U.S. patent application number 10/316763 was filed with the patent office on 2003-08-21 for cdna for human methylenetetrahydrofolate reductase.
Invention is credited to Goyette, Philippe, Rozen, Rima.
Application Number | 20030157530 10/316763 |
Document ID | / |
Family ID | 10755786 |
Filed Date | 2003-08-21 |
United States Patent
Application |
20030157530 |
Kind Code |
A1 |
Rozen, Rima ; et
al. |
August 21, 2003 |
cDNA for human methylenetetrahydrofolate reductase
Abstract
Provided herein is a heretofore unknown isolated nucleic acid
molecule which encodes human methylenetetrahydrofolate reducatase,
along with an amino acid sequence of methylenetetrahydrofolate
reductase, and a cDNA probe for human methylenetetrahydrofolate
reductase. Also provided are a molecule description of mutations in
humans resulting in a phenotype having reduced levels of
methylenetetrahydrofolate reductase, and methods of diagnosing
methylenetetrahydrofolate reductase deficiency in a human.
Inventors: |
Rozen, Rima; (Montreal West,
CA) ; Goyette, Philippe; (Montreal, CA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
10755786 |
Appl. No.: |
10/316763 |
Filed: |
December 11, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10316763 |
Dec 11, 2002 |
|
|
|
09660872 |
Sep 13, 2000 |
|
|
|
6528259 |
|
|
|
|
09660872 |
Sep 13, 2000 |
|
|
|
09258928 |
Mar 1, 1999 |
|
|
|
6218120 |
|
|
|
|
09258928 |
Mar 1, 1999 |
|
|
|
08738000 |
Feb 12, 1997 |
|
|
|
6074821 |
|
|
|
|
Current U.S.
Class: |
435/5 ; 435/6.17;
514/1 |
Current CPC
Class: |
C12Q 2600/156 20130101;
A61K 31/495 20130101; C12N 9/0026 20130101; A61K 48/00 20130101;
C12Q 1/6883 20130101; A61K 38/00 20130101; C12N 9/0028
20130101 |
Class at
Publication: |
435/6 ;
514/1 |
International
Class: |
C12Q 001/68; A61K
031/00 |
Foreign Application Data
Date |
Code |
Application Number |
May 26, 1994 |
GB |
9410620.0 |
Feb 28, 2000 |
WO |
PCT/IB00/00442 |
May 25, 1995 |
WO |
PCT/CA95/00314 |
Claims
1. A method for treating an individual having an MTHFR allele
variant correlated to increased or decreased toxicity of a
treatment, said method comprising: (a) analyzing a nucleic acid
sample obtained from said individual to determine whether said
sample comprises at least one MTHFR allele variant, said variant
leading to a decrease in MTHFR activity, and said variant being
correlated to increased or decreased toxicity to a treatment for a
disorder selected from the group consisting of cardiovascular
disorders, coronary and arterial disorders, osteoporosis, and
neurological disorders; and (b) administering said treatment to
said individual having said MTHFR allele variant.
2. A method for treating an individual having an MTHFR allele
variant correlated to increased or decreased toxicity of a
treatment, said method comprising: (a) analyzing a nucleic acid
sample obtained from said individual to determine whether said
sample comprises at least one MTHFR allele variant, said variant
leading to a decrease in MTHFR activity, and said variant being
correlated to increased or decreased toxicity to a treatment
selected from the group consisting of antibiotics and antiepileptic
agents; and (b) administering said treatment to said individual
having said MTHFR allele variant.
3. A method for selecting a treatment that has increased or
decreased toxicity in an individual having an MTHFR allele variant,
said method comprising: (a) analyzing a nucleic acid sample
obtained from said individual to determine whether said sample
comprises at least one MTHFR allele variant, said variant leading
to a decrease in MTHFR activity, and said variant being correlated
to increased or decreased toxicity to a treatment for a disorder
selected from the group consisting of cardiovascular disorders,
coronary and arterial disorders, osteoporosis, and neurological
disorders; and (b) selecting a treatment known to have increased or
decreased drug toxicity in an individual having said MTHFR allele,
wherein said treatment is for a disorder selected from the group
consisting of cardiovascular disorders, coronary and arterial
disorders, osteoporosis, and neurological disorders.
4. A method for selecting a treatment that has increased or
decreased toxicity in an individual having an MTHFR allele variant,
said method comprising: (a) analyzing a nucleic acid sample
obtained from said individual to determine whether said sample
comprises at least one MTHFR allele variant, said variant leading
to a decrease in MTHFR activity, and said variant being correlated
to increased or decreased toxicity to a treatment selected from the
group consisting of antibiotics and antiepileptic agents; and (b)
selecting a treatment known to have increased or decreased drug
toxicity in an individual having said MTHFR allele, wherein said
treatment is selected from the group consisting of antibiotics and
antiepileptic agents.
5. The method of claim 1 or 2, wherein said treatment affects
folate metabolism and leads to an increased level of folate or to a
decreased level of homocysteine.
6. The method of claim 1 or 2, wherein said treatment is for a
disorder associated with reduced MTHFR activity.
7. The method of claim 1 or 2, wherein said treatment is for a
disorder associated with said MTHFR allele variant.
8. The method of claim 1 or 2, wherein said MTHFR allele variant is
associated with a disorder influenced by folic acid metabolism.
9. The method of claim 1 or 3, wherein said disorder is a neural
tube defect.
10. The method of claim 1 or 2, wherein said MTHFR allele variant
correlates with increased drug responsiveness to said a treatment,
and wherein said treatment affects folate metabolism and leads to
an increased level of folate or to a decreased level of
homocysteine.
11. The method of claim 1 or 2, further comprising administering
folate or folic acid to said individual.
12. The method of claim 1 or 2, wherein said MTHFR allele variant
is selected from the group consisting of 167G/A, 482G/A, 559C/T,
677C/T, 692C/T, 764C/T, 792+1G/A, 985C/T, 1015C/T, and 1081C/T.
13. The method of claim 12, wherein said MTHFR allele variant is
677C/T.
14. A method for identifying an individual having an MTHFR allele
variant correlated to increased or decreased toxicity of a
treatment, said method comprising analyzing a nucleic acid sample
obtained from an individual to determine whether said sample
comprises at least one MTHFR allele variant correlated to increased
or decreased toxicity of a treatment for a disorder selected from
the group consisting of cardiovascular disorders, coronary and
arterial disorders, osteoporosis, and neurological disorders,
wherein said MTHFR allele variant leads to a decrease in MTHFR
activity.
15. A method for identifying an individual having an MTHFR allele
variant correlated to increased or decreased toxicity of a
treatment, said method comprising analyzing a nucleic acid sample
obtained from an individual to determine whether said sample
comprises at least one MTHFR allele variant correlated to increased
or decreased toxicity of a treatment selected from the group
consisting of antibiotics and antiepileptic agents, wherein said
MTHFR allele variant leads to a decrease in MTHFR activity.
Description
RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 08/738,000 filed Feb. 12, 1997, which is still
pending.
BACKGROUND OF THE INVENTION
[0002] (a) Field of the Invention
[0003] The invention relates to a cDNA probe for human
methylenetetrahydrofolate reductase (MTHFR), and its uses.
[0004] (b) Description of Prior Art
[0005] Folic acid derivatives are coenzymes for several critical
single-carbon transfer reactions, including reactions in the
biosynthesis of purines, thymidylate and methionine.
Methylenetetrahydrofolate reductase (MTHFR; EC 1.5.1.20) catalyses
the NADPH-linked reduction of 5,10-methylenetetrahydrofolate to
5-methyltetrahydrofolate, a co-substrate for methylation of
homocysteine to methionine. The porcine liver enzyme, a
flavoprotein, has been purified to homogeneity; it is a homodimer
of 77-kDa subunits. Partial proteolysis of the porcine peptide has
revealed two spatially distinct domains: an N-terminal domain of 40
kDa and a C-terminal domain of 37 kDa. The latter domain contains
the binding site for the allosteric regulator
S-adenosylmethionine.
[0006] Hereditary deficiency of MTHFR, an autosomal recessive
disorder, is the most common inborn error of folic acid metabolism.
A block in the production of methyltetrahydrofolate leads to
elevated homocysteine with low to normal levels of methionine.
Patients with severe deficiencies of MTHFR (0-20% activity in
fibroblasts) can have variable phenotypes. Developmental delay,
mental retardation, motor and gait abnormalities, peripheral
neuropathy, seizures and psychiatric disturbances have been
reported in this group, although at least one patient with severe
MTHFR deficiency was asymptomatic. Pathologic changes in the severe
form include the vascular changes that have been found in other
conditions with elevated homocysteine, as well as reduced
neurotransmitter and methionine levels in the CNS. A milder
deficiency of MTHFR (35-50% activity) has been described in
patients with coronary artery disease (see below). Genetic
heterogeneity is likely, considering the diverse clinical features,
the variable levels of enzyme activity, and the differential heat
inactivation profiles of the reductase in patients' cells.
[0007] Coronary artery disease (CAD) accounts for 25% of deaths of
Canadians. Cardiovascular risk factors (male sex, family history,
smoking, hypertension, dyslipoproteinemia and diabetes) account for
approximately 60 to 70% of the ability to discriminate CAD patients
from healthy subjects. Elevated plasma homocysteine has also been
shown to be an independent risk factor for cardiovascular
disease.
[0008] Homocysteine is a sulfhydryl-containing amino acid that is
formed by the demethylation of methionine. It is normally
metabolized to cysteine (transsulfuration) or re-methylated to
methionine. Inborn errors of metabolism (as in severe MTHFR
deficiency) causing extreme elevations of homocysteine in plasma,
with homocystinuria, are associated with premature vascular disease
and widespread arterial and venous thrombotic phenomena. Milder
elevations of plasma homocysteine (as in mild MTHFR deficiency)
have been associated with the development of peripheral vascular
disease, cerebrovascular disease and premature CAD.
[0009] Homocysteine remethylation to methionine requires the folic
acid intermediate, 5-methyltetrahydrofolate, which is produced from
5,10-methylenetetrahydrofolate folate through the action of
5,10-methylenetetrahydrofolate reductase (MTHFR). Deficiency of
MTHFR results in an inability to metabolize homocysteine to
methionine; elevated plasma homocysteine and decreased methionine
are the metabolic consequences of the block. Severe deficiencies of
MTHFR (less than 20% of activity of controls) as described above,
are associated with early-onset neurologic symptoms (mental
retardation, peripheral neuropathy, seizures, etc.) and with
atherosclerotic changes and thromboembolism. Milder deficiencies of
MTHFR (35-50% of activity of controls), with a thermolabile form of
the enzyme, are seen in patients with cardiovascular disease
without obvious neurologic abnormalities.
[0010] In a survey of 212 patients with proven coronary artery
disease, the thermolabile form of MTHFR was found in 17% of the CAD
group and 5% of controls. In a subsequent report on 339 subjects
who underwent coronary angiography, a correlation was found between
thermolabile MTHFR and the degree of coronary artery stenosis.
Again, traditional risk factors (age, sex, smoking, hypertension,
etc.) were not significantly associated with thermolabile MTHFR.
All the studies on MTHFR were performed by enzymatic assays of
MTHFR in lymphocytes, with measurements of activity before and
after heat treatment to determine thermolability of the enzyme.
[0011] Since 5-methyltetrahydrofolate, the product of the MTHFR
reaction, is the primary form of circulatory folate, a deficiency
in MTHFR might lead to other types of disorders. For example,
periconceptual folate administration to women reduces the
occurrence and recurrence of neural tube defects in their
offspring. Neural tube defects are a group of developmental
malformations (meningomyelocele, anencephaly, and encephalocele)
that arise due to failure of closure of the neural tube. Elevated
levels of plasma homocysteine have been reported in mothers of
children with neural tube defects. The elevated plasma homocysteine
could be due to a deficiency of MTHFR, as described above for
cardiovascular disease.
[0012] Neuroblastomas are tumors derived from neural crest cells.
Many of these tumors have been reported to have deletions of human
chromosome region 1p36, the region of the genome to which MTHFR has
been mapped. It is possible that MTHFR deletions/mutations are
responsible for or contribute to the formation of this type of
tumor. MTHFR abnormalities may also contribution to the formation
of other types of tumors, such as colorectal tumors, since high
dietary folate has been shown to be inversely associated with risk
of colorectal carcinomas.
[0013] MTHFR activity is required for homocysteine methylation to
methionine. Methionine is necessary for the formation of
S-adenosylmethionine, the primary methyl donor for methylation of
DNA, proteins, lipids, neurotransmitters, etc. Abnormalities in
MTHFR might lead to lower levels of methionine and
S-adenosylmethionine, as well as to elevated homocysteine.
Disruption of methylation processes could result in a wide variety
of conditions, such as neoplasias, developmental anomalies,
neurologic disorders, etc.
[0014] Although the MTHFR gene in Escherichia coli (metF) has been
isolated and sequenced, molecular studies of the enzyme in higher
organisms have been limited without the availability of an
eukaryotic cDNA.
[0015] It would be highly desirable to be provided with a cDNA
probe for human methylenetetrahydrofolate reductase (MTHFR). This
probe would be used for identification of sequence abnormalities in
individuals with severe or mild MTHFR deficiency, including
cardiovascular patients and patients with neurologic symptoms or
tumors. The probe would also be used in gene therapy, isolation of
the gene, and expression studies to produce the MTHFR protein. The
probe would also provide the amino acid sequence of the human MTHFR
protein, which would be useful for therapy of MTHFR deficiency by
biochemical or pharmacological approaches.
[0016] It would be highly desirable to be provided with a molecular
description of mutations in methylenetetrahydrofolate reductase
deficiency.
[0017] Patients with sequence abnormalities in MTHFR might have
different responses to drugs, possibly but not limited to drugs
that affect folate metabolism. Therefore, it would be useful to
know if these mutations are present before determining the
appropriate therapy. The drugs/diseases for which this might be
relevant include cancer chemotherapeutic agents, antibiotics,
antiepileptic medication, antiarthritic medication, etc.
SUMMARY OF THE INVENTION
[0018] One aim of the present invention is to provide a cDNA probe
for human methylenetetrahydrofolate reductase (MTHFR).
[0019] Another aim of the present invention is to provide a
molecular description of mutations in methylenetetrahydrofolate
reductase deficiency.
[0020] Another aim of the present invention is to provide a nucleic
acid and amino acid sequence for human methylenetetrahydrofolate
reductase.
[0021] Another aim of the present invention is to provide potential
therapy for individuals with methylenetetrahydrofolate reductase
deficiency.
[0022] Another aim of the present invention is to provide a system
for synthesis of MTHFR protein in vitro.
[0023] A further aim of the present invention is to provide
technology/protocol for identification of sequence changes in the
MTHFR gene.
[0024] In accordance with one aspect of the present invention,
there is provided a cDNA probe for human methylenetetrahydrofolate
reductase (MTHFR) gene encoded by a nucleotide sequence as set
forth in SEQ ID NO:1 or having an amino acid sequence as set forth
in SEQ ID NO:2. The probe comprises a nucleotide sequence that
hybridizes to the MTHFR nucleotide sequence, or an amino acid
sequence that hybridizes to the MTHFR amino acid sequence.
[0025] In accordance with another aspect of the present invention,
there is provided a method of diagnosis of
methylenetetrahydrofolate reductase (MTHFR) deficiency in a patient
with MTHFR deficiency. The method comprises the steps of amplifying
a DNA sample obtained from the patient or reverse-transcripting a
RNA sample obtained from the patient into a DNA and amplifying the
DNA, and analyzing the amplified DNA to determine at least one
sequence abnormality with respect to a human MTHFR encoded by a
nucleotide sequence as set forth in SEQ ID NO:1 or having an amino
acid sequence as set forth in SEQ ID NO:2, the sequence abnormality
being indicative of MTHFR deficiency.
[0026] The sequence abnormality may comprise a mutation selected
from a group consisting of 167G.fwdarw.A, 482G.fwdarw.A,
559C.fwdarw.T, 677C.fwdarw.T, 692C.fwdarw.T, 764C.fwdarw.T,
792+1G.fwdarw.A, 985C.fwdarw.T, 1015C.fwdarw.T, 1081C.fwdarw.T,
1298A.fwdarw.C and 1317T.fwdarw.C.
[0027] The selected mutation may consist of 677C.fwdarw.T.
[0028] The MTHFR deficiency may be associated with a disorder
selected from a group consisting of cardiovascular disorders,
cancer, osteoporosis, increased risk of occurrence of a neural tube
defect in an offspring of said patient, neurological disorders and
disorders influenced by folic acid metabolism.
[0029] The cancer may be selected from a group consisting of
neuroblastomas and colorectal carcinomas.
[0030] The disorder may consist of osteoporosis.
[0031] In accordance with yet another aspect of the present
invention, there is provided a method for gene therapy of
methylenetetrahydrofolate reductase (MTHFR) deficiency in a
patient. The method comprises the steps of producing a recombinant
vector for expression of MTHFR under the control of a suitable
promoter, the MTHFR being encoded by a nucleotide sequence as set
forth in SEQ ID NO:1 or having an amino acid sequence as set forth
in SEQ ID NO:2, and transfecting the patient with the vector for
expression of MTHFR.
