U.S. patent application number 10/154206 was filed with the patent office on 2003-08-14 for compositions and methods for random nucleic acid molecules.
This patent application is currently assigned to Stratagene. Invention is credited to Cline, Janice M., Hogrefe, Holly H..
Application Number | 20030152944 10/154206 |
Document ID | / |
Family ID | 23132994 |
Filed Date | 2003-08-14 |
United States Patent
Application |
20030152944 |
Kind Code |
A1 |
Hogrefe, Holly H. ; et
al. |
August 14, 2003 |
Compositions and methods for random nucleic acid molecules
Abstract
The invention relates to compositions and methods for nucleic
acid PCR mutagenesis using novel error-prone DNA polymerases and a
PCR enhancing factor. The invention also relates to compositions
and methods for nucleic mutagenesis with two or more DNA
polymerases lacking or exhibiting reduced exonuclease activity. The
invention further relates to kit format of said compositions for
PCR mutagenesis.
Inventors: |
Hogrefe, Holly H.; (San
Diego, CA) ; Cline, Janice M.; (San Marcos,
CA) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS / STR
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Assignee: |
Stratagene
|
Family ID: |
23132994 |
Appl. No.: |
10/154206 |
Filed: |
May 23, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60294341 |
May 30, 2001 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.1; 435/91.2 |
Current CPC
Class: |
C12N 15/102
20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
1. A composition for PCR mutagenesis comprising an archaeal exo-
DNA polymerase which substantially lacks 3' to 5' exonuclease
activity, and PCR enhancing factor.
2. The composition of claim 1, wherein said archaeal exo- DNA
polymerase is selected from the group consisting of: exo-Tli DNA
polymerase, exo- Pfu DNA polymerase, exo- KOD DNA polymerase, exo-
JDF-3 DNA polymerase, and exo-PGB-D DNA polymerase.
3. The composition of claim 1, further comprising one or more DNA
polymerases selected from the group consisting of Taq DNA
polymerase, Tth DNA polymerase, UlTma DNA polymerase, exo-Tli DNA
polymerase, exo- Pfu DNA polymerase, exo- Tma DNA polymerase, exo-
KOD DNA polymerase, exo- JDF-3 DNA polymerase, and exo-PGB-D DNA
polymerase, wherein said one or more DNA polymerases are different
from said archaeal DNA polymerase.
4. The composition of claim 1, 2, or 3, further comprising a PCR
buffer useful for generating a mutated amplified product at a given
mutation frequency.
5. The composition of claim 4, wherein said PCR buffer lacks
Mn.sup.2+.
6. The composition of claim 1, 2, or 3, further comprising
equivalent molar amounts of dATP, dTTP, dGTP, and dCTP.
7. A kit for PCR mutagenesis comprising an archaeal exo- DNA
polymerase, PCR enhancing factor, and packaging means therefor.
8. The kit of claim 7, wherein said archaeal exo- DNA polymerase is
selected from the group consisting of: exo-Tli DNA polymerase, exo-
Pfu DNA polymerase, exo- Tma DNA polymerase, exo- KOD DNA
polymerase, exo- JDF-3 DNA polymerase, and exo- PGB-D DNA
polymerase.
9. The kit of claim 7, further comprising one or more polymerases
selected from a group consisting of Taq DNA polymerase, Tth DNA
polymerase, UlTma DNA polymerase, exo-Tli DNA polymerase, exo- Pfu
DNA polymerase, exo-Tli DNA polymerase, exo- Tma DNA polymerase,
exo- KOD DNA polymerase, exo- JDF-3 DNA polymerase, and exo-PGB-D
DNA polymerase, wherein said one or more DNA polymerases are
different from said archaeal DNA polymerase.
10. The kit of claim 7, 8, or 9, further comprising a PCR buffer
useful for generating a mutated amplified product at a given
mutation frequency.
11. The kit of claim 10, wherein said PCR buffer lacks
Mn.sup.2+.
12. The kit of claim 7, 8, or 9, further comprising equivalent
molar amounts of dATP, dTTP, dGTP, and dCTP.
13. A method of PCR amplification for mutagenesis comprising
incubating a reaction mixture comprising a nucleic acid template,
at least two PCR primers, an archaeal exo- DNA polymerase, and PCR
enhancing factor under conditions which permit amplification of
said nucleic acid template by said archaeal exo- DNA polymerase to
produce a mutated amplified product.
14. The method of claim 13, wherein said archaeal exo- DNA
polymerase is selected from the group consisting of: Taq DNA
polymerase, Tth DNA polymerase, UlTma DNA polymerase, exo-Tli DNA
polymerase, exo- Pfu DNA polymerase, exo- Tma DNA polymerase, exo-
KOD DNA polymerase, exo- JDF-3 DNA polymerase, and exo-PGB-D DNA
polymerase.
15. The method of claim 13, wherein said incubating step further
comprises incubating one or more exo- DNA polymerases selected from
a group consisting of: Taq DNA polymerase, Tth DNA polymerase,
UlTma DNA polymerase, exo-Tli DNA polymerase, exo- Pfu DNA
polymerase, exo-Tli DNA polymerase, exo- Tma DNA polymerase, exo-
KOD DNA polymerase, exo- JDF-3 DNA polymerase, and exo-PGB-D DNA
polymerase in said reaction mixture, wherein said one or more DNA
polymerases are different from said archaeal DNA polymerase.
16. The method of claim 13, 14, or 15, wherein said incubating step
is performed in a PCR reaction buffer lacking Mn.sup.2+.
17. The method of claim 13, 14, or 15, wherein said incubating step
further comprises incubating equivalent molar amounts of dATP,
dTTP, dGTP, and dCTP.
18. The method of claim 13, wherein said incubating step generates
said mutated amplified product at a given mutation frequency using
a given amount of said nucleic acid template.
19. The method of claim 18, wherein a first said incubating step
generates a first said mutated amplified product at a first given
frequency using a first selected amount of said nucleic acid
template, and a second said incubating step generates a second said
mutated amplified product at a second given frequency using a
second selected amount of said nucleic acid template, wherein said
first incubating step and second incubating step comprise a single
buffer composition.
20. The method of claim 19, further comprising subsequently
repeating one or more additional said incubating step using a
portion of or the total amplified product of a preceding incubating
as template for a subsequent incubating step.
21. The method of claim 18, wherein said mutation frequency is
proportional to the amount of said nucleic acid template.
22. The method of claim 13, 14, or 15, wherein said incubating step
comprises 1 pg to 1 .mu.g of said nucleic acid template.
23. The method of claim 18, wherein said incubating produces said
mutated amplified product from said nucleic acid template at a
mutation frequency of 1,000 to 16,000 mutations or more per
10.sup.6 base pairs.
24. The method of claim 22, wherein said incubating comprises
10-100 ng of said nucleic acid template.
25. The method of claim 24, wherein said incubating produces said
mutated amplified product at a mutation frequency of 1,000 to 3,000
mutations per 10.sup.6 base pair.
26. The method of claim 22, wherein said incubating comprises 10 pg
to 10 ng of said nucleic acid template.
27. The method of claim 26, wherein said incubating produces said
mutated amplified product at a mutation frequency of 3,000 to 7,000
mutations per 10.sup.6 base pairs.
28. The method of claim 26, wherein said incubating produces said
mutated amplified product at a mutation frequency of 7,000 to
16,000 or more mutations per 10.sup.6 base pairs.
29. The method of claim 28, wherein one or more additional said
incubating steps are repeated subsequently using a portion of or
the total amplified product of a preceding incubating as template
for a subsequent incubating.
30. The method of claim 13, 14, or 15, wherein said incubating
comprises a nucleic acid template of 0.1 kb to 10 kb in length.
31. The method of claim 13, 14, or 15, wherein said incubating
produces amplified product at a yield of 0.5-10 .mu.g.
Description
RELATED APPLICATIONS
[0001] This application claims the priority of U.S. Serial No.
60/294,341, filed May 30, 2001, which is incorporated herein by
reference in its totality, including tables and drawings.
TECHNICAL FIELD
[0002] The invention relates to random nucleic acid mutagenesis
using exo- DNA polymerases.
BACKGROUND
[0003] PCR-based random mutagenesis is widely used for elucidating
structure-function relationships of proteins, and for improving
protein function (e.g., directed protein evolution) (Cadwell, R. C.
and Joyce, G. F. 1992. Randomization of genes by PCR mutagenesis.
PCR Methods Appl. 2:28-33; Leung, D. W., Chen, E., and Goeddel, D.
V. 1989. A method for random mutagenesis of a defined DNA segment
using a modified polymerase chain reaction. Technique 1:11-15). The
procedure involves amplifying a gene or portion of a gene under
mutagenic conditions, cloning the PCR fragments, and then screening
the resulting library for novel mutations that affect protein
activity (Melnikov, A. and Youngman, P. J. 1999. Random mutagenesis
by recombinational capture of PCR products in Bacillus subtilis and
Acinetobacter calcoaceticus. Nucleic Acids Res. 27:1056-1062; Wan,
L., Twitchett, M. B., Eltis, L. D., Mauk. A. G., and Smith, M.
1998. In vitro evolution of horse heart myoglobin to increase
peroxidase activity. Proc. Natl. Acad. Sci. U.S.A. 95:12825-12831;
You, L. and Arnold, F. H. 1996. Directed evolution of subtilisin E
in Bacillus subtilis to enhance total activity in aqueous
dimethylformamide. Protein Eng. 9:77-83). Mutations are
deliberately introduced during PCR through the use of error-prone
DNA polymerases and reaction conditions. To analyze
structure-function relationships, mutation rates of 1 mutation per
gene are desired to assess the contribution of individual amino
acids to protein function (Vartanian, J. P., Henry, M., and
Wain-Hobson, S. 1996. Hypermutagenic PCR involving all four
transitions and a sizeable proportion of transversions. Nucleic
Acids Res. 24:2627-2631). For directed evolution, mutagenesis rates
of 2 to 7 mutations per gene are considered the most effective for
creating mutant libraries and isolating proteins with enhanced
activities (Cherry, J. R. Lamsa, M. H., Schneider, P., Vind, J.,
Svendsen, A., Jones, A., and Pedersen, A.H. 1999. Directed
evolution of a fungal peroxidase. Nat. Biotechnol. 17:379-384;
Shafikhani, S., Siegel, R. A., Ferrari, E., and Schellenberger, V.
1997. Generation of large libraries of random mutants in Bacillus
subtilis by PCR-based plasmid multimerization. BioTechniques
23:304-310; Wan, L., Twitchett, M. B., Eltis, L. D., Mauk. A. G.,
and Smith, M. 1998. In vitro evolution of horse heart myoglobin to
increase peroxidase activity. Proc. Natl. Acad. Sci. U.S.A.
95:12825-12831; You, L. and Arnold, F. H. 1996. Directed evolution
of subtilisin E in Bacillus subtilis to enhance total activity in
aqueous dimethylformamide. Protein Eng. 9:77-83). Mutation rates
greater than 7 mutations per gene typically result in loss of
protein activity, although proteins with improved activities have
been successfully isolated from highly mutagenized libraries
exhibiting up to 20 mutations per gene (Daugherty, P. S., Chen, G.,
Iverson, B. L., and Georgiou, G. 2000. Quantitative analysis of the
effect of the mutation frequency on the affinity maturation of
single chain Fv antibodies. Proc. Natl. Acad. Sci. U.S.A.
97:2029-2034).
[0004] Conventional methods employ Taq DNA polymerase, as it lacks
proofreading activity and is inherently error prone. To achieve
useful mutation frequencies, the error rate of Taq (1 mutation per
.about.125,000 bases (Cline, J., Braman, J. C. and Hogrefe, H. H.
1996. PCR fidelity of Pfu DNA polymerase and other thermostable DNA
polymerases. Nucleic Acids Res. 24:3546-3551) is further increased
by employing PCR reaction buffers that contain Mn.sup.2+ and/or
unbalanced nucleotide concentrations (Cadwell, R. C. and Joyce, G.
F. 1992. Randomization of genes by PCR mutagenesis. PCR Methods
Appl. 2:28-33; Leung, D. W., Chen, E., and Goeddel, D. V. 1989. A
method for random mutagenesis of a defined DNA segment using a
modified polymerase chain reaction. Technique 1:11-15). In the
presence of 7 mM MgCl.sub.2, 0.5 mM MnCl.sub.2, 1mM dCTP and TTP,
and 0.2 mM dGTP and dATP, Taq incorporates 4.9 to 6.6 mutations per
kb per PCR (Cadwell, R. C. and Joyce, G. F. 1992. Randomization of
genes by PCR mutagenesis. PCR Methods Appl. 2:28-33; Shafikhani,
S., Siegel, R. A., Ferrari, E., and Schellenberger, V. 1997.
Generation of large libraries of random mutants in Bacillus
subtilis by PCR-based plasmid multimerization. BioTechniques
23:304-310). Under these conditions, mutational bias is regarded as
minimal or skewed to favor mutations at AT base pairs. Lower
mutation frequencies can be obtained by reducing MnCl.sub.2
concentration (1-2 mutations per kb), while higher mutation
frequencies (>6 mutations per kb) are achieved by performing
consecutive PCRs or by selectively increasing dGTP concentration
(Melnikov, A. and Youngman, P. J. 1999. Random mutagenesis by
recombinational capture of PCR products in Bacillus subtilis and
Acinetobacter calcoaceticus. Nucleic Acids Res. 27:1056-1062;
Nishiya, Y. and Imanaka, T. 1994. Alteration of substrate
specificity and optimum pH of sarcosine oxidase by random and
site-directed mutagenesis. Appl. Env. Microbiol. 60:4213-4215; You,
L. and Arnold, F. H. 1996. Directed evolution of subtilisin E in
Bacillus subtilis to enhance total activity in aqueous
dimethylformamide. Protein Eng. 9:77-83).
[0005] Although widely used, Taq-based methods exhibit significant
drawbacks that limit the utility of PCR random mutagenesis methods.
First, amplification under mutagenic conditions (Mn.sup.2+,
unbalanced nucleotide pools) reduces the activity of Taq and limits
random mutagenesis to DNA sequences less than 1-kb in length
(Leung, D. W., Chen, E., and Goeddel, D. V. 1989. A method for
random mutagenesis of a defined DNA segment using a modified
polymerase chain reaction. Technique 1: 11-15; Stemmer, W. P. 1994.
