U.S. patent application number 10/355820 was filed with the patent office on 2003-09-04 for high potency sirnas for reducing the expression of target genes.
Invention is credited to Brown, David, Ford, Lance, Jarvis, Rich, Pallotta, Vince, Pasloske, Brittan.
Application Number | 20030166282 10/355820 |
Document ID | / |
Family ID | 27804989 |
Filed Date | 2003-09-04 |
United States Patent
Application |
20030166282 |
Kind Code |
A1 |
Brown, David ; et
al. |
September 4, 2003 |
High potency siRNAS for reducing the expression of target genes
Abstract
The present invention provides improved methods of attenuating
gene expression through the phenomenon of RNA interference. The
invention provides methods of synthesis of double stranded RNAs
(dsRNAs) of increased potency for use as small interfering RNA
(siRNA). Surprisingly and unexpectedly, siRNAs made by the methods
of the invention are significantly more potent than previously
available siRNAs.
Inventors: |
Brown, David; (Austin,
TX) ; Ford, Lance; (Austin, TX) ; Jarvis,
Rich; (Austin, TX) ; Pallotta, Vince; (Austin,
TX) ; Pasloske, Brittan; (Austin, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
27804989 |
Appl. No.: |
10/355820 |
Filed: |
January 31, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60353332 |
Feb 1, 2002 |
|
|
|
Current U.S.
Class: |
435/455 ;
435/375 |
Current CPC
Class: |
C12Y 102/01012 20130101;
C12N 2310/14 20130101; C12N 2320/50 20130101; C12N 2310/336
20130101; C12N 2310/322 20130101; C12N 15/1135 20130101; C12N
2310/335 20130101; C12N 15/113 20130101; C12N 15/111 20130101; C12N
2310/111 20130101; C12N 2310/53 20130101; C12N 2310/333 20130101;
C12N 15/1137 20130101; C12N 2310/334 20130101 |
Class at
Publication: |
435/455 ;
435/375 |
International
Class: |
C12N 005/02; C12N
015/85 |
Claims
What is claimed is:
1. A method for making siRNA of increased potency comprising: (a)
obtaining nucleotides; (b) incorporating the nucleotides into siRNA
such that an RNA duplex of from 15 to 30 contiguous nucleotides is
formed, wherein the siRNA has a sequence that is substantially
identical to at least a portion of a selected target gene.
2. The method of claim 1, wherein the siRNA is further defined as
having reduced duplex stability.
3. The method of claim 1, further defined as comprising obtaining
at least one modified nucleotide analog and incorporating the at
least one modified nucleotide analog into the siRNA.
4. The method of claim 3, wherein the modified nucleotide analog is
selected from the group consisting of aminoallyl uridine,
pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine, alpha-S
adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S uridine,
4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine, 2'NH.sub.2
cytidine, and 2'F uridine.
5. The method of claim 3, wherein the siRNA is further defined as
having reduced duplex stability.
6. The method of claim 1, wherein incorporating the nucleotides
into siRNA is further defined as comprising enzymatic
synthesis.
7. The method of claim 6, further defined as comprising obtaining
at least one modified nucleotide analog and incorporating the at
least one modified nucleotide analog into the siRNA.
8. The method of claim 6, wherein the method of enzymatic
incorporation comprises: (a) obtaining a first polynucleotide
template comprising a first promoter operatively linked to a first
target sequence that has 5' and 3' ends and that is substantially
identical to at least a portion of the target gene; (b) obtaining a
second polynucleotide template comprising a second promoter
operatively linked to a second target sequence that has 5' and 3'
ends and that is substantially the reverse complement of the first
target sequence of the first template; (c) enzymatically
incorporating nucleotides into RNA by contacting the first template
with a reaction mixture comprising an RNA polymerase and
nucleotides to transcribe the first template to form a first RNA
product; (e) enzymatically incorporating nucleotides into RNA by
contacting the second template with a reaction mixture comprising
an RNA polymerase and nucleotides to transcribe the second template
to form a second RNA product; and (f) annealing the first and
second RNA products to form a siRNA product.
9. The method of claim 8, wherein the first template further
comprises an overhang encoding sequence joined to the 3' end of the
first target sequence and the second template further comprises an
overhang encoding sequence joined to the 3' end of the second
target sequence.
10. The method of claim 9, wherein the first and second overhang
sequences each comprise TT.
11. The method of claim 9, wherein the first two nucleotides of the
5' end of the first target sequence are GG and the last two
nucleotides of the 3' end of the first target sequence are CC.
12. The method of claim 9, wherein the first two nucleotides of the
5' end of the first target sequence are GA and the last two
nucleotides of the 3' end of the first target sequence are TC.
13. The method of claim 8, wherein the first target sequence is 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30
nucleotides in length.
14. The method of claim 8, wherein the first promoter is a T7, T3,
or SP6 promoter.
15. The method of claim 8, wherein the second promoter is a T7, T3,
or SP6 promoter.
16. The method of claim 8, wherein the first promoter and the
second promoter are the same promoter.
17. The method of claim 8, wherein the first promoter and the
second promoter are different promoters.
18. The method of claim 8, wherein at least one nucleotide is a
modified nucleotide analog.
19. The method of claim 8, wherein the first template further
comprises a first leader sequence of about 10 nucleotides
positioned between the first promoter and the first target
sequence.
20. The method of claim 19, wherein the second template further
comprises a second leader sequence of about 10 nucleotides
positioned between the second promoter and the second target
sequence.
21. The method of claim 20, wherein the second leader sequence is
substantially non-complementary to any portion of either strand of
the siRNA.
22. The method of claim 20, wherein the first and second leader
sequences each comprise SEQ ID NO:1.
23. The method of claim 20, wherein the first and second leader
sequences each comprise SEQ ID NO: 2.
24. The method of claim 20, wherein the first leader sequence
comprises SEQ ID NO: 1 and the second leader sequence comprises SEQ
ID NO: 2.
25. The method of claim 8 further comprising the step of contacting
the siRNA product with a nuclease.
26. The method of claim 25, wherein the nuclease is RNase T1, RNase
A, RNase Sa, RNase Sa2, or RNase Sa3.
27. The method of of claim 8, wherein at least one step is
performed in at least one container.
28. The method of claim 27, wherein the transcription of the first
template and the transcription of the second template are performed
in the same container.
29. The method of claim 27, wherein the transcription of the first
template and the transcription of the second template are performed
in different containers.
30. The method of claim 27, wherein the annealing is performed in
the same container as at least one of the transcription steps.
31. The method of claim 6, wherein the method of enzymatic
incorporation comprises: (a) obtaining a polynucleotide template
comprising a promoter operatively linked to a first target
sequence, a loop sequence, and a second target sequence having 5'
and 3' ends and that is substantially the reverse complement of the
first target sequence; and (b) enzymatically incorporating
nucleotides into RNA by contacting the template with a reaction
mixture comprising an RNA polymerase and nucleotides to transcribe
the template to form an siRNA product
32. The method of claim 31, wherein the promoter is a T7, T3, or
SP6 promoter.
33. The method of claim 31, further comprising the step of
annealing the siRNA product to form a stem and loop siRNA
product.
34. The method of claim 31, wherein the template further comprises
an overhang encoding sequence attached to the 3' end of the second
target sequence.
35. The method of claim 34, wherein the overhang encoding sequence
comprises TT.
36. The method of claim 31, wherein the template further comprises
a leader sequence of about 10 nucleotides positioned between the
promoter and the first target sequence.
37. The method of claim 36, wherein the leader sequence comprises
SEQ ID NO:1.
38. The method of claim 36, wherein the leader sequence comprises
SEQ ID NO:2.
39. The method of claim 34, wherein the loop sequence is selected
such that the loop is resistant to nuclease digestion.
40. The method of claim 39, wherein the loop sequence is AAGC.
41. The method of claim 39, further comprising the step of
digesting the stem and loop siRNA product with a nuclease.
42. The method of claim 41, wherein the nuclease is RNase T1, RNase
A, RNase Sa, RNase Sa2, or RNase Sa3.
43. The method of claim 1, further defined as comprising obtaining
at least one modified nucleotide analog and incorporating the at
least one modified nucleotide analog into the siRNA with a method
comprising chemical synthesis.
44. The method of claim 43, wherein the modified nucleotide analog
is selected from the group consisting of aminoallyl uridine,
pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine, alpha-S
adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S uridine,
4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine, 2'NH.sub.2
cytidine, and 2'F uridine.
45. The method of claim 43, wherein the siRNA is further defined as
having reduced duplex stability.
46. A method for attenuating the expression of a target gene in a
cell comprising: (a) obtaining a siRNA of increased potency; (b)
introducing the siRNA of increased potency into the cell in an
amount sufficient to attenuate expression of the target gene.
47. The method of claim 46, wherein the cell is comprised within a
tissue.
48. The method of claim 46, wherein the cell is comprised within an
organism.
49. The method of claim 48, wherein the organism is a plant,
animal, protozoan, virus, bacterium, or fungus.
50. The method of claim 49, wherein the organism is an animal.
51. The method of claim 50, wherein the animal is a vertebrate.
52. The method of claim 51, wherein the vertebrate is a fish.
53. The method of claim 51, wherein the animal is a mammal.
54. The method of claim 52, wherein the mammal is a mouse, a rat,
or a primate.
55. The method of claim 54, wherein the primate is a human.
56. The method of claim 46, wherein obtaining siRNA of increased
potency comprises practicing a method of making siRNA of increased
potency comprising: (a) obtaining nucleotides; (b) incorporating
the nucleotides into siRNA such that an RNA duplex of from 15 to 30
contiguous nucleotides is formed, wherein the siRNA has a sequence
that is substantially identical to at least a portion of a selected
target gene.
57. The method of claim 56, wherein the siRNA is further defined as
having reduced duplex stability.
58. The method of claim 56, further defined as comprising obtaining
at least one modified nucleotide analog and incorporating the at
least one modified nucleotide analog into the siRNA.
59. The method of claim 58, wherein the modified nucleotide analog
is selected from the group consisting of aminoallyl uridine,
pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine, alpha-S
adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S uridine,
4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine, 2'NH.sub.2
cytidine, and 2'F uridine.
60. The method of claim 56, wherein incorporating the nucleotides
into siRNA is further defined as comprising enzymatic
synthesis.
61. The method of claim 60, further defined as comprising obtaining
at least one modified nucleotide analog and incorporating the at
least one modified nucleotide analog into the siRNA.
62. The method of claim 60, wherein the method of enzymatic
incorporation comprises: (a) obtaining a first polynucleotide
template comprising a first promoter operatively linked to a first
target sequence that has 5' and 3' ends and that is substantially
identical to at least a portion of the target gene; (b) obtaining a
second polynucleotide template comprising a second promoter
operatively linked to a second target sequence that has 5' and 3'
ends and that is substantially the reverse complement of the first
target sequence of the first template; (c) enzymatically
incorporating nucleotides into RNA by contacting the first template
with a reaction mixture comprising an RNA polymerase and
nucleotides to transcribe the first template to form a first RNA
product; (e) enzymatically incorporating nucleotides into RNA by
contacting the second template with a reaction mixture comprising
an RNA polymerase and nucleotides to transcribe the second template
to form a second RNA product; and (f) annealing the first and
second RNA products to form a siRNA product.
63. The method of claim 62, wherein the first template further
comprises an overhang encoding sequence joined to the 3' end of the
first target sequence and the second template further comprises an
overhang encoding sequence joined to the 3' end of the second
target sequence.
64. The method of claim 63, wherein the first and second overhang
encoding sequences each comprise TT.
65. The method of claim 63, wherein the first two nucleotides of
the 5' end of the first target sequence are GG and the last two
nucleotides of the 3' end of the first target sequence are CC.
66. The method of claim 63, wherein the first two nucleotides of
the 5' end of the first target sequence are GA and the last two
nucleotides of the 3' end of the first target sequence are TC.
67. The method of claim 62, wherein the first target sequence is
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30
nucleotides in length.
68. The method of claim 62, wherein the first promoter is a T7, T3,
or SP6 promoter.
69. The method of claim 62, wherein the second promoter is a T7,
T3, or SP6 promoter.
70. The method of claim 62, wherein the first promoter and the
second promoter are the same promoter.
71. The method of claim 62, wherein the first promoter and the
second promoter are different promoters.
72. The method of claim 62, wherein at least one nucleotide is a
modified nucleotide analog.
73. The method of claim 62, wherein the first template further
comprises a first leader sequence of about 10 nucleotides
positioned between the first promoter and the first target
sequence.
74. The method of claim 73, wherein the second template further
comprises a second leader sequence of about 10 nucleotides
positioned between the second promoter and the second target
sequence.
75. The method of claim 74, wherein the second leader sequence is
substantially non-complementary to the first leader sequence.
76. The method of claim 74, wherein the first and second leader
sequences each comprise SEQ ID NO:1.
77. The method of claim 74, wherein the first and second leader
sequences each comprise SEQ ID NO: 2.
78. The method of claim 74, wherein the first leader sequence
comprises SEQ ID NO: 1 and the second leader sequence comprises SEQ
ID NO: 2.
79. The method of claim 62 further comprising the step of
contacting the siRNA product with a nuclease.
80. The method of claim 79, wherein the nuclease is RNase T1, RNase
A, RNase Sa, RNase Sa2, or RNase Sa3.
81. The method of claim 62, wherein at least one step is performed
in at least one container.
82. The method of claim 81, wherein the transcription of the first
template and the transcription of the second template are performed
in the same container.
83. The method of claim 81, wherein the transcription of the first
template and the transcription of the second template are performed
in different containers.
84. The method of claim 81, wherein the annealing is performed in
the same container as at least one of the transcription steps.
85. The method of claim 60, wherein the method of enzymatic
incorporation comprises: (a) obtaining a polynucleotide template
comprising a promoter operatively linked to a first target
sequence, a loop sequence, and a second target sequence having 5'
and 3' ends and that is substantially the reverse complement of the
first target sequence; and (b) enzymatically incorporating
nucleotides into RNA by contacting the template with a reaction
mixture comprising an RNA polymerase and nucleotides to transcribe
the template to form an siRNA product
86. The method of claim 85, wherein the promoter is a T7, T3, or
SP6 promoter.
87. The method of claim 85, further comprising the step of
annealing the siRNA product to form a stem and loop siRNA
product.
88. The method of claim 85, wherein the template further comprises
an overhang encoding sequence attached to the 3' end of the second
target sequence.
89. The method of claim 88, wherein the overhang encoding sequence
comprises TT.
90. The method of claim 85, wherein the template further comprises
a leader sequence of about 10 nucleotides positioned between the
promoter and the first target sequence.
91. The method of claim 90, wherein the leader sequence comprises
SEQ ID NO:1.
92. The method of claim 90, wherein the leader sequence comprises
SEQ ID NO:2.
93. The method of claim 88, wherein the loop sequence is selected
such that the loop is resistant to nuclease digestion.
94. The method of claim 93, wherein the loop sequence is AAGC.
95. The method of claim 93, further comprising the step of
digesting the stem and loop siRNA product with a nuclease.
96. The method of claim 95, wherein the nuclease is RNase T1, RNase
A, RNase Sa, RNase Sa2, or RNase Sa3.
97. The method of claim 46, further defined as comprising obtaining
at least one modified nucleotide analog and incorporating the at
least one modified nucleotide analog into the siRNA and
incorporating the nucleotides into siRNA with a method comprising
chemical synthesis.
98. The method of claim 97, wherein the siRNA is further defined as
having reduced duplex stability.
99. The method of claim 97, wherein the modified nucleotide analog
is selected from the group consisting of aminoallyl UTP,
pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S ATP, alpha-S CTP,
alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP, 2'NH.sub.2 UTP,
2'NH.sub.2 CTP, and 2'F UTP.
100. A siRNA of increased potency comprising a duplex structure of
from 15 to 30 nucleotides that has a nucleotide sequence
substantially identical to at least a portion of a target gene.
101. The siRNA of claim 100, wherein the duplex structure is of
reduced stability.
102. The siRNA of claim 100, further defined as being produced by a
method comprising enzymatic synthesis.
