U.S. patent application number 10/307505 was filed with the patent office on 2003-09-04 for disease detection by digital protein truncation assays.
This patent application is currently assigned to The Johns Hopkins University. Invention is credited to Kinzler, Kenneth W., Traverso, C. Giovanni, Vogelstein, Bert.
Application Number | 20030165940 10/307505 |
Document ID | / |
Family ID | 32107735 |
Filed Date | 2003-09-04 |
United States Patent
Application |
20030165940 |
Kind Code |
A1 |
Traverso, C. Giovanni ; et
al. |
September 4, 2003 |
Disease detection by digital protein truncation assays
Abstract
Genetic diseases can be diagnosed by detection of mutations in
causative genes. Protein truncation assays can be used to detect
gene products of truncation-type mutations. However, the
sensitivity of the assays is often insufficient to detect mutations
present in a sample of DNA at a low frequency. Sensitivity can be
increased by dividing samples so that the signal generated by a
mutant allele comprises a larger fraction of the total alleles than
prior to dividing. Thus a previously undetectable signal generated
by the mutant allele can become detectable in the assay. Such
increased sensitivity permits detection at early stages and in
samples having high levels of other alleles.
Inventors: |
Traverso, C. Giovanni;
(Etobicoke, CA) ; Kinzler, Kenneth W.; (Bel Air,
MD) ; Vogelstein, Bert; (Baltimore, MD) |
Correspondence
Address: |
BANNER & WITCOFF
1001 G STREET N W
SUITE 1100
WASHINGTON
DC
20001
US
|
Assignee: |
The Johns Hopkins
University
Baltimore
MD
|
Family ID: |
32107735 |
Appl. No.: |
10/307505 |
Filed: |
December 2, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60336177 |
Dec 6, 2001 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6886 20130101;
G01N 33/68 20130101; C12Q 2600/156 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Goverment Interests
[0002] This invention was made using funds from the U.S.
government. The government retains certain rights in the invention
according to the terms of grants CA57345 and CA62924.
Claims
1. A method of detecting tumors, comprising: dividing a test sample
of APC alleles isolated from a patient, to form a plurality of
aliquots of APC alleles; amplifying said APC alleles in said
plurality of aliquots to form amplified APC alleles; transcribing
and translating proteins in vitro using said amplified APC alleles
as transcription templates; determining size or composition of said
proteins, wherein proteins which differ in size or composition from
the protein produced by a wild-type APC allele indicate a mutation
in an amplified APC allele which indicates a tumor in the
patient.
2. The method of claim 1 further comprising the step of determining
the concentration of APC alleles in the test sample by limiting
dilution polymerase chain reaction.
3. The method of claim 1 wherein said proteins are subjected to gel
electrophoresis.
4. The method of claim 1 wherein composition of said proteins is
determined using mass spectroscopy.
5. The method of claim 1 wherein said aliquots comprise on average
between 0 and 20 APC alleles prior to amplification.
6. The method of claim 1 wherein said aliquots comprise on average
between 0 and 10 APC alleles prior to amplification.
7. The method of claim 1 wherein said aliquots comprise on average
between 0 and 5 APC alleles prior to amplification.
8. The method of claim 1 wherein said aliquots comprise on average
between 0 and 1 APC alleles prior to amplification.
9. The method of claim 1 wherein said aliquots comprise on average
between 1 and 20 APC alleles prior to amplification.
10. The method of claim 1 wherein said aliquots comprise on average
between 5 and 20 APC alleles prior to amplification.
11. The method of claim 1 wherein said aliquots comprise on average
between 10 and 20 APC alleles prior to amplification.
12. The method of claim 1 wherein said aliquots comprise on average
between 1 and 5 APC alleles prior to amplification.
13. The method of claim 1 wherein said aliquots comprise on average
between 2 and 4 APC alleles prior to amplification.
14. The method of claim 1 wherein size is determined by
polyacrylamide gel electrophoresis.
15. The method of claim 1 wherein the step of dividing is performed
by diluting the APC alleles to achieve an average number of APC
alleles per aliquot of between 0 and 20.
16. The method of claim 1 wherein the step of dividing is performed
by diluting the captured APC alleles to achieve an average number
of APC alleles per aliquot of between 0 and 5.
17. The method of claim 1 wherein the test sample is a body fluid
or exudate.
18. The method of claim 1 wherein the test sample is a washing or
aspirate of an organ.
19. The method of claim 1 wherein the test sample of APC alleles
are isolated from a stool sample of the patient.
20. The method of claim 1 wherein the step of dividing is performed
by diluting the test sample.
21. The method of claim 19 wherein at least 500 bp of template is
amplified.
22. The method of claim 19 wherein at least 750 bp of template is
amplified.
23. The method of claim 19 wherein at least 1 kb of template is
amplified.
24. The method of claim 1 wherein at least a portion of exon 15 is
amplified.
25. The method of claim 19 wherein codons 1210 through 1581 of APC
are amplified.
26. The method of claim 1 wherein the step of amplifying employs a
first and a second set of primers, wherein the first set of primers
amplifies a template to which the second set of primers is
complementary.
27. The method of claim 1 wherein antibodies to a C-terminal
epitope of said proteins are used to determine composition of said
proteins.
28. The method of claim 1 wherein antibodies to a C-terminal
epitope of said proteins are used to immnunodeplete said proteins
of full-length proteins.
29. The method of claim 1 wherein antibodies to an N-terminal
epitope of said proteins are used to determine size or composition
of said proteins.
30. A method of detecting a disease associated with a mutation in a
gene, comprising: dividing a test sample of alleles of the gene
isolated from a patient, to form a plurality of aliquots of alleles
of the gene; amplifying said alleles in said plurality of aliquots
to form amplified alleles; transcribing and translating proteins in
vitro using said amplified alleles as transcription templates;
determining size or composition of said proteins, wherein proteins
which differ in size or composition from the protein produced by a
wild-type allele of the gene indicate a mutation in an amplified
allele of the gene which indicates the disease in the patient.
31. The method of claim 30 wherein the step of dividing is
performed by diluting the test sample.
32. The method of claim 30 further comprising the step of
determining the concentration of said alleles in the test sample by
limiting dilution polymerase chain reaction.
33. The method of claim 30 wherein said aliquots comprise on
average between 0 and 20 alleles prior to amplification.
34. The method of claim 30 wherein said aliquots comprise on
average between 0 and 10 alleles prior to amplification.
35. The method of claim 30 wherein said aliquots comprise on
average between 0 and 5 alleles prior to amplification.
36. The method of claim 30 wherein said aliquots comprise on
average between 0 and 1 alleles prior to amplification.
37. The method of claim 30 wherein said aliquots comprise on
average between 1 and 20 alleles prior to amplification.
38. The method of claim 30 wherein said aliquots comprise on
average between 5 and 20 alleles prior to amplification.
39. The method of claim 30 wherein said aliquots comprise on
average between 10 and 20 alleles prior to amplification.
40. The method of claim 30 wherein said aliquots comprise on
average between 1 and 5 alleles prior to amplification.
41. The method of claim 30 wherein said aliquots comprise on
average between 2 and 4 alleles prior to amplification.
42. The method of claim 30 wherein the step of dividing is
accomplished by diluting the alleles to achieve an average number
of alleles per aliquot of between 0 and 20.
43. The method of claim 30 wherein the step of dividing is
accomplished by diluting the alleles to achieve an average number
of alleles per aliquot of between 0 and 5.
44. The method of claim 30 wherein the gene is Merlin, and the
disease is neurofibromatosis type 2.
45. The method of claim 30 wherein the gene is VHL, and the disease
is von Hippel-Landau disease.
46. The method of claim 30 wherein the gene is CF, and the gene is
cystic fibrosis.
