypass of the monoadduct or to extension
of non-monoadducted 71-mer that was present as a contaminant.
Non-monoadducted 71-mer could have been present due to incomplete
separation of 15-mer monoadduct from unmodified 15-mer prior to
ligation during the preparation of the 71-mer (see Example 42).
[0687] To investigate this question further, a new 5-MIP
monoadducted 71-mer was prepared by repurification of the HPLC
purified 5-MIP monoadducted 15-mer by PAGE. In this way, more of
the non-monoadducted 15-mer was removed prior to ligation. The
purified 71-mer was then used as template in an extension
experiment as described in Example 45. After 10 cycles, there was
still evidence of extension product (FIG. 34). Excision of the band
and counting found this full length extension product constituted
2.3% of the total extension products (i.e., 97.7% of the extension
products were truncated).
EXAMPLE 47
[0688] Template-dependent Enzymatic Synthesis
[0689] From Examples 43, 44 and 45, it is clear that some
isopsoralens may be used for polymerase blocking. It is important
to note that isopsoralens form monoadducts with double stranded
nucleic acid but do not form crosslinks because of their angular
structure. Because of this, these isopsoralen-modified single
strands remain detectable by hybridization procedures. On the other
hand, it may be useful under some circumstances to block
replication with psoralens. This experiment examines the ability of
HMT to block Tag polymerase on an HIV template.
[0690] Monoadducted 71-mer was constructed as described, but for
HMT. Extension was carried out and analyzed as before on PAGE. The
results for Taq polymerase are shown in FIG. 35. Clearly, HMT
monoadducts stop Tag polymerase. Full length 71-mer is not made and
a shorter strand corresponding to the position of the HMT adduct
was made.
EXAMPLE 48
Template-dependent Enzymatic Synthesis
[0691] In this experiment, the ability of AMIP, AMDMIP and MIF to
block replication of 71-mer is investigated by randomly adding each
compound to the 71-mer. Of course, addition may only be random in
the sense that one or more adducts may be formed with any one
strand of nucleic acid. The actual placement of the isopsoralen may
be governed by preferential binding at particular sites (e.g. A:T).
In addition to blockage by random adducts, photoproducts of the
various isopsoralens may be providing an inhibitory effect. No
attempt to separate the effects of photoproduct from the effects of
covalent adducts on the 71-mer template was made in this series of
experiments.
[0692] In these experiments, the 71-mer template (10.sup.-9 M) was
primed with .sup.32P-SK-39 (10.sup.-8) and extended with Taq
polymerase in a total volume of 20 .mu.l. The dNTP concentration
was 200 .mu.M. In the control samples, the 71-mer, the primer, and
the dNTPs were mixed in Taq buffer in a volume of 18 .mu.l. These
samples were initially denatured at 95.degree. C. for 5 minutes,
followed by equilibration at 55.degree. C. for 3 minutes. Taq
enzyme was then added (0.5 units) and the extension reaction was
carried out for 5 minutes at 55.degree. C. The reaction was stopped
by making the solution 10 mM in EDTA. In another set of samples,
the 71-mer in 10 .mu.l was mixed with either AMIP (200 .mu.g/ml),
AMDMIP (200 .mu.g/ml), or MIP (60 .mu.g/ml). Half of these samples
were irradiated for 15 minutes on the CE-I device at 25.degree. C.
The other half was kept in the dark as controls. These samples were
then mixed with the primer and dNTPs as before, and were subjected
to the same thermal profile and extension reactions as the samples
that were described earlier. The results were examined by PAGE. The
extended product bands were identified by autoradiography, excised
and counted (data not shown).
[0693] The unirradiated controls that contained the isopsoralens
resulted in full length extension products; no truncated products
were observed. Quantitation of these extension products showed they
were equivalent to the amount of extension products seen in the
samples that did not contain isopsoralens, which corresponded to
about 8% of the primer being extended.
[0694] The irradiated samples that contained either AMIP or AMDMIP
were not extended at all. The irradiated sample that contained MIP
resulted in some full length extension product and a minor
truncated product. The amount of full length product with
irradiated MIP was half of that observed with the control
samples.
EXAMPLE 49
Template-dependent Enzymatic Synthesis
[0695] In this experiment, the ability of two different Phenylazide
derivatives (see Table 1), photobiotin (Vector Labs) and monoazide
ethidium chloride, to block replication of 71-mer was investigated
by randomly adding each compound to the 71-mer. Again, addition may
only be random in the sense that one or more adducts may be formed
with any one strand of nucleic acid. The actual placement of these
compounds may be governed by preferential binding at particular
sites (e.g. A:T). In addition to blockage by random adducts, there
may be inhibition by photoproducts. As in Example 48, no attempt
was made to separate the impact of photoproducts from that of
covalent binding of photoreactive compound on the 71-mer.
[0696] The two compounds, photobiotin and monoazide ethidium
chloride, have different spectral characteristics. To activate
these compounds, two different wavelength regions were selected
using a single light source (General Electric Sunlamp, Model RSM,
275 watt). The light source was positioned 10 cm above uncapped
Eppendorph tubes which contained samples to be irradiated. The
samples were kept on ice during irradiation. A pyrex dish was
placed between the lamp and the samples.
[0697] For samples containing photobiotin, 2.5 cm of water was
added to the pyrex dish to help remove some of the infrared
radiation. The samples were irradiated for 15 minutes.
[0698] For samples containing monoazide ethidium chloride,
wavelengths less than 400 nm were filtered out by using 2.5 cm of
an aqueous solution of 2.9 M NaNO.sub.2. Removal of short
wavelengths (i.e. wavelengths shorter than 400 nm) is necessary for
the use of monoazide ethidium chloride. Irradiation of this
compound with shorter wavelengths results in conversion to
non-active forms (data not shown). Wavelengths below 400 nm are
therefore undesirable for use with this compound.
[0699] In this experiment, the 71-mer template (2.times.10.sup.-9
M) in 10 .mu.l was mixed with either no photoreactive compound,
photobiotin (6.times.10.sup.-6 M), or monoazide ethidium
(1.4.times.10.sup.-3 M). Half of each of these samples were
irradiated on ice for 15 minutes with wavelengths appropriate for
each specific photoreactive compound. The other half of the samples
were kept in the dark as controls. The samples containing no
photoreactive compound were exposed with the water filter in place.
