U.S. patent application number 10/285696 was filed with the patent office on 2003-08-28 for cloned dna polymerases from thermotoga and mutants thereof.
This patent application is currently assigned to Invitrogen Corporation. Invention is credited to Chatterjee, Deb K., Hughes, A. John JR..
Application Number | 20030162201 10/285696 |
Document ID | / |
Family ID | 27569662 |
Filed Date | 2003-08-28 |
United States Patent
Application |
20030162201 |
Kind Code |
A1 |
Chatterjee, Deb K. ; et
al. |
August 28, 2003 |
Cloned DNA polymerases from Thermotoga and mutants thereof
Abstract
The invention relates to a substantially pure thermostable DNA
polymerase from Thermotoga (Tne and Tma) and mutants thereof. The
Tne DNA polymerase has a molecular weight of about 100 kilodaltons
and is more thermostable than Taq DNA polymerase. The mutant DNA
polymerase has at least one mutation selected from the group
consisting of (1) a first mutation that substantially reduces or
eliminates 3'.fwdarw.5' exonuclease activity of said DNA
polymerase; (2) a second mutation that substantially reduces or
eliminates 5'.fwdarw.3' exonuclease activity of said DNA
polymerase; (3) a third mutation in the O helix of said DNA
polymerase resulting in said DNA polymerase becoming
non-discriminating against dideoxynucleotides. The present
invention also relates to the cloning and expression of the wild
type or mutant DNA polymerases in E. coli, to DNA molecules
containing the cloned gene, and to host cells which express said
genes. The DNA polymerases of the invention may be used in
well-known DNA sequencing and amplification reactions.
Inventors: |
Chatterjee, Deb K.; (North
Potomac, MD) ; Hughes, A. John JR.; (Germantown,
MD) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Invitrogen Corporation
|
Family ID: |
27569662 |
Appl. No.: |
10/285696 |
Filed: |
November 1, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10285696 |
Nov 1, 2002 |
|
|
|
09238471 |
Jan 28, 1999 |
|
|
|
6506560 |
|
|
|
|
09238471 |
Jan 28, 1999 |
|
|
|
08706706 |
Sep 6, 1996 |
|
|
|
6015668 |
|
|
|
|
08706706 |
Sep 6, 1996 |
|
|
|
08689818 |
Aug 14, 1996 |
|
|
|
08689818 |
Aug 14, 1996 |
|
|
|
08537400 |
Oct 2, 1995 |
|
|
|
5939301 |
|
|
|
|
08537400 |
Oct 2, 1995 |
|
|
|
08370190 |
Jan 9, 1995 |
|
|
|
5912155 |
|
|
|
|
08370190 |
Jan 9, 1995 |
|
|
|
08316423 |
Sep 30, 1994 |
|
|
|
08576759 |
Dec 21, 1995 |
|
|
|
08537397 |
Oct 2, 1995 |
|
|
|
08537397 |
Oct 2, 1995 |
|
|
|
08525057 |
Sep 8, 1995 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/199; 435/252.3; 435/320.1; 435/69.1; 435/91.2; 536/23.2 |
Current CPC
Class: |
C12Q 1/6869 20130101;
C12Q 1/686 20130101; C12Q 2521/101 20130101; C12Q 2521/101
20130101; C12Y 207/07007 20130101; C12N 9/1252 20130101; C12Q 1/686
20130101; C12Q 1/6869 20130101 |
Class at
Publication: |
435/6 ; 435/69.1;
435/199; 435/91.2; 435/320.1; 435/252.3; 536/23.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34; C12N 009/22; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. A substantially pure Thermotoga neapolitana (Tne) DNA
polymerase.
2. The DNA polymerase of claim 1, which is isolated from Thermotoga
neapolitana.
3. The DNA polymerase of claim 2, which is isolated from Thermotoga
neapolitana DSM 5068 and said DNA polymerase has a molecular weight
of about 100 kilodaltons.
4. The DNA polymerase of claim 1 having the amino acid sequence of
SEQ ID NO:3.
5. A Tne DNA polymerase mutant which is modified at least one way
selected from the group consisting of (a) to reduce or eliminate
the 3'.fwdarw.5' exonuclease activity of the polymerase; (b) to
reduce or eliminate the 5'.fwdarw.3' exonuclease activity of the
polymerase; and (c) to reduce or eliminate discriminatory behavior
against a dideoxynucleotide.
6. The DNA polymerase mutant of claim 5, which is modified at least
two ways.
7. The DNA polymerase mutant of claim 5, which is modified three
ways.
8. The Tne DNA polymerase mutant of claim 5 which comprises a
mutation in the O-helix of said DNA polymerase resulting in said
DNA polymerase becoming non-discriminating against
dideoxynucleotides.
9. The DNA polymerase of claim 8, wherein said O-helix is defined
as RXXXKXXXFXXXYX, wherein X is any amino acid.
10. The Tne DNA polymerase as claimed in claim 10, wherein said
mutation is a Phe.sup.730.fwdarw.Tyr.sup.730 substitution.
11. The Tne DNA polymerase of claim 5, wherein said DNA polymerase
is a Tne DNA polymerase having substantially reduced 3'.fwdarw.5'
exonuclease activity.
12. The mutant Tne DNA polymerase as claimed in claim 11, wherein
said mutant is a Asp.sup.323.fwdarw.Ala.sup.323 substitution.
13. The mutant Tne DNA polymerase as claimed in claim 5, wherein
said mutant polymerase comprises both a
Phe.sup.730.fwdarw.Tyr.sup.730 substitution and a
Asp.sup.323.fwdarw.Ala.sup.323 substitution.
14. The mutant DNA polymerase mutant of claim 5, wherein said DNA
polymerase is a Tne DNA polymerase having substantially reduced
5'.fwdarw.3' exonuclease activity.
15. The mutant Tne DNA polymerase as claimed in claim 14, wherein
said mutant polymerase has a deletion mutation in the N-terminal
5'.fwdarw.3' exonuclease domain.
16. The mutant Tne DNA polymerase as claimed in claim 15, wherein
said mutant polymerase is devoid of the 219 N-terminal amino
acids.
17. A vector comprising a gene encoding the DNA polymerase of any
one of claims 1 or 5.
18. The vector of claim 17, wherein said gene is operably linked to
a promoter.
19. The vector of claim 18, wherein said promoter is selected from
the group consisting of a .lambda.-P.sub.L promoter, a tac
promoter, a trp promoter, and a trc promoter.
20. A host cell comprising the vector of claim 17.
21. A method of producing a DNA polymerase, said method comprising:
(a) culturing the host cell of claim 20; (b) expressing said gene;
and (c) isolating said DNA polymerase from said host cell.
22. The method of claim 21, wherein said host cell is E. coli.
23. A method of synthesizing a double-stranded DNA molecule
comprising: (a) hybridizing a primer to a first DNA molecule; and
(b) incubating said DNA molecule of step (a) in the presence of one
or more deoxy- or dideoxyribonucleoside triphosphates and the DNA
polymerase of any one of claims 1 or 5, under conditions sufficient
to synthesize a second DNA molecule complementary to all or a
portion of said first DNA molecule.
24. The method of claim 21, wherein said deoxy- or
dideoxyribonucleoside triphosphates are selected from the group
consisting of dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP,
ddATP, ddCTP, ddGTP, ddlTP, ddTTP, [.alpha.-S]dATP,
[.alpha.-S]dTTP, [.alpha.-S]dGTP, and [.alpha.-S]dCTP.
25. The method of claim 23, wherein one or more of said deoxy- or
dideoxyribonucleoside triphosphates are detectably labeled. (a) A
method of sequencing a DNA molecule, comprising: (a) hybridizing a
primer to a first DNA molecule; (b) contacting said DNA molecule of
step (a) with deoxyribonucleoside triphosphates, the DNA polymerase
of any one of claims 1 or 5, and a terminator nucleotide; (c)
incubating the mixture of step (b) under conditions sufficient to
synthesize a random population of DNA molecules complementary to
said first DNA molecule, wherein said synthesized DNA molecules are
shorter in length than said first DNA molecule and wherein said
synthesized DNA molecules comprise a terminator nucleotide at their
5'termini; and (d) separating said synthesized DNA molecules by
size so that at least a part of the nucleotide sequence of said
first DNA molecule can be determined.
26. The method of claim 26, wherein said deoxyribonucleoside
triphosphates are selected from the group consisting of dATP, dCTP,
dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP, [.alpha.-S]dATP,
[.alpha.-S]dTTP, [.alpha.-S]dGTP, and [.alpha.-S]dCTP.
27. The method of claim 26, wherein said terminator nucleotide is
ddTTP, ddATP, ddGTP, ddITP or ddCTP.
28. The method of claim 26, wherein one or more of said
deoxyribonucleoside triphosphates is detectably labeled.
29. The method of claim 26, wherein one or more of said terminator
nucleotides is detectably labeled.
30. A method for amplifying a double stranded DNA molecule,
comprising: (a) providing a first and second primer, wherein said
first primer is complementary to a sequence at or near the
3'-termini of the first strand of said DNA molecule and said second
primer is complementary to a sequence at or near the 3'-termini of
the second strand of said DNA molecule; (b) hybridizing said first
primer to said first strand and said second primer to said second
strand in the presence of the DNA polymerase of any one of claims 1
or 5, under conditions such that a third DNA molecule complementary
to said first strand and a fourth DNA molecule complementary to
said second strand are synthesized; (c) denaturing said first and
third strand, and said second and fourth strands; and (d) repeating
steps (a) to (c) one or more times.
31. The method of claim 31, wherein said deoxyribonucleoside
triphosphates are selected from the group consisting of dATP, dCTP,
dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP, [.alpha.-S]dATP,
[.alpha.-S]dTTP, [.alpha.-S]dGTP, and [.alpha.-S]dCTP.
32. A kit for sequencing a DNA molecule, comprising: (a) a first
container means comprising the DNA polymerase of any one of claims
1 or 5; (b) a second container means comprising one or more
dideoxyribonucleoside triphosphates; and (c) a third container
means comprising one or more deoxyribonucleoside triphosphates.
33. A kit for amplifying a DNA molecule, comprising: (a) a first
container means comprising the DNA polymerase of any one of claims
1 or 5; and (b) a second container means comprising one or more
deoxyribonucleoside triphosphates.
34. A mutant Tne DNA polymerase having substantially reduced or
eliminated 5'-3' exonuclease activity, wherein at least one of the
amino acids corresponding to Asp.sup.8, Glu.sup.112, Asp.sup.114,
Asp.sup.115, Asp.sup.137, Asp.sup.139, Gly.sup.102, Gly.sup.187, or
Gly.sup.195 has been mutated.
35. A vector coding for the mutant DNA polymerase of claim 35.
36. A host cell comprising the vector of claim 36.
37. A method of producing a mutant Tne DNA polymerase having
substantially reduced or eliminated 5'-3' exonuclease activity,
wherein at least one of the amino acids corresponding to Asp.sup.8,
Glu.sup.112, Asp.sup.114, Asp.sup.115, Asp.sup.137, Asp.sup.139,
Gly.sup.102, Gly.sup.187, or Gly.sup.195 has been mutated,
comprising (a) culturing the host cell of claim 37; (b) expressing
the mutant DNA polymerase; amd (c) isolating said mutant DNA
polymerase.
38. A method of preparing cDNA from mRNA, comprising (a) contacting
mRNA with an oligo(dT) primer or other complementary primer to form
a hybrid, and (b) contacting said hybrid formed in step (a) with
the Tne DNA polymerase or mutant of claim 1 or 5 and dATP, dCTP,
dGTP and dTTP, whereby a cDNA-RNA hybrid is obtained.
39. A method of preparing dsDNA from mRNA, comprising (a)
contacting mRNA with an oligo(dT) primer or other complementary
primer to form a hybrid, and (b) contacting said hybrid formed in
step (a) with the Tne DNA polymerase or mutant of claim 1 or 5,
dATP, dCTP, dGTP and dTTP, and an oligonucleotide or primer which
is complementary to the first strand cDNA; whereby dsDNA is
obtained.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation-in-part of U.S. application Ser. No.
08/______, filed Aug. 14, 1996, pending, which is a
continuation-in-part of U.S. application Ser. No. 08/537,400, filed
Oct. 2, 1995, pending, which is a continuation-in-part of U.S.
application Ser. No. 08/370,190, filed Jan. 9, 1995, pending, which
is a continuation-in-part of U.S. application Ser. No. 08/316,423,
filed Sep. 30, 1994, now abandoned. This is also a
continuation-in-part of U.S. application Ser. No. 08/576,759, filed
Dec. 21, 1995, which is a continuation of U.S. application Ser. No.
08/537,397, filed Oct. 2, 1995, which is a continuation-in-part of
U.S. application Ser. No. 08/525,057, filed Sep. 8, 1995. The
contents of each of these applications are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to a substantially pure
thermostable DNA polymerase. Specifically, the DNA polymerase of
the present invention is a Thermotoga DNA polymerase and more
specifically a Thermotoga neapolitana (Tne) DNA polymerase or
Thermotoga maritima (Tma) DNA polymerase. Preferably, the
polymerase has a molecular weight of about 100 kilodaltons. The
present invention also relates to the cloning and expression of the
Thermotoga DNA polymerase in E. coli, to DNA molecules containing
the cloned gene, and to hosts which express said genes. The DNA
polymerase of the present invention may be used in DNA sequencing,
amplification reactions, and cDNA synthesis.
[0004] This invention also relates to mutants of the Thermotoga DNA
polymerase, including Tne and Tma DNA polymerase. Specifically, the
DNA polymerases of the present invention have mutations which
substantially reduce 3'.fwdarw.5' exonuclease activity; mutations
resulting in the ability of the mutant DNA polymerase to
incorporate dideoxynucleotides into a DNA molecule about as
efficiently as deoxynucleotides; and mutations which substantially
reduce 5'.fwdarw.3' exonuclease activity. The Thermotoga (e.g., Tne
and Tma) mutant DNA polymerase of this invention can have one or
more of these properties. These DNA polymerase mutants may also be
used in DNA sequencing, amplification reactions, and cDNA
synthesis.
[0005] The present invention is also directed to novel mutants of
other DNA polymerases which have substantially reduced 5'-3'
exonuclease activity.
[0006] 2. Background Information
[0007] DNA polymerases synthesize the formation of DNA molecules
which are complementary to a DNA template. Upon hybridization of a
primer to the single-stranded DNA template, polymerases synthesize
DNA in the 5' to 3' direction, successively adding nucleotides to
the 3'-hydroxyl group of the growing strand. Thus, in the presence
of deoxyribonucleoside triphosphates (dNTPs) and a primer, a new
DNA molecule, complementary to the single stranded DNA template,
can be synthesized.
[0008] A number of DNA polymerases have been isolated from
mesophilic microorganisms such as E. coli. A number of these
mesophilic DNA polymerases have also been cloned. Lin et al. cloned
and expressed T4 DNA polymerase in E. coli (Proc. Natl. Acad. Sci.
USA 84:7000-7004 (1987)). Tabor et al. (U.S. Pat. No. 4,795,699)
describes a cloned T7 DNA polymerase, while Minkley et al. (J.
Biol. Chem. 259:10386-10392 (1984)) and Chatterjee (U.S. Pat. No.
5,047,342) described E. coli DNA polymerase I and the cloning of T5
DNA polymerase, respectively.
[0009] Although DNA polymerases from thermophiles are known,
relatively little investigation has been done to isolate and even
clone these enzymes. Chien et al., J. Bacteriol. 127:1550-1557
(1976) describe a purification scheme for obtaining a polymerase
from Thermus aquaticus (Taq). The resulting protein had a molecular
weight of about 63,000 daltons by gel filtration analysis and
68,000 daltons by sucrose gradient centrifugation. Kaledin et al.,
Biokhymiya 45:644-51 (1980) disclosed a purification procedure for
isolating DNA polymerase from T. aquaticus YT1 strain. The purified
enzyme was reported to be a 62,000 dalton monomeric protein.
Gelfand et al. (U.S. Pat. No. 4,889,818) cloned a gene encoding a
thermostable DNA polymerase from Thermus aquaticus. The molecular
weight of this protein was found to be about 86,000 to 90,000
daltons.
[0010] Simpson et al. purified and partially characterized a
thermostable DNA polymerase from a Thermotoga species (Biochem.
Cell. Biol. 86:1292-1296 (1990)). The purified DNA polymerase
isolated by Simpson et al. exhibited a molecular weight of 85,000
daltons as determined by SDS-polyacrylamide gel electrophoresis and
size-exclusion chromatography. The enzyme exhibited half-lives of 3
minutes at 95.degree. C. and 60 minutes at 50.degree. C. in the
absence of substrate and its pH optimum was in the range of pH 7.5
to 8.0. Triton X-100 appeared to enhance the thermostability of
this enzyme. The strain used to obtain the thermostable DNA
polymerase described by Simpson et al. was Thermotoga species
strain FjSS3-B.1 (Hussar et al., FEMS Microbiology Letters
37:121-127 (1986)). Others have cloned and sequenced a thermostable
DNA polymerase from Thermotoga maritima (U.S. Pat. No. 5,374,553,
which is expressly incorporated herein by reference).
