U.S. patent application number 10/325403 was filed with the patent office on 2003-08-28 for method and reagent for treatment of diseases caused by expression of the c-myc gene.
This patent application is currently assigned to Ribozyme Pharmaceuticals, Inc.. Invention is credited to Draper, Kenneth G., Thompson, James D..
Application Number | 20030162264 10/325403 |
Document ID | / |
Family ID | 25468607 |
Filed Date | 2003-08-28 |
United States Patent
Application |
20030162264 |
Kind Code |
A1 |
Thompson, James D. ; et
al. |
August 28, 2003 |
Method and reagent for treatment of diseases caused by expression
of the c-myc gene
Abstract
The present invention relates to an enzymatic RNA molecule which
cleaves mRNA derived from c-myc gene.
Inventors: |
Thompson, James D.;
(Lafayette, CO) ; Draper, Kenneth G.; (Reno,
NV) |
Correspondence
Address: |
Anita J. Terpstra, Ph.D.
McDonnell Boehnen Hulbert & Berghoff
32nd Floor
300 S. Wacker Drive
Chicago
IL
60606
US
|
Assignee: |
Ribozyme Pharmaceuticals,
Inc.
|
Family ID: |
25468607 |
Appl. No.: |
10/325403 |
Filed: |
December 23, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10325403 |
Dec 23, 2002 |
|
|
|
08192943 |
Feb 7, 1994 |
|
|
|
6544755 |
|
|
|
|
08192943 |
Feb 7, 1994 |
|
|
|
07936422 |
Aug 26, 1992 |
|
|
|
Current U.S.
Class: |
435/91.1 ;
435/320.1; 435/325; 536/23.1 |
Current CPC
Class: |
C12N 2310/126 20130101;
C12N 15/113 20130101; C12N 2310/121 20130101; C12N 15/1135
20130101; C12N 2310/122 20130101; C12N 2310/123 20130101; C12N
2310/124 20130101 |
Class at
Publication: |
435/91.1 ;
435/325; 536/23.1; 435/320.1 |
International
Class: |
C07H 021/02; C12P
019/34; C12N 015/00; C12N 005/06 |
Claims
1. An enzymatic RNA molecule which cleaves RNA derived from c-myc
gene, wherein said enzymatic nucleic acid molecule comprises one or
more chemical modifications.
2. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule is in a hammerhead (HH) motif.
3. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule is in a hairpin, hepatitis Delta virus, group I
intron, VS nucleic acid, or RNAse P nucleic acid motif.
4. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule comprises at least one 2'-sugar modification.
5. The enzymatic RNA molecule of claim 4, wherein said 2' sugar
modification comprises a 2'-O-methyl modification.
6. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule comprises at least one nucleic acid base
modification.
7. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule comprises at least one phosphate backbone
modification.
8. The enzymatic RNA molecule of claim 7, wherein said phosphate
backbone modification comprises a phosphorothioate
modification.
9. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule comprises a 5' end modification.
10. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule comprises a 3' end modification.
11. The enzymatic RNA molecule of claim 1, wherein said enzymatic
RNA molecule comprises a cap structure at the 5'-end, or 3'-end, or
both the 5'-end and the 3'-end.
12. A mammalian cell comprising the enzymatic RNA molecule of claim
1.
13. The mammalian cell of claim 12, wherein said cell is a human
cell.
14. An expression vector comprising nucleic acid encoding one or
more enzymatic RNA molecules which cleave RNA derived from c-myc
gene in a manner which allows expression of the enzymatic RNA
molecule(s) within a mammalian cell.
15. A mammalian cell comprising the expression vector of claim
14.
16. The enzymatic RNA molecule of claim 1, wherein said enzymatic
nucleic acid comprises between 5 and 23 bases complementary to said
RNA derived from c-myc gene.
17. The enzymatic RNA molecule of claim 16, wherein said enzymatic
nucleic acid comprises between 10 and 18 bases complementary to
said RNA derived from c-myc gene.
Description
[0001] This patent application is a continuation of Thompson, U.S.
Ser. No. 08/192,943 filed Feb. 7, 1994, which is a continuation of
Thompson, U.S. Ser. No. 07/936,422 filed Aug. 26, 1992, abandoned,
all entitled "METHOD AND REAGENT FOR TREATMENT OF DISEASES CAUSED
BY EXPRESSION OF THE c-MYC GENE". All of the above applications are
hereby incorporated by reference herein in their entirety,
including the drawings.
BACKGROUND OF THE INVENTION
[0002] This invention relates to methods for inhibition of growth
of transformed cells, and inhibition of progression to a
transformed phenotype in pre-neoplastic cells.
[0003] Transformation is a cumulative process whereby normal
control of cell growth and differentiation is interrupted, usually
through the accumulation of mutations affecting the expression of
genes that regulate cell growth and differentiation.
[0004] Scanlon W091/18625, W091/18624, and W091/18913 describes a
ribozyme effective to cleave oncogene RNA from the H-ras gene. This
ribozyme is said to inhibit H-ras expression in response to
exogenous stimuli. Reddy W092/00080 describes use of ribozymes as
therapeutic agents for leukemias, such as CML by targeting specific
portions of the BCR-ABL gene transcript.
[0005] c-Myc, when activated, can induce malignancy in a variety of
tissues, most notably hematopoietic tissues (Leder et al., 222
Science 765, 1983). The most common mechanism of c-myc activation
is translocation to any of the immunoglobulin (Ig) or T cell
receptor loci during lymphoid maturation (Croce and Nowell, 65
Blood 1, 1985; Klein and Klein, 6 Immunol. Today 208, 1985). For
example, in Burkitt's lymphoma the c-myc locus on chromosome 8
translocates most often to the Ig heavy chain locus on chromosome
14, but also to the lambda or kappa light chain Ig genes on
chromosomes 2 and 22 (Magrath, in "Epstein-Barr Virus and
Associated Diseases", M. Nijhoff Publishing: 631, 1986). In some
instances the c-myc transcription region is altered in the
non-coding exon 1 region; in such cases transcription is initiated
at a cryptic promoter present in the first intron of the c-myc
locus. These rearrangements are thought to lead to deregulation of
c-myc expression.
[0006] c-Myc is not normally expressed in quiescent cells, but is
temporally expressed in actively-dividing cells, most prominently
during transition from G0 to G1 phases of growth induction.
[0007] Experiments with transfected cell lines and transgenic
animals have shown that c-myc activation plays a critical role, but
is not sufficient for transformation (Adams et al., 318 Nature 533,
1985; Lombardi et al., 49 Cell 161, 1987; Schwartz et al., 6 Mol.
Cell. Biol. 3221, 1986; Langdon et al., 47 Cell 11, 1986). Targeted
inhibition of c-myc expression in tumor cell lines using antisense
oligonucleotides has shown that c-myc expression is required for
growth in certain lymphomas (McManaway et al., 335 Lancet 808,
1990).
SUMMARY OF THE INVENTION
[0008] The invention features use of ribozymes to inhibit the
development or expression of a transformed phenotype in man and
other animals by modulating expression of a gene that contributes
to the expression of Burkitt's lymphoma, acute lymphocytic leukemia
and other neoplastic conditions. Cleavage of targeted mRNAs
expressed in pre-neoplastic and transformed cells elicits
inhibition of the transformed state.
