U.S. patent application number 10/240485 was filed with the patent office on 2003-08-07 for diagnosis of diseases associated with metastasis.
Invention is credited to Berlin, Kurt, Olek, Alexander, Piepenbrock, Christian.
Application Number | 20030148327 10/240485 |
Document ID | / |
Family ID | 27437807 |
Filed Date | 2003-08-07 |
United States Patent
Application |
20030148327 |
Kind Code |
A1 |
Olek, Alexander ; et
al. |
August 7, 2003 |
Diagnosis of diseases associated with metastasis
Abstract
The present invention relates to the chemically modified genomic
sequences of genes associated with metastasis, to oligonucleotides
and/or PNA-oligomers for detecting the cytosine methylation state
of genes associated with metastasis which are directed against the
sequence, as well as to a method for ascertaining genetic and/or
epigenetic parameters of genes associated with metastasis.
Inventors: |
Olek, Alexander; (Berlin,
DE) ; Piepenbrock, Christian; (Berlin, DE) ;
Berlin, Kurt; (Stahnsdorf, DE) |
Correspondence
Address: |
DAVIDSON, DAVIDSON & KAPPEL, LLC
485 SEVENTH AVENUE, 14TH FLOOR
NEW YORK
NY
10018
US
|
Family ID: |
27437807 |
Appl. No.: |
10/240485 |
Filed: |
January 21, 2003 |
PCT Filed: |
April 6, 2001 |
PCT NO: |
PCT/EP01/03970 |
Current U.S.
Class: |
435/6.12 ;
435/91.2; 536/24.3 |
Current CPC
Class: |
C07K 14/4703 20130101;
A61P 7/04 20180101; C12Q 1/6883 20130101; A61P 13/12 20180101; C12Q
1/6886 20130101; A61P 11/06 20180101; A61P 35/00 20180101; C12Q
2600/154 20130101; A61P 29/00 20180101; C12Q 2600/156 20130101;
C07K 14/82 20130101; A61P 9/10 20180101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/24.3 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 6, 2000 |
DE |
10019058.8 |
Apr 7, 2000 |
DE |
10019173.8 |
Jun 30, 2000 |
DE |
100529.7 |
Sep 1, 2000 |
DE |
10043826.1 |
Claims
1. A nucleic acid comprising a sequence at least 18 bases in length
of a segment of the chemically pretreated DNA of genes associated
with metastasis according to one of the sequences taken from the
group of Seq. ID No. 1 to Seq. ID No. 198 and sequences
complementary thereto.
2. A nucleic acid comprising a sequence at least 18 base pairs in
length of the chemically pretreated DNA of genes associated with
metastasis according to one of the sequences according to one of
the genes CD20 (L23418), FN1 (M10905), SDC2 (J04621), ACTG1
(NM.sub.--001614), CDH2 (NM.sub.--001792), CDH4 (NM.sub.--001794),
CDW52 (NM.sub.--001803), ITGAX (NM.sub.--000887), NM.sub.--002211,
ITGB5 (NM.sub.--002213), ITGB7 (NM.sub.--000889), NEOI
(NM.sub.--002499), PCDH1 (NM.sub.--002587), ENPPI
(NM.sub.--006208), RTNI (NM.sub.--021136), SELPLG
(NM.sub.--003006), TM4sf2 (NM.sub.--004615), ITGEA
(NM.sub.--002208), SPTB (NM.sub.--000347), ITGB1 (NM.sub.--002211)
and sequences complementary thereto.
3. An oligomer, in particular an oligonucleotide or peptide nucleic
acid (PNA)-oligomer, said oligomer comprising in each case at least
one base sequence having a length of at least 9 nucleotides which
hybridizes to or is identical to a chemically pretreated DNA of
genes associated with metastasis according to one of the Seq ID Nos
1 to 198 according to claim 1 or to a chemically pretreated DNA of
genes according to claim 2 and sequences complementary thereto.
4. The oligomer as recited in claim 3; wherein the base sequence
includes at least one CpG dinucleotide.
5. The oligomer as recited in claim 3; characterized in that the
cytosine of the CpG dinucleotide is located approximately in the
middle third of the oligomer.
6. A set of oligomers, comprising at least two oligomers according
to any of claims 3 to 5.
7. A set of oligomers as recited in claim 6, comprising oligomers
for detecting the methylation state of all CpG dinucleotides within
one of the sequences according to Seq. ID Nos. 1 through 198
according to claim 1 or a chemically pretreated DNA of genes
according to claim 2, and sequences complementary thereto.
8. A set of at least two oligonucleotides as recited in claim 3,
which can be used as primer oligonucleotides for the amplification
of DNA sequences of one of Seq. ID No. 1 through Seq. ID No. 198
and sequences complementary thereto and/or sequences of a
chemically pretreated DNA of genes according to claim 2, and
sequences complementary thereto and segments thereof.
9. A set of oligonucleotides as recited in claim 8, characterized
in that at least one oligonucleotide is bound to a solid phase.
10. Use of a set of oligomer probes comprising at least ten of the
oligomers according to any of claims 6 through 9 for detecting the
cytosine methylation state and/or single nucleotide polymorphisms
(SNPs) in a chemically pretreated genomic DNA according to claim 1
or a chemically pretreated DNA of genes according to claim 2.