[0011] Other DNA polymerases have been isolated from thermophilic
bacteria including Bacillus steraothermophilus (Stenesh et al.,
Biochim. Biophys. Acta 272:156-166 (1972); and Kaboev et al., J.
Bacteriol. 145:21-26 (1981)) and several archaebacterial species
(Rossi et al., System. Appl. Microbiol. 7:337-341 (1986); Klimczak
et al., Biochemistry 25:4850-4855 (1986); and Elie et al., Eur. J.
Biochem. 178:619-626 (1989)). The most extensively purified
archaebacterial DNA polymerase had a reported half-life of 15
minutes at 87.degree. C. (Elie et al. (1989), supra). Innis et al.,
In PCR Protocol: A Guide To Methods and Amplification, Academic
Press, Inc., San Diego (1990) noted that there are several extreme
thermophilic eubacteria and archaebacteria that are capable of
growth at very high temperatures (Bergquist et al., Biotech. Genet.
Eng. Rev. 5:199-244 (1987); and Kelly et al., Biotechnol. Prog.
4:47-62 (1988)) and suggested that these organisms may contain very
thermostable DNA polymerases.
[0012] In many of the known polymerases, the 5'.fwdarw.3'
exonuclease activity is present in the N-terminal region of the
polymerase. (Ollis, et al., Nature 313:762-766 (1985); Freemont et
al., Proteins 1:66-73 (1986); Joyce, Cur. Opin. Struct. Biol.
1:123-129 (1991).) There are some amino acids, the mutation of
which are thought to impair the 5'.fwdarw.3' exonuclease activity
of E. coli DNA polymerase I. (Gutman & Minton, Nucl. Acids Res.
21:4406-4407 (1993).) These amino acids include Tyr.sup.77,
Gly.sup.103, Gly.sup.184, and Gly.sup.192 in E. coli DNA polymerase
I. It is known that the 5'-exonuclease domain is dispensable. The
best known example is the Klenow fragment of E. coli polymerase I.
The Klenow fragment is a natural proteolytic fragment devoid of
5'-exonuclease activity (Joyce et. al., J. Biol. Chem. 257:1958-64
(1990).) Polymerases lacking this activity are useful for DNA
sequencing.
[0013] Most DNA polymerases also contain a 3'.fwdarw.5' exonuclease
activity. This exonuclease activity provides a proofreading ability
to the DNA polymerase. A T5 DNA polymerase that lacks 3'.fwdarw.5'
exonuclease activity is disclosed in U.S. Pat. No. 5,270,179.
Polymerases lacking this activity are particularly useful for DNA
sequencing.
[0014] The polymerase active site, including the dNTP binding
domain is usually present at the carboxyl terminal region of the
polymerase (Ollis et al., Nature 313:762-766 (1985); Freemont et
al., Proteins 1:66-73 (1986)). It has been shown that Phe.sup.762
of E. coli polymerase I is one of the amino acids that directly
interacts with the nucleotides (Joyce & Steitz, Ann. Rev.
Biochem. 63:777-822 (1994); Astatke, J. Biol. Chem. 270:1945-54
(1995)). Converting this amino acid to a Tyr results in a mutant
DNA polymerase that does not discriminate against
dideoxynucleotides. See copending U.S. application Ser. No.
08/525,087, of Deb K. Chatterjee, filed Sep. 8, 1995, entitled
"Mutant DNA Polymerases and the Use Thereof," which is expressly
incorporated herein by reference.
[0015] Thus, there exists a need in the art to develop more
thermostable DNA polymerases. There also exists a need in the art
to obtain wild type or mutant DNA polymerases that are devoid of
exonuclease activities and are non-discriminating against
dideoxynucleotides.
SUMMARY OF THE INVENTION
[0016] The present invention satisfies these needs in the art by
providing additional DNA polymerases useful in molecular biology.
Specifically, this invention includes a thermostable DNA
polymerase. Preferably, the polymerase has a molecular weight of
about 100 kilodaltons. Specifically, the DNA polymerase of the
invention is isolated from Thermotoga, and more specifically, the
DNA polymerase is obtained from Thermotoga neapolitana (Tne) and
Thermotoga maritima (Tma). The Thermotoga species preferred for
isolating the DNA polymerase of the present invention was isolated
from an African continental solfataric spring (Windberger et al.,
Arch. Microbiol. 151. 506-512, (1989)).
[0017] The Thermotoga DNA polymerases of the present invention are
extremely thermostable, showing more than 50% of activity after
being heated for 60 minutes at 90.degree. C. with or without
detergent. Thus, the DNA polymerases of the present invention is
more thermostable than Taq DNA polymerase.
[0018] The present invention is also directed to cloning a gene
encoding a Thermotoga DNA polymerase enzyme. DNA molecules
containing the Thermotoga DNA polymerase genes, according to the
present invention, can be transformed and expressed in a host cell
to produce the DNA polymerase. Any number of hosts may be used to
express the Thermotoga DNA polymerase gene of the present
invention; including prokaryotic and eukaryotic cells. Preferably,
prokaryotic cells are used to express the DNA polymerase of the
invention. The preferred prokaryotic host according to the present
invention is E. coli.
[0019] The present invention also relates mutant thermostable DNA
polymerases of the PolI type and DNA coding therefor, wherein there
is amino acid change in the O-helix which renders the polymerase
nondiscriminatory against ddNTPs in sequencing reactions. The
O-helix is defined as RXXXKXXXFXXXYX, wherein X is any amino
acid.
[0020] The present invention also relates to Thermotoga DNA
polymerase mutants that lack exonuclease activity and/or which are
nondiscriminatory against ddNTPs in sequencing reactions.
[0021] The present invention is also directed generally to DNA
polymerases that have mutations that result in substantially
reduced or missing 5'.fwdarw.3' exonuclease activity.
[0022] In particular, the invention relates to a Thermotoga DNA
polymerase mutant which is modified at least one way selected from
the group consisting of
[0023] (a) to reduce or eliminate the 3'-5' exonuclease activity of
the polymerase;
[0024] (b) to reduce or eliminate the 5'-3' exonuclease activity of
the polymerase; and
[0025] (c) to reduce or eliminate discriminatory behavior against a
dideoxynucleotide.
[0026] The invention also relates to a method of producing a DNA
polymerase, said method comprising:
[0027] (a) culturing the host cell of the invention;
[0028] (b) expressing said gene; and
[0029] (c) isolating said DNA polymerase from said host cell.
[0030] The invention also relates to a method of synthesizing a
double-stranded DNA molecule comprising:
[0031] (a) hybridizing a primer to a first DNA molecule; and
[0032] (b) incubating said DNA molecule of step (a) in the presence
of one or more deoxy- or dideoxyribonucleoside triphosphates and
the DNA polymerase of the invention, under conditions sufficient to
synthesize a second DNA molecule complementary to all or a portion
of said first DNA molecule. Such deoxy- and dideoxyribonucleoside
triphosphates include dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP,
7-deaza-dATP, dUTP, ddATP, ddCTP, ddGTP, ddlTP, ddTTP,
[.alpha.-S]dATP, [.alpha.-S]dTTP, [.alpha.-S]dGTP, and
[.alpha.-S]dCTP.
[0033] The invention also relates to a method of sequencing a DNA
molecule, comprising:
[0034] (a) hybridizing a primer to a first DNA molecule;
[0035] (b) contacting said DNA molecule of step (a) with
deoxyribonucleoside triphosphates, the DNA polymerase of the
invention, and a terminator nucleotide;
[0036] (c) incubating the mixture of step (b) under conditions
sufficient to synthesize a random population of DNA molecules
complementary to said first DNA molecule, wherein said synthesized
DNA molecules are shorter in length than said first DNA molecule
and Wherein said synthesized DNA molecules comprise a terminator
nucleotide at their 3' termini; and
[0037] (d) separating said synthesized DNA molecules by size so
that at least a part of the nucleotide sequence of said first DNA
molecule can be determined. Such terminator-nucleotides include
ddTTP, ddATP, ddGTP, ddITP or ddCTP.
[0038] The invention also relates to a method for amplifying a
double stranded DNA molecule, comprising:
[0039] (a) providing a first and second primer, wherein said first
primer is complementary to a sequence at or near the 3'-termini of
the first strand of said DNA molecule and said second primer is
complementary to a sequence at or near the 3'-termini of the second
strand of said DNA molecule;
[0040] (b) hybridizing said first primer to said first strand and
said second primer to said second strand in the presence of the DNA
polymerase of the invention, under conditions such that a third DNA
molecule complementary to said first strand and a fourth DNA
molecule complementary to said second strand are synthesized;
[0041] (c) denaturing said first and third strand, and said second
and fourth strands; and
[0042] (d) repeating steps (a) to (c) one or more times.
[0043] The invention also relates to a kit for sequencing a DNA
molecule, comprising:
[0044] (a) a first container means comprising the DNA polymerase of
the invention;
[0045] (b) a second container means comprising one or more
dideoxyribonucleoside triphosphates; and
[0046] (c) a third container means comprising one or more
deoxyribonucleoside triphosphates.
[0047] The invention also relates to a kit for amplifying a DNA
molecule, comprising:
[0048] (a) a first container means comprising the DNA polymerase of
the invention; and
[0049] (b) a second container means comprising one or more
deoxyribonucleoside triphosphates.
[0050] The present invention also relates to a mutant DNA
polymerase having substantially-reduced or eliminated 5'-3'
exonuclease activity, wherein at least one of the amino acids
corresponding to Asp.sup.8, Glu.sup.112, Asp.sup.114, Asp.sup.115,
Asp.sup.137, Asp.sup.139, Gly.sup.102, Gly.sup.187, or Gly.sup.195
of Tne DNA polymerase has been mutated.
[0051] The present invention also relates to a method of producing
a mutant DNA polymerase having substantially reduced or eliminated
5'-3' exonuclease activity, wherein at least one of the amino acids
corresponding to Asp.sup.8, Glu.sup.112, Asp.sup.114, Asp.sup.115,
Asp.sup.137, Asp.sup.139, Gly.sup.102, Gly.sup.187, or Gly.sup.195
of Tne DNA polymerase has been mutated, comprising:
[0052] (a) culturing the host cell of the invention;
[0053] (b) expressing the mutant DNA polymerase; and
[0054] (c) isolating said mutant DNA polymerase.
BRIEF DESCRIPTION OF THE FIGURES
[0055] FIG. 1 demonstrates the heat stability of Tne DNA polymerase
at 90.degree. C. over time. Partially purified DNA polymerase from
the crude extract of Thermotoga neapolitana cells was used in the
assay.
[0056] FIG. 2 shows the time-dependent DNA polymerase activity of
Tne DNA polymerase isolated from an E. coli host containing the
cloned Tne DNA polymerase gene.
[0057] FIG. 3 compares the ability of various DNA polymerases to
incorporate radioactive dATP and [.alpha.S]dATP. Tne DNA polymerase
is more effective at incorporating [.alpha.S]dATP than was Taq DNA
polymerase.
[0058] FIG. 4 shows the restriction map of the approximate DNA
fragment which contains the Tne DNA polymerase gene in pSport 1 and
pUC19. This figure also shows the region containing the O-helix
homologous sequences.
[0059] FIGS. 5A and 5B shows the nucleotide and deduced amino acid
sequences, in all 3 reading frames, for the carboxyl terminal
portion, including the O-helix region, of the Thermotoga
neapolitana polymerase gene.
[0060] FIG. 6A schematically depicts the construction of plasmids
pUC-Tne (3'.fwdarw.5') and pUC-Tne FY.
[0061] FIG. 6B schematically depicts the construction of plasmids
pTrc Tne35 and pTrcTne FY.
[0062] FIG. 7 schematically depicts the construction of plasmid
pTrcTne35 FY.
[0063] FIG. 8 schematically depicts the construction of plasmid
pTTQTne5 FY and pTTQTne535FY.
[0064] FIG. 9 depicts a gel containing two sequencing reaction sets
showing the efficient .sup.35S incorporation by Tne DNA polymerase
of Example 12. Alkali-denatured pUC19 DNA was sequenced with Tne
DNA polymerase in set A. M13 mp19(+) DNA was sequenced in set
B.
[0065] FIG. 10 depicts a gel containing three sequencing reaction
sets showing that the mutant Tne DNA polymerase of Example 12
generates clear sequence from plasmids containing cDNAs with
poly(dA) tails. Alkali-denatured plasmid DNAs containing cDNA
inserts were sequenced using either Tne DNA polymerase (sets A and
B), or Sequenase Ver 2.0 (set C).
[0066] FIG. 11 depicts a gel containing three sequencing reaction
sets that compare the mutant Tne DNA polymerase of Example 12 (set
A), Sequenase.TM. (set B) and Taq DNA polymerase (set C) generated
sequences from a plasmid containing poly(dC).
[0067] FIG. 12 depicts a gel containing three sequencing reaction
sets showing that the mutant Tne DNA polymerase of Example 12 (set
A) produces .sup.35S-labeled sequence 3-fold stronger than Thermo
Sequenase.TM. (set B) and without the uneven band intensities
obtained with Taq DNA polymerase (set C).
[0068] FIG. 13 depicts a gel containing four sequencing reaction
sets demonstrating that the mutant Tne DNA polymerase of Example 12
produces high quality sequences of in vitro amplified DNA (set A,
E. coli .beta. poll (.about.450 bp); set B, E. coli rrsE
(.about.350 bp); set C, ori from pSC101 (.about.1.5 kb); and set D,
an exon from human HSINF gene (.about.750 bp).
[0069] FIGS. 14A and 14B depict gels containing three and four
sequencing reaction sets, respectively, showing that the mutant Tne
DNA polymerase of Example 12 provides superior sequence from
double-stranded DNA clones containing poly(dA) or poly(dC)
stretches. FIG. 14A, supercoiled plasmid DNAs containing inserts
with homopolymers were cycle sequenced using the mutant Tne DNA
polymerase (set A, RPA1; set B, elf (cap binding protein); and set
C, a poly(dC)-tailed 5' RACE-derived insert). FIG. 14B, supercoiled
plasmid DNAs containing inserts with homopolymers were cycled
sequenced using Taq DNA polymerase (set D), or SequiTherm.TM. (sets
E-G) (set D, RPA; set E, RPA; set F, a poly(dC)-tailed 5'
RACE-derived insert; and set G, elf).
[0070] FIG. 15 depicts a gel containing two sequencing reaction
sets showing cycle sequencing using the mutant Tne DNA polymerase
of Example 12 and .sup.32P end-labeled primer.
[0071] FIGS. 16A-16C and 16D-16F depict two sets of chromatograms
showing comparison of the mutant Tne DNA polymerase of Example 12
(16A-16C) to AmpliTaq FS.TM. (16D-16F) in Fluorescent Dye Primer
Sequencing.
[0072] FIGS. 17A-17C and 17D-17F depict chromatograms showing a
comparison of the mutant Tne DNA polymerase of Example 12 (17A) to
AmpliTaq FS.TM. (17B) in Fluorescent Dye Terminator Sequencing.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0073] Definitions
[0074] In the description that follows, a number of terms used in
recombinant DNA technology are extensively utilized. In order to
provide a clearer and consistent understanding of the specification
and claims, including the scope to be given such terms, the
following definitions are provided.
[0075] Cloning vector. A plasmid, cosmid or phage DNA or other DNA
molecule which is able to replicate autonomously in a host cell,
and which is characterized by one or a small number of restriction
endonuclease recognition sites at which such DNA sequences may be
cut in a determinable fashion without loss of an essential
biological function of the vector, and into which DNA may be
spliced in order to bring about its replication and cloning. The
cloning vector may further contain a marker suitable for use in the
identification of cells transformed with the cloning vector.
Markers, for example, are tetracycline resistance or ampicillin
resistance.
[0076] Expression vector. A vector similar to a cloning vector but
which is capable of enhancing the expression of a gene which has
been cloned into it, after transformation into a host. The cloned
gene is usually placed under the control of (i.e., operably linked
to) certain control sequences such as promoter sequences.
[0077] Recombinant host. Any prokaryotic or eukaryotic or
microorganism which contains the desired cloned genes in an
expression vector, cloning vector or any DNA molecule. The term
"recombinant host" is also meant to include those host cells which
have been genetically engineered to contain the desired gene on the
host chromosome or genome.
[0078] Host. Any prokaryotic or eukaryotic microorganism that is
the recipient of a replicable expression vector, cloning vector or
any DNA molecule. The DNA molecule may contain, but is not limited
to, a structural gene, a promoter and/or an origin of
replication.
[0079] Promoter. A DNA sequence generally described as the 5'
region of a gene, located proximal to the start codon. At the
promoter region, transcription of an adjacent gene(s) is
initiated.
[0080] Gene. A DNA sequence that contains information necessary for
expression of a polypeptide or protein. It includes the promoter
and the structural gene as well as other sequences involved in
expression of the protein.
[0081] Structural gene. A DNA sequence that is transcribed into
messenger RNA that is then translated into a sequence of amino
acids characteristic of a specific polypeptide.
[0082] Operably linked. As used herein means that the promoter is
positioned to control the initiation of expression of the
polypeptide encoded by the structural gene.
[0083] Expression. Expression is the process by which a gene
produces a polypeptide. It includes transcription of the gene into
messenger RNA (mRNA) and the translation of such mRNA into
polypeptide(s).