[0009] Ribozymes are RNA molecules having an enzymatic activity
which is able to repeatedly cleave other separate RNA molecules in
a nucleotide base sequence specific manner. Such enzymatic RNA
molecules can be targeted to virtually any RNA transcript and
efficient cleavage has been achieved in vitro. Kim et al., 84 Proc.
Nat. Acad. of Sci. USA 8788, 1987, Haseloff and Gerlach, 334 Nature
585, 1988, Cech, 260 JAMA 3030, 1988, and Jefferies et al., 17
Nucleic Acid Research 1371, 1989.
[0010] Ribozymes act by first binding to a target RNA. Such binding
occurs through the target RNA binding portion of a ribozyme which
is held in close proximity to an enzymatic portion of the RNA which
acts to cleave the target RNA. Thus, the ribozyme first recognizes
and then binds a target RNA through complementary base-pairing, and
once bound to the correct site, acts enzymatically to cut the
target RNA. Strategic cleavage of such a target RNA will destroy
its ability to direct synthesis of an encoded protein. After a
ribozyme has bound and cleaved its RNA target it is released from
that RNA to search for another target and can repeatedly bind and
cleave new targets.
[0011] The enzymatic nature of a ribozyme is advantageous over
other technologies, such as antisense technology (where a nucleic
acid molecule simply binds to a nucleic acid target to block its
translation) since the effective concentration of ribozyme
necessary to effect a therapeutic treatment is lower than that of
an antisense oligonucleotide. This advantage reflects the ability
of the ribozyme to act enzymatically. Thus, a single ribozyme
molecule is able to cleave many molecules of target RNA. In
addition, the ribozyme is a highly specific inhibitor, with the
specificity of inhibition depending not only on the base pairing
mechanism of binding, but also on the mechanism by which the
molecule inhibits the expression of the RNA to which it binds. That
is, the inhibition is caused by cleavage of the RNA target and so
specificity is defined as the ratio of the rate of cleavage of the
targeted RNA over the rate of cleavage of non-targeted RNA. This
cleavage mechanism is dependent upon factors additional to those
involved in base pairing. Thus, it is thought that the specificity
of action of a ribozyme is greater than that of antisense
oligonucleotide binding the same RNA site.
[0012] This class of chemicals exhibits a high degree of
specificity for cleavage of the intended target mRNA. Consequently,
the ribozyme agent will only affect cells expressing that
particular gene, and will not be toxic to normal tissues.
[0013] The invention can be used to treat cancer or pre-neoplastic
conditions. Two preferred administration protocols can be used,
either in vivo administration to reduce the tumor burden, or ex
vivo treatment to eradicate transformed cells from tissues such as
bone marrow prior to reimplantation.
[0014] Thus, in the first aspect the invention features an
enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated
with development or maintenance of Burkitt's lymphoma or acute
lymphocytic leukemia, e.g., those mRNAs produced from the gene
c-myc, including mRNA targets disclosed in Table 1.
1TABLE 1 nucleotide mRNA target sequence ID. NO. (469)
CAGGACCCGCUUCUCUGAAAGGCUCUCCUU SEQ. ID. NO. 1 (553)
GCGACGAUGCCCCUCAACGUUAGCU SEQ. ID. NO. 2 (589)
AACUAUCACCUCGACUACGACUCGGU SEQ. ID. NO. 3 (629)
ACUGCGACGAGGAGGAGAACUUCUACCA SEQ. ID. NO. 4 (662) AGCAGCAGAGCGA
SEQ. ID. NO. 5 (680) AGCCCCCGGCGCCCAGCGAGGAUAUCUGGA SEQ. ID. NO. 6
(725) UGCCCACCCCGCC SEQ. ID. NO. 7 (758) CCGGGCUCUGCUCGCCCUCCUA
SEQ. ID. NO. 8 (783) UGCGGUCACACCCU SEQ. ID. NO. 9 (813)
CAACGACGGCGGUGGCGGGAGCUUCUCCACGGCCGACCA SEQ. ID. NO. 10 (876)
GGGAGGAGACAU SEQ. ID. NO. 11 (907)
UGCGACCCGGACGACGAGACCUUCAUCAAAAACAUCAUCA SEQ. ID. NO. 12 (981)
CGCCAAGCUCGUCUCAGAGAAGCUGGCCUCCUACCA SEQ. ID. NO. 13 (1023)
GCGCAAAGACAGCG SEQ. ID. NO. 14 (1043) CGAACCCCGCCC SEQ. ID. NO. 15
(1077) CUCCAGCUUGUACCUGCAGGA SEQ. ID. NO. 16 (1114)
UCAGAGUGCAUCGACCC SEQ. ID. NO. 17 (1124)
UCGACCCCUCGGUGGUCUUCCCCUACCCUCUCAACGAC SEQ. ID. NO. 18 (1168)
UCGCCCAAGUCCUGCGCCUCGCAAGACUCCAGCGC SEQ. ID. NO. 19 (1230)
CUCCUCGACGGA SEQ. ID. NO. 20 (1258) AGCCCCGAGCCCC SEQ. ID. NO. 21
(1276) CUCCAUGAGGAGA SEQ. ID. NO. 22 (1357) GUGGAAAAGAGG SEQ. ID.
NO. 23 (1376) CUGGCAAAAGGUCA SEQ. ID. NO. 24 (1397)
GAUCACCUUCUGCUGGAGGCCACAGCAAACCUCCUCACA SEQ. ID. NO. 25 (1459)
CACGUCUCCACACAUCAGCACAACUACGCA SEQ. ID. NO. 26 (1496)
CCUCCACUCGGAAGGACUAUCC SEQ. ID. NO. 27 (1523) CCAAGAGGGUCAAGUUGGA
SEQ. ID. NO. 28 (1547) UCAGAGUCCUGAGACA SEQ. ID. NO. 29 (1569)
CAACAACCGAAAAUGCA SEQ. ID. NO. 30 (1643) UGGAGCGCCAGAGG SEQ. ID.
NO. 31 (1662) CGAGCUAAAACGGAGCU SEQ. ID. NO. 32 (1684)
GCCCUGCGUGACCAGAUCCCGGA SEQ. ID. NO. 33 (1712)
AAAACAAUGAAAAGGCCCCCAAGGUAGUUAUCCUUAAAA SEQ. ID. NO. 34 (1755)
CACAGCAUACAUCCUGUCCGUCCAAG SEQ. ID. NO. 35 (1786) GAGCAAAAGCUCAU
SEQ. ID. NO. 36 (1805) AAGAGGACUUGUUGCGGAAACGACGAGAACAGUUGAAAC SEQ.
ID. NO. 37 (1845) CAAACUUGAACAGCUACGGAACUCUUGUGCGU SEQ. ID. NO. 38
(1883) AAGUAAGGAAAACGA SEQ. ID. NO. 39 (1904)
CUAACAGAAAUGUCCUGAGCAAUCACCUAUGAACU SEQ. ID. NO. 40 (1964)
ACCUCACAACCU SEQ. ID. NO. 41
[0015] By "enzymatic RNA molecule" it is meant an RNA molecule
which has complementarity in a substrate binding region to a
specified mRNA target, and also has an enzymatic activity which is
active to specifically cleave that mRNA. That is, the enzymatic RNA
molecule is able to intermolecularly cleave mRNA and thereby
inactivate a target mRNA molecule. This complementarity functions
to allow sufficient hybridization of the enzymatic RNA molecule to
the target RNA to allow the cleavage to occur. One hundred percent
complementarity is preferred, but complementarity as low as 50-75%
may also be useful in this invention.