DNA shuffling by random fragmentation and reassembly: in vitro
recombination for molecular evolution. Proc. Natl. Acad. Sci. USA
91:10747-10751). Second, PCR products are amplified in lower yield
using mutagenic reaction conditions (Vartanian, J. P., Henry, M.,
and Wain-Hobson, S. 1996. Hypermutagenic PCR involving all four
transitions and a sizeable proportion of transversions. Nucleic
Acids Res. 24:2627-2631), which can reduce cloning efficiency and
library size. Third, preparing and using multiple buffers (varying
MnCl.sub.2 and dNTP concentrations) to construct a series of
libraries with different mutation frequencies is time-consuming and
can produce variable results. Finally, altering nucleotide ratios
to achieve high mutation frequencies (>6 mutations per kb) can
lead to strong bias in the types of mutations produced. For
example, selectively increasing dGTP concentration favors
AT.fwdarw.GC transitions, which accounted for 70% of all mutations
in one study (You, L. and Arnold, F. H. 1996. Directed evolution of
subtilisin E in Bacillus subtilis to enhance total activity in
aqueous dimethylformamide. Protein Eng. 9:77-83).
[0006] There is a need in the art for random mutagenesis of nucleic
acid longer than 1 kb. There is also a need to improve the yield of
the final mutated product to facilitate subsequent cloning of the
product. There is further a need for a novel error prone DNA
polymerase which minimizes mutation bias or produces a different
mutational bias than a given polymerase produces. Finally, there is
a need for a simplified PCR mutagenesis conditions to achieve
various mutation frequencies.
SUMMARY OF THE INVENTION
[0007] The invention is related to novel compositions and methods
for nucleic acid mutagenesis.
[0008] The invention provides a composition for PCR mutagenesis
comprising an archaeal exo- DNA polymerase which substantially
lacks 3' to 5' exonuclease activity, and PCR enhancing factor.
[0009] In a preferred embodiment, the archaeal exo- DNA polymerase
is selected from the group consisting of: exo-Tli DNA polymerase,
exo- Pfu DNA polymerase, exo- KOD DNA polymerase, exo- JDF-3 DNA
polymerase, and exo-PGB-D DNA polymerase.
[0010] The invention also provides a composition comprising an
archaeal exo- DNA polymerase, PCR enhancing factor, and one or more
DNA polymerases selected from the group consisting of Taq DNA
polymerase, Tth DNA polymerase, UlTma DNA polymerase, exo-Tli DNA
polymerase, exo- Pfu DNA polymerase, exo- Tma DNA polymerase, exo-
KOD DNA polymerase, exo- JDF-3 DNA polymerase, and exo-PGB-D DNA
polymerase, wherein said one or more DNA polymerases are different
from said archaeal DNA polymerase.
[0011] Preferably the compositions mentioned above herein further
comprise a PCR buffer useful for generating a mutated amplified
product at a given mutation frequency.
[0012] More preferably, the PCR buffer lacks Mn.sup.2+.
[0013] The compositions mentioned above-herein may further comprise
equivalent molar amounts of dATP, dTTP, dGTP, and dCTP.
[0014] The invention provides a kit for PCR mutagenesis comprising
an archaeal exo- DNA polymerase, PCR enhancing factor, and
packaging means therefore.
[0015] The invention further provides the above-mentioned kit,
further comprising one or more polymerases selected from a group
consisting of Taq DNA polymerase, Tth DNA polymerase, UlTma DNA
polymerase, exo-Tli DNA polymerase, exo- Pfu DNA polymerase,
exo-Tli DNA polymerase, exo- Tma DNA polymerase, exo- KOD DNA
polymerase, exo- JDF-3 DNA polymerase, and exo-PGB-D DNA
polymerase, wherein said one or more DNA polymerases are different
from said archaeal DNA polymerase.
[0016] The kits mentioned above-herein may further comprise a PCR
buffer useful for generating a mutated amplified product at a given
mutation frequency.
[0017] Preferably, the PCR buffer in the above mentioned kits lacks
Mn.sup.2+.
[0018] More preferably, the kits further comprise equivalent molar
amounts of dATP, dTTP, dGTP, and dCTP.
[0019] The invention provides a method of PCR amplification for
mutagenesis comprising incubating a reaction mixture comprising a
nucleic acid template, at least two PCR primers, an archaeal exo-
DNA polymerase, and PCR enhancing factor under conditions which
permit amplification of said nucleic acid template by said archaeal
exo- DNA polymerase to produce a mutated amplified product.
[0020] Preferably, the archaeal exo- DNA polymerase is selected
from the group consisting of: Taq DNA polymerase, Tth DNA
polymerase, UlTma DNA polymerase, exo-Tli DNA polymerase, exo- Pfu
DNA polymerase, exo- Tma DNA polymerase, exo- KOD DNA polymerase,
exo- JDF-3 DNA polymerase, and exo-PGB-D DNA polymerase.
[0021] The above-mentioned method, may further comprise incubating
one or more exo- DNA polymerases selected from a group consisting
of: Taq DNA polymerase, Tth DNA polymerase, UlTma DNA polymerase,
exo-Tli DNA polymerase, exo- Pfu DNA polymerase, exo-Tli DNA
polymerase, exo- Tma DNA polymerase, exo- KOD DNA polymerase, exo-
JDF-3 DNA polymerase, and exo-PGB-D DNA polymerase in said reaction
mixture, wherein said one or more DNA polymerases are different
from said archaeal DNA polymerase.
[0022] Preferably, said incubating step is performed in a PCR
reaction buffer lacking Mn.sup.2+.
[0023] Also preferably, said incubating step may further comprise
incubating equivalent molar amounts of dATP, dTTP, dGTP, and
dCTP.
[0024] Still preferably, said incubating step may generate said
mutated amplified product at a given mutation frequency using a
given amount of said nucleic acid template.
[0025] The method useful to the invention may comprise a first said
incubating step which generates a first said mutated amplified
product at a first given frequency using a first selected amount of
said nucleic acid template, and a second said incubating step which
generates a second said mutated amplified product at a second given
frequency using a second selected amount of said nucleic acid
template, wherein said first incubating step and second incubating
step comprise a single buffer composition.
[0026] The method of the invention may further comprise
subsequently repeating one or more additional said incubating step
using a portion of or the total amplified product of a preceding
incubating as template for a subsequent incubating step.
[0027] Preferably, the mutation frequency generated by the
incubating step is proportional to the amount of said nucleic acid
template.
[0028] The incubating step of the subject invention may comprise 1
pg to 1 .mu.g of said nucleic acid template, which may produce said
mutated amplified product from said nucleic acid template at a
mutation frequency of 1,000 to 16,000 mutations or more per
10.sup.6 base pair.
[0029] The incubating step of the subject invention may comprise
10-100 ng of said nucleic acid template, which may produce said
mutated amplified product at a mutation frequency of 1,000 to 3,000
mutations per 10.sup.6 base pair.
[0030] The incubating step of the subject invention may comprise 10
pg to 10 ng of said nucleic acid template, which may produce said
mutated amplified product at a mutation frequency of 3,000 to 7,000
mutations per 10.sup.6 base pair.
[0031] The incubating step of the subject invention may comprise 10
pg to 10 ng of said nucleic acid template, which may produce said
mutated amplified product at a mutation frequency of 7,000 to
16,000 or more mutations per 10.sup.6 base pair.
[0032] According to the instant invention, one or more additional
said incubating steps may be repeated subsequently using a portion
of or the total amplified product of a preceding incubating as
template for a subsequent incubating to generate a mutation
frequency of 7,000 to 16,000 or more mutations per 10.sup.6 base
pair.
[0033] The nucleic acid template of the instant invention may be
0.1 kb to 10 kb in length.
[0034] The method of the instant invention may produce an amplified
product at a yield of 0.5-10 .mu.g.
BRIEF DESCRIPTION OF DRAWINGS
[0035] FIG. 1 illustrates the relationship between error-prone PCR
yield and various amount of input DNA. Ethidium Bromide stained 1%
agarose gel shows amplification of LacZ plasmid with Mutazyme.
Amount of plasmid used is as follows: 1) 100 ng, 2) 10 ng, 3) 1 ng,
4) 100 pg, 5) 10 pg, 6) 1 pg, 7) 100 fg, 8) 1 ul of PCR #5 diluted
1:1000, 9) 1 ul of PCR #8 diluted 1:1000. Amount of DNA standard:
a) 100 ng, b) 200 ng, c) 500 ng, d) 1 ug, e) 2 ug. Marker (M) is
Stratagene's Kb ladder.
[0036] FIG. 2 shows the terminal extendase activity of DNA
polymerases. Extension reactions were carried out as described in
Example 6 in the presence of: a) 0 .mu.M dNTP, b) 200 .mu.M dATP,
c) 200 .mu.M dCTP, d) 200 .mu.M dGTP e) 200 .mu.M dTTP.
Autoradiogram is from a 6% CastAway gel.
[0037] FIG. 3 shows the relationship between phenotype (percent of
white colonies) and genotype (mutation frequency) in a lacZ assay
as described in Example 1.
[0038] FIG. 4 shows a lacZ assay with Mutazyme, PfuTurbo and Taq.
Amplification of 100 ng, 10 ng, 1 ng, 100 pg, and a double PCR from
lacZ was performed as described in Example 1. Mutazyme and PfuTurbo
were done in cPfu buffer. Taq2000 was done in standard Taq buffer
with balanced dNTPs. All polymerases were 2.5 units/reaction. The d
value was determined from the PCR yield from an Ethidium Bromide
stained gel using the Eagle Eye concentration program and the
equation on page 1. The % white colonies was determined with the
color-screening assay. At least 100 colonies were counted from each
data point. The equation shown is for the Mutazyme trendline.
[0039] FIG. 5 shows the relationship between duplications (d value)
and mutation frequency. All reactions were Mutazyme in cPfu buffer.
Conditions were as described in Example 1. The value for d was
calculated by estimating PCR yield from an EtBr stained agarose gel
and then using the equation shown on page 1. The value for mut/kb
was determined by sequencing. One data point (rectangle) is
amplification of 10 pg MMLV-RT and 3.2 kb of sequence from 6
clones. Amplification of 100 pg GFP (circle) is data from 4.5 kb
sequence of 6 clones. The rest of the data points (diamonds) are
from amplification of 1 pg-100 ng of lacZ. Each point is 0.8-5.3 kb
of sequence from 2-10 clones. The trendline and equation shown are
determined by the Excel program.
DETAILED DESCRIPTION OF THE INVENTION
[0040] I. Definitions
[0041] As used herein, "exonuclease" refers to an enzyme that
cleaves bonds, preferably phosphodiester bonds, between nucleotides
one at a time from the end of a nucleic acid. An exonuclease can be
specific for the 5' or 3' end of a DNA or RNA molecule, and is
referred to herein as a 5' to 3' exonuclease or a 3' to 5'
exonuclease. An exonulcease according to the invention is a 3' to
5' exonuclease which degrades nucleic acid by cleaving successive
nucleotides from the 3' end of the nucleic acid. During the
synthesis or amplification of a nucleic acid template, a DNA
polymerase with 3' to 5' exonuclease activity (exo+) has the
capacity of removing mispaired base (proofreading activity),
therefore is less error-prone than a DNA polymerase without 3' to
5' exonuclease activity (exo-). Wild type Tth DNA polymerase and
Taq DNA polymerase are exo- because thay do not have 3' to 5'
exonuclease activities, however, wild type Pfu DNA polymerase, E.
coli DNA polymerase I, T7 DNA polymerase, Tma DNA polymerase, Tli
DNA polymerase, KOD DNA polymerase, JDF DNA polymerse, and PGB-D
DNA polymerase are exo+ because they all have 3' to 5' exonuclease
activity. The exonuclease activity can be defined by methods well
known in the art. For example, one unit of exonuclease activity may
refer to the amount of enzyme required to cleave 1 .mu.g DNA target
in an hour at 37.degree. C.
[0042] As used herein, "nucleic acid polymerase" refers to an
enzyme that catalyzes the polymerization of nucleotides. Generally,
the enzyme will initiate synthesis at the 3'-end of the primer
annealed to a nucleic acid template sequence, and will proceed
toward the 5' end of the template strand. "DNA polymerase"
catalyzes the polymerization of deoxynucleotides. Known DNA
polymerases include, for example, Pyrococcus furiosus (Pfu) DNA
polymerase (Lundberg et al., 1991, Gene, 108:1), E. coli DNA
polymerase I (Lecomte and Doubleday, 1983, Nucleic Acids Res.
11:7505), T7 DNA polymerase (Nordstrom et al., 1981, J. Biol. Chem.
256:3112), Thermus thermophilus (Tth) DNA polymerase (Myers and
Gelfand 1991, Biochemistry 30:7661), Bacillus stearothermophilus
DNA polymerase (Stenesh and McGowan, 1977, Biochim Biophys Acta
475:32), Thermococcus litoralis (Tli) DNA polymerase (also referred
to as Vent DNA polymerase, Cariello et al., 1991, Nucleic Acids
Res, 19: 4193), 9.degree. Nm DNA polymerase (discontinued product
from New England Biolabs), Thermotoga maritima (Tma) DNA polymerase
(Diaz and Sabino, 1998 Braz J. Med. Res, 31:1239), Thermus
aquaticus (Taq) DNA polymerase (Chien et al., 1976, J. Bacteoriol,
127: 1550), Pyrococcus kodakaraensis KOD DNA polymerase (Takagi et
al., 1997, Appl. Environ. Microbiol. 63:4504), JDF-3 DNA polymerase
(Patent application WO 0132887), and Pyrococcus GB-D (PGB-D) DNA
polymerase (Juncosa-Ginesta et al., 1994, Biotechniques, 16:820).
The polymerase activity of any of the above enzyme can be
determined by means well known in the art. One unit of DNA
polymerase activity, according to the subject invention, is defined
as the amount of enzyme which catalyzes the incorporation of 10
mmoles of total dNTPs into polymeric form in 30 minutes at optimal
temperature (e.g., 72.degree. C. for Pfu DNA polymerase).
[0043] As used herein, "archaeal" refers to an organism or to a DNA
polymerase from an organism of the kingdom Archaea.
[0044] As used herein, "substantially lacks 3' to 5' exonuclease
activity" or "exonuclease deficient" refers to a DNA polymerase
which exhibits 3' to 5' exonuclease activity of less than 100 units
(U) per milligram (mg) of purified polymerase, preferably less than
50 U/mg, and more preferably less than 10 U/mg. Such an enzyme,
according to the invention, is referred to as an "exo-" enzyme. An
"exo-" enzyme may be made with abolished or reduced exonuclease
activity through deletions or point mutations of the polynucleotide
sequence encoding the exonuclease domain.