.sup.32P-SK-39 primer (1.times.10.sup.-8 M), dNTPs (200 .mu.M), and
additional buffer were added to yield a volume of 18 .mu.l. The
samples were then denatured at 95.degree. C. for 5 minutes, and
then equilibrated at 55.degree. C. for 3 minutes. Taq polymerase
was then added and extension was allowed to proceed for 5 minutes
at 55.degree. C. The reactions were stopped by bringing the samples
10 mM in EDTA. The products were examined by PAGE (data not shown).
The controls containing no photoreactive compound, no photoreactive
compound plus light, and photobiotin (Dark control) all showed
similar amounts of full length extension product. No truncated
products were observed with these samples. The dark control with
monoazide ethidium chloride resulted in inhibition of extension.
Photobiotin, by contrast, showed inhibition only after
irradiation.
EXAMPLE 50
Template-Dependent Enzymatic Synthesis
[0700] This example demonstrates that AMDMIP photoproduct inhibits
primer extension. This example also demonstrates that the
inhibitory effect of photoproduct is not sufficient to account for
all the inhibition seen when a 71-mer target is irradiated in the
presence of AMDMIP and subsequently extended.
[0701] 71-mer was made up in Taq buffer. Samples were prepared as
follows: 1) dark control samples were not subjected to activating
light; 2) 10 .mu.l samples of the 71-mer (2.times.10.sup.-9 M) were
irradiated in the presence of 200 .mu.g/ml AMDMIP, and 3) 10 .mu.l
samples of a 200 .mu.g/ml solution of AMDMIP were irradiated in the
absence of the 71-mer target. All irradiations were carried out
with the CE-I device at 25.degree. C. After preparing the above
samples, unirradiated AMDMIP was added to one set of the dark
control samples. Another set of dark controls received irradiated
AMDMIP. .sup.32P-SK-39 primer and dNTPs were then added to all
samples and the volume was adjusted to 18 .mu.l. These samples were
denatured at 95.degree. C. for 5 minutes, followed by equilibration
at 55.degree. C. for 3 minutes. Taq polymerase was then added and
the extension reaction was carried out for 5 minutes. The reaction
was stopped by bringing the samples to 10 mM in EDTA. The final
concentrations of all reagents during the extension reactions
were:
35 Buffer 1 .times. Taq Taq Polymerase 0.5 units dNTPs 200 .mu.m
.sup.32P-SK-39 Primer 1 .times. 10.sup.-8 M 71-mer target 1 .times.
10.sup.-9 M AMDMIP 100 .mu.g/ml
[0702] The results were analyzed byg PA-E (data not shown). A
visual inspection of the autoradiograph showed that the dark
controls yielded full length extension product. 71-mer that was
irradiated in the presence of AMDMIP resulted in no extension
products at all. The sample that contained AMDMIP photoproduct and
unirradiated 71-mer resulted in full length entension product, but
at about 10% of the level seen in the dark control samples. The
observation that some extension product was made in the presence of
photoproduct but not with directly irradiated 71-mer indicats that
the effects of photoproduct and covalent addition of AMDMIP to a
template oligonucleotide may be synergistic.
EXAMPLE 51
Post-Amplification Sterilization
[0703] FIG. 36 describes a series of oligonucleotides that can be
used with the PCR amplification technique. Two primers are
described (SK-38 and SK-39) that are complementary to a segment of
the HIV genome. Each primer is complementary to sequences at the 5'
ends of one of each of two strands of a 115 base pair long segment
of the HIV genome. In addition, FIG. 36 describes a crosslinkable
probe molecule which is capable of hybridizing and crosslinking to
one strand of the 115-mer PCR product. Repeated thermal cycling of
SK-38 and SK-39 in the presence of Taq polymerase, appropriate
reagents, and a target polynucleotide containing at least the
115-mer segment bounded by SK-38/SK-39, will result in the
synthesis of both strands of the 115-mer. Therefore, PCR
amplification will occur, with both strands of the 115-mer
accumulating geometrically. This is in contrast to the
oligonuceleotides described in FIG. 26. Only one primer (SK-39) is
described in FIG. 26 which is capable hybridizing to the 3' end of
the 71-mer target oligonucleotide (HRI-55). The lack of a second
primer in the system of oligonucleotides described by FIG. 26
prevents this system from being amplified geometrically. Repeated
thermal cycling of HRI-55 and SK-39 in the presence of Taq
polymerase and appropriate reagents will result in the linear
accumulation of the complement of HRI-55.
[0704] The system described in FIG. 36 for the HIV DNA system was
used for PCR sterilization. In FIG. 36, the arrows indicate the
polymerase extension direction for the primers. The HMT monoadduct
on SK-19-MA is shown by (). A block denotes a natural, conserved
5-TpA-3' crosslinking site in the DNA sequence of HIV.
[0705] PCR amplification requires numerous cycles of denaturation
and replication. Because denaturation is most conveniently
accomplished by heat, the polymerase is ideally thermostable. See
K. B. Mullis et al., U.S. Pat. Nos. 4,683,195 and 4,683,202
(incorporated by reference.) Taq I DNA polymerase, a thermostable
DNA polymerase isolated from Thermus aquaticus (Cetus Corp.,
Emmeryville, Calif.) was used for all amplifications.
[0706] Unless otherwise noted, the PCR amplification procedure
follows the broad temporal steps of FIG. 4: 1) template
preparation, 2) amplification cycling, and 3) detection.
[0707] AMDMIP photoproduct was made by irradiating AMDMIP (using
the CE-III device) in 1.times.Taq buffer (50 mM KCL, 2.5 mM
M.sub.gCl.sub.2, 10 mM Tris, pH 8.5, 200 .mu.g/ml gelatin) in a
separate vessel for 15 minutes at room temperature (RT). Aliquots
of AMDMIP photoproduct and the unirradiated compound were added (by
pipetting) at 50, 100, 200 and 300 .mu.g/ml to 1 .mu.l aliquots of
a 10.sup.6 dilution of PCR product copies. PCR product was provided
by a) preparing template, b) providing template, c) providing PCR
reagents, d) providing polymerase, e) mixing PCR reagents,
template, and polymerase to initiate PCR, f) cycling to synthesize
PCR product.