11. A method for manufacturing an arrangement of different
oligomers (array) fixed to a carrier material for analyzing
diseases associated with the methylation state of the CpG
dinucleotides of one of the Seq. ID No. 1 through Seq. ID No. 198
and sequences complementary thereto and/or chemically pretreated
DNA of genes according to claim 2, wherein at least one oligomer
according to any of the claims 3 through 5 is coupled to a solid
phase.
12. An arrangement of different oligomers (array) obtainable
according to claim 11.
13. An array of different oligonucleotide- and/or PNA-oligomer
sequences as recited in claim 12, characterized in that these are
arranged on a plane solid phase in the form of a rectangular or
hexagonal lattice.
14. The array as recited in any of the claims 12 or 13,
characterized in that the solid phase surface is composed of
silicon, glass, polystyrene, aluminium, steel, iron, copper,
nickel, silver, or gold.
15. A DNA- and/or PNA-array for analyzing diseases associated with
the methylation state of genes, comprising at least one nucleic
acid according to one of the preceeding claims.
16. A method for ascertaining genetic and/or epigenetic parameters
for the diagnosis and/or therapy of existing diseases or the
predisposition to specific diseases by analyzing cytosine
methylations, characterized in that the following steps are carried
out: a) in a genomic DNA sample, cytosine bases which are
unmethylated at the 5-position are converted, by chemical
treatment, to uracil or another base which is dissimilar to
cytosine in terms of hybridization behavior; b) fragments of the
chemically pretreated genomic DNA are amplified using sets of
primer oligonucleotides according to claim 8 or 9 and a polymerase,
the amplificates carrying a detectable label; c) Amplificates are
hybridized to a set of oligonucleotides and/or PNA probes according
to the claims 6 and 7, or else to an array according to one of the
claims 12 through 15; d) the hybridized amplificates are
subsequently detected.
17. The method as recited in claim 16, characterized in that the
chemical treatment is carried out by means of a solution of a
bisulfite, hydrogen sulfite or disulfite.
18. The method as recited in one of the claims 16 or 17,
characterized in that more than ten different fragments having a
length of 100-2000 base pairs are amplified.
19. The method as recited in one of the claims 16 through 18,
characterized in that the amplifiction of several DNA segments is
carried out in one reaction vessel.
20. The method as recited in one of the claims 16 through 19,
characterized in that the polymerase is a heat-resistant DNA
polymerase.
21. The method as recited in claim 20, characterized in that the
amplification is carried out by means of the polymerase chain
reaction (PCR).
22. The method as recited in one of the claims 16 through 21,
characterized in that the labels of the amplificates are
fluorescence labels.
23. The method as recited in one of the claims 16 through 21,
characterized in that the labels of the amplificates are
radionuclides.
24. The method as recited in one of the claims 16 through 21,
characterized in that the labels of the amplificates are detachable
molecule fragments having a typical mass which are detected in a
mass spectrometer.
25. The method as recited in one of the claims 16 through 21,
characterized in that the amplificates or fragments of the
amplificates are detected in the mass spectrometer.
26. The method as recited in one of the claims 24 and/or 25,
characterized in that the produced fragments have a single positive
or negative net charge for better detectability in the mass
spectrometer
27. The method as recited in one of the claims 24 through 26,
characterized in that detection is carried out and visualized by
means of matrix assisted laser desorption/ionization mass
spectrometry (MALDI) or using electron spray mass spectrometry
(ESI).
28. The method as recited in one of the claims 16 through 27,
characterized in that the genomic DNA is obtained from cells or
cellular components which contain DNA, sources of DNA comprising,
for example, cell lines, biopsies, blood, sputum, stool, urine,
cerebral-spinal fluid, tissue embedded in paraffin such as tissue
from eyes, intestine, kidney, brain, heart, prostate, lung, breast
or liver, histologic object slides, and all possible combinations
thereof.
29. A kit comprising a bisulfite (=disulfite, hydrogen sulfite)
reagent as well as oligonucleotides and/or PNA-oligomers according
to one of the claims 3 through 5.
30. The use of a nucleic acid according to claims 1 or 2, of an
oligonucleotide or PNA-oligomer according to one of the claims 3
through 5, of a kit according to claim 29, of an array according to
one of the claims 12 through 15, of a set of oligonucleotides
according to one of claims 6 through 9 for the diagnosis of solid
tumours and cancer.
31. The use of a nucleic acid according to claims 1 or 2, of an
oligonucleotide or PNA-oligomer according to one of claims 3
through 5, of a kit according to claim 29, of an array according to
one of the claims 12 through 15, of a set of oligonucleotides
according to one of claims 6 through 9 for the therapy of solid
tumours and cancer.
32. A kit, comprising a bisulfite (=disulfite, hydrogen sulfite)
reagent as well as oligonucleotides tides and/or PNA-oligomers
according to one of claims 3 through 5.
Description
FIELD OF THE INVENTION
[0001] The levels of observation that have been well studied by the
methodological developments of recent years in molecular biology,
are the genes themselves, the translation of these genes into RNA,
and the resulting proteins. The question of which gene is switched
on at which point in the course of the development of an
individual, and how the activation and inhibition of specific genes
in specific cells and tissues are controlled is correlatable to the
degree and character of the methylation of the genes or of the
genome. In this respect, pathogenic conditions may manifest
themselves in a changed methylation pattern of individual genes or
of the genome.
[0002] The present invention relates to nucleic acids,
oligonucleotides, PNA-oligomers and to a method for the diagnosis
and/or therapy of diseases which have a connection with the genetic
and/or epigenetic parameters of genes associated with metastasis
and, in particular, with the methylation status thereof.