47. The method of claim 30 wherein the gene is hMSH2, and the
disease is Hereditary non-Polyposis Colon Cancer (HNPCC).
48. The method of claim 30 wherein the gene is hMLH1, and the
disease is Hereditary non-Polyposis Colon Cancer (HNPCC).
49. The method of claim 30 wherein the gene is hPMS2, and the
disease is Hereditary non-Polyposis Colon Cancer (HNPCC).
50. The method of claim 30 wherein said proteins are subjected to
gel electrophoresis.
51. The method of claim 30 wherein composition of said proteins is
determined using mass spectroscopy.
52. The method of claim 30 wherein size is determined by
polyacrylamide gel electrophoresis.
53. The method of claim 30 wherein the test sample is a body fluid
or exudate.
54. The method of claim 30 wherein the test sample is a washing or
aspirate of an organ.
55. The method of claim 30 wherein at least 500 bp of template is
amplified.
56. The method of claim 30 wherein at least 750 bp of template is
amplified.
57. The method of claim 30 wherein at least 1 kb of template is
amplified.
58. The method of claim 30 wherein the step of amplifying employs a
first and a second set of primers, wherein the first set of primers
amplifies a template to which the second set of primers is
complementary.
59. The method of claim 30 wherein antibodies to a C-terminal
epitope of said proteins are used to determine composition of said
proteins.
60. The method of claim 30 wherein antibodies to a C-terminal
epitope of said proteins are used to immunodeplete said proteins of
full-length proteins.
61. The method of claim 30 wherein antibodies to an N-terminal
epitope of said proteins are used to determine size or composition
of said proteins.
Description
[0001] This application claims the benefit of provisional
application serial no. 60/336,177 filed Dec. 6, 2001.
TECHNICAL FIELD OF THE INVENTION
[0003] This invention is related to the field of disease diagnosis
and prognosis. In particular it relates to the detection of
mutations in genes which are associated with a disease state or
with predisposition to disease.
BACKGROUND OF THE INVENTION
[0004] A revolution in fundamental knowledge about the molecular
basis of human cancer has occurred in the last fifteen years. One
major challenge for the future is to apply this ever-expanding
knowledge to the management of patients. Most efforts in this
regard have been devoted to therapeutic strategies, and exciting
advances have occasionally been made, such as those recently
reported for breast cancer.sup.1 and CML.sup.2. Much less work has
been devoted to diagnostic applications, even though early
detection through enhanced diagnosis is widely believed to be a
very effective strategy to reduce cancer mortality. Deaths from
cervical cancers, for example, have decreased dramatically since
the advent of routine Pap smears despite the fact that treatment
for cervical cancers has not improved dramatically.
[0005] Several established strategies for the early detection of
colorectal tumors have been devised. Colonoscopy, sigmoidoscopy,
and barium enemas provide highly specific and sensitive tests for
neoplasia.sup.3-6, but are invasive and are limited by available
expertise and patient compliance.sup.7, 8 . Testing for occult
blood in the stool (FOB) has in some studies been shown to reduce
incidence, morbidity and mortality from colorectal cancer.sup.9-13.
These FOB tests are non-invasive and extremely useful, but are not
completely sensitive or specific for neoplasia.sup.14-17.
Furthermore, some FOB tests require patients to change their
dietary habits prior to testing or require multiple tests,
potentially reducing compliance.sup.7, 18, 19. There is thus a
pressing need to develop new diagnostic tests that overcome these
obstacles.
[0006] One of the most promising classes of new diagnostic markers
comprises mutations in oncogenes and tumor suppressor genes.sup.20.
As these mutations are directly responsible for neoplastic growth,
they have clear conceptual advantages over indirect markers for
neoplasia such as fecal occult blood. Furthermore, because these
mutations only occur in a clonal fashion in neoplastic cells, they
theoretically have very high specificity. Several groups have
reported that mutations in cancer-related genes can be detected in
the stool of colorectal cancer patients.sup.21-35. However, the
sensitivities and specificities achieved have been limited either
by technical impediments or low frequencies of detectable mutations
in any specific gene. To increase sensitivity, investigators have
recently combined tests for mutations in several different genes or
combined tests for genetic alterations with other DNA-based tests
that are independent of mutation.sup.32-34. There is a continuing
need in the art for diagnostic methods for detection of early
stages of cancer and other diseases.
SUMMARY OF THE INVENTION
[0007] According to one embodiment of the invention a method is
provided of detecting tumors. A test sample of APC alleles isolated
from a patient is divided to form a plurality of aliquots of APC
alleles. The APC alleles in said plurality of aliquots are
amplified to form amplified APC alleles. The proteins are
transcribed and translated in vitro using the amplified APC alleles
as transcription templates. Size or composition of the proteins is
determined. Proteins which differ in size or composition from the
protein produced by a wild-type APC allele indicate a mutation in
an amplified APC allele which indicates a tumor in the patient.
[0008] According to another embodiment of the invention a method is
provided for detecting a disease associated with a mutation in a
gene. A test sample of alleles of the gene isolated from a patient
is divided to form a plurality of aliquots of alleles of the gene.
The alleles in the plurality of aliquots are amplified to form
amplified alleles. The proteins are transcribed and translated in
vitro using said amplified alleles as transcription templates. The
size or composition of the proteins is determined. Proteins which
differ in size or composition from the protein produced by a
wild-type allele of the gene indicate a mutation in an amplified
allele of the gene which indicates the disease in the patient. The
present invention thus provides the art with diagnostic methods for
detection of early stages of cancer and for detecting other
diseases
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1. Digital Protein Truncation Test. Dig-PT relies on
two basic principles: (1) the amplification of a small number of
APC gene templates in each PCR, and (2) the detection of truncated
polypeptides generated by in vitro transcription and translation
(IVTT) of the PCR products. The small lines in the left panel
represent single stranded APC templates present in a DNA
population, with black and red lines indicating wild-type and
mutant APC gene copies, respectively. Two situations are
illustrated in circles A and B. In circle A, the mutant APC genes
represent a large fraction of the total APC genes, as would be
found in a tumor. Analysis of the whole population of molecules by
PCR/IVTT readily reveals the mutant product, which is equivalent in
intensity to the normal APC product (lane A in the gel on the
right). In Circle B, the mutant APC genes represent only a small
fraction of the total APC genes, as would be found in the feces of
a patient with colorectal cancer. Analysis of the whole population
of molecules by PCR/IVTT does not reveal the mutant product, as it
is present in too small a proportion of the molecules to create a
detectable signal in the assay (lane B on the right). To reduce the
complexity and thereby increase the mutant: wild-type ratio,
.about.4 molecules were sampled in each well; the circles labeled C
to G within circle B surround the APC gene copies that were
amplified in individual wells. Lanes D, F, and G represent wells
with no mutant products; lane C represents a well in which one of
the two APC templates was mutant; lane E represents a well in which
one of four templates was mutant. The APC gene copies per well vary
stochastically according to a Poisson distribution.
[0010] FIG. 2. Examples of Dig-PT results. Dig-PT analyses of six
patients (ID# 28, 29, 35, 23, 15 and 34) with truncating mutations
in APC are displayed. The wild-type protein product is 43 kDa
(asterisk). The transcription-translation products from 30
individual reactions are shown in each case, and the abnormal
polypeptides are indicated by red arrowheads. Because of the
Poisson distribution of template molecules, an occasional lane will
contain no templates and will be blank (e.g., lane 2 in patient
#28).
[0011] FIG. 3. Identification of the mutations producing truncated
polypeptides in Dig-PT. PCR products that generated abnormal
polypeptides in Dig-PT were used for sequence analyses as described
in the Methods. In each case, primers were chosen based on the
position of the mutation expected from the Dig-PT results. The top
chromatogram in each case represents the wild-type (wt) sequence
while the bottom chromatogram depicts the mutant (mut) sequence
(black arrowheads mark site of genetic alteration). Examples of a
base substitution (Patient #13), on bp insertion (Patient #34) and
a five bp deletion (Patient #31) are illustrated. All mutations
resulted in stop codons (black circles) immediately downstream of
the mutations, as indicated on the right.
