U.S. patent application number 10/325490 was filed with the patent office on 2003-09-04 for method and compositions for efficient and specific rolling circle amplification.
Invention is credited to Abarzua, Patricio, Alsmadi, Osama A., Driscoll, Mark D., Egholm, Michael.
Application Number | 20030165948 10/325490 |
Document ID | / |
Family ID | 25187247 |
Filed Date | 2003-09-04 |
United States Patent
Application |
20030165948 |
Kind Code |
A1 |
Alsmadi, Osama A. ; et
al. |
September 4, 2003 |
Method and compositions for efficient and specific rolling circle
amplification
Abstract
Disclosed are compositions and methods for nucleic acid
amplification reactions that reduce, prevent, or eliminate
artifacts; increase efficiency; increase specificity; and/or
increase consistency. The disclosed method can combine, for
example, the use of open circle probes that can form intramolecular
stem structures; the use of matched open circle probe sets in the
same amplification reaction; the use of detection primers and
detection during the amplification reaction; the use of a plurality
of detection rolling circle replication primer, a secondary DNA
strand displacement primer and a common rolling circle replication
primer in the same amplification reaction; and/or the use of
peptide nucleic acid quenchers associated with detection rolling
circle replication primers. Such combinations can produce, in the
same amplification reaction, the benefits of each of the combined
components.
Inventors: |
Alsmadi, Osama A.; (Hamden,
CT) ; Driscoll, Mark D.; (Wallingford, CT) ;
Egholm, Michael; (Woodbridge, CT) ; Abarzua,
Patricio; (West Caldwell, NJ) |
Correspondence
Address: |
NEEDLE & ROSENBERG P C
127 PEACHTREE STREET N E
ATLANTA
GA
30303-1811
US
|
Family ID: |
25187247 |
Appl. No.: |
10/325490 |
Filed: |
December 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10325490 |
Dec 19, 2002 |
|
|
|
09803713 |
Mar 9, 2001 |
|
|
|
6573051 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6844 20130101;
C12Q 1/6844 20130101; C12Q 2525/301 20130101; C12Q 2525/301
20130101; C12Q 2525/307 20130101; C12Q 2531/125 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim:
1. A method of amplifying nucleic acid sequences, the method
comprising a DNA ligation operation and an amplification operation,
wherein the DNA ligation operation comprises circularization of one
or more open circle probes, wherein the ligation operation is
carried out in the presence of a set of open circle probes, wherein
the set of open circle probes comprises a plurality of different
open circle probes, wherein each open circle probe comprises two
ends, wherein at least one of the ends of at least one of the open
circle probes can form an intramolecular stem structure, wherein
circularization of the open circle probes that can form an
intramolecular stem structure is dependent on hybridization of the
open circle probe to a target sequence, wherein the amplification
operation comprises rolling circle replication of the circularized
open circle probes, wherein the amplification operation is carried
out in the presence of a plurality of detection rolling circle
replication primers, a secondary DNA strand displacement primer,
and a common rolling circle replication primer, wherein each
detection rolling circle replication primer is associated with a
peptide nucleic acid quencher or a peptide nucleic acid fluor,
wherein each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, wherein the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, wherein the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes, wherein two or more of the open circle probes in the
set of open circle probes constitute a matched open circle probe
set.
2. The method of claim 1 wherein each detection rolling circle
replication primer comprises a complementary portion, wherein each
open circle probe comprises a detection primer complement portion,
wherein the complementary portion of the detection rolling circle
replication primer is complementary to the detection primer
complement portion of the open circle probe to which the detection
rolling circle replication primer corresponds, wherein the
complementary portion of the detection rolling circle replication
primer is not substantially complementary to an open circle probe
to which the detection rolling circle replication primer does not
correspond.
3. The method of claim 2 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher is associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher comprises a
quenching moiety, wherein association of the peptide nucleic acid
quencher with the detection rolling circle replication primer
quenches fluorescence from the fluorescent moiety, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quenchers from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
detection rolling circle replication primers to fluoresce.
4. The method of claim 3 wherein the quencher complement portion of
each detection rolling circle replication primer is the same,
wherein the peptide nucleic acid quencher associated with each
detection rolling circle replication primer is the same.
5. The method of claim 3 wherein the quencher complement portion of
at least one of the detection rolling circle replication primers is
different from the quencher complement portion of at least one of
the other detection rolling circle replication primers.
6. The method of claim 3 wherein the quencher complement portion of
each detection rolling circle replication primer corresponding to
an open circle probe in the set of open circle probes is the same,
wherein the peptide nucleic acid quencher associated with each
detection rolling circle replication primer is the same.
7. The method of claim 3 wherein the quencher complement portion of
at least one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes is different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes.
8. The method of claim 3 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
9. The method of claim 3 wherein the amplification operation
results in disassociation of the peptide nucleic acid quenchers
from the detection rolling circle replication primers, thereby
allowing the fluorescent moiety of the detection rolling circle
replication primers to fluoresce.
10. The method of claim 2 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a quenching moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid fluor, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor comprises a fluorescent moiety, wherein
association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
11. The method of claim 10 wherein the quencher complement portion
of each detection rolling circle replication primer is the same,
wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
12. The method of claim 10 wherein the quencher complement portion
of at least one of the detection rolling circle replication primers
is different from the quencher complement portion of at least one
of the other detection rolling circle replication primers.
13. The method of claim 10 wherein the quencher complement portion
of each detection rolling circle replication primer corresponding
to an open circle probe in the set of open circle probes is the
same, wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
14. The method of claim 10 wherein the quencher complement portion
of at least one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes is different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes.
15. The method of claim 14 wherein each peptide nucleic acid fluor
comprises a different fluorescent moiety.
16. The method of claim 10 wherein the amplification operation
results in disassociation of the peptide nucleic acid flours from
the detection rolling circle replication primers, thereby allowing
the fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
17. The method of claim 2 wherein the detection rolling circle
replication primer is a hairpin quenched primer.
18. The method of claim 1 wherein the ligation operation is carried
out in the presence of one or more additional sets of open circle
probes, wherein each set of open circle probes comprises a
plurality of different open circle probes.
19. The method of claim 18 wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
all of the sets of open circle probes, wherein the secondary DNA
strand displacement primer corresponds to all of the open circle
probes in all of the sets of open circle probes, wherein the common
rolling circle replication primer corresponds to all of the open
circle probes in all of the sets of open circle probes.
20. The method of claim 19 each detection rolling circle
replication primer comprises a complementary portion, a fluorescent
moiety, and a quencher complement portion.
21. The method of claim 20 wherein each detection rolling circle
replication primer corresponding to an open circle probe in the
same set of open circle probes comprises a different fluorescent
moiety.
22. The method of claim 21 wherein at least one of the detection
rolling circle replication primers corresponding to an open circle
probe in one of the sets of open circle probes comprises the same
fluorescent moiety as at least one of the detection rolling circle
replication primers in a different one of the sets of open circle
probes.
23. The method of claim 20 wherein at least one of the detection
rolling circle replication primers corresponding to an open circle
probe in one of the sets of open circle probes comprises the same
fluorescent moiety as a different detection rolling circle
replication primer in the same set of open circle probes.
24. The method of claim 18 wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
all of the sets of open circle probes, wherein the common rolling
circle replication primer corresponds to all of the open circle
probes in all of the sets of open circle probes, wherein the
amplification operation is carried out in the presence of a
plurality of secondary DNA strand displacement primers, wherein
each secondary DNA strand displacement primer corresponds to open
circle probes in a different set of open circle probes, wherein a
single secondary DNA strand displacement primer corresponds to all
of the open circle probes in a given set of open circle probes.
25. The method of claim 18 wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
all of the sets of open circle probes, wherein the secondary DNA
strand displacement primer corresponds to all of the open circle
probes in all of the sets of open circle probes, wherein the
amplification operation is carried out in the presence of a
plurality of common rolling circle replication primers, wherein
each common rolling circle replication primer corresponds to open
circle probes in a different set of open circle probes, wherein a
single common rolling circle replication primer corresponds to all
of the open circle probes in a given set of open circle probes.
26. The method of claim 18 wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
all of the sets of open circle probes, wherein the amplification
operation is carried out in the presence of a plurality of
secondary DNA strand displacement primers, wherein each secondary
DNA strand displacement primer corresponds to open circle probes in
a different set of open circle probes, wherein a single secondary
DNA strand displacement primer corresponds to all of the open
circle probes in a given set of open circle probes, wherein the
amplification operation is carried out in the presence of a
plurality of common rolling circle replication primers, wherein
each common rolling circle replication primer corresponds to open
circle probes in a different set of open circle probes, wherein a
single common rolling circle replication primer corresponds to all
of the open circle probes in a given set of open circle probes.
27. The method of claim 18 wherein all of the open circle probes in
all of the sets of open circle probes are different.
28. The method of claim 18 wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
a given set of open circle probes.
29. The method of claim 28 wherein at least one of the detection
rolling circle replication primers corresponds to an open circle
probe in each of at least two of the sets of open circle
probes.
30. The method of claim 18 wherein at least one of the detection
rolling circle replication primers corresponds to an open circle
probe in each of at least two of the sets of open circle
probes.
31. The method of claim 1 wherein the peptide nucleic acid quencher
comprises peptide nucleic acid and a quenching moiety.
32. The method of claim 31 wherein each detection rolling circle
replication primer comprises a complementary portion, a fluorescent
moiety, and a quencher complement portion, wherein the peptide
nucleic acid quencher is associated with the detection rolling
circle replication primers via the quencher complement portion.
33. The method of claim 31 wherein each detection rolling circle
replication primer comprises a complementary portion, a fluorescent
moiety, and a quencher complement portion, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quencher from the detection rolling circle replication
primers, thereby allowing the fluorescent moiety of the detection
rolling circle replication primers to fluoresce.
34. The method of claim 1 wherein the peptide nucleic acid fluor
comprises peptide nucleic acid and a fluorescent moiety.
35. The method of claim 34 wherein each detection rolling circle
replication primer comprises a complementary portion, a quenching
moiety, and a quencher complement portion, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primers via the quencher complement portion.
36. The method of claim 1 wherein the open circle probes in the
matched open circle probe set are targeted to different forms of
the same target sequence.
37. The method of claim 36 wherein the different forms of the same
target sequence comprise a wild type form of the target sequence
and a mutant form of the target sequence.
38. The method of claim 37 wherein the different forms of the same
target sequence further comprise a second mutant form of the target
sequence.
39. The method of claim 37 wherein the different forms of the same
target sequence further comprise a plurality of different mutant
forms of the target sequence.
40. The method of claim 36 wherein the different forms of the same
target sequence comprise a plurality of different mutant forms of
the target sequence.
41. The method of claim 36 wherein the different forms of the same
target sequence comprise a normal form of the target sequence and a
mutant form of the target sequence.
42. The method of claim 41 wherein the different forms of the same
target sequence further comprise a second mutant form of the target
sequence.
43. The method of claim 41 wherein the different forms of the same
target sequence further comprise a plurality of different mutant
forms of the target sequence.
44. The method of claim 36 wherein the set of open circle probes
comprises a plurality of matched open circle probe sets.
45. The method of claim 44 wherein the open circle probes in each
of the matched open circle probe sets are targeted to different
forms of the same target sequence, wherein open circle probes in
different matched open circle probe sets are targeted to different
target sequences.
46. The method of claim 45 wherein the different forms of the same
target sequence comprise a wild type form of the target sequence
and a mutant form of the target sequence.
47. The method of claim 46 wherein the different forms of the same
target sequence further comprise a second mutant form of the target
sequence.
48. The method of claim 46 wherein the different forms of the same
target sequence further comprise a plurality of different mutant
forms of the target sequence.
49. The method of claim 45 wherein the different forms of the same
target sequence comprise a plurality of different mutant forms of
the target sequence.
50. The method of claim 45 wherein the different forms of the same
target sequence comprise a normal form of the target sequence and a
mutant form of the target sequence.
51. The method of claim 50 wherein the different forms of the same
target sequence further comprise a second mutant form of the target
sequence.
52. The method of claim 50 wherein the different forms of the same
target sequence further comprise a plurality of different mutant
forms of the target sequence.
53. The method of claim 45 wherein the different target sequences
are in the same gene.
54. The method of claim 45 wherein the different target sequences
are associated with the same disease or condition.
55. The method of claim 36 wherein the matched open circle probe
set consists of two open circle probes, wherein one of the open
circle probes in the matched open circle probe set is targeted to a
wild type form of the target sequence, wherein the other open
circle probe in the matched open circle probe set is targeted to a
mutant form of the target sequence.
56. The method of claim 36 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
57. The method of claim 36 wherein each detection rolling circle
replication primer corresponding to an open circle probes in the
matched open circle probe set comprises a different fluorescent
moiety.
58. The method of claim 1 further comprising, following the
ligation operation, heating the circularized open circle
probes.
59. The method of claim 58 wherein the circularized open circle
probes are heated to about 95.degree. C. for about 10 minutes.
60. The method of claim 1 wherein the open circle probes are each
specific for a target sequence, wherein each target sequence
comprises a 5' region and a 3' region, wherein each open circle
probe comprises a single-stranded, linear DNA molecule, wherein the
single-stranded, linear DNA molecule comprises, from 5' end to 3'
end, a 5' phosphate group, a right target probe portion, a spacer
portion, a left target probe portion, and a 3' hydroxyl group,
wherein the left target probe portion is complementary to the 3'
region of the target sequence, wherein the right target probe
portion is complementary to the 5' region of the target
sequence.
61. The method of claim 60 wherein at least one of the target
sequences further comprises a central region located between the 5'
region and the 3' region, wherein neither the left target probe
portion of the open circle probe specific for the target sequence
nor the right target probe portion of the open circle probe
specific for the target sequence is complementary to the central
region of the target sequence.
62. The method of claim 61 wherein the ligation operation comprises
mixing the open circle probes and one or more gap oligonucleotides
with one or more target samples, and incubating under conditions
that promote hybridization between the open circle probes and the
gap oligonucleotides and the target sequences, and ligation of the
open circle probes and gap oligonucleotides to form the
circularized open circle probes, wherein each gap oligonucleotide
comprises a single-stranded, linear DNA molecule comprising a 5'
phosphate group and a 3' hydroxyl group, wherein each gap
oligonucleotide is complementary all or a portion of the central
region of the target sequence.
63. The method of claim 61 wherein a complement to the central
region of the target sequence is synthesized during the ligation
operation.
64. The method of claim 60 wherein a plurality of the open circle
probes are each specific for a different target sequence.
65. The method of claim 64 wherein a plurality of different target
sequences are detected.
66. The method of claim 64 wherein the amplification operation
produces amplified nucleic acid, wherein the method further
comprises detecting the amplified nucleic acid with one or more
detection probes.
67. The method of claim 66 wherein a portion of each of a plurality
of the detection probes has sequence matching or complementary to a
portion of a different one of the open circle probes, wherein a
plurality of different amplified nucleic acids are detected using
the plurality of detection probes.
68. The method of claim 60 wherein the spacer portion comprises a
detection primer complement portion.
69. The method of claim 60 wherein the spacer portion comprises a
common primer complement portion.
70. The method of claim 60 wherein the intramolecular stem
structure of at least one of the open circle probes forms a stem
and loop structure.
71. The method of claim 60 wherein a portion of one of the target
probe portions of at least one of the open circle probes is in the
loop of the stem and loop structure, wherein the portion of the
target probe portion in the loop can hybridize to the target
sequence, wherein hybridization of the target probe portion in the
loop to the target sequence disrupts the intramolecular stem
structure.
72. The method of claim 60 wherein a hybrid between the target
sequence and the target probe portion at the end of the open circle
probes that can form an intramolecular stem structure is more
stable than the intramolecular stem structure.
73. The method of claim 1 wherein if one or more of the open circle
probes that can form an intramolecular stem structure are not
circularized, the end of at least one of the uncircularized open
circle probes that forms the intramolecular stem structure is
extended during the amplification operation using the open circle
probe as a template.
74. The method of claim 1 wherein the intramolecular stem structure
can form under the conditions used for the amplification
operation.
75. The method of claim 1 wherein the intramolecular stem structure
prevents the open circle probes from priming nucleic acid
replication.
76. The method of claim 1 wherein the intramolecular stem structure
prevents the open circle probes from serving as a template for
rolling circle replication.
77. The method of claim 1 wherein the intramolecular stem structure
forms a hairpin structure.
78. The method of claim 1 wherein the intramolecular stem structure
forms a stem and loop structure.
79. The method of claim 1 wherein one of the ends of the open
circle probes is a 3' end, wherein the 3' end of at least one of
the open circle probes can form an intramolecular stem
structure.
80. The method of claim 1 wherein rolling circle replication is
primed by one or more detection rolling circle replication primers,
wherein each detection rolling circle replication primer comprises
two ends, wherein at least one of the ends of at least one of the
detection rolling circle replication primers can form an
intramolecular stem structure, wherein priming by the detection
rolling circle replication primers that can form an intramolecular
stem structure is dependent on hybridization of the detection
rolling circle replication primers to the circularized open circle
probes.
81. The method of claim 1 wherein the amplification operation
produces tandem sequence DNA, wherein the amplification operation
further comprises secondary DNA strand displacement.
82. The method of claim 1 wherein rolling circle replication is
primed by one or more common rolling circle replication primers,
wherein each common rolling circle replication primer comprises two
ends, wherein at least one of the ends of at least one of the
common rolling circle replication primers can form an
intramolecular stem structure, wherein priming by the common
rolling circle replication primers that can form an intramolecular
stem structure is dependent on hybridization of the common rolling
circle replication primers to the circularized open circle
probes.
83. The method of claim 1 wherein the amplification operation
produces tandem sequence DNA, wherein the method further comprises
detecting the tandem sequence DNA.
84. The method of claim 83 wherein the tandem sequence DNA is
detected via one or more fluorescent change probes.
85. The method of claim 84 wherein the fluorescent change probes
are hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a
combination.
86. The method of claim 83 wherein the tandem sequence DNA is
detected via one or more fluorescent change primers.
87. The method of claim 86 wherein the fluorescent change primers
are stem quenched primers, hairpin quenched primers, or a
combination.
88. The method of claim 1 wherein the amplification operation
produces tandem sequence DNA and secondary tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA, the secondary tandem sequence DNA, or both.
89. A method of amplifying nucleic acid sequences, the method
comprising a DNA ligation operation and an amplification operation,
wherein the DNA ligation operation comprises circularization of one
or more open circle probes, wherein the ligation operation is
carried out in the presence of a set of open circle probes, wherein
the set of open circle probes comprises a plurality of different
open circle probes, wherein the amplification operation comprises
rolling circle replication of the circularized open circle probes,
wherein the amplification operation is carried out in the presence
of a plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer, wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
the set of open circle probes, wherein the secondary DNA strand
displacement primer corresponds to all of the open circle probes in
the set of open circle probes, wherein the common rolling circle
replication primer corresponds to all of the open circle probes in
the set of open circle probes.
90. The method of claim 89 wherein each detection rolling circle
replication primer comprises a complementary portion, wherein each
open circle probe comprises a detection primer complement portion,
wherein the complementary portion of the detection rolling circle
replication primer is complementary to the detection primer
complement portion of the open circle probe to which the detection
rolling circle replication primer corresponds, wherein the
complementary portion of the detection rolling circle replication
primer is not substantially complementary to an open circle probe
to which the detection rolling circle replication primer does not
correspond.
91. The method of claim 90 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher is associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher comprises a
quenching moiety, wherein association of the peptide nucleic acid
quencher with the detection rolling circle replication primer
quenches fluorescence from the fluorescent moiety, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quenchers from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
detection rolling circle replication primers to fluoresce.
92. The method of claim 91 wherein the quencher complement portion
of each detection rolling circle replication primer is the same,
wherein the peptide nucleic acid quencher associated with each
detection rolling circle replication primer is the same.
93. The method of claim 91 wherein the quencher complement portion
of at least one of the detection rolling circle replication primers
is different from the quencher complement portion of at least one
of the other detection rolling circle replication primers.
94. The method of claim 91 wherein the quencher complement portion
of each detection rolling circle replication primer corresponding
to an open circle probe in the set of open circle probes is the
same, wherein the peptide nucleic acid quencher associated with
each detection rolling circle replication primer is the same.
95. The method of claim 91 wherein the quencher complement portion
of at least one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes is different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes.
96. The method of claim 91 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
97. The method of claim 90 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a quenching moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid fluor, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor comprises a fluorescent moiety, wherein
association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
98. The method of claim 97 wherein the quencher complement portion
of each detection rolling circle replication primer is the same,
wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
99. The method of claim 97 wherein the quencher complement portion
of at least one of the detection rolling circle replication primers
is different from the quencher complement portion of at least one
of the other detection rolling circle replication primers.
100. The method of claim 97 wherein the quencher complement portion
of each detection rolling circle replication primer corresponding
to an open circle probe in the set of open circle probes is the
same, wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
101. The method of claim 97 wherein the quencher complement portion
of at least one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes is different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes.
102. The method of claim 101 wherein each peptide nucleic acid
fluor comprises a different fluorescent moiety.
103. The method of claim 90 wherein the detection rolling circle
replication primer is a hairpin quenched primer.
104. The method of claim 89 wherein the ligation operation is
carried out in the presence of one or more additional sets of open
circle probes, wherein each set of open circle probes comprises a
plurality of different open circle probes.
105. The method of claim 89 wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher, wherein the peptide nucleic acid quencher comprises
peptide nucleic acid and a quenching moiety, wherein the detection
rolling circle replication primer comprises a fluorescent
moiety.
106. The method of claim 89 wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid fluor,
wherein the peptide nucleic acid fluor comprises peptide nucleic
acid and a fluorescent moiety, wherein the detection rolling circle
replication primer comprises a quenching moiety.
107. The method of claim 89 wherein two or more of the open circle
probes in the set of open circle probes constitute a matched open
circle probe set, wherein the open circle probes in the matched
open circle probe set are targeted to different forms of the same
target sequence.
108. The method of claim 107 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
109. The method of claim 89 further comprising, following the
ligation operation, heating the circularized open circle
probes.
110. The method of claim 89 wherein each open circle probe
comprises two ends, wherein the open circle probes are each
specific for a target sequence, wherein each target sequence
comprises a 5' region and a 3' region, wherein each open circle
probe comprises a single-stranded, linear DNA molecule, wherein the
single-stranded, linear DNA molecule comprises, from 5' end to 3'
end, a 5' phosphate group, a right target probe portion, a spacer
portion, a left target probe portion, and a 3' hydroxyl group,
wherein the left target probe portion is complementary to the 3'
region of the target sequence, wherein the right target probe
portion is complementary to the 5' region of the target sequence,
wherein at least one of the target sequences further comprises a
central region located between the 5' region and the 3' region,
wherein neither the left target probe portion of the open circle
probe specific for the target sequence nor the right target probe
portion of the open circle probe specific for the target sequence
is complementary to the central region of the target sequence.
111. The method of claim 89 wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein the intramolecular stem structure of at least one of the
open circle probes forms a stem and loop structure.
112. The method of claim 89 wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein if one or more of the open circle probes that can form an
intramolecular stem structure are not circularized, the end of at
least one of the uncircularized open circle probes that forms the
intramolecular stem structure is extended during the amplification
operation using the open circle probe as a template.
113. The method of claim 89 wherein the amplification operation
produces tandem sequence DNA, wherein the method further comprises
detecting the tandem sequence DNA.
114. The method of claim 113 wherein the tandem sequence DNA is
detected via one or more fluorescent change probes.
115. The method of claim 114 wherein the fluorescent change probes
are hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a
combination.
116. The method of claim 113 wherein the tandem sequence DNA is
detected via one or more fluorescent change primers.
117. The method of claim 116 wherein the fluorescent change primers
are stem quenched primers, hairpin quenched primers, or a
combination.
118. The method of claim 89 wherein the amplification operation
produces tandem sequence DNA and secondary tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA, the secondary tandem sequence DNA, or both.
119. A method of amplifying nucleic acid sequences, the method
comprising an amplification operation, wherein the amplification
operation is carried out in the presence of a set of amplification
target circles, wherein the set of amplification target circles
comprises a plurality of different amplification target circles,
wherein the amplification operation comprises rolling circle
replication of the amplification target circles, wherein the
amplification operation is carried out in the presence of a
plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer, wherein each detection rolling circle
replication primer corresponds to a different amplification target
circle in the set of amplification target circles, wherein the
secondary DNA strand displacement primer corresponds to all of the
amplification target circles in the set of amplification target
circles, wherein the common rolling circle replication primer
corresponds to all of the amplification target circles in the set
of amplification target circles.
120. The method of claim 119 wherein each detection rolling circle
replication primer comprises a complementary portion, wherein each
amplification target circle comprises a detection primer complement
portion, wherein the complementary portion of the detection rolling
circle replication primer is complementary to the detection primer
complement portion of the amplification target circle to which the
detection rolling circle replication primer corresponds, wherein
the complementary portion of the detection rolling circle
replication primer is not substantially complementary to an
amplification target circle to which the detection rolling circle
replication primer does not correspond.
121. The method of claim 120 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher is associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher comprises a
quenching moiety, wherein association of the peptide nucleic acid
quencher with the detection rolling circle replication primer
quenches fluorescence from the fluorescent moiety, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quenchers from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
detection rolling circle replication primers to fluoresce.
122. The method of claim 121 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid quencher associated with
each detection rolling circle replication primer is the same.
123. The method of claim 121 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
124. The method of claim 121 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an amplification target circle in the set of
amplification target circles is the same, wherein the peptide
nucleic acid quencher associated with each detection rolling circle
replication primer is the same.
125. The method of claim 121 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an amplification target circle in the set
of amplification target circles is different from the quencher
complement portion of at least one of the other detection rolling
circle replication primers corresponding to an amplification target
circle in the set of amplification target circles.
126. The method of claim 121 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
127. The method of claim 120 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a quenching moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid fluor, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor comprises a fluorescent moiety, wherein
association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
128. The method of claim 127 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
129. The method of claim 127 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
130. The method of claim 127 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an amplification target circle in the set of
amplification target circles is the same, wherein the peptide
nucleic acid fluor associated with each detection rolling circle
replication primer is the same.
131. The method of claim 127 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an amplification target circle in the set
of amplification target circles is different from the quencher
complement portion of at least one of the other detection rolling
circle replication primers corresponding to an amplification target
circle in the set of amplification target circles.
132. The method of claim 131 wherein each peptide nucleic acid
fluor comprises a different fluorescent moiety.
133. The method of claim 120 wherein the detection rolling circle
replication primer is a hairpin quenched primer.
134. The method of claim 119 wherein the amplification operation is
carried out in the presence of one or more additional sets of
amplification target circles, wherein each set of amplification
target circles comprises a plurality of different amplification
target circles.
135. The method of claim 119 wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher, wherein the peptide nucleic acid quencher comprises
peptide nucleic acid and a quenching moiety, wherein the detection
rolling circle replication primer comprises a fluorescent
moiety.
136. The method of claim 119 wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid fluor,
wherein the peptide nucleic acid fluor comprises peptide nucleic
acid and a fluorescent moiety, wherein the detection rolling circle
replication primer comprises a quenching moiety.
137. The method of claim 119 wherein the amplification operation
produces tandem sequence DNA, wherein the method further comprises
detecting the tandem sequence DNA.
138. The method of claim 137 wherein the tandem sequence DNA is
detected via one or more fluorescent change probes.
139. The method of claim 138 wherein the fluorescent change probes
are hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a
combination.
140. The method of claim 137 wherein the tandem sequence DNA is
detected via one or more fluorescent change primers.
141. The method of claim 140 wherein the fluorescent change primers
are stem quenched primers, hairpin quenched primers, or a
combination.
142. The method of claim 119 wherein the amplification operation
produces tandem sequence DNA and secondary tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA, the secondary tandem sequence DNA, or both.
143. A method of amplifying nucleic acid sequences, the method
comprising a DNA ligation operation and an amplification operation,
wherein the DNA ligation operation comprises circularization of one
or more open circle probes, wherein the ligation operation is
carried out in the presence of a set of open circle probes, wherein
the set of open circle probes comprises a plurality of different
open circle probes, wherein the amplification operation comprises
rolling circle replication of the circularized open circle probes,
wherein two or more of the open circle probes in the set of open
circle probes constitute a matched open circle probe set.
144. The method of claim 143 wherein the amplification operation is
carried out in the presence of a plurality of detection rolling
circle replication primers, a secondary DNA strand displacement
primer, and a common rolling circle replication primer, wherein
each detection rolling circle replication primer comprises a
complementary portion, wherein each open circle probe comprises a
detection primer complement portion, wherein each detection rolling
circle replication primer corresponds to a different open circle
probe in the set of open circle probes, wherein the complementary
portion of the detection rolling circle replication primer is
complementary to the detection primer complement portion of the
open circle probe to which the detection rolling circle replication
primer corresponds, wherein the complementary portion of the
detection rolling circle replication primer is not substantially
complementary to an open circle probe to which the detection
rolling circle replication primer does not correspond.
145. The method of claim 144 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher is associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher comprises a
quenching moiety, wherein association of the peptide nucleic acid
quencher with the detection rolling circle replication primer
quenches fluorescence from the fluorescent moiety, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quenchers from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
detection rolling circle replication primers to fluoresce.
146. The method of claim 145 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid quencher associated with
each detection rolling circle replication primer is the same.
147. The method of claim 145 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
148. The method of claim 145 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an open circle probe in the set of open circle
probes is the same, wherein the peptide nucleic acid quencher
associated with each detection rolling circle replication primer is
the same.
149. The method of claim 145 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes is different from the quencher complement portion of
at least one of the other detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes.
150. The method of claim 145 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
151. The method of claim 144 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a quenching moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid fluor, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor comprises a fluorescent moiety, wherein
association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
152. The method of claim 151 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
153. The method of claim 151 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
154. The method of claim 151 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an open circle probe in the set of open circle
probes is the same, wherein the peptide nucleic acid fluor
associated with each detection rolling circle replication primer is
the same.
155. The method of claim 151 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes is different from the quencher complement portion of
at least one of the other detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes.
156. The method of claim 155 wherein each peptide nucleic acid
fluor comprises a different fluorescent moiety.
157. The method of claim 144 wherein the detection rolling circle
replication primer is a hairpin quenched primer.
158. The method of claim 143 wherein the ligation operation is
carried out in the presence of one or more additional sets of open
circle probes, wherein each set of open circle probes comprises a
plurality of different open circle probes.
159. The method of claim 143 wherein the amplification operation is
carried out in the presence of one or more detection rolling circle
replication primers, wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher, wherein the peptide nucleic acid quencher comprises
peptide nucleic acid and a quenching moiety, wherein the detection
rolling circle replication primer comprises a fluorescent
moiety.
160. The method of claim 143 wherein the amplification operation is
carried out in the presence of one or more detection rolling circle
replication primers, wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid fluor,
wherein the peptide nucleic acid fluor comprises peptide nucleic
acid and a fluorescent moiety, wherein the detection rolling circle
replication primer comprises a quenching moiety.
161. The method of claim 143 wherein the open circle probes in the
matched open circle probe set are targeted to different forms of
the same target sequence.
162. The method of claim 161 wherein the amplification operation is
carried out in the presence of one or more detection rolling circle
replication primers, wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
163. The method of claim 143 further comprising, following the
ligation operation, heating the circularized open circle
probes.
164. The method of claim 143 wherein each open circle probe
comprises two ends, wherein the open circle probes are each
specific for a target sequence, wherein each target sequence
comprises a 5' region and a 3' region, wherein each open circle
probe comprises a single-stranded, linear DNA molecule, wherein the
single-stranded, linear DNA molecule comprises, from 5' end to 3'
end, a 5' phosphate group, a right target probe portion, a spacer
portion, a left target probe portion, and a 3' hydroxyl group,
wherein the left target probe portion is complementary to the 3'
region of the target sequence, wherein the right target probe
portion is complementary to the 5' region of the target sequence,
wherein at least one of the target sequences further comprises a
central region located between the 5' region and the 3' region,
wherein neither the left target probe portion of the open circle
probe specific for the target sequence nor the right target probe
portion of the open circle probe specific for the target sequence
is complementary to the central region of the target sequence.
165. The method of claim 143 wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein the intramolecular stem structure of at least one of the
open circle probes forms a stem and loop structure.
166. The method of claim 143 wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein if one or more of the open circle probes that can form an
intramolecular stem structure are not circularized, the end of at
least one of the uncircularized open circle probes that forms the
intramolecular stem structure is extended during the amplification
operation using the open circle probe as a template.
167. The method of claim 143 wherein the amplification operation
produces tandem sequence DNA, wherein the method further comprises
detecting the tandem sequence DNA.
168. The method of claim 167 wherein the tandem sequence DNA is
detected via one or more fluorescent change probes.
169. The method of claim 168 wherein the fluorescent change probes
are hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a
combination.
170. The method of claim 167 wherein the tandem sequence DNA is
detected via one or more fluorescent change primers.
171. The method of claim 170 wherein the fluorescent change primers
are stem quenched primers, hairpin quenched primers, or a
combination.
172. The method of claim 143 wherein the amplification operation
produces tandem sequence DNA and secondary tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA, the secondary tandem sequence DNA, or both.
173. A method of amplifying nucleic acid sequences, the method
comprising a DNA ligation operation and an amplification operation,
wherein the DNA ligation operation comprises circularization of one
or more open circle probes, wherein the amplification operation
comprises rolling circle replication of the circularized open
circle probes, wherein the amplification operation is carried out
in the presence of one or more rolling circle replication primers,
wherein at least one of the rolling circle replication primers is
associated with a peptide nucleic acid quencher or a peptide
nucleic acid fluor.
174. The method of claim 173 wherein each detection rolling circle
replication primer comprises a complementary portion, wherein each
open circle probe comprises a detection primer complement portion,
wherein the ligation operation is carried out in the presence of a
set of open circle probes, wherein the set of open circle probes
comprises a plurality of different open circle probes, wherein the
complementary portion of the detection rolling circle replication
primer is complementary to the detection primer complement portion
of the open circle probe to which the detection rolling circle
replication primer corresponds, wherein the complementary portion
of the detection rolling circle replication primer is not
substantially complementary to an open circle probe to which the
detection rolling circle replication primer does not
correspond.
175. The method of claim 174 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher is associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher comprises a
quenching moiety, wherein association of the peptide nucleic acid
quencher with the detection rolling circle replication primer
quenches fluorescence from the fluorescent moiety, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quenchers from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
detection rolling circle replication primers to fluoresce.
176. The method of claim 175 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid quencher associated with
each detection rolling circle replication primer is the same.
177. The method of claim 175 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
178. The method of claim 175 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an open circle probe in the set of open circle
probes is the same, wherein the peptide nucleic acid quencher
associated with each detection rolling circle replication primer is
the same.
179. The method of claim 175 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes is different from the quencher complement portion of
at least one of the other detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes.
180. The method of claim 175 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
181. The method of claim 174 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a quenching moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid fluor, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor comprises a fluorescent moiety, wherein
association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
182. The method of claim 181 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
183. The method of claim 181 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
184. The method of claim 181 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an open circle probe in the set of open circle
probes is the same, wherein the peptide nucleic acid fluor
associated with each detection rolling circle replication primer is
the same.
185. The method of claim 181 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes is different from the quencher complement portion of
at least one of the other detection rolling circle replication
primers corresponding to an open circle probe in the set of open
circle probes.
186. The method of claim 185 wherein each peptide nucleic acid
fluor comprises a different fluorescent moiety.
187. The method of claim 174 wherein the detection rolling circle
replication primer is a hairpin quenched primer.
188. The method of claim 173 wherein the ligation operation is
carried out in the presence of a plurality of sets of open circle
probes, wherein each set of open circle probes comprises a
plurality of different open circle probes.
189. The method of claim 173 wherein the peptide nucleic acid
quencher comprises peptide nucleic acid and a quenching moiety,
wherein the detection rolling circle replication primer comprises a
fluorescent moiety.
190. The method of claim 173 wherein the peptide nucleic acid fluor
comprises peptide nucleic acid and a fluorescent moiety, wherein
the detection rolling circle replication primer comprises a
quenching moiety.
191. The method of claim 173 wherein the ligation operation is
carried out in the presence of a set of open circle probes, wherein
the set of open circle probes comprises a plurality of different
open circle probes, wherein two or more of the open circle probes
in the set of open circle probes constitute a matched open circle
probe set, wherein the open circle probes in the matched open
circle probe set are targeted to different forms of the same target
sequence.
192. The method of claim 191 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
193. The method of claim 173 further comprising, following the
ligation operation, heating the circularized open circle
probes.
194. The method of claim 173 wherein each open circle probe
comprises two ends, wherein the open circle probes are each
specific for a target sequence, wherein each target sequence
comprises a 5' region and a 3' region, wherein each open circle
probe comprises a single-stranded, linear DNA molecule, wherein the
single-stranded, linear DNA molecule comprises, from 5' end to 3'
end, a 5' phosphate group, a right target probe portion, a spacer
portion, a left target probe portion, and a 3' hydroxyl group,
wherein the left target probe portion is complementary to the 3'
region of the target sequence, wherein the right target probe
portion is complementary to the 5' region of the target sequence,
wherein at least one of the target sequences further comprises a
central region located between the 5' region and the 3' region,
wherein neither the left target probe portion of the open circle
probe specific for the target sequence nor the right target probe
portion of the open circle probe specific for the target sequence
is complementary to the central region of the target sequence.
195. The method of claim 173 wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein the intramolecular stem structure of at least one of the
open circle probes forms a stem and loop structure.
196. The method of claim 173 wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein if one or more of the open circle probes that can form an
intramolecular stem structure are not circularized, the end of at
least one of the uncircularized open circle probes that forms the
intramolecular stem structure is extended during the amplification
operation using the open circle probe as a template.
197. The method of claim 173 wherein the amplification operation
produces tandem sequence DNA, wherein the method further comprises
detecting the tandem sequence DNA.
198. The method of claim 197 wherein the tandem sequence DNA is
detected via one or more fluorescent change probes.
199. The method of claim 198 wherein the fluorescent change probes
are hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a
combination.
200. The method of claim 197 wherein the tandem sequence DNA is
detected via one or more fluorescent change primers.
201. The method of claim 200 wherein the fluorescent change primers
are stem quenched primers, hairpin quenched primers, or a
combination.
202. The method of claim 173 wherein the amplification operation
produces tandem sequence DNA and secondary tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA, the secondary tandem sequence DNA, or both.
203. A method of amplifying nucleic acid sequences, the method
comprising an amplification operation, wherein the amplification
operation comprises rolling circle replication of the amplification
target circles, wherein the amplification operation is carried out
in the presence of one or more rolling circle replication primers,
wherein at least one of the rolling circle replication primers is
associated with a peptide nucleic acid quencher or a peptide
nucleic acid fluor.
204. The method of claim 203 wherein each detection rolling circle
replication primer comprises a complementary portion, wherein each
amplification target circle comprises a detection primer complement
portion, wherein the amplification operation is carried out in the
presence of a set of amplification target circles, wherein the set
of amplification target circles comprises a plurality of different
amplification target circles, wherein the complementary portion of
the detection rolling circle replication primer is complementary to
the detection primer complement portion of the amplification target
circle to which the detection rolling circle replication primer
corresponds, wherein the complementary portion of the detection
rolling circle replication primer is not substantially
complementary to an amplification target circle to which the
detection rolling circle replication primer does not
correspond.
205. The method of claim 204 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher is associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher comprises a
quenching moiety, wherein association of the peptide nucleic acid
quencher with the detection rolling circle replication primer
quenches fluorescence from the fluorescent moiety, wherein the
amplification operation results in disassociation of the peptide
nucleic acid quenchers from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
detection rolling circle replication primers to fluoresce.
206. The method of claim 205 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid quencher associated with
each detection rolling circle replication primer is the same.
207. The method of claim 205 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
208. The method of claim 205 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an amplification target circle in the set of
amplification target circles is the same, wherein the peptide
nucleic acid quencher associated with each detection rolling circle
replication primer is the same.
209. The method of claim 205 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an amplification target circle in the set
of amplification target circles is different from the quencher
complement portion of at least one of the other detection rolling
circle replication primers corresponding to an amplification target
circle in the set of amplification target circles.
210. The method of claim 205 wherein each detection rolling circle
replication primer comprises a different fluorescent moiety.
211. The method of claim 204 wherein the detection rolling circle
replication primer is a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer further
comprises a quenching moiety and a quencher complement portion,
wherein each detection rolling circle replication primer is
associated with a peptide nucleic acid fluor, wherein the peptide
nucleic acid fluor is associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor comprises a fluorescent moiety, wherein
association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
212. The method of claim 211 wherein the quencher complement
portion of each detection rolling circle replication primer is the
same, wherein the peptide nucleic acid fluor associated with each
detection rolling circle replication primer is the same.
213. The method of claim 211 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers is different from the quencher complement portion of at
least one of the other detection rolling circle replication
primers.
214. The method of claim 211 wherein the quencher complement
portion of each detection rolling circle replication primer
corresponding to an amplification target circle in the set of
amplification target circles is the same, wherein the peptide
nucleic acid fluor associated with each detection rolling circle
replication primer is the same.
215. The method of claim 211 wherein the quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an amplification target circle in the set
of amplification target circles is different from the quencher
complement portion of at least one of the other detection rolling
circle replication primers corresponding to an amplification target
circle in the set of amplification target circles.
216. The method of claim 215 wherein each peptide nucleic acid
fluor comprises a different fluorescent moiety.
217. The method of claim 204 wherein the detection rolling circle
replication primer is a hairpin quenched primer.
218. The method of claim 203 wherein the amplification operation is
carried out in the presence of a set of amplification target
circles, wherein the set of amplification target circles comprises
a plurality of different amplification target circles.
219. The method of claim 218 wherein the amplification operation is
carried out in the presence of one or more additional sets of
amplification target circles, wherein each set of amplification
target circles comprises a plurality of different amplification
target circles.
220. The method of claim 203 wherein the peptide nucleic acid
quencher comprises peptide nucleic acid and a quenching moiety,
wherein the detection rolling circle replication primer comprises a
fluorescent moiety.
221. The method of claim 203 wherein the peptide nucleic acid fluor
comprises peptide nucleic acid and a fluorescent moiety, wherein
the detection rolling circle replication primer comprises a
quenching moiety.
222. The method of claim 203 wherein the amplification operation
produces tandem sequence DNA, wherein the method further comprises
detecting the tandem sequence DNA.
223. The method of claim 222 wherein the tandem sequence DNA is
detected via one or more fluorescent change probes.
224. The method of claim 223 wherein the fluorescent change probes
are hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a
combination.
225. The method of claim 222 wherein the tandem sequence DNA is
detected via one or more fluorescent change primers.
226. The method of claim 225 wherein the fluorescent change primers
are stem quenched primers, hairpin quenched primers, or a
combination.
227. The method of claim 203 wherein the amplification operation
produces tandem sequence DNA and secondary tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA, the secondary tandem sequence DNA, or both.
228. A method of selectively amplifying nucleic acid sequences
related to one or more target sequences, the method comprising, (a)
mixing a set of open circle probes with a target sample, to produce
an OCP-target sample mixture, and incubating the OCP-target sample
mixture under conditions that promote hybridization between the
open circle probes and the target sequences in the OCP-target
sample mixture, wherein the set of open circle probes comprises a
plurality of different open circle probes, wherein each open circle
probe comprises two ends, wherein at least one of the ends of at
least one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein two or more of the open circle probes in the set of open
circle probes constitute a matched open circle probe set, (b)
mixing ligase with the OCP-target sample mixture, to produce a
ligation mixture, and incubating the ligation mixture under
conditions that promote ligation of the open circle probes to form
amplification target circles, wherein the amplification target
circles formed from the open circle probes in the set of open
circle probes comprise a set of amplification target circles, (c)
mixing a plurality of detection rolling circle replication primers,
a secondary DNA strand displacement primer, and a common rolling
circle replication primer with the ligation mixture, to produce a
primer-ATC mixture, and incubating the primer-ATC mixture under
conditions that promote hybridization between the amplification
target circles and the rolling circle replication primers in the
primer-ATC mixture, wherein each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher, wherein each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, wherein the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, wherein the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes, and (d) mixing DNA polymerase with the primer-ATC
mixture, to produce a polymerase-ATC mixture, and incubating the
polymerase-ATC mixture under conditions that promote replication of
the amplification target circles, wherein replication of the
amplification target circles results in the formation of tandem
sequence DNA.
229. A kit for selectively detecting one or more target sequences
or selectively amplifying nucleic acid sequences related to one or
more target sequences, the kit comprising, a set of open circle
probes each comprising two ends, wherein at least one of the ends
of one of the open circle probe can form an intramolecular stem
structure, wherein portions of each open circle probe are
complementary to the one or more target sequences, a plurality of
detection rolling circle replication primers, wherein all or a
portion of each detection rolling circle replication primer is
complementary to a portion of one or more of the open circle
probes, one or more secondary DNA strand displacement primers,
wherein all or a portion of each secondary DNA strand displacement
primer matches a portion of one or more of the open circle probes,
and one or more common rolling circle replication primers, wherein
all or a portion of each common rolling circle replication primer
is complementary to a portion of one or more of the open circle
probes.
230. The kit of claim 229 wherein all or a portion of each
detection rolling circle replication primer is complementary to a
portion of a different one or more of the open circle probes in the
set of open circle probes, wherein all or a portion of each
secondary DNA strand displacement primer matches a portion of all
of the open circle probes in the set of open circle probes, and
wherein all or a portion of each common rolling circle replication
primer is complementary to a portion of all of the open circle
probes in the set of open circle probes.
231. The kit of claim 229 wherein the end of the open circle probe
that can form an intramolecular stem structure is a 3' end.
232. The kit of claim 229 wherein each target sequence comprises a
5' region and a 3' region, wherein the open circle probes each
comprise a single-stranded, linear DNA molecule comprising, from 5'
end to 3' end, a 5' phosphate group, a right target probe portion,
a spacer portion, a left target probe portion, and a 3' hydroxyl
group, wherein the spacer portion comprises a primer complement
portion, wherein the left target probe portion is complementary to
the 3' region of at least one of the target sequences and the right
target probe portion is complementary to the 5' region of the same
target sequence, wherein the rolling circle replication primer
comprises a single-stranded, linear nucleic acid molecule
comprising a complementary portion that is complementary to the
primer complement portion of one or more of the open circle
probes.
233. The kit of claim 232 wherein at least one target sequence
further comprises a central region located between the 5' region
and the 3' region, wherein neither the left target probe portion
nor the right target probe portion of the open circle probe
complementary to the target sequence is complementary to the
central region of the target sequence.
234. The kit of claim 233 further comprising one or more gap
oligonucleotides, wherein the gap oligonucleotides are
complementary to all or a portion of the central region of the
target sequence.
235. The kit of claim 232 the target probe portions of the open
circle probes are complementary to a different target sequence for
each of a plurality of the open circle probes.
236. The kit of claim 229 further comprising one or more reporter
binding agents each comprising a specific binding molecule and an
oligonucleotide portion, wherein the oligonucleotide portion
comprises one of the target sequences.
237. The kit of claim 229 wherein the portions of the open circle
probes that are complementary to the target sequence are
complementary to a different target sequence for each of a
plurality of the open circle probes.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of copending
application Ser. No. 09/803,713, filed Mar. 9, 2001, entitled "Open
Circle Probes With Intramolecular Stem Structures," by Osama A.