103. The siRNA of claim 100, further defined as comprising at least
one nucleotide that is a modified nucleotide analog.
104. The siRNA of claim 103, wherein the modified nucleotide analog
is selected from the group consisting of aminoallyl UTP,
pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S ATP, alpha-S CTP,
alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP, 2'NH.sub.2 UTP,
2'NH.sub.2 CTP, and 2'F UTP.
105. The siRNA of claim 104, further defined as being produced by a
method comprising chemical synthesis.
106. The siRNA of claim 104, further defined as being produced by a
method comprising enzymatic synthesis.
107. The siRNA of claim 100, wherein the duplex structure is 15
nucleotides in length.
108. The siRNA of claim 100, wherein the duplex structure is 16
nucleotides in length.
109. The siRNA of claim 100, wherein the duplex structure is 17
nucleotides in length.
110. The siRNA of claim 100, wherein the duplex structure is 18
nucleotides in length.
111. The siRNA of claim 100, wherein the duplex structure is 19
nucleotides in length.
112. The siRNA of claim 100, wherein the duplex structure is 20
nucleotides in length.
113. The siRNA of claim 100, wherein the duplex structure is 21
nucleotides in length.
114. The siRNA of claim 100, wherein the duplex structure is 22
nucleotides in length.
115. The siRNA of claim 100, wherein the duplex structure is 23
nucleotides in length.
116. The siRNA of claim 100, wherein the duplex structure is 24
nucleotides in length.
117. The siRNA of claim 100, wherein the duplex structure is 25
nucleotides in length.
118. The siRNA of claim 100, wherein the duplex structure is 26
nucleotides in length.
119. The siRNA of claim 100, wherein the duplex structure is 27
nucleotides in length.
120. The siRNA of claim 100, wherein the duplex structure is 28
nucleotides in length.
121. The siRNA of claim 100, wherein the duplex structure is 29
nucleotides in length.
122. The siRNA of claim 100, wherein the duplex structure is 30
nucleotides in length.
123. The siRNA of claim 100, wherein the duplex structure is of
reduced stability.
124. A cell comprising a target gene whose expression is attenuated
by a method comprising: (a) obtaining siRNA of increased potency
comprising a duplex structure of from 15 to 30 nucleotides that has
a nucleotide sequence substantially identical to at least a portion
of a target gene; and (b) introducing the siRNA of increased
potency into the cell in an amount sufficient to attenuate
expression of the target gene.
125. A kit for making siRNA of increased potency comprising
nucleotides.
126. The kit of claim 125, further comprising at least one
polynucleotide template.
127. The kit of claim 126, further comprising at least one
component for enzymatic synthesis of siRNA of increased potency
128. The kit of claim 127, further comprising at least one
component for isolation and purification of siRNA of increased
potency.
129. A kit for attenuating expression of a target gene in a cell
comprising at least one siRNA of increased potency.
Description
[0001] The present application claims the benefit of U.S.
Provisional Application Serial No. 60/353,332 filed Feb. 1, 2002,
the entire text of which is herein incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to improved methods for making
small interfering RNA (siRNA), improved siRNA made by such methods,
their use in the modulation of gene expression in mammalian and
other cell types and their use in medical therapies.
[0004] 2. Description of Related Art
[0005] RNA interference (RNAi) is a phenomenon in which a double
stranded RNA (dsRNA) specifically suppresses the expression of a
gene bearing its complementary sequence. The phenomenon was
originally discovered in Caenorhabditis elegans by Fire and Mello
(Fire et al., 1998). RNAi has since become a useful research tool
for many organisms. Although the mechanism by which dsRNA
suppresses gene expression is not entirely understood, experimental
data provide important insights. In non-mammalian systems, it
appears that longer dsRNA are processed into small, 21-23 nt dsRNAs
by an enzyme containing RNase III motifs (Bernstein et al., 2001;
Grishok et al., 2001; Hamilton and Baulcombe, 1999; Knight and
Bass, 2001; Zamore et al., 2000). It has been theorized that the
RNAi nuclease complex, called RNA-induced silencing complex (RISC),
helps the small dsRNAs recognize complementary mRNAs through
base-pairing interactions. Following the siRNAs interaction with
its substrate, the mRNA is targeted for degradation, perhaps by
enzymes that are present in the RISC (Montgomery et al., 1998).
[0006] Until recently, RNAi could only be used in non-mammalian
cells. This is because mammalian cells have a potent antiviral
response pathway that induces global changes in gene expression
when the cells are challenged with long (>30 nucleotides) dsRNA
molecules. This pathway has made it impossible to specifically
suppress the expression of proteins in mammalian cells using the
typical RNAi molecules, which are hundreds of nucleotides long.
[0007] Recently Elbashir et al. (2001) published a method to bypass
the antiviral response and induce gene specific silencing in
mammalian cells. Several 21 nucleotide (nt) dsRNAs with 2 nt 3'
overhangs were transfected into mammalian cells without inducing
the antiviral response. These small dsRNAs, referred to as small
interfering RNAs (siRNAs) proved capable of inducing the specific
suppression of target genes. In one set of experiments, siRNAs
complementary to a luciferase gene were co-transfected with a
luciferase reporter plasmid into NIH3T3, COS-7, HeLaS3, and 293
cells. In all cases, the siRNAs were able to specifically reduce
luciferase gene expression. In addition, the authors demonstrated
that siRNAs could reduce the expression of several endogenous genes
in human cells. The endogenous targets were lamin A/C, lamin B1,
nuclear mitotic apparatus protein, and vimentin. The use of siRNAs
to modulate gene expression in mammalian cells has now been
repeated at least twice (Caplen et al., 2001; Hutvagner et al.,
2001). This technology has great potential as a tool to study gene
function in mammalian cells and may lead to the development of
pharmacological agents based upon siRNA.
[0008] To realize this potential, siRNAs must be designed so that
they are specific and effective in suppressing the expression of
the genes of interest. Methods of selecting the target sequences,
i.e. those sequences present in the gene or genes of interest to
which the siRNAs will guide the degradative machinery, are directed
to avoiding sequences that may interfere with the siRNA's guide
function while including sequences that are specific to the gene or
genes. Typically, siRNA target sequences of about 21 to 23
nucleotides in length are most effective. This length reflects the
lengths of digestion products resulting from the processing of much
longer RNAs as described above.
[0009] The making of siRNAs to date has been through direct
chemical synthesis or through processing of longer, double stranded
RNAs through exposure to Drosophila embryo lysates or through an in
vitro system derived from S2 cells. Use of cell lysates or in vitro
processing may further involve the subsequent isolation of the
short, 21-23 nucleotide siRNAs from the lysate, etc., making the
process somewhat cumbersome and expensive. Chemical synthesis
proceeds by making two single stranded RNA-oligomers followed by
the annealing of the two single stranded oligomers into a double
stranded RNA. Methods of chemical synthesis are diverse.
Non-limiting examples are provided in U.S. Pat. Nos. 5,889,136;
4,415,732; 4,458,066, expressly incorporated herein by reference,
and in Wincott et al. (1995).
[0010] Elbashir and colleagues have published the procedure that
they use to design, prepare, and transfect siRNAs for mammalian
RNAi experiments. ("The siRNA user guide" Aug. 26, 2001). Similar
protocols and procedures are available in Dharmacon Technical
Bulletin #003, July 2001. These guides recommend chemically
synthesizing two 21-mer RNA oligomers with two deoxythymidines at
the 3' terminus and 19 nucleotide complementary sequences. The two
ribo-oligomers are mixed to allow them to hybridize. The products
are then mixed with a transfection agent and added to cell culture
at concentrations of about 100 nM. The pamphlet further recommends
that the selection of the target sequence should be constrained so
that they begin with AA and end with TT, so that the AA and TT
overhang sequences may be fashioned from the target sequence
itself. The pamphlet indicates that the symmetric 3' overhangs aid
the formation of approximately equimolar ratios of sense and
antisense target RNA-cleaving siRNAs.
[0011] Several further modifications to siRNA sequences have been
suggested in order to alter their stability or improve their
effectiveness. It is suggested that synthetic complementary 21mer
RNAs having di-nucleotide overhangs (i.e. 19 complementary
nucleotides +3' non-complementary dimers) may provide the greatest
level of suppression, although actual data demonstrating this
advantage is lacking. These protocols primarily use a sequence of
two (2'-deoxy)thymidine nucleotides as the dinucleotide overhangs.
These dinucleotide overhangs are often written as dTdT to
distinguish them from the typical nucleotides incorporated into
RNA. The literature has indicated that the use of dT overhangs is
primarily motivated by the need to reduce the cost of the
chemically synthesized RNAs. It is also suggested that the dTdT
overhangs might be more stable than UU overhangs, though the data
available shows only a slight (<20%) improvement of the dTdT
overhang compared to an siRNA with a UU overhang.
[0012] To date, such chemically synthesized siRNAs are found to
work optimally when they are in cell culture at concentrations of
25-100 nM. Elbashir et al. used concentrations of about 100 nM to
achieve effective suppression of expression in mammalian cells.
Unfortunately, ribo-oligomers are very expensive to chemically
synthesize, making the procedure less appealing and not cost
effective to many researchers and pharmaceutical companies.
Furthermore, in foreseeable medical applications of siRNA, it would
be desirable to achieve target gene inhibition with as little siRNA
as possible. Therefore, siRNAs that are still as effective, if not
more so, at lower concentrations would be significantly
advantageous. There is therefore a need in the art for siRNAs that
function at lower concentrations to modulate or attenuate the
expression of target genes.
[0013] siRNAs have been most effective in mammalian cell culture at
about 100 nM. In several instances, however, lower concentrations
of chemically synthesized siRNA have been used. Caplen, et al. used
chemically synthesized siRNAs at 18 nM. However, Caplen used
semi-quantitative RT-PCR to monitor reduction of transcripts. The
semi-quantitative nature of the assay makes unclear how great an
effect this low concentration of siRNA had on transcript levels.
Hutvagner, et al. used chemically synthesized siRNAs at
concentrations of 70 nM to elicit a response. Although less than
100 nM, 70 nM may still represent a substantially prohibitive
concentration for some applications. Although Elbashir et al. also
indicated that they could use lower amounts of siRNA in the cell
culture and still observe suppression, they did not provide data
nor did they indicate by how much the expression was reduced at
these lower levels.
[0014] WO 99/32619 and WO 01/68836 suggest that RNA for use in
siRNA may be chemically or enzymatically synthesized. Both of these
texts are incorporated herein in their entirety by reference. The
enzymatic synthesis contemplated in these references is by a
cellular RNA polymerase or a bacteriophage RNA polymerase (e.g. T3,
T7, SP6) via the use and production of an expression construct as
is known in the art. For example, see U.S. Pat. No. 5,795,715. The
contemplated constructs provide templates that produce RNAs that
contain nucleotide sequences identical to a portion of the target
gene. The length of identical sequences provided by these
references is at least 25 bases, and may be as many as 400 or more
bases in length. An important aspect of this reference is that the
authors contemplate digesting longer dsRNAs to 21-25mer lengths
with the endogenous nuclease complex that converts long dsRNAs to
siRNAs in vivo. They do not describe or present data for
synthesizing and using in vitro transcribed 21-25mer dsRNAs. No
distinction is made between the expected properties of chemical or
enzymatically synthesized dsRNA in its use in RNA interference.
[0015] Similarly, WO 00/44914, incorporated herein by reference,
suggests that single strands of RNA can be produced enzymatically
or by partial/total organic synthesis. Preferably, single stranded
RNA is enzymatically synthesized from the PCR products of a DNA
template, preferably a cloned cDNA template and the RNA product is
a complete transcript of the cDNA, which may comprise hundreds of
nucleotides. WO 01/36646, incorporated herein by reference, places
no limitation upon the manner in which the siRNA is synthesized,
providing that the RNA may be synthesized in vitro or in vivo,
using manual and/or automated procedures. This reference also
provides that in vitro synthesis may be chemical or enzymatic, for
example using cloned RNA polymerase (e.g. T3, T7, SP6) for
transcription of the endogenous DNA (or cDNA) template, or a
mixture of both. Again, no distinction in the desirable properties
for use in RNA interference is made between chemically or
enzymatically synthesized siRNA.
[0016] U.S. Pat. No. 5,795,715 reports the simultaneous
transcription of two complementary DNA sequence strands in a single
reaction mixture, wherein the two transcripts are immediately
hybridized. The templates used are preferably of between 40 and 100
base pairs, and which is equipped at each end with a promoter
sequence. The templates are preferably attached to a solid surface.
After transcription with RNA polymerase, the resulting dsRNA
fragments may be used for detecting and/or assaying nucleic acid
target sequences. U.S. Pat. No. 5,795,715 was filed Jun. 17, 1994,
well before the phenomenon of RNA interference was described by
Fire et al. (1998). The production of siRNA was, therefore, not
contemplated by these authors.
[0017] As described above, there is a need for siRNAs of increased
potency, both for general research and for use as medical or
veterinary therapies. siRNAs of increased potency would decrease
the risk or adverse reactions or other, undesired effects of
medical therapies using siRNA. Fewer molecules of siRNA of
increased potency would be needed for such therapies, with
concomitant benefits to patients.
SUMMARY OF THE INVENTION
[0018] The present invention is directed to compositions and
methods useful in the production of double stranded RNAs (dsRNAs)
of increased potency for use as small interfering RNA (siRNA) in
the suppression of gene expression and the treatment of disease.
The invention provides methods of synthesis and use of siRNA that
result in less costly siRNA and siRNA of substantially and
significantly higher potency.
[0019] SiRNAs of increased potency are those wherein the provision
of fewer molecules of siRNA is effective in achieving modulation or
attenuation of gene expression when compared to the number of
standard siRNA molecules required to achieve the same level of
modulation or attenuation of target gene expression. Standard
siRNAs are those provided by typical chemical synthesis methods and
incorporating the usual, unmodified nucleotides that make up the
RNA polymer, i.e. adenine, cytosine, guanine, and uracil.
[0020] Potency of siRNA may be evaluated by a number of means as
will be appreciated by those of skill in the art. The level of
attenuation of gene expression may be compared between replicate
cells or organisms treated with equal molar amounts of standard and
siRNAs of increased potency designed to target the same target
sequence within a target gene or genes. Additionally, response
curves may be generated wherein levels of expression of a target
gene in response to varying concentrations of siRNAs are measured
and displayed for standard and siRNAs of increased potency
delivered to replicate cells or organisms. Other means of
comparison are contemplated. Generally, any means will suffice that
reveals that fewer molecules of a particular siRNA are required to
achieve the same level of modulation or attenuation as a standard
siRNA used under equivalent conditions and targeting the same
target sequence.
[0021] The use of siRNAs of increased potency therefore results in
an increased modulation or attenuation of gene expression in
comparison to standard siRNAs when both are used under identical
conditions. Such increased attenuation may be recognized in a
number of measures. Non limiting examples include altered gene
expression measurable through decreased transcript abundance,
decreased protein product abundance, decreased activity associated
with the protein product, or an altered phenotype associated with
the protein product. Such changes in expression or phenotype may be
large or small yet still reveal the high potency of the presently
disclosed siRNAs.
[0022] The choice of effect measured, the context of its
measurement, and the metric used all interact to determine the
absolute magnitude of the response. Nevertheless, the
identification of siRNA of increased potency is unambiguous even
though the relative effectiveness of standard and siRNAs of
increased potency may be indicated by small relative changes in
phenotype or expression levels.
[0023] A relative change in expression levels or phenotype may be
on the order of any level greater than 1% to 100%. Thus, in one
example, relative cell proliferation may be altered by about 2% at
an siRNA concentration of 1 nM (FIG. 10) and will be indicative of
the high potency of the siRNA provided by the present invention. In
another example, the relative transcript levels of a gene may be
reduced more effectively by siRNAs of increased potency of the
present invention across a continuous range of concentrations (FIG.
