U.S. patent application number 10/322780 was filed with the patent office on 2003-08-14 for human abh.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Sutton, Granger G. III, Wei, Ying-Fei.
Application Number | 20030153738 10/322780 |
Document ID | / |
Family ID | 23842020 |
Filed Date | 2003-08-14 |
United States Patent
Application |
20030153738 |
Kind Code |
A1 |
Wei, Ying-Fei ; et
al. |
August 14, 2003 |
Human ABH
Abstract
A human hABH polypeptide and DNA (RNA) encoding such polypeptide
and a procedure for producing such polypeptide by recombinant
techniques is disclosed. Also disclosed are methods for utilizing
such polypeptide for the treatment of mutations and the treatment
of diseases which result from damaged DNA, for example, cancer.
Antagonists against such polypeptides and their use as a
therapeutic to augment chemotherapy of cancer cells are also
disclosed.
Inventors: |
Wei, Ying-Fei; (Berkeley,
CA) ; Sutton, Granger G. III; (Columbia, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
9410 KEY WEST AVENUE
ROCKVILLE
MD
20850
|
Assignee: |
Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville
MD
20850
|
Family ID: |
23842020 |
Appl. No.: |
10/322780 |
Filed: |
December 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10322780 |
Dec 19, 2002 |
|
|
|
09296623 |
Apr 23, 1999 |
|
|
|
6573360 |
|
|
|
|
09296623 |
Apr 23, 1999 |
|
|
|
09023327 |
Feb 13, 1998 |
|
|
|
5929225 |
|
|
|
|
09023327 |
Feb 13, 1998 |
|
|
|
08783266 |
Jan 15, 1997 |
|
|
|
5747312 |
|
|
|
|
08783266 |
Jan 15, 1997 |
|
|
|
08463975 |
Jun 5, 1995 |
|
|
|
5618717 |
|
|
|
|
08463975 |
Jun 5, 1995 |
|
|
|
PCT/US94/12058 |
Oct 21, 1994 |
|
|
|
Current U.S.
Class: |
536/23.2 ;
435/199; 435/320.1; 435/325; 435/69.1; 435/7.23 |
Current CPC
Class: |
Y02A 50/473 20180101;
A61K 38/00 20130101; Y02A 50/30 20180101; A61K 48/00 20130101; C07K
14/47 20130101; C07K 14/4702 20130101; C12N 9/22 20130101 |
Class at
Publication: |
536/23.2 ;
435/7.23; 435/69.1; 435/199; 435/320.1; 435/325 |
International
Class: |
G01N 033/574; C07H
021/04; C12N 009/22; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding the polypeptide
as set forth in SEQ ID NO:2; (b) a polynucleotide capable of
hybridizing to and which is at least 70% identical to the
polynucleotide of (a); and (c) a polynucleotide fragment of the
polynucleotide of (a) or (b).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 2 which encodes the polypeptide as
set forth in SEQ ID NO:2.
4. The polynucleotide of claim 2 comprising the nucleotide sequence
of SEQ ID NO:1 from nucleotide 1 to 1953.
5. The polynucleotide of claim 2 comprising the nucleotide sequence
of SEQ ID NO:1 from nucleotide 200 to 1953.
6. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide which encodes a mature
polypeptide encoded by the DNA contained in ATCC Deposit No. 75855;
(b) a polynucleotide which encodes a polypeptide expressed by the
DNA contained in ATCC Deposit No. 75855; (c) a polynucleotide
capable of hybridizing to and which is at least 70% identical to
the polynucleotide of (a) or (b); and (d) a polynucleotide fragment
of the polynucleotide of (a), (b) or (c).
7. A vector containing the DNA of claim 2.
8. A host cell genetically engineered with the vector of claim
7.
9. A process for producing a polypeptide comprising expressing from
the host cell of claim 8 the polypeptide encoded by said DNA.