PRIOR ART
[0003] The key feature of malignant cells is their ability to
invade normal healthy tissue and to be disseminated through the
body to distant organs. This ability, known as metastasis, is one
of the most fatal metastasis of cancer. In breast cancer for
example, the extent of metastasis to the lymph nodes is a key
prognostic factor of the disease. Approximately 30% of cancers are
metastatic at the time of diagnosis, and a further 30-40% of the
remaining case harbour occult metastases.
[0004] Metastasis is a highly complicated pathway involving
multiple proteolytic enzymes, cell adhesion, deformability, cell
receptors and motility. Cancer metastasis can be described in the
following steps. The initial events involve establishment of the
primary tumour. These comprise prise the initial transforming event
and proliferation of the transformed cells followed by evasion of
the immune mechanism and establishment of a nutritional supply.
[0005] From the primary tumour, metastasis proceeds by local
invasion and destruction of extracellular matrix and parenchymal
cells. It is hypothesised that destruction of the basement membrane
proceeds in a two step manner. Firstly, the cancer cell attaches
itself to the membrane, this is mediated by the binding of tumour
cell surface proteins to glycoproteins, such as laminin, type IV
collagen, and fibronectin. Invasion then proceeds by enzymatic
means, both proteinases (serine, cysteine, aspartic proteinases and
metalloproteinases) and tumour secreted hydrolytic enzymes (e.g.
glycosidase, hyaluronidase and heparanase) have been
implicated.
[0006] The next step involves the migration of tumour cells from
the primary tumour. The movement of the cells through biological
barriers may be driven by a number of factors. These include
tumour-derived chemotactic factors, host-derived chemoattractants,
and combinations of the two. Studies have shown that tumor cells
respond chemotactically to growth factors, collagen, peptides,
matrix components and proteolytic fragments of matrix components,
adhesion proteins such as laminin and fibronectin, and
tumour-derived attractants. Furthermore, the importance of
autocrine growth factors for transformed cell motility has also
been demonstrated.
[0007] The mobilised cells then attempt to penetrate blood vessel
walls. Once the mobilised cells enter the blood stream they are
embolized to distant organs. The cells may then be arrested in the
lumen of small blood vessels or lymphatics. The cancer cells then
proceed to extrude themselves through the walls of the vessels.
Establishment of secondary tumours then proceeds by proliferation
of the transformed cells followed by evasion of the immune
mechanism and establishment of a nutritional supply.
[0008] The metastatic pathways involve the recruitment of enzymes
used in many different normal pathways. Therefore the key
difference between normal cells and malignant cancerous cells can
be defined as one of gene regulation. DNA methylation has been
implicated as a key regulatory mechanism in tumorigenesis, the role
of methylation in tumorigenesis has been reviewed by Singal and
Ginder `DNA Methylation` Blood, Vol. 93 No. 12 (June 15), 1999: pp.
4059-4070. Examples of methylation linked oncogenesis include:
[0009] Head and neck cancer (Sanchez-Cespedes M et al. "Gene
promoter hypermethylation in tumours and serum of head and neck
cancer patients" Cancer Res. 2000 Feb. 15; 60 (4):892-5)
[0010] Hodgkin's disease (Garcia J F et al "Loss of p16 protein
expression associated with methylation of the p16INK4A gene is a
frequent finding in Hodgkin's disease" Lab invest 1999 December; 79
(12):1453-9)
[0011] Gastric cancer (Yanagisawa Y et al. "Methylation of the
hMLH1 promoter in familial gastric cancer with microsatellite
instability" Int J Cancer 2000 Jan. 1; 85 (1):50-3)
[0012] There is a continuing need to develop new methods of
treatment and diagnosis of cancer. The identification of the
methylation dependant regulation of cancer genes has opened up the
possibility of creating alternative methods of cancer treatment and
diagnosis. Treatment with DNA methylation inhibitors has been shown
to restore gene expression of the key tumor suppressor genes and
oncogenes gene p16, Bender et. al. "Inhibition of DNA methylation
by 5-aza-2'-deoxycydine suppresses the growth of human tumor cell
lines." Cancer research 58; 95-101 (1998). This resulted in
heritable levels of gene expression leading to suppression of
growth in tumor cell lines.
[0013] Methylation based therapies could have considerable
advantages over current methods of treatment, such as chemotherapy,
surgery and radiotherapy. They may even provide a means of treating
tumors which are resistant to conventional methods of therapy, as
demonstrated by Soengas et al "Inactivation of the apoptosis
effector Apaf-1 in malignant melanoma" Nature 409; 207-211(2001).
In addition to the development of methylation specific therapies,
experiments with Min mice have shown that inhibition of DNA
methylation can suppress tumor initiation, Laird et. al.
"Suppression of intestinal neoplasia by DNA hypomethylation" Cell
81; 197-205 (1995). Furthermore, DNA methylation analysis may
provide novel means for cancer diagnosis.
[0014] The identification of methylation as a regulatory mechanism,
and of the characterisation of the components of the metastatic
cascade provides a novel basis for the development of therapies and
diagnostics, through the methylation analysis of metastasis related
genes.
[0015] 5-methylcytosine is the most frequent covalent base
modification in the DNA of eukaryotic cells. It plays a role, for
example, in the regulation of the transcription, in genetic
imprinting, and in tumorigenesis. Therefore, the identification of
5-methylcytosine as a component of genetic information is of
considerable interest. However, 5-methylcytosine positions cannot
be identified by sequencing since 5-methylcytosine has the same
base pairing behavior as cytosine. Moreover, the epigenetic
information carried by 5-methylcytosine is completely lost during
PCR amplification.