[0016] In preferred embodiments, the enzymatic RNA molecule is
formed in a hammerhead motif, but may also be formed in the motif
of a hairpin, hepatitis delta virus, group I intron or RNAseP-like
RNA (in association with an RNA guide sequence). Examples of such
hammerhead motifs are described by Rossi et al., 8 AIDS RESEARCH
AND HUMAN RETROVIRUSES 183, 1992, of hairpin motifs by Hampel et
al., RNA CATALYST FOR CLEAVING SPECIFIC RNA SEQUENCES, filed Sep.
20, 1989, which is a continuation-in-part of U.S. Ser. No.
07/247,100 filed Sep. 20, 1988, Hampel and Tritz, 28 Biochemistry
4929, 1989 and Hampel et al., 18 Nucleic Acids Research 299, 1990,
and an example of the hepatitis delta virus motif is described by
Perrotta and Been, 31 Biochemistry 16, 1992, of the RNAseP motif by
Guerrier-Takada, et al., 35 Cell 849, 1983, and of the group I
intron by Cech et al., U.S. Pat. No. 4,987,071. These specific
motifs are not limiting in the invention and those skilled in the
art will recognize that all that is important in an enzymatic RNA
molecule of this invention is that it has a specific substrate
binding site which is complementary to one or more of the target
gene RNA regions, and that it have nucleotide sequences within or
surrounding that substrate binding site which impart an RNA
cleaving activity to the molecule.
[0017] In a second related aspect, the invention features a
mammalian cell which includes an enzymatic RNA molecule as
described above. Preferably, the mammalian cell is a human
cell.
[0018] In a third related aspect, the invention features an
expression vector which includes nucleic acid encoding an enzymatic
RNA molecule described above, located in the vector, e.g., in a
manner which allows expression of that enzymatic RNA molecule
within a mammalian cell.
[0019] In a fourth related aspect, the invention features a method
for treatment of Burkitt's lymphoma or acute lymphocytic leukemia
by administering to a patient an enzymatic RNA molecule as
described above.
[0020] The invention provides a class of chemical cleaving agents
which exhibit a high degree of specificity for the mRNA causative
of Burkitt's lymphoma or acute lymphocytic leukemia. Such enzymatic
RNA molecules can be delivered exogenously or endogenously to
infected cells. In the preferred hammerhead motif the small size
(less than 40 nucleotides, preferably between 32 and 36 nucleotides
in length) of the molecule allows the cost of treatment to be
reduced.
[0021] The smallest ribozyme delivered for any type of treatment
reported to date (by Rossi et al., 1992 supra) is an in vitro
transcript having a length of 142 nucleotides. Synthesis of
ribozymes greater than 100 nucleotides in length is very difficult
using automated methods, and the therapeutic cost of such molecules
is prohibitive. Delivery of ribozymes by expression vectors is
primarily feasible using only ex vivo treatments. This limits the
utility of this approach. In this invention, an alternative
approach uses smaller ribozyme motifs (e.g., of the hammerhead
structure, shown generally in FIG. 1) and exogenous delivery. The
simple structure of these molecules also increases the ability of
the ribozyme to invade targeted regions of the mRNA structure.
Thus, unlike the situation when the hammerhead structure is
included within longer transcripts, there are no non-ribozyme
flanking sequences to interfere with correct folding of the
ribozyme structure, as well as complementary binding of the
ribozyme to the mRNA target.
[0022] The enzymatic RNA molecules of this invention can be used to
treat human Burkitt's lymphoma, acute lymphocytic leukemia or
precancerous conditions. Such treatment can also be extended to
other related genes in nonhuman primates. Affected animals can be
treated at the time of cancer detection or in a prophylactic
manner. This timing of treatment will reduce the number of affected
cells and disable cellular replication. This is possible because
the ribozymes are designed to disable those structures required for
successful cellular proliferation.
[0023] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0024] The drawing will first briefly be described.
[0025] Drawing
[0026] FIG. 1 is a diagrammatic representation of a hammerhead
motif ribozyme showing stems I, II and III (marked (I), (II) and
(III) respectively) interacting with a viral target region. The 5'
and 3' ends of both ribozyme and target are shown. Dashes indicate
base-paired nucleotides.
[0027] Target Sites
[0028] Ribozymes targeting selected regions of mRNA associated with
tumor cell growth are chosen to cleave the target RNA in a manner
which preferably inhibits translation of the RNA. Genes are
selected such that inhibition of translation will preferably
inhibit cell replication, e.g., by inhibiting production of a
necessary protein. Selection of effective target sites within these
critical regions of MRNA entails testing the accessibility of the
target RNA to hybridization with various oligonucleotide probes.
These studies can be performed using RNA probes and assaying
accessibility by cleaving the hybrid molecule with RNAseH (see
below). Alternatively, such a study can use ribozyme probes
designed from secondary structure predictions of the mRNAs, and
assaying cleavage products by polyacrylamide gel electrophoresis
(PAGE), to detect the presence of cleaved and uncleaved
molecules.
[0029] The following is but one example of a method by which
suitable target sites can be identified and is not limiting in this
invention. Generally, the method involves identifying potential
cleavage sites for a hammerhead ribozyme, and then testing each of
these sites to determine their suitability as targets by ensuring
that secondary structure formation is minimal.
[0030] The mRNA sequences are compared in an appropriate target
region. Putative ribozyme cleavage sites are found. These sites
represent the preferable sites for hammerhead ribozyme cleavage
within these two target mRNAs.
[0031] Short RNA substrates corresponding to each of the mRNA sites
are designed. Each substrate is composed of two to three
nucleotides at the 5' and 3' ends that will not base pair with a
corresponding ribozyme recognition region. The unpaired regions
flanked a central region of 12-14 nucleotides to which
complementary arms in the ribozyme are designed.
[0032] The structure of each substrate sequence is predicted using
a PC fold computer program. Sequences which give a positive free
energy of binding are accepted. Sequences which give a negative
free energy are modified by trimming one or two bases from each of
the ends. If the modified sequences are still predicted to have a
strong secondary structure, they are rejected.
[0033] After substrates are chosen, ribozymes are designed to each
of the RNA substrates. Ribozyme folding is also analyzed using PC
fold.
[0034] Ribozyme molecules are sought which form hammerhead motif
stem II (see FIG. 1) regions and contain flanking arms which are
devoid of intramolecular base pairing. Often the ribozymes are
modified by trimming a base from the ends of the ribozyme, or by
introducing additional base pairs in stem II to achieve the desired
fold. Ribozymes with incorrect folding are rejected. After
substrate/ribozyme pairs are found to contain correct
intramolecular structures, the molecules are folded together to
predict intermolecular interactions. A schematic representation of
a ribozyme with its coordinate base pairing to its cognate target
sequence is shown in FIG. 1. Examples of useful targets are listed
above in Table 1.
[0035] Those targets thought to be useful as ribozyme targets can
be tested to determine accessibility to nucleic acid probes in a
ribonuclease H assay (see below). This assay provides a quick test
of the use of the target site without requiring synthesis of a
ribozyme. It can be used to screen for sites most suited for
ribozyme attack.