10. A process for producing cells capable of expressing a
polypeptide comprising transforming or transfecting the cells with
the vector of claim 7.
11. A polypeptide selected from the group consisting of: (a) a
polypeptide having the deduced amino acid sequence of SEQ ID NO:2
and fragments, analogs and derivatives thereof; (b) a polypeptide
comprising amino acid 1 to amino acid 262 of SEQ ID NO:2; and (c) a
polypeptide encoded by the cDNA of ATCC Deposit No. 75855 and
fragments, analogs and derivatives of said polypeptide.
12. A compound effective as an agonist for the polypeptide of claim
11.
13. A compound effective as an antagonist against the polypeptide
of claim 11.
14. A method for the treatment of a patient having need of hABH
comprising: administering to the patient a therapeutically
effective amount of the polypeptide of claim 11.
15. The method of claim 14 wherein said therapeutically effective
amount of the polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
16. A method for the treatment of a patient having need of hABH
comprising administering to the patient a therapeutically effective
amount of the compound of claim 12.
17. A method for the treatment of a patient having need to inhibit
hABH comprising: administering to the patient a therapeutically
effective amount of the antagonist of claim 13.
18. A process for diagnosing a disease or a susceptibility to a
disease related to expression of the polypeptide of claim 11
comprising determining a mutation in the nucleic acid sequence
encoding said polypeptide.
19. A diagnostic process comprising analyzing for the presence of
the polypeptide of claim 11 in a sample derived from a host.
20. A method for identifying compounds which bind to and activate
or inhibit a receptor for the polypeptide of claim 11 comprising:
(a) contacting a cell expressing on the surface thereof a receptor
for the polypeptide, said receptor being associated with a second
component capable of providing a detectable signal in response to
the binding of a compound to said receptor, with a compound to be
screened under conditions to permit binding to the receptor; and
(b) determining whether the compound binds to and activates or
inhibits the receptor by detecting the presence or absence of a
signal generated from the interaction of the compound with the
receptor.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of and claims priority
under 35 U.S.C. .sctn.120 to U.S. application Ser. No. 09/296,623,
filed Apr. 23, 1999, which is a divisional of and claims priority
under 35 U.S.C. .sctn.120 to U.S. application Ser. No. 09/023,327,
filed Feb. 13, 1998 (now U.S. Pat. No. 5,929,225, issued on Jul.
27, 1999), which is a divisional of and claims priority under 35
U.S.C. .sctn.120 to U.S. application Ser. No. 08/783,266, filed
Jan. 15, 1997 (now U.S. Pat. No. 5,747,312, issued on May 5, 1998),
which is a divisional of and claims priority under 35 U.S.C.
.sctn.120 to U.S. application Ser. No. 08/463,975, filed Jun. 5,
1995 (now U.S. Pat. No. 5,618,717, issued on Apr. 8, 1997), which
is a continuation-in-part of and claims priority under 35 U.S.C.
.sctn.120 to International Application No. PCT/US94/12058, filed
Oct. 21, 1994. Each of the above referenced applications is hereby
incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is human homolog of the
bacterial AlkB gene, sometimes hereinafter referred as "hABH". The
invention also relates to inhibiting the action of such
polypeptides.
BACKGROUND OF THE INVENTION
[0003] Alkylating agents induce DNA damage which may cause either
killing of cells or induction of mutation and cancer. Most of such
damage is subjected to common cellular DNA repair mechanisms, such
as excision repair and postreplication repair (Hanawalt, P. C., et
al, Annu. Rev. Biochem., 48:783-836 (1979) and Witkem, Bacteriol.
Rev., 40:869-907 (1976)). A repair mechanism is that performed by
the human DNA mismatch repair protein.
[0004] Certain strain of E. coli mutants have been found to be
specifically sensitive to alkylating agents. Two types of such
mutants have been isolated, alkA and tagA (Yamamato, Y., et al., J.
Bacteriology, 135:144-152 (1978) and Karran, P., et al., J. Mol.
