U.S. patent application number 10/200002 was filed with the patent office on 2003-08-14 for methods and compositions for rnai mediated inhibition of gene expression in mammals.
Invention is credited to Kay, Mark A., McCaffrey, Anton.
Application Number | 20030153519 10/200002 |
Document ID | / |
Family ID | 26975733 |
Filed Date | 2003-08-14 |
United States Patent
Application |
20030153519 |
Kind Code |
A1 |
Kay, Mark A. ; et
al. |
August 14, 2003 |
Methods and compositions for RNAi mediated inhibition of gene
expression in mammals
Abstract
Methods and compositions are provided for modulating, e.g.,
reducing, coding sequence expression in mammals. In the subject
methods, an effective amount of an RNAi agent, e.g., an interfering
ribonucleic acid (such as an siRNA or shRNA) or a transcription
template thereof, e.g., a DNA encoding an shRNA, is administered to
a non-embryonic mammal, e.g., via a hydrodynamic administration
protocol. Also provided are RNAi agent pharmaceutical preparations
for use in the subject methods. The subject methods and
compositions find use in a variety of different applications,
including academic and therapeutic applications.
Inventors: |
Kay, Mark A.; (Los Altos,
CA) ; McCaffrey, Anton; (Pacifica, CA) |
Correspondence
Address: |
BOZICEVIC, FIELD & FRANCIS LLP
200 MIDDLEFIELD RD
SUITE 200
MENLO PARK
CA
94025
US
|
Family ID: |
26975733 |
Appl. No.: |
10/200002 |
Filed: |
July 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60307411 |
Jul 23, 2001 |
|
|
|
60360664 |
Feb 27, 2002 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
A61P 31/12 20180101;
A01K 67/0275 20130101; A61K 31/713 20130101; A61K 31/7105 20130101;
A61P 31/14 20180101; A61P 1/16 20180101; A61P 43/00 20180101; C12N
15/113 20130101; A61K 31/70 20130101; A61K 45/06 20130101; A01K
2217/075 20130101; A61K 49/0008 20130101; A61K 48/00 20130101 |
Class at
Publication: |
514/44 ;
536/23.1 |
International
Class: |
A61K 048/00; C07H
021/02 |
Claims
What is claimed is:
1. A method of reducing expression of a coding sequence in a target
cell of a non-embryonic mammal, said method comprising:
administering to said mammal an effective amount of an RNAi agent
specific for said coding sequence to reduce expression of said
coding sequence.
2. The method according to claim 1, wherein said RNAi agent is an
interfering ribonucleic acid.
3. The method according to claim 2, wherein said interfering
ribonucleic acid is a siRNA.
4. The method according to claim 2, wherein said interfering
ribonucleic acid is a shRNA.
5. The method according to claim 1, wherein said RNAi agent is a
transcription template of an interfering ribonucleic acid.
6. The method according to claim 5, wherein said transcription
template is a deoxyribonucleic acid.
7. The method according to claim 6, wherein said deoxyribonucleic
acid encodes a shRNA.
8. The method according to claim 1, wherein said non-embryonic
mammal is an adult.
9. The method according to claim 8, wherein said non-embryonic
mammal is a juvenile.
10. The method according to claim 1, wherein said RNAi agent is
hydrodynamically administered to said non-embryonic mammal.
11. The method according to claim 10, wherein said RNAi agent is
hydrodynamically administered to said non-embryonic mammal in
conjunction with an RNAse inhibitor.
12. A pharmaceutical preparation comprising an RNAi agent in a
pharmaceutically acceptable delivery vehicle.
13. The pharmaceutical preparation according to claim 12, wherein
said preparation further comprises an RNAse inhibitor.
14. A kit for use in practicing the method of claim 1, said kit
comprising: (a) a pharmaceutical preparation comprising an RNAi
agent in a pharmaceutically acceptable delivery vehicle; and (b)
instructions for practicing the method of claim 1.
15. The kit according to claim 14, wherein said kit further
comprises an RNAse inhibitor.
16. A non-embryonic non-human animal comprising an RNAi agent.
17. A non-embryonic non-human animal produced according to the
method of claim 1.
18. A method for introducing a ribonucleic acid into a target cell
of a vascularized multi-cellular organism, said method comprising:
administering said ribonucleic acid as a naked ribonucleic acid
into the vascular system of said organism to introduce said
ribonucleic acid into said target cell of said vascularized
multi-cellular organism.
19. The method according to claim 18, wherein said administering is
intravenous.
20. The method according to claim 18, wherein said vascularized
multi-cellular organism is a mammal.
21. The method according to claim 18, wherein said target cell is a
hepatic cell.
22. The method according to claim 18, wherein said method further
comprises administering an RNAse inhibitor.
23. The method according to claim 18, wherein said method further
comprises administering a competitor ribonucleic acid to said
organism.
24. A method for introducing a nucleic acid into a target cell of a
vascularized multi-cellular organism, said method comprising:
hydrodynamically administering to said vascularized multi-cellular
organism an aqueous formulation comprising said nucleic acid as a
naked nucleic acid and an RNase inhibitor to introduce said nucleic
acid into said target cell.
25. The method according to claim 24, wherein said nucleic acid is
a deoxyribonucleic acid.
26. The method according to claim 24, wherein said nucleic acid is
ribonucleic acid.
27. The method according to claim 24, wherein said aqueous
formulation further comprises competitor ribonucleic acid.
28. A kit for use in delivering a nucleic acid to a target cell of
a vascularized multi-cellular organism, said kit comprising: said
nucleic acid present as a naked nucleic acid; and an RNase
inhibitor;
29. The kit according to claim 28, wherein said nucleic acid is a
deoxyribonucleic acid.
30. The kit according to claim 28, wherein said nucleic acid is a
ribonucleic acid.
31. The kit according to claim 28, wherein said kit further
comprises instructions for introducing said formulation into the
vascular system a multi-cellular organism.
32. The kit according to claim 28, wherein said kit further
comprises a competitor ribonucleic acid.
33. The kit according to claim 28, wherein said kit further
comprises a means for vascularly administrating said aqueous
formulation.
34. A method of determining the activity of an RNA virus candidate
modulatory agent, said method comprising: (1) hydrodynamically
administering to a vascularized multicellular animal: (a) a nucleic
acid construct that includes either: (i) a RNA molecule that
includes at least one regulatory element of said RNA virus operably
linked to a reporter element; or (ii) a DNA molecule capable of
being transcribed into said RNA molecule; and (b) said candidate
modulatory agent; and (2) observing the effect of said modulatory
agent on the activity of said construct is to determine the
activity of said candidate modulatory agent.
35. The method according to claim 34, wherein said nucleic acid
method further comprises hydrodynamically administering an RNAse
inhibitor.
36. The method according to claim 34, wherein said method further
comprising hydrodynamically administering a competitor RNA.
37. The method according to claim 34, wherein said RNA virus is
HCV.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] Pursuant to 35 U.S.C. .sctn.119 (e), this application claims
priority to the filing date of the U.S. Provisional Patent
Application Serial No. 60/307,411 filed Jul. 23, 2001 and U.S.
Provisional Patent Application Serial No. 60/360,664 filed Feb. 27,
2002; the disclosures of which are herein incorporated by
reference.
INTRODUCTION
[0002] 1. Field of the Invention
[0003] The field of this invention is RNAi.
[0004] 2. Background of the Invention
[0005] Double-stranded RNA induces potent and specific gene
silencing through a process referred to as RNA interference (RNAi)
or posttranscriptional gene silencing (PTGS). RNAi is mediated by
RNA-induced silencing complex (RISC), a sequence-specific,
multicomponent nuclease that destroys messenger RNAs homologous to
the silencing trigger. RISC is known to contain short RNAs
(approximately 22 nucleotides) derived from the double-stranded RNA
trigger.
[0006] RNAi has become the method of choice for loss-of-function
investigations in numerous systems including, C. elegans,
Drosophila, fungi, plants, and even mammalian cell lines. To
specifically silence a gene in most mammalian cell lines, small
interfering RNAs (siRNA) are used because large dsRNAs (>30 bp)
trigger the interferon response and cause nonspecific gene
silencing.
[0007] To date, the Applicants are not aware of any report of
successful application of RNAi technology to non-embryonic
mammalian organisms. Demonstration that RNAi works in non-embryonic
mammalian organisms would provide for a number of important
additional applications for RNAi technology, including both
research and therapeutic applications, and is therefore of intense
interest.
[0008] Relevant Literature
[0009] WO 01/68836. See also: Bernstein et al., RNA (2001) 7:
1509-1521; Bernstein et al., Nature (2001) 409:363-366; Billy et
al., Proc. Nat'l Acad. Sci USA (2001) 98:14428-33; Caplan et al.,
Proc. Nat'l Acad. Sci USA (2001) 98:9742-7; Carthew et al., Curr.
Opin. Cell Biol (2001) 13: 244-8; Elbashir et al., Nature (2001)
411: 494-498; Hammond et al., Science (2001) 293:1146-50; Hammond
et al., Nat. Ref. Genet. (2001) 2:110-119; Hammond et al., Nature
(2000) 404:293-296; McCaffrrey et al., Nature (2002): 418-38-39;
and McCaffrey et al., Mol. Ther. (2002) 5:676-684; Paddison et al.,
Genes Dev. (2002) 16:948-958; Paddison et al., Proc. Nat'l Acad.
Sci USA (2002) 99:1443-48; Sui et al., Proc. Nat'l Acad. Sci USA
(2002) 99:5515-20.
[0010] U.S. patents of interest include U.S. Pat. Nos. 5,985,847
and 5,922,687. Also of interest is WO/11092. Additional references
of interest include: Acsadi et al., New Biol. (January 1991)
3:71-81; Chang et al., J. Virol. (2001) 75:3469-3473; Hickman et
al., Hum. Gen. Ther. (1994) 5:1477-1483; Liu et al., Gene Ther.
(1999) 6:1258-1266; Wolff et al., Science (1990) 247: 1465-1468;
and Zhang et al., Hum. Gene Ther. (1999) 10: 1735-1737: and Zhang
et al., Gene Ther. (1999) 7:1344-1349.
SUMMARY OF THE INVENTION
[0011] Methods and compositions are provided for modulating, e.g.,
reducing, coding sequence expression in mammals. In the subject
methods, an effective amount of an RNAi agent, e.g., an interfering
ribonucleic acid (such as an siRNA or shRNA) or a transcription
template thereof, e.g., a DNA encoding an shRNA, is administered to
a non-embryonic mammal, e.g., via a hydrodynamic administration
protocol. Also provided are RNAi agent pharmaceutical preparations
for use in the subject methods. The subject methods and
compositions find use in a variety of different applications,
including academic and therapeutic applications.
BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1 provides expression constructs employed in the RNAi
experiments described below.
[0013] FIGS. 2A to 2D: RNA interference in adult mice. FIG. 2A)
Representative images of light emitted from mice co-transfected
with the luciferase plasmid pGL3-Control and either no siRNA
(left), luciferase siRNA (middle) or unrelated siRNA (right). A
pseudocolor image representing intensity of emitted light (red most
and blue least intense) superimposed on a grayscale reference image
(for orientation) shows that RNAi functions in adult mammals. Forty
.mu.g of annealed 21-mer siRNAs (Dharmacon) were co-injected into
the livers of mice with the 2 .mu.g of pGL3-Control DNA and 800
units of RNasin (Promega) in 1.8 ml of PBS in 5-7 seconds. Seventy
two hours after the original injection, mice were anesthetized and
given 3 mg of luciferin intraperitoneally 15 min prior to imaging.
FIG. 2B) Summary of siRNA data. Mice receiving luciferase siRNA
emitted significantly less light than untreated controls. A one-way
ANOVA analysis with a post hoc Fisher's test was conducted. The
untreated and unrelated siRNA groups were statistically similar.
FIG. 2C) pShh1-Ff1 (center) but not pShh1-Ff1 rev (right) reduced
luciferase expression in mice compared to the untreated control
(left). 10 .mu.g of pShh1-Ff1 or pShh1-rev were co-injected with 40
.mu.g of pLuc-NS5B in 1.8 ml of PBS. FIG. 2D) Quantitation of pShh1
data. Animals were treated according to NIH Guidelines for Animal
Care and the Guidelines of Stanford University.