[0036] Synthesis of Ribozymes
[0037] Ribozymes useful in this invention can be produced by gene
transcription as described by Cech, supra, or by chemical
synthesis. Chemical synthesis of RNA is similar to that for DNA
synthesis. The additional 2'-OH group in RNA, however, requires a
different protecting group strategy to deal with selective 3'-5'
internucleotide bond formation, and with RNA susceptibility to
degradation in the presence of bases. The recently developed method
of RNA synthesis utilizing the t-butyldimethylsilyl group for the
protection of the 2' hydroxyl is the most reliable method for
synthesis of ribozymes. The method reproducibly yields RNA with the
correct 3'-5' internucleotide linkages, with average coupling
yields in excess of 99%, and requires only a two-step deprotection
of the polymer.
[0038] A method, based upon H-phosphonate chemistry of
phosphoroamidites gives a relatively lower coupling efficiency than
a method based upon phosphoroamidite chemistry. This is a problem
for synthesis of DNA as well. A promising approach to scale-up of
automatic oligonucleotide synthesis has been described recently for
the H-phosphonates. A combination of a proper coupling time and
additional capping of "failure" sequences gave high yields in the
synthesis of oligodeoxynucleotides in scales in the range of 14
.mu.moles with as little as 2 equivalents of a monomer in the
coupling step. Another alternative approach is to use soluble
polymeric supports (e.g., polyethylene glycols), instead of the
conventional solid supports. This method can yield short
oligonucleotides in hundred milligram quantities per batch
utilizing about 3 equivalents of a monomer in a coupling step.
[0039] Various modifications to ribozyme structure can be made to
enhance the utility of ribozymes. Such modifications will enhance
shelf-life, half-life in vitro, stability, and ease of introduction
of such ribozymes to the target site, e.g., to enhance penetration
of cellular membranes, and confer the ability to recognize and bind
to targeted cells.
[0040] Exogenous delivery of ribozymes benefits from chemical
modification of the backbone, e.g., by the overall negative charge
of the ribozyme molecule being reduced to facilitate diffusion
across the cell membrane. The present strategies for reducing the
oligonucleotide charge include: modification of internucleotide
linkages by methylphosphonates, use of phosphoramidites, linking
oligonucleotides to positively charged molecules, and creating
complex packages composed of oligonucleotides, lipids and specific
receptors or effectors for targeted cells. Examples of such
modifications include sulfur-containing ribozymes containing
phosphorothioates and phosphorodithioates as internucleotide
linkages in RNA. Synthesis of such sulfur-modified ribozymes is
achieved by use of the sulfur-transfer reagent,
.sup.3H-1,2-benzenedithiol-3-one 1,1-dioxide. Ribozymes may also
contain ribose modified ribonucleotides. Pyrimidine analogues are
prepared from uridine using a procedure employing diethylamino
sulphur trifluoride (DAST) as a starting reagent. Ribozymes can
also be either electrostatically or covalently attached to
polymeric cations for the purpose of reducing charge. The polymer
can be attached to the ribozyme by simply converting the 3'-end to
a ribonucleoside dialdehyde which is obtained by a periodate
cleavage of the terminal 2' 3'-cis diol system. Depending on the
specific requirements for delivery systems, other possible
modifications may include different linker arms containing
carboxyl, amino or thiol functionalities. Yet further examples
include use of methylphosphonates and 2'-o-methylribose and 5' or
3' capping or blocking with m.sub.7GpppG or
m.sub.3.sup.2.2.7GpppG.
[0041] For example, a kinased ribozyme is contacted with guanosine
triphosphate and guanyltransferase to add a m.sup.3G cap to the
ribozyme. After such synthesis, the ribozyme can be gel purified
using standard procedure. To ensure that the ribozyme has the
desired activity, it may be tested with and without the 5' cap
using standard procedures to assay both its enzymatic activity and
its stability.
[0042] Synthetic ribozymes, including those containing various
modifiers, can be purified by high pressure liquid chromatography
(HPLC). Other liquid chromatography techniques, employing reverse
phase columns and anion exchangers on silica and polymeric supports
may also be used.
[0043] There follows an example of the synthesis of one ribozyme.
(See Dudycz, U.S. Ser. No. 07/884,436, filed May 14, 1992, hereby
incorporated by reference herein.) A solid phase phosphoramidite
chemistry was employed. Monomers used were
2'-tert-butyl-dimethylsilyl cyanoethylphosphoramidities of uridine,
N-benzoyl-cytosine, N-phenoxyacetyl adenosine and guanosine (Glen
Research, Sterling, Va.). Solid phase synthesis was carried out on
either an ABI 394 or 380B DNA/RNA synthesizer using the standard
protocol provided with each machine. The only exception was that
the coupling step was increased from 10 to 12 minutes. The
phosphoramidite concentration was 0.1 M. Synthesis was done on a 1
.mu.mole scale using a 1 .mu.mole RNA reaction column (Glen
Research). The average coupling efficiencies were between 97% and
98% for the 394 model, and between 97% and 99% for the 380B model,
as determined by a calorimetric measurement of the released trityl
cation.
[0044] Blocked ribozymes were cleaved from the solid support (e.g.,
CPG), and the bases and diphosphoester moiety deprotected in a
sterile vial by dry ethanolic ammonia (2 mL) at 55.degree. C. for
16 hours. The reaction mixture was cooled on dry ice. Later, the
cold liquid was transferred into a sterile screw cap vial and
lyophilized.
[0045] To remove the 2'-tert-butyl-dimethylsilyl groups from the
ribozyme, the residue was suspended in 1 M tetra-n-butylammonium
fluoride in dry THF (TBAF), using a 20 fold excess of the reagent
for every silyl group, for 16 hours at ambient temperature (about
15-25.degree. C.). The reaction was quenched by adding an equal
volume of sterile 1 M triethylamine acetate, pH 6.5. The sample was
cooled and concentrated on a SpeedVac to the half of the initial
volume.
[0046] The ribozymes were purified in two steps by HPLC on a C4 300
.ANG. 5 mm DeltaPak column in an acetonitrile gradient.
[0047] The first step, or "trityl on" step, was a separation of
5'-DMT-protected ribozyme(s) from failure sequences lacking a
5'-DMT group. Solvents used for this step were: A (0.1 M
triethylammonium acetate, pH 6.8) and B (acetonitrile). The elution
profile was: 20% B for 10 minutes, followed by a linear gradient of
20% B to 50% B over 50 minutes, 50% B for 10 minutes, a linear
gradient of 50% B to 100% B over 10 minutes, and a linear gradient
of 100% B to 0% B over 10 minutes.
[0048] The second step was a purification of a completely deblocked
ribozyme by a treatment of 2% trifluoroacetic acid on a C4 300
.ANG. 5 mm DeltaPak column in an acetonitrile gradient. Solvents
used for this second step were: A (0.1 M Triethylammonium acetate,
pH 6.8) and B (80% acetonitrile, 0.1 M triethylammonium acetate, pH
6.8). The elution profile was: 5% B for 5 minutes, a linear
gradient of 5% B to 15% B over 60 minutes, 15% B for 10 minutes,
and a linear gradient of 15% B to 0% B over 10 minutes.
[0049] The fraction containing ribozyme was cooled and lyophilized
on a SpeedVac. Solid residue was dissolved in a minimum amount of
ethanol and sodium perchlorate in acetone. The ribozyme was
collected by centrifugation, washed three times with acetone, and
lyophilized.