Biol., 40:101-127 (1980)). These genes control the formation of
enzymes that catalyze the liberation of certain alkylated bases
from damaged DNA (Karran, P., Nature (London), 296:770-773 (1982)).
In addition, ada and adc mutants have been isolated which are
defective in controlling mechanisms to induce the adaptive response
to alkylating agents (Jeggo, P., J. Bacteriol., 139:783-791
(1982)).
[0005] The tagA gene has been mapped to an E. coli chromosome and
controls a constitutive enzyme 3-methyladenine-DNA glycosylase I
that releases 3-methyladenine from alkylated DNA (Karran, P. et
al., Nature (London), 296:770-773 (1982)). The alkA gene has also
been mapped and it too controls an inducible enzyme,
3-methyladenine-DNA glycosylase II, which catalyzes the liberation
of 3-methyladenine, 3-methylguanine, and 7-methylguanine from the
DNA (Evensen, G. and Seeberg, E., Nature (London), 296:773-775
(1982).
[0006] Another gene of E. coli, AlkB, has also been found to
control sensitivity to methyl methane sulfonate (MMS). The AlkB
gene was located in a region of the chromosome near ada and adc,
but is not considered an allele to these genes (Sedgwick, B., J.
Bacteriol., 150:984-988 (1982)).
[0007] Thus, AlkB resides in a new gene that is near the nalA gene.
The AlkB phenotype is different from that of ada, since the AlkB
mutant exhibited a normal adaptive response to
n-methyl-n'-nitro-n-nitrosoguanid- ine (Kataoka, H., et al., J.
Bact., 153:1301-1307 (1983)). The AlkB gene of E. coli has been
found to be responsible for the repair of alkylated DNA (Kondo, H.,
et al., J. Biol. Chem., 15:1-6, (1986)).
BRIEF SUMMARY OF THE INVENTION
[0008] Due to the amino acid sequence between AlkB from E. coli,
the present polynucleotide and deduced polypeptide have been
putatively identified as a human homolog of the E. coli AlkB
protein.
[0009] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide which is hABH, as well
as fragments, analogs and derivatives thereof. The polypeptide of
the present invention is of human origin.
[0010] In accordance with another aspect of the present invention,
there are provided polynucleotides (DNA or RNA) which encode such
polypeptides.
[0011] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques.
[0012] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
therapeutic purposes, for example, for repairing alkylated DNA and
accordingly preventing or treating cell death and cancer.
[0013] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0014] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be used to inhibit the action of such polypeptides, for
example, to prevent this polypeptide from repairing tumor cell DNA
during chemotherapy with alkylating agents.
[0015] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0017] FIGS. 1A-1G show the cDNA sequence (SEQ ID NO:1) and
corresponding deduced amino acid sequence (SEQ ID NO:2) for hABH.
The amino acid sequence shown comprises the putative mature
polypeptide. The standard one letter abbreviations for amino acids
are used.
[0018] FIG. 2 is a schematic illustration of the survival rate of
cells in the presence of increasing concentrations of MMS (methyl
methane sulfonate). Cells which are wild type for AlkB show no
decrease in survival rate as there is an increase in MMS. Mutations
(MT) show a dramatic decrease in the survival rate as the
concentration of MMS increases. Cells which have the hABH present
therein show an increased survival rate as compared to mutant
cells.
[0019] FIG. 3 illustrates amino acid homology between hABH (top)
and AlkB (bottom) from E. coli.
DETAILED DESCRIPTION
[0020] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIGS. 1A-1H (SEQ ID NO:2) or for the mature polypeptide encoded
by the cDNA of the clone deposited with the American Type Culture
Collection (ATCC), 10801 University Boulevard, Manassas, Va.
20110-2209 (present address), as ATCC Deposit No. 75855 on Aug. 9,
1994.