[0084] Substantially Pure. As used herein "substantially pure"
means that the desired purified protein is essentially free from
contaminating cellular contaminants which are associated with the
desired protein in nature. Contaminating cellular components may
include, but are not limited to, phosphatases, exonucleases,
endonucleases or undesirable DNA polymerase enzymes.
[0085] Primer. As used herein "primer" refers to a single-stranded
oligonucleotide that is extended by covalent bonding of nucleotide
monomers during amplification or polymerization of a DNA
molecule.
[0086] Template. The term "template" as used herein refers to a
double-stranded or single-stranded DNA molecule which is to be
amplified, synthesized or sequenced. In the case of a
double-stranded DNA molecule, denaturation of its strands to form a
first and a second strand is performed before these molecules may
be amplified, synthesized or sequenced. A primer, complementary to
a portion of a DNA template is hybridized under appropriate
conditions and the DNA polymerase of the invention may then
synthesize a DNA molecule complementary to said template or a
portion thereof. The newly synthesized DNA molecule, according to
the invention, may be equal or shorter in length than the original
DNA template. Mismatch incorporation during the synthesis or
extension of the newly synthesized DNA molecule may result in one
or a number of mismatched base pairs. Thus, the synthesized DNA
molecule need not be exactly complementary to the DNA template.
[0087] Incorporating. The term "incorporating" as used herein means
becoming a part of a DNA molecule or primer.
[0088] Amplification. As used herein "amplification" refers to any
in vitro method for increasing the number of copies of a nucleotide
sequence with the use of a DNA polymerase. Nucleic acid
amplification results in the incorporation of nucleotides into a
DNA molecule or primer thereby forming a new DNA molecule
complementary to a DNA template. The formed DNA molecule and its
template can be used as templates to synthesize additional DNA
molecules. As used herein, one amplification reaction may consist
of many rounds of DNA replication. DNA amplification reactions
include, for example, polymerase chain reactions (PCR). One PCR
reaction may consist of 30 to 100 "cycles" of denaturation and
synthesis of a DNA molecule.
[0089] Oligonucleotide. "Oligonucleotide" refers to a synthetic or
natural molecule comprising a covalently linked sequence of
nucleotides which are joined by a phosphodiester bond between the
3' position of the pentose of one nucleotide and the 5' position of
the pentose of the adjacent nucleotide.
[0090] Nucleotide. As used herein "nucleotide" refers to a
base-sugar-phosphate combination. Nucleotides are monomeric units
of a nucleic acid sequence (DNA and RNA). The term nucleotide
includes deoxyribonucleoside triphosphates such as dATP, dCTP,
dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives
include, for example, [.alpha.S]dATP, 7-deaza-dGTP and
7-deaza-dATP. The term nucleotide as used herein also refers to
dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives.
Illustrated examples of dideoxyribonucleoside triphosphates
include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and
ddTTP. According to the present invention, a "nucleotide" may be
unlabeled or detectably labeled by well known techniques.
Detectable labels include, for example, radioactive isotopes,
fluorescent labels, chemiluminescent labels, bioluminescent labels
and enzyme labels.
[0091] Thermostable. As used herein "thermostable" refers to a DNA
polymerase which is resistant to inactivation by heat. DNA
polymerases synthesize the formation of a DNA molecule
complementary to a single-stranded DNA template by extending a
primer in the 5'-to-3' direction. This activity for mesophilic DNA
polymerases may be inactivated by heat treatment. For example, T5
DNA polymerase activity is totally inactivated by exposing the
enzyme to a temperature of 90.degree. C. for 30 seconds. As used
herein, a thermostable DNA polymerase activity is more resistant to
heat inactivation than a mesophilic DNA polymerase. However, a
thermostable DNA polymerase does not mean to refer to an enzyme
which is totally resistant to heat inactivation and thus heat
treatment may reduce the DNA polymerase activity to some extent. A
thermostable DNA polymerase typically will also have a higher
optimum temperature than mesophilic DNA polymerases.
[0092] Hybridization. The terms "hybridization" and "hybridizing"
refers to the pairing of two complementary single-stranded nucleic
acid molecules (RNA and/or DNA) to give a double-stranded molecule.
As used herein, two nucleic acid molecules may be hybridized,
although the base pairing is not completely complementary.
Accordingly, mismatched bases do not prevent hybridization of two
nucleic acid molecules provided that appropriate conditions, well
known in the art, are used.
[0093] 3'-to-5' Exonuclease Activity. "3'-to-5' exonuclease
activity" is an enzymatic activity well known to the art. This
activity is often associated with DNA polymerases, and is thought
to be involved in a DNA replication "editing" or correction
mechanism.
[0094] A "DNA polymerase substantially reduced in 3'-to-5'
exonuclease activity" is defined herein as either (1) a mutated DNA
polymerase that has about or less than 10%, or preferably about or
less than 1%, of the 3'-to-5' exonuclease activity of the
corresponding unmutated, wild-type enzyme, or (2) a DNA polymerase
having a 3'-to-5' exonuclease specific activity which is less than
about 1 unit/mg protein, or preferably about or less than 0.1
units/mg protein. A unit of activity of 3'-to-5' exonuclease is
defined as the amount of activity that solubilizes 10 nmoles of
substrate ends in 60 min. at 37.degree. C., assayed as described in
the "BRL 1989 Catalogue & Reference Guide", page 5, with HhaI
fragments of lambda DNA 3'-end labeled with [.sup.3H]dTTP by
terminal deoxynucleotidyl transferase (TdT). Protein is measured by
the method of Bradford, Anal. Biochem. 72:248 (1976). As a means of
comparison, natural, wild-type T5-DNA polymerase (DNAP) or T5-DNAP
encoded by pTTQ19-T5-2 has a specific activity of about 10 units/mg
protein while the DNA polymerase encoded by pTTQ19-T5-2(Exo.sup.31)
(U.S. Pat. No. 5,270,179) has a specific activity of about 0.0001
units/mg protein, or 0.001% of the specific activity of the
unmodified enzyme, a 10.sup.5-fold reduction.
[0095] 5'-to-3' Exonuclease Activity. "5'-to-3' exonuclease
activity" is also an enzymatic activity well known in the art. This
activity is often associated with DNA polymerases, such as E. coli
PolI and PolIII.
[0096] A "DNA polymerase substantially reduced in 5'-to-3'
exonuclease activity" is defined herein as either (1) a mutated DNA
polymerase that has about or less than 10%, or preferably about or
less than 1%, of the 5'-to-3' exonuclease activity of the
corresponding unmutated, wild-type enzyme, or (2) a DNA polymerase
having 5'-to-3' exonuclease specific activity which is less than
about 1 unit mg protein, or preferably about or less than 0.1
units/mg protein.
[0097] Both of the 3'-to-5' and 5'-to-3' exonuclease activities can
be observed on sequencing gels. Active 5'-to-3' exonuclease
activity will produce nonspecific ladders in a sequencing gel by
removing nucleotides from the 5'-end of the growing primers.
3'-to-5' exonuclease activity can be measured by following the
degradation of radiolabeled primers in a sequencing gel. Thus, the
relative amounts of these activities, e.g. by comparing wild-type
and mutant polymerases, can be determined with no more than routine
experimentation.
[0098] 1. Cloning and Expression of Thermotoga DNA Polymerases
[0099] The Thermotoga DNA polymerase of the invention can be
isolated from any strain of Thermotoga which produces a DNA
polymerase. The preferred strain to isolate the gene encoding
Thermotoga DNA polymerase of the present invention is Thermotoga
neapolitana (Tne) and Thermotoga maritima (Tma). The most preferred
Thermotoga neapolitana for isolating the DNA polymerase of the
invention was isolated from an African continental solfataric
spring (Windberger et al., Arch. Microbiol. 151:506-512 (1989) and
may be obtained from Deutsche Sammalung von Microorganismen und
Zellkulturan GmbH (DSM; German Collection of Microorganisms and
Cell Culture) Mascheroder Weg lb D-3300 Braunschweig, Federal
Republic of Germany, as Deposit No. 5068 (deposited Dec. 13,
1988).
[0100] To clone a gene encoding a Thermotoga DNA polymerase of the
invention, isolated DNA which contains the polymerase gene obtained
from Thermotoga cells, is used to construct a recombinant DNA
library in a vector. Any vector, well known in the art, can be used
to clone the wild type or mutant Thermotoga DNA polymerase of the
present invention. However, the vector used must be compatible with
the host in which the recombinant DNA library will be
transformed.
[0101] Prokaryotic vectors for constructing the plasmid library
include plasmids such as those capable of replication in E. coli
such as, for example, pBR322, ColE1, pSC101, pUC-vectors (pUC18,
pUC19, etc.: In: Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982);
and Sambrook et al., In: Molecular Cloning A Laboratory Manual (2d
ed.) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989)). Bacillus plasmids include pC194, pC221, pC217, etc. Such
plasmids are disclosed by Glyczan, T. In: The Molecular Biology
Bacilli, Academic Press, York (1982), 307-329. Suitable
Streptomyces plasmids include pIJ101 (Kendall et al., J. Bacteriol
169:4177-4183 (1987)). Pseudomonas plasmids are reviewed by John et
al., (Rad. Insec. Dis. 8:693-704 (1986)), and Igaki, (Jpn. J.
Bacteriol. 33:729-742 (1978)). Broad-host range plasmids or
cosmids, such as pCP13 (Darzins and Chakrabarbary, J. Bacteriol.
159:9-18, 1984) can also be used for the present invention. The
preferred vectors for cloning the genes of the present invention
are prokaryotic vectors. Preferably, pCP13 and pUC vectors are used
to clone the genes of the present invention.
[0102] The preferred host for cloning the wild type or mutant DNA
polymerase genes of the invention is a prokaryotic host. The most
preferred prokaryotic host is E. coli. However, the wild type or
mutant DNA polymerase genes of the present invention may be cloned
in other prokaryotic hosts including, but not limited to,
Escherichia, Bacillus, Streptomyces, Pseudomonas, Salmonella,
Serratia, and Proteus. Bacterial hosts of particular interest
include E. coli DH10B, which may be obtained from Life
Technologies, Inc. (LTI) (Gaithersburg, Md.).
[0103] Eukaryotic hosts for cloning and expression of the wild type
or mutant DNA polymerases of the present invention include yeast,
fungi, and mammalian cells. Expression of the desired DNA
polymerase in such eukaryotic cells may require the use of
eukaryotic regulatory regions which include eukaryotic promoters.
Cloning and expressing the wild type or mutant DNA polymerase gene
of the invention in eukaryotic cells may be accomplished by well
known techniques using well known eukaryotic vector systems.
[0104] Once a DNA library has been constructed in a particular
vector, an appropriate host is transformed by well known
techniques. Transformed colonies are plated at a density of
approximately 200-300 colonies per petri dish. Colonies are then
screened for the expression of a heat stable DNA polymerase by
transferring transformed E. coli colonies to nitrocellulose
membranes. After the transferred cells are grown on nitrocellulose
(approximately 12 hours), the cells are lysed by standard
techniques, and the membranes are then treated at 95.degree. C. for
5 minutes to inactivate the endogenous E. coli enzyme. Other
temperatures may be used to inactivate the host polymerases
depending on the host used and the temperature stability of the DNA
polymerase to be cloned. Stable DNA polymerase activity is then
detected by assaying for the presence of DNA polymerase activity
using well known techniques. Sagner et al., Gene 97:119-123 (1991),
which is hereby incorporated by reference in its entirety. The gene
encoding a DNA polymerase of the present invention can be cloned
using the procedure described by Sagner et al., supra.
[0105] The recombinant host containing the wild type gene encoding
Tne DNA polymerase, E. coli DH10B (pUC-Tne), was deposited on Sep.
30, 1994, with the Collection, Agricultural Research Culture
Collection (NRRL), 1815 North University Street, Peoria, Ill. 61604
USA as Deposit No. NRRL B-21338. The gene encoding Tma DNA
polymerase has also been cloned and sequenced (U.S. Pat. No.
5,374,553, which is expressly incorporated by reference in its
entirety).
[0106] If the Thermotoga (e.g., Tne or Tma) DNA polymerase has
3'-to-5' exonuclease activity, this activity may be reduced,
substantially reduced, or eliminated by mutating the DNA polymerase
gene. Such mutations include point mutations, frame shift
mutations, deletions and insertions. Preferably, the region of the
gene encoding the 3'-to-5' exonuclease activity is mutated or
deleted using techniques well known in the art (Sambrook et al.,
(1989) in: Molecular Cloning, A Laboratory Manual (2nd Ed.), Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0107] The 3'-to-5' exonuclease activity can be reduced or impaired
by creating site specific mutants within the 3'.fwdarw.5'
exonuclease domain. See infra. In a specific embodiment of the
invention Asp.sup.323 of Tne DNA polymerase (SEQ ID NO. 3) is
changed to any amino acid, preferably to Ala.sup.323 to
substantially reduce 3'-to-5' exonuclease activity. In another
specific embodiment of the invention, Asp.sup.323 of Tma may be
changed to any other amino acid, preferably to Ala to substantially
reduce 3'-to-5' exonuclease activity.
[0108] The 5'.fwdarw.3' exonuclease activity of the DNA polymerase
can be reduced or eliminated by mutating the DNA polymerase gene.
Such mutations include point mutations, frame shift mutations,
deletions, and insertions. Preferably, the region of the gene
encoding the 5'.fwdarw.3' exonuclease activity is deleted using
techniques well known in the art. In embodiments of this invention,
any one of six conserved amino acids that are associated with the
5'.fwdarw.3' exonuclease activity can be mutated. Examples of these
conserved amino acids with respect to Tne DNA polymerase include
Asp.sup.8, Glu.sup.112, Asp 114, Asp.sup.115, Asp.sup.137, and
Asp.sup.139. Other possible sites for mutation are: Gly.sup.102,
Gly.sup.187 and Gly.sup.195.
[0109] The present invention is directed broadly to mutations of
DNA polymerases that result in the reduction or elimination of
5'-3' exonuclease activity. Other particular mutations correspond
to the following amino acids.
1 E. coli polI: Asp.sup.13, Glu.sup.113, Asp.sup.115, Asp.sup.116,
Asp.sup.138, and Asp.sup.140. Taq pol: Asp.sup.18, Glu.sup.117,
Asp.sup.119, Asp.sup.120, Asp.sup.142, and Asp.sup.144. Tma pol:
Asp.sup.8, Glu.sup.112, Asp.sup.114, Asp.sup.115, Asp.sup.137, and
Asp.sup.139.
[0110] Amino acid residues of Taq DNA polymerase are as numbered in
U.S. Pat. No. 5,079,352.
[0111] Amino acid residues of Thermotoga maritima (Tma) DNA
polymerase are numbered as in U.S. Pat. No. 5,374,553.
[0112] By comparison to the amino acid sequence of other DNA
polymerases, the corresponding sites can easily be located and the
DNA mutanigized to prepare a coding sequence for the corresponding
DNA polymerase which lacks the 5'-3' exonuclease activity. Examples
of other DNA polymerases that can be so mutated include:
2 Enzyme or source Mutation positions Streptococcus Asp.sup.10,
Glu.sup.114, Asp.sup.116, Asp.sup.117, Asp.sup.139, Asp.sup.141
pneumoniae Thermus flavus Asp.sup.17, Glu.sup.116, Asp.sup.118,
Asp.sup.119, Asp.sup.141, Asp.sup.143 Thermus thermophilus
Asp.sup.18, Glu.sup.118, Asp.sup.120, Asp.sup.121, Asp.sup.143,
Asp.sup.145 Deinococcus radiodurans Asp.sup.18, Glu.sup.117,
Asp.sup.119, Asp.sup.120, Asp.sup.142, Asp.sup.144 Bacillus
caldotenax Asp.sup.9, Glu.sup.109, Asp.sup.111, Asp.sup.112,
Asp.sup.134, Asp.sup.136
[0113] Coordinates of S. pneumoniae, T. flavus, D. radiodurans, B.
caldotenax were obtained from Gutman and Minton. Coordinates of T.
thermophilus were obtained from International Patent No. WO
92/06200.
[0114] To abolish the 5'-3' exonuclease activity, amino acids are
selected which have different properties. For example, an acidic
amino acid such as Asp may be changed to a basic, neutral or polar
but uncharged amino acid such as Lys, Arg, His (basic); Ala, Val,
Leu, Ile, Pro, Met, Phe, Trp (neutral); or Gly, Ser, Thr, Cys, Tyr,
Asn or Gln (polar but uncharged). Glu may be changed to Asp, Ala,
Val Leu, Ile, Pro, Met, Phe, Trp, Gly, Ser, Thr, Cys, Tyr, Asn or
Gln. Specifically, the Ala substitution in the corresponding
position is expected to abolish 5'-exo activity.
[0115] Preferably, oligonucleotide directed mutagenesis is used to
create the mutant DNA polymerase which allows for all possible
classes of base pair changes at any determined site along the
encoding DNA molecule. In general, this technique involves
annealing a oligonucleotide complementary (except for one or more
mismatches) to a single stranded nucleotide sequence coding for the
DNA polymerase of interest. The mismatched oligonucleotide is then
extended by DNA polymerase, generating a double stranded DNA
molecule which contains the desired change in sequence on one
strand. The changes in sequence can of course result in the
deletion, substitution, or insertion of an amino acid. The double
stranded polynucleotide can then be inserted into an appropriate
expression vector, and a mutant polypeptide can thus be produced.