[0014] FIG. 3 provides a schematic representation of the constructs
employed in the morpholino phosporamidate antisense HCV inhibition
assay performed in the Experimental Section, below.
[0015] FIG. 4 provides background information of the mechanism of
antisense inhibitors.
[0016] FIGS. 5A to 5F provide graphical results of a morpholino
phosporamidate antisense HCV inhibition assay performed according
to the subject invention.
DEFINITIONS
[0017] For convenience, certain terms employed in the
specification, examples, and appended claims are collected
here.
[0018] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a genomic integrated vector,
or "integrated vector", which can become integrated into the
chromsomal DNA of the host cell. Another type of vector is an
episomal vector, i.e., a nucleic acid capable of extra-chromosomal
replication in an appropriate host, e.g., a eukaryotic or
prokaryotic host cell. Vectors capable of directing the expression
of genes to which they are operatively linked are referred to
herein as "expression vectors". In the present specification,
"plasmid" and "vector" are used interchangeably unless otherwise
clear from the context.
[0019] As used herein, the term "nucleic acid" refers to
polynucleotides such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term should also be
understood to include, as applicable to the embodiment being
described, single-stranded (such as sense or antisense) and
double-stranded polynucleotides.
[0020] As used herein, the term "gene" or "recombinant gene" refers
to a nucleic acid comprising an open reading frame encoding a
polypeptide of the present invention, including both exon and
(optionally) intron sequences. A "recombinant gene" refers to
nucleic acid encoding such regulatory polypeptides, that may
optionally include intron sequences that are derived from
chromosomal DNA. The term "intron" refers to a DNA sequence present
in a given gene that is not translated into protein and is
generally found between exons. As used herein, the term
"transfection" means the introduction of a nucleic acid, e.g., an
expression vector, into a recipient cell by nucleic acid-mediated
gene transfer.
[0021] A "protein coding sequence" or a sequence that "encodes" a
particular polypeptide or peptide, is a nucleic acid sequence that
is transcribed (in the case of DNA) and is translated (in the case
of mRNA) into a polypeptide in vitro or in vivo when placed under
the control of appropriate regulatory sequences. The boundaries of
the coding sequence are determined by a start codon at the 5'
(amino) terminus and a translation stop codon at the 3' (carboxy)
terminus. A coding sequence can include, but is not limited to,
cDNA from procaryotic or eukaryotic mRNA, genomic DNA sequences
from procaryotic or eukaryotic DNA, and even synthetic DNA
sequences. A transcription termination sequence will usually be
located 3' to the coding sequence.
[0022] Likewise, "encodes", unless evident from its context, will
be meant to include DNA sequences that encode a polypeptide, as the
term is typically used, as well as DNA sequences that are
transcribed into inhibitory antisense molecules.
[0023] The term "loss-of-function", as it refers to genes inhibited
by the subject RNAi method, refers a diminishment in the level of
expression of a gene when compared to the level in the absence of
the RNAi agent.
[0024] The term "expression" with respect to a gene sequence refers
to transcription of the gene and, as appropriate, translation of
the resulting mRNA transcript to a protein. Thus, as will be clear
from the context, expression of a protein coding sequence results
from transcription and translation of the coding sequence.
[0025] "Cells," "host cells" or "recombinant host cells" are terms
used interchangeably herein. It is understood that such terms refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0026] By "recombinant virus" is meant a virus that has been
genetically altered, e.g., by the addition or insertion of a
heterologous nucleic acid construct into the particle.
[0027] As used herein, the terms "transduction" and "transfection"
are art recognized and mean the introduction of a nucleic acid,
e.g., an expression vector, into a recipient cell by nucleic
acid-mediated gene transfer. "Transformation", as used herein,
refers to a process in which a cell's genotype is changed as a
result of the cellular uptake of exogenous DNA or RNA, and, for
example, the transformed cell expresses a dsRNA construct.
[0028] "Transient transfection" refers to cases where exogenous DNA
does not integrate into the genome of a transfected cell, e.g.,
where episomal DNA is transcribed into mRNA and translated into
protein.
[0029] A cell has been "stably transfected" with a nucleic acid
construct when the nucleic acid construct is capable of being
inherited by daughter cells.
[0030] As used herein, a "reporter gene construct" is a nucleic
acid that includes a "reporter gene" operatively linked to at least
one transcriptional regulatory sequence. Transcription of the
reporter gene is controlled by these sequences to which they are
linked. The activity of at least one or more of these control
sequences can be directly or indirectly regulated by the target
receptor protein. Exemplary transcriptional control sequences are
promoter sequences. A reporter gene is meant to include a
promoter-reporter gene construct that is heterologously expressed
in a cell.
[0031] As used herein, "transformed cells" refers to cells that
have spontaneously converted to a state of unrestrained growth,
i.e., they have acquired the ability to grow through an indefinite
number of divisions in culture. Transformed cells may be
characterized by such terms as neoplastic, anaplastic and/or
hyperplastic, with respect to their loss of growth control. For
purposes of this invention, the terms "transformed phenotype of
malignant mammalian cells" and "transformed phenotype " are
intended to encompass, but not be limited to, any of the following
phenotypic traits associated with cellular transformation of
mammalian cells: immortalization, morphological or growth
transformation, and tumorigenicity, as detected by prolonged growth
in cell culture, growth in semi-solid media, or tumorigenic growth
in immuno-incompetent or syngeneic animals.
[0032] As used herein, "proliferating" and "proliferation" refer to
cells undergoing mitosis.
[0033] As used herein, "immortalized cells" refers to cells that
have been altered via chemical, genetic, and/or recombinant means
such that the cells have the ability to grow through an indefinite
number of divisions in culture.
[0034] The "growth state" of a cell refers to the rate of
proliferation of the cell and the state of differentiation of the
cell.
[0035] "Inhibition of gene expression" refers to the absence (or
observable decrease) in the level of protein and/or mRNA product
from a target gene. "Specificity" refers to the ability to inhibit
the target gene without manifest effects on other genes of the
cell. The consequences of inhibition can be confirmed by
examination of the outward properties of the cell or organism (as
presented below in the examples) or by biochemical techniques such
as RNA solution hybridization, nuclease protection, Northern
hybridization, reverse transcription, gene expression monitoring
with a microarray, antibody binding, enzyme linked immunosorbent
assay (ELISA), Western blotting, radioimmunoassay (RIA), other
immunoassays, and fluorescence activated cell analysis (FACS). For
RNA-mediated inhibition in a cell line or whole organism, gene
expression is conveniently assayed by use of a reporter or drug
resistance gene whose protein product is easily assayed. Such
reporter genes include acetohydroxyacid synthase (AHAS), alkaline
phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase
(GUS), chloramphenicol acetyltransferase (CAT), green fluorescent
protein (GFP), horseradish peroxidase (HRP), luciferase (Luc),
nopaline synthase (NOS), octopine synthase (OCS), and derivatives
thereof multiple selectable markers are available that confer
resistance to ampicillin, bleomycin, chloramphenicol, gentamycin,
hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin,
puromycin, and tetracyclin.
[0036] Depending on the assay, quantitation of the amount of gene
expression allows one to determine a degree of inhibition which is
greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to a cell
not treated according to the present invention. Lower doses of
administered active agent and longer times after administration of
active agent may result in inhibition in a smaller fraction of
cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted
cells). Quantitation of gene expression in a cell may show similar
amounts of inhibition at the level of accumulation of target mRNA
or translation of target protein. As an example, the efficiency of
inhibition may be determined by assessing the amount of gene
product in the cell: mRNA may be detected with a hybridization
probe having a nucleotide sequence outside the region used for the
inhibitory double-stranded RNA, or translated polypeptide may be
detected with an antibody raised against the polypeptide sequence
of that region.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[0037] Methods and compositions are provided for modulating, e.g.,
reducing, coding sequence expression in mammals. In the subject
methods, an effective amount of an RNAi agent, e.g., an interfering
ribonucleic acid (such as an siRNA or shRNA) or a transcription
template thereof, e.g., a DNA encoding an shRNA, is administered to
a non-embryonic mammal, e.g., via a hydrodynamic administration
protocol. Also provided are RNAi agent pharmaceutical preparations
for use in the subject methods. The subject methods and
compositions find use in a variety of different applications,
including academic and therapeutic applications.
[0038] Before the subject invention is described further, it is to
be understood that the invention is not limited to the particular
embodiments of the invention described below, as variations of the
particular embodiments may be made and still fall within the scope
of the appended claims. It is also to be understood that the
terminology employed is for the purpose of describing particular
embodiments, and is not intended to be limiting. Instead, the scope
of the present invention will be established by the appended
claims.
[0039] In this specification and the appended claims, the singular
forms "a," "an" and "the" include plural reference unless the
context clearly dictates otherwise. Unless defined otherwise, all
technical and scientific terms used herein have the same meaning as
commonly understood to one of ordinary skill in the art to which
this invention belongs.
[0040] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range, and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges, and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0041] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this invention belongs. Although
any methods, devices and materials similar or equivalent to those
described herein can be used in the practice or testing of the
invention, representative methods, devices and materials are now
described.
[0042] All publications mentioned herein are incorporated herein by
reference for the purpose of describing and disclosing the
components that are described in the publications which might be
used in connection with the presently described invention.
[0043] RNAi in Non-Embryonic Mammals
[0044] As summarized above, the subject invention provides methods
of performing RNAi in non-embryonic mammals. In further describing
this aspect of the subject invention, the subject methods of RNAi
in non-embryonic mammals are described first in greater detail,
followed by a review of various representative applications in
which the subject invention finds use as well as kits that find use
in practicing the subject invention.
[0045] Methods
[0046] As indicated above, one aspect of the subject invention
provides methods of employing RNAi to modulate expression of a
target gene or genes in a non-embryonic mammalian host. In many
embodiments, the subject invention provides methods of reducing
expression of one or more target genes in a non-embryonic mammalian
host organism. By reducing expression is meant that the level of
expression of a target gene or coding sequence is reduced or
inhibited by at least about 2-fold, usually by at least about
5-fold, e.g., 10-fold, 15-fold, 20-fold, 50-fold, 100-fold or more,
as compared to a control. In certain embodiments, the expression of
the target gene is reduced to such an extent that expression of the
target gene/coding sequence is effectively inhibited. By modulating
expression of a target gene is meant altering, e.g., reducing,
transcription/translation of a coding sequence, e.g., genomic DNA,
mRNA etc., into a polypeptide, e.g., protein, product.
[0047] The subject invention provides methods of modulating
expression of a target gene in a non-embryonic mammalian organism.
By non-embryonic mammalian organism is meant a mammalian organism
or host that is not an embryo, i.e., is at a stage of development
that is later in time than the embryonic stage of development. As
such, the host organism may be a fetus, but is generally a host
organism in a post natal stage of development, e.g., juvenile,
adult, etc.
[0048] In practicing the subject methods, an effective amount of an
RNAi agent is administered to the host organism to modulate
expression of a target gene in a desirable manner, e.g., to achieve
the desired reduction in target cell gene expression.
[0049] By RNAi agent is meant an agent that modulates expression of
a target gene by a RNA interference mechanism. The RNAi agents
employed in one embodiment of the subject invention are small
ribonucleic acid molecules (also referred to herein as interfering
ribonucleic acids), i.e., oligoribonucleotides, that are present in
duplex structures, e.g., two distinct oligoribonucleotides
hybridized to each other or a single ribooligonucleotide that
assumes a small hairpin formation to produce a duplex structure. By
oligoribonucleotide is meant a ribonucleic acid that does not
exceed about 100 nt in length, and typically does not exceed about
75 nt length, where the length in certain embodiments is less than
about 70 nt. Where the RNA agent is a duplex structure of two
distinct ribonucleic acids hybridized to each other, e.g., an siRNA
(such as d-siRNA as described in copending application serial No.
60/377,704; the disclosure of which is herein incorporated by
reference), the length of the duplex structure typically ranges
from about 15 to 30 bp, usually from about 15 to 29 bp, where
lengths between about 20 and 29 bps, e.g., 21 bp, 22 bp, are of
particular interest in certain embodiments. Where the RNA agent is
a duplex structure of a single ribonucleic acid that is present in
a hairpin formation, i.e., a shRNA, the length of the hybridized
portion of the hairpin is typically the same as that provided above
for the siRNA type of agent or longer by 4-8 nucleotides. The
weight of the RNAi agents of this embodiment typically ranges from
about 5,000 daltons to about 35,000 daltons, and in many
embodiments is at least about 10,000 daltons and less than about
27,500 daltons, often less than about 25,000 daltons.