[0021] A polynucleotide encoding a polypeptide of the present
invention may be obtained from a human prostate, testis, placenta
and heart. The polynucleotide of this invention was discovered in a
cDNA library derived from a human synovial sarcoma. It is
structurally related to E. coli AlkB. It contains an open reading
frame encoding a protein of 307 amino acid residues. The protein
exhibits the highest degree of homology to E. coli AlkB with 23%
identity and 52% similarity over a 283 amino acid stretch.
[0022] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIGS. 1A-1H (SEQ ID NO:1) or that of the deposited clone
or may be a different coding sequence which coding sequence, as a
result of the redundancy or degeneracy of the genetic code, encodes
the same mature polypeptide as the DNA of FIGS. 1A-1H (SEQ ID NO:1)
or the deposited cDNA.
[0023] The polynucleotide which encodes for the mature polypeptide
of FIGS. 1A-1H (SEQ ID NO:2) or for the mature polypeptide encoded
by the deposited cDNA may include: only the coding sequence for the
mature polypeptide; the coding sequence for the mature polypeptide
and additional coding sequence such as a leader or secretory
sequence or a proprotein sequence; the coding sequence for the
mature polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence 5'
and/or 3' of the coding sequence for the mature polypeptide.
[0024] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0025] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIGS. 1A-1H (SEQ ID NO:2) or the polypeptide
encoded by the cDNA of the deposited clone. The variant of the
polynucleotide may be a naturally occurring allelic variant of the
polynucleotide or a non-naturally occurring variant of the
polynucleotide.
[0026] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A-1H (SEQ
ID NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 1A-1H or the polypeptide encoded by the cDNA
of the deposited clone. Such nucleotide variants include deletion
variants, substitution variants and addition or insertion
variants.
[0027] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A-1H (SEQ ID NO:1) or of the
coding sequence of the deposited clone. As known in the art, an
allelic variant is an alternate form of a polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0028] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains. Thus, for
example, the polynucleotide of the present invention may encode for
a mature protein, or for a protein having a prosequence or for a
protein having both a prosequence and a presequence (leader
sequence).
[0029] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0030] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0031] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promoter regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0032] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIGS. 1A-1H (SEQ ID
NO:1) or the deposited cDNA(s).
[0033] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0034] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0035] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0036] The present invention further relates to an hABH polypeptide
which has the deduced amino acid sequence of FIGS. 1A-1H or which
has the amino acid sequence encoded by the deposited cDNA, as well
as fragments, analogs and derivatives of such polypeptide.
[0037] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIGS. 1A-1H or that encoded by the
deposited cDNA, means a polypeptide which retains essentially the
same biological function or activity as such polypeptide. Thus, an
analog includes a proprotein which can be activated by cleavage of
the proprotein portion to produce an active mature polypeptide.
[0038] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0039] The fragment, derivative or analog of the polypeptide of
FIGS. 1A-1H or that encoded by the deposited cDNA may be (i) one in
which one or more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide, such as a leader or secretory sequence or a
sequence which is employed for purification of the mature
polypeptide or a proprotein sequence. Such fragments, derivatives
and analogs are deemed to be within the scope of those skilled in
the art from the teachings herein.
[0040] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0041] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0042] The polypeptides of the present invention include the
polypeptide of FIGS. 1A-1H SEQ ID NO:2 (in particular the mature
polypeptide) as well as polypeptides which have at least 70%
similarity (preferably at least 70% identity) to the polypeptide of
FIGS. 1A-1H SEQ ID NO:2 and more preferably at least 90% similarity
(more preferably at least 90% identity) to the polypeptide of FIGS.
1A-1H SEQ ID NO:2 and still more preferably at least 95% similarity
(still more preferably at least 95% identity) to the polypeptide of
FIGS. 1A-1H SEQ ID NO:2 and also include portions of such
polypeptides with such portion of the polypeptide generally
containing at least 30 amino acids and more preferably at least 50
amino acids.