[0032] In accordance with yet another aspect of the present
invention, there is provided a human methylenetetrahydrofolate
reductase (MTHFR) protein encoded by a nucleotide sequence as set
forth in SEQ ID NO:1 or having an amino acid sequence as set forth
in SEQ ID NO:2.
[0033] In accordance with yet another aspect of the present
invention, there is provided a recombinant human
methylenetetrahydrofolate reductase (MTHFR) protein encoded by a
nucleotide sequence as set forth in SEQ ID NO:1 or having an amino
acid sequence as set forth in SEQ ID NO:2.
[0034] In accordance with yet another aspect of the present
invention, there is provided a method of treatment of
MTHFR-deficiency in a patient that comprises administering such a
MTHFR protein.
[0035] The MTHFR deficiency may be associated with a cancer.
[0036] The cancer may be selected from a group consisting of
neuroblastomas and colorectal carcinomas.
[0037] In accordance with yet another aspect of the present
invention, there is provided a method of preventing an occurrence
of a neural tube defect in an offspring of a patient. The method
comprises administering to the patient such a MTHFR protein.
[0038] In accordance with yet another aspect of the present
invention, there is provided a method for determining
susceptibility, response or toxicity of a drug with a patient
having a methylenetetrahydrofolate reductase (MTHFR) deficiency.
The method comprises the steps of amplifying a DNA sample obtained
from the patient or reverse-transcripting a RNA sample obtained
from the patient into a DNA and amplifying said DNA, analyzing the
amplified DNA to determine a sequence abnormality in a MTHFR
sequence, the MTHFR sequence being encoded by a nucleotide sequence
as set forth in SEQ ID NO:1 or having an amino acid sequence as set
forth in SEQ ID NO:2, and administering the drug to the patient and
determining the sequence abnormality associated with the patient
susceptibility, response or toxicity to the drug.
[0039] The sequence abnormality may comprise a mutation selected
from a group consisting of 167G.fwdarw.A, 482G.fwdarw.A,
559C.fwdarw.T, 677C.fwdarw.T, 692C.fwdarw.T, 764C.fwdarw.T,
792+1G.fwdarw.A, 985C.fwdarw.T, 1015C.fwdarw.T, 1081C.fwdarw.T,
1298A.fwdarw.C and 1317T.fwdarw.C and the drug may be selected from
a group consisting of cancer chemotherapeutic agents, antibiotics,
antiepileptic agents and antiarthritic agents.
[0040] The MTHFR deficiency may be associated with a disorder
selected from a group consisting of cardiovascular disorders,
coronary and arterial disorders, neurological disorders, increased
risk of occurrence of a neural tube defect in an offspring, cancer,
osteoporosis and other disorders influenced by folic acid
metabolism.
[0041] In accordance with yet another aspect of the present
invention, there is provided a method of treatment of a patient
having a cancer comprising the step of inhibiting gene expression
for a MTHFR protein or a mRNA produced form the gene.
[0042] In accordance with yet another aspect of the present
invention, there is provided a method of treatment of a patient
having a cancer comprising the step of inhibiting the MTHFR
protein.
[0043] A "polymorphism" is intended to mean a mutation present in
1% or more of alleles of the general population. A polymorphism is
disease-causing when it is present in patients with a disease but
not in the general population. However, a polymorphism present both
in patients having a disease and in the general population is not
necessarily benign. The definition of a disease-causing
substitution, as distinct from a benign polymorphism, is based on 3
factors: (1) absence of the change in at least 50 independent
control chromosomes; (2) presence of the amino acid in the
bacterial enzyme, attesting to its evolutionary significance and
(3) change in amino acid not conservative. Although expression of
the substitutions is required to formally prove that they are not
benign, the criteria above allow us to postulate that the changes
described in this report are likely to affect activity.
BRIEF DESCRIPTION OF THE DRAWINGS
[0044] FIGS. 1A to 1F illustrate the first cDNA coding sequence
(SEQ ID NO:1 and NO:2) for methylenetetrahydrofolate reductase
(MTHFR);
[0045] FIG. 2 is the alignment of amino acids for human
methylenetetrahydrofolate reductase (MTHFR), the metF genes from E.
Coli (ECOMETF), and S. Typhimurium (STYMETF), and an unidentified
open reading frame in Saccharomyces cerevisiae that is divergently
transcribed from an excision repair gene (ysRAD1);
[0046] FIGS. 3A and 3B illustrate the sequencing and restriction
enzyme analysis for the Arg to Ter substitution;
[0047] FIGS. 4A and 4B illustrate the sequencing and restriction
enzyme analysis for the Arg to Gln substitution;
[0048] FIGS. 5A and 5B illustrate the sequence change and
restriction enzyme analysis for the alanine to valine
substitution;
[0049] FIGS. 6A to 6C illustrate the total available sequence (SEQ
ID NO:3 and NO:4) of human MTHFR cDNA;
[0050] FIGS. 7A and 7B illustrate the expression analysis of MTHFR
cDNA in E. Coli, respectively (7A) the Western blot of bacterial
extracts and tissues, and (7B) the thermolability assay of
bacterial extracts;
[0051] FIGS. 8A to 8D illustrate the identification of a 5' splice
site mutation leading to a 57-bp in-frame deletion of the cDNA;
[0052] FIGS. 9A to 9D illustrate the diagnostic restriction
endonuclease analysis of 4 mutations;
[0053] FIGS. 10A to 10D illustrate the ASO hybridization analysis
of 2 mutations;
[0054] FIG. 11 illustrates the region of homology between human
methylenetetrahydrofolate reductase (MTHFR) and human dihydrofolate
reductase (DHFR);
[0055] FIGS. 12A-12B illustrate the exonic sequences of the human
MTHFR gene with their flanking intronic sequences;
[0056] FIGS. 13A-13B illustrate the exonic sequences of the mouse
MTHFR gene with their flanking intronic sequences;
[0057] FIG. 14 illustrates intron sizes and locations for both
human and mouse genes; and
[0058] FIG. 15 illustrates the alignment of MTHFR amino acid
sequences for the human MTHFR (hMTHFR), mouse MTHFR (mMTHFR) and
the MetF gene of bacteria (bMTHFR).
DETAILED DESCRIPTION OF THE INVENTION
[0059] Sequencing of Peptides from Porcine MTHFR
[0060] Homogeneous native porcine MTHFR was digested with trypsin
to generate a 40 kDa N-terminal fragment and a 31 kDa C-terminal
fragment; the 31 kDa fragment is a proteolytic product of the 37
kDa fragment. The fragments were separated by SDS-PAGE,
electroeluted, and the denatured fragments were digested with lysyl
endopeptidase (LysC). The resulting peptides were separated by
reversed-phase HPLC and subjected to sequence analysis by Edman
degradation (details contained in Goyette P et al., Nature
Genetics, 1994, 7:195-200).
[0061] Isolation and Sequencing of cDNAs
[0062] Two degenerate oligonucleotides were synthesized based on
the sequence of a 30 amino acid porcine MTHFR peptide (first
underlined peptide in FIG. 2). These were used to generate a 90 bp
PCR product, encoding the predicted peptide, from reverse
transcription-PCR reactions of 500 ng pig liver polyA+RNA. A
pig-specific (non-degenerate, antisense) PCR primer was then
synthesized from this short cDNA sequence. Using this primer and a
primer for phage arms, a human liver .lambda.gt10 cDNA library
(Clontech) was screened by PCR; this technique involved the
generation of phage lysate stocks (50,000 pfu) which were boiled
for 5 min and then used directly in PCR reactions with these two
primers. PCR fragments were then sequenced directly (Cycle
Sequencing.TM. kit, GIBCO), and a positive clone was identified by
comparison of the deduced amino acid sequence to the sequence of
the pig peptide (allowing for inter-species variations). The
positive stock was then replated at lower density and screened with
the radiolabelled positive PCR product by plaque hybridization
until a well-isolated plaque was identified. Phage DNA was purified
and the insert was then subcloned into pBS+ (Bluescript) and
sequenced on both strands (Cycle Sequencing.TM. kit, GIBCO and
Sequenase.TM., Pharmacia) The deduced amino acid sequence of the
human cDNA was aligned to the porcine peptide sequences, the metF
genes from E. coli (ecometf, accession number VO1502) and S.
Typhimurium (stymetF, accession number XO7689) and with a
previously unidentified open reading frame in Saccharomyces
cerevisiae that is divergently transcribed with respect to the
excision repair gene, ysRAD1 (accession number KO2070). The initial
alignments were performed using BestFit.TM. in the GCG computer
package, and these alignments were adjusted manually to maximize
homologies.
[0063] In summary, degenerate oligonucleotide primers were designed
to amplify a sequence corresponding to a 30-amino acid segment of a
porcine peptide from the N-terminal region of the enzyme (first
porcine peptide in FIG. 2). A 90-bp porcine cDNA fragment was
obtained from reverse transcription/PCR of pig liver RNA.
Sequencing of the PCR fragment confirmed its identity by comparison
of the deduced amino acid sequence to the porcine peptide sequence.
A nondegenerate oligonucleotide primer, based on the internal
sequence of the porcine cDNA, was used in conjunction with primers
for the phage arms to screen a human liver .lambda.gt10 cDNA
library by PCR. The insert of the positive clone was isolated and
sequenced. The sequence consisted of 1266 bp with one continuous
open reading frame.
[0064] Homology with MTHFR in Other Species
[0065] The deduced amino acid sequence of the human cDNA was
aligned with the metF genes from E. coli and S. typhimurium, as
well as with a previously unidentified ORF in Saccharomyces
cerevisiae that is divergently transcribed with respect to the
excision repair gene, ysRAD1 (FIG. 2). The sequences homologous to
5 porcine peptides are underlined in FIG. 2. Three segments
(residues 61-94, 219-240, and 337-351) correspond to internal
peptide sequence from the N-terminal 40-kDa domain of the porcine
liver enzyme. Residues 374-393 correspond to the upstream portion
of the LysC peptide from the C-terminal domain of the porcine liver
enzyme that is labeled when the enzyme is irradiated with UV light
in the presence of (.sup.3H-methyl)AdoMet; as predicted from the
AdoMet labeling studies, this peptide lies at one end (N-terminal)
of the 37 kDa domain. A fifth region of homology (residues 359-372)
was also identified, but the localization of the porcine peptide
within the native protein had not been previously determined.
[0066] Methylenetetrahydrofolate reductase (MTHFR) is an enzyme
involved in amino acid metabolism, that is critical for maintaining
an adequate methionine pool, as well as for ensuring that the
homocysteine concentration does not reach toxic levels. The high
degree of sequence conservation, from E. coli to Homo sapiens,
attests to the significance of MTHFR in these species. The enzyme
in E. coli (encoded by the metF locus) is a 33-kDa peptide that
binds reduced FAD and catalyzes the reduction of
methylenetetrahydrofolate to methyltetrahydrofolate. The metF
enzyme differs from the mammalian enzyme in that NADPH or NADH
cannot reduce it, and its activity is not allosterically regulated
by S-adenosylmethionine. The native porcine enzyme is susceptible
to tryptic cleavage between the N-terminal 40 kDa domain and the
C-terminal 37 kDa domain, and this cleavage results in the loss of
allosteric regulation by adenosylmethionine, but does not result in
loss of catalytic activity. Since the homology between the
bacterial and mammalian enzymes is within the N-terminal domain,
this region must contain the flavin binding site and residues
necessary to bind the folate substrate and catalyze its reduction.
The domain structure of the human enzyme has not been elucidated,
although the human enzyme has been reported to have a molecular
mass of 150 kDa and is likely to be a homodimer of 77 kDa.
[0067] The predicted point of cleavage between the two domains lies
between residues 351 and 374 of the human sequence, based on the
localization of peptides obtained from the isolated domains of the
porcine enzyme. This region, containing the highly charged sequence
KRREED, is predicted to have the highest hydrophilicity and surface
probability of any region in the deduced human sequence.
[0068] The N-terminus of the porcine protein has been sequenced,
and the region encoding this part of the protein is missing from
the human cDNA. It is estimated that this cDNA is missing only a
few residues at the N-terminus, since the predicted molecular mass
of the deduced sequence upstream of the putative cleavage site
(KRREED) is 40 kDa, and the measured molecular mass of the porcine
N-terminal domain is also 40 kDa. When the bacterial, yeast and
human sequences are aligned, the deduced human sequence contains an
N-terminal extension of 40 amino acids; it is suspected that this
extension contains determinants for NADPH binding. Many pyridine
nucleotide-dependent oxidoreductases contain such determinants at
the N-terminus of the protein.
[0069] The C-terminus of the human sequence contains a peptide that
is labeled when the protein is irradiated with ultraviolet light in
the presence of tritiated AdoMet. The cDNA sequence reported here
contains only about 7 kDa of the predicted 37-kDa mass of this
domain, indicating that this cDNA is truncated at the 3' terminus
as well. A number of peptides from the C-terminal porcine domain
have also not been detected. As might be expected, given that the
prokaryotic enzymes do not appear to be allosterically regulated by
AdoMet, there are no significant homologies between the C-terminal
region in this cDNA and the prokaryotic metF sequences. The
alignment shown in FIG. 2 shows that the homologous sequences
terminate just prior to the putative cleavage site of the human
enzyme.
[0070] Chromosomal Assignment
[0071] In situ hybridization to metaphase human chromosomes was
used for localization of the human gene. The analysis of the
distribution of 200 silver grains, revealed a significant
clustering of grain 40 grains, in the p36.3-36.2 region of
chromosome 1 (p<0.0001), with the majority of grains, 25 grains,
observed over 1p36.3.
[0072] The isolation of the human cDNA has allowed us to localize
the gene to chromosome 1p36.3. The observation of one strong signal
on that chromosome with little background is highly suggestive of a
single locus with no pseudogenes. Southern blotting of human DNA
revealed fragments of approximately 10 kb, predicting a gene of
average size, since this cDNA encodes approximately half of the
coding sequence.
[0073] Additional cDNA Sequences and Constructs for Expression
Analysis
[0074] A human colon carcinoma cDNA library (gift of Dr. Nicole
Beauchemin, McGill University) was screened by plaque hybridization
with the original 1.3-kb cDNA to obtain additional coding
sequences. A cDNA of 2.2 kb was isolated, which contained 1.3 kb of
overlapping sequence to the original cDNA and-900 additional bp at
the 3' end (FIG. 6). The amino acid sequence is identical to that
of the original cDNA for the overlapping segment (codons 1-415)
except for codon 177 (ASP) which was a GLY codon in the original
cDNA. Analysis of 50 control chromosomes revealed an ASP codon at
this position. The cDNA has an open reading frame of 1980 bp, 100
bp of 3' UTR and a poly A tail.
[0075] Sequencing was performed on both strands for the entire
cDNA. Additional 5' sequences (800 bp) were obtained from a human
kidney cDNA library (Clontech) but these sequences did not contain
additional coding sequences and were therefore used for the
PCR-based mutagenesis only (as described below) and not for the
expression analysis. The two cDNAs (2.2 kb and 800 bp) were ligated
using the EcoRI site at bp 199 and inserted into the Bluescript.TM.
vector (Stratagene). The 2.2 kb cDNA was subcloned into the
expression vector pTrc99A (Pharmacia) using the NcoI site at bp 11
and the XbaI site in the polylinker region of both the
Bluescript.TM. and the pTrc99A vectors. Sequencing was performed
across the cloning sites to verify the wild-type construct.
[0076] Utility of Invention in Identification of Mutations
[0077] I. Identification of First Two Mutations in Severe MTHFR
Deficiency
[0078] Total RNA of skin fibroblasts from MTHFR-deficient patients
was reverse-transcribed and amplified by PCR for analysis by the
single strand conformation polymorphism (SSCP) method (Orita, M. et
al., Genomics, 1989, 5:8874-8879). Primers were designed to
generate fragments of 250-300 bp and to cover the available cDNA
sequences with small regions of overlap for each fragment at both
ends. The first mutation identified by SSCP was a C to T
substitution at bp 559 in patient 1554; this substitution converted
an arginine codon to a termination codon (FIG. 3A). Since the
mutation abolished a FokI site, restriction digestion was used for
confirmation of the change and for screening additional patients
for this mutation; a second patient (1627) was identified in this
manner (FIG. 3B). The SSCP pattern for patient 1554 and the
restriction digestion pattern for both patients was consistent with
a homozygous mutant state or with a genetic compound consisting of
the nonsense mutation with a second mutation that did not produce
any detectable RNA (null allele). Studies in the parents are
required for confirmation.
