Detection and identification of human papillomavirus by PCR and type-specific reverse hybridization

Abstract

A method for detection and/or identification of HPV present in a biological sample comprising amplification of HPV polynucleic acids and of hybridization of said amplified polynucleic acids to a number of probes whereby a short fragment of the L1 gene of HPV is amplified after which, the amplimers are contacted with probes that specifically hybridize to the said short fragment of the L1 gene of at least one HPV type and a diagnostic kit to perform said method and primers and probes used in the said method.

Description

FIELD OF THE INVENTION

[0001] The present invention relates to the field of detection and identification of Human Papillomavirus (HPV) infections in clinical samples.

BACKGROUND OF THE INVENTION

[0002] Cervical cancer is the second most common malignancy in women, following breast cancer. Carcinoma of the cervix is unique in that it is the first major solid tumor in which HPV DNA is found in virtually all cases and in precursor lesions worldwide.

[0003] Nowadays, 74 HPV genotypes have been characterized and are numbered in chronological order of isolation. HPV is epitheliotropic and infects only the skin (cutaneous types) or the mucosa of the respiratory and anogenital tract (mucosal types). Thirty-six of the 74 HPV types are known to infect the uterine cervix. Based on the induced benign, premalignant or malignant lesions, HPV is divided into low-risk (e.g., HPV types 6, 11, 42, 43 and 44) and high-risk types (e.g., types 16, 18, 31, 33 and 45), respectively. The high-risk types account for more than 80% of all invasive cervical cancers. Consequently, detection and identification of HPV types is very important. The high-risk types are more consistently found in high grade SIL (Squamous Intraepithelial Lesion) and carcinoma in-situ than low-risk types which are mainly found in low grade SIL. This epidemiological observation is supported by molecular findings. For instance, the E6 and E7 proteins from low-risk types 6 and 11 bind p53 and pRB too weakly to immortalize keratinocytes in vitro or to induce malignant transformation in vivo (Woodworth et al., 1990). The circular ds-DNA genome of low-risk HPV types remains episomal whereas the genome of high-risk HPV types is able to integrate into the human genome.

[0004] Screening for malignant and premalignant disorders of the cervix is usually performed according to the Papanicoloau (PAP) system. The cervical smears are examined by light microscopy and the specimens containing morphologically abnormal cells are classified into PAP I to V, at a scale of increasing severity of the lesion. This cytomorphological method is an indirect method and measures the possible outcome of an HPV infection. Therefore, HPV DNA detection and typing is of importance in secondary screening in order to select patients for monitoring (follow-up) and treatment. This means that cervical smears classified as PAP II (a typical squamous metaplasia) or higher classes should be analyzed for low-risk and high-risk HPV types. Follow-up studies have shown that only high-risk HPV types are involved in the progression from cytologically normal cervix cells to high grade SIL (Remminck et al., 1995). These results indicate that the presence of high-risk HPV types is a prognostic marker for development and detection of cervical cancer.

[0005] Detection of HPV Infections

[0006] Diagnosis of HPV by culture is not possible. Also diagnosis by detection of HPV anti-bodies appears to be hampered by insufficient sensitivity and specificity. Direct methods to diagnose an HPV infection are mainly based on detection of the viral DNA genome by different formats of DNA/DNA hybridization with or without prior amplification of HPV DNA. The polymerase chain reaction (PCR) is a method that is highly efficient for amplification of minute amounts of target DNA. Nowadays, mainly three different primer pairs are used for universal amplification of HPV DNA Two of these primer pairs, MY11/MY09 and GP5/GP6, are directed to conserved regions among diffent HPV types in the L1 region (Manos et al., 1989; Van den Brule et al., 1990). The other primer pair, CPI/CPIIg, is directed to conserved regions in the E1 region (Tieben et al., 1993).

[0007] Typing of HPV Isolates

[0008] There are several methods to identify the various HPV types.

[0009] 1. HPV DNA can be typed by PCR primers that recognize only one specific type. This method is known as type-specific PCR. Such methods have been described for HPV types 6, 11, 16, 18, 31 and 33 (Claas et al., 1989; Cornelissen et al., 1989; Falcinelli et al., 1992; Van den Brule et al., 1990; Young et al., 1989). The primers are aimed at the E5, L1, E6, L1, E2 and E1 regions of the HPV genome for types 6, 11, 16, 18, 31 and 33, respectively (Baay et al., 1996). The synthesized amplimer sizes vary from 217 bp to 514 bp.

[0010] 2. Another method is general amplification of a genomic part from all HPV types followed by hybridization with two cocktails of type-specific probes differentiating between the oncogenic and non-oncogenic groups, respectively. A similar typing method has been described without prior amplification of HPV DNA. In the Hybrid capture assay (Hybrid Capture Sharp Assay; Digene, Silver Springs, Md.), each sample is tested for a group of "high-risk" HPV types (16, 18, 31, 33, 35, 45, 51, 52 and 56) and for another group of "low-risk" HPV types (6, 11, 42, 43 and 44) (Cox et al., 1995).

[0011] At present, classification of human papillomaviruses can be performed for instance by sequence analysis of a 450 bp PCR fragment synthesized by the primers MY 11/MY09 in the L1 region (Chan et al., 1995) or by the primers CPI and CPIIg in the E1 region (Tieben et al., 1993). Phylogenetic analysis of these sequences allows classification of the different HPV types. By definition, if the sequence differences between two HPV isolates is higher than 10% they are classified as different types. Consequently, if the sequence differs more than 10% from any known HPV type it is classified as a novel HPV genotype. HPV isolates that differ between 2-10% are classified as different subtypes. Finally, if the sequence variation is below 2%, the 2 isolates are classified within the same subtype as different variants.

AIMS OF THE INVENTION

[0012] It is an aim of the present invention to provide a rapid and reliable method for detection and/or identification of HPV, possibly present in a biological sample.

[0013] It is more particularly an aim of the present invention to provide a method for detection and/or identification of HPV comprising amplification of a polynucleic acid fragment of HPV and subsequent hybridization of this fragment to suitable probes.

[0014] It is also an aim of the present invention to provide a number of oligonucleotide primers and probes enabling said method of detection and/or amplification of HPV.

[0015] It is also an aim of the present invention to provide new HPV sequences.

[0016] It is furthermore an aim of the present invention to provide protocols according to which said amplification and hybridization steps can be performed. One format for the hybridization step is, for instance, the reverse hybridization format, and more particularly the LiPA technique.

[0017] It is also an aim of the present invention to compose diagnostic kits comprising said primers and probes, permitting the rapid and reliable detection and/or identification of HPV possibly present in a biological sample.

[0018] All the aims of the present invention are met by the following specific embodiments.

DETAILED DESCRIPTION OF THE INVENTION

[0019] The present invention provides a method for detection and/or identification of HPV, possibly present in a biological sample, comprising the following steps:

[0020] (i) amplification of a polynucleic acid fragment of HPV by use of:

[0021] a 5'-primer specifically hybridizing to the A region or B region of the genome of at least one HPV type, said A region and B region being indicated in FIG. 1, and

[0022] a 3'-primer specifically hybridizing to the C region of the genome of at least one HPV type, said C region being indicated in FIG. 1;

[0023] (ii) hybridizing the amplified fragments from step (i) with at least one probe capable of specific hybridization with the D region of at least one HPV type, said D region being indicated in FIG. 1.

[0024] According to one preferred embodiment of the present invention, said probe mentioned in step (ii) is capable of specific hybridization with the D region of the genome of only one HPV type, and thus enables specific identification of this HPV type, when this type is present in a biological sample.

[0025] According to another preferred embodiment of the present invention, said probe mentioned in step (ii) is capable of specific hybridization with the D region of more than one HPV type, and thus enables detection of any of said more than one HPV type, when any of said types is present in a biological sample.

[0026] According to another preferred embodiment of the present invention, the 3'-end of said 5'-primer specifically hybridizing to the A region of the genome of at least one HPV type, is situated at position 6572 of the genome of HPV 16, or at the corresponding position of any other HPV genome, as indicated in FIG. 1.

[0027] According to another preferred embodiment of the present invention, the 3'-end of said 5'-primer specifically hybridizing to the B region of the genome of at least one HPV type, is situated at position 6601 of the genome of HPV 16, or at the corresponding position of any other HPV genome, as indicated in FIG. 1.

[0028] According to another preferred embodiment of the present invention, the 3'-end of said 3'-primer specifically hybridizing to the C region of the genome of at least one HPV type, is situated at position 6624 of the genome of HPV 16, or at the corresponding position of any other HPV genome, as indicated in FIG. 1.

[0029] According to another preferred embodiment of the present invention, said probe capable of specific hybridization with the D region of the genome of only one HPV type, more particularly specifically hybridizes to the E region, with said E region being a subregion of the D region, as indicated in FIG. 1.

[0030] According to another preferred embodiment of the present invention, said probe capable of specific hybridization with the D region of the genome of only one HPV type, more particularly specifically hybridizes to the 22 bp region situated between the B region and the C region, as indicated in FIG. 1.

[0031] According to another preferred embodiment, said 5'-primer specifically hybridizing to the A region of the genome of at least one HPV type, is chosen from the following list:

[0032] SGP3, SGP3A, SGP3B, SGP3C, SGP3D, SGP3E, SGP3F, SGP3G.

[0033] The sequences of said primers are shown in table 1 and in table 4.

[0034] According to another preferred embodiment, said 5'-primer specifically hybridizing to the B region of the genome of at least one HPV type, is chosen from the following list:

[0035] SGP1, SGP1A, SGP1B, SGP1C, SGP1D.

[0036] The sequences of said primers are shown in table 1, in table 4 and in table 11.

[0037] According to another preferred embodiment, said 3'-primer specifically hybridizing to the C region of the genome of at least one HPV type, is chosen from the following list:

[0038] SGP2, SGP2A, SGP2B, SGP2C, SGP2D, SGP2E, SGP2F, SGP2H, SGP2I, SGP2J, SGP2K, SGP2L, SGP2M, SGP2N, SGP2P.

[0039] The sequences of said primers are shown in table 1, in table 4 and in table 11.

[0040] According to another preferred embodiment, said probe capable of specific hybridization with the aforementioned 22 bp region of only one HPV type, is chosen from the following list:

[0041] HPV6 Pr1, HPV6 Pr2, HPV6 Pr3, HPV6 Pr4, HPV6 Pr5, HPV11 Pr1, HPV11 Pr2, HPV11 Pr3, HPV11 Pr4, HPV11 Pr5, HPV16 Pr1, HPV16 Pr2, HPV16 Pr3, HPV16 Pr4, HPV16 Pr5, HPV18 Pr1, HPV18 Pr2, HPV18 Pr3, HPV18 Pr4, HPV18 Pr5, HPV31 Pr1, HPV31 Pr2, HPV31 Pr3, HPV31 Pr4, HPV31 Pr5, HPV31 Pr21, HPV31 Pr22, HPV31 Pr23, HPV31 Pr24, HPV31 Pr25, HPV31 Pr26, HPV31 Pr31, HPV31 Pr32, HPV33 Pr1, HPV33 Pr2, HPV33 Pr3, HPV33 Pr4, HPV33 Pr5, HPV33 Pr21, HPV33 Pr22, HPV33 Pr23, HPV33 Pr24, HPV33 Pr25, HPV33 Pr26, HPV40 Pr1, HPV45 Pr1 (=SGPP68), HPV45 Pr2, HPV45 Pr3, HPV45 Pr4, HPV45 Pr5, HPV45 Pr11, HPV45 Pr12, HPV45 Pr13, HPV52 Pr1, HPV52 Pr2, HPV52 Pr3, HPV52 Pr4, HPV52 Pr5, HPV52 Pr6, HPV56 Pr1, HPV56 Pr2, HPV56 Pr3, HPV56 Pr11, HPV56 Pr12, HPV58 Pr1, HPV58 Pr9, HPV58 Pr3, HPV58 Pr4, SGPP35, SGPP39, SGPP51 (=HPV51 Pr1), SGPP54, SGPP59, SGPP66, SGPP70 (=HPV70 Pr11), SGPP13, SGPP34, SGPP42, SGPP43, SGPP44, SGPP53, SGPP55, SGPP69, SGPP61,

[0042] SGPP62, SGPP64, SGPP67, SGPP74 (=HPV74 Pr13), MM4 (=HPVM4 Pr11), MM7, MM8, HPV18b Pr1, HPV18b Pr2, HPV31 Vs40-1, HPV31 Vs40-2, HPV31 Vs40-3, HPV34 Pr1, HPV35 Pr1, HPV35 Pr2, HPV35 Pr3, HPV39 Pr1, HPV42 Pr1, HPV42 Pr2, HPV43 Pr1, HPV43 Pr2, HPV43 Pr3, HPV44 Pr1, HPV44 Pr2, HPV44 Pr3, HPV44 Pr4, HPV45 Pr5, HPV51 Pr2, HPV53 Pr1, HPV54 Pr1, HPV54 Pr11, HPV54 Pr11as, HPV54-Pr12, HPV55 Pr1, HPV55 Pr11, HPV55 Pr12, HPV55 Pr13, HPV56 Vs74-1, HPV59 Pr1, HPV59 Pr11, HPV59 Pr12, HPV59 Pr13, HPV66 Pr1, HPV67 Pr1, HPV 67Pr11, HPV67 Pr12, HPV67 Pr13, HPV67 Pr21, HPV67 Pr22, HPV67 Pr23, HPV68 Pr1, HPV68 Pr2, HPV68 Pr3, HPV68 Vs45-1, HPV68 Vs45-2, HPV70 Pr1, HPV70 Pr12, HPV70 Pr13, HPV74 Pr1, HPV74 Pr11, HPV74 Pr12, HPV74 Pr2, HPV74 Pr3, HPVM4 Pr1, HPVM4 Pr12, HPVM4 Pr21, HPVM4 Pr22.

[0043] The sequences of said probes are shown in table 7 and table 12.

[0044] It is to be understood that combinations of the aforementioned embodiments are also preferred embodiments, for instance a method characterized in that said 5'-primer specifically hybridizing to the A region is chosen from the aforementioned respective list and that said 3'-primer specifically hybridizing to the C region is chosen from the aforementioned respective list.

[0045] It is an important feature of the present invention that the amplified polynucleic acid fragments of HPV fall within a short region of the L1 gene, a region that presents a high degree of sequence variability. Said region is denoted D region and for any HPV type consists of the region corresponding in a sequence alignment to the region from position 6553 to position 6646 of the genome of HPV 16, with the numbering being according to isolate PPH16, with Genbank accession number K02718. The advantage of amplifying a short fragment is that higher sensitivity can be obtained, i.e. a lower number of copies of HPV polynucleic acids can be detected and/or identified. The aforementioned primers may be used to amplify a fragment of approximately 65 bp (by use of 5'-primers specifically hybridizing to the B region and 3'-primers specifically hybridizing to the C region) or a fragment of approximately 94 bp (by use of 5'-primers specifically hybridizing to the A region and 3'-primers specifically hybridizing to the C region). However, it is obvious to one skilled in the art that other primers may be used in order to amplify other fragments within or overlapping with said D region. Preferred primers are shown in table 1 and in table 4. These primers permit amplification of polynucleic acid fragments of a large group of HPV types, but it may be desirable for some purposes to chose primers that selectively amplify a smaller group of HPV types.

[0046] The different types of HPV in a sample can be identified by hybridization of polynucleic acids of said types of HPV to at least one, preferably at least two, more preferably at least three, even more preferably at least four and most preferably at least five oligonucleotide probes. These probes may be designed to specifically hybridize to the D region of only one HPV genome, said D region being indicated in FIG. 1. Tables 7 and 12 contain a list of preferred probes specifically hybridizing to the 22 bp region within said D region, situated between the B region and the C region. These probes may be used together under the same conditions of hybridization and washing, for instance in a LiPA format (see below). Probes that have been optimized to work together in a LiPA format are for instance the combination of HPV6 Pr1, HPV11 Pr1, HPV16 Pr1, HPV18 Pr1, HPV31 Pr25, HPV31 Pr31, HPV31 Pr32, HPV33 Pr21, HPV33 Pr25, HPV40 Pr1, HPV45 Pr11, HPV45 Pr12, HPV45 Pr13 HPV52 Pr5, HPV52 Pr6, HPV56 Pr11, HPV56 Pr12, HPV58 Pr2, HPV58 Pr3 and HPV58 Pr4 (see example 4), the combination of HPV6 Pr1, HPV11 Pr5, HPV16 Pr1, HPV18 Pr1, HPV18b Pr2, HPV31 Pr31, c31-3, HPV33 Pr21, HPV34 Pr1, HPV35 Pr1, HPV39 Pr1, HPV40 Pr1, HPV42 Pr1, HPV43 Pr3, HPV44 Pr1, HPV45 Pr11, HPV51 Pr2, HPV52 Pr5, HPV53 Pr1, HPV56 Pr12, c56-1, HPV58 Pr2, HPV59 Pr12, HPV66 Pr1, HPV68 Pr1, c68-1, HPV70 Pr12 and HPV74 Pr1, or the combination outlined in example 7. Probes specifically hybridizing to said 22 bp region should permit discrimination of all genital low-risk types including HPV types 6, 11, 34, 40, 42-44, 53, 54, 55, 59, 61, 62, 64, 67, 68, 71 and 74 as well as all genital high-risk types including HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56-58, 66 and 69 (zur Hausen, 1996). It should be clear to one skilled in the art that other probes than those listed in table 7 or 12 may be chosen within said region D, provided that they specifically hybridize to only one HPV-type. It should also be clear that in some cases probes may be chosen that overlap with the primers used in the amplification step. In this case, however, the region of overlap between primer and probe should not be as long as to allow by itself duplex formation under the experimental conditions used. It should furthermore be clear that, if presently unknown types are detected that differ in the D region from all presently known types, the methods of this invention will also enable detection and/or identification of said presently unknown HPV types. The present invention furthermore discloses novel sequences in said 22 bp region, as shown in example 5 and in FIG. 1 (SEQ ID NO 135-153). Probes or primers that are designed to specifically hybridize to these sequences, may be used in a method to detect and/or to identify HPV polynucleic acids comprising any of these sequences, when these polynucleic acids are present in a biological sample.

[0047] According to another preferred embodiment of the present invention, probes are used that specifically hybridize to the D region, or more particularly to the E region of more than one HPV type. Examples of such probes are given in table 9 and in table 10. The probes in table 9 have been designed for hybridization in a microtiter plate, e.g. according to the DEIA technique (see below), whereas the probes in table 10 are more suitable for the LiPA technique (see below). These probes hybridize to the E region of more than one HPV type, and hence may be used to detect the presence in a biological sample of any of the types to which they hybridize. It should be clear to one skilled in the art that, according to this embodiment, other probes than those listed in table 9 and table 10 may be chosen within the D region, provided that they hybridize to one or more than one HPV type.

[0048] According to another preferred embodiment of the present invention, the aforementioned methods of detection and/or identification of HPV are characterized further in that the hybridization step involves a reverse hybridization format. This format implies that the probes are immobilized to certain locations on a solid support and that the amplified HPV polynucleic acids are labelled in order to enable the detection of the hybrids formed. According to this embodiment, at least one probe, or a set of a least 2, preferably at least 3, more preferably at least 4 and most preferably at least 5 probes is used. When at least 2 probes are used, said probes are meticulously designed in such a-way that they specifically hybridize to their target sequences under the same hybridization and wash conditions.

[0049] According to an even more preferred embodiment of the present invention, the aforementioned hybridization step is performed according to the LiPA technique. Said technique involves a reverse hybridization assay, characterized in that the oligonucleotide probes are immobilized on a solid support as parallel lines (Stuyver et al., 1993; international application WO 94/12670). The reverse hybridization format and particularly the LiPA format have many practical advantages as compared to other DNA techniques or hybridization formats, especially when the use of a combination of probes is preferable or unavoidable to obtain the relevant information sought.