[0045] "exo-" DNA polymerases that are useful according to the
invention include exo- Pfu DNA polymerase (a mutant form of Pfu DNA
polymerase that substantially lacks 3' to 5' exonuclease activity,
Cline et al., 1996, Nucleic Acids Research, 24: 3546; U.S. Pat. No.
5,556,772; commercially available from Stratagene, La Jolla, Calif.
Catalogue #600163), exo- Tma DNA polymerase (a mutant form of Tma
DNA polymerase that substantially lacks 3' to 5' exonuclease
activity), exo- Tli DNA polymerase (a mutant form of Tli DNA
polymerase that substantially lacks 3' to 5' exonuclease activity;
New England Biolabs, (Cat #257)), exo- E. coli DNA polymerase (a
mutant form of E. coli DNA polymerase that substantially lacks 3'
to 5' exonuclease activity) exo-klenow fragment of E.col; DNA
polymerase I (Stratagene, Cat #600069), exo- T7 DNA polymerase (a
mutant form of T7 DNA polymerase that substantially lacks 3' to 5'
exonuclease activity), exo- KOD DNA polymerase (a mutant form of
KOD DNA polymerase that substantially lacks 3' to 5' exonuclease
activity), exo- JDF-3 DNA polymerase (a mutant form of JDF-3 DNA
polymerase that substantially lacks 3' to 5' exonuclease activity),
exo- PGB-D DNA polymerase (a mutant form of PGB-D DNA polymerase
that substantially lacks 3' to 5' exonuclease activity) New England
Biolabs, Cat. #259, Tth DNA polymerase, Taq DNA polymerase (e.g.,
Cat. Nos 600131, 600132, 600139, Stratagene La Jolla, Calif.);
UlTma (N-truncated) Thermatoga martima DNA polymerase; Klenow
fragment of DNA polymerase 1,9Nm DNA polymerase (discontinued
product from New England Biolabs, Beverly, Mass.), and "3'-5' exo
reduced" mutant (Southworth et al., 1996, Proc. Natl. Acad. Sci
93:5281).
[0046] As used herein, useful Taq DNA polymerase includes wild type
Taq DNA polymerase and mutant forms of Taq DNA polymerase with
reduced fidelity (e.g., Patel et al., 2001, J. Biol.Chem. 276:
5044, hereby incorporated by reference).
[0047] As used herein, a "PCR enhancing Turbo factor (Turbo
factor)" or a "Polymerase Enhancing Factor" (PEF) refers to a
complex or protein possessing nucleic acid polymerase enhancing
activity (Hogrefe, H., Scott, B., Nielson, K., Hedden, V., Hansen,
C., Cline, J., Bai, F., Amberg, J., Allen, R., Madden, M.(1997)
Novel PCR enhancing factor improves performance of Pfu DNA
polymerase. Strategies 10(3):93-96; and U.S. Pat. No. 6,183,997,
both of which are hereby incorporated as references). PEF, useful
in the present invention, comprises either P45 in native form (as a
complex of P50 and P45) or as a recombinant protein. In the native
complex of Pfu P50 and P45, only P45 exhibits PCR enhancing
activity. The P50 protein is similar in structure to a bacterial
flavoprotein. The P45 protein is similar in structure to dCTP
deaminase and dUTPase, but it functions only as a dUTPase
converting dUTP to dUMP and pyrophosphate. PEF, according to the
present invention, can also be selected from the group consisting
of: an isolated or purified naturally occurring polymerase
enhancing protein obtained from an archeabacteria source (e.g.,
Pyrococcus furiosus); a wholly or partially synthetic protein
having the same amino acid sequence as Pfu P45, or analogs thereof
possessing polymerase enhancing activity; polymerase-enhancing
mixtures of one or more of said naturally occurring or wholly or
partially synthetic proteins; polymerase-enhancing protein
complexes of one or more of said naturally occurring or wholly or
partially synthetic proteins; or polymerase-enhancing partially
purified cell extracts containing one or more of said naturally
occurring proteins (U.S. Pat. No. 6,183,997, supra). The PCR
enhancing activity of PEF is determined by means well known in the
art. The unit definition for PEF is based on the dUTPase activity
of PEF (P45), which is determined by monitoring the production of
pyrophosphate (PPi) from dUTP. For example, PEF is incubated with
dUTP (10 mM dUTP in 1.times. cloned Pfu PCR buffer) during which
time PEF hydrolyzes dUTP to dUMP and PPi. The amount of PPi formed
is quantitated using a coupled enzymatic assay system that is
commercially available from Sigma (#P7275). One unit of activity is
functionally defined as 4.0 mmole of PPi formed per hour (at
85.degree. C.).
[0048] In some embodiments, 1 ng PEF preparation has an activity of
3-4 mmoles PPi/hour, which is 1 unit.
[0049] As used herein, the term "Mutazyme" refers to a composition
comprising a mixture of exo- Pfu DNA polymerase and PEF. The
composition may also include a storage buffer containing 50 mM
Tris-HCl, pH 8.2; 0.1 mM EDTA, pH 8.2; 1 mM DTT; 0.1% (v/v) Igepal
CA-630; 0.1% (v/v) Tween 20; and 50% Glycerol. exo- Pfu DNA
polymerase and PEF can be mixed at different ratios as measured by
their respective activities. For example, exo- Pfu DNA polymerase
and PEF can be mixed at an activity ratio of from 40/1, 20/1, 15/1,
10/1, 5/1, 2/1, 1/1, 1/2, 1/5, 1/10, 1/20, 1/40, 1/100, 1/200,
1/300, 1/400, or lower. Preferably, the ratio of exo- Pfu DNA
polymerase and PEF is between 2.5/1 to 40/1. The activity of
Mutazyme, according to the invention, refers to the activity of
exo- DNA polymerase, not the activity of PEF. Mutazyme may be
stored at -20.degree. C. till use.
[0050] As used herein, "mutation" refers to an alteration in a
nucleic acid sequence. A mutation according to the invention can
involve the removal, addition or substitution of a single
nucleotide base within a DNA sequence, or they may be the
consequence of changes involving the insertion or deletion of large
numbers of nucleotides. A nucleic acid in which a mutation has
occurred is called a "mutant". The term "mutagenesis" according to
the invention refers to the introduction of mutations into a
nucleic acid sequence.
[0051] As used herein, "mutation frequency" refers to the number of
mutations per unit of base pair or unit of time, for example, the
number of mutations per 10.sup.6 base pair or per PCR reaction.
"Mutation frequency" also refers to the number of mutations per
nucleotide sequence. In one embodiment, a low mutation frequency of
1-3000 (e.g., 1000-3000) per 10.sup.6 base pair is obtained. In
another embodiment, a mutation frequency of 3000-7000 per 10.sup.6
base pair is obtained. In yet another embodiment, a mutation
frequency of 7000-16000 per 10.sup.6 base pair is obtained by
comprising one or more additional PCR amplification reactions.
[0052] Mutation frequency (M.F.), according to the invention, is
related to the number of target duplications or the "d value". "d
value" is calculated by the following relation: d log (A/B)/log2,
wherein A is the yield of amplified mutated product, B is the
starting amount of nucleic acid template. The amount of start
template is not measured as the total amount of DNA in the
reaction, but the amount of target DNA in the reaction, that is,
the actual sequence to be mutagenized which resides between the two
primer complementary sites. For example, if a 1 kb fragment is to
be amplified from a 10 kb DNA template, the target amount (ng) is
only 10% of the plasmid amount (ng) added to the PCR reaction.
Alternatively, the amount of nucleic acid can be in molar
quantities for the calculation of d value. The mutation frequency
(M.F.) may be calculated according to M.F. =(error
rate).times.(number of base pairs).times.(d). Because M.F. is
related to d value, the mutation frequency can be controlled by
controlling the "d value" or the number of times a target is
duplicated in a PCR reaction.
[0053] As used herein, "amplification" refers to any in vitro
method for increasing the number of copies of a nucleic acid
template sequence with the use of a polymerase. Nucleic acid
amplification results in the incorporation of nucleotides into a
nucleic acid (e.g., DNA) molecule or primer thereby forming a new
nucleic acid molecule complementary to the nucleic acid template.
The formed nucleic acid molecule and its template can be used as
templates to synthesize additional nucleic acid molecules. As used
herein, one amplification reaction may consist of many rounds of
nucleic acid synthesis. Amplification reactions include, for
example, polymerase chain reactions (PCR; Mullis and Faloona, 1987,
Methods Enzymol., 155:335). One PCR reaction may consist of 5 to
100 "cycles" of denaturation and synthesis of a nucleic acid
molecule. PCR amplifications with an exo- DNA polymerase inherently
will result in generating mutated amplified product.
[0054] As used herein, "polymerase chain reaction" or "PCR" refers
to an in vitro method for amplifying a specific nucleic acid
template sequence. The PCR reaction involves a repetitive series of
temperature cycles and is typically performed in a volume of 50-100
.mu.l. The reaction mix comprises dNTPs (each of the four
deoxynucleotides dATP, dCTP, dGTP, and dTTP), primers, buffers, DNA
polymerase, and nucleic acid template. The PCR reaction comprises
providing a set of oligonucleotide primers wherein a first primer
contains a sequence complementary to a region in one strand of the
nucleic acid template sequence and primes the synthesis of a
complementary DNA strand, and a second primer contains a sequence
complementary to a region in a second strand of the target nucleic
acid sequence and primes the synthesis of a complementary DNA
strand, and amplifying the nucleic acid template sequence employing
a nucleic acid polymerase as a template-dependent polymerizing
agent under conditions which are permissive for PCR cycling steps
of (i) annealing of primers required for amplification to a target
nucleic acid sequence contained within the template sequence, (ii)
extending the primers wherein the nucleic acid polymerase
synthesizes a primer extension product. "A set of oligonucleotide
primers" or "a set of PCR primers" can comprise two, three, four or
more primers. In one embodiment, an exo- Pfu DNA polymerase is used
to amplify a nucleic acid template in a PCR reaction.
[0055] As used herein, the term "PCR primer" refers to a single
stranded DNA or RNA molecule that can hybridize to a nucleic acid
template and prime enzymatic synthesis of a second nucleic acid
strand. A PCR primer useful according to the invention is between
10 to 100 nucleotides in length, preferably 17-50 nucleotides in
length and more preferably 17-45 nucleotides in length.
[0056] As used herein, a "PCR buffer lacking Mn.sup.2+" refers to a
PCR buffer which is prepared without the addition of an organic or
inorganic Mn.sup.2+ salt, although the buffer may contain a small
amount of endogenous Mn.sup.2+. A buffer lacking Mn.sup.2+ contains
less than 100 .mu.M Mn.sup.2+, for example, less than 50 .mu.M
Mn.sup.2+ or less than 10 .mu.M Mn.sup.2+.
[0057] As used herein, a "universal PCR reaction buffer" or
"universal reaction buffer" refers to a single buffer composition
which allows PCR amplification of a nucleic acid template by
Mutazyme. The buffer may contain any known chemicals used in a
buffer for PCR reaction. Preferably, the buffer contains a
buffering composition selected from Tris or Tricine. More
preferably, the buffering composition has a pH range of from 7.5 to
9.5. Preferably, the universal PCR reaction buffer contains
Mg.sup.2+ (e.g., MgCl.sub.2 or MgSO.sub.4) in the range of 1-10 mM.
The buffer according to the invention may also contain K+ (e.g.,
KCl) in the range of from 0 to 20 mM. In some embodiments, the
buffer contains components which enhances PCR yield (e.g.,
(NH.sub.4).sub.2SO.sub.4 in the range of from 0 to 20 mM). In other
embodiments, the buffer contains one or more non-ionic detergents
(e.g., Trition X-100, Tween 20, or NP40, in the range of from 0 to
1%). The buffer may also contain BSA in the range of from 1-100
.mu.g/ml. In a preferred embodiment of the invention, the universal
PCR reaction buffer contains 10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 20 mM Tris-Cl (pH 8.8), 2 mM MgSO.sub.4,
0.1% Triton X-100, 100 .mu.g/ml BSA. In another preferred
embodiment, the buffer contains 10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 20 mM Tris-Cl (pH 9.2), 2 mM MgSO.sub.4,
0.1% Triton X-100, 100 .mu.g/ml BSA.
[0058] As used herein, the term "equivalent amount(s)" refers to
components (e.g., dATP, dTTP, dGTP, and dCTP) in the PCR buffer
having an equal molar concentration.
[0059] As used herein, the term "unbalanced dNTP concentration"
refers to an unequal molar concentration of dATP, dTTP, dGTP, and
dCTP in the PCR reaction mixture. For example, an "unbalanced dNTP
concentration" may have more dCTP and dTTP than dATP and dGTP.
[0060] As used herein, an "amplified product" refers to the double
strand nucleic acid population at the end of a PCR amplification
reaction. The amplified product contains the original nucleic acid
template and nucleic acid synthesized by DNA polymerase using the
nucleic acid template during the PCR reaction. The amplified
product, according to the invention, contains mutations to the
original nucleic acid template sequence due to the use of
error-prone DNA polymerases in the PCR reaction, e.g., Mutazyme and
Taq DNA polymerases.
[0061] As used herein, a "mutant nucleic acid library" or a "mutant
library" refers to a nucleic acid library comprising a collection
of mutant nucleic acids representing a number of different
mutations as defined herein, derived from one or more nucleic aid
templates. The "complexity of a mutant nucleic acid library" refers
to the number of different mutations represented in the library.
Preferably a mutant nucleic acid library, according to the
invention, is prepared by PCR mutagenesis using exo- Pfu DNA
polymerase. In one embodiment, a mutant nucleic acid library is
prepared by exo- Pfu DNA polymerase and another exo- DNA polymerase
selected from the group consisting of: Taq DNA polymerase, exo- E.
coli DNA polymerase, exo-Tli DNA polymerase, exo- Tma DNA
polymerase, exo-Tth DNA polymerase, exo-KOD DNA polymerase,
9.degree. Nm DNA polymerase, exo-Tma DNA polymerase and exo- PGB-D
DNA polymerase. In another preferred embodiment, a mutant nucleic
acid library is prepared by PCR mutagenesis using exo- Pfu DNA
polymerase and Taq DNA polymerase. In another embodiment, a mutant
library is generated by repeating one or more additional PCR
amplification reactions.