Alsmadi and Patricio Abarza, which application is hereby
incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention is in the field of nucleic acid
amplification, and specifically in the area of rolling circle
amplification reactions having increased efficiency and
specificity.
BACKGROUND OF THE INVENTION
[0003] Numerous nucleic acid amplification techniques have been
devised, including strand displacement cascade amplification
(SDCA)(referred to herein as exponential rolling circle
amplification (ERCA)) and rolling circle amplification (RCA)(U.S.
Pat. No. 5,854,033; PCT Application No. WO 97/19193; Lizardi et
al., Nature Genetics 19(3):225-232 (1998)); multiple displacement
amplification (MDA)(PCT Application WO 99/18241); strand
displacement amplification (SDA)(Walker et al., Nucleic Acids
Research 20:1691-1696 (1992), Walker et al., Proc. Natl. Acad. Sci.
USA 89:392-396 (1992)); polymerase chain reaction (PCR) and other
exponential amplification techniques involving thermal cycling,
self-sustained sequence replication (3SR), nucleic acid sequence
based amplification (NASBA), and amplification with QP replicase
(Birkenmeyer and Mushahwar, J. Virological Methods 35:117-126
(1991); Landegren, Trends Genetics 9:199-202 (1993)); and various
linear amplification techniques involving thermal cycling such as
cycle sequencing (Craxton et al., Methods Companion Methods in
Enzymology 3:20-26 (1991)).
[0004] Rolling Circle Amplification (RCA) driven by DNA polymerase
can replicate circular oligonucleotide probes with either linear or
geometric kinetics under isothermal conditions (Lizardi et al.,
Nature Genet. 19: 225-232 (1998); U.S. Pat. Nos. 5,854,033 and
6,143,495; PCT Application No. WO 97/19193). If a single primer is
used, RCA generates in a few minutes a linear chain of hundreds or
thousands of tandemly-linked DNA copies of a target that is
covalently linked to that target. Generation of a linear
amplification product permits both spatial resolution and accurate
quantitation of a target. DNA generated by RCA can be labeled with
fluorescent oligonucleotide tags that hybridize at multiple sites
in the tandem DNA sequences. RCA can be used with fluorophore
combinations designed for multiparametric color coding (PCT
Application No. WO 97/19193), thereby markedly increasing the
number of targets that can be analyzed simultaneously. RCA
technologies can be used in solution, in situ and in microarrays.
In solid phase formats, detection and quantitation can be achieved
at the level of single molecules (Lizardi et al., 1998).
Ligation-mediated Rolling Circle Amplification (LM-RCA) involves
circularization of a probe molecule hybridized to a ' target
sequence and subsequent rolling circle amplification of the
circular probe (U.S. Pat. Nos. 5, 854,033 and 6,143,495; PCT
Application No. WO 97/19193).
[0005] Artifacts--that is, unwanted, unexpected, or non-specific
nucleic acid molecules--have been observed in almost all nucleic
acid amplification reactions. For example, Stump et al., Nucleic
Acids Research 27:4642-4648 (1999), describes nucleic acid
artifacts resulting from an illegitimate PCR process during cycle
sequencing. In rolling circle amplification, uncircularized open
circle probes could prime synthesis during amplification of
circularized open circle probes. Other forms of artifacts can occur
in other types of nucleic acid amplification techniques.
BRIEF SUMMARY OF THE INVENTION
[0006] Disclosed are compositions and methods for nucleic acid
amplification reactions that reduce, prevent, or eliminate
artifacts; increase efficiency; increase specificity;
[0007] and/or increase consistency. The disclosed method can
combine, for example, the use of open circle probes that can form
intramolecular stem structures; the use of matched open circle
probe sets in the same amplification reaction; the use of detection
primers and detection during the amplification reaction; the use of
a plurality of detection rolling circle replication primer, a
secondary DNA strand displacement primer and a common rolling
circle replication primer in the same amplification reaction;
and/or the use of peptide nucleic acid quenchers associated with
detection rolling circle replication primers. Such combinations can
produce, in the same amplification reaction, the benefits of each
of the combined components.
[0008] Disclosed are compositions and methods for reducing or
eliminating generation of unwanted, undesirable, or non-specific
amplification products in nucleic acid amplification reactions. One
form of composition is an open circle probe that can form an
intramolecular stem structure, such as a hairpin structure, at one
or both ends. Open circle probes are useful in rolling circle
amplification techniques. The stem structure allows the open circle
probe to be circularized when hybridized to a legitimate target
sequence but results in inactivation of uncircularized open circle
probes. This inactivation, which can involve stabilization of the
stem structure, extension of the end of the open circle probe, or
both, reduces or eliminates the ability of the open circle probe to
prime nucleic acid synthesis or to serve as a template for rolling
circle amplification.
[0009] Disclosed are compositions and methods for increasing the
efficiency of nucleic acid amplification reactions. Increased
efficiency can include, for example, increased amplification and/or
signal generation in less time, from less starting material, and/or
from less reagents; and/or signal detection during the
amplification reaction. One form of method for increasing
efficiency is the use of a detection primer, such as a detection
rolling circle replication primer. The detection primer produces a
signal during amplification as a quenching moiety in or on the
primer becomes separated from a fluorescent label on the primer. A
useful form of detection primer is a detection rolling circle
primer associated with a peptide nucleic acid quencher. The peptide
nucleic acid quencher is displaced from the detection primer as
amplification proceeds (via, for example, replication of a nucleic
acid strand complementary to the nucleic acid strand that
incorporates the primer).
[0010] Another form of method for increasing efficiency is the use
of combinations of primers having different relationships to open
circle probes used in the method. For example, the use of two or
more rolling circle replication primers and one or more secondary
DNA strand displacement primers, with each primer specific for a
different sequence or region of the open circle probes, can
increase the efficiency of amplification by producing multiple
simultaneous initiations of replication and multiple simultaneous
generations of amplification product simultaneously. For example,
each of two or more different rolling circle replication primers
can simultaneously prime replication from different sequences in a
given circularized open circle probe or amplification target
circle. This multiplies the yield of amplification. Use of both
rolling circle replication primers (which prime replication of
circularized open circle probes and amplification target circles)
and secondary DNA strand displacement primers (which prime
replication of the product of replication of circularized open
circle probes and amplification target circles) allows multiple
generations of amplification product to be generated
simultaneously. This multiplies the yield of amplification.
[0011] Disclosed are compositions and methods for increasing the
specificity of nucleic acid amplification reactions. Increased
specificity can include, for example, more amplification of
amplification targets, or more amplification based on specific
targets, relative to non-target amplification and/or more accurate
assessment of false positive and false negative amplification. One
form of method for increasing specificity is the use of matched
open circle probe sets. Matched open circle probes are open circle
probes that are targeted to different forms of the same target
sequence. For example, a target sequence in a gene of interest may
occur in two or more forms (for example, a "wild type" or "normal"
form and a "mutant" form; or, more generally, polymorphic forms);
single nucleotide polymorphisms are an example of such different
forms of target sequences. By targeting two or more (up to, for
example, most or all) of the different forms of a target sequence
that may be present, the amplification reaction will include a
positive control. That is, for example, the open circle probe
targeted to the normal form of the target sequence will produce a
signal even if the mutant form of the target sequence is not
present in the reaction or the open circle probe targeted to the
mutant form of the target sequence will produce a signal even if
the normal form of the target sequence is not present in the
reaction.
[0012] Disclosed are compositions and methods for increasing the
consistency of nucleic acid amplification reactions. Increased
consistency can include, for example, levels of amplification
products that more accurately reflect the relative amount of
starting material, and/or less variation in the yield of
amplification from different amplification targets. One form of
method for increasing consistency involves the use of three primers
having different relationships to open circle probes used in the
method. The three primers are detection rolling circle replication
primers, secondary DNA strand displacement primers, and common
rolling circle replication primers. For example, for a given set of
open circle probes or amplification target circles, detection
rolling circle replication primers can each correspond to a
different open circle probe or amplification target circle in the
set while secondary DNA strand displacement primers and common
rolling circle replication primers can correspond to all of the
open circle probe or amplification target circles in the set. These
relationships allow the overall amplification to be consistent
among different open circle probes or amplification target circles
in a set because the sequence of two of the primers used (and their
complements on the circles) will be the same throughout the set
(thus minimizing or eliminating the effect of sequence on primer
efficiency). Differential detection is mediated by the
circle-specific detection rolling circle replication primers.
[0013] Disclosed are compositions and methods for nucleic acid
amplification reactions that involve or produce a combination of
the above effects. That is, nucleic acid amplification reactions
can combine two or more of reduction, prevention, or elimination of
artifacts; increased efficiency; increased specificity; and/or
increased consistency. The disclosed method can combine, for
example, the use of open circle probes that can form intramolecular
stem structures; the use of matched open circle probe sets in the
same amplification reaction; the use of detection primers and
detection during the amplification reaction; the use of a plurality
of detection rolling circle replication primer, a secondary DNA
strand displacement primer and a common rolling circle replication
primer in the same amplification reaction; and/or the use of
peptide nucleic acid quenchers associated with detection rolling
circle replication primers. Such combinations can produce, in the
same amplification reaction, the benefits of each of the combined
components.
[0014] The disclosed open circle probes can be inactivated in
several ways. For example, where the 3' end of an open circle probe
is involved in an intramolecular stem structure, the 3' end can be
extended in a replication reaction using the open circle probe
sequences as template. Stabilization of the stem structure results
in a reduction or elimination of the ability of the open circle
probe to prime nucleic acid synthesis because the 3' end is stably
hybridized to sequences in the open circle probe under the
conditions used for nucleic acid replication. The open circle probe
can also be inactivated by formation of the intramolecular stem
structure during the amplification reaction. As long as the end
remains in the intramolecular stem structure, it is not available
for priming nucleic acid synthesis. A useful form of open circle
probe includes a loop as part of the intramolecular stem structure.
Hybridization of the loop to the target sequence disrupts the
intramolecular stem structure while hybridization of the loop to a
mismatched or non-target sequence will not. Thus, the
sequence-discrimination ability of the open circle probe determines
inactivation of the open circle probe. A hybridization nucleating
loop can also be used in linear primers used for nucleic acid
replication and amplification.
[0015] The disclosed method is useful for detection, quantitation,
and/or location of any desired analyte, such as proteins and
peptides. The disclosed method can be multiplexed to detect
numerous different analytes simultaneously or used in a single
assay. Thus, the disclosed method is useful for detecting,
assessing, quantitating, profiling, and/or cataloging gene
expression and the presence of nucleic acids and protein in
biological samples. The disclosed method is also particularly
useful for detecting and discriminating single nucleotide
differences in nucleic acid sequences. Thus, the disclosed method
is useful for extensive multiplexing of target sequences for
sensitive and specific detection of the target sequences themselves
or analytes to which the target sequences have been associated. The
disclosed method is applicable to numerous areas including, but not
limited to, analysis of proteins present in a sample (for example,
proteomics analysis), disease detection, mutation detection,
protein expression profiling, RNA expression profiling, gene
discovery, gene mapping (molecular haplotyping), agricultural
research, and virus detection.
[0016] It is an object of the present invention to provide a method
of reducing, preventing, or eliminating artifacts in nucleic acid
amplification reactions.
[0017] It is another object of the present invention to provide
open circle probes and primers that, when used in a nucleic acid
amplification reaction, can reduce, prevent, or eliminate artifacts
in the nucleic acid amplification reaction.
[0018] It is another object of the present invention to provide
kits for nucleic acid amplification that can reduce, prevent, or
eliminate artifacts in the nucleic acid amplification reaction.
[0019] It is another object of the present invention to provide a
more efficient method of nucleic acid amplification.
[0020] It is another object of the present invention to provide
open circle probes and primers that, when used in a nucleic acid
amplification reaction, produce a more efficient nucleic acid
amplification.
[0021] It is another object of the present invention to provide
kits for nucleic acid amplification that produce a more efficient
nucleic acid amplification.
[0022] It is another object of the present invention to provide a
more specific method of nucleic acid amplification.
[0023] It is another object of the present invention to provide
open circle probes and primers that, when used in a nucleic acid
amplification reaction, produce a more specific nucleic acid
amplification.
[0024] It is another object of the present invention to provide
kits for nucleic acid amplification that produce a more specific
nucleic acid amplification.
[0025] It is another object of the present invention to provide a
more consistent method of nucleic acid amplification.
[0026] It is another object of the present invention to provide
open circle probes and primers that, when used in a nucleic acid
amplification reaction, produce a more consistent nucleic acid
amplification.
[0027] It is another object of the present invention to provide
kits for nucleic acid amplification that produce a more consistent
nucleic acid amplification.
[0028] It is another object of the present invention to provide a
method of nucleic acid amplification that, in combination, reduces,
prevents, or eliminates artifacts, is more efficient, is more
specific, and/or is more consistent.
[0029] It is another object of the present invention to provide
open circle probes and primers that, when used in a nucleic acid
amplification reaction, produce a nucleic acid amplification that,
in combination, reduces, prevents, or eliminates artifacts, is more
efficient, is more specific, and/or is more consistent.
[0030] It is another object of the present invention to provide
kits for nucleic acid amplification that produce a nucleic acid
amplification that, in combination, reduces, prevents, or
eliminates artifacts, is more efficient, is more specific, and/or
is more consistent.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 is a diagram illustrating an open circle probe that
forms hairpin intramolecular stem structures at both ends (top
left). The open circle probe is shown hybridized to a target
sequence and ligated (top right). Possible intramolecular
structures formed by the ligated open circle probe are also shown
(bottom).
[0032] FIGS. 2A and 2B are diagrams illustrating an open circle
probe that forms a stem and loop intramolecular stem structure. If
the target sequence is present, the open circle probe will
hybridize to the target sequence, be ligated, and serve as a
template in rolling circle amplification (FIG. 2A). If the target
sequence is not present, the intramolecular structure remains and
the 3' end of the open circle probe is extended using the "other"
strand as template (FIG. 2B).
[0033] FIG. 3 is a diagram illustrating hybridization, ligation,
and amplification of an open circle probe that forms a stem and
loop intramolecular stem structure. Hybridization to the target
sequence is nucleated by interaction between nucleotides in the
loop of the open circle probe and nucleotides in the target
sequence (left). This nucleation causes the intramolecular stem
structure to be disrupted (middle bottom). The freed end can now
hybridize to the target sequence, adjacent to the other end of the
probe (right bottom). The open circle probe can then be ligated,
thus circularizing the probe, followed by rolling circle
amplification of the circularized probe (right top).
[0034] FIGS. 4A, 4B, and 4C are diagrams illustrating hybridization
of an open circle probe that forms a stem and loop intramolecular
stem structure to a non-target sequence. In most cases,
hybridization of loop sequences to a non-target sequence will leave
the intramolecular stem structure intact (FIG. 4B). The open circle
probe will not be circularized. Even if hybridization of the loop
to a non-target sequence were to disrupt the intramolecular stem
structure, the non-target sequence is unlikely to have nucleotides
complementary to end sequences of the open circle probe (FIG.
4C).
[0035] FIG. 5 is a graph of end point fluorescent signal for mutant
targets versus end point fluorescent signal for wild type targets.
This is an X-Y plot of end point fluorescent readings obtained from
the samples in FIGS. 6A-6F. The X-axis shows Cy3 fluorescence
(arbitrary units) corresponding to the mutant genotype. The Y-axis
shows FAM signal corresponding to wild type genotype, also in
arbitrary units. End point readings fall into three clusters that
are easily differentiated by genotype, as indicated in the
Figure.
[0036] FIGS. 6A, 6B, 6C, 6D, 6E, and 6F depict graphs of
fluorescence over time during the course of rolling circle
amplification reactions using a matched open circle probe set. The
reaction used a FAM labeled detection rolling circle replication
primer specific for an open circle probe targeted to the wild type
sequence of Factor II prothrombin and a Cy3 labeled detection
rolling circle replication primer specific for an open circle probe
targeted to the mutant sequence of Factor II prothrombin. FIG. 6A
shows FAM fluorescence in amplification reactions of nucleic acid
samples from 32 repeats of a single normal human sample. FIG. 6B
shows Cy3 fluorescence from the same 32 samples in FIG. 6A. FIG. 6C
shows FAM fluorescence in amplification reactions of nucleic acid
samples from 32 repeats of a single heterozygous human sample. FIG.
6D shows Cy3 fluorescence from the same 32 samples in FIG. 6C. FIG.
6E shows FAM fluorescence in amplification reactions of nucleic
acid samples from 32 repeats of a single homozygous mutant human
sample. FIG. 6F shows Cy3 fluorescence from the same 32 samples in
FIG. 6E.
DETAILED DESCRIPTION OF THE INVENTION
[0037] Disclosed are compositions and methods for nucleic acid
amplification reactions that reduce, prevent, or eliminate
artifacts; increase efficiency; increase specificity; and/or
increase consistency. The disclosed method can combine, for
example, the use of open circle probes that can form intramolecular
stem structures; the use of matched open circle probe sets in the
same amplification reaction; the use of detection primers and
detection during the amplification reaction; the use of a plurality
of detection rolling circle replication primer, a secondary DNA
strand displacement primer and a common rolling circle replication
primer in the same amplification reaction; and/or the use of
peptide nucleic acid quenchers associated with detection rolling
circle replication primers. Such combinations can produce, in the
same amplification reaction, the benefits of each of the combined
components.
[0038] Disclosed are compositions and methods for increasing the
efficiency of nucleic acid amplification reactions. Increased
efficiency can include, for example, increased amplification and/or
signal generation in less time, from less starting material, and/or
from less reagents; and/or signal detection during the
amplification reaction. One form of method for increasing
efficiency is the use of a detection primer, such as a detection
rolling circle replication primer. The detection primer produces a
signal during amplification as a quenching moiety in or on the
primer becomes separated from a fluorescent label on the primer. A
useful form of detection primer is a detection rolling circle
primer associated with a peptide nucleic acid quencher. The peptide
nucleic acid quencher is displaced from the detection primer as
amplification proceeds (via, for example, replication of a nucleic
acid strand complementary to the nucleic acid strand that
incorporates the primer).
[0039] The progress of rolling circle amplification reactions can
be monitored in real-time (that is, during the reaction) by using
detection primers in the amplification. The detection primer
produces a signal during amplification as a quenching moiety in or
on the primer becomes separated from a fluorescent label on the
primer. When a quenching moiety is in proximity to a fluorescent
molecule or label, fluorescence is quenched by transfer of energy
to the quenching moiety. Fluorescence is detectable once the
quenching moiety is no longer in proximity to the fluorescent
label. Detection primers are incorporated into amplification
products as they prime replication. In the disclosed amplification
reactions, the incorporated primer goes on to serve as a template
sequence when the nucleic acid strand in which it is incorporated
is replicated. A quenching moiety can be placed in proximity to a
fluorescent label on the primer, for example, via hybridization of
a nucleic acid sequence to which the quenching moiety is attached
to sequence of the primer adjacent to the fluorescent label. When
the incorporated primer is replicated, the hybrid is disrupted and
the quencher moiety is separated from the fluorescent label, which
can then produce a fluorescent signal. Thus, as the amplification
reaction proceeds, more and more incorporated detection primers are
replicated, producing an ever-increasing fluorescent signal that
can be monitored as the reaction proceeds.
[0040] Another form of method for increasing efficiency is the use
of combinations of primers having different relationships to open
circle probes used in the method. For example, the use of two or
more rolling circle replication primers and one or more secondary
DNA strand displacement primers, with each primer specific for a
different sequence or region of the open circle probes, can
increase the efficiency of amplification by producing multiple
simultaneous initiations of replication and multiple simultaneous
generations of amplification product simultaneously. For example,
each of two or more different rolling circle replication primers
can simultaneously prime replication from different sequences in a
given circularized open circle probe or amplification target
circle. This multiplies the yield of amplification.
[0041] Rolling circle amplification involves rolling circle
replication of a circular template, such as a circularized open
circle probe or an amplification target circle. Rolling circle
replication can be mediated by a primer, referred to as a rolling
circle replication primer, that hybridizes anywhere on the circular
temple. Multiple strands can be produced simultaneously by using
two or more rolling circle replication primers that hybridize to
different sequences (that is, at different locations) in the
circular template. Thus, the disclosed method can be performed
using of two or more rolling circle replication primers targeted to
different sequences in the circular templates. Particularly useful
are the use of detection rolling circle replication primers and
common rolling circle replication primers in amplification
reactions where both a detection rolling circle replication primer
and a common rolling circle replication primer correspond to each
open circle probe or amplification target circle.
[0042] Use of both rolling circle replication primers (which prime
replication of circularized open circle probes and amplification
target circles) and secondary DNA strand displacement primers
(which prime replication of the product of replication of
circularized open circle probes and amplification target circles)
allows multiple generations of amplification product to be
generated simultaneously. This multiplies the yield of
amplification.
[0043] Rolling circle replication of a circular template produces
long strands of DNA containing tandem repeats of sequence
complementary to the sequence of the circular template. These
strands are referred to as tandem sequence DNA. The speed and yield
of rolling circle amplification reactions can be greatly increased
by replicating the tandem sequence DNA during rolling circle
replication. This can be accomplished by using one or more primers
complementary to sequence in the tandem sequence DNA. Such primers,
referred to as secondary DNA strand displacement primers, have
sequence matching sequence in an open circle probe or amplification
target circle (and thus are complementary to the tandem sequence
DNA). Replication of the tandem sequence DNA produces more nucleic
acid, referred to as secondary tandem sequence DNA, and provides a
template for further replication by the rolling circle replication
primers (which are complementary to sequences in the secondary
tandem sequence DNA). These, and subsequent replication products
are similarly replicated producing an overall cascade of
replication, referred to as exponential rolling circle
amplification, that produces a huge amplification in a short
time.
[0044] Disclosed are compositions and methods for increasing the
specificity of nucleic acid amplification reactions. Increased
specificity can include, for example, more amplification of
amplification targets, or more amplification based on specific
targets, relative to non-target amplification and/or more accurate
assessment of false positive and false negative amplification. One
form of method for increasing specificity is the use of matched
open circle probe sets. Matched open circle probes are open circle
probes that are targeted to different forms of the same target
sequence. For example, a target sequence in a gene of interest may
occur in two or more forms (for example, a "wild type" or "normal"
form and a "mutant" form; or, more generally, polymorphic forms);
single nucleotide polymorphisms are an example of such different
forms of target sequences. By targeting two or more (up to, for
example, most or all) of the different forms of a target sequence
that may be present, the amplification reaction will include a
positive control. That is, for example, the open circle probe
targeted to the normal form of the target sequence will produce a
signal even if the mutant form of the target sequence is not
present in the reaction or the open circle probe targeted to the
mutant form of the target sequence will produce a signal even if
the normal form of the target sequence is not present in the
reaction.
[0045] Ligation-mediated rolling circle amplification should
produce amplification products from a given open circle probe when
the target sequence of that open circle probe is present and should
not produce amplification products from that open circle probe when
the target sequence of that open circle probe is not present.
However, it is possible that the absence of the amplification
products could be the result of a non-functional reaction rather
than the absence of target sequence. Including open target circles
specific for two or more possible forms of a target sequence means
that the target for at least one of the open circle probes will be
present. Resultant production of amplification products serves as a
sort of positive control, indicating that the amplification
reaction is functional. Further, if there is no target sequence
present in the reaction (so that no open circle probe should be
circularized and amplified), there is an increased tendency for the
reaction to produce spurious or artifactual amplification products.
This can be referred to as idle assay artifact production. By
ensuring (or increasing the chances) that the target sequence for
at least one open circle is present in the amplification reaction,
the chance that idle assay artifacts will be produced is
minimized.
[0046] Disclosed are compositions and methods for increasing the
consistency of nucleic acid amplification reactions. Increased
consistency can include, for example, levels of amplification
products that more accurately reflect the relative amount of
starting material, and/or less variation in the yield of
amplification from different amplification targets. One form of
method for increasing consistency involves the use of three primers
having different relationships to open circle probes used in the
method. The three primers are detection rolling circle replication
primers, secondary DNA strand displacement primers, and common
rolling circle replication primers. For example, for a given set of
open circle probes or amplification target circles, detection
rolling circle replication primers can each correspond to a
different open circle probe or amplification target circle in the
set while secondary DNA strand displacement primers and common
rolling circle replication primers can correspond to all of the
open circle probe or amplification target circles in the set. These
relationships allow the overall amplification to be consistent
among different open circle probes or amplification target circles
in a set because the sequence of two of the primers used (and their
complements on the circles) will be the same throughout the set
(thus minimizing or eliminating the effect of sequence on primer
efficiency). Differential detection is mediated by the
circle-specific detection rolling circle replication primers.
[0047] Rolling circle amplification can be performed using multiple
open circle probes or amplification target circles in the same
reaction. Specificity of detection of rolling circle replication of
different circularized open circle probes and amplification target
circles can be accomplished in numerous ways. For real-time
detection, it is useful to use a different detection rolling circle
replication primer specific for each different open circle probe
and amplification target circle. Because the different detection
rolling circle replication primers may have different priming
efficiencies (due to sequence differences, for example), it is
useful to include one or more common rolling circle replication
primers that are complementary to all of the open circle probes or
amplification target circles in the reaction. This provides rolling
circle replication unbiased by differing priming efficiencies.
[0048] Disclosed are compositions and methods for reducing or
eliminating generation of unwanted, undesirable, or non-specific
amplification products in nucleic acid amplification reactions. One
form of composition is an open circle probe that can form an
intramolecular stem structure, such as a hairpin structure, at one
or both ends. Open circle probes are useful in rolling circle
amplification techniques. The stem structure allows the open circle
probe to be circularized when hybridized to a legitimate target
sequence but results in inactivation of uncircularized open circle
probes. This inactivation, which usefully involves stabilization of
the stem structure, extension of the end of the open circle probe,
or both, reduces or eliminates the ability of the open circle probe
to prime nucleic acid synthesis or to serve as a template for
rolling circle amplification.
[0049] In ligation-mediated rolling circle amplification (LM-RCA),
a linear DNA molecule, referred to as an open circle probe or
padlock probe, hybridizes to a target sequence and is circularized.
The circularized probe is then amplified via rolling circle
replication of the circular probe. Uncircularized probe that
remains in the reaction can hybridize to nucleic acid sequences in
the reaction and cause amplification of undesirable, non-specific
sequences. The disclosed compositions and method address this
problem by reducing or eliminating the potential uncircularized
open circle probes from priming nucleic acid synthesis.
[0050] The disclosed open circle probes can be inactivated in
several ways. For example, where the 3' end of an open circle probe
is involved in an intramolecular stem structure, the 3' end can be
extended in a replication reaction using the open circle probe
sequences as template (see FIG. 2B). The result is stabilization of
the intramolecular stem structure and a change in the 3' end
sequence. Stabilization of the stem structure results in a
reduction or elimination of the ability of the open circle probe to
prime nucleic acid synthesis because the 3' end is stably
hybridized to sequences in the open circle probe under the
conditions used for nucleic acid replication.
[0051] The open circle probe can also be inactivated by formation
of the intramolecular stem structure during the amplification
reaction. As long as the end remains in the intramolecular stem
structure, it is not available for priming nucleic acid synthesis.
This form of inactivation is aided by design the intramolecular
stem structure, or selecting amplification conditions, such that
the intramolecular hybrid remains stable during rolling circle
amplification.
[0052] One form of the disclosed open circle probes includes a loop
as part of the intramolecular stem structure. It is useful for the
loop to contain sequences complementary to the target sequence.
This allows the loop to nucleate hybridization of the open probe to
the target sequence. Useful forms of the loop-containing probes are
characterized by a sequence discrimination capability that is
markedly better that the comparable linear probes due to the
competition between the structural interferences between folding
due to intramolecular stem formation and linear rigidity due to
hybridization of the probe sequence to the target (Tyagi and
Kramer, Nat Biotechnol 14(3):303-8 (1996); Bonnet et al., Proc Natl
Acad Sci U S A 96(11):6171-6 (1999)). Useful open circle probes of
this type will not hybridize to mismatched sequences under suitable
conditions because duplex hybridization of probe to target does not
effectively compete with intramolecular stem formation of the
structured probe. This makes the end(s) of the open circle probe
involved in an intramolecular stem structure unavailable for
ligation to circularize the probe and leave the 3' end available
for inactivating extension. The presence of target sequence causes
the correctly matched open circle probe to unfold, allowing the
ends to hybridize to the target sequence and be coupled (see FIG.
3). Where sequences in the loop nucleate hybridization of the open
circle probe to a target sequence, loop hybridization to a
non-target sequence is unlikely to lead to circularization of the
open circle probe. This is because it is unlikely that a non-target
sequence will include adjacent sequences to which both the loop and
open circle probe end can hybridize (see FIG. 4).
[0053] A hybridization nucleating loop can also be used in linear
primers used for nucleic acid replication and amplification. Such a
primer forms an intramolecular stem structure, including a loop.
Loop-containing primers of this type will not hybridize to
mismatched sequences under suitable conditions because duplex
hybridization of probe to target does not effectively compete with
intramolecular stem formation of the structured probe. This makes
the end of the primer involved in an intramolecular stem structure
unavailable for priming. The legitimate primer complement sequence
causes the correctly matched primer to unfold, allowing the end to
hybridize to the primer complement sequence and prime synthesis.
Where sequences in the loop nucleate hybridization of the primer,
loop hybridization to an illegitimate sequence is unlikely to lead
to priming. This is because it is unlikely that an illegitimate
sequence will include adjacent sequences to which both the loop and
the primer end can hybridize. Including proximity-sensitive labels
used in molecular beacon probes in such primers allows
hybridization and priming by the primers to be detected through
activation of the label upon disruption of the intramolecular stem
structure (Tyagi and Kramer, Nat Biotechnol 14(3):303-8 (1996);
Bonnet et al., Proc Natl Acad Sci U S A 96(11):6171-6 (1999)).
[0054] Disclosed are compositions and methods for nucleic acid
amplification reactions that involve or produce a combination of
the above effects. That is, nucleic acid amplification reactions
can combine two or more of reduction, prevention, or elimination of
artifacts; increased efficiency; increased specificity; and/or
increased consistency. The disclosed method can combine, for
example, the use of open circle probes that can form intramolecular
stem structures; the use of matched open circle probe sets in the
same amplification reaction; the use of detection primers and
detection during the amplification reaction; the use of a plurality
of detection rolling circle replication primer, a secondary DNA
strand displacement primer and a common rolling circle replication
primer in the same amplification reaction; and/or the use of
peptide nucleic acid quenchers associated with detection rolling
circle replication primers. Such combinations can produce, in the
same amplification reaction, the benefits of each of the combined
components.
[0055] The disclosed method is useful for detection, quantitation,
and/or location of any desired analyte. The disclosed method can be
multiplexed to detect numerous different analytes simultaneously or
used in a single assay. Thus, the disclosed method is useful for
detecting, assessing, quantitating, profiling, and/or cataloging
gene expression and the presence of protein in biological samples.
The disclosed method is also particularly useful for detecting and
discriminating single nucleotide differences in nucleic acid
sequences. This specificity is possible due to the sensitivity of
the intramolecular stem structure in loop-containing probes and
primers to mismatches between the loop sequence and a prospective
target sequence. Thus, the disclosed method is useful for extensive
multiplexing of target sequences for sensitive and specific
detection of the target sequences themselves or analytes to which
the target sequences have been associated. The disclosed method is
also useful for detecting, assessing, quantitating, and/or
cataloging single nucleotide polymorphisms, and other sequence
differences between nucleic acids, nucleic acid samples, and
sources of nucleic acid samples.
[0056] The disclosed method is useful for detecting any desired
sequence or other analyte, such as proteins and peptides. In
particular, the disclosed method can be used to localize or amplify
signal from any desired analyte. For example, the disclosed method
can be used to assay tissue, transgenic cells, bacterial or yeast
colonies, cellular material (for example, whole cells, proteins,
DNA fibers, interphase nuclei, or metaphase chromosomes on slides,
arrayed genomic DNA, RNA), and samples and extracts from any of
biological source. Where target sequences are associated with an
analyte, different target sequences, and thus different analytes,
can be sensitively distinguished. Specificity of such detection is
aided by sensitivity of a loop in an open circle probe to
mismatches.
[0057] The disclosed method is applicable to numerous areas
including, but not limited to, analysis of proteins present in a
sample (for example, proteomics analysis), disease detection,
mutation detection, protein expression profiling, RNA expression
profiling, gene discovery, gene mapping (molecular haplotyping),
agricultural research, and virus detection. Notable uses include
protein and peptide detection in situ in cells, on microarrays,
protein expression profiling; mutation detection; detection of
abnormal proteins or peptides (for example, overexpression of an
oncogene protein or absence of expression of a tumor suppressor
protein); expression in cancer cells; detection of viral proteins
in cells; viral protein expression; detection of inherited diseases
such as cystic fibrosis, muscular dystrophy, diabetes, hemophilia,
sickle cell anemia; assessment of predisposition for cancers such
as prostate cancer, breast cancer, lung cancer, colon cancer,
ovarian cancer, testicular cancer, pancreatic cancer. The disclosed
method can also be used for detection of nucleic acids in situ in
cells, on microarrays, on DNA fibers, and on genomic DNA arrays;
detection of RNA in cells; RNA expression profiling; molecular
haplotyping; mutation detection; detection of abnormal RNA (for
example, overexpression of an oncogene or absence of expression of
a tumor suppressor gene); expression in cancer cells; detection of
viral genome in cells; viral RNA expression; detection of inherited
diseases such as cystic fibrosis, muscular dystrophy, diabetes,
hemophilia, sickle cell anemia; assessment of predisposition for
cancers such as prostate cancer, breast cancer, lung cancer, colon
cancer, ovarian cancer, testicular cancer, pancreatic cancer.
[0058] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation. The DNA ligation
operation can comprise circularization of one or more open circle
probes and can be carried out in the presence of a set of open
circle probes. The set of open circle probes can comprise a
plurality of different open circle probes. Each open circle probe
can comprise two ends, where at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure. Circularization of the open circle probes that can form
an intramolecular stem structure can be dependent on hybridization
of the open circle probe to a target sequence. Two or more of the
open circle probes in the set of open circle probes can constitute
a matched open circle probe set.
[0059] The amplification operation can comprise rolling circle
replication of the circularized open circle probes. The
amplification operation can be carried out in the presence of a
plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer. Each detection rolling circle
replication primer can be associated with a peptide nucleic acid
quencher. Each detection rolling circle replication primer can
correspond to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer can
correspond to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer can
correspond to all of the open circle probes in the set of open
circle probes.
[0060] Some forms of the disclosed method can comprise an
amplification operation. The amplification operation can be carried
out in the presence of a set of amplification target circles. The
set of amplification target circles can comprise a plurality of
different amplification target circles. The amplification operation
can comprise rolling circle replication of the amplification target
circles. The amplification operation can be carried out in the
presence of a plurality of detection rolling circle replication
primers, a secondary DNA strand displacement primer, and a common
rolling circle replication primer. Each detection rolling circle
replication primer can correspond to a different amplification
target circle in the set of amplification target circles, the
secondary DNA strand displacement primer can correspond to all of
the amplification target circles in the set of amplification target
circles, and the common rolling circle replication primer can
correspond to all of the amplification target circles in the set of
amplification target circles.
[0061] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and where the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The ligation operation is carried out in the presence of a set of
open circle probes, where the set of open circle probes comprises a
plurality of different open circle probes, and where two or more of
the open circle probes in the set of open circle probes constitute
a matched open circle probe set.
[0062] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and where the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The ligation operation is carried out in the presence of a set of
open circle probes, where the set of open circle probes comprises a
plurality of different open circle probes. The amplification
operation is carried out in the presence of a plurality of
detection rolling circle replication primers, a secondary DNA
strand displacement primer, and a common rolling circle replication
primer, where each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes.
[0063] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and where the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The amplification operation is carried out in the presence of one
or more rolling circle replication primers, where at least one of
the rolling circle replication primers is associated with a peptide
nucleic acid quencher.
[0064] Some forms of the disclosed method can comprise an
amplification operation, where the amplification operation
comprises rolling circle replication of the amplification target
circles. The amplification operation is carried out in the presence
of one or more rolling circle replication primers, where at least
one of the rolling circle replication primers is associated with a
peptide nucleic acid quencher.
[0065] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and wherein the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The ligation operation is carried out in the presence of a set of
open circle probes, where the set of open circle probes comprises a
plurality of different open circle probes. Each open circle probe
comprises two ends, where at least one of the ends of at least one
of the open circle probes can form an intramolecular stem
structure. Circularization of the open circle probes that can form
an intramolecular stem structure is dependent on hybridization of
the open circle probe to a target sequence. Two or more of the open
circle probes in the set of open circle probes constitute a matched
open circle probe set.
[0066] The amplification operation is carried out in the presence
of a plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer. Each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher. Each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes.
[0067] Some forms of the disclosed method can comprise
[0068] (a) mixing a set of open circle probes with a target sample,
to produce an OCP-target sample mixture, and incubating the
OCP-target sample mixture under conditions that promote
hybridization between the open circle probes and the target
sequences in the OCP-target sample mixture. The set of open circle
probes comprises a plurality of different open circle probes. Each
open circle probe can comprise two ends. At least one of the ends
of at least one of the open circle probes can form an
intramolecular stem structure. Circularization of the open circle
probes that can form an intramolecular stem structure can be
dependent on hybridization of the open circle probe to a target
sequence. Two or more of the open circle probes in the set of open
circle probes can constitute a matched open circle probe set.
[0069] (b) mixing ligase with the OCP-target sample mixture, to
produce a ligation mixture, and incubating the ligation mixture
under conditions that promote ligation of the open circle probes to
form amplification target circles. The amplification target circles
formed from the open circle probes in the set of open circle probes
can comprise a set of amplification target circles.
[0070] (c) mixing a plurality of detection rolling circle
replication primers, a secondary DNA strand displacement primer,
and a common rolling circle replication primer with the ligation
mixture, to produce a primer-ATC mixture, and incubating the
primer-ATC mixture under conditions that promote hybridization
between the amplification target circles and the rolling circle
replication primers in the primer-ATC mixture. Each detection
rolling circle replication primer can be associated with a peptide
nucleic acid quencher. Each detection rolling circle replication
primer can correspond to a different open circle probe in the set
of open circle probes, the secondary DNA strand displacement primer
can correspond to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer can
correspond to all of the open circle probes in the set of open
circle probes.
[0071] (d) mixing DNA polymerase with the primer-ATC mixture, to
produce a polymerase-ATC mixture, and incubating the polymerase-ATC
mixture under conditions that promote replication of the
amplification target circles. Replication of the amplification
target circles results in the formation of tandem sequence DNA.
[0072] In some forms of the disclosed method, rolling circle
amplification can be performed using peptide nucleic acid (PNA)
quenched primers. Amplification primers (such as detection rolling
circle replication primers, common rolling circle replication
primers and secondary DNA strand displacement primers) for the
reaction can contain a fluorescent dye, with the fluorescence
quenched by a PNA molecule that incorporates a quencher. In brief,
the PNA anneals to the amplification primer in a manner such that
the fluor and quencher are adjacent to one another. After primer
incorporation of the primer, the PNA is displaced, resulting in an
increase in fluorescence. Examples of useful PNA quenchers are
available from Boston Probes.
[0073] The disclosed compositions and method can be illustrated
with the following example of oligonucleotides. The
oligonucleotides have a 5' phosphate unless a different molecule or
moiety is indicated. An example of a peptide nucleic acid quencher
(designated Q-PNA-13) having a Dabcyl quencher is:
[0074] Ac-X-OO-TGA-TTG-CGA-ATG-Lys(Dabcyl) (SEQ ID NO:1)
[0075] This peptide nucleic can be annealed to primers, such as the
following examples of two detection rolling circle replication
primers (primer 1066 PI FAM and primer 5901 P1 Cy 3) and a
secondary DNA strand displacement primer (primer 1704 P2). These
primers were designed for use with open circle probes targeted to
different forms of a Factor V Leiden target sequence (a wild type
form and a mutant form), also shown below. The sequence in the
rolling circle replication primers that is complementary to the
sequence in the peptide nucleic aid quencher is underlined. The
complementary portions of the rolling circle replication primers
and the primer complement portions of the open circle probes are in
bold. The fluorescent moieties (Cy3 and FAM) are shown at the 5'
end of the primers. The secondary DNA strand displacement primer
has sequence matching sequence in the open circle probes. This
matching sequence in the open circle probes is in italic. In the
open circle probes, sequence that forms a stem is underlined and
sequence that is in the resulting loop is shown in lowercase
letters. The open circle probes constitute a matched open circle
probe set because they are targeted to different forms of the same
sequence.
1 1066 P1 FAM (sequence 1066): 5'-/6-FAM/TCATTCGCAATCAATG
GGCACCGAAGAA-3' (SEQ ID NO:2) 5901 P1 Cy3 (sequence 5901):
5'-/Cy3/TCATTCGCAATCAACGGCCGATAACAGA-3' (SEQ ID NO:3) 1704 P2
(sequence 1704): 5'-CGC GCA GAC ACG ATA-3' (SEQ ID NO:4)
[0076] Factor V Leiden wild type open circle probe (OCP FV
1066/1704-2 wt (78 bases long)):
2 (SEQ ID NO:5) 5'-GCCTGTCCAGGGATCTGCTTCTTCGGTCCCATCGCGCAGA-
CACGATA GAGGAATACAacaaaataccTGTATTCCTC-3'
[0077] This OCP has a 10 nt long loop (in lowercase) and a 10 bp
stem sequence (underlined). The Tm of the stem, calculated using
Oligo 6, is 64.3.degree. C. The Tm of a perfectly matched 3'-arm
(lowercase sequence and 3' underlined sequence; this is the left
target probe portion) is 53.2.degree. C., and the Tm of a 3'-arm
containing a single base mismatch is 47.2.degree. C. Tm of the 5'
arm (plain black text; this is the right target probe portion) is
77.2.degree. C. The primer complement portion for primer 1066 P1
FAM is in bold, and the primer matching portion for the secondary
DNA strand displacement primer 1704 P2 is in italic.
[0078] Factor V Leiden mutant open circle probe (OCP FV 5901/1704-2
(78 bases long):
5'-GCCTGTCCAGGGATCTGCTCTGTTATCGGCCGTCGCGCAGACACGATA
AAGGAATACAacaaaataccTGTATTCCTT-3' (SEQ ID NO:6)
[0079] This OCP has a 10 nt long loop (in lowercase) and a 10 bp
stem sequence (underlined). The Tm of the stem, calculated using
Oligo 6, is 64.4.degree. C. The Tm of a perfectly matched 3' arm
(lowercase sequence and 3' underlined sequence; this is the left
target probe portion) is 53.2.degree. C., and the Tm of a 3'-arm
containing a single base mismatch is 47.2.degree. C. Tm of the 5'
arm (plain black text; this is the right target probe portion) is
77.2.degree. C. The primer complement portion for primer 5901 P1
Cy3 is in bold, and the primer matching portion for the secondary
DNA strand displacement primer 1704 P2 is in italic.
[0080] The assay for both alleles can be performed in a single
tube. This offers the advantage of having two probes in one tube,
halving the number of experiments required to obtain the genotype
of a locus. Two alleles per well also offers the advantage of
increased ligation discrimination, because it guarantees that a
probe will anneal perfectly to target regardless of the genotype.
The presence of a perfectly matched ligation probe reduces the
chance of forced misligation due to mass action. Using matched open
circle probes reduces the appearance of artifactual synthesis.
Because both probes are present, there is always legitimate
circular amplification template being created. Further, conditions
can be used such that ERCA will out-compete any amplification
artifact.
[0081] Both open circle probes in the assay use the same secondary
DNA strand displacement primer (primer 1704 P2). Using the same
secondary DNA strand displacement primer for multiplexed open
circle probes is a general design improvement that reduces the
chance for variation in priming efficiency from sequence to
sequence, and therefore provides more uniform amplification for
each open circle probe.
[0082] No overnight enzymatic digestion of genomic DNA is required.
A 10 minute heat step following ligation can be used. For example,
the DNA to 90-96.degree. C. (95.degree. C. is preferred) for 10
minutes following the ligation operation. This allows amplification
to proceed as though the DNA had been digested with a restriction
enzyme. Genomic DNA amplified using multiple displacement
amplification can be genotyped directly (that is, without the need
for purification) using the disclosed method.
[0083] Because the rolling circle replication primers and secondary
DNA strand displacement primers can correspond to arbitrary
sequences in open circle probes, the same primers can be used for
multiple different open circle probes (for example, open circle
probes targeted to different target sequences).
[0084] Multiple rolling circle replication primers and/or multiple
secondary DNA strand displacement primers can be used with the same
open circle probe. Further, the primers can be the same for
multiple open circle probes used in the reaction. This speeds up
the amplification and can help prevent biased amplification by
eliminating sequence differences (and thus, sequence-based
differences in priming efficiency). The sequences of an additional
rolling circle replication primer (primer FV P5e; an example of a
common rolling circle replication primer) and an additional
secondary DNA strand displacement primer (primer FV P3d) for the
Factor V Leiden open circle probes are shown below.
3 FV P5e: GATCCCTGGACAGGC (SEQ ID NO:7) FV P3d: GAGGAATACAACAAAATA
(SEQ ID NO:8)
[0085] A. Rolling Circle Amplification
[0086] The disclosed probes and primers are generally useful in
rolling circle amplification (RCA) reactions. Rolling circle
amplification is described in U.S. Pat. Nos. 5,854,033 and
6,143,495. Rolling circle amplification involves amplifying nucleic
acid sequences based on the presence of a specific target sequence
or analyte, such as a protein or peptide. The method is useful for
detecting specific nucleic acids or analytes in a sample with high
specificity and sensitivity. The method also has an inherently low
level of background signal. Useful embodiments of the method,
referred to as ligation-mediated RCA (LM-RCA), consist of a DNA
ligation operation, an amplification operation, and, optionally, a
detection operation. The DNA ligation operation circularizes a
specially designed nucleic acid probe molecule (referred to as an
open circle probe). This step is dependent on hybridization of the
probe to a target sequence and forms circular probe molecules in
proportion to the amount of target sequence present in a sample.
The amplification operation is rolling circle replication of the
circularized probe. By coupling a nucleic acid tag to a specific
binding molecule, such as an antibody, amplification of the nucleic
acid tag can be used to detect analytes in a sample. This is useful
for detection of analytes where a target nucleic acid sequence is
part of a reporter binding molecule, where an amplification target
circle serves as an amplifiable tag on a reporter binding molecule,
or where an amplification target circle is amplified using a
rolling circle replication primer that is part of a reporter
binding molecule. Optionally, an additional amplification operation
can be performed on the DNA produced by rolling circle replication.
Rolling circle amplification can also be performed independently of
a ligation operation.
[0087] During or following amplification, the amplified sequences
can be detected and quantified using any of the conventional
detection systems for nucleic acids such as detection of
fluorescent labels, enzyme-linked detection systems,
antibody-mediated label detection, and detection of radioactive
labels. Major advantages of this method are that the ligation
operation can be manipulated to obtain allelic discrimination and
the amplification operation is isothermal. In multiplex assays, the
primer oligonucleotide used for DNA replication can be the same for
all probes, or subsets of probes can be used for different sets of
amplified nucleic acids to be detected. Rolling circle
amplification is especially suited to sensitive detection of
multiple analytes, such as proteins and peptides, in a single
assay, reaction, or assay system.