[0050] Alternatively, detection of HPV polynucleic acids in a biological sample may be performed by use of the DNA Enzyme Immuno Assay (DEIA). This method is used for rapid and specific detection of PCR products. PCR products are generated by a primer set, of which either the forward or the reverse primer contain biotin at the 5' end. This allows binding of the biotinylated amplimers to streptavidin-coated microtiter wells. PCR products are denatured by sodium hydroxide, which allows removal of the non-biotinylated strand. Specific labelled oligonucleotide probes (e.g. with digoxigenin) are hybridized to the single-stranded immobilized PCR product and hybrids are detected by enzyme-labelled conjugate and calorimetric methods.

[0051] The present invention also relates to sets of oligonucleotides, said sets comprising at least one primer and/or at least one probe that may be used to perform the methods for detection and/or identification of HPV as described above. Preferred primers according to the present invention can for instance be chosen from table 1, table 4 and table 11. Preferred probes are shown in tables 7, 9, 10 and 12. These probes can be optimized to be used together in a given format, e.g. a LiPA format, under the same hybridization and washing conditions. Evidently, when other hybridization conditions would be preferred, all probes should be adapted accordingly by adding or deleting one or more nucleotides at their extremities. It should be understood that these concomitant adaptations should give rise to the same result, namely that the probes still hybridize specifically to their respective type-specific target sequences. Such adaptations may also be necessary if the amplified material is RNA and not DNA as is the case in the NASBA system.

[0052] The present invention also relates to diagnostic kits for detection and/or identification of HPV, possibly present in a biological sample, comprising the following components:

[0053] (i) at least one suitable primer or at least one suitable primer pair;

[0054] (ii) at least one suitable probe, preferably at least 2, more preferably at least 3, even more preferably at least 4 and most preferably at least 5 suitable probes, possibly fixed to a solid support;

[0055] (iii) a hybridization buffer, or components necessary for the production of said buffer, or instructions to prepare said buffer;

[0056] (iv) a wash solution, or components necessary for the production of said solution, or instructions to prepare said solution;

[0057] (v) optionally a means for detection of the hybrids formed;

[0058] (vi) optionally a means for attaching the probe(s) to a known location on a solid support.

[0059] The following definitions and explanations will permit a better understanding of the present invention.

[0060] HPV isolates that display a sequence difference of more than 10%:to any previously known type in the combined nucleotide sequences of E6, E7 and L1 genes (Chan et al., 1995, de Villiers, 1994) are classified as different HPV "genotypes". HPV isolates that differ between 2 and 10% are classified as different "subtypes". If the sequence variation is below 2%, the isolates are classified within the same subtype as different "variants". The term "type" when applied to HPV refers to any of the three categories defined above.

[0061] The target material in the samples to be analyzed may either be DNA or RNA, e.g. genomic DNA, messenger RNA, viral RNA or amplified versions thereof. These molecules are in this application also termed "polynucleic acids".

[0062] Well-known extraction and purification procedures are available for the isolation of RNA or DNA from a sample (e.g. in Sambrook et al., 1989).

[0063] The term "probe" according to the present invention refers to a single-stranded oligonucleotide which is designed to specifically hybridize to HPV polynucleic acids. The term "primer" refers to a single stranded oligonucleotide sequence capable of acting as a point of initiation for synthesis of a primer extension product which is complementary to the nucleic acid strand to be copied. The length and the sequence of the primer must be such that they allow to prime the synthesis of the extension products. Preferably the primer is about 5-50 nucleotides long. Specific length and sequence will depend on the complexity of the required DNA or RNA targets, as well as on the conditions at which the primer is used, such as temperature and ionic strength.

[0064] The expression "suitable primer pair" in this invention refers to a pair of primers allowing the amplification of part or all of the HPV polynucleic acid fragment for which probes are immobilized.

[0065] The term "target sequence" of a probe or a primer according to the present invention is a sequence within the HPV polynucleic acids to which the probe or the primer is completely complementary or partially complementary (i.e. with some degree of mismatch). It is to be understood that the complement of said target sequence is also a suitable target sequence in some cases. Probes of the present invention should be complementary to at least the central part of their target sequence. In most cases the probes are completely complementary to their target sequence. The term "type-specific target sequence" refers to a target sequence within the polynucleic acids of a given HPV type that contains at least one nucleotide difference as compared to any other HPV-type.

[0066] "Specific hybridization" of a probe to a region of the HPV polynucleic acids means that, after the amplification step, said probe forms a duplex with part of this region or with the entire region under the experimental conditions used, and that under those conditions said probe does not form a duplex with other regions of the polynucleic acids present in the sample to be analysed. It should be understood that probes that are designed for specific hybridization to a region of HPV polynucleic acids, may fall within said region or may to a large extent overlap with said region (i.e. form a duplex with nucleotides outside as well as within said region). For instance, some of the probes that are shown in table 7 and that are designed for specific hybridization to the 22 bp region between the B and the C regions (FIG. 1), extend up to 5 nucleotides beyond the 3'-end of said 22 bp region and other probes of table 7 extend up to 3 nucleotides beyond the 5'-end of said 22 bp region.

[0067] "Specific hybridization" of a primer to a region of the HPV polynucleic acids means that, during the amplification step, said primer forms a duplex with part of this region or with the entire region under the experimental conditions used, and that under those conditions said primer does not form a duplex with other regions of the polynucleic acids present in the sample to be analysed. It should be understood that primers that are designed for specific hybridization to a region of HPV polynucleic acids, may fall within said region or may to a large extent overlap with said region (i.e. form a duplex with nucleotides outside as well as within said region).

[0068] Since the current application requires the detection of single base pair mismatches, stringent conditions for hybridization of probes are required, allowing only hybridization of exactly complementary sequences. However, it should be noted that, since the central part of the probe is essential for its hybridization characteristics, possible deviations of the probe sequence versus the target sequence may be allowable towards the extremities of the probe when longer probe sequences are used. Variations are possible in the length of the probes. Said deviations and variations, which may be conceived from the common knowledge in the art, should however always be evaluated experimentally, in order to check if they result in equivalent hybridization characteristics as the exactly complementary probes.

[0069] Preferably, the probes of the invention are about 5 to 50 nucleotides long, more preferably from about 10 to 25 nucleotides. Particularly preferred lengths of probes include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. The nucleotides as used in the present invention may be ribonucleotides, deoxyribonucleotides and modified nucleotides such as inosine or nucleotides containing modified groups which do not essentially alter their hybridization characteristics.

[0070] Probe sequences are represented throughout the specification as single stranded DNA oligonucleotides from the 5' to the 3' end. It is obvious to the man skilled in the art that any of the below-specified probes can be used as such, or in their complementary form, or in their RNA form (wherein T is replaced by U).

[0071] The probes according to the invention can be prepared by cloning of recombinant plasmids containing inserts including the corresponding nucleotide sequences, if need be by excision of the latter from the cloned plasmids by use of the adequate nucleases and recovering them, e.g. by fractionation according to molecular weight. The probes according to the present invention can also be synthesized chemically, for instance by the conventional phospho-triester method.

[0072] The fact that amplification primers do not have to match exactly with the corresponding target sequence in the template to warrant proper amplification is amply documented in the literature (Kwok et al., 1990). However, when the primers are not completely complementary to their target sequence, it should be taken into account that the amplified fragments will have the sequence of the primers and not of the target sequence. Primers may be labelled with a label of choice (e.g. biotine). The amplification method used can be either polymerase chain reaction (PCR; Saiki et al., 1988), ligase chain reaction (LCR; Landgren et al., 1988; Wu & Wallace, 1989; Barany, 1991), nucleic acid sequence-based amplification (NASBA; Guatelli et al., 1990; Compton, 1991), transcription-based amplification system (TAS; Kwoh et al., 1989), strand displacement amplification (SDA; Duck, 1990; Walker et al., 1992) or amplification by means of Q.beta. replicase (Lizardi et al., 1988; Lomeli et al., 1989) or any other suitable method to amplify nucleic acid molecules known in the art.

[0073] The oligonucleotides used as primers or probes may also comprise nucleotide analogues such as phosphorothiates (Matsukura et al., 1987), alkylphosphorothiates (Miller et al., 1979) or peptide nucleic acids (Nielsen et al., 1991; Nielsen et al., 1993) or may contain intercalating agents (Asseline et al., 1984). As most other variations or modifications introduced into the original DNA sequences of the invention these variations will necessitate adaptions with respect to the conditions under which the oligonucleotide should be used to obtain the required specificity and sensitivity. However the eventual results of hybridization will be essentially the same as those obtained with the unmodified oligonucleotides. The introduction of these modifications may be advantageous in order to positively influence characteristics such as hybridization kinetics, reversibility of the hybrid-formation, biological stability of the oligonucleotide molecules, etc.

[0074] The term "solid support" can refer to any substrate to which an oligonucleotide probe can be coupled, provided that it retains its hybridization characteristics and provided that the background level of hybridization remains low. Usually the solid substrate will be a microtiter plate (e.g. in the DEIA technique), a membrane (e.g. nylon or nitrocellulose) or a microsphere (bead) or a chip. Prior to application to the membrane or fixation it may be convenient to modify the nucleic acid probe in order to facilitate fixation or improve the hybridization efficiency. Such modifications may encompass homopolymer tailing, coupling with different reactive groups such as aliphatic groups, NH.sub.2 groups, SH groups, carboxylic groups, or coupling with biotin, haptens or proteins.

[0075] The term "labelled" refers to the use of labelled nucleic acids. Labelling may be carried out by the use of labelled nucleotides incorporated during the polymerase step of the amplification such as illustrated by Saiki et al. (1988) or Bej et al. (1990) or labelled primers, or by any other method known to the person skilled in the art. The nature of the label may be isotopic (.sup.32P, .sup.35S, etc.) or non-isotopic (biotin, digoxigenin, etc.).

[0076] The "sample" may be any biological material taken either directly from the infected human being (or animal), or after culturing (enrichment). Biological material may be e.g. scrapes or biopsies from the urogenital tract or any part of the human or animal body.

[0077] The sets of probes of the present invention will include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 93, 24, 25, 26, 27, 28, 29, 30 or more probes. Said probes may be applied in two or more (possibly as many as there are probes) distinct and known positions on a solid substrate. Often it is preferable to apply two or more probes together in one and the same position of said solid support.

[0078] For designing probes with desired characteristics, the following useful guidelines known to the person skilled in the art can be applied.

[0079] Because the extent and specificity of hybridization reactions such as those described herein are affected by a number of factors, manipulation of one or more of those factors will determine the exact sensitivity and specificity of a particular probe, whether perfectly complementary to its target or not. The importance and effect of various assay conditions are explained further herein.

[0080] **The stability of the [probe:target] nucleic acid hybrid should be chosen to be compatible with the assay conditions. This may be accomplished by avoiding long AT-rich sequences, by terminating the hybrids with G:C base pairs, and by designing the probe with an appropriate Tm. The beginning and end points of the probe should be chosen so that the length and % GC result in a Tm about 2-10.degree. C. higher than the temperature at which the final assay will be performed. The base composition of the probe is significant because G-C base pairs exhibit greater thermal stability as compared to A-T base pairs due to additional hydrogen bonding. Thus, hybridization involving complementary nucleic acids of higher G-C content will be more stable at higher temperatures.

[0081] **Conditions such as ionic strength and incubation temperature under which a probe will be used should also be taken into account when designing a probe. It is known that the degree of hybridization will increase as the ionic strength of the reaction mixture increases, and that the thermal stability of the hybrids will increase with increasing ionic strength. On the other hand, chemical reagents, such as formamide, urea, DMSO and alcohols, which disrupt hydrogen bonds, will increase the stringency of hybridization. Destabilization of the hydrogen bonds by such reagents can greatly reduce the Tm. In general, optimal hybridization for synthetic oligonucleotide probes of about 10-50 bases in length occurs approximately 5.degree. C. below the melting temperature for a given duplex. Incubation at is temperatures below the optimum may allow mismatched base sequences to hybridize and can therefore result in reduced specificity.

[0082] **It is desirable to have probes which hybridize only under conditions of high stringency. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. The degree of stringency is chosen such as to maximize the difference in stability between the hybrid formed with the target and the nontarget nucleic acid. In the present case, single base pair changes need to be detected, which requires conditions of very high stringency.

[0083] **The length of the probe sequence can also be important. In some cases, there may be several sequences from a particular region, varying in location and length, which will yield probes with the desired hybridization characteristics. In other cases, one sequence may be significantly better than another which differs merely by a single base. While it is possible for nucleic acids that are not perfectly complementary to hybridize, the longest stretch of perfectly complementary base sequence will normally primarily determine hybrid stability. While oligonucleotide probes of different lengths and base composition may be used, preferred oligonucleotide probes of this invention are between about 5 to 50 (more particularly 10-25) bases in length and have a sufficient stretch in the sequence which is perfectly complementary to the target nucleic acid sequence.

[0084] **Regions in the target DNA or RNA which are known to form strong internal structures inhibitory to hybridization are less preferred. Likewise, probes with extensive self-complementarity should be avoided. As explained above, hybridization is the association of two single strands of complementary nucleic acids to form a hydrogen bonded double strand. It is implicit that if one of the two strands is wholly or partially involved in a hybrid that it will be less able to participate in formation of a new hybrid. There can be intramolecular and intermolecular hybrids formed within the molecules of one type of probe if there is sufficient self complementarity. Such structures can be avoided through careful probe design. By designing a probe so that a substantial portion of the sequence of interest is single stranded, the rate and extent of hybridization may be greatly increased. Computer programs are available to search for this type of interaction. However, in certain instances, it may not be possible to avoid this type of interaction.

[0085] **Standard hybridization and wash conditions are disclosed in the Materials & Methods section of the Examples. Other conditions are for instance 3.times.SSC (Sodium Saline Citrate), 20% deionized FA (Formamide) at 50.degree. C. Other solutions (SSPE (Sodium saline phosphate EDTA), TMAC (Tetramethyl ammonium Chloride), etc.) and temperatures can also be used provided that the specificity and sensitivity of the probes is maintained. When needed, slight modifications of the probes in length or in sequence have to be carried out to maintain the specificity and sensitivity required under the given circumstances.

[0086] In order to identify different HPV types with the selected set of oligonucleotide probes, any hybridization method known in the art can be used (conventional dot-blot, Southern blot, sandwich, etc.). However, in order to obtain fast and easy results if a multitude of probes are involved, a reverse hybridization format may be most convenient. In a preferred embodiment the selected probes are immobilized to a solid support in known distinct locations (dots, lines or other figures). In another preferred embodiment the selected set of probes are immobilized to a membrane strip in a line fashion. Said probes may be immobilized individually or as mixtures to delineated locations on the solid support. A specific and very user-friendly embodiment of the above-mentioned preferential method is the LiPA method, where the above-mentioned set of probes is immobilized in parallel lines on a membrane, as further described in Example 4. The HPV polynucleic acids can be labelled with biotine, and the hybrid can then, via a biotine-streptavidine coupling, be detected with a non-radioactive colour developing system.

[0087] The term "hybridization buffer" means a buffer allowing a hybridization reaction between the probes and the polynucleic acids present in the sample, or the amplified products, under the appropriate stringency conditions.

[0088] The term "wash solution" means a solution enabling washing of the hybrids formed under the appropriate stringency conditions.

[0089] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of stated integers or steps but not to the exclusion of any other integer or step or group of integers or steps.

FIGURE AND TABLE LEGENDS

[0090] FIG. 1. Alignment of HPV sequences

[0091] Alignment of sequences of genital HPV types and previously unknown sequences within the region from position 6553 to position 6646 (numbered according to HPV 16, Genbank locus name PPH16, accession number K02718), denoted region D. Hyphens indicate the presence of identical nucleotides as in HPV 16. The primer target regions A, B and C are boxed. The sequences identified as 95M or 97M followed by a number are novel sequences disclosed by the present invention. The SEQ ID NO of the novel squences is shown between brackets.

[0092] FIG. 2. Outline of the HPV DNA genome

[0093] Schematic outline of the HPV genome. The Early (E) and Late (L) antigens are boxed. The length of the amplimers that can be synthesized by the different general primer sets in the L1 region is shown by a horizontal bar (bp stands for base pairs).

[0094] FIG. 3. Phylogenetic tree of HPV sequences in the MY11/MY09 region

[0095] Phylogenetic analyses were performed with the Phylip 3.5c software (Felsenstein, 1995). The numbers correspond to the different HPV types; the HPV groups are also indicated.

[0096] FIG. 4. Phylogenetic tree of HPV sequences between regions B and C.

[0097] Phylogenetic analyses of the region between B and C (corresponding to position 6602 to 6623 of HPV 16) were performed with the Phylip 3.5c software (Felsenstein, 1995). The numbers correspond to the HPV types.

[0098] FIG. 5. Phylogenetic tree of HPV sequences between regions A and C.

[0099] Phylogenetic analyses of the region between A and C (corresponding to position 6573 to 6623 of HPV 16) were performed with the Phylip 3.5c software (Felsenstein, 1995). The numbers correspond to the HPV types.

[0100] FIG. 6. Outline of a HPV LiPA

[0101] The bottom panel shows a possible configuration of a LiPA strip enabling detection and identification of HPV types 16, 18, 31, 33, 45, 6 and 11 (ook 52, 56, 58, 40?). The lines correspond to the positions of type-specific probes. "Control" indicates the position of biotinlyated DNA that is used as a control for the conjugate and substrate reaction. "General HPV" indicates the position of probes that enable detection of almost all HPV types. For the amplification step, primers SGP1 and SGP2 can be used; the position of these primers is indicated in the top panel.

[0102] FIG. 7. LiPA experiment

[0103] Plasmids containing complete genomic sequences from the HPV types 6, 11, 16, 18, 31, 33 and 45 were subjected to PCR with primer set SGP1-bio/SGP2-bio. Subsequently, the amplimers were analysed in a LiPA assay containing type-specific probes for recognition of the HPV types 6, 11, 16, 18, 31, 33 and 45. The strips A and B contained 5 probes for each of these types, as indicated. Of each probe, two amounts (0.2 and 1 pmol) were present on the strip. The probes for recognition of types 6, 11, 16 and 18 were applied to strip A and those for types 31, 33 and 45 were applied to strip B.

[0104] FIG. 8. LiPA experiment

[0105] Amplimers synthesized by use of primer set SGP1-bio/MY09-bio from HPV types 6, 16, 31, 33 and 45 were analysed by means of a LiPA experiment. The strip contained 5 probes for each of the types; of each probe two amounts were present. Strip A contains the probes for recognition of types 6, 11, 16 and 18, whereas strip B contains the probes for types 31, 33 and 45.

[0106] FIG. 9. Nucleotide sequence alignments of 39 HPV genotypes

[0107] Alignment of HPV sequences within the region from position 6582 to position 6646 (numbered according to HPV 16, GenBank locus name PPH16, accession number K02718). Hyphens indicate the presence of identical nucleotides as in HPV 16. The primer target regions B and C are boxed.

[0108] FIG. 10. Outline HPV-LiPA for identification of 25 types

[0109] The LiPA strip shows a possible configuration enabling detection and identification of HPV types 6, 11, 16, 18, 31, 33, 34, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 66, 68, 70 and 74. The lines correspond to the positions of type-specific probes. "Control" indicates the position of biotinylated DNA that is used as a control for the conjugate and substrate reaction.

[0110] FIG. 11. Typical HPV-LiPA patterns

[0111] Plasmids containing genomic sequences of HPV genotypes 6, 11, 16, 18, 33, 35, 45, 51, 52, 53, 56, 59, 66, 68, and 70 were subjected to PCR using primers directed to the B and C region in FIG. 9. Subsequently, the amplimers were analysed in a LiPA experiment containing type-specific probes for identification of 25 HPV genotypes. The colored bands indicate hybridization of the amplimer to the type-specific probe.