[0050] In certain embodiments, instead of the RNAi agent being an
interfering ribonucleic acid, e.g., an siRNA or shRNA as described
above, the RNAi agent may encode an interfering ribonucleic acid,
e.g., an shRNA, as described above. In other words, the RNAi agent
may be a transcriptional template of the interfering ribonucleic
acid. In these embodiments, the transcriptional template is
typically a DNA that encodes the interfering ribonucleic acid. The
DNA may be present in a vector, where a variety of different
vectors are known in the art, e.g., a plasmid vector, a viral
vector, etc.
[0051] The RNAi agent can be administered to the non-embryonic
mammalian host using any convenient protocol, where the protocol
employed is typically a nucleic acid administration protocol, where
a number of different such protocols are known in the art. The
following discussion provides a review of representative nucleic
acid administration protocols that may be employed. The nucleic
acids may be introduced into tissues or host cells by any number of
routes, including viral infection, microinjection, or fusion of
vesicles. Jet injection may also be used for intra-muscular
administration, as described by Furth et al. (1992), Anal Biochem
205:365-368. The nucleic acids may be coated onto gold
microparticles, and delivered intradermally by a particle
bombardment device, or "gene gun" as described in the literature
(see, for example, Tang et al. (1992), Nature 356:152-154), where
gold microprojectiles are coated with the DNA, then bombarded into
skin cells. Expression vectors may be used to introduce the nucleic
acids into a cell. Such vectors generally have convenient
restriction sites located near the promoter sequence to provide for
the insertion of nucleic acid sequences. Transcription cassettes
may be prepared comprising a transcription initiation region, the
target gene or fragment thereof, and a transcriptional termination
region. The transcription cassettes may be introduced into a
variety of vectors, e.g. plasmid; retrovirus, e.g. lentivirus;
adenovirus; and the like, where the vectors are able to transiently
or stably be maintained in the cells, usually for a period of at
least about one day, more usually for a period of at least about
several days to several weeks.
[0052] For example, the RNAi agent can be fed directly to, injected
into, the host organism containing the target gene. The agent may
be directly introduced into the cell (i.e., intracellularly); or
introduced extracellularly into a cavity, interstitial space, into
the circulation of an organism, introduced orally, etc. Methods for
oral introduction include direct mixing of RNA with food of the
organism. Physical methods of introducing nucleic acids include
injection directly into the cell or extracellular injection into
the organism of an RNA solution. The agent may be introduced in an
amount which allows delivery of at least one copy per cell. Higher
doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of
the agent may yield more effective inhibition; lower doses may also
be useful for specific applications.
[0053] In certain embodiments, a hydrodynamic nucleic acid
administration protocol is employed. Where the agent is a
ribonucleic acid, the hydrodynamic ribonucleic acid administration
protocol described in detail below is of particular interest. Where
the agent is a deoxyribonucleic acid, the hydrodynamic
deoxyribonucleic acid administration protocols described in Chang
et al., J. Virol. (2001) 75:3469-3473; Liu et al., Gene Ther.
(1999) 6:1258-1266; Wolff et al., Science (1990) 247: 1465-1468;
Zhang et al., Hum. Gene Ther. (1999) 10:1735-1737: and Zhang et
al., Gene Ther. (1999) 7:1344-1349; are of interest.
[0054] Additional nucleic acid delivery protocols of interest
include, but are not limited to: those described in U.S. patents of
interest include U.S. Pat. Nos. 5,985,847 and 5,922,687 (the
disclosures of which are herein incorporated by reference);
WO/11092;. Acsadi et al., New Biol. (1991) 3:71-81; Hickman et al.,
Hum. Gen. Ther. (1994) 5:1477-1483; and Wolff et al., Science
(1990) 247: 1465-1468; etc.
[0055] Depending n the nature of the RNAi agent, the active
agent(s) may be administered to the host using any convenient means
capable of resulting in the desired modulation of target gene
expression. Thus, the agent can be incorporated into a variety of
formulations for therapeutic administration. More particularly, the
agents of the present invention can be formulated into
pharmaceutical compositions by combination with appropriate,
pharmaceutically acceptable carriers or diluents, and may be
formulated into preparations in solid, semi-solid, liquid or
gaseous forms, such as tablets, capsules, powders, granules,
ointments, solutions, suppositories, injections, inhalants and
aerosols. As such, administration of the agents can be achieved in
various ways, including oral, buccal, rectal, parenteral,
intraperitoneal, intradermal, transdermal, intracheal, etc.,
administration.
[0056] In pharmaceutical dosage forms, the agents may be
administered alone or in appropriate association, as well as in
combination, with other pharmaceutically active compounds. The
following methods and excipients are merely exemplary and are in no
way limiting.
[0057] For oral preparations, the agents can be used alone or in
combination with appropriate additives to make tablets, powders,
granules or capsules, for example, with conventional additives,
such as lactose, mannitol, corn starch or potato starch; with
binders, such as crystalline cellulose, cellulose derivatives,
acacia, corn starch or gelatins; with disintegrators, such as corn
starch, potato starch or sodium carboxymethylcellulose; with
lubricants, such as talc or magnesium stearate; and if desired,
with diluents, buffering agents, moistening agents, preservatives
and flavoring agents.
[0058] The agents can be formulated into preparations for injection
by dissolving, suspending or emulsifying them in an aqueous or
nonaqueous solvent, such as vegetable or other similar oils,
synthetic aliphatic acid glycerides, esters of higher aliphatic
acids or propylene glycol; and if desired, with conventional
additives such as solubilizers, isotonic agents, suspending agents,
emulsifying agents, stabilizers and preservatives.
[0059] The agents can be utilized in aerosol formulation to be
administered via inhalation. The compounds of the present invention
can be formulated into pressurized acceptable propellants such as
dichlorodifluoromethane, propane, nitrogen and the like.
[0060] Furthermore, the agents can be made into suppositories by
mixing with a variety of bases such as emulsifying bases or
water-soluble bases. The compounds of the present invention can be
administered rectally via a suppository. The suppository can
include vehicles such as cocoa butter, carbowaxes and polyethylene
glycols, which melt at body temperature, yet are solidified at room
temperature.
[0061] Unit dosage forms for oral or rectal administration such as
syrups, elixirs, and suspensions may be provided wherein each
dosage unit, for example, teaspoonful, tablespoonful, tablet or
suppository, contains a predetermined amount of the composition
containing one or more inhibitors. Similarly, unit dosage forms for
injection or intravenous administration may comprise the
inhibitor(s) in a composition as a solution in sterile water,
normal saline or another pharmaceutically acceptable carrier.
[0062] The term "unit dosage form," as used herein, refers to
physically discrete units suitable as unitary dosages for human and
animal subjects, each unit containing a predetermined quantity of
compounds of the present invention calculated in an amount
sufficient to produce the desired effect in association with a
pharmaceutically acceptable diluent, carrier or vehicle. The
specifications for the novel unit dosage forms of the present
invention depend on the particular compound employed and the effect
to be achieved, and the pharmacodynamics associated with each
compound in the host.
[0063] The pharmaceutically acceptable excipients, such as
vehicles, adjuvants, carriers or diluents, are readily available to
the public. Moreover, pharmaceutically acceptable auxiliary
substances, such as pH adjusting and buffering agents, tonicity
adjusting agents, stabilizers, wetting agents and the like, are
readily available to the public.
[0064] Those of skill in the art will readily appreciate that dose
levels can vary as a function of the specific compound, the nature
of the delivery vehicle, and the like. Preferred dosages for a
given compound are readily determinable by those of skill in the
art by a variety of means.
[0065] Administration of an effective amount of an RNAi agent to a
non-embryonic mammalian host according as described above results
in a modulation of target gene(s) expression, e.g., a reduction of
target gene(s) expression, as described above.
[0066] The above described methods work in any mammal, where
representative mammals of interest include, but are not limited to:
ungulates or hooved animals, e.g., cattle, goats, pigs, sheep,
etc.; rodents, e.g., hamsters, mice, rats, etc.; lagomorphs, e.g.,
rabbits; primates, e.g., monkeys, baboons, humans, etc.; and the
like.
[0067] The above described methods find use in a variety of
different applications, representative types of which are now
described in greater detail below.
[0068] Utility
[0069] The subject methods find use in a variety of different
applications, where representative applications include both
academic/research applications and therapeutic applications. Each
of these types of representative applications is described more
fully below.
[0070] Academic/Research Applications
[0071] The subject methods find use in a variety of different types
of academic, research applications, in which one desires to
modulate expression of one or more target genes (coding sequences)
in a mammalian host, e.g., to determine the function of a target
gene/coding sequence in a mammalian host. The subject methods find
particular use in "loss-of-function" type assays, where one employs
the subject methods to reduce or decrease or inhibit expression of
one or more target genes/coding sequences in a mammalian host.
[0072] As such, one representative utility of the present invention
is as a method of identifying gene function in a non-embryonic
mammal, where an RNAi agent is administered to a mammal according
to the present invention in order to inhibit the activity of a
target gene of previously unknown function. Instead of the time
consuming and laborious isolation of mutants by traditional genetic
screening, functional genomics using the subject methods determines
the function of uncharacterized genes by administering an RNAi
agent to reduce the amount and/or alter the timing of target gene
activity. Such methods can be used in determining potential targets
for pharmaceutics, understanding normal and pathological events
associated with development, determining signaling pathways
responsible for postnatal development/aging, and the like. The
increasing speed of acquiring nucleotide sequence information from
genomic and expressed gene sources, including total sequences for
mammalian genomes, can be coupled with use of the subject methods
to determine gene function in a live mammalian organism. The
preference of different organisms to use particular codons,
searching sequence databases for related gene products, correlating
the linkage map of genetic traits with the physical map from which
the nucleotide sequences are derived, and artificial intelligence
methods may be used to define putative open reading frames from the
nucleotide sequences acquired in such sequencing projects.
[0073] A simple representative assay inhibits gene expression
according to the partial sequence available from an expressed
sequence tag (EST). Functional alterations in growth, development,
metabolism, disease resistance, or other biological processes would
be indicative of the normal role of the EST's gene product. The
function of the target gene can be assayed from the effects it has
on the mammal when gene activity is inhibited.
[0074] If a characteristic of an organism is determined to be
genetically linked to a polymorphism through RFLP or QTL analysis,
the present invention can be used to gain insight regarding whether
that genetic polymorphism might be directly responsible for the
characteristic. For example, a fragment defining the genetic
polymorphism or sequences in the vicinity of such a genetic
polymorphism can be employed to produce an RNAi agent, which agent
can then be administered to the mammal, and whether an alteration
in the characteristic is correlated with inhibition can be
determined.
[0075] The present invention is useful in allowing the inhibition
of essential genes. Such genes may be required for organism
viability at only particular stages of development or cellular
compartments. The functional equivalent of conditional mutations
may be produced by inhibiting activity of the target gene when or
where it is not required for viability. The invention allows
addition of an RNAi agent at specific times of development and
locations in the organism without introducing permanent mutations
into the target genome.
[0076] In situations where alternative splicing produces a family
of transcripts that are distinguished by usage of characteristic
exons, the present invention can target inhibition through the
appropriate exons to specifically inhibit or to distinguish among
the functions of family members. For example, a hormone that
contained an alternatively spliced transmembrane domain may be
expressed in both membrane bound and secreted forms. Instead of
isolating a nonsense mutation that terminates translation before
the transmembrane domain, the functional consequences of having
only secreted hormone can be determined according to the invention
by targeting the exon containing the transmembrane domain and
thereby inhibiting expression of membrane-bound hormone.
[0077] Therapeutic Applications
[0078] The subject methods also find use in a variety of
therapeutic applications in which it is desired to modulate, e.g.,
one or more target genes in a whole mammal or portion thereof,
e.g., tissue, organ, etc. In such methods, an effective amount of
an RNAi active agent is administered to the host mammal. By
effective amount is meant a dosage sufficient to modulate
expression of the target gene(s), as desired. As indicated above,
in many embodiments of this type of application, the subject
methods are employed to reduce/inhibit expression of one or more
target genes in the host in order to achieve a desired therapeutic
outcome.