[0708] Step a): Template Preparation. The templates were derived
from actual patient samples. Ficoll-Hypaque separated peripheral
blood mononuclear cells (PBMCs) are prepared from individuals
enrolled in a longitudinal AIDS study. Approximately
1.times.10.sup.6 cells are added to 10 ml of RPMI containing 10%
fetal calf serum. The cells are pelleted by centrifugation at
200.times.g for 5 minutes and washed twice with 10 ml PBS. The cell
pellet is resuspended in a solution of 50 mM KCl, 10 mM Tris-HCl
(pH 8.3), 2.5 mM MgCl.sub.2 and subsequently lysed by the addition
of 0.5% Tween 20 and 0.5% NP40. Samples are digested with 60
.mu.g/ml proteinase K (Sigma) for 1 hour at 60.degree. C.
Inactivation of the proteinase K is achieved by heating the sample
at 95.degree. C. for 10 minutes.
[0709] Step b): Providing Template. For the reaction, 10 .mu.l of
template (equivalent to approximately 3.times.10.sup.4 cells) is
placed in a reaction vessel (0.5 ml Eppendorph tube) for later
amplification.
[0710] Steps c). d) e) and f). PCR reagents were provided, mixed to
a final volume of 20 .mu.l and cycled as described above.
[0711] To evaluate the efficacy of photoproduct as a sterilization
reagent, a subsequent polymerase chain reaction was carried out for
30 cycles in the presence of .alpha.-.sup.32P-dCTP. PCR reaction
products were then visually examined by running them on a 12%
acrylamide/8 M urea gel followed by autoradiography. The results
are shown in FIG. 37. The irradiated compound (i.e. photoproduct)
shows complete sterilization (i.e. no PCR product is evident) at
concentrations above 50 .mu.g/ml (Lanes 4,6 and 8); photoproduct
shows partial sterilization (i.e. some PCR product is evident) at
50 .mu.g/ml (Lane 2). The unirradiated compound (i.e. the control)
shows no sterilization (Lanes 1,3,5 and 7).
[0712] With the concentration spectrum for photoproduct
sterilization of PCR broadly defined, an additional experiment was
performed to more specifically pinpoint the cutoff for photoproduct
sterilization of PCR. Again, AMDMIP photoproduct was made by
separately irradiating AMDMIP (with the CE-III device) in
1.times.Taq buffer for 15 minutes at RT. This time, however,
aliquots of AMDMIP photoproduct were added to PCR product to give a
concentration range of between 0.25 and 50 .mu.g/ml.
[0713] Again, to evaluate the efficacy of this method of
sterilization, a subsequent polymerase chain reaction was carried
out for 30 cycles in the presence of .alpha.-.sup.32P-dCTP. PCR
product was then quantitated by running gels (see above), cutting
the bands (detected by autoradiography) and counting the bands on a
commercial scintillation counter. The results are plotted on FIG.
38.
[0714] FIG. 38 shows that as little as 5 .mu.g/ml of photoproduct
can result in as much as a 50% reduction in the amount of PCR
product (as measured by DPM). On the other hand, very little
reduction in PCR product is seen at 0.25 .mu.g/ml; with
concentrations of photoproduct below 0.25 .mu.g/ml, photoproduct
sterilization of PCR is insignificant.
EXAMPLE 52
Post-Amplification Sterilization
[0715] It may be desired that photoproduct sterilization of PCR be
avoided. Other methods of sterilization--methods that are preferred
over photoproduct sterilization--may be employed without
interference of photoproduct sterilization by either 1) working
with photoreactive compound concentrations that are below that
where photoproduct sterilization can occur, or 2) by selecting
conditions where less photoproduct is generated.
[0716] In this experiment, conditions were selected where less
photoproduct was generated. These conditions involve irradiation of
AMDMIP with the PTI light source. More intact AMDMIP remains after
irradiation with the PTI light source (in contrast with irradiation
of AMDMIP with the CE-III device; see FIG. 23).
[0717] AMDMIP in 1.times.Taq buffer was irradiated in the PTI
source for 15 minutes at RT. As a control, AMDMIP in 1.times.Taq
buffer was irradiated with the CE-III device for 15 minutes at RT.
In both cases, photoproduct was added to 1 .mu.l aliquots of a
10.sup.6 dilution of a PCR product mixture to give a final
concentration of 100 .mu.l/ml photoproduct. As a control,
unirradiated AMDMIP was added to similar PCR product mixtures at
the same concentration as the photoproduct. PCR product was
provided as described earlier.
[0718] To evaluate the efficacy of this sterilization method, a new
PCR reaction was carried out for 30 cycles in the presence of
.alpha.-.sup.32P-dCTP. PCR product was examined on gels as in
Example 51 (FIG. 37) and the gels were subjected to
autoradiography. The results are shown in FIG. 39.
[0719] In both cases where unirradiated AMDMIP was used (FIG. 39,
Lanes 1 and 3) PCR product is clearly evident. Where AMDMIP
irradiated in the CE-III device is used, extensive sterilization is
observed. By contrast, where AMDMIP irradiated in the PTI device is
used, little sterilization is observed. AMDMIP irradiated with the
PTI light source shows the same results as unirradiated AMDMIP
(control), suggesting that photoproduct is at a concentration below
which its effects are seen by the PCR assay.
[0720] The dramatic difference in results between the two light
sources may be due to the fact that the CE-III source has a shorter
wavelength (300 nm cutoff) relative to the PTI source (320 nm
cutoff). The absorption spectrum of AMDMIP suggests it would be
more reactive with the broader light window provided by the CE-III
source.
EXAMPLE 53
Post-Amplification Sterilization
[0721] To systematically evaluate the effect of the presence of
increasing concentrations of isopsoralen on PCR, AMDMIP (0, 100,
200, 400 .mu.g/ml) was added to 10.sup.7 copies of HIV 115-mer as
template. PCR was then carried out for 30 cycles in the presence of
.alpha.-.sup.32P-dCTP. The PCR product was run on denaturing
polyacrylamide gel and autoradiographed. The bands were thereafter
cut and counted. The results were as follows:
36 [AMDMIP] Counts (CPM) 0 42200 100 77200 200 77500 400 69400
[0722] The results show that unirradiated isopsoralen does not
cause PCR sterilization. Indeed, with this particular isopsoralen,
AMDMIP, there is enhancement of PCR product. Importantly, even high
concentrations (400 .mu.g/ml) of AMDMIP show no appreciable impact
on amplification.