[0112] Table 1. HPV L1 primers for the A, B and C regions

[0113] Selection of preferred primers specifically hybridizing to the A, B or C regions. HPV16, MY16s and SGP16 as represent the corresponding sequence of HPV type 16. MY11 was described by Manos et al. (1989). A + sign indicates that the primer is a sense (forward) primer; a - sign refers to an antisense (reverse) primer.

[0114] Table 2. HPV DNA detection by the novel general primers SGP1/SGP2.

[0115] Plasmids containing HPV polynucleic acids were subjected to PCR with primer sets SGP1/SGP2 and SGP3/GP6. + indicates that an amplimer was obtained. - indicates that no amplimer was obtained. n.d. indicates that this HPV plasmid was not subjected to PCR with the SGP3/GP6 primer set. An amplimer was obtained for all HPV plasmids with the SGP1/SGP2 primer set, although the amount of PCR-product was different. Sequence analysis revealed that the PCR-product was obtained from the corresponding HPV plasmid and matched the published sequence. Primer set SGP3/GP6 was used to confirm proper isolation of the HPV plasmids.

[0116] Table 3. HPV DNA detection by type-specific primers and general primer sets

[0117] To evaluate the efficacy of the novel primers SGP1 and SGP2 in biological samples, 92 formalin-fixed, paraffin-embedded cervical cancer biopsies were tested. A total of 61 out of the 92 biopsies were positive by type-specific PCR. Of these 61 biopsies, 54 contained HPV type 16 and 7 contained HPV type 18. The remaining 31 biopsies were assayed by HPV 31 and HPV 33 type-specific primers and remained negative. These 31 samples, negative by type-specific PCR, were also analyzed by two general primer sets described previously. By using the MY11/MY09 and GP5/GP6 primer sets only 1/31 and 3/31 biopsies were found positive, respectively. All 92 biopsies were found positive by the newly developed SGP1/SGP2 primerset.

[0118] Table 4. HPV L1 primers for the A, B and C regions

[0119] Selection of preferred primers specifically hybridizing to the A, B or C regions.

[0120] Table 5. PCR amplification with primers in the B and in the C region

[0121] The specificity of the primers listed in table 4 for the regions B and C was tested on plasmids containig polynucleic acids of HPV types 6, 11, 16, 18, 31, 33, 45, 3D, 39, 58, 57 and 59. PCR was performed by all 20 possible primer combinations for the regions B and C. The results are indicated as follows: .+-.=poor amplification; +=good; ++=very good; blank=no amplification.

[0122] Table 6. HPV genotyping of 77 isolates by type-specific PCR and sequence analysis of the SGP1/SGP2 amplimer

[0123] 77 HPV isolates positive with specific primers for type 16 or 18, were studied for sequence variability in the SGP1/SGP2 amplimer. Samples identified as type 16 by type-specific PCR were all identically typed by sequence analysis of the SGP1/SGP2 amplimer. There was no intratypic sequence variation in the small SGP1/SGP2 amplimer. Identical results were obtained for HPV 18.

[0124] Table 7. Type-specific HPV probes

[0125] Selection of preferred probes specifically hybridizing to the 22 bp region between regions B and C. "+" indicates that the probe is a sense probe; "-" refers to an antisense probe. The underlined G or C residues represent non-specific nucleotides that were added to facilitate tailing of the probes.

[0126] Table 8. HPV primers for the synthesis of biotinviated PCR products

[0127] SGP1-bio and SGP2-bio are the biotinylated versions of SGP1 and SGP2, shown in table 1. MY09-bio is the biotinylated version of MY09, the sequence of which was disclosed in Manos et al.(1989).

[0128] Table 9. Probes for general HPV detection

[0129] Selection of preferred probes that enable detection of more than one HPV type. The types detected by each probe are listed next to the probe.

[0130] Table 10. Probes for general HPV detection

[0131] Selection of preferred probes that enable detection of more than one HPV type.

[0132] Table 11. PCR primers

[0133] Selection of preferred primers specifically hybridizing to the B or C regions.

[0134] Table 12. HPV type-specific probes

[0135] Selection of preffered probes specifically hybridizing to the region between position 6582-6646 (numbers according to HPV 16, GenBank locus name PPH16, accession number K02718). "+" indicates that the probe is a sense probe; "-" refers to an antisense probe. The underlined residues represent non HPV type-specific nucleotides.

[0136] Table

1TABLE 1 HPV L1 primers in the A, B and C regions SEQ ID NO/ Name polarity 5'-sequence-3' reference A region HPV16 + TATTCAATAAACCTTATTGC 1 SGP3 + -D--T-----R--W------ 2 SGP3A + ----T--------A------ 3 SGP3B + ----T-----G--A------ 4 B region MY16s + GCACAGGGCCACAATAATGG 5 MY11 + --M-----W--T--Y----- Manos et al., 1989 SGP1 + --M-----H--T--Y----- 6 C region SGP16as - GTATCAACAACAGTAACAAA 7 SGP2A - -----T--C----------- 8 SGP2 - -----H--H----------- 9 D = G, A or T; R = A or G; W = A or T; M = A or C; Y = C or T; H = A, C or T.

[0137]

2TABLE 2 HPV DNA detection by the novel general primers SGP1/SGP2 HPV plasmid SGP1/SGP2 SGP3/GP6.sup.a reference.sup.b 3 + + Ostrow 4 + - de Villiers 5 + + Ostrow 5/48 + - de Villiers 6 + n.d. de Villiers 7/4 + + de Villiers 7/5 + + de Villiers 8 + - de Villiers 11 + + de Villiers 13 + + de Villiers 16 + + de Villiers 18 + + de Villiers 26 + + Ostrow 27 + + Ostrow 30 + + Orth 31 + + Lorinz 33 + n.d. Orth 35s + + Lorincz 35l + + Lorincz 37 + + de Villiers 39 + n.d. Orth 43s + + Lorincz 43l + + Lorincz 45 + + de Villiers 51 + + de Villiers 52 + n.d. Orth 53 + + de Villiers 56 + + Lorincz 57 + + de Villiers 58 + + Matsukura 59 + + Matsukura 62.2 + + Matsukura 64 + + Matsukura 65 + + de Villiers 67 + + Matsukura .sup.aGeneral primer GP6 (van den Brule et al., 1990) .sup.bThe HPV plasmids were kindly provided by the Dr's: Lorincz, de Villiers, Matsukura, Ostrow, ter Schegget and Orth.

[0138]

3TABLE 3 HPV DNA detection by type-specific primers and general primer sets HPV primer set number HPV pos. HPV neg. amplimer 16 92 54 38 96 bp 18 92 7 85 115 bp 31 31.sup.a 0 31 110 bp 33 31.sup.a 0 31 114 bp MY11/MY09 31.sup.b 1 30 .+-.450 bp GP5/GP6 31.sup.b 3 28 .+-.142 bp SGP1/SGP2 92 92 0 62 bp .sup.aSamples negative by type-specific primers for HPV 16 and 18 .sup.bSamples negative by type-specific primers for HPV 16, 18, 31 and 33

[0139]

4TABLE 4 HPV L1 primers for the A, B and C regions Name 5'-sequence-3' SEQ ID NO Forward primers region A SGP3A TATTTAATAAACCATATTGG 3 SGP3B TATTTAATAAGCCATATTGG 4 SGP3C TATTTAATAAGCCTTATTGG 10 SGP3D TATTCAATAAACCTTATTGG 11 SGP3E TATTTAATAAACCTTACTGG 12 SGP3F TATTTAATAAICCITATTGG 13 SGP3G TATTTAATAAICCITACTGG 14 Forward primers region B SGP1A GCICAGGGTCACAATAATGG 15 SGP1B GCICAGGGICATAACAATGG 16 SGP1C GCICAGGGICATAATAATGG 17 SGP1D GCICAAGGICATAATAATGG 18 Reverse primers region C SGP2B-bio bio-GTIGTATCIACAACAGTAACAAA 19 SOP2C-bio bio-GTIGTATCTACCACAGTAACAAA 20 SGP2D-bio bio-GTIGTATCIACTACAGTAACAAA 21 SCP2-bio bio-GTIGTATCIACGACAGTIACAAA 22 SGP2F-bio bio-GTIGTATCIACAACAGTIAIAAA 23 I stands for inosine "bio-" indicates that the primer is biotinylated

[0140]

5TABLE 5 PCR amplification with primers in the B and in the C region SGP1C SGP1C SGP1C SGP1C SGP1D SGP1D SGP1D SGP1D SGP1D SGP1tot MY11Q SGP1AB Primerset SGP2C- SGP2D- SGP2E- SGP2F- SGP2B- SGP2C- SGP2D- SGP2E- SGP2F- SGP2tot- SGP2- SGP2BD- HPV blo blo blo blo blo blo blo blo blo blo blo blo 6 ++ ++ .+-. + ++ .+-. ++ ++ ++ 11 ++ ++ ++ + ++ .+-. ++ + ++ .+-. ++ 16 ++ ++ .+-. .+-. + ++ ++ ++ 18 ++ ++ ++ + ++ + ++ ++ ++ ++ ++ 31 ++ ++ ++ + ++ + ++ + ++ ++ ++ 33 ++ ++ ++ + ++ ++ ++ ++ + ++ ++ ++ 45 .+-. + .+-. + .+-. ++ ++ ++ 35 .+-. ++ ++ ++ ++ ++ ++ + ++ .+-. ++ 39 ++ + ++ ++ ++ ++ .+-. ++ 58 .+-. + + .+-. ++ ++ ++ + ++ ++ ++ 57 + ++ + + + ++ ++ + ++ 59 + ++ .+-. + + .+-. ++ ++ ++ SGP1A SGP1A SGP1A SGP1A SGP1A SGP1B SGP1B SGP1B SGP1B SGP1B SGP1B Primerset SGP2B- SGP2C- SGP2D- SGP2E- SGP2F- SGP2B- SGP2C- SGP2D- SGP2E- SGP2F- SGP2B- HPV blo blo blo blo blo blo blo blo blo blo blo 6 + + + ++ ++ ++ ++ + ++ 11 ++ ++ + ++ ++ ++ ++ + ++ 16 ++ ++ ++ + ++ + + ++ 18 ++ + ++ ++ .+-. ++ ++ ++ ++ + ++ 31 ++ ++ ++ ++ + ++ + ++ ++ ++ 33 ++ + ++ ++ ++ + ++ ++ ++ 45 ++ ++ + 35 + ++ .+-. .+-. ++ + ++ 39 + + .+-. + + + 58 .+-. ++ + ++ + + 57 + ++ + ++ + 59 .+-. + .+-. + + ++ ++ .+-. +

[0141]

6TABLE 6 HPV genotyping of 77 isolates by type-specific PCR and sequence analysis of the SGP1/SGP2 amplimer. HPV-type type-specific PCR SGP1/SGP2 16 70 70 18 7 7

[0142]

7TABLE 7 Type-specific HPV probes po- lar- SEQ Name 5'-sequence-3' ity ID NO HPV6 Pr1 TTGGGGTAATCAACTGTGG + 24 HPV6 Pr2 GTTGGGGTAATCAACTGTGG + 25 HPV6 Pr3 TTGGGGTAATCAACTGTTG + 26 HPV6 Pr4 GTTGGGGTAATCAACTGTTG + 27 HPV6 Pr5 TTGGGGTAATCAACTGTTT + 28 HPV11 Pr1 TGCTGGGGAAACCACTG + 29 HPV11 Pr2 TGCTGGGGAAACCACTTAGG + 30 HPV11 Pr3 TTGTTGGGGAAACCACTG + 31 HPV11 Pr4 TTGCTGGGGAAACCACTTAGG + 32 HPV11 Pr5 TGCTGGGGAAACCACTTGGG + 33 HPV16 Pr1 TTGGGGTAACCAACTATGG + 34 HPV16 Pr2 GTTGGGGTAACCAACTATGG + 35 HPV16 Pr3 TTGGGGTAACCAACTATTG + 36 HPV16 Pr4 GTTGGGGTAACCAACTATTG + 37 HPV16 Pr5 TTGGGGTAACCAACTATTT + 38 HPV18 Pr1 GTGTTTGCTGOCATAAT + 39 HPV18 Pr2 GGTGTTTGCTGGCATAAG + 40 HPV18 Pr3 GTGTTTGCTGGCATAATC + 41 HPV18 Pr4 TGGTGTTTGCTGGCATAAG + 42 HPV18 Pr5 GGTGTTTGCTGGCATAAT + 43 HPV31 Pr1 TTGGGGCAATCAGTTATGG + 44 HPV31 Pr2 GTTGGGGCAATCAGTTATGG + 45 HPV31 Pr3 TTGGGGCAATCAGTTATTG + 46 HPV31 Pr4 GTTGGGGCAATCAGTTATTG + 47 HPV31 Pr5 GTTGGGGCAATCAGTTATTT + 48 HPV31 Pr21 GGGCAATCAGTTATTG + 49 HPV31 Pr22 AATAACTGATTGCCC - 50 HPV31 Pr23 GGCAATCAGTTATTTCC + 51 HPV31 Pr24 AAATAACTGATTGCC - 52 HPV31 Pr25 GCAATCAGTTATTTGG + 53 HPV31 Pr26 CAAATAACTGATTGC - 54 HPV31 Pr31 GGCAATCAGTTATTTGG + 55 HPV31 Pr32 GCAATCAGTTATTTGTG + 56 HPV33 Pr1 TTGGGGCAATCAGGTATGG + 57 HPV33 Pr2 GTTGGGGCAATCAGGTATGG + 58 HPV33 Pr3 TTGGGGCAATCAGGTATTG + 59 HPV33 Pr4 GTTGGGGCAATCAGGTATTG + 60 HPV33 Pr5 GTTGGGGCAATCAGGTATTT + 61 HPV33 Pr21 GGGCAATCAGGTATTG + 62 HPV33 Pr22 AATACCTGATTGCCC - 63 HPV33 Pr23 GGCAATCAGGTATTTCC + 64 HPV33 Pr24 AAATACCTGATTGCC - 65 HPV33 Pr25 GCAATCAGGTATTTGG + 66 HPV33 Pr26 CAAATACCTGATTGC - 67 HPV40 Pr1 CATATGTTTTGGCAATC + 68 HPV45 Pr1 = SGPP68 GTATTTGTTGGCATAAT + 69 H2V45 Pr2 GGTATTTGTTGGCATAAG + 70 HPV45 Pr3 GTATTTGTTGGCATAATC + 71 HPV45 Pr4 TGGTATTTGTTGGCATAAG + 72 HPV45 Pr5 GGTATTTGTTGGCATAAT + 73 HPV45 Pr11 TGGCATAATCAGTTGGG + 74 HPV45 Pr12 GGCATAATCAGTTGTG + 75 HPV45 Pr13 GCATAATCAGTTGTTT + 76 HPV52 Pr1 GCAATCAGTTGTTTGC + 77 HPV52 Pr2 CAATCAGTTGTTTGTC + 78 HPV52 Pr3 ATGGCATATGTTGGG + 79 HPV52 Pr4 TGGCATATGTTGGGGG + 80 HPV52 Pr5 GGCATATGTTGGGGC + 81 HPVS2 Pr6 GCATATGTTGGGGCA + 82 HPV56 Pr1 GGGGTAATCAATTATC + 83 HPVS6 Pr2 GGGGTAATCAATTATTC + 84 HPV5G Pr3 GGGGTAATCAATTATTT + 85 HPV56 Pr11 TGGGGTAATCAATTATTT + 86 HPV56 Pr12 GGGGTAATCAATTATTTGG + 87 HPV58 Pr1 CATTTGCTGGGGCAAG + 88 HPV58 Pr2 ATTTGCTGGGGCAAT + 89 HPV58 Pr3 TTTGCTGGGGCAATC + 90 HPV58 Pr4 TTGCTGGGGCAATCA + 91 SGPP35 GTTGGAGTAACCAATTG + 92 SGPP39 GTATATGTTGGCATAAT + 93 SGPP51 = HPV51 Pr1 GCATTTGCTGGAACAAT + 94 SGPP54 GGGGCAATCAGGTGTTT + 95 SGPP59 GGTATATGTTGGCACAA + 96 SGPP66 GCATATGCTGGGGTA + 97 SGPP68 = HPV45 Pr1 GTATTTGTTGGCATAAT + 69 SGPP70 = HPV70 Pr11 CATTTGTTGGCATAACC + 99 SGPP13 TGGGGCAATCACTTG + 100 SGPP34 GCATTTGCTGGCATA + 101 SGPP42 TGGGGAAATCAGCTATT + 102 SGPP43 GGCATTTGTTTTGGGAA + 103 SGPP44 TTGGGGAAATCAGTTATT + 104 SGPP53 GCATCTGTTGGAACAA + 105 SGPP55 GTTGGGGGAATCAGT + 106 SGPP69 GTTGGGGCAACCAATTG + 107 SGPP61 TGGTTTAATGAATTGTTT + 108 SGPP62 GGTTTAATGAACTGTTT + 109 SGPP64 AATGGAATTTGTTGGCA + 110 SGPP67 GTATATGCTGGGGTAAT + 111 SGPP74 = HPV74 Pr13 ATTTGTTGGGGTAATCA + 112 MM4 = HPVM4 Pr11 TGCTGGAATAATCAGCT + 113 MM7 TGGTTTAATGAGTTATTT + 114 MM8 ATATGCTGGTTTAATCA + 115

[0143]

8TABLE 8 HPV primers for synthesis of biotinylated PCR products. SEQ ID NO/ Name polarity 5'-sequence-3+ reference SGP1-bio + bio-GCMCAGGGHCATAAYAATGG 6 SGP2-bio - bio-GTATCHACHACAGTAACAAA 9 MY09-bio - bio-CGTCCMARRGGAWACTGATC Manos et al., 1989 M = A or C; H = A, C or T; Y = C or T; R = A or G; W = A or T

[0144]

9TABLE 9 Probes for general HPV detection HPV types Name 5'-sequence-3'.sup.1 position.sup.2 recognized SEQ ID NO HPVuni1 AATAATGGCATITGTTGG 6594-6611 16, 30, 52,53, 116 70, MM7, 72, 43 HPVuni2 AATAATGGTATITGTTGG 6594-6611 31, 33, 26, 35, 117 13, 42, 44, 55, 62, 73 HPVuni3 AACAATGGTATITGTTGG 6594-6611 45, 6, 59, 68, 118 54, 61, 39 HPVuni4 AACAATGGTATITGCTGG 6594-6611 11, 67, MM8 119 HPVuni5 AACAATGGTGTTTGCTGG 6594-6611 18 120 HPVuni6 AATAATGGCATTTGCTGG 6594-6611 51, 56, 66, MM4 121 HPVuni7 AACAATGGCATITGCTGG 6594-6611 34, 57, 58 122 HPVuni1A CAIAATAATGGCATITGTTGGC 6591-6612 16, 30, 52, 53, 220 70, MM7, 72, 43 HPVuni1B CAIAACAATGGCATTTGTTGGC 6591-6612 16, 30, 40, 52, 5 221 3, 69, 70, MM7 72, 43 HPVuni1c CACAATAATGGCATTTGTTGGGG 6591-6613 16, 30, 52, 53, 222 70, MM7, 72, 43 HPVuni2A CAIAATAATGGTATITGTTGGG 6591-6612 31, 33, 26, 35, 223 13, 42, 44, 55, 62, 73 HPVuni3A CAIAACAATGGTATITGTTGGC 6591-6612 45, 6, 59, 68, 224 54, 61, 39 .sup.1I = inosine .sup.2Sequence positions according to HPV genotype 16 sequence PPH16, Genbank accession number K02718 HPV type 64 is theoretically not recognised.