[0079] The second substitution (FIG. 4A) was a G to A transition at
bp 482 in patient 1834 that converted an arginine into a glutamine
residue. The substitution created a PstI site that was used to
verify the substitution and to identify a second patient (1863)
with this change (FIG. 4B). The SSCP analysis and the restriction
digestion pattern were consistent with a heterozygous state for
both patients. The arginine codon affected by this change is an
evolutionarily conserved residue, as shown in FIG. 2. This
observation, in conjunction with the fact that the codon change is
not conservative, makes a strong argument that the substitution is
a pathologic change rather than a benign polymorphism. Furthermore,
35 controls (of similar ethnic background to that of the probands)
were tested for this substitution by Southern blotting of
PstI-digested DNA; all were negative.
[0080] The family of patient 1834 was studied. The symptomatic
brother and the mother of the proband were all shown to carry this
substitution, whereas the father was negative for the change (FIG.
4B). In the family of 1863, the mother of the proband was shown to
be a carrier, while the father and an unaffected brother were
negative.
[0081] Cell lines
[0082] Cell line 1554 is from a Hopi male who was admitted at age
three months with homocystinuria, seizures, dehydration, corneal
clouding, hypotonia and Candida sepsis. Folate distribution in
cultured fibroblasts showed a Pediococcus cerivisiae/Lactobacillus
casei (PC/LC) ratio of 0.52 (Control 0.14). There was no measurable
methylenetetrahydrofolate reductase (MTHFR) activity (Control
values=9.7 and 15.1 nmoles/h/mg protein; residual activity after
treatment of control extracts at 55.degree. C. for 20 min.=28% and
31%).
[0083] Cell line 1627 is from a Choctaw male who presented with
poor feeding, apnea, failure to thrive, dehydration and
homocystinuria at five weeks of age. He was subsequently found to
have superior sagittal sinus thrombosis and hydrocephalus. The
PC/LC ratio was 0.61 and the specific activity of MTHFR was 0.1
nmoles/h/mg protein. There is consanguinity in that the maternal
and paternal grandmothers are thought to be "distantly
related".
[0084] Cell line 1779 is from a French Canadian male with
homocystinuria who first had limb weakness, uncoordination,
paresthesiae, and memory lapses at age 15 years, and was
wheelchair-bound in his early twenties. His brother (cell line
1834) also has homocystinuria, but is 37 years old and
asymptomatic. Specific activity of MTHFR was 0.7 and 0.9 nmole/h/mg
protein for 1779 and 1834, respectively; the residual activity
after heat treatment at 55.degree. C. was 0.9% and 0% for 1779 and
1834, respectively.
[0085] Cell line 1863 is from a white male who was diagnosed at age
21 years because of a progressive gait disturbance, spasticity,
cerebral white matter degeneration, and homocystinuria. He had a
brother who died at age 21 years of neurodegenerative disease.
Specific activity of MTHFR in fibroblast extracts was 1.76
nmoles/h/mg protein and the residual enzyme activity after
treatment at 55.degree. C. was 3.6%.
[0086] Mutation Analysis
[0087] Primers were designed from the cDNA sequence to generate
250-300 bp fragments that overlapped 50-75 bp at each end. The
primer pairs were used in reverse transcription-PCR of 5 .mu.g
patient total fibroblast RNA. The PCR products were analyzed by a
non-isotopic rapid SSCP protocol (PhastSystem.TM., Pharmacia),
which uses direct silver staining for detection of single strands.
Any PCR products from patients showing a shift on SSCP gels were
purified by NuSieve (FMC Bioproducts) and sequenced directly (Cycle
Sequencing.TM. kit, GIBCO) to identify the change. If the change
affected a restriction site, then a PCR product was digested with
the appropriate restriction endonuclease and analyzed on
polyacrylamide gels. To screen for the Arg to Gln mutation in
controls, 5 .mu.g of PstI-digested DNA was run on 0.8% agarose gels
and analyzed by Southern blotting using the radiolabelled cDNA by
standard techniques.
[0088] II. Seven Additional Mutations at the
Methylenetetrahydrofolate Reductase (MTHFR) Locus with Genotype:
Phenotype Correlation in Severe MTHFR Deficiency
[0089] It is reported hereinbelow the characterization of 7
additional mutations at this locus: 6 missense mutations and a 5'
splice site defect which activates a cryptic splice site in the
coding sequence. A preliminary analysis of the relationship between
genotype and phenotype for all 9 mutations identified thus far at
this locus is also reported. A nonsense mutation and 2 missense
mutations (proline to leucine and threonine to methionine) in the
homozygous state are associated with extremely low activity (0-3%)
and onset of symptoms within the first year. Other missense
mutations (arginine to cysteine and arginine to glutamine) are
associated with higher enzyme activity and later onset of
symptoms.
[0090] 7 additional mutations at the MTHFR locus are described and
the association between genotype, enzyme activity, and clinical
phenotype in severe MTHFR deficiency is examined.
[0091] Patient Description
[0092] The clinical and laboratory findings of the patients have
been reported in the published literature. Residual MTHFR activity
was previously measured in cultured fibroblasts at confluence.
[0093] Patient 354, an African-American girl, was diagnosed at age
13 years with mild mental retardation. Her sister, patient 355 was
diagnosed at age 15 years with anorexia, tremor, hallucinations and
progressive withdrawal. In patient 354, residual MTHFR activity was
19% and in her sister, 355, it was 14% of control values. The
residual activity after heating had equivalent thermal stability to
control enzyme.
[0094] Patient 1807, a Japanese girl whose parents are first
cousins, had delayed walking and speech until age 2 years, seizures
at age 6 years and a gait disturbance with peripheral neuropathy at
age 16 years. Residual activity of MTHFR was 3% and the enzyme was
thermolabile.
[0095] Patient 735, an African-Indian girl, was diagnosed at age 7
months with microcephaly, progressive deterioration of mental
development, apnea and coma. Residual activity of MTHFR was 2% of
control levels. Thermal properties were not determined.
[0096] Patient 1084, a Caucasian male, was diagnosed at age 3
months with an infantile fibrosarcoma. He was found to be hypotonic
and became apneic. He died at the age of 4 months. Residual
activity of MTHFR was not detectable. Thermal properties were not
determined.
[0097] Patient 356, the first patient reported with MTHFR
deficiency, is an Italian-American male who presented at age 16
years with muscle weakness, abnormal gait and flinging movements of
the upper extremities. MTHFR residual activity was 20% of control
values; activity was rapidly and exponentially inactivated at
55.degree..
[0098] Patient 458, a Caucasian male, was diagnosed at age 12 years
with ataxia and marginal school performance. Residual MTHFR
activity was approximately 10%, and the activity was
thermolabile.
[0099] Patient 1396, a Caucasian female, was described as clumsy
and as having a global learning disorder in childhood. At age 14
years, she developed ataxia, foot drop, and inability to walk. She
developed deep vein thrombosis and bilateral pulmonary emboli.
Residual activity of MTHFR was 14% and the enzyme was
thermolabile.
[0100] Genomic Structure and Intronic Primers
[0101] Exon nomenclature is based on available cDNA sequence in
Goyette et al. (Nature Genetics, 1994, 7:195-200). Exon 1 has been
arbitrarily designated as the region of cDNA from bp 1 to the first
intron. Identification of introns was performed by amplification of
genomic DNA using cDNA primer sequences. PCR products that were
greater in size than expected cDNA sizes were sequenced
directly.
[0102] Mutation Detection
[0103] Specific exons (see Table 1 for primer sequences) were
amplified by PCR from genomic DNA and analyzed by the SSCP
protocol. SSCP was performed with the Phastgel.TM. system
(Pharmacia), a non-isotopic rapid SSCP protocol, as previously
described (Goyette P et al., Nature Genetics, 1994, 7:195-200), or
with .sup.35S-labeled PCR products run on 6% acrylamide: 10%
glycerol gels at room temperature (6 watts, over-night). In some
cases, the use of restriction endonucleases, to cleave the PCR
product before SSCP analysis, enhanced the detection of band
shifts. PCR fragments with altered mobility were sequenced directly
(GIBCO, Cycle Sequencing.TM. kit). If the sequence change affected
a restriction endonuclease site, then the PCR product was digested
with the appropriate enzyme and analyzed by PAGE. Otherwise,
allele-specific oligonucleotide (ASO) hybridization was performed
on a dot blot of the PCR-amplified exon.
1TABLE 1 PCR Primers for DNA amplification and mutation analysis of
MTHFR Fragment Exon Primer Type Primer Sequence (5'.fwdarw.3')
Location Size (bp) 1 Sense AGCCTCAACCCCTGCTTGGAGG (SEQ ID NO:5) C
271 Antisense TGACAGTTTGCTCCCCAGGCAC (SEQ ID NO:6) I 4 Sense
TGAAGGAGAAGGTGTCTGCGGGA (SEQ ID NO:7) C 198 Antisense
AGGACGGTGCGGTGAGAGTGG (SEQ ID NO:8) I 5 Sense
CACTGTGGTTGGCATGGATGATG (SEQ ID NO:9) I 392 Antisense
GGCTGCTCTTGGACCCTCCTC (SEQ ID NO:10) I 6 Sense
TGCTTCCGGCTCCCTCTAGCC (SEQ ID NO:11) I 251 Antisense
CCTCCCGCTCCCAAGAACAAAG (SEQ ID NO:12) I
[0104]
2TABLE 2 Summary of genotypes, enzyme activity, age at onset, and
background of patients with MTHFR deficiency Amino acid %
Patient.sup.a BP Changes.sup.b changes Activity Age at Onset
Background 1807 C764T/C764T Pro.fwdarw.Leu/Pro.fwdarw.Leu 3 within
1st year Japanese 735 C692T/C692T Thr.fwdarw.Met/Thr.fwdarw.Met 2 7
months African Indian 1084 C692T/C692T
Thr.fwdarw.Met/Thr.fwdarw.Met 0 3 months Caucasian 1554 C559T/C559T
Arg.fwdarw.Ter/Arg.fwdarw.Ter 0 1 month Native American (Hopi) 1627
C559T/C559T Arg.fwdarw.Ter/Arg.fwdarw.Ter 1 1 month Native American
(Choctaw) 356 C985T/C985T Arg.fwdarw.Cys/Arg.fwdarw.Cys 20 16 yrs
Italian American 458 C1015T/G167A Arg.fwdarw.Cys/Arg.fwdarw.Gln 10
11 yrs Caucasian 1396 C1081T/G167A Arg.fwdarw.Cys/Arg.fwdarw.Gl- n
14 14 yrs Caucasian 1779 G482A/? Arg.fwdarw.Gln/? 6 15 yrs French
Canadian 1834.sup.c G482A/? Arg.fwdarw.Gln/? 7 Asymptomatic French
Canadian at 37 yrs 1863 G482A/? Arg.fwdarw.Gln/? 14 21 yrs
Caucasian 354.sup.d 792 + 1G.fwdarw.A/? 5' splice site/? 19 13 yrs
African American 355.sup.d 792 + 1G.fwdarw.A/? 5' splice site/? 14
11 yrs African American .sup.aPatients 1554, 1627, 1779, 1834 and
1863 were previously reported by Goyette et al. (1994) .sup.b? =
unidentified mutation. .sup.cPatients 1779 and 1834 are sibs.
.sup.dPatients 354 and 355 are sibs.
[0105] (1) 5' Splice Site Mutation
[0106] Amplification of cDNA, bp 653-939, from reverse-transcribed
total fibroblast RNA revealed 2 bands in sisters 354 and 355: a
smaller PCR fragment (230 bp) in addition to the normal 287 bp
allele (FIG. 8A). FIG. 8A is the PAGE analysis of amplification
products of cDNA bp 653-939, from reverse transcribed RNA. Controls
have the expected 287-bp fragment while patients 354 and 355 have
an additional 230-bp fragment. Sequencing of the smaller fragment
identified a 57-bp in-frame deletion which would remove 19 amino
acids (FIG. 8B). FIG. 8B is the direct sequencing of the PCR
products from patient 354. The 57-bp deletion spans bp 736-792 of
the cDNA. An almost perfect 5' splice site (boxed) is seen at the
5' deletion breakpoint. Analysis of the sequence at the 5' deletion
breakpoint in the undeleted fragment revealed an almost perfect 5'
splice site consensus sequence (AG/gcatgc). This observation
suggested the presence of a splicing mutation in the natural 5'
splice site that might activate this cryptic site, to generate the
deleted allele. The sequence following the deletion breakpoint, in
the mutant allele, corresponded exactly to the sequence of the next
exon. Amplification of genomic DNA, using the same amplification
primers as those used for reverse-transcribed RNA, generated a
1.2-kb PCR product indicating the presence of an intron. Direct
sequencing of this PCR fragment in patient 354 identified a
heterozygous G.fwdarw.A substitution in the conserved GT
dinucleotide of the intron at the 5' splice site (FIG. 8C). FIG. 8C
is the sequencing of the 5' splice site in control and patient 354.
The patient carries a heterozygous G.fwdarw.A substitution in the
5' splice site (boxed). Intronic sequences are in lower case. This
substitution abolished a HphI restriction endonuclease site which
was used to confirm the mutation in the 2 sisters (FIG. 8D). FIG.
8D is the HphI restriction endonuclease analysis on PCR products of
DNA for exon 4 of patients 354 and 355, and of 3 controls (C). The
198-bp PCR product has 2 HphI sites. The products of digestion for
the control allele are 151, 24 and 23 bp. The products of digestion
for the mutant allele are 175 and 23 bp due to the loss of a HphI
site. The fragments of 24 and 23 bp have been run off the gel.
[0107] (2) Patients with Homozygous Coding Substitutions
[0108] SSCP analysis of exon 4 for patient 1807 revealed an
abnormally-migrating fragment, which was directly sequenced to
reveal a homozygous C.fwdarw.T substitution (bp 764) converting a
proline to a leucine residue. This change creates a MnlI
restriction endonuclease site, which was used to confirm the
homozygous state of the mutation (FIG. 9A). FIG. 9A is the MnlI
restriction analysis of exon 4 PCR products for patient 1807 and 3
controls (C). Expected fragments: control allele, 90, 46, 44, 18
bp; mutant allele, 73, 46, 44, 18, 17 bp. An additional band at the
bottom of the gel is the primer. Fifty independent control
Caucasian chromosomes and 12 control Japanese chromosomes were
tested by restriction analysis; all were negative for this
mutation. Homozygosity in this patient is probably due to the
consanguinity of the parents.
[0109] Patients 735 and 1084 had the same mutation in exon 4, in a
homozygous state: a C.fwdarw.T substitution (bp 692) which
converted an evolutionarily conserved threonine residue to a
methionine residue, and abolished a NlaIII restriction endonuclease
site. Allele-specific oligonucleotide hybridization to amplified
exon 4 (FIGS. 10A and 10B) was used to confirm the mutation in
these 2 patients and to screen 60 independent chromosomes, all of
which turned out to be negative. FIG. 10A is the hybridization of
mutant oligonucleotide (692T) to exon 4 PCR products from patients
735, 1084 and 30 controls. Only DNA from patients 735 and 1084
hybridized to this probe. FIG. 10B is the hybridization of normal
oligonucleotide (692C) to stripped dot blot from A. All control
DNAs hybridized to this probe.
[0110] Patient 356 showed a shift on SSCP analysis of exon 5.
Direct sequencing revealed a homozygous C.fwdarw.T substitution (bp
985) which converted an evolutionarily conserved arginine residue
to cysteine; the substitution abolished an AciI restriction
endonuclease site. This was used to confirm the homozygous state of
the mutation in patient 356 (FIG. 9B) and its presence in the
heterozygous state in both parents. Fifty independent control
chromosomes, tested in the same manner, were negative for this
mutation. FIG. 9B is the AciI restriction analysis of exon 5 PCR
products for patient 356, his father (F), his mother (M), and 3
controls (C). Expected fragments: control allele, 129, 105, 90, 68
bp; mutant allele, 195, 129, 68 bp.
[0111] (3) Patients who are Genetic Compounds
[0112] Patient 458 is a compound heterozygote of a mutation in exon
5 and a mutation in exon 1. The exon 5 substitution (C.fwdarw.T at
bp 1015) resulted in the substitution of a cysteine residue for an
arginine residue; this abolished a HhaI restriction endonuclease
site, which was used to confirm the mutation in patient 458 (FIG.
9C) and to show that 50 control chromosomes were negative. FIG. 9C
is the HhaI restriction analysis of exon 5 PCR products for patient
458 and 4 controls (C). Expected fragments: control allele, 317 and
75 bp; mutant allele 392 bp. The 75-bp fragment is not shown in
FIG. 9C. The second mutation was a heterozygous G.fwdarw.A
substitution (bp 167) converting an arginine to a glutamine
residue. Allele-specific oligonucleotide hybridization to amplified
exon 1 confirmed the heterozygous state of this mutation in patient
458 and identified a second patient (1396) carrying this mutation
also in the heterozygous state (FIGS. 10C and 10D). FIG. 10C is the
hybridization of mutant oligonucleotide (167A) to exon 1 PCR
products from patients 458, 1396 and 31 controls. FIG. 10D is the
hybridization of normal oligonucleotide (167G) to stripped dot blot
from C. None of the 62 control chromosomes carried this
mutation.