[0079] Depending on the nature of the condition being treated, the
target gene may be a gene derived from the cell, an endogenous
gene, a pathologically mutated gene, e.g. a cancer causing gene, a
transgene, or a gene of a pathogen which is present in the cell
after infection thereof. Depending on the particular target gene
and the dose of RNAi agent delivered, the procedure may provide
partial or complete loss of function for the target gene. Lower
doses of injected material and longer times after administration of
RNAi agent may result in inhibition in a smaller fraction of
cells.
[0080] The subject methods find use in the treatment of a variety
of different conditions in which the modulation of target gene
expression in a mammalian host is desired. By treatment is meant
that at least an amelioration of the symptoms associated with the
condition afflicting the host is achieved, where amelioration is
used in a broad sense to refer to at least a reduction in the
magnitude of a parameter, e.g. symptom, associated with the
condition being treated. As such, treatment also includes
situations where the pathological condition, or at least symptoms
associated therewith, are completely inhibited, e.g. prevented from
happening, or stopped, e.g. terminated, such that the host no
longer suffers from the condition, or at least the symptoms that
characterize the condition.
[0081] A variety of hosts are treatable according to the subject
methods. Generally such hosts are "mammals" or "mammalian," where
these terms are used broadly to describe organisms which are within
the class mammalia, including the orders carnivore (e.g., dogs and
cats), rodentia (e.g., mice, guinea pigs, and rats), and primates
(e.g., humans, chimpanzees, and monkeys). In many embodiments, the
hosts will be humans.
[0082] The present invention is not limited to modulation of
expression of any specific type of target gene or nucleotide
sequence. Representative classes of target genes of interest
include but are not limited to: developmental genes (e.g., adhesion
molecules, cyclin kinase inhibitors, cytokines/lymphokines and
their receptors, growth/differentiation factors and their
receptors, neurotransmitters and their receptors); oncogenes (e.g.,
ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB, EBRB2, ETSI,
ETS1, ETV6, FOR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2,
MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM 1, PML, RET, SRC, TALI, TCL3,
and YES); tumor suppressor genes (e.g., APC, BRCA 1, BRCA2, MADH4,
MCC, NF 1, NF2, RB 1, TP53, and WTI); and enzymes (e.g., ACC
synthases and oxidases, ACP desaturases and hydroxylases,
ADP-glucose pyrophorylases, ATPases, alcohol dehydrogenases,
amylases, amyloglucosidases, catalases, cellulases, chalcone
synthases, chitinases, cyclooxygenases, decarboxylases,
dextrinases, DNA and RNA polymerases, galactosidases, glucanases,
glucose oxidases, granule-bound starch synthases, GTPases,
helicases, hemicellulases, integrases, inulinases, invertases,
isomerases, kinases, lactases, Upases, lipoxygenases, lyso/ymes,
nopaline synthases, octopine synthases, pectinesterases,
peroxidases, phosphatases, phospholipases, phosphorylases,
phytases, plant growth regulator synthases, polygalacturonases,
proteinases and peptidases, pullanases, recombinases, reverse
transcriptases, RUBISCOs, topoisomerases, and xylanases);
chemokines (e.g. CXCR4, CCR5), the RNA component of telomerase,
vascular endothelial growth factor (VEGF), VEGF receptor, tumor
necrosis factors nuclear factor kappa B, transcription factors,
cell adhesion molecules, Insulin-like growth factor, transforming
growth factor beta family members, cell surface receptors, RNA
binding proteins (e.g. small nucleolar RNAs, RNA transport
factors), translation factors, telomerase reverse transcriptase);
etc.
[0083] Kits
[0084] Also provided are reagents and kits thereof for practicing
one or more of the above-described methods. The subject reagents
and kits thereof may vary greatly. Typically, the kits at least
include an RNAi agent as described above.
[0085] In addition to the above components, the subject kits will
further include instructions for practicing the subject methods.
These instructions may be present in the subject kits in a variety
of forms, one or more of which may be present in the kit. One form
in which these instructions may be present is as printed
information on a suitable medium or substrate, e.g., a piece or
pieces of paper on which the information is printed, in the
packaging of the kit, in a package insert, etc. Yet another means
would be a computer readable medium, e.g., diskette, CD, etc., on
which the information has been recorded. Yet another means that may
be present is a website address which may be used via the internet
to access the information at a removed site. Any convenient means
may be present in the kits.
[0086] Hydrodynamic Administration of Naked RNA
[0087] Also provided by the subject invention are methods and
compositions for the in vivo introduction of a naked nucleic acid,
e.g. ribonucleic acid, deoxyribonucleic or chemically modified
nucleic acids (including, but not limited to, morpholino, peptide
nucleic acids, methylphosphonate, phosphorothioate or 2'-Omethyl
oligonucleotides), into the target cell of a vascularized organism,
e.g. a mammal. These methods of the subject invention are
conveniently referred to as "hydrodynamic" methods.
[0088] In one embodiment of the subject methods, an aqueous
formulation of a naked nucleic acid and an RNase inhibitor is
administered into the vascular system of the organism. In many
embodiments, the aqueous formulation also includes a competitor
ribonucleic acid, e.g. a non-capped non-polyadenylated ribonucleic
acid. In yet other embodiments, codelivery of DNA capable of being
transcribed into the RNA molecule with candidate modulatory agents
is performed without an RNase inhibitor or competitor ribonucleic
acid, where the modulatory agent and the DNA may or may not be
delivered as a single composition. The subject methods find use in
a variety of different applications, including both research and
therapeutic applications, and are particularly suited for use in
the in vivo delivery of a ribonucleic acid into a hepatic cell,
e.g. for liver targeted in vivo delivery of nucleic acids.
[0089] In further describing this aspect of the subject invention,
the subject methods will be described first followed by a
description of representative applications in which the subject
methods find use and kits for use in practicing the subject
methods.
[0090] Methods
[0091] As summarized above, the subject invention provides a method
for the in vivo introduction of a nucleic acid, e.g. a ribonucleic
acid, into a target cell present in a vascularized multi-cellular
organism. By in vivo introduction is meant that, in the subject
methods, the target cell into which the nucleic acid is introduced
is one that is present in the multi-cellular organism, i.e., it is
not a cell that is separated from e.g. removed from, the
multi-cellular organism. As such, the subject methods are distinct
from in vitro nucleic acid transfer protocols, in which a nucleic
acid is introduced into a cell or cells separated from the
multi-cellular organism from which they originated, e.g. are in
culture. In other words, the subject methods are not methods of in
vitro nucleic acid transfer.
[0092] By introduction of the nucleic acid is meant that the
nucleic acid, e.g., deoxyribonucleic acid (DNA) or ribonucleic acid
(RNA) or a non-naturally occurring nucleic acid analog, is inserted
into the cytoplasm of the target cell. In other words, the nucleic
acid is moved from the outside of the target cell to the inside of
the target cell across the cell membrane.
[0093] By vascularized multi-cellular organism is meant a
multi-cellular organism that includes a vascular system.
Multi-cellular organisms of interest include plants and animals,
where animals are of particular interest, particularly vertebrate
animals that have a vascular system made up of a system of veins
and arteries through which blood is flowed, e.g. in response to the
beating of a heart. Animals of interest are mammals in many
embodiments. Mammals of interest include; rodents, e.g. mice, rats;
livestock, e.g. pigs, horses, cows, etc., pets, e.g. dogs, cats;
and primates, e.g. humans. In certain embodiments, the
multi-cellular organism is a human. In other embodiments, the
multi-cellular organism is a non-human mammal, e.g. a rodent, such
as a mouse, rat, etc.
[0094] As mentioned above, the subject methods are, in the broadest
sense, suitable for introduction of nucleic acids into the target
cell of a host. The term "nucleic acid" as used herein means a
polymer composed of nucleotides, e.g. deoxyribonucleotides or
ribonucleotides, or compounds produced synthetically (e.g. PNA as
described in U.S. Pat. No. 5,948,902 and the references cited
therein) which can hybridize with naturally occurring nucleic acids
in a sequence specific manner analogous to that of two naturally
occurring nucleic acids. The terms "ribonucleic acid" and "RNA" as
used herein mean a polymer composed of ribonucleotides. The terms
"deoxyribonucleic acid" and "DNA" as used herein mean a polymer
composed of deoxyribonucleotides.
[0095] The subject methods are particularly suited for use in the
delivery of a ribonucleic acid into a target cell of a
multi-cellular organism. As such, the methods will now be further
described in terms of the delivery of ribonucleic acids. However,
the following protocols are also suitable for use in the delivery
of other nucleic acids, e.g. DNAs (such as plasmid DNA), etc.
[0096] In practicing the subject methods, an aqueous composition of
the ribonucleic acid in which the ribonucleic acid is present as a
naked ribonucleic acid is administered to the vascular system of
the multi-cellular organism or host. In many embodiments, the naked
RNA aqueous composition or formulation is administered to the vein
of the host, i.e. the naked RNA formulation is intravenously
administered. In certain embodiments, the naked RNA formulation is
intravenously administered to the host via high pressure injection.
By high pressure injection is meant that the aqueous formulation is
intravenously introduced at an elevated pressure, where the
elevated pressure is generally at least about 20, usually at least
about 30 mmHg. In many embodiments, the elevated pressure ranges
from about 10 to 50 mm Hg, where 40 to 50 mm Hg is often preferred.
Methods of administering aqueous formulations under high pressure,
such as those described above, are described in the references
listed in the relevant literature section, supra.
[0097] As mentioned above, the RNA or DNA that is to be introduced
into the target cell via the subject methods is present in the
aqueous formulation as naked RNA. By "naked" is meant that the RNA
is free from any delivery vehicle that can act to facilitate entry
into the target cell. For example, the naked RNAs or DNAs delivered
in the subject methods are free from any material that promotes
transfection, such as liposomal formulations, charged lipids or
precipitating agents, e.g. they are not complexed to colloidal
materials (including liposomal preparations). In addition, the
naked RNAs of the subject invention are not contained in a vector
that would cause integration of the RNA into the target cell
genome, i.e. they are free of viral sequences or particles that
carry genetic information.
[0098] The naked RNAs that may be delivered via the subject
invention may vary widely in length, depending on their intended
purpose, e.g. the protein they encode, etc. Generally, the naked
RNAs will be at least about 10 nt long, usually at least about 30
nt long and more usually at least about 35 nt long, where the naked
RNAs may be as long as 20,000 nt or longer, but generally will not
exceed about 10,000 nt long and usually will not exceed about 6,000
nt long. In certain embodiments where the naked RNA is an RNAi
agent, as described above, the length of the RNA ranges from about
10 to 50 nt, often from about 10 to 40 nt, and more often from
about 15 to 30 nt, including 15 to 25 nt, such as 20 to 25 nt,
e.g., 21 or 22 nt.
[0099] The naked RNAs that may be introduced into a target cell
according to the subject methods may or may not encode a protein,
i.e. may or may not be capable of being translated into a protein
upon introduction into the target cell. In those embodiments where
the naked RNA is capable of being translated into a protein
following introduction into the target cell, the naked RNA may or
may not be capped, it may include an IRES domain, etc. However, in
many particular protocols of this embodiment, the naked RNA is
capped. Furthermore, the RNA in these embodiments generally
includes at least a polyadenylation signal, and in many embodiments
is polyadenylated, where the polyA tail, when present, generally
ranges in length from about 10 to 300, usually from about 30 to 50.
Further description of the naked RNAs is provided infra.
[0100] As mentioned above, an aqueous formulation of the naked RNA
is intravascularly, usually intravenously, administered to the
host. In the aqueous formulations employed in the subject methods,
an effective amount of the naked RNA is combined with an aqueous
delivery vehicle. By effective amount is meant an amount that is
sufficient to provide for the desired amount of transfer into the
target cell, e.g. to provide the desired outcome, such as desired
amount of protein expression. In many embodiments, the amount of
naked RNA present in the aqueous formulation is at least about 5
micrograms, usually at least about 10 micrograms and more usually
at least about 20 micrograms, where the amount may be as great as
10 milligrams or greater, but generally does not exceed about 1
milligram and usually does not exceed about 200 micrograms.