[0145]

10TABLE 10 Probes for general HPV detection po- lar- SEQ Name 5'-sequence-3' ity ID NO HPVuni2L2 CAIAATAATGGTATITGTTGG + 123 HPVuni2L3 AIAATAATGGTATITGTTGG + 124 HPVuni2L4 CAIAATAATGGTATTTGTTGG + 125 HPVuni2L5 AIAATAATGGTATTTGTTGG + 126 HPVuni2LG CACAATAATGGTATTTGTTGG + 127 HPVuni2L7 ACAATAATGGTATTTGTTGG + 128 HPVuni4L1 CAIAACAATGGTATITGTTGG + 129 HPVuni4L2 AIAACAATGGTATITCTTGG + 130 HPVuni4L3 CAIAACAATGCTATTTGTTGG + 131 HPVuni4L4 AIAACAATGGTATTTGTTGG + 132 HPVuni4L5 CATAACAATGGTATTTGTTGG + 133 HPVuni4LG ATAACAATGGTATTTGTTGG + 134 HPV G1 AATGGCATTTGTTGGGGTAACCA- ACTATTT + 225 HPV G1A1 TTGTTGGGGTAACCAACTATG + 226 HPV G1A2 ATTTGTTGGGGTAACCAACTATTG + 227 HPV G1A3 GCATTTGTTGGGGTAACCAACTA + 228 HPV G1A4 TGGCATTTGTTGGGGTAACCAACTA + 229 HPV G2 AATGGTATTTGTTGGGGCAATCAGTTATTT + 230 HPV G3 AATGGTATTTGTTGGCATAATCAGTTGTTT + 231 HPV G4 AATGGTATTTGTTGGTTTAATGAATTGTTT + 232 HPV G5 AATGGCATTTGCTGGAACAATCAGCTTTTT + 233 HPV G6 AATGGTATATGTTGGGGCAATCACTTGTTT + 234 HPV R1 AATGGCATTTGTTGGGGC + 235 HPV R10 AATGGCATATGCTGGAATAATC + 236 HPV R11 AATGGTATATGTTGGGGCAATC + 237 HPV R2 AATGGTATTTGTTGGGGC + 238 HPV R3 AATGGAATTTCTTGGCATAATC + 239 HPV R4 GGTATCTGCTGGCATAAT + 240 HPV R5 AATGGCATTTGTTGGTTTAATC + 241 HPV R6 AATGGTATTTGTTGGTTTAATG + 242 HPV R7 AATGGCATCTGTTGGTTTAATG + 243 HPV R8 TGTTGGTTTAATGAGCTCTG + 244 HPV R9 TGCTGGTTTAATCAATTGTTG + 245 Underlined sequences are not complementary to HPV.

[0146]

11TABLE 11 PCR primers SEQ Primer ID designation 5'-sequence-3'.sup.1 position.sup.2 NO SGP1A GCICAGGGICACAATAATGG 6582-6601 15 SGP1B GCICAGGGICATAACAATGG 6582-6601 16 SGP1C GCICAGGGICATAATAATGG 6582-6601 17 SGP1D CCICAAGGICATAATAATGG 6582-6601 18 SGP2B-bio GTIGTATCIACAACAGTAACAAA 6624-6646 19 SGP2D-bio GTIGTATCIACTACAGTAACAAA 6624-6646 21 SGP2H-bio GTIGTATCIACAACTGTAACAAA 6624-6646 98 SGP2I-bio GTIGTATCCACAACAGTTACAAA 6624-6646 154 SGP2J-bio GTGGTATCCACAACIGTGACAAA 6624-6646 155 SGP2K-bio GTAGTTTCCACAACAGTAAGAAA 6624-6646 156 SGP2L-bio GTAGTATCAACCACACTTAAAAA 6624-6646 157 SGP2M-bio CTIGTATCTACAACIGTTAAAAA 6624-6646 158 SGP2N-bio GTAGTATCTACACAAGTAACAAA 6624-6646 159 SGP2P-bio GTAGTATCAACACAGGTAATAAA 6624-6646 160 .sup.1I = inosine .sup.2Sequence positions according to HPV genotype 16 sequence PPH16, Genbank accession number K02718.

[0147]

12TABLE 12 HFV type-specific probes +HC,28SEQ HPV PROBE 5'-sequence-3' polarity ID NO HPV18b Pr1 GGTATCTGCTGGCATAAG + 161 HPV18b Pr2 TGGTATCTGCTGGCATA + 162 HPV31 Vs40-1 TATTTGTTGGGGCAATC + 163 HPV31 Vs40-2 ATTTGTTGGGGCAATC + 164 HPV31 Vs40-3 TATTTGTTGGGGCAAT + 165 HPV34 Pr1 GGCATTTGCTGGCATA + 166 HPV35 Pr1 GTTGGAGTAACCAATTGGG + 167 HPV35 Pr2 TGTTGGAGTAACCAATTCC + 168 HPV35 Pr3 TTGTTGGAGTAACCAATG + 169 HPV39 Pr1 GGTATATGTTGGCATAAT + 170 HPV42 Pr1 GGGGAAATCAGCTATTG + 171 HPV42 Pr2 GGGAAATCAGCTATTT + 172 HPV43 Pr1 GGCATTTGTTTTGGGAAG + 173 HPV43 Pr2 GCATTTGTTTTGGGAAT + 174 HPV43 Pr3 CATTTGTTTTGGGAATC + 175 HPV44 Pr1 GGGGAAATCAGTTATTG + 176 HPV44 Pr2 GGGGAAATCACTTATTT + 177 HPV44 Pr3 GGGAAATCAGTTATTT + 178 HPV44 Pr4 TGGGGAAATCAGTTATG + 179 HPV45 Pr5 GGTATTTGTTGGCATAAT + 73 HPV51 Pr1= GCATTTGCTGGAACAAT + 94 SGPP51 HPV51 Pr2 CATTTGCTGGAACAATC + 180 HPV53 Pr1 GGCATCTGTTGGAACAA + 181 HPV54 Pr1 GGCAATCAGGTGTTTC + 182 HPV54 Pr11 CGGCAATCAGGTGTTTC + 183 HPV54 Pr11as AAACACCTGATTGCCC - 184 HPV54 Pr12 GGCAATCAGGTGTTTTG + 185 HPV55 Pr1 GGGGGAATCAGTTATTG + 186 HPV55 Pr11 GGGGGAATCAGTTATG + 187 HPV55 Pr12 TGGGGGAATCAGTTATG + 188 HPV55 Pr13 TGGGGGAATCAGTTAG + 189 HPV56 Vs74-1 CATTTGCTGGGGTAAT + 190 HPV59 Pr1 TGGTATATGTTGGCACAA + 191 HPV59 Pr11 GGTATATGTTGGCACAAT + 192 HPV59 Pr12 GTATATGTTGGCACAATC + 193 HPV59 Pr13 TATATGTTGGCACAATC + 194 HPV66 Pr1 GGCATATGCTGGGGTA + 195 HPV67 Pr1 GGTATATGCTGGGGTAAT + 196 HPV67 Pr11 GGTATATGCTGGGGTA + 197 HPV67 Pr12 TGGTATATGCTGGGGT + 198 HPV67 Pr13 ATGGTATATGCTGGGGG + 199 HPV67 Pr21 GGTATATGCTGGGGT + 200 HPV67 Pr22 TGGTATATGCTGGGGG + 201 HPV67 Pr23 AATGGTATATGCTGGG + 202 HPV68 Pr1 TGGTATTTGTTGGCATA + 203 HPV68 Pr2 ATGGTATTTGTTGGCATA + 204 HPV68 Pr3 ATGGTATTTGTTGGCAT + 205 HPV68 Vs45-1 TTGGCATAATCAATTATTT + 206 HPV68 Vs45-2 TTGGCATAATCAATTATTTCG + 207 HPV70 Pr1 GCATTTGTTGGCATAACC + 208 HPV70 Pr11 = CATTTGTTGGCATAACC + 99 SGPP70 HPV70 Pr12 GCATTTGTTGGCATAAC + 209 HPV70 Pr13 CATTTGTTGGCATAAC + 210 HPV74 Pr1 TATTTGTTGGGGTAAT + 211 HPV74 Pr11 ATTTGTTGGGGTAATC + 212 HPV74 Pr12 TTTGTTGGGGTAATCA + 213 HPV74 Pr13 = ATTTGTTGGGGTAATCA + 112 SGPP74 HPV74 Pr2 GTATTTGTTGGGGTAAT + 214 HPV74 Pr3 TATTTGTTGGGGTAATC + 215 HPVM4 Pr1 TTGCTGGAATAATCAGCT + 216 HPVM4 Pr11 = TGCTGGAATAATCAGCT + 113 MM4 HPVM4 Pr12 TGCTGGAATAATCAGC + 217 HPVM4 Pr21 TGCTGGAATAATCAGCTG + 218 HPVM4 Pr22 TGCTGGAATAATCAGCG + 219 Underlined sequences are not complementary to HPV

EXAMPLES

[0148] The following examples only serve to illustrate the present invention. These examples are in no way intended to limit the scope of the present invention.

Example 1

Development of Novel General HPV PCR Primers

[0149] Introduction

[0150] The aim of the present example was to deduce PCR primers that allow general PCR amplification of sequences from multiple HPV types.

[0151] Materials and Methods

[0152] Design of Primers

[0153] HPV sequences were obtained from the GenBank database.

[0154] Alignment of all available L1 sequences revealed that there are several regions that show a high degree of conservation among the different HPV genotypes. These regions are indicated in FIG. 1 and are designated A, B and C, respectively.

[0155] In order to obtain universal amplification of all HPV sequences, several primers were selected in these three regions. The locations and sequences of the different primers are represented in FIG. 2 and table 1, respectively. Primer combinations from the A (SGP3) and C (SGP2) region and those from the B (SGP1) and C (SGP2) region will yield an expected amplimer of 91 basepairs (bp) or 62 bp, respectively. Type-specific primers for HPV types 16, 18, 31 and 33 were described in Baay et al. (1996). The MY11-MY09 primer set was described in Manos et al. (1989). The GP5/GP6 primer set was described in van den Brule et al. (1990).

[0156] DNA Isolation

[0157] DNA was isolated from the 92 formalin fixed and paraffin-embedded cervical cancer biopsies by a modified version of the method described by Claas et al (1989). A 10 .mu.m section was collected in a 1.5 ml tube and deparaffinized by 500 .mu.l Xylol. After gently shaking for 2 minutes and centrifugation for 5 minutes the pellet was again treated with 500 .mu.l Xylol. The pellet was washed twice with 500 .mu.l alcohol 96% and once with 500 .mu.l acetone. Subsequently, the pellet was air-dried and treated with a 200 .mu.l proteinase K solution (1 mg/ml) overnight at 37.degree. C.

[0158] PCR

[0159] The PCR was performed essentially as described by Saiki (1988). Briefly, the final volume of 100 .mu.l contained 10 .mu.l of the isolated DNA, 10 mM Tris-HCl pH 9.0, 50 mM KCl, 2.5 mM MgCl.sub.2, 0.1% Triton X-100, 0.01% gelatin, 200 .mu.M of each deoxynucleoside triphosphate, 50 pmol of forward and reverse primer, and 0.25U of SuperTaq (Sphaero Q, Cambridge, United Kingdom). For the MY11/MY09 primerset (Manos et al., 1989) 0.5U SuperTaq was used. PCR conditions were a preheating step for 1 min 94.degree. C. followed by 40 cycles of 1 min 94.degree. C., 1 min 52.degree. C. and 1 min 72.degree. C. For the primerset SGP3/SGP2 the 40 cycles of amplification consisted of 1 min 94.degree. C., 1 min 40.degree. C. and 1 min 72.degree. C. For the primerset GP5/GP6 (van den Brule et al., 1990) the 40 cycles of amplification consisted of and 1 min 94.degree. C., 2 min 40.degree. C. and 1.5 min 72.degree. C. As a control for succesful DNA isolation a PCR was performed using .beta.-globin primers described by Saiki (1986).

[0160] Southern Blot Analysis

[0161] The Southern blot hybridization experiments were performed according to standard procedures (Sambrook et al., 1989). Briefly, 20 .mu.l of the PCR-product was electrophoresed on a 2% agarose gel. Amplimers produced by the primer sets SGP1/SGP2 and SGP3/SGP2 were applied on a 3% agarose gel. Subsequently, amplimers were transferred to a nylon membrane (Hybond N+, Amersham, Little Chalfont, United Kingdom) by vacuum blotting in the presence of 0.4N NaOH. The Southern blots were hybridized with a .sup.32P 5'-end labeled probe(s) for 16 hours at 42.degree. C. in a solution containing 5.times.SSC (1.times.SSC: 15 mM Na-citrate and 150 mM NaCl, pH 7.0), 5.times. Denhardt's (1.times. Denhardt: 0.02% bovine serum albumin, 0.02% polyvinyl pyrolidone and 0.02% ficoll), 0.5% SDS, 75 MM EDTA and 0.1 mg/ml herring sperm DNA. Subsequently, the blots were washed twice in 2.times.SSC/0.1% SDS at 42.degree. C. for 15 minutes. Autoradiography was performed for 3.5 hours using the Kodak X-Omat AR film.

[0162] Samples that were negative by type-specific primers were also analyzed by the L1 directed general primer sets MY11/MY09 and GP5/GP6.

[0163] Sequence Analysis

[0164] PCR products were analyzed by direct sequencing, using a cycle-sequencing kit (Perkin Elmer). Sequences were analyzed by the PC-Gene software (Intelligenetics, USA)

[0165] Results

[0166] In order to develop a general set of PCR primers that would allow universal amplification of HPV sequences, we aimed at the L1 region. Primers SGP1 and SGP2 were tested on a number of plasmids, containing partial or complete genomic sequences from various HPV types. The results are summarized in table 2. An amplimer was obtained for all HPV plasmids by the SGP1/SGP2 primer set, although the amount of PCR-product was different. Sequence analysis revealed that the PCR-product was obtained from the corresponding HPV plasmid and matched the published sequence. Primer set SGP3/GP6 was used to confirm proper isolation of the HPV plasmids.

[0167] To evaluate the efficacy of the novel primers SGP1 and SGP2 in biological samples, 92 formalin-fixed, paraffin-embedded cervical cancer biopsies were tested. DNA isolated from these biopsies was subjected to different PCR assays: .beta.-globin primers PCO3 and PCO4 (Saiki et al., 1988), SGP1/SGP2, and type-specific PCR for HPV types 16, 18, 31, and 33. The results are summarized in table 3.

[0168] 1. All biopsies contained amplifiable DNA as determined with PCR directed to the .beta.-globin gene.

[0169] 2. A total of 61 (66%) of the 92 biopsies were positive by type-specific PCR. Of these 61 biopsies, 54 contained HPV type 16 and 7 contained HPV type 18. Subsequently, the remaining 31 biopsies were assayed by HPV 31 and HPV 33 type-specific primers and remained negative.

[0170] 3. The 31 samples, negative by type-specific PCR were also analyzed by two general primer sets described previously (Manos et al., 1989; van den Brule et al., 1990). By using the MY11/MY09 and GP5/GP6 primersets only 1/31 and 3/31 biopsies were found positive, respectively.

[0171] 4. All 92 biopsies were found positive by the newly developed SGP1/SGP2 primerset.

[0172] Discussion

[0173] In general, amplification of a small genomic fragment is likely to increase the sensitivity of the PCR. This is of particular importance when using biological samples that contain a very low copy number of HPV. Furthermore, cervical biopsies that have been formalin-fixed and paraffin-embedded are a poor source of amplifiable DNA.

[0174] In this high-risk group for HPV, the novel primer combination SGP1/SGP2 was more sensitive than the type-specific PCR and the general PCRs that were also directed to the L1 region of HPV.

[0175] In conclusion the newly developed primer sets are highly sensitive for detection of HPV DNA.

Example 2

Optimization of PCR Primers from the A, B and C region

[0176] Introduction

[0177] Example 1 describes the selection of semi-conserved regions in the L1 gene of the HPV genome, that permitted the development of a general PCR system. Degenerated primers were used for universal amplification of HPV sequences from different genotypes.

[0178] The present example describes the optimization of the primers aimed at these regions. Instead of degenerated primers, this study aimed at the development of several distinct and defined forward and reverse primers.

[0179] Materials and Methods

[0180] Alignments of L1 sequences were used to deduce PCR primers from the three regions A, B and C (FIG. 1). Primers were tested by PCR in different combinations on plasmids, containing partial or complete genomic inserts from the genital HPV types 6, 11, 16, 18, 31, 33, 35, 39, 43, 45, 51, 52, 53, 56, 57, 58, 59, 62, 64 and 67 as listed in table 2.

[0181] HPV DNA amplification was performed according to the following protocol. The final PCR volume of 100 .mu.l contained 10 .mu.l of HPV plasmid DNA, 75 mM Tris-HCl pH 9.0, mM (NH.sub.4).sub.2SO.sub.4, 2.5 mM MgCL.sub.2, 0.1% (w/v) Tween 20, 200 .mu.M of each deoxynucleoside triphosphate, 100 pmol of forward and reverse primer, and 3U of Taq-DNA polymerase (Pharmacia, Uppsala, Sweden). After a preheating step for 1 min 94.degree. C. amplification was performed by 1 min 94.degree. C., 1 min 52.degree. C. and 1 min 72.degree. C. for 40 cycles. Subsequently, PCR-products were analyzed on a 3% agarose gel.

[0182] Results

[0183] Based on the alignments of the L1 sequences as shown in FIG. 1, primers were selected, as shown in table 4. The specificity of the primers in the regions B and C was tested on the plasmids HPV 6, 11, 16, 18, 31, 33, 45, 35, 39, 58, 57 and 59. PCR was performed by all 20 possible primer combinations for the regions B and C and results are summarized in table 5. Poor results were only obtained when using the primer SGP2F-bio that contains an inosine residu at four positions. Although some primer sets had mismatches with the target HPV sequences, amplimers were synthesized for all tested HPV plasmids. From the tested nine primers in the regions B and C, four of them (SGP1A, SGP1B, SGP2B-bio and SGP2D-bio) could be used for efficient HPV amplification. PCR performance of the primer set containing the four primers SGP1A, SGP1B, SGP2B and SGP2D revealed amplification from all tested HPV plasmids: 6, 11, 16, 18, 31, 33, 45, 35, 39, 58, 57 and 59.

[0184] Sequence analysis of the amplimers revealed the expected sequence for each plasmid. This result indicates that the four primers are able to detect the various HPV types. The mismatches with especially type 57 and 59 apparently did not hamper amplification.

[0185] Discussion

[0186] Despite the presence of mismatches between primer and target sequence, successful amplification by PCR may occur if there are no mismatches at the 3' end of the primer. The PCR and sequence data obtained in this study indicate that the primers SGP1A, SGP1B, SGP2B-bio and SGP2D-bio are able to detect efficiently the various HPV genotypes. Therefore, these four primers can be used for universal amplification of HPV.

Example 3

Identification of Different HPV Types by Analysis of a Small PCR Fragment Derived from the L1 region

[0187] Introduction

[0188] Identification of the different HPV genotypes may have great clinical and epidemiological importance. Current classification methods are for instance based on either type-specific PCR or sequence analysis of larger DNA fragments. Therefore, there is a clear need for a simple, rapid and reliable genotyping assay for the different HPV genotypes.

[0189] This assay should preferably be combined with the detection of HPV DNA, aiming at the same genomic region. Therefore, we aimed at the development of a screening assay to detect the presence of HPV DNA in clinical samples, and (in case of a positive screening result) the subsequent use of the same amplimer in a genotyping assay.