[0050] Expression Vector
[0051] While synthetic ribozymes are preferred in this invention,
those produced by expression vectors can also be used. (See
McSwiggen, U.S. Ser. No. 07/884,431, filed May 14, 1992, hereby
incorporated by reference herein.) In designing a suitable ribozyme
expression vector the following factors are important to consider.
The final ribozyme must be kept as small as possible to minimize
unwanted secondary structure within the ribozyme. A promoter (e.g.,
the human cytomegalovirus immediate early promoter or the U6snRNA
promoter) should be chosen to be a relatively strong promoter, and
expressible both in vitro and in vivo (e.g., the human
cytomegalovirus immediate early promoter or human beta actin
promoter). Such a promoter should express the ribozyme at a level
suitable to effect production of enough ribozyme to destroy a
target RNA, but not at too high a level to prevent other cellular
activities from occurring (unless cell death itself is
desired).
[0052] A hairpin at the 5' end of the ribozyme is useful to ensure
that the required transcription initiation sequence (GG or GGG or
GGGAG) does not bind to some other part of the ribozyme and thus
affect regulation of the transcription process. The 5' hairpin is
also useful to protect the ribozyme from 5'-3' exonucleases. A
selected hairpin at the 3' end of the ribozyme gene is useful since
it acts as a transcription termination signal, and protects the
ribozyme from 3'-5' exonuclease activity. One example of a known
termination signal is that present on the T7 RNA polymerase system.
This signal is about 30 nucleotides in length. Other 3' hairpins of
shorter length can be used to provide good termination and RNA
stability. Such hairpins can be inserted within the vector
sequences to allow standard ribozymes to be placed in an
appropriate orientation and expressed with such sequences
attached.
[0053] Poly(A) tails are also useful to protect the 3' end of the
ribozyme. These can be provided by either including a poly(A)
signal site in the expression vector (to signal a cell to add the
poly(A) tail in vivo), or by introducing a poly(A) sequence
directly into the expression vector. In the first approach the
signal must be located to prevent unwanted secondary structure
formation with other parts of the ribozyme. In the second approach,
the poly(A) stretch may reduce in size over time when expressed in
vivo, and thus the vector may need to be checked over time. Care
must be taken in addition of a poly(A) tail which binds poly(A)
binding proteins which prevent the ribozyme from acting.
[0054] Ribozyme Testing
[0055] Once the desired ribozymes are selected, synthesized and
purified, they are tested in kinetic and other experiments to
determine their utility. An example of such a procedure is provided
below.
[0056] Preparation of Ribozyme
[0057] Crude synthetic ribozyme (typically 350 .mu.g at a time) was
purified by separation on a 15% denaturing polyacrylamide gel (0.75
mm thick, 40 cm long) and visualized by UV shadowing. Once excised,
gel slices containing full length ribozyme were soaked in 5 ml gel
elution buffer (0.5 M NH.sub.4OAc, 1 mM EDTA) overnight with
shaking at 4.degree. C. The eluent was desalted over a C-18 matrix
(Sep-Pak cartridges, Millipore, Milford, MA) and vacuum dried. The
dried RNA was resuspended in 50-100 .mu.l TE (TRIS 10 mM, EDTA 1
mM, pH 7.2). An aliquot of this solution was diluted 100 fold into
1 ml TE, half of which was used to spectrophotometrically
quantitate the ribozyme solution. The concentration of this dilute
stock was typically 150-800 nM. Purity of the ribozyme was
confirmed by the presence of a single band on a denaturing
polyacrylamide gel.
[0058] A ribozyme may advantageously be synthesized in two or more
portions. (See Mamone, U.S. Ser. No. 07/882,689, filed May 11,
1992, hereby incorporated by reference herein.) Each portion of a
ribozyme will generally have only limited or no enzymatic activity,
and the activity will increase substantially (by at least 5-10
fold) when all portions are ligated (or otherwise juxtaposed)
together. A specific example of hammerhead ribozyme synthesis is
provided below.
[0059] The method involves synthesis of two (or more) shorter
"half" ribozymes and ligation of them together using T4 RNA ligase.
For example, to make a 34 mer ribozyme, two 17 mers are
synthesized, one is phosphorylated, and both are gel purified.
These purified 17 mers are then annealed to a DNA splint strand
complementary to the two 17 mers. (Such a splint is not always
necessary.) This DNA splint has a sequence designed to locate the
two 17 mer portions with one end of each adjacent each other. The
juxtaposed RNA molecules are then treated with T4 RNA ligase in the
presence of ATP. The 34 mer RNA so formed is then HPLC
purified.
[0060] Preparation of Substrates
[0061] Approximately 10-30 pmoles of unpurified substrate was
radioactively 5' end-labelled with T4 polynucleotide kinase using
25 pmoles of [.gamma.-.sup.32P] ATP. The entire labelling mix was
separated on a 20% denaturing polyacrylamide gel and visualized by
autoradiography. The full length band was excised and soaked
overnight at 4.degree. C. in 100 .mu.l of TE (10 mM Tris-HCl pH
7.6, 0.1 mM EDTA).
[0062] Kinetic Reactions
[0063] For reactions using short substrates (between 8 and 16
bases) a substrate solution was made 1X in assay buffer (75 mM
Tris-HCl, pH 7.6; 0.1 mM EDTA, 10 MM MgCl.sub.2) such that the
concentration of substrate was less than 1 nM. A ribozyme solution
(typically 20 nM) was made 1X in assay buffer and four dilutions
were made using 1X assay buffer. Fifteen .mu.l of each ribozyme
dilution (i.e., 20, 16, 12, 8 and 4 nM) was placed in a separate
tube. These tubes and the substrate tube were pre-incubated at
37.degree. C. for at least five minutes.
[0064] The reaction was started by mixing 15 .mu.l of substrate
into each ribozyme tube by rapid pipetting (note that final
ribozyme concentrations were 10, 8, 6, 4, 2 nM). 5 .mu.l aliquots
were removed at 15 or 30 second intervals and quenched with 5 .mu.l
stop solution (95% formamide, 20 mM EDTA xylene cyanol, and
bromphenol blue dyes). Following the final ribozyme time point, an
aliquot of the remaining substrate was removed as a zero ribozyme
control.
[0065] The samples were separated on either 15% or 20%
polyacrylamide gels. Each gel was visualized and quantitated with
an Ambis beta scanner (Ambis Systems, San Diego, Calif.).
[0066] For the most active ribozymes, kinetic analyses were
performed in substrate excess to determine K.sub.m and K.sub.cat
values.
[0067] For kinetic reactions with long RNA substrates (greater than
15 bases in length) the substrates were prepared by transcription
using T7 RNA polymerase and defined templates containing a T7
promoter, and DNA encoding appropriate nucleotides of the target
RNA. The substrate solution is made 1X in assay buffer (75 mM
Tris-HCl, pH 7.6; 0.1 mM EDTA; 10 mM MgCl.sub.2) and contains 58
nanomolar concentration of the long RNA molecules. The reaction is
started by addition of gel purified ribozymes to 1 .mu.M
concentration. Aliquots are removed at 20, 40, 60, 80 and 100
minutes, then quenched by the addition of 5 .mu.l stop solution.
Cleavage products are separated using denaturing PAGE. The bands
are visualized and quantitated with an Ambis beta scanner.