[0101] Aqueous delivery vehicles of interest include: water, saline
and buffered media. Specific vehicles of interest include: sodium
chloride solution, Ringer's dextrose, dextrose and sodium chloride,
lactated Ringer's, phosphate buffered saline, etc. The aqueous
delivery vehicles may further include preservatives and other
additives, e.g. antimicrobials, antioxidants, chelating agents,
inert gases, nutrient replenishers, electrolyte replenishers,
divalent cations, such as magnesium, calcium and manganese, etc. Of
particular interest in many embodiments is the use of buffered salt
solutions are pseudophysiological.
[0102] A feature of certain embodiments of the subject methods is
that the naked RNA is introduced into the vascular system of the
multi-cellular organism in combination with an RNase inhibitor. By
RNase inhibitor is meant a compound or agent that at least reduces
the activity of, if not completely inactivates, an RNase activity
in the multi-cellular organism. In many embodiments, the RNase
inhibitor is a protein inhibitor of RNase, where the human
placental RNase inhibitor is of particular interest. The protein
RNase inhibitor may be purified from a natural source or
synthetically produced, e.g. via recombinant techniques. Human
placental RNase inhibitor may be obtained from a variety of
different sources under a variety of different tradenames, where
representative sources include: Promega, Inc., Strategene, Inc.,
Fisher Scientific, Inc., and the like.
[0103] While the RNase inhibitor may, in certain embodiments, be
administered to the host in a composition separate from the aqueous
naked RNA composition, in many embodiments the RNase inhibitor is
present in the aqueous naked RNA composition. The amount of RNase
inhibitor that is present in the aqueous composition is sufficient
to provide for the desired uptake of the naked RNA. Where the RNase
inhibitor is a protein inhibitor, the concentration of the
inhibitor in the aqueous composition that is introduced into the
multi-cellular organism during practice of the subject methods may
range from about 4 to 4,000 units, usually from about 400 to 4,000
units and more usually from about 400 to 1,500 units.
[0104] In certain embodiments, the naked RNA and RNase inhibitor
are administered in conjunction with a competitor RNA. By
competitor RNA is meant an RNA that is capable of serving as a
competitive inhibitor of RNase activity. In many embodiments, the
competitor RNA is uncapped and non-polyadenylated. By uncapped is
meant that the competitor RNA lacks the cap structure found at the
5' end of eukaryotic messenger RNA, i.e. it lacks a 5' 7 methyl G.
By non-polyadenylated is meant that the competitor RNA lacks a
polyA tail or domain of polyadenylation at its 3' end, as is found
in eukaryotic messenger RNA. The length of the competitor RNA may
vary, but is generally at least about 70 nt, usually at least about
200 nt and more usually at least about 1,500 nt, where the length
may be as great as 10,000 nt or greater, but generally does not
exceed about 3,500 nt and usually does not exceed about 1,500 nt.
The concentration of competitor RNA in the aqueous composition is
sufficient to provide for the desired protection of the naked RNA
(e.g. via competition for binding by RNase), and in many
embodiments ranges from about 10 .mu.g/ml to 10 mg/ml, usually from
about 20 to 200 .mu.g/ml and more usually from about 40 to 150
.mu.g/ml.
[0105] The subject methods result in highly efficient transfer of
the administered RNA into the cytoplasm of the target cell(s). The
subject methods are particularly suited for transferring RNA into
the cytoplasm of liver or hepatic cells and non-parenchymal cells
in the liver. As such, in many embodiments the subject methods are
in vivo methods of achieving high level nucleic acid, e.g. RNA,
transfer into hepatic cells or liver tissue.
[0106] The nucleic acid that is introduced into the target cell via
the subject methods is short lived once inside the target cell.
Depending on the particular nature of the nucleic acid, the half
life the nucleic acid following introduction via the subject
methods generally ranges from about 30 sec to 10 days, usually from
about 1 min to 24 hrs and more usually from about 5 min to 10 hrs.
As such, where the nucleic acid is an RNA encoding a protein of
interest, protein expression following introduction via the subject
method is transient, typically lasting for a period of time ranging
from about 1 min to 3 days, usually from about 5 min to 24 hrs. As
such, in many embodiments of the subject methods, the subject
methods are methods of providing for transient protein expression
from a transgene, where protein expression is equal to RNA
lifetime. Nonetheless, the protein expressed may have a longer
lifetime, depending on the nature of the particular protein.
[0107] Utility
[0108] The subject methods find use in a variety of different
applications in which the efficient in vivo transfer of a naked
nucleic acid into a target cell is desired. Applications in which
the subject methods find use include both therapeutic and research
applications. Therapeutic applications of interest include gene
therapy applications, vaccination applications, and the like.
Research applications of interest include the production of animal
models for particular conditions, e.g. RNA viral infections, the
observation of gene expression on phenotypes to elucidate gene
function, etc. Other applications in which the subject invention
finds use include the development of antisense, ribozyme and
chimeraplasty (i.e. the repair of genes via RNA/DNA chimeras (see
e.g. Yoon et al., Proc Natl Acad Sci USA (1996) 93(5):2071-6;
Cole-Strauss et al., Science (1996) 273(5280):1386-9; and Zhu et
al., Proc Natl Acad Sci USA (1999) 96(15):8768-73) therapeutics, as
well as interfering RNA (RNA whose presence in the cell prevents
the translation of similar RNAs, (See e.g. Wianny et al., Nat Cell
Biol (2000) 2(2):70-5; and SiQun et al., Nature (1998) 391:
806-811) therapeutics.
[0109] One type of application in which the subject methods find
use is in the synthesis of polypeptides, e.g. proteins, of interest
from a target cell, particularly the transient expression of a
polypeptide. In such applications, a nucleic acid that encodes the
polypeptide of interest in combination with requisite and/or
desired expression components, e.g. 5' cap structures, IRES
domains, polyA signals or tails, etc., is introduced into the
target cell via in vivo administration to the multi-cellular
organism in which the target cell resides, where the target cell is
to serve as an expression host for expression of the polypeptide.
For example, where the naked nucleic acid administered by the
subject methods is RNA, the RNA is an RNA that is capable of being
translated in the cytoplasm of the target cell into the protein
encoded by the sequence contained in the RNA. The RNA may be capped
or uncapped, where when it is uncapped it generally includes an
IRES sequence. The RNA also generally further includes a polyA
tail, where the length of the polyA tail typically ranges from
about 10 to 300, usually from about 30 to 50 nt. Following in vivo
administration and subsequent introduction into the target cell,
the multi-cellular organism, and targeted host cell present
therein, is then maintained under conditions sufficient for
expression of the protein encoded by the transferred RNA. The
expressed protein is then harvested, and purified where desired,
using any convenient protocol.
[0110] As such, the subject methods provide a means for at least
enhancing the amount of a protein of interest in a multi-cellular
organism. The term `at least enhance` includes situations where the
methods are employed to increase the amount of a protein in a
multi-cellular organism where a certain initial amount of protein
is present prior to practice of the subject methods. The term `at
least enhance` also includes those situations in which the
multi-cellular organism includes substantially none of the protein
prior to practice of the subject methods. As the subject methods
find use in at least enhancing the amount of a protein present in a
multi-cellular organism, they find use in a variety of different
applications, including pharmaceutical preparation applications and
therapeutic applications, where the latter is described in greater
detail infra.
[0111] Therapeutic applications in which the subject methods find
use include gene therapy applications in which the subject methods
are used to enhance the level of a therapeutic protein in the host
organism and vaccination applications, in which the subject methods
are used to vaccinate the host (or develop vaccines for delivery by
other methods). As distinct from DNA based expression protocols,
the subject RNA based expression protocols are uncomplicated by the
need for promoter, enhancer, repressor and other regulatory
elements commonly associated with eukaryotic genes. The subject
methods may be used to deliver a wide variety of therapeutic
nucleic acids which, upon entry into the target cell, provide for
the requisite enhanced protein level in the host. Therapeutic
nucleic acids of interest include nucleic acids that replace
defective genes in the target host cell, such as those responsible
for genetic defect based diseased conditions, by encoding products
that are supposed to be provided to the host by these defective
genes; nucleic acids which have therapeutic utility in the
treatment of cancer; and the like. Representative products involved
in gene defect disease conditions whose level may be enhanced by
practicing the subject methods include, but are not limited to:
factor VIII, factor IX, .beta.-globin, low-density protein
receptor, adenosine deaminase, purine nucleoside phosphorylase,
sphingomyelinase, glucocerebrosidase, cystic fibrosis transmembrane
regulator, .alpha.-antitrypsin, CD-18, ornithine transcarbamylase,
arginosuccinate synthetase, phenylalanine hydroxylase,
branched-chain .alpha.-ketoacid dehydrogenase, fumarylacetoacetate
hydrolase, glucose 6-phosphatase, .alpha.-L-fucosidase,
.beta.-glucuronidase, .alpha.-L-iduronidase, galactose 1-phosphate
uridyltransferase, and the like. Cancer therapeutic nucleic acids
that may be delivered via the subject methods include: nucleic
acids that enhance the antitumor activity of lymphocytes by
encoding appropriate factors, nucleic acids whose expression
product enhances the immunogenicity of tumor cells, tumor
suppressor encoding nucleic acids, toxin encoding nucleic acids,
suicide factor encoding nucleic acids, multiple-drug resistance
product encoding nucleic acids, ribozymes, DNA ribozymes, DNA/RNA
chimeras, interfering RNA and antisense sequences, and the
like.
[0112] An important feature of the subject methods, as described
supra, is that the subject methods may be used for in vivo gene
therapy applications. By in vivo gene therapy applications is meant
that the target cell or cells in which expression of the
therapeutic gene is desired are not removed from the host prior to
practice of the subject methods. In contrast, the naked nucleic
acid compositions are administered directly to the multi-cellular
organism and are taken up by the target cells, following which
expression of the encoded product occurs.
[0113] As mentioned above, another therapeutic application in which
the subject methods find use is in vaccination of a host (as well
as development of a vaccine to be delivered by other methods). In
these methods, the naked nucleic acid, e.g. RNA, that is
administered to the host via the subject methods encodes a desired
immunogen that, upon entry of the RNA into the target cell, is
expressed and secreted to elicit the desired immune response.
Vaccination methods in which naked nucleic acid are employed and in
which the subject methods of naked nucleic acid delivery find use
are further described in WO 90/11092, the disclosure of which is
herein incorporated by reference.
[0114] As mentioned above, the subject methods also find use in
various research applications. One research application in which
the subject invention finds use is in the production of animal
models of RNA virus infection, where RNA viruses of interest
include: HCV, HIV, influenza A, Hepatitis A, poliovirus,
enteroviruses, rhinoviruses, aphthoviruses, and the like. To
produce such animal models, constructs are first provided that
include one or more regulatory elements from the RNA virus of
interest operably linked to a reporter domain, e.g., a domain
encoding a detectable product (such as luciferase, a fluorescent
protein, etc.); etc. Alternatively, DNA constructs that can be
transcribed in vivo into such RNA constructs may be employed. These
constructs are then administered to a host, e.g., a mouse,
according to the subject methods to produce an animal model of an
infection by the corresponding RNA virus. As such, also provided
are the animal models of RNA viruses produced by the subject
methods. A representative protocol for the production of an RNA
virus animal model is provided in the experimental section
infra.
[0115] The subject methods also find use in the delivery of RNAi
therapeutic and/or research agents, including siRNA and shRNA, as
described more fully above and in the experimental section,
below.
[0116] Also provided are methods of screening candidate modulatory,
e.g., enhancing or inhibitory, agents using such animal models. A
variety of different types of candidate agents may be screened
according to the subject methods.
[0117] Candidate agents encompass numerous chemical classes, though
typically they are organic molecules, preferably small organic
compounds having a molecular weight of more than 50 and less than
about 2,500 daltons. Candidate agents comprise functional groups
necessary for structural interaction with proteins, particularly
hydrogen bonding, and typically include at least an amine,
carbonyl, hydroxyl or carboxyl group, preferably at least two of
the functional chemical groups. The candidate agents often comprise
cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found among
biomolecules including peptides, saccharides, fatty acids,
steroids, purines, pyrimidines, derivatives, structural analogs or
combinations thereof.
