U.S. patent application number 10/272358 was filed with the patent office on 2003-09-04 for targeted replacement of a gene without endogenous and selectable residual sequences.
Invention is credited to Rajewsky, Klaus, Zou, Yong-Rui.
Application Number | 20030167489 10/272358 |
Document ID | / |
Family ID | 6466351 |
Filed Date | 2003-09-04 |
United States Patent
Application |
20030167489 |
Kind Code |
A1 |
Rajewsky, Klaus ; et
al. |
September 4, 2003 |
Targeted replacement of a gene without endogenous and selectable
residual sequences
Abstract
Transgenic mice that produce high levels of humanized antibodies
are described. Targeted gene replacement exchanges constant regions
of the mouse immunoglobulin heavy and light chain genes with human
genes, either through conventional gene targeting, or by use of the
bacteriophage-derived Cre-loxP recombination system. The transgenic
animals undergo antibody affinity maturation, and a class switch
from the native immunoglobulin to the humanized form.
Inventors: |
Rajewsky, Klaus; (Koln,
DE) ; Zou, Yong-Rui; (Bethesda, MD) |
Correspondence
Address: |
Randolph Ted Apple
Morrison & Foerster LLP
755 Page Mill Road
Palo Alto
CA
94304-1018
US
|
Family ID: |
6466351 |
Appl. No.: |
10/272358 |
Filed: |
October 15, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10272358 |
Oct 15, 2002 |
|
|
|
08403416 |
Feb 23, 1995 |
|
|
|
6570061 |
|
|
|
|
08403416 |
Feb 23, 1995 |
|
|
|
PCT/EP93/02268 |
Aug 24, 1993 |
|
|
|
Current U.S.
Class: |
800/14 ; 800/18;
800/21 |
Current CPC
Class: |
C12N 15/907 20130101;
A01K 2217/05 20130101; C07K 16/00 20130101; A61K 38/00 20130101;
A01K 67/0275 20130101 |
Class at
Publication: |
800/14 ; 800/18;
800/21 |
International
Class: |
A01K 067/027 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 25, 1992 |
DE |
P42 28 162.8 |
Claims
What is claimed is:
1. A method for replacement of a gene or gene segment in the cell
of a nonhuman mammal with a homologous gene or a homologous gene
segment of another mammal, the method comprising: transfecting an
embryonic stem cell with a recombination vector having a selectable
marker; selecting said transfected cells for the presence of said
marker gene; selecting for cells having targeted recombination by
at least one of PCR and Southern blotting; injecting said selected
cells into blastocysts of said nonhuman mammal; transferring said
blastocytes to surrogate mothers, wherein said endogenous gene or
endogenous gene segment is functionally replaced in one step by the
homologous gene or homologous gene segment in the recombination
event.
2. A method according to claim 1, wherein said introduced gene or
gene segment is human and said nonhuman mammal is a rodent.
3. A method according to claim 1, wherein said homologous gene or
gene segment encodes a protein selected from the group consisting
of proteins of the immune system; proteins of the nervous system;
virus receptors; proteins of the blood-forming system; and proteins
of the support tissue.
4. A method according claim 1, wherein said homologous gene or gene
segment encodes a protein selected from the group consisting of
antibody, T-cell receptor, cytokine, cytokine receptor, MHC
antigen, adhesion molecule and signal-mediating molecule.
5. A method according to claim 4, wherein said homologous gene or
gene segment encodes a human antibody.
6. A method according to claim 1, wherein said recombination vector
is a replacement vector containing the gene or gene segment to be
introduced; sequences homologous to the sequences flanking the
endogenous DNA segment to be replaced; a marker gene selected from
neomycin and hygromycin; and additional functional gene
sequences.
7. A method according to claim 6, wherein said functional gene
sequences are recognition sequences for a non-mammalian
recombinase.
8. A method according to claim 1, wherein said recombination vector
is pTZ.sub.2-C.kappa.N (PA-)(DSM 7211).
9. A method according to claim 7, wherein said marker gene and said
sequences homologous to the sequences flanking the endogenous DNA
segment are removed by means of said recombinase recognition
sequences.
10. A recombination vector comprising a gene or gene segment to be
introduced; sequences homologous to the sequences flanking the
endogenous DNA segment to be replaced; a marker gene selected from
neomycin and hygromycin; and additional functional gene
sequences.
11. A recombination vector according to claim 10, wherein said
functional gene sequences are recognition sequences for a
non-mammalian recombinase.
12. A method for producing a transgenic nonhuman mammal, the method
comprising: transfecting an embryonic stern cell with a
recombination vector according to claim 10; selecting said
transfected cells for the presence of said marker gene; selecting
for cells having targeted recombination by at least one of PCR and
Southern blotting; injecting said selected cells into blastocysts
of said nonhuman mammal; transferring said blastocytes to surrogate
mothers, mating the chimeric offpspring of said mothers; and
selecting progeny of said mating for the presence of said
introduced gene or gene segment.
13. A method according to claim 12, wherein said transgenic
non-human mammal is a mouse.
14. A transgenic, nonhuman mammal obtained according to the method
of claim 12.
15. A method of producing a gene product, the method comprising:
isolating said gene product from a transgenic animal according to
claim 14.
16. A method for producing humanized antibodies, the method
comprising: isolating said humanized antibodies from a transgenic
animal according to claim 14, wherein said introduced gene or gene
segment encodes at least a portion of a human antibody.
17. A method for producing viral proteins, the method comprising:
isolating said viral proteins from a transgenic animal according to
claim 14, wherein said introduced gene or gene segment encodes a
viral protein.
18. A transgenic mouse having a genome comprising: at least one
human immunoglobulin constant region gene functionally replacing an
analogous mouse gene, wherein humanized antibodies comprising a
human constant region joined to a mouse variable region are
produced at high levels in response to antigen; and wherein said
humanized antibodies undergo somatic hypermutation.
19. A transgenic mouse according to claim 18, wherein said at least
one human immunoglobulin constant region is present on both
chromosomes.
20. A transgenic mouse according to claim 19, wherein said
humanized antibodies are produced at levels of at least 50 .mu.g/ml
in serum.
21. A transgenic mouse according to claim 20, wherein said at least
one human immunoglobulin constant region gene is C.gamma.1.
22. A transgenic mouse according to claim 18, wherein said at least
one human immunoglobulin constant region gene is C.kappa., and
wherein humanized antibodies are produced at levels of at least 500
.mu.g/ml.
23. A transgenic mouse according to claim 21, further comprising a
human C.kappa. gene functionally replacing the analogous mouse gene
on both chromosomes, wherein said human C.kappa. and said human
C.gamma. chains form an antibody molecule in vivo.
24. A method of producing humanized antibodies in response to an
antigen, the method comprising: immunizing a mouse according to
claim 18 with an antigen; collecting antibodies from said mouse;
selecting for antibodies comprising a human constant region.