11), resulting in relative potency ranging continuously from
greater than 0% to 100%. siRNAs of increased potency may be 1%,
2,%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
45%, 50%, 60%, 70%, 80%, 90%, or 100% more potent. siRNAs of
increased potency may also be described as 1-, 2-, 3-, 4-, 5-, 6-,
7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 20-, 25-, 30-, 40-, 50-,
60-, 70-, 80-, 90-, 100-, 200-, and more fold more potent than
standard siRNAs. Potency may thus be further defined with respect
to specific processes used to determine potency. Particularly
preferred embodiments for calculating increased potency include the
comparison of the magnitudes or importance of the desired effects
of administering siRNAs of the present invention to the effects of
administering siRNAs made from standard or currently available
protocols.
[0024] The inventors have made the surprising discovery that the
method of synthesis of siRNA can dictate its potency. Specifically,
the inventors have discovered that enzymatic synthesis of siRNAs
through the methods of the present invention provides for siRNA
with substantially and significantly greater potency. In one
example, the optimal concentration of siRNA made by the present
invention for use in the transfection of cells is unexpectedly up
to 20-fold less than what is commonly used. Thus, these siRNAs of
increased potency may be 20-fold more potent than standard siRNAs.
Since siRNAs synthesized by the methods and compositions of the
present invention are unexpectedly, and significantly more potent
that those available otherwise, methods of use of these siRNAs are
provided that incorporate this highly surprising and unexpected
potency. These methods include methods of attenuating gene
expression in host cells, organs, tissues, and whole organisms.
[0025] An advantage of this aspect of the present invention lies in
providing for siRNA that may be enzymatically synthesized from a
great range of template sequences. Templates are provided that
contain structures specifically adapted for the efficient synthesis
of siRNAs of increased potency in a variety of situations without
limitation and for any target gene sequence that may be desired.
These siRNAs may be from 15 to 30 nucleotides in length, may
contain dinucleotide or other overhang sequences, may contain
modified nucleotides, or other modifications as desired. The
methods of the present invention also provide for the use of dT,
and other overhang sequences, as well as the incorporation of
modified nucleotide analogs, which may also increase effectiveness
of the siRNA.
[0026] Compositions of the present invention include
oligonucleotide and polynucleotide templates and methods for the
use of those templates in enzymatic synthesis of siRNA of increased
potency, which is employed in the specific inhibition of target
gene expression. The templates may comprise a polynucleotide
sequence comprising a target sequence. The target sequence may be
derived from the sequence of a target gene. A target gene is a gene
whose expression is targeted for interference, inhibition,
attenuation, disruption, augmentation, or other modulation.
Preferably, the expression is targeted for interference. Most
preferably the expression is targeted for attenuation.
[0027] The inventors have also made the surprising discovery that
incorporation of modified nucleotide analogs may increase the
potency of siRNA. Modified nucleotide analogs may be incorporated
in siRNAs through either enzymatic synthesis or chemical synthesis.
Enzymatic synthesis is the use of RNA polymerases to polymerize
nucleotides into single or double stranded RNA for use as siRNA
through the methods and compositions presently disclosed. Chemical
synthesis is the use of any other method to synthesize single or
double stranded RNA for use in siRNA.
[0028] The inventors have found that modified nucleotide analogs
increase the potency of siRNAs whether incorporated through
enzymatic or chemical synthesis. In particular, enzymatic
incorporation of modified nucleotide analogs produces even further
enhancement of siRNA potency over that achieved through enzymatic
synthesis alone. Modified nucleotide analogs incorporated through
chemical synthesis have also been found to unexpectedly enhance
siRNA potency. Increased potency of siRNA may thus be achieved
through the enzymatic synthesis of siRNA, through the incorporation
of modified nucleotide analogs through enzymatic synthesis, and
through the incorporation of modified nucleotide analogs through
chemical synthesis.
[0029] The inventors have also discovered that siRNAs wherein the
duplex structure of the double stranded RNA is of reduced stability
are significantly more potent. In particular, nucleotide analogs
that reduce the stability of RNA duplexes enhance the potency of
siRNAs.
[0030] RNA duplex stability may be measured by several methods, as
will be appreciated by one of skill in the art. A typical example
is the measurement of the melting temperature (TM) of the duplex in
a specified set of conditions, such as, but not limited to
specified salt concentrations, pH, etc. See, for example the
thermal melting analysis provided in U.S. Pat. No. 6,005,087,
incorporated herein by reference. Also see, generally, Sambrook
(2001), and by way of additional example, Dubins, et al. (2001) and
Testa et al. (1999). Reduced duplex stability may be on the order
of a 1%, 2,%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50% or more decrease in TM or like measure in
comparison to unmodified, or fully complementary, or other RNA,
DNA, or RNA/DNA duplexes. Reduced RNA duplex stability may be
further defined by the particular methods chosen, as will be
appreciated by one of skill in the art. Such methods can include
assays of siRNA potency as described above.
[0031] Reduced stability of the siRNA duplex may be achieved
through a variety of techniques. Nucleotide analogs, as described
above, may be introduced such that the resultant duplex of the
siRNA is of reduced stability. The following discussion is a
non-limiting list of possible modifications to be made to the siRNA
that may result in higher potency through reduced stability of the
siRNA duplex structure.
[0032] Phosphorothioates--Phosphorothioates reduce duplex stability
approximately 0.5.degree. C. to 1.degree. C. per modification. They
can be substituted at one or more nucleotide positions along the
length of the siRNA.
[0033] Inosine--Substitution of inosine (I) for G's at one or more
positions in the siRNA will reduce duplex stability and thereby
enhance siRNA potency. I:C base pairs form only two hydrogen bonds
(as opposed to three in G:C base-pairs), reducing the stability of
the duplex (Kawase et al. 1986).
[0034] 4-Thio uridine--4-thio uridine forms only a single hydrogen
bond with adenosine (Testa et al. 1999) and therefore the
substitution of one or more uracils (U) in the siRNA results in
duplex structures of reduced stability.
[0035] 4-Ethyl cytosine--4-ethyl cytosine forms only two hydrogen
bonds with guanosine, reducing the stability of G:C base-pairs
(Nguyen et al. 1997). Use of 4-ethyl cytosine at one or more
positions in the siRNA is expected to reduce stability of the
duplex structure.
[0036] 3-Nitropyrrole nucleoside and 5-nitroindole nucleoside
(5-nitroindole)--Both of these nucleosides hybridize to all four
natural nucleosides, but with lower affinity than canonical
base-pairs (Bergstrom et al. 1997). Thus, substitution of an
appropriate number of nucleotides of the siRNA with these
nucleosides will result in reduced overall duplex stability without
loss of appropriate sequence specificity. The selection of the
appropriate number and position of such nucleoside substitutions
are well within the skill of the ordinary artisan (Bergstrom et al.
1997).
[0037] Abasic sites--There are several nucleotide linkers that do
not have an associated base. These can be introduced at one or more
sites in the sense strand of the siRNA to eliminate one or more
base-pairs and reduce the stability of the siRNA duplex. Nucleic
acid helices with abasic sites have reduced melting temperatures,
i.e. reduced duplex stabilities. (Shishkina et al. 2000).
[0038] Mismatches--One or more mismatches can be introduced along
the length of the siRNA duplex. The mismatched bases should be in
the sense strand of the siRNA so as not to reduce the binding
affinity of the anti-sense strand for the mRNA target. The net
effect of such mismatches on duplex stability is the same as that
achieved by the other chemical substitutions described above. That
is, the stability of the duplex structure of the siRNA is reduced
relative to that of a completely and absolutely complementary match
between the two single strand sequences that make up the RNA
duplex.
[0039] All of the discoveries described are directed to the
modulation, especially the attenuation of the expression of a
target gene. The target gene may include sequences encoding
polypeptides or polynucleotide sequences that regulate the
replication, transcription, translation or other process important
to the expression of the gene. The target gene need not necessarily
encode a polypeptide but may encode other cellular components, such
as ribosomal RNA, splicosome RNA, transfer RNA, etc.
[0040] The target gene may exist as an endogenous gene, which
occurs naturally within a cell, or an exogenous gene, which does
not naturally occur within a cell. Exogenous genes may, for
example, be a transgene or synthetic gene, or a gene of a pathogen,
parasite, or commensal organism. Preferably, the target gene exists
within a vertebrate cell, although the invention is not limited to
the making of siRNA for use in vertebrate cells.
[0041] The target sequence may be the entire sequence of the target
gene, or, preferably, only a portion of the target gene.
Preferably, the target sequence is a contiguous subsequence of the
target gene sequence and is from 15 to 30 nucleotides in length.
The target sequence may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29 or 30 nucleotides in length. The size and
sequence of the target gene used as the target sequence may be
selected by those of skill in the art so as to optimize the
interfering effects of the product siRNAs.
[0042] Within a polynucleotide template for making siRNA, the
target sequence may be operatively linked to a promoter (FIG. 1).
Preferably, the promoter is a sequence sufficient to direct the
transcription of the template sequence into RNA when contacted with
RNA polymerase. Such promoters are well known to those of skill in
the art and include, but are not limited to the T7, T3, and SP6
promoters. Polymerases may be chosen so as to maximize the benefits
of enzymatic synthesis of siRNA. Such polymerases are well known to
those of skill in the art and include, but are not limited to the
T7, T3, SP6, polymerases and derivatives thereof. Such a choice is
within the skill of one in the art. In one embodiment, the
polymerase is selected from T7, T3, and SP6. In a preferred
embodiment, the polymerase is T7 RNA polymerase. Naturally, the
selection of appropriate polymerase is performed in conjunction
with the selection of appropriate promoter so that the polymerase
functionally recognizes the promoter, leading to the synthesis of
an RNA strand.
[0043] If operatively linked to a T7, T3, SP6 or similar promoter,
the target sequence may be contiguous with the promoter sequence
(FIG. 1). Milligan et al. (1987) reports the use of relatively
short template nucleotides in the synthesis of single-stranded RNA
products. In particular, Milligan et al. disclose necessary
sequence constraints imposed by the use of T7, T3, or SP6 RNA
polymerase promoters. Therefore, in an embodiment of the invention,
if the target sequence is contiguous with the promoter sequence,
the target sequence adjacent to the promoter sequence preferably
begins with the dinucleotide sequence of GG or GA.
[0044] However, the present invention in part provides compositions
and methods that surmount the limitations identified by Milligan et
al. by providing a template comprising at least one leader sequence
interposed between the promoter and the template sequence (FIG. 2
and FIG. 3). Thus, in another preferred embodiment, the target
sequence present in the polynucleotide template for making siRNA
may be operatively linked to a promoter without being contiguous
with it. A spacer or leader sequence may be interposed between the
promoter sequence and the target sequence of the template.
Preferably, such a leader sequence provides the dinucleotide
sequences of GG or GA that aid the efficient transcription from a
T7, T3, SP6 or similar promoter. Such a leader sequence may be any
length that does not interfere with the effective functioning of
the promoter. Such a leader sequence may be 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 40, or 50 or more nucleotides in length.
Preferably, the leader sequence is about 10 nt, but may be 9, 8, 7,
6, 5, 4, 3, or even 2 or 1 nt in length. In one embodiment, the
leader sequence is selected from SEQ ID NO: 1 and SEQ ID NO: 2. In
another embodiment, the leader sequence is that of SEQ ID NO: 1. In
another embodiment, the leader sequence is that of SEQ ID NO: 2. In
yet another embodiment, the leader sequences of two templates are
different sequences.
[0045] Of course, and as will be appreciated by those of skill in
the art, specifying the template sequence for enzymatic synthesis
is generally accomplished by listing the nucleotide sequence of the
template in the 5' to 3' direction, and by convention, as the top,
or sense strand of a double stranded duplex. (FIGS. 1-4). However,
the template sequence so specified in the context of the present
invention is not limited to the sense strand. For example, the
double stranded molecule, as discussed above, can function as a
template for RNA synthesis. Furthermore, the antisense strand alone
can function as a template for RNA synthesis. Therefore, following
convention, as used herein the description of polynucleotides will
be generally from 5' to 3' and will recite the sense strand,
although the invention is not limited to transcription from the
sense strand as listed, but will encompass both the sense and the
antisense (or bottom) strand and a single, antisense strand (FIGS.
1-4). Therefore, for example, the embodiments that comprise
templates comprising overhang encoding sequences comprising the
nucleotide sequence of TT, are designed so that the resultant RNA
strand formed comprises an overhang of UU or the like.
[0046] In preferred embodiments, the invention provides for RNases
that have activity in relation to the nucleotide sequences of the
leader sequence. Thus, RNase T1 preferentially digests
single-stranded RNA at G residues. RNase A preferentially digests
at C and U residues. If RNase T1 is to be used, the last nucleotide
in the leader sequence is preferred to be a G to eliminate the
entire leader sequence from the siRNA. Likewise, if RNase A is to
be used, the last nucleotide in the leader sequence should be a C
or U. In additional, preferred embodiments, the RNase may be RNase
Sa, RNase Sa2, or RNase Sa3. In a particularly preferred
embodiment, the RNase is RNase Sa.
[0047] In yet another preferred embodiment, the polynucleotide
template for synthesizing small interfering RNA comprises a
promoter, a target sequence, and a complementary sequence to the
target sequence positioned between the target sequence and the 3'
terminus of the template (FIG. 4).
[0048] The templates provided by the invention may be used in the
synthesis of siRNA of increased potency. The embodiments of the
synthesis methods preferably comprise the transcription of the
templates by RNA polymerase, annealing of the single stranded RNA
products to form double stranded RNA, and RNAse digestion to remove
unnecessary single stranded RNA from the double stranded RNA
product (FIGS. 2, 3, and 4).
[0049] In one preferred embodiment, the synthesized RNA is such
that it is partially self-complementary and so forms a stem and
loop structure (FIG. 4). In alternative and preferred embodiments,
two strands of RNA may be made that are substantially complementary
so that they form a duplex upon provision of appropriate conditions
(FIGS. 1, 2, and 3). In yet another preferred embodiment, a single
RNA strand may be synthesized that complements a template RNA
strand itself made through other means (RNA copying). Additionally,
a single RNA strand may be synthesized that complements a
pre-existing single stranded RNA molecule and allowed to form a
duplex therewith, forming a dsRNA functional as a siRNA of
increased potency. In a further preferred embodiment, the
synthesized RNA is further treated with nucleases in order to
digest or remove template nucleic acids or portions of the
synthesized RNA. In an additional preferred embodiment, once
synthesized, the RNA products may be purified or further
manipulated before use as siRNA. In an alternative embodiment, the
RNA products may be used directly without further manipulation.
[0050] In still more preferred embodiments, the siRNA includes
modifications to either the phosphate-sugar backbone or the
nucleoside. In one embodiment, the phosphodiester linkages of
natural RNA are modified to include at least one of a nitrogen or
sulfur hetero-atom. In another embodiment, bases may be modified to
block the activity of adenosine deaminase. In some embodiments, the
modified nucleotide analogs may be selected from the group of
aminoallyl UTP, pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S
ATP, alpha-S CTP, alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP,
2'NH.sub.2 UTP, 2'NH.sub.2 CTP, and 2'F UTP.
[0051] In preferred embodiments, modified nucleotide analogs are
incorporated into the synthesized siRNA that decrease duplex
stability. Modified nucleotide analogs may be incorporated through
enzymatic or chemical synthesis. In one preferred embodiment,
modified nucleotide analogs are incorporated through enzymatic
synthesis. In another preferred embodiment modified nucleotide
analogs are incorporated through chemical synthesis
[0052] siRNA can be introduced into cells in a number of ways.
Preferred embodiments include micro-injection, bombardment by
particles covered by the siRNA, soaking the cell or organism in a
solution of the siRNA, electroporation of cell membranes in the
presence of siRNA, liposome-mediated delivery of siRNA and
transfection mediated by chemicals such as polyamines, calcium
phosphate, viral infection, transformation, and the like. In
further preferred embodiments, siRNA is introduced along with
components that enhance RNA uptake by the cell, stabilize the
annealed strands, or otherwise increase inhibition of the target
gene. In a most preferred embodiment, cells are conveniently
incubated in a solution containing the siRNA.
