U.S. patent application number 10/346493 was filed with the patent office on 2003-08-21 for bispecific antisense olignucleotides that inhibit igfbp-2 and igfbp-5 and methods of using same.
Invention is credited to Gleave, Martin, Signaevsky, Maxim.
Application Number | 20030158143 10/346493 |
Document ID | / |
Family ID | 27613360 |
Filed Date | 2003-08-21 |
United States Patent
Application |
20030158143 |
Kind Code |
A1 |
Gleave, Martin ; et
al. |
August 21, 2003 |
Bispecific antisense olignucleotides that inhibit IGFBP-2 and
IGFBP-5 and methods of using same
Abstract
Bispecific antisense oligonucleotides which consist essentially
of a sequence of bases that is complementary to portions of both
the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5
are useful in as antisense therapeutics in the treatment of
endocrine-regulated cancers.
Inventors: |
Gleave, Martin; (Vancouver,
CA) ; Signaevsky, Maxim; (Vancouver, CA) |
Correspondence
Address: |
OPPEDAHL AND LARSON LLP
P O BOX 5068
DILLON
CO
80435-5068
US
|
Family ID: |
27613360 |
Appl. No.: |
10/346493 |
Filed: |
January 17, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60350046 |
Jan 17, 2002 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 435/6.14; 536/23.2 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/11 20130101; A61P 35/04 20180101; A61K 31/713 20130101;
A61K 38/00 20130101; A61P 35/00 20180101; C12N 2310/111 20130101;
C07K 2319/00 20130101; C12N 2310/3519 20130101; C12N 2310/51
20130101 |
Class at
Publication: |
514/44 ; 435/375;
435/6; 536/23.2 |
International
Class: |
A61K 048/00; C12Q
001/68; C07H 021/04 |
Claims
1. A bispecific antisense oligonucleotide which consist essentially
of a sequence of bases that is complementary to portions of both
the gene encoding IGFBP-2 and the gene encoding IGFBP-5, and which
is sufficient length to act as an inhibitor of the effective amount
of IGFBP-2 and IGFBP-5.
2. The antisense oligonucleotide according to claim 1, wherein the
oligonucleotide consists essentially of a series of bases as set
forth in Seq. ID. No. 1.
3. The antisense oligonucleotide according to claim 1, wherein the
oligonucleotide consists essentially of a series of bases as set
forth in Seq. ID. No. 2.
4. The antisense oligonucleotide according to claim 1, wherein the
oligonucleotide consists essentially of a series of bases as set
forth in any of Seq. ID. Nos. 3 through 7.
5. A method for making a pharmaceutical composition for treatment
of endocrine-regulated cancers, comprising the steps of combining a
bispecific antisense oligonucleotide with a pharmaceutically
acceptable carrier for intravenous, intraperitoneal, subcutaneous
or oral administration, wherein the bispecific antisense
oligonucleotide consists essentially of a sequence of bases that is
complementary to portions of both the gene encoding IGFBP-2 and the
gene encoding IGFBP-5, and which is sufficient length to act as an
inhibitor of the effective amount of IGFBP-2 and IGFBP-5.
6. The method of claim 5, wherein the oligonucleotide consists
essentially of a series of bases as set forth in Seq. ID. No.
1.
7. The method of claim 5, wherein the oligonucleotide consists
essentially of a series of bases as set forth in Seq. ID. No.
2.
8. The method of claim 5, wherein the oligonucleotide consists
essentially of a series of bases as set forth in any of Seq. ID.
Nos. 3 through 7.
9. A method for treating an endocrine-regulated cancer in a subject
suffering from the endocrine-regulated cancer, comprising the step
of administering to the subject a bispecific antisense
oligonucleotide in an amount effective to reduce the effective
levels of IGFBP-2 and/or IGFBP-5 in cells of the
endocrine-regulated cancer, wherein the bispecific antisense
oligonucleotide consists essentially of a sequence of bases that is
complementary to portions of both the gene encoding IGFBP-2 and the
gene encoding IGFBP-5, and which is sufficient length to act as an
inhibitor of the effective amount of IGFBP-2 and IGFBP-5.
10. The method of claim 9, wherein the oligonucleotide consists
essentially of a series of bases as set forth in Seq. ID. No.
1.