25. A method according to claim 24, wherein said human constant
region is C.gamma.1.
26. A method according to claim 24, wherein said human constant
region is C.kappa..
27. A method according to claim 24, wherein said antibodies
comprise human C.kappa. and human C.gamma.1 chains.
28. A method of producing an antigen specific monoclonal humanized
antibody, the method comprising: immunizing a mouse according to
claim 18 with all antigen; immortalizing B cells from said
immunized mouse; growing said clones of said immortalized B cells;
screening said immortalized B cells for production of antigen
specific humanized antibodies; collecting antibodies from said
immortalized B cells.
29. A method according to claim 28, wherein said human constant
region is C.gamma.1.
30. A method according to claim 28, wherein said humanized
antibodies further comprise a human C.kappa. region.
Description
INTRODUCTION
[0001] 1. Field of the Invention
[0002] The invention concerns a method for replacement of a
homologous gene segment from mammals in the cell line of nonhuman
mammals by homologous recombination. The invention also concerns a
method for creation of a transgenic nonhuman mammal, as well as its
use for expression of gene products and for testing of drugs and
therapeutic models. In addition, a recombination vehicle for
homologous recombination, a stably transfected cell clone and a
transgenic, nonhuman mammal are disclosed.
[0003] The field of this invention is the production of humanized
antibodies in a transgenic host.
[0004] 2. Background
[0005] Monoclonal antibodies find application in both diagnosis and
treatment. Because of their capacity to bind to a specific epitope,
they can be used to identify molecules carrying that epitope or may
be aimed, by themselves or in conjunction with another moiety, to a
specific place for diagnosis or therapy. Humanized antibodies
posess significant advantages over rodent antibodies, however they
have been difficult to produce in large quantities.
[0006] Various technologies have been developed to overcome
problems related to the production of human monoclonal antibodies.
one strategy is the generation of chimeric antibodies in which the
rodent constant (C) regions of both heavy (H) and light (L) chains,
with or without the framework of the variable region, are replaced
by the equivalent domains or sequences of human immunoglobulin.
Another strategy attempts to mimic the immune response in vitro,
through bacteriophage expression of human variable region genes
isolated from human B cell populations, followed by selection for
rare, high affinity antibodies through antigen binding. A major
drawback to these and similar approaches is the cumbersome work
required to generate each specific mAb of appropriate biological
function.
[0007] An ideal solution to these problems would be the generation
of a mouse strain synthesizing human antibodies instead of mouse
antibodies. This has been approached by introducing a mini-locus
containing a few human V and C region gene segments in germline
configuration into the mouse genome as a transgene. In such
strains, antibodies carrying human H and L chains were indeed
produced, but the levels of production were low and the repertoire
of human V regions was severely limited. Thus, while the approach
appears promising in principle, it is not yet at the stage to stand
its final test. There is, therefore, substantial interest in
finding alternative routes to the production of allogeneic
antibodies for humans.
[0008] Relevant Literature
[0009] Homologous recombination between the DNA sequences present
in a chromosome and new, added, cloned DNA sequences (hereafter
referred to as gene targeting) permits insertion of a cloned gene
into the genome of a living cell. Animals that are homozygous for
the desired mutation can be obtained with this method using
embryonal germ cells via chimeras (M. R. Capecchi, Science, 244,
1288 (1989)). The use of gene targeting to deactivate a gene (gene
disruption) and for gene correction, i.e., incorporation of a gene
segment previously not present, is described in R. D.
Camerini-Otero, R. Kucherlapati, The New Biologist, 2(4), 334-341
(1990).
[0010] The insertion methods described in WO 90/11354 and WO
91/19796 in which a desired gene segment is introduced into the
genome of a cell by homologous recombination are also included
among the gene correction methods. In the latter method the still
functional endogenous gene is removed in a second step and an
endogenous gene segment thus replaced with a homologous gene
segment. Moreover, WO 91/19796 discloses a virtually one-stage
method, i.e., co-transfection, in which the resistance marker is
not situated in the gene segment being introduced, but is
introduced separately. In the examples cited in this document,
however, only slightly varied homologous gene segments (maximum
2.times.2 base variations) are introduced, raising the question as
to the extent to which a selectable recombination event can still
be established during a reduction in homology (given the limited
recombination frequency of the two-stage method). Nor is it
demonstrated in this document whether the executed mutation of the
embryonal parent cells is transferred to the cell line. Moreover,
K. Rajewsky (Science, 256, 483 (1992)) suggests the use of
homologous recombination for gene substitution in order, for
example, to identify the function of a newly discovered gene.
[0011] In this sense, the task of the present invention was to make
available a direct successful method in one step for production of
genetically engineered nonhuman mammals that contain homologous
gene segments from other mammals via homologous recombination.
[0012] Homologous recombination between the DNA sequences present
in a chromosome and exogenous DNA sequences permits insertion of a
cloned gene into the genome of a living cell. The generation of
transgenic animals using this methodology is described in Thomas
and Capecchi (1987) Cell 51:503-512; Capecchi (1989) Science
244:1288 and Koller and Smithies (1989) P.N.A.S. 86:8932-8935. The
use of gene targeting for gene correction is described in
Camerini-Otero and Kucherlapati (1990) The New Biologist 2:334-341.
Targeted deletion of gene segments using the bacteriophage-derived
Cre-loxP recombination system is described in Sauer and Henderson
(1988) P.N.A.S. 85:5166-5170 and Orban et al. (1992) P.N.A.S.
89:6861-6865. K. Rajewsky (1992) Science 256:483 suggests the use
of homologous recombination for gene substitution in order to
identify the function of a newly discovered gene. Yung et al (1993)
Science 259:984-987 describe the generation of transgenic animals
using the Flp/frt recombinase system.
[0013] WO 90/11354 and WO 91/19796 further describe methods of
homologous recombination. In the former, a functional endogenous
gene is removed in a second step after homologous recombination,
thereby replacing an endogenous gene with a homologous gene
segment. WO 91/19796 discloses a method in which the resistance
marker is not situated in the gene segment being introduced, but is
introduced separately.
[0014] The genes encoding human and mouse immnunoglobulins have
been extensively characterized. Berman et al. (1988) EMBO J.
7:727-738 describe the human Ig VH locus. Sakano et al. (1981)
Nature 290:562-565 describe a diversity segment of the
immunoglobulin heavy chain genes. Blankenstein and Kruwinkel (1987)
Eur. J. Immunol. 17:1351-1357 describe the mouse variable heavy
chain region.
[0015] The generation of transgenic mice bearing human
immunoglobulin genes is described in International Application WO
90/10077 and WO 90/04036. WO 90/04036 describes a transgenic mouse
with an integrated human immunoglobulin "mini" locus. WO 90/10077
describes a vector containing the immunoglobulin dominant control
region for use in generating transgenic animals.
SUMMARY OF THE INVENTION
[0016] Animals, DNA compositions and methods are provided for the
efficient production of high affinity humanized antibodies.
Transgenic animals are produced through targeted gene replacement.
The native immunoglobulin constant region is replaced with the
corresponding human gene segment. Of particular interest is the use
of non-mammalian recombinase systems in embryonic stem (ES) cells,
which allows for a convenient replacement process. Humanized
antibodies are made at a high level and efficiency. In a preferred
embodiment, transgenic animals are obtained that undergo antibody
affinity maturation and a class switch from the native
immunoglobulin to the humanized form. A method was found by the
applicant that permits targeted replacement of individual gene
segments in the cell line of a mammal in one step with gene
segments of other species.
[0017] The present invention thus concerns a method for replacement
of a gene or gene segment in the cell line of a nonhuman mammal
with a homologous gene or a homologous gene segment of another
mammal, in which (i) an embryonal parent cell line is transfected
with a selectably marked recombination vehicle; (ii) stably
transfected cell clones are selected for the presence of the marker
gene; (iii) they are subjected to targeted selection by PCR and/or
Southern Blot; (iv) these are injected into the blastocysts of the
nonhuman mammal; (v) the blastocysts are transferred to surrogate
mothers, characterized by the fact that the endogenous gene or the
endogenous gene segment is functionally replaced in one step by the
homologous gene or the homologous gene segment in the recombination
event by means of the selectably marked recombination vehicle.
[0018] It is preferred according to the present invention that the
introduced gene or the introduced gene segment originate from
humans and that the nonhuman mammal be a rodent, especially a
mouse.
[0019] Genes or gene segments that code for proteins involved in
the immune system, the nervous system, especially signal-mediating
and adhesion molecules, virus receptors, the blood-forming system
and support tissue, especially muscles, tendons and bones may also
be replaced according to the subject methods. Those genes and gene
segments that code for protein of the immune system are
particularly preferred, especially antibody genes, T-cell receptor
genes, cytokines, cytokine receptor genes, MHC genes, adhesion
molecule genes and genes of signal-mediating molecules.
[0020] An antibody gene segment of the mouse is replaced by an
antibody gene segment of man in a special variant of the present
invention.
[0021] The selectably marked recombination vehicle according to the
invention is a replacement vector and carries the gene or gene
segment to be introduced, sequences that are homologous to the
sequences that flank the endogenous DNA segment to be replaced and
a marker gene, especially neomycin or hygromycin, neomycin being
preferred. Moreover, the recombination vehicle can also contain
viral recognition sequences (for example SV40), additional
sequences to amplify gene expression, target sequences for pro- and
eukaryotic recombination systems. The latter sequences, especially
the Cre recognition sequence LoxP or the flip recognition sequence
Frt, can be used for targeted removal of marker genes, as well as
any still remaining non-functional target gene segments. In this
fashion it is possible to replace in the first step the endogenous
gene segment with a homologous gene segment of another mammal and
to remove the remaining residues in a second step by means of a
selectively functioning recombinase (H. Gu et al., Cell, 73,
1155-1164 (1993)). The remaining residue is selectively removed in
this method and only the desired recombination can occur, in
contrast to the "hit and run" method described in WO 91/19796.
[0022] The selectably marked recombination vehicle in a preferred
variant of the present invention is the plasmid pTZ.sub.2-CkN
(PA.sup.-)(DSM 7211).
[0023] Another object of the present invention is a recombination
vehicle for homologous recombination that contains the gene to be
replaced or the gene segment to be replaced and a selectable marker
gene. The recombination vehicle can also contain the recognition,
amplification and/or target sequences already mentioned.
[0024] Another object of the present invention is the stably
transfected cell clone produced by the method according to the
invention, as well as a method for creation of a transfected,
nonhuman mammal. According to the latter method the stably
transfected cell clones according to the invention are injected
into mouse blastocysts, these blastocysts are transferred to the
surrogate mother, the born chimeral animals are mated and their
offspring selected for the presence of the mutation.
[0025] Transgenic nonhuman mammals that can be obtained in this
fashion are also an object of the present invention.
[0026] Another object of the present invention is the use of the
selectively mutated, transgenic nonhuman mammal for expression of
gene products of another mammal instead of the product coded by the
original gene segment and for testing of drugs and therapeutic
models. The use of these gene products to produce humanized
monoclonal antibodies and for virus production is particularly
preferred in the sense of the present invention.
[0027] The method according to the invention permits replacement of
genes or gene segments in the cell line of nonhuman mammals with a
homologous gene or a homologous gene segment of another mammal in
one step. Animals that are homozygous for the desired mutation are
obtained via chimeras and can be used for expression of gene
products of another animal instead of the endogenous gene or for
testing of drugs and therapeutic models.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIGS. 1A to 1C are schematics of the human and mouse
immunoglobulin kappa region loci. FIG. 1A shows the germline mouse
C.sub..kappa. locus. FIG. 1B shows the subject targeting vector.
FIG. 1C shows the mouse locus after the recombination event in
which mC.sub..kappa. is replaced by HC.sub..kappa.. The cleavage
sites for restriction enzymes (B, BamHI; E, Eco RI; H, Hpa I; M,
Mst II; Bg, Bgl II; K, Kpn I) are indicated. The DNA probes used
for the Southern blot analyses are shown, as well as the fragments
obtained. FIG. 1C shows the primers, designated by arrows, used for
amplification.
[0029] FIG. 2 is a point diagram of antibody staining for the
presence of human kappa chain in the transgenic mice. Spleen cells
of a wild type mouse (WT/WT; left side) and a homozygous mouse
mutant (HC.sub..kappa./HC.sub..kappa.; right side) were stained
with antibodies specific for the B-cell antigen CD45R (B220), and
antibodies specific for either mouse (top) or human (bottom) kappa
chains. The cells were analyzed in a flow cytometer.
[0030] FIGS. 3A to 3C are schematics of the human and mouse IgG1
locus during homologous recombination using a Cre recombinase. FIG.
3A shows the germline mouse IgG1 locus, with the exons marked with
boxes. The symbols B and X signify BamHI and XbaI restriction
sites. FIG. 3B shows the locus after replacement with the human
gene fragment. The black triangles designate LoxP recognition
sequences. FIG. 3C shows the locus after removal of the region
flanked by LoxP by recombinase Cre.
[0031] FIG. 4 is a graph showing the response of mice, having
homozygous human C.kappa. gene replacement, to immunization with
several defined antigens.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[0032] Animals, DNA compositions and methods are provided for the
efficient production of high affinity humanized antibodies in a
transgenic animal. Targeted gene replacement is used to exchange
the native immunoglobulin constant region with the corresponding
human gene segment. The replacement may be effected with
conventional gene targeting or with the a non-mammalian
recombination system, such as bacteriophage-derived Cre-loxP or
flp/frt. Transgenic animals are obtained that produce high affinity
antibodies with human constant region sequences. During in vivo
affinity maturation, animals with a native C.mu. region are able to
class switch to a transgenic C region, e.g. C.gamma., C.alpha.,
C.delta. or C.epsilon..
[0033] The subject invention provides for the production of
polyclonal humanized anti-serum or humanized monoclonal antibodies.
The humanized antibodies have a human constant region and a host
variable region. The humanized antibodies are produced at a level
comparable to native antibodies. Humanized light chains will
usually be present in serum at concentrations of at least about 500
.mu.g/ml, more usually at least about 1 mg/ml. The serum
concentration of humanized heavy chains is dependent on class
switching and will usually be present at concentrations of at least
about 50 .mu.g/ml, more usually at least about 100 .mu.g/ml. The
genes encoding the humanized antibodies are able to undergo somatic
hypermutation, thereby allowing for B cell selection and affinity
maturation.
[0034] The subject transgenic animals have a native immunoglobulin
(Ig) constant region gene functionally replaced with a human
constant region gene, that is, the human constant region segment
replaces the native gene segment in the genetic recombination and
expression events associated with an antibody response. The native
gene may be deleted or inactivated. The constant region gene is
herein defined as the constant region exons, and optionally
including introns, encoding the secreted portion of a mature
immunoglobulin chain. In a preferred embodiment, the host
transmembrane and cytoplasmic portion will be retained. An intact
switch region, either human or from the native gene, will be
present at the heavy chain locus.
[0035] For most applications, it is desirable to have the genes for
both the Ig heavy and light chain constant regions replaced with
human genes. Either of the human light chain constant region genes,
i.e. C.kappa. and C.lambda., may be used to replace a host light
chain constant region. At the host heavy chain locus, at least one
of the isotypes will be functionally replaced, e.g. C.mu.,
C.delta., C.gamma., C.alpha. or C.epsilon.. The transgenic human
gene may be the counterpart to the native gene, e.g.
C.gamma.1.fwdarw.C.gamma.1, or may be a different isotype.
Preferably, the replaced host region will be other than C.mu.. Of
particular interest are the .alpha. and .gamma. constant regions,
which may be interchanged, e.g. C.gamma.1.fwdarw.C.alpha.;
C.gamma.2.fwdarw.C.alpha.; C.gamma.3.fwdarw.C.alpha.;
C.gamma.4.fwdarw.C.alpha.; C.alpha..fwdarw.C.gamma.1, etc.;
C.gamma.1.fwdarw.C.epsilon., etc.; C.alpha..fwdarw.C.epsilon., and
the like.
[0036] A number of strategies may be employed to achieve the
desired transgenic hosts. Various hosts may be employed,
particularly murine, lagomorpha, ovine, porcine, equine, canine,
feline, or similar animals. For the most part, mice have been used
for the production of B-lymphocytes that are immortalized for the
production of antibodies. Since mice are easy to handle, can be
produced in large quantities, and are known to have an extensive
immune repertoire, mice will usually be the animals of choice.
Therefore, in the following embodiments, the discussion will refer
to mice, but it should be understood that other animals,
particularly mammals, may be readily substituted for the mice,
following the same procedures.
[0037] Methods for producing transgenic animals are known in the
art. A host embryonic cell, generally an embryonic stem cell line,
is transfected with the recombination vector. Where the exogenous
gene is an Ig heavy chain, the host coding region for the exons
CH1, CH2, hinge, CH3 and CH4 will be inactivated by a lesion that
results in the loss of transcription. Preferably, the heavy chain
cytoplasmic and transmembrane domains of the constant region will
continue to be expressed. Where the exogenous gene is an Ig light
chain, at least one of the host Ig light chain constant regions,
e.g. IgC.kappa. or IgC.lambda., will be similarly inactivated. Such
a lesion may take the form of a deletion in the target gene, an
insertion of a foreign gene, or a replacement, where a deletion is
made in the endogenous gene and is replaced with exogenous
sequences. In a preferred embodiment, the vector will include loxP
sites, allowing for the deletion of the host coding region through
the action of Cre recombinase.
[0038] The vector will usually include a selectable marker, the
human constant region gene, and regions of homology to the host
target locus, i.e. the region of the chromosome that will be
replaced with the human sequence. The homologous region will
usually be at least about 100 bp, more usually at least about 1 kb,
and usually not more than about 10 kb in length. If a non-mammalian
recombinase, e.g. Cre, Flip, etc., is to be used, the homologous
region will contain the entire region to be replaced, having
recombinase recognition sites, e.g. loxP, frt, flanking the
selectable marker and homologous region.
[0039] Various markers may be employed for selection. These markers
include the HPRT minigene (Reid et al. (1990) Proc. Natl. Acad.
Sci. USA 87:4299-4303), the neo gene for resistance to G418, the
HSV thymidine kinase (tk) gene for sensitivity to gancyclovir, the
hygromycin resistance gene, etc. The recombination vehicle may also
contain viral recognition sequences, e.g. SV40, etc., additional
sequences to amplify gene expression and the like.
[0040] After transfection, the embryonic stem cells are grown in
culture under conditions that select for cells expressing the
selectable marker gene. Those cells are then screened to determine
whether the recombination event took place at the homologous
chromosome region. Such screening may be performed by any
convenient method, including Southern blotting for detection of
differentially sized fragments, PCR amplification, hybridization,
etc.
[0041] The cells may be further manipulated to homogenotize the
recombination (see, for example PCT/US93/00926) or to induce
deletion of the host target sequence. Where the vector includes
recognition sites for an exogenous recombinase, deletion between
the recognition sites occurs by exposure of the DNA to the
recombinase, which is conveniently achieved by transfecting the
cell with an expression vector encoding the recombinase, and then
inducing transient expression. The cells may then undergo another
round of selection for those having the deletion.
[0042] Cells having the desired recombination are injected into
blastocysts of the host mammal. Blastocysts may be obtained from
females by flushing the uterus 3-5 days after ovulation. At least
one, and up to thirty, modified embryonic stem cells may be
injected into the blastocoel of the blastocyst. After injection, at
least one and not more then about fifteen of the blastocysts are
returned to each uterine horn of pseudo-pregnant females. Females
are then allowed to go to term, and the resulting litter is
screened for mutant cells having the construct.
[0043] Subsequent breeding allows for germ line transmission of the
altered locus. One can choose to breed heterozygous offspring and
select for homozygous offspring, (i.e. those having the human gene
segment present on both chromosomes) from the heterozygous parents,
or the embryonic stem cell may be used for additional homologous
recombination and inactivation of the comparable locus. The animal
thus generated may serve as a source of embryonic cells for further
replacement of Ig loci.
[0044] The subject invention provides for the production of
polyclonal humanized anti-serum or humanized monoclonal antibodies
or antibody analogs. Where the mammalian host has been immunized
with all immunogen, the resulting humanized antibodies may be
isolated from other proteins by means of an an Fc binding moiety,
such as protein A or the like. Of particular interest is the
production of antibodies to proteins or other molecules of human
origin that are not normally capable of raising an antibody
response in humans. Proteins found in blood or the surface of human
cells are useful as immunogens. Tumor antigens of human origin may
also be a source of antigens. Also of interest is the production of
antibodies to various pathogens that infect humans, e.g. viruses,
fungi, protozoans, bacteria, etc. The transgenic animal is able to
respond to immunization with specific antigens by producing mouse
B-cells expressing specific humanized antibodies. The B-cells can
be fused with mouse myeloma cells or be immortalized in ally other
manner for the continuous stable production of humanized monoclonal
antibodies.
[0045] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTAL
[0046] Gene Replacement with the Human C.sub..kappa. Gene
Segment
[0047] The plasmid pTZ-HC.sub..kappa. was constructed, in which a
727 base pair long SphI-HhaI fragment containing the
C.sub..kappa.-exon from the vector pC-2 (H. -G. Klobeck et al.
(1984) Nucleic Acids Research 12:6995-7006) was inserted between
the SphI and PstI cleavage sites of the polylinker of plasmid
pTz-19(R) (Pharmacia LKB, Catalog No. 27-5986-01, Pharmacia LKB
GmbH, P.O. Box 5480, Munzinger Str. 9, 7800 Freiburg).
[0048] The plasmid
pTZ-HC.sub..kappa.-mC.sub..kappa.-mC.sub..kappa.5' was constructed,
in which a 1.2 kb HindIII-MstII fragment of vector pHBC.sub..kappa.
(S. Lewis et al. (1982) Cell 30:807-816) that contains the intron
enhancer element wis inserted between the HindIII and SphI cleavage
sites of plasmid pTZ-HC.sub..kappa..
[0049] The plasmid pTZ-5'HC.sub..kappa.Neo was constructed in which
a 1.1 kb XHOI-BamHI fragment that contains the neomycin-resistance
gene from plasmid pMCINeo (Stratagene, Catalog No. 213201,
Stratagene GmbH, P.O. Box 105466, Im Weiher 12, 6900 Heidelberg)
was inserted between the SalI and BamHI cleavage sites of vector
pTZ-HC.sub..kappa.-mC.sub..kappa.5'.
[0050] The plasmid pTZ-5'HC.sub..kappa.Neo was constructed in which
a 2.8 kb long HindIII fragment of plasmid pHJ.sub..kappa. (S. Lewis
et al., loc cit.) that contains the J 1-5 elements was inserted in
the HindIII cleavage site of plasmid pTZ-5'HC.sub..kappa.Neo.
[0051] The plasmid pTZ.sub.2-CkN (PA-) (DSM 7211), which was used
for gene substitution, additionally contains a 427 bp long fragment
between the Bam HI and KpnI cleavage sites of plasmid
pTZ-5'-HRC.sub..kappa.Neo, which was amplified by means of the
polymerase chain reaction from mouse cell line DNA. The following
primers were used to amplify this fragment from the mouse cell line
DNA:
[0052] 5'-CAGGATCCAACTGTATCCATC (SEQ ID NO:1) hybridizes 12 base
pairs after the beginning of the C.sub..kappa.-exon;
5'-GAGGTACCAAGGAAAGGGAGG (SEQ ID NO:2) hybridizes 137 base pairs
after the stop codon TAG of the C.sub..kappa.-exon.
[0053] Homologous Recombination
[0054] The method of homologous recombination by means of
replacement vectors has been previously described (Kitamura et al.
(1991) Nature; Kuhn et al. (1991) Science; Kitamura et al. (1992)
Cell). The vector used for homologous recombination contains a 4.5
kb segment of genomic DNA of the murine kappa gene
(mC.sub..kappa.), containing the gene segment J.sub..kappa. 1-5,
the kappa-intron-enhancer and the 3' untranslated region present
from the mC.sub..kappa. gene without the polyadenylation site. The
human kappa gene (HC.sub..kappa.) and a neomycin gene lacking its
own polyadenylation site were inserted between the MstII and HpaI
restriction cleavage sites, and the splice donor site of
mC.sub..kappa. present between MstII and HpaI was removed (FIG. 1).
Since the neomycin gene carries no polyadenylation site on the
vector, a homologous recombination event was selected for because a
neomycin-resistant cell clone can only form if the vector
integrates before a polyadenylation site in the genome. This occurs
if the vector integrates at the homologous site.
[0055] The vector was linearized and incorporated by
electroporation into the embryonic stem cells (ES) of the mouse.
Neomycin-resistant ES cells carrying the homologous recombination
event were identified by polymerase chain reaction and subsequent
Southern blot. 2.times.10.sup.7 ES cells were transfected in one
experiment. Out of 480 neomycin-resistant ES cells, one carried the
planned mutation, as shown in FIG. 1.
[0056] In order to investigate expression of the humanized
antibody, chimeric mice were produced by means of an ES cell clone.
These chimeric mice were mated with C57BL/6 mice. Mice carrying the
mutation were mated in the next generation. Mice born in the
following generation carried the two unaltered mouse kappa loci
(WT) (25%), carried two mutated loci (HC.sub..kappa.) (25%), or
carried one unaltered and one mutated locus (50%).
[0057] A wild type mouse (WT/WT) and a mouse homozygous for the
mutation (HC.sub..kappa./HC.sub..kappa.) were compared in their
ability to produce antibodies. To demonstrate that the
HC.sub..kappa. gene is used for antibody formation in the
homozygous mouse mutants, the concentration of antibodies that
carry the constant region of the human kappa gene were determined
in the serum of the mice. Humanized antibodies are not detectable
in a wild type mouse, where the limits of detection are about 250
ng/ml human C.sub..kappa. protein. A concentration of 178 .mu.g/mL
was found in the sera of mice carrying one HC.sub..kappa. allele,
while a concentration of 2860 .mu.g/ml was found in the homozygous
mice. For comparison, normal human serum contains about 15,000
.mu.g/ml C.sub..kappa..
[0058] The direct proof that the HC.sub..kappa. gene functionally
replaced the mC.sub..kappa. gene is shown by an analysis of
antibody-producing cells (B-lymphocytes) in the mouse. Resting
B-lymphocytes carry antibodies on their surface that they express
after gene rearrangement. These antibodies can be detected by
labeled antibodies specific for light chains. FIG. 2 depicts the
results of an experiment in which antibodies specific either for
the kappa chain of the mouse or for the kappa chain of humans. The
cells were stained with a phycoerythrin (PE) conjugated antibody
that recognizes all B-cells (anti CD45R(B220)). At the same time,
the cells were stained with a fluorescein conjugated antibody
specific for the constant region of the kappa-light chain. The data
shows that B-lymphocytes in the transgenic mouse express antibodies
with the human kappa chain and that the kappa chain of the mouse is
no longer used.
[0059] Gene Replacement with the Human C.gamma. Gene
[0060] To construct the vector pG1, the plasmid pG1A that codes for
the homologous region of the short arm of IgG1 (which contains the
mouse .sub..gamma.1-gene and its flanking regions) was first
isolated by PCR. For this purpose, a mixture of 10 pmol of the
following primers: TTATCGATACAGAGGCTCAACCTACAAA (SEQ ID NO:3) and
CCAAGCTTCGCTACTTTTGCACCCTT (SEQ ID NO:4), as well as 10 ng of the
plasmid DNA, were subjected to 25 cycles at 94.degree. C. (1 min),
69.degree. C. (1.5 min) and 74.degree. C. (2 min). To produce the
p5'HROGNT vector, the isolated homologous region was cloned in a
neo.sup.r-tk cassette (H. Gu et al. (1993) Cell 73:1155-1164) that
had an Frt site (O'Gorman et al. (1991) Science 251:1351) on the 5'
terminus. The p5'HROGNT vector was partially digested with BamHI
and then with XHoI. A 1.2 kb BamH-XhoI fragment that contains a
neo.sup.r gene having a loxP site on its 5' terminus was isolated
from the plasmid pGH1 and cloned to produce the vector pG1 in the
digested p5'HROGNT vector.
[0061] To produce vector PG2, the human .sub..gamma.1 gene that
codes for the secretory form of human IgG1 was subcloned in the pG1
vector. For this purpose, a 2.1 kb HindIII-PvuII fragment that
contains the human .sub..gamma.1gene was isolated from the plasmid
pTJ1B (A. Kudo et al. (1985) Gene 33:1 8 1). Another fragment that
contains the neo.sup.r gene and part of the tk gene was isolated
from the pG1 plasmid by XhoI digestation, subsequent T.sub.4
polymerase replenishment and digestion with BgIII. The pG1 vector
was also partially digested with HindIII and then with XhoI-BgIII.
These three fragments were ligated to construct the pG2 vector.
[0062] To construct vector pG3, a loxP site was subcloned before
the mouse .sub..gamma.1 membrane exons. For this purpose, the
plasmid pTZ-3'.sub..gamma.1 (4.3) and the plasmid pGEM30 (H. Gu et
al., Cell, 73, 1155-1164 (1993)) were partially digested with EcoRI
and SalI and were ligated together. The plasmid pTZ-3'.sub..gamma.1
(4.3), which contains two membrane exons of the mouse .sub..gamma.1
gene, was produced from a 1.5 kb SacI-EcoRI fragment of plasmid
pGA1 and a 2.8 kb EcoRI fragment of the bacteriophage
ch.sub..gamma.1-3 (A. Schimizu et al., Cell, 28, 499 (1982)).
[0063] To construct the entire 3' homologous region of the gene
substitution vector, the vector pGH2 (which contains a genomic
6.3-XbaI-EcoRI genomic DNA fragment) including the mouse
.sub..gamma.1gene in the secretory and membrane form, was digested
with SacI, replenished with T.sub.4 polymerase and then digested
with BgIII. The pG3 vector was cleaved with XhoI, replenished with
T.sub.4 polymerase and then cleaved with BgIII and SphI. To
construct vector pG4, the two fragments so obtained were
ligated.
[0064] To construct the gene substitution vector pG5, the vector
pG4 was cleaved with ClaI and XhoI, the vector pG2 was cleaved with
ClaI and SalI, and the cleaved vectors were ligated together.
[0065] Homologous Recombination
[0066] For homologous recombination, the vector pG5 was linearized
by ClaI digestion and introduced to embryonic parent cells of the
mouse by electroporation as described above.
[0067] In an additional step, the Cre recombinase was transiently
expressed in the embryonic parent cells (H. Gu et al. (1993) Cell
73:1155-1164). The recombinase then removes the region flanked by
the loxP recognition sequences with higher efficiency (FIG. 3). A
mouse mutant that is homozygous for the mutation was then created
in accordance with the method described above for the C.kappa.
locus chimeric mice.
[0068] The demonstration that the mouse gene that normally codes
for the constant region of the IgG1 gene was replaced by the
corresponding region of the human gene was confirmed by detection
of human IgG1 in cultures of B-cells of the corresponding chimeric
mouse: concentrations of 2 .mu.g/ml of human IgG1 were measured in
cultures from three mice, whereas the values were below the
detection limit of 0.1 .mu.g/ml in the control cultures.
[0069] These examples show that it is possible by homologous
recombination to replace antibody genes or gene segments from one
species with those of another species in a single step. In
addition, by mating a mouse having the C.kappa. replacement with a
mouse having the C.gamma. replacement, a mouse mutant is obtained
in which both the C.kappa. gene and the C.gamma..sub.1 gene are of
human origin. Such a mouse mutant is therefore suitable for the
production of humanized monoclonal antibodies.
[0070] The plasmid (pTZ.sub.2-CkN (PA-)) used for gene substitution
was filed with the German Collection of Microorganisms and Cell
Cultures GmbH, Maschorder Weg 1b, W-3300 Braunschweig as E. Coli
strain DSM 7211.
[0071] Analysis of Human C.sub..kappa. Antibody Production
[0072] In the transgenic mouse strain, substantial numbers of
B-cells which express humanized .kappa. chains on the cell surface
are generated. In the blood of 8-week-old transgenics, the levels
of antibodies bearing humanized light chains were approximately 2
mg/ml, compared to 3.5 mg/ml .kappa. chain bearing antibodies in
control mice of the same age.
[0073] The data in Table 1 is a representation of different
lymphocyte populations in the spleen of normal and control mice.
Single cell suspensions were prepared from the spleens of
individual mice at the age of 8 weeks. Cell numbers were determined
by hemocytometer. Cells were stained with FITC-conjugated
anti-mouse .lambda., anti-mouse .kappa., anti-human .kappa., or
anti-CD3, respectively. The cells were also stained with a
PE-conjugated anti-CD45/B220 antibody. The flow cytometric analysis
was performed on a FACScan.
1 TABLE 1 +/+ (wild type) C.kappa.R/+ C.kappa.R/C.kappa.R No. of
nucleated cells (.times.10.sup.7) 25.2 .+-. 2.5 N.D. 17.3 .+-. 1.9
No. of T cells (.times.10.sup.7) 7.5 .+-. 0.9 N.D. 7.7 .+-. 0.5 No.
of B cells (.times.10.sup.7) 17.7 .+-. 1.5 N.D. 9.5 .+-. 2.4
.lambda./B cells (%) 4.9 .+-. 0.4 5.6 .+-. 0.5 17.2 .+-. 2.8 Mouse
.kappa./B cells (%) N.D. 85.4 .+-. 1.5 <1 Human .kappa./B cells
(%) <1 6.1 .+-. 1.9 89.1 .+-. 8.1 N.D. not determined.
[0074] The distribution of antibody isotypes was similar in mutant
and wild-type animals. Although in the transgenics about 10% of the
antibodies carry .gamma..sub.1 chains, a large fraction of the IgG
antibodies are associated with humanized .kappa. chains, because
IgG represents the major isotype in the serum. The presence of
serum IgG antibodies which carry the humanized light chains
indicates that B cells expressing the latter can be triggered by
environmental antigens to contribute to antibody responses.
[0075] Analysis of Antigen Specific Response
[0076] To investigate whether the CkR strain would have its natural
antibody repertoire at its disposal, and whether it would be
capable of generating antigen-specific antibodies upon immunization
with different antigens, the human C.kappa. mice were immunized
with phosphorylcholine (PC) coupled to keyhole limpet hemocyanin
(KLH), 2-phenyl-5-oxazolone (phOX)-chicken serum albumin (CSA) and
chicken .gamma.-globulin (CG). Eight-week old mice received
intra-peritoneal injections of 100 .mu.g alum precipitated antigen,
mixed with 10.sup.9 Bordatella pertussis cells.
[0077] The concentration of specific antibodies was determined by
ELISA. Plastic plates were coated with CG, KLH, OX-BSA or PC-BSA
(10 .mu.g/ml). Diluted serum samples were added, and bound
antibodies were detected by means of biotinylated antibodies for
the determination of mouse .kappa., human .kappa., IgM, and for
total IgG. The relative concentration of OX-specific IgG or
PC-specific IgM was determined by comparison to standard monoclonal
OX- or PC-specific antibodies of the same isotypes. The relative
concentration of CG- or OX-specific .kappa. bearing antibodies as
well as KLH-binding IgM or IgG are shown as arbitrary units defined
by taking the value of the serum from a pre-immune normal or mutant
animal as one unit.
[0078] Serum antibodies were measured at the time of immunization
and on days 7 and 14 after immunization. The data in FIG. 4 shows
the antibody measurements from homozygous human C.kappa. mice
(.circle-solid.) and control mice (.largecircle.). It is clear from
the results that the response of the mutants to any of these
antigens is equivalent to that of wild-type mice, both in terms the
levels of k chain bearing antibodies and the production of
different isotypes tested.
[0079] Analysis of Affinity Maturation
[0080] A fundamental feature of the antibody response is affinity
maturation through somatic hypermutation of the gene segments
encoding the antigen binding site, and subsequent selection of
those B cells which express antibodies of increased affinity. The
mutation frequency was analyzed in rearranged V.kappa. genes
expressed by B cells responding to immunization with phOX-CSA.
Fourteen days after immunization, these cells are known to be
contained in a B cell subset which can be brightly stained by
phycoerythrin (PE)-labeled peanut agglutinin (PNA). They are also
known to dominantly express a particular V.kappa.-J.kappa.
rearrangement (V.kappa..sub.ox1-J.kappa..sub.5).
[0081] On day 14 of the phOX-CSA response, splenocytes from a
C.kappa.R mutant mouse were isolated and stained with
FITC-conjugated RA3-2B6 and PE-conjugated PNA, followed by sorting
for the PNA.sup.hi B cell population. The purity of the sorted
cells was 91%. cDNA sequences of V.kappa..sub.ox1-J.kappa..sub.5
were obtained and compared to the germline gene by the following
method. Total cellular RNA was prepared from 1.8.times.10.sup.5
PNA.sup.hi splenic B cells (as described in Gu et al. (1990) EMBO
J. 9:2133). cDNA was synthesized using the Super Script Reverse
Transcriptase kit (BRL). V.kappa..sub.ox1-J.kappa..sub.5 joints
were then amplified with synthesis primers carrying the cloning
sites of BAMHI and HindII. The primers were as follows:
V.kappa..sub.ox1 leader specific primer (SEQ ID NO:16)
TGCGGATCCTCAGTCATAATATCCAG and J.kappa..sub.5 primer (SEQ ID NO:17)
CGGAATTCTTTCAGCTCCAGCTTGG. PCR was performed for 35 cycles. Each
cycle consisted of 1 min. at 94.degree., 1 min. at 60.degree., and
1 min. at 74.degree.. The amplified light chain fragments were
cloned into the pTZ19R vector (Pharmacia, Uppsala).
[0082] The data is shown in Table 2. The data revealed that 66% of
the sequences had mutations in the V.kappa..sub.ox1-J.kappa..sub.5
region of the chimeric k chain. Several sequences carried the key
mutations in codons 34 and 37, known to increase the affinity of
phOX-binding antibodies by approximately 10-fold. The frequency of
mutations (2 mutations/sequence) in the chimeric light chains is
similar to previously published observations.
[0083] Taken together, the human C.sub..kappa. replacement mouse
produces B lymphocytes which synthesize antibodies containing
humanized .kappa. chains at levels comparable to those of mouse
.kappa. chains in wild-type littermates. When immunized with
various T cell-dependent antigens, the mutant and wild-type mice
produce equal levels of .kappa. chain bearing specific antibodies.
Furthermore, antigen specific B cells homozygous for the CkR
mutation undergo affinity maturation through somatic hypermutation
to the same extent as documented for the wild-type C.kappa.
gene.
2 TABLE 2 CDR I 11 14 19 20 23 26 31 34 36 37 46 (SEQ ID NO:5) M S
V T C S Y H Y Q R V.kappa.-OX1 ATG TCT GTC ACC TGC AGC TAC CAC TAC
CAG AGA A ------ ------ ------ ------ ------ ------ ------ ------
------ ------ ------ B ------ ------ ------ ------ ------ ------
------ ------ ------ ------ ------ (SEQ ID NO:6) ------ ------
------ ------ ------ ------ ------ ------ ------ ------ ------ (SEQ
ID NO:7) ------ ------ ------ ------ ------ ------ ------ ------
------ ------ ------ (SEQ ID NO:8) ------ ------ ------ ------
------ ------ ------ ------ ------ ------ ------ (SEQ ID NO:9)
------ ------ ------ ------ ------ ------ ------ ------ ------
------ G---- (SEQ ID NO:10) ------ ------ ------ T---- ------
------ ------ ------ ------ ------ ------ (SEQ ID NO:11) ------
------ --C-- ------ ------ ------ ------ ------ --T-- ------ ------
(SEQ ID NO:12) G---- ------ ------ ------ ------ ------ ------
A---- --T-- A---- ------ (SEQ ID NO:13) G---- ------ ------ ------
------ ------ ------ A---- --T-- A---- ------ (SEQ ID NO:14) ------
------ ------ ------ ------ ------ ------ ----G --T-- ------ ------
(SEQ ID NO:15) ------ --T-- ------ ------ C---- --A-- --T-- ------
--T-- ------ ------ CDR II CDR III 52 75 80 93 94 95 (SEQ ID NO:5)
S I A S N P V.kappa.-OX1 TCC ATC GCT AGT AAC CCA A ------ ------
------ ------ ------ ------ B ------ ------ ------ ------ ------
------ (SEQ ID NO:6) ------ ------ ------ ------ ------ ----G (SEQ
ID NO:7) ------ ------ ------ ------ ------ ----G (SEQ ID NO:8)
------ ------ ------ ------ ----T ----G (SEQ ID NO:9) ------ ------
------ ------ ------ ----G (SEQ ID NO:10) ------ ------ ------
--A-- ------ ------ (SEQ ID NO:11) ------ ------ ------ ------
------ ----G (SEQ ID NO:12) ------ ------ ------ ------ ------
------ (SEQ ID NO:13) ------ ------ ------ ------ ------ ----G (SEQ
ID NO:14) ------ G---- ------ ----C ------ ------ (SEQ ID NO:15)
--T-- ------ ----C ------ ------ ----G
[0084] Analysis of Immunoglobulin Production in Human C.gamma.
Mice.
[0085] Peripheral blood lymphocytes were isolated from four mice
(heterozygous for the C.gamma.1R mutation) through FicolI gradient
and cultured with 40 .mu.g/ml LPS plus IL4. Culture supernatants
were collected after 6 days, and the concentrations of mouse
(mIgG1) and humanized IgG1 (hIgG1) were determined by ELISA as
described.
3TABLE 3 IgG1 antibodies generated through in vitro class switch
mIgG1 (.mu.g/ml) 33 25 26 16 hIgG1 (.mu.g/ml) 20 20 21 17
[0086] When switching to IgG1 expression is induced in vitro from B
cells of mice heterozygous for the C.gamma.1 replacement, the
levels of wild-type and humanized IgG1 secreted into the culture
medium was similar. As expected, the IgG1 in the mutants could only
be detected by anti-human, not anti-mouse antibodies. That the
constant region of the secreted .gamma.1 chain in the mutants is
indeed fully encoded by the human C.gamma.1 gene was confirmed by
cloning the corresponding DNA from splenic B cells by polymerase
chain reaction, and sequencing.
[0087] When the double mutant C.gamma.1 replacement mice were
immunized with various T cell dependent antigens (in which IgG1 is
often the predominant antibody isotype), they produced as much
specific IgG1 antibody as did wild-type mice. There also appeared
to be no major difference in antibody quality: affinity maturation
proceeded similarly in mutant and wild-type animals in the
anti-3-nitro-4-hydroxy-phenylacety- l (NP) response. The data is
shown in FIG. 5.
[0088] Serum levels of antibodies of mutant and wild-type animals
were determined by ELISA. Each symbol represents a value obtained
from an individual mouse. FIG. 5A: Serum concentrations of Ig
isotypes in 7-week-old mutant mice. Sera from 5-week-old wild-type
129 mice served as control. For the determination of humanized
IgG1, plastic plates were coated with goat anti-human IgG
antibodies (Jackson Immuno Research) and developed with mouse mAb
anti-human IgG1 (clone 8c/6-39, The Binding Site, Birmingham, UK).
ELISA was performed as described for all the other isotypes. The
concentrations were calculated with mAbs of the respective isotypes
as standards. The concentrations of light chain isotypes were
determined as well, and the ratio of .kappa.- to .gamma.1-bearing
antibodies in the mutant animals was found to be around 4.5,
indicating that the majority of the heavy chains pair with the
chimeric .kappa. chains.
[0089] FIG. 5B: Serum levels of antigen-binding antibodies.
9-week-old control and 6-week-old mutant animals received
intraperitoneal injections of 100 .mu.g of alum-precipitated NP-CG,
phOX-CSA, mixed with 10.sup.9 Bordetella pertussis organisms. Sera
were collected on day 14 after immunization. The left panel shows
titers of antigen-specific IgG1 antibodies. The right panel depicts
titers of CG-specific .kappa.-bearing antibodies. In case of the
anti-NP response, the concentration of NP-binding IgG1 was
determined by comparison to monoclonal mouse as well as humanized
IgG1 mAbs against NP (the latter raised by fusion of X63Ag8.653
myeloma cells with splenic B cells isolated from the NP-CG
immunized mutant mice homozygous for both the C.kappa.R and
C.gamma.1R mutations). The relative concentrations of OX-or
CG-specific IgG1 and .kappa.-bearing antibodies are shown is
arbitrary units, taking the value of the serum from a pre-immune
normal or mutant animal as 1 unit.
[0090] FIG. 5C: Affinity maturation. Relative affinities of anti-NP
IgG1 antibodies were measured using a plate binding assay which is
based on the direct correlation of antibody affinity and the ratio
of antibody-binding to NP-carrier conjugates at low (NP.sub.4BSA)
and high (NP.sub.14BSA) hapten density. Relative affinities were
determined at days 7 and 14 after immunization.
[0091] Analysis of Somatic Hypermutation in Human C.gamma.1
Replacment Mice
[0092] In order to confirm that the human C.gamma.1 replacement
mutation does not interfere with the somatic hypermutation process,
the sequence was determined. Germinal center B cells were isolated
from oxalozone (Ox)-immunized mice on day 14 of the response by
fluorescent cell sorting, using the B lineage surface marker
B220/CD45R and the germinal center B cell specific marker peanut
agglutinin. From these cells, mRNA encoding human .gamma.1 constant
regions and V.sub.H regions predominantly expressed in anti-Ox
responses of IgH.sup.a allotype mice were amplified with the
appropriate primers, cloned and sequenced. Somatic point mutations
could be identified in most sequences at high frequency. In 6
V.sub.H gene sequences, there were 29 independent point mutations
in 1740 base pairs sequenced, i.e. a mutation frequency of
1:60.
[0093] It is evident from the above results that the replacement of
host immunoglobulin constant region genes with corresponding human
genes generates a mouse strain that produces high levels of
humanized antibodies. The animal host can be immunized to produce
human antibodies or analogs specific for an immunogen. The B cells
thus generated are able to undergo the process of class switching,
and somatic mutation, to produce high affinity antibodies.
[0094] The subject invention provides for a convenient source of
humanized antibodies. The problems associated with obtaining human
monoclonal antibodies are avoided, since mice can be immunized with
immunogens that could not be used with a human host. Humanized
antibodies can be produced to human immunogens, e.g. proteins, by
immunization of the subject mice with the human immunogens. The
resulting antisera will be specific for the human immunogen and may
be harvested from the serum of the host. One can also provide for
booster injections and adjuvants which would not be permitted with
a human host. The resulting B-cells may then be immortalized for
the continuous production of the desired antibody.
[0095] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0096] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
Sequence CWU 1
1
* * * * *