[0088] Rolling circle amplification has two features that provide
simple and consistent amplification and detection of a target
nucleic acid sequence. First, target sequences are amplified via a
small diagnostic probe with an arbitrary primer binding sequence.
This allows consistency in the priming and replication reactions,
even between probes having very different target sequences. Second,
amplification takes place not in cycles, but in a continuous,
isothermal replication: rolling circle replication. This makes
amplification less complicated and much more consistent in
output.
[0089] The disclosed compositions can also be used in methods for
of multiplex detection of molecules of interest involving rolling
circle replication. The methods are useful for simultaneously
detecting multiple specific nucleic acids in a sample with high
specificity and sensitivity. The methods also have an inherently
low level of background signal. A useful form of such a method
consists of an association operation, an amplification operation,
and a detection operation. The method can also include a ligation
operation. The association operation involves association of one or
more specially designed reporter binding molecules, either wholly
or partly nucleic acid, to target molecules of interest. The
reporter binding molecules can target any molecule of interest but
preferably targets proteins or peptides. This operation associates
the reporter binding molecules to a target molecules present in a
sample. The amplification operation is rolling circle replication
of circular nucleic acid molecules, termed amplification target
circles, that are either a part of, or hybridized to, the probe
molecules. By coupling a nucleic acid tag to a specific binding
molecule, such as an antibody, amplification of the nucleic acid
tag can be used to detect analytes in a sample.
[0090] Following rolling circle replication, the amplified
sequences can be detected using combinatorial multicolor coding
probes (or other multiplex detection system) that allow separate
and simultaneous detection of multiple different amplified target
sequences representing multiple different target molecules. Major
advantages of this method are that a large number of distinct
target molecules can be detected simultaneously, and that
differences in the amounts of the various target molecules in a
sample can be accurately quantified. The target molecules can be
analytes of any nature (such as proteins and peptides) by
associating the target sequences to be amplified with the target
molecules.
Materials
[0091] A. Open Circle Probes
[0092] An open circle probe (OCP) is a linear DNA molecule,
preferably containing between 50 to 1000 nucleotides, more
preferably between about 60 to 150 nucleotides, and most preferably
between about 70 to 100 nucleotides. The OCP has a 5' phosphate
group and a 3' hydroxyl group. This allows the ends to be ligated
(to each other or to other nucleic acid ends) using a ligase,
coupled, or extended in a gap-filling operation. Useful open circle
probes for use in the disclosed method can form an intramolecular
stem structure involving one or both of the OCP's ends. Such open
circle probes are referred to herein as hairpin open circle probes.
An intramolecular stem structure involving an end refers to a stem
structure where the terminal nucleotides (that is, nucleotides at
the end) of the OCP are hybridized to other nucleotides in the OCP
(FIGS. 1 and 2). Open circle probes can be partially
double-stranded.
[0093] The intramolecular stem structure can form a hairpin
structure or a stem and loop structure. If both ends of an OCP are
involved in an intramolecular stem structure, the two ends of the
OCP can each form a separate intramolecular stem structure or can
together form a single intramolecular stem structure. In the latter
case the two ends would be hybridized together. In some forms, the
3' end of the open circle probe can form an intramolecular stem
structure. The 5' end of the open circle probe can also form an
intramolecular stem structure, either alone, or in the same open
circle probe having an intramolecular stem structure at the 3' end.
The intramolecular stem structure can form, for example, under
conditions suitable for nucleic acid replication, and in particular
under conditions used for nucleic acid replication when the open
circle probe is being used. For example, the intramolecular stem
structure can be designed to form under conditions used for rolling
circle replication. The formation of the intramolecular stem
structure during replication allows the structure to reduce or
prevent participation of uncircularized open circle probes in
nucleic acid replication. In particular, the intramolecular stem
structure prevents the open circle probe in which the structure
forms from serving as a template for rolling circle replication,
from priming nucleic acid replication, or both. This follows from
the sequestration of the end of uncircularized open circle probe in
the stem. The end of the open circle probe cannot hybridize to, and
prime from, another sequence while sequestered in the
intramolecular stem structure. It is also useful for the
intramolecular stem structure to be more stable than hybrids
between the open circle probe and mismatched sequences.' In this
way, the intramolecular stem structure will be thermodynamically
favored over undesired primer hybridizations. Open circle probes
that form intramolecular stem structures at the 3' end will have
the 3' end extended during replication (using open circle probe
sequences as template). This serves to stabilize the intramolecular
stem structure in the uncircularized open circle probes, making
them unavailable for priming.
[0094] Portions of the OCP can have specific functions making the
OCP useful for RCA and LM-RCA. These portions are referred to as
the target probe portions, the primer complement portions, the
spacer region, the secondary DNA strand displacement primer
matching portions, the detection tag portions, the secondary target
sequence portions, the address tag portions, and the promoter
portions. The target probe portions and at least one primer
complement portion are required elements of an open circle probe.
The primer complement portion can be part of, for example, the
spacer region. Detection tag portions, secondary target sequence
portions, promoter portions, and additional primer complement
portions are optional and, when present, can be part of, for
example, the spacer region. Address tag portions are optional and,
when present, can be part of, for example, the spacer region. The
primer complement portions, and the detection tag portions, the
secondary target sequence portions, the address tag portions, and
the promoter portions, if present, can be non-overlapping. However,
various of these portions can be partially or completely
overlapping if desired. OCPs can be single-stranded but may be
partially double-stranded. In use, the target probe portions of an
OCP should be single-stranded so that they can interact with target
sequences. Generally, an open circle probe is a single-stranded,
linear DNA molecule comprising, from 5' end to 3' end, a 5'
phosphate group, a right target probe portion, a spacer region, a
left target probe portion, and a 3' hydroxyl group, with a primer
complement portion present as part of the spacer region.
Particularly useful open circle probes comprise a right target
probe portion, a left target probe portion, a detection primer
complement portion, a secondary DNA strand displacement primer
matching portion, and a common primer complement portion. Those
segments of the spacer region that do not correspond to a specific
portion of the OCP can be arbitrarily chosen sequences. It is
preferred that OCPs do not have any sequences that are
self-complementary. It is considered that this condition is met if
there are no complementary regions greater than six nucleotides
long without a mismatch or gap. It is also preferred that OCPs
containing a promoter portion do not have any sequences that
resemble a transcription terminator, such as a run of eight or more
thymidine nucleotides.
[0095] The open circle probe, when ligated and replicated, gives
rise to a long DNA molecule containing multiple repeats of
sequences complementary to the open circle probe. This long DNA
molecule is referred to herein as tandem sequences DNA (TS-DNA).
TS-DNA contains sequences complementary to the target probe
portions, the primer complement portion, the spacer region, and, if
present on the open circle probe, the detection tag portions, the
secondary target sequence portions, the address tag portions, and
the promoter portion. These sequences in the TS-DNA are referred to
as target sequences (which match the original target sequence),
primer sequences (which match the sequence of the rolling circle
replication primer), spacer sequences (complementary to the spacer
region), detection tags, secondary target sequences, address tags,
and promoter sequences. The TS-DNA will also have sequence
complementary to the matching portion of secondary DNA strand
displacement primers. This sequence in the TS-DNA is referred to as
the secondary DNA strand displacement primer complement or as the
primer complement.
[0096] 1. Sets of Open Circle Probes
[0097] Open circle probes can be used in sets in the disclosed
method. Ligation and amplification operations can involve a single
reaction or multiple different reactions. Each reaction can use one
or more sets of open circle probes. The same or different sets of
open circle probes can be used in different reactions. Useful sets
of open circle probes can have particular relationships to
detection rolling circle replication primers, common rolling circle
replication primers, and secondary DNA strand displacement primers.
For example, each detection rolling circle replication primer can
correspond to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer can
correspond to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer can
correspond to all of the open circle probes in the set of open
circle probes. This relationship has advantages discussed elsewhere
herein.
[0098] The disclosed method also can be carried out using multiple
open circle probe sets. The sets can each include a plurality of
different open circle probes. The primer relationships described
above can be extended to multiple open circle probe sets. For
example, each detection rolling circle replication primer can
correspond to a different open circle probe in all of the sets of
open circle probes, the secondary DNA strand displacement primer
can correspond to all of the open circle probes in all of the sets
of open circle probes, and the common rolling circle replication
primer can correspond to all of the open circle probes in all of
the sets of open circle probes. As another example, each detection
rolling circle replication primer can correspond to a different
open circle probe in all of the sets of open circle probes and the
common rolling circle replication primer can correspond to all of
the open circle probes in all of the sets of open circle probes.
The amplification operation can then be carried out in the presence
of a plurality of secondary DNA strand displacement primers, where
each secondary DNA strand displacement primer can correspond to
open circle probes in a different set of open circle probes and a
single secondary DNA strand displacement primer can correspond to
all of the open circle probes in a given set of open circle probes.
As another example, each detection rolling circle replication
primer can correspond to a different open circle probe in all of
the sets of open circle probes, the secondary DNA strand
displacement primer and can correspond to all of the open circle
probes in all of the sets of open circle probes. The amplification
operation can then be carried out in the presence of a plurality of
common rolling circle replication primers, where each common
rolling circle replication primer can correspond to open circle
probes in a different set of open circle probes and a single common
rolling circle replication primer can correspond to all of the open
circle probes in a given set of open circle probes.
[0099] As another example, each detection rolling circle
replication primer can correspond to a different open circle probe
in all of the sets of open circle probes. The amplification
operation can then be carried out in the presence of a plurality of
secondary DNA strand displacement primers and in the presence of a
plurality of common rolling circle replication primers. In the
reaction, each secondary DNA strand displacement primer can
correspond to open circle probes in a different set of open circle
probes, a single secondary DNA strand displacement primer can
correspond to all of the open circle probes in a given set of open
circle probes, each common rolling circle replication primer can
correspond to open circle probes in a different set of open circle
probes, and a single common rolling circle replication primer and
correspond to all of the open circle probes in a given set of open
circle probes.
[0100] As other examples, all of the open circle probes in all of
the sets of open circle probes can be different, and/or at least
one of the detection rolling circle replication primers can
correspond to an open circle probe in each of at least two of the
sets of open circle probes. As another example, each detection
rolling circle replication primer can correspond to a different
open circle probe in a given set of open circle probes. At least
one of the detection rolling circle replication primers can
correspond to an open circle probe in each of at least two of the
sets of open circle probes. Other combinations of sets and
relationships of primers to sets and members of the sets are
contemplated.
[0101] At least one of the detection rolling circle replication
primers corresponding to an open circle probe in one of the sets of
open circle probes can be labeled or detected with the same
fluorescent moiety as at least one of the detection rolling circle
replication primers corresponding to an open circle probe in a
different one of the sets of open circle probes. At least one of
the detection rolling circle replication primers corresponding to
an open circle probe in one of the sets of open circle probes can
be labeled or detected with the same fluorescent moiety as at least
one of the detection rolling circle replication primers in the same
set of open circle probes.
[0102] Another form of open circle probe set is a matched open
circle probe set. In a matched open circle probe set, the open
circle probes can be targeted to different forms of the same target
sequence. Different forms of a target sequence refer to sequences
that are homologous, analogous, allelic, or otherwise similarly
related or derived from a common source sequence but that have some
difference in sequence. For example, different forms of the same
target sequence can include a "wild type" or "normal" form and one
or more "mutant" forms of, for example, the same nucleic acid
segment, gene, or gene segment; two or more polymorphic forms of,
for example, the same nucleic acid segment, gene, or gene segment;
two or more allelic forms of, for example, the same nucleic acid
segment, gene, or gene segment; or two or more single nucleotide
polymorphisms of, for example, the same nucleic acid segment, gene,
or gene segment. These are only examples. The different forms of
the same target sequence can be any set of target sequences that
have an overall sequence similarity but that are not identical. By
targeting two or more different forms of a target sequence that may
be present, the amplification reaction can include a positive
control. That is, for example, an open circle probe targeted to the
normal form of the target sequence will produce a signal even if
the mutant form of the target sequence is not present in the
reaction or an open circle probe targeted to the mutant form of the
target sequence will produce a signal even if the normal form of
the target sequence is not present in the reaction.
[0103] The different forms of the same target sequence can
comprise, for example, a wild type form of the target sequence and
a mutant form of the target sequence; a normal form of the target
sequence and a mutant form of the target sequence; a wild type form
of the target sequence and two mutant forms of the target sequence;
a normal form of the target sequence and two mutant forms of the
target sequence; a wild type form of the target sequence and a
plurality of mutant forms of the target sequence; a normal form of
the target sequence and a plurality of mutant forms of the target
sequence; two allelic forms of the target sequence; two polymorphic
forms of the target sequence; two single nucleotide polymorphisms
of the target sequence; a normal form of the target sequence and a
single nucleotide polymorphism of the target sequence; a wild type
form of the target sequence and a single nucleotide polymorphism of
the target sequence; a plurality of allelic forms of the target
sequence; a plurality of polymorphic forms of the target sequence;
a plurality of single nucleotide polymorphisms of the target
sequence; a normal form of the target sequence and a plurality of
single nucleotide polymorphisms of the target sequence; a wild type
form of the target sequence and a plurality of single nucleotide
polymorphisms of the target sequence; or a combination. These are
only examples. Other combinations of forms of target sequences are
contemplated.
[0104] The set of open circle probes can include one or a plurality
of matched open circle probe sets. Open circle probes in different
matched open circle probe sets can be targeted to the same or to
different target sequences. Thus, open circle probes in one matched
open circle probe set can be targeted to different forms of the
same target sequence (for example, a first target sequence) while
open circle probes in a different matched open circle probe set can
be targeted to different forms of a different target sequence (for
example, a second target sequence). The different target sequences
can be unrelated or can have some relationship to each other. For
example, the different target sequences can be in the same gene.
Thus, there can be, for example, open circle probe sets that
include more than one matched open circle probe sets where the open
circle probe in two or more of the matched open circle probe sets
are targeted to different target sequences in the same gene. This
is useful, for example, for simultaneously testing for the presence
of alternative sequences at a number of different sites in a gene.
As another example, different target sequences to which open circle
probes in different matched open circle probe sets are targeted can
be associated with the same disease or condition. This is useful,
for example, for simultaneously testing for the presence of
multiple different sequences associated with a disease or
condition.
[0105] Matched open circle probe sets can be subsets of other open
circle probe sets (such as open circle probe sets having the
relationships to primers described above). A set of open circle
probes can comprise one or a plurality of matched open circle probe
sets. Differential detection of different open circle probes in
sets of open circle probes and in sets of matched open circle
probes can be accomplished generally as described elsewhere herein.
For example, different detection rolling circle replication primers
can correspond to different open circle probes in the set and can
include or be associated with different fluorescent moieties.
[0106] 2. Target Probe Portions
[0107] There are two target probe portions on each OCP, one at each
end of the OCP. The target probe portions can each be any length
that supports specific and stable hybridization between the target
probes and the target sequence. For this purpose, a length of 10 to
35 nucleotides for each target probe portion is preferred, with
target probe portions 15 to 25 nucleotides long being most
preferred. The target probe portion at the 3' end of the OCP is
referred to as the left target probe, and the target probe portion
at the 5' end of the OCP is referred to as the right target probe.
These target probe portions are also referred to herein as left and
right target probes or left and right probes. The target probe
portions are complementary to a target nucleic acid sequence.
[0108] The target probe portions are complementary to the target
sequence, such that upon hybridization the 5' end of the right
target probe portion and the 3' end of the left target probe
portion are base-paired to adjacent nucleotides in the target
sequence, with the objective that they serve as a substrate for
ligation.
[0109] Where the open circle probe has an intramolecular stem
structure that forms a stem and loop structure, it is useful for a
portion of one of the target probe portions of the open circle
probe to be in the loop of the stem and loop structure. This
portion of the target probe portion in the loop can then hybridize
to the target sequence of the open circle probe. Such an
arrangement allows design of hairpin open circle probes where the
stability of the intramolecular stem structure depends on the
presence or absence of the specific target sequence. In particular,
an open circle probe that forms a stem and loop structure with a
portion of the target probe portion in the loop can be designed so
that hybridization of the target probe portion in the loop to the
target sequence disrupts the intramolecular stem structure (FIG. 2;
Tyagi and Kramer, Nat Biotechnol 14(3):303-8 (1996); Bonnet et al.,
Proc Natl Acad Sci U S A 96(11):6171-6 (1999)). In this way, the
intramolecular stem structure remains intact in the absence of the
target sequence and thus reduces or eliminates the ability of the
open circle probe to prime nucleic acid replication (or to serve as
a template for rolling circle replication). In the presence of the
target sequence, disruption of the intramolecular stem structure
allows the end of the open circle probe to hybridize to the target
sequence. This hybrid between the target sequence and the end of
the open circle probe allows the ends of the open circle probe to
come into proximity on the target sequence which in turn allows
ligation of the ends (FIG. 3). For this form of hairpin open circle
probe, it is useful if hybridization of the loop to a sequence
other than the target sequence does not disrupt the intramolecular
stem structure. The hybrid between the target sequence and the
target probe portion at the end of the open circle probe can be
more stable than the intramolecular stem structure. This helps
stabilize hybridization of the open circle probe to the target
sequence in competition with the intramolecular stem structure.
[0110] Discrimination of open circle probe hybridization also can
be accomplished by hybridizing probe to target sequence under
conditions that favor only exact sequence matches leaving other
open circle probes unhybridized. The unhybridized open circle
probes will retain or re-form the intramolecular hybrid and the end
of the open circle probe involved in the intramolecular stem
structure will be extended during replication.
[0111] In another form of open circle probe, the 5' end and the 3'
end of the target probe portions may hybridize in such a way that
they are separated by a gap space. In this case the 5' end and the
3' end of the OCP may only be ligated if one or more additional
oligonucleotides, referred to as gap oligonucleotides, are used, or
if the gap space is filled during the ligation operation. The gap
oligonucleotides hybridize to the target sequence in the gap space
to form a continuous probe/target hybrid. The gap space may be any
length desired but is generally ten nucleotides or less. It is
preferred that the gap space is between about three to ten
nucleotides in length, with a gap space of four to eight
nucleotides in length being most preferred. Alternatively, a gap
space could be filled using a DNA polymerase during the ligation
operation. When using such a gap-filling operation, a gap space of
three to five nucleotides in length is most preferred. As another
alternative, the gap space can be partially bridged by one or more
gap oligonucleotides, with the remainder of the gap filled using
DNA polymerase.
[0112] 3. Primer Complement Portions
[0113] Primer complement portions are parts of an open circle probe
that are complementary to rolling circle replication primers
(RCRP). Each OCP preferably has at least two primer complement
portions: a detection primer complement portion and a common primer
complement portion. This allows rolling circle replication to
initiate at multiple sites on ligated OCPs. An OCP can include one
or more than one detection primer complement portion, and one or
more than one common primer complement portion. A single detection
primer complement portion is preferred. However, if multiple
detection primer complement portions are present, they can have
sequence complementary to the same detection rolling circle
replication primer (which is preferred), different detection
rolling circle replication primers, or a combination of the same
and different detection rolling circle replication primers. If
multiple common primer complement portions are present, they can
have sequence complementary to the same common rolling circle
replication primer (which is preferred), different common rolling
circle replication primers, or a combination of the same and
different common rolling circle replication primers. A primer
complement portion and its cognate primer can have any desired
sequence so long as they are complementary to each other. The
sequence of the primer complement portion is referred to as the
primer complement sequence. The primer complement portion
complementary to a detection rolling circle replication primer can
be referred to as a detection primer complement portion. The primer
complement portion complementary to a common rolling circle
replication primer can be referred to as a common primer complement
portion. The primer complement sequence of a detection primer
complement portion can be referred to as a detection primer
complement sequence. The primer complement sequence of a common
primer complement portion can be referred to as a common primer
complement sequence.
[0114] In general, the sequence of a primer complement can be
chosen such that it is not significantly similar to any other
portion of the OCP. The primer complement portion can be any length
that supports specific and stable hybridization between the primer
complement portion and the primer. For this purpose, a length of 10
to 35 nucleotides is preferred, with a primer complement portion 16
to 20 nucleotides long being most preferred. The primer complement
portion can be located anywhere on the OCP, such as within the
spacer region of an OCP. Primer complement portions can be anywhere
on the OCP or circularized OCP. For example, the primer complement
portions can be adjacent to the right target probe, with the right
target probe portion and the primer complement portion preferably
separated by three to ten nucleotides, and most preferably
separated by six nucleotides, from the proximate primer complement
portion. This location prevents the generation of any other spacer
sequences, such as detection tags and secondary target sequences,
from unligated open circle probes during DNA replication. A primer
complement portion can also be a part of or overlap all or a part
of the target probe portions and/or any gap space sequence, if
present.
[0115] 4. Secondary DNA Strand Displacement Primer Matching
Portions
[0116] Secondary DNA strand displacement primer matching portions
are parts of an open circle probe that match sequence in secondary
DNA strand displacement primers. The sequence in a secondary DNA
strand displacement primer that matches a secondary DNA strand
displacement primer matching portion in an OCP is referred to as
the matching portion of the secondary DNA strand displacement
primer. An OCP can include one or more than one primer matching
portion. If multiple primer matching portions are present, they can
have sequence matching the same secondary DNA strand displacement
primer (which is preferred), different secondary DNA strand
displacement primers, or a combination of the same and different
secondary DNA strand displacement primers. A single secondary DNA
strand displacement primer matching portion is preferred. A primer
matching portion and its cognate primer can have any desired
sequence so long as they are complementary to each other. The
sequence of the primer matching portion can be referred to as the
primer matching sequence. More specifically, the sequence of the
secondary DNA strand displacement primer matching portion can be
referred to as the secondary DNA strand displacement primer
matching sequence.
[0117] In general, the sequence of a primer matching portion can be
chosen such that it is not significantly similar to any other
portion of the OCP. Primer matching portions can overlap with
primer complement portions, although it is preferred that they not
overlap. The primer matching portion can be any length that
supports specific and stable hybridization between the primer
complement portion in the resulting TS-DNA and the primer. For this
purpose, a length of 10 to 35 nucleotides is preferred, with a
primer matching portion 16 to 20 nucleotides long being most
preferred. The primer matching portion can be located anywhere on
the OCP, such as within the spacer region of an OCP. Primer
matching portions can be anywhere on the OCP or circularized
OCP.
[0118] 5. Detection Tag Portions
[0119] Detection tag portions are part of the spacer region of an
open circle probe. Detection tag portions have sequences matching
the sequence of the complementary portion of detection probes.
These detection tag portions, when amplified during rolling circle
replication, result in TS-DNA having detection tag sequences that
are complementary to the complementary portion of detection probes.
If present, there may be one, two, three, or more than three
detection tag portions on an OCP. For example, an OCP can have two,
three or four detection tag portions. Most preferably, an OCP will
have three detection tag portions. Generally, it is preferred that
an OCP have 60 detection tag portions or less. There is no
fundamental limit to the number of detection tag portions that can
be present on an OCP except the size of the OCP. When there are
multiple detection tag portions, they may have the same sequence or
they may have different sequences, with each different sequence
complementary to a different detection probe. It is preferred that
an OCP contain detection tag portions that have the same sequence
such that they are all complementary to a single detection probe.
For some multiplex detection methods, it is preferable that OCPs
contain up to six detection tag portions and that the detection tag
portions have different sequences such that each of the detection
tag portions is complementary to a different detection probe. The
detection tag portions can each be any length that supports
specific and stable hybridization between the detection tags and
the detection probe. For this purpose, a length of 10 to 35
nucleotides is preferred, with a detection tag portion 15 to 20
nucleotides long being most preferred. Detection tags are less
useful when the method involves real-time detection of
amplification via detection rolling circle replication primers.
[0120] 6. Secondary Target Sequence Portions
[0121] Secondary target sequence portions are part of the spacer
region of an open circle probe. Secondary target sequence portions
have sequences matching the sequence of target probes of a
secondary open circle probe. These secondary target sequence
portions, when amplified during rolling circle replication, result
in TS-DNA having secondary target sequences that are complementary
to target probes of a secondary open circle probe. If present,
there may be one, two, or more than two secondary target sequence
portions on an OCP. It is preferred that an OCP have one or two
secondary target sequence portions. Most preferably, an OCP will
have one secondary target sequence portion. Generally, it is
preferred that an OCP have 50 secondary target sequence portions or
less. There is no fundamental limit to the number of secondary
target sequence portions that can be present on an OCP except the
size of the OCP. When there are multiple secondary target sequence
portions, they may have the same sequence or they may have
different sequences, with each different sequence complementary to
a different secondary OCP. It is preferred that an OCP contain
secondary target sequence portions that have the same sequence such
that they are all complementary to a single target probe portion of
a secondary OCP. The secondary target sequence portions can each be
any length that supports specific and stable hybridization between
the secondary target sequence and the target sequence probes of its
cognate OCP. For this purpose, a length of 20 to 70 nucleotides is
preferred, with a secondary target sequence portion 30 to 40
nucleotides long being most preferred. As used herein, a secondary
open circle probe is an open circle probe where the target probe
portions match or are complementary to secondary target sequences
in another open circle probe or an amplification target circle. It
is contemplated that a secondary open circle probe can itself
contain secondary target sequences that match or are complementary
to the target probe portions of another secondary open circle
probe. Secondary open circle probes related to each other in this
manner are referred to herein as nested open circle probes.
[0122] 7. Address Tag Portions
[0123] The address tag portion is part of either the target probe
portions or the spacer region of an open circle probe. The address
tag portion has a sequence matching the sequence of the
complementary portion of an address probe. This address tag
portion, when amplified during rolling circle replication, results
in TS-DNA having address tag sequences that are complementary to
the complementary portion of address probes. If present, there may
be one, or more than one, address tag portions on an OCP. It is
preferred that an OCP have one or two address tag portions. Most
preferably, an OCP will have one address tag portion. Generally, it
is preferred that an OCP have 50 address tag portions or less.
There is no fundamental limit to the number of address tag portions
that can be present on an OCP except the size of the OCP. When
there are multiple address tag portions, they may have the same
sequence or they may have different sequences, with each different
sequence complementary to a different address probe. It is
preferred that an OCP contain address tag portions that have the
same sequence such that they are all complementary to a single
address probe. Preferably, the address tag portion overlaps all or
a portion of the target probe portions, and all of any intervening
gap space. Most preferably, the address tag portion overlaps all or
a portion of both the left and right target probe portions. The
address tag portion can be any length that supports specific and
stable hybridization between the address tag and the address probe.
For this purpose, a length between 10 and 35 nucleotides long is
preferred, with an address tag portion 15 to 20 nucleotides long
being most preferred.
[0124] 8. Promoter Portions
[0125] The promoter portion corresponds to the sequence of an RNA
polymerase promoter. A promoter portion can be included in an open
circle probe so that transcripts can be generated from the OCP or
TS-DNA. The sequence of any promoter may be used, but simple
promoters for RNA polymerases without complex requirements are
preferred. It is also preferred that the promoter is not recognized
by any RNA polymerase that may be present in the sample containing
the target nucleic acid sequence. Preferably, the promoter portion
corresponds to the sequence of a T7 or SP6 RNA polymerase promoter.
The T7 and SP6 RNA polymerases are highly specific for particular
promoter sequences. Other promoter sequences specific for RNA
polymerases with this characteristic would also be preferred.
Because promoter sequences are generally recognized by specific RNA
polymerases, the cognate polymerase for the promoter portion of the
OCP should be used for transcriptional amplification. Numerous
promoter sequences are known and any promoter specific for a
suitable RNA polymerase can be used. The promoter portion can be
located anywhere within the spacer region of an OCP and can be in
either orientation. Preferably, the promoter portion is immediately
adjacent to the left target probe and is oriented to promote
transcription toward the 3' end of the open circle probe. This
orientation results in transcripts that are complementary to
TS-DNA, allowing independent detection of TS-DNA and the
transcripts, and prevents transcription from interfering with
rolling circle replication.
[0126] B. Gap Oligonucleotides
[0127] Gap oligonucleotides are oligonucleotides that are
complementary to all or a part of that portion of a target sequence
which covers a gap space between the ends of a hybridized open
circle probe. Gap oligonucleotides have a phosphate group at their
5' ends and a hydroxyl group at their 3' ends. This facilitates
ligation of gap oligonucleotides to open circle probes, or to other
gap oligonucleotides. The gap space between the ends of a
hybridized open circle probe can be filled with a single gap
oligonucleotide, or it can be filled with multiple gap
oligonucleotides. For example, two 3 nucleotide gap
oligonucleotides can be used to fill a six nucleotide gap space, or
a three nucleotide gap oligonucleotide and a four nucleotide gap
oligonucleotide can be used to fill a seven nucleotide gap space.
Gap oligonucleotides are particularly useful for distinguishing
between closely related target sequences. For example, multiple gap
oligonucleotides can be used to amplify different allelic variants
of a target sequence. By placing the region of the target sequence
in which the variation occurs in the gap space formed by an open
circle probe, a single open circle probe can be used to amplify
each of the individual variants by using an appropriate set of gap
oligonucleotides.
[0128] C. Amplification Target Circles
[0129] An amplification target circle (ATC) is a circular DNA
molecule, preferably containing between 40 to 1000 nucleotides,
more preferably between about 50 to 150 nucleotides, and most
preferably between about 50 to 100 nucleotides. ATCs are preferably
single-stranded but may be partially or fully double-stranded.
Portions of ATCs have specific functions making the ATC useful for
rolling circle amplification (RCA). These portions are referred to
as the primer complement portions, the secondary DNA strand
displacement primer matching portions, the detection tag portions,
the secondary target sequence portions, the address tag portions,
and the promoter portions. These portions are analogous to
similarly-named portions of OCPs and their further description
elsewhere herein in the context of OCPs is applicable to the
analogous portion in ATCs. At least one primer complement portion
is a required element of an amplification target circle. Secondary
DNA strand displacement primer matching portions, detection tag
portions, secondary target sequence portions, address tag portions,
and promoter portions are optional. The primer complement portion,
and other primer complement portions, the secondary DNA strand
displacement primer matching portions, the detection tag portions,
the secondary target sequence portions, the address tag portions,
and the promoter portion, if present, are preferably
non-overlapping. However, various of these portions can be
partially or completely overlapping if desired. Generally, an
amplification target circle is a single-stranded, circular DNA
molecule comprising a primer complement portion. Particularly
useful amplification target circles comprise a detection primer
complement portion, a secondary DNA strand displacement primer
matching portion, and a common primer complement portion. Those
segments of the ATC that do not correspond to a specific portion of
the ATC can be arbitrarily chosen sequences. It is preferred that
ATCs do not have any sequences that are self-complementary. It is
considered that this condition is met if there are no complementary
regions greater than six nucleotides long without a mismatch or
gap. It is also preferred that ATCs containing a promoter portion
do not have any sequences that resemble a transcription terminator,
such as a run of eight or more thymidine nucleotides. Ligated and
circularized open circle probes are a type of ATC, and as used
herein the term amplification target circle includes ligated open
circle probes and circularized open circle probes. An ATC can be
used in the same manner as described herein for OCPs that have been
ligated or circularized.
[0130] An amplification target circle, when replicated, gives rise
to a long DNA molecule containing multiple repeats of sequences
complementary to the amplification target circle. This long DNA
molecule is referred to herein as tandem sequences DNA (TS-DNA).
TS-DNA contains sequences complementary to the primer complement
portions and, if present on the amplification target circle, the
secondary DNA strand displacement primer matching portions, the
detection tag portions, the secondary target sequence portions, the
address tag portions, and the promoter portion. These sequences in
the TS-DNA are referred to as primer sequences (which match the
sequence of the rolling circle replication primer), spacer
sequences (complementary to the spacer region), detection tags,
secondary target sequences, address tags, and promoter sequences.
The TS-DNA will also have sequence complementary to the matching
portion of secondary DNA strand displacement primers. This sequence
in the TS-DNA is referred to as the secondary DNA strand
displacement primer complement or as the primer complement.
Amplification target circles are useful as tags for specific
binding molecules.
[0131] 1. Sets of Amplification Target Circles
[0132] Amplification target circles can be used in sets in the
disclosed method. Amplification operations can involve a single
reaction or multiple different reactions. Each reaction can use one
or more sets of amplification target circles. The same or different
sets of amplification target circles can be used in different
reactions. Useful sets of amplification target circles can have
particular relationships to detection rolling circle replication
primers, common rolling circle replication primers, and secondary
DNA strand displacement primers. Generally, these are the same
relationships that sets of open circle probes can have to the
primers, as described elsewhere herein. For example, each detection
rolling circle replication primer can correspond to a different
amplification target circle in the set of amplification target
circles, the secondary DNA strand displacement primer can
correspond to all of the amplification target circles in the set of
amplification target circles, and the common rolling circle
replication primer can correspond to all of the amplification
target circles in the set of amplification target circles. This
relationship has advantages discussed elsewhere herein.
[0133] The disclosed method also can be carried out using multiple
amplification target circle sets. The sets can each include a
plurality of different amplification target circles. The primer
relationships described above can be extended to multiple
amplification target circle sets. For example, each detection
rolling circle replication primer can correspond to a different
amplification target circle in all of the sets of amplification
target circles, the secondary DNA strand displacement primer can
correspond to all of the amplification target circles in all of the
sets of amplification target circles, and the common rolling circle
replication primer can correspond to all of the amplification
target circles in all of the sets of amplification target circles.
As another example, each detection rolling circle replication
primer can correspond to a different amplification target circle in
all of the sets of amplification target circles and the common
rolling circle replication primer can correspond to all of the
amplification target circles in all of the sets of amplification
target circles. The amplification operation can then be carried out
in the presence of a plurality of secondary DNA strand displacement
primers, where each secondary DNA strand displacement primer can
correspond to amplification target circles in a different set of
amplification target circles and a single secondary DNA strand
displacement primer can correspond to all of the amplification
target circles in a given set of amplification target circles. As
another example, each detection rolling circle replication primer
can correspond to a different amplification target circle in all of
the sets of amplification target circles, the secondary DNA strand
displacement primer and can correspond to all of the amplification
target circles in all of the sets of amplification target circles.
The amplification operation can then be carried out in the presence
of a plurality of common rolling circle replication primers, where
each common rolling circle replication primer can correspond to
amplification target circles in a different set of amplification
target circles and a single common rolling circle replication
primer can correspond to all of the amplification target circles in
a given set of amplification target circles.
[0134] As another example, each detection rolling circle
replication primer can correspond to a different amplification
target circle in all of the sets of amplification target circles.
The amplification operation can then be carried out in the presence
of a plurality of secondary DNA strand displacement primers and in
the presence of a plurality of common rolling circle replication
primers. In the reaction, each secondary DNA strand displacement
primer can correspond to amplification target circles in a
different set of amplification target circles, a single secondary
DNA strand displacement primer can correspond to all of the
amplification target circles in a given set of amplification target
circles, each common rolling circle replication primer can
correspond to amplification target circles in a different set of
amplification target circles, and a single common rolling circle
replication primer and correspond to all of the amplification
target circles in a given set of amplification target circles.
[0135] As other examples, all of the amplification target circles
in all of the sets of amplification target circles can be
different, and/or at least one of the detection rolling circle
replication primers can correspond to an amplification target
circle in each of at least two of the sets of amplification target
circles. As another example, each detection rolling circle
replication primer can correspond to a different amplification
target circle in a given set of amplification target circles. At
least one of the detection rolling circle replication primers can
correspond to an amplification target circle in each of at least
two of the sets of amplification target circles. Other combinations
of sets and relationships of primers to sets and members of the
sets are contemplated.
[0136] At least one of the detection rolling circle replication
primers corresponding to an amplification target circle in one of
the sets of amplification target circles can be labeled or detected
with the same fluorescent moiety as at least one of the detection
rolling circle replication primers corresponding to an
amplification target circle in a different one of the sets of
amplification target circles. At least one of the detection rolling
circle replication primers corresponding to an amplification target
circle in one of the sets of amplification target circles can be
labeled or detected with the same fluorescent moiety as at least
one of the detection rolling circle replication primers in the same
set of amplification target circles.
[0137] Another form of amplification target circle set is a matched
amplification target circle set. In one form of matched
amplification target circle set, the amplification target circles
are circularized open circle probes from a matched set of open
circle probes. In a matched open circle probe set, the open circle
probes can be targeted to different forms of the same target
sequence. Matched open circle probe sets are described further
elsewhere herein. In another form of matched amplification target
circles, the amplification target circles correspond to or are
derived from different forms of the same target molecule. Different
forms of a target molecule refer to the same molecule that has some
difference. For example, different forms of the same target
molecule can include a "wild type" or "normal" form and one or more
"mutant" forms of, for example, the same nucleic protein; two or
more polymorphic forms of, for example, the same protein. These are
only examples. The different forms of the same target molecule can
be any set of target molecules that have an overall similarity but
that are not identical. By targeting two or more different forms of
a target molecule that may be present, the amplification reaction
can include a positive control. That is, for example, an
amplification target circle corresponding to the normal form of the
target molecule will produce a signal even if the mutant form of
the target molecule is not present in the reaction or an
amplification target circle corresponding to the mutant form of the
target molecule will produce a signal even if the normal form of
the target molecule is not present in the reaction.
[0138] The set of amplification target circles can include one or a
plurality of matched amplification target circle sets.
Amplification target circles in different matched amplification
target circle sets can correspond to the same or to different
target molecules. Thus, open circle probes in one matched
amplification target circle set can correspond to different forms
of the same target molecule (for example, a first protein) while
amplification target circles in a different matched amplification
target circle set can correspond to different forms of a different
target molecule (for example, a second protein). The different
target molecules can be unrelated or can have some relationship to
each other. For example, the different target molecules to which
amplification target circles in different matched amplification
target circle sets correspond can be associated with the same
disease or condition. This is useful, for example, for
simultaneously testing for the presence of multiple different
proteins associated with a disease or condition.
[0139] Matched amplification target circle sets can be subsets of
other amplification target circle sets (such as amplification
target circle sets having the relationships to primers described
above). A set of amplification target circles can comprise one or a
plurality of matched amplification target circle sets. Differential
detection of different amplification target circles in sets of
amplification target circles and in sets of matched amplification
target circles can be accomplished generally as described elsewhere
herein. For example, different detection rolling circle replication
primers can correspond to different amplification target circles in
the set and can include or be associated with different fluorescent
moieties.
[0140] D. Rolling Circle Replication Primers
[0141] A rolling circle replication primer (RCRP) is an
oligonucleotide having sequence complementary to the primer
complement portion of an OCP or ATC. This sequence is referred to
as the complementary portion of the RCRP. The complementary portion
of a RCRP and the cognate primer complement portion can have any
desired sequence so long as they are complementary to each other.
In general, the sequence of the RCRP can be chosen such that it is
not significantly complementary to any other portion of the OCP or
ATC. The complementary portion of a rolling circle replication
primer can be any length that supports specific and stable
hybridization between the primer and the primer complement portion.
Generally this is 10 to 35 nucleotides long, but is preferably 16
to 20 nucleotides long. Useful rolling circle replication primers
are fluorescent change primers.
[0142] It is preferred that rolling circle replication primers also
contain additional sequence at the 5' end of the RCRP that is not
complementary to any part of the OCP or ATC. This sequence is
referred to as the non-complementary portion of the RCRP. The
non-complementary portion of the RCRP, if present, can serve to
facilitate strand displacement during DNA replication. The
non-complementary portion of a RCRP may be any length, but is
generally 1 to 100 nucleotides long, and preferably 4 to 8
nucleotides long. The non-complementary portion can be involved in
interactions that provide specialized effects. For example, the
non-complementary portion can comprise a quencher complement
portion that can hybridize to a peptide nucleic acid quencher or
peptide nucleic acid fluor or that can form an intramolecular
structure. Rolling circle replication primers can also comprise
fluorescent moieties or labels and quenching moieties.
[0143] Useful rolling circle replication primers for use in the
disclosed method can form an intramolecular stem structure
involving one or both of the RCRP's ends. Such rolling circle
replication primers are referred to herein as hairpin rolling
circle replication primers. An intramolecular stem structure
involving an end refers to a stem structure where the terminal
nucleotides (that is, nucleotides at the end) of the RCRP are
hybridized to other nucleotides in the RCRP.
[0144] The intramolecular stem structure can form a hairpin
structure or a stem and loop structure. If both ends of an RCRP are
involved in an intramolecular stem structure, the two ends of the
RCRP can each form a separate intramolecular stem structure or can
together form a single intramolecular stem structure. In the latter
case the two ends would be hybridized together. It is preferred
that the 3' end of the rolling circle replication primer form an
intramolecular stem structure. The 5' end of the rolling circle
replication primer can also form an intramolecular stem structure,
either alone, or in the rolling circle replication primer having an
intramolecular stem structure at the 3' end. The intramolecular
stem structure preferably involves both ends of the primer and has
a blunt end. Also preferred is a short 3' unpaired overhang. The
intramolecular stem structure preferably forms under conditions
suitable for nucleic acid replication, and in particular under
conditions used for nucleic acid replication when the rolling
circle replication primer is being used. For example, the
intramolecular stem stricture can be designed to form under
conditions used for rolling circle replication. The formation of
the intramolecular stem structure during replication allows the
structure to reduce or prevent priming by rolling circle
replication primers at unintended sequences. In particular, the
intramolecular stem structure prevents the rolling circle
replication primer in which the structure forms from priming
rolling circle replication, from priming nucleic acid replication,
or both, at sites other than primer complement sequences (that is,
the specific sequences complementary to the complementary portion
of the rolling circle replication primer). This follows from the
sequestration of the end of rolling circle replication primer in
the stem. The end of the rolling circle replication primer cannot
hybridize to, and prime from, another sequence while sequestered in
the intramolecular stem structure. For this purpose, it is
preferred that the intramolecular stem structure be less stable
that the hybrid between the primer complement sequence and the
complementary portion of the rolling circle replication primer (or,
put another way, the hybrid between the primer complement sequence
and the complementary portion of the rolling circle replication
primer should be more stable than the intramolecular stem
structure). It is also preferred that the intramolecular stem
structure be more stable than hybrids between the rolling circle
replication primer and mismatched sequences. In this way, the
intramolecular stem structure will be thermodynamically favored
over undesired primer hybridizations. Although rolling circle
replication primers that form intramolecular stem structures at the
3' end leaving the 5' end unpaired and overhanging can be used,
this is not preferred. In such a case, the 3' end could be extended
during replication (using rolling circle replication primer
sequences as template), thus inactivating the primers.
[0145] Where the intramolecular stem structure of a rolling circle
replication primer forms a stem and loop structure, it is preferred
that a portion of the complementary portion of the rolling circle
replication primer be in the loop of the stem and loop structure.
This portion of the complementary portion in the loop can then
hybridize to the primer complement sequence of the open circle
probe. Such an arrangement allows design of hairpin rolling circle
replication primers where the stability of the intramolecular stem
structure depends on the presence or absence of the specific primer
complement sequence. In particular, a rolling circle replication
primer that forms a stem and loop structure with a portion of the
complementary portion in the loop can be designed so that
hybridization of the complementary portion in the loop to the
primer complement sequence disrupts the intramolecular stem
structure (Tyagi and Kramer, Nat Biotechnol 14(3):303-8 (1996);
Bonnet et al., Proc Natl Acad Sci U S A 96(11):6171-6 (11999)). In
this way, the intramolecular stem structure remains intact in the
absence of the primer complement sequence and thus reduces or
eliminates the ability of the rolling circle replication primer to
prime nucleic acid replication. In the presence of the primer
complement sequence, disruption of the intramolecular stem
structure allows the end of the rolling circle replication primer
to hybridize to the primer complement sequence. This hybrid between
the primer complement sequence and the end of the rolling circle
replication primer allows the priming of nucleic acid replication
by the primer. For this form of hairpin rolling circle replication
primer, it is preferred that hybridization of the loop to a
sequence other than the primer complement sequence does not disrupt
the intramolecular stem structure. Preferably, the hybrid between
the primer complement sequence and the end of the rolling circle
replication primer is more stable than the intramolecular stem
structure. This helps stabilize hybridization of the rolling circle
replication primer to the primer complement sequence in competition
with the intramolecular stem structure.
[0146] Discrimination of rolling circle replication primer
hybridization also can be accomplished by hybridizing primer to
primer complement portions of OCPs or ATCs under conditions that
favor only exact sequence matches leaving other rolling circle
replication primer unhybridized. The unhybridized rolling circle
replication primers will retain or re-form the intramolecular
hybrid.
[0147] The rolling circle replication primer may also include
modified nucleotides to make it resistant to exonuclease digestion.
For example, the primer can have three or four phosphorothioate
linkages between nucleotides at the 5' end of the primer. Such
nuclease resistant primers allow selective degradation of excess
unligated OCP and gap oligonucleotides that might otherwise
interfere with hybridization of detection probes, address probes,
and secondary OCPs to the amplified nucleic acid. A rolling circle
replication primer can be used as the tertiary DNA strand
displacement primer in strand displacement cascade
amplification.
[0148] Rolling circle replication primers may also include modified
nucleotides to make them resistant to exonuclease digestion. For
example, the primer can have three or four phosphorothioate
linkages between nucleotides at the 5' end of the primer. Such
nuclease resistant primers allow selective degradation of excess
unligated OCP and gap oligonucleotides that might otherwise
interfere with hybridization of detection probes, address probes,
and secondary OCPs to the amplified nucleic acid.
[0149] A rolling circle replication primer is specific for, or
corresponds to, an open circle probe or amplification target circle
when the complementary portion of the rolling circle replication
primer is complementary to the primer complement portion of the
open circle probe or amplification target circle. A rolling circle
replication primer is not specific for, or does not correspond to,
an open circle probe or amplification target circle when the
complementary portion of the rolling circle replication primer is
not substantially complementary to the open circle probe or
amplification target circle. A complementary portion is not
substantially complementary to another sequence if it has a melting
temperature 10.degree. C. lower than the melting temperature under
the same conditions of a sequence fully complementary to the
complementary portion of the rolling circle replication primer.
[0150] A rolling circle replication primer is specific for, or
corresponds to, a set of open circle probes or a set of
amplification target circles when the complementary portion of the
rolling circle replication primer is complementary to the primer
complement portion of the open circle probes or amplification
target circles in the set. A rolling circle replication primer is
not specific for, or does not correspond to, a set of open circle
probes or a set of amplification target circles when the
complementary portion of the rolling circle replication primer is
not substantially complementary to the open circle probes or
amplification target circles in the set.
[0151] 1. Detection Rolling Circle Replication Primers
[0152] Detection rolling circle replication primers are rolling
circle replication primers that are specific for, or correspond to,
a particular open circle probe, amplification target circle, set of
open circle probes, or set of amplification target circles in an
amplification reaction. Useful detection rolling circle replication
primers are fluorescent change primers. Fluorescent change primers
are primers that involve a change in fluorescence intensity or
wavelength based on a change in the form or conformation of the
primer. Useful fluorescent change primers have a stem structure
with the fluorescent moiety and quenching moiety incorporated into
opposite strands of the stem structure. The stem structure can be
an intermolecular stem structure (such as a hairpin or stem and
loop) or an intramolecular stem structure. In the structured state,
the quenching moiety prevents or limits fluorescence of the
fluorescent moiety. When the stem of the primer is disrupted, the
quenching moiety and fluorescent moiety are no longer in proximity
and the fluorescent moiety produces a fluorescent signal.