[0053] In further embodiments, siRNA is delivered to a cell
indirectly by introducing one or more vectors that encode both
single strands of a siRNA (or, in the case of a self-complementary
RNA, the single self-complementary strand) into the cell. The
vectors of these embodiments contain elements of the templates
described above such that the RNA is transcribed inside the cell,
annealed to form siRNA and effects attenuation of the target gene
expression. See WO 99/32619, WO 00/44914, WO 01/68836 (each of
which is expressly incorporated herein by reference) and references
therein for further examples of methods known to the art for
introducing siRNA into cells.
[0054] Thus, in some embodiments of the present invention, a method
for making siRNA of increased potency comprises obtaining
nucleotides, and incorporating the nucleotides into siRNA such that
an RNA duplex of from 15 to 30 contiguous nucleotides is formed,
wherein the siRNA has a sequence that is substantially identical to
at least a portion of a selected target gene. In a preferred
embodiment, the siRNA is further defined as having reduced duplex
stability. In an additional preferred embodiment the siRNA is
further defined as comprising obtaining at least one modified
nucleotide analog and incorporating the at least one modified
nucleotide analog into the siRNA.
[0055] In additional, preferred embodiments, the modified
nucleotide analog is selected from the group consisting of
aminoallyl UTP, pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S
ATP, alpha-S CTP, alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP,
2'NH.sub.2 UTP, 2'NH.sub.2 CTP, and 2'F UTP.
[0056] In another preferred embodiemnt, the nucleotides or
nucleotide analogs may be incorporated into siRNA through enzymatic
synthesis. In one embodiement, the nucleotides or nucleotide
analogs may be incorporated into siRNA through chemical
synthesis.
[0057] In some embodiments the invention comprises a method of
attenuating the expression of a target gene, the method comprising
the steps of:
[0058] (a) obtaining a first polynucleotide template comprising a
first promoter operatively linked to a first target sequence that
has 5' and 3' ends that is substantially identical to at least a
portion of the target gene;
[0059] (b) obtaining a second polynucleotide template comprising a
second promoter operatively linked to a second target sequence that
has 5' and 3' ends and substantially the reverse complement of the
first target sequence of the first template;
[0060] (c) contacting the first template with a reaction mixture
comprising an RNA polymerase and nucleotides to transcribe the
first template to form a first RNA product;
[0061] (d) contacting the second template with a reaction mixture
comprising an RNA polymerase and nucleotides to transcribe the
second template to form a second RNA product;
[0062] (e) annealing the first and second RNA products to form a
double stranded RNA product; and
[0063] (f) introducing the double stranded RNA product into the
cell in an amount sufficient to attenuate expression of the target
gene.
[0064] Other preferred embodiments comprise the steps of:
[0065] (a) obtaining a polynucleotide template comprising a
promoter operatively linked to a first target sequence, a loop
sequence, and a second target sequence having 5' and 3' ends and
that is substantially the reverse complement of the first target
sequence;
[0066] (b) contacting the template with a reaction mixture
comprising an RNA polymerase and nucleotides to transcribe the
template to form an RNA product; and
[0067] (c) introducing the RNA product into the cell in an amount
sufficient to attenuate expression of the target gene.
[0068] In other embodiments a method of attenuating target gene
expression comprises the steps of:
[0069] (a) obtaining a single-stranded polynucleotide template
comprising a target sequence substantially identical to at least a
portion of the target gene;
[0070] (b) contacting the template with a reaction mixture
comprising an RNA replicase and nucleotides to synthesize RNA of a
complementary sequence to that of the target sequence so as to form
a double stranded RNA product; and
[0071] (c) introducing the double stranded RNA product into the
cell in an amount sufficient to attenuate expression of the target
gene.
[0072] Additional preferred embodiments comprise the steps of:
[0073] (a) obtaining a polynucleotide template comprising a
promoter operatively linked to a first target sequence, a loop
sequence, and a second target sequence having 5' and 3' ends and
that is substantially the reverse complement of the first target
sequence;
[0074] (b) enzymatically incorporating nucleotides into RNA by
contacting the template with a reaction mixture comprising an RNA
polymerase and nucleotides to transcribe the template to form an
RNA product;
[0075] (c) annealing the RNA product to form a stem and loop siRNA
product; and
[0076] (d) introducing the RNA product to a cell comprising a
target gene.
[0077] Further embodiments comprise the steps of:
[0078] (a) obtaining a polynucleotide template comprising a
promoter operatively linked to a first target sequence, a loop
sequence, and a second target sequence having 5' and 3' ends and
that is substantially the reverse complement of the first target
sequence;
[0079] (b) enzymatically incorporating nucleotides into RNA by
contacting the template with a reaction mixture comprising an RNA
polymerase and nucleotides to transcribe the template to form an
RNA product;
[0080] (c) introducing the RNA product to a cell comprising a
target gene; and
[0081] (d) annealing the RNA product to form a stem and loop siRNA
product within the cell.
[0082] Further preferred embodiments comprise the steps of treating
the template nucleotides with an appropriate nuclease, e.g. DNase
or similar enzyme, to remove template nucleic acids. Yet another
preferred embodiment comprises the steps of treating the enzymatic
or chemically synthesized dsRNA with RNases to remove single
stranded leader sequences or other, undesired sequences.
[0083] Surprisingly and unexpectedly, siRNAs of from 15 to 30
nucleotides in length made through these embodiments of the
invention are significantly more potent than siRNAs of the same
length made through standard chemical synthesis or without
appropriate incorporation of modified nucleotide analogs.
[0084] Any of the compositions described herein may be comprised in
a kit formulated for performing the methods disclosed. In a
non-limiting example the kits may comprise, in suitable container
means, a promoter primer, corresponding polymerases, reagents and
materials for performing the methods of the invention. In another
non-limiting example, the kits may comprise in a suitable container
means, modified nucleotide analogs, reagents and materials for
incorporation of the modified nucleotide analogs through chemical
synthesis means. In a further example, the kits may comprise siRNAs
that have incorporated in them modified nucleotide analogs that
reduce dsRNA duplex stability.
[0085] The kits may comprise compositions of the present invention
in suitable aliquots, whether labeled or unlabeled, as may be used
to practice the methods of the invention. The components of the
kits may be packaged either in aqueous media or in lyophilized
form. The container means of the kits will generally include at
least one vial, test tube, flask, bottle, syringe or other
container means, into which a component may be placed, and
preferably, in suitable aliquots. Where there is more than one
component in the kit, the kit also will generally contain a second,
third or other additional container into which the additional
components may be separately placed. However, various combinations
of components may be comprised in a vial. kits may also contain
cells in which the expression of target genes is attenuated by the
methods of the present invention.
[0086] Therapeutic kits of the present invention are kits
comprising a promoter, a polymerase, and the reagents, agents, and
materials that may be required to practice the methods of the
invention, including, but not limited to those reagents necessary
for transfection or transformation of cells with siRNA. Such kits
may also comprise siRNA made by the methods of the present
invention. Such kits will generally contain, in suitable container
means, a pharmaceutically acceptable formulation of siRNA made by
the methods of the present invention. Such kits may also contain
cells in which the expression of target genes is attenuated by the
methods of the present invention. The kit may have a single
container means, and/or it may have distinct container means for
each compound or each reaction mixture or step.
[0087] When the components of the kit are provided in one and/or
more liquid solutions, the liquid solution is an aqueous solution,
with a sterile aqueous solution being particularly preferred. The
compositions may also be formulated into a syringeable composition.
In which case, the container means may itself be a syringe,
pipette, and/or other such like apparatus, from which the
formulation may be applied to an infected area of the body,
injected into an animal, and/or even applied to and/or mixed with
the other components of the kit. However, the components of the kit
may be provided as dried powder(s). When reagents and/or components
are provided as a dry powder, the powder can be reconstituted by
the addition of a suitable solvent. It is envisioned that the
solvent may also be provided in another container means.
[0088] The container means will generally include at least one
vial, test tube, flask, bottle, syringe and/or other container
means, into which the siRNA or cells in which the expression of
target gene or genes is attenuated are placed, preferably, suitably
allocated. The kits may also comprise a second container means for
containing a sterile, pharmaceutically acceptable buffer and/or
other diluent. The kits of the present invention also will
typically include a means for containing the materials for
practicing the methods of the invention, and any other reagent
containers in close confinement for commercial sale. Such
containers may include injection or blow-molded plastic containers
into which the desired vials are retained. Irrespective of the
number or type of containers, the kits of the invention may also
comprise, or be packaged with, an instrument for assisting with the
injection/administration and/or placement of the ultimate cells in
which the expression of a target gene or genes is attenuated within
the body of an animal. Such an instrument may be a syringe,
pipette, forceps, and/or any such medically approved delivery
vehicle.
[0089] Following long-standing patent law, the words "a" and "an,"
when used in conjunction with the word "comprising" in the claims
or specification, denotes one or more.
BRIEF DESCRIPTION OF THE DRAWINGS
[0090] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0091] FIG. 1: Production of siRNA by transcription of templates
without leader sequences.
[0092] FIG. 2: Production of siRNA by transcription of templates
with leader sequences and subsequent digestion by RNase T1.
[0093] FIG. 3: Production of siRNA by transcription of templates
with leader sequences and subsequent digestion with RNase A.
[0094] FIG. 4: Production of siRNA by transcription of templates
encoding hairpin structures.
[0095] FIG. 5: c-myc mRNA transcript organization. The locations of
siRNAs made are indicated by the boxes above the line representing
the transcript.
[0096] FIG. 6: Relative cell proliferation (as compared to a
buffer-transfected control) of HeLa cells transfected with the
various siRNAs to c-myc, as well as with the optimized antisense
oligonucleotide, 48 hr after transfection.
[0097] FIG. 7: Immunofluorescence experiments using an anti-myc
antibody were used to measure c-myc protein levels to confirm that
siRNAs were reducing expression of c-myc.
[0098] FIG. 8: The siRNA against the 3' UTR leads to a drastic
reduction in c-myc protein levels.
[0099] FIG. 9: Relative reduction in GAPDH mRNA levels in siRNA
transfected cells versus untreated cells.
[0100] FIG. 10: Comparison of siRNA effectiveness between
enzymatically synthesized and siRNA made through standard chemical
synthesis in attenuation of c-myc mediated cell proliferation.
[0101] FIG. 11: Comparison of siRNA effectiveness between
enzymatically synthesized and siRNA made through standard chemical
synthesis in expression of GAPDH mRNA.
[0102] FIG. 12: Comparison of siRNA effectiveness between siRNA
made through standard chemical synthesis and enzymatically
synthesized siRNA via RNA copying in attenuation of c-myc mediated
cell proliferation.
[0103] FIG. 13: Impact of Nucleotide Analogs on siRNA Potency in
enzymatically synthesized siRNA.
DETAILED DESCRIPTION OF THE INVENTION
[0104] The present invention provides a method for preparing
double-stranded RNA molecules that are of increased potency when
used to modulate or attenuate gene expression in cells, tissues,
organs, and organisms. The method includes enzymatic polymerization
of individual ribonucleotides in a sequence that effectively
matches or hybridizes with the nucleotide sequence of a target
gene, thereby facilitating the specific modulation of target gene
expression. Surprisingly, such enzymatic preparation of dsRNA
yields siRNA that is many fold more potent in modulating gene
expression than corresponding siRNA prepared through chemical
synthesis.
[0105] The methods of the present invention therefore provide for
much more efficient and cost-effective means for producing and
using siRNA in RNA interference applications, which include a wide
range of research, industrial, and medical processes, materials,
and applications. Medical applications include, by way of example,
anti-viral compositions and therapies, anti-tumor compositions and
therapies, and compositions and therapies for inherited disorders.
One example of the latter application would be the enzymatic
synthesis of siRNA for use in therapies to treat autosomal dominant
genetic disease such as Huntington's chorea. Additional examples of
therapeutic uses include the management of transplant rejection
through the treatment of tissues to be introduced into a subject
with the siRNAs of the invention in order to modulate or attenuate
the expression of genes promoting transplant rejection. For
example, hepatocytes may be incubated with enzymatically
synthesized siRNA designed to attenuate expression of genes that
prompt a host immune response.
[0106] The siRNA provided by the present invention allows for the
modulation and especially the attenuation of target gene expression
when such a gene is present and liable to expression within a cell.
Modulation of expression can be partial or complete inhibition of
gene function, or even the up-regulation of other, secondary target
genes or the enhancement of expression of such genes in response to
the inhibition of the primary target gene. Attenuation of gene
expression may include the partial or complete suppression or
inhibition of gene function, transcript processing or translation
of the transcript. In the context of RNA interference, modulation
of gene expression is thought to proceed through a complex of
proteins and RNA, specifically including small, dsRNA that may act
as a "guide" RNA. The siRNA therefore is thought to be effective
when its nucleotide sequence sufficiently corresponds to at least
part of the nucleotide sequence of the target gene. Although the
present invention is not limited by this mechanistic hypothesis, it
is highly preferred that the sequence of nucleotides in the siRNA
be substantially identical to at least a portion of the target gene
sequence.
[0107] A target gene generally means a polynucleotide comprising a
region that encodes a polypeptide, or a polynucleotide region that
regulates replication, transcription or translation or other
processes important tot expression of the polypeptide, or a
polynucleotide comprising both a region that encodes a polypeptide
and a region operably linked thereto that regulates expression. The
targeted gene can be chromosomal (genomic) or extrachromosomal. It
may be endogenous to the cell, or it may be a foreign gene (a
transgene). The foreign gene can be integrated into the host
genome, or it may be present on an extrachromosomal genetic
construct such as a plasmid or a cosmid. The targeted gene can also
be derived from a pathogen, such as a virus, bacterium, fungus or
protozoan, which is capable of infecting an organism or cell.
Target genes may be viral and pro-viral genes that do not elicit
the interferon response, such as retroviral genes. The target gene
may be a protein-coding gene or a non-protein coding gene, such as
a gene which codes for ribosmal RNAs, splicosomal RNA, tRNAs,
etc.
[0108] Any gene being expressed in a cell can be targeted.
Preferably, a target gene is one involved in or associated with the
progression of cellular activities important to disease or of
particular interest as a research object. Thus, by way of example,
the following are classes of possible target genes that may be used
in the methods of the present invention to modulate or attenuate
target gene expression: developmental genes (e.g. adhesion
molecules, cyclin kinase inhibitors, Wnt family members, Pax family
members, Winged helix family members, Hox family members,
cytokines/lymphokines and their receptors, growth or
differentiation factors and their receptors, neurotransmitters and
their receptors), oncogenes (e.g. ABLI, BLC1, BCL6, CBFA1, CBL,
CSFIR, ERBA, ERBB, EBRB2, ETS1, ETS1, ETV6, FGR, FOX, FYN, HCR,
HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCL1, MYCN, NRAS,
PIM1, PML, RET, SRC, TAL1, TCL3 and YES), tumor suppresser genes
(e.g. APC, BRCA1, BRCA2, MADH4, MCC, NF1, NF2, RB1, TP53 and WT1),
and enzymes (e.g. ACP desaturases and hycroxylases, ADP-glucose
pyrophorylases, ATPases, alcohol dehycrogenases, amylases,
amyloglucosidases, catalases, cellulases, cyclooxygenases,
decarboxylases, dextrinases, esterases, DNA and RNA polymerases,
galactosidases, glucanases, glucose oxidases, GTPases, helicases,
hemicellulases, integrases, invertases, isomersases, kinases,
lactases, lipases, lipoxygenases, lysozymes, pectinesterases,
peroxidases, phosphatases, phospholipases, phophorylases,
polygalacturonases, proteinases and peptideases, pullanases,
recombinases, reverse transcriptases, topoisomerases,
xylanases).
[0109] The nucleotide sequence of the siRNA is defined by the
nucleotide sequence of its target gene. The siRNA contains a
nucleotide sequence that is essentially identical to at least a
portion of the target gene. Preferably, the siRNA contains a
nucleotide sequence that is completely identical to at least a
portion of the target gene. Of course, when comparing an RNA
sequence to a DNA sequence, an "identical" RNA sequence will
contain ribonucleotides where the DNA sequence contains
deoxyribonucleotides, and further that the RNA sequence will
typically contain a uracil at positions where the DNA sequence
contains thymidine.