EXAMPLE 54
Post-Amplification Sterilization
[0723] In this embodiment, the method of sterilization comprises:
1) providing PCR reagents, 2) providing template, 3) providing
polymerase, 4) mixing PCR reagents, template, and polymerase to
initiate PCR, 5) cycling to provide PCR product, 6) providing
isopsoralen, 7) adding isopsoralen to PCR product, and 8)
irradiating PCR product.
[0724] Note that, while the isopsoralen could be introduced to the
mixture at any time prior to irradiation (e.g. at the time the
template is added in order to avoid opening the reaction vessel
again prior to irradiating), in this embodiment, the isopsoralen is
added after amplification.
[0725] To demonstrate the effectiveness of the method of the
present invention, the sterilized carryover must be shown to be
unamplifiable. For the purposes of this determination, the steps of
the following experiment include (see FIG. 40): a) preparing
template, b) providing template, c) providing PCR reagents, d)
providing polymerase, e) mixing PCR reagents, template, and
polymerase to initiate PCR, f) cycling to provide PCR product, g)
carrying over of PCR product into new tubes, h) providing
isopsoralen, i) adding isopsoralen to the carryover, j)
irradiating, k) addition of new PCR reagents, and l) subsequent
PCR.
[0726] Steps a), b), c), d), e), and f). PCR product was provided
as described earlier.
[0727] Step g) Carrying over of PCR product. Aliquots of PCR
product were added into new reaction tubes at 10.sup.6 copies per
tube.
[0728] Step h) Providing Isopsoralen. AMDMIP was synthesized as
described and diluted.
[0729] Step i) Addition of Isopsoralen. AMDMIP (100 .mu.g/ml,
approximately 10.sup.-4 M) was added reaction vessels containing
carryover.
[0730] Step j) Irradiation. Irradiation was performed on the PTI
device to avoid photoproduct. Three of the new reaction tubes were
irradiated while the others were left unirradiated as controls.
Irradiation was for 15 minutes at RT as above.
[0731] Step k) PCR Reagents and Tag Polymerase Were Added to
Appropriate Concentrations. The final volume was increased two fold
such that AMDMIP photoproducts were at 50 .mu.g/ml.
[0732] Step l) Subsequent PCR. Amplification was performed, in
closed reaction vessels using primer pair SK-38/39 for 20, 25 or 30
cycles, using the temperature profile for cycling described above
in the presence of .alpha.-.sup.32P-dCTP.
[0733] The results were evaluated by gel electrophoresis and
autoradiography (FIG. 41). To the right of the gel lanes, the bands
corresponding to starting material and product are indicated. As
expected, the control reactions that have no carry-over (Lanes 1,
5, and 9) show no amplified product. On the other hand, the control
reactions that contain carryover produced in the first
amplification without AMDMIP (Lanes 2, 6, and 10) show
amplification. The control reactions that contain carryover
produced in the first amplification with AMDMIP, but that were not
light-treated (Lanes 3, 7, and 11), also show amplification.
Importantly, the reactions that received carryover, AMDMIP and
irradiation (Lanes 4, 8 and 12) show isopsoralen sterilization of
PCR to a degree that is cycle defendant. With twenty cycles,
sterilization appears to be complete (i.e. the twenty-cycle
amplification does not provide detectable product). With
twenty-five cycles, PCR product is visible (Lane 8), albeit it is
reduced relative to controls (Lanes 6 and 7). Finally, with thirty
cycles, no significant sterilization is observed; PCR product (Lane
12) is approximately the same relative to controls (Lanes 10 and
11).
[0734] On the basis of visual examination of the bands, AMDMIP,
when photoactivated in the presence of carryover, appears to be
very effective at 20 cycles. However, at thirty cycles,
sterilization appears to be overwhelmed. This illustrates the
interplay of amplification factor and sterilization
sensitivity.
[0735] FIG. 41 can be interpreted in terms of Table 6. At 20 cycles
of PCR, sterilization appeared to be completely effective (lane 4
compared to lane 3). If 100 CPM is taken to be the threshold for
seeing a band on the autoradiograph, then Table 6 shows that the
sterilization protocol of this example with AMDMIP left less than
10.sup.4 target molecules that were capable of being replicated by
the PCR procedure. At 25 cycles of PCR, a very measurable band was
observed (lane 8), suggesting that at least 103 target molecules
retained replicating capabilities. At 30 cycles of PCR it is
difficult to distinguish the control signal from the signal
obtained with the sterilized sample (lane 11 compared with lane
12). This is consistent with both the control sample and the AMDMIP
treated sample reaching the plateau region of the PCR amplification
process.
EXAMPLE 55
Post-Amplification Sterilization
[0736] To demonstrate the effectiveness of the method of the
present invention, the sterilized carryover is again shown to be
unamplifiable. In this example, however, isopsoralen is introduced
prior to amplification.
[0737] For the purposes of this determination, the steps of the
following experiment include (see FIG. 42): a) preparing template,
b) providing template, c) providing isopsoralen, d) providing PCR
reagents, e) providing polymerase, f) mixing isopsoralen, PCR
reagents, template, and polymerase to initiate PCR, g) cycling to
provide PCR product, h) irradiating, i) carrying over of PCR
product into new tubes at specific copy numbers, and j) amplifying
in a subsequent PCR.
[0738] Step a): Template Preparation. HIV 115-mer was used as
template.
[0739] Step b) Providing Template. For the reaction, template
(equivalent to approximately 10.sup.7 copies) in buffer was
provided for the reaction vessel.
[0740] Step c) Providing Isopsoralen. AMDMIP (400 .mu.g/ml) was
provided as the isopsoralen. This is a higher concentration of
AMDMIP than used in the previous example.
[0741] Steps d), e), f) and g). PCR reagents and polymerase were
provided, mixed and cycled as described above. This time, however,
isopsoralen is part of the pre-amplification mixture.
[0742] Step h) Irradiation. Irradiation was performed on the CE-III
device for 15 minutes at 25.degree. C.