Fluorescent change primers that form an intramolecular stem
structure are referred to as hairpin quenched primers. Fluorescent
change primers that form an intermolecular stem structure are
referred to as stem quenched primers.
[0153] In the disclosed method, use of fluorescent change primers
produces double-stranded tandem sequence DNA where the primer stem
is disrupted in favor of a complementary, replicated strand. From a
reaction initially containing structured (that is, non-fluorescent)
fluorescent change primers, fluorescence signal increases as
amplification takes place, as more and more of the fluorescent
change primers are incorporated into double stranded TS-DNA, as the
fluorescent change primer stems are disrupted, and as the
fluorescent moieties are consequently unquenched. Thus, use of
fluorescent change primers is particularly suited for real-time
detection of amplification in ERCA. Examples of fluorescent change
primers are stem quenched primers, hairpin quenched primers,
Amplifluor primers and scorpion primers.
[0154] 2. Common Rolling Circle Replication Primers
[0155] Common rolling circle replication primers are rolling circle
replication primers that are specific for, or correspond to, all of
the open circle probes or amplification target circles in an
amplification reaction or in a set of open circle probes or set of
amplification target circles in an amplification reaction. Common
rolling circle replication primers can be fluorescent change
primers although this is not preferred.
[0156] The use of both detection rolling circle replication primers
and common rolling circle replication primers in a reaction can
increase the consistency of the amplification. Detection rolling
circle replication primers and common rolling circle replication
primers can have different relationships to open circle probes and
amplification target circles used in the method. For example, for a
given set of open circle probes or amplification target circles,
detection rolling circle replication primers can each correspond to
a different open circle probe or amplification target circle in the
set while common rolling circle replication primers can correspond
to all of the open circle probes or amplification target circles in
the set. These relationships allow the overall amplification to be
consistent among different open circle probes or amplification
target circles in a set because the sequence of one of the primers
used (and its complement on the circles) will be the same
throughout the set (thus minimizing or eliminating the effect of
sequence on primer efficiency). Differential detection can be
mediated by the circle-specific detection rolling circle
replication primers. The use of secondary DNA strand displacement
primers that correspond to all of the open circle probes or
amplification target circles in the set has a similar effect of
allowing the overall amplification to be consistent among different
open circle probes or amplification target circles in a set because
the sequence of two of the primers used (and their complements on
the circles) will be the same throughout the set (thus minimizing
or eliminating the effect of sequence on primer efficiency).
[0157] The use of two or more rolling circle replication primers,
such as the use of a detection rolling circle replication primer
and a common rolling circle replication primer, with each primer
specific for a different sequence or region of the open circle
probes or amplification target circles, can increase the efficiency
of amplification by producing multiple simultaneous initiations of
replication. For example, each of two or more different rolling
circle replication primers can simultaneously prime replication
from different sequences in a given circularized open circle probe
or amplification target circle. This multiplies the yield of
amplification.
[0158] E. DNA Strand Displacement Primers
[0159] Primers used for secondary DNA strand displacement are
referred to herein as DNA strand displacement primers. One form of
DNA strand displacement primer, referred to herein as a secondary
DNA strand displacement primer, is an oligonucleotide having
sequence matching part of the sequence of an OCP or ATC. This
sequence in the secondary DNA strand displacement primer is
referred to as the matching portion of the secondary DNA strand
displacement primer. The sequence in the OCP or ATC that matches
the matching portion of the secondary DNA strand displacement
primer is referred to as the secondary DNA strand displacement
primer matching portion. The matching portion of a secondary DNA
strand displacement primer is complementary to sequences in TS-DNA.
The matching portion of a secondary DNA strand displacement primer
may be complementary to any sequence in TS-DNA. However, it is
preferred that it not be complementary TS-DNA sequence matching
either the rolling circle replication primers or a tertiary DNA
strand displacement primer, if one is being used. This prevents
hybridization of the primers to each other. The matching portion of
a secondary DNA strand displacement primer may be complementary to
all or a portion of the target sequence. In this case, it is
preferred that the 3' end nucleotides of the secondary DNA strand
displacement primer are complementary to the gap sequence in the
target sequence. It is most preferred that nucleotide at the 3' end
of the secondary DNA strand displacement primer falls complementary
to the last nucleotide in the gap sequence of the target sequence,
that is, the 5' nucleotide in the gap sequence of the target
sequence. The matching portion of a secondary DNA strand
displacement primer can be any length that supports specific and
stable hybridization between the primer and its complement.
Generally this is 12 to 35 nucleotides long, but is preferably 18
to 25 nucleotides long.
[0160] Secondary DNA strand displacement primers can be specific
for, or correspond to, all of the open circle probes or
amplification target circles in an amplification reaction or in a
set of open circle probes or set of amplification target circles in
an amplification reaction. A secondary DNA strand displacement
primer is specific for, or corresponds to, an open circle probe or
amplification target circle when the matching portion of the
secondary DNA strand displacement primer matches the primer
complement portion of the open circle probe or amplification target
circle. A secondary DNA strand displacement primer is not specific
for, or does not correspond to, an open circle probe or
amplification target circle when the matching portion of the
secondary DNA strand displacement primer does not substantially
match sequence in the open circle probe or amplification target
circle. A matching portion does not substantially match another
sequence if it has a melting temperature with the complement of the
other sequence that is 10.degree. C. lower than the melting
temperature under the same conditions of a sequence fully
complementary to the matching portion of the secondary DNA strand
displacement primer.
[0161] A secondary DNA strand displacement primer is specific for,
or corresponds to, a set of open circle probes or a set of
amplification target circles when the matching portion of the
secondary DNA strand displacement primer matches the primer
complement portion of the open circle probes or amplification
target circles in the set. A secondary DNA strand displacement
primer is not specific for, or does not correspond to, a set of
open circle probes or a set of amplification target circles when
the matching portion of the secondary DNA strand displacement
primer does not substantially match the open circle probes or
amplification target circles in the set. Secondary DNA strand
displacement primers can be fluorescent change primers although
this is not preferred.
[0162] The use of two or more rolling circle replication primers,
such as the use of a detection rolling circle replication primer
and a common rolling circle replication primer, with each primer
specific for a different sequence or region of the open circle
probes or amplification target circles, can increase the efficiency
of amplification by producing multiple simultaneous generations of
amplification product. For example, use of both rolling circle
replication primers (which prime replication of circularized open
circle probes and amplification target circles) and secondary DNA
strand displacement primers (which prime replication of the product
of replication of circularized open circle probes and amplification
target circles) allows multiple generations of amplification
product to be generated simultaneously. This multiplies the yield
of amplification.
[0163] The use of both rolling circle replication primers and
secondary DNA strand displacement primers in a reaction can
increase the consistency of the amplification. rolling circle
replication primers and secondary DNA strand displacement primers
can have different relationships to open circle probes and
amplification target circles used in the method. For example, for a
given set of open circle probes or amplification target circles,
detection rolling circle replication primers can each correspond to
a different open circle probe or amplification target circle in the
set while secondary DNA strand displacement primers and common
rolling circle replication primers can correspond to all of the
open circle probe or amplification target circles in the set. These
relationships allow the overall amplification to be consistent
among different open circle probes or amplification target circles
in a set because the sequence of two of the primers used (and their
complements on the circles) will be the same throughout the set
(thus minimizing or eliminating the effect of sequence on primer
efficiency). Differential detection is mediated by the
circle-specific detection rolling circle replication primers.
[0164] It is preferred that secondary DNA strand displacement
primers also contain additional sequence at the 5' end of the
primer that does not match any part of the OCP or ATC. This
sequence is referred to as the non-matching portion of the
secondary DNA strand displacement primer. The non-matching portion
of the secondary DNA strand displacement primer, if present, can
serve to facilitate strand displacement during DNA replication. The
non-matching portion of a secondary DNA strand displacement primer
may be any length, but is generally 1 to 100 nucleotides long, and
preferably 4 to 8 nucleotides long. The non-matching portion can be
involved in interactions that provide specialized effects. For
example, the non-matching portion can comprise a quencher
complement portion that can hybridize to a peptide nucleic acid
quencher or peptide nucleic acid fluor or that can form an
intramolecular structure. Secondary DNA strand displacement primers
can also comprise fluorescent moieties or labels and quenching
moieties.
[0165] Useful secondary DNA strand displacement primers for use in
the disclosed method can form an intramolecular stem structure
involving one or both of the secondary DNA strand displacement
primer's ends. Such secondary DNA strand displacement primers are
referred to herein as hairpin secondary DNA strand displacement
primers. An intramolecular stem structure involving an end refers
to a stem structure where the terminal nucleotides (that is,
nucleotides at the end) of the secondary DNA strand displacement
primer are hybridized to other nucleotides in the secondary DNA
strand displacement primer.
[0166] The intramolecular stem structure can form a hairpin
structure or a stem and loop structure. If both ends of a secondary
DNA strand displacement primer are involved in an intramolecular
stem structure, the two ends of the secondary DNA strand
displacement primer can each form a separate intramolecular stem
structure or can together form a single intramolecular stem
structure. In the latter case the two ends would be hybridized
together. It is preferred that the 3' end of the secondary DNA
strand displacement primer form an intramolecular stem structure.
The 5' end of the secondary DNA strand displacement primer can also
form an intramolecular stem structure, either alone, or in the
secondary DNA strand displacement primer having an intramolecular
stem structure at the 3' end. The intramolecular stem structure
preferably involves both ends of the primer and has a blunt end.
Also preferred is a short 3' unpaired overhang. The intramolecular
stem structure preferably forms under conditions suitable for
nucleic acid replication, and in particular under conditions used
for nucleic acid replication when the secondary DNA strand
displacement primer is being used.
[0167] For example, the intramolecular stem structure can be
designed to form under conditions used for rolling circle
replication. The formation of the intramolecular stem structure
during replication allows the structure to reduce or prevent
priming by secondary DNA strand displacement primers at unintended
sequences. In particular, the intramolecular stem structure
prevents the secondary DNA strand displacement primer in which the
structure forms from priming nucleic acid replication at sites
other than primer complement sequences (that is, the specific
sequences complementary to the complementary portion of the
secondary DNA strand displacement primer) in TS-DNA. This follows
from the sequestration of the end of secondary DNA strand
displacement primer in the stem. The end of the rolling circle
replication primer cannot hybridize to, and prime from, another
sequence while sequestered in the intramolecular stem structure.
For this purpose, it is preferred that the intramolecular stem
structure be less stable that the hybrid between the primer
complement sequence and the complementary portion of the secondary
DNA strand displacement primer (or, put another way, the hybrid
between the primer complement sequence and the matching portion of
the secondary DNA strand displacement primer should be more stable
than the intramolecular stem structure). It is also preferred that
the intramolecular stem structure be more stable than hybrids
between the secondary DNA strand displacement primer and mismatched
sequences. In this way, the intramolecular stem structure will be
thermodynamically favored over undesired primer hybridizations.
Although secondary DNA strand displacement primers that form
intramolecular stem structures at the 3' end leaving the 5' end
unpaired and overhanging can be used, they are not preferred. In
such a case, the 3' end could be extended during replication (using
secondary DNA strand displacement primer sequences as template),
thus inactivating the primers.
[0168] Where the intramolecular stem structure of a secondary DNA
strand displacement primer forms a stem and loop structure, it is
preferred that a portion of the complementary portion of the
secondary DNA strand displacement primer be in the loop of the stem
and loop structure. This portion of the complementary portion in
the loop can then hybridize to the primer complement sequence in
TS-DNA. Such an arrangement allows design of hairpin secondary DNA
strand displacement primers where the stability of the
intramolecular stem structure depends on the presence or absence of
the specific primer complement sequence. In particular, a secondary
DNA strand displacement primer that forms a stem and loop structure
with a portion of the matching portion in the loop can be designed
so that hybridization of the matching portion in the loop to the
primer complement sequence disrupts the intramolecular stem
structure (Tyagi and Kramer, Nat Biotechnol 14(3):303-8 (1996);
Bonnet et al., Proc Natl Acad Sci U S A 96(11):6171-6 (1999)). In
this way, the intramolecular stem structure remains intact in the
absence of the primer complement sequence and thus reduces or
eliminates the ability of the secondary DNA strand displacement
primer to prime nucleic acid replication. In the presence of the
primer complement sequence, disruption of the intramolecular stem
structure allows the end of the secondary DNA strand displacement
primer to hybridize to the primer complement sequence. This hybrid
between the primer complement sequence and the end of the secondary
DNA strand displacement primer allows the priming of nucleic acid
replication by the primer. For this form of hairpin secondary DNA
strand displacement primer, it is preferred that hybridization of
the loop to a sequence other than the primer complement sequence
does not disrupt the intramolecular stem structure. Preferably, the
hybrid between the primer complement sequence and the end of the
secondary DNA strand displacement primer is more stable than the
intramolecular stem structure. This helps stabilize hybridization
of the secondary DNA strand displacement primer to the primer
complement sequence in competition with the intramolecular stem
structure.
[0169] Discrimination of secondary DNA strand displacement primer
hybridization also can be accomplished by hybridizing primer to
primer complement portions in TS-DNA under conditions that favor
only exact sequence matches leaving other secondary DNA strand
displacement primer unhybridized. The unhybridized secondary DNA
strand displacement primers will retain or re-form the
intramolecular hybrid.
[0170] Another form of DNA strand displacement primer, referred to
herein as a tertiary DNA strand displacement primer, is an
oligonucleotide having sequence complementary to part of the
sequence of an OCP or ATC. This sequence is referred to as the
complementary portion of the tertiary DNA strand displacement
primer. This complementary portion of the tertiary DNA strand
displacement primer matches sequences in TS-DNA. The complementary
portion of a tertiary DNA strand displacement primer may be
complementary to any sequence in the OCP or ATC. However, it is
preferred that it not be complementary OCP or ATC sequence matching
the secondary DNA strand displacement primer. This prevents
hybridization of the primers to each other. Preferably, the
complementary portion of the tertiary DNA strand displacement
primer has sequence complementary to a portion of the spacer
portion of an OCP. The complementary portion of a tertiary DNA
strand displacement primer can be any length that supports specific
and stable hybridization between the primer and its complement.
Generally this is 12 to 35 nucleotides long, but is preferably 18
to 25 nucleotides long. Tertiary DNA strand displacement primers
can be fluorescent change primers although this is not
preferred.
[0171] Useful tertiary DNA strand displacement primers for use in
the disclosed method can form an intramolecular stem structure
involving one or both of the tertiary DNA strand displacement
primer's ends. Such tertiary DNA strand displacement primers are
referred to herein as hairpin tertiary DNA strand displacement
primers. An intramolecular stem structure involving an end refers
to a stem structure where the terminal nucleotides (that is,
nucleotides at the end) of the tertiary DNA strand displacement
primer are hybridized to other nucleotides in the tertiary DNA
strand displacement primer.
[0172] The intramolecular stem structure can form a hairpin
structure or a stem and loop structure. If both ends of a tertiary
DNA strand displacement primer are involved in an intramolecular
stem structure, the two ends of the tertiary DNA strand
displacement primer can each form a separate intramolecular stem
structure or can together form a single intramolecular stem
structure. In the latter case the two ends would be hybridized
together. It is preferred that the 3' end of the tertiary DNA
strand displacement primer form an intramolecular stem structure.
The 5' end of the tertiary DNA strand displacement primer can also
form an intramolecular stem structure, either alone, or in the
tertiary DNA strand displacement primer having an intramolecular
stem structure at the 3' end. The intramolecular stem structure
preferably forms under conditions suitable for nucleic acid
replication, and in particular under conditions used for nucleic
acid replication when the tertiary DNA strand displacement primer
is being used. For example, the intramolecular stem structure can
be designed to form under conditions used for rolling circle
replication. The formation of the intramolecular stem structure
during replication allows the structure to reduce or prevent
priming by tertiary DNA strand displacement primers at unintended
sequences. In particular, the intramolecular stem structure
prevents the tertiary DNA strand displacement primer in which the
structure forms from priming nucleic acid replication at sites
other than primer complement sequences (that is, the specific
sequences complementary to the complementary portion of the
tertiary DNA strand displacement primer) in TS-DNA. This follows
from the sequestration of the end of tertiary DNA strand
displacement primer in the stem. The end of the rolling circle
replication primer cannot hybridize to, and prime from, another
sequence while sequestered in the intramolecular stem structure.
For this purpose, it is preferred that the intramolecular stem
structure be less stable that the hybrid between the primer
complement sequence and the complementary portion of the tertiary
DNA strand displacement primer (or, put another way, the hybrid
between the primer complement sequence and the complementary
portion of the tertiary DNA strand displacement primer should be
more stable than the intramolecular stem structure). It is also
preferred that the intramolecular stem structure be more stable
than hybrids between the tertiary DNA strand displacement primer
and mismatched sequences. In this way, the intramolecular stem
structure will be thermodynamically favored over undesired primer
hybridizations. Tertiary DNA strand displacement primers that form
intramolecular stem structures at the 3' end will have the 3' end
extended during replication (using tertiary DNA strand displacement
primer sequences as template). This serves to stabilize the
intramolecular stem structure in the tertiary DNA strand
displacement primers, making them unavailable for priming.
[0173] Where the intramolecular stem structure of a tertiary DNA
strand displacement primer forms a stem and loop structure, it is
preferred that a portion of the complementary portion of the
tertiary DNA strand displacement primer be in the loop of the stem
and loop structure. This portion of the complementary portion in
the loop can then hybridize to the primer complement sequence in
TS-DNA. Such an arrangement allows design of hairpin tertiary DNA
strand displacement primers where the stability of the
intramolecular stem structure depends on the presence or absence of
the specific primer complement sequence. In particular, a tertiary
DNA strand displacement primer that forms a stem and loop structure
with a portion of the complementary portion in the loop can be
designed so that hybridization of the complementary portion in the
loop to the primer complement sequence disrupts the intramolecular
stem structure (Tyagi and Kramer, Nat Biotechnol 14(3):303-8
(1996); Bonnet et al., Proc Natl Acad Sci U S A 96(11):6171-6
(1999)). In this way, the intramolecular stem structure remains
intact in the absence of the primer complement sequence and thus
reduces or eliminates the ability of the tertiary DNA strand
displacement primer to prime nucleic acid replication. In the
presence of the primer complement sequence, disruption of the
intramolecular stem structure allows the end of the tertiary DNA
strand displacement primer to hybridize to the primer complement
sequence. This hybrid between the primer complement sequence and
the end of the tertiary DNA strand displacement primer allows the
priming of nucleic acid replication by the primer. For this form of
hairpin tertiary DNA strand displacement primer, it is preferred
that hybridization of the loop to a sequence other than the primer
complement sequence does not disrupt the intramolecular stem
structure. Preferably, the hybrid between the primer complement
sequence and the end of the tertiary DNA strand displacement primer
is more stable than the intramolecular stem structure. This helps
stabilize hybridization of the tertiary DNA strand displacement
primer to the primer complement sequence in competition with the
intramolecular stem structure.
[0174] Discrimination of tertiary DNA strand displacement primer
hybridization also can be accomplished by hybridizing primer to
primer complement portions in TS-DNA under conditions that favor
only exact sequence matches leaving other tertiary DNA strand
displacement primer unhybridized. The unhybridized tertiary DNA
strand displacement primers will retain or re-form the
intramolecular hybrid and the end of the tertiary DNA strand
displacement primer involved in the intramolecular stem structure
will be extended during replication.
[0175] It is preferred that tertiary DNA strand displacement
primers also contain additional sequence at their 5' end that is
not complementary to any part of the OCP or ATC. This sequence is
referred to as the non-complementary portion of the tertiary DNA
strand displacement primer. The non-complementary portion of the
tertiary DNA strand displacement primer, if present, serves to
facilitate strand displacement during DNA replication. The
non-complementary portion of a tertiary DNA strand displacement
primer may be any length, but is generally 1 to 100 nucleotides
long, and preferably 4 to 8 nucleotides long. A rolling circle
replication primer is a preferred form of tertiary DNA strand
displacement primer. Secondary DNA strand displacement primers can
also comprise fluorescent moieties or labels and quenching
moieties.
[0176] DNA strand displacement primers may also include modified
nucleotides to make them resistant to exonuclease digestion. For
example, the primer can have three or four phosphorothioate
linkages between nucleotides at the 5' end of the primer. Such
nuclease resistant primers allow selective degradation of excess
unligated OCP and gap oligonucleotides that might otherwise
interfere with hybridization of detection probes, address probes,
and secondary OCPs to the amplified nucleic acid. DNA strand
displacement primers can be used for secondary DNA strand
displacement and strand displacement cascade amplification, both
described below and in U.S. Pat. No. 6,143,495.
[0177] F. Fluorescent Change Probes and Primers
[0178] Fluorescent change probes and fluorescent change primers
refer to all probes and primers that involve a change in
fluorescence intensity or wavelength based on a change in the form
of conformation of the probe or primer and nucleic acid to be
detected, assayed or replicated. Examples of fluorescent change
probes and primers include molecular beacons, Amplifluors, FRET
probes, cleavable FRET probes, TaqMan probes, scorpion primers,
fluorescent triplex oligos, fluorescent water-soluble conjugated
polymers, PNA probes and QPNA probes.
[0179] Fluorescent change probes and primers can be classified
according to their structure and/or function. Fluorescent change
probes include hairpin quenched probes, cleavage quenched probes,
cleavage activated probes, and fluorescent activated probes.
[0180] Fluorescent change primers include stem quenched primers and
hairpin quenched primers. The use of several types of fluorescent
change probes and primers are reviewed in Schweitzer and Kingsmore,
Curr. Opin. Biotech. 12:21-27 (2001). Hall et al., Proc. Natl.
Acad. Sci. USA 97:8272-8277 (2000), describe the use of fluorescent
change probes with Invader assays.
[0181] Hairpin quenched probes are probes that when not bound to a
target sequence form a hairpin structure (and, typically, a loop)
that brings a fluorescent label and a quenching moiety into
proximity such that fluorescence from the label is quenched. When
the probe binds to a target sequence, the stem is disrupted, the
quenching moiety is no longer in proximity to the fluorescent label
and fluorescence increases. Examples of hairpin quenched probes are
molecular beacons, fluorescent triplex oligos, and QPNA probes.
[0182] Cleavage activated probes are probes where fluorescence is
increased by cleavage of the probe. Cleavage activated probes can
include a fluorescent label and a quenching moiety in proximity
such that fluorescence from the label is quenched. When the probe
is clipped or digested (typically by the 5'-3' exonuclease activity
of a polymerase during amplification), the quenching moiety is no
longer in proximity to the fluorescent label and fluorescence
increases. TaqMan probes (Holland et al., Proc. Natl. Acad. Sci.
USA 88:7276-7280 (1991)) are an example of cleavage activated
probes.
[0183] Cleavage quenched probes are probes where fluorescence is
decreased or altered by cleavage of the probe. Cleavage quenched
probes can include an acceptor fluorescent label and a donor moiety
such that, when the acceptor and donor are in proximity,
fluorescence resonance energy transfer from the donor to the
acceptor causes the acceptor to fluoresce. The probes are thus
fluorescent, for example, when hybridized to a target sequence.
When the probe is clipped or digested (typically by the 5'-3'
exonuclease activity of a polymerase during amplification), the
donor moiety is no longer in proximity to the acceptor fluorescent
label and fluorescence from the acceptor decreases. If the donor
moiety is itself a fluorescent label, it can release energy as
fluorescence (typically at a different wavelength than the
fluorescence of the acceptor) when not in proximity to an acceptor.
The overall effect would then be a reduction of acceptor
fluorescence and an increase in donor fluorescence. Donor
fluorescence in the case of cleavage quenched probes is equivalent
to fluorescence generated by cleavage activated probes with the
acceptor being the quenching moiety and the donor being the
fluorescent label. Cleavable FRET (fluorescence resonance energy
transfer) probes are an example of cleavage quenched probes.
[0184] Fluorescent activated probes are probes or pairs of probes
where fluorescence is increased or altered by hybridization of the
probe to a target sequence. Fluorescent activated probes can
include an acceptor fluorescent label and a donor moiety such that,
when the acceptor and donor are in proximity (when the probes are
hybridized to a target sequence), fluorescence resonance energy
transfer from the donor to the acceptor causes the acceptor to
fluoresce. Fluorescent activated probes are typically pairs of
probes designed to hybridize to adjacent sequences such that the
acceptor and donor are brought into proximity. Fluorescent
activated probes can also be single probes containing both a donor
and acceptor where, when the probe is not hybridized to a target
sequence, the donor and acceptor are not in proximity but where the
donor and acceptor are brought into proximity when the probe
hybridized to a target sequence. This can be accomplished, for
example, by placing the donor and acceptor on opposite ends a the
probe and placing target complement sequences at each end of the
probe where the target complement sequences are complementary to
adjacent sequences in a target sequence. If the donor moiety of a
fluorescent activated probe is itself a fluorescent label, it can
release energy as fluorescence (typically at a different wavelength
than the fluorescence of the acceptor) when not in proximity to an
acceptor (that is, when the probes are not hybridized to the target
sequence). When the probes hybridize to a target sequence, the
overall effect would then be a reduction of donor fluorescence and
an increase in acceptor fluorescence. FRET probes are an example of
fluorescent activated probes.
[0185] Stem quenched primers are primers that when not hybridized
to a complementary sequence form a stem structure (either an
intramolecular stem structure or an intermolecular stem structure)
that brings a fluorescent label and a quenching moiety into
proximity such that fluorescence from the label is quenched. When
the primer binds to a complementary sequence, the stem is
disrupted, the quenching moiety is no longer in proximity to the
fluorescent label and fluorescence increases. In the disclosed
method, stem quenched primers are used as primers for nucleic acid
synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of stem quenched primers are
peptide nucleic acid quenched primers and hairpin quenched
primers.
[0186] Peptide nucleic acid quenched primers are primers associated
with a peptide nucleic acid quencher or a peptide nucleic acid
fluor to form a stem structure. The primer contains a fluorescent
label or a quenching moiety and is associated with either a peptide
nucleic acid quencher or a peptide nucleic acid fluor,
respectively. This puts the fluorescent label in proximity to the
quenching moiety. When the primer is replicated, the peptide
nucleic acid is displaced, thus allowing the fluorescent label to
produce a fluorescent signal.
[0187] Hairpin quenched primers are primers that when not
hybridized to a complementary sequence form a hairpin structure
(and, typically, a loop) that brings a fluorescent label and a
quenching moiety into proximity such that fluorescence from the
label is quenched. When the primer binds to a complementary
sequence, the stem is disrupted, the quenching moiety is no longer
in proximity to the fluorescent label and fluorescence increases.
Hairpin quenched primers are typically used as primers for nucleic
acid synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of hairpin quenched primers are
Amplifluor primers (Nazerenko et al., Nucleic Acids Res.
25:2516-2521 (1997)) and scorpion primers (Thelwell et al., Nucleic
Acids Res. 28(19):3752-3761 (2000)).
[0188] Cleavage activated primers are similar to cleavage activated
probes except that they are primers that are incorporated into
replicated strands and are then subsequently cleaved. Little et
al., Clin. Chem. 45:777-784 (1999), describe the use of cleavage
activated primers.
[0189] G. Reporter Binding Agents
[0190] A reporter binding agent is a specific binding molecule
coupled or tethered to a nucleic acid such as an oligonucleotide.
The specific binding molecule is referred to as the affinity
portion of the reporter binding agent and the nucleic acid is
referred to as the oligonucleotide portion of the reporter binding
agent. As used herein, a specific binding molecule is a molecule
that interacts specifically with a particular molecule or moiety
(that is, an analyte). The molecule or moiety that interacts
specifically with a specific binding molecule is referred to herein
as a target molecule. The target molecules can be any analyte. It
is to be understood that the term target molecule refers to both
separate molecules and to portions of molecules, such as an epitope
of a protein, that interacts specifically with a specific binding
molecule. Antibodies, either member of a receptor/ligand pair, and
other molecules with specific binding affinities are examples of
specific binding molecules, useful as the affinity portion of a
reporter binding molecule. A reporter binding molecule with an
affinity portion which is an antibody is referred to herein as a
reporter antibody. The oligonucleotide portion can be a nucleic
acid molecule or a combination of nucleic acid molecules. The
oligonucleotide portion is preferably an oligonucleotide or an
amplification target circle.
[0191] By tethering an amplification target circle or coupling a
target sequence to a specific binding molecule, binding of a
specific binding molecule to its specific target can be detected by
amplifying the ATC or target sequence with rolling circle
amplification. This amplification allows sensitive detection of a
very small number of bound specific binding molecules. A reporter
binding molecule that interacts specifically with a particular
target molecule is said to be specific for that target molecule.
For example, a reporter binding molecule with an affinity portion
which is an antibody that binds to a particular antigen is said to
be specific for that antigen. The antigen is the target molecule.
Reporter binding agents are also referred to herein as reporter
binding molecules. FIGS. 25, 26, 27, 28, and 29 of U.S. Pat. No.
6,143,495 illustrate examples of several preferred types of
reporter binding molecules and their use. FIG. 29 of U.S. Pat. No.
6,143,495 illustrates a reporter binding molecule using an antibody
as the affinity portion.
[0192] Preferred target molecules are proteins and peptides. Use of
reporter binding agents that target proteins and peptides allows
sensitive signal amplification using rolling circle amplification
for the detection of proteins and peptides. The ability to
multiplex rolling circle amplification detection allows multiplex
detection of the proteins and peptides (or any other target
molecule). Thus, the disclosed method can be used for multi-protein
analysis such as proteomics analysis. Such multi-protein analysis
can be accomplished, for example, by using reporter binding agents
targeted to different proteins, with the oligonucleotide portion of
each reporter binding agent coded to allow separate amplification
and detection of each different reporter binding agent.
[0193] In one embodiment, the oligonucleotide portion of a reporter
binding agent includes a sequence, referred to as a target
sequence, that serves as a target sequence for an OCP. The sequence
of the target sequence can be arbitrarily chosen. In a multiplex
assay using multiple reporter binding agents, it is preferred that
the target sequence for each reporter binding agent be
substantially different to limit the possibility of non-specific
target detection. Alternatively, it may be desirable in some
multiplex assays, to use target sequences with related sequences.
By using different, unique gap oligonucleotides to fill different
gap spaces, such assays can use one or a few OCPs to amplify and
detect a larger number of target sequences. The oligonucleotide
portion can be coupled to the affinity portion by any of several
established coupling reactions. For example, Hendrickson et al.,
Nucleic Acids Res., 23(3):522-529 (1995) describes a suitable
method for coupling oligonucleotides to antibodies.
[0194] A preferred form of target sequence in a reporter binding
agent is an oligonucleotide having both ends coupled to the
specific binding molecule so as to form a loop. In this way, when
the OCP hybridizes to the target and is circularized, the OCP will
remain topologically locked to the reporter binding agent during
rolling circle replication of the circularized OCP. This improves
the localization of the resulting amplified signal to the location
where the reporter binding agent is bound (that is, at the location
of the target molecule).
[0195] A special form of reporter binding molecule, referred to
herein as a reporter binding probe, has an oligonucleotide or
oligonucleotide derivative as the specific binding molecule.
Reporter binding probes are designed for and used to detect
specific nucleic acid sequences. Thus, the target molecule for
reporter binding probes are nucleic acid sequences. The target
molecule for a reporter binding probe can be a nucleotide sequence
within a larger nucleic acid molecule. It is to be understood that
the term reporter binding molecule encompasses reporter binding
probes. The specific binding molecule of a reporter binding probe
can be any length that supports specific and stable hybridization
between the reporter binding probe and the target molecule. For
this purpose, a length of 10 to 40 nucleotides is preferred, with a
specific binding molecule of a reporter binding probe 16 to 25
nucleotides long being most preferred. It is preferred that the
specific binding molecule of a reporter binding probe is peptide
nucleic acid. As described above, peptide nucleic acid forms a
stable hybrid with DNA. This allows a reporter binding probe with a
peptide nucleic acid specific binding molecule to remain firmly
adhered to the target sequence during subsequent amplification and
detection operations. This useful effect can also be obtained with
reporter binding probes with oligonucleotide specific binding
molecules by making use of the triple helix chemical bonding
technology described by Gasparro et al., Nucleic Acids Res. 1994
22(14):2845-2852 (1994). Briefly, the affinity portion of a
reporter binding probe is designed to form a triple helix when
hybridized to a target sequence. This is accomplished generally as
known, preferably by selecting either a primarily homopurine or
primarily homopyrimidine target sequence. The matching
oligonucleotide sequence which constitutes the affinity portion of
the reporter binding probe will be complementary to the selected
target sequence and thus be primarily homopyrimidine or primarily
homopurine, respectively. The reporter binding probe (corresponding
to the triple helix probe described by Gasparro et al.) contains a
chemically linked psoralen derivative. Upon hybridization of the
reporter binding probe to a target sequence, a triple helix forms.
By exposing the triple helix to low wavelength ultraviolet
radiation, the psoralen derivative mediates cross-linking of the
probe to the target sequence. FIGS. 25, 26, 27, and 28 of U.S. Pat.
No. 6,143,495 illustrate examples of reporter binding molecules
that are reporter binding probes.
[0196] The specific binding molecule in a reporter binding probe
can also be a bipartite DNA molecule, such as ligatable DNA probes
adapted from those described by Landegren et al., Science
241:1077-1080 (1988). When using such a probe, the affinity portion
of the probe is assembled by target-mediated ligation of two
oligonucleotide portions which hybridize to adjacent regions of a
target nucleic acid. Thus, the components used to form the affinity
portion of such reporter binding probes are a truncated reporter
binding probe (with a truncated affinity portion which hybridizes
to part of the target sequence) and a ligation probe which
hybridizes to an adjacent part of the target sequence such that it
can be ligated to the truncated reporter binding probe. The
ligation probe can also be separated from (that is, not adjacent
to) the truncated reporter binding probe when both are hybridized
to the target sequence. The resulting space between them can then
be filled by a second ligation probe or by gap-filling synthesis.
For use in the disclosed methods, it is preferred that the
truncated affinity portion be long enough to allow target-mediated
ligation but short enough to, in the absence of ligation to the
ligation probe, prevent stable hybridization of the truncated
reporter binding probe to the target sequence during the subsequent
amplification operation. For this purpose, a specific step designed
to eliminate hybrids between the target sequence and unligated
truncated reporter binding probes can be used following the
ligation operation.
[0197] In another embodiment, the oligonucleotide portion of a
reporter binding agent includes a sequence, referred to as a
rolling circle replication primer sequence, that serves as a
rolling circle replication primer for an ATC. This allows rolling
circle replication of an added ATC where the resulting TS-DNA is
coupled to the reporter binding agent. Because of this, the TS-DNA
will be effectively immobilized at the site of the target molecule.
Preferably, the immobilized TS-DNA can then be collapsed in situ
prior to detection. The sequence of the rolling circle replication
primer sequence can be arbitrarily chosen. The rolling circle
replication sequence can be designed to form and intramolecular
stem structure as described for rolling circle replication primers
above.
[0198] In a multiplex assay using multiple reporter binding agents,
it is preferred that the detection rolling circle replication
primer sequences for each reporter binding agent be substantially
different to limit the possibility of non-specific target
detection. Alternatively, it may be desirable in some multiplex
assays, to use detection rolling circle replication primer
sequences with related sequences. Such assays can use one or a few
ATCs to detect a larger number of target molecules. It is preferred
that common rolling circle replication primer sequences for each
reporter binding agent be the same. Any of the other relationships
between ATCs and primers disclosed herein can also be used. When
the oligonucleotide portion of a reporter binding agent is used as
a rolling circle replication primer, the oligonucleotide portion
can be any length that supports specific and stable hybridization
between the oligonucleotide portion and the primer complement
portion of an amplification target circle. Generally this is 10 to
35 nucleotides long, but is preferably 16 to 20 nucleotides long.
FIGS. 25, 26, 27, 28, and 29 of U.S. Pat. No. 6,143,495 illustrate
examples of reporter binding molecules in which the oligonucleotide
portion is a rolling circle replication primer.
[0199] In another embodiment, the oligonucleotide portion of a
reporter binding agent can include an amplification target circle
which serves as a template for rolling circle replication. In a
multiplex assay using multiple reporter binding agents, it is
preferred that detection primer complement portions, address tag
portions, and detection tag portions of the ATC comprising the
oligonucleotide portion of each reporter binding agent be
substantially different to unique detection of each reporter
binding agent. It is desirable, however, to use the same common
primer complement portion in all of the ATCs used in a multiplex
assay. The ATC is tethered to the specific binding molecule by
looping the ATC around a tether loop. This allows the ATC to rotate
freely during rolling circle replication while remaining coupled to
the affinity portion. The tether loop can be any material that can
form a loop and be coupled to a specific binding molecule. Linear
polymers are a preferred material for tether loops.
[0200] A preferred method of producing a reporter binding agent
with a tethered ATC is to form the tether loop by ligating the ends
of oligonucleotides coupled to a specific binding molecule around
an ATC. Oligonucleotides can be coupled to specific binding
molecules using known techniques. For example, Hendrickson et al.
(1995), describes a suitable method for coupling oligonucleotides
to antibodies. This method is generally useful for coupling
oligonucleotides to any protein. To allow ligation,
oligonucleotides comprising the two halves of the tether loop
should be coupled to the specific binding molecule in opposite
orientations such that the free end of one is the 5' end and the
free end of the other is the 3' end. Ligation of the ends of the
tether oligonucleotides can be mediated by hybridization of the
ends of the tether oligonucleotides to adjacent sequences in the
ATC to be tethered. In this way, the ends of the tether
oligonucleotides are analogous to the target probe portions of an
open circle probe, with the ATC containing the target sequence.
Similar techniques can be used to form tether loops containing a
target sequence.
[0201] Another preferred method of producing a reporter binding
agent with a tethered ATC is to ligate an open circle probe while
hybridized to an oligonucleotide tether loop on a specific binding
molecule. In this method, both ends of a single tether
oligonucleotide are coupled to a specific binding molecule. This
can be accomplished using known coupling techniques as described
above. Ligation of an open circle probe hybridized to a tether loop
is analogous to the ligation operation of LM-RCA. In this case, the
target sequence is part of an oligonucleotide with both ends
coupled to a specific binding molecule. This same ligation
technique can be used to circularize open circle probes on target
sequences that are part of reporter binding agents. This
topologically locks the open circle probe to the reporter binding
agent (and thus, to the target molecule to which the reporter
binding agent binds).
[0202] The ends of tether loops can be coupled to any specific
binding molecule with functional groups that can be derivatized
with suitable activating groups. When the specific binding molecule
is a protein, or a molecule with similar functional groups,
coupling of tether ends can be accomplished using known methods of
protein attachment. Many such methods are described in Protein
immobilization: fundamentals and applications Richard F. Taylor,
ed. (M. Dekker, New York, 1991).
[0203] Antibodies useful as the affinity portion of reporter
binding agents, can be obtained commercially or produced using well
established methods. For example, Johnstone and Thorpe, on pages
30-85, describe general methods useful for producing both
polyclonal and monoclonal antibodies. The entire book describes
many general techniques and principles for the use of antibodies in
assay systems.
[0204] H. Detection Labels
[0205] To aid in detection and quantitation of nucleic acids
amplified using the disclosed method, detection labels can be
directly incorporated into amplified nucleic acids or can be
coupled to detection molecules. As used herein, a detection label
is any molecule that can be associated with amplified nucleic acid,
directly or indirectly, and which results in a measurable,
detectable signal, either directly or indirectly. Many such labels
for incorporation into nucleic acids or coupling to nucleic acid or
antibody probes are known to those of skill in the art. Examples of
detection labels suitable for use in the disclosed method are
radioactive isotopes, fluorescent molecules, phosphorescent
molecules, enzymes, antibodies, and ligands. A preferred use of
detection labels in the disclosed method is as a label in
fluorescent change probes and primers.
[0206] Examples of suitable fluorescent labels include fluorescein
(FITC), 5,6-carboxymethyl fluorescein, Texas red,
nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride,
rhodamine, 4'-6-diamidino-2-phenylinodo- le (DAPI), and the cyanine
dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Preferred fluorescent labels
are fluorescein (5-carboxyfluorescein-N-hydroxysuccini- mide ester)
and rhodamine (5,6-tetramethyl rhodamine). Preferred fluorescent
labels for combinatorial multicolor coding are FITC and the cyanine
dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. The absorption and emission
maxima, respectively, for these fluors are: FITC (490 nm; 520 nm),
Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm),
Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing
their simultaneous detection. The fluorescent labels can be
obtained from a variety of commercial sources, including Molecular
Probes, Eugene, Oreg. and Research Organics, Cleveland, Ohio.
[0207] Labeled nucleotides are preferred form of detection label
since they can be directly incorporated into the products of RCA
and RCT during synthesis. Examples of detection labels that can be
incorporated into amplified DNA or RNA include nucleotide analogs
such as BrdUrd (Hoy and Schimke, Mutation Research 290:217-230
(1993)), BrUTP (Wansick et al., J. Cell Biology 122:283-293 (1993))
and nucleotides modified with biotin (Langer et al., Proc. Natl.
Acad. Sci. USA 78:6633 (1981)) or with suitable haptens such as
digoxygenin (Kerkhof, Anal. Biochem. 205:359-364 (1992)). Suitable
fluorescence-labeled nucleotides are
Fluorescein-isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP
(Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)). A preferred
nucleotide analog detection label for DNA is BrdUrd (BUDR
triphosphate, Sigma), and a preferred nucleotide analog detection
label for RNA is Biotin-16-uridine-5'-triphosphate (Biotin-16-dUTP,
Boehringher Mannheim). Fluorescein, Cy3, and Cy5 can be linked to
dUTP for direct labeling. Cy3.5 and Cy7 are available as avidin or
anti-digoxygenin conjugates for secondary detection of biotin- or
digoxygenin-labeled probes.
[0208] Detection labels that are incorporated into amplified
nucleic acid, such as biotin, can be subsequently detected using
sensitive methods well-known in the art. For example, biotin can be
detected using streptavidin-alkaline phosphatase conjugate (Tropix,
Inc.), which is bound to the biotin and subsequently detected by
chemiluminescence of suitable substrates (for example,
chemiluminescent substrate CSPD: disodium,
3-(4-methoxyspiro-[1,2,-dioxetane-3-2'-(5'-chloro)tricyclo
[3.3.1.1.sup.3,7]decane]-4-yl) phenyl phosphate; Tropix, Inc.).
[0209] A preferred detection label for use in detection of
amplified RNA is acridinium-ester-labeled DNA probe (GenProbe,
Inc., as described by Arnold et al., Clinical Chemistry
35:1588-1594 (1989)). An acridinium-ester-labeled detection probe
permits the detection of amplified RNA without washing because
unhybridized probe can be destroyed with alkali (Arnold et al.
(1989)).
[0210] Molecules that combine two or more of these detection labels
are also considered detection labels. Any of the known detection
labels can be used with the disclosed probes, tags, and method to
label and detect nucleic acid amplified using the disclosed method.
Methods for detecting and measuring signals generated by detection
labels are also known to those of skill in the art. For example,
radioactive isotopes can be detected by scintillation counting or
direct visualization; fluorescent molecules can be detected with
fluorescent spectrophotometers; phosphorescent molecules can be
detected with a spectrophotometer or directly visualized with a
camera; enzymes can be detected by detection or visualization of
the product of a reaction catalyzed by the enzyme; antibodies can
be detected by detecting a secondary detection label coupled to the
antibody. Such methods can be used directly in the disclosed method
of amplification and detection. As used herein, detection molecules
are molecules that interact with amplified nucleic acid and to
which one or more detection labels are coupled. Fluorescent labels,
especially in the context of fluorescent change probes and primers
are useful for real-time detection of amplification.
[0211] I. Detection Probes
[0212] Detection probes are labeled oligonucleotides having
sequence complementary to detection tags on TS-DNA or transcripts
of TS-DNA. The complementary portion of a detection probe can be
any length that supports specific and stable hybridization between
the detection probe and the detection tag. For this purpose, a
length of 10 to 35 nucleotides is preferred, with a complementary
portion of a detection probe 16 to 20 nucleotides long being most
preferred. Detection probes can contain any of the detection labels
described above. Preferred labels are biotin and fluorescent
molecules. Useful detection probes are fluorescent change probes. A
particularly preferred detection probe is a molecular beacon (which
is a form of fluorescent change probe). Molecular beacons are
detection probes labeled with fluorescent moieties where the
fluorescent moieties fluoresce only when the detection probe is
hybridized (Tyagi and Kramer, Nature Biotechnology 14:303-308
(1996)). The use of such probes eliminates the need for removal of
unhybridized probes prior to label detection because the
unhybridized detection probes will not produce a signal. This is
especially useful in multiplex assays.
[0213] One form of detection probe, referred to herein as a
collapsing detection probe, contains two separate complementary
portions. This allows each detection probe to hybridize to two
detection tags in TS-DNA. In this way, the detection probe forms a
bridge between different parts of the TS-DNA. The combined action
of numerous collapsing detection probes hybridizing to TS-DNA will
be to form a collapsed network of cross-linked TS-DNA. Collapsed
TS-DNA occupies a much smaller volume than free, extended TS-DNA,
and includes whatever detection label present on the detection
probe. This result is a compact and discrete detectable signal for
each TS-DNA. Collapsing TS-DNA is useful both for in situ
hybridization applications and for multiplex detection because it
allows detectable signals to be spatially separate even when
closely packed. Collapsing TS-DNA is especially preferred for use
with combinatorial multicolor coding.
[0214] TS-DNA collapse can also be accomplished through the use of
ligand/ligand binding pairs (such as biotin and avidin) or
hapten/antibody pairs. As described in U.S. Pat. No. 6,143,495
(Example 6), a nucleotide analog, BUDR, can be incorporated into
TS-DNA during rolling circle replication. When biotinylated
antibodies specific for BUDR and avidin are added, a cross-linked
network of TS-DNA forms, bridged by avidin-biotin-antibody
conjugates, and the TS-DNA collapses into a compact structure.
Collapsing detection probes and biotin-mediated collapse can also
be used together to collapse TS-DNA.
[0215] J. Address Probes
[0216] An address probe is an oligonucleotide having a sequence
complementary to address tags on TS-DNA or transcripts of TS-DNA.
The complementary portion of an address probe can be any length
that supports specific and stable hybridization between the address
probe and the address tag. For this purpose, a length of 10 to 35
nucleotides is preferred, with a complementary portion of an
address probe 12 to 18 nucleotides long being most preferred.
Preferably, the complementary portion of an address probe is
complementary to all or a portion of the target probe portions of
an OCP. Most preferably, the complementary portion of an address
probe is complementary to a portion of either or both of the left
and right target probe portions of an OCP and all or a part of any
gap oligonucleotides or gap sequence created in a gap-filling
operation (see FIG. 6 of U.S. Pat. No. 6,143,495). Address probe
can contain a single complementary portion or multiple
complementary portions. Preferably, address probes are coupled,
either directly or via a spacer molecule, to a solid-state support.
Such a combination of address probe and solid-state support are a
preferred form of solid-state detector. Address probes can be
fluorescent change probes although this is not preferred.