[0012] FIG. 4. APC mutation spectrum in fecal DNA. The black bar
depicts the APC region queried. A total of 21 different mutations
were identified among the 23 patients with positive Digital-PT
tests. Mutations occurred in the form of deletions (red triangles),
insertions (green squares) and base substitutions (yellow circles).
The numbers within the symbols refer to patient ID# (Table 1).
[0013] FIG. 5. Schematic of Immuno-selection in stool. FIG. 5A: The
protein of interest is labeled specifically at the N and C tennini
with distinct epitopes. This allows the separation of full length
protein (wild-type) from truncated ones. FIG. 5B: The signal to
noise ratio can be dramatically improved by eliminating the full
length proteins from the mixture as depicted by the
immunoprecipitation with the FLAG antibody. The remaining truncated
products can be directly analyzed or further purified by a second
immunoselection.
[0014] FIG. 6. Immuno-selection of truncated APC proteins with
fluorescently labeled amino-acids. FIGS. 6A and 6B are pictures of
the same gel with a greater exposure in FIG. 6B. An SDS-PAGE gel
was used to separate fluorescently labeled proteins which had
undergone imnuno-selection of APC proteins containing N-term-6-His
and C-term-FLAG. Lanes 1-3 contain the full length protein captured
with FLAG antibody. Lanes 1-3 contain varying amounts of mutant
(truncation-producing) template relative to the full length: lane
1={fraction (1/24)}, lane 2={fraction (1/12)} and lane3=1/6. Lanes
4-6 contain the truncated product which was eluted from nickel
agarose beads.
DETAILED DESCRIPTION
[0015] It is a finding of the present invention that diseases can
be detected at an early stage using techniques which increase the
signal to noise ratio. Means for increasing the signal to noise
ratio include elimination of noise (other DNA) by diluting or
dividing a sample to an extent that the signal represents a larger
fraction of the total than initially. Such techniques permit the
use of highly specific tests, such as protein truncation tests,
which may lack the ability to detect highly dilute signals.
[0016] Protein truncation tests are useful for detecting mutations
that result in stop codons, e.g., as a result of nonsense
substitutions or out-of frame deletions or insertions. Such tests
are the standard method for genetic diagnosis of familial
adenomatous polyposis (FAP). These techniques are described in
Powell S M, Petersen G M, Krush A J, et al. Molecular diagnosis of
familial adenomatous polyposis, N Engl J Med 1993; 329:1982-7, and
van der Luijt R, Khan P M, Vasen H, et al. Rapid detection of
translation-terminating mutations at the adenomatous polyposis coli
(APC) gene by direct protein truncation test, Genomics 1994;
20:1-4, which are expressly incorporated herein. Briefly, analyte
DNA markers are transcribed and translated in vitro and the size or
composition of the products is determined. Typically the products
are analyzed by gel electrophoresis, which can detect aberrant
migration as a change in size or amino acid composition, but other
methods can be used, including but not limited to gel
chromatography. Protein products can be analyzed using mass
spectroscopy, for example. Any technique for determining properties
of protein can be used, including immunological and sequencing
techniques.
[0017] Templates can be obtained using any technique known in the
art. Hybridization can be used to enrich for desired templates,
using such reagents as beads, magnetic beads, chromatographic
column packing matrix, and the like, which have attached
sequence-specific oligonucleotides. The oligonucleotides will bind
templates of the desired gene which is to be analyzed. Bound
templates can be eluted using any technique which separates duplex
DNA into single strands, such as heating above the T.sub.M.
[0018] Desirably a small number of template molecules for a DNA
marker are analyzed in multiple aliquots. The aliquots can be made
by dividing up a single sample or by diluting a sample. Preferably
each aliquot will contain less than 20 templates. More preferably
each aliquot will contain less than 10, less than 5, or less than 2
templates. At least some of the aliquots should contain at least 1
template, at least 5 templates or at least 10 templates. Using such
small number of template molecules in each aliquot permits
detection of mutations in templates which occur in less than 15% of
template molecules.
[0019] Amplification of templates can be accomplished by any linear
or exponential technique, including but not limited to polymerase
chain reaction and rolling circle amplification. All or a portion
of the desired analyte gene can be amplified. Preferably the
mutation spectrum of the analyte gene will be known and the
amplified portion will contain the majority of the mutations which
occur in the population being tested. For example in the APC gene,
about 65% of sporadic tumors harbor APC mutations in exon 15,
between codons 1210 to 1581.
[0020] Transcription and translation can be performed using any
particular techniques known in the art. Products can be labeled,
for example, using radiolabeled or fluorescently labeled amino
acids and can be detected using autoradiography or scintillation
counting. Products can also be analyzed and/or enriched using
antibodies which recognize the products, including products which
contain short oligopeptide tags. Antibodies to N- and C-terminal
epitopes, whether naturally occurring epitopes or introduced during
amplification, can be used to immunoselect rare products or
immunodeplete abundant products. The antibodies can be used in
conjunction with solid supports such as beads, magnetic beads,
filters, microtiter dishes, column packing materials, etc.
N-terminal and C-terminal epitopes may be, but need not be the
epitopes formed by the most terminal amino acids. Epitopes from
these general regions, i.e., within the terminal {fraction (1/10)},
1/8, 1/5, 1/4, or 1/3 of a protein may be used. Any detection and
sizing methods known in the art can be used. Optionally, amplified
products can be sequenced to ascertain the identity of a mutation
which causes a truncated protein product.
[0021] Any means can be used for isolation of a DNA from a sample
of a human or other test animal. Stool samples can be treated, for
example, as disclosed in U.S. Pat. Nos. 6,177,251 or 5,910,407.
Other samples which can be used as sources of DNA include tears,
saliva, urine, biopsy samples, tumor margins, serum, blood, plasma,
endometrial washings, nipple aspirates, semen, and bronchoalveolar
lavage. Other body fluids and exudates can be used as is
appropriate for the particular disease.
[0022] When a disease is referred to in the present application it
includes a finding of a predisposition to the disease. For example,
an APC mutation can be inherited and cause a predisposition to
develop colorectal and other cancers. APC mutations can also occur
somatically in sporadic tumors. Mutations in APC indicate either
the disease state or the predisposition. Other diseases which can
be detected using the present method include but are not limited to
hereditary nonpolyposis colon cancer, cystic fibrosis, von Hippel
Landau disease, and neurofibromatosis.
[0023] The above disclosure generally describes the present
invention. A more complete understanding can be obtained by
reference to the following specific examples which are provided
herein for purposes of illustration only, and are not intended to
limit the scope of the invention.
EXAMPLE 1
[0024] Methods Employed in the Subsequent Examples
[0025] Patients and Samples
[0026] A total of 68 stool samples were derived from a sequential
collection of 315 patients evaluated at M. D. Anderson Cancer
Center or surrounding hospitals between 1997 and 2000 for suspected
colorectal neoplasia. Of these patients, 77 had cancer, including
30 with Dukes' B2 (T3N0M0) disease, five with in situ lesions, six
with Duke's A, five with Duke's B1, 20 with Duke's C, nine with
Duke's D, and two of unknown/other classes. We chose to focus on
the Duke's B2 cases because these were the most common class and
because the great majority of B2 cancers should be surgically
curable, maximizing the potential impact of diagnostic detection
through analysis of stool. We excluded two of these 30 cases
because of other colonic lesions found at colonoscopy or surgery,
potentially complicating analysis. To control for the 28 cancer
patients, 28 control patients from the same cohort were selected
randomly from among the 55 patients who proved to be tumor-free
upon colonoscopy. The reasons for performing colonoscopy in these
controls included positive FOBT, rectal bleeding, or personal or
family history of colorectal neoplasia (Table 2).