[0113] The second mutation in patient 1396 was identified in exon
6: a heterozygous C.fwdarw.T substitution (bp 1081) that converted
an arginine residue to a cysteine residue, and abolished a HhaI
restriction endonuclease site. Restriction analysis confirmed the
heterozygous substitution in 1396 (FIG. 9D) and showed that 50
control chromosomes were negative. Fig. Tooth decay does not occur
in patients having a saliva above pH 5.0. 9D is the HhaI
restriction analysis of exon 6 PCR products for patient 1396 and 2
controls (C). 1S Expected fragments: control allele, 152, 86, 13
bp; mutant allele 165, 86 bp. The 13-bp fragment has been run off
the gel.
[0114] (4) Additional Sequence Chances
[0115] HhaI analysis of exon 6, mentioned above, revealed a DNA
polymorphism. This change is a T.fwdarw.C substitution at bp 1068
which does not alter the amino acid (serine), but creates a HhaI
recognition site. T at bp 1068 was found in 9% of tested
chromosomes. Sequence analysis identified 2 discrepancies with the
published cDNA sequence: a G.fwdarw.A substitution at bp 542 which
converts the glycine to an aspartate codon, and a C.fwdarw.T change
at bp 1032 which does not alter the amino acid (threonine). Since
all DNAs tested (>50 chromosomes) carried the A at bp 542 and
the T at bp 1032, it is likely that the sequence of the original
cDNA contained some cloning artifacts.
[0116] Genotype:Phenotype Correlation
[0117] Table 2 summarizes the current status of mutations in severe
MTHFR deficiency. In 8 patients, both mutations have been
identified; in 5 patients (3 families), only 1 mutation has been
identified. Overall the correlation between the genotype, enzyme
activity, and phenotype is quite consistent. Five patients, with
onset of symptoms within the first year of life, had .ltoreq.3% of
control activity. Three of these patients had missense mutations in
the homozygous state: two patients with the threonine to methionine
substitution (C692T) and one patient with the proline to leucine
substitution (C764T). The nonsense mutation (C559T) in the
homozygous state in patients 1554 and 1627 (previously reported in
Goyette P et al., Nature Genetics, 1994, 7:195-200) is also
associated with a neonatal severe form, as expected.
[0118] The other patients in Table 2 had >6% of control activity
and onset of symptoms within or after the 2nd decade of life; the
only exception is patient 1834, as previously reported (Goyette P
et al., Nature Genetics, 1994, 7:195-200). The three patients (356,
458 and 1396) with missense mutations (G167A, C985T, C1015T and
C1081T) are similar to those previously reported (patients 1779,
1834 and 1863) who had an arginine to glutamine substitution and a
second unidentified mutation (Goyette P et al., Nature Genetics,
1994, 7:195-200). The sisters with the 5' splice mutation and an
unidentified second mutation also had levels of activity in the
same range and onset of symptoms in the second decade, but the
activity is likely due to the second unidentified allele.
[0119] Discussion
[0120] The patients come from diverse ethnic backgrounds. Although
patients 1554 and 1627 are both Native Americans, the mutations
occur on different haplotypes, suggesting recurrent mutation rather
than identity by descent. Since the substitution occurs in a CpG
dinucleotide, a "hot spot" for mutation, recurrent mutation is a
reasonable hypothesis. It is difficult to assess whether some
mutations are population-specific since the numbers are too small
at the present time.
[0121] MTHFR deficiency is the most common inborn error of folate
metabolism, and a major cause of hereditary homocysteinemia. The
recent isolation of a cDNA for MTHFR has permitted mutational
analysis at this locus, with the aims of defining important domains
for the enzyme and of correlating genotype with phenotype in
MTHFR-deficient patients.
[0122] The 7 mutations described here (6 single amino acid
substitutions and a 5' splice site mutation) bring the total to 9
mutations identified thus far in severe MTHFR deficiency and
complete the mutation analysis for 8 patients. The identification
of each mutation in only one or two families points to the striking
degree of genetic heterogeneity at this locus. Seven of the 9
mutations are located in CpG dinucleotides, which are prone to
mutational events.
[0123] 5' Splice Site Mutation
[0124] The G.fwdarw.A substitution at the GT dinucleotide of the 5'
splice site in patients 354 and 355 results in a 57 bp in-frame
deletion of the coding sequence, which should delete 19 amino acids
of the protein. This deletion occurs as a result of the activation
of a cryptic 5' splice site (AG/gc) even though this cryptic site
does not have a perfect 5' splice site consensus sequence (AG/gt).
However, GC (instead of GT) as the first 2 nucleotides of an intron
has been reported in several naturally-occurring splice sites, such
as in the genes for human prothrombin and human adenine
phosphoribosyltransferase and twice within the gene for the largest
subunit of mouse RNA polymerase II. The remaining nucleotides of
the cryptic site conform to a normal splice site consensus sequence
with its expected variations (A.sub.60
G.sub.79/g.sub.100t.sub.100a.sub.59a.sub.71g.sub.82t.sub.50). It is
unlikely that the deleted enzyme resulting from this
aberrantly-spliced mRNA would have any activity; 8 of the 19
deleted amino acids are conserved in the E. Coli enzyme. Although
the 2 patients show residual enzyme activity in the range of 20% of
controls, the activity is probably due to the unidentified second
allele in these patients.
[0125] 6 Missense Mutations
[0126] The Arg.fwdarw.Cys substitution (C1081T) in patient 1396 is
within a hydrophilic sequence previously postulated to be the
linker region between the catalytic and regulatory domains of MTHFR
(Goyette P et al., Nature Genetics, 1994, 7:195-200). These 2
domains are readily separable by mild trypsinization of the porcine
enzyme. The linker domain, a highly-charged region, is likely to be
located on the outside surface of the protein and therefore more
accessible to proteolysis. Because the Arg.fwdarw.Cys substitution
converts a charged hydrophilic residue to an uncharged polar
residue, it cannot be considered a conservative change, and could
affect the stability of the enzyme.
[0127] The 2 Arg-Cys substitutions identified in patients 356 and
458 (C985T and C1015T, respectively) may be involved in binding the
FAD cofactor. Previous work in the literature showed that heating
fibroblast extracts at 55.degree., in the absence of the FAD
cofactor, inactivated MTHFR completely. The addition of FAD to the
reaction mixture before heat inactivation restored some enzyme
activity to control extracts and to extracts from some patients,
while the extracts of patients 356 and 458 were unaffected. Based
on these observations, it was suggested that these 2 patients had
mutations affecting a region of the protein involved in binding
FAD. The 2 mutations are found in close proximity to each other,
within 11 amino acids. In patient 356, the Arg residue is
evolutionarily-conserved in E. Coli and is found in a stretch of 9
conserved amino acids, suggesting a critical role for this residue;
the altered Arg residue in patient 458 is not
evolutionarily-conserved. Crystal structure analysis of medium
chain acyl-CoA dehydrogenase (MCAD), a flavoprotein, has defined
critical residues involved in the binding of FAD. Two consecutive
residues of the MCAD protein, Met165 and Trp166, involved in
interactions with FAD, can also be identified in MTHFR, 3 and 4
amino acids downstream, respectively, from the Arg residue altered
in patient 458.
[0128] The Thr.fwdarw.Met substitution (C692T) is found in a region
of high conservation with the E. Coli enzyme and in a region of
good homology with human dihydrofolate reductase (DHFR) (FIG. 11).
In FIG. 11, =is identity; .cndot. is homology; and $ is identity to
bovine DHFR enzyme. An asterisk (*) indicates location of
Thr.fwdarw.Met substitution. Considering the early-onset phenotype
of the patients, one can assume that the threonine residue is
critical for activity or that it contributes to an important domain
of the protein. This region of homology in DHFR contains a residue,
Thr136, which has been reported to be involved in folate binding.
This Thr residue in DHFR aligns with a Ser residue in MTHFR, an
amino acid with similar biochemical properties. The Thr.fwdarw.Met
substitution is located 8 amino acids downstream from this Ser
codon, in the center of the region of homology between the 2
enzymes. It is therefore hypothesized that the Thr.fwdarw.Met
substitution may alter the binding of the folate substrate.
[0129] The G167A (Arg.fwdarw.Gln) and C764T (Pro.fwdarw.Leu)
substitutions both affect non-conserved amino acids. Their
importance in the development of MTHFR deficiency cannot be
determined at the present time. All the mutations identified thus
far are located in the 5' end of the coding sequence, the region
thought to encode the catalytic domain of MTHFR. Mutation analysis
has been useful in beginning to address the structure: function
properties of the enzyme as well as to understand the diverse
phenotypes in severe MTHFR deficiency.
[0130] III. Identification of A.fwdarw.V Mutation
[0131] SSCP analysis and direct sequencing of PCR fragments were
used to identify a C to T substitution at bp 677, which converts an
alanine residue to a valine residue (FIG. 5A). The primers for
analysis of the A.fwdarw.V change are: 5'-TGAAGGAGAA GGTGTCTGCG
GGA-3' (SEQ ID NO:13) (exonic) and 5'-AGGACGGTGC GGTGAGAGTG-3' (SEQ
ID NO:14) (intronic); these primers generate a fragment of 198 bp.
FIG. 5A depicts the sequence of two individuals, a homozygote for
the alanine residue and a homozygote for the valine residue. The
antisense strands are depicted. This alteration creates a HinfI
site (FIG. 5B), which was used to screen 114 unselected French
Canadian chromosomes; the allele frequency of the substitution was
0.38. The substitution creates a HinfI recognition sequence which
digests the 198 bp fragment into a 175 bp and a 23 bp fragment; the
latter fragment has been run off the gel. FIG. 5B depicts the three
possible genotypes. The frequency of the 3 genotypes were as
follows: -/-, 37%; +/-, 51%; and +/+, 12% (the (+) indicates the
presence of the HinfI restriction site and a valine residue).
[0132] The alanine residue is conserved in porcine MTHFR, as well
as in the corresponding metF and stymetF genes of E. Coli and S.
Typhimurium, respectively. The strong degree of conservation of
this residue, and its location in a region of high homology with
the bacterial enzymes, alluded to its importance in enzyme
structure or function. Furthermore, the frequency of the (+/+)
genotype was consistent with the frequency of the thermolabile
MTHFR variant implicated in vascular disease.
[0133] Clinical Material
[0134] To determine the frequency of the A.fwdarw.V mutation, DNA
from 57 individuals from Quebec was analyzed by PCR and restriction
digestion. The individuals, who were all French Canadian, were not
examined clinically or biochemically.
[0135] The 40 individuals analyzed in Table 3 had been previously
described in Engbersen et al. (Am. J. Hum. Genet., 1995,
56:142-150). Of the 13 cardiovascular patients, 8 had
cerebrovascular arteriosclerosis and 5 had peripheral
arteriosclerosis. Five had thermolabile MTHFR while 8 had
thermostable MTHFR (greater than 33% residual activity after
heating). Controls and patients were all Dutch-Caucasian, between
20-60 years of age. None of these individuals used vitamins which
could alter homocysteine levels. Enzyme assays and homocysteine
determinations were also reported by Engbersen et al. (Am. J. Hum.
Genet., 1995, 56:142-150).
3TABLE 3 Correlation between MTHFR genotype and enzyme activity,
thermolability and plasma homocysteine level -/- +/- +/+ n = 19 n =
9 n = 12 specific activity.sup.a, b 22.9 .+-. 1.7 15.0 .+-. 0.8 6.9
.+-. 0.6 (nmol CH.sub.2O/mg.protein/hr) (11.8-33.8) (10.2-18.8)
(2.6-10.2) residual activity after 66.8 .+-. 1.5 56.2 .+-. 2.8 21.8
.+-. 2.8 heating.sup.a,b (%) (55-76) (41-67) (10-35) plasma
homocysteine.sup.a, c 12.6 .+-. 1.1 13.8 .+-. 1.0 22.4 .+-. 2.9
(.mu.M)(after fasting) (7-21) (9.6-20) (9.6-42) plasma
homocysteine.sup.a, c 41.3 .+-. 5.0.sup.d 41 .+-. 2.8 72.6 .+-.
11.7.sup.e (.mu.M)(post-methionine load) (20.9-110) (29.1-54)
(24.4-159) .sup.aone-way anova p < .01 .sup.bpaired t test for
all combinations p < .01 .sup.cpaired t test p < .05 for +/+
group versus +/- group or -/- group; p > .05 for +/- versus -/-
group. .sup.dn = 18 for this parameter .sup.en = 11 for this
parameter
[0136] Enzyme activity and plasma homocysteine were determined as
previously reported. Each value represents mean.+-.standard error.
The range is given in parentheses below the mean.
[0137] Correlation of A.fwdarw.V Mutation with Altered MTHFR
Function
[0138] A genotypic analysis was performed and enzyme activity and
thermolability were measured in a total of 40 lymphocyte pellets
from patients with premature vascular disease and controls. 13
vascular patients were selected from a previous study (Engbersen et
al., Am. J. Hum. Genet., 1995, 56:142-150), among which 5 were
considered to have thermolabile MTHFR. From a large reference group
of 89 controls, all 7 individuals who had thermolabile MTHFR were
studied, and an additional 20 controls with normal MTHFR were
selected from the same reference group. Table 3 documents the
relationship between genotypes and specific enzyme activity,
thermolability and plasma homocysteine level. The mean MTHFR
activity for individuals homozygous for the substitution (+/+) was
approximately 30% of the mean activity for (-/-) individuals,
homozygous for the alanine residue. Heterozygotes had a mean MTHFR
activity that was 65% of the activity of (-/-) individuals; this
value is intermediate between the values for (-/-) and (+/+)
individuals. The ranges of activities showed some overlap for the
heterozygous and (-/-) genotypes, but homozygous (+/+) individuals
showed virtually no overlap with the former groups. A one-way
analysis of variance yielded a p value<0.0001; a pairwise
Bonferroni t test showed that all three genotypes were
significantly different with p<0.01 for the three possible
combinations.
[0139] The three genotypes were all significantly different
(p<0.01) with respect to enzyme thermolability. The mean
residual activity after heat inactivation for 5 minutes at 460 was
67%, 56% and 22% for the (-/-), (+/-) and (+/+) genotypes,
respectively. While the degree of thermolability overlaps somewhat
for (-/-) individuals and heterozygotes, individuals with two
mutant alleles had a distinctly lower range. Every individual with
the (+/+) genotype had residual activity<35% after heating, and
specific activity<50% of that of the (-/-) genotype.
[0140] Total homocysteine concentrations, after fasting and 6 hours
after methionine loading, were measured in plasma by high
performance liquid chromatography using fluorescence detection.
Fasting homocysteine levels in (+/+) individuals were almost twice
the value for (+/-) and (-/-) individuals. The differences among
genotypes for plasma homocysteine were maintained when homocysteine
was measured following 6 hours of methionine loading. A one-way
anova yielded a p<0.01 for the fasting and post-methionine
homocysteine levels. A pairwise Bonferroni t test showed that only
homozygous mutant individuals had significantly elevated
homocysteine levels (p<0.05).
[0141] PCR-Based Mutagenesis for Expression of A.fwdarw.V Mutation
in vitro
[0142] PCR-based mutagenesis, using the cDNA-containing
Bluescript.TM. vector as template, was used to create the A to V
mutation. Vent.TM. polymerase (NEB) was used to reduce PCR errors.
The following primers were used: primer 1, bp -200 to -178, sense;
primer 2, bp 667 to 687, antisense, containing a mismatch, A, at bp
677; primer 3, 667 to 687, sense, containing a mismatch, T, at bp
677; primer 4, bp 1092 to 1114, antisense. PCR was performed using
primers 1 and 2 to generate a product of 887 bp, and using primers
3 and 4 to generate a product of 447 bp. The two PCR fragments were
isolated from a 1.2% agarose gel by Geneclean.TM. (BIO 101). A
final PCR reaction, using primers 1 and 4 and the first 2 PCR
fragments as template, was performed to generate a 1.3 kb band
containing the mutation. The 1.3 kb fragment was digested with NcoI
and MscI, and inserted into the wild-type cDNA-containing
expression vector by replacing the sequences between the NcoI site
at bp 11 and the MscI site at bp 943. The entire replacement
fragment and the cloning sites were sequenced to verify that no
additional changes were introduced by PCR.
[0143] Expression Analysis of Wild-Type and Mutagenized cDNA
[0144] Overnight cultures of JM105.TM. containing vector alone,
vector+wild-type MTHFR cDNA, or vector+mutagenized cDNA were grown
at 37.degree. C. in 2.times.YT media with 0.05 mg/ml ampicillin.
Fresh 10 ml cultures of each were inoculated with approximately 50
.mu.L of overnight cultures for a starting O.D. of 0.05, and were
grown at 37.degree. C. to an O.D. of 1 at 420 nM. Cultures were
then induced for 2 hrs. with 1 mM IPTG and pelleted. The cells were
resuspended in TE buffer with 2 .mu.g/ml aprotinin and 2 .mu.g/ml
leupeptin (3.5.times.wet weight of cells). Cell suspensions were
sonicated on ice for 3.times.15 sec. to break open cell membranes
and then centrifuged for 30 min. at 4.degree. C. to pellet cell
debris and unlysed cells. The supernatant was removed and assayed
for protein concentration with the Bio-Rad.TM. protein assay.