[0217] K. Oligonucleotide Synthesis
[0218] Methods to produce or synthesize oligonucleotides are well
known in the art. Such methods can range from standard enzymatic
digestion followed by nucleotide fragment isolation (see for
example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989) Chapters 5, 6) to purely synthetic methods, for
example, by the cyanoethyl phosphoramidite method. Solid phase
chemical synthesis of DNA fragments is routinely performed using
protected nucleoside cyanoethyl phosphoramidites (S. L. Beaucage et
al. (1981) Tetrahedron Lett. 22:1859). In this approach, the
3'-hydroxyl group of an initial 5'-protected nucleoside is first
covalently attached to the polymer support (R. C. Pless et al.
(1975) Nucleic Acids Res. 2:773 (1975)). Synthesis of the
oligonucleotide then proceeds by deprotection of the 5'-hydroxyl
group of the attached nucleoside, followed by coupling of an
incoming nucleoside-3'-phosphoramidite to the deprotected hydroxyl
group (M. D. Matteucci et a. (1981) J. Am. Chem. Soc. 103:3185).
The resulting phosphite triester is finally oxidized to a
phosphorotriester to complete the internucleotide bond (R. L.
Letsinger et al. (1976) J. Am. Chem. Soc. 9:3655). Alternatively,
the synthesis of phosphorothioate linkages can be carried out by
sulfurization of the phosphite triester. Several chemicals can be
used to perform this reaction, among them 3H-1,2-benzodithiole-3-o-
ne, 1,1-dioxide (R. P. Iyer, W. Egan, J. B. Regan, and S. L.
Beaucage, J. Am. Chem. Soc., 1990, 112, 1253-1254). The steps of
deprotection, coupling and oxidation are repeated until an
oligonucleotide of the desired length and sequence is obtained.
Other methods exist to generate oligonucleotides such as the
H-phosphonate method (Hall et al, (1957) J. Chem. Soc., 3291-3296)
or the phosphotriester method as described by Ikuta et al., Ann.
Rev. Biochem. 53:323-356 (1984), (phosphotriester and
phosphite-triester methods), and Narang et al., Methods Enzymol.,
65:610-620 (1980), (phosphotriester method). Protein nucleic acid
molecules can be made using known methods such as those described
by Nielsen et al., Bioconjug. Chem. 5:3-7 (1994). Other forms of
oligonucleotide synthesis are described in U.S. Pat. Nos. 6,294,664
and 6,291,669.
[0219] The nucleotide sequence of an oligonucleotide is generally
determined by the sequential order in which subunits of subunit
blocks are added to the oligonucleotide chain during synthesis.
Each round of addition can involve a different, specific nucleotide
precursor, or a mixture of one or more different nucleotide
precursors. In general, degenerate or random positions in an
oligonucleotide can be produced by using a mixture of nucleotide
precursors representing the range of nucleotides that can be
present at that position. Thus, precursors for A and T can be
included in the reaction for a particular position in an
oligonucleotide if that position is to be degenerate for A and T.
Precursors for all four nucleotides can be included for a fully
degenerate or random position. Completely random oligonucleotides
can be made by including all four nucleotide precursors in every
round of synthesis. Degenerate oligonucleotides can also be made
having different proportions of different nucleotides. Such
oligonucleotides can be made, for example, by using different
nucleotide precursors, in the desired proportions, in the
reaction.
[0220] Many of the oligonucleotides described herein are designed
to be complementary to certain portions of other oligonucleotides
or nucleic acids such that stable hybrids can be formed between
them. The stability of these hybrids can be calculated using known
methods such as those described in Lesnick and Freier, Biochemistry
34:10807-10815 (1995), McGraw et al., Biotechniques 8:674-678
(1990), and Rychlik et al., Nucleic Acids Res. 18:6409-6412
(1990).
[0221] As an example, random oligonucleotides can be synthesized on
a Perseptive Biosystems 8909 Expedite Nucleic Acid Synthesis system
using standard .beta.-cyanoethyl phosphoramidite coupling chemistry
on mixed dA+dC+dG+dT synthesis columns (Glen Research, Sterling,
Va.). The four phosphoramidites can be mixed in equal proportions
to randomize the bases at each position in the oligonucleotide.
Oxidation of the newly formed phosphites can be carried out using
the sulfurizing reagent 3H-1,2-benzothiole-3-one-1,1-idoxide (Glen
Research) instead of the standard oxidizing reagent after the first
and second phosphoramidite addition steps. The thio-phosphitylated
oligonucleotides can be deprotected using 30% ammonium hydroxide
(3.0 ml) in water at 55.degree. C. for 16 hours, concentrated in an
OP 120 Savant Oligo Prep deprotection unit for 2 hours, and
desalted with PD10 Sephadex columns using the protocol provided by
the manufacturer.
[0222] Open circle probes, fluorescent change probe and primers,
amplification target circles, rolling circle replication primers,
detection probes, address probes, DNA strand displacement primers,
and any other oligonucleotides can be synthesized using established
oligonucleotide synthesis methods. Methods to produce or synthesize
oligonucleotides are well known in the art. Such methods can range
from standard enzymatic digestion followed by nucleotide fragment
isolation (see for example, Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989) Chapters 5, 6) to purely
synthetic methods, for example, by the cyanoethyl phosphoramidite
method. Solid phase chemical synthesis of DNA fragments is
routinely performed using protected nucleoside cyanoethyl
phosphoramidites (S. L. Beaucage et al. (1981) Tetrahedron Lett.
22:1859). In this approach, the 3'-hydroxyl group of an initial
5'-protected nucleoside is first covalently attached to the polymer
support (R. C. Pless et al. (1975) Nucleic Acids Res. 2:773
(1975)). Synthesis of the oligonucleotide then proceeds by
deprotection of the 5'-hydroxyl group of the attached nucleoside,
followed by coupling of an incoming nucleoside-3'-phosphoramidite
to the deprotected hydroxyl group (M. D. Matteucci et a. (1981) J.
Am. Chem. Soc. 103:3185). The resulting phosphite triester is
finally oxidized to a phosphorotriester to complete the
internucleotide bond (R. L. Letsinger et al. (1976) J. Am. Chem.
Soc. 9:3655). Alternatively, the synthesis of phosphorothioate
linkages can be carried out by sulfurization of the phosphite
triester. Several chemicals can be used to perform this reaction,
among them 3H-1,2-benzodithiole-3-one, 1,1-dioxide (R. P. Iyer, W.
Egan, J. B. Regan, and S. L. Beaucage, J. Am. Chem. Soc., 1990,
112, 1253-1254). The steps of deprotection, coupling and oxidation
are repeated until an oligonucleotide of the desired length and
sequence is obtained. Other methods exist to generate
oligonucleotides such as the H-phosphonate method (Hall et al,
(1957) J. Chem. Soc., 3291-3296) or the phosphotriester method as
described by Ikuta et al., Ann. Rev. Biochem. 53:323-356 (1984),
(phosphotriester and phosphite-triester methods), and Narang et
al., Methods Enzymol., 65:610-620 (1980), (phosphotriester method).
Protein nucleic acid molecules can be made using known methods such
as those described by Nielsen et al., Bioconjug. Chem. 5:3-7
(1994). Other forms of oligonucleotide synthesis are described in
U.S. Pat. Nos. 6,294,664 and 6,291,669.
[0223] Many of the oligonucleotides described herein are designed
to be complementary to certain portions of other oligonucleotides
or nucleic acids such that stable hybrids can be formed between
them via base pairing. The stability of these hybrids can be
calculated using known methods such as those described in Lesnick
and Freier, Biochemistry 34:10807-10815 (1995), McGraw et al.,
Biotechniques 8:674-678 (1990), and Rychlik et al., Nucleic Acids
Res. 18:6409-6412 (1990).
[0224] Oligonucleotides can be synthesized, for example, on a
Perseptive Biosystems 8909 Expedite Nucleic Acid Synthesis system
using standard .beta.-cyanoethyl phosphoramidite coupling chemistry
on synthesis columns (Glen Research, Sterling, Va.). Oxidation of
the newly formed phosphites can be carried out using, for example,
the sulfurizing reagent 3H-1,2-benzothiole-3-one-1,1-idoxide (Glen
Research) or the standard oxidizing reagent after the first and
second phosphoramidite addition steps. The thio-phosphitylated
oligonucleotides can be deprotected, for example, using 30%
ammonium hydroxide (3.0 ml) in water at 55.degree. C. for 16 hours,
concentrated in an OP 120 Savant Oligo Prep deprotection unit for 2
hours, and desalted with PD 10 Sephadex columns using the protocol
provided by the manufacturer.
[0225] So long as their relevant function is maintained, open
circle probes, fluorescent change probe and primers, amplification
target circles, rolling circle replication primers, detection
probes, address probes, DNA strand displacement primers, and any
other oligonucleotides can be made up of or include modified
nucleotides (nucleotide analogs). Many modified nucleotides are
known and can be used in oligonucleotides. A nucleotide analog is a
nucleotide which contains some type of modification to either the
base, sugar, or phosphate moieties. Modifications to the base
moiety would include natural and synthetic modifications of A, C,
G, and T/U as well as different purine or pyrimidine bases, such as
uracil-5-yl, hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. A
modified base includes but is not limited to 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo
uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and
other 8-substituted adenines and guanines, 5-halo particularly
5-bromo, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Additional base modifications can be found for
example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S.,
Chapter 15, Antisense Research and Applications, pages 289-302,
Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain
nucleotide analogs, such as 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine can increase the stability of
duplex formation. Other modified bases are those that function as
universal bases. Universal bases include 3-nitropyrrole and
5-nitroindole. Universal bases substitute for the normal bases but
have no bias in base pairing. That is, universal bases can base
pair with any other base. Base modifications often can be combined
with for example a sugar modification, such as 2'-O-methoxyethyl,
to achieve unique properties such as increased duplex stability.
There are numerous United States patents such as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, which
detail and describe a range of base modifications. Each of these
patents is herein incorporated by reference in its entirety, and
specifically for their description of base modifications, their
synthesis, their use, and their incorporation into oligonucleotides
and nucleic acids.
[0226] Nucleotide analogs can also include modifications of the
sugar moiety. Modifications to the sugar moiety would include
natural modifications of the ribose and deoxyribose as well as
synthetic modifications. Sugar modifications include but are not
limited to the following modifications at the 2' position: OH; F;
O--, S--, or N-alkyl; O--, S--, or N-alkenyl; O--, S-- or
N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and
alkynyl may be substituted or unsubstituted C1 to C10, alkyl or C2
to C10 alkenyl and alkynyl. 2' sugar modifications also include but
are not limited to --O[(CH.sub.2)n O]m CH.sub.3, --O(CH.sub.2)n
OCH.sub.3, --O(CH.sub.2)n NH.sub.2, --O(CH.sub.2)n CH.sub.3,
--O(CH.sub.2)n --ONH2, and --O(CH.sub.2)nON[(CH.sub.2)n
CH.sub.3)].sub.2, where n and m are from 1 to about 10.
[0227] Other modifications at the 2' position include but are not
limited to: C1 to C10 lower alkyl, substituted lower alkyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2 CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties. Similar modifications may also be made at other
positions on the sugar, particularly the 3' position of the sugar
on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides
and the 5' position of 5' terminal nucleotide. Modified sugars
would also include those that contain modifications at the bridging
ring oxygen, such as CH.sub.2 and S. Nucleotide sugar analogs may
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. There are numerous United States patents
that teach the preparation of such modified sugar structures such
as U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is
herein incorporated by reference in its entirety, and specifically
for their description of modified sugar structures, their
synthesis, their use, and their incorporation into nucleotides,
oligonucleotides and nucleic acids.
[0228] Nucleotide analogs can also be modified at the phosphate
moiety. Modified phosphate moieties include but are not limited to
those that can be modified so that the linkage between two
nucleotides contains a phosphorothioate, chiral phosphorothioate,
phosphorodithioate, phosphotriester, aminoalkylphosphotriester,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonate and chiral phosphonates, phosphinates, phosphoramidates
including 3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates. It is understood
that these phosphate or modified phosphate linkages between two
nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and
the linkage can contain inverted polarity such as 3'-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are
also included. Numerous United States patents teach how to make and
use nucleotides containing modified phosphates and include but are
not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is
herein incorporated by reference its entirety, and specifically for
their description of modified phosphates, their synthesis, their
use, and their incorporation into nucleotides, oligonucleotides and
nucleic acids.
[0229] It is understood that nucleotide analogs need only contain a
single modification, but may also contain multiple modifications
within one of the moieties or between different moieties.
[0230] Nucleotide substitutes are molecules having similar
functional properties to nucleotides, but which do not contain a
phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide
substitutes are molecules that will recognize and hybridize to
(base pair to) complementary nucleic acids in a Watson-Crick or
Hoogsteen manner, but which are linked together through a moiety
other than a phosphate moiety. Nucleotide substitutes are able to
conform to a double helix type structure when interacting with the
appropriate target nucleic acid.
[0231] Nucleotide substitutes are nucleotides or nucleotide analogs
that have had the phosphate moiety and/or sugar moieties replaced.
Nucleotide substitutes do not contain a standard phosphorus atom.
Substitutes for the phosphate can be for example, short chain alkyl
or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl
or cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and CH2
component parts. Numerous United States patents disclose how to
make and use these types of phosphate replacements and include but
are not limited to U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, each of which is herein incorporated by reference its
entirety, and specifically for their description of phosphate
replacements, their synthesis, their use, and their incorporation
into nucleotides, oligonucleotides and nucleic acids.
[0232] It is also understood in a nucleotide substitute that both
the sugar and the phosphate moieties of the nucleotide can be
replaced, by for example an amide type linkage (aminoethylglycine)
(PNA). U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262 teach how
to make and use PNA molecules, each of which is herein incorporated
by reference. (See also Nielsen et al., Science 254:1497-1500
(1991)).
[0233] Oligonucleotides can be comprised of nucleotides and can be
made up of different types of nucleotides or the same type of
nucleotides. For example, one or more of the nucleotides in an
oligonucleotide can be ribonucleotides, 2'-O-methyl
ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl
ribonucleotides; about 10% to about 50% of the nucleotides can be
ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of
ribonucleotides and 2'-O-methyl ribonucleotides; about 50% or more
of the nucleotides can be ribonucleotides, 2'-O-methyl
ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl
ribonucleotides; or all of the nucleotides are ribonucleotides,
2'-O-methyl ribonucleotides, or a mixture of ribonucleotides and
2'-O-methyl ribonucleotides. Such oligonucleotides can be referred
to as chimeric oligonucleotides.
[0234] L. Solid-State Detectors
[0235] Solid-state detectors are solid-state substrates or supports
to which address probes or detection molecules have been coupled. A
preferred form of solid-state detector is an array detector. An
array detector is a solid-state detector to which multiple
different address probes or detection molecules have been coupled
in an array, grid, or other organized pattern.
[0236] Solid-state substrates for use in solid-state detectors can
include any solid material to which oligonucleotides can be
coupled. This includes materials such as acrylamide, cellulose,
nitrocellulose, glass, gold, polystyrene, polyethylene vinyl
acetate, polypropylene, polymethacrylate, polyethylene,
polyethylene oxide, glass, polysilicates, polycarbonates, teflon,
fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic
acid, polylactic acid, polyorthoesters, functionalized silane,
polypropylfumerate, collagen, glycosaminoglycans, and polyamino
acids. Solid-state substrates can have any useful form including
thin films or membranes, beads, bottles, dishes, fibers, optical
fibers, woven fibers, chips, compact disks, shaped polymers,
particles and microparticles. A chip is a rectangular or square
small piece of material. Preferred forms for solid-state substrates
are thin films, beads, or chips.
[0237] Address probes immobilized on a solid-state substrate allow
capture of the products of the disclosed amplification method on a
solid-state detector. Such capture provides a convenient means of
washing away reaction components that might interfere with
subsequent detection steps. By attaching different address probes
to different regions of a solid-state detector, different
amplification products can be captured at different, and therefore
diagnostic, locations on the solid-state detector. For example, in
a multiplex assay, address probes specific for numerous different
amplified nucleic acids (each representing a different target
sequence amplified via a different set of primers) can be
immobilized in an array, each in a different location. Capture and
detection will occur only at those array locations corresponding to
amplified nucleic acids for which the corresponding target
sequences were present in a sample.
[0238] Methods for immobilization of oligonucleotides to
solid-state substrates are well established. Oligonucleotides,
including address probes and detection probes, can be coupled to
substrates using established coupling methods. For example,
suitable attachment methods are described by Pease et al., Proc.
Natl. Acad. Sci. USA 91(11):5022-5026 (1994), and Khrapko et al.,
Mol Biol (Mosk) (USSR) 25:718-730 (1991). A method for
immobilization of 3'-amine oligonucleotides on casein-coated slides
is described by Stimpson et al., Proc. Natl. Acad. Sci. USA
92:6379-6383 (1995). A preferred method of attaching
oligonucleotides to solid-state substrates is described by Guo et
al., Nucleic Acids Res. 22:5456-5465 (1994). Examples of nucleic
acid chips and arrays, including methods of making and using such
chips and arrays, are described in U.S. Pat. Nos. 6,287,768,
6,288,220, 6,287,776, 6,297,006, and 6,291,193.
[0239] Some solid-state detectors useful in the disclosed method
have detection antibodies attached to a solid-state substrate. Such
antibodies can be specific for a molecule of interest. Captured
molecules of interest can then be detected by binding of a second,
reporter antibody, followed by amplification. Such a use of
antibodies in a solid-state detector allows amplification assays to
be developed for the detection of any molecule for which antibodies
can be generated. Methods for immobilizing antibodies to
solid-state substrates are well established. Immobilization can be
accomplished by attachment, for example, to aminated surfaces,
carboxylated surfaces or hydroxylated surfaces using standard
immobilization chemistries. Examples of attachment agents are
cyanogen bromide, succinimide, aldehydes, tosyl chloride,
avidin-biotin, photocrosslinkable agents, epoxides and maleimides.
A preferred attachment agent is glutaraldehyde. These and other
attachment agents, as well as methods for their use in attachment,
are described in Protein immobilization: fundamentals and
applications, Richard F. Taylor, ed. (M. Dekker, New York, 1991),
Johnstone and Thorpe, Immunochemistry In Practice (Blackwell
Scientific Publications, Oxford, England, 1987) pages 209-216 and
241-242, and Immobilized Affinity Ligands, Craig T. Hermanson et
al., eds. (Academic Press, New York, 1992). Antibodies can be
attached to a substrate by chemically cross-linking a free amino
group on the antibody to reactive side groups present within the
solid-state substrate. For example, antibodies may be chemically
cross-linked to a substrate that contains free amino or carboxyl
groups using glutaraldehyde or carbodiimides as cross-linker
agents. In this method, aqueous solutions containing free
antibodies are incubated with the solid-state substrate in the
presence of glutaraldehyde or carbodiimide. For crosslinking with
glutaraldehyde the reactants can be incubated with 2%
glutaraldehyde by volume in a buffered solution such as 0.1 M
sodium cacodylate at pH 7.4. Other standard immobilization
chemistries are known by those of skill in the art.
[0240] M. Solid-State Samples
[0241] Solid-state samples are solid-state substrates or supports
to which target molecules or target sequences have been coupled or
adhered. Target molecules or target sequences are preferably
delivered in a target sample or assay sample. A preferred form of
solid-state sample is an array sample. An array sample is a
solid-state sample to which multiple different target samples or
assay samples have been coupled or adhered in an array, grid, or
other organized pattern.
[0242] Solid-state substrates for use in solid-state samples can
include any solid material to which target molecules or target
sequences can be coupled or adhered. This includes materials such
as acrylamide, cellulose, nitrocellulose, glass, gold, polystyrene,
polyethylene vinyl acetate, polypropylene, polymethacrylate,
polyethylene, polyethylene oxide, glass, polysilicates,
polycarbonates, teflon, fluorocarbons, nylon, silicon rubber,
polyanhydrides, polyglycolic acid, polylactic acid,
polyorthoesters, functionalized silane, polypropylfumerate,
collagen, glycosaminoglycans, and polyamino acids. Solid-state
substrates can have any useful form including thin films or
membranes, beads, bottles, dishes, fibers, optical fibers, woven
fibers, chips, compact disks, shaped polymers, particles and
microparticles. A chip is a rectangular or square small piece of
material. Preferred forms for solid-state substrates are thin
films, beads, or chips.
[0243] Target molecules and target sequences immobilized on a
solid-state substrate allow formation of target-specific TS-DNA
localized on the solid-state substrate. Such localization provides
a convenient means of washing away reaction components that might
interfere with subsequent detection steps, and a convenient way of
assaying multiple different samples simultaneously. Diagnostic
TS-DNA can be independently formed at each site where a different
sample is adhered. For immobilization of target sequences or other
oligonucleotide molecules to form a solid-state sample, the methods
described above for can be used. Nucleic acids produced in the
disclosed method can be coupled or adhered to a solid-state
substrate in any suitable way. For example, nucleic acids generated
by multiple strand displacement can be attached by adding modified
nucleotides to the 3' ends of nucleic acids produced by strand
displacement replication using terminal deoxynucleotidyl
transferase, and reacting the modified nucleotides with a
solid-state substrate or support thereby attaching the nucleic
acids to the solid-state substrate or support.
[0244] A preferred form of solid-state substrate is a glass slide
to which up to 256 separate target samples have been adhered as an
array of small dots. Each dot is preferably from 0.1 to 2.5 mm in
diameter, and most preferably around 2.5 mm in diameter. Such
microarrays can be fabricated, for example, using the method
described by Schena et al., Science 270:487-470 (1995). Briefly,
microarrays can be fabricated on poly-L-lysine-coated microscope
slides (Sigma) with an arraying machine fitted with one printing
tip. The tip is loaded with 1 .mu.l of a DNA sample (0.5 mg/ml)
from, for example, 96-well microtiter plates and deposited
.about.0.005 .mu.l per slide on multiple slides at the desired
spacing. The printed slides can then be rehydrated for 2 hours in a
humid chamber, snap-dried at 100.degree. C. for 1 minute, rinsed in
0.1% SDS, and treated with 0.05% succinic anhydride prepared in
buffer consisting of 50% 1-methyl-2-pyrrolidinone and 50% boric
acid. The DNA on the slides can then be denatured in, for example,
distilled water for 2 minutes at 90.degree. C. immediately before
use. Microarray solid-state samples can scanned with, for example,
a laser fluorescent scanner with a computer-controlled XY stage and
a microscope objective. A mixed gas, multiline laser allows
sequential excitation of multiple fluorophores.
[0245] N. DNA ligases
[0246] Any DNA ligase is suitable for use in the disclosed
amplification method. Preferred ligases are those that
preferentially form phosphodiester bonds at nicks in
double-stranded DNA. That is, ligases that fail to ligate the free
ends of single-stranded DNA at a significant rate are preferred.
Thermostable ligases are especially preferred. Many suitable
ligases are known, such as T4 DNA ligase (Davis et al., Advanced
Bacterial Genetics--A Manual for Genetic Engineering (Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., 1980)), E. coli DNA
ligase (Panasnko et al., J. Biol. Chem. 253:4590-4592 (1978)),
AMPLIGASE.RTM. (Kalin et al., Mutat. Res., 283(2):119-123 (1992);
Winn-Deen et al., Mol Cell Probes (England) 7(3):179-186 (1993)),
Taq DNA ligase (Barany, Proc. Natl. Acad. Sci. USA 88:189-193
(1991), Thermus thermophilus DNA ligase (Abbott Laboratories),
Thermus scotoductus DNA ligase and Rhodothermus marinus DNA ligase
(Thorbjarnardottir et al., Gene 151:177-180 (1995)). T4 DNA ligase
is preferred for ligations involving RNA target sequences due to
its ability to ligate DNA ends involved in DNA:RNA hybrids (Hsuih
et al., Quantitative detection of HCV RNA using novel
ligation-dependent polymerase chain reaction, American Association
for the Study of Liver Diseases (Chicago, Ill., Nov. 3-7,
1995)).
[0247] The frequency of non-target-directed ligation catalyzed by a
ligase can be determined as follows. LM-RCA is performed with an
open circle probe and a gap oligonucleotide in the presence of a
target sequence. Non-targeted-directed ligation products can then
be detected by using an address probe specific for the open circle
probe ligated without the gap oligonucleotide to capture TS-DNA
from such ligated probes. Target directed ligation products can be
detected by using an address probe specific for the open circle
probe ligated with the gap oligonucleotide. By using a solid-state
detector with regions containing each of these address probes, both
target directed and non-target-directed ligation products can be
detected and quantitated. The ratio of target-directed and
non-target-directed TS-DNA produced provides a measure of the
specificity of the ligation operation. Target-directed ligation can
also be assessed as discussed in Barany (1991).
[0248] O. DNA Polymerases
[0249] DNA polymerases useful in the rolling circle replication
step of the disclosed method must perform rolling circle
replication of primed single-stranded circles. Such polymerases are
referred to herein as rolling circle DNA polymerases. For rolling
circle replication, it is preferred that a DNA polymerase be
capable of displacing the strand complementary to the template
strand, termed strand displacement, and lack a 5' to 3' exonuclease
activity. Strand displacement is necessary to result in synthesis
of multiple tandem copies of the ligated OCP. A 5' to 3'
exonuclease activity, if present, might result in the destruction
of the synthesized strand. DNA polymerases for use in the disclosed
method can also be highly processive, if desired. The suitability
of a DNA polymerase for use in the disclosed method can be readily
determined by assessing its ability to carry out rolling circle
replication. Preferred rolling circle DNA polymerases are Bst DNA
polymerase, VENT.RTM. DNA polymerase (Kong et al., J. Biol. Chem.
268:1965-1975 (1993)), ThermoSequenase.TM., delta Tts DNA
polymerase, Bea DNA polymerase (Journal of Biochemistry
113(3):401-10, 1993 Mar.), bacteriophage .phi.29 DNA polymerase
(U.S. Pat. Nos. 5,198,543 and 5,001,050 to Blanco et al.), phage M2
DNA polymerase (Matsumoto et al., Gene 84:247 (1989)), phage
.phi.PRD1 DNA polymerase (Jung et al., Proc. Natl. Acad. Sci. USA
84:8287 (1987)), Klenow fragment of DNA polymerase I (Jacobsen et
al., Eur. J Biochem. 45:623-627 (1974)), T5 DNA polymerase
(Chatterjee et al., Gene 97:13-19 (1991)), PRD1 DNA polymerase (Zhu
and Ito, Biochim. Biophys. Acta. 1219:267-276 (1994)), modified T7
DNA polymerase (Tabor and Richardson, J. Biol. Chem.
262:15330-15333 (1987); Tabor and Richardson, J. Biol. Chem.
264:6447-6458 (1989); Sequenase.TM. (U.S. Biochemicals)), and T4
DNA polymerase holoenzyme (Kaboord and Benkovic, Curr. Biol.
5:149-157 (1995)). More preferred are Bst DNA polymerase, VENT.RTM.
DNA polymerase, ThermoSequenase.TM., and delta Tts DNA polymerase.
Bst DNA polymerase is most preferred.
[0250] Strand displacement can be facilitated through the use of a
strand displacement factor, such as helicase. It is considered that
any DNA polymerase that can perform rolling circle replication in
the presence of a strand displacement factor is suitable for use in
the disclosed method, even if the DNA polymerase does not perform
rolling circle replication in the absence of such a factor. Strand
displacement factors useful in the disclosed method include BMRFI
polymerase accessory subunit (Tsurumi et al., J. Virology
67(12):7648-7653 (1993)), adenovirus DNA-binding protein
(Zijderveld and van der Vliet, J. Virology 68(2):1158-1164 (1994)),
herpes simplex viral protein ICP8 (Boehmer and Lehman, J. Virology
67(2):711-715 (1993); Skaliter and Lehman, Proc. Natl. Acad. Sci.
USA 91(22):10665-10669 (1994)), single-stranded DNA
binding-proteins (SSB; Rigler and Romano, J. Biol. Chem.
270:8910-8919 (1995)), and calf thymus helicase (Siegel et al., J.
Biol. Chem. 267:13629-13635 (1992)).
[0251] The ability of a polymerase to carry out rolling circle
replication can be determined by using the polymerase in a rolling
circle replication assay such as those described in Fire and Xu,
Proc. Natl. Acad. Sci. USA 92:4641-4645 (1995) and in U.S. Pat. No.
6,143,495 (Example 1).
[0252] Another type of DNA polymerase can be used if a gap-filling
synthesis step is used, such as in gap-filling LM-RCA (see U.S.
Pat. No. 6,143,495, Example 3). When using a DNA polymerase to fill
gaps, strand displacement by the DNA polymerase is undesirable.
Such DNA polymerases are referred to herein as gap-filling DNA
polymerases. Unless otherwise indicated, a DNA polymerase referred
to herein without specifying it as a rolling circle DNA polymerase
or a gap-filling DNA polymerase, is understood to be a rolling
circle DNA polymerase and not a gap-filling DNA polymerase.
Preferred gap-filling DNA polymerases are T7 DNA polymerase
(Studier et al., Methods Enzymol. 185:60-89 (1990)), DEEP VENTS DNA
polymerase (New England Biolabs, Beverly, Mass.), modified T7 DNA
polymerase (Tabor and Richardson, J. Biol. Chem. 262:15330-15333
(1987); Tabor and Richardson, J. Biol. Chem. 264:6447-6458 (1989);
Sequenase.TM. (U.S. Biochemicals)), and T4 DNA polymerase (Kunkel
et al., Methods Enzymol. 154:367-382 (1987)). An especially
preferred type of gap-filling DNA polymerase is the Thermus flavus
DNA polymerase (MBR, Milwaukee, Wis.). The most preferred
gap-filling DNA polymerase is the Stoffel fragment of Taq DNA
polymerase (Lawyer et al., PCR Methods Appl. 2(4):275-287 (1993),
King et al., J. Biol. Chem. 269(18):13061-13064 (1994)).
[0253] The ability of a polymerase to fill gaps can be determined
by performing gap-filling LM-RCA. Gap-filling LM-RCA is performed
with an open circle probe that forms a gap space when hybridized to
the target sequence. Ligation can only occur when the gap space is
filled by the DNA polymerase. If gap-filling occurs, TS-DNA can be
detected, otherwise it can be concluded that the DNA polymerase, or
the reaction conditions, is not useful as a gap-filling DNA
polymerase.
[0254] P. RNA polymerases
[0255] Any RNA polymerase which can carry out transcription in
vitro and for which promoter sequences have been identified can be
used in the disclosed rolling circle transcription method. Stable
RNA polymerases without complex requirements are preferred. Most
preferred are T7 RNA polymerase (Davanloo et al., Proc. Natl. Acad.
Sci. USA 81:2035-2039 (1984)) and SP6 RNA polymerase (Butler and
Chamberlin, J. Biol. Chem. 257:5772-5778 (1982)) which are highly
specific for particular promoter sequences (Schenbom and
Meirendorf, Nucleic Acids Research 13:6223-6236 (1985)). Other RNA
polymerases with this characteristic are also preferred. Because
promoter sequences are generally recognized by specific RNA
polymerases, the OCP or ATC should contain a promoter sequence
recognized by the RNA polymerase that is used. Numerous promoter
sequences are known and any suitable RNA polymerase having an
identified promoter sequence can be used. Promoter sequences for
RNA polymerases can be identified using established techniques.
[0256] Q. Kits
[0257] The materials described above can be packaged together in
any suitable combination as a kit useful for performing the
disclosed method. All such possible combinations are specifically
contemplated. It is preferred that the kit components in a given
kit be designed and adapted for use together in the disclosed
method. A kit can include, for example, one or more open circle
probes and one or more detection rolling circle replication
primers. A kit can also include a secondary DNA strand displacement
primer, a common rolling circle replication primer, or both. The
open circle probes, detection rolling circle replication primers,
common rolling circle replication primers and secondary DNA strand
displacement primers.
[0258] A kit can include, for example, a set of open circle probes
each comprising two ends, where at least one of the ends of one of
the open circle probe can form an intramolecular stem structure,
where portions of each open circle probe are complementary to the
one or more target sequences, and a plurality of detection rolling
circle replication primers, where all or a portion of each
detection rolling circle replication primer is complementary to a
portion of one or more of the open circle probes. Such kits can
also include, for example, one or more secondary DNA strand
displacement primers, where all or a portion of each secondary DNA
strand displacement primer matches a portion of one or more of the
open circle probes, and one or more common rolling circle
replication primers, where all or a portion of each common rolling
circle replication primer is complementary to a portion of one or
more of the open circle probes.
[0259] A kit can also include one or more gap oligonucleotides. The
target probe portions of the open circle probes in a kit preferably
are each complementary to a different target sequence or to
different forms of the same target sequence. A kit can also include
one or more detection probes. Preferably, a portion of each of the
detection probes in a kit has sequence matching or complementary to
a portion of a different one of the open circle probes in that
kit.
[0260] A kit can also include one or more reporter binding agents
where the oligonucleotide portion of the reporter binding agents
include one of the target-sequences. The specific binding molecules
of the reporter binding agents in a kit each can be specific for an
analyte, preferably specific for a protein or peptide.
Method
[0261] The disclosed method involves an amplification operations
and, optionally, a ligation operation. The method provides nucleic
acid amplification reactions that reduce, prevent, or eliminate
artifacts; increase efficiency; increase specificity; and/or
increase consistency. The disclosed method can combine, for
example, the use of open circle probes that can form intramolecular
stem structures; the use of matched open circle probe sets in the
same amplification reaction; the use of detection primers and
detection during the amplification reaction; the use of a plurality
of detection rolling circle replication primer, a secondary DNA
strand displacement primer and a common rolling circle replication
primer in the same amplification reaction; and/or the use of
peptide nucleic acid quenchers associated with detection rolling
circle replication primers.
[0262] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation. The DNA ligation
operation can comprise circularization of one or more open circle
probes and can be carried out in the presence of a set of open
circle probes. The set of open circle probes can comprise a
plurality of different open circle probes. Each open circle probe
can comprise two ends, where at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure. Circularization of the open circle probes that can form
an intramolecular stem structure can be dependent on hybridization
of the open circle probe to a target sequence. Two or more of the
open circle probes in the set of open circle probes can constitute
a matched open circle probe set.
[0263] The amplification operation can comprise rolling circle
replication of the circularized open circle probes. The
amplification operation can be carried out in the presence of a
plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer. Each detection rolling circle
replication primer can be associated with a peptide nucleic acid
quencher. Each detection rolling circle replication primer can
correspond to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer can
correspond to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer can
correspond to all of the open circle probes in the set of open
circle probes.
[0264] Some forms of the disclosed method can comprise an
amplification operation. The amplification operation can be carried
out in the presence of a set of amplification target circles. The
set of amplification target circles can comprise a plurality of
different amplification target circles. The amplification operation
can comprise rolling circle replication of the amplification target
circles. The amplification operation can be carried out in the
presence of a plurality of detection rolling circle replication
primers, a secondary DNA strand displacement primer, and a common
rolling circle replication primer. Each detection rolling circle
replication primer can correspond to a different amplification
target circle in the set of amplification target circles, the
secondary DNA strand displacement primer can correspond to all of
the amplification target circles in the set of amplification target
circles, and the common rolling circle replication primer can
correspond to all of the amplification target circles in the set of
amplification target circles.
[0265] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and where the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The ligation operation is carried out in the presence of a set of
open circle probes, where the set of open circle probes comprises a
plurality of different open circle probes, and where two or more of
the open circle probes in the set of open circle probes constitute
a matched open circle probe set.
[0266] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and where the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The ligation operation is carried out in the presence of a set of
open circle probes, where the set of open circle probes comprises a
plurality of different open circle probes. The amplification
operation is carried out in the presence of a plurality of
detection rolling circle replication primers, a secondary DNA
strand displacement primer, and a common rolling circle replication
primer, where each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes.
[0267] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and where the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The amplification operation is carried out in the presence of one
or more rolling circle replication primers, where at least one of
the rolling circle replication primers is associated with a peptide
nucleic acid quencher.
[0268] Some forms of the disclosed method can comprise an
amplification operation, where the amplification operation
comprises rolling circle replication of the amplification target
circles. The amplification operation is carried out in the presence
of one or more rolling circle replication primers, where at least
one of the rolling circle replication primers is associated with a
peptide nucleic acid quencher.
[0269] Some forms of the disclosed method can comprise a DNA
ligation operation and an amplification operation, where the DNA
ligation operation comprises circularization of one or more open
circle probes, and wherein the amplification operation comprises
rolling circle replication of the circularized open circle probes.
The ligation operation is carried out in the presence of a set of
open circle probes, where the set of open circle probes comprises a
plurality of different open circle probes. Each open circle probe
comprises two ends, where at least one of the ends of at least one
of the open circle probes can form an intramolecular stem
structure. Circularization of the open circle probes that can form
an intramolecular stem structure is dependent on hybridization of
the open circle probe to a target sequence. Two or more of the open
circle probes in the set of open circle probes constitute a matched
open circle probe set.
[0270] The amplification operation is carried out in the presence
of a plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer. Each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher. Each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes.
[0271] Some forms of the disclosed method can comprise
[0272] (a) mixing a set of open circle probes with a target sample,
to produce an OCP-target sample mixture, and incubating the
OCP-target sample mixture under conditions that promote
hybridization between the open circle probes and the target
sequences in the OCP-target sample mixture. The set of open circle
probes comprises a plurality of different open circle probes. Each
open circle probe can comprise two ends. At least one of the ends
of at least one of the open circle probes can form an
intramolecular stem structure. Circularization of the open circle
probes that can form an intramolecular stem structure can be
dependent on hybridization of the open circle probe to a target
sequence. Two or more of the open circle probes in the set of open
circle probes can constitute a matched open circle probe set.
[0273] (b) mixing ligase with the OCP-target sample mixture, to
produce a ligation mixture, and incubating the ligation mixture
under conditions that promote ligation of the open circle probes to
form amplification target circles. The amplification target circles
formed from the open circle probes in the set of open circle probes
can comprise a set of amplification target circles.
[0274] (c) mixing a plurality of detection rolling circle
replication primers, a secondary DNA strand displacement primer,
and a common rolling circle replication primer with the ligation
mixture, to produce a primer-ATC mixture, and incubating the
primer-ATC mixture under conditions that promote hybridization
between the amplification target circles and the rolling circle
replication primers in the primer-ATC mixture. Each detection
rolling circle replication primer can be associated with a peptide
nucleic acid quencher. Each detection rolling circle replication
primer can correspond to a different open circle probe in the set
of open circle probes, the secondary DNA strand displacement primer
can correspond to all of the open circle probes in the set of open
circle probes, and the common rolling circle replication primer can
correspond to all of the open circle probes in the set of open
circle probes.
[0275] (d) mixing DNA polymerase with the primer-ATC mixture, to
produce a polymerase-ATC mixture, and incubating the polymerase-ATC
mixture under conditions that promote replication of the
amplification target circles. Replication of the amplification
target circles results in the formation of tandem sequence DNA.
[0276] Some forms of the disclosed compositions and method can
increase the efficiency of nucleic acid amplification reactions.
Increased efficiency can include, for example, increased
amplification and/or signal generation in less time, from less
starting material, and/or from less reagents; and/or signal
detection during the amplification reaction. One form of method for
increasing efficiency is the use of a detection primer, such as a
detection rolling circle replication primer. The detection primer
produces a signal during amplification as a quenching moiety in or
on the primer becomes separated from a fluorescent label on the
primer. A useful form of detection primer is a detection rolling
circle primer associated with a peptide nucleic acid quencher. The
peptide nucleic acid quencher is displaced from the detection
primer as amplification proceeds (via, for example, replication of
a nucleic acid strand complementary to the nucleic acid strand that
incorporates the primer).
[0277] The progress of rolling circle amplification reactions can
be monitored in real-time (that is, during the reaction) by using
detection primers in the amplification. The detection primer
produces a signal during amplification as a quenching moiety in or
on the primer becomes separated from a fluorescent label on the
primer. When a quenching moiety is in proximity to a fluorescent
molecule or label, fluorescence is quenched by transfer of energy
to the quenching moiety. Fluorescence is detectable once the
quenching moiety is no longer in proximity to the fluorescent
label. Detection primers are incorporated into amplification
products as they prime replication. In the disclosed amplification
reactions, the incorporated primer goes on to serve as a template
sequence when the nucleic acid strand in which it is incorporated
is replicated. A quenching moiety can be placed in proximity to a
fluorescent label on the primer, for example, via hybridization of
a nucleic acid sequence to which the quenching moiety is attached
to sequence of the primer adjacent to the fluorescent label. When
the incorporated primer is replicated, the hybrid is disrupted and
the quencher moiety is separated from the fluorescent label, which
can then produce a fluorescent signal. Thus, as the amplification
reaction proceeds, more and more incorporated detection primers are
replicated, producing an ever-increasing fluorescent signal that
can be monitored as the reaction proceeds.
[0278] Another form of method for increasing efficiency is the use
of combinations of primers having different relationships to open
circle probes used in the method. For example, the use of two or
more rolling circle replication primers and one or more secondary
DNA strand displacement primers, with each primer specific for a
different sequence or region of the open circle probes, can
increase the efficiency of amplification by producing multiple
simultaneous initiations of replication and multiple simultaneous
generations of amplification product simultaneously. For example,
each of two or more different rolling circle replication primers
can simultaneously prime replication from different sequences in a
given circularized open circle probe or amplification target
circle. This multiplies the yield of amplification.
[0279] Rolling circle amplification involves rolling circle
replication of a circular template, such as a circularized open
circle probe or an amplification target circle. Rolling circle
replication can be mediated by a primer, referred to as a rolling
circle replication primer, that hybridizes anywhere on the circular
temple. Multiple strands can be produced simultaneously by using
two or more rolling circle replication primers that hybridize to
different sequences (that is, at different locations) in the
circular template. Thus, the disclosed method can be performed
using of two or more rolling circle replication primers targeted to
different sequences in the circular templates. Particularly useful
are the use of detection rolling circle replication primers and
common rolling circle replication primers in amplification
reactions where both a detection rolling circle replication primer
and a common rolling circle replication primer correspond to each
open circle probe or amplification target circle.
[0280] Use of both rolling circle replication primers (which prime
replication of circularized open circle probes and amplification
target circles) and secondary DNA strand displacement primers
(which prime replication of the product of replication of
circularized open circle probes and amplification target circles)
allows multiple generations of amplification product to be
generated simultaneously. This multiplies the yield of
amplification.
[0281] Rolling circle replication of a circular template produces
long strands of DNA containing tandem repeats of sequence
complementary to the sequence of the circular template. These
strands are referred to as tandem sequence DNA. The speed and yield
of rolling circle amplification reactions can be greatly increased
by replicating the tandem sequence DNA during rolling circle
replication. This can be accomplished by using one or more primers
complementary to sequence in the tandem sequence DNA. Such primers,
referred to as secondary DNA strand displacement primers, have
sequence matching sequence in an open circle probe or amplification
target circle (and thus are complementary to the tandem sequence
DNA). Replication of the tandem sequence DNA produces more nucleic
acid, referred to as secondary tandem sequence DNA, and provides a
template for further replication by the rolling circle replication
primers (which are complementary to sequences in the secondary
tandem sequence DNA). These, and subsequent replication products
are similarly replicated producing an overall cascade of
replication, referred to as exponential rolling circle
amplification, that produces a huge amplification in a short
time.
[0282] Some forms of the disclosed compositions and method can
increase the specificity of nucleic acid amplification reactions.
Increased specificity can include, for example, more amplification
of amplification targets, or more amplification based on specific
targets, relative to non-target amplification and/or more accurate
assessment of false positive and false negative amplification. One
form of method for increasing specificity is the use of matched
open circle probe sets. Matched open circle probes are open circle
probes that are targeted to different forms of the same target
sequence. For example, a target sequence in a gene of interest may
occur in two or more forms (for example, a "wild type" or "normal"
form and a "mutant" form; or, more generally, polymorphic forms);
single nucleotide polymorphisms are an example of such different
forms of target sequences. By targeting two or more (up to, for
example, most or all) of the different forms of a target sequence
that may be present, the amplification reaction will include a
positive control. That is, for example, the open circle probe
targeted to the normal form of the target sequence will produce a
signal even if the mutant form of the target sequence is not
present in the reaction or the open circle probe targeted to the
mutant form of the target sequence will produce a signal even if
the normal form of the target sequence is not present in the
reaction.
[0283] Ligation-mediated rolling circle amplification should
produce amplification products from a given open circle probe when
the target sequence of that open circle probe is present and should
not produce amplification products from that open circle probe when
the target sequence of that open circle probe is not present.
However, it is possible that the absence of the amplification
products could be the result of a non-functional reaction rather
than the absence of target sequence. Including open target circles
specific for two or more possible forms of a target sequence
increases the chance that the target for at least one of the open
circle probes will be present. Resultant production of
amplification products serves as a sort of positive control,
indicating that the amplification reaction is functional. Further,
if there is no target sequence present in the reaction (so that no
open circle probe should be circularized and amplified), there is
an increased tendency for the reaction to produce spurious or
artifactual amplification products. This can be referred to as idle
assay artifact production. By ensuring (or increasing the chances)
that the target sequence for at least one open circle is present in
the amplification reaction, the chance that idle assay artifacts
will be produced.
[0284] Some forms of the disclosed compositions and method can
increase the consistency of nucleic acid amplification reactions.
Increased consistency can include, for example, levels of
amplification products that more accurately reflect the relative
amount of starting material, and/or less variation in the yield of
amplification from different amplification targets. One form of
method for increasing consistency involves the use of three primers
having different relationships to open circle probes used in the
method. The three primers are detection rolling circle replication
primers, secondary DNA strand displacement primers, and common
rolling circle replication primers. For example, for a given set of
open circle probes or amplification target circles, detection
rolling circle replication primers can each correspond to a
different open circle probe or amplification target circle in the
set while secondary DNA strand displacement primers and common
rolling circle replication primers can correspond to all of the
open circle probe or amplification target circles in the set. These
relationships allow the overall amplification to be consistent
among different open circle probes or amplification target circles
in a set because the sequence of two of the primers used (and their
complements on the circles) will be the same throughout the set
(thus minimizing or eliminating the effect of sequence on primer
efficiency). Differential detection is mediated by the
circle-specific detection rolling circle replication primers.
[0285] Rolling circle amplification can be performed using multiple
open circle probes or amplification target circles in the same
reaction. Specificity of detection of rolling circle replication of
different circularized open circle probes and amplification target
circles can be accomplished in numerous ways. For real-time
detection, it is useful to use a different detection rolling circle
replication primer specific for each different open circle probe
and amplification target circle. Because the different detection
rolling circle replication primers may have different priming
efficiencies (due to sequence differences, for example), it is
useful to include one or more common rolling circle replication
primers that are complementary to all of the open circle probes or
amplification target circles in the reaction. This provides rolling
circle replication unbiased by differing priming efficiencies.
[0286] Some forms of the disclosed compositions and method can
reduce or eliminate generation of unwanted, undesirable, or
non-specific amplification products in nucleic acid amplification
reactions. One form of composition is an open circle probe that can
form an intramolecular stem structure, such as a hairpin structure,
at one or both ends. Open circle probes are useful in rolling
circle amplification techniques. The stem structure allows the open
circle probe to be circularized when hybridized to a legitimate
target sequence but results in inactivation of uncircularized open
circle probes. This inactivation, which preferably involves
stabilization of the stem structure, extension of the end of the
open circle probe, or both, reduces or eliminates the ability of
the open circle probe to prime nucleic acid synthesis or to serve
as a template for rolling circle amplification.