The above-described oligonucleotide directed mutagenesis can of
course be carried out via PCR.
[0116] In other embodiments, the entire 5'.fwdarw.3' exonuclease
domain of the DNA polymerase can be deleted by proteolytic cleavage
or by genetic engineering. For example, a unique SphI restriction
site can be used to obtain a clone devoid of nucleotides encoding
the 219 amino terminal amino acids of Tne DNA polymerase. Examples
of such a clone are pTTQTne535FY and pTTQTne5FY. Alternatively,
less than the 219 amino terminal amino acids may be removed, for
example, by treating the DNA coding for the Tne DNA polymerase with
an exonuclease, isolating the fragments, ligating the fragments
into a cloning vehicle, transfecting cells with the cloning
vehicle, and screening the transformants for DNA polymerase
activity and lack of 5'.fwdarw.3' exonuclease activity, with no
more than routine experimentation.
[0117] Thermotoga DNA polymerase mutants can also be made to render
the polymerase non-discriminating against non-natural nucleotides
such as dideoxynucleotides. Changes within the O-helix of
Thermotoga polymerases, such as other point mutations, deletions,
and insertions, can be made to render the polymerase
non-discriminating. By way of example, one Tne DNA polymerase
mutant having this property substitutes a nonnatural amino acid
such as Tyr for Phe at amino acid 67 as numbered in FIGS. 5A and
5B, and 730 of SEQ ID NO:3.
[0118] The O-helix region is a 14 amino acid sequence corresponding
to amino acids 722-735 of SEQ ID NO:3 or amino acids 59-72 as
numbered in FIGS. 5A and 5B. The O-helix may be defined as
RXXXKXXXFXXXYX, wherein X is any amino acid. The most important
amino acids in conferring discriminatory activity include Arg, Lys
and Phe. Amino acids which may be substituted for Arg at positions
722 are selected independently from Asp, Glu, Ala, Val Leu, Ile,
Pro, Met, Phe, Trp, Gly, Ser, Thr, Cys, Tyr, Gln, Asn, Lys and His.
Amino acids that may be substituted for Phe at position 730 include
Lys, Arg, His, Asp, Glu, Ala, Val, Leu, Ile, Pro, Met, Trp, Gly,
Ser, Thr, Cys, Tyr, Asn or Gln. Amino acids that may be substituted
for Lys at position 726 of SEQ ID NO: 3 include Tyr, Arg, His, Asp,
Glu, Ala, Val, Leu, Ile, Pro, Met, Trp, Gly, Ser, Thr, Cys, Phe,
Asn or Gln. Preferred mutants include Tyr.sup.730, Ala.sup.730,
Ser.sup.730 and Thr.sup.730. Such Tne mutants may be prepared by
well known methods of site directed mutagenesis as described
herein. See also Example 10.
[0119] The corresponding mutants can also be prepared from Tma DNA
polymerase, including Arg.sup.722, Lys.sup.726 and Phe.sup.730.
Most prefered mutants include Phe.sup.730 to Tyr.sup.730,
Ser.sup.730, Thr.sup.730 and Ala.sup.730.
[0120] 2. Enhancing Expression of Thermotoga DNA Polymerase
[0121] To optimize expression of the wild type or mutant Thermotoga
DNA polymerases of the present invention, inducible or constitutive
promoters are well known and may be used to express high levels of
a polymerase structural gene in a recombinant host. Similarly, high
copy number vectors, well known in the art, may be used to achieve
high levels of expression. Vectors having an inducible high copy
number may also be useful to enhance expression of Thermotoga DNA
polymerase in a recombinant host.
[0122] To express the desired structural gene in a prokaryotic cell
(such as, E. coli, B. subtilis, Pseudomonas, etc.), it is necessary
to operably link the desired structural gene to a functional
prokaryotic promoter. However, the natural Thermotoga promoter may
function in prokaryotic hosts allowing expression of the polymerase
gene. Thus, the natural Thermotoga promoter or other promoters may
be used to express the DNA polymerase gene. Such other promoters
may be used to enhance expression and may either be constitutive or
regulatable (i.e., inducible or derepressible) promoters. Examples
of constitutive promoters include the int promoter of bacteriophage
.lambda., and the bla promoter of the .beta.-lactamase gene of
pBR322. Examples of inducible prokaryotic promoters include the
major right and left promoters of bacteriophage .lambda. (P.sub.R
and P.sub.L), trp, recA, lacZ, lacI, tet, gal, trc, and tac
promoters of E. coli. The B. subtilis promoters include
.alpha.-amylase (Ulmanen et al., J. Bacteriol 162:176-182 (1985))
and Bacillus bacteriophage promoters (Gryczan, T., In: The
Molecular Biology Of Bacilli, Academic Press, New York (1982)).
Streptomyces promoters are described by Ward et al., Mol. Gen.
Genet. 203:468478 (1986)). Prokaryotic promoters are also reviewed
by Glick, J. Ind. Microbiol. 1:277-282 (1987); Cenatiempto, Y.,
Biochimie 68:505-516 (1986); and Gottesman, Ann. Rev. Genet.
18:415-442 (1984). Expression in a prokaryotic cell also requires
the presence of a ribosomal binding site upstream of the
gene-encoding sequence. Such ribosomal binding sites are disclosed,
for example, by Gold et al., Ann. Rev. Microbiol. 35:365404
(1981).
[0123] To enhance the expression of Thermotoga (e.g., The and Tma)
DNA polymerase in a eukaryotic cell, well known eukaryotic
promoters and hosts may be used. Preferably, however, enhanced
expression of Thermotoga DNA polymerase is accomplished in a
prokaryotic host. The preferred prokaryotic host for overexpressing
this enzyme is E. coli.
[0124] 3. Isolation and Purification of Thermotoga DNA
Polymerase
[0125] The enzyme(s) of the present invention (Thermotoga DNA
polymerases and mutants thereof) is preferably produced by
fermentation of the recombinant host containing and expressing the
cloned DNA polymerase gene. However, the wild type and mutant DNA
polymerases of the present invention may be isolated from any
Thermotoga strain which produces the polymerase of the present
invention. Fragments of the polymerase are also included in the
present invention. Such fragments include proteolytic fragments and
fragments having polymerase activity.
[0126] Any nutrient that can be assimilated by Thermotoga or a host
containing the cloned Thermotoga DNA polymerase gene may be added
to the culture medium. Optimal culture conditions should be
selected case by case according to the strain used and the
composition of the culture medium. Antibiotics may also be added to
the growth media to insure maintenance of vector DNA containing the
desired gene to be expressed. Culture conditions for Thermotoga
neapolitana have, for example, been described by Huber et al.,
Arch. Microbiol. 144:324-333 (1986). Media formulations are also
described in DSM or ATCC Catalogs and Sambrook et al., In:
Molecular Cloning, a Laboratory Manual (2nd ed.), Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0127] Thermotoga and recombinant host cells producing the DNA
polymerase of this invention can be separated from liquid culture,
for example, by centrifugation. In general, the collected microbial
cells are dispersed in a suitable buffer, and then broken down by
ultrasonic treatment or by other well known procedures to allow
extraction of the enzymes by the buffer solution. After removal of
cell debris by ultracentrifugation or centrifugation, the DNA
polymerase can be purified by standard protein purification
techniques such as extraction, precipitation, chromatography,
affinity chromatography, electrophoresis or the like. Assays to
detect the presence of the DNA polymerase during purification are
well known in the art and can be used during conventional
biochemical purification methods to determine the presence of these
enzymes.
[0128] 4. Uses of Thermotoga DNA Polymerase
[0129] The wild type and mutant Thermotoga DNA polymerases (e.g.,
Tma and Tne) of the present invention may be used in well known DNA
sequencing, DNA labeling, DNA amplification and cDNA synthesis
reactions. Thermotoga DNA polymerase mutants devoid of or
substantially reduced in 3'.fwdarw.5' exonuclease activity, devoid
of or substantially reduced in 5'.fwdarw.3' exonuclease activity,
or containing one or mutations in the O-helix that make the enzyme
nondiscriminatory for dNTPs and ddNTPs (e.g., a
Phe.sup.730.fwdarw.Tyr.sup.730 mutation of SEQ ID NO: 3) are
especially useful for DNA sequencing, DNA labeling, and DNA
amplification reactions and cDNA synthesis. Moreover, Thermotoga
DNA polymerase mutants containing two or more of these properties
are also especially useful for DNA sequencing, DNA labeling, DNA
amplification or cDNA synthesis reactions. As is well known,
sequencing reactions (isothermal DNA sequencing and cycle
sequencing of DNA) require the use of DNA polymerases.
Dideoxy-mediated sequencing involves the use of a chain-termination
technique which uses a specific polymer for extension by DNA
polymerase, a base-specific chain terminator and the use of
polyacrylamide gels to separate the newly synthesized
chain-terminated DNA molecules by size so that at least a part of
the nucleotide sequence of the original DNA molecule can be
determined. Specifically, a DNA molecule is sequenced by using four
separate DNA sequence reactions, each of which contains different
base-specific terminators. For example, the first reaction will
contain a G-specific terminator, the second reaction will contain a
T-specific terminator, the third reaction will contain an
A-specific terminator, and a fourth reaction may contain a
C-specific terminator. Preferred terminator nucleotides include
dideoxyribonucleoside triphosphates (ddNTPs) such as ddATP, ddTTP,
ddGTP, ddITP and ddCTP. Analogs of dideoxyribonucleoside
triphosphates may also be used and are well known in the art.
[0130] When sequencing a DNA molecule, ddNTPs lack a hydroxyl
residue at the 3' position of the deoxyribose base and thus,
although they can be incorporated by DNA polymerases into the
growing DNA chain, the absence of the 3'-hydroxy residue prevents
formation of the next phosphodiester bond resulting in termination
of extension of the DNA molecule. Thus, when a small amount of one
ddNTP is included in a sequencing reaction mixture, there is
competition between extension of the chain and base-specific
termination resulting in a population of synthesized DNA molecules
which are shorter in length than the DNA template to be sequenced.
By using four different ddNTPs in four separate enzymatic
reactions, populations of the synthesized DNA molecules can be
separated by size so that at least a part of the nucleotide
sequence of the original DNA molecule can be determined. DNA
sequencing by dideoxy-nucleotides is well known and is described by
Sambrook et al., In: Molecular Cloning, a Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). As
will be readily recognized, the Thermotoga DNA polymerases and
mutants thereof of the present invention may be used in such
sequencing reactions.
[0131] As is well known, detectably labeled nucleotides are
typically included in sequencing reactions. Any number of labeled
nucleotides can be used in sequencing (or labeling) reactions,
including, but not limited to, radioactive isotopes, fluorescent
labels, chemiluminescent labels, bioluminescent labels, and enzyme
labels. It has been discovered that the wild type and mutant DNA
polymerase of the present invention may be useful for incorporating
.alpha.S nucleotides ([.alpha.S]dATP, [.alpha.S]dTTP,
[.alpha.S]dCTP and [.alpha.S]dGTP) during sequencing (or labeling)
reactions. For example, [.alpha..sup.35S]dATP, a commonly used
detectably labeled nucleotide in sequencing reactions, is
incorporated three times more efficiently with the Tne DNA
polymerase of the present invention, than with Taq DNA polymerase.
Thus, the enzyme of the present invention is particularly suited
for sequencing or labeling DNA molecules with
[.alpha..sup.35S]dNTPs.
[0132] Polymerase chain reaction (PCR), a well known DNA
amplification technique, is a process by which DNA polymerase and
deoxyribonucleoside triphosphates are used to amplify a target DNA
template. In such PCR reactions, two primers, one complementary to
the 3' termini (or near the 3'-termini) of the first strand of the
DNA molecule to be amplified, and a second primer complementary to
the 3' termini (or near the 3'-termini) of the second strand of the
DNA molecule to be amplified, are hybridized to their respective
DNA strands. After hybridization, DNA polymerase, in the presence
of deoxyribonucleoside triphosphates, allows the synthesis of a
third DNA molecule complementary to the first strand and a fourth
DNA molecule complementary to the second strand of the DNA molecule
to be amplified. This synthesis results in two double stranded DNA
molecules. Such double stranded DNA molecules may then be used as
DNA templates for synthesis of additional DNA molecules by
providing a DNA polymerase, primers, and deoxyribonucleoside
triphosphates. As is well known, the additional synthesis is
carried out by "cycling" the original reaction (with excess primers
and deoxyribonucleoside triphosphates) allowing multiple denaturing
and synthesis steps. Typically, denaturing of double stranded DNA
molecules to form single stranded DNA templates is accomplished by
high temperatures. The wild type and mutant Thermotoga DNA
polymerases of the present invention are heat stable DNA
polymerases, and thus will survive such thermal cycling during DNA
amplification reactions. Thus, the wild type and mutant DNA
polymerases of the invention are ideally suited for PCR reactions,
particularly where high temperatures are used to denature the DNA
molecules during amplification.
[0133] The Thermotoga DNA polymerase and mutants of the present
invention (e.g. Tne and Tma) may also be used to prepare cDNA from
mRNA templates. See, U.S. Pat. Nos. 5,405,776 and 5,244,797, the
disclosures of which are explicitly incorporated by reference
herein. Thus, the invention also relates to a method of preparing
cDNA from mRNA, comprising
[0134] (a) contacting mRNA with an oligo(dT) primer or other
complementary primer to form a hybrid, and
[0135] (b) contacting said hybrid formed in step (a) with the
Thermotoga DNA polymerase or mutant of the invention and the four
dNTPs, whereby a cDNA-RNA hybrid is obtained.
[0136] If the reaction mixture is step (b) further comprises an
appropriate oligonucleotide which is complementary to the cDNA
being produced, it is also possible to obtain dsDNA following first
strand synthesis. Thus, the invention is also directed to a method
of preparing dsDNA with the Thermotoga DNA polymerases and mutants
thereof of the present invention.
[0137] 5. Kits
[0138] The wild type and mutant Thermotoga DNA polymerases of the
invention are suited for the preparation of a kit. Kits comprising
the wild type or mutant DNA polymerase(s) may be used for
detectably labeling DNA molecules, DNA sequencing, amplifying DNA
molecules or cDNA synthesis by well known techniques, depending on
the content of the kit. See U.S. Pat. Nos. 4,962,020, 5,173,411,
4,795,699, 5,498,523, 5,405,776 and 5,244,797. Such kits may
comprise a carrying means being compartmentalized to receive in
close confinement one or more container means such as vials, test
tubes and the like. Each of such container means comprises
components or a mixture of components needed to perform DNA
sequencing, DNA labeling, DNA amplification, or cDNA synthesis.
[0139] A kit for sequencing DNA may comprise a number of container
means. A first container means may, for example, comprise a
substantially purified sample of Thermotoga DNA polymerases or
mutants thereof. A second container means may comprise one or a
number of types of nucleotides needed to synthesize a DNA molecule
complementary to DNA template. A third container means may comprise
one or a number of different types of dideoxynucleoside
triphosphates. A fourth container means may comprise
pyrophosphatase. In addition to the above container means,
additional container means may be included in the kit which
comprise one or a number of DNA primers.
[0140] A kit used for amplifying DNA will comprise, for example, a
first container means comprising a substantially pure mutant or
wild type Thermotoga DNA polymerase of the invention and one or a
number of additional container means which comprise a single type
of nucleotide or mixtures of nucleotides. Various primers may or
may not be included in a kit for amplifying DNA.
[0141] Kits for cDNA synthesis will comprise a first container
means containing the wild type or mutant Tne DNA polymerase of the
invention, a second container means will contain the four dNTPs and
the third container means will contain oligo(dT) primer. See U.S.
Pat. Nos. 5,405,776 and 5,244,797. Since the Thermotoga DNA
polymerases of the present invention are also capable of preparing
dsDNA, a fourth container means may contain an appropriate primer
complementary to the first strand cDNA.
[0142] Of course, it is also possible to combine one or more of
these reagents in a single tube. A detailed description of such
formulations at working concentrations is described in the patent
application entitled "Stable Compositions for Nucleic Acid
Amplification and Sequencing" filed on Aug. 14, 1996, which is
expressly incorporated by reference herein in its entirety.
[0143] When desired, the kit of the present invention may also
include container means which comprise detectably labeled
nucleotides which may be used during the synthesis or sequencing of
a DNA molecule. One of a number of labels may be used to detect
such nucleotides. Illustrative labels include, but are not limited
to, radioactive isotopes, fluorescent labels, chemiluminescent
labels, bioluminescent labels and enzyme labels.
[0144] 6. Advantages of the Thermotoga DNA Polymerase
[0145] Thermotoga DNA polymerases of the invention have distinct
advantages in DNA sequencing. For example, when using the Tne DNA
polymerase mutants of the invention in single-extension sequencing,
they generate strong, clear .sup.35S-labeled sequence, increase
sequence signal to background ratio, generate .gtoreq.500 bases of
sequence, reduce false stops in the sequencing ladder, and permit
high temperature sequencing reactions. The efficient .sup.35S
incorporation by the Tne DNA polymerase mutants of the invention
can reduce template requirement 10-fold, give sharper bands than
.sup.32P, emit lower energy radiation than .sup.32P, and have a
longer shelf life than .sup.32P. Further, the Tne polymerase
mutants produce longer sequence reads and gives more accurate
sequence interpretation. In addition, the use of a 70.degree. C.
reaction temperature with this thermophilic polymerase increases
sequencing efficiency of structure-containing and GC-rich
templates.