Western analysis was performed using the Amersham ECL.TM. kit
according to the instructions of the supplier, using antiserum
generated against purified porcine liver MTHFR. Enzymatic assays
were performed by established procedures; pre-treating the extracts
at 46.degree. C. for 5 min. before determining activity assessed
thermolability. Specific activities (nmol formaldehyde/hr./mg.
protein) were calculated for the 2 cDNA-containing constructs after
subtraction of the values obtained with vector alone (to subtract
background E. Coli MTHFR activity).
[0145] The MTHFR cDNA (2.2 kb) (FIG. 6) has an open reading frame
of 1980 bp, predicting a protein of 74.6 kDa. The purified porcine
liver enzyme has been shown to have subunits of 77 kDa. Western
analysis (FIG. 7A) of several human tissues and of porcine liver
has revealed a polypeptide of 77 kDa in all the studied tissues, as
well as an additional polypeptide of approximately 70 kDa in human
fetal liver and in porcine liver, suggesting the presence of
isozymes. Two .mu.g of bacterial extract protein was used for lanes
1-3. The tissues (lanes 4-8) were prepared by homogenization in
0.25M sucrose with protease inhibitors (2 .mu.g/ml each of
aprotinin and leupeptin), followed by sonication (3.times.15 sec.)
on ice. The extracts were spun for 15 min. in a microcentrifuge at
14,000 g and 100 .mu.g of supernatant protein was used for Western
analysis. h=human; p=porcine.
[0146] The wild-type cDNA and a mutagenized cDNA, containing the
A.fwdarw.V substitution, were expressed in E. Coli to yield a
protein of approximately 70 kDa (FIG. 7A), which co-migrates with
the smaller polypeptide mentioned above. Treatment of extracts at
46.degree. C. for 5 minutes revealed that the enzyme containing the
substitution was significantly more thermolabile than the wild-type
enzyme (p<0.001; FIG. 7B). Two separate experiments (with 3-4
replicates for each construct for each experiment) were performed
to measure thermostable activity of the wild-type MTHFR and
mutagenized MTHFR A.fwdarw.V cDNAs. The values shown represent
mean.+-.standard error for each experiment, as % of residual
activity after heating. The means of the specific activities before
heating (expressed as nmol formaldehyde/hr./mg. protein) were as
follows: Exp. 1, 3.8 and 5.3 for MTHFR and MTHFR A.fwdarw.V,
respectively; Exp. 2, 6.2 and 7.5 for MTHFR and MTHFR A.fwdarw.V,
respectively. The expression experiments were not designed to
measure differences in specific activity before heating, since
variation in efficiencies of expression could contribute to
difficulties in interpretation. Curiously though, the specific
activity for the mutant construct was higher in both experiments.
It is possible that the mutant protein has increased stability in
E. Coli, or that inclusion bodies in the extracts contributed to
differences in recovery of properly-assembled enzyme.
[0147] These studies have identified a common substitution in the
MTHFR gene which results in thermolability in vitro and in vivo.
The mutation, in the heterozygous or homozygous state, correlates
with reduced enzyme activity and increased thermolability of MTHFR
in lymphocyte extracts. A significant elevation in plasma
homocysteine was observed in individuals who were homozygous for
the mutation. Statistically-significant differences for
homocysteine levels were not observed between heterozygotes and
(-/-) individuals; this observation is not surprising, since plasma
homocysteine can be influenced by several environmental factors,
including intake of folate, vitamin B.sub.12, vitamin B.sub.6, and
methionine, as well as by genetic variation at other loci, such as
the cystathionine-S-synthase gene.
[0148] The alanine to valine substitution conserves the
hydrophobicity of the residue and is associated with small changes
in activity, in contrast to non-conservative changes, such as the
previously-reported arginine to glutamine change in MTHFR, which is
associated with a greater decrease in enzyme activity and severe
hyperhomocysteinemia. The alanine residue is situated in a region
of homology with the bacterial metF genes. The same region of
homology was also observed in the human dihydrofolate reductase
(DHFR) gene (FIG. 11), although the alanine residue itself is not
conserved; this region of amino acids 130-149 of DHFR contains T136
which has been implicated in folate binding in an analysis of the
crystal structure of recombinant human DHFR. It is tempting to
speculate that this region in MTHFR is also involved in folate
binding and that the enzyme may be stabilized in the presence of
folate. This hypothesis is compatible with the well-documented
influence of folate on homocysteine levels and with the reported
correction of mild hyperhomocysteinemia by folic acid in
individuals with premature vascular disease, and in individuals
with thermolabile MTHFR.
[0149] Although the cDNA is not long enough to encode the larger
MTHFR polypeptide, it is capable of directing synthesis of the
smaller isozyme. The ATG start codon for this polypeptide is within
a good consensus sequence for translation initiation. Whether the
isozyme is restricted to liver and what its role is in this tissue
remain to be determined.
[0150] These data have identified a common genetic change in MTHFR
which results in thermolability; these experiments do not directly
address the relationship between this change and vascular disease.
Nonetheless, this polymorphism represents a diagnostic test for
evaluation of MTHFR thermolability in hyperhomocysteinemia. Large
case-control studies are required to evaluate the frequency of this
genetic change in various forms of occlusive arterial disease and
to examine the interaction between this genetic marker and dietary
factors. Well-defined populations need to be examined, since the
limited data set thus far suggests that population-specific allele
frequencies may exist. More importantly, however, the
identification of a candidate genetic risk factor for vascular
disease, which may be influenced by nutrient intake, represents a
critical step in the design of appropriate therapies for the
homocysteinemic form of arteriosclerosis.
[0151] cDNA For MTHFR and its Potential Utility
[0152] The cDNA sequence is a necessary starting point for the
detection of MTHFR sequence abnormalities that would identify
individuals at risk for cardiovascular and neurological diseases,
as well as other disorders affected by folic acid metabolism.
Diagnostic tests by DNA analysis are more efficient and accurate
than testing by enzymatic/biochemical assays. Less blood is
required and results are available in a shorter period of time. The
tests could be performed as a routine operation in any laboratory
that performs molecular genetic diagnosis, without the specialized
reagents/expertise that is required for an enzyme-based test.
[0153] The second major utility of the cDNA would be in the design
of therapeutic protocols, for correction of MTHFR deficiency. These
protocols could directly involve the gene, as in gene therapy
trials or in the use of reagents that could modify gene expression.
Alternatively, the therapy might require knowledge of the amino
acid sequence (derived from the cDNA sequence), as in the use of
reagents that would modify enzyme activity. The identification of
sequences and/or sequence changes in specific regions of the cDNA
or protein, such as FAD binding sites or folate-binding sites, are
useful in designing therapeutic protocols involving the above
nutrients.
[0154] Utility of Invention in Clinical and Diagnostic Studies
[0155] Coronary artery disease patients in Montreal (n=153) were
studied to examine the frequency of the alanine to valine
substitution. Fourteen percent of the patients were homozygous for
this mutation. An analysis of 70 control individuals (free of
cardiovascular disease) demonstrated that only seven % of these
individuals were homozygous for the alanine to valine mutation.
[0156] Analysis of homocysteine levels in 123 men of the above
patient group indicated that the mutant allele significantly raised
homocysteine levels from 10.2 micromoles/L in homozygous normal men
to 11.5 and 12.7 in heterozygotes and homozygous mutants,
respectively.
[0157] Families with a child with spina bifida, a neural tube
defect, have been examined for the presence of the alanine to
valine mutation. Approximately 16% of mothers who had a child with
spina bifida were homozygous for this mutation, while only 5% of
control individuals were homozygous. Fathers of children with spina
bifida also had an increased prevalence of the homozygous mutant
genotype (10%) as did the affected children themselves (13%).
[0158] Table 4 indicates the interactive effect of folic acid with
the homozygous mutant alanine to valine change. In a study of
families from Framingham, Mass. and Utah, individuals who were
homozygous mutant but had folate levels above 5 ng/ml did not have
increased homocysteine levels compared to individuals with the
normal or heterozygous genotype. However, individuals who were.
homozygous mutant but had folate levels below 5 ng/ml had
homocysteine levels that were significantly higher than the other
genotypes.
4TABLE 4 Mean fasting and PML homocysteine levels for different
MTHFR genotypes MTHFR genotype Plasma Normals Heterozygote
Homozygotes Homocysteine (-/-) s (+/-) (+/+) P.sub.trend N 58 61 30
Fasting* 9.4 9.2 12.1 0.02 Folate <5 ng/mL 10.2 10.4 15.2 0.002
Folate .sup.3 5 ng/mL 8.2 7.5 7.5 0.52 Post-Methionine load 30.0
30.9 31.3 0.62 *Significant interaction between folate levels and
genotype (p = 0.03)
[0159] Table 4 provides preliminary data for therapeutic
intervention by folic acid supplementation to individuals who are
homozygous for the alanine to valine change. The data suggest that
higher levels of plasma folate would lead to normalization of
homocysteine levels in mutant individuals and might prevent the
occurrence of disorders associated with high homocysteine levels,
such as cardiovascular disease, neural tube defects, and possibly
other disorders. Folic acid supplementation for mutant individuals
might also restore methionine and S-adenosylmethionine levels to
normal. This would be relevant for disorders that are influenced by
methylation, such as neoplasias, developmental anomalies,
neurologic disease, etc.
[0160] Genetic Polymorphism in Methylenetetrahydrofolate Reductase
(MTHFR) Associated with Decreased Activity
[0161] A common mutation (C677T) results in a thermolabile enzyme
with reduced specific activity (approximately 35% of control values
in homozygous mutant individuals). Homozygous mutant individuals
(approximately 10% of North Americans) are predisposed to mild
hyperhomocysteinemia, when their folate status is low. This
genetic-nutrient interactive effect is believed to increase the
risk for neural tube defects (NTD) and vascular disease. There has
been reported an increased risk for spina bifida in children with
the homozygous mutant genotype for C677T. With the present
invention, a second common variant in MTHFR (A1298C), an E to A
substitution has been characterized. Homozygosity was observed in
approximately 10% of Canadian individuals. This polymorphism was
associated with decreased enzyme activity; homozygotes had
approximately 60% of control activity in lymphocytes.
[0162] A sequence change (C1298A) has been identified.
Heterozygotes for both the C677T and the A1298C mutation,
approximately 15% of individuals, had 50%-60% of control activity,
a value that was lower than that seen in single heterozygotes for
the C677T variant. No individuals were homozygous for both
mutations. A silent genetic variant T1317C, was identified in the
same exon. It was relatively infrequent (allele frequency=5%) in
the study group, but was common in a small sample of African
individuals (allele frequency=39%).
[0163] In addition, by virtue of the role of MTHFR in
folate-dependent homocysteine metabolism, the C677T mutation
predisposes to mild hyperhomocysteinemia, a risk factor for
vascular disease, in the presence of low folate status. By the
present invention, the frequency of the A1298C variant has been
determined and its potential impact on enzyme function has been
assessed.
[0164] Patients with spina bifida and mothers of patients were
recruited from the Spina Bifida Clinic at the Montreal Children's
Hospital following approval from the Institutional Review Board.
Control children and mothers of controls were recruited from the
same institution. Blood samples were used to prepare DNA from
peripheral leukocytes, to assay MTHFR activity in lymphocyte
extracts, and to measure total plasma homocysteine (tHcy). The
presence of the C677T mutation (A to V) was evaluated by PCR and
HinfI digestion (2). The A1298C mutation was initially examined by
PCR and MboII digestion (5). The silent mutation, T1317C, was
identified by SSCP and sequence analysis in a patient with severe
MTHFR deficiency and homocystinuria. This patient, an
African-American female, already carries a previously-described
splice mutation (patient 354 (8)). Since this mutation also creates
a MboII site and results in a digestion pattern identical to that
of the A1298C mutation, distinct artificially-created restriction
sites were used to distinguish between these 2 mutations. Detection
of the A1298C polymorphism was performed with the use of the sense
primer 5'-GGGAGGAGCTGACCAGTGCAG-3' and the antisense primer
(5'-GGGGTCAGGCCAGGGGCAG-3'), such that the 138 bp PCR fragment was
digested into 119 bp and 19 bp fragments by Fnu4HI in the presence
of the C allele. An antisense primer
(5'-GGTTCTCCCGAGAGGTAAAGATC-3'), which introduces a TaqI site, was
similarly designed to identify the C allele of the T1317C
polymorphism. Together with a sense primer
(5'-CTGGGGATGTGGTGGCACTGC-3'), the 227 bp fragment is digested into
202 bp and 25 bp fragments.
5TABLE 5 Genotype distributions, MTHFR activity (nmol
formaldehyde/mg protein/hour), and total plasma homocysteine (tHcy;
.mu.M) for mothers and children E/E E/A A/A A/A A/V V/V A/A A/V V/V
A/A A/V V/V Mothers (n = 141) # 24 32 19 27 26 0 13 0 0 % 17 23 13
19 18 0 9 0 0 MTHFR 49.0 .+-. 18.9 33.0 .+-. 10.8 15,7 .+-. 4.5
45.0 .+-. 16.0 30.2 .+-. 19.3 -- 32.1 .+-. 9.0 -- -- [14] [19]
[11]* [15] [15]* [7]* THcy 9.5 .+-. 3.1 10.0 .+-. 3.2 12.2 .+-. 7.1
8.4 .+-. 2.1 10.0 .+-. 3.1 -- 9.5 .+-. 2.0 -- -- [24] [32] [19]**
[25] [26] [13] Children (n = 133) # 23 43 18 20 15 1 13 0 0 % 17 32
13 15 11 1 10 0 0 MTHFR 52.0 .+-. 17.0 38.2 .+-. 15.0 16.2 .+-. 5.3
35.7 .+-. 9.7 26.1 .+-. 5.0 21.6 29.5 .+-. 10.3 -- -- [12] [27]*
[11]* [18]* [9]* [1] [6]* THcy 7.6 .+-. 2.5 8.2 .+-. 3.0 9.7 .+-.
5.1 7.5 .+-. 2.3 8.1 .+-. 2.8 9.5 7.4 .+-. 1.5 -- -- [23] [43]
[18]** [20] [15] [1] [13] The three A1298C genotypes and the three
C677T genotypes are designated by the amino acid codes: EE, EA, AA,
and AA, AV, VV, respectively. Statistical significance was assessed
by student t-test, in comparison with EEAA values. *(p < 0.05);
**(p .ltoreq. 0.07). Standard deviations are given and square
brackets indicate the number of individuals for whom MTHFR
activities and homocysteine levels were available.
[0165] The frequencies of the three genotypes for the A1298C
mutation (EE, EA and AA) were not different between case and
control mothers, or between case and control children (data not
shown). Consequently, all the mothers and all the children were
grouped together for analyses (Table 5). Nine % of mothers had the
homozygous AA genotype while 37% were heterozygous. This frequency
is quite similar to the frequency of the homozygous mutant genotype
(VV) for the C677T polymorphism. In the MTHFR human cDNA sequence
mentioned above, the cDNA contained the C nucleotide at bp 1298
change as a C1298A substitution. Since the A nucleotide is clearly
the more frequent base at this position, the A1298C nomenclature
was chosen.
[0166] Since the C677T mutation (A to V) decreases MTHFR activity
and increases homocysteine levels, the three genotype groups for
the A1298C (E to A) mutation were further stratified by the
genotype for the A to V mutation, to avoid the confounding
influence of the latter polymorphism on MTHFR activity and
homocysteine levels. The frequencies of the 9 genotypes, with MTHFR
activity and homocysteine levels for each genotype, are shown in
Table 5. If the mothers and children without either mutation i.e.
EE/AA are used as the reference (control) group, the mothers and
children that are homozygous for the A1298C mutation (AAAA) have
approximately 65% and 57%, respectively, of control MTHFR activity.
Heterozygotes for the C677T change alone (EEAV) have approximately
70% of control activity, as reported in other studies, while double
heterozygotes (EAAV), 18% of mothers and 11% of children, have an
additional loss of activity (approximately 62% and 50% of control
values, respectively) Homocysteine levels were not significantly
increased by the A1298C mutation, but homocysteine was elevated
(with borderline significance, p<0.07) in mothers and children
who were homozygous for the C677T change. The small number of
individuals who were homozygous for the A1298C mutation (n=13) may
have influenced the power of the statistical analyses and precluded
an investigation of the genetic-nutrient interactive effect that
leads to mild hyperhomocysteinemia, as seen in individuals with the
C677T mutation.
[0167] The T1317C substitution does not alter the amino acid
(phenylalanine) and is likely a benign change, although a splicing
defect cannot be ruled out at the present time. In an evaluation of
38 control mothers from this study, 2 were found to be heterozygous
and one was identified as a homozygote, resulting in an allele
frequency of 5% ({fraction (4/76)}). Since this substitution was
identified in an African-American female, control African
individuals were also examined (n=9). Seven of these were
heterozygous, resulting in an allele frequency of 39% ({fraction
(7/18)}).