[0110] A siRNA comprises a double stranded structure, the sequence
of which is "substantially identical" to at least a portion of the
target gene. "Identity," as known in the art, is the relationship
between two or more polynucleotide (or polypeptide) sequences, as
determined by comparing the-sequences. In the art, identity also
means the degree of sequence relatedness between polynucleotide
sequences, as determined by the match of the order of nucleotides
between such sequences. Identity can be readily calculated. See,
for example: Computational Molecular Biology, Lesk, A.M., ed.
Oxford University Press, New York, 1988; Biocomputing: Informatics
and Genome Projects, Smith, D. W., ed., Academic Press, New York,
1993; and the methods disclosed in WO 99/32619, WO 01/68836, WO
00/44914, and WO 01/36646, specifically incorporated herein by
reference. While a number of methods exist for measuring identity
between two nucleotide sequences, the term is well known in the
art. Methods for determining identity are typically designed to
produce the greatest degree of matching of nucleotide sequence and
are also typically embodied in computer programs. Such programs are
readily available to those in the relevant art. For example, the
GCG program package (Devereux et al.), BLASTP, BLASTN, and FASTA
(Atschul et al.) and CLUSTAL (Higgins et al., 1992; Thompson, et
al., 1994).
[0111] One of skill in the art will appreciate that two
polynucleotides of different lengths may be compared over the
entire length of the longer fragment. Alternatively, small regions
may be compared. Normally sequences of the same length are compared
for a final estimation of their utility in the practice of the
present invention. It is preferred that there be 100% sequence
identity between the dsRNA for use as siRNA and at least 15
contiguous nucleotides of the target gene, although a dsRNA having
70%, 75%, 80%, 85%, 90%, or 95% or greater may also be used in the
present invention. A siRNA that is essentially identical to a least
a portion of the target gene may also be a dsRNA wherein one of the
two complementary strands (or, in the case of a self-complementary
RNA, one of the two self-complementary portions) is either
identical to the sequence of that portion or the target gene or
contains one or more insertions, deletions or single point
mutations relative to the nucleotide sequence of that portion of
the target gene. siRNA technology thus has the property of being
able to tolerate sequence variations that might be expected to
result from genetic mutation, strain polymorphism, or evolutionary
divergence.
[0112] Alternatively, a siRNA that is "essentially identical to at
least a portion of the target gene can be functionally a dsRNA
wherein one of the two complementary strands (or, in the case of a
self-complementary RNA, one of the two self-complementary portions)
is capable of hybridizing with a portion of the target gene
transcript (e.g. under conditions including 400 mM NaCl, 40 mM
PIPES pH 6.4, 1 mM EDTA, 50 degrees C. or 70 degrees C.
hybridization for 12-26 hours; followed by washing).
[0113] RNA (ribonucleic acid) is known to be the transcription
product of a molecule of DNA (deoxyribonucleic acid) synthesized
under the action of an enzyme, DNA-dependent RNA polymerase. There
are diverse applications of the obtaining of specific RNA
sequences, such as, for example, the synthesis of RNA probes or of
oligoribonucleotides (Milligan et al.), or the expression of genes
(see, in particular, Steen et al, Fuerst, et al. and Patent
Applications WO 91/05,866 and EP 0,178,863), or alternatively gene
amplification as described by Kievits, et al. and Kwoh et al. or in
Patent Applications WO 88/10,315 and WO 91/02,818, and U.S. Pat.
No. 5,795,715, all of which are expressly incorporated herein by
reference.
[0114] One of the distinctive features of most DNA-dependent RNA
polymerases is that of initiating RNA synthesis according to a DNA
template from a particular start site as a result of the
recognition of a nucleic acid sequence, termed a promoter, which
makes it possible to define the precise localization and the strand
on which initiation is to be effected. Contrary to DNA-dependent
DNA polymerases, polymerization by DNA-dependent RNA polymerases is
not initiated from a 3'-OH end, and their natural substrate is an
intact DNA double strand.
[0115] Compared to bacterial, eukaryotic or mitochondrial RNA
polymerases, phage RNA polymerases are very simple enzymes. Among
these, the best known are the RNA polymerases of bacteriophages T7,
T3 and SP6. These enzymes are very similar to one another, and are
composed of a single subunit of 98 to 100 kDa. Two other phage
polymerases share these similarities: that of Klebsiella phage K11
and that of phage BA14 (Diaz et al.). Any DNA dependent RNA
polymerase is expected to perform in conjunction with a
functionally active promoter as desired in the present invention.
These include, but are not limited to the above listed polymerases,
active mutants thereof, E. coli RNA polymerase, and RNA polymerases
I., II, and III from a variety of eukaryotic organisms.
[0116] Initiation of transcription with T7, SP6 RNA and T3 RNA
Polymerases is highly specific for the T7, SP6 and T3 phage
promoters, respectively. The properties and utility of these
polymerases are well known to the art. Their properties and sources
are described in U.S. Pat. Nos. (T7) U.S. Pat. Nos. 5,869,320;
4,952,496; 5,591,601; 6,114,152; (SP6) U.S. Pat. No. 5,026,645;
(T3) U.S. Pat. Nos. 5,102,802; 5,891,681; 5,824,528; 5,037,745, all
of which are expressly incorporated herein by reference.
[0117] Reaction conditions for use of these RNA polymerases are
well known in the art, and are exemplified by those conditions
provided in the examples and references. The result of contacting
the appropriate template with an appropriate polymerase is the
synthesis of an RNA product, which is typically single-stranded.
Although under appropriate conditions, double stranded RNA may be
made from a double stranded DNA template. See U.S. Pat. No.
5,795,715, incorporated herein by reference. The process of
sequence specific synthesis may also be known as transcription, and
the product the transcript, whether the product represents an
entire, functional gene product or not.
[0118] dsRNA for use as siRNA may also be enzymatically synthesized
through the use of RNA dependent RNA polymerases such as Q beta
replicase, Tobacco mosaic virus replicase, brome mosaic virus
replicase, potato virus replicase, etc. Reaction conditions for use
of these RNA polymerases are well known in the art, and are
exemplified by those conditions provided in the examples and
references. Also see U.S. Pat. No. RE35,443, and U.S. Pat. No.
4,786,600, both of which are incorporated herein by reference. The
result of contacting the appropriate template with an appropriate
polymerase is the synthesis of an RNA product, which is typically
double-stranded. Employing these RNA dependent RNA polymerases
therefore may utilize a single stranded RNA or single stranded DNA
template. If utilizing a single stranded DNA template, the
enzymatic synthesis results in a hybrid RNA/DNA duplex that is also
contemplated as useful as siRNA.
[0119] The templates for enzymatic synthesis of siRNA are nucleic
acids, typically, though not exclusively DNA. A nucleic acid may be
made by any technique known to one of ordinary skill in the art.
Non-limiting examples of synthetic nucleic acid, particularly a
synthetic oligonucleotide, include a nucleic acid made by in vitro
chemical synthesis using phosphotriester, phosphite or
phosphoramidite chemistry and solid phase techniques such as
described in EP 266,032, incorporated herein by reference, or via
deoxynucleoside H-phosphonate intermediates as described by
Froehler et al., 1986, and U.S. Pat. No. 5,705,629, each
incorporated herein by reference. A non-limiting example of
enzymatically produced nucleic acid include one produced by enzymes
in amplification reactions such as PCR.TM. (see, for example, U.S.
Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated
herein by reference), or the synthesis of oligonucleotides
described in U.S. Pat. No. 5,645,897, incorporated herein by
reference. A non-limiting example of a biologically produced
nucleic acid includes recombinant nucleic acid production in living
cells (see for example, Sambrook, 2001, incorporated herein by
reference).
[0120] A nucleic acid may be purified on polyacrylamide gels,
cesium chloride centrifugation gradients, or by any other means
known to one of ordinary skill in the art (see for example,
Sambrook (2001), incorporated herein by reference).
[0121] The term "nucleic acid" will generally refer to at least one
molecule or strand of DNA, RNA or a derivative or mimic thereof,
comprising at least one nucleotide base, such as, for example, a
naturally occurring purine or pyrimidine base found in DNA (e.g.,
adenine "A," guanine "G," thymine "T," and cytosine "C") or RNA
(e.g. A, G, uracil "U," and C). The term "nucleic acid" encompasses
the terms "oligonucleotide" and "polynucleotide." These definitions
generally refer to at least one single-stranded molecule, but in
specific embodiments will also encompass at least one additional
strand that is partially, substantially or fully complementary to
the at least one single-stranded molecule. Thus, a nucleic acid may
encompass at least one double-stranded molecule or at least one
triple-stranded molecule that comprises one or more complementary
strand(s) or "complement(s)" of a particular sequence comprising a
strand of the molecule.
[0122] As will be appreciated by one of skill in the art, the
useful form of nucleotide or modified nucleotide to be incorporated
will be dictated largely by the nature of the synthesis to be
performed. Thus, for example, enzymatic synthesis typically
utilizes the free form of nucleotides and nucleotide analogs,
typically represented as nucleotide triphospates, or NTPs. These
forms thus include, but are not limited to aminoallyl UTP,
pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S ATP, alpha-S CTP,
alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP, 2'NH.sub.2 UTP,
2'NH.sub.2 CTP, and 2'F UTP. As will also be appreciated by one of
skill in the art, the useful form of nucleotide for chemical
syntheses may be typically represented as aminoallyl uridine,
pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine, alpha-S
adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S uridine,
4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine, 2'NH.sub.2
cytidine, and 2'F uridine. In the present invention, the listing of
either form is non-limiting in that the choice of nucleotide form
will be dictated by the nature of the synthesis to be performed. In
the present invention, then, the inventors use the terms aminoallyl
uridine, pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine,
alpha-S adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S
uridine, 4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine,
2'NH.sub.2 cytidine, and 2'F uridine generically to refer to the
appropriate nucleotide or modified nucleotide, including the free
phosphate (NTP) forms as well as all other useful forms of the
nucleotides.
[0123] In certain embodiments, a "gene" refers to a nucleic acid
that is transcribed. As used herein, a "gene segment" is a nucleic
acid segment of a gene. In certain aspects, the gene includes
regulatory sequences involved in transcription, or message
production or composition. In particular embodiments, the gene
comprises transcribed sequences that encode for a protein,
polypeptide or peptide. In other particular aspects, the gene
comprises a nucleic acid, and/or encodes a polypeptide or
peptide-coding sequences of a gene that is defective or mutated in
a hematopoietic and lympho-hematopoietic disorder. In keeping with
the terminology described herein, an "isolated gene" may comprise
transcribed nucleic acid(s), regulatory sequences, coding
sequences, or the like, isolated substantially away from other such
sequences, such as other naturally occurring genes, regulatory
sequences, polypeptide or peptide encoding sequences, etc. In this
respect, the term "gene" is used for simplicity to refer to a
nucleic acid comprising a nucleotide sequence that is transcribed,
and the complement thereof. In particular aspects, the transcribed
nucleotide sequence comprises at least one functional protein,
polypeptide and/or peptide encoding unit. As will be understood by
those in the art, this functional term "gene" includes both genomic
sequences, RNA or cDNA sequences, or smaller engineered nucleic
acid segments, including nucleic acid segments of a non-transcribed
part of a gene, including but not limited to the non-transcribed
promoter or enhancer regions of a gene. Smaller engineered gene
nucleic acid segments may express, or may be adapted to express
using nucleic acid manipulation technology, proteins, polypeptides,
domains, peptides, fusion proteins, mutants and/or such like. Thus,
a "truncated gene" refers to a nucleic acid sequence that is
missing a stretch of contiguous nucleic acid residues.
[0124] Various nucleic acid segments may be designed based on a
particular nucleic acid sequence, and may be of any length. By
assigning numeric values to a sequence, for example, the first
residue is 1, the second residue is 2, etc., an algorithm defining
all nucleic acid segments can be created:
n to n+y
[0125] where n is an integer from 1 to the last number of the
sequence and y is the length of the nucleic acid segment minus one,
where n+y does not exceed the last number of the sequence. Thus,
for a 10-mer, the nucleic acid segments correspond to bases 1 to
10, 2 to 11, 3 to 12 . . . and/or so on. For a 15-mer, the nucleic
acid segments correspond to bases 1 to 15, 2 to 16, 3 to 17 . . .
and/or so on. For a 20-mer, the nucleic segments correspond to
bases 1 to 20, 2 to 21, 3 to 22 . . . and/or so on.
[0126] The nucleic acid(s) of the present invention, regardless of
the length of the sequence itself, may be combined with other
nucleic acid sequences, including but not limited to, promoters,
enhancers, polyadenylation signals, restriction enzyme sites,
multiple cloning sites, coding segments, and the like, to create
one or more nucleic acid construct(s). The overall length may vary
considerably between nucleic acid constructs. Thus, a nucleic acid
segment of almost any length may be employed, with the total length
preferably being limited by the ease of preparation or use in the
intended protocol.
[0127] To obtain the RNA corresponding to a given template sequence
through the action of an RNA polymerase, it is necessary to place
the target sequence under the control of the promoter recognized by
the RNA polymerase.
[0128] A "promoter" is a control sequence that is a region of a
nucleic acid sequence at which initiation and rate of transcription
are controlled. It may contain genetic elements at which regulatory
proteins and molecules may bind, such as RNA polymerase and other
transcription factors, to initiate the specific transcription a
nucleic acid sequence. The phrases "operatively positioned,"
"operatively linked," "under control," and "under transcriptional
control" mean that a promoter is in a correct functional location
and/or orientation in relation to a nucleic acid sequence to
control transcriptional initiation and/or expression of that
sequence.
[0129] A promoter generally comprises a sequence that functions to
position the start site for RNA synthesis. The best known example
of this is the TATA box, but in some promoters lacking a TATA box,
such as, for example, the promoter for the mammalian terminal
deoxynucleotidyl transferase gene and the promoter for the SV40
late genes, a discrete element overlying the start site itself
helps to fix the place of initiation. Additional promoter elements
regulate the frequency of transcriptional initiation. Typically,
these are located in the region 30-110 bp upstream of the start
site, although a number of promoters have been shown to contain
functional elements downstream of the start site as well. To bring
a coding sequence "under the control of" a promoter, one positions
the 5' end of the transcription initiation site of the
transcriptional reading frame "downstream" of (i.e., 3' of) the
chosen promoter. The "upstream" promoter stimulates transcription
of the DNA and synthesis of the RNA.
[0130] The spacing between promoter elements frequently is
flexible, so that promoter function is preserved when elements are
inverted or moved relative to one another. The spacing between
promoter elements can be increased to 50 bp apart before activity
begins to decline. Depending on the promoter, it appears that
individual elements can function either cooperatively or
independently to activate transcription. A promoter may or may not
be used in conjunction with an "enhancer," which refers to a
cis-acting regulatory sequence involved in the transcriptional
activation of a nucleic acid sequence.
[0131] T7, T3, or SP6 RNA polymerases display a high fidelity to
their respective promoters. The natural promoters specific for the
RNA polymerases of phages T7, T3 and SP6 are well known.
Furthermore, consensus sequences of promoters are known to be
functional as promoters for these polymerases. The bacteriophage
promoters for T7, T3, and SP6 consist of 23 bp numbered -17 to +6,
where +1 indicates the first base of the coded transcript. An
important observation is that, of the +1 through +6 bases, only the
base composition of +1 and +2 are critical and must be a G and
purine, respectively, to yield an efficient transcription template.
In addition, synthetic oligonucleotide templates only need to be
double-stranded in the -17 to -1 region of the promoter, and the
coding region can be all single-stranded. (See Milligan et al.)
This can reduce the cost of synthetic templates, since the coding
region (i.e., from +1 on) can be left single-stranded and the short
oligonucleotides required to render the promoter region
double-stranded can be used with multiple templates. A further
discussion of consensus promoters and a source of naturally
occurring bacteriophage promoters is U.S. Pat. No. 5,891,681,
specifically incorporated herein by reference.