[0016] A relatively new and currently the most frequently used
method for analyzing DNA for 5-methylcytosine is based upon the
specific reaction of bisulfite with cytosine which, upon subsequent
alkaline hydrolysis, is converted to uracil which corresponds to
thymidine in its base pairing behavior. However, 5-methylcytosine
remains unmodified under these conditions. Consequently, the
original DNA is converted in such a manner that methylcytosine,
which originally could not be distinguished from cytosine by its
hybridization behavior, can now be detected as the only remaining
cytosine using "normal" molecular biological techniques, for
example, by amplification and hybridization or sequencing. All of
these techniques are based on base pairing which can now be fully
exploited. In terms of sensitivity, the prior art is defined by a
method which encloses the DNA to be analyzed in an agarose matrix,
thus preventing the diffusion and renaturation of the DNA
(bisulfite only reacts with single-stranded DNA), and which
replaces all precipitation and purification steps with fast
dialysis (Olek A, Oswald J, Walter J. A modified and improved
method for bisulphite based cytosine methylation analysis. Nucleic
Acids Res. 1996 Dec. 15; 24(24):5064-6). Using this method, it is
possible to analyze individual cells, which illustrates the
potential of the method. However, currently only individual regions
of a length of up to approximately 3000 base pairs are analyzed, a
global analysis of cells for thousands of possible methylation
events is not possible. However, this method cannot reliably
analyze very small fragments from small sample quantities either.
These are lost through the matrix in spite of the diffusion
protection.
[0017] An overview of the further known methods of detecting
5-methylcytosine may be gathered from the following review article:
Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998,
26, 2255.
[0018] To date, barring few exceptions (e.g., Zeschnigk M, Lich C,
Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the
diagnosis of Angelman and Prader-Willi syndrome based on allelic
methylation differences at the SNRPN locus. Eur J Hum Genet. 1997
March-April; 5(2):94-8) the bisulfite technique is only used in
research. Always, however, short, specific fragments of a known
gene are amplified subsequent to a bisulfite treatment and either
completely sequenced (Olek A, Walter J. The pre-implantation
ontogeny of the H19 methylation imprint. Nat Genet. 1997 November;
17(3):275-6) or individual cytosine positions are detected by a
primer extension reaction (Gonzalgo M L, Jones P A. Rapid
quantitation of methylation differences at specific sites using
methylation-sensitive single nucleotide primer extension
(Ms-SNuPE). Nucleic Acids Res. 1997 Jun. 15; 25(12):2529-31, WO
95/00669) or by enzymatic digestion (Xiong Z, Laird P W. COBRA: a
sensitive and quantitative DNA methylation assay. Nucleic Acids
Res. 1997 Jun. 15; 25(12):2532-4). In addition, detection by
hybridization has also been described (Olek et al., WO
99/28498).
[0019] Further publications dealing with the use of the bisulfite
technique for methylation detection in individual genes are: Grigg
G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA.
Bioessays. 1994 June; 16(6):431-6, 431; Zeschnigk M, Schmitz B,
Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments
in the human genome: different DNA methylation patterns in the
Prader-Willi/Angelman syndrome region as determined by the genomic
sequencing method. Hum Mol Genet. 1997 March; 6(3):387-95; Feil R,
Charlton J, Bird A P, Walter J, Reik W. Methylation analysis on
individual chromosomes: improved protocol for bisulphite genomic
sequencing. Nucleic Acids Res. 1994 Feb. 25; 22(4):695-6; Martin V,
Ribieras S, Song-Wang X, Rio M C, Dante R. Genomic sequencing
indicates a correlation between DNA hypomethylation in the 5'
region of the pS2 gene and its expression in human breast cancer
cell lines. Gene. 1995 May 19; 157(1-2):261-4; WO 97 46705, WO 95
15373 and WO 97/45560.
[0020] An overview of the Prior Art in oligomer array manufacturing
can be gathered from a special edition of Nature Genetics (Nature
Genetics Supplement, Volume 21, January 1999), published in January
1999, and from the literature cited therein.
[0021] Fluorescently labeled probes are often used for the scanning
of immobilized DNA arrays. The simple attachment of Cy3 and Cy5
dyes to the 5'-OH of the specific probe are particularly suitable
for fluorescence labels. The detection of the fluorescence of the
hybridized probes may be carried out, for example via a confocal
microscope. Cy3 and Cy5 dyes, besides many others, are commercially
available.
[0022] Matrix Assisted Laser Desorption Ionization Mass
Spectrometry (MALDI-TOF) is a very efficient development for the
analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption
ionization of proteins with molecular masses exceeding 10,000
daltons. Anal Chem. 1988 Oct. 15; 60(20):2299-301). An analyte is
embedded in a light-absorbing matrix. The matrix is evaporated by a
short laser pulse thus transporting the analyte molecule into the
vapor phase in an unfragmented manner. The analyte is ionized by
collisions with matrix molecules. An applied voltage accelerates
the ions into a field-free flight tube. Due to their different
masses, the ions are accelerated at different rates. Smaller ions
reach the detector sooner than bigger ones.