[0287] In ligation-mediated rolling circle amplification (LM-RCA),
a linear DNA molecule, referred to as an open circle probe or
padlock probe, hybridizes to a target sequence and is circularized.
The circularized probe is then amplified via rolling circle
replication of the circular probe. Uncircularized probe that
remains in the reaction can hybridize to nucleic acid sequences in
the reaction and cause amplification of undesirable, non-specific
sequences. The disclosed compositions and method address this
problem by reducing or eliminating the potential uncircularized
open circle probes from priming nucleic acid synthesis.
[0288] The disclosed open circle probes can be inactivated in
several ways. For example, where the 3' end of an open circle probe
is involved in an intramolecular stem structure, the 3' end can be
extended in a replication reaction using the open circle probe
sequences as template (see FIG. 2B). The result is stabilization of
the intramolecular stem structure and a change in the 3' end
sequence. Stabilization of the stem structure results in a
reduction or elimination of the ability of the open circle probe to
prime nucleic acid synthesis because the 3' end is stably
hybridized to sequences in the open circle probe under the
conditions used for nucleic acid replication. Change in the
sequence of the 3' end can reduce of the ability of the open circle
probe to prime nucleic acid synthesis because the changed 3'
sequences may not be as closely related to sequences involved in
the amplification reaction or assay. Change in the sequence of the
3' end can reduce of the ability of the open circle probe to serve
as a template for rolling circle amplification. For example, even
if the open circle probe with extended 3' end were circularized,
the rolling circle replication primer could be prevented from
priming replication of such a circle if the primer complement
sequence on the open circle probe were interrupted by the added
sequences. This can be accomplished by, for example, designing the
open circle probe to have the primer complement sequence include
both 5' and 3' end sequences of the open circle probe.
[0289] The open circle probe can also be inactivated by formation
of the intramolecular stem structure during the amplification
reaction. As long as the end remains in the intramolecular stem
structure, it is not available for priming nucleic acid synthesis.
This form of inactivation is aided by design the intramolecular
stem structure, or selecting amplification conditions, such that
the intramolecular hybrid remains stable during rolling circle
amplification.
[0290] One form of the disclosed open circle probes includes a loop
as part of the intramolecular stem structure. It is preferred that
the loop contain sequences complementary to the target sequence.
This allows the loop to nucleate hybridization of the open probe to
the target sequence. Preferred forms of the loop-containing probes
are characterized by a sequence discrimination capability that is
markedly better that the comparable linear probes due to the
competition between the structural interferences between folding
due to intramolecular stem formation and linear rigidity due to
hybridization of the probe sequence to the target (Tyagi and
Kramer, Nat Biotechnol 14(3):303-8 (1996); Bonnet et al., Proc Natl
Acad Sci U S A 96(11):6171-6 (1999)). Preferred open circle probes
of this type will not hybridize to mismatched sequences under
suitable conditions because duplex hybridization of probe to target
does not effectively compete with intramolecular stem formation of
the structured probe. This makes the end(s) of the open circle
probe involved in an intramolecular stem structure unavailable for
ligation to circularize the probe and leave the 3' end available
for inactivating extension. The presence of target sequence causes
the correctly matched open circle probe to unfold, allowing the
ends to hybridize to the target sequence and be coupled (see FIG.
3). Where sequences in the loop nucleate hybridization of the open
circle probe to a target sequence, loop hybridization to a
non-target sequence is unlikely to lead to circularization of the
open circle probe. This is because it is unlikely that a non-target
sequence will include adjacent sequences to which both the loop and
open circle probe end can hybridize (see FIG. 4).
[0291] A hybridization nucleating loop can also be used in linear
primers used for nucleic acid replication and amplification. Such a
primer forms an intramolecular stem structure, including a loop.
Loop-containing primers of this type will not hybridize to
mismatched sequences under suitable conditions because duplex
hybridization of probe to target does not effectively compete with
intramolecular stem formation of the structured probe. This makes
the end of the primer involved in an intramolecular stem structure
unavailable for priming. The legitimate primer complement sequence
causes the correctly matched primer to unfold, allowing the end to
hybridize to the primer complement sequence and prime synthesis.
Where sequences in the loop nucleate hybridization of the primer,
loop hybridization to an illegitimate sequence is unlikely to lead
to priming. This is because it is unlikely that an illegitimate
sequence will include adjacent sequences to which both the loop and
the primer end can hybridize. Useful primers forming intramolecular
stem structures can be fluorescent change primers. For example,
including proximity-sensitive labels used in molecular beacon
probes in such primers allows hybridization and priming by the
primers to be detected through activation of the label upon
disruption of the intramolecular stem structure (Tyagi and Kramer,
Nat Biotechnol 14(3):303-8 (1996); Bonnet et al., Proc Natl Acad
Sci U S A 96(11):6171-6 (1999)).
[0292] Some forms of the disclosed compositions and method can
involve or produce a combination of the above effects. That is,
nucleic acid amplification reactions can combine two or more of
reduction, prevention, or elimination of artifacts; increased
efficiency; increased specificity; and/or increased consistency.
The disclosed method can combine, for example, the use of open
circle probes that can form intramolecular stem structures; the use
of matched open circle probe sets in the same amplification
reaction; the use of detection primers and detection during the
amplification reaction; the use of a plurality of detection rolling
circle replication primer, a secondary DNA strand displacement
primer and a common rolling circle replication primer in the same
amplification reaction; and/or the use of peptide nucleic acid
quenchers associated with detection rolling circle replication
primers. Such combinations can produce, in the same amplification
reaction, the benefits of each of the combined components.
[0293] The disclosed method is useful for detection, quantitation,
and/or location of any desired analyte. The disclosed method can be
multiplexed to detect numerous different analytes simultaneously or
used in a single assay. Thus, the disclosed method is useful for
detecting, assessing, quantitating, profiling, and/or cataloging
gene expression and the presence of protein in biological samples.
The disclosed method is also particularly useful for detecting and
discriminating single nucleotide differences in nucleic acid
sequences. This specificity is possible due to the sensitivity of
the intramolecular stem structure in loop-containing probes and
primers to mismatches between the loop sequence and a prospective
target sequence. Thus, the disclosed method is useful for extensive
multiplexing of target sequences for sensitive and specific
detection of the target sequences themselves or analytes to which
the target sequences have been associated. The disclosed method is
also useful for detecting, assessing, quantitating, and/or
cataloging single nucleotide polymorphisms, and other sequence
differences between nucleic acids, nucleic acid samples, and
sources of nucleic acid samples.
[0294] The disclosed method is useful for detecting any desired
sequence or other analyte, such as proteins and peptides. In
particular, the disclosed method can be used to localize or amplify
signal from any desired analyte. For example, the disclosed method
can be used to assay tissue, transgenic cells, bacterial or yeast
colonies, cellular material (for example, whole cells, proteins,
DNA fibers, interphase nuclei, or metaphase chromosomes on slides,
arrayed genomic DNA, RNA), and samples and extracts from any of
biological source. Where target sequences are associated with an
analyte, different target sequences, and thus different analytes,
can be sensitively distinguished. Specificity of such detection is
aided by sensitivity of a loop in an open circle probe to
mismatches.
[0295] The disclosed method is applicable to numerous areas
including, but not limited to, analysis of proteins present in a
sample (for example, proteomics analysis), disease detection,
mutation detection, protein expression profiling, RNA expression
profiling, gene discovery, gene mapping (molecular haplotyping),
agricultural research, and virus detection. Preferred uses include
protein and peptide detection in situ in cells, on microarrays,
protein expression profiling; mutation detection; detection of
abnormal proteins or peptides (for example, overexpression of an
oncogene protein or absence of expression of a tumor suppressor
protein); expression in cancer cells; detection of viral proteins
in cells; viral protein expression; detection of inherited diseases
such as cystic fibrosis, muscular dystrophy, diabetes, hemophilia,
sickle cell anemia; assessment of predisposition for cancers such
as prostate cancer, breast cancer, lung cancer, colon cancer,
ovarian cancer, testicular cancer, pancreatic cancer. The disclosed
method can also be used for detection of nucleic acids in situ in
cells, on microarrays, on DNA fibers, and on genomic DNA arrays;
detection of RNA in cells; RNA expression profiling; molecular
haplotyping; mutation detection; detection of abnormal RNA (for
example, overexpression of an oncogene or absence of expression of
a tumor suppressor gene); expression in cancer cells; detection of
viral genome in cells; viral RNA expression; detection of inherited
diseases such as cystic fibrosis, muscular dystrophy, diabetes,
hemophilia, sickle cell anemia; assessment of predisposition for
cancers such as prostate cancer, breast cancer, lung cancer, colon
cancer, ovarian cancer, testicular cancer, pancreatic cancer.
[0296] A. The Ligation Operation
[0297] An open circle probe, optionally in the presence of one or
more gap oligonucleotides, can be incubated with a sample
containing nucleic acids, under suitable hybridization conditions,
and then ligated to form a covalently closed circle. The ligated
open circle probe is a form of amplification target circle. This
operation is similar to ligation of padlock probes described by
Nilsson et al., Science, 265:2085-2088 (1994). The ligation
operation allows subsequent amplification to be dependent on the
presence of a target sequence. Suitable ligases for the ligation
operation are described above. Ligation conditions are generally
known. Most ligases require-Mg.sup.++. There are two main types of
ligases, those that are ATP-dependent and those that are
NAD-dependent. ATP or NAD, depending on the type of ligase, should
be present during ligation.
[0298] The disclosed hairpin open circle probes reduce the
incidence of non-specific ligation of open circle probe ends
because one or both of the ends remain in the intramolecular stem
structure unless hybridized to a target sequence. Loop-containing
open circle probes allow better discrimination of target sequence
hybridization by the open circle probes. As discussed below,
hybridization of sequences in the loop to target sequence can
disrupt the intramolecular stem structure. In the absence of target
sequence, the stem structure remains intact. The disclosed open
circle probes are particularly suited for use in ligation reactions
with multiple different open circle probes and a complex nucleic
acid sample.
[0299] The target sequence for an open circle probe can be any
nucleic acid or other compound to which the target probe portions
of the open circle probe can hybridize in the proper alignment.
Target sequences can be found in any nucleic acid molecule from any
nucleic acid sample. Thus, target sequences can be in nucleic acids
in cell or tissue samples, reactions, and assays. Target sequences
can also be artificial nucleic acids (or other compounds to which
the target probe portions of the open circle probe can hybridize in
the proper alignment). For example, nucleic acid tags can be
associated with various of the disclosed compounds to be detected
using open circle probes. Thus, a reporter binding agent can
contain a target sequence to which an open circle probe can
hybridize. In these cases, the target sequence provides a link
between the target molecule being detected and the amplification of
signal mediated by the open circle probe. When matched open circle
probe sets are used, the target sequences will be related based on
the relationship of the open circle probes in the set.
[0300] When RNA is to be detected, it is preferred that a reverse
transcription operation be performed to make a DNA target sequence.
Alternatively, an RNA target sequence can be detected directly by
using a ligase that can perform ligation on a DNA:RNA hybrid
substrate. A preferred ligase for this is T4 DNA ligase.
[0301] B. The Amplification Operation
[0302] The basic form of amplification operation is rolling circle
replication of a circular DNA molecule (that is, a circularized
open circle probe or an amplification target circle). The circular
open circle probes formed by specific ligation and amplification
target circles serve as substrates for a rolling circle
replication. This reaction requires two reagents: (a) a rolling
circle replication primer, which is complementary to the primer
complement portion of the OCP or ATC, and (b) a rolling circle DNA
polymerase. The DNA polymerase catalyzes primer extension and
strand displacement in a processive rolling circle polymerization
reaction that proceeds as long as desired, generating a molecule of
100,000 nucleotides or more that contains up to approximately 1000
tandem copies or more of a sequence complementary to the
amplification target circle or open circle probe. This tandem
sequence DNA (TS-DNA) consists of, in the case of OCPs, alternating
target sequence and spacer sequence. Note that the spacer sequence
of the TS-DNA is the complement of the sequence between the left
target probe and the right target probe in the original open circle
probe. Some forms of the disclosed method use two types of rolling
circle replication primer (detection rolling circle replication
primers and common rolling circle replication primers) and
secondary DNA strand displacement primers in the amplification
reaction. The use of these different primers provide benefits in
the amplification operation as described elsewhere herein.
[0303] Detection of amplification during the amplification
operation (that is, real-time detection) is desirable. This can be
accomplished in any suitable manner. A particularly useful means of
obtaining real-time detection is the use of fluorescent change
probes and/or primers in the amplification operation. With suitably
designed fluorescent change probes and primers, fluorescent signals
can be generated as amplification proceeds. In most such cases, the
fluorescent signals will be in proportion to the amount of
amplification product and/or amount of target sequence or target
molecule.
[0304] During rolling circle replication one may additionally
include radioactive, or modified nucleotides such as
bromodeoxyuridine triphosphate, in order to label the DNA generated
in the reaction. Alternatively, one may include suitable precursors
that provide a binding moiety such as biotinylated nucleotides
(Langer et al. (1981)). Unmodified TS-DNA can be detected using any
nucleic acid detection technique.
[0305] As well as rolling circle replication, the amplification
operation can include additional nucleic acid replication or
amplification processes. For example, TS-DNA can itself be
replicated to form secondary TS-DNA. This process is referred to as
secondary DNA strand displacement. The combination of rolling
circle replication and secondary DNA strand displacement is
referred to as linear rolling circle amplification (LRCA). The
secondary TS-DNA can itself be replicated to form tertiary TS-DNA
in a process referred to as tertiary DNA strand displacement.
Secondary and tertiary DNA strand displacement can be performed
sequentially or simultaneously. When performed simultaneously, the
result is strand displacement cascade amplification. The
combination of rolling circle replication and strand displacement
cascade amplification is referred to as exponential rolling circle
amplification (ERCA). Secondary TS-DNA, tertiary TS-DNA, or both
can be amplified by transcription. Exponential rolling circle
amplification is a preferred form of amplification operation.
Particularly useful is ERCA mediated by the use of detection
rolling circle replication primers, common rolling circle
replication primers and secondary DNA strand displacement primers
in the amplification reaction.
[0306] After RCA, a round of LM-RCA can be performed on the TS-DNA
produced in the first RCA. This new round of LM-RCA is performed
with a new open circle probe, referred to as a secondary open
circle probe, having target probe portions complementary to a
target sequence in the TS-DNA produced in the first round. When
such new rounds of LM-RCA are performed, the amplification is
referred to as nested LM-RCA. Nested LM-RCA can also be performed
on ligated OCPs or ATCs that have not been amplified. In this case,
LM-RCA can be carried out using either ATCs or target-dependent
ligated OCPs. This is especially useful for in situ detection. For
in situ detection, the first, unamplified OCP, which is
topologically locked to its target sequence, can be subjected to
nested LM-RCA. By not amplifying the first OCP, it can remain
hybridized to the target sequence while LM-RCA amplifies a
secondary OCP topologically locked to the first OCP. Nested LM-RCA
is described in U.S. Pat. No. 6,143,495.
[0307] C. Extension
[0308] The disclosed method can use probes and primers that form
intramolecular stem structures to reduce or eliminate non-specific
and other undesired nucleic acid replication. This is accomplished
by virtue of the probe and primer design (as described elsewhere
herein) and results in "inactivation" of the probes and primer if
they are not involved in legitimate hybrid. Such inactivation
refers to the reduced ability of the probe or primer to hybridize
to sequences other than their intended target sequence. As used
herein, inactivation of probes and primers does not require
complete loss of-non-specific hybridization; reduction in
non-specific hybridization is sufficient.
[0309] The disclosed open circle probes that can form
intramolecular stem structures can be inactivated in several ways.
For example, where the 3' end of an open circle probe is involved
in an intramolecular stem structure, the 3' end can be extended in
a replication reaction using the open circle probe sequences as
template (see FIG. 2B). The result is stabilization of the
intramolecular stem structure and a change in the 3' end sequence.
Stabilization of the stem structure results in a reduction or
elimination of the ability of the open circle probe to prime
nucleic acid synthesis because the 3' end is stably hybridized to
sequences in the open circle probe under the conditions used for
nucleic acid replication. Change in the sequence of the 3' end can
reduce of the ability of the open circle probe to prime nucleic
acid synthesis because the changed 3' sequences may not be as
closely related to sequences involved in the amplification reaction
or assay. Change in the sequence of the 3' end can reduce of the
ability of the open circle probe to serve as a template for rolling
circle amplification. For example, even if the open circle probe
with extended 3' end were circularized, the rolling circle
replication primer could be prevented from priming replication of
such a circle if the primer complement sequence on the open circle
probe were interrupted by the added sequences. This can be
accomplished by, for example, designing the open circle probe to
have the primer complement sequence include both 5' and 3' end
sequences of the open circle probe.
[0310] D. Sequestration
[0311] The disclosed open circle probes that can form
intramolecular stem structures can also be inactivated by formation
of the intramolecular stem structure during the amplification
reaction. As long as the end remains in the intramolecular stem
structure (that is, as long as it is sequestered in the stem
structure), it is not available for priming nucleic acid synthesis.
This form of inactivation is aided by design the intramolecular
stem structure, or selecting amplification conditions, such that
the intramolecular hybrid remains stable during rolling circle
amplification. Extension of the end as described above also results
in sequestration of the end in the intramolecular stem
structure.
[0312] Discrimination of rolling circle replication primer
hybridization also can be accomplished by hybridizing primer to
primer complement portions of OCPs or ATCs under conditions that
favor only exact sequence matches leaving other rolling circle
replication primers unhybridized. The unhybridized rolling circle
replication primers will retain or re-form the intramolecular
hybrid. Discrimination of DNA strand displacement primer
hybridization can be accomplished in a similar manner by
hybridizing primer to TS-DNA under conditions that favor only exact
sequence matches leaving other DNA strand displacement primers
unhybridized.
[0313] E. Loop Hybridization Disruption
[0314] One form of the disclosed open circle probes includes a loop
as part of the intramolecular stem structure. It is preferred that
the loop contain sequences complementary to the target sequence.
This allows the loop to nucleate hybridization of the open probe to
the target sequence. Preferred forms of the loop-containing probes
are characterized by a sequence discrimination capability that is
markedly better that the comparable linear probes due to the
competition between the structural interferences between folding
due to intramolecular stem formation and linear rigidity due to
hybridization of the probe sequence to the target (Tyagi and
Kramer, Nat Biotechnol 14(3):303-8 (1996); Bonnet et al., Proc Natl
Acad Sci U S A 96(11):6171-6 (1999)). Preferred open circle probes
of this type will not hybridize to mismatched sequences under
suitable conditions because duplex hybridization of probe to target
does not effectively compete with intramolecular stem formation of
the structured probe. This makes the end(s) of the open circle
probe involved in an intramolecular stem structure unavailable for
ligation to circularize the probe and leave the 3' end available
for inactivating extension. The presence of target sequence causes
the correctly matched open circle probe to unfold, allowing the
ends to hybridize to the target sequence and be coupled (see FIG.
3). Where sequences in the loop nucleate hybridization of the open
circle probe to a target sequence, loop hybridization to a
non-target sequence is unlikely to lead to circularization of the
open circle probe. This is because it is unlikely that a non-target
sequence will include adjacent sequences to which both the loop and
open circle probe end can hybridize (see FIG. 4).
[0315] A hybridization nucleating loop can also be used in linear
primers used for nucleic acid replication and amplification. Such a
primer forms an intramolecular stem structure, including a loop.
Loop-containing primers of this type will not hybridize to
mismatched sequences under suitable conditions because duplex
hybridization of probe to target does not effectively compete with
intramolecular stem formation of the structured probe. This makes
the end of the primer involved in an intramolecular stem structure
unavailable for priming. The legitimate primer complement sequence
causes the correctly matched primer to unfold, allowing the end to
hybridize to the primer complement sequence and prime synthesis.
Where sequences in the loop nucleate hybridization of the primer,
loop hybridization to an illegitimate sequence is unlikely to lead
to priming. This is because it is unlikely that an illegitimate
sequence will include adjacent sequences to which both the loop and
the primer end can hybridize. Useful primers forming intramolecular
stem structures can be fluorescent change primers. For example,
including proximity-sensitive labels used in molecular beacon
probes in such primers allows hybridization and priming by the
primers to be detected through activation of the label upon
disruption of the intramolecular stem structure (Tyagi and Kramer,
Nat Biotechnol 14(3):303-8 (1996); Bonnet et al., Proc Natl Acad
Sci U S A 96(11):6171-6 (1999)).
[0316] F. DNA Strand Displacement
[0317] DNA strand displacement is one way to amplify TS-DNA.
Secondary DNA strand displacement is accomplished by hybridizing
secondary DNA strand displacement primers to TS-DNA and allowing a
DNA polymerase to synthesize DNA from these primed sites (see FIG.
11 in U.S. Pat. No. 6,143,495). Because a complement of the
secondary DNA strand displacement primer occurs in each repeat of
the TS-DNA, secondary DNA strand displacement can result in a high
level of amplification. The product of secondary DNA strand
displacement is referred to as secondary tandem sequence DNA or
TS-DNA-2. Secondary DNA strand displacement can be accomplished by
performing RCA to produce TS-DNA, mixing secondary DNA strand
displacement primer with the TS-DNA, and incubating under
conditions promoting replication of the tandem sequence DNA. The
disclosed hairpin open circle probes are especially useful for DNA
strand displacement because inactivated hairpin open circle probes
will not compete with secondary DNA strand displacement primers for
hybridization to TS-DNA. The DNA strand displacement primers are
preferably hairpin DNA strand displacement primers.
[0318] Secondary DNA strand displacement can also be carried out
simultaneously with rolling circle replication. This is
accomplished by mixing secondary DNA strand displacement primer
with the reaction prior to rolling circle replication. As a
secondary DNA strand displacement primer is elongated, the DNA
polymerase will run into the 5' end of the next hybridized
secondary DNA strand displacement molecule and will displace its 5'
end. In this fashion a tandem queue of elongating DNA polymerases
is formed on the TS-DNA template. As long as the rolling circle
reaction continues, new secondary DNA strand displacement primers
and new DNA polymerases are added to TS-DNA at the growing end of
the rolling circle. The generation of TS-DNA-2 and its release into
solution by strand displacement is shown diagrammatically in FIG.
11 in U.S. Pat. No. 6,143,495. For simultaneous rolling circle
replication and secondary DNA strand displacement, it is preferred
that the rolling circle DNA polymerase be used for both
replications. This allows optimum conditions to be used and results
in displacement of other strands being synthesized downstream.
Secondary DNA strand displacement can follow any DNA replication
operation, such as RCA, LM-RCA or nested LM-RCA.
[0319] Generally, secondary DNA strand displacement can be
performed by, simultaneous with or following RCA, mixing a
secondary DNA strand displacement primer with the reaction mixture
and incubating under conditions that promote both hybridization
between the tandem sequence DNA and the secondary DNA strand
displacement primer, and replication of the tandem sequence DNA,
where replication of the tandem sequence DNA results in the
formation of secondary tandem sequence DNA.
[0320] When secondary DNA strand displacement is carried out in the
presence of a tertiary DNA strand displacement primer (or an
equivalent primer), an exponential amplification of TS-DNA
sequences takes place. This special and preferred mode of DNA
strand displacement is referred to as strand displacement cascade
amplification (SDCA) and is a form of exponential rolling circle
amplification (ERCA). In SDCA, a secondary DNA strand displacement
primer primes replication of TS-DNA to form TS-DNA-2, as described
above. The tertiary DNA strand displacement primer strand can then
hybridize to, and prime replication of, TS-DNA-2 to form TS-DNA-3.
Strand displacement of TS-DNA-3 by the adjacent, growing TS-DNA-3
strands makes TS-DNA-3 available for hybridization with secondary
DNA strand displacement primer. This results in another round of
replication resulting in TS-DNA-4 (which is equivalent to
TS-DNA-2). TS-DNA-4, in turn, becomes a template for DNA
replication primed by tertiary DNA strand displacement primer. The
cascade continues this manner until the reaction stops or reagents
become limiting. This reaction amplifies DNA at an almost
exponential rate. In a useful mode of SDCA, the rolling circle
replication primers serve as the tertiary DNA strand displacement
primer, thus eliminating the need for a separate primer.
[0321] For this mode, the rolling circle replication primer should
be used at a concentration sufficiently high to obtain rapid
priming on the growing TS-DNA-2 strands. To optimize the efficiency
of SDCA, it is preferred that a sufficient concentration of
secondary DNA strand displacement primer and tertiary DNA strand
displacement primer be used to obtain sufficiently rapid priming of
the growing TS-DNA strand to out compete TS-DNA for binding to its
complementary TS-DNA. Optimization of primer concentrations are
described in U.S. Pat. No. 6,143,495 and can be aided by analysis
of hybridization kinetics (Young and Anderson, "Quantitative
analysis of solution hybridization" in Nucleic Acid Hybridization:
A Practical Approach (IRL Press, 1985) pages 47-71).
[0322] A useful form of strand displacement cascade amplification
uses one or more detection rolling circle replication primers, one
or more common rolling circle replication primers, and one or more
secondary DNA strand displacement primers. Either or both of the
rolling circle replication primers can function as a tertiary DNA
strand displacement primer (they will also function as rolling
circle replication primers).
[0323] Generally, strand displacement cascade amplification can be
performed by, simultaneous with, or following, RCA, mixing a
secondary DNA strand displacement primer and a tertiary DNA strand
displacement primer with the reaction mixture and incubating under
conditions that promote hybridization between the tandem sequence
DNA and the secondary DNA strand displacement primer, replication
of the tandem sequence DNA--where replication of the tandem
sequence DNA results in the formation of secondary tandem sequence
DNA hybridization between the secondary tandem sequence DNA and the
tertiary DNA strand displacement primer, and replication of
secondary tandem sequence DNA--where replication of the secondary
tandem sequence DNA results in formation of tertiary tandem
sequence DNA (TS-DNA-3).
[0324] Secondary and tertiary DNA strand displacement can also be
carried out sequentially. Following a first round of secondary DNA
strand displacement, a tertiary DNA strand displacement primer can
be mixed with the secondary tandem sequence DNA and incubated under
conditions that promote hybridization between the secondary tandem
sequence DNA and the tertiary DNA strand displacement primer, and
replication of secondary tandem sequence DNA, where replication of
the secondary tandem sequence DNA results in formation of tertiary
tandem sequence DNA (TS-DNA-3). This round of strand displacement
replication can be referred to as tertiary DNA strand displacement.
However, all rounds of strand displacement replication following
rolling circle replication can also be referred to collectively as
DNA strand displacement or secondary DNA strand displacement.
[0325] A modified form of secondary DNA strand displacement results
in amplification of TS-DNA and is referred to as opposite strand
amplification (OSA). OSA is the same as secondary DNA strand
displacement except that a special form of rolling circle
replication primer is used that prevents it from hybridizing to
TS-DNA-2. Opposite strand amplification is described in U.S. Pat.
No. 6,143,495.
[0326] The DNA generated by DNA strand displacement can be labeled
and/or detected using the same labels, labeling methods, and
detection methods described for use with TS-DNA. Most of these
labels and methods are adaptable for use with nucleic acids in
general. A preferred method of labeling the DNA is by incorporation
of labeled nucleotides during synthesis.
[0327] G. Detection of Amplification Products
[0328] Products of the amplification operation can be detected
using any nucleic acid detection technique. Many techniques are
known for detecting nucleic acids. Several preferred forms of
detection are described below. The nucleotide sequence of the
amplified sequences also can be determined using any suitable
technique. Particularly useful are techniques for real-time
detection of amplification. Fluorescent change probes and primers
are useful for detection in general and real-time detection in
particular.
[0329] 1. Primary Labeling
[0330] Primary labeling consists of incorporating labeled moieties,
such as fluorescent nucleotides, biotinylated nucleotides,
digoxygenin-containing nucleotides, or bromodeoxyuridine, during
rolling circle replication in RCA, or during transcription in RCT.
For example, one may incorporate cyanine dye UTP analogs (Yu et al.
(1994)) at a frequency of 4 analogs for every 100 nucleotides. A
preferred method for detecting nucleic acid amplified in situ is to
label the DNA during amplification with BrdUrd, followed by binding
of the incorporated BUDR with a biotinylated anti-BUDR antibody
(Zymed Labs, San Francisco, Calif.), followed by binding of the
biotin moieties with Streptavidin-Peroxidase (Life Sciences, Inc.),
and finally development of fluorescence with Fluorescein-tyramide
(DuPont de Nemours & Co., Medical Products Dept.).
[0331] A useful form of primary labeling is the use of fluorescent
change primers in the amplification operation. Fluorescent change
primers exhibit a change in fluorescence intensity or wavelength
based on a change in the form of conformation of the primer and the
amplified nucleic acid. Stem quenched primers are primers that when
not hybridized to a complementary sequence form a stem structure
(either an intramolecular stem structure or an intermolecular stem
structure) that brings a fluorescent label and a quenching moiety
into proximity such that fluorescence from the label is quenched.
When the primer binds to a complementary sequence, the stem is
disrupted, the quenching moiety is no longer in proximity to the
fluorescent label and fluorescence increases. In the disclosed
method, stem quenched primers are used as primers for nucleic acid
synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of stem quenched primers are
peptide nucleic acid quenched primers and hairpin quenched
primers.
[0332] Peptide nucleic acid quenched primers are primers associated
with a peptide nucleic acid quencher or a peptide nucleic acid
fluor to form a stem structure. The primer contains a fluorescent
label or a quenching moiety and is associated with either a peptide
nucleic acid quencher or a peptide nucleic acid fluor,
respectively. This puts the fluorescent label in proximity to the
quenching moiety. When the primer is replicated, the peptide
nucleic acid is displaced, thus allowing the fluorescent label to
produce a fluorescent signal.
[0333] Hairpin quenched primers are primers that when not
hybridized to a complementary sequence form a hairpin structure
(and, typically, a loop) that brings a fluorescent label and a
quenching moiety into proximity such that fluorescence from the
label is quenched. When the primer binds to a complementary
sequence, the stem is disrupted, the quenching moiety is no longer
in proximity to the fluorescent label and fluorescence increases.
Hairpin quenched primers are typically used as primers for nucleic
acid synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of hairpin quenched primers are
Amplifluor primers and scorpion primers.
[0334] 2. Secondary Labeling
[0335] Secondary labeling consists of using suitable molecular
probes, such as detection probes, to detect the amplified nucleic
acids. For example, an open circle may be designed to contain
several repeats of a known arbitrary sequence, referred to as
detection tags. A secondary hybridization step can be used to bind
detection probes to these detection tags (see FIG. 7 in U.S. Pat.
No. 6,143,495). The detection probes may be labeled as described
above with, for example, an enzyme, fluorescent moieties, or
radioactive isotopes. By using three detection tags per open circle
probe, and four fluorescent moieties per each detection probe, one
may obtain a total of twelve fluorescent signals for every open
circle probe repeat in the TS-DNA, yielding a total of 12,000
fluorescent moieties for every ligated open circle probe that is
amplified by RCA.
[0336] A useful form of secondary labeling is the use of
fluorescent change probes and primers in or following the
amplification operation. Hairpin quenched probes are probes that
when not bound to a target sequence form a hairpin structure (and,
typically, a loop) that brings a fluorescent label and a quenching
moiety into proximity such that fluorescence from the label is
quenched. When the probe binds to a target sequence, the stem is
disrupted, the quenching moiety is no longer in proximity to the
fluorescent label and fluorescence increases. Examples of hairpin
quenched probes are molecular beacons, fluorescent triplex oligos,
and QPNA probes.
[0337] Cleavage activated probes are probes where fluorescence is
increased by cleavage of the probe. Cleavage activated probes can
include a fluorescent label and a quenching moiety in proximity
such that fluorescence from the label is quenched. When the probe
is clipped or digested (typically by the 5'-3' exonuclease activity
of a polymerase during or following amplification), the quenching
moiety is no longer in proximity to the fluorescent label and
fluorescence increases. TaqMan probes are an example of cleavage
activated probes.
[0338] Cleavage quenched probes are probes where fluorescence is
decreased or altered by cleavage of the probe. Cleavage quenched
probes can include an acceptor fluorescent label and a donor moiety
such that, when the acceptor and donor are in proximity,
fluorescence resonance energy transfer from the donor to the
acceptor causes the acceptor to fluoresce. The probes are thus
fluorescent, for example, when hybridized to a target sequence.
When the probe is clipped or digested (typically by the 5'-3'
exonuclease activity of a polymerase during or after
amplification), the donor moiety is no longer in proximity to the
acceptor fluorescent label and fluorescence from the acceptor
decreases. If the donor moiety is itself a fluorescent label, it
can release energy as fluorescence (typically at a different
wavelength than the fluorescence of the acceptor) when not in
proximity to an acceptor. The overall effect would then be a
reduction of acceptor fluorescence and an increase in donor
fluorescence. Donor fluorescence in the case of cleavage quenched
probes is equivalent to fluorescence generated by cleavage
activated probes with the acceptor being the quenching moiety and
the donor being the fluorescent label. Cleavable FRET (fluorescence
resonance energy transfer) probes are an example of cleavage
quenched probes.
[0339] Fluorescent activated probes are probes or pairs of probes
where fluorescence is increased or altered by hybridization of the
probe to a target sequence. Fluorescent activated probes can
include an acceptor fluorescent label and a donor moiety such that,
when the acceptor and donor are in proximity (when the probes are
hybridized to a target sequence), fluorescence resonance energy
transfer from the donor to the acceptor causes the acceptor to
fluoresce. Fluorescent activated probes are typically pairs of
probes designed to hybridize to adjacent sequences such that the
acceptor and donor are brought into proximity. Fluorescent
activated probes can also be single probes containing both a donor
and acceptor where, when the probe is not hybridized to a target
sequence, the donor and acceptor are not in proximity but where the
donor and acceptor are brought into proximity when the probe
hybridized to a target sequence. This can be accomplished, for
example, by placing the donor and acceptor on opposite ends a the
probe and placing target complement sequences at each end of the
probe where the target complement sequences are complementary to
adjacent sequences in a target sequence. If the donor moiety of a
fluorescent activated probe is itself a fluorescent label, it can
release energy as fluorescence (typically at a different wavelength
than the fluorescence of the acceptor) when not in proximity to an
acceptor (that is, when the probes are not hybridized to the target
sequence). When the probes hybridize to a target sequence, the
overall effect would then be a reduction of donor fluorescence and
an increase in acceptor fluorescence. FRET probes are an example of
fluorescent activated probes. Stem quenched primers (such as
peptide nucleic acid quenched primers and hairpin quenched primers)
can be used as secondary labels.
[0340] 3. Multiplexing and Hybridization Array Detection
[0341] RCA is easily multiplexed by using sets of different open
circle probes, each open circle probe carrying different target
probe sequences designed for binding to unique targets and,
optionally, each open circle probe having a different detection
primer complement portion corresponding to different detection
rolling circle replication primers. Note that although the target
probe sequences designed for each target and the detection primer
complement portions are different, the common primer complement
portions and secondary DNA strand displacement primer matching
portions may remain the same for all of the open circle probes, and
thus some of the primers for rolling circle amplification can
remain the same for all targets. Only those open circle probes that
are able to find their targets will give rise to TS-DNA. Use of
different fluorescent labels with different detection rolling
circle replication primers allows specific detection of different
open circle probes (and thus, of different targets).
[0342] The TS-DNA molecules generated by RCA are of high molecular
weight and low complexity; the complexity being the length of the
open circle probe. There are two alternatives for capturing a given
TS-DNA to a fixed position in a solid-state detector. One is to
include within the spacer region of the open circle probes a unique
address tag sequence for each unique open circle probe. TS-DNA
generated from a given open circle probe will then contain
sequences corresponding to a specific address tag sequence. A
second and preferred alternative is to use the target sequence
present on the TS-DNA as the address tag.
[0343] 4. Combinatorial Multicolor Coding
[0344] One form of multiplex detection involves the use of a
combination of labels that either fluoresce at different
wavelengths or are colored differently. One of the advantages of
fluorescence for the detection of hybridization probes is that
several targets can be visualized simultaneously in the same
sample. Using a combinatorial strategy, many more targets can be
discriminated than the number of spectrally resolvable
fluorophores. Combinatorial labeling provides the simplest way to
label probes in a multiplex fashion since a probe fluor is either
completely absent (-) or present in unit amounts (+); image
analysis is thus more amenable to automation, and a number of
experimental artifacts, such as differential photobleaching of the
fluors and the effects of changing excitation source power
spectrum, arc avoided.
[0345] The combinations of labels establish a code for identifying
different detection probes and, by extension, different target
molecules to which those detection probes are associated with. This
labeling scheme is referred to as Combinatorial Multicolor Coding
(CMC). Such coding is described by Speicher et al., Nature Genetics
12:368-375 (1996). Use of CMC in connection with rolling circle
amplification is described in U.S. Pat. No. 6,143,495. Any number
of labels, which when combined can be separately detected, can be
used for combinatorial multicolor coding. It is preferred that 2,
3, 4, 5, or 6 labels be used in combination. It is most preferred
that 6 labels be used. The number of labels used establishes the
number of unique label combinations that can be formed according to
the formula 2.sup.N-1, where N is the number of labels. According
to this formula, 2 labels forms three label combinations, 3 labels
forms seven label combinations, 4 labels forms 15 label
combinations, 5 labels form 31 label combinations, and 6 labels
forms 63 label combinations.
[0346] For combinatorial multicolor coding, a group of different
detection probes are used as a set. Each type of detection probe in
the set is labeled with a specific and unique combination of
fluorescent labels. For those detection probes assigned multiple
labels, the labeling can be accomplished by labeling each detection
probe molecule with all of the required labels. Alternatively,
pools of detection probes of a given type can each be labeled with
one of the required labels. By combining the pools, the detection
probes will, as a group, contain the combination of labels required
for that type of detection probe. Where each detection probe is
labeled with a single label, label combinations can also be
generated by using OCPs or ATCs with coded combinations of
detection tags complementary to the different detection probes. In
this scheme, the OCPs or ATCs will contain a combination of
detection tags representing the combination of labels required for
a specific label code. Further illustrations are described in U.S.
Pat. No. 6,143,495.
[0347] Rolling circle amplification can be engineered to produce
TS-DNA of different lengths in an assay involving multiple ligated
OCPs or ATCs. The resulting TS-DNA of different length can be
distinguished simply on the basis of the size of the detection
signal they generate. Thus, the same set of detection probes could
be used to distinguish two different sets of generated TS-DNA. In
this scheme, two different TS-DNAs, each of a different size but
assigned the same color code, would be distinguished by the size of
the signal produced by the hybridized detection probes. In this
way, a total of 126 different targets can be distinguished on a
single solid-state sample using a code with 63 combinations, since
the signals will come in two flavors, low amplitude and high
amplitude. Thus one could, for example, use the low amplitude
signal set of 63 probes for detection of an oncogene mutations, and
the high amplitude signal set of 63 probes for the detection of a
tumor suppressor p53 mutations.
[0348] Speicher et al. describes a set of fluors and corresponding
optical filters spaced across the spectral interval 350-770 nm that
give a high degree of discrimination between all possible fluor
pairs. This fluor set, which is preferred for combinatorial
multicolor coding, consists of 4'-6-diamidino-2-phenylinodole
(DAPI), fluorescein (FITC), and the cyanine dyes Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. Any subset of this preferred set can also be used
where fewer combinations are required. The absorption and emission
maxima, respectively, for these fluors are: DAPI (350 nm; 456 nm),
FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588
nm), Cy5 (652 nm; 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm;
778 nm). The excitation and emission spectra, extinction
coefficients and quantum yield of these fluors are described by
Ernst et al., Cytometry 10:3-10 (1989), Mujumdar et al., Cytometry
10:11-19 (1989), Yu, Nucleic Acids Res. 22:3226-3232 (1994), and
Waggoner, Meth. Enzymology 246:362-373 (1995). These fluors can all
be excited with a 75W Xenon arc.
[0349] To attain selectivity, filters with bandwidths in the range
of 5 to 16 nm are preferred. To increase signal discrimination, the
fluors can be both excited and detected at wavelengths far from
their spectral maxima. Emission bandwidths can be made as wide as
possible. For low-noise detectors, such as cooled CCD cameras,
restricting the excitation bandwidth has little effect on
attainable signal to noise ratios. A list of preferred filters for
use with the preferred fluor set is listed in Table 1 of Speicher
et al. It is important to prevent infra-red light emitted by the
arc lamp from reaching the detector; CCD chips are extremely
sensitive in this region. For this purpose, appropriate IR blocking
filters can be inserted in the image path immediately in front of
the CCD window to minimize loss of image quality. Image analysis
software can then be used to count and analyze the spectral
signatures of fluorescent dots.
[0350] Discrimination of individual signals in combinatorial
multicolor coding can be enhanced by collapsing TS-DNA generated
during amplification. As described elsewhere herein, this is
preferably accomplished using collapsing detection probes,
biotin-antibody conjugates, or a combination of both. A collapsed
TS-DNA can occupy a space of no more than 0.3 microns in diameter.
Based on this, it is expected that up to a million discrete signals
can be detected in a 2.5 mm sample dot. Such discrimination also
results in a large dynamic range for quantitative signal detection.
Thus, the relative numbers of different types of signals (such as
multicolor codes) can be determined over a wide range. This is
expected to allow determination of, for example, the relative
amount of different target molecules, such as proteins, in a
sample. Such comparative detections would be useful in, for
example, proteomics analyses of cell and tissue samples. This would
also allow determination of whether a particular target sequence is
homozygous or heterozygous in a genomic DNA sample, whether a
target sequence was inherited or represents a somatic mutation, and
the genetic heterogeneity of a genomic DNA sample, such as a tumor
sample.
[0351] 5. Detecting Multiple Target Sequences
[0352] Multiplex RCA assays are useful for detecting multiple
proteins. A single LM-RCA assay can be used to detect the presence
of one or more members of a group of any number of target
sequences. By associating different target sequences with different
proteins (using reporter binding agents specific for the proteins
of interest), each different protein can be detected by
differential detection of the various target sequences. This can be
accomplished, for example, by designing an open circle probe (and
associated gap oligonucleotides, if desired) for each target
sequence in the group, where the target probe portions and the
detection primer complement portions of each open circle probe are
different but the sequence of the common primer complement portions
and secondary DNA strand displacement matching portions of all the
open circle probes are the same. All of the open circle probes are
placed in the same OCP-target sample mixture, and the same primers
are used to amplify. For each target sequence present in the assay
(those associated with proteins present in the target sample, for
example), the OCP for that target will be ligated into a circle and
the circle will be amplified to form TS-DNA. Since the detection
primer complement portions are different, amplification of the
different OCPs can be detected (using, for example, detection
rolling circle replication primers that are fluorescent change
primers). Alternatively, the open circle probes can each target a
different target sequence in the group, where the target probe
portions and the sequence of the detection tag portions of each
open circle probe are different but the sequence of the primer
portions of all the open circle probes are the same. Different
detection probes are used to detect the various TS-DNAs (each
having specific detection tag sequences). For each target sequence
present in the assay (those associated with proteins present in the
target sample, for example), the OCP for that target will be
ligated into a circle and the circle will be amplified to form
TS-DNA. Since the detection tags on TS-DNA resulting from
amplification of the OCPs are the different, TS-DNA resulting from
ligation each OCP can be detected individually in that assay.
[0353] 6. Detecting Groups of Target Sequences
[0354] Multiplex RCA assays are particularly useful for detecting
any of a set of target sequences in a defined group. For example,
the disclosed method can be used to detect mutations in genes where
numerous distinct mutations are associated with certain diseases or
where mutations in multiple genes are involved. For example,
although the gene responsible for Huntington's chorea has been
identified, a wide range of mutations in different parts of the
gene occur among affected individuals. The result is that no single
test has been devised to detect whether an individual has one or
more of the many Huntington's mutations. A single LM-RCA assay can
be used to detect the presence of one or more members of a group of
any number of target sequences. This can be accomplished, for
example, by designing an open circle probe (and associated gap
oligonucleotides, if desired) for each target sequence in the
group, where the target probe portions of each open circle probe
are different but the sequence of the primer complement portions
and secondary DNA strand displacement primer matching portions of
all the open circle probes are the same. All of the open circle
probes are placed in the same OCP-target sample mixture, and the
same primers are used to amplify and detect TS-DNA. If any of the
target sequences are present in the target sample, the OCP for that
target will be ligated into a circle and the circle will be
amplified to form TS-DNA. Since the detection rolling circle
replication primers (preferably using fluorescent change primers)
for all of the OCPs are the same, TS-DNA resulting from ligation of
any of the OCPs will be detected in that assay. Detection indicates
that at least one member of the target sequence group is present in
the target sample. This allows detection of a trait associated with
multiple target sequences in a single tube or well.
[0355] If a positive result is found, the specific target sequence
involved can be identified by using a multiplex assay. This can be
facilitated by including different detection tags in each of the
OCPs of the group. In this way, TS-DNA generated from each
different OCP, representing each different target sequence, can be
individually detected. It is convenient that such multiple assays
need be performed only when an initial positive result is
found.
[0356] The above scheme can also be used with arbitrarily chosen
groups of target sequences in order to screen for a large number of
target sequences without having to perform an equally large number
of assays. Initial assays can be performed as described above, each
using a different group of OCPs designed to hybridize to a
different group of target sequences. Additional assays to determine
which target sequence is present can then be performed on only
those groups that produce TS-DNA. Such group assays can be further
nested if desired.
[0357] Multiplex detection can also be accomplished by designing an
open circle probe (and associated gap oligonucleotides, if desired)
for each target sequence in the group, where the target probe
portions of each open circle probe are different but the sequence
of the primer portions and the sequence of the detection tag
portions of all the open circle probes are the same. All of the
open circle probes are placed in the same OCP-target sample
mixture, and the same primer and detection probe are used to
amplify and detect TS-DNA. If any of the target sequences are
present in the target sample, the OCP for that target will be
ligated into a circle and the circle will be amplified to form
TS-DNA. Since the detection tags on TS-DNA resulting from
amplification of any of the OCPs are the same, TS-DNA resulting
from ligation of any of the OCPs will be detected in that assay.
Detection indicates that at least one member of the target sequence
group is present in the target sample. This allows detection of a
trait associated with multiple target sequences in a single tube or
well.
[0358] If a positive result is found, the specific target sequence
involved can be identified by using a multiplex assay. This can be
facilitated by including an additional, different detection tag in
each of the OCPs of the group. In this way, TS-DNA generated from
each different OCP, representing each different target sequence,
can be individually detected. It is convenient that such multiple
assays need be performed only when an initial positive result is
found.
[0359] 7. In Situ Detection Using RCA
[0360] In situ detection of target sequences is a powerful
application of the disclosed method. For example, open circle
probes can be ligated on targets immobilized on a substrate, and
incubated in situ with fluorescent precursors during rolling circle
replication. The circle will remain topologically trapped on the
chromosome unless the DNA is nicked (Nilsson et al. (1994)). The
resulting TS-DNA will then be associated with the location of the
target sequence.