[0118] Of particular interest in certain embodiments are antisense
nucleic acids. The anti-sense reagent may be antisense
oligonucleotides (ODN), particularly synthetic ODN having chemical
modifications from native nucleic acids, or nucleic acid constructs
that express such anti-sense molecules as RNA. The antisense
sequence is complementary to the mRNA of the targeted gene, and
inhibits expression of the targeted gene products. Antisense
molecules inhibit gene expression through various mechanisms, e.g.
by reducing the amount of mRNA available for translation, through
activation of RNAse H, or steric hindrance. One or a combination of
antisense molecules may be administered, where a combination may
comprise multiple different sequences.
[0119] Antisense molecules may be produced by expression of all or
a part of the target gene sequence in an appropriate vector, where
the transcriptional initiation is oriented such that an antisense
strand is produced as an RNA molecule. Alternatively, the antisense
molecule is a synthetic oligonucleotide. Antisense oligonucleotides
will generally be at least about 7, usually at least about 12, more
usually at least about 16 nucleotides in length, and not more than
about 500, usually not more than about 50, more usually not more
than about 35 nucleotides in length, where the length is governed
by efficiency of inhibition, specificity, including absence of
cross-reactivity, and the like. It has been found that short
oligonucleotides, of from 7 to 8 bases in length, can be strong and
selective inhibitors of gene expression (see Wagner et al. (1996),
Nature Biotechnol. 14:840-844).
[0120] A specific region or regions of the endogenous sense strand
mRNA sequence is chosen to be complemented by the antisense
sequence. Selection of a specific sequence for the oligonucleotide
may use an empirical method, where several candidate sequences are
assayed for inhibition of expression of the target gene in an in
vitro or animal model. A combination of sequences may also be used,
where several regions of the mRNA sequence are selected for
antisense complementation.
[0121] Antisense oligonucleotides may be chemically synthesized by
methods known in the art (see Wagner et al. (1993), supra, and
Milligan et al., supra.) Preferred oligonucleotides are chemically
modified from the native phosphodiester structure, in order to
increase their intracellular stability and binding affinity. A
number of such modifications have been described in the literature,
which alter the chemistry of the backbone, sugars or heterocyclic
bases.
[0122] Among useful changes in the backbone chemistry are
phosphorodiamidate linkages, methylphosphonates phosphorothioates;
phosphorodithioates, where both of the non-bridging oxygens are
substituted with sulfur; phosphoroamidites; alkyl phosphotriesters
and boranophosphates. Achiral phosphate derivatives include
3'-O-5'-S-phosphorothioate, 3'-S-5'-O-phosphorothioate,
3'-CH.sub.2-5'-O-phosphonate and 3'-NH-5'-O-phosphoroamidate.
Peptide nucleic acids replace the entire ribose phosphodiester
backbone with a peptide linkage. Sugar modifications are also used
to enhance stability and affinity. One example is the substitution
of the ribose sugar with a morpholine. The .alpha.-anomer of
deoxyribose may be used, where the base is inverted with respect to
the natural .beta.-anomer. The 2'-OH of the ribose sugar may be
altered to form 2'-O-methyl or 2'-O-allyl sugars, which provides
resistance to degradation without comprising affinity. Modification
of the heterocyclic bases must maintain proper base pairing. Some
useful substitutions include deoxyuridine for deoxythymidine;
5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for
deoxycytidine. 5-propynyl-2'-deoxyuridine and
5-propynyl-2'-deoxycytidine have been shown to increase affinity
and biological activity when substituted for deoxythymidine and
deoxycytidine, respectively.
[0123] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides and oligopeptides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. Additionally, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means, and may be used to
produce combinatorial libraries. Known pharmacological agents may
be subjected to directed or random chemical modifications, such as
acylation, alkylation, esterification, amidification, etc. to
produce structural analogs.
[0124] In such screening assays, the nucleic acid construct (e.g.,
the RNA or DNA construct described above) and the candidate agent
are administered to the host animal, the effect of the candidate
agent on the activity of the construct is observed, and the
observed effect is related to the modulatory activity of the
candidate compound. The candidate agent and nucleic acid construct
may be administered to the host according to the subject methods at
the same or different times, where in certain preferred embodiments
the two components are administered to the host simultaneously,
e.g., in the form of a single fluid composition. Representative
screening assays are provided in the experimental section
infra.
[0125] Another research application in which the subject methods
find use is the elucidation of gene function. In such methods, RNA
having a particular gene sequence is introduced via the subject
methods and the effect of the gene on the phenotype of the organism
is observed. Benefits of using the subject methods for gene
function research applications include the ability to express the
genes without concern for genetic regulatory elements. Other
research applications in which the subject methods find use
include, but are not limited to: the study of ribozyme and
antisense efficacy; the study of RNA metabolism, and the like.
[0126] Kits
[0127] Also provided by the subject invention are kits for use in
practicing the subject methods of in vivo nucleic acid delivery to
a target cell, e.g. hepatic cells. The subject kits generally
include a naked nucleic acid that is desired to be introduced into
the target cell and an RNase inhibitor. The subject kits may
further include an aqueous delivery vehicle, e.g. a buffered saline
solution, etc. In addition, the kits may include a competitor RNA,
as described supra. In the subject kits, the above components may
be combined into a single aqueous composition for delivery into the
host or separate as different or disparate compositions, e.g. in
separate containers. Optionally, the kit may further include a
vascular delivery means for delivering the aqueous composition to
the host, e.g. a syringe etc., where the delivery means may or may
not be pre-loaded with the aqueous composition. In cases were the
reporter gene is transcribed in vivo from a DNA, RNase inhibitor
and competitor RNA are not required.
[0128] In addition to the above components, the subject kits will
further include instructions for practicing the subject methods.
These instructions may be present in the subject kits in a variety
of forms, one or more of which may be present in the kit. One form
in which these instructions may be present is as printed
information on a suitable medium or substrate, e.g. a piece or
pieces of paper on which the information is printed, in the
packaging of the kit, in a package insert, etc. Yet another means
would be a computer readable medium, e.g. diskette, CD, etc., on
which the information has been recorded. Yet another means that may
be present is a website address which may be used via the internet
to access the information at a removed site. Any convenient means
may be present in the kits.
[0129] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTAL
[0130] I. RNAi in Mammals
[0131] A. We co-delivered a 2 micrograms of plasmid that expresses
a luciferase mRNA (pCMVGL3) mixed with 1.8 ml PBS, 1200 units of
RNasin and 40 micrograms of competitor RNA along with the following
formulations:
[0132] 1) (Group 1 no RNA) 1.8 ml PBS as a untreated control;
[0133] 2) (Group 2 antisense RNA) 1.8 ml PBS mixed with 20
micrograms of antisense orientation 21 mer RNA/DNA chimera with the
sequence 5'-UCGAAGUACUCAGCGUAAGdTdT-3' (SEQ ID NO:01)
(deoxythymidilate residues are indicated by dT, the remaining
nucleotides are ribonucleotides); or
[0134] 3) (Group 3 RNAi) 1.8 ml PBS mixed with 20 micrograms of
antisense 21 mer described above annealed to 20 micrograms of its
sense complement (with sequence 5'-CUUACGCUGAGUACUUCGAdTdT-3')(SEQ
ID. NO:02).
[0135] The oligonucleotides were kinased using adenosine
triphosphate and T4 polynucleotide kinase. Each formulation (1-3)
was tested by high pressure tail vein injection in 5 week old
female Balb/c mice. At 5, 72 and 96 hours post injection, light
emitted as a result of luciferase expression was measured as
described above. The results of this experiment are summarized in
the table below. Numbers expressed as relative light units.
1 Group 1 Group 2 Group 3 Group 1 standard Group 2 standard Group 3
standard no RNA error Antisense error RNAi error 3 hours 1.11
.times. 10.sup.9 2.05 .times. 10.sup.8 1.29 .times. 10.sup.9 7.90
.times. 10.sup.7 7.90 .times. 10.sup.8 3.54 .times. 10.sup.7 72
hours 6.60 .times. 10.sup.6 7.57 .times. 10.sup.5 5.41 .times.
10.sup.6 9.91 .times. 10.sup.5 8.23 .times. 10.sup.5 2.86 .times.
10.sup.5 96 hours 3.41 .times. 10.sup.6 4.50 .times. 10.sup.5 2.72
.times. 10.sup.6 5.25 .times. 10.sup.5 4.61 .times. 10.sup.5 6.77
.times. 10.sup.4
[0136] The above results demonstrate that RNAi (group 3) caused the
destruction of luciferase RNA in the liver of an adult mammal. This
destruction resulted in a decrease in light emitted as a result of
luciferase activity when compared to animals that received no RNA
or antisense oligonucleotide alone. To our knowledge, this is the
first demonstration that RNAi is effective in an adult mammal. This
method provides a model system to study the mechanism by which RNAi
functions in a mammal. It is also useful for the development and
optimization of RNAi based therapeutics. Furthermore, one need not
codeliver the expression plasmid with the modulating agent. One
could also deliver a modulating agent targeting an endogenous
gene.
[0137] B. Here, we test the ability of RNAi to suppress gene
expression in adult mammals. We find that synthetic small
interfering RNAs (siRNAs) are potent inhibitors of gene expression
in vivo. Furthermore, small-hairpin RNAs (shRNAs) are similarly
effective. Notably, these RNAi agents can be delivered either as
synthetic RNAs or transcribed in vivo from DNA expression
constructs. These studies indicate that RNAi can be developed as a
therapeutic tool and demonstrate that it can be employed with
conventional gene-therapy strategies.
[0138] 1. siRNAs
[0139] We modified existing hydrodynamic transfection methods J.
Chang, L. J. Sigal, A. Lerro, J. Taylor, J Virol 75, 3469-73.
(2001)) to permit efficient delivery of naked RNAs. Either an siRNA
derived from firefly luciferase or an unrelated siRNA were
co-injected with a luciferase expression plasmid (construct
description in FIG. 1). Luciferase expression was monitored in
living animals using quantitative whole body imaging following
injection of a luciferase substrate (4) and was dependent on the
amount of reporter plasmid injected and the time after transfection
(data not shown). Representative animals are shown in FIG. 2A.
Quantification of these results is shown in FIG. 2B.
[0140] In each experiment, serum measurements of a co-injected
plasmid encoding human .alpha.-1 antitrypsin (hAAT) (S. R. Yant, et
al., Nat Genet 25, 35-41. (2000)) served as an internal control to
normalize transfection efficiency and to monitor non-specific
translational inhibition. Average serum hAAT levels at 74 hours
were similar in each group of animals.
[0141] Our results indicate specific siRNA-mediated inhibition of
luciferase expression in adult mice (p<0.0115); unrelated siRNAs
were without effect (p<0.864). In 11 independent experiments,
luciferase siRNAs reduced luciferase expression (emitted light) by
an average of 81% (+/-2.2%).
[0142] 2. shRNA
[0143] Short hairpin RNAs (shRNAs) targeting firefly luciferase of
renilla luciferase were synthesized by T7 polymerase in vitro
runoff transcription. Co-transfection of these in vitro transcribed
RNAs with pGL3-Control DNA resulted in reduced firefly luciferase
expression in culture (Paddison et al, Genes Dev. 16(8):948-58
(2002)). In order to test whether these hairpin RNAs were
functional in mice, we hydrodynamically transfected 40 .mu.g of in
vitro transcribed luciferase shRNA (or as a control, renilla
shRNA), 2 .mu.g pGL3-Control DNA 2 .mu.g pThAAT, 800 units of
RNasin and 1.8 ml of PBS into mice. Light emitted from mice 72
hours after receiving firefly luciferase shRNAs was reduced by an
average of 95% (+/-1.4%) compared to the untreated control. Light
emitted from mice receiving the renilla shRNA was reduced only
slightly. Surprisingly, co-transfection of T7 transcription
template DNA with a plasmid expressing the T7 polymerase protein
did not lead to any reduction in luciferase reporter activity in
culture or in mice (data not shown).
2 Firefly Luciferase shRNA sequence (from 5' to 3')
GGUCGAAGUACUCAGCGUAAGUGAUGUCCACUUAAGUGGGUGUUGUUUGUG (SEQ ID NO:11)
UUGGGUGUUUUGGUU Renilla Luciferase shRNA sequence (from 5' to 3')
GGGAUGGACGAUGGCCUUGAUCUUGUUUACCGUCACACCCACCACUGGGAG (SEQ ID NO:12)
AUACAAGAUCAAGGCCAUCGUCUUCCU
[0144] The above results demonstrate that short in vitro
transcribed hairpins also reduced luciferase expression in
vivo.