11. The method of claim 9, wherein the oligonucleotide consists
essentially of a series of bases as set forth in Seq. ID. No.
2.
12. The method of claim 9, wherein the oligonucleotide consists
essentially of a series of bases as set forth in any of Seq. ID.
Nos. 3 through 7.
13. The method of claim 9, wherein the cancer is prostate
cancer.
14. The method of claim 9, wherein the cancer is breast cancer.
15. A pharmaceutical composition comprising an antisense
oligonucleotide and a pharmaceutically acceptable carrier, wherein
the bispecific antisense oligonucleotide consists essentially of a
sequence of bases that is complementary to portions of both the
gene encoding IGFBP-2 and the gene encoding IGFBP-5, and which is
sufficient length to act as an inhibitor of the effective amount of
IGFBP-2 and IGFBP-5.
16. The compositions of claim 15, wherein the oligonucleotide
consists essentially of a series of bases as set forth in Seq. ID.
No. 1.
17. The compositions of claim 15, wherein the oligonucleotide
consists essentially of a series of bases as set forth in Seq. ID.
No. 2.
18. The compositions of claim 15, wherein the oligonucleotide
consists essentially of a series of bases as set forth in any of
Seq. ID. Nos. 3 through 7.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/350,046, filed Jan. 17, 2002, which is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] This present application relates to bispecific antisense
olignucleotides that inhibit IGFBP-2 and IGFBP-5 and methods of
using same in the treatment of endocrine-regulated tumors (for
example, breast, prostate, ovarian and colon cancers).
[0003] Prostate cancer is the most common cancer that affects men,
and the second leading cause of cancer deaths in men in the Western
world. Because prostate cancer is an androgen-sensitive tumor,
androgen withdrawal, for example via castration, is utilized in
some therapeutic regimens for patients with advanced prostate
cancer. Androgen withdrawal leads to extensive apoptosis in the
prostate tumor, and hence to a regression of the disease. However,
castration-induced apoptosis is not complete, and a progression of
surviving tumor cells to androgen-independence ultimately occurs.
This progression is the main obstacle to improving survival and
quality of life, and efforts have therefore been made to target
androgen-independent cells. These efforts have focused on
non-hormonal therapies targeted against androgen-independent tumor
cells, however as of a 1998 report, no non-hormonal agent had
improved survival. Oh et al., J. Urol 160: 1220-1229 (1998)
Alternative approaches are therefore indicated.
[0004] Insulin-like growth factor (IGF)-I and IGF-II are potent
mitogens for many normal and malignant cells. Accumulating evidence
suggests that IGFs play an important role in the pathophysiology of
prostatic disease and breast cancer. Boudon et al., J. Clin.
Endocrin. Metab. 81: 612-617 (1996); Angelloz-Nicoud et al.,
Endocrinology 136: 5485-5492 (1995); Nickerson et al.,
Endocrinology 139: 807-810 (1998); Figueroa et al., J. Urol. 159:
1379-1383 (1998).
[0005] The biological response to IGF's is regulated by various
factors, including IGFBPs. To date, six IGFBPs have been identified
whose function is believed to involve modulation of the biological
actions of the IGFs through high affinity interactions. Rajaram et
al., Endocrin. Rev. 18: 801-813 (1997). However, some evidence
suggests biological activity for IGFBPs that are independent of
IGFs, Id., Andress et al., J. Biol. Chem. 267: 22467-22472 (1992);
Oh et al., J. Biol. Chem. 268: 14964-14971 (1993), and both
stimulatory and inhibitory effects of IGFBPs on cell proliferation
have been reported under various experimental conditions. Andress
et al., supra; Elgin et al., Proc. Nat'l. Acad. Sci. (USA), 84,
3254-3258 (1987); Huynh et al., J. Biol. Chem. 271: 1016-1021
(1996); Damon et al., Endocrinology 139: 3456-3464 (1998). Thus,
the precise function role of IGFBPs remains controversial. Because
of this, while the reported results implicate IGF in prostate and
breast cancer, they do not clearly suggest a therapeutic approach
based upon this involvement.
[0006] PCT Publication WO 01/05435, which is incorporated herein by
reference, describes a method for treating hormone-regulated tumors
(for example, breast and prostatic tumors) in mammals, including
humans, by administration of an antisense oligodeoxynucleotide
which is complementary to a portion of the gene encoding IGFBP-5.