[0043] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0044] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0045] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0046] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
hABH genes. The culture conditions, such as temperature, pH and the
like, are those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan.
[0047] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0048] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0049] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0050] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0051] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0052] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila and Sf9; animal cells such as CHO, COS or Bowes
melanoma; plant cells, etc. The selection of an appropriate host is
deemed to be within the scope of those skilled in the art from the
teachings herein.
[0053] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0054] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lac, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0055] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0056] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0057] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0058] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0059] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0060] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0061] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0062] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0063] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0064] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0065] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0066] The hABH polypeptides can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
mature protein. Finally, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0067] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0068] The hABH polypeptide of the present invention may be
employed to protect against cellular DNA damage as a result of
exposure to chemical mutagens. More particularly, the hABH may be
used to repair cellular DNA, such as by excision repair,
substitution, removing alkylated portion of bases or
postreplication repair.
[0069] In this manner, the hABH polypeptide of the present
invention may be used to treat diseases characterized by abnormal
cellular differentiation, for example, cancer. Further, mutated DNA
leads to a host of other known and unknown disorders which could be
treated with the hABH polypeptide of the present invention.
[0070] The present invention also provides a diagnostic assay for
detecting mutated hABH genes, which is indicative of a
susceptibility to mutation of DNA by various agents, such as
chemical mutation. One example of such an assay is the RT-PCR
method. For RT-PCR (Reverse Transcriptase Polymerase Chain
Reaction), the mRNA encoding hABH is isolated from the total
cellular RNA removed from a cell sample. The coding region of the
RT-PCR products are then sequenced and compared to the hABH gene to
detect mutations. Alternatively, oligonucleotide probes may be
prepared which are highly specific for the mRNA to be detected.
Such oligonucleotide probes have between 10 and 40 base pairs and
preferably between 10 and 30 base pairs. The oligonucleotide probes
may be labeled, for example by radioactivity. The probe is
hybridized, for example in situ hybridization, to a cDNA library
prepared from total mRNA in a cell sample derived from a host. If
there is hybridization, the probe may be removed and the gene to
which it hybridizes is sequenced to detect mutations.
[0071] The present invention also relates to an assay which
demonstrates the biological activity of the hABH gene to protect
against the effects of exposure to chemical mutagens and alkylating
agents. An example of this type of assay comprises exposing three
different groups of E. coli cells to varying concentrations of an
alkylating agent, for example MMS. One cell type is an HK81 strain
of E. coli which is wild-type for the alkB gene. Another cell type
is an KH82 strain of E. coli which is a mutant strain for the alkB
gene. The third group is the HK82 strain which has been transfected
with a vector containing the hABH gene. A survival percentage of
these groups of E. coli cells is then computed and the results are
shown in FIG. 2. It is clear from FIG. 2 that the mutant strain
(mt) had the lowest survival rate, while the wild-type (wt) strain
had the highest survival rate. The results further show that the
hABH gene was able to increase the survival rate of the mutant
strain and, therefore, effectively protect against alkylating
agents by repairing DNA.
[0072] Alternatively, mammalian cells may be employed wherein cells
which are wild-type and mutant for the alkB gene may be used. The
mutant strain may then be transfected with the hABH gene and
percentage of surviving cells calculated. In another embodiment,
knock-out mice may be employed wherein the alkB gene has been
removed through genetic engineering techniques known to those of
skill in the art.
[0073] The above-described assay could be used to identify agonist
or antagonist compounds. An example of such an assay comprises
preparing groups of cells, E. coli or mammalian, wherein one group
is wild-type and the other group is mutant for the alkB gene. The
cells are then exposed to the varying amounts of MMS as above.
However, in this assay compounds are added to the reaction and the
ability of the compound to increase or decrease the survival rate
of the mutant strain could then be determined using an assay
performed in the absence of any compounds as a control.
[0074] Example of potential antagonists to hABH include antibodies,
or in some cases an oligonucleotide, which binds to the hABH to
eliminate its function. Potential antagonists also include proteins
closely related to hABH such that they recognize and bind to the
damaged bases of the DNA but do not repair them.