[0361] A useful method of in situ detection uses reporter binding
agents having target sequences as the oligonucleotide portion. In
this form of the method, reporter binding agents having target
sequences as the oligonucleotide portion are associated with target
molecules (such as proteins) that are immobilized or otherwise
attached to a substrate. Once the reporter binding agent is
associated with a target molecule, an open circle probe is
hybridized to the target sequence of the reporter binding agent and
circularized. The circularized open circle probe is then amplified.
The resulting TS-DNA is associated with the site of the target
molecule via the open circle probe and reporter binding agent.
[0362] Localization of the TS-DNA for in situ detection can also be
enhanced by collapsing the TS-DNA using collapsing detection
probes, biotin-antibody conjugates, or both, as described elsewhere
herein. Multiplexed in situ detection can be carried out as
follows: Rolling circle replication can be carried out using
different detection rolling circle replication primers and the same
common rolling circle replication primer and secondary DNA strand
displacement primer. Detection of different detection rolling
circle replication primers (such as by real-time detection using
fluorescent change primers) identifies the different targets.
Alternatively, rolling circle replication is carried out using
unlabeled nucleotides. The different TS-DNAs are then detected
using standard multi-color FISH with detection probes specific for
each unique target sequence or each unique detection tag in the
TS-DNA. Alternatively, and preferably, combinatorial multicolor
coding, as described above, can be used for multiplex in situ
detection.
[0363] Another method of in situ detection uses reporter binding
agents having rolling circle replication primers as the
oligonucleotide portion (this is referred to as Reporter Binding
Agent Unimolecular Rolling Amplification (RBAURA) in U.S. Pat. No.
6,143,495). In RBAURA, a reporter binding agent is used where the
oligonucleotide portion serves as a rolling circle replication
primer. Once the reporter binding agent is associated with a target
molecule, an amplification target circle is hybridized to the
rolling circle replication primer sequence of the reporter binding
agent followed by amplification of the ATC by RCA. The resulting
TS-DNA has the rolling circle replication primer sequence of the
reporter binding agent at one end, thus anchoring the TS-DNA to the
site of the target molecule. The rolling circle replication primer
sequence can be configured as a fluorescent change primer. Common
rolling circle replication primers and secondary DNA strand
displacement primers can be used in this form of the method as
well. Peptide Nucleic Acid Probe Unimolecular Rolling Amplification
(PNAPURA) and Locked Antibody Unimolecular Rolling Amplification
(LAURA), described in U.S. Pat. No. 6,143,495, are useful forms of
RBAURA and can be adapted to the disclosed method.
[0364] 8. Enzyme-Linked Detection
[0365] Amplified nucleic acid labeled by incorporation of labeled
nucleotides can be detected with established enzyme-linked
detection systems. For example, amplified nucleic acid labeled by
incorporation of biotin-16-UTP (Boehringher Mannheim) can be
detected as follows. The nucleic acid is immobilized on a solid
glass surface by hybridization with a complementary DNA
oligonucleotide (address probe) complementary to the target
sequence (or its complement) present in the amplified nucleic acid.
After hybridization, the glass slide is washed and contacted with
alkaline phosphatase-streptavidin conjugate (Tropix, Inc., Bedford,
Mass.). This enzyme-streptavidin conjugate binds to the biotin
moieties on the amplified nucleic acid. The slide is again washed
to remove excess enzyme conjugate and the chemiluminescent
substrate CSPD (Tropix, Inc.) is added and covered with a glass
cover slip. The slide can then be imaged in a Biorad
Fluorimager.
[0366] 9. Collapse of Nucleic Acids
[0367] Tandem sequence DNA or TS-RNA, which are produced as
extended nucleic acid molecules, can be collapsed into a compact
structure. It is preferred that the nucleic acid to be collapsed is
immobilized on a substrate. A useful means of collapsing nucleic
acids is by hybridizing one or more collapsing probes with the
nucleic acid to be collapsed. Collapsing probes are
oligonucleotides having a plurality of portions each complementary
to sequences in the nucleic acid to be collapsed. These portions
are referred to as complementary portions of the collapsing probe,
where each complementary portion is complementary to a sequence in
the nucleic acid to be collapsed. The sequences in the nucleic acid
to be collapsed are referred to as collapsing target sequences. The
complementary portion of a collapsing probe can be any length that
supports specific and stable hybridization between the collapsing
probe and the collapsing target sequence. For this purpose, a
length of 10 to 35 nucleotides is preferred, with a complementary
portion of a collapsing probe 16 to 20 nucleotides long being most
preferred. It is preferred that at least two of the complementary
portions of a collapsing probe be complementary to collapsing
target sequences which are separated on the nucleic acid to be
collapsed or to collapsing target sequences present in separate
nucleic acid molecules. This allows each detection probe to
hybridize to at least two separate collapsing target sequences in
the nucleic acid sample. In this way, the collapsing probe forms a
bridge between different parts of the nucleic acid to be collapsed.
The combined action of numerous collapsing probes hybridizing to
the nucleic acid will be to form a collapsed network of
cross-linked nucleic acid. Collapsed nucleic acid occupies a much
smaller volume than free, extended nucleic acid, and includes
whatever detection probe or detection label hybridized to the
nucleic acid. This result is a compact and discrete nucleic acid
structure which can be more easily detected than extended nucleic
acid. Collapsing nucleic acids is useful both for in situ
hybridization applications and for multiplex detection because it
allows detectable signals to be spatially separate even when
closely packed. Collapsing nucleic acids is especially useful for
use with combinatorial multicolor coding. Collapsing probes can
also contain any of the detection labels described above.
Collapsing probes can also be fluorescent change probes. TS-DNA
collapse can also be accomplished through the use of ligand/ligand
binding pairs (such as biotin and avidin) or hapten/antibody pairs.
Nucleic acid collapse is further described in U.S. Pat. No.
6,143,495.
[0368] H. Reporter Binding Agents with Target Sequences
[0369] A useful form of the disclosed method uses reporter binding
agents having target sequences as the oligonucleotide portion. The
oligonucleotide portion of the reporter binding agent serves as a
target sequence. The affinity portion of the reporter binding agent
is a specific binding molecule specific for a target molecule of
interest, such as proteins or peptides. The reporter binding agent
is associated with the target molecule and detection of this
interaction is mediated by rolling circle amplification. Unbound
reporter binding agents can be removed by washing. Once the
reporter binding agent is associated with a target molecule, a open
circle probe is hybridized to the target sequence of the reporter
binding agent, ligated, and amplified. The resulting TS-DNA is
associated with the ligated open circle probe, thus associating the
TS-DNA to the site of the target molecule.
[0370] Reporter binding agents are preferably used with a
solid-state substrate and in combination with combinatorial
multicolor coding. For this purpose, samples to be tested are
incorporated into a solid-state sample, as described above. The
solid-state substrate is preferably a glass slide and the
solid-state sample preferably incorporates up to 256 individual
target or assay samples arranged in dots. Multiple solid-state
samples can be used to either test more individual samples, or to
increase the number of distinct target sequences to be detected. In
the later case, each solid-state sample has an identical set of
samples dots, and the assay will be carried out using a different
set of reporter binding agents and open circle probes, collectively
referred to as a probe set, for each solid-state sample. This
allows a large number of individuals and target sequences to be
assayed in a single assay. By using up to six different labels,
combinatorial multicolor coding allows up to 63 distinct targets to
be detected on a single solid-state sample. When using multiple
solid-state substrates and performing RCA with a different set of
reporter binding agents and open circle probes for each solid-state
substrate, the same labels can be used with each solid-state sample
(although differences between OCPs in each set may require the use
of different detection probes). For example, 10 replica slides,
each with 256 target sample dots, can be subjected to RCA using 10
different sets of reporter binding agents and open circle probes,
where each set is designed for combinatorial multicolor coding of
63 targets. This results in an assay for detection of 630 different
target molecules.
[0371] After rolling circle amplification, a cocktail of detection
probes is added, where the cocktail contains color combinations
that are specific for each OCP. The design and combination of such
detection probes for use in combinatorial multicolor coding is
described elsewhere herein. It is preferred that the OCPs be
designed with combinatorially coded detection tags to allow use of
a single set of singly labeled detection probes. It is also
preferred that collapsing detection probes be used.
[0372] I. Transcription Following RCA
[0373] Once TS-DNA is generated using RCA, further amplification
can be accomplished by transcribing the TS-DNA from promoters
embedded in the TS-DNA. This combined process, referred to as
rolling circle replication with transcription (RCT), or ligation
mediated rolling circle replication with transcription (LM-RCT),
requires that the OCP or ATC from which the TS-DNA is made have a
promoter portion in its spacer region. The promoter portion is then
amplified along with the rest of the OCP or ATC resulting in a
promoter embedded in each tandem repeat of the TS-DNA. Because
transcription, like rolling circle amplification, is a process that
can go on continuously (with re-initiation), multiple transcripts
can be produced from each of the multiple promoters present in the
TS-DNA. RCT effectively adds another level of amplification of
ligated OCP sequences.
[0374] Generally, RCT can be accomplished by performing RCA to
produce TS-DNA, and then mixing RNA polymerase with the reaction
mixture and incubating under conditions promoting transcription of
the tandem sequence DNA. The OCP or ATC must include the sequence
of a promoter for the RNA polymerase (a promoter portion) in its
spacer region for RCT to work. The transcription step in RCT
generally can be performed using established conditions for in
vitro transcription of the particular RNA polymerase used.
Alternatively, transcription can be carried out simultaneously with
rolling circle replication. This is accomplished by mixing RNA
polymerase with the reaction mixture prior to rolling circle
replication. Transcription can follow any DNA replication
operation, such as RCA, LM-RCA, nested LM-RCA, DNA strand
displacement, or strand displacement cascade amplification.
[0375] The transcripts generated in RCT can be labeled and/or
detected using the same labels, labeling methods, and detection
methods described for use with TS-DNA. Most of these labels and
methods are adaptable for use with nucleic acids in general. A
preferred method of labeling RCT transcripts is by direct labeling
of the transcripts by incorporation of labeled nucleotides, most
preferably biotinylated nucleotides, during transcription.
[0376] J. Gap-Filling Ligation
[0377] The gap space formed by an OCP hybridized to a target
sequence is normally occupied by one or more gap oligonucleotides
as described above. Such a gap space may also be filled in by a
gap-filling DNA polymerase during the ligation operation. As an
alternative, the gap space can be partially bridged by one or more
gap oligonucleotides, with the remainder of the gap filled using
DNA polymerase. This modified ligation operation is referred to
herein as gap-filling ligation and is a preferred form of the
ligation operation. The principles and procedure for gap-filling
ligation are generally analogous to the filling and ligation
performed in gap LCR (Wiedmann et al., PCR Methods and Applications
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor
Laboratory, NY, 1994) pages S51-S64; Abravaya et al., Nucleic Acids
Res., 23(4):675-682 (1995); European Patent Application EP0439182
(1991)). In the case of LM-RCA, the gap-filling ligation operation
is substituted for the normal ligation operation. Gap-filling
ligation provides a means for discriminating between closely
related target sequences. Gap-filling ligation can be accomplished
by using a different DNA polymerase, referred to herein as a
gap-filling DNA polymerase. Suitable gap-filling DNA polymerases
are described above. Alternatively, DNA polymerases in general can
be used to fill the gap when a stop base is used. The use of stop
bases in the gap-filling operation of LCR is described in European
Patent Application EP0439182. The principles of the design of gaps
and the ends of flanking probes to be joined, as described in
EP0439182, is generally applicable to the design of the gap spaces
and the ends of target probe portions described herein. Gap-filling
ligation is further described in U.S. Pat. No. 6,143,495.
[0378] K. Reporter Binding Agent Unimolecular Rolling
Amplification
[0379] Reporter Binding Agent Unimolecular Rolling Amplification
(RBAURA) is a form of RCA where a reporter binding agent provides
the rolling circle replication primer for amplification of an
amplification target circle. In RBAURA, the oligonucleotide portion
of the reporter binding agent serves as a rolling circle
replication primer. The rolling circle replication primer can be a
hairpin rolling circle replication primer. RBAURA allows RCA to
produce an amplified signal (that is, TS-DNA) based on association
of the reporter binding agent to a target molecule. The specific
primer sequence that is a part of the reporter binding agent
provides the link between the specific interaction of the reporter
binding agent to a target molecule (via the affinity portion of the
reporter binding agent) and RCA. In RBAURA, once the reporter
binding agent is associated with a target molecule, an
amplification target circle is hybridized to the rolling circle
replication primer sequence of the reporter binding agent, followed
by amplification of the ATC by RCA. The resulting TS-DNA
incorporates the rolling circle replication primer sequence of the
reporter binding agent at one end, thus anchoring the TS-DNA to the
site of the target molecule. RBAURA is a preferred RCA method for
in situ detections. For this purpose, it is preferred that the
TS-DNA is collapsed using collapsing detection probes,
biotin-antibody conjugates, or both, as described above. RBAURA can
be performed using any target molecule. Preferred target molecules
are nucleic acids, including amplified nucleic acids such as TS-DNA
and amplification target circles, antigens and ligands. Examples of
the use of such target molecules are described in U.S. Pat. No.
6,143,495. Peptide Nucleic Acid Probe Unimolecular Rolling
Amplification (PNAPURA) and Locked Antibody Unimolecular Rolling
Amplification (LAURA), described in U.S. Pat. No. 6,143,495, are
preferred forms of RBAURA.
[0380] L. Discrimination Between Closely Related Target
Sequences
[0381] Open circle probes, gap oligonucleotides, and gap spaces can
be designed to discriminate closely related target sequences, such
as genetic alleles. Where closely related target sequences differ
at a single nucleotide, it is preferred that open circle probes be
designed with the complement of this nucleotide occurring at one
end of the open circle probe, or at one of the ends of the gap
oligonucleotide(s). Where gap-filling ligation is used, it is
preferred that the distinguishing nucleotide appear opposite the
gap space. This allows incorporation of alternative (that is,
allelic) sequence into the ligated OCP without the need for
alternative gap oligonucleotides. Where gap-filling ligation is
used with a gap oligonucleotide(s) that partially fills the gap, it
is preferred that the distinguishing nucleotide appear opposite the
portion of gap space not filled by a gap oligonucleotide. Ligation
of gap oligonucleotides with a mismatch at either terminus is
extremely unlikely because of the combined effects of hybrid
instability and enzyme discrimination. When the TS-DNA is
generated, it will carry a copy of the gap oligonucleotide sequence
that led to a correct ligation. Gap oligonucleotides may give even
greater discrimination between related target sequences in certain
circumstances, such as those involving wobble base pairing of
alleles. Features of open circle probes and gap oligonucleotides
that increase the target-dependency of the ligation operation are
generally analogous to such features developed for use with the
ligation chain reaction. These features can be incorporated into
open circle probes and gap oligonucleotides for use in LM-RCA. In
particular, European Patent Application EP0439182 describes several
features for enhancing target-dependency in LCR that can be adapted
for use in LM-RCA. The use of stop bases in the gap space, as
described in European Patent Application EP0439182, is a preferred
mode of enhancing the target discrimination of a gap-filling
ligation operation.
[0382] A preferred form of target sequence discrimination can be
accomplished by employing two types of open circle probes. In one
embodiment, a single gap oligonucleotide is used which is the same
for both target sequences, that is, the gap oligonucleotide is
complementary to both target sequences. In a preferred embodiment,
a gap-filling ligation operation can be used (Example 3 in U.S.
Pat. No. 6,143,495). Target sequence discrimination would occur by
virtue of mutually exclusive ligation events, or extension-ligation
events, for which only one of the two open-circle probes is
competent. Preferably, the discriminator nucleotide would be
located at the penultimate nucleotide from the 3' end of each of
the open circle probes. The two open circle probes would also
contain two different detection tags designed to bind alternative
detection probes and/or address probes. Each of the two detection
probes would have a different detection label. Both open circle
probes would have the same primer complement portion. Thus, both
ligated open circle probes can be amplified using a single primer.
Upon array hybridization, each detection probe would produce a
unique signal, for example, two alternative fluorescence colors,
corresponding to the alternative target sequences.
[0383] These technique for target sequence discrimination are
especially useful within matched open circle probe sets.
[0384] M. Size Classes of Tandem Sequence DNA
[0385] Rolling circle amplification can be engineered to produce
TS-DNA of different lengths in an assay involving multiple ligated
OCPs or ATCs. This can be useful for extending the number of
different targets that can be detected in a single assay. TS-DNA of
different lengths can be produced in several ways. In one
embodiment, the base composition of the spacer region of different
classes of OCP or ATC can be designed to be rich in a particular
nucleotide. Then a small amount of the dideoxy nucleotide
complementary to the enriched nucleotide can be included in the
rolling circle amplification reaction. After some amplification,
the dideoxy nucleotides will terminate extension of the TS-DNA
product of the class of OCP or ATC enriched for the complementary
nucleotide. Other OCPs or ATCs will be less likely to be
terminated, since they are not enriched for the complementary
nucleotide, and will produce longer TS-DNA products, on
average.
[0386] In another embodiment, two different classes of OCP or ATC
can be designed with different primer complement portions. These
different primer complement portions are designed to be
complementary to a different rolling circle replication primer.
Then the two different rolling circle replication primers are used
together in a single rolling circle amplification reaction, but at
significantly different concentrations. The primer at high
concentration immediately primes rolling circle replication due to
favorable kinetics, while the primer at lower concentration is
delayed in priming due to unfavorable kinetics. Thus, the TS-DNA
product of the class of OCP or ATC designed for the primer at high
concentration will be longer than the TS-DNA product of the class
of OCP or ATC designed for the primer at lower concentration since
it will have been replicated for a longer period of time. These and
other techniques for producing size classes of TS-DNA are described
in U.S. Pat. No. 6,143,495.
Specific Embodiment
[0387] Disclosed is a method of amplifying nucleic acid sequences,
the method comprising a DNA ligation operation and an amplification
operation, wherein the DNA ligation operation comprises
circularization of one or more open circle probes, and wherein the
ligation operation is carried out in the presence of a set of open
circle probes. The amplification operation comprises rolling circle
replication of the circularized open circle probes, wherein the
amplification operation is carried out in the presence of a
plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer. The set of open circle probes comprises
a plurality of different open circle probes, wherein each open
circle probe comprises two ends, wherein at least one of the ends
of at least one of the open circle probes can form an
intramolecular stem structure, and wherein circularization of the
open circle probes that can form an intramolecular stem structure
is dependent on hybridization of the open circle probe to a target
sequence. Each detection rolling circle replication primer is
associated with a peptide nucleic acid quencher or a peptide
nucleic acid fluor, wherein each detection rolling circle
replication primer corresponds to a different open circle probe in
the set of open circle probes, wherein the secondary DNA strand
displacement primer corresponds to all of the open circle probes in
the set of open circle probes, wherein the common rolling circle
replication primer corresponds to all of the open circle probes in
the set of open circle probes, and wherein two or more of the open
circle probes in the set of open circle probes constitute a matched
open circle probe set.
[0388] Also disclosed is a method of amplifying nucleic acid
sequences, the method comprising a DNA ligation operation and an
amplification operation, wherein the DNA ligation operation
comprises circularization of one or more open circle probes,
wherein the ligation operation is carried out in the presence of a
set of open circle probes. The amplification operation comprises
rolling circle replication of the circularized open circle probes,
wherein the amplification operation is carried out in the presence
of a plurality of detection rolling circle replication primers, a
secondary DNA strand displacement primer, and a common rolling
circle replication primer. The set of open circle probes comprises
a plurality of different open circle probes. Each detection rolling
circle replication primer corresponds to a different open circle
probe in the set of open circle probes, wherein the secondary DNA
strand displacement primer corresponds to all of the open circle
probes in the set of open circle probes, wherein the common rolling
circle replication primer corresponds to all of the open circle
probes in the set of open circle probes.
[0389] Also disclosed is a method of amplifying nucleic acid
sequences, the method comprising an amplification operation,
wherein the amplification operation is carried out in the presence
of a set of amplification target circles, wherein the set of
amplification target circles comprises a plurality of different
amplification target circles, wherein the amplification operation
comprises rolling circle replication of the amplification target
circles, wherein the amplification operation is carried out in the
presence of a plurality of detection rolling circle replication
primers, a secondary DNA strand displacement primer, and a common
rolling circle replication primer. Each detection rolling circle
replication primer corresponds to a different amplification target
circle in the set of amplification target circles, wherein the
secondary DNA strand displacement primer corresponds to all of the
amplification target circles in the set of amplification target
circles, wherein the common rolling circle replication primer
corresponds to all of the amplification target circles in the set
of amplification target circles.
[0390] Also disclosed is a method of amplifying nucleic acid
sequences, the method comprising a DNA ligation operation and an
amplification operation, wherein the DNA ligation operation
comprises circularization of one or more open circle probes,
wherein the ligation operation is carried out in the presence of a
set of open circle probes, wherein the set of open circle probes
comprises a plurality of different open circle probes. The
amplification operation comprises rolling circle replication of the
circularized open circle probes, wherein two or more of the open
circle probes in the set of open circle probes constitute a matched
open circle probe set.
[0391] Also disclosed is a method of amplifying nucleic acid
sequences, the method comprising a DNA ligation operation and an
amplification operation, wherein the DNA ligation operation
comprises circularization of one or more open circle probes,
wherein the amplification operation comprises rolling circle
replication of the circularized open circle probes, wherein the
amplification operation is carried out in the presence of one or
more rolling circle replication primers, and wherein at least one
of the rolling circle replication primers is associated with a
peptide nucleic acid quencher or a peptide nucleic acid fluor.
[0392] Also disclosed is a method of amplifying nucleic acid
sequences, the method comprising an amplification operation,
wherein the amplification operation comprises rolling circle
replication of the amplification target circles, wherein the
amplification operation is carried out in the presence of one or
more rolling circle replication primers, wherein at least one of
the rolling circle replication primers is associated with a peptide
nucleic acid quencher or a peptide nucleic acid fluor.
[0393] Also disclosed is a method of selectively amplifying nucleic
acid sequences related to one or more target sequences, the method
comprising,
[0394] (a) mixing a set of open circle probes with a target sample,
to produce an OCP-target sample mixture, and incubating the
OCP-target sample mixture under conditions that promote
hybridization between the open circle probes and the target
sequences in the OCP-target sample mixture,
[0395] (b) mixing ligase with the OCP-target sample mixture, to
produce a ligation mixture, and incubating the ligation mixture
under conditions that promote ligation of the open circle probes to
form amplification target circles,
[0396] (c) mixing a plurality of detection rolling circle
replication primers, a secondary DNA strand displacement primer,
and a common rolling circle replication primer with the ligation
mixture, to produce a primer-ATC mixture, and incubating the
primer-ATC mixture under conditions that promote hybridization
between the amplification target circles and the rolling circle
replication primers in the primer-ATC mixture, and
[0397] (d) mixing DNA polymerase with the primer-ATC mixture, to
produce a polymerase-ATC mixture, and incubating the polymerase-ATC
mixture under conditions that promote replication of the
amplification target circles.
[0398] The set of open circle probes comprises a plurality of
different open circle probes, wherein each open circle probe
comprises two ends, wherein at least one of the ends of at least
one of the open circle probes can form an intramolecular stem
structure, wherein circularization of the open circle probes that
can form an intramolecular stem structure is dependent on
hybridization of the open circle probe to a target sequence,
wherein two or more of the open circle probes in the set of open
circle probes constitute a matched open circle probe set,
[0399] wherein the amplification target circles formed from the
open circle probes in the set of open circle probes comprise a set
of amplification target circles. Each detection rolling circle
replication primer is associated with a peptide nucleic acid
quencher, wherein each detection rolling circle replication primer
corresponds to a different open circle probe in the set of open
circle probes, wherein the secondary DNA strand displacement primer
corresponds to all of the open circle probes in the set of open
circle probes, wherein the common rolling circle replication primer
corresponds to all of the open circle probes in the set of open
circle probes. Replication of the amplification target circles
results in the formation of tandem sequence DNA.
[0400] In the disclosed method, each detection rolling circle
replication primer can comprise a complementary portion, wherein
each open circle probe can comprise a detection primer complement
portion, wherein the complementary portion of the detection rolling
circle replication primer can be complementary to the detection
primer complement portion of the open circle probe to which the
detection rolling circle replication primer corresponds, wherein
the complementary portion of the detection rolling circle
replication primer is not substantially complementary to an open
circle probe to which the detection rolling circle replication
primer does not correspond. The detection rolling circle
replication primer can be a peptide nucleic acid quenched primer,
wherein the detection rolling circle replication primer can further
comprise a fluorescent moiety and a quencher complement portion,
wherein each detection rolling circle replication primer can be
associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher can be associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid quencher can comprise a
quenching moiety. Association of the peptide nucleic acid quencher
with the detection rolling circle replication primer quenches
fluorescence from the fluorescent moiety, wherein the amplification
operation results in disassociation of the peptide nucleic acid
quenchers from the detection rolling circle replication primers,
thereby allowing the fluorescent moiety of the detection rolling
circle replication primers to fluoresce.
[0401] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid quencher associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
quencher associated with each detection rolling circle replication
primer can be the same. The quencher complement portion of at least
one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes can be different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes. Each detection rolling circle replication primer can
comprise a different fluorescent moiety. The amplification
operation can result in disassociation of the peptide nucleic acid
quenchers from the detection rolling circle replication primers,
thereby allowing the fluorescent moiety of the detection rolling
circle replication primers to fluoresce.
[0402] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprise a quenching moiety
and a quencher complement portion, wherein each detection rolling
circle replication primer can be associated with a peptide nucleic
acid fluor, wherein the peptide nucleic acid fluor can be
associated with the detection rolling circle replication primer via
the quencher complement portion, wherein the peptide nucleic acid
fluor comprises a fluorescent moiety. Association of the peptide
nucleic acid fluor with the detection rolling circle replication
primer quenches fluorescence from the fluorescent moiety, wherein
the amplification operation results in disassociation of the
peptide nucleic acid fluors from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
peptide nucleic acid fluors to fluoresce.
[0403] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid fluor associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
fluor associated with each detection rolling circle replication
primer can be the same. The quencher complement portion of at least
one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes can be different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes.
[0404] Each peptide nucleic acid fluor can comprise a different
fluorescent moiety. The amplification operation can result in
disassociation of the peptide nucleic acid flours from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to fluoresce.
The detection rolling circle replication primer can be a hairpin
quenched primer.
[0405] The ligation operation can be carried out in the presence of
one or more additional sets of open circle probes, wherein each set
of open circle probes can comprise a plurality of different open
circle probes. Each detection rolling circle replication primer can
correspond to a different open circle probe in all of the sets of
open circle probes, wherein the secondary DNA strand displacement
primer can correspond to all of the open circle probes in all of
the sets of open circle probes, wherein the common rolling circle
replication primer can correspond to all of the open circle probes
in all of the sets of open circle probes. Each detection rolling
circle replication primer can comprise a complementary portion, a
fluorescent moiety, and a quencher complement portion. Each
detection rolling circle replication primer corresponding to an
open circle probe in the same set of open circle probes can
comprise a different fluorescent moiety.
[0406] At least one of the detection rolling circle replication
primers corresponding to an open circle probe in one of the sets of
open circle probes can comprise the same fluorescent moiety as at
least one of the detection rolling circle replication primers in a
different one of the sets of open circle probes. At least one of
the detection rolling circle replication primers corresponding to
an open circle probe in one of the sets of open circle probes can
comprise the same fluorescent moiety as a different detection
rolling circle replication primer in the same set of open circle
probes. Each detection rolling circle replication primer can
correspond to a different open circle probe in all of the sets of
open circle probes, wherein the common rolling circle replication
primer can correspond to all of the open circle probes in all of
the sets of open circle probes. The amplification operation can be
carried out in the presence of a plurality of secondary DNA strand
displacement primers, wherein each secondary DNA strand
displacement primer can correspond to open circle probes in a
different set of open circle probes, wherein a single secondary DNA
strand displacement primer can correspond to all of the open circle
probes in a given set of open circle probes.
[0407] Each detection rolling circle replication primer can
correspond to a different open circle probe in all of the sets of
open circle probes, wherein the secondary DNA strand displacement
primer can correspond to all of the open circle probes in all of
the sets of open circle probes. The amplification operation can be
carried out in the presence of a plurality of common rolling circle
replication primers, wherein each common rolling circle replication
primer can correspond to open circle probes in a different set of
open circle probes, wherein a single common rolling circle
replication primer can correspond to all of the open circle probes
in a given set of open circle probes. Each detection rolling circle
replication primer can correspond to a different open circle probe
in all of the sets of open circle probes. The amplification
operation can be carried out in the presence of a plurality of
secondary DNA strand displacement primers, wherein each secondary
DNA strand displacement primer can correspond to open circle probes
in a different set of open circle probes, wherein a single
secondary DNA strand displacement primer can correspond to all of
the open circle probes in a given set of open circle probes. The
amplification operation can be carried out in the presence of a
plurality of common rolling circle replication primers, wherein
each common rolling circle replication primer can correspond to
open circle probes in a different set of open circle probes,
wherein a single common rolling circle replication primer can
correspond to all of the open circle probes in a given set of open
circle probes.
[0408] All of the open circle probes in all of the sets of open
circle probes can be different. Each detection rolling circle
replication primer can correspond to a different open circle probe
in a given set of open circle probes. At least one of the detection
rolling circle replication primers can correspond to an open circle
probe in each of at least two of the sets of open circle probes. At
least one of the detection rolling circle replication primers can
correspond to an open circle probe in each of at least two of the
sets of open circle probes.
[0409] The peptide nucleic acid quencher can comprise peptide
nucleic acid and a quenching moiety. Each detection rolling circle
replication primer can comprise a complementary portion, a
fluorescent moiety, and a quencher complement portion, wherein the
peptide nucleic acid quencher can be associated with the detection
rolling circle replication primers via the quencher complement
portion. Each detection rolling circle replication primer can
comprise a complementary portion, a fluorescent moiety, and a
quencher complement portion, wherein the amplification operation
can result in disassociation of the peptide nucleic acid quencher
from the detection rolling circle replication primers, thereby
allowing the fluorescent moiety of the detection rolling circle
replication primers to fluoresce. The peptide nucleic acid fluor
can comprise peptide nucleic acid and a fluorescent moiety. Each
detection rolling circle replication primer can comprise a
complementary portion, a quenching moiety, and a quencher
complement portion, wherein the peptide nucleic acid fluor can be
associated with the detection rolling circle replication primers
via the quencher complement portion.
[0410] The open circle probes in the matched open circle probe set
can be targeted to different forms of the same target sequence. The
different forms of the same target sequence can comprise a wild
type form of the target sequence and a mutant form of the target
sequence. The different forms of the same target sequence can
further comprise a second mutant form of the target sequence. The
different forms of the same target sequence can further comprise a
plurality of different mutant forms of the target sequence. The
different forms of the same target sequence can comprise a
plurality of different mutant forms of the target sequence. The
different forms of the same target sequence can comprise a normal
form of the target sequence and a mutant form of the target
sequence. The different forms of the same target sequence can
further comprise a second mutant form of the target sequence. The
different forms of the same target sequence can further comprise a
plurality of different mutant forms of the target sequence.
[0411] The set of open circle probes can comprise a plurality of
matched open circle probe sets. The open circle probes in each of
the matched open circle probe sets can be targeted to different
forms of the same target sequence, and open circle probes in
different matched open circle probe sets can be targeted to
different target sequences. The different forms of the same target
sequence can comprise a wild type form of the target sequence and a
mutant form of the target sequence. The different forms of the same
target sequence can further comprise a second mutant form of the
target sequence. The different forms of the same target sequence
can further comprise a plurality of different mutant forms of the
target sequence. The different forms of the same target sequence
can comprise a plurality of different mutant forms of the target
sequence. The different forms of the same target sequence can
comprise a normal form of the target sequence and a mutant form of
the target sequence. The different forms of the same target
sequence can further comprise a second mutant form of the target
sequence. The different forms of the same target sequence can
further comprise a plurality of different mutant forms of the
target sequence. The different target sequences can be in the same
gene. The different target sequences can be associated with the
same disease or condition.
[0412] The matched open circle probe set can consist of two open
circle probes, wherein one of the open circle probes in the matched
open circle probe set can be targeted to a wild type form of the
target sequence, wherein the other open circle probe in the matched
open circle probe set can be targeted to a mutant form of the
target sequence. Each detection rolling circle replication primer
can comprise a different fluorescent moiety. Each detection rolling
circle replication primer corresponding to an open circle probes in
the matched open circle probe set can comprise a different
fluorescent moiety.
[0413] The method can further comprise, following the ligation
operation, heating the circularized open circle probes. The
circularized open circle probes can be heated to about 95.degree.
C. for about 10 minutes.
[0414] The open circle probes each can be specific for a target
sequence, wherein each target sequence can comprise a 5' region and
a 3' region, wherein each open circle probe can comprise a
single-stranded, linear DNA molecule, wherein the single-stranded,
linear DNA molecule can comprise, from 5' end to 3' end, a 5'
phosphate group, a right target probe portion, a spacer portion, a
left target probe portion, and a 3' hydroxyl-group, wherein the
left target probe portion is complementary to the 3' region of the
target sequence, wherein the right target probe portion is
complementary to the 5' region of the target sequence. At least one
of the target sequences can further comprise a central region
located between the 5' region and the 3' region, wherein neither
the left target probe portion of the open circle probe specific for
the target sequence nor the right target probe portion of the open
circle probe specific for the target sequence is complementary to
the central region of the target sequence.
[0415] The ligation operation can comprise mixing the open circle
probes and one or more gap oligonucleotides with one or more target
samples, and incubating under conditions that promote hybridization
between the open circle probes and the gap oligonucleotides and the
target sequences, and ligation of the open circle probes and gap
oligonucleotides to form the circularized open circle probes. Each
gap oligonucleotide can comprise a single-stranded, linear DNA
molecule comprising a 5' phosphate group and a 3' hydroxyl group,
wherein each gap oligonucleotide can be complementary all or a
portion of the central region of the target sequence. A complement
to the central region of the target sequence can be synthesized
during the ligation operation. A plurality of the open circle
probes each can be specific for a different target sequence. A
plurality of different target sequences can be detected. The
amplification operation can produce amplified nucleic acid, wherein
the method can further comprise detecting the amplified nucleic
acid with one or more detection probes. A portion of each of a
plurality of the detection probes can have sequence matching or
complementary to a portion of a different one of the open circle
probes, wherein a plurality of different amplified nucleic acids
can be detected using the plurality of detection probes.
[0416] The spacer portion can comprise a detection primer
complement portion. The spacer portion can comprise a common primer
complement portion. The intramolecular stem structure of at least
one of the open circle probes can form a stem and loop structure. A
portion of one of the target probe portions of at least one of the
open circle probes can be in the loop of the stem and loop
structure, wherein the portion of the target probe portion in the
loop can hybridize to the target sequence, wherein hybridization of
the target probe portion in the loop to the target sequence
disrupts the intramolecular stem structure. A hybrid between the
target sequence and the target probe portion at the end of the open
circle probes that can form an intramolecular stem structure can be
more stable than the intramolecular stem structure.
[0417] In the method, if one or more of the open circle probes that
can form an intramolecular stem structure are not circularized, the
end of at least one of the uncircularized open circle probes that
forms the intramolecular stem structure can be extended during the
amplification operation using the open circle probe as a template.
The intramolecular stem structure can form under the conditions
used for the amplification operation. The intramolecular stem
structure can prevent the open circle probes from priming nucleic
acid replication. The intramolecular stem structure can prevent the
open circle probes from serving as a template for rolling circle
replication. The intramolecular stem structure can form a hairpin
structure. The intramolecular stem structure can form a stem and
loop structure. One of the ends of the open circle probes can be a
3' end, wherein the 3' end of at least one of the open circle
probes can form an intramolecular stem structure.
[0418] Rolling circle replication can be primed by one or more
detection rolling circle replication primers, wherein each
detection rolling circle replication primer can comprise two ends,
wherein at least one of the ends of at least one of the detection
rolling circle replication primers can form an intramolecular stem
structure, wherein priming by the detection rolling circle
replication primers that can form an intramolecular stem structure
is dependent on hybridization of the detection rolling circle
replication primers to the circularized open circle probes. The
amplification operation can produce tandem sequence DNA, wherein
the amplification operation can further comprise secondary DNA
strand displacement. Rolling circle replication can be primed by
one or more common rolling circle replication primers, wherein each
common rolling circle replication primer can comprise two ends,
wherein at least one of the ends of at least one of the common
rolling circle replication primers can form an intramolecular stem
structure, wherein priming by the common rolling circle replication
primers that can form an intramolecular stem structure is dependent
on hybridization of the common rolling circle replication primers
to the circularized open circle probes.
[0419] The amplification operation can produce tandem sequence DNA,
wherein the method can further comprises detecting the tandem
sequence DNA. The tandem sequence DNA can be detected via one or
more fluorescent change probes. The fluorescent change probes can
be hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a combination.
The tandem sequence DNA can be detected via one or more fluorescent
change primers. The fluorescent change primers can be stem quenched
primers, hairpin quenched primers, or a combination. The
amplification operation can produce tandem sequence DNA and
secondary tandem sequence DNA, wherein the method can further
comprise detecting the tandem sequence DNA, the secondary tandem
sequence DNA, or both.
[0420] Each detection rolling circle replication primer can
comprise a complementary portion, wherein each open circle probe
can comprise a detection primer complement portion, wherein the
complementary portion of the detection rolling circle replication
primer can be complementary to the detection primer complement
portion of the open circle probe to which the detection rolling
circle replication primer corresponds, wherein the complementary
portion of the detection rolling circle replication primer is not
substantially complementary to an open circle probe to which the
detection rolling circle replication primer does not
correspond.
[0421] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprise a fluorescent moiety
and a quencher complement portion, wherein each detection rolling
circle replication primer can be associated with a peptide nucleic
acid quencher, wherein the peptide nucleic acid quencher can be
associated with the detection rolling circle replication primer via
the quencher complement portion, wherein the peptide nucleic acid
quencher can comprise a quenching moiety. Association of the
peptide nucleic acid quencher with the detection rolling circle
replication primer quenches fluorescence from the fluorescent
moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid quenchers from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the detection rolling circle replication
primers to fluoresce.
[0422] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid quencher associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
quencher associated with each detection rolling circle replication
primer can be the same. The quencher complement portion of at least
one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes can be different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes. Each detection rolling circle replication primer can
comprise a different fluorescent moiety.
[0423] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprise a quenching moiety
and a quencher complement portion, wherein each detection rolling
circle replication primer can be associated with a peptide nucleic
acid fluor, wherein the peptide nucleic acid fluor can be
associated with the detection rolling circle replication primer via
the quencher complement portion, wherein the peptide nucleic acid
fluor can comprise a fluorescent moiety. Association of the peptide
nucleic acid fluor with the detection rolling circle replication
primer quenches fluorescence from the fluorescent moiety, wherein
the amplification operation results in disassociation of the
peptide nucleic acid fluors from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
peptide nucleic acid fluors to fluoresce.
[0424] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid fluor associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
fluor associated with each detection rolling circle replication
primer can be the same. The quencher complement portion of at least
one of the detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes can be different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an open circle probe in the set of open circle
probes. Each peptide nucleic acid fluor can comprise a different
fluorescent moiety. The detection rolling circle replication primer
can be a hairpin quenched primer.
[0425] The ligation operation can be carried out in the presence of
one or more additional sets of open circle probes, wherein each set
of open circle probes can comprise a plurality of different open
circle probes. Each detection rolling circle replication primer can
be associated with a peptide nucleic acid quencher, wherein the
peptide nucleic acid quencher can comprise peptide nucleic acid and
a quenching moiety, wherein the detection rolling circle
replication primer can comprise a fluorescent moiety. Each
detection rolling circle replication primer can be associated with
a peptide nucleic acid fluor, wherein the peptide nucleic acid
fluor can comprise peptide nucleic acid and a fluorescent moiety,
wherein the detection rolling circle replication primer can
comprise a quenching moiety.
[0426] Two or more of the open circle probes in the set of open
circle probes can constitute a matched open circle probe set,
wherein the open circle probes in the matched open circle probe set
can be targeted to different forms of the same target sequence.
Each detection rolling circle replication primer can comprise a
different fluorescent moiety. The method can further comprise,
following the ligation operation, heating the circularized open
circle probes.
[0427] Each open circle probe can comprises two ends, wherein the
open circle probes each can be specific for a target sequence,
wherein each target sequence can comprise a 5' region and a 3'
region, wherein each open circle probe can comprise a
single-stranded, linear DNA molecule, wherein the single-stranded,
linear DNA molecule can comprise, from 5' end to 3' end, a 5'
phosphate group, a right target probe portion, a spacer portion, a
left target probe portion, and a 3' hydroxyl group. The left target
probe portion is complementary to the 3' region of the target
sequence, wherein the right target probe portion is complementary
to the 5' region of the target sequence. At least one of the target
sequences can further comprise a central region located between the
5' region and the 3' region, wherein neither the left target probe
portion of the open circle probe specific for the target sequence
nor the right target probe portion of the open circle probe
specific for the target sequence is complementary to the central
region of the target sequence.
[0428] Each open circle probe can comprises two end, wherein at
least one of the ends of at least one of the open circle probes can
form an intramolecular stem structure, wherein circularization of
the open circle probes that can form an intramolecular stem
structure is dependent on hybridization of the open circle probe to
a target sequence, wherein the intramolecular stem structure of at
least one of the open circle probes forms a stem and loop
structure. Each open circle probe can comprise two ends, wherein at
least one of the ends of at least one of the open circle probes can
form an intramolecular stem structure, wherein circularization of
the open circle probes that can form an intramolecular stem
structure is dependent on hybridization of the open circle probe to
a target sequence. If one or more of the open circle probes that
can form an intramolecular stem structure are not circularized, the
end of at least one of the uncircularized open circle probes that
forms the intramolecular stem structure can be extended during the
amplification operation using the open circle probe as a
template.
[0429] The amplification operation can produce tandem sequence DNA,
wherein the method can further comprise detecting the tandem
sequence DNA. The tandem sequence DNA can be detected via one or
more fluorescent change probes. The fluorescent change probes can
be hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a combination.
The tandem sequence DNA can be detected via one or more fluorescent
change primers. The fluorescent change primers can be stem quenched
primers, hairpin quenched primers, or a combination. The
amplification operation can produce tandem sequence DNA and
secondary tandem sequence DNA, wherein the method can further
comprise detecting the tandem sequence DNA, the secondary tandem
sequence DNA, or both.
[0430] Each detection rolling circle replication primer can
comprise a complementary portion, wherein each amplification target
circle can comprise a detection primer complement portion, wherein
the complementary portion of the detection rolling circle
replication primer can be complementary to the detection primer
complement portion of the amplification target circle to which the
detection rolling circle replication primer corresponds, wherein
the complementary portion of the detection rolling circle
replication primer is not substantially complementary to an
amplification target circle to which the detection rolling circle
replication primer does not correspond.
[0431] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprise a fluorescent moiety
and a quencher complement portion, wherein each detection rolling
circle replication primer can be associated with a peptide nucleic
acid quencher, wherein the peptide nucleic acid quencher can be
associated with the detection rolling circle replication primer via
the quencher complement portion, wherein the peptide nucleic acid
quencher can comprise a quenching moiety. Association of the
peptide nucleic acid quencher with the detection rolling circle
replication primer quenches fluorescence from the fluorescent
moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid quenchers from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the detection rolling circle replication
primers to fluoresce.
[0432] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid quencher associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an amplification target circle
in the set of amplification target circles can be the same, and the
peptide nucleic acid quencher associated with each detection
rolling circle replication primer can be the same.
[0433] The quencher complement portion of at least one of the
detection rolling circle replication primers corresponding to an
amplification target circle in the set of amplification target
circles can be different from the quencher complement portion of at
least one of the other detection rolling circle replication primers
corresponding to an amplification target circle in the set of
amplification target circles. Each detection rolling circle
replication primer can comprise a different fluorescent moiety. The
detection rolling circle replication primer can be a peptide
nucleic acid quenched primer, wherein the detection rolling circle
replication primer can further comprise a quenching moiety and a
quencher complement portion, wherein each detection rolling circle
replication primer can be associated with a peptide nucleic acid
fluor, wherein the peptide nucleic acid fluor can be associated
with the detection rolling circle replication primer via the
quencher complement portion, wherein the peptide nucleic acid fluor
can comprise a fluorescent moiety. Association of the peptide
nucleic acid fluor with the detection rolling circle replication
primer quenches fluorescence from the fluorescent moiety, wherein
the amplification operation results in disassociation of the
peptide nucleic acid fluors from the detection rolling circle
replication primers, thereby allowing the fluorescent moiety of the
peptide nucleic acid fluors to fluoresce.
[0434] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid fluor associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an amplification target circle
in the set of amplification target circles can be the same, and the
peptide nucleic acid fluor associated with each detection rolling
circle replication primer can be the same. The quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an amplification target circle in the set
of amplification target circles can be different from the quencher
complement portion of at least one of the other detection rolling
circle replication primers corresponding to an amplification target
circle in the set of amplification target circles. Each peptide
nucleic acid fluor can comprise a different fluorescent moiety. The
detection rolling circle replication primer can be a hairpin
quenched primer.
[0435] The amplification operation can be carried out in the
presence of one or more additional sets of amplification target
circles, wherein each set of amplification target circles can
comprise a plurality of different amplification target circles.
Each detection rolling circle replication primer can be associated
with a peptide nucleic acid quencher, wherein the peptide nucleic
acid quencher can comprise peptide nucleic acid and a quenching
moiety, wherein the detection rolling circle replication primer can
comprise a fluorescent moiety. Each detection rolling circle
replication primer can be associated with a peptide nucleic acid
fluor, wherein the peptide nucleic acid fluor can comprise peptide
nucleic acid and a fluorescent moiety, wherein the detection
rolling circle replication primer can comprise a quenching
moiety.
[0436] The amplification operation can produce tandem sequence DNA,
wherein the method can further comprises detecting the tandem
sequence DNA. The tandem sequence DNA can be detected via one or
more fluorescent change probes. The fluorescent change probes can
be hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a combination.
The tandem sequence DNA can be detected via one or more fluorescent
change primers. The fluorescent change primers can be stem quenched
primers, hairpin quenched primers, or a combination. The
amplification operation can produce tandem sequence DNA and
secondary tandem sequence DNA, wherein the method can further
comprise detecting the tandem sequence DNA, the secondary tandem
sequence DNA, or both.
[0437] The amplification operation can be carried out in the
presence of a plurality of detection rolling circle replication
primers, a secondary DNA strand displacement primer, and a common
rolling circle replication primer, wherein each detection rolling
circle replication primer can comprise a complementary portion,
wherein each open circle probe can comprise a detection primer
complement portion, wherein each detection rolling circle
replication primer can correspond to a different open circle probe
in the set of open circle probes, wherein the complementary portion
of the detection rolling circle replication primer can be
complementary to the detection primer complement portion of the
open circle probe to which the detection rolling circle replication
primer corresponds, wherein the complementary portion of the
detection rolling circle replication primer is not substantially
complementary to an open circle probe to which the detection
rolling circle replication primer does not correspond.