[0168] The A1298C mutation clearly reduces MTHFR activity, albeit
to a lesser extent than the C677T mutation. Consequently its effect
on homocysteine levels is also attenuated and, in fact, may only be
significant when an individual carries both mutations and/or has
poor nutrient status. However, since double heterozygotes are
estimated to represent approximately 15% of the population, this
variant should be examined in conjunction with the C677T variant in
studies of hyperhomocysteinemia.
[0169] The A1298C mutation is clearly polymorphic in Canadian
individuals and should be examined in other populations. The A
nucleotide is likely to be the ancestral sequence since it
represents the more common allele, although the original human
MTHFR cDNA sequence (GenBank accession number U09806) carried the C
nucleotide. This polymorphism is similar in frequency to the C677T
polymorphism. Presumably the two substitutions arose separately on
a A1298/C677 or E/A haplotype, since the haplotype with both
substitutions (C1298/T677 or A/V) is extremely rare. One such
haplotype was seen in a child with the EAVV genotype, suggesting a
recombinant chromosome.
[0170] Doubly homozygous individuals (AAVV) were not observed in
this study. Since the double mutation in cis is rare, it is
possible that not enough alleles were studied. Larger studies in
other populations might result in the identification of these
individuals. Presumably the MTHFR activity would be even lower and
homocysteine levels might be higher than those observed thus
far.
[0171] The C677T polymorphism in exon 4 is within the N-terminal
catalytic domain of the enzyme whereas the A1298C polymorphism in
exon 7 is within the C-terminal regulatory domain. The more
dramatic effect on enzyme activity with the first polymorphism may
be a consequence of its location within the catalytic region. The
second polymorphism could affect enzyme regulation, possibly by
S-adenosylmethionine, an allosteric inhibitor of MTHFR, which is
known to bind in the C-terminal region.
[0172] Many studies have examined the effects of the C677T
polymorphism on MTHFR enzyme activity and on homocysteine levels.
Although the correlation between the presence of this substitution
and decreased enzyme activity/increased homocysteine levels has
been quite good, the variability in results, particularly in
heterozygous individuals, may reflect the presence of a second
common variant in the population.
[0173] The third variant, T1317C, was present on 5% of alleles in
Canadian individuals but appears to be extremely common in
individuals of African ancestry. The methodology outlined in this
report should be used to assess the frequency of the A1298C and
T1317C in other populations, since the use of the MboII restriction
site for analysis of the A1298C change, as first reported, would
not discriminate between the 2 polymorphisms.
[0174] The C677T mutation is a risk factor for hyperhomocysteinemia
and has been implicated in both neural tube defects and vascular
disease.
[0175] Gene Structure of Human and Mouse Methylenetetrahydrofolate
Reductase (MTHFR)
[0176] A human cDNA for MTHFR, 2.2 kb in length, has been expressed
and shown to result in a catalytically-active enzyme of
approximately 70 kDa. Fifteen mutations have been identified in the
MTHFR gene: 14 rare mutations associated with severe enzymatic
deficiency and one common variant associated with a milder
deficiency. The common polymorphism has been implicated in three
multifactorial diseases: occlusive vascular disease, neural tube
defects and colon cancer. The human gene has been mapped to
chromosomal region 1p36.3 while the mouse gene has been localized
to distal Chromosome 4. The isolation and characterization of the
human and mouse genes for MTHFR is herein reported. A human genomic
clone (17 kb) was found to contain the entire cDNA sequence of 2.2
kb; there were 11 exons ranging in size from 102 bp to 432 bp.
Intron sizes ranged from 250 bp to 1.5 kb with one exception of 4.2
kb. The mouse genomic clones (19 kb) start 7 kb 5' to exon 1 and
extend to the end of the coding sequence. The mouse amino acid
sequence is approximately 90% identical to the corresponding human
sequence. The exon sizes, locations of intronic boundaries, and
intron sizes are also quite similar between the two species. The
availability of human genomic clones has been useful in designing
primers for exon amplification and mutation detection. The mouse
genomic clones may be used to make constructs for gene targeting
and generation of mouse models for MTHFR deficiency.
[0177] A common polymorphism, C677T has been identified, which
converts an alanine codon to valine (Frosst et al., 1995). This
common polymorphism, which is present on approximately 35% of
alleles in the North American population, encodes the thermolabile
variant and predisposes to mild hyperhomocysteinemia when folate
status is low (Frosst et al., 1995; Jacques et al., 1996;
Christensen et al., 1997). This genetic-nutrient interactive effect
is believed to be a risk factor for arteriosclerosis (Frosst et al,
1995) and neural tube defects. In contrast, the mutant homozygous
genotype may decrease the risk for colon cancer.
[0178] The characterization of the genomic structure for human
MTHFR is reported herein. The corresponding analysis of the mouse
gene, with a comparison of the overall organization of the gene and
the amino acid sequences in these two species, is also shown.
[0179] Screening of Genomic Libraries
[0180] Genomic libraries were screened using standard methods of
plaque hybridization. The 2.2 kb human cDNA was radiolabelled and
used as a probe in screening both human and murine genomic
libraries. Screening for the human gene was performed on a phage
library of partial EcoRI digestion fragments from total genomic DNA
(ATCC #37385), and on a phage library of chromosome 1-specific
complete EcoRI digestion fragments (ATCC#57738). Screening for the
mouse gene was performed on a .lambda.DASH library of partial Sau3A
digestion fragments from total genomic DNA of mouse strain 129SV
(obtained from Dr. J. Rossant, University of Toronto). Positive
clones were purified by sequential rounds of screening and
isolation, and phage DNA was isolated using phage DNA isolation
columns (QIAGEN). Human clones were digested with EcoRI to release
the inserts, and then with XbaI to facilitate cloning into
Bluescript plasmid (Stratagene). The mouse clones were digested
with SalI or EcoRI, and the inserts were subcloned into
Bluescript.
[0181] Characterization of Mouse cDNA Sequences
[0182] Mouse genomic clones were sequenced (Sequenase kit,
Amersham) using human cDNA primers spanning most of the available
2.2 kb cDNA. These sequences were then used to generate
mouse-specific cDNA primers. The mouse-specific primers were used
in PCR amplification of overlapping cDNA fragments from
reverse-transcribed mouse liver RNA. The PCR products were
subcloned into the PCRII vector (Invitrogen) and sequenced. Two
different species of mouse (C57B1/6J and ct) were used to generate
MTHFR sequence by RT-PCR, to ensure that the PCR protocol did not
generate sequencing errors.
[0183] Characterization of Intron Boundaries and Sizes, and
Restriction Analysis of Human and Mouse Genes
[0184] Primers from cDNA sequences of human and mouse were used to
sequence the respective genomic clones. Intron boundaries were
determined from regions of divergence between cDNA and genomic
clone sequences, and by the identification of splice acceptor and
donor consensus sites. Intronic sequences were obtained for 40-50
bp from the junctions and are shown in FIGS. 12A-12B (human) and
FIGS. 13A-13B (mouse). The same cDNA primers were used in PCR
amplification of total genomic DNA and of genomic clones to
determine the approximate sizes of introns in the human and mouse
genes. Table 6 lists the locations and approximate sizes of introns
for both species. The PCR products were analyzed by restriction
enzyme digestion to generate a preliminary restriction map of the
gene. This restriction map was then confirmed by restriction
analysis of the genomic clones in Bluescript.
[0185] Referring to FIGS. 12A-12B, the bp location of the exons
within the cDNA, in parentheses, is based on the published human
cDNA sequence (GenBank accession number U09806). Bp 1 is 12 bp
upstream from the ATG in the original cDNA; an asterisk indicates
the equivalent base here. Exon 1 contains the ATG start site
(underlined), and exon 11 contains the termination codon
(underlined). Uppercase characters indicate exonic sequences, and
lower case characters are intronic. Consensus splice junction
sequences are underlined. The 3' boundary of exon 11 has been
designated by the location of the polyA tail.
[0186] Referring to FIGS. 13A-13B, the bp location of the exons
within the cDNA, in parentheses, is based on the equivalent bp 1 of
the human sequences in FIGS. 12A-12B (bp 1 is indicated by an
asterisk). Exon 1 contains the ATG start site (underlined), and
exon 11 contains the termination codon (doubly underlined).
Uppercase characters indicate exonic sequences, and lower case
characters are intronic. Consensus splice junction sequences are
underlined. The 3' boundary of exon 11 is designated as the
termination codon, since the site of polyadenylation is unknown.
Also underlined in exon 11 is the first repeat of the 52 bp
repeated element.
[0187] Referring to FIG. 14, exon sizes for human and mouse are
reported in FIGS. 12A-12B and FIGS. 13A-13B, respectively. Exons
are indicated in shaded boxes. Uncharacterized regions of the gene
are hatched, and exon numbering corresponds to FIGS. 12A-12B and
13A-13B. E=EcoRI; X=XbaI; A.sub.n=polyadenylation site. The EcoRI
restriction site at the 5' end of the mouse gene is part of the
phage polylinker sequence.
[0188] Referring to FIG. 15, residues that are identical to the
human MTHFR sequence are shown as empty boxes, and gaps in amino
acid homology are represented by a dash.
[0189] Human Genomic Clones
[0190] The genomic clones isolated from the human libraries
contained a 16 kb EcoRI fragment, encompassing part of exon 1 and
exons 2 through 11, and a 1 kb EcoRI fragment containing most of
exon 1. Exon 1 is defined as the most 5' exon from the previously
published cDNA sequence; it contains the ATG start site that was
used to express the human cDNA in bacterial extracts (Frosst et al.
1995). A graphic representation of the human gene and its
restriction map are depicted in FIG. 3. The sequences of each exon
and 50 bp of flanking intronic sequences are shown in FIGS.
12A-12B. Exons range in size from 102 bp to 432 bp, and the
critical dinucleotides in the 5' and 3' splice site consensus
sequences (GT and AG, respectively) are underlined. The 3' boundary
of exon 11 is defined by the site of polyadenylation in the cDNA; a
possible polyadenylation signal (AACCTA) is present 15 bp upstream
of the polyadenylation site, although it varies from the consensus
sequence. Table 6 lists the locations and approximate sizes of
introns as determined by PCR amplification; the introns range in
size from approximately 250 bp to 4.2 kb.
[0191] Mouse Genomic Clones
[0192] Genomic clones isolated from the mouse libraries were
digested with EcoRI for subcloning and characterization. Exon
nomenclature is based on the corresponding human gene sequences.
FIGS. 13A-13B list all known exons and their sizes, with 40 to 50
bp of flanking intronic sequences. FIG. 14 shows a graphic
representation of the mouse genomic structure aligned with the
human gene. The size of exon 11 is undetermined, since the sequence
for this region was determined directly from the genomic clones.
The termination codon is located within a region of 52 bp which is
repeated 3 times in the gene. The significance of this, if any, is
unknown at the present time. The dinucleotides of the splice
junctions (underlined in FIGS. 13A-13B) are in agreement with
consensus sequences. Table 6 lists the approximate sizes of introns
as determined by PCR, and their bp location in the cDNA. The
introns range in size from approximately 250 bp to 4.2 kb.
[0193] Comparison of the Human and Mouse Genes
[0194] The human and mouse genes are very similar in size and
structure (FIG. 14). The introns are similar in size, and identical
in location within the coding sequence. However, the mouse cDNA is
one amino acid shorter in exon 1 which causes a shift in bp
numbering of the mouse cDNA (Table 6, FIGS. 13A-13B). Exon 1 was
defined from the original published human cDNA, based on the
presence of a translation start codon. In both human and mouse
genes, the 5' boundary of exon 1 was assigned after the isolation
of several non-coding cDNA extensions that are generated by
alternative splicing from this junction. Characterization of these
5' cDNA extensions is in progress. The nucleotide sequences of the
human and mouse genes are very similar within coding regions, but
homology decreases dramatically in the 3' UTR region and within
introns.
[0195] Human and Mouse Primary Amino Acid Sequence Homology
[0196] The primary amino acid sequences of human and mouse were
compared to each other, and aligned with the sequence of the MetF
(MTHFR) enzyme from bacteria (FIG. 15). The human and mouse amino
acid sequences are almost 90% identical. As previously observed,
only the 5' half of the mammalian sequences align with the
bacterial enzyme; bacterial MTHFR has the same catalytic activity
as the mammalian enzyme but lacks the regulatory region in the
C-terminal domain. The murine amino acid sequence is two amino
acids shorter than the human sequence: one less amino acid in exon
1 and one less in exon 11.
[0197] The isolation of the human MTHFR gene and the analysis of
gene structure are part of an ongoing effort to study MTHFR
deficiency in homocystinuria and in multifactorial diseases. The
availability of genetic structure information and of intronic
sequences will help in the mutational analysis of patients
suffering from MTHFR deficiency and in the characterization of the
5' regulatory region.
[0198] Expression analysis of the 2.2 kb cDNA in a bacterial
expression system resulted in a catalytically-active 70 kDa protein
(Frosst et al. 1995). A MTHFR polypeptide of this size was observed
in some human tissues on Western blots, but a larger isozyme (77
kDa), corresponding to the estimated size of the porcine
polypeptide, was observed in all the examined tissues. These data
suggested the presence of protein isoforms for MTHFR that could be
tissue-specific (Frosst et al., 1995). Since human or mouse
sequences homologous to the N-terminal porcine amino acid sequences
have not been identified, it is assumed that the missing sequences
required to encode the larger isoform are 5' to the available cDNA
sequences. Two mRNAs for human MTHFR (approximately 7.5 and 8.5 kb)
have been seen in all tissues on Northern blots (data not shown),
suggesting very large UTRs. The isolation of 5' coding sequences
has been complicated by the presence of several
alternatively-spliced 5' non-coding extensions that splice into
exon 1. The alternative splicing into exon 1 has been observed in
both human and mouse MTHFR. The long UTRs and the alternative
splicing events suggest that the regulation of this important gene
may be quite complex.
[0199] Nonetheless, the available information has been critical for
identification of mutations in patients with various forms of MTHFR
deficiency. The mouse sequences in exons 1 and 2 have been useful
in the design of antisense oligonucleotides to successfully inhibit
MTHFR in mouse embryo cultures and disrupt development of the
neural tube (Lanoue et al. 1997). The isolation and
characterization of mouse genomic clones is essential for
construction of targeting vectors to generate mouse models for
MTHFR deficiency.
6TABLE 6 Approximate sizes of introns, and their locations in human
and mouse MTHFR cDNA Approximate Human Mouse Intron size (kb)
location.sup.1 Location.sup.1 1 1.5 248-249 245-246 2 0.8 487-488
484-485 3 4.2 598-599 595-596 4 0.8 792-793 789-790 5 0.35
1043-1044 1040-1041 6 0.25 1178-1179 1175-1176 7 0.3 1359-1360
1356-1357 8 1.5 1542-1543 1539-1540 9 1.3 1644-1645 1641-1642 10
0.3 1764-1765 1761-1762 .sup.1Base pairs flanking introns, from
FIGS. 1 and 2. Bp1 is 12 bp upstream from the ATG, as in the
original report of the CDNA sequence (Goyette et al. 1994)
[0200] Various doses of methotrexate (a drug used in treatment of
cancer and arthritis, possibly other diseases) were added to colon
carcinoma lines in culture. Much lower doses of methotrexate are
needed to kill the lines that carry the 677C.fwdarw.T mutation in
MTHFR, compared to lines that do not carry this mutation. The IC50
(concentration needed to kill half the cells) is approximately 20
nM for lines with the mutation and approximately 150 nM for lines
without the mutation. To extrapolate to the human condition,
patients with this MTHFR mutation might require lower doses of
methotrexate for therapy, or might be subject to methotrexate
toxicity at high doses.
7TABLE 7 Summary of BMD analysis Entire cohort: Values are means
+/- SE Genotype 1/1 Genotype 1/2 Genotype 2/2 Spinal Z score -1.06
(0.193) -1.25 (0.176) -1.86 (0.238) Femoral neck Z score -0.69
(0.134) -0.78 (0.126) -0.87 (0.228) Trochanter Z score -0.60
(0.142) -0.52 (0.134) -1.15 (0.249) Ward's triangle Z -0.67 (0.147)
-0.80 (0.139) -0.96 (0.257) score Values for bone mineral density
in a group of individuals who were examined for the MTHFR
677G.fwdarw. T mutation. Genotype 1/1 = normal C/C Genotype 1/2 =
carriers C/T Genotype 2/2 = homozygous mutant T/T
[0201] As seen on Table 7, the lower the score, the lower the bone
mineral density and therefore the higher the risk for osteoporosis.
The results suggest that the homozygous mutant genotype (2/2) is
asssociated with lower bone mineral density and therefore higher
risk of osteoporosis.