[0027] From among this same 315 patient cohort, 12 patients were
identified who had single adenomas .gtoreq.1 cm in diameter. Stools
from patients with adenomas of this size were chosen because such
adenomas have an 8% chance of progressing to malignancy within ten
years after diagnosis, while smaller adenomas have a low risk of
progression.sup.44, 45. We additionally examined stool samples from
six patients with adenomas .gtoreq.1 cm in diameter from the Lahey
Clinic. These patients represented all those found to have adenomas
of this size among 172 patients referred to the Lahey Clinic for a
screening or diagnostic colonoscopy between September, 2000 and
June, 2001.
[0028] Stool samples were collected prior to colonoscopy from 19 of
the 46 patients with neoplasia and prior to surgery in the
remainder. All stool samples were collected prior to colonoscopy in
the controls. Patients received detailed oral and written
instructions for stool collection, which were all obtained prior to
beginning laxative treatments to prepare for surgery or
colonoscopy. None of the patients had familial adenomatous
polyposis or hereditary non-polyposis colon cancer. Verbal or
written informed consent was obtained from each patient,
documenting their willingness to participate in the
laboratory-based study. The work was carried out in accordance with
the institutional review boards at The University of Texas M. D.
Anderson Cancer Center, The Johns Hopkins Medical Institutions
(Baltimore, Md.), the Baylor College of Medicine, St. Luke's
Episcopal Hospital (Houston, Tex.), and the Lahey Clinic
(Burlington, Mass.).
[0029] Purification of DNA
[0030] Purification of DNA was performed using modifications of
procedures described in Ahlquist et al..sup.32. All stool samples
were thawed at room temperature and homogenized with an EXACTOR
stool shaker (EXACT Laboratories, Maynard, Mass.). After
homogenization, a 4-g stool equivalent of each sample was subjected
to two centrifugations (2536 g, 5 minutes and 16,500 g, 10 minutes)
to remove large and small particulate matter, respectively.
Supernatants were incubated with 20 .mu.L RNase (0.5mg/mL) for 1
hour at 37.degree. C., followed by a precipitation with {fraction
(1/10)} volume 3 mol/L NaOAc and an equal volume of isopropanol.
The crude DNA was dissolved in 10 mL of TE (0.01 mol/L Tris [pH
7.4] and 0.001 mol/L EDTA). Hybrid capture of APC genes was
performed by adding 300 .mu.L of sample to an equal volume of 6
mol/L guanidine Isothiocyanate solution (Invitrogen, Carlsbad,
Calif.) containing biotinylated sequence-specific oligonucleotides
(20 pmol; Midland Certified Reagent C., Midland, Tex.). After a
12-hour incubation at 25.degree. C., streptavidin-coated magnetic
beads were added to the solution, and the tubes incubated for an
additional hour at room temperature. The bead/hybrid capture
complexes were then washed four times with 1.times. B+W buffer
(1mol/L NaCl, 0.01 mol/L Tris-HCl [pH7.2], 0.001 mol/L EDTA, and
0.1% Tween 20), and the sequence-specific captured DNA was eluted
into 85.degree. C. pre-warmed 40 .mu.L L-TE (1 mmol/L Tris [pH 7.4]
and 0.1 mol/L EDTA) for 4 minutes. The concentration of amplifiable
APC templates in captured DNA was determined by limiting dilution,
using primers F1 and R1 for PCR, carried out as described
below.
[0031] Digital-PT
[0032] 1. PCR
[0033] Each reaction contained 1.times. PCR Buffer (Invitrogen,
Carlsbad, Calif.), 0.2 mM dNTPs, 2 mM MgSO.sub.4, 0.9 .mu.M
oligonucleotides F1 and R1, and 0.015 U/.mu.l Platinum Taq DNA
Polymerase High Fidelity (Invitrogen, Carlsbad, Calif.). A single
PCR mix, containing .about.580 APC template molecules, was prepared
for each stool sample and the mix aliquotted to 144 wells; each
well therefore contained .about.four APC templates. After an
initial denaturation at 94.degree. C. for 2 minutes, amplifications
were performed as follows: 3 cycles of: 94.degree. C for 30
seconds, 67.degree. C. for 30 seconds, 70.degree. C. for 1 minute;
3 cycles of: 94.degree. C. for 30 seconds, 64.degree. C. for 30
seconds, 70.degree. C. for 1 minute; 3 cycles of: 94.degree. C. for
30 seconds, 61.degree. C. for 30 seconds, 70.degree. C. for 1
minute; 50 cycles of: 94.degree. C. for 30 seconds, 58.degree. C.
for 30 seconds, 70.degree. C. for 1 minute. One .mu.L of the
reaction was added to a 10-.mu.L PCR reaction of the same makeup as
the one described above except that primers F2 and R2 were used.
Following a 2 minute denaturation step at 94.degree. C., the
reaction was cycled for 15 cycles of 94.degree. C. for 30 seconds,
58.degree. C. for 30 seconds, 70.degree. C. for 1 minute. Primer
sequences were: F1, 5'-GGTAATTTTGAAGCAGTCTGGGC-3' (SEQ ID NO: 1);
R1, 5'-ACGTCATGTGGATCAGCCTATTG-3' (SEQ ID NO: 2); F2:
5'-GGATCCTAATACGACTCACTATAGGGAGACCACCATGATGATGA
TGATGATGATGATGATGATGATGTC- TGGACAAAGCAGTAAAACCG -3' (SEQ ID NO: 3);
and R2: 5'-TTTTTTTTAACGCTGATGACTT- TGTTGGCATGGC-3' (SEQ ID NO:
4).
[0034] 2. In Vitro Transcription and Translation
[0035] In vitro transcription and translation was performed in
5-.mu.L volumes in 96-well polypropylene PCR plates. Reactions
consisted of 4-.mu.L TnT T7 Quick for PCR DNA (Promega, Madison,
Wis.), 0.25-.mu.L .sup.35S-Promix (Amersham Pharmacia Biotech,
Piscataway, N.J.), 0.25-.mu.L dH.sub.2O, 0.5-.mu.L of F2/R2 PCR
products. Reactions were covered with mineral oil and incubated at
30.degree. C. for 90 minutes, then diluted with Laemmli sample
buffer and denatured at 95.degree. C. for 2 minutes. Proteins were
separated on 10-20% Tris-Glycine gradient polyacrylamide gels, then
fixed in ethanol and dried prior to autoradiography.
[0036] Sequencing Studies
[0037] PCR products from wells yielding truncated peptides in the
Dig-PT assay were isolated and gel purified using the Q1Aquick Gel
Extraction kit (Qiagen, Valencia, Calif.). The DNA was then cloned
using the TOPO Cloning kit (Invitrogen, Carlsbad, Calif.). Single
colonies were used for PCR and the products sequenced with dye
terminators (Applied Biosystems Prism Cycle Sequencing, v. 3.0).
Sequencing reactions were analyzed on an SCE-9610 96-well capillary
electrophoresis system (SpectruMedix Corporation, State College,
Pa.). In seven cases, DNA was prepared from archived tumors and
small regions of the APC amplified and subjected to manual sequence
analysis with ThermoSequinase (Amersham Pharmacia, Inc.,
Piscataway, N.J.) to confirm that the mutations identified in stool
were also present in the patient's tumors.
EXAMPLE 2
[0038] Development of Dig-PT Assay
[0039] The intent of the current study was to develop a single
gene-based test that would facilitate the specific detection of
clinically significant but pre-metastatic colorectal tumors.
Conceptually, the optimal gene for such studies is APC.sup.36, 37.