[0068] Kinetic Analysis
[0069] A simple reaction mechanism for ribozyme-mediated cleavage
is: 1
[0070] where R=ribozyme, S=substrate, and P=products. The boxed
step is important only in substrate excess. Because ribozyme
concentration is in excess over substrate concentration, the
concentration of the ribozyme-substrate complex ([R:S]) is constant
over time except during the very brief time when the complex is
being initially formed, i.e.,: 1 [ R : S ] t = 0
[0071] where t=time, and thus:
(R)(S)k.sub.1=(RS)(k.sub.2+k.sub.1)
[0072] The rate of the reaction is the rate of disappearance of
substrate with time: 2 Rate = - ( S ) t = k 2 ( R S )
[0073] Substituting these expressions: 3 ( R ) ( S ) k 1 = 1 / k 2
- ( S ) t ( k 2 + k 1 ) or : - ( S ) S = k 1 k 2 ( k 2 + k 1 ) ( R
) t
[0074] Integrating this expression with respect to time yields: 4 -
ln S S 0 = k 1 k 2 ( k 2 + k 1 ) ( R ) t
[0075] where S.sub.0=initial substrate. Therefore, a plot of the
negative log of fraction substrate uncut versus time (in minutes)
yields a straight line with slope: 5 slope = k 1 k 2 ( k 2 + k 1 )
( R ) = k obs
[0076] where k.sub.obs=observed rate constant. A plot of slope
(k.sub.obs) versus ribozyme concentration yields a straight line
with a slope which is: 6 slope = k 1 k 2 ( k 2 + k 1 ) which is k
cat K m
[0077] Using these equations the data obtained from the kinetic
experiments provides the necessary information to determine which
ribozyme tested is most useful, or active. Such ribozymes can be
selected and tested in in vivo or ex vivo systems.
[0078] Liposome Preparation
[0079] Lipid molecules are dissolved in a volatile organic solvent
(CHCl.sub.3, methanol, diethylether, ethanol, etc.). The organic
solvent is removed by evaporation. The lipid is hydrated into
suspension with 0.1.times.phosphate buffered saline (PBS), then
freeze-thawed 3.times. using liquid nitrogen and incubation at room
temperature. The suspension is extruded sequentially through a 0.4
.mu.m, 0.2 .mu.m and 0.1 .mu.m polycarbonate filters at maximum
pressure of 800 psi. The ribozyme is mixed with the extruded
liposome suspension and lyophilized to dryness. The lipid/ribozyme
powder is rehydrated with water to one-tenth the original volume.
The suspension is diluted to the minimum volume required for
extrusion,(0.4 ml for 1.5 ml barrel and 1.5 ml for 10 ml barrel)
with 1.times.PBS and re-extruded through 0.4 .mu.m, 0.2 .mu.m, 0.1
.mu.m polycarbonate filters. The liposome entrapped ribozyme is
separated from untrapped ribozyme by gel filtration chromatography
(SEPHAROSE CL-4B, BIOGEL A5M). The liposome extractions are pooled
and sterilized by filtration through a 0.2 .mu.m filter. The free
ribozyme is pooled and recovered by ethanol precipitation. The
liposome concentration is determined by incorporation of a
radioactive lipid. The ribozyme concentration is determined by
labeling with .sup.32P. Rossi et al., 1992 supra (and references
cited therein) describe other methods suitable for preparation of
liposomes.
[0080] In Vivo Assay
[0081] The efficacy of action of a chosen ribozyme may be tested in
vivo by use of transformed cells containing the target mRNA using
standard procedures.
[0082] Ribonuclease Protection Assay
[0083] The accumulation of target mRNA in cells or the cleavage of
the RNA by ribozymes or RNAseH (in vitro or in vivo) can be
quantified using an RNAse protection assay. (See McSwiggen, U.S.
Ser. Nos. 07/883,849 and 07/884,073, both filed May 14, 1992,
hereby incorporated by reference herein.)
[0084] In this method, antisense riboprobes are transcribed from
template DNA using T7 RNA polymerase (U.S. Biochemicals) in 20
.mu.l reactions containing 1.times. transcription buffer (supplied
by the manufacturer), 0.2 mM ATP, GTP and UTP, 1 U/.mu.l pancreatic
RNAse inhibitor (Boehringer Mannheim Biochemicals) and 200 .mu.Ci
.sup.32P-labeled CTP (800 Ci/mmol, New England Nuclear) for 1 hour
at 37.degree. C. Template DNA is digested with 1 U RNAse-free DNAse
I (U.S. Biochemicals, Cleveland, Ohio) at 37.degree. C. for 15
minutes and unincorporated nucleotides removed by G-50 SEPHADEX
spin chromatography.
[0085] In a manner similar to the transcription of antisense probe,
the target RNA can be transcribed in vitro using a suitable DNA
template. The transcript is purified by standard methods and
digested with ribozyme at 37.degree. C. according to methods
described later.
[0086] Alternatively, cells are harvested into 1 ml of PBS,
transferred to a 1.5 ml EPPENDORF tube, pelleted for 30 seconds at
low speed in a microcentrifuge, and lysed in 70 .mu.l of
hybridization buffer (4 M guanidine isothiocyanate, 0.1% sarcosyl,
25 mM sodium citrate, pH 7.5). Cell lysate (45 .mu.l) or defined
amounts of in vitro transcript (also in hybridization buffer) is
then combined with 5 .mu.l of hybridization buffer containing
5.times.10.sup.5 cpm of each antisense riboprobe in 0.5 ml
Eppendorf tubes, overlaid with 25 .mu.l mineral oil, and
hybridization accomplished by heating overnight at 55.degree. C.
The hybridization reactions are diluted into 0.5 ml RNAse solution
(20 U/ml RNAse A, 2 U/ml RNAse T1, 10 U/ml RNAse-free DNAse I in
0.4 M NaCl), heated for 30 minutes at 37.degree. C., and 10 .mu.l
of 20% SDS and 10 .mu.l of Proteinase K (10 mg/ml) added, followed
by an additional 30 minutes incubation at 37.degree. C. Hybrids are
partially purified by extraction with 0.5 ml of a 1:1 mixture of
phenol/chloroform; aqueous phases are combined with 0.5 ml
isopropanol, and RNAse-resistant hybrids pelleted for 10 minutes at
room temperature (about 20.degree. C.) in a microcentrifuge.
Pellets are dissolved in 10 .mu.l loading buffer (95% formamide,
1.times. TBE, 0.1% bromophenol blue, 0.1% xylene cylanol), heated
to 95.degree. C. for five minutes, cooled on ice, and analyzed on
4% polyacrylamide/7 M urea gels under denaturing conditions.
[0087] Ribozyme Stability
[0088] The chosen ribozyme can be tested to determine its
stability, and thus its potential utility. Such a test can also be
used to determine the effect of various chemical modifications
(e.g., addition of a poly(A) tail) on the ribozyme stability and
thus aid selection of a more stable ribozyme. For example, a
reaction mixture contains 1 to 5 pmoles of 5' (kinased) and/or 3'
labeled ribozyme, 15 .mu.g of cytosolic extract and 2.5 mM
MgCl.sub.2 in a total volume of 100 .mu.l. The reaction is
incubated at 37.degree. C. Eight .mu.l aliquots are taken at timed
intervals and mixed with 8 .mu.l of a stop mix (20 mM EDTA, 95%
formamide). Samples are separated on a 15% acrylamide sequencing
gel, exposed to film, and scanned with an Ambis.