[0743] Step i) Carrying over of PCR product. Aliquots of PCR
product were added into six new reaction tubes--two tubes for each
dilution. Dilutions to yield 10.sup.7, 10.sup.5 and 10.sup.3 copies
were made. (Note that the dilutions were made from a concentration
of approximately 10.sup.101 copies/.mu.l; thus, the dilutions
produce a concentration of photoproduct that is far too low to
consider photoproduct sterilization.)
[0744] Step j) is Subsequent PCR. New PCR reagents and polymerase
were provided and mixed. Amplification was performed in closed
reaction vessels using primer pair SK-38/39 for 30 cycles, using
the temperature profile for cycling described above in the presence
of .alpha.-.sup.32P-dCTP.
[0745] The results were evaluated by gel electrophoresis and
autoradiography (FIG. 43). The control reactions that contained
carryover produced in the first amplification with AMDMIP, but that
were not light-treated (Lanes 1, 3, and 5) show amplification.
Importantly, the reactions that received carryover from the first
PCR after irradiation in the presence of AMDMIP (Lanes 2, 4 and 6)
show complete, post-amplification sterilization.
EXAMPLE 56
[0746] Photobiotin and monoazide ethidium chloride were previously
tested for their ability to block template-dependent enzymatic
synthesis (see Example 49). The effect of photoproduct (if any) was
not investigated at that time.
[0747] In this experiment, photobiotin and monoazide ethidium
chloride were tested as PCR sterilization reagents. The temporal
steps were performed to examine photoproduct effects (if any).
Solutions of photobiotin and monoazide ethidium chloride were made
up in 1.times.Taq buffer. Concentrations of photobiotin ranged form
7.times.10.sup.-4 M to 7.times.10.sup.-10 M: concentrations of the
monoazide ethidium chloride ranged from 3.times.10.sup.-6 M to
3.times.10.sup.-10 M. The high-end of these concentration series
was based on earlier experiments that showed that higher
concentrations of these compounds shut down PCR by dark binding.
Each compound solution was divided into two parts: One part was
irradiated under a GE sunlamp through a pyrex filter (300 nm
cut-off); the other half was irradiated under a GE sunlamp through
a 2.9 M NaNO.sub.2 liquid filter (400 nm cut-off). Irradiations
were carried out on ice for 15 minutes. After irradiation, aliquots
of each tube were carried over into tubes containing PCR reagents
and target (HIV 115-mer); PCR was then carried out for 30 cycles in
the presence of .alpha.-.sup.32P-dCTP. After amplification aliquots
were analyzed on 12% acrylamide/8 M urea gels.
[0748] The results obtained show that monoazide ethidium chloride,
when tested in this mode, does not inhibit PCR; 115-mer amplified
at the high concentration points. By contrast, when used in this
mode, photobiotin shut down PCR at the highest concentration used
(7.times.10.sup.-4 M) (115-mer amplified at all lower
concentrations).
[0749] Given these results, it is believed that blocking of primer
extension seen earlier (Example 49) with the monoazide ethidium
chloride was probably due to photobinding and not photoproduct
binding. The results seen here with photobiotin, however, suggest
that the previous blocking was probably due to photobiotin
photoproduct.
EXAMPLE 57
Post-Amplification Sterilization
[0750] A PCR sample is prepared for amplification with the
following changes. Instead of AMDMIP, AMT is added prior to
amplification at a concentration of 100 .mu.g/ml. Instead of primer
pair SK-38/39, the biotinylated analogs, in which biotin has been
appended to the 5' end of one or both primers via an intervening
tetraethylenglycol bridge (ester linkage to the biotin), are used.
Following 30 cycles of PCR, the reaction vessel is exposed to
300-400 nm light on the CE-III device. Following irradiation, the
PCR reaction vessel is opened and the PCR product removed. Free
primer is then removed by spinning the PCR reaction mix through a
Centricon 100 (Amicon Division, W R Grace & Co., Danvers,
Mass.). The Centricon filters consist of a semipermeable membrane
which permits the passage of short oligonucleotides, but not long
oligonucleotides. PCR product is differentially retained in the
retentate. Several washes are required (these membranes are
conveniently mounted in a disposable plastic tube that is spun in a
centrifuge for 5 mins at 2000.times.g). After the final wash, the
retentate is immobilized on a nylon membrane or a nitrocellulose
membrane by filtration. The filter is then baked under vacuum for 2
hours at 80.degree. C. After immobilization, the PCR product is
detected with a commercially available biotin detection systems
(BluGene Detection System; catalog #8179 SA; BRL).
[0751] Alternatively, detection may be realized by the
incorporation of .alpha.-.sup.32P-deoxyribonucleoside triphosphates
during the PCR amplification step. The steps here are the same as
the first method except for the detection step. Instead of
immobilization following the irradiation step, a portion of the
sterilized sample is loaded on a 8 M urea (denaturing) 11%
polyacrylamide gel and electrophoresed for 2-3 hours at 50 watts
(25 mA/2000 V) until the marker dye bromphenol blue just runs off
the gel. The crosslinked double stranded PCR product is them
visualized by autoradiography (XAR-5 X-ray film; Kodak): a typical
exposure time is 12-16 hours.
[0752] To show that the AMT treated product is sterilized, aliquots
of AMT treated PCR reaction mix containing 10.sup.4 to 10.sup.10
copies of PCR product are carried over into new reaction vessels.
PCR reagents are added and the samples reamplified for 30 cycles,
and .alpha.-.sup.32P-dCTP is present during the amplification.
Following PCR, the reamplified samples are analyzed by denaturing
PAGE as described above. In all cases, the crosslinked (AMT
treated) PCR product does not reamplify.
[0753] In a third method, a solution of AMT (100 .mu.g/ml) is
prepared and irradiated for 15 minutes on the CE-III device. This
solution is then added to a PCR reaction tube which contains target
DNA for amplification along with all the reagents necessary for
PCR. The mix is then amplified for 30 cycles in the presence of
.alpha.-.sup.32P-dCTP, then analyzed by PAGE, as above. No
reamplification was observed, hence the AMT photoproduct is in
itself an effective inhibitor of PCR. The mechanism of photoproduct
inhibition is not understood at this time, but is clearly
concentration dependent.