[0190] The theoretical requirements for such an assay would be as follows:

[0191] 1. The amplimer should be small, to allow highly sensitive detection and to permit amplification from formalin-fixed, paraffin-embedded materials. The development of such a PCR assay has been described in examples 1 and 2.

[0192] 2. The amplified fragment should contain sufficient sequence variation to permit specific detection of the different genotypes.

[0193] The present study describes: (i) the relationship between sequences from the various HPV types by phylogenetic analyses of the regions MY11/MY09, the sequence between region A and C (51 bp) and between B and C (22 bp); (ii) the analysis of the small amplimer of 62 bp generated by primers from the region B and C; (iii) The development of HPV type-specific probes from this region.

[0194] Materials and Methods

[0195] 1. Sequences from the different HPV genotypes were obtained from the GenBank database.

[0196] 2. Phylogenetic analyses were performed with the Phylip 3.5c software (Felsenstein 1995).

[0197] 3. Type-specific HPV PCR and general HPV amplification by SGP1/SGP2 were performed according to the protocol as described in examples 1 and 2.

[0198] 4. Sequence analysis of the PCR-products was performed by manual sequencing, using the cycle-sequencing kit (Perkin Elmer). Sequences were analyzed by the PC-Gene software (Intelligenetics, USA)

[0199] Results

[0200] Phylogenetic Analyses

[0201] In order to study the relationships between the HPV-derived sequences, several phylogenetic trees were constructed.

[0202] 1. Sequences between primers MY11 and MY09 were selected from all available HPV sequences. The phylogenetic tree is shown in FIG. 3. Sequence variation in this .+-.410 bp region permits discrimination between most, if not all HPV genotypes. The different groups of HPV (indicated with an A followed by a number) are indicated in the figure (Chan et al., 1995).

[0203] 2. Sequences between the regions A and C and those between B and C were also subjected to phylogenetic analysis, and both trees are shown in the FIG. 4 and FIG. 5, respectively. Sequence variation enclosed by the primers in regions B and C (22 bp) allows discrimination between the genital HPV types. HPV68 (a genital type) and HPV73 (an oral 15-type) show an identical sequence in this region. However these two types can be recognized in the region flanked by primers in the regions A and C, for instance by use of probes HPV 68 (CAGGGACACAACAATG) and HPV 73 (CAGGGTCATAACAATGG).

[0204] Intratypic Variation

[0205] Since the aim of this study is to determine whether the intratypic sequence variation in the small PCR product is sufficient to identify the different HPV genotypes, the intratypic variation should also be investigated.

[0206] Therefore, 77 HPV isolates positive with specific primers for type 16 or 18, were studied for sequence variability in the SGP1/SGP2 amplimer. Samples identified as type 16 by type-specific PCR were all identically typed by sequence analysis of the SGP1/SGP2 amplimer (table 6). There was no intratypic sequence variation in the small SGP1/SGP2 amplimer. Identical results were obtained for HPV 18. Sequence analysis of the SGP1/SGP2 amplimers in the group of 31 samples negative by HPV type-specific PCR, as described in example 1, revealed different HPV sequences. The obtained sequences were identical to HPV types 16 (n=9), 18 (n=4), 31 (n=2), 35 (n=1), 45 (n=5), 52 (n=2), 56 (n=3) and 58 (n=2). This indicates that PCR with SGP1/SGP2 is more sensitive than HPV type-specific PCRs. Aberrant sequences, not matching any known HPV type, were found in three cases. It was not possible to amplify these isolates by other previously described general primer sets (MY11/MY09, GP5/GP6 and CPI/CPIIg). For these samples the HPV specificity was confirmed by performing a semi-nested PCR with the primer sets SGP3/SGP2 and SGP1/SGP2.

[0207] Discussion

[0208] Phylogenetic analyses of the various HPV types revealed heterogeneity in the region between primers SGP1 and SGP2. Sequence variation was found to be sufficient for consistent discrimination between all genital HPV types. In order to investigate the reproducibility of this region for HPV genotyping, 77 samples were typed by type-specific PCR and sequence analysis of the SGP1/SGP2 amplimer. No intratypic variation was observed in the SGP1/SGP2 amplimers.

[0209] From these results and that of already reported sequences, in particular HPV type 16 variants, it might be suggested that intratypic variability in the 22 bp between the SGP1 and SGP2 primers is very limited. This observation supports the use of sequence variation in the SGP1/SGP2 amplimer for HPV genotyping.

Example 4

Development of the HPV INNO-LiPA Genotyping Assay

[0210] Introduction

[0211] An aim of the invention was to develop a simple and reliable system for detection as well as identification of HPV genotypes. A possible format of such a system could comprise a single PCR using universal primers, that amplify a small genomic fragment with very high sensitivity. Subsequently, the same PCR product can be used to discriminate between the HPV genotypes.

[0212] For analysis of the PCR products, sequence analysis is a very accurate method, but it is not very convenient. Therefore we aimed at the development of type-specific probes, that would permit positive recognition of the different HPV genotypes.

[0213] Materials and Methods

[0214] Selection of Probes:

[0215] Based on the 22 bp sequences located between the regions B and C (FIG. 1), a number of type-specific probes were proposed. These probes are listed in table 7.

[0216] HPV Plasmids and Clinical Isolates

[0217] The selected probes were analysed for analytical and clinical specificity. First, plasmids, containing complete genomic sequences of different HPV types, were used as target for PCR amplification with primers SGP1-bio and SGP2-bio, and with primers SGP1-bio and MY09-bio.

[0218] PCR Reactions

[0219] PCR was performed using the primer sets SGP1-bio/SGP2-bio and SGP1-bio/MY09-bio. All primers contained a biotin moiety at the 5' end (table 8). The PCR conditions were similar to those described in example 1. The final volume of 100 .mu.l contained 10 .mu.l of plasmid DNA, 75 mM Tris-HCl pH 9.0, 20 mM (NH.sub.4).sub.2SO.sub.4 2.5 mM MgCl.sub.2 0.1% (w/v) Tween 20, 200 .mu.M of each deoxynucleoside triphosphate, 100 pmol of forward and reverse primer, and 3U of Taq-DNA polymerase (Pharmacia, Uppsala, Sweden). After a preheating step for 1 min 94.degree. C. amplification was performed by 1 min 94.degree. C., 1 min 52.degree. C. and 1 min 72.degree. C. for 40 cycles.

[0220] Development of a Reverse Hybridization Format

[0221] In order to permit analysis of multiple probes in a single hybridization step, a reverse hybridization assay was developed. This requires the selection of type-specific probes that have very similar hybridization characteristics. For this experiment probes were chosen for HPV types 6, 11, 16, 18, 31, 33 and 45.

[0222] Oligonucleotide probes were provided with a poly-(dT) tail at the 3' end. Twenty pmol primer was incubated in 25 .mu.l buffer containing 3.2 mM dTTP, 25 mM Tris-HCl (pH 7.5), 0.1 M sodium cacodylate, 1 mM CoCl.sub.2, 0.1 mM dithiothreitol and 60 U terminal desoxynucleotidyl transferase for 1 h at 37.degree. C. The reaction was stopped by adding 2.5 .mu.l 0.5 M EDTA (pH 8.0) and diluted with 20.times.SSC (Sambrook et al., 1989), until a final concentration of 6.times.SSC and 2.5 pmol oligonucleotide/.mu.l was reached. The tailed probes were immobilized on a nitrocellulose strip as parallel lines. As a control for the conjugate, biotinylated DNA was also applied. A possible outline of the strip is shown in FIG. 6.

[0223] Ten .mu.l of the PCR amplification product, containing biotin at the 5' end of each primer, was mixed with 10 .mu.l of denaturation solution (400 mM NaOH, 10 mM EDTA) and incubated at room temperature for 10 minutes. After denaturation of the DNA, 1 ml of preheated hybridization buffer, 3.times.SSC, 0.1% SDS, (1.times.SSC: 15 mM Na-citrate and 150 mM NaCl) was added. The hybridization was performed at 50.degree. C. in a shaking waterbath for 1 h. The strips were washed once with hybridization buffer at 50.degree. C. for 30 minutes. The strips were then washed by rinse solution (phosphate buffer containing NaCl, Triton and 0.5% NaN.sub.3). Alkaline phosphatase labelled streptavidin was added in conjugate diluent (phosphate buffer containing NaCl, Triton, protein stabilizers and 0.1% NaN.sub.3) and incubated at 37.degree. C. for 1 h. Strips were washed again three times with rinse solution and once with substrate buffer (Tris buffer containing NaCl and MgCl.sub.2). Colour development was achieved by addition of BCIP and NBT in substrate buffer and incubation for 30 minutes at room temperature. Colour development was stopped by incubation in water and drying of the strips. Reverse hybridization results were interpreted visually.

[0224] Results and Discussion

[0225] In order to develop a novel HPV typing assay, we selected probes from a small part of the L1 region. This approach would first require detection of HPV sequences in general by PCR using universal primers, such as SGP1/SGP2, generating a fragment of 62 bp or MY11/MY09, generating a fragment of approximately 450 bp. Subsequently, the same PCR product can be analysed using type-specific probes from this L1 region. PCR fragments of 62 bp and 450 bp were generated by primer sets SGP1-bio/SGP2-bio and SGP1-bio/MY09-bio, respectively from different target DNA.

[0226] First, plasmids containing complete genomic sequences from the HPV types 6, 11, 16, 18, 31, 33 and 45 were subjected to PCR with primerset SGP1-bio/SGP2-bio. Subsequently, the amplimers were analysed in the reverse hybridization assay containing type-specific probes for recognition of the HPV types 6, 11, 16, 18, 31, 33 and 45. Representative results of reverse hybridization are shown in FIG. 7. Secondly, amplimers synthesized by the primerset SGP1-bio/MY09-bio from HPV types 6, 16, 31, 33 and 45 were analysed in the reverse hybridization assay (FIG. 8).

[0227] The results show that the method has a high sensitivity and allows detection of HPV sequences at very low concentrations or from difficult clinical materials, such as formalin-fixed, paraffin-embedded biopsies. The reverse hybridization method permits positive identification of the main HPV genotypes 6, 11, 16, 18, 31, 33 and 45. This assay can easily be extended by adding probes on the strip for recognition of all other genital HPV genotypes.

Example 5

Sequencing of HPV Isolates

[0228] Introduction

[0229] In this study, the sequence of HPV isolates in the region between primers SGP1 and SGP2 was analyzed.

[0230] Materials and Methods

[0231] DNA was isolated from formalin-fixed and paraffin-embedded cervical cancer biopsies and cytologically abnormal scrapes according to standard protocols. PCR was is performed as described in example 1 by the use of primers SGP1 and SGP2. The obtained amplimers were analyzed by direct sequencing.

[0232] Results

[0233] Sequencing of HPV-positive samples revealed that, within the region between primers SGP1 and SGP2, 19 sequences from different patients were aberrant from previously described full-length HPV types. These previously unknown sequences are listed in FIG. 1. Sequences having an identification number starting with 95, were found in cervical cancer biopsies, whereas those starting with 97 were found in cytologically abnormal scrapes.

[0234] Discussion

[0235] Any of the 19 sequences disclosed in this study may be representative for a new HPV type. Further investigation will be carried out to determine whether indeed any of these sequences is characteristic of a new HPV type that is possibly clinically important. Probes that specifically hybridize to these sequences can be used to detect and/or to identify the corresponding HPV types according to the methods of the present invention.

Example 6

Broad-Spectrum Detection of HPV by Amplification of a Short PCR Fragment Using a Mixture of 10 HPV Primers

[0236] Introduction

[0237] The examples 1 and 2 describe the selection and optimization of a novel HPV PCR primerset. The selected primers from example 2, SGP1A, SGP1B, SGP2B-bio and SGP2D-bio, could be used for efficient HPV amplification. Additional broad spectrum primers were developed for a more sensitive HPV DNA PCR assay. The current example describes the use of a mixture of 10 primers for highly sensitive detection of human papillomaviruses.

[0238] Materials and Methods

[0239] From alignments of HPV L1 sequences as shown in FIG. 1, forward and reverse primers were selected for sensitive amplification of HPVs, see table 11. The primers were tested on plasmids containing HPV genotypes 6, 13, 16, 18, 26, 34, 35, 39, 40, 42, 43, 51, 52, 53, 54, 55, 68, 69, 70, 74. These HPV plasmids were provided by Dr. E-M. de Villiers, Heidelberg, Germany (HPV genotypes 6, 13, 16, 18, 40, 51 and 53), Dr. R. Ostrow, Minneapolis, Minn. (HPV genotype 26), Dr. A. Lorincz, Silver Springs, MD (HPV genotypes 35 and 43), Dr. T. Matsukura, Tokyo, Japan (HPV genotype 69), and Dr. G. Orth, Paris, France (HPV genotypes 34, 39, 42, 52, 54, 55, 68, 70 and 74).

[0240] HPV DNA amplification was performed in a final reaction volume of 50 .mu.l, containing 10 .mu.l of small amounts of plasmid DNA, 10 mM Tris-HCl pH 9.0, 50 MM KCl, 2.5 mM MgCl.sub.2, 0.1% Triton X-100, 0.01% gelatin, 200 mM of each deoxynucleoside triphosphate, 15 pmol of each forward (SGP1A-1D) and 15 pmol of different reverse primers, and 1.5 U of AmpliTaq gold (Perkin Elmer, Branchburg, N.J., USA). The PCR conditions were as follows: preheating for 9 min 94.degree. C. was followed by 40 cycles of 30 seconds 94.degree. C., 45 seconds, at 50.degree. C. or 52.degree. C. or 55.degree. C. and 45 seconds at 72.degree. C., and a final extension of 5 min at 72.degree. C. PCR-products were analyzed on a 3% TBE agarose gel.

[0241] Results

[0242] Developed were 14 broad spectrum primers, 4 sense (SGP1A, SGP1B, SGP1C, SGP1D) and 10 antisense (SGP2B-bio, SGP2D-bio, SGP2H-bio, SGP2I-bio, SGP2J-bio, SGP2K-bio, SGP2L-bio, SGP2M-bio, SGP2N-bio, SGP2P-bio), respectively. See table 11 for sequences and positions. For selection of sensitive PCR primers, plasmid DNA from HPV genotypes 6, 13, 16, 18, 26, 34, 35, 39, 40, 42, 43, 51, 52, 53, 54, 55, 68, 69, 70 and 74 were used as target. PCR experiments were performed with the 4 sense primers (SGP1A, SGP1B, SGP1C, SGP1D) in combination with one or more reverse primers at different annealing temperatures, using low amounts of HPV plasmid DNA. The reverse primers SGP2H-bio, SGP2I-bio, SGP2L-bio and SGP2N-bio appeared to have no added value compared to a mixture of the remaining 6 reverse primers (SGP2B-bio, SGP2D-bio, SGP2J-bio, SGP2K-bio, SGP2M-bio and SGP2P-bio) as listed in table 11. Although the sequences of the 10 primers, 4 sense (SGP1A-1D) and 6 antisense (SGP2B-bio, SGP2D-bio, SGP2J-bio, SGP2K-bio, SGP2M-bio and SGP2P-bio) showed minor mismatches compared to known HPV genotypes (FIG. 1), still low amounts of HPV DNA could efficiently be amplified.

[0243] Discussion

[0244] A mixture of 10 primers was developed for broad-spectrum detection of HPV. Despite minor mismatches between primer and target sequences of known HPVs, the 10 selected primers were succesfull to detect various HPV genotypes at low levels. Therefore, this mixture of 10 primers can be used for sensitive broad-spectrum detection of HPV.

Example 7

A Line Probe Assay for Rapid Detection and Simultaneous Identification of 25 Different HPV Genotypes

[0245] Introduction

[0246] Example 4 describes the development of the HPV INNO-LiPA genotyping assay for simple detection and identification of HPV genotypes. This example describes an HPV INNO-LiPA genotyping assay for simultaneous detection and identification of 25 types. After universal HPV amplification, synthesized amplimers can be detected and identified by hybridization to type-specific probes that are applied on a LiPA strip.

[0247] Materials and Methods

[0248] Based on the inner primer sequence of 22 bp which is located between the regions B and C (FIG. 9), several type-specific probes were proposed and tested for specificity reasons. The selected probes are listed in tables 7 and 12. Plasmids containing HPV sequences of different genotypes were used as target for broad-spectrum amplification (see examples 4 and 6). LiPA experiments were performed as described in example 4 using the Auto-LiPA system.

[0249] Results

[0250] Amplimers obtained from well defined plasmids containing HPV sequences of various genotypes were used in LiPA experiments in order to determine the specificity of the selected probes (tables 7 and 12). Subsequently, 25 HPV type-specific probes and another 3 probes were selected for simultaneous identification of 25 different HPV genotypes. The outline of the HPV-LiPA is shown in FIG. 10 and typical LiPA patterns are shown in FIG. 11.

[0251] In most cases the probe name is directly linked to the HPV type (e.g. a purple color on probe lane 16 means hybridization of an amplimer derived from HPV type 16). The probes c31, c56 and c68 are secundairy probes. These probes are of interest when there is a positive hybridization with the probe line just above (31/40/58 or 56/74 or 68/45). These `c` probes were developed for exclusion of type 40, 58, 74, and 45. Those types are also identified by positive hybridization. The `c` probes c31, c56 and c68 will also react with other types. Amplimers from type 33 and 54 will give a positive reaction with probe c31. Similarly, the amplimer from type 58 hybridizes with c56. Therefore, amplimers of type 58 will give three bands on a LiPA strip (positive on: 31/40/58 and c56 and 58). Probe c68 is also reactive with amplimers from type 18 and 39. HPV type 6 is identified by hybridization to the probes 6. HPV type 74 is identified by the probes 56/74 and 74. A sample contains type 54 when probe c31 is positive while probes 31/40/58, 33, 40, and 58 are negative.

[0252] Discussion

[0253] The described HPV LiPA genotyping assay detects and identifies simultaneously the HPV genotypes 6, 11, 16, 18, 31, 33, 34, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 66, 68, 70, and 74. These genotypes can be recognized after universal PCR using the novel developed primerset as described in this patent and the MY11/09 primerset which is discussed in example 4. This typing assay can still be extended with type-specific probes for recognition of other HPV genotypes.

[0254] In summary, the novel PCR system for highly sensitive detection of HPV DNA in diverse clinical materials followed by a HPV LiPA typing experiment could be a usefull tool to improve the molecular diagnosis and epidemiology of HPV infections.

REFERENCES

[0255] Baay, M. F. D., W. G. V. Quint, J. Koudstaal, H. Hollema, J. M. Duk, M. P. M. Burger, E. Stolz, and P. Herbrink. 1995. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas. 34:745-747.

[0256] Claas, E. C. J., W. J. G. Melchers, H. C. van der Linden, J. Lindeman, and W. G. V. Quint. 1989. Human papillomavirus detection in parafinn embedded cervical carcinomas and metastases of the carcinomas by the polymerase chain reaction. Am. J. Pathol. 135:703-709.

[0257] Cornelissen, M. T. E., J. G. van den Tweel, A. P. H. B. Struyk, M. F. Jebbink, M. Brit, J. van der Noordaa, and J. ter schegget 1989. Localization of human pappilomavirus type 16 DNA using the polymerase chain reaction in the cervix uteri of women with cervical intraepithelial neoplasia J. Gen. Virol. 70:2555-2562.

[0258] Cox, J. Th., A. T. Lorincz, M. H. Schiffman, M. E. Sherman, A. Cullen, and R. J. Kurman. Human papillomavirus testing by hybrid capture appears to be useful in triaging women with a cytological diagnosis of a typical squamous cells of undetermined significance.

[0259] de Villiers, E. -M. 1989. Heterogeneity in the human papillomavirus group. J. Virology 63:4898-4903.