PCT Publication No. WO 02/22642, which is incorporated herein by
reference, describes a method are provided for the treatment of
prostate and other endocrine tumors in mammals, including humans,
by administration of an antisense oligodeoxynucleotide which is
complementary to a portion of the gene encoding IGFBP-2.
[0007] The present invention utilizes bispecific antisense
oligodeoxynucleotides targeted to both IBFBP-2 and IGFBP-5 as a
treatment for endocrine-regulated cancers. Antisense
oligodeoxynucleotides are chemically modified stretches of
single-stranded DNA that are complementary to mRNA regions of a
target gene, and thereby effectively inhibit gene expression by
forming RNA/DNA duplexes. Figueroa, et al., J. Urol., 159:1379-1383
(1998). Phosphorothioate oligodeoxynucleotides are stabilized to
resist nuclease digestion by substituting one of the nonbridging
phosphoryl oxygen of DNA with a sulfur. Recently, several antisense
oligodeoxynucleotides specifically targeted against genes involved
in neoplastic progression have been evaluated both in vitro and in
vivo, and demonstrated the efficacy of antisense strategy as
potential therapeutic agents. Monia, et al. Nature Med. 2: 668-675
(1996.); Cucco, et al., Cancer Res. 56: 4332-4337 (1996); Ziegler,
et al., J. Natl. Cancer Inst. 89: 1027-1036 (1997); Jansen, et al.,
Nature Med. 4: 232-234 (1998).
SUMMARY OF THE INVENTION
[0008] The present invention provides a method for treating
endocrine-regulated tumors (for example, breast, prostate, ovarian
and colon cancers) in mammals, including humans, by administration
of a bispecific antisense oligodeoxynucleotide which is
complementary to portions of both the gene encoding IGFBP-2 and the
gene encoding IGFBP-5. The administration of such an
oligodeoxynucleotide was shown to reduce levels of both IGFBP-2 and
IGFBP-5 in PC3 and LNCaP cells, and the reduction of expression of
the proteins has been previously shown to reduce proliferation of
tumor cells, and also to delay the progression to androgen
independence. Thus, in accordance with the invention we provide
methods for treatment of prostate cancer in mammals, including
humans, and for delaying the progression of prostate tumors to
androgen independence comprising the step of administering to the
mammal a therapeutically effective amount of a bispecific antisense
oligodeoxynucleotide which is complementary to portions of both the
nucleic acid sequence encoding IGFBP-2 and the nucleic acid
sequence encoding IGFBP-5, and which hybridizes with such sequences
to inhibit or otherwise reduce the expression of IGFBP-2 and
IGFBP-5.
[0009] The application further provides bi-specific antisense
sequences that can be used in the method of the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0010] FIG. 1 the amount of IGBFP-2 and IGBFP-5 expression observed
in LNCaP and PC3 cells, respectively, upon administration of the
three bispecific antisense oligonucleotide, a mismatch control
(MM), or no olignucleotide (control).
[0011] FIG. 2 shows the increase in IGFBP-2 expression in prostate
cancer cells during progression to androgen indpendence.
[0012] FIGS. 3A-E shows inhibition of IGFBP-2 and 5 in prostate
cancer and bone cells using various antisense oligonucleotides.
[0013] FIGS. 4 and 5 show real time PCR results for levels of
IGFBP-2 and IGFBP-5 in RT4 bladder cancer cells after treatment
with antisense oligonucleotides of the invention.
[0014] FIG. 6 shows results of real time PCR measurement of IGFBP-5
in MSF human fetal fibroblast cells after antisense treatment.
[0015] FIG. 7 shows the results of real time PCR measurements of
IGFBP-2 and IGFBP-5 LNCaP/msf in mixed tumors and in intact fetal
bone fragments
DETAILED DESCRIPTION OF THE INVENTION
[0016] The present invention provides bispecific antisense
oligonucleotides which consist essentially of a sequence of bases
that is complementary to portions of both the gene encoding IGFBP-2
and the gene encoding IGFBP-5, and that is sufficient length to act
as an inhibitor of the effective amount of IGFBP-2 and IGFBP-5 (in
general at least 15 bases). As used in the specification and claims
of this application, this language means that substantially all of
the antisense oligonucleotide is complementary to a portion of each
gene sequence. The invention does not, however, exclude minor
modifications in sequence, such as the addition of one or two
terminal bases, or single base substitutions which might depart
from perfect complementarity but which still function as an
inhibitor of the effective amount of IGFBP-2 and IGFBP-5.