[0132] Use of a T7, T3 or SP6 cytoplasmic expression system is
another possible embodiment. Eukaryotic cells can support
cytoplasmic transcription from certain bacterial promoters if the
appropriate bacterial polymerase is provided, either as part of the
delivery complex or as an additional genetic expression
construct.
[0133] When made in vitro, siRNA is formed from one or more strands
of polymerized ribonucleotide. When formed of only one strand, it
takes the form of a self-complementary hairpin-type or stem and
loop structure that doubles back on itself to form a partial
duplex. The self-duplexed portion of the RNA molecule may be
referred to as the "stem" and the remaining, connecting single
stranded portion referred to as the "loop" of the stem and loop
structure (FIG. 4). When made of two strands, they are
substantially complementary (FIGS. 1, 2, and 3).
[0134] The cell containing the target gene may be derived from or
contained in any organism (e.g. plant, animal, protozoan, virus,
bacterium, or fungus). The plant may be a monocot, dicot or
gynmosperm; the animal may be a vertebrate or invertebrate.
Preferred microbes are those used in agriculture or by industry,
and those that a pathogenic for plants or animals. Fungi include
organisms in both the mold and yeast morphologies. Examples of
vertebrates include fish and mammals, including cattle, goat, pig,
sheep, hamster, mouse, rate and human; invertebrate animals include
nematodes, insects, arachnids, and other arthropods. Preferably,
the cell is a vertebrate cell. More preferably, the cell is a
mammalian cell.
[0135] The cell having the target gene may be from the germ line or
somatic, totipotent or pluripotent, dividing or non-dividing,
parenchyma or epithelium, immortalized or transformed, or the like.
The cell can be a gamete or an embryo; if an embryo, it can be a
single cell embryo or a constituent cell or cells from a
multicellular embryo. The term "embryo" thus encompasses fetal
tissue. The cell having the target gene may be an undifferentiated
cell, such as a stem cell, or a differentiated cell, such as from a
cell of an organ or tissue, including fetal tissue, or any other
cell present in an organism. Cell types that are differentiated
include adipocytes, fibroblasts, myocytes, cardiomyocytes,
endothelium, neurons, glia, blood cells, megakaryocytes,
lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast
cells, leukocytes, granulocytes, keratinocytes, chondrocytes,
osteoblasts, osteoclasts, hepatocytes, and cells, of the endocrine
or exocrine glands.
[0136] As used herein, the terms "cell," "cell line," and "cell
culture" may be used interchangeably. All of these terms also
include their progeny, which is any and all subsequent generations
formed by cell division. It is understood that all progeny may not
be identical due to deliberate or inadvertent mutations. A host
cell may be "transfected" or "transformed," which refers to a
process by which exogenous nucleic acid is transferred or
introduced into the host cell. A transformed cell includes the
primary subject cell and its progeny. As used herein, the terms
"engineered" and "recombinant" cells or host cells are intended to
refer to a cell into which an exogenous nucleic acid sequence, such
as, for example, a small, interfering RNA or a template construct
encoding such an RNA has been introduced. Therefore, recombinant
cells are distinguishable from naturally occurring cells which do
not contain a recombinantly introduced nucleic acid.
[0137] In certain embodiments, it is contemplated that RNAs or
proteinaceous sequences may be co-expressed with other selected
RNAs or proteinaceous sequences in the same host cell.
Co-expression may be achieved by co-transfecting the host cell with
two or more distinct recombinant vectors. Alternatively, a single
recombinant vector may be constructed to include multiple distinct
coding regions for RNAs, which could then be expressed in host
cells transfected with the single vector.
[0138] A tissue may comprise a host cell or cells to be transformed
or contacted with a nucleic acid delivery composition and/or an
additional agent. The tissue may be part or separated from an
organism. In certain embodiments, a tissue and its constituent
cells may comprise, but is not limited to, blood (e.g.,
hematopoietic cells (such as human hematopoietic progenitor cells,
human hematopoietic stem cells, CD34.sup.+ cells CD4.sup.+ cells),
lymphocytes and other blood lineage cells), bone marrow, brain,
stem cells, blood vessel, liver, lung, bone, breast, cartilage,
cervix, colon, cornea, embryonic, endometrium, endothelial,
epithelial, esophagus, facia, fibroblast, follicular, ganglion
cells, glial cells, goblet cells, kidney, lymph node, muscle,
neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin,
small intestine, spleen, stomach, testes.
[0139] In certain embodiments, the host cell or tissue may be
comprised in at least one organism. In-certain embodiments, the
organism may be, human, primate or murine. In other embodiments the
organism may be any eukaryote or even a prokayrote (e.g., a
eubacteria, an archaea), as would be understood by one of ordinary
skill in the art. One of skill in the art would further understand
the conditions under which to incubate all of the above described
host cells to maintain them and to permit their division to form
progeny.
EXAMPLES
[0140] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples that
follow represent techniques discovered by the inventor to function
well in the practice of the invention, and thus can be considered
to constitute preferred modes for its practice. However, those of
skill in the art should, in light of the present disclosure,
appreciate that many changes can be made in the specific
embodiments which are disclosed and still obtain a like or similar
result without departing from the spirit and scope of the
invention.
[0141] Materials and Methodology Employed in Examples 1-5.
[0142] A. Cell Proliferation Assays.
[0143] Transfected HeLa cells were analyzed using Alamar Blue
(BioSource International, Inc., CA) at 24 hr intervals. Alamar Blue
is a compound, that when reduced by cellular metabolism, changes
from a non-fluorescent blue color to a fluorescent red form that is
easily quantified. The amount of Alamar Blue reduced is directly
proportional to the cell number, providing a rapid method for
assessing cell proliferation. To perform the assay, the Alamar Blue
reagent was added into the tissue culture media at a 10% final
concentration. The mixture was incubated for 3-6 hr in growth
conditions after which fluorescence was quantified using a Spectra
MaX.TM. GeminiXS.TM. (Molecular Devices, Sunnyvale, Calif.).
[0144] B. Immunofluorescence.
[0145] HeLa cells used for immunofluorescence were grown on chamber
slides in DMEM/10% FBS and transfected with the siRNAs, buffer, or
phosphorothioate oligonucleotides. 48 hr after transfection, the
cells were fixed with 4% paraformaldehyde/PBS. Cells were
permeabilized by exposure to 0.1% Triton X-100/PBS for 5 min and
then incubated with 3% BSA in PBS for 1 hr. After incubating with a
mouse anti-myc monoclonal antibody (Neomarkers) at a 1:200 dilution
in PBS, the cells were washed briefly with PBS, incubated with
fluorescein-conjugated goat anti-mouse IgG (Jackson ImmunoResearch
Laboratories). The cells were mounted with Vectashield.TM. (Vector
Laboratories). Images were analyzed using an Olympus BX60 .TM.
microscope and acquired with the help of a Hitachi KP-c571 .TM.
camera and Adobe.RTM. Photoshop.RTM..
[0146] C. Transfection of HeLa Cells with siRNAs.
[0147] Hela S3 cells@5.times.10.sup.3 cells/well were plated in
complete medium w/out antibiotics. The cells were incubated
overnight@37.degree. C. in a humidified 5% CO.sub.2 incubator.
Chemically synthesized siRNA stocks were diluted into 40 ul
Opti-MEM.TM. (Invitrogen) to indicated final concentrations in 250
ul total volume per well. Enzymatically synthesized siRNA stocks
were diluted into 40 ul Opti-MEM.TM. to indicated final
concentrations in 250 ul total volume per well.
[0148] For transfections, 1.5 ul of Oligofectamine.TM. (Invitrogen)
was added to 6 ul of OptiMEM.TM. for each well being transfected.
The mixture was incubated at room temperature for 5-10 min. The
diluted Oligofectamine.TM. was added to prepared siRNAs, mixed
gently, and incubated at RT for 15-20 min. The cell medium was
aspirated, and 200 ul fresh growth medium was added to each well.
The medium was mixed gently, and then overlaid with .about.50 ul of
the appropriate siRNA/oligofectamine complex. The transfected cells
were incubated at 37.degree. C. in a humidified 5% Co.sub.2
incubator.
[0149] D. Direct Recovery of siRNAs.
[0150] To prepare chemically or enzymatically produced siRNAs for
transfection, they must be purified from accompanying salts,
proteins, and non-dsRNA nucleic acids. The hybridization,
transcription, or nuclease digestion reactions used to produce
siRNAs can be phenol extracted with 2.times.volumes of buffered
phenol, extracted with 2.times.volumes of ether or chloroform, and
precipitated by adding NH.sub.4OAc to a final concentration of 0.5
M and 2.times.volumes of ethanol. The siRNA is recovered by
centrifuging at 13,200 RPM. The siRNA pellet is washed one time
with 70% ethanol.
[0151] E. Gel Purification of siRNAs.
[0152] To gel purify siRNAs, 10 .mu.l of 50% sucrose/0.25%
bromophenol blue is added to the hybridization, transcription, or
nuclease digestion reaction. The sample is loaded on a 12%
polyacrylamide gel and electrophoresed at 250 volts for one hour.
The siRNA is detected by UV shadowing (Sambrook 2001). The product
band is excised from the gel, transferred to a microfuge tube With
400 .mu.l of 2 mM EDTA, and incubated overnight at 37.degree. C.
The siRNA is recovered by transferring the solution to a new
microfuge tube, adding NH.sub.4OAc to a final concentration of 0.5
M, adding 2.times.volumes of ethanol, incubating at 20.degree. C.
for fifteen minutes, and centrifuging at 13,200 RPM for fifteen
minutes. The siRNA pellet is washed 1.times. with 70% ethanol and
then dried.
[0153] F. Column Purification of siRNAs.
[0154] 400 .mu.l of 1.2.times.Binding Buffer (625 mM NaCl, 62.5%
EtOH) is added to hybridization, transcription, or
nuclease-digestion reaction. A glass fiber filter in a column is
equilibrated with 400 .mu.l of 1.times.Binding Buffer (500 mM NaCl,
50% EtOH). The siRNA/binding buffer mixture is added to the pre-wet
column and spun at 13,200 RPM for 2 minutes. The column is washed
2.times.with 500 .mu.l of 1.times.Binding Buffer. 100 .mu.l of
nuclease-free water pre-heated to 75.degree. C. is added to the
column and incubated for two minutes. The column is spun at 13,200
RPM for 2 minutes. siRNA is in the elute.
[0155] G. RNAse Digestion.
[0156] In cases where a leader sequence is used to improve the
yield of siRNAs and reduce template constraints, the following
nuclease digestion step is employed to remove a non-homologous
leader sequence and non-hybridized RNAs. Add 50 .mu.l of nuclease
free water, 0.6 .mu.l of 10.times.Nuclease buffer (100 mM Tri pH
7.5, 25 mM MgCl.sub.2, 1 mM CaCl.sub.2), and 10 U of RNase A or
10,000 U of RNase T1, or similar unit activity of RNase Sa.
Incubate for thirty minutes at room temperature.
[0157] Leader sequence used may dictate which of the nucleases to
use. Single strand specific Rnases are preferred. Thus, RNase T1
preferentially digests single-stranded RNA at G residues. RNase A
preferentially digests at C and U residues. If RNase T1 is to be
used, the last nucleotide in the leader sequence is preferred to be
a G to eliminate the entire leader sequence from the siRNA.
Likewise, if RNase A is to be used, the last nucleotide in the
leader sequence should be a C or U. Additionally, RNase Sa, RNase
Sa2, or RNase Sa3, whose use and properties are well known to those
of skill in the art, may be employed to digest the leader
sequences. See Hebert et al. (1997) and Pace et al. (1998), both of
which are expressly incorporated herein by reference.
[0158] H. T7 RNA Polymerase
[0159] T7 RNA Polymerase is used as a preparation that includes 200
U/ul of T7 RNA Polymerase, Inorganic Pyrophosphatase (IPP) 0.05
U/ul, Placental Ribonuclease Inhibitor (Sambrook 2001) 0.3 U/ul,
Superasin.TM. (Ambion) 2 U/ul, and 1% chaps.
Example 1
Model Target Genes
[0160] C-myc and GAPDH were chosen to evaluate the impact of siRNA
on the expression of genes in mammalian cells. The c-myc
proto-oncogene can be a transcription repressor and activator and
has important roles in cell death and cell cycle progression
(reviewed in Ryan et al., 1996). GAPDH is the metabolic protein
Glyceraldehyde-3-phosphate Dehydrogenase. It is involved in
glycolysis. Reducing the expression of either gene slows the cell
division rate, which can be tracked using the Alomar Blue assay
described above or by quantifying the number of healthy cells. In
addition, the abundance of the mRNA and protein from each gene can
be calculated using standard techniques (RT-PCR, Northern analysis,
immunofluorescence, or Western analysis).
Example 2
siRNA Target Site Selection
[0161] Four different double-stranded 21mer siRNAs were designed
and prepared for both c-myc and GAPDH. These siRNAs were tested to
determine which siRNA provided the greatest effect without
affecting non-target genes.
[0162] c-myc siRNA Development
[0163] The siRNAs specific to different regions of the c-myc gene
are listed in Table 1 (SEQ ID NOS: 3-10) and diagrammed in FIG. 5.
Also shown are the locations of the start codon (start), stop codon
(stop), coding region, 5' and 3'UTR's as well as the binding site
of a well-characterized antisense oligonucleotide. The antisense
oligonucleotide that we used has previously been shown to reduce
c-myc expression (Kimura et al., 1995) and served as a positive
control in our experiments.
[0164] 1.5 nanomoles of the sense and anti-sense siRNAs were mixed
in a solution comprising 100 mM KOAc, 30 mM HEPES-KOH pH 7.4, and 2
mM MgOAc. The solutions were incubated at 37.degree. C. for one
minute, then at room temperature for one hour. The samples were
evaluated by non-denaturing 12% PAGE to confirm that the majority
of the RNA was double-stranded. The siRNAs were then kept in
aliquots at -20.degree. C. until they were transfected.
[0165] HeLa cells were transfected with 100 nM of the siRNAs and
the antisense oligonucleotide. Since reduction in c-myc expression
levels can lead to a reduction in cell division rates, cell
proliferation was monitored at 24 hr intervals following
transfection. Differences in proliferation rates were first noted
48 hr after the HeLa cells had been transfected with the siRNAs.
FIG. 6 depicts the relative cell proliferation (as compared to a
buffer-transfected control) of HeLa cells transfected with the
various siRNAs, as well as with the optimized antisense
oligonucleotide, 48 hr after transfection. The data demonstrate
that siRNAs to different regions of the mRNA have variable effects
on cell proliferation.
1TABLE 1 SEQ ID Name RNA Sequence (5' to 3') NO: 5' UTR sense
GGGAGAUCCGGAGCGAAUAdTdT 3 5' UTR anti-sense UAUUCGCUCCGGAUCUCCCdTdT
4 Exon 2 sense CUUCUACCAGCAGCAGCAGdTdT 5 Exon 2 anti-sense
CUGCUGCUGCUGGUAGAAGdTdT 6 Exon 3 sense CACACAACGUCUUGGAGCGdTdT 7
Exon 3 antisense CGCUCCAAGACGUUGUGUGdTdT 8 3' UTR sense
CGAUUCCUUCUAACAGAAAdTdT 9 3' UTR anti-sense UUUCUGUUAGAAGGAAUCGdTdT
10 Scrambled sense GCGACGUUCCUGAAACCACdTdT 11 Scrambled antisense
GUGGUUUCAGGAACGUCGCdTdT 12
[0166] The reduction in cell proliferation observed with the siRNA
to the 3' UTR was similar to that found using the optimized
antisense phosphorothioate oligonucleotide complementary to the
start codon of the c-myc mRNA (Kimura et al., 1995). In contrast,
siRNAs against the 5' UTR and Exon 2 of the c-myc mRNA affected
cell proliferation similarly to the scrambled siRNA sequence, which
was used as a negative control (FIG. 6). All of the transfections
and cell proliferation assays were reproduced in independent
experiments and the differences in cell proliferation rates were
shown to be statistically significant.