[0062] As used herein, the term "repeating one or more additional
subsequent PCR amplification reactions" refers to the subsequent
performance of one or more additional PCR amplification reactions
comprising incubating a nucleic acid template, at least two PCR
primers, an error-prone DNA polymerase under conditions which
permit amplification of the nucleic acid template. A subsequent PCR
reaction comprises said incubating step using the PCR amplified
product of a preceding PCR amplification as template. The amplified
product of a preceding PCR amplification reaction may be purified
before being used as template for a subsequent PCR reaction by
means known in the art, e.g., phenol extraction/ethanol
precipitation or column purification. The template for a subsequent
PCR amplification reaction may be a portion of or the total
amplified product of a preceding PCR amplification. For each
subsequent PCR amplification, fresh reagents (e.g., reaction
buffer, dNTP, DNA polymerase, primers) are added to the reaction
mixture. If a portion of the amplified product of a preceding PCR
amplification is used, the volume of a subsequent PCR reaction may
be the same as the preceding PCR reaction. If the total amplified
product of a preceding PCR reaction is used as template, a
subsequent PCR reaction will have larger volume than the preceding
PCR reaction.
[0063] As used herein, a "mutation spectrum" refers to the presence
in mutated amplified PCR product of different mutation frequencies
of different types of mutations generated from a nucleic acid
template by PCR mutagenesis using one or more given DNA
polymerases. Each DNA polymerase may have its unique mutation
spectrum due to its unique bias in generating mutations (Andre, P.,
Kim, A., Khrapko, K. and Thilly, W. G. (1997) Fidelity and
mutational spectrum of Pfu DNA polymerase on a human mitochondrial
DNA sequence. Genome Res. 7:843-852; Keohavong, P., Ling, L., Dias,
C. and Thilly, W. G. (1993) Predominant mutations induced by the
Thermococcus litoralis, Vent polymerase during DNA amplification in
vitro. PCR Methods Applic. 2:288-292; Shafikhani, et al., 1997,
Generation of large libraries of random mutants in Bacillus
subtilis by PCR-based plasmid multimerization, Biotechniques 23
:304-310). Different types of mutations which occur in a DNA
molecule are described as transition (Ts), transversion (Tv), GC,
or AT mutations. Bias in mutation spectrum can be assessed by
calculating the Ts/Tv and GC/AT ratios. As used herein, a "GC/AT
ratio" refers to a ratio between GC mutation frequency wherein
nucleotide G or C of a nucleic acid template is mutated to
nucleotide A or T and AT mutation frequency wherein nucleotide A or
T of a nucleic acid template is mutated to nucleotide G or C in a
PCR reaction. As used herein, "transition" refers to a single base
pair mutation wherein a pyrimidine (T or C) is substituted by
another pyrimidine (C or T respectively) or a purine (A or G) is
substituted by another purine (G or A respectively). As used
herein, "transversion" refers to a single base pair mutation
wherein a purine (A or G) is replaced by a pyrimidine (C or T) or a
pyrimidine (C or T) is replaced by a purine (A or G). There are
four possible transitions: A.fwdarw.G, T.fwdarw.C, G.fwdarw.A, and
C.fwdarw.T. There are eight possible transversions: A.fwdarw.T,
T.fwdarw.A, A.fwdarw.C, C.fwdarw.A, T.fwdarw.G, G.fwdarw.T,
G.fwdarw.C, and C.fwdarw.G. If a DNA polymerase lacks bias, the
GC/AT ratio of the mutation spectrum generated by the DNA
polymerase would be 1 and the Ts/Tv ratio of the mutation spectrum
generated by the DNA polymerase would be 0.5.
[0064] As used herein, "proportional" refers to a numeric
relationship between mutation frequency and the amount of nucleic
acid template, wherein the mutation frequency increases as the
amount of nucleic acid template in the PCR reaction decreases. In
one embodiment, a "low" mutation frequency of 1000-3000 mutations
per 10.sup.6 base pair is obtained employing 10-100 ng DNA
template. In another embodiment, a "medium" mutation frequency of
3000-7000 mutations per 10.sup.6 base pair is obtained employing 10
pg-10 ng DNA template. In yet another embodiment, a "high" mutation
frequency of 7000-16000 mutations per 10.sup.6 base pair, or a
frequency greater than 16,000 mutations per 10.sup.6 base pair, is
obtained by repeating one or more additional PCR amplification
reactions.
[0065] As used herein, "nucleic acid template" or "target nucleic
acid template" refers to a nucleic acid containing an amplified
region. The "amplified region," as used herein, is a region of a
nucleic acid that is to be either synthesized or amplified by
polymerase chain reaction (PCR). For example, an amplified region
of a nucleic acid template resides between two sequences to which
two PCR primers are complementary to.
[0066] II. exo- Pfu DNA Polymerase
[0067] The wild type Pfu DNA plymerase can be purified from
hyperthermophilic, marine archaebacterium, Pyrococcus furiosus
(Pfu) as described (U.S. Pat. No. 5,545,552; Cline et al., 1996,
Nucleic acid Research, 24:3546-3551). The wild type enzyme has an
inherent 3' to 5' exonuclease activity which proofreads the
synthesized DNA strand and allows a low error rate of
1.3.times.10.sup.-6 nutation frequency per base pair per
duplication during nucleic acid synthesis and amplification. The
enzyme is extremely thermostable through a temperature range of
about 0.degree. C. to about 104.degree. C., and exhibits DNA
polymerase activity in temperatures of from about 40.degree. C. to
90.degree. C., with an activity optimum at about 72-75.degree. C.,
which is limited by melting of DNA templates.
[0068] exo- Pfu DNA polymerase substantially lacks the 3' to 5'
exonuclease activity, and therefore is error prone. exo-Pfu DNA
polymerase exhibits an error prone rate of 4.7.times.10.sup.-5
which is about 6 fold higher than the error rate of Taq DNA
polymerase (Cline, J., Braman, J. C. and Hogrefe, H. H. (1996) PCR
fidelity of Pfu DNA polymerase and other thermostable DNA
polymerases. Nucleic Acids Res. 24(18):3546-3551).
[0069] The exo- Pfu DNA polymerase can be prepared by any
recombinant DNA techniques from the wild type Pfu DNA polymerase as
described in U.S. Pat. No. 5,489,523, incorporated herein as
reference. Other recombinant DNA techniques are also known in the
art (For example, Ausubel et al., John Weley & Sons, Inc.,
1997, Current Protocols in Molecular Biology).
[0070] Preferably, the exo- Pfu DNA polymerase has an amino acid
residue sequence that substantially corresponds to the amino acid
residue sequence of the wild type Pfu enzyme, except for certain
specified substitutions to produce the desired deficiency in
exonuclease. By "substantially corresponds" means that the sequence
is at least 80% homologous, preferably at least 90% homologous, and
more preferably is at least 98% homologous to the wild type
enzyme.
[0071] The exo- Pfu DNA polymerase may be made by selective
substitution of nucleotides encoding amino acid residues required
for the 3' to 5' exonuclease activity of the wild type Pfu enzyme
without inhibiting the DNA polymerase activity. An exo- Pfu DNA
polymerase preferably has a DNA polymerase activity, expressed as
specific activity, of at least about 10,000 units (10 KU) per mg of
polymerase protein, and preferably at least about 15 KU/mg, and
more preferably at least 25 KU/mg. One unit of polymerase activity
is defined as the amount of enzyme which catalyzes the
incorporation of 10 mmoles of total dNTP into polymeric form in 30
minutes at optimal temperature for each enzyme (e.g., 72.degree. C.
for Pfu DNA polymerase). Polymerase concentrations (U/.mu.l) are
extrapolated from the slope of the linear portion of units vs.
enzyme volume plots, this format for indicating enzyme amount is
well known in the art.
[0072] The apparent molecular weight of the wild type Pfu DNA
polymerase protein is about 90,000-93,000 daltons as determined by
SDS-PAGE under denaturing conditions. Preferred exo- Pfu DNA
polymerase proteins have the same apparent molecular weight as the
wild type polymerase.
[0073] Preferably, Exo- Pfu DNA polymerase retains the
thermostability of the wild type Pfu DNA polymerase and functions
effectively in PCR reaction. Stated differently, the exo- Pfu
enzyme does not become irreversibly denatured (inactivated) when
subjected to the elevated temperatures for the time necessary to
effect denaturation of double-stranded nucleic acids. Irreversible
denaturation for purposes herein refers to permanent and complete
loss of enzymatic activity. More preferably, the enzyme preferably
does not become irreversibly denatured at about 90-100.degree. C.
That is, the enzyme loses less than 25 percent of its DNA
polymerase activity after exposure to 95.degree. C. for 1 hour
(hr), more preferably less than 10%, and yet more preferably less
than 5% of its activity.
[0074] One form of the exo- Pfu DNA polymerase is commercially
available from Stratagene (Catalogue #600163, La Jolla, Calif.).
However, the subject invention is also intended to include other
forms of exo- Pfu DNA polymerases made by any recombinant DNA
techniques, for example, techniques disclosed in U.S. Pat. No.
5,489,523, which can be relied on by one skilled in the art in
making and using exo- Pfu DNA polymerase. The referred reference
(U.S. Pat. No. 5,489,523), therefore, is specifically incorporated,
in its entirety, into this disclosure. The other forms of exo- Pfu
DNA polymerases include N-terminal or C-terminal truncation, and
point mutations in 3'-5' exonuclease domain and ancillary domains
(e.g., partitioning domains).
[0075] III. PCR Enhancing Factor PEF
[0076] Proteins with PCR enhancing activity can be produced from a
bacterial or an archeabacterial source. PEFs can be polymerase
enhancing activity mixtures of one or more such proteins, protein
complexes containing one or more such proteins, or extracts
containing one or more of such proteins, mixtures or complexes. The
Pfu P45 and P50 proteins are illustrative of PEF proteins P45 and
P50, which exhibit an apparent molecular weight of approximately 45
kD and 50 kD. These two proteins are predominant components of a
PEF complex derivable from Pyrococcus furiosus (Pfu) as described
by U.S. Pat. No. 6,183,997. The P45 protein appears to be the most
active component, although full activity or stability may also
require the presence of the P50 component. Preferably, homogenous
PEF made by recombinant DNA techniques from a bacterial host other
than Pfu is used in the subject invention to avoid any
contamination of wild type Pfu DNA polymerase which may result in
the reduction of mutation frequency of exo- Pfu DNA polymerase.
However, the present invention is intended to encompass other PEF
proteins, mixtures, complexes, and extracts derived from organisms
other than Pfu, or by use of the structural information on the PEF
proteins described as in U.S. Pat. No. 6,183,997. The referred
reference (U.S. Pat. No. 6,183,997), therefore, is specifically
incorporated, in its entirety, into this disclosure.
[0077] IV. Mutazyme
[0078] Mutazyme is prepared by mixing exo-Pfu DNA polymerase with
PCR enhancing factor PEF. The ratio of the amount of the exo- Pfu
DNA polymerase (as indicated by its polymerase activity unit) and
the amount of the PEF (as indicated by its PCR enhancing activity
unit) in Mutazyme can be from 40/1 to 1/400 or lower, preferably
from 2.5/1 to 1/40. In a preferred embodiment of Mutazyme, the exo-
Pfu DNA polymerase has a final concentration of 2.5 U/.mu.l and PEF
has a final concentration of 2 U/.mu.l, therefore resulting in a
ratio of 1.25/1. In a more preferred embodiment, recombinant
untagged p45 (rp45) is used as the PEF to mix with the exo- Pfu DNA
polymerase (commercially available from Stratagene, La Jolla,
Calif. Catalogue # 600550).
[0079] V. PCR Mutagenesis by Mutazyme
[0080] The compositions comprising Mutazyme according to the
subject invention may be used in various methods of synthesizing
polynucleotides in essentially the same manner as the exo- Pfu DNA
polymerase present in the subject composition. Typically, synthesis
of a polynucleotide requires a set of synthesis primers, a
synthesis template, polynucleotide precursors (e.g. dATP, dCTP,
dGTP, and dTTP, also referred as dNTPs) for incorporation into the
newly synthesized polynucleotide. Detailed methods for carrying out
polynucleotide synthesis are well known to the person of ordinary
skill in the art and can be found, for example, in Molecular
Cloning second edition, Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989). Polymerase chain
reaction (PCR) is one of the most well known methods for DNA
synthesis, amplification and mutagenesis (Cadwell, R. C. and Joyce,
G. F. 1992. Randomization of genes by PCR mutagenesis. PCR Methods
Appl. 2:28-33; Leung, D. W., Chen, E., and Goeddel, D. V. 1989. A
method for random mutagenesis of a defined DNA segment using a
modified polymerase chain reaction. Technique 1: 11-15). Mutazyme
may also be used for other random mutagenesis methods well known in
the art, such as primer extension or reverse transcription (Ausubel
et al., John Weley & Sons, Inc., 1997, Current Protocols in
Molecular Biology).
[0081] Conventional PCR mutagenesis methods employ Taq DNA
polymerase, as it lacks proofreading activity and is inherently
error prone. The process of PCR employs multiple cycles with a
template denature step, a primer annealing step, and a
polynucleotide synthesis step in each cycle. A PCR reaction mixture
typically contains a nucleic acid template, a DNA polymerase, a
suitable reaction buffer, a dNTP mix, and/or other additives.
[0082] A. Amount of Mutazyme in PCR Reaction
[0083] PEF enhances the performance of Pfu DNA polymerase when
present at concentrations spanning a 10,000-fold range (0.09-900
U/100 .mu.l) in the PCR reaction. In a preferred embodiment, this
corresponds to 0.09-900 ng PEF per 100 .mu.l reaction mixture.
Preferably, the PEF concentration present in the PCR reaction is
from 1 to 100 ng/100 .mu.l.
[0084] B. PCR Parameters
[0085] Any PCR conditions which allow the amplification of nucleic
acid template by Pfu DNA polymerase is encompassed by the subject
invention. The PCR amplification is usually carried out in a 50
.mu.l or 100 .mu.l volume. In preferred embodiments, the PCR
reaction mixtures comprise 1.times. Mutazyme reaction buffer, 200
.mu.M each dNTP, 125 ng each primer, and 2.5 U Mutazyme DNA
polymerase. The reactions are cycled in a RoboCycle.RTM. Gradient
40 Temperature Cycler (Stratagene), fitted with a hot top assembly.
The following cycling parameters are employed: 1 cycle of
95.degree. C. for 1 minute; 30 cycles of 95.degree. C. for 1
minute, 55.degree. C. for 1 minute, and 72.degree. C. for 1 minute
(.ltoreq.1 kb templates) or 1 minute per kb (>1 kb
templates).