3. Conclusion
[0145] The above data demonstrate that RNAi can downregulate gene
expression in adult mice.
[0146] C. Hepatitis C virus (HCV) is an RNA virus that infects 1
out of 40 people worldwide and is the most common underlying cause
for liver transplantation in the western world. To determine
whether RNAi could be directed against a human pathogen, several
siRNAs were tested for their ability to target HCV RNAs in mouse
liver. We used a reporter strategy in which HCV sequences were
fused to luciferase RNA and RNAi was monitored by co-transfection
in vivo. siRNAs targeting the HCV internal ribosome entry site and
core protein coding region failed to inhibit luciferase expression.
In contrast, siRNAs targeting the NS5B region of a chimeric HCV
NS5B protein-luciferase fusion RNA reduced luciferase expression by
75% (+/-6.8%).
[0147] These results indicate the utility of using RNAi
therapeutically to target important human pathogens.
[0148] D. From these data, it is clear that siRNAs are functional
in mice. Functional shRNAs, which are equally effective in inducing
gene suppression, can be expressed in vivo from DNA templates using
RNA polymerase III promoters (Paddison et al., submitted).
Expression of a cognate shRNA (pShh1-Ff1) induced up to a 98%
(+/-0.6%) suppression of luciferase expression, with an average
suppression of 92.8% (+/-3.39%) in three independent experiments
(FIGS. 2C and 2D). An empty shRNA-expression vector had no effect
(data not shown). Furthermore, reversing the orientation of the
shRNA (pShh1-Ff1 rev) insert abolished silencing, due to altered
termination by RNA polymerase III and consequent production of an
improperly structured shRNA (Paddison et al., submitted). These
data indicate that plasmid-encoded shRNAs can induce a potent and
specific RNAi response in adult mice. Furthermore, it demonstrates
that this method of RNAi delivery can be tailored to take advantage
of the significant progress that has been made in the development
of gene-transfer vectors.
[0149] Existing gene therapy strategies depend largely upon the
ectopic expression of exogenous proteins to achieve a therapeutic
result. Since its discovery, RNAi has held the promise of
complementing these gain-of-function approaches by providing a
means for silencing disease-related genes. Considered together, our
results indicate that RNAi can be induced in adult mammals using
DNA constructs to direct the expression of small hairpin RNAs.
These studies demonstrate that the present invention provides viral
and non-viral delivery systems for application, of therapeutic RNAi
to a wide range of diseases.
[0150] II. Hydrodynamic Delivery of Naked RNA
[0151] A. Introduction
[0152] Unless otherwise noted, in all experiments RNAs and DNAs
were added to the indicated amount of RNasin and brought to a final
volume of PBS equal to 1.4-1.8 milliliters. This solution was
injected into the tail vain of the mice in 4-5 seconds. All RNAs
used in these studies were synthesized using an mMessage Machine
kit and purified using an RNeasy kit (both from Qiagen Inc.).
However, it should not be necessary to purify the RNA and other
purification methods exist that should also work. RNasin used in
all the experiments listed here was native RNasin purified from
human placenta unless otherwise indicated (purchased from Promega
Inc.). For luciferase samples, at the indicated time, mice were
given an intraperitoneal injection of luciferin (1.5
micrograms/gram body weight) and the light emitted from the mouse
was measured. Background is .about.2.times.10.sup.2 relative light
units. Human factor IX samples were analyzed using an enzyme linked
immunoassay.
[0153] B. Hydrodynamic Delivery of Naked RNA
[0154] RNAs coding for luciferase protein were injected into living
mice with:
[0155] 1) no RNase inhibitor; or
[0156] 2) RNase inhibitor (called RNasin).
[0157] All RNA samples also contained an uncapped unpolyadenylated
RNA (competitor RNA) that was included as a competitive inhibitor
of RNase activity. Total RNA in each sample was adjusted to a total
of 80 micrograms with competitor RNA. As a negative control
(described below) DNAs expressing the luciferase protein under the
control of a prokaryotic promoter were also injected. At 3 and 6
hours mice were given an intraperitoneal injection of luciferin
(the substrate for the luciferase enzyme) and the light emitted
from the mouse was measured.
[0158] Results summarized in Table 1
3TABLE 1 Number Nucleic of Mice Relative Light Units Acid Used (N)
Formulation (RLU/ 5 min) Poly A RNA 1 4 units of RNasin 10 .times.
10.sup.6 Poly A RNA 1 400 units of RNasin 2.0 .times. 10.sup.7 Poly
A signal 1 4 units of RNasin 7.2 .times. 10.sup.4 RNA Template DNA
1 none signal at background
[0159] The above results show that:
[0160] Injected RNA is transfected into the liver of living
mice.
[0161] Capped polyadenylated RNA with a poly A tail (Poly A RNA) is
translated in mouse livers because capped polyadenylated RNA gives
a strong luciferase signal
[0162] Capped RNA with a poly A signal (Poly A signal RNA) is
translated in mouse livers but it gives a signal but it is about
100 fold lower than that seen with the RNA that has a poly A
tail
[0163] The RNAs used in all the experiments described here were
transcribed from a bacterial promoter on a DNA plasmid. This
promoter should not function efficiently in mammalian cells. The
DNA template was removed after transcription using a DNase, however
there is always the concern that the signal seen could be the
result of DNA contamination. To control for this, an amount of
template DNA equivalent to that used in the transcription was
injected. If the signal is due to DNA contamination then this
sample should give a signal. However, no signal is seen from the
DNA control.
[0164] It was also found that addition of an RNase inhibitor
(called RNasin) protects the RNA from degradation by serum
nucleases, thus increasing the observed signal, because addition of
RNasin increased the signal by 20 fold at the dose used.
[0165] From the above, the following conclusions are drawn.
Hydrodynamic delivery of naked RNA results in high level transfer
of RNA into the livers of living mice. Furthermore, capped and
polyadenylated RNA works better than RNA with a polyadenylation
signal but no poly A tail, although both RNAs gave a signal.
Addition of an RNase inhibitor protected the RNA from degradation,
resulting in a higher luciferase signal. Finally, the signal seen
with the injected RNA is not due to DNA contamination.
[0166] C. Refinement of System
[0167] RNAs coding for luciferase protein were injected into living
mice with 1) high or low doses of native or recombinant RNasin or
2) after treatment with RNase T1 which should destroy the RNA and
abolish the signal (negative control). All RNA samples also
contained an uncapped unpolyadenylated competitor RNA such that the
total amount of RNA injected was 80 micrograms. Control DNAs
expressing the luciferase protein under the control of a
prokaryotic promoter were also injected in indicated control
reactions. At 3 and 6 hours mice were given an intraperitoneal
injection of luciferin and the light emitted from the mouse was
measured. This experiment is largely to verify the results of the
first experiment and to test which parameters are important. At the
six hour timepoint, one mouse that had been injected with RNA was
sacrificed and its organs were removed to determine which organs
express luciferase.
[0168] The results are summarized in Table 2
4TABLE 2 micro- Relative Light Relative Light Relative Light grams
Number Units (RLU/5 Units (RLU/5 Units (RLU/5 Nucleic Acid of RNA
of Mice min) min) min) Used or DNA (N) Formulation 3 hours 6 hours
24 hours Poly A RNA 35 1 240 units 1.8 .times. 10.sup.5 1.1 .times.
10.sup.6 Background RNasin Native Poly A RNA 50 1 240 units 1.6
.times. 10.sup.5 5.4 .times. 10.sup.5 Background RNasin Native Poly
A RNA 50 1 44 units 5.5 .times. 10.sup.4 1.9 .times. 10.sup.5
RNasin Native Poly A RNA 10 1 240 units 7.7 .times. 10.sup.4 1.8
.times. 10.sup.5 RNasin Recombinant Poly A RNA 50 2 3000 units
Background Background RNase T1 Template 2 1 none Background
Background DNA
[0169] The above results demonstrate that:
[0170] The dose of RNasin alters the level of expression seen
because increasing doses of RNasin lead to increased levels of
luciferase activity.
[0171] Both native and recombinant RNasin both protect the RNA.
[0172] When the RNA is destroyed with RNase, the signal is
abolished, demonstrating that the RNA is responsible for the signal
(negative control).
[0173] When an amount of template DNA equivalent to that used in
the transcription is injected without DNase treatment, no signal is
seen, demonstrating that the signal is not due to DNA
contamination.
[0174] Liver is the only site of luciferase expression.
[0175] From the above, the following conclusions are drawn. RNasin
dose effects the level of expression. Both recombinant and native
RNasin protect the injected RNA. No signal was seen when template
DNA was injected or when RNA was destroyed with RNase,
demonstrating that signal is not the result of DNA contamination.
Finally, liver is the only site of luciferase expression.
[0176] D. Competitor RNA Enhances the Activity.
[0177] Luciferase activity from 20 micrograms of capped and
polyadenylated luciferase RNA was measured. Four conditions were
tested in experiments similar to those described in experiments 1
and 2:
[0178] 1) 400 units of RNasin+competitor RNA;
[0179] 2) 40 units of RNasin with no competitor RNA;
[0180] 3) 800 units of RNasin with no competitor RNA;
[0181] 4) 1200 units of RNasin with no competitor RNA.
[0182] At 3, 6 and 9 hours mice were given an intraperitoneal
injection of luciferin and the light emitted from the mouse was
measured.
[0183] The results are summarized in Table 3.
5 TABLE 3 Micro-grams Number Average Average Average Competitor
Units of of Mice (RLU/2 min) (RLU/2 min) (RLU/2 min) RNA RNasin (N)
3 hours 6 hours 9 hours RLU 60 400 3 7.6 .times. 10.sup.4 1.7
.times. 10.sup.4 3.5 .times. 10.sup.3 standard 3.5 .times. 10.sup.4
4.2 .times. 10.sup.3 9.6 .times. 10.sup.2 error RLU None 400 3 6.5
.times. 10.sup.3 4.2 .times. 10.sup.3 2.6 .times. 10.sup.3 standard
1.4 .times. 10.sup.3 2.8 .times. 10.sup.3 1.7 .times. 10.sup.3
error RLU None 800 3 6.2 .times. 10.sup.3 8.7 .times. 10.sup.3 2.0
.times. 10.sup.3 standard 3.1 .times. 10.sup.4 2.5 .times. 10.sup.3
3.7 .times. 10.sup.2 error RLU None 1200 3 7.6 .times. 10.sup.4 2.2
.times. 10.sup.4 7.4 .times. 10.sup.3 standard 5.4 .times. 10.sup.4
1.6 .times. 10.sup.4 4.5 .times. 10.sup.3 error
[0184] The above results demonstrate that:
[0185] RNasin dose alters the luciferase activity because
increasing doses of RNasin lead to increasing luciferase activity.
The highest dose (1200 units of RNasin) gave the highest activity
at all times tested.
[0186] The addition of competitor RNA enhanced the measured
luciferase activity, because presence of the competitor RNA
enhanced the luciferase activity. This effect was synergistic with
the protective effect of the RNasin.
[0187] From the above results, the following conclusions are drawn.
Addition of competitor RNA increases luciferase signal.
Furthermore, increasing doses of RNasin lead to increasing levels
of luciferase activity
[0188] E. Cap Independent Translation of Luciferase Using an
Internal Ribosome Entry Site.
[0189] In Eukaryotes, translation of RNAs into protein occurs by
two different mechanisms called cap dependent and cap independent
translation. Cap independent translation requires a 5'
nontranslated region called an internal ribosome entry site (IRES).
Several RNA viruses, such as hepatitis C virus (HCV), polio virus
and hepatitis A utilize IRES sequences to carry out cap independent
translation. We originally developed the RNA transfection method
described here with the idea that it could be used to make a small
animal model system for studying anti-HCV therapeutics.
Transfection with IRES RNAs could also be used for mutagenesis
studies designed to investigate sequence elements necessary for
efficient IRES function.