[0023] MALDI-TOF spectrometry is excellently suited to the analysis
of peptides and proteins. The analysis of nucleic acids is somewhat
more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser
Desorption Ionization Mass Spectrometry. Current Innovations and
Future Trends. 1995, 1; 147-57). The sensitivity to nucleic acids
is approximately 100 times worse than to peptides and decreases
disproportionally with increasing fragment size. For nucleic acids
having a multiply negatively charged backbone, the ionization
process via the matrix is considerably less efficient. In MALDI-TOF
spectrometry, the selection of the matrix plays an eminently
important role. For the desorption of peptides, several very
efficient matrixes have been found which produce a very fine
crystallization. There are now several responsive matrixes for DNA,
however, the difference in sensitivity has not been reduced. The
difference in sensitivity can be reduced by chemically modifying
the DNA in such a manner that it becomes more similar to a peptide.
Phosphorothioate nucleic acids in which the usual phosphates of the
backbone are substituted with thiophosphates can be converted into
a chargeneutral neutral DNA using simple alkylation chemistry (Gut
I G, Beck S. A procedure for selective DNA alkylation and detection
by mass spectrometry. Nucleic Acids Res. 1995 Apr. 25;
23(8):1367-73). The coupling of a charge tag to this modified DNA
results in an increase in sensitivity to the same level as that
found for peptides. A further advantage of charge tagging is the
increased stability of the analysis against impurities which make
the detection of unmodified substrates considerably more
difficult.
[0024] Genomic DNA is obtained from DNA of cell, tissue or other
test samples using standard methods. This standard methodology is
found in references such as Fritsch and Maniatis eds., Molecular
Cloning: A Laboratory Manual, 1989.
DESCRIPTION
[0025] The object of the present invention is to provide the
chemically modified DNA of genes associated with metastasis, as
well as oligonucleotides and/or PNA-oligomers for detecting
cytosine methylations, as well as a method which is particularly
suitable for the diagnosis and/or therapy of genetic and epigenetic
parameters of genes associated with metastasis. The present
invention is based on the discovery that genetic and epigenetic
parameters and, in particular, the cytosine methylation pattern of
genes associated with metastasis are particularly suitable for the
diagnosis and/or therapy of diseases associated with
metastasis.
[0026] This objective is achieved according to the present
invention using a nucleic acid containing a sequence of at least 18
bases in length of the chemically pretreated DNA of genes
associated with metastasis according to one of Seq. ID No.1 through
Seq. ID No. 198 and sequences complementary thereto and/or of genes
according to one of the sequences of the genes according to table 1
and sequences complementary thereto. In the table, after the listed
gene designations, the respective data bank numbers (accession
numbers) are specified which define the appertaining gene sequences
as unique. GenBank was used as the underlying data bank, which is
located at the National Institute of Health, interact address
www.ncbi.nlm.nih.gov.
[0027] The chemically modified nucleic acid could heretofore not be
connected with the ascertainment of genetic and epigenetic
parameters.
[0028] The object of the present invention is further achieved by
an oligonucleotide or oligomer for detecting the cytosine
methylation state in chemically pretreated DNA, containing at least
one base sequence having a length of at least 13 nucleotides which
hybridizes to a chemically pretreated DNA of genes associated with
metastasis according to Seq. ID No. 1 through Seq. ID No. 198 and
sequences complementary thereto and/or of genes according to one of
the sequences of the genes according to table 1 and sequences
complementary thereto. The oligomer probes according to the present
invention constitute important and effective tools which, for the
first time, make it possible to ascertain the genetic and
epigenetic parameters of genes associated with metastasis. The base
sequence of the oligomers preferably contains at least one CpG
dinucleotide. The probes may also exist in the form of a PNA
(peptide nucleic acid) which has particularly preferred pairing
properties. Particularly preferred are oligonucleotides according
to the present invention in which the cytosine of the CpG
dinucleotide is the 5.sup.th-9.sup.th nucleotide from the 5'-end of
the 13-mer; in the case of PNA-oligomers, it is preferred for the
cytosine of the CpG dinucleotide to be the 4.sup.th-6.sup.th
nucleotide from the 5'-end of the 9-mer.
[0029] The oligomers according to the present invention are
normally used in so called "sets" which contain at least one
oligomer for each of the CpG dinucleotides of the sequences of Seq.
ID No.1 through Seq. ID No. 198 and sequences complementary thereto
and/or of genes according to one of the sequences of the genes
according to table 1 and sequences complementary thereto. Preferred
is a set which contains at least one oligomer for each of the CpG
dinucleotides from one of Seq. ID No.1 through Seq. ID No. 198 and
sequences complementary thereto and/or of genes according to one of
the sequences of the genes according to table 1 and sequences
complementary thereto.
[0030] Moreover, the present invention makes available a set of at
least two oligonucleotides which can be used as so-called "primer
oligonucleotides" for amplifying DNA sequences of one of Seq. ID
No.1 through Seq. ID No. 198 and sequences complementary thereto
and/or of genes according to one of the sequences of the genes
according to table 1 and sequences complementary thereto, or
segments thereof.
[0031] In the case of the sets of oligonucleotides according to the
present invention, it is preferred that at least one
oligonucleotide is bound to a solid phase.
[0032] The present invention moreover relates to a set of at least
10 n (oligonucleotides and/or PNA-oligomers) used for detecting the
cytosine methylation state in chemically pretreated genomic DNA
(Seq. ID No.1 through Seq. ID No. 198 and sequences complementary
thereto and/or of genes according to one of the sequences of the
genes according to table 1 and sequences complementry thereto).