APC mutations generally initiate colorectal neoplasia and therefore
are present in tumors at an earlier stage than any other genetic
alteration.sup.38. Other mutations, like those in p53, are present
only in the later stages of colorectal neoplasia.sup.39 or, like
those in c-Ki-RAS, may be present in non-neoplastic but
hyperproliferative cells.sup.40-42. Practically, however, detection
of mutations in APC present extraordinarily difficult technical
challenges. Unlike c-Ki-RAS gene mutations, which have been used
for most previous studies because mutations are clustered at two
codons, mutations in APC can occur virtually anywhere within the
first 1600 codons of the gene.sup.43. Moreover, the nature of
individual mutations (base substitutions, insertions or deletions
of diverse length) varies widely among tumors. Though such APC
mutations can be detected relatively easily in tumors, where they
are present in every neoplastic cell, they are much harder to
detect in fecal DNA, where they may be present in less than one in
a hundred of the total APC genes present in the sample. Herein we
describe an approach that allowed us to detect such mutations in
the fecal DNA of cancer patients in a highly precise, specific, and
quantitative fashion.
[0040] The detection of APC mutations in fecal DNA required us to
surmount two major technical hurdles. The first involved
purification of DNA templates that were of sufficient size to allow
PCR of a substantial region of the APC gene. It has been
demonstrated previously that .about.65% of sporadic tumors harbor
APC mutations between codons 1210 and 1581, representing an expanse
of 1113 nucleotides.sup.43. For our analysis, it was important to
be able to amplify this region within a single PCR product rather
than in multiple overlapping PCR products. The DNA molecules to be
assessed must therefore be considerably larger than 1100 nt.
However, stool contains numerous inhibitors of DNA polymerization,
and long PCR products, such as those of 1100 bp, are particularly
sensitive to such inhibitors. During the developmental stages of
this study, we explored numerous methods for stool homogenization,
DNA purification, and PCR conditions. The final method, employing
affinity capture, resulted in routine amplification of fragments of
the required size from the stools of all 56 individuals analyzed. A
median of 4.3 and 2.3 APC gene copies/mg stool were found in
patients with and without colorectal neoplasia, respectively, with
wide variations from patient to patient (Tables 1 & 2).
[0041] The second technical hurdle involved the identification of
mutations within these PCR products. It has previously been shown
that virtually all APC mutations result in stop codons as a result
of nonsense substitutions or small out-of-frame deletions or
insertions.sup.43. APC mutations can therefore be identified
through in vitro transcription and translation of suitably
engineered PCR products.sup.46, 47. This "in vitro synthesized
protein (IVSP)" or "protein truncation (PT)" test is the standard
method for genetic diagnosis of familial adenomatous polyposis
(FAP). However, this method could not be used to evaluate fecal DNA
samples because of the high preponderance of wild-type sequences
over mutated sequences in such samples. In particular, the
sensitivity of the conventional method was limited to mutations
that were present in more than 15% of template molecules while
mutant APC genes were expected to be present in fecal DNA at much
lower frequency. We therefore developed a modification of this
method, called Digital Protein Truncation (Dig-PT), that
considerably increased its sensitivity. In brief, a small number of
template molecules was included in each reaction and the protein
products of each reaction separated through polyacrylamide gel
electrophoresis (FIG. 1). In this way we could analyze as many gene
copies as desired from each sample. In the current study, we chose
to assess 144 reactions each containing .about.4 APC gene copies.
To increase the specificity of Dig-PT and to control for
polymerase-generated errors, the test was scored positive for
mutation only when the same size truncated protein product was
identified at least twice among the .about.576 APC gene copies
analyzed.
EXAMPLE 3
[0042] Analysis of Cancer Patients and Controls
[0043] Dig-PT was used to analyze stool samples from the 74
patients described in Methods. Of the 46 patients with neoplasia,
mutations were identified in 26 (57%, Cl 41% to 71%).
Representative positive Dig-PT assays are shown in FIG. 2. In FIG.
2, for example, it is clear that several independent PCR products
from stool #5 generated a truncated polypeptide of 12 kDa in
addition to the normal protein of 43 kDa in size Different
truncated polypeptides were identified in other patients (FIG. 2).
No mutations were identified in the Dig-PT assay in the 28 control
individuals without neoplastic disease (0%, CI 0 to 12%). The
difference between patients with and without neoplastic disease was
highly significant (2-sided p<0.001, Fishers exact test).
Positive Dig-PT results were obtained in patients with both cancer
(61% of 28) and pre-malignant adenomas (50% of 18). Additionally,
positive Dig-PT results were observed in 56% of 36 patients with
neoplasms distal to the splenic flexure and in 60% of ten patients
with more proximal lesions. There was also no appreciable
difference in our ability to detect mutations in stools collected
prior to colonoscopy (53% of 19 cases) vs. those collected after
colonoscopy but prior to surgery (59% of 27 cases). In those
patients scoring positive, the fraction of altered APC genes ranged
from 0.4% to 14% of the total APC genes in the stool sample (Table
1).
EXAMPLE 4
[0044] Confirmation of Mutations
[0045] The Dig-PT assay provided evidence for mutations that were
predicted to truncate the protein at specific positions within the
gene. To confirm that the abnormal polypeptides observed in this
assay represented APC mutations, and to determine the nature of
these mutations, we determined the sequence of corresponding PCR
products. The PCR products from two wells whose
transcription/translation products produced truncated proteins of
identical size were purified and cloned from each patient scoring
positively in the Dig-PT assay. These cloned PCR products were then
subjected to automated sequencing. In each of the 26 cases, we
observed a mutation that was predicted to result in a truncated
polypeptide of exactly the size observed in the Dig-PT assay
(examples shown in FIG. 3). The spectrum of mutations was broad,
with 27 different mutations identified in the 26 samples (FIG. 4).
Sixteen (59%) of these mutations were nucleotide substitutions
resulting in nonsense mutations, two (7.4%) were small insertions,
and nine (33%) were small deletions (Table 1). The frequency and
type of these mutations closely resembled those described
previously in sporadic colorectal tumors.sup.43. The insertions and
deletions resulted in frameshifts producing stop codons 2 to 49 bp
downstream from the sites of mutation.
EXAMPLE 5
[0046] Immuno-Selection of Truncated APC Proteins
[0047] As described above, one way of improving the signal-to-noise
ratio is by way of a controlled dilution of the DNA sample. It is
also possible to improve the signal-to-noise ratio at the protein
level by subtracting full-length protein from a mixed population of
truncated and full-length proteins. The protein can be tagged at
the N- and C-termini by the addition of distinct epitopes (e.g.,
HA, FLAG, 6-His, myc, etc.).
[0048] For example, using the same PCR primers as described above,
one can add the 6-His sequence to the F2 primer and the FLAG
sequence to the R2 primer. Following translation of the PCR
products, "full-length" APC protein product will contain an N
terminal 6-His epitope and a FLAG C-terminal epitope. DNA molecules
with a truncating mutation will yield truncated proteins which
contain only the N-terminal FLAG epitope. The protein mixture can
be immunodepleted by incubation with FLAG-agarose beads. (Other
solid supports can be used, e g, magnetic beads, as depicted in the
accompanying figure.) The "full-length" proteins will be bound by
the beads while the truncated ones will remain in solution. The
solution can be analyzed directly or concentrated, e.g., by
immunoprecipitating the truncated products with beads containing
antibodies to an N-terminal epitope (6-His in FIG. 5). Results of
such an experiment are shown in FIGS. 6A and 6B and described in
the Brief Description of the Drawings.
EXAMPLE 6
[0049] Discussion
[0050] The results described above show that PCR-amplifiable DNA
fragments >1100 bp in size could be purified from the stools of
all patients analyzed, whether or not they had colorectal
neoplasia. The keys to this purification involved affinity
purification of APC genes through hybrid capture rather than the
physicochemical methods that are conventionally used to purify DNA.