[0086] C. Reaction Buffer and dNTPs
[0087] Taq DNA polymerase needs a buffer with Mn.sup.2+ and
unbalanced dNTP concentration to be highly mutagenic.
Polymerization is carried out under sub-optimal conditions in the
presence of Mn.sup.2+ and an unbalanced dNTP concentration, and PCR
yield is reduced by more than two-fold (Melnikov, A. and Youngman,
P. J. (1999) Random mutagenesis by recombinational capture of PCR
products in Bacillus subtilis and Acinetobacter calcoaceticus.
Nucleic Acids Res. 27(4):1056-1062).
[0088] Mutazyme has a 6-fold higher intrinsic error rate than Taq
DNA polymerase. Therefore Mutazyme does not require mutagenic
buffer conditions in order to perform error prone PCR. However, a
mutagenic buffer (e.g., a buffer containing Mn.sup.2+ or a buffer
with an unbalanced dNTP concentration) may be used in the subject
invention.
[0089] Buffers useful to the subject invention include any buffer
compositions that allow the amplification of a nucleic acid
template by Mutazyme. Preferably, the buffer contains Mg.sup.2+ and
a buffering component of either Tris or Tricine. Also preferably,
the buffer has a pH range of from 7.5 to 9.2. More preferably, the
buffer contains a component to enhance the yield of the amplified
product, e.g., (NH.sub.4).sub.2SO.sub.4 and KCl. Other buffer
components such as BSA, non-ionic detergent (e.g., Triton X-100,
Tween 20, NP40) may be added to the buffer as long as the buffer
provide the desired yield and mutation frequency for a given
template.
[0090] Optimal PCR buffer allows Mutazyme to be a more robust
polymerase. In a preferred embodiment, a universal Mutazyme PCR
reaction buffer containing 20 mM Tris, 10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 2 mM MgSO.sub.4, 100 .mu.g/ml BSA, and
0.1% Triton X-100. In one embodiment, the pH of the Mutazyme PCR
reaction buffer is 8.8. In another embodiment, the pH of the
Mutazyme PCR reaction buffer is increased (e.g., pH 9.2) to achieve
higher mutation frequencies.
[0091] In order to obtain high mutation frequencies (>6,000
mutations per 10.sup.6 base pair), Taq DNA polymerase requires the
change of the one or more of the dNTP concentrations (e.g.,
increasing the concentration of dGTP). In contrast, Mutazyme
generates a variety of mutation frequencies with equivalent amount
of each of the dNTPs. Therefore, it's not required to increase one
of the dNTP concentrations when a high mutation frequency is
desired.
[0092] In a preferred embodiment, a final concentration of 200
.mu.M of each dNTPs is used.
[0093] D. Target Nucleic Acid Template (Length, Source, and
Yield)
[0094] Mutagenesis by Taq DNA polymerase requires the use of a
suboptimal PCR reaction buffer comprising Mn.sup.2+ and an
unbalanced dNTP concentration and can only amplify nucleic acid
less than 1 kb in length (Leung, D. W., Chen, E., and Goeddel, D.
V. 1989. A method for random mutagenesis of a defined DNA segment
using a modified polymerase chain reaction. Technique 1: 11-15;
Stemmer, W. P. 1994. DNA shuffling by random fragmentation and
reassembly: in vitro recombination for molecular evolution. Proc.
Natl. Acad. Sci. USA 91:10747-10751).
[0095] The PCR enhancing effect of PEF in Mutazyme allows the
amplification of long or low copy number targets. Therefore
lowering the template concentration may be used to achieve a
desired high product yield with mutzyme, but not with Taq DNA
polymerase. Mutazyme with exo- Pfu DNA polymerase (2.5U/.mu.l) and
PEF (2U/.mu.l) significantly increases yields of PCR templates up
to 10 kb. Mutazyme is capable of amplifying DNA fragment of 1 kb, 2
kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, or greater in
length.
[0096] In one embodiment, Mutazyme efficiently amplifies a 10 kb
lambda target from 10 pg of lambda DNA. In another embodiment,
Mutazyme amplifies plasmid targets of 650 bp, 2.5 kb, and 4.5 kb.
The PCR yield of these targets is higher than that generated by Taq
or exo- Pfu DNA polymerase.
[0097] Mutazyme enhances the yield of PCR products using plasmid,
lambda, and genomic DNA templates. Therefore, fewer PCR cycles or
lower template concentrations could be used in Mutazyme containing
amplifications. The PCR enhancing effect of PEF in Mutazyme also
allows the amplification of highly complex targets. When exo- Pfu
DNA polymerase is used in the absence of PEF, such targets are
poorly amplified.
[0098] In one embodiment, a 5.2 kb target is successfully amplified
from human genomic DNA by Mutazyme with relatively shorter
extension time per kb template, compared to exo- Pfu DNA
polymerase.
[0099] In a preferred embodiment of the subject invention, when a
target is amplified from genomic DNA and low-to-medium mutation
rates are desired, the target is first amplified with a high
fidelity DNA polymerase (i.e., wild type Pfu). The amplified PCR
product is then used as template for Mutazyme mutagenesis.
[0100] E. The Amount of Target Nucleic Acid Template and Mutation
Frequencies
[0101] Mutazyme of the subject invention amplifies nucleic acid
template more efficiently with less starting template
concentration, compared to Taq and exo- Pfu DNA polymerases.
Mutazyme is suitable for PCR amplification of DNA templates of 1 pg
to 1 .mu.g, preferably 10 pg to 100 ng. Nucleic acid concentration
can be determined by methods well known in the art, for example, by
measuring absorbencies at 260 nm.
[0102] Taq DNA polymerase mutagenesis relies on the presence of
Mn.sup.2+ and an unbalanced dNTP concentration to change the error
rate of Taq DNA polymerase and therefore, the mutation frequency of
the reaction. Sometimes, a range of different buffer conditions are
required to vary the mutation frequency of the PCR reaction (Cline,
J., Braman, J. C. and Hogrefe, H. H. 1996. PCR fidelity of Pfu DNA
polymerase and other thermostable DNA polymerases. Nucleic Acids
Res. 24:3546-3551). The subject invention provides a simple method
of controlling mutation frequencies of target nucleic acid template
by controlling the starting template concentration. In preferred
embodiments of the invention, the mutation frequencies are
proportional to the starting amount of nucleic acid templates.
[0103] Mutazyme has a high mutation frequency even with optimal
buffers containing Mg.sup.++ and balanced dNTPs. The error rate of
exo-Pfu in cPfu buffer is 4.7.times.10.sup.-5 which is about 6 fold
higher than the error rate of Taq (Cline, J., Braman, J. C. and
Hogrefe, H. H. (1996) PCR fidelity of Pfu DNA polymerase and other
thermostable DNA polymerases.
Nucleic Acids Res. 24(18):3546-3551).
[0104] We use variation in number of target duplications to control
the mutation frequency of the PCR reaction. Changing the ratio of
PCR yield to starting amount of target alters the d value. The
easiest way to increase d (and hence the mutation frequency) is to
lower the starting amount of target. A single PCR amplification
reaction may be used to achieve a d value of less than 20. In order
to get values of d greater than 20 (greater than 10 mutations/kb),
a second PCR is preferably performed.
[0105] To increase d values to greater than 20, one or more
additional PCR reactions may be performed. The d values of the
first and sequential PCRs are added together to get the overall d
value. The actual corresponding mutation frequency to a d value may
be determined by DNA sequencing of randomly selected clones of
mutated product. In one embodiment, a second PCR is performed to
achieve an overall d value of greater than 20. In another
embodiment, a third PCR is performed which resulted in an overall d
value of approximately 50. The mutation frequency observed after
two or more sequential PCRs can be greater than 16 mutations/kb. It
is possible, whenever desired, to perform more than three
sequential PCRs. A mutation frequency of 29,200 mutations per
10.sup.6 base pair has been seen with six sequential rounds of PCR
with Taq DNA polymerase (Shafikhani, S., Siegel, R. A., Ferrari, E.
and Schellenberger, V. (1997) Generation of large libraries of
random mutants in Bacillus subtilis by PCR-based plasmid
multimerization. Biotechniques 23(2) 304-310). Since Mutazyme has
higher error prone rate than Taq DNA polymerase, an even higher
mutation frequency may be achieved.
[0106] Table 1 shows the range of calculated d values that can be
achieved in theory by single or sequential PCR reactions using the
indicated amounts of starting template and various projected
product yields. In some embodiments, the d values shown in bold
type are achieved experimentally where product yields of 0.1-7.5
.mu.g/50 .mu.l PCR were generated from 1 pg-100 ng of target (FIG.
1). In one embodiment, a series of PCR reactions employing 1 pg, 10
pg, 1 ng, 10 ng or 100 ng of target DNA produced a range of d
values from 5.6 to almost 17. The d value, and therefore, the
mutation frequency, increases as the input DNA dropped from 100 ng
(d=5.6) to 100 pg (d=15.6).
1TABLE 1 d values at different product yield. start 100 ng 500 ng 1
.mu.g 2.5 .mu.g 5 .mu.g 7.5 .mu.g 10 .mu.g 100 ng 0 2.3 3.3 4.6 5.6
6.2 6.6 10 ng 3.3 5.6 6.6 8.0 9.0 9.6 10 1 ng 6.6 9.0 10 11.3 12.3
12.9 13.3 100 pg 10 12.3 13.3 14.6 15.6 16.2 16.6 10 pg 13.3 15.6
16.6 17.9 18.9 19.5 20 1 pg 16.6 18.9 20 21.3 22.3 22.8 23.3 100 fg
20 22.3 23.3 24.6 25.6 26.2 26.6 Double 20 35 PCR Triple 35 50
PCR
[0107] The mutation frequencies can be divided into three ranges of
numbers defining "Mutation Levels". The low mutation frequency PCRs
use 10-100 ng (40-400 fmole) of target to achieve 1000-3,000
mutations/10.sup.6 base pair. The medium mutation rate is achieved
by using 10 pg to 10 ng (0.04-40 fmole) of target and gives a
mutation frequency of 3000-7000 mutations/10.sup.6 base pair. The
high mutation rate is obtained using one or more additional PCR
reactions, which give mutation frequencies of 7000-16000
mutations/10.sup.6 base pair.
[0108] If one or more additional PCR reactions are performed
subsequently, a portion of or the total of a preceding PCR
amplified product may be used as the template of a subsequent PCR
reaction. Preferably, a portion of the preceding PCR amplified
product is used as the template of a subsequent PCR amplification.
More preferably, less than {fraction (1/10)}, or {fraction (1/25)},
or {fraction (1/50)} of the preceding PCR amplified product is used
as the template of the subsequent PCR amplification. In one
embodiment, the preceding PCR amplified product is purified before
being used as template for a subsequent PCR amplification. In
another embodiment, the preceding PCR amplified product is directly
used as template for a subsequent PCR amplification without
purification.
[0109] A lacZ mutagenesis assay may be used as control for the
Mutazyme error prone PCR. Instead of sequencing to determine
mutation frequency, mutations may be scored using the
color-screening assay. Clones containing a mutation in lacZ that
inactivates .beta.-galactosidase activity produce white or
colorless colonies on Xgal/IPTG plates. Wild type lacZ clones
produce blue colonies on Xgal/IPTG plates.
[0110] E. Mutational Spectrum
[0111] Mutazyme generates similar mutation spectrum with different
nucleic acid templates and the generated mutations are uniformly
distributed on the nucleic acid templates. The mutational spectrum
produced in the pH 9.2 buffer is similar to the spectrum generated
in the pH 8.8 buffer with only slight differences. The frequency of
incorporated mutations was comparable in the pH 8.8 buffer (6.96
mutations per kb) and the pH 9.2 buffer (6.58 per kb). The use of
recombinant PEF protein rP45 does not alter mutation frequency or
the mutational spectrum of exo-Pfu DNA polymerase.
[0112] One way of analyzing mutational bias is to use the ratio of
transitions to transversions. Transition mutations are purine (A
and G) to purine changes and pyrimidine (C and T) to pyrimidine
changes. Transversions are purine to pyrimidine and pyrimidine to
purine changes. There are eight possible transversions and four
possible transitions. If a DNA polymerase lacks bias, the Ts/Tv
ratio would be 0.5. The Ts/Tv ratio for Mutazyme is greater than
0.5, indicating that Mutazyme favors transitions over
transversions. In one embodiment, Mutazyme generates a Ts/Tv ratio
of greater than 1. Taq DNA polymerase also tends to make transition
mutations more often than transversion mutations.
[0113] However, the types of mutations made by Mutazyme are
different from the types of mutations produced by Taq DNA
polymerase. While Mutazyme prefers to mutate G and C to A or T, Taq
prefers to mutate A and T to G or C (Fromant, M, Blanquet, S. and
Plateau, P. 1995. Direct random mutagenesis of gene-sized DNA
fragments using polymerase chain reaction. Anal. Biochem.
224(1):347-353). Therefore, if the mutation bias is analyzed by a
ratio of GC mutations to AT mutations, Mutazyme would have a GC/AT
ratio of greater than 1 while Taq DNA polymerase would have a GC/AT
ratio of less than 1.
[0114] In one embodiment, Mutazyme shows less bias with respect to
Ts/Tv ratios at high mutation frequencies (>7 mutations/kb).
[0115] Taq DNA polymerase reaction buffer composition (e.g.,
Mn.sup.+ concentration and the ratio of the dNTPs) has to be
changed in order to increase the mutation frequency of the
reaction. To further increase mutation frequencies to higher than
4.9-6.6 mutations per kb, one typically further increases the dGTP
concentration. Selectively increasing the dGTP concentration can
lead to changes in the mutational spectrum and further increases in
the mutational bias of Taq (You and Arnold, supra). In contrast,
because the Mutazyme reaction buffer does not need to be altered,
the mutational spectrum does not change with different mutation
frequencies.