These probes enable diagnosis and/or therapy of genetic and
epigenetic parameters of genes associated with metastasis. The set
of oligomers may also be used for detecting single nucleotide
polymorphisms (SNPs) in the chemically pretreated DNA of genes
associated with metastasis according to one of Seq. ID No.1 through
Seq. ID No. 198 and sequences complementary thereto of genes
according to one of the sequences of the genes according to table 1
and sequences complementary thereto.
[0033] According to the present invention, it is preferred that an
arrangement of different oligonucleotides- and/or PNA-oligomers (a
so-called "array") made available by the present invention is
present in a manner that it is likewise bound to a solid phase.
This array of different oligonucleotide- and/or PNA-oligomer
sequences can be characterized in that it is arranged on the solid
phase in the form of a rectangular or hexagonal lattice. The solid
phase surface is preferably composed of silicon, glass,
polystyrene, aluminium, steel, iron, copper, nickel, silver, or
gold. However, nitrocellulose as well as plastics such as nylon
which can exist in the form of pellets or also as resin matrices
are possible as well.
[0034] Therefore, a further subject matter of the present invention
is a method for manufacturing an array fixed to a carrier material
for analysis in connection with diseases associated with metastasis
in which method at least one oligomer according to the present
invention is coupled to a solid phase. Methods for manufacturing
such arrays are known, for example, from U.S. Pat. No. 5,744,305 by
means of solid-phase chemistry and photolabile protecting
groups.
[0035] A further subject matter of the present invention relates to
a DNA chip for the analysis of disease associated with metastasis
which contains at least one nucleic acid according to the present
invention. DNA chips are known, for example, for U.S. Pat. No.
5,837,832.
[0036] Moreover, a subject matter of the present invention is a kit
which may be composed, for example, of a bisulfite-containing
reagent, a set of primer oligonucleotides containing at least two
oligonucleotides whose sequences in each case correspond or are
complementary to an 18 base long segment of the base sequences
specified in the appendix (Seq. ID No. 1 through Seq. ID No. 198
and sequences complementary thereto and/or of genes according to
one of the sequences of the genes according to table I and
sequences complementary thereto), oligonucleotides and/or
PNA-oligomers as well as instructions for carrying out and
evaluating the described method. However, a kit along the lines of
the present invention can also contain only part of the
aforementioned components.
[0037] The present invention also makes available a method for
ascertaining genetic and/or epigenetic netic parameters of genes
associated with the cycle cell by analyzing cytosine methylations
and single nucleotide polymorphisms, including the following
steps:
[0038] In the first step of the method, a genomic DNA sample is
chemically treated in such a manner that cytosine bases which are
unmethylated at the 5'-position are converted to uracil, thymine,
or another base which is dissimilar to cytosine in terms of
hybridization behavior. This will be understood as `chemical
pretreatmnent` hereinafter.
[0039] The genomic DNA to be analyzed is preferably obtained form
usual sources of DNA such as cells or cell components, for example,
cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal
spinal fluid, tissue embedded in paraffm such as tissue from eyes,
intestine, kidney, brain, heart, prostate, lung, breast or liver,
histologic object slides, or combinations thereof.
[0040] The above described treatment of genomic DNA is preferably
carried out with bisulfite (hydroben sulfite, disulfite) and
subsequent alkaline hydrolysis which results in a conversion of
non-methylated cytosine nucleobases to uracil or to another base
which is dissimilar to cytosine in terms of base pairing
behavior.
[0041] Fragments of the chemically pretreated DNA are amplified,
using sets of primer oligonucleotides according to the present
invention, and a, preferably heat-stable polymerase. Because of
statistical and practical considerations, preferably more than ten
different fragments having a length of 100-2000 base pairs are
amplified. The amplification of several DNA segments can be carried
out simultaneously in one and the same reaction vessel. Usually,
the amplification is carried out by means of a polymerase chain
reaction (PCR).
[0042] In a preferred embodiment of the method, the set of primer
oligonucleotides includes at least two olignonucleotides whose
sequences are each reverse complementary or identical to an at
least 18 base-pair long segment of the base sequences specified in
the appendix (Seq. ID No. 1 through Seq. ID No. 198 and sequences
complementary thereto and/or of genes according to one of the
sequences of the genes according to table 1 and sequences
complementary thereto). The primer oligonucleotides are preferably
characterized in that they do not contain any CpG
dinucleotides.
[0043] According to the present invention, it is preferred that at
least one primer oligonucleotide is bonded to a solid phase during
amplification. The different oligonucleotide and/or PNA oligomer
sequences can be arranged on a plane solid phase in the form of a
rectangular or hexagonal lattice, the solid phase surface
preferably being composed of silicon, glass, polystyrene,
aluminium, steel, iron, copper, nickel, silver, or gold, it being
possible for other materials such as nitrocellulose or plastics to
be used as well.
[0044] The fragments obtained by means of the amplification can
carry a directly or indirectly detectable label. Preferred are
labels in the form of fluorescence labels, radionuclides, or
detachable molecule fragments having a typical mass which can be
detected in a mass spectrometer, it being preferred that the
fragments that are produced have a single positive or negative net
charge for better detectability in the mass spectrometer. The
detection may be carried out and visualized by means of matrix
assisted laser desorption/ionization mass spectrometry (MALDI) or
using electron spray mass spectrometry (ESI).
[0045] The amplificates obtained in the second step of the method
are subsequently hybridized to an array or a set of
oligonucleotides and/or PNA probes. In this context, the
hybridization takes place in the manner described in the following.