[0017] The phrase "inhibitor of the effective amount" takes into
account the fact that antisense oligonucleotides may function by
different mechanisms. The effective amount of IGFBP-2 or IGFBP-5 is
the amount that is present in a functional state in the cell.
Reduction of this amount by administration of antisense
oligonucleotides may occur through restricting production of the
IGFBP (at the transcription or translation level) or by degrading
the IGFBP at a rate faster than it is being produced. Further, it
will be appreciated that the inhibition which is referred to is one
which occurs when the IGFBP would otherwise be present if the
antisense oligonucleotide had not been administered. As discussed
below, not all cells that are potential therapeutic targets express
both IGFBP-2 and IGFBP-5.
[0018] Specific antisense oligonucleotides according to the
invention consist essentially of a series of bases as set forth in
Seq. ID. No. 1 through 7. These sequences are set forth in Table
1.
1TABLE 1 Seq. ID NO. Sequence 1 ggtgtagacgccgcacg 2
gcagcgcagcccctgg 3 gcagcagccgcageccggctcc 4 agccgcagcccggctcct 5
cagcagccgcagcccggctc 6 gcagcagcegcagcccggct 7
agcagccgcagcecggctcc
[0019] The antisense oligonucleotides employed may be modified to
increase the stability of the antisense oligonucleotide in vivo.
For example, the antisense oligonucleotides may be employed as
phosphorothioate derivatives (replacement of a non-bridging
phosphoryl oxygen atom with a sulfur atom) which have increased
resistance to nuclease digestion. Increased antisense
oligonucleotide stability can also be achieved using molecules with
2-methoxyethyl (MOE) substituted backbones as described generally
in U.S. Pat. No. 6,451,991 and U.S. patent application Ser. No.
10/080,794 which are incorporated herein by reference.
[0020] The compositions of the present invention can be used for
treatment of endocrine-regulated tumors (for example, breast,
prostate, ovarian and colon cancers) in mammals, including humans,
by administration of a bispecific antisense oligonucleotide in
accordance with the invention. Administration of antisense
oligonucleotides can be carried out using the various mechanisms
known in the art, including naked administration and administration
in pharmaceutically acceptable carriers. For example, lipid
carriers for antisense delivery are described in U.S. Pat. Nos.
5,855,911 and 5,417,978 which are incorporated herein by reference.
In general, the antisense is administered by intravenous,
intraperitoneal, subcutaneous or oral routes. Where the
oligonucleotides are administered in a pharmaceutically acceptable
carrier, the carrier is generally free from substances which
produce toxic or other harmful reactions when administered to
humans.
[0021] The amount of antisense oligonucleotide administered is one
effective to reduce the effective amount of levels of IGFBP-2
and/or IGFBP-5 in the endocrine-regulated tumor cell of concern. As
noted above, in the context of the present invention, applicants do
not intend to be bound by any specific mechanism by which this
reduction may occur, although it is noted that the reduction may
occur as a result of reduced expression of IGFBP-2 and -5 if the
antisense molecule interferes with translation of the mRNA, or via
an RNase mediated mechanism. Furthermore, it will be appreciated
that the appropriate therapeutic amount will vary both with the
effectiveness of the specific antisense oligonucleotide employed,
and with the nature of any carrier used. The determination of
appropriate amounts for any given composition is within the skill
in the art, through standard series of tests designed to assess
appropriate therapeutic levels.
[0022] The method for treating endocrine-regulated cancer in
accordance with the invention may further include administration of
chemotherapy agents and/or additional antisense oligonucleotides
directed at different targets. For example, conventional
chemotherapy agents such as taxol (paclitaxel or docetaxel) and
mitoxanthrone may be used. Similarly, combinations of the
bispecific antisense oligonucleotide of the invention with other
antisense sequences such as antisense Bcl-2 oligonucleotide, TRPM-2
(clusterin) oligonucleotide, IGFBP-2 or IGFBP-5 oligonucleotide may
be used.