[0116] As mentioned above, the ratio of GC/AT is another way to
show mutational bias. For a DNA polymerase lacking bias, the ratio
would be 1. The GC/AT ratio for Taq DNA polymerase ranges from 0.07
to 0.35, showing a tendency for Taq DNA polymerase to mutate from A
or T to G or C (Table in Example 4) and from 0.52 to 0.73
(Shafikhani et al, 1997, supra). In contrast, the GC/AT ratio for
Mutazyme in the pH 8.8 buffer is about 3-7, indicating that
Mutazyme favors replacing G or C with A or T. Although Mutazyme
preferentially introduces A and T mutations, the degree of bias
(the distance from 1) is similar to that exhibited by the Taq DNA
polymerase.
[0117] Furthermore, even though Mutazyme prefers to mutate C and G
to A and T, it does make all possible nucleotide changes
(A.fwdarw.G, G.fwdarw.A, T.fwdarw.C, C.fwdarw.T, G.fwdarw.T,
T.fwdarw.G, C.fwdarw.A, A.fwdarw.C, A.fwdarw.T, T.fwdarw.A,
G.fwdarw.C, and C.fwdarw.G). In contrast, Taq DNA polymerase makes
no or only a few C.fwdarw.G plus G.fwdarw.C changes and G.fwdarw.T
plus C.fwdarw.A changes all of which represent less than 3% of the
total mutations made by Taq DNA polymerase. Mutazyme also generates
fewer insertion and deletion mutations than Taq DNA polymerase does
under low to medium mutation frequencies. Mutazyme, therefore, is
less likely to produce nonfunctional proteins because an insertion
or deletion often creates a frame shift which produces in inactive
protein.
[0118] F. Mutazyme Generates Blunt Ends in the Amplified Mutant
Product
[0119] Taq DNA polymerase is known to add dNTPs (primarily A) to
the 3' end of PCR products, while Pfu creates blunt ends (Hu, G.
(1993) DNA polymerase-catalyzed addition of nontemplated extra
nucleotides to the 3' end of a DNA fragment. DNA Cell Biol
12(8):763-770). Because Mutazyme lacks 3'-5' exonuclease activity,
it is not obvious whether Mutazyme will produce PCR products with
blunt ends or with overhangs. Mutazyme is tested for extension
activity using a blunt ended oligo duplex and the amplified product
contains blunt ends.
[0120] VI. PCR Mutagenesis Using Mutazyme and Another exo- DNA
Polymerase in Combination
[0121] Every polymerase will produce a unique mutation spectrum
(Keohavong, P., Ling, L., Dias, C. and Thilly, W. G. (1993)
Predominant mutations induced by the Thermococcus litoralis, Vent
polymerase during DNA amplification in vitro. PCR Methods Applic.
2:288-292; Shafikhani, et al., 1997, Generation of large libraries
of random mutants in Bacillus subtilis by PCR-based plasmid
multimerization, Biotechniques 23 :304-310).
[0122] Nucleic acid mutant libraries may be made by PCR mutagenesis
using a combination of two or more error-prone DNA polymerase. The
DNA polymerases can be selected based on the desired mutation
spectrum of the library and the mutational bias of a given DNA
polymerase. For example, Taq DNA polymerase tends to mutate A and T
sites, whereas Mutazyme tends to mutate G and C sites. The amino
acid changes in a gene are likely to be quite different for PCR
performed with Mutazyme than with Taq. A combination of the two DNA
polymerases in PCR mutagenesis may give a near uniform mutational
spectrum.
[0123] Preferably, the DNA polymerases used are exo- DNA
polymerases. More preferably, one of the exo- DNA polymerases is
exo- Pfu DNA polymerase.
[0124] If the selected DNA polymerases used have compatible
reaction buffers and amplification parameters, one PCR reaction can
be carried out with all DNA polymerases in one reaction mixture. By
"compatible", it refers to reaction buffers or amplification
parameters which allow the amplification of the template by all
selected DNA polymerases. In one embodiment, PCR mutagenesis is
carried out with exo- Pfu DNA polymerase and Taq DNA polymerase by
incubating a nucleic acid template, two PCR primers, and the two
DNA polymerase under the conditions which permit the amplification
of the template by both DNA polymerases.
[0125] Any PCR reaction mixture and parameters may be used as long
as it allows the amplification of the template by both DNA
polymerases. Certain buffer compositions may be preferable to
increase the mutation frequency for one or both DNA polymerases.
For example, a change in pH, dNTP ratios, Mg.sup.2+ concentration,
and the inclusion of Mn.sup.2+ can all alter mutation frequency. In
a preferred embodiment, the PCR buffer contains Mg.sup.2+ and a
buffer component with a pH range of from 7.5 to 9.2. Components
such as KCl, (NH.sub.4).sub.2SO.sub.4, BSA, non-ionic detergent, as
described herein, may be added if desired. The reaction mixture may
contain Mn.sup.2+ and an unbalanced dNTP concentration (e.g., when
Taq DNA polymerase is one of the polymerases used). By "unbalanced
dNTP concentration", it means that one or more of the four dNTPs
have concentrations different from the other dNTPs.
[0126] When a compatible reaction buffer or amplification
parameters are not available, PCR reactions may be carried out
sequentially with one DNA polymerase in each PCR reaction under its
optimal PCR conditions. For example, exo- Pfu may be inefficient in
buffer containing high amount of Mn.sup.2+(>100 .mu.M). So if
Taq DNA polymerase is also used and a mutagenic buffer containing
Mn.sup.2+ is desired, the PCRs may be done separately and then
combined or performed as two sequential PCRs.
[0127] The use of other mutagenic DNA polymerases may overcome
problems of buffer incompatibility. For example, Mutazyme could be
used with a DNA polymerase like UITma, which has a high mutation
frequency in the absence of manganese. Another possibility is
exo-JDF3 (related to exo- Pfu). This DNA polymerase can be used in
PCR in the presence of 0.5 mM MnCl.sub.2 (0 mM Mg.sup.++) and
therefore could be used with Taq under mutagenic buffer
conditions.
[0128] Preferably the DNA polymerase to use with exo- Pfu is
another thermosatble polymerase. Preferably, the polymerase used in
combination with exo- Pfu is naturally devoid of proofreading
activity (e.g., thermostable eubacterial Family A DNA polymerases:
e.g., Taq, Tth). In a preferred embodiment, Taq or Tth DNA
polymerase is used in combination with exo- Pfu DNA polymerase in a
buffer lacking Mn.sup.2+ and unbalanced dNTPs. The error-prone rate
of Taq DNA polymerase is increased by using one or more conditions
selected from the group consisting of: increasing dNTP
concentration, increasing Mg.sup.2+ concentration (in excess over
dNTPs), increasing pH, and using prolonged extension times and high
enzyme amounts (Ling, L. L., Keohavong, P, Dias, C., and Thilly, W.
G. (91) PCR Methods Appl. 1:63-69; Eckert, K. A. and Kunkel, T. A.
(91) PCR Methods Appl. 1: 17-24; Eckert, K. A. and Kunkel, T. A.
(90) Nucl. Acids Res. 18:3739-44). The use of these conditions to
decrease the fidelity of Taq, may provide suitable reaction
conditions for a mix of exo-Pfu and Taq DNA polymerase so to avoid
the use of Mn.sup.2+ which significantly inactivates exo- Pfu DNA
polymerase.
[0129] Other DNA polymerase that may be used in combination with
exo- Pfu DNA polymerase include exo- archaeal DNA polymerases, with
point mutations in the 3'-5' exo domain that eliminate exo
activity; e.g., exo- JDF-3, Exo- Tli (Exo- Vent, New Engliand
Biolabs), Exo- P GB-D (Exo- Deep Vent, New England Biolabs).
[0130] There are other known proofreading archaeal DNA polymerases
which could be make exo- by point mutagenesis; e.g., DNA
polymerases from Thermococcus sp. KOD, Thermococcus gorgonarius,
Thermococcus aggregans, Pyrolobus fumarius.
[0131] An additional group of DNA polymerase that may be used in
combination with exo- Pfu DNA polymerase include polymerases
modified to have reduced exonuclease activity. By "reduced
exonuclease activity", it means that the modified polymerase has a
exonuclease activity less than its wild type enzyme. Useful DNA
polymerases with reduced exonuclease activities include
N-terminally truncated eubacterial (Klenow-like fragments); UITma
(derived from Thermotoga maritima DNA polymerase). There are other
known proofreading eubacterial DNA polymerases which could be make
exo reduced by N-truncation; e.g., DNA polymerases from Thermotoga
neopolitana. Another type of exo reduced DNA polymerase is an
archaeal DNA polymerase with conservative point mutations in the
3'-5' exo domain; e.g., 9.degree. Nm DNA polymerase (New England
Biolabs).
[0132] PEF also enhances yields of PCR products obtained with a
mixture of exo- Pfu DNA polymerase and Taq DNA polymerase. PEF can
be also used for mixtures comprising exo- Pfu and other exo- DNA
polymerase than Taq DNA polymerase.
[0133] PEF can be also used with exo-JDF3, either alone or in a
mixture comprising exo- JDF3 and other exo-DNA polymerases.
[0134] VII. Mutant Nucleic Acid Library
[0135] The subject invention provides mutant libraries made by
Mutazyme PCR amplification which have less or a different
mutational bias than those generated by Taq DNA polymerase.
[0136] As described herein, both Taq DNA polymerase and Mutazyme
generate a Ts/Tv ratio of greater than 1, therefore tend to make
transition mutations more than transversion mutations. However, Taq
DNA polymerase has a tendency to mutate A or T nucleotide
(GC/AT<1), while Mutazyme has a tendency to mutate G or C
nucleotide (GC/AT>1).
[0137] Furthermore, even though Mutazyme prefers to mutate C or G
to A or T, it does make all possible nucleotide changes
(A.fwdarw.G, G.fwdarw.A, T.fwdarw.C, C.fwdarw.T, G.fwdarw.T,
T.fwdarw.G, C.fwdarw.A, A.fwdarw.C, A.fwdarw.T, T.fwdarw.A,
G.fwdarw.C, and C.fwdarw.G). In contrast, Taq DNA polymerase makes
no or only a few C.fwdarw.G plus G.fwdarw.C changes and G.fwdarw.T
plus C.fwdarw.A changes.
[0138] Therefore the library generated using Mutazyme would contain
unique mutations compared to that generated by Taq DNA polymerase.
In addition, the library generated by Mutazyme would be more
represented in mutations at Gs and Cs compared to Taq
libraries.
[0139] Since each DNA polymerase may have its unique bias in
generating mutations, libraries according to the invention can be
generated, as described herein, by using Mutazyme and one or more
other exo- DNA polymerases to create libraries with less bias and
greater diversity compared to one generated with one DNA
polymerase. For example, Taq DNA polymerase is skewed to favor
mutations at AT base pairs while exo- Pfu DNA polymerase favors GC
mutations. In one embodiment, a library is generated using a
combination of Taq and exo- pfu DNA polymerases by a first PCR
mutagenesis with Taq DNA polymerase in a buffer containing
Mn.sup.2+ and unbalanced dNTPs followed by a second PCR where a
portion of the first amplification reaction is subject tofurther
PCR mutagenesis by Mutazyme in the pH 8.8 buffer. In another
embodiment, PCRs are carried out with a blend of two DNA
polymerases.
[0140] When two DNA polymerases are used to generate a mutant
library, a first PCR reaction can be performed with a first DNA
polymerase and a second PCR reaction with a second DNA polymerase
can be performed using a portion of the first PCR reaction.
[0141] In some embodiments of the invention, the libraries are
generated using one or more additional PCR amplification reactions
to increase the mutation frequencies of the libraries as described
herein.
[0142] The use of PEF in Mutazyme increases the efficiency of the
PCR reaction and therefore provides higher product yield than
amplifications without PEF. High PCR yield provided by Mutazyme is
also desired for random mutagenesis in order to construct libraries
that are as large and representative as possible.
[0143] VIII. Kits
[0144] The invention is intended to provide novel compositions and
methods for PCR mutagenesis as described herein. The invention
herein also contemplates a kit format which comprises a package
unit having one or more containers of the subject composition and
in some embodiments including containers of various reagents used
for polynucleotide synthesis, including synthesis in PCR. The kit
may also contain one or more of the following items: polymerization
enzymes, polynucleotide precursors, primers, buffers, instructions,
and controls. The Kits may include containers of reagents mixed
together in suitable proportions for performing the methods in
accordance with the invention. Reagent containers preferably
contain reagents in unit quantities that obviate measuring steps
when performing the subject methods. One kit according to the
invention also contains a DNA yield standard for the quantitation
of the PCR product yields from a stained gel.
[0145] In one preferred embodiment, the polymerase enzyme in the
kit is Mutazyme. In another preferred embodiment, the kit comprises
both Mutazyme and Taq DNA polymerase.
[0146] Preferably, the kit contains a universal PCR reaction buffer
without the addition of Mn.sup.2+. Also preferably, the kit
contains equal molar concentration of each dNTPs. Still preferably,
the PCR reaction is set up like a normal PCR reaction with the only
variable in the reaction being the amount of starting template
which controls the mutation frequencies in the final PCR
product.
[0147] In one embodiment, three levels of mutagenesis: low (1-3,000
mutations per 10.sup.6 kb), medium (3,000-7,000 mutations per
10.sup.6 kb) and high (7,000-16,000 mutations per 10.sup.6 kb), are
obtained by using 10-100 ng of target, 10 pg-10 ng of target, and
an additional PCR reaction respectively. This may be achieved by
first diluting the DNA template into series concentrations (e.g.,
10 pg/.mu.l, 100 pg/.mu.l, 1 ng/.mu.l, 10 ng/.mu.l, 100 ng/.mu.l,
etc.). 1 .mu.l of the template of each concentration can be used in
the PCR reaction mixture containing a suitable PCR buffer (e.g.,
the pH 8.8 buffer). The PCR may be performed under parameters known
in the art (Cline et al., 1996, Nucleic Acids Research, 24: 3546).
In one embodiment, the PCR is set up in a mixture containing 2.5 U
Mutazyme, 200 .mu.M each of dNTPs, two primers (100-250 ng each) in
a final concentration of 50 .mu.l.
[0148] According to the subject invention, a kit may also contain
reagents required for a lacZ mutagenesis assay which may be used to
verify the quality of the Mutazyme error prone PCR kit.
[0149] Other PCR additives such as DMSO may be added to kits to
improve product yields when amplifying targets that have high GC
content or difficult secondary structures (Landre et al., 1995;
Berger 1994; Sun et al., 1993).
EXAMPLES
[0150] The examples below are non-limiting and are merely
representative of various aspects and features of the subject
invention.