The set of probes used during the hybridization is preferably
composed of at least 10 oligonucleotides or PNA-oligomers. In the
process, the amplificates serve as probes which hybridize to
oligonucleotides previously bonded to a solid phase. The
non-hybridized fragments are subsequently removed. Said
oligonucleotides contain at least one base sequence having a length
of 13 nucleotides which is reverse complementary or identical to a
segment of the base sequences specified in the appendix, the
segment containing at least one CpG dinucleotide. The cytosine of
the CpG dinucleotide is the 5.sup.th to 9.sup.th nucleotide from
the 5'-end of the 13-mer. One oligonucleotide exists for each CpG
dinucleotide. Said PNA-oligomers contain at least one base sequence
having a length of 9 nucleotides which is reverse complementary or
identical to a segment of the base sequences specified in the
appendix, the segment containing at least one CpG dinucleotide. The
cytosine of the CpG dinucleotide is the 4.sup.th to 6.sup.th
nucleotide seen from the 5'-end of the 9-mer. One oligonucleotide
exists for each CpG dinucleotide.
[0046] In the fourth step of the method, the non-hybridized
amplificates are removed.
[0047] In the final step of the method, the hybridized amplificates
are detected. In this context, it is preferred that labels attached
to the amplificates are identifiable at each position of the solid
phase at which an oligonucleotide sequence is located.
[0048] According to the present invention, it is preferred that the
labels of the amplificates are fluorescence labels, radionuclides,
or detachable molecule fragments having a typical mass which can be
detected in a mass spectrometer. The mass spectrometer is preferred
for the detection of the amplificates, fragments of the
amplificates or of probes which are complementary to the
amplificates, it being possible for the detection to be carried out
and visualized by means of matrix assisted laser
desorption/ionization mass spectrometry (MALDI) or using electron
spray mass spectrometry (ESI).
[0049] The produced fragments may have a single positive or
negative net charge for better detectability in the mass
spectrometer. The aforementioned method is preferably used for
ascertaining genetic and/or epigenetic parameters of genes
associated with metastasis.
[0050] The oligomers according to the present invention or arrays
thereof as well as a kit according to the present invention are
intended to be used for the diagnosis and/or therapy of diseases
associated with metastasis by analyzing methylation patterns of
genes associated with metastasis. According to the present
invention, the method is preferably used for the diagnosis and/or
therapy of important genetic and/or epigenctic parameters within
genes associated with metastasis.
[0051] The method according to the present invention is used, for
example, for the diagnosis and/or therapy of solid tumours and
cancer.
[0052] The nucleic acids according to the present invention of Seq.
ID No. 1 through Seq. ID No. 198 and sequences complementary
thereto and/or of genes according to one of the sequences of the
genes according to table 1 and sequences complementary thereto can
be used for the diagnosis and/or therapy of genetic and/or
epigenetic parameters of genes associated with metastasis
[0053] The present invention moreover relates to a method for
manufacturing a diagnostic agent and/or therapeutic agent for the
diagnosis and/or therapy of diseases associated with metastasis by
analyzing methylation patterns of genes associated with metastasis,
the diagnostic agent and/or therapeutic agent being characterized
in that at least one nucleic acid according to the present
invention is used for manufacturing it, possibly together with
suitable additives and auxiliary agents.
[0054] A further subject matter of the present invention relates to
a diagnostic agent and/or therapeutic agent for diseases associated
with metastasis by analyzing methylation patterns of genes
associated with metastasis, the diagnostic agent and/or therapeutic
agent containing at least one nucleic acid according to the present
invention, possibly together with suitable additives and auxiliary
agents.
[0055] The present invention moreover relates to the diagnosis
and/or prognosis of events which are disadvantageous to patients or
individuals in which important genetic and/or epigenetic parameters
within genes associated with metastasis said parameters obtained by
means of the present invention may be compared to another set of
genetic and/or epigenetic parameters, the differences serving as
the basis for a diagnosis and/or prognosis of events which are
disadvantageous to patients or individuals.
[0056] In the context of the present invention the term
"hybridization" is to be understood as a bond of an oligonucleotide
to a completely complementary sequence along the lines of the
WatsonCrick Crick base pairings in the sample DNA, forming a duplex
structure. To be understood by "stringent hybridization conditions"
are those conditions in which a hybridization is carried out at
60.degree. C. in 2.5.times.SSC buffer, followed by several washing
steps at 37.degree. C. in a low buffer concentration, and remains
stable.
[0057] The term "functional variants" denotes all DNA sequences
which are complementary to a DNA sequence, and which hybridize to
the reference sequence under stringent conditions and have an
activity similar to the corresponding polypeptide according to the
present invention.
[0058] In the context of the present invention, "genetic
parameters" are mutations and polymorphisms of genes associated
with metastasis and sequences further required for their
regulation. To be designated as mutations are, in particular,
insertions, deletions, point mutations, inversions and
polymorphisms and, particularly preferred, SNPs (single nucleotide
polymorphisms).
[0059] In the context of the present invention, "epigenetic
parameters" are, in particular, cytosine methylations and further
chemical modifications of DNA bases of genes associated with
metastasis and sequences further required for their regulation.
Further epigenetic parameters include, for example, the acetylation
of histones which, however, cannot be directly analyzed using the
described method but which, in turn, correlates with the DNA
methylation.