[0260] de Villiers, E. -M. 1994. Human pathogenic papillomavirus types: an update. Curr. Top; Microbiol. 186: 1-12.

[0261] Evander, M., and G. Wadell. 1991. A general primer pair for amplification and detection of genital human papillomavirus types. J. Virol. Methods 31:239-250.

[0262] Falcinelli, C., E. Claas, B. Kleter, and W. G. V. Quint. 1992. Detection of the human papillomavirus type 16 mRNA-transcripts in cytological abnormal scrappings. J. Med. Virol. 37:93-98.

[0263] Garson, J. A., C. J. A. Ring, and P. W. Tuke. 1991. Improvement of HCV genome detection with "short" PCR products. Lancet 338:1466-1467.

[0264] Manos, M. M., Y. Ting, D. K. Wright, A. J. Lewis, T. R. Broker, and S. M. Wolinsky. 1989. The use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7:209-214.

[0265] Newton, C. R., A. Graham, L. E. Heptinstall, S. J. Powell, C. Summers, N. Kalsheker, J. C. Smith, and A. F. Markham. 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Research 17:2503-2516.

[0266] Ohara, Y., M. Honma, and Y. Iwasaki. 1992. Sensitivity of the polymerase chain reaction for detecting human T-cell leukemia virus type I sequences in paraffin-embedded tissue: Effect of unbuffered formalin fixation. J. Virol. Methods 37:83-88.

[0267] Remmink, A. J., J. M. M. Walboomers, T. J. M. Helmerhorst, F. J. Voorhorst, L. Roozendaal, E. K. J. Risse, C. J. L. M. Meijer, and P. Kenemans. 1995. The presence of persistence high-risk HPV genotypes in dysplastic cervical lesions is associated with progressive disease: Natural history up to 36 months. Int. J. Cancer 61:1-6.

[0268] Saiki, R. K., D. H. Gelfland, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.

[0269] Saiki, R. K., T. L. Bugawan, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1986. Analysis of enzymatically amplified b-globin and HLA-DQ-alfa DNA with allele-specific oligonucleotide probes. Nature 324:163-166.

[0270] Sambrook et al. 1989 Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbour Laboratory Press

[0271] Sommer, R., and D. Tautz. 1989. Minimal homology requirements for PCR primers. Nucleic Acids Research 17:6749.

[0272] Stuyver, L., R. Rossau, A. Wyseur, M. Duhamel, B. Vanderborght, H. Van Heuverswyn, and G. Maertens. 1993. Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. J. Gen. Virol. 74:1093-1102.

[0273] Tieben L. M., J. ter Schegget, R. P. Minnaar, J. N. Bouwes Bavinck, R. J. M. Berkhout, B. J. Vermeer, M. f. Jebbink, and H. L. Smits. 1993. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers. J. Virol. Methods 42:265-280.

[0274] Van den Brule, A. J. C., P. J. F. Snijders, R. L. J. Gordijn, O. P. Bleker, C. J. L. M. Meijer, and J. M. M. Walboomers. 1990. General primer-mediated polymerase chain reaction permits the detection of sequenced and still unsequenced human papillomavirus genotypes in cervical scrapes and carcinomas. Int. J. Cancer 45:644-649.

[0275] Young, L. S., I. S. Bevan, M. A. Johnson, P. I. Blomfield, T. Bromidge, N. J. Maitland, and G. B. J. Woodman. 1989. The polymerase chain reaction: A new epidemiological tool for investigatiing cervical human papillomavirus infection. Brit Med. J. 298:14-18.

[0276] Woodworth, C. D., Waggoner, S., Barnes, W., Stoler, M. H., Di Paolo, J. A. 1990. Human cervical and foreskin eptithelial cells immortalized by human papillomavirus DNAs exhibit displastic differentiation in vivo. Cancer Res. 50: 3709-3715.

Sequence CWU 1

1

497 1 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 1 tattcaataa accttattgg 20 2 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 2 tdtttaataa rccwtattgg 20 3 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 3 tatttaataa accatattgg 20 4 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 4 tatttaataa gccatattgg 20 5 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 5 gcacagggcc acaataatgg 20 6 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 6 gcmcaggghc ataayaatgg 20 7 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 7 gtatcaacaa cagtaacaaa 20 8 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 8 gtatctacca cagtaacaaa 20 9 20 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 9 gtatchacha cagtaacaaa 20 10 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 10 tatttaataa gccttattgg 20 11 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 11 tattcaataa accttattgg 20 12 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 12 tatttaataa accttactgg 20 13 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 13 tatttaataa nccntattgg 20 14 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 14 tatttaataa nccntactgg 20 15 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 15 gcncagggnc acaataatgg 20 16 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 16 gcncagggnc ataacaatgg 20 17 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 17 gcncagggnc ataataatgg 20 18 20 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 18 gcncaaggnc ataataatgg 20 19 23 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 19 gtngtatcna caacagtaac aaa 23 20 23 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 20 gtngtatcta ccacagtaac aaa 23 21 23 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 21 gtngtatcna ctacagtaac aaa 23 22 23 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 22 gtngtatcna cgacagtnac aaa 23 23 23 DNA Artificial Sequence Synthetic Primer for the Human Papillomavirus (HPV) 23 gtngtatcna caacagtnan aaa 23 24 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 24 ttggggtaat caactgtgg 19 25 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 25 gttggggtaa tcaactgtgg 20 26 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 26 ttggggtaat caactgttg 19 27 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 27 gttggggtaa tcaactgttg 20 28 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 28 ttggggtaat caactgttt 19 29 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 29 tgctggggaa accactg 17 30 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 30 tgctggggaa accacttagg 20 31 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 31 ttgttgggga aaccactg 18 32 21 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 32 ttgctgggga aaccacttag g 21 33 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 33 tgctggggaa accacttggg 20 34 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 34 ttggggtaac caactatgg 19 35 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 35 gttggggtaa ccaactatgg 20 36 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 36 ttggggtaac caactattg 19 37 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 37 gttggggtaa ccaactattg 20 38 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 38 ttggggtaac caactattt 19 39 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 39 gtgtttgctg gcataat 17 40 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 40 ggtgtttgct ggcataag 18 41 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 41 gtgtttgctg gcataatc 18 42 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 42 tggtgtttgc tggcataag 19 43 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 43 ggtgtttgct ggcataat 18 44 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 44 ttggggcaat cagttatgg 19 45 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 45 gttggggcaa tcagttatgg 20 46 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 46 ttggggcaat cagttattg 19 47 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 47 gttggggcaa tcagttattg 20 48 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 48 gttggggcaa tcagttattt 20 49 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 49 gggcaatcag ttattg 16 50 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 50 aataactgat tgccc 15 51 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 51 ggcaatcagt tatttcc 17 52 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 52 aaataactga ttgcc 15 53 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 53 gcaatcagtt atttgg 16 54 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 54 caaataactg attgc 15 55 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 55 ggcaatcagt tatttgg 17 56 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 56 gcaatcagtt atttgtg 17 57 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 57 ttggggcaat caggtatgg 19 58 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 58 gttggggcaa tcaggtatgg 20 59 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 59 ttggggcaat caggtattg 19 60 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 60 gttggggcaa tcaggtattg 20 61 20 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 61 gttggggcaa tcaggtattt 20 62 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 62 gggcaatcag gtattg 16 63 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 63 aatacctgat tgccc 15 64 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 64 ggcaatcagg tatttcc 17 65 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 65 aaatacctga ttgcc 15 66 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 66 gcaatcaggt atttgg 16 67 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 67 caaatacctg attgc 15 68 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 68 catatgtttt ggcaatc 17 69 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 69 gtatttgttg gcataat 17 70 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 70 ggtatttgtt ggcataag 18 71 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 71 gtatttgttg gcataatc 18 72 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 72 tggtatttgt tggcataag 19 73 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 73 ggtatttgtt ggcataat 18 74 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 74 tggcataatc agttggg 17 75 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 75 ggcataatca gttgtg 16 76 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 76 gcataatcag ttgttt 16 77 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 77 gcaatcagtt gtttgc 16 78 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 78 caatcagttg tttgtc 16 79 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 79 atggcatatg ttggg 15 80 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 80 tggcatatgt tggggg 16 81 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 81 ggcatatgtt ggggc 15 82 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 82 gcatatgttg gggca 15 83 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 83 ggggtaatca attatc 16 84 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 84 ggggtaatca attattc 17 85 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 85 ggggtaatca attattt 17 86 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 86 tggggtaatc aattattt 18 87 19 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 87 ggggtaatca attatttgg 19 88 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 88 catttgctgg ggcaag 16 89 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 89 atttgctggg gcaat 15 90 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 90 tttgctgggg caatc 15 91 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 91 ttgctggggc aatca 15 92 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 92 gttggagtaa ccaattg 17 93 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 93 gtatatgttg gcataat 17 94 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 94 gcatttgctg gaacaat 17 95 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 95 ggggcaatca ggtgttt 17 96 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 96 ggtatatgtt ggcacaa 17 97 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 97 gcatatgctg gggta 15 98 23 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 98 gtngtatcna caactgtaac aaa 23 99 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 99 catttgttgg cataacc 17 100 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 100 tggggcaatc acttg 15 101 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 101 gcatttgctg gcata 15 102 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 102 tggggaaatc agctatt 17 103 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 103 ggcatttgtt ttgggaa 17 104 18 DNA Artificial Sequence Type specific probe derived from the Human

Papillomavirus (HPV) 104 ttggggaaat cagttatt 18 105 16 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 105 gcatctgttg gaacaa 16 106 15 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 106 gttgggggaa tcagt 15 107 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 107 gttggggcaa ccaattg 17 108 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 108 tggtttaatg aattgttt 18 109 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 109 ggtttaatga actgttt 17 110 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 110 aatggaattt gttggca 17 111 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 111 gtatatgctg gggtaat 17 112 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 112 atttgttggg gtaatca 17 113 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 113 tgctggaata atcagct 17 114 18 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 114 tggtttaatg agttattt 18 115 17 DNA Artificial Sequence Type specific probe derived from the Human Papillomavirus (HPV) 115 atatgctggt ttaatca 17 116 18 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 116 aataatggca tntgttgg 18 117 18 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 117 aataatggta tntgttgg 18 118 18 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 118 aacaatggta tntgttgg 18 119 18 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 119 aacaatggta tntgctgg 18 120 18 DNA Artificial Sequence General Probe for Human Papillomavirus (HPV) detectio 120 aacaatggtg tttgctgg 18 121 18 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 121 aataatggca tntgctgg 18 122 18 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 122 aacaatggca tntgctgg 18 123 21 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 123 canaataatg gtatntgttg g 21 124 20 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 124 anaataatgg tatntgttgg 20 125 21 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 125 canaataatg gtatttgttg g 21 126 20 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 126 anaataatgg tatttgttgg 20 127 21 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 127 cacaataatg gtatttgttg g 21 128 20 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 128 acaataatgg tatttgttgg 20 129 21 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 129 canaacaatg gtatntgttg g 21 130 20 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 130 anaacaatgg tatntgttgg 20 131 21 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 131 canaacaatg gtatttgttg g 21 132 20 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 132 anaacaatgg tatttgttgg 20 133 21 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 133 cataacaatg gtatttgttg g 21 134 20 DNA Artificial Sequence General probe derived from the Human Papillomavirus (HPV) 134 ataacaatgg tatttgttgg 20 135 20 DNA Human Papillomavirus 135 catatgctgg aataatcaac 20 136 20 DNA Human Papillomavirus 136 catatgctgg aataatcttc 20 137 22 DNA Human Papillomavirus 137 tatctgctgg ggtaatcagc tt 22 138 21 DNA Human Papillomavirus 138 atctgctggc ayaatcaatt a 21 139 20 DNA Human Papillomavirus 139 tctgctggca taatcaatta 20 140 22 DNA Human Papillomavirus 140 tatatgttgg cataatcaat ta 22 141 22 DNA Human Papillomavirus 141 aatttgttgg cataatcaat tg 22 142 20 DNA Human Papillomavirus 142 tttgttgggg taatcaattg 20 143 20 DNA Human Papillomavirus 143 tttgctggtt taatcaattg 20 144 20 DNA Human Papillomavirus 144 tatgttggtt taatgagctg 20 145 20 DNA Human Papillomavirus 145 tttgttggtt taatgagttg 20 146 20 DNA Human Papillomavirus 146 tttgttggtt taatgagtta 20 147 21 DNA Human Papillomavirus 147 atttgttggt ttaatgagat g 21 148 20 DNA Human Papillomavirus 148 tttgttggtt taatgaaatg 20 149 20 DNA Human Papillomavirus 149 tatgttggtt taatgagctg 20 150 20 DNA Human Papillomavirus 150 tytgttggtt taatgacctg 20 151 22 DNA Human Papillomavirus 151 tatttgttgg tttaatgacc tg 22 152 20 DNA Human Papillomavirus 152 tttgttggtt taatgaaatg 20 153 21 DNA Human Papillomavirus 153 atctgttttg gyaaccaggt g 21 154 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 154 gtngtatcca caacagttac aaa 23 155 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 155 gtggtatcca caacngtgac aaa 23 156 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 156 gtagtntcca caacagtaag aaa 23 157 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 157 gtagtatcaa ccacagttaa aaa 23 158 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 158 gtngtatcta caacngttaa aaa 23 159 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 159 gtagtatcta cacaagtaac aaa 23 160 23 DNA Artificial Sequence Synthetic Primer derived from the Human Papillomavirus (HPV) 160 gtagtatcaa cacaggtaat aaa 23 161 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 161 ggtatctgct ggcataag 18 162 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 162 tggtatctgc tggcata 17 163 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 163 tatttgttgg ggcaatc 17 164 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 164 atttgttggg gcaatc 16 165 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 165 tatttgttgg ggcaat 16 166 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 166 ggcatttgct ggcata 16 167 19 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 167 gttggagtaa ccaattggg 19 168 19 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 168 tgttggagta accaattcc 19 169 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 169 ttgttggagt aaccaatg 18 170 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 170 ggtatatgtt ggcataat 18 171 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 171 ggggaaatca gctattg 17 172 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 172 gggaaatcag ctattt 16 173 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 173 ggcatttgtt ttgggaag 18 174 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 174 gcatttgttt tgggaat 17 175 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 175 catttgtttt gggaatc 17 176 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 176 ggggaaatca gttattg 17 177 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 177 ggggaaatca gttattt 17 178 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 178 gggaaatcag ttattt 16 179 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 179 tggggaaatc agttatg 17 180 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 180 catttgctgg aacaatc 17 181 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 181 ggcatctgtt ggaacaa 17 182 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 182 ggcaatcagg tgtttc 16 183 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 183 gggcaatcag gtgtttc 17 184 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 184 aaacacctga ttgccc 16 185 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 185 ggcaatcagg tgttttg 17 186 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 186 gggggaatca gttattg 17 187 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 187 gggggaatca gttatg 16 188 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 188 tgggggaatc agttatg 17 189 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 189 tgggggaatc agttag 16 190 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 190 catttgctgg ggtaat 16 191 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 191 tggtatatgt tggcacaa 18 192 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 192 ggtatatgtt ggcacaat 18 193 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 193 gtatatgttg gcacaatc 18 194 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 194 tatatgttgg cacaatc 17 195 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 195 ggcatatgct ggggta 16 196 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 196 ggtatatgct ggggtaat 18 197 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 197 ggtatatgct ggggta 16 198 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 198 tggtatatgc tggggt 16 199 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 199 atggtatatg ctggggg 17 200 15 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 200 ggtatatgct ggggt 15 201 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 201 tggtatatgc tggggg 16 202 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 202 aatggtatat gctggg 16 203 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 203 tggtatttgt tggcata 17 204 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 204 atggtatttg ttggcata 18 205 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 205 atggtatttg ttggcat 17 206 19 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 206 ttggcataat caattattt 19 207 21 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 207 ttggcataat caattatttc g 21 208 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 208 gcatttgttg gcataacc 18 209 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 209 gcatttgttg gcataac 17 210 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 210 catttgttgg cataac 16 211 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 211 tatttgttgg ggtaat 16 212 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 212 atttgttggg gtaatc