[0146] Compared to modified T7 DNA polymerase (Sequenase.TM.), Tne
DNA polymerase mutants allow improved sequencing efficiency of
structure containing and GC-rich templates, are more forgiving in
incubation times for labeling and extensions, and allow one to
obtain full length sequence from one-tenth the amount of template.
With regard to other polymerases, the Tne DNA polymerase mutants
provide, under appropriate reaction conditions, more even band
intensities and give longer, more accurate sequence reads, exhibit
no weak or absent "dropout" bands, exhibit improved sequencing
efficiency of structure containing and GC-rich templates, exhibit
no sequence artifacts from templates containing homopolymers, and
provide for shorter film exposure and/or less template input due to
the efficient .sup.35S-dNTP incorporation.
[0147] With regard to cycle sequencing, the Tne DNA polymerase
mutants generate strong, clear .sup.35S-labeled sequence, they
increase sequence signal to background ratio, generate .gtoreq.500
bases of sequence, reduce false stops in the sequencing ladder
under appropriate conditions, and permit high temperature
reactions. The Tne DNA polymerase mutants also allow for highly
efficient .sup.35S dATP incorporation and therefore shorter film
exposures and/or less template input, give sharper bands than
.sup.32P, give off lower energy radiation than .sup.32P and have a
longer shelf life than .sup.32P. The Tne DNA polymerase mutants
also produce longer sequence reads and give more accurate sequence
interpretation. .sup.32p end labeling of primers generates data
with less background from less pure DNA and requires as little as 5
fmole (0.01 .mu.g) of DNA.
[0148] With regard to cycle sequencing, compared to the mutant Taq
DNA polymerase (ThermoSequenase.TM.), the Tne DNA polymerase
mutants generate three times stronger .sup.35S-labeled sequence
without an extra 2 hour cycled labeling step, require no special
primer design for .sup.35S labeling, and allow for sequencing of
PCR products directly using any primer. Compared to SequiTherm.TM.,
the mutants of Tne DNA polymerase generate three times stronger
.sup.35S-labeled sequence, give more even band intensities, gives
longer and more accurate sequence reads, require less template and
less primer, and give no sequence artifacts from templates
containing homopolymers. Compared to various other polymerases
(e.g. Tth DNA polymerase), the Tne DNA polymerase mutants under
appropriate reaction conditions generate three times stronger
.sup.35S-labeled sequence, give more even band intensities, give
longer and more accurate sequence reads, give no weak or absent
"dropout" bands, improve sequencing efficiency of
structure-containing and GC-rich templates, and reduce false stops
in sequencing ladders, including through homopolymer regions.
[0149] With regard to fluorescent sequencing, the mutants of Tne
DNA polymerase readily accept dye primers and dye terminators,
increase sequence signal to background ratio, produce fewer
ambiguous calls, and generate .gtoreq.500 bases of sequence. The
Tne DNA polymerase mutants also produce longer sequence read
lengths, give more accurate sequence interpretation, and allow for
quantitation of bases in heterologous mixtures. Since the Tne DNA
polymerase mutants provide for good incorporation of dye
terminators, such dye terminators can be reduced 500-fold. Further,
increased signal improves bases calling, reduces cost and time to
sequence, eliminates the need to remove excess dye terminators
before gel loading, and produces more even band intensities. The
efficient use of dye primers generates data with less background
from impure DNA and requires as little as 0.6 .mu.g of dsDNA
(double-stranded DNA).
[0150] With regard to the use of Thermo Sequenase.TM. and AmpliTaq
FS.TM. in fluorescent sequencing, the Tne DNA polymerase mutants
provide more even band intensities in dye terminator sequencing and
give comparable results with dye primers. With regard to
SequiTherm.TM., the Tne DNA polymerase mutants give more even band
intensities that give longer, more accurate sequencing reads with
both dye terminators and dye primers, use 500-fold less dye
terminators, eliminate post reaction clean up of dye terminators,
require 10-fold less template, and allow for quantitation of bases
in heterologous mixtures using dye primers.
[0151] With regard to the use of various other enzymes in
fluorescent sequencing, such as AmpliTaq.TM. and AmpliTaqCS.TM.,
mutant Tne DNA polymerases under appropriate reaction conditions
provide more even band intensities and more accurate sequence reads
with both dye terminators and dye primers, give no weak or absent
"dropout" bands, have lower background and fewer false stops, use
500-fold less dye terminators, eliminate post reaction clean up of
dye terminators, require 10-fold less template, and allow for
quantitation of bases in heterologous mixtures.
[0152] As shown in FIG. 3, Tne DNA polymerase incorporates
.alpha.-thio dATP at three times the rate of Taq DNA polymerase.
However, surprisingly, when .alpha.-thio dATP is used in place of
dATP in sequencing reactions using [.alpha.-.sup.35S]dATP and
mutants of Tne DNA polymerase, the resulting sequencing band signal
intensity is increased by approximately 8-10 fold. The weak signal
seen when dATP is used reflects the mutant DNA polymerase's strong
preference for incorporating dATP over .alpha.-thio dATP from a
mixed pool. Attempts to improve signal intensity by merely
decreasing the amount of dATP resulted in very poor quality
sequence with many false stops. Parallel experiments with
[.alpha.-.sup.32P]dATP and low concentrations of dATP produced
similar poor quality sequence, indicating that the nucleotide
concentration imbalance was causing the enzyme to perform poorly.
By using .alpha.-thio dATP mixed with [.alpha.-.sup.35S]dATP, the
four nucleotide concentrations kept constant without diminishing
signal or sequence quality.
[0153] Having now generally described the invention, the same will
be more readily understood through reference to the following
Examples which are provided by way of illustration, and are not
intended to be limiting of the present invention, unless
specified.
EXAMPLE 1
Bacterial Strains and Growth Conditions
[0154] Thermotoga neapolitana DSM No. 5068 was grown under
anaerobic conditions as described in the DSM catalog (addition of
resazurin, Na.sub.2S, and sulfur granules while sparging the media
with nitrogen) at 85.degree. C. in an oil bath from 12 to 24 hours.
The cells were harvested by filtering the broth through Whatman #1
filter paper. The supernatant was collected in an ice bath and then
centrifuged in a refrigerated centrifuge at 8,000 rpms for twenty
minutes. The cell paste was stored at -70.degree. C. prior to total
genomic DNA isolation.
[0155] E. coli strains were grown in 2.times.LB broth base (Lennox
L broth base: GIBCO/BRL) medium. Transformed cells were incubated
in SOC (2% tryptone, 0.5% yeast extract, yeast 10 mM NaCl, 2.5 mM
KCl, 20 mM glucose, 10 mM MgCl.sub.2, and 10 mM MgSO.sub.4 per
liter) before plating. When appropriate antibiotic supplements were
20 mg/l tetracycline and 100 mg/l ampicillin. E. coli strain DH10B
(Lorow et al., Focus 12:19-20 (1990)) was used as host strain.
Competent DH10B may be obtained from Life Technologies, Inc. (LTI)
(Gaithersburg, Md).
EXAMPLE 2
DNA Isolation
[0156] Thermotoga neapolitana chromosomal DNA was isolated from 1.1
g of cells by suspending the cells in 2.5 ml TNE (50 mM Tris-HCl,
pH 8.0, 50 mM NaCl, 10 mM EDTA) and treated with 1% SDS for 10
minutes at 37.degree. C. DNA was extracted with phenol by gently
rocking the lysed cells overnight at 4.degree. C. The next day, the
lysed cells were extracted with chloroform:isoamyl alcohol. The
resulting chromosomal DNA was further purified by centrifugation in
a CsCl density gradient. Chromosomal DNA isolated from the density
gradient was extracted three times with isopropanol and dialyzed
overnight against a buffer containing 10 mM Tris-HCl (pH 8.0) and 1
mM EDTA (TE).
EXAMPLE 3
Construction of Genomic Libraries
[0157] The chromosomal DNA isolated in Example 2 was used to
construct a genomic library in the plasmid pCP13. Briefly, 10 tubes
each containing 10 .mu.g of Thermotoga neapolitana chromosomal DNA
was digested with 0.01 to 10 units of Sau3A1 for 1 hour at
37.degree. C. A portion of the digested DNA was tested in an
agarose (1.2%) gel to determine the extent of digestion. Samples
with less than 50% digestion were pooled, ethanol precipitated and
dissolved in TE. 6.5 .mu.g of partially digested chromosomal DNA
was ligated into 1.5 .mu.g of pCP13 cosmid which had been digested
with BamHI restriction endonuclease and dephosphorylated with calf
intestinal alkaline phosphatase. Ligation of the partially digested
Thermotoga DNA and BamHI cleaved pCP13 was carried out with T4 DNA
ligase at 22.degree. C. for 16 hours. After ligation, about 1 .mu.g
of ligated DNA was packaged using .lambda.-packaging extract
(obtained from Life Technologies, Inc., Gaithersburg, Md.). DH10B
cells (Life Tech. Inc.) were then infected with 100 .mu.l of the
packaged material. The infected cells were plated on tetracycline
containing plates. Serial dilutions were made so that approximately
200 to 300 tetracycline resistant colonies were obtained per
plate.
EXAMPLE 4
Screening for Clones Expressing Thermotoga neapolitana DNA
Polymerase
[0158] Identification of the Thermotoga neapolitana DNA polymerase
gene of the invention was cloned using the method of Sagner et al.,
Gene 97:119-123 (1991) which reference is herein incorporated in
its entirety. Briefly, the E. coli tetracycline resistant colonies
from Example 3 were transferred to nitrocellulose membranes and
allowed to grow for 12 hours. The cells were then lysed with the
fumes of chloroform:toluene (1:1) for 20 minutes and dried for 10
minutes at room temperature. The membranes were then treated at
95.degree. C. for 5 minutes to inactivate the endogenous E. coli
enzymes. Surviving DNA polymerase activity was detected by
submerging the membranes in 15 ml of polymerase reaction mix (50 mM
Tris-HCl (pH 8.8), 1 mM MgCl.sub.2, 3 mM .beta.-mercaptoethanol, 10
.mu.M dCTP, dGTP, dTTP, and 15 .mu.Ci of 3,000 Ci/mmol
[.alpha..sup.32P]dATP) for 30 minutes at 65.degree. C.
[0159] Using autoradiography, three colonies were identified that
expressed a Thermotoga neapolitana DNA polymerase. The cells were
grown in liquid culture and the protein extract was made by
sonication. The presence of the cloned thermostable polymerase was
confirmed by treatment at 90.degree. C. followed by measurement of
DNA polymerase activity at 72.degree. C. by incorporation of
radioactive deoxyribonucleoside triphosphates into acid insoluble
DNA. One of the clones, expressing Tne DNA polymerase, contained a
plasmid designated pCP13-32 and was used for further study.
EXAMPLE 5
Subcloning of Tne DNA Polymerase
[0160] Since the pCP13-32 clone expressing the Tne DNA polymerase
gene contains about 25 kb of T. neapolitana DNA, subcloning a
smaller fragment of the Tne polymerase gene was attempted. The
molecular weight of the Tne DNA polymerase purified from E.
coli/pCP13-32 was about 100 kd. Therefore, a 2.5-3.0 kb DNA
fragment will be sufficient to code for full-length polymerase. A
second round of Sau3A partial digestion similar to Example 3 was
done using pCP13-32 DNA. In this case, a 3.5 kb region was cut out
from the agarose gel, purified by Gene Clean (BIO 101, La Jolla,
Calif.) and ligated into plasmid pSport 1 (Life Technologies, Inc.)
which had been linearized with BamHI and dephosphorylated with calf
intestinal alkaline phosphatase. After ligation, DH10B was
transformed and colonies were tested for DNA polymerase activity as
described in Example 4. Several clones were identified that
expressed Tne DNA polymerase. One of the clones (pSport-Tne)
containing about 3 kb insert was further characterized. A
restriction map of the DNA fragment is shown in FIG. 4. Further, a
2.7 Kb HindIII-SstI fragment was subcloned into pUC19 to generate
pUC19-Tne. E. coli/pUC19-Tne also produced Tne DNA polymerase.
[0161] The Tne polymerase clone was sequenced by methods known in
the art. The nucleotide sequence obtained of the 5' end prior to
the start ATG is shown in SEQ ID NO:1. The nucleotide sequence
obtained which encodes carboxy-terminal region of the Tne
polymerase is shown in FIGS. 5A and 5B (SEQ ID NO:17). When SEQ ID
NO:17 is translated it does not produce the entire amino acid
sequence of the Tne polymerase due to frame shift errors generated
during the determination of the nucleotide sequence. However, an
amino acid sequence of the Tne polymerase was obtained by
translating all three reading frames of SEQ ID NO:17, comparing
these sequences with known polymerase amino acid sequences, and
splicing the Tne polymerase sequence together to form the amino
acid sequence set forth in SEQ ID NO:18. The complete nucleotide
sequence coding for Tne is shown in SEQ ID NO:2 and the complete
amino acid sequence is shown in SEQ ID NO:3.
[0162] SEQ ID NO:3 shows that the Tne sequence has an N-terminal
methionine. It is not known with certainty whether the wild type
Tne protein comprises an N-terminal methionine. It is possible to
remove this N-terminal methionine according to methods well known
to those of ordinary skill in the art, e.g. with a methionine amino
peptidase.
EXAMPLE 6
Purification of Thermotoga neapolitana DNA Polymerase from E.
coli
[0163] Twelve grams of E. coli cells expressing cloned Tne DNA
polymerase (DH10B/pSport-Tne) were lysed by sonication (four
thirty-second bursts with a medium tip at the setting of nine with
a Heat Systems Ultrasonics Inc., model 375 sonicator) in 20 ml of
ice cold extraction buffer (50 mM Tris HCl (pH 7.4), 8% glycerol, 5
mM mercaptoethanol, 10 mM NaCl, 1 mM EDTA, 0.5 mM PMSF). The
sonicated extract was heated at 80.degree. C. for 15 min. and then
cooled in ice for 5 min. 50 mM KCl and PEI (0.4%) was added to
remove nucleic acids. The extract was centrifuged for
clarification. Ammonium sulfate was added to 60%, the pellet was
collected by centrifugation and resuspended in 10 ml of column
buffer (25 mM Tris-HCl (pH 7.4), 8% glycerol, 0.5% EDTA, 5 mM
2-mercaptoethanol, 10 mM KCl). A Blue-Sepharose (Pharmacia) column,
or preferably a Toso heparin (Tosohaas) column, was washed with 7
column volumes of column buffer and eluted with a 15 column volume
gradient of buffer from 10 mM to 2 M KCl. Fractions containing
polymerase activity were pooled. The fractions were dialyzed
against 20 volumes of column buffer. The pooled fractions were
applied to a Toso650Q column (Tosohaas). The column was washed to
baseline OD.sub.280 and elution effected with a linear 10 column
volume gradient of 25 mM Tris (pH 7.4), 8% glycerol, 0.5 mM EDTA,
10 mM KCl, 5 mM .beta.-mercaptoethanol to the same buffer plus 650
mM KCl. Active fractions were pooled.
EXAMPLE 7
Characterization of Purified Tne DNA Polymerase
[0164] 1. Determination of the Molecular Weight of Thermotoga
neapolitana DNA Polymerase
[0165] The molecular weight of 100 kilodaltons was determined by
electrophoresis in a 12.5% SDS gel by the method of Laemmli, U.K.,
Nature (Lond.) 227:680-685 (1970). Proteins were detected by
staining with Coomassie brilliant blue. A 10 kd protein ladder
(Life Technologies, Inc.) was used as a standard.
[0166] 2. Method for Measuring Incorporation of
[.alpha..sup.35S]-dATP Relative to .sup.3H-dATP
[0167] Incorporation of [.alpha.S]dATP was evaluated in a final
volume of 500 .mu.l of reaction mix, which was preincubated at
72.degree. C. for five minutes, containing either a [.sup.3H]TTP
nucleotide cocktail (100 .mu.M each TTP, dATP, dCTP, dGTP with
[.sup.3H]TTP at 90.3 cpm/pmol), a nucleotide cocktail containing
[.alpha.S]dATP as the only source of dATP (100 .mu.M each
[.alpha.S]dATP, dCTP, dGTP, TTP with [.alpha..sup.35S]dATP at 235
cpm/pmol), or a mixed cocktail (50 .mu.M [.alpha.S]dATP, 50 .mu.M
dATP, 100 .mu.M TTP, 100 .mu.M dCTP, 100 .mu.M dGTP with
[.sup.35.alpha.S] dATP at 118 cpm/pmol and [.sup.3H]TTP at 45.2
cpm/pmol) and 50 mM bicine, pH 8.5, 30 mM MgCl.sub.2, 0.25 mg/ml
activated salmon sperm DNA, 20% glycerol. The reaction was
initiated by the addition of 0.3 units of T. neapolitana DNA
polymerase or T. aquaticus DNA polymerase. At the times indicated a
25 .mu.l aliquot was removed and quenched by addition of ice cold
EDTA to a final concentration of 83 mM. 20 .mu.l aliquots of the
quenched reaction samples were spotted onto GF/C filters. Rates of
incorporation were compared and expressed as a ratio of T.
neapolitana to T. aquaticus. The incorporation of
[.alpha..sup.35S]dATP by T. neapolitana DNA polymerase was
three-fold higher than that of T. aquaticus DNA polymerase.