[0060] In the following, the present invention will be explained in
greater detail on the basis of the sequences and examples without
being limited thereto.
Sequence ID Nos. 1 to 198
[0061] Sequences having odd sequence numbers (e.g., Seq. ID No. 1,
3, 5, . . . ) exhibit in each case sequences of the chemically
pretreated genomic DNAs of different genes associated with
metastasis. Sequences having even sequence numbers (e.g., Seq. ID
No. 2, 4, 6, . . . ) exhibit in each case the sequences of the
chemically pretreated genomic DNAs of genes associated with
metastasis which are complementary to the preceeding sequences
(e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2,
the complementary sequence to Seq. ID No.3 is Seq. ID No.4,
etc.)
Sequence ID Nos. 199 to 202
[0062] Sequence ID Nos. 199 to 202 show the sequences of
oligonucleotides used in Example 1.
[0063] The following example relates to a fragment of a gene
associated with metastasis, in this case, CD22 in which a specific
CG-position is analyzed for its methylation status.
EXAMPLE 1
Methylation analysis of the gene CD22 associated with
metastasis.
[0064] The following example relates to a fragment of the gene CD22
in which a specific CG-position is to be analyzed for
methylation.
[0065] In the first step, a genomic sequence is treated using
bisulfite (hydrogen sulfite, disulfite) in such a manner that all
cytosines which are not methylated at the 5-position of the base
are modified in such a manner that a different base is substituted
with regard to the base pairing behavior while the cytosines
methylated at the 5-position remain unchanged.
[0066] If bisulfite solution is used for the reaction, then an
addition takes place at the non-methylated cytosine bases.
Moreover, a denaturating reagent or solvent as well as a radical
interceptor must be present. A subsequent alkaline hydrolysis then
gives rise to the conversion of nonmethylated cytosine nucleobases
to uracil. The chemically converted DNA (sequence ID No. 159) is
then used for the detection of methylated cytosines. In the second
method step, the treated DNA sample is diluted with water or an
aqueous solution. Preferably, the DNA is subsequently desulfonated
(10-30 min, 90-100 .degree. C.) at an alkaline pH value. In the
third step of the method, the DNA sample is amplified in a
polymerase chain reaction, preferably using a heatresistant DNA
polymerase. In the present case, cytosines of the gene CD22 are
analyzed. To this end, a defined fragment having a length of 470 bp
is amplified with the specific primer oligonucleotides
TGTGTGTTGTTAAATGAAGA (Sequence ID No. 199) and ACACAAATATTAAAATTATC
(Sequence ID No. 200). This amplificate serves as a sample which
hybridizes to an oligonucleotide previously bonded to a solid
phase, forming a duplex structure, for example TTGTTATACGTTTTGTTT
(Sequence ID No. 201), the cytosine to be detected being located at
position 210 of the amplificate. The detection of the hybridization
product is based on Cy3 and Cy5 fluorescently labelled primer
oligonucleotides which have been used for the amplification. A
hybridization reaction of the amplified DNA with the
oligonucleotide takes place only if a methylated cytosine was
present at this location in the bisulfite-treated DNA. Thus, the
methylation status of the specific cytosine to be analyzed is
inferred from the hybridization product.
[0067] In order to verify the methylation status of the position, a
sample of the amplificate is further hybridized to another
oligonucleotide previously bonded to a solid phase. Said
olignonucleotide is identical to the oligonucleotide previously
used to analyze the methylation status of the sample, with the
exception of the position in question. At the position to be
analysed said oligonucleotide comprises a thymine base as opposed
to a cytosine base i.e TTGTTATATGTTTTGTTT (Sequence ID No. 202).
Therefore, the hybridisation reaction only takes place if an
unmethylated cytosine was present at the position to be
analysed.
EXAMPLE 2
Diagnosis of diseases associated with metastasis
[0068] In order to relate the methylation patterns to one of the
diseases associated with metastasis, it is initially required to
analyze the DNA methylation patterns of a group of diseased and of
a group of healthy patients. These analyses are carried out, for
example, analogously to Example 1. The results obtained in this
manner are stored in a database and the CpG dinucleotides which are
methylated differently between the two groups are identified. This
can be carried out by determining individual CpG methylation rates
as can be done, for example, in a relatively imprecise manner, by
sequencing or else, in a very precise manner, by a
methylation-sensitive "primer extension reaction". It is also
possible for the entire methylation status to be analyzed
simultaneously, and for the patterns to be compared, for example,
by clustering analyses which can be carried out, for example, by a
computer.
[0069] Subsequently, it is possible to allocate the examined
patients to a specific therapy group and to treat these patients
selectively with an individualized therapy.
[0070] Example 2 can be carried out, for example, for cancer and
solid tumours.
1TABLE 1 List of preferred genes associated with metastasis
according to the invention GenBank Entry No. Gene
(http://www.ncbi.nim.nih.gov) CD20 L23418 FN1 M10905 SDC2 H04621
ACTG1 NM_001614 CDH2 NM_001792 CDH4 NM_001794 CDW52 NM_001803 ITGAX
NM_000887 UTGB1 NM_002211 ITGB5 NM_002213 ITGB7 NM_000889 NEO1
NM_002499 PCDH1 NM_002587 ENPP1 NM_006208 RTN1 NM_021136 SELPLG
NM_003006 TM4SF2 NM_004615 ITGAE NM_002208 SPTB NM_000347 ITGB1
NM_002211
[0071]
Sequence CWU 0
0
* * * * *
References