[0167] Immunofluorescence experiments using an anti-myc antibody
were used to measure c-myc protein levels to confirm that siRNAs
were reducing expression of c-myc (FIG. 7). As with the cell
proliferation assay, the siRNA corresponding to the 3' UTR induced
the greatest reduction in fluorescence (FIG. 7), indicating the
lowest levels of protein. A representative example of the
immunofluorescence data for c-myc protein levels is shown in FIG.
8. These data clearly demonstrate that the siRNA against the 3' UTR
leads to a drastic reduction in c-myc protein levels. The amount of
fluorescence detected for the 3' UTR sample was nearly equivalent
to that observed for the "secondary antibody-only" control and no
change in GAPDH protein levels was detected after transfection with
any of the siRNAs complementary to the c-myc mRNA (data not shown),
indicating that the antiviral response pathway was not induced. The
3' UTR specific c-myc siRNA was selected for subsequent
studies.
[0168] GAPDH siRNA Development
[0169] The siRNAs specific to different regions of the GAPDH gene
are listed in Table 2 (SEQ ID NOS: 14-21) The four siRNAs were
prepared from DNA oligonucleotides using in vitro transcription
with T7 RNA polymerase.
2TABLE 2 SEQ ID Name RNA Sequence (5' to 3') NO: 5' GAPDH sense
UGAUGGCAACAAUAUCCACdTdT 13 5' GAPDH anti-sense
GUGGAUAUUGAAGCCAUCAdTdT 14 5' Medial GAPDH sense
AAAGUUGUCAUGGAUGACCdTdT 15 5' Medial GAPDH anti-
GGUCAUCCAUGACAACUUUdTdT 16 sense 3' Medial GAPDH sense
GAAGGCCAUGCCAGUGAGCdTdT 17 3' Medial GAPDH sense
GCUCACUGGCAUGGCCUUCdTdT 18 3' GAPDHsense CAUGAGGUCCACCACCCUGdTdT 19
3' GAPDH anti-sense CAGGGUGGUGGACCUCAUGdTdT 20
[0170] The following synthetic DNA oligomers were purchased from
Integrated DNA Technologies:
3TABLE 3 SEQ ID Name DNA Sequence (5' to 3') NO T7 Promoter Primer:
GGTAATACGACTCACTATAGGGAGACAGG 21 5' GAPDH sense:
AAGTGGATATTGTTGCCATCACCTGTCTC 22 5'GAPDH antisense:
AATGATGGCAACAATATCCACCCTGTCTC 23 5' Medial GAPDH sense
AAGGTCATCCATGACAACTTTCCTGTCTC 24 5' Medial GAPDH antisense
AAAAAGTTGTCATGGATGACCCCTGTCTC 25 3' Medial GAPDH sense
AAGCTTCACTGGCATGGCCTTCCCTGTCTC 26 3'Medial GAPDH antisense
AAGAAGGCCATGCCAGTGAGCCCTGTCTC 27 3' GAPDH sense
AACAGGGTGGTGGACCTCATGCCTGTCTC 28 3'GAPDH antisense
AACATGAGGTCCACCACCCTGCCTGTCTC 29
[0171] In separate reactions, the T7 promoter primer was mixed with
each of the sense and antisense templates in separate reactions and
converted to transcription templates. Templates for in vitro
transcription may be double-stranded over the length of the
promoter sequence (Milligan et al. 1987). Making the entire
template double-stranded improves the transcription of siRNAs,
therefore the following procedure is used to convert DNA
oligonucleotides to transcription templates for siRNA
synthesis.
[0172] The DNA templates were diluted to 100 .mu.M in nuclease-free
water. 2 .mu.l of each DNA template was mixed with 2 .mu.l of 100
.mu.M Promoter Primer and 6 .mu.l of Hybridization Buffer (20 mM
Tris pH 7.0, 100 mM KCl, 1 mM EDTA). The oligonucleotide mixtures
were heated to 70.degree. C. for five minutes, then incubate at
37.degree. C. for five minutes. 2 .mu.l of 10.times.reaction Buffer
(150 mM Tris pH 7.0, 850 mM KCl, 50 mM MgCl.sub.2, 50 mM
(NH.sub.4).sub.2SO.sub.4), 2 .mu.l of 10 dNTP mix (2.5 mM dATP, 2.5
mM dCTP, 2.5 mM dGTP, and 2.5 mM dTTP), 4 .mu.l of water, and 2
.mu.l of 5 U/ml klenow DNA polymerase was added to each
oligonucleotide mixture. The reaction was incubated at 37.degree.
C. for thirty minutes.
[0173] The templates were transcribed using T7 RNA polymerase by
mixing together the following: 2 .mu.l siRNA DNA Template; 2 .mu.l
75 mM ATP; 2 .mu.l 75 mM CTP; 2 .mu.l 75 mM GTP; 2 .mu.l 75 mM UTP;
2 .mu.l 10.times.Transcription Buffer (400 mM Tris pH 8.0, 240 mM
MgCl.sub.2, 20 mM Spermidine, 100 mM DTT); 6 .mu.l Nuclease-Free
Water; and 2 .mu.l T7 RNA Polymerase (T7 RNA Polymerase-200 U/ul,
Inorganic Pyrophosphatase (IPP) 0.05 U/ul, RNase Inhibitor 0.3
U/ul, Superasin 2 U/ul, 1% chaps).
[0174] This reaction mix was incubated for two to four hours at
37.degree. C. The RNA products were then mixed and incubated
overnight at 37.degree. C. to facilitate annealing of the
complementary strands of the siRNAs. The leader sequences were
removed by treatment with RNase T1 and the resulting siRNAs were
gel purified.
[0175] HeLa cells were transfected with 10 nM of each of the
GAPDH-specific siRNAs. 48 hours after transfection, the cells were
harvested and RNA was isolated using the RNAquesous kit (Ambion).
Equal amounts of the RNA samples were fractionated by agarose gel
electrophoresis and transferred to positively charged nylon
membranes using the NorthernMax-Gly kit (Ambion). The Northern
blots were probed for GAPDH, cyclophilin, and 28s rRNA using the
reagents and protocols of the NorthernMax-Gly kit. The Northern
blots were exposed to a phosphorimager screen and quantified using
the Molecular Analyst (BioRad). The relative reduction in GAPDH
mRNA levels in siRNA transfected cells versus untreated cells is
provided in FIG. 9. For GAPDH, the 5' Medial siRNA provided the
greatest level of gene silencing and was selected for subsequent
evaluation.
Example 3
Potency of Chemical Versus Enzymatic Synthesis of siRNA-c-myc
[0176] The 3' UTR siRNA described above was produced by in vitro
transcription to compare the potency of siRNAs prepared by
enzymatic means to siRNAs generated by chemical synthesis. The
following synthetic DNA oligomers were purchased from Integrated
DNA Technologies:
4TABLE 4 SEQ ID Name DNA Sequence (5' to 3') NO T7 Promoter
GGTAATACGACTCACTATAGGGA- GACAGG 30 Primer: 3'UTR sense:
AATTTCTGTTAGAAGGAATCGCCTGTCTC 31 3'UTR antisense:
AACGATTCCTTCTAACAGAAACCTGTCTC 32
[0177] The T7 promoter primer was mixed with the 3' UTR sense and
antisense templates in separate reactions and converted to
transcription templates. Templates for in vitro transcription may
be double-stranded over the length of the promoter sequence
(Milligan et al. 1987). Making the entire template double-stranded
improves the transcription of siRNAs, therefore the following
procedure is used to convert DNA oligonucleotides to transcription
templates for siRNA synthesis.
[0178] The DNA templates were diluted to 100 .mu.M in nuclease-free
water. 2 .mu.l of each DNA template was mixed with 2 .mu.l of 100
.mu.M Promoter Primer and 6 .mu.l of Hybridization Buffer (20 mM
Tris pH 7.0, 100 mM KCl, 1 mM EDTA). The oligonucleotide mixtures
were heated to 70.degree. C. for five minutes, then incubated at
37.degree. C. for five minutes. 2 .mu.l of 10.times.reaction Buffer
(150 mM Tris pH 7.0, 850 mM KCl, 50 mM MgCl.sub.2, 50 mM
(NH.sub.4).sub.2SO.sub.4), 2 .mu.l of 10 dNTP mix (2.5 mM dATP, 2.5
mM dCTP, 2.5 mM dGTP, and 2.5 mM dTTP), 4 .mu.l of water, and 2
.mu.l of 5 U/ml klenow DNA polymerase was added to each
oligonucleotide mixture. The reaction was incubated at 37.degree.
C. for thirty minutes.
[0179] The templates were transcribed using T7 RNA polymerase by
mixing together the following: 2 .mu.l siRNA DNA Template; 2 .mu.l
75 mM ATP; 2 .mu.l 75 mM CTP; 2 .mu.l 75 mM GTP; 2 .mu.l 75 mM UTP;
2 .mu.l 10.times.Transcription Buffer (400 mM Tris pH 8.0, 240 mM
MgCl.sub.2, 20 mM Spermidine, 100 mM DTT); 6 .mu.l Nuclease-Free
Water; and 2 .mu.l T7 RNA Polymerase (T7 RNA Polymerase-200 U/ul,
Inorganic Pyrophosphatase (IPP) 0.05 U/ul, RNase Inhibitor 0.3
U/ul, Superasin 2 U/ul, 1% chaps).
[0180] This reaction mix was incubated for two to four hours at
37.degree. C. The RNA products were then mixed and incubated
overnight at 37.degree. C. to facilitate annealing to form siRNA.
The leader sequences were removed by digestion with RNase T1. The
resulting siRNA was then gel purified.
[0181] Different molar amounts of in vitro transcribed and
chemically synthesized siRNAs specific to the 3' UTR of the c-myc
mRNA were transfected into HeLa S3 cells. The HeLa S3 cells were
evaluated for proliferation using Alamar Blue (BioSource
International, Inc., CA) at 72 hrs post-transfection. The in vitro
transcribed siRNAs at a concentration of 10 nM reduced cell
proliferation by greater than 50% (FIG. 10). In contrast, synthetic
siRNA to the same target sequence at a concentration of 100 nM
reduced proliferation by only 40% (FIG. 10). The experiment was
done in triplicate and has been repeated many times with identical
results.
[0182] The in vitro transcribed and chemically synthesized siRNAs
were quantified by both the Picogreen Assay (Molecular Probes) and
by measuring the absorbance of the samples at 260 nm (Sambrook
2001). Both methods confirmed the concentrations of the siRNAs,
supporting our conclusion that our preparative procedure yields
siRNAs that are at least ten-fold more potent than siRNAs prepared
by standard methods.
[0183] To rule out the possibility that purification procedures
were providing an advantage to enzymatic siRNA preparations, both
the in vitro transcribed and chemically synthesized siRNAs were gel
purified. Gel purification did not enhance the potency of the
chemically synthesized siRNA, confirming that there is a
fundamental difference between the siRNAs produced by the two
methods. Three different methods to purify siRNAs prior to
transfection: Phenol extraction/ethanol precipitation, gel
purification, and column purification. Each of the methods yield
siRNAs that are at least ten times as potent as equivalent siRNAs
prepared by standard chemical synthesis.
Example 4
Potency of Chemical Versus Enzymatic Synthesis of siRNA-GAPDH.
[0184] To confirm the general enhanced potency of enzymatically
synthesized siRNAs and to confirm that the higher potency was due
to a reduction in target mRNA concentration, siRNAs specific to
GAPDH were compared for their capacity to reduce GAPDH mRNA levels
in HeLa cells. Chemically synthesized and enzymatically synthesized
siRNAs specific to the same target sequence in the 5' Medial Region
of the GAPDH mRNA were prepared and transfected at varying
concentrations into HeLa cells. The cells were harvested
forty-eight hours after transfection. Total RNA from the samples
was harvested, fractionated by agarose gel electrophoresis, and
transferred to a membrane. The resulting Northern blot was
incubated with a probe specific to the GAPDH mRNA. The relative
abundance of GAPDH mRNA in the various samples was determined by
imaging the probe signal on the Northern blot using a
phosphorimager. Cyclophilin (a common housekeeping gene used for
sample normalization) was assessed on the same Northern blots to
normalize the samples.
[0185] FIG. 11 shows the GAPDH signal normalized to cyclophilin in
the samples treated with varying concentrations of the two siRNAs.
Consistent with our results with c-myc, the in vitro transcribed
siRNAs were ten- to twenty-fold more potent than the chemically
synthesized siRNA to the same target sequence. This experiment
confirms that the improved potency of enzymatically synthesized
siRNAs is consistent for different gene targets and that the
improved potency derives from an ability to decrease the
concentration of the target mRNA and not through some other
cellular process.
Example 5
SiRNA of Increased Potency Synthesis by RNA Copying (via RNA
Dependent RNA Polymerase)
[0186] Recombinant protein P2 of the double-stranded RNA
bacteriophage phi6 (P2 replicase) is an RNA polymerase that binds
single-stranded RNAs and synthesizes a complementary strand to
create dsRNA (Makeyev and Bamford, 2000). P2 replicase was used to
convert single-stranded 21mer oligonucleotides bearing sequence
identical to or complementary to c-myc mRNA into 21mer dsRNAs.
These dsRNAs were transfected into HeLa cells at concentrations of
5 or 10 nM in the cell culture medium. Seventy-two hours after
transfection, the cells were counted. Reduction in c-myc protein
levels limits cell-division, thus more potent siRNAs result in
reduced numbers of cells.
[0187] FIG. 12 shows the effect on cell growth of four different
siRNAs transfected at two different concentrations. The first and
second sets show cell numbers for cells transfected with chemically
synthesized, single-stranded RNAs that had been converted to dsRNAs
by P2 replicase. The first set was a dsRNA specific to the c-myc
mRNA. The second set was a scrambled sequence bearing a nucleotide
composition equivalent to the c-myc-specific siRNA. The third and
fourth sets are c-myc-specific and scrambled sequence siRNAs
whereby both strands were chemically synthesized. The P2
replicase-generated dsRNAs specific to c-myc are 10-20 fold more
potent than the equivalent chemically synthesized siRNA (FIG. 12).
The enhanced potency is sequence specific as the equivalently
treated scrambled sequence has a profile equivalent to the
chemically synthesized, scrambled sequence siRNA.
[0188] Surprisingly, both sense and anti-sense strand chemically
synthesized RNA can be converted to siRNA of increased potency by
the action of the P2 replicase (data not shown). These data
indicate that the chemically synthesized anti-sense strand of the
siRNA can target mRNA degradation as well as an enzymatically
prepared RNA.
EXAMPLE 6
Enzymatically Synthesized siRNA Incorporating Nucleotide
Analogs
[0189] Parrish et al. (2000) found that several nucleotide analogs
could be present in double-stranded RNAs without eliminating the
capacity of the dsRNAs to suppress gene expression. However,
Parrish et al. (2000) observed no particular benefit to using the
nucleotide analogs in their studies.
[0190] Elbashir et al (2001) reported a slight improvement in the
effectiveness of siRNAs that had 3' overhanging di-nucleotide
deoxy-thymidines rather than ribo-uridines. Elbashir et al.
suggested that the improvement might be due to improved nuclease
stability of the deoxy-thymidines, though they also indicated that
they saw improved yield of the siRNAs with the deoxy-thymidines
which could translate to improved siRNA quality and thus an
improved molecule for siRNA experiments.
[0191] A variety of nucleotide analogs were systematically tested
for their capacity to improve the potency of siRNAs. Analogs of
UTP, CTP, GTP, and ATP were incorporated by transcription into
siRNAs specific to GAPDH. The siRNAs were prepared and transfected
into HeLa cells. Forty-eight hours after transfection, the treated
cells were harvested, total RNA was recovered, and the levels of
GAPDH mRNA were assessed by Northern analysis. Cyclophilin (a
common housekeeping gene used for sample normalization) and 28S
rRNA were also probed to normalize the samples. Many of the analogs
performed equivalently to the unmodified siRNA (FIG. 13),
consistent with what Parrish et al (2000) had observed in their
experiments. However, several analogs provided a 2-4-fold
enhancement in siRNA potency, over and above the enhancement of
potency resulting from enzymatic synthesis alone.