EXAMPLE 8
Reverse Transcriptase Activity
[0168] (A).sub.n:(dT).sub.12-18 is the synthetic template primer
used most frequently to assay for reverse transcriptase activity of
DNA polymerases. It is not specific for retroviral-like reverse
transcriptase, however, being copied by many prokaryotic and
eukaryotic DNA polymerases (Modak and Marcus, J. Biol. Chem.
252:11-19 (1977); Gerard et al., Biochem. 13:1632-1641 (1974);
Spadari and Weissbach, J. Biol. Chem. 249:5809-5815 (1974)).
(A).sub.n:(dT).sub.12-18 is copied particularly well by cellular,
replicative DNA polymerases in the presence of Mn.sup.++, and much
less efficiently in the presence of Mg.sup.++ (Modak and Marcus, J.
Biol. Chem. 252:11-19 (1977); Gerard et al., Biochem. 13:1632-1641
(1974); Spadari and Weissbach, J. Biol. Chem. 249:5809-5815
(1974)). In contrast, most cellular, replicative DNA polymerases do
not copy the synthetic template primer (C).sub.n:(dG).sub.12-18
efficiently in presence of either Mn.sup.++ or Mg.sup.++, but
retroviral reverse transcriptases do. Therefore, in testing for the
reverse transcriptase activity of a DNA polymerase with synthetic
template primers, the stringency of the test increases in the
following manner from least to most stringent:
(A).sub.n:(dT).sub.12-18 (Mn.sup.++)<(A).sub.n:(dT).sub.12-18
(Mg.sup.++)<<(C).sub.n:(dG)- .sub.12-18
(Mn.sup.++)<(C).sub.n:(dG).sub.12-18 (Mg.sup.++).
[0169] The reverse transcriptase activity of Tne DNA polymerase was
compared with Thermus thermophilus (Tth) DNA polymerase utilizing
both (A).sub.n:(dT).sub.20 and (C).sub.n:(dG).sub.12-18. Reaction
mixtures (50 .mu.l) with (A).sub.n:(dT).sub.20 contained 50 mM
Tris-HCl (pH 8.4), 100 .mu.M (A).sub.n, 100 .mu.M (dT).sub.20, and
either 40 mM KCl, 6 mM MgCl.sub.2, 10 mM dithiothreitol, and 500
.mu.M [.sup.3H]dTTP (85 cpm/pmole), or 100 mM KCl, 1 mM MnCl.sub.2,
and 200 .mu.M [.sup.3H]dTTP (92 cpm/pmole). Reaction mixtures (50
.mu.l) with (C).sub.n:(dG).sub.12-1- 8 contained 50 mM Tris-HCl (pH
8.4), 60 .mu.M (C).sub.n, 24 .mu.M (dG).sub.12-18, and either 50 mM
KCl, 10 mM MgCl.sub.2, 10 mM dithiothreitol, and 100 .mu.M
[.sup.3H]dGTP (132 cpm/pmole), or 100 mM KCl, 0.5 mM MnCl.sub.2,
and 200 .mu.M [.sup.3H]dGTP (107 cpm/pmole). Reaction mixtures also
contained either 2.5 units of the Tth DNA polymerase (Perkin-Elmer)
or 2.5 units of the Tne DNA polymerase. Incubations were at
45.degree. C. for 10 min followed by 75.degree. C. for 20 min.
[0170] The table shows the results of determining the relative
levels of incorporation of Tne and Tth DNA polymerase with
(A).sub.n:(dT).sub.20 and (C).sub.n:(dG).sub.12-18 in the presence
of Mg.sup.++ and Mn.sup.++. Tne DNA polymerase appears to be a
better reverse transcriptase than Tth DNA polymerase under reaction
conditions more specific for reverse transcriptase, i.e., in the
presence of (A).sub.n:(dT).sub.20 with Mg.sup.++ and
(C).sub.n:(dG).sub.12-18 with Mn.sup.++ or Mg.sup.++.
DNA Polymerase Activity of Tth and Tne DNA Polymerase with
(A).sub.n:(dT).sub.20 and (C).sub.n:(dG).sub.12-18
[0171]
3 DNA Polymerase Activity of Tth and Tne DNA Polymerase with
(A).sub.n:(dT).sub.20 and (C).sub.n:(dG).sub.12-18 DNA Polymerase
Activity (pMoles Complementary [.sup.3H]dNTP Incorporated)
(A).sub.n:(dT).sub.20 (C).sub.n:(dG) Enzyme Mg.sup.++ Mn.sup.++
Mg.sup.++ Mn.sup.++ Tne 161.8 188.7 0.6 4.2 Tth 44.8 541.8 0
0.9
EXAMPLE 9
Construction of Thermotoga Neapolitana 3'-to-5' Exonuclease
Mutant
[0172] The amino acid sequence of portions of the Tne DNA
polymerase was compared with other known DNA polymerases such as E.
coli DNA polymerase 1, Taq DNA polymerase, T5 DNA polymerase, and
T7 DNA polymerase to localize the regions of 3'-to-5' exonuclease
activity, and the dNTP binding domains within the DNA polymerase.
One of the 3'-to-5' exonuclease domains was determined based on the
comparison of the amino acid sequences of various DNA polymerases
(Blanco, L., et al. Gene 112: 139-144 (1992); Braithwaite and Ito,
Nucleic Acids Res. 21: 787-802 (1993)) is as follows:
4 Tne 318 PSFALD.LETSS 328 (SEQ ID NO:4) Pol I 350 PVFAFDTETDS 360
(SEQ ID NO:5; Braithwaite and Ito, supra) T5 133 GPVAFDSETSA 143
(SEQ ID NO:6; Braithwaite and Ito, supra) T7 1 MIVSDIEANA 10 (SEQ
ID NO:7; Braithwaite and Ito, supra).
[0173] As a first step to make the Tne DNA polymerase devoid of
3'.fwdarw.5' exonuclease activity, a 2 kb Sph fragment from
pSport-Tne was cloned into M13mp19 (LTI, Gaithersburg, Md.). The
recombinant clone was selected in E. coli DH5.alpha.F'IQ (LTI,
Gaithersburg, Md.). One of the clones with the proper insert was
used to isolate uracilated single-stranded DNA by infecting E. coli
CJ236 (Biorad, California) with the phage particle obtained from E.
coli DH5.alpha.F'IQ. An oligonucleotide, GA CGT TTC AAG CGC TAG GGC
AAA AGA (SEQ ID NO:8) was used to perform site directed
mutagenesis. This site-directed mutagenesis converted Asp.sup.323
(indicated as * above) to Ala .sup.323. An Eco47III restriction
site was created as part of this mutagenesis to facilitate
screening of the mutant following mutagenesis. The mutagenesis was
performed using a protocol as described in the Biorad manual (1987)
except T7 DNA polymerase was used instead of T4 DNA polymerase
(USB, Cleveland, Ohio). The mutant clones were screened for the
Eco47III restriction site that was created in the mutagenic
oligonucleotide. One of the mutants having the created Eco47III
restriction site was used for further study. The mutation
Asp.sup.323 to Ala.sup.323 has been confirmed by DNA
sequencing.
[0174] To incorporate the 3'-to-5' exonuclease mutation in an
expression vector, the mutant phage was digested with SphI and
HindIII. A 2 kb fragment containing the mutation was isolated. This
fragment was cloned in pUC-Tne to replace the wild type fragment.
See FIG. 6A. The desired clone, pUC-Tne (3'.fwdarw.5'), was
isolated. The presence of the mutant sequence was confirmed by the
presence of the unique Eco47III site. The plasmid was then digested
with SstI and HindIII. The entire mutant polymerase gene (2.6 kb)
was purified and cloned into SstI and HindIII digested pTrc99
expression vector (Pharmacia, Sweden). The clones were selected in
DH10B (LTI, Gaithersburg, Md.). The resulting plasmid was
designated pTrcTne35. See FIG. 6B. This clone produced active heat
stable DNA polymerase.
EXAMPLE 10
Phenylalanine to Tyrosine Mutant
[0175] As discussed supra, the polymerase active site including the
dNTP binding domain is usually present at the carboxyl terminal
region of the polymerase. The sequence of the Tne polymerase gene
suggests that the amino acids that presumably contact and interact
with the dNTPs are present within the 694 bases starting at the
internal BamHI site. See FIG. 4 and FIGS. 5A and 5B. This
conclusion is based on homology with a prototype polymerase E. coli
DNA polymerase 1. See Polisky et al., J. Biol. Chem.
265:14579-14591 (1990). The sequence of the carboxyl terminal
portion of the polymerase gene is shown in FIGS. 5A and 5B. Based
upon this sequence, it is possible to compare the amino acid
sequence within the O-helix for various polymerases. The complete
sequence of the DNA polymerase is shown in SEQ ID NO:3. The
corresponding O-helix region band on the sequence in FIGS. 5A and
5B includes amino acids 59 to 72.
5 Tne 722 RRVGKMVNFSIIYG 735 (SEQ ID NO:9) Pol I 754 RRSAKAINFGLIYG
767 (SEQ ID NO:10) T5 562 RQAAKAITFGILYG 575 (SEQ ID NO:11) T7 518
RDNAKTFIYGFLYG 531 (SEQ ID NO:12) Taq 659 RRAAKTINFGVLYG 672 (SEQ
ID NO:13)
[0176] It was shown that by replacing the phenylalanine residue of
Taq DNA polymerase, the polymerase becomes non-discriminating
against non-natural nucleotides such as dideoxynucleotides. See
application Ser. No. 08/525,087 entitled "Mutant DNA Polymerases
and Use Thereof" of Deb K. Chatterjee, filed Sep. 8, 1995,
specifically incorporated herein by reference. The mutation was
based on the assumption that T7 DNA polymerase contains a tyrosine
residue in place of the phenylalanine, and T7 DNA polymerase is
non-discriminating against dideoxynucleotides. The corresponding
residue, Phe.sup.762 of E. coli PolI is an amino acid that directly
interacts with nucleotides. (Joyce and Steitz, Ann. Rev. Biochem.
63:777-822 (1994); Astake, M. J., J. Biol. Chem. 270:1945-1954
(1995)). A similar mutant of Tne DNA polymerase was prepared.
[0177] In order to change Phe.sup.730 of the Tne polymerase to a
Tyr.sup.730 as numbered in SEQ ID NO:3, site directed mutagenesis
was performed using the oligonucleotide GTA TAT TAT AGA GTA GTT AAC
CAT CTT TCC A. (SEQ ID NO:14). As part of this oligonucleotide
directed mutagenesis, a HpaI restriction site was created in order
to screen mutants easily. The same uracilated single-stranded DNA
and mutagenesis procedure described in Example 9 were used for this
mutagenesis. Following mutagenesis, the mutants were screened for
the HpaI site. Mutants with the desired HpaI site were used for
further study. The mutation has been confirmed by DNA
sequencing.
[0178] The Phe.sup.730 to Tyr.sup.730 mutation was incorporated
into pUC-Tne by replacing the wild type SphI-HindIII fragment with
the mutant fragment obtained from the mutant phage DNA. The
presence of the desired clone, pUC-TneFY, was confirmed by the
presence of the unique HpaI site, see FIG. 6A. The entire mutant
polymerase gene was subcloned into pTrc99 as an SstI-HindIII
fragment as described above in DH10B. The resulting plasmid was
designated pTrcTneFY. (FIG. 6B). The clone produced active heat
stable polymerase.
EXAMPLE 11
3'-to-5' Exonuclease and Phe.sup.730.fwdarw.Tyr.sup.730 Double
Mutants
[0179] In order to introduce the 3'.fwdarw.5' exonuclease mutation
and the Phe.sup.730.fwdarw.Tyr.sup.730 mutation in the same
expression vector, pTrc99, it was necessary to first reconstitute
both mutations in the pUC-Tne clone. See FIG. 7. Both the pUC-Tne
(3'.fwdarw.5') and the pUC-TneFY were digested with BamHI. The
digested pUC-Tne (3'.fwdarw.5') was dephosphorylated to avoid
recirculation in the following ligations. The resulting fragments
were purified on a 1% agarose gel. The largest BamHI fragment (4.4
kb) was purified from pUC-Tne (3'.fwdarw.5') digested DNA and the
smallest BamHI fragment (0.8 kb) containing the
Phe.sup.730.fwdarw.Tyr.sup.730 mutation was purified and ligated to
generate pUC-Tne35FY. The proper orientation and the presence of
both mutations in the same plasmid was confirmed by Eco47III, HpaI,
and SphI-HindIII restriction digests. See FIG. 7.
[0180] The entire polymerase containing both mutations was
subcloned as a SstI-HindIII fragment in pTrc99 to generate
pTrcTne35FY in DH10B. The clone produced active heat stable
polymerase.
EXAMPLE 12
3'-to-5' Exonuclease, 5'-to-3' Exonuclease, and
Phe.sup.730.fwdarw.Tyr.sup- .730 Triple Mutants
[0181] In most of the known polymerases, the 5'-to-3' exonuclease
activity is present at the amino terminal region of the polymerase
(Ollis, D. L., et al., Nature 313, 762-766, 1985; Freemont, P. S.,
et al., Proteins 1, 66-73, 1986; Joyce, C. M., Curr. Opin. Struct.
Biol. 1: 123-129 (1991). There are some conserved amino acids that
are implicated to be responsible for 5'-to-3' exonuclease activity
(Gutman and Minton, Nucl. Acids Res. 21, 4406-4407, 1993). See
supra. It is known that 5 '-to-3' exonuclease domain is
dispensable. The best known example is the Klenow fragment of E.
coli Pol I. The Klenow fragment is a natural proteolytic fragment
devoid of 5'-to-3' exonuclease activity (Joyce, C. M., et al., J.
Biol. Chem. 257, 1958-1964, 1990). In order to generate an
equivalent mutant for Tne DNA polymerase devoid of 5'-to-3'
exonuclease activity, the presence of a unique SphI site present
680 bases from the SstI site was exploited. pUC-Tne35FY was
digested with HindIII, filled-in with Klenow fragment to generate a
blunt-end, and digested with SphI. The 1.9 kb fragment was cloned
into an expression vector pTTQ19 (Stark, M. J. R., Gene 51,
255-267, 1987) at the SphI-SmaI sites and was introduced into
DH10B. This cloning strategy generated an in-frame polymerase clone
with an initiation codon for methionine from the vector. The
resulting clone is devoid of 219 amino terminal amino acids of Tne
DNA polymerase. This clone is designated as pTTQTne535FY. The clone
produced active heat stable polymerase. No exonuclease activity
could be detected in the mutant polymerase as evidenced by lack of
presence of unusual sequence ladders in the sequencing reaction.
This particular mutant polymerase is highly suitable for DNA
sequencing.
EXAMPLE 13
5'-to-3' Exonuclease Deletion and Phe.sup.730.fwdarw.Tyr.sup.730
Substitution Mutant
[0182] In order to generate the 5'.fwdarw.3' exonuclease deletion
mutant of the Tne DNA polymerase Phe.sup.730.fwdarw.Tyr.sup.730
mutant, the 1.8 kb SphI-SpeI fragment of pTTQTne535FY was replaced
with the identical fragment of pUC-Tne FY. See FIG. 8. A resulting
clone, pTTQTne5FY, produced active heat stable DNA polymerase. As
measured by the rate of degradation of a labeled primer, this
mutant has a modulated, low but detectable, 3'.fwdarw.5'
exonuclease activity compared to wild type Tne DNA polymerase.
M13/pUC Forward 23-Base Sequencing Primer.TM., obtainable from LTI,
Gaithersburg, Md., was labeled at the 5' end with [P.sup.32] ATP
and T4 kinase, also obtainable from LTI, Gaithersburg, Md., as
described by the manufacturer. The reaction mixtures contained 20
units of either wild-type or mutant Tne DNA polymerase, 0.25 pmol
of labeled primer, 20 mM tricine, pH 8.7, 85 mM potassium acetate,
1.2 mM magnesium acetate, and 8% glycerol. Incubation was carried
out at 70.degree. C. At various time points, 10 .mu.l aliquots were
removed to 5 .mu.l cycle sequencing stop solution and were resolved
in a 6% polyacrylamide sequencing gel followed by andoradiography.
While the wild-type polymerase degraded the primer in 5 to 15
minutes, it took the mutant polymerase more than 60 minutes for the
same amount of degradation of the primer. Preliminary results
suggest that this mutant polymerase is able to amplify more than 12
kb of genomic DNA when used in conjunction with Taq DNA polymerase.
Thus, the mutant polymerase is suitable for large fragment PCR.
EXAMPLE 14
Purification of the Mutant Polymerases
[0183] The purification of the mutant polymerases was done
essentially as described in U.S. patent application Ser. No.
08/370,190, filed Jan. 9, 1995, entitled "Cloned DNA Polymerases
for Thermotoga neapolitana," and as in Example 6, supra, with minor
modifications. Specifically, 5 to 10 grams of cells expressing
cloned mutant Tne DNA polymerase were lysed by sonication with a
Heat Systems Ultrasonic, Inc. Model 375 machine in a sonication
buffer comprising 50 mM Tris-HCl (pH 7.4); 8% glycerol; 5 mM
2-mercaptoethanol, 10 mM NaCl, 1 mM EDTA, and 0.5 mM PMSF. The
sonication sample was heated at 75.degree. C. for 15 minutes.