[0190] 1. Description of Experiment and Results:
[0191] The RNA HCVluc has the HCV IRES at the 5' end and the
luciferase gene followed by a poly A tail. 40 micrograms of
HCVluc+40 micrograms of competitor RNA+20 microliters of RNasin
were injected into the tail vain of the mice. At 3 and 6 hours mice
were given an intraperitoneal injection of luciferin and the light
emitted from the mouse was measured. Result: The HCV IRES was able
to drive translation of the injected HCV luciferase RNA fusion.
Quantitation of the results is summarized in Table 4.
6 TABLE 4 3 hours post injection 6 hours post injection Average
Relative Light 1.7 .times. 10.sup.5 4.6 .times. 10.sup.4 Units
Standard Error 7.4 .times. 10.sup.4 1.6 .times. 10.sup.4
[0192] F. Measurable serum concentrations of human factor IX (hFIX)
protein can be produced and secreted upon injection of hFIX
RNA.
[0193] Human factor IX protein is a blood clotting protein that is
not produced by some patients with hemophilia. The levels of this
protein in serum can be easily measured using an enzyme linked
immunoassay (ELISA). We chose to express this protein for two
reasons:
[0194] 1). hFIX is a therapeutically relevant protein. Although
transient expression of hFIX is not clinically relevant, it would
be desirable to transiently express some other types of therapeutic
proteins that do not require chronic expression.
[0195] 2) hFIX is a human protein and is thus capable of eliciting
an immune response in mice.
[0196] One application of RNA injection is in the development and
testing of vaccines. An immune response to hFIX upon injection of
hFIX RNA would demonstrate the proof of principle of using RNA as a
vaccine.
[0197] 1. Description of Experiment and Results:
[0198] 40 micrograms of capped and polyadenylated hFIX RNA+40
micrograms of competitor RNA+800 units of RNasin were injected by
tail vain into 1 mouse. Result: 40 nanograms/milliliter of serum
were detected by ELISA at 6 hours. This amount of hFIX is within
the significant range of the ELISA assay.
[0199] G. Hydrodynamic Delivery of HCV Genomic RNAs to Create an
HCV Mouse Model
[0200] Two groups of 6 mice were injected with:
[0201] 1) 50 micrograms of capped HCV full length genomic RNA
called 90 FL HCV (which also contains some uncapped RNA)+40
micrograms of capped and polyadenylated hFIX RNA+400 units of
RNasin; or
[0202] 2) a full length non-infectious HCV genomic RNA that has a
mutation in the replicase gene that makes it catalytically inactive
(called 101 FL HCV)+40 micrograms of capped and polyadenylated hFIX
RNA+400 units of RNasin.
[0203] The transcription templates for making the HCV RNAs were
obtained from Charles Rice and Washington University. Six hours
after injection the mice were bled and hFIX levels are being
measured to normalize for injection efficiency. The injected HCV
RNAs are expected to degrade rapidly. Any RNA detected after a few
days is likely to be RNA newly synthesized during viral
replication. A quantitative real time PCR method has been developed
to measure the levels of HCV RNA in the livers of these mice. If
replication of the virus occurs, then the levels of HCV RNAs in the
mice injected with 90 FL HCV will be greater than the levels in
mice injected with 101 FL HCV when measured weeks after injection.
A histological assay is also being developed in order to assay for
the synthesis of HCV proteins. Three different positive outcomes
are possible 1) The RNA enters the liver but is not translated and
does not replicate 2) the RNA enters the liver and is translated
but does not replicate 3) the RNA enters the liver, is translated
and replicates. All three outcomes are useful model systems. If 1,
2 or 3 occurs then this system could be used to test ribozymes
directed against HCV RNAs (see experiment 9 below). If 2 or 3
occurs then, the this system could be used to test inhibitors of
HCV translation, replication and infection.
[0204] Injection of this RNA did not result in a viral replication
cycle for HCV. However, another group has used a similar method to
initiate a hepatitis delta replication cycle. See Chang J, Sigal L
J, Lerro A, Taylor J., J Virol.75(7):3469-73 (2001).
[0205] H. In vivo Cleavage of HCV RNAs by Ribozymes
[0206] DNAzymes targeting the IRES of HCV have been chemically
synthesized. We hydrodynamically injected these ribozymes into mice
and assessed their ability to decrease the levels of injected HCV
RNAs within the liver. Five nanomoles of DNAzyme targetting the
IRES was coinjected with 20 .mu.g of an RNA comprised of the HCV
IRES followed by the firefly luciferase coding sequence followed by
30 adenosines. The sequence of the DNAzyme was
5'-GAGGTTTAGGAGGCTAGCTACAACGATCGTGCTCA-3' (SEQ ID NO:013). Mice
that received the DNAzyme in combination with the target RNA
emitted 95% less light at 6 hours than mice that received the
target RNA alone. Conclusion: We demonstrated that this DNAzyme can
inhibit translation from the HCV IRES, presumably by cleaving the
IRES RNA sequence. Synthetic ribozymes were also tested using an
analogous methodology and were found to be ineffective.
[0207] I. This experiment is to do a timecourse of luciferase
expression after a single injection of capped and polyadenylated
RNA. If the following condition is met, then we can use a first
order exponential decay fit (described by Equation 1) of the data
to calculate the degradation rate of the expressed protein. In
order for this data to be fit to a simple first order exponential
decay, the half life of the mRNA must be significantly less than
the halflife of the protein (at least 5-10 fold less). If this
condition is not met, then a more complex mathematical relationship
that takes into account the halflife of the mRNA can be used.
Another solution to this problem is to decrease the half life of
the mRNA by making it uncapped or omiting the competitor RNA.
[0208] If we define the amount of protein at a given time (or the
signal from the protein) as A, the amount of protein (or signal) at
the first timepoint as Ao, the decay rate constant as k and time
after the first measurement as t, the equation would be of the
form:
A=Ao exp.sup.(-kt) (Equation 1)
[0209] 1. Description of the Experiment:
[0210] Four groups of 6 mice were injected with 20 micrograms of
capped polyadenylated luciferase RNA+60 micrograms of uncapped
competitor RNA+800 units of RNasin. At 3, 6, 9 or 24 hours, the
mice were given an intraperitoneal injection of luciferin (1.5
micrograms/gram body weight) and the light emitted from the mouse
was measured.
[0211] The results are provided in the table below:
7 Hours Post Light Units Standard Standard Error 1 3.000 530000.000
330000.000 150000.000 2 6.000 200000.000 88000.000 36000.000 3
9.000 110000.000 43000.000 18000.000 4 24.000 1900.000 1100.000
440.000
[0212] Relative light units were plotted vs. time and the resulting
curve is fit to Equation 1. This analysis yields an apparent
degradation rate consant of 0.297 hour.sup.-1.
[0213] The most common method for measuring a half-life of a
protein is the following. In one approach, the protein is purified
and sometimes labeled (for example with radioactive iodine). The
purified protein is injected and at different times the animal is
sampled and the amount of protein remaining at any given time is
plotted vs. time and the curve is fit to an equation such as
Equation 1. The advantage of our method is that it does not require
the in vitro synthesis or purification of the protein.
[0214] J. We have constructed RNAs that contain regulatory regions
of the HCV RNA controlling the translation of a protein called
luciferase (referred to here as HCV luc RNA). We have also
constructed DNA expression plasmids that express similar RNAs once
they enter cells (referred to here as HCV luc DNA). See FIG. 3 for
diagrams of these constructs.
[0215] When either the HCV luc RNAs or the HCV luc DNAs are
transfected into mice, they go to the liver and HCV luc RNAs or
RNAs transcribed from the HCV luc DNAs are translated into
luciferase protein. At various times, the substrate of the
luciferase protein, luciferin, is injected into the mice. The
enzyme luciferase consumes the luciferin and makes light in the
process. The amount of light emitted from the mice is proportional
to the amount of luciferase protein present at the time of the
sampling.
[0216] We have synthesized short synthetic oligonucleotides of a
type known as Morpholino oligos. We mixed 1 nanomol of a morpholino
oligo with 10 micrograms of HCV luc RNA or 1 microgram of HCV luc
DNA. The morpholino oligo was made by Gene Tools, LLC in Corvallis,
Oreg. and has the sequence 5'-TCTTTGAGGTTTAGGATTCGTGCTC-3' (SEQ ID
NO:14). This mixture is then added to 1.8 milliliters of buffer and
injected under high pressure into the tail veins of mice as
described in our previous application. As a control, mixtures that
do not contain the inhibitor are injected into other mice. In the
presence of inhibitor, emitted light is reduced by more than 90%.
We conclude from this finding that translation of the injected RNA
or translation of the RNA produced from the injected DNA is
prevented by the inhibitor by an antisense mechanism. In the case
of the injected RNA we can only follow this inhibition for about 24
hours, because of the limited stability of the RNA in cells. In the
case of the injected DNA, we can monitor translation for about 8
days. The translational inhibition lasted for the whole duration of
the time we could measure translation in this system.
[0217] K.
[0218] Experiment A
[0219] control group: RNAs containing the HCV IRES and a luciferase
reporter sequence are injected into mice and they glow when this
RNA is translated into luciferase protein
[0220] Test group:
[0221] Coinject inhibitor with RNA. Both go to the same cells.
Inhibition is expressed as activity (glowing) compared to control
group.
[0222] Experiment B
[0223] Same as experiment A except we inject a DNA that encodes the
target RNA along with the inhibitor. The DNA goes to the nucleus of
the mouse hepatocytes and is transcribed to give the target RNA.
This RNA goes to the cytoplasm of the cells where it interacts with
the inhibitor.
[0224] The constructs employed in these experiments are provided in
FIG. 4. The results of these experiments with antisense and DNAzyme
inhibitors are provided in FIGS. 5A to 5F.
[0225] The above screening protocol in which the inhibitor and
RNA/DNA are coadministered offers important advantages in terms of
allowing one to separate issues of drug delivery from issues of
drug efficacy.
[0226] It is evident from the above results and discussion that the
subject invention provides a viable way of using RNAi agents in
non-embryonic mammalian organisms, where the subject methods and
compositions can be employed for a variety of different academic
and therapeutic applications. In addition, the subject invention
provides an improved method of transferring a nucleic acid into a
target cell is provided by the subject invention. Specifically, the
subject invention provides for a highly efficient in vivo method
for naked nucleic acid transfer which does not employ viral vectors
and therefore provides many advantages over prior art methods of
nucleic acid transfer. As such, the subject invention represents a
significant contribution to the art.
[0227] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present invention is not entitled to antedate such publication by
virtue of prior invention.
[0228] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
Sequence CWU 1
1
14 1 21 RNA Artificial Sequence oligonucleotide 1 ucgaaguacu
cagcguaagu u 21 2 21 RNA Artificial Sequence oligonucleotide 2
cuuacgcuga guacuucgau u 21 3 21 RNA Artificial Sequence
oligonucleotide 3 cuuacgcuga guacuucgau u 21 4 21 RNA Artificial
Sequence oligonucleotide 4 uugaaugcga cucaugaagc u 21 5 21 RNA
Artificial Sequence oligonucleotide 5 agcuucauaa ggcgcaugcu u 21 6
21 RNA Artificial Sequence oligonucleotide 6 uuucgaagua uuccgcguac
g 21 7 23 RNA Artificial Sequence oligonucleotide 7 cugugagauc
uacggagccu guu 23 8 23 RNA Artificial Sequence oligonucleotide 8
uugacacucu agaugccucg gac 23 9 33 RNA Artificial Sequence
oligonucleotide 9 ggauuccaau ucagcgggag ccaccugaug aag 33 10 36 RNA
Artificial Sequence oligonucleotide 10 uaaccuaagg uugagucgcu
cucggugggc uaguuc 36 11 66 RNA Artificial Sequence oligonucleotide
11 ggucgaagua cucagcguaa gugaugucca cuuaaguggg uguuguuugu
guuggguguu 60 uugguu 66 12 78 RNA Artificial Sequence
oligonucleotide 12 gggauggacg auggccuuga ucuuguuuac cgucacaccc
accacuggga gauacaagau 60 caaggccauc gucuuccu 78 13 35 DNA
Artificial Sequence oligonucleotide 13 gaggtttagg aggctagcta
caacgatcgt gctca 35 14 25 DNA Artificial Sequence oligonucleotide
14 tctttgaggt ttaggattcg tgctc 25
* * * * *