EXAMPLE 58
Post-Amplification Sterilization
[0754] As discussed generally for sterilization, it is expected
that the sensitivity of sterilization will depend upon both the
modification density and the length of the PCR target sequences. In
this experiment, the effect of modification density and target
length on sterilization sensitivity were examined by sterilizing
two different length PCR products with either AMIP or AMDMIP. Each
isopsoralen was used at two different concentrations for the
sterilization procedure to produce differing modification densities
on PCR targets.
[0755] The two PCR targets used in these experiments were a 115-mer
(SK-38/SK-39 HIV system) and a 500-mer. The 500-mer target is
obtained from a PCR amplification of a lambda plasmid with primers
PCR 01/02. This system is provided by Cetus/Perkin Elmer as a
control in their commercial kits of PCR reagents (Catalogue No.
N801-0055). For both of these systems equivalent copy numbers of
each target were prepared in the following manner: An initial 30
cycle PCR reaction was carried out for each system with the
appropriate primers and targets. Aliquots (approximately
10.sup.5-10.sup.6 target copies) of each of these reactions were
transferred to a second set of PCR reactions. These second sets of
PCR amplifications were carried out in the presence of
.alpha.-.sup.32P-dCTP, again for 30 cycles. Aliquots of these
reactions were removed and counted by liquid scintillation
counting. With these numbers, the specific activity of the
.alpha.-.sup.32P-dCTP, and the sequence of each of the PCR product
oligonucleotides (115-mer and 500-mer), the concentrations of each
of the two PCR product oligonucleotides in the second set of PCR
reaction tubes was determined. Both the 115-mer and the 500-mer
concentrations were then adjusted to exactly 1.times.10.sup.-8 M by
the addition of additional Taq buffer. These stocks of equivalent
copy number of PCR products were then used for further
investigation. Each of the stock solutions then was subdivided into
four reaction tubes. The reaction tubes were adjusted to contain
the following: Tube 1, 100 .mu.g/ml AMIP; Tube 2, 400 .mu.g/ml
AMIP; Tube 3, 100 .mu.g/ml AMDMIP; and Tube 4, 400 .mu.g/ml AMDMIP.
Each of these samples were again split into two portions, one part
being irradiated for 15 minutes at room temperature with the CE-III
device and the other part kept in the dark. Serial dilutions of the
irradiated and the unirradiated targets were then carried out on
these samples for 30 cycles in the presence of
.alpha.-.sup.32P-CTP. Aliquots of these samples were analyzed on
denaturing polyacrylamide gels. The PCR product bands were
visualized by autoradiography, cut, and counted in a liquid
scintillation counter.
[0756] The sterilization effect of 100 .mu.g/ml AMIP on the 115-mer
PCR product is illustrated in FIG. 44(A). A 10.sup.8 fold dilution
of the irradiated PCR carryover product, corresponding to 600
carryover molecules, resulted in a diminished PCR signal compared
to its unirradiated control after 30 cycles of amplification. At
10.sup.6 fold or less dilutions of the PCR carryover products, both
the irradiated and the unirradiated samples yield similar signals.
Apparently at 100 .mu.g/ml, AMIP has an insufficient modification
density on the 115-mer to effectively sterilize more than about
10,000 molecules of carryover. When the concentration of AMIP was
increased to 400 .mu.g/ml, sterilization sensitivity was improved
with the 115-mer target. FIG. 44(B) shows that a carryover of
600,000 molecules of unirradiated PCR product results in a signal
which is consistent with the concentration of the PCR product being
in the plateau region of PCR amplification. The equivalent amount
of irradiated PCR carryover product does not produce a measurable
PCR signal at all. 100 fold more of the irradiated PCR carryover
product does start to overwhelm this sterilization protocol,
indicating that the sterilization sensitivity limit with 400
.mu.g/ml AMIP and the 115-mer PCR product is about 10.sup.6
carryover molecules.
[0757] The effect of PCR product length is illustrated by comparing
FIG. 44(C) to FIG. 44(A). At 100 .mu.g/ml of AMIP, the 500-mer PCR
product is clearly more effectively sterilized than the 115-mer PCR
product. At 400 .mu.g/ml AMIP, the irradiated 500-mer was not
amplified at all for any of the dilution series up to
6.times.10.sup.9 molecules of carryover (data not shown). Larger
amounts of carryover were not tested. The unirradiated 500-mer with
400 .mu.g/ml AMIP yielded signals comparable to those in FIG.
44(C).
[0758] FIG. 44(d) shows that AMDMIP at 100 .mu.g/ml is a better
sterilization agent with the 115-mer PCR product than is AMIP at a
similar concentration (compare with FIG. 44(A)). When AMDMIP was
used at 400 .mu.g/ml, the irradiated carryover series yielded no
signal at all up to 6.times.10.sup.9 molecules of carryover with
the 115-mer PCR product. The unirradiated controls yield normal
levels of PCR signals from the carryover molecules. When AMDMIP was
used with the 500-mer PCR product, both 100 .mu.g/ml and 400
.mu.g/ml concentrations resulted in no signal in the irradiated
dilution series. AMDMIP at 100 .mu.g/ml has a high enough
modification density on the 500-mer target that there appears to be
no non-sterilized 500-mers in 6.times.10.sup.9 carryover molecules
with the .alpha.-.sup.32P assay for PCR product.
EXAMPLE 59
[0759] It is believed that isopsoralens form monoadducts with
double stranded nucleic acid but do not form crosslinks because of
their angular structure. Because of this, these
isopsoralen-modified single strands should remain detectable by
hybridization procedures. The following experiments demonstrate the
particular usefulness of isopsoralens by virtue of their
compatibility with two different hybridization formats: 1)
Oligonucleotide Hybridization (OH) and 2) Crosslinkable
Oligonucleotide Probe Analysis (COP) (FIG. 45). The experiments
show that AMDMIP sterilized target molecules remain detectable by
both OH and COP procedures. The presence of AMDMIP on the target
115-mer appears not to inhibit probe hybridization and likewise,
does not reduce the crosslinkability of these sterilized target
molecules, when assayed and examined visually on gels.