Equally important for the success of the amplification was the
development of highly efficient methods for producing relatively
long PCR products in the presence of inhibitors. The number of DNA
molecules in stool samples varied widely, consistent with the large
variation of fecal content and volume expected from a diverse
American population (Tables 1 & 2). The bulk of DNA in the
stool is derived from sloughed normal cells whose number
undoubtedly reflects the vagaries of diet and bowel habits. Though
intestinal epithelial cells normally turn over at a high rate, most
of their DNA appears to be reabsorbed through phagocytosis rather
than shed into the stool.sup.48.
[0051] In addition to quantifying the number of total APC alleles
present in stool, our approach allowed us to determine the fraction
of mutant APC molecules present in the same samples. This ranged
from 0.4% to 14% in our patients. This variation had little
correlation with the size of the tumors, their site, or their
malignancy (adenoma vs. carcinoma), but instead was likely
determined by the "contaminating" DNA from non-neoplastic cells
present in the stool by virtue of the processes described above.
Knowledge gained from the current study about the actual fraction
of mutant DNA molecules present in stool should prove important to
the design of future studies in this area. For example, our results
indicate that any technique to assess mutant DNA molecules in fecal
DNA must have the capacity to distinguish one mutant molecule from
at least 250 wild type molecules if comparable sensitivity is to be
achieved.
[0052] Another advantage of the approach described here is that
only a single PCR product, encompassing APC codons 1210 to 1581 was
used for analysis. Prior studies generally employed multiple PCR
products from the same gene or from several genes to increase
sensitivity. Even with such multiple tests, past studies have not
documented sensitivities as high as those described here in
patients with equivalent disease status. In particular, our study
is the first to focus on relatively early stage lesions. All of the
patients we analyzed had either pre-malignant adenomas or
pre-metastatic carcinomas. Because of the high potential for cure
through surgical or endoscopic removal of these lesions, their
detection through non-invasive methods like Dig-PT offers
outstanding opportunities for reducing morbidity and mortality in
the future.
[0053] An important component of our study was the high specificity
observed: no APC alterations were identified in any of the 28
controls without neoplasia. Of the published studies on fecal DNA
mutations.sup.21-35, few employed more than three stool samples
from normal individuals as controls. In one such study, c-Ki-Ras
mutations were observed in 7% of the controls.sup.32. Aberrant
crypt foci and small hyperplastic polyps, which occur relatively
frequently in normal individuals but are thought not to be
precursors to cancer, often contain c-Ki-Ras gene mutations but do
not harbor APC mutations.sup.40-42, further emphasizing the value
of APC for stool-based testing.
[0054] The necessity for an APC-based technique that could reveal
multiple different mutations was clear from the mutation spectrum
shown in FIG. 4. Only four mutations were found in more than one
patient, and the type and location of the detected mutations varied
considerably. These data are consistent with the mutations
previously found in sporadic colorectal tumors.sup.43. The fraction
of patients positive with the Dig-PT assay (57%) was close to the
theoretical fraction of patients expected to be positive from these
previous studies (65%) Though tumor material suitable for
mutational analyses was not available for most patients, we were
able to identify APC mutations in seven primary colorectal cancers,
and in each case, the mutation was identical to that found in the
stool (examples in FIG. 3).
[0055] In summary, it is clearly possible to detect APC mutations
in fecal DNA in a substantial fraction of patients with potentially
curable colorectal tumors. Our analyses clearly showed that that it
was feasible to detect fecal APC mutations in patients whose tumors
were pre-malignant or located in the proximal colon (Table 1). It
was of interest that five of the control patients in our study had
a positive FOBT as the reason for colonoscopy, while in another
six, the reason was rectal bleeding, precluding FOBT (Table 2).
This result supports the potential value of a more specific
genetically-based test for analysis of feces. As Dig-PT screening
is based on the identification of abnormal proteins synthesized
from mutant genes, the powerful new tools being developed for
proteomics should be directly applicable to this approach in the
future, further increasing its power.
1TABLE 1 Characteristics of Patients with Neoplasia APC gene
Fraction of Mutation identified (codon, Patient Site of Diameter
copies/mg Mutant normal sequence->mutant ID # Age Sex Cancer
Stage/Histology (cm) stool APC genes sequence) 1 36 Female Rectum
B2 (T3N0M0) 1.3 40.6 NF N/A 2 42 Female Rectum B2 (T3N0M0) 0.2
309.8 1.3% 1319, TCC->TC 3 45 Male Rectum B2 (T3N0M0) 0.5 32.7
NF N/A 4 46 Female Rectum Tubular Adenoma 2.5 5.0 NF N/A 5 47 Male
Rectum B2 (T3N0M0) 3.0 9.7 3.6% 1367, CAG->TAG: 1411,
AGT->AG* 6 47 Female Rectum B2 (T3N0M0) NR 75.6 1.3% 1286,
ATA->TA 7 50 Male Rectum B2 (T3N0M0) 1.6 57.4 NF N/A 8 50 Male
Rectum B2 (T3N0M0) 3.7 0.1 6.6% 1309, AAAGAAAAGA->AAAGA 9 50
Male Rectum B2 (T3N0M0) 0.9 18.8 NF N/A 10 52 Female Rectum Villous
Adenoma 3.0 26.6 1.1% 1554, GAAAAAACT->GAAAAAAACT 11 52 Female
Transverse Tubular Adenoma 4.5 591.4 0.5% 1450, CGA->TGA 12 52
Female Ascending Tubulovillous Adenoma 2.0 3.7 NF N/A 13 52 Female
Sigmoid B2 (T3N0M0) 3.5 21.9 5.6% 1295, GAA->TAA 14 53 Male
Rectum B2 (T3N0M0) 1.4 18.7 12.8% 1406, CAG->TAG 15 54 Male
Descending Tubular Abenoma 2.0 1.6 1.0% 1489, TTA->TT 16 54 Male
Rectum B2 (T3N0M0) 2.4 757.8 NF N/A 17 57 Male Splenic Flexure B2
(T3N0M0) 6.7 6.4 NF N/A 18 58 Male Sigmoid Tubular Adenoma 1.0 1.4
1.2% 1463, GAG->G 19 60 Male Rectum B2 (T3N0M0) 4.3 0.4 2.0%
1317, GAA->TAA 20 61 Female Rectum Villous Adenoma 4.5 0.2 NF
N/A 21 61 Female Rectum B2 (T3N0M0) NR 0.1 NF N/A 22 62 Female
Rectum Villous Acenoma 3.0 1.2 NF N/A 23 62 Female Rectum B2
(T3N0M0) 0.6 6.6 2.3% 1435, AGA->TGA 24 63 Male Rectum B2
(T3N0M0) 0.8 9.4 NF N/A 25 64 Male Rectum B2 (T3N0M0) 2.4 5.1 NF
N/A 26 64 Male Rectum B2 (T3N0M0) 1.3 800.0 0.4% 1309, GAA->TAA