[0075] Another potential antagonist includes an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix--see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of hABH. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into the hABH
(antisense--Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of hABH.
[0076] Potential antagonists also include small molecules which
bind to and occupy the effective site of the hABH polypeptide such
that it is inaccessible to damaged DNA. Examples of small molecules
include but are not limited to small peptides or peptide like
molecules.
[0077] The antagonists may be employed to specifically target tumor
cells and prevent hABH from repairing the DNA of the tumor cell so
that the result of chemotherapy with alkylating agents is not
offset. However, it is desirable for normal cells to have the
alkylated bases repaired by hABH, therefore, the above antagonists
are only effective if specifically to tumor cells, or other cells
which are the object of chemotherapy. The antagonists may be
employed in a composition with a pharmaceutically acceptable
carrier, e.g., as hereinafter described.
[0078] The polypeptides and agonists and antagonists may be
employed in combination with a suitable pharmaceutical carrier.
Such compositions comprise a therapeutically effective amount of
the polypeptide, and a pharmaceutically acceptable carrier or
excipient. Such a carrier includes but is not limited to saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The formulation should suit the mode of
administration.
[0079] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides of the present
invention may be employed in conjunction with other therapeutic
compounds.
[0080] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. Pharmaceutical compositions are administered in
an amount which is effective for treating and/or prophylaxis of the
specific indication. In general, the pharmaceutical compositions
will be administered in an amount of at least about 10 .mu.g/kg
body weight and in most cases they will be administered in an
amount not in excess of about 8 mg/Kg body weight per day. In most
cases, the dosage is from about 10 .mu.g/kg to about 1 mg/kg body
weight daily, taking into account the routes of administration,
symptoms, etc.
[0081] The hABH polypeptides and agonists or antagonists may also
be employed in accordance with the present invention by expression
of such polypeptides in vivo, which is often referred to as "gene
therapy."
[0082] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0083] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0084] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0085] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0086] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or heterologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0087] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0088] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0089] This invention is also related to the use of the gene of the
present invention as a diagnostic. Detection of a mutated form of
the gene will allow a diagnosis of a disease or a susceptibility to
a disease which results from underexpression of hABH.
[0090] Individuals carrying mutations in the gene of the present
invention may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, including but not limited to blood, urine, saliva,
tissue biopsy and autopsy material. The genomic DNA may be used
directly for detection or may be amplified enzymatically by using
PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example,
PCR primers complementary to the nucleic acid encoding hABH can be
used to identify and analyze mutations. For example, deletions and
insertions can be detected by a change in size of the amplified
product in comparison to the normal genotype. Point mutations can
be identified by hybridizing amplified DNA to radiolabeled RNA or
alternatively, radiolabeled antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by
RNase A digestion or by differences in melting temperatures.
[0091] Sequence differences between the reference gene and genes
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is
greatly enhanced when combined with PCR. For example, a sequencing
primer is used with double-stranded PCR product or a
single-stranded template molecule generated by a modified PCR. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic sequencing procedures with
fluorescent-tags.
[0092] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0093] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0094] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0095] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0096] The present invention also relates to a diagnostic assay for
detecting altered levels of the polypeptide of the present
invention in various tissues. Assays used to detect levels of the
polypeptide of the present invention in a sample derived from a
host are well-known to those of skill in the art and include
radioimmunoassays, competitive-binding assays, Western Blot
analysis and preferably an ELISA assay. An ELISA assay initially
comprises preparing an antibody specific to the hABH antigen,
preferably a monoclonal antibody. In addition a reporter antibody
is prepared against the monoclonal antibody. To the reporter
antibody is attached a detectable reagent such as radioactivity,
fluorescence or in this example a horseradish peroxidase enzyme. A
sample is now removed from a host and incubated on a solid support,
e.g. a polystyrene dish, that binds the proteins in the sample. Any
free protein binding sites on the dish are then covered by
incubating with a non-specific protein such as bovine serum
albumin. Next, the monoclonal antibody is incubated in the dish
during which time the monoclonal antibodies attached to any of the
polypeptide of the present invention attached to the polystyrene
dish. All unbound monoclonal antibody is washed out with buffer.