[0760] Preparation of Samples: The HIV 115-mer system with primers
SK-38/SK-39 was used for the experiment (see FIG. 36, "HIV
Oligonucleotide System"). Two types of starting template were used:
previously amplified 115-mer or genomic DNA, isolated from an
individual known to be infected with HIV (MACS sample). For
previously amplified 115-mer between 10.sup.5 and 10.sup.6 copies
were used for starting template. For the genomic (MACS) sample,
approximately 1 .mu.g (3.times.10.sup.5 copies) of genomic DNA were
used. Two PCR samples were prepared for each type of template then
amplification was carried out for either 20 or 30 cycles. One of
the two PCR samples contained AMDMIP at 200 .mu.g/ml while the
other was AMDMIP free. Following amplification, the AMDMIP
containing samples were divided and half were irradiated. Analysis
(OH or COP) was then done on the three samples from each set
(AMDMIP free, AMDMIP unirradiated, and AMDMIP irradiated) for each
cycle number. The AMDMIP free samples served as control, the AMDMIP
unirradiated samples adressed the effect of non-covalently bound
AMDMIP on detection, and AMDMIP irradiated samples addressed the
effect of covalently bound AMDMIP on detection.
[0761] COP and OH assays were performed a follows. 10 .mu.l of the
PCR reaction mixture was added to 3.3 .mu.l of "probe mix"
[5'-labelled SK-19 (normal or monoadducted) at 10.sup.-8 M
containing EDTA and an appropriate salt mixture], overlaid with
30-40 .mu.l of light mineral oil, then heated to 95-100.degree. C.
for 5 minutes. For COP, the hybridization mixture as placed in the
PTI device at 56.degree. C. and irradiated for 15 minutes.
Following this, loading dyes (containing urea or formamide) were
added, the sample heated to 95-100.degree. C. for 5 minutes, quick
chilled on wet ice, then loaded on a denaturing PAGE gel followed
by electrophoresis under denaturing conditions. For OH reactions,
the hybridization mixture was incubated at 56.degree. C. for 30
minutes, loading dyes added, and aliquots loaded directly into a
native PAGE gel followed by electrophoresis under native
conditions.
[0762] 1. COP Results: The results with COP are shown in FIG. 46.
Samples 1-6 contain previously amplified 115-mer that was
re-amplified either 20 (samples 1,3,5) or 30 (Samples 2,4,6) cycles
then detected by COP. Samples 1 & 2 are controls (without
AMDMIP); samples 3 and 4 are (with AMDMIP and with light)
sterilized samples; samples 5 & 6 are (with AMDMIP but without
light) controls. The bands corresponding to amplified 115-mer
crosslinked to labelled 41-mer probe (SK-19 MA) are the upper bands
in FIG. 46. Samples 11-16 are the same series except the MACS
sample was used as template.
[0763] Inspection of FIG. 46 shows that only the samples amplified
30 times generated significant PCR product (band excision allowed
the 20 cycle samples to be quantitated; see below). The visual
intensity all of the hybrid bands in the 30 cycle series appear to
be quite similar. For the 30 cycle series, comparison of the (no
compound) control amplification (lanes 2/12) with the test
amplification [with AMDMIP and light (lanes 4/14)] with the (no
light) control amplification (lanes 6/16) shows little difference
in band intensity. Better quantitation was obtained by excising the
bands and counting which provided the following numbers:
37 Sample CPM (%) Sample CPM (%) 1 3104 (100) 11 878 (100) 3 1944
(62) 13 460 (52) 5 4480 (144) 15 464 (53) 2 43948 (100) 12 53304
(100) 4 36452 (83) 14 41777 (78) 6 39596 (90) 16 35176 (66)
[0764] The trends in both the 20 and 30 cycle series were similar.
Comparison of the (with AMDMIP and light) samples (3,4,13,14) with
the corresponding (without AMDMIP and without light) samples
(1,2,11,12) shows the hybridization signal is reduced between 52
and 83%. Comparison with the (with AMDMIP but without light)
controls also show a reduction in hybridization signal (except
sample 5). It is expected that these (no light) samples are samples
which contained AMDMIP but were not sterilize prior to the COP
analysis. However, light is added during the COP procedure, and
since AMDMIP is present, photoaddition occurs during COP.
[0765] 2. OH Results: The results with OH are shown in FIG. 47.
This experiment used the same amplified samples described above; it
was identical to the COP experiment except that detection was by
OH. Samples 1-6 again contain previously amplified 115-mer that was
re-amplified either 20 (samples 1,3,5) or 30 (samples 2,4,6) cycles
followed by OH analysis. Samples 1 & 2 are (without compound
and without light) controls; samples 3 & 4 are (with AMDMIP and
with light) samples; samples 5 & 6 are (with AMDMIP but without
light controls. The bands corresponding to amplified 115-mer
hyridized to labelled 41-mer probe SK-19) are the upper bands in
FIG. 47. Lanes 11-16 are the same series but the MACS sample was
used as the template. The sample in the middle is a negative
(reagent) control, while "M1" and "M2" are probe alone (as
marker).
[0766] Visual inspection of FIG. 47 shows that only the samples
amplified 30 times provided significant PCR product. In the 30
cycle series, the band intensities all appear to be similar.
Comparison of the control amplifications (lanes 2/12) with the test
(with AMDMIP and light; lanes 4/14) and the control (with AMDMIP
but without light; lanes 6/16) show similar intensity. It was not
possible to obtain reliable counts from the bands in this gel
(native gels do not tolerate the band excision process), so more
quantitative comparisons were not made. Relying on the visual
signal of the gels one can conclude that there may be no impact of
the photoreactive compound (whether covalently or non-covalently
bound to nucleic acid) on subsequent detection of the amplified
target. Assuming the quantitation of the OH (if it could be done)
shows the same trend as the COP data, there may be a difference of
up factor of 2 in hybridization signal caused by the presence of
the photoreactive compound.
EXAMPLE 60
Post-Amplification Sterilization
[0767] Four samples containing 1 .mu.g of Molt-4 human genomic DNA
target were prepared for PCR with primers KM 29
(5'-GGTTGGCCAATCTACTCCCAGG) and HRI-12 (5'-GGCAGTAACGGCAGACTACT).
These primers give a 174 bp product within the human beta globin
gene. All four samples contained AMDMIP at 100 .mu.g/ml, and were
irradiated for 0, 5, 10 or 15 minutes prior to PCR amplification. A
duplicate set of control samples were also prepared which did not
contain AMDMIP. Amplification were carried out in 1.times.Taq
buffer (50 mM KCl, 10 mM Tris pH 8.5, 2.5 mM MgCl.sub.2, 200
.mu.g/ml gelatin), 175 .mu.M each dNTP, 20 .mu.M primer with 2.5
units of Tag polymerase and 100 .mu.g/ml AMDMIP present during
amplification. PCR was carried out for 30 cycles; one cycle=30 sec
at 94.degree. C. (denaturing), 30 sec at 55.degree. C. (primer
annealing), and 60 sec at 72.degree. C. (extension).