27 64 Male Rectum B2 (T3N0M0) 1.7 133.4 3.1% 1353, GAA->TAA 28
67 Female Rectum B2 (T3N0M0) 1.1 2.5 14.1% 1303, CAA->TAA 29 67
Male Rectum B2 (T3N0M0) 2.4 300.0 1.9% 1394,
CTTGATAGTT->CTTGAGTT 30 68 Female Ascending B2 (T3N0M0) 1.7 0.2
NF N/A 31 69 Male Rectum B2 (T3N0M0) 5.0 1.5 1.2% 1309,
AAAGAAAAGA->AAAGA 32 70 Female Ascending Tubular Adenoma 1.0 1.3
1.9% 1463, GAG->G 33 70 Male Sigmoid B2 (T3N0M0) 1.7 9.0 0.5%
1480, CAG->TAG 34 70 Male Rectum B2 (T2N0M0) 1.6 1.5 5.8% 1554,
GAAAAAACT->GAAAAAAACT 35 73 Female Ascending Tubulovillous
Adenpma 1.0 0.2 1.8% 1412, GGA->TGA 36 74 Female Sigmoid
Tubulovillous Adenoma 3.0 1.4 NF N/A 37 75 Male Rectum B2 (T3N0M0)
NR 59.2 0.9% 1315, TCA->TAA 38 76 Male Sigmoid B2 (T3N0M0) 1.3
2.5 NF N/A 39 76 Male Rectum B2 (T3N0M0) 1.4 3.5 1.6% 1408,
GAA->TAA 40 78 Male Hepatic Tubulovillous Adenoma 2.5 5.8 NF N/A
Flexure NR = Diameter not recorded NF = Mutaton not found N/A = Not
applicable *= Two different mutations identified by Dig-PT and
confirmed by sequencing
[0056]
2TABLE 2 Characteristics of Control Patients APC gene Patient
Reason for copies/mg ID # Age Sex Colonoscopy stool C1 26 Male
Abdominal pain, Rectal 40.1 Bleeding C2 27 Female FOBT Positive 3.9
C3 35 Male Rectal Bleeding 6.1 C4 36 Female Low abdominal pain 0.3
C5 36 Female Family History of Attenuated 2.3
polyposis-questionable C6 41 Female FOBT Positive 1.8 C7 42 Male
Family History of Colorectal 7.4 Cancer C8 44 Female Rectal
Bleeding 2.3 C9 44 Female Family History of Colorectal 17.4 Cancer
C10 47 Female FOBT Positive 1.4 C11 50 Male Family History of
Colorectal 2.6 Cancer C12 53 Female Family History of Colorectal
3.8 Cancer C13 53 Female Family History of Colorectal 12.3 Cancer
C14 54 Female Family History of Colorectal 5.9 Cancer C15 55 Female
Family History of Polyps 1.1 C16 55 Female History of 11.8
Adenomas/Nonadenomatous Polyps C17 56 Female Family History of
Colorectal 2.0 Cancer C18 56 Female Low abdominal pain 1.0 C19 58
Female Rectal Bleeding 35.7 C20 61 Female FOBT Positive 0.7 C21 62
Female FOBT Positive 2.4 C22 62 Female Family History of Colorectal
0.1 Cancer C23 66 Female Rectal Bleeding 1.0 C24 69 Female Family
History of Colorectal 0.6 Cancer C25 69 Male Screening 0.3 C26 70
Female Family History of Colorectal 0.5 Cancer C27 72 Female Rectal
Bleeding 4.7 C28 73 Female Low abdominal pain 0.4 FOBT = Fecal
occult blood test
REFERENCES
[0057] 1. Slamon D J, Leyland-Jones B, Shak S, et al. Use of
chemotherapy plus a monoclonal antibody against HER2 for metastatic
breast cancer that overexpresses HER2. N Engl J Med 2001;
344:783-92.
[0058] 2. Druker B J, Talpaz M, Resta D J, et al. Efficacy and
safety of a specific inhibitor of the BCR-ABL tyrosine kinase in
chronic myeloid leukemia. N EngI J Med 2001; 344:1031-7.
[0059] 3. Newcomb P A, Norfleet R G, Storer B E, Surawicz T S,
Marcus P M. Screening sigmoidoscopy and colorectal cancer
mortality. J Natl Cancer Inst 1992; 84:1572-5.
[0060] 4. Selby J V, Friedman G D, Quesenberry C P, Jr., Weiss N S.
A case-control study of screening sigmoidoscopy and mortality from
colorectal cancer. N Engl J Med 1992; 326:653-7.
[0061] 5. Lieberman DA, Weiss D G, Bond J H, Ahnen D J, Garewal U,
Chejfec G. Use of colonoscopy to screen asymptomatic adults for
colorectal cancer. Veterans Affairs Cooperative Study Group 380. N
Engl J Med 2000; 343:162-8.
[0062] 6. Imperiale T F, Wagner D R, Lin C Y, Larkin G N, Rogge J
D, Ransohoff D F. Risk of advanced proximal neoplasms in
asymptomatic adults according to the distal colorectal findings. N
Engl J Med 2000; 343:169-74.
[0063] 7. Trends in Screening for Colorectal Cancer--United States,
1997 and 1999. JAMA 2001; 285:1570-1571.
[0064] 8. Scotiniotis I, Lewis J D, Strom B L. Screening for
colorectal cancer and other GI cancers. Curr Opin Oncol 1999;
11:305-11.
[0065] 9. Mandel J S, Bond J H, Church T R, et al. Reducing
mortality from colorectal cancer by screening for fecal occult
blood. Minnesota Colon Cancer Control Study. N Engl J Med 1993;
328:1365-71.
[0066] 10. Kronborg O, Fenger C, Olsen J, Jorgensen O D,
Sondergaard O. Randomised study of screening for colorectal cancer
with faecal-occult-blood test. Lancet 1996; 348:1467-71.
[0067] 11. Hardcastle J D, Chamberlain J O, Robinson M H, et al.
Randomised controlled trial of faecal-occult-blood screening for
colorectal cancer. Lancet 1996; 348:1472-7.
[0068] 12. Towler B, Irwig L, Glasziou P, Kewenter J, Weller D,
Silagy C. A systematic review of the effects of screening for
colorectal cancer using the faecal occult blood test, Hemoccult.
BMJ 1998; 317:559-65.
[0069] 13. Mandel J S, Church T R, Bond J H, et al. The effect of
fecal occult-blood screening on the incidence of colorectal cancer.
N Engl J Med 2000; 343:1603-7.
[0070] 14. Allison J E, Feldman R, Tekawa I S. Hemoccult screening
in detecting colorectal neoplasm: sensitivity, specificity, and
predictive value. Long-term follow-up in a large group practice
setting. Ann Intern Med 1990; 112:328-33.
[0071] 15. Verne J E, Aubrey R, Love S B, Talbot I C, Northover J
M. Population based randomized study of uptake and yield of
screening by flexible sigmoidoscopy compared with screening by
faecal occult blood testing. BMJ 1998; 317:182-5.
[0072] 16. Mandel J S, Church T R, Ederer F, Bond J H. Colorectal
cancer mortality: effectiveness of biennial screening for fecal
occult blood. J Natl Cancer Inst 1999; 91:434-7.
[0073] 17. Rozen P, Knaani J, Samuel Z. Comparative screening with
a sensitive guaiac and specific irnmunochemical occult blood test
in an endoscopic study. Cancer 2000; 89:46-52.
[0074] 18. Ore L, Hagoel L, Lavi I, Rennert G. Screening with
faecal occult blood test (FOBT) for colorectal cancer: assessment
of two methods that attempt to improve compliance. European Journal
of Cancer Prevention 2001; 10:251-56.
[0075] 19. Shields H M, Weiner M S, Henry D R, et al. Factors that
influence the decision to do an adequate evaluation of a patient
with a positive stool for occult blood. Am J Gastroenterol 2001;
96:196-203.
[0076] 20. Kinzler K W, Vogelistein B. The Genetic Basis of Human
Cancer. Toronto: McGraw-Hill, 1998.
[0077] 21. Sidransky D, Tokino T, Hamilton S R, et al.
Identification of ras oncogene mutations in the stool of patients
with curable colorectal tumors. Science 1992; 256:102-5.
[0078] 22. Smith-Ravin J, England J, Talbot I C, Bodmer W.
Detection of c-Ki-ras mutations in faecal samples from sporadic
colorectal cancer patients. Gut 1995; 36:81-6.