16 213 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 213 tttgttgggg taatca 16 214 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 214 gtatttgttg gggtaat 17 215 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 215 tatttgttgg ggtaatc 17 216 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 216 ttgctggaat aatcagct 18 217 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 217 tgctggaata atcagc 16 218 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 218 tgctggaata atcagctg 18 219 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 219 tgctggaata atcagcg 17 220 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 220 canaataatg gcatntgttg gc 22 221 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 221 canaacaatg gcatntgttg gc 22 222 23 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 222 cacaataatg gcatttgttg ggg 23 223 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 223 canaataatg gtatntgttg gg 22 224 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 224 canaacaatg gtatntgttg gc 22 225 30 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 225 aatggcattt gttggggtaa ccaactattt 30 226 21 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 226 ttgttggggt aaccaactat g 21 227 24 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 227 atttgttggg gtaaccaact attg 24 228 23 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 228 gcatttgttg gggtaaccaa cta 23 229 25 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 229 tggcatttgt tggggtaacc aacta 25 230 30 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 230 aatggtattt gttggggcaa tcagttattt 30 231 30 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 231 aatggtattt gttggcataa tcagttgttt 30 232 30 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 232 aatggtattt gttggtttaa tgaattgttt 30 233 30 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 233 aatggcattt gctggaacaa tcagcttttt 30 234 30 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 234 aatggtatat gttggggcaa tcacttgttt 30 235 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 235 aatggcattt gttggggc 18 236 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 236 aatggcatat gctggaataa tc 22 237 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 237 aatggtatat gttggggcaa tc 22 238 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 238 aatggtattt gttggggc 18 239 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 239 aatggaattt gttggcataa tc 22 240 18 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 240 ggtatctgct ggcataat 18 241 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 241 aatggcattt gttggtttaa tg 22 242 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 242 aatggtattt gttggtttaa tg 22 243 22 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 243 aatggcatct gttggtttaa tg 22 244 20 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 244 tgttggttta atgagctgtg 20 245 21 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 245 tgctggttta atcaattgtt g 21 246 16 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 246 cagggacaca acaatg 16 247 17 DNA Artificial Sequence Synthetic Probe derived from the Human Papillomavirus (HPV) 247 cagggtcata acaatgg 17 248 65 DNA Human Papillomavirus 248 gcccagggac ataacaatgg tatttgttgg ggtaatcaac tgtttgttac tgtggtagat 60 accac 65 249 94 DNA Human Papillomavirus 249 tatttaataa accatattgg cttcaaaagg ctcagggaca taacaatggt atttgctggg 60 gaaaccactt gtttgttact gtggtagata ccac 94 250 65 DNA Human Papillomavirus 250 gctcagggac ataacaatgg tatttgctgg ggaaaccact tgtttgttac tgtggtagat 60 accac 65 251 65 DNA Human Papillomavirus 251 gcccagggac acaataatgg tatatgttgg ggcaatcact tgtttgttac tgtagttgat 60 actac 65 252 94 DNA Human Papillomavirus 252 tgtttaataa accatattgg ttacataagg cacagggtca taacaatggt gtttgctggc 60 ataatcaatt atttgttact gtggtagata ccac 94 253 65 DNA Human Papillomavirus 253 gcacagggtc ataacaatgg tgtttgctgg cataatcaat tatttgttac tgtggtagat 60 accac 65 254 65 DNA Human Papillomavirus 254 gcacagggtc ataataatgg tatctgttgg ggcaatcaat tgtttgttac ctgtgttgat 60 accac 65 255 65 DNA Human Papillomavirus 255 gcacagggac acaataatgg catttgttgg ggcaaccagg tatttgttac tgttgtggac 60 accac 65 256 94 DNA Human Papillomavirus 256 tttttaataa accatattgg atgcaacgtg ctcagggaca caataatggt atttgttggg 60 gcaatcagtt atttgttact gtggtagata ccac 94 257 65 DNA Human Papillomavirus 257 gctcagggac acaataatgg tatttgttgg ggcaatcagt tatttgttac tgtggtagat 60 accac 65 258 94 DNA Human Papillomavirus 258 tatttaataa gccatattgg ctacaacgtg cacaaggtca taataatggt atttgttggg 60 gcaatcaggt atttgttact gtggtagata ccac 94 259 65 DNA Human Papillomavirus 259 gcacaaggtc ataataatgg tatttgttgg ggcaatcagg tatttgttac tgtggtagat 60 accac 65 260 94 DNA Human Papillomavirus 260 tttttaataa gccttattgg ttgcaaaagg cccagggaca aaacaatggc atttgctggc 60 ataatcaact gtttttaact gttgtagata ctac 94 261 65 DNA Human Papillomavirus 261 gcccagggac aaaacaatgg catttgctgg cataatcaac tgtttttaac tgttgtagat 60 actac 65 262 94 DNA Human Papillomavirus 262 tatttaataa accatattgg ttgcaacgtg cacaaggcca taataatggt atttgttgga 60 gtaaccaatt gtttgttact gtagttgata caac 94 263 65 DNA Human Papillomavirus 263 gcacaaggcc ataataatgg tatttgttgg agtaaccaat tgtttgttac tgtagttgat 60 acaac 65 264 94 DNA Human Papillomavirus 264 tatttaataa gccttattgg ctacataagg cccagggcca caacaatggt atatgttggc 60 ataatcaatt atttcttact gttgtggaca ctac 94 265 65 DNA Human Papillomavirus 265 gcccagggcc acaacaatgg tatatgttgg cataatcaat tatttcttac tgttgtggac 60 accac 65 266 94 DNA Human Papillomavirus 266 tatttaacaa gccattgtgg atacaaaagg cccagggcca taacaatggc atatgttttg 60 gcaatcagtt atttgttaca gttgtagaca ccac 94 267 65 DNA Human Papillomavirus 267 gcccagggcc ataacaatgg catatgtttt ggcaatcagt tatttgttac agttgtagac 60 accac 65 268 94 DNA Human Papillomavirus 268 tatttaataa accatattgg ttacaacaag cacaaggaca caataatggt atatgttggg 60 gaaatcagct atttttaact gtggttgata ctac 94 269 65 DNA Human Papillomavirus 269 gcacaaggac acaataatgg tatatgttgg ggaaatcagc tatttttaac tgtggttgat 60 actac 65 270 59 DNA Human Papillomavirus 270 ggacataata atggcatttg ttttgggaat cagttgtttg ttacagtggt agataccac 59 271 59 DNA Human Papillomavirus 271 ggacataata atggcatttg ttttgggaat cagttgtttg ttacagtggt agataccac 59 272 65 DNA Human Papillomavirus 272 gcgcagggcc acaataatgg tatttgttgg ggaaatcagt tatttgttac tgttgtagat 60 actac 65 273 65 DNA Human Papillomavirus 273 gcgcagggcc acaataatgg tatttgttgg ggaaatcagt tatttgttac tgttgtagat 60 actac 65 274 94 DNA Human Papillomavirus 274 tatttaataa gccatattgg ttacataagg cccagggcca taacaatggt atttgttggc 60 ataatcagtt gtttgttact gtagtggaca ctac 94 275 65 DNA Human Papillomavirus 275 gcccagggcc ataacaatgg tatttgttgg cataatcagt tgtttgttac tgtagtggac 60 actac 65 276 94 DNA Human Papillomavirus 276 tttttaataa gccttattgg ctccaccgtg cgcagggtca caataatggc atttgctgga 60 acaatcagct ttttattacc tgtgttgata ctac 94 277 65 DNA Human Papillomavirus 277 gcgcagggtc acaataatgg catttgctgg aacaatcagc tttttattac ctgtgttgat 60 actac 65 278 94 DNA Human Papillomavirus 278 tatttaataa accgtactgg ttacaacgtg cgcagggcca caataatggc atatgttggg 60 gcaatcagtt gtttgtcaca gttgtggata ccac 94 279 65 DNA Human Papillomavirus 279 gcgcagggcc acaataatgg catatgttgg ggcaatcagt tgtttgtcac agttgtggat 60 accac 65 280 94 DNA Human Papillomavirus 280 tgtttaataa gccatattgg ctgcaacgtg cccagggaca taataatggc atctgttgga 60 acaatcagtt atttgtaact gttgtggata ccac 94 281 65 DNA Human Papillomavirus 281 gcccagggac ataataatgg catctgttgg aacaatcagt tatttgtaac tgttgtggat 60 accac 65 282 94 DNA Human Papillomavirus 282 tatttaataa gccatactgg ttacaacggg cccagggtca aaacaatggt atttgttggg 60 gcaatcaggt gtttttaaca gttgtagata ccac 94 283 65 DNA Human Papillomavirus 283 gcccagggtc aaaacaatgg tatttgttgg ggcaatcagg tgtttttaac agttgtagat 60 accac 65 284 65 DNA Human Papillomavirus 284 gcgcagggcc acaataatgg tatttgttgg gggaatcagt tatttgttac tgttgtagat 60 actac 65 285 65 DNA Human Papillomavirus 285 gcgcagggcc acaataatgg tatttgttgg gggaatcagt tatttgttac tgttgtagat 60 actac 65 286 94 DNA Human Papillomavirus 286 tatttaataa accttattgg ttgcaacgtg cccaaggcca taataatggc atttgctggg 60 gtaatcaatt atttgttact gtagtagata ctac 94 287 65 DNA Human Papillomavirus 287 gcccaaggcc ataataatgg catttgctgg ggtaatcaat tatttgttac tgtagtagat 60 actac 65 288 94 DNA Human Papillomavirus 288 tatttaataa gccttattgg ctacagcgtg cacaaggtca taacaatggc atttgctggg 60 gcaatcagtt atttgttacc gtggttgata ccac 94 289 65 DNA Human Papillomavirus 289 gcacaaggtc ataacaatgg catttgctgg ggcaatcagt tatttgttac cgtggttgat 60 accac 65 290 94 DNA Human Papillomavirus 290 tatttaataa accatattgg ctgcacaagg ctcagggttt aaacaatggt atatgttggc 60 acaatcaatt gtttttaaca gttgtagata ctac 94 291 65 DNA Human Papillomavirus 291 gctcagggtt taaacaatgg tatatgttgg cacaatcaat tgtttttaac agttgtagat 60 actac 65 292 65 DNA Human Papillomavirus 292 gcccagggcc acaacaatgg tatttgttgg tttaatgaat tgtttgtaac cgttgtggat 60 accac 65 293 65 DNA Human Papillomavirus 293 gcccagggcc acaacaatgg tatttgttgg tttaatgaat tgtttgtaac cgttgtggat 60 accac 65 294 65 DNA Human Papillomavirus 294 gcacagggtc ataataatgg tatttgttgg tttaatgaac tgtttgttac tgtggtggat 60 actac 65 295 65 DNA Human Papillomavirus 295 gcacagggtc ataataatgg tatttgttgg tttaatgaac tgtttgttac tgtggtggat 60 actac 65 296 65 DNA Human Papillomavirus 296 gcacagggac ataacaatgg aatttgttgg cataatcaac tgtttctaac tgttgtatat 60 actac 65 297 65 DNA Human Papillomavirus 297 gcacagggac ataacaatgg aatttgttgg cataatcaac tgtttctaac tgttgtatat 60 actac 65 298 65 DNA Human Papillomavirus 298 gcacagggtc ataataatgg catatgctgg ggtaatcagg tatttgttac tgttgtggat 60 actac 65 299 65 DNA Human Papillomavirus 299 gcacagggtc ataataatgg catatgctgg ggtaatcagg tatttgttac tgttgtggat 60 actac 65 300 65 DNA Human Papillomavirus 300 gcccagggac ataacaatgg tatatgctgg ggtaatcaaa tatttgttac tgttgtagac 60 actac 65 301 65 DNA Human Papillomavirus 301 gcccagggac ataacaatgg tatatgctgg ggtaatcaaa tatttgttac tgttgtagac 60 actac 65 302 94 DNA Human Papillomavirus 302 tatttaacaa gccctattgg ctgcacaagg cacagggaca caacaatggt atttgttggc 60 ataatcaatt atttcttact gttgtggata ccac 94 303 65 DNA Human Papillomavirus 303 gcacagggac acaacaatgg tatttgttgg cataatcaat tatttcttac tgttgtggat 60 accac 65 304 65 DNA Human Papillomavirus 304 gcacagggac ataacaatgg catttgttgg ggcaaccaat tgtttgttac ttgtgtagat 60 actac 65 305 65 DNA Human Papillomavirus 305 gcacagggac ataacaatgg catttgttgg ggcaaccaat tgtttgttac ttgtgtagat 60 actac 65 306 94 DNA Human Papillomavirus 306 tgtttaataa gccatattgg ctacaaaaag cccagggaca taacaatggt atttgttggg 60 gtaatcaact gtttgttact gtggtagata ccac 94 307 65 DNA Human Papillomavirus 307 gcccagggaa ctaataatgg catttgttgg cataaccagt tgtttattac tgtggtggac 60 actac 65 308 65 DNA Human Papillomavirus 308 gcccagggtc ataataatgg catctgttgg tttaatgagc tttttgtgac agttgtagat 60 actac 65 309 65 DNA Human Papillomavirus 309 gcacagggtc ataataatgg tatttgttgg cataatcaat tatttttaac tgttgtagat 60 actac 65 310 94 DNA Human Papillomavirus 310 tgtttaataa gccgttttgg ctgcaaaggg cgcaaggcca caataatggt atttgttggg 60 gtaatcaatt atttgttaca gttgtggata ccac 94 311 65 DNA Human Papillomavirus 311 gcgcaaggcc acaataatgg tatttgttgg ggtaatcaat tatttgttac agttgtggat 60 accac 65 312 94 DNA Human Papillomavirus 312 tattcaataa accttattgg ttacaacgag cacagggcca caataatggc atttgttggg 60 gtaaccaact atttgttact gttgttgata ctac 94 313 65 DNA Human Papillomavirus 313 gcacagggcc acaataatgg catttgttgg ggtaaccaac tatttgttac tgttgttgat 60 actac

65 314 20 DNA Human Papillomavirus 314 gcmcagggwc ataayaatgg 20 315 65 DNA Human Papillomavirus 315 gcacagggac ataataatgg catttgctgg aataatcagc tttttattac ttgtgttgac 60 actac 65 316 65 DNA Human Papillomavirus 316 gcacagggac ataataatgg catttgctgg aataatcagc tttttattac ttgtgttgac 60 actac 65 317 65 DNA Human Papillomavirus 317 gcccagggac ataataatgg catttgttgg tttaatgagt tatttgttac agttgtagat 60 actac 65 318 65 DNA Human Papillomavirus 318 gcccagggac ataataatgg catttgttgg tttaatgagt tatttgttac agttgtagat 60 actac 65 319 65 DNA Human Papillomavirus 319 gcgcggggtc ataacaatgg tatatgctgg tttaatcaat tgtttgtcac ggtggtggat 60 accac 65 320 65 DNA Human Papillomavirus 320 gcgcggggtc ataacaatgg tatatgctgg tttaatcaat tgtttgtcac ggtggtggat 60 accac 65 321 20 DNA Human Papillomavirus 321 tattcaataa accttattgg 20 322 20 DNA Human Papillomavirus 322 tgtttaataa accatattgg 20 323 20 DNA Human Papillomavirus 323 tttttaataa accatattgg 20 324 20 DNA Human Papillomavirus 324 tatttaataa gccatattgg 20 325 20 DNA Human Papillomavirus 325 tatttaataa accatattgg 20 326 20 DNA Human Papillomavirus 326 tatttaataa gccttattgg 20 327 20 DNA Human Papillomavirus 327 tatttaataa gccatattgg 20 328 20 DNA Human Papillomavirus 328 tttttaataa gccttattgg 20 329 20 DNA Human Papillomavirus 329 tatttaataa accgtactgg 20 330 20 DNA Human Papillomavirus 330 tatttaataa accttattgg 20 331 20 DNA Human Papillomavirus 331 tatttaataa gccttattgg 20 332 20 DNA Human Papillomavirus 332 tgtttaataa gccatattgg 20 333 20 DNA Human Papillomavirus 333 tatttaataa accatattgg 20 334 20 DNA Human Papillomavirus 334 tttttaataa gccttattgg 20 335 20 DNA Human Papillomavirus 335 tatttaacaa gccattgtgg 20 336 20 DNA Human Papillomavirus 336 tatttaataa accatattgg 20 337 20 DNA Human Papillomavirus 337 tgtttaataa gccatattgg 20 338 20 DNA Human Papillomavirus 338 tatttaataa gccatactgg 20 339 20 DNA Human Papillomavirus 339 tatttaataa accatattgg 20 340 20 DNA Human Papillomavirus 340 tatttaacaa gccctattgg 20 341 20 DNA Human Papillomavirus 341 tgtttaataa gccgttttgg 20 342 20 DNA Human Papillomavirus 342 gcacagggcc acaataatgg 20 343 20 DNA Human Papillomavirus 343 gcacagggtc ataacaatgg 20 344 20 DNA Human Papillomavirus 344 gctcagggac acaataatgg 20 345 20 DNA Human Papillomavirus 345 gcacaaggtc ataataatgg 20 346 20 DNA Human Papillomavirus 346 gcacaaggcc ataataatgg 20 347 20 DNA Human Papillomavirus 347 gcccagggcc acaacaatgg 20 348 20 DNA Human Papillomavirus 348 gcccagggcc ataacaatgg 20 349 20 DNA Human Papillomavirus 349 gcgcagggtc acaataatgg 20 350 20 DNA Human Papillomavirus 350 gcgcagggcc acaataatgg 20 351 20 DNA Human Papillomavirus 351 gcccaaggcc ataataatgg 20 352 20 DNA Human Papillomavirus 352 gcacaaggtc ataacaatgg 20 353 20 DNA Human Papillomavirus 353 gcacagggtc ataataatgg 20 354 20 DNA Human Papillomavirus 354 gcacagggac ataacaatgg 20 355 20 DNA Human Papillomavirus 355 gcccagggac ataacaatgg 20 356 20 DNA Human Papillomavirus 356 gctcagggac ataacaatgg 20 357 20 DNA Human Papillomavirus 357 gcccagggac aaaacaatgg 20 358 20 DNA Human Papillomavirus 358 gcccagggcc ataacaatgg 20 359 20 DNA Human Papillomavirus 359 gcacaaggac acaataatgg 20 360 14 DNA Human Papillomavirus 360 ggacataata atgg 14 361 20 DNA Human Papillomavirus 361 gcgcagggcc acaataatgg 20 362 20 DNA Human Papillomavirus 362 gcccagggac ataataatgg 20 363 20 DNA Human Papillomavirus 363 gcccagggtc aaaacaatgg 20 364 20 DNA Human Papillomavirus 364 gcgcagggcc acaataatgg 20 365 20 DNA Human Papillomavirus 365 gctcagggtt taaacaatgg 20 366 20 DNA Human Papillomavirus 366 gcccagggcc acaacaatgg 20 367 20 DNA Human Papillomavirus 367 gcacagggtc ataataatgg 20 368 20 DNA Human Papillomavirus 368 gcacagggac ataacaatgg 20 369 20 DNA Human Papillomavirus 369 gcccagggac ataacaatgg 20 370 20 DNA Human Papillomavirus 370 gcacagggac acaacaatgg 20 371 20 DNA Human Papillomavirus 371 gcgcaaggcc acaataatgg 20 372 20 DNA Human Papillomavirus 372 gcacagggac ataataatgg 20 373 20 DNA Human Papillomavirus 373 gcccagggac ataataatgg 20 374 20 DNA Human Papillomavirus 374 gcgcggggtc ataacaatgg 20 375 23 DNA Human Papillomavirus 375 tttgttactg ttgttgatac tac 23 376 23 DNA Human Papillomavirus 376 tttgttactg tggtagatac cac 23 377 23 DNA Human Papillomavirus 377 tttgttactg tggtagatac cac 23 378 23 DNA Human Papillomavirus 378 tttgttactg tggtagatac cac 23 379 23 DNA Human Papillomavirus 379 tttgttactg tagttgatac aac 23 380 23 DNA Human Papillomavirus 380 tttcttactg ttgtggacac tac 23 381 23 DNA Human Papillomavirus 381 tttgttactg tagtggacac tac 23 382 23 DNA Human Papillomavirus 382 tttattacct gtgttgatac tac 23 383 23 DNA Human Papillomavirus 383 tttgtcacag ttgtggatac cac 23 384 23 DNA Human Papillomavirus 384 tttgttactg tagtagatac tac 23 385 23 DNA Human Papillomavirus 385 tttgttaccg tggttgatac cac 23 386 23 DNA Human Papillomavirus 386 tttgttactg ttgtggatac tac 23 387 23 DNA Human Papillomavirus 387 tttgttactt gtgtagatac tac 23 388 23 DNA Human Papillomavirus 388 tttgttactg tggtagatac cac 23 389 23 DNA Human Papillomavirus 389 tttgttactg tggtagatac cac 23 390 23 DNA Human Papillomavirus 390 tttttaactg ttgtagatac tac 23 391 23 DNA Human Papillomavirus 391 tttgttacag ttgtagacac cac 23 392 23 DNA Human Papillomavirus 392 tttttaactg tggttgatac tac 23 393 23 DNA Human Papillomavirus 393 tttgttacag tggtagatac cac 23 394 23 DNA Human Papillomavirus 394 tttgttactg ttgtagatac tac 23 395 23 DNA Human Papillomavirus 395 tttgtaactg ttgtggatac cac 23 396 23 DNA Human Papillomavirus 396 tttttaacag ttgtagatac cac 23 397 23 DNA Human Papillomavirus 397 tttgttactg ttgtagatac tac 23 398 23 DNA Human Papillomavirus 398 tttttaacag ttgtagatac tac 23 399 23 DNA Human Papillomavirus 399 tttgtaaccg ttgtggatac cac 23 400 23 DNA Human Papillomavirus 400 tttgttactg tggtggatac tac 23 401 23 DNA Human Papillomavirus 401 tttctaactg ttgtatatac tac 23 402 23 DNA Human Papillomavirus 402 tttgttactg ttgtagacac tac 23 403 23 DNA Human Papillomavirus 403 tttcttactg ttgtggatac cac 23 404 23 DNA Human Papillomavirus 404 tttgttacag ttgtggatac cac 23 405 23 DNA Human Papillomavirus 405 tttattactt gtgttgacac tac 23 406 23 DNA Human Papillomavirus 406 tttgttacag ttgtagatac tac 23 407 23 DNA Human Papillomavirus 407 tttgtcacgg tggtggatac cac 23 408 22 DNA Human Papillomavirus 408 catttgttgg ggtaaccaac ta 22 409 22 DNA Human Papillomavirus 409 tgtttgctgg cataatcaat ta 22 410 22 DNA Human Papillomavirus 410 tatttgttgg ggcaatcagt ta 22 411 22 DNA Human Papillomavirus 411 tatttgttgg ggcaatcagg ta 22 412 22 DNA Human Papillomavirus 412 tatttgttgg agtaaccaat tg 22 413 22 DNA Human Papillomavirus 413 tatatgttgg cataatcaat ta 22 414 22 DNA Human Papillomavirus 414 tatttgttgg cataatcagt tg 22 415 22 DNA Human Papillomavirus 415 catttgctgg aacaatcagc tt 22 416 22 DNA Human Papillomavirus 416 catatgttgg ggcaatcagt tg 22 417 22 DNA Human Papillomavirus 417 catttgctgg ggtaatcaat ta 22 418 22 DNA Human Papillomavirus 418 catttgctgg ggcaatcagt ta 22 419 22 DNA Human Papillomavirus 419 catatgctgg ggtaatcagg ta 22 420 22 DNA Human Papillomavirus 420 catttgttgg ggcaaccaat tg 22 421 22 DNA Human Papillomavirus 421 tatttgttgg ggtaatcaac tg 22 422 22 DNA Human Papillomavirus 422 tatttgctgg ggaaaccact tg 22 423 22 DNA Human Papillomavirus 423 catttgctgg cataatcaac tg 22 424 22 DNA Human Papillomavirus 424 catatgtttt ggcaatcagt ta 22 425 22 DNA Human Papillomavirus 425 tatatgttgg ggaaatcagc ta 22 426 22 DNA Human Papillomavirus 426 catttgtttt gggaatcagt tg 22 427 22 DNA Human Papillomavirus 427 tatttgttgg ggaaatcagt ta 22 428 22 DNA Human Papillomavirus 428 catctgttgg aacaatcagt ta 22 429 22 DNA Human Papillomavirus 429 tatttgttgg ggcaatcagg tg 22 430 22 DNA Human Papillomavirus 430 tatttgttgg gggaatcagt ta 22 431 22 DNA Human Papillomavirus 431 tatatgttgg cacaatcaat tg 22 432 22 DNA Human Papillomavirus 432 tatttgttgg tttaatgaat tg 22 433 22 DNA Human Papillomavirus 433 tatttgttgg tttaatgaac tg 22 434 22 DNA Human Papillomavirus 434 aatttgttgg cataatcaac tg 22 435 22 DNA Human Papillomavirus 435 tatatgctgg ggtaatcaaa ta 22 436 22 DNA Human Papillomavirus 436 tatttgttgg cataatcaat ta 22 437 22 DNA Human Papillomavirus 437 tatttgttgg ggtaatcaat ta 22 438 22 DNA Human Papillomavirus 438 catttgctgg aataatcagc tt 22 439 22 DNA Human Papillomavirus 439 catttgttgg tttaatgagt ta 22 440 22 DNA Human Papillomavirus 440 tatatgctgg tttaatcaat tg 22 441 65 DNA Human Papillomavirus 441 gcacagggcc acaataatgg catttgttgg ggtaaccaac tatttgttac tgttgttgat 60 actac 65 442 65 DNA Human Papillomavirus 442 gcacagggtc ataacaatgg tgtttgctgg cataatcaat tatttgttac tgtggtagat 60 accac 65 443 65 DNA Human Papillomavirus 443 gctcagggac acaataatgg tatttgttgg ggcaatcagt tatttgttac tgtggtagat 60 accac 65 444 65 DNA Human Papillomavirus 444 gcacaaggtc ataataatgg tatttgttgg ggcaatcagg tatttgttac tgtggtagat 60 accac 65 445 65 DNA Human Papillomavirus 445 gcacaaggcc ataataatgg tatttgttgg agtaaccaat tgtttgttac tgtagttgat 60 acaac 65 446 65 DNA Human Papillomavirus 446 gcccagggcc acaacaatgg tatatgttgg cataatcaat tatttcttac tgttgtggac 60 actac 65 447 65 DNA Human Papillomavirus 447 gcccagggcc ataacaatgg tatttgttgg cataatcagt tgtttgttac tgtagtggac 60 actac 65 448 65 DNA Human Papillomavirus 448 gcgcagggtc acaataatgg catttgctgg aacaatcagc tttttattac ctgtgttgat 60 actac 65 449 65 DNA Human Papillomavirus 449 gcgcagggcc acaataatgg catatgttgg ggcaatcagt tgtttgtcac agttgtggat 60 accac 65 450 65 DNA Human Papillomavirus 450 gcccaaggcc ataataatgg catttgctgg ggtaatcaat tatttgttac tgtagtagat 60 actac 65 451 65 DNA Human Papillomavirus 451 gcacaaggtc ataacaatgg catttgctgg ggcaatcagt tatttgttac cgtggttgat 60 accac 65 452 65 DNA Human Papillomavirus 452 gcacagggtc ataataatgg catatgctgg ggtaatcagg tatttgttac tgttgtggat 60 actac 65 453 65 DNA Human Papillomavirus 453 gcacagggac ataacaatgg catttgttgg ggcaaccaat tgtttgttac ttgtgtagat 60 actac 65 454 65 DNA Human Papillomavirus 454 gcccagggac ataacaatgg tatttgttgg ggtaatcaac tgtttgttac tgtggtagat 60 accac 65 455 65 DNA Human Papillomavirus 455 gctcagggac ataacaatgg tatttgctgg ggaaaccact tgtttgttac tgtggtagat 60 accac 65 456 65 DNA Human Papillomavirus 456 gcccagggac aaaacaatgg catttgctgg cataatcaac tgtttttaac tgttgtagat 60 actac 65 457 65 DNA Human Papillomavirus 457 gcccagggcc ataacaatgg catatgtttt ggcaatcagt tatttgttac agttgtagac 60 accac 65 458 65 DNA Human Papillomavirus 458 gcacaaggac acaataatgg tatatgttgg ggaaatcagc tatttttaac tgtggttgat 60 actac 65 459 59 DNA Human Papillomavirus 459 ggacataata atggcatttg ttttgggaat cagttgtttg ttacagtggt agataccac 59 460 65 DNA Human Papillomavirus 460 gcgcagggcc acaataatgg tatttgttgg ggaaatcagt tatttgttac tgttgtagat 60 actac 65 461 65 DNA Human Papillomavirus 461 gcccagggac ataataatgg catctgttgg aacaatcagt tatttgtaac tgttgtggat 60 accac 65 462 65 DNA Human Papillomavirus 462 gcccagggtc aaaacaatgg tatttgttgg ggcaatcagg tgtttttaac agttgtagat 60 accac