[0192] Interestingly, replacing an oxygen with a thiol on the
bridging phosphate 5' to any of the four nucleotides improved the
potency of the GAPDH-specific siRNA (see alpha-S ATP, alpha-S CTP,
alpha-S GTP, alpha-S UTP). Each of these analogs are reported to
provide some protection to nucleases (Black et al. (1972) "Studies
on the Toxicity and Antiviral Activity of Various Polynucleotides,"
Antimicrob. Agents Chemotherap. 3, 198-206), though our work
suggests that the level of protection is significantly less than
two-fold (data not shown). Notably, each of the alpha-thio modified
NTPs provide similar enhancements in siRNA potency. If nuclease
stability was important in improving siRNA potency as was suggested
(Elbashir 2001), then one would expect that the modified uridine
would be more beneficial because it would ensure that the
single-stranded, overhanging di-nucleotide remained intact.
[0193] Further evidence that nuclease stability is not that
critical to siRNA potency is the observation that the siRNAs with
2'NH.sub.2 Uridine and 2'NH.sub.2 Cytidine as well as 2'F Uridine
(these analogs are known to improve RNA stability) perform no
better than the unmodified siRNAs (FIG. 13). Based on these data,
it is not nuclease stability but rather the stability of the siRNA
duplex that has a substantial impact on the potency of the siRNAs.
Alpha-thio-nucleotides reduce the stability of the dsRNA duplex.
Presumably, an early step in the gene silencing pathway is the
dissociation of the double-stranded siRNA to facilitate
hybridization of the siRNA to the mRNA target. Reducing the
stability of the siRNA duplex would make it less difficult for the
proteins involved in the gene silencing pathway to dissociate the
anti-sense and sense strands of the siRNA, thus improving their
potency. Analogs other than alpha-thio-NTPs that decrease dsRNA
stability and thus would be expected to improve siRNA potency
include 4-thio UTP, inosine triphosphate, 4-Ethyl CTP, etc.
[0194] To test this hypothesis, GAPDH-specific siRNAs with 4-thio
UTP and 2-thio UTP were synthesized. The 2-thio modification
stabilizes A-U base pairs whereas the 4-thio modification
destabilizes A-U basepairs (Testa et al., 1999). If duplex
stability truly is an important predictor of siRNA potency, then
the 2-thio modified siRNA would reduce potency and the 4-thio
modification would enhance potency. The data are consistent with
this hypothesis (FIG. 13).
Example 7
Chemical Synthesis and use of siRNAs with Reduced Duplex
Stability
[0195] Standard and modified 21mer ribo-oligomers of the two
sequences provided below were chemically synthesized using an
Expedite Nucleic Acid Synthesis System.TM. (Applied Biosystems) and
the associated synthesis program. Two types of phosphoramidites
were used: 5'-O-DMT-N-6-phenoxyace- tyl)-2'-O-t-butyldimethylsilyl
group (TBDMS)-nucleoside-3'-O-(B-cyanoethyl-
-N,N-diisopropylamino)phosphoramidite (Wu et al.,1989) and
5'-O-DMT-N-6-phenoxyacetyl)-2'O-TriisopropylsilylOxyMethyl(TOM)-3'-O-(B-c-
yanoethyl-N,N-diisopropylamino)phosphoramidite. For both types of
amidites, we followed the same basic procedure for coupling and
deprotecting as described (Wincott et al. 1995). Following the
addition of the last nucleotide, ribo-oligomers generated with
either phosphoramidite were cleaved from the solid support with 40%
aqueous methylamine and deprotected with tetrabutylammonium
fluoride (Wincott 1995).
5 SEQ ID Name RNA Sequence (5' to 3') NO: 5' GAPDH sense
UGAUGGCAACAAUAUCCACdTdT 33 5' GAPDH anti-sense
GUGGAUAUUGAAGCCAUCAdTdT 34
[0196] Ribo-oligomers with phosphorothioates at defined positions
were produced by incubating the elongating oligonucleotide with
thiosulfonate for 30 seconds after the appropriate nucleoside was
added (Iyer et al. 1990). Ribo-oligomers with 4-thio-U and inosine
were produced by substituting a 4-thio-U phosphoramidite for the U
precursor and an Inosine phosphoramidite for the G precursor in the
standard synthesis procedure.
[0197] The incorporation of these modified nucleotide analogs,
because they act to effectively reduce overall duplex stability in
RNA duplexes, is expected to lead to substantially enhanced potency
of the resultant siRNAs.
[0198] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
REFERENCES
[0199] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0200] U.S. Pat. No. 4,415,732
[0201] U.S. Pat. No. 4,458,066
[0202] U.S. Pat. No. 4,682,195
[0203] U.S. Pat. No. 4,683,202
[0204] U.S. Pat. No. 4,786,600
[0205] U.S. Pat. No. 4,952,496
[0206] U.S. Pat. No. 5,026,645
[0207] U.S. Pat. No. 5,037,745
[0208] U.S. Pat. No. 5,102,802
[0209] U.S. Pat. No. 5,591,601
[0210] U.S. Pat. No. 5,645,897
[0211] U.S. Pat. No. 5,705,629
[0212] U.S. Pat. No. 5,795,715
[0213] U.S. Pat. No. 5,824,528
[0214] U.S. Pat. No. 5,869,320
[0215] U.S. Pat. No. 5,889,136
[0216] U.S. Pat. No. 5,891,681
[0217] U.S. Pat. No. 6,005,087
[0218] U.S. Pat. No. 6,114,152
[0219] U.S. Patent No. RE35,443
[0220] Euro. Patent No. 178,863
[0221] Euro. Patent No. 266,032
[0222] WO 00/44914
[0223] WO 01/36646
[0224] WO 01/68836
[0225] WO 88/10,315
[0226] WO 91/02,818
[0227] WO 91/05,866
[0228] WO 99/32619
[0229] Anonymous, "The siRNA user guide." Revised Aug. 26, 2001,
[online], [retrieved on Jan. 31, 2002] Retrieved from Max Planck
Institute for Biophysical Chemistry using Internet
<URL:http://www.mpibpc.gwdg.de/ab-
teilungen/100/105/siRNAuserguide.pdf>.
[0230] Atschul, S. F. et al., J. Molec. Biol. 215:403 (1990).
[0231] Bergstrom D. E., Zhang, P. and Johnson W. T. (1997) Nucleic
Acids Res. 25:1935-1942.
[0232] Bernstein, E, Caudy, A A, Hammond, S M, and Hannon, G J
(2001). Role for a bidentate ribonuclease in the initiation step of
RNA interference. Nature 409: 363-366.
[0233] Black et al (1972) "Studies on the Toxicity and Antiviral
Activity of Various Polynucleotides," Antimicrob. Agents
Chemotherap. 3, 198-206.
[0234] Caplen, N J, Parrish, S, Imani, F, Fire, A, and Morgan, R A
(2001). Specific inhibition of gene expression by small
double-stranded RNAs in invertebrate and vertebrate systems. Proc
Natl Acad Sci USA 98: 9742-9747.
[0235] Devereux, J., et al., Nucleic Acid. Res. 12(1):387
(1984).
[0236] Dharmacon Research. (July 2001) siRNA Oligonucleotides for
RNAi Applications: Dharmacon siACE-RNAi.TM. Options. Technical
Bulletin #003. [online], [retrieved on 2002-01-31] using Internet
<URL:http://www.dharnacon.com/tech/tech003.html>.
[0237] Diaz et al., J. Mol. Biol. 229: 805-811 (1993).
[0238] Dubins, D N, Lee, A, Macgbregor, R B, and Chalikian, T V
(2001). On the stability of double stranded nucleic acids. J. Am.
Chem. Soc. 123:9254-59.
[0239] Elbashir, S M, Harborth, J, Lendeckel, W, Yalcin, A, Weber,
K, and Tuschl, T (2001). Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 411: 494-498.
[0240] Fire, A, Xu, S, Montgomery, M K, Kostas, S A, Driver, S E,
and Mello, C C (1998). Potent and specific genetic interference by
double-stranded RNA in Caenorhabditis elegans. Nature 391:
806-811.
[0241] Froehler, et al. (1986). Synthesis of DNA via
deoxynucleoside H-phosphonate intermediates. Nucleic Acids Res.
14(13):5399-407.
[0242] Fuerst, T. R. et al. (1987) Molecular and Cellular Probes 7,
2538-2544.
[0243] Grishok, A, Pasquinelli, A E, Conte, D, Li, N, Parrish, S,
Ha, I, Baillie, D L, Fire, A, Ruvkun, G, and Mello, C C (2001).
Genes and mechanisms related to RNA interference regulate
expression of the small temporal RNAs that control C. elegans
developmental timing. Cell 106: 23-34.
[0244] Hamilton, A J, and Baulcombe, D C (1999). A species of small
antisense RNA in posttranscriptional gene silencing in plants.
Science 286: 950-952.
[0245] Hammond, S M, Boettcher, S, Caudy, A A, Kobayashi, R, and
Hannon, G J (2001). Argonaute2, a link between genetic and
biochemical analyses of RNAi. Science 293: 1146-1150.
[0246] Hebert E J, Grimsley G R, Hartley R W, Horn G, Schell D,
Garcia S, Both V, Sevcik J, and Pace C N. (1997). Purification of
ribonucleases Sa, Sa2, and Sa3 after expression in Escherichia
coli. Protein Expr. Purif. 11, 162-8.
[0247] Higgins, D. G., Bleasby, A. J. and Fuchs, R. (1992) CLUSTAL
V: improved software for multiple sequence alignment. Computer
Applications in the Biosciences (CABIOS), 8(2):189-191.
[0248] Hutvagner, G., McLachlan, J., Pasquinelli, A. E., Balint,
E., Tuschl, T., and Zamore, P. D. (2001). A cellular function for
the RNA-interference enzyme Dicer in the maturation of the let-7
small temporal RNA. Science 293: 834-838.
[0249] Iyer R P, Egan W, Regan J B, Beaucage S L (1990) J. Am.
Chem. Soc. 112, 1253-1254.
[0250] Kawase, Y., Iwai, S., Inoue, H., Miura, K. and Ohtsuka E.
(1986) Nucleic Acids Res. 19:7727-7736.
[0251] Kievits, T. et al. Journal of Virological Methods 35,
273-286 (1991).
[0252] Kimura S, Maekawa T, Hirakawa K, Murakami A and Abe T
(1995). Alterations of c-myc expression by antisense
oligodeoxynucleotides enhance the induction of apoptosis in HL-60
cells. Cancer Research 55: 1379-1384.
[0253] Knight, S W, and Bass, B L (2001). A Role for the RNase III
Enzyme DCR-1 in RNA Interference and Germ Line Development in C.
elegans. Science 2: 2.
[0254] Kwoh, D. Y. et al. Proc. Natl. Acad. Sci. USA 86, 1173-1177
(1989).
[0255] Lesk, A. M., ed., (1988). Computational Molecular Biology.
Oxford University Press, New York, 1988.
[0256] Makeyev E V, Bamford D H [2000] "Replicase activity of
purified recombinant protein P2 of double-stranded RNA
bacteriophage phi6," EMBO J. 19:124-33.
[0257] Milligan, J. F., Groebe, D. R., Witherell, G. W. and
Uhlenbeck, O. C. (1987) Nucleic Acids Res. 25, 8783-8798
[0258] Montgomery, M K, Xu, S and Fire, A (1998). RNA as a target
of double-stranded RNA-mediated genetic interference in
Caenorhabditis elegans. Proc Natl Acad Sci USA 95: 15502-15507.
[0259] Nguyen H K, Auffray P, Asseline U, Dupret D, Thuong N T
(1997) Nucl. Acids Res. 25, 3059-65.
[0260] Pace C N, Hebert E J, Shaw K L, Schell D, Both V, Krajcikova
D, Sevcik J, Wilson K S, Dauter Z, Hartley R W, and Grimsley G R
(1998). Conformational stability and thermodynamics of folding of
ribonucleases Sa, Sa2 and Sa3. J. Mol. Biol. 279, 271-86.
[0261] Parrish et al. (2000) Functional anatomy of a dsRNA trigger:
differential requirement for the two trigger strands in RNA
interference. Mol Cell.6(5):1077-87.
[0262] Ryan, K M and Birnie G D (1996). Myc oncogenes: the
enigmatic family. Biochem. J. 314: 713-721.
[0263] Sambrook, J, Russell D W (2001) Molecular Cloning, Cold
Spring Harbor Laboratory Press.
[0264] Shishkina, I. G. and F. Johnson, Chem Res Toxicol, 2000, 13,
907-912.
[0265] Smith, D. W., ed. (1986) Biocomputing: Informatics and
Genome Projects. Academic Press, New York, 1993.
[0266] Stein, C A (2001) The experimental use of antisense
oligonucleotides: a guide for the perplexed. J. Clinical Invest.
108: 641-644.
[0267] Testa S M, Disney M D, Turner D H, Kierzek R (1999)
"Thermodynamics of RNA-RNA Duplexes with 2- or 4-thiouridines,"
Biochemistry 38, 16655-62.
[0268] Thompson J. D., Higgins D. G., Gibson T. J. "CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice." Nucleic Acids Res.
22:4673-4680 (1994).
[0269] Wincott F, DiRenzo A, Grimm S, Tracz D, Workman C, Sweedler
D, Gonzalez C, Scaringe S, Usman N (1995) "Synthesis, Deprotection,
analysis and Purification of RNA and Ribozymes," Nucl. Acids Res.
23, 2677-2684.
[0270] Wu, T., Ogilvie, K. K., and Pon, R. T. (1989) Nucl. Acids
Res. 17, 3501-3517.
[0271] Zamore, P D, Tuschl, T, Sharp, P A, and Bartel, D P (2000).
RNAi: double-stranded RNA directs the ATP-dependent cleavage of
mRNA at 21 to 23 nucleotide intervals. Cell 101: 25-33.
Sequence CWU 1
1
34 1 10 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 gggagacagg 10 2 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 2 gggagaaacc 10
3 21 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 3 gggagauccg gagcgaauad d 21 4 17 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 4
acgcccggac cccdtdt 17 5 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 5 ccaccagcag cagcagdtdt 20 6
18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 6 cgcgcgcgga gaagdtdt 18 7 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 7
cacacaacgc ggagcgdtdt 20 8 18 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 8 cgcccaagac ggggdtdt 18 9
18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 9 cgacccaaca gaaadtdt 18 10 16 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 10
cgagaaggaa cgdtdt 16 11 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 11 gcgacgccga aaccacdtdt 20 12
18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 12 gggcaggaac gcgcdtdt 18 13 19 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 13
gaggcaacaa accacdtdt 19 14 18 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 14 gggaagaagc cacadtdt 18
15 18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 15 aaaggcagga gaccdtdt 18 16 17 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 16
ggcaccagac aacdtdt 17 17 21 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 17 gaaggccagc caggagcdtd t 21
18 18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 18 gccacggcag gcccdtdt 18 19 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 19
cagaggccac cacccgdtdt 20 20 19 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 20 caggggggga cccagdtdt 19
21 29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 21 ggtaatacga ctcactatag ggagacagg 29 22 29 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 22 aagtggatat tgttgccatc acctgtctc 29 23 29 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 23
aatgatggca acaatatcca ccctgtctc 29 24 29 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 24 aaggtcatcc
atgacaactt tcctgtctc 29 25 29 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 25 aaaaagttgt catggatgac
ccctgtctc 29 26 30 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 26 aagcttcact ggcatggcct
tccctgtctc 30 27 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 27 aagaaggcca tgccagtgag
ccctgtctc 29 28 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 28 aacagggtgg tggacctcat
gcctgtctc 29 29 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 29 aacatgaggt ccaccaccct
gcctgtctc 29 30 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 30 ggtaatacga ctcactatag
ggagacagg 29 31 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 31 aatttctgtt agaaggaatc
gcctgtctc 29 32 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 32 aacgattcct tctaacagaa
acctgtctc 29 33 19 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 33 gaggcaacaa accacdtdt 19 34
18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 34 gggaagaagc cacadtdt 18
* * * * *
References