[0438] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprises a fluorescent
moiety and a quencher complement portion, wherein each detection
rolling circle replication primer can be associated with a peptide
nucleic acid quencher, wherein the peptide nucleic acid quencher
can be associated with the detection rolling circle replication
primer via the quencher complement portion, wherein the peptide
nucleic acid quencher can comprise a quenching moiety. Association
of the peptide nucleic acid quencher with the detection rolling
circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid quenchers from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the detection rolling circle replication
primers to fluoresce.
[0439] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid quencher associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
quencher associated with each detection rolling circle replication
primer can be the same.
[0440] The quencher complement portion of at least one of the
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes can be different
from the quencher complement portion of at least one of the other
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes. Each detection
rolling circle replication primer can comprise a different
fluorescent moiety. The detection rolling circle replication primer
can be a peptide nucleic acid quenched primer, wherein the
detection rolling circle replication primer can further comprise a
quenching moiety and a quencher complement portion, wherein each
detection rolling circle replication primer can be associated with
a peptide nucleic acid fluor, wherein the peptide nucleic acid
fluor can be associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor can comprise a fluorescent moiety.
Association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
[0441] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid fluor associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
fluor associated with each detection rolling circle replication
primer can be the same.
[0442] The quencher complement portion of at least one of the
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes can be different
from the quencher complement portion of at least one of the other
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes. Each peptide
nucleic acid fluor can comprise a different fluorescent moiety. The
detection rolling circle replication primer can be a hairpin
quenched primer. The ligation operation can be carried out in the
presence of one or more additional sets of open circle probes,
wherein each set of open circle probes can comprise a plurality of
different open circle probes. The amplification operation can be
carried out in the presence of one or more detection rolling circle
replication primers, wherein each detection rolling circle
replication primer can be associated with a peptide nucleic acid
quencher, wherein the peptide nucleic acid quencher can comprise
peptide nucleic acid and a quenching moiety, wherein the detection
rolling circle replication primer can comprise a fluorescent
moiety.
[0443] The amplification operation can be carried out in the
presence of one or more detection rolling circle replication
primers, wherein each detection rolling circle replication primer
can be associated with a peptide nucleic acid fluor, wherein the
peptide nucleic acid fluor can comprise peptide nucleic acid and a
fluorescent moiety, wherein the detection rolling circle
replication primer can comprise a quenching moiety. The open circle
probes in the matched open circle probe set can be targeted to
different forms of the same target sequence. The amplification
operation can be carried out in the presence of one or more
detection rolling circle replication primers, wherein each
detection rolling circle replication primer can comprise a
different fluorescent moiety.
[0444] The method can further comprise, following the ligation
operation, heating the circularized open circle probes. Each open
circle probe can comprise two ends, wherein the open circle probes
each can be specific for a target sequence, wherein each target
sequence can comprise a 5' region and a 3' region, wherein each
open circle probe can comprise a single-stranded, linear DNA
molecule, wherein the single-stranded, linear DNA molecule can
comprise, from 5' end to 3' end, a 5' phosphate group, a right
target probe portion, a spacer portion, a left target probe
portion, and a 3' hydroxyl group, wherein the left target probe
portion is complementary to the 3' region of the target sequence,
wherein the right target probe portion is complementary to the 5'
region of the target sequence. At least one of the target sequences
can further comprise a central region located between the 5' region
and the 3' region, wherein neither the left target probe portion of
the open circle probe specific for the target sequence nor the
right target probe portion of the open circle probe specific for
the target sequence is complementary to the central region of the
target sequence.
[0445] Each open circle probe can comprise two ends, wherein at
least one of the ends of at least one of the open circle probes can
form an intramolecular stem structure, wherein circularization of
the open circle probes that can form an intramolecular stem
structure is dependent on hybridization of the open circle probe to
a target sequence, wherein the intramolecular stem structure of at
least one of the open circle probes forms a stem and loop
structure. Each open circle probe can comprise two ends, wherein at
least one of the ends of at least one of the open circle probes can
form an intramolecular stem structure, wherein circularization of
the open circle probes that can form an intramolecular stem
structure is dependent on hybridization of the open circle probe to
a target sequence. If one or more of the open circle probes that
can form an intramolecular stem structure are not circularized, the
end of at least one of the uncircularized open circle probes that
forms the intramolecular stem structure can be extended during the
amplification operation using the open circle probe as a
template.
[0446] The amplification operation can produce tandem sequence DNA,
wherein the method further comprises detecting the tandem sequence
DNA. The tandem sequence DNA can be detected via one or more
fluorescent change probes. The fluorescent change probes can be
hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a combination.
The tandem sequence DNA can be detected via one or more fluorescent
change primers. The fluorescent change primers can be stem quenched
primers, hairpin quenched primers, or a combination. The
amplification operation can produce tandem sequence DNA and
secondary tandem sequence DNA, wherein the method can further
comprises detecting the tandem sequence DNA, the secondary tandem
sequence DNA, or both.
[0447] Each detection rolling circle replication primer can
comprise a complementary portion, wherein each open circle probe
can comprise a detection primer complement portion, wherein the
ligation operation can be carried out in the presence of a set of
open circle probes, wherein the set of open circle probes can
comprise a plurality of different open circle probes, wherein the
complementary portion of the detection rolling circle replication
primer can be complementary to the detection primer complement
portion of the open circle probe to which the detection rolling
circle replication primer corresponds, wherein the complementary
portion of the detection rolling circle replication primer is not
substantially complementary to an open circle probe to which the
detection rolling circle replication primer does not
correspond.
[0448] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprise a fluorescent moiety
and a quencher complement portion, wherein each detection rolling
circle replication primer can be associated with a peptide nucleic
acid quencher, wherein the peptide nucleic acid quencher can be
associated with the detection rolling circle replication primer via
the quencher complement portion, wherein the peptide nucleic acid
quencher can comprise a quenching moiety. Association of the
peptide nucleic acid quencher with the detection rolling circle
replication primer quenches fluorescence from the fluorescent
moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid quenchers from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the detection rolling circle replication
primers to fluoresce.
[0449] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid quencher associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
quencher associated with each detection rolling circle replication
primer can be the same.
[0450] The quencher complement portion of at least one of the
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes can be different
from the quencher complement portion of at least one of the other
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes. Each detection
rolling circle replication primer can comprise a different
fluorescent moiety. The detection rolling circle replication primer
can be a peptide nucleic acid quenched primer, wherein the
detection rolling circle replication primer can further comprise a
quenching moiety and a quencher complement portion, wherein each
detection rolling circle replication primer can be associated with
a peptide nucleic acid fluor, wherein the peptide nucleic acid
fluor can be associated with the detection rolling circle
replication primer via the quencher complement portion, wherein the
peptide nucleic acid fluor can comprise a fluorescent moiety.
Association of the peptide nucleic acid fluor with the detection
rolling circle replication primer quenches fluorescence from the
fluorescent moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid fluors from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the peptide nucleic acid fluors to
fluoresce.
[0451] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid fluor associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an open circle probe in the set
of open circle probes can be the same, and the peptide nucleic acid
fluor associated with each detection rolling circle replication
primer can be the same.
[0452] The quencher complement portion of at least one of the
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes can be different
from the quencher complement portion of at least one of the other
detection rolling circle replication primers corresponding to an
open circle probe in the set of open circle probes. Each peptide
nucleic acid fluor can comprise a different fluorescent moiety. The
detection rolling circle replication primer can be a hairpin
quenched primer.
[0453] The ligation operation can be carried out in the presence of
a plurality of sets of open circle probes, wherein each set of open
circle probes can comprise a plurality of different open circle
probes. The peptide nucleic acid quencher can comprise peptide
nucleic acid and a quenching moiety, wherein the detection rolling
circle replication primer can comprise a fluorescent moiety. The
peptide nucleic acid fluor can comprise peptide nucleic acid and a
fluorescent moiety, wherein the detection rolling circle
replication primer comprises a quenching moiety.
[0454] The ligation operation can be carried out in the presence of
a set of open circle probes, wherein the set of open circle probes
can comprise a plurality of different open circle probes, wherein
two or more of the open circle probes in the set of open circle
probes can constitute a matched open circle probe set, wherein the
open circle probes in the matched open circle probe set are
targeted to different forms of the same target sequence. Each
detection rolling circle replication primer can comprise a
different fluorescent moiety. The method can further comprise,
following the ligation operation, heating the circularized open
circle probes.
[0455] Each open circle probe can comprise two ends, wherein the
open circle probes each can be specific for a target sequence,
wherein each target sequence can comprise a 5' region and a 3'
region, wherein each open circle probe can comprise a
single-stranded, linear DNA molecule, wherein the single-stranded,
linear DNA molecule can comprise, from 5' end to 3' end, a 5'
phosphate group, a right target probe portion, a spacer portion, a
left target probe portion, and a 3' hydroxyl group, wherein the
left target probe portion is complementary to the 3' region of the
target sequence, wherein the right target probe portion is
complementary to the 5' region of the target sequence. At least one
of the target sequences can further comprise a central region
located between the 5' region and the 3' region, wherein neither
the left target probe portion of the open circle probe specific for
the target sequence nor the right target probe portion of the open
circle probe specific for the target sequence is complementary to
the central region of the target sequence.
[0456] Each open circle probe can comprise two ends, wherein at
least one of the ends of at least one of the open circle probes can
form an intramolecular stem structure, wherein circularization of
the open circle probes that can form an intramolecular stem
structure is dependent on hybridization of the open circle probe to
a target sequence, wherein the intramolecular stem structure of at
least one of the open circle probes forms a stem and loop
structure. Each open circle probe can comprise two ends, wherein at
least one of the ends of at least one of the open circle probes can
form an intramolecular stem structure, wherein circularization of
the open circle probes that can form an intramolecular stem
structure is dependent on hybridization of the open circle probe to
a target sequence. If one or more of the open circle probes that
can form an intramolecular stem structure are not circularized, the
end of at least one of the uncircularized open circle probes that
forms the intramolecular stem structure can be extended during the
amplification operation using the open circle probe as a
template.
[0457] The amplification operation can produce tandem sequence DNA,
wherein the method can further comprise detecting the tandem
sequence DNA. The tandem sequence DNA can be detected via one or
more fluorescent change probes. The fluorescent change probes can
be hairpin quenched probes, cleavage quenched probes, cleavage
activated probes, fluorescent activated probes, or a combination.
The tandem sequence DNA can be detected via one or more fluorescent
change primers. The fluorescent change primers can be stem quenched
primers, hairpin quenched primers, or a combination. The
amplification operation can produce tandem sequence DNA and
secondary tandem sequence DNA, wherein the method can further
comprise detecting the tandem sequence DNA, the secondary tandem
sequence DNA, or both.
[0458] Each detection rolling circle replication primer can
comprise a complementary portion, wherein each amplification target
circle can comprise a detection primer complement portion, wherein
the amplification operation can be carried out in the presence of a
set of amplification target circles, wherein the set of
amplification target circles can comprise a plurality of different
amplification target circles, wherein the complementary portion of
the detection rolling circle replication primer is complementary to
the detection primer complement portion of the amplification target
circle to which the detection rolling circle replication primer
corresponds, wherein the complementary portion of the detection
rolling circle replication primer is not substantially
complementary to an amplification target circle to which the
detection rolling circle replication primer does not
correspond.
[0459] The detection rolling circle replication primer can be a
peptide nucleic acid quenched primer, wherein the detection rolling
circle replication primer can further comprise a fluorescent moiety
and a quencher complement portion, wherein each detection rolling
circle replication primer can be associated with a peptide nucleic
acid quencher, wherein the peptide nucleic acid quencher can be
associated with the detection rolling circle replication primer via
the quencher complement portion, wherein the peptide nucleic acid
quencher can comprise a quenching moiety. Association of the
peptide nucleic acid quencher with the detection rolling circle
replication primer quenches fluorescence from the fluorescent
moiety, wherein the amplification operation results in
disassociation of the peptide nucleic acid quenchers from the
detection rolling circle replication primers, thereby allowing the
fluorescent moiety of the detection rolling circle replication
primers to fluoresce.
[0460] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid quencher associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an amplification target circle
in the set of amplification target circles can be the same, and the
peptide nucleic acid quencher associated with each detection
rolling circle replication primer can be the same. The quencher
complement portion of at least one of the detection rolling circle
replication primers corresponding to an amplification target circle
in the set of amplification target circles can be different from
the quencher complement portion of at least one of the other
detection rolling circle replication primers corresponding to an
amplification target circle in the set of amplification target
circles.
[0461] Each detection rolling circle replication primer can
comprise a different fluorescent moiety. The detection rolling
circle replication primer can be a peptide nucleic acid quenched
primer, wherein the detection rolling circle replication primer can
further comprise a quenching moiety and a quencher complement
portion, wherein each detection rolling circle replication primer
can be associated with a peptide nucleic acid fluor, wherein the
peptide nucleic acid fluor can be associated with the detection
rolling circle replication primer via the quencher complement
portion, wherein the peptide nucleic acid fluor can comprise a
fluorescent moiety. Association of the peptide nucleic acid fluor
with the detection rolling circle replication primer quenches
fluorescence from the fluorescent moiety, wherein the amplification
operation results in disassociation of the peptide nucleic acid
fluors from the detection rolling circle replication primers,
thereby allowing the fluorescent moiety of the peptide nucleic acid
fluors to fluoresce.
[0462] The quencher complement portion of each detection rolling
circle replication primer can be the same, and the peptide nucleic
acid fluor associated with each detection rolling circle
replication primer can be the same. The quencher complement portion
of at least one of the detection rolling circle replication primers
can be different from the quencher complement portion of at least
one of the other detection rolling circle replication primers. The
quencher complement portion of each detection rolling circle
replication primer corresponding to an amplification target circle
in the set of amplification target circles can be the same, and the
peptide nucleic acid fluor associated with each detection rolling
circle replication primer can be the same. The quencher complement
portion of at least one of the detection rolling circle replication
primers corresponding to an amplification target circle in the set
of amplification target circles can be different from the quencher
complement portion of at least one of the other detection rolling
circle replication primers corresponding to an amplification target
circle in the set of amplification target circles. Each peptide
nucleic acid fluor can comprise a different fluorescent moiety.
[0463] The detection rolling circle replication primer can be a
hairpin quenched primer. The amplification operation can be carried
out in the presence of a set of amplification target circles,
wherein the set of amplification target circles can comprise a
plurality of different amplification target circles. The
amplification operation can be carried out in the presence of one
or more additional sets of amplification target circles, wherein
each set of amplification target circles can comprise a plurality
of different amplification target circles. The peptide nucleic acid
quencher can comprise peptide nucleic acid and a quenching moiety,
wherein the detection rolling circle replication primer can
comprise a fluorescent moiety.
[0464] The peptide nucleic acid fluor can comprise peptide nucleic
acid and a fluorescent moiety, wherein the detection rolling circle
replication primer can comprise a quenching moiety. The
amplification operation can produce tandem sequence DNA, wherein
the method can further comprise detecting the tandem sequence DNA.
The tandem sequence DNA can be detected via one or more fluorescent
change probes. The fluorescent change probes can be hairpin
quenched probes, cleavage quenched probes, cleavage activated
probes, fluorescent activated probes, or a combination. The tandem
sequence DNA can be detected via one or more fluorescent change
primers. The fluorescent change primers can be stem quenched
primers, hairpin quenched primers, or a combination. The
amplification operation can produce tandem sequence DNA and
secondary tandem sequence DNA, wherein the method can further
comprise detecting the tandem sequence DNA, the secondary tandem
sequence DNA, or both.
[0465] Also disclosed is a kit for selectively detecting one or
more target sequences or selectively amplifying nucleic acid
sequences related to one or more target sequences, the kit
comprising, a set of open circle probes each comprising two ends,
wherein at least one of the ends of one of the open circle probe
can form an intramolecular stem structure, wherein portions of each
open circle probe are complementary to the one or more target
sequences; a plurality of detection rolling circle replication
primers, wherein all or a portion of each detection rolling circle
replication primer is complementary to a portion of one or more of
the open circle probes; one or more secondary DNA strand
displacement primers, wherein all or a portion of each secondary
DNA strand displacement primer matches a portion of one or more of
the open circle probes; and one or more common rolling circle
replication primers, wherein all or a portion of each common
rolling circle replication primer is complementary to a portion of
one or more of the open circle probes.
[0466] All or a portion of each detection rolling circle
replication primer is complementary to a portion of a different one
or more of the open circle probes in the set of open circle probes,
all or a portion of each secondary DNA strand displacement primer
matches a portion of all of the open circle probes in the set of
open circle probes, and all or a portion of each common rolling
circle replication primer is complementary to a portion of all of
the open circle probes in the set of open circle probes. The end of
the open circle probe that can form an intramolecular stem
structure can be a 3' end. Each target sequence can comprise a 5'
region and a 3' region, wherein the open circle probes each can
comprise a single-stranded, linear DNA molecule comprising, from 5'
end to 3' end, a 5' phosphate group, a right target probe portion,
a spacer portion, a left target probe portion, and a 3' hydroxyl
group, wherein the spacer portion can comprise a primer complement
portion, wherein the left target probe portion can be complementary
to the 3' region of at least one of the target sequences and the
right target probe portion can be complementary to the 5' region of
the same target sequence, wherein the rolling circle replication
primer can comprise a single-stranded, linear nucleic acid molecule
comprising a complementary portion that is complementary to the
primer complement portion of one or more of the open circle
probes.
[0467] At least one target sequence can further comprise a central
region located between the 5' region and the 3' region, wherein
neither the left target probe portion nor the right target probe
portion of the open circle probe complementary to the target
sequence is complementary to the central region of the target
sequence. The kit can further comprise one or more gap
oligonucleotides, wherein the gap oligonucleotides can be
complementary to all or a portion of the central region of the
target sequence. The target probe portions of the open circle
probes can be complementary to a different target sequence for each
of a plurality of the open circle probes.
[0468] The kit can further comprise one or more reporter binding
agents each comprising a specific binding molecule and an
oligonucleotide portion, wherein the oligonucleotide portion can
comprise one of the target sequences. The portions of the open
circle probes that are complementary to the target sequence can be
complementary to a different target sequence for each of a
plurality of the open circle probes.
Examples
A. Example 1
Primer Extension Assay
[0469] This example demonstrates that a hairpin open circle probe
with a 5' overhanging end can be extended from the 3' end. Such
extension would lead to an inactive open circle probe. Open circle
probe 1822ocT was used as a model for the new design of 3' hairpin
open circle probes. The new design was compared to the conventional
design.
[0470] Conventional OCP design sequence: 5'-GAAGAACTGGACAGATTT
ACTACGTATGTTGACTGGTCACACGTCGTTCTAGTACGCTTCTACTCCCTCTT
GAGATGTTCTGCTTTGTT 3' (SEQ ID NO:9)
[0471] New (hairpin) OCP design sequence: 5'-GAAGAACTGGA
CAGATTTACTACGTATGTTGACTGGTCACACGTCGTTCTAGTAACAAAGCAC
TCCCTCTTGAGATGTTCTGCTTTGTT 3' (SEQ ID NO:10)
[0472] .gamma..sup.32P ATP exchange reaction end labeling: M13
bacteriophage forward primer and OCPs were end labeled with
radioactive .sup.32P in an exchange reaction as follows:
[0473] 30 minutes exchange reactions were carried out in 20 ill
volume containing 10 .mu.l of M13 bacteriophage forward primer or
open circle probe DNA (1 pM/.mu.l), 4 .mu.l 5.times.exchange buffer
(Gibco BRL, cat # 10456-010) (250 mM imidazole-HCl (pH 6.4), 60 mM
MgCl.sub.2, 5 mM 2-mercaptoethanol, and 0.35 mM ADP), 0.5 .mu.l T4
polynucleotide kinase (NEB) (10u/.mu.l), 2.5 .mu.l dH.sub.2O, and 3
.mu.l 10 mM .gamma..sup.32P ATP (10 .mu.Ci/.mu.i). DNA was purified
and eluted into 100 .mu.l of EB buffer (10 mM Tris-HCl, pH 8.5)
using QIAquick nucleotide removal kit (QIAGEN).
[0474] Annealing of .gamma..sup.32P ATP labeled forward primer to
M13 DNA: Annealing reaction was carried out by mixing: 3.3 .mu.l
forward primer, 7.6 .mu.M13 mp19 ssDNA (0.25 .mu.g/.mu.l), 1 .mu.l
Tris-HCl (pH 7.54), and 18.1 .mu.l dH.sub.2O. Heated to 95.degree.
C. for 2 minutes, and cooled to room temperature.
[0475] M13 ladder preparation: 4 .mu.l of the above reaction was
added to 1 .mu.l 0.1 M DTT, 7.6 .mu.l 50.times.sequenase buffer
(260 mM Tris-HCl, pH 9.5, 65 mM MgCl.sub.2), 7.6 .mu.l dH.sub.2O,
and 0.4 .mu.l sequenase (USB) (4 units/.mu.l). The mix was divided
into 4 equal portions and 2.5 .mu.l of ddG, ddA, ddT, or ddC was
added into each portion. All four portions were then incubated at
37.degree. C. for 5 minutes.
[0476] Primer extension reactions: 30 .mu.l extension reactions
were performed as follows: 0.1 .mu.l of labeled open circle probe
was added to ligation and ERCA reaction mix containing: 1 .mu.l
Ampligase buffer (20 mM Tris-HCl, pH 8.3) (Epicentre Technologies),
3 .mu.l 10.times.modified ThermoPol reaction buffer (200 mM
Tris-HCl, pH 8.8, 100 mM KCl, 100 mM (NH4).sub.2SO.sub.4 and
1%Triton X-100), 3 .mu.l 50% TMA oxalate, 20.7 .mu.l dH.sub.2O, 1.2
.mu.l 10 mM dNTP mix (dATP, dCTP, dGTP, and TTP), and 1 .mu.l Bst
polymerase (8 units/.mu.l) (New England Biolabs, Mass.), the mix
was incubated at 60.degree. C.
[0477] 3 .mu.l Aliquots were pipetted out between 15 seconds and 2
hr time points and added into 3 .mu.l 2.times.stop buffer (95%
formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% xylene
cyanol FF). Samples were then boiled for 5 minutes and
electrophoresed on a 8% denaturing polyacrylamide gel. For each
open circle probe, aliquot number one was taken prior to adding the
polymerase enzyme, which represents the unextended open circle
probe.
[0478] Results: A hairpin forms at the 3' end of the open circle
probe that allowed the ERCA DNA polymerase to extend 54 bases from
the self-annealed 3' end of the open circle probe. Full extension
should have converted the hairpin open circle probe to an inert
double-stranded form. This reaction, called the "suicide pathway",
inactivates the open circle probe. The reaction was completed
within 15 sec of the start of primer extension reaction.
B. Example 2
VCAM Rolling Circle Amplification Assay
[0479] This example describes single nucleotide polymorphism (SNP)
detection on genomic DNA, using exponential rolling circle
amplification (ERCA). Specifically, Exponential Rolling Circle
Amplification is used for allele discrimination on genomic DNA on
an ABI Prism 7700 Sequence Detection System using generic P1
Amplifluors as detection probes.
[0480] Oligonucleotide sequences:
4 VCAMinA sequence: 5'-AAATTGATTCAGGAAATACTAGCTTATAAAGACTC-
GTCATGTCTCAGCTCTAGTTTCTGATCCCATGACTTCAC (SEQ ID NO:11)
CTACCAAATATCTAGGGATCAGAA-3' VCAMocG sequence:
5'-AAATTGATTCAGGAAATACTAGCTTATAAAATGTTGACT GGT CAC ACG
TCGCTCTGATCCC ATG ACT (SEQ ID NO:12) TCA CCT ACC AAA TAT CTA GGG
ATC AGA G-3' VCAMinA P2: CTTCACCTACCAAATATCTAGGGATCAGAA (SEQ ID
NO:13) VCAMocG P21: CTTCACCTACCAAATATCTAGGGATCAGAG (SEQ ID NO:14)
P1 in Amplifluor:
5'-FAM-TCGATGACTGACGGTCATCG-Dabcyl-dT)-ACTAGAGCTGAGACATGACGAGTC-3'
(SEQ ID NO:15) P1 oc Amplifluor:
5'-TET-TCGATGACTGACGGTCATCG-(Dabcyl-dT)-ACGACGTGTGACCAGTCAACAT-3'
(SEQ ID NO:16)
[0481] Primer (P1) is an Amplifluor (a type of fluorescent change
primer) and is complementary to the region of the spacer region of
an open circle probe. The sequence of the allele-specific primer
(P2) is homologous to the 3' arm of an open circle probe. The
Amplifluor P1s have either FAM or TET fluorophores at the 5' ends
for the two alleles. The Tms of both these primers is approximately
65.degree. C.
[0482] DNA Annealing and Ligation: The reactions were set up in
96-well MicroAmp Optical plates (Perkin Elmer) in a 10 .mu.l
reaction volume containing 1 unit Ampligase (Epicentre
Technologies), 20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM
MgCl.sub.2, 0.5 mM NAD, and 0.01% Triton.RTM.X-100. Standard
reactions contained 0.01 nM open circle probes and 100 ng of Alu I
digested genomic DNA. DNA was denatured by heating the reactions at
95.degree. C. for 3 min followed by annealing and ligation at
60.degree. C. for 30 min.
[0483] ERCA.TM. Reaction: For each 30 .mu.l reaction to be run, 20
.mu.l of ERCA mix was added to the 10 .mu.l ligation mix. ERCA mix
was prepared as follows: 3 .mu.l of 10.times.Bst Thermopol buffer
(200 mM Tris-HCl, pH 8.8, 100 mM KCl, 100 mM
(NH.sub.4).sub.2SO.sub.4 and 1% Triton X-100) containing no
Mg.sup.2+, 3 .mu.l 50 mM TMA oxalate, 1.2 .mu.l 10 mM dNTP mix
(dATP, dGTP, dCTP, and dTTP), 3 .mu.l 10 .mu.M Amplifluor P1
primer, 3 .mu.l 10 .mu.M P2 primer, 2.5 .mu.l 20 .mu.M ROX dye, 1
.mu.l of 8 units/.mu.l Bst polymerase (New England Biolabs, MA),
and 3.3 .mu.l water. 20 .mu.l of ERCA mix was added to the 10 .mu.l
ligation reaction. Real time ERCA reaction was performed in 96-well
MicroAmp Optical Plates (Perkin-Elmer) and run on real time ABI
Prism 7700 (Perkin-Elmer) for 3 hrs. Specific signal was expressed
as "delta Ct". Delta Ct=(Ct minus ligase control--Ct plus
ligase).
[0484] Results: Genotyping assays with the hairpin open circle
probe for the SNP VCAM gave a typical real time profiles, and 98%
overall accuracy (Table 1) when 92 genomic DNA samples were
analyzed.
5 TABLE 1 Genotype Accuracy % Accuracy CT 31/31 100.0% TT (FAM-A)
55/56 98.2% CC (TET-G) 4/5 80.0% Total 90/92 98%
C. Example 3
Hemochromatosis H63D Mutation Genotyping Using Rolling Circle
Amplification
[0485] This example describes an example of the disclosed method
using a matched set of open circle probes, detection rolling circle
primers that are fluorescent change primers (specifically, peptide
nucleic acid quenched primers) via association with a peptide
nucleic acid quencher, a common rolling circle replication primer,
and a secondary DNA strand displacement primer.
[0486] 1. Oligonucleotides
[0487] The oligonucleotides used are described below. The
oligonucleotides have a 5' phosphate unless a different molecule or
moiety is indicated.
[0488] An open circle probe targeted to a wild type sequence (OCP
H63D 1166/1704-2 wt#10 3'mm short):
6 (SEQ ID NO:17) 5'-ATC ATA GAA CAC GAA CAG CTG GTC ATC CAG TTC TTC
GCT GCC CAT CGC GCA GAC ACG ATA CAA GAG AGT GAC TCT CTT G
[0489] An open circle probe targeted to a mutant form of the same
sequence (OCP H63D 5901/1704-2 mut#5):
7 (SEQ ID NO:18) 5'-ATC ATA GAA CAC GAA CAG CTG GTC ATC TGC TCT GTT
ATC GGC CGT CGC GCA GAC ACG ATA GAT GAG GCG ACT CTC ATC
[0490] A peptide nucleic acid quencher (Q-PNA-13), which is
annealed to the detection rolling circle replication primers:
[0491] Ac-X-OO-tga-ttg-cga-atg-Lys(Dabcyl) (SEQ ID NO: 1)
[0492] A detection rolling circle replication primer (P1 Cy3 5901),
which is annealed to the peptide nucleic acid quencher (Q-PNA-13)
and which corresponds to the mutant open circle probe (OCP H63D
5901/1704-2 mut#5):
[0493] 5'-/Cy3/Tc att cgc aat ca ACG GCC GAT AAC AGA (SEQ ID
NO:3)
[0494] A detection rolling circle replication primer (P1 FAM 1166),
which is annealed to the peptide nucleic acid quencher (Q-PNA-13)
and which corresponds to the wild type open circle probe (OCP H63D
1166/1704-2 wt#10 3'mm short):
[0495] 5'-/6-FAM/Tcattcgcaatca ATG GGC AGC GAA GAA (SEQ ID
NO:19)
[0496] A secondary DNA strand displacement primer (P2 1704) which
corresponds to both open circle probes:
[0497] 5'-CGC GCA GACACG ATA-3' (SEQ ID NO:4)
[0498] A common rolling circle replication primer (3C H63D) which
corresponds to both open circle probes:
[0499] 5'-TG TTC GTG TTC TAT GAT-3' (SEQ ID NO:20)
[0500] The sequence relationships between these oligonucleotides is
shown as follows. Complementary sequences between the open circle
probes and the detection rolling circle replication primers are
shown in bold. Complementary sequences between the common rolling
circle replication primer and the open circle probes is underlined.
Matching sequences between the secondary DNA strand displacement
primer and the open circle probes is shown in italic. Complementary
sequence between the detection rolling circle replication primers
and the peptide nucleic acid quencher is shown as lowercase.
[0501] These oligonucleotides use many of the features that can be
used in the disclosed method. Both open circle probes can form an
intramolecular stem structure (in the form of a hairpin). The open
circle probes constitute a matched open circle probe set since they
are targeted to different forms (wild type and mutant) of the same
target sequence (hemochromatosis H63D sequence). Both detection
rolling circle amplification primers contain the same 5' tail that
anneals to the same peptide nucleic acid quencher (Q-PNA-13). A
common rolling circle replication primer (3C H63D) that is
complementary to both open circle probes is an extra
non-fluorescent primer used to suppress unwanted background ERCA. A
secondary DNA strand displacement primer (P2 1704) has sequence
matching sequence in both open circle probes. The reaction is
performed with two OCPs in the same reaction.
[0502] 2. OCP Annealing and Ligation
[0503] MicroAmp Optical plates and/or tubes were set up on ice for
the required number of reactions. Ligation reaction volume was 10
.mu.l. 200 ng (50 ng/.mu.l) of genomic DNA or multiple displacement
amplification (MDA) product to be genotyped was added to the
appropriate tubes. DNA from 34 homozygous wild type individuals, 25
heterozygous wild type/mutant individuals, and 12 homozygous mutant
individuals was used. A premix was prepared for 1.5 times the
number of ligation reactions, containing 0.1 unit of Ampligase and
1 .mu.l of 10.times.Ampligase reaction buffer (Epicentre) per
reaction. OCPs were added to a final concentration of 50 pM each.:
Sufficient water was added to bring the total reaction volume to 10
.mu.l per reaction upon addition of premix. Using eppendorf repeat
pipettor, 6 .mu.l premix was dispensed into wells containing
genomic DNA. Samples were incubated as follows: 95.degree. C. for
30 seconds, 63.degree. C. for 20 minutes, 95.degree. C. for 10
minutes, 4.degree. C. hold. The ligation reactions were kept at
4.degree. C. until ERCA mix was added.
[0504] 3. Exponential Rolling Circle Amplification (ERCA)
Reaction
[0505] ERCA master mix was set up the in a PCR enclosure to reduce
the possibility of cross-contamination. A premix of 1.3 times the
number of reactions was prepared, such that the reaction volume
added to the ligation reaction was 20 pi. Each ERCA reaction
contained 3 .mu.l of 10.times.Bst Thermopol II buffer (NEB), 3
.mu.l 50 mM TMA oxalate, 1.2 .mu.l 10 mM dNTPs, 1 .mu.l of 8u/.mu.l
Bst polymerase. Final concentration of P1 FAM 1166 primer was 0.3
.mu.M; P1 Cy3 5901 primer was 0.4 .mu.M, P2 1704 primer was 0.525
.mu.M, Q-PNA-13 was 1.4 .mu.M, and 3C H63D primer was 0.3 .mu.M.
The volume was brought to 20 .mu.l per ERCA reaction using water.
An eppendorf repeat pipettor was used to dispense 20 .mu.l of the
ERCA master mix into the wells containing the 10 .mu.l ligation
reaction. The reactions were incubated at 60.degree. C. in BioRad
I-Cycler, collecting data using both the FAM and Cy3 channels.
[0506] All of the wild type individuals gave a strong FAM signal
(corresponding to the wild type open circle probe) and essentially
no Cy3 signal (corresponding to the mutant open circle probe). This
is the expected result from wild type individuals (who have two
copies of the wild type sequence). Similarly, all of the mutant
individuals gave essentially no FAM signal (corresponding to the
wild type open circle probe) and a strong Cy3 signal (corresponding
to the mutant open circle probe). This is the expected result from
mutant individuals (who have two copies of the mutant sequence).
Finally, all of the heterozygous individuals gave a moderate FAM
signal (corresponding to the wild type open circle probe) and a
moderate Cy3 signal (corresponding to the mutant open circle
probe). This is the expected result from heterozygous individuals
(who have both the mutant and wild type sequences).
D. Example 4
Factor II Prothrombin Mutation Genotyping Using Rolling Circle
Amplification
[0507] This example describes an example of the disclosed method
using a matched set of open circle probes, detection rolling circle
primers that are fluorescent change primers (specifically, peptide
nucleic acid quenched primers) via association with a peptide
nucleic acid quencher, a common rolling circle replication primer,
and a secondary DNA strand displacement primer.
[0508] 1. Oligonucleotides
[0509] The oligonucleotides used are described below. The
oligonucleotides have a 5' phosphate unless a different molecule or
moiety is indicated.
[0510] An open circle probe targeted to a wild type sequence (FII
Wild type):
8 (SEQ ID NO:21) 5'-AGCCTCAATGCTCCCAGTGCACAAGACCGAAAGGGTAGT- CGCGG
ATTGTTGCGCTGAGAAATAAAAGTGACTCTCAGCG
[0511] An open circle probe targeted to a mutant form of the same
sequence (FII Mutant):
9 (SEQ ID NO:22) 5'-AGCCTCAATGCTCCCAGTGCACTCAATCCCAGGCGAGTC- GCGG
ATTGTTGTGCTGAGAGAATAAAAGTGACTCTCAGCA
[0512] A peptide nucleic acid quencher (Q-PNA-13), which is
annealed to the detection rolling circle replication primers:
[0513] Ac-X-OO-tgattgcgaatg-Lys(Dabcyl) (SEQ ID NO: 1)
[0514] A detection rolling circle replication primer (FII Mutant
P1), which is annealed to the peptide nucleic acid quencher
(Q-PNA-13) and which corresponds to the mutant open circle probe
(FII Mutant):
[0515] 5'-/Cy3/tcattcgcaatcaCGCCTGGGATTGAGT (SEQ ID NO:23)
[0516] A detection rolling circle replication primer (FII Wild type
P1), which is annealed to the peptide nucleic acid quencher
(Q-PNA-13) and which corresponds to the wild type open circle probe
(FII Wild type):
[0517] 5'-/6-FAM/tcattcgcaatcaCCCTTTCGGTCTTGT (SEQ ID NO:24)
[0518] A secondary DNA strand displacement primer (FII P2) which
corresponds to both open circle probes:
[0519] 5'-AGTCGCGGATTGTTG-3' (SEQ ID NO:25)
[0520] A common rolling circle replication primer (FII allele
specific primer) which corresponds to both open circle probes:
[0521] 5'-CACTGGGAGCATTGA-3' (SEQ ID NO:26)
[0522] The sequence relationships between these oligonucleotides is
shown as follows. Complementary sequences between the open circle
probes and the detection rolling circle replication primers are
shown in bold. Complementary sequences between the common rolling
circle replication primer and the open circle probes is underlined.
Matching sequences between the secondary DNA strand displacement
primer and the open circle probes is shown in italic. Complementary
sequence between the detection rolling circle replication primers
and the peptide nucleic acid quencher is shown as lowercase.
[0523] These oligonucleotides use many of the features that can be
used in the disclosed method. Both open circle probes can form an
intramolecular stem structure (in the form of a hairpin). The open
circle probes constitute a matched open circle probe set since they
are targeted to different forms (wild type and mutant) of the same
target sequence (Factor II prothrombin sequence). Both detection
rolling circle amplification primers contain the same 5' tail that
anneals to the same peptide nucleic acid quencher (Q-PNA-13). A
common rolling circle replication primer (FII allele specific
primer) that is complementary to both open circle probes is an
extra non-fluorescent primer used to suppress unwanted background
ERCA. A secondary DNA strand displacement primer (FII P2) has
sequence matching sequence in both open circle probes. The reaction
is performed with two OCPs in the same reaction.
[0524] 2. OCP Annealing and Ligation
[0525] 50 ng to 1 .mu.g of either genomic DNA or of an MDA
amplified genomic sample was mixed with both OCPs (typically 0.5 nM
final concentration for each OCP) and 0.5 unit of Ampligase
(Epicentre Technologies, Madison, Wis.) in 1.times.Ampligase buffer
(Epicentre), for a total volume of 10 .mu.l. The reaction was
heated to 95.degree. C. for 10 seconds, and cooled to 63-68.degree.
C. for 5-20 minutes, during which time the OCP annealed to genomic
target and was circularized by ligase.
[0526] 3. Exponential Rolling Circle Amplification (ERCA)
Reaction
[0527] The ligation reaction was heated to 95.degree. C. for 10
minutes to release ligated circles from genomic DNA. The reaction
was cooled to 4.degree. C., and 20 .mu.l ERCA reaction mix was
added (typically 16 units BST polymerase (New England Biolabs,
Beverly, Mass.), 6 mM dNTPs, 0.5 .mu.M FII Wild type P1, 0.7 .mu.M
FII Mutant P1, 0.5 .mu.M FII P2, 4 .mu.M FII allele specific
primer, 4 .mu.M Q-PNA-13, 7.5 .mu.M TMA oxalate in
1.times.ThermoPol Buffer II, all concentrations final). Reactions
were incubated at 60.degree. C. for 3 hours in an I-Cycler (BioRad,
Hercules, Calif.) reading both FAM and Cy3 channels. Signals
typically appeared after 10-20 minutes.
[0528] 4. Results and Analysis
[0529] The basic results (fluorescence signal over time) are shown
in FIG. 6. FIG. 6A shows FAM fluorescence in amplification
reactions of nucleic acid samples from 32 repeats of a single
normal human sample. FIG. 6B shows Cy3 fluorescence from the same
32 samples in FIG. 6A. FIG. 6C shows FAM fluorescence in
amplification reactions of nucleic acid samples from 32 repeats of
a single heterozygous human sample. FIG. 6D shows Cy3 fluorescence
from the same 32 samples in FIG. 6C. FIG. 6E shows FAM fluorescence
in amplification reactions of nucleic acid samples from 32 repeats
of a single homozygous mutant human sample. FIG. 6F shows Cy3
fluorescence from the same 32 samples in FIG. 6E.
[0530] As can be seen, all of the wild type individuals gave a
strong FAM signal (corresponding to the wild type open circle
probe; FIG. 6A) and essentially no Cy3 signal (corresponding to the
mutant open circle probe; FIG. 6D). This is the expected result
from wild type individuals (who have two copies of the wild type
sequence). Similarly, all of the mutant individuals gave
essentially no FAM signal (corresponding to the wild type open
circle probe; FIG. 6C) and a strong Cy3 signal (corresponding to
the mutant open circle probe; FIG. 6F). This is the expected result
from mutant individuals (who have two copies of the mutant
sequence). Finally, all of the heterozygous individuals gave a
moderate FAM signal (corresponding to the wild type open circle
probe; FIG. 6B) and a moderate Cy3 signal (corresponding to the
mutant open circle probe; FIG. 6E). This is the expected result
from heterozygous individuals (who have both the mutant and wild
type sequences).
[0531] The genotype for each sample was determined by amplitude of
amplification. The average amplification threshold time for all
amplified reactions was determined using the I-Cycler software.
Fluorescence traces were normalized using early cycles as a
baseline, and a threshold value was determined, typically at
10-fold above the average standard deviation of the baseline
values. Threshold cycle for each trace was measured at the point
where the trace crossed the threshold value. Threshold cycle values
fell into three distinct clusters, one each for homozygous normal,
heterozygous, and homozygous mutant.
[0532] Genotype of each sample was determined automatically using a
modified fuzzy c-means clustering algorithm (Pickering, J., et al.,
Integration of DNA ligation and rolling circle amplification for
the homogeneous, end-point detection of single nucleotide
polymorphisms. Nucleic Acids Res, 30(12):e60 (2002)), which groups
the data into three genotypes plus a negative control, and assigns
a confidence level to each genotyping call from 0 (not in cluster)
to 1 (100% certainty that point belongs to cluster). The results of
this clustering can be seen in FIG. 5. FIG. 5 is an X-Y plot of end
point fluorescent readings obtained from the samples in FIGS.
6A-6F. The X-axis shows Cy3 fluorescence (arbitrary units)
corresponding to the mutant genotype. The Y-axis shows FAM signal
corresponding to wild type genotype, also in arbitrary units. End
point readings fall into three clusters that are easily
differentiated by genotype, as indicated in the Figure.
[0533] It is understood that the disclosed method and compositions
are not limited to the particular methodology, protocols, and
reagents described as these may vary. It is also to be understood
that the terminology used herein is for the purpose of describing
particular embodiments only, and is not intended to limit the scope
of the present invention which will be limited only by the appended
claims.
[0534] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
reference unless the context clearly dictates otherwise. Thus, for
example, reference to "a rolling circle replication primer"
includes a plurality of such rolling circle replication primers,
reference to "the open circle probes" is a reference to one or more
open circle probes and equivalents thereof known to those skilled
in the art, and so forth. "Optional" or "optionally" means that the
subsequently described event, circumstance, or material may or may
not occur or be present, and that the description includes
instances where the event, circumstance, or material occurs or is
present and instances where it does not occur or is not
present.
[0535] Ranges may be expressed herein as from "about" one
particular value, and/or to "about" another particular value. When
such a range is expressed, also specifically contemplated and
considered disclosed is the range from the one particular value
and/or to the other particular value unless the context
specifically indicates otherwise. Similarly, when values are
expressed as approximations, by use of the antecedent "about," it
will be understood that the particular value forms another,
specifically contemplated embodiment that should be considered
disclosed unless the context specifically indicates otherwise. It
will be further understood that the endpoints of each of the ranges
are significant both in relation to the other endpoint, and
independently of the other endpoint unless the context specifically
indicates otherwise. Finally, it should be understood that all of
the individual values and sub-ranges of values contained within an
explicitly disclosed range are also specifically contemplated and
should be considered disclosed unless the context specifically
indicates otherwise. The foregoing applies regardless of whether in
particular cases some or all of these embodiments are explicitly
disclosed.
[0536] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
skill in the art to which the disclosed method and compositions
belong. Although any methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present method and compositions, the particularly useful
methods, devices, and materials are as described. Publications
cited herein and the material for which they are cited are
specifically incorporated by reference. Nothing herein is to be
construed as an admission that the present invention is not
entitled to antedate such disclosure by virtue of prior
invention.
[0537] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the method and
compositions described herein. Such equivalents are intended to be
encompassed by the following claims.
Sequence CWU 1
1
26 1 12 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 1 tgattgcgaa tg 12 2 28 DNA
Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 2 tcattcgcaa tcaatgggca ccgaagaa 28 3 28 DNA
Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 3 tcattcgcaa tcaacggccg ataacaga 28 4 15 DNA
Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 4 cgcgcagaca cgata 15 5 77 DNA Artificial
Sequence Description of Artificial Sequence/Note= Synthetic
Construct 5 gcctgtccag ggatctgctt cttcggtccc atcgcgcaga cacgatagag
gaatacaaca 60 aaatacctgt attcctc 77 6 30 DNA Artificial Sequence
Description of Artificial Sequence/Note= Synthetic Construct 6
aaggaataca acaaaatacc tgtattcctt 30 7 15 DNA Artificial Sequence
Description of Artificial Sequence/Note= Synthetic Construct 7
gatccctgga caggc 15 8 18 DNA Artificial Sequence Description of
Artificial Sequence/Note= Synthetic Construct 8 gaggaataca acaaaata
18 9 17 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 9 agatgttctg ctttgtt 17 10 78
DNA Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 10 cagatttact acgtatgttg actggtcaca cgtcgttcta
gtaacaaagc actccctctt 60 gagatgttct gctttgtt 78 11 77 DNA
Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 11 gcttataaag actcgtcatg tctcagctct agtttctgat
cccatgactt cacctaccaa 60 atatctaggg atcagaa 77 12 95 DNA Artificial
Sequence Description of Artificial Sequence/Note= Synthetic
Construct 12 aaattgattc aggaaatact agcttataaa atgttgactg gtcacacgtc
gctctgatcc 60 catgacttca cctaccaaat atctagggat cagag 95 13 30 DNA
Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 13 cttcacctac caaatatcta gggatcagaa 30 14 30
DNA Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 14 cttcacctac caaatatcta gggatcagag 30 15 45
DNA Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 15 tcgatgactg acggtcatcg tactagagct gagacatgac
gagtc 45 16 43 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 16 tcgatgactg acggtcatcg
tacgacgtgt gaccagtcaa cat 43 17 79 DNA Artificial Sequence
Description of Artificial Sequence/Note= Synthetic Construct 17
atcatagaac acgaacagct ggtcatccag ttcttcgctg cccatcgcgc agacacgata
60 caagagagtg actctcttg 79 18 78 DNA Artificial Sequence
Description of Artificial Sequence/Note= Synthetic Construct 18
atcatagaac acgaacagct ggtcatctgc tctgttatcg gccgtcgcgc agacacgata
60 gatgaggcga ctctcatc 78 19 28 DNA Artificial Sequence Description
of Artificial Sequence/Note= Synthetic Construct 19 tcattcgcaa
tcaatgggca gcgaagaa 28 20 17 DNA Artificial Sequence Description of
Artificial Sequence/Note= Synthetic Construct 20 tgttcgtgtt ctatgat
17 21 79 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 21 agcctcaatg ctcccagtgc
acaagaccga aagggtagtc gcggattgtt gcgctgagaa 60 ataaaagtga ctctcagcg
79 22 79 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 22 agcctcaatg ctcccagtgc
actcaatccc aggcgagtcg cggattgttg tgctgagaga 60 ataaaagtga ctctcagca
79 23 28 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 23 tcattcgcaa tcacgcctgg
gattgagt 28 24 28 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 24 tcattcgcaa tcaccctttc
ggtcttgt 28 25 15 DNA Artificial Sequence Description of Artificial
Sequence/Note= Synthetic Construct 25 agtcgcggat tgttg 15 26 15 DNA
Artificial Sequence Description of Artificial Sequence/Note=
Synthetic Construct 26 cactgggagc attga 15
* * * * *