[0202] While the invention has been described in connection with
specific embodiments thereof, it will be understood that it is
capable of further modifications and this application is intended
to cover any variations, uses, or adaptations of the invention
following, in general, the principles of the invention and
including such departures from the present disclosure as come
within known or customary practice within the art to which the
invention pertains and as may be applied to the essential features
hereinbefore set forth, and as follows in the scope of the appended
claims.
Sequence CWU 1
1
18 1 2220 DNA Homo sapiens CDS (1)...(1980) 1 aat tcc gga gcc atg
gtg aac gaa gcc aga gga aac agc agc ctc aac 48 Asn Ser Gly Ala Met
Val Asn Glu Ala Arg Gly Asn Ser Ser Leu Asn 1 5 10 15 ccc tgc ttg
gag ggc agt gcc agc agt ggc agt gag agc tcc aaa gat 96 Pro Cys Leu
Glu Gly Ser Ala Ser Ser Gly Ser Glu Ser Ser Lys Asp 20 25 30 agt
tcg aga tgt tcc acc ccg ggc ctg gac cct gag cgg cat gag aga 144 Ser
Ser Arg Cys Ser Thr Pro Gly Leu Asp Pro Glu Arg His Glu Arg 35 40
45 ctc cgg gag aag atg agg cgg cga ttg gaa tct ggt gac aag tgg ttc
192 Leu Arg Glu Lys Met Arg Arg Arg Leu Glu Ser Gly Asp Lys Trp Phe
50 55 60 tcc ctg gaa ttc ttc cct cct cga act gct gag gga gct gtc
aat ctc 240 Ser Leu Glu Phe Phe Pro Pro Arg Thr Ala Glu Gly Ala Val
Asn Leu 65 70 75 80 atc tca agg ttt gac cgg atg gca gca ggt ggc ccc
ctc tac ata gac 288 Ile Ser Arg Phe Asp Arg Met Ala Ala Gly Gly Pro
Leu Tyr Ile Asp 85 90 95 gtg acc tgg cac cca gca ggt gac cct ggc
tca gac aag gag acc tcc 336 Val Thr Trp His Pro Ala Gly Asp Pro Gly
Ser Asp Lys Glu Thr Ser 100 105 110 tcc atg atg atc gcc agc acc gcc
gtg aac tac tgt ggc ctg gag acc 384 Ser Met Met Ile Ala Ser Thr Ala
Val Asn Tyr Cys Gly Leu Glu Thr 115 120 125 atc ctg cac atg acc tgc
tgc cgt cag cgc ctg gag gag atc acg ggc 432 Ile Leu His Met Thr Cys
Cys Arg Gln Arg Leu Glu Glu Ile Thr Gly 130 135 140 cat ctg cac aaa
gct aag cag ctg ggc ctg aag aac atc atg gcg ctg 480 His Leu His Lys
Ala Lys Gln Leu Gly Leu Lys Asn Ile Met Ala Leu 145 150 155 160 cgg
gga gac cca ata ggt gac cag tgg gaa gag gag gag gga ggc ttc 528 Arg
Gly Asp Pro Ile Gly Asp Gln Trp Glu Glu Glu Glu Gly Gly Phe 165 170
175 aac tac gca gtg gac ctg gtg aag cac atc cga agt gag ttt ggt gac
576 Asn Tyr Ala Val Asp Leu Val Lys His Ile Arg Ser Glu Phe Gly Asp
180 185 190 tac ttt gac atc tgt gtg gca ggt tac ccc aaa ggc cac ccc
gaa gca 624 Tyr Phe Asp Ile Cys Val Ala Gly Tyr Pro Lys Gly His Pro
Glu Ala 195 200 205 ggg agc ttt gag gct gac ctg aag cac ttg aag gag
aag gtg tct gcg 672 Gly Ser Phe Glu Ala Asp Leu Lys His Leu Lys Glu
Lys Val Ser Ala 210 215 220 gga gcc gat ttc atc atc acg cag ctt ttc
ttt gag gct gac aca ttc 720 Gly Ala Asp Phe Ile Ile Thr Gln Leu Phe
Phe Glu Ala Asp Thr Phe 225 230 235 240 ttc cgc ttt gtg aag gca tgc
acc gac atg ggc atc act tgc ccc atc 768 Phe Arg Phe Val Lys Ala Cys
Thr Asp Met Gly Ile Thr Cys Pro Ile 245 250 255 gtc ccc ggg atc ttt
ccc atc cag ggc tac cac tcc ctt cgg cag ctt 816 Val Pro Gly Ile Phe
Pro Ile Gln Gly Tyr His Ser Leu Arg Gln Leu 260 265 270 gtg aag ctg
tcc aag ctg gag gtg cca cag gag atc aag gac gtg att 864 Val Lys Leu
Ser Lys Leu Glu Val Pro Gln Glu Ile Lys Asp Val Ile 275 280 285 gag
cca atc aaa gac aac gat gct gcc atc cgc aac tat ggc atc gag 912 Glu
Pro Ile Lys Asp Asn Asp Ala Ala Ile Arg Asn Tyr Gly Ile Glu 290 295
300 ctg gcc gtg agc ctg tgc cag gag ctt ctg gcc agt ggc ttg gtg cca
960 Leu Ala Val Ser Leu Cys Gln Glu Leu Leu Ala Ser Gly Leu Val Pro
305 310 315 320 ggc ctc cac ttc tac acc ctc aac cgc gag atg gct acc
aca gag gtg 1008 Gly Leu His Phe Tyr Thr Leu Asn Arg Glu Met Ala
Thr Thr Glu Val 325 330 335 ctg aag cgc ctg ggg atg tgg act gag gac
ccc agg cgt ccc cta ccc 1056 Leu Lys Arg Leu Gly Met Trp Thr Glu
Asp Pro Arg Arg Pro Leu Pro 340 345 350 tgg gct ctc agt gcc cac ccc
aag cgc cga gag gaa gat gta cgt ccc 1104 Trp Ala Leu Ser Ala His
Pro Lys Arg Arg Glu Glu Asp Val Arg Pro 355 360 365 atc ttc tgg gcc
tcc aga cca aag agt tac atc tac cgt acc cag gag 1152 Ile Phe Trp
Ala Ser Arg Pro Lys Ser Tyr Ile Tyr Arg Thr Gln Glu 370 375 380 tgg
gac gag ttc cct aac ggc cgc tgg ggc aat tcc tct tcc cct gcc 1200
Trp Asp Glu Phe Pro Asn Gly Arg Trp Gly Asn Ser Ser Ser Pro Ala 385
390 395 400 ttt ggg gag ctg aag gac tac tac ctc ttc tac ctg aag agc
aag tcc 1248 Phe Gly Glu Leu Lys Asp Tyr Tyr Leu Phe Tyr Leu Lys
Ser Lys Ser 405 410 415 ccc aag gag gag ctg ctg aag atg tgg ggg gag
gag ctg acc agt gaa 1296 Pro Lys Glu Glu Leu Leu Lys Met Trp Gly
Glu Glu Leu Thr Ser Glu 420 425 430 gca agt gtc ttt gaa gtc ttt gtt
ctt tac ctc tcg gga gaa cca aac 1344 Ala Ser Val Phe Glu Val Phe
Val Leu Tyr Leu Ser Gly Glu Pro Asn 435 440 445 cgg aat ggt cac aaa
gtg act tgc ctg ccc tgg aac gat gag ccc ctg 1392 Arg Asn Gly His
Lys Val Thr Cys Leu Pro Trp Asn Asp Glu Pro Leu 450 455 460 gcg gct
gag acc agc ctg ctg aag gag gag ctg ctg cgg gtg aac cgc 1440 Ala
Ala Glu Thr Ser Leu Leu Lys Glu Glu Leu Leu Arg Val Asn Arg 465 470
475 480 cag ggc atc ctc acc atc aac tca cag ccc aac atc aac ggg aag
ccg 1488 Gln Gly Ile Leu Thr Ile Asn Ser Gln Pro Asn Ile Asn Gly
Lys Pro 485 490 495 tcc tcc gac ccc atc gtg ggc tgg ggc ccc agc ggg
ggc tat gtc ttc 1536 Ser Ser Asp Pro Ile Val Gly Trp Gly Pro Ser
Gly Gly Tyr Val Phe 500 505 510 cag aag gcc tac tta gag ttt ttc act
tcc cgc gag aca gcg gaa gca 1584 Gln Lys Ala Tyr Leu Glu Phe Phe
Thr Ser Arg Glu Thr Ala Glu Ala 515 520 525 ctt ctg caa gtg ctg aag
aag tac gag ctc cgg gtt aat tac cac ctt 1632 Leu Leu Gln Val Leu
Lys Lys Tyr Glu Leu Arg Val Asn Tyr His Leu 530 535 540 gtc aat gtg
aag ggt gaa aac atc acc aat gcc cct gaa ctg cag ccg 1680 Val Asn
Val Lys Gly Glu Asn Ile Thr Asn Ala Pro Glu Leu Gln Pro 545 550 555
560 aat gct gtc act tgg ggc atc ttc cct ggg cga gag atc atc cag ccc
1728 Asn Ala Val Thr Trp Gly Ile Phe Pro Gly Arg Glu Ile Ile Gln
Pro 565 570 575 acc gta gtg gat ccc gtc agc ttc atg ttc tgg aag gac
gag gcc ttt 1776 Thr Val Val Asp Pro Val Ser Phe Met Phe Trp Lys
Asp Glu Ala Phe 580 585 590 gcc ctg tgg att gag cgg tgg gga aag ctg
tat gag gag gag tcc ccg 1824 Ala Leu Trp Ile Glu Arg Trp Gly Lys
Leu Tyr Glu Glu Glu Ser Pro 595 600 605 tcc cgc acc atc atc cag tac
atc cac gac aac tac ttc ctg gtc aac 1872 Ser Arg Thr Ile Ile Gln
Tyr Ile His Asp Asn Tyr Phe Leu Val Asn 610 615 620 ctg gtg gac aat
gac ttc cca ctg gac aac tgc ctc tgg cag gtg gtg 1920 Leu Val Asp
Asn Asp Phe Pro Leu Asp Asn Cys Leu Trp Gln Val Val 625 630 635 640
gaa gac aca ttg gag ctt ctc aac agg ccc acc cag aat gcg aga gaa
1968 Glu Asp Thr Leu Glu Leu Leu Asn Arg Pro Thr Gln Asn Ala Arg
Glu 645 650 655 acg gag gct cca tgaccctgcg tcctgacgcc ctgcgttgga
gccactcctg 2020 Thr Glu Ala Pro 660 tcccgccttc ctcctccaca
gtgctgcttc tcttgggaac tccactctcc ttcgtgtctc 2080 tcccaccccg
gcctccactc ccccacctga caatggcagc tagactggag tgaggcttcc 2140
aggctcttcc tggacctgag tcggccccac atgggaacct agtactctct gctctaaaaa
2200 aaaaaaaaaa aaaggaattc 2220 2 660 PRT Homo sapiens 2 Asn Ser
Gly Ala Met Val Asn Glu Ala Arg Gly Asn Ser Ser Leu Asn 1 5 10 15
Pro Cys Leu Glu Gly Ser Ala Ser Ser Gly Ser Glu Ser Ser Lys Asp 20
25 30 Ser Ser Arg Cys Ser Thr Pro Gly Leu Asp Pro Glu Arg His Glu
Arg 35 40 45 Leu Arg Glu Lys Met Arg Arg Arg Leu Glu Ser Gly Asp
Lys Trp Phe 50 55 60 Ser Leu Glu Phe Phe Pro Pro Arg Thr Ala Glu
Gly Ala Val Asn Leu 65 70 75 80 Ile Ser Arg Phe Asp Arg Met Ala Ala
Gly Gly Pro Leu Tyr Ile Asp 85 90 95 Val Thr Trp His Pro Ala Gly
Asp Pro Gly Ser Asp Lys Glu Thr Ser 100 105 110 Ser Met Met Ile Ala
Ser Thr Ala Val Asn Tyr Cys Gly Leu Glu Thr 115 120 125 Ile Leu His
Met Thr Cys Cys Arg Gln Arg Leu Glu Glu Ile Thr Gly 130 135 140 His
Leu His Lys Ala Lys Gln Leu Gly Leu Lys Asn Ile Met Ala Leu 145 150
155 160 Arg Gly Asp Pro Ile Gly Asp Gln Trp Glu Glu Glu Glu Gly Gly
Phe 165 170 175 Asn Tyr Ala Val Asp Leu Val Lys His Ile Arg Ser Glu
Phe Gly Asp 180 185 190 Tyr Phe Asp Ile Cys Val Ala Gly Tyr Pro Lys
Gly His Pro Glu Ala 195 200 205 Gly Ser Phe Glu Ala Asp Leu Lys His
Leu Lys Glu Lys Val Ser Ala 210 215 220 Gly Ala Asp Phe Ile Ile Thr
Gln Leu Phe Phe Glu Ala Asp Thr Phe 225 230 235 240 Phe Arg Phe Val
Lys Ala Cys Thr Asp Met Gly Ile Thr Cys Pro Ile 245 250 255 Val Pro
Gly Ile Phe Pro Ile Gln Gly Tyr His Ser Leu Arg Gln Leu 260 265 270
Val Lys Leu Ser Lys Leu Glu Val Pro Gln Glu Ile Lys Asp Val Ile 275
280 285 Glu Pro Ile Lys Asp Asn Asp Ala Ala Ile Arg Asn Tyr Gly Ile
Glu 290 295 300 Leu Ala Val Ser Leu Cys Gln Glu Leu Leu Ala Ser Gly
Leu Val Pro 305 310 315 320 Gly Leu His Phe Tyr Thr Leu Asn Arg Glu
Met Ala Thr Thr Glu Val 325 330 335 Leu Lys Arg Leu Gly Met Trp Thr
Glu Asp Pro Arg Arg Pro Leu Pro 340 345 350 Trp Ala Leu Ser Ala His
Pro Lys Arg Arg Glu Glu Asp Val Arg Pro 355 360 365 Ile Phe Trp Ala
Ser Arg Pro Lys Ser Tyr Ile Tyr Arg Thr Gln Glu 370 375 380 Trp Asp
Glu Phe Pro Asn Gly Arg Trp Gly Asn Ser Ser Ser Pro Ala 385 390 395
400 Phe Gly Glu Leu Lys Asp Tyr Tyr Leu Phe Tyr Leu Lys Ser Lys Ser
405 410 415 Pro Lys Glu Glu Leu Leu Lys Met Trp Gly Glu Glu Leu Thr
Ser Glu 420 425 430 Ala Ser Val Phe Glu Val Phe Val Leu Tyr Leu Ser
Gly Glu Pro Asn 435 440 445 Arg Asn Gly His Lys Val Thr Cys Leu Pro
Trp Asn Asp Glu Pro Leu 450 455 460 Ala Ala Glu Thr Ser Leu Leu Lys
Glu Glu Leu Leu Arg Val Asn Arg 465 470 475 480 Gln Gly Ile Leu Thr
Ile Asn Ser Gln Pro Asn Ile Asn Gly Lys Pro 485 490 495 Ser Ser Asp
Pro Ile Val Gly Trp Gly Pro Ser Gly Gly Tyr Val Phe 500 505 510 Gln
Lys Ala Tyr Leu Glu Phe Phe Thr Ser Arg Glu Thr Ala Glu Ala 515 520
525 Leu Leu Gln Val Leu Lys Lys Tyr Glu Leu Arg Val Asn Tyr His Leu
530 535 540 Val Asn Val Lys Gly Glu Asn Ile Thr Asn Ala Pro Glu Leu
Gln Pro 545 550 555 560 Asn Ala Val Thr Trp Gly Ile Phe Pro Gly Arg
Glu Ile Ile Gln Pro 565 570 575 Thr Val Val Asp Pro Val Ser Phe Met
Phe Trp Lys Asp Glu Ala Phe 580 585 590 Ala Leu Trp Ile Glu Arg Trp
Gly Lys Leu Tyr Glu Glu Glu Ser Pro 595 600 605 Ser Arg Thr Ile Ile
Gln Tyr Ile His Asp Asn Tyr Phe Leu Val Asn 610 615 620 Leu Val Asp
Asn Asp Phe Pro Leu Asp Asn Cys Leu Trp Gln Val Val 625 630 635 640
Glu Asp Thr Leu Glu Leu Leu Asn Arg Pro Thr Gln Asn Ala Arg Glu 645
650 655 Thr Glu Ala Pro 660 3 2219 DNA Homo sapiens CDS
(13)...(1983) 3 aattccggag cc atg gtg aac gaa gcc aga gga aac agc
agc ctc aac ccc 51 Met Val Asn Glu Ala Arg Gly Asn Ser Ser Leu Asn
Pro 1 5 10 tgc ttg gag ggc agt gcc agc agt ggc agt gag agc tcc aaa