[0089] A 3'-labelled ribozyme can be formed by incorporation of the
.sup.32P-labeled cordycepin at the 3' OH using poly(A) polymerase.
For example, the poly(A) polymerase reaction contains 40 mM Tris,
pH 8, 10 mM MgCl.sub.2, 250 mM NaCl, 2.5 mM MnCl.sub.2,; 3 .mu.l
p.sup.32 cordycepin, 500 Ci/mM; and 6 units poly(A) polymerase in a
total volume of 50 .mu.l. The reaction mixture is incubated for 30
minutes at 37.degree. C.
[0090] Effect of Base Substitution upon Ribozyme Activity
[0091] To determine which primary structural characteristics could
change ribozyme cleavage of substrate, minor base changes can be
made in the substrate cleavage region recognized by a specific
ribozyme. For example, the substrate sequences can be changed at
the central "C" nucleotide, changing the cleavage site from a GUC
to a GUA motif. (See McSwiggen, U.S. Ser. No. 07/884,074, filed May
14, 1992, hereby incorporated by reference herein.) The
K.sub.cat/K.sub.m values for cleavage using each substrate are then
analyzed to determine if such a change increases ribozyme cleavage
rates. Similar experiments can be performed to address the effects
of changing bases complementary to the ribozyme binding arms.
Changes predicted to maintain strong binding to the complementary
substrate are preferred. Minor changes in nucleotide content can
alter ribozyme/substrate interactions in ways which are
unpredictable based upon binding strength alone. Structures in the
catalytic core region of the ribozyme recognize trivial changes in
either substrate structure or the three dimensional structure of
the ribozyme/substrate complex.
[0092] To begin optimizing ribozyme design, the cleavage rates of
ribozymes containing varied arm lengths, but targeted to the same
length of short RNA substrate can be tested. Minimal arm lengths
are required and effective cleavage varies with ribozyme/substrate
combinations.
[0093] The cleavage activity of selected ribozymes can be assessed
using target mRNA substrates. The assays are performed in ribozyme
excess and approximate K.sub.cat/K.sub.min values obtained.
Comparison of values obtained with short and long substrates
indicates utility in vivo of a ribozyme.
[0094] Intracellular Stability of Liposome-delivered Ribozymes
[0095] To test the stability of a chosen ribozyme in vivo the
following test is useful. Ribozymes are .sup.32P-end labeled,
entrapped in liposomes and delivered to target mRNA-containing
cells for three hours. The cells are fractionated and ribozyme is
purified by phenol/chloroform extraction. Alternatively, cells
(1.times.10.sup.7) are cultured and washed twice with cold PBS. The
cells are homogenized by douncing 35 times in 4 ml of TSE (10 mM
Tris, pH 7.4, 0.25 M Sucrose, mM EDTA). Nuclei are pelleted at
100.times.g for 10 minutes. Subcellular organelles (the membrane
fraction) are pelleted at 200,000.times.g for two hours using an
SW60 rotor. The pellet is resuspended in 1 ml of H buffer (0.25 M
Sucrose, 50 mM HEPES, pH 7.4). The supernatant contains the
cytoplasmic fraction (in approximately 3.7 ml). The nuclear pellet
is resuspended in 1 ml of 65% sucrose in TM (50 mM Tris, pH 74.,
2.5 MM MgCl.sub.2) and banded on a sucrose step gradient (1 ml
nuclei in 65% sucrose TM, 1 ml 60% sucrose TM, 1 ml 55% sucrose TM,
50% sucrose TM, 300 ul 25% sucrose TM) for one hour at
37,000.times.g with an SW60 rotor. The nuclear band is harvested
and diluted to 10% sucrose with TM buffer. Nuclei are pelleted at
37,000.times.g using an SW60 rotor for 15 minutes and the pellet
resuspended in 1 ml of TM buffer. Aliquots are size fractionated on
denaturing polyacrylamide gels and the intracellular localization
determined. By comparison to the migration rate of newly
synthesized ribozyme, the various fraction containing intact
ribozyme can be determined.
[0096] To investigate modifications which would lengthen the
half-life of ribozyme molecules intracellularly, the cells may be
fractioned as above and the purity of each fraction assessed by
assaying enzyme activity known to exist in that fraction.
[0097] The various cell fractions are frozen at -70.degree. C. and
used to determine relative nuclease resistances of modified
ribozyme molecules. Ribozyme molecules may be synthesized with 5
phosphorothioate (ps), or 2' Omethyl (2'-OMe) modifications at each
end of the molecule. These molecules and a phosphodiester version
of the ribozyme are end-labeled with .sup.32P and ATP using T4
polynucleotide kinase. Equal concentrations are added to the cell
cytoplasmic extracts and aliquots of each taken at 10 min.
intervals. The samples are size fractionated by denaturing PAGE and
relative rates of nuclease resistance analyzed by scanning the gel
with an Ambis .beta.-scanner. The results show whether the
ribozymes are digested by the cytoplasmic extract, and which
versions are relatively more nuclease resistant. Modified ribozymes
generally maintain 80-90% of the catalytic activity of the native
ribozyme when short RNA substrates are employed.
[0098] Unlabeled, 5' end-labeled or 3' end-labeled ribozymes can be
used in the assays. These experiments can also be performed with
human cell extracts to verify the observations.
[0099] Administration of Ribozyme
[0100] Selected ribozymes can be administered prophylactically, or
to patients having Burkitt's lymphoma or pretumor cells, e.g., by
exogenous delivery of the ribozyme to an infected tissue by means
of an appropriate delivery vehicle, e.g., a liposome, a controlled
release vehicle, by use of iontophoresis, electroporation or ion
paired molecules, or covalently attached adducts, and other
pharmacologically approved methods of delivery. Routes of
administration include intramuscular, aerosol, oral (tablet or pill
form), topical, systemic, ocular, intraperitoneal and/or
intrathecal. Expression vectors for immunization with ribozymes
and/or delivery of ribozymes are also suitable.
[0101] The specific delivery route of any selected ribozyme will
depend on the use of the ribozyme. Generally, a specific delivery
program for each ribozyme will focus on unmodified ribozyme uptake
with regard to intracellular localization, followed by
demonstration of efficacy. Alternatively, delivery to these same
cells in an organ or tissue of an animal can be pursued. Uptake
studies will include uptake assays to evaluate cellular ribozyme
uptake, regardless of the delivery vehicle or strategy. Such assays
will also determine the intracellular localization of the ribozyme
following uptake, ultimately establishing the requirements for
maintenance of steady-state concentrations within the cellular
compartment containing the target sequence (nucleus and/or
cytoplasm). Efficacy and cytotoxicity can then be tested. Toxicity
will not only include cell viability but also cell function.
[0102] Some methods of delivery that may be used include:
[0103] a. encapsulation in liposomes,
[0104] b. transduction by retroviral vectors,
[0105] c. conjugation with cholesterol,
[0106] d. localization to nuclear compartment utilizing nuclear
targeting site found on most nuclear proteins,
[0107] e. neutralization of charge of ribozyme by using nucleotide
derivatives, and
[0108] f. use of blood stem cells to distribute ribozymes
throughout the body.
[0109] At least three types of delivery strategies are useful in
the present invention, including: ribozyme modifications, particle
carrier drug delivery vehicles, and retroviral expression vectors.