The reporter antibody linked to horseradish peroxidase is now
placed in the dish resulting in binding of the reporter antibody to
any monoclonal antibody bound to the polypeptide of the present
invention. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of the polypeptide of the present invention present in a
given volume of patient sample when compared against a standard
curve.
[0097] A competition assay may be employed wherein antibodies
specific to the polypeptide of the present invention are attached
to a solid support and labeled hABH and a sample derived from the
host are passed over the solid support and the amount of label
detected attached to the solid support can be correlated to a
quantity of the polypeptide of the present invention in the
sample.
[0098] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0099] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA,
thus complicating the amplification process. These primers are then
used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the primer will yield an amplified
fragment.
[0100] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0101] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA having at least 50 or 60 bases. For a review of this
technique, see Verma et al., Human Chromosomes: a Manual of Basic
Techniques, Pergamon Press, New York (1988).
[0102] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0103] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0104] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0105] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0106] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0107] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0108] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0109] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0110] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0111] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0112] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0113] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0114] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0115] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units to
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0116] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
[0117] Bacterial Expression and Functional Complementation of
hABH
[0118] The DNA sequence encoding for hABH, ATCC #75855, is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences of the hABH protein. The 5'
oligonucleotide primer has the sequence 5'
GCGCGTCGACATGTGTCTTCTGTCAGTG (SEQ ID NO:3) contains a SalI
restriction enzyme site (underlined) followed by 18 nucleotides of
hABH coding sequence starting from the presumed N-terminal amino
acid of the protein codon. The 3' primer has the sequence 5'
GCGCAAGCTTTCATCCAGATGGCA- GAAACC 3' (SEQ ID NO:4) contains
complementary sequences to a HindIII site (underlined) and is
followed by 20 nucleotides of hABH. The restriction enzyme sites
correspond to the restriction enzyme sites on the bacterial
expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth,
Calif., 91311). pQE-9 encodes antibiotic resistance (Amp.sup.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 was then digested with SalI and
HindIII. The amplified sequences were ligated into pQE-9 and were
inserted in frame with the sequence encoding for the histidine tag
and the RBS. The ligation mixture was then used to transform E.
coli mutant strain HK82 by the procedure described in Sambrook, J.
et al., Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989). Transformants are identified by their
ability to grow on LB plates and ampicillin resistant colonies were
selected. Plasmid DNA was isolated and confirmed by restriction
analysis.
[0119] The AlkB mutant strain of HK82 was then examined for its
ability to complement an AlkB mutant. Wild-type E. coli strain HK81
harboring the pQE-9 vector and mutant E. coli strain HK82
containing the vector pQE-9hABH were grown to
[0120] 2.times.10.sup.8 cells per milliliter in LB ampicillin
medium at 37 degrees C. The cells were then diluted with M9 salts,
and plated on LB ampicillin plates containing 0, 0.001, 0.02, and
0.03% of MMS. The plates were incubated at 37 degree C. overnight.
The results are depicted in FIG. 2.
EXAMPLE 2
[0121] Expression of Recombinant hABH in COS Cells
[0122] The expression of plasmid, hABH HA is derived from a vector
pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication,
2) ampicillin resistance gene, 3) E. coli replication origin, 4)
CMV promoter followed by a polylinker region, a SV40 intron and
polyadenylation site. A DNA fragment encoding the entire hABH
precursor and a HA tag fused in frame to its 3' end was cloned into
the polylinker region of the vector, therefore, the recombinant
protein expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza hemagglutinin
protein as previously described (I. Wilson, H. Niman, R. Heighten,
A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The
infusion of HA tag to our target protein allows easy detection of
the recombinant protein with an antibody that recognizes the HA
epitope.