Example 1
[0151] Template Preparation
[0152] A plasmid containing the lacZ target sequence was used as a
template for Mutazyme PCR mutagenesis. The plasmid was constructed
by subcloning a 650 bp lacZ insert into EcoRI and XhoI sites in pBC
SK+ vector, resulting in new vector pBC SK+-lacZ, which is
chloramphenicol resistant.
[0153] Complete sequence of lacZ insert including LIC (ligation
independent cloning) and restriction sites (underlined) is shown
below (LIC Primers shown in Italics and start of lacZ shown in
bold):
2 (Xho I) CTCGATTACTAGTACTTATCCCTGATTCTGTGGATAA
CCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGA
CCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGC
AAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGA
CAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGA
GTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCT
CGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAG
CTATGACCATGATACGCCAAGCGCGCTCACTGGCCGTCGTTTTACAACGT
CGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACA
TCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCC
CTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGC
GGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGTCGACGTT AAGAATTC (EcoR
I)
[0154] The plasmid concentration was determined by reading an OD at
260 nm. The plasmid was then diluted to 100 ng/.mu.l. Sequential
ten fold dilutions of this plasmid were done to generate the other
concentrations used in the assay below.
[0155] Mutazyme Error Prone PCR of pBC SK.sup.+-lacZ Plasmid
[0156] The pBC SK.sup.+-lacZ plasmid was used as template for
Mutazyme mediated PCR mutagenesis.
[0157] 100 ng, 10 ng, 1 ng, and 100 pg of lacZ DNA (contained
within the pBC SK+-lacZ plasmid) were used in PCR amplifications.
The PCR reactions were set up in a final volume of 50.mu.l
containing 1.times. pH 8.8 buffer (20 mM Tris, 10 mM KCl, 10 mM
AmSO.sub.4, 2 mM MgSO.sub.4, 100 .mu.g/ml BSA, and 0.1% Triton
X-100), 200 .mu.M of each dNTPs, and 250 ng each primer (forward
XhoI end 5' GGA ACA AGA CCC GTT ACT AGT ACT; reverse EcoRI end 5'
GAC GAC GAC AAG TTA ACG TCG ACA), 2.5U Mutazyme DNA polymerase, 1
.mu.l template (100pg/.mu.l-100 ng/.mu.l), and 42.1 .mu.l water (50
.mu.l final).
[0158] The PCR was performed in a Robocycler 40 with hot top with
the following parameters: step one: 95.degree. C. 1 min, step two
95.degree. C. 1 min (denaturation), step three 55.degree. C. 1 min
(annealing), step four 72.degree. C. 1 min (extension), with steps
two to four repeated 30 times.
[0159] The amplified PCR product was analyzed on an agarose gel.
The 650 bp band corresponding to lacZ insert was cut out of the gel
and purified with the Strataprep gel extraction kit (Stratagene,
cat #400766). 1 .mu.l of the purified PCR product was used to clone
into the Affinity.TM. LIC vector (Cat#214310) following the product
manual through the transformation step using Solopack.TM. Gold
cells (Cat #230350). The transformation was plated on
Xgal/IPTG/LB/Amp plates.
[0160] d values were calculated as d=log (A/B)/log2, wherein A is
the yield of amplified mutated produce, B is the amount of start
nucleic acid template. B (10 pg to 100 ng) is calculated as 16% of
the total amount of template DNA added to the reaction (62.5 pg to
625 ng) because the target lacZ insert (650 bp) is only 16% of the
pBC SK.sup.+-lacZ length (4.05 kb).
[0161] PCR Yield Quantitation
[0162] To examine the yield of amplified product, 10.mu.l of each
PCR reaction was analyzed on a 1% agarose gel. A DNA standard at
concentrations of 100 ng and 2 .mu.g was also loaded. PCR product
yield was compared to the DNA standard. This can be done by eye, or
more accurately, using the Eagle Eye II Still Video System to
quantitate (Stratagene, Cat. #401304). The 10 .mu.l of each PCR
reaction analyzed must contain 100 ng to 2 .mu.g DNA in order to
obtain an accurate quantitation. For the entire 50 .mu.l reaction,
there was a yield of between 500 ng and 10 .mu.g.
[0163] lacZ Color Screening Assay
[0164] The mutation frequency of each PCR amplified product was
first measured by a color-screening assay as follows.
[0165] The amplified lacZ fragment was cloned into an ampicillin
resistant vector, Affinity.TM. LIC vector. If there was carry over
of the pBC SK.sup.+-lacZ plasmid (chloramphenicol resistant) to the
transformation step, it would not be seen as background.
[0166] LB/Amp plates were prewarmed at 37.degree. C. Appropriate
amount of top agar was melted. 3 mls top agar was used for each 75
mm plate and cooled to 50.degree. C. in a water bath. To 100 mls of
melted top agar, 150 .mu.l 1M IPTG (dissolved in water) and 150 mg
Xgal in 540 .mu.l DMF were added. The plates were cooled and then
chilled at 4.degree. C. 25 .mu.l and 175 .mu.l of each
transformation were plated and grow overnight at 37.degree. C. If
the blue colonies were pale when the plates were taken out of the
incubator, the plates were allowed to sit at RT or 4.degree. C. for
several hours before counting. Blue colonies contain wild type copy
of the lacZ gene and white colonies contain mutations in lacZ gene
that inactivate P-galactosidase activity. Pale blues colonies were
counted as blue colonies. At least 100 colonies from each
transformation were counted to get an accurate count of mutation
frequency. Total number of colonies and percent mutant (white)
colonies were recorded.
[0167] Sequencing
[0168] The mutation frequency and mutational spectrum produced were
also determined by DNA sequencing. PCR reactions were cloned into
the Affinity vector and annealing products transformed into
Solopack.TM. Gold cells. Individual colonies were picked and
resuspended in 200 .mu.l TE. One microliter of each suspension was
added to a 50 .mu.l PCR reaction with Herculase.TM. enhanced DNA
polymerase (Cat #600280). The clones were amplified with one gene
specific primer (EcoRI end primer for lacZ) and one vector specific
primer (Affinity new C primer 5'GCT AGT TAT TGC TCA GCG GTG). PCR
products were purified with the Strataprep kit (cat#400771).
Sequencing was performed by Sequetech using a nested gene specific
primer (XhoI end primer for lacZ).
[0169] FIG. 3 show the relationships between mutant phenotype
(percent white colonies) and genotype (mutation frequency). Clones
from each PCR reactions were sequenced. DNA sequences for each
template concentration were analyzed to calculate the mutation
frequency. For each lacZ reaction, a total of 0.8-5.3 kb of DNA
sequence from 2-10 random clones was analyzed. For the RT and GFP
reactions, 3.2 kb (6 clones) and 4.5 kb (6 clones) were analyzed
respectively.
[0170] As expected, there was a direct relationship between percent
white colonies and number of mutations determined by DNA sequencing
(FIG. 4). Also as expected, mutation frequency increased with
increasing d value (FIG. 5). The equation of the line relating
mutation frequency (mut/kb) to d value was calculated as:
mut/kb=0.31d+0.41 with a correlation coefficient of 0.65.
Example 2
[0171] The mutation spectrum of Mutazyme was examined, as well as
the effect of buffer pH on Mutazyme mutation spectrum. The PCR
reactions were performed using pBC SK.sup.+-lacZ as template
(10-100 pg plasmid DNA) as described in Example 1. Table 2 shows
the mutation frequency and spectrum of Mutazyme in the pH 8.8
buffer and the pH 9.2 buffer. Over 20 kb of sequence from at least
40 lacZ clones is analyzed for each buffer condition.
3TABLE 2 Mutation frequency and spectrum of Mutazyme with different
buffer conditions. pH 8.8 pH 9.2 # of % total # of % total
Mutations Mutations Mutations Mutations Transitions A.fwdarw.G 10
3.8 4 2.7 G.fwdarw.A 61 23.4 32 21.3 T.fwdarw.C 17 6.5 3 2.0
C.fwdarw.T 53 20.3 42 28.0 Transversions G.fwdarw.T 32 12.3 10 6.7
T.fwdarw.G 9 3.4 3 2.0 C.fwdarw.A 20 7.7 14 9.3 A.fwdarw.C 2 0.8 2
2.0 A.fwdarw.T 16 6.1 9 6.0 T.fwdarw.A 13 5.0 4 2.7 G.fwdarw.C 12
4.6 12 8.0 C.fwdarw.G 11 4.2 5 3.3 Insertions 2 0.8 8 5.3 Deletions
3 1.1 2 2.0 Ts/Tv 1.2 1.4 kb analyzed 37.5 22.8
[0172] The mutational spectrum produced in the pH 9.2 buffer is
similar to the spectrum generated in the pH 8.8 buffer with only
slight differences. The pH 9.2 buffer did slightly increase the
mutation frequency (6.6 mut/kb) as compared to the pH 8.8 buffer
(6.0 mutations/kb) using the lacZ test system.
Example 3
[0173] Two other genes were also used as mutational targets for
Mutazyme PCR mutagenesis.
[0174] The 2.5 kb gene encoding RNaseH-MMLV-RT was amplified from
plasmid pDION containing RT DNA with the following primers:
4 RT N terminus 5'GAC GAC GAC AAG ATG ACC CTA AAT ATA GAA GAT RT C
terminus 5'GGA ACA AGA CCC GTC AAG CTT TGC AGG TCT CAG TG
[0175] The PCR products were cloned into the Affinity.TM. LIC
vector and the annealed products transformed into XL10 Gold. The
inserts from several clones were amplified, and the PCR products
sequenced. 600 bp was sequenced from each of Ten MMLV-RT clones
with the two above primers.
[0176] A 720 bp gene encoding humanized Renilla reniformis green
fluorescent protein (GFP) was the third mutagenesis target. 1 ng of
plasmid (about 0.1 ng of target) was amplified from template with
the primers:
5 5' Retro primer 5'GGC TGC CGA CCC CGG GGG TGG 3' pFB primer 5'CGA
ACC CCA GAG TCC CGC TCA
[0177] The PCR products were cloned into the EcoR1/Xho1 sites of
the pFB retroviral vector (CAT#217563). Strataprep minipreps were
performed for six GFP clones. 720 bp from each clone was sequenced
with the above primers.
[0178] All PCRs were performed in a Robocycler 40 with hot top.
Cycling parameters were as described in the lacZ assay except that
2.5 minute extension times were used for the RT gene.
[0179] Data obtained in seven different experiments were shown in
FIG. 5. These data were generated from 23 different PCR reactions
employing varying amounts of input template. Mutation frequencies
were measured using lacZ (diamond), MMLV RT (rectangle), or GFP
(circle) as the mutational target gene. Two to ten clones from each
PCR reaction were sequenced. A total of 800-5250 bases of DNA
sequence for each data point were analyzed to calculate the
mutation frequency.
[0180] As expected, mutation frequency increased with increasing d
value. The mutation frequencies obtained using the MMLV-RT target
gene (d=17) and the GFP target gene (d=15) were consistent with the
mutation frequencies observed using lacZ and similar template
duplications. The equation of the line relating mutation frequency
(mut/kb) to d value was calculated as: mut/kb=0.31d+0.41 with a
correlation coefficient of 0.65.
[0181] Table 3 shows the spectrum of mutations produced using the
reverse transcriptase (RT) and GFP genes (in the pH 8.8 buffer),
which is imilar to that generated using the lacZ gene (Table
2).
6TABLE 3 Mutation frequency and spectrum of Mutazyme RTpH 8.8 GFPpH
8.8 % total Mutations % total Mutations Transitions A.fwdarw.G 3.1
10 G.fwdarw.A 21.9 10 T.fwdarw.C 6.3 5 C.fwdarw.T 9.4 25
Transversions G.fwdarw.T 9.4 15 T.fwdarw.G 6.3 0 C.fwdarw.A 0 0
A.fwdarw.C 0 0 Transversions A.fwdarw.T 6.3 0 T.fwdarw.A 18.8 10
G.fwdarw.C 9.4 10 C.fwdarw.G 6.3 5 Insertions 0 0 Deletions 3.1 10
Ts/Tv 0.7 1.5 kb analyzed 4.8 4.5
Example 4
[0182] The mutation spectrum of Mutazyme from Table 2 is compared
to that generated by Taq DNA polymerase using the Clontech
Diversify.TM. Random Mutagenesis kit (Clontech, Cat. #k1830-1)
(Table 4). Mutazyme PCR mutagenesis was performed using lacZ DNA
template as described in Example 1.
7TABLE 4 Comparison of Mutation spectra generated by Mutazyme and
Taq DNA polymerase Taq DNA Pol.* Taq DNA Pol.* Taq DNA Pol.*
Condition 2 Condition 3 Mutazyme Condition 1 low medium high
mutagenic pH 8.8 mutagenic rate mutagenic rate rate buffer Ts/Tv
0.9 1.3 3.9 1.2 GC/AT 0.13 0.34 0.07 5 Transitions A.fwdarw.G,
T.fwdarw.C 33.3 42.7 74.0 10.3 G.fwdarw.A, C.fwdarw.T 8.3 11.5 4.9
43.7 Transversions A.fwdarw.T, T.fwdarw.A 16.7 26.0 13.8 11.1
A.fwdarw.C, T.fwdarw.G 27.8 8.3 4.1 4.2 G.fwdarw.C, C.fwdarw.G 0 0
1.6 8.8 G.fwdarw.T, C.fwdarw.A 0 6.3 0.8 20.0 Insertions 2.8 2.1 0
0.8 Deletions 11.1 3.1 0.8 1.1 Mut/kb 2 4.6 8.1 1-20** *The Taq
data in Table 4 was obtained from Clontech's product literature on
the Diversify kit (Diversify .TM. PCR Ransom Mutagenesis Kit User
Manual PT3393-1, catalog # K1830-1). **Mut/kb varies with d
value.
[0183] The types of mutations made by Mutazyme are different from
the types of mutations produced by Taq DNA polymerase. Bias in
mutation spectra can be analyzed by assessing the Ts/Tv and GC/AT
ratios. Both Taq and Mutazyme tend to make transition mutations
more often than transversion mutations (with Ts/Tv greater than
0.5). However, Mutazyme preferentially mutated G or C nucleotides
(GC/AT being 5) while Taq DNA polymerase preferentially mutated A
or T nucleotides GC/AT average 0.13).
[0184] Similar to Taq DNA polymerase, Mutazyme generated mutations
are uniformly distributed on the nucleic acid template of
mutations.