Following heat treatment, 200 mM NaCl and 0.4% PEI was added to
remove nucleic acids. The extract was centrifuged for
clarification. Ammonium sulfate was added to 48%, the pellet was
resuspended in a column buffer consisting of 25 mM Tris-HCl (pH
7.4); 8% glycerol; 0.5% EDTA; 5 mM 2-mercaptoethanol; 10 mM KCl and
loaded on a heparin agarose (LTI) column. The column was washed
with 10 column volumes using the loading buffer and eluted with a
10 column volume buffer gradient from 10 mM to 1 M KCl. Fractions
containing polymerase activity were pooled and dialyzed in column
buffer as above with the pH adjusted to 7.8. The dialyzed pool of
fractions were loaded onto a MonoQ (Pharmacia) column. The column
was washed and eluted as described above for the heparin column.
The active fractions are pooled and a unit assay was performed.
[0184] The unit assay reaction mixture contained 25 mM TAPS (pH
9.3), 2 mM MgCl.sub.2, 50 mM KCl, 1 mM DTT, 0.2 mM dNTPs, 500
.mu.g/ml DNAse I treated salmon sperm DNA, 21 mCi/ml
[.alpha.P.sup.32] dCTP and various amounts of polymerase in a final
volume of 50 .mu.l. After 10 minutes incubation at 70.degree. C.,
10 .mu.l of 0.5 M EDTA was added to the tube. TCA precipitable
counts were measured in GF/C filters using 40 .mu.l of the reaction
mixture.
EXAMPLE 15
DNA Sequencing with the Mutant Polymerases
[0185] M13/pUC 23-base forward sequencing primer was
.sup.32P-end-labeled for use in sequencing by incubating the
following mixture at 37.degree. C. for 10 minutes: 60 mM Tris-HCl
(pH 7.8), 10 mM MgCl.sub.2, 200 mM KCl, 0.2 .mu.M primer, 0.4 .mu.M
(2 .mu.Ci/.mu.l) [.gamma.-.sup.32P]ATP, 0.2 U/.mu.l T4
polynucleotide kinase. Labeling was terminated by incubating at
55.degree. C. for 5 minutes.
[0186] Four 10 .mu.l base-specific sequencing reactions were set up
for each test. The polymerase and the ddNTP concentrations were
varied as follows:
6 Test Tne DNA polymerase [ddATP] [ddCTP] [ddGTP] [ddTTP] 1
wild-type 0.4 mM 0.2 mM 0.04 mM 0.4 mM 2 TneFY 0.4 mM 0.2 mM 0.04
mM 0.4 mM 3 TneFY 0.04 mM 0.02 mM 0.004 mM 0.04 mM 4 TneFY 0.004 mM
0.002 mM 0.0004 mM 0.004 mM 5 Tne35FY 0.4 mM 0.2 mM 0.04 mM 0.4 mM
6 Tne35FY 0.04 mM 0.02 mM 0.004 mM 0.04 mM 7 Tne35FY 0.004 mM 0.002
mM 0.0004 mM 0.004 mM 8 Tne535FY 0.4 mM 0.2 mM 0.04 mM 0.4 mM 9
Tne535FY 0.04 mM 0.02 mM 0.004 mM 0.04 mM 10 Tne535FY 0.004 mM
0.002 mM 0.0004 mM 0.004 mM
[0187] Other components of the reaction were held constant: 1.1 nM
pUC 18 DNA, 22 nM .sup.32P-end-labeled primer, 30 mM Tris-HCl (pH
9.0), 5 mM MgCl.sub.2, 50 mM KCl, 0.05% (w/v) W-1, 0.056 U/.mu.l
DNA polymerase (see table), 20 .mu.M dATP, 20 .mu.M dCTP, 20 .mu.M
7-deaza-dGTP, 20 .mu.M dTTP. Samples were incubated in a thermal
cycler at 95.degree. C. for 3 minutes, followed by 20 cycles of (30
seconds at 95.degree. C., 30 seconds at 55.degree. C., 60 seconds
at 70.degree. C.) and 10 cycles of (30 seconds at 95.degree. C., 60
seconds at 70.degree. C.). Reactions were terminated with 5 .mu.l
of stop solution (95% (v/v) formamide, 10 mM EDTA (pH 8.0), 0.1%
(w/v) bromophenol blue, 0.1% (w/v) xylene cyanol and denatured for
two minutes at 70.degree. C. Three .mu.l aliquots were separated on
a 6% TBE/urea sequencing gel. The dried gel was exposed to
BioMAX-MR x-ray film for 16 hours.
[0188] Results
[0189] Cycle sequencing reactions using P.sup.32 end-labeled
primers were prepared using wild-type Tne DNA polymerase and each
of the three mutants, TneFY, Tne35FY, and Tne535FY. All four of the
polymerases produced sequencing ladders. The TneFY mutant gave only
a 9 base sequencing ladder when the Taq cycle sequencing reaction
conditions were used. This is suggestive of premature termination
due to efficient ddNTP incorporation. Diluting the
dideoxynucleotides by a factor of 100 extended the ladder to about
200 bases. The F.fwdarw.Y mutation in the TneFY polymerase
therefore allowed dideoxynucleotides to be incorporated at a much
higher frequency than for wild-type polymerase. The Tne35FY mutant
demonstrated a similar ability to incorporate dideoxynucleotides.
In this case, the sequence extended to beyond 400 bases and the
excess P.sup.32 end-labeled M13/pUC forward 23-Base sequencing
primer band remained at the 23-base position in the ladder. The
persistence of the 23-base primer band confirmed that the
3'.fwdarw.5' exonuclease activity had been significantly reduced.
The Tne535FY mutant performed similarly to the Tne35FY mutant
except that the signal intensity increased by at least fivefold.
The background was very low and relative band intensities were
extremely even, showing no patterns of sequence-dependent intensity
variation.
EXAMPLE 16
Generation of 5'.fwdarw.3' Exonuclease Mutant of Full Length Tne
DNA Polymerase
[0190] 1. Identification of Two Amino Acids Responsible for 5'-3'
Exonuclease Activity
[0191] Tne DNA polymerase contains three enzymatic activities
similar to E. coli DNA polymerase I: 5'-3' DNA polymerase activity,
3'-5' exonuclease activity and 5'-3' exonuclease activity. This
example is directed to the elimination of the 5'-3' exonuclease
activity in full length Tne DNA polymerase. Gutman and Minton
(Nucleic Acids Res. 1993, 21, 4406-4407) identified six (A-F)
conserved 5'-3' exonuclease domains containing a total of 10
carboxylates in various DNA polymerases in the polI family. Seven
out of 10 carboxylates (in domains A, D and E) have been implicated
to be involved in divalent metal ions binding as judged from the
crystal structure (Kim et al. Nature, 1995, 376, 612-616) of Taq
DNA polymerase. However, there was no clear demonstration that
these carboxylates are actually involved 5'-3' exonuclease
activity. In order to find out the biochemical characteristics of
some of these carboxylates, two of the aspartic acids in domains A
and E were chosen for mutagenesis. The following aspartic acids in
these two domains were identified:
7 Tne DNA polymerase: 5 F L F D.sup.8 G T 10 (domain A) Taq DNA
polymerase: 15 L L V D.sup.18 G H 20 and Tne DNA polymerase: 132 S
L I T G D.sup.137 K D M L 141 (domain E) Taq DNA polymerase: 137 R
I L T A D.sup.142 K D L Y 146
[0192] 2. Isolation of Single Stranded DNA for Mutagenesis
[0193] Single stranded DNA was isolated from pSportTne (see infra).
pSportTne was introduced into DH5.alpha.F'IQ (LTI, Gaithersburg,
Md.) by transformation. A single colony was grown in 2 ml Circle
Grow (Bio 101, CA) medium with ampicillin at 37.degree. C. for 16
hrs. A 10 ml fresh media was inoculated with 0.1 ml of the culture
and grown at 37.degree. C. until the A590 reached approximately
0.5. At that time, 0.1 ml of M13KO7 helper phage (1.times.10.sup.11
pfu/ml, LTI) was added to the culture. The infected culture was
grown for 75 min. Kanamycin was then added at 50 .mu.g/ml, and the
culture was grown overnight (16 hrs.). The culture was spun down. 9
ml of the supernatant was treated with 50 .mu.g each of RNaseA and
DNaseI in the presence of 10 mM MgCl.sub.2 for 30 min. at room
temperature. To this mixture, 0.25 volume of a cocktail of 3M
ammonium acetate plus 20% polyethylene glycol was added and
incubated for 20 min. on ice to precipitate phage. The phage was
recovered by centrifugation. The phage pellet was dissolved in 200
.mu.l of TE (10 mM Tris-HCl (pH 8) and 1 mM EDTA). The phage
solution was extracted twice with equal volume of buffer saturated
phenol (LTI, Gaithersburg, Md.), twice with equal volume of
phenol:chloroform:isoamyl alcohol mixture (25:24:1, LTI,
Gaithersburg, Md.) and finally, twice with chloroform: isoamyl
alcohol (24:1). To the aqueous layer, 0.1 volume of 7.5 M ammonium
acetate and 2.5 volume of ethanol were added and incubated for 15
min. at room temperature to precipitate single stranded DNA. The
DNA was recovered by centrifugation and suspended in 200 .mu.l
TE.
[0194] 3. Mutagenesis of D.sup.8 and D.sup.137
[0195] Two oligos were designed to mutagenize D.sup.8 and D.sup.137
to alanine. The oligos are: 5' GTAGGCCAGGGCTGTGCCGGCAAAGAGAAATAGTC
3' (SEQ ID NO:15) (D8A) and 5' GAAGCATATCCTTGGCGCCGGTTAT TATGAAAATC
3' (SEQ ID NO:16) (D137A). In the D8A oligo a NgoAIV (bold
underlined) and in the oligo D137A a KasI (bold underlined) site
was created for easy identification of clones following
mutagenesis. 200 pmol of each oligo was kinased according to the
Muta-gene protocol (Bio-Rad, CA) using 5 units of T4 Kinase (LTI,
Gaithersburg, Md.). 200 ng of single stranded DNA was annealed with
2 pmol of oligo according to the Muta-gene protocol. The reaction
volume was 10 .mu.l. Following the annealing step, complementary
DNA synthesis and ligation was carried out using 5 units of
wild-type T7 DNA polymerase (USB, Ohio) and 0.5 unit T4 ligase
(LTI). 1 .mu.l of the reaction was used to transform a MutS E. coli
(obtainable from Dr. Paul Modrich at the Duke University, NC) and
selected in agar plates containing ampicillin. A control annealing
and synthesis reaction was carried out without addition of any
oligo to determine the background. There were 50-60 fold more
colonies in the transfomation plates with the oligos than without
any oligo. Six colonies from each mutagenic oligo directed
synthesis were grown and checked for respective restriction site
(NgoAIV or KasI). For D8A (NgoAIV), 4 out of 6 generated two
fragments (3 kb and 4.1 kb). Since pSportTne has an NgoAIV site
near the f1 intergenic region, the new NgoAIV site within the Tne
DNA polymerase produced the expected fragments. The plasmid was
designated as pSportTneNgoAIV. For D137A (KasI), 5 out of 6 clones
produced two expected fragments of 1.1 kb and 6 kb in size. Since
pSportTne has another KasI site, the newly created KasI site
generated these two expected fragments. The plasmid was designated
as pSportTneKasI. Both D8A and D137A mutations have been confirmed
by DNA sequencing.
[0196] 4. Reconstruction of the Mutant Polymerase into Expression
Vector
[0197] During the course of expression of Tne DNA polymerase or
mutant Tne DNA polymerase, a variety of clones were constructed.
One such clone was designated as pTTQ Tne SeqS1. This plasmid was
constructed as follows: first, similar to above mutagenesis
technique glycine 195 was changed to an aspartic acid in pSportTne.
A mutation in the corresponding amino acid in E. coli DNA
polymeraseI (polA214, domain F) was found to have lost the 5'-3'
exonuclease activity (Gutman and Minton, see above). An SspI site
was created in the mutant polymerase. Second, a 650 bp SstI-SphI
fragment containing the G195D mutation was subcloned in pUCTne35FY
(see infra) to replace the wild type fragment. This plasmid was
called pUCTne3022. Finally, the entire mutant Tne DNA polymerase
was subcloned from pUCTne3022 into pTTQ18 as SstI-HindIII fragment
to generate pTTQTneSeqS1. To introduce the mutation D8A or D137A in
this expression vector, the 650 bp SstI-SphI was replaced with the
same SstI-SphI fragment from pSportTneNgoAIV or pSportTneKasI. The
plasmids were designated as pTTQTneNgo(D8A) and pTTQTneKas(D137A),
respectively.
[0198] 5. Confirmation of the Mutations by DNA Sequencing
[0199] DNA sequencing of both mutant polymerases confirmed the
presence of the restriction site NgoAIV as well as the mutation
D8A; and KasI site as well as the mutation D137A. Also confirmed by
DNA sequencing was the presence of the mutation D323A and the
Eco47III restriction site in the 3'-5' exonuclease region. In
addition, confirmed by DNA sequencing was the F730Y mutation and
the HpaI restriction site in the O-helix region of the mutant Tne
DNA polymerase.
[0200] 6. 5'-3' Exonuclease Activity of the Mutant Tne DNA
Polymerases
[0201] The full length mutant DNA polymerase was purified as
described above. The 5'-3' exonuclease activity was determined as
described in the LTI catalog. Briefly, 1 pmol of labeled (.sup.32P)
HaeIII digested .lambda. DNA (LTI) was used for the assay. The
buffer composition is: 25 mM Tris-HCl (pH 8.3), 5 mM MgCl.sub.2, 50
mM NaCl, 0.01% gelatin. The reaction was initiated by the addition
of 0, 2, 4, 6 and 10 units of either wild type or mutant Tne DNA
polymerase in a 50 .mu.l reaction. The reaction mix was incubated
for 1 hr at 72.degree. C. A 10 .mu.l aliquot was subjected to
PEI-cellulose thin layer chromatography and the label released was
quantitated by liquid scintillation. In this assay, both D8A and
D137A mutants showed less than 0.01% label release compared to the
wild type Tne DNA polymerase. The result demonstrates that in both
D8A and D137A mutants the 5'-3' exonuclease activity has been
considerably diminished. Thus, it has been confirmed for the first
time that these two aspartates are involved with the 5'-3'
exonuclease activity.
[0202] 7. DNA Sequencing Characteristics of the Mutant DNA
Polymerases
[0203] Four separate base-specific reactions of the following
composition were set up for each Tne polymerase mutant. 6.5 nM pUC
18, 111 nM M13/pUC 23 base forward sequencing primer, 30 mM
Tris-HCl (pH 9.0), 5 mM MgCl.sub.2, 10 mM NaCl, 10 mM DTT, 0.05%
(w/v) W-1, 0.00185 U/.mu.l inorganic pyrophosphatase, 0.37
.mu.Ci/.mu.l (0.37 .mu.M) [.alpha.-.sup.35S]dATP, 16.7 .mu.M
.alpha.-thio-dATP, 16.7 .mu.M dCTP, 16.7 .mu.M 7-deaza-dGTP, 16.7
.mu.M dTTP, and either 0.042 .mu.M ddATP, 0.3 .mu.M ddCTP, 0.255
.mu.M ddGTP or 0.375 .mu.M ddTTP. In these reactions, the
concentrations of the various mutants were: 0.185 U/.mu.l Tne535FY,
or 0.170 U/.mu.l D8A, or 0.185 U/.mu.l D137A. Reaction volumes were
6 .mu.l each. Sample tubes were incubated in an MJ Research DNA
Engine thermal cycler at 95.degree. C. for 3 minutes, followed by
20 cycles of (30 seconds at 95.degree. C., 30 seconds at 55.degree.
C. and 60 seconds at 70.degree. C.), and 10 cycles of (30 seconds
at 95.degree. C. and 60 seconds at 70.degree. C.). Reactions were
terminated with 3 .mu.l of stop solution (95% (v/v) formamide, 10
mM EDTA (pH 8.0), 0.1% (w/v) bromophenol blue, 0.1% (w/v) xylene
cyanol) and denatured for two minutes at 70.degree. C. Three .mu.l
aliquots were separated on a 6% TBE/urea sequencing gel. The dried
gel was exposed to Kodak BioMAX x-ray film at room temperature
approximately 18 hours.
[0204] The results of the sequencing data suggest that both D8A and
D137A mutants of Tne DNA polymerase produced equivalent sequence
ladders with equal band intensity in all 4 lanes comparable to
another Tne DNA polymerase where the 5'-exonuclease domain was
deleted (Tne535FY). This result also suggests that both D8A and
D137A mutants are devoid of 5'-exonuclease activity since no false
bands are seen in the sequencing ladder, a characteristic of 5'-3'
exonuclease containing DNA polymerase.