Unmodified ribozymes, like most small molecules, are taken up by
cells, albeit slowly. To enhance cellular uptake, the ribozyme may
be modified essentially at random, in ways which reduce its charge
but maintains specific functional groups. This results in a
molecule which is able to diffuse across the cell membrane, thus
removing the permeability barrier.
[0110] Modification of ribozymes to reduce charge is just one
approach to enhance the cellular uptake of these larger molecules.
The random approach, however, is not advisable since ribozymes are
structurally and functionally more complex than small drug
molecules. The structural requirements necessary to maintain
ribozyme catalytic activity are well understood by those in the
art. These requirements are taken into consideration when designing
modifications to enhance cellular delivery. The modifications are
also designed to reduce susceptibility to nuclease degradation.
Both of these characteristics should greatly improve the efficacy
of the ribozyme. Cellular uptake can be increased by several orders
of magnitude without having to alter the phosphodiester linkages
necessary for ribozyme cleavage activity.
[0111] Chemical modifications of the phosphate backbone will reduce
the negative charge allowing free diffusion across the membrane.
This principle has been successfully demonstrated for antisense DNA
technology. The similarities in chemical composition between DNA
and RNA make this a feasible approach. In the body, maintenance of
an external concentration will be necessary to drive the diffusion
of the modified ribozyme into the cells of the tissue.
Administration routes which allow the diseased tissue to be exposed
to a transient high concentration of the drug, which is slowly
dissipated by systemic adsorption are preferred. Intravenous
administration with a drug carrier designed to increase the
circulation half-life of the ribozyme can be used. The size and
composition of the drug carrier restricts rapid clearance from the
blood stream. The carrier, made to accumulate at the site of
infection, can protect the ribozyme from degradative processes.
[0112] Drug delivery vehicles are effective for both systemic and
topical administration. They can be designed to serve as a slow
release reservoir, or to deliver their contents directly to the
target cell. An advantage of using direct delivery drug vehicles is
that multiple molecules are delivered per uptake. Such vehicles
have been shown to increase the circulation half-life of drugs
which would otherwise be rapidly cleared from the blood stream.
Some examples of such specialized drug delivery vehicles which fall
into this category are liposomes, hydrogels, cyclodextrins,
biodegradable nanocapsules, and bioadhesive microspheres.
[0113] From this category of delivery systems, liposomes are
preferred. Liposomes increase intracellular stability, increase
uptake efficiency and improve biological activity.
[0114] Liposomes are hollow spherical vesicles composed of lipids
arranged in a similar fashion as those lipids which make up the
cell membrane. They have an internal aqueous space for entrapping
water soluble compounds and range in size from 0.05 to several
microns in diameter. Several studies have shown that liposomes can
deliver RNA to cells and that the RNA remains biologically
active.
[0115] For example, a liposome delivery vehicle originally designed
as a research tool, Lipofectin, has been shown to deliver intact
mRNA molecules to cells yielding production of the corresponding
protein.
[0116] Liposomes offer several advantages: They are non-toxic and
biodegradable in composition; they display long circulation
half-lives; and recognition molecules can be readily attached to
their surface for targeting to tissues. Finally, cost effective
manufacture of liposome-based pharmaceuticals, either in a liquid
suspension or lyophilized product, has demonstrated the viability
of this technology as an acceptable drug delivery system.
[0117] Other controlled release drug delivery systems, such as
nonoparticles and hydrogels may be potential delivery vehicles for
a ribozyme. These carriers have been developed for chemotherapeutic
agents and protein-based pharmaceuticals, and consequently, can be
adapted for ribozyme delivery.
[0118] Topical administration of ribozymes is advantageous since it
allows localized concentration at the site of administration with
slow, continuous systemic adsorption. This simplifies the delivery
strategy of the ribozyme to the disease site and reduces the extent
of toxicological characterization. Furthermore, the amount of
material to be applied is far less than that required for other
administration routes. Effective delivery requires the ribozyme to
diffuse into the infected cells. Chemical modification of the
ribozyme to neutralize negative charge may be all that is required
for penetration. However, in the event that charge neutralization
is insufficient, the modified ribozyme can be co-formulated with
permeability enhancers, such as Azone or oleic acid, in a liposome.
The liposomes can either represent a slow release presentation
vehicle in which the modified ribozyme and permeability enhancer
transfer from the liposome into the infected cell, or the liposome
phospholipids can participate directly with the modified ribozyme
and permeability enhancer in facilitating cellular delivery. In
some cases, both the ribozyme and permeability enhancer can be
formulated into a suppository formulation for slow release.
[0119] Ribozymes may also be systemically administered. Systemic
absorption refers to the accumulation of drugs in the blood stream
followed by distribution throughout the entire body. Administration
routes which lead to systemic absorption include: intravenous,
subcutaneous, intraperitoneal, intranasal, intrathecal and
ophthalmic. Each of these administration routes expose the ribozyme
to an accessible diseased tissue. Subcutaneous administration
drains into a localized lymph node which proceeds through the
lymphatic network into the circulation. The rate of entry into the
circulation has been shown to be a function of molecular weight or
size. The use of a liposome or other drug carrier localizes the
ribozyme at the lymph node. The ribozyme can be modified to diffuse
into the cell, or the liposome can directly participate in the
delivery of either the unmodified or modified ribozyme to the
cell.
[0120] A liposome formulation which can deliver oligonucleotides to
lymphocytes and macrophages is also useful for certain cancerous
conditions. This oligonucleotide delivery system prevents mRNA
expression in affected primary immune cells. Whole blood studies
show that the formulation is taken up by 90% of the lymphocytes
after 8 hours at 37.degree. C. Preliminary biodistribution and
pharmacokinetic studies yielded 70% of the injected dose/gm of
tissue in the spleen after one hour following intravenous
administration.
[0121] Liposomes injected intravenously show accumulation in the
liver, lung and spleen. The composition and size can be adjusted so
that this accumulation represents 30% to 40% of the injected dose.
The remaining dose circulates in the blood stream for up to 24
hours.
[0122] The chosen method of delivery should result in cytoplasmic
accumulation and molecules should have some nuclease-resistance for
optimal dosing. Nuclear delivery may be used but is less
preferable. Most preferred delivery methods include liposomes
(10-400 nm), hydrogels, controlled-release polymers, microinjection
or electroporation (for ex vivo treatments) and other
pharmaceutically applicable vehicles. The dosage will depend upon
the disease indication and the route of administration but should
be between 100-200 mg/kg of body weight/day. The duration of
treatment will extend through the course of the disease symptoms,
possibly continuously. The number of doses will depend upon disease
delivery vehicle and efficacy data from clinical trials.
[0123] Establishment of therapeutic levels of ribozyme within the
cell is dependent upon the rate of uptake and degradation.
Decreasing the degree of degradation will prolong the intracellular
half-life of the ribozyme. Thus, chemically modified ribozymes,
e.g., with modification of the phosphate backbone, or capping of
the 5' and 3' ends of the ribozyme with nucleotide analogs may
require different dosaging. Descriptions of useful systems are
provided in the art cited above, all of which is hereby
incorporated by reference herein.
[0124] The claimed ribozymes are also useful as diagnostic tools to
specifically or non-specifically detect the presence of a target
RNA in a sample. That is, the target RNA, if present in the sample,
will be specifically cleaved by the ribozyme, and thus can be
readily and specifically detected as smaller RNA species. The
presence of such smaller RNA species is indicative of the presence
of the target RNA in the sample.
[0125] Other embodiments are within the following claims.
* * * * *