gat agt 99 Cys Leu Glu Gly Ser Ala Ser Ser Gly Ser Glu Ser Ser Lys
Asp Ser 15 20 25 tcg aga tgt tcc acc ccg ggc ctg gac cct gag cgg
cat gag aga ctc 147 Ser Arg Cys Ser Thr Pro Gly Leu Asp Pro Glu Arg
His Glu Arg Leu 30 35 40 45 cgg gag aag atg agg cgg cga ttg gaa tct
ggt gac aag tgg ttc tcc 195 Arg Glu Lys Met Arg Arg Arg Leu Glu Ser
Gly Asp Lys Trp Phe Ser 50 55 60 ctg gaa ttc ttc cct cct cga act
gct gag gga gct gtc aat ctc atc 243 Leu Glu Phe Phe Pro Pro Arg Thr
Ala Glu Gly Ala Val Asn Leu Ile 65 70 75 tca agg ttt gac cgg atg
gca gca ggt ggc ccc ctc tac ata gac gtg 291 Ser Arg Phe Asp Arg Met
Ala Ala Gly Gly Pro Leu Tyr Ile Asp Val 80 85 90 acc tgg cac cca
gca ggt gac cct ggc tca gac aag gag acc tcc tcc 339 Thr Trp His Pro
Ala Gly Asp Pro Gly Ser Asp Lys Glu Thr Ser Ser 95 100 105 atg atg
atc gcc agc acc gcc gtg aac tac tgt ggc ctg gag acc atc 387 Met Met
Ile Ala Ser Thr Ala Val Asn Tyr Cys Gly Leu Glu Thr Ile 110 115 120
125 ctg cac atg acc tgc tgc cgt cag cgc ctg gag gag atc acg ggc cat
435 Leu His Met Thr Cys Cys Arg Gln Arg Leu Glu Glu Ile Thr Gly His
130 135 140 ctg cac aaa gct aag cag ctg ggc ctg aag aac atc atg gcg
ctg cgg 483 Leu His Lys Ala Lys Gln Leu Gly Leu Lys Asn Ile Met Ala
Leu Arg 145 150 155 gga gac cca ata ggt gac cag tgg gaa gag gag gag
gga ggc ttc aac 531 Gly Asp Pro Ile Gly Asp Gln Trp Glu Glu Glu Glu
Gly Gly Phe Asn 160 165 170 tac gca gtg gac ctg gtg aag cac atc cga
agt gag ttt ggt gac tac 579 Tyr Ala Val Asp Leu Val Lys His Ile Arg
Ser Glu Phe Gly Asp Tyr 175 180 185 ttt gac atc tgt gtg gca ggt tac
ccc aaa ggc cac ccc gaa gca ggg 627 Phe Asp Ile Cys Val Ala Gly Tyr
Pro Lys Gly His Pro Glu Ala Gly 190 195 200 205 agc ttt gag gct gac
ctg aag cac ttg aag gag aag gtg tct gcg gga 675 Ser Phe Glu Ala Asp
Leu Lys His Leu Lys Glu Lys Val Ser Ala Gly 210 215 220 gcc gat ttc
atc atc acg cag ctt ttc ttt gag gct gac aca ttc ttc 723 Ala Asp Phe
Ile Ile Thr Gln Leu Phe Phe Glu Ala Asp Thr Phe Phe 225 230 235 cgc
ttt gtg aag gca tgc acc gac atg ggc atc act tgc ccc atc gtc 771 Arg
Phe Val Lys Ala Cys Thr Asp Met Gly Ile Thr Cys Pro Ile Val 240 245
250 ccc ggg atc ttt ccc atc cag ggc tac cac tcc ctt cgg cag ctt gtg
819 Pro Gly Ile Phe Pro Ile Gln Gly Tyr His Ser Leu Arg Gln Leu Val
255 260 265 aag ctg tcc aag ctg gag gtg cca cag gag atc aag gac gtg
att gag 867 Lys Leu Ser Lys Leu Glu Val Pro Gln Glu Ile Lys Asp Val
Ile Glu 270 275 280 285 cca atc aaa gac aac gat gct gcc atc cgc aac
tat ggc atc gag ctg 915 Pro Ile Lys Asp Asn Asp Ala Ala Ile Arg Asn
Tyr Gly Ile Glu Leu 290 295 300 gcc gtg agc ctg tgc cag gag ctt ctg
gcc agt ggc ttg gtg cca ggc 963 Ala Val Ser Leu Cys Gln Glu Leu Leu
Ala Ser Gly Leu Val Pro Gly 305 310 315 ctc cac ttc tac acc ctc aac
cgc gag atg gct acc aca gag gtg ctg 1011 Leu His Phe Tyr Thr Leu
Asn Arg Glu Met Ala Thr Thr Glu Val Leu 320 325 330 aag cgc ctg ggg
atg tgg act gag gac ccc agg cgt ccc cta ccc tgg 1059 Lys Arg Leu
Gly Met Trp Thr Glu Asp Pro Arg Arg Pro Leu Pro Trp 335 340 345 gct
ctc agt gcc cac ccc aag cgc cga gag gaa gat gta cgt ccc atc 1107
Ala Leu Ser Ala His Pro Lys Arg Arg Glu Glu Asp Val Arg Pro Ile 350
355 360 365 ttc tgg gcc tcc aga cca aag agt tac atc tac cgt acc cag
gag tgg 1155 Phe Trp Ala Ser Arg Pro Lys Ser Tyr Ile Tyr Arg Thr
Gln Glu Trp 370 375 380 gac gag ttc cct aac ggc cgc tgg ggc aat tcc
tct tcc cct gcc ttt 1203 Asp Glu Phe Pro Asn Gly Arg Trp Gly Asn
Ser Ser Ser Pro Ala Phe 385 390 395 ggg gag ctg aag gac tac tac ctc
ttc tac ctg aag agc aag tcc ccc 1251 Gly Glu Leu Lys Asp Tyr Tyr
Leu Phe Tyr Leu Lys Ser Lys Ser Pro
400 405 410 aag gag gag ctg ctg aag atg tgg ggg gag gag ctg acc agt
gaa gca 1299 Lys Glu Glu Leu Leu Lys Met Trp Gly Glu Glu Leu Thr
Ser Glu Ala 415 420 425 agt gtc ttt gaa gtc ttt gtt ctt tac ctc tcg
gga gaa cca aac cgg 1347 Ser Val Phe Glu Val Phe Val Leu Tyr Leu
Ser Gly Glu Pro Asn Arg 430 435 440 445 aat ggt cac aaa gtg act tgc
ctg ccc tgg aac gat gag ccc ctg gcg 1395 Asn Gly His Lys Val Thr
Cys Leu Pro Trp Asn Asp Glu Pro Leu Ala 450 455 460 gct gag acc agc
ctg ctg aag gag gag ctg ctg cgg gtg aac cgc cag 1443 Ala Glu Thr
Ser Leu Leu Lys Glu Glu Leu Leu Arg Val Asn Arg Gln 465 470 475 ggc
atc ctc acc atc aac tca cag ccc aac atc aac ggg aag ccg tcc 1491
Gly Ile Leu Thr Ile Asn Ser Gln Pro Asn Ile Asn Gly Lys Pro Ser 480
485 490 tcc gac ccc atc gtg ggc tgg ggc ccc agc ggg ggc tat gtc ttc
cag 1539 Ser Asp Pro Ile Val Gly Trp Gly Pro Ser Gly Gly Tyr Val
Phe Gln 495 500 505 aag gcc tac tta gag ttt ttc act tcc cgc gag aca
gcg gaa gca ctt 1587 Lys Ala Tyr Leu Glu Phe Phe Thr Ser Arg Glu
Thr Ala Glu Ala Leu 510 515 520 525 ctg caa gtg ctg aag aag tac gag
ctc cgg gtt aat tac cac ctt gtc 1635 Leu Gln Val Leu Lys Lys Tyr
Glu Leu Arg Val Asn Tyr His Leu Val 530 535 540 aat gtg aag ggt gaa
aac atc acc aat gcc cct gaa ctg cag ccg aat 1683 Asn Val Lys Gly
Glu Asn Ile Thr Asn Ala Pro Glu Leu Gln Pro Asn 545 550 555 gct gtc
act tgg ggc atc ttc cct ggg cga gag atc atc cag ccc acc 1731 Ala
Val Thr Trp Gly Ile Phe Pro Gly Arg Glu Ile Ile Gln Pro Thr 560 565
570 gta gtg gat ccc gtc agc ttc atg ttc tgg aag gac gag gcc ttt gcc
1779 Val Val Asp Pro Val Ser Phe Met Phe Trp Lys Asp Glu Ala Phe
Ala 575 580 585 ctg tgg att gag cgg tgg gga aag ctg tat gag gag gag
tcc ccg tcc 1827 Leu Trp Ile Glu Arg Trp Gly Lys Leu Tyr Glu Glu
Glu Ser Pro Ser 590 595 600 605 cgc acc atc atc cag tac atc cac gac
aac tac ttc ctg gtc aac ctg 1875 Arg Thr Ile Ile Gln Tyr Ile His
Asp Asn Tyr Phe Leu Val Asn Leu 610 615 620 gtg gac aat gac ttc cca
ctg gac aac tgc ctc tgg cag gtg gtg gaa 1923 Val Asp Asn Asp Phe
Pro Leu Asp Asn Cys Leu Trp Gln Val Val Glu 625 630 635 gac aca ttg
gag ctt ctc aac agg ccc acc cag aat gcg aga gaa acg 1971 Asp Thr
Leu Glu Leu Leu Asn Arg Pro Thr Gln Asn Ala Arg Glu Thr 640 645 650
gag gct cca tga ccctgcgtcc tgacgccctg cgttggagcc actcctgtcc 2023
Glu Ala Pro * 655 cgccttcctc ctccacagtg ctgcttctct tgggaactcc
actctccttc gtgtctctcc 2083 caccccggcc tccactcccc cacctgacaa
tggcagctag actggagtga ggcttccagg 2143 ctcttcctgg acctgagtcg
gccccacatg ggaacctagt actctctgct ctaaaaaaaa 2203 aaaaaaaaaa ggaatt
2219 4 656 PRT Homo sapiens 4 Met Val Asn Glu Ala Arg Gly Asn Ser
Ser Leu Asn Pro Cys Leu Glu 1 5 10 15 Gly Ser Ala Ser Ser Gly Ser
Glu Ser Ser Lys Asp Ser Ser Arg Cys 20 25 30 Ser Thr Pro Gly Leu
Asp Pro Glu Arg His Glu Arg Leu Arg Glu Lys 35 40 45 Met Arg Arg
Arg Leu Glu Ser Gly Asp Lys Trp Phe Ser Leu Glu Phe 50 55 60 Phe
Pro Pro Arg Thr Ala Glu Gly Ala Val Asn Leu Ile Ser Arg Phe 65 70
75 80 Asp Arg Met Ala Ala Gly Gly Pro Leu Tyr Ile Asp Val Thr Trp
His 85 90 95 Pro Ala Gly Asp Pro Gly Ser Asp Lys Glu Thr Ser Ser
Met Met Ile 100 105 110 Ala Ser Thr Ala Val Asn Tyr Cys Gly Leu Glu
Thr Ile Leu His Met 115 120 125 Thr Cys Cys Arg Gln Arg Leu Glu Glu
Ile Thr Gly His Leu His Lys 130 135 140 Ala Lys Gln Leu Gly Leu Lys
Asn Ile Met Ala Leu Arg Gly Asp Pro 145 150 155 160 Ile Gly Asp Gln
Trp Glu Glu Glu Glu Gly Gly Phe Asn Tyr Ala Val 165 170 175 Asp Leu
Val Lys His Ile Arg Ser Glu Phe Gly Asp Tyr Phe Asp Ile 180 185 190
Cys Val Ala Gly Tyr Pro Lys Gly His Pro Glu Ala Gly Ser Phe Glu 195
200 205 Ala Asp Leu Lys His Leu Lys Glu Lys Val Ser Ala Gly Ala Asp
Phe 210 215 220 Ile Ile Thr Gln Leu Phe Phe Glu Ala Asp Thr Phe Phe
Arg Phe Val 225 230 235 240 Lys Ala Cys Thr Asp Met Gly Ile Thr Cys
Pro Ile Val Pro Gly Ile 245 250 255 Phe Pro Ile Gln Gly Tyr His Ser
Leu Arg Gln Leu Val Lys Leu Ser 260 265 270 Lys Leu Glu Val Pro Gln
Glu Ile Lys Asp Val Ile Glu Pro Ile Lys 275 280 285 Asp Asn Asp Ala
Ala Ile Arg Asn Tyr Gly Ile Glu Leu Ala Val Ser 290 295 300 Leu Cys
Gln Glu Leu Leu Ala Ser Gly Leu Val Pro Gly Leu His Phe 305 310 315
320 Tyr Thr Leu Asn Arg Glu Met Ala Thr Thr Glu Val Leu Lys Arg Leu
325 330 335 Gly Met Trp Thr Glu Asp Pro Arg Arg Pro Leu Pro Trp Ala
Leu Ser 340 345 350 Ala His Pro Lys Arg Arg Glu Glu Asp Val Arg Pro
Ile Phe Trp Ala 355 360 365 Ser Arg Pro Lys Ser Tyr Ile Tyr Arg Thr
Gln Glu Trp Asp Glu Phe 370 375 380 Pro Asn Gly Arg Trp Gly Asn Ser
Ser Ser Pro Ala Phe Gly Glu Leu 385 390 395 400 Lys Asp Tyr Tyr Leu
Phe Tyr Leu Lys Ser Lys Ser Pro Lys Glu Glu 405 410 415 Leu Leu Lys
Met Trp Gly Glu Glu Leu Thr Ser Glu Ala Ser Val Phe 420 425 430 Glu
Val Phe Val Leu Tyr Leu Ser Gly Glu Pro Asn Arg Asn Gly His 435 440
445 Lys Val Thr Cys Leu Pro Trp Asn Asp Glu Pro Leu Ala Ala Glu Thr
450 455 460 Ser Leu Leu Lys Glu Glu Leu Leu Arg Val Asn Arg Gln Gly
Ile Leu 465 470 475 480 Thr Ile Asn Ser Gln Pro Asn Ile Asn Gly Lys
Pro Ser Ser Asp Pro 485 490 495 Ile Val Gly Trp Gly Pro Ser Gly Gly
Tyr Val Phe Gln Lys Ala Tyr 500 505 510 Leu Glu Phe Phe Thr Ser Arg
Glu Thr Ala Glu Ala Leu Leu Gln Val 515 520 525 Leu Lys Lys Tyr Glu
Leu Arg Val Asn Tyr His Leu Val Asn Val Lys 530 535 540 Gly Glu Asn
Ile Thr Asn Ala Pro Glu Leu Gln Pro Asn Ala Val Thr 545 550 555 560
Trp Gly Ile Phe Pro Gly Arg Glu Ile Ile Gln Pro Thr Val Val Asp 565
570 575 Pro Val Ser Phe Met Phe Trp Lys Asp Glu Ala Phe Ala Leu Trp
Ile 580 585 590 Glu Arg Trp Gly Lys Leu Tyr Glu Glu Glu Ser Pro Ser
Arg Thr Ile 595 600 605 Ile Gln Tyr Ile His Asp Asn Tyr Phe Leu Val
Asn Leu Val Asp Asn 610 615 620 Asp Phe Pro Leu Asp Asn Cys Leu Trp
Gln Val Val Glu Asp Thr Leu 625 630 635 640 Glu Leu Leu Asn Arg Pro
Thr Gln Asn Ala Arg Glu Thr Glu Ala Pro 645 650 655 5 22 DNA
Artificial Sequence Synthetic primer 5 agcctcaacc cctgcttgga gg 22
6 22 DNA Artificial Sequence Synthetic primer 6 tgacagtttg
ctccccaggc ac 22 7 23 DNA Artificial Sequence Synthetic primer 7
tgaaggagaa ggtgtctgcg gga 23 8 21 DNA Artificial Sequence Synthetic
primer 8 aggacggtgc ggtgagagtg g 21 9 23 DNA Artificial Sequence
Synthetic primer 9 cactgtggtt ggcatggatg atg 23 10 21 DNA
Artificial Sequence Synthetic primer 10 ggctgctctt ggaccctcct c 21
11 21 DNA Artificial Sequence Synthetic primer 11 tgcttccggc
tccctctagc c 21 12 22 DNA Artificial Sequence Synthetic primer 12
cctcccgctc ccaagaacaa ag 22 13 23 DNA Artificial Sequence Synthetic
primer 13 tgaaggagaa ggtgtctgcg gga 23 14 20 DNA Artificial
Sequence Synthetic primer 14 aggacggtgc ggtgagagtg 20 15 21 DNA
Artificial Sequence Synthetic Primer 15 gggaggagct gaccagtgca g 21
16 19 DNA Artificial Sequence Synthetic Primer 16 ggggtcaggc
caggggcag 19 17 23 DNA Artificial Sequence Synthetic Primer 17
ggttctcccg agaggtaaag atc 23 18 21 DNA Artificial Sequence
Synthetic Primer 18 ctggggatgt ggtggcactg c 21
* * * * *