65 463 65 DNA Human Papillomavirus 463 gcgcagggcc acaataatgg tatttgttgg gggaatcagt tatttgttac tgttgtagat 60 actac 65 464 65 DNA Human Papillomavirus 464 gctcagggtt taaacaatgg tatatgttgg cacaatcaat tgtttttaac agttgtagat 60 actac 65 465 65 DNA Human Papillomavirus 465 gcccagggcc acaacaatgg tatttgttgg tttaatgaat tgtttgtaac cgttgtggat 60 accac 65 466 65 DNA Human Papillomavirus 466 gcacagggtc ataataatgg tatttgttgg tttaatgaac tgtttgttac tgtggtggat 60 actac 65 467 65 DNA Human Papillomavirus 467 gcacagggac ataacaatgg aatttgttgg cataatcaac tgtttctaac tgttgtatat 60 actac 65 468 65 DNA Human Papillomavirus 468 gcccagggac ataacaatgg tatatgctgg ggtaatcaaa tatttgttac tgttgtagac 60 actac 65 469 65 DNA Human Papillomavirus 469 gcacagggac acaacaatgg tatttgttgg cataatcaat tatttcttac tgttgtggat 60 accac 65 470 65 DNA Human Papillomavirus 470 gcgcaaggcc acaataatgg tatttgttgg ggtaatcaat tatttgttac agttgtggat 60 accac 65 471 65 DNA Human Papillomavirus 471 gcacagggac ataataatgg catttgctgg aataatcagc tttttattac ttgtgttgac 60 actac 65 472 65 DNA Human Papillomavirus 472 gcccagggac ataataatgg catttgttgg tttaatgagt tatttgttac agttgtagat 60 actac 65 473 65 DNA Human Papillomavirus 473 gcgcggggtc ataacaatgg tatatgctgg tttaatcaat tgtttgtcac ggtggtggat 60 accac 65 474 20 DNA Human Papillomavirus 474 gcccagggac acaataatgg 20 475 20 DNA Human Papillomavirus 475 gcacagggtc ataataatgg 20 476 20 DNA Human Papillomavirus 476 gcacagggac acaataatgg 20 477 20 DNA Human Papillomavirus 477 gcccagggaa ctaataatgg 20 478 20 DNA Human Papillomavirus 478 gcccagggtc ataataatgg 20 479 20 DNA Human Papillomavirus 479 gcacagggtc ataataatgg 20 480 23 DNA Human Papillomavirus 480 tttgttactg tagttgatac tac 23 481 23 DNA Human Papillomavirus 481 tttgttacct gtgttgatac cac 23 482 23 DNA Human Papillomavirus 482 tttgttactg ttgtggacac cac 23 483 23 DNA Human Papillomavirus 483 tttattactg tggtggacac tac 23 484 23 DNA Human Papillomavirus 484 tttgtgacag ttgtagatac tac 23 485 23 DNA Human Papillomavirus 485 tttttaactg ttgtagatac tac 23 486 22 DNA Human Papillomavirus 486 tatatgttgg ggcaatcact tg 22 487 22 DNA Human Papillomavirus 487 tatctgttgg ggcaatcaat tg 22 488 22 DNA Human Papillomavirus 488 catttgttgg ggcaaccagg ta 22 489 22 DNA Human Papillomavirus 489 catttgttgg cataaccagt tg 22 490 22 DNA Human Papillomavirus 490 catctgttgg tttaatgagc tt 22 491 22 DNA Human Papillomavirus 491 tatttgttgg cataatcaat ta 22 492 65 DNA Human Papillomavirus 492 gcccagggac acaataatgg tatatgttgg ggcaatcact tgtttgttac tgtagttgat 60 actac 65 493 65 DNA Human Papillomavirus 493 gcacagggtc ataataatgg tatctgttgg ggcaatcaat tgtttgttac ctgtgttgat 60 accac 65 494 65 DNA Human Papillomavirus 494 gcacagggac acaataatgg catttgttgg ggcaaccagg tatttgttac tgttgtggac 60 accac 65 495 65 DNA Human Papillomavirus 495 gcccagggaa ctaataatgg catttgttgg cataaccagt tgtttattac tgtggtggac 60 actac 65 496 65 DNA Human Papillomavirus 496 gcccagggtc ataataatgg catctgttgg tttaatgagc tttttgtgac agttgtagat 60 actac 65 497 65 DNA Human Papillomavirus 497 gcacagggtc ataataatgg tatttgttgg cataatcaat tatttttaac tgttgtagat 60 actac 65

Claims

1. Method for detection and/or identification of HPV present in a biological sample, comprising the following steps: (i) amplification of a polynucleic acid fragment of HPV by use of: a 5'-primer specifically hybridizing to the A region or B region of the genome of at least one HPV type, said A region or B region being indicated in FIG. 1, and, a 3'-primer specifically hybridizing to the C region of the genome of at least one HPV type, said C region being indicated in FIG. 1; (ii) hybridizing the amplified fragments from step (i) with at least one probe capable of specific hybridization with the D region of at least one HPV type, said D region being indicated in FIG. 1.

2. Method according to claim 1, characterized further in that: the 3'-end of said 5'-primer specifically hybridizing to the A region of the genome of at least one HPV type, is situated at position 6572 of the genome of HPV 16, or at the corresponding position of any other HPV genome, as indicated in FIG. 1, and/or, the 3'-end of said 5'-primer specifically hybridizing to the B region of the genome of at least one HPV type, is situated at position 6601 of the genome of HPV 16, or at the corresponding position of any other HPV genome, as indicated in FIG. 1, and/or, the 3'-end of said 3'-primer specifically hybridizing to the C region of the genome of at least one HPV type, is situated at position 6624 of the genome of HPV 16, or at the corresponding position of any other HPV genome, as indicated in FIG. 1.

3. A method according to claim 2, characterized further in that: said 5'-primer specifically hybridizing to the A region is chosen from the following list: SGP3 (SEQ ID NO 2), SGP3A (SEQ ID NO 3), SGP3B (SEQ ID NO 4), SGP3C (SEQ ID NO 10), SGP3D (SEQ ID NO 11), SGP3E (SEQ ID NO 12), SGP3F (SEQ ID NO 13), SGP3G (SEQ ID NO 14), and/or, said 5-primer specifically hybridizing to the b region is chosen from the following list: SGP1 (SEQ ID NO 6), SGP1A (SEQ ID NO 15), SGP1B (SEQ ID NO16), SGP1C (SEQ ID NO 17), SGP1D (SEQ ID NO 18), and/or, said 3'-primer specifically hybridizing to the C region is chosen from the following list: SGP2 (SEQ ID NO 9), SGP2A (SEQ ID NO 8), SGP2B (SEQ ID NO 19), SGP2C (SEQ ID NO 20), SGP2D (SEQ ID NO 21), SGP2E (SEQ ID NO 22), SGP2F (SEQ ID NO 23), SGP2H (SEQ ID NO 98), SGP2I (SEQ ID NO 154), SGP2J (SEQ ID NO 155), SGP2K (SEQ ID NO 156), SGP2L (SEQ ID NO 157), SGP2M (SEQ ID NO 158), SGP2N (SEQ ID NO 159), SGP2P (SEQ ID NO 160).

4. Method according to any of claims 1 to 3, characterized further in that said probe mentioned in step (ii) is capable of specific hybridization with the D region of the genome of only one HPV type, and thus enables specific identification of this HPV type, when this type is present in a biological sample.

5. Method according to any of claims 1 to 3, characterized further in that said probe mentioned in step (ii) is capable of specific hybridization with the D region of more than one HPV type, and thus enables detection of any of said more than one HPV type, when any of said types is present in a biological sample.

6. Method according to claim 4, characterized further in that said probe capable of specific hybridization with the D region of the genome of only one HPV type, more particularly hybridizes to the E region, with said E region being a subregion of the D region, as indicated in FIG. 1.

7. Method according to claim 4, characterized further in that said probe capable of specific hybridization with the D region of the genome of only one HPV type, more particularly specifically hybridizes to the 22 bp region situated between the B region and the C region, as indicated in FIG. 1.

8. Method according to claim 7, characterized further in that said probe specifically hybridizing to said 22 bp region of only one HPV type is chosen from the following list: HPV6 Pr1, HPV6 Pr2, HPV6 Pr3, HPV6 Pr4, HPV6 Pr5, HPV11 Pr1, HPV11 Pr2, HPV11 Pr3, HPV11 Pr4, HPV11 Pr5, HPV16 Pr1, HPV16 Pr2, HPV16 Pr3, HPV16 Pr4, HPV16 Pr5, HPV18 Pr1, HPV18 Pr2, HPV18 Pr3, HPV18 Pr4, HPV18 Pr5, HPV31 Pr1, HPV31 Pr2, HPV31 Pr3, HPV31 Pr4, HPV31 Pr5, HPV31 Pr21, HPV31 Pr22, HPV31 Pr23, HPV31 Pr24, HPV31 Pr25, HPV31 Pr26, HPV31 Pr31, HPV31 Pr32, HPV33 Pr1, HPV33 Pr2, HPV33 Pr3, HPV33 Pr4, HPV33 Pr5, HPV33 Pr21, HPV33 Pr22, HPV33 Pr23, HPV33 Pr24, HPV33 Pr25, HPV33 Pr26, HPV40 Pr1, HPV45 Pr1 (=SGPP68), HPV45 Pr2, HPV45 Pr3, HPV45 Pr4, HPV45 Pr5, HPV45 Pr11, HPV45 Pr12, HPV45 Pr13, HPV52 Pr1, HPV52 Pr2, HPV52 Pr3, HPV52 Pr4, HPV52 Pr5, HPV52 Pr6, HPV56 Pr1, HPV56 Pr2, HPV56 Pr3, HPV56 Pr11, HPV56 Pr12, HPV58 Pr1, HPV58 Pr2, HPV58 Pr3, HPV58 Pr4 (SEQ ID NOs 24 to 91), and, SGPP35, SGPP39, SGPP51 (=HPV51 Pr1), SGPP54, SGPP59, SGPP66, SGPP70 (=HPV70 Pr1), SGPP13, SGPP34, SGPP42, SGPP43, SGPP44, SGPP53, SGPP55, SGPP69, SGPP61, SGPP62, SGPP64, SGPP67, SGPP74 (=HPV74 Pr13), MM4 (=HPVM4 Pr11), MM7, MM8 (SEQ ID NOs 92 to 115), and, HPV18b Pr1, HPV18b Pr2, HPV31 Vs40-1, HPV31 Vs40-2, HPV31 Vs40-3, HPV34 Pr1, HPV35 Pr1, HPV35 Pr2, HPV35 Pr3, HPV39 Pr1, HPV42 Pr1, HPV42 Pr2, HPV43 Pr1, HPV43 Pr2, HPV43 Pr3, HPV44 Pr1, HPV44 Pr2, HPV44 Pr3, HPV44 Pr4, HPV51 Pr2, HPV53 Pr1, HPV54 Pr1, HPV54 Pr11, HPV54 Pr11as, HPV54 Pr12, HPV55 Pr1, HPV55 Pr11, HPV55 Pr12, HPV55 Pr13, HPV56 Vs74-1, HPV59 Pr1, HPV59 Pr11, HPV59 Pr12, HPV59 Pr13, HPV66 Pr1, HPV67 Pr1, HPV67 Pr11, HPV67 Pr12, HPV67 Pr13, HPV67 Pr21, HPV67 Pr22, HPV67 Pr23, HPV68 Pr1, HPV68 Pr2, HPV68 Pr3, HPV68 Vs45-1, HPV68 Vs45-2, HPV70 Pr1, HPV70 Pr12, HPV70 Pr13, HPV74 Pr1, HPV74 Pr11, HPV74 Pr12, HPV74 Pr2, HPV74 Pr3, HPVM4 Pr1, HPVM4 Pr12, HPVM4 Pr21, HPVM4 Pr22 (SEQ ID NOs 161 to 219).

9. Method according to claim 5, characterized further in that said probe capable of specific hybridization with the D region of the genome of more than one HPV type, more particularly hybridizes to the E region, with said E region being a subregion of the D region, as indicated in FIG. 1.

10. Method according to claim 9, characterized further in that said probe specifically hybridizing to said E region of more than one HPV type, is chosen from the following list: HPVuni1, HPVuni2, HPVuni3, HPVuni4, HPVuni5, HPVuni6, HPVuni7, HPVuni2L2, HPVuni2L3, HPVuni2L4, HPVuni2L5, HPVuni2L6, HPVuni2L7, HPVuni4L1, HPVuni4L2, HPVuni4L3, HPVuni4L4, HPVuni4L5, HPVuni4L6 (SEQ ID NOs 116 to 134), and, HPVuni1A, HPVuni1B, HPVuni1C, HPVuni2A, HPVuni3A (SEQ ID NOs 220 to 224), and, HPV G1, HPV G1A1, HPV G1A2, HPV G1A3, HPV G1A4, HPV G2, HPV G3, HPV G4, HPV G5, HPV G6, HPV R1, HPV R10, HPV R11, HPV R2, HPV R3, HPV R4, HPV R5, HPV R6, HPV R7, HPV R8, HPV R9 (SEQ ID NOs 225 to 245).

11. A primer as defined in any of claims 1 to 3, for use in the detection and/or identification of HPV present in a biological sample.

12. A primer combination consisting of a 5'-primer as defined in any of claims 1 to 3 and of a 3'-primer as defined in any of claims 1 to 3, for use in the detection and/or identification of HPV present in a biological sample.

13. A probe as defined in any of claims 1 and 4 to 10, for use in the detection and/or identification of HPV present in a biological sample.

14. A diagnostic kit for detection and/or identification of HPV, possibly present in a biological sample, comprising the following components: (i) at least one suitable primer, with said primers being defined in any of claims 1 to 3; (ii) at least one suitable probe, with said probes being defined in any of claims 1 and 4 to 10.

15. An isolated HPV polynucleic acid, defined by SEQ ID NO 135 to 153, or any fragment thereof, that can be used as a primer or as a probe in a method for detection and/or identification of HPV present in a sample.