.alpha.-.sup.32P-dCTP was used as an internal label. After
amplification, the samples were analyzed for product by PAGE
followed by autoradiaography. As shown in FIG. 48, irradiation in
the presence of AMDMIP at all time points (Lanes 5-8 are,
respectively, 0, 5, 10 and 15 minutes) resulted in no amplification
of the sterilized genomic target. Irradiation in the absence of
AMDMIP at all time points (Lanes 1-4 are, respectively, 0, 5, 10
and 15 minutes) resulted in amplification of the genomic
target.
[0768] Note that the concentration of AMDMIP was selected to be 100
.mu.g/ml. This concentration of unirradiated AMDMIP was determined
to have no significant impact on amplification (data not shown).
Even when the sterilizing compound is the same, it is desirable to
determine appropriate concentrations for each particular
amplification system (in this example, Globin) and not rely on
concentrations determined for other systems (e.g. HIV). In general,
results with the present invention indicate that, the longer the
length of the amplification product, the lower the concentration of
unactivated compound needed to inhibit amplification (data not
shown).
EXAMPLE 61
Post-Amplification Sterilization
[0769] This example investigated the concentrations at which
non-psoralen compounds inhibited PCR in the absence of light. The
compounds tested were the following: 1) ethidium bromide (a
Phenanthridine, see Table 1), 2) xylene cylanol (an Organic Dye,
see Table 1), 3) bromphenol blue (an Organic Dye, see Table 1), 4)
coumarin and 5) methylene blue (a Phenazathionium Salt, see Table
1).
[0770] The first dark control was run with compounds 1-3. The
results are shown in FIG. 49. All the compounds showed some
inhibition of PCR at the higher concentrations used.
[0771] A separate experiment examined PCR inhibition with coumarin
and methylene blue in the absence of light. The following
concentrations of methylene blue were tried: 4.3.times.10.sup.-2,
4.3.times.10.sup.-3, 4.3.times.10.sup.-4 and 4.3.times.10.sup.-5 M.
Concentrations of coumarin tried included: 7.times.10.sup.-3,
7.times.10.sup.-4, 7.times.10.sup.-5 and 7.times.10.sup.-6 M.
Compound was added to PCR tube containing .alpha.-.sup.32P-dCTP and
target (1 .mu.l 10.sup.65.times.dil.; PCR'd MACS 1555 per
assay-point). PCR was carried out for 30.times.cycles. Samples were
loaded onto a 12%/8 M urea gel. The results showed that methylene
blue inhibited PCR at concentrations above 4.3.times.10.sup.-5 M.
Coumarin did not inhibit PCR at any of the concentrations
tested.
EXAMPLE 62
[0772] As discussed in Example 60, it cannot be assumed that the
particular sterilizing compound concentration compatible with one
PCR system will be compatible with another. The impact of a given
concentration of sterilizing compound on PCR amplification
efficiency must be determined on a system by system basis. For
example, the HIV 115-mer system is compatible with concentrations
of AMDMIP up to 400 .mu.g/ml, and therefore this concentration of
AMDMIP may be used for sterilization. However, this concentration
of AMDMIP may not be compatible with other PCR systems. Indeed, the
amplification efficiency of some PCR systems may be compromised by
high concentrations of sterilizing compounds.
[0773] High concentrations of sterilizing compounds may function to
stabilize PCR product (particularly long PCR products or PCR
products which are exceptionally GC rich) such that less of the
double stranded product will denature each cycle. This reduced
availability of single stranded product for subsequent priming and
extension would reduce the product yield in each PCR cycle. This
reduced efficiency over many PCR cycles would result in drastic
reduction in the yield of PCR product.
[0774] One method to overcome stabilization of PCR product is to
modify the PCR conditions such that the melting temperature of the
PCR product is lowered. In so doing, more of the double stranded
PCR product is denatured each cycle thereby providing more single
stranded target for subsequent priming and extension. The net
result of the modified PCR conditions is a higher yield of PCR
product.
[0775] One modification of PCR conditions which provides more
denatured (single stranded) PCR product is to raise the pre-set
denaturation temperature above 95.degree. C. for each PCR cycle.
This modification has the disadvantage of concomitant inactivation
of Taq at temperatures above 95.degree. C. Another modification is
adding a co-solvent to the PCR buffer which allows denaturation of
the PCR product to occur at a lower temperature. One such
co-solvent is dimethyl sulfoxide (DMSO). Under some circumstances,
DMSO has been shown to facilitate PCR. PCR Technology, H. A. Erlich
(ed.) (Stockton Press 1989).
[0776] In this example, the effect of DMSO on PCR amplification in
the presence of high concentrations of sterilizing compound
(AMDMIP) was investigated. Samples were prepared for PCR which
contained 1 .mu.g of human placental DNA either with or without
(unirradiated) AMDMIP (200 .mu.g/ml). The samples were amplified 30
cycles under standard PCR conditions in the presence of 0%, 1%, 5%
or 10% DMSO. The reaction mix contained .alpha.-.sup.32P-dCTP.
Following amplification, the samples were analyzed by PAGE (data
not shown).
[0777] The results indicated that, while (unirradiated) AMDMIP
inhibits amplification at a concentration of 200 .mu.g/ml to the
point where there is virtually no detectable amplification product,
addition of DMSO as a PCR co-solvent allowed amplification to
proceed in the presence of AMDMIP. Excision and counting of the
product bands provided the following results for the
AMDMIP-containing samples (% DMSO/CPM): 0%/2500; 1%/2800;
5%/86,000; 10%/102,000).
[0778] Comparison of the control (no AMDMIP) PCR samples as a
function of % DMSO showed a regular decrease in amplification
yield. Excision and counting of the product bands (reported as the
average of the duplicate samples) confirmed the visual observation
that increasing concentrations of DMSO showed increased inhibition
of PCR (% DMSO/CPM; 0%/139,000; 1%/137,000; 5%/94,000;
10%/76,000).
* * * * *