EXAMPLE 17
Advantages of Tne DNA Polymerase Mutant in Sequencing Reactions
[0205] In this example, the Tne DNA polymerase of Example 12 was
used which has the Phe.sup.730.fwdarw.Tyr.sup.730 mutation (making
it non-discriminatory for dNTPs over ddNTPs), the
Asp.sup.323.fwdarw.Ala.sup- .323 mutation (which substantially
reduces 3'-to-5' exonuclease activity), and the N-terminal 219
amino acid deletion mutation (which eliminates 5'-to-3' exonuclease
activity).
[0206] Sequenase Ver 2.0.TM. is a modified T7 DNA polymerase sold
by Amersham International plc, Little Chalfont, England.
[0207] Taq DNA polymerase was purchase from LTI, Gaithersburg,
Md.
[0208] Thermo Sequenase.TM. is a Taq F.fwdarw.Y mutant containing a
5'-exonuclease deletion sold by Amersham International plc, Little
Chalfont, England.
[0209] AmpliTaq FS.TM. is a Taq F.fwdarw.Y mutant believed to
contain a Gly.sup.37 mutation sold by Perkin Elmer ABI, Foster
City, Calif.
[0210] Sequitherm.TM. is a thermophilic DNA polymerase sold by
Epicenter, Madison, Wis.
[0211] Methods
[0212] .sup.35S Cycle Sequencing with Tne DNA Polymerase
[0213] Four separate base-specific reactions of the following
composition are set up for each template: 6.5 nM dsDNA, 111 nM
primer, 30 mM Tris-HCl (pH 9.0), 5 mM MgCl.sub.2, 10 mM NaCl, 10 mM
DTT, 0.05% (w/v) W-1, 0.185 U/.mu.L Tne DNA polymerase mutant,
0.00185 U/.mu.l thermophilic inorganic pyrophosphatase, 0.37
.mu.Ci/.mu.l (0.37 .mu.M) [.alpha.-.sup.35S]dATP, 16.7 .mu.M
.alpha.-thio-dATP, 16.7 .mu.M dCTP, 16.7 .mu.M 7-deaza-dGTP, 16.7
.mu.M dTTP, and either 0.042 .mu.M ddATP, 0.3 .mu.M ddCTP, 0.255
.mu.M ddGTP or 0.375 .mu.M ddTTP. Reaction volumes are 6 .mu.l
each. Sample tubes are incubated in an MJ Research DNA Engine
thermal cycler at 95.degree. C. for 3 minutes, followed by 20
cycles of (30 seconds at 95.degree. C., 30 seconds at 55.degree. C.
and 60 seconds at 70.degree. C.), and 10 cycles of (30 seconds at
95.degree. C. and 60 seconds at 70.degree. C.). Reactions are
terminated with 3 .mu.l of stop solution (95% (v/v) formamide, 10
mM EDTA (pH 8.0), 0.1% (w/v) bromophenol blue, 0.1% (w/v) xylene
cyanol) and denatured for 2 minutes at 70.degree. C. Three
microliter aliquots are separated on a 6% TBE/urea sequencing gel.
The dried gel is exposed to Kodak BioMAX x-ray film at room
temperature for approximately 18 hours, unless otherwise
specified.
[0214] .sup.32P-end Labeled Primer Cycle Sequencing with Tne DNA
Polymerase
[0215] The sequencing primer is labeled by incubating the following
5 .mu.l reaction for 10 minutes at 37.degree. C.: 60 mM Tris-HCl,
10 mM MgCl.sub.2, 200 mM KCl, 0.6 .mu.M primer, 0.4 .mu.M (2
.mu.Ci/.mu.l) [.gamma.-.sup.32P]ATP, 0.2 U/.mu.l T4 polynucleotide
kinase. The reaction is stopped by incubating 5 minutes at
55.degree. C. Four separate base-specific reactions of the
following composition are then set up for each template: 1.1 nM
dsDNA, 67 nM .sup.32P-end-labeled primer, 30 mM Tris-HCl (pH 9.0),
5 mM MgCl.sub.2, 50 mM KCl, 0.05% (w/v) W-1, 0.185 U/.mu.l Tne DNA
polymerase, 0.00185 U/.mu.l thermophilic inorganic pyrophosphatase,
20 .mu.M dATP, 20 .mu.M dCTP, 20 .mu.M 7-deaza-dGTP, 20 .mu.M dTTP,
and either 0.4 .mu.M ddATP, 0.4 .mu.M ddCTP, 0.4 .mu.M ddGTP or 0.4
.mu.M ddTTP. Reaction volumes are 10 .mu.l each. Sample tubes are
incubated in an MJ Research DNA Engine thermal cycler at 95.degree.
C. for 3 minutes, followed by 20 cycles of (30 seconds at
95.degree. C., 30 seconds at 55.degree. C. and 60 seconds at
70.degree. C.), and 10 cycles of (30 seconds at 95.degree. C. and
60 seconds at 70.degree. C.). Reactions are terminated with 5 .mu.l
of stop solution (95% (v/v) formamide, 10 mM EDTA (pH 8.0), 0.1%
(w/v) bromophenol blue, 0.1% (w/v) xylene cyanol) and denatured for
2 minutes at 70.degree. C. Three .mu.l aliquots are separated on a
6% TBE/urea sequencing gel. The dried gel is exposed to Kodak
BioMAX x-ray film at room temperature for approximately 18 hours,
unless otherwise specified.
[0216] Single-Extension Sequencing with Tne DNA Polymerase
[0217] This reaction requires either ssDNA or denatured dsDNA. The
DNA is annealed to primer in a 10 .mu.l volume by heating for five
minutes at 50.degree. C. under the following reaction conditions:
150 nM dsDNA and 150 nM primer or 50 nM ssDNA and 50 nM primer with
60 mM Tris-HCl (pH 9.0), 60 mM KCl, 10 mM MgCl.sub.2, 0.1% (w/v)
W-1. The following labeling reaction is then incubated for five
minutes at 50.degree. C. in a 15.5 .mu.l volume: 10 .mu.l annealed
DNA-primer 0.32 .mu.Ci/.mu.l (0.32 .mu.M) [.alpha.-.sup.35S]dATP,
48.4 mM Tris HCl (pH 9.0), 48.4 mM KCl, 8.1 mM MgCl.sub.2, 194 nM
dCTP, 194 nM 7-deaza-dGTP, 194 nM dTTP, 6.5 nM DTT, 0.081% (w/v)
W-1, 0.32 U/.mu.l Tne DNA polymerase, 0.0032 U/.mu.l thermophilic
inorganic pyrophosphatase. The label mixture is then dispensed into
four base-specific specific reaction tubes. Each tube contains a
total reaction volume of 6 .mu.l and is incubated for 5 minutes at
70.degree. C. under the following conditions: DNA-labeled primer
0.19 .mu.Ci/.mu.l (0.19 .mu.M) [.alpha.-.sup.35S]dATP, 28 mM
Tris-HCl (pH 9.0), 28 mM KCl, 4.7 mM MgCl.sub.2, 42 .mu.M dATP, 42
.mu.M dCTP, 42 .mu.M 7-deaza-dGTP, 42 .mu.M dTTP, 3.8 mM DTT,
0.047% (w/v) W-1, 0.19 U/.mu.l Tne DNA polymerase, 0.0019 U/.mu.l
thermophilic inorganic pyrophosphatase and either 0.83 .mu.M ddATP,
0.83 .mu.M ddCTP, 0.83 .mu.M ddGTP or 0.83 .mu.M ddTTP. Reactions
are terminated by adding 4 .mu.l of stop solution (95% (v/v)
formamide, 10 mM EDTA (pH 8.0), 0.1% (w/v) bromophenol blue, 0.1%
(w/v) xylene cyanol) and denatured for 2 minutes at 70.degree. C.
Two .mu.l aliquots are separated on a 6% TBE/urea sequencing gel.
The dried gel is exposed to Kodak BioMAX x-ray film at room
temperature for approximately 2 hours, unless otherwise
specified.
[0218] Fluorescent Dye Primer Sequencing with Tne DNA
Polymerase
[0219] Four base-specific reactions are set up for each template.
The A and C reaction volumes are 5 .mu.l and the G and T reaction
volumes are 10 .mu.l. The composition of the reactions are as
follows: 20 nM dsDNA or 10 nM ssDNA, with 30 mM Tris-HCl (pH 9.0),
30 mM KCl, 5 mM MgCl.sub.2, 0.05% (w/v) W-1, 20 .mu.M dATP, 20
.mu.M dCTP, 20 .mu.M 7-deaza-dGTP, 20 .mu.M dTTP, 0.29 U/.mu.l Tne
DNA polymerase, 0.0029 U/.mu.l thermophilic inorganic
pyrophosphatase. Each of the four tubes also contains a
base-specific dye primer and ddNTP as follows:
[0220] A: 0.4 .mu.M JOE dye primer, 0.4 .mu.M ddATP
[0221] C: 0.4 .mu.M FAM dye primer, 0.4 .mu.M ddCTP
[0222] G: 0.4 .mu.M TAMRA dye primer, 0.4 .mu.M ddGTP
[0223] T: 0.4 .mu.M ROX dye primer, 0.4 .mu.M ddTTP
[0224] Sample tubes are incubated in a thermal cycler at 95.degree.
C. for 3 minutes, followed by 20 cycles of (30 seconds at
95.degree. C., 30 seconds at 55.degree. C. and 60 seconds at
70.degree. C.), and 10 cycles of (30 seconds at 95.degree. C. and
60 seconds at 70.degree. C.). Reactions are pooled, purified over a
CentriSep spin column, and dried. The dried pellet is dissolved in
3 .mu.l of 83% formamide, 4.2 mM EDTA (pH 8.0) and heated for 2
minutes at 90.degree. C. just before loading the entire sample on a
4.75% polyacrylamide/TBE/urea gel in an ABI 373 Stretch machine.
The gel is run at 32 watts for 14 hours.
[0225] Fluorescent Dye Terminator Sequencing with Tne DNA
Polymerase
[0226] One 20 .mu.l reaction is set up for each template. The
composition of the reaction is an follows: 12.5 nM dsDNA or 6.25 nM
ssDNA, with 0.16 .mu.M primer, 30 mM Tris-HCl (pH 9.0), 30 mM KCl,
5 mM MgCl.sub.2, 0.05% (w/v) W-1, 0.6 mM dATP, 0.6 mM dCTP, 1.8 mM
dITP, 0.6 mM dTTP, 0.5 U/ml Tne DNA polymerase, 0.005 U/.mu.l
thermophilic inorganic pyrophosphatase. The reaction also includes
four base-specific dye terminators at a final concentration 16-fold
lower than the original concentration supplied by ABI. The sample
tube is incubated in a thermal cycler for 25 cycles of (30 seconds
at 96.degree. C., 15 seconds at 50.degree. C. and 4 minutes at
60.degree. C.). The reaction is purified over a CentriSep spin
column, and dried. The dried pellet is dissolved in 3 .mu.l of 83%
formamide, 4.2 mM EDTA (pH 8.0) and heated for 2 minutes at
90.degree. C. just before loading the entire sample on a 4.75%
polyacrylamide/TBE/urea gel in an ABI 373 Stretch machine. The gel
is run at 32 watts for 14 hours.
[0227] Results
[0228] Single-Extension Sequencing
[0229] FIG. 9 shows that the efficient .sup.35S incorporation by
Tne DNA polymerase mutant provides strong signals in single- and
double-strand DNA sequencing. Alkali-denatured pUC19 DNA (1.5 pmol)
was sequenced using single-extension sequencing with Tne DNA
polymerase of Example 12 as described above (set A); film was
exposed for only 2 hours. M13 mp19(+) DNA was used at one-tenth the
normal amount of template (40 pmol) in the Tne DNA polymerase
single-extension sequencing reactions as described (set B); film
exposed for 20 hours. Since the Tne mutant produces such a strong
signal, templates can be used more economically without sacrificing
sequence quality.
[0230] FIG. 10 shows that the Tne DNA polymerase mutant generates
clear sequence from plasmids containing cDNAs with poly(dA) tails.
Alkali-denatured plasmid DNAs containing cDNA inserts (1.5 pmol)
were sequenced using either the Tne DNA polymerase mutant in
single-extension sequencing (sets A and B) as described, or
Sequenase Ver 2.0.TM. (set C) following the standard kit protocol.
Set A, .beta.-actin cDNA; set B, RPA1 cDNA (a replication protein);
and set C, RPA2 cDNA (a replication protein).
[0231] FIG. 11 compares the Tne DNA polymerase mutant,
Sequenase.TM. and Taq DNA polymerase generated sequences from a
plasmid containing poly(dC). Plasmid DNA (1.5 pmol) containing a
poly(dC)-tailed 5' RACE-derived insert was alkali denatured. The
DNA was sequenced using Tne DNA polymerase mutant in
single-extension sequencing (set A) as described, Sequenase Ver
2.0.TM. (set B) as described in the kit manual, and by Taq DNA
polymerase (set C) following the recommended protocol in the
TaqTrack kit (Promega, Madison, Wis.).
[0232] Cycle Sequencing
[0233] FIG. 12 shows that the Tne DNA polymerase mutant in cycle
sequencing produces .sup.35S-labeled sequence 3-fold stronger than
Thermo Sequenase.TM. and without the 60-cycle labeling step.
Plasmid DNA (0.5 .mu.g) containing a poly(dC)-tailed 5'
RACE-derived insert was cycled sequenced using Tne DNA polymerase
mutant (set A) as described; film exposure was 6 hours. Using
Thermo Sequenase.TM. as described in the kit manual, the plasmid
DNA (0.5 .mu.g) was labeled with .sup.35S by partial primer
extension using an incubation of 60 cycles. This was followed by
the standard cycle sequencing protocol in the presence of chain
terminators (set B); film exposure was 18 hours. The plasmid DNA
(0.5 .mu.g) was cycle sequenced using Taq DNA polymerase (set C) as
described in the fmol kit manual; film exposure was 18 hours. Note,
uneven band intensities in set C.
[0234] FIG. 13 shows that the Tne DNA polymerase mutant produces
high quality sequences of in vitro amplified DNA. Templates were in
vitro amplified directly from E. coli chromosomal DNA, from plasmid
pSC101 and from human genomic DNA, purified by simple isopropanol
precipitation and quantitated. DNAs (100 fmol) were cycle sequenced
as described using the Tne DNA polymerase mutant and one of the
amplification primers. Set A, E. coli .beta. polI (.about.450 bp);
set B, E. coli rrsE (.about.350 bp); set C, ori from pSC101
(.about.1.5 kb); and set D, an exon from human HSINF gene
(.about.750 bp); amplified product sizes in parentheses. Note,
these DNAs could not be sequenced using Thermo Sequenase.TM.
because the primers did not meet the extra requirements for the
labeling reaction.
[0235] FIGS. 14A and 14B show that the Tne DNA polymerase mutant
provides superior sequence from double-stranded DNA clones
containing poly(dA) or poly(dC) stretches. FIG. 14A, supercoiled
plasmid DNAs containing inserts with homopolymers were cycle
sequenced using the Tne DNA polymerase mutant as described; film
exposure was 6 hours. Set A, RPA1; set B, elf (cap binding
protein); and set C, a poly(dC)-tailed 5' RACE-derived insert.
[0236] FIG. 14B, supercoiled plasmid DNAs containing inserts with
homopolymers were cycled sequenced using Taq DNA polymerase (set D)
in the fmol kit manual, or SequiTherm.TM. (sets E-G) following the
kit manual; film exposure was 18 hours. Set D, RPA; set E, RPA; set
F, a poly(dC)-tailed 5' RACE-derived insert; and set G, elf. Note,
the many false stops, especially in the homopolymer region.
[0237] FIG. 15 shows cycle sequencing using the Tne DNA polymerase
mutant and .sup.32P end-labeled primer. A sequencing primer was
first 5'-end labeled with .sup.32P using T4 kinase. A supercoiled
plasmid DNA (50 fmol) was cycle sequenced using the Tne DNA
polymerase mutant as described; film exposure was 18 hours. The
left and right sets are aliquots of the same reaction, the right
set loaded on the gel 45 minutes after the left.
[0238] Fluorescent Automated Sequencing
[0239] FIGS. 16A-16C and 16D-16F show a comparison of the Tne DNA
polymerase mutant (16A-16C) to AmpliTaq FS.TM. (16D-16F) in
fluorescent dye primer sequencing. pUC19 DNA was sequenced with dye
primers (ABI, Foster City, Calif.) using either the Tne DNA
polymerase mutant or AmpliTaq FS.TM. as described.
[0240] FIGS. 17A-17C and 17D-17F show a comparison of the Tne DNA
polymerase mutant (17A-17C) to AmpliTaq FS.TM. (17D-17F) in
fluorescent dye terminator sequencing. pUC19 DNA was sequenced with
dye terminators (ABI, Foster City, Calif.) using either the Tne DNA
polymerase mutant or AmpliTaq FS.TM. as described. Note, greater
evenness of peak heights with Tne.
[0241] These results demonstrate that the Tne DNA polymerase mutant
gives unexpectedly better results in DNA sequencing compared to
other DNA polymerases, whether they are similar mutants or not.
[0242] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention,
and without departing from the spirit and scope thereof, can make
various changes and modifications of the invention to adapt it to
various usages and conditions without undue experimentation. All
patents, patent applications and publications cited herein are
incorporated by reference in their entirety.
Sequence CWU 1
1
* * * * *