[0079] 23. Hasegawa Y, Takeda S, Ichii S, et al. Detection of K-ras
mutations in DNAs isolated from feces of patients with colorectal
tumors by mutant-allele-specific amplification (MASA). Oncogene
1995; 10:1441-5.
[0080] 24. Koornstra J J, Rokke O, Halvorsen J F, Haug K, Ogreid D.
Determination of the activated proto-oncogene (Ki-ras) in feces. A
new laboratory analysis for early diagnosis of colorectal cancer.
Tidsskr Nor Laegeforen 1995; 115:3266-70.
[0081] 25. Ratto C, Flamini G, Sofo L, et al. Detection of oncogene
mutation from neoplastic colonic cells exfoliated in feces. Dis
Colon Rectum 1996; 39:1238-44.
[0082] 26. Villa E, Dugani A, Rebecchi A M, et al. Identification
of subjects at risk for colorectal carcinoma through a test based
on K-ras determination in the stool. Gastroenterology 1996;
110:1346-53.
[0083] 27. Eguchi S, Kohara N, Komuta K, Kanematsu T. Mutations of
the p53 gene in the stool of patients with resectable colorectal
cancer. Cancer 1996; 77:1707-10.
[0084] 28. Kohata Y. Detection of K-ras point mutations in the
stool of patients with colorectal tumors. Nippon Shokakibyo Gakkai
Zasshi 1996; 93:391-7.
[0085] 29. Nollau P, Moser C, Weinland G, Wagener C. Detection of
K-ras mutations in stools of patients with colorectal cancer by
mutant-enriched PCR. Int J Cancer 1996; 66:332-6.
[0086] 30. Deuter R, Muller O . Detection of APC mutations in stool
DNA of patients with colorectal cancer by HD-PCR. Hum Mutat 1998;
11:84-9.
[0087] 31 Puig P, Urgell E, Capella G, et al. Improved detection of
K-ras codon 12 mutations in fecal exfoliated cells. Lab Invest
1999; 79:617-8.
[0088] 32. Ahlquist D A, Skoletsky J E, Boynton K A, et al.
Colorectal cancer screening by detection of altered human DNA in
stool: feasibility of a multitarget assay panel. Gastroenterology
2000; 119:1219-27.
[0089] 33. Dong S M, Traverso G, Johnson C, et al. Detecting
Colorectal Cancer in Stool With the Use of Multiple Genetic
Targets. J Natl Cancer Inst 2001; 93:858-865.
[0090] 34. Rengucci C, Maiolo P, Saragoni L, Zoli W, Amadori D,
Calistri D. Multiple detection of genetic alterations in tumors and
stool. Clin Cancer Res 2001; 7:590-3.
[0091] 35. Doolittle B R, Emanuel J, Tuttle C, Costa J. Detection
of the mutated k-ras biomarker in colorectal carcinoma. Exp Mol
Pathol 2001; 70:289-301.
[0092] 36. Boland C R. Genetic pathways to colorectal cancer. Hosp
Pract 1997; 32:79-84, 87-96.
[0093] 37. Kinzler K W, Vogelstein B. Lessons from Hereditary Colon
Cancer. Cell 1996; 87:159-170.
[0094] 38. Tsao J, Shibata D. Further evidence that one of the
earliest alterations in colorectal carcinogenesis involves APC. Am
J Pathol 1994; 145:531-4.
[0095] 39. Baker S J, Preisinger A C, Jessup J M, et al. p53 gene
mutations occur in combination with 17p allelic deletions as late
events in colorectal tumorigenesis. Cancer Res 1990;
50:7717-22.
[0096] 40. Smith A J, Stem H S, Penner M, et al. Somatic APC and
K-ras codon 12 mutations in aberrant crypt foci from human colons.
Cancer Res 1994; 54:5527-30.
[0097] 41. Jen J, Powell S M, Papadopoulos N, et al. Molecular
determinants of dysplasia in colorectal lesions. Cancer Res 1994;
54:5523-6.
[0098] 42. Pretlow T P. Aberrant crypt foci and K-ras mutations:
earliest recognized players or innocent bystanders in colon
carcinogenesis? Gastroenterology 1995; 108:600-3.
[0099] 43. Laurent-Puig P, Beroud C, Soussi T. APC gene: database
of gernline and somatic mutations in human tumors and cell lines.
Nucleic Acids Res 1998; 26:269-70.
[0100] 44. Stryker S J, Wolff B G, Culp C E, Libbe S D, Ilstrup D
M, MacCarty R L. Natural history of untreated colonic polyps.
Gastroenterology 1987; 93:1009-13.
[0101] 45. Bond J H. Clinical relevance of the small colorectal
polyp. Endoscopy 2001; 33:454-7.
[0102] 46. Powell S M, Petersen G M, Krush A J, et al. Molecular
diagnosis of familial adenomatous polyposis. N Engl J Med 1993;
329:1982-7.
[0103] 47. van der Luijt R, Khan P M, Vasen H, et al. Rapid
detection of translation-terminating mutations at the adenomatous
polyposis coli (APC) gene by direct protein truncation test.
Genomics 1994; 20:1 -4.
[0104] 48. Ahiquist D A, Harrington J J, Burgart L J, Roche P C.
Morphometric analysis of the "mucocellular layer" overlying
colorectal cancer and normal mucosa: relevance to exfoliation and
stool screening. Hum Pathol 2000; 31:51-7.
Sequence CWU 1
1
27 1 23 DNA Homo sapiens 1 ggtaattttg aagcagtctg ggc 23 2 23 DNA
Homo sapiens 2 acgtcatgtg gatcagccta ttg 23 3 89 DNA Homo sapiens 3
ggatcctaat acgactcact atagggagac caccatgatg atgatgatga tgatgatgat
60 gatgatgtct ggacaaagca gtaaaaccg 89 4 33 DNA Homo sapiens 4
ttttttttaa cgtgatgact ttgttggcat ggc 33 5 9 DNA Homo sapiens 5
aaagaaaga 9 6 10 DNA Homo sapiens 6 gaaaaaaact 10 7 10 DNA Homo
sapiens 7 cttgatagtt 10 8 11 DNA Homo sapiens 8 tgcttcctgt g 11 9
11 DNA Homo sapiens 9 tgcttactgt g 11 10 13 DNA Homo sapiens 10
atcttttctt tta 13 11 11 DNA Homo sapiens 11 cacaggaagc a 11 12 11
DNA Homo sapiens 12 gtgtccttcg t 11 13 4 PRT Homo sapiens 13 Thr
Gln Glu Ala 1 14 11 DNA Homo sapiens 14 cacagtaagc a 11 15 11 DNA
Homo sapiens 15 gtgtcattcg t 11 16 17 DNA Homo sapiens 16
cagaaaaaac tattgat 17 17 17 DNA Homo sapiens 17 gtcttttttg ataacta
17 18 6 PRT Homo sapiens 18 Ala Glu Lys Thr Ile Asp 1 5 19 18 DNA
Homo sapiens 19 cagaaaaaaa ctattgat 18 20 18 DNA Homo sapiens 20
gtcttttttt gataacta 18 21 5 PRT Homo sapiens 21 Ala Glu Lys Asn Tyr
1 5 22 23 DNA Homo sapiens 22 taaaagaaaa gattggaact agg 23 23 23
DNA Homo sapiens 23 attttctttt ctaaccttga tcc 23 24 9 PRT Homo
sapiens 24 Ile Lys Glu Lys Ile Gly Thr Tyr Arg 1 5 25 18 DNA Homo
sapiens 25 taaaagattg gaactagg 18 26 18 DNA Homo sapiens 26
attttctaac cttgatcc 18 27 5 PRT Homo sapiens 27 Ile Lys Asn Trp Asn
1 5
* * * * *