[0023] The effectiveness of the present invention is founded on
solid theoretical and experimental bases. Activation of alternative
growth factor pathways following androgen withdrawal is one
mechanism mediating androgen independent (AI) progression in
advanced prostate cancer. Insulin-like growth factor-I (IGF-I)
activation is modulated by a family of insulin-like growth factor
binding proteins (IGFBPs). Although IGFBP-2 and IGFBP-5 are among
the most commonly over-expressed genes in hormone refractory
prostate cancer, the functional significance of changes in IGF-I
signaling during AI progression remain poorly defined. AI
progression of prostate cancer leads to treatment resistance and
ultimately culminates in the development of bone metastases, the
most ominous sign of clinical progression in prostate cancer
patients with advanced disease. This development usually precedes
death by 12-18 months. The bone environment, particularly rich in
IGFBP-5, has long been identified as an attractive "soil" for
supporting prostate cancer metastasis. The crucial IGF-1 signaling
components IGFBP-2 and IGFBP-5 may not only be key to AI
progression but also to the site-specific metastasis of prostate
cancer. In an attempt to address these issues, we characterized
changes in IGFBP-2 and IGFBP-5 in prostate cancer models after
androgen withdrawal and evaluated their functional significance in
AI progression using gain-of-function and loss-of-function
analyses.
[0024] IGFBP-2 mRNA and protein levels increase 2-3-fold after
androgen withdrawal in LNCaP cells in vitro in LNCaP tumors during
AI progression in vivo. Increased IGFBP-2 levels after castration
were also identified using a human prostate tissue microarray of
untreated and post-hormone therapy-treated prostatectomy specimen.
LNCaP cell transfectants (LNBP-2) that stably over-expressed
IGFBP-2 had a shorter cell doubling-time and a lower rate of
apoptosis in the absence of androgens. Reporter assays demonstrated
that this increased growth potential did not result from
IGFBP-2-mediated transcription of androgen-response elements. In
vivo, the LNBP-2 cell line formed significantly more tumors in
castrate mice and progressed to androgen independence more rapidly
compared with a control cell line. Antisense oligonucleotides
targeting IGFBP-2 reduced IGFBP-2 mRNA and protein expression by
>70% in a dose-dependent and sequence-specific manner. Antisense
oligonucleotide-induced decreases in IGFBP-2 reduced LNCaP cell
growth rates and increased apoptosis 3-fold. LNCaP tumor growth and
serum PSA levels in mice treated with castration plus adjuvant
IGFBP-2 antisense oligonucleotide s were significantly reduced
compared to mismatch control oligonucleotides.
[0025] Similar findings were obtained with gain-of-function and
loss-of-function analyses of IGFBP-5 in IGFBP-5 expressing prostate
cancer models. The growth rates of IGFBP-5 transfected LNCaP cells
were significantly faster compared to either the parental or
vector-only transfected LNCaP cells in both the presence and
absence of dihydrotestosterone. IGFBP-5-induced increases in LNCaP
cell proliferation occurs through both IGF-I-dependent and
-independent pathways, with corresponding increases in the cyclin
D1 mRNA expression and the fraction of cells in S+G2/M phases of
the cell cycle. Changes in Akt/protein kinase B (PKB), a downstream
component of phosphatidylinositol 3'-kinase (PI3K) pathway, in the
LNCaP sublines also paralleled changes in their growth rates.
Although treatment with a PI3K inhibitor induced apoptosis in both
control and IGFBP-5-overexpressing LNCaP cells, this PI3K
inhibitor-induced apoptosis was prevented by exogenous IGF-I
treatment only in IGFBP-5 transfectants, suggesting that IGFBP-5
overexpression can potentiate the antiapoptotic effects of IGF-I.
Furthermore, tumor growth and serum PSA levels increased several
fold faster in mice bearing IGFBP-5-transfected LNCaP tumors after
castration despite having similar tumor incidence and tumor growth
rates with controls when grown in intact mice before castration.
These data suggest that IGFBP-5 overexpression in prostate cancer
cells after castration is an adaptive cell survival mechanism that
helps potentiate the antiapoptotic and mitogenic effects of IGF-I,
thereby accelerating progression to androgen-independence through
activation of the PI3K-Akt/PKB signaling pathway. Systemic
administration of IGFBP-5 antisense oligonucleotides significantly
delayed time to progression to androgen independence and inhibited
growth of AI recurrent tumors. IGFBP-5 expression in human bone was
confirmed.