[0123] The plasmid construction strategy is described as
follows:
[0124] The DNA sequence encoding for hABH, ATCC #75855, was
constructed by PCR on the original EST cloned using two primers:
the 5' primer 5' GCGCAAGCTTATGTGTCTTCTGTCAGTG 3' (SEQ ID NO:5)
contains a HindIII site (underlined) followed by 18 nucleotides of
hABH coding sequence starting from the initiation codon; the 3'
primer sequence 5' GCGCGAATTCTCAAGCGTAGTCT
GGGACGTCGTATGGGTATCCAGATGGCAGAAACC 3' (SEQ ID NO:6) contains an
EcoRI site, complementary sequences to a translation stop codon, HA
tag and the last 17 nucleotides of the hABH coding sequence (not
including the stop codon). Therefore, the PCR product contains a
HindIII site, hABH coding sequence followed by HA tag fused in
frame, a translation termination stop codon next to the HA tag, and
an EcoRI site. The PCR amplified DNA fragment and the vector,
pcDNAI/Amp, were digested with HindIII and EcoRI restriction enzyme
and ligated. The ligation mixture was transformed into E. coli
strain SURE (available from Stratagene Cloning Systems, 11099 North
Torrey Pines Road, La Jolla, Calif. 92037) the transformed culture
was plated on ampicillin media plates and resistant colonies were
selected. Plasmid DNA was isolated from transformants and examined
by restriction analysis for the presence of the correct fragment.
For expression of the recombinant hABH, COS cells were transfected
with the expression vector by DEAE-DEXTRAN method. (J. Sambrook, E.
Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989)). The expression of the hABH HA
protein was detected by radiolabeling and immunoprecipitation
method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, (1988)). Cells were labeled for 8
hours with .sup.35S-cysteine two days post transfection. Culture
media were then collected and cells were lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both cell
lysate and culture media were precipitated with a HA specific
monoclonal antibody. Proteins precipitated were analyzed on 15%
SDS-PAGE gels.
EXAMPLE 3
[0125] Expression Pattern of hABH in Human Tissue
[0126] Northern blot analysis was carried out to examine the levels
of expression of hABH in human tissues. Total cellular RNA samples
were isolated with RNAzol.TM. B system (Biotecx Laboratories, Inc.
6023 South Loop East, Houston, Tex. 77033). About 10 .mu.g of total
RNA isolated from each human tissue specified was separated on 1%
agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch,
and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)).
The labeling reaction was done according to the Stratagene Prime-It
kit with 50 ng DNA fragment. The labeled DNA was purified with a
Select-G-50 column. (5 Prime-3 Prime, Inc. 5603 Arapahoe Road,
Boulder, Colo. 80303). The filter was then hybridized with
radioactive labeled full length hABH gene at 1,000,000 cpm/ml in
0.5 M NaPO.sub.4, pH 7.4 and 7% SDS overnight at 65.degree. C.
After wash twice at room temperature and twice at 60.degree. C.
with 0.5.times.SSC, 0.1% SDS, the filter was then exposed at
-70.degree. C. overnight with an intensifying screen. The message
RNA for hABH is abundant in thymus, testis, gall bladder, liver,
prostate, heart and placenta.
EXAMPLE 4
[0127] Expression via Gene Therapy
[0128] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0129] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0130] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0131] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0132] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove producer cells and this media is then used to infect
fibroblast cells. Media is removed from a sub-confluent plate of
fibroblasts and quickly replaced with the media from the producer
cells. This media is removed and replaced with fresh media. If the
titer of virus is high, then virtually all fibroblasts will be
infected and no selection is required. If the titer is very low,
then it is necessary to use a retroviral vector that has a
selectable marker, such as neo or his.
[0133] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0134] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
* * * * *