[0185] The mutation frequencies of Mutazyme were also compared to
PfuTurbo (Stratagene, Cat. #600252) and Taq2000 (Stratagene, Cat.
#600196) using the lacZ assay. PCR with Mutazyme was performed as
described in Example 1, and PCR reactions for the other two enzymes
were performed as recommended in the product manual. Each
polymerase was used at 2.5 units/50 .mu.l PCR reaction.
[0186] FIG. 4 shows a comparison of percent white (mutant) colonies
vs duplications (d) for Mutazyme, PfuTurbo, and Taq (in
Mg++buffer). For each polymerase four reactions consisting of a
single round of PCR (d=8,11,15,17) and one reaction consisting of
two sequential PCRs (d=28) were performed. As expected, the number
of mutant clones is directly related to d value for all three
polymerases tested. The plot for Mutazyme, which should have the
highest mutation frequency, exhibited the greatest slope. PfuTurbo,
which should have the lowest mutation frequency, produced a level
of errors at or near background until d=17. The plot for Taq is
intermediate between the two as expected (error rates: Pfu
1.3.times.10.sup.-6, Taq 8.times.10.sup.-6, Mutazyme
47.times.10.sup.-6 mutations/bp/d). Although the graph does not
give actual values for mutation frequency, it does show that
Mutazyme is error prone and produces an increase in number of
mutant clones as d increases.
[0187] The addition of PEF in the mutazyme did not alter the
mutation frequency of exo- Pfu DNA polymerase.
Example 5
[0188] To obtain a mutation frequency greater than 10 mutations/kb
or a d value greater than 20, one or more additional PCR reactions
were employed.
[0189] A portion of the first PCR reaction was re-amplified. One
microliter of the first PCR (either the products from the 1 ng or
the 100 pg reaction above) was diluted 1:1000 in TE and 1 .mu.l of
the dilution was added to a second 50 .mu.l PCR reaction. The
reaction conditions were the same as described in Example 1. A
third PCR can also be carried out using the re-amplification
products as template by diluting a portion of the second PCR 1:1000
in TE and then amplifying 1 .mu.l in a third 50 .mu.l PCR
reaction.
[0190] Table 5 lists the range of mutation frequencies expected for
the indicated amount of starting template and assuming product
yields of 0.5-10 .mu.g/50 .mu.l reaction. These values were
calculated from the equation MF=0.31d+0.41. If the first PCR has ad
value of about 17 (mutation frequency of 6 mut/kb) and the second
PCR has a d value of 18. The total d value is 35. The mutation
frequency, as determined by DNA sequencing of randomly selected
clones, was found to be 14 mut/kb.
8TABLE 5 Mutation/kb Experimental Start Calculated Actual Average
Mutation Start fmole mut/kb mut/kb mut/kb Level 100 ng 400 1.1-2.5
0.8-1.5 1.2 Low 10 ng 40 2.1-3.5 0.8-3.3 1.9 0-3 mut/kb 1 ng 4
3.2-4.5 3.3-7.2 5.3 Medium 100 pg 0.4 4.2-5.6 2.7-11.7 5.9 3-8
mut/kb 10 pg 0.04 5.2-6.6 5.2-11.7 6.6 Double 5.7-12.8 6.7-14.1
10.0 High 6-16 PCR mut/kb Triple 8.8-17.5 16.1 16.1 PCR
Example 6
[0191] Terminal Extendase Activity Assay
[0192] The Mutazyme amplified PCR product was examined by a
terminal extendaseactivity assay to determine whether the products
have blunt ends or sticky ends. Taq DNA polymerase amplified
products are known to have 3' overhangs, which are predominantly 3'
dAs.
[0193] Two primers were used:
9 Primer #1 5'CCA TGA TTA CGC CAA GCG CGC AAT TAA CCC TCA C Primer
#2 5'GTG AGG GTT AAT TGC GCG CTT GGC GTA ATC ATG G
[0194] 100 ng of primer #1 was 5' end labeled with .gamma..sup.33p
dATP and the KinAce-It kit (Cat #200390). The products were
purified with a NucTrap column (Cat#400701). The final volume was
120 .mu.l at 20,000 cpms/.mu.l. 100 ng of primer #2 was annealed to
primer #1 to create a blunt ended double stranded template. A 10
.mu.l extension reaction was prepared consisting of 1.times. buffer
(the pH 8.8 buffer or Taq PCR buffer as used for Taq2000, Cat
#400701), 200 .mu.M of one dNTP, 1 .mu.l of oligo template (0.8
ng), and 2.5 units of Mutazyme or Taq2000 DNA polymerase. Extension
was carried out for 10 minutes at 72.degree. C. in a Robocycler 40
with a hot top. 3 .mu.l of Novex loading dye was added. Samples
were heated to 85.degree. C. and run on a 6% CastAway gel
(cat#401094). Autoradiography was performed for 2 days at room
temperature.
[0195] As shown in FIG. 2, Taq2000 added one A to the end of the
fragment, but did not add C, G, or T. Mutazyme did not extend with
any of the four dNTPs. Therefore, PCR products produced with
Mutazyme have blunt ends.
[0196] The foregoing is merely illustrative of the invention and is
not intended to limit the invention to the disclosed compositions,
kits and methods. Variation and changes are intended to be within
the scope and nature of the invention.
Example 7
[0197] exo- JDF-3 DNA polymerase for error prone PCR.
[0198] exo- JDF-3 was used for error prone PCR in different
buffers, with different concentrations of Mn.sup.2+ and Mg.sup.2+
(separate and combined), and different concentrations of dNTPs
(balanced and different ratios). Highest product yields were
obtained using Taq PCR buffer (50 mM KCl, 10 mM Tris HCl (pH 8.8),
0.1% gelatin, 1.5 mM MgCl.sub.2). In reactions employing Mn.sup.2+,
it was found that JDF-3 produced amplification product in the
presence of 0.5 mM MnCl.sub.2, and that product yields were highest
when MgCl.sub.2 was completely omitted from Mn.sup.2+-containing
reactions.
[0199] Because exo-JDF-3 could amplify in the presence of Mn.sup.2+
alone, unbalanced dNTPs were not used to further increase its error
rate. Instead, balanced dNTPs were used. It was found that 0.45-1.0
mM each dNTP gave better yields than 200 uM each dNTP. Thus final
error prone PCR conditions with exo- JDF-3 are 5U DNA polymerase,
lx Mg-free Taq PCR buffer, 0.5 mM MnCl.sub.2, and 0.45 mM each
dNTP.
[0200] The following reaction mixture was used with exo.sup.- JDF-3
DNA polymerase mutagenesis:
10 1x magnesium free Taq Buffer (Stratagene catalog #200530) 450
.mu.M each deoxynucleotide (dGTP, dATP, TTP and dCTP) 2 ng/.mu.l
Primer 923 (also called 490) 2 ng/.mu.l Primer 721 .sup. 0.1
u/.mu.l exo JDF-3 DNA polymerase .sup. 0.5 mM MnCl.sub.2 .sup. 0.1
pM plasmid DNA
[0201] PCRs were carried out using Stratagene's ROBOCYCLER.TM. 40
Temperature Cycler with a Hot Top assembly. The following cycling
conditions were used:
[0202] 1) 95.degree. C. for 1 minute
[0203] 2) 95.degree. C. for 1 minute
[0204] 3) 54.degree. C. for 1 minute
[0205] 4) 72.degree. C. for 2.5 minutes
[0206] 5) Repeat steps 2 through 4 thirty times.
[0207] It is understood that the foregoing detailed description is
given merely by way of illustration and that modifications and
variations may be made therein without departing from the spirit
and scope of the invention.
REFERENCES
[0208] 1. Andre, P., Kim, A., Khrapko, K. and Thilly, W. G. (1997)
Fidelity and mutational spectrum of Pfu DNA polymerase on a human
mitochondrial DNA sequence. Genome Res. 7:843-852
[0209] 2. Ausubel et al., John Weley & Sons, Inc., 1997,
Current Protocols in Molecular Biolog
[0210] 3. Berger, SL, 1994, Annual Biochem. 222:290-293
[0211] 4. Borns, M. and Hogrefe, H. (2000) Unique DNA polymerase
formulation excels in a broad range of PCR applications. Strategies
13(1)
[0212] 5. Cadwell, R. C. and Joyce, G. F. 1992. Randomization of
genes by PCR mutagenesis. PCR Methods Appl. 2:28-33
[0213] 6. Cariello et al., 1991, Nucleic Acids Res, 19: 4193
[0214] 7. Cherry, J. R. Lamsa, M. H., Schneider, P., Vind, J.,
Svendsen, A., Jones, A., and Pedersen, A. H. 1999. Directed
evolution of a fungal peroxidase. Nat. Biotechnol. 17:379-384
[0215] 8. Chien et al., 1976, J. Bacteoriol, 127: 1550
[0216] 9. Cline et al., 1996, Nucleic acid Research,
24:3546-3551
[0217] 10. Cline, J., Braman, J. C. and Hogrefe, H. H. (1996) PCR
fidelity of Pfu DNA polymerase and other thermostable DNA
polymerases. Nucleic Acids Res. 24(18):3546-3551
[0218] 11. Daugherty, P. S., Chen, G., Iverson, B. L., and
Georgiou, G. 2000. Quantitative analysis of the effect of the
mutation frequency on the affinity maturation of single chain Fv
antibodies. Proc. Natl. Acad. Sci. U.S.A. 97:2029-2034
[0219] 12. Diaz and Sabino, 1998 Braz J. Med. Res, 31:1239
[0220] 13. Eckert, K. A. and Kunkel, T. A. (90) Nucl. Acids Res.
18:3739-44
[0221] 14. Eckert, K. A. and Kunkel, T. A. (91) PCR Methods Appl.
1: 17-24
[0222] 15. Fromant, M, Blanquet, S. and Plateau, P. 1995. Direct
random mutagenesis of gene-sized DNA fragments using polymerase
chain reaction. Anal Biochem. 224(1):347-353
[0223] 16. Hogrefe, H., Scott, B., Nielson, K., Hedden, V., Hansen,
C., Cline, J., Bai, F., Amberg, J., Allen, R., Madden, M.(1997)
Novel PCR enhancing factor improves performance of Pfu DNA
polymerase. Strategies 10(3):93-96
[0224] 17. Hu, G. (1993) DNA polymerase-catalyzed addition of
nontemplated extra nucleotides to the 3' end of a DNA fragment. DNA
Cell Biol 12(8):763-770
[0225] 18. Juncosa-Ginesta et al., 1994, Biotechniques, 16:820
[0226] 19. Jung, et al, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:
8287
[0227] 20. Keohavong, P., Ling, L., Dias, C. and Thilly, W. G.
(1993) Predominant mutations induced by the Thermococcus litoralis,
Vent polymerase during DNA amplification in vitro. PCR Methods
Applic. 2:288-292
[0228] 21. Landre P A, Celfand D H, and Watson E M, in PCR
Strategies, Academic Press, 1995, page 3-16
[0229] 22. Lecomte and Doubleday, 1983, Nucleic Acids Res.
11:7505
[0230] 23. Leung, D. W., Chen, E., and Goeddel, D. V. 1989. A
method for random mutagenesis of a defined DNA segment using a
modified polymerase chain reaction. Technique 1:11-15
[0231] 24. Ling, L. L., Keohavong, P, Dias, C., and Thilly, W. G.
(91) PCR Methods Appl. 1:63-69
[0232] 25. Lundberg et al., 1991, Gene, 108:1
[0233] 26. Melnikov, A. and Youngman, P. J. (1999) Random
mutagenesis by recombinational capture of PCR products in Bacillus
subtilis and Acinetobacter calcoaceticus. Nucleic Acids Res.
27(4):1056-1062
[0234] 27. Mullis and Faloona, 1987, Methods Enzymol., 155:335
[0235] 28. Myers and Gelfand 1991, Biochemistry 30:7661
[0236] 29. Nishiya, Y. and Imanaka, T. 1994. Alteration of
substrate specificity and optimum pH of sarcosine oxidase by random
and site-directed mutagenesis. Appl. Env. Microbiol.
60:4213-4215
[0237] 30. Nordstrom et al., 1981, J. Biol. Chem. 256:3112
[0238] 31. Patel, P H., Kawate, H., Adman, E., Ashbach, M., and
Loeb, L A. 2001. J. Biol. Chem. 276: 5044-5051
[0239] 32. Sambrook et al., Molecular Cloning second edition, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)
[0240] 33. Shafikhani, R A, Feviari E., and Schellenberger V.,
1997, Generation of large libraries of random mutants in Bacillus
subtilis by PCR-based plasmid multimerization, Biotechniques 23
:304-310
[0241] 34. Shafikhani, S., Siegel, R. A., Ferrari, E. and
Schellenberger, V. (1997) Generation of large libraries of random
mutants in Bacillus subtilis by PCR-based plasmid multimerization.
Biotechniques 23(2) 304-310
[0242] 35. Southworth et al., 1996, Proc. Natl. Acad. Sci
93:5281
[0243] 36. Stemmer, W. P. 1994. DNA shuffling by random
fragmentation and reassembly: in vitro recombination for molecular
evolution. Proc. Natl. Acad. Sci. USA 91:10747-10751
[0244] 37. Stenesh and McGowan, 1977, Biochim Biophys Acta
475:32
[0245] 38. Sun y, Hegamyer, G., and Colburn, N H 1993,
BioTechniques 15: 372-4
[0246] 39. Takagi et al., 1997, Appl. Environ. Microbiol.
63:4504
[0247] 40. Vartanian, J. P., Henry, M., and Wain-Hobson, S. 1996.
Hypermutagenic PCR involving all four transitions and a sizeable
proportion of transversions. Nucleic Acids Res. 24:2627-2631
[0248] 41. Wan, L., Twitchett, M. B., Eltis, L. D., Mauk. A. G.,
and Smith, M. 1998. In vitro evolution of horse heart myoglobin to
increase peroxidase activity. Proc. Natl. Acad. Sci. U.S.A.
95:12825-12831
[0249] 42. You, L. and Arnold, F. H. 1996. Directed evolution of
subtilisin E in Bacillus subtilis to enhance total activity in
aqueous dimethylformamide. Protein Eng. 9:77-83
[0250] 43. You, L. and Arnold, F. H. 1996. Directed evolution of
subtilisin E in Bacillus subtilis to enhance total activity in
aqueous dimethylformamide. Protein Eng. 9:77-83
* * * * *