[0026] Inhibiting IGFBP-2 and IGFBP-5 expression using targeted
antisense technologies provides a treatment platform to delay AI
progression and bone metastasis in prostate cancer patients and
patients with other malignancies expressing these key regulators of
IGF-1 signaling. By targeting both IGFBP-2 and IGFBP-5
simultaneously with a single antisense oligonucleotide the
complications associated with use of a cocktail of antisense
oligonucleotides targeting either of these compounds separately are
avoided.
[0027] The application is further described in the following
non-limiting examples.
EXAMPLE 1
[0028] LNCaP cells were treated with treated with 500 nM
concentrations of antisense oligonucleotides of Seq. ID Nos. 1, 2
or 3 or a mismatch control. Levels of IGFBP-2 were measured. The
result are summarized in FIG. 1A.
[0029] PC3 cells were treated with treated with 500 nM
concentrations of antisense oligonucleotides of Seq. ID Nos. 1, 2
or 3 or a mismatch control. Levels of IGFBP-5 were measured. The
result are summarized in FIG. 1B.
EXAMPLE 2
[0030] Samples of human prostate cancer cells were sectioned and
immuno-stained to detect IGFBP-2. Tissue microarray scoring showed
expression of IGFBP-2 was essentially absent in benign,
non-cancerous tissues but increased with time to highest levels
after androgen independent was achieved. (FIG. 2)
EXAMPLE 3
[0031] Osseous metastases of human prostate cancer was evaluated in
15 specimens. Human prostate cancer expressed IGFBP-2 in very high
levels, but also expressed IGFBP-5. Human bone osteocytes expressed
high levels of IGFBP-5 and lower levels of IGFBP-2.
EXAMPLE 4
[0032] Bispecific antisense oligonucleotides were used to treat
PC3, LNCaP and bone cells at concentration of 500 nm, and the
amount of inhibition of IGFBP-2 or IGFBP-5 was measured using real
time PCR. Oligonucleotides of Seq. ID Nos. 2, 4, 5 and 7 were
tested, and all were effective to reduce the detected amount of the
IGFBP measured. (FIG. 3A) Reductions of up to 70% in IGFBP-2 levels
were also observed in A549 lung cells using 500 nM of Seq. ID Nos.
4 and 5. (FIG. 3B) Seq. ID No. 4 (500 nM) was also shown to be
effective to inhibit cell growth of LNCaP cells and reduce the cell
number by more than 90%. (FIG. 3C) FIGS. 3D and E respectively show
results for inhibition of IGFBP-5 levels in PC3 cells with 500 nM
of Seq ID Nos. 1, 2, 4 5, 6 and 7; and inhibition of IGBFP-5 levels
in human fetal bone fobroblast cells with 500 nM of Seq. ID Nos. 1,
2, 4, 5, 6 and 7.
EXAMPLE 5
[0033] Real time PCR was used to measure the amount IGFBP-5 in MSF
human fetal fibroblast cells after treatment with antisense
oligonucleotide and LIPOFECTIN (4 .mu.g/ml). Cells were plated in
vitro and treated with a four-hour pulse of 500 nM oligonucleotide
followd by a 20 hour period in normalmedium plus 5% serum. A second
four-hour pulse was repeated on day 2 and the cells were counted on
day 3. The most active antisense oligonucleotides were Seq. ID Nos.
4 and 5. (FIG. 6)
EXAMPLE 6
[0034] Real time PCR was used to evaluate the amounts of IGFBP-2
and IGFBP-5 in human bladder cancer (RT4) following treatment with
varying amounts of antisense oligonucleotides (Seq. ID Nos. 4 and
5) and 4 .mu.g/ml LIPOFECTIN. As shown in FIGS. 4 and 5, a dose
dependent response was observed to both antisense oligonucleotides
at concentrations ranging from 50 to 500 nM.
EXAMPLE 7
[0035] Real time PCR was used to measure IGFBP-2 and IGFBP-5 in
LNCaP/msf mixed tumors and in intact fetal bone fragments. The
results are shown in FIG. 7.
* * * * *