U.S. patent application number 09/870932 was filed with the patent office on 2003-09-04 for anti-ccr5 antibodies and methods of use therefor.
This patent application is currently assigned to Millennium Pharmaceuticals, Inc.. Invention is credited to Mackay, Charles R., Wu, Lijun.
Application Number | 20030166870 09/870932 |
Document ID | / |
Family ID | 27113544 |
Filed Date | 2003-09-04 |
United States Patent
Application |
20030166870 |
Kind Code |
A1 |
Wu, Lijun ; et al. |
September 4, 2003 |
Anti-CCR5 antibodies and methods of use therefor
Abstract
The present invention relates to an antibody or functional
portion thereof which binds to a mammalian (e.g., human)
CC-chemokine receptor 5 protein (CKR-5 or CCR5) or portion of the
receptor. The invention further relates to a method of inhibiting
the interaction of a cell bearing mammalian CCR5 with a ligand
thereof. Another aspect of the invention relates to a method of
inhibiting HIV infection of a cell which expresses a mammalian CCR5
or portion thereof using the antibodies described herein. Also
encompassed by the present invention are methods of treating or
preventing HIV in a patient.
Inventors: |
Wu, Lijun; (Lexington,
MA) ; Mackay, Charles R.; (Vancluse NSW, AU) |
Correspondence
Address: |
HAMILTON, BROOK, SMITH & REYNOLDS, P.C.
530 VIRGINIA ROAD
P.O. BOX 9133
CONCORD
MA
01742-9133
US
|
Assignee: |
Millennium Pharmaceuticals,
Inc.
Cambridge
MA
|
Family ID: |
27113544 |
Appl. No.: |
09/870932 |
Filed: |
May 30, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09870932 |
May 30, 2001 |
|
|
|
08893911 |
Jul 11, 1997 |
|
|
|
6528625 |
|
|
|
|
08893911 |
Jul 11, 1997 |
|
|
|
08739507 |
Oct 28, 1996 |
|
|
|
Current U.S.
Class: |
530/388.2 ;
424/143.1; 435/5 |
Current CPC
Class: |
Y10S 435/81 20130101;
C07K 16/2866 20130101; Y10S 530/866 20130101; A61K 38/00
20130101 |
Class at
Publication: |
530/388.2 ;
435/5; 424/143.1 |
International
Class: |
C12Q 001/70; A61K
039/395; C07K 016/28 |
Claims
What is claimed is:
1. An antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein.
2. The antibody or antigen-binding fragment thereof of claim 1
wherein the mammalian CC-chemokine receptor 5 protein is a human
CC-chemokine receptor 5 protein.
3. The antibody or antigen-binding fragment thereof of claim 1
wherein the antibody is 5C7.
4. The antibody or antigen-binding fragment thereof of claim 1
wherein the antibody or antigen-binding fragment thereof can
compete with monoclonal antibody 5C7 for binding to a human
CC-chemokine receptor 5 protein.
5. An antibody having specificity for a mammalian CC-chemokine
receptor 5 protein, wherein the antibody inhibits binding of a
ligand to the receptor and inhibits function associated with
binding of the ligand to the receptor.
6. The antibody of claim 5 wherein the ligand is human
immunodeficiency virus.
7. An antigen-binding fragment of the antibody of claim 3.
8. A method of inhibiting the interaction of a cell bearing
mammalian CC-chemokine receptor 5 protein with a ligand thereof,
comprising contacting said cell with an effective amount of an
antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein.
9. The method of claim 8 wherein the cell is selected from the
group consisting of T cells, monocytes and cells comprising a
recombinant nucleic acid encoding CCR5 or a portion thereof.
10. The method of claim 9 wherein the T cells are selected from the
group consisting of CD8+ cells, CD4+ cells and CD45RO+ cells.
11. The method of claim 8 wherein the ligand is human
immunodeficiency virus.
12. A method of inhibiting HIV infection of a cell, comprising
contacting a cell with an effective amount of an antibody or
antigen-binding fragment thereof which binds to a mammalian
CC-chemokine receptor 5 protein.
13. The method of claim 12 wherein the cell is selected from the
group consisting of T cells, monocytes and cells comprising a
recombinant nucleic acid encoding CCR5 or a portion thereof.
14. The method of claim 13 wherein the T cells are selected from
the group consisting of CD8+ cells, CD4+ cells and CD45RO+
cells.
15. A method of treating HIV in a patient, comprising administering
to the patient an effective amount of an antibody or
antigen-binding fragment thereof which binds to a mammalian
CC-chemokine receptor 5 protein.
16. A method of detecting expression of a mammalian CC-chemokine
receptor 5 protein by a cell, comprising: a) contacting a
composition comprising a cell to be tested with an antibody or
antigen-binding fragment thereof which binds to a mammalian
CC-chemokine receptor 5 protein under conditions appropriate for
binding of said antibody or fragment thereto; and b) detecting
binding of said antibody or fragment, wherein the binding of said
antibody or fragment indicates the presence of said receptor on
said cell.
17. The method of claim 16 wherein the composition is a sample
comprising human cells.
18. The method of claim 16 wherein the antibody is 5C7.
19. A method of detecting the susceptibility of a mammal to HIV,
comprising: a) contacting a sample to be tested with an antibody or
antigen-binding fragment thereof which binds to a mammalian
CC-chemokine receptor 5 protein under conditions appropriate for
binding of said antibody or fragment thereto, wherein the sample
comprises cells which express CCR5 in normal individuals; and b)
detecting binding of said antibody or fragment, wherein the binding
of said antibody or fragment indicates the level of receptor
expressed by the cells, which correlates with the susceptibility of
the mammal to HIV.
20. The method of claim 19 wherein the composition is a sample
comprising human cells.
21. The method of claim 19 wherein the antibody is 5C7.
22. A method of determining the prognosis for an HIV-infected
mammal, comprising: a) contacting a sample from the HIV-infected
mammal to be tested with an antibody or antigen-binding fragment
thereof which binds to a mammalian CC-chemokine receptor 5 protein
under conditions appropriate for binding of said antibody or
fragment thereto, wherein the sample comprises cells which express
CCR5 in normal individuals; and b) detecting binding of said
antibody or fragment, wherein the binding of said antibody or
fragment indicates the level of receptor expressed by the cells,
which correlates with a poorer prognosis for the HIV-infected
mammal.
23. The method of claim 22 wherein the composition is a sample
comprising human cells.
24. The method of claim 22 wherein the a ntibody is 5C7.
25. A method of inhibiting HIV infection in a patient, comprising
administering to the patient an effective amount of an antibody or
antigen-binding fragment thereof which binds to a mammalian
CC-chemokine receptor 5 protein.
26. A method of inhibiting leukocyte trafficking in a patient,
comprising administering to the patient an effective amount of an
antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein.
27. The antibody or antigen-binding fragment thereof of claim 1
wherein the antibody or antigen-binding fragment thereof binds a
second extracellular loop or portion thereof of the mammalian
CC-chemokine receptor 5 protein.
28. The antibody or antigen-binding fragment thereof of claim 27
wherein the antibody is 2D7 or an antibody having an epitopic
specificity which is the same as or similar to that of 2D7.
29. The antibody or antigen-binding fragment thereof of claim 1
wherein the antibody or antigen-binding fragment thereof can
compete with monoclonal antibody 2D7 for binding to a CC-chemokine
receptor 5 protein.
30. The antibody of claim 5, wherein the ligand is a chemokine.
31. The antibody of claim 30, wherein the chemokine is selected
from the group consisting of MIP-1.alpha., MIP-1.beta., RANTES and
combinations thereof.
32. An antigen-binding fragment of the antibody of claim 28.
33. The method of claim 8 wherein the ligand is a chemokine.
34. The method of claim 33, wherein the chemokine is selected from
the group consisting of MIP-1.alpha., MIP-1.beta., RANTES and
combinations thereof.
35. The method of claim 12 wherein the antibody or antigen-binding
fragment thereof is selected from the group consisting of 5C7, 2D7,
an antigen binding fragment of 5C7, an antigen-binding fragment of
2D7, an antibody or antigen-binding fragment thereof having an
epitopic specificity which is the same as or similar to that of
5C7, an antibody or antigen-binding fragment thereof having an
epitopic specificity which is the same as or similar to that of
2D7, and combinations of the foregoing.
36. The method of claim 16 wherein the antibody or antigen-binding
fragment thereof binds a second extracellular loop or portion
thereof of the mammalian CC-chemokine receptor 5 protein.
37. The method of claim 36 wherein the antibody is one or more
antibodies selected from the group consisting of 2D7 and an
antibody having an epitopic specificity which is the same as or
similar to that of 2D7.
38. The method of claim 19 wherein the antibody or antigen-binding
fragment thereof binds a second extracellular loop or portion
thereof of the mammalian CC-chemokine receptor 5 protein.
39. The method of claim 38 wherein the antibody is one or more
antibodies selected from the group consisting of 2D7 and an
antibody having an epitopic specificity which is the same as or
similar to that of 2D7.
40. The method of claim 22 wherein the antibody binds a second
extracellular loop or portion thereof of the mammalian CC-chemokine
receptor 5 protein.
41. The method of claim 40 wherein the antibody is one or more
antibodies selected from the group consisting of 2D7 and an
antibody having an epitopic specificity which is the same as or
similar to that of 2D7.
42. The method of claim 25 wherein the antibody is selected from
the group consisting of 5C7, 2D7, an antigen-binding fragment of
5C7, an antigen-binding fragment of 2D7, an antibody or
antigen-binding fragment thereof having an epitopic specificity
which is the same as or similar to that of 5C7, an antibody or
antigen-binding fragment thereof having an epitopic specificity
which is the same as or similar to that of 2D7, and combinations of
the foregoing.
43. A method of inhibiting the interaction of a cell bearing
mammalian CC-chemokine receptor 5 protein with a chemokine,
comprising contacting said cell with an effective amount of an
antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein.
44. The method of claim 43 wherein the antibody or antigen-binding
fragment thereof is selected from 2D7, an antigen-binding fragment
of 2D7, an antibody or antigen-binding fragment thereof having an
epitopic specificity which is the same as or similar to 2D7, and
combinations of the foregoing.
45. A method of inhibiting a function associated with binding of a
chemokine to a mammalian CC-chemokine receptor 5 protein or
antigen-binding fragment thereof, comprising contacting a
composition comprising the protein with an effective amount of an
antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein.
46. The method of claim 45 wherein the antibody or antigen-binding
fragment thereof is selected from 2D7, an antigen-binding fragment
of 2D7, an antibody or antigen-binding fragment thereof having an
epitopic specificity which is the same as or similar to that of
2D7, and combinations of the foregoing.
47. The hybridoma cell line deposited under ATCC Accession No.
HB-12366.
48. The hybridoma cell line deposited under ATCC Accession No.
HB-12222.
49. A monoclonal antibody produced by the hybridoma cell line of
claim 47 or an antigen-binding fragment thereof.
50. A monoclonal antibody produced by the hybridoma cell line of
claim 48 or an antigen-binding fragment thereof.
51. A test kit for use in detecting the presence of a mammalian
CC-chemokine receptor 5 protein in a biological sample comprising
a) an antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein; and b) one or more
ancillary reagents suitable for detecting the presence of a complex
between said antibody or antigen-binding fragment thereof and said
protein.
52. The kit of claim 51, wherein the antibody or antigen-binding
fragment thereof is selected from 5C7, 2D7, an antigen-binding
fragment of 2D7, an antigen-binding fragment of 5C7, an antibody or
antigen-binding fragment thereof having an epitopic specificity
which is the same as or similar to that of 5C7, an antibody or
antigen-binding fragment thereof having an epitopic specificity
which is the same as or similar to that of 2D7, and combinations of
the foregoing.
53. A method according to claim 15, wherein the antibody is 5C7 or
2D7.
54. A method according to claim 26, wherein the antibody is 5C7 or
2D7.
55. A bispecific antibody or antigen-binding fragment thereof
having an epitopic specificity which is the same as or similar to
that of 2D7 and 5C7.
56. A bispecific antibody or antigen-binding fragment thereof which
binds a second extracellular loop or portion thereof and an amino
terminal region or portion thereof of a mammalian CC-chemokine
receptor 5 protein.
57. A method of detecting or identifying an agent which binds a
mammalian CC-chemokine receptor 5 protein or ligand binding variant
thereof, comprising combining an agent to be tested; an antibody or
antigen-binding fragment selected from the group consisting of
monoclonal antibody 2D7, an antibody having an epitopic specificity
which is the same as or similar to that of 2D7, and antigen-binding
fragments thereof; and a composition comprising a mammalian
CC-chemokine receptor 5 protein or a ligand binding variant
thereof, under conditions suitable for binding of said antibody or
antigen-binding fragment thereto, and detecting or measuring
binding of said antibody or fragment to said mammalian CC-chemokine
receptor 5 protein or ligand binding variant.
58. The method of claim 57, wherein the formation of a complex
between said antibody or fragment and said mammalian CC-chemokine
receptor 5 protein or variant is monitored, and wherein a decrease
in the amount of complex formed relative to a suitable control is
indicative that the agent binds said receptor or variant.
59. The method of claim 57, wherein the composition comprising a
mammalian CC-chemokine receptor 5 protein or a ligand binding
variant thereof is a membrane fraction of a cell bearing
recombinant CC-chemokine receptor 5 protein or ligand binding
variant thereof.
60. The method of claim 57, wherein the antibody is labeled with a
label selected from the group consisting of a radioisotope, spin
label, antigen label, enzyme label, fluorescent group and
chemiluminescent group.
61. The method of claim 57, wherein the agent is an antibody having
specificity for a CC-chemokine receptor 5 protein or
antigen-binding fragment thereof.
62. A method of detecting or identifying an agent which binds a
mammalian CC-chemokine receptor 5 protein or a ligand binding
variant thereof comprising combining an agent to be tested; an
antibody or antigen binding fragment selected from the group
consisting of monoclonal antibody 2D7, an antibody having an
epitopic specificity which is the same as or similar to that of
2D7, and antigen-binding fragments thereof; and a cell bearing a
mammalian CC-chemokine receptor 5 protein or a ligand binding
variant thereof, under conditions suitable for binding of said
antibody or antigen-binding fragment thereto, and detecting or
measuring binding of said antibody or fragment to said mammalian
CC-chemokine receptor 5 protein or variant.
63. The method of claim 62, wherein the formation of a complex
between said antibody or fragment and said mammalian CC-chemokine
receptor 5 protein or variant is monitored, and wherein a decrease
in the amount of complex formed relative to a suitable control is
indicative that the agent binds said receptor or variant.
64. The method of claim 62, wherein the antibody is labeled with a
label selected from the group consisting of a radioisotope, spin
label, antigen label, enzyme label, fluorescent group and
chemiluminescent group.
65. The method of claim 62, wherein the agent is an antibody having
specificity for a CC-chemokine receptor 5 protein or
antigen-binding fragment thereof.
66. A method of detecting a mammalian CC-chemokine receptor 5
protein, comprising: a) contacting a sample to be tested with an
antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein under conditions
appropriate for specific binding of said antibody or
antigen-binding fragment thereto; and b) detecting or measuring
binding of said antibody or antigen-binding fragment thereof,
wherein the binding of said antibody or antigen-binding fragment
thereof to material in said sample is indicative of the presence of
a mammalian CC-chemokine receptor 5 protein in said sample.
67. The method of claim 66, wherein the antibody or antigen-binding
fragment thereof is selected from the group consisting of 2D7, an
antigen-binding fragment of 2D7, and an antibody or antigen-binding
fragment thereof having an epitopic specificity which is the same
as or similar to that of 2D7.
68. The method of claim 66, wherein the sample is a cellular
fraction which comprises a mammalian CC-chemokine receptor 5
protein or portion thereof in normal individuals.
69. A method of detecting the susceptibility of a mammal to HIV,
comprising: a) contacting a sample to be tested with an antibody or
antigen-binding fragment thereof which binds to a mammalian
CC-chemokine receptor 5 protein under conditions appropriate for
binding of said antibody or antigen-binding fragment thereto; and
b) detecting or measuring binding of said antibody or
antigen-binding fragment thereof, wherein the binding of said
antibody or antigen-binding fragment thereof to material in said
sample is indicative of the level of a mammalian CC-chemokine
receptor 5 protein in said sample, which is correlated with the
susceptibility of the mammal to HIV.
70. A method of inhibiting a function associated with binding of a
chemokine to the CC-chemokine receptor 5 protein in a mammal in
need thereof, comprising administering an effective amount of an
antibody or antigen-binding fragment thereof which binds to a
mammalian CC-chemokine receptor 5 protein.
71. A method of treating a CC-chemokine receptor 5-mediated
condition in a patient, comprising administering to the patient an
effective amount of an antibody or antigen-binding fragment thereof
which binds to mammalian CC-chemokine receptor 5.
72. A method according to claim 71, wherein said CC-chemokine
receptor 5-mediated condition is arthritis.
73. A method according to claim 72, wherein said CC-chemokine
receptor 5-mediated condition is rheumatoid arthritis.
74. A method according to claim 72, wherein said CC-chemokine
receptor 5-mediated condition is juvenile rheumatoid arthritis.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part application of
copending U.S. application Ser. No. 08/893,911, filed Jul. 11,
1997, which is a continuation-in-part application of U.S.
application Ser. No. 08/739,507, filed Oct. 28, 1996. The teachings
of these prior applications are incorporated herein by reference in
their entirety.
BACKGROUND OF THE INVENTION
[0002] Over the past several years a growing family of leukocyte
chemoattractant/activating factors, termed chemokines, has been
described (Oppenheim, J. J. et al., Annu. Rev. Immunol., 9:617-648
(1991); Schall and Bacon, Curr. Opin. Immunol., 6:865-873 (1994);
Baggiolini, M., et al., Adv. Imunol., 55:97-179 (1994)). Members of
this family are produced and secreted by many cell types in
response to early inflammatory mediators such as IL-1.beta. or
TNF.alpha.. The chemokine superfamily comprises two main branches:
the .alpha.-chemokines (or CXC chemokines) and the
.beta.-chemokines (CC chemokines). The .alpha.-chemokine branch
includes proteins such as IL-8, neutrophil activating peptide-2
(NAP-2), melanoma growth stimulatory activity (MGSA/gro or
GRO.alpha.), and ENA-78, each of which have attracting and
activating effects predominantly on neutrophils. The members of the
.beta.-chemokine branch affect other cell types such as monocytes,
lymphocytes, basophils, and eosinophils (Oppenheim, J. J. et al.,
Annu. Rev. Immunol., 9:617-648 (1991); Baggiolini, M., et al., Adv.
Imunol., 55:97-179 (1994); Miller and Krangel, Crit. Rev. Immunol.,
12:17-46 (1992); Jose, P. J., et al., J. Exp. Med., 179:881-118
(1994); Ponath, P. D., et al., J. Clin. Invest., 97:604-612
(1996)), and include proteins such as monocyte chemotactic proteins
1-4 (MCP-1, MCP-2, MCP-3, and MCP-4), RANTES, and macrophage
inflammatory proteins (MIP-1.alpha., MIP-1.beta.). Recently, a new
class of membrane-bound chemokine having a CX.sub.3C motif has been
identified (Bazan, J. F. et al., Nature, 385: 640-644 (1997)).
Chemokines can mediate a range of pro-inflammatory effects on
leukocytes, such as chemotaxis, degranulation, synthesis of lipid
mediators, and integrin activation (Oppenheim, J. J. et al., Annu.
Rev. Immunol., 9:617-648 (1991); Baggiolini, M., et al., Adv.
Imunol., 55:97-179 (1994); Miller, M. D. and Krangel, M. S., Crit.
Rev. Immunol., 12:17-46 (1992)). Lately, certain .beta.-chemokines
have been shown to suppress HIV-1 infection of human T cell lines
in vitro (Cocchi, F., et al., Science (Wash. D.C.), 270:1811-1815
(1995)).
[0003] Chemokines bind to 7 transmembrane spanning (7TMS) G-protein
coupled receptors (Murphy, P. M., Annu. Rev. Immunol., 12:593-633
(1994)). The principal human CXC chemokine receptors characterized
to date include: CXCR1 (IL-8 Receptor type A (IL-8 RA)), which
binds IL-8; CXCR2 (IL-8 RB), which binds a number of CXC chemokines
including IL-8 and GRO.alpha. (Murphy, P. M. and Tiffany, H. L.,
Science (Wash. D.C.), 253:1280-3 (1991); Beckmann, M. P., et al.,
Biochem. Biophys. Res. Commun., 179:784-789 (1991); Holmes, W. E.,
et al., Science (Wash. D.C.), 253:1278-1280 (1991)); an IP-10/Mig
receptor designated CXCR3 (Loetscher et al., J. Exp. Med.
184:963-969 (1996)); and CXCR4 (also referred to as "LESTR" or
"fusin"), which binds SDF-1 (Nagasawa et al., Proc. Natl. Acad.
Sci. USA 93:14726-14729 (1996)). The known receptors for the CC or
.beta. chemokines include CCR1, which binds MIP-1.alpha. and RANTES
(Neote, K., et al., Cell, 72:415-425 (1993); Gao, J. L., J. Exp.
Med., 177:1421-1427 (1993)); CCR2, which binds MCP-1 and MCP-3
(Charo, I. F., et al., Proc. Natl. Acad. Sci. USA, 91:2752-2756
(1994); Myers, S. J., et al., J. Biol. Chem., 270:5786-5792
(1995)); CCR3, which binds chemokines including eotaxin, RANTES and
MCP-3 (Ponath, P. D., et al., J. Exp. Med., 183:2437-2448 (1996));
CCR4, which has been found to signal in response to MCP-1,
MIP-1.alpha., and RANTES (Power, C. A., et al., J. Biol. Chem.,
270:19495-19500 (1995)); and CCR5, which has been shown to signal
in response to MIP-1.alpha., MIP-1.beta. and RANTES (Boring, L., et
al., J. Biol. Chem., 271 (13):7551-7558 (1996); Raport, C. J., J.
Biol. Chem., 271:17161-17166 (1996); and Samson, M. et al.,
Biochemistry, 35:3362-3367 (1996)).
[0004] The precise expression of many of the chemokine receptors is
not yet known, because specific mAbs are not available. For T
cells, PCR or Northern blotting indicates that the known receptors
for CC chemokines are expressed on subsets of T cells. Delineating
exactly which subsets is an area of intense study, because
chemokine receptor expression may explain the localization or
migration of various cell types, such as TH1 or TH2 T cells or
tissue homing subsets. It may also determine which T cells are
infected with different strains of HIV-1. Despite the development
of over 130 CD-defined specificities on leukocytes by the .sub.5th
International Leukocyte Workshop in 1993 (Schlossman, S. F., et
al., Leukocyte Typing V, Oxford University Press, 1995), none of
these are specific for chemokine receptors, pointing to the
difficulty in making antibodies to these cell surface
receptors.
SUMMARY OF THE INVENTION
[0005] The present invention relates to an antibody
(immunoglobulin) or functional portion thereof (e.g., antigen
binding fragment) which binds to a mammalian chemokine receptor 5
protein (also referred to as CKR-5 or CCR5) or portion of the
receptor (anti-CCR5). In one embodiment, the antibody of the
present invention has specificity for human CCR5 or portion
thereof, wherein the antibody blocks binding of a ligand (e.g.,
RANTES, MIP-1.alpha., MIP-1.beta., human immunodeficiency virus
(HIV)) to the receptor and inhibits function associated with
binding of the ligand to the receptor (e.g., leukocyte
trafficking). For example, as described herein, antibodies of the
present invention having specificity for human CCR5 or a portion
thereof, can block binding of a chemokine (e.g., RANTES,
MIP-1.alpha., MIP-1.beta.) to the receptor and inhibit function
associated with binding of the chemokine to the receptor. In one
embodiment, the antibody is monoclonal antibody 5C7 or a monoclonal
antibody (mAb) which can compete with 5C7 for binding to human CCR5
or portion of human CCR5. In another embodiment, the antibody is
monoclonal antibody 2D7 or a mAb which can compete with 2D7 for
binding to human CCR5 or portion of human CCR5.
[0006] The present invention further relates to a method of
inhibiting the interaction of a cell (e.g., leukocytes, T cells
such as CD8+ cells, CD4+ cells and CD45RO+ cells, monocytes and
transfected cells) bearing mammalian (e.g., human, non-human
primate or murine) CCR5 with a ligand thereof, comprising
contacting the cell with an effective amount of an antibody or
functional portion thereof which binds to a mammalian CCR5 or
portion of CCR5.
[0007] Another embodiment of the invention relates to a method of
inhibiting the interaction of a cell bearing mammalian chemokine
receptor 5 protein with a chemokine, comprising contacting said
cell with an effective amount of an antibody or functional portion
thereof which binds to a mammalian chemokine receptor 5 protein or
portion of said receptor. In one embodiment of the method, the
antibody or functional portion thereof is any one or more of 2D7,
an antigen binding fragment of 2D7 or an antibody having an
epitopic specificity which is the same as or similar to that of
2D7. Furthermore, the invention relates to a method of inhibiting a
function associated with binding of a chemokine to the chemokine 5
receptor protein, comprising administering an effective amount of
an antibody or functional portion thereof which binds to a
mammalian chemokine receptor 5 protein or portion of said receptor.
In one aspect of the method, the antibody or functional portion
thereof is any one or more of 2D7, an antigen binding fragment of
2D7 or an antibody having an epitopic specificity which is the same
as or similar to that of 2D7.
[0008] Another aspect of the invention is a method of identifying
expression of a mammalian CCR5 or portion of the receptor by a
cell. According to the method, a composition comprising a cell or
fraction thereof (e.g., a membrane fraction) is contacted with an
antibody or functional portion thereof (e.g., 5C7 or 2D7) which
binds to a mammalian CCR5 or portion of the receptor under
conditions appropriate for binding of the antibody thereto, and the
formation of a complex between said antibody and said protein or
portion thereof is detected. Detection of the complex indicates the
presence of the receptor on the cell. The present invention also
relates to a kit for use in detecting the presence of CCR5 or a
portion thereof in a biological sample, comprising an antibody or
functional portion thereof which binds to a mammalian chemokine
receptor 5 protein or portion of said receptor, and ancillary
reagents suitable for detecting the presence of a complex between
said antibody and said protein or portion thereof.
[0009] Also encompassed by the present invention are methods of
identifying additional ligands or other substances which bind a
mammalian CCR5 protein, including inhibitors and/or promoters of
mammalian CCR5 function. For example, agents having the same or a
similar binding specificity as that of an antibody of the present
invention or functional portion thereof can be identified by a
competition assay with said antibody or portion thereof. Thus, the
present invention also encompasses methods of identifying ligands
or other substances which bind the CCR5 receptor, including
inhibitors (e.g., antagonists) or promoters (e.g., agonists) of
receptor function. In one embodiment, suitable host cells which
have been engineered to express a receptor protein or variant
encoded by a nucleic acid introduced into said cells are used in an
assay to identify and assess the efficacy of ligands, inhibitors or
promoters of receptor function. Such cells are also useful in
assessing the function of the expressed receptor protein or
polypeptide.
[0010] Thus, the invention also relates to a method of detecting or
identifying an agent which binds a mammalian chemokine receptor 5
protein or ligand binding variant thereof, comprising combining an
agent to be tested, an antibody or antigen binding fragment of the
present invention (e.g., 2D7, an antibody having an epitopic
specificity which is the same as or similar to that of 2D7, and
antigen binding fragments thereof) and a composition comprising a
mammalian chemokine receptor 5 protein or a ligand binding variant
thereof. The foregoing components can be combined under conditions
suitable for binding of the antibody or antigen binding fragment to
mammalian chemokine receptor 5 protein or a ligand binding variant
thereof, and binding of the antibody or fragment to the mammalian
chemokine receptor 5 protein or ligand binding variant is detected
or measured, either directly or indirectly, according to methods
described herein or other suitable methods. A decrease in the
amount of complex formed relative to a suitable control (e.g., in
the absence of the agent to be tested) is indicative that the agent
binds said receptor or variant. The composition comprising a
mammalian chemokine receptor 5 protein or a ligand binding variant
thereof can be a membrane fraction of a cell bearing recombinant
chemokine receptor 5 protein or ligand binding variant thereof. The
antibody or fragment thereof can be labeled with a label such as a
radioisotope, spin label, antigen label, enzyme label, fluorescent
group and chemiluminescent group. These and similar assays can be
used to detect agents, including ligands (e.g., chemokines or
strains of HIV which interact with CCR5) or other substances,
including inhibitors or promoters of receptor function, which can
bind CCR5 and compete with the antibodies described herein for
binding to the receptor.
[0011] According to the present invention, ligands, inhibitors or
promoters of receptor function can be identified in a suitable
assay, and further assessed for therapeutic effect. Inhibitors of
receptor function can be used to inhibit (reduce or prevent)
receptor activity, and ligands and/or promoters can be used to
induce (trigger or enhance) normal receptor function where
indicated. Thus, the present invention also provides a method of
treating HIV or inflammatory diseases, including autoimmune disease
and graft rejection, comprising administering an inhibitor of
receptor function to an individual (e.g., a mammal). The present
invention further provides a method of stimulating receptor
function by administering a novel ligand or promoter to an
individual, providing a new approach to selective stimulation of
leukocyte function, which is useful, for example, in the treatment
of infectious diseases and cancer.
[0012] The present invention also relates to a method of detecting
the susceptibility of a mammal to HIV. According to the method, a
sample to be tested is contacted with an antibody or functional
portion thereof which binds to a mammalian CCR5 or portion thereof,
under conditions appropriate for binding of said antibody thereto,
wherein the sample comprises cells which express CCR5 in normal
individuals. Binding of antibody is detected using a suitable
assay, and the binding of the antibody is indicative of the level
of receptor expressed by the cells, which correlates with the
susceptibility of the mammal to HIV. Thus, the method can be used
to determine the expression level of CCR5 on the T cells of a
susceptible but uninfected individual to determine the degree of
risk to such an individual upon exposure to HIV. In another
embodiment, a sample comprising a mammalian CCR5 protein, such as a
cellular fraction or liposomes comprising said protein, can be
used.
[0013] The present invention also encompasses a method of
determining the prognosis for HIV in a mammal. According to the
method, a sample to be tested is contacted with an antibody or
functional portion thereof which binds to a mammalian CCR5 or
portion thereof, under conditions appropriate for binding of said
antibody thereto, wherein the sample comprises cells which express
CCR5 in normal individuals. Binding of antibody is detected, and
binding of antibody is indicative of the level of receptor
expressed by the cells, which correlates with the prognosis for HIV
in the mammal. In another embodiment, a sample comprising a
mammalian CCR5 protein, such as a cellular fraction or liposomes
comprising said protein, can be used.
[0014] Another aspect of the invention relates to a method of
inhibiting HIV infection of a cell which expresses a mammalian CCR5
or portion thereof (e.g., monocytes, macrophages, dendritic cells
or T cells such as CD4+ cells, CD8+ cells), comprising contacting
the cell with an effective amount of an antibody or functional
portion thereof which binds to a mammalian CCR5 or portion of the
receptor.
[0015] Also encompassed by the present invention is a method of
inhibiting (e.g., treating) HIV in a patient, comprising
administering to the patient an effective amount of an antibody or
functional portion thereof which binds to a mammalian CCR5 or
portion of said receptor.
[0016] Another aspect of the invention also relates to a method of
preventing or inhibiting HIV infection in an individual, comprising
administering to the individual an effective amount of an antibody
or functional portion thereof which binds to CCR5. According to the
method, preventing HIV infection includes treatment in order to
prevent (reduce or eliminate) infection of new cells in an infected
individual or in order to prevent infection in an individual who
may be, may have been or has been exposed to HIV. For example,
individuals such as an HIV infected individual, a fetus of an HIV
infected female, or a health care worker can be treated according
to the method of the present invention.
[0017] The present invention also encompasses a method of
inhibiting leukocyte trafficking in a patient, comprising
administering to the patient an effective amount of an antibody or
functional portion thereof which binds to a mammalian CCR5 or
portion of said receptor.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 is a FACScan.RTM. profile illustrating that mab 5C7
is reactive with CCR5 transfected L1.2 cells (solid lines), but not
with L1.2 cells transfected with a variety of other chemokine
receptors (broken lines).
[0019] FIGS. 2A-2C are FACScan.RTM.V dot plots in which expression
of CCR5 on lymphocytes from a normal individual (Donor 5) (FIG.
2A), an individual heterozygous for the CCR5 deletion (Donor 3)
(FIG. 2B), and an individual homozygous for the CCR5 deletion
(Donor 1) (FIG. 2C) was monitored. Staining was performed using
PBMC, and cells were gated so that the lymphocyte population was
assessed. The X-axis represents forward light scatter (a measure of
cell size), and the Y-axis fluorescence intensity of staining for
CCR5 (using mAb 5C7, and a second step anti-mouse Ig-FITC). The
level of negative control staining is indicated by a line.
[0020] FIGS. 3A-3B illustrate the position of the CCR5 deletion and
the presence or absence of mutant CCR5 alleles in various
individuals. FIG. 3A shows the position of the CCR5 deletion, and
the sequence difference between the normal (CCR5 wild type (WT),
SEQ ID NO: 1) and mutant (CCR5 MUT, SEQ ID NO: 2) forms of CCR5.
FIG. 3B is a photograph of an agarose gel demonstrating the bands
detected in normal CCR5 individuals (Donor 5), homozygous CCR5
mutant individuals (Donors 1 and 2), and CCR5 heterozygous
individuals (Donors 3 and 4). Genomic DNA was isolated from PBMC
cells of selected blood donors. PCR reactions were carried out
using a set of 5' and 3' primers, the reaction products were run on
a 4% Nusieve GTG agarose gel and DNA bands stained by ethidium
bromide. Under these conditions, a 174 -bp band for a normal
individual, a 142 -bp band for homozygous CCR5 mutant individuals,
and both 174 -bp and 142 -bp bands for CCR5 heterozygous
individuals were detected.
[0021] FIGS. 4A-4B are FACScan.RTM. dot plots assessing expression
of CCR5 on CD4+ (FIG. 4A) and CD8+ (FIG. 4B) cells, although CCR5
was expressed preferentially on the CD8+ subset.
[0022] FIGS. 5A-5D are FACScan.RTM. dot plots assessing expression
of CCR5 on memory lymphocytes (FIGS. 5A-5B) and activated
lymphocytes (FIGS. 5C-5D). Human PBMC were stained with mAb 5C7,
followed by anti-mouse Ig-FITC, and were then stained for CD45RO
(FIG. 5A), CD45RA (FIG. 5B), CD26 (FIG. 5C), or CD25 (IL-2R) (FIG.
5D), using PE-labeled mAbs (Becton Dickinson). As indicated, CCR5
was largely absent from the IL-2 receptor (IL-2R) subset. FL1
(green fluorescence, 5C7 staining in all plots) is shown on the
X-axis, and FL2 (red fluorescence) is shown on the Y-axis. The
PE-labeled mAb used (FL2 staining) is indicated for each plot.
[0023] FIGS. 6A and 6B demonstrate that mAb 2D7 recognizes the CCR5
receptor. FIG. 6A illustrates the reactivity of mAb 2D7 with CCR5
L1.2 cells, but not with CXCR4 L1.2 cells. FIG. 6B illustrates the
results of two color staining of human PBL with 2D7 (green
fluorescence) and 12G5 (anti-CXCR4, red fluorescence). Quadrants
were set on the basis of control and single color stainings.
[0024] FIG. 7 illustrates the reactivity of CCR5-specific mAbs with
cells expressing various CCR5/CCR2b receptor chimeras or
untransfected control cells. The structures of CCR5/CCR2b chimeras
used are shown schematically on the left hand side. Regions derived
from CCR5 are shown as shaded regions, and regions derived from
CCR2b are shown as dark lines. Stable CHO cell transfectants
expressing various CCR5/CCR2b receptor chimeras were stained with
anti-CCR5 mAb 3A9, 5C7, 2D7, anti-CCR2b mAb 5A11, or anti-CXCR1 mAb
7D9. Level of staining of the transfectants by the various mAbs was
graded + to +++, or negative (neg).
[0025] FIGS. 8A-8C are histograms illustrating that mAb 2D7
inhibits ligand binding to CCR5. CCR5 L1.2 cells (FIG. 8A), THP1
cells (FIG. 8B), or CD3 blasts (FIG. 8C) were incubated with 0.1 nM
.sup.125I-labeled-MIP-1.alpha., .sup.125I-labeled-MIP-1.beta., or
.sup.125I-labeled-RANTES, in the absence (total binding; stippled
bar) or presence of either 10 .mu.g/ml of mAb 2D7 (an IgG1 isotype;
unshaded bar), mAb 3A9 (right horizontal-striped bar), control IgG1
mAb (left horizontal-striped bar), or 100 nM unlabeled chemokine
(gray shaded bar). Data are shown as the % of total binding which
is in the absence of mAb or unlabeled chemokines.
[0026] FIGS. 9A and 9B are tracings illustrating that mAb 2D7
inhibits transient increases in the concentration of intracellular
free calcium ions ([Ca.sup.2+].sub.i) in CCR5 L1.2 cells induced in
response to MIP-1.alpha., but not in response to SDF-1.alpha.. The
tracings are representative of three separate experiments. In FIG.
9A, an irrelevant mAb (MOPC-2 1) was used, and in FIG. 9B, mnAb 2D7
was used. Antibodies were used at a final concentration of 20
.mu.g/ml. MIP-1.alpha. was used at 100 nM, and SDF-1 was used at
200 nM.
[0027] FIGS. 10A-10D are graphs illustrating the inhibition of
chemotactic responses of various cell types to MIP-1.alpha.,
MIP-1.beta., or RANTES, using mAb 2D7. FIG. 10A shows CCR5 L1.2
cell chemotaxis; FIG. 10B shows blood lymphocyte chemotaxis; FIG.
10C shows blood monocyte chemotaxis; and FIG. 10D shows day 21
activated, IL-2 stimulated T cell (CD3 blast) chemotaxis. The
results are representative of at least four separate experiments.
The chemotactic indices for MIP-1.beta. treated cells (open
circles), RANTES treated cells (open squares), and MIP-1.alpha.
treated cells (open diamonds), were calculated by dividing the
number of migrated cells for a specific chemokine by the "no
chemokine" background value.
[0028] FIGS. 11A and 11B illustrate the inhibition of radiolabeled
gp120 binding and HIV-1 infection by anti-CCR5 mAbs. FIG. 11A is a
graph illustrating inhibition of radiolabeled M-tropic HIV-1 JRFL
gp120 binding to CCR5 L1.2 transfectants by mAb 2D7 or mAb 3A9.
100% of inhibition was defined as the level of inhibition achieved
in the presence of 100 nM unlabeled gp120. The percent inhibition
achieved by mAb 2D7 (open circles), mAb 3A9 (filled triangles) or
IgG1 (open squares), is shown. FIG. 11B is a bar graph illustrating
inhibition of HIV-1 infection in U87-CD4-CCR5 cells by mAb 2D7. The
infectability of U87-CD4-CCR5 cells by macrophage-tropic (ADA and
JRFL), dual-tropic (DH123) and T-tropic (HxB) HIV-1 strains, in the
absence or presence of increasing concentrations of 2D7 or an IgG1
control mAb, was determined using a virus entry assay. Infection of
the cells was measured by quantification of luciferase
activity.
[0029] FIGS. 12A-12F are graphs showing inhibition of HIV-1
infection of PBMC by various anti-CCR5 mAbs.
DETAILED DESCRIPTION OF THE INVENTION
[0030] A description of preferred embodiments of the invention
follows.
[0031] The present invention relates to an antibody (anti-CCR5)
having binding specificity for mammalian chemokine receptor 5
protein (CKR-5 or CCR5) or a portion of CCR5. In one embodiment,
the antibodies (immunoglobulins) are raised against an isolated
and/or recombinant mammalian CCR5 or portion thereof (e.g.,
peptide) or against a host cell which expresses recombinant
mammalian CCR5. In a preferred embodiment, the antibodies
specifically bind human CCR5 receptor(s) or a portion thereof, and
in a particularly preferred embodiment the antibodies have
specificity for a naturally occurring or endogenous human CCR5.
Antibodies which can inhibit one or more functions characteristic
of a mammalian CCR5, such as a binding activity (e.g., ligand,
inhibitor and/or promoter binding), a signalling activity (e.g.,
activation of a mammalian G protein, induction of a rapid and
transient increase in the concentration of cytosolic free calcium
[Ca.sup.2+]i), and/or stimulation of a cellular response (e.g.,
stimulation of chemotaxis, exocytosis or inflammatory mediator
release by leukocytes, integrin activation) are also encompassed by
the present invention, such as an antibody which can inhibit
binding of a ligand (i.e., one or more ligands) to CCR5 and/or one
or more functions mediated by CCR5 in response to a ligand. For
example, in one aspect, the antibodies can inhibit (reduce or
prevent) the interaction of receptor with a natural ligand, such as
RANTES, MIP-1.alpha. and/or MIP-1.beta.. In another aspect, a
monoclonal antibody that reacts with CCR5 can inhibit binding of
RANTES, MIP-1.alpha., MIP-1.beta. and/or HIV to mammalian CCR5
(e.g., human CCR5, non-human primate CCR5, murine CCR5). Monoclonal
antibody directed against CCR5 can inhibit functions mediated by
human CCR5, including leukocyte trafficking, HIV entry into a cell,
T cell activation, inflammatory mediator release and/or leukocyte
degranulation. Preferably, the immunoglobulins can bind CCR5 with
an affinity of at least about 1.times.10.sup.-9 M, and preferably
at least about 3.times.10.sup.-]M.
[0032] Murine monoclonal antibodies specific for CCR5 of human
origin, designated 5C7 and 2D7, were produced as described herein.
In a particular embodiment, the antibodies of the present invention
have specificity for human CCR5, and have an epitopic specificity
which is the same as or similar to that of murine 5C7 or 2D7
antibody described herein. Antibodies with an epitopic specificity
similar to that of murine 5C7 monoclonal antibody can be identified
by their ability to compete with murine 5C7 monoclonal antibody for
binding to human CCR5 (e.g., to cells bearing human CCR5, such as
transfectants bearing CCR5 (see Example 1), CD8+ cells, CD4+ cells,
CDR45RO+ cells, monocytes, dendritic cells, macrophages).
Similarly, antibodies with an epitopic specificity which is the
same as or similar to that of murine 2D7 monoclonal antibody can be
identified by their ability to compete with murine 2D7 monoclonal
antibody for binding to human CCR5. Using receptor chimeras, the
binding site of mAb 2D7 has been mapped to the second extracellular
domain of CCR5. Using these or other suitable techniques,
antibodies having an epitopic specificity which is the same as or
similar to that of an antibody of the present invention can be
identified. mAb 5C7, like mAb 3A9, has epitopic specificity for the
amino-terminus of the CCR5 receptor. mAb 2D7 has epitopic
specificity for the second extracellular loop of the CCR5 receptor.
Thus, the invention pertains to an antibody or functional portion
thereof which binds to a second extracellular loop or portion
thereof of mammalian chemokine receptor 5 protein, or which binds
to the amino-terminal region or portion thereof of mammalian
chemokine receptor 5 protein.
[0033] The invention also relates to a bispecific antibody, or
functional portion thereof, which has the same or similar epitopic
specificity as at least two of the antibodies described herein
(see, e.g., U.S. Pat. No. 5,141,736 (Iwasa et al.), U.S. Pat. Nos.
4,444,878, 5,292,668, 5,523,210 (all to Paulus et al.) and U.S.
Pat. No. 5,496,549 (Yamazaki et al.). For example, a bispecific
antibody of the present invention can have the same or similar
epitopic specificity as mAb 2D7 and 5C7, e.g., binds the second
extracellular loop, or portion thereof, and the amino terminal
region, or portion thereof, of mammalian CCR5 protein.
[0034] The present invention also pertains to the hybridoma cell
lines deposited under ATCC Accession No. HB-12222 and ATCC
Accession No. HB-12366 at the American Type Culture Collection,
10801 University Boulevard, Manassas, Va. 20110-2209 on Oct. 25,
1996 and Jun. 6, 1997, respectively, as well as to the monoclonal
antibodies produced by the hybridoma cell lines deposited under
ATCC Accession Nos. HB-12222 and HB-12366.
[0035] The antibodies of the present invention can be polyclonal or
monoclonal, and the term "antibody" is intended to encompass both
polyclonal and monoclonal antibodies. Furthermore, it is understood
that methods described herein which utilize 2D7 can also utilize
antigen binding fragments of 2D7, antibodies which have the same or
similar epitopic specificity as 2D7, and combinations thereof,
optionally in combination with antibodies having an epitopic
specificity which is not the same as or similar to 2D7; similarly,
methods described as utilizing 5C7 can also utilize antigen binding
fragments of 5C7, antibodies which have the same or similar
epitopic specificity as 5C7, and combinations thereof, optionally
in combination with antibodies having an epitopic specificity which
is not the same as or similar to 2D7. Antibodies of the present
invention can be raised against an appropriate immunogen, such as
isolated and/or recombinant mammalian CCR5 protein or portion
thereof, or synthetic molecules, such as synthetic peptides. In a
preferred embodiment, cells which express receptor, such as
transfected cells, can be used as immunogens or in a screen for
antibody which binds receptor.
[0036] The antibodies of the present invention, and fragments
thereof, are useful in therapeutic, diagnostic and research
applications as described herein. The present invention encompasses
an antibody or functional portion thereof of the present invention
(e.g., mAb 2D7 or 5C7, or antigen-binding fragments thereof) for
use in therapy (including prophylaxis) or diagnosis (e.g., of
particular diseases or conditions as described herein), and use of
such antibodies or functional portions thereof for the manufacture
of a medicament for use in treatment of diseases or conditions as
described herein.
[0037] Preparation of immunizing antigen, and polyclonal and
monoclonal antibody production can be performed as described
herein, or using other suitable techniques. A variety of methods
have been described (see e.g., Kohler et al., Nature, 256: 495-497
(1975) and Eur. J. Immunol. 6: 511-519 (1976); Milstein et al.,
Nature 266: 550-552 (1977); Koprowski et al., U.S. Pat. No.
4,172,124; Harlow, E. and D. Lane, 1988, Antibodies: A Laboratory
Manual, (Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y.);
Current Protocols In Molecular Biology, Vol. 2 (Supplement 27,
Summer '94), Ausubel, F. M. et al., Eds., (John Wiley & Sons:
New York, N.Y.), Chapter 11, (1991)). Generally, a hybridoma can be
produced by fusing a suitable immortal cell line (e.g., a myeloma
cell line such as SP2/0) with antibody producing cells. The
antibody producing cell, preferably those of the spleen or lymph
nodes, are obtained from animals immunized with the antigen of
interest. The fused cells (hybridomas) can be isolated using
selective culture conditions, and cloned by limiting dilution.
Cells which produce antibodies with the desired specificity can be
selected by a suitable assay (e.g., ELISA).
[0038] Other suitable methods of producing or isolating antibodies
of the requisite specificity can used, including, for example,
methods which select recombinant antibody from a library, or which
rely upon immunization of transgenic animals (e.g., mice) capable
of producing a full repertoire of human antibodies (see e.g.,
Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90: 2551-2555
(1993); Jakobovits et al., Nature, 362: 255-258 (1993); Lonberg et
al., U.S. Pat. No. 5,545,806; Surani et al., U.S. Pat. No.
5,545,807).
[0039] Single chain antibodies, and chimeric, humanized or
primatized (CDR-grafted) antibodies, as well as chimeric or
CDR-grafted single chain antibodies, comprising portions derived
from different species, are also encompassed by the present
invention and the term "antibody". The various portions of these
antibodies can be joined together chemically by conventional
techniques, or can be prepared as a contiguous protein using
genetic engineering techniques. For example, nucleic acids encoding
a chimeric or humanized chain can be expressed to produce a
contiguous protein. See, e.g., Cabilly et al., U.S. Pat. No.
4,816,567; Cabilly et al., European Patent No. 0,125,023 B1; Boss
et al., U.S. Pat. No.4,816,397; Boss et al., European Patent
No.0,120,694 B1; Neuberger, M. S. et al., WO 86/01533; Neuberger,
M. S. et al., European Patent No. 0,194,276 B1; Winter, U.S. Pat.
No. 5,225,539; and Winter, European Patent No. 0,239,400 B1. See
also, Newman, R. et al., BioTechnology, 10: 1455-1460 (1992),
regarding primatized antibody, and Ladner et al., U.S. Pat. No.
4,946,778 and Bird, R. E. et al., Science, 242: 423-426 (1988))
regarding single chain antibodies.
[0040] In addition, functional fragments of antibodies, including
fragments of chimeric, humanized, primatized or single chain
antibodies, can also be produced. Functional fragments of the
foregoing antibodies retain at least one binding function and/or
modulation function of the full-length antibody from which they are
derived. Preferred functional fragments retain an antigen binding
function of a corresponding full-length antibody (e.g., specificity
for a mammalian CCR5). Particularly preferred functional fragments
retain the ability to inhibit one or more functions characteristic
of a mammalian CCR5, such as a binding activity, a signalling
activity, and/or stimulation of a cellular response. For example,
in one embodiment, a functional fragment can inhibit the
interaction of CCR5 with one or more of its ligands (e.g., RANTES,
MIP-1.alpha., MIP-1.beta., HIV) and/or can inhibit one or more
receptor-mediated functions, such as leukocyte trafficking, HIV
entry into cells, T cell activation, inflammatory mediator release
and/or leukocyte degranulation.
[0041] For example, antibody fragments capable of binding to a
mammalian CCR5 receptor or portion thereof, including, but not
limited to, Fv, Fab, Fab' and F(ab').sub.2 fragments are
encompassed by the invention. Such fragments can be produced by
enzymatic cleavage or by recombinant techniques. For instance,
papain or pepsin cleavage can generate Fab or F(ab').sub.2
fragments, respectively. Antibodies can also be produced in a
variety of truncated forms using antibody genes in which one or
more stop codons has been introduced upstream of the natural stop
site. For example, a chimeric gene encoding a F(ab').sub.2 heavy
chain portion can be designed to include DNA sequences encoding the
CH.sub.1 domain and hinge region of the heavy chain.
[0042] The term "humanized immunoglobulin" as used herein refers to
an immunoglobulin comprising portions of immunoglobulins of
different origin, wherein at least one portion is of human origin.
Accordingly, the present invention relates to a humanized
immunoglobulin having binding specificity for a mammalian CCR5
(e.g., human CCR5, murine CCR5), said immunoglobulin comprising an
antigen binding region of nonhuman origin (e.g., rodent) and at
least a portion of an immunoglobulin of human origin (e.g., a human
framework region, a human constant region or portion thereof). For
example, the humanized antibody can comprise portions derived from
an immunoglobulin of nonhuman origin with the requisite
specificity, such as a mouse, and from immunoglobulin sequences of
human origin (e.g., a chimeric immunoglobulin), joined together
chemically by conventional techniques (e.g., synthetic) or prepared
as a contiguous polypeptide using genetic engineering techniques
(e.g., DNA encoding the protein portions of the chimeric antibody
can be expressed to produce a contiguous polypeptide chain).
Another example of a humanized immunoglobulin of the present
invention is an immunoglobulin containing one or more
immunoglobulin chains comprising a CDR of nonhuman origin (e.g.,
one or more CDRs derived from an antibody of nonhuman origin) and a
framework region derived from a light and/or heavy chain of human
origin (e.g., CDR-grafted antibodies with or without framework
changes). In one embodiment, the humanized immunoglobulin can
compete with murine 5C7 or 2D7 monoclonal antibody for binding to
human CCR5. In a preferred embodiment, the antigen binding region
of the humanized immunoglobulin (a) is derived from 5C7 monoclonal
antibody (e.g., as in a humanized immunoglobulin comprising CDR1,
CDR2 and CDR3 of the 5C7 light chain and CDR1, CDR2 and CDR3 of the
5C7 heavy chain) or (b) is derived from 2D7 monoclonal antibody
(e.g., as in a humanized immunoglobulin comprising CDR1, CDR2 and
CDR3 of the 2D7 light chain and CDR1, CDR2 and CDR3 of the 2D7
heavy chain). Chimeric or CDR-grafted single chain antibodies are
also encompassed by the term humanized immunoglobulin. See, e.g.,
Cabilly et al., U.S. Pat. No. 4,816,567; Cabilly et al., European
Patent No. 0,125,023 B1; Queen et al., European Patent No.
0,451,216 B1; Boss et al., U.S. Pat. No. 4,816,397; Boss et al.,
European Patent No. 0,120,694 B1; Neuberger, M. S. et al., WO
86/01533; Neuberger, M. S. et al., European Patent No. 0,194,276
B1; Winter, U.S. Pat. No. 5,225,539; Winter, European Patent No.
0,239,400 B1; Padlan, E. A. et al., European Patent Application No.
0,519,596 A1. See also, Ladner et al., U.S. Pat. No. 4,946,778;
Huston, U.S. Pat. No. 5,476,786; and Bird, R. E. et al., Science,
242: 423-426 (1988)), regarding single chain antibodies.
[0043] Such humanized immunoglobulins can be produced using
synthetic and/or recombinant nucleic acids to prepare genes (e.g.,
cDNA) encoding the desired humanized chain. For example, nucleic
acid (e.g., DNA) sequences coding for humanized variable regions
can be constructed using PCR mutagenesis methods to alter DNA
sequences encoding a human or humanized chain, such as a DNA
template from a previously humanized variable region (see e.g.,
Kanunan, M., et al., Nucl. Acids Res., 17: 5404 (1989)); Sato, K.,
et al., Cancer Research, 53: 851-856 (1993); Daugherty, B. L. et
al., Nucleic Acids Res., 19(9): 2471-2476 (1991); and Lewis, A. P.
and J. S. Crowe, Gene, 101: 297-302 (1991)). Using these or other
suitable methods, variants can also be readily produced. In one
embodiment, cloned variable regions can be mutagenized, and
sequences encoding variants with the desired specificity can be
selected (e.g., from a phage library; see e.g., Krebber et al.,
U.S. Pat. No. 5,514,548; Hoogenboom et al., WO 93/06213, published
Apr. 1, 1993)).
[0044] The present invention also pertains to the hybridoma cell
lines deposited under ATCC Accession Nos. HB-12222 and HB-12366, as
well as to the monoclonal antibodies produced by the hybridoma cell
lines deposited under ATCC Accession Nos. HB-12222 and HB-12366.
The cell lines of the present invention have uses other than for
the production of the monoclonal antibodies. For example, the cell
lines of the present invention can be fused with other cells (such
as suitably drug-marked human myeloma, mouse myeloma, human-mouse
heteromyeloma or human lymphoblastoid cells) to produce additional
hybridomas, and thus provide for the transfer of the genes encoding
the monoclonal antibodies. In addition, the cell lines can be used
as a source of nucleic acids encoding the anti-CCR5 immunoglobulin
chains, which can be isolated and expressed (e.g., upon transfer to
other cells using any suitable technique (see e.g., Cabilly et al.,
U.S. Pat. No. 4,816,567; Winter, U.S. Pat. No. 5,225,539)). For
instance, clones comprising a rearranged anti-CCR5 light or heavy
chain can be isolated (e.g., by PCR) or cDNA libraries can be
prepared from mRNA isolated from the cell lines, and cDNA clones
encoding an anti-CCR5 immunoglobulin chain can be isolated. Thus,
nucleic acids encoding the heavy and/or light chains of the
antibodies or portions thereof can be obtained and used in
accordance with recombinant DNA techniques for the production of
the specific immunoglobulin, immunoglobulin chain, or variants
thereof (e.g., humanized immunoglobulins) in a variety of host
cells or in an in vitro translation system. For example, the
nucleic acids, including cDNAs, or derivatives thereof encoding
variants such as a humanized immunoglobulin or immunoglobulin
chain, can be placed into suitable prokaryotic or eukaryotic
vectors (e.g., expression vectors) and introduced into a suitable
host cell by an appropriate method (e.g., transformation,
transfection, electroporation, infection), such that the nucleic
acid is operably linked to one or more expression control elements
(e.g., in the vector or integrated into the host cell genome). For
production, host cells can be maintained under conditions suitable
for expression (e.g., in the presence of inducer, suitable media
supplemented with appropriate salts, growth factors, antibiotic,
nutritional supplements, etc.), whereby the encoded polypeptide is
produced. If desired, the encoded protein can be recovered and/or
isolated (e.g., from the host cells, medium, milk). It will be
appreciated that the method of production encompasses expression in
a host cell of a transgenic animal (see e.g., WO 92/03918, GenPharm
International, published Mar. 19, 1992).
[0045] As described herein, antibodies of the present invention can
block (inhibit) binding of a ligand to CCR5 and/or inhibit function
associated with binding of the ligand to the CCR5. As discussed
below various methods can be used to assess inhibition of binding
of a ligand to CCR5 and/or function associated with binding of the
ligand to the receptor.
[0046] Binding Assays
[0047] As used herein "mammalian CCR5 protein" refers to naturally
occurring or endogenous mammalian CCR5 proteins and to proteins
having an amino acid sequence which is the same as that of a
naturally occurring or endogenous corresponding mammalian CCR5
protein (e.g., recombinant proteins). Accordingly, as defined
herein, the term includes mature receptor protein, polymorphic or
allelic variants, and other isoforms of a mammalian CCR5 (e.g.,
produced by alternative splicing or other cellular processes), and
modified or unmodified forms of the foregoing (e.g., glycosylated,
unglycosylated). Mammalian CCR5 proteins can be isolated and/or
recombinant proteins (including synthetically produced proteins).
Naturally occurring or endogenous mammalian CCR5 proteins include
wild type proteins such as mature CCR5, polymorphic or allelic
variants and other isoforms which occur naturally in mammals (e.g.,
humans, non-human primates). Such proteins can be recovered or
isolated from a source which naturally produces mammalian CCR5, for
example. These proteins and mammalian CCR5 proteins having the same
amino acid sequence as a naturally occurring or endogenous
corresponding mammalian CCR5, are referred to by the name of the
corresponding mammal. For example, where the corresponding mammal
is a human, the protein is designated as a human CCR5 protein
(e.g., a recombinant human CCR5 produced in a suitable host
cell).
[0048] "Functional variants" of mammalian CCR5 proteins include
functional fragments, functional mutant proteins, and/or functional
fusion proteins (e.g., produced via mutagenesis and/or recombinant
techniques). Generally, fragments or portions of mammalian CCR5
proteins include those having a deletion (i.e., one or more
deletions) of an amino acid (i.e., one or more amino acids)
relative to the mature mammalian CCR5 protein (such as N-terminal,
C-terminal or internal deletions). Fragments or portions in which
only contiguous amino acids have been deleted or in which
non-contiguous amino acids have been deleted relative to mature
mammalian CCR5 protein are also envisioned.
[0049] Generally, mutants of mammalian CCR5 proteins include
natural or artificial variants of a mammalian CCR5 protein
differing by the addition, deletion and/or substitution of one or
more contiguous or non-contiguous amino acid residues (e.g.,
receptor chimeras). Such mutations can be in a conserved region or
nonconserved region (compared to other CXC and/or CC chemokine
receptors), extracellular, cytoplasmic, or transmembrane region,
for example.
[0050] A "functional fragment or portion", "functional mutant"
and/or "functional fusion protein" of a mammalian CCR5 protein
refers to an isolated and/or recombinant protein or polypeptide
which has at least one function characteristic of a mammalian CCR5
protein as described herein, such as a binding activity, a
signalling activity and/or ability to stimulate a cellular
response. Preferred functional variants can bind a ligand (i.e.,
one or more ligands such as MIP-1.alpha., MIP-1.beta., RANTES,
HIV), and are referred to herein as "ligand binding variants".
[0051] A composition comprising an isolated and/or recombinant
mammalian CCR5 or portion thereof can be maintained under
conditions suitable for binding, the receptor is contacted with an
antibody to be tested, and binding is detected or measured. In one
embodiment, a receptor protein can be expressed in cells which
naturally express CCR5 or in cells stably or transiently
transfected with a construct comprising a nucleic acid sequence
which encodes a mammalian CCR5 or portion thereof. The cells are
maintained under conditions appropriate for expression of receptor.
The cells are contacted with an antibody under conditions suitable
for binding (e.g., in a suitable binding buffer), and binding is
detected by standard techniques. To measure binding, the extent of
binding can be determined relative to a suitable control (e.g.,
compared with background determined in the absence of antibody,
compared with binding of a second antibody (i.e., a standard),
compared with binding of antibody to untransfected cells). A
cellular fraction, such as a membrane fraction, containing receptor
or liposomes comprising receptor can be used in lieu of whole
cells.
[0052] In one embodiment, the antibody is labeled with a suitable
label (e.g., fluorescent label, isotope label, enzyme label), and
binding is determined by detection of the label. In another
embodiment, bound antibody can be detected by labeled second
antibody. Specificity of binding can be assessed by competition or
displacement, for example, using unlabeled antibody or a ligand as
competitor.
[0053] Binding inhibition assays can also be used to identify
antibodies which bind CCR5 and inhibit binding of another compound
such as a ligand (MIP-1.alpha., MIP-1.beta., RANTES). For example,
a binding assay can be conducted in which a reduction in the
binding of a ligand of CCR5 (in the absence of an antibody), as
compared to binding of the ligand in the presence of the antibody,
is detected or measured. The receptor can be contacted with the
ligand and antibody simultaneously, or one after the other, in
either order. A reduction in the extent of binding of the ligand in
the presence of the antibody, is indicative of inhibition of
binding by the antibody. For example, binding of the ligand could
be decreased or abolished.
[0054] In one embodiment, direct inhibition of the binding of a
ligand (e.g., a chemokine such as RANTES) to a mammalian CCR5 by an
antibody is monitored. For example, the ability of an antibody to
inhibit the binding of .sup.125I-labeled RANTES, .sup.125I-labeled
MIP-1.alpha. or .sup.125I-labeled MIP-1.beta. to mammalian CCR5 can
be monitored. Such an assay can be conducted using either whole
cells (e.g., T cells, or a suitable cell line containing nucleic
acid encoding a mammalian CCR5) or a membrane fraction from said
cells, for instance.
[0055] Other methods of identifying the presence of an antibody
which binds CCR5 are available, such as other suitable binding
assays, or methods which monitor events which are triggered by
receptor binding, including signalling function and/or stimulation
of a cellular response (e.g., leukocyte trafficking).
[0056] It will be understood that the inhibitory effect of
antibodies of the present invention can be assessed in a binding
inhibition assay. Competition between antibodies for receptor
binding can also be assessed in the method. Antibodies which are
identified in this manner can be further assessed to determine
whether, subsequent to binding, they act to inhibit other functions
of CCR5 and/or to assess their therapeutic utility.
[0057] Signalling Assays
[0058] The binding of a ligand or promoter, such as an agonist, to
CCR5 can result in signalling by a G protein-coupled receptor, and
the activity of G proteins is stimulated. The induction of
signalling function by a compound can be monitored using any
suitable method. Such an assay can be used to identify antibody
agonists of CCR5. The inhibitory activity of an antibody can be
determined using a ligand or promoter in the assay, and assessing
the ability of the antibody to inhibit the activity induced by
ligand or promoter.
[0059] G protein activity, such as hydrolysis of GTP to GDP, or
later signalling events triggered by receptor binding, such as
induction of rapid and transient increase in the concentration of
intracellular (cytosolic) free calcium [Ca.sup.2+].sub.i, can be
assayed by methods known in the art or other suitable methods (see
e.g., Neote, K. et al., Cell, 72: 415-425 1993); Van Riper et al.,
J. Exp. Med., 177: 851-856 (1993); Dahinden, C. A. et al., J. Exp.
Med., 179: 751-756 (1994)).
[0060] For example, the functional assay of Sledziewski et al.
using hybrid G protein coupled receptors can be used to monitor the
ability a ligand or promoter to bind receptor and activate a G
protein (Sledziewski et al., U.S. Pat. No. 5,284,746, the teachings
of which are incorporated herein by reference).
[0061] A biological response of the host cell (triggered by binding
to hybrid receptor) is monitored, detection of the response being
indicative of the presence of ligand in the test sample.
Sledziewski et al. describes a method of detecting the presence of
a ligand in a test sample, wherein the ligand is a compound which
is capable of being bound by the ligand-binding domain of a
receptor. In one embodiment of the method, yeast host cells are
transformed with a DNA construct capable of directing the
expression of a biologically active hybrid G protein-coupled
receptor (i.e., a fusion protein). The hybrid receptor comprises a
mammalian G protein-coupled receptor having at least one domain
other than the ligand-binding domain replaced with a corresponding
domain of a yeast G protein-coupled receptor, such as a STE2 gene
product. The yeast host cells containing the construct are
maintained under conditions in which the hybrid receptor is
expressed, and the cells are contacted with a test sample under
conditions suitable to permit binding of ligand to the hybrid
receptor. The assay is conducted as described and the biological
response of the host cell (triggered by binding to hybrid receptor)
is monitored, detection of the response being indicative of a
signalling function.
[0062] For instance, an assay is provided in which binding to a
hybrid receptor derived from STE2 gene product leads to induction
of the BAR1 promoter. Induction of the promoter is measured by
means of a reporter gene (.beta.-gal), which is linked to the BAR1
promoter and introduced into host cells on a second construct.
Expression of the reporter gene can be detected by an in vitro
enzyme assay on cell lysates or by the presence of blue colonies on
plates containing an indicator (X-gal) in the medium, for
example.
[0063] Such assays can be preformed in the presence of the antibody
to be assessed, and the ability of the antibody to inhibit the
activity induced by the ligand or promoter is determined using
known methods and/or methods described herein.
[0064] Chemotaxis and Assays of Cellular Stimulation
[0065] Chemotaxis assays can also be used to assess the ability of
an antibody to block binding of a ligand to mammalian CCR5 and/or
inhibit function associated with binding of the ligand to the
receptor. These assays are based on the functional migration of
cells in vitro or in vivo induced by a compound. The use of an in
vitro transendothelial chemotaxis assay is described by Springer et
al. (Springer et al., WO 94/20142, published Sep. 15, 1994, the
teachings of which are incorporated herein by reference; see also
Berman et al., Immunol. Invest. 17: 625-677 (1988)). Migration
across endothelium into collagen gels has also been described
(Kavanaugh et al., J. Immunol., 146: 4149-4156 (1991)). Stable
transfectants of mouse L1-2 pre-B cells or of other suitable host
cells capable of chemotaxis can be used (see e.g., Example 1) in
chemotaxis assays, for example.
[0066] Generally, chemotaxis assays monitor the directional
movement or migration of a suitable cell (such as a leukocyte
(e.g., lymphocyte, eosinophil, basophil)) into or through a barrier
(e.g., endothelium, a filter), toward increased levels of a
compound, from a first surface of the barrier toward an opposite
second surface. Membranes or filters provide convenient barriers,
such that the directional movement or migration of a suitable cell
into or through a filter, toward increased levels of a compound,
from a first surface of the filter toward an opposite second
surface of the filter, is monitored. In some assays, the membrane
is coated with a substance to facilitate adhesion, such as ICAM-1,
fibronectin or collagen. Such assays provide an in vitro
approximation of leukocyte "homing".
[0067] For example, one can detect or measure inhibition of the
migration of cells in a suitable container (a containing means),
from a first chamber into or through a microporous membrane into a
second chamber which contains an antibody to be tested, and which
is divided from the first chamber by the membrane. A suitable
membrane, having a suitable pore size for monitoring specific
migration in response to compound, including, for example,
nitrocellulose, polycarbonate, is selected. For example, pore sizes
of about 3-8 microns, and preferably about 5-8 microns can be used.
Pore size can be uniform on a filter or within a range of suitable
pore sizes.
[0068] To assess migration and inhibition of migration, the
distance of migration into the filter, the number of cells crossing
the filter that remain adherent to the second surface of the
filter, and/or the number of cells that accumulate in the second
chamber can be determined using standard techniques (e.g.,
microscopy). In one embodiment, the cells are labeled with a
detectable label (e.g., radioisotope, fluorescent label, antigen or
epitope label), and migration can be assessed in the presence and
absence of the antibody by determining the presence of the label
adherent to the membrane and/or present in the second chamber using
an appropriate method (e.g., by detecting radioactivity,
fluorescence, immunoassay). The extent of migration induced by an
antibody agonist can be determined relative to a suitable control
(e.g., compared to background migration determined in the absence
of the antibody, compared to the extent of migration induced by a
second compound (i.e., a standard), compared with migration of
untransfected cells induced by the antibody).
[0069] Chambers can be formed from various solids, such as plastic,
glass, polypropylene, polystyrene, etc. Membranes which are
detachable from the chambers, such as a Biocoat (Collaborative
Biomedical Products) or Transwell (Costar, Cambridge, Mass.)
culture insert, facilitate counting adherent cells.
[0070] In the container, the filter is situated so as to be in
contact with fluid containing cells in the first chamber, and the
fluid in the second chamber. Other than the antibody (test
compound) for the purpose of the assay, the fluid on either side of
the membrane is preferably the same or substantially similar. The
fluid in the chambers can comprise protein solutions (e.g., bovine
serum albumin, fetal calf serum, human serum albumin) which may act
to increase stability and inhibit nonspecific binding of cells,
and/or culture media.
[0071] In a preferred embodiment, particularly for T cells,
monocytes or cells expressing a mammalian CCR5, transendothelial
migration is monitored. Such assays are better physiological
models, because they more accurately recapitulate in vivo
conditions in which leukocytes emigrate from blood vessels toward
chemoattractants present in the tissues at sites of inflammation by
crossing the endothelial cell layer lining the vessel wall. In
addition, transendothelial assays have lower background and as a
result a higher signal to noise ratio.
[0072] In this embodiment, transmigration through an endothelial
cell layer is assessed. To prepare the cell layer, endothelial
cells can be cultured on a microporous filter or membrane,
optionally coated with a substance such as collagen, fibronectin,
or other extracellular matrix proteins, to facilitate the
attachment of endothelial cells. Preferably, endothelial cells are
cultured until a confluent monolayer is formed. A variety of
mammalian endothelial cells can are available for monolayer
formation, including for example, vein, artery or microvascular
endothelium, such as human umbilical vein endothelial cells
(Clonetics Corp, San Diego, Calif.). To assay chemotaxis in
response to a particular mammalian receptor, endothelial cells of
the same mammal are preferred; however endothelial cells from a
heterologous mammalian species or genus can also be used.
[0073] Generally, the assay is performed by detecting the
directional migration of cells into or through a membrane or
filter, in a direction toward increased levels of a compound, from
a first surface of the filter toward an opposite second surface of
the filter, wherein the filter contains an endothelial cell layer
on a first surface. Directional migration occurs from the area
adjacent to the first surface, into or through the membrane,
towards a compound situated on the opposite side of the filter. The
concentration of compound present in the area adjacent to the
second surface, is greater than that in the area adjacent to the
first surface.
[0074] In one embodiment used to test for an antibody inhibitor, a
composition comprising cells capable of migration and expressing a
mammalian CCR5 receptor can be placed in the first chamber. A
composition comprising one or more ligands or promoters capable of
inducing chemotaxis of the cells in the first chamber (having
chemoattractant function) is placed in the second chamber.
Preferably shortly before the cells are placed in the first
chamber, or simultaneously with the cells, a composition comprising
the antibody to be tested is placed, preferably, in the first
chamber. Antibodies which can bind receptor and inhibit the
induction of chemotaxis, by a ligand or promoter, of the cells
expressing a mammalian CCR5 in this assay are inhibitors of
receptor function (e.g., inhibitors of stimulatory function). A
reduction in the extent of migration induced by the ligand or
promoter in the presence of the antibody is indicative of
inhibitory activity. Separate binding studies (see above) could be
performed to determine whether inhibition is a result of binding of
the antibody to receptor or occurs via a different mechanism.
[0075] In vivo assays which monitor leukocyte infiltration of a
tissue, in response to injection of a compound (e.g., antibody) in
the tissue, are described below (see Models of Inflammation). These
models of in vivo homing measure the ability of cells to respond to
a ligand or promoter by emigration and chemotaxis to a site of
inflammation.
[0076] In addition to the methods described, the effects of an
antibody on the stimulatory function of CCR5 can be assessed by
monitoring cellular responses induced by active receptor, using
suitable host cells containing receptor.
[0077] Identification of Additional Ligands, Inhibitors and/or
Promoters of Mammalian CCR5 Function
[0078] The assays described above, which can be used to assess
binding and function of the antibodies of the present invention,
can be adapted to identify additional ligands or other substances
which bind a mammalian CCR5 protein, as well as inhibitors and/or
promoters of mammalian CCR5 function. For example, agents having
the same or a similar binding specificity as that of an antibody of
the present invention or functional portion thereof can be
identified by a competition assay with said antibody or portion
thereof. Thus, the present invention also encompasses methods of
identifying ligands of the receptor or other substances which bind
a mammalian CCR5 protein, as well as inhibitors (e.g., antagonists)
or promoters (e.g., agonists) of receptor function. In one
embodiment, cells bearing a mammalian CCR5 protein or functional
variant thereof (e.g., leukocytes or suitable host cells which have
been engineered to express a mammalian CCR5 protein or functional
variant encoded by a nucleic acid introduced into said cells) are
used in an assay to identify and assess the efficacy of ligands or
other substances which bind receptor, including inhibitors or
promoters of receptor function. Such cells are also useful in
assessing the function of the expressed receptor protein or
polypeptide.
[0079] According to the present invention, ligands and other
substances which bind receptor, inhibitors and promoters of
receptor function can be identified in a suitable assay, and
further assessed for therapeutic effect. Inhibitors of receptor
function can be used to inhibit (reduce or prevent) receptor
activity, and ligands and/or promoters can be used to induce
(trigger or enhance) normal receptor function where indicated.
Thus, the present invention provides a method of treating
inflammatory diseases, including autoimmune disease and graft
rejection, comprising administering an inhibitor of receptor
function to an individual (e.g., a mammal). The present invention
further provides a method of stimulating receptor function by
administering a novel ligand or promoter of receptor function to an
individual, providing a new approach to selective stimulation of
leukocyte function, which is useful, for example, in the treatment
of infectious diseases and cancer.
[0080] As used herein, a "ligand" of a mammalian CCR5 protein
refers to a particular class of substances which bind to a
mammalian CCR5 protein, including natural ligands and synthetic
and/or recombinant forms of natural ligands, as well as infectious
agents having a tropism for mammalian CCR5 positive cells (e.g.,
viruses such as HIV). A natural ligand of a selected mammalian
receptor is of a mammalian origin which is the same as that of the
mammalian CCR5 protein (e.g., a chemokine such as RANTES,
MIP-1.alpha., MIP-1.beta.). In a preferred embodiment, ligand
binding of a mammalian CCR5 protein occurs with high affinity.
[0081] As used herein, an "inhibitor" is a substance which inhibits
(decreases or prevents) at least one function characteristic of a
mammalian CCR5 protein (e.g., a human CXCR3), such as a binding
activity (e.g., ligand binding, promoter binding), a signalling
activity (e.g., activation of a mammalian G protein, induction of
rapid and transient increase in the concentration of cytosolic free
calcium [Ca.sup.2+].sub.i), and/or cellular response function
(e.g., stimulation of chemotaxis, exocytosis or inflammatory
mediator release by leukocytes). An inhibitor is also a substance
which inhibits HIV entry into a cell. The term inhibitor refers to
substances including antagonists which bind receptor (e.g., an
antibody, a mutant of a natural ligand, other competitive
inhibitors of ligand binding), and substances which inhibit
receptor function without binding thereto (e.g., an anti-idiotypic
antibody).
[0082] As used herein, a "promoter" is a substance which promotes
(induces, causes, enhances or increases) at least one function
characteristic of a mammalian CCR5 protein (e.g., a human CCR5),
such as a binding activity (e.g., ligand, inhibitor and/or promoter
binding), a signalling activity (e.g., activation of a mammalian G
protein, induction of rapid and transient increase in the
concentration of cytosolic free calcium [Ca.sup.2+].sub.i), and/or
a cellular response function (e.g., stimulation of chemotaxis,
exocytosis or inflammatory mediator release by leukocytes). The
term promoter refers to substances including agonists which bind
receptor (e.g., an antibody, a homolog of a natural ligand from
another species), and substances which promote receptor function
without binding thereto (e.g., by activating an associated
protein). In a preferred embodiment, the agonist is other than a
homolog of a natural ligand.
[0083] Thus, the invention also relates to a method of detecting or
identifying an agent which binds a mammalian chemokine receptor 5
protein or ligand binding variant thereof, including ligands,
inhibitors, promoters, and other substances which bind a mammalian
CCR5 receptor or functional variant. According to the method, an
agent to be tested, an antibody or antigen binding fragment of the
present invention (e.g., 2D7, an antibody having an epitopic
specificity which is the same as or similar to that of 2D7, and
antigen binding fragments thereof) and a composition comprising a
mammalian chemokine receptor 5 protein or a ligand binding variant
thereof can be combined. The foregoing components are combined
under conditions suitable for binding of the antibody or antigen
binding fragment to mammalian chemokine receptor 5 protein or a
ligand binding variant thereof, and binding of the antibody or
fragment to the mammalian chemokine receptor 5 protein or ligand
binding variant is detected or measured, either directly or
indirectly, according to methods described herein or other suitable
methods. A decrease in the amount of complex formed relative to a
suitable control (e.g., in the absence of the agent to be tested)
is indicative that the agent binds said receptor or variant. The
composition comprising a mammalian chemokine receptor 5 protein or
a ligand binding variant thereof can be a membrane fraction of a
cell bearing recombinant chemokine receptor 5 protein or ligand
binding variant thereof. The antibody or fragment thereof can be
labeled with a label such as a radioisotope, spin label, antigen
label, enzyme label, fluorescent group and chemiluminescent
group.
[0084] In one embodiment, the invention relates to a method of
detecting or identifying an agent which binds a mammalian chemokine
receptor 5 protein or a ligand binding variant thereof, comprising
combining an agent to be tested, an antibody or antigen binding
fragment of the present invention (e.g., 2D7, an antibody having an
epitopic specificity which is the same as or similar to that of
2D7, or antigen binding fragments thereof) and a cell bearing a
mammalian chemokine receptor 5 protein or a ligand binding variant
thereof. The foregoing components are combined under conditions
suitable for binding of the antibody or antigen binding fragment to
the CCR5 protein or ligand binding variant thereof, and binding of
the antibody or fragment to the mammalian chemokine receptor 5
protein or variant is detected or measured, either directly or
indirectly, by methods described herein and or other suitable
methods. A decrease in the amount of complex formed relative to a
suitable control is indicative that the agent binds the receptor or
variant. The antibody or fragment thereof can be labeled with a
label selected from the group consisting of a radioisotope, spin
label, antigen label, enzyme label, fluorescent group and
chemiluminescent group. These and similar assays can be used to
detect agents, including ligands (e.g., chemokines or strains of
HIV which interact with CCR5) or other substances, including
inhibitors or promoters of receptor function, which can bind CCR5
and compete with the antibodies described herein for binding to the
receptor.
[0085] The assays described above can be used, alone or in
combination with each other or other suitable methods, to identify
ligands or other substances which bind a mammalian CCR5 protein,
and inhibitors or promoters of a mammalian CCR5 protein or variant.
The in vitro methods of the present invention can be adapted for
high-throughput screening in which large numbers of samples are
processed (e.g., a 96-well format). Host cells expressing
recombinant mammalian CCR5 (e.g., human CCR5) at levels suitable
for high-throughput screening can be used, and thus, are
particularly valuable in the identification and/or isolation of
ligands or other substances which bind receptor, and inhibitors or
promoters of mammalian CCR5 proteins. Expression of receptor can be
monitored in a variety of ways. For instance, expression can be
monitored using antibodies of the present invention which bind
receptor or a portion thereof. Also, commercially available
antibodies can be used to detect expression of an antigen- or
epitope-tagged fusion protein comprising a receptor protein or
polypeptide (e.g., FLAG tagged receptors), and cells expressing the
desired level can be selected.
[0086] Nucleic acid encoding a mammalian CCR5 protein or functional
variant thereof can be incorporated into an expression system to
produce a receptor protein or polypeptide. An isolated and/or
recombinant mammalian CCR5 protein or variant, such as a receptor
expressed in cells stably or transiently transfected with a
construct comprising a recombinant nucleic acid encoding a
mammalian CCR5 protein or variant, or in a cell fraction containing
receptor (e.g., a membrane fraction from transfected cells,
liposomes incorporating receptor), can be used in tests for
receptor function. The receptor can be further purified if desired.
Testing of receptor function can be carried out in vitro or in
vivo.
[0087] An isolated and/or recombinant mammalian CCR5 protein or
functional variant thereof, such as a human CCR5, can be used in
the present method, in which the effect of a compound is assessed
by monitoring receptor function as described herein or using other
suitable techniques. For example, stable or transient transfectants
(e.g., baculovirus infected Sf9 cells, stable tranfectants of mouse
L1.2 pre-B cells), can be used in binding assays. Stable
transfectants of Jurkat cells or of other suitable cells capable of
chemotaxis can be used (e.g., mouse L1.2 pre-B cells) in chemotaxis
assays, for example.
[0088] According to the method of the present invention, compounds
can be individually screened or one or more compounds can be tested
simultaneously according to the methods herein. Where a mixture of
compounds is tested, the compounds selected by the processes
described can be separated (as appropriate) and identified by
suitable methods (e.g., PCR, sequencing, chromatography). The
presence of one or more compounds (e.g., a ligand, inhibitor,
promoter) in a test sample can also be determined according to
these methods.
[0089] Large combinatorial libraries of compounds (e.g., organic
compounds, recombinant or synthetic peptides, "peptoids", nucleic
acids) produced by combinatorial chemical synthesis or other
methods can be tested (see e.g., Zuckerman, R. N. et al., J. Med.
Chem., 37: 2678-2685 (1994) and references cited therein; see also,
Ohlmeyer, M. H. J. et al., Proc. Natl. Acad. Sci. USA
90:10922-10926 (1993) and DeWitt, S. H. et al., Proc. Natl. Acad.
Sci. USA 90:6909-6913 (1993), relating to tagged compounds; Rutter,
W. J. et al. U.S. Pat. No. 5,010,175; Huebner, V. D. et al., U.S.
Pat. No. 5,182,366; and Geysen, H. M., U.S. Pat. No. 4,833,092).
Where compounds selected from a combinatorial library by the
present method carry unique tags, identification of individual
compounds by chromatographic methods is possible.
[0090] In one embodiment, phage display methodology is used. For
example, a mammalian CCR5 protein or functional variant, an
antibody or functional portion thereof of the present invention,
and a phage (e.g., a phage or collection of phage such as a
library) displaying a polypeptide, can be combined under conditions
appropriate for binding of the antibody or portion thereof to the
mammalian CCR5 protein or variant (e.g., in a suitable binding
buffer). Phage which can compete with the antibody or portion
thereof and bind to the mammalian CCR5 protein or variant can be
detected or selected using standard techniques or other suitable
methods. Bound phage can be separated from receptor using a
suitable elution buffer. For example, a change in the ionic
strength or pH can lead to a release of phage. Alternatively, the
elution buffer can comprise a release component or components
designed to disrupt binding of compounds (e.g., one or more
compounds which can disrupt binding of the displayed peptide to the
receptor, such as a ligand, inhibitor, and/or promoter which
competitively inhibits binding). Optionally, the selection process
can be repeated or another selection step can be used to further
enrich for phage which bind receptor. The displayed polypeptide can
be characterized (e.g., by sequencing phage DNA). The polypeptides
identified can be produced and further tested for binding, and for
inhibitor or promoter function. Analogs of such peptides can be
produced which will have increased stability or other desirable
properties.
[0091] In one embodiment, phage expressing and displaying fusion
proteins comprising a coat protein with an N-terminal peptide
encoded by random sequence nucleic acids can be produced. Suitable
host cells expressing a mammalian CCR5 protein or variant and an
anti-CCR5 antibody or functional portion thereof, are combined with
the phage, bound phage are selected, recovered and characterized.
(See e.g., Doorbar, J. and G. Winter, J. Mol. Biol., 244: 361
(1994) discussing a phage display procedure used with a G
protein-coupled receptor).
[0092] Other sources of potential ligands or other substances which
bind to, or inhibitors and/or promoters of, mammalian CCR5 proteins
include, but are not limited to, variants of CCR5 ligands,
including naturally occurring, synthetic or recombinant variants of
MIP-1.alpha., MIP-1.beta. or RANTES, substances such as other
chemoattractants or chemokines, variants thereof, other inhibitors
and/or promoters (e.g., anti-CCR5 antibodies, antagonists,
agonists), other G protein-coupled receptor ligands, inhibitors
and/or promoters (e.g., antagonists or agonists), and soluble
portions of a mammalian CCR5 receptor, such as a suitable receptor
peptide or analog which can inhibit receptor function (see e.g.,
Murphy, R. B., WO 94/05695).
[0093] Models of Inflammation
[0094] In vivo models of inflammation are available which can be
used to assess the effects of antibodies against CCR5 in vivo as
therapeutic agents. For example, leukocyte infiltration upon
intradermal injection of an antibody reactive with mammalian CCR5
into a suitable animal, such as rabbit, rat, or guinea pig, can be
monitored (see e.g., Van Damme, J. et al., J. Exp. Med., 176: 59-65
(1992); Zachariae, C. O. C. et al., J. Exp. Med. 171: 2177-2182
(1990); Jose, P. J. et al., J. Exp. Med. 179: 881-887 (1994)). In
one embodiment, skin biopsies are assessed histologically for
infiltration of leukocytes (e.g., eosinophils, granulocytes). In
another embodiment, labeled cells (e.g., stably transfected cells
expressing a mammalian CCR5, labeled with .sup.111In for example)
capable of chemotaxis and extravasation are administered to the
animal. For example, an antibody to be assessed can be
administered, either before, simultaneously with or after ligand or
agonist is administered to the test animal. A decrease of the
extent of infiltration in the presence of antibody as compared with
the extent of infiltration in the absence of inhibitor is
indicative of inhibition.
[0095] Diagnostic and Therapeutic Applications
[0096] The antibodies of the present invention are useful in a
variety of applications, including research, diagnostic and
therapeutic applications. In one embodiment, the antibodies are
labeled with a suitable label (e.g., fluorescent label,
chemiluminescent label, isotope label, epitope or enzyme label).
For instance, they can be used to isolate and/or purify receptor or
portions thereof, and to study receptor structure (e.g.,
conformation) and function.
[0097] In addition, the various antibodies of the present invention
can be used to detect or measure the expression of receptor, for
example, on T cells (e.g., CD8+ cells, CD45RO+ cells), monocytes
and/or on cells transfected with a receptor gene. Thus, they also
have utility in applications such as cell sorting (e.g., flow
cytometry, fluorescence activated cell sorting), for diagnostic or
research purposes.
[0098] Anti-idiotypic antibodies are also provided. Anti-idiotypic
antibodies recognize antigenic determinants associated with the
antigen-binding site of another antibody. Anti-idiotypic antibodies
can be prepared a against second antibody by immunizing an animal
of the same species, and preferably of the same strain, as the
animal used to produce the second antibody. See e.g., U.S. Pat. No.
4,699,880.
[0099] In one embodiment, antibodies are raised against receptor or
a portion thereof, and these antibodies are used in turn to produce
an anti-idiotypic antibody. The anti-Id produced thereby can bind
compounds which bind receptor, such as ligands, inhibitors or
promoters of receptor function, and can be used in an immunoassay
to detect or identify or quantitate such compounds. Such an
anti-idiotypic antibody can also be an inhibitor of mammalian CCR5
receptor function, although it does not bind receptor itself.
[0100] Anti-idiotypic (i.e., Anti-Id) antibody can itself be used
to raise an anti-idiotypic antibody (i.e., Anti-anti-Id). Such an
antibody can be similar or identical in specificity to the original
immunizing antibody. In one embodiment, antibody antagonists which
block binding to receptor can be used to raise Anti-Id, and the
Anti-Id can be used to raise Anti-anti-Id, which can have a
specificity which is similar or identical to that of the antibody
antagonist. These anti-anti-Id antibodies can be assessed for their
effects on receptor function.
[0101] Single chain, and chimeric, humanized or primatized
(CDR-grafted), as well as chimeric or CDR-grafted single chain
anti-idiotypic antibodies can be prepared, and are encompassed by
the term anti-idiotypic antibody. Antibody fragments of such
antibodies can also be prepared.
[0102] mAb antagonists of CCR5 can be used as therapeutics for
AIDS, as well as certain inflammatory diseases. HIV-1 and HIV-2 are
the etiologic agents of acquired immunodeficiency syndrome (AIDS)
in humans. AIDS results in part from the depletion of CD4+ T
lymphocytes in HIV infected individuals. HIV-1 infects primarily T
lymphocytes, monocytes/macrophages, dendritic cells and, in the
central nervous system, microglia. All of these cells express the
CD4 glycoprotein, which serves as a receptor for HIV-1 and HIV-2.
Efficient entry of HIV into target cells is dependent upon binding
of the viral exterior envelope glycoprotein, gp120, to the
amino-terminal CD4 domain. After virus binding, the HIV-1 envelope
glycoproteins mediate the fusion of viral and host cell membranes
to complete the entry process. Membrane fusion directed by HIV-1
envelope glycoproteins expressed on the infected cell surface leads
to cell-cell fusion, resulting in syncytia.
[0103] Recently, host cell factors in addition to CD4 have been
suggested to determine the efficiency of HIV-1 envelope
glycoprotein-mediated membrane fusion. The 7 transmembrane receptor
(7TMR) termed H-UMSTSR, LESTR, or "fusin" has been shown to allow a
range of CD4-expressing cells to support infection and cell fusion
mediated by laboratory-adapted HIV-1 envelope glycoproteins (Feng,
Y., et al., Science (Wash. D.C.), 272:872-877 (1996)). Antibodies
to HUMSTSR blocked cell fusion and infection by laboratory-adapted
HIV-1 isolates but not by macrophage-tropic primary viruses in
vitro (Feng, Y., et al, Science (Wash. D.C.), 272:872-877
(1996)).
[0104] It has been observed that infection of macrophage-tropic
primary HIV-1 isolates, but not that of a laboratory-adapted
isolate, could be inhibited by the .beta.-chemokines RANTES,
MIP-1.alpha. and MIP-1.beta. (Cocchi, F., et al, Science (Wash.
D.C.), 270:1811-1815 (1995)). High endogenous expression of these
.beta.-chemokines has also been suggested to account for the in
vitro resistance to HIV-1 infection of CD4+ T cells from uninfected
individuals with multiple sexual exposures to seropositive partners
(Paxton, W. A., et al., Nat. Med., 2:412-417 (1996)). This
resistance was only seen for macrophage-tropic and not T cell
line-tropic viruses and was influenced by the structure of the
third variable (V3) gp120 region of the infecting virus. The
available data suggested that at least one other host cell surface
molecule besides CD4 and distinct from HllMSTSR facilitates the
entry of primary, macrophage tropic HIV-1 isolates, and that this
molecule might be influenced by interaction with
.beta.-chemokines.
[0105] The ability of chemokine receptors and related molecules to
facilitate the infection of primary clinical HIV-1 isolates has
been reported recently by five separate groups (see e.g., Bates,
P., Cell, 86:1-3 (1996); Choe, H., et al., Cell, 85:1135-1148
(1996)). CCR5, when expressed along with CD4, allowed cell lines
resistant to most primary HIV-1 isolates to be infected.
Utilization of CCR5 on the target cell depended upon the sequence
of the third variable (V3) region of the HIV-1 gp120 exterior
envelope glycoprotein. These studies indicated that involvement of
various members of the chemokine receptor family in the early
stages of HIV-1 infection helps to explain viral tropism and
.beta.-chemokine inhibition of primary HIV-1 isolates. CCR5 is the
principal co-receptor for primary macrophage-tropic HIV-1 strains
(Choe et al., Cell 85:1135-1148 (1996); Alkhatib et al., Science
272:1955-1958 (1996); Doranz et al., Cell 85:1149-1158 (1996); Deng
et al., Nature 381:661-666 (1996); Dragic et al., Nature
381:667-673 (1996)), while CXCR4 supports infection of CD4.sup.+
cells by laboratory-adapted, T tropic HIV-1 strains (Feng et al.,
Science 272:872-877 (1996)). Recent studies have shown that the
envelope glycoprotein gp120 of M-tropic HIV-1, upon binding to CD4,
interacts specifically with the second co-receptor, CCR5 (Wu et
al., Nature 384:179-183(1996)).
[0106] There is evidence that at least some of the long term
survivors of HIV-1 infection have defects in CCR5 expression. The
significance of CCR5 for HIV-1 infection is suggested from recent
studies involving long term survivors who have been multiply
exposed to HIV-1 (Liu et al., Cell 86:367-377 (1996); Samson et
al., Nature 382:722-725 (1996); Dean et al., Science 273:1856-1862
(1996); Huang et al., Nature Med. 2:1240-1243 (1996)). This
resistance results from a defective CCR5 allele that contains an
internal 32 base pair deletion (CCR5 .DELTA.32). CCR5 .DELTA.32
homozygous individuals comprise approximately 1% of the Caucasian
population, and heterozygous individuals comprise approximately 15%
(Liu et al., Nature 384:179-183 (1996); Samson et al., Nature
382:722-725 (1996); Dean et al., Science 273:1856-1862 (1996);
Huang et al., Nature Med. 2:1240-1243 (1996)). To date, no
immunological defects have been noted in either the CCR5 .DELTA.32
homozygous individuals, or in heterozygous individuals. Moreover,
CD4+ T cells from these individuals were found to be highly
resistant in vitro to the entry of primary macrophage-tropic virus
(Liu et al., Cell 86:367-377 (1996); Paxton et al., Nature Med.
2:412-417 (1996)).
[0107] The present invention also provides a method of inhibiting
HIV infection of a cell (e.g., new infection and/or syncytium
formation) which expresses a mammalian CCR5 or portion thereof,
comprising contacting the cell with an effective amount of an
antibody or functional portion thereof which binds to a mammalian
CCR5 or portion of said receptor.
[0108] Various methods can be used to assess binding of HIV to a
cell and/or infection of a cell by HIV in the presence of the
antibodies of the present invention. For example, assays which
assess binding of gp120 or a portion thereof to the receptor, HIV
infection and syncytium formation can be used (see, for example,
Choe, H., et al., Cell, 85:1135-1148 (1996)). The ability of the
antibody of the present invention to inhibit these processes can be
assessed using these or other suitable methods.
[0109] In addition, the present invention provides a method of
treating HIV in a patient, comprising administering to the patient
an effective amount of an antibody or functional portion thereof
which binds to a mammalian CCR5 or portion of said receptor.
Therapeutic use of antibody to treat HIV includes prophylactic use
(e.g., for treatment of a patient who may be or who may have been
exposed to HIV). For example, health care providers who may be
exposed or who have been exposed to HIV (e.g., by needle-stick) can
be treated according to the method. Another example is the
treatment of a patient exposed to virus after unprotected sexual
contact or failure of protection.
[0110] In AIDS, multiple drug treatment appears the most promising.
An anti-chemokine receptor antagonist that inhibits HIV infection
can be added to the drug treatment regimen, in particular by
blocking virus infection of new cells. Thus, administration of an
antibody or fragment of the present administration in combination
with one or more other therapeutic agents such as nucleoside
analogues (e.g., AZT, 3TC, ddI) and/or protease inhibitors is
envisioned, and provides an important addition to an HIV treatment
regimen. In one embodiment, a humanized anti-CCR5 mAb is used in
combination with a (i.e., one or more) therapeutic agent to reduce
viral load from patients, by preventing fusion and/or infection of
new cells. Such an antibody can also be useful in preventing
perinatal infection.
[0111] The anti-CCR5 antibodies of the present invention also have
value in diagnostic applications. An anti-CCR5 antibody can be used
to monitor expression of this receptor in HIV infected individuals,
similar to the way anti-CD4 has been used as a diagnostic indicator
of disease stage. Expression of CCR5 has a correlation with disease
progression, and can be used to identify low or high risk
individuals for AIDS susceptibility.
[0112] For diagnostic purposes, the antibodies or antigen binding
fragments can be labeled or unlabeled. Typically, diagnostic assays
entail detecting the formation of a complex resulting from the
binding of an antibody or fragment to CCR5. The antibodies or
fragments can be directly labeled. A variety of labels can be
employed, including, but not limited to, radionuclides,
fluorescers, enzymes, enzyme substrates, enzyme cofactors, enzyme
inhibitors and ligands (e.g., biotin, haptens). Numerous
appropriate immunoassays are known to the skilled artisan (see, for
example, U.S. Pat. Nos. 3,817,827; 3,850,752; 3,901,654 and
4,098,876). When unlabeled, the antibodies or fragments can be used
in agglutination assays, for example. Unlabeled antibodies or
fragments can also be used in combination with another (i.e., one
or more) suitable reagent which can be used to detect antibody,
such as a labeled antibody (e.g., a second antibody) reactive with
the first antibody (e.g., anti-idiotype antibodies or other
antibodies that are specific for the unlabeled immunoglobulin) or
other suitable reagent (e.g., labeled protein A).
[0113] In one embodiment, the antibodies of the present invention
can be utilized in enzyme immunoassays, wherein the subject
antibodies, or second antibodies, are conjugated to an enzyme. When
a biological sample comprising a mammalian CCR5 protein is combined
with the subject antibodies, binding occurs between the antibodies
and CCR5 protein. In one embodiment, a sample containing cells
expressing a mammalian CCR5 protein, such as human blood, is
combined with the subject antibodies, and binding occurs between
the antibodies and cells bearing a human CCR5 protein comprising an
epitope recognized by the antibody. These bound cells can be
separated from unbound reagents and the presence of the
antibody-enzyme conjugate specifically bound to the cells can be
determined, for example, by contacting the sample with a substrate
of the enzyme which produces a color or other detectable change
when acted on by the enzyme. In another embodiment, the subject
antibodies can be unlabeled, and a second, labeled antibody can be
added which recognizes the subject antibody.
[0114] Kits for use in detecting the presence of a mammalian CCR5
protein in a biological sample can also be prepared. Such kits will
include an antibody or functional portion thereof which binds to a
mammalian chemokine receptor 5 protein or portion of said receptor,
as well as one or more ancillary reagents suitable for detecting
the presence of a complex between the antibody or fragment and CCR5
or portion thereof. The antibody compositions of the present
invention can be provided in lyophilized form, either alone or in
combination with additional antibodies specific for other epitopes.
The antibodies, which can be labeled or unlabeled, can be included
in the kits with adjunct ingredients (e.g., buffers, such as Tris,
phosphate and carbonate, stabilizers, excipients, biocides and/or
inert proteins, e.g., bovine serum albumin). For example, the
antibodies can be provided as a lyophilized mixture with the
adjunct ingredients, or the adjunct ingredients can be separately
provided for combination by the user. Generally these adjunct
materials will be present in less than about 5% weight based on the
amount of active antibody, and usually will be present in a total
amount of at least about 0.001% weight based on antibody
concentration. Where a second antibody capable of binding to the
monoclonal antibody is employed, such antibody can be provided in
the kit, for instance in a separate vial or container. The second
antibody, if present, is typically labeled, and can be formulated
in an analogous manner with the antibody formulations described
above.
[0115] Similarly, the present invention also relates to a method of
detecting and/or quantitating expression of a mammalian CCR5 or
portion of the receptor by a cell, in which a composition
comprising a cell or fraction thereof (e.g., membrane fraction) is
contacted with an antibody or functional portion thereof (e.g.,
5C7) which binds to a mammalian CCR5 or portion of the receptor
under conditions appropriate for binding of the antibody thereto,
and antibody binding is monitored. Detection of the antibody,
indicative of the formation of a complex between antibody and CCR5
or a portion thereof, indicates the presence of the receptor.
Binding of antibody to the cell can be determined as described
above under the heading "Binding Assays", for example. The method
can be used to detect expression of CCR5 on cells from an
individual (e.g., in a sample, such as a body fluid, such as blood,
saliva or other suitable sample). A quantitative expression of CCR5
on the surface of T cells or monocytes can be evaluated, for
instance, by flow cytometry, and the staining intensity can be
correlated with disease susceptibility, progression or risk.
[0116] The present invention also relates to a method of detecting
the susceptibility of a mammal to infectious agent having a tropism
for CCR5 positive cells (e.g., viruses such as HIV). That is, the
method can be used to detect the susceptibility of a mammal to
diseases which progress based on the amount of CCR5 present on
cells and/or the number of CCR5 positive cells in a mammal. In one
embodiment the invention relates to a method of detecting
susceptibility of a mammal to HIV. In this embodiment, a sample to
be tested is contacted with an antibody or functional portion
thereof which binds to a mammalian CCR5 or portion thereof under
conditions appropriate for binding of said antibody thereto,
wherein the sample comprises cells which express CCR5 in normal
individuals. The binding of antibody and/or amount of binding is
detected, which indicates the susceptibility of the mammal to HIV,
wherein higher levels of receptor correlate with increased
susceptibility of the mammal to HIV. Thus, the method can be used
to determine the expression level of CCR5 on the T cells of a
susceptible but uninfected individual to determine the degree of
risk to such an individual upon exposure to HIV. As discussed
above, expression of CCR5 has a correlation with HIV disease
progression. The antibodies of the present invention can also be
used to further elucidate the correlation of CCR5 expression or of
particular allelic forms of CCR5 with HIV disease progression in a
mammal.
[0117] The present invention also encompasses a method of
determining the prognosis for HIV in a mammal. According to the
method, a sample to be tested is contacted with an antibody or
functional portion thereof which binds to a mammalian CCR5 or
portion thereof under conditions appropriate for binding of said
antibody thereto, wherein the sample comprises cells which express
CCR5 in normal individuals. The binding of antibody and/or amount
of binding is detected, which indicates the prognosis for HIV in
the mammal, wherein higher levels correlate with a poorer
prognosis. Thus, the method can be used to monitor the course of
HIV infection in a patient (e.g., by monitoring reduction of CCR5+,
CD4+ cells over time). For example, the method can be used to
estimate the appearance of full blown AIDS in a patient and/or
determine the timing for appropriate treatment based on the disease
progression.
[0118] Another aspect of the invention relates to a method of
preventing HIV infection in an individual, comprising administering
to the individual an effective amount of an antibody or functional
portion thereof which binds to CCR5. According to the method,
preventing HIV infection includes treatment in order to prevent
(reduce or eliminate) infection of new cells in an infected
individual or in order to prevent infection in an individual who
may be, may have been, or has been, exposed to HIV. For example,
individuals such as an H1V infected individual, a fetus of an HIV
infected female, or a health care worker may be treated according
to the method of the present invention.
[0119] Apart from their new found role in HIV infection, chemokine
receptors function in the migration of leukocytes throughout the
body, particularly to inflammatory sites. Inflammatory cell
emigration from the vasculature is regulated by a three-step
process involving interactions of leukocyte and endothelial cell
adhesion proteins and cell specific chemoattractants and activating
factors (Springer, T. A., Cell, 76:301-314 (1994); Butcher, E. C.,
Cell, 67:1033-1036 (1991); Butcher, E. C. and Picker, L. J.,
Science (Wash. D.C.), 272:60-66 (1996)). These are: (a) a low
affinity interaction between leukocyte selectins and endothelial
cell carbohydrates; (b) a high-affinity interaction between
leukocyte chemoattractant receptors and chemoattractant/activating
factors; and (c) a tight-binding between leukocyte integrins and
endothelial cell adhesion proteins of the immunoglobulin
superfamily. Different leukocyte subsets express different
repertoires of selecting, chemoattractant receptors and integrins.
Additionally, inflammation alters the expression of endothelial
adhesion proteins and the expression of chemoattractant and
leukocyte activating factors. As a consequence, there is a great
deal of diversity for regulating the selectivity of leukocyte
recruitment to extravascular sites. The second step is crucial in
that the activation of the leukocyte chemoattractant receptors is
thought to cause the transition from the selectin-mediated cell
rolling to the integrin-mediated tight binding. This results in the
leukocyte being ready to transmigrate to perivascular sites. The
chemoattractant/chemoattractant receptor interaction is also
crucial for transendothelial migration and localization within a
tissue (Campbell, J. J., et al., J. Cell Biol., 134:255-266 (1996);
Carr, M. W., et al., Immunity, 4:179-187 (1996)). This migration is
directed by a concentration gradient of chemoattractant leading
towards the inflammatory focus.
[0120] The importance of chemokines in leukocyte trafficking has
been demonstrated in several animal models. For example,
neutralizing antibodies to IL-8 inhibit neutrophil recruitment to
sites of inflammation such as in endotoxin-induced pleurisy and
reperfusion injury (Broaddus, V. C., et al., J. Immunol.,
152:2960-2967 (1994); Mulligan, M. S., et al., J. Immunol.,
150:5585-5595 (1993); Sekido, N., et al., Nature (Lond.),
365:654-657 (1993)). Neutrophil recruitment is also impaired in
IL-8 receptor knockout mice (Cacalano, G., et al., Science (Wash.,
D.C.), 265:682-684 (1994)). MIP-1.alpha. knockout mice were shown
to have reduced inflammatory responses to viral infection (Cook, D.
N., et al., Science (Wash., D.C.), 269:1583-1585 (1995)) as
demonstrated by a delay in T cell dependent viral clearance of
influenza, and elimination of coxsackie virus mediated myocarditis.
Furthermore, neutralizing antibodies to MIP-1.alpha. were reported
to influence eosinophil recruitment into mouse lung in a model of
antigen-specific airway inflammation (Lukacs, N. W., et al., Eur.
J. Immunol., 25:245-251 (1995)). Finally, antibodies to MCP-1 were
able to block monocyte recruitment in a granuloma model (Flory, C.
M., et al., Lab. Invest., 69:396-404 (1993)) and to completely
inhibit T cell recruitment and cutaneous delayed-type
hypersensitivity-induced inflammation in rats (Rand, M. L., et al.,
Am. J. Path., 148:855-864 (1995)).
[0121] CCR5 has an important role in leukocyte trafficking, apart
from its role in HIV infection. It is likely that CCR5 is a key
chemokine receptor for T cell or T cell subset migration to certain
inflammatory sites, and so anti-CCR5 mAbs can be used to inhibit
(reduce or prevent) T cell migration, particularly that associated
with T cell dysfunction, such as autoimmune disease, or allergic
reactions. Accordingly, the antibodies of the present invention can
also be used to modulate receptor function in research and
therapeutic applications. For instance, the antibodies described
herein can act as inhibitors to inhibit (reduce or prevent) (a)
binding (e.g., of a ligand, an inhibitor or a promoter) to the
receptor, (b) a receptor signalling function, and/or (c) a
stimulatory function. Antibodies which act as inhibitors of
receptor function can block ligand or promoter binding directly or
indirectly (e.g., by causing a conformational change). For example,
antibodies can inhibit receptor function by inhibiting binding of a
ligand, or by desensitization (with or without inhibition of
binding of a ligand). Antibodies which bind receptor can also act
as agonists of receptor function, triggering or stimulating a
receptor function, such as a signalling and/or a stimulatory
function of a receptor (e.g., leukocyte trafficking) upon binding
to receptor. Thus, the present invention provides a method of
inhibiting leukocyte trafficking in a mammal (e.g., a human
patient), comprising administering to the mammal an effective
amount of an antibody or functional portion thereof which binds to
a mammalian CCR5 or portion of said receptor. Diseases which can be
treated according to the method include autoimmune diseases such as
multiple sclerosis, arthritis, and psoriasis, as well as allergic
diseases, such as asthma. Administration of an antibody which binds
CCR5 can result in amelioration or elimination of the disease
state.
[0122] The antibody of the present invention, or a functional
portion thereof, can also be used to treat disorders in which
activation of the CCR5 receptor by binding of chemokines is
implicated. For example, the antibodies or functional portions
thereof (e.g., 2D7) can be used to treat allergy, atherogenesis,
anaphylaxis, malignancy, chronic and acute inflammation, histamine
and IgE-mediated allergic reactions, shock and rheumatoid
arthritis.
[0123] Diseases or conditions of humans or other species which can
be treated with inhibitors of CCR5 receptor function (including
antibodies or portions thereof), include, but are not limited
to:
[0124] inflammatory or allergic diseases and conditions, including
respiratory allergic diseases such as asthma, allergic rhinitis,
hypersensitivity lung diseases, hypersensitivity pneumonitis,
interstitial lung diseases (ILD) (e.g., idiopathic pulmonary
fibrosis, or ILD associated with rheumatoid arthritis, systemic
lupus erythematosus, ankylosing spondylitis, systemic sclerosis,
Sjogren's syndrome, polymyositis or dermatomyositis); systemic
anaphylaxis or hypersensitivity responses, drug allergies (e.g., to
penicillin, cephalosporins), insect sting allergies; inflammatory
bowel diseases, such as Crohn's disease and ulcerative colitis;
spondyloarthropathies; scleroderma; psoriasis and inflammatory
dermatoses such as dermatitis, eczema, atopic dermatitis, allergic
contact dermatitis, urticaria; vasculitis (e.g., necrotizing,
cutaneous, and hypersensitivity vasculitis);
[0125] autoimmune diseases, such as arthritis (e.g., rheumatoid
arthritis, juvenile rheumatoid arthritis, psoriatic arthritis),
multiple sclerosis, systemic lupus erythematosus, myasthenia
gravis, juvenile onset diabetes, nephritides such as
glomerulonephritis, autoimmune thyroiditis, Behcet's disease;
[0126] graft rejection (e.g., in transplantation), including
allograft rejection or graft-versus-host disease;
[0127] cancers with leukocyte infiltration of the skin or
organs;
[0128] other diseases or conditions (including CCR5-mediated
diseases or conditions), in which undesirable inflammatory
responses are to be inhibited can be treated, including, but not
limited to, reperfusion injury, atherosclerosis, certain
hematologic malignancies, cytokine-induced toxicity (e.g., septic
shock, endotoxic shock), polymyositis, dermatomyositis.
[0129] Diseases or conditions of humans or other species which can
be treated with promoters of CCR5 receptor function (including
antibodies or portions thereof), include, but are not limited
to:
[0130] immunosuppression, such as that in individuals with
immunodeficiency syndromes such as AIDS, individuals undergoing
radiation therapy, chemotherapy, therapy for autoimmune disease or
other drug therapy (e.g., corticosteroid therapy), which causes
immunosuppression; and immunosuppression due congenital deficiency
in receptor function or other causes. Anti-CCR5 antibodies of the
present invention can block the binding of one or more chemokines,
thereby blocking the downstream cascade of one or more events
leading to the above disorders.
[0131] Modes of Administration
[0132] According to the method, one or more antibodies can be
administered to the host by an appropriate route, either alone or
in combination with (before, simultaneous with, or after) another
drug. For example, the antibodies of the present invention can also
be used in combination with other monoclonal or polyclonal
antibodies or with existing blood plasma products, such as
commercially available gamma globulin and immune globulin products
used in prophylactic or therapeutic treatments. The antibodies of
the present invention can be used as separately administered
compositions given in conjunction with antibiotics and/or
antimicrobial agents.
[0133] An effective amount of an antibody (i.e., one or more
antibodies or fragments) is administered. An effective amount is an
amount sufficient to achieve the desired therapeutic effect, under
the conditions of administration, such as an amount sufficient for
inhibition of a CCR5 function, and thereby, inhibition of an
inflammatory response or HIV infection, or an amount sufficient for
promotion of a CCR5 function.
[0134] A variety of routes of administration are possible
including, but not necessarily limited to, oral, dietary, topical,
parenteral (e.g., intravenous, intraarterial, intramuscular,
subcutaneous injection), inhalation (e.g., intrabronchial,
intranasal or oral inhalation, intranasal drops), depending on the
disease or condition to be treated. Other suitable methods of
administration can also include rechargeable or biodegradable
devices and slow release polymeric devices. The pharmaceutical
compositions of this invention can also be administered as part of
a combinatorial therapy with other agents.
[0135] Formulation of an antibody or fragment to be administered
will vary according to the route of administration selected (e.g.,
solution, emulsion, capsule). An appropriate pharmaceutical
composition comprising an antibody or functional portion thereof to
be administered can be prepared in a physiologically acceptable
vehicle or carrier. A mixture of antibodies and/or fragments can
also be used. For solutions or emulsions, suitable carriers
include, for example, aqueous or alcoholic/aqueous solutions,
emulsions or suspensions, including saline and buffered media.
Parenteral vehicles can include sodium chloride solution, Ringer's
dextrose, dextrose and sodium chloride, lactated Ringer's or fixed
oils. A variety of appropriate aqueous carriers are known to the
skilled artisan, including water, buffered water, buffered saline,
polyols (e.g., glycerol, propylene glycol, liquid polyethylene
glycol), dextrose solution and glycine. Intravenous vehicles can
include various additives, preservatives, or fluid, nutrient or
electrolyte replenishers (See, generally, Remington's
Pharmaceutical Science, 16th Edition, Mack, Ed. 1980). The
compositions can optionally contain pharmaceutically acceptable
auxiliary substances as required to approximate physiological
conditions such as pH adjusting and buffering agents and toxicity
adjusting agents, for example, sodium acetate, sodium chloride,
potassium chloride, calcium chloride and sodium lactate. The
antibodies of this invention can be lyophilized for storage and
reconstituted in a suitable carrier prior to use according to
art-known lyophilization and reconstitution techniques. The optimum
concentration of the active ingredient(s) in the chosen medium can
be determined empirically, according to procedures well known to
the skilled artisan, and will depend on the ultimate pharmaceutical
formulation desired. For inhalation, the compound can be
solubilized and loaded into a suitable dispenser for administration
(e.g., an atomizer, nebulizer or pressurized aerosol
dispenser).
EXAMPLES
[0136] The present invention will now be illustrated by the
following Examples, which are not intended to be limiting in any
way. The teachings of all references cited herein are incorporated
herein by reference.
Example 1
[0137] Generation and Edentification of mAb to CCR5
[0138] Cells, Cell Lines, and Tissue Culture
[0139] Eosinophils were isolated from heparinized blood using CD 16
microbeads (Miltenyi Biotec, Auburn, Calif.), as described in
Ponath, P. D., et al., J. Clin. Invest., 97:604-612 (1996) and were
shown cytologically to be >99% pure. Neutrophils and PBMCs were
isolated as described in Ponath, P. D., et al., J. Clin. Invest.,
97:604-612 (1996). To generate CD3 blasts, 2.times.10.sup.6 PBMC/ml
in RPMI-1640 plus 10% FCS were added to tissue culture plates first
coated with the anti-CD3 antibody TR66. After 4-6 days blasts were
removed to fresh media and supplemented with IL-2 (provided by
Antonio Lanzavecchia, Basel) at 50 units/ml. Other cell lines used
included transfectants of the L1.2 murine pre B cell lymphoma,
expressing high levels of either CCR3 (Ponath, P. D., et al, J.
Exp. Med., 183:2437-2448 (1996)), IL-8 RA (CXCR1) (Ponath, P. D.,
et al., J. Exp. Med., 183:2437-2448 (1996)), IL-8 RB (CXCR2)
(Ponath, P. D., et al., J. Exp. Med., 183:2437-2448 (1996)), CCR2b,
CCR4 and CCR5, and CCR1 (Campbell, J. J., et al., J. Cell Biol.,
134:255-266 (1996)). Transfectants were maintained in RPMI-1640
supplemented with 10% bovine serum and 800 .mu.g/ml G418 or
mycophenolic acid. The different transfectants were monitored for
expression of the relevant receptors, using mAbs specific for CCR3
(Ponath, P. D., et al., J. Exp. Med., 183:2437-2448 (1996)), IL-8
RA, IL-8 RB, or CCR2 (Qin, S., et al., Eur. J. Immunol. 26:640-647
(1996); (Ponath, P. D., et al., J. Clin. Invest., 97:604-612
(1996)).
[0140] The CCR5 transfectant cells were maintained in selective
medium. When needed, they were grown in non-selective medium for at
least 24 hours before the experiment, and receptor expression was
not lost when kept in non-selective medium for up to 1 week.
[0141] Expression Vector Construction and Generation of CCR5 Stable
Transfectants
[0142] CCR5 cDNA (Raport, C. J., J. Biol. Chem., 271:17161-17166
(1996)) was obtained by RT-PCR using a 5'-oligonucleotide primer 5'
(CCCCTCGAGATGGACTACAAGGACGACGATGACAAGGATTATCAAGTGT CAAGTCC) (SEQ ID
NO: 3) and 3'-oligonucleotide primer 5'
(CCCTCTAGATTACAAGCCCACAGATATTTCCTGCTC- CCC (SEQ ID NO: 4) which
contained flanking XhoI and XbaI sites, respectively. The 5' primer
also contained a Flag epitope (Asp .Tyr.Lys.Asp.Asp.Asp.Asp.Lys)
(SEQ ID NO: 7). The template for the RT-PCR was total RNA made from
KG1a cells (ATCC). The reaction conditions used were described in
the Perkin-Elmer RT-PCR kit.
[0143] The PCR fragment was subcloned into the XhoI-XbaI sites of
pCDNA3 (Invitrogen) and this construct was designated CCR5/pCDNA3
(NR54). Another expression vector, CCR5/pMRB101, was constructed in
which the 1.1 kb CCR5 cDNA insert of CCR5/pCDNA3 construct was
subcloned into the HindIII-XbaI sites of pMRB101 (Martin Robinson,
CellTech). PCR fragments were sequenced to ascertain the sequence
fidelity. In both of these expression vectors, the expression of
the inserted gene was driven by a CMV promoter. The DNA was stably
transfected into a murine pre-B lymphoma cell line (L1.2) as
described (Ponath, P. D., et al., J. Exp. Med., 183:2437-2448
(1996)), except that with the CCR5/pMRB101 construct, the
mycophenolic acid-selective medium was used to select for
transfectants. The cell surface expression of CCR5 was monitored by
staining with anti-FLAG mAb, and cells with high level expression
were enriched by several rounds of limiting dilution and
rescreening. For monoclonal antibody production, the L1.2 cell line
transfected with CCR5/pMRB101 (NR56), treated with 5 mM butyric
acid for 16-18 hours, was used exclusively for immunizing mice.
[0144] The murine pre-B lymphoma cell line L1.2 was maintained in
RPMI-1640 supplemented with 10% bovine serum. 20 .mu.g of the
FLAG-tagged CCR-5/pMRB101 construct were linearized by digestion
with SalI and used to transfect the L1.2 cell line as follows. L1.2
cells were washed twice in HBSS and resuspended in 0.8 ml of the
same buffer. The plasmid DNA was mixed with the cells and incubated
for 10 minutes at room temperature, transferred to a 0.4 -cm
electroporation cuvette, and a single pulse was applied at 250 V,
960 .mu.F. The electroporation was followed by a 10 minute
incubation at room temperature. Cells were changed to selective
medium, as described above, 48 hours after transfection and the
cells were plated in 96-well plates at 25,000 cells/well. After 2-3
weeks under drug selection, mycophenolic acid-resistant cells were
stained with M2 monoclonal antibody, and analyzed by FACScan.RTM.
(Becton Dickinson & Co., Mountain View, Calif.). For mAb
staining, cells were washed once with PBS, and resuspended in 100
.mu.l PBS containing 2% FCS, 0.1% sodium azide (FACS.RTM. buffer),
5 .mu.g/ml affinity purified antibody or 5 .mu.g/ml MOPC-21
IgG.sub.1-isotype matched control mAb (Sigma Chemical Co., St.
Louis, Mo.), or 100 .mu.L hybridoma culture supernatant. After 30
minutes at 4.degree. C., cells were washed twice with FACS.RTM.
buffer, and resuspended in 100 .mu.l FITC-conjugated,
affinity-purified F(ab').sub.2 goat anti-mouse IgG (Jackson
ImmunoResearch Laboratories). After incubation for 30 minutes at
4.degree. C., cells were washed twice in FACS.RTM. buffer and
analyzed by FACScan.RTM.. Propidium iodide was used to exclude dead
cells. In some experiments, stable transfectants were treated with
5 mM n-butyric acid (Sigma Chemical Co., St. Louis, Mo., Catalog
No. B 5887) 16-18 hours prior to analysis (FACS staining or
binding) or immunization. Lines with detectable surface staining
were expanded and cloned several times by limiting dilution. In
addition, ligand binding was used to assess the level of
expression. A CCR5 transfected clone having the highest number of
binding sites per cell (Bmax=60,000-80,000 binding sites/cell) was
used as immunogen as described below.
[0145] Chemotaxis of CCR5 L1.2 Transfectants
[0146] The Biocoat transwell tissue culture inserts (Collaborative
Biomedical Products, MA) were used for the chemotaxis assays. The
cells were incubated for 5-6 hours at 37.degree. C. and the number
of cells migrated to the lower chamber were counted on the FACS
using forward and side scatter. In these studies, 10 nM of each
chemokine was used.
[0147] Selection of Transfectants
[0148] To produce mAbs to CCR5, murine pre-B lymphoma L1.2 cells,
expressing high levels of CCR5 were selected and maintained over
several months. Cell lines expressing high levels have been
generated, as described above, however these were continually
monitored to ensure that receptor expression did not drift
downward. Ligand binding and Scatchard analysis were performed
routinely to ascertain receptor level on the transfectants, using
radiolabeled MIP-1.beta., MIP-1.alpha. and RANTES. Routine
chemotaxis assays were also performed to ensure that the lines
responded correctly in a functional assay. To produce lines that
express higher levels of the receptor, the L1.2 cells were cloned
by limiting dilution in 96 well plates, or FACs sorted using a FACS
advantage. Clones that grew up were assessed for receptor
expression, using the anti-FLAG mAb and flow cytometry. Ligand
binding was also used to assess the level of receptor
expression.
[0149] Ligand Binding
[0150] .sup.125I-labeled human MIP-1.alpha. and MIP-1.beta. were
purchased from DuPont NEN (Boston, Mass.), and cold chemokines were
from Peprotech (Rocky Hill, N.J.). CCR5/L1.2 cells were washed and
resuspended in binding buffer (50 mM HEPES, pH 7.5, 1 mM
CaCl.sub.2, 5 mM MgCl.sub.2, and 0.5% BSA) at 5.times.10.sup.6
cells/ml. For each binding reaction (in a final volume of 100
.mu.l), 25 .mu.l cell suspension (1.25.times.10.sup.5 cells) was
mixed with 0.1 nM radio-labeled chemokine with or without
appropriate amount of anti-CCR5 mAb. Total binding was in the
presence of radio-labeled chemokines only, and non-specific binding
(background) was determined in the presence of 100 nM cold
chemokines. The reactions were incubated at 37.degree. C. for 30-45
minutes, and stopped by transferring the mixture to GFB filter
plates which were then washed 2-3 times with binding buffer
containing 0.5 M NaCl. The plates were dried and MicroScint
scintillation fluid was added before counting. Each sample was done
with at least duplicates.
[0151] Monoclonal Antibody Production and Flow Cytometry
[0152] L1.2 cells transfected with CCR5/pMRB101, prepared as
described above, were washed three times in PBS and resuspended in
200 .mu.l PBS/10.sup.7 cells. Monoclonal antibodies reactive with
CCR5 were generated by immunizing C57BL6 mice with 10.sup.7 L1.2
CCR5 transfected cells, intraperitoneally, six times at 2 week
intervals. The final immunization was injected intravenously. Three
days later, the spleen was removed and cells were fused with the
SP2/0 cell line as described (Coligan, J. E. et al., 1992, In:
Current Protocols In Immunology (John Wiley and Sons, New York),
Unit 2.5.4).
[0153] Monoclonal antibodies reactive with CCR5 were identified
using untransfected and L1.2 cells transfected with CCR5/pMRB101,
and immunofluorescent staining analysis using a FACScan.RTM.
(Becton Dickinison & Co., Mountain View, Calif.). Hybridoma
culture supernatants were used in an indirect iminunofluorescence
assay in a 96-well format using anti-mouse Ig-FITC. Untransfected
and CCR5 transfected L1.2 cells were washed once with PBS, and
resuspended in 50 .mu.l PBS containing 2% FCS, 0.1% sodium azide
(FACS.RTM. buffer). 50 .mu.L hybridoma culture supematant was
added. After 30 minutes at 4.degree. C., cells were washed twice
with FACS.RTM. buffer, and resuspended in 100 .mu.I
FITC-conjugated, affinity-purified F(ab').sub.2 goat anti-mouse IgG
(Jackson lmmunoResearch Laboratories). After incubation for 30
minutes at 4.degree. C., cells were washed twice in FACS.RTM.
buffer and analyzed by FACScan.RTM.. Antibodies which stained CCR5
transfectants, but not untransfected L1.2 cells, were selected.
[0154] Results
[0155] CCR5 was expressed in L1.2 cells, by stably transfecting a
CCR5/pcDNA3 or CCR5/pMRB 101 expression construct tagged with an
eight amino acid residue epitope, FLAG. Stable transfectants were
selected by their ability to stain with the anti-FLAG mAb, M2, and
high expressors were enriched by limiting dilution cloning, and
FACS analysis. Ligand binding and Scatchard analysis showed that
the CCR5 transfectants bound MIP-1.alpha., MIP-1.beta., and RANTES
with high affinity (Kd=0.2-0.9 nM), and the receptor was expressed
at a high level (Bmax=60,000-80,000 binding sites/cell). IL-8 and
MCP-1 did not show any specific binding to these transfectants, nor
could they compete the binding of .sup.125I-MIP-1.alpha.,
.sup.125I-MIP-1.beta., .sup.125I-RANTES. It was found that the
treatment of these cells with 5 mM butyrate could enhance the
expression of CCR5 by 2-3 fold, i.e., a receptor level of
.about.200,000 sites per cell. The ability of the CCR5
transfectants to chemotax in response to various chemokines was
also examined. CCR5/L1.2 transfectants chemotaxed very well to
MIP-1.alpha., MIP-1.beta., and RANTES, but had no detectable
response to IL-8 or MCP-1.
[0156] A murine monoclonal antibody specific for human CCR5,
designated 5C7, was produced as described herein. mAbs reactive
with CCR5 were generated by immunizing mice with L1.2 cells
transfected with CCR5/pMRB101, which expressed high levels of CCR5.
Ten female C57BL6 mice were immunized with 10.sup.7 cells,
intra-peritoneally, six times at 2 wk intervals, and a total of 6
fusions were performed, to identify a CCR5 specific mAb. In one
fusion, 12 mAbs were identified that reacted with L1.2 cells
expressing CCR5. The typical FACScan.RTM. profile of one of these
mAbs, 5C7, is shown in FIG. 1. This mAb stained L1.2 CCR5
transfectants (solid profile), but not L1.2 cells transfected with
other 7TMS receptors, such as CCR1, CXCR1, CXCR2, CXCR3, or wild
type L1.2 cells (broken profiles). Negative control staining of all
the transfectants with an irrelevant mAb yielded profiles similar
to those shown for 5C7 staining on CCR1, CXCR1, CXCR2 or CXCR3.
Anti-CCR5 mAbs were also found to stain a subset of human T cells
from most donors (FIGS. 2A-2C), but were unreactive with
neutrophils and eosinophils. Blood monocytes were weakly stained by
mAb 5C7.
[0157] The 5C7 hybridoma cell line was deposited on Oct. 25, 1996
on behalf of LeukoSite, Inc., under the terms of the Budapest
Treaty at the American Type Culture Collection, 10801 University
Boulevard, Manassas, Va. 20110-2209, under Accession Number
HB-12222.
Example 2
[0158] Expression of CCR5 on T Cells, and Correlation with Presence
of the CCR5 Deletion Allele
[0159] Genomic DNA was isolated from PBMC of selected blood donors
using Trizol reagent according to the manufacturer's instructions
(GibcoBRL). Upstream and downstream oligonucleotide primers for
amplifying the CCR5 gene correspond to the second extracellular
region of CCR5, and their sequences were as follows: 5'-primer,
5'-GAAGTTCCTCATTACACCTGCAGCTCTC (SEQ ID NO: 5); 3'-primer,
5'-CTTCTTCTCATTTCGACACCGAAGCAGAG (SEQ ID NO: 6). Using this set of
primers, the wild-type CCR5 allele will give rise to a PCR fragment
of 174 bp, whereas the PCR fragment amplified from the deleted
allele will be 142 bp. For each PCR reaction (100 .mu.l volume), 1
jig genomic DNA was first denatured at 95.degree. C. for 5 min.,
and amplified by 5 cycles of PCR (94.degree. C., 45 s; 55.degree.
C., 45 s; 72.degree. C., 45 s) an additional 35 cycles (94.degree.
C., 45 s; 62.degree. C., 45 s; 72.degree. C., 30 s). The reaction
products (25 .mu.l) were run on a 4% Nusieve GTG agarose gel and
DNA bands stained by ethidium bromide.
[0160] Results
[0161] To confirm that the mAbs were specific for CCR5, and to
assess the usefulness of the mAbs for determining expression levels
of CCR5 on T cells, PBMC from a large number of donors were
assessed for CCR5 expression, using the mAb SC7. The staining of
PBMC from 50 blood donors revealed three staining patterns on
lymphocytes. Several donors' PBMC were completely unreactive with
mAb 5C7, typified by Donor 1 in FIG. 2C, whereas the majority of
donors' PBMC showed a staining pattern in which approximately
10-20% of lymphocytes were intensely stained, typified by Donor 5
in FIG. 2A. Eight donors' PBMC showed a weak staining of a smaller
percentage of lymphocytes, usually <5% (see Donor 3 in FIG. 2B).
Recently, a mutant form of the CCR5 gene, containing a 32 base pair
deletion (.DELTA.32) which renders the molecule inactive and
incapable of cell surface expression, has been identified (Dean, et
al., Science, 273:1856 (1996); Liu, et al., Cell, 86:367-377
(1996)). Individuals homozygous for this mutant form of CCR5 were
shown to be resistant to infection with HIV-1, indicating that the
CCR5 receptor was a critical element for HIV transmission (Dean, et
al., Science, 273:1856 (1996); Liu, et al., Cell, 86:367-377
(1996)). In addition, individuals with one normal and one mutant
copy of the CCR5 gene (heterozygous individuals) also showed
evidence of increased survival following HIV-1 infection (Dean, et
al., Science, 273:1856 (1996)). Blood donors were assessed for the
presence of the CCR5 deletion allele, using PCR primers, designed
to distinguish a 174 base pair PCR product for normal CCR5, and a
142 bp product for the mutant form of CCR5. Heterozygous
individuals show both the 174 and 142 bp products. FIG. 3A shows
the position of the CCR5 deletion, and the sequence difference
between the normal form of CCR5 (CCR5 wild type (WT), SEQ ID NO: 1)
and mutant form of CCR5 (CCR5 MUT, SEQ ID NO: 2).
[0162] FIG. 3B shows an agarose gel with the PCR products amplified
from the DNA of selected individuals. The positions of the 174 and
142 bp products are indicated by arrows. Donors 1 and 2 contained
only the 142 bp product, indicating that these individuals were
homozygous for the CCR5 mutant allele. Donors 3 and 4 contained
both the 174 and 142 bp product indicating that they were
heterozygous, containing one CCR5 mutant allele, and one normal
CCRS allele. Donor 5 showed only the 174 bp product, indicating
that this individual had two normal copies of the CCR5 gene.
Markers (Lane M) were run in order to determine the size of the
various DNA products.
Example 3
[0163] Identity of CCR5-Positive Lymphocytes in Human Blood
[0164] The expression of CCR5 on human lymphocytes was assessed, to
determine which subset expressed CCR5 and CD4, and therefore might
be most susceptible to infection by HIV-1. A two color
immunofluorescence analysis was performed, using a variety of
reagents recognizing human leukocyte surface molecules, such as
CD45RO, CD45RA, CD26, CD25, CD4, and CD8. The level of control
staining was determined using a variety of non-specific reagents,
and quadrants were set for each plot based on this staining. FIGS.
4A-4B show that CCR5 was expressed on CD4+ T cells (FIG. 4A), as
well as on CD8+ T cells (FIG. 4B), although CCR5 was expressed
preferentially on the CD8+ subset. These cells expressed high
levels of CD45RO, indicative of a memory phenotype, but also
expressed low levels of the CD45RA molecule (FIGS. 5A-5B). CD26 has
been used as a marker of acute activation of T cells, and the CCR5
positive cells were found to be CD26-hi or intermediate (FIG. 5C).
CCR5 was largely absent from the IL-2 receptor (CD25+) subset (FIG.
5D).
Example 4
[0165] Generation and Identification of Additional mAb to CCR5 and
Assessment of Chemokine and HIV-1 gp120 Binding
[0166] CCR5/CCR2 Chimeras
[0167] A variety of CCR5/CCR2 chimeras (C25-01 to C25-14) were
constructed by transferring restriction fragments flanked by the
common BamHI, AfIII, ClaI, EcoRI, and XbaI sites between human CCR5
and human CCR2b. The construction and characterization of these
chimeras has been described previously (Rucker et al., Cell,
87:437-446 (1996)). The constructs were transferred into a
bicistronic vector (Ghattas et al., Mol. Cell. Biol. 11:5848
(1991)), under control of the elongation factor 1.alpha.
(EF1.alpha.) promoter, and transfected in CHO-k1 cells as described
by Perret et al. (Biochem. Biophys. Res. Commun. 17:1044 (1990)).
G418-resistant cell populations were used in FACS analyses.
[0168] Cells and Cell Lines
[0169] PBMCs were isolated as described (Ponath et al., J. Clin.
Invest., 97:604-612 (1996)). To generate CD3 blasts,
2.times.10.sup.6 PBMC/ml in RPMI-1640 plus 10% FCS were added to
tissue culture plates first coated with the anti-CD3 antibody TR77.
After 4-6 days, blasts were removed to fresh media and supplemented
with recombinant human interleukin 2 (rhIL-2, Hoffmann-LaRoche,
Nutley, N.J.) at 100 u/ml. Other cell lines used included THP-1 and
transfectants of the L1.2 murine pre B cell lymphoma, expressing
high levels of CCR5 (Wu et al., J. Exp. Med., 185:1681-1691 (1997);
Wu et al., Nature, 384:179-183 (1996)). Transfectants were
maintained in RPMI-1640 supplemented with 10% bovine serum and 800
.mu.g/ml G418 or mycophenolic acid. The different transfectants
were monitored for expression of the relevant receptors, using
specific mAbs (Qin et al., Eur. J. Immunol., 26:640-647 (1996); Wu
et al., J. Exp. Med., 185:1681-1691 (1997)). Chemokine and HIV-1
gp120 Binding
[0170] .sup.125I-labeled human RANTES, .sup.125I-MIP-1.alpha. and
.sup.125I-MIP-1.beta. were purchased from DuPont NEN (Boston,
Mass.), and unlabeled chemokines were from Peprotech (Rocky Hill,
N.J.). Chemokine binding to target cells was carried out using a
modified method previously reported (Wu et al., Nature, 384:179-183
(1996); Van Riper et al., J. Exp. Med., 177:851-856 (1993)). CCR5
L1.2 cells or CD3 blasts were washed and resuspended in binding
buffer (50 mM HEPES, pH 7.5, 1 mM CaCl.sub.2, 5 mM MgCl.sub.2, and
0.5% BSA) at 5.times.10.sup.6 cells/ml. For each binding reaction
(in a final volume of 100 .mu.l), 25 .mu.l cell suspension
(1.25.times.10.sup.5 cells) was mixed with 0.1 nM radiolabeled
chemokine, with or without an appropriate amount of anti-CCR5 mAb,
or isotype matched control mAb. Total binding was determined in the
presence of radio-labeled chemokines only, and non-specific binding
(background) was determined in the presence of 100 nM unlabeled
chemokines. The reactions were incubated at room temperature for
30-45 minutes, and stopped by transferring the mixture to GFB
filter plates, which were then washed 2-3 times with binding buffer
containing 0.5 M NaCl. The plates were dried and MicroScint
scintillation fluid was added before counting. Each sample was done
in duplicate.
[0171] The envelope gp120 protein derived from HIV-1 JR-FL
(macrophage-tropic) was iodinated using solid phase lactoperoxidase
(Bio-Rad) to a specific activity of 20 .mu.Ci/.mu.g. CCR5 L1.2
cells were incubated with 0.2 nM .sup.125I-labeled-gp120 in the
absence or presence of increasing concentrations of mAb 2D7 or 3A9.
mAb 3A9, produced by the 3A9 hybridoma cell line, is another
anti-CCR5 antibody which was produced as described (Example 1).
Binding to target cells was performed similarly as for radiolabeled
chemokine binding, except that soluble CD4 was included in the
assays, as previously reported (Wu et al., Nature, 384:179-183
(1996)). An IgG1 control mAb was used as a control.
[0172] mAbs, Immunofluorescent Staining, and FACS.RTM. Analysis
[0173] mAb 2D7 reactive with CCR5 was generated by immunizing mice
with L1.2 cells expressing high levels of transfected CCR5-Flag, as
described (Wu et al., J. Exp. Med., 185:1681-1691 (1997)). C57BL6
mice were immunized with 10.sup.7 cells, intraperitoneally, six
times at 2 week intervals, and four days following an intravenous
injection, the spleen was removed and cells were fused with the
SP2/0 cell line. The mAb generated, 2D7, was determined to be IgG1.
The 2D7 hybridoma cell line (also referred to as
LS100-2D7-13-1-1-14-14-4) was deposited on Jun. 6, 1997, on behalf
of LeukoSite, Inc., under the terms of the Budapest Treaty at the
American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209, under Accession Number HB-12366. Other
mAbs used in this study included 511, an anti-CCR2b mAb (Qin et
al., Eur. J. Immunol., 26:640-647 (1996)), and 3A9, an anti-CCR5
mAb (Example 1) that blocks macrophage-tropic HIV-1 infection of
human T cells (Wu et al., J. Exp. Med., 185:1681-1691 (1997)).
[0174] To assess reactivity of mkbs against transfected cells
(including cells transfected with chimeras as described herein) or
leukocytes, indirect immunofluorescence and flow cytometry were
used. Cells were washed once with PBS, and resuspended in 100 .mu.l
PBS containing 2% human serum and 0.1% sodium azide (staining
buffer), and 5 .mu.g/ml purified antibody, 5 .mu.g/ml IgG1 or
IgG.sub.2a isotype-matched control mAb (Sigma Chemical Co., St.
Louis, Mo.), or 50 .mu.l hybridoma culture supernatant. After 20
minutes at 4.degree. C., cells were washed twice with staining
buffer, and resuspended in 50 .mu.l FITC-conjugated affinity
purified F(ab').sub.2 goat anti-mouse IgG (Jackson ImmunoResearch
Laboratories). After incubating for 20 minutes at 4.degree. C.,
cells were washed twice in staining buffer and analyzed on the
FACScan.RTM. to determine the level of surface expression.
Propidium iodide was used to exclude dead cells.
[0175] Chemotaxis Assays
[0176] Recombinant human chemokines were obtained either from
Peprotech (Rocky Hill, N.J.) or R and D systems (Minneapolis,
Minn.). Chemotaxis assays with human PBMC or CD3-activated IL-2
stimulated T cells, employed the cell line ECV304 (an endothelial
cell line, European Collection of Animal Cell Cultures, Porton
Down, Salisbury, U.K.) to coat Biocoat(.RTM. Transwell tissue
culture inserts (Costar Corp., Cambridge, Mass.), and were
performed as described (Ponath et al., J. Clin. Invest., 97:604-612
(1996)). Cells migrating to the bottom chamber of the Transwell
tissue culture inserts were enumerated using the FACScan.RTM., by
counting cells for 30 seconds. Chemotaxis assays with L1.2 receptor
transfectant cell lines were as described (Ponath et al., J. Clin.
Invest., 97:604-612 (1996)), except that endothelial cells were not
used to coat the Biocoat.RTM. Transwell tissue culture inserts and
the incubation was for 4-6 hours. Tight forward angle and side
scatter gates were set on the FACScan.RTM. to exclude debris or
irrelevant cells.
[0177] Measurement of [Ca.sup.2+].sub.i
[0178] Cells were labeled with the fluorochrome Fura-2 AM
(Molecular Probes, Eugene Oreg.), as previously described (Heath et
al., J. Clin. Invest., 99:178-184 (1997)). Briefly, Fura-2 AM was
added to the cell suspension to produce a final concentration of
0.2 moles/10.sup.6 cells. After incubation at 37.degree. C. for 30
minutes, excess dye was removed by centrifugation and cells were
resuspended at a concentration of 10.sup.6 cells/ml in 125 mM NaCl,
5 mM KCl, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2, 0.5 mM glucose, 0.025%
BSA and 20 mM HEPES, pH 7.4. CCR5 L1.2 cells were stimulated
sequentially with mAb, followed 40 seconds later with MIP-1.alpha.,
and 100 seconds following that with SDF-1. [Ca.sup.2+].sub.i
fluorescence changes were recorded using excitation at 340 and 380
nm on a Hitachi F-2000 fluorescence spectrometer. Calibration was
performed using 1% NP-40 for total release and 25 .mu.M EGTA to
chelate free Ca.sup.2+.
[0179] Inhibition of HIV-1 Infection by Anti-CCR5 mAbs
[0180] Inhibition of HIV-1 infection in U87-CD4-CCR5 cells was
determined using a virus entry assay based on single-cycle
infection. Cells were infected with the env-deficient virus NL4/3
luc (Connor et al., Virol. 206:935 (1995)) complemented in trans
with envelope glycoproteins from several clones. Infection of the
cells was measured by quantification of luciferase activity.
Briefly, U87-CD4-CCR5 cells (a gift from D. Littman, New York
University Medical Center) were split to a concentration of
5.times.10.sup.4 cells/ml, and 100 .mu.l was added to each well of
a 96-well tissue culture plate. The following day, the cells were
washed with PBS and pre-incubated with dilutions of mAb 2D7, an
isotype-control (IgG1) mAb, or medium only in a total volume of 40
.mu.l for 1 hour at 4.degree. C. Fifty microliters of HIV-1 (env
genes of ADA, JR-FL, DH123 or HxB2, stocks of 100 ng/ml, as
measured by p24) was added, and the cells were incubated with the
mAb and the virus for 2 hours at 37.degree. C. The cells were then
washed and fresh medium was added, and again after 48 hours.
Seventy-two hours post-infection, the cells were washed with PBS
and lysed in 50 .mu.l of 1.times. reporter lysis buffer (Promega).
To measure luciferase activity, 100 .mu.I of luciferase substrate
(Promega) was added to 30 .mu.l of the cell lysate.
[0181] Studies showing inhibition of HIV-1 infection of PBMC by mAb
5C7 were also carried out. Complementation of a single round of
replication of the env-deficient chloramphenicol acetyltransferase
(CAT)-expressing provirus by various envelope glycoproteins was
performed as described in Helseth et al. (J. Virol. 64:2416-2420
(1990)) and Thali et al. (J. Virol. 67:3978-3988 (1993)). To
inhibit viral replication, monoclonal antibody was incubated with
target PBMC for 90 minutes at 37.degree. C. before the addition of
recombinant virus YU2 (M-tropic) or HxBC2 (T-tropic) to the cells.
At three days after infection, the target cells were lysed and CAT
activity was measured as described in Helseth et al. (J. Virol.
64:2416-2420 (1990)). The results of this study are shown in FIGS.
12A-12F.
[0182] Results
[0183] Generation of Anti-CCR5 mAbs that Recognize Different
Domains of CCR5
[0184] As described herein, mAbs to CCR5 were generated which can
inhibit the various functions of this molecule, and can be used to
determine how different portions of the molecule bind chemokines or
HIV-1. Anti-CCR5 mAbs that inhibit HIV-1 binding, but not ligand
binding, have been described (Wu et al., J. Exp. Med.,
185:1681-1691 (1997)). Monoclonal antibodies to CCR5 were generated
as described herein by immunizing C57BL6 mice with the murine pre-B
cell lymphoma line, L1.2, expressing high levels of transfected
human CCR5. One mAb generated by this method, termed 2D7, reacted
with CCR5-transfected L1.2 cells, as well as CHO cells expressing
certain portions of CCR5, but not with L1.2 cells expressing CXCR4
(FIG. 6A) or various other receptors, including CCR2b. Moreover,
2D7 showed a pattern of reactivity against human leukocytes which
appeared to be identical to that previously noted for other
anti-CCR5 mAbs (Wu et al., J. Exp. Med., 185:1681-1691 (1997);
Bleul et al., Proc. Natl. Acad. Sci., USA, 94:1925-1930 (1997)). In
particular, 2D7 stained mostly the CXCR4.sup.- subset of human
peripheral blood lymphocytes (PBL) (FIG. 6B), as well as a subset
of tissue macrophages.
[0185] To determine how chemokines or HIV-1 interact with CCR5, a
series of chimeric receptors were generated by replacing
extracellular domains of human CCR5 with the corresponding domain
of human CCR2b, or vice versa, using common restriction sites in
regions conserved between the two molecules (Rucker et al., Cell,
87:437-446 (1996)). The chimeras of CCR5 and CCR2b were ideal for
this purpose, since these two receptors are closely related, but
have different ligand binding properties. The interaction of these
chimeras with different strains of HIV-1 has already been reported
(Rucker et al., Cell, 87:437-446 (1996)). FIG. 7 shows the panel of
chimeras that was used in the present experiments, and the
reactivity of these chimeras to several mAbs. The 2D7 mAb reacted
with all chimeras that contained the second extracellular loop of
CCR5. In particular, C25-14, a receptor chimera comprising CCR2b
with the second extracellular loop of CCR5, was stained intensely
by mAb 2D7. In contrast, the anti-CCR5 mAb 3A9 and seven other
anti-CCR5 mAbs (5C7, 2F9, 3D8, 2C4, 5D7, 5H11, and 1G4; see Example
1 and Wu et al., J. Exp. Med., 185:1681-1691 (1997)) reacted only
with chimeras that contained the amino-terminal region of CCR5
(FIG. 7). In addition, mutants of CCR5 lacking the amino-terminal 8
amino acids were unstained by mAb 3A9, suggesting that the epitope
for this mAb was dependent on the amino-terminus of the molecule. A
mAb to CCR2b, designated 5A11, stained all chimeras containing the
amino-terminus of CCR2b, consistent with the fact that this mAb was
raised against a synthetic peptide comprising the 32 amino terminal
amino acids of CCR2b (Qin et al., Eur. J. Immunol., 26:640-647
(1996)).
[0186] mAb 2D7, having Specificity for the Second Extracellular
Loop of CCR5, Blocks MIP-1.alpha., MIP-1.beta. and RANTES Binding
to CCR5 Transfectants and to Activated T Cells.
[0187] A preliminary analysis of a panel of anti-CCR5 mAbs revealed
that none of eight anti-CCR5 mAbs (3A9, 5C7, 2F9, 3D8, 2C4, 5D7,
5H11, or 1G4; see Example 1 and Wu et al., J. Exp. Med.,
185:1681-1691 (1997)) was able to block the binding of CCR5 ligands
RANTES, MIP-1.alpha. or MIP-1.beta. to CCR5 L1.2 transfectants
under the conditions used. The ability of the new mAb to inhibit
the binding of these ligands was assessed. FIG. 8A shows that 10
.mu.g/ml of mAb 2D7 was able to inhibit completely the binding of
.sup.125I-labeled human RANTES, .sup.125I-MIP-1.alpha. and
.sup.125I-MIP-1.beta. to these transfectants. An analysis with
decreasing amounts of mAb 2D7 established an lC.sub.50 of 23 ng/ml
for MIP-1.alpha. binding, 41 ng/ml for MIP-1.beta. binding, and 58
ng/ml for RANTES binding. mAb 3A9, directed to the amino-terminus
of CCR5, showed little inhibition of binding of the three ligands
at 10 .mu.g/ml (FIG. 8A), and only slight inhibition at a
concentration up to 100 .mu.g/ml. THP-1 cells, which do not express
CCR5 (Wu et al., J. Exp. Med., 185:1681-1691 (1997)), were also
examined. These cells bound .sup.125I-MIP-1.alpha. (FIG. 8B) and
.sup.125I-RANTES, however mAb 2D7 had no effect on the level of
binding. The predominant receptor on these cells is presumably
CCR1.
[0188] .sup.125I-RANTES, .sup.125I-MIP-1.alpha. and
.sup.125I-MIP-1.beta. binding to activated T cells is shown in FIG.
8C. These three ligands bound to IL-2 maintained T cells, and such
binding could be competed with 100 nM unlabeled chemokine. Day 21
post activation T cells showed the highest level of binding and
chemotactic responses to the three ligands (see below). mAb 2D7 was
assessed for its ability to compete for binding of these three
ligands. At 10 .mu.g/ml, 2D7 completely blocked
.sup.125I-MIP-1.beta. binding to these activated T cells. Under the
same conditions, the .sup.125I-RANTES and .sup.125I-MIP-1.alpha.
binding were inhibited by 95% and 85%, respectively. This result
indicated that CCR5 was responsible for most of the RANTES,
MIP-1.alpha. or MIP-1.beta. binding to these T cells. However, some
variations were noted in the 2D7 inhibition level when using T
cells from different time points (10-26 days). At earlier time
points, fewer RANTES and MIP-1.alpha. binding sites were blocked by
mAb 2D7. These data suggest that CCR5 and other receptors are
differentially regulated.
[0189] mAb 2D7 Inhibits MIP-1.alpha., MIP-1.beta. and RANTES
Functional Responses
[0190] Chemokines are capable of selectively inducing chemotaxis of
the formed elements of the blood (other than red blood cells),
including leukocytes such as neutrophils, monocytes, macrophages,
eosinophils, basophils, mast cells, and lymphocytes, such as T
cells and B cells. In addition to stimulating chemotaxis, other
changes can be selectively induced by chemokines in responsive
cells, including changes in cell shape, transient rises in the
concentration of intracellular free calcium ions
([Ca.sup.2+].sub.i), granule exocytosis, integrin upregulation,
formation of bioactive lipids (e.g., leukotrienes) and respiratory
burst, associated with leukocyte activation. Thus, the chemokines
are early triggers of the inflammatory response, causing
inflammatory mediator release, chemotaxis and extravasation to
sites of infection or inflammation.
[0191] The agonist/antagonist activity of mAb 2D7 was tested on
CCR5 L1.2 transfectants, by measuring the change in intracellular
calcium concentration [Ca.sup.2+], of Fura-2 loaded cells
stimulated with various concentrations of mAb 2D7 (FIG. 9B). mnAb
2D7 did not itself stimulate a change in [Ca.sup.2+], in CCR5 L1.2
cells, but was able to inhibit subsequent stimulation by
MIP-1.alpha. (FIG. 9B), as well as by RANTES and MIP-1.beta.. mAb
2D7 did not inhibit a change in [Ca.sup.2+].sub.i following
stimulation with SDF-1, which operates through an endogenous mouse
CXCR4 receptor. Incubation of CCR5 L1.2 cells with a control mAb
(MOPC-21) had no inhibitory effect. Neither mAb 3A9 nor any of the
other mAbs having binding specificity for the amino-terminal region
of CCR5 had any inhibitory effect on the RANTES, MIP-1.alpha. or
MIP-1.beta. responses. mAb 2D7 inhibited the chemotaxis of CCR5
L1.2 cells in response to RANTES, MIP-1.alpha. and MIP-1.beta., in
a dose-dependent manner (FIG. 10A). Incubation of cells with 20
.mu.g/ml of mAb in the top chamber was sufficient to achieve
complete inhibition of migration to all of the ligands. This fully
antagonistic mAb to CCR5, able to block responses through this
receptor, allowed us to examine the significance of this receptor
for lymphocyte (FIG. 10B), monocyte (FIG. 10C) and activated T cell
responses (FIG. 10D) to RANTES, MIP-1.alpha. and MIP-1.beta..
Chemotactic responses by blood lymphocytes to MIP-1.beta. were
totally inhibited by 2D7 (FIG. 10B), consistent with the notion
that MIP-1.beta. binds only CCR5 and not other receptors. RANTES
responses were also inhibited in most individuals, however
MIP-1.alpha. responses were not. mAb 2D7 did not inhibit chemotaxis
of monocytes to RANTES or MIP-1.alpha. (FIG. 10C), presumably
because these responses were occurring through CCR1. This result
agrees with previous studies showing minimal expression of CCR5 on
most monocytes (Wu et al., J. Exp. Med., 185:1681-1691 (1997)). T
cells stimulated in vitro with anti-CD3 and maintained with IL-2
for 3 weeks showed a very robust chemotactic response to RANTES,
MIP-1.alpha. and MIP-1.beta. (FIG. 10D). T cells maintained in
culture for shorter periods of time also responded but not quite as
robustly (not shown). Importantly, mAb 2D7 was able to inhibit most
of the functional chemotactic responses of these T cells to RANTES
and MIP-1.beta., and about 60-80% of the chemotactic response to
MIP-1.alpha.. However, individual to individual variation was
observed. These results were supported by studies with T cell lines
from .DELTA.32 homozygous individuals. The MIP-1.alpha. and RANTES
chemotactic responses were markedly impaired in these T cell
lines.
[0192] In general, these results are consistent with CCR5 being an
important RANTES, MIP-1.beta. and MIP-1.alpha. receptor on
activated/effector T cells, but having little role in the
chemotactic responses of blood monocytes.
[0193] Inhibition of gp120 Binding to CCR5 is Manifested by mAbs
Recognizing Either the Amino-Terminus or the Second Extracellular
Loop
[0194] It was reported previously that the exterior envelope
glycoprotein gp120 of macrophage-tropic primary HIV-1, upon binding
to soluble CD4, can interact with CCR5 specifically and with high
affinity (Wu et al., Nature, 384:179-183 (1996); Trkola et al.,
Nature 384:184-186 (1996)). To assess the ability of the various
anti-CCR5 mAbs to inhibit such an interaction, binding assays were
performed using .sup.125I-labeled gp120 derived from HIV-1 JR-FL (a
macrophage-tropic strain) in the presence or absence of mAb 3A9 or
mAb 2D7 (FIG. 11A). mAb 2D7 inhibited efficiently the binding of
.sup.125I-gp120 to CCR5 L1.2 cells, in the presence of soluble CD4,
with an IC.sub.50 of approximately 10 ng/ml. At a concentration of
50 ng/ml, 2D7 inhibited the binding of radiolabeled gp120
completely, to the same level as that obtained with excess
unlabeled gp120. In contrast, mAb 3A9 had a moderate inhibitory
effect on the .sup.125I-gp120 binding at a lower concentration
range, but it inhibited completely when a higher concentration
(greater than approximately 100 .mu.g/ml) of mAb was used, which is
consistent with the previous finding that 3A9 can neutralize the
infection of PBMC by macrophage-tropic HIV-1 strains (Wu et al., J.
Exp. Med., 185:1681-1691 (1997)). As expected, an isotype-control
rnAb did not have any significant inhibitory effect at a
concentration up to 100 .mu.g/ml.
[0195] Thus, efficient inhibition of a M-tropic HIV-1-derived gp120
binding to CCR5 could be achieved with mAbs recognizing either the
second extracellular loop, or the amino-terminal region, although
the former showed superior inhibition. These results suggest that
agonists or antagonists that bind the second extracellular loop of
CCR5 can serve as potent inhibitors of gp120 binding to CCR5, even
though this loop can be redundant for HIV-1 gp120 binding.
[0196] Monoclonal antibody 2D7, prepared as described herein, was
able to totally inhibit the binding of RANTES, MIP-1.alpha., and
MIP-1.beta., while mAbs recognizing the N-terminus of CCR5 did not
display similar activity under the conditions used. mAb 2D7 was
able to completely inhibit the binding of gp120 of HIV-1 JR-FL (a
macrophage-tropic strain) to CCR5, despite the fact that the
amino-terminus of CCR5 also contributes to gp120 interactions.
Studies with CCR5/CCR2b chimeras showed that JR-FL gp 120 binding
appears to rely more on the amino-terminus and the first
extracellular loop (Rucker et al., Cell, 87:437-446 (1996)). The
ability of an agent to inhibit HIV-1 binding may have more to do
with steric hinderance rather than direct interruption of the
important binding site.
[0197] In order to assess the inhibitory effect of 2D7 on HIV-1
entry, a virus entry assay based on single-cycle infection using
several viral strains was employed. As shown in FIG. 11B, the
U87MG-CD4+ cells expressing CCR5 can be efficiently infected by
M-tropic (ADA and JR-FL env) and dual-tropic (DH123 env) chimeric
viruses, which can use CCR5 as a co-receptor, but not by the T
cell-tropic chimera HxB2), which uses only CXCR4. mAb 2D7
efficiently inhibited the entry of the dual-tropic DH123 chimera
(>90% inhibition at 1 .mu.g/ml), whereas a higher concentration
of 2D7 (approximately 10 .mu.g/ml for approximately 90% inhibition)
was required for inhibiting the M-tropic (ADA and JR-FL). Under the
same conditions, the inhibitory effect of mAb 3A9 and 5C7 were
weaker, and the isotype-control mAb had no significant effect.
[0198] Anti-CCR5 mAbs whose binding specificity mapped to the
amino-terminus were also able to inhibit HIV-1 entry into T cells.
This result is consistent with a contribution of the amino-terminus
for HIV-1 binding (Rucker et al., Cell, 87:437-446 (1996)), and the
fact that HIV-1 entry and response to chemokines are somewhat
non-overlapping functions of CCR5 (Atchison et al., Science, 274:
1924-1926 (1996); Farzan et al., J. Biol Chem 272(11):6854-6857
(1997). Therefore, whereas specificity of ligand binding to CCR5 is
determined by a single domain, the binding of gp120 is more complex
and involves at least two domains. As shown herein, total
inhibition of gp120 binding to CCR5 can be achieved with mAbs
directed against either the amino terminus, or the second
extracellular loop, particularly for gp120 from macrophage-tropic
isolates. It appears that mAb 2D7 will block CCR5 binding to gp120
of most HIV-1 strains, particularly those which can use CCR5 as a
co-receptor, since mAb 2D7 is able to block entry of a wide range
of macrophage-tropic and dual tropic isolates (FIG. 11B). The
potential to disrupt HIV-1 gp120 binding with agents that interfere
with either the amino-terminus or the second extracellular loop
suggest that similarly acting small molecule antagonists, binding
to one or more of these or other regions of CCR5, can also be
effective at blocking CCR5-gp120 interactions. Antibodies of the
present invention can be used in competition binding studies to
identify agents which can compete for binding to one or more of
these regions, and which are potential inhibitors (e.g.,
antagonists) or promoters (e.g., agonists) of mammalian CCR5
function.
[0199] The mAb 2D7 blocked RANTES, MIP-1.alpha. and MIP-1.beta.
chemotactic responses by T cell lines from most individuals. In
most cases, only partial (60-80%) inhibition of RANTES and
MIP-1.alpha. responses was observed, suggesting that although CCR5
is the predominant RANTES and MIP-1.alpha. receptor, and the only
MIP-1.beta. receptor on T cells, other receptors play a role for
RANTES and MIP-1.alpha. responses.
[0200] While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims.
Sequence CWU 1
1
7 1 56 DNA Homo sapiens 1 attttccata cagtcagtat caattctgga
agaatttcca gacattaaag atagtc 56 2 24 DNA Homo sapiens 2 attttccata
cattaaagat agtc 24 3 56 DNA Homo sapiens 3 cccctcgaga tggactacaa
ggacgacgat gacaaggatt atcaagtgtc aagtcc 56 4 39 DNA Homo sapiens 4
ccctctagat tacaagccca cagatatttc ctgctcccc 39 5 28 DNA Homo sapiens
5 gaagttcctc attacacctg cagctctc 28 6 29 DNA Homo sapiens 6
cttcttctca tttcgacacc gaagcagag 29 7 8 PRT Homo sapiens 7 Asp Tyr
Lys Asp Asp Asp Asp